#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
DNA2	1763	genome.wustl.edu	37	10	70176522	70176522	+	Missense_Mutation	SNP	G	G	T			TCGA-MB-A8JK-01A-11D-A36J-09	TCGA-MB-A8JK-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	307db8e1-7146-4506-b618-eba5076a6860	9be6e5e2-2506-4a0a-9cb7-a0fcb5e7834a	g.chr10:70176522G>T	ENST00000358410.3	-	20	3108	c.3058C>A	c.(3058-3060)Cta>Ata	p.L1020I	DNA2_ENST00000399180.2_Missense_Mutation_p.L1106I|DNA2_ENST00000399179.2_Missense_Mutation_p.L782I	NM_001080449.2	NP_001073918.2	P51530	DNA2_HUMAN	DNA replication helicase/nuclease 2	1020	Helicase activity. {ECO:0000250}.				ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing (GO:0000729)|DNA duplex unwinding (GO:0032508)|DNA replication (GO:0006260)|DNA replication checkpoint (GO:0000076)|DNA replication, Okazaki fragment processing (GO:0033567)|DNA replication, removal of RNA primer (GO:0043137)|DNA strand elongation involved in DNA replication (GO:0006271)|mitochondrial DNA repair (GO:0043504)|mitochondrial DNA replication (GO:0006264)|mitotic cell cycle (GO:0000278)|positive regulation of DNA replication (GO:0045740)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	mitochondrial nucleoid (GO:0042645)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|5'-3' DNA helicase activity (GO:0043139)|5'-flap endonuclease activity (GO:0017108)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|nuclease activity (GO:0004518)|single-stranded DNA-dependent ATPase activity (GO:0043142)|site-specific endodeoxyribonuclease activity, specific for altered base (GO:0016890)			breast(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(7)|prostate(1)	20						TAGCAATTTAGTGAGGGCACA	0.373																																																	0								ENSG00000138346						99.0	97.0	97.0					10																	70176522		1831	4092	5923	DNA2	SO:0001583	missense	0			-	HGNC	D42046	CCDS44415.1, CCDS44415.2	10q21.3-q22.1	2013-05-13	2013-05-13	2008-01-08	ENSG00000138346	ENSG00000138346			2939	protein-coding gene	gene with protein product		601810	"""DNA2 DNA replication helicase 2-like (yeast)"", ""DNA replication helicase 2 homolog (yeast)"""	DNA2L		8938459, 17032657, 23352259	Standard	NM_001080449		Approved	KIAA0083	uc031pvh.1	P51530	OTTHUMG00000018352	ENST00000358410.3:c.3058C>A	10.37:g.70176522G>T	ENSP00000351185:p.Leu1020Ile	Somatic	0	57	0.00		0.5423643324612125	6	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	31	11.43	Q2NKM1|Q5TC49|Q5TC50|Q6P455|Q6PI80|Q7Z6H9|Q8N346	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DNA_replication_fac_Dna2_N,superfamily_P-loop_NTPase	p.L1106I	ENST00000358410.3	37	c.3316		10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.57|17.57	3.422138|3.422138	0.62622|0.62622	.|.	.|.	ENSG00000138346|ENSG00000138346	ENST00000551118;ENST00000399180;ENST00000399179;ENST00000358410|ENST00000440722	D;D;D|.	0.83250|.	-1.7;-1.7;-1.7|.	5.08|5.08	-0.0613|-0.0613	0.13785|0.13785	.|.	0.160698|.	0.42172|.	D|.	0.000760|.	T|T	0.39172|0.39172	0.1068|0.1068	L|L	0.55990|0.55990	1.75|1.75	0.21627|0.21627	N|N	0.999613|0.999613	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.85130|.	0.986;0.997|.	T|T	0.32981|0.32981	-0.9886|-0.9886	10|5	0.49607|.	T|.	0.09|.	.|.	6.0611|6.0611	0.19839|0.19839	0.2687:0.0:0.6103:0.121|0.2687:0.0:0.6103:0.121	.|.	782;1020|.	F8VR31;P51530|.	.;DNA2L_HUMAN|.	I|N	782;1106;782;1020|341	ENSP00000382133:L1106I;ENSP00000382132:L782I;ENSP00000351185:L1020I|.	ENSP00000351185:L1020I|.	L|T	-|-	1|2	2|0	DNA2|DNA2	69846528|69846528	1.000000|1.000000	0.71417|0.71417	0.142000|0.142000	0.22268|0.22268	0.933000|0.933000	0.57130|0.57130	3.141000|3.141000	0.50593|0.50593	-0.300000|-0.300000	0.08895|0.08895	-0.822000|-0.822000	0.03109|0.03109	CTA|ACT	-	NULL		0.373	DNA2-001	KNOWN	basic|appris_principal	protein_coding	DNA2	protein_coding	OTTHUMT00000048334.2	G		-		70176522	-1	no_errors	ENST00000399180	ensembl	human	known	74_37	missense	SNP	0.734	T
GGCX	2677	genome.wustl.edu	37	2	85781577	85781578	+	Intron	INS	-	-	TTGTTGTTG	rs376988482|rs112936952|rs72370006|rs60769490	byFrequency	TCGA-MB-A8JK-01A-11D-A36J-09	TCGA-MB-A8JK-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	307db8e1-7146-4506-b618-eba5076a6860	9be6e5e2-2506-4a0a-9cb7-a0fcb5e7834a	g.chr2:85781577_85781578insTTGTTGTTG	ENST00000233838.4	-	7	806				GGCX_ENST00000473665.1_5'UTR|GGCX_ENST00000430215.3_Intron	NM_000821.5	NP_000812.2	P38435	VKGC_HUMAN	gamma-glutamyl carboxylase						blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|peptidyl-glutamic acid carboxylation (GO:0017187)|post-translational protein modification (GO:0043687)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	gamma-glutamyl carboxylase activity (GO:0008488)			endometrium(3)|large_intestine(5)|lung(3)|ovary(1)|stomach(1)|urinary_tract(2)	15					Anisindione(DB01125)|Coagulation Factor IX(DB00100)|Coagulation factor VIIa(DB00036)|Drotrecogin alfa(DB00055)|Menadione(DB00170)|Phylloquinone(DB01022)	CTCTAGgttgtttgttgttgtt	0.465														546	0.109026	0.1067	0.1369	5008	,	,		23095	0.0179		0.2366	False		,,,				2504	0.0552																0								ENSG00000115486																																			GGCX	SO:0001627	intron_variant	0				HGNC		CCDS1978.1, CCDS46353.1	2p12	2008-05-21			ENSG00000115486	ENSG00000115486			4247	protein-coding gene	gene with protein product	"""vitamin K-dependent gamma-carboxylase"""	137167				1749935	Standard	NM_000821		Approved	VKCFD1	uc002sps.3	P38435	OTTHUMG00000130173	ENST00000233838.4:c.726-148->CAACAACAA	2.37:g.85781578_85781586dupTTGTTGTTG		Somatic	NA	NA	NA		0.5423643324612125	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B4DMC5|E9PEE1|Q14415|Q6GU45	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000233838.4	37	NULL	CCDS1978.1	2																																																																																			-	-		0.465	GGCX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GGCX	protein_coding	OTTHUMT00000252490.3	-	NM_000821			85781578	-1	no_errors	ENST00000473665	ensembl	human	known	74_37	rna	INS	0.009:0.012	TTGTTGTTG
FAM92B	339145	genome.wustl.edu	37	16	85132846	85132846	+	Missense_Mutation	SNP	G	G	A			TCGA-MB-A8JK-01A-11D-A36J-09	TCGA-MB-A8JK-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	307db8e1-7146-4506-b618-eba5076a6860	9be6e5e2-2506-4a0a-9cb7-a0fcb5e7834a	g.chr16:85132846G>A	ENST00000539556.1	-	9	1015	c.860C>T	c.(859-861)gCc>gTc	p.A287V		NM_198491.1	NP_940893.1	Q6ZTR7	FA92B_HUMAN	family with sequence similarity 92, member B	287										breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)	16						CACACAGTGGGCTGGCTGCCC	0.527																																																	0								ENSG00000153789						129.0	104.0	112.0					16																	85132846		2198	4300	6498	FAM92B	SO:0001583	missense	0			-	HGNC		CCDS32500.1	16q24.1	2005-09-22				ENSG00000153789			24781	protein-coding gene	gene with protein product						12477932	Standard	NM_198491		Approved	FLJ44299	uc021tlz.1	Q6ZTR7		ENST00000539556.1:c.860C>T	16.37:g.85132846G>A	ENSP00000443411:p.Ala287Val	Somatic	0	54	0.00		0.5423643324612125	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	34	10.53		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_FAM92	p.A287V	ENST00000539556.1	37	c.860	CCDS32500.1	16	.	.	.	.	.	.	.	.	.	.	G	8.699	0.909168	0.17833	.	.	ENSG00000153789	ENST00000393246;ENST00000539556	T	0.35605	1.3	1.22	0.226	0.15353	.	7.699220	0.00550	N	0.000250	T	0.20455	0.0492	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.26573	-1.0099	10	0.87932	D	0	3.1778	3.4321	0.07432	0.2795:0.0:0.7205:0.0	.	287	Q6ZTR7	FA92B_HUMAN	V	287	ENSP00000443411:A287V	ENSP00000376937:A287V	A	-	2	0	FAM92B	83690347	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.435000	0.21510	0.103000	0.17682	0.491000	0.48974	GCC	-	NULL		0.527	FAM92B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM92B	protein_coding		G	NM_198491	-		85132846	-1	no_errors	ENST00000539556	ensembl	human	known	74_37	missense	SNP	0.000	A
HUWE1	10075	genome.wustl.edu	37	X	53589091	53589093	+	In_Frame_Del	DEL	TCC	TCC	-			TCGA-MB-A8JK-01A-11D-A36J-09	TCGA-MB-A8JK-10A-01D-A36M-09	TCC	TCC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	307db8e1-7146-4506-b618-eba5076a6860	9be6e5e2-2506-4a0a-9cb7-a0fcb5e7834a	g.chrX:53589091_53589093delTCC	ENST00000342160.3	-	53	7774_7776	c.7317_7319delGGA	c.(7315-7320)gaggaa>gaa	p.2439_2440EE>E	HUWE1_ENST00000262854.6_In_Frame_Del_p.2439_2440EE>E			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	2439	Asp-rich.|Glu-rich.				base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						ttcctcatcttcctcctcctcct	0.532														3	0.000794702	0.0	0.0029	3775	,	,		17096	0.001		0.0	False		,,,				2504	0.0																0								ENSG00000086758																																			HUWE1	SO:0001651	inframe_deletion	0				HGNC	AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.7317_7319delGGA	X.37:g.53589100_53589102delTCC	ENSP00000340648:p.Glu2440del	Somatic	0	27	0.00		0.5423643324612125	74	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	20	13.04	O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_E3_Ub_ligase_DUF913,pfam_HECT,pfam_E3_Ub_ligase_DUF908,pfam_WWE-dom,pfam_UBA/Ts_N,superfamily_HECT,superfamily_UBA-like,superfamily_ARM-type_fold,smart_UBA/transl_elong_EF1B_N_euk,smart_HECT,pfscan_HECT,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_WWE-dom	p.E2440in_frame_del	ENST00000342160.3	37	c.7319_7317	CCDS35301.1	X																																																																																			-	NULL		0.532	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HUWE1	protein_coding	OTTHUMT00000056766.1	TCC	XM_497119			53589093	-1	no_errors	ENST00000262854	ensembl	human	known	74_37	in_frame_del	DEL	1.000:1.000:1.000	-
SLC31A2	1318	genome.wustl.edu	37	9	115923976	115923976	+	Silent	SNP	C	C	T			TCGA-MB-A8JK-01A-11D-A36J-09	TCGA-MB-A8JK-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	307db8e1-7146-4506-b618-eba5076a6860	9be6e5e2-2506-4a0a-9cb7-a0fcb5e7834a	g.chr9:115923976C>T	ENST00000259392.3	+	3	394	c.261C>T	c.(259-261)caC>caT	p.H87H		NM_001860.2	NP_001851.1	O15432	COPT2_HUMAN	solute carrier family 31 (copper transporter), member 2	87					cellular copper ion homeostasis (GO:0006878)|copper ion transport (GO:0006825)|regulation of copper ion transmembrane transport (GO:1902311)	integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|recycling endosome (GO:0055037)	copper ion transmembrane transporter activity (GO:0005375)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|stomach(1)|upper_aerodigestive_tract(1)	7					Carboplatin(DB00958)|Cisplatin(DB00515)	GAACCCACCACAGGTACAGGC	0.572																																																	0								ENSG00000136867						64.0	64.0	64.0					9																	115923976		2042	4196	6238	SLC31A2	SO:0001819	synonymous_variant	0			-	HGNC		CCDS6788.1	9q32	2013-07-17	2013-07-17		ENSG00000136867	ENSG00000136867		"""Solute carriers"""	11017	protein-coding gene	gene with protein product	"""copper transporter 2"""	603088		COPT2		9207117	Standard	NM_001860		Approved	hCTR2, CTR2	uc004bgq.3	O15432	OTTHUMG00000021037	ENST00000259392.3:c.261C>T	9.37:g.115923976C>T		Somatic	0	45	0.00		0.5423643324612125	24	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	41	8.89		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Cop_transporter	p.H87	ENST00000259392.3	37	c.261	CCDS6788.1	9																																																																																			-	pfam_Cop_transporter		0.572	SLC31A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC31A2	protein_coding	OTTHUMT00000055509.2	C	NM_001860	-		115923976	+1	no_errors	ENST00000259392	ensembl	human	known	74_37	silent	SNP	0.980	T
LINC01317	104355287	genome.wustl.edu	37	2	33952223	33952223	+	lincRNA	SNP	G	G	T			TCGA-MB-A8JK-01A-11D-A36J-09	TCGA-MB-A8JK-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	307db8e1-7146-4506-b618-eba5076a6860	9be6e5e2-2506-4a0a-9cb7-a0fcb5e7834a	g.chr2:33952223G>T	ENST00000366209.2	+	0	68				MYADML_ENST00000474610.1_RNA																							CACAAGGTAGGGGTTTCTGTC	0.592																																																	0								ENSG00000239649																																			MYADML			0			-	HGNC																													2.37:g.33952223G>T		Somatic	0	43	0.00		0.5423643324612125	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	33	19.51		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000366209.2	37	NULL		2																																																																																			-	-		0.592	AC009499.1-002	KNOWN	non_canonical_polymorphism|basic	lincRNA	MYADML	lincRNA	OTTHUMT00000325406.1	G		-		33952223	-1	no_errors	ENST00000474610	ensembl	human	known	74_37	rna	SNP	0.001	T
LOC388882	388882	genome.wustl.edu	37	22	23825282	23825282	+	lincRNA	SNP	C	C	T			TCGA-MB-A8JK-01A-11D-A36J-09	TCGA-MB-A8JK-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	307db8e1-7146-4506-b618-eba5076a6860	9be6e5e2-2506-4a0a-9cb7-a0fcb5e7834a	g.chr22:23825282C>T	ENST00000320372.9	-	0	133																											GCTCCCTTTTCACACGCTTTT	0.438																																																	0								ENSG00000178248																																			AP000345.1			0			-	Clone_based_vega_gene																													22.37:g.23825282C>T		Somatic	1	313	0.32		0.5423643324612125	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	70	249	21.94		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000320372.9	37	NULL		22																																																																																			-	-		0.438	AP000345.1-001	KNOWN	basic	lincRNA	LOC388882	lincRNA	OTTHUMT00000319544.1	C		-		23825282	-1	no_errors	ENST00000320372	ensembl	human	known	74_37	rna	SNP	0.000	T
COX7A2L	9167	genome.wustl.edu	37	2	42578275	42578275	+	3'UTR	DEL	A	A	-			TCGA-MB-A8JK-01A-11D-A36J-09	TCGA-MB-A8JK-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	307db8e1-7146-4506-b618-eba5076a6860	9be6e5e2-2506-4a0a-9cb7-a0fcb5e7834a	g.chr2:42578275delA	ENST00000378669.1	-	0	1258				COX7A2L_ENST00000234301.2_3'UTR|COX7A2L_ENST00000482463.1_5'UTR			O14548	COX7R_HUMAN	cytochrome c oxidase subunit VIIa polypeptide 2 like						cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain (GO:0005746)	cytochrome-c oxidase activity (GO:0004129)			lung(4)	4						CCATCCAAGtaaaaaaaaaaa	0.323																																																	0								ENSG00000115944																																			COX7A2L	SO:0001624	3_prime_UTR_variant	0				HGNC	AB007618	CCDS1808.1	2p21	2010-06-14			ENSG00000115944	ENSG00000115944			2289	protein-coding gene	gene with protein product		605771				9418891	Standard	NM_004718		Approved	EB1, COX7RP, COX7AR, SIG81	uc002rsk.3	O14548	OTTHUMG00000128605	ENST00000378669.1:c.*84T>-	2.37:g.42578275delA		Somatic	0	39	0.00		0.5423643324612125	295	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	31	13.89	Q9P118	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000378669.1	37	NULL	CCDS1808.1	2																																																																																			-	-		0.323	COX7A2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COX7A2L	protein_coding	OTTHUMT00000250466.3	A	NM_004718			42578275	-1	no_errors	ENST00000482463	ensembl	human	known	74_37	rna	DEL	0.000	-
F2	2147	genome.wustl.edu	37	11	46744808	46744808	+	Missense_Mutation	SNP	G	G	T			TCGA-MB-A8JK-01A-11D-A36J-09	TCGA-MB-A8JK-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	307db8e1-7146-4506-b618-eba5076a6860	9be6e5e2-2506-4a0a-9cb7-a0fcb5e7834a	g.chr11:46744808G>T	ENST00000311907.5	+	5	451	c.395G>T	c.(394-396)tGg>tTg	p.W132L	F2_ENST00000530231.1_Missense_Mutation_p.W132L	NM_000506.3	NP_000497.1	P00734	THRB_HUMAN	coagulation factor II (thrombin)	132	Kringle 1. {ECO:0000255|PROSITE- ProRule:PRU00121}.				acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell surface receptor signaling pathway (GO:0007166)|cellular protein metabolic process (GO:0044267)|cytosolic calcium ion homeostasis (GO:0051480)|fibrinolysis (GO:0042730)|leukocyte migration (GO:0050900)|multicellular organismal development (GO:0007275)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of platelet activation (GO:0010544)|negative regulation of proteolysis (GO:0045861)|peptidyl-glutamic acid carboxylation (GO:0017187)|platelet activation (GO:0030168)|positive regulation of blood coagulation (GO:0030194)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C-activating G-protein coupled receptor signaling pathway (GO:1900738)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)|regulation of blood coagulation (GO:0030193)|regulation of cell shape (GO:0008360)|response to wounding (GO:0009611)	blood microparticle (GO:0072562)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|growth factor activity (GO:0008083)|receptor binding (GO:0005102)|serine-type endopeptidase activity (GO:0004252)|thrombospondin receptor activity (GO:0070053)			endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|ovary(3)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)	27		all_lung(304;0.000414)|Lung NSC(402;0.0011)		BRCA - Breast invasive adenocarcinoma(625;0.146)	Antihemophilic Factor(DB00025)|Argatroban(DB00278)|ART-123(DB05777)|Bivalirudin(DB00006)|Coagulation Factor IX(DB00100)|Dabigatran etexilate(DB06695)|Drotrecogin alfa(DB00055)|Lepirudin(DB00001)|Menadione(DB00170)|Proflavine(DB01123)|Suramin(DB04786)|Ximelagatran(DB04898)	TGCCAGCTATGGAGGAGTCGC	0.612																																					Esophageal Squamous(147;1147 1808 2148 38609 51144)												0								ENSG00000180210						115.0	107.0	110.0					11																	46744808		2201	4299	6500	F2	SO:0001583	missense	0			-	HGNC	M33031	CCDS31476.1	11p11.2	2013-02-28			ENSG00000180210	ENSG00000180210	3.4.21.5	"""Endogenous ligands"""	3535	protein-coding gene	gene with protein product	"""prepro-coagulation factor II"""	176930					Standard	NM_000506		Approved		uc001ndf.4	P00734	OTTHUMG00000150344	ENST00000311907.5:c.395G>T	11.37:g.46744808G>T	ENSP00000308541:p.Trp132Leu	Somatic	0	50	0.00		0.5423643324612125	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	24	14.29	B2R7F7|B4E1A7|Q4QZ40|Q53H04|Q53H06|Q69EZ7|Q7Z7P3|Q9UCA1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_S1,pfam_Kringle,pfam_Thrombin_light_chain,pfam_GLA_domain,superfamily_Trypsin-like_Pept_dom,superfamily_Kringle-like,superfamily_GLA_domain,smart_GLA_domain,smart_Kringle,smart_Peptidase_S1,pirsf_Prothrombin/thrombin,pfscan_GLA_domain,pfscan_Kringle,pfscan_Peptidase_S1,prints_Prothrombin/thrombin,prints_Peptidase_S1A,prints_GLA_domain	p.W132L	ENST00000311907.5	37	c.395	CCDS31476.1	11	.	.	.	.	.	.	.	.	.	.	G	28.4	4.918059	0.92249	.	.	ENSG00000180210	ENST00000311907;ENST00000530231;ENST00000442468	D;D;D	0.96685	-4.09;-4.09;-4.09	5.33	5.33	0.75918	Kringle (5);Kringle-like fold (1);	0.000000	0.85682	D	0.000000	D	0.99070	0.9681	H	0.98802	4.335	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99072	1.0834	10	0.87932	D	0	.	19.031	0.92957	0.0:0.0:1.0:0.0	.	132	P00734	THRB_HUMAN	L	132;132;122	ENSP00000308541:W132L;ENSP00000433907:W132L;ENSP00000387413:W122L	ENSP00000308541:W132L	W	+	2	0	F2	46701384	1.000000	0.71417	0.993000	0.49108	0.886000	0.51366	8.628000	0.90979	2.502000	0.84385	0.511000	0.50034	TGG	-	pfam_Kringle,superfamily_Kringle-like,smart_Kringle,pirsf_Prothrombin/thrombin,pfscan_Kringle		0.612	F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	F2	protein_coding	OTTHUMT00000317706.1	G		-		46744808	+1	no_errors	ENST00000311907	ensembl	human	known	74_37	missense	SNP	1.000	T
MROH7	374977	genome.wustl.edu	37	1	55118966	55118966	+	Missense_Mutation	SNP	C	C	T			TCGA-MB-A8JK-01A-11D-A36J-09	TCGA-MB-A8JK-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	307db8e1-7146-4506-b618-eba5076a6860	9be6e5e2-2506-4a0a-9cb7-a0fcb5e7834a	g.chr1:55118966C>T	ENST00000421030.2	+	3	652	c.367C>T	c.(367-369)Cca>Tca	p.P123S	MROH7_ENST00000395690.2_Missense_Mutation_p.P123S|MROH7_ENST00000545244.1_Intron|MROH7-TTC4_ENST00000414150.2_Missense_Mutation_p.P123S|MROH7_ENST00000339553.5_Missense_Mutation_p.P123S|MROH7_ENST00000454855.2_Intron|MROH7_ENST00000472987.1_3'UTR|MROH7_ENST00000409996.1_Intron	NM_001039464.2	NP_001034553	Q68CQ1	MROH7_HUMAN	maestro heat-like repeat family member 7	123						extracellular space (GO:0005615)|integral component of membrane (GO:0016021)											GCGCCTCTGTCCAGCCTCAAA	0.572																																																	0								ENSG00000271723						109.0	106.0	107.0					1																	55118966		1954	4165	6119	MROH7-TTC4	SO:0001583	missense	0			-	HGNC	AL832492	CCDS41342.2	1p32.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000184313	ENSG00000184313		"""maestro heat-like repeat containing"""	24802	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 175"", ""HEAT repeat containing 8"""	C1orf175, HEATR8		12477932	Standard	NM_001039464		Approved	FLJ46354	uc010ooe.1	Q68CQ1	OTTHUMG00000009890	ENST00000421030.2:c.367C>T	1.37:g.55118966C>T	ENSP00000396622:p.Pro123Ser	Somatic	0	44	0.00		0.5423643324612125	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	A0AUX8|Q5TA99|Q6ZP40|Q6ZRH6|Q8N311|Q8NA14	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_ARM-type_fold	p.P123S	ENST00000421030.2	37	c.367	CCDS41342.2	1	.	.	.	.	.	.	.	.	.	.	C	13.58	2.280619	0.40294	.	.	ENSG00000184313	ENST00000421030;ENST00000414867;ENST00000339553;ENST00000395690	T;T;T	0.03301	4.49;3.98;3.99	3.58	2.63	0.31362	.	0.510296	0.14798	N	0.297826	T	0.08179	0.0204	L	0.32530	0.975	0.40066	D	0.975955	D;D;D	0.69078	0.959;0.959;0.997	P;B;P	0.61874	0.654;0.362;0.895	T	0.30621	-0.9972	10	0.72032	D	0.01	.	8.8481	0.35184	0.0:0.7694:0.2306:0.0	.	123;123;123	F8W8P2;Q68CQ1;Q68CQ1-4	.;HEAT8_HUMAN;.	S	123	ENSP00000396622:P123S;ENSP00000343211:P123S;ENSP00000379044:P123S	ENSP00000343211:P123S	P	+	1	0	HEATR8	54891554	0.090000	0.21635	0.428000	0.26697	0.225000	0.24961	0.984000	0.29565	1.041000	0.40125	0.561000	0.74099	CCA	-	NULL		0.572	MROH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MROH7-TTC4	protein_coding	OTTHUMT00000346978.1	C	NM_198547	-		55118966	+1	no_errors	ENST00000414150	ensembl	human	known	74_37	missense	SNP	0.459	T
WASH3P	374666	genome.wustl.edu	37	15	102516816	102516816	+	RNA	SNP	G	G	T			TCGA-MB-A8JK-01A-11D-A36J-09	TCGA-MB-A8JK-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	307db8e1-7146-4506-b618-eba5076a6860	9be6e5e2-2506-4a0a-9cb7-a0fcb5e7834a	g.chr15:102516816G>T	ENST00000557932.1	+	0	1679				DDX11L9_ENST00000562189.1_RNA			C4AMC7	WASH3_HUMAN	WAS protein family homolog 3 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)			central_nervous_system(1)|endometrium(6)|kidney(11)|prostate(5)|stomach(1)|urinary_tract(1)	25						GGATGCAAACGTCTCGGGGTC	0.527																																																	0								ENSG00000248472																																			DDX11L9			0			-	HGNC			15q26.3	2014-03-20	2008-01-16	2008-01-16	ENSG00000185596	ENSG00000185596		"""WAS protein homologs"""	24362	pseudogene	pseudogene			"""family with sequence similarity 39, member D pseudogene"""	FAM39DP		11701968, 18159949	Standard	NR_003659		Approved	FLJ25222	uc002cdi.3	C4AMC7	OTTHUMG00000172275		15.37:g.102516816G>T		Somatic	0	13	0.00		0.5423643324612125	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	12	29.41		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000557932.1	37	NULL		15																																																																																			-	-		0.527	WASH3P-001	KNOWN	basic	processed_transcript	DDX11L9	pseudogene	OTTHUMT00000417608.1	G	NM_199163	-		102516816	-1	no_errors	ENST00000559159	ensembl	human	known	74_37	rna	SNP	0.000	T
ANKRD33B	651746	genome.wustl.edu	37	5	10638141	10638141	+	Splice_Site	SNP	G	G	A			TCGA-MB-A8JK-01A-11D-A36J-09	TCGA-MB-A8JK-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	307db8e1-7146-4506-b618-eba5076a6860	9be6e5e2-2506-4a0a-9cb7-a0fcb5e7834a	g.chr5:10638141G>A	ENST00000296657.5	+	3	498	c.498G>A	c.(496-498)ggG>ggA	p.G166G		NM_001164440.1	NP_001157912.1	A6NCL7	AN33B_HUMAN	ankyrin repeat domain 33B	166																	TCTTTACAGGGCACGCTATCA	0.498																																																	0								ENSG00000164236						124.0	104.0	110.0					5																	10638141		692	1591	2283	ANKRD33B	SO:0001630	splice_region_variant	0			-	HGNC		CCDS47191.1	5p15.2	2013-01-10			ENSG00000164236	ENSG00000164236		"""Ankyrin repeat domain containing"""	35240	protein-coding gene	gene with protein product							Standard	NM_001164440		Approved		uc021xwp.1	A6NCL7	OTTHUMG00000162050	ENST00000296657.5:c.497-1G>A	5.37:g.10638141G>A		Somatic	0	41	0.00		0.5423643324612125	2	33.33	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	24	14.29		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.G166	ENST00000296657.5	37	c.498	CCDS47191.1	5																																																																																			-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom		0.498	ANKRD33B-001	NOVEL	not_best_in_genome_evidence|basic|appris_principal|exp_conf|CCDS	protein_coding	ANKRD33B	protein_coding	OTTHUMT00000367037.3	G	XM_001130634	-	Silent	10638141	+1	no_errors	ENST00000296657	ensembl	human	novel	74_37	silent	SNP	0.835	A
