#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
C1QTNF5	114902	genome.wustl.edu	37	11	119210232	119210232	+	Missense_Mutation	SNP	A	A	T			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr11:119210232A>T	ENST00000528368.1	-	3	772	c.541T>A	c.(541-543)Ttt>Att	p.F181I	C1QTNF5_ENST00000445041.2_Missense_Mutation_p.F181I|MFRP_ENST00000555262.1_3'UTR|MFRP_ENST00000530681.1_3'UTR|RP11-334E6.10_ENST00000501918.2_RNA|C1QTNF5_ENST00000525657.1_5'UTR	NM_001278431.1	NP_001265360.1	Q9BXJ0	C1QT5_HUMAN	C1q and tumor necrosis factor related protein 5	181	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.					collagen trimer (GO:0005581)|extracellular vesicular exosome (GO:0070062)				endometrium(1)|lung(2)	3		Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;3.78e-05)		CCCCCGAAAAACTGGAAGAAA	0.617																																																	0								ENSG00000223953						66.0	60.0	62.0					11																	119210232		2199	4295	6494	C1QTNF5	SO:0001583	missense	0			-	HGNC	AF329841	CCDS8420.1	11q23.3	2013-05-10				ENSG00000223953			14344	protein-coding gene	gene with protein product	"""complement-c1q tumor necrosis factor-related protein 5"", ""complement C1q tumor necrosis factor-related protein 5 precursor variant 3"""	608752				12944416	Standard	NM_015645		Approved	CTRP5, DKFZp586B0621, LORD		Q9BXJ0	OTTHUMG00000166198	ENST00000528368.1:c.541T>A	11.37:g.119210232A>T	ENSP00000431140:p.Phe181Ile	Somatic	0	53	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	33	15.38	A6NDD3|B0YJ35|Q335M2|Q8N6P2|Q9UFX4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_C1q,pfam_Collagen,superfamily_Tumour_necrosis_fac-like_dom,smart_C1q,pfscan_C1q,prints_C1q	p.F181I	ENST00000528368.1	37	c.541	CCDS8420.1	11	.	.	.	.	.	.	.	.	.	.	A	13.04	2.118101	0.37339	.	.	ENSG00000223953	ENST00000528368;ENST00000445041	T;T	0.74632	-0.86;-0.86	4.24	4.24	0.50183	.	0.297259	0.31279	U	0.007929	T	0.59018	0.2163	N	0.15975	0.35	0.80722	D	1	.	.	.	.	.	.	T	0.55147	-0.8186	8	0.22706	T	0.39	.	8.2761	0.31873	0.9109:0.0:0.0891:0.0	.	.	.	.	I	181	ENSP00000431140:F181I;ENSP00000402389:F181I	ENSP00000402389:F181I	F	-	1	0	C1QTNF5	118715442	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	4.580000	0.60942	1.773000	0.52216	0.533000	0.62120	TTT	-	pfam_C1q,superfamily_Tumour_necrosis_fac-like_dom,smart_C1q,pfscan_C1q		0.617	C1QTNF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1QTNF5	protein_coding	OTTHUMT00000388354.1	A	NM_015645	-		119210232	-1	no_errors	ENST00000445041	ensembl	human	known	74_37	missense	SNP	1.000	T
CHD2	1106	genome.wustl.edu	37	15	93540315	93540316	+	Frame_Shift_Ins	INS	-	-	A			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr15:93540315_93540316insA	ENST00000394196.4	+	29	4792_4793	c.3724_3725insA	c.(3724-3726)gaafs	p.E1242fs	CHD2_ENST00000557381.1_Frame_Shift_Ins_p.E1242fs	NM_001271.3	NP_001262.3	O14647	CHD2_HUMAN	chromodomain helicase DNA binding protein 2	1242					cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|hematopoietic stem cell differentiation (GO:0060218)|muscle organ development (GO:0007517)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|histone binding (GO:0042393)|poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(10)|lung(17)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	47	Lung NSC(78;0.00976)|all_lung(78;0.016)		BRCA - Breast invasive adenocarcinoma(143;0.0282)|OV - Ovarian serous cystadenocarcinoma(32;0.0814)			GGACCCTGAAGAAAAAAAAAAG	0.347																																																	0								ENSG00000173575																																			CHD2	SO:0001589	frameshift_variant	0				HGNC	AF006514	CCDS10374.2, CCDS45356.1	15q26	2008-07-18			ENSG00000173575	ENSG00000173575			1917	protein-coding gene	gene with protein product		602119				9326634	Standard	NM_001042572		Approved	FLJ38614, DKFZp547I1315, DKFZp781D1727, DKFZp686E01200	uc002bsp.3	O14647	OTTHUMG00000149845	ENST00000394196.4:c.3735dupA	15.37:g.93540325_93540325dupA	ENSP00000377747:p.Glu1242fs	Somatic	0	25	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	27	15.62	C6G482|Q96IP5	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_SNF2_N,pfam_Chromo_domain,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_Chromodomain-like,superfamily_Homeodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.Y1246fs	ENST00000394196.4	37	c.3724_3725	CCDS10374.2	15																																																																																			-	NULL		0.347	CHD2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	CHD2	protein_coding	OTTHUMT00000313528.3	-	NM_001271			93540316	+1	no_errors	ENST00000557381	ensembl	human	putative	74_37	frame_shift_ins	INS	1.000:1.000	A
XIST	7503	genome.wustl.edu	37	X	73071079	73071079	+	lincRNA	SNP	C	C	A			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chrX:73071079C>A	ENST00000429829.1	-	0	1509					NR_001564.2				X inactive specific transcript (non-protein coding)																		CCATGATGTCCACGTGACAAA	0.537																																																	0								ENSG00000229807						111.0	108.0	109.0					X																	73071079		876	1991	2867	XIST			0			-	HGNC	M97168		Xq13.2	2013-12-18	2013-02-07		ENSG00000229807	ENSG00000229807		"""Long non-coding RNAs"", ""-"""	12810	non-coding RNA	RNA, long non-coding	"""long intergenic non-protein coding RNA 1"""	314670	"""X (inactive)-specific transcript"", ""X (inactive)-specific transcript (non-protein coding)"""	DXS399E		1985261, 2034279	Standard	NR_001564		Approved	NCRNA00001, DXS1089, swd66, LINC00001	uc004ebm.2		OTTHUMG00000021839		X.37:g.73071079C>A		Somatic	0	26	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	38	19.15		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000429829.1	37	NULL		X																																																																																			-	-		0.537	XIST-001	KNOWN	basic	lincRNA	XIST	lincRNA	OTTHUMT00000057239.1	C	NR_001564	-		73071079	-1	no_errors	ENST00000429829	ensembl	human	known	74_37	rna	SNP	0.006	A
POTEH	23784	genome.wustl.edu	37	22	16287369	16287369	+	Missense_Mutation	SNP	G	G	A	rs371550897		TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr22:16287369G>A	ENST00000343518.6	-	1	568	c.517C>T	c.(517-519)Cgt>Tgt	p.R173C		NM_001136213.1	NP_001129685.1	Q6S545	POTEH_HUMAN	POTE ankyrin domain family, member H	173										NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|lung(20)|ovary(1)|skin(7)|urinary_tract(2)	37						TCTTCTCGACGGACGTGGTAC	0.572																																																	0								ENSG00000198062	G	CYS/ARG	0,3944		0,0,1972	36.0	42.0	40.0		517	-0.1	0.0	22		40	3,7471		0,3,3734	no	missense	POTEH	NM_001136213.1	180	0,3,5706	AA,AG,GG		0.0401,0.0,0.0263	benign	173/546	16287369	3,11415	1972	3737	5709	POTEH	SO:0001583	missense	0			-	HGNC	AY462874	CCDS74808.1	22q11.1	2013-01-10	2008-11-26	2008-11-26	ENSG00000198062	ENSG00000198062		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	133	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 7"""	608913	"""actin, beta-like 1"", ""ANKRD26-like family C, member 3"""	ACTBL1, A26C3		10591208, 15276201, 21439273	Standard	NM_001136213		Approved	POTE22, CT104.7	uc010gqp.2	Q6S545	OTTHUMG00000140314	ENST00000343518.6:c.517C>T	22.37:g.16287369G>A	ENSP00000340610:p.Arg173Cys	Somatic	0	117	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	39	229	14.55	A2CEK4|A6NCI1|A9Z1W0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.R173C	ENST00000343518.6	37	c.517	CCDS46658.1	22	.	.	.	.	.	.	.	.	.	.	.	6.286	0.420827	0.11928	0.0	4.01E-4	ENSG00000198062	ENST00000359587;ENST00000343518;ENST00000355872	T	0.53423	0.62	1.38	-0.111	0.13576	.	.	.	.	.	T	0.34424	0.0897	L	0.40543	1.245	0.09310	N	1	B	0.15930	0.015	B	0.14023	0.01	T	0.27297	-1.0078	9	0.46703	T	0.11	.	5.7857	0.18333	0.0:0.4917:0.5082:0.0	.	173	Q6S545	POTEH_HUMAN	C	136;173;173	ENSP00000340610:R173C	ENSP00000340610:R173C	R	-	1	0	POTEH	14667369	0.005000	0.15991	0.001000	0.08648	0.117000	0.20001	0.161000	0.16481	0.048000	0.15891	0.152000	0.16155	CGT	-	NULL		0.572	POTEH-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	POTEH	protein_coding	OTTHUMT00000276918.4	G	NM_001136213	-		16287369	-1	no_errors	ENST00000343518	ensembl	human	known	74_37	missense	SNP	0.001	A
CELSR3	1951	genome.wustl.edu	37	3	48687949	48687949	+	Missense_Mutation	SNP	C	C	T	rs199670636	byFrequency	TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr3:48687949C>T	ENST00000164024.4	-	16	6716	c.6436G>A	c.(6436-6438)Gtc>Atc	p.V2146I	CELSR3_ENST00000544264.1_Missense_Mutation_p.V2146I	NM_001407.2	NP_001398.2	Q9NYQ7	CELR3_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 3	2146					axonal fasciculation (GO:0007413)|cilium assembly (GO:0042384)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of protein localization (GO:0032880)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(9)|prostate(6)|skin(7)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	83				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		GTGGCCAGGACGCCAAACTTT	0.607													C|||	3	0.000599042	0.0	0.0	5008	,	,		14070	0.002		0.0	False		,,,				2504	0.001																0								ENSG00000008300	C	ILE/VAL	1,4403		0,1,2201	57.0	52.0	54.0		6436	-8.1	0.0	3		54	0,8598		0,0,4299	no	missense	CELSR3	NM_001407.2	29	0,1,6500	TT,TC,CC		0.0,0.0227,0.0077	benign	2146/3313	48687949	1,13001	2202	4299	6501	CELSR3	SO:0001583	missense	0			GMAF=0.0005	HGNC	AF231023	CCDS2775.1	3p21.31	2014-08-08	2013-02-18		ENSG00000008300	ENSG00000008300		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3230	protein-coding gene	gene with protein product	"""flamingo homolog 1 (Drosophila)"""	604264	"""cadherin EGF LAG seven-pass G-type receptor 3, flamingo (Drosophila) homolog"""	EGFL1		9693030	Standard	NM_001407		Approved	MEGF2, HFMI1, FMI1, CDHF11	uc003cuf.1	Q9NYQ7	OTTHUMG00000133544	ENST00000164024.4:c.6436G>A	3.37:g.48687949C>T	ENSP00000164024:p.Val2146Ile	Somatic	0	51	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	36	37.93	O75092	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_GPCR_2_secretin-like,pfam_Laminin_G,pfam_DUF3497,pfam_EG-like_dom,pfam_EGF_laminin,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,smart_EGF_laminin,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_GPS_dom,pfscan_Laminin_G,pfscan_Cadherin,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_Cadherin,prints_GPCR_2_secretin-like	p.V2146I	ENST00000164024.4	37	c.6436	CCDS2775.1	3	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	7.133	0.580303	0.13686	2.27E-4	0.0	ENSG00000008300	ENST00000164024;ENST00000544264	T;T	0.52754	0.65;0.65	5.42	-8.12	0.01078	GPCR, family 2, extracellular hormone receptor domain (3);	.	.	.	.	T	0.19644	0.0472	N	0.08118	0	0.09310	N	1	B;B	0.09022	0.0;0.002	B;B	0.08055	0.003;0.001	T	0.16247	-1.0409	9	0.36615	T	0.2	.	4.8782	0.13667	0.1008:0.1248:0.1321:0.6422	.	2146;2216	Q9NYQ7;Q5Y190	CELR3_HUMAN;.	I	2146	ENSP00000164024:V2146I;ENSP00000445694:V2146I	ENSP00000164024:V2146I	V	-	1	0	CELSR3	48662953	0.000000	0.05858	0.000000	0.03702	0.755000	0.42902	-0.476000	0.06591	-1.442000	0.01955	-0.769000	0.03391	GTC	-	smart_GPCR_2_extracellular_dom,pfscan_GPCR_2_extracellular_dom		0.607	CELSR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CELSR3	protein_coding	OTTHUMT00000257523.1	C	NM_001407	rs199670636		48687949	-1	no_errors	ENST00000544264	ensembl	human	known	74_37	missense	SNP	0.001	T
MYO18B	84700	genome.wustl.edu	37	22	26164343	26164343	+	Silent	SNP	T	T	C			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr22:26164343T>C	ENST00000407587.2	+	4	629	c.460T>C	c.(460-462)Ttg>Ctg	p.L154L	MYO18B_ENST00000335473.7_Silent_p.L154L|MYO18B_ENST00000536101.1_Silent_p.L154L			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	154						cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						GGGTGATGTGTTGTTGATGGT	0.597																																																	0								ENSG00000133454						34.0	41.0	38.0					22																	26164343		2048	4197	6245	MYO18B	SO:0001819	synonymous_variant	0			-	HGNC	AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.460T>C	22.37:g.26164343T>C		Somatic	0	52	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	70	11.39	B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,superfamily_tRNA-bd_arm,superfamily_Ribosomal_zn-bd,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.L154	ENST00000407587.2	37	c.460		22																																																																																			-	superfamily_Ribosomal_zn-bd		0.597	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	MYO18B	protein_coding	OTTHUMT00000400691.1	T	NM_032608	-		26164343	+1	no_errors	ENST00000335473	ensembl	human	known	74_37	silent	SNP	0.007	C
DENND4B	9909	genome.wustl.edu	37	1	153908534	153908534	+	Splice_Site	SNP	A	A	G			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr1:153908534A>G	ENST00000361217.4	-	17	2987		c.e17+1			NM_014856.2	NP_055671.2	O75064	DEN4B_HUMAN	DENN/MADD domain containing 4B						positive regulation of Rab GTPase activity (GO:0032851)|regulation of Rab protein signal transduction (GO:0032483)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(1)|breast(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	36	all_lung(78;2.89e-32)|Lung NSC(65;2.27e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			CAAAGTAGGTACCTTATTGTA	0.587																																																	0								ENSG00000198837						63.0	72.0	69.0					1																	153908534		2140	4248	6388	DENND4B	SO:0001630	splice_region_variant	0			-	HGNC	AB007945	CCDS44228.1	1q21.3	2012-10-03	2006-01-27	2006-01-27	ENSG00000198837	ENSG00000198837		"""DENN/MADD domain containing"""	29044	protein-coding gene	gene with protein product			"""KIAA0476"""	KIAA0476		9455484, 12906859	Standard	NM_014856		Approved		uc001fdd.1	O75064	OTTHUMG00000037157	ENST00000361217.4:c.2568+1T>C	1.37:g.153908534A>G		Somatic	0	42	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	48	18.64	Q5T4K0	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e16+2	ENST00000361217.4	37	c.2568+2	CCDS44228.1	1	.	.	.	.	.	.	.	.	.	.	a	21.1	4.094661	0.76870	.	.	ENSG00000198837	ENST00000361217;ENST00000368646	.	.	.	5.27	5.27	0.74061	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.3047	0.66377	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	DENND4B	152175158	1.000000	0.71417	0.945000	0.38365	0.888000	0.51559	8.944000	0.92980	2.216000	0.71823	0.459000	0.35465	.	-	-		0.587	DENND4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DENND4B	protein_coding	OTTHUMT00000090278.2	A	XM_375806	-	Intron	153908534	-1	no_errors	ENST00000361217	ensembl	human	known	74_37	splice_site	SNP	0.998	G
SLC22A1	6580	genome.wustl.edu	37	6	160575836	160575836	+	Silent	SNP	C	C	T	rs536418062	byFrequency	TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr6:160575836C>T	ENST00000366963.4	+	9	1539	c.1392C>T	c.(1390-1392)ctC>ctT	p.L464L	SLC22A1_ENST00000324965.4_Intron|SLC22A1_ENST00000457470.2_Intron	NM_003057.2|NM_153187.1	NP_003048.1|NP_694857.1	O15245	S22A1_HUMAN	solute carrier family 22 (organic cation transporter), member 1	464					dopamine transport (GO:0015872)|drug transmembrane transport (GO:0006855)|epinephrine transport (GO:0048241)|establishment or maintenance of transmembrane electrochemical gradient (GO:0010248)|norepinephrine transport (GO:0015874)|organic cation transport (GO:0015695)|protein homooligomerization (GO:0051260)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	acetylcholine transmembrane transporter activity (GO:0005277)|dopamine transmembrane transporter activity (GO:0005329)|norepinephrine transmembrane transporter activity (GO:0005333)|organic cation transmembrane transporter activity (GO:0015101)|quaternary ammonium group transmembrane transporter activity (GO:0015651)|secondary active organic cation transmembrane transporter activity (GO:0008513)		SLC22A1/CUTA(2)	breast(1)|endometrium(3)|large_intestine(3)|lung(13)|upper_aerodigestive_tract(1)	21		Breast(66;0.000776)|Ovarian(120;0.00556)		OV - Ovarian serous cystadenocarcinoma(65;2.73e-17)|BRCA - Breast invasive adenocarcinoma(81;1.1e-06)	Acebutolol(DB01193)|Acepromazine(DB01614)|Aciclovir(DB00787)|Amantadine(DB00915)|Amiloride(DB00594)|Aminohippurate(DB00345)|Caspofungin(DB00520)|Chlorphenamine(DB01114)|Chlorpromazine(DB00477)|Choline(DB00122)|Cimetidine(DB00501)|Cladribine(DB00242)|Clonidine(DB00575)|Codeine(DB00318)|Cytarabine(DB00987)|Desipramine(DB01151)|Dinoprostone(DB00917)|Diphenhydramine(DB01075)|Disopyramide(DB00280)|Dopamine(DB00988)|Epinephrine(DB00668)|Estradiol(DB00783)|Estropipate(DB04574)|Ganciclovir(DB01004)|Gentian Violet(DB00406)|Guanidine(DB00536)|Histamine Phosphate(DB00667)|Imatinib(DB00619)|Imipramine(DB00458)|Indinavir(DB00224)|Lamivudine(DB00709)|Latanoprost(DB00654)|Metformin(DB00331)|Midazolam(DB00683)|Nelfinavir(DB00220)|Nicotine(DB00184)|Norepinephrine(DB00368)|Oxaliplatin(DB00526)|Pancuronium(DB01337)|Phenformin(DB00914)|Phenoxybenzamine(DB00925)|Pipotiazine(DB01621)|Pramipexole(DB00413)|Prazosin(DB00457)|Probenecid(DB01032)|Procainamide(DB01035)|Progesterone(DB00396)|Quinidine(DB00908)|Quinine(DB00468)|Ranitidine(DB00863)|Reserpine(DB00206)|Rocuronium(DB00728)|Saquinavir(DB01232)|Spermine(DB00127)|Testosterone(DB00624)|Thiamine(DB00152)|Thioproperazine(DB01622)|Thiothixene(DB01623)|Tubocurarine(DB01199)|Vecuronium(DB01339)|Verapamil(DB00661)	TCAGGAACCTCGGAGTGATGG	0.438													C|||	2	0.000399361	0.0008	0.0	5008	,	,		22831	0.001		0.0	False		,,,				2504	0.0																0								ENSG00000175003						171.0	149.0	156.0					6																	160575836		2203	4300	6503	SLC22A1	SO:0001819	synonymous_variant	0			-	HGNC	U77086	CCDS5274.1, CCDS5275.1	6q25.3	2013-05-22			ENSG00000175003	ENSG00000175003		"""Solute carriers"""	10963	protein-coding gene	gene with protein product		602607				9605850	Standard	NM_003057		Approved	OCT1	uc003qtc.3	O15245	OTTHUMG00000015947	ENST00000366963.4:c.1392C>T	6.37:g.160575836C>T		Somatic	0	53	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	41	52	44.09	A6NFF3|A8K1H2|C9JSU6|O15395|Q9NQD4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Orgcat_transp	p.L464	ENST00000366963.4	37	c.1392	CCDS5274.1	6																																																																																			-	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Orgcat_transp		0.438	SLC22A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC22A1	protein_coding	OTTHUMT00000042938.2	C		-		160575836	+1	no_errors	ENST00000366963	ensembl	human	known	74_37	silent	SNP	0.235	T
CASP5	838	genome.wustl.edu	37	11	104878040	104878041	+	Frame_Shift_Ins	INS	-	-	T	rs112680102|rs144697764		TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr11:104878040_104878041insT	ENST00000260315.3	-	3	201_202	c.202_203insA	c.(202-204)acafs	p.T68fs	CASP5_ENST00000526056.1_Frame_Shift_Ins_p.T81fs|CASP5_ENST00000444749.2_Frame_Shift_Ins_p.T10fs|CASP5_ENST00000531367.1_Intron|CASP5_ENST00000393139.2_Frame_Shift_Ins_p.T35fs|CASP5_ENST00000418434.1_Intron|CASP5_ENST00000393141.2_Frame_Shift_Ins_p.T81fs			P51878	CASP5_HUMAN	caspase 5, apoptosis-related cysteine peptidase	68	CARD. {ECO:0000255|PROSITE- ProRule:PRU00046}.				apoptotic process (GO:0006915)|cellular response to mechanical stimulus (GO:0071260)|execution phase of apoptosis (GO:0097194)|proteolysis (GO:0006508)|regulation of apoptotic process (GO:0042981)|regulation of inflammatory response (GO:0050727)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|NLRP1 inflammasome complex (GO:0072558)	cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)	p.T52fs*26(1)		NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(15)|ovary(3)|skin(1)|urinary_tract(1)	35		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Melanoma(852;0.0047)		BRCA - Breast invasive adenocarcinoma(274;0.000943)|Epithelial(105;0.0104)|all cancers(92;0.042)		CATCTTAACTGTTTTTTTTTTG	0.356																																																	1	Deletion - Frameshift(1)	ovary(1)						ENSG00000137757																																			CASP5	SO:0001589	frameshift_variant	0				HGNC		CCDS8328.2, CCDS44718.1, CCDS44719.1, CCDS44720.1	11q22.2-q22.3	2006-02-17	2005-08-17		ENSG00000137757	ENSG00000137757		"""Caspases"""	1506	protein-coding gene	gene with protein product		602665	"""caspase 5, apoptosis-related cysteine protease"""			7797592, 9250871	Standard	NM_004347		Approved	ICE(rel)III	uc010ruz.1	P51878	OTTHUMG00000048073	ENST00000260315.3:c.203dupA	11.37:g.104878050_104878050dupT	ENSP00000260315:p.Thr68fs	Somatic	0	23	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	37	15.91	B4DKP5|Q0QVY7|Q0QVY8|Q0QVZ0|Q0QVZ1|Q0QVZ2|Q14DD6|Q1HBJ3|Q6DJV7	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_Pept_C14_caspase,pfam_CARD,superfamily_DEATH-like_dom,smart_CARD,smart_Pept_C14A_p45_core,pirsf_Caspase_IL-1_beta,pfscan_CARD,pfscan_Pept_C14_p10,pfscan_Pept_C14_ICE_p20,prints_Pept_C14A_p45_core	p.T81fs	ENST00000260315.3	37	c.242_241	CCDS8328.2	11																																																																																			-	pfam_CARD,superfamily_DEATH-like_dom,smart_CARD,pirsf_Caspase_IL-1_beta,pfscan_CARD		0.356	CASP5-001	KNOWN	basic|CCDS	protein_coding	CASP5	protein_coding	OTTHUMT00000109397.2	-	NM_004347			104878041	-1	no_errors	ENST00000393141	ensembl	human	known	74_37	frame_shift_ins	INS	0.000:0.000	T
FBN3	84467	genome.wustl.edu	37	19	8194143	8194143	+	Silent	SNP	G	G	A			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr19:8194143G>A	ENST00000600128.1	-	17	2565	c.2151C>T	c.(2149-2151)gcC>gcT	p.A717A	FBN3_ENST00000601739.1_Silent_p.A717A|FBN3_ENST00000270509.2_Silent_p.A717A			Q75N90	FBN3_HUMAN	fibrillin 3	717	EGF-like 8; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.					proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(9)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(15)|lung(53)|ovary(7)|pancreas(2)|prostate(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	132						CCTTGCCTGAGGCACCTGCCT	0.637																																																	0								ENSG00000142449						49.0	46.0	47.0					19																	8194143		2203	4300	6503	FBN3	SO:0001819	synonymous_variant	0			-	HGNC		CCDS12196.1	19p13	2008-02-05							18794	protein-coding gene	gene with protein product		608529					Standard	NM_032447		Approved		uc002mjf.3	Q75N90		ENST00000600128.1:c.2151C>T	19.37:g.8194143G>A		Somatic	0	50	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	50	31.51	Q75N91|Q75N92|Q75N93|Q86SJ5|Q96JP8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_EGF-like_Ca-bd_dom,pfam_TB_dom,pfam_EG-like_dom,superfamily_TB_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pirsf_FBN,pfscan_EG-like_dom	p.A717	ENST00000600128.1	37	c.2151	CCDS12196.1	19																																																																																			-	pfam_EGF-like_Ca-bd_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pirsf_FBN,pfscan_EG-like_dom		0.637	FBN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN3	protein_coding	OTTHUMT00000461428.2	G	NM_032447	-		8194143	-1	no_errors	ENST00000270509	ensembl	human	known	74_37	silent	SNP	0.000	A
SHANK1	50944	genome.wustl.edu	37	19	51165487	51165487	+	Missense_Mutation	SNP	C	C	T			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr19:51165487C>T	ENST00000293441.1	-	23	6239	c.6221G>A	c.(6220-6222)cGc>cAc	p.R2074H	SHANK1_ENST00000359082.3_Missense_Mutation_p.R2065H|SHANK1_ENST00000483981.2_5'Flank|SHANK1_ENST00000391813.1_Missense_Mutation_p.R1461H|SHANK1_ENST00000391814.1_Missense_Mutation_p.R2082H|SYT3_ENST00000544769.1_Intron	NM_016148.2	NP_057232.2	Q9Y566	SHAN1_HUMAN	SH3 and multiple ankyrin repeat domains 1	2074					adult behavior (GO:0030534)|associative learning (GO:0008306)|cytoskeletal anchoring at plasma membrane (GO:0007016)|dendritic spine morphogenesis (GO:0060997)|determination of affect (GO:0050894)|habituation (GO:0046959)|long-term memory (GO:0007616)|negative regulation of actin filament bundle assembly (GO:0032232)|neuromuscular process controlling balance (GO:0050885)|olfactory behavior (GO:0042048)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|protein complex assembly (GO:0006461)|protein localization to synapse (GO:0035418)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|righting reflex (GO:0060013)|social behavior (GO:0035176)|synapse maturation (GO:0060074)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|excitatory synapse (GO:0060076)|intracellular (GO:0005622)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ankyrin repeat binding (GO:0071532)|GKAP/Homer scaffold activity (GO:0030160)|identical protein binding (GO:0042802)|ionotropic glutamate receptor binding (GO:0035255)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|scaffold protein binding (GO:0097110)|SH3 domain binding (GO:0017124)|somatostatin receptor binding (GO:0031877)			breast(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(15)|liver(1)|lung(21)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	64		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00493)|GBM - Glioblastoma multiforme(134;0.0199)		TGAGAGGGAGCGCGAGGCCCC	0.687																																																	0								ENSG00000161681						31.0	32.0	31.0					19																	51165487		2203	4300	6503	SHANK1	SO:0001583	missense	0			-	HGNC	AF163302	CCDS12799.1	19q13.3	2013-01-10			ENSG00000161681	ENSG00000161681		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	15474	protein-coding gene	gene with protein product	"""somatostatin receptor-interacting protein"""	604999				10551867	Standard	NM_016148		Approved	SSTRIP, SPANK-1, synamon	uc002psx.1	Q9Y566	OTTHUMG00000137380	ENST00000293441.1:c.6221G>A	19.37:g.51165487C>T	ENSP00000293441:p.Arg2074His	Somatic	0	30	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	0	100.00	A8MXP5|B7WNY6|Q9NYW9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ankyrin_rpt,pfam_SAM_type1,pfam_SH3_2,pfam_SAM_2,pfam_PDZ,pfam_SH3_domain,superfamily_Ankyrin_rpt-contain_dom,superfamily_PDZ,superfamily_SH3_domain,superfamily_SAM/pointed,smart_Ankyrin_rpt,smart_SH3_domain,smart_PDZ,smart_SAM,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_PDZ,pfscan_SAM,pfscan_SH3_domain	p.R2082H	ENST00000293441.1	37	c.6245	CCDS12799.1	19	.	.	.	.	.	.	.	.	.	.	c	9.657	1.143110	0.21205	.	.	ENSG00000161681	ENST00000293441;ENST00000391813;ENST00000359082;ENST00000391814	T;T;T;T	0.53857	0.7;1.06;0.72;0.6	3.55	3.55	0.40652	.	0.683935	0.11773	U	0.530937	T	0.47857	0.1468	L	0.46157	1.445	0.44825	D	0.99783	B;B	0.27732	0.056;0.187	B;B	0.23150	0.005;0.044	T	0.52909	-0.8512	10	0.72032	D	0.01	.	14.4496	0.67376	0.0:1.0:0.0:0.0	.	2074;1461	Q9Y566;Q9Y566-2	SHAN1_HUMAN;.	H	2074;1461;2065;2082	ENSP00000293441:R2074H;ENSP00000375689:R1461H;ENSP00000351984:R2065H;ENSP00000375690:R2082H	ENSP00000293441:R2074H	R	-	2	0	SHANK1	55857299	0.999000	0.42202	0.993000	0.49108	0.796000	0.44982	1.149000	0.31626	2.010000	0.58986	0.450000	0.29827	CGC	-	NULL		0.687	SHANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHANK1	protein_coding	OTTHUMT00000268071.1	C	NM_016148	-		51165487	-1	no_errors	ENST00000391814	ensembl	human	known	74_37	missense	SNP	1.000	T
ADAMTS20	80070	genome.wustl.edu	37	12	43925909	43925909	+	Silent	SNP	C	C	T			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr12:43925909C>T	ENST00000389420.3	-	3	542	c.543G>A	c.(541-543)aaG>aaA	p.K181K	ADAMTS20_ENST00000553158.1_Silent_p.K181K	NM_025003.3	NP_079279.3	P59510	ATS20_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 20	181					extracellular matrix organization (GO:0030198)|negative regulation of apoptotic process (GO:0043066)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of signal transduction (GO:0009967)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(6)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(43)|ovary(4)|pancreas(3)|prostate(5)|skin(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	95	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		TAAGATGTGGCTTGTTGTGAC	0.358																																																	0								ENSG00000173157						138.0	133.0	135.0					12																	43925909		2203	4300	6503	ADAMTS20	SO:0001819	synonymous_variant	0			-	HGNC	AF488804	CCDS31778.2	12q12	2005-08-19	2005-08-19			ENSG00000173157		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17178	protein-coding gene	gene with protein product		611681	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 20"""			12514189, 12562771	Standard	NM_025003		Approved	GON-1	uc010skx.2	P59510		ENST00000389420.3:c.543G>A	12.37:g.43925909C>T		Somatic	0	37	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	36	34.55	A6NNC9|J3QT00	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Pept_M12B_GON-ADAMTSs,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_Peptidase_M12B,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Pept_M12B_GON-ADAMTSs,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.K181	ENST00000389420.3	37	c.543	CCDS31778.2	12																																																																																			-	pfam_Peptidase_M12B_N		0.358	ADAMTS20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS20	protein_coding	OTTHUMT00000403643.1	C	NM_025003	-		43925909	-1	no_errors	ENST00000389420	ensembl	human	known	74_37	silent	SNP	1.000	T
G6PD	2539	genome.wustl.edu	37	X	153763329	153763329	+	Intron	SNP	G	G	A			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chrX:153763329G>A	ENST00000393564.2	-	5	598				G6PD_ENST00000369620.2_Intron|G6PD_ENST00000393562.2_Intron|G6PD_ENST00000497281.1_5'UTR	NM_001042351.1	NP_001035810.1	P11413	G6PD_HUMAN	glucose-6-phosphate dehydrogenase						carbohydrate metabolic process (GO:0005975)|cellular response to oxidative stress (GO:0034599)|cholesterol biosynthetic process (GO:0006695)|cytokine production (GO:0001816)|erythrocyte maturation (GO:0043249)|glucose 6-phosphate metabolic process (GO:0051156)|glutathione metabolic process (GO:0006749)|lipid metabolic process (GO:0006629)|NADP metabolic process (GO:0006739)|NADPH regeneration (GO:0006740)|negative regulation of protein glutathionylation (GO:0010734)|oxidation-reduction process (GO:0055114)|pentose biosynthetic process (GO:0019322)|pentose-phosphate shunt (GO:0006098)|pentose-phosphate shunt, oxidative branch (GO:0009051)|regulation of neuron apoptotic process (GO:0043523)|response to ethanol (GO:0045471)|response to food (GO:0032094)|response to organic cyclic compound (GO:0014070)|ribose phosphate biosynthetic process (GO:0046390)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	glucose binding (GO:0005536)|glucose-6-phosphate dehydrogenase activity (GO:0004345)|NADP binding (GO:0050661)|protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(3)|ovary(4)	18	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					AGTGGTGGGAGCACTGCCTGG	0.652																																																	0								ENSG00000160211																																			G6PD	SO:0001627	intron_variant	0			-	HGNC	X03674	CCDS14756.2, CCDS44023.1	Xq28	2014-09-17			ENSG00000160211	ENSG00000160211	1.1.1.49		4057	protein-coding gene	gene with protein product		305900				3012556, 2428611	Standard	NM_000402		Approved	G6PD1	uc004flx.1	P11413	OTTHUMG00000024237	ENST00000393564.2:c.485+53C>T	X.37:g.153763329G>A		Somatic	0	81	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	65	30.85	D3DWX9|Q16000|Q16765|Q8IU70|Q8IU88|Q8IUA6|Q96PQ2	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000393564.2	37	NULL	CCDS44023.1	X																																																																																			-	-		0.652	G6PD-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	G6PD	protein_coding	OTTHUMT00000061170.3	G	NM_000402	-		153763329	-1	no_errors	ENST00000497281	ensembl	human	known	74_37	rna	SNP	0.039	A
ZNF565	147929	genome.wustl.edu	37	19	36685966	36685966	+	Silent	SNP	C	C	T			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr19:36685966C>T	ENST00000355114.5	-	3	948	c.222G>A	c.(220-222)gtG>gtA	p.V74V	ZNF565_ENST00000304116.5_Silent_p.V34V|ZNF565_ENST00000392173.2_Silent_p.V34V			Q8N9K5	ZN565_HUMAN	zinc finger protein 565	74	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(4)|lung(4)|ovary(1)|skin(2)	11	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.206)			TCTCCAGAGTCACCTCCCTGT	0.532																																																	0								ENSG00000196357						160.0	128.0	139.0					19																	36685966		2203	4300	6503	ZNF565	SO:0001819	synonymous_variant	0			-	HGNC	AK094310	CCDS12491.1	19q13.12	2013-09-20			ENSG00000196357	ENSG00000196357		"""Zinc fingers, C2H2-type"", ""-"""	26726	protein-coding gene	gene with protein product		614275					Standard	NM_001042474		Approved	FLJ36991	uc002odn.3	Q8N9K5	OTTHUMG00000180508	ENST00000355114.5:c.222G>A	19.37:g.36685966C>T		Somatic	0	40	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	133	12.50	B3KQ35|Q6NUS2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.V34	ENST00000355114.5	37	c.102		19																																																																																			-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box		0.532	ZNF565-003	PUTATIVE	basic	protein_coding	ZNF565	protein_coding	OTTHUMT00000451697.1	C	NM_152477	-		36685966	-1	no_errors	ENST00000304116	ensembl	human	known	74_37	silent	SNP	1.000	T
ACTRT3	84517	genome.wustl.edu	37	3	169485726	169485726	+	Silent	SNP	T	T	G			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr3:169485726T>G	ENST00000330368.2	-	2	987	c.613A>C	c.(613-615)Aga>Cga	p.R205R	RP11-816J6.3_ENST00000602879.1_RNA|TERC_ENST00000602385.1_lincRNA	NM_032487.4	NP_115876.3	Q9BYD9	ACTT3_HUMAN	actin-related protein T3	205						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|male germ cell nucleus (GO:0001673)											ACAATCTTTCTGTCTGAAGCA	0.448																																																	0								ENSG00000184378						156.0	148.0	151.0					3																	169485726		2203	4300	6503	ACTRT3	SO:0001819	synonymous_variant	0			-	HGNC	AK055346	CCDS3206.1	3q26.2	2012-04-10			ENSG00000184378	ENSG00000184378			24022	protein-coding gene	gene with protein product	"""actin related protein M1"""	608534				11750065, 18692047	Standard	NM_032487		Approved	ARPM1	uc003ffs.2	Q9BYD9		ENST00000330368.2:c.613A>C	3.37:g.169485726T>G		Somatic	0	34	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	12	55.56	Q96IS0|Q96NJ0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Actin-related,smart_Actin-related,prints_Actin-related	p.R205	ENST00000330368.2	37	c.613	CCDS3206.1	3																																																																																			-	pfam_Actin-related,smart_Actin-related		0.448	ACTRT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTRT3	protein_coding	OTTHUMT00000467797.1	T	NM_032487	-		169485726	-1	no_errors	ENST00000330368	ensembl	human	known	74_37	silent	SNP	0.999	G
MAG	4099	genome.wustl.edu	37	19	35801001	35801001	+	Missense_Mutation	SNP	G	G	A	rs142036180		TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr19:35801001G>A	ENST00000392213.3	+	8	1615	c.1456G>A	c.(1456-1458)Gtc>Atc	p.V486I	MAG_ENST00000593348.1_3'UTR|MAG_ENST00000361922.4_Missense_Mutation_p.V486I|MAG_ENST00000537831.2_Missense_Mutation_p.V461I	NM_002361.3	NP_002352.1	P20916	MAG_HUMAN	myelin associated glycoprotein	486	Ig-like C2-type 4.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|leukocyte migration (GO:0050900)|negative regulation of axonogenesis (GO:0050771)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of axonogenesis (GO:0050770)|substantia nigra development (GO:0021762)	integral component of membrane (GO:0016021)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)	carbohydrate binding (GO:0030246)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|large_intestine(10)|lung(11)|skin(2)|upper_aerodigestive_tract(2)	34	all_lung(56;2.37e-08)|Lung NSC(56;3.66e-08)|Esophageal squamous(110;0.162)	Renal(1328;0.242)	Epithelial(14;3.14e-19)|OV - Ovarian serous cystadenocarcinoma(14;1.5e-18)|all cancers(14;1.5e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)			CCCGCCCCGCGTCATCTGCAC	0.697																																																	0								ENSG00000105695	G	ILE/VAL,ILE/VAL,ILE/VAL	0,4406		0,0,2203	34.0	34.0	34.0		1381,1456,1456	4.7	1.0	19	dbSNP_134	34	2,8592		0,2,4295	no	missense,missense,missense	MAG	NM_001199216.1,NM_002361.3,NM_080600.2	29,29,29	0,2,6498	AA,AG,GG		0.0233,0.0,0.0154	possibly-damaging,possibly-damaging,possibly-damaging	461/602,486/627,486/583	35801001	2,12998	2203	4297	6500	MAG	SO:0001583	missense	0			-	HGNC	M29273	CCDS12455.1, CCDS12456.1, CCDS56090.1	19q13.1	2013-01-29			ENSG00000105695	ENSG00000105695		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6783	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 4A"""	159460		GMA		2476987, 8432525	Standard	NM_080600		Approved	SIGLEC4A, SIGLEC-4A, S-MAG	uc002nyy.2	P20916		ENST00000392213.3:c.1456G>A	19.37:g.35801001G>A	ENSP00000376048:p.Val486Ile	Somatic	0	20	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	66	30.53	B7Z2E5|F5GYC0|Q567S4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_CD80_C2-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.V486I	ENST00000392213.3	37	c.1456	CCDS12455.1	19	.	.	.	.	.	.	.	.	.	.	G	13.76	2.333059	0.41297	0.0	2.33E-4	ENSG00000105695	ENST00000262624;ENST00000361922;ENST00000392213;ENST00000537831	T;T;T	0.13778	2.56;2.56;2.56	4.68	4.68	0.58851	.	0.063541	0.64402	D	0.000007	T	0.06234	0.0161	N	0.14661	0.345	0.43412	D	0.995558	B;P;P	0.37688	0.336;0.605;0.605	B;B;B	0.24155	0.051;0.033;0.033	T	0.29761	-1.0001	10	0.45353	T	0.12	.	8.6702	0.34145	0.1022:0.0:0.8978:0.0	.	523;486;486	Q59GD9;P20916;Q567S4	.;MAG_HUMAN;.	I	523;486;486;461	ENSP00000355234:V486I;ENSP00000376048:V486I;ENSP00000440695:V461I	ENSP00000262624:V523I	V	+	1	0	MAG	40492841	0.998000	0.40836	1.000000	0.80357	0.988000	0.76386	2.884000	0.48562	2.431000	0.82371	0.462000	0.41574	GTC	-	NULL		0.697	MAG-001	KNOWN	basic|CCDS	protein_coding	MAG	protein_coding	OTTHUMT00000466071.1	G	NM_080600	rs142036180		35801001	+1	no_errors	ENST00000392213	ensembl	human	known	74_37	missense	SNP	0.999	A
KLF6	1316	genome.wustl.edu	37	10	3827225	3827225	+	5'UTR	SNP	G	G	A			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr10:3827225G>A	ENST00000497571.1	-	0	242				KLF6_ENST00000173785.4_5'Flank|KLF6_ENST00000469435.1_5'UTR|KLF6_ENST00000542957.1_5'UTR	NM_001160124.1|NM_001300.5	NP_001153596.1|NP_001291.3	Q99612	KLF6_HUMAN	Kruppel-like factor 6						B cell differentiation (GO:0030183)|cytokine-mediated signaling pathway (GO:0019221)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(3)|endometrium(1)|large_intestine(1)|lung(6)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16				Colorectal(1;0.238)		GGGTTGGACGGAGCCCGCGGT	0.677																																																	0								ENSG00000067082						25.0	25.0	25.0					10																	3827225		2203	4300	6503	KLF6	SO:0001623	5_prime_UTR_variant	0			-	HGNC	U51869	CCDS7060.1, CCDS53490.1	10p15	2013-01-08	2004-11-29	2004-12-01	ENSG00000067082	ENSG00000067082		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	2235	protein-coding gene	gene with protein product	"""GC-rich binding factor"""	602053	"""core promoter element binding protein"""	BCD1, ST12, COPEB		9503030, 9685731	Standard	NM_001300		Approved	CPBP, GBF, Zf9, PAC1	uc001iha.3	Q99612	OTTHUMG00000017567	ENST00000497571.1:c.-19C>T	10.37:g.3827225G>A		Somatic	0	12	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	20	28.57	B2RE86|B4DDN0|D3DRR1|F5H3M5|Q5VUT7|Q5VUT8|Q9BT79	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000497571.1	37	NULL	CCDS7060.1	10																																																																																			-	-		0.677	KLF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLF6	protein_coding	OTTHUMT00000046495.1	G		-		3827225	-1	no_errors	ENST00000380946	ensembl	human	known	74_37	rna	SNP	0.111	A
FAM57A	79850	genome.wustl.edu	37	17	636266	636267	+	Intron	INS	-	-	GGGCC	rs141977343|rs3830920	byFrequency	TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr17:636266_636267insGGGCC	ENST00000308278.8	+	2	358				FAM57A_ENST00000301324.8_Intron|FAM57A_ENST00000572018.1_Intron	NM_024792.1	NP_079068.1	Q8TBR7	FA57A_HUMAN	family with sequence similarity 57, member A							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				cervix(1)|endometrium(2)|large_intestine(1)|lung(2)|prostate(2)|urinary_tract(2)	10				UCEC - Uterine corpus endometrioid carcinoma (25;0.0217)		GTCAGGCCGAAGGGCCGGGCCG	0.762														2438	0.486821	0.3351	0.5173	5008	,	,		10677	0.6022		0.4692	False		,,,				2504	0.5695																0								ENSG00000167695																																			FAM57A	SO:0001627	intron_variant	0				HGNC	AK025935	CCDS10996.1	17p13.3	2014-08-14				ENSG00000167695			29646	protein-coding gene	gene with protein product		611627				12270127	Standard	NM_024792		Approved	FLJ22282, CT120	uc002frp.3	Q8TBR7		ENST00000308278.8:c.123-71->GGGCC	17.37:g.636272_636276dupGGGCC		Somatic	NA	NA	NA		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A8K7Q0|Q7Z464|Q96D97|Q9H6H3	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	NULL	p.P131fs	ENST00000308278.8	37	c.379_380	CCDS10996.1	17																																																																																			-	NULL		0.762	FAM57A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM57A	protein_coding	OTTHUMT00000437155.2	-	NM_024792			636267	+1	no_errors	ENST00000574327	ensembl	human	known	74_37	frame_shift_ins	INS	0.000:0.000	GGGCC
TCP11	6954	genome.wustl.edu	37	6	35109033	35109040	+	5'Flank	DEL	GCGGCCTG	GCGGCCTG	-	rs142118879|rs112303926	byFrequency	TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	GCGGCCTG	GCGGCCTG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr6:35109033_35109040delGCGGCCTG	ENST00000512012.1	-	0	0				TCP11_ENST00000373979.2_5'UTR|TCP11_ENST00000244645.3_5'UTR|TCP11_ENST00000311875.5_5'UTR|TCP11_ENST00000510465.1_5'UTR|TCP11_ENST00000412155.2_5'UTR|TCP11_ENST00000373974.4_5'UTR|TCP11_ENST00000444780.2_5'UTR|TCP11_ENST00000418521.2_Intron			Q8WWU5	TCP11_HUMAN	t-complex 11, testis-specific						cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)				breast(1)|kidney(5)|large_intestine(3)|lung(10)|ovary(3)|prostate(1)|skin(4)	27						GGTGGGCCTCGCGGCCTGGCGGCCTGGA	0.769														2193	0.437899	0.1831	0.611	5008	,	,		9765	0.3085		0.6849	False		,,,				2504	0.5389																0								ENSG00000124678		,	265,1133		113,39,547					,	0.6	0.0		dbSNP_130	1	1818,1276		830,158,559	no	utr-5,utr-5	TCP11	NM_018679.4,NM_001093728.1	,	943,197,1106	A1A1,A1R,RR		41.2411,18.9557,46.3713	,	,		2083,2409				TCP11	SO:0001631	upstream_gene_variant	0				HGNC		CCDS4799.1, CCDS47413.1, CCDS59015.1, CCDS59016.1, CCDS59017.1, CCDS59018.1	6p21.31	2012-09-20	2012-09-20		ENSG00000124678	ENSG00000124678			11658	protein-coding gene	gene with protein product	"""fertilization-promoting peptide receptor"""	186982	"""t-complex 11 (a murine tcp homolog)"", ""t-complex 11 homolog (mouse)"""	D6S230E		1427894, 11756566, 21597245	Standard	NM_001093728		Approved	KIAA0229, FPPR	uc003okd.2	Q8WWU5	OTTHUMG00000014560		6.37:g.35109041_35109048delGCGGCCTG	Exception_encountered	Somatic	NA	NA	NA		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B2RCE9|B3KQ27|B7Z7B5|B7Z7G1|B7Z7H4|B7Z7S8|E7EP29|J3KNG1|Q8NF85|Q9NQZ9|Q9NR39	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000512012.1	37	NULL		6																																																																																			-	-		0.769	TCP11-014	PUTATIVE	basic	protein_coding	TCP11	protein_coding	OTTHUMT00000370354.1	GCGGCCTG	NM_001093728			35109040	-1	no_errors	ENST00000394696	ensembl	human	known	74_37	rna	DEL	0.001:0.000:0.000:0.001:0.002:0.001:0.000:0.000	-
ACO1	48	genome.wustl.edu	37	9	32407428	32407428	+	Splice_Site	SNP	G	G	A			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr9:32407428G>A	ENST00000309951.6	+	3	404		c.e3+1		ACO1_ENST00000379923.1_Splice_Site|ACO1_ENST00000541043.1_Splice_Site	NM_002197.2	NP_002188.1	P21399	ACOC_HUMAN	aconitase 1, soluble						cellular iron ion homeostasis (GO:0006879)|citrate metabolic process (GO:0006101)|intestinal absorption (GO:0050892)|post-embryonic development (GO:0009791)|regulation of translation (GO:0006417)|response to iron(II) ion (GO:0010040)|tricarboxylic acid cycle (GO:0006099)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)	4 iron, 4 sulfur cluster binding (GO:0051539)|aconitate hydratase activity (GO:0003994)|iron-responsive element binding (GO:0030350)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)	p.?(3)		breast(1)|endometrium(7)|kidney(5)|large_intestine(6)|lung(6)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	30			LUSC - Lung squamous cell carcinoma(29;0.00813)	GBM - Glioblastoma multiforme(74;3.94e-06)		AGGACTTTACGTGAGCCTAAT	0.388																																																	3	Unknown(3)	lung(2)|ovary(1)						ENSG00000122729						113.0	85.0	95.0					9																	32407428		2203	4300	6503	ACO1	SO:0001630	splice_region_variant	0			-	HGNC	M58510	CCDS6525.1	9p21.1	2013-05-21			ENSG00000122729	ENSG00000122729	4.2.1.3		117	protein-coding gene	gene with protein product	"""aconitate hydratase, cytoplasmic"""	100880		IREB1		2172968, 2771641	Standard	NM_002197		Approved	IRP1, IREBP	uc003zqw.4	P21399	OTTHUMG00000019740	ENST00000309951.6:c.266+1G>A	9.37:g.32407428G>A		Somatic	0	23	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	13	43.48	D3DRK7|Q14652|Q5VZA7	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e2+1	ENST00000309951.6	37	c.266+1	CCDS6525.1	9	.	.	.	.	.	.	.	.	.	.	G	24.3	4.512926	0.85389	.	.	ENSG00000122729	ENST00000432017;ENST00000309951;ENST00000379923;ENST00000379921	.	.	.	5.34	5.34	0.76211	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.1904	0.89805	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ACO1	32397428	1.000000	0.71417	1.000000	0.80357	0.901000	0.52897	9.614000	0.98353	2.673000	0.90976	0.650000	0.86243	.	-	-		0.388	ACO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACO1	protein_coding	OTTHUMT00000051998.3	G	NM_002197	-	Intron	32407428	+1	no_errors	ENST00000309951	ensembl	human	known	74_37	splice_site	SNP	1.000	A
KCNT1	57582	genome.wustl.edu	37	9	138651572	138651572	+	Missense_Mutation	SNP	T	T	C			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr9:138651572T>C	ENST00000263604.3	+	11	845	c.845T>C	c.(844-846)cTc>cCc	p.L282P	KCNT1_ENST00000371757.2_Missense_Mutation_p.L301P|KCNT1_ENST00000486577.2_Missense_Mutation_p.L262P|KCNT1_ENST00000490355.2_Missense_Mutation_p.L282P|KCNT1_ENST00000491806.2_Missense_Mutation_p.L268P|KCNT1_ENST00000487664.1_Missense_Mutation_p.L256P|KCNT1_ENST00000488444.2_Missense_Mutation_p.L282P|KCNT1_ENST00000298480.5_Missense_Mutation_p.L301P			Q5JUK3	KCNT1_HUMAN	potassium channel, subfamily T, member 1	282					potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)			breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(18)|ovary(1)|pancreas(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;2.11e-07)|Epithelial(140;1.57e-06)|all cancers(34;9.22e-05)		AACCTGTCCCTCCTGACCTCC	0.667																																																	0								ENSG00000107147						159.0	122.0	135.0					9																	138651572		2203	4300	6503	KCNT1	SO:0001583	missense	0			-	HGNC	AB037843	CCDS35175.1, CCDS35175.2, CCDS65188.1	9q34.3	2012-07-05			ENSG00000107147	ENSG00000107147		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18865	protein-coding gene	gene with protein product		608167				10718198, 16382103	Standard	NM_020822		Approved	KCa4.1, KIAA1422	uc011mdq.2	Q5JUK3	OTTHUMG00000020917	ENST00000263604.3:c.845T>C	9.37:g.138651572T>C	ENSP00000263604:p.Leu282Pro	Somatic	0	27	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	32	15.79	B3KXF7|B7ZVY4|B9EGP2|G5E9V0|Q9P2C5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_K_chnl_Ca-activ_BK_asu,pfam_2pore_dom_K_chnl_dom	p.L301P	ENST00000263604.3	37	c.902		9	.	.	.	.	.	.	.	.	.	.	T	22.1	4.244096	0.79912	.	.	ENSG00000107147	ENST00000487664;ENST00000298480;ENST00000371757;ENST00000473941;ENST00000486577;ENST00000491806;ENST00000488444;ENST00000490355;ENST00000263604	T;T;T;T;T	0.33438	1.76;1.76;1.76;1.41;1.76	5.05	5.05	0.67936	Ion transport 2 (1);	0.000000	0.64402	D	0.000005	T	0.56108	0.1963	M	0.77616	2.38	0.80722	D	1	D;D;D;P	0.63880	0.985;0.993;0.991;0.56	D;D;D;P	0.72075	0.956;0.976;0.967;0.593	T	0.62053	-0.6935	10	0.87932	D	0	-29.8082	13.9756	0.64271	0.0:0.0:0.0:1.0	.	268;301;256;282	C9JYL2;B9EGP2;G5E9V0;Q5JUK3	.;.;.;KCNT1_HUMAN	P	256;301;301;248;262;268;282;282;282	ENSP00000417851:L256P;ENSP00000298480:L301P;ENSP00000360822:L301P;ENSP00000420764:L248P;ENSP00000263604:L282P	ENSP00000263604:L282P	L	+	2	0	KCNT1	137791393	1.000000	0.71417	0.999000	0.59377	0.955000	0.61496	7.747000	0.85070	1.907000	0.55213	0.482000	0.46254	CTC	-	pfam_2pore_dom_K_chnl_dom		0.667	KCNT1-201	KNOWN	basic|appris_candidate	protein_coding	KCNT1	protein_coding		T	NM_020822	-		138651572	+1	no_errors	ENST00000298480	ensembl	human	known	74_37	missense	SNP	1.000	C
