#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
OR7A17	26333	genome.wustl.edu	37	19	14992099	14992099	+	Missense_Mutation	SNP	C	C	A			TCGA-N1-A6IA-01A-12D-A32I-09	TCGA-N1-A6IA-11A-11D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	26f94549-f63a-4c0f-8c70-0341ea0f528f	29f71321-1ce9-42d2-8923-7528a4bff739	g.chr19:14992099C>A	ENST00000327462.2	-	1	165	c.69G>T	c.(67-69)ttG>ttT	p.L23F		NM_030901.1	NP_112163.1	O14581	OR7AH_HUMAN	olfactory receptor, family 7, subfamily A, member 17	23						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|cervix(1)|large_intestine(2)|lung(6)|prostate(1)|skin(1)	12	Ovarian(108;0.203)					GGAAGGGCTGCAATTCTGGTT	0.428																																																	0								ENSG00000185385						40.0	35.0	36.0					19																	14992099		2203	4300	6503	OR7A17	SO:0001583	missense	0			-	HGNC	X64993	CCDS12319.1	19p13.12	2012-08-09				ENSG00000185385		"""GPCR / Class A : Olfactory receptors"""	8363	protein-coding gene	gene with protein product						1370859	Standard	NM_030901		Approved	HTPCRX19	uc010xob.2	O14581		ENST00000327462.2:c.69G>T	19.37:g.14992099C>A	ENSP00000328144:p.Leu23Phe	Somatic	0	70	0.00		0.586032912036718	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	84	18	82.35	Q6IFQ6|Q96R98	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L23F	ENST00000327462.2	37	c.69	CCDS12319.1	19	.	.	.	.	.	.	.	.	.	.	c	10.20	1.284405	0.23392	.	.	ENSG00000185385	ENST00000327462	T	0.03330	3.97	2.73	-0.874	0.10631	.	2.440800	0.03848	U	0.271810	T	0.09379	0.0231	M	0.82056	2.57	0.09310	N	1	B	0.33198	0.401	B	0.43018	0.405	T	0.40869	-0.9540	10	0.66056	D	0.02	.	0.5709	0.00695	0.196:0.3672:0.1924:0.2444	.	23	O14581	OR7AH_HUMAN	F	23	ENSP00000328144:L23F	ENSP00000328144:L23F	L	-	3	2	OR7A17	14853099	0.000000	0.05858	0.007000	0.13788	0.009000	0.06853	-1.145000	0.03194	-0.051000	0.13334	0.388000	0.25769	TTG	-	NULL		0.428	OR7A17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR7A17	protein_coding	OTTHUMT00000466523.1	C	NM_030901	-		14992099	-1	no_errors	ENST00000327462	ensembl	human	known	74_37	missense	SNP	0.184	A
CCDC178	374864	genome.wustl.edu	37	18	30517983	30517983	+	Missense_Mutation	SNP	C	C	T	rs200567065		TCGA-N1-A6IA-01A-12D-A32I-09	TCGA-N1-A6IA-11A-11D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	26f94549-f63a-4c0f-8c70-0341ea0f528f	29f71321-1ce9-42d2-8923-7528a4bff739	g.chr18:30517983C>T	ENST00000383096.3	-	23	2778	c.2596G>A	c.(2596-2598)Gat>Aat	p.D866N	CCDC178_ENST00000581852.1_Missense_Mutation_p.D71N|CCDC178_ENST00000406524.2_Missense_Mutation_p.D890N|CCDC178_ENST00000403303.1_Missense_Mutation_p.D866N|CCDC178_ENST00000300227.8_Missense_Mutation_p.D828N|CCDC178_ENST00000583930.1_Missense_Mutation_p.D890N|CCDC178_ENST00000402325.1_Missense_Mutation_p.D816N|RP11-746B8.1_ENST00000580366.1_RNA|CCDC178_ENST00000579916.1_Missense_Mutation_p.D186N			Q5BJE1	CC178_HUMAN	coiled-coil domain containing 178	866																	GCTTAACCATCGTTTTCGCAT	0.368													C|||	1	0.000199681	0.0	0.0014	5008	,	,		21455	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000166960						179.0	160.0	166.0					18																	30517983		2203	4300	6503	CCDC178	SO:0001583	missense	0			GMAF=0.0005	HGNC	AK126038	CCDS11906.1, CCDS42424.1	18q12.1	2012-10-15	2012-10-15	2012-10-15	ENSG00000166960	ENSG00000166960			29588	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 34"""	C18orf34			Standard	NM_198995		Approved	FLJ44050	uc002kxn.2	Q5BJE1	OTTHUMG00000132279	ENST00000383096.3:c.2596G>A	18.37:g.30517983C>T	ENSP00000372576:p.Asp866Asn	Somatic	0	48	0.00		0.586032912036718	3	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	31	22.50	A6NDC6|J3KS92|Q6ZP67|Q6ZU20	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.D890N	ENST00000383096.3	37	c.2668	CCDS42424.1	18	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	9.907	1.208464	0.22205	.	.	ENSG00000166960	ENST00000403303;ENST00000383096;ENST00000300227;ENST00000406524;ENST00000402325	T;T;T;T;T	0.17054	2.31;2.31;2.35;2.3;2.32	5.72	4.84	0.62591	.	.	.	.	.	T	0.29288	0.0729	N	0.24115	0.695	0.26142	N	0.980267	D;D;D;D;D	0.89917	1.0;0.979;1.0;1.0;1.0	D;B;D;D;D	0.77557	0.966;0.434;0.99;0.966;0.966	T	0.10730	-1.0617	9	0.87932	D	0	0.0028	14.9957	0.71431	0.0:0.9308:0.0:0.0692	.	890;866;816;828;866	F8W7A7;A1L4G8;Q5BJE1-3;Q5BJE1-2;Q5BJE1	.;.;.;.;CR034_HUMAN	N	866;866;828;890;816	ENSP00000385591:D866N;ENSP00000372576:D866N;ENSP00000300227:D828N;ENSP00000385867:D890N;ENSP00000385234:D816N	ENSP00000300227:D828N	D	-	1	0	C18orf34	28771981	0.786000	0.28738	0.961000	0.40146	0.546000	0.35178	1.460000	0.35244	2.696000	0.92011	0.650000	0.86243	GAT	-	NULL		0.368	CCDC178-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCDC178	protein_coding	OTTHUMT00000255373.2	C	NM_198995	rs200567065		30517983	-1	no_errors	ENST00000406524	ensembl	human	known	74_37	missense	SNP	0.943	T
MYO15A	51168	genome.wustl.edu	37	17	18082113	18082113	+	Missense_Mutation	SNP	C	C	T			TCGA-N1-A6IA-01A-12D-A32I-09	TCGA-N1-A6IA-11A-11D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	26f94549-f63a-4c0f-8c70-0341ea0f528f	29f71321-1ce9-42d2-8923-7528a4bff739	g.chr17:18082113C>T	ENST00000205890.5	+	66	10860	c.10522C>T	c.(10522-10524)Cac>Tac	p.H3508Y	RP11-258F1.1_ENST00000583062.1_RNA|MYO15A_ENST00000451725.2_3'UTR|MYO15A_ENST00000418233.3_Missense_Mutation_p.A789V|RP11-258F1.1_ENST00000577847.1_RNA	NM_016239.3	NP_057323.3	Q9UKN7	MYO15_HUMAN	myosin XVA	3508	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.|Tail.				inner ear morphogenesis (GO:0042472)|locomotory behavior (GO:0007626)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|stereocilium (GO:0032420)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(5)|central_nervous_system(2)|endometrium(17)|kidney(3)|large_intestine(16)|lung(27)|ovary(3)|pancreas(1)|prostate(6)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	99	all_neural(463;0.228)					GGTGGCCGTGCACGTGGAGAA	0.612																																																	0								ENSG00000091536						127.0	142.0	137.0					17																	18082113		2150	4267	6417	MYO15A	SO:0001583	missense	0			-	HGNC	AF144094	CCDS42271.1	17p11.2	2011-09-27			ENSG00000091536	ENSG00000091536		"""Myosins / Myosin superfamily : Class XV"""	7594	protein-coding gene	gene with protein product		602666		DFNB3, MYO15		9603736	Standard	NM_016239		Approved		uc021trl.1	Q9UKN7	OTTHUMG00000059390	ENST00000205890.5:c.10522C>T	17.37:g.18082113C>T	ENSP00000205890:p.His3508Tyr	Somatic	0	38	0.00		0.586032912036718	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	53	24.29	B4DFC7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Myosin_head_motor_dom,pfam_MyTH4_dom,pfam_SH3_2,pfam_FERM_central,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,superfamily_FERM_central,superfamily_SH3_domain,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,smart_MyTH4_dom,smart_SH3_domain,smart_Band_41_domain,pfscan_FERM_domain,pfscan_IQ_motif_EF-hand-BS,pfscan_MyTH4_dom,prints_Myosin_head_motor_dom	p.H3508Y	ENST00000205890.5	37	c.10522	CCDS42271.1	17	.	.	.	.	.	.	.	.	.	.	C	17.74	3.462998	0.63513	.	.	ENSG00000091536	ENST00000205890	D	0.86769	-2.17	5.58	5.58	0.84498	FERM domain (1);	.	.	.	.	D	0.88138	0.6356	N	0.25485	0.75	0.80722	D	1	D	0.89917	1.0	D	0.66716	0.946	T	0.83355	-0.0001	9	0.10111	T	0.7	.	19.1853	0.93641	0.0:1.0:0.0:0.0	.	3508	Q9UKN7	MYO15_HUMAN	Y	3508	ENSP00000205890:H3508Y	ENSP00000205890:H3508Y	H	+	1	0	MYO15A	18022838	1.000000	0.71417	0.989000	0.46669	0.680000	0.39746	7.600000	0.82769	2.637000	0.89404	0.555000	0.69702	CAC	-	pfscan_FERM_domain		0.612	MYO15A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO15A	protein_coding	OTTHUMT00000132048.1	C	NM_016239	-		18082113	+1	no_errors	ENST00000205890	ensembl	human	known	74_37	missense	SNP	1.000	T
PLXNB3	5365	genome.wustl.edu	37	X	153044436	153044436	+	Missense_Mutation	SNP	T	T	A			TCGA-N1-A6IA-01A-12D-A32I-09	TCGA-N1-A6IA-11A-11D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	26f94549-f63a-4c0f-8c70-0341ea0f528f	29f71321-1ce9-42d2-8923-7528a4bff739	g.chrX:153044436T>A	ENST00000361971.5	+	36	5786	c.5672T>A	c.(5671-5673)cTg>cAg	p.L1891Q	PLXNB3_ENST00000538966.1_Missense_Mutation_p.L1914Q|SRPK3_ENST00000370104.1_5'Flank|SRPK3_ENST00000370100.1_5'Flank|PLXNB3_ENST00000538776.1_Missense_Mutation_p.L1544Q|SRPK3_ENST00000370101.3_5'Flank|SRPK3_ENST00000393786.3_5'Flank|SRPK3_ENST00000489426.1_5'UTR|SRPK3_ENST00000370108.3_5'Flank	NM_005393.2	NP_005384.2	Q9ULL4	PLXB3_HUMAN	plexin B3	1891					axon guidance (GO:0007411)|cell chemotaxis (GO:0060326)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell migration (GO:0030336)|negative regulation of GTPase activity (GO:0034260)|negative regulation of lamellipodium assembly (GO:0010593)|positive chemotaxis (GO:0050918)|positive regulation of endothelial cell proliferation (GO:0001938)|semaphorin-plexin signaling pathway (GO:0071526)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	protein domain specific binding (GO:0019904)|semaphorin receptor activity (GO:0017154)			central_nervous_system(1)|endometrium(7)|large_intestine(2)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	32	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)					AAGCTGCAGCTGGCCTGCCGC	0.657																																																	0								ENSG00000198753						17.0	15.0	16.0					X																	153044436		2191	4283	6474	PLXNB3	SO:0001583	missense	0			-	HGNC	AF149019	CCDS14729.1, CCDS55536.1	Xq28	2008-02-05			ENSG00000198753	ENSG00000198753		"""Plexins"""	9105	protein-coding gene	gene with protein product		300214		PLXN6		10520995	Standard	NM_005393		Approved	PLEXR, PLEXB3	uc010nuk.2	Q9ULL4	OTTHUMG00000024217	ENST00000361971.5:c.5672T>A	X.37:g.153044436T>A	ENSP00000355378:p.Leu1891Gln	Somatic	0	74	0.00		0.586032912036718	17	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	34	52	39.53	B7Z3E6|F5H773|Q9HDA4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_IPT,pfam_Plexin_repeat,pfam_Semap_dom,superfamily_Semap_dom,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_IPT,pfscan_Semap_dom	p.L1914Q	ENST00000361971.5	37	c.5741	CCDS14729.1	X	.	.	.	.	.	.	.	.	.	.	T	24.5	4.536319	0.85812	.	.	ENSG00000198753	ENST00000538966;ENST00000361971;ENST00000538776	T;T;T	0.03386	4.52;4.5;3.95	4.77	4.77	0.60923	.	0.081973	0.49916	D	0.000129	T	0.22244	0.0536	M	0.90198	3.095	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.992;0.997;0.992	T	0.02581	-1.1138	10	0.87932	D	0	.	12.5861	0.56419	0.0:0.0:0.0:1.0	.	1544;1914;1891	B7Z3H9;F5H773;Q9ULL4	.;.;PLXB3_HUMAN	Q	1914;1891;1544	ENSP00000442736:L1914Q;ENSP00000355378:L1891Q;ENSP00000445569:L1544Q	ENSP00000355378:L1891Q	L	+	2	0	PLXNB3	152697630	1.000000	0.71417	1.000000	0.80357	0.890000	0.51754	7.957000	0.87870	1.678000	0.50952	0.340000	0.21749	CTG	-	NULL		0.657	PLXNB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLXNB3	protein_coding	OTTHUMT00000061063.1	T		-		153044436	+1	no_errors	ENST00000538966	ensembl	human	known	74_37	missense	SNP	1.000	A
RBM6	10180	genome.wustl.edu	37	3	50004793	50004794	+	Intron	INS	-	-	A	rs377257427		TCGA-N1-A6IA-01A-12D-A32I-09	TCGA-N1-A6IA-11A-11D-A32I-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	26f94549-f63a-4c0f-8c70-0341ea0f528f	29f71321-1ce9-42d2-8923-7528a4bff739	g.chr3:50004793_50004794insA	ENST00000266022.4	+	3	303				RBM6_ENST00000422955.1_Intron|RBM6_ENST00000443081.1_5'UTR|RBM6_ENST00000441115.1_Intron|RBM6_ENST00000539992.1_Intron|RBM6_ENST00000442092.1_Intron	NM_005777.2	NP_005768.1	P78332	RBM6_HUMAN	RNA binding motif protein 6						RNA processing (GO:0006396)	nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(10)|ovary(3)|prostate(1)|skin(4)|urinary_tract(1)	33				BRCA - Breast invasive adenocarcinoma(193;6.81e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0084)|Kidney(197;0.00977)		AGAACTCTGCCAAAAAAAAAAT	0.361																																																	0								ENSG00000004534																																			RBM6	SO:0001627	intron_variant	0				HGNC	AF069517	CCDS2809.1, CCDS54586.1	3p21.3	2013-01-28			ENSG00000004534	ENSG00000004534		"""RNA binding motif (RRM) containing"", ""G patch domain containing"""	9903	protein-coding gene	gene with protein product		606886				10352938	Standard	NM_001167582		Approved	DEF-3, 3G2, NY-LU-12, g16, DEF3	uc003cyc.3	P78332	OTTHUMG00000156736	ENST00000266022.4:c.45-109->A	3.37:g.50004803_50004803dupA		Somatic	0	24	0.00		0.586032912036718	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	18	14.29	O60549|O75524|Q86SS3	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000266022.4	37	NULL	CCDS2809.1	3																																																																																			-	-		0.361	RBM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM6	protein_coding	OTTHUMT00000345528.4	-	NM_005777			50004794	+1	no_errors	ENST00000488807	ensembl	human	putative	74_37	rna	INS	1.000:1.000	A
