#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
LOC101930028	101930028	genome.wustl.edu	37	4	189717765	189717782	+	lincRNA	DEL	GCGCCCATCACAGACGCC	GCGCCCATCACAGACGCC	-	rs34567807|rs74983816|rs201117926|rs376187116|rs70944314	byFrequency	TCGA-MB-A5Y9-01A-11D-A29N-09	TCGA-MB-A5Y9-10A-01D-A29N-09	GCGCCCATCACAGACGCC	GCGCCCATCACAGACGCC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	055a030d-bb19-4224-98bf-cb860ff64b9d	109e7716-d7ac-4834-a63d-f88057eb4e6c	g.chr4:189717765_189717782delGCGCCCATCACAGACGCC	ENST00000514297.2	-	0	5_22																											CACAGACCCTGCGCCCATCACAGACGCCGCGCCCCTCA	0.56																																																	0								ENSG00000250626																																			RP11-756P10.2			0				Clone_based_vega_gene																													4.37:g.189717765_189717782delGCGCCCATCACAGACGCC		Somatic	NA	NA	NA		0.5001677347163723	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000514297.2	37	NULL		4																																																																																			-	-		0.560	RP11-756P10.2-001	KNOWN	basic|exp_conf	lincRNA	LOC101930449	lincRNA	OTTHUMT00000360039.3	GCGCCCATCACAGACGCC				189717782	-1	no_errors	ENST00000514297	ensembl	human	known	74_37	rna	DEL	0.245:0.199:0.160:0.153:0.152:0.145:0.143:0.154:0.165:0.166:0.161:0.143:0.136:0.116:0.102:0.096:0.098:0.106	-
POTEM	641455	genome.wustl.edu	37	14	20012850	20012850	+	Intron	SNP	A	A	T	rs201036322		TCGA-MB-A5Y9-01A-11D-A29N-09	TCGA-MB-A5Y9-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	055a030d-bb19-4224-98bf-cb860ff64b9d	109e7716-d7ac-4834-a63d-f88057eb4e6c	g.chr14:20012850A>T	ENST00000551509.1	-	4	862				RP11-244H18.1_ENST00000547584.1_lincRNA	NM_001145442.1	NP_001138914.1	A6NI47	POTEM_HUMAN	POTE ankyrin domain family, member M											endometrium(4)|kidney(1)|lung(4)	9						actgaggttgaggttggagga	0.398																																																	0								ENSG00000187537																																			POTEM	SO:0001627	intron_variant	0			-	HGNC		CCDS73609.1	14q11.2	2013-01-10			ENSG00000187537	ENSG00000187537		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	37096	protein-coding gene	gene with protein product	"""prostate-specific P704P"""					16364570	Standard	NM_001145442		Approved	POTE14beta, P704P, ACT	uc001vwc.3	A6NI47		ENST00000551509.1:c.811-1193T>A	14.37:g.20012850A>T		Somatic	0	17	0.00		0.5001677347163723	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	10	28.57		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.P302	ENST00000551509.1	37	c.906	CCDS45076.1	14																																																																																			-	NULL		0.398	POTEM-001	NOVEL	basic|appris_principal|CCDS	protein_coding	POTEM	protein_coding	OTTHUMT00000409490.3	A	NM_001145442	rs201036322		20012850	-1	no_errors	ENST00000547722	ensembl	human	known	74_37	silent	SNP	0.030	T
FBXO42	54455	genome.wustl.edu	37	1	16577304	16577304	+	Missense_Mutation	SNP	C	C	T			TCGA-MB-A5Y9-01A-11D-A29N-09	TCGA-MB-A5Y9-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	055a030d-bb19-4224-98bf-cb860ff64b9d	109e7716-d7ac-4834-a63d-f88057eb4e6c	g.chr1:16577304C>T	ENST00000375592.3	-	10	2231	c.2015G>A	c.(2014-2016)gGa>gAa	p.G672E		NM_018994.1	NP_061867.1	Q6P3S6	FBX42_HUMAN	F-box protein 42	672										autonomic_ganglia(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(4)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	26		Colorectal(325;0.000147)|Renal(390;0.00145)|Breast(348;0.00224)|Lung NSC(340;0.00475)|all_lung(284;0.00671)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0193)|Colorectal(212;3.16e-07)|COAD - Colon adenocarcinoma(227;1.46e-05)|BRCA - Breast invasive adenocarcinoma(304;4.37e-05)|Kidney(64;0.000246)|KIRC - Kidney renal clear cell carcinoma(64;0.00336)|STAD - Stomach adenocarcinoma(313;0.0139)|READ - Rectum adenocarcinoma(331;0.0693)		TTCAGGAGGTCCAACCACAGA	0.468																																																	0								ENSG00000037637						191.0	182.0	185.0					1																	16577304		2203	4300	6503	FBXO42	SO:0001583	missense	0			-	HGNC	BC063864	CCDS30613.1	1p36.23-p36.11	2008-02-05			ENSG00000037637	ENSG00000037637		"""F-boxes /  ""other"""""	29249	protein-coding gene	gene with protein product		609109				10718198	Standard	XM_006710698		Approved	KIAA1332, Fbx42	uc001ayg.3	Q6P3S6	OTTHUMG00000002218	ENST00000375592.3:c.2015G>A	1.37:g.16577304C>T	ENSP00000364742:p.Gly672Glu	Somatic	0	73	0.00		0.5001677347163723	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	50	16.67	B3KP30|Q5TEU8|Q86XI0|Q8N3N4|Q8N5F8|Q9BRM0|Q9P2L4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Kelch_2,pfam_Kelch_1,pfam_F-box_dom,superfamily_F-box_dom,smart_F-box_dom,pfscan_F-box_dom	p.G672E	ENST00000375592.3	37	c.2015	CCDS30613.1	1	.	.	.	.	.	.	.	.	.	.	C	18.33	3.600939	0.66332	.	.	ENSG00000037637	ENST00000375592	T	0.11277	2.79	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	T	0.18130	0.0435	N	0.08118	0	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.29488	-1.0010	10	0.72032	D	0.01	-14.6209	18.7865	0.91957	0.0:1.0:0.0:0.0	.	672	Q6P3S6	FBX42_HUMAN	E	672	ENSP00000364742:G672E	ENSP00000364742:G672E	G	-	2	0	FBXO42	16449891	1.000000	0.71417	0.257000	0.24404	0.693000	0.40251	7.587000	0.82613	2.767000	0.95098	0.655000	0.94253	GGA	-	NULL		0.468	FBXO42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO42	protein_coding	OTTHUMT00000006285.1	C		-		16577304	-1	no_errors	ENST00000375592	ensembl	human	known	74_37	missense	SNP	0.999	T
EMC1	23065	genome.wustl.edu	37	1	19545484	19545485	+	3'UTR	INS	-	-	AAAAC	rs200361810|rs370415955|rs71716681|rs113921390	byFrequency	TCGA-MB-A5Y9-01A-11D-A29N-09	TCGA-MB-A5Y9-10A-01D-A29N-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	055a030d-bb19-4224-98bf-cb860ff64b9d	109e7716-d7ac-4834-a63d-f88057eb4e6c	g.chr1:19545484_19545485insAAAAC	ENST00000477853.1	-	0	3336_3337				EMC1_ENST00000480380.1_5'UTR|RP1-43E13.2_ENST00000437898.1_RNA|EMC1_ENST00000375208.3_3'UTR|EMC1_ENST00000375199.3_3'UTR	NM_001271427.1|NM_001271428.1|NM_015047.2	NP_001258356.1|NP_001258357.1|NP_055862.1	Q8N766	EMC1_HUMAN	ER membrane protein complex subunit 1							ER membrane protein complex (GO:0072546)|integral component of membrane (GO:0016021)											TCTTATTAAAAAAAACAAAACA	0.366														2517	0.502596	0.5182	0.4971	5008	,	,		23597	0.6865		0.3946	False		,,,				2504	0.407																0								ENSG00000127463																																			EMC1	SO:0001624	3_prime_UTR_variant	0				HGNC		CCDS190.1, CCDS59190.1, CCDS59191.1	1p36.13	2012-05-23	2012-05-23	2012-05-23	ENSG00000127463	ENSG00000127463			28957	protein-coding gene	gene with protein product			"""KIAA0090"""	KIAA0090		22119785	Standard	NM_015047		Approved		uc001bbo.4	Q8N766	OTTHUMG00000002497	ENST00000477853.1:c.*313->GTTTT	1.37:g.19545490_19545494dupAAAAC		Somatic	NA	NA	NA		0.5001677347163723	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A8K6F3|Q14700|Q5TG62|Q63HL0|Q63HL3|Q8NBH8	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000477853.1	37	NULL	CCDS190.1	1																																																																																			-	-		0.366	EMC1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EMC1	protein_coding	OTTHUMT00000007076.2	-	NM_015047			19545485	-1	no_errors	ENST00000461353	ensembl	human	known	74_37	rna	INS	0.002:0.000	AAAAC
PKN1	5585	genome.wustl.edu	37	19	14581437	14581437	+	Silent	SNP	C	C	T	rs367563299		TCGA-MB-A5Y9-01A-11D-A29N-09	TCGA-MB-A5Y9-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	055a030d-bb19-4224-98bf-cb860ff64b9d	109e7716-d7ac-4834-a63d-f88057eb4e6c	g.chr19:14581437C>T	ENST00000242783.6	+	20	2652	c.2487C>T	c.(2485-2487)aaC>aaT	p.N829N	PKN1_ENST00000342216.4_Silent_p.N835N	NM_002741.3	NP_002732.3	Q16512	PKN1_HUMAN	protein kinase N1	829	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of JUN kinase activity (GO:0007257)|epithelial cell migration (GO:0010631)|histone H3-T11 phosphorylation (GO:0035407)|hyperosmotic response (GO:0006972)|protein phosphorylation (GO:0006468)|regulation of cell motility (GO:2000145)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|midbody (GO:0030496)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|GTP-Rho binding (GO:0017049)|histone binding (GO:0042393)|histone deacetylase binding (GO:0042826)|histone kinase activity (H3-T11 specific) (GO:0035402)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein kinase C binding (GO:0005080)|protein serine/threonine kinase activity (GO:0004674)|Rac GTPase binding (GO:0048365)			breast(3)|central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)	31						GCATCGTCAACGACGAGGTTC	0.677													C|||	1	0.000199681	0.0	0.0	5008	,	,		16759	0.001		0.0	False		,,,				2504	0.0				NSCLC(185;2539 2965 10733 52867)												0								ENSG00000123143	C	,	0,3996		0,0,1998	22.0	26.0	25.0		2487,2505	-5.7	0.7	19		25	1,8303		0,1,4151	no	coding-synonymous,coding-synonymous	PKN1	NM_002741.3,NM_213560.1	,	0,1,6149	TT,TC,CC		0.012,0.0,0.0081	,	829/943,835/949	14581437	1,12299	1998	4152	6150	PKN1	SO:0001819	synonymous_variant	0			-	HGNC	S75546	CCDS42513.1, CCDS42514.1	19p13.12	2008-05-14	2004-07-01	2004-07-01	ENSG00000123143	ENSG00000123143			9405	protein-coding gene	gene with protein product		601032	"""protein kinase C-like 1"""	PRKCL1		9570957	Standard	NM_002741		Approved	DBK, PRK1, PKN, MGC46204, PAK1	uc002myq.3	Q16512	OTTHUMG00000039611	ENST00000242783.6:c.2487C>T	19.37:g.14581437C>T		Somatic	0	52	0.00		0.5001677347163723	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	57	18.57	A8K7W5|B2R9R4|B3KVN3|Q15143|Q504U4|Q8IUV5|Q9UD44	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_HR1_rho-bd,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_HR1_rho-bd,superfamily_C2_dom,smart_HR1_rho-bd,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_Prot_kinase_dom	p.N835	ENST00000242783.6	37	c.2505	CCDS42513.1	19																																																																																			-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.677	PKN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKN1	protein_coding	OTTHUMT00000095510.1	C	NM_002741, NM_213560	-		14581437	+1	no_errors	ENST00000342216	ensembl	human	known	74_37	silent	SNP	0.889	T