CCNA1	8900	genome.wustl.edu	37	13	37011865	37011865	+	Missense_Mutation	SNP	C	C	A			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr13:37011865C>A	ENST00000255465.4	+	3	661	c.397C>A	c.(397-399)Caa>Aaa	p.Q133K	CCNA1_ENST00000418263.1_Missense_Mutation_p.Q132K|CCNA1_ENST00000440264.1_Missense_Mutation_p.Q89K|CCNA1_ENST00000449823.1_Missense_Mutation_p.Q89K			P78396	CCNA1_HUMAN	cyclin A1	133					G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|male meiosis I (GO:0007141)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|spermatogenesis (GO:0007283)	cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)				breast(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(10)|ovary(3)|prostate(1)|skin(2)|stomach(2)|urinary_tract(1)	35		Breast(139;0.014)|Lung SC(185;0.0548)|Prostate(109;0.174)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.91e-07)|Epithelial(112;1.22e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0119)|GBM - Glioblastoma multiforme(144;0.0242)		GCCCCCCAAGCAAGGGTTTGA	0.517																																																	0								ENSG00000133101						82.0	88.0	86.0					13																	37011865		2203	4300	6503	CCNA1	SO:0001583	missense	0			-	HGNC	U66838	CCDS9357.1, CCDS45031.1	13q12.3-q13	2014-01-21			ENSG00000133101	ENSG00000133101			1577	protein-coding gene	gene with protein product		604036				9041194	Standard	NM_003914		Approved	CT146	uc001uvr.4	P78396	OTTHUMG00000016733	ENST00000255465.4:c.397C>A	13.37:g.37011865C>A	ENSP00000255465:p.Gln133Lys	Somatic	0	26	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	19	42.42	B7Z7E3|Q5T3V0|Q5U0G2|Q8IY91	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cyclin_N,pfam_Cyclin_C-dom,superfamily_Cyclin-like,smart_Cyclin-like,pirsf_Cyclin_A/B/D/E	p.Q133K	ENST00000255465.4	37	c.397	CCDS9357.1	13	.	.	.	.	.	.	.	.	.	.	C	10.45	1.352761	0.24512	.	.	ENSG00000133101	ENST00000440264;ENST00000449823;ENST00000418263;ENST00000255465	T;T;T;T	0.15372	2.47;2.47;2.43;2.43	5.76	5.76	0.90799	.	0.757322	0.12090	N	0.500548	T	0.23806	0.0576	L	0.56769	1.78	0.33236	D	0.556554	B;B	0.23128	0.08;0.048	B;B	0.19946	0.027;0.012	T	0.20505	-1.0273	9	.	.	.	.	19.9731	0.97292	0.0:1.0:0.0:0.0	.	132;133	P78396-2;P78396	.;CCNA1_HUMAN	K	89;89;132;133	ENSP00000400666:Q89K;ENSP00000409873:Q89K;ENSP00000396479:Q132K;ENSP00000255465:Q133K	.	Q	+	1	0	CCNA1	35909865	1.000000	0.71417	0.839000	0.33178	0.169000	0.22640	5.033000	0.64146	2.715000	0.92844	0.563000	0.77884	CAA	-	pirsf_Cyclin_A/B/D/E		0.517	CCNA1-001	KNOWN	basic|CCDS	protein_coding	CCNA1	protein_coding	OTTHUMT00000044514.2	C	NM_003914	-		37011865	+1	no_errors	ENST00000255465	ensembl	human	known	74_37	missense	SNP	0.989	A
KLHL1	57626	genome.wustl.edu	37	13	70456450	70456450	+	Missense_Mutation	SNP	G	G	C			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr13:70456450G>C	ENST00000377844.4	-	5	1951	c.1192C>G	c.(1192-1194)Ctt>Gtt	p.L398V	KLHL1_ENST00000545028.1_Missense_Mutation_p.L205V	NM_020866.2	NP_065917.1	Q9NR64	KLHL1_HUMAN	kelch-like family member 1	398					actin cytoskeleton organization (GO:0030036)|adult walking behavior (GO:0007628)|cerebellar Purkinje cell layer development (GO:0021680)|dendrite development (GO:0016358)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	actin binding (GO:0003779)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(56)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	84		Breast(118;0.000162)		COAD - Colon adenocarcinoma(199;0.000193)|GBM - Glioblastoma multiforme(99;0.000211)		ATAAAGGCAAGAAGCATGCTC	0.393																																																	0								ENSG00000150361						169.0	139.0	149.0					13																	70456450		2203	4300	6503	KLHL1	SO:0001583	missense	0			-	HGNC	AB040923	CCDS9445.1, CCDS73582.1	13q21	2013-01-30	2013-01-30		ENSG00000150361	ENSG00000150361		"""Kelch-like"", ""BTB/POZ domain containing"""	6352	protein-coding gene	gene with protein product	"""Kelch-like protein 1"", ""Mayven-related protein 2"""	605332	"""kelch (Drosophila)-like 1"", ""kelch-like 1 (Drosophila)"""			10888605	Standard	NM_020866		Approved	KIAA1490, MRP2, FLJ30047	uc001vip.3	Q9NR64	OTTHUMG00000017056	ENST00000377844.4:c.1192C>G	13.37:g.70456450G>C	ENSP00000367075:p.Leu398Val	Somatic	0	28	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	16	46.67	A8K5X0|Q5VZ64|Q9H4X4|Q9NR65|Q9P238	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Kelch_1,pfam_Kelch_2,pfam_BACK,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pfscan_BTB/POZ-like	p.L398V	ENST00000377844.4	37	c.1192	CCDS9445.1	13	.	.	.	.	.	.	.	.	.	.	G	18.62	3.664219	0.67700	.	.	ENSG00000150361	ENST00000377844;ENST00000545028	T;T	0.77098	-1.07;-1.07	4.89	4.89	0.63831	BTB/Kelch-associated (2);	0.000000	0.56097	D	0.000031	D	0.90638	0.7064	M	0.91920	3.255	0.45747	D	0.998648	D;D	0.76494	0.999;0.999	D;D	0.78314	0.986;0.991	D	0.92851	0.6297	10	0.87932	D	0	.	18.403	0.90523	0.0:0.0:1.0:0.0	.	398;398	Q8TBJ7;Q9NR64	.;KLHL1_HUMAN	V	398;205	ENSP00000367075:L398V;ENSP00000439602:L205V	ENSP00000367075:L398V	L	-	1	0	KLHL1	69354451	1.000000	0.71417	0.993000	0.49108	0.927000	0.56198	7.930000	0.87610	2.406000	0.81754	0.591000	0.81541	CTT	-	pfam_BACK,smart_BACK		0.393	KLHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL1	protein_coding	OTTHUMT00000045231.3	G	NM_020866	-		70456450	-1	no_errors	ENST00000377844	ensembl	human	known	74_37	missense	SNP	1.000	C
RPLP0P2	113157	genome.wustl.edu	37	11	61404783	61404783	+	RNA	SNP	T	T	C			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr11:61404783T>C	ENST00000496593.1	+	0	1387					NR_002775.2				ribosomal protein, large, P0 pseudogene 2																		GAGGAAACTCTGTATTCTCGC	0.547																																																	0								ENSG00000243742																																			RPLP0P2			0			-	HGNC	BC010523		11q12.2	2014-08-07			ENSG00000243742	ENSG00000243742		"""L ribosomal proteins"""	17960	pseudogene	pseudogene						19123937, 25089627	Standard	NR_002775		Approved		uc001nrz.1		OTTHUMG00000158396		11.37:g.61404783T>C		Somatic	0	46	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	84	8.70		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000496593.1	37	NULL		11																																																																																			-	-		0.547	RPLP0P2-002	KNOWN	basic	processed_transcript	RPLP0P2	pseudogene	OTTHUMT00000350911.1	T	NR_002775	-		61404783	+1	no_errors	ENST00000496593	ensembl	human	known	74_37	rna	SNP	0.981	C
PCDHA12	56137	genome.wustl.edu	37	5	140257091	140257091	+	Silent	SNP	G	G	A			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr5:140257091G>A	ENST00000398631.2	+	1	2034	c.2034G>A	c.(2032-2034)acG>acA	p.T678T	PCDHA2_ENST00000526136.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA4_ENST00000530339.1_Intron	NM_018903.2|NM_031864.2	NP_061726.1|NP_114070.1	Q9UN75	PCDAC_HUMAN	protocadherin alpha 12	678	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(4)|breast(2)|cervix(1)|endometrium(19)|kidney(8)|large_intestine(8)|liver(2)|lung(25)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCCCAAAGACGTCGTCGCGGG	0.657																																					Pancreas(113;759 1672 13322 24104 50104)												0								ENSG00000251664						42.0	47.0	45.0					5																	140257091		2203	4300	6503	PCDHA12	SO:0001819	synonymous_variant	0			-	HGNC	AF152477	CCDS47285.1, CCDS75327.1	5q31	2010-11-26			ENSG00000251664	ENSG00000251664		"""Cadherins / Protocadherins : Clustered"""	8666	other	complex locus constituent	"""KIAA0345-like 2"""	606318				10380929	Standard	NM_018903		Approved	PCDH-ALPHA12	uc003lic.2	Q9UN75	OTTHUMG00000163366	ENST00000398631.2:c.2034G>A	5.37:g.140257091G>A		Somatic	0	55	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	33	42.11	O75278|Q2M1N8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.T678	ENST00000398631.2	37	c.2034	CCDS47285.1	5																																																																																			-	pfscan_Cadherin		0.657	PCDHA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA12	protein_coding	OTTHUMT00000372882.2	G	NM_018903	-		140257091	+1	no_errors	ENST00000398631	ensembl	human	known	74_37	silent	SNP	0.000	A
AGTR1	185	genome.wustl.edu	37	3	148459060	148459060	+	Missense_Mutation	SNP	A	A	T			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr3:148459060A>T	ENST00000497524.1	+	2	629	c.238A>T	c.(238-240)Act>Tct	p.T80S	AGTR1_ENST00000542281.1_Missense_Mutation_p.T80S|AGTR1_ENST00000349243.3_Missense_Mutation_p.T80S|AGTR1_ENST00000418473.2_Missense_Mutation_p.T80S|AGTR1_ENST00000474935.1_Missense_Mutation_p.T80S|AGTR1_ENST00000402260.1_Missense_Mutation_p.T80S|AGTR1_ENST00000461609.1_Missense_Mutation_p.T80S|AGTR1_ENST00000404754.2_Missense_Mutation_p.T80S|AGTR1_ENST00000475347.1_Missense_Mutation_p.T80S	NM_009585.3	NP_033611.1	P30556	AGTR1_HUMAN	angiotensin II receptor, type 1	80					angiotensin-activated signaling pathway (GO:0038166)|calcium-mediated signaling (GO:0019722)|cell chemotaxis (GO:0060326)|G-protein coupled receptor signaling pathway (GO:0007186)|kidney development (GO:0001822)|low-density lipoprotein particle remodeling (GO:0034374)|phospholipase C-activating angiotensin-activated signaling pathway (GO:0086097)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of cholesterol esterification (GO:0010873)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of inflammatory response (GO:0050729)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of NAD(P)H oxidase activity (GO:0033864)|positive regulation of phospholipase A2 activity (GO:0032430)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|regulation of blood vessel size by renin-angiotensin (GO:0002034)|regulation of cell growth (GO:0001558)|regulation of cell proliferation (GO:0042127)|regulation of inflammatory response (GO:0050727)|regulation of renal sodium excretion (GO:0035813)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)|regulation of vasoconstriction (GO:0019229)|regulation of vasodilation (GO:0042312)|renin-angiotensin regulation of aldosterone production (GO:0002018)|Rho protein signal transduction (GO:0007266)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	angiotensin type I receptor activity (GO:0001596)|angiotensin type II receptor activity (GO:0004945)|bradykinin receptor binding (GO:0031711)|protein heterodimerization activity (GO:0046982)			breast(4)|endometrium(3)|kidney(1)|large_intestine(5)|lung(13)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	30			LUSC - Lung squamous cell carcinoma(72;0.127)|Lung(72;0.152)		Azilsartan medoxomil(DB08822)|Candesartan(DB00796)|Eprosartan(DB00876)|Forasartan(DB01342)|Irbesartan(DB01029)|Losartan(DB00678)|Olmesartan(DB00275)|Saprisartan(DB01347)|Tasosartan(DB01349)|Telmisartan(DB00966)|Valsartan(DB00177)	CTTTTTACTGACTTTGCCACT	0.428																																																	0								ENSG00000144891						78.0	75.0	76.0					3																	148459060		2203	4300	6503	AGTR1	SO:0001583	missense	0			-	HGNC	M87290	CCDS3137.1	3q24	2012-08-08	2002-02-20		ENSG00000144891	ENSG00000144891		"""GPCR / Class A : Angiotensin receptors"""	336	protein-coding gene	gene with protein product		106165	"""angiotensin receptor 1B"""	AGTR1B		1550596	Standard	NM_009585		Approved	AT1, AT2R1, AGTR1A, AT2R1A, HAT1R, AG2S, AT2R1B, AT1B	uc003ewh.4	P30556	OTTHUMG00000159503	ENST00000497524.1:c.238A>T	3.37:g.148459060A>T	ENSP00000419422:p.Thr80Ser	Somatic	0	31	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	28	12.50	Q13725|Q8TBK4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_ATII_AT1_rcpt,prints_ATII_rcpt,prints_GPCR_Rhodpsn,prints_Chemokine_rcpt,prints_Formyl_pep_rcpt,prints_Brdyknn_rcpt	p.T80S	ENST00000497524.1	37	c.238	CCDS3137.1	3	.	.	.	.	.	.	.	.	.	.	A	19.29	3.798624	0.70567	.	.	ENSG00000144891	ENST00000497524;ENST00000349243;ENST00000542281;ENST00000418473;ENST00000404754;ENST00000475347;ENST00000474935;ENST00000461609;ENST00000402260	T;T;T;T;T;T;T;T;T	0.72942	-0.7;-0.7;-0.7;-0.7;-0.7;-0.7;-0.7;-0.7;-0.7	4.95	4.95	0.65309	GPCR, rhodopsin-like superfamily (1);	0.052054	0.85682	D	0.000000	T	0.78521	0.4296	L	0.48986	1.54	0.80722	D	1	D	0.61080	0.989	D	0.65874	0.939	T	0.77528	-0.2554	10	0.37606	T	0.19	-23.1279	14.7728	0.69693	1.0:0.0:0.0:0.0	.	80	P30556	AGTR1_HUMAN	S	80	ENSP00000419422:T80S;ENSP00000273430:T80S;ENSP00000443186:T80S;ENSP00000398832:T80S;ENSP00000385612:T80S;ENSP00000419783:T80S;ENSP00000418084:T80S;ENSP00000418851:T80S;ENSP00000385641:T80S	ENSP00000273430:T80S	T	+	1	0	AGTR1	149941750	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.135000	0.94478	2.071000	0.62044	0.533000	0.62120	ACT	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_Chemokine_rcpt,prints_Formyl_pep_rcpt		0.428	AGTR1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	AGTR1	protein_coding	OTTHUMT00000355807.1	A		-		148459060	+1	no_errors	ENST00000349243	ensembl	human	known	74_37	missense	SNP	1.000	T
NBR1	4077	genome.wustl.edu	37	17	41338461	41338461	+	Splice_Site	SNP	G	G	T			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr17:41338461G>T	ENST00000422280.1	+	6	861	c.402G>T	c.(400-402)caG>caT	p.Q134H	NBR1_ENST00000389312.4_Splice_Site_p.Q134H|NBR1_ENST00000590996.1_Splice_Site_p.Q134H|NBR1_ENST00000542611.1_Splice_Site_p.Q113H|NBR1_ENST00000589872.1_Splice_Site_p.Q134H|NBR1_ENST00000341165.6_Splice_Site_p.Q134H	NM_031858.2	NP_114064.1	Q14596	NBR1_HUMAN	neighbor of BRCA1 gene 1	134					macroautophagy (GO:0016236)|negative regulation of osteoblast differentiation (GO:0045668)|protein oligomerization (GO:0051259)|regulation of bone mineralization (GO:0030500)|regulation of stress-activated MAPK cascade (GO:0032872)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|pre-autophagosomal structure (GO:0000407)	mitogen-activated protein kinase binding (GO:0051019)|ubiquitin binding (GO:0043130)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|cervix(1)|kidney(4)|large_intestine(1)|lung(7)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	24		Breast(137;0.00086)		BRCA - Breast invasive adenocarcinoma(366;0.0934)		CTGCAGTGCAGGTATGAAGGG	0.403																																																	0								ENSG00000188554						37.0	35.0	36.0					17																	41338461		1876	4106	5982	NBR1	SO:0001630	splice_region_variant	0			-	HGNC	X76952	CCDS45694.1	17q21.31	2008-02-01	2005-02-15	2005-02-16		ENSG00000188554			6746	protein-coding gene	gene with protein product		166945	"""membrane component, chromosome 17, surface marker 2 (ovarian carcinoma antigen CA125)"""	M17S2		8069304	Standard	XM_006721903		Approved	CA125, KIAA0049, 1A1-3B	uc010whv.2	Q14596		ENST00000422280.1:c.402+1G>T	17.37:g.41338461G>T		Somatic	0	34	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	30	9.09	Q13173|Q15026|Q5J7Q8|Q96GB6|Q9NRF7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_OPR_PB1,pfam_Znf_ZZ,superfamily_UBA-like,smart_OPR_PB1,smart_Znf_ZZ,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Znf_ZZ	p.Q134H	ENST00000422280.1	37	c.402	CCDS45694.1	17	.	.	.	.	.	.	.	.	.	.	G	9.941	1.217484	0.22373	.	.	ENSG00000188554	ENST00000422280;ENST00000542611;ENST00000341165;ENST00000389312;ENST00000389311	T;T;T;T	0.46063	1.43;0.88;1.43;1.45	5.43	4.47	0.54385	.	0.483808	0.22763	N	0.055924	T	0.35098	0.0920	L	0.41236	1.265	0.80722	D	1	B;B;B	0.11235	0.001;0.004;0.001	B;B;B	0.11329	0.005;0.006;0.003	T	0.17349	-1.0372	10	0.66056	D	0.02	-1.1256	11.2756	0.49165	0.0849:0.0:0.9151:0.0	.	113;134;134	B7Z5R6;Q14596-2;Q14596	.;.;NBR1_HUMAN	H	134;113;134;134;134	ENSP00000411250:Q134H;ENSP00000437545:Q113H;ENSP00000343479:Q134H;ENSP00000373963:Q134H	ENSP00000343479:Q134H	Q	+	3	2	NBR1	38591987	1.000000	0.71417	0.975000	0.42487	0.518000	0.34316	4.524000	0.60552	1.320000	0.45209	0.609000	0.83330	CAG	-	NULL		0.403	NBR1-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NBR1	protein_coding	OTTHUMT00000453461.1	G	NM_005899	-	Missense_Mutation	41338461	+1	no_errors	ENST00000341165	ensembl	human	known	74_37	missense	SNP	0.996	T
MECOM	2122	genome.wustl.edu	37	3	168813010	168813010	+	Missense_Mutation	SNP	A	A	T			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr3:168813010A>T	ENST00000464456.1	-	11	3482	c.2282T>A	c.(2281-2283)tTt>tAt	p.F761Y	MECOM_ENST00000433243.2_Missense_Mutation_p.F771Y|MECOM_ENST00000264674.3_Missense_Mutation_p.F835Y|MECOM_ENST00000472280.1_Missense_Mutation_p.F771Y|MECOM_ENST00000468789.1_Missense_Mutation_p.F770Y|MECOM_ENST00000392736.3_Missense_Mutation_p.F770Y|MECOM_ENST00000460814.1_Missense_Mutation_p.F761Y|MECOM_ENST00000494292.1_Missense_Mutation_p.F949Y	NM_001164000.1	NP_001157472.1	Q13465	MDS1_HUMAN	MDS1 and EVI1 complex locus	0					regulation of transcription, DNA-templated (GO:0006355)		sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(13)|liver(1)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(12)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	85						AGATATGCTAAATGATCTGTC	0.343																																																	0								ENSG00000085276						102.0	90.0	94.0					3																	168813010		2202	4300	6502	MECOM	SO:0001583	missense	0			-	HGNC	S82592, AF164154	CCDS3205.1, CCDS54669.1, CCDS54670.1	3q26.2	2013-01-08	2009-08-07	2009-08-07	ENSG00000085276	ENSG00000085276		"""Zinc fingers, C2H2-type"""	3498	protein-coding gene	gene with protein product		165215	"""myelodysplasia syndrome 1"", ""ecotropic viral integration site 1"""	MDS1, EVI1		2115646, 8171026, 8643684	Standard	NM_001105077		Approved	MDS1-EVI1, PRDM3	uc011bpj.1	Q03112	OTTHUMG00000158596	ENST00000464456.1:c.2282T>A	3.37:g.168813010A>T	ENSP00000419770:p.Phe761Tyr	Somatic	0	35	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	20	33.33	Q13466|Q6FH90	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Znf_BED_prd,smart_SET_dom,smart_Znf_C2H2-like,pfscan_SET_dom,pfscan_Znf_C2H2	p.F949Y	ENST00000464456.1	37	c.2846	CCDS54669.1	3	.	.	.	.	.	.	.	.	.	.	A	31	5.090433	0.94149	.	.	ENSG00000085276	ENST00000264674;ENST00000392736;ENST00000464456;ENST00000472280;ENST00000494292;ENST00000468789;ENST00000460814;ENST00000433243	T;T;T;T;T;T;T;T	0.36157	1.27;1.27;1.27;1.27;1.27;1.27;1.27;1.27	5.64	5.64	0.86602	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.60560	0.2278	M	0.70903	2.155	0.80722	D	1	D;D;D;D;D	0.76494	0.999;0.999;0.999;0.999;0.999	D;D;D;D;D	0.91635	0.998;0.979;0.999;0.996;0.999	T	0.64512	-0.6390	10	0.87932	D	0	-10.2458	15.8679	0.79080	1.0:0.0:0.0:0.0	.	958;762;949;835;770	Q03112-3;Q03112-6;E7EQ57;Q03112-4;Q03112	.;.;.;.;EVI1_HUMAN	Y	835;770;761;771;949;770;761;771	ENSP00000264674:F835Y;ENSP00000376493:F770Y;ENSP00000419770:F761Y;ENSP00000420048:F771Y;ENSP00000417899:F949Y;ENSP00000419995:F770Y;ENSP00000420466:F761Y;ENSP00000394302:F771Y	ENSP00000264674:F835Y	F	-	2	0	MECOM	170295704	1.000000	0.71417	0.826000	0.32828	0.896000	0.52359	9.281000	0.95811	2.166000	0.68216	0.459000	0.35465	TTT	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.343	MECOM-020	NOVEL	basic|exp_conf|CCDS	protein_coding	MECOM	protein_coding	OTTHUMT00000351519.1	A	NM_005241, NM_004991	-		168813010	-1	no_errors	ENST00000494292	ensembl	human	known	74_37	missense	SNP	1.000	T
ASH1L	55870	genome.wustl.edu	37	1	155429652	155429652	+	Silent	SNP	T	T	C			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr1:155429652T>C	ENST00000368346.3	-	4	5661	c.5022A>G	c.(5020-5022)ccA>ccG	p.P1674P	ASH1L_ENST00000392403.3_Silent_p.P1674P			Q9NR48	ASH1L_HUMAN	ash1 (absent, small, or homeotic)-like (Drosophila)	1674	Ser-rich.				cell-cell signaling (GO:0007267)|DNA packaging (GO:0006323)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|tight junction (GO:0005923)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(13)|large_intestine(28)|lung(39)|ovary(2)|pancreas(1)|prostate(6)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(4)	124	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			TGCTCTCTGATGGCCGCTGGG	0.408																																																	0								ENSG00000116539						79.0	79.0	79.0					1																	155429652		2203	4300	6503	ASH1L	SO:0001819	synonymous_variant	0			-	HGNC	AB037841	CCDS1113.2	1q22	2013-01-28			ENSG00000116539	ENSG00000116539		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	19088	protein-coding gene	gene with protein product		607999				10860993, 16545939	Standard	NM_018489		Approved	huASH1, ASH1, ASH1L1, KMT2H	uc001fkt.3	Q9NR48	OTTHUMG00000014011	ENST00000368346.3:c.5022A>G	1.37:g.155429652T>C		Somatic	0	19	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	49	23.44	Q59GP1|Q5T714|Q5T715|Q9P2C7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_SET_dom,pfam_BAH_dom,pfam_Bromodomain,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_AT_hook_DNA-bd_motif,smart_AWS,smart_SET_dom,smart_Bromodomain,smart_Znf_PHD,smart_BAH_dom,pfscan_AWS,pfscan_BAH_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Bromodomain	p.P1674	ENST00000368346.3	37	c.5022		1																																																																																			-	NULL		0.408	ASH1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	ASH1L	protein_coding	OTTHUMT00000039400.1	T	NM_018489	-		155429652	-1	no_errors	ENST00000368346	ensembl	human	known	74_37	silent	SNP	0.596	C
LAMTOR1	55004	genome.wustl.edu	37	11	71817090	71817090	+	5'Flank	SNP	C	C	G			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr11:71817090C>G	ENST00000278671.5	-	0	0				LAMTOR1_ENST00000535107.1_5'Flank|LRTOMT_ENST00000419228.1_Intron|LRTOMT_ENST00000435085.1_Silent_p.V64V|LAMTOR1_ENST00000545249.1_5'Flank|LRTOMT_ENST00000307198.7_Silent_p.V64V|LAMTOR1_ENST00000538404.1_5'Flank|LRTOMT_ENST00000439209.1_Intron|snoU13_ENST00000459046.1_RNA	NM_017907.2	NP_060377.1	Q6IAA8	LTOR1_HUMAN	late endosomal/lysosomal adaptor, MAPK and MTOR activator 1						cell growth (GO:0016049)|cellular protein localization (GO:0034613)|cellular response to amino acid stimulus (GO:0071230)|cholesterol homeostasis (GO:0042632)|endosome localization (GO:0032439)|endosome organization (GO:0007032)|lysosome localization (GO:0032418)|lysosome organization (GO:0007040)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of TOR signaling (GO:0032008)|regulation of cholesterol efflux (GO:0010874)|regulation of cholesterol esterification (GO:0010872)|regulation of cholesterol import (GO:0060620)|regulation of receptor recycling (GO:0001919)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|late endosome membrane (GO:0031902)|lysosome (GO:0005764)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|Ragulator complex (GO:0071986)				cervix(1)	1						TGCGCACGGTCTTGCTGCGAA	0.627																																																	0								ENSG00000184154						55.0	51.0	52.0					11																	71817090		692	1591	2283	LRTOMT	SO:0001631	upstream_gene_variant	0			-	HGNC	AK000632	CCDS8209.1	11q13.4	2011-05-18	2011-02-15	2011-02-15	ENSG00000149357	ENSG00000149357			26068	protein-coding gene	gene with protein product	"""p27kip1 releasing factor from RhoA"", ""protein associated with DRMs and endosomes"""	613510	"""chromosome 11 open reading frame 59"""	C11orf59		12358155	Standard	NM_017907		Approved	FLJ20625, p18, p27RF-Rho, Pdro, Ragulator1	uc001ort.3	Q6IAA8	OTTHUMG00000167869		11.37:g.71817090C>G	Exception_encountered	Somatic	0	27	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	32	17.95	Q8WZ09|Q9NWT0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.L199V	ENST00000278671.5	37	c.595	CCDS8209.1	11																																																																																			-	NULL		0.627	LAMTOR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRTOMT	protein_coding	OTTHUMT00000396733.1	C	NM_017907	-		71817090	+1	no_errors	ENST00000427369	ensembl	human	known	74_37	missense	SNP	1.000	G
MAD1L1	8379	genome.wustl.edu	37	7	1938010	1938010	+	Silent	SNP	C	C	T			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr7:1938010C>T	ENST00000406869.1	-	18	2381	c.1824G>A	c.(1822-1824)gtG>gtA	p.V608V	MAD1L1_ENST00000402746.1_Silent_p.V516V|MAD1L1_ENST00000399654.2_Silent_p.V608V|MAD1L1_ENST00000265854.7_Silent_p.V608V			Q9Y6D9	MD1L1_HUMAN	MAD1 mitotic arrest deficient-like 1 (yeast)	608					mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|regulation of metaphase plate congression (GO:0090235)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|mitotic spindle (GO:0072686)|nucleus (GO:0005634)|spindle (GO:0005819)				central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(2)|lung(20)|ovary(1)|prostate(5)	36		Ovarian(82;0.0272)		UCEC - Uterine corpus endometrioid carcinoma (27;0.134)|OV - Ovarian serous cystadenocarcinoma(56;3.63e-14)		CGGCACTCTCCACCTGCTTCT	0.647																																																	0								ENSG00000002822						106.0	116.0	113.0					7																	1938010		2089	4205	6294	MAD1L1	SO:0001819	synonymous_variant	0			-	HGNC	U33822	CCDS43539.1	7p22	2013-01-17	2001-11-28		ENSG00000002822	ENSG00000002822			6762	protein-coding gene	gene with protein product		602686	"""MAD1 (mitotic arrest deficient, yeast, homolog)-like 1"""			10049595, 9546394	Standard	XM_005249876		Approved	HsMAD1, TXBP181, MAD1, PIG9, TP53I9	uc003slg.1	Q9Y6D9	OTTHUMG00000151493	ENST00000406869.1:c.1824G>A	7.37:g.1938010C>T		Somatic	0	16	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	6	80.00	B3KR41|Q13312|Q75MI0|Q86UM4|Q9UNH0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Mad1	p.V608	ENST00000406869.1	37	c.1824	CCDS43539.1	7																																																																																			-	pfam_Mad1		0.647	MAD1L1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MAD1L1	protein_coding	OTTHUMT00000322871.1	C	NM_003550	-		1938010	-1	no_errors	ENST00000265854	ensembl	human	known	74_37	silent	SNP	1.000	T
OR51I2	390064	genome.wustl.edu	37	11	5475397	5475397	+	Missense_Mutation	SNP	G	G	C			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr11:5475397G>C	ENST00000341449.2	+	1	760	c.679G>C	c.(679-681)Gcc>Ccc	p.A227P	HBG2_ENST00000380259.2_Intron|HBE1_ENST00000380237.1_Intron|HBG2_ENST00000380252.1_Intron|AC104389.28_ENST00000415970.1_RNA	NM_001004754.2	NP_001004754.1	Q9H344	O51I2_HUMAN	olfactory receptor, family 51, subfamily I, member 2	227					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	29		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;1.09e-10)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TTCTGTCATGGCCACTGCTTC	0.463																																																	0								ENSG00000187918						322.0	273.0	290.0					11																	5475397		2201	4297	6498	OR51I2	SO:0001583	missense	0			-	HGNC	BK004381	CCDS31383.1	11p15.4	2012-08-09			ENSG00000187918	ENSG00000187918		"""GPCR / Class A : Olfactory receptors"""	15201	protein-coding gene	gene with protein product							Standard	NM_001004754		Approved		uc010qzf.2	Q9H344	OTTHUMG00000066902	ENST00000341449.2:c.679G>C	11.37:g.5475397G>C	ENSP00000341987:p.Ala227Pro	Somatic	0	35	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	20	39.39	Q6IF81	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.A227P	ENST00000341449.2	37	c.679	CCDS31383.1	11	.	.	.	.	.	.	.	.	.	.	G	12.28	1.890368	0.33348	.	.	ENSG00000187918	ENST00000341449	T	0.00123	8.7	5.58	1.68	0.24146	GPCR, rhodopsin-like superfamily (1);	0.553738	0.17868	N	0.159296	T	0.00356	0.0011	M	0.88775	2.98	0.25715	N	0.985433	D	0.55385	0.971	P	0.55785	0.784	T	0.40608	-0.9554	10	0.54805	T	0.06	.	5.3082	0.15815	0.29:0.0:0.5764:0.1336	.	227	Q9H344	O51I2_HUMAN	P	227	ENSP00000341987:A227P	ENSP00000341987:A227P	A	+	1	0	OR51I2	5431973	0.000000	0.05858	0.797000	0.32132	0.012000	0.07955	0.021000	0.13489	0.162000	0.19483	-0.140000	0.14226	GCC	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM		0.463	OR51I2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR51I2	protein_coding	OTTHUMT00000143385.1	G	NM_001004754	-		5475397	+1	no_errors	ENST00000341449	ensembl	human	known	74_37	missense	SNP	0.675	C
RBM47	54502	genome.wustl.edu	37	4	40439840	40439840	+	Silent	SNP	G	G	A			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr4:40439840G>A	ENST00000381793.2	-	3	1467	c.1071C>T	c.(1069-1071)taC>taT	p.Y357Y	RBM47_ENST00000319592.4_Silent_p.Y357Y|RBM47_ENST00000514014.1_Silent_p.Y319Y|RBM47_ENST00000381795.6_Silent_p.Y357Y|RBM47_ENST00000515809.1_Intron|RBM47_ENST00000295971.7_Silent_p.Y357Y			A0AV96	RBM47_HUMAN	RNA binding motif protein 47	357					hematopoietic progenitor cell differentiation (GO:0002244)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(5)|endometrium(1)|kidney(3)|large_intestine(2)|lung(9)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	29						AGGGGTAGCCGTAGTAGGCCA	0.642																																																	0								ENSG00000163694						44.0	45.0	45.0					4																	40439840		2203	4300	6503	RBM47	SO:0001819	synonymous_variant	0			-	HGNC	AK000280	CCDS3460.1, CCDS43223.1	4p14	2013-02-12			ENSG00000163694	ENSG00000163694		"""RNA binding motif (RRM) containing"""	30358	protein-coding gene	gene with protein product							Standard	NM_019027		Approved	FLJ20273, NET18	uc003gvc.2	A0AV96	OTTHUMG00000128598	ENST00000381793.2:c.1071C>T	4.37:g.40439840G>A		Somatic	0	47	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	32	11.11	A0PJK2|B5MED4|Q8NI52|Q8NI53|Q9NXG3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,tigrfam_HnRNP_R/Q_splicing_fac	p.Y357	ENST00000381793.2	37	c.1071	CCDS43223.1	4																																																																																			-	tigrfam_HnRNP_R/Q_splicing_fac		0.642	RBM47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM47	protein_coding	OTTHUMT00000250456.2	G	NM_019027	-		40439840	-1	no_errors	ENST00000295971	ensembl	human	known	74_37	silent	SNP	0.998	A
FBXO36	130888	genome.wustl.edu	37	2	230861515	230861515	+	Missense_Mutation	SNP	A	A	G			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr2:230861515A>G	ENST00000283946.3	+	3	272	c.254A>G	c.(253-255)aAt>aGt	p.N85S	FBXO36_ENST00000373652.3_Missense_Mutation_p.N54S|FBXO36_ENST00000409992.1_Intron	NM_174899.4	NP_777559.3	Q8NEA4	FBX36_HUMAN	F-box protein 36	85										endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|ovary(1)	7		Renal(207;0.0112)|all_lung(227;0.0179)|Lung NSC(271;0.0804)|all_hematologic(139;0.103)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;7.56e-14)|all cancers(144;7.74e-11)|Lung(119;0.00488)|LUSC - Lung squamous cell carcinoma(224;0.008)		TATGTCATCAATTTGTGCAAA	0.353																																																	0								ENSG00000153832						171.0	165.0	167.0					2																	230861515		2203	4300	6503	FBXO36	SO:0001583	missense	0			-	HGNC	BC033935	CCDS2472.1	2q37.1	2008-02-05	2004-06-15		ENSG00000153832	ENSG00000153832		"""F-boxes /  ""other"""""	27020	protein-coding gene	gene with protein product		609105	"""F-box only protein 36"""			12477932	Standard	NM_174899		Approved	Fbx36, FLJ37592	uc002vqa.3	Q8NEA4	OTTHUMG00000133206	ENST00000283946.3:c.254A>G	2.37:g.230861515A>G	ENSP00000283946:p.Asn85Ser	Somatic	0	28	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	31	34.04	B3KVQ6|Q53TE6|Q8WWD4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_F-box_dom,superfamily_F-box_dom,smart_F-box_dom,pfscan_F-box_dom	p.N85S	ENST00000283946.3	37	c.254	CCDS2472.1	2	.	.	.	.	.	.	.	.	.	.	A	5.483	0.274154	0.10403	.	.	ENSG00000153832	ENST00000373652;ENST00000283946	T;T	0.44881	0.91;0.92	5.37	5.37	0.77165	.	0.124564	0.50627	D	0.000105	T	0.52256	0.1723	L	0.38838	1.175	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.76071	0.987;0.987	T	0.43669	-0.9377	10	0.22706	T	0.39	-3.8363	14.3573	0.66745	1.0:0.0:0.0:0.0	.	54;85	B3KVQ6;Q8NEA4	.;FBX36_HUMAN	S	54;85	ENSP00000362756:N54S;ENSP00000283946:N85S	ENSP00000283946:N85S	N	+	2	0	FBXO36	230569759	1.000000	0.71417	0.996000	0.52242	0.066000	0.16364	2.993000	0.49425	2.038000	0.60285	0.459000	0.35465	AAT	-	NULL		0.353	FBXO36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO36	protein_coding	OTTHUMT00000256919.2	A	NM_174899	-		230861515	+1	no_errors	ENST00000283946	ensembl	human	known	74_37	missense	SNP	1.000	G
PDXDC1	23042	genome.wustl.edu	37	16	15229552	15229552	+	Intron	SNP	T	T	C			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr16:15229552T>C	ENST00000535621.2	+	17	1587							Q6P996	PDXD1_HUMAN	pyridoxal-dependent decarboxylase domain containing 1						carboxylic acid metabolic process (GO:0019752)	Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)	carboxy-lyase activity (GO:0016831)|pyridoxal phosphate binding (GO:0030170)			central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(2)|liver(1)|lung(10)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						CGGCGTCTGGTCGCCATCCTC	0.642																																																	0								ENSG00000250251																																			PKD1P6	SO:0001627	intron_variant	0			-	HGNC	AK025504, BX647809	CCDS32393.1, CCDS66954.1, CCDS66957.1, CCDS73830.1, CCDS73831.1	16p13.11	2008-02-05							28995	protein-coding gene	gene with protein product		614244					Standard	XM_005255173		Approved	KIAA0251	uc002dda.4	Q6P996	OTTHUMG00000166304	ENST00000535621.2:c.1400-3184T>C	16.37:g.15229552T>C		Somatic	0	97	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	90	9.90	B4DR55|B4DSL3|E7EMH5|E7EPL4|H3BNZ1|O00236|Q4F6X7|Q6PID7|Q86YF1|Q8N4Q9|Q8TBS5	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000535621.2	37	NULL		16																																																																																			-	-		0.642	PDXDC1-016	PUTATIVE	basic	protein_coding	PKD1P6	protein_coding	OTTHUMT00000422421.1	T	NM_015027	-		15229552	-1	no_errors	ENST00000538100	ensembl	human	known	74_37	rna	SNP	0.993	C
IFNA10	3446	genome.wustl.edu	37	9	21206569	21206569	+	Silent	SNP	C	C	A	rs148033880		TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr9:21206569C>A	ENST00000357374.2	-	1	573	c.528G>T	c.(526-528)tcG>tcT	p.S176S		NM_002171.1	NP_002162.1	P01566	IFN10_HUMAN	interferon, alpha 10	176					adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|natural killer cell activation involved in immune response (GO:0002323)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to exogenous dsRNA (GO:0043330)|T cell activation involved in immune response (GO:0002286)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|type I interferon receptor binding (GO:0005132)			endometrium(1)|large_intestine(3)|liver(1)|lung(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	16				Lung(24;1.26e-23)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.17)		TTGTTGAAAACGAGAGGGATC	0.383																																																	0								ENSG00000186803						215.0	221.0	219.0					9																	21206569		2203	4298	6501	IFNA10	SO:0001819	synonymous_variant	0			-	HGNC		CCDS6499.1	9p22	2010-08-24			ENSG00000186803	ENSG00000186803		"""Interferons"""	5418	protein-coding gene	gene with protein product		147577				1385305	Standard	NM_002171		Approved	IFN-alphaC	uc003zoq.1	P01566	OTTHUMG00000019658	ENST00000357374.2:c.528G>T	9.37:g.21206569C>A		Somatic	0	62	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	123	9.56	Q5VV13	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Interferon_alpha/beta/delta,superfamily_4_helix_cytokine-like_core,smart_Interferon_alpha/beta/delta,prints_Interferon_alpha/beta/delta	p.S176	ENST00000357374.2	37	c.528	CCDS6499.1	9																																																																																			-	pfam_Interferon_alpha/beta/delta,superfamily_4_helix_cytokine-like_core		0.383	IFNA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFNA10	protein_coding	OTTHUMT00000051887.1	C	NM_002171	rs148033880		21206569	-1	no_errors	ENST00000357374	ensembl	human	known	74_37	silent	SNP	0.000	A
CCDC151	115948	genome.wustl.edu	37	19	11534640	11534640	+	Missense_Mutation	SNP	G	G	A			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr19:11534640G>A	ENST00000356392.4	-	8	1109	c.1022C>T	c.(1021-1023)gCc>gTc	p.A341V	CCDC151_ENST00000586836.1_Missense_Mutation_p.A150V|CCDC151_ENST00000545100.1_Missense_Mutation_p.A287V|CCDC151_ENST00000591179.1_Missense_Mutation_p.A281V	NM_145045.4	NP_659482.3	A5D8V7	CC151_HUMAN	coiled-coil domain containing 151	341										endometrium(2)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)	12						CTCCTCCTTGGCATGCAGGCT	0.622																																																	0								ENSG00000198003						117.0	128.0	124.0					19																	11534640		2178	4265	6443	CCDC151	SO:0001583	missense	0			-	HGNC		CCDS42501.1	19p13.2	2014-02-20				ENSG00000198003			28303	protein-coding gene	gene with protein product		615956				24067530	Standard	NM_145045		Approved	MGC20983	uc002mrs.3	A5D8V7		ENST00000356392.4:c.1022C>T	19.37:g.11534640G>A	ENSP00000348757:p.Ala341Val	Somatic	0	32	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	39	9.30	B4DXT0|Q96CG5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.A341V	ENST00000356392.4	37	c.1022	CCDS42501.1	19	.	.	.	.	.	.	.	.	.	.	G	13.00	2.105705	0.37145	.	.	ENSG00000198003	ENST00000545100;ENST00000356392;ENST00000543934	D;D	0.83506	-1.73;-1.73	4.13	0.315	0.15852	.	0.997587	0.08108	N	0.996655	T	0.67813	0.2933	N	0.19112	0.55	0.09310	N	1	B;B;B	0.14438	0.01;0.01;0.01	B;B;B	0.14578	0.011;0.006;0.006	T	0.50874	-0.8776	10	0.29301	T	0.29	-0.6935	4.3526	0.11163	0.2045:0.0:0.565:0.2305	.	341;341;321	B3KPH7;A5D8V7;B4DG09	.;CC151_HUMAN;.	V	287;341;320	ENSP00000442987:A287V;ENSP00000348757:A341V	ENSP00000348757:A341V	A	-	2	0	CCDC151	11395640	0.878000	0.30173	0.035000	0.18076	0.639000	0.38242	1.328000	0.33758	-0.057000	0.13199	0.491000	0.48974	GCC	-	NULL		0.622	CCDC151-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC151	protein_coding	OTTHUMT00000458800.1	G	NM_145045	-		11534640	-1	no_errors	ENST00000356392	ensembl	human	known	74_37	missense	SNP	0.001	A
KIF15	56992	genome.wustl.edu	37	3	44879780	44879780	+	Missense_Mutation	SNP	G	G	A			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr3:44879780G>A	ENST00000326047.4	+	27	3334	c.3185G>A	c.(3184-3186)tGt>tAt	p.C1062Y	KIF15_ENST00000425755.1_Missense_Mutation_p.C697Y	NM_020242.2	NP_064627.1	Q9NS87	KIF15_HUMAN	kinesin family member 15	1062					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic nuclear division (GO:0007067)	centrosome (GO:0005813)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|plus-end kinesin complex (GO:0005873)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|liver(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(5)	36				BRCA - Breast invasive adenocarcinoma(193;0.0099)|KIRC - Kidney renal clear cell carcinoma(197;0.0564)|Kidney(197;0.0707)		GATATGCTCTGTGAGGACCTG	0.453																																																	0								ENSG00000163808						61.0	63.0	62.0					3																	44879780		2203	4300	6503	KIF15	SO:0001583	missense	0			-	HGNC	AB035898	CCDS33744.1	3p21.31	2008-03-03	2005-03-15	2005-03-17	ENSG00000163808	ENSG00000163808		"""Kinesins"""	17273	protein-coding gene	gene with protein product			"""kinesin-like 7"""	KNSL7		10878014	Standard	NM_020242		Approved	HKLP2, NY-BR-62	uc003cnx.4	Q9NS87	OTTHUMG00000156307	ENST00000326047.4:c.3185G>A	3.37:g.44879780G>A	ENSP00000324020:p.Cys1062Tyr	Somatic	0	21	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	8	27.27	Q17RV9|Q69YL6|Q96JX7|Q9H280	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.C1062Y	ENST00000326047.4	37	c.3185	CCDS33744.1	3	.	.	.	.	.	.	.	.	.	.	G	15.34	2.804402	0.50315	.	.	ENSG00000163808	ENST00000326047;ENST00000396031;ENST00000425755	T;T	0.41065	1.01;1.01	5.26	5.26	0.73747	.	0.000000	0.56097	D	0.000028	T	0.34077	0.0885	L	0.27053	0.805	0.42222	D	0.991856	P	0.45348	0.856	B	0.42798	0.398	T	0.21211	-1.0252	10	0.59425	D	0.04	.	13.3018	0.60330	0.0:0.1587:0.8413:0.0	.	1062	Q9NS87	KIF15_HUMAN	Y	1062;1061;697	ENSP00000324020:C1062Y;ENSP00000389982:C697Y	ENSP00000324020:C1062Y	C	+	2	0	KIF15	44854784	0.999000	0.42202	1.000000	0.80357	0.998000	0.95712	1.580000	0.36547	2.450000	0.82876	0.650000	0.86243	TGT	-	NULL		0.453	KIF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF15	protein_coding	OTTHUMT00000343831.2	G		-		44879780	+1	no_errors	ENST00000326047	ensembl	human	known	74_37	missense	SNP	1.000	A
NWD1	284434	genome.wustl.edu	37	19	16918668	16918668	+	Silent	SNP	C	C	T	rs376902807		TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr19:16918668C>T	ENST00000552788.1	+	16	4008	c.4008C>T	c.(4006-4008)atC>atT	p.I1336I	NWD1_ENST00000549814.1_Silent_p.I1294I|NWD1_ENST00000524140.2_Silent_p.I1336I|NWD1_ENST00000523826.1_Silent_p.I1130I|NWD1_ENST00000339803.6_Silent_p.I1201I|NWD1_ENST00000379808.3_Silent_p.I1336I			Q149M9	NWD1_HUMAN	NACHT and WD repeat domain containing 1	1336							ATP binding (GO:0005524)			NS(3)|breast(2)|cervix(1)|endometrium(8)|large_intestine(17)|lung(18)|ovary(2)|pancreas(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						GCCCGGTCATCGATGGGCCAA	0.607													C|||	1	0.000199681	0.0	0.0014	5008	,	,		19202	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000188039	C		0,4406		0,0,2203	109.0	94.0	99.0		4008	-2.3	0.0	19		99	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	NWD1	NM_001007525.3		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		1336/1433	16918668	1,13005	2203	4300	6503	NWD1	SO:0001819	synonymous_variant	0			-	HGNC	BX648940	CCDS32945.1, CCDS32945.2	19p13.11	2013-01-09				ENSG00000188039		"""WD repeat domain containing"""	27619	protein-coding gene	gene with protein product							Standard	NM_001007525		Approved		uc002neu.4	Q149M9		ENST00000552788.1:c.4008C>T	19.37:g.16918668C>T		Somatic	0	26	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	38	26.92	C9J021|Q68CT3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_P-loop_NTPase,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.I1336	ENST00000552788.1	37	c.4008		19																																																																																			-	superfamily_WD40_repeat_dom		0.607	NWD1-005	NOVEL	basic|appris_candidate_longest	protein_coding	NWD1	protein_coding	OTTHUMT00000403569.1	C	NM_001007525	-		16918668	+1	no_errors	ENST00000379808	ensembl	human	known	74_37	silent	SNP	0.088	T
GIMAP8	155038	genome.wustl.edu	37	7	150174540	150174540	+	Missense_Mutation	SNP	C	C	T	rs148200096	byFrequency	TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr7:150174540C>T	ENST00000307271.3	+	5	2244	c.1670C>T	c.(1669-1671)aCg>aTg	p.T557M		NM_175571.2	NP_783161.1	Q8ND71	GIMA8_HUMAN	GTPase, IMAP family member 8	557	AIG1-type G 3.					cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	GTP binding (GO:0005525)	p.T557R(1)		breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(11)|lung(26)|ovary(2)|skin(7)|stomach(1)|urinary_tract(1)	62			OV - Ovarian serous cystadenocarcinoma(82;0.0218)	UCEC - Uterine corpus endometrioid carcinoma (81;0.17)		GCAGACTTTACGAAATACGCG	0.498																																																	1	Substitution - Missense(1)	lung(1)						ENSG00000171115						90.0	90.0	90.0					7																	150174540		2203	4300	6503	GIMAP8	SO:0001583	missense	0			-	HGNC	AL834361	CCDS34777.1	7q36.1	2014-04-04			ENSG00000171115	ENSG00000171115		"""GTPases, IMAP"""	21792	protein-coding gene	gene with protein product	"""immune-associated nucleotide-binding protein 9"""					15474311	Standard	XM_005249951		Approved	DKFZp667I133, hIAN6, IAN9	uc003whj.3	Q8ND71	OTTHUMG00000158327	ENST00000307271.3:c.1670C>T	7.37:g.150174540C>T	ENSP00000305107:p.Thr557Met	Somatic	0	34	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	14	57.58		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_AIG1,superfamily_P-loop_NTPase	p.T557M	ENST00000307271.3	37	c.1670	CCDS34777.1	7	.	.	.	.	.	.	.	.	.	.	C	0.018	-1.485511	0.01027	.	.	ENSG00000171115	ENST00000307271	T	0.05199	3.48	4.44	0.229	0.15368	AIG1 (1);	1.090880	0.07111	N	0.842194	T	0.01287	0.0042	N	0.00337	-1.62	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.46119	-0.9214	10	0.02654	T	1	.	2.8718	0.05619	0.2307:0.2112:0.0:0.5581	.	557	Q8ND71	GIMA8_HUMAN	M	557	ENSP00000305107:T557M	ENSP00000305107:T557M	T	+	2	0	GIMAP8	149805473	0.000000	0.05858	0.001000	0.08648	0.000000	0.00434	-0.601000	0.05687	0.151000	0.19162	-0.294000	0.09567	ACG	-	pfam_AIG1,superfamily_P-loop_NTPase		0.498	GIMAP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GIMAP8	protein_coding	OTTHUMT00000350701.1	C	NM_175571	-		150174540	+1	no_errors	ENST00000307271	ensembl	human	known	74_37	missense	SNP	0.000	T
RAP1A	5906	genome.wustl.edu	37	1	112240076	112240076	+	Missense_Mutation	SNP	A	A	C			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr1:112240076A>C	ENST00000369709.3	+	4	319	c.140A>C	c.(139-141)gAt>gCt	p.D47A	RAP1A_ENST00000436150.2_Missense_Mutation_p.D47A|RAP1A_ENST00000494982.1_3'UTR|RAP1A_ENST00000356415.1_Missense_Mutation_p.D47A|RAP1A_ENST00000545460.1_Missense_Mutation_p.D47A	NM_002884.2	NP_002875.1	P62834	RAP1A_HUMAN	RAP1A, member of RAS oncogene family	47					activation of MAPKK activity (GO:0000186)|blood coagulation (GO:0007596)|cellular response to cAMP (GO:0071320)|cellular response to nerve growth factor stimulus (GO:1990090)|energy reserve metabolic process (GO:0006112)|establishment of endothelial barrier (GO:0061028)|negative regulation of synaptic vesicle exocytosis (GO:2000301)|nerve growth factor signaling pathway (GO:0038180)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of Rap GTPase activity (GO:0032854)|positive regulation of vasculogenesis (GO:2001214)|protein transport (GO:0015031)|Rap protein signal transduction (GO:0032486)|regulation of cell junction assembly (GO:1901888)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|guanyl-nucleotide exchange factor complex (GO:0032045)|late endosome (GO:0005770)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|protein complex binding (GO:0032403)|protein transporter activity (GO:0008565)|Rap guanyl-nucleotide exchange factor activity (GO:0017034)			endometrium(1)|large_intestine(2)|lung(3)	6		all_cancers(81;6.79e-06)|all_epithelial(167;2.42e-05)|all_lung(203;0.000105)|Lung NSC(277;0.00021)		Lung(183;0.0183)|Colorectal(144;0.0418)|LUSC - Lung squamous cell carcinoma(189;0.0966)|all cancers(265;0.098)|Epithelial(280;0.0981)|COAD - Colon adenocarcinoma(174;0.141)		GTTGAAGTCGATTGCCAACAG	0.368																																																	0								ENSG00000116473						161.0	165.0	164.0					1																	112240076		2203	4300	6503	RAP1A	SO:0001583	missense	0			-	HGNC	BC014086	CCDS840.1	1p13.3	2014-05-09			ENSG00000116473	ENSG00000116473			9855	protein-coding gene	gene with protein product		179520				3143720	Standard	XM_006710803		Approved	KREV-1, SMGP21	uc001ebl.3	P62834	OTTHUMG00000011959	ENST00000369709.3:c.140A>C	1.37:g.112240076A>C	ENSP00000358723:p.Asp47Ala	Somatic	0	26	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	31	29.55	P10113	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_EF_GTP-bd_dom,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.D47A	ENST00000369709.3	37	c.140	CCDS840.1	1	.	.	.	.	.	.	.	.	.	.	A	19.38	3.817153	0.70912	.	.	ENSG00000116473	ENST00000356415;ENST00000433097;ENST00000369709;ENST00000436150;ENST00000545460	T;T;T;T;T	0.73047	-0.71;-0.71;-0.71;-0.71;-0.71	5.33	5.33	0.75918	Small GTP-binding protein domain (1);	0.049050	0.85682	D	0.000000	T	0.71298	0.3323	M	0.88181	2.935	0.80722	D	1	B	0.23377	0.084	B	0.32465	0.146	T	0.75972	-0.3129	10	0.87932	D	0	.	15.2735	0.73723	1.0:0.0:0.0:0.0	.	47	P62834	RAP1A_HUMAN	A	47	ENSP00000348786:D47A;ENSP00000396741:D47A;ENSP00000358723:D47A;ENSP00000394318:D47A;ENSP00000443009:D47A	ENSP00000348786:D47A	D	+	2	0	RAP1A	112041599	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.962000	0.93254	2.143000	0.66587	0.528000	0.53228	GAT	-	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_EF_GTP-bd_dom,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom		0.368	RAP1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAP1A	protein_coding	OTTHUMT00000033071.1	A	NM_002884	-		112240076	+1	no_errors	ENST00000356415	ensembl	human	known	74_37	missense	SNP	1.000	C