ABCC2	1244	genome.wustl.edu	37	10	101578579	101578579	+	Silent	SNP	G	G	T			TCGA-MB-A8JK-01A-11D-A36J-09	TCGA-MB-A8JK-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	307db8e1-7146-4506-b618-eba5076a6860	9be6e5e2-2506-4a0a-9cb7-a0fcb5e7834a	g.chr10:101578579G>T	ENST00000370449.4	+	18	2417	c.2304G>T	c.(2302-2304)cgG>cgT	p.R768R		NM_000392.3	NP_000383	Q92887	MRP2_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 2	768	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.		R -> W (in DJS; dbSNP:rs56199535). {ECO:0000269|PubMed:10053008, ECO:0000269|PubMed:11266082, ECO:0000269|PubMed:9425227}.		cellular chloride ion homeostasis (GO:0030644)|drug transmembrane transport (GO:0006855)|prostaglandin transport (GO:0015732)|response to arsenic-containing substance (GO:0046685)|response to estrogen (GO:0043627)|response to heat (GO:0009408)|response to methotrexate (GO:0031427)|response to oxidative stress (GO:0006979)|thyroid hormone transport (GO:0070327)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)			NS(1)|breast(5)|endometrium(9)|kidney(2)|large_intestine(20)|liver(1)|lung(20)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	67		Colorectal(252;0.234)		Epithelial(162;2.77e-10)|all cancers(201;2.47e-08)	Adenosine triphosphate(DB00171)|Aminohippurate(DB00345)|Arsenic trioxide(DB01169)|Atorvastatin(DB01076)|Canagliflozin(DB08907)|Carbamazepine(DB00564)|Carboplatin(DB00958)|Cisplatin(DB00515)|Clotrimazole(DB00257)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dexamethasone(DB01234)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Eprosartan(DB00876)|Ethinyl Estradiol(DB00977)|Etoposide(DB00773)|Ezetimibe(DB00973)|Furosemide(DB00695)|Fusidic Acid(DB02703)|Gadoxetate(DB08884)|Glutathione(DB00143)|Glyburide(DB01016)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Ivermectin(DB00602)|Lamivudine(DB00709)|Leucovorin(DB00650)|Levetiracetam(DB01202)|Lomefloxacin(DB00978)|Lovastatin(DB00227)|Methotrexate(DB00563)|Mycophenolate mofetil(DB00688)|Nifedipine(DB01115)|Norgestimate(DB00957)|Ofloxacin(DB01165)|Olmesartan(DB00275)|Oxaliplatin(DB00526)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pitavastatin(DB08860)|Pranlukast(DB01411)|Pravastatin(DB00175)|Probenecid(DB01032)|Quinidine(DB00908)|Reserpine(DB00206)|Rifampicin(DB01045)|Ritonavir(DB00503)|Saquinavir(DB01232)|Simvastatin(DB00641)|Sorafenib(DB00398)|Sparfloxacin(DB01208)|Spironolactone(DB00421)|Sulfasalazine(DB00795)|Sulfinpyrazone(DB01138)|Sunitinib(DB01268)|Tamoxifen(DB00675)|Telmisartan(DB00966)|Tenofovir(DB00300)|Tetrahydrofolic acid(DB00116)|Ursodeoxycholic acid(DB01586)|Vasopressin(DB00067)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)	AGAAGCAGCGGATCAGCCTGG	0.413																																																	0								ENSG00000023839						82.0	86.0	85.0					10																	101578579		2203	4300	6503	ABCC2	SO:0001819	synonymous_variant	0			-	HGNC	U63970	CCDS7484.1	10q24	2012-03-14			ENSG00000023839	ENSG00000023839		"""ATP binding cassette transporters / subfamily C"""	53	protein-coding gene	gene with protein product		601107	"""canalicular multispecific organic anion transporter 1"""	CMOAT		8797578, 9284939	Standard	XM_006717630		Approved	DJS, MRP2, cMRP	uc001kqf.2	Q92887	OTTHUMG00000018895	ENST00000370449.4:c.2304G>T	10.37:g.101578579G>T		Somatic	0	69	0.00		0.5423643324612125	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	B2RMT8|Q14022|Q5T2B1|Q92500|Q92798|Q99663|Q9UMS2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC1_TM_dom,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom,tigrfam_Multidrug-R_assoc	p.R768	ENST00000370449.4	37	c.2304	CCDS7484.1	10																																																																																			-	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like,tigrfam_Multidrug-R_assoc		0.413	ABCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCC2	protein_coding	OTTHUMT00000049825.1	G	NM_000392	-		101578579	+1	no_errors	ENST00000370449	ensembl	human	known	74_37	silent	SNP	0.585	T
NFAT5	10725	genome.wustl.edu	37	16	69726420	69726422	+	In_Frame_Del	DEL	CAG	CAG	-	rs369235958		TCGA-MB-A8JK-01A-11D-A36J-09	TCGA-MB-A8JK-10A-01D-A36M-09	CAG	CAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	307db8e1-7146-4506-b618-eba5076a6860	9be6e5e2-2506-4a0a-9cb7-a0fcb5e7834a	g.chr16:69726420_69726422delCAG	ENST00000354436.2	+	12	2956_2958	c.2638_2640delCAG	c.(2638-2640)cagdel	p.Q888del	NFAT5_ENST00000432919.1_In_Frame_Del_p.Q906del|NFAT5_ENST00000567239.1_In_Frame_Del_p.Q905del|NFAT5_ENST00000566899.1_In_Frame_Del_p.Q812del|NFAT5_ENST00000393742.2_In_Frame_Del_p.Q812del|NFAT5_ENST00000349945.1_In_Frame_Del_p.Q812del	NM_006599.3	NP_006590.1	O94916	NFAT5_HUMAN	nuclear factor of activated T-cells 5, tonicity-responsive	888	Poly-Gln.				cytokine production (GO:0001816)|excretion (GO:0007588)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of calcineurin-NFAT signaling cascade (GO:0070884)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q804Q(1)|p.Q898Q(1)		NS(1)|breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(11)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	37						ATCTAATcaacagcagcagcagc	0.473																																																	2	Substitution - coding silent(2)	endometrium(2)						ENSG00000102908																																			NFAT5	SO:0001651	inframe_deletion	0				HGNC	AF134870	CCDS10881.1, CCDS10882.1, CCDS45519.1	16q22.1	2009-11-24			ENSG00000102908	ENSG00000102908		"""Nuclear factor of activated T-cells"""	7774	protein-coding gene	gene with protein product		604708				10377394	Standard	NM_173214		Approved	TONEBP, KIAA0827, NFATL1, OREBP, NFATZ, NF-AT5	uc002exl.2	O94916	OTTHUMG00000137572	ENST00000354436.2:c.2638_2640delCAG	16.37:g.69726429_69726431delCAG	ENSP00000346420:p.Gln888del	Somatic	0	26	0.00		0.5423643324612125	11	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	20	13.04	A2RRB4|A6H8V5|E9PHR7|O95693|Q7LA65|Q969Q8|Q96QH3|Q9UN18	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_RHD,superfamily_p53-like_TF_DNA-bd,superfamily_Ig_E-set,smart_IPT,pfscan_RHD,prints_NFAT	p.Q901in_frame_del	ENST00000354436.2	37	c.2692_2694	CCDS10881.1	16																																																																																			-	NULL		0.473	NFAT5-001	KNOWN	basic|CCDS	protein_coding	NFAT5	protein_coding	OTTHUMT00000268952.2	CAG	NM_138714			69726422	+1	no_errors	ENST00000432919	ensembl	human	known	74_37	in_frame_del	DEL	0.966:0.976:0.988	-
MASP1	5648	genome.wustl.edu	37	3	186947606	186947606	+	Silent	SNP	G	G	T			TCGA-MB-A8JK-01A-11D-A36J-09	TCGA-MB-A8JK-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	307db8e1-7146-4506-b618-eba5076a6860	9be6e5e2-2506-4a0a-9cb7-a0fcb5e7834a	g.chr3:186947606G>T	ENST00000337774.5	-	11	1772	c.1383C>A	c.(1381-1383)ccC>ccA	p.P461P		NM_001879.5	NP_001870.3	P48740	MASP1_HUMAN	mannan-binding lectin serine peptidase 1 (C4/C2 activating component of Ra-reactive factor)	461	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				complement activation (GO:0006956)|complement activation, lectin pathway (GO:0001867)|innate immune response (GO:0045087)|negative regulation of complement activation (GO:0045916)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|peptidase activity (GO:0008233)|protein homodimerization activity (GO:0042803)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|liver(2)|lung(27)|ovary(2)|pancreas(1)|prostate(3)|urinary_tract(1)	60	all_cancers(143;5.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;3.49e-18)	GBM - Glioblastoma multiforme(93;0.0366)		TGGCAATCCAGGGAGTGGTGC	0.597																																																	0								ENSG00000127241						80.0	75.0	77.0					3																	186947606		2203	4300	6503	MASP1	SO:0001819	synonymous_variant	0			-	HGNC	D28593	CCDS33907.1, CCDS33908.1, CCDS33909.1	3q27-q28	2014-09-17	2005-08-17		ENSG00000127241	ENSG00000127241		"""Serine peptidases / Serine peptidases"""	6901	protein-coding gene	gene with protein product		600521	"""mannan-binding lectin serine protease 1 (C4/C2 activating component of Ra-reactive factor)"""	CRARF, PRSS5		8018603, 8240317	Standard	NR_033519		Approved	MASP	uc003fri.3	P48740	OTTHUMG00000156461	ENST00000337774.5:c.1383C>A	3.37:g.186947606G>T		Somatic	0	68	0.00		0.5423643324612125	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	32	8.57	A8K542|A8K6M1|B4E2L7|O95570|Q68D21|Q8IUV8|Q96RS4|Q9UF09	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_S1,pfam_CUB_dom,pfam_Sushi_SCR_CCP,pfam_EGF-like_Ca-bd_dom,superfamily_Trypsin-like_Pept_dom,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_EGF-like_Ca-bd_dom,smart_Sushi_SCR_CCP,smart_Peptidase_S1,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.P461	ENST00000337774.5	37	c.1383	CCDS33907.1	3																																																																																			-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1		0.597	MASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MASP1	protein_coding	OTTHUMT00000344262.1	G	NM_001879	-		186947606	-1	no_errors	ENST00000337774	ensembl	human	known	74_37	silent	SNP	0.961	T
CEP350	9857	genome.wustl.edu	37	1	179966060	179966060	+	Silent	SNP	C	C	T			TCGA-MB-A8JK-01A-11D-A36J-09	TCGA-MB-A8JK-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	307db8e1-7146-4506-b618-eba5076a6860	9be6e5e2-2506-4a0a-9cb7-a0fcb5e7834a	g.chr1:179966060C>T	ENST00000367607.3	+	6	1186	c.768C>T	c.(766-768)gaC>gaT	p.D256D		NM_014810.4	NP_055625.4	Q5VT06	CE350_HUMAN	centrosomal protein 350kDa	256					microtubule anchoring (GO:0034453)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	66						GACTAACTGACTCTTCTCCAT	0.373																																																	0								ENSG00000135837						127.0	127.0	127.0					1																	179966060		2203	4300	6503	CEP350	SO:0001819	synonymous_variant	0			-	HGNC	AF287356	CCDS1336.1	1q25.2	2014-02-20			ENSG00000135837	ENSG00000135837			24238	protein-coding gene	gene with protein product	"""centrosome associated protein 350"""					16314388, 15615782	Standard	NM_014810		Approved	KIAA0480, CAP350	uc001gnt.3	Q5VT06	OTTHUMG00000035269	ENST00000367607.3:c.768C>T	1.37:g.179966060C>T		Somatic	0	39	0.00		0.5423643324612125	6	25.00	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	63	13.70	O75068|Q8TDK3|Q8WY20	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_CAP-Gly_domain,superfamily_CAP-Gly_domain,pfscan_CAP-Gly_domain	p.D256	ENST00000367607.3	37	c.768	CCDS1336.1	1																																																																																			-	NULL		0.373	CEP350-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP350	protein_coding	OTTHUMT00000085315.2	C	NM_014810	-		179966060	+1	no_errors	ENST00000367607	ensembl	human	known	74_37	silent	SNP	0.938	T
SH3BP1	23616	genome.wustl.edu	37	22	38046665	38046670	+	In_Frame_Del	DEL	CCGGCT	CCGGCT	-	rs565412693|rs929038	byFrequency	TCGA-MB-A8JK-01A-11D-A36J-09	TCGA-MB-A8JK-10A-01D-A36M-09	CCGGCT	CCGGCT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	307db8e1-7146-4506-b618-eba5076a6860	9be6e5e2-2506-4a0a-9cb7-a0fcb5e7834a	g.chr22:38046665_38046670delCCGGCT	ENST00000357436.4	+	16	1844_1849	c.1531_1536delCCGGCT	c.(1531-1536)ccggctdel	p.PA523del	Z83844.1_ENST00000456099.1_RNA|SH3BP1_ENST00000599616.1_In_Frame_Del_p.PA459del	NM_018957.3	NP_061830.3	Q9Y3L3	3BP1_HUMAN	SH3-domain binding protein 1	523					signal transduction (GO:0007165)	cytoplasm (GO:0005737)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(5)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	Melanoma(58;0.0574)					agccaccaccccggctccggctccgg	0.641																																																	0								ENSG00000100092			10,4250		2,6,2122						0.9	0.0			34	9,8243		0,9,4117	no	coding	SH3BP1	NM_018957.3		2,15,6239	A1A1,A1R,RR		0.1091,0.2347,0.1519				19,12493				SH3BP1	SO:0001651	inframe_deletion	0				HGNC		CCDS13952.2	22q13.1	2011-07-04			ENSG00000100092	ENSG00000100092		"""Rho GTPase activating proteins"""	10824	protein-coding gene	gene with protein product						10591208, 12029088	Standard	NM_018957		Approved	ARHGAP43	uc003ati.3	Q9Y3L3	OTTHUMG00000030996	ENST00000357436.4:c.1531_1536delCCGGCT	22.37:g.38046671_38046676delCCGGCT	ENSP00000350018:p.Pro523_Ala524del	Somatic	NA	NA	NA		0.5423643324612125	34	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q5R3N0|Q6IBZ2|Q6ZVL9|Q96HQ5|Q9NSQ9	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_RhoGAP_dom,pfam_BAR_dom,superfamily_Rho_GTPase_activation_prot,smart_BAR_dom,smart_RhoGAP_dom,pfscan_BAR_dom,pfscan_RhoGAP_dom	p.AP514in_frame_del	ENST00000357436.4	37	c.1531_1536	CCDS13952.2	22																																																																																			-	NULL		0.641	SH3BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SH3BP1	protein_coding	OTTHUMT00000075884.4	CCGGCT	NM_018957			38046670	+1	no_errors	ENST00000357436	ensembl	human	known	74_37	in_frame_del	DEL	0.131:0.094:0.000:0.000:0.001:0.005	-
CFHR2	3080	genome.wustl.edu	37	1	196876546	196876546	+	Intron	SNP	G	G	T			TCGA-MB-A8JK-01A-11D-A36J-09	TCGA-MB-A8JK-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	307db8e1-7146-4506-b618-eba5076a6860	9be6e5e2-2506-4a0a-9cb7-a0fcb5e7834a	g.chr1:196876546G>T	ENST00000367421.3	+	2	135				CFHR4_ENST00000251424.4_Intron|CFHR4_ENST00000367418.2_Intron|CFHR4_ENST00000608469.1_Intron|CFHR4_ENST00000367416.2_Missense_Mutation_p.Q238H			P36980	FHR2_HUMAN	complement factor H-related 2							extracellular region (GO:0005576)				large_intestine(2)|ovary(1)|skin(3)	6						TCGAGTACCAGTGCCAGTCCT	0.428																																																	0								ENSG00000134365																																			CFHR4	SO:0001627	intron_variant	0			-	HGNC	X64877	CCDS30959.1	1q31.3	2008-02-05	2004-08-09	2006-02-28	ENSG00000080910	ENSG00000080910		"""Complement system"""	4890	protein-coding gene	gene with protein product		600889	"""H factor (complement)-like 3"""	HFL3, CFHL2		1533657, 7672821	Standard	NM_005666		Approved	FHR2	uc001gtq.1	P36980	OTTHUMG00000036518	ENST00000367421.3:c.59-42039G>T	1.37:g.196876546G>T		Somatic	0	83	0.00		0.5423643324612125	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	39	9.30	Q14310|Q5T9T1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.Q238H	ENST00000367421.3	37	c.714		1	.	.	.	.	.	.	.	.	.	.	.	11.98	1.802069	0.31869	.	.	ENSG00000134365	ENST00000367416	T	0.65178	-0.14	3.49	-6.98	0.01611	.	.	.	.	.	T	0.64768	0.2628	L	0.56199	1.76	0.09310	N	1	P;D	0.63046	0.599;0.992	B;D	0.65573	0.261;0.936	T	0.61058	-0.7139	9	0.39692	T	0.17	.	6.2082	0.20613	0.1634:0.0:0.4979:0.3386	.	238;239	C9J7J7;Q5DVJ7	.;.	H	238	ENSP00000356386:Q238H	ENSP00000356386:Q238H	Q	+	3	2	CFHR4	195143169	0.000000	0.05858	0.015000	0.15790	0.008000	0.06430	-1.084000	0.03393	-2.153000	0.00793	-0.655000	0.03904	CAG	-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP		0.428	CFHR2-201	KNOWN	basic|appris_principal	protein_coding	CFHR4	protein_coding		G	NM_005666	-		196876546	+1	no_errors	ENST00000367416	ensembl	human	known	74_37	missense	SNP	0.006	T
NME2	4831	genome.wustl.edu	37	17	49245607	49245607	+	Missense_Mutation	SNP	C	C	G			TCGA-MB-A8JK-01A-11D-A36J-09	TCGA-MB-A8JK-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	307db8e1-7146-4506-b618-eba5076a6860	9be6e5e2-2506-4a0a-9cb7-a0fcb5e7834a	g.chr17:49245607C>G	ENST00000393193.2	+	6	553	c.476C>G	c.(475-477)tCt>tGt	p.S159C	NME2_ENST00000376392.6_Missense_Mutation_p.S159C|NME2_ENST00000555572.1_Missense_Mutation_p.S184C|NME1-NME2_ENST00000514264.2_Missense_Mutation_p.S44C|NME1-NME2_ENST00000393183.3_5'UTR|NME1-NME2_ENST00000393198.3_Missense_Mutation_p.S159C|NME1-NME2_ENST00000503064.1_Missense_Mutation_p.S44C|NME1-NME2_ENST00000608447.1_Missense_Mutation_p.S184C|NME1-NME2_ENST00000393190.1_Missense_Mutation_p.S44C|NME1-NME2_ENST00000393185.1_5'UTR|NME1-NME2_ENST00000513177.1_Missense_Mutation_p.S44C|NME1-NME2_ENST00000512737.1_Missense_Mutation_p.S44C			P22392	NDKB_HUMAN	NME/NM23 nucleoside diphosphate kinase 2	44					cell adhesion (GO:0007155)|CTP biosynthetic process (GO:0006241)|GTP biosynthetic process (GO:0006183)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of apoptotic process (GO:0043066)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleoside triphosphate biosynthetic process (GO:0009142)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of epidermis development (GO:0045682)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|UTP biosynthetic process (GO:0006228)	cell periphery (GO:0071944)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|ruffle (GO:0001726)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|nucleoside diphosphate kinase activity (GO:0004550)|protein histidine kinase activity (GO:0004673)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|kidney(1)|lung(1)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	6			BRCA - Breast invasive adenocarcinoma(22;1.54e-08)		Adefovir Dipivoxil(DB00718)|Lamivudine(DB00709)|Tenofovir(DB00300)	TGCCAGGCCTCTGAAGAACAC	0.517																																					Esophageal Squamous(49;809 1203 4404 15246)												0								ENSG00000243678						109.0	91.0	97.0					17																	49245607		2203	4300	6503	NME1-NME2	SO:0001583	missense	0			-	HGNC	X58965	CCDS11580.1, CCDS74107.1	17q21.33	2013-04-29	2012-05-18		ENSG00000011052	ENSG00000011052			7850	protein-coding gene	gene with protein product		156491	"""non-metastatic cells 2, protein (NM23B) expressed in"""			1988104, 19852809	Standard	NM_001018137		Approved	NM23-H2, NDPKB		P22392	OTTHUMG00000154062	ENST00000393193.2:c.476C>G	17.37:g.49245607C>G	ENSP00000376889:p.Ser159Cys	Somatic	0	66	0.00		0.5423643324612125	3170	19.91	790	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	93	13.89	A8MWA3|Q1WM23|Q6LCT6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Nucleoside_diP_kinase,superfamily_Nucleoside_diP_kinase,smart_Nucleoside_diP_kinase,prints_Nucleoside_diP_kinase	p.S184C	ENST00000393193.2	37	c.551	CCDS32682.1	17	.	.	.	.	.	.	.	.	.	.	c	21.4	4.147123	0.77888	.	.	ENSG00000011052;ENSG00000011052;ENSG00000011052;ENSG00000011052;ENSG00000011052;ENSG00000011052;ENSG00000011052;ENSG00000243678;ENSG00000243678	ENST00000376392;ENST00000555572;ENST00000514264;ENST00000513177;ENST00000512737;ENST00000503064;ENST00000393190;ENST00000393193;ENST00000393198	T;T;T;T;T;T;T;T	0.79845	-1.31;-1.31;-1.31;-1.31;-1.31;-1.31;-1.31;-1.31	4.81	4.81	0.61882	.	0.000000	0.64402	U	0.000002	D	0.94473	0.8221	H	0.99590	4.645	0.80722	D	1	D;D	0.89917	0.994;1.0	P;D	0.70487	0.874;0.969	D	0.97253	0.9899	10	0.87932	D	0	-12.4231	17.8748	0.88822	0.0:1.0:0.0:0.0	.	44;184	P22392;Q32Q12	NDKB_HUMAN;.	C	159;184;44;44;44;44;44;159;184	ENSP00000365572:S159C;ENSP00000451932:S184C;ENSP00000426976:S44C;ENSP00000425581:S44C;ENSP00000421064:S44C;ENSP00000426901:S44C;ENSP00000376886:S44C;ENSP00000376889:S159C	ENSP00000365572:S44C	S	+	2	0	NME2;NME1-NME2	46600606	0.991000	0.36638	0.991000	0.47740	0.969000	0.65631	3.380000	0.52448	2.374000	0.81015	0.651000	0.88453	TCT	-	pfam_Nucleoside_diP_kinase,superfamily_Nucleoside_diP_kinase,smart_Nucleoside_diP_kinase		0.517	NME2-001	KNOWN	basic|appris_candidate|readthrough_transcript|CCDS	protein_coding	NME1-NME2	protein_coding	OTTHUMT00000268664.2	C	NM_002512	-		49245607	+1	no_errors	ENST00000608447	ensembl	human	known	74_37	missense	SNP	0.999	G
C1orf52	148423	genome.wustl.edu	37	1	85725291	85725291	+	Missense_Mutation	SNP	A	A	C			TCGA-MB-A8JK-01A-11D-A36J-09	TCGA-MB-A8JK-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	307db8e1-7146-4506-b618-eba5076a6860	9be6e5e2-2506-4a0a-9cb7-a0fcb5e7834a	g.chr1:85725291A>C	ENST00000471115.1	-	1	34	c.26T>G	c.(25-27)cTg>cGg	p.L9R	C1orf52_ENST00000294661.4_5'UTR|C1orf52_ENST00000344356.5_Missense_Mutation_p.L9R	NM_198077.3	NP_932343.1	Q8N6N3	CA052_HUMAN	chromosome 1 open reading frame 52	9							poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(1)	10				all cancers(265;0.0105)|Epithelial(280;0.0293)		AAAATAGCTCAGAGGGTCCTT	0.662											OREG0013580	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000162642						16.0	14.0	15.0					1																	85725291		2202	4298	6500	C1orf52	SO:0001583	missense	0			-	HGNC	BC029538	CCDS703.1	1p22.3	2008-02-05			ENSG00000162642	ENSG00000162642			24871	protein-coding gene	gene with protein product						11891061	Standard	NM_198077		Approved	gm117, FLJ44982	uc001dkv.3	Q8N6N3	OTTHUMG00000009966	ENST00000471115.1:c.26T>G	1.37:g.85725291A>C	ENSP00000419417:p.Leu9Arg	Somatic	0	66	0.00	1239	0.5423643324612125	60	16.67	12	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	54	19.40	B3KX89|Q8TDK5|Q8TDK6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.L9R	ENST00000471115.1	37	c.26	CCDS703.1	1	.	.	.	.	.	.	.	.	.	.	A	16.75	3.209341	0.58343	.	.	ENSG00000162642	ENST00000471115;ENST00000344356	.	.	.	5.12	5.12	0.69794	.	0.073852	0.56097	D	0.000036	T	0.62925	0.2468	L	0.45581	1.43	0.53688	D	0.999977	D;D	0.76494	0.998;0.999	D;D	0.76071	0.981;0.987	T	0.65026	-0.6268	9	0.51188	T	0.08	-2.0581	15.3651	0.74516	1.0:0.0:0.0:0.0	.	9;9	Q8N6N3-2;Q8N6N3	.;CA052_HUMAN	R	9	.	ENSP00000345092:L9R	L	-	2	0	C1orf52	85497879	1.000000	0.71417	0.932000	0.37286	0.288000	0.27193	4.814000	0.62627	2.270000	0.75569	0.519000	0.50382	CTG	-	NULL		0.662	C1orf52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf52	protein_coding	OTTHUMT00000027616.2	A	NM_198077	-		85725291	-1	no_errors	ENST00000471115	ensembl	human	known	74_37	missense	SNP	0.996	C
GLE1	2733	genome.wustl.edu	37	9	131303467	131303467	+	3'UTR	SNP	C	C	T			TCGA-MB-A8JK-01A-11D-A36J-09	TCGA-MB-A8JK-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	307db8e1-7146-4506-b618-eba5076a6860	9be6e5e2-2506-4a0a-9cb7-a0fcb5e7834a	g.chr9:131303467C>T	ENST00000309971.4	+	0	2221				RNU7-171P_ENST00000459581.1_RNA|RP11-216B9.6_ENST00000434999.1_RNA|RP11-216B9.6_ENST00000426704.1_RNA|GLE1_ENST00000539582.1_3'UTR	NM_001003722.1	NP_001003722.1	Q53GS7	GLE1_HUMAN	GLE1 RNA export mediator						mRNA export from nucleus (GO:0006406)|poly(A)+ mRNA export from nucleus (GO:0016973)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|membrane (GO:0016020)|nuclear pore (GO:0005643)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|skin(2)|upper_aerodigestive_tract(1)	16						CCATCACCCACCATCACCGCT	0.453																																																	0								ENSG00000228395						86.0	81.0	83.0					9																	131303467		2203	4300	6503	RP11-216B9.6	SO:0001624	3_prime_UTR_variant	0			-	Clone_based_vega_gene	AF058922	CCDS6904.1, CCDS35154.1	9q34.13	2014-09-17	2013-06-18	2007-10-04	ENSG00000119392	ENSG00000119392			4315	protein-coding gene	gene with protein product		603371	"""GLE1 (yeast homolog)-like, RNA export mediator"", ""GLE1 RNA export mediator-like (yeast)"", ""GLE1 RNA export mediator (yeast)"", ""lethal congenital contracture syndrome 1"", ""GLE1 RNA export mediator homolog (yeast)"""	GLE1L, LCCS1		9618489, 18204449	Standard	NM_001499		Approved	hGLE1	uc004bvj.3	Q53GS7	OTTHUMG00000020749	ENST00000309971.4:c.*18C>T	9.37:g.131303467C>T		Somatic	0	45	0.00		0.5423643324612125	92	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	32	11.11	O75458|Q53GT9|Q5VVU1|Q8NCP6|Q9UFL6	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000309971.4	37	NULL	CCDS35154.1	9																																																																																			-	-		0.453	GLE1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000228395	protein_coding	OTTHUMT00000054456.1	C	NM_001003722	-		131303467	-1	no_errors	ENST00000426704	ensembl	human	known	74_37	rna	SNP	0.000	T
RASGEF1C	255426	genome.wustl.edu	37	5	179528441	179528441	+	3'UTR	SNP	G	G	A			TCGA-MB-A8JK-01A-11D-A36J-09	TCGA-MB-A8JK-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	307db8e1-7146-4506-b618-eba5076a6860	9be6e5e2-2506-4a0a-9cb7-a0fcb5e7834a	g.chr5:179528441G>A	ENST00000393371.2	-	0	1757				RASGEF1C_ENST00000522500.1_3'UTR|RASGEF1C_ENST00000361132.4_3'UTR			Q8N431	RGF1C_HUMAN	RasGEF domain family, member 1C						regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|kidney(2)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)|stomach(1)	12	all_cancers(89;3.44e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	all_cancers(40;0.0242)|Medulloblastoma(196;0.00498)|all_neural(177;0.0137)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GGCCACTGAGGCAGGGCTGTG	0.612																																																	0								ENSG00000146090						23.0	25.0	25.0					5																	179528441		692	1591	2283	RASGEF1C	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AK093160	CCDS4452.1	5q35.3	2005-08-16			ENSG00000146090	ENSG00000146090			27400	protein-coding gene	gene with protein product						12477932	Standard	XM_006714839		Approved	FLJ35841	uc003mlr.3	Q8N431	OTTHUMG00000130914	ENST00000393371.2:c.*60C>T	5.37:g.179528441G>A		Somatic	0	57	0.00		0.5423643324612125	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	23	25.00	D3DWQ7|Q7Z4T0|Q8NA49	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000393371.2	37	NULL	CCDS4452.1	5																																																																																			-	-		0.612	RASGEF1C-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RASGEF1C	protein_coding	OTTHUMT00000253506.2	G	NM_175062	-		179528441	-1	no_errors	ENST00000519456	ensembl	human	known	74_37	rna	SNP	0.918	A
ABCA6	23460	genome.wustl.edu	37	17	67079036	67079036	+	Missense_Mutation	SNP	G	G	T			TCGA-MB-A8JK-01A-11D-A36J-09	TCGA-MB-A8JK-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	307db8e1-7146-4506-b618-eba5076a6860	9be6e5e2-2506-4a0a-9cb7-a0fcb5e7834a	g.chr17:67079036G>T	ENST00000284425.2	-	36	4768	c.4594C>A	c.(4594-4596)Cca>Aca	p.P1532T	ABCA6_ENST00000446604.2_5'UTR	NM_080284.2	NP_525023.2	Q8N139	ABCA6_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 6	1532					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(6)|endometrium(5)|kidney(17)|large_intestine(18)|lung(20)|ovary(3)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	82	Breast(10;5.65e-12)					GCAGCCTGTGGGAAAAGCTTC	0.438																																																	0								ENSG00000154262						211.0	213.0	212.0					17																	67079036		2203	4300	6503	ABCA6	SO:0001583	missense	0			-	HGNC	U66680	CCDS11683.1	17q21	2012-03-14			ENSG00000154262	ENSG00000154262		"""ATP binding cassette transporters / subfamily A"""	36	protein-coding gene	gene with protein product		612504				8894702	Standard	NM_080284		Approved	EST155051	uc002jhw.1	Q8N139		ENST00000284425.2:c.4594C>A	17.37:g.67079036G>T	ENSP00000284425:p.Pro1532Thr	Somatic	0	59	0.00		0.5423643324612125	55	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	Q6NSH9|Q8N856|Q8WWZ6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.P1532T	ENST00000284425.2	37	c.4594	CCDS11683.1	17	.	.	.	.	.	.	.	.	.	.	G	22.7	4.330096	0.81690	.	.	ENSG00000154262	ENST00000284425;ENST00000446604	D	0.86627	-2.15	5.03	5.03	0.67393	.	0.000000	0.49305	D	0.000153	D	0.95114	0.8417	M	0.92604	3.325	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95842	0.8867	10	0.87932	D	0	.	17.8989	0.88897	0.0:0.0:1.0:0.0	.	1532	Q8N139	ABCA6_HUMAN	T	1532;392	ENSP00000284425:P1532T	ENSP00000284425:P1532T	P	-	1	0	ABCA6	64590631	1.000000	0.71417	1.000000	0.80357	0.820000	0.46376	8.665000	0.91144	2.787000	0.95880	0.650000	0.86243	CCA	-	NULL		0.438	ABCA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA6	protein_coding	OTTHUMT00000450463.1	G	NM_080284	-		67079036	-1	no_errors	ENST00000284425	ensembl	human	known	74_37	missense	SNP	1.000	T