MEFV	4210	genome.wustl.edu	37	16	3298968	3298968	+	Silent	SNP	G	G	A			TCGA-N1-A6IA-01A-12D-A32I-09	TCGA-N1-A6IA-11A-11D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	26f94549-f63a-4c0f-8c70-0341ea0f528f	29f71321-1ce9-42d2-8923-7528a4bff739	g.chr16:3298968G>A	ENST00000219596.1	-	4	1336	c.1297C>T	c.(1297-1299)Ctg>Ttg	p.L433L	MEFV_ENST00000339854.4_Silent_p.L253L|MEFV_ENST00000541159.1_Silent_p.L222L|MEFV_ENST00000536379.1_Silent_p.L222L	NM_000243.2	NP_000234.1	O15553	MEFV_HUMAN	Mediterranean fever	433	Required for homotrimerization and induction of pyroptosomes.				inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of macrophage inflammatory protein 1 alpha production (GO:0071641)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity (GO:2001056)	cell projection (GO:0042995)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)	actin binding (GO:0003779)|zinc ion binding (GO:0008270)			NS(2)|biliary_tract(1)|breast(5)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(6)|lung(19)|ovary(3)|prostate(1)|skin(6)	50						GATTTTCTCAGCTTCTTCAGA	0.512																																																	0								ENSG00000103313						172.0	153.0	160.0					16																	3298968		2197	4300	6497	MEFV	SO:0001819	synonymous_variant	0			-	HGNC	AF018080	CCDS10498.1, CCDS55981.1	16p13.3	2014-09-17			ENSG00000103313	ENSG00000103313		"""Tripartite motif containing / Tripartite motif containing"""	6998	protein-coding gene	gene with protein product	"""pyrin"""	608107		MEF		9288094	Standard	NM_000243		Approved	FMF, TRIM20	uc002cun.1	O15553	OTTHUMG00000129324	ENST00000219596.1:c.1297C>T	16.37:g.3298968G>A		Somatic	0	25	0.00		0.586032912036718	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	10	50.00	D3DUC0|F5H0Q3|Q3MJ84|Q96PN4|Q96PN5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_DAPIN,pfam_SPRY_rcpt,pfam_Znf_B-box,superfamily_ConA-like_lec_gl_sf,superfamily_DEATH-like_dom,smart_Znf_B-box,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_DAPIN,pfscan_Znf_B-box,prints_Butyrophylin	p.L433	ENST00000219596.1	37	c.1297	CCDS10498.1	16																																																																																			-	NULL		0.512	MEFV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MEFV	protein_coding	OTTHUMT00000251464.1	G	NM_000243	-		3298968	-1	no_errors	ENST00000219596	ensembl	human	known	74_37	silent	SNP	0.000	A
FAM167A	83648	genome.wustl.edu	37	8	11295631	11295631	+	Intron	SNP	G	G	T			TCGA-N1-A6IA-01A-12D-A32I-09	TCGA-N1-A6IA-11A-11D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	26f94549-f63a-4c0f-8c70-0341ea0f528f	29f71321-1ce9-42d2-8923-7528a4bff739	g.chr8:11295631G>T	ENST00000528897.1	-	2	1001				FAM167A_ENST00000531564.1_Intron|FAM167A_ENST00000534308.1_Intron|C8orf12_ENST00000533578.1_Missense_Mutation_p.E40D|C8orf12_ENST00000284481.3_Missense_Mutation_p.E40D|FAM167A_ENST00000284486.4_Intron			Q96KS9	F167A_HUMAN	family with sequence similarity 167, member A											breast(1)|endometrium(1)|large_intestine(4)|lung(2)|prostate(1)	9						ggccagtggaggccggtagtg	0.607																																																	0								ENSG00000184608																																			C8orf12	SO:0001627	intron_variant	0			-	HGNC		CCDS5981.1	8p23-p22	2010-08-27	2008-06-11	2008-06-11	ENSG00000154319	ENSG00000154319			15549	protein-coding gene	gene with protein product		610085	"""chromosome 8 open reading frame 13"""	C8orf13			Standard	NM_053279		Approved		uc003wtw.2	Q96KS9	OTTHUMG00000129361	ENST00000528897.1:c.381+5908C>A	8.37:g.11295631G>T		Somatic	0	63	0.00		0.586032912036718	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	69	18.82	A8K3T9|Q3SXY1|Q3SXY3|Q8N3M3|Q9NSR0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.E40D	ENST00000528897.1	37	c.120	CCDS5981.1	8	.	.	.	.	.	.	.	.	.	.	G	2.093	-0.407855	0.04832	.	.	ENSG00000184608	ENST00000284481;ENST00000533578	.	.	.	1.63	-0.765	0.11023	.	.	.	.	.	T	0.29556	0.0737	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.35425	-0.9789	5	0.87932	D	0	.	2.2551	0.04053	0.0:0.3468:0.3389:0.3143	.	.	.	.	D	40	.	ENSP00000284481:E40D	E	+	3	2	C8orf12	11333041	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	-0.960000	0.03849	-0.140000	0.11394	-0.791000	0.03333	GAG	-	NULL		0.607	FAM167A-003	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	C8orf12	protein_coding	OTTHUMT00000383901.1	G		-		11295631	+1	no_errors	ENST00000284481	ensembl	human	known	74_37	missense	SNP	0.001	T
CASP5	838	genome.wustl.edu	37	11	104878041	104878041	+	Frame_Shift_Del	DEL	T	T	-	rs144697764		TCGA-N1-A6IA-01A-12D-A32I-09	TCGA-N1-A6IA-11A-11D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	26f94549-f63a-4c0f-8c70-0341ea0f528f	29f71321-1ce9-42d2-8923-7528a4bff739	g.chr11:104878041delT	ENST00000260315.3	-	3	201	c.202delA	c.(202-204)acafs	p.T68fs	CASP5_ENST00000531367.1_Intron|CASP5_ENST00000393139.2_Frame_Shift_Del_p.T35fs|CASP5_ENST00000418434.1_Intron|CASP5_ENST00000444749.2_Frame_Shift_Del_p.T10fs|CASP5_ENST00000393141.2_Frame_Shift_Del_p.T81fs|CASP5_ENST00000526056.1_Frame_Shift_Del_p.T81fs			P51878	CASP5_HUMAN	caspase 5, apoptosis-related cysteine peptidase	68	CARD. {ECO:0000255|PROSITE- ProRule:PRU00046}.				apoptotic process (GO:0006915)|cellular response to mechanical stimulus (GO:0071260)|execution phase of apoptosis (GO:0097194)|proteolysis (GO:0006508)|regulation of apoptotic process (GO:0042981)|regulation of inflammatory response (GO:0050727)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|NLRP1 inflammasome complex (GO:0072558)	cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)	p.T52fs*26(1)		NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(15)|ovary(3)|skin(1)|urinary_tract(1)	35		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Melanoma(852;0.0047)		BRCA - Breast invasive adenocarcinoma(274;0.000943)|Epithelial(105;0.0104)|all cancers(92;0.042)		ATCTTAACTGTTTTTTTTTTG	0.358																																																	1	Deletion - Frameshift(1)	ovary(1)						ENSG00000137757		,,,	386,251,42,3585		1,0,1,383,0,0,251,0,41,1455	104.0	101.0	102.0		,,,	-2.3	0.0	11	dbSNP_132	106	651,407,1,7195		0,0,0,651,0,0,407,0,1,3068	no	codingComplex,codingComplex,intron,codingComplex	CASP5	NM_004347.3,NM_001136112.1,NM_001136110.1,NM_001136109.1	,,,	1,0,1,1034,0,0,658,0,42,4523	A1A1,A1A2,A1A3,A1R,A2A2,A2A3,A2R,A3A3,A3R,RR		12.8301,15.924,13.884	,,,	,,,	104878041	1037,658,43,10780	2202	4299	6501	CASP5	SO:0001589	frameshift_variant	0				HGNC		CCDS8328.2, CCDS44718.1, CCDS44719.1, CCDS44720.1	11q22.2-q22.3	2006-02-17	2005-08-17		ENSG00000137757	ENSG00000137757		"""Caspases"""	1506	protein-coding gene	gene with protein product		602665	"""caspase 5, apoptosis-related cysteine protease"""			7797592, 9250871	Standard	NM_004347		Approved	ICE(rel)III	uc010ruz.1	P51878	OTTHUMG00000048073	ENST00000260315.3:c.202delA	11.37:g.104878041delT	ENSP00000260315:p.Thr68fs	Somatic	0	43	0.00		0.586032912036718	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	32	13.51	B4DKP5|Q0QVY7|Q0QVY8|Q0QVZ0|Q0QVZ1|Q0QVZ2|Q14DD6|Q1HBJ3|Q6DJV7	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Pept_C14_caspase,pfam_CARD,superfamily_DEATH-like_dom,smart_CARD,smart_Pept_C14A_p45_core,pirsf_Caspase_IL-1_beta,pfscan_CARD,pfscan_Pept_C14_p10,pfscan_Pept_C14_ICE_p20,prints_Pept_C14A_p45_core	p.T81fs	ENST00000260315.3	37	c.241	CCDS8328.2	11																																																																																			-	pfam_CARD,superfamily_DEATH-like_dom,smart_CARD,pirsf_Caspase_IL-1_beta,pfscan_CARD		0.358	CASP5-001	KNOWN	basic|CCDS	protein_coding	CASP5	protein_coding	OTTHUMT00000109397.2	T	NM_004347			104878041	-1	no_errors	ENST00000393141	ensembl	human	known	74_37	frame_shift_del	DEL	0.000	-
ZNF831	128611	genome.wustl.edu	37	20	57829601	57829601	+	Missense_Mutation	SNP	A	A	T			TCGA-N1-A6IA-01A-12D-A32I-09	TCGA-N1-A6IA-11A-11D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	26f94549-f63a-4c0f-8c70-0341ea0f528f	29f71321-1ce9-42d2-8923-7528a4bff739	g.chr20:57829601A>T	ENST00000371030.2	+	5	4837	c.4837A>T	c.(4837-4839)Agg>Tgg	p.R1613W		NM_178457.1	NP_848552.1	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	1613							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(71)|ovary(2)|pancreas(1)|prostate(4)|skin(16)|upper_aerodigestive_tract(2)|urinary_tract(3)	125	all_lung(29;0.0085)					AAGTGACGGTAGGAAACGTCA	0.493																																																	0								ENSG00000124203						83.0	80.0	81.0					20																	57829601		1882	4126	6008	ZNF831	SO:0001583	missense	0			-	HGNC	AL121919	CCDS42894.1	20q13.32	2008-10-20	2008-03-25	2008-03-25	ENSG00000124203	ENSG00000124203			16167	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 174"""	C20orf174			Standard	NM_178457		Approved	dJ492J12.1	uc002yan.3	Q5JPB2	OTTHUMG00000032864	ENST00000371030.2:c.4837A>T	20.37:g.57829601A>T	ENSP00000360069:p.Arg1613Trp	Somatic	0	19	0.00		0.586032912036718	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	31	26.19	Q5TDR4|Q8TCP0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R1613W	ENST00000371030.2	37	c.4837	CCDS42894.1	20	.	.	.	.	.	.	.	.	.	.	A	13.91	2.377802	0.42105	.	.	ENSG00000124203	ENST00000371030	T	0.04970	3.52	5.66	3.6	0.41247	.	0.690849	0.13151	N	0.409858	T	0.09555	0.0235	L	0.40543	1.245	0.09310	N	1	D	0.56287	0.975	P	0.49192	0.602	T	0.18777	-1.0326	10	0.66056	D	0.02	-6.0237	9.0462	0.36347	0.1734:0.0:0.8266:0.0	.	1613	Q5JPB2	ZN831_HUMAN	W	1613	ENSP00000360069:R1613W	ENSP00000360069:R1613W	R	+	1	2	ZNF831	57262996	0.000000	0.05858	0.001000	0.08648	0.009000	0.06853	0.274000	0.18680	0.720000	0.32209	-0.182000	0.12963	AGG	-	NULL		0.493	ZNF831-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	ZNF831	protein_coding	OTTHUMT00000079916.2	A	NM_178457	-		57829601	+1	no_errors	ENST00000371030	ensembl	human	novel	74_37	missense	SNP	0.005	T
KHDRBS1	10657	genome.wustl.edu	37	1	32508536	32508536	+	3'UTR	SNP	T	T	A			TCGA-N1-A6IA-01A-12D-A32I-09	TCGA-N1-A6IA-11A-11D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	26f94549-f63a-4c0f-8c70-0341ea0f528f	29f71321-1ce9-42d2-8923-7528a4bff739	g.chr1:32508536T>A	ENST00000327300.7	+	0	1810				KHDRBS1_ENST00000307714.8_3'UTR	NM_006559.1	NP_006550.1			KH domain containing, RNA binding, signal transduction associated 1											endometrium(4)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)	14		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				AGAAGTTGAGTAAAAAAAAAA	0.254																																					Ovarian(173;401 1982 12359 31110 42403)												0								ENSG00000121774																																			KHDRBS1	SO:0001624	3_prime_UTR_variant	0			-	HGNC	U78971	CCDS350.1, CCDS60067.1	1p32	2008-07-18			ENSG00000121774	ENSG00000121774			18116	protein-coding gene	gene with protein product	"""GAP-associated tyrosine phosphoprotein p62 (Sam68)"""	602489				1374686, 10564820	Standard	NM_006559		Approved	Sam68, p62, FLJ34027	uc001bub.4	Q07666	OTTHUMG00000003921	ENST00000327300.7:c.*311T>A	1.37:g.32508536T>A		Somatic	0	42	0.00		0.586032912036718	283	3.40	10	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	57	9.23		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000327300.7	37	NULL	CCDS350.1	1																																																																																			-	-		0.254	KHDRBS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KHDRBS1	protein_coding	OTTHUMT00000011199.4	T	NM_006559	-		32508536	+1	no_errors	ENST00000307714	ensembl	human	known	74_37	rna	SNP	0.998	A
VDAC1	7416	genome.wustl.edu	37	5	133308469	133308469	+	Missense_Mutation	SNP	T	T	G			TCGA-N1-A6IA-01A-12D-A32I-09	TCGA-N1-A6IA-11A-11D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	26f94549-f63a-4c0f-8c70-0341ea0f528f	29f71321-1ce9-42d2-8923-7528a4bff739	g.chr5:133308469T>G	ENST00000265333.3	-	9	1089	c.845A>C	c.(844-846)cAa>cCa	p.Q282P	VDAC1_ENST00000395047.2_Missense_Mutation_p.Q282P|VDAC1_ENST00000395044.3_Missense_Mutation_p.Q282P	NM_003374.2	NP_003365.1	P21796	VDAC1_HUMAN	voltage-dependent anion channel 1	282					anion transport (GO:0006820)|apoptotic process (GO:0006915)|behavioral fear response (GO:0001662)|epithelial cell differentiation (GO:0030855)|learning (GO:0007612)|neuron-neuron synaptic transmission (GO:0007270)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|pore complex (GO:0046930)	porin activity (GO:0015288)|protein kinase binding (GO:0019901)|voltage-gated anion channel activity (GO:0008308)			endometrium(1)|large_intestine(1)|lung(1)|skin(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00806)|Kidney(363;0.02)		Dihydroxyaluminium(DB01375)	CATTTATGCTTGAAATTCCAG	0.378																																					NSCLC(127;1776 1806 35523 41489 48154)												0								ENSG00000213585						31.0	32.0	32.0					5																	133308469		2200	4279	6479	VDAC1	SO:0001583	missense	0			-	HGNC		CCDS4168.1	5q31	2011-11-15			ENSG00000213585	ENSG00000213585		"""Voltage-dependent anion channels"""	12669	protein-coding gene	gene with protein product		604492				7517385	Standard	NM_003374		Approved	MGC111064, PORIN	uc003kyr.2	P21796	OTTHUMG00000129118	ENST00000265333.3:c.845A>C	5.37:g.133308469T>G	ENSP00000265333:p.Gln282Pro	Somatic	0	43	0.00		0.586032912036718	391	16.06	75	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	45	11.76	B3KVK4|D3DQ93|Q5FVE7|Q9UIQ5|Q9UPL0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Porin_Euk/Tom40,prints_Porin_Euk	p.Q282P	ENST00000265333.3	37	c.845	CCDS4168.1	5	.	.	.	.	.	.	.	.	.	.	T	16.01	3.001219	0.54254	.	.	ENSG00000213585	ENST00000265333;ENST00000395044;ENST00000395047	T;T;T	0.45668	0.89;0.89;0.89	5.15	5.15	0.70609	.	0.118551	0.64402	D	0.000019	T	0.38639	0.1048	L	0.34521	1.04	0.58432	D	0.999999	B	0.16802	0.019	B	0.29862	0.108	T	0.31558	-0.9939	10	0.87932	D	0	.	15.4286	0.75075	0.0:0.0:0.0:1.0	.	282	P21796	VDAC1_HUMAN	P	282	ENSP00000265333:Q282P;ENSP00000378484:Q282P;ENSP00000378487:Q282P	ENSP00000265333:Q282P	Q	-	2	0	VDAC1	133336368	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.798000	0.85924	2.288000	0.76882	0.533000	0.62120	CAA	-	NULL		0.378	VDAC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	VDAC1	protein_coding	OTTHUMT00000259208.1	T		-		133308469	-1	no_errors	ENST00000265333	ensembl	human	known	74_37	missense	SNP	1.000	G