TTC6	319089	genome.wustl.edu	37	14	38207994	38207994	+	Missense_Mutation	SNP	C	C	T			TCGA-MB-A5Y9-01A-11D-A29N-09	TCGA-MB-A5Y9-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	055a030d-bb19-4224-98bf-cb860ff64b9d	109e7716-d7ac-4834-a63d-f88057eb4e6c	g.chr14:38207994C>T	ENST00000553443.1	+	10	1997	c.1997C>T	c.(1996-1998)tCt>tTt	p.S666F				Q86TZ1	TTC6_HUMAN	tetratricopeptide repeat domain 6	0										central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|skin(1)|stomach(1)|urinary_tract(1)	14	Hepatocellular(127;0.213)|Esophageal squamous(585;0.22)		Lung(238;1.59e-06)|LUAD - Lung adenocarcinoma(48;2.48e-05)|Epithelial(34;0.0543)|all cancers(34;0.108)|BRCA - Breast invasive adenocarcinoma(188;0.156)|LUSC - Lung squamous cell carcinoma(13;0.176)	GBM - Glioblastoma multiforme(112;0.00551)		GTAAAATCTTCTGTAGACTTG	0.318																																																	0								ENSG00000139865																																			TTC6	SO:0001583	missense	0			-	HGNC	BC014342		14q13.1	2013-01-10			ENSG00000139865	ENSG00000139865		"""Tetratricopeptide (TTC) repeat domain containing"""	19739	protein-coding gene	gene with protein product			"""non-protein coding RNA 291"", ""chromosome 14 open reading frame 25"""	NCRNA00291, C14orf25			Standard	XM_006709976		Approved		uc001wuj.3	Q86TZ1	OTTHUMG00000157369	ENST00000553443.1:c.1997C>T	14.37:g.38207994C>T	ENSP00000451131:p.Ser666Phe	Somatic	0	15	0.00		0.5001677347163723	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	26	15.62	Q3SY88|Q96CE6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TPR_1,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.S666F	ENST00000553443.1	37	c.1997		14	.	.	.	.	.	.	.	.	.	.	C	10.06	1.246382	0.22796	.	.	ENSG00000139865	ENST00000553443	T	0.71103	-0.54	4.76	-0.474	0.12108	.	.	.	.	.	T	0.51719	0.1691	.	.	.	.	.	.	.	.	.	.	.	.	T	0.46735	-0.9170	4	.	.	.	.	1.0462	0.01570	0.3044:0.3654:0.151:0.1792	.	.	.	.	F	666	ENSP00000451131:S666F	.	S	+	2	0	TTC6	37277745	0.003000	0.15002	0.013000	0.15412	0.000000	0.00434	0.362000	0.20284	0.017000	0.15025	-0.886000	0.02939	TCT	-	NULL		0.318	TTC6-001	NOVEL	basic|appris_principal|exp_conf	protein_coding	TTC6	protein_coding	OTTHUMT00000348620.4	C	XM_002343299	-		38207994	+1	no_errors	ENST00000553443	ensembl	human	novel	74_37	missense	SNP	0.009	T
WASH6P	653440	genome.wustl.edu	37	X	155250570	155250570	+	RNA	SNP	C	C	G			TCGA-MB-A5Y9-01A-11D-A29N-09	TCGA-MB-A5Y9-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	055a030d-bb19-4224-98bf-cb860ff64b9d	109e7716-d7ac-4834-a63d-f88057eb4e6c	g.chrX:155250570C>G	ENST00000461007.1	+	0	0				AJ271736.10_ENST00000285718.7_RNA			Q9NQA3	WASH6_HUMAN	WAS protein family homolog 6 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)										ACACACGCATCAGAGTTAACT	0.567																																																	0								ENSG00000182484																																			WASH6P			0			-	HGNC	AI042587		Xq28 and Yq12	2014-08-28	2008-01-16	2008-01-16	ENSG00000182484	ENSG00000182484		"""Pseudoautosomal regions / PAR2"", ""WAS protein homologs"""	31685	pseudogene	pseudogene			"""family with sequence similarity 39, member A"", ""chromosomes X and Y open reading frame 1"""	FAM39A, CXYorf1		10655549, 12566406, 18159949	Standard	NG_008380		Approved			Q9NQA3	OTTHUMG00000022677		X.37:g.155250570C>G		Somatic	0	55	0.00		0.5001677347163723	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	64	17.95	A6NGF1|Q8N305	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000461007.1	37	NULL		X																																																																																			-	-		0.567	WASH6P-016	KNOWN	basic	processed_transcript	WASH6P	pseudogene	OTTHUMT00000058840.1	C	NG_008380	-		155250570	+1	no_errors	ENST00000476066	ensembl	human	known	74_37	rna	SNP	0.002	G
PCDHA5	56143	genome.wustl.edu	37	5	140202722	140202722	+	Silent	SNP	C	C	T	rs536422534	byFrequency	TCGA-MB-A5Y9-01A-11D-A29N-09	TCGA-MB-A5Y9-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	055a030d-bb19-4224-98bf-cb860ff64b9d	109e7716-d7ac-4834-a63d-f88057eb4e6c	g.chr5:140202722C>T	ENST00000529859.1	+	1	1362	c.1362C>T	c.(1360-1362)ttC>ttT	p.F454F	PCDHA5_ENST00000378126.3_Silent_p.F454F|PCDHA4_ENST00000512229.2_Intron|PCDHA5_ENST00000529619.1_Silent_p.F454F|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA3_ENST00000522353.2_Intron	NM_018908.2	NP_061731.1	Q9Y5H7	PCDA5_HUMAN	protocadherin alpha 5	454	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(6)|large_intestine(8)|liver(1)|lung(22)|ovary(2)|prostate(6)|skin(4)|upper_aerodigestive_tract(3)	60			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTCCGGCGTTCGCGCAGCCCC	0.677													.|||	3	0.000599042	0.0	0.0	5008	,	,		17146	0.0		0.0	False		,,,				2504	0.0031																0								ENSG00000204965						72.0	74.0	74.0					5																	140202722		2203	4300	6503	PCDHA5	SO:0001819	synonymous_variant	0			-	HGNC	AF152483	CCDS54917.1	5q31	2010-11-26				ENSG00000204965		"""Cadherins / Protocadherins : Clustered"""	8671	other	complex locus constituent	"""ortholog of mouse CNR6"", ""KIAA0345-like 9"""	606311		CNRS6		10380929, 10662547	Standard	NM_018908		Approved	CNR6, CRNR6, CNRN6, PCDH-ALPHA5		Q9Y5H7		ENST00000529859.1:c.1362C>T	5.37:g.140202722C>T		Somatic	0	114	0.00		0.5001677347163723	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	46	113	28.93	O75284|Q8N4R3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.F454	ENST00000529859.1	37	c.1362	CCDS54917.1	5																																																																																			-	superfamily_Cadherin-like,prints_Cadherin,pfscan_Cadherin		0.677	PCDHA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA5	protein_coding	OTTHUMT00000372883.2	C	NM_018908	-		140202722	+1	no_errors	ENST00000529859	ensembl	human	known	74_37	silent	SNP	0.085	T
RP11-403I13.4	0	genome.wustl.edu	37	1	149250592	149250592	+	lincRNA	SNP	G	G	C	rs114062375		TCGA-MB-A5Y9-01A-11D-A29N-09	TCGA-MB-A5Y9-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	055a030d-bb19-4224-98bf-cb860ff64b9d	109e7716-d7ac-4834-a63d-f88057eb4e6c	g.chr1:149250592G>C	ENST00000325963.8	+	0	637																											TGAGGAAGCAGAACAGGGACA	0.443																																																	0								ENSG00000223779																																			RP11-403I13.4			0			-	Clone_based_vega_gene																													1.37:g.149250592G>C		Somatic	0	8	0.00		0.5001677347163723	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	2	75.00		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000325963.8	37	NULL		1																																																																																			-	-		0.443	RP11-403I13.4-002	KNOWN	not_best_in_genome_evidence|basic	lincRNA	LOC100293748	lincRNA	OTTHUMT00000099551.1	G		rs114062375		149250592	+1	no_errors	ENST00000325963	ensembl	human	known	74_37	rna	SNP	0.021	C
TP53	7157	genome.wustl.edu	37	17	7577010	7577018	+	Splice_Site	DEL	CTTGCTTAC	CTTGCTTAC	-	rs199527475		TCGA-MB-A5Y9-01A-11D-A29N-09	TCGA-MB-A5Y9-10A-01D-A29N-09	CTTGCTTAC	CTTGCTTAC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	055a030d-bb19-4224-98bf-cb860ff64b9d	109e7716-d7ac-4834-a63d-f88057eb4e6c	g.chr17:7577010_7577018delCTTGCTTAC	ENST00000269305.4	-	8	1109		c.e8+1		TP53_ENST00000413465.2_Intron|TP53_ENST00000445888.2_Splice_Site|TP53_ENST00000455263.2_Splice_Site|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Splice_Site|TP53_ENST00000420246.2_Splice_Site	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53						apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.?(32)|p.0?(8)|p.A307fs*34(1)|p.L308fs*31(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TCTTGTCCTGCTTGCTTACCTCGCTTAGT	0.56		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	42	Unknown(32)|Whole gene deletion(8)|Deletion - Frameshift(2)	lung(7)|breast(7)|upper_aerodigestive_tract(4)|central_nervous_system(4)|bone(4)|haematopoietic_and_lymphoid_tissue(3)|ovary(3)|large_intestine(2)|stomach(2)|biliary_tract(1)|endometrium(1)|urinary_tract(1)|skin(1)|oesophagus(1)|prostate(1)	GRCh37	CD920913	TP53	D		ENSG00000141510																																			TP53	SO:0001630	splice_region_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;		HGNC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.919+1GTAAGCAAG>-	17.37:g.7577010_7577018delCTTGCTTAC		Somatic	NA	NA	NA		0.5001677347163723	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Splice_Site	DEL	NA	NA	NA	NA	NA	NA	-	e7+1	ENST00000269305.4	37	c.919+1_919+1	CCDS11118.1	17																																																																																			-	-		0.560	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	CTTGCTTAC	NM_000546		Intron	7577018	-1	no_errors	ENST00000269305	ensembl	human	known	74_37	splice_site_del	DEL	0.000:0.000:0.001:0.070:0.132:0.231:0.250:0.853:0.976	-