CCNT2	905	genome.wustl.edu	37	2	135694493	135694493	+	Missense_Mutation	SNP	A	A	G			TCGA-MB-A8JK-01A-11D-A36J-09	TCGA-MB-A8JK-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	307db8e1-7146-4506-b618-eba5076a6860	9be6e5e2-2506-4a0a-9cb7-a0fcb5e7834a	g.chr2:135694493A>G	ENST00000264157.5	+	3	353	c.323A>G	c.(322-324)cAt>cGt	p.H108R	CCNT2_ENST00000537343.1_5'UTR|CCNT2_ENST00000295238.6_Missense_Mutation_p.H108R	NM_001241.3|NM_058241.2	NP_001232.1|NP_490595.1	O60583	CCNT2_HUMAN	cyclin T2	108					cell cycle (GO:0007049)|cell division (GO:0051301)|gene expression (GO:0010467)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)				endometrium(2)|kidney(3)|large_intestine(10)|lung(6)|ovary(2)|prostate(1)|skin(1)	25				BRCA - Breast invasive adenocarcinoma(221;0.107)		AAAGTAGCACATGCTTGTCTT	0.333																																																	0								ENSG00000082258						137.0	137.0	137.0					2																	135694493		2203	4300	6503	CCNT2	SO:0001583	missense	0			-	HGNC	AF048731	CCDS2174.1, CCDS2175.1	2q21.3	2010-11-15			ENSG00000082258	ENSG00000082258			1600	protein-coding gene	gene with protein product		603862				9499409, 10465067	Standard	NM_001241		Approved		uc002tuc.2	O60583	OTTHUMG00000131712	ENST00000264157.5:c.323A>G	2.37:g.135694493A>G	ENSP00000264157:p.His108Arg	Somatic	0	21	0.00		0.5423643324612125	10	44.44	8	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	32	36.00	A8KA48|D3DP73|D3DP74|O60582|Q29R66|Q53SR4|Q5I1Y0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cyclin_N,superfamily_Cyclin-like,smart_Cyclin-like	p.H108R	ENST00000264157.5	37	c.323	CCDS2174.1	2	.	.	.	.	.	.	.	.	.	.	A	20.1	3.935184	0.73442	.	.	ENSG00000082258	ENST00000295238;ENST00000264157	T;T	0.10668	2.85;2.85	5.39	5.39	0.77823	Cyclin, N-terminal (1);Cyclin-like (3);	0.044474	0.85682	D	0.000000	T	0.12220	0.0297	L	0.45422	1.42	0.80722	D	1	B;P	0.37914	0.422;0.611	B;B	0.36845	0.158;0.234	T	0.04041	-1.0982	10	0.42905	T	0.14	.	15.7054	0.77577	1.0:0.0:0.0:0.0	.	108;108	O60583;O60583-2	CCNT2_HUMAN;.	R	108	ENSP00000295238:H108R;ENSP00000264157:H108R	ENSP00000264157:H108R	H	+	2	0	CCNT2	135410963	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.287000	0.95975	2.163000	0.67991	0.533000	0.62120	CAT	-	pfam_Cyclin_N,superfamily_Cyclin-like,smart_Cyclin-like		0.333	CCNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCNT2	protein_coding	OTTHUMT00000254629.1	A	NM_058241	-		135694493	+1	no_errors	ENST00000264157	ensembl	human	known	74_37	missense	SNP	1.000	G
OBSCN	84033	genome.wustl.edu	37	1	228401199	228401199	+	Missense_Mutation	SNP	C	C	T			TCGA-MB-A8JK-01A-11D-A36J-09	TCGA-MB-A8JK-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	307db8e1-7146-4506-b618-eba5076a6860	9be6e5e2-2506-4a0a-9cb7-a0fcb5e7834a	g.chr1:228401199C>T	ENST00000422127.1	+	3	1090	c.1046C>T	c.(1045-1047)tCg>tTg	p.S349L	C1orf145_ENST00000295012.5_Missense_Mutation_p.D55N|OBSCN_ENST00000570156.2_Missense_Mutation_p.S349L|OBSCN_ENST00000366707.4_5'UTR|OBSCN_ENST00000366709.4_5'UTR|OBSCN_ENST00000284548.11_Missense_Mutation_p.S349L	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	349	Ig-like 4.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				GAGAAGGAGTCGGCCACGTTC	0.652																																																	0								ENSG00000154358						25.0	29.0	28.0					1																	228401199		2112	4206	6318	OBSCN	SO:0001583	missense	0			-	HGNC	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.1046C>T	1.37:g.228401199C>T	ENSP00000409493:p.Ser349Leu	Somatic	0	70	0.00		0.5423643324612125	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	34	37.04	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Fibronectin_type3,pfam_DH-domain,pfam_IQ_motif_EF-hand-BS,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_IQ_motif_EF-hand-BS,smart_DH-domain,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,pfscan_DH-domain	p.S349L	ENST00000422127.1	37	c.1046	CCDS58065.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	22.8|22.8	4.334458|4.334458	0.81801|0.81801	.|.	.|.	ENSG00000162913|ENSG00000154358	ENST00000295012|ENST00000284548;ENST00000422127	.|T;T	.|0.70164	.|-0.46;-0.46	5.47|5.47	4.55|4.55	0.56014|0.56014	.|Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.490293|.	0.15258|.	N|.	0.271964|.	T|T	0.56171|0.56171	0.1967|0.1967	L|L	0.55213|0.55213	1.73|1.73	0.80722|0.80722	D|D	1|1	.|P;P	.|0.37573	.|0.6;0.545	.|B;B	.|0.30495	.|0.116;0.071	T|T	0.55095|0.55095	-0.8194|-0.8194	7|8	0.87932|.	D|.	0|.	-15.0299|-15.0299	10.6159|10.6159	0.45449|0.45449	0.0:0.7937:0.1343:0.072|0.0:0.7937:0.1343:0.072	.|.	.|349;349	.|Q5VST9;Q5VST9-3	.|OBSCN_HUMAN;.	N|L	55|349	.|ENSP00000284548:S349L;ENSP00000409493:S349L	ENSP00000295012:D55N|.	D|S	-|+	1|2	0|0	C1orf145|OBSCN	226467822|226467822	0.976000|0.976000	0.34144|0.34144	0.932000|0.932000	0.37286|0.37286	0.976000|0.976000	0.68499|0.68499	3.237000|3.237000	0.51344|0.51344	1.282000|1.282000	0.44496|0.44496	0.655000|0.655000	0.94253|0.94253	GAC|TCG	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.652	OBSCN-204	KNOWN	basic|CCDS	protein_coding	OBSCN	protein_coding		C	NM_052843	-		228401199	+1	no_errors	ENST00000422127	ensembl	human	known	74_37	missense	SNP	0.992	T
ANKRA2	57763	genome.wustl.edu	37	5	72858439	72858439	+	Missense_Mutation	SNP	C	C	T			TCGA-MB-A8JK-01A-11D-A36J-09	TCGA-MB-A8JK-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	307db8e1-7146-4506-b618-eba5076a6860	9be6e5e2-2506-4a0a-9cb7-a0fcb5e7834a	g.chr5:72858439C>T	ENST00000296785.3	-	2	926	c.268G>A	c.(268-270)Gtg>Atg	p.V90M		NM_023039.4	NP_075526.1	Q9H9E1	ANRA2_HUMAN	ankyrin repeat, family A (RFXANK-like), 2	90						cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	low-density lipoprotein particle binding (GO:0030169)			endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|skin(1)	8		Lung NSC(167;0.0378)|Ovarian(174;0.0908)		OV - Ovarian serous cystadenocarcinoma(47;3.71e-54)		ACAGATGCCACCTCCAGGTCA	0.328																																																	0								ENSG00000164331						89.0	91.0	90.0					5																	72858439		2203	4300	6503	ANKRA2	SO:0001583	missense	0			-	HGNC	AA442702	CCDS4020.1	5q12-q13	2013-01-10			ENSG00000164331	ENSG00000164331		"""Ankyrin repeat domain containing"""	13208	protein-coding gene	gene with protein product		605787				10965114	Standard	NM_023039		Approved		uc003kcu.2	Q9H9E1	OTTHUMG00000102030	ENST00000296785.3:c.268G>A	5.37:g.72858439C>T	ENSP00000296785:p.Val90Met	Somatic	0	68	0.00		0.5423643324612125	15	25.00	5	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	62	26.19		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.V90M	ENST00000296785.3	37	c.268	CCDS4020.1	5	.	.	.	.	.	.	.	.	.	.	C	25.1	4.598861	0.87055	.	.	ENSG00000164331	ENST00000296785;ENST00000504641	T;T	0.57436	0.92;0.4	5.21	5.21	0.72293	Ankyrin repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.67401	0.2889	L	0.44542	1.39	0.80722	D	1	D;D	0.89917	1.0;0.99	D;D	0.91635	0.999;0.969	T	0.69363	-0.5165	10	0.62326	D	0.03	-15.5892	18.7735	0.91901	0.0:1.0:0.0:0.0	.	90;90	D6RBK8;Q9H9E1	.;ANRA2_HUMAN	M	90	ENSP00000296785:V90M;ENSP00000422643:V90M	ENSP00000296785:V90M	V	-	1	0	ANKRA2	72894195	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.451000	0.80668	2.426000	0.82243	0.655000	0.94253	GTG	-	NULL		0.328	ANKRA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRA2	protein_coding	OTTHUMT00000219814.2	C	NM_023039	-		72858439	-1	no_errors	ENST00000296785	ensembl	human	known	74_37	missense	SNP	1.000	T
CLDN1	9076	genome.wustl.edu	37	3	190030660	190030660	+	Splice_Site	SNP	C	C	T			TCGA-MB-A8JK-01A-11D-A36J-09	TCGA-MB-A8JK-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	307db8e1-7146-4506-b618-eba5076a6860	9be6e5e2-2506-4a0a-9cb7-a0fcb5e7834a	g.chr3:190030660C>T	ENST00000295522.3	-	2	657		c.e2+1			NM_021101.4	NP_066924.1	O95832	CLD1_HUMAN	claudin 1						calcium-independent cell-cell adhesion (GO:0016338)|cell adhesion (GO:0007155)|cell-cell junction organization (GO:0045216)|establishment of skin barrier (GO:0061436)|viral process (GO:0016032)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			lung(9)	9	all_cancers(143;2.95e-10)|Ovarian(172;0.0512)		Lung(62;2.23e-05)|LUSC - Lung squamous cell carcinoma(58;3.15e-05)	GBM - Glioblastoma multiforme(93;0.015)		GCCTCTATTACCTGCAAGAAG	0.453																																																	0								ENSG00000163347						180.0	147.0	158.0					3																	190030660		2203	4300	6503	CLDN1	SO:0001630	splice_region_variant	0			-	HGNC	AF101051	CCDS3295.1	3q28-q29	2008-07-18			ENSG00000163347	ENSG00000163347		"""Claudins"""	2032	protein-coding gene	gene with protein product	"""senescence-associated epithelial membrane protein 1"""	603718				10828592, 9892664	Standard	NM_021101		Approved	SEMP1, ILVASC	uc003fsh.3	O95832	OTTHUMG00000156214	ENST00000295522.3:c.388+1G>A	3.37:g.190030660C>T		Somatic	0	43	0.00		0.5423643324612125	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	28	12.50		Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e2+1	ENST00000295522.3	37	c.388+1	CCDS3295.1	3	.	.	.	.	.	.	.	.	.	.	C	15.62	2.887454	0.52014	.	.	ENSG00000163347	ENST00000295522;ENST00000545382	.	.	.	6.04	6.04	0.98038	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.143	0.93452	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CLDN1	191513354	1.000000	0.71417	1.000000	0.80357	0.304000	0.27724	7.543000	0.82106	2.873000	0.98535	0.561000	0.74099	.	-	-		0.453	CLDN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLDN1	protein_coding	OTTHUMT00000343516.2	C	NM_021101	-	Intron	190030660	-1	no_errors	ENST00000295522	ensembl	human	known	74_37	splice_site	SNP	1.000	T
SLC16A5	9121	genome.wustl.edu	37	17	73094219	73094219	+	Missense_Mutation	SNP	G	G	A			TCGA-MB-A8JK-01A-11D-A36J-09	TCGA-MB-A8JK-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	307db8e1-7146-4506-b618-eba5076a6860	9be6e5e2-2506-4a0a-9cb7-a0fcb5e7834a	g.chr17:73094219G>A	ENST00000450736.2	+	3	701	c.286G>A	c.(286-288)Gcc>Acc	p.A96T	SLC16A5_ENST00000585293.1_3'UTR|SLC16A5_ENST00000580123.1_Missense_Mutation_p.A96T|SLC16A5_ENST00000329783.4_Missense_Mutation_p.A96T|SLC16A5_ENST00000538213.2_Missense_Mutation_p.A136T			O15375	MOT6_HUMAN	solute carrier family 16 (monocarboxylate transporter), member 5	96					monocarboxylic acid transport (GO:0015718)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	monocarboxylic acid transmembrane transporter activity (GO:0008028)|secondary active monocarboxylate transmembrane transporter activity (GO:0015355)|symporter activity (GO:0015293)			central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(1)|large_intestine(4)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	22	all_lung(278;0.226)		LUSC - Lung squamous cell carcinoma(166;0.162)|Lung(188;0.235)		Pyruvic acid(DB00119)	GGGCATGGTGGCCAGCTCCTT	0.587																																																	0								ENSG00000170190						92.0	95.0	94.0					17																	73094219		2203	4299	6502	SLC16A5	SO:0001583	missense	0			-	HGNC	U59299	CCDS11713.1	17q25.1	2013-07-18	2013-07-18		ENSG00000170190	ENSG00000170190		"""Solute carriers"""	10926	protein-coding gene	gene with protein product		603879	"""solute carrier family 16 (monocarboxylic acid transporters), member 5"", ""solute carrier family 16, member 5 (monocarboxylic acid transporter 6)"""			9425115	Standard	NM_004695		Approved	MCT5, MCT6	uc002jmr.4	O15375	OTTHUMG00000179277	ENST00000450736.2:c.286G>A	17.37:g.73094219G>A	ENSP00000390564:p.Ala96Thr	Somatic	0	33	0.00		0.5423643324612125	19	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.16	B4E288	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Monocarb_transpt	p.A96T	ENST00000450736.2	37	c.286	CCDS11713.1	17	.	.	.	.	.	.	.	.	.	.	g	11.20	1.567494	0.28003	.	.	ENSG00000170190	ENST00000329783;ENST00000450736;ENST00000538213	T;T;T	0.40756	1.02;1.02;1.02	4.59	3.59	0.41128	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.218706	0.47455	N	0.000232	T	0.26340	0.0643	L	0.41124	1.26	0.21967	N	0.999445	B;P	0.38504	0.207;0.634	B;B	0.33121	0.101;0.158	T	0.11867	-1.0570	10	0.31617	T	0.26	.	4.4564	0.11645	0.2081:0.0:0.6031:0.1887	.	136;96	B4E288;O15375	.;MOT6_HUMAN	T	96;96;136	ENSP00000330141:A96T;ENSP00000390564:A96T;ENSP00000440212:A136T	ENSP00000330141:A96T	A	+	1	0	SLC16A5	70605814	1.000000	0.71417	0.996000	0.52242	0.590000	0.36582	1.850000	0.39328	0.853000	0.35312	0.457000	0.33378	GCC	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Monocarb_transpt		0.587	SLC16A5-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	SLC16A5	protein_coding	OTTHUMT00000445547.1	G	NM_004695	-		73094219	+1	no_errors	ENST00000329783	ensembl	human	known	74_37	missense	SNP	1.000	A
PPP1R3A	5506	genome.wustl.edu	37	7	113519017	113519017	+	Silent	SNP	G	G	A			TCGA-MB-A8JK-01A-11D-A36J-09	TCGA-MB-A8JK-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	307db8e1-7146-4506-b618-eba5076a6860	9be6e5e2-2506-4a0a-9cb7-a0fcb5e7834a	g.chr7:113519017G>A	ENST00000284601.3	-	4	2198	c.2130C>T	c.(2128-2130)tgC>tgT	p.C710C		NM_002711.3	NP_002702.2	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory subunit 3A	710					glycogen metabolic process (GO:0005977)	integral component of membrane (GO:0016021)				NS(2)|breast(8)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|liver(1)|lung(43)|ovary(10)|pancreas(7)|prostate(3)|skin(15)|stomach(1)|upper_aerodigestive_tract(2)	121						ACAGTTCACAGCACACTGTTT	0.403																																																	0								ENSG00000154415						203.0	198.0	200.0					7																	113519017		2203	4300	6503	PPP1R3A	SO:0001819	synonymous_variant	0			-	HGNC	AF024578	CCDS5759.1	7q31.1	2012-04-17	2011-10-04	2001-07-02	ENSG00000154415	ENSG00000154415	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9291	protein-coding gene	gene with protein product	"""glycogen-associated regulatory subunit of protein phosphatase-1"", ""protein phosphatase 1 regulatory subunit GM"""	600917	"""protein phosphatase 1, regulatory (inhibitor) subunit 3A (glycogen and sarcoplasmic reticulum binding subunit, skeletal muscle)"", ""protein phosphatase 1, regulatory (inhibitor) subunit 3A"""	PPP1R3		7926294	Standard	NM_002711		Approved	GM	uc010ljy.1	Q16821	OTTHUMG00000156944	ENST00000284601.3:c.2130C>T	7.37:g.113519017G>A		Somatic	0	34	0.00		0.5423643324612125	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	30	11.76	A0AVQ2|A4D0T6|O43476|Q75LN8|Q7KYM8|Q86UI6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_CBM_21,pfscan_CBM_21	p.C710	ENST00000284601.3	37	c.2130	CCDS5759.1	7																																																																																			-	NULL		0.403	PPP1R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R3A	protein_coding	OTTHUMT00000346724.1	G	NM_002711	-		113519017	-1	no_errors	ENST00000284601	ensembl	human	known	74_37	silent	SNP	0.031	A
SFT2D2	375035	genome.wustl.edu	37	1	168215941	168215941	+	3'UTR	SNP	G	G	C			TCGA-MB-A8JK-01A-11D-A36J-09	TCGA-MB-A8JK-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	307db8e1-7146-4506-b618-eba5076a6860	9be6e5e2-2506-4a0a-9cb7-a0fcb5e7834a	g.chr1:168215941G>C	ENST00000271375.4	+	0	4718				ANKRD36BP1_ENST00000358576.4_RNA	NM_199344.2	NP_955376.1			SFT2 domain containing 2											lung(3)|skin(1)	4	all_hematologic(923;0.215)					ACGATGGTATGATTCCATTTC	0.413																																																	0								ENSG00000214262																																			ANKRD36BP1	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AL035297	CCDS1271.1	1q24.2	2008-02-05			ENSG00000213064	ENSG00000213064			25140	protein-coding gene	gene with protein product							Standard	NM_199344		Approved	UNQ512, dJ747L4.C1.2	uc001gfi.4	O95562	OTTHUMG00000034650	ENST00000271375.4:c.*4163G>C	1.37:g.168215941G>C		Somatic	0	68	0.00		0.5423643324612125	39	4.76	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	103	16.26		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000271375.4	37	NULL	CCDS1271.1	1	.	.	.	.	.	.	.	.	.	.	G	10.39	1.337735	0.24253	.	.	ENSG00000214262	ENST00000358576	.	.	.	0.827	0.827	0.18835	.	.	.	.	.	T	0.33702	0.0872	.	.	.	.	.	.	.	.	.	.	.	.	T	0.25222	-1.0138	4	0.87932	D	0	.	7.4555	0.27264	0.0:0.0:1.0:0.0	.	.	.	.	D	115	.	ENSP00000351384:H115D	H	-	1	0	ANKRD36BP1	166482565	0.998000	0.40836	0.943000	0.38184	0.730000	0.41778	2.254000	0.43214	0.729000	0.32403	0.205000	0.17691	CAT	-	-		0.413	SFT2D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD36BP1	protein_coding	OTTHUMT00000083827.2	G	NM_199344	-		168215941	-1	no_errors	ENST00000358576	ensembl	human	known	74_37	rna	SNP	0.987	C
ZIC5	85416	genome.wustl.edu	37	13	100622668	100622670	+	In_Frame_Del	DEL	GGC	GGC	-	rs71114653		TCGA-MB-A8JK-01A-11D-A36J-09	TCGA-MB-A8JK-10A-01D-A36M-09	GGC	GGC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	307db8e1-7146-4506-b618-eba5076a6860	9be6e5e2-2506-4a0a-9cb7-a0fcb5e7834a	g.chr13:100622668_100622670delGGC	ENST00000267294.4	-	1	1493_1495	c.1260_1262delGCC	c.(1258-1263)ccgcca>cca	p.420_421PP>P		NM_033132.3	NP_149123.2	Q96T25	ZIC5_HUMAN	Zic family member 5	420	Pro-rich.				cell differentiation (GO:0030154)|forebrain development (GO:0030900)|neural tube closure (GO:0001843)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(1)|lung(2)|prostate(1)|skin(2)	9	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					cgggggcggtggcggcggcggcg	0.724																																																	0								ENSG00000139800																																			ZIC5	SO:0001651	inframe_deletion	0				HGNC	AF378304	CCDS9494.2	13q32.2	2013-01-08	2011-05-19		ENSG00000139800	ENSG00000139800		"""Zinc fingers, C2H2-type"""	20322	protein-coding gene	gene with protein product			"""Zic family member 5 (odd-paired homolog, Drosophila)"""				Standard	NM_033132		Approved		uc001vom.1	Q96T25	OTTHUMG00000017280	ENST00000267294.4:c.1260_1262delGCC	13.37:g.100622677_100622679delGGC	ENSP00000267294:p.Pro424del	Somatic	0	24	0.00		0.5423643324612125	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	16	23.81	Q5VYB0	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P424in_frame_del	ENST00000267294.4	37	c.1262_1260	CCDS9494.2	13																																																																																			-	NULL		0.724	ZIC5-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	ZIC5	protein_coding	OTTHUMT00000045623.3	GGC	NM_033132			100622670	-1	no_errors	ENST00000267294	ensembl	human	known	74_37	in_frame_del	DEL	0.885:0.709:0.221	-
CUL4B	8450	genome.wustl.edu	37	X	119670866	119670866	+	Silent	SNP	C	C	G	rs185389157		TCGA-MB-A8JK-01A-11D-A36J-09	TCGA-MB-A8JK-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	307db8e1-7146-4506-b618-eba5076a6860	9be6e5e2-2506-4a0a-9cb7-a0fcb5e7834a	g.chrX:119670866C>G	ENST00000404115.3	-	17	2417	c.2016G>C	c.(2014-2016)ccG>ccC	p.P672P	CUL4B_ENST00000336592.6_Silent_p.P659P|CUL4B_ENST00000371322.5_Silent_p.P654P	NM_003588.3	NP_003579.3	Q13620	CUL4B_HUMAN	cullin 4B	672					cell cycle (GO:0007049)|histone H2A monoubiquitination (GO:0035518)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of protein catabolic process (GO:0045732)|ubiquitin-dependent protein catabolic process (GO:0006511)|UV-damage excision repair (GO:0070914)	Cul4B-RING E3 ubiquitin ligase complex (GO:0031465)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(14)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						CAATATTTCCCGGAACATTCT	0.348																																																	0								ENSG00000158290						107.0	95.0	99.0					X																	119670866		2203	4300	6503	CUL4B	SO:0001819	synonymous_variant	0			-	HGNC	U58091	CCDS35379.1, CCDS43987.1	Xq23	2011-05-24			ENSG00000158290	ENSG00000158290			2555	protein-coding gene	gene with protein product		300304				8681378	Standard	NM_003588		Approved		uc004esw.3	Q13620	OTTHUMG00000022302	ENST00000404115.3:c.2016G>C	X.37:g.119670866C>G		Somatic	0	31	0.00		0.5423643324612125	15	82.14	69	WXS	Illumina HiSeq 2500	Phase_IV	tier1	32	6	84.21	B1APK5|B3KVX4|B7Z5K8|Q6PIE4|Q6UP07|Q7Z673|Q9BY37|Q9UEB7|Q9UED7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Cullin_N,pfam_Cullin_neddylation_domain,superfamily_Cullin_repeat-like_dom,superfamily_Cullin_homology,smart_Cullin_homology,smart_Cullin_neddylation_domain,pfscan_Cullin_homology	p.P672	ENST00000404115.3	37	c.2016	CCDS35379.1	X																																																																																			-	pfam_Cullin_N,superfamily_Cullin_homology,smart_Cullin_homology,pfscan_Cullin_homology		0.348	CUL4B-001	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	CUL4B	protein_coding	OTTHUMT00000058103.1	C	NM_003588	-		119670866	-1	no_errors	ENST00000404115	ensembl	human	known	74_37	silent	SNP	1.000	G
NFE2L2	4780	genome.wustl.edu	37	2	178095856	178095856	+	Missense_Mutation	SNP	T	T	C			TCGA-MB-A8JK-01A-11D-A36J-09	TCGA-MB-A8JK-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	307db8e1-7146-4506-b618-eba5076a6860	9be6e5e2-2506-4a0a-9cb7-a0fcb5e7834a	g.chr2:178095856T>C	ENST00000397062.3	-	5	2029	c.1475A>G	c.(1474-1476)gAa>gGa	p.E492G	NFE2L2_ENST00000464747.1_Missense_Mutation_p.E476G|NFE2L2_ENST00000397063.4_Missense_Mutation_p.E476G|NFE2L2_ENST00000446151.2_Missense_Mutation_p.E469G	NM_006164.4	NP_006155.2	Q16236	NF2L2_HUMAN	nuclear factor, erythroid 2-like 2	492					cellular response to hydrogen peroxide (GO:0070301)|cellular response to laminar fluid shear stress (GO:0071499)|cellular response to tumor necrosis factor (GO:0071356)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|positive regulation of blood coagulation (GO:0030194)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to stress (GO:0036003)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|regulation of embryonic development (GO:0045995)|regulation of removal of superoxide radicals (GO:2000121)|transcription from RNA polymerase II promoter (GO:0006366)	centrosome (GO:0005813)|chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|cervix(4)|endometrium(14)|kidney(5)|large_intestine(4)|liver(13)|lung(71)|oesophagus(29)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	158			Epithelial(96;0.00442)|OV - Ovarian serous cystadenocarcinoma(117;0.00739)|all cancers(119;0.0195)|LUSC - Lung squamous cell carcinoma(2;0.036)|Lung(16;0.0935)			AAGTTGAGCTTCATTGAACTG	0.388			Mis		"""NSCLC, HNSCC"""					HNSCC(56;0.16)																														Dom	yes		2	2q31	4780	nuclear factor (erythroid-derived 2)-like 2 (NRF2)		E	0								ENSG00000116044						174.0	153.0	159.0					2																	178095856		1849	4085	5934	NFE2L2	SO:0001583	missense	0			-	HGNC		CCDS42782.1, CCDS46457.1, CCDS46458.1	2q31	2013-08-23	2013-08-23		ENSG00000116044	ENSG00000116044		"""basic leucine zipper proteins"""	7782	protein-coding gene	gene with protein product	"""NF-E2-related factor 2"""	600492	"""nuclear factor (erythroid-derived 2)-like 2"""			7937919	Standard	NM_006164		Approved	NRF2	uc002ulh.5	Q16236	OTTHUMG00000133620	ENST00000397062.3:c.1475A>G	2.37:g.178095856T>C	ENSP00000380252:p.Glu492Gly	Somatic	0	19	0.00		0.5423643324612125	291	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	12	20.00	B2RBU2|B4E338|E9PGJ7|Q53RW6|Q59HH2|Q96F71	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_bZIP,superfamily_TF_DNA-bd,superfamily_Serpin_dom,smart_bZIP,pfscan_bZIP	p.E492G	ENST00000397062.3	37	c.1475	CCDS42782.1	2	.	.	.	.	.	.	.	.	.	.	T	19.69	3.875023	0.72180	.	.	ENSG00000116044	ENST00000397063;ENST00000397062;ENST00000446151;ENST00000449627	D;D;D;D	0.92446	-3.04;-3.04;-3.04;-3.04	5.95	5.95	0.96441	Eukaryotic transcription factor, Skn-1-like, DNA-binding (2);	0.088284	0.85682	D	0.000000	D	0.95655	0.8587	M	0.76328	2.33	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.69654	0.965;0.965	D	0.96017	0.9006	10	0.87932	D	0	-17.8952	16.4069	0.83677	0.0:0.0:0.0:1.0	.	469;492	E9PGJ7;Q16236	.;NF2L2_HUMAN	G	476;492;469;220	ENSP00000380253:E476G;ENSP00000380252:E492G;ENSP00000411575:E469G;ENSP00000391590:E220G	ENSP00000380252:E492G	E	-	2	0	NFE2L2	177804102	1.000000	0.71417	1.000000	0.80357	0.862000	0.49288	8.040000	0.89188	2.272000	0.75746	0.460000	0.39030	GAA	-	superfamily_TF_DNA-bd		0.388	NFE2L2-001	KNOWN	basic|CCDS	protein_coding	NFE2L2	protein_coding	OTTHUMT00000257752.4	T	NM_006164	-		178095856	-1	no_errors	ENST00000397062	ensembl	human	known	74_37	missense	SNP	1.000	C
EPHX1	2052	genome.wustl.edu	37	1	226026987	226026987	+	Missense_Mutation	SNP	A	A	G	rs368539734		TCGA-MB-A8JK-01A-11D-A36J-09	TCGA-MB-A8JK-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	307db8e1-7146-4506-b618-eba5076a6860	9be6e5e2-2506-4a0a-9cb7-a0fcb5e7834a	g.chr1:226026987A>G	ENST00000366837.4	+	5	858	c.662A>G	c.(661-663)tAc>tGc	p.Y221C	RP11-285F7.2_ENST00000424332.1_RNA|EPHX1_ENST00000272167.5_Missense_Mutation_p.Y221C	NM_000120.3	NP_000111.1	P07099	HYEP_HUMAN	epoxide hydrolase 1, microsomal (xenobiotic)	221					aromatic compound catabolic process (GO:0019439)|response to toxic substance (GO:0009636)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	cis-stilbene-oxide hydrolase activity (GO:0033961)|epoxide hydrolase activity (GO:0004301)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(7)|ovary(3)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	28	Breast(184;0.197)					CAGGAATTCTACATTCAAGGA	0.572																																																	0								ENSG00000143819	A	CYS/TYR,CYS/TYR	1,4405	2.1+/-5.4	0,1,2202	72.0	80.0	77.0		662,662	4.9	0.8	1		77	0,8600		0,0,4300	no	missense,missense	EPHX1	NM_000120.3,NM_001136018.2	194,194	0,1,6502	GG,GA,AA		0.0,0.0227,0.0077	probably-damaging,probably-damaging	221/456,221/456	226026987	1,13005	2203	4300	6503	EPHX1	SO:0001583	missense	0			-	HGNC	J03518	CCDS1547.1	1q42.1	2009-07-10			ENSG00000143819	ENSG00000143819	3.3.2.9		3401	protein-coding gene	gene with protein product		132810		EPHX		9925921	Standard	NM_000120		Approved		uc001hpk.3	P07099	OTTHUMG00000037743	ENST00000366837.4:c.662A>G	1.37:g.226026987A>G	ENSP00000355802:p.Tyr221Cys	Somatic	0	69	0.00		0.5423643324612125	132	34.00	68	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	36	34.55	B2R8N0|Q5VTJ6|Q9NP75|Q9NPE7|Q9NQU6|Q9NQU7|Q9NQU8|Q9NQU9|Q9NQV0|Q9NQV1|Q9NQV2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Epoxide_hydro_N,pfam_AB_hydrolase_1,pirsf_Epoxide_hydrolase,prints_Epox_hydrolase-like	p.Y221C	ENST00000366837.4	37	c.662	CCDS1547.1	1	.	.	.	.	.	.	.	.	.	.	A	18.42	3.619127	0.66787	2.27E-4	0.0	ENSG00000143819	ENST00000272167;ENST00000366837	T;T	0.61742	0.08;0.08	4.87	4.87	0.63330	Alpha/beta hydrolase fold-1 (1);	0.000000	0.85682	D	0.000000	T	0.78604	0.4309	M	0.87617	2.895	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.83247	-0.0055	10	0.87932	D	0	-4.2389	14.7656	0.69637	1.0:0.0:0.0:0.0	.	221	P07099	HYEP_HUMAN	C	221	ENSP00000272167:Y221C;ENSP00000355802:Y221C	ENSP00000272167:Y221C	Y	+	2	0	EPHX1	224093610	1.000000	0.71417	0.839000	0.33178	0.816000	0.46133	5.706000	0.68362	1.955000	0.56771	0.482000	0.46254	TAC	-	pfam_AB_hydrolase_1,pirsf_Epoxide_hydrolase		0.572	EPHX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHX1	protein_coding	OTTHUMT00000092064.1	A	NM_000120	-		226026987	+1	no_errors	ENST00000272167	ensembl	human	known	74_37	missense	SNP	0.992	G