ITGA4	3676	genome.wustl.edu	37	2	182339711	182339711	+	Missense_Mutation	SNP	G	G	T			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr2:182339711G>T	ENST00000397033.2	+	3	774	c.344G>T	c.(343-345)gGa>gTa	p.G115V	ITGA4_ENST00000478440.1_3'UTR|ITGA4_ENST00000339307.4_Missense_Mutation_p.G115V	NM_000885.4	NP_000876.3	P13612	ITA4_HUMAN	integrin, alpha 4 (antigen CD49D, alpha 4 subunit of VLA-4 receptor)	115					B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|blood vessel remodeling (GO:0001974)|cell-matrix adhesion (GO:0007160)|cell-matrix adhesion involved in ameboidal cell migration (GO:0003366)|chorio-allantoic fusion (GO:0060710)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|face development (GO:0060324)|heart development (GO:0007507)|heterophilic cell-cell adhesion (GO:0007157)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|negative regulation of protein homodimerization activity (GO:0090074)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|substrate adhesion-dependent cell spreading (GO:0034446)|T cell migration (GO:0072678)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integrin alpha4-beta7 complex (GO:0034669)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(27)|ovary(3)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	58			OV - Ovarian serous cystadenocarcinoma(117;0.0593)		Natalizumab(DB00108)|Tinzaparin(DB06822)	GAACCTTGTGGAAAGACTTGT	0.413																																																	0								ENSG00000115232						99.0	95.0	96.0					2																	182339711		1870	4106	5976	ITGA4	SO:0001583	missense	0			-	HGNC		CCDS42788.1	2q31-q32	2010-03-23			ENSG00000115232	ENSG00000115232		"""CD molecules"", ""Integrins"""	6140	protein-coding gene	gene with protein product		192975		CD49D		1537388	Standard	NM_000885		Approved	CD49d	uc002unu.3	P13612	OTTHUMG00000154212	ENST00000397033.2:c.344G>T	2.37:g.182339711G>T	ENSP00000380227:p.Gly115Val	Somatic	0	31	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	31	40.38	D3DPG4|Q7Z4L6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Integrin_alpha-2,pfam_FG-GAP,smart_Int_alpha_beta-p,prints_Integrin_alpha	p.G115V	ENST00000397033.2	37	c.344	CCDS42788.1	2	.	.	.	.	.	.	.	.	.	.	G	26.1	4.706244	0.89018	.	.	ENSG00000115232	ENST00000425522;ENST00000339307;ENST00000397033;ENST00000233573	T;T;T	0.57107	0.42;0.42;0.42	5.28	5.28	0.74379	.	0.051361	0.85682	D	0.000000	T	0.73202	0.3557	M	0.82823	2.61	0.80722	D	1	D;D	0.64830	0.994;0.993	P;P	0.59825	0.831;0.864	T	0.77566	-0.2540	10	0.72032	D	0.01	.	19.2608	0.93967	0.0:0.0:1.0:0.0	.	115;115	E7EP60;P13612	.;ITA4_HUMAN	V	115	ENSP00000340149:G115V;ENSP00000380227:G115V;ENSP00000233573:G115V	ENSP00000233573:G115V	G	+	2	0	ITGA4	182047956	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.610000	0.90902	2.623000	0.88846	0.655000	0.94253	GGA	-	NULL		0.413	ITGA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGA4	protein_coding	OTTHUMT00000334427.1	G		-		182339711	+1	no_errors	ENST00000397033	ensembl	human	known	74_37	missense	SNP	1.000	T
INTS10	55174	genome.wustl.edu	37	8	19694611	19694611	+	Missense_Mutation	SNP	A	A	T			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr8:19694611A>T	ENST00000397977.3	+	13	1977	c.1579A>T	c.(1579-1581)Att>Ttt	p.I527F		NM_018142.2	NP_060612.2	Q9NVR2	INT10_HUMAN	integrator complex subunit 10	527					snRNA processing (GO:0016180)	integrator complex (GO:0032039)				breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(2)|prostate(1)|urinary_tract(1)	20				Colorectal(111;0.057)|COAD - Colon adenocarcinoma(73;0.215)		GGTACTCCCCATTCAAGATGG	0.373																																																	0								ENSG00000104613						118.0	114.0	115.0					8																	19694611		1865	4099	5964	INTS10	SO:0001583	missense	0			-	HGNC	AK001431	CCDS6011.2	8p21.3	2006-04-26	2006-03-15	2006-03-15	ENSG00000104613	ENSG00000104613			25548	protein-coding gene	gene with protein product		611353	"""chromosome 8 open reading frame 35"""	C8orf35		16239144	Standard	XM_005273558		Approved	FLJ10569, INT10	uc003wzj.3	Q9NVR2	OTTHUMG00000131065	ENST00000397977.3:c.1579A>T	8.37:g.19694611A>T	ENSP00000381064:p.Ile527Phe	Somatic	0	29	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	20	16.00	Q6IA93|Q7L538|Q7L8C8|Q9H3W8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.I527F	ENST00000397977.3	37	c.1579	CCDS6011.2	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	8.557|8.557	0.876979|0.876979	0.17395|0.17395	.|.	.|.	ENSG00000104613|ENSG00000104613	ENST00000518799|ENST00000397977	.|.	.|.	.|.	5.54|5.54	0.159|0.159	0.14968|0.14968	.|.	.|0.423268	.|0.28448	.|N	.|0.015304	T|T	0.20495|0.20495	0.0493|0.0493	N|N	0.08118|0.08118	0|0	0.33043|0.33043	D|D	0.531796|0.531796	.|B	.|0.02656	.|0.0	.|B	.|0.04013	.|0.001	T|T	0.04360|0.04360	-1.0957|-1.0957	5|9	.|0.37606	.|T	.|0.19	-4.0617|-4.0617	3.2721|3.2721	0.06886|0.06886	0.5089:0.0:0.2232:0.2679|0.5089:0.0:0.2232:0.2679	.|.	.|527	.|Q9NVR2	.|INT10_HUMAN	L|F	109|527	.|.	.|ENSP00000381064:I527F	H|I	+|+	2|1	0|0	INTS10|INTS10	19738891|19738891	0.980000|0.980000	0.34600|0.34600	0.990000|0.990000	0.47175|0.47175	0.957000|0.957000	0.61999|0.61999	2.248000|2.248000	0.43160|0.43160	0.076000|0.076000	0.16826|0.16826	0.533000|0.533000	0.62120|0.62120	CAT|ATT	-	NULL		0.373	INTS10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INTS10	protein_coding	OTTHUMT00000253724.2	A	NM_018142	-		19694611	+1	no_errors	ENST00000397977	ensembl	human	known	74_37	missense	SNP	0.991	T
SLC25A25	114789	genome.wustl.edu	37	9	130871537	130871537	+	IGR	SNP	T	T	A			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr9:130871537T>A	ENST00000373064.5	+	0	3474				RP11-395P17.11_ENST00000602939.1_RNA|RP11-395P17.3_ENST00000418747.1_RNA	NM_052901.4	NP_443133.2	Q6KCM7	SCMC2_HUMAN	solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 25						adipose tissue development (GO:0060612)|ATP metabolic process (GO:0046034)|calcium ion transmembrane transport (GO:0070588)|camera-type eye development (GO:0043010)|cellular respiration (GO:0045333)|multicellular organism growth (GO:0035264)|response to activity (GO:0014823)|response to dietary excess (GO:0002021)|response to food (GO:0032094)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(3)	10						ATGGAGCCAGTATTTTTCTGA	0.478																																																	0								ENSG00000269988																																			RP11-395P17.11	SO:0001628	intergenic_variant	0			-	Clone_based_vega_gene	AJ619963	CCDS6890.1, CCDS35151.1, CCDS48031.1, CCDS59146.1	9q34	2013-05-22			ENSG00000148339	ENSG00000148339		"""Solute carriers"", ""EF-hand domain containing"""	20663	protein-coding gene	gene with protein product		608745				15123600	Standard	NM_052901		Approved	KIAA1896, PCSCL, MCSC	uc004btb.4	Q6KCM7	OTTHUMG00000020736		9.37:g.130871537T>A		Somatic	0	9	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	13	23.53	Q5SYW7|Q5SYW8|Q5SYX3|Q5VWU2|Q5VWU3|Q5VWU4|Q6KCM4|Q6KCM6|Q6UX48|Q705K2|Q96PZ1|Q9BSA6	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000373064.5	37	NULL	CCDS6890.1	9																																																																																			-	-		0.478	SLC25A25-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000269988	protein_coding	OTTHUMT00000054407.1	T	NM_052901	-		130871537	-1	no_errors	ENST00000602939	ensembl	human	known	74_37	rna	SNP	0.000	A
ATM	472	genome.wustl.edu	37	11	108164194	108164194	+	Missense_Mutation	SNP	C	C	T			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr11:108164194C>T	ENST00000452508.2	+	32	4955	c.4766C>T	c.(4765-4767)tCa>tTa	p.S1589L	ATM_ENST00000278616.4_Missense_Mutation_p.S1589L			Q13315	ATM_HUMAN	ATM serine/threonine kinase	1589					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)			NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	GGACCCTTTTCACTCTTGGAG	0.303			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																													yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	0								ENSG00000149311						85.0	97.0	93.0					11																	108164194		2200	4293	6493	ATM	SO:0001583	missense	0	Familial Cancer Database	AT, Louis-Bar syndrome	-	HGNC	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.4766C>T	11.37:g.108164194C>T	ENSP00000388058:p.Ser1589Leu	Somatic	0	27	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	76	20	79.17	B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,pfam_TAN,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.S1589L	ENST00000452508.2	37	c.4766	CCDS31669.1	11	.	.	.	.	.	.	.	.	.	.	C	18.38	3.610329	0.66558	.	.	ENSG00000149311	ENST00000278616;ENST00000452508	T;T	0.72051	-0.62;-0.62	5.31	4.4	0.53042	Armadillo-type fold (1);	0.231260	0.45126	N	0.000394	T	0.68091	0.2963	M	0.63428	1.95	0.37750	D	0.925958	B	0.30021	0.265	B	0.31245	0.126	T	0.70178	-0.4943	10	0.39692	T	0.17	.	14.001	0.64433	0.0:0.9268:0.0:0.0732	.	1589	Q13315	ATM_HUMAN	L	1589	ENSP00000278616:S1589L;ENSP00000388058:S1589L	ENSP00000278616:S1589L	S	+	2	0	ATM	107669404	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.937000	0.56575	1.367000	0.46095	0.655000	0.94253	TCA	-	superfamily_ARM-type_fold		0.303	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ATM	protein_coding	OTTHUMT00000389938.1	C	NM_000051	-		108164194	+1	no_errors	ENST00000278616	ensembl	human	known	74_37	missense	SNP	1.000	T
POTEM	641455	genome.wustl.edu	37	14	20012850	20012850	+	Intron	SNP	A	A	T	rs201036322		TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr14:20012850A>T	ENST00000551509.1	-	4	862				RP11-244H18.1_ENST00000547584.1_lincRNA	NM_001145442.1	NP_001138914.1	A6NI47	POTEM_HUMAN	POTE ankyrin domain family, member M											endometrium(4)|kidney(1)|lung(4)	9						actgaggttgaggttggagga	0.398																																																	0								ENSG00000187537																																			POTEM	SO:0001627	intron_variant	0			-	HGNC		CCDS73609.1	14q11.2	2013-01-10			ENSG00000187537	ENSG00000187537		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	37096	protein-coding gene	gene with protein product	"""prostate-specific P704P"""					16364570	Standard	NM_001145442		Approved	POTE14beta, P704P, ACT	uc001vwc.3	A6NI47		ENST00000551509.1:c.811-1193T>A	14.37:g.20012850A>T		Somatic	0	12	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	34	25.53		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.P302	ENST00000551509.1	37	c.906	CCDS45076.1	14																																																																																			-	NULL		0.398	POTEM-001	NOVEL	basic|appris_principal|CCDS	protein_coding	POTEM	protein_coding	OTTHUMT00000409490.3	A	NM_001145442	rs201036322		20012850	-1	no_errors	ENST00000547722	ensembl	human	known	74_37	silent	SNP	0.030	T
MMRN1	22915	genome.wustl.edu	37	4	90830469	90830469	+	Silent	SNP	G	G	T			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr4:90830469G>T	ENST00000394980.1	+	3	985	c.666G>T	c.(664-666)gtG>gtT	p.V222V	MMRN1_ENST00000508372.1_5'UTR|MMRN1_ENST00000264790.2_Silent_p.V222V|MMRN1_ENST00000394981.1_Silent_p.V188V			Q13201	MMRN1_HUMAN	multimerin 1	222	EMI. {ECO:0000255|PROSITE- ProRule:PRU00384}.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|platelet alpha granule lumen (GO:0031093)				breast(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(12)|liver(2)|lung(34)|ovary(5)|prostate(1)|skin(6)|stomach(1)|urinary_tract(2)	72		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;6.96e-05)		CTCCCACAGTGATATTGGACA	0.398																																																	0								ENSG00000138722						123.0	114.0	117.0					4																	90830469		2203	4299	6502	MMRN1	SO:0001819	synonymous_variant	0			-	HGNC	U27109	CCDS3635.1	4q22	2008-02-05	2004-03-02	2004-03-02	ENSG00000138722	ENSG00000138722		"""EMI domain containing"""	7178	protein-coding gene	gene with protein product	"""glycoprotein Ia*"""	601456	"""multimerin"""	MMRN		7629143, 10828608	Standard	NM_007351		Approved	ECM, EMILIN4, GPIa*	uc003hst.3	Q13201	OTTHUMG00000130947	ENST00000394980.1:c.666G>T	4.37:g.90830469G>T		Somatic	0	38	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51	Q4W5L1|Q6P3T8|Q6ZUL9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_C1q,pfam_EMI_domain,pfam_EG-like_dom,superfamily_Tumour_necrosis_fac-like_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_C1q,prints_C1q,pfscan_C1q,pfscan_EG-like_dom,pfscan_EMI_domain	p.V222	ENST00000394980.1	37	c.666	CCDS3635.1	4																																																																																			-	pfam_EMI_domain,pfscan_EMI_domain		0.398	MMRN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMRN1	protein_coding	OTTHUMT00000253546.2	G	NM_007351	-		90830469	+1	no_errors	ENST00000264790	ensembl	human	known	74_37	silent	SNP	0.764	T
TUBA4B	80086	genome.wustl.edu	37	2	220136525	220136525	+	RNA	SNP	G	G	T			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr2:220136525G>T	ENST00000490341.1	+	0	995					NR_003063.1		Q9H853	TBA4B_HUMAN	tubulin, alpha 4b (pseudogene)						microtubule-based process (GO:0007017)	cytoplasm (GO:0005737)|microtubule (GO:0005874)	GTP binding (GO:0005525)|structural constituent of cytoskeleton (GO:0005200)										TCAAGACCAAGTGCAGCATTC	0.552																																																	0								ENSG00000243910																																			TUBA4B			0			-	HGNC	AK024002		2q35	2014-03-20	2007-03-16	2007-02-12	ENSG00000243910	ENSG00000243910		"""Tubulins"""	18637	pseudogene	pseudogene			"""tubulin, alpha 4"", ""tubulin, alpha 4b"""	TUBA4		3785200	Standard	NR_003063		Approved	FLJ13940	uc002vkv.1	Q9H853	OTTHUMG00000154516		2.37:g.220136525G>T		Somatic	0	46	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	28	28.21		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000490341.1	37	NULL		2																																																																																			-	-		0.552	TUBA4B-001	KNOWN	basic	processed_transcript	TUBA4B	pseudogene	OTTHUMT00000335637.1	G	NR_003063	-		220136525	+1	no_errors	ENST00000473885	ensembl	human	known	74_37	rna	SNP	1.000	T
UBQLN2	29978	genome.wustl.edu	37	X	56590841	56590841	+	Missense_Mutation	SNP	C	C	A			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chrX:56590841C>A	ENST00000338222.5	+	1	816	c.535C>A	c.(535-537)Cct>Act	p.P179T		NM_013444.3	NP_038472.2	Q9UHD9	UBQL2_HUMAN	ubiquilin 2	179					cell death (GO:0008219)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(2)|endometrium(3)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(1)	21						TATGGCCAGCCCTGAGATGAT	0.527																																					Esophageal Squamous(104;218 1492 6022 10838 28884)												0								ENSG00000188021						67.0	67.0	67.0					X																	56590841		2203	4300	6503	UBQLN2	SO:0001583	missense	0			-	HGNC	AF189009	CCDS14374.1	Xp11.21	2014-09-17			ENSG00000188021	ENSG00000188021		"""Ubiquilin family"""	12509	protein-coding gene	gene with protein product	"""NEDD4 binding protein 4"""	300264				10675567	Standard	NM_013444		Approved	Chap1, Dsk2, RIHFB2157, LIC-2, CHAP1/DSK2, PLIC-2, N4BP4, PLIC2	uc004dus.3	Q9UHD9	OTTHUMG00000021669	ENST00000338222.5:c.535C>A	X.37:g.56590841C>A	ENSP00000345195:p.Pro179Thr	Somatic	0	20	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	6	66.67	O94798|Q5D027|Q9H3W6|Q9HAZ4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ubiquitin_dom,pfam_Rad60/SUMO_like,pfam_UBA/Ts_N,superfamily_UBA-like,superfamily_ARM-type_fold,superfamily_XPC-bd,smart_Ubiquitin_dom,smart_STI1_HS-bd,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Ubiquitin_supergroup	p.P179T	ENST00000338222.5	37	c.535	CCDS14374.1	X	.	.	.	.	.	.	.	.	.	.	C	12.78	2.039889	0.35989	.	.	ENSG00000188021	ENST00000338222;ENST00000535171	D	0.84800	-1.9	4.79	4.79	0.61399	Heat shock chaperonin-binding (1);	0.000000	0.64402	D	0.000003	D	0.92776	0.7703	M	0.87971	2.92	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.93455	0.6805	10	0.56958	D	0.05	-5.8075	14.4648	0.67477	0.0:1.0:0.0:0.0	.	179;179	B4DZF1;Q9UHD9	.;UBQL2_HUMAN	T	179	ENSP00000345195:P179T	ENSP00000345195:P179T	P	+	1	0	UBQLN2	56607566	1.000000	0.71417	1.000000	0.80357	0.113000	0.19764	7.604000	0.82830	2.384000	0.81235	0.600000	0.82982	CCT	-	smart_STI1_HS-bd		0.527	UBQLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBQLN2	protein_coding	OTTHUMT00000056891.1	C	NM_013444	-		56590841	+1	no_errors	ENST00000338222	ensembl	human	known	74_37	missense	SNP	1.000	A
H6PD	9563	genome.wustl.edu	37	1	9324533	9324533	+	Missense_Mutation	SNP	C	C	T			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr1:9324533C>T	ENST00000377403.2	+	5	2283	c.1981C>T	c.(1981-1983)Cgg>Tgg	p.R661W	H6PD_ENST00000602477.1_Missense_Mutation_p.R672W	NM_001282587.1|NM_004285.3	NP_001269516.1|NP_004276.2	O95479	G6PE_HUMAN	hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase)	661	6-phosphogluconolactonase.				pentose-phosphate shunt (GO:0006098)|response to alcohol (GO:0097305)	endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)	6-phosphogluconolactonase activity (GO:0017057)|carbohydrate binding (GO:0030246)|glucose 1-dehydrogenase [NAD(P)] activity (GO:0047936)|glucose-6-phosphate dehydrogenase activity (GO:0004345)|NADP binding (GO:0050661)			breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)|upper_aerodigestive_tract(1)	23	all_lung(157;0.23)	all_epithelial(116;1.28e-19)|all_lung(118;5.22e-06)|Lung NSC(185;1.98e-05)|Renal(390;0.000147)|Breast(348;0.00109)|Colorectal(325;0.00205)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;1.88e-07)|COAD - Colon adenocarcinoma(227;7.47e-05)|Kidney(185;0.000244)|KIRC - Kidney renal clear cell carcinoma(229;0.000905)|STAD - Stomach adenocarcinoma(132;0.00176)|BRCA - Breast invasive adenocarcinoma(304;0.00183)|READ - Rectum adenocarcinoma(331;0.0419)		CCTGCAGCAGCGGCTCTGCGC	0.657																																																	0								ENSG00000049239						48.0	51.0	50.0					1																	9324533		2203	4296	6499	H6PD	SO:0001583	missense	0			-	HGNC	AJ012590	CCDS101.1, CCDS72697.1	1p36	2008-02-05	2003-10-10		ENSG00000049239	ENSG00000049239	1.1.1.47		4795	protein-coding gene	gene with protein product		138090	"""glucose dehyrogenase"""	GDH		10349511	Standard	NM_001282587		Approved		uc001apt.3	O95479	OTTHUMG00000001768	ENST00000377403.2:c.1981C>T	1.37:g.9324533C>T	ENSP00000366620:p.Arg661Trp	Somatic	0	29	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	23	25.81	Q4TT33|Q66I35|Q68DT3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_G6P_DH_C,pfam_G6P_DH_NAD-bd,prints_G6P_DH,tigrfam_6-phosphogluconolactonase_DevB	p.R661W	ENST00000377403.2	37	c.1981	CCDS101.1	1	.	.	.	.	.	.	.	.	.	.	C	17.53	3.413668	0.62511	.	.	ENSG00000049239	ENST00000377403	D	0.98362	-4.89	5.72	1.16	0.20824	Glucosamine/galactosamine-6-phosphate isomerase (1);6-phosphogluconolactonase, DevB-type (1);	0.053786	0.64402	D	0.000001	D	0.97835	0.9289	M	0.66939	2.045	0.58432	D	0.999993	D	0.76494	0.999	D	0.63033	0.91	D	0.96214	0.9155	10	0.72032	D	0.01	-35.2963	5.8458	0.18665	0.3298:0.4973:0.1031:0.0699	.	661	O95479	G6PE_HUMAN	W	661	ENSP00000366620:R661W	ENSP00000366620:R661W	R	+	1	2	H6PD	9247120	1.000000	0.71417	0.996000	0.52242	0.977000	0.68977	1.675000	0.37555	0.330000	0.23485	0.561000	0.74099	CGG	-	tigrfam_6-phosphogluconolactonase_DevB		0.657	H6PD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	H6PD	protein_coding	OTTHUMT00000004928.2	C	NM_004285	-		9324533	+1	no_errors	ENST00000377403	ensembl	human	known	74_37	missense	SNP	1.000	T
TIAM1	7074	genome.wustl.edu	37	21	32598231	32598231	+	Silent	SNP	G	G	A	rs143707356	byFrequency	TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr21:32598231G>A	ENST00000286827.3	-	8	2091	c.1620C>T	c.(1618-1620)acC>acT	p.T540T	TIAM1_ENST00000541036.1_Silent_p.T540T|TIAM1_ENST00000469412.1_5'UTR	NM_003253.2	NP_003244.2	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1	540	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				apoptotic signaling pathway (GO:0097190)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|ephrin receptor signaling pathway (GO:0048013)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell contact zone (GO:0044291)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)	phospholipid binding (GO:0005543)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			autonomic_ganglia(3)|breast(7)|central_nervous_system(2)|endometrium(13)|kidney(4)|large_intestine(33)|lung(44)|ovary(2)|prostate(3)|skin(2)|urinary_tract(2)	115						AGTGGATGGCGGTGATCCAGT	0.527																																																	0								ENSG00000156299	G		8,4398	14.3+/-33.2	0,8,2195	82.0	80.0	81.0		1620	-4.0	1.0	21	dbSNP_134	81	0,8600		0,0,4300	no	coding-synonymous	TIAM1	NM_003253.2		0,8,6495	AA,AG,GG		0.0,0.1816,0.0615		540/1592	32598231	8,12998	2203	4300	6503	TIAM1	SO:0001819	synonymous_variant	0			-	HGNC		CCDS13609.1	21q22.1	2013-01-10			ENSG00000156299	ENSG00000156299		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11805	protein-coding gene	gene with protein product		600687				8595894, 15340013	Standard	NM_003253		Approved		uc002yow.1	Q13009	OTTHUMG00000084869	ENST00000286827.3:c.1620C>T	21.37:g.32598231G>A		Somatic	0	22	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	0	100.00	B7ZLR6|F5GZ53|Q17RT7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_DH-domain,pfam_Pleckstrin_homology,pfam_Raf-like_ras-bd,pfam_PDZ,superfamily_DH-domain,superfamily_PDZ,smart_Pleckstrin_homology,smart_Raf-like_ras-bd,smart_PDZ,smart_DH-domain,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_Raf-like_ras-bd,pfscan_DH-domain	p.T540	ENST00000286827.3	37	c.1620	CCDS13609.1	21																																																																																			-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology		0.527	TIAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIAM1	protein_coding	OTTHUMT00000192552.1	G	NM_003253	rs143707356		32598231	-1	no_errors	ENST00000286827	ensembl	human	known	74_37	silent	SNP	0.327	A
SNTG1	54212	genome.wustl.edu	37	8	51465635	51465635	+	Missense_Mutation	SNP	G	G	T			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr8:51465635G>T	ENST00000522124.1	+	12	1367	c.706G>T	c.(706-708)Gtg>Ttg	p.V236L	SNTG1_ENST00000517473.1_Missense_Mutation_p.V236L|SNTG1_ENST00000518864.1_Missense_Mutation_p.V236L|SNTG1_ENST00000276467.5_Missense_Mutation_p.V236L	NM_018967.2	NP_061840.1	Q9NSN8	SNTG1_HUMAN	syntrophin, gamma 1	236					cell communication (GO:0007154)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)|syntrophin complex (GO:0016013)	protein C-terminus binding (GO:0008022)			NS(1)|breast(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(36)|ovary(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	66		all_cancers(86;0.00754)|all_epithelial(80;9.76e-05)|Lung NSC(129;0.000865)|all_lung(136;0.00249)|Colorectal(162;0.22)				AGTCATTGCTGTGGATGGGGT	0.428																																																	0								ENSG00000147481						145.0	124.0	131.0					8																	51465635		2203	4300	6503	SNTG1	SO:0001583	missense	0			-	HGNC	AJ003030	CCDS6147.1, CCDS75737.1	8q11-q12	2008-07-03				ENSG00000147481			13740	protein-coding gene	gene with protein product		608714				10747910	Standard	NM_018967		Approved	SYN4, G1SYN	uc003xqs.1	Q9NSN8		ENST00000522124.1:c.706G>T	8.37:g.51465635G>T	ENSP00000429842:p.Val236Leu	Somatic	0	37	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	35	10.26	Q2M3Q0|Q9NY98	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PDZ,superfamily_PDZ,smart_PDZ,smart_Pleckstrin_homology,pfscan_PDZ,pfscan_Pleckstrin_homology	p.V236L	ENST00000522124.1	37	c.706	CCDS6147.1	8	.	.	.	.	.	.	.	.	.	.	G	6.537	0.467394	0.12402	.	.	ENSG00000147481	ENST00000518864;ENST00000522124;ENST00000517473;ENST00000276467	T;T;T;T	0.53640	0.61;0.61;0.61;0.61	5.2	5.2	0.72013	Pleckstrin homology domain (1);	0.053373	0.85682	D	0.000000	T	0.34774	0.0909	N	0.16790	0.44	0.80722	D	1	B;B	0.20550	0.005;0.046	B;B	0.14023	0.01;0.008	T	0.08722	-1.0708	10	0.35671	T	0.21	.	17.7901	0.88550	0.0:0.0:1.0:0.0	.	236;236	Q9NSN8-2;Q9NSN8	.;SNTG1_HUMAN	L	236	ENSP00000429276:V236L;ENSP00000429842:V236L;ENSP00000431123:V236L;ENSP00000276467:V236L	ENSP00000276467:V236L	V	+	1	0	SNTG1	51628188	1.000000	0.71417	0.996000	0.52242	0.932000	0.56968	6.970000	0.76099	2.437000	0.82529	0.558000	0.71614	GTG	-	smart_Pleckstrin_homology		0.428	SNTG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNTG1	protein_coding	OTTHUMT00000377964.1	G		-		51465635	+1	no_errors	ENST00000518864	ensembl	human	known	74_37	missense	SNP	1.000	T
RAD23A	5886	genome.wustl.edu	37	19	13060159	13060159	+	Missense_Mutation	SNP	G	G	C			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr19:13060159G>C	ENST00000586534.1	+	7	811	c.750G>C	c.(748-750)caG>caC	p.Q250H	RAD23A_ENST00000316856.3_Missense_Mutation_p.Q249H|RAD23A_ENST00000588826.2_3'UTR|RAD23A_ENST00000541222.1_Missense_Mutation_p.Q85H|RAD23A_ENST00000592268.1_Missense_Mutation_p.Q250H			P54725	RD23A_HUMAN	RAD23 homolog A (S. cerevisiae)	250					nucleotide-excision repair (GO:0006289)|positive regulation of viral genome replication (GO:0045070)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|proteasome complex (GO:0000502)	damaged DNA binding (GO:0003684)|polyubiquitin binding (GO:0031593)|single-stranded DNA binding (GO:0003697)|ubiquitin-specific protease binding (GO:1990381)			central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(2)|ovary(2)|prostate(1)|skin(1)	12						TGATTCAGCAGAACCCTGCGC	0.632								Nucleotide excision repair (NER)																																									0								ENSG00000179262						60.0	64.0	63.0					19																	13060159		2203	4300	6503	RAD23A	SO:0001583	missense	0			-	HGNC		CCDS12289.1, CCDS59357.1, CCDS59358.1	19p13.2	2008-07-17	2001-11-28			ENSG00000179262			9812	protein-coding gene	gene with protein product	"""RAD23, yeast homolog, A"""	600061	"""RAD23 (S. cerevisiae) homolog A"""			7851894	Standard	NM_005053		Approved	HHR23A, MGC111083	uc002mvw.2	P54725		ENST00000586534.1:c.750G>C	19.37:g.13060159G>C	ENSP00000467024:p.Gln250His	Somatic	0	32	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	40	16.67	K7ESE3|Q59EU8|Q5M7Z1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_XPC-bd,pfam_UBA/Ts_N,pfam_Ubiquitin_dom,pfam_Rad60/SUMO_like,superfamily_XPC-bd,superfamily_UBA-like,smart_Ubiquitin_dom,smart_UBA/transl_elong_EF1B_N_euk,smart_STI1_HS-bd,prints_Rad23,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Ubiquitin_supergroup,tigrfam_Rad23	p.Q250H	ENST00000586534.1	37	c.750	CCDS12289.1	19	.	.	.	.	.	.	.	.	.	.	G	15.38	2.817658	0.50633	.	.	ENSG00000179262	ENST00000316856;ENST00000541222	T	0.26223	1.75	5.03	3.97	0.46021	XPC-binding domain (3);Heat shock chaperonin-binding (1);	0.000000	0.85682	D	0.000000	T	0.58736	0.2143	M	0.93898	3.47	0.58432	D	0.99999	P;B;D	0.71674	0.95;0.059;0.998	D;B;D	0.75484	0.916;0.232;0.986	T	0.68085	-0.5502	10	0.72032	D	0.01	-22.5976	11.5358	0.50636	0.0936:0.0:0.9064:0.0	.	249;266;250	A8K1J3;Q59EU8;P54725	.;.;RD23A_HUMAN	H	250;85	ENSP00000438741:Q85H	ENSP00000321365:Q250H	Q	+	3	2	RAD23A	12921159	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	4.259000	0.58828	1.076000	0.40961	0.655000	0.94253	CAG	-	pfam_XPC-bd,superfamily_XPC-bd,smart_STI1_HS-bd,tigrfam_Rad23		0.632	RAD23A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RAD23A	protein_coding	OTTHUMT00000452752.1	G	NM_005053	-		13060159	+1	no_errors	ENST00000586534	ensembl	human	known	74_37	missense	SNP	1.000	C
DNM1P47	100216544	genome.wustl.edu	37	15	102299958	102299958	+	RNA	SNP	C	C	G			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr15:102299958C>G	ENST00000561463.1	+	0	8004									DNM1 pseudogene 47																		CTTCTCAGAGCTGCTGTCCAA	0.587																																																	0								ENSG00000259660																																			DNM1P47			0			-	HGNC	AJ576276		15q26.3	2013-04-25			ENSG00000259660	ENSG00000259660			35200	pseudogene	pseudogene				DNM1DN14@			Standard	NG_009149		Approved	DNM1DN14-3			OTTHUMG00000172265		15.37:g.102299958C>G		Somatic	0	53	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	73	8.75		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000561463.1	37	NULL		15																																																																																			-	-		0.587	DNM1P47-001	KNOWN	basic	processed_transcript	DNM1P47	pseudogene	OTTHUMT00000417589.1	C	NG_009149	-		102299958	+1	no_errors	ENST00000561463	ensembl	human	known	74_37	rna	SNP	0.996	G
KIF21B	23046	genome.wustl.edu	37	1	200956187	200956187	+	Missense_Mutation	SNP	C	C	T	rs371053876		TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr1:200956187C>T	ENST00000422435.2	-	25	3867	c.3551G>A	c.(3550-3552)cGa>cAa	p.R1184Q	KIF21B_ENST00000461742.2_Missense_Mutation_p.R1184Q|KIF21B_ENST00000360529.5_Missense_Mutation_p.R1184Q|KIF21B_ENST00000332129.2_Missense_Mutation_p.R1184Q	NM_001252100.1	NP_001239029.1	O75037	KI21B_HUMAN	kinesin family member 21B	1184					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(4)|large_intestine(8)|liver(1)|lung(27)|ovary(3)|pancreas(1)|prostate(5)|skin(8)|stomach(2)|urinary_tract(2)	83						ATAGGGGTCTCGGACAGAGAA	0.602													C|||	1	0.000199681	0.0	0.0	5008	,	,		17308	0.0		0.0	False		,,,				2504	0.001																0								ENSG00000116852	C	GLN/ARG	1,4405	2.1+/-5.4	0,1,2202	94.0	96.0	95.0		3551	5.2	0.9	1		95	0,8600		0,0,4300	no	missense	KIF21B	NM_017596.2	43	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	1184/1625	200956187	1,13005	2203	4300	6503	KIF21B	SO:0001583	missense	0			-	HGNC	BC031927	CCDS30965.1, CCDS58054.1, CCDS58055.1, CCDS58056.1	1q32.1	2013-01-10			ENSG00000116852	ENSG00000116852		"""Kinesins"", ""WD repeat domain containing"""	29442	protein-coding gene	gene with protein product		608322				9455484	Standard	NM_001252100		Approved	DKFZP434J212, KIAA0449	uc001gvs.2	O75037	OTTHUMG00000035787	ENST00000422435.2:c.3551G>A	1.37:g.200956187C>T	ENSP00000411831:p.Arg1184Gln	Somatic	0	32	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	5	64.29	B2RP62|B7ZMI0|Q5T4J3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Kinesin_motor_dom,pfam_WD40_repeat,superfamily_P-loop_NTPase,superfamily_WD40_repeat_dom,superfamily_Prefoldin,smart_Kinesin_motor_dom,smart_WD40_repeat,pfscan_Kinesin_motor_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Kinesin_motor_dom	p.R1184Q	ENST00000422435.2	37	c.3551	CCDS58056.1	1	.	.	.	.	.	.	.	.	.	.	C	14.25	2.478771	0.44044	2.27E-4	0.0	ENSG00000116852	ENST00000332129;ENST00000360529;ENST00000461742;ENST00000422435;ENST00000539858	T;T;T;T	0.71579	-0.24;-0.55;-0.58;-0.27	5.17	5.17	0.71159	.	0.083005	0.49305	D	0.000152	T	0.62048	0.2396	L	0.44542	1.39	0.44976	D	0.997999	P;P;P;P	0.51791	0.913;0.824;0.905;0.948	B;B;B;B	0.39660	0.227;0.084;0.111;0.306	T	0.61292	-0.7092	10	0.14656	T	0.56	.	18.2598	0.90031	0.0:1.0:0.0:0.0	.	1184;1184;1184;1184	B7ZMI0;B2RP62;O75037;O75037-2	.;.;KI21B_HUMAN;.	Q	1184	ENSP00000328494:R1184Q;ENSP00000353724:R1184Q;ENSP00000433808:R1184Q;ENSP00000411831:R1184Q	ENSP00000328494:R1184Q	R	-	2	0	KIF21B	199222810	1.000000	0.71417	0.929000	0.37066	0.522000	0.34438	4.558000	0.60789	2.420000	0.82092	0.655000	0.94253	CGA	-	NULL		0.602	KIF21B-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIF21B	protein_coding	OTTHUMT00000382635.1	C	XM_371332	-		200956187	-1	no_errors	ENST00000422435	ensembl	human	known	74_37	missense	SNP	1.000	T
PFKFB4	5210	genome.wustl.edu	37	3	48563039	48563039	+	Missense_Mutation	SNP	G	G	A			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr3:48563039G>A	ENST00000232375.3	-	10	1163	c.1051C>T	c.(1051-1053)Cgg>Tgg	p.R351W	PFKFB4_ENST00000541519.1_Missense_Mutation_p.R317W|PFKFB4_ENST00000490115.1_5'UTR|PFKFB4_ENST00000383734.2_Intron|PFKFB4_ENST00000416568.1_Missense_Mutation_p.R344W|PFKFB4_ENST00000536104.1_Missense_Mutation_p.R340W|PFKFB4_ENST00000545984.1_3'UTR	NM_004567.2	NP_004558.1	Q16877	F264_HUMAN	6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4	351	Fructose-2,6-bisphosphatase.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose 2,6-bisphosphate metabolic process (GO:0006003)|fructose metabolic process (GO:0006000)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	6-phosphofructo-2-kinase activity (GO:0003873)|ATP binding (GO:0005524)|fructose-2,6-bisphosphate 2-phosphatase activity (GO:0004331)			breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|liver(1)|lung(5)|ovary(1)|urinary_tract(1)	14				BRCA - Breast invasive adenocarcinoma(193;0.0003)|KIRC - Kidney renal clear cell carcinoma(197;0.00596)|Kidney(197;0.00684)		TCCTGGTCCCGCAGGGCGAAC	0.567																																																	0								ENSG00000114268						72.0	61.0	65.0					3																	48563039		2203	4300	6503	PFKFB4	SO:0001583	missense	0			-	HGNC	BC010269	CCDS2771.1	3p22-p21	2004-03-02			ENSG00000114268	ENSG00000114268			8875	protein-coding gene	gene with protein product		605320				8830046, 10095107	Standard	NM_004567		Approved		uc003ctv.3	Q16877	OTTHUMG00000133528	ENST00000232375.3:c.1051C>T	3.37:g.48563039G>A	ENSP00000232375:p.Arg351Trp	Somatic	0	11	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	16	33.33	Q5S3G5|Q5XLC2|Q64EX5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_6Phosfructo_kin,pfam_His_Pase_superF_clade-1,superfamily_P-loop_NTPase,smart_His_Pase_superF_clade-1,pirsf_Bifunct_6PFK/fruc_bisP_Ptase,prints_6Pfruct_kin	p.R351W	ENST00000232375.3	37	c.1051	CCDS2771.1	3	.	.	.	.	.	.	.	.	.	.	G	18.79	3.699573	0.68501	.	.	ENSG00000114268	ENST00000232375;ENST00000536104;ENST00000416568;ENST00000541519	T;T;T;T	0.70164	-0.46;-0.46;-0.46;-0.46	4.1	2.21	0.28008	Histidine phosphatase superfamily, clade-1 (2);	0.000000	0.85682	D	0.000000	T	0.73016	0.3533	L	0.42487	1.325	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.72766	-0.4194	10	0.87932	D	0	-17.215	10.7359	0.46124	0.0:0.0:0.6571:0.3429	.	340;344;351	B7Z5C3;Q66S35;Q16877	.;.;F264_HUMAN	W	351;340;344;317	ENSP00000232375:R351W;ENSP00000438908:R340W;ENSP00000388394:R344W;ENSP00000437446:R317W	ENSP00000232375:R351W	R	-	1	2	PFKFB4	48538043	0.199000	0.23386	1.000000	0.80357	0.997000	0.91878	0.151000	0.16283	0.435000	0.26365	0.467000	0.42956	CGG	-	pfam_His_Pase_superF_clade-1,smart_His_Pase_superF_clade-1,pirsf_Bifunct_6PFK/fruc_bisP_Ptase		0.567	PFKFB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PFKFB4	protein_coding	OTTHUMT00000257503.2	G	NM_004567	-		48563039	-1	no_errors	ENST00000232375	ensembl	human	known	74_37	missense	SNP	1.000	A
CACNA1B	774	genome.wustl.edu	37	9	140941368	140941368	+	Silent	SNP	C	C	T			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr9:140941368C>T	ENST00000371372.1	+	22	3571	c.3426C>T	c.(3424-3426)ttC>ttT	p.F1142F	CACNA1B_ENST00000545473.1_Silent_p.F168F|CACNA1B_ENST00000371363.1_Silent_p.F1142F|CACNA1B_ENST00000371355.4_Silent_p.F1143F|CACNA1B_ENST00000371357.1_Silent_p.F1143F|CACNA1B_ENST00000277549.5_Silent_p.F334F|CACNA1B_ENST00000277551.2_Silent_p.F1142F	NM_000718.3|NM_001243812.1	NP_000709.1|NP_001230741.1	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type, alpha 1B subunit	1142					calcium ion import (GO:0070509)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|neurotransmitter secretion (GO:0007269)|regulation of blood pressure (GO:0008217)|regulation of calcium ion transport (GO:0051924)|regulation of heart contraction (GO:0008016)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transport (GO:0006810)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|protein C-terminus binding (GO:0008022)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(17)|lung(31)|ovary(1)|prostate(1)|skin(2)|stomach(2)|urinary_tract(2)	80	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)|Levetiracetam(DB01202)|Spironolactone(DB00421)|Verapamil(DB00661)	TCCGCCGCTTCTGCCACTACA	0.657																																																	0								ENSG00000148408						54.0	57.0	56.0					9																	140941368		2129	4229	6358	CACNA1B	SO:0001819	synonymous_variant	0			-	HGNC	AB209467	CCDS59522.1, CCDS59523.1	9q34	2013-01-10	2007-02-16		ENSG00000148408	ENSG00000148408		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1389	protein-coding gene	gene with protein product		601012		CACNL1A5		8825650, 16382099	Standard	NM_000718		Approved	Cav2.2, CACNN	uc004cog.3	Q00975	OTTHUMG00000021002	ENST00000371372.1:c.3426C>T	9.37:g.140941368C>T		Somatic	0	37	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	46	0	100.00	B1AQK5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,pfscan_EF_hand_dom,prints_VDCCAlpha1,prints_VDCC_N_a1su,prints_PKD_2	p.F1143	ENST00000371372.1	37	c.3429	CCDS59522.1	9																																																																																			-	NULL		0.657	CACNA1B-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	CACNA1B	protein_coding	OTTHUMT00000055380.1	C	NM_000718	-		140941368	+1	no_errors	ENST00000371355	ensembl	human	known	74_37	silent	SNP	0.980	T
ERVW-1	30816	genome.wustl.edu	37	7	92099904	92099904	+	5'UTR	SNP	G	G	A			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr7:92099904G>A	ENST00000493463.2	-	0	715				ERVW-1_ENST00000603053.1_5'UTR|AC007566.10_ENST00000427458.1_RNA|ERVW-1_ENST00000604270.1_5'UTR	NM_014590.3	NP_055405.3	Q9UQF0	SYCY1_HUMAN	endogenous retrovirus group W, member 1						anatomical structure morphogenesis (GO:0009653)|syncytium formation (GO:0006949)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|viral envelope (GO:0019031)				endometrium(1)|large_intestine(1)|lung(15)	17						gactgggtagggtccttccca	0.473																																																	0								ENSG00000242950																																			ERVW-1	SO:0001623	5_prime_UTR_variant	0			-	HGNC	AF208161	CCDS5626.1	7q21.2	2011-06-16	2011-05-05	2011-05-05	ENSG00000242950	ENSG00000242950			13525	other	endogenous retrovirus	"""envelope protein"", ""HERV-W Env glycoprotein"", ""enverin"", ""syncytin-1"", ""HERV-tryptophan envelope protein"", ""HERV-W{7q21.1} provirus ancestral Env polyprotein"", ""HERV-7q envelope protein"", ""envelope glycoprotein"", ""syncytin"""	604659	"""endogenous retroviral family W, env(C7), member 1"""	ERVWE1		9835022, 9882319, 21542922	Standard	NM_001130925		Approved	HERV-W, HERV-W-ENV, HERVW, HERV-7q	uc022ahe.1	Q9UQF0	OTTHUMG00000131249	ENST00000493463.2:c.-209C>T	7.37:g.92099904G>A		Somatic	0	18	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	13	45.83	B2RPD4|O95244|O95245|Q8NHY7|Q9NRZ2|Q9NZG3	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000493463.2	37	NULL	CCDS5626.1	7																																																																																			-	-		0.473	ERVW-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERVW-1	protein_coding	OTTHUMT00000254009.2	G	NM_014590	-		92099904	-1	no_errors	ENST00000604270	ensembl	human	known	74_37	rna	SNP	0.579	A
ARHGAP31	57514	genome.wustl.edu	37	3	119133323	119133323	+	Silent	SNP	A	A	G	rs376360791		TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr3:119133323A>G	ENST00000264245.4	+	12	3079	c.2547A>G	c.(2545-2547)tcA>tcG	p.S849S		NM_020754.2	NP_065805.2	Q2M1Z3	RHG31_HUMAN	Rho GTPase activating protein 31	849					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	GTPase activator activity (GO:0005096)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(3)|large_intestine(11)|lung(29)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	67						AGCAAAATTCAAAGAATGCTG	0.502																																					Pancreas(7;176 297 5394 51128 51241)												0								ENSG00000031081	A		0,3906		0,0,1953	64.0	66.0	65.0		2547	-0.6	0.2	3		65	1,8285		0,1,4142	no	coding-synonymous	ARHGAP31	NM_020754.2		0,1,6095	GG,GA,AA		0.0121,0.0,0.0082		849/1445	119133323	1,12191	1953	4143	6096	ARHGAP31	SO:0001819	synonymous_variant	0			-	HGNC		CCDS43135.1	3q13.33	2011-06-29			ENSG00000031081	ENSG00000031081		"""Rho GTPase activating proteins"""	29216	protein-coding gene	gene with protein product		610911				9786927, 12819203, 16519628	Standard	NM_020754		Approved	CDGAP	uc003ecj.4	Q2M1Z3	OTTHUMG00000159362	ENST00000264245.4:c.2547A>G	3.37:g.119133323A>G		Somatic	0	35	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	22	15.38	Q9ULL6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.S849	ENST00000264245.4	37	c.2547	CCDS43135.1	3																																																																																			-	NULL		0.502	ARHGAP31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP31	protein_coding	OTTHUMT00000354942.2	A		-		119133323	+1	no_errors	ENST00000264245	ensembl	human	known	74_37	silent	SNP	0.508	G
P2RY12	64805	genome.wustl.edu	37	3	151056330	151056330	+	Missense_Mutation	SNP	C	C	T			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr3:151056330C>T	ENST00000302632.3	-	3	603	c.304G>A	c.(304-306)Gtc>Atc	p.V102I	MED12L_ENST00000474524.1_Intron|MED12L_ENST00000273432.4_Intron|MED12L_ENST00000491549.1_Intron	NM_022788.4|NM_176876.2	NP_073625.1|NP_795345.1	Q9H244	P2Y12_HUMAN	purinergic receptor P2Y, G-protein coupled, 12	102					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cell projection organization (GO:0030030)|G-protein coupled purinergic nucleotide receptor signaling pathway (GO:0035589)|G-protein coupled receptor signaling pathway (GO:0007186)|hemostasis (GO:0007599)|negative regulation of cell differentiation (GO:0045596)|negative regulation of norepinephrine secretion (GO:0010700)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|positive regulation of GTPase activity (GO:0043547)|positive regulation of ion transport (GO:0043270)|potassium ion transmembrane transport (GO:0071805)|protein kinase B signaling (GO:0043491)|regulation of calcium ion transport (GO:0051924)	basal plasma membrane (GO:0009925)|caveola (GO:0005901)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|intrinsic component of membrane (GO:0031224)|plasma membrane (GO:0005886)	ADP receptor activity (GO:0001621)|G-protein coupled adenosine receptor activity (GO:0001609)|guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|prostate(1)|skin(1)	17			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)		Clopidogrel(DB00758)|Epoprostenol(DB01240)|Prasugrel(DB06209)|Ticagrelor(DB08816)|Ticlopidine(DB00208)|Treprostinil(DB00374)	TAAAATATGACGGAGGTAACT	0.393																																																	0								ENSG00000169313						65.0	70.0	68.0					3																	151056330		2202	4300	6502	P2RY12	SO:0001583	missense	0			-	HGNC	AJ320495	CCDS3159.1	3q24-q25	2014-09-17			ENSG00000169313	ENSG00000169313		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	18124	protein-coding gene	gene with protein product		600515				11502873, 11104774	Standard	NM_022788		Approved	P2Y12, SP1999, HORK3	uc003eyw.1	Q9H244	OTTHUMG00000159863	ENST00000302632.3:c.304G>A	3.37:g.151056330C>T	ENSP00000307259:p.Val102Ile	Somatic	0	8	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	9	60.87	D3DNJ5|Q546J7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_P2Y12_rcpt,prints_GPCR_Rhodpsn,prints_P2Y13_rcpt,prints_P2Y14_rcpt	p.V102I	ENST00000302632.3	37	c.304	CCDS3159.1	3	.	.	.	.	.	.	.	.	.	.	C	21.0	4.089970	0.76756	.	.	ENSG00000169313	ENST00000302632	T	0.37058	1.22	5.17	5.17	0.71159	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.58935	0.2157	M	0.72624	2.21	0.80722	D	1	D	0.89917	1.0	D	0.67900	0.954	T	0.54576	-0.8273	10	0.30854	T	0.27	-28.1525	19.0551	0.93059	0.0:1.0:0.0:0.0	.	102	Q9H244	P2Y12_HUMAN	I	102	ENSP00000307259:V102I	ENSP00000307259:V102I	V	-	1	0	P2RY12	152539020	1.000000	0.71417	0.065000	0.19835	0.646000	0.38490	7.445000	0.80570	2.571000	0.86741	0.650000	0.86243	GTC	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.393	P2RY12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	P2RY12	protein_coding	OTTHUMT00000357796.1	C		-		151056330	-1	no_errors	ENST00000302632	ensembl	human	known	74_37	missense	SNP	0.994	T
TTC23L	153657	genome.wustl.edu	37	5	34880291	34880291	+	Missense_Mutation	SNP	G	G	C	rs535984245		TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr5:34880291G>C	ENST00000505624.1	+	9	1058	c.955G>C	c.(955-957)Gtt>Ctt	p.V319L	TTC23L_ENST00000514080.1_3'UTR	NM_144725.3	NP_653326.3	Q6PF05	TT23L_HUMAN	tetratricopeptide repeat domain 23-like	319										breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(9)|prostate(2)|stomach(1)|urinary_tract(1)	22						TCCAGATGCTGTTGAGATATA	0.348																																																	0								ENSG00000205838						90.0	87.0	88.0					5																	34880291		1824	4090	5914	TTC23L	SO:0001583	missense	0			-	HGNC		CCDS54840.1	5p13.2	2008-07-14			ENSG00000205838	ENSG00000205838			26355	protein-coding gene	gene with protein product						12477932	Standard	NM_144725		Approved	FLJ25439	uc003jiu.3	Q6PF05	OTTHUMG00000162020	ENST00000505624.1:c.955G>C	5.37:g.34880291G>C	ENSP00000422188:p.Val319Leu	Somatic	0	19	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	22	29.03	Q6RGS4|Q8N7R3|Q96LJ2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.V319L	ENST00000505624.1	37	c.955	CCDS54840.1	5	.	.	.	.	.	.	.	.	.	.	g	10.29	1.308269	0.23821	.	.	ENSG00000205838	ENST00000505624;ENST00000535797	T	0.11385	2.78	4.5	3.58	0.41010	Tetratricopeptide-like helical (1);	0.085601	0.44285	U	0.000465	T	0.10981	0.0268	L	0.57536	1.79	0.23156	N	0.998203	B	0.22683	0.073	B	0.23716	0.048	T	0.19943	-1.0290	9	.	.	.	-19.4344	7.3221	0.26533	0.1317:0.0:0.8683:0.0	.	319	Q6PF05	TT23L_HUMAN	L	319	ENSP00000422188:V319L	.	V	+	1	0	TTC23L	34916048	0.995000	0.38212	0.951000	0.38953	0.275000	0.26752	3.161000	0.50747	1.159000	0.42565	0.580000	0.79431	GTT	-	NULL		0.348	TTC23L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC23L	protein_coding	OTTHUMT00000366819.1	G	NM_144725	-		34880291	+1	no_errors	ENST00000505624	ensembl	human	known	74_37	missense	SNP	0.971	C
FAXC	84553	genome.wustl.edu	37	6	99729131	99729131	+	Missense_Mutation	SNP	G	G	A			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr6:99729131G>A	ENST00000389677.5	-	6	1421	c.1139C>T	c.(1138-1140)tCc>tTc	p.S380F	FAXC_ENST00000538471.1_Missense_Mutation_p.S100F|FAXC_ENST00000461803.1_5'UTR	NM_032511.2	NP_115900.1	Q5TGI0	FAXC_HUMAN	failed axon connections homolog (Drosophila)	380						integral component of membrane (GO:0016021)											TGGGGTTCTGGAAAAACTGTT	0.488																																																	0								ENSG00000146267						140.0	144.0	143.0					6																	99729131		2203	4300	6503	FAXC	SO:0001583	missense	0			-	HGNC	BC011583	CCDS34500.1	6q16.3	2012-02-07	2012-02-07	2012-02-07	ENSG00000146267	ENSG00000146267			20742	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 168"""	C6orf168		12477932	Standard	NM_032511		Approved	MGC2817, dJ273F20	uc003ppj.4	Q5TGI0	OTTHUMG00000015261	ENST00000389677.5:c.1139C>T	6.37:g.99729131G>A	ENSP00000374328:p.Ser380Phe	Somatic	0	30	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	57	14.93	B3KU39|Q96F61|Q96LU3|Q9BR58|Q9BSS2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_Thioredoxin-like_fold,superfamily_Glutathione-S-Trfase_C-like	p.S380F	ENST00000389677.5	37	c.1139	CCDS34500.1	6	.	.	.	.	.	.	.	.	.	.	G	15.65	2.895567	0.52121	.	.	ENSG00000146267	ENST00000389677;ENST00000538471	.	.	.	5.13	5.13	0.70059	.	0.138539	0.51477	D	0.000100	T	0.50803	0.1637	L	0.44542	1.39	0.48830	D	0.99971	D	0.54207	0.965	P	0.48141	0.568	T	0.58668	-0.7596	9	0.87932	D	0	-24.2005	18.6087	0.91276	0.0:0.0:1.0:0.0	.	380	Q5TGI0	CF168_HUMAN	F	380;100	.	ENSP00000374328:S380F	S	-	2	0	C6orf168	99835852	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.768000	0.68858	2.384000	0.81235	0.655000	0.94253	TCC	-	NULL		0.488	FAXC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAXC	protein_coding	OTTHUMT00000041589.4	G	NM_032511	-		99729131	-1	no_errors	ENST00000389677	ensembl	human	known	74_37	missense	SNP	1.000	A
SSPO	23145	genome.wustl.edu	37	7	149482730	149482730	+	RNA	SNP	C	C	G			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr7:149482730C>G	ENST00000378016.2	+	0	3146							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			GGCCTATTCACAGTCTCTGCC	0.622																																																	0								ENSG00000197558						21.0	26.0	24.0					7																	149482730		2087	4204	6291	SSPO			0			-	HGNC	AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149482730C>G		Somatic	0	29	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	14	33.33	Q76B61	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000378016.2	37	NULL		7																																																																																			-	-		0.622	SSPO-202	KNOWN	basic	processed_transcript	SSPO	processed_transcript		C		-		149482730	+1	no_errors	ENST00000262089	ensembl	human	known	74_37	rna	SNP	0.477	G