RGPD4	285190	genome.wustl.edu	37	2	108479247	108479247	+	Missense_Mutation	SNP	C	C	T			TCGA-MB-A5Y9-01A-11D-A29N-09	TCGA-MB-A5Y9-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	055a030d-bb19-4224-98bf-cb860ff64b9d	109e7716-d7ac-4834-a63d-f88057eb4e6c	g.chr2:108479247C>T	ENST00000408999.3	+	16	2392	c.2315C>T	c.(2314-2316)gCg>gTg	p.A772V	RGPD4_ENST00000354986.4_Missense_Mutation_p.A772V	NM_182588.2	NP_872394.2	Q7Z3J3	RGPD4_HUMAN	RANBP2-like and GRIP domain containing 4	772					protein targeting to Golgi (GO:0000042)					breast(1)|endometrium(7)|kidney(4)|lung(23)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(3)	43						TTGCGAAATGCGGATTCAGAA	0.368																																																	0								ENSG00000196862						34.0	31.0	32.0					2																	108479247		377	927	1304	RGPD4	SO:0001583	missense	0			-	HGNC	BX537861	CCDS46381.1	2q12.3	2013-01-10			ENSG00000196862	ENSG00000196862		"""Tetratricopeptide (TTC) repeat domain containing"""	32417	protein-coding gene	gene with protein product		612707				15710750, 15815621	Standard	NM_182588		Approved	RGP4, DKFZp686P0288	uc010ywk.2	Q7Z3J3	OTTHUMG00000153208	ENST00000408999.3:c.2315C>T	2.37:g.108479247C>T	ENSP00000386810:p.Ala772Val	Somatic	0	132	0.00		0.5001677347163723	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	132	10.20	B9A029	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ran_bind_dom,pfam_GRIP,pfam_TPR_1,pfam_TPR_2,superfamily_GRIP,smart_TPR_repeat,smart_Ran_bind_dom,smart_GRIP,pfscan_GRIP,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_Ran_bind_dom	p.A772V	ENST00000408999.3	37	c.2315	CCDS46381.1	2	.	.	.	.	.	.	.	.	.	.	-	9.686	1.150676	0.21371	.	.	ENSG00000196862	ENST00000354986;ENST00000408999;ENST00000439322	T;T	0.23348	1.91;1.91	2.3	1.37	0.22104	.	.	.	.	.	T	0.20292	0.0488	L	0.47716	1.5	0.23376	N	0.997802	B	0.15141	0.012	B	0.06405	0.002	T	0.16630	-1.0396	9	0.42905	T	0.14	-0.1623	6.3879	0.21572	0.0:0.8312:0.0:0.1688	.	772	Q7Z3J3	RGPD4_HUMAN	V	772;772;530	ENSP00000347081:A772V;ENSP00000386810:A772V	ENSP00000347081:A772V	A	+	2	0	RGPD4	107845679	0.832000	0.29368	0.909000	0.35828	0.075000	0.17131	0.083000	0.14871	1.299000	0.44798	0.152000	0.16155	GCG	-	NULL		0.368	RGPD4-001	NOVEL	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	RGPD4	protein_coding	OTTHUMT00000330096.2	C	XM_496581	-		108479247	+1	no_errors	ENST00000354986	ensembl	human	known	74_37	missense	SNP	0.894	T
CELSR2	1952	genome.wustl.edu	37	1	109813851	109813851	+	Silent	SNP	C	C	T			TCGA-MB-A5Y9-01A-11D-A29N-09	TCGA-MB-A5Y9-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	055a030d-bb19-4224-98bf-cb860ff64b9d	109e7716-d7ac-4834-a63d-f88057eb4e6c	g.chr1:109813851C>T	ENST00000271332.3	+	26	7670	c.7609C>T	c.(7609-7611)Ctg>Ttg	p.L2537L	CELSR2_ENST00000498157.1_3'UTR	NM_001408.2	NP_001399.1	Q9HCU4	CELR2_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 2	2537					cerebrospinal fluid secretion (GO:0033326)|cilium assembly (GO:0042384)|cilium movement (GO:0003341)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neural plate anterior/posterior regionalization (GO:0021999)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of cell-cell adhesion (GO:0022407)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|ventricular system development (GO:0021591)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(27)|ovary(5)|prostate(1)|skin(3)|urinary_tract(2)	82		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		GAGTGTCTTCCTGTACATCCT	0.637																																					NSCLC(158;1285 2011 34800 34852 42084)												0								ENSG00000143126						96.0	107.0	103.0					1																	109813851		2203	4300	6503	CELSR2	SO:0001819	synonymous_variant	0			-	HGNC	D87469	CCDS796.1	1p13.3	2014-08-08	2013-02-18		ENSG00000143126	ENSG00000143126		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3231	protein-coding gene	gene with protein product		604265	"""cadherin, EGF LAG seven-pass G-type receptor 2, flamingo (Drosophila) homolog"""	EGFL2		9693030, 10907856	Standard	NM_001408		Approved	KIAA0279, MEGF3, Flamingo1, CDHF10	uc001dxa.4	Q9HCU4	OTTHUMG00000012003	ENST00000271332.3:c.7609C>T	1.37:g.109813851C>T		Somatic	0	32	0.00		0.5001677347163723	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	30	14.29	Q5T2Y7|Q92566	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_DUF3497,pfam_Laminin_G,pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_EG-like_dom,pfam_EGF_laminin,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,smart_EGF_laminin,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_GPS_dom,pfscan_Laminin_G,pfscan_Cadherin,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_Cadherin,prints_GPCR_2_secretin-like	p.L2537	ENST00000271332.3	37	c.7609	CCDS796.1	1																																																																																			-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like		0.637	CELSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CELSR2	protein_coding	OTTHUMT00000033200.1	C	NM_001408	-		109813851	+1	no_errors	ENST00000271332	ensembl	human	known	74_37	silent	SNP	1.000	T
DMD	1756	genome.wustl.edu	37	X	32583996	32583996	+	Silent	SNP	A	A	T			TCGA-MB-A5Y9-01A-11D-A29N-09	TCGA-MB-A5Y9-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	055a030d-bb19-4224-98bf-cb860ff64b9d	109e7716-d7ac-4834-a63d-f88057eb4e6c	g.chrX:32583996A>T	ENST00000357033.4	-	16	2021	c.1815T>A	c.(1813-1815)gtT>gtA	p.V605V	DMD_ENST00000288447.4_Silent_p.V597V|DMD_ENST00000378677.2_Silent_p.V601V	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	605					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				CCGCTTTTAAAACCTGTTAAA	0.373																																																	0								ENSG00000198947						97.0	80.0	85.0					X																	32583996		2202	4300	6502	DMD	SO:0001819	synonymous_variant	0			-	HGNC	AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.1815T>A	X.37:g.32583996A>T		Somatic	0	30	0.00		0.5001677347163723	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	32	13.51	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Spectrin_repeat,pfam_EF-hand_dom_typ1,pfam_EF-hand_dom_typ2,pfam_CH-domain,pfam_Znf_ZZ,pfam_WW_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_WW_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_WW_dom,smart_Znf_ZZ,pirsf_Dystrophin/utrophin,pfscan_CH-domain,pfscan_WW_dom,pfscan_Znf_ZZ	p.V605	ENST00000357033.4	37	c.1815	CCDS14233.1	X																																																																																			-	smart_Spectrin/alpha-actinin,pirsf_Dystrophin/utrophin		0.373	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMD	protein_coding	OTTHUMT00000056182.2	A	NM_004006	-		32583996	-1	no_errors	ENST00000357033	ensembl	human	known	74_37	silent	SNP	0.611	T
DNM1P47	100216544	genome.wustl.edu	37	15	102299761	102299761	+	RNA	SNP	G	G	A			TCGA-MB-A5Y9-01A-11D-A29N-09	TCGA-MB-A5Y9-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	055a030d-bb19-4224-98bf-cb860ff64b9d	109e7716-d7ac-4834-a63d-f88057eb4e6c	g.chr15:102299761G>A	ENST00000561463.1	+	0	7807									DNM1 pseudogene 47																		TCATGGAGGAGTCGGCAGAGC	0.582																																																	0								ENSG00000259660																																			DNM1P47			0			-	HGNC	AJ576276		15q26.3	2013-04-25			ENSG00000259660	ENSG00000259660			35200	pseudogene	pseudogene				DNM1DN14@			Standard	NG_009149		Approved	DNM1DN14-3			OTTHUMG00000172265		15.37:g.102299761G>A		Somatic	0	14	0.00		0.5001677347163723	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	13	31.58		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000561463.1	37	NULL		15																																																																																			-	-		0.582	DNM1P47-001	KNOWN	basic	processed_transcript	DNM1P47	pseudogene	OTTHUMT00000417589.1	G	NG_009149	-		102299761	+1	no_errors	ENST00000561463	ensembl	human	known	74_37	rna	SNP	1.000	A
HMBS	3145	genome.wustl.edu	37	11	118962697	118962697	+	Intron	DEL	A	A	-	rs111268492		TCGA-MB-A5Y9-01A-11D-A29N-09	TCGA-MB-A5Y9-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	055a030d-bb19-4224-98bf-cb860ff64b9d	109e7716-d7ac-4834-a63d-f88057eb4e6c	g.chr11:118962697delA	ENST00000278715.3	+	10	763				HMBS_ENST00000442944.2_Intron|HMBS_ENST00000534956.1_3'UTR|HMBS_ENST00000537841.1_Intron|HMBS_ENST00000543090.1_Intron|HMBS_ENST00000542729.1_Intron|HMBS_ENST00000392841.1_Intron|HMBS_ENST00000544387.1_Intron	NM_000190.3	NP_000181.2	P08397	HEM3_HUMAN	hydroxymethylbilane synthase						heme biosynthetic process (GO:0006783)|peptidyl-pyrromethane cofactor linkage (GO:0018160)|porphyrin-containing compound metabolic process (GO:0006778)|protoporphyrinogen IX biosynthetic process (GO:0006782)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	hydroxymethylbilane synthase activity (GO:0004418)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|urinary_tract(1)	15	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.72e-05)		GAAAATTTACAAAAAAAAAAA	0.473																																																	0								ENSG00000256269																																			HMBS	SO:0001627	intron_variant	0				HGNC	X04808	CCDS8409.1, CCDS41726.1, CCDS58186.1, CCDS58187.1	11q23.3	2013-07-10			ENSG00000256269	ENSG00000256269	2.5.1.61		4982	protein-coding gene	gene with protein product		609806	"""uroporphyrinogen I synthase"", ""porphobilinogen deaminase"", ""porphyria, acute; Chester type"""	PBGD, UPS, PORC		8432552, 17298217	Standard	NM_001258208		Approved		uc001puz.1	P08397	OTTHUMG00000168295	ENST00000278715.3:c.613-138A>-	11.37:g.118962697delA		Somatic	0	9	0.00		0.5001677347163723	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	7	36.36	A8K2L0|G3V1P4|G5EA58|P08396|Q16012	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000278715.3	37	NULL	CCDS8409.1	11																																																																																			-	-		0.473	HMBS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMBS	protein_coding	OTTHUMT00000399188.1	A	NM_000190			118962697	+1	no_errors	ENST00000534956	ensembl	human	known	74_37	rna	DEL	0.013	-