PRKDC	5591	genome.wustl.edu	37	8	48739410	48739410	+	Nonsense_Mutation	SNP	G	G	A			TCGA-MB-A8JK-01A-11D-A36J-09	TCGA-MB-A8JK-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	307db8e1-7146-4506-b618-eba5076a6860	9be6e5e2-2506-4a0a-9cb7-a0fcb5e7834a	g.chr8:48739410G>A	ENST00000314191.2	-	64	8643	c.8587C>T	c.(8587-8589)Cag>Tag	p.Q2863*	PRKDC_ENST00000338368.3_Nonsense_Mutation_p.Q2863*|PRKDC_ENST00000523565.1_5'UTR	NM_006904.6	NP_008835.5	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic polypeptide	2864	KIP-binding.				B cell lineage commitment (GO:0002326)|brain development (GO:0007420)|cellular protein modification process (GO:0006464)|cellular response to insulin stimulus (GO:0032869)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|ectopic germ cell programmed cell death (GO:0035234)|heart development (GO:0007507)|immunoglobulin V(D)J recombination (GO:0033152)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of protein phosphorylation (GO:0001933)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|pro-B cell differentiation (GO:0002328)|protein destabilization (GO:0031648)|regulation of circadian rhythm (GO:0042752)|response to gamma radiation (GO:0010332)|rhythmic process (GO:0048511)|signal transduction involved in mitotic G1 DNA damage checkpoint (GO:0072431)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell receptor V(D)J recombination (GO:0033153)|telomere maintenance (GO:0000723)	cytosol (GO:0005829)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription factor binding (GO:0008134)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(9)|cervix(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(30)|lung(56)|ovary(6)|pancreas(1)|prostate(8)|skin(7)	147		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)			Caffeine(DB00201)	GCTGCGTGCTGACAGCTAATG	0.537								Non-homologous end-joining																													Esophageal Squamous(79;1091 1253 12329 31680 40677)												0								ENSG00000253729						11.0	14.0	13.0					8																	48739410		1998	4170	6168	PRKDC	SO:0001587	stop_gained	0			-	HGNC		CCDS75734.1, CCDS75735.1	8q11	2014-09-17				ENSG00000253729	2.7.11.1		9413	protein-coding gene	gene with protein product		600899		HYRC, HYRC1		7638222	Standard	NM_001081640		Approved	DNPK1, p350, DNAPK, XRCC7, DNA-PKcs	uc003xqi.3	P78527		ENST00000314191.2:c.8587C>T	8.37:g.48739410G>A	ENSP00000313420:p.Gln2863*	Somatic	0	96	0.00		0.5423643324612125	18	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	23	20.69	P78528|Q13327|Q13337|Q14175|Q59H99|Q7Z611|Q96SE6|Q9UME3	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_NUC194,pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.Q2863*	ENST00000314191.2	37	c.8587		8	.	.	.	.	.	.	.	.	.	.	G	49	15.088007	0.99822	.	.	ENSG00000253729	ENST00000314191;ENST00000338368	.	.	.	5.55	3.75	0.43078	.	0.243294	0.34362	N	0.004027	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.23891	T	0.37	.	15.7983	0.78428	0.0:0.0:0.7154:0.2846	.	.	.	.	X	2863	.	ENSP00000313420:Q2863X	Q	-	1	0	PRKDC	48901963	1.000000	0.71417	0.153000	0.22517	0.433000	0.31745	4.437000	0.59955	0.684000	0.31448	0.655000	0.94253	CAG	-	NULL		0.537	PRKDC-201	KNOWN	basic|appris_principal	protein_coding	PRKDC	protein_coding		G	NM_001081640	-		48739410	-1	no_errors	ENST00000314191	ensembl	human	known	74_37	nonsense	SNP	0.998	A
SOX4	6659	genome.wustl.edu	37	6	21595992	21595992	+	Frame_Shift_Del	DEL	C	C	-			TCGA-MB-A8JK-01A-11D-A36J-09	TCGA-MB-A8JK-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	307db8e1-7146-4506-b618-eba5076a6860	9be6e5e2-2506-4a0a-9cb7-a0fcb5e7834a	g.chr6:21595992delC	ENST00000244745.1	+	1	2021	c.1227delC	c.(1225-1227)aacfs	p.N409fs	SOX4_ENST00000543472.1_Frame_Shift_Del_p.N409fs	NM_003107.2	NP_003098.1	Q06945	SOX4_HUMAN	SRY (sex determining region Y)-box 4	409					ascending aorta morphogenesis (GO:0035910)|atrial septum primum morphogenesis (GO:0003289)|canonical Wnt signaling pathway (GO:0060070)|cardiac right ventricle morphogenesis (GO:0003215)|cardiac ventricle formation (GO:0003211)|cellular response to glucose stimulus (GO:0071333)|DNA damage response, detection of DNA damage (GO:0042769)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|endocrine pancreas development (GO:0031018)|glial cell development (GO:0021782)|glial cell proliferation (GO:0014009)|glucose homeostasis (GO:0042593)|heart development (GO:0007507)|kidney morphogenesis (GO:0060993)|limb bud formation (GO:0060174)|mitral valve morphogenesis (GO:0003183)|negative regulation of cell death (GO:0060548)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein export from nucleus (GO:0046826)|negative regulation of protein ubiquitination (GO:0031397)|neural tube formation (GO:0001841)|neuroepithelial cell differentiation (GO:0060563)|noradrenergic neuron differentiation (GO:0003357)|positive regulation of apoptotic process (GO:0043065)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell proliferation (GO:0008284)|positive regulation of insulin secretion (GO:0032024)|positive regulation of N-terminal peptidyl-lysine acetylation (GO:2000761)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of translation (GO:0045727)|positive regulation of Wnt signaling pathway (GO:0030177)|pro-B cell differentiation (GO:0002328)|protein stabilization (GO:0050821)|regulation of protein stability (GO:0031647)|regulation of transcription, DNA-templated (GO:0006355)|skeletal system development (GO:0001501)|somatic stem cell maintenance (GO:0035019)|spinal cord development (GO:0021510)|spinal cord motor neuron differentiation (GO:0021522)|sympathetic nervous system development (GO:0048485)|T cell differentiation (GO:0030217)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear transcription factor complex (GO:0044798)|nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription coactivator activity (GO:0001105)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			kidney(2)|lung(2)|prostate(1)|upper_aerodigestive_tract(1)	6	Ovarian(93;0.163)		all cancers(50;0.0751)|Epithelial(50;0.155)			TCGACCTGAACCCCAGCTCAA	0.642																																																	0								ENSG00000124766						29.0	25.0	26.0					6																	21595992		2202	4299	6501	SOX4	SO:0001589	frameshift_variant	0				HGNC	AF070669	CCDS4547.1	6p22.3	2008-02-05			ENSG00000124766	ENSG00000124766		"""SRY (sex determining region Y)-boxes"""	11200	protein-coding gene	gene with protein product		184430				8268656, 9730625	Standard	NM_003107		Approved		uc003ndi.3	Q06945	OTTHUMG00000016101	ENST00000244745.1:c.1227delC	6.37:g.21595992delC	ENSP00000244745:p.Asn409fs	Somatic	0	95	0.00		0.5423643324612125	88	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	51	50	50.50		Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pirsf_SOX-12/11/4a,pfscan_HMG_box_dom	p.S411fs	ENST00000244745.1	37	c.1227	CCDS4547.1	6																																																																																			-	pirsf_SOX-12/11/4a		0.642	SOX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOX4	protein_coding	OTTHUMT00000043301.1	C	NM_003107			21595992	+1	no_errors	ENST00000244745	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
ADAMTS9	56999	genome.wustl.edu	37	3	64582660	64582660	+	Missense_Mutation	SNP	C	C	T			TCGA-MB-A8JK-01A-11D-A36J-09	TCGA-MB-A8JK-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	307db8e1-7146-4506-b618-eba5076a6860	9be6e5e2-2506-4a0a-9cb7-a0fcb5e7834a	g.chr3:64582660C>T	ENST00000498707.1	-	27	4367	c.4025G>A	c.(4024-4026)aGt>aAt	p.S1342N	ADAMTS9_ENST00000295903.4_Missense_Mutation_p.S1314N	NM_182920.1	NP_891550.1	Q9P2N4	ATS9_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 9	1342	TSP type-1 9. {ECO:0000255|PROSITE- ProRule:PRU00210}.				glycoprotein catabolic process (GO:0006516)|multicellular organismal development (GO:0007275)|positive regulation of melanocyte differentiation (GO:0045636)|protein transport (GO:0015031)|proteolysis (GO:0006508)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(17)|liver(4)|lung(43)|ovary(3)|prostate(3)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	100		Lung NSC(201;0.00682)		BRCA - Breast invasive adenocarcinoma(55;0.00142)|Kidney(15;0.00202)|KIRC - Kidney renal clear cell carcinoma(15;0.00221)		AGCACAGGTACTGGAACACTA	0.468																																																	0								ENSG00000163638						95.0	92.0	93.0					3																	64582660		2203	4300	6503	ADAMTS9	SO:0001583	missense	0			-	HGNC	AF261918	CCDS2903.1	3p14.1	2008-05-15	2005-08-19		ENSG00000163638	ENSG00000163638		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	13202	protein-coding gene	gene with protein product		605421	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 9"""			10936055	Standard	NM_182920		Approved	KIAA1312	uc003dmg.3	Q9P2N4	OTTHUMG00000158722	ENST00000498707.1:c.4025G>A	3.37:g.64582660C>T	ENSP00000418735:p.Ser1342Asn	Somatic	0	45	0.00		0.5423643324612125	34	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.16	A1L4L0|B7ZVX9|B9ZVN0|Q9NR29	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Pept_M12B_GON-ADAMTSs,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_Peptidase_M12B,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Pept_M12B_GON-ADAMTSs,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.S1342N	ENST00000498707.1	37	c.4025	CCDS2903.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	28.5|28.5	4.927929|4.927929	0.92389|0.92389	.|.	.|.	ENSG00000163638|ENSG00000163638	ENST00000295903;ENST00000498707|ENST00000481060	T;T|.	0.54279|.	0.58;0.58|.	5.4|5.4	5.4|5.4	0.78164|0.78164	.|.	0.095675|.	0.64402|.	D|.	0.000001|.	D|D	0.82559|0.82559	0.5063|0.5063	M|M	0.84082|0.84082	2.675|2.675	0.80722|0.80722	D|D	1|1	P;D;B|.	0.61697|.	0.635;0.99;0.314|.	P;P;B|.	0.57244|.	0.461;0.816;0.178|.	T|T	0.83127|0.83127	-0.0115|-0.0115	10|5	0.66056|.	D|.	0.02|.	.|.	19.3682|19.3682	0.94473|0.94473	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1314;1342;1342|.	B7ZVX9;Q9P2N4-1;Q9P2N4|.	.;.;ATS9_HUMAN|.	N|I	1314;1342|398	ENSP00000295903:S1314N;ENSP00000418735:S1342N|.	ENSP00000295903:S1314N|.	S|V	-|-	2|1	0|0	ADAMTS9|ADAMTS9	64557700|64557700	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	7.273000|7.273000	0.78527|0.78527	2.818000|2.818000	0.97014|0.97014	0.591000|0.591000	0.81541|0.81541	AGT|GTA	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt		0.468	ADAMTS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS9	protein_coding	OTTHUMT00000351891.1	C		-		64582660	-1	no_errors	ENST00000498707	ensembl	human	known	74_37	missense	SNP	1.000	T
HDAC5	10014	genome.wustl.edu	37	17	42164842	42164842	+	Nonsense_Mutation	SNP	C	C	A			TCGA-MB-A8JK-01A-11D-A36J-09	TCGA-MB-A8JK-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	307db8e1-7146-4506-b618-eba5076a6860	9be6e5e2-2506-4a0a-9cb7-a0fcb5e7834a	g.chr17:42164842C>A	ENST00000393622.2	-	13	2153	c.1822G>T	c.(1822-1824)Gag>Tag	p.E608*	HDAC5_ENST00000336057.5_Nonsense_Mutation_p.E608*|HDAC5_ENST00000225983.6_Nonsense_Mutation_p.E609*|HDAC5_ENST00000586802.1_Nonsense_Mutation_p.E608*	NM_001015053.1|NM_005474.4	NP_001015053.1|NP_005465.2	Q9UQL6	HDAC5_HUMAN	histone deacetylase 5	608					B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|cellular response to insulin stimulus (GO:0032869)|chromatin modification (GO:0016568)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|chromatin silencing (GO:0006342)|heart development (GO:0007507)|histone deacetylation (GO:0016575)|inflammatory response (GO:0006954)|multicellular organismal response to stress (GO:0033555)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|osteoblast development (GO:0002076)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of gene expression, epigenetic (GO:0040029)|regulation of myotube differentiation (GO:0010830)|regulation of protein binding (GO:0043393)|regulation of skeletal muscle fiber development (GO:0048742)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|histone deacetylase complex (GO:0000118)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter binding (GO:0001047)|histone deacetylase activity (GO:0004407)|metal ion binding (GO:0046872)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein kinase C binding (GO:0005080)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(5)|large_intestine(4)|lung(7)|ovary(1)|prostate(2)|skin(1)	21		Breast(137;0.00637)|Prostate(33;0.0313)		BRCA - Breast invasive adenocarcinoma(366;0.118)		CTCTCGCCCTCCTCGTCCTTA	0.612																																																	0								ENSG00000108840						75.0	57.0	63.0					17																	42164842		2203	4300	6503	HDAC5	SO:0001587	stop_gained	0			-	HGNC	AF249731	CCDS32663.1, CCDS45696.1	17q21	2008-07-18					3.5.1.98		14068	protein-coding gene	gene with protein product		605315				10220385, 9610721	Standard	XM_005256905		Approved	KIAA0600, NY-CO-9, FLJ90614	uc002iff.1	Q9UQL6		ENST00000393622.2:c.1822G>T	17.37:g.42164842C>A	ENSP00000377244:p.Glu608*	Somatic	0	26	0.00		0.5423643324612125	59	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00	C9JFV9|O60340|O60528|Q96DY4	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_His_deacetylse_dom,pfam_Hist_deacetylase_Gln_rich_N,pirsf_Histone_deAcase_II_euk,prints_His_deacetylse	p.E609*	ENST00000393622.2	37	c.1825	CCDS45696.1	17	.	.	.	.	.	.	.	.	.	.	C	41	8.696020	0.98918	.	.	ENSG00000108840	ENST00000225983;ENST00000393622;ENST00000336057	.	.	.	4.69	4.69	0.59074	.	0.332441	0.25938	N	0.027331	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.21540	T	0.41	-5.2287	14.5338	0.67944	0.0:1.0:0.0:0.0	.	.	.	.	X	609;608;608	.	ENSP00000225983:E609X	E	-	1	0	HDAC5	39520368	0.039000	0.19947	0.989000	0.46669	0.953000	0.61014	3.432000	0.52824	2.147000	0.66899	0.561000	0.74099	GAG	-	pirsf_Histone_deAcase_II_euk		0.612	HDAC5-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	HDAC5	protein_coding	OTTHUMT00000457686.1	C	NM_001015053	-		42164842	-1	no_errors	ENST00000225983	ensembl	human	known	74_37	nonsense	SNP	0.594	A
RP11-509A17.3	0	genome.wustl.edu	37	15	20563423	20563423	+	lincRNA	DEL	C	C	-			TCGA-MB-A8JK-01A-11D-A36J-09	TCGA-MB-A8JK-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	307db8e1-7146-4506-b618-eba5076a6860	9be6e5e2-2506-4a0a-9cb7-a0fcb5e7834a	g.chr15:20563423delC	ENST00000557528.1	+	0	1812				AC026495.1_ENST00000581090.1_RNA																							cccttcctctcccttcctctc	0.672																																																	0								ENSG00000265002																																			AC026495.1			0				Clone_based_ensembl_gene																													15.37:g.20563423delC		Somatic	0	44	0.00		0.5423643324612125	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	35	14.63		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000557528.1	37	NULL		15																																																																																			-	-		0.672	RP11-509A17.3-001	KNOWN	basic	lincRNA	ENSG00000265002	lincRNA	OTTHUMT00000414658.1	C				20563423	+1	no_errors	ENST00000581090	ensembl	human	novel	74_37	rna	DEL	0.102	-
A2MP1	3	genome.wustl.edu	37	12	9416382	9416382	+	IGR	SNP	T	T	C			TCGA-MB-A8JK-01A-11D-A36J-09	TCGA-MB-A8JK-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	307db8e1-7146-4506-b618-eba5076a6860	9be6e5e2-2506-4a0a-9cb7-a0fcb5e7834a	g.chr12:9416382T>C								RP11-118B22.4 (5826 upstream) : SNORA75 (22886 downstream)																							GTAGTTGCACTGAAATAGTAT	0.388																																																	0								ENSG00000256069																																			A2MP1	SO:0001628	intergenic_variant	0			-	HGNC																													12.37:g.9416382T>C		Somatic	0	80	0.00		0.5423643324612125	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	52	21.21		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL		37	NULL		12																																																																																			-	-	0	0.388					A2MP1			T		-		9416382	-1	no_errors	ENST00000544183	ensembl	human	known	74_37	rna	SNP	0.001	C
MYH3	4621	genome.wustl.edu	37	17	10541189	10541189	+	Nonsense_Mutation	SNP	C	C	A			TCGA-MB-A8JK-01A-11D-A36J-09	TCGA-MB-A8JK-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	307db8e1-7146-4506-b618-eba5076a6860	9be6e5e2-2506-4a0a-9cb7-a0fcb5e7834a	g.chr17:10541189C>A	ENST00000583535.1	-	28	3880	c.3793G>T	c.(3793-3795)Gag>Tag	p.E1265*	MYH3_ENST00000226209.7_Nonsense_Mutation_p.E1265*	NM_002470.3	NP_002461.2	P11055	MYH3_HUMAN	myosin, heavy chain 3, skeletal muscle, embryonic	1265					actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|embryonic limb morphogenesis (GO:0030326)|face morphogenesis (GO:0060325)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|sarcomere organization (GO:0045214)|skeletal muscle contraction (GO:0003009)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(5)|large_intestine(18)|lung(30)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	83						TGAATTTCCTCATTCTTGCCC	0.527																																																	0								ENSG00000109063						78.0	69.0	72.0					17																	10541189		2203	4300	6503	MYH3	SO:0001587	stop_gained	0			-	HGNC		CCDS11157.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109063	ENSG00000109063		"""Myosins / Myosin superfamily : Class II"""	7573	protein-coding gene	gene with protein product	"""myosin, skeletal, heavy chain, embryonic 1"", ""muscle embryonic myosin heavy chain 3"""	160720	"""myosin, heavy polypeptide 3, skeletal muscle, embryonic"""			2726495	Standard	NM_002470		Approved	MYHC-EMB, MYHSE1, HEMHC, SMHCE	uc002gmq.2	P11055	OTTHUMG00000130367	ENST00000583535.1:c.3793G>T	17.37:g.10541189C>A	ENSP00000464317:p.Glu1265*	Somatic	0	59	0.00		0.5423643324612125	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	11	38.89	Q15492	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.E1265*	ENST00000583535.1	37	c.3793	CCDS11157.1	17	.	.	.	.	.	.	.	.	.	.	C	43	10.230431	0.99365	.	.	ENSG00000109063	ENST00000226209	.	.	.	5.36	5.36	0.76844	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	19.4593	0.94910	0.0:1.0:0.0:0.0	.	.	.	.	X	1265	.	ENSP00000226209:E1265X	E	-	1	0	MYH3	10481914	1.000000	0.71417	0.996000	0.52242	0.815000	0.46073	7.818000	0.86416	2.665000	0.90641	0.655000	0.94253	GAG	-	pfam_Myosin_tail,superfamily_Prefoldin		0.527	MYH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH3	protein_coding	OTTHUMT00000252734.2	C	NM_002470	-		10541189	-1	no_errors	ENST00000226209	ensembl	human	known	74_37	nonsense	SNP	1.000	A
NALCN	259232	genome.wustl.edu	37	13	101763479	101763479	+	Missense_Mutation	SNP	C	C	T			TCGA-MB-A8JK-01A-11D-A36J-09	TCGA-MB-A8JK-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	307db8e1-7146-4506-b618-eba5076a6860	9be6e5e2-2506-4a0a-9cb7-a0fcb5e7834a	g.chr13:101763479C>T	ENST00000251127.6	-	19	2372	c.2291G>A	c.(2290-2292)cGc>cAc	p.R764H		NM_052867.2	NP_443099.1	Q8IZF0	NALCN_HUMAN	sodium leak channel, non-selective	764					calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium channel activity (GO:0005272)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|autonomic_ganglia(2)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(33)|liver(2)|lung(81)|ovary(8)|pancreas(3)|prostate(5)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	177	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					TATTTACCTGCGCTCTTGGCG	0.552																																																	0								ENSG00000102452						175.0	165.0	168.0					13																	101763479		2203	4300	6503	NALCN	SO:0001583	missense	0			-	HGNC	AY141972	CCDS9498.1	13q32.3	2012-02-21	2007-04-26	2007-04-26	ENSG00000102452	ENSG00000102452		"""Ion channels / Sodium leak channels, non-selective"""	19082	protein-coding gene	gene with protein product		611549	"""voltage gated channel like 1"""	VGCNL1		17448995	Standard	XM_006719943		Approved	bA430M15.1, CanIon	uc001vox.1	Q8IZF0	OTTHUMG00000017295	ENST00000251127.6:c.2291G>A	13.37:g.101763479C>T	ENSP00000251127:p.Arg764His	Somatic	0	45	0.00		0.5423643324612125	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	34	10	77.27	Q6P2S6|Q6ZMI7|Q8IZZ1|Q8TAH1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom	p.R764H	ENST00000251127.6	37	c.2291	CCDS9498.1	13	.	.	.	.	.	.	.	.	.	.	C	29.5	5.010209	0.93346	.	.	ENSG00000102452	ENST00000251127	D	0.97831	-4.56	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	D	0.97904	0.9311	L	0.42245	1.32	0.80722	D	1	D	0.89917	1.0	D	0.64595	0.927	D	0.98450	1.0591	10	0.52906	T	0.07	.	19.518	0.95171	0.0:1.0:0.0:0.0	.	764	Q8IZF0	NALCN_HUMAN	H	764	ENSP00000251127:R764H	ENSP00000251127:R764H	R	-	2	0	NALCN	100561480	1.000000	0.71417	1.000000	0.80357	0.787000	0.44495	7.298000	0.78815	2.615000	0.88500	0.650000	0.86243	CGC	-	NULL		0.552	NALCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NALCN	protein_coding	OTTHUMT00000045663.2	C	NM_052867	-		101763479	-1	no_errors	ENST00000251127	ensembl	human	known	74_37	missense	SNP	1.000	T
KMT2E	55904	genome.wustl.edu	37	7	104747062	104747062	+	Missense_Mutation	SNP	C	C	A			TCGA-MB-A8JK-01A-11D-A36J-09	TCGA-MB-A8JK-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	307db8e1-7146-4506-b618-eba5076a6860	9be6e5e2-2506-4a0a-9cb7-a0fcb5e7834a	g.chr7:104747062C>A	ENST00000311117.3	+	20	3235	c.2690C>A	c.(2689-2691)aCa>aAa	p.T897K	CTB-152G17.6_ENST00000607968.1_RNA|KMT2E_ENST00000334877.4_Missense_Mutation_p.T897K|KMT2E_ENST00000257745.4_Missense_Mutation_p.T897K|KMT2E_ENST00000334914.7_5'UTR	NM_182931.2	NP_891847.1	Q8IZD2	KMT2E_HUMAN	lysine (K)-specific methyltransferase 2E	897					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|DNA methylation (GO:0006306)|erythrocyte differentiation (GO:0030218)|histone H3-K4 methylation (GO:0051568)|neutrophil activation (GO:0042119)|neutrophil mediated immunity (GO:0002446)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of transcription, DNA-templated (GO:0045893)|retinoic acid receptor signaling pathway (GO:0048384)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|MLL5-L complex (GO:0070688)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)										CCGTATGCTACACCAACTCAC	0.408																																																	0								ENSG00000005483						158.0	158.0	158.0					7																	104747062		2203	4300	6503	KMT2E	SO:0001583	missense	0			-	HGNC	AF067804	CCDS34723.1	7q22.1	2013-05-09	2013-05-09	2013-05-09	ENSG00000005483	ENSG00000005483		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	18541	protein-coding gene	gene with protein product		608444	"""myeloid/lymphoid or mixed-lineage leukemia 5 (trithorax homolog, Drosophila)"""	MLL5		9218106, 7672722	Standard	XM_005250493		Approved	HDCMC04P		Q8IZD2	OTTHUMG00000157403	ENST00000311117.3:c.2690C>A	7.37:g.104747062C>A	ENSP00000312379:p.Thr897Lys	Somatic	0	39	0.00		0.5423643324612125	30	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	34	10.53	B6ZDE4|B6ZDM3|M4K8J3|Q6P5Y2|Q6PKG4|Q6T316|Q86TI3|Q86W12|Q86WG0|Q86WL2|Q8IV78|Q8IWR5|Q8NFF8|Q9NWE7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SET_dom,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_SET_dom,pfscan_SET_dom,pfscan_Znf_PHD-finger	p.T897K	ENST00000311117.3	37	c.2690	CCDS34723.1	7	.	.	.	.	.	.	.	.	.	.	C	19.09	3.760318	0.69763	.	.	ENSG00000005483	ENST00000311117;ENST00000393656;ENST00000334877;ENST00000351043;ENST00000257745	D;D;D	0.92495	-3.05;-2.63;-3.05	5.34	5.34	0.76211	.	0.000000	0.85682	D	0.000000	D	0.93471	0.7917	L	0.27053	0.805	0.80722	D	1	D	0.71674	0.998	D	0.76071	0.987	D	0.94421	0.7641	10	0.66056	D	0.02	.	19.0324	0.92963	0.0:1.0:0.0:0.0	.	897	Q8IZD2	MLL5_HUMAN	K	897;897;897;817;897	ENSP00000312379:T897K;ENSP00000335599:T897K;ENSP00000257745:T897K	ENSP00000257745:T897K	T	+	2	0	MLL5	104534298	1.000000	0.71417	0.995000	0.50966	0.998000	0.95712	5.359000	0.66074	2.491000	0.84063	0.585000	0.79938	ACA	-	NULL		0.408	KMT2E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KMT2E	protein_coding	OTTHUMT00000348697.1	C		-		104747062	+1	no_errors	ENST00000257745	ensembl	human	known	74_37	missense	SNP	0.999	A