TEX11	56159	genome.wustl.edu	37	X	69849586	69849586	+	Splice_Site	SNP	C	C	G			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chrX:69849586C>G	ENST00000395889.2	-	19	1684		c.e19-1		TEX11_ENST00000344304.3_Splice_Site|TEX11_ENST00000374320.2_Splice_Site|TEX11_ENST00000374333.2_Splice_Site	NM_001003811.1	NP_001003811.1	Q8IYF3	TEX11_HUMAN	testis expressed 11						chiasma assembly (GO:0051026)|fertilization (GO:0009566)|male gonad development (GO:0008584)|male meiosis chromosome segregation (GO:0007060)|meiotic gene conversion (GO:0006311)|negative regulation of apoptotic process (GO:0043066)|reciprocal meiotic recombination (GO:0007131)|resolution of meiotic recombination intermediates (GO:0000712)|synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)				breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(12)|lung(13)|ovary(3)|prostate(3)|skin(3)	48	Renal(35;0.156)					GCCTGCAAAGCTGAAAAACAA	0.294																																																	0								ENSG00000120498						54.0	50.0	51.0					X																	69849586		2203	4300	6503	TEX11	SO:0001630	splice_region_variant	0			-	HGNC	AF285594	CCDS35323.1, CCDS43968.1	Xp11	2008-02-05	2007-03-13		ENSG00000120498	ENSG00000120498			11733	protein-coding gene	gene with protein product		300311	"""testis expressed sequence 11"""			11279525	Standard	NM_001003811		Approved	TSGA3, TGC1	uc004dyl.3	Q8IYF3	OTTHUMG00000021782	ENST00000395889.2:c.1529-1G>C	X.37:g.69849586C>G		Somatic	0	30	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	64	20.00	A8K8V6|Q5JQQ8|Q96LZ4|Q96M47|Q9BXU6	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e17-1	ENST00000395889.2	37	c.1529-1	CCDS35323.1	X	.	.	.	.	.	.	.	.	.	.	C	9.004	0.980725	0.18812	.	.	ENSG00000120498	ENST00000374333;ENST00000395889;ENST00000374320;ENST00000344304	.	.	.	3.77	2.88	0.33553	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.7717	0.29012	0.2494:0.7506:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TEX11	69766311	1.000000	0.71417	0.808000	0.32385	0.037000	0.13140	3.458000	0.53014	0.731000	0.32448	-0.385000	0.06624	.	-	-		0.294	TEX11-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TEX11	protein_coding	OTTHUMT00000359072.1	C		-	Intron	69849586	-1	no_errors	ENST00000344304	ensembl	human	known	74_37	splice_site	SNP	0.787	G
PPP1R35	221908	genome.wustl.edu	37	7	100033348	100033348	+	Missense_Mutation	SNP	A	A	G			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr7:100033348A>G	ENST00000292330.2	-	3	684	c.494T>C	c.(493-495)gTg>gCg	p.V165A	RP11-758P17.2_ENST00000492523.1_RNA|PPP1R35_ENST00000476185.1_Intron|RP11-758P17.3_ENST00000475250.1_RNA	NM_145030.2	NP_659467.1	Q8TAP8	PPR35_HUMAN	protein phosphatase 1, regulatory subunit 35	165					negative regulation of phosphatase activity (GO:0010923)		phosphatase binding (GO:0019902)|protein phosphatase inhibitor activity (GO:0004864)										CTGCAGGCTCACCAGGTCCCG	0.687																																																	0								ENSG00000160813						15.0	17.0	17.0					7																	100033348		2196	4297	6493	PPP1R35	SO:0001583	missense	0			-	HGNC	BC026269	CCDS5694.1	7q22.1	2012-04-17	2011-10-11	2011-10-11	ENSG00000160813	ENSG00000160813		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	28320	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 47"""	C7orf47		12477932	Standard	NM_145030		Approved	MGC22793	uc003uuy.1	Q8TAP8	OTTHUMG00000159540	ENST00000292330.2:c.494T>C	7.37:g.100033348A>G	ENSP00000292330:p.Val165Ala	Somatic	0	42	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	29	23.68	A4D2C5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.V165A	ENST00000292330.2	37	c.494	CCDS5694.1	7	.	.	.	.	.	.	.	.	.	.	A	24.5	4.543122	0.86022	.	.	ENSG00000160813	ENST00000292330	.	.	.	4.6	3.43	0.39272	.	0.000000	0.64402	D	0.000013	T	0.47637	0.1456	L	0.55481	1.735	0.35763	D	0.82035	P	0.35348	0.496	B	0.38264	0.269	T	0.58148	-0.7687	9	0.72032	D	0.01	-31.2218	8.188	0.31350	0.7966:0.2034:0.0:0.0	.	165	Q8TAP8	PPR35_HUMAN	A	165	.	ENSP00000292330:V165A	V	-	2	0	C7orf47	99871284	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.132000	0.50523	0.784000	0.33661	0.459000	0.35465	GTG	-	NULL		0.687	PPP1R35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R35	protein_coding	OTTHUMT00000356095.2	A	NM_145030	-		100033348	-1	no_errors	ENST00000292330	ensembl	human	known	74_37	missense	SNP	1.000	G
TCERG1L	256536	genome.wustl.edu	37	10	132944799	132944799	+	Missense_Mutation	SNP	G	G	A			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr10:132944799G>A	ENST00000368642.4	-	7	1244	c.1159C>T	c.(1159-1161)Ccc>Tcc	p.P387S		NM_174937.3	NP_777597.2	Q5VWI1	TCRGL_HUMAN	transcription elongation regulator 1-like	387										cervix(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	31		all_cancers(35;1.22e-10)|all_epithelial(44;2.65e-09)|Lung NSC(174;0.00188)|all_lung(145;0.00307)|Melanoma(40;0.0179)|all_neural(114;0.0424)|Breast(234;0.0743)|Colorectal(57;0.09)		all cancers(32;0.000899)|OV - Ovarian serous cystadenocarcinoma(35;0.0021)|Epithelial(32;0.00276)		CGTTTGTGGGGCGGGTCCTCA	0.502																																																	0								ENSG00000176769						110.0	104.0	106.0					10																	132944799		2203	4300	6503	TCERG1L	SO:0001583	missense	0			-	HGNC	AK096269	CCDS7662.2	10q26.3	2006-04-12			ENSG00000176769	ENSG00000176769			23533	protein-coding gene	gene with protein product							Standard	NM_174937		Approved	FLJ38950	uc001lkp.3	Q5VWI1	OTTHUMG00000019276	ENST00000368642.4:c.1159C>T	10.37:g.132944799G>A	ENSP00000357631:p.Pro387Ser	Somatic	0	39	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	15	58.33	Q5VWI2|Q86XM8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_FF_domain,pfam_WW_dom,superfamily_FF_domain,superfamily_WW_dom,smart_WW_dom,smart_FF_domain,pfscan_WW_dom	p.P387S	ENST00000368642.4	37	c.1159	CCDS7662.2	10	.	.	.	.	.	.	.	.	.	.	G	24.1	4.489014	0.84962	.	.	ENSG00000176769	ENST00000368642	T	0.27557	1.66	4.83	4.83	0.62350	.	0.000000	0.64402	D	0.000001	T	0.57946	0.2088	M	0.78344	2.41	0.80722	D	1	D	0.89917	1.0	D	0.75484	0.986	T	0.63712	-0.6575	10	0.72032	D	0.01	-8.1756	17.2993	0.87177	0.0:0.0:1.0:0.0	.	387	Q5VWI1	TCRGL_HUMAN	S	387	ENSP00000357631:P387S	ENSP00000357631:P387S	P	-	1	0	TCERG1L	132834789	1.000000	0.71417	0.934000	0.37439	0.841000	0.47740	9.117000	0.94347	2.392000	0.81423	0.467000	0.42956	CCC	-	NULL		0.502	TCERG1L-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TCERG1L	protein_coding	OTTHUMT00000091619.2	G	NM_174937	-		132944799	-1	no_errors	ENST00000368642	ensembl	human	known	74_37	missense	SNP	1.000	A
CEP170B	283638	genome.wustl.edu	37	14	105353081	105353081	+	Silent	SNP	C	C	T			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr14:105353081C>T	ENST00000414716.3	+	12	2733	c.2505C>T	c.(2503-2505)ggC>ggT	p.G835G	CEP170B_ENST00000453495.1_Silent_p.G836G|CEP170B_ENST00000556508.1_Silent_p.G765G|CEP170B_ENST00000418279.1_Silent_p.G765G	NM_001112726.2	NP_001106197.1	Q9Y4F5	C170B_HUMAN	centrosomal protein 170B	835						cytoplasm (GO:0005737)|microtubule (GO:0005874)											CACGGGATGGCGTCTATGTCA	0.642																																																	0								ENSG00000099814						33.0	41.0	38.0					14																	105353081		1997	4145	6142	CEP170B	SO:0001819	synonymous_variant	0			-	HGNC	AB006622	CCDS45175.1, CCDS45176.1, CCDS45176.2	14q32.33	2014-02-20	2012-11-30	2012-11-30	ENSG00000099814	ENSG00000099814			20362	protein-coding gene	gene with protein product	"""Cep170-related"""		"""KIAA0284"""	KIAA0284		23087211	Standard	NM_015005		Approved	FAM68C, Cep170R	uc010axb.4	Q9Y4F5	OTTHUMG00000170763	ENST00000414716.3:c.2505C>T	14.37:g.105353081C>T		Somatic	0	52	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	54	0	100.00	Q2KHR7|Q86TI7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_FHA_dom,pfscan_FHA_dom	p.G836	ENST00000414716.3	37	c.2508	CCDS45175.1	14																																																																																			-	NULL		0.642	CEP170B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CEP170B	protein_coding	OTTHUMT00000410289.2	C	NM_001112726	-		105353081	+1	no_errors	ENST00000453495	ensembl	human	known	74_37	silent	SNP	0.007	T
SUDS3	64426	genome.wustl.edu	37	12	118852390	118852390	+	3'UTR	SNP	C	C	A			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr12:118852390C>A	ENST00000543473.1	+	0	1451				SUDS3_ENST00000397564.2_3'UTR	NM_022491.2	NP_071936.2	Q9H7L9	SDS3_HUMAN	suppressor of defective silencing 3 homolog (S. cerevisiae)						apoptotic process (GO:0006915)|histone deacetylation (GO:0016575)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|substantia nigra development (GO:0021762)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|Sin3 complex (GO:0016580)	enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)			breast(1)|lung(1)	2	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CTTTAGGGCACTTTTGTGGCC	0.423																																																	0								ENSG00000111707																																			SUDS3	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AK023801	CCDS44993.1	12q24.23	2006-02-13	2006-02-13		ENSG00000111707	ENSG00000111707			29545	protein-coding gene	gene with protein product	"""sin3A-associated protein, 45kDa"""	608250	"""suppressor of defective silencing 3 homolog (SDS3, S. cerevisiae)"""			11909966	Standard	NM_022491		Approved	SDS3, FLJ00052, SAP45	uc001twz.3	Q9H7L9	OTTHUMG00000168884	ENST00000543473.1:c.*152C>A	12.37:g.118852390C>A		Somatic	0	60	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	30	40	42.86	Q4KMQ5|Q8N6H0|Q9H8D2	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000543473.1	37	NULL	CCDS44993.1	12																																																																																			-	-		0.423	SUDS3-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	SUDS3	protein_coding	OTTHUMT00000401504.1	C	NM_022491	-		118852390	+1	no_errors	ENST00000541591	ensembl	human	known	74_37	rna	SNP	0.017	A
GPT	2875	genome.wustl.edu	37	8	145730243	145730243	+	Silent	SNP	G	G	A			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr8:145730243G>A	ENST00000528431.1	+	4	499	c.342G>A	c.(340-342)gcG>gcA	p.A114A	GPT_ENST00000394955.2_Silent_p.A114A			P24298	ALAT1_HUMAN	glutamic-pyruvate transaminase (alanine aminotransferase)	114					cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|L-alanine catabolic process (GO:0042853)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	L-alanine:2-oxoglutarate aminotransferase activity (GO:0004021)|pyridoxal phosphate binding (GO:0030170)			central_nervous_system(1)|endometrium(1)|lung(2)|ovary(1)	5	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)		L-Alanine(DB00160)|Phenelzine(DB00780)	TCTTGCAGGCGTGTGGGGGCC	0.627																																																	0								ENSG00000167701																																			GPT	SO:0001819	synonymous_variant	0			-	HGNC		CCDS6430.1	8q24.3	2013-09-19			ENSG00000167701	ENSG00000167701	2.6.1.2		4552	protein-coding gene	gene with protein product		138200					Standard	NM_005309		Approved	ALT1, GPT1	uc003zdh.4	P24298	OTTHUMG00000165176	ENST00000528431.1:c.342G>A	8.37:g.145730243G>A		Somatic	0	117	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	95	37	71.97	B0YJ18|D3DWM7|P78398|Q93076	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase	p.A114	ENST00000528431.1	37	c.342	CCDS6430.1	8																																																																																			-	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase		0.627	GPT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPT	protein_coding	OTTHUMT00000382471.1	G		-		145730243	+1	no_errors	ENST00000394955	ensembl	human	known	74_37	silent	SNP	0.005	A
TOM1L1	10040	genome.wustl.edu	37	17	52992048	52992048	+	Missense_Mutation	SNP	G	G	T			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr17:52992048G>T	ENST00000575882.1	+	6	900	c.547G>T	c.(547-549)Gct>Tct	p.A183S	TOM1L1_ENST00000570371.1_Missense_Mutation_p.A183S|TOM1L1_ENST00000536554.1_Missense_Mutation_p.A106S|TOM1L1_ENST00000575333.1_Missense_Mutation_p.A183S|TOM1L1_ENST00000348161.4_Missense_Mutation_p.A106S|TOM1L1_ENST00000445275.2_Missense_Mutation_p.A183S|TOM1L1_ENST00000572158.1_Missense_Mutation_p.A176S|TOM1L1_ENST00000540336.1_Intron|TOM1L1_ENST00000572405.1_Missense_Mutation_p.A148S	NM_005486.2	NP_005477.2	O75674	TM1L1_HUMAN	target of myb1 (chicken)-like 1	183					activation of protein kinase activity (GO:0032147)|intracellular protein transport (GO:0006886)|negative regulation of mitosis (GO:0045839)|positive regulation of protein autophosphorylation (GO:0031954)|signal transduction (GO:0007165)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|lysosome (GO:0005764)|membrane (GO:0016020)	clathrin binding (GO:0030276)|protein kinase activator activity (GO:0030295)|protein kinase binding (GO:0019901)|ubiquitin binding (GO:0043130)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|skin(1)	15						TACTGCACCAGCTCTTTCTTC	0.378																																																	0								ENSG00000141198						290.0	266.0	274.0					17																	52992048		2203	4300	6503	TOM1L1	SO:0001583	missense	0			-	HGNC	AJ010071	CCDS11582.1	17q23.2	2008-01-03	2007-01-12			ENSG00000141198			11983	protein-coding gene	gene with protein product		604701	"""target of myb1 (chicken) homolog-like 1"""			10329004, 15611048, 17977829	Standard	NM_005486		Approved	SRCASM	uc002iud.2	O75674		ENST00000575882.1:c.547G>T	17.37:g.52992048G>T	ENSP00000460823:p.Ala183Ser	Somatic	0	36	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	42	22.22	Q53G06|Q8N749	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_VHS,pfam_GAT,superfamily_ENTH_VHS,smart_VHS_subgr,pirsf_TOM1,pfscan_GAT,pfscan_VHS	p.A183S	ENST00000575882.1	37	c.547	CCDS11582.1	17	.	.	.	.	.	.	.	.	.	.	G	8.694	0.908139	0.17833	.	.	ENSG00000141198	ENST00000445275;ENST00000348161;ENST00000536554	T;T;T	0.41758	0.99;0.99;0.99	5.55	4.57	0.56435	.	0.508887	0.17949	N	0.156580	T	0.21631	0.0521	N	0.24115	0.695	0.37623	D	0.921363	P;P;P;B;P	0.44734	0.842;0.842;0.704;0.255;0.842	B;B;B;B;B	0.33750	0.169;0.169;0.169;0.053;0.169	T	0.08371	-1.0725	10	0.09338	T	0.73	-8.4267	10.6953	0.45894	0.0903:0.0:0.9097:0.0	.	176;106;183;183;106	B4E1N0;B7Z9E2;O75674;Q8N749;B4E1M9	.;.;TM1L1_HUMAN;.;.	S	183;106;106	ENSP00000408958:A183S;ENSP00000343901:A106S;ENSP00000443099:A106S	ENSP00000343901:A106S	A	+	1	0	TOM1L1	50347047	0.928000	0.31464	0.994000	0.49952	0.662000	0.39071	2.982000	0.49337	2.606000	0.88127	0.655000	0.94253	GCT	-	pirsf_TOM1		0.378	TOM1L1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TOM1L1	protein_coding	OTTHUMT00000439029.2	G	NM_005486	-		52992048	+1	no_errors	ENST00000575882	ensembl	human	known	74_37	missense	SNP	0.368	T
CD46	4179	genome.wustl.edu	37	1	207940949	207940949	+	Intron	SNP	T	T	C			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr1:207940949T>C	ENST00000358170.2	+	7	1012				CD46_ENST00000367047.1_Intron|CD46_ENST00000367041.1_Intron|CD46_ENST00000322918.5_Intron|CD46_ENST00000441839.2_Intron|CD46_ENST00000367042.1_Intron|CD46_ENST00000357714.1_Intron|CD46_ENST00000361067.1_Intron|CD46_ENST00000480003.1_Intron|CD46_ENST00000469535.1_3'UTR|CD46_ENST00000360212.2_Intron|CD46_ENST00000322875.4_Intron|CD46_ENST00000354848.1_Intron	NM_002389.4	NP_002380.3	P15529	MCP_HUMAN	CD46 molecule, complement regulatory protein						adaptive immune response (GO:0002250)|complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)|interleukin-10 production (GO:0032613)|negative regulation of complement activation (GO:0045916)|negative regulation of gene expression (GO:0010629)|positive regulation of gene expression (GO:0010628)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of memory T cell differentiation (GO:0043382)|positive regulation of regulatory T cell differentiation (GO:0045591)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of transforming growth factor beta production (GO:0071636)|proteolysis (GO:0006508)|regulation of complement activation (GO:0030449)|regulation of Notch signaling pathway (GO:0008593)|sequestering of extracellular ligand from receptor (GO:0035581)|single fertilization (GO:0007338)|T cell mediated immunity (GO:0002456)|viral process (GO:0016032)	basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|inner acrosomal membrane (GO:0002079)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cadherin binding (GO:0045296)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(6)|prostate(1)|skin(1)	19						TTTTGTTTCCTAGTGCTGCCT	0.338																																																	0								ENSG00000117335						184.0	185.0	185.0					1																	207940949		2203	4300	6503	CD46	SO:0001627	intron_variant	0			-	HGNC	BC030594	CCDS1479.1, CCDS1480.1, CCDS1481.1, CCDS1482.1, CCDS1484.1, CCDS1485.1, CCDS31008.1, CCDS31009.1	1q32	2014-09-17	2006-03-28	2006-02-09	ENSG00000117335	ENSG00000117335		"""CD molecules"", ""Complement system"""	6953	protein-coding gene	gene with protein product		120920	"""antigen identified by monoclonal antibody TRA-2-10"", ""membrane cofactor protein (CD46, trophoblast-lymphocyte cross-reactive antigen)"", ""CD46 antigen, complement regulatory protein"""	MIC10, MCP		7929741	Standard	NM_002389		Approved	TRA2.10, MGC26544, TLX	uc001hgj.3	P15529	OTTHUMG00000036397	ENST00000358170.2:c.857-3T>C	1.37:g.207940949T>C		Somatic	0	18	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	15	42.31	A0T1T0|A0T1T1|A0T1T2|Q15429|Q53GV9|Q5HY94|Q5VWS6|Q5VWS7|Q5VWS8|Q5VWS9|Q5VWT0|Q5VWT1|Q5VWT2|Q6N0A1|Q7Z3R5|Q9NNW2|Q9NNW3|Q9NNW4|Q9UCJ4	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000358170.2	37	NULL	CCDS1485.1	1																																																																																			-	-		0.338	CD46-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CD46	protein_coding	OTTHUMT00000088588.3	T	NM_172361	-		207940949	+1	no_errors	ENST00000469535	ensembl	human	known	74_37	rna	SNP	0.000	C
GP6	51206	genome.wustl.edu	37	19	55525954	55525954	+	3'UTR	SNP	T	T	C			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr19:55525954T>C	ENST00000417454.1	-	0	1382				CTC-550B14.7_ENST00000593060.1_RNA|CTC-550B14.7_ENST00000586845.1_RNA|GP6_ENST00000333884.2_3'UTR|GP6_ENST00000310373.3_Silent_p.G453G	NM_016363.4	NP_057447	Q9HCN6	GPVI_HUMAN	glycoprotein VI (platelet)						blood coagulation (GO:0007596)|enzyme linked receptor protein signaling pathway (GO:0007167)|leukocyte migration (GO:0050900)|platelet activation (GO:0030168)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|tetraspanin-enriched microdomain (GO:0097197)	collagen binding (GO:0005518)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			NS(2)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19			BRCA - Breast invasive adenocarcinoma(297;0.156)	GBM - Glioblastoma multiforme(193;0.0515)		ACCTTAGAGATCCGTCTGGAG	0.542																																																	0								ENSG00000088053						84.0	90.0	88.0					19																	55525954		1951	4132	6083	GP6	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AB035073	CCDS42626.1, CCDS46184.1, CCDS58678.1	19q13.4	2013-01-29			ENSG00000088053	ENSG00000088053		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14388	protein-coding gene	gene with protein product		605546				11027634	Standard	NM_001083899		Approved	GPVI	uc002qil.3	Q9HCN6	OTTHUMG00000159709	ENST00000417454.1:c.*335A>G	19.37:g.55525954T>C		Somatic	0	25	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	6	57.14	Q9HCN7|Q9UIF2	Silent	SNP	NA	NA	NA	NA	NA	NA	smart_Ig_sub,smart_Ig_sub2	p.G453	ENST00000417454.1	37	c.1359	CCDS46184.1	19																																																																																			-	NULL		0.542	GP6-001	KNOWN	basic|CCDS	protein_coding	GP6	protein_coding	OTTHUMT00000357006.1	T		-		55525954	-1	no_errors	ENST00000310373	ensembl	human	known	74_37	silent	SNP	0.000	C
CD68	968	genome.wustl.edu	37	17	7482543	7482544	+	5'Flank	DEL	AA	AA	-			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	AA	AA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr17:7482543_7482544delAA	ENST00000250092.6	+	0	0				AC113189.5_ENST00000572046.1_RNA|SNORA67_ENST00000384423.1_RNA|SNORD10_ENST00000459579.1_RNA|AC113189.5_ENST00000417897.1_RNA|SENP3-EIF4A1_ENST00000579777.1_RNA|AC113189.5_ENST00000415124.1_RNA|CD68_ENST00000380498.6_5'Flank	NM_001251.2	NP_001242.2	P34810	CD68_HUMAN	CD68 molecule						cellular response to organic substance (GO:0071310)	endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)				endometrium(1)|lung(1)|skin(1)	3						GGATGGTCACAAGCCCCTCACA	0.574																																																	0								ENSG00000264772																																			SNORA67	SO:0001631	upstream_gene_variant	0				HGNC	S57235	CCDS11114.1, CCDS58512.1	17p13	2011-11-24	2006-03-28		ENSG00000129226	ENSG00000129226		"""CD molecules"""	1693	protein-coding gene	gene with protein product	"""scavenger receptor class D, member 1"", ""CD68 antigen"", ""macrophage antigen CD68"""	153634	"""CD68 antigen"""			9790779	Standard	NM_001251		Approved	SCARD1, macrosialin, GP110, DKFZp686M18236, LAMP4	uc002ghv.3	P34810	OTTHUMG00000108146		17.37:g.7482543_7482544delAA	Exception_encountered	Somatic	0	8	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	7	46.15	B4DVT4|Q53HR6|Q53XI3|Q96BI7	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000250092.6	37	NULL	CCDS11114.1	17																																																																																			-	-		0.574	CD68-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNORA67	protein_coding	OTTHUMT00000226949.3	AA	NM_001251			7482544	+1	no_errors	ENST00000581621	ensembl	human	known	74_37	rna	DEL	0.000:0.000	-
NLRP2	55655	genome.wustl.edu	37	19	55494500	55494500	+	Silent	SNP	C	C	T			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr19:55494500C>T	ENST00000543010.1	+	6	1577	c.1434C>T	c.(1432-1434)tcC>tcT	p.S478S	NLRP2_ENST00000448584.2_Silent_p.S478S|NLRP2_ENST00000538819.1_Silent_p.S454S|NLRP2_ENST00000391721.4_Silent_p.S454S|NLRP2_ENST00000537859.1_Silent_p.S456S|NLRP2_ENST00000339757.7_Silent_p.S456S|NLRP2_ENST00000427260.2_Silent_p.S455S|NLRP2_ENST00000263437.6_Silent_p.S475S	NM_001174081.1	NP_001167552.1	Q9NX02	NALP2_HUMAN	NLR family, pyrin domain containing 2	478	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|Pyrin domain binding (GO:0032090)			large_intestine(4)|liver(1)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)	11			BRCA - Breast invasive adenocarcinoma(297;0.163)	GBM - Glioblastoma multiforme(193;0.028)		TGCAGGAGTCCGACCTCCGTC	0.642																																																	0								ENSG00000022556						38.0	38.0	38.0					19																	55494500		2203	4300	6503	NLRP2	SO:0001819	synonymous_variant	0			-	HGNC	AK000517	CCDS12913.1, CCDS54318.1, CCDS54319.1	19q13.42	2008-02-05	2006-12-08	2006-12-08	ENSG00000022556	ENSG00000022556		"""Nucleotide-binding domain and leucine rich repeat containing"""	22948	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 2"""	609364	"""NACHT, leucine rich repeat and PYD containing 2"""	NALP2		12563287, 11270363	Standard	NM_001174081		Approved	FLJ20510, PYPAF2, NBS1, PAN1, CLR19.9	uc021vbq.1	Q9NX02	OTTHUMG00000167763	ENST00000543010.1:c.1434C>T	19.37:g.55494500C>T		Somatic	0	20	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	2	90.00	B4DZL7|I3L0G4|Q53FL5|Q59G09|Q8IXT0|Q9BVN5|Q9H6G6|Q9HAV9|Q9NWK3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_DAPIN,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.S478	ENST00000543010.1	37	c.1434	CCDS12913.1	19																																																																																			-	NULL		0.642	NLRP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NLRP2	protein_coding	OTTHUMT00000396152.1	C	NM_017852	-		55494500	+1	no_errors	ENST00000448584	ensembl	human	known	74_37	silent	SNP	0.000	T
TBC1D9	23158	genome.wustl.edu	37	4	141592016	141592016	+	Missense_Mutation	SNP	C	C	T			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr4:141592016C>T	ENST00000442267.2	-	7	1198	c.1124G>A	c.(1123-1125)cGa>cAa	p.R375Q		NM_015130.2	NP_055945.2	Q6ZT07	TBCD9_HUMAN	TBC1 domain family, member 9 (with GRAM domain)	375							calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)			endometrium(3)|kidney(2)|large_intestine(3)|lung(18)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	31	all_hematologic(180;0.162)	Medulloblastoma(177;0.00498)				CATCCTGTTTCGGGTGCTGAT	0.433																																																	0								ENSG00000109436						165.0	166.0	165.0					4																	141592016		1937	4153	6090	TBC1D9	SO:0001583	missense	0			-	HGNC	AB020689	CCDS47136.1	4q31.1	2013-01-10	2006-07-12		ENSG00000109436	ENSG00000109436		"""EF-hand domain containing"""	21710	protein-coding gene	gene with protein product			"""TBC1 domain family, member 9"""			12970790	Standard	NM_015130		Approved	KIAA0882, MDR1	uc010ioj.3	Q6ZT07	OTTHUMG00000161405	ENST00000442267.2:c.1124G>A	4.37:g.141592016C>T	ENSP00000411197:p.Arg375Gln	Somatic	0	37	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	33	10.81	A6H8U8|D3DNZ1|O94958	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Rab-GTPase-TBC_dom,pfam_GRAM,superfamily_Rab-GTPase-TBC_dom,smart_GRAM,smart_Rab-GTPase-TBC_dom,pfscan_EF_hand_dom,pfscan_Rab-GTPase-TBC_dom	p.R375Q	ENST00000442267.2	37	c.1124	CCDS47136.1	4	.	.	.	.	.	.	.	.	.	.	C	17.82	3.483496	0.63962	.	.	ENSG00000109436	ENST00000442267	T	0.08807	3.05	5.45	3.35	0.38373	.	0.087564	0.85682	D	0.000000	T	0.08223	0.0205	L	0.49778	1.585	0.43667	D	0.996098	B	0.31256	0.316	B	0.31751	0.135	T	0.18023	-1.0350	10	0.36615	T	0.2	-9.8788	6.8771	0.24153	0.0:0.6943:0.0:0.3057	.	375	Q6ZT07	TBCD9_HUMAN	Q	375	ENSP00000411197:R375Q	ENSP00000411197:R375Q	R	-	2	0	TBC1D9	141811466	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	3.411000	0.52672	1.426000	0.47256	0.650000	0.86243	CGA	-	NULL		0.433	TBC1D9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D9	protein_coding	OTTHUMT00000364806.1	C	NM_015130	-		141592016	-1	no_errors	ENST00000442267	ensembl	human	known	74_37	missense	SNP	1.000	T
LPAR2	9170	genome.wustl.edu	37	19	19735114	19735114	+	Missense_Mutation	SNP	C	C	T	rs557173160		TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr19:19735114C>T	ENST00000542587.1	-	6	1909	c.1007G>A	c.(1006-1008)cGc>cAc	p.R336H	LPAR2_ENST00000586703.1_Missense_Mutation_p.R336H|LPAR2_ENST00000407877.3_Missense_Mutation_p.R336H			Q9HBW0	LPAR2_HUMAN	lysophosphatidic acid receptor 2	336					activation of MAPK activity (GO:0000187)|activation of phospholipase C activity (GO:0007202)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of Rho protein signal transduction (GO:0035025)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|lipid binding (GO:0008289)|lysophosphatidic acid receptor activity (GO:0070915)			breast(1)|endometrium(2)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|urinary_tract(1)	10						AAGCATGATGCGAGTGCTGGC	0.622													C|||	1	0.000199681	0.0	0.0	5008	,	,		21165	0.0		0.0	False		,,,				2504	0.001																0								ENSG00000064547						161.0	145.0	151.0					19																	19735114		2203	4300	6503	LPAR2	SO:0001583	missense	0			-	HGNC	AF011466	CCDS12407.1	19p12	2012-08-08	2008-04-11	2008-04-11		ENSG00000064547		"""GPCR / Class A : Lysophospholipid receptors : Lysophosphatidic acid"""	3168	protein-coding gene	gene with protein product		605110	"""endothelial differentiation, lysophosphatidic acid G-protein-coupled receptor, 4"""	EDG4		9525886, 9804623	Standard	NM_004720		Approved	EDG-4, LPA2	uc002nnb.4	Q9HBW0		ENST00000542587.1:c.1007G>A	19.37:g.19735114C>T	ENSP00000443256:p.Arg336His	Somatic	0	32	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	40	9.09	O00543|O43431	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_LPA_rcpt_EDG4,prints_GPCR_Rhodpsn,prints_LPA_rcpt,prints_LPA_rcpt_EDG2,prints_Melcrt_ACTH_rcpt,prints_S1P_rcpt	p.R336H	ENST00000542587.1	37	c.1007	CCDS12407.1	19	.	.	.	.	.	.	.	.	.	.	C	16.90	3.251329	0.59212	.	.	ENSG00000064547	ENST00000407877;ENST00000542587	T;T	0.80738	-1.41;-1.41	4.78	4.78	0.61160	.	0.669733	0.14130	N	0.339421	T	0.72622	0.3483	L	0.29908	0.895	0.29769	N	0.834893	B	0.19935	0.04	B	0.08055	0.003	T	0.68845	-0.5301	10	0.52906	T	0.07	.	15.346	0.74337	0.0:1.0:0.0:0.0	.	336	Q9HBW0	LPAR2_HUMAN	H	336	ENSP00000384665:R336H;ENSP00000443256:R336H	ENSP00000384665:R336H	R	-	2	0	LPAR2	19596114	0.862000	0.29867	0.769000	0.31535	0.920000	0.55202	0.810000	0.27183	2.480000	0.83734	0.561000	0.74099	CGC	-	prints_LPA_rcpt_EDG4		0.622	LPAR2-003	KNOWN	alternative_5_UTR|non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	LPAR2	protein_coding	OTTHUMT00000460544.1	C	NM_004720	-		19735114	-1	no_errors	ENST00000407877	ensembl	human	known	74_37	missense	SNP	0.540	T
KDM5A	5927	genome.wustl.edu	37	12	432285	432285	+	Silent	SNP	A	A	G			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr12:432285A>G	ENST00000399788.2	-	16	2600	c.2238T>C	c.(2236-2238)gtT>gtC	p.V746V	KDM5A_ENST00000382815.4_Silent_p.V746V	NM_001042603.1	NP_001036068.1	P29375	KDM5A_HUMAN	lysine (K)-specific demethylase 5A	746					chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|multicellular organismal development (GO:0007275)|negative regulation of histone deacetylase activity (GO:1901726)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			NS(2)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(29)|ovary(1)|prostate(5)|skin(6)|stomach(1)|urinary_tract(2)	77						ATGCTTCTGTAACACGACTGA	0.373			T	NUP98	AML																																			Dom	yes		12	12p11	5927	"""lysine (K)-specific demethylase 5A, JARID1A"""		L	0								ENSG00000073614						104.0	100.0	101.0					12																	432285		1878	4102	5980	KDM5A	SO:0001819	synonymous_variant	0			-	HGNC		CCDS41736.1	12p13.33	2013-01-28	2009-04-06	2009-04-06	ENSG00000073614	ENSG00000073614		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	9886	protein-coding gene	gene with protein product		180202	"""retinoblastoma-binding protein 2"", ""Jumonji, AT rich interactive domain 1A (RBBP2-like)"", ""jumonji, AT rich interactive domain 1A"""	RBBP2, JARID1A		1857421	Standard	NM_001042603		Approved		uc001qif.1	P29375	OTTHUMG00000168055	ENST00000399788.2:c.2238T>C	12.37:g.432285A>G		Somatic	0	41	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	31	11.43	A8MV76|Q4LE72|Q86XZ1	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Lys_sp_deMease_like_dom,pfam_JmjC_dom,pfam_Znf_PHD-finger,pfam_ARID/BRIGHT_DNA-bd,pfam_Znf_C5HC2,pfam_TF_JmjN,superfamily_ARID/BRIGHT_DNA-bd,superfamily_Znf_FYVE_PHD,smart_TF_JmjN,smart_ARID/BRIGHT_DNA-bd,smart_Znf_PHD,smart_JmjC_dom,pfscan_TF_JmjN,pfscan_JmjC_dom,pfscan_Znf_PHD-finger,pfscan_ARID/BRIGHT_DNA-bd	p.V746	ENST00000399788.2	37	c.2238	CCDS41736.1	12																																																																																			-	pfam_Lys_sp_deMease_like_dom		0.373	KDM5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM5A	protein_coding	OTTHUMT00000397812.1	A	NM_005056	-		432285	-1	no_errors	ENST00000399788	ensembl	human	known	74_37	silent	SNP	0.976	G
NPTXR	23467	genome.wustl.edu	37	22	39222606	39222606	+	Missense_Mutation	SNP	C	C	T			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr22:39222606C>T	ENST00000333039.2	-	3	1120	c.997G>A	c.(997-999)Ggc>Agc	p.G333S		NM_014293.3	NP_055108	O95502	NPTXR_HUMAN	neuronal pentraxin receptor	333	Pentaxin.					integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)			central_nervous_system(2)|large_intestine(3)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14	Melanoma(58;0.04)					GTGCCCTGGCCGGTGCCGCTG	0.632																																					Pancreas(139;2521 3281 36965)												0								ENSG00000221890						70.0	67.0	68.0					22																	39222606		2203	4300	6503	NPTXR	SO:0001583	missense	0			-	HGNC	AF052163	CCDS33647.1	22q13.1	2007-01-25			ENSG00000221890	ENSG00000221890			7954	protein-coding gene	gene with protein product		609474				16497176	Standard	NM_014293		Approved		uc003awk.3	O95502	OTTHUMG00000150458	ENST00000333039.2:c.997G>A	22.37:g.39222606C>T	ENSP00000327545:p.Gly333Ser	Somatic	0	33	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	55	20.29		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Pentaxin,superfamily_ConA-like_lec_gl_sf,smart_Pentaxin,prints_Pentaxin	p.G333S	ENST00000333039.2	37	c.997	CCDS33647.1	22	.	.	.	.	.	.	.	.	.	.	C	22.0	4.229168	0.79688	.	.	ENSG00000221890	ENST00000333039	T	0.06768	3.26	4.64	4.64	0.57946	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.000000	0.85682	D	0.000000	T	0.22044	0.0531	L	0.60957	1.885	0.45822	D	0.998690	D	0.76494	0.999	D	0.68039	0.955	T	0.03641	-1.1017	9	0.72032	D	0.01	-54.3521	11.8698	0.52513	0.135:0.7342:0.1308:0.0	.	333	O95502	NPTXR_HUMAN	S	333	ENSP00000327545:G333S	ENSP00000327545:G333S	G	-	1	0	NPTXR	37552552	1.000000	0.71417	0.971000	0.41717	0.525000	0.34531	4.604000	0.61112	2.861000	0.98227	0.655000	0.94253	GGC	-	pfam_Pentaxin,superfamily_ConA-like_lec_gl_sf,smart_Pentaxin		0.632	NPTXR-001	KNOWN	non_ATG_start|basic|appris_principal|CCDS	protein_coding	NPTXR	protein_coding	OTTHUMT00000318194.2	C	NM_014293	-		39222606	-1	no_errors	ENST00000333039	ensembl	human	known	74_37	missense	SNP	0.996	T
MUC16	94025	genome.wustl.edu	37	19	9084743	9084743	+	Missense_Mutation	SNP	G	G	A	rs372186047		TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr19:9084743G>A	ENST00000397910.4	-	1	7275	c.7072C>T	c.(7072-7074)Cgg>Tgg	p.R2358W		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	2358	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TTTGTTTTCCGTGCGTCAAGG	0.433																																																	0								ENSG00000181143	G	TRP/ARG	0,3876		0,0,1938	154.0	151.0	152.0		7072	-0.4	0.0	19		152	1,8283		0,1,4141	no	missense	MUC16	NM_024690.2	101	0,1,6079	AA,AG,GG		0.0121,0.0,0.0082	benign	2358/14508	9084743	1,12159	1938	4142	6080	MUC16	SO:0001583	missense	0			-	HGNC	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.7072C>T	19.37:g.9084743G>A	ENSP00000381008:p.Arg2358Trp	Somatic	0	36	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	45	23.73	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.R2358W	ENST00000397910.4	37	c.7072	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	g	0.134	-1.110164	0.01813	0.0	1.21E-4	ENSG00000181143	ENST00000397910	T	0.03004	4.08	0.225	-0.451	0.12214	.	.	.	.	.	T	0.01940	0.0061	N	0.08118	0	.	.	.	B	0.02656	0.0	B	0.01281	0.0	T	0.43032	-0.9416	7	0.87932	D	0	.	.	.	.	.	2358	B5ME49	.	W	2358	ENSP00000381008:R2358W	ENSP00000381008:R2358W	R	-	1	2	MUC16	8945743	0.013000	0.17824	0.008000	0.14137	0.008000	0.06430	-0.931000	0.03967	-0.694000	0.05113	-0.680000	0.03767	CGG	-	NULL		0.433	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	protein_coding	OTTHUMT00000402806.1	G	NM_024690	-		9084743	-1	no_errors	ENST00000397910	ensembl	human	known	74_37	missense	SNP	0.010	A
ZNF366	167465	genome.wustl.edu	37	5	71756678	71756678	+	Nonsense_Mutation	SNP	T	T	A			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr5:71756678T>A	ENST00000318442.5	-	2	1136	c.646A>T	c.(646-648)Aaa>Taa	p.K216*		NM_152625.1	NP_689838.1	Q8N895	ZN366_HUMAN	zinc finger protein 366	216					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|estrogen receptor binding (GO:0030331)|metal ion binding (GO:0046872)|transcription corepressor activity (GO:0003714)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(9)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	35		Lung NSC(167;0.0247)|Ovarian(174;0.0908)|Prostate(461;0.155)		OV - Ovarian serous cystadenocarcinoma(47;2.51e-53)		GGCTCGGCTTTCCGGGGCAGC	0.652																																																	0								ENSG00000178175						66.0	69.0	68.0					5																	71756678		2203	4300	6503	ZNF366	SO:0001587	stop_gained	0			-	HGNC	AK097115	CCDS4015.1	5q13.1	2013-01-08			ENSG00000178175	ENSG00000178175		"""Zinc fingers, C2H2-type"""	18316	protein-coding gene	gene with protein product		610159					Standard	NM_152625		Approved	FLJ39796	uc003kce.1	Q8N895	OTTHUMG00000100965	ENST00000318442.5:c.646A>T	5.37:g.71756678T>A	ENSP00000313158:p.Lys216*	Somatic	0	35	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	23	28.12	Q5HYI9|Q7RTV4	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.K216*	ENST00000318442.5	37	c.646	CCDS4015.1	5	.	.	.	.	.	.	.	.	.	.	T	37	6.313624	0.97467	.	.	ENSG00000178175	ENST00000318442	.	.	.	5.64	1.77	0.24775	.	0.366026	0.26289	N	0.025237	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.13470	T	0.59	-9.2682	6.7844	0.23665	0.0:0.1363:0.1287:0.7351	.	.	.	.	X	216	.	ENSP00000313158:K216X	K	-	1	0	ZNF366	71792434	0.001000	0.12720	0.002000	0.10522	0.966000	0.64601	1.168000	0.31859	0.441000	0.26529	0.459000	0.35465	AAA	-	NULL		0.652	ZNF366-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF366	protein_coding	OTTHUMT00000218574.3	T		-		71756678	-1	no_errors	ENST00000318442	ensembl	human	known	74_37	nonsense	SNP	0.000	A
TRPC3	7222	genome.wustl.edu	37	4	122853434	122853434	+	Missense_Mutation	SNP	C	C	G			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr4:122853434C>G	ENST00000379645.3	-	2	1052	c.979G>C	c.(979-981)Gag>Cag	p.E327Q	TRPC3_ENST00000513531.1_Missense_Mutation_p.E254Q|TRPC3_ENST00000264811.5_Missense_Mutation_p.E254Q	NM_001130698.1	NP_001124170.1	Q13507	TRPC3_HUMAN	transient receptor potential cation channel, subfamily C, member 3	242					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|phototransduction (GO:0007602)|platelet activation (GO:0030168)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of cardiac muscle hypertrophy in response to stress (GO:1903244)|response to ATP (GO:0033198)|response to calcium ion (GO:0051592)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(1)|large_intestine(12)|lung(13)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	51						ACCTTGAACTCCTTCTCTATG	0.617																																																	0								ENSG00000138741						48.0	39.0	42.0					4																	122853434		2203	4300	6503	TRPC3	SO:0001583	missense	0			-	HGNC	Y13758	CCDS3725.1, CCDS47130.1	4q27	2011-12-14			ENSG00000138741	ENSG00000138741		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12335	protein-coding gene	gene with protein product		602345				8646775, 16382100	Standard	NM_003305		Approved		uc003ieg.2	Q13507	OTTHUMG00000133069	ENST00000379645.3:c.979G>C	4.37:g.122853434C>G	ENSP00000368966:p.Glu327Gln	Somatic	0	15	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	8	65.22	A7VJS1|E9PCJ9|O00593|Q15660|Q52M35|Q5G1L5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_TRP_dom,pfam_PKD1_2_channel,superfamily_Ankyrin_rpt-contain_dom,superfamily_ARM-type_fold,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_TRPC3_channel,prints_TRPC_channel,tigrfam_TRP_channel	p.E327Q	ENST00000379645.3	37	c.979	CCDS47130.1	4	.	.	.	.	.	.	.	.	.	.	C	26.3	4.725960	0.89298	.	.	ENSG00000138741	ENST00000264811;ENST00000379645;ENST00000513531	D;D;D	0.88509	-2.39;-2.39;-2.39	5.34	5.34	0.76211	.	0.000000	0.85682	D	0.000000	D	0.94588	0.8256	M	0.79614	2.46	0.80722	D	1	D;D	0.76494	0.996;0.999	D;D	0.79108	0.964;0.992	D	0.95012	0.8152	10	0.87932	D	0	-18.6823	19.0581	0.93074	0.0:1.0:0.0:0.0	.	254;327	E9PCJ9;Q5G1L5	.;.	Q	254;327;254	ENSP00000264811:E254Q;ENSP00000368966:E327Q;ENSP00000426899:E254Q	ENSP00000264811:E254Q	E	-	1	0	TRPC3	123072884	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.662000	0.83803	2.488000	0.83962	0.655000	0.94253	GAG	-	pfam_TRP_dom,tigrfam_TRP_channel		0.617	TRPC3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRPC3	protein_coding	OTTHUMT00000364252.1	C	NM_003305	-		122853434	-1	no_errors	ENST00000379645	ensembl	human	known	74_37	missense	SNP	1.000	G
RALGPS2	55103	genome.wustl.edu	37	1	178875998	178875998	+	Missense_Mutation	SNP	A	A	G			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr1:178875998A>G	ENST00000367635.3	+	19	2056	c.1718A>G	c.(1717-1719)cAa>cGa	p.Q573R	RALGPS2_ENST00000367634.2_Missense_Mutation_p.Q547R	NM_152663.3	NP_689876.2	Q86X27	RGPS2_HUMAN	Ral GEF with PH domain and SH3 binding motif 2	573	Required for stimulation of nucleotide exchange by RALA. {ECO:0000250}.				small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(11)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	29						AGTAACAAACAACAGGTAAGC	0.343																																																	0								ENSG00000116191						88.0	84.0	86.0					1																	178875998		2203	4300	6503	RALGPS2	SO:0001583	missense	0			-	HGNC	AK098470	CCDS1325.1, CCDS65733.1	1q24	2013-01-11			ENSG00000116191	ENSG00000116191		"""Pleckstrin homology (PH) domain containing"""	30279	protein-coding gene	gene with protein product						10747847, 12102558	Standard	NM_152663		Approved	KIAA0351, FLJ10244, FLJ25604	uc001glz.3	Q86X27	OTTHUMG00000035076	ENST00000367635.3:c.1718A>G	1.37:g.178875998A>G	ENSP00000356607:p.Gln573Arg	Somatic	0	37	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	44	18.52	B7Z7B1|Q5T5Z1|Q5VZ67|Q9NW78	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RasGRF_CDC25,superfamily_Ras_GEF_dom,smart_RasGRF_CDC25,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_RasGRF_CDC25	p.Q573R	ENST00000367635.3	37	c.1718	CCDS1325.1	1	.	.	.	.	.	.	.	.	.	.	A	16.58	3.163951	0.57476	.	.	ENSG00000116191	ENST00000367635;ENST00000367634;ENST00000324778;ENST00000535251	T;T;T	0.78816	-1.21;-1.21;-1.21	5.87	5.87	0.94306	Pleckstrin homology-type (1);	0.199408	0.45606	D	0.000346	T	0.71829	0.3386	L	0.44542	1.39	0.80722	D	1	B;B	0.31581	0.3;0.329	B;B	0.29942	0.109;0.109	T	0.70223	-0.4931	10	0.39692	T	0.17	.	15.9315	0.79663	1.0:0.0:0.0:0.0	.	547;573	B7Z7B1;Q86X27	.;RGPS2_HUMAN	R	573;547;538;222	ENSP00000356607:Q573R;ENSP00000356606:Q547R;ENSP00000313613:Q538R	ENSP00000313613:Q538R	Q	+	2	0	RALGPS2	177142621	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.707000	0.91367	2.248000	0.74166	0.533000	0.62120	CAA	-	NULL		0.343	RALGPS2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RALGPS2	protein_coding	OTTHUMT00000084926.2	A	NM_152663	-		178875998	+1	no_errors	ENST00000367635	ensembl	human	known	74_37	missense	SNP	1.000	G
ADNP2	22850	genome.wustl.edu	37	18	77894115	77894115	+	Frame_Shift_Del	DEL	T	T	-			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr18:77894115delT	ENST00000262198.4	+	4	1274	c.819delT	c.(817-819)catfs	p.H273fs		NM_014913.3	NP_055728.1	Q6IQ32	ADNP2_HUMAN	ADNP homeobox 2	273	Pro-rich.				cellular response to oxidative stress (GO:0034599)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell death (GO:0060548)|neuron differentiation (GO:0030182)|positive regulation of cell growth (GO:0030307)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(9)|liver(1)|lung(15)|ovary(5)|prostate(2)	42		all_cancers(4;1.06e-15)|all_epithelial(4;2.36e-10)|all_lung(4;0.000302)|Lung NSC(4;0.000518)|Esophageal squamous(42;0.0212)|Ovarian(4;0.0256)|all_hematologic(56;0.15)|Melanoma(33;0.2)		Epithelial(2;1.1e-11)|OV - Ovarian serous cystadenocarcinoma(15;7.54e-09)|BRCA - Breast invasive adenocarcinoma(31;0.00247)|STAD - Stomach adenocarcinoma(84;0.164)		CAGCAGCACATTTGGCTGCAC	0.502																																																	0								ENSG00000101544						70.0	72.0	71.0					18																	77894115		2203	4300	6503	ADNP2	SO:0001589	frameshift_variant	0				HGNC	AB020670	CCDS32853.1	18q23	2013-01-07	2007-07-17	2007-07-17	ENSG00000101544	ENSG00000101544		"""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	23803	protein-coding gene	gene with protein product			"""zinc finger protein 508"""	ZNF508			Standard	NM_014913		Approved	KIAA0863	uc002lnw.3	Q6IQ32	OTTHUMG00000172535	ENST00000262198.4:c.819delT	18.37:g.77894115delT	ENSP00000262198:p.His273fs	Somatic	0	30	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	7	22.22	A8K951|O94943|Q9H9P3	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeobox_dom,pfscan_Znf_C2H2	p.L274fs	ENST00000262198.4	37	c.819	CCDS32853.1	18																																																																																			-	NULL		0.502	ADNP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADNP2	protein_coding	OTTHUMT00000418979.1	T	NM_014913			77894115	+1	no_errors	ENST00000262198	ensembl	human	known	74_37	frame_shift_del	DEL	0.000	-
METTL21EP	121952	genome.wustl.edu	37	13	103544905	103544906	+	lincRNA	INS	-	-	T	rs57292537|rs34557658|rs397961022|rs546368308	byFrequency	TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr13:103544905_103544906insT	ENST00000607072.1	+	0	1954				METTL21EP_ENST00000605100.1_RNA																							CCAAGCGTCCCTTTTTTTTTTT	0.327																																																	0								ENSG00000250878																																			METTL21EP			0				HGNC																													13.37:g.103544916_103544916dupT		Somatic	0	20	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	29	9.38		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000607072.1	37	NULL		13																																																																																			-	-		0.327	RP11-255P5.2-001	KNOWN	basic	lincRNA	METTL21EP	lincRNA	OTTHUMT00000471205.1	-				103544906	+1	no_errors	ENST00000605100	ensembl	human	known	74_37	rna	INS	0.000:0.000	T
CYBB	1536	genome.wustl.edu	37	X	37663304	37663304	+	Missense_Mutation	SNP	G	G	A			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chrX:37663304G>A	ENST00000378588.4	+	9	1139	c.1072G>A	c.(1072-1074)Gtt>Att	p.V358I	CYBB_ENST00000536160.1_Missense_Mutation_p.V91I|CYBB_ENST00000492288.1_3'UTR|TM4SF2_ENST00000465127.1_Intron|CYBB_ENST00000545017.1_Missense_Mutation_p.V326I	NM_000397.3	NP_000388.2	P04839	CY24B_HUMAN	cytochrome b-245, beta polypeptide	358	FAD-binding FR-type. {ECO:0000255|PROSITE-ProRule:PRU00716}.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|hydrogen peroxide biosynthetic process (GO:0050665)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interaction with host (GO:0051701)|oxidation-reduction process (GO:0055114)|phagosome maturation (GO:0090382)|respiratory burst (GO:0045730)|response to drug (GO:0042493)|response to nutrient (GO:0007584)|superoxide anion generation (GO:0042554)|superoxide metabolic process (GO:0006801)	dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|NADPH oxidase complex (GO:0043020)|neuronal cell body (GO:0043025)|phagocytic vesicle membrane (GO:0030670)|rough endoplasmic reticulum (GO:0005791)	flavin adenine dinucleotide binding (GO:0050660)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|superoxide-generating NADPH oxidase activity (GO:0016175)|voltage-gated ion channel activity (GO:0005244)	p.V358L(1)		central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(20)|prostate(2)|skin(2)	32					Dextromethorphan(DB00514)	TATCCGCATCGTTGGGGACTG	0.468																																																	1	Substitution - Missense(1)	lung(1)						ENSG00000165168						79.0	75.0	76.0					X																	37663304		2202	4300	6502	CYBB	SO:0001583	missense	0			-	HGNC	X04011	CCDS14242.1	Xp21.1	2014-09-17	2008-07-29		ENSG00000165168	ENSG00000165168		"""Cytochrome b genes"""	2578	protein-coding gene	gene with protein product		300481	"""chronic granulomatous disease"""	CGD			Standard	NM_000397		Approved	GP91-PHOX, NOX2	uc004ddr.2	P04839	OTTHUMG00000033175	ENST00000378588.4:c.1072G>A	X.37:g.37663304G>A	ENSP00000367851:p.Val358Ile	Somatic	0	60	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	34	41.38	A8K138|Q2PP16	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Fe_red_NAD-bd_6,pfam_FAD-bd_8,pfam_Fe3_Rdtase_TM_dom,pfam_OxRdtase_FAD-bd_dom,superfamily_Riboflavin_synthase-like_b-brl,prints_Cyt_b245_heavy_chain	p.V358I	ENST00000378588.4	37	c.1072	CCDS14242.1	X	.	.	.	.	.	.	.	.	.	.	G	29.4	5.006382	0.93287	.	.	ENSG00000165168	ENST00000378588;ENST00000545017;ENST00000536160	D;D;D	0.94457	-3.43;-3.43;-3.43	5.77	5.77	0.91146	Riboflavin synthase-like beta-barrel (1);FAD-binding 8 (1);Ferredoxin reductase-type FAD-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.97442	0.9163	M	0.88775	2.98	0.80722	D	1	D;D	0.64830	0.994;0.994	P;P	0.60886	0.85;0.88	D	0.97936	1.0323	10	0.72032	D	0.01	.	18.9785	0.92747	0.0:0.0:1.0:0.0	.	326;358	F5GWD2;P04839	.;CY24B_HUMAN	I	358;326;91	ENSP00000367851:V358I;ENSP00000441896:V326I;ENSP00000441958:V91I	ENSP00000367851:V358I	V	+	1	0	CYBB	37548248	1.000000	0.71417	0.870000	0.34147	0.876000	0.50452	9.476000	0.97823	2.430000	0.82344	0.544000	0.68410	GTT	-	pfam_FAD-bd_8,pfam_OxRdtase_FAD-bd_dom,superfamily_Riboflavin_synthase-like_b-brl		0.468	CYBB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYBB	protein_coding	OTTHUMT00000080881.1	G		-		37663304	+1	no_errors	ENST00000378588	ensembl	human	known	74_37	missense	SNP	0.997	A