LOC285556	285556	genome.wustl.edu	37	4	100573428	100573428	+	Missense_Mutation	SNP	C	C	T			TCGA-N1-A6IA-01A-12D-A32I-09	TCGA-N1-A6IA-11A-11D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	26f94549-f63a-4c0f-8c70-0341ea0f528f	29f71321-1ce9-42d2-8923-7528a4bff739	g.chr4:100573428C>T	ENST00000511828.1	-	1	2377	c.2378G>A	c.(2377-2379)gGc>gAc	p.G793D																								GGGCTTGCTGCCCTCGGAGGT	0.657																																																	0								ENSG00000248713																																			RP11-766F14.2	SO:0001583	missense	0			-	Clone_based_vega_gene																												ENST00000511828.1:c.2378G>A	4.37:g.100573428C>T	ENSP00000427555:p.Gly793Asp	Somatic	0	43	0.00		0.586032912036718	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.16		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.G793D	ENST00000511828.1	37	c.2378		4	.	.	.	.	.	.	.	.	.	.	C	2.842	-0.240315	0.05944	.	.	ENSG00000248713	ENST00000511828	T	0.17370	2.28	4.56	4.56	0.56223	.	.	.	.	.	T	0.11580	0.0282	N	0.08118	0	.	.	.	.	.	.	.	.	.	T	0.17228	-1.0376	6	0.37606	T	0.19	.	10.5299	0.44971	0.0:0.9068:0.0:0.0932	.	.	.	.	D	793	ENSP00000427555:G793D	ENSP00000427555:G793D	G	-	2	0	RP11-766F14.2	100792451	0.824000	0.29247	0.012000	0.15200	0.042000	0.13812	3.063000	0.49978	2.358000	0.79984	0.655000	0.94253	GGC	-	NULL		0.657	RP11-766F14.2-001	PUTATIVE	basic|appris_principal|exp_conf	protein_coding	LOC285556	protein_coding	OTTHUMT00000365456.1	C		-		100573428	-1	no_errors	ENST00000511828	ensembl	human	putative	74_37	missense	SNP	0.002	T
PTGES	9536	genome.wustl.edu	37	9	132501706	132501707	+	3'UTR	INS	-	-	AT	rs1134680|rs137962222|rs35042232|rs3884098|rs367837009		TCGA-N1-A6IA-01A-12D-A32I-09	TCGA-N1-A6IA-11A-11D-A32I-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	26f94549-f63a-4c0f-8c70-0341ea0f528f	29f71321-1ce9-42d2-8923-7528a4bff739	g.chr9:132501706_132501707insAT	ENST00000340607.4	-	0	676_677				PTGES_ENST00000481476.1_5'UTR	NM_004878.4	NP_004869.1	O14684	PTGES_HUMAN	prostaglandin E synthase						acute inflammatory response (GO:0002526)|arachidonic acid metabolic process (GO:0019369)|chronic inflammatory response (GO:0002544)|cyclooxygenase pathway (GO:0019371)|negative regulation of cell proliferation (GO:0008285)|prostaglandin biosynthetic process (GO:0001516)|prostaglandin metabolic process (GO:0006693)|response to calcium ion (GO:0051592)|response to cytokine (GO:0034097)|response to lipopolysaccharide (GO:0032496)|response to organic cyclic compound (GO:0014070)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)|perinuclear region of cytoplasm (GO:0048471)	glutathione binding (GO:0043295)|prostaglandin-E synthase activity (GO:0050220)			lung(1)|skin(1)	2		Ovarian(14;0.00556)				Aacatacacacacacatacaca	0.525																																																	0								ENSG00000148344																																			PTGES	SO:0001624	3_prime_UTR_variant	0				HGNC	AF010316	CCDS6927.1	9q34.3	2008-07-21			ENSG00000148344	ENSG00000148344			9599	protein-coding gene	gene with protein product	"""microsomal glutathione S-transferase 1-like 1"", ""tumor protein p53 inducible protein 12"", ""p53-induced gene 12"", ""microsomal prostaglandin E synthase-1"", ""glutathione S-transferase 1-like 1"", ""MGST1-like 1"""	605172		MGST1L1		9305847, 10091672	Standard	NM_004878		Approved	MGST-IV, PIG12, MGST1-L1, TP53I12	uc004byi.3	O14684	OTTHUMG00000020791	ENST00000340607.4:c.*184->AT	9.37:g.132501706_132501707insAT		Somatic	0	9	0.00		0.586032912036718	246	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	6	45.45	O14900|Q5SZC0	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000340607.4	37	NULL	CCDS6927.1	9																																																																																			-	-		0.525	PTGES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTGES	protein_coding	OTTHUMT00000054599.2	-	NM_004878			132501707	-1	no_errors	ENST00000481476	ensembl	human	known	74_37	rna	INS	0.000:0.000	AT
KIF1B	23095	genome.wustl.edu	37	1	10383993	10383993	+	Missense_Mutation	SNP	C	C	T			TCGA-N1-A6IA-01A-12D-A32I-09	TCGA-N1-A6IA-11A-11D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	26f94549-f63a-4c0f-8c70-0341ea0f528f	29f71321-1ce9-42d2-8923-7528a4bff739	g.chr1:10383993C>T	ENST00000377086.1	+	25	2612	c.2410C>T	c.(2410-2412)Cct>Tct	p.P804S	KIF1B_ENST00000263934.6_Missense_Mutation_p.P758S|KIF1B_ENST00000377081.1_Missense_Mutation_p.P804S			O60333	KIF1B_HUMAN	kinesin family member 1B	804					anterograde axon cargo transport (GO:0008089)|apoptotic process (GO:0006915)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based movement (GO:0007018)|mitochondrion transport along microtubule (GO:0047497)|neuromuscular synaptic transmission (GO:0007274)|neuron-neuron synaptic transmission (GO:0007270)|vesicle-mediated transport (GO:0016192)	cytoplasmic vesicle (GO:0031410)|cytoplasmic vesicle membrane (GO:0030659)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinesin binding (GO:0019894)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			breast(2)|endometrium(7)|kidney(8)|large_intestine(9)|lung(29)|ovary(3)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(2)	71	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)		CCCTTTGCCTCCTGAATTACT	0.448																																																	0								ENSG00000054523						128.0	119.0	122.0					1																	10383993		2203	4300	6503	KIF1B	SO:0001583	missense	0			-	HGNC	AF257176	CCDS111.1, CCDS112.1	1p36.22	2014-09-17			ENSG00000054523	ENSG00000054523		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	16636	protein-coding gene	gene with protein product		605995		CMT2A, CMT2		11389829, 10762626	Standard	NM_015074		Approved	KIAA0591, KLP, HMSNII	uc001aqw.4	O60333	OTTHUMG00000001817	ENST00000377086.1:c.2410C>T	1.37:g.10383993C>T	ENSP00000366290:p.Pro804Ser	Somatic	0	55	0.00		0.586032912036718	4	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	55	25.68	A6NFS8|A6NKQ4|Q4VXC3|Q4VXC4|Q4VXC5|Q4VXC6|Q96Q94|Q9BV80|Q9P280	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Kinesin_motor_dom,pfam_Kinesin-like,pfam_Pleckstrin_homology,pfam_KIF1B,pfam_FHA_dom,superfamily_P-loop_NTPase,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,smart_FHA_dom,smart_Pleckstrin_homology,pfscan_FHA_dom,pfscan_Pleckstrin_homology,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.P758S	ENST00000377086.1	37	c.2272		1	.	.	.	.	.	.	.	.	.	.	C	16.66	3.184919	0.57909	.	.	ENSG00000054523	ENST00000355249;ENST00000263934;ENST00000377086;ENST00000377081	T;T;T	0.74106	-0.81;-0.81;-0.81	5.6	5.6	0.85130	.	0.054238	0.85682	D	0.000000	T	0.66557	0.2801	L	0.41573	1.285	0.80722	D	1	B;B;B;B;B;B	0.33212	0.025;0.025;0.019;0.402;0.005;0.011	B;B;B;B;B;B	0.33846	0.019;0.019;0.014;0.171;0.007;0.013	T	0.62982	-0.6738	10	0.06891	T	0.86	.	19.9659	0.97266	0.0:1.0:0.0:0.0	.	790;764;804;778;804;758	Q4R9M9;Q4R9M7;Q4VXC4;Q4R9M8;O60333;O60333-2	.;.;.;.;KIF1B_HUMAN;.	S	804;758;804;804	ENSP00000263934:P758S;ENSP00000366290:P804S;ENSP00000366284:P804S	ENSP00000263934:P758S	P	+	1	0	KIF1B	10306580	1.000000	0.71417	0.994000	0.49952	0.988000	0.76386	5.722000	0.68485	2.802000	0.96397	0.650000	0.86243	CCT	-	NULL		0.448	KIF1B-001	NOVEL	basic	protein_coding	KIF1B	protein_coding	OTTHUMT00000005102.1	C		-		10383993	+1	no_errors	ENST00000263934	ensembl	human	known	74_37	missense	SNP	1.000	T
B3GNT3	10331	genome.wustl.edu	37	19	17918638	17918638	+	Silent	SNP	C	C	A	rs202205669		TCGA-N1-A6IA-01A-12D-A32I-09	TCGA-N1-A6IA-11A-11D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	26f94549-f63a-4c0f-8c70-0341ea0f528f	29f71321-1ce9-42d2-8923-7528a4bff739	g.chr19:17918638C>A	ENST00000318683.6	+	2	169	c.22C>A	c.(22-24)Cgg>Agg	p.R8R	B3GNT3_ENST00000595387.1_Silent_p.R8R	NM_014256.3	NP_055071.2	Q9Y2A9	B3GN3_HUMAN	UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 3	8					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)	beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,3-N-acetylglucosaminyltransferase activity (GO:0047223)|galactosyltransferase activity (GO:0008378)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|prostate(2)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)	21						CCGGCACCGGCGGCCCAATGC	0.622																																																	0								ENSG00000179913						27.0	28.0	27.0					19																	17918638		2200	4293	6493	B3GNT3	SO:0001819	synonymous_variant	0			-	HGNC	AB015630	CCDS12364.1	19p13.1	2013-02-19				ENSG00000179913		"""Beta 3-glycosyltransferases"""	13528	protein-coding gene	gene with protein product	"""putative type II membrane protein"", ""beta-1,3-N-acetylglucosaminyltransferase bGnT-3"", ""transmembrane protein 3"""	605863		TMEM3		10072769, 11042166	Standard	NM_014256		Approved	B3GN-T3, beta3Gn-T3, HP10328, B3GNT-3	uc002nhl.1	Q9Y2A9		ENST00000318683.6:c.22C>A	19.37:g.17918638C>A		Somatic	0	66	0.00		0.586032912036718	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	80	13.04	B2RAS4|Q6NWU9|Q6NXU9|Q8WWR6|Q9C0J2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Glyco_trans_31	p.R8	ENST00000318683.6	37	c.22	CCDS12364.1	19																																																																																			-	NULL		0.622	B3GNT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	B3GNT3	protein_coding	OTTHUMT00000466877.1	C	NM_014256	-		17918638	+1	no_errors	ENST00000318683	ensembl	human	known	74_37	silent	SNP	0.001	A
BSN	8927	genome.wustl.edu	37	3	49700331	49700331	+	Missense_Mutation	SNP	G	G	T			TCGA-N1-A6IA-01A-12D-A32I-09	TCGA-N1-A6IA-11A-11D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	26f94549-f63a-4c0f-8c70-0341ea0f528f	29f71321-1ce9-42d2-8923-7528a4bff739	g.chr3:49700331G>T	ENST00000296452.4	+	7	10854	c.10740G>T	c.(10738-10740)gaG>gaT	p.E3580D		NM_003458.3	NP_003449.2	Q9UPA5	BSN_HUMAN	bassoon presynaptic cytomatrix protein	3580					synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuron projection terminus (GO:0044306)|nucleus (GO:0005634)|presynaptic cytoskeletal matrix assembled at active zones (GO:0048788)	metal ion binding (GO:0046872)			breast(8)|central_nervous_system(2)|cervix(2)|endometrium(16)|kidney(3)|large_intestine(17)|lung(37)|ovary(7)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	106				BRCA - Breast invasive adenocarcinoma(193;6.66e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0032)|Kidney(197;0.00336)		GCCAGGAGGAGACGGACTGGT	0.612																																																	0								ENSG00000164061						68.0	68.0	68.0					3																	49700331		2203	4300	6503	BSN	SO:0001583	missense	0			-	HGNC	AF052224	CCDS2800.1	3p21	2013-01-07	2013-01-07		ENSG00000164061	ENSG00000164061			1117	protein-coding gene	gene with protein product	"""zinc finger protein 231"", ""neuronal double zinc finger protein"""	604020	"""bassoon (presynaptic cytomatrix protein)"""	ZNF231		9806829, 10329005	Standard	NM_003458		Approved		uc003cxe.4	Q9UPA5	OTTHUMG00000133750	ENST00000296452.4:c.10740G>T	3.37:g.49700331G>T	ENSP00000296452:p.Glu3580Asp	Somatic	0	92	0.00		0.586032912036718	0	100.00	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	43	38.57	O43161|Q7LGH3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_piccolo,superfamily_Znf_FYVE_PHD	p.E3580D	ENST00000296452.4	37	c.10740	CCDS2800.1	3	.	.	.	.	.	.	.	.	.	.	G	11.46	1.646766	0.29246	.	.	ENSG00000164061	ENST00000296452	T	0.26373	1.74	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	T	0.49372	0.1553	M	0.70595	2.14	0.53005	D	0.999963	D	0.76494	0.999	D	0.78314	0.991	T	0.49331	-0.8951	10	0.87932	D	0	-11.4205	12.9835	0.58577	0.0739:0.0:0.9261:0.0	.	3580	Q9UPA5	BSN_HUMAN	D	3580	ENSP00000296452:E3580D	ENSP00000296452:E3580D	E	+	3	2	BSN	49675335	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	2.711000	0.47177	2.679000	0.91253	0.655000	0.94253	GAG	-	NULL		0.612	BSN-001	KNOWN	NMD_exception|basic|appris_principal|exp_conf|CCDS	protein_coding	BSN	protein_coding	OTTHUMT00000258164.1	G	NM_003458	-		49700331	+1	no_errors	ENST00000296452	ensembl	human	known	74_37	missense	SNP	1.000	T