SCUBE1	80274	genome.wustl.edu	37	22	43600071	43600071	+	Missense_Mutation	SNP	T	T	C			TCGA-MB-A8JK-01A-11D-A36J-09	TCGA-MB-A8JK-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	307db8e1-7146-4506-b618-eba5076a6860	9be6e5e2-2506-4a0a-9cb7-a0fcb5e7834a	g.chr22:43600071T>C	ENST00000360835.4	-	22	3025	c.2899A>G	c.(2899-2901)Atg>Gtg	p.M967V		NM_173050.3	NP_766638.2	Q8IWY4	SCUB1_HUMAN	signal peptide, CUB domain, EGF-like 1	967					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|endothelial cell differentiation (GO:0045446)|inflammatory response (GO:0006954)|post-embryonic development (GO:0009791)|protein homooligomerization (GO:0051260)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extrinsic component of plasma membrane (GO:0019897)	calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|protein heterodimerization activity (GO:0046982)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(4)|large_intestine(4)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31		all_neural(38;0.0414)|Ovarian(80;0.07)				CGTGGGAACATCTCCTTGGAT	0.577																																																	0								ENSG00000159307						168.0	151.0	157.0					22																	43600071		2203	4300	6503	SCUBE1	SO:0001583	missense	0			-	HGNC		CCDS14048.1	22q13	2008-07-01			ENSG00000159307	ENSG00000159307			13441	protein-coding gene	gene with protein product		611746				11087664	Standard	NM_173050		Approved		uc003bdt.2	Q8IWY4	OTTHUMG00000150679	ENST00000360835.4:c.2899A>G	22.37:g.43600071T>C	ENSP00000354080:p.Met967Val	Somatic	0	71	0.00		0.5423643324612125	0	100.00	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	48	23.81	Q5R336	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_EGF-like_Ca-bd_dom,pfam_Tyr-kin_ephrin_A/B_rcpt-like,pfam_EG-like_dom,pfam_CUB_dom,superfamily_CUB_dom,superfamily_Growth_fac_rcpt_N_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_CUB_dom,pfscan_CUB_dom,pfscan_EG-like_dom	p.M967V	ENST00000360835.4	37	c.2899	CCDS14048.1	22	.	.	.	.	.	.	.	.	.	.	T	21.4	4.149901	0.78001	.	.	ENSG00000159307	ENST00000360835;ENST00000381243	D	0.85411	-1.98	4.13	4.13	0.48395	.	0.000000	0.85682	D	0.000000	T	0.80059	0.4554	N	0.24115	0.695	0.80722	D	1	P	0.46912	0.886	P	0.47251	0.542	T	0.81258	-0.1014	10	0.45353	T	0.12	.	13.6064	0.62050	0.0:0.0:0.0:1.0	.	967	Q8IWY4	SCUB1_HUMAN	V	967;597	ENSP00000354080:M967V	ENSP00000354080:M967V	M	-	1	0	SCUBE1	41930015	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.918000	0.69996	1.872000	0.54250	0.482000	0.46254	ATG	-	NULL		0.577	SCUBE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCUBE1	protein_coding	OTTHUMT00000319582.3	T	NM_173050	-		43600071	-1	no_errors	ENST00000360835	ensembl	human	known	74_37	missense	SNP	1.000	C
AC002485.1	0	genome.wustl.edu	37	6	67069388	67069389	+	RNA	INS	-	-	ACACACACACAT	rs12210657	byFrequency	TCGA-MB-A8JK-01A-11D-A36J-09	TCGA-MB-A8JK-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	307db8e1-7146-4506-b618-eba5076a6860	9be6e5e2-2506-4a0a-9cb7-a0fcb5e7834a	g.chr6:67069388_67069389insACACACACACAT	ENST00000408354.1	+	0	71_72																											cacacacacacaTATATATGag	0.446																																																	0								ENSG00000221281																																			AC002485.1			0				Clone_based_ensembl_gene																													6.37:g.67069388_67069389insACACACACACAT		Somatic	NA	NA	NA		0.5423643324612125	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000408354.1	37	NULL		6																																																																																			-	-		0.446	AC002485.1-201	NOVEL	basic	miRNA	ENSG00000221281	miRNA		-				67069389	+1	no_errors	ENST00000408354	ensembl	human	novel	74_37	rna	INS	0.005:0.011	ACACACACACAT
WDR1	9948	genome.wustl.edu	37	4	10077097	10077097	+	Missense_Mutation	SNP	G	G	T			TCGA-MB-A8JK-01A-11D-A36J-09	TCGA-MB-A8JK-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	307db8e1-7146-4506-b618-eba5076a6860	9be6e5e2-2506-4a0a-9cb7-a0fcb5e7834a	g.chr4:10077097G>T	ENST00000499869.2	-	15	1919	c.1726C>A	c.(1726-1728)Ctg>Atg	p.L576M	WDR1_ENST00000382452.2_Missense_Mutation_p.L576M|WDR1_ENST00000382451.2_Missense_Mutation_p.L436M|RP11-448G15.3_ENST00000561486.1_RNA|WDR1_ENST00000515743.1_5'UTR|WDR1_ENST00000502702.1_Missense_Mutation_p.L436M			O75083	WDR1_HUMAN	WD repeat domain 1	576					blood coagulation (GO:0007596)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|sensory perception of sound (GO:0007605)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)				endometrium(3)|lung(5)|ovary(2)|pancreas(1)|urinary_tract(1)	12				STAD - Stomach adenocarcinoma(129;0.000703)|Colorectal(103;0.0057)|LUSC - Lung squamous cell carcinoma(721;0.0232)		ACATGGTGCAGCCGGTGTGCA	0.532																																																	0								ENSG00000071127						46.0	51.0	49.0					4																	10077097		2112	4231	6343	WDR1	SO:0001583	missense	0			-	HGNC	AF020260	CCDS54739.1, CCDS54740.1	4p16.1	2013-01-09			ENSG00000071127	ENSG00000071127		"""WD repeat domain containing"""	12754	protein-coding gene	gene with protein product		604734				10036186	Standard	NM_017491		Approved		uc021xlv.1	O75083	OTTHUMG00000160253	ENST00000499869.2:c.1726C>A	4.37:g.10077097G>T	ENSP00000427687:p.Leu576Met	Somatic	0	38	0.00		0.5423643324612125	994	0.30	3	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	27	10.00	A8K6E9|A8MPU4|O75313|Q8N6E5|Q9UG05|Q9UG78|Q9UQE0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.L576M	ENST00000499869.2	37	c.1726	CCDS54740.1	4	.	.	.	.	.	.	.	.	.	.	G	12.76	2.035327	0.35893	.	.	ENSG00000071127	ENST00000499869;ENST00000382452;ENST00000382451;ENST00000502702;ENST00000439733	T;T;T;T	0.56103	0.67;0.67;0.48;0.48	5.7	4.74	0.60224	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.62660	0.2446	L	0.45051	1.395	0.54753	D	0.99998	D;P	0.89917	1.0;0.944	D;B	0.91635	0.999;0.437	T	0.59679	-0.7409	10	0.41790	T	0.15	-13.2696	12.033	0.53408	0.1134:0.0:0.8866:0.0	.	436;576	O75083-3;O75083	.;WDR1_HUMAN	M	576;576;436;436;411	ENSP00000427687:L576M;ENSP00000371890:L576M;ENSP00000371889:L436M;ENSP00000426725:L436M	ENSP00000371889:L436M	L	-	1	2	WDR1	9686195	0.998000	0.40836	0.982000	0.44146	0.948000	0.59901	1.847000	0.39299	2.689000	0.91719	0.462000	0.41574	CTG	-	superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom		0.532	WDR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR1	protein_coding	OTTHUMT00000359877.1	G		-		10077097	-1	no_errors	ENST00000382452	ensembl	human	known	74_37	missense	SNP	0.994	T
LRRC8A	56262	genome.wustl.edu	37	9	131669718	131669718	+	Missense_Mutation	SNP	C	C	T	rs150865438	byFrequency	TCGA-MB-A8JK-01A-11D-A36J-09	TCGA-MB-A8JK-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	307db8e1-7146-4506-b618-eba5076a6860	9be6e5e2-2506-4a0a-9cb7-a0fcb5e7834a	g.chr9:131669718C>T	ENST00000259324.5	+	3	798	c.275C>T	c.(274-276)aCg>aTg	p.T92M	LRRC8A_ENST00000372599.3_Missense_Mutation_p.T92M|LRRC8A_ENST00000372600.4_Missense_Mutation_p.T92M	NM_001127244.1	NP_001120716.1	Q8IWT6	LRC8A_HUMAN	leucine rich repeat containing 8 family, member A	92					anion transport (GO:0006820)|cell volume homeostasis (GO:0006884)|pre-B cell differentiation (GO:0002329)|response to osmotic stress (GO:0006970)	cell surface (GO:0009986)|ion channel complex (GO:0034702)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|skin(3)	28						ACCCCTGACACGGGCCCCACA	0.607													C|||	2	0.000399361	0.0	0.0	5008	,	,		17505	0.0		0.001	False		,,,				2504	0.001																0								ENSG00000136802	C	MET/THR,MET/THR,MET/THR	1,4405	2.1+/-5.4	0,1,2202	62.0	65.0	64.0		275,275,275	5.4	0.0	9	dbSNP_134	64	2,8598	2.2+/-6.3	0,2,4298	yes	missense,missense,missense	LRRC8A	NM_001127244.1,NM_001127245.1,NM_019594.3	81,81,81	0,3,6500	TT,TC,CC		0.0233,0.0227,0.0231	benign,benign,benign	92/811,92/811,92/811	131669718	3,13003	2203	4300	6503	LRRC8A	SO:0001583	missense	0			GMAF=0.0005	HGNC	AB037858	CCDS35155.1	9q34.2	2014-09-17	2005-06-29	2005-06-29	ENSG00000136802	ENSG00000136802			19027	protein-coding gene	gene with protein product		608360	"""leucine rich repeat containing 8"""	LRRC8			Standard	NM_001127244		Approved	KIAA1437, FLJ10337	uc010myp.3	Q8IWT6	OTTHUMG00000020766	ENST00000259324.5:c.275C>T	9.37:g.131669718C>T	ENSP00000259324:p.Thr92Met	Somatic	0	28	0.00		0.5423643324612125	90	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	32	11.11	Q6UXM2|Q8NCI0|Q9P2B1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_LRR_protein-8_N,pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.T92M	ENST00000259324.5	37	c.275	CCDS35155.1	9	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	7.033	0.560957	0.13498	2.27E-4	2.33E-4	ENSG00000136802	ENST00000372600;ENST00000372599;ENST00000259324	T;T;T	0.29142	1.58;1.58;1.58	5.41	5.41	0.78517	.	0.657806	0.16024	N	0.233174	T	0.20292	0.0488	N	0.08118	0	0.24725	N	0.993125	B	0.10296	0.003	B	0.08055	0.003	T	0.13548	-1.0505	10	0.36615	T	0.2	.	18.1836	0.89786	0.0:1.0:0.0:0.0	.	92	Q8IWT6	LRC8A_HUMAN	M	92	ENSP00000361682:T92M;ENSP00000361680:T92M;ENSP00000259324:T92M	ENSP00000259324:T92M	T	+	2	0	LRRC8A	130709539	0.004000	0.15560	0.007000	0.13788	0.435000	0.31806	2.108000	0.41854	2.537000	0.85549	0.563000	0.77884	ACG	-	NULL		0.607	LRRC8A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC8A	protein_coding	OTTHUMT00000054516.2	C	NM_019594	rs150865438		131669718	+1	no_errors	ENST00000259324	ensembl	human	known	74_37	missense	SNP	0.364	T
MYH3	4621	genome.wustl.edu	37	17	10541190	10541190	+	Missense_Mutation	SNP	A	A	T			TCGA-MB-A8JK-01A-11D-A36J-09	TCGA-MB-A8JK-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	307db8e1-7146-4506-b618-eba5076a6860	9be6e5e2-2506-4a0a-9cb7-a0fcb5e7834a	g.chr17:10541190A>T	ENST00000583535.1	-	28	3879	c.3792T>A	c.(3790-3792)aaT>aaA	p.N1264K	MYH3_ENST00000226209.7_Missense_Mutation_p.N1264K	NM_002470.3	NP_002461.2	P11055	MYH3_HUMAN	myosin, heavy chain 3, skeletal muscle, embryonic	1264					actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|embryonic limb morphogenesis (GO:0030326)|face morphogenesis (GO:0060325)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|sarcomere organization (GO:0045214)|skeletal muscle contraction (GO:0003009)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(5)|large_intestine(18)|lung(30)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	83						GAATTTCCTCATTCTTGCCCC	0.527																																																	0								ENSG00000109063						78.0	69.0	72.0					17																	10541190		2203	4300	6503	MYH3	SO:0001583	missense	0			-	HGNC		CCDS11157.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109063	ENSG00000109063		"""Myosins / Myosin superfamily : Class II"""	7573	protein-coding gene	gene with protein product	"""myosin, skeletal, heavy chain, embryonic 1"", ""muscle embryonic myosin heavy chain 3"""	160720	"""myosin, heavy polypeptide 3, skeletal muscle, embryonic"""			2726495	Standard	NM_002470		Approved	MYHC-EMB, MYHSE1, HEMHC, SMHCE	uc002gmq.2	P11055	OTTHUMG00000130367	ENST00000583535.1:c.3792T>A	17.37:g.10541190A>T	ENSP00000464317:p.Asn1264Lys	Somatic	0	59	0.00		0.5423643324612125	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	11	38.89	Q15492	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.N1264K	ENST00000583535.1	37	c.3792	CCDS11157.1	17	.	.	.	.	.	.	.	.	.	.	A	11.93	1.786336	0.31593	.	.	ENSG00000109063	ENST00000226209	T	0.77358	-1.09	5.36	-8.36	0.00980	Myosin tail (1);	.	.	.	.	T	0.66458	0.2791	M	0.64997	1.995	0.23043	N	0.99838	B	0.17268	0.021	B	0.25987	0.065	T	0.53809	-0.8386	9	0.30078	T	0.28	.	3.9801	0.09492	0.3499:0.1232:0.4004:0.1266	.	1264	P11055	MYH3_HUMAN	K	1264	ENSP00000226209:N1264K	ENSP00000226209:N1264K	N	-	3	2	MYH3	10481915	0.000000	0.05858	0.915000	0.36163	0.834000	0.47266	-1.492000	0.02300	-1.074000	0.03132	-0.290000	0.09829	AAT	-	pfam_Myosin_tail,superfamily_Prefoldin		0.527	MYH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH3	protein_coding	OTTHUMT00000252734.2	A	NM_002470	-		10541190	-1	no_errors	ENST00000226209	ensembl	human	known	74_37	missense	SNP	0.050	T
XPO1	7514	genome.wustl.edu	37	2	61726050	61726051	+	Splice_Site	INS	-	-	A	rs372688892		TCGA-MB-A8JK-01A-11D-A36J-09	TCGA-MB-A8JK-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	307db8e1-7146-4506-b618-eba5076a6860	9be6e5e2-2506-4a0a-9cb7-a0fcb5e7834a	g.chr2:61726050_61726051insA	ENST00000401558.2	-	8	1318		c.e8-2		XPO1_ENST00000406957.1_Splice_Site|XPO1_ENST00000404992.2_Splice_Site	NM_003400.3	NP_003391.1	O14980	XPO1_HUMAN	exportin 1						gene expression (GO:0010467)|intracellular transport of virus (GO:0075733)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|mRNA transport (GO:0051028)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|protein export from nucleus (GO:0006611)|protein localization to nucleus (GO:0034504)|regulation of centrosome duplication (GO:0010824)|regulation of protein catabolic process (GO:0042176)|regulation of protein export from nucleus (GO:0046825)|response to drug (GO:0042493)|ribosomal large subunit export from nucleus (GO:0000055)|ribosomal small subunit export from nucleus (GO:0000056)|RNA metabolic process (GO:0016070)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral life cycle (GO:0019058)|viral process (GO:0016032)	annulate lamellae (GO:0005642)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleocytoplasmic transporter activity (GO:0005487)|protein transporter activity (GO:0008565)|RNA binding (GO:0003723)|transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(5)|lung(5)|ovary(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	39			LUSC - Lung squamous cell carcinoma(7;5.71e-05)|Epithelial(17;0.0662)|all cancers(80;0.226)			TTGCACATGCTAAAAAAAAAAA	0.262			Mis		CLL																																		-'	Dom	yes		2	2p15	7514	"""exportin 1 (CRM1 homolog, yeast)"""		L	0								ENSG00000082898																																			XPO1	SO:0001630	splice_region_variant	0				HGNC	Y08614	CCDS33205.1	2p15	2014-02-19	2014-02-19		ENSG00000082898	ENSG00000082898		"""Exportins"""	12825	protein-coding gene	gene with protein product	"""chromosome region maintenance 1 homolog (yeast)"""	602559	"""exportin 1 (CRM1, yeast, homolog)"", ""exportin 1 (CRM1 homolog, yeast)"""			9205132, 9368044	Standard	XM_005264544		Approved	CRM1, emb	uc002sbj.3	O14980	OTTHUMG00000152316	ENST00000401558.2:c.591-2->T	2.37:g.61726061_61726061dupA		Somatic	0	21	0.00		0.5423643324612125	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	22	12.00	A6NL14|A8K1K5|D6W5E2|Q63HP8|Q68CP3|Q99433	Splice_Site	INS	NA	NA	NA	NA	NA	NA	-	e7-2	ENST00000401558.2	37	c.591-3_591-2	CCDS33205.1	2																																																																																			-	-		0.262	XPO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XPO1	protein_coding	OTTHUMT00000325872.3	-	NM_003400		Intron	61726051	-1	no_errors	ENST00000401558	ensembl	human	known	74_37	splice_site_ins	INS	1.000:0.996	A
MAT2B	27430	genome.wustl.edu	37	5	162943725	162943725	+	Intron	SNP	G	G	C			TCGA-MB-A8JK-01A-11D-A36J-09	TCGA-MB-A8JK-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	307db8e1-7146-4506-b618-eba5076a6860	9be6e5e2-2506-4a0a-9cb7-a0fcb5e7834a	g.chr5:162943725G>C	ENST00000321757.6	+	5	859				MAT2B_ENST00000518095.1_Missense_Mutation_p.R243T|MAT2B_ENST00000280969.5_Intron	NM_013283.3	NP_037415.1	Q9NZL9	MAT2B_HUMAN	methionine adenosyltransferase II, beta						cellular nitrogen compound metabolic process (GO:0034641)|extracellular polysaccharide biosynthetic process (GO:0045226)|methylation (GO:0032259)|one-carbon metabolic process (GO:0006730)|regulation of catalytic activity (GO:0050790)|S-adenosylmethionine biosynthetic process (GO:0006556)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|methionine adenosyltransferase complex (GO:0048269)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	dTDP-4-dehydrorhamnose reductase activity (GO:0008831)|enzyme binding (GO:0019899)|methionine adenosyltransferase regulator activity (GO:0048270)			endometrium(3)|large_intestine(4)|lung(6)|upper_aerodigestive_tract(1)	14	Renal(175;0.000281)	Medulloblastoma(196;0.0208)|all_neural(177;0.0765)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.027)|OV - Ovarian serous cystadenocarcinoma(192;0.0406)|Epithelial(171;0.0797)	L-Methionine(DB00134)	CTGGTAAGAAGGATTCCTGAG	0.493																																																	0								ENSG00000038274						70.0	66.0	67.0					5																	162943725		2203	4300	6503	MAT2B	SO:0001627	intron_variant	0			-	HGNC	AF182814	CCDS4364.1, CCDS4365.1	5q34-q35	2011-09-14			ENSG00000038274	ENSG00000038274		"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	6905	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 23E, member 1"""	605527				9055605, 10644686, 19027726	Standard	NM_182796		Approved	MATIIbeta, SDR23E1	uc003lzk.4	Q9NZL9	OTTHUMG00000130379	ENST00000321757.6:c.720+8G>C	5.37:g.162943725G>C		Somatic	0	60	0.00		0.5423643324612125	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	43	28.33	B2R5Y6|Q1WAI7|Q27J92|Q3LIE8|Q567T7|Q6NYC7|Q9BS89|Q9H3E1|Q9UJ54	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_dTDP_dehydrorham_reduct,pfam_Epimerase_deHydtase,pfam_Polysac_CapD-like	p.R243T	ENST00000321757.6	37	c.728	CCDS4365.1	5	.	.	.	.	.	.	.	.	.	.	G	9.889	1.203760	0.22121	.	.	ENSG00000038274	ENST00000518095	.	.	.	3.6	-7.21	0.01490	.	.	.	.	.	T	0.15349	0.0370	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.17471	-1.0368	6	.	.	.	.	2.5912	0.04843	0.2162:0.1633:0.4478:0.1726	.	243	Q9NZL9-3	.	T	243	.	.	R	+	2	0	MAT2B	162876303	0.682000	0.27624	0.000000	0.03702	0.143000	0.21401	-0.340000	0.07821	-2.378000	0.00596	-0.708000	0.03648	AGG	-	NULL		0.493	MAT2B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MAT2B	protein_coding	OTTHUMT00000252749.2	G	NM_013283	-		162943725	+1	no_errors	ENST00000518095	ensembl	human	known	74_37	missense	SNP	0.000	C
PQLC2L	152078	genome.wustl.edu	37	3	157318056	157318056	+	Missense_Mutation	SNP	G	G	T			TCGA-MB-A8JK-01A-11D-A36J-09	TCGA-MB-A8JK-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	307db8e1-7146-4506-b618-eba5076a6860	9be6e5e2-2506-4a0a-9cb7-a0fcb5e7834a	g.chr3:157318056G>T	ENST00000449199.2	+	5	518	c.377G>T	c.(376-378)tGc>tTc	p.C126F	C3orf55_ENST00000461040.1_Intron|C3orf55_ENST00000426338.2_Silent_p.L96L	NM_001130002.2	NP_001123474.1	A1A4F0	CC055_HUMAN		126										breast(1)|lung(1)	2			Lung(72;0.0215)|LUSC - Lung squamous cell carcinoma(72;0.037)			GGAGTCCTCTGCCCTGTATAT	0.388																																																	0								ENSG00000174899						74.0	64.0	67.0					3																	157318056		692	1591	2283	C3orf55	SO:0001583	missense	0			-	HGNC																												ENST00000449199.2:c.377G>T	3.37:g.157318056G>T	ENSP00000413228:p.Cys126Phe	Somatic	0	64	0.00		0.5423643324612125	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	35	10.26	C9JP04|C9JXB5|Q8N6Q6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.C126F	ENST00000449199.2	37	c.377	CCDS46943.1	3	.	.	.	.	.	.	.	.	.	.	G	9.149	1.015889	0.19355	.	.	ENSG00000174899	ENST00000449199	T	0.53640	0.61	3.54	-2.96	0.05547	.	.	.	.	.	T	0.30324	0.0761	.	.	.	0.09310	N	1	B	0.14805	0.011	B	0.10450	0.005	T	0.27673	-1.0067	8	0.72032	D	0.01	.	3.307	0.07003	0.2666:0.0:0.2616:0.4718	.	126	A1A4F0	CC055_HUMAN	F	126	ENSP00000413228:C126F	ENSP00000413228:C126F	C	+	2	0	C3orf55	158800750	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-0.935000	0.03950	-0.683000	0.05190	0.655000	0.94253	TGC	-	NULL		0.388	C3orf55-003	KNOWN	basic|appris_principal|CCDS	protein_coding	C3orf55	protein_coding	OTTHUMT00000352018.1	G		-		157318056	+1	no_errors	ENST00000449199	ensembl	human	known	74_37	missense	SNP	0.000	T
FGFR2	2263	genome.wustl.edu	37	10	123278339	123278339	+	Intron	SNP	G	G	T			TCGA-MB-A8JK-01A-11D-A36J-09	TCGA-MB-A8JK-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	307db8e1-7146-4506-b618-eba5076a6860	9be6e5e2-2506-4a0a-9cb7-a0fcb5e7834a	g.chr10:123278339G>T	ENST00000358487.5	-	7	1212				FGFR2_ENST00000369060.4_Intron|FGFR2_ENST00000356226.4_Intron|FGFR2_ENST00000357555.5_Intron|FGFR2_ENST00000478859.1_Intron|FGFR2_ENST00000369059.1_Nonsense_Mutation_p.S200*|FGFR2_ENST00000346997.2_Intron|FGFR2_ENST00000457416.2_Nonsense_Mutation_p.S315*|FGFR2_ENST00000369061.4_Intron|FGFR2_ENST00000360144.3_Nonsense_Mutation_p.S226*|FGFR2_ENST00000351936.6_Intron|FGFR2_ENST00000490349.1_5'UTR|FGFR2_ENST00000369056.1_Nonsense_Mutation_p.S315*	NM_000141.4	NP_000132.3	P21802	FGFR2_HUMAN	fibroblast growth factor receptor 2						angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|axonogenesis (GO:0007409)|bone development (GO:0060348)|bone mineralization (GO:0030282)|bone morphogenesis (GO:0060349)|branch elongation involved in salivary gland morphogenesis (GO:0060667)|branching involved in labyrinthine layer morphogenesis (GO:0060670)|branching involved in prostate gland morphogenesis (GO:0060442)|branching involved in salivary gland morphogenesis (GO:0060445)|branching morphogenesis of a nerve (GO:0048755)|bud elongation involved in lung branching (GO:0060449)|cell fate commitment (GO:0045165)|cell-cell signaling (GO:0007267)|coronal suture morphogenesis (GO:0060365)|digestive tract development (GO:0048565)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic organ development (GO:0048568)|embryonic organ morphogenesis (GO:0048562)|embryonic pattern specification (GO:0009880)|endodermal digestive tract morphogenesis (GO:0061031)|epidermal growth factor receptor signaling pathway (GO:0007173)|epidermis morphogenesis (GO:0048730)|epithelial cell differentiation (GO:0030855)|epithelial cell proliferation involved in salivary gland morphogenesis (GO:0060664)|epithelial to mesenchymal transition (GO:0001837)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|fibroblast growth factor receptor signaling pathway involved in hemopoiesis (GO:0035603)|fibroblast growth factor receptor signaling pathway involved in mammary gland specification (GO:0060595)|fibroblast growth factor receptor signaling pathway involved in negative regulation of apoptotic process in bone marrow (GO:0035602)|fibroblast growth factor receptor signaling pathway involved in orbitofrontal cortex development (GO:0035607)|fibroblast growth factor receptor signaling pathway involved in positive regulation of cell proliferation in bone marrow (GO:0035604)|gland morphogenesis (GO:0022612)|hair follicle morphogenesis (GO:0031069)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|insulin receptor signaling pathway (GO:0008286)|lacrimal gland development (GO:0032808)|lateral sprouting from an epithelium (GO:0060601)|lens fiber cell development (GO:0070307)|limb bud formation (GO:0060174)|lung alveolus development (GO:0048286)|lung development (GO:0030324)|lung lobe morphogenesis (GO:0060463)|lung-associated mesenchyme development (GO:0060484)|mammary gland bud formation (GO:0060615)|membranous septum morphogenesis (GO:0003149)|mesenchymal cell differentiation (GO:0048762)|mesenchymal cell differentiation involved in lung development (GO:0060915)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesodermal cell differentiation (GO:0048333)|midbrain development (GO:0030901)|morphogenesis of embryonic epithelium (GO:0016331)|multicellular organism growth (GO:0035264)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of mitosis (GO:0045839)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuromuscular junction development (GO:0007528)|neurotrophin TRK receptor signaling pathway (GO:0048011)|odontogenesis (GO:0042476)|orbitofrontal cortex development (GO:0021769)|organ growth (GO:0035265)|organ morphogenesis (GO:0009887)|otic vesicle formation (GO:0030916)|outflow tract septum morphogenesis (GO:0003148)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|post-embryonic development (GO:0009791)|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis (GO:0060527)|prostate epithelial cord elongation (GO:0060523)|prostate gland morphogenesis (GO:0060512)|protein autophosphorylation (GO:0046777)|pyramidal neuron development (GO:0021860)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|regulation of cell fate commitment (GO:0010453)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of morphogenesis of a branching structure (GO:0060688)|regulation of multicellular organism growth (GO:0040014)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoblast proliferation (GO:0033688)|regulation of smooth muscle cell differentiation (GO:0051150)|regulation of smoothened signaling pathway (GO:0008589)|reproductive structure development (GO:0048608)|skeletal system morphogenesis (GO:0048705)|squamous basal epithelial stem cell differentiation involved in prostate gland acinus development (GO:0060529)|synaptic vesicle transport (GO:0048489)|ureteric bud development (GO:0001657)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|ventricular zone neuroblast division (GO:0021847)	cell cortex (GO:0005938)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|excitatory synapse (GO:0060076)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|heparin binding (GO:0008201)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)			breast(3)|central_nervous_system(3)|cervix(2)|endometrium(98)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(7)|lung(21)|ovary(4)|skin(30)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(2)	181		Lung NSC(174;0.0841)|all_lung(145;0.106)|all_neural(114;0.107)	STAD - Stomach adenocarcinoma(1;7.52e-05)|all cancers(1;0.0722)	all cancers(201;9.73e-05)|GBM - Glioblastoma multiforme(135;0.0845)	Palifermin(DB00039)|Ponatinib(DB08901)|Regorafenib(DB08896)|Thalidomide(DB01041)	ATTTATCCCCGAGTGCTAGAA	0.468		5	Mis		"""gastric. NSCLC, endometrial"""		"""Crouzon, Pfeiffer, and Apert syndromes"""		Saethre-Chotzen syndrome;Apert syndrome																															Dom	yes		10	10q26	2263	fibroblast growth factor receptor 2	yes	E	0								ENSG00000066468						79.0	74.0	76.0					10																	123278339		1987	4155	6142	FGFR2	SO:0001627	intron_variant	0	Familial Cancer Database	Acrocephalosyndactyly type III;Acrocephalosyndactyly type I and II, ACS1. ACS2, incl Apert-Crouzon s.	-	HGNC	AK026508	CCDS7620.2, CCDS31298.1, CCDS44485.1, CCDS44486.1, CCDS44487.1, CCDS44488.1, CCDS44489.1, CCDS53584.1, CCDS73210.1	10q25.3-q26	2013-01-11	2008-08-01		ENSG00000066468	ENSG00000066468		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3689	protein-coding gene	gene with protein product	"""Crouzon syndrome"", ""Pfeiffer syndrome"""	176943	"""bacteria-expressed kinase"", ""keratinocyte growth factor receptor"", ""craniofacial dysostosis 1"", ""Jackson-Weiss syndrome"""	KGFR, BEK, CFD1, JWS			Standard	NM_022970		Approved	CEK3, TK14, TK25, ECT1, K-SAM, CD332	uc021pzy.1	P21802	OTTHUMG00000019175	ENST00000358487.5:c.939+1153C>A	10.37:g.123278339G>T		Somatic	0	35	0.00		0.5423643324612125	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	33	10.81	B4DFC2|E7EVR6|E9PCR0|P18443|Q01742|Q12922|Q14300|Q14301|Q14302|Q14303|Q14304|Q14305|Q14672|Q14718|Q14719|Q1KHY5|Q86YI4|Q8IXC7|Q96KL9|Q96KM0|Q96KM1|Q96KM2|Q9NZU2|Q9NZU3|Q9UD01|Q9UD02|Q9UIH3|Q9UIH4|Q9UIH5|Q9UIH6|Q9UIH7|Q9UIH8|Q9UM87|Q9UMC6|Q9UNS7|Q9UQH7|Q9UQH8|Q9UQH9|Q9UQI0	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_FGF_rcpt_fam,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.S315*	ENST00000358487.5	37	c.944	CCDS31298.1	10	.	.	.	.	.	.	.	.	.	.	G	46	12.196113	0.99645	.	.	ENSG00000066468	ENST00000369059;ENST00000457416;ENST00000360144;ENST00000369056;ENST00000369058	.	.	.	6.01	6.01	0.97437	.	0.207951	0.49916	D	0.000128	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.30854	T	0.27	.	20.5211	0.99222	0.0:0.0:1.0:0.0	.	.	.	.	X	200;315;226;315;315	.	ENSP00000353262:S226X	S	-	2	0	FGFR2	123268329	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.860000	0.99555	2.861000	0.98227	0.650000	0.86243	TCG	-	pirsf_FGF_rcpt_fam,pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.468	FGFR2-001	KNOWN	non_canonical_conserved|basic|appris_candidate|CCDS	protein_coding	FGFR2	protein_coding	OTTHUMT00000050715.1	G	NM_022976, NM_000141	-		123278339	-1	no_errors	ENST00000457416	ensembl	human	known	74_37	nonsense	SNP	1.000	T