HNF1A	6927	genome.wustl.edu	37	12	121434630	121434631	+	Frame_Shift_Ins	INS	-	-	TCATTCAT	rs55853809|rs75100977|rs397707647|rs371591990|rs587777932|rs58371019	byFrequency	TCGA-MB-A5Y9-01A-11D-A29N-09	TCGA-MB-A5Y9-10A-01D-A29N-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	055a030d-bb19-4224-98bf-cb860ff64b9d	109e7716-d7ac-4834-a63d-f88057eb4e6c	g.chr12:121434630_121434631insTCATTCAT	ENST00000402929.1	+	6	1529_1530	c.1394_1395insTCATTCAT	c.(1393-1398)actcatfs	p.-468fs	HNF1A_ENST00000400024.2_Intron|HNF1A_ENST00000257555.6_Intron|HNF1A_ENST00000541395.1_Intron|HNF1A_ENST00000544413.1_Intron|HNF1A_ENST00000543427.1_Frame_Shift_Ins_p.-351fs|HNF1A_ENST00000538626.1_Intron			P20823	HNF1A_HUMAN	HNF1 homeobox A						glucose homeostasis (GO:0042593)|glucose import (GO:0046323)|insulin secretion (GO:0030073)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|renal glucose absorption (GO:0035623)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(8)|large_intestine(19)|liver(175)|lung(9)|ovary(2)|prostate(1)|urinary_tract(1)	221	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					GCCACTGGGACTCATTCattca	0.53									Hepatic Adenoma, Familial Clustering of																																								0								ENSG00000135100																																			HNF1A	SO:0001589	frameshift_variant	0	Familial Cancer Database	incl. Maturity-Onset Diabetes of the Young type 3, MODY3		HGNC	M57732	CCDS9209.1	12q24.31	2014-09-17	2007-08-24	2007-08-24	ENSG00000135100	ENSG00000135100		"""Homeoboxes / HNF class"""	11621	protein-coding gene	gene with protein product		142410	"""transcription factor 1, hepatic; LF-B1, hepatic nuclear factor (HNF1), albumin proximal factor"""	MODY3, TCF1		1535333, 7795649	Standard	NM_000545		Approved	HNF1, LFB1	uc001tzg.3	P20823	OTTHUMG00000151015	ENST00000402929.1:c.1403_1410dupTCATTCAT	12.37:g.121434631_121434638dupTCATTCAT	ENSP00000475300:p.Phe468fs	Somatic	NA	NA	NA		0.5001677347163723	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A5Z2R8|E0YMJ5|E0YMK0|E0YMK1|E2I9R4|E2I9R5|F5H5U3|Q2M3H2|Q99861	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_HNF1b_C,pfam_HNF-1_N,pfam_Homeobox_dom,superfamily_Homeodomain-like,superfamily_Lambda_DNA-bd_dom,smart_Homeobox_dom,pfscan_Homeobox_dom	p.F352fs	ENST00000402929.1	37	c.1043_1044		12																																																																																			-	NULL		0.530	HNF1A-003	PUTATIVE	basic	protein_coding	HNF1A	protein_coding	OTTHUMT00000320959.3	-	NM_000545			121434631	+1	no_errors	ENST00000543427	ensembl	human	known	74_37	frame_shift_ins	INS	0.006:0.017	TCATTCAT
FMO6P	388714	genome.wustl.edu	37	1	171116874	171116874	+	Silent	SNP	C	C	T			TCGA-MB-A5Y9-01A-11D-A29N-09	TCGA-MB-A5Y9-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	055a030d-bb19-4224-98bf-cb860ff64b9d	109e7716-d7ac-4834-a63d-f88057eb4e6c	g.chr1:171116874C>T	ENST00000236166.3	+	4	704	c.594C>T	c.(592-594)gaC>gaT	p.D198D				O60774	FMO6_HUMAN	flavin containing monooxygenase 6 pseudogene	198						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	flavin adenine dinucleotide binding (GO:0050660)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)										CGGGATCTGACATTGCTGTTG	0.488																																																	0								ENSG00000117507																																			FMO6P	SO:0001819	synonymous_variant	0			-	HGNC	AK130511		1q24.3	2011-08-04	2006-12-04	2006-12-04	ENSG00000117507	ENSG00000117507			24024	pseudogene	pseudogene			"""flavin containing monooxygenase 6"""	FMO6		15077013	Standard	NR_002601		Approved		uc001ghj.1	O60774	OTTHUMG00000035503	ENST00000236166.3:c.594C>T	1.37:g.171116874C>T		Somatic	0	35	0.00		0.5001677347163723	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	53	10.17		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Flavin_mOase-like,pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,prints_Flavin_mOase,prints_Flavin_mOase_3,prints_Flavin_mOase_1	p.D198	ENST00000236166.3	37	c.594		1																																																																																			-	pfam_Flavin_mOase-like,pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,prints_Flavin_mOase		0.488	FMO6P-003	NOVEL	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	FMO6P	protein_coding	OTTHUMT00000385941.4	C	XM_371326	-		171116874	+1	no_errors	ENST00000236166	ensembl	human	novel	74_37	silent	SNP	1.000	T
FAM47C	442444	genome.wustl.edu	37	X	37027132	37027132	+	Missense_Mutation	SNP	A	A	T			TCGA-MB-A5Y9-01A-11D-A29N-09	TCGA-MB-A5Y9-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	055a030d-bb19-4224-98bf-cb860ff64b9d	109e7716-d7ac-4834-a63d-f88057eb4e6c	g.chrX:37027132A>T	ENST00000358047.3	+	1	701	c.649A>T	c.(649-651)Act>Tct	p.T217S		NM_001013736.2	NP_001013758.1	Q5HY64	FA47C_HUMAN	family with sequence similarity 47, member C	217										breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	120						GCCTCCAGAGACTGGAGTGTC	0.662																																																	0								ENSG00000198173						35.0	36.0	36.0					X																	37027132		2202	4299	6501	FAM47C	SO:0001583	missense	0			-	HGNC	AK125992	CCDS35227.1	Xp21.1	2006-07-04			ENSG00000198173	ENSG00000198173			25301	protein-coding gene	gene with protein product							Standard	NM_001013736		Approved		uc004ddl.2	Q5HY64	OTTHUMG00000024025	ENST00000358047.3:c.649A>T	X.37:g.37027132A>T	ENSP00000367913:p.Thr217Ser	Somatic	0	44	0.00		0.5001677347163723	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	59	10.45	Q6ZU46	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.T217S	ENST00000358047.3	37	c.649	CCDS35227.1	X	.	.	.	.	.	.	.	.	.	.	A	10.13	1.265133	0.23136	.	.	ENSG00000198173	ENST00000358047	T	0.18174	2.23	1.03	-0.238	0.13055	.	.	.	.	.	T	0.10680	0.0261	L	0.49126	1.545	0.20563	N	0.999884	P	0.41041	0.736	B	0.31812	0.136	T	0.23154	-1.0196	9	0.27785	T	0.31	.	3.8702	0.09033	0.3709:0.0:0.6291:0.0	.	217	Q5HY64	FA47C_HUMAN	S	217	ENSP00000367913:T217S	ENSP00000367913:T217S	T	+	1	0	FAM47C	36937053	0.005000	0.15991	0.020000	0.16555	0.021000	0.10359	0.120000	0.15647	0.245000	0.21373	0.242000	0.17961	ACT	-	NULL		0.662	FAM47C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM47C	protein_coding	OTTHUMT00000060508.1	A	NM_001013736	-		37027132	+1	no_errors	ENST00000358047	ensembl	human	known	74_37	missense	SNP	0.964	T
VCAM1	7412	genome.wustl.edu	37	1	101200244	101200244	+	Missense_Mutation	SNP	T	T	C			TCGA-MB-A5Y9-01A-11D-A29N-09	TCGA-MB-A5Y9-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	055a030d-bb19-4224-98bf-cb860ff64b9d	109e7716-d7ac-4834-a63d-f88057eb4e6c	g.chr1:101200244T>C	ENST00000294728.2	+	8	2080	c.1979T>C	c.(1978-1980)tTg>tCg	p.L660S	VCAM1_ENST00000370115.1_Missense_Mutation_p.L461S|VCAM1_ENST00000370119.4_Missense_Mutation_p.L598S|VCAM1_ENST00000347652.2_Missense_Mutation_p.L568S	NM_001078.3	NP_001069.1	P19320	VCAM1_HUMAN	vascular cell adhesion molecule 1	660	Ig-like C2-type 7.				acute inflammatory response (GO:0002526)|aging (GO:0007568)|amine metabolic process (GO:0009308)|B cell differentiation (GO:0030183)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell-matrix adhesion (GO:0007160)|cellular response to glucose stimulus (GO:0071333)|cellular response to tumor necrosis factor (GO:0071356)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|chorio-allantoic fusion (GO:0060710)|chronic inflammatory response (GO:0002544)|cytokine-mediated signaling pathway (GO:0019221)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|heterophilic cell-cell adhesion (GO:0007157)|interferon-gamma-mediated signaling pathway (GO:0060333)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte tethering or rolling (GO:0050901)|membrane to membrane docking (GO:0022614)|oxidation-reduction process (GO:0055114)|positive regulation of T cell proliferation (GO:0042102)|regulation of immune response (GO:0050776)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|response to lipopolysaccharide (GO:0032496)|response to nicotine (GO:0035094)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|viral process (GO:0016032)	alpha9-beta1 integrin-vascular cell adhesion molecule-1 complex (GO:0071065)|apical part of cell (GO:0045177)|cell surface (GO:0009986)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|podosome (GO:0002102)|sarcolemma (GO:0042383)	cell adhesion molecule binding (GO:0050839)|integrin binding (GO:0005178)|primary amine oxidase activity (GO:0008131)			central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|liver(1)|lung(27)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	56		all_epithelial(167;3.83e-06)|all_lung(203;0.000485)|Lung NSC(277;0.0011)		Epithelial(280;0.0227)|all cancers(265;0.0276)|COAD - Colon adenocarcinoma(174;0.149)|Colorectal(144;0.169)|Lung(183;0.196)	Carvedilol(DB01136)	AAGGCCCAGTTGAAGGATGCG	0.383																																																	0								ENSG00000162692						95.0	98.0	97.0					1																	101200244		2203	4300	6503	VCAM1	SO:0001583	missense	0			-	HGNC	M60335	CCDS773.1, CCDS774.1, CCDS55617.1	1p32-p31	2014-01-30			ENSG00000162692	ENSG00000162692		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Endogenous ligands"""	12663	protein-coding gene	gene with protein product		192225					Standard	NM_080682		Approved	CD106	uc001dti.3	P19320	OTTHUMG00000010982	ENST00000294728.2:c.1979T>C	1.37:g.101200244T>C	ENSP00000294728:p.Leu660Ser	Somatic	0	31	0.00		0.5001677347163723	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	28	15.15	A8K6R7|B4DKS4|E9PDD1|Q6NUP8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Ig_C2-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like_dom,prints_VCAM-1,prints_ICAM_VCAM_N	p.L660S	ENST00000294728.2	37	c.1979	CCDS773.1	1	.	.	.	.	.	.	.	.	.	.	T	12.06	1.823844	0.32237	.	.	ENSG00000162692	ENST00000370119;ENST00000347652;ENST00000294728;ENST00000370115	T;T;T;T	0.36699	1.24;1.24;1.24;1.24	5.77	5.77	0.91146	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.688925	0.13976	N	0.349812	T	0.33673	0.0871	L	0.56340	1.77	0.09310	N	1	D;D;D	0.76494	0.999;0.991;0.987	D;D;P	0.72075	0.976;0.974;0.887	T	0.15122	-1.0448	10	0.08837	T	0.75	-10.5976	10.9509	0.47327	0.0:0.0728:0.0:0.9272	.	598;568;660	E9PDD1;P19320-2;P19320	.;.;VCAM1_HUMAN	S	598;568;660;461	ENSP00000359137:L598S;ENSP00000304611:L568S;ENSP00000294728:L660S;ENSP00000359133:L461S	ENSP00000294728:L660S	L	+	2	0	VCAM1	100972832	0.002000	0.14202	0.651000	0.29564	0.041000	0.13682	0.891000	0.28309	2.326000	0.78906	0.533000	0.62120	TTG	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.383	VCAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VCAM1	protein_coding	OTTHUMT00000030213.1	T	NM_001078	-		101200244	+1	no_errors	ENST00000294728	ensembl	human	known	74_37	missense	SNP	0.325	C