SYNGAP1	8831	genome.wustl.edu	37	6	33412335	33412335	+	Silent	SNP	C	C	A			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr6:33412335C>A	ENST00000418600.2	+	16	3624	c.3523C>A	c.(3523-3525)Cgg>Agg	p.R1175R	SYNGAP1_ENST00000428982.2_Silent_p.R1116R|SYNGAP1_ENST00000293748.5_Silent_p.R1175R|SYNGAP1_ENST00000496374.1_3'UTR	NM_006772.2	NP_006763.2	Q96PV0	SYGP1_HUMAN	synaptic Ras GTPase activating protein 1	1175					dendrite development (GO:0016358)|negative regulation of axonogenesis (GO:0050771)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of Ras protein signal transduction (GO:0046580)|pattern specification process (GO:0007389)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|receptor clustering (GO:0043113)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of MAPK cascade (GO:0043408)|regulation of synapse structure and activity (GO:0050803)|regulation of synaptic plasticity (GO:0048167)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	Rab GTPase activator activity (GO:0005097)|Ras GTPase activator activity (GO:0005099)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(15)|ovary(7)|pancreas(1)|stomach(1)|urinary_tract(1)	43						CCACATCGAGCGGGAAGAGTA	0.562																																																	0								ENSG00000197283						78.0	65.0	69.0					6																	33412335		2203	4300	6503	SYNGAP1	SO:0001819	synonymous_variant	0			-	HGNC	AB067525	CCDS34434.2	6p21.3	2010-06-25	2010-06-25		ENSG00000197283	ENSG00000197283			11497	protein-coding gene	gene with protein product		603384	"""synaptic Ras GTPase activating protein 1 homolog (rat)"""			9581761, 18323856	Standard	NM_006772		Approved	SYNGAP, RASA5, KIAA1938	uc011dri.2	Q96PV0	OTTHUMG00000031096	ENST00000418600.2:c.3523C>A	6.37:g.33412335C>A		Somatic	0	33	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70	A2AB17|A2BEL6|A2BEL7|A8MQC4|Q8TCS2|Q9UGE2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF3498,pfam_RasGAP,pfam_C2_dom,superfamily_Rho_GTPase_activation_prot,superfamily_C2_dom,smart_Pleckstrin_homology,smart_C2_dom,smart_RasGAP,pfscan_Pleckstrin_homology,pfscan_RasGAP	p.R1175	ENST00000418600.2	37	c.3523	CCDS34434.2	6																																																																																			-	pfam_DUF3498		0.562	SYNGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNGAP1	protein_coding	OTTHUMT00000076151.4	C	XM_166407	-		33412335	+1	no_errors	ENST00000418600	ensembl	human	known	74_37	silent	SNP	1.000	A
DNAH14	127602	genome.wustl.edu	37	1	225328548	225328548	+	Missense_Mutation	SNP	G	G	A			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr1:225328548G>A	ENST00000445597.2	+	17	3130	c.3130G>A	c.(3130-3132)Gct>Act	p.A1044T	DNAH14_ENST00000439375.2_Missense_Mutation_p.A1428T|DNAH14_ENST00000430092.1_Missense_Mutation_p.A1428T			Q0VDD8	DYH14_HUMAN	dynein, axonemal, heavy chain 14	1044					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(2)|lung(2)|skin(2)|stomach(1)	27						AAAAGTCCACGCTGGTCTGAT	0.363																																																	0								ENSG00000185842						98.0	92.0	94.0					1																	225328548		692	1591	2283	DNAH14	SO:0001583	missense	0			-	HGNC	U61741	CCDS41472.1, CCDS44322.1	1q42.13	2009-02-12	2006-09-04		ENSG00000185842	ENSG00000185842		"""Axonemal dyneins"""	2945	protein-coding gene	gene with protein product		603341	"""dynein, axonemal, heavy polypeptide 14"", ""chromosome 1 open reading frame 67"""	C1orf67		8812413	Standard	NM_144989		Approved	Dnahc14, HL-18, HL18, DKFZp781B1548, MGC27277	uc001how.2	Q0VDD8	OTTHUMG00000037447	ENST00000445597.2:c.3130G>A	1.37:g.225328548G>A	ENSP00000409472:p.Ala1044Thr	Somatic	0	35	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	11	56.00	A6NG62|A6NNL2|Q0VDD9|Q4VXC7|Q4VXG4|Q4VXG5|Q5VU33|Q5VU34	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,superfamily_P-loop_NTPase,superfamily_Tautomerase/MIF_sf,smart_AAA+_ATPase	p.A1428T	ENST00000445597.2	37	c.4282		1	.	.	.	.	.	.	.	.	.	.	G	10.23	1.292031	0.23564	.	.	ENSG00000185842	ENST00000445597;ENST00000430092;ENST00000439375;ENST00000328556	T;T;T;T	0.31247	2.54;1.5;1.5;1.72	5.46	1.32	0.21799	.	.	.	.	.	T	0.22126	0.0533	L	0.46157	1.445	0.09310	N	1	B	0.27498	0.18	B	0.20384	0.029	T	0.18808	-1.0325	9	0.33141	T	0.24	.	5.0763	0.14632	0.2092:0.0:0.5373:0.2534	.	1428	Q0VDD8-4	.	T	1044;1428;1428;523	ENSP00000409472:A1044T;ENSP00000414402:A1428T;ENSP00000392061:A1428T;ENSP00000332424:A523T	ENSP00000332424:A523T	A	+	1	0	DNAH14	223395171	0.000000	0.05858	0.000000	0.03702	0.352000	0.29268	0.449000	0.21744	0.249000	0.21456	0.603000	0.83216	GCT	-	NULL		0.363	DNAH14-007	PUTATIVE	basic|exp_conf	protein_coding	DNAH14	protein_coding	OTTHUMT00000331217.3	G	XM_059166	-		225328548	+1	no_errors	ENST00000430092	ensembl	human	known	74_37	missense	SNP	0.000	A
TFB2M	64216	genome.wustl.edu	37	1	246719999	246719999	+	Missense_Mutation	SNP	A	A	T			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr1:246719999A>T	ENST00000366514.4	-	4	766	c.581T>A	c.(580-582)aTg>aAg	p.M194K	TFB2M_ENST00000544618.1_3'UTR	NM_022366.2	NP_071761.1	Q9H5Q4	TFB2M_HUMAN	transcription factor B2, mitochondrial	194					gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from mitochondrial promoter (GO:0006390)|transcription initiation from mitochondrial promoter (GO:0006391)	mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)	poly(A) RNA binding (GO:0044822)|rRNA (adenine-N6,N6-)-dimethyltransferase activity (GO:0000179)|transcription cofactor activity (GO:0003712)			breast(1)|endometrium(1)|kidney(12)|large_intestine(3)|lung(5)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	28	all_cancers(71;4.25e-05)|all_epithelial(71;4.92e-06)|Ovarian(71;0.0254)|all_lung(81;0.0272)|Breast(184;0.0318)|Lung NSC(105;0.0376)		OV - Ovarian serous cystadenocarcinoma(106;0.00358)			ACTTGGGAACATTCCAACTAC	0.323																																																	0								ENSG00000162851						54.0	58.0	57.0					1																	246719999		2203	4298	6501	TFB2M	SO:0001583	missense	0			-	HGNC	AK026835	CCDS1627.1	1q44	2008-02-05			ENSG00000162851	ENSG00000162851			18559	protein-coding gene	gene with protein product		607055					Standard	NM_022366		Approved	FLJ23182, FLJ22661, Hkp1	uc001ibn.3	Q9H5Q4	OTTHUMG00000040091	ENST00000366514.4:c.581T>A	1.37:g.246719999A>T	ENSP00000355471:p.Met194Lys	Somatic	0	47	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	25	13.79	Q9H626	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_rRNA_Ade_methylase_transferase,smart_rRNA_Ade_methylase_Trfase_N,pirsf_Mt_di-Me-Ado_Trfase_2_prcur	p.M194K	ENST00000366514.4	37	c.581	CCDS1627.1	1	.	.	.	.	.	.	.	.	.	.	A	9.507	1.104671	0.20632	.	.	ENSG00000162851	ENST00000366514	T	0.27402	1.67	5.19	4.07	0.47477	.	0.624373	0.16807	N	0.198755	T	0.24353	0.0590	L	0.34521	1.04	0.80722	D	1	P	0.41313	0.745	B	0.39027	0.288	T	0.02269	-1.1185	10	0.56958	D	0.05	-1.7748	10.2677	0.43464	0.9205:0.0:0.0795:0.0	.	194	Q9H5Q4	TFB2M_HUMAN	K	194	ENSP00000355471:M194K	ENSP00000355471:M194K	M	-	2	0	TFB2M	244786622	1.000000	0.71417	0.376000	0.26042	0.010000	0.07245	3.990000	0.56965	0.906000	0.36621	-0.280000	0.10049	ATG	-	pfam_rRNA_Ade_methylase_transferase,smart_rRNA_Ade_methylase_Trfase_N,pirsf_Mt_di-Me-Ado_Trfase_2_prcur		0.323	TFB2M-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TFB2M	protein_coding	OTTHUMT00000096673.1	A	NM_022366	-		246719999	-1	no_errors	ENST00000366514	ensembl	human	known	74_37	missense	SNP	0.854	T
ATG9B	285973	genome.wustl.edu	37	7	150712975	150712975	+	5'UTR	SNP	G	G	T			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr7:150712975G>T	ENST00000494791.1	-	0	2858				ATG9B_ENST00000377974.2_3'UTR|ATG9B_ENST00000605938.1_3'UTR|ATG9B_ENST00000444312.1_3'UTR			Q674R7	ATG9B_HUMAN	autophagy related 9B						autophagic vacuole assembly (GO:0000045)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)				cervix(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(1)|ovary(4)|prostate(1)	14	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CTGACCCTGAGGAGTCGTCTC	0.577																																																	0								ENSG00000181652						66.0	72.0	71.0					7																	150712975		692	1591	2283	ATG9B	SO:0001623	5_prime_UTR_variant	0			-	HGNC	AK027791		7q36	2014-02-12	2012-06-06	2005-09-11	ENSG00000181652	ENSG00000181652			21899	protein-coding gene	gene with protein product		612205	"""nitric oxide synthase 3 antisense"", ""ATG9 autophagy related 9 homolog B (S. cerevisiae)"""	NOS3AS		15234981, 15755735	Standard	NM_173681		Approved	FLJ14885, APG9L2, SONE	uc011kvc.2	Q674R7	OTTHUMG00000158634	ENST00000494791.1:c.-1713C>A	7.37:g.150712975G>T		Somatic	0	27	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	23	14.81	A1A5D3|Q6JRW5|Q8N8I8	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000494791.1	37	NULL		7																																																																																			-	-		0.577	ATG9B-001	KNOWN	non_canonical_U12|basic	processed_transcript	ATG9B	protein_coding	OTTHUMT00000351543.2	G	NM_173681	-		150712975	-1	no_errors	ENST00000464855	ensembl	human	known	74_37	rna	SNP	0.002	T
VIL1	7429	genome.wustl.edu	37	2	219292725	219292725	+	Missense_Mutation	SNP	G	G	T	rs374719806		TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr2:219292725G>T	ENST00000248444.5	+	5	473	c.385G>T	c.(385-387)Gtg>Ttg	p.V129L	VIL1_ENST00000440053.1_Missense_Mutation_p.V129L|VIL1_ENST00000392114.2_Intron	NM_007127.2	NP_009058.2	P09327	VILI_HUMAN	villin 1	129	Core.				actin filament capping (GO:0051693)|actin filament depolymerization (GO:0030042)|actin filament polymerization (GO:0030041)|actin filament severing (GO:0051014)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to hepatocyte growth factor stimulus (GO:0035729)|cytoplasmic actin-based contraction involved in cell motility (GO:0060327)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell differentiation (GO:0030855)|positive regulation of actin filament bundle assembly (GO:0032233)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell migration (GO:0010634)|protein complex assembly (GO:0006461)|regulation of actin nucleation (GO:0051125)|regulation of cell shape (GO:0008360)|regulation of lamellipodium morphogenesis (GO:2000392)|regulation of wound healing (GO:0061041)|response to bacterium (GO:0009617)	actin filament bundle (GO:0032432)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|filopodium tip (GO:0032433)|lamellipodium (GO:0030027)|microvillus (GO:0005902)|ruffle (GO:0001726)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|identical protein binding (GO:0042802)|lysophosphatidic acid binding (GO:0035727)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(20)|ovary(2)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	41		Renal(207;0.0474)		Epithelial(149;6.88e-07)|all cancers(144;0.00013)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CATGAAGCACGTGGAGACCAA	0.612																																																	0								ENSG00000127831						147.0	142.0	144.0					2																	219292725		2203	4300	6503	VIL1	SO:0001583	missense	0			-	HGNC	X12901	CCDS2417.1	2q35	2012-10-02			ENSG00000127831	ENSG00000127831			12690	protein-coding gene	gene with protein product		193040		VIL		2846586	Standard	NM_007127		Approved	D2S1471	uc002via.3	P09327	OTTHUMG00000133112	ENST00000248444.5:c.385G>T	2.37:g.219292725G>T	ENSP00000248444:p.Val129Leu	Somatic	0	29	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	33	10.81	B2R9A7|Q53S11|Q96AC8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Gelsolin_dom,pfam_Villin_headpiece,superfamily_Villin_headpiece,smart_Villin/Gelsolin,smart_Villin_headpiece,pfscan_Villin_headpiece,prints_Villin/Gelsolin	p.V129L	ENST00000248444.5	37	c.385	CCDS2417.1	2	.	.	.	.	.	.	.	.	.	.	G	16.14	3.038842	0.55003	.	.	ENSG00000127831	ENST00000248444;ENST00000454069;ENST00000440053	T;T;T	0.18810	2.19;2.19;2.19	5.05	4.15	0.48705	.	0.000000	0.64402	D	0.000004	T	0.32852	0.0843	M	0.87328	2.875	0.52501	D	0.999955	P;P	0.40834	0.664;0.73	B;B	0.38500	0.242;0.275	T	0.43893	-0.9363	10	0.52906	T	0.07	-26.0694	15.4705	0.75437	0.0:0.1392:0.8608:0.0	.	129;129	Q96AC8;P09327	.;VILI_HUMAN	L	129;125;129	ENSP00000248444:V129L;ENSP00000412657:V125L;ENSP00000409270:V129L	ENSP00000248444:V129L	V	+	1	0	VIL1	219000969	1.000000	0.71417	0.639000	0.29394	0.215000	0.24574	4.750000	0.62162	1.337000	0.45525	0.462000	0.41574	GTG	-	NULL		0.612	VIL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VIL1	protein_coding	OTTHUMT00000256778.3	G	NM_007127	-		219292725	+1	no_errors	ENST00000248444	ensembl	human	known	74_37	missense	SNP	0.996	T
PRR14L	253143	genome.wustl.edu	37	22	32134586	32134586	+	Silent	SNP	A	A	G			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr22:32134586A>G	ENST00000327423.6	-	2	450	c.261T>C	c.(259-261)agT>agC	p.S87S	PRR14L_ENST00000434485.1_Silent_p.S87S|PRR14L_ENST00000397493.2_Silent_p.S87S|PRR14L_ENST00000461722.1_Intron	NM_173566.2	NP_775837.2	Q5THK1	PR14L_HUMAN	proline rich 14-like	87										endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(5)|skin(1)|urinary_tract(2)	14						GCCCAGGCTCACTCCCATGAT	0.527																																																	0								ENSG00000183530						120.0	104.0	109.0					22																	32134586		692	1591	2283	PRR14L	SO:0001819	synonymous_variant	0			-	HGNC	BC040859	CCDS13900.2	22q12.2	2011-01-25	2011-01-25	2011-01-25	ENSG00000183530	ENSG00000183530			28738	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 30"""	C22orf30		12477932	Standard	NM_173566		Approved	MGC50372	uc003alp.4	Q5THK1	OTTHUMG00000030139	ENST00000327423.6:c.261T>C	22.37:g.32134586A>G		Somatic	0	25	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	34	10.53	Q5THK4|Q6ZNN1|Q6ZWH0|Q8IW74|Q9H5T4	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.S87	ENST00000327423.6	37	c.261	CCDS13900.2	22																																																																																			-	NULL		0.527	PRR14L-001	NOVEL	basic|appris_principal|CCDS	protein_coding	PRR14L	protein_coding	OTTHUMT00000074993.2	A	NM_173566	-		32134586	-1	no_errors	ENST00000397493	ensembl	human	known	74_37	silent	SNP	0.024	G
LINC01020	340094	genome.wustl.edu	37	5	5034574	5034574	+	lincRNA	SNP	G	G	C			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr5:5034574G>C	ENST00000508201.1	+	0	103				CTD-2247C11.1_ENST00000509057.1_lincRNA					long intergenic non-protein coding RNA 1020																		ttgtgaccaagttgGAGCAGC	0.468																																																	0								ENSG00000215231																																			LINC01020			0			-	HGNC			5p15.32	2013-07-26			ENSG00000215231	ENSG00000215231		"""Long non-coding RNAs"""	27968	non-coding RNA	RNA, long non-coding						12477932	Standard	NR_026994		Approved				OTTHUMG00000161653		5.37:g.5034574G>C		Somatic	0	26	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	45	23.73		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000508201.1	37	NULL		5																																																																																			-	-		0.468	LINC01020-001	KNOWN	basic	lincRNA	LINC01020	lincRNA	OTTHUMT00000365595.1	G		-		5034574	+1	no_errors	ENST00000508201	ensembl	human	known	74_37	rna	SNP	0.001	C
PLCB3	5331	genome.wustl.edu	37	11	64033670	64033670	+	Nonsense_Mutation	SNP	G	G	T	rs367729670		TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr11:64033670G>T	ENST00000540288.1	+	27	3365	c.3262G>T	c.(3262-3264)Gag>Tag	p.E1088*	PLCB3_ENST00000325234.5_Nonsense_Mutation_p.E1021*|PLCB3_ENST00000279230.6_Nonsense_Mutation_p.E1088*	NM_000932.2	NP_000923.1	Q01970	PLCB3_HUMAN	phospholipase C, beta 3 (phosphatidylinositol-specific)	1088					inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|regulation of systemic arterial blood pressure (GO:0003073)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|protein complex (GO:0043234)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(14)|ovary(1)|pancreas(1)|prostate(3)|urinary_tract(1)	33						AGAGATGAACGAGAGGTGAAA	0.562																																																	0								ENSG00000149782						106.0	110.0	108.0					11																	64033670		2201	4297	6498	PLCB3	SO:0001587	stop_gained	0			-	HGNC	Z26649	CCDS8064.1, CCDS53654.1	11q13	2008-03-18			ENSG00000149782	ENSG00000149782	3.1.4.11		9056	protein-coding gene	gene with protein product		600230				7849701	Standard	NM_000932		Approved		uc009ypg.2	Q01970	OTTHUMG00000167816	ENST00000540288.1:c.3262G>T	11.37:g.64033670G>T	ENSP00000443631:p.Glu1088*	Somatic	0	22	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	14	17.65	A5PKZ6|G5E960|Q8N1A4	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_PLC-beta,pfam_PLC-beta_C,pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_PLipase_C_EF-hand-like,pfam_C2_dom,pfam_PLC-beta_CS,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_dom,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_dom,prints_Pinositol_PLipase_C,pfscan_C2_dom,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y	p.E1088*	ENST00000540288.1	37	c.3262	CCDS8064.1	11	.	.	.	.	.	.	.	.	.	.	G	38	6.695789	0.97768	.	.	ENSG00000149782	ENST00000279230;ENST00000540288;ENST00000325234	.	.	.	5.04	4.13	0.48395	.	2.247720	0.02285	N	0.069756	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	.	10.7541	0.46225	0.0909:0.0:0.9091:0.0	.	.	.	.	X	1088;1088;1021	.	ENSP00000279230:E1088X	E	+	1	0	PLCB3	63790246	1.000000	0.71417	0.386000	0.26170	0.317000	0.28152	6.522000	0.73783	1.135000	0.42183	0.455000	0.32223	GAG	-	pirsf_PLC-beta,pfam_PLC-beta_C		0.562	PLCB3-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	PLCB3	protein_coding	OTTHUMT00000396405.1	G		-		64033670	+1	no_errors	ENST00000279230	ensembl	human	known	74_37	nonsense	SNP	0.995	T
NISCH	11188	genome.wustl.edu	37	3	52505860	52505860	+	Missense_Mutation	SNP	T	T	A			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr3:52505860T>A	ENST00000479054.1	+	6	512	c.440T>A	c.(439-441)tTt>tAt	p.F147Y	NISCH_ENST00000488380.1_Missense_Mutation_p.F147Y|NISCH_ENST00000420808.2_Missense_Mutation_p.F147Y|NISCH_ENST00000345716.4_Missense_Mutation_p.F147Y			Q9Y2I1	NISCH_HUMAN	nischarin	147	Necessary for homooligomerization and targeting to endosomes.				actin cytoskeleton organization (GO:0030036)|apoptotic process (GO:0006915)|glucose metabolic process (GO:0006006)|negative regulation of cell migration (GO:0030336)|norepinephrine secretion (GO:0048243)|Rac protein signal transduction (GO:0016601)|regulation of blood pressure (GO:0008217)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytosol (GO:0005829)|endosome (GO:0005768)|membrane (GO:0016020)|plasma membrane (GO:0005886)	G-protein coupled amine receptor activity (GO:0008227)|identical protein binding (GO:0042802)|phosphatidylinositol binding (GO:0035091)			NS(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(9)|ovary(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	33				BRCA - Breast invasive adenocarcinoma(193;1.93e-05)|Kidney(197;0.00216)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)|OV - Ovarian serous cystadenocarcinoma(275;0.0577)	Tizanidine(DB00697)	GGCGAGGTCTTTGCCATTGGA	0.642											OREG0015615	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000010322						43.0	48.0	46.0					3																	52505860		2203	4300	6503	NISCH	SO:0001583	missense	0			-	HGNC	AF082516	CCDS33767.1, CCDS63651.1, CCDS63652.1	3p21.1	2008-07-18			ENSG00000010322	ENSG00000010322			18006	protein-coding gene	gene with protein product	"""imidazoline receptor candidate"", ""I-1 receptor candidate protein"", ""imidazoline receptor antisera selected"""	615507				11912194, 10882231	Standard	NM_007184		Approved	KIAA0975, I-1, IRAS	uc003ded.4	Q9Y2I1	OTTHUMG00000158571	ENST00000479054.1:c.440T>A	3.37:g.52505860T>A	ENSP00000418232:p.Phe147Tyr	Somatic	0	88	0.00	985	0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	39	9.30	C9J245|Q6PGP3|Q6PIB4|Q7L8M3|Q7Z2X6|Q9UES6|Q9UEU4|Q9UFW3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Phox,pfam_Leu-rich_rpt,superfamily_Phox,smart_Phox,pfscan_Phox	p.F147Y	ENST00000479054.1	37	c.440	CCDS33767.1	3	.	.	.	.	.	.	.	.	.	.	T	32	5.106805	0.94292	.	.	ENSG00000010322	ENST00000479054;ENST00000345716;ENST00000488380;ENST00000420808	T;T;T;T	0.09073	3.02;3.02;3.17;3.16	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	T	0.23330	0.0564	L	0.59436	1.845	0.50632	D	0.999884	D;D	0.76494	0.997;0.999	D;D	0.68483	0.914;0.958	T	0.00540	-1.1681	10	0.36615	T	0.2	-11.7344	14.0776	0.64900	0.0:0.0:0.0:1.0	.	147;147	Q9Y2I1;C9J715	NISCH_HUMAN;.	Y	147	ENSP00000418232:F147Y;ENSP00000339958:F147Y;ENSP00000417812:F147Y;ENSP00000392484:F147Y	ENSP00000339958:F147Y	F	+	2	0	NISCH	52480900	1.000000	0.71417	1.000000	0.80357	0.852000	0.48524	7.049000	0.76613	2.067000	0.61834	0.459000	0.35465	TTT	-	NULL		0.642	NISCH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NISCH	protein_coding	OTTHUMT00000351357.1	T	NM_007184	-		52505860	+1	no_errors	ENST00000345716	ensembl	human	known	74_37	missense	SNP	1.000	A
COL4A3	1285	genome.wustl.edu	37	2	228159755	228159755	+	Missense_Mutation	SNP	C	C	T			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr2:228159755C>T	ENST00000396578.3	+	40	3656	c.3494C>T	c.(3493-3495)cCa>cTa	p.P1165L	AC097662.2_ENST00000396588.2_RNA|AC097662.2_ENST00000433324.1_RNA|AC097662.2_ENST00000439598.2_RNA	NM_000091.4	NP_000082.2	Q01955	CO4A3_HUMAN	collagen, type IV, alpha 3 (Goodpasture antigen)	1165	Triple-helical region.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|blood circulation (GO:0008015)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|collagen catabolic process (GO:0030574)|endothelial cell apoptotic process (GO:0072577)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endopeptidase activity (GO:0010951)|sensory perception of sound (GO:0007605)	basement membrane (GO:0005604)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)|integrin binding (GO:0005178)|metalloendopeptidase inhibitor activity (GO:0008191)|structural molecule activity (GO:0005198)			NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	55		all_lung(227;0.00101)|Lung NSC(271;0.00278)|Renal(207;0.0112)|Ovarian(221;0.0129)|all_hematologic(139;0.211)|Esophageal squamous(248;0.247)		Epithelial(121;1.17e-46)|all cancers(144;6.87e-42)|Lung(261;0.0137)|LUSC - Lung squamous cell carcinoma(224;0.0187)		ATTCCTGGTCCAGCCGGAGAA	0.408																																																	0								ENSG00000169031						125.0	130.0	129.0					2																	228159755		1855	4099	5954	COL4A3	SO:0001583	missense	0			-	HGNC		CCDS42829.1	2q36-q37	2014-09-17			ENSG00000169031	ENSG00000169031		"""Collagens"""	2204	protein-coding gene	gene with protein product	"""tumstatin"""	120070				1737849	Standard	NM_000091		Approved		uc002vom.2	Q01955	OTTHUMG00000149891	ENST00000396578.3:c.3494C>T	2.37:g.228159755C>T	ENSP00000379823:p.Pro1165Leu	Somatic	0	31	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70	Q53QQ1|Q53R14|Q53RW8|Q9BQT2|Q9NYC4|Q9UDJ9|Q9UDK9|Q9UDL0|Q9UDL1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Collagen,pfam_Collagen_VI_NC,superfamily_C-type_lectin_fold,smart_Collagen_VI_NC	p.P1165L	ENST00000396578.3	37	c.3494	CCDS42829.1	2	.	.	.	.	.	.	.	.	.	.	C	11.07	1.530262	0.27387	.	.	ENSG00000169031	ENST00000396578;ENST00000328380;ENST00000335583;ENST00000396574;ENST00000315699	D	0.93247	-3.19	5.79	4.91	0.64330	.	0.000000	0.64402	D	0.000013	D	0.90960	0.7158	N	0.13043	0.29	0.44927	D	0.997949	D;D;D;D	0.89917	0.999;0.999;0.999;1.0	D;D;D;D	0.77557	0.982;0.982;0.982;0.99	D	0.86269	0.1660	10	0.16420	T	0.52	.	8.1384	0.31069	0.1551:0.7631:0.0:0.0817	.	1165;1165;1165;1165	Q01955-5;Q01955-4;Q01955-2;Q01955	.;.;.;CO4A3_HUMAN	L	1165	ENSP00000379823:P1165L	ENSP00000323334:P1165L	P	+	2	0	COL4A3	227867999	0.010000	0.17322	0.437000	0.26809	0.935000	0.57460	1.692000	0.37731	2.750000	0.94351	0.563000	0.77884	CCA	-	pfam_Collagen		0.408	COL4A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL4A3	protein_coding	OTTHUMT00000331409.2	C	NM_000091	-		228159755	+1	no_errors	ENST00000396578	ensembl	human	known	74_37	missense	SNP	0.379	T
ERCC5	2073	genome.wustl.edu	37	13	103524612	103524612	+	Frame_Shift_Del	DEL	A	A	-			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr13:103524612delA	ENST00000355739.4	+	13	4166	c.2743delA	c.(2743-2745)aaafs	p.K917fs	BIVM-ERCC5_ENST00000602836.1_Frame_Shift_Del_p.E1340fs|ERCC5_ENST00000375954.1_Frame_Shift_Del_p.K150fs	NM_000123.3	NP_000114	P28715	ERCC5_HUMAN	excision repair cross-complementation group 5	917					DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|negative regulation of apoptotic process (GO:0043066)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA incision, 3'-to lesion (GO:0006295)|response to UV (GO:0009411)|response to UV-C (GO:0010225)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)	intermediate filament cytoskeleton (GO:0045111)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	bubble DNA binding (GO:0000405)|double-stranded DNA binding (GO:0003690)|endodeoxyribonuclease activity (GO:0004520)|endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)|single-stranded DNA binding (GO:0003697)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(4)|large_intestine(8)|lung(18)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	51	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)					CACCAAAGTGAAAAAAAAATT	0.428			"""Mis, N, F"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																														yes	Rec		Xeroderma pigmentosum (G)	13	13q33	2073	"""excision repair cross-complementing rodent repair deficiency, complementation group 5 (xeroderma pigmentosum, complementation group G (Cockayne syndrome))"""		E	0								ENSG00000134899						79.0	77.0	77.0					13																	103524612		2203	4300	6503	ERCC5	SO:0001589	frameshift_variant	0	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV		HGNC	X71342	CCDS32004.1	13q22-q34	2014-09-17	2014-03-07		ENSG00000134899	ENSG00000134899			3437	protein-coding gene	gene with protein product	"""Cockayne syndrome"""	133530	"""xeroderma pigmentosum, complementation group G"", ""excision repair cross-complementing rodent repair deficiency, complementation group 5"""	ERCM2, XPGC		8088806	Standard	NM_000123		Approved			P28715	OTTHUMG00000017310	ENST00000355739.4:c.2743delA	13.37:g.103524612delA	ENSP00000347978:p.Lys917fs	Somatic	0	28	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	57	9.52	A6NGT4|Q5JUS4|Q5JUS5|Q7Z2V3|Q8IZL6|Q8N1B7|Q9HD59|Q9HD60	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_XPG_DNA_repair_N,pfam_XPG-I_dom,superfamily_5-3_exonuclease_C,smart_XPG_DNA_repair_N,smart_XPG-I_dom,smart_HhH2,prints_XPG/Rad2_eukaryotes,prints_XPG/Rad2,tigrfam_XPG/Rad2_eukaryotes	p.K917fs	ENST00000355739.4	37	c.2743	CCDS32004.1	13																																																																																			-	superfamily_5-3_exonuclease_C,tigrfam_XPG/Rad2_eukaryotes		0.428	ERCC5-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	ERCC5	protein_coding	OTTHUMT00000045708.1	A				103524612	+1	no_errors	ENST00000355739	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
ZSWIM8	23053	genome.wustl.edu	37	10	75556805	75556805	+	Intron	SNP	T	T	A			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr10:75556805T>A	ENST00000605216.1	+	16	3476				ZSWIM8_ENST00000604524.1_Intron|RP11-574K11.31_ENST00000603027.1_3'UTR|ZSWIM8_ENST00000604729.1_Intron|ZSWIM8_ENST00000398706.2_Intron|ZSWIM8_ENST00000603114.1_Intron|ZSWIM8-AS1_ENST00000456638.2_RNA	NM_001242487.1	NP_001229416.1	A7E2V4	ZSWM8_HUMAN	zinc finger, SWIM-type containing 8								zinc ion binding (GO:0008270)										GGGGGATGAATGGTGTGGACC	0.607																																																	0								ENSG00000272589						26.0	28.0	27.0					10																	75556805		1961	4160	6121	ZSWIM8-AS1	SO:0001627	intron_variant	0			-	HGNC	BC151206, BC040726	CCDS44440.1, CCDS60560.1	10q22.3	2012-11-02	2012-11-02	2012-11-02	ENSG00000214655	ENSG00000214655		"""Zinc fingers, SWIM-type"""	23528	protein-coding gene	gene with protein product			"""KIAA0913"""	KIAA0913			Standard	NM_015037		Approved	4832404P21Rik	uc001jvj.3	A7E2V4	OTTHUMG00000018486	ENST00000605216.1:c.3259+33T>A	10.37:g.75556805T>A		Somatic	0	45	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	26	13.33	B2RP37|O94987|Q17RS8|Q2TAB8|Q6P439|Q8IW81|Q8NB34|Q9H8F3	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000605216.1	37	NULL		10																																																																																			-	-		0.607	ZSWIM8-012	NOVEL	basic|appris_principal	protein_coding	ZSWIM8-AS1	protein_coding	OTTHUMT00000468545.1	T	NM_001242487	-		75556805	-1	no_errors	ENST00000456638	ensembl	human	known	74_37	rna	SNP	0.021	A
MUC12	10071	genome.wustl.edu	37	7	100646158	100646158	+	Missense_Mutation	SNP	C	C	A			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr7:100646158C>A	ENST00000379442.3	+	5	12743	c.12743C>A	c.(12742-12744)aCa>aAa	p.T4248K	MUC12_ENST00000536621.1_Missense_Mutation_p.T4105K			Q9UKN1	MUC12_HUMAN	mucin 12, cell surface associated	4248	28 X 19 AA approximate tandem repeats of E-E-S-X-X-X-H-X-X-P-X-X-T-X-T-X-X-X-P.|Ser-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|regulation of cell growth (GO:0001558)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)				breast(6)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)|stomach(13)	25						GAAGTATCCACAACCTACCAC	0.537																																																	0								ENSG00000205277						23.0	25.0	25.0					7																	100646158		520	1083	1603	MUC12	SO:0001583	missense	0			-	HGNC	AF147790, AF147791	CCDS55139.1	7q22	2007-01-17	2006-03-14		ENSG00000205277	ENSG00000205277		"""Mucins"""	7510	protein-coding gene	gene with protein product		604609	"""mucin 11"""	MUC11		10463611	Standard	NM_001164462		Approved		uc003uxo.3	Q9UKN1	OTTHUMG00000157042	ENST00000379442.3:c.12743C>A	7.37:g.100646158C>A	ENSP00000368755:p.Thr4248Lys	Somatic	0	77	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	61	80	43.26	A6ND38|F5GWV9|Q9UKN0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SEA_dom	p.T4105K	ENST00000379442.3	37	c.12314		7	.	.	.	.	.	.	.	.	.	.	C	2.384	-0.341377	0.05243	.	.	ENSG00000205277	ENST00000379442;ENST00000536621	T;T	0.11821	2.74;2.74	0.53	0.53	0.17102	.	.	.	.	.	T	0.06645	0.0170	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.41610	-0.9499	7	0.30078	T	0.28	.	6.8033	0.23764	0.0:0.9998:0.0:2.0E-4	.	.	.	.	K	4248;4105	ENSP00000368755:T4248K;ENSP00000441929:T4105K	ENSP00000368755:T4248K	T	+	2	0	MUC12	100432878	0.002000	0.14202	0.002000	0.10522	0.002000	0.02628	1.639000	0.37176	0.519000	0.28406	0.195000	0.17529	ACA	-	NULL		0.537	MUC12-001	NOVEL	basic|appris_candidate_longest	protein_coding	MUC12	protein_coding	OTTHUMT00000347234.1	C	XM_379904	-		100646158	+1	no_errors	ENST00000536621	ensembl	human	known	74_37	missense	SNP	0.005	A
CACNA2D3	55799	genome.wustl.edu	37	3	54871231	54871231	+	Missense_Mutation	SNP	C	C	G			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr3:54871231C>G	ENST00000474759.1	+	15	1492	c.1444C>G	c.(1444-1446)Cct>Gct	p.P482A	CACNA2D3_ENST00000288197.5_Missense_Mutation_p.P482A|CACNA2D3_ENST00000415676.2_Missense_Mutation_p.P482A|CACNA2D3_ENST00000490478.1_Missense_Mutation_p.P388A	NM_018398.2	NP_060868.2	Q8IZS8	CA2D3_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 3	482	Cache.					integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(17)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(3)	59				KIRC - Kidney renal clear cell carcinoma(284;0.00287)|Kidney(284;0.00327)	Amlodipine(DB00381)|Nilvadipine(DB06712)|Spironolactone(DB00421)	TGTAGCCATGCCTGTGTTTAG	0.537																																																	0								ENSG00000157445						210.0	206.0	207.0					3																	54871231		2005	4171	6176	CACNA2D3	SO:0001583	missense	0			-	HGNC	AJ272268	CCDS54598.1	3p21.1	2010-10-05	2008-02-26		ENSG00000157445	ENSG00000157445		"""Calcium channel subunits"""	15460	protein-coding gene	gene with protein product		606399				11245980	Standard	XM_005265318		Approved	HSA272268	uc003dhf.3	Q8IZS8	OTTHUMG00000158580	ENST00000474759.1:c.1444C>G	3.37:g.54871231C>G	ENSP00000419101:p.Pro482Ala	Somatic	0	36	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	20	13.04	B2RPL6|Q9NY16|Q9NY18	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_VWA_N,pfam_Cache_domain,pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	p.P482A	ENST00000474759.1	37	c.1444	CCDS54598.1	3	.	.	.	.	.	.	.	.	.	.	C	25.9	4.680916	0.88542	.	.	ENSG00000157445	ENST00000415676;ENST00000474759;ENST00000288197;ENST00000490478;ENST00000398624;ENST00000438476	T;T;T;T	0.16457	2.34;2.34;2.34;2.38	6.06	6.06	0.98353	Cache (1);	0.000000	0.85682	D	0.000000	T	0.45013	0.1321	M	0.76574	2.34	0.54753	D	0.999989	D	0.89917	1.0	D	0.83275	0.996	T	0.09729	-1.0661	10	0.45353	T	0.12	-13.8408	18.8014	0.92018	0.0:1.0:0.0:0.0	.	482	Q8IZS8	CA2D3_HUMAN	A	482;482;482;388;388;381	ENSP00000389506:P482A;ENSP00000419101:P482A;ENSP00000288197:P482A;ENSP00000417279:P388A	ENSP00000288197:P482A	P	+	1	0	CACNA2D3	54846271	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.925000	0.75829	2.882000	0.98803	0.655000	0.94253	CCT	-	pfam_Cache_domain		0.537	CACNA2D3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNA2D3	protein_coding	OTTHUMT00000351402.1	C		-		54871231	+1	no_errors	ENST00000288197	ensembl	human	known	74_37	missense	SNP	1.000	G
MYO15A	51168	genome.wustl.edu	37	17	18025157	18025157	+	Nonsense_Mutation	SNP	G	G	T			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr17:18025157G>T	ENST00000205890.5	+	2	3381	c.3043G>T	c.(3043-3045)Gag>Tag	p.E1015*		NM_016239.3	NP_057323.3	Q9UKN7	MYO15_HUMAN	myosin XVA	1015					inner ear morphogenesis (GO:0042472)|locomotory behavior (GO:0007626)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|stereocilium (GO:0032420)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(5)|central_nervous_system(2)|endometrium(17)|kidney(3)|large_intestine(16)|lung(27)|ovary(3)|pancreas(1)|prostate(6)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	99	all_neural(463;0.228)					GCCTGAAGAAGAGGCCACCCT	0.622																																																	0								ENSG00000091536						33.0	38.0	37.0					17																	18025157		1914	4123	6037	MYO15A	SO:0001587	stop_gained	0			-	HGNC	AF144094	CCDS42271.1	17p11.2	2011-09-27			ENSG00000091536	ENSG00000091536		"""Myosins / Myosin superfamily : Class XV"""	7594	protein-coding gene	gene with protein product		602666		DFNB3, MYO15		9603736	Standard	NM_016239		Approved		uc021trl.1	Q9UKN7	OTTHUMG00000059390	ENST00000205890.5:c.3043G>T	17.37:g.18025157G>T	ENSP00000205890:p.Glu1015*	Somatic	0	41	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	66	23.26	B4DFC7	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Myosin_head_motor_dom,pfam_MyTH4_dom,pfam_SH3_2,pfam_FERM_central,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,superfamily_FERM_central,superfamily_SH3_domain,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,smart_MyTH4_dom,smart_SH3_domain,smart_Band_41_domain,pfscan_FERM_domain,pfscan_IQ_motif_EF-hand-BS,pfscan_MyTH4_dom,prints_Myosin_head_motor_dom	p.E1015*	ENST00000205890.5	37	c.3043	CCDS42271.1	17	.	.	.	.	.	.	.	.	.	.	g	44	10.635156	0.99441	.	.	ENSG00000091536	ENST00000205890	.	.	.	4.83	3.86	0.44501	.	.	.	.	.	.	.	.	.	.	.	0.38678	D	0.952462	.	.	.	.	.	.	.	.	.	.	0.10377	T	0.69	.	8.8792	0.35365	0.105:0.0:0.895:0.0	.	.	.	.	X	1015	.	ENSP00000205890:E1015X	E	+	1	0	MYO15A	17965882	0.312000	0.24545	0.480000	0.27341	0.479000	0.33129	1.723000	0.38053	1.028000	0.39785	0.555000	0.69702	GAG	-	NULL		0.622	MYO15A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO15A	protein_coding	OTTHUMT00000132048.1	G	NM_016239	-		18025157	+1	no_errors	ENST00000205890	ensembl	human	known	74_37	nonsense	SNP	0.545	T
ZNF274	10782	genome.wustl.edu	37	19	58723009	58723009	+	Silent	SNP	C	C	T			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr19:58723009C>T	ENST00000326804.4	+	8	1392	c.933C>T	c.(931-933)taC>taT	p.Y311Y	ZNF274_ENST00000424679.2_Silent_p.Y206Y|ZNF274_ENST00000345813.3_Silent_p.Y279Y|ZNF274_ENST00000597818.1_3'UTR	NM_001278734.1|NM_133502.1	NP_001265663.1|NP_598009.1	Q96GC6	ZN274_HUMAN	zinc finger protein 274	312	KRAB 2. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(13)|ovary(1)|prostate(1)|skin(1)	21		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Ovarian(87;0.0443)|Breast(46;0.0889)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0168)|Lung(386;0.215)		GGACCGAGTACCGCGATGTGA	0.617																																																	0								ENSG00000171606						105.0	121.0	116.0					19																	58723009		2197	4300	6497	ZNF274	SO:0001819	synonymous_variant	0			-	HGNC	AB029149	CCDS74473.1, CCDS74474.1, CCDS74475.1, CCDS74476.1	19q13.43	2013-01-09				ENSG00000171606		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13068	protein-coding gene	gene with protein product		605467				10777669	Standard	NM_133502		Approved	ZKSCAN19, ZSCAN51	uc002qrs.1	Q96GC6		ENST00000326804.4:c.933C>T	19.37:g.58723009C>T		Somatic	0	35	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	2	91.30	Q53XU4|Q6MZG1|Q8WY37|Q8WY38|Q92969|Q9UII0|Q9UII1	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Krueppel-associated_box,pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.Y311	ENST00000326804.4	37	c.933		19																																																																																			-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box		0.617	ZNF274-201	KNOWN	basic|appris_candidate_longest	protein_coding	ZNF274	protein_coding		C	NM_133502	-		58723009	+1	no_errors	ENST00000326804	ensembl	human	known	74_37	silent	SNP	0.994	T
ZNF365	22891	genome.wustl.edu	37	10	64159366	64159366	+	Frame_Shift_Del	DEL	A	A	-			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr10:64159366delA	ENST00000395254.3	+	5	1322	c.1042delA	c.(1042-1044)aaafs	p.K349fs	ZNF365_ENST00000410046.3_Intron|ZNF365_ENST00000466727.1_3'UTR|ZNF365_ENST00000395255.3_Intron	NM_014951.2	NP_055766.2	Q70YC4	TALAN_HUMAN	zinc finger protein 365	0										breast(1)|endometrium(6)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27	Prostate(12;0.0297)|all_hematologic(501;0.228)					GAACCACCTGAAAAAGGCCAA	0.567																																																	0								ENSG00000138311						140.0	137.0	138.0					10																	64159366		2203	4300	6503	ZNF365	SO:0001589	frameshift_variant	0				HGNC	AB020651	CCDS7264.1, CCDS7265.1, CCDS31209.1, CCDS41531.1	10q21.2	2008-10-28			ENSG00000138311	ENSG00000138311		"""Zinc fingers, C2H2-type"""	18194	protein-coding gene	gene with protein product	"""Talanin"""	607818				10048485, 12740763	Standard	NM_199450		Approved	KIAA0844, UAN	uc001jmc.2	Q70YC4	OTTHUMG00000018302	ENST00000395254.3:c.1042delA	10.37:g.64159366delA	ENSP00000378674:p.Lys349fs	Somatic	0	31	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	22	12.00		Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	NULL	p.K349fs	ENST00000395254.3	37	c.1042	CCDS31209.1	10																																																																																			-	NULL		0.567	ZNF365-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF365	protein_coding	OTTHUMT00000048238.2	A	NM_014951			64159366	+1	no_errors	ENST00000395254	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
DDX21	9188	genome.wustl.edu	37	10	70737433	70737433	+	Missense_Mutation	SNP	A	A	T			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr10:70737433A>T	ENST00000354185.4	+	12	1989	c.1891A>T	c.(1891-1893)Aac>Tac	p.N631Y		NM_001256910.1|NM_004728.3	NP_001243839.1|NP_004719.2	Q9NR30	DDX21_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 21	631					ATP catabolic process (GO:0006200)|osteoblast differentiation (GO:0001649)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(6)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)	20						CTCCTTGATCAACTCAAATGT	0.483																																																	0								ENSG00000165732						93.0	92.0	92.0					10																	70737433		2203	4300	6503	DDX21	SO:0001583	missense	0			-	HGNC	U41387	CCDS31211.1, CCDS73144.1	10q21	2013-05-13	2012-02-23		ENSG00000165732	ENSG00000165732		"""DEAD-boxes"""	2744	protein-coding gene	gene with protein product		606357	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 21"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 21"""			8614622, 18180292	Standard	NM_004728		Approved	RH-II/GU, GURDB	uc001jov.2	Q9NR30	OTTHUMG00000018366	ENST00000354185.4:c.1891A>T	10.37:g.70737433A>T	ENSP00000346120:p.Asn631Tyr	Somatic	0	31	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00	B2RDL0|Q13436|Q5VX41|Q68D35	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_GUCT,pfam_Helicase_C,pfam_Helicase/UvrB_dom,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.N631Y	ENST00000354185.4	37	c.1891	CCDS31211.1	10	.	.	.	.	.	.	.	.	.	.	A	26.5	4.744961	0.89663	.	.	ENSG00000165732	ENST00000354185	T	0.18016	2.24	5.61	5.61	0.85477	GUCT (1);	0.080581	0.85682	D	0.000000	T	0.37865	0.1019	M	0.75447	2.3	0.80722	D	1	D	0.56746	0.977	P	0.56398	0.797	T	0.21759	-1.0236	10	0.72032	D	0.01	-1.3352	16.1025	0.81194	1.0:0.0:0.0:0.0	.	631	Q9NR30	DDX21_HUMAN	Y	631	ENSP00000346120:N631Y	ENSP00000346120:N631Y	N	+	1	0	DDX21	70407439	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	6.664000	0.74437	2.254000	0.74563	0.533000	0.62120	AAC	-	pfam_GUCT		0.483	DDX21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX21	protein_coding	OTTHUMT00000048374.1	A	NM_004728	-		70737433	+1	no_errors	ENST00000354185	ensembl	human	known	74_37	missense	SNP	1.000	T
LAMTOR1	55004	genome.wustl.edu	37	11	71817014	71817014	+	5'Flank	SNP	C	C	T			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr11:71817014C>T	ENST00000278671.5	-	0	0				LAMTOR1_ENST00000535107.1_5'Flank|LRTOMT_ENST00000419228.1_Intron|LRTOMT_ENST00000435085.1_Missense_Mutation_p.A39V|LAMTOR1_ENST00000545249.1_5'Flank|LRTOMT_ENST00000307198.7_Missense_Mutation_p.A39V|LAMTOR1_ENST00000538404.1_5'Flank|LRTOMT_ENST00000439209.1_Intron|snoU13_ENST00000459046.1_RNA	NM_017907.2	NP_060377.1	Q6IAA8	LTOR1_HUMAN	late endosomal/lysosomal adaptor, MAPK and MTOR activator 1						cell growth (GO:0016049)|cellular protein localization (GO:0034613)|cellular response to amino acid stimulus (GO:0071230)|cholesterol homeostasis (GO:0042632)|endosome localization (GO:0032439)|endosome organization (GO:0007032)|lysosome localization (GO:0032418)|lysosome organization (GO:0007040)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of TOR signaling (GO:0032008)|regulation of cholesterol efflux (GO:0010874)|regulation of cholesterol esterification (GO:0010872)|regulation of cholesterol import (GO:0060620)|regulation of receptor recycling (GO:0001919)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|late endosome membrane (GO:0031902)|lysosome (GO:0005764)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|Ragulator complex (GO:0071986)				cervix(1)	1						CCTGCCATTGCATTGGCCTTC	0.587																																																	0								ENSG00000184154						55.0	55.0	55.0					11																	71817014		692	1591	2283	LRTOMT	SO:0001631	upstream_gene_variant	0			-	HGNC	AK000632	CCDS8209.1	11q13.4	2011-05-18	2011-02-15	2011-02-15	ENSG00000149357	ENSG00000149357			26068	protein-coding gene	gene with protein product	"""p27kip1 releasing factor from RhoA"", ""protein associated with DRMs and endosomes"""	613510	"""chromosome 11 open reading frame 59"""	C11orf59		12358155	Standard	NM_017907		Approved	FLJ20625, p18, p27RF-Rho, Pdro, Ragulator1	uc001ort.3	Q6IAA8	OTTHUMG00000167869		11.37:g.71817014C>T	Exception_encountered	Somatic	0	43	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	45	21.05	Q8WZ09|Q9NWT0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_O-MeTrfase_3	p.A39V	ENST00000278671.5	37	c.116	CCDS8209.1	11	.	.	.	.	.	.	.	.	.	.	C	26.2	4.715174	0.89112	.	.	ENSG00000184154	ENST00000435085;ENST00000307198	D;D	0.91237	-2.81;-2.81	4.27	4.27	0.50696	.	.	.	.	.	D	0.91379	0.7280	N	0.24115	0.695	0.41583	D	0.988752	D	0.89917	1.0	D	0.80764	0.994	D	0.91641	0.5327	9	0.41790	T	0.15	-4.7738	16.8442	0.85976	0.0:1.0:0.0:0.0	.	39	Q8WZ04	TOMT_HUMAN	V	39	ENSP00000409789:A39V;ENSP00000305742:A39V	ENSP00000409789:A39V	A	+	2	0	LRTOMT	71494662	1.000000	0.71417	0.973000	0.42090	0.787000	0.44495	5.026000	0.64103	2.372000	0.80975	0.462000	0.41574	GCA	-	NULL		0.587	LAMTOR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRTOMT	protein_coding	OTTHUMT00000396733.1	C	NM_017907	-		71817014	+1	no_errors	ENST00000307198	ensembl	human	known	74_37	missense	SNP	0.998	T
LAMP3	27074	genome.wustl.edu	37	3	182872145	182872145	+	Silent	SNP	T	T	C			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr3:182872145T>C	ENST00000265598.3	-	2	339	c.84A>G	c.(82-84)aaA>aaG	p.K28K	LAMP3_ENST00000466939.1_Silent_p.K4K	NM_014398.3	NP_055213.2	Q9UQV4	LAMP3_HUMAN	lysosomal-associated membrane protein 3	28					cell proliferation (GO:0008283)|immune system process (GO:0002376)	alveolar lamellar body membrane (GO:0097233)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(9)|ovary(2)|prostate(2)	28	all_cancers(143;9.14e-14)|Ovarian(172;0.0355)		all cancers(12;2.91e-44)|Epithelial(37;5.52e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;4.16e-21)			CTGGAAATGCTTTTGCTCTCA	0.413																																																	0								ENSG00000078081						134.0	125.0	128.0					3																	182872145		2203	4300	6503	LAMP3	SO:0001819	synonymous_variant	0			-	HGNC	AB013924	CCDS3242.1	3q26.3-q27	2011-11-24			ENSG00000078081	ENSG00000078081		"""CD molecules"""	14582	protein-coding gene	gene with protein product		605883				9721848	Standard	NM_014398		Approved	LAMP, TSC403, DC-LAMP, DCLAMP, CD208	uc003flh.4	Q9UQV4	OTTHUMG00000158387	ENST00000265598.3:c.84A>G	3.37:g.182872145T>C		Somatic	0	29	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	17	15.00	D3DNS4|O94781|Q8NEC8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Lysosome-assoc_membr_glycop,prints_Lysosome-assoc_membr_glycop	p.K28	ENST00000265598.3	37	c.84	CCDS3242.1	3																																																																																			-	NULL		0.413	LAMP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMP3	protein_coding	OTTHUMT00000350863.1	T		-		182872145	-1	no_errors	ENST00000265598	ensembl	human	known	74_37	silent	SNP	0.000	C
TMEM87A	25963	genome.wustl.edu	37	15	42553434	42553434	+	Missense_Mutation	SNP	T	T	A			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr15:42553434T>A	ENST00000389834.4	-	5	683	c.419A>T	c.(418-420)gAt>gTt	p.D140V	TMEM87A_ENST00000307216.6_Missense_Mutation_p.D140V|TMEM87A_ENST00000448392.1_Missense_Mutation_p.D79V|TMEM87A_ENST00000568432.1_5'UTR	NM_015497.3	NP_056312.2	Q8NBN3	TM87A_HUMAN	transmembrane protein 87A	140						integral component of membrane (GO:0016021)				breast(1)|endometrium(4)|kidney(4)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	24		all_cancers(109;4.28e-16)|all_epithelial(112;1.04e-14)|Lung NSC(122;5.01e-09)|all_lung(180;2.24e-08)|Melanoma(134;0.0574)|Colorectal(260;0.152)		GBM - Glioblastoma multiforme(94;1.03e-06)		ATGCATAAAATCTCCAGAAAA	0.328																																																	0								ENSG00000103978						37.0	38.0	38.0					15																	42553434		2201	4299	6500	TMEM87A	SO:0001583	missense	0			-	HGNC	AF132733	CCDS32205.1, CCDS45243.1, CCDS66742.1	15q15.1	2005-10-30				ENSG00000103978			24522	protein-coding gene	gene with protein product						12477932	Standard	XM_005254287		Approved	DKFZP564G2022	uc021sjr.1	Q8NBN3		ENST00000389834.4:c.419A>T	15.37:g.42553434T>A	ENSP00000374484:p.Asp140Val	Somatic	0	36	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	86	17.31	Q6NT77|Q8NCA4|Q9BS46|Q9P103|Q9Y3Y7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TM_rcpt_euk	p.D140V	ENST00000389834.4	37	c.419	CCDS32205.1	15	.	.	.	.	.	.	.	.	.	.	T	19.20	3.781337	0.70222	.	.	ENSG00000103978	ENST00000389834;ENST00000448392;ENST00000535305;ENST00000307216	.	.	.	4.64	4.64	0.57946	.	0.312241	0.33515	N	0.004831	T	0.51449	0.1675	N	0.24115	0.695	0.80722	D	1	B;B;D	0.63046	0.068;0.098;0.992	B;B;P	0.59546	0.014;0.031;0.859	T	0.48317	-0.9046	9	0.34782	T	0.22	-2.3058	10.6149	0.45445	0.0:0.0:0.0:1.0	.	140;79;140	Q8NBN3;Q8NBN3-3;Q8NBN3-2	TM87A_HUMAN;.;.	V	140;79;116;140	.	ENSP00000305894:D140V	D	-	2	0	TMEM87A	40340726	0.988000	0.35896	0.885000	0.34714	0.961000	0.63080	3.634000	0.54302	2.084000	0.62774	0.383000	0.25322	GAT	-	NULL		0.328	TMEM87A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	TMEM87A	protein_coding	OTTHUMT00000420482.2	T	NM_015497	-		42553434	-1	no_errors	ENST00000389834	ensembl	human	known	74_37	missense	SNP	0.934	A