MYBPC2	4606	genome.wustl.edu	37	19	50962526	50962526	+	Missense_Mutation	SNP	C	C	G			TCGA-MB-A8JK-01A-11D-A36J-09	TCGA-MB-A8JK-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	307db8e1-7146-4506-b618-eba5076a6860	9be6e5e2-2506-4a0a-9cb7-a0fcb5e7834a	g.chr19:50962526C>G	ENST00000357701.5	+	23	2805	c.2754C>G	c.(2752-2754)aaC>aaG	p.N918K		NM_004533.3	NP_004524.3	Q14324	MYPC2_HUMAN	myosin binding protein C, fast type	918	Ig-like C2-type 6.				cell adhesion (GO:0007155)|muscle filament sliding (GO:0030049)	cytosol (GO:0005829)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)			breast(1)	1		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.0079)|GBM - Glioblastoma multiforme(134;0.0144)		AGATCGAGAACATGAAGGACA	0.701																																																	0								ENSG00000086967						24.0	28.0	27.0					19																	50962526		2099	4218	6317	MYBPC2	SO:0001583	missense	0			-	HGNC		CCDS46152.1	19q13.33	2013-02-11	2001-11-28		ENSG00000086967	ENSG00000086967		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7550	protein-coding gene	gene with protein product	"""fast-type muscle myosin-binding-protein C"""	160793	"""myosin-binding protein C, fast-type"""			8375400	Standard	NM_004533		Approved	MYBPCF, MYBPC, MGC163408	uc002psf.2	Q14324		ENST00000357701.5:c.2754C>G	19.37:g.50962526C>G	ENSP00000350332:p.Asn918Lys	Somatic	0	51	0.00		0.5423643324612125	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	30	16.67	A1L4G9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.N918K	ENST00000357701.5	37	c.2754	CCDS46152.1	19	.	.	.	.	.	.	.	.	.	.	c	16.68	3.191342	0.58017	.	.	ENSG00000086967	ENST00000357701	T	0.66460	-0.21	3.74	3.74	0.42951	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);	0.000000	0.37530	U	0.002055	T	0.59595	0.2205	M	0.71920	2.185	0.41445	D	0.987942	B	0.19200	0.034	B	0.27887	0.084	T	0.51903	-0.8646	10	0.05436	T	0.98	.	9.849	0.41046	0.0:0.891:0.0:0.109	.	918	Q14324	MYPC2_HUMAN	K	918	ENSP00000350332:N918K	ENSP00000350332:N918K	N	+	3	2	MYBPC2	55654338	1.000000	0.71417	1.000000	0.80357	0.890000	0.51754	2.718000	0.47236	2.026000	0.59711	0.401000	0.26515	AAC	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.701	MYBPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYBPC2	protein_coding	OTTHUMT00000464751.1	C	NM_004533	-		50962526	+1	no_errors	ENST00000357701	ensembl	human	known	74_37	missense	SNP	1.000	G
SURF6	6838	genome.wustl.edu	37	9	136199122	136199122	+	Missense_Mutation	SNP	C	C	A			TCGA-MB-A8JK-01A-11D-A36J-09	TCGA-MB-A8JK-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	307db8e1-7146-4506-b618-eba5076a6860	9be6e5e2-2506-4a0a-9cb7-a0fcb5e7834a	g.chr9:136199122C>A	ENST00000372022.4	-	5	934	c.669G>T	c.(667-669)agG>agT	p.R223S	SURF6_ENST00000468290.1_5'UTR	NM_006753.4	NP_006744.2	O75683	SURF6_HUMAN	surfeit 6	223					ribosome biogenesis (GO:0042254)	granular component (GO:0001652)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(1)|large_intestine(5)|lung(5)|ovary(1)	12				OV - Ovarian serous cystadenocarcinoma(145;1.16e-06)|Epithelial(140;8.34e-06)|all cancers(34;7.08e-05)		TCCCCTTCACCCTCTGCCTCT	0.667																																																	0								ENSG00000148296						59.0	64.0	62.0					9																	136199122		2203	4289	6492	SURF6	SO:0001583	missense	0			-	HGNC	AF186772	CCDS6962.1	9q33-q34	2010-07-06			ENSG00000148296	ENSG00000148296			11478	protein-coding gene	gene with protein product	"""surfeit locus protein 6"""	185642				9740673, 15629442	Standard	NM_006753		Approved	FLJ30322, RRP14	uc004cdb.4	O75683	OTTHUMG00000020871	ENST00000372022.4:c.669G>T	9.37:g.136199122C>A	ENSP00000361092:p.Arg223Ser	Somatic	0	25	0.00		0.5423643324612125	74	30.19	32	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	21	32.26	Q5T8U1|Q9BRK9|Q9BTZ5|Q9UK24	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Surf6	p.R223S	ENST00000372022.4	37	c.669	CCDS6962.1	9	.	.	.	.	.	.	.	.	.	.	C	10.90	1.479899	0.26511	.	.	ENSG00000148296	ENST00000372022	T	0.13901	2.55	4.94	1.82	0.25136	.	0.716909	0.13252	N	0.401984	T	0.08846	0.0219	L	0.34521	1.04	0.19300	N	0.99998	B	0.18610	0.029	B	0.14023	0.01	T	0.35375	-0.9791	10	0.18710	T	0.47	-8.4624	6.0412	0.19736	0.1479:0.619:0.0:0.2331	.	223	O75683	SURF6_HUMAN	S	223	ENSP00000361092:R223S	ENSP00000361092:R223S	R	-	3	2	SURF6	135188943	0.000000	0.05858	0.991000	0.47740	0.887000	0.51463	-0.413000	0.07123	1.022000	0.39626	0.467000	0.42956	AGG	-	pfam_Surf6		0.667	SURF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SURF6	protein_coding	OTTHUMT00000054905.1	C	NM_006753	-		136199122	-1	no_errors	ENST00000372022	ensembl	human	known	74_37	missense	SNP	0.187	A
DLG5	9231	genome.wustl.edu	37	10	79565430	79565430	+	Silent	SNP	G	G	T			TCGA-MB-A8JK-01A-11D-A36J-09	TCGA-MB-A8JK-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	307db8e1-7146-4506-b618-eba5076a6860	9be6e5e2-2506-4a0a-9cb7-a0fcb5e7834a	g.chr10:79565430G>T	ENST00000372391.2	-	27	5162	c.5157C>A	c.(5155-5157)ctC>ctA	p.L1719L	DLG5_ENST00000459739.1_5'UTR|DLG5_ENST00000372388.2_Silent_p.L1379L	NM_004747.3	NP_004738.3	Q8TDM6	DLG5_HUMAN	discs, large homolog 5 (Drosophila)	1719					apical protein localization (GO:0045176)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|intracellular signal transduction (GO:0035556)|metanephric collecting duct development (GO:0072205)|midbrain development (GO:0030901)|negative regulation of cell proliferation (GO:0008285)|polarized epithelial cell differentiation (GO:0030859)|protein complex assembly (GO:0006461)|protein localization to adherens junction (GO:0071896)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|zonula adherens assembly (GO:0045186)	cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|cytoskeletal protein binding (GO:0008092)|receptor signaling complex scaffold activity (GO:0030159)			breast(9)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(8)|lung(17)|ovary(5)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	60	all_cancers(46;0.0316)|all_epithelial(25;0.00147)|Breast(12;0.0015)|Prostate(51;0.0146)		Epithelial(14;0.00105)|OV - Ovarian serous cystadenocarcinoma(4;0.00151)|all cancers(16;0.00446)			TGCCTTCAAAGAGTGGAATGG	0.527																																																	0								ENSG00000151208						119.0	96.0	104.0					10																	79565430		2203	4300	6503	DLG5	SO:0001819	synonymous_variant	0			-	HGNC	U61843	CCDS7353.2	10q23	2008-07-09	2001-11-28		ENSG00000151208	ENSG00000151208			2904	protein-coding gene	gene with protein product		604090	"""discs, large (Drosophila) homolog 5"""			9738934	Standard	XM_005270276		Approved	P-dlg, KIAA0583	uc001jzk.3	Q8TDM6	OTTHUMG00000018548	ENST00000372391.2:c.5157C>A	10.37:g.79565430G>T		Somatic	0	59	0.00		0.5423643324612125	123	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	A6H8Y3|Q149N1|Q5T1H7|Q5T1H8|Q6DKG3|Q86WC0|Q8TDM7|Q9UE73|Q9Y4E3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_PDZ,pfam_DUF622,pfam_GK/Ca_channel_bsu,superfamily_P-loop_NTPase,superfamily_PDZ,superfamily_SH3_domain,superfamily_DEATH-like_dom,smart_PDZ,smart_SH3_domain,smart_GK/Ca_channel_bsu,pfscan_CARD,pfscan_PDZ,pfscan_SH3_domain,pfscan_Guanylate_kin-like	p.L1719	ENST00000372391.2	37	c.5157	CCDS7353.2	10																																																																																			-	NULL		0.527	DLG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DLG5	protein_coding	OTTHUMT00000048900.2	G		-		79565430	-1	no_errors	ENST00000372391	ensembl	human	known	74_37	silent	SNP	1.000	T
ADAM30	11085	genome.wustl.edu	37	1	120438051	120438051	+	Missense_Mutation	SNP	A	A	T			TCGA-MB-A8JK-01A-11D-A36J-09	TCGA-MB-A8JK-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	307db8e1-7146-4506-b618-eba5076a6860	9be6e5e2-2506-4a0a-9cb7-a0fcb5e7834a	g.chr1:120438051A>T	ENST00000369400.1	-	1	1067	c.909T>A	c.(907-909)gaT>gaA	p.D303E		NM_021794.3	NP_068566.2	Q9UKF2	ADA30_HUMAN	ADAM metallopeptidase domain 30	303	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				binding of sperm to zona pellucida (GO:0007339)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(11)|lung(16)|ovary(2)|skin(2)	38	all_cancers(5;7.07e-10)|all_epithelial(5;1.62e-10)|all_neural(166;0.153)|Breast(55;0.234)	all_lung(203;1.55e-06)|Lung NSC(69;1.04e-05)|all_epithelial(167;0.00138)		Lung(183;0.0204)|LUSC - Lung squamous cell carcinoma(189;0.117)		ATGCAAGAGCATCATTATATT	0.363																																																	0								ENSG00000134249						57.0	59.0	58.0					1																	120438051		2203	4300	6503	ADAM30	SO:0001583	missense	0			-	HGNC	AF171932	CCDS907.1	1p12	2012-05-16	2005-08-18		ENSG00000134249	ENSG00000134249		"""ADAM metallopeptidase domain containing"""	208	protein-coding gene	gene with protein product		604779	"""a disintegrin and metalloproteinase domain 30"""				Standard	NM_021794		Approved	svph4	uc001eij.3	Q9UKF2	OTTHUMG00000012176	ENST00000369400.1:c.909T>A	1.37:g.120438051A>T	ENSP00000358407:p.Asp303Glu	Somatic	0	29	0.00		0.5423643324612125	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	19	13.64	A8K8W8|Q5T3X6|Q9UKF1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_ADAM_Cys-rich,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_EG-like_dom,pfscan_Peptidase_M12B,prints_Blood-coag_inhib_Disintegrin	p.D303E	ENST00000369400.1	37	c.909	CCDS907.1	1	.	.	.	.	.	.	.	.	.	.	A	12.05	1.820747	0.32145	.	.	ENSG00000134249	ENST00000369400;ENST00000543066	T	0.10005	2.92	4.88	-0.242	0.13039	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.310755	0.22744	U	0.056169	T	0.02571	0.0078	M	0.72118	2.19	0.09310	N	1	B	0.23249	0.082	B	0.29663	0.105	T	0.48536	-0.9027	10	0.06625	T	0.88	.	3.309	0.07010	0.5457:0.0:0.285:0.1693	.	303	Q9UKF2	ADA30_HUMAN	E	303	ENSP00000358407:D303E	ENSP00000358407:D303E	D	-	3	2	ADAM30	120239574	0.000000	0.05858	0.001000	0.08648	0.064000	0.16182	-0.870000	0.04228	-0.206000	0.10203	0.460000	0.39030	GAT	-	pfam_Peptidase_M12B,pfscan_Peptidase_M12B		0.363	ADAM30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM30	protein_coding	OTTHUMT00000033678.1	A	NM_021794	-		120438051	-1	no_errors	ENST00000369400	ensembl	human	known	74_37	missense	SNP	0.004	T
CTTN	2017	genome.wustl.edu	37	11	70265954	70265954	+	Frame_Shift_Del	DEL	C	C	-			TCGA-MB-A8JK-01A-11D-A36J-09	TCGA-MB-A8JK-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	307db8e1-7146-4506-b618-eba5076a6860	9be6e5e2-2506-4a0a-9cb7-a0fcb5e7834a	g.chr11:70265954delC	ENST00000301843.8	+	9	877	c.671delC	c.(670-672)tccfs	p.S224fs	CTTN_ENST00000346329.3_Frame_Shift_Del_p.S224fs|CTTN_ENST00000376561.3_Frame_Shift_Del_p.S224fs|CTTN_ENST00000538675.1_5'Flank	NM_005231.3	NP_005222.2	Q14247	SRC8_HUMAN	cortactin	224					negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|mitotic spindle midzone (GO:1990023)|ruffle (GO:0001726)				breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(14)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(1)	31			BRCA - Breast invasive adenocarcinoma(2;4.34e-41)|LUSC - Lung squamous cell carcinoma(11;1.51e-13)|STAD - Stomach adenocarcinoma(18;0.0513)	Lung(977;0.0234)|LUSC - Lung squamous cell carcinoma(976;0.133)		AAGCACGAGTCCCAGAAAGGT	0.478																																																	0								ENSG00000085733						81.0	67.0	72.0					11																	70265954		2200	4294	6494	CTTN	SO:0001589	frameshift_variant	0				HGNC	AJ288897	CCDS8197.1, CCDS41680.1, CCDS53676.1	11q13	2008-02-05	2004-06-08	2004-06-09	ENSG00000085733	ENSG00000085733			3338	protein-coding gene	gene with protein product		164765	"""ems1 sequence (mammary tumor and squamous cell carcinoma-associated (p80/85 src substrate)"""	EMS1		7685625	Standard	NM_005231		Approved		uc001opu.3	Q14247	OTTHUMG00000134307	ENST00000301843.8:c.671delC	11.37:g.70265954delC	ENSP00000301843:p.Ser224fs	Somatic	0	64	0.00		0.5423643324612125	231	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	50	31.51	Q8N707|Q96H99	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Hs1_Cortactin,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_Hs1_Cortactin,pfscan_SH3_domain,prints_SH3_domain,prints_p67phox	p.Q225fs	ENST00000301843.8	37	c.671	CCDS41680.1	11																																																																																			-	pfam_Hs1_Cortactin,pfscan_Hs1_Cortactin		0.478	CTTN-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CTTN	protein_coding	OTTHUMT00000259233.2	C	NM_138565			70265954	+1	no_errors	ENST00000301843	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
GRIA4	2893	genome.wustl.edu	37	11	105850542	105850542	+	3'UTR	SNP	C	C	T			TCGA-MB-A8JK-01A-11D-A36J-09	TCGA-MB-A8JK-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	307db8e1-7146-4506-b618-eba5076a6860	9be6e5e2-2506-4a0a-9cb7-a0fcb5e7834a	g.chr11:105850542C>T	ENST00000530497.1	+	0	2785				GRIA4_ENST00000533094.1_3'UTR|GRIA4_ENST00000393127.2_3'UTR|GRIA4_ENST00000282499.5_3'UTR			P48058	GRIA4_HUMAN	glutamate receptor, ionotropic, AMPA 4						glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|vesicle (GO:0031982)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(24)|liver(2)|lung(25)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(6)	82		Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Breast(348;0.0323)		BRCA - Breast invasive adenocarcinoma(274;0.000147)|Epithelial(105;0.0291)|all cancers(92;0.0899)		GGACACGCCACGCGCGGGTCT	0.522																																																	0								ENSG00000152578																																			GRIA4	SO:0001624	3_prime_UTR_variant	0			-	HGNC	U16129	CCDS8333.1, CCDS41706.1, CCDS41707.1	11q22	2012-08-29	2012-02-03		ENSG00000152578	ENSG00000152578		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4574	protein-coding gene	gene with protein product		138246	"""glutamate receptor, ionotrophic, AMPA 4"""	GLUR4			Standard	NM_001077244		Approved	GluA4, GLURD	uc001pix.2	P48058	OTTHUMG00000166236	ENST00000530497.1:c.*76C>T	11.37:g.105850542C>T		Somatic	0	26	0.00		0.5423643324612125	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	13	43.48	Q86XE8	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000530497.1	37	NULL	CCDS8333.1	11																																																																																			-	-		0.522	GRIA4-005	KNOWN	basic|CCDS	protein_coding	GRIA4	protein_coding	OTTHUMT00000388593.1	C		-		105850542	+1	no_errors	ENST00000533094	ensembl	human	putative	74_37	rna	SNP	0.000	T
SEC14L5	9717	genome.wustl.edu	37	16	5061242	5061242	+	Nonsense_Mutation	SNP	C	C	A			TCGA-MB-A8JK-01A-11D-A36J-09	TCGA-MB-A8JK-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	307db8e1-7146-4506-b618-eba5076a6860	9be6e5e2-2506-4a0a-9cb7-a0fcb5e7834a	g.chr16:5061242C>A	ENST00000251170.7	+	15	2127	c.1947C>A	c.(1945-1947)taC>taA	p.Y649*	RP11-165E7.1_ENST00000588778.1_RNA	NM_014692.1	NP_055507.1	O43304	S14L5_HUMAN	SEC14-like 5 (S. cerevisiae)	649	GOLD. {ECO:0000255|PROSITE- ProRule:PRU00096}.					integral component of membrane (GO:0016021)|intracellular (GO:0005622)	transporter activity (GO:0005215)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(9)|ovary(1)|skin(1)	29						AACTTCTCTACTACTGTGAGG	0.637																																																	0								ENSG00000103184						27.0	30.0	29.0					16																	5061242		1934	4142	6076	SEC14L5	SO:0001587	stop_gained	0			-	HGNC	AB007880	CCDS45403.1	16p13.3	2008-02-05				ENSG00000103184			29032	protein-coding gene	gene with protein product						9455477	Standard	NM_014692		Approved	KIAA0420, PRELID4B	uc002cye.2	O43304		ENST00000251170.7:c.1947C>A	16.37:g.5061242C>A	ENSP00000251170:p.Tyr649*	Somatic	0	81	0.00		0.5423643324612125	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	60	16.67		Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PRELI/MSF1,pfam_CRAL-TRIO_dom,pfam_CRAL/TRIO_N_dom,superfamily_CRAL-TRIO_dom,superfamily_CRAL/TRIO_N_dom,superfamily_GOLD,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom,pfscan_GOLD,pfscan_PRELI/MSF1,prints_CRAL-bd_toc_tran	p.Y649*	ENST00000251170.7	37	c.1947	CCDS45403.1	16	.	.	.	.	.	.	.	.	.	.	C	36	5.716552	0.96830	.	.	ENSG00000103184	ENST00000251170	.	.	.	4.45	3.49	0.39957	.	0.000000	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	0.095	7.7232	0.28744	0.0:0.7443:0.0:0.2557	.	.	.	.	X	649	.	ENSP00000251170:Y649X	Y	+	3	2	SEC14L5	5001243	1.000000	0.71417	0.998000	0.56505	0.169000	0.22640	2.329000	0.43876	1.232000	0.43678	0.561000	0.74099	TAC	-	superfamily_GOLD,pfscan_GOLD		0.637	SEC14L5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC14L5	protein_coding	OTTHUMT00000434379.1	C		-		5061242	+1	no_errors	ENST00000251170	ensembl	human	known	74_37	nonsense	SNP	1.000	A
ZAK	51776	genome.wustl.edu	37	2	174034545	174034545	+	Missense_Mutation	SNP	A	A	G			TCGA-MB-A8JK-01A-11D-A36J-09	TCGA-MB-A8JK-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	307db8e1-7146-4506-b618-eba5076a6860	9be6e5e2-2506-4a0a-9cb7-a0fcb5e7834a	g.chr2:174034545A>G	ENST00000375213.3	+	3	250	c.172A>G	c.(172-174)Agt>Ggt	p.S58G	MLTK_ENST00000409176.2_Missense_Mutation_p.S58G|MLK7-AS1_ENST00000422703.1_RNA|MLK7-AS1_ENST00000419609.1_RNA|MLTK_ENST00000480606.1_3'UTR|MLTK_ENST00000338983.3_Missense_Mutation_p.S58G|MLTK_ENST00000431503.2_5'UTR|MLTK_ENST00000539448.1_Missense_Mutation_p.S58G	NM_016653.2	NP_057737.2	Q9NYL2	MLTK_HUMAN		58	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of JUN kinase activity (GO:0007257)|activation of MAPKK activity (GO:0000186)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell death (GO:0008219)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|DNA damage checkpoint (GO:0000077)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|protein phosphorylation (GO:0006468)|response to radiation (GO:0009314)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase kinase kinase activity (GO:0004709)|poly(A) RNA binding (GO:0044822)|protein serine/threonine kinase activity (GO:0004674)										AGAAATACTCAGTGTCCTCAG	0.338																																																	0								ENSG00000091436						136.0	131.0	133.0					2																	174034545		2203	4300	6503	MLTK	SO:0001583	missense	0			-	Uniprot_gn																												ENST00000375213.3:c.172A>G	2.37:g.174034545A>G	ENSP00000364361:p.Ser58Gly	Somatic	0	53	0.00		0.5423643324612125	31	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	B3KPG2|Q53SX1|Q580W8|Q59GY5|Q86YW8|Q9HCC4|Q9HCC5|Q9HDD2|Q9NYE9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_SAM_type1,pfam_SAM_2,superfamily_Kinase-like_dom,superfamily_SAM/pointed,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,pfscan_SAM,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.S58G	ENST00000375213.3	37	c.172	CCDS42777.1	2	.	.	.	.	.	.	.	.	.	.	A	20.9	4.070150	0.76301	.	.	ENSG00000091436	ENST00000539448;ENST00000409176;ENST00000338983;ENST00000375213;ENST00000422149	D;D;D;D;D	0.83419	-1.72;-1.72;-1.72;-1.72;-1.72	5.67	5.67	0.87782	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.88005	0.6321	L	0.52206	1.635	0.80722	D	1	D;D;D;D	0.76494	0.997;0.999;0.998;0.995	P;D;D;P	0.75020	0.894;0.985;0.936;0.793	D	0.86400	0.1741	10	0.31617	T	0.26	.	15.5783	0.76410	1.0:0.0:0.0:0.0	.	58;58;58;58	Q9NYL2-2;Q9NYL2;D4Q8H0;Q9NYL2-3	.;MLTK_HUMAN;.;.	G	58	ENSP00000439414:S58G;ENSP00000387259:S58G;ENSP00000340257:S58G;ENSP00000364361:S58G;ENSP00000411923:S58G	ENSP00000340257:S58G	S	+	1	0	AC013461.1	173742791	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	8.522000	0.90573	2.152000	0.67230	0.455000	0.32223	AGT	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.338	MLTK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZAK	protein_coding	OTTHUMT00000255401.1	A		-		174034545	+1	no_errors	ENST00000375213	ensembl	human	known	74_37	missense	SNP	1.000	G
DBF4B	80174	genome.wustl.edu	37	17	42828395	42828395	+	Frame_Shift_Del	DEL	T	T	-			TCGA-MB-A8JK-01A-11D-A36J-09	TCGA-MB-A8JK-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	307db8e1-7146-4506-b618-eba5076a6860	9be6e5e2-2506-4a0a-9cb7-a0fcb5e7834a	g.chr17:42828395delT	ENST00000315005.3	+	14	1760	c.1622delT	c.(1621-1623)cttfs	p.L541fs	DBF4B_ENST00000393547.2_Intron	NM_145663.2	NP_663696.1	Q8NFT6	DBF4B_HUMAN	DBF4 zinc finger B	541					cell cycle (GO:0007049)|positive regulation of cell proliferation (GO:0008284)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of protein kinase activity (GO:0045860)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|protein kinase activator activity (GO:0030295)|protein kinase binding (GO:0019901)|zinc ion binding (GO:0008270)			kidney(1)|large_intestine(1)|lung(5)	7		Prostate(33;0.0322)				TGTCTCAGACTTGGATACCTT	0.562																																																	0								ENSG00000161692						135.0	116.0	123.0					17																	42828395		2203	4300	6503	DBF4B	SO:0001589	frameshift_variant	0				HGNC	AF465820	CCDS11485.1, CCDS45706.1, CCDS45706.2	17q21.31	2014-02-17	2014-02-17		ENSG00000161692	ENSG00000161692		"""Zinc fingers, DBF-type"""	17883	protein-coding gene	gene with protein product	"""chiffon homolog B (Drosophila)"", ""zinc finger, DBF-type containing 1B"""	611661	"""DBF4 homolog B (S. cerevisiae)"""			15668232	Standard	NM_145663		Approved	FLJ13087, DRF1, ASKL1, chifb, ZDBF1B	uc002ihf.3	Q8NFT6	OTTHUMG00000165717	ENST00000315005.3:c.1622delT	17.37:g.42828395delT	ENSP00000323663:p.Leu541fs	Somatic	0	65	0.00		0.5423643324612125	6	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	73	23.16	D3DX56|Q8TEX0|Q96B19|Q9H912	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Znf_DBF,superfamily_BRCT_dom,smart_Znf_DBF	p.G542fs	ENST00000315005.3	37	c.1622	CCDS11485.1	17																																																																																			-	NULL		0.562	DBF4B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DBF4B	protein_coding	OTTHUMT00000385930.1	T	NM_025104			42828395	+1	no_errors	ENST00000315005	ensembl	human	known	74_37	frame_shift_del	DEL	0.001	-
LOC105372257	105372257	genome.wustl.edu	37	19	6954619	6954619	+	RNA	SNP	T	T	C			TCGA-MB-A8JK-01A-11D-A36J-09	TCGA-MB-A8JK-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	307db8e1-7146-4506-b618-eba5076a6860	9be6e5e2-2506-4a0a-9cb7-a0fcb5e7834a	g.chr19:6954619T>C	ENST00000593558.1	+	0	219				EMR4P_ENST00000600751.1_RNA																							TCTTACCGTTTTGGTTTGGGT	0.423																																																	0								ENSG00000268845																																			RP11-1137G4.3			0			-	Clone_based_vega_gene																													19.37:g.6954619T>C		Somatic	0	84	0.00		0.5423643324612125	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	128	17.42		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000593558.1	37	NULL		19																																																																																			-	-		0.423	RP11-1137G4.3-001	KNOWN	basic	antisense	ENSG00000268845	antisense	OTTHUMT00000458493.1	T		-		6954619	+1	no_errors	ENST00000593558	ensembl	human	known	74_37	rna	SNP	0.011	C
TMEM116	89894	genome.wustl.edu	37	12	112429640	112429640	+	5'UTR	SNP	C	C	T			TCGA-MB-A8JK-01A-11D-A36J-09	TCGA-MB-A8JK-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	307db8e1-7146-4506-b618-eba5076a6860	9be6e5e2-2506-4a0a-9cb7-a0fcb5e7834a	g.chr12:112429640C>T	ENST00000550831.3	-	0	224				TMEM116_ENST00000355445.3_Nonsense_Mutation_p.W44*|TMEM116_ENST00000549537.2_5'UTR|TMEM116_ENST00000552374.2_Nonsense_Mutation_p.W44*|TMEM116_ENST00000354825.3_5'UTR|TMEM116_ENST00000437003.2_5'UTR|TMEM116_ENST00000552839.2_5'UTR	NM_138341.2	NP_612350.1	Q8NCL8	TM116_HUMAN	transmembrane protein 116							integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(3)|lung(2)|ovary(1)|skin(1)	8						TCTCCGTGAGCCAGCAAAGTC	0.433																																																	0								ENSG00000198270																																			TMEM116	SO:0001623	5_prime_UTR_variant	0			-	HGNC	AK074648	CCDS9157.1, CCDS55886.1, CCDS55887.1	12q24.13	2012-03-02			ENSG00000198270	ENSG00000198270			25084	protein-coding gene	gene with protein product						12477932	Standard	NM_001193453		Approved	FLJ90167	uc001ttd.2	Q8NCL8	OTTHUMG00000169606	ENST00000550831.3:c.-145G>A	12.37:g.112429640C>T		Somatic	0	71	0.00		0.5423643324612125	20	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	50	8.93	G3V1W7|G5E985|Q6NSH5|Q8IZ66	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	prints_GCR1-cAMP_receptor	p.W44*	ENST00000550831.3	37	c.132	CCDS9157.1	12	.	.	.	.	.	.	.	.	.	.	c	4.723	0.134424	0.09032	.	.	ENSG00000198270	ENST00000355445;ENST00000552374;ENST00000550037;ENST00000549425;ENST00000546962;ENST00000550233	.	.	.	5.32	4.42	0.53409	.	0.091357	0.47852	D	0.000201	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.0435	11.3808	0.49757	0.1811:0.8189:0.0:0.0	.	.	.	.	X	44	.	ENSP00000347620:W44X	W	-	3	0	TMEM116	110914023	1.000000	0.71417	1.000000	0.80357	0.018000	0.09664	2.585000	0.46111	1.227000	0.43598	0.563000	0.77884	TGG	-	NULL		0.433	TMEM116-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	TMEM116	protein_coding	OTTHUMT00000405026.3	C	NM_138341	-		112429640	-1	no_errors	ENST00000552374	ensembl	human	known	74_37	nonsense	SNP	1.000	T