SFXN5	94097	genome.wustl.edu	37	2	73200502	73200502	+	Intron	SNP	G	G	T			TCGA-MB-A5Y9-01A-11D-A29N-09	TCGA-MB-A5Y9-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	055a030d-bb19-4224-98bf-cb860ff64b9d	109e7716-d7ac-4834-a63d-f88057eb4e6c	g.chr2:73200502G>T	ENST00000272433.2	-	11	756				SFXN5_ENST00000410065.1_Intron|SFXN5_ENST00000474528.1_Intron	NM_144579.2	NP_653180.1	Q8TD22	SFXN5_HUMAN	sideroflexin 5						iron ion homeostasis (GO:0055072)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	cation transmembrane transporter activity (GO:0008324)|citrate transmembrane transporter activity (GO:0015137)			breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(1)|ovary(2)|prostate(1)	9						atttggccatgtttgagggca	0.587											OREG0014706	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000144040																																			SFXN5	SO:0001627	intron_variant	0			-	HGNC	AY044437	CCDS1922.1	2p13	2008-05-21			ENSG00000144040	ENSG00000144040		"""Sideroflexins"""	16073	protein-coding gene	gene with protein product		615572				12039050, 12150972	Standard	XM_005264648		Approved	BBG-TCC	uc002siq.3	Q8TD22	OTTHUMG00000129775	ENST00000272433.2:c.626-1688C>A	2.37:g.73200502G>T		Somatic	0	47	0.00	1143	0.5001677347163723	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	35	10.26	A8K116|Q494Y3|Q53T29	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000272433.2	37	NULL	CCDS1922.1	2																																																																																			-	-		0.587	SFXN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SFXN5	protein_coding	OTTHUMT00000251991.1	G	NM_144579	-		73200502	-1	no_errors	ENST00000416579	ensembl	human	known	74_37	rna	SNP	0.000	T
TTC6	319089	genome.wustl.edu	37	14	38208169	38208169	+	Silent	SNP	C	C	T			TCGA-MB-A5Y9-01A-11D-A29N-09	TCGA-MB-A5Y9-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	055a030d-bb19-4224-98bf-cb860ff64b9d	109e7716-d7ac-4834-a63d-f88057eb4e6c	g.chr14:38208169C>T	ENST00000553443.1	+	10	2172	c.2172C>T	c.(2170-2172)atC>atT	p.I724I				Q86TZ1	TTC6_HUMAN	tetratricopeptide repeat domain 6	0										central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|skin(1)|stomach(1)|urinary_tract(1)	14	Hepatocellular(127;0.213)|Esophageal squamous(585;0.22)		Lung(238;1.59e-06)|LUAD - Lung adenocarcinoma(48;2.48e-05)|Epithelial(34;0.0543)|all cancers(34;0.108)|BRCA - Breast invasive adenocarcinoma(188;0.156)|LUSC - Lung squamous cell carcinoma(13;0.176)	GBM - Glioblastoma multiforme(112;0.00551)		TAGATGACATCTTTGATAACA	0.363																																																	0								ENSG00000139865																																			TTC6	SO:0001819	synonymous_variant	0			-	HGNC	BC014342		14q13.1	2013-01-10			ENSG00000139865	ENSG00000139865		"""Tetratricopeptide (TTC) repeat domain containing"""	19739	protein-coding gene	gene with protein product			"""non-protein coding RNA 291"", ""chromosome 14 open reading frame 25"""	NCRNA00291, C14orf25			Standard	XM_006709976		Approved		uc001wuj.3	Q86TZ1	OTTHUMG00000157369	ENST00000553443.1:c.2172C>T	14.37:g.38208169C>T		Somatic	0	28	0.00		0.5001677347163723	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	60	21.05	Q3SY88|Q96CE6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_TPR_1,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.I724	ENST00000553443.1	37	c.2172		14																																																																																			-	NULL		0.363	TTC6-001	NOVEL	basic|appris_principal|exp_conf	protein_coding	TTC6	protein_coding	OTTHUMT00000348620.4	C	XM_002343299	-		38208169	+1	no_errors	ENST00000553443	ensembl	human	novel	74_37	silent	SNP	0.000	T
RBPMS2	348093	genome.wustl.edu	37	15	65033426	65033426	+	Frame_Shift_Del	DEL	A	A	-			TCGA-MB-A5Y9-01A-11D-A29N-09	TCGA-MB-A5Y9-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	055a030d-bb19-4224-98bf-cb860ff64b9d	109e7716-d7ac-4834-a63d-f88057eb4e6c	g.chr15:65033426delA	ENST00000300069.4	-	7	850	c.583delT	c.(583-585)tccfs	p.S196fs	RBPMS2_ENST00000560606.1_Frame_Shift_Del_p.S85fs	NM_194272.1	NP_919248.1	Q6ZRY4	RBPS2_HUMAN	RNA binding protein with multiple splicing 2	196							nucleic acid binding (GO:0003676)|nucleotide binding (GO:0000166)			breast(1)|large_intestine(3)|lung(3)|prostate(1)	8						GTGTCAGAGGAAGGGTACCAG	0.572																																																	0								ENSG00000166831						81.0	62.0	68.0					15																	65033426		2200	4299	6499	RBPMS2	SO:0001589	frameshift_variant	0				HGNC	AY369207	CCDS32271.1	15q22.31	2014-05-15			ENSG00000166831	ENSG00000166831		"""RNA binding motif (RRM) containing"""	19098	protein-coding gene	gene with protein product							Standard	NM_194272		Approved		uc002anq.3	Q6ZRY4	OTTHUMG00000172423	ENST00000300069.4:c.583delT	15.37:g.65033426delA	ENSP00000300069:p.Ser196fs	Somatic	0	22	0.00		0.5001677347163723	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	19	9.52	A2RRG0	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.S195fs	ENST00000300069.4	37	c.583	CCDS32271.1	15																																																																																			-	NULL		0.572	RBPMS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBPMS2	protein_coding	OTTHUMT00000418466.1	A				65033426	-1	no_errors	ENST00000300069	ensembl	human	known	74_37	frame_shift_del	DEL	0.997	-
TBC1D4	9882	genome.wustl.edu	37	13	75930351	75930351	+	Missense_Mutation	SNP	G	G	A	rs377252828		TCGA-MB-A5Y9-01A-11D-A29N-09	TCGA-MB-A5Y9-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	055a030d-bb19-4224-98bf-cb860ff64b9d	109e7716-d7ac-4834-a63d-f88057eb4e6c	g.chr13:75930351G>A	ENST00000377636.3	-	4	1553	c.1207C>T	c.(1207-1209)Cgg>Tgg	p.R403W	TBC1D4_ENST00000377625.2_Missense_Mutation_p.R403W|TBC1D4_ENST00000431480.2_Missense_Mutation_p.R403W|TBC1D4_ENST00000425511.1_5'UTR	NM_014832.2	NP_055647.2	O60343	TBCD4_HUMAN	TBC1 domain family, member 4	403	PID 2. {ECO:0000255|PROSITE- ProRule:PRU00148}.				cellular response to insulin stimulus (GO:0032869)|membrane organization (GO:0061024)|negative regulation of vesicle fusion (GO:0031339)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)	Rab GTPase activator activity (GO:0005097)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(12)|lung(18)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Prostate(6;0.014)|Breast(118;0.0982)		GBM - Glioblastoma multiforme(99;0.0116)		GGAGACTCCCGGCAGATAAAG	0.413																																																	0								ENSG00000136111	G	TRP/ARG	0,3824		0,0,1912	62.0	60.0	60.0		1207	6.1	1.0	13		60	4,8270		0,4,4133	no	missense	TBC1D4	NM_014832.2	101	0,4,6045	AA,AG,GG		0.0483,0.0,0.0331	probably-damaging	403/1299	75930351	4,12094	1912	4137	6049	TBC1D4	SO:0001583	missense	0			-	HGNC	AB011175	CCDS41901.1, CCDS66563.1, CCDS66564.1	13q22.2	2013-07-09			ENSG00000136111	ENSG00000136111			19165	protein-coding gene	gene with protein product	"""Akt substrate of 160 kDa"""	612465				11829485, 11994271, 15304337	Standard	XM_005266603		Approved	KIAA0603, AS160, DKFZp779C0666	uc001vjl.1	O60343	OTTHUMG00000017088	ENST00000377636.3:c.1207C>T	13.37:g.75930351G>A	ENSP00000366863:p.Arg403Trp	Somatic	0	29	0.00		0.5001677347163723	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	13	27.78	A7E2X8|B4DU25|B4E235|B6ETN8|B6ETN9|Q5W0B9|Q68D14	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Rab-GTPase-TBC_dom,pfam_DUF3350,pfam_PTB/PI_dom,superfamily_Rab-GTPase-TBC_dom,smart_PTB/PI_dom,smart_Rab-GTPase-TBC_dom,pfscan_PTB/PI_dom,pfscan_Rab-GTPase-TBC_dom	p.R403W	ENST00000377636.3	37	c.1207	CCDS41901.1	13	.	.	.	.	.	.	.	.	.	.	G	35	5.508306	0.96386	0.0	4.83E-4	ENSG00000136111	ENST00000377636;ENST00000431480;ENST00000377625	T;T;T	0.18960	2.18;2.18;2.18	6.06	6.06	0.98353	Phosphotyrosine interaction domain (3);Pleckstrin homology-type (1);	0.000000	0.64402	D	0.000010	T	0.51160	0.1658	M	0.75615	2.305	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.47315	-0.9127	10	0.87932	D	0	-29.2539	20.6397	0.99537	0.0:0.0:1.0:0.0	.	403;403;403	O60343-2;O60343-3;O60343	.;.;TBCD4_HUMAN	W	403	ENSP00000366863:R403W;ENSP00000395986:R403W;ENSP00000366852:R403W	ENSP00000366852:R403W	R	-	1	2	TBC1D4	74828352	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.584000	0.74057	2.880000	0.98712	0.650000	0.86243	CGG	-	pfam_PTB/PI_dom,smart_PTB/PI_dom,pfscan_PTB/PI_dom		0.413	TBC1D4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D4	protein_coding	OTTHUMT00000045283.1	G	NM_014832	-		75930351	-1	no_errors	ENST00000377636	ensembl	human	known	74_37	missense	SNP	1.000	A
ADAM33	80332	genome.wustl.edu	37	20	3650540	3650541	+	Intron	INS	-	-	CACCACC	rs17513846|rs201776286	byFrequency	TCGA-MB-A5Y9-01A-11D-A29N-09	TCGA-MB-A5Y9-10A-01D-A29N-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	055a030d-bb19-4224-98bf-cb860ff64b9d	109e7716-d7ac-4834-a63d-f88057eb4e6c	g.chr20:3650540_3650541insCACCACC	ENST00000356518.2	-	20	2482				ADAM33_ENST00000350009.2_Intron|ADAM33_ENST00000379861.4_Intron|ADAM33_ENST00000466620.1_Intron	NM_025220.2	NP_079496.1	Q9BZ11	ADA33_HUMAN	ADAM metallopeptidase domain 33						proteolysis (GO:0006508)	integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(17)|ovary(1)|skin(3)	29						CCAGGCTCTGACAGCAGCCTGG	0.599														4162	0.83107	0.9236	0.7695	5008	,	,		18177	0.6438		0.8738	False		,,,				2504	0.8988																0								ENSG00000149451																																			ADAM33	SO:0001627	intron_variant	0				HGNC	AL117415, AB055891	CCDS13058.1, CCDS63219.1	20p13	2010-04-06	2005-08-18		ENSG00000149451	ENSG00000149451		"""ADAM metallopeptidase domain containing"""	15478	protein-coding gene	gene with protein product		607114	"""a disintegrin and metalloproteinase domain 33"", ""chromosome 20 open reading frame 153"""	C20orf153		11814695	Standard	XM_005260843		Approved	DKFZp434K0521, dJ964F7.1	uc002wit.3	Q9BZ11	OTTHUMG00000031758	ENST00000356518.2:c.2241-256->GGTGGTG	20.37:g.3650540_3650541insCACCACC		Somatic	NA	NA	NA		0.5001677347163723	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A0A1K6|Q5JT75|Q5JT76|Q8N0W6	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000356518.2	37	NULL	CCDS13058.1	20																																																																																			-	-		0.599	ADAM33-001	KNOWN	basic|CCDS	protein_coding	ADAM33	protein_coding	OTTHUMT00000077763.2	-	NM_025220			3650541	-1	no_errors	ENST00000483362	ensembl	human	known	74_37	rna	INS	0.000:0.000	CACCACC