RHCG	51458	genome.wustl.edu	37	15	90023597	90023597	+	Missense_Mutation	SNP	C	C	T			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr15:90023597C>T	ENST00000268122.4	-	4	633	c.565G>A	c.(565-567)Gcc>Acc	p.A189T	RHCG_ENST00000544600.1_Missense_Mutation_p.A189T	NM_016321.1	NP_057405.1	Q9UBD6	RHCG_HUMAN	Rh family, C glycoprotein	189					amine transport (GO:0015837)|ammonium transmembrane transport (GO:0072488)|ammonium transport (GO:0015696)|cellular ion homeostasis (GO:0006873)|epithelial cell differentiation (GO:0030855)|homeostatic process (GO:0042592)|regulation of pH (GO:0006885)|transepithelial ammonium transport (GO:0070634)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ammonium transmembrane transporter activity (GO:0008519)|ankyrin binding (GO:0030506)			breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	Lung NSC(78;0.0237)|all_lung(78;0.0478)					CCAAAGTAGGCGCCAAATGTG	0.572																																																	0								ENSG00000140519						214.0	197.0	203.0					15																	90023597		2200	4299	6499	RHCG	SO:0001583	missense	0			-	HGNC	AF081497	CCDS10351.1	15q25	2013-05-22	2006-02-23		ENSG00000140519	ENSG00000140519		"""Solute carriers"""	18140	protein-coding gene	gene with protein product		605381	"""chromosome 15 open reading frame 6"", ""Rhesus blood group, C glycoprotein"""	C15orf6		10852913	Standard	NM_016321		Approved	RHGK, PDRC2, SLC42A3	uc002bnz.2	Q9UBD6	OTTHUMG00000149647	ENST00000268122.4:c.565G>A	15.37:g.90023597C>T	ENSP00000268122:p.Ala189Thr	Somatic	0	23	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	22	38.89	A8K4D4|Q6X3Y4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_NH4_transpt_AmtB-like_dom,superfamily_NH4_transpt_AmtB-like_dom,prints_RhesusRHD	p.A189T	ENST00000268122.4	37	c.565	CCDS10351.1	15	.	.	.	.	.	.	.	.	.	.	C	34	5.391862	0.95988	.	.	ENSG00000140519	ENST00000544600;ENST00000268122;ENST00000536247	T;T	0.29655	1.56;1.56	5.21	5.21	0.72293	Ammonium transporter AmtB-like (3);	0.099800	0.64402	D	0.000002	T	0.66509	0.2796	M	0.92077	3.27	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.76575	0.988;0.988	T	0.75676	-0.3235	9	.	.	.	-22.2471	18.8117	0.92059	0.0:1.0:0.0:0.0	.	189;189	A8K4D4;Q9UBD6	.;RHCG_HUMAN	T	189;189;180	ENSP00000438123:A189T;ENSP00000268122:A189T	.	A	-	1	0	RHCG	87824601	1.000000	0.71417	0.984000	0.44739	0.932000	0.56968	7.788000	0.85771	2.462000	0.83206	0.456000	0.33151	GCC	-	pfam_NH4_transpt_AmtB-like_dom,superfamily_NH4_transpt_AmtB-like_dom,prints_RhesusRHD		0.572	RHCG-001	KNOWN	basic|CCDS	protein_coding	RHCG	protein_coding	OTTHUMT00000312855.2	C	NM_016321	-		90023597	-1	no_errors	ENST00000268122	ensembl	human	known	74_37	missense	SNP	1.000	T
HTATIP2	10553	genome.wustl.edu	37	11	20403784	20403784	+	Splice_Site	SNP	G	G	T			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr11:20403784G>T	ENST00000451739.2	+	4	943	c.502G>T	c.(502-504)Gga>Tga	p.G168*	HTATIP2_ENST00000419348.2_Splice_Site_p.G202*|HTATIP2_ENST00000531058.1_Splice_Site_p.G122*|HTATIP2_ENST00000443524.2_Splice_Site_p.G168*|HTATIP2_ENST00000421577.2_Splice_Site_p.G168*	NM_001098522.1	NP_001091992.1			HIV-1 Tat interactive protein 2, 30kDa											large_intestine(2)|lung(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	8						ATTTAGGCCTGGGTAAGTATA	0.338																																																	0								ENSG00000109854						102.0	115.0	111.0					11																	20403784		2202	4300	6502	HTATIP2	SO:0001630	splice_region_variant	0			-	HGNC	AF039103	CCDS7852.1, CCDS44553.1, CCDS53613.1	11p15.1	2011-09-14	2002-08-29		ENSG00000109854	ENSG00000109854	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	16637	protein-coding gene	gene with protein product	"""Tat-interacting protein (30kD)"", ""short chain dehydrogenase/reductase family 44U, member 1"""	605628	"""HIV-1 Tat interactive protein 2, 30 kDa"""			9482853, 9174052, 19027726	Standard	NM_006410		Approved	TIP30, CC3, FLJ26963, SDR44U1	uc001mpx.2	Q9BUP3	OTTHUMG00000166015	ENST00000451739.2:c.503+1G>T	11.37:g.20403784G>T		Somatic	0	51	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	40	9.09		Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Semialdehyde_DH_NAD-bd	p.G202*	ENST00000451739.2	37	c.604	CCDS7852.1	11	.	.	.	.	.	.	.	.	.	.	G	35	5.460552	0.96240	.	.	ENSG00000109854	ENST00000421577;ENST00000443524;ENST00000419348;ENST00000451739;ENST00000531058	.	.	.	5.62	5.62	0.85841	.	0.150598	0.64402	D	0.000019	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-12.2099	17.5131	0.87765	0.0:0.0:1.0:0.0	.	.	.	.	X	168;168;202;168;122	.	ENSP00000392985:G202X	G	+	1	0	HTATIP2	20360360	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.582000	0.74049	2.809000	0.96659	0.655000	0.94253	GGA	-	NULL		0.338	HTATIP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HTATIP2	protein_coding	OTTHUMT00000387445.2	G	NM_001098521	-	Nonsense_Mutation	20403784	+1	no_errors	ENST00000419348	ensembl	human	known	74_37	nonsense	SNP	1.000	T
DOCK6	57572	genome.wustl.edu	37	19	11347064	11347064	+	Missense_Mutation	SNP	C	C	T			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr19:11347064C>T	ENST00000294618.7	-	20	2361	c.2350G>A	c.(2350-2352)Gtg>Atg	p.V784M	C19orf80_ENST00000591200.1_5'Flank|DOCK6_ENST00000319867.7_Missense_Mutation_p.V88M|RN7SL298P_ENST00000581369.1_RNA	NM_020812.3	NP_065863.2	Q96HP0	DOCK6_HUMAN	dedicator of cytokinesis 6	784					blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(1)|endometrium(11)|large_intestine(8)|liver(2)|lung(9)|ovary(4)|prostate(1)|skin(1)|urinary_tract(1)	39						ACCAGACGCACGAGCTTGTCC	0.622																																																	0								ENSG00000130158						20.0	25.0	24.0					19																	11347064		2057	4195	6252	DOCK6	SO:0001583	missense	0			-	HGNC		CCDS45975.1	19p13.2	2011-08-04			ENSG00000130158	ENSG00000130158			19189	protein-coding gene	gene with protein product		614194				12432077	Standard	NM_020812		Approved	KIAA1395, ZIR1	uc002mqs.5	Q96HP0		ENST00000294618.7:c.2350G>A	19.37:g.11347064C>T	ENSP00000294618:p.Val784Met	Somatic	0	39	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	40	21.57	A6H8X5|Q7Z7P4|Q9P2F2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DOCK_C,pfam_DOCK_C/D_N	p.V784M	ENST00000294618.7	37	c.2350	CCDS45975.1	19	.	.	.	.	.	.	.	.	.	.	C	18.65	3.670557	0.67814	.	.	ENSG00000130158	ENST00000294618;ENST00000319867	T;T	0.33438	1.41;1.41	5.11	4.01	0.46588	.	0.063201	0.64402	D	0.000014	T	0.22085	0.0532	N	0.12182	0.205	0.44619	D	0.997598	P;D	0.54964	0.936;0.969	P;P	0.51974	0.686;0.557	T	0.02893	-1.1097	10	0.72032	D	0.01	-27.8771	3.9881	0.09525	0.0:0.6638:0.0:0.3362	.	88;784	C9IZV6;Q96HP0	.;DOCK6_HUMAN	M	784;88	ENSP00000294618:V784M;ENSP00000321556:V88M	ENSP00000294618:V784M	V	-	1	0	DOCK6	11208064	0.744000	0.28250	0.628000	0.29241	0.506000	0.33950	1.112000	0.31172	2.378000	0.81104	0.561000	0.74099	GTG	-	NULL		0.622	DOCK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK6	protein_coding	OTTHUMT00000453155.1	C	NM_020812	-		11347064	-1	no_errors	ENST00000294618	ensembl	human	known	74_37	missense	SNP	1.000	T
ENTPD3	956	genome.wustl.edu	37	3	40433641	40433641	+	Splice_Site	SNP	G	G	T			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr3:40433641G>T	ENST00000301825.3	+	3	286	c.168G>T	c.(166-168)aaG>aaT	p.K56N	ENTPD3-AS1_ENST00000425156.1_RNA|ENTPD3-AS1_ENST00000452768.1_RNA|ENTPD3-AS1_ENST00000439293.1_RNA|ENTPD3_ENST00000456402.1_Splice_Site_p.K56N|ENTPD3_ENST00000445129.1_Splice_Site_p.K56N	NM_001248.2	NP_001239.2	O75355	ENTP3_HUMAN	ectonucleoside triphosphate diphosphohydrolase 3	56					nucleoside diphosphate catabolic process (GO:0009134)|nucleoside triphosphate catabolic process (GO:0009143)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|nucleoside-diphosphatase activity (GO:0017110)|nucleoside-triphosphatase activity (GO:0017111)			endometrium(1)|kidney(3)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18				KIRC - Kidney renal clear cell carcinoma(284;0.0605)|Kidney(284;0.0758)		CAGGACTGAAGGTAAGTGTGA	0.443																																																	0								ENSG00000168032						107.0	98.0	101.0					3																	40433641		2203	4300	6503	ENTPD3	SO:0001630	splice_region_variant	0			-	HGNC	AF039917	CCDS2691.1, CCDS74919.1	3p21.3	2004-02-26			ENSG00000168032	ENSG00000168032			3365	protein-coding gene	gene with protein product		603161		CD39L3		9676430	Standard	XM_005265605		Approved	NTPDase-3, HB6	uc003ckd.4	O75355	OTTHUMG00000131390	ENST00000301825.3:c.168+1G>T	3.37:g.40433641G>T		Somatic	0	33	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	31	11.43	B2R8D0|G5E9N0|O60495|Q8N6K2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GDA1_CD39_NTPase	p.K56N	ENST00000301825.3	37	c.168	CCDS2691.1	3	.	.	.	.	.	.	.	.	.	.	G	25.0	4.594232	0.86953	.	.	ENSG00000168032	ENST00000301825;ENST00000456402;ENST00000439533;ENST00000445129	T;T;T;T	0.13901	2.55;2.55;5.0;2.55	5.32	5.32	0.75619	.	0.142348	0.64402	D	0.000007	T	0.27866	0.0686	M	0.75447	2.3	0.58432	D	0.999998	P	0.47841	0.901	P	0.51777	0.679	T	0.00931	-1.1510	10	0.26408	T	0.33	-24.3082	14.8812	0.70534	0.0:0.0:1.0:0.0	.	56	O75355	ENTP3_HUMAN	N	56	ENSP00000301825:K56N;ENSP00000401565:K56N;ENSP00000406555:K56N;ENSP00000404671:K56N	ENSP00000301825:K56N	K	+	3	2	ENTPD3	40408645	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	5.448000	0.66612	2.667000	0.90743	0.655000	0.94253	AAG	-	pfam_GDA1_CD39_NTPase		0.443	ENTPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENTPD3	protein_coding	OTTHUMT00000254179.2	G	NM_001248	-	Missense_Mutation	40433641	+1	no_errors	ENST00000301825	ensembl	human	known	74_37	missense	SNP	1.000	T
KIF19	124602	genome.wustl.edu	37	17	72339230	72339230	+	Silent	SNP	C	C	T			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr17:72339230C>T	ENST00000389916.4	+	5	525	c.387C>T	c.(385-387)aaC>aaT	p.N129N		NM_153209.3	NP_694941.2	Q2TAC6	KIF19_HUMAN	kinesin family member 19	129	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|axonemal microtubule depolymerization (GO:0060404)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|plus-end specific microtubule depolymerization (GO:0070462)	cilium (GO:0005929)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|plus-end-directed microtubule motor activity (GO:0008574)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(3)|lung(16)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	41						AGACCCTCAACGACCTCTTCC	0.592																																																	0								ENSG00000196169						97.0	75.0	82.0					17																	72339230		2203	4300	6503	KIF19	SO:0001819	synonymous_variant	0			-	HGNC	AK094619	CCDS32718.2	17q25	2007-02-13			ENSG00000196169	ENSG00000196169		"""Kinesins"""	26735	protein-coding gene	gene with protein product						11416179	Standard	NM_153209		Approved	FLJ37300, KIF19A	uc031rei.1	Q2TAC6	OTTHUMG00000150694	ENST00000389916.4:c.387C>T	17.37:g.72339230C>T		Somatic	0	32	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	47	28.79	A6NLG2|B7ZKR1|Q52M87|Q8N1X8|Q8TAB6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,prints_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	p.N129	ENST00000389916.4	37	c.387	CCDS32718.2	17																																																																																			-	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom		0.592	KIF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF19	protein_coding	OTTHUMT00000319644.2	C	NM_153209	-		72339230	+1	no_errors	ENST00000389916	ensembl	human	known	74_37	silent	SNP	0.903	T
KIF26A	26153	genome.wustl.edu	37	14	104640600	104640600	+	Missense_Mutation	SNP	G	G	A	rs370868498		TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr14:104640600G>A	ENST00000423312.2	+	11	2146	c.2146G>A	c.(2146-2148)Gtg>Atg	p.V716M	KIF26A_ENST00000315264.7_Missense_Mutation_p.V577M	NM_015656.1	NP_056471.1	Q9ULI4	KI26A_HUMAN	kinesin family member 26A	716	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|blood coagulation (GO:0007596)|enteric nervous system development (GO:0048484)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of signal transduction (GO:0009968)|regulation of cell growth by extracellular stimulus (GO:0001560)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	21		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0767)	Epithelial(46;0.152)	Epithelial(152;0.161)		ACTCAGCACCGTGCAGCTCGC	0.697																																																	0								ENSG00000066735	G	MET/VAL	0,4292		0,0,2146	17.0	23.0	21.0		2146	1.1	0.9	14		21	2,8456		0,2,4227	no	missense	KIF26A	NM_015656.1	21	0,2,6373	AA,AG,GG		0.0236,0.0,0.0157	probably-damaging	716/1883	104640600	2,12748	2146	4229	6375	KIF26A	SO:0001583	missense	0			-	HGNC	AB033062	CCDS45171.1	14q32.33	2009-03-19			ENSG00000066735	ENSG00000066735		"""Kinesins"""	20226	protein-coding gene	gene with protein product		613231				10574462, 11416179	Standard	NM_015656		Approved	KIAA1236, DKFZP434N178	uc001yos.4	Q9ULI4	OTTHUMG00000154986	ENST00000423312.2:c.2146G>A	14.37:g.104640600G>A	ENSP00000388241:p.Val716Met	Somatic	0	87	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	34	101	25.19	Q8TAZ7|Q96GK3|Q9UFL3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,prints_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	p.V716M	ENST00000423312.2	37	c.2146	CCDS45171.1	14	.	.	.	.	.	.	.	.	.	.	G	13.76	2.333235	0.41297	0.0	2.36E-4	ENSG00000066735	ENST00000423312;ENST00000315264	T;T	0.41400	1.0;1.0	4.13	1.07	0.20283	Kinesin, motor domain (3);	.	.	.	.	T	0.41743	0.1172	L	0.39397	1.21	0.28297	N	0.923273	D	0.64830	0.994	P	0.53954	0.738	T	0.29027	-1.0025	9	0.48119	T	0.1	.	6.3148	0.21184	0.2121:0.2558:0.5321:0.0	.	716	Q9ULI4	KI26A_HUMAN	M	716;577	ENSP00000388241:V716M;ENSP00000325452:V577M	ENSP00000325452:V577M	V	+	1	0	KIF26A	103710353	0.481000	0.25941	0.928000	0.36995	0.239000	0.25481	0.941000	0.29005	-0.011000	0.14247	0.313000	0.20887	GTG	-	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom		0.697	KIF26A-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	KIF26A	protein_coding	OTTHUMT00000414356.1	G		-		104640600	+1	no_errors	ENST00000423312	ensembl	human	known	74_37	missense	SNP	0.627	A
DIP2A	23181	genome.wustl.edu	37	21	47976337	47976337	+	Intron	SNP	C	C	G			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr21:47976337C>G	ENST00000417564.2	+	29	3519				DIP2A_ENST00000427143.2_Missense_Mutation_p.L1110V|DIP2A_ENST00000318711.7_Intron|DIP2A_ENST00000400274.1_Intron			Q14689	DIP2A_HUMAN	DIP2 disco-interacting protein 2 homolog A (Drosophila)						multicellular organismal development (GO:0007275)|negative regulation of gene expression (GO:0010629)|regulation of apoptotic process (GO:0042981)	cell surface (GO:0009986)|nucleus (GO:0005634)	catalytic activity (GO:0003824)			cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(22)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Breast(49;0.0933)			Epithelial(3;3.12e-06)|OV - Ovarian serous cystadenocarcinoma(3;5.68e-06)|all cancers(3;4.08e-05)|Colorectal(79;0.0129)|COAD - Colon adenocarcinoma(84;0.0824)		tggctcacgcctgtaatccca	0.512																																																	0								ENSG00000160305						104.0	96.0	98.0					21																	47976337		692	1591	2283	DIP2A	SO:0001627	intron_variant	0			-	HGNC	AF490768	CCDS46655.1, CCDS46656.1, CCDS46657.1, CCDS54490.1, CCDS54491.1	21q22.3	2010-08-20	2006-01-13	2006-01-13	ENSG00000160305	ENSG00000160305			17217	protein-coding gene	gene with protein product		607711	"""chromosome 21 open reading frame 106"""	C21orf106			Standard	NM_015151		Approved	Dip2, KIAA0184	uc002zjo.2	Q14689	OTTHUMG00000090717	ENST00000417564.2:c.3498+333C>G	21.37:g.47976337C>G		Somatic	0	17	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	2	77.78	A6P4T3|B4E0F0|E7EMA5|Q8IVA3|Q8N4S2|Q8TD89|Q96ML9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_AMP-dep_Synth/Lig	p.L1110V	ENST00000417564.2	37	c.3328	CCDS46655.1	21	.	.	.	.	.	.	.	.	.	.	C	5.890	0.348238	0.11126	.	.	ENSG00000160305	ENST00000427143	T	0.22743	1.94	0.839	-0.136	0.13473	.	.	.	.	.	T	0.09992	0.0245	N	0.08118	0	0.09310	N	1	P	0.35923	0.528	B	0.41374	0.355	T	0.30736	-0.9968	9	0.21540	T	0.41	.	3.3267	0.07070	0.0:0.6833:0.0:0.3167	.	1110	E7EMA5	.	V	1110	ENSP00000400528:L1110V	ENSP00000400528:L1110V	L	+	1	2	DIP2A	46800765	0.000000	0.05858	0.004000	0.12327	0.017000	0.09413	-1.209000	0.03002	-0.057000	0.13199	-0.643000	0.03959	CTG	-	NULL		0.512	DIP2A-012	KNOWN	basic|CCDS	protein_coding	DIP2A	protein_coding	OTTHUMT00000376736.1	C	NM_015151	-		47976337	+1	no_errors	ENST00000427143	ensembl	human	known	74_37	missense	SNP	0.004	G
IRS4	8471	genome.wustl.edu	37	X	107977403	107977403	+	Missense_Mutation	SNP	A	A	C			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chrX:107977403A>C	ENST00000372129.2	-	1	2248	c.2172T>G	c.(2170-2172)aaT>aaG	p.N724K	RP6-24A23.3_ENST00000436013.1_RNA|RP6-24A23.3_ENST00000608811.1_RNA|RP6-24A23.6_ENST00000563887.1_5'Flank	NM_003604.2	NP_003595.1	O14654	IRS4_HUMAN	insulin receptor substrate 4	724	CRK-binding.				positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(1)	78						AAGCAGAGACATTTTGAGGAG	0.502																																																	0								ENSG00000133124						78.0	80.0	79.0					X																	107977403		2203	4300	6503	IRS4	SO:0001583	missense	0			-	HGNC	AF007567	CCDS14544.1	Xq22.3	2008-08-01			ENSG00000133124	ENSG00000133124			6128	protein-coding gene	gene with protein product		300904				9261155, 9553137	Standard	NM_003604		Approved	PY160, IRS-4	uc004eoc.2	O14654	OTTHUMG00000022181	ENST00000372129.2:c.2172T>G	X.37:g.107977403A>C	ENSP00000361202:p.Asn724Lys	Somatic	0	35	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	22	15.38		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Insln_rcpt_S1,smart_Pleckstrin_homology,smart_Insln_rcpt_S1,pfscan_Pleckstrin_homology,pfscan_Insln_rcpt_S1,prints_Insln_rcpt_S1	p.N724K	ENST00000372129.2	37	c.2172	CCDS14544.1	X	.	.	.	.	.	.	.	.	.	.	A	13.34	2.206707	0.39003	.	.	ENSG00000133124	ENST00000372129	T	0.16073	2.37	5.33	1.27	0.21489	.	0.000000	0.85682	D	0.000000	T	0.13884	0.0336	L	0.57536	1.79	0.09310	N	0.999998	P	0.34462	0.454	B	0.21917	0.037	T	0.10660	-1.0620	10	0.54805	T	0.06	-9.756	9.304	0.37863	0.6639:0.0:0.3361:0.0	.	724	O14654	IRS4_HUMAN	K	724	ENSP00000361202:N724K	ENSP00000361202:N724K	N	-	3	2	IRS4	107864059	0.944000	0.32072	0.097000	0.21041	0.966000	0.64601	1.632000	0.37102	-0.035000	0.13691	0.486000	0.48141	AAT	-	NULL		0.502	IRS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRS4	protein_coding	OTTHUMT00000057879.1	A	NM_003604	-		107977403	-1	no_errors	ENST00000372129	ensembl	human	known	74_37	missense	SNP	0.100	C
ZDHHC11B	653082	genome.wustl.edu	37	5	766963	766963	+	Missense_Mutation	SNP	C	C	A			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr5:766963C>A	ENST00000382776.4	-	1	71	c.72G>T	c.(70-72)ttG>ttT	p.L24F	ZDHHC11B_ENST00000508859.2_Missense_Mutation_p.L35F|ZDHHC11_ENST00000424784.2_Intron			P0C7U3	ZH11B_HUMAN	zinc finger, DHHC-type containing 11B	24						integral component of membrane (GO:0016021)	protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			lung(3)|stomach(1)	4						TGCGGGGCGGCAAGACCAGCT	0.607																																																	0								ENSG00000206077																																			ZDHHC11B	SO:0001583	missense	0			-	HGNC			5p15.33	2007-01-29				ENSG00000206077		"""Zinc fingers, DHHC-type"""	32962	protein-coding gene	gene with protein product							Standard	XM_003118532		Approved			P0C7U3		ENST00000382776.4:c.72G>T	5.37:g.766963C>A	ENSP00000445280:p.Leu24Phe	Somatic	0	80	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	120	13.04	A6NHR3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_DHHC_palmitoyltrfase,pfscan_Znf_DHHC_palmitoyltrfase	p.L24F	ENST00000382776.4	37	c.72		5	.	.	.	.	.	.	.	.	.	.	-	13.35	2.211256	0.39102	.	.	ENSG00000206077	ENST00000508859;ENST00000382776	T;T	0.55413	0.52;0.52	2.75	-5.5	0.02576	.	.	.	.	.	T	0.20618	0.0496	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.23332	-1.0191	6	0.10111	T	0.7	-6.5271	1.4678	0.02409	0.1386:0.3531:0.1384:0.3699	.	.	.	.	F	35;24	ENSP00000442373:L35F;ENSP00000445280:L24F	ENSP00000445280:L24F	L	-	3	2	ZDHHC11B	819963	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.193000	0.01244	-1.121000	0.02949	-0.293000	0.09583	TTG	-	NULL		0.607	ZDHHC11B-201	KNOWN	basic|appris_candidate	protein_coding	ZDHHC11B	protein_coding		C	XM_926053	-		766963	-1	no_errors	ENST00000382776	ensembl	human	known	74_37	missense	SNP	0.000	A
MYH11	4629	genome.wustl.edu	37	16	15844065	15844065	+	Missense_Mutation	SNP	T	T	C			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr16:15844065T>C	ENST00000300036.5	-	16	2097	c.1988A>G	c.(1987-1989)aAg>aGg	p.K663R	MYH11_ENST00000452625.2_Missense_Mutation_p.K670R|MYH11_ENST00000396324.3_Missense_Mutation_p.K670R|MYH11_ENST00000576790.2_Missense_Mutation_p.K663R	NM_002474.2	NP_002465.1	P35749	MYH11_HUMAN	myosin, heavy chain 11, smooth muscle	663	Actin-binding. {ECO:0000250}.|Myosin motor.				axon guidance (GO:0007411)|cardiac muscle fiber development (GO:0048739)|elastic fiber assembly (GO:0048251)|muscle contraction (GO:0006936)|skeletal muscle myosin thick filament assembly (GO:0030241)|smooth muscle contraction (GO:0006939)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|smooth muscle contractile fiber (GO:0030485)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(34)|liver(1)|lung(37)|ovary(9)|pancreas(1)|prostate(7)|skin(7)|upper_aerodigestive_tract(1)	123						GGTCATCAGCTTGCCCAGCTG	0.637			T	CBFB	AML																																			Dom	yes		16	16p13.13-p13.12	4629	"""myosin, heavy polypeptide 11, smooth muscle"""		L	0								ENSG00000133392						162.0	122.0	135.0					16																	15844065		2197	4300	6497	MYH11	SO:0001583	missense	0			-	HGNC	X69292	CCDS10565.1, CCDS10566.1, CCDS45423.1, CCDS45424.1	16p13.11	2011-09-27	2006-09-29		ENSG00000133392	ENSG00000133392		"""Myosins / Myosin superfamily : Class II"""	7569	protein-coding gene	gene with protein product		160745	"""myosin, heavy polypeptide 11, smooth muscle"""			7684189	Standard	NM_001040113		Approved	SMMHC, SMHC	uc002ddx.3	P35749	OTTHUMG00000129935	ENST00000300036.5:c.1988A>G	16.37:g.15844065T>C	ENSP00000300036:p.Lys663Arg	Somatic	0	37	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	39	25.00	D2JYH7|O00396|O94944|P78422|Q3MIV8|Q3MNF0|Q3MNF1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,superfamily_t-SNARE,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS	p.K670R	ENST00000300036.5	37	c.2009	CCDS10565.1	16	.	.	.	.	.	.	.	.	.	.	T	22.3	4.274725	0.80580	.	.	ENSG00000133392	ENST00000300036;ENST00000338282;ENST00000396320;ENST00000396324;ENST00000452625	D;D;D;D	0.87887	-2.31;-2.31;-2.31;-2.31	5.47	5.47	0.80525	Myosin head, motor domain (2);	0.000000	0.85682	D	0.000000	T	0.82204	0.4986	L	0.31207	0.915	0.80722	D	1	B;B;B;B;B;B	0.15141	0.012;0.001;0.001;0.001;0.007;0.001	B;B;B;B;B;B	0.23852	0.049;0.033;0.033;0.033;0.033;0.02	T	0.79220	-0.1893	10	0.87932	D	0	.	14.7231	0.69323	0.0:0.0:0.0:1.0	.	670;663;663;670;663;670	B1PS43;D2JYH7;P35749;Q3MNF1;Q3MIV8;Q3MNF0	.;.;MYH11_HUMAN;.;.;.	R	663;663;670;670;670	ENSP00000300036:K663R;ENSP00000345136:K663R;ENSP00000379616:K670R;ENSP00000407821:K670R	ENSP00000300036:K663R	K	-	2	0	MYH11	15751566	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.040000	0.89188	2.078000	0.62432	0.459000	0.35465	AAG	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom		0.637	MYH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH11	protein_coding	OTTHUMT00000252192.2	T	NM_001040113	-		15844065	-1	no_errors	ENST00000396324	ensembl	human	known	74_37	missense	SNP	1.000	C
VKORC1L1	154807	genome.wustl.edu	37	7	65419354	65419356	+	3'UTR	DEL	TTA	TTA	-	rs577125188|rs71982071	byFrequency	TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	TTA	TTA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr7:65419354_65419356delTTA	ENST00000360768.3	+	0	703_705				VKORC1L1_ENST00000434382.2_In_Frame_Del_p.I171del	NM_001284342.1|NM_173517.4	NP_001271271.1|NP_775788.2	Q8N0U8	VKORL_HUMAN	vitamin K epoxide reductase complex, subunit 1-like 1						cellular response to oxidative stress (GO:0034599)|peptidyl-glutamic acid carboxylation (GO:0017187)|vitamin K metabolic process (GO:0042373)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	quinone binding (GO:0048038)|vitamin-K-epoxide reductase (warfarin-sensitive) activity (GO:0047057)			large_intestine(1)|prostate(1)	2		Lung NSC(55;0.197)			Menadione(DB00170)	CAGCAGGTTTttattattattat	0.409																																																	0								ENSG00000196715																																			VKORC1L1	SO:0001624	3_prime_UTR_variant	0				HGNC		CCDS5529.1, CCDS64663.1	7q11.21	2013-10-07			ENSG00000196715	ENSG00000196715			21492	protein-coding gene	gene with protein product		608838				23928358	Standard	NM_001284342		Approved		uc003tul.3	Q8N0U8	OTTHUMG00000129449	ENST00000360768.3:c.*69TTA>-	7.37:g.65419363_65419365delTTA		Somatic	0	24	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	28	9.68	B4E222|E7ETM5|Q6AHW9|Q6TEK6	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_VKOR	p.I167in_frame_del	ENST00000360768.3	37	c.488_490	CCDS5529.1	7																																																																																			-	NULL		0.409	VKORC1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VKORC1L1	protein_coding	OTTHUMT00000251612.3	TTA	NM_173517			65419356	+1	no_errors	ENST00000434382	ensembl	human	novel	74_37	in_frame_del	DEL	0.999:0.999:0.932	-
SLC4A3	6508	genome.wustl.edu	37	2	220494110	220494111	+	Frame_Shift_Ins	INS	-	-	C			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr2:220494110_220494111insC	ENST00000358055.3	+	4	974_975	c.462_463insC	c.(463-465)cccfs	p.P155fs	SLC4A3_ENST00000373762.3_Frame_Shift_Ins_p.P155fs|SLC4A3_ENST00000273063.6_Frame_Shift_Ins_p.P155fs|AC009955.8_ENST00000455896.1_RNA|SLC4A3_ENST00000373760.2_Frame_Shift_Ins_p.P155fs|SLC4A3_ENST00000497589.1_3'UTR|SLC4A3_ENST00000317151.3_Frame_Shift_Ins_p.P155fs			P48751	B3A3_HUMAN	solute carrier family 4 (anion exchanger), member 3	155	Pro-rich.				bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|regulation of intracellular pH (GO:0051453)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)	51		Renal(207;0.0183)		Epithelial(149;2.53e-07)|all cancers(144;5.57e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		AACCTGTGGAGCCCCCCCACTC	0.629																																																	0								ENSG00000114923																																			SLC4A3	SO:0001589	frameshift_variant	0				HGNC		CCDS2445.1, CCDS2446.1	2q35	2013-07-19	2013-07-19		ENSG00000114923	ENSG00000114923		"""Solute carriers"""	11029	protein-coding gene	gene with protein product	"""Anion exchanger 3, neuronal"""	106195	"""solute carrier family 4, anion exchanger, member 3"""			8001971	Standard	NM_005070		Approved	AE3, SLC2C	uc002vmo.4	P48751	OTTHUMG00000059238	ENST00000358055.3:c.469dupC	2.37:g.220494117_220494117dupC	ENSP00000350756:p.Pro155fs	Somatic	0	33	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	31	8.82	A6H8L2|A8K1Q9|B7ZVX6|B9EGD1|Q6YIQ9	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_HCO3_transpt_C,pfam_Band3_cytoplasmic_dom,superfamily_PTrfase/Anion_transptr,prints_HCO3_transpt_euk,prints_Anion_exchange_3,prints_Anion_exchange,tigrfam_HCO3_transpt_euk	p.H156fs	ENST00000358055.3	37	c.462_463	CCDS2445.1	2																																																																																			-	prints_Anion_exchange_3		0.629	SLC4A3-009	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SLC4A3	protein_coding	OTTHUMT00000316472.1	-	NM_005070			220494111	+1	no_errors	ENST00000273063	ensembl	human	known	74_37	frame_shift_ins	INS	0.015:0.049	C
OR11G2	390439	genome.wustl.edu	37	14	20665795	20665795	+	Missense_Mutation	SNP	C	C	T			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr14:20665795C>T	ENST00000357366.3	+	1	301	c.301C>T	c.(301-303)Ctc>Ttc	p.L101F		NM_001005503.1	NP_001005503.1	Q8NGC1	O11G2_HUMAN	olfactory receptor, family 11, subfamily G, member 2	101						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|kidney(1)|large_intestine(4)|lung(7)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	22	all_cancers(95;0.00108)		Epithelial(56;9.76e-07)|all cancers(55;5.61e-06)	GBM - Glioblastoma multiforme(265;0.0144)		GTACATCCTGCTCGCCAACTT	0.527																																																	0								ENSG00000196832						117.0	95.0	102.0					14																	20665795		2203	4300	6503	OR11G2	SO:0001583	missense	0			-	HGNC		CCDS32032.1	14q11.2	2013-09-24			ENSG00000196832	ENSG00000196832		"""GPCR / Class A : Olfactory receptors"""	15346	protein-coding gene	gene with protein product							Standard	NM_001005503		Approved		uc010tlb.2	Q8NGC1	OTTHUMG00000167700	ENST00000357366.3:c.301C>T	14.37:g.20665795C>T	ENSP00000349930:p.Leu101Phe	Somatic	0	36	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	26	45.83	Q6IF09|Q96R33	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L101F	ENST00000357366.3	37	c.301	CCDS32032.1	14	.	.	.	.	.	.	.	.	.	.	c	16.36	3.102201	0.56183	.	.	ENSG00000196832	ENST00000357366	T	0.14391	2.51	4.67	3.69	0.42338	GPCR, rhodopsin-like superfamily (1);	0.000000	0.35870	U	0.002923	T	0.46132	0.1377	H	0.98980	4.39	0.27082	N	0.963065	P	0.51653	0.947	P	0.54431	0.752	T	0.58918	-0.7551	10	0.72032	D	0.01	.	11.8774	0.52554	0.0:0.899:0.0:0.101	.	101	Q8NGC1	O11G2_HUMAN	F	101	ENSP00000349930:L101F	ENSP00000349930:L101F	L	+	1	0	OR11G2	19735635	0.648000	0.27313	1.000000	0.80357	0.995000	0.86356	0.436000	0.21526	2.414000	0.81942	0.650000	0.86243	CTC	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.527	OR11G2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	OR11G2	protein_coding	OTTHUMT00000395722.1	C		-		20665795	+1	no_errors	ENST00000357366	ensembl	human	known	74_37	missense	SNP	1.000	T
OR2M5	127059	genome.wustl.edu	37	1	248308470	248308470	+	Silent	SNP	C	C	T			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr1:248308470C>T	ENST00000366476.1	+	1	21	c.21C>T	c.(19-21)acC>acT	p.T7T		NM_001004690.1	NP_001004690.1	A3KFT3	OR2M5_HUMAN	olfactory receptor, family 2, subfamily M, member 5	7						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(5)|kidney(2)|large_intestine(7)|liver(1)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	49	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0388)			AGAATCAGACCTTCAACTCTG	0.433																																																	0								ENSG00000162727						214.0	211.0	212.0					1																	248308470		2203	4300	6503	OR2M5	SO:0001819	synonymous_variant	0			-	HGNC		CCDS31105.1	1q44	2012-08-09		2004-03-10	ENSG00000162727	ENSG00000162727		"""GPCR / Class A : Olfactory receptors"""	19576	protein-coding gene	gene with protein product				OR2M5P			Standard	NM_001004690		Approved		uc010pze.2	A3KFT3	OTTHUMG00000040447	ENST00000366476.1:c.21C>T	1.37:g.248308470C>T		Somatic	0	56	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	28	25	52.83		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.T7	ENST00000366476.1	37	c.21	CCDS31105.1	1																																																																																			-	NULL		0.433	OR2M5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2M5	protein_coding	OTTHUMT00000097343.1	C	NM_001004690	-		248308470	+1	no_errors	ENST00000366476	ensembl	human	known	74_37	silent	SNP	0.000	T
PPP1R3A	5506	genome.wustl.edu	37	7	113518852	113518852	+	Frame_Shift_Del	DEL	G	G	-			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr7:113518852delG	ENST00000284601.3	-	4	2363	c.2295delC	c.(2293-2295)cccfs	p.P765fs		NM_002711.3	NP_002702.2	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory subunit 3A	765					glycogen metabolic process (GO:0005977)	integral component of membrane (GO:0016021)				NS(2)|breast(8)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|liver(1)|lung(43)|ovary(10)|pancreas(7)|prostate(3)|skin(15)|stomach(1)|upper_aerodigestive_tract(2)	121						TTACCTCGATGGGCCTGTCAC	0.403																																																	0								ENSG00000154415						126.0	111.0	116.0					7																	113518852		2203	4299	6502	PPP1R3A	SO:0001589	frameshift_variant	0				HGNC	AF024578	CCDS5759.1	7q31.1	2012-04-17	2011-10-04	2001-07-02	ENSG00000154415	ENSG00000154415	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9291	protein-coding gene	gene with protein product	"""glycogen-associated regulatory subunit of protein phosphatase-1"", ""protein phosphatase 1 regulatory subunit GM"""	600917	"""protein phosphatase 1, regulatory (inhibitor) subunit 3A (glycogen and sarcoplasmic reticulum binding subunit, skeletal muscle)"", ""protein phosphatase 1, regulatory (inhibitor) subunit 3A"""	PPP1R3		7926294	Standard	NM_002711		Approved	GM	uc010ljy.1	Q16821	OTTHUMG00000156944	ENST00000284601.3:c.2295delC	7.37:g.113518852delG	ENSP00000284601:p.Pro765fs	Somatic	0	16	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	26	18.75	A0AVQ2|A4D0T6|O43476|Q75LN8|Q7KYM8|Q86UI6	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_CBM_21,pfscan_CBM_21	p.I766fs	ENST00000284601.3	37	c.2295	CCDS5759.1	7																																																																																			-	NULL		0.403	PPP1R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R3A	protein_coding	OTTHUMT00000346724.1	G	NM_002711			113518852	-1	no_errors	ENST00000284601	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
IMPA2	3613	genome.wustl.edu	37	18	12009897	12009897	+	Missense_Mutation	SNP	G	G	T			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr18:12009897G>T	ENST00000269159.3	+	3	488	c.246G>T	c.(244-246)gaG>gaT	p.E82D	IMPA2_ENST00000588752.1_3'UTR|IMPA2_ENST00000588927.1_5'UTR|IMPA2_ENST00000589238.1_5'UTR	NM_014214.2	NP_055029.1	O14732	IMPA2_HUMAN	inositol(myo)-1(or 4)-monophosphatase 2	82					inositol biosynthetic process (GO:0006021)|inositol phosphate dephosphorylation (GO:0046855)|inositol phosphate metabolic process (GO:0043647)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylinositol phosphorylation (GO:0046854)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	inositol monophosphate 1-phosphatase activity (GO:0008934)|inositol monophosphate 3-phosphatase activity (GO:0052832)|inositol monophosphate 4-phosphatase activity (GO:0052833)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(1)|skin(2)|stomach(2)|urinary_tract(1)	12					Lithium(DB01356)	TTGCAGAAGAGGCCGCGGCTT	0.542																																																	0								ENSG00000141401						121.0	123.0	122.0					18																	12009897		2203	4300	6503	IMPA2	SO:0001583	missense	0			-	HGNC	AF014398	CCDS11855.1	18p11.2	2008-03-18			ENSG00000141401	ENSG00000141401	3.1.3.25		6051	protein-coding gene	gene with protein product		605922				9322233	Standard	NM_014214		Approved		uc002kqp.2	O14732	OTTHUMG00000131693	ENST00000269159.3:c.246G>T	18.37:g.12009897G>T	ENSP00000269159:p.Glu82Asp	Somatic	0	25	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	43	10.42	B0YJ29|Q9UJT3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Inositol_monophosphatase,prints_Inositol_monophosphatase,prints_Inositol_monoPase_Li-sen	p.E82D	ENST00000269159.3	37	c.246	CCDS11855.1	18	.	.	.	.	.	.	.	.	.	.	G	19.74	3.884422	0.72410	.	.	ENSG00000141401	ENST00000269159	T	0.76060	-0.99	5.48	-1.45	0.08828	.	0.000000	0.85682	D	0.000000	D	0.88905	0.6564	H	0.98178	4.165	0.80722	D	1	D	0.76494	0.999	D	0.76575	0.988	D	0.88279	0.2935	10	0.87932	D	0	-30.4292	10.2101	0.43136	0.7336:0.0:0.2664:0.0	.	82	O14732	IMPA2_HUMAN	D	82	ENSP00000269159:E82D	ENSP00000269159:E82D	E	+	3	2	IMPA2	11999897	1.000000	0.71417	0.869000	0.34112	0.791000	0.44710	0.815000	0.27253	-0.168000	0.10853	0.491000	0.48974	GAG	-	pfam_Inositol_monophosphatase,prints_Inositol_monophosphatase		0.542	IMPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IMPA2	protein_coding	OTTHUMT00000254601.1	G		-		12009897	+1	no_errors	ENST00000269159	ensembl	human	known	74_37	missense	SNP	0.993	T
MAP3K7	6885	genome.wustl.edu	37	6	91269900	91269900	+	Missense_Mutation	SNP	G	G	T			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr6:91269900G>T	ENST00000369329.3	-	5	538	c.377C>A	c.(376-378)aCt>aAt	p.T126N	MAP3K7_ENST00000369327.3_Missense_Mutation_p.T126N|MAP3K7_ENST00000369325.3_Missense_Mutation_p.T126N|MAP3K7_ENST00000369332.3_Missense_Mutation_p.T126N	NM_145331.2	NP_663304.1	O43318	M3K7_HUMAN	mitogen-activated protein kinase kinase kinase 7	126	Interaction with MAPK8IP1. {ECO:0000250}.|Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|activation of NF-kappaB-inducing kinase activity (GO:0007250)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|Fc-epsilon receptor signaling pathway (GO:0038095)|histone H3 acetylation (GO:0043966)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of ripoptosome assembly involved in necroptotic process (GO:1902443)|neural tube formation (GO:0001841)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell cytokine production (GO:0002726)|regulation of reactive oxygen species metabolic process (GO:2000377)|stress-activated MAPK cascade (GO:0051403)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase kinase activity (GO:0004708)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|scaffold protein binding (GO:0097110)			endometrium(4)|kidney(1)|large_intestine(5)|lung(10)|ovary(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	28		all_cancers(76;6.4e-08)|Acute lymphoblastic leukemia(125;1.43e-09)|Prostate(29;9.32e-09)|all_hematologic(105;3.69e-06)|all_epithelial(107;0.000187)|Ovarian(999;0.0164)		OV - Ovarian serous cystadenocarcinoma(136;2.05e-11)|all cancers(137;3.25e-11)|GBM - Glioblastoma multiforme(226;0.0416)|BRCA - Breast invasive adenocarcinoma(108;0.0429)		GTGGGCAGCAGTATAATATGG	0.433																																																	0								ENSG00000135341						192.0	163.0	173.0					6																	91269900		2203	4300	6503	MAP3K7	SO:0001583	missense	0			-	HGNC	AB009356	CCDS5027.1, CCDS5028.1, CCDS5029.1, CCDS5030.1	6q15	2011-06-09			ENSG00000135341	ENSG00000135341		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6859	protein-coding gene	gene with protein product		602614		TAK1		9466656	Standard	NM_003188		Approved	MEKK7	uc003pnz.2	O43318	OTTHUMG00000015217	ENST00000369329.3:c.377C>A	6.37:g.91269900G>T	ENSP00000358335:p.Thr126Asn	Somatic	0	24	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	26	16.13	B2RE27|E1P523|O43317|O43319|Q5TDN2|Q5TDN3|Q5TDT7|Q9NTR3|Q9NZ70	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_MAPKKK7,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.T126N	ENST00000369329.3	37	c.377	CCDS5028.1	6	.	.	.	.	.	.	.	.	.	.	G	26.0	4.699285	0.88830	.	.	ENSG00000135341	ENST00000369332;ENST00000369329;ENST00000369325;ENST00000369327	T;T;T;T	0.34859	1.34;1.34;1.34;1.34	5.25	5.25	0.73442	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.32675	0.0837	L	0.38175	1.15	0.80722	D	1	P;P;D;P	0.58970	0.855;0.855;0.984;0.881	P;P;P;P	0.55391	0.57;0.465;0.775;0.601	T	0.01452	-1.1351	10	0.19147	T	0.46	.	19.2089	0.93746	0.0:0.0:1.0:0.0	.	126;126;126;126	O43318-4;O43318-2;O43318-3;O43318	.;.;.;M3K7_HUMAN	N	126	ENSP00000358338:T126N;ENSP00000358335:T126N;ENSP00000358331:T126N;ENSP00000358333:T126N	ENSP00000358331:T126N	T	-	2	0	MAP3K7	91326621	1.000000	0.71417	0.999000	0.59377	0.892000	0.51952	9.813000	0.99286	2.611000	0.88343	0.585000	0.79938	ACT	-	pirsf_MAPKKK7,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.433	MAP3K7-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAP3K7	protein_coding	OTTHUMT00000041530.1	G	NM_145331	-		91269900	-1	no_errors	ENST00000369329	ensembl	human	known	74_37	missense	SNP	1.000	T
TTN	7273	genome.wustl.edu	37	2	179426447	179426447	+	Missense_Mutation	SNP	T	T	G			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr2:179426447T>G	ENST00000591111.1	-	276	79713	c.79489A>C	c.(79489-79491)Agc>Cgc	p.S26497R	TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.S28138R|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.S19198R|TTN_ENST00000460472.2_Missense_Mutation_p.S19073R|TTN_ENST00000342992.6_Missense_Mutation_p.S25570R|TTN_ENST00000342175.6_Missense_Mutation_p.S19265R|TTN-AS1_ENST00000592750.1_RNA			Q8WZ42	TITIN_HUMAN	titin	26497	Fibronectin type-III 92. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTGTAGGAGCTCTTTCCATAG	0.448																																																	0								ENSG00000155657						89.0	91.0	90.0					2																	179426447		1901	4116	6017	TTN	SO:0001583	missense	0			-	HGNC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.79489A>C	2.37:g.179426447T>G	ENSP00000465570:p.Ser26497Arg	Somatic	0	16	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	20	20.00	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.S25570R	ENST00000591111.1	37	c.76708		2	.	.	.	.	.	.	.	.	.	.	T	14.39	2.522269	0.44866	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.59772	0.24;0.24;0.24;0.24	6.1	6.1	0.99115	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.84543	0.5495	H	0.97186	3.955	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	D	0.89663	0.3878	9	0.87932	D	0	.	16.686	0.85306	0.0:0.0:0.0:1.0	.	19073;19198;19265;26497	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	R	25570;19073;19265;19198;19071	ENSP00000343764:S25570R;ENSP00000434586:S19073R;ENSP00000340554:S19265R;ENSP00000352154:S19198R	ENSP00000340554:S19265R	S	-	1	0	TTN	179134693	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	8.040000	0.89188	2.340000	0.79590	0.528000	0.53228	AGC	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.448	TTN-019	PUTATIVE	basic	protein_coding	TTN	protein_coding	OTTHUMT00000460310.1	T	NM_133378	-		179426447	-1	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	SNP	1.000	G
WIPF2	147179	genome.wustl.edu	37	17	38375620	38375621	+	5'UTR	INS	-	-	GGCGGC	rs542122273|rs60253561|rs368567525|rs71152656		TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr17:38375620_38375621insGGCGGC	ENST00000323571.4	+	0	47_48				WIPF2_ENST00000494757.1_3'UTR|WIPF2_ENST00000583130.1_5'Flank|WIPF2_ENST00000394103.3_5'UTR|WIPF2_ENST00000536600.1_5'UTR|WIPF2_ENST00000585043.1_5'UTR	NM_133264.4	NP_573571.1	Q8TF74	WIPF2_HUMAN	WAS/WASL interacting protein family, member 2						Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)				NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	30						AAAGGggcggtggcggcggcgg	0.693										HNSCC(43;0.11)																																							0								ENSG00000171475																																			WIPF2	SO:0001623	5_prime_UTR_variant	0				HGNC	BC025965	CCDS11364.1	17q21.2	2006-10-12			ENSG00000171475	ENSG00000171475			30923	protein-coding gene	gene with protein product		609692				12213210, 11829459	Standard	XM_005257083		Approved	WICH, WIRE	uc002hug.1	Q8TF74	OTTHUMG00000133331	ENST00000323571.4:c.-193->GGCGGC	17.37:g.38375621_38375626dupGGCGGC		Somatic	NA	NA	NA		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A8K0L3|Q658J8|Q71RE1|Q8TE44	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000323571.4	37	NULL	CCDS11364.1	17																																																																																			-	-		0.693	WIPF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WIPF2	protein_coding	OTTHUMT00000257157.2	-	NM_133264			38375621	+1	no_errors	ENST00000494757	ensembl	human	known	74_37	rna	INS	0.994:1.000	GGCGGC
ZNF718	255403	genome.wustl.edu	37	4	155843	155843	+	lincRNA	SNP	C	C	T	rs369590905		TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr4:155843C>T	ENST00000510175.1	+	0	1278							Q3SXZ3	ZN718_HUMAN	zinc finger protein 718						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)						all_cancers(4;0.0738)|all_epithelial(65;0.139)		Lung(54;0.0681)|Epithelial(2;0.0838)|all cancers(2;0.135)|LUSC - Lung squamous cell carcinoma(95;0.18)		GTAAAGAATGCGGGAAAGCTT	0.358													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18833	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000250312						29.0	32.0	31.0					4																	155843		2017	4213	6230	ZNF718			0			-	HGNC	AK096662	CCDS75078.1, CCDS75079.1	4p16.3	2011-05-24			ENSG00000250312	ENSG00000250312		"""Zinc fingers, C2H2-type"""	26889	protein-coding gene	gene with protein product							Standard	XM_005278364		Approved	FLJ90036	uc003fzt.4	Q3SXZ3	OTTHUMG00000159873		4.37:g.155843C>T		Somatic	0	26	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	13	18.75	Q3SXZ4|Q3SXZ5	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000510175.1	37	NULL		4																																																																																			-	-		0.358	ZNF718-002	KNOWN	basic	lincRNA	ZNF718	lincRNA	OTTHUMT00000357865.3	C	NM_001039127	-		155843	+1	no_errors	ENST00000400172	ensembl	human	known	74_37	rna	SNP	1.000	T
ESPNP	284729	genome.wustl.edu	37	1	17029215	17029215	+	RNA	SNP	G	G	T			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr1:17029215G>T	ENST00000492551.1	-	0	1150					NR_026567.1				espin pseudogene																		GAGGGCCTCTGTCTCCACGTG	0.632																																																	0								ENSG00000268869																																			ESPNP			0			-	HGNC	AL035288		1p36.13	2013-05-22			ENSG00000268869	ENSG00000268869			23285	pseudogene	pseudogene						15286153	Standard	NR_026567		Approved		uc001azn.1		OTTHUMG00000000803		1.37:g.17029215G>T		Somatic	0	81	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	111	16.42		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000492551.1	37	NULL		1																																																																																			-	-		0.632	ESPNP-002	KNOWN	basic	processed_transcript	ESPNP	pseudogene	OTTHUMT00000326311.1	G		-		17029215	-1	no_errors	ENST00000492551	ensembl	human	known	74_37	rna	SNP	0.109	T
OSCAR	126014	genome.wustl.edu	37	19	54598486	54598486	+	3'UTR	SNP	T	T	G			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr19:54598486T>G	ENST00000284648.6	-	0	1503				OSCAR_ENST00000351806.4_Nonstop_Mutation_p.*253C|OSCAR_ENST00000358375.4_Nonstop_Mutation_p.*264C|OSCAR_ENST00000391761.1_3'UTR|OSCAR_ENST00000359649.4_3'UTR|OSCAR_ENST00000356532.3_Nonstop_Mutation_p.*268C			Q8IYS5	OSCAR_HUMAN	osteoclast associated, immunoglobulin-like receptor							extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				large_intestine(1)|skin(1)	2	all_cancers(19;0.0128)|all_epithelial(19;0.00564)|all_lung(19;0.031)|Lung NSC(19;0.0358)|Ovarian(34;0.19)					CTCCTGGGGCTCAGGGGCGGA	0.672																																																	0								ENSG00000170909						19.0	22.0	21.0					19																	54598486		2203	4299	6502	OSCAR	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AK130199	CCDS12873.1, CCDS12874.1, CCDS12875.1, CCDS12876.1, CCDS62789.1, CCDS74444.1	19q13.42	2013-01-29			ENSG00000170909	ENSG00000170909		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	29960	protein-coding gene	gene with protein product		606862				11805147	Standard	NM_206818		Approved		uc002qda.3	Q8IYS5	OTTHUMG00000064966	ENST00000284648.6:c.*457A>C	19.37:g.54598486T>G		Somatic	0	83	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	28	63	30.77	B7WNS2|Q5GRG5|Q8N763|Q8NHL4|Q8WXQ0|Q8WXQ1|Q8WXQ2	Nonstop_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_Ig_sub	p.*268C	ENST00000284648.6	37	c.804		19	.	.	.	.	.	.	.	.	.	.	.	4.817	0.151889	0.09185	.	.	ENSG00000170909	ENST00000356532;ENST00000358375;ENST00000351806	.	.	.	1.83	1.83	0.25207	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	5.7349	0.18061	0.0:0.0:0.0:1.0	.	.	.	.	C	268;264;253	.	.	X	-	3	0	OSCAR	59290298	0.113000	0.22115	0.814000	0.32528	0.057000	0.15508	1.858000	0.39408	1.092000	0.41356	0.374000	0.22700	TGA	-	NULL		0.672	OSCAR-001	NOVEL	basic	protein_coding	OSCAR	protein_coding	OTTHUMT00000139493.4	T	NM_133169	-		54598486	-1	no_errors	ENST00000356532	ensembl	human	known	74_37	nonstop	SNP	0.889	G
PDS5A	23244	genome.wustl.edu	37	4	39891901	39891901	+	Silent	SNP	G	G	T			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr4:39891901G>T	ENST00000303538.8	-	17	2393	c.1854C>A	c.(1852-1854)atC>atA	p.I618I		NM_001100399.1	NP_001093869.1			PDS5, regulator of cohesion maintenance, homolog A (S. cerevisiae)											breast(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(9)|lung(14)|prostate(3)|skin(1)|urinary_tract(1)	39						GCACAGGTGCGATTCTTTCCA	0.353																																																	0								ENSG00000121892						76.0	72.0	73.0					4																	39891901		1825	4085	5910	PDS5A	SO:0001819	synonymous_variant	0			-	HGNC	AF294791	CCDS47045.1, CCDS54759.1	4p14	2007-06-20			ENSG00000121892	ENSG00000121892			29088	protein-coding gene	gene with protein product		613200				11076961, 15855230	Standard	NM_001100399		Approved	KIAA0648, PIG54, SCC-112	uc003guv.4	Q29RF7	OTTHUMG00000160582	ENST00000303538.8:c.1854C>A	4.37:g.39891901G>T		Somatic	0	35	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	38	11.63		Silent	SNP	NA	NA	NA	NA	NA	NA	superfamily_ARM-type_fold	p.I618	ENST00000303538.8	37	c.1854	CCDS47045.1	4																																																																																			-	superfamily_ARM-type_fold		0.353	PDS5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDS5A	protein_coding	OTTHUMT00000361287.1	G	NM_015200	-		39891901	-1	no_errors	ENST00000303538	ensembl	human	known	74_37	silent	SNP	1.000	T