VEZT	55591	genome.wustl.edu	37	12	95694454	95694454	+	3'UTR	SNP	C	C	T			TCGA-N1-A6IA-01A-12D-A32I-09	TCGA-N1-A6IA-11A-11D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	26f94549-f63a-4c0f-8c70-0341ea0f528f	29f71321-1ce9-42d2-8923-7528a4bff739	g.chr12:95694454C>T	ENST00000436874.1	+	0	2450				VEZT_ENST00000261219.6_3'UTR|VEZT_ENST00000356859.4_3'UTR	NM_017599.3	NP_060069.3	Q9HBM0	VEZA_HUMAN	vezatin, adherens junctions transmembrane protein						chordate embryonic development (GO:0043009)|single organismal cell-cell adhesion (GO:0016337)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|stereocilia ankle link complex (GO:0002142)				endometrium(2)|kidney(3)|large_intestine(1)|lung(14)|ovary(2)|upper_aerodigestive_tract(1)	23						AAGTAAGAACCAAGATTCATA	0.328																																																	0								ENSG00000028203						18.0	18.0	18.0					12																	95694454		1817	4053	5870	VEZT	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AF216644	CCDS44954.1	12q22	2011-02-15			ENSG00000028203	ENSG00000028203			18258	protein-coding gene	gene with protein product						11080149, 16199027, 21156161	Standard	NM_017599		Approved	DKFZP761C241	uc001tdz.2	Q9HBM0	OTTHUMG00000170182	ENST00000436874.1:c.*5C>T	12.37:g.95694454C>T		Somatic	0	52	0.00		0.586032912036718	54	50.91	56	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	26	42.22	Q6P1Q3|Q9H2F4|Q9H2U5|Q9NT70|Q9NVW0|Q9UF91	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000436874.1	37	NULL	CCDS44954.1	12																																																																																			-	-		0.328	VEZT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VEZT	protein_coding	OTTHUMT00000407804.2	C	NM_017599	-		95694454	+1	no_errors	ENST00000356859	ensembl	human	known	74_37	rna	SNP	0.107	T
PPP2R1B	5519	genome.wustl.edu	37	11	111612792	111612792	+	Missense_Mutation	SNP	G	G	T			TCGA-N1-A6IA-01A-12D-A32I-09	TCGA-N1-A6IA-11A-11D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	26f94549-f63a-4c0f-8c70-0341ea0f528f	29f71321-1ce9-42d2-8923-7528a4bff739	g.chr11:111612792G>T	ENST00000527614.1	-	14	1839	c.1774C>A	c.(1774-1776)Cag>Aag	p.Q592K	PPP2R1B_ENST00000393055.2_Missense_Mutation_p.Q465K|PPP2R1B_ENST00000341980.6_Missense_Mutation_p.Q547K|PPP2R1B_ENST00000311129.5_Missense_Mutation_p.Q592K|PPP2R1B_ENST00000427203.2_Missense_Mutation_p.Q431K|PPP2R1B_ENST00000426998.2_Missense_Mutation_p.Q528K	NM_001177562.1|NM_002716.4	NP_001171033.1|NP_002707.3	P30154	2AAB_HUMAN	protein phosphatase 2, regulatory subunit A, beta	592					apoptotic process involved in morphogenesis (GO:0060561)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)	extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|liver(1)|lung(10)|prostate(1)|urinary_tract(2)	22		all_cancers(61;2.34e-15)|all_epithelial(67;1.72e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|Epithelial(105;2.36e-06)|all cancers(92;3.78e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0761)		ATAGCTTCCTGTGCAAAGTAT	0.388																																																	0								ENSG00000137713						214.0	189.0	198.0					11																	111612792		2201	4297	6498	PPP2R1B	SO:0001583	missense	0			-	HGNC	AF087438	CCDS8348.1, CCDS8349.1, CCDS53706.1, CCDS53707.1, CCDS53708.1	11q23.1	2010-06-18	2010-04-14		ENSG00000137713	ENSG00000137713	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9303	protein-coding gene	gene with protein product	"""PP2A-A-beta"", ""protein phosphatase 2A, regulatory subunit A, beta isoform"""	603113	"""protein phosphatase 2 (formerly 2A), regulatory subunit A (PR 65), beta isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit A, beta isoform"""			2159327, 9795170	Standard	NM_181699		Approved	PR65B, PP2A-Abeta	uc001plw.1	P30154	OTTHUMG00000166741	ENST00000527614.1:c.1774C>A	11.37:g.111612792G>T	ENSP00000437193:p.Gln592Lys	Somatic	0	56	0.00		0.586032912036718	18	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	24	14.29	A8MY67|B0YJ69|B4DGQ6|B4DK91|B4DWW5|F8W8G1|O75620|Q8NHV8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_HEAT,superfamily_ARM-type_fold,pfscan_HEAT_type_2	p.Q592K	ENST00000527614.1	37	c.1774	CCDS8349.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.14|10.14	1.267262|1.267262	0.23136|0.23136	.|.	.|.	ENSG00000137713|ENSG00000137713	ENST00000311129;ENST00000426998;ENST00000527614;ENST00000427203;ENST00000341980;ENST00000393055|ENST00000531890	T;T;T;T;T;T|.	0.16743|.	2.32;2.32;2.32;2.32;2.32;2.32|.	5.47|5.47	5.47|5.47	0.80525|0.80525	Armadillo-like helical (1);Armadillo-type fold (1);|.	0.180423|.	0.51477|.	D|.	0.000087|.	T|T	0.59689|0.59689	0.2212|0.2212	L|L	0.35793|0.35793	1.09|1.09	0.80722|0.80722	D|D	1|1	B;B;B;B;B;B|.	0.20368|.	0.044;0.002;0.001;0.002;0.0;0.002|.	B;B;B;B;B;B|.	0.20184|.	0.028;0.013;0.005;0.004;0.002;0.004|.	T|T	0.54529|0.54529	-0.8280|-0.8280	10|5	0.26408|.	T|.	0.33|.	-10.2963|-10.2963	16.8052|16.8052	0.85625|0.85625	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	465;547;431;528;592;592|.	A8MY67;F8W8G1;B7Z1G3;B4DWW5;P30154;P30154-2|.	.;.;.;.;2AAB_HUMAN;.|.	K|K	592;528;592;431;547;465|220	ENSP00000311344:Q592K;ENSP00000410671:Q528K;ENSP00000437193:Q592K;ENSP00000415759:Q431K;ENSP00000343317:Q547K;ENSP00000376775:Q465K|.	ENSP00000311344:Q592K|.	Q|T	-|-	1|2	0|0	PPP2R1B|PPP2R1B	111118002|111118002	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.059000|0.059000	0.15707|0.15707	9.021000|9.021000	0.93673|0.93673	2.580000|2.580000	0.87095|0.87095	0.484000|0.484000	0.47621|0.47621	CAG|ACA	-	superfamily_ARM-type_fold,pfscan_HEAT_type_2		0.388	PPP2R1B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PPP2R1B	protein_coding	OTTHUMT00000391298.1	G	NM_002716	-		111612792	-1	no_errors	ENST00000311129	ensembl	human	known	74_37	missense	SNP	1.000	T
BCL9	607	genome.wustl.edu	37	1	147084929	147084929	+	Nonsense_Mutation	SNP	C	C	T			TCGA-N1-A6IA-01A-12D-A32I-09	TCGA-N1-A6IA-11A-11D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	26f94549-f63a-4c0f-8c70-0341ea0f528f	29f71321-1ce9-42d2-8923-7528a4bff739	g.chr1:147084929C>T	ENST00000234739.3	+	5	1041	c.301C>T	c.(301-303)Cga>Tga	p.R101*	BCL9_ENST00000473292.1_Intron	NM_004326.2	NP_004317.2	O00512	BCL9_HUMAN	B-cell CLL/lymphoma 9	101					canonical Wnt signaling pathway (GO:0060070)|myotube differentiation involved in skeletal muscle regeneration (GO:0014908)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell maintenance (GO:0035019)	cis-Golgi network (GO:0005801)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)				breast(1)|large_intestine(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	7	all_hematologic(923;0.115)					GAAAAGGGAGCGAAGTATTTC	0.532			T	"""IGH@, IGL@"""	B-ALL																																			Dom	yes		1	1q21	607	B-cell CLL/lymphoma 9		L	0								ENSG00000116128						49.0	54.0	52.0					1																	147084929		2203	4300	6503	BCL9	SO:0001587	stop_gained	0			-	HGNC	Y13620	CCDS30833.1	1q21	2008-02-05			ENSG00000116128	ENSG00000116128			1008	protein-coding gene	gene with protein product		602597				9490669	Standard	NM_004326		Approved		uc001epq.3	O00512	OTTHUMG00000014031	ENST00000234739.3:c.301C>T	1.37:g.147084929C>T	ENSP00000234739:p.Arg101*	Somatic	0	91	0.00		0.586032912036718	25	16.67	5	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	106	15.20	Q5T489	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_BCL9_beta-catenin-bd_dom	p.R101*	ENST00000234739.3	37	c.301	CCDS30833.1	1	.	.	.	.	.	.	.	.	.	.	C	43	10.475636	0.99412	.	.	ENSG00000116128	ENST00000234739	.	.	.	5.4	4.43	0.53597	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.4576	11.3705	0.49697	0.3448:0.6552:0.0:0.0	.	.	.	.	X	101	.	ENSP00000234739:R101X	R	+	1	2	BCL9	145551553	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.131000	0.64751	2.797000	0.96272	0.655000	0.94253	CGA	-	NULL		0.532	BCL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCL9	protein_coding	OTTHUMT00000039468.1	C	NM_004326	-		147084929	+1	no_errors	ENST00000234739	ensembl	human	known	74_37	nonsense	SNP	1.000	T
MTPAP	55149	genome.wustl.edu	37	10	30657272	30657272	+	5'UTR	SNP	C	C	A	rs370854775|rs549707608	byFrequency	TCGA-N1-A6IA-01A-12D-A32I-09	TCGA-N1-A6IA-11A-11D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	26f94549-f63a-4c0f-8c70-0341ea0f528f	29f71321-1ce9-42d2-8923-7528a4bff739	g.chr10:30657272C>A	ENST00000488290.1	-	0	746				RN7SL241P_ENST00000482973.2_RNA			Q9NVV4	PAPD1_HUMAN	mitochondrial poly(A) polymerase						cell death (GO:0008219)|histone mRNA catabolic process (GO:0071044)|mRNA polyadenylation (GO:0006378)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|poly(A) RNA binding (GO:0044822)|polynucleotide adenylyltransferase activity (GO:0004652)|protein homodimerization activity (GO:0042803)|UTP binding (GO:0002134)			breast(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	33						actcccgtagcctctcctccc	0.667																																																	0								ENSG00000107951																																			MTPAP	SO:0001623	5_prime_UTR_variant	0			-	HGNC	AL122121	CCDS7165.1	10p12.1	2014-01-30	2009-01-12	2009-01-12	ENSG00000107951	ENSG00000107951			25532	protein-coding gene	gene with protein product	"""TUTase1"""	613669	"""PAP associated domain containing 1"""	PAPD1		12239557, 15769737, 15547249	Standard	NM_018109		Approved	FLJ10486, mtPAP, SPAX4	uc001iva.4	Q9NVV4	OTTHUMG00000017895	ENST00000488290.1:c.-3357G>T	10.37:g.30657272C>A		Somatic	0	18	0.00		0.586032912036718	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	8	42.86	D3DRX0|Q659E3|Q6P7E5|Q9HA74	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000488290.1	37	NULL		10																																																																																			-	-		0.667	MTPAP-002	KNOWN	basic	processed_transcript	MTPAP	protein_coding	OTTHUMT00000047427.1	C	NM_018109	-		30657272	-1	no_errors	ENST00000471055	ensembl	human	known	74_37	rna	SNP	0.272	A
SPG7	6687	genome.wustl.edu	37	16	89590458	89590458	+	Missense_Mutation	SNP	C	C	T			TCGA-N1-A6IA-01A-12D-A32I-09	TCGA-N1-A6IA-11A-11D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	26f94549-f63a-4c0f-8c70-0341ea0f528f	29f71321-1ce9-42d2-8923-7528a4bff739	g.chr16:89590458C>T	ENST00000268704.2	+	4	436	c.421C>T	c.(421-423)Cgg>Tgg	p.R141W	SPG7_ENST00000341316.2_Missense_Mutation_p.R141W	NM_003119.2	NP_003110.1	Q9UQ90	SPG7_HUMAN	spastic paraplegia 7 (pure and complicated autosomal recessive)	141					anterograde axon cargo transport (GO:0008089)|cell death (GO:0008219)|mitochondrion organization (GO:0007005)|nervous system development (GO:0007399)|proteolysis (GO:0006508)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|metalloendopeptidase activity (GO:0004222)|peptidase activity (GO:0008233)|unfolded protein binding (GO:0051082)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|ovary(2)|urinary_tract(1)	20		all_hematologic(23;0.00824)|Colorectal(91;0.102)		all cancers(4;1.39e-07)|OV - Ovarian serous cystadenocarcinoma(4;5.64e-06)|BRCA - Breast invasive adenocarcinoma(80;0.015)		GTACCGAGAGCGGCTGCGCAC	0.582																																																	0								ENSG00000197912						61.0	54.0	56.0					16																	89590458		2198	4300	6498	SPG7	SO:0001583	missense	0			-	HGNC	Y16610	CCDS10977.1, CCDS10978.1	16q24.3	2010-04-21	2007-04-23		ENSG00000197912	ENSG00000197912		"""ATPases / AAA-type"""	11237	protein-coding gene	gene with protein product	"""paraplegin"""	602783	"""cell matrix adhesion regulator"""	CMAR		9635427, 9634528	Standard	XM_006721264		Approved	CAR, SPG5C	uc002fnj.3	Q9UQ90	OTTHUMG00000138046	ENST00000268704.2:c.421C>T	16.37:g.89590458C>T	ENSP00000268704:p.Arg141Trp	Somatic	0	54	0.00		0.586032912036718	43	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	13	18.75	O75756|Q2TB70|Q58F00|Q96IB0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_M41,pfam_ATPase_AAA_core,pfam_Pept_M41_FtsH_extracell,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase,tigrfam_FtsH	p.R141W	ENST00000268704.2	37	c.421	CCDS10977.1	16	.	.	.	.	.	.	.	.	.	.	C	21.5	4.159312	0.78226	.	.	ENSG00000197912	ENST00000268704;ENST00000341316;ENST00000312632	D;D	0.94046	-3.15;-3.34	5.3	3.26	0.37387	Peptidase M41, FtsH (1);	0.000000	0.85682	D	0.000000	D	0.93562	0.7945	L	0.32530	0.975	0.58432	D	0.999999	D;P	0.89917	1.0;0.642	D;B	0.67548	0.952;0.117	D	0.92054	0.5651	10	0.38643	T	0.18	-2.4589	14.2385	0.65943	0.2803:0.7197:0.0:0.0	.	141;141	Q9UQ90;Q9UQ90-2	SPG7_HUMAN;.	W	141;141;118	ENSP00000268704:R141W;ENSP00000341157:R141W	ENSP00000268704:R141W	R	+	1	2	SPG7	88117959	1.000000	0.71417	1.000000	0.80357	0.637000	0.38172	4.717000	0.61923	0.653000	0.30826	0.561000	0.74099	CGG	-	NULL		0.582	SPG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPG7	protein_coding	OTTHUMT00000269921.2	C	NM_003119	-		89590458	+1	no_errors	ENST00000268704	ensembl	human	known	74_37	missense	SNP	1.000	T