OR2T2	401992	genome.wustl.edu	37	1	248616790	248616790	+	Missense_Mutation	SNP	C	C	T			TCGA-MB-A5Y9-01A-11D-A29N-09	TCGA-MB-A5Y9-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	055a030d-bb19-4224-98bf-cb860ff64b9d	109e7716-d7ac-4834-a63d-f88057eb4e6c	g.chr1:248616790C>T	ENST00000342927.3	+	1	714	c.692C>T	c.(691-693)tCt>tTt	p.S231F		NM_001004136.1	NP_001004136.1	Q6IF00	OR2T2_HUMAN	olfactory receptor, family 2, subfamily T, member 2	231						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(21)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	37	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			AGGATGAACTCTGCTGAGGGC	0.557																																																	0								ENSG00000196240						87.0	63.0	71.0					1																	248616790		2189	4261	6450	OR2T2	SO:0001583	missense	0			-	HGNC	BK004462	CCDS31116.1	1q44	2012-08-09	2002-11-13	2002-11-15	ENSG00000196240	ENSG00000196240		"""GPCR / Class A : Olfactory receptors"""	14725	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily T, member 2 pseudogene"""	OR2T2P		14983052	Standard	NM_001004136		Approved		uc001iek.1	Q6IF00	OTTHUMG00000040480	ENST00000342927.3:c.692C>T	1.37:g.248616790C>T	ENSP00000343062:p.Ser231Phe	Somatic	0	32	0.00		0.5001677347163723	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	27	20.59	B2RNM1|B9EH01	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S231F	ENST00000342927.3	37	c.692	CCDS31116.1	1	.	.	.	.	.	.	.	.	.	.	c	10.57	1.388383	0.25118	.	.	ENSG00000196240	ENST00000342927	T	0.00340	8.04	3.33	3.33	0.38152	GPCR, rhodopsin-like superfamily (1);	0.145157	0.32258	N	0.006350	T	0.01222	0.0040	H	0.95437	3.67	0.31853	N	0.621979	D	0.89917	1.0	D	0.91635	0.999	T	0.01914	-1.1248	10	0.87932	D	0	.	13.6086	0.62063	0.0:1.0:0.0:0.0	.	231	Q6IF00	OR2T2_HUMAN	F	231	ENSP00000343062:S231F	ENSP00000343062:S231F	S	+	2	0	OR2T2	246683413	0.000000	0.05858	0.291000	0.24904	0.013000	0.08279	0.358000	0.20216	1.682000	0.51000	0.298000	0.19748	TCT	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM		0.557	OR2T2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T2	protein_coding	OTTHUMT00000097421.1	C	NM_001004136	-		248616790	+1	no_errors	ENST00000342927	ensembl	human	known	74_37	missense	SNP	0.734	T
PRKCB	5579	genome.wustl.edu	37	16	24202517	24202517	+	Missense_Mutation	SNP	G	G	A	rs563116744		TCGA-MB-A5Y9-01A-11D-A29N-09	TCGA-MB-A5Y9-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	055a030d-bb19-4224-98bf-cb860ff64b9d	109e7716-d7ac-4834-a63d-f88057eb4e6c	g.chr16:24202517G>A	ENST00000321728.7	+	16	2004	c.1829G>A	c.(1828-1830)cGc>cAc	p.R610H	PRKCB_ENST00000303531.7_Missense_Mutation_p.R610H	NM_212535.2	NP_997700.1	P05771	KPCB_HUMAN	protein kinase C, beta	610	AGC-kinase C-terminal.				apoptotic process (GO:0006915)|B cell activation (GO:0042113)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|cellular calcium ion homeostasis (GO:0006874)|cellular response to carbohydrate stimulus (GO:0071322)|histone H3-T6 phosphorylation (GO:0035408)|intracellular signal transduction (GO:0035556)|lipoprotein transport (GO:0042953)|negative regulation of glucose transport (GO:0010829)|negative regulation of insulin receptor signaling pathway (GO:0046627)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of B cell receptor signaling pathway (GO:0050861)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|chromatin binding (GO:0003682)|histone binding (GO:0042393)|histone kinase activity (H3-T6 specific) (GO:0035403)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein kinase C activity (GO:0004697)|protein kinase C binding (GO:0005080)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)	p.R610H(2)		central_nervous_system(3)|large_intestine(1)|lung(2)|ovary(3)	9					Tamoxifen(DB00675)|Vitamin E(DB00163)	AAACTTGAACGCAAAGAGATC	0.478													G|||	1	0.000199681	0.0	0.0	5008	,	,		18802	0.0		0.0	False		,,,				2504	0.001																2	Substitution - Missense(2)	large_intestine(2)						ENSG00000166501						120.0	122.0	122.0					16																	24202517		2197	4300	6497	PRKCB	SO:0001583	missense	0			-	HGNC	M13975	CCDS10618.1, CCDS10619.1	16p12	2009-07-10	2008-08-18	2008-08-18	ENSG00000166501	ENSG00000166501	2.7.11.1		9395	protein-coding gene	gene with protein product		176970	"""protein kinase C, beta 1"""	PRKCB2, PKCB, PRKCB1		3658678	Standard	NM_002738		Approved		uc002dme.3	P05771	OTTHUMG00000131615	ENST00000321728.7:c.1829G>A	16.37:g.24202517G>A	ENSP00000318315:p.Arg610His	Somatic	0	45	0.00		0.5001677347163723	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	29	14.71	C5IFJ8|D3DWF5|O43744|P05127|Q15138|Q93060|Q9UE49|Q9UE50|Q9UEH8|Q9UJ30|Q9UJ33	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_C2_dom,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_C2_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_C2_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pirsf_Protein_kinase_C_a/b/g,pfscan_C2_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_dom,prints_DAG/PE-bd,prints_C2_dom	p.R610H	ENST00000321728.7	37	c.1829	CCDS10618.1	16	.	.	.	.	.	.	.	.	.	.	G	18.05	3.536078	0.64972	.	.	ENSG00000166501	ENST00000321728;ENST00000303531	T;T	0.54071	0.59;0.59	5.79	5.79	0.91817	AGC-kinase, C-terminal (2);Protein kinase-like domain (1);	0.124523	0.56097	D	0.000028	T	0.42787	0.1218	L	0.31207	0.915	0.42943	D	0.994353	B;B	0.21225	0.053;0.031	B;B	0.14578	0.011;0.005	T	0.24154	-1.0168	10	0.18710	T	0.47	.	18.5987	0.91239	0.0:0.0:1.0:0.0	.	610;610	P05771-2;P05771	.;KPCB_HUMAN	H	610	ENSP00000318315:R610H;ENSP00000305355:R610H	ENSP00000305355:R610H	R	+	2	0	PRKCB	24110018	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.857000	0.48349	2.744000	0.94065	0.650000	0.86243	CGC	-	superfamily_Kinase-like_dom,smart_AGC-kinase_C,pirsf_Protein_kinase_C_a/b/g		0.478	PRKCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKCB	protein_coding	OTTHUMT00000254504.2	G	NM_212535	-		24202517	+1	no_errors	ENST00000303531	ensembl	human	known	74_37	missense	SNP	1.000	A
TLL1	7092	genome.wustl.edu	37	4	166914025	166914025	+	Missense_Mutation	SNP	G	G	A			TCGA-MB-A5Y9-01A-11D-A29N-09	TCGA-MB-A5Y9-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	055a030d-bb19-4224-98bf-cb860ff64b9d	109e7716-d7ac-4834-a63d-f88057eb4e6c	g.chr4:166914025G>A	ENST00000061240.2	+	3	997	c.350G>A	c.(349-351)aGa>aAa	p.R117K	TLL1_ENST00000513213.1_Missense_Mutation_p.R117K|TLL1_ENST00000507499.1_Missense_Mutation_p.R117K	NM_012464.4	NP_036596.3	O43897	TLL1_HUMAN	tolloid-like 1	117					cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(21)|lung(26)|ovary(2)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	77	all_hematologic(180;0.221)	Melanoma(52;0.0315)|Prostate(90;0.0405)		GBM - Glioblastoma multiforme(119;0.103)		AGGATAAGAAGAATTGGCTTT	0.368																																																	0								ENSG00000038295						103.0	102.0	102.0					4																	166914025		2203	4299	6502	TLL1	SO:0001583	missense	0			-	HGNC	AF282732	CCDS3811.1, CCDS56342.1	4q32-q33	2008-07-29			ENSG00000038295	ENSG00000038295			11843	protein-coding gene	gene with protein product		606742				10516436	Standard	NM_012464		Approved		uc003irh.2	O43897	OTTHUMG00000161112	ENST00000061240.2:c.350G>A	4.37:g.166914025G>A	ENSP00000061240:p.Arg117Lys	Somatic	0	43	0.00		0.5001677347163723	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	33	23.26	B2RMU2|Q96AN3|Q9NQS4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_CUB_dom,pfam_Peptidase_M12A,pfam_EGF-like_Ca-bd_dom,superfamily_CUB_dom,smart_Peptidase_Metallo,smart_CUB_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pirsf_BMP_1/tolloid-like,pfscan_CUB_dom,pfscan_EG-like_dom,prints_Peptidase_M12A	p.R117K	ENST00000061240.2	37	c.350	CCDS3811.1	4	.	.	.	.	.	.	.	.	.	.	G	15.91	2.972970	0.53614	.	.	ENSG00000038295	ENST00000061240;ENST00000507499;ENST00000513213;ENST00000506144	T;T;T;T	0.79454	0.54;0.48;0.4;-1.27	5.52	5.52	0.82312	.	0.057900	0.64402	U	0.000005	T	0.62575	0.2439	L	0.28274	0.84	0.47659	D	0.999483	B;B	0.09022	0.001;0.002	B;B	0.06405	0.001;0.002	T	0.57004	-0.7885	10	0.05833	T	0.94	.	13.698	0.62591	0.0738:0.0:0.9262:0.0	.	117;117	E9PD25;O43897	.;TLL1_HUMAN	K	117;117;117;17	ENSP00000061240:R117K;ENSP00000426082:R117K;ENSP00000422937:R117K;ENSP00000423748:R17K	ENSP00000061240:R117K	R	+	2	0	TLL1	167133475	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	6.679000	0.74513	2.599000	0.87857	0.563000	0.77884	AGA	-	pirsf_BMP_1/tolloid-like		0.368	TLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLL1	protein_coding	OTTHUMT00000363821.1	G		-		166914025	+1	no_errors	ENST00000061240	ensembl	human	known	74_37	missense	SNP	1.000	A
TMCO5B	100652857	genome.wustl.edu	37	15	33529018	33529025	+	RNA	DEL	GAGAGAGA	GAGAGAGA	-	rs547206613|rs372383914|rs374648277|rs56028951	byFrequency	TCGA-MB-A5Y9-01A-11D-A29N-09	TCGA-MB-A5Y9-10A-01D-A29N-09	GAGAGAGA	GAGAGAGA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	055a030d-bb19-4224-98bf-cb860ff64b9d	109e7716-d7ac-4834-a63d-f88057eb4e6c	g.chr15:33529018_33529025delGAGAGAGA	ENST00000529696.1	-	0	295_302							A8MYB1	TMC5B_HUMAN	transmembrane and coiled-coil domains 5B, pseudogene							integral component of membrane (GO:0016021)											AAAGAGgagggagagagagagagagaga	0.466																																																	0								ENSG00000215296																																			TMCO5B			0				HGNC			15q13.3	2013-09-26	2010-09-29		ENSG00000215296	ENSG00000215296			34243	pseudogene	pseudogene			"""transmembrane and coiled-coil domains 5B"""				Standard	NR_046005		Approved		uc031qri.1	A8MYB1	OTTHUMG00000167569		15.37:g.33529026_33529033delGAGAGAGA		Somatic	NA	NA	NA		0.5001677347163723	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000529696.1	37	NULL		15																																																																																			-	-		0.466	TMCO5B-001	KNOWN	basic	processed_transcript	TMCO5B	pseudogene	OTTHUMT00000395082.1	GAGAGAGA				33529025	-1	no_errors	ENST00000529696	ensembl	human	known	74_37	rna	DEL	0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000	-