ABCB1	5243	genome.wustl.edu	37	7	87214969	87214969	+	Silent	SNP	A	A	G			TCGA-MB-A8JK-01A-11D-A36J-09	TCGA-MB-A8JK-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	307db8e1-7146-4506-b618-eba5076a6860	9be6e5e2-2506-4a0a-9cb7-a0fcb5e7834a	g.chr7:87214969A>G	ENST00000265724.3	-	5	562	c.145T>C	c.(145-147)Ttg>Ctg	p.L49L	ABCB1_ENST00000543898.1_Silent_p.L49L	NM_000927.4	NP_000918.2	P08183	MDR1_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 1	49					drug transmembrane transport (GO:0006855)|G2/M transition of mitotic cell cycle (GO:0000086)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|stem cell proliferation (GO:0072089)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)|xenobiotic-transporting ATPase activity (GO:0008559)			NS(1)|breast(6)|central_nervous_system(2)|endometrium(14)|kidney(9)|large_intestine(14)|lung(48)|ovary(4)|prostate(6)|skin(6)|upper_aerodigestive_tract(1)	111	Esophageal squamous(14;0.00164)				Acebutolol(DB01193)|Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Adenosine triphosphate(DB00171)|ado-trastuzumab emtansine(DB05773)|Afatinib(DB08916)|Albendazole(DB00518)|Alfentanil(DB00802)|Alitretinoin(DB00523)|Amantadine(DB00915)|Aminohippurate(DB00345)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amlodipine(DB00381)|Amprenavir(DB00701)|Amsacrine(DB00276)|Apixaban(DB06605)|Arsenic trioxide(DB01169)|Astemizole(DB00637)|Atazanavir(DB01072)|Atenolol(DB00335)|Atorvastatin(DB01076)|Axitinib(DB06626)|Azelastine(DB00972)|Azithromycin(DB00207)|Benzocaine(DB01086)|Bepridil(DB01244)|Betamethasone(DB00443)|Biperiden(DB00810)|Boceprevir(DB08873)|Bosutinib(DB06616)|Brentuximab vedotin(DB08870)|Bromocriptine(DB01200)|Buprenorphine(DB00921)|Buspirone(DB00490)|Cabazitaxel(DB06772)|Caffeine(DB00201)|Canagliflozin(DB08907)|Candesartan(DB00796)|Captopril(DB01197)|Carbamazepine(DB00564)|Carfilzomib(DB08889)|Carvedilol(DB01136)|Caspofungin(DB00520)|Chloroquine(DB00608)|Chlorpromazine(DB00477)|Chlorpropamide(DB00672)|Chlorprothixene(DB01239)|Cilazapril(DB01340)|Cimetidine(DB00501)|Ciprofloxacin(DB00537)|Cisplatin(DB00515)|Citalopram(DB00215)|Clarithromycin(DB01211)|Clobazam(DB00349)|Clofazimine(DB00845)|Clomifene(DB00882)|Clomipramine(DB01242)|Clonidine(DB00575)|Clopidogrel(DB00758)|Clotrimazole(DB00257)|Clozapine(DB00363)|Colchicine(DB01394)|Conjugated Estrogens(DB00286)|Crizotinib(DB08865)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dabigatran etexilate(DB06695)|Dabrafenib(DB08912)|Dactinomycin(DB00970)|Dapagliflozin(DB06292)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Debrisoquin(DB04840)|Desipramine(DB01151)|Desloratadine(DB00967)|Dexamethasone(DB01234)|Dextromethorphan(DB00514)|Diazepam(DB00829)|Diclofenac(DB00586)|Diethylstilbestrol(DB00255)|Digitoxin(DB01396)|Digoxin(DB00390)|Dihydroergotamine(DB00320)|Diltiazem(DB00343)|Dipyridamole(DB00975)|Docetaxel(DB01248)|Domperidone(DB01184)|Doxazosin(DB00590)|Doxepin(DB01142)|Doxorubicin(DB00997)|Dronabinol(DB00470)|Dronedarone(DB04855)|Eletriptan(DB00216)|Enalapril(DB00584)|Enzalutamide(DB08899)|Epinastine(DB00751)|Ergonovine(DB01253)|Ergotamine(DB00696)|Erlotinib(DB00530)|Erythromycin(DB00199)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estrone(DB00655)|Ethinyl Estradiol(DB00977)|Etoposide(DB00773)|Etravirine(DB06414)|Ezetimibe(DB00973)|Felodipine(DB01023)|Fentanyl(DB00813)|Fesoterodine(DB06702)|Fexofenadine(DB00950)|Fidaxomicin(DB08874)|Fluconazole(DB00196)|Fluoxetine(DB00472)|Flupentixol(DB00875)|Fluphenazine(DB00623)|Flurazepam(DB00690)|Fluticasone furoate(DB08906)|Fluvoxamine(DB00176)|Gefitinib(DB00317)|Gemcitabine(DB00441)|Glyburide(DB01016)|Gramicidin D(DB00027)|Haloperidol(DB00502)|Hydrocortisone(DB00741)|Ibuprofen(DB01050)|Imatinib(DB00619)|Imipramine(DB00458)|Indacaterol(DB05039)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Itraconazole(DB01167)|Ivacaftor(DB08820)|Ivermectin(DB00602)|Ketamine(DB01221)|Ketazolam(DB01587)|Ketoconazole(DB01026)|Lamivudine(DB00709)|Lamotrigine(DB00555)|Lansoprazole(DB00448)|Lapatinib(DB01259)|Lenalidomide(DB00480)|Levetiracetam(DB01202)|Levofloxacin(DB01137)|Levomilnacipran(DB08918)|Levothyroxine(DB00451)|Lidocaine(DB00281)|Linagliptin(DB08882)|Liothyronine(DB00279)|Liotrix(DB01583)|Lisinopril(DB00722)|Lomitapide(DB08827)|Loperamide(DB00836)|Lopinavir(DB01601)|Loratadine(DB00455)|Losartan(DB00678)|Lovastatin(DB00227)|Mannitol(DB00742)|Maprotiline(DB00934)|Mebendazole(DB00643)|Mefloquine(DB00358)|Megestrol acetate(DB00351)|Meprobamate(DB00371)|Methadone(DB00333)|Methotrexate(DB00563)|Methylprednisolone(DB00959)|Metoprolol(DB00264)|Miconazole(DB01110)|Midazolam(DB00683)|Mifepristone(DB00834)|Mirabegron(DB08893)|Mitomycin(DB00305)|Mitoxantrone(DB01204)|Morphine(DB00295)|Mycophenolate mofetil(DB00688)|Nadolol(DB01203)|Naloxone(DB01183)|Naltrexone(DB00704)|Nefazodone(DB01149)|Nelfinavir(DB00220)|Neostigmine(DB01400)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilotinib(DB04868)|Nisoldipine(DB00401)|Nitrazepam(DB01595)|Nitrendipine(DB01054)|Nizatidine(DB00585)|Norethindrone(DB00717)|Olanzapine(DB00334)|Omeprazole(DB00338)|Paclitaxel(DB01229)|Pantoprazole(DB00213)|Paroxetine(DB00715)|Pazopanib(DB06589)|Perindopril(DB00790)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pimozide(DB01100)|Pitavastatin(DB08860)|Pomalidomide(DB08910)|Ponatinib(DB08901)|Posaconazole(DB01263)|Pravastatin(DB00175)|Prazosin(DB00457)|Prednisolone(DB00860)|Prednisone(DB00635)|Probenecid(DB01032)|Progesterone(DB00396)|Promethazine(DB01069)|Propafenone(DB01182)|Propranolol(DB00571)|Protriptyline(DB00344)|Quetiapine(DB01224)|Quinacrine(DB01103)|Quinidine(DB00908)|Quinine(DB00468)|Ranitidine(DB00863)|Reboxetine(DB00234)|Regorafenib(DB08896)|Reserpine(DB00206)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Risperidone(DB00734)|Ritonavir(DB00503)|Rivaroxaban(DB06228)|Roxithromycin(DB00778)|Salicylic acid(DB00936)|Saquinavir(DB01232)|Scopolamine(DB00747)|Selegiline(DB01037)|Sertraline(DB01104)|Silodosin(DB06207)|SIMEPREVIR(DB06290)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sitagliptin(DB01261)|SOFOSBUVIR(DB08934)|Sorafenib(DB00398)|Sparfloxacin(DB01208)|Spironolactone(DB00421)|Streptozocin(DB00428)|Sulfinpyrazone(DB01138)|Sumatriptan(DB00669)|Sunitinib(DB01268)|Tacrolimus(DB00864)|Tamoxifen(DB00675)|Telaprevir(DB05521)|Telmisartan(DB00966)|Temsirolimus(DB06287)|Terazosin(DB01162)|Testosterone(DB00624)|Ticagrelor(DB08816)|Timolol(DB00373)|Tolvaptan(DB06212)|Topotecan(DB01030)|Toremifene(DB00539)|Trazodone(DB00656)|Trifluoperazine(DB00831)|Triflupromazine(DB00508)|Trimethoprim(DB00440)|Trimipramine(DB00726)|Troleandomycin(DB01361)|Vecuronium(DB01339)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)|Vinorelbine(DB00361)|Vismodegib(DB08828)|Voacamine(DB04877)|Zidovudine(DB00495)	ACCATATACAACTTGTCAAGC	0.393																																																	0								ENSG00000085563						65.0	68.0	67.0					7																	87214969		2203	4300	6503	ABCB1	SO:0001819	synonymous_variant	0			-	HGNC	M14758	CCDS5608.1	7q21.12	2012-03-14	2004-05-12		ENSG00000085563	ENSG00000085563		"""CD molecules"", ""ATP binding cassette transporters / subfamily B"""	40	protein-coding gene	gene with protein product	"""multidrug resistance protein 1"""	171050	"""colchicin sensitivity"""	PGY1, MDR1, CLCS		3027054	Standard	NM_000927		Approved	P-gp, CD243, GP170, ABC20	uc003uiz.2	P08183	OTTHUMG00000023393	ENST00000265724.3:c.145T>C	7.37:g.87214969A>G		Somatic	0	46	0.00		0.5423643324612125	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	23	20.00	A8K294|B5AK60|Q12755|Q14812	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,pfam_ABC_ATPase_put,superfamily_P-loop_NTPase,superfamily_ABC1_TM_dom,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom	p.L49	ENST00000265724.3	37	c.145	CCDS5608.1	7																																																																																			-	superfamily_ABC1_TM_dom		0.393	ABCB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCB1	protein_coding	OTTHUMT00000335444.2	A	NM_000927	-		87214969	-1	no_errors	ENST00000265724	ensembl	human	known	74_37	silent	SNP	0.210	G
LPXN	9404	genome.wustl.edu	37	11	58338061	58338061	+	Missense_Mutation	SNP	G	G	T			TCGA-MB-A8JK-01A-11D-A36J-09	TCGA-MB-A8JK-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	307db8e1-7146-4506-b618-eba5076a6860	9be6e5e2-2506-4a0a-9cb7-a0fcb5e7834a	g.chr11:58338061G>T	ENST00000395074.2	-	2	227	c.139C>A	c.(139-141)Ctt>Att	p.L47I	LPXN_ENST00000528489.1_Silent_p.S42S|LPXN_ENST00000528954.1_Missense_Mutation_p.L52I	NM_004811.2	NP_004802.1	O60711	LPXN_HUMAN	leupaxin	47					cell adhesion (GO:0007155)|negative regulation of B cell receptor signaling pathway (GO:0050859)|negative regulation of cell adhesion (GO:0007162)|protein complex assembly (GO:0006461)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|podosome (GO:0002102)	transcription cofactor activity (GO:0003712)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14		Breast(21;0.00725)|all_epithelial(135;0.0101)|all_lung(304;0.24)				TGAATAGAAAGGATCTCCGAA	0.413																																																	0								ENSG00000110031						94.0	90.0	92.0					11																	58338061		2201	4295	6496	LPXN	SO:0001583	missense	0			-	HGNC	AF062075	CCDS7969.1, CCDS53635.1	11q12.1	2013-09-20			ENSG00000110031	ENSG00000110031			14061	protein-coding gene	gene with protein product		605390				9565592	Standard	NM_004811		Approved	LDPL	uc001nmw.3	O60711	OTTHUMG00000167466	ENST00000395074.2:c.139C>A	11.37:g.58338061G>T	ENSP00000378512:p.Leu47Ile	Somatic	0	41	0.00		0.5423643324612125	20	20.00	5	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	31	26.19	B2R8B4|B4DV71|Q53FW6|Q6FI07	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_LIM,smart_Znf_LIM,pirsf_Leupaxin,pfscan_Znf_LIM	p.L52I	ENST00000395074.2	37	c.154	CCDS7969.1	11	.	.	.	.	.	.	.	.	.	.	G	10.09	1.255191	0.22965	.	.	ENSG00000110031	ENST00000528954;ENST00000395074	T;T	0.30981	1.51;1.52	4.96	-0.159	0.13379	.	1.478620	0.04346	N	0.354819	T	0.28034	0.0691	L	0.57536	1.79	0.09310	N	1	B;B	0.14012	0.007;0.009	B;B	0.19946	0.006;0.027	T	0.21895	-1.0232	10	0.22706	T	0.39	.	4.0233	0.09675	0.2748:0.3611:0.3642:0.0	.	52;47	B4DV71;O60711	.;LPXN_HUMAN	I	52;47	ENSP00000431284:L52I;ENSP00000378512:L47I	ENSP00000378512:L47I	L	-	1	0	LPXN	58094637	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	0.003000	0.13083	0.355000	0.24131	0.557000	0.71058	CTT	-	pirsf_Leupaxin		0.413	LPXN-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	LPXN	protein_coding	OTTHUMT00000394709.1	G	NM_004811	-		58338061	-1	no_errors	ENST00000528954	ensembl	human	known	74_37	missense	SNP	0.000	T
NRXN2	9379	genome.wustl.edu	37	11	64374700	64374700	+	Missense_Mutation	SNP	T	T	C			TCGA-MB-A8JK-01A-11D-A36J-09	TCGA-MB-A8JK-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	307db8e1-7146-4506-b618-eba5076a6860	9be6e5e2-2506-4a0a-9cb7-a0fcb5e7834a	g.chr11:64374700T>C	ENST00000377551.1	-	22	5318	c.5107A>G	c.(5107-5109)Aag>Gag	p.K1703E	NRXN2_ENST00000377559.3_Missense_Mutation_p.K1633E|NRXN2_ENST00000409571.1_Missense_Mutation_p.K1696E|NRXN2_ENST00000265459.6_Missense_Mutation_p.K1703E|NRXN2_ENST00000301894.2_Missense_Mutation_p.K657E			Q9P2S2	NRX2A_HUMAN	neurexin 2	1703					adult behavior (GO:0030534)|gephyrin clustering (GO:0097116)|neuroligin clustering (GO:0097118)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	calcium channel regulator activity (GO:0005246)|cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)|neuroligin family protein binding (GO:0097109)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(1)|lung(34)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(6)|urinary_tract(1)	71						TTGTTCTTCTTGGCCTTGCTG	0.642																																																	0								ENSG00000110076						40.0	47.0	45.0					11																	64374700		2201	4297	6498	NRXN2	SO:0001583	missense	0			-	HGNC		CCDS8077.1, CCDS31597.1, CCDS8078.1	11q13	2008-07-18			ENSG00000110076	ENSG00000110076			8009	protein-coding gene	gene with protein product	"""neurexin II"""	600566				1621094	Standard	NM_015080		Approved		uc021qkw.1	P58401	OTTHUMG00000045214	ENST00000377551.1:c.5107A>G	11.37:g.64374700T>C	ENSP00000366774:p.Lys1703Glu	Somatic	0	37	0.00		0.5423643324612125	18	25.00	6	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	34	26.09	A7E2C1|Q9Y2D6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,smart_EG-like_dom,smart_Neurexin-like,pfscan_EG-like_dom,pfscan_Laminin_G	p.K1703E	ENST00000377551.1	37	c.5107	CCDS8077.1	11	.	.	.	.	.	.	.	.	.	.	T	16.82	3.228368	0.58777	.	.	ENSG00000110076	ENST00000301894;ENST00000377551;ENST00000377559;ENST00000265459;ENST00000345863;ENST00000409571	T;T;T;T;T	0.67171	0.25;-0.25;-0.22;-0.25;-0.14	4.45	3.32	0.38043	.	0.000000	0.44688	U	0.000433	T	0.71888	0.3393	L	0.46157	1.445	0.44890	D	0.997909	D;P;D;D	0.76494	0.999;0.61;0.998;0.993	D;B;D;P	0.85130	0.997;0.366;0.993;0.9	T	0.70407	-0.4880	10	0.44086	T	0.13	.	7.4111	0.27017	0.0:0.1063:0.0:0.8937	.	1633;1703;1449;657	Q9P2S2-2;Q9P2S2;E7EV67;P58401	.;NRX2A_HUMAN;.;NRX2B_HUMAN	E	657;1703;1633;1703;1633;1696	ENSP00000301894:K657E;ENSP00000366774:K1703E;ENSP00000366782:K1633E;ENSP00000265459:K1703E;ENSP00000386416:K1696E	ENSP00000265459:K1703E	K	-	1	0	NRXN2	64131276	1.000000	0.71417	1.000000	0.80357	0.816000	0.46133	2.695000	0.47043	1.650000	0.50662	0.254000	0.18369	AAG	-	NULL		0.642	NRXN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NRXN2	protein_coding	OTTHUMT00000104967.3	T	NM_015080	-		64374700	-1	no_errors	ENST00000265459	ensembl	human	known	74_37	missense	SNP	1.000	C
KLRG1	10219	genome.wustl.edu	37	12	9162633	9162633	+	3'UTR	SNP	C	C	G			TCGA-MB-A8JK-01A-11D-A36J-09	TCGA-MB-A8JK-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	307db8e1-7146-4506-b618-eba5076a6860	9be6e5e2-2506-4a0a-9cb7-a0fcb5e7834a	g.chr12:9162633C>G	ENST00000266551.4	+	0	612				KLRG1_ENST00000538029.1_3'UTR|KLRG1_ENST00000356986.3_3'UTR	NM_005810.3	NP_005801.3	Q96E93	KLRG1_HUMAN	killer cell lectin-like receptor subfamily G, member 1						cell surface receptor signaling pathway (GO:0007166)|cellular defense response (GO:0006968)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|regulation of immune response (GO:0050776)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			breast(1)|central_nervous_system(1)|kidney(1)|lung(3)|pancreas(1)|upper_aerodigestive_tract(1)	8						GAAGAATAAACCTAGCTggca	0.463																																																	0								ENSG00000139187																																			KLRG1	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AF097358	CCDS8599.1	12p13.31	2011-08-30			ENSG00000139187	ENSG00000139187		"""Killer cell lectin-like receptors"", ""C-type lectin domain containing"""	6380	protein-coding gene	gene with protein product	"""C-type lectin domain family 15, member A"""	604874				9862378, 9842918, 16461340, 16140789	Standard	NM_005810		Approved	MAFA, 2F1, MAFA-L, CLEC15A	uc001qvg.3	Q96E93		ENST00000266551.4:c.*9C>G	12.37:g.9162633C>G		Somatic	0	11	0.00		0.5423643324612125	3	40.00	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	16	30.43	B7ZAM2|O43198|O75613	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000266551.4	37	NULL		12																																																																																			-	-		0.463	KLRG1-002	KNOWN	basic	protein_coding	KLRG1	protein_coding	OTTHUMT00000399145.1	C	NM_005810	-		9162633	+1	no_errors	ENST00000538029	ensembl	human	known	74_37	rna	SNP	0.149	G
OR2L3	391192	genome.wustl.edu	37	1	248224054	248224054	+	Frame_Shift_Del	DEL	T	T	-			TCGA-MB-A8JK-01A-11D-A36J-09	TCGA-MB-A8JK-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	307db8e1-7146-4506-b618-eba5076a6860	9be6e5e2-2506-4a0a-9cb7-a0fcb5e7834a	g.chr1:248224054delT	ENST00000359959.3	+	1	71	c.71delT	c.(70-72)cttfs	p.L24fs	OR2L13_ENST00000366478.2_Intron	NM_001004687.1	NP_001004687.1	Q8NG85	OR2L3_HUMAN	olfactory receptor, family 2, subfamily L, member 3	24						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(2)|large_intestine(7)|lung(28)|prostate(1)|skin(1)|urinary_tract(1)	41	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0278)			AGAATTGGCCTTTTCCTCTTC	0.408																																																	0								ENSG00000198128						242.0	240.0	240.0					1																	248224054		2203	4300	6503	OR2L3	SO:0001589	frameshift_variant	0				HGNC	AB065950	CCDS31104.1	1q44	2012-08-09			ENSG00000198128	ENSG00000198128		"""GPCR / Class A : Olfactory receptors"""	15009	protein-coding gene	gene with protein product							Standard	NM_001004687		Approved		uc001idx.1	Q8NG85	OTTHUMG00000040195	ENST00000359959.3:c.71delT	1.37:g.248224054delT	ENSP00000353044:p.Leu24fs	Somatic	0	101	0.00		0.5423643324612125	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	25	10.71	B9EH44	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.F25fs	ENST00000359959.3	37	c.71	CCDS31104.1	1																																																																																			-	prints_GPCR_Rhodpsn		0.408	OR2L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2L3	protein_coding	OTTHUMT00000096852.1	T	NM_001004687			248224054	+1	no_errors	ENST00000359959	ensembl	human	known	74_37	frame_shift_del	DEL	0.025	-
POTEM	641455	genome.wustl.edu	37	14	20012819	20012822	+	Intron	DEL	AAAG	AAAG	-	rs61976405	byFrequency	TCGA-MB-A8JK-01A-11D-A36J-09	TCGA-MB-A8JK-10A-01D-A36M-09	AAAG	AAAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	307db8e1-7146-4506-b618-eba5076a6860	9be6e5e2-2506-4a0a-9cb7-a0fcb5e7834a	g.chr14:20012819_20012822delAAAG	ENST00000551509.1	-	4	862				RP11-244H18.1_ENST00000547584.1_lincRNA	NM_001145442.1	NP_001138914.1	A6NI47	POTEM_HUMAN	POTE ankyrin domain family, member M											endometrium(4)|kidney(1)|lung(4)	9						ataaaaataaaaagaaagaaagaa	0.417																																																	0								ENSG00000187537																																			POTEM	SO:0001627	intron_variant	0				HGNC		CCDS73609.1	14q11.2	2013-01-10			ENSG00000187537	ENSG00000187537		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	37096	protein-coding gene	gene with protein product	"""prostate-specific P704P"""					16364570	Standard	NM_001145442		Approved	POTE14beta, P704P, ACT	uc001vwc.3	A6NI47		ENST00000551509.1:c.811-1162CTTT>-	14.37:g.20012827_20012830delAAAG		Somatic	0	42	0.00		0.5423643324612125	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	52	13.33		Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.I314fs	ENST00000551509.1	37	c.937_934	CCDS45076.1	14																																																																																			-	NULL		0.417	POTEM-001	NOVEL	basic|appris_principal|CCDS	protein_coding	POTEM	protein_coding	OTTHUMT00000409490.3	AAAG	NM_001145442			20012822	-1	no_errors	ENST00000547722	ensembl	human	known	74_37	frame_shift_del	DEL	0.009:0.013:0.017:0.020	-
DNAH9	1770	genome.wustl.edu	37	17	11593505	11593505	+	Missense_Mutation	SNP	C	C	T	rs141375188	byFrequency	TCGA-MB-A8JK-01A-11D-A36J-09	TCGA-MB-A8JK-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	307db8e1-7146-4506-b618-eba5076a6860	9be6e5e2-2506-4a0a-9cb7-a0fcb5e7834a	g.chr17:11593505C>T	ENST00000262442.4	+	20	4434	c.4366C>T	c.(4366-4368)Cgg>Tgg	p.R1456W	DNAH9_ENST00000454412.2_Missense_Mutation_p.R1456W	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	1456	Stem. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		GCCCCACCCACGGACCAATGT	0.498																																																	0								ENSG00000007174	C	TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	79.0	78.0	78.0		4366	2.4	0.0	17	dbSNP_134	78	3,8597	3.0+/-9.4	0,3,4297	yes	missense	DNAH9	NM_001372.3	101	0,4,6499	TT,TC,CC		0.0349,0.0227,0.0308	probably-damaging	1456/4487	11593505	4,13002	2203	4300	6503	DNAH9	SO:0001583	missense	0			-	HGNC	U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.4366C>T	17.37:g.11593505C>T	ENSP00000262442:p.Arg1456Trp	Somatic	0	66	0.00		0.5423643324612125	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	25	50.98	A2VCQ8|O15064|O95494|Q9NQ28	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.R1456W	ENST00000262442.4	37	c.4366	CCDS11160.1	17	.	.	.	.	.	.	.	.	.	.	C	12.33	1.905405	0.33628	2.27E-4	3.49E-4	ENSG00000007174	ENST00000262442;ENST00000454412;ENST00000413703	T;T	0.61742	0.08;0.08	5.57	2.37	0.29283	Dynein heavy chain, domain-2 (1);	0.000000	0.64402	D	0.000001	D	0.82481	0.5046	H	0.95982	3.75	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.87056	0.2150	10	0.87932	D	0	.	14.7896	0.69830	0.3756:0.6243:0.0:0.0	.	1456	Q9NYC9	DYH9_HUMAN	W	1456;1456;38	ENSP00000262442:R1456W;ENSP00000414874:R1456W	ENSP00000262442:R1456W	R	+	1	2	DNAH9	11534230	0.512000	0.26186	0.011000	0.14972	0.018000	0.09664	1.168000	0.31859	0.263000	0.21812	0.655000	0.94253	CGG	-	pfam_Dynein_heavy_dom-2		0.498	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH9	protein_coding	OTTHUMT00000252756.2	C	NM_001372	rs141375188		11593505	+1	no_errors	ENST00000262442	ensembl	human	known	74_37	missense	SNP	0.951	T
SAMD9	54809	genome.wustl.edu	37	7	92735360	92735360	+	Silent	SNP	C	C	T			TCGA-MB-A8JK-01A-11D-A36J-09	TCGA-MB-A8JK-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	307db8e1-7146-4506-b618-eba5076a6860	9be6e5e2-2506-4a0a-9cb7-a0fcb5e7834a	g.chr7:92735360C>T	ENST00000379958.2	-	3	320	c.51G>A	c.(49-51)gaG>gaA	p.E17E		NM_001193307.1|NM_017654.3	NP_001180236.1|NP_060124.2	Q5K651	SAMD9_HUMAN	sterile alpha motif domain containing 9	17	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.					cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)				NS(1)|breast(4)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(20)|lung(32)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	88	all_cancers(62;5.71e-11)|all_epithelial(64;3.25e-10)|Breast(17;0.000675)|Lung NSC(181;0.0969)|all_lung(186;0.125)		STAD - Stomach adenocarcinoma(171;0.000302)			GATTTACATCCTCTTTTGTCC	0.318																																																	0								ENSG00000205413						83.0	83.0	83.0					7																	92735360		2202	4297	6499	SAMD9	SO:0001819	synonymous_variant	0			-	HGNC	AB095925	CCDS34680.1	7q21.2	2013-01-10	2004-07-15	2004-07-16	ENSG00000205413	ENSG00000205413		"""Sterile alpha motif (SAM) domain containing"""	1348	protein-coding gene	gene with protein product		610456	"""chromosome 7 open reading frame 5"""	C7orf5			Standard	NM_017654		Approved	KIAA2004, FLJ20073	uc003umg.3	Q5K651	OTTHUMG00000155809	ENST00000379958.2:c.51G>A	7.37:g.92735360C>T		Somatic	0	56	0.00		0.5423643324612125	3	25.00	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	39	11.36	A2RU68|Q5K649|Q6P080|Q75N21|Q8IVG6|Q9NXS8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,superfamily_P-loop_NTPase,smart_SAM,pfscan_SAM	p.E17	ENST00000379958.2	37	c.51	CCDS34680.1	7																																																																																			-	pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM,pfscan_SAM		0.318	SAMD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAMD9	protein_coding	OTTHUMT00000341761.1	C	NM_017654	-		92735360	-1	no_errors	ENST00000379958	ensembl	human	known	74_37	silent	SNP	0.768	T
HLA-DQA2	3118	genome.wustl.edu	37	6	32713602	32713602	+	Silent	SNP	T	T	C	rs142901825	byFrequency	TCGA-MB-A8JK-01A-11D-A36J-09	TCGA-MB-A8JK-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	307db8e1-7146-4506-b618-eba5076a6860	9be6e5e2-2506-4a0a-9cb7-a0fcb5e7834a	g.chr6:32713602T>C	ENST00000374940.3	+	3	468	c.366T>C	c.(364-366)ccT>ccC	p.P122P		NM_020056.4	NP_064440.1	P01906	DQA2_HUMAN	major histocompatibility complex, class II, DQ alpha 2	122	Alpha-2.|Ig-like C1-type.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|interferon-gamma-mediated signaling pathway (GO:0060333)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)	MHC class II receptor activity (GO:0032395)			endometrium(2)|large_intestine(3)|lung(7)|skin(1)	13					"""""""Insulin(DB00071)"""	CCAAGTTTCCTGTGACGCTGG	0.507													T|||	301	0.0601038	0.0605	0.0677	5008	,	,		23748	0.0873		0.0467	False		,,,				2504	0.0399																0								ENSG00000237541						184.0	144.0	159.0					6																	32713602		1511	2709	4220	HLA-DQA2	SO:0001819	synonymous_variant	0			-	HGNC		CCDS4753.1	6p21.3	2013-01-11			ENSG00000237541	ENSG00000237541		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4943	protein-coding gene	gene with protein product		613503		HLA-DXA			Standard	NM_020056		Approved		uc003obx.3	P01906	OTTHUMG00000031108	ENST00000374940.3:c.366T>C	6.37:g.32713602T>C		Somatic	0	56	0.00		0.5423643324612125	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	78	10.34	A2BF37|B0V0E7|O19789|Q5SQ94|Q5SR04	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_MHC_II_a_N,pfam_Ig_C1-set,pfam_CD80_C2-set,superfamily_MHC_I/II-like_Ag-recog,smart_MHC_II_a_N,smart_Ig_C1-set,pfscan_Ig-like_dom	p.P122	ENST00000374940.3	37	c.366	CCDS4753.1	6																																																																																			-	pfam_Ig_C1-set,pfscan_Ig-like_dom		0.507	HLA-DQA2-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	HLA-DQA2	protein_coding	OTTHUMT00000076179.2	T	NM_020056	rs142901825		32713602	+1	no_errors	ENST00000374940	ensembl	human	known	74_37	silent	SNP	0.078	C
ANKRD20A8P	729171	genome.wustl.edu	37	2	95494915	95494915	+	RNA	SNP	C	C	T			TCGA-MB-A8JK-01A-11D-A36J-09	TCGA-MB-A8JK-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	307db8e1-7146-4506-b618-eba5076a6860	9be6e5e2-2506-4a0a-9cb7-a0fcb5e7834a	g.chr2:95494915C>T	ENST00000432432.2	-	0	1120					NR_040113.1		Q5CZ79	AN20B_HUMAN	ankyrin repeat domain 20 family, member A8, pseudogene																		AATTAATTACCTTCAAGGAAG	0.343																																																	0								ENSG00000229089																																			ANKRD20A8P			0			-	HGNC			2q11.1	2011-09-16	2010-12-15	2010-12-15	ENSG00000229089	ENSG00000229089			23666	pseudogene	pseudogene			"""ankyrin repeat domain 20B"""	ANKRD20B			Standard	NR_003366		Approved		uc010fhq.2	Q5CZ79	OTTHUMG00000155138		2.37:g.95494915C>T		Somatic	0	244	0.00		0.5423643324612125	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	63	240	20.72	A6NC18	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000432432.2	37	NULL		2																																																																																			-	-		0.343	ANKRD20A8P-002	KNOWN	not_best_in_genome_evidence|basic	processed_transcript	ANKRD20A8P	pseudogene	OTTHUMT00000451404.1	C		-		95494915	-1	no_errors	ENST00000432432	ensembl	human	known	74_37	rna	SNP	0.911	T