TPRXL	348825	genome.wustl.edu	37	3	14105925	14105927	+	In_Frame_Del	DEL	CAG	CAG	-			TCGA-N1-A6IA-01A-12D-A32I-09	TCGA-N1-A6IA-11A-11D-A32I-09	CAG	CAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	26f94549-f63a-4c0f-8c70-0341ea0f528f	29f71321-1ce9-42d2-8923-7528a4bff739	g.chr3:14105925_14105927delCAG	ENST00000424053.1	+	3	796_798	c.249_251delCAG	c.(247-252)cccagc>ccc	p.S88del	TPRXL_ENST00000429201.1_In_Frame_Del_p.S88del|TPRXL_ENST00000532753.1_Intron|TPRXL_ENST00000326972.8_In_Frame_Del_p.S88del			Q17RH7	TPRXL_HUMAN	tetra-peptide repeat homeobox-like	0	Ser-rich.									endometrium(1)	1						gcagcagccccagcagcagcagc	0.68																																																	0								ENSG00000180438																																			TPRXL	SO:0001651	inframe_deletion	0				HGNC	AK092426		3p25.1	2011-06-20			ENSG00000180438	ENSG00000180438		"""Homeoboxes / PRD class"""	32178	pseudogene	pseudogene		611167					Standard	NR_002223		Approved	FLJ35107	uc003byg.3	Q17RH7	OTTHUMG00000155509	ENST00000424053.1:c.249_251delCAG	3.37:g.14105934_14105936delCAG	ENSP00000400448:p.Ser88del	Somatic	0	34	0.00		0.586032912036718	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	27	12.90	Q8NAM5	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	NULL	p.S87in_frame_del	ENST00000424053.1	37	c.249_251		3																																																																																			-	NULL		0.680	TPRXL-003	KNOWN	alternative_5_UTR|basic|appris_principal	protein_coding	TPRXL	protein_coding	OTTHUMT00000340436.1	CAG	NR_002223			14105927	+1	no_errors	ENST00000326972	ensembl	human	known	74_37	in_frame_del	DEL	0.252:0.271:0.284	-
PHRF1	57661	genome.wustl.edu	37	11	610995	610995	+	Missense_Mutation	SNP	G	G	C			TCGA-N1-A6IA-01A-12D-A32I-09	TCGA-N1-A6IA-11A-11D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	26f94549-f63a-4c0f-8c70-0341ea0f528f	29f71321-1ce9-42d2-8923-7528a4bff739	g.chr11:610995G>C	ENST00000264555.5	+	17	4847	c.4719G>C	c.(4717-4719)gaG>gaC	p.E1573D	PHRF1_ENST00000416188.2_Missense_Mutation_p.E1572D|PHRF1_ENST00000413872.2_Missense_Mutation_p.E1571D|PHRF1_ENST00000533464.1_Missense_Mutation_p.E1569D	NM_020901.2	NP_065952.2	Q9P1Y6	PHRF1_HUMAN	PHD and ring finger domains 1	1573					mRNA processing (GO:0006397)|transcription from RNA polymerase II promoter (GO:0006366)	membrane (GO:0016020)	RNA polymerase binding (GO:0070063)|zinc ion binding (GO:0008270)			breast(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(13)|urinary_tract(2)	28						CTGTGGAGGAGGTGAAGCTGG	0.597																																																	0								ENSG00000070047						92.0	94.0	94.0					11																	610995		2202	4300	6502	PHRF1	SO:0001583	missense	0			-	HGNC	BC004950	CCDS44507.1, CCDS65987.1, CCDS65988.1, CCDS65989.1	11p15.5	2014-06-13			ENSG00000070047	ENSG00000070047		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, PHD-type"""	24351	protein-coding gene	gene with protein product	"""CTD binding SR like protein rA9"", ""protein phosphatase 1, regulatory subunit 125"""	611780		RNF221			Standard	XM_005253027		Approved	KIAA1542, PPP1R125	uc010qwc.2	Q9P1Y6	OTTHUMG00000165141	ENST00000264555.5:c.4719G>C	11.37:g.610995G>C	ENSP00000264555:p.Glu1573Asp	Somatic	0	59	0.00		0.586032912036718	38	56.32	49	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	22	48.84	A6H8W1|B7ZM64|B9EGP0|C9JS82|Q6PJP2|Q8IVY2|Q8N2Y7|Q9BSM2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_PHD-finger,pfam_Znf_C3HC4_RING-type,superfamily_Znf_FYVE_PHD,smart_Znf_RING,smart_Znf_PHD,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.E1573D	ENST00000264555.5	37	c.4719		11	.	.	.	.	.	.	.	.	.	.	G	12.04	1.818784	0.32145	.	.	ENSG00000070047	ENST00000264555;ENST00000413872;ENST00000416188;ENST00000533464	T;T;T;T	0.67865	-0.29;-0.29;-0.29;-0.29	4.34	1.33	0.21861	.	0.000000	0.36338	N	0.002643	T	0.79551	0.4465	M	0.82823	2.61	0.37891	D	0.930712	D;D;D;D	0.89917	0.982;0.998;1.0;0.999	D;D;D;D	0.85130	0.952;0.995;0.997;0.994	T	0.80125	-0.1513	10	0.87932	D	0	-37.3089	8.8738	0.35332	0.3998:0.0:0.6002:0.0	.	1569;1571;1572;1573	E9PJ24;F8WEF5;Q9P1Y6-3;Q9P1Y6	.;.;.;PHRF1_HUMAN	D	1573;1571;1572;1569	ENSP00000264555:E1573D;ENSP00000388589:E1571D;ENSP00000410626:E1572D;ENSP00000431870:E1569D	ENSP00000264555:E1573D	E	+	3	2	PHRF1	600995	1.000000	0.71417	1.000000	0.80357	0.306000	0.27790	1.924000	0.40065	0.169000	0.19679	-0.291000	0.09656	GAG	-	NULL		0.597	PHRF1-001	KNOWN	basic|appris_candidate_longest	protein_coding	PHRF1	protein_coding	OTTHUMT00000382133.1	G	NM_020901	-		610995	+1	no_errors	ENST00000264555	ensembl	human	known	74_37	missense	SNP	1.000	C
OR1E2	8388	genome.wustl.edu	37	17	3336989	3336989	+	Missense_Mutation	SNP	A	A	C			TCGA-N1-A6IA-01A-12D-A32I-09	TCGA-N1-A6IA-11A-11D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	26f94549-f63a-4c0f-8c70-0341ea0f528f	29f71321-1ce9-42d2-8923-7528a4bff739	g.chr17:3336989A>C	ENST00000248384.1	-	1	146	c.147T>G	c.(145-147)atT>atG	p.I49M		NM_003554.1	NP_003545.1	P47887	OR1E2_HUMAN	olfactory receptor, family 1, subfamily E, member 2	49					sensory perception of chemical stimulus (GO:0007606)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)|receptor activity (GO:0004872)			endometrium(3)|large_intestine(3)|lung(3)	9						AGTCCAGTCGAATGAGGACAA	0.517																																																	0								ENSG00000127780						106.0	101.0	103.0					17																	3336989		2203	4300	6503	OR1E2	SO:0001583	missense	0			-	HGNC	U04686	CCDS11026.1	17p13.3	2012-08-09			ENSG00000127780	ENSG00000127780		"""GPCR / Class A : Olfactory receptors"""	8190	protein-coding gene	gene with protein product				OR1E4		8004088, 9500546	Standard	NM_003554		Approved	OR17-93, OR17-135	uc010vre.2	P47887	OTTHUMG00000090651	ENST00000248384.1:c.147T>G	17.37:g.3336989A>C	ENSP00000248384:p.Ile49Met	Somatic	0	98	0.00		0.586032912036718	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	89	25	78.07	O43877|O95632|Q0VAD5|Q0VAD6|Q9UL13	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.I49M	ENST00000248384.1	37	c.147	CCDS11026.1	17	.	.	.	.	.	.	.	.	.	.	A	11.39	1.624842	0.28889	.	.	ENSG00000127780	ENST00000248384;ENST00000454364	T	0.08458	3.09	5.34	1.88	0.25563	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000009	T	0.32315	0.0825	H	0.96015	3.755	0.20975	N	0.999811	D	0.76494	0.999	D	0.71184	0.972	T	0.26326	-1.0106	10	0.87932	D	0	.	3.3283	0.07075	0.4344:0.0:0.1653:0.4002	.	49	P47887	OR1E2_HUMAN	M	49;48	ENSP00000248384:I49M	ENSP00000248384:I49M	I	-	3	3	OR1E2	3283739	0.000000	0.05858	0.198000	0.23420	0.120000	0.20174	-0.088000	0.11198	0.136000	0.18733	0.473000	0.43528	ATT	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.517	OR1E2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR1E2	protein_coding	OTTHUMT00000207311.1	A		-		3336989	-1	no_errors	ENST00000248384	ensembl	human	known	74_37	missense	SNP	0.039	C
EPDR1	54749	genome.wustl.edu	37	7	37960263	37960275	+	5'UTR	DEL	AGGCAGTGGCAGC	AGGCAGTGGCAGC	-	rs201513905|rs62443108|rs200181352|rs76859517	byFrequency	TCGA-N1-A6IA-01A-12D-A32I-09	TCGA-N1-A6IA-11A-11D-A32I-09	AGGCAGTGGCAGC	AGGCAGTGGCAGC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	26f94549-f63a-4c0f-8c70-0341ea0f528f	29f71321-1ce9-42d2-8923-7528a4bff739	g.chr7:37960263_37960275delAGGCAGTGGCAGC	ENST00000199448.4	+	0	101_113				EPDR1_ENST00000423717.1_5'UTR|EPDR1_ENST00000559325.1_Frame_Shift_Del_p.RQWQQ28fs|EPDR1_ENST00000425345.1_5'Flank|EPDR1_ENST00000476620.1_Intron	NM_017549.4	NP_060019.2	Q9UM22	EPDR1_HUMAN	ependymin related 1						cell-matrix adhesion (GO:0007160)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	calcium ion binding (GO:0005509)	p.A36fs*79(3)		breast(1)|endometrium(1)|large_intestine(2)|lung(9)|ovary(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	22						AAGCGGCAGAAGGCAGTGGCAGCAGGCAGTGGC	0.634														805	0.160743	0.059	0.2104	5008	,	,		17289	0.1389		0.3052	False		,,,				2504	0.137																3	Deletion - Frameshift(3)	urinary_tract(1)|ovary(1)|breast(1)						ENSG00000086289			445,3795		57,331,1732						-0.3	0.2			25	2789,5371		581,1627,1872	no	frameshift	EPDR1	NM_017549.4		638,1958,3604	A1A1,A1R,RR		34.1789,10.4953,26.0806				3234,9166				EPDR1	SO:0001623	5_prime_UTR_variant	0				HGNC	BC018299	CCDS5454.1, CCDS5454.2, CCDS59051.1, CCDS59052.1	7p14.1	2013-07-31	2013-07-31		ENSG00000086289	ENSG00000086289			17572	protein-coding gene	gene with protein product			"""ependymin related protein 1 (zebrafish)"""			11749721, 11248421	Standard	NM_001242946		Approved	MERP-1, MERP1, UCC1, EPDR	uc003tfp.4	Q9UM22	OTTHUMG00000102187	ENST00000199448.4:c.-267AGGCAGTGGCAGC>-	7.37:g.37960263_37960275delAGGCAGTGGCAGC		Somatic	NA	NA	NA		0.586032912036718	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A8K4C0|C9JYS3|Q06BL0|Q99M77	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Ependymin,smart_Ependymin,prints_Ependymin	p.Q31fs	ENST00000199448.4	37	c.82_94	CCDS5454.2	7																																																																																			-	NULL		0.634	EPDR1-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	EPDR1	protein_coding	OTTHUMT00000220037.3	AGGCAGTGGCAGC	NM_017549			37960275	+1	no_errors	ENST00000559325	ensembl	human	known	74_37	frame_shift_del	DEL	0.174:0.169:0.163:0.158:0.152:0.146:0.139:0.133:0.126:0.118:0.111:0.103:0.095	-
DIXDC1	85458	genome.wustl.edu	37	11	111857611	111857611	+	Missense_Mutation	SNP	G	G	T	rs587612868		TCGA-N1-A6IA-01A-12D-A32I-09	TCGA-N1-A6IA-11A-11D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	26f94549-f63a-4c0f-8c70-0341ea0f528f	29f71321-1ce9-42d2-8923-7528a4bff739	g.chr11:111857611G>T	ENST00000440460.2	+	10	1319	c.1022G>T	c.(1021-1023)cGt>cTt	p.R341L	DIXDC1_ENST00000315253.5_Missense_Mutation_p.R130L|DIXDC1_ENST00000389821.4_3'UTR	NM_001037954.2	NP_001033043.1	Q155Q3	DIXC1_HUMAN	DIX domain containing 1	342					camera-type eye development (GO:0043010)|cell cycle (GO:0007049)|cerebellar cortex development (GO:0021695)|cerebral cortex radially oriented cell migration (GO:0021799)|forebrain development (GO:0030900)|forebrain ventricular zone progenitor cell division (GO:0021869)|negative regulation of neuron differentiation (GO:0045665)|positive regulation of axonogenesis (GO:0050772)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of JNK cascade (GO:0046330)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of JNK cascade (GO:0046328)|regulation of microtubule cytoskeleton organization (GO:0070507)|Wnt signaling pathway (GO:0016055)	axon terminus (GO:0043679)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cytosol (GO:0005829)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)	gamma-tubulin binding (GO:0043015)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)			cervix(2)|endometrium(4)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)	17		all_cancers(61;7.58e-15)|all_epithelial(67;5.42e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;2.99e-07)|BRCA - Breast invasive adenocarcinoma(274;6.72e-07)|all cancers(92;6.25e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.0548)		ATCCAAAGTCGTCTGGATCAG	0.413																																																	0								ENSG00000150764						98.0	92.0	94.0					11																	111857611		1893	4107	6000	DIXDC1	SO:0001583	missense	0			-	HGNC	AB051522	CCDS60957.1, CCDS73381.1, CCDS73382.1	11q23.1	2014-03-20			ENSG00000150764	ENSG00000150764			23695	protein-coding gene	gene with protein product		610493				12792787	Standard	NM_001037954		Approved	KIAA1735, Dixin	uc001pmm.3	Q155Q3	OTTHUMG00000166912	ENST00000440460.2:c.1022G>T	11.37:g.111857611G>T	ENSP00000394352:p.Arg341Leu	Somatic	0	24	0.00		0.586032912036718	30	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	16	15.79	A1A5D8|E9PRV4|Q6P2J8|Q6PIK4|Q86SR7|Q8IVY4|Q96N69|Q9C0C8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DIX,pfam_CH-domain,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_DIX,pfscan_CH-domain,pfscan_DIX	p.R341L	ENST00000440460.2	37	c.1022		11	.	.	.	.	.	.	.	.	.	.	G	24.2	4.503493	0.85176	.	.	ENSG00000150764	ENST00000440460;ENST00000315253	T;T	0.29142	1.58;1.58	4.96	4.96	0.65561	.	0.048021	0.85682	D	0.000000	T	0.56108	0.1963	.	.	.	0.80722	D	1	D;D	0.76494	0.999;0.997	D;P	0.70935	0.971;0.871	T	0.58301	-0.7660	9	0.54805	T	0.06	-10.0021	17.3805	0.87403	0.0:0.0:1.0:0.0	.	130;342	E7EQ17;Q155Q3	.;DIXC1_HUMAN	L	341;130	ENSP00000394352:R341L;ENSP00000314068:R130L	ENSP00000314068:R130L	R	+	2	0	DIXDC1	111362821	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	6.392000	0.73213	2.595000	0.87683	0.655000	0.94253	CGT	-	NULL		0.413	DIXDC1-202	KNOWN	basic|appris_principal	protein_coding	DIXDC1	protein_coding		G	NM_001037954	-		111857611	+1	no_errors	ENST00000440460	ensembl	human	known	74_37	missense	SNP	1.000	T
FAM98A	25940	genome.wustl.edu	37	2	33812338	33812338	+	Nonsense_Mutation	SNP	A	A	C			TCGA-N1-A6IA-01A-12D-A32I-09	TCGA-N1-A6IA-11A-11D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	26f94549-f63a-4c0f-8c70-0341ea0f528f	29f71321-1ce9-42d2-8923-7528a4bff739	g.chr2:33812338A>C	ENST00000238823.8	-	5	712	c.572T>G	c.(571-573)tTa>tGa	p.L191*	FAM98A_ENST00000441530.2_5'UTR|FAM98A_ENST00000498340.1_5'UTR|FAM98A_ENST00000403368.1_Nonsense_Mutation_p.L191*			Q8NCA5	FA98A_HUMAN	family with sequence similarity 98, member A	192							poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(12)|ovary(1)|prostate(1)|skin(1)	24	all_hematologic(175;0.115)					CTTCTTCAGTAAAGGCTTTCC	0.338																																																	0								ENSG00000119812						116.0	117.0	117.0					2																	33812338		2203	4300	6503	FAM98A	SO:0001587	stop_gained	0			-	HGNC		CCDS33179.1	2p22.3	2006-11-29		2005-11-20	ENSG00000119812	ENSG00000119812			24520	protein-coding gene	gene with protein product						12477932	Standard	NM_015475		Approved	DKFZP564F0522	uc002rpa.1	Q8NCA5	OTTHUMG00000152152	ENST00000238823.8:c.572T>G	2.37:g.33812338A>C	ENSP00000238823:p.Leu191*	Somatic	0	41	0.00		0.586032912036718	47	22.95	14	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	21	54.35	B2RNA2|Q9Y3Y6	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Uncharacterised_FAM98	p.L191*	ENST00000238823.8	37	c.572	CCDS33179.1	2	.	.	.	.	.	.	.	.	.	.	A	35	5.592205	0.96590	.	.	ENSG00000119812	ENST00000238823;ENST00000395190;ENST00000403368	.	.	.	5.87	5.87	0.94306	.	0.000000	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-4.1656	16.5764	0.84681	1.0:0.0:0.0:0.0	.	.	.	.	X	191;192;191	.	ENSP00000238823:L191X	L	-	2	0	FAM98A	33665842	0.997000	0.39634	0.997000	0.53966	0.993000	0.82548	8.678000	0.91211	2.371000	0.80710	0.533000	0.62120	TTA	-	pfam_Uncharacterised_FAM98		0.338	FAM98A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM98A	protein_coding	OTTHUMT00000325457.2	A	NM_015475	-		33812338	-1	no_errors	ENST00000238823	ensembl	human	known	74_37	nonsense	SNP	0.890	C