PRLHR	2834	genome.wustl.edu	37	10	120353729	120353729	+	Missense_Mutation	SNP	C	C	T			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr10:120353729C>T	ENST00000369169.1	-	1	1027	c.1028G>A	c.(1027-1029)cGc>cAc	p.R343H	PRLHR_ENST00000239032.2_Missense_Mutation_p.R343H			P49683	PRLHR_HUMAN	prolactin releasing hormone receptor	343					feeding behavior (GO:0007631)|female pregnancy (GO:0007565)|G-protein coupled receptor signaling pathway (GO:0007186)|hormone metabolic process (GO:0042445)|neuropeptide signaling pathway (GO:0007218)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide receptor activity (GO:0008188)|neuropeptide Y receptor activity (GO:0004983)			large_intestine(2)|lung(8)|ovary(1)|skin(1)	12		Colorectal(252;0.0429)|Lung NSC(174;0.142)|all_lung(145;0.175)		all cancers(201;0.0166)		CAGCTCCTCGCGGAAGCTGTC	0.612																																																	0								ENSG00000119973						52.0	50.0	51.0					10																	120353729		2203	4300	6503	PRLHR	SO:0001583	missense	0			-	HGNC	AB048946	CCDS7606.1	10q25.3-q26	2014-02-21	2005-11-24	2005-11-24	ENSG00000119973	ENSG00000119973		"""GPCR / Class A : RF amide peptide receptors"""	4464	protein-coding gene	gene with protein product		600895	"""G protein-coupled receptor 10"""	GPR10		8666380, 15885496	Standard	NM_004248		Approved	PrRPR	uc001ldp.1	P49683	OTTHUMG00000019136	ENST00000369169.1:c.1028G>A	10.37:g.120353729C>T	ENSP00000358167:p.Arg343His	Somatic	0	27	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	8	66.67	O75194|Q502U8|Q5VXR9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Prolrel_pep_rcpt,prints_GPCR_Rhodpsn,prints_NPY_rcpt	p.R343H	ENST00000369169.1	37	c.1028	CCDS7606.1	10	.	.	.	.	.	.	.	.	.	.	C	23.7	4.442595	0.83993	.	.	ENSG00000119973	ENST00000239032;ENST00000369169	T;T	0.70749	-0.51;-0.51	4.53	3.54	0.40534	.	0.000000	0.85682	D	0.000000	T	0.80486	0.4632	L	0.61218	1.895	0.48696	D	0.999693	D	0.89917	1.0	D	0.80764	0.994	T	0.82420	-0.0466	10	0.72032	D	0.01	.	13.0823	0.59121	0.0:0.9087:0.0:0.0913	.	343	P49683	PRLHR_HUMAN	H	343	ENSP00000239032:R343H;ENSP00000358167:R343H	ENSP00000239032:R343H	R	-	2	0	PRLHR	120343719	1.000000	0.71417	0.982000	0.44146	0.987000	0.75469	5.884000	0.69729	2.337000	0.79520	0.561000	0.74099	CGC	-	pfam_7TM_GPCR_olfarory/Srsx,prints_Prolrel_pep_rcpt,prints_GPCR_Rhodpsn,prints_NPY_rcpt		0.612	PRLHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRLHR	protein_coding	OTTHUMT00000050610.1	C	NM_004248	-		120353729	-1	no_errors	ENST00000239032	ensembl	human	known	74_37	missense	SNP	0.994	T
DCAF7	10238	genome.wustl.edu	37	17	61628123	61628123	+	Missense_Mutation	SNP	G	G	A			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr17:61628123G>A	ENST00000310827.4	+	1	302	c.85G>A	c.(85-87)Gat>Aat	p.D29N	DCAF7_ENST00000431926.1_Missense_Mutation_p.D29N|DCAF7_ENST00000415273.2_Missense_Mutation_p.D29N|DCAF7_ENST00000577702.1_3'UTR	NM_005828.3	NP_005819.3	P61962	DCAF7_HUMAN	DDB1 and CUL4 associated factor 7	29					multicellular organismal development (GO:0007275)|protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|protein complex (GO:0043234)				endometrium(6)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)	18						TGTGCGGCCCGATAAGCGCTT	0.652																																																	0								ENSG00000136485						56.0	62.0	60.0					17																	61628123		1984	4159	6143	DCAF7	SO:0001583	missense	0			-	HGNC	U94747	CCDS74127.1	17q23.3	2013-01-09	2009-07-17	2009-07-17		ENSG00000136485		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	30915	protein-coding gene	gene with protein product	"""seven-WD-repeat protein of the AN11 family-1"", ""human anthocyanin"""	605973	"""WD repeat domain 68"""	WDR68		9192870, 20940704	Standard	NM_005828		Approved	HAN11, SWAN-1	uc002jbc.4	P61962		ENST00000310827.4:c.85G>A	17.37:g.61628123G>A	ENSP00000308344:p.Asp29Asn	Somatic	0	33	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51	B4E039|D3DU14|O15491|Q9DAE4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.D29N	ENST00000310827.4	37	c.85		17	.	.	.	.	.	.	.	.	.	.	G	25.8	4.671297	0.88348	.	.	ENSG00000136485	ENST00000310827;ENST00000431926;ENST00000415273	T;T;T	0.69175	-0.25;-0.38;1.23	5.62	5.62	0.85841	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.090917	0.85682	D	0.000000	T	0.68751	0.3035	L	0.51422	1.61	0.80722	D	1	D;B	0.53312	0.959;0.426	P;B	0.47705	0.555;0.116	T	0.65438	-0.6168	10	0.28530	T	0.3	-30.8828	19.6415	0.95760	0.0:0.0:1.0:0.0	.	29;29	B4E039;P61962	.;DCAF7_HUMAN	N	29	ENSP00000308344:D29N;ENSP00000402312:D29N;ENSP00000403920:D29N	ENSP00000308344:D29N	D	+	1	0	DCAF7	58981855	1.000000	0.71417	0.977000	0.42913	0.996000	0.88848	9.115000	0.94336	2.651000	0.90000	0.561000	0.74099	GAT	-	superfamily_WD40_repeat_dom		0.652	DCAF7-201	KNOWN	basic|appris_principal	protein_coding	DCAF7	protein_coding		G	NM_005828	-		61628123	+1	no_errors	ENST00000310827	ensembl	human	known	74_37	missense	SNP	1.000	A
RP11-640M9.2	0	genome.wustl.edu	37	1	144598755	144598755	+	RNA	SNP	G	G	A	rs2660554	byFrequency	TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr1:144598755G>A	ENST00000419820.1	+	0	683																											GGTGTGGGCCGAATGAAGAGC	0.527													.|||	2490	0.497204	0.5	0.4986	5008	,	,		51439	0.494		0.493	False		,,,				2504	0.5																0								ENSG00000225241																																			RP11-640M9.2			0			-	Clone_based_vega_gene																													1.37:g.144598755G>A		Somatic	0	8	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	22	31.25		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000419820.1	37	NULL		1																																																																																			-	-		0.527	RP11-640M9.2-011	KNOWN	basic	processed_transcript	ENSG00000225241	pseudogene	OTTHUMT00000038365.1	G		rs2660554		144598755	+1	no_errors	ENST00000419820	ensembl	human	known	74_37	rna	SNP	0.003	A
WDR75	84128	genome.wustl.edu	37	2	190327331	190327368	+	Splice_Site	DEL	TGCAGGAGATTTATTCTGCACTTCTCACTCTGATAATA	TGCAGGAGATTTATTCTGCACTTCTCACTCTGATAATA	-	rs370964637|rs568931467|rs369195954	byFrequency	TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	TGCAGGAGATTTATTCTGCACTTCTCACTCTGATAATA	TGCAGGAGATTTATTCTGCACTTCTCACTCTGATAATA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr2:190327331_190327368delTGCAGGAGATTTATTCTGCACTTCTCACTCTGATAATA	ENST00000314761.4	+	9	960_997	c.900_937delTGCAGGAGATTTATTCTGCACTTCTCACTCTGATAATA	c.(898-939)cctgcaggagatttattctgcacttctcactctgataataag>ccag	p.AGDLFCTSHSDNK301fs		NM_032168.1	NP_115544.1	Q8IWA0	WDR75_HUMAN	WD repeat domain 75	301						nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(1)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)	25			OV - Ovarian serous cystadenocarcinoma(117;0.00105)|Epithelial(96;0.0129)|all cancers(119;0.0456)			CAGTCTCGCCTGCAGGAGATTTATTCTGCACTTCTCACTCTGATAATAGTAAGTCTAA	0.382																																																	0								ENSG00000115368																																			WDR75	SO:0001630	splice_region_variant	0				HGNC	AK091546	CCDS2298.1	2q32.2	2013-01-09			ENSG00000115368	ENSG00000115368		"""WD repeat domain containing"""	25725	protein-coding gene	gene with protein product	"""UTP17, small subunit (SSU) processome component, homolog (yeast)"""					17699751	Standard	NM_032168		Approved	FLJ12519, NET16, UTP17	uc002uql.1	Q8IWA0	OTTHUMG00000132660	ENST00000314761.4:c.937+1TGCAGGAGATTTATTCTGCACTTCTCACTCTGATAATA>-	2.37:g.190327331_190327368delTGCAGGAGATTTATTCTGCACTTCTCACTCTGATAATA		Somatic	NA	NA	NA		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q96J10|Q9H8U8|Q9H9U5|Q9H9V8|Q9UIX2	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.A301fs	ENST00000314761.4	37	c.900_937	CCDS2298.1	2																																																																																			-	superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom		0.382	WDR75-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR75	protein_coding	OTTHUMT00000255913.1	TGCAGGAGATTTATTCTGCACTTCTCACTCTGATAATA	NM_032168		Frame_Shift_Del	190327368	+1	no_errors	ENST00000314761	ensembl	human	known	74_37	frame_shift_del	DEL	0.884:0.984:0.969:0.111:1.000:1.000:0.782:0.909:0.963:0.966:0.972:0.999:0.998:1.000:1.000:1.000:1.000:1.000:0.984:1.000:1.000:0.889:0.994:0.998:0.932:1.000:1.000:0.933:0.928:0.924:0.507:1.000:1.000:1.000:1.000:1.000:1.000:1.000	-
FAM133B	257415	genome.wustl.edu	37	7	92207637	92207638	+	Frame_Shift_Ins	INS	-	-	T			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr7:92207637_92207638insT	ENST00000445716.1	-	4	373_374	c.271_272insA	c.(271-273)agafs	p.R91fs	FAM133B_ENST00000427372.1_Frame_Shift_Ins_p.R81fs|FAM133B_ENST00000438306.1_Frame_Shift_Ins_p.R81fs	NM_152789.2	NP_690002.2	Q5BKY9	F133B_HUMAN	family with sequence similarity 133, member B	91	Lys-rich.|Ser-rich.						poly(A) RNA binding (GO:0044822)			endometrium(1)|large_intestine(1)|ovary(1)|upper_aerodigestive_tract(1)	4	all_cancers(62;7.39e-11)|all_epithelial(64;7.03e-10)|Breast(17;0.00201)|all_lung(186;0.0384)|Lung NSC(181;0.053)|all_hematologic(106;0.237)		STAD - Stomach adenocarcinoma(4;6.16e-07)|GBM - Glioblastoma multiforme(5;9.78e-06)|all cancers(6;1.67e-05)|Epithelial(20;0.113)|LUSC - Lung squamous cell carcinoma(200;0.225)|Lung(22;0.23)			TATTACCTGTCTTTTTTTGGAT	0.342																																																	0								ENSG00000234545																																			FAM133B	SO:0001589	frameshift_variant	0				HGNC		CCDS47640.1, CCDS47641.1	7q21.2	2014-02-12	2007-04-26		ENSG00000234545	ENSG00000234545			28629	protein-coding gene	gene with protein product						12477932	Standard	NM_152789		Approved	MGC40405	uc003umc.3	Q5BKY9	OTTHUMG00000155863	ENST00000445716.1:c.272dupA	7.37:g.92207644_92207644dupT	ENSP00000398401:p.Arg91fs	Somatic	0	46	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	51	25.00	B2R994|Q05D67|Q6P5S6|Q8N0W8	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	NULL	p.R91fs	ENST00000445716.1	37	c.272_271	CCDS47640.1	7																																																																																			-	NULL		0.342	FAM133B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM133B	protein_coding	OTTHUMT00000342181.2	-	NM_001040057			92207638	-1	no_errors	ENST00000445716	ensembl	human	known	74_37	frame_shift_ins	INS	1.000:1.000	T
ADORA2A	135	genome.wustl.edu	37	22	24827477	24827477	+	Intron	SNP	G	G	C			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr22:24827477G>C	ENST00000337539.7	+	2	185				ADORA2A_ENST00000496497.1_Intron|SPECC1L-ADORA2A_ENST00000358654.2_Intron|ADORA2A-AS1_ENST00000543438.1_RNA|ADORA2A-AS1_ENST00000326341.4_RNA	NM_000675.4|NM_001278497.1|NM_001278498.1|NM_001278499.1|NM_001278500.1	NP_000666.2|NP_001265426.1|NP_001265427.1|NP_001265428.1|NP_001265429.1	P29274	AA2AR_HUMAN	adenosine A2a receptor						activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|apoptotic process (GO:0006915)|blood circulation (GO:0008015)|blood coagulation (GO:0007596)|cAMP biosynthetic process (GO:0006171)|cell-cell signaling (GO:0007267)|cellular defense response (GO:0006968)|central nervous system development (GO:0007417)|inflammatory response (GO:0006954)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phagocytosis (GO:0006909)|positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010579)|sensory perception (GO:0007600)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|G-protein coupled adenosine receptor activity (GO:0001609)|identical protein binding (GO:0042802)			breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|liver(1)|lung(7)|skin(1)	21	Colorectal(2;0.196)				Adenosine(DB00640)|Caffeine(DB00201)|Defibrotide(DB04932)|Dyphylline(DB00651)|Enprofylline(DB00824)|Mefloquine(DB00358)|Oxtriphylline(DB01303)|Pentoxifylline(DB00806)|Regadenoson(DB06213)|Theobromine(DB01412)|Theophylline(DB00277)	ACAGGGCTCAGGACCAGGAGT	0.572																																																	0								ENSG00000178803																																			ADORA2A-AS1	SO:0001627	intron_variant	0			-	HGNC	X68486	CCDS13826.1	22q11.23	2012-08-08			ENSG00000128271	ENSG00000128271		"""GPCR / Class A : Adenosine receptors"""	263	protein-coding gene	gene with protein product		102776		ADORA2		1662665, 2541503	Standard	NM_001278497		Approved	RDC8	uc002zzy.4	P29274	OTTHUMG00000150761	ENST00000337539.7:c.-274-1622G>C	22.37:g.24827477G>C		Somatic	0	31	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	38	17.39	B2R7E0	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000337539.7	37	NULL	CCDS13826.1	22	.	.	.	.	.	.	.	.	.	.	G	4.403	0.074424	0.08485	.	.	ENSG00000178803	ENST00000326341;ENST00000543438	.	.	.	2.59	1.18	0.20946	.	.	.	.	.	T	0.53158	0.1779	.	.	.	0.09310	N	1	D	0.65815	0.995	D	0.63877	0.919	T	0.38585	-0.9654	7	0.87932	D	0	.	3.9165	0.09225	0.3213:0.0:0.6787:0.0	.	15	P86434	CV045_HUMAN	R	15	.	ENSP00000426996:P15R	P	-	2	0	C22orf45	23157477	0.001000	0.12720	0.013000	0.15412	0.141000	0.21300	0.044000	0.13992	0.383000	0.24910	0.561000	0.74099	CCT	-	-		0.572	ADORA2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADORA2A-AS1	protein_coding	OTTHUMT00000319971.2	G	NM_000675	-		24827477	-1	no_errors	ENST00000326341	ensembl	human	known	74_37	rna	SNP	0.013	C
ANKRD42	338699	genome.wustl.edu	37	11	82921150	82921151	+	Intron	INS	-	-	A			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr11:82921150_82921151insA	ENST00000393392.2	+	4	408				ANKRD42_ENST00000526731.1_Intron|ANKRD42_ENST00000260047.6_Intron|ANKRD42_ENST00000531895.1_Intron|RP11-727A23.7_ENST00000531869.1_RNA|ANKRD42_ENST00000533342.1_Intron|ANKRD42_ENST00000528722.1_Intron|ANKRD42_ENST00000393389.3_Intron	NM_182603.2	NP_872409.2	Q8N9B4	ANR42_HUMAN	ankyrin repeat domain 42						positive regulation of cytokine production involved in inflammatory response (GO:1900017)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)	nucleus (GO:0005634)				central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(6)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	18						TTTTGTAATCTAAAAAAAAAAA	0.277																																																	0								ENSG00000254551																																			RP11-727A23.7	SO:0001627	intron_variant	0				Clone_based_vega_gene	AK095193	CCDS8265.1, CCDS73355.1, CCDS73356.1	11q14.1	2014-06-12			ENSG00000137494	ENSG00000137494		"""Ankyrin repeat domain containing"""	26752	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 79"""						Standard	XM_005273971		Approved	FLJ37874, SARP, PPP1R79	uc001ozz.1	Q8N9B4	OTTHUMG00000167075	ENST00000393392.2:c.247-191->A	11.37:g.82921161_82921161dupA		Somatic	0	22	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	21	16.00	Q49A49	Splice_Site	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000393392.2	37	c.NULL	CCDS8265.1	11																																																																																			-	-		0.277	ANKRD42-001	KNOWN	basic|CCDS	protein_coding	ENSG00000254551	protein_coding	OTTHUMT00000392934.1	-	NM_182603			82921151	-1	no_errors	ENST00000531869	ensembl	human	known	74_37	splice_site_ins	INS	0.001:0.000	A
PRSS3	5646	genome.wustl.edu	37	9	33794840	33794840	+	Intron	SNP	G	G	A	rs10117993	byFrequency	TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr9:33794840G>A	ENST00000361005.5	+	2	211				RP11-133O22.6_ENST00000454429.2_RNA|PRSS3_ENST00000429677.3_Intron|PRSS3_ENST00000379405.3_5'Flank|PRSS3_ENST00000342836.4_Silent_p.A17A	NM_007343.3	NP_031369	P35030	TRY3_HUMAN	protease, serine, 3						cobalamin metabolic process (GO:0009235)|digestion (GO:0007586)|endothelial cell migration (GO:0043542)|innate immune response (GO:0045087)|proteolysis (GO:0006508)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)|zymogen activation (GO:0031638)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			large_intestine(3)|lung(4)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	13			LUSC - Lung squamous cell carcinoma(29;0.0176)			GGAGGAGTGCGCCATTGGTTT	0.498													G|||	318	0.0634984	0.2337	0.013	5008	,	,		20986	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000010438																																			PRSS3	SO:0001627	intron_variant	0			-	HGNC		CCDS6545.1, CCDS47958.1, CCDS56570.1, CCDS56571.1	9p13	2010-05-07	2008-03-11		ENSG00000010438	ENSG00000010438	3.4.21.4	"""Serine peptidases / Serine peptidases"""	9486	protein-coding gene	gene with protein product	"""mesotrypsin"""	613578	"""protease, serine, 4 (trypsin 4, brain)"", ""protease, serine, 3 (mesotrypsin)"""	PRSS4		2326201, 8294000	Standard	NM_002771		Approved	TRY3, TRY4	uc003ztj.4	P35030	OTTHUMG00000019798	ENST00000361005.5:c.212-1801G>A	9.37:g.33794840G>A		Somatic	0	22	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	28	15.15	A8CED1|A8CED3|A9Z1Y4|E7ES07|F8W7P3|P15951|Q15665|Q5VXV0|Q6ISJ4|Q9UQV3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.A17	ENST00000361005.5	37	c.51	CCDS47958.1	9																																																																																			-	NULL		0.498	PRSS3-003	KNOWN	basic|CCDS	protein_coding	PRSS3	protein_coding	OTTHUMT00000052121.1	G	NM_002771	rs10117993		33794840	+1	no_errors	ENST00000342836	ensembl	human	known	74_37	silent	SNP	0.000	A
TUBA3D	113457	genome.wustl.edu	37	2	132240193	132240193	+	Silent	SNP	G	G	A			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr2:132240193G>A	ENST00000321253.6	+	5	1232	c.1125G>A	c.(1123-1125)gtG>gtA	p.V375V	MZT2A_ENST00000410036.2_5'Flank	NM_080386.3	NP_525125.2	Q13748	TBA3C_HUMAN	tubulin, alpha 3d	375					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(18)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	32				BRCA - Breast invasive adenocarcinoma(221;0.13)		AGCGGGCCGTGTGCATGCTGA	0.617																																					Ovarian(137;2059 2432 35543 39401)												0								ENSG00000075886						46.0	46.0	46.0					2																	132240193		2203	4297	6500	TUBA3D	SO:0001819	synonymous_variant	0			-	HGNC	K03460	CCDS33290.1	2q21.1	2007-03-16			ENSG00000075886	ENSG00000075886		"""Tubulins"""	24071	protein-coding gene	gene with protein product	"""alpha-tubulin isotype H2-alpha"""					3785200	Standard	NM_080386		Approved	H2-ALPHA	uc002tsu.4	Q13748	OTTHUMG00000153600	ENST00000321253.6:c.1125G>A	2.37:g.132240193G>A		Somatic	0	43	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	43	36.76	A6NJQ0|Q5W099|Q6PEY3|Q96F18	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Alpha_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Delta_tubulin,prints_Beta_tubulin	p.V375	ENST00000321253.6	37	c.1125	CCDS33290.1	2																																																																																			-	pfam_Tubulin/FtsZ_2-layer-sand-dom,superfamily_Tub_FtsZ_C,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Alpha_tubulin,prints_Delta_tubulin		0.617	TUBA3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBA3D	protein_coding	OTTHUMT00000331800.2	G	NM_080386	-		132240193	+1	no_errors	ENST00000321253	ensembl	human	known	74_37	silent	SNP	1.000	A
SFRP4	6424	genome.wustl.edu	37	7	37951720	37951720	+	Splice_Site	SNP	C	C	A			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr7:37951720C>A	ENST00000436072.2	-	4	1169		c.e4+1		EPDR1_ENST00000476620.1_Intron	NM_003014.3	NP_003005.2	Q6FHJ7	SFRP4_HUMAN	secreted frizzled-related protein 4						brain development (GO:0007420)|cell differentiation (GO:0030154)|decidualization (GO:0046697)|epithelium development (GO:0060429)|gonad development (GO:0008406)|mammary gland involution (GO:0060056)|menstrual cycle phase (GO:0022601)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of JNK cascade (GO:0046329)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of sodium-dependent phosphate transport (GO:2000119)|phosphate ion homeostasis (GO:0055062)|positive regulation of apoptotic process (GO:0043065)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of epidermal cell differentiation (GO:0045606)|positive regulation of gene expression (GO:0010628)|positive regulation of keratinocyte apoptotic process (GO:1902174)|positive regulation of receptor internalization (GO:0002092)|response to hormone (GO:0009725)|vasculature development (GO:0001944)|Wnt signaling pathway (GO:0016055)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleus (GO:0005634)	PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(13)|upper_aerodigestive_tract(2)|urinary_tract(1)	29						TTTGTGCCTACCTTGAGCGCC	0.438																																																	0								ENSG00000106483						149.0	142.0	145.0					7																	37951720		2203	4300	6503	SFRP4	SO:0001630	splice_region_variant	0			-	HGNC	AF026692	CCDS5453.1	7p14.1	2008-07-18			ENSG00000106483	ENSG00000106483		"""Secreted frizzled-related proteins"""	10778	protein-coding gene	gene with protein product		606570				10211996	Standard	NM_003014		Approved	frpHE, FRP-4, FRPHE	uc003tfo.4	Q6FHJ7	OTTHUMG00000023026	ENST00000436072.2:c.791+1G>T	7.37:g.37951720C>A		Somatic	0	41	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	50	9.09	B4DYC1|O14877|Q05BG7|Q1ZYW2|Q4G124|Q6FHM0|Q6PD64	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e4+1	ENST00000436072.2	37	c.791+1	CCDS5453.1	7	.	.	.	.	.	.	.	.	.	.	C	19.83	3.900766	0.72754	.	.	ENSG00000106483	ENST00000436072;ENST00000446575;ENST00000447200	.	.	.	5.72	5.72	0.89469	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.6559	0.91453	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SFRP4	37918245	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	6.478000	0.73596	2.684000	0.91462	0.650000	0.86243	.	-	-		0.438	SFRP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SFRP4	protein_coding	OTTHUMT00000220017.2	C	NM_003014	-	Intron	37951720	-1	no_errors	ENST00000436072	ensembl	human	known	74_37	splice_site	SNP	1.000	A
IL2RB	3560	genome.wustl.edu	37	22	37532384	37532384	+	Missense_Mutation	SNP	T	T	C			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr22:37532384T>C	ENST00000216223.5	-	7	785	c.587A>G	c.(586-588)gAg>gGg	p.E196G	AL022314.1_ENST00000516333.1_RNA	NM_000878.3	NP_000869.1	P14784	IL2RB_HUMAN	interleukin 2 receptor, beta	196	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cytokine-mediated signaling pathway (GO:0019221)|interleukin-2-mediated signaling pathway (GO:0038110)|negative regulation of apoptotic process (GO:0043066)|protein complex assembly (GO:0006461)|signal transduction (GO:0007165)|viral process (GO:0016032)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	interleukin-2 binding (GO:0019976)|interleukin-2 receptor activity (GO:0004911)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)|skin(5)	23					Aldesleukin(DB00041)|Basiliximab(DB00074)|Daclizumab(DB00111)|Denileukin diftitox(DB00004)	GGTGAGCGTCTCCAGGCAGAT	0.642																																																	0								ENSG00000100385						36.0	37.0	37.0					22																	37532384		2203	4300	6503	IL2RB	SO:0001583	missense	0			-	HGNC	M26062	CCDS13942.1	22q13	2011-02-15			ENSG00000100385	ENSG00000100385		"""Interleukins and interleukin receptors"", ""CD molecules"""	6009	protein-coding gene	gene with protein product		146710	"""interleukin 15 receptor, beta"""	IL15RB			Standard	NM_000878		Approved	CD122	uc003aqv.1	P14784	OTTHUMG00000150534	ENST00000216223.5:c.587A>G	22.37:g.37532384T>C	ENSP00000216223:p.Glu196Gly	Somatic	0	48	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	73	14.12	B2R765	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.E196G	ENST00000216223.5	37	c.587	CCDS13942.1	22	.	.	.	.	.	.	.	.	.	.	T	15.65	2.896063	0.52121	.	.	ENSG00000100385	ENST00000216223	D	0.96992	-4.2	4.74	3.65	0.41850	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.525534	0.20502	N	0.091061	D	0.96806	0.8957	M	0.68593	2.085	0.23693	N	0.997093	D	0.76494	0.999	D	0.68943	0.961	D	0.91083	0.4901	10	0.27082	T	0.32	-19.6258	9.2851	0.37753	0.0:0.0:0.1805:0.8195	.	196	P14784	IL2RB_HUMAN	G	196	ENSP00000216223:E196G	ENSP00000216223:E196G	E	-	2	0	IL2RB	35862330	0.988000	0.35896	0.990000	0.47175	0.315000	0.28087	2.286000	0.43496	1.756000	0.51951	0.379000	0.24179	GAG	-	superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.642	IL2RB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL2RB	protein_coding	OTTHUMT00000318792.1	T		-		37532384	-1	no_errors	ENST00000216223	ensembl	human	known	74_37	missense	SNP	0.432	C
NKAIN3	286183	genome.wustl.edu	37	8	63775856	63775856	+	Intron	DEL	T	T	-	rs200185258	byFrequency	TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr8:63775856delT	ENST00000523211.1	+	5	603				NKAIN3_ENST00000328472.5_Intron|NKAIN3_ENST00000519049.1_Intron	NM_173688.2	NP_775959.1	Q8N8D7	NKAI3_HUMAN	Na+/K+ transporting ATPase interacting 3							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				kidney(3)|large_intestine(2)|lung(8)	13	Breast(64;0.127)	Lung NSC(129;0.187)				GGAGCCGTACTCACTGCAGAC	0.428													T|T|-|deletion	569	0.113618	0.0106	0.196	5008	,	,		20977	0.256		0.0686	False		,,,				2504	0.0941																0								ENSG00000185942																																			NKAIN3	SO:0001627	intron_variant	0				HGNC	AK096949	CCDS55239.1	8q12.3	2014-08-12	2007-10-04	2007-10-04	ENSG00000185942	ENSG00000185942		"""Na+/K+ transporting ATPase interacting"""	26829	protein-coding gene	gene with protein product		612872	"""family with sequence similarity 77, member D"""	FAM77D		17606467	Standard	NM_173688		Approved	FLJ39630	uc010lyq.1	Q8N8D7	OTTHUMG00000164361	ENST00000523211.1:c.472-55156T>-	8.37:g.63775856delT		Somatic	0	11	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	11	45.00		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000523211.1	37	NULL	CCDS55239.1	8																																																																																			-	-		0.428	NKAIN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NKAIN3	protein_coding	OTTHUMT00000378447.2	T	NM_173688			63775856	+1	no_errors	ENST00000523367	ensembl	human	known	74_37	rna	DEL	1.000	-
CCDC58	131076	genome.wustl.edu	37	3	122087043	122087043	+	Missense_Mutation	SNP	G	G	T			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr3:122087043G>T	ENST00000291458.5	-	3	310	c.304C>A	c.(304-306)Ctt>Att	p.L102I	CCDC58_ENST00000479899.1_Missense_Mutation_p.L88I|CCDC58_ENST00000497726.1_Intron|CCDC58_ENST00000466854.1_5'Flank	NM_001017928.2	NP_001017928.1	Q4VC31	CCD58_HUMAN	coiled-coil domain containing 58	102						mitochondrion (GO:0005739)				large_intestine(1)|lung(1)	2				GBM - Glioblastoma multiforme(114;0.148)		TCTTTTCTAAGTTGTTTTAAT	0.323																																																	0								ENSG00000160124						104.0	103.0	103.0					3																	122087043		2203	4298	6501	CCDC58	SO:0001583	missense	0			-	HGNC	AK090592	CCDS33838.1	3q21.1	2006-01-17			ENSG00000160124	ENSG00000160124			31136	protein-coding gene	gene with protein product							Standard	XM_005247108		Approved	FLJ33273	uc003eey.3	Q4VC31	OTTHUMG00000159490	ENST00000291458.5:c.304C>A	3.37:g.122087043G>T	ENSP00000291458:p.Leu102Ile	Somatic	0	35	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	31	11.43	Q32LY6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Caffeine_induced_death_Cid2	p.L102I	ENST00000291458.5	37	c.304	CCDS33838.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.59|15.59	2.878839|2.878839	0.51801|0.51801	.|.	.|.	ENSG00000160124|ENSG00000160124	ENST00000291458;ENST00000479899|ENST00000479414	.|.	.|.	.|.	5.17|5.17	4.23|4.23	0.50019|0.50019	.|.	0.058037|.	0.64402|.	D|.	0.000001|.	T|T	0.74222|0.74222	0.3688|0.3688	M|M	0.74881|0.74881	2.28|2.28	0.41004|0.41004	D|D	0.984953|0.984953	B|.	0.19331|.	0.035|.	B|.	0.28305|.	0.088|.	T|T	0.75539|0.75539	-0.3282|-0.3282	9|5	0.62326|.	D|.	0.03|.	.|.	15.3604|15.3604	0.74469|0.74469	0.0:0.0:0.8513:0.1487|0.0:0.0:0.8513:0.1487	.|.	102|.	Q4VC31|.	CCD58_HUMAN|.	I|N	102;88|98	.|.	ENSP00000291458:L102I|.	L|T	-|-	1|2	0|0	CCDC58|CCDC58	123569733|123569733	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	6.787000|6.787000	0.75099|0.75099	2.692000|2.692000	0.91855|0.91855	0.655000|0.655000	0.94253|0.94253	CTT|ACT	-	pfam_Caffeine_induced_death_Cid2		0.323	CCDC58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC58	protein_coding	OTTHUMT00000355754.1	G	NM_001017928	-		122087043	-1	no_errors	ENST00000291458	ensembl	human	known	74_37	missense	SNP	1.000	T
UGT1A6	54578	genome.wustl.edu	37	2	234681041	234681041	+	Missense_Mutation	SNP	G	G	A			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr2:234681041G>A	ENST00000305139.6	+	5	1574	c.1435G>A	c.(1435-1437)Gac>Aac	p.D479N	UGT1A3_ENST00000482026.1_Missense_Mutation_p.D481N|UGT1A9_ENST00000354728.4_Missense_Mutation_p.D477N|UGT1A1_ENST00000609637.1_Missense_Mutation_p.D477N|UGT1A1_ENST00000373450.4_Missense_Mutation_p.D477N|UGT1A6_ENST00000373424.1_Missense_Mutation_p.D212N|UGT1A4_ENST00000373409.3_Missense_Mutation_p.D481N|UGT1A5_ENST00000373414.3_Missense_Mutation_p.D481N|UGT1A1_ENST00000609767.1_Missense_Mutation_p.D481N|UGT1A8_ENST00000305208.5_Missense_Mutation_p.D480N|UGT1A10_ENST00000344644.5_Missense_Mutation_p.D477N|UGT1A1_ENST00000608381.1_Missense_Mutation_p.D481N|UGT1A1_ENST00000608383.1_Missense_Mutation_p.D480N|UGT1A7_ENST00000373426.3_Missense_Mutation_p.D477N	NM_001072.3	NP_001063.2	P19224	UD16_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A6	479					cellular glucuronidation (GO:0052695)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	enzyme binding (GO:0019899)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(10)|skin(1)|upper_aerodigestive_tract(1)	22		Breast(86;0.000765)|all_lung(227;0.00267)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0457)|Lung SC(224;0.128)		Epithelial(121;5.86e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000384)|Lung(119;0.00306)|LUSC - Lung squamous cell carcinoma(224;0.00702)	Acetaminophen(DB00316)|Deferiprone(DB08826)|Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|Propofol(DB00818)|Valproic Acid(DB00313)	CGCAGCCCACGACCTCACCTG	0.597																																																	0								ENSG00000244474						155.0	128.0	137.0					2																	234681041		2203	4300	6503	UGT1A4	SO:0001583	missense	0			-	HGNC	M84130	CCDS2507.1, CCDS2508.1	2q37	2010-03-05	2005-07-20		ENSG00000167165	ENSG00000167165		"""UDP glucuronosyltransferases"""	12538	other	complex locus constituent		606431	"""UDP glycosyltransferase 1 family, polypeptide A6"""			9295054, 1339448	Standard	NM_001072		Approved	HLUGP, GNT1, UGT1F		P19224	OTTHUMG00000059122	ENST00000305139.6:c.1435G>A	2.37:g.234681041G>A	ENSP00000303174:p.Asp479Asn	Somatic	0	27	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	19	35.48	A6NKK6|B8K289|Q96TE7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	p.D481N	ENST00000305139.6	37	c.1441	CCDS2507.1	2	.	.	.	.	.	.	.	.	.	.	G	26.1	4.701229	0.88924	.	.	ENSG00000242366;ENSG00000242515;ENSG00000241119;ENSG00000244122;ENSG00000167165;ENSG00000167165;ENSG00000240224;ENSG00000244474;ENSG00000243135;ENSG00000241635	ENST00000373450;ENST00000344644;ENST00000354728;ENST00000373426;ENST00000373424;ENST00000305139;ENST00000373414;ENST00000373409;ENST00000482026;ENST00000305208	T;T;T;T;T;T;T;T;T;T	0.63744	-0.06;-0.06;-0.06;-0.06;-0.06;-0.06;-0.06;-0.06;-0.06;-0.06	5.83	4.95	0.65309	.	0.103647	0.64402	D	0.000005	T	0.76040	0.3932	L	0.60067	1.865	0.80722	D	1	D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;0.999	D;D;D;D;D;D;D;D;D	0.97110	0.988;0.98;0.999;1.0;0.997;0.991;0.999;0.999;0.938	T	0.75578	-0.3269	10	0.38643	T	0.18	.	16.9581	0.86265	0.0:0.1277:0.8723:0.0	.	480;481;481;481;479;477;477;477;477	P22309;P35503;P22310;P35504;P19224;Q9HAW7;O60656;Q9HAW8;Q9HAW9	UD11_HUMAN;UD13_HUMAN;UD14_HUMAN;UD15_HUMAN;UD16_HUMAN;UD17_HUMAN;UD19_HUMAN;UD110_HUMAN;UD18_HUMAN	N	477;477;477;477;212;479;481;481;481;480	ENSP00000362549:D477N;ENSP00000343838:D477N;ENSP00000346768:D477N;ENSP00000362525:D477N;ENSP00000362523:D212N;ENSP00000303174:D479N;ENSP00000362513:D481N;ENSP00000362508:D481N;ENSP00000418532:D481N;ENSP00000304845:D480N	ENSP00000343838:D477N	D	+	1	0	UGT1A7;UGT1A6;UGT1A10;UGT1A9;UGT1A8;UGT1A3;UGT1A5;UGT1A4;UGT1A1	234345780	1.000000	0.71417	0.972000	0.41901	0.982000	0.71751	3.779000	0.55379	1.451000	0.47736	0.655000	0.94253	GAC	-	pfam_UDP_glucos_trans		0.597	UGT1A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGT1A4	protein_coding	OTTHUMT00000130988.1	G	NM_205862	-		234681041	+1	no_errors	ENST00000373409	ensembl	human	known	74_37	missense	SNP	0.991	A
UBXN11	91544	genome.wustl.edu	37	1	26627488	26627488	+	Missense_Mutation	SNP	C	C	T			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr1:26627488C>T	ENST00000374222.1	-	5	592	c.128G>A	c.(127-129)gGg>gAg	p.G43E	UBXN11_ENST00000374223.1_Intron|UBXN11_ENST00000436301.2_Intron|UBXN11_ENST00000535108.1_Intron|UBXN11_ENST00000374217.2_Intron|UBXN11_ENST00000357089.4_Intron|UBXN11_ENST00000314675.7_Missense_Mutation_p.G43E|UBXN11_ENST00000374221.3_Missense_Mutation_p.G43E			Q5T124	UBX11_HUMAN	UBX domain protein 11	43						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				endometrium(3)|kidney(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(3)|upper_aerodigestive_tract(3)	23						TGAGCCACACCCATCACTCAA	0.602																																																	0								ENSG00000158062						142.0	138.0	139.0					1																	26627488		2090	4227	6317	UBXN11	SO:0001583	missense	0			-	HGNC	AF521017	CCDS41286.1, CCDS41287.1, CCDS41288.1	1p36.11	2008-07-25	2008-07-25	2008-07-25	ENSG00000158062	ENSG00000158062		"""UBX domain containing"""	30600	protein-coding gene	gene with protein product	"""socius"""	609151	"""UBX domain containing 5"""	UBXD5		11940653	Standard	NM_183008		Approved	SOC, SOCI	uc001blw.3	Q5T124	OTTHUMG00000003382	ENST00000374222.1:c.128G>A	1.37:g.26627488C>T	ENSP00000363339:p.Gly43Glu	Somatic	0	41	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	41	8.89	D3DPK6|Q5T117|Q5T120|Q5T125|Q5T126|Q5T129|Q5T131|Q5T133|Q63HM6|Q71RB3|Q8IY27|Q8N1L6|Q8N9M4|Q8NA18|Q8NFE3|Q8NFE4|Q8NFE6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SEP_domain,superfamily_SEP_domain,pfscan_UBX	p.G43E	ENST00000374222.1	37	c.128	CCDS41288.1	1	.	.	.	.	.	.	.	.	.	.	C	8.040	0.763697	0.15914	.	.	ENSG00000158062	ENST00000314675;ENST00000374221;ENST00000374222;ENST00000374215;ENST00000423664;ENST00000421827	T;T;T;T;T	0.44881	0.91;0.91;0.91;0.91;0.91	3.8	0.894	0.19242	.	0.683705	0.12190	N	0.491317	T	0.31482	0.0798	L	0.59436	1.845	0.09310	N	0.999999	P;P	0.48162	0.573;0.906	B;B	0.44224	0.343;0.444	T	0.23190	-1.0195	10	0.02654	T	1	-0.525	3.8351	0.08891	0.0:0.5488:0.2198:0.2314	.	43;43	Q5T124-3;Q5T124	.;UBX11_HUMAN	E	43;43;43;5;5;43	ENSP00000324721:G43E;ENSP00000363338:G43E;ENSP00000363339:G43E;ENSP00000363332:G5E;ENSP00000394036:G5E	ENSP00000324721:G43E	G	-	2	0	UBXN11	26500075	0.001000	0.12720	0.000000	0.03702	0.003000	0.03518	0.660000	0.25009	0.212000	0.20703	-0.218000	0.12543	GGG	-	NULL		0.602	UBXN11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	UBXN11	protein_coding	OTTHUMT00000009500.1	C	NM_145345	-		26627488	-1	no_errors	ENST00000374221	ensembl	human	known	74_37	missense	SNP	0.000	T
AC010543.1	0	genome.wustl.edu	37	16	57908329	57908329	+	RNA	DEL	T	T	-			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr16:57908329delT	ENST00000580935.1	-	0	105																											taaataacaattttttttagc	0.338																																																	0								ENSG00000265209																																			AC010543.1			0				Clone_based_ensembl_gene																													16.37:g.57908329delT		Somatic	0	27	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	19	9.52		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000580935.1	37	NULL		16																																																																																			-	-		0.338	AC010543.1-201	NOVEL	basic	miRNA	ENSG00000265209	miRNA		T				57908329	-1	no_errors	ENST00000580935	ensembl	human	novel	74_37	rna	DEL	0.000	-
BEST4	266675	genome.wustl.edu	37	1	45250616	45250616	+	Silent	SNP	G	G	A	rs369088764		TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr1:45250616G>A	ENST00000372207.3	-	7	953	c.954C>T	c.(952-954)gaC>gaT	p.D318D		NM_153274.2	NP_695006.1	Q8NFU0	BEST4_HUMAN	bestrophin 4	318						chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)			large_intestine(1)|lung(4)|ovary(1)|skin(1)	7	Acute lymphoblastic leukemia(166;0.155)					TCTCAAAGTCGTCATCATCCT	0.537																																																	0								ENSG00000142959	G		0,4406		0,0,2203	77.0	80.0	79.0		954	-6.1	0.8	1		79	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	BEST4	NM_153274.2		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		318/474	45250616	1,13005	2203	4300	6503	BEST4	SO:0001819	synonymous_variant	0			-	HGNC	AF440757	CCDS514.1	1p33-p32.3	2012-09-26	2006-10-18	2006-10-18	ENSG00000142959	ENSG00000142959		"""Ion channels / Chloride channels : Calcium activated : Bestrophins"""	17106	protein-coding gene	gene with protein product		607336	"""vitelliform macular dystrophy 2-like 2"""	VMD2L2		12032738, 16702355	Standard	NM_153274		Approved		uc001cmm.3	Q8NFU0	OTTHUMG00000008488	ENST00000372207.3:c.954C>T	1.37:g.45250616G>A		Somatic	0	18	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	28	22.22	Q5JR93	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Bestrophin/UPF0187	p.D318	ENST00000372207.3	37	c.954	CCDS514.1	1																																																																																			-	pfam_Bestrophin/UPF0187		0.537	BEST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BEST4	protein_coding	OTTHUMT00000023425.1	G	NM_153274	-		45250616	-1	no_errors	ENST00000372207	ensembl	human	known	74_37	silent	SNP	0.919	A
GPT2	84706	genome.wustl.edu	37	16	46943701	46943701	+	Missense_Mutation	SNP	G	G	A			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr16:46943701G>A	ENST00000340124.4	+	6	794	c.682G>A	c.(682-684)Gcc>Acc	p.A228T	GPT2_ENST00000440783.2_Missense_Mutation_p.A128T	NM_133443.2	NP_597700.1	Q8TD30	ALAT2_HUMAN	glutamic pyruvate transaminase (alanine aminotransferase) 2	228					2-oxoglutarate metabolic process (GO:0006103)|cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|L-alanine catabolic process (GO:0042853)|L-alanine metabolic process (GO:0042851)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)	L-alanine:2-oxoglutarate aminotransferase activity (GO:0004021)|pyridoxal phosphate binding (GO:0030170)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(2)	23		all_cancers(37;0.0276)|all_epithelial(9;0.0498)|all_lung(18;0.0522)			L-Alanine(DB00160)|Phenelzine(DB00780)	TGAGCTCGACGCCATCCAGGT	0.582																																																	0								ENSG00000166123						90.0	85.0	86.0					16																	46943701		2203	4300	6503	GPT2	SO:0001583	missense	0			-	HGNC		CCDS10725.1, CCDS45478.1	16q12.1	2008-02-05			ENSG00000166123	ENSG00000166123	2.6.1.2		18062	protein-coding gene	gene with protein product		138210					Standard	NM_133443		Approved	ALT2	uc002eel.3	Q8TD30	OTTHUMG00000132541	ENST00000340124.4:c.682G>A	16.37:g.46943701G>A	ENSP00000345282:p.Ala228Thr	Somatic	0	31	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	15	40.00	Q8N9E2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase	p.A228T	ENST00000340124.4	37	c.682	CCDS10725.1	16	.	.	.	.	.	.	.	.	.	.	G	27.8	4.865021	0.91511	.	.	ENSG00000166123	ENST00000340124;ENST00000440783	T;D	0.91237	1.98;-2.81	5.15	5.15	0.70609	Aminotransferase, class I/classII (1);Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.000000	0.85682	D	0.000000	D	0.95357	0.8493	M	0.90483	3.12	0.80722	D	1	D	0.65815	0.995	P	0.56612	0.802	D	0.95663	0.8717	10	0.56958	D	0.05	.	18.8172	0.92081	0.0:0.0:1.0:0.0	.	228	Q8TD30	ALAT2_HUMAN	T	228;128	ENSP00000345282:A228T;ENSP00000413804:A128T	ENSP00000345282:A228T	A	+	1	0	GPT2	45501202	1.000000	0.71417	0.805000	0.32314	0.937000	0.57800	9.137000	0.94496	2.677000	0.91161	0.561000	0.74099	GCC	-	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase		0.582	GPT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPT2	protein_coding	OTTHUMT00000255741.2	G		-		46943701	+1	no_errors	ENST00000340124	ensembl	human	known	74_37	missense	SNP	1.000	A
MYOCD	93649	genome.wustl.edu	37	17	12626248	12626248	+	Missense_Mutation	SNP	C	C	T			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr17:12626248C>T	ENST00000343344.4	+	5	338	c.338C>T	c.(337-339)gCt>gTt	p.A113V	MYOCD_ENST00000395988.1_3'UTR|AC005358.1_ENST00000609971.1_Missense_Mutation_p.A17V|MYOCD_ENST00000425538.1_Missense_Mutation_p.A113V			Q8IZQ8	MYCD_HUMAN	myocardin	113					cardiac muscle cell differentiation (GO:0055007)|cardiac ventricle development (GO:0003231)|cardiocyte differentiation (GO:0035051)|cell growth involved in cardiac muscle cell development (GO:0061049)|cellular component maintenance (GO:0043954)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hypoxia (GO:0071456)|digestive tract development (GO:0048565)|ductus arteriosus closure (GO:0097070)|hepatic stellate cell activation (GO:0035733)|lung alveolus development (GO:0048286)|negative regulation of beta-amyloid clearance (GO:1900222)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of skeletal muscle cell differentiation (GO:2001015)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|positive regulation of cardiac vascular smooth muscle cell differentiation (GO:2000724)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell differentiation (GO:0051152)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003257)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of cell growth by extracellular stimulus (GO:0001560)|regulation of histone acetylation (GO:0035065)|regulation of myoblast differentiation (GO:0045661)|regulation of smooth muscle cell differentiation (GO:0051150)|response to hypoxia (GO:0001666)|smooth muscle cell differentiation (GO:0051145)|urinary bladder development (GO:0060157)|uterus development (GO:0060065)|vasculogenesis (GO:0001570)|ventricular cardiac muscle cell differentiation (GO:0055012)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|protein domain specific binding (GO:0019904)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|liver(2)|lung(33)|ovary(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	70				UCEC - Uterine corpus endometrioid carcinoma (92;0.0969)		GAAAAAATTGCTCTACGACCA	0.463																																																	0								ENSG00000141052						136.0	140.0	139.0					17																	12626248		2203	4300	6503	MYOCD	SO:0001583	missense	0			-	HGNC	AF532596	CCDS11163.1, CCDS54091.1	17p11.2	2004-03-01			ENSG00000141052	ENSG00000141052			16067	protein-coding gene	gene with protein product		606127				11439182, 12397177	Standard	XM_005256863		Approved	MYCD	uc002gno.2	Q8IZQ8	OTTHUMG00000058767	ENST00000343344.4:c.338C>T	17.37:g.12626248C>T	ENSP00000341835:p.Ala113Val	Somatic	0	14	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	45	31	59.21	Q5UBU5|Q8N7Q1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RPEL_repeat,pfam_SAP_dom,smart_RPEL_repeat,smart_SAP_dom,pfscan_RPEL_repeat,pfscan_SAP_dom	p.A113V	ENST00000343344.4	37	c.338	CCDS11163.1	17	.	.	.	.	.	.	.	.	.	.	C	20.4	3.991945	0.74703	.	.	ENSG00000141052	ENST00000425538;ENST00000343344;ENST00000395988	T	0.52295	0.67	5.46	5.46	0.80206	.	0.190106	0.44902	D	0.000411	T	0.54143	0.1840	M	0.81942	2.565	0.80722	D	1	B;B;B	0.34103	0.437;0.314;0.301	B;B;B	0.32583	0.148;0.029;0.054	T	0.60762	-0.7199	10	0.72032	D	0.01	-22.9684	18.2528	0.90009	0.0:1.0:0.0:0.0	.	17;113;113	Q8IZQ8-2;Q8IZQ8-3;Q8IZQ8	.;.;MYCD_HUMAN	V	113;113;17	ENSP00000341835:A113V	ENSP00000341835:A113V	A	+	2	0	MYOCD	12566973	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	5.823000	0.69272	2.840000	0.97914	0.655000	0.94253	GCT	-	pfam_RPEL_repeat,smart_RPEL_repeat,pfscan_RPEL_repeat		0.463	MYOCD-004	KNOWN	basic|appris_principal|CCDS	protein_coding	MYOCD	protein_coding	OTTHUMT00000129950.1	C	NM_153604	-		12626248	+1	no_errors	ENST00000425538	ensembl	human	known	74_37	missense	SNP	1.000	T
PIK3AP1	118788	genome.wustl.edu	37	10	98380174	98380174	+	Missense_Mutation	SNP	C	C	T			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr10:98380174C>T	ENST00000339364.5	-	12	1995	c.1876G>A	c.(1876-1878)Gtg>Atg	p.V626M	PIK3AP1_ENST00000371109.3_Missense_Mutation_p.V225M|RNA5SP324_ENST00000365177.1_RNA|PIK3AP1_ENST00000371110.2_Missense_Mutation_p.V448M	NM_152309.2	NP_689522.2	Q6ZUJ8	BCAP_HUMAN	phosphoinositide-3-kinase adaptor protein 1	626					negative regulation of toll-like receptor signaling pathway (GO:0034122)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|regulation of inflammatory response (GO:0050727)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 7 signaling pathway (GO:0034154)|toll-like receptor 9 signaling pathway (GO:0034162)	cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	phosphatidylinositol 3-kinase regulatory subunit binding (GO:0036312)			NS(1)|autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(27)|ovary(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(4)	52		Colorectal(252;0.0442)		Epithelial(162;6.29e-08)|all cancers(201;3.18e-06)		AAGTGGAGCACAGCCTCATCC	0.498																																																	0								ENSG00000155629						129.0	121.0	124.0					10																	98380174		2203	4300	6503	PIK3AP1	SO:0001583	missense	0			-	HGNC	AK092883	CCDS31259.1	10q24.2	2008-10-23			ENSG00000155629	ENSG00000155629			30034	protein-coding gene	gene with protein product		607942				1251844, 11163197	Standard	NM_152309		Approved	BCAP, FLJ35564	uc001kmq.3	Q6ZUJ8	OTTHUMG00000018838	ENST00000339364.5:c.1876G>A	10.37:g.98380174C>T	ENSP00000339826:p.Val626Met	Somatic	0	25	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	18	14.29	Q5TB56|Q5VXJ9|Q8N6J6|Q8NAC8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_Ankyrin_rpt-contain_dom	p.V626M	ENST00000339364.5	37	c.1876	CCDS31259.1	10	.	.	.	.	.	.	.	.	.	.	C	26.3	4.720786	0.89205	.	.	ENSG00000155629	ENST00000339364;ENST00000371110;ENST00000371109	T;T;T	0.51071	0.72;0.72;0.72	5.88	4.96	0.65561	.	0.000000	0.85682	D	0.000000	T	0.63510	0.2517	M	0.61703	1.905	0.80722	D	1	D;D	0.69078	0.992;0.997	P;P	0.62089	0.898;0.898	T	0.67055	-0.5767	10	0.62326	D	0.03	-22.0998	15.2752	0.73737	0.1412:0.8588:0.0:0.0	.	626;225	Q6ZUJ8;Q6ZUJ8-3	BCAP_HUMAN;.	M	626;448;225	ENSP00000339826:V626M;ENSP00000360151:V448M;ENSP00000360150:V225M	ENSP00000339826:V626M	V	-	1	0	PIK3AP1	98370164	1.000000	0.71417	0.912000	0.35992	0.992000	0.81027	7.752000	0.85141	1.451000	0.47736	0.555000	0.69702	GTG	-	NULL		0.498	PIK3AP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIK3AP1	protein_coding	OTTHUMT00000049619.2	C	NM_152309	-		98380174	-1	no_errors	ENST00000339364	ensembl	human	known	74_37	missense	SNP	0.999	T
COL4A1	1282	genome.wustl.edu	37	13	110839583	110839583	+	Nonsense_Mutation	SNP	C	C	A			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr13:110839583C>A	ENST00000375820.4	-	25	1751	c.1630G>T	c.(1630-1632)Gga>Tga	p.G544*		NM_001845.4	NP_001836.2	P02462	CO4A1_HUMAN	collagen, type IV, alpha 1	544	Triple-helical region.				axon guidance (GO:0007411)|basement membrane organization (GO:0071711)|blood vessel morphogenesis (GO:0048514)|brain development (GO:0007420)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|epithelial cell differentiation (GO:0030855)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)|patterning of blood vessels (GO:0001569)|renal tubule morphogenesis (GO:0061333)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix constituent conferring elasticity (GO:0030023)|extracellular matrix structural constituent (GO:0005201)|platelet-derived growth factor binding (GO:0048407)			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	105	all_cancers(4;9.8e-13)|all_epithelial(4;9.66e-08)|all_lung(23;3.75e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00178)|all_neural(89;0.00459)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0604)	Breast(118;0.2)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.145)			CCTGGGTCTCCTTTGTCACCT	0.612																																																	0								ENSG00000187498						68.0	70.0	69.0					13																	110839583		2203	4300	6503	COL4A1	SO:0001587	stop_gained	0			-	HGNC	J04217	CCDS9511.1	13q34	2013-09-05			ENSG00000187498	ENSG00000187498		"""Collagens"""	2202	protein-coding gene	gene with protein product		120130				3691802	Standard	NM_001845		Approved		uc001vqw.4	P02462	OTTHUMG00000017342	ENST00000375820.4:c.1630G>T	13.37:g.110839583C>A	ENSP00000364979:p.Gly544*	Somatic	0	23	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	38	15.56	A7E2W4|B1AM70|Q1P9S9|Q5VWF6|Q86X41|Q8NF88|Q9NYC5	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Collagen,pfam_Collagen_VI_NC,superfamily_C-type_lectin_fold,smart_Collagen_VI_NC	p.G544*	ENST00000375820.4	37	c.1630	CCDS9511.1	13	.	.	.	.	.	.	.	.	.	.	C	40	8.400451	0.98794	.	.	ENSG00000187498	ENST00000375820	.	.	.	4.66	4.66	0.58398	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	17.9388	0.89021	0.0:1.0:0.0:0.0	.	.	.	.	X	544	.	ENSP00000364979:G544X	G	-	1	0	COL4A1	109637584	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.119000	0.77145	2.308000	0.77769	0.563000	0.77884	GGA	-	pfam_Collagen		0.612	COL4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL4A1	protein_coding	OTTHUMT00000045759.3	C		-		110839583	-1	no_errors	ENST00000375820	ensembl	human	known	74_37	nonsense	SNP	1.000	A