RP11-402P6.11	0	genome.wustl.edu	37	X	70979259	70979260	+	lincRNA	INS	-	-	GC	rs201976710|rs199772875		TCGA-MB-A5Y9-01A-11D-A29N-09	TCGA-MB-A5Y9-10A-01D-A29N-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	055a030d-bb19-4224-98bf-cb860ff64b9d	109e7716-d7ac-4834-a63d-f88057eb4e6c	g.chrX:70979259_70979260insGC	ENST00000439926.1	-	0	440				BX276092.1_ENST00000408757.1_RNA																							cgtgcacatgtgcgcgcgcgcg	0.564																																																	0								ENSG00000221684																																			BX276092.1			0				Clone_based_ensembl_gene																													X.37:g.70979268_70979269dupGC		Somatic	0	9	0.00		0.5001677347163723	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	10	37.50		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000439926.1	37	NULL		X																																																																																			-	-		0.564	RP11-402P6.11-001	KNOWN	basic	lincRNA	ENSG00000221684	lincRNA	OTTHUMT00000057168.1	-				70979260	-1	no_errors	ENST00000408757	ensembl	human	novel	74_37	rna	INS	0.000:0.000	GC
C9orf152	401546	genome.wustl.edu	37	9	112963433	112963433	+	Missense_Mutation	SNP	A	A	T			TCGA-MB-A5Y9-01A-11D-A29N-09	TCGA-MB-A5Y9-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	055a030d-bb19-4224-98bf-cb860ff64b9d	109e7716-d7ac-4834-a63d-f88057eb4e6c	g.chr9:112963433A>T	ENST00000400613.4	-	2	1124	c.515T>A	c.(514-516)aTc>aAc	p.I172N	C9orf152_ENST00000473442.1_Intron	NM_001012993.2	NP_001013011.2	Q5JTZ5	CI152_HUMAN	chromosome 9 open reading frame 152	172										NS(1)|endometrium(1)|large_intestine(1)|lung(1)|skin(1)|stomach(1)	6						AGCCTCTGGGATTCCGGTTCC	0.493																																																	0								ENSG00000188959						170.0	156.0	161.0					9																	112963433		2203	4300	6503	C9orf152	SO:0001583	missense	0			-	HGNC	BX648620	CCDS35102.2	9q31.3	2012-04-03			ENSG00000188959	ENSG00000188959			31455	protein-coding gene	gene with protein product							Standard	NM_001012993		Approved	bA470J20.2	uc011lwk.2	Q5JTZ5	OTTHUMG00000020478	ENST00000400613.4:c.515T>A	9.37:g.112963433A>T	ENSP00000383456:p.Ile172Asn	Somatic	0	40	0.00		0.5001677347163723	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	40	11.11	A8MWT6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.I172N	ENST00000400613.4	37	c.515	CCDS35102.2	9	.	.	.	.	.	.	.	.	.	.	A	10.26	1.300182	0.23650	.	.	ENSG00000188959	ENST00000400613	.	.	.	4.32	-2.28	0.06826	.	1.222500	0.05776	N	0.607715	T	0.24890	0.0604	N	0.17082	0.46	0.09310	N	1	B	0.11235	0.004	B	0.12156	0.007	T	0.26573	-1.0099	9	0.51188	T	0.08	0.3381	4.9001	0.13769	0.4796:0.0:0.3774:0.143	.	172	Q5JTZ5	CI152_HUMAN	N	172	.	ENSP00000383456:I172N	I	-	2	0	C9orf152	112003254	0.000000	0.05858	0.000000	0.03702	0.016000	0.09150	-0.187000	0.09656	-0.400000	0.07656	0.533000	0.62120	ATC	-	NULL		0.493	C9orf152-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf152	protein_coding	OTTHUMT00000053602.2	A	NM_001012993	-		112963433	-1	no_errors	ENST00000400613	ensembl	human	known	74_37	missense	SNP	0.001	T
MT-ND2	4536	genome.wustl.edu	37	M	2301	2301	+	5'Flank	SNP	T	T	C			TCGA-MB-A5Y9-01A-11D-A29N-09	TCGA-MB-A5Y9-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	055a030d-bb19-4224-98bf-cb860ff64b9d	109e7716-d7ac-4834-a63d-f88057eb4e6c	g.chrM:2301T>C	ENST00000361453.3	+	0	0				MT-TQ_ENST00000387372.1_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-TF_ENST00000387314.1_RNA|MT-TV_ENST00000387342.1_RNA|MT-RNR1_ENST00000389680.2_RNA|MT-TL1_ENST00000386347.1_RNA|MT-TM_ENST00000387377.1_RNA|MT-ND1_ENST00000361390.2_5'Flank|MT-TI_ENST00000387365.1_RNA			P03891	NU2M_HUMAN	mitochondrially encoded NADH dehydrogenase 2						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|reactive oxygen species metabolic process (GO:0072593)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|lung(1)	3						GAAGAACTAATGTTAGTATAA	0.388																																																	0								ENSG00000210082																																			MT-RNR2	SO:0001631	upstream_gene_variant	0			-	HGNC			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198763	ENSG00000198763	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7456	protein-coding gene	gene with protein product	"""complex I ND2 subunit"", ""NADH-ubiquinone oxidoreductase chain 2"""	516001	"""NADH dehydrogenase 2"""	MTND2			Standard			Approved	ND2, NAD2		P03891			M.37:g.2301T>C	Exception_encountered	Somatic	0	51	0.00		0.5001677347163723	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	47	20.34	Q34769|Q9TGI0|Q9TGI1|Q9TGI2|Q9TGI3|Q9TGI4	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000361453.3	37	NULL		MT																																																																																			-	-		0.388	MT-ND2-201	KNOWN	basic|appris_principal	protein_coding	MT-RNR2	protein_coding		T	YP_003024027	-		2301	+1	no_errors	ENST00000387347	ensembl	human	known	74_37	rna	SNP	NULL	C
SNRNP40	9410	genome.wustl.edu	37	1	31732603	31732603	+	3'UTR	DEL	A	A	-	rs59591825		TCGA-MB-A5Y9-01A-11D-A29N-09	TCGA-MB-A5Y9-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	055a030d-bb19-4224-98bf-cb860ff64b9d	109e7716-d7ac-4834-a63d-f88057eb4e6c	g.chr1:31732603delA	ENST00000263694.4	-	0	1408				SNRNP40_ENST00000373720.3_3'UTR|SNRNP40_ENST00000489853.1_5'UTR	NM_004814.2	NP_004805.2	Q96DI7	SNR40_HUMAN	small nuclear ribonucleoprotein 40kDa (U5)						gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|small nucleolar ribonucleoprotein complex (GO:0005732)|U5 snRNP (GO:0005682)	poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|large_intestine(1)|lung(3)|upper_aerodigestive_tract(1)	7						AGCCAGTTACAAAAAAAAAAA	0.299																																																	0								ENSG00000060688																																			SNRNP40	SO:0001624	3_prime_UTR_variant	0				HGNC	AF090988	CCDS340.1	1p35.2	2013-01-09	2008-10-29	2008-10-29	ENSG00000060688	ENSG00000060688		"""WD repeat domain containing"""	30857	protein-coding gene	gene with protein product		607797	"""WD repeat domain 57 (U5 snRNP specific)"""	WDR57		9774689, 9731529, 10788320	Standard	NM_004814		Approved	PRP8BP, SPF38, PRPF8BP, HPRP8BP	uc009vtt.3	Q96DI7	OTTHUMG00000003790	ENST00000263694.4:c.*316T>-	1.37:g.31732603delA		Somatic	0	14	0.00		0.5001677347163723	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	19	24.00	B4DQJ1|O75938|O95320	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000263694.4	37	NULL	CCDS340.1	1																																																																																			-	-		0.299	SNRNP40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNRNP40	protein_coding	OTTHUMT00000010657.1	A	NM_004814			31732603	-1	no_errors	ENST00000486941	ensembl	human	known	74_37	rna	DEL	0.000	-
RIMS2	9699	genome.wustl.edu	37	8	104863873	104863878	+	Intron	DEL	ACACAC	ACACAC	-	rs56306101|rs10529078|rs369439768|rs59712615	byFrequency	TCGA-MB-A5Y9-01A-11D-A29N-09	TCGA-MB-A5Y9-10A-01D-A29N-09	ACACAC	ACACAC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	055a030d-bb19-4224-98bf-cb860ff64b9d	109e7716-d7ac-4834-a63d-f88057eb4e6c	g.chr8:104863873_104863878delACACAC	ENST00000507740.1	+	1	358				RIMS2_ENST00000522174.1_Intron|AP001572.1_ENST00000401294.1_RNA|RIMS2_ENST00000406091.3_Intron|RIMS2_ENST00000262231.10_Intron	NM_014677.4	NP_055492.3	Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2						calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			AATGCTATGTacacacacacacacac	0.359										HNSCC(12;0.0054)																																							0								ENSG00000216113																																			AP001572.1	SO:0001627	intron_variant	0				Clone_based_ensembl_gene	AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000507740.1:c.122+32016ACACAC>-	8.37:g.104863879_104863884delACACAC		Somatic	NA	NA	NA		0.5001677347163723	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000507740.1	37	NULL	CCDS43761.1	8																																																																																			-	-		0.359	RIMS2-005	NOVEL	basic|CCDS	protein_coding	ENSG00000216113	protein_coding	OTTHUMT00000367215.1	ACACAC	NM_001100117			104863878	+1	no_errors	ENST00000401294	ensembl	human	novel	74_37	rna	DEL	0.000:0.000:0.000:0.000:0.000:0.000	-
CHRM5	1133	genome.wustl.edu	37	15	34355670	34355670	+	Missense_Mutation	SNP	G	G	A			TCGA-MB-A5Y9-01A-11D-A29N-09	TCGA-MB-A5Y9-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	055a030d-bb19-4224-98bf-cb860ff64b9d	109e7716-d7ac-4834-a63d-f88057eb4e6c	g.chr15:34355670G>A	ENST00000383263.5	+	3	1422	c.752G>A	c.(751-753)aGa>aAa	p.R251K	CHRM5_ENST00000557872.1_Missense_Mutation_p.R251K	NM_012125.3	NP_036257.1	P08912	ACM5_HUMAN	cholinergic receptor, muscarinic 5	251					adenylate cyclase-inhibiting G-protein coupled acetylcholine receptor signaling pathway (GO:0007197)|cell proliferation (GO:0008283)|dopamine transport (GO:0015872)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|gastric acid secretion (GO:0001696)|metabolic process (GO:0008152)|regulation of phosphatidylinositol dephosphorylation (GO:0060304)|transmission of nerve impulse (GO:0019226)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	G-protein coupled acetylcholine receptor activity (GO:0016907)|phosphatidylinositol phospholipase C activity (GO:0004435)	p.R251K(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(10)|ovary(1)|skin(1)	20		all_lung(180;1.76e-08)		all cancers(64;4.82e-17)|GBM - Glioblastoma multiforme(113;2.58e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0262)	Aclidinium(DB08897)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Aripiprazole(DB01238)|Atropine(DB00572)|Brompheniramine(DB00835)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Cryptenamine(DB00785)|Darifenacin(DB00496)|Desipramine(DB01151)|Doxepin(DB01142)|Fesoterodine(DB06702)|Homatropine Methylbromide(DB00725)|Imipramine(DB00458)|Ketamine(DB01221)|Loxapine(DB00408)|Maprotiline(DB00934)|Methotrimeprazine(DB01403)|Metixene(DB00340)|Nicardipine(DB00622)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Paroxetine(DB00715)|Pethidine(DB00454)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Scopolamine(DB00747)|Solifenacin(DB01591)|Tolterodine(DB01036)|Trihexyphenidyl(DB00376)|Trimipramine(DB00726)|Ziprasidone(DB00246)	GCTCTGTTCAGATCCTGCTTG	0.602																																																	1	Substitution - Missense(1)	lung(1)						ENSG00000184984						78.0	78.0	78.0					15																	34355670		2201	4298	6499	CHRM5	SO:0001583	missense	0			-	HGNC		CCDS10031.1	15q26	2012-08-08			ENSG00000184984	ENSG00000184984		"""Cholinergic receptors"", ""GPCR / Class A : Cholinergic receptors, muscarinic"""	1954	protein-coding gene	gene with protein product	"""acetylcholine receptor, muscarinic 5"""	118496					Standard	NM_012125		Approved		uc001zhk.1	P08912	OTTHUMG00000129369	ENST00000383263.5:c.752G>A	15.37:g.34355670G>A	ENSP00000372750:p.Arg251Lys	Somatic	0	23	0.00		0.5001677347163723	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	37	15.91	Q96RG7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_Musac_Ach_M5_rcpt,prints_Musac_Ach_rcpt,prints_GPCR_Rhodpsn	p.R251K	ENST00000383263.5	37	c.752	CCDS10031.1	15	.	