CCDC85A	114800	genome.wustl.edu	37	2	56612793	56612793	+	3'UTR	SNP	G	G	C			TCGA-N1-A6IA-01A-12D-A32I-09	TCGA-N1-A6IA-11A-11D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	26f94549-f63a-4c0f-8c70-0341ea0f528f	29f71321-1ce9-42d2-8923-7528a4bff739	g.chr2:56612793G>C	ENST00000407595.2	+	0	3467				RP11-482H16.1_ENST00000607540.1_RNA	NM_001080433.1	NP_001073902.1	Q96PX6	CC85A_HUMAN	coiled-coil domain containing 85A											breast(6)|cervix(2)|endometrium(5)|kidney(1)|lung(18)|ovary(2)|pancreas(1)|prostate(3)	38			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			ATTCATGGCAGATATTCTCTG	0.313																																																	0								ENSG00000271894																																			RP11-482H16.1	SO:0001624	3_prime_UTR_variant	0			-	Clone_based_vega_gene	AB067499	CCDS46290.1	2p16.1	2006-03-29			ENSG00000055813	ENSG00000055813			29400	protein-coding gene	gene with protein product						11572484	Standard	NM_001080433		Approved	KIAA1912	uc002rzn.3	Q96PX6	OTTHUMG00000152033	ENST00000407595.2:c.*1303G>C	2.37:g.56612793G>C		Somatic	0	31	0.00		0.586032912036718	1	50.00	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	57	9.38		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000407595.2	37	NULL	CCDS46290.1	2																																																																																			-	-		0.313	CCDC85A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000271894	protein_coding	OTTHUMT00000324993.1	G		-		56612793	+1	no_errors	ENST00000607540	ensembl	human	known	74_37	rna	SNP	0.000	C
FAM20A	54757	genome.wustl.edu	37	17	66537102	66537103	+	Intron	DEL	GA	GA	-			TCGA-N1-A6IA-01A-12D-A32I-09	TCGA-N1-A6IA-11A-11D-A32I-09	GA	GA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	26f94549-f63a-4c0f-8c70-0341ea0f528f	29f71321-1ce9-42d2-8923-7528a4bff739	g.chr17:66537102_66537103delGA	ENST00000592554.1	-	8	1832				FAM20A_ENST00000226094.5_5'UTR|AC079210.1_ENST00000600820.1_5'Flank|PRKAR1A_ENST00000588188.2_Intron	NM_001243746.1|NM_017565.3	NP_001230675.1|NP_060035.2	Q96MK3	FA20A_HUMAN	family with sequence similarity 20, member A						calcium ion homeostasis (GO:0055074)|enamel mineralization (GO:0070166)|tooth eruption (GO:0044691)	cell (GO:0005623)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)				cervix(1)|endometrium(1)|large_intestine(3)|lung(2)|prostate(1)|stomach(1)	9	Breast(10;1.64e-13)					CCTCCCACCTGAGGGGGAGAAG	0.594																																																	0								ENSG00000108950																																			FAM20A	SO:0001627	intron_variant	0				HGNC	AK056789	CCDS11679.1	17q24.2	2014-02-07			ENSG00000108950	ENSG00000108950			23015	protein-coding gene	gene with protein product		611062					Standard	NM_017565		Approved	DKFZp434F2322	uc002jho.3	Q96MK3	OTTHUMG00000180152	ENST00000592554.1:c.1110-3TC>-	17.37:g.66537102_66537103delGA		Somatic	0	51	0.00		0.586032912036718	7	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	49	35.53	B2RN47|B2RN49|Q9UF95	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000592554.1	37	NULL	CCDS11679.1	17																																																																																			-	-		0.594	FAM20A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM20A	protein_coding	OTTHUMT00000450029.2	GA	NM_017565			66537103	-1	no_errors	ENST00000226094	ensembl	human	known	74_37	rna	DEL	0.997:0.815	-
NUP133	55746	genome.wustl.edu	37	1	229606361	229606361	+	Missense_Mutation	SNP	G	G	C			TCGA-N1-A6IA-01A-12D-A32I-09	TCGA-N1-A6IA-11A-11D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	26f94549-f63a-4c0f-8c70-0341ea0f528f	29f71321-1ce9-42d2-8923-7528a4bff739	g.chr1:229606361G>C	ENST00000261396.3	-	15	2133	c.2042C>G	c.(2041-2043)tCc>tGc	p.S681C	NUP133_ENST00000537506.1_Missense_Mutation_p.S665C	NM_018230.2	NP_060700.2	Q8WUM0	NU133_HUMAN	nucleoporin 133kDa	681					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|nuclear pore organization (GO:0006999)|paraxial mesoderm development (GO:0048339)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)|nuclear pore outer ring (GO:0031080)	nucleocytoplasmic transporter activity (GO:0005487)			NS(1)|breast(7)|endometrium(1)|kidney(6)|large_intestine(9)|lung(20)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|stomach(4)	56	Breast(184;0.104)|Ovarian(103;0.249)	Prostate(94;0.167)				AGTCAGGTTGGATGGGATTTC	0.473																																																	0								ENSG00000069248						122.0	119.0	120.0					1																	229606361		2203	4300	6503	NUP133	SO:0001583	missense	0			-	HGNC		CCDS1579.1	1q42.13	2008-02-05	2002-08-29		ENSG00000069248	ENSG00000069248			18016	protein-coding gene	gene with protein product		607613	"""nucleoporin 133kD"""			11684705	Standard	NM_018230		Approved	FLJ10814	uc001htn.3	Q8WUM0	OTTHUMG00000039462	ENST00000261396.3:c.2042C>G	1.37:g.229606361G>C	ENSP00000261396:p.Ser681Cys	Somatic	0	68	0.00		0.586032912036718	24	40.00	16	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	35	28.00	B2RAZ8|Q5T8N0|Q9H9W2|Q9NV71|Q9NVC4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Nucleoporin_Nup133/Nup155_C,pfam_Nucleoporin_Nup133/Nup155_N	p.S681C	ENST00000261396.3	37	c.2042	CCDS1579.1	1	.	.	.	.	.	.	.	.	.	.	G	8.746	0.920085	0.17982	.	.	ENSG00000069248	ENST00000366681;ENST00000261396;ENST00000366679;ENST00000537506	T;T;T	0.24350	1.86;1.86;1.86	5.56	1.41	0.22369	Nucleoporin, Nup133/Nup155-like, C-terminal (1);	0.807892	0.12081	N	0.501327	T	0.16085	0.0387	N	0.08118	0	0.09310	N	1	P	0.45126	0.851	P	0.47626	0.552	T	0.11446	-1.0587	10	0.56958	D	0.05	-24.0942	5.4333	0.16466	0.0632:0.2276:0.4743:0.2349	.	681	Q8WUM0	NU133_HUMAN	C	681;681;681;665	ENSP00000261396:S681C;ENSP00000355640:S681C;ENSP00000443496:S665C	ENSP00000261396:S681C	S	-	2	0	NUP133	227672984	0.003000	0.15002	0.003000	0.11579	0.243000	0.25628	1.070000	0.30653	0.071000	0.16664	0.655000	0.94253	TCC	-	pfam_Nucleoporin_Nup133/Nup155_C		0.473	NUP133-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP133	protein_coding	OTTHUMT00000095224.1	G	NM_018230	-		229606361	-1	no_errors	ENST00000261396	ensembl	human	known	74_37	missense	SNP	0.002	C
DPEP1	1800	genome.wustl.edu	37	16	89703959	89703959	+	Splice_Site	SNP	C	C	T	rs142226072		TCGA-N1-A6IA-01A-12D-A32I-09	TCGA-N1-A6IA-11A-11D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	26f94549-f63a-4c0f-8c70-0341ea0f528f	29f71321-1ce9-42d2-8923-7528a4bff739	g.chr16:89703959C>T	ENST00000393092.3	+	8	1143	c.852C>T	c.(850-852)gcC>gcT	p.A284A	DPEP1_ENST00000421184.1_Splice_Site_p.A284A|DPEP1_ENST00000261615.4_Splice_Site_p.A284A	NM_004413.3	NP_004404.1	P16444	DPEP1_HUMAN	dipeptidase 1 (renal)	284					antibiotic metabolic process (GO:0016999)|arachidonic acid metabolic process (GO:0019369)|cellular lactam catabolic process (GO:0072340)|cellular response to calcium ion (GO:0071277)|cellular response to drug (GO:0035690)|cellular response to nitric oxide (GO:0071732)|glutathione metabolic process (GO:0006749)|homocysteine metabolic process (GO:0050667)|leukotriene metabolic process (GO:0006691)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell migration (GO:0030336)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|apical part of cell (GO:0045177)|cell projection (GO:0042995)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|dipeptidyl-peptidase activity (GO:0008239)|GPI anchor binding (GO:0034235)|metallodipeptidase activity (GO:0070573)|metalloexopeptidase activity (GO:0008235)|modified amino acid binding (GO:0072341)|zinc ion binding (GO:0008270)			large_intestine(2)|lung(10)|prostate(1)|urinary_tract(1)	14		all_lung(18;0.0054)|all_hematologic(23;0.094)		BRCA - Breast invasive adenocarcinoma(80;0.0258)	Cilastatin(DB01597)	CCCAAGTGGCCGGTAGGTGGG	0.567													C|||	1	0.000199681	0.0008	0.0	5008	,	,		19402	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000015413	C	,	4,4390	8.1+/-20.4	0,4,2193	75.0	85.0	82.0		852,852	-3.4	0.9	16	dbSNP_134	82	2,8590	2.2+/-6.3	0,2,4294	yes	coding-synonymous-near-splice,coding-synonymous-near-splice	DPEP1	NM_001128141.1,NM_004413.3	,	0,6,6487	TT,TC,CC		0.0233,0.091,0.0462	,	284/412,284/412	89703959	6,12980	2197	4296	6493	DPEP1	SO:0001630	splice_region_variant	0			-	HGNC		CCDS10982.1	16q24	2011-07-22			ENSG00000015413	ENSG00000015413	3.4.13.19		3002	protein-coding gene	gene with protein product		179780					Standard	NM_004413		Approved		uc002fnr.4	P16444	OTTHUMG00000138052	ENST00000393092.3:c.853+1C>T	16.37:g.89703959C>T		Somatic	0	32	0.00		0.586032912036718	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	20	33.33	D3DX80|Q96AK2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_M19	p.A284	ENST00000393092.3	37	c.852	CCDS10982.1	16																																																																																			-	pfam_Peptidase_M19		0.567	DPEP1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	DPEP1	protein_coding	OTTHUMT00000423058.1	C	NM_001128141	rs142226072	Silent	89703959	+1	no_errors	ENST00000261615	ensembl	human	known	74_37	silent	SNP	0.955	T
CD82	3732	genome.wustl.edu	37	11	44626777	44626777	+	Intron	SNP	C	C	A			TCGA-N1-A6IA-01A-12D-A32I-09	TCGA-N1-A6IA-11A-11D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	26f94549-f63a-4c0f-8c70-0341ea0f528f	29f71321-1ce9-42d2-8923-7528a4bff739	g.chr11:44626777C>A	ENST00000227155.4	+	5	509				RP11-58K22.5_ENST00000533814.1_RNA|RP11-58K22.4_ENST00000532524.1_RNA|CD82_ENST00000342935.3_Intron|CD82_ENST00000530931.1_Intron	NM_002231.3	NP_002222.1	P27701	CD82_HUMAN	CD82 molecule							extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				large_intestine(1)|ovary(1)	2						TTCCTCTCATCCAGCCGAGTG	0.682																																																	0								ENSG00000254693						35.0	34.0	35.0					11																	44626777		2203	4298	6501	RP11-58K22.5	SO:0001627	intron_variant	0			-	Clone_based_vega_gene	U20770	CCDS7909.1, CCDS31469.1	11p11.2	2013-02-14	2006-03-28	2005-03-03		ENSG00000085117		"""CD molecules"", ""Tetraspanins"""	6210	protein-coding gene	gene with protein product	"""suppression of tumorigenicity 6"", ""R2 leukocyte antigen"""	600623	"""kangai 1 (suppression of tumorigenicity 6, prostate; CD82 antigen (R2 leukocyte antigen, antigen detected by monoclonal and antibody IA4))"", ""CD82 antigen"""	ST6, KAI1			Standard	XM_006718222		Approved	R2, IA4, TSPAN27	uc001myc.3	P27701		ENST00000227155.4:c.261+45C>A	11.37:g.44626777C>A		Somatic	0	28	0.00		0.586032912036718	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	13	53.57	D3DQN6|E9PC70|Q7Z2D4|Q7Z5N2	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000227155.4	37	NULL	CCDS7909.1	11																																																																																			-	-		0.682	CD82-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000254693	protein_coding	OTTHUMT00000389886.1	C		-		44626777	-1	no_errors	ENST00000533814	ensembl	human	known	74_37	rna	SNP	0.001	A