HLA-DQA2	3118	genome.wustl.edu	37	6	32713598	32713598	+	Missense_Mutation	SNP	T	T	C	rs138296677	byFrequency	TCGA-MB-A8JK-01A-11D-A36J-09	TCGA-MB-A8JK-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	307db8e1-7146-4506-b618-eba5076a6860	9be6e5e2-2506-4a0a-9cb7-a0fcb5e7834a	g.chr6:32713598T>C	ENST00000374940.3	+	3	464	c.362T>C	c.(361-363)tTt>tCt	p.F121S		NM_020056.4	NP_064440.1	P01906	DQA2_HUMAN	major histocompatibility complex, class II, DQ alpha 2	121	Alpha-2.|Ig-like C1-type.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|interferon-gamma-mediated signaling pathway (GO:0060333)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)	MHC class II receptor activity (GO:0032395)			endometrium(2)|large_intestine(3)|lung(7)|skin(1)	13					"""""""Insulin(DB00071)"""	TTTTCCAAGTTTCCTGTGACG	0.512													T|||	352	0.0702875	0.0961	0.0677	5008	,	,		25198	0.0873		0.0507	False		,,,				2504	0.0399																0								ENSG00000237541						179.0	140.0	154.0					6																	32713598		1511	2709	4220	HLA-DQA2	SO:0001583	missense	0			-	HGNC		CCDS4753.1	6p21.3	2013-01-11			ENSG00000237541	ENSG00000237541		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4943	protein-coding gene	gene with protein product		613503		HLA-DXA			Standard	NM_020056		Approved		uc003obx.3	P01906	OTTHUMG00000031108	ENST00000374940.3:c.362T>C	6.37:g.32713598T>C	ENSP00000364076:p.Phe121Ser	Somatic	0	60	0.00		0.5423643324612125	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	71	13.41	A2BF37|B0V0E7|O19789|Q5SQ94|Q5SR04	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MHC_II_a_N,pfam_Ig_C1-set,pfam_CD80_C2-set,superfamily_MHC_I/II-like_Ag-recog,smart_MHC_II_a_N,smart_Ig_C1-set,pfscan_Ig-like_dom	p.F121S	ENST00000374940.3	37	c.362	CCDS4753.1	6	.	.	.	.	.	.	.	.	.	.	.	0	-2.802170	0.00075	.	.	ENSG00000237541	ENST00000374940	T	0.00572	6.49	3.06	-0.236	0.13067	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.726686	0.12656	N	0.450006	T	0.00039	0.0001	N	0.00308	-1.67	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.24119	-1.0169	10	0.02654	T	1	.	0.5152	0.00602	0.1938:0.3561:0.1905:0.2596	.	121	P01906	DQA2_HUMAN	S	121	ENSP00000364076:F121S	ENSP00000364076:F121S	F	+	2	0	HLA-DQA2	32821576	0.000000	0.05858	0.837000	0.33122	0.054000	0.15201	0.039000	0.13884	0.145000	0.18977	-1.188000	0.01700	TTT	-	pfscan_Ig-like_dom		0.512	HLA-DQA2-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	HLA-DQA2	protein_coding	OTTHUMT00000076179.2	T	NM_020056	rs138296677		32713598	+1	no_errors	ENST00000374940	ensembl	human	known	74_37	missense	SNP	0.252	C
GMPS	8833	genome.wustl.edu	37	3	155615770	155615770	+	Missense_Mutation	SNP	G	G	T			TCGA-MB-A8JK-01A-11D-A36J-09	TCGA-MB-A8JK-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	307db8e1-7146-4506-b618-eba5076a6860	9be6e5e2-2506-4a0a-9cb7-a0fcb5e7834a	g.chr3:155615770G>T	ENST00000496455.2	+	3	599	c.264G>T	c.(262-264)tgG>tgT	p.W88C	GMPS_ENST00000295920.7_Intron|GMPS_ENST00000476145.1_3'UTR	NM_003875.2	NP_003866.1	P49915	GUAA_HUMAN	guanine monphosphate synthase	88	Glutamine amidotransferase type-1. {ECO:0000255|PROSITE-ProRule:PRU00605}.				glutamine metabolic process (GO:0006541)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase biosynthetic process (GO:0009113)|purine nucleobase metabolic process (GO:0006144)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|GMP synthase (glutamine-hydrolyzing) activity (GO:0003922)|GMP synthase activity (GO:0003921)|pyrophosphatase activity (GO:0016462)			breast(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(5)|lung(12)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)		L-Glutamine(DB00130)	ATGCTCCCTGGTTTGATCCAG	0.358			T	MLL	AML																																Ovarian(153;896 1876 4149 15499 28134)			Dom	yes		3	3q24	8833	guanine monphosphate synthetase		L	0								ENSG00000163655						324.0	308.0	313.0					3																	155615770		1884	4120	6004	GMPS	SO:0001583	missense	0			-	HGNC	U10860	CCDS46941.1	3q25.31	2013-06-18	2013-06-18		ENSG00000163655	ENSG00000163655	6.3.5.2		4378	protein-coding gene	gene with protein product	"""GMP synthase"""	600358	"""guanine monphosphate synthetase"""			8089153, 9195163	Standard	NM_003875		Approved		uc003faq.3	P49915	OTTHUMG00000158551	ENST00000496455.2:c.264G>T	3.37:g.155615770G>T	ENSP00000419851:p.Trp88Cys	Somatic	0	71	0.00		0.5423643324612125	105	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	34	10.53	A8K639|B4DXV7|F8W720	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GATASE,pfam_GMP_synth_C,pfam_Peptidase_C26,pfam_NAD/GMP_synthase,pfam_QueC,pfam_Asn_synthase,pfam_tRNA-specific_2-thiouridylase,tigrfam_GMP_synth_N	p.W88C	ENST00000496455.2	37	c.264	CCDS46941.1	3	.	.	.	.	.	.	.	.	.	.	G	16.24	3.068578	0.55539	.	.	ENSG00000163655	ENST00000496455;ENST00000537975;ENST00000541628	D	0.89343	-2.5	5.57	5.57	0.84162	Glutamine amidotransferase type 1 (2);GMP synthase, N-terminal (1);	0.070358	0.64402	D	0.000009	D	0.85626	0.5740	L	0.52011	1.625	0.80722	D	1	P	0.46912	0.886	B	0.34991	0.193	D	0.87537	0.2456	10	0.59425	D	0.04	-6.7736	19.5529	0.95328	0.0:0.0:1.0:0.0	.	88	P49915	GUAA_HUMAN	C	88;37;88	ENSP00000419851:W88C	ENSP00000419851:W88C	W	+	3	0	GMPS	157098464	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.119000	0.71590	2.621000	0.88768	0.655000	0.94253	TGG	-	pfam_GATASE,tigrfam_GMP_synth_N		0.358	GMPS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GMPS	protein_coding	OTTHUMT00000351260.2	G		-		155615770	+1	no_errors	ENST00000496455	ensembl	human	known	74_37	missense	SNP	1.000	T
DUOX2	50506	genome.wustl.edu	37	15	45388168	45388168	+	Missense_Mutation	SNP	G	G	A			TCGA-MB-A8JK-01A-11D-A36J-09	TCGA-MB-A8JK-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	307db8e1-7146-4506-b618-eba5076a6860	9be6e5e2-2506-4a0a-9cb7-a0fcb5e7834a	g.chr15:45388168G>A	ENST00000603300.1	-	30	4140	c.3938C>T	c.(3937-3939)aCc>aTc	p.T1313I	DUOX2_ENST00000389039.6_Missense_Mutation_p.T1313I	NM_014080.4	NP_054799.4	Q9NRD8	DUOX2_HUMAN	dual oxidase 2	1313	FAD-binding FR-type. {ECO:0000255|PROSITE-ProRule:PRU00716}.				adenohypophysis morphogenesis (GO:0048855)|bone mineralization (GO:0030282)|cuticle development (GO:0042335)|cytokine-mediated signaling pathway (GO:0019221)|fertilization (GO:0009566)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|inner ear development (GO:0048839)|multicellular organism growth (GO:0035264)|oxidation-reduction process (GO:0055114)|response to cAMP (GO:0051591)|response to virus (GO:0009615)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|NAD(P)H oxidase activity (GO:0016174)|peroxidase activity (GO:0004601)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(28)|ovary(3)|pancreas(1)|prostate(4)|skin(7)|urinary_tract(1)	63		all_cancers(109;3.79e-11)|all_epithelial(112;2.92e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;1.05e-18)|GBM - Glioblastoma multiforme(94;4.23e-07)|COAD - Colon adenocarcinoma(120;0.0668)|Colorectal(133;0.068)		GTGGTACTCGGTGGTCCCCAG	0.632																																																	0								ENSG00000140279						107.0	92.0	97.0					15																	45388168		2198	4298	6496	DUOX2	SO:0001583	missense	0			-	HGNC	AF181972	CCDS10117.1	15q15.3-q21	2013-01-10			ENSG00000140279	ENSG00000140279		"""EF-hand domain containing"""	13273	protein-coding gene	gene with protein product	"""dual oxidase-like domains 2"", ""nicotinamide adenine dinucleotide phosphate oxidase"", ""flavoprotein NADPH oxidase"", ""NADPH thyroid oxidase 2"", ""NADH/NADPH thyroid oxidase p138-tox"", ""NADPH oxidase/peroxidase DUOX2"""	606759				10601291, 10806195	Standard	NM_014080		Approved	P138-TOX, P138(TOX), THOX2, LNOX2	uc010bea.3	Q9NRD8	OTTHUMG00000131355	ENST00000603300.1:c.3938C>T	15.37:g.45388168G>A	ENSP00000475084:p.Thr1313Ile	Somatic	0	47	0.00		0.5423643324612125	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.16	A8MQ13|D2XI64|Q9NR02|Q9UHF9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Haem_peroxidase_animal,pfam_Fe_red_NAD-bd_6,pfam_FAD-bd_8,pfam_Fe3_Rdtase_TM_dom,pfam_EF_hand_dom,superfamily_Haem_peroxidase,superfamily_Riboflavin_synthase-like_b-brl,smart_EF_hand_dom,pfscan_EF_hand_dom,pfscan_Haem_peroxidase_animal,prints_Haem_peroxidase_animal_subgr,prints_Recoverin	p.T1313I	ENST00000603300.1	37	c.3938	CCDS10117.1	15	.	.	.	.	.	.	.	.	.	.	G	14.66	2.600411	0.46423	.	.	ENSG00000140279	ENST00000389039	.	.	.	5.69	0.862	0.19056	Riboflavin synthase-like beta-barrel (1);FAD-binding 8 (1);Ferredoxin reductase-type FAD-binding domain (1);	0.206543	0.50627	D	0.000102	T	0.40247	0.1109	L	0.43923	1.385	0.20307	N	0.999913	B	0.27229	0.172	B	0.31191	0.125	T	0.24512	-1.0158	9	0.23302	T	0.38	-6.7198	15.7786	0.78243	0.0:0.0:0.5161:0.4839	.	1313	Q9NRD8	DUOX2_HUMAN	I	1313	.	ENSP00000373691:T1313I	T	-	2	0	DUOX2	43175460	0.054000	0.20591	0.784000	0.31847	0.995000	0.86356	0.319000	0.19522	-0.173000	0.10761	0.561000	0.74099	ACC	-	pfam_FAD-bd_8,superfamily_Riboflavin_synthase-like_b-brl		0.632	DUOX2-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DUOX2	protein_coding		G	NM_014080	-		45388168	-1	no_errors	ENST00000389039	ensembl	human	known	74_37	missense	SNP	0.258	A
PLCB4	5332	genome.wustl.edu	37	20	9404506	9404506	+	Missense_Mutation	SNP	A	A	C			TCGA-MB-A8JK-01A-11D-A36J-09	TCGA-MB-A8JK-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	307db8e1-7146-4506-b618-eba5076a6860	9be6e5e2-2506-4a0a-9cb7-a0fcb5e7834a	g.chr20:9404506A>C	ENST00000378493.1	+	24	2410	c.2395A>C	c.(2395-2397)Att>Ctt	p.I799L	PLCB4_ENST00000334005.3_Missense_Mutation_p.I799L|PLCB4_ENST00000414679.2_Missense_Mutation_p.I811L|PLCB4_ENST00000378473.3_Missense_Mutation_p.I811L|PLCB4_ENST00000492632.1_3'UTR|PLCB4_ENST00000378501.2_Missense_Mutation_p.I799L|PLCB4_ENST00000278655.4_Missense_Mutation_p.I799L			Q15147	PLCB4_HUMAN	phospholipase C, beta 4	799					inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|dendrite (GO:0030425)|nucleus (GO:0005634)|postsynaptic density (GO:0014069)|smooth endoplasmic reticulum (GO:0005790)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			NS(2)|breast(4)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(11)|liver(4)|lung(34)|ovary(3)|pancreas(1)|prostate(1)|skin(19)|upper_aerodigestive_tract(1)	87						ATATCGACACATTTCCCTTCG	0.428																																																	0								ENSG00000101333						95.0	81.0	86.0					20																	9404506		2203	4300	6503	PLCB4	SO:0001583	missense	0			-	HGNC		CCDS13104.1, CCDS13105.1, CCDS54447.1	20p12	2008-03-18			ENSG00000101333	ENSG00000101333	3.1.4.11		9059	protein-coding gene	gene with protein product		600810				8530101	Standard	NM_000933		Approved		uc021wam.1	Q15147	OTTHUMG00000031853	ENST00000378493.1:c.2395A>C	20.37:g.9404506A>C	ENSP00000367754:p.Ile799Leu	Somatic	0	60	0.00		0.5423643324612125	4	33.33	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	37	30.91	B7ZLK6|E2QRH8|Q17R56|Q5JYS8|Q5JYS9|Q5JYT0|Q5JYT3|Q5JYT4|Q9BQW5|Q9BQW6|Q9BQW8|Q9UJQ2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_PLC-beta,pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_PLipase_C_EF-hand-like,pfam_PLC-beta_CS,pfam_C2_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_dom,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_dom,prints_Pinositol_PLipase_C,pfscan_C2_dom,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y	p.I799L	ENST00000378493.1	37	c.2395	CCDS13105.1	20	.	.	.	.	.	.	.	.	.	.	A	27.0	4.790583	0.90367	.	.	ENSG00000101333	ENST00000334005;ENST00000378473;ENST00000278655;ENST00000378493;ENST00000378501;ENST00000414679	T;T;T;T;T;T	0.12672	2.66;2.66;2.66;2.66;2.66;2.66	5.72	5.72	0.89469	C2 calcium-dependent membrane targeting (1);C2 calcium/lipid-binding domain, CaLB (1);	0.047016	0.85682	D	0.000000	T	0.31136	0.0787	L	0.52011	1.625	0.80722	D	1	P;P;B;P	0.44309	0.832;0.701;0.199;0.505	P;P;P;P	0.61477	0.889;0.659;0.572;0.565	T	0.00514	-1.1695	10	0.42905	T	0.14	.	16.0205	0.80486	1.0:0.0:0.0:0.0	.	811;646;799;799	E2QRH8;Q15147-2;Q15147;Q15147-4	.;.;PLCB4_HUMAN;.	L	799;811;799;799;799;647	ENSP00000334105:I799L;ENSP00000367734:I811L;ENSP00000278655:I799L;ENSP00000367754:I799L;ENSP00000367762:I799L;ENSP00000390616:I647L	ENSP00000278655:I799L	I	+	1	0	PLCB4	9352506	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	9.085000	0.94083	2.194000	0.70268	0.533000	0.62120	ATT	-	pirsf_PLC-beta,superfamily_C2_dom,smart_C2_dom		0.428	PLCB4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLCB4	protein_coding	OTTHUMT00000077948.2	A		-		9404506	+1	no_errors	ENST00000334005	ensembl	human	known	74_37	missense	SNP	1.000	C
CST11	140880	genome.wustl.edu	37	20	23433382	23433382	+	Missense_Mutation	SNP	G	G	T			TCGA-MB-A8JK-01A-11D-A36J-09	TCGA-MB-A8JK-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	307db8e1-7146-4506-b618-eba5076a6860	9be6e5e2-2506-4a0a-9cb7-a0fcb5e7834a	g.chr20:23433382G>T	ENST00000377009.3	-	1	100	c.67C>A	c.(67-69)Ccc>Acc	p.P23T	CST11_ENST00000377007.3_Missense_Mutation_p.P23T	NM_130794.1	NP_570612.1	Q9H112	CST11_HUMAN	cystatin 11	23					defense response to bacterium (GO:0042742)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cysteine-type endopeptidase inhibitor activity (GO:0004869)			kidney(2)|large_intestine(1)|lung(7)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	14	Colorectal(13;0.0431)|Lung NSC(19;0.235)					GCTTGGTAGGGGAGGGCCATC	0.512																																																	0								ENSG00000125831						98.0	85.0	89.0					20																	23433382		2203	4300	6503	CST11	SO:0001583	missense	0			-	HGNC	AL096677	CCDS13154.1, CCDS13155.1	20p11.21	2012-08-14			ENSG00000125831	ENSG00000125831			15959	protein-coding gene	gene with protein product		609731		CST8L		20565543	Standard	NM_080830		Approved	dJ322G13.6, CTES2	uc002wtf.1	Q9H112	OTTHUMG00000032060	ENST00000377009.3:c.67C>A	20.37:g.23433382G>T	ENSP00000366208:p.Pro23Thr	Somatic	0	36	0.00		0.5423643324612125	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	10	23.08	Q0VAF2|Q0VAF3|Q8WXU5|Q8WXU6|Q9H113	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_inh_cystat,smart_Prot_inh_cystat	p.P23T	ENST00000377009.3	37	c.67	CCDS13155.1	20	.	.	.	.	.	.	.	.	.	.	G	0.203	-1.043002	0.01997	.	.	ENSG00000125831	ENST00000377009;ENST00000377007	T;T	0.16897	2.88;2.31	3.86	0.273	0.15650	.	1.070420	0.07156	N	0.849936	T	0.04092	0.0114	N	0.01576	-0.805	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.38672	-0.9650	10	0.02654	T	1	0.0122	0.9871	0.01448	0.2022:0.1079:0.1882:0.5018	.	23;23	Q9H112-2;Q9H112	.;CST11_HUMAN	T	23	ENSP00000366208:P23T;ENSP00000366206:P23T	ENSP00000366206:P23T	P	-	1	0	CST11	23381382	0.029000	0.19370	0.002000	0.10522	0.438000	0.31896	0.089000	0.15002	0.009000	0.14813	-0.265000	0.10407	CCC	-	NULL		0.512	CST11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CST11	protein_coding	OTTHUMT00000078314.1	G	NM_130794	-		23433382	-1	no_errors	ENST00000377009	ensembl	human	known	74_37	missense	SNP	0.002	T
TXLNGY	246126	genome.wustl.edu	37	Y	21758039	21758039	+	RNA	DEL	A	A	-			TCGA-MB-A8JK-01A-11D-A36J-09	TCGA-MB-A8JK-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	307db8e1-7146-4506-b618-eba5076a6860	9be6e5e2-2506-4a0a-9cb7-a0fcb5e7834a	g.chrY:21758039delA	ENST00000253320.4	+	0	3120																				haematopoietic_and_lymphoid_tissue(1)	1						TACTTCTTGGAAAAAAAAAAA	0.378													GA	15	0.0125209	0.0063	0.0059	1198	,	,		6405	0.0082		0.0063	False		,,,				1198	0.0038																0								ENSG00000131002																																			TXLNG2P			0				HGNC																													Y.37:g.21758039delA		Somatic	0	27	0.00		0.5423643324612125	9	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	22	18.52		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000253320.4	37	NULL		Y																																																																																			-	-		0.378	TXLNG2P-012	KNOWN	basic	processed_transcript	TXLNG2P	pseudogene	OTTHUMT00000088781.1	A				21758039	+1	no_errors	ENST00000253320	ensembl	human	known	74_37	rna	DEL	0.012	-
LIMK1	3984	genome.wustl.edu	37	7	73500126	73500126	+	Missense_Mutation	SNP	G	G	T			TCGA-MB-A8JK-01A-11D-A36J-09	TCGA-MB-A8JK-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	307db8e1-7146-4506-b618-eba5076a6860	9be6e5e2-2506-4a0a-9cb7-a0fcb5e7834a	g.chr7:73500126G>T	ENST00000336180.2	+	2	155	c.104G>T	c.(103-105)gGc>gTc	p.G35V	LIMK1_ENST00000418310.1_Missense_Mutation_p.G65V	NM_002314.3	NP_002305.1	P53667	LIMK1_HUMAN	LIM domain kinase 1	35	LIM zinc-binding 1. {ECO:0000255|PROSITE- ProRule:PRU00125}.				actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|negative regulation of ubiquitin-protein transferase activity (GO:0051444)|nervous system development (GO:0007399)|positive regulation of actin filament bundle assembly (GO:0032233)|positive regulation of axon extension (GO:0045773)|positive regulation of stress fiber assembly (GO:0051496)|protein phosphorylation (GO:0006468)|Rho protein signal transduction (GO:0007266)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|neuron projection (GO:0043005)|nucleus (GO:0005634)	ATP binding (GO:0005524)|heat shock protein binding (GO:0031072)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|ovary(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	21		Lung NSC(55;0.137)			Dabrafenib(DB08912)	ATCTATGATGGCCAGTACCTC	0.607																																																	0								ENSG00000106683						75.0	52.0	60.0					7																	73500126		2185	4276	6461	LIMK1	SO:0001583	missense	0			-	HGNC	D26309	CCDS5563.1, CCDS56491.1	7q11.23	2005-01-21			ENSG00000106683	ENSG00000106683			6613	protein-coding gene	gene with protein product		601329				8673124, 8812460	Standard	NM_002314		Approved	LIMK	uc003uaa.2	P53667	OTTHUMG00000023448	ENST00000336180.2:c.104G>T	7.37:g.73500126G>T	ENSP00000336740:p.Gly35Val	Somatic	0	41	0.00		0.5423643324612125	39	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52	B7Z6I8|D3DXF4|D3DXF5|O15283|Q15820|Q15821|Q75MU3|Q9Y5Q1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Znf_LIM,pfam_PDZ,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,superfamily_PDZ,smart_Znf_LIM,smart_PDZ,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Znf_LIM,pfscan_PDZ,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.G35V	ENST00000336180.2	37	c.104	CCDS5563.1	7	.	.	.	.	.	.	.	.	.	.	G	12.60	1.987582	0.35036	.	.	ENSG00000106683	ENST00000418310;ENST00000419043;ENST00000336180	D;D	0.87256	-2.23;-2.23	4.66	2.81	0.32909	Zinc finger, LIM-type (5);	0.121926	0.56097	U	0.000040	D	0.85613	0.5737	L	0.55743	1.74	0.80722	D	1	B	0.33964	0.434	B	0.43018	0.405	T	0.81901	-0.0720	10	0.62326	D	0.03	-19.4615	7.7842	0.29083	0.2006:0.0:0.7994:0.0	.	35	P53667	LIMK1_HUMAN	V	65;35;35	ENSP00000409717:G65V;ENSP00000336740:G35V	ENSP00000336740:G35V	G	+	2	0	LIMK1	73138062	1.000000	0.71417	0.977000	0.42913	0.836000	0.47400	3.381000	0.52455	0.381000	0.24851	0.306000	0.20318	GGC	-	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM		0.607	LIMK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIMK1	protein_coding	OTTHUMT00000252335.2	G	NM_002314	-		73500126	+1	no_errors	ENST00000336180	ensembl	human	known	74_37	missense	SNP	1.000	T
LAMC3	10319	genome.wustl.edu	37	9	133954581	133954581	+	Silent	SNP	C	C	T			TCGA-MB-A8JK-01A-11D-A36J-09	TCGA-MB-A8JK-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	307db8e1-7146-4506-b618-eba5076a6860	9be6e5e2-2506-4a0a-9cb7-a0fcb5e7834a	g.chr9:133954581C>T	ENST00000361069.4	+	23	3956	c.3823C>T	c.(3823-3825)Ctg>Ttg	p.L1275L	LAMC3_ENST00000480883.1_Intron	NM_006059.3	NP_006050.3	Q9Y6N6	LAMC3_HUMAN	laminin, gamma 3	1275	Domain II and I.				astrocyte development (GO:0014002)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|extracellular matrix organization (GO:0030198)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	structural molecule activity (GO:0005198)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(31)|ovary(3)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	69	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.06e-05)|Epithelial(140;0.000551)		GGCGAAGGCCCTGGAGAAGAC	0.632																																																	0								ENSG00000050555						50.0	43.0	45.0					9																	133954581		2203	4300	6503	LAMC3	SO:0001819	synonymous_variant	0			-	HGNC	AF041835	CCDS6938.1	9q31-q34	2013-03-01			ENSG00000050555	ENSG00000050555		"""Laminins"""	6494	protein-coding gene	gene with protein product		604349				10225960	Standard	NM_006059		Approved	DKFZp434E202	uc004caa.1	Q9Y6N6	OTTHUMG00000020819	ENST00000361069.4:c.3823C>T	9.37:g.133954581C>T		Somatic	0	61	0.00		0.5423643324612125	97	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	28	54	34.15	B1APX9|B1APY0|Q59H72	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_EGF_laminin,pfam_Laminin_N,pfam_Laminin_B_type_IV,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_B_subgr,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_N	p.L1275	ENST00000361069.4	37	c.3823	CCDS6938.1	9																																																																																			-	NULL		0.632	LAMC3-004	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMC3	protein_coding	OTTHUMT00000054717.3	C	NM_006059	-		133954581	+1	no_errors	ENST00000361069	ensembl	human	known	74_37	silent	SNP	0.318	T
ITPK1	3705	genome.wustl.edu	37	14	93535790	93535790	+	Intron	SNP	G	G	T			TCGA-MB-A8JK-01A-11D-A36J-09	TCGA-MB-A8JK-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	307db8e1-7146-4506-b618-eba5076a6860	9be6e5e2-2506-4a0a-9cb7-a0fcb5e7834a	g.chr14:93535790G>T	ENST00000267615.6	-	3	294				ITPK1_ENST00000556603.2_Intron|ITPK1_ENST00000354313.3_Intron|ITPK1_ENST00000555495.1_Intron|ITPK1-AS1_ENST00000553639.1_RNA			Q13572	ITPK1_HUMAN	inositol-tetrakisphosphate 1-kinase						blood coagulation (GO:0007596)|dephosphorylation (GO:0016311)|inositol phosphate metabolic process (GO:0043647)|inositol trisphosphate metabolic process (GO:0032957)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|catalytic activity (GO:0003824)|inositol tetrakisphosphate 1-kinase activity (GO:0047325)|inositol-1,3,4,5,6-pentakisphosphate 1-phosphatase activity (GO:0052825)|inositol-1,3,4,6-tetrakisphosphate 1-phosphatase activity (GO:0052831)|inositol-1,3,4,6-tetrakisphosphate 6-phosphatase activity (GO:0052830)|inositol-1,3,4-trisphosphate 5-kinase activity (GO:0052726)|inositol-1,3,4-trisphosphate 6-kinase activity (GO:0052725)|inositol-3,4,6-trisphosphate 1-kinase activity (GO:0052835)|isomerase activity (GO:0016853)|magnesium ion binding (GO:0000287)			endometrium(1)|large_intestine(3)|lung(6)|ovary(1)	11		all_cancers(154;0.077)|all_epithelial(191;0.247)		Epithelial(152;0.124)|all cancers(159;0.169)		TGTGGCCCTGGCCATGCTCCT	0.597																																																	0								ENSG00000258730						131.0	127.0	128.0					14																	93535790		692	1591	2283	ITPK1-AS1	SO:0001627	intron_variant	0			-	HGNC	U51336	CCDS9907.1, CCDS45157.1	14q32.12	2012-08-16	2011-04-28		ENSG00000100605	ENSG00000100605	2.7.1.134		6177	protein-coding gene	gene with protein product		601838	"""inositol 1,3,4-triphosphate 5/6 kinase"""			8662638, 11042108	Standard	NM_014216		Approved		uc001ybh.3	Q13572	OTTHUMG00000171226	ENST00000267615.6:c.120+7149C>A	14.37:g.93535790G>T		Somatic	0	38	0.00		0.5423643324612125	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	31	11.43	Q9BTL6|Q9H2E7	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000267615.6	37	NULL	CCDS9907.1	14																																																																																			-	-		0.597	ITPK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITPK1-AS1	protein_coding	OTTHUMT00000412421.2	G	NM_014216	-		93535790	+1	no_errors	ENST00000553639	ensembl	human	known	74_37	rna	SNP	0.000	T
ADAMTS12	81792	genome.wustl.edu	37	5	33576831	33576831	+	Silent	SNP	C	C	T			TCGA-MB-A8JK-01A-11D-A36J-09	TCGA-MB-A8JK-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	307db8e1-7146-4506-b618-eba5076a6860	9be6e5e2-2506-4a0a-9cb7-a0fcb5e7834a	g.chr5:33576831C>T	ENST00000504830.1	-	19	3635	c.3300G>A	c.(3298-3300)caG>caA	p.Q1100Q	ADAMTS12_ENST00000352040.3_Silent_p.Q1015Q|ADAMTS12_ENST00000504582.1_5'Flank	NM_030955.2	NP_112217.2	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 12	1100	Spacer 2.				cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of cellular response to hepatocyte growth factor stimulus (GO:2001113)|negative regulation of cellular response to vascular endothelial growth factor stimulus (GO:1902548)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of hepatocyte growth factor receptor signaling pathway (GO:1902203)|proteoglycan catabolic process (GO:0030167)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of endothelial tube morphogenesis (GO:1901509)|regulation of inflammatory response (GO:0050727)	extracellular matrix (GO:0031012)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(31)|liver(1)|lung(135)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	216						CCTCACTTGGCTGAATGCTCA	0.512										HNSCC(64;0.19)																																							0								ENSG00000151388						98.0	92.0	94.0					5																	33576831		2203	4300	6503	ADAMTS12	SO:0001819	synonymous_variant	0			-	HGNC	AJ250725	CCDS34140.1	5q35	2008-07-18	2005-08-19		ENSG00000151388	ENSG00000151388		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14605	protein-coding gene	gene with protein product		606184	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 12"""			11279086	Standard	NM_030955		Approved		uc003jia.1	P58397	OTTHUMG00000162088	ENST00000504830.1:c.3300G>A	5.37:g.33576831C>T		Somatic	0	38	0.00		0.5423643324612125	18	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	27	12.90	A2RRN9|A5D6V6|Q6UWL3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.Q1100	ENST00000504830.1	37	c.3300	CCDS34140.1	5																																																																																			-	NULL		0.512	ADAMTS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS12	protein_coding	OTTHUMT00000367164.2	C	NM_030955	-		33576831	-1	no_errors	ENST00000504830	ensembl	human	known	74_37	silent	SNP	0.054	T