.	.	.	.	.	.	.	.	.	G	0.009	-1.828724	0.00584	.	.	ENSG00000184984	ENST00000383263	T	0.61274	0.12	5.32	0.975	0.19721	GPCR, rhodopsin-like superfamily (1);	0.345212	0.29572	N	0.011763	T	0.27169	0.0666	N	0.04959	-0.14	0.09310	N	1	B	0.06786	0.001	B	0.11329	0.006	T	0.17471	-1.0368	10	0.10902	T	0.67	-1.1529	6.1003	0.20043	0.1528:0.5964:0.2507:0.0	.	251	P08912	ACM5_HUMAN	K	251	ENSP00000372750:R251K	ENSP00000372750:R251K	R	+	2	0	CHRM5	32142962	0.926000	0.31397	0.584000	0.28653	0.388000	0.30384	1.547000	0.36190	0.357000	0.24183	0.585000	0.79938	AGA	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.602	CHRM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRM5	protein_coding	OTTHUMT00000251521.2	G		-		34355670	+1	no_errors	ENST00000383263	ensembl	human	known	74_37	missense	SNP	0.040	A
CCDC64B	146439	genome.wustl.edu	37	16	3085556	3085556	+	Intron	SNP	C	C	G			TCGA-MB-A5Y9-01A-11D-A29N-09	TCGA-MB-A5Y9-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	055a030d-bb19-4224-98bf-cb860ff64b9d	109e7716-d7ac-4834-a63d-f88057eb4e6c	g.chr16:3085556C>G	ENST00000572449.1	-	2	33				RP11-473M20.5_ENST00000382225.3_RNA|CCDC64B_ENST00000389347.4_5'Flank|CCDC64B_ENST00000573514.1_5'Flank			A1A5D9	BICR2_HUMAN	coiled-coil domain containing 64B											breast(1)|endometrium(2)|large_intestine(1)	4						TGCAGCCTGACAGGGGCTCAC	0.677																																																	0								ENSG00000205890																																			RP11-473M20.5	SO:0001627	intron_variant	0			-	Clone_based_vega_gene	BC128602	CCDS45393.1	16p13.3	2008-07-04				ENSG00000162069			33584	protein-coding gene	gene with protein product							Standard	NM_001103175		Approved		uc002ctf.4	A1A5D9		ENST00000572449.1:c.30-29G>C	16.37:g.3085556C>G		Somatic	0	39	0.00		0.5001677347163723	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	47	20.00	Q658L9	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000572449.1	37	NULL	CCDS45393.1	16																																																																																			-	-		0.677	CCDC64B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC100128770	protein_coding	OTTHUMT00000436991.1	C		-		3085556	+1	no_errors	ENST00000382225	ensembl	human	known	74_37	rna	SNP	0.000	G
PABPC4L	132430	genome.wustl.edu	37	4	135121699	135121699	+	Missense_Mutation	SNP	C	C	G			TCGA-MB-A5Y9-01A-11D-A29N-09	TCGA-MB-A5Y9-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	055a030d-bb19-4224-98bf-cb860ff64b9d	109e7716-d7ac-4834-a63d-f88057eb4e6c	g.chr4:135121699C>G	ENST00000421491.3	-	2	732	c.476G>C	c.(475-477)gGa>gCa	p.G159A	PABPC4L_ENST00000529122.2_Missense_Mutation_p.G217A			P0CB38	PAB4L_HUMAN	poly(A) binding protein, cytoplasmic 4-like	159	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.						nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(1)|endometrium(2)	3						GAGTAGTTTTCCATTCATCTC	0.463																																																	0								ENSG00000254535						139.0	113.0	121.0					4																	135121699		692	1591	2283	PABPC4L	SO:0001583	missense	0			-	HGNC	AY672099		4q28.3	2013-02-12				ENSG00000254535		"""RNA binding motif (RRM) containing"""	31955	protein-coding gene	gene with protein product							Standard	NM_001114734		Approved		uc010ioe.3	P0CB38		ENST00000421491.3:c.476G>C	4.37:g.135121699C>G	ENSP00000463233:p.Gly159Ala	Somatic	0	70	0.00		0.5001677347163723	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RRM_dom,smart_RRM_dom,smart_RRM_dom_euk,pfscan_RRM_dom,tigrfam_PABP_1234	p.G217A	ENST00000421491.3	37	c.650		4																																																																																			-	pfam_RRM_dom,smart_RRM_dom_euk,smart_RRM_dom,pfscan_RRM_dom,tigrfam_PABP_1234		0.463	PABPC4L-001	KNOWN	upstream_ATG|basic|appris_principal	protein_coding	PABPC4L	protein_coding	OTTHUMT00000364399.2	C	NM_001114734	-		135121699	-1	no_errors	ENST00000529122	ensembl	human	known	74_37	missense	SNP	1.000	G
C6orf10	10665	genome.wustl.edu	37	6	32261597	32261597	+	Missense_Mutation	SNP	T	T	C			TCGA-MB-A5Y9-01A-11D-A29N-09	TCGA-MB-A5Y9-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	055a030d-bb19-4224-98bf-cb860ff64b9d	109e7716-d7ac-4834-a63d-f88057eb4e6c	g.chr6:32261597T>C	ENST00000447241.2	-	23	1025	c.853A>G	c.(853-855)Aaa>Gaa	p.K285E	C6orf10_ENST00000375015.4_Missense_Mutation_p.K284E|C6orf10_ENST00000375007.4_Missense_Mutation_p.K283E|C6orf10_ENST00000533191.1_Missense_Mutation_p.K283E|C6orf10_ENST00000527965.1_Missense_Mutation_p.K269E|C6orf10_ENST00000442822.2_Missense_Mutation_p.K276E	NM_006781.3	NP_006772.3	Q5SRN2	CF010_HUMAN	chromosome 6 open reading frame 10	285						integral component of membrane (GO:0016021)|nucleus (GO:0005634)				cervix(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(12)|ovary(1)|skin(1)	25						ATTTTGTCTTTCTCTAAATCA	0.388																																																	0								ENSG00000204296						255.0	259.0	258.0					6																	32261597		1511	2709	4220	C6orf10	SO:0001583	missense	0			-	HGNC	U60665	CCDS34422.1, CCDS69082.1, CCDS75430.1	6p21.32	2012-11-20			ENSG00000204296	ENSG00000204296			13922	protein-coding gene	gene with protein product	"""testis specific basic protein"""					10803852	Standard	XM_005248810		Approved	TSBP	uc021yvs.1	Q5SRN2	OTTHUMG00000031107	ENST00000447241.2:c.853A>G	6.37:g.32261597T>C	ENSP00000415517:p.Lys285Glu	Somatic	0	55	0.00		0.5001677347163723	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	62	12.68	A2BET1|A2BET2|A6NME2|B0S7R2|B0S7R3|E9PMB1|Q5SPI9|Q5SPJ0|Q5SPK9|Q5SPL0|Q5SRN3|Q5TG25|Q5TG26|Q8N4B6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.K285E	ENST00000447241.2	37	c.853	CCDS34422.1	6	.	.	.	.	.	.	.	.	.	.	T	17.04	3.286712	0.59867	.	.	ENSG00000204296	ENST00000442822;ENST00000447241;ENST00000375015;ENST00000533191;ENST00000527965;ENST00000375007;ENST00000375002;ENST00000305725	T;T;T;T;T;T	0.04862	3.57;3.58;3.54;3.55;3.56;3.55	3.57	-1.56	0.08532	.	.	.	.	.	T	0.07638	0.0192	L	0.59436	1.845	0.09310	N	1	B;D	0.67145	0.376;0.996	B;D	0.76071	0.084;0.987	T	0.16571	-1.0398	9	0.42905	T	0.14	-9.4327	8.7353	0.34525	0.0:0.534:0.0:0.466	.	285;276	Q5SRN2;C9J9T8	CF010_HUMAN;.	E	276;285;284;283;269;283;284;282	ENSP00000411164:K276E;ENSP00000415517:K285E;ENSP00000364155:K284E;ENSP00000431199:K283E;ENSP00000435103:K269E;ENSP00000364146:K283E	ENSP00000303292:K282E	K	-	1	0	C6orf10	32369575	0.000000	0.05858	0.000000	0.03702	0.410000	0.31052	0.044000	0.13992	-0.282000	0.09128	0.455000	0.32223	AAA	-	NULL		0.388	C6orf10-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C6orf10	protein_coding	OTTHUMT00000076178.4	T	NM_006781	-		32261597	-1	no_errors	ENST00000447241	ensembl	human	known	74_37	missense	SNP	0.001	C
ZNF488	118738	genome.wustl.edu	37	10	48370980	48370980	+	Missense_Mutation	SNP	G	G	A	rs202233826		TCGA-MB-A5Y9-01A-11D-A29N-09	TCGA-MB-A5Y9-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	055a030d-bb19-4224-98bf-cb860ff64b9d	109e7716-d7ac-4834-a63d-f88057eb4e6c	g.chr10:48370980G>A	ENST00000395702.2	+	2	675	c.448G>A	c.(448-450)Gtg>Atg	p.V150M	ZNF488_ENST00000586537.1_Missense_Mutation_p.V43M|ZNF488_ENST00000494156.1_3'UTR			Q96MN9	ZN488_HUMAN	zinc finger protein 488	150					negative regulation of transcription, DNA-templated (GO:0045892)|oligodendrocyte development (GO:0014003)|positive regulation of oligodendrocyte differentiation (GO:0048714)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(7)|ovary(2)	14						AGTCTTCTCTGTGTGGCCCAG	0.612																																																	0								ENSG00000165388						51.0	51.0	51.0					10																	48370980		2203	4300	6503	ZNF488	SO:0001583	missense	0			-	HGNC	AK056666	CCDS73120.1	10q11.22	2014-04-10			ENSG00000165388	ENSG00000265763		"""Zinc fingers, C2H2-type"""	23535	protein-coding gene	gene with protein product							Standard	NM_153034		Approved	FLJ32104	uc001jex.3	Q96MN9	OTTHUMG00000188322	ENST00000395702.2:c.448G>A	10.37:g.48370980G>A	ENSP00000379054:p.Val150Met	Somatic	0	33	0.00		0.5001677347163723	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	31	11.43	Q05CE0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.V150M	ENST00000395702.2	37	c.448	CCDS7217.1	10	.	.	.	.	.	.	.	.	.	.	g	17.04	3.286154	0.59867	.	.	ENSG00000165388	ENST00000395702	T	0.28895	1.59	5.54	2.69	0.31865	.	1.014320	0.07905	N	0.973381	T	0.29321	0.0730	L	0.48642	1.525	0.19945	N	0.999947	P	0.43431	0.807	B	0.39217	0.294	T	0.18053	-1.0349	10	0.72032	D	0.01	.	9.8122	0.40831	0.2219:0.0:0.7781:0.0	.	150	Q96MN9	ZN488_HUMAN	M	150	ENSP00000379054:V150M	ENSP00000379054:V150M	V	+	1	0	ZNF488	47990986	0.747000	0.28283	0.010000	0.14722	0.585000	0.36419	3.198000	0.51035	0.302000	0.22762	0.556000	0.70494	GTG	-	NULL		0.612	ZNF488-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF488	protein_coding	OTTHUMT00000314632.1	G	NM_153034	-		48370980	+1	no_errors	ENST00000395702	ensembl	human	known	74_37	missense	SNP	0.801	A