CHAF1A	10036	genome.wustl.edu	37	19	4433417	4433417	+	Missense_Mutation	SNP	G	G	C	rs577677696		TCGA-N1-A6IA-01A-12D-A32I-09	TCGA-N1-A6IA-11A-11D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	26f94549-f63a-4c0f-8c70-0341ea0f528f	29f71321-1ce9-42d2-8923-7528a4bff739	g.chr19:4433417G>C	ENST00000301280.5	+	13	2655	c.2554G>C	c.(2554-2556)Gac>Cac	p.D852H	CTB-50L17.5_ENST00000590159.1_RNA	NM_005483.2	NP_005474	Q13111	CAF1A_HUMAN	chromatin assembly factor 1, subunit A (p150)	852	Binds to p60.				cell cycle (GO:0007049)|chromatin assembly (GO:0031497)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication-dependent nucleosome assembly (GO:0006335)|protein complex assembly (GO:0006461)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	CAF-1 complex (GO:0033186)|nuclear chromatin (GO:0000790)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|identical protein binding (GO:0042802)|unfolded protein binding (GO:0051082)			breast(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(6)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	27		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0148)|STAD - Stomach adenocarcinoma(1328;0.18)		CCCCAAAGAGGACAGTGGCAG	0.632								Chromatin Structure																																									0								ENSG00000167670						46.0	46.0	46.0					19																	4433417		2203	4300	6503	CHAF1A	SO:0001583	missense	0			-	HGNC	U20979	CCDS32875.1	19p13.3	2008-07-16				ENSG00000167670			1910	protein-coding gene	gene with protein product	"""chromatin assembly factor I (150 kDa)"""	601246				7600578	Standard	NM_005483		Approved	CAF1P150, CAF1B, CAF-1, CAF1, P150, MGC71229	uc002mal.3	Q13111		ENST00000301280.5:c.2554G>C	19.37:g.4433417G>C	ENSP00000301280:p.Asp852His	Somatic	0	44	0.00		0.586032912036718	81	44.52	65	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	38	29.63	Q6NXG5|Q7Z7K3|Q9UJY8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_CAF1A	p.D852H	ENST00000301280.5	37	c.2554	CCDS32875.1	19	.	.	.	.	.	.	.	.	.	.	G	16.92	3.254138	0.59212	.	.	ENSG00000167670	ENST00000301280	T	0.34667	1.35	5.62	5.62	0.85841	.	.	.	.	.	T	0.56819	0.2011	M	0.61703	1.905	0.51482	D	0.999928	D	0.69078	0.997	D	0.64042	0.921	T	0.52351	-0.8587	8	.	.	.	-44.3575	18.6935	0.91592	0.0:0.0:1.0:0.0	.	852	Q13111	CAF1A_HUMAN	H	852	ENSP00000301280:D852H	.	D	+	1	0	CHAF1A	4384417	1.000000	0.71417	1.000000	0.80357	0.275000	0.26752	9.319000	0.96338	2.653000	0.90120	0.650000	0.86243	GAC	-	NULL		0.632	CHAF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHAF1A	protein_coding	OTTHUMT00000458310.2	G	NM_005483	-		4433417	+1	no_errors	ENST00000301280	ensembl	human	known	74_37	missense	SNP	1.000	C
MTMR9LP	339483	genome.wustl.edu	37	1	32706857	32706857	+	RNA	SNP	A	A	T			TCGA-N1-A6IA-01A-12D-A32I-09	TCGA-N1-A6IA-11A-11D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	26f94549-f63a-4c0f-8c70-0341ea0f528f	29f71321-1ce9-42d2-8923-7528a4bff739	g.chr1:32706857A>T	ENST00000441044.1	-	0	364									myotubularin related protein 9-like, pseudogene																		CTGGGGAGGGACGTTCCTTTC	0.647																																					Melanoma(41;686 1336 34611 48972)												0								ENSG00000220785																																			MTMR9LP			0			-	HGNC			1p35.1	2010-10-28	2010-04-29	2010-10-28	ENSG00000220785	ENSG00000220785			27920	pseudogene	pseudogene			"""myotubularin related protein 9-like"""	MTMR9L		12477932	Standard	NR_026850		Approved		uc001buv.4		OTTHUMG00000007461		1.37:g.32706857A>T		Somatic	0	77	0.00		0.586032912036718	2	50.00	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	89	17.59		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000441044.1	37	NULL		1																																																																																			-	-		0.647	MTMR9LP-003	KNOWN	basic	processed_transcript	MTMR9LP	pseudogene	OTTHUMT00000019609.2	A	NR_026850	-		32706857	-1	no_errors	ENST00000441044	ensembl	human	known	74_37	rna	SNP	0.000	T
ZNF736	728927	genome.wustl.edu	37	7	63808779	63808780	+	Frame_Shift_Del	DEL	AA	AA	-			TCGA-N1-A6IA-01A-12D-A32I-09	TCGA-N1-A6IA-11A-11D-A32I-09	AA	AA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	26f94549-f63a-4c0f-8c70-0341ea0f528f	29f71321-1ce9-42d2-8923-7528a4bff739	g.chr7:63808779_63808780delAA	ENST00000423484.2	+	4	660_661	c.538_539delAA	c.(538-540)aaafs	p.K180fs	ZNF736_ENST00000355095.4_Frame_Shift_Del_p.K180fs			B4DX44	ZN736_HUMAN	zinc finger protein 736	180					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(6)|stomach(1)|urinary_tract(1)	9						AGAATGTGGCAAAGACTGTAGG	0.347																																																	0								ENSG00000234444																																			ZNF736	SO:0001589	frameshift_variant	0				HGNC		CCDS55114.1	7q11.21	2013-01-08			ENSG00000234444	ENSG00000234444		"""Zinc fingers, C2H2-type"", ""-"""	32467	protein-coding gene	gene with protein product							Standard	XM_006716104		Approved		uc011kdo.2	B4DX44	OTTHUMG00000156537	ENST00000423484.2:c.538_539delAA	7.37:g.63808779_63808780delAA	ENSP00000400852:p.Lys180fs	Somatic	0	47	0.00		0.586032912036718	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	43	12.24		Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K180fs	ENST00000423484.2	37	c.538_539	CCDS55114.1	7																																																																																			-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.347	ZNF736-003	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	ZNF736	protein_coding	OTTHUMT00000344559.2	AA	NM_001170905			63808780	+1	no_errors	ENST00000355095	ensembl	human	known	74_37	frame_shift_del	DEL	0.997:0.991	-
ELN	2006	genome.wustl.edu	37	7	73471034	73471034	+	Missense_Mutation	SNP	G	G	A			TCGA-N1-A6IA-01A-12D-A32I-09	TCGA-N1-A6IA-11A-11D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	26f94549-f63a-4c0f-8c70-0341ea0f528f	29f71321-1ce9-42d2-8923-7528a4bff739	g.chr7:73471034G>A	ENST00000252034.7	+	21	1747	c.1348G>A	c.(1348-1350)Gcc>Acc	p.A450T	ELN_ENST00000380584.4_Missense_Mutation_p.A436T|ELN_ENST00000380575.4_Missense_Mutation_p.A440T|ELN_ENST00000429192.1_Missense_Mutation_p.A455T|ELN_ENST00000320399.6_Missense_Mutation_p.A450T|CTB-51J22.1_ENST00000435932.1_RNA|ELN_ENST00000414324.1_Missense_Mutation_p.A445T|ELN_ENST00000445912.1_Missense_Mutation_p.A450T|ELN_ENST00000358929.4_Missense_Mutation_p.A450T|ELN_ENST00000380553.4_Missense_Mutation_p.A333T|ELN_ENST00000380562.4_Missense_Mutation_p.A450T|ELN_ENST00000320492.7_Missense_Mutation_p.A388T|ELN_ENST00000380576.5_Missense_Mutation_p.A450T|ELN_ENST00000458204.1_Missense_Mutation_p.A440T|ELN_ENST00000357036.5_Missense_Mutation_p.A455T	NM_000501.2|NM_001278915.1	NP_000492.2|NP_001265844.1	P15502	ELN_HUMAN	elastin	0	Ala-rich.				blood circulation (GO:0008015)|blood vessel remodeling (GO:0001974)|cell proliferation (GO:0008283)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|organ morphogenesis (GO:0009887)|regulation of actin filament polymerization (GO:0030833)|respiratory gaseous exchange (GO:0007585)|skeletal muscle tissue development (GO:0007519)|stress fiber assembly (GO:0043149)	elastic fiber (GO:0071953)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix binding (GO:0050840)|extracellular matrix constituent conferring elasticity (GO:0030023)|extracellular matrix structural constituent (GO:0005201)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(10)|ovary(4)|pancreas(2)|prostate(1)|skin(2)|stomach(1)	32		Lung NSC(55;0.159)				CGCCAAGGCTGCCAAGTACGG	0.627			T	PAX5	B-ALL		"""Supravalvular Aortic Stenosis, Cutis laxa , Williams-Beuren Syndrome"""																																	Dom	yes		7	7q11.23	2006	elastin	yes	L	0								ENSG00000049540						44.0	45.0	45.0					7																	73471034		2203	4300	6503	ELN	SO:0001583	missense	0			-	HGNC		CCDS5562.2, CCDS43598.1, CCDS43599.1, CCDS47611.1, CCDS47612.1, CCDS64673.1, CCDS64674.1, CCDS64675.1, CCDS64676.1, CCDS64677.1, CCDS64678.1, CCDS75616.1, CCDS75617.1	7q11.1-q21.1	2008-08-01	2008-08-01		ENSG00000049540	ENSG00000049540			3327	protein-coding gene	gene with protein product	"""tropoelastin"", ""supravalvular aortic stenosis"", ""Williams-Beuren syndrome"""	130160				8096434	Standard	NM_001278939		Approved	WBS, WS, SVAS	uc003tzn.3	P15502	OTTHUMG00000150229	ENST00000252034.7:c.1348G>A	7.37:g.73471034G>A	ENSP00000252034:p.Ala450Thr	Somatic	0	65	0.00		0.586032912036718	139	19.19	33	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	44	20.00	B3KTS6|O15336|O15337|Q14233|Q14234|Q14235|Q14238|Q6P0L4|Q6ZWJ6|Q75MU5|Q7Z316|Q7Z3F5|Q9UMF5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	prints_Tropoelastin	p.A450T	ENST00000252034.7	37	c.1348	CCDS5562.2	7	.	.	.	.	.	.	.	.	.	.	G	14.70	2.613918	0.46631	.	.	ENSG00000049540	ENST00000445912;ENST00000252034;ENST00000358929;ENST00000320492;ENST00000414324;ENST00000380562;ENST00000380575;ENST00000380584;ENST00000458204;ENST00000357036;ENST00000429192;ENST00000442462;ENST00000380553;ENST00000380576;ENST00000320399	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.46063	1.42;1.43;0.88;1.36;1.35;1.29;1.43;1.32;1.42;1.42;1.35;1.36;1.39;1.44	3.91	3.91	0.45181	.	.	.	.	.	T	0.51312	0.1667	.	.	.	0.34043	D	0.655224	D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.67145	0.996;0.996;0.996;0.996;0.996;0.996;0.996;0.996;0.996;0.996;0.996;0.996;0.996;0.996	D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.77557	0.99;0.99;0.99;0.99;0.99;0.99;0.99;0.99;0.99;0.99;0.99;0.99;0.99;0.99	T	0.52026	-0.8630	8	0.11485	T	0.65	-11.9038	11.7797	0.52006	0.0:0.0:1.0:0.0	.	450;419;388;445;440;450;440;455;455;450;333;380;436;450	E7ENM0;E9PBM4;G5E950;G3V0G6;E7EN65;P15502-1;P15502-7;P15502-12;P15502-5;P15502-13;P15502-11;B3KRT8;P15502-8;P15502-2	.;.;.;.;.;.;.;.;.;.;.;.;.;.	T	450;450;450;388;445;450;440;436;440;455;455;419;333;450;450	ENSP00000389857:A450T;ENSP00000252034:A450T;ENSP00000351807:A450T;ENSP00000315607:A388T;ENSP00000392575:A445T;ENSP00000369936:A450T;ENSP00000369949:A440T;ENSP00000369958:A436T;ENSP00000403162:A440T;ENSP00000349540:A455T;ENSP00000391129:A455T;ENSP00000369926:A333T;ENSP00000369950:A450T;ENSP00000313565:A450T	ENSP00000252034:A450T	A	+	1	0	ELN	73108970	0.952000	0.32445	0.994000	0.49952	0.602000	0.36980	4.283000	0.58977	2.215000	0.71742	0.449000	0.29647	GCC	-	NULL		0.627	ELN-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ELN	protein_coding	OTTHUMT00000316913.1	G	NM_000501	-		73471034	+1	no_errors	ENST00000358929	ensembl	human	known	74_37	missense	SNP	0.997	A
TMPRSS9	360200	genome.wustl.edu	37	19	2396405	2396405	+	Intron	SNP	A	A	G			TCGA-N1-A6IA-01A-12D-A32I-09	TCGA-N1-A6IA-11A-11D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	26f94549-f63a-4c0f-8c70-0341ea0f528f	29f71321-1ce9-42d2-8923-7528a4bff739	g.chr19:2396405A>G	ENST00000332578.3	+	2	142				TMPRSS9_ENST00000592650.1_3'UTR	NM_182973.1	NP_892018.1	Q7Z410	TMPS9_HUMAN	transmembrane protease, serine 9						plasminogen activation (GO:0031639)	integral component of plasma membrane (GO:0005887)	serine-type endopeptidase activity (GO:0004252)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(3)|lung(12)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGGGGCGTCGACCACCCCACT	0.617																																																	0								ENSG00000178297																																			TMPRSS9	SO:0001627	intron_variant	0			-	HGNC	AJ488946	CCDS12088.1	19p13.3	2010-04-13						"""Serine peptidases / Transmembrane"""	30079	protein-coding gene	gene with protein product	"""polyserase 1"""	610477				12886014	Standard	NM_182973		Approved		uc010xgx.2	Q7Z410		ENST00000332578.3:c.143-132A>G	19.37:g.2396405A>G		Somatic	0	33	0.00		0.586032912036718	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	23	25.81	Q6ZND6|Q7Z411	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000332578.3	37	NULL	CCDS12088.1	19																																																																																			-	-		0.617	TMPRSS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMPRSS9	protein_coding	OTTHUMT00000451330.3	A	NM_182973	-		2396405	+1	no_errors	ENST00000592650	ensembl	human	known	74_37	rna	SNP	0.004	G
TRIM40	135644	genome.wustl.edu	37	6	30104709	30104709	+	5'UTR	SNP	C	C	T	rs533874564	byFrequency	TCGA-N1-A6IA-01A-12D-A32I-09	TCGA-N1-A6IA-11A-11D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	26f94549-f63a-4c0f-8c70-0341ea0f528f	29f71321-1ce9-42d2-8923-7528a4bff739	g.chr6:30104709C>T	ENST00000396581.1	+	0	282				TRIM40_ENST00000307859.4_5'Flank|TRIM40_ENST00000489892.1_3'UTR|TRIM40_ENST00000376724.2_5'UTR			Q6P9F5	TRI40_HUMAN	tripartite motif containing 40						negative regulation of cell growth (GO:0030308)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of NIK/NF-kappaB signaling (GO:1901223)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of protein localization to nucleus (GO:1900181)|protein neddylation (GO:0045116)	IkappaB kinase complex (GO:0008385)	zinc ion binding (GO:0008270)			ovary(1)	1						TGCCTCCTTCCGACTGGGCCT	0.587													C|||	6	0.00119808	0.0	0.0	5008	,	,		18290	0.0		0.0	False		,,,				2504	0.0061																0								ENSG00000204614																																			TRIM40	SO:0001623	5_prime_UTR_variant	0			-	HGNC	AF489517	CCDS4675.1, CCDS69069.1	6p21.31	2013-01-09	2011-01-25		ENSG00000204614	ENSG00000204614		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	18736	protein-coding gene	gene with protein product			"""tripartite motif-containing 40"""				Standard	NM_138700		Approved	RNF35	uc003npm.2	Q6P9F5	OTTHUMG00000031083	ENST00000396581.1:c.-105C>T	6.37:g.30104709C>T		Somatic	0	14	0.00		0.586032912036718	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	9	30.77	Q5SRJ6|Q5SS36|Q8TD96	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000396581.1	37	NULL		6																																																																																			-	-		0.587	TRIM40-001	KNOWN	basic	protein_coding	TRIM40	protein_coding	OTTHUMT00000076117.2	C		-		30104709	+1	no_errors	ENST00000489892	ensembl	human	known	74_37	rna	SNP	0.000	T