AMY2B	280	genome.wustl.edu	37	1	104115688	104115688	+	Missense_Mutation	SNP	C	C	T			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr1:104115688C>T	ENST00000361355.4	+	5	935	c.319C>T	c.(319-321)Cgt>Tgt	p.R107C	AMY2B_ENST00000491397.1_3'UTR	NM_020978.3	NP_066188.1	P19961	AMY2B_HUMAN	amylase, alpha 2B (pancreatic)	107					carbohydrate metabolic process (GO:0005975)|digestion (GO:0007586)	extracellular vesicular exosome (GO:0070062)	alpha-amylase activity (GO:0004556)|metal ion binding (GO:0046872)			breast(1)|endometrium(7)|kidney(4)|large_intestine(1)|lung(30)|prostate(1)|skin(1)|urinary_tract(1)	46		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Colorectal(144;0.0669)|all cancers(265;0.083)|Epithelial(280;0.094)|Lung(183;0.112)		TTTCTAGGTTCGTATTTATGT	0.363																																																	0								ENSG00000240038						357.0	349.0	352.0					1																	104115688		2203	4300	6503	AMY2B	SO:0001583	missense	0			-	HGNC	M24895	CCDS782.1	1p21	2010-08-02	2006-04-27		ENSG00000240038	ENSG00000240038	3.2.1.1		478	protein-coding gene	gene with protein product		104660	"""amylase, alpha 2B; pancreatic"""	AMY2		8268204	Standard	NM_020978		Approved		uc001duq.3	P19961	OTTHUMG00000011024	ENST00000361355.4:c.319C>T	1.37:g.104115688C>T	ENSP00000354610:p.Arg107Cys	Somatic	0	110	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	37	97	27.61	B3KTI1|B3KXB7|D3DT76|Q9UBH3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Glyco_hydro_13_cat_dom,pfam_A-amylase_b_C,superfamily_Glycoside_hydrolase_SF,smart_Glyco_hydro_13_sub_cat_dom,smart_A-amylase_b_C,prints_Alpha_amylase	p.R107C	ENST00000361355.4	37	c.319	CCDS782.1	1	.	.	.	.	.	.	.	.	.	.	C	15.00	2.702392	0.48307	.	.	ENSG00000240038	ENST00000361355	D	0.98493	-4.96	4.58	3.62	0.41486	Glycoside hydrolase, subgroup, catalytic domain (1);Glycosyl hydrolase, family 13, catalytic domain (1);Glycoside hydrolase, superfamily (1);Glycosyl hydrolase, family 13, subfamily, catalytic domain (1);	0.465814	0.25590	N	0.029626	D	0.98880	0.9621	H	0.96015	3.755	0.23070	N	0.998348	D	0.89917	1.0	D	0.71656	0.974	D	0.95215	0.8329	10	0.87932	D	0	.	8.1505	0.31137	0.2716:0.6505:0.0:0.078	.	107	P19961	AMY2B_HUMAN	C	107	ENSP00000354610:R107C	ENSP00000354610:R107C	R	+	1	0	AMY2B	103917211	0.002000	0.14202	0.928000	0.36995	0.677000	0.39632	1.495000	0.35627	2.104000	0.64026	0.644000	0.83932	CGT	-	pfam_Glyco_hydro_13_cat_dom,superfamily_Glycoside_hydrolase_SF,smart_Glyco_hydro_13_sub_cat_dom,prints_Alpha_amylase		0.363	AMY2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMY2B	protein_coding	OTTHUMT00000030318.1	C	NM_020978	-		104115688	+1	no_errors	ENST00000361355	ensembl	human	known	74_37	missense	SNP	0.095	T
TAAR6	319100	genome.wustl.edu	37	6	132892363	132892363	+	Silent	SNP	T	T	C			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr6:132892363T>C	ENST00000275198.1	+	1	903	c.903T>C	c.(901-903)taT>taC	p.Y301Y		NM_175067.1	NP_778237.1	Q96RI8	TAAR6_HUMAN	trace amine associated receptor 6	301					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|trace-amine receptor activity (GO:0001594)			cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(19)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	41	Breast(56;0.112)			OV - Ovarian serous cystadenocarcinoma(155;0.006)|GBM - Glioblastoma multiforme(226;0.00792)		GGTGTGCTTATTATAACTCAG	0.333																																																	0								ENSG00000146383						116.0	118.0	117.0					6																	132892363		2203	4300	6503	TAAR6	SO:0001819	synonymous_variant	0			-	HGNC	AF380192	CCDS5155.1	6q23.1	2012-08-08	2005-02-23	2005-02-24	ENSG00000146383	ENSG00000146383		"""GPCR / Class A : Trace amine associated receptors"""	20978	protein-coding gene	gene with protein product		608923	"""trace amine receptor 4"""	TRAR4		11459929, 15718104	Standard	NM_175067		Approved	TA4	uc011eck.2	Q96RI8	OTTHUMG00000015579	ENST00000275198.1:c.903T>C	6.37:g.132892363T>C		Somatic	0	37	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	50	37	57.47	Q5VUQ4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_TAAR_fam	p.Y301	ENST00000275198.1	37	c.903	CCDS5155.1	6																																																																																			-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.333	TAAR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAAR6	protein_coding	OTTHUMT00000042255.1	T	NM_175067	-		132892363	+1	no_errors	ENST00000275198	ensembl	human	known	74_37	silent	SNP	0.992	C
MYO16	23026	genome.wustl.edu	37	13	109858995	109858995	+	Silent	SNP	G	G	T			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr13:109858995G>T	ENST00000357550.2	+	34	5429	c.5388G>T	c.(5386-5388)gtG>gtT	p.V1796V	MYO16_ENST00000356711.2_Silent_p.V1796V	NM_001198950.1	NP_001185879.1			myosin XVI											NS(3)|breast(4)|central_nervous_system(2)|endometrium(10)|kidney(8)|large_intestine(27)|lung(51)|ovary(9)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	121	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)			ATGAAAGTGTGGCCCTGCAGG	0.532																																																	0								ENSG00000041515						82.0	78.0	79.0					13																	109858995		2203	4300	6503	MYO16	SO:0001819	synonymous_variant	0			-	HGNC		CCDS32008.1, CCDS73598.1	13q33.3	2014-06-12			ENSG00000041515	ENSG00000041515		"""Myosins / Myosin superfamily : Class XVI"", ""Ankyrin repeat domain containing"""	29822	protein-coding gene	gene with protein product	"""neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 3"", ""protein phosphatase 1, regulatory subunit 107"""	615479				11588169, 17029291, 21946561	Standard	NM_001198950		Approved	MYR8, KIAA0865, Myo16b, NYAP3, PPP1R107	uc001vqt.1	Q9Y6X6	OTTHUMG00000017333	ENST00000357550.2:c.5388G>T	13.37:g.109858995G>T		Somatic	0	24	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	17	58.54		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Myosin_head_motor_dom,pfam_Ankyrin_rpt,superfamily_P-loop_NTPase,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Myosin_head_motor_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.V1796	ENST00000357550.2	37	c.5388	CCDS32008.1	13																																																																																			-	NULL		0.532	MYO16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO16	protein_coding	OTTHUMT00000045746.1	G	NM_015011	-		109858995	+1	no_errors	ENST00000356711	ensembl	human	known	74_37	silent	SNP	0.979	T
LINS	55180	genome.wustl.edu	37	15	101113917	101113917	+	Missense_Mutation	SNP	T	T	A			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr15:101113917T>A	ENST00000314742.8	-	5	1383	c.1161A>T	c.(1159-1161)ttA>ttT	p.L387F	LINS_ENST00000559149.1_5'UTR|LINS_ENST00000560133.1_Missense_Mutation_p.L268F|LINS_ENST00000561308.1_Missense_Mutation_p.L387F	NM_001040616.2	NP_001035706	Q8NG48	LINES_HUMAN	lines homolog (Drosophila)	387										central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(3)|ovary(1)|prostate(1)|skin(1)|stomach(4)	21						TCATTATAACTAAGCTTGCTG	0.338																																																	0								ENSG00000140471						71.0	68.0	69.0					15																	101113917		2203	4300	6503	LINS	SO:0001583	missense	0			-	HGNC	AK095448	CCDS10385.1	15q26.3	2010-09-08	2010-09-08	2010-09-08	ENSG00000140471	ENSG00000140471			30922	protein-coding gene	gene with protein product		610350	"""lines homolog 1 (Drosophila)"""	LINS1		12119551, 8889548	Standard	NM_001040616		Approved	WINS1	uc002bwg.3	Q8NG48	OTTHUMG00000149865	ENST00000314742.8:c.1161A>T	15.37:g.101113917T>A	ENSP00000318423:p.Leu387Phe	Somatic	0	24	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	38	36.67	Q96FW2|Q9NVQ3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.L387F	ENST00000314742.8	37	c.1161	CCDS10385.1	15	.	.	.	.	.	.	.	.	.	.	T	17.47	3.396480	0.62177	.	.	ENSG00000140471	ENST00000314742	T	0.38401	1.14	6.07	-1.06	0.10002	.	0.000000	0.64402	D	0.000002	T	0.49236	0.1545	M	0.77103	2.36	0.22446	N	0.999096	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;0.999	T	0.39375	-0.9617	10	0.87932	D	0	-10.3722	1.4943	0.02463	0.1263:0.3047:0.2574:0.3116	.	268;387;387	B4DQT3;Q8NG48-2;Q8NG48	.;.;LINES_HUMAN	F	387	ENSP00000318423:L387F	ENSP00000318423:L387F	L	-	3	2	LINS	98931440	0.014000	0.17966	0.020000	0.16555	0.971000	0.66376	-0.399000	0.07250	-0.082000	0.12640	-0.250000	0.11733	TTA	-	NULL		0.338	LINS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LINS	protein_coding	OTTHUMT00000313592.1	T	NM_018148	-		101113917	-1	no_errors	ENST00000314742	ensembl	human	known	74_37	missense	SNP	0.313	A
TNIK	23043	genome.wustl.edu	37	3	170841407	170841407	+	Missense_Mutation	SNP	C	C	G			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr3:170841407C>G	ENST00000436636.2	-	18	2442	c.2098G>C	c.(2098-2100)Gga>Cga	p.G700R	TNIK_ENST00000470834.1_Missense_Mutation_p.G671R|TNIK_ENST00000357327.5_Missense_Mutation_p.G671R|TNIK_ENST00000538048.1_Missense_Mutation_p.G645R|TNIK_ENST00000460047.1_Missense_Mutation_p.G645R|TNIK_ENST00000488470.1_Missense_Mutation_p.G645R|TNIK_ENST00000341852.6_Missense_Mutation_p.G616R|TNIK_ENST00000284483.8_Missense_Mutation_p.G700R|TNIK_ENST00000369326.5_Missense_Mutation_p.G671R|TNIK_ENST00000475336.1_Missense_Mutation_p.G616R	NM_015028.2	NP_055843.1	Q9UKE5	TNIK_HUMAN	TRAF2 and NCK interacting kinase	700	Mediates interaction with NEDD4.				actin cytoskeleton reorganization (GO:0031532)|activation of JNKK activity (GO:0007256)|cytoskeleton organization (GO:0007010)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of dendrite morphogenesis (GO:0048814)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(14)|lung(22)|ovary(5)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(2)	62	all_cancers(22;2.55e-19)|all_lung(20;2.22e-14)|Ovarian(172;0.00197)|Breast(254;0.122)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)			GGTTGAGATCCTAGTCTGGGT	0.448																																																	0								ENSG00000154310						115.0	102.0	106.0					3																	170841407		1860	4097	5957	TNIK	SO:0001583	missense	0			-	HGNC	AF172264	CCDS46956.1, CCDS54673.1, CCDS54674.1, CCDS54675.1, CCDS54676.1, CCDS54677.1, CCDS54678.1, CCDS54679.1	3q26.31	2008-01-23			ENSG00000154310	ENSG00000154310			30765	protein-coding gene	gene with protein product		610005				9628581, 10521462	Standard	NR_027767		Approved	KIAA0551	uc003fhh.2	Q9UKE5	OTTHUMG00000159036	ENST00000436636.2:c.2098G>C	3.37:g.170841407C>G	ENSP00000399511:p.Gly700Arg	Somatic	0	64	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	40	35.48	A7E2A3|A8K4U1|D3DNQ6|O60298|Q8WUY7|Q9UKD8|Q9UKD9|Q9UKE0|Q9UKE1|Q9UKE2|Q9UKE3|Q9UKE4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Citron,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Citron,pfscan_Prot_kinase_dom	p.G700R	ENST00000436636.2	37	c.2098	CCDS46956.1	3	.	.	.	.	.	.	.	.	.	.	C	32	5.130126	0.94473	.	.	ENSG00000154310	ENST00000436636;ENST00000369326;ENST00000538048;ENST00000341852;ENST00000284483;ENST00000475336;ENST00000357327;ENST00000460047;ENST00000488470;ENST00000470834	T;T;T;T;T;T;T;T;T;T	0.73047	-0.7;-0.67;-0.69;-0.71;-0.7;-0.69;-0.68;-0.71;-0.7;-0.69	6.17	6.17	0.99709	.	0.055823	0.64402	D	0.000001	T	0.78489	0.4291	L	0.33485	1.01	0.80722	D	1	P;D;P;P;D;D;P;D	0.61697	0.846;0.978;0.846;0.846;0.99;0.99;0.846;0.983	P;D;P;P;D;D;P;P	0.66847	0.714;0.923;0.714;0.714;0.947;0.923;0.714;0.84	T	0.75431	-0.3320	10	0.41790	T	0.15	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	616;671;645;616;700;671;645;700	Q9UKE5-8;Q9UKE5-6;Q9UKE5-7;Q9UKE5-5;Q9UKE5-4;Q9UKE5-2;Q9UKE5-3;Q9UKE5	.;.;.;.;.;.;.;TNIK_HUMAN	R	700;671;645;616;700;616;671;645;645;671	ENSP00000399511:G700R;ENSP00000358332:G671R;ENSP00000443278:G645R;ENSP00000345352:G616R;ENSP00000284483:G700R;ENSP00000418156:G616R;ENSP00000349880:G671R;ENSP00000418916:G645R;ENSP00000418378:G645R;ENSP00000419990:G671R	ENSP00000284483:G700R	G	-	1	0	TNIK	172324101	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.206000	0.77891	2.941000	0.99782	0.655000	0.94253	GGA	-	NULL		0.448	TNIK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TNIK	protein_coding	OTTHUMT00000352973.2	C	XM_039796	-		170841407	-1	no_errors	ENST00000436636	ensembl	human	known	74_37	missense	SNP	1.000	G
CYP26A1	1592	genome.wustl.edu	37	10	94833762	94833762	+	Missense_Mutation	SNP	C	C	T			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr10:94833762C>T	ENST00000224356.4	+	1	116	c.71C>T	c.(70-72)gCg>gTg	p.A24V	CYP26A1_ENST00000394139.1_5'UTR|CYP26A1_ENST00000371531.1_Intron	NM_000783.3	NP_000774.2	O43174	CP26A_HUMAN	cytochrome P450, family 26, subfamily A, polypeptide 1	24					anterior/posterior pattern specification (GO:0009952)|cellular response to retinoic acid (GO:0071300)|central nervous system development (GO:0007417)|metabolic process (GO:0008152)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|neural crest cell development (GO:0014032)|retinoic acid catabolic process (GO:0034653)|retinoic acid receptor signaling pathway (GO:0048384)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)|retinoic acid 4-hydroxylase activity (GO:0008401)|retinoic acid binding (GO:0001972)			breast(1)|endometrium(1)|large_intestine(4)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	16		Colorectal(252;0.122)			Acitretin(DB00459)|Ketoconazole(DB01026)|Vitamin A(DB00162)	TTCCTGGCTGCGATCAAGCTC	0.697																																																	0								ENSG00000095596						23.0	26.0	25.0					10																	94833762		2202	4300	6502	CYP26A1	SO:0001583	missense	0			-	HGNC	AF005418	CCDS7426.1, CCDS7427.1	10q23-q24	2003-10-06	2003-01-14		ENSG00000095596	ENSG00000095596		"""Cytochrome P450s"""	2603	protein-coding gene	gene with protein product		602239	"""cytochrome P450, subfamily XXVIA, polypeptide 1"""			9228017, 9521883	Standard	NM_000783		Approved	P450RAI, CP26, CYP26, P450RAI1	uc001kil.2	O43174	OTTHUMG00000018765	ENST00000224356.4:c.71C>T	10.37:g.94833762C>T	ENSP00000224356:p.Ala24Val	Somatic	0	58	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	B3KNI4|Q5VXH9|Q5VXI0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_E_grp-I,prints_Cyt_P450,prints_Cyt_P450_B	p.A24V	ENST00000224356.4	37	c.71	CCDS7426.1	10	.	.	.	.	.	.	.	.	.	.	C	15.31	2.794915	0.50208	.	.	ENSG00000095596	ENST00000224356	T	0.72615	-0.67	4.94	4.94	0.65067	.	0.107611	0.64402	D	0.000007	T	0.47875	0.1469	N	0.08118	0	0.80722	D	1	B	0.21452	0.056	B	0.18561	0.022	T	0.44483	-0.9325	10	0.13853	T	0.58	-13.605	12.7455	0.57280	0.0:0.9215:0.0:0.0785	.	24	O43174	CP26A_HUMAN	V	24	ENSP00000224356:A24V	ENSP00000224356:A24V	A	+	2	0	CYP26A1	94823752	1.000000	0.71417	0.993000	0.49108	0.991000	0.79684	7.203000	0.77864	2.583000	0.87209	0.462000	0.41574	GCG	-	NULL		0.697	CYP26A1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CYP26A1	protein_coding	OTTHUMT00000049408.3	C		-		94833762	+1	no_errors	ENST00000224356	ensembl	human	known	74_37	missense	SNP	0.993	T
NLRP13	126204	genome.wustl.edu	37	19	56419196	56419196	+	Frame_Shift_Del	DEL	T	T	-			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr19:56419196delT	ENST00000342929.3	-	7	2408	c.2409delA	c.(2407-2409)aaafs	p.K803fs	NLRP13_ENST00000588751.1_Frame_Shift_Del_p.K803fs	NM_176810.2	NP_789780.2	Q86W25	NAL13_HUMAN	NLR family, pyrin domain containing 13	803							ATP binding (GO:0005524)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|lung(58)|ovary(4)|pancreas(2)|prostate(2)|skin(13)|stomach(2)|urinary_tract(1)	109		Colorectal(82;3.48e-05)|Ovarian(87;0.0481)|Renal(1328;0.218)		GBM - Glioblastoma multiforme(193;0.0642)		GTCTCAAAGCTTTAAGAATCA	0.493																																																	0								ENSG00000173572						128.0	115.0	119.0					19																	56419196		2203	4300	6503	NLRP13	SO:0001589	frameshift_variant	0				HGNC	AY154468	CCDS33119.1	19q13.43	2008-02-05	2006-12-08	2006-12-08	ENSG00000173572	ENSG00000173572		"""Nucleotide-binding domain and leucine rich repeat containing"""	22937	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 13"""	609660	"""NACHT, leucine rich repeat and PYD containing 13"""	NALP13		12563287	Standard	NM_176810		Approved	NOD14, PAN13, CLR19.7	uc010ygg.2	Q86W25	OTTHUMG00000167839	ENST00000342929.3:c.2409delA	19.37:g.56419196delT	ENSP00000343891:p.Lys803fs	Somatic	0	20	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	12	20.00	Q7RTR5	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_DAPIN,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.A804fs	ENST00000342929.3	37	c.2409	CCDS33119.1	19																																																																																			-	NULL		0.493	NLRP13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NLRP13	protein_coding	OTTHUMT00000396560.1	T	NM_176810			56419196	-1	no_errors	ENST00000342929	ensembl	human	known	74_37	frame_shift_del	DEL	0.000	-
DUSP7	1849	genome.wustl.edu	37	3	52088158	52088158	+	Frame_Shift_Del	DEL	G	G	-			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr3:52088158delG	ENST00000495880.1	-	2	933	c.750delC	c.(748-750)cccfs	p.P250fs	DUSP7_ENST00000296483.6_Frame_Shift_Del_p.P199fs			Q16829	DUS7_HUMAN	dual specificity phosphatase 7	250					inactivation of MAPK activity (GO:0000188)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of MAP kinase activity (GO:0043407)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|protein tyrosine phosphatase activity (GO:0004725)			breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(1)	17				BRCA - Breast invasive adenocarcinoma(193;5.14e-05)|Kidney(197;0.000534)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		GGTAGAGGTAGGGCAGGATCT	0.617																																																	0								ENSG00000164086						207.0	185.0	193.0					3																	52088158		2203	4300	6503	DUSP7	SO:0001589	frameshift_variant	0				HGNC	X93921	CCDS33766.1, CCDS33766.2	3p21	2011-06-09			ENSG00000164086	ENSG00000164086		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3073	protein-coding gene	gene with protein product		602749				8626780, 9205128	Standard	NM_001947		Approved	MKP-X, PYST2	uc003dct.3	Q16829	OTTHUMG00000157819	ENST00000495880.1:c.750delC	3.37:g.52088158delG	ENSP00000417183:p.Pro250fs	Somatic	0	36	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	10	16.67	Q2M3J7|Q8NFJ0	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Dual-sp_phosphatase_cat-dom,pfam_Rhodanese-like_dom,superfamily_Rhodanese-like_dom,smart_Rhodanese-like_dom,smart_Dual-sp_phosphatase_subgr_cat,pirsf_MKP,prints_MKP,pfscan_Rhodanese-like_dom,pfscan_Tyr/Dual-sp_Pase,pfscan_Dual-sp_phosphatase_subgr_cat	p.Y200fs	ENST00000495880.1	37	c.597	CCDS33766.2	3																																																																																			-	smart_Dual-sp_phosphatase_subgr_cat,pirsf_MKP,pfscan_Dual-sp_phosphatase_subgr_cat		0.617	DUSP7-001	NOVEL	basic|CCDS	protein_coding	DUSP7	protein_coding	OTTHUMT00000349697.1	G	NM_001947			52088158	-1	no_errors	ENST00000296483	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
CRLF3	51379	genome.wustl.edu	37	17	29119617	29119617	+	Intron	SNP	C	C	G			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr17:29119617C>G	ENST00000324238.6	-	6	951				CRLF3_ENST00000577725.1_Intron|CRLF3_ENST00000544695.1_Intron|CTD-2349P21.9_ENST00000580085.1_lincRNA	NM_015986.3	NP_057070.3	Q8IUI8	CRLF3_HUMAN	cytokine receptor-like factor 3						G1/S transition of mitotic cell cycle (GO:0000082)|negative regulation of cell growth (GO:0030308)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)	cytoplasm (GO:0005737)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(7)|prostate(1)|upper_aerodigestive_tract(1)	17		all_hematologic(16;0.014)|Acute lymphoblastic leukemia(14;0.0236)|Myeloproliferative disorder(56;0.0255)				ATATTGAAAACTGTTAGAATC	0.383																																					Pancreas(30;346 881 29244 33464 41299)												0								ENSG00000266490						81.0	81.0	81.0					17																	29119617		2203	4300	6503	CTD-2349P21.9	SO:0001627	intron_variant	0			-	Clone_based_vega_gene	AF120151	CCDS32607.1	17q11.2	2008-05-02				ENSG00000176390			17177	protein-coding gene	gene with protein product		614853					Standard	NM_015986		Approved	CREME9, CYTOR4	uc002hfr.4	Q8IUI8		ENST00000324238.6:c.827-27G>C	17.37:g.29119617C>G		Somatic	0	27	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	83	14.43	A6NJF3|B2R8C3|Q2MLY7|Q9UNI3|Q9Y6M8	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000324238.6	37	NULL	CCDS32607.1	17																																																																																			-	-		0.383	CRLF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000266490	protein_coding	OTTHUMT00000444354.1	C		-		29119617	+1	no_errors	ENST00000580085	ensembl	human	known	74_37	rna	SNP	0.005	G
TXNRD1	7296	genome.wustl.edu	37	12	104720164	104720164	+	Missense_Mutation	SNP	A	A	T			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr12:104720164A>T	ENST00000529546.1	+	9	1009	c.784A>T	c.(784-786)Att>Ttt	p.I262F	TXNRD1_ENST00000540716.1_Missense_Mutation_p.I262F|TXNRD1_ENST00000354940.6_Missense_Mutation_p.I300F|TXNRD1_ENST00000525566.1_Missense_Mutation_p.I450F|TXNRD1_ENST00000524698.1_Missense_Mutation_p.I300F|TXNRD1_ENST00000378070.4_Missense_Mutation_p.I399F|TXNRD1_ENST00000388854.3_Missense_Mutation_p.I352F|TXNRD1_ENST00000542918.1_Missense_Mutation_p.I350F|TXNRD1_ENST00000503506.2_Missense_Mutation_p.I300F|TXNRD1_ENST00000429002.2_Missense_Mutation_p.I450F|TXNRD1_ENST00000526691.1_Missense_Mutation_p.I352F|TXNRD1_ENST00000397736.2_Missense_Mutation_p.I344F|TXNRD1_ENST00000526390.1_Missense_Mutation_p.I344F|TXNRD1_ENST00000427956.1_Missense_Mutation_p.I415F|TXNRD1_ENST00000526950.1_Missense_Mutation_p.I369F			Q16881	TRXR1_HUMAN	thioredoxin reductase 1	450					cell proliferation (GO:0008283)|cell redox homeostasis (GO:0045454)|cellular lipid metabolic process (GO:0044255)|mesoderm formation (GO:0001707)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|NADP binding (GO:0050661)|protein disulfide oxidoreductase activity (GO:0015035)|thioredoxin-disulfide reductase activity (GO:0004791)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(5)|skin(1)|stomach(1)|urinary_tract(1)	16					Arsenic trioxide(DB01169)|Flavin adenine dinucleotide(DB03147)	CACAAGAAAAATTGGCTTAGA	0.274																																					Ovarian(139;555 1836 9186 9946 10884)												0								ENSG00000198431						33.0	34.0	34.0					12																	104720164		1797	4057	5854	TXNRD1	SO:0001583	missense	0			-	HGNC		CCDS53820.1, CCDS53821.1, CCDS53823.1, CCDS58274.1	12q23-q24.1	2012-03-01							12437	protein-coding gene	gene with protein product		601112				7589432	Standard	NM_001093771		Approved	TXNR, GRIM-12, Trxr1	uc021rcx.2	Q16881		ENST00000529546.1:c.784A>T	12.37:g.104720164A>T	ENSP00000434919:p.Ile262Phe	Somatic	0	63	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	43	67	39.09	B7Z1F4|B7Z3Y8|B7Z904|E9PMY9|F5H780|Q6FI31|Q6VB40|Q6VB41|Q6VB42|Q6VBP2|Q6VBP3|Q6VBP4|Q6VBP5|Q6VBP9|Q6VBQ0|Q6YNQ1|Q76P53|Q7LA96|Q8WVC8|Q99475|Q9UES8|Q9UH79	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,pfam_Pyr_nucl-diS_OxRdtase_dimer,pfam_Pyr_OxRdtase_NAD-bd_dom,pfam_FAD_bind_dom,pfam_Glutaredoxin,superfamily_FAD/NAD-linked_Rdtase_dimer,superfamily_Thioredoxin-like_fold,prints_FAD_pyr_nucl-diS_OxRdtase,prints_Hg_reductase,prints_Pyridine_nuc-diS_OxRdtase_2,tigrfam_Thioredoxin/glutathione_Rdtase	p.I450F	ENST00000529546.1	37	c.1348	CCDS58274.1	12	.	.	.	.	.	.	.	.	.	.	A	23.8	4.456516	0.84317	.	.	ENSG00000198431	ENST00000525566;ENST00000429002;ENST00000503506;ENST00000526691;ENST00000388854;ENST00000354940;ENST00000526390;ENST00000529546;ENST00000529751;ENST00000540716;ENST00000524698;ENST00000542918;ENST00000378070;ENST00000397736;ENST00000427956;ENST00000526950	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.66815	-0.23;-0.23;-0.23;-0.23;-0.23;-0.23;-0.23;0.88;0.94;0.88;-0.23;-0.23;-0.23;-0.23;-0.23;-0.23	5.93	3.49	0.39957	Pyridine nucleotide-disulphide oxidoreductase, FAD/NAD(P)-binding domain (1);	0.090690	0.85682	D	0.000000	T	0.80237	0.4586	M	0.83953	2.67	0.58432	D	0.999992	D;B;D;P;P;D;P	0.59767	0.962;0.241;0.986;0.907;0.73;0.972;0.476	P;B;P;P;P;P;B	0.62184	0.782;0.284;0.899;0.576;0.702;0.854;0.41	T	0.81697	-0.0815	10	0.72032	D	0.01	-18.5887	12.9921	0.58625	0.7458:0.2542:0.0:0.0	.	350;344;450;352;300;450;415	B7Z2S5;E2QRB9;B7Z904;Q16881-4;B2R5P6;Q16881;E7EW10	.;.;.;.;.;TRXR1_HUMAN;.	F	450;450;300;352;352;300;344;262;13;262;300;350;399;344;415;369	ENSP00000434516:I450F;ENSP00000412045:I450F;ENSP00000421934:I300F;ENSP00000435929:I352F;ENSP00000373506:I352F;ENSP00000347020:I300F;ENSP00000435123:I344F;ENSP00000434919:I262F;ENSP00000432273:I13F;ENSP00000442709:I262F;ENSP00000433425:I300F;ENSP00000440978:I350F;ENSP00000367310:I399F;ENSP00000380844:I344F;ENSP00000393328:I415F;ENSP00000432812:I369F	ENSP00000347020:I300F	I	+	1	0	TXNRD1	103244294	1.000000	0.71417	0.999000	0.59377	0.989000	0.77384	2.975000	0.49281	0.455000	0.26910	0.514000	0.50259	ATT	-	pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,prints_FAD_pyr_nucl-diS_OxRdtase,tigrfam_Thioredoxin/glutathione_Rdtase		0.274	TXNRD1-004	PUTATIVE	basic|exp_conf|CCDS|seleno	protein_coding	TXNRD1	protein_coding	OTTHUMT00000389969.1	A	NM_003330	-		104720164	+1	no_errors	ENST00000429002	ensembl	human	known	74_37	missense	SNP	1.000	T
TP53	7157	genome.wustl.edu	37	17	7579311	7579311	+	Splice_Site	SNP	C	C	T			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr17:7579311C>T	ENST00000269305.4	-	4	565		c.e4+1		TP53_ENST00000445888.2_Splice_Site|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Splice_Site|TP53_ENST00000359597.4_Splice_Site|TP53_ENST00000455263.2_Splice_Site|TP53_ENST00000420246.2_Splice_Site	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53						apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.?(26)|p.0?(8)|p.V73fs*9(1)|p.Y126fs*11(1)|p.P13fs*18(1)|p.T125_Y126insX(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGGCAACTGACCGTGCAAGTC	0.532		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	38	Unknown(26)|Whole gene deletion(8)|Deletion - Frameshift(3)|Insertion - In frame(1)	lung(12)|breast(5)|upper_aerodigestive_tract(4)|bone(4)|ovary(3)|large_intestine(2)|central_nervous_system(2)|stomach(1)|haematopoietic_and_lymphoid_tissue(1)|liver(1)|urinary_tract(1)|oesophagus(1)|pancreas(1)	GRCh37	CS951538	TP53	S		ENSG00000141510						66.0	61.0	63.0					17																	7579311		2203	4300	6503	TP53	SO:0001630	splice_region_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	-	HGNC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.375+1G>A	17.37:g.7579311C>T		Somatic	0	59	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	99	1	99.00	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e3+1	ENST00000269305.4	37	c.375+1	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	20.6	4.015182	0.75161	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000508793;ENST00000503591	.	.	.	4.3	4.3	0.51218	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.6586	0.68852	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TP53	7520036	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	6.208000	0.72165	2.403000	0.81681	0.655000	0.94253	.	-	-		0.532	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	C	NM_000546	-	Intron	7579311	-1	no_errors	ENST00000269305	ensembl	human	known	74_37	splice_site	SNP	1.000	T
LRCH2	57631	genome.wustl.edu	37	X	114347861	114347861	+	Missense_Mutation	SNP	C	C	G			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chrX:114347861C>G	ENST00000317135.8	-	21	2246	c.2216G>C	c.(2215-2217)cGa>cCa	p.R739P	LRCH2_ENST00000538422.1_Missense_Mutation_p.R722P	NM_020871.3	NP_065922.3	Q5VUJ6	LRCH2_HUMAN	leucine-rich repeats and calponin homology (CH) domain containing 2	739	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.									breast(1)|endometrium(4)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	19						CACAAGTCCTCGTTCTTCCAA	0.343																																																	0								ENSG00000130224						62.0	55.0	57.0					X																	114347861		1834	4069	5903	LRCH2	SO:0001583	missense	0			-	HGNC	AB040928	CCDS48155.1, CCDS59175.1	Xq24	2008-02-05			ENSG00000130224	ENSG00000130224			29292	protein-coding gene	gene with protein product						10819331	Standard	NM_020871		Approved	KIAA1495	uc010nqe.3	Q5VUJ6	OTTHUMG00000022233	ENST00000317135.8:c.2216G>C	X.37:g.114347861C>G	ENSP00000325091:p.Arg739Pro	Somatic	0	71	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	36	30	54.55	F5H2T1|Q08AD5|Q9HA88|Q9P233	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Leu-rich_rpt,pfam_CH-domain,superfamily_CH-domain,superfamily_NA-bd_OB-fold,smart_Leu-rich_rpt_typical-subtyp,smart_CH-domain,pfscan_CH-domain	p.R739P	ENST00000317135.8	37	c.2216	CCDS48155.1	X	.	.	.	.	.	.	.	.	.	.	C	18.87	3.715854	0.68844	.	.	ENSG00000130224	ENST00000317135;ENST00000536655;ENST00000538422	D;D	0.94650	-3.48;-3.48	5.52	5.52	0.82312	Calponin homology domain (5);	.	.	.	.	D	0.97636	0.9225	M	0.88105	2.93	0.54753	D	0.999986	D;D	0.76494	0.999;0.983	D;P	0.87578	0.998;0.854	D	0.98368	1.0552	9	0.66056	D	0.02	2.7416	16.8514	0.85995	0.0:1.0:0.0:0.0	.	739;722	Q5VUJ6;F5H2T1	LRCH2_HUMAN;.	P	739;218;722	ENSP00000325091:R739P;ENSP00000439366:R722P	ENSP00000325091:R739P	R	-	2	0	LRCH2	114254117	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.118000	0.77137	2.291000	0.77112	0.600000	0.82982	CGA	-	pfam_CH-domain,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain		0.343	LRCH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LRCH2	protein_coding	OTTHUMT00000057971.2	C	NM_020871	-		114347861	-1	no_errors	ENST00000317135	ensembl	human	known	74_37	missense	SNP	1.000	G
MME	4311	genome.wustl.edu	37	3	154864940	154864940	+	Missense_Mutation	SNP	C	C	T			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr3:154864940C>T	ENST00000460393.1	+	15	1544	c.1424C>T	c.(1423-1425)gCa>gTa	p.A475V	MME_ENST00000462745.1_Missense_Mutation_p.A475V|MME_ENST00000493237.1_Missense_Mutation_p.A475V|MME_ENST00000492661.1_Missense_Mutation_p.A475V|MME_ENST00000360490.2_Missense_Mutation_p.A475V	NM_000902.3|NM_007287.2	NP_000893.2|NP_009218.2	P08473	NEP_HUMAN	membrane metallo-endopeptidase	475					angiotensin maturation (GO:0002003)|beta-amyloid metabolic process (GO:0050435)|cellular protein metabolic process (GO:0044267)|cellular response to cytokine stimulus (GO:0071345)|cellular response to UV-A (GO:0071492)|cellular response to UV-B (GO:0071493)|creatinine metabolic process (GO:0046449)|kidney development (GO:0001822)|peptide metabolic process (GO:0006518)|proteolysis (GO:0006508)|replicative senescence (GO:0090399)|sensory perception of pain (GO:0019233)	axon (GO:0030424)|brush border (GO:0005903)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|neuron projection terminus (GO:0044306)|plasma membrane (GO:0005886)|synapse (GO:0045202)|synaptic vesicle (GO:0008021)	endopeptidase activity (GO:0004175)|metalloendopeptidase activity (GO:0004222)|peptide binding (GO:0042277)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(31)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	64		all_neural(597;0.00391)|Myeloproliferative disorder(1037;0.0122)	LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.135)		Candoxatril(DB00616)|Liraglutide(DB06655)	TAGGCCTTAGCAATTAAAGAA	0.308																																																	0								ENSG00000196549						63.0	68.0	66.0					3																	154864940		2203	4300	6503	MME	SO:0001583	missense	0			-	HGNC		CCDS3172.1	3q25.2	2012-01-31	2007-02-21		ENSG00000196549	ENSG00000196549	3.4.24.11	"""CD molecules"""	7154	protein-coding gene	gene with protein product	"""neutral endopeptidase"", ""enkephalinase"", ""neprilysin"""	120520					Standard	NM_007287		Approved	CALLA, CD10, NEP	uc003fad.1	P08473	OTTHUMG00000158455	ENST00000460393.1:c.1424C>T	3.37:g.154864940C>T	ENSP00000418525:p.Ala475Val	Somatic	0	44	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	33	10.81	A8K6U6|D3DNJ9|Q3MIX4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_M13_N,pfam_Peptidase_M13_C,prints_Peptidase_M13_C	p.A475V	ENST00000460393.1	37	c.1424	CCDS3172.1	3	.	.	.	.	.	.	.	.	.	.	C	32	5.128381	0.94473	.	.	ENSG00000196549	ENST00000492661;ENST00000460393;ENST00000462745;ENST00000493237;ENST00000360490	T;T;T;T;T	0.78816	-1.21;-1.21;-1.21;-1.21;-1.21	5.84	5.84	0.93424	Peptidase M13 (1);Metallopeptidase, catalytic domain (1);	0.116770	0.64402	D	0.000019	D	0.87047	0.6080	M	0.86097	2.795	0.54753	D	0.999988	D	0.54207	0.965	P	0.52672	0.706	D	0.88360	0.2987	10	0.72032	D	0.01	-23.7183	20.1379	0.98040	0.0:1.0:0.0:0.0	.	475	P08473	NEP_HUMAN	V	475	ENSP00000420389:A475V;ENSP00000418525:A475V;ENSP00000419653:A475V;ENSP00000417079:A475V;ENSP00000353679:A475V	ENSP00000353679:A475V	A	+	2	0	MME	156347634	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.173000	0.71937	2.779000	0.95612	0.655000	0.94253	GCA	-	pfam_Peptidase_M13_N		0.308	MME-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MME	protein_coding	OTTHUMT00000351076.1	C	NM_000902	-		154864940	+1	no_errors	ENST00000360490	ensembl	human	known	74_37	missense	SNP	1.000	T
DAOA	267012	genome.wustl.edu	37	13	106119431	106119431	+	Missense_Mutation	SNP	T	T	A			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr13:106119431T>A	ENST00000375936.3	+	2	120	c.74T>A	c.(73-75)tTc>tAc	p.F25Y	DAOA-AS1_ENST00000448407.1_RNA|DAOA_ENST00000329625.5_5'UTR	NM_001161812.1|NM_172370.3	NP_001155284.1|NP_758958.3	P59103	DAOA_HUMAN	D-amino acid oxidase activator	25					negative regulation of D-amino-acid oxidase activity (GO:1900758)|positive regulation of catalytic activity (GO:0043085)	Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)	enzyme activator activity (GO:0008047)|enzyme binding (GO:0019899)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(5)|skin(1)	13	Lung NSC(43;0.01)|all_neural(89;0.0741)|Lung SC(71;0.14)|Medulloblastoma(90;0.169)					AAAATCTACTTCATAGGTTTT	0.303																																																	0								ENSG00000182346						77.0	75.0	75.0					13																	106119431		1791	4061	5852	DAOA	SO:0001583	missense	0			-	HGNC	AY138547	CCDS41905.1, CCDS53880.1, CCDS59242.1	13q33.2	2011-08-01			ENSG00000182346	ENSG00000182346			21191	protein-coding gene	gene with protein product	"""G72 transcript"""	607408				12364586, 15057823	Standard	NM_001161814		Approved	G72	uc010tjg.2	P59103	OTTHUMG00000041333	ENST00000375936.3:c.74T>A	13.37:g.106119431T>A	ENSP00000365103:p.Phe25Tyr	Somatic	0	23	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	15	42.31	A6NKG7|Q0VAE6|Q5VX59|Q86Y17|Q8IWM4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.F25Y	ENST00000375936.3	37	c.74	CCDS41905.1	13	.	.	.	.	.	.	.	.	.	.	T	13.94	2.388156	0.42308	.	.	ENSG00000182346	ENST00000375936	T	0.28666	1.6	3.06	1.88	0.25563	.	.	.	.	.	T	0.32194	0.0821	N	0.19112	0.55	0.09310	N	0.999997	D	0.76494	0.999	D	0.63703	0.917	T	0.09443	-1.0674	9	0.87932	D	0	.	4.9067	0.13802	0.0:0.1429:0.0:0.8571	.	25	P59103	DAOA_HUMAN	Y	25	ENSP00000365103:F25Y	ENSP00000365103:F25Y	F	+	2	0	DAOA	104917432	0.002000	0.14202	0.006000	0.13384	0.577000	0.36160	0.472000	0.22116	0.577000	0.29470	0.528000	0.53228	TTC	-	NULL		0.303	DAOA-005	KNOWN	NMD_exception|basic|appris_candidate_longest|CCDS	protein_coding	DAOA	protein_coding	OTTHUMT00000099040.2	T	NM_172370	-		106119431	+1	no_errors	ENST00000375936	ensembl	human	known	74_37	missense	SNP	0.007	A
OVGP1	5016	genome.wustl.edu	37	1	111957515	111957583	+	In_Frame_Del	DEL	ACTCACAGGGGTCACAGACTGATGACCCACAGGGGTCAGGGTCTTTTCCCCAGGGGTCACAGACTGATA	ACTCACAGGGGTCACAGACTGATGACCCACAGGGGTCAGGGTCTTTTCCCCAGGGGTCACAGACTGATA	-	rs61742558|rs568931117|rs12096782|rs112145355|rs113984808|rs201350653|rs375218077|rs79262073|rs201210901|rs75512011|rs1126656|rs368203827|rs150261549|rs3767609|rs3767608|rs201662631|rs376377993|rs145862799|rs45455292|rs74322126|rs374145757|rs140282461|rs549398942|rs369687480|rs386634633|rs144666939|rs551744565|rs139753199	byFrequency	TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	ACTCACAGGGGTCACAGACTGATGACCCACAGGGGTCAGGGTCTTTTCCCCAGGGGTCACAGACTGATA	ACTCACAGGGGTCACAGACTGATGACCCACAGGGGTCAGGGTCTTTTCCCCAGGGGTCACAGACTGATA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr1:111957515_111957583delACTCACAGGGGTCACAGACTGATGACCCACAGGGGTCAGGGTCTTTTCCCCAGGGGTCACAGACTGATA	ENST00000369732.3	-	11	1595_1663	c.1540_1608delTATCAGTCTGTGACCCCTGGGGAAAAGACCCTGACCCCTGTGGGTCATCAGTCTGTGACCCCTGTGAGT	c.(1540-1608)tatcagtctgtgacccctggggaaaagaccctgacccctgtgggtcatcagtctgtgacccctgtgagtdel	p.YQSVTPGEKTLTPVGHQSVTPVS514del		NM_002557.3	NP_002548.3	Q12889	OVGP1_HUMAN	oviductal glycoprotein 1, 120kDa	514			Y -> H (in dbSNP:rs1126656). {ECO:0000269|Ref.2}.		binding of sperm to zona pellucida (GO:0007339)|carbohydrate metabolic process (GO:0005975)|chitin catabolic process (GO:0006032)|female pregnancy (GO:0007565)|multicellular organism reproduction (GO:0032504)|negative regulation of binding of sperm to zona pellucida (GO:2000360)|single fertilization (GO:0007338)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|egg coat (GO:0035805)|perivitelline space (GO:0098595)	chitinase activity (GO:0004568)	p.T597_V604delTPVSHQSV(2)|p.T533_V540delTPVSHQSV(2)		NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(13)|ovary(4)|prostate(1)|skin(4)|stomach(3)|urinary_tract(1)	39		all_cancers(81;8.18e-06)|all_epithelial(167;5.64e-06)|all_lung(203;0.000152)|Lung NSC(277;0.000302)		Lung(183;0.0253)|Colorectal(144;0.033)|all cancers(265;0.0552)|Epithelial(280;0.0802)|COAD - Colon adenocarcinoma(174;0.123)|LUSC - Lung squamous cell carcinoma(189;0.14)		CAGACTGATGACTCACAGGGGTCACAGACTGATGACCCACAGGGGTCAGGGTCTTTTCCCCAGGGGTCACAGACTGATAACCCACAGAG	0.554																																																	4	Deletion - In frame(4)	haematopoietic_and_lymphoid_tissue(2)|stomach(2)						ENSG00000085465																																			OVGP1	SO:0001651	inframe_deletion	0				HGNC	U09550	CCDS834.1	1p13.2	2008-07-31	2008-07-31		ENSG00000085465	ENSG00000085465		"""Mucins"""	8524	protein-coding gene	gene with protein product	"""oviductin"""	603578	"""mucin 9"""	MUC9		7819450, 9341614	Standard	NM_002557		Approved	CHIT5	uc001eba.3	Q12889	OTTHUMG00000011746	ENST00000369732.3:c.1540_1608delTATCAGTCTGTGACCCCTGGGGAAAAGACCCTGACCCCTGTGGGTCATCAGTCTGTGACCCCTGTGAGT	1.37:g.111957515_111957583delACTCACAGGGGTCACAGACTGATGACCCACAGGGGTCAGGGTCTTTTCCCCAGGGGTCACAGACTGATA	ENSP00000358747:p.Tyr514_Ser536del	Somatic	NA	NA	NA		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A0AV19|B9EGE1|Q15841	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Glyco_hydro18cat,superfamily_Glycoside_hydrolase_SF,smart_Chitinase_II	p.YQSVTPGEKTLTPVGHQSVTPVS514in_frame_del	ENST00000369732.3	37	c.1608_1540	CCDS834.1	1																																																																																			-	NULL		0.554	OVGP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OVGP1	protein_coding	OTTHUMT00000032461.1	ACTCACAGGGGTCACAGACTGATGACCCACAGGGGTCAGGGTCTTTTCCCCAGGGGTCACAGACTGATA	NM_002557			111957583	-1	no_errors	ENST00000369732	ensembl	human	known	74_37	in_frame_del	DEL	0.000:0.000:0.000:0.001:0.000:0.001:0.001:0.004:0.005:0.008:0.009:0.045:0.066:0.065:0.061:0.012:0.006:0.001:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.001:0.002:0.007:0.006:0.001:0.000:0.001:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.001:0.000:0.000:0.000:0.000:0.000:0.004:0.007:0.004:0.004:0.004:0.010:0.010:0.015:0.009:0.010:0.006:0.006:0.000:0.000:0.000:0.000:0.001:0.000:0.000	-
FER1L6	654463	genome.wustl.edu	37	8	124987395	124987395	+	Nonsense_Mutation	SNP	C	C	T	rs369182988		TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr8:124987395C>T	ENST00000522917.1	+	8	738	c.532C>T	c.(532-534)Cag>Tag	p.Q178*	FER1L6_ENST00000399018.1_Nonsense_Mutation_p.Q178*	NM_001039112.2	NP_001034201.2	Q2WGJ9	FR1L6_HUMAN	fer-1-like family member 6	178						integral component of membrane (GO:0016021)				NS(2)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(18)|liver(1)|lung(49)|ovary(5)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(1)	118	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			CACAGGTCATCAGTTCTGCAA	0.572																																																	0								ENSG00000214814	C	stop/GLN	1,4031		0,1,2015	89.0	87.0	88.0		532	5.5	1.0	8		88	0,8364		0,0,4182	no	stop-gained	FER1L6	NM_001039112.2		0,1,6197	TT,TC,CC		0.0,0.0248,0.0081		178/1858	124987395	1,12395	2016	4182	6198	FER1L6	SO:0001587	stop_gained	0			-	HGNC	AB196633	CCDS43767.1	8q24.13	2014-06-27	2014-06-27		ENSG00000214814	ENSG00000214814			28065	protein-coding gene	gene with protein product			"""fer-1-like 6 (C. elegans)"""				Standard	NM_001039112		Approved	C8ORFK23	uc003yqw.3	Q2WGJ9	OTTHUMG00000164998	ENST00000522917.1:c.532C>T	8.37:g.124987395C>T	ENSP00000428280:p.Gln178*	Somatic	0	30	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	46	14.81		Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_C2_dom,pfam_Ferlin_B-domain,pfam_FerIin-domain,superfamily_C2_dom,superfamily_ABC1_TM_dom,smart_C2_dom,pfscan_C2_dom	p.Q178*	ENST00000522917.1	37	c.532	CCDS43767.1	8	.	.	.	.	.	.	.	.	.	.	C	40	8.337320	0.98767	2.48E-4	0.0	ENSG00000214814	ENST00000522917;ENST00000399018	.	.	.	5.5	5.5	0.81552	.	0.083449	0.49305	U	0.000146	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.16420	T	0.52	.	19.7571	0.96298	0.0:1.0:0.0:0.0	.	.	.	.	X	178	.	ENSP00000381982:Q178X	Q	+	1	0	FER1L6	125056576	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.776000	0.85560	2.758000	0.94735	0.561000	0.74099	CAG	-	pfam_FerIin-domain,superfamily_C2_dom,smart_C2_dom		0.572	FER1L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FER1L6	protein_coding	OTTHUMT00000381400.1	C	NM_001039112	-		124987395	+1	no_errors	ENST00000399018	ensembl	human	known	74_37	nonsense	SNP	1.000	T
AMBRA1	55626	genome.wustl.edu	37	11	46439590	46439590	+	Missense_Mutation	SNP	C	C	T	rs370651158		TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr11:46439590C>T	ENST00000458649.2	-	15	3407	c.2989G>A	c.(2989-2991)Gtc>Atc	p.V997I	AMBRA1_ENST00000534300.1_Missense_Mutation_p.V937I|AMBRA1_ENST00000533727.1_Missense_Mutation_p.V878I|AMBRA1_ENST00000314845.3_Missense_Mutation_p.V907I|AMBRA1_ENST00000426438.1_Missense_Mutation_p.V968I|AMBRA1_ENST00000528950.1_Missense_Mutation_p.V968I|AMBRA1_ENST00000298834.3_Missense_Mutation_p.V937I			Q9C0C7	AMRA1_HUMAN	autophagy/beclin-1 regulator 1	997					autophagy (GO:0006914)|cell differentiation (GO:0030154)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron apoptotic process (GO:0043524)|neural tube development (GO:0021915)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|phagocytic vesicle (GO:0045335)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	39				GBM - Glioblastoma multiforme(35;0.0435)|Lung(87;0.182)		GGATAAAGGACGTTGAAAACT	0.458																																																	0								ENSG00000110497	C	ILE/VAL	1,4401	2.1+/-5.4	0,1,2200	61.0	61.0	61.0		2719	5.8	1.0	11		61	0,8598		0,0,4299	no	missense	AMBRA1	NM_017749.2	29	0,1,6499	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	907/1209	46439590	1,12999	2201	4299	6500	AMBRA1	SO:0001583	missense	0			-	HGNC	AB051523	CCDS31475.1, CCDS58132.1, CCDS73281.1	11p11.2	2013-01-09			ENSG00000110497	ENSG00000110497		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	25990	protein-coding gene	gene with protein product	"""WD repeat domain 94"", ""DDB1 and CUL4 associated factor 3"""	611359				17622796, 17603510, 17589504	Standard	NM_001267782		Approved	FLJ20294, KIAA1736, WDR94, DCAF3	uc001ncv.3	Q9C0C7	OTTHUMG00000166500	ENST00000458649.2:c.2989G>A	11.37:g.46439590C>T	ENSP00000415327:p.Val997Ile	Somatic	0	45	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	26	10.34	A6XN33|D3DQP8|G3V193|Q86XD6|Q9H8Z0|Q9NXE7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.V997I	ENST00000458649.2	37	c.2989		11	.	.	.	.	.	.	.	.	.	.	C	32	5.150670	0.94645	2.27E-4	0.0	ENSG00000110497	ENST00000314845;ENST00000533727;ENST00000534300;ENST00000426438;ENST00000298834;ENST00000458649;ENST00000528950	T;T;T;T;T;T;T	0.72167	-0.54;-0.63;-0.22;-0.35;-0.22;-0.38;-0.35	5.75	5.75	0.90469	WD40/YVTN repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.76535	0.4001	N	0.24115	0.695	0.58432	D	0.999996	D;D;D;D;D;D	0.76494	0.999;0.999;0.999;0.999;0.999;0.999	D;D;D;D;D;D	0.78314	0.972;0.991;0.991;0.987;0.987;0.987	T	0.75725	-0.3217	10	0.39692	T	0.17	.	19.9478	0.97189	0.0:1.0:0.0:0.0	.	997;968;937;878;1000;907	Q9C0C7;Q9C0C7-3;Q9C0C7-2;G3V193;Q9C0C7-5;Q9C0C7-4	AMRA1_HUMAN;.;.;.;.;.	I	907;878;937;968;937;997;968	ENSP00000318313:V907I;ENSP00000433372:V878I;ENSP00000431926:V937I;ENSP00000410899:V968I;ENSP00000298834:V937I;ENSP00000415327:V997I;ENSP00000433945:V968I	ENSP00000298834:V937I	V	-	1	0	AMBRA1	46396166	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	7.786000	0.85741	2.712000	0.92718	0.591000	0.81541	GTC	-	NULL		0.458	AMBRA1-005	KNOWN	basic	protein_coding	AMBRA1	protein_coding	OTTHUMT00000390103.1	C	NM_017749	-		46439590	-1	no_errors	ENST00000458649	ensembl	human	known	74_37	missense	SNP	1.000	T
SLC2A5	6518	genome.wustl.edu	37	1	9098547	9098547	+	Missense_Mutation	SNP	G	G	A			TCGA-LI-A9QH-01A-11D-A37C-09	TCGA-LI-A9QH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	54cb564e-9e29-443c-a113-aeba455a038d	92b531bd-cb9f-4317-b419-14a32eb8ad6a	g.chr1:9098547G>A	ENST00000377424.4	-	10	1296	c.1117C>T	c.(1117-1119)Cca>Tca	p.P373S	SLC2A5_ENST00000535586.1_Missense_Mutation_p.P258S|SLC2A5_ENST00000536305.1_Missense_Mutation_p.P314S	NM_003039.2	NP_003030.1	P22732	GTR5_HUMAN	solute carrier family 2 (facilitated glucose/fructose transporter), member 5	373					carbohydrate metabolic process (GO:0005975)|cellular response to fructose stimulus (GO:0071332)|fructose transport (GO:0015755)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	fructose transmembrane transporter activity (GO:0005353)|glucose transmembrane transporter activity (GO:0005355)	p.P373A(1)		endometrium(6)|kidney(15)|large_intestine(6)|lung(4)|ovary(1)|pancreas(2)|prostate(1)|urinary_tract(1)	36	Ovarian(185;0.112)|all_lung(157;0.185)	all_epithelial(116;1.34e-15)|all_lung(118;9.46e-05)|Lung NSC(185;0.000172)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.00715)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;7.78e-07)|COAD - Colon adenocarcinoma(227;8.83e-05)|Kidney(185;0.000286)|KIRC - Kidney renal clear cell carcinoma(229;0.00103)|STAD - Stomach adenocarcinoma(132;0.0019)|BRCA - Breast invasive adenocarcinoma(304;0.00199)|READ - Rectum adenocarcinoma(331;0.0649)		CTGATGTATGGCATCCAGGAC	0.607																																																	1	Substitution - Missense(1)	endometrium(1)						ENSG00000142583						113.0	102.0	106.0					1																	9098547		2203	4300	6503	SLC2A5	SO:0001583	missense	0			-	HGNC	BC001820	CCDS99.1, CCDS44054.1	1p36.2	2013-05-22			ENSG00000142583	ENSG00000142583		"""Solute carriers"""	11010	protein-coding gene	gene with protein product		138230		GLUT5		9691177	Standard	NM_003039		Approved		uc001apo.3	P22732	OTTHUMG00000001771	ENST00000377424.4:c.1117C>T	1.37:g.9098547G>A	ENSP00000366641:p.Pro373Ser	Somatic	0	33	0.00		0.7212932210862795	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52	Q14770|Q5T977|Q8IVB3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,prints_Sugar/inositol_transpt,prints_Fru_transpt_5,tigrfam_Sugar/inositol_transpt	p.P373S	ENST00000377424.4	37	c.1117	CCDS99.1	1	.	.	.	.	.	.	.	.	.	.	G	9.581	1.123702	0.20959	.	.	ENSG00000142583	ENST00000377424;ENST00000456780;ENST00000536305;ENST00000535586	T;T;T	0.71341	-0.56;-0.56;-0.56	5.35	5.35	0.76521	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.053909	0.85682	D	0.000000	T	0.49372	0.1553	N	0.12961	0.28	0.54753	D	0.999985	B;B;B	0.20164	0.008;0.042;0.008	B;B;B	0.24541	0.054;0.054;0.054	T	0.45848	-0.9233	10	0.02654	T	1	.	12.0865	0.53700	0.0837:0.0:0.9163:0.0	.	329;314;373	B4DG19;B4DU31;P22732	.;.;GTR5_HUMAN	S	373;356;314;258	ENSP00000366641:P373S;ENSP00000440688:P314S;ENSP00000442744:P258S	ENSP00000366641:P373S	P	-	1	0	SLC2A5	9021134	1.000000	0.71417	1.000000	0.80357	0.175000	0.22909	3.147000	0.50639	2.507000	0.84556	0.655000	0.94253	CCA	-	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Sugar/inositol_transpt		0.607	SLC2A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC2A5	protein_coding	OTTHUMT00000004932.1	G	NM_003039	-		9098547	-1	no_errors	ENST00000377424	ensembl	human	known	74_37	missense	SNP	1.000	A