N4BP2	55728	genome.wustl.edu	37	4	40108621	40108621	+	Missense_Mutation	SNP	C	C	T			TCGA-N1-A6IA-01A-12D-A32I-09	TCGA-N1-A6IA-11A-11D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	26f94549-f63a-4c0f-8c70-0341ea0f528f	29f71321-1ce9-42d2-8923-7528a4bff739	g.chr4:40108621C>T	ENST00000261435.6	+	5	1891	c.1475C>T	c.(1474-1476)gCa>gTa	p.A492V		NM_018177.4	NP_060647.2	Q86UW6	N4BP2_HUMAN	NEDD4 binding protein 2	492					nucleic acid phosphodiester bond hydrolysis (GO:0090305)|phosphorylation (GO:0016310)	cytosol (GO:0005829)	ATP binding (GO:0005524)|ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity (GO:0046404)|endonuclease activity (GO:0004519)			breast(4)|endometrium(3)|kidney(12)|large_intestine(7)|liver(2)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)	60						TTAGGAGAAGCACATGAATGG	0.333																																																	0								ENSG00000078177						74.0	76.0	76.0					4																	40108621		2203	4300	6503	N4BP2	SO:0001583	missense	0			-	HGNC	AB037834	CCDS3457.1	4p14	2008-01-18			ENSG00000078177	ENSG00000078177			29851	protein-coding gene	gene with protein product	"""BCL-3 binding protein"""					10718198, 11717310	Standard	NM_018177		Approved	B3BP	uc003guy.4	Q86UW6	OTTHUMG00000128599	ENST00000261435.6:c.1475C>T	4.37:g.40108621C>T	ENSP00000261435:p.Ala492Val	Somatic	0	73	0.00		0.586032912036718	0	100.00	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	55	53	50.93	A0AVR3|Q9NVK2|Q9P2D4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF1771,pfam_Smr/MutS2_C,superfamily_P-loop_NTPase,superfamily_UBA-like,smart_Smr/MutS2_C,pfscan_CUE,pfscan_Smr/MutS2_C	p.A492V	ENST00000261435.6	37	c.1475	CCDS3457.1	4	.	.	.	.	.	.	.	.	.	.	C	29.6	5.017730	0.93404	.	.	ENSG00000078177	ENST00000261435;ENST00000381804	T	0.40225	1.04	5.4	5.4	0.78164	.	0.000000	0.85682	D	0.000000	T	0.59891	0.2227	L	0.43757	1.38	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.60855	-0.7180	10	0.72032	D	0.01	-16.4039	19.5377	0.95260	0.0:1.0:0.0:0.0	.	492;492	Q86UW6-2;Q86UW6	.;N4BP2_HUMAN	V	492;412	ENSP00000261435:A492V	ENSP00000261435:A492V	A	+	2	0	N4BP2	39785016	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.745000	0.74860	2.689000	0.91719	0.591000	0.81541	GCA	-	superfamily_P-loop_NTPase		0.333	N4BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	N4BP2	protein_coding	OTTHUMT00000250458.2	C	NM_018177	-		40108621	+1	no_errors	ENST00000261435	ensembl	human	known	74_37	missense	SNP	1.000	T
ACTC1	70	genome.wustl.edu	37	15	35083451	35083451	+	Missense_Mutation	SNP	A	A	C			TCGA-N1-A6IA-01A-12D-A32I-09	TCGA-N1-A6IA-11A-11D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	26f94549-f63a-4c0f-8c70-0341ea0f528f	29f71321-1ce9-42d2-8923-7528a4bff739	g.chr15:35083451A>C	ENST00000290378.4	-	6	1509	c.854T>G	c.(853-855)aTg>aGg	p.M285R	RP11-814P5.1_ENST00000558707.1_RNA|RP11-814P5.1_ENST00000503496.1_RNA|ACTC1_ENST00000557860.1_5'UTR	NM_005159.4	NP_005150.1	P68032	ACTC_HUMAN	actin, alpha, cardiac muscle 1	285					actin filament-based movement (GO:0030048)|actin-myosin filament sliding (GO:0033275)|actomyosin structure organization (GO:0031032)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cardiac muscle contraction (GO:0060048)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|heart contraction (GO:0060047)|muscle filament sliding (GO:0030049)|negative regulation of apoptotic process (GO:0043066)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|skeletal muscle thin filament assembly (GO:0030240)	actin filament (GO:0005884)|actomyosin, actin portion (GO:0042643)|blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|I band (GO:0031674)|membrane (GO:0016020)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|myosin binding (GO:0017022)			central_nervous_system(1)|endometrium(5)|kidney(1)|lung(14)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)	31		all_lung(180;2.3e-08)		all cancers(64;5.83e-19)|GBM - Glioblastoma multiforme(113;1.98e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0244)		GTCACACTTCATGATGCTATT	0.463																																																	0								ENSG00000159251						266.0	226.0	240.0					15																	35083451		2201	4298	6499	ACTC1	SO:0001583	missense	0			-	HGNC	BC009978	CCDS10041.1	15q14	2014-09-17	2006-08-24	2006-08-24	ENSG00000159251	ENSG00000159251			143	protein-coding gene	gene with protein product		102540	"""actin, alpha, cardiac muscle"""	ACTC		1639426	Standard	NM_005159		Approved	CMD1R	uc001ziu.1	P68032	OTTHUMG00000129675	ENST00000290378.4:c.854T>G	15.37:g.35083451A>C	ENSP00000290378:p.Met285Arg	Somatic	0	49	0.00		0.586032912036718	73	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	36	16.28	P04270	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Actin-related,smart_Actin-related,prints_Actin-related	p.M285R	ENST00000290378.4	37	c.854	CCDS10041.1	15	.	.	.	.	.	.	.	.	.	.	A	17.73	3.461814	0.63513	.	.	ENSG00000159251	ENST00000290378;ENST00000544062	D	0.94280	-3.39	5.49	5.49	0.81192	.	0.000000	0.64402	U	0.000005	D	0.96291	0.8790	M	0.84082	2.675	0.80722	D	1	B	0.20368	0.044	P	0.46208	0.507	D	0.95523	0.8596	10	0.87932	D	0	.	15.8884	0.79273	1.0:0.0:0.0:0.0	.	285	P68032	ACTC_HUMAN	R	285;250	ENSP00000290378:M285R	ENSP00000290378:M285R	M	-	2	0	ACTC1	32870743	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.287000	0.95975	2.209000	0.71365	0.533000	0.62120	ATG	-	pfam_Actin-related,smart_Actin-related		0.463	ACTC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTC1	protein_coding	OTTHUMT00000251876.3	A	NM_005159	-		35083451	-1	no_errors	ENST00000290378	ensembl	human	known	74_37	missense	SNP	1.000	C
LOC101927648	101927648	genome.wustl.edu	37	1	143355633	143355633	+	lincRNA	SNP	G	G	T	rs12565701		TCGA-N1-A6IA-01A-12D-A32I-09	TCGA-N1-A6IA-11A-11D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	26f94549-f63a-4c0f-8c70-0341ea0f528f	29f71321-1ce9-42d2-8923-7528a4bff739	g.chr1:143355633G>T	ENST00000423249.1	-	0	1118				RP11-435B5.3_ENST00000430699.1_lincRNA																							GTCTGAATCAGATCAATCAGA	0.358																																																	0								ENSG00000185044																																			RP11-435B5.4			0			-	Clone_based_vega_gene																													1.37:g.143355633G>T		Somatic	0	25	0.00		0.586032912036718	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	24	25.00		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000423249.1	37	NULL		1																																																																																			-	-		0.358	RP11-435B5.4-002	KNOWN	not_best_in_genome_evidence|basic	lincRNA	LOC101927648	lincRNA	OTTHUMT00000037552.1	G		-		143355633	-1	no_errors	ENST00000423249	ensembl	human	known	74_37	rna	SNP	0.002	T
SPTBN5	51332	genome.wustl.edu	37	15	42153620	42153622	+	In_Frame_Del	DEL	TAG	TAG	-			TCGA-N1-A6IA-01A-12D-A32I-09	TCGA-N1-A6IA-11A-11D-A32I-09	TAG	TAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	26f94549-f63a-4c0f-8c70-0341ea0f528f	29f71321-1ce9-42d2-8923-7528a4bff739	g.chr15:42153620_42153622delTAG	ENST00000320955.6	-	46	8037_8039	c.7810_7812delCTA	c.(7810-7812)ctadel	p.L2604del		NM_016642.2	NP_057726.4	Q9NRC6	SPTN5_HUMAN	spectrin, beta, non-erythrocytic 5	2604					actin cytoskeleton organization (GO:0030036)|actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi organization (GO:0007030)|lysosomal transport (GO:0007041)|protein homooligomerization (GO:0051260)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|photoreceptor connecting cilium (GO:0032391)|photoreceptor disc membrane (GO:0097381)|spectrin (GO:0008091)	actin binding (GO:0003779)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|kinesin binding (GO:0019894)|myosin tail binding (GO:0032029)|protein self-association (GO:0043621)|spectrin binding (GO:0030507)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(6)|lung(18)|ovary(5)|prostate(8)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	62		all_cancers(109;1.84e-17)|all_epithelial(112;1.12e-15)|Lung NSC(122;7.6e-10)|all_lung(180;4.15e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		all cancers(2;4.33e-34)|Epithelial(2;1.72e-25)|OV - Ovarian serous cystadenocarcinoma(18;8.32e-20)|GBM - Glioblastoma multiforme(94;4.69e-07)|Colorectal(2;0.00104)|COAD - Colon adenocarcinoma(120;0.0405)|READ - Rectum adenocarcinoma(92;0.0908)		CACCTACCCATAGACCCTCACTG	0.552																																																	0								ENSG00000137877																																			SPTBN5	SO:0001651	inframe_deletion	0				HGNC	AF233523	CCDS61599.1	15q21	2010-08-17			ENSG00000137877	ENSG00000137877			15680	protein-coding gene	gene with protein product	"""beta V spectrin"""	605916				10764729	Standard	NM_016642		Approved	HUSPECV, BSPECV, HUBSPECV	uc001zos.4	Q9NRC6		ENST00000320955.6:c.7810_7812delCTA	15.37:g.42153620_42153622delTAG	ENSP00000317790:p.Leu2604del	Somatic	0	49	0.00		0.586032912036718	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	43	35.82		In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Spectrin_repeat,pfam_CH-domain,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Pleckstrin_homology,pfscan_CH-domain,pfscan_Pleckstrin_homology	p.L2604in_frame_del	ENST00000320955.6	37	c.7812_7810		15																																																																																			-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin		0.552	SPTBN5-001	KNOWN	basic|appris_principal	protein_coding	SPTBN5	protein_coding	OTTHUMT00000420237.1	TAG	NM_016642			42153622	-1	no_errors	ENST00000320955	ensembl	human	known	74_37	in_frame_del	DEL	0.010:0.006:0.003	-
RPL4	6124	genome.wustl.edu	37	15	66795818	66795818	+	Missense_Mutation	SNP	G	G	A			TCGA-N1-A6IA-01A-12D-A32I-09	TCGA-N1-A6IA-11A-11D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	26f94549-f63a-4c0f-8c70-0341ea0f528f	29f71321-1ce9-42d2-8923-7528a4bff739	g.chr15:66795818G>A	ENST00000307961.6	-	2	145	c.53C>T	c.(52-54)tCt>tTt	p.S18F	ZWILCH_ENST00000307897.5_5'Flank|ZWILCH_ENST00000535141.2_5'Flank|RPL4_ENST00000568588.1_5'UTR|SNORD18A_ENST00000363753.1_RNA|RPL4_ENST00000564517.1_5'Flank|SNORD18C_ENST00000362704.1_RNA|SNORD18B_ENST00000365659.1_RNA|ZWILCH_ENST00000565627.1_5'Flank|SNORD16_ENST00000362803.1_RNA|ZWILCH_ENST00000446801.2_5'Flank	NM_000968.3	NP_000959.2	P36578	RL4_HUMAN	ribosomal protein L4	18					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|skin(1)|stomach(1)|urinary_tract(1)	17						ATTTTTGCCAGATGACTCCCC	0.428																																																	0								ENSG00000174444						59.0	55.0	56.0					15																	66795818		2201	4299	6500	RPL4	SO:0001583	missense	0			-	HGNC	AB007167	CCDS10218.1	15q22	2011-04-06			ENSG00000174444	ENSG00000174444		"""L ribosomal proteins"""	10353	protein-coding gene	gene with protein product	"""60S ribosomal protein L4"""	180479				9582194, 8268230	Standard	NM_000968		Approved	L4	uc002apv.3	P36578	OTTHUMG00000133193	ENST00000307961.6:c.53C>T	15.37:g.66795818G>A	ENSP00000311430:p.Ser18Phe	Somatic	0	30	0.00		0.586032912036718	2246	0.09	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52	A8K502|P39029|Q4VBR0|Q969Z9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ribosomal_L4/L1e,superfamily_Ribosomal_L4_dom	p.S18F	ENST00000307961.6	37	c.53	CCDS10218.1	15	.	.	.	.	.	.	.	.	.	.	G	22.1	4.244157	0.79912	.	.	ENSG00000174444	ENST00000307961;ENST00000449253;ENST00000432669	.	.	.	4.51	4.51	0.55191	Ribosomal protein L4 domain (2);	0.160977	0.56097	D	0.000026	T	0.81083	0.4749	M	0.87547	2.89	0.80722	D	1	B;P	0.47910	0.231;0.902	B;P	0.54815	0.438;0.761	D	0.85229	0.1031	9	0.66056	D	0.02	-16.2514	17.4321	0.87542	0.0:0.0:1.0:0.0	.	18;18	B4DFI6;P36578	.;RL4_HUMAN	F	18	.	ENSP00000311430:S18F	S	-	2	0	RPL4	64582872	1.000000	0.71417	0.979000	0.43373	0.995000	0.86356	6.437000	0.73421	2.348000	0.79779	0.561000	0.74099	TCT	-	superfamily_Ribosomal_L4_dom		0.428	RPL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPL4	protein_coding	OTTHUMT00000256903.2	G	NM_000968	-		66795818	-1	no_errors	ENST00000307961	ensembl	human	known	74_37	missense	SNP	0.993	A
UXT	8409	genome.wustl.edu	37	X	47511493	47511493	+	Missense_Mutation	SNP	T	T	G			TCGA-N1-A6IA-01A-12D-A32I-09	TCGA-N1-A6IA-11A-11D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	26f94549-f63a-4c0f-8c70-0341ea0f528f	29f71321-1ce9-42d2-8923-7528a4bff739	g.chrX:47511493T>G	ENST00000333119.3	-	6	462	c.407A>C	c.(406-408)cAc>cCc	p.H136P	UXT_ENST00000335890.2_Missense_Mutation_p.H148P|UXT_ENST00000460840.1_5'UTR|ELK1_ENST00000343894.4_5'Flank|ELK1_ENST00000247161.3_5'Flank|ELK1_ENST00000468956.1_5'Flank|ELK1_ENST00000376983.3_5'Flank|ELK1_ENST00000592066.1_5'Flank	NM_004182.3	NP_004173.1	Q9UBK9	UXT_HUMAN	ubiquitously-expressed, prefoldin-like chaperone	136					centrosome organization (GO:0051297)|microtubule cytoskeleton organization (GO:0000226)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein folding (GO:0006457)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)|prefoldin complex (GO:0016272)	beta-tubulin binding (GO:0048487)|chromatin binding (GO:0003682)|microtubule binding (GO:0008017)|RNA polymerase II transcription corepressor activity (GO:0001106)			central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(1)	6						TAGCAACATGTGGATATGGGC	0.483																																																	0								ENSG00000126756						121.0	95.0	104.0					X																	47511493		2203	4300	6503	UXT	SO:0001583	missense	0			-	HGNC	AF092737	CCDS14284.1, CCDS14285.1	Xp11.23-p11.22	2011-11-21	2011-11-21		ENSG00000126756	ENSG00000126756			12641	protein-coding gene	gene with protein product	"""androgen receptor trapped clone 27"", ""SKP2-associated alpha PFD 1"""	300234	"""ubiquitously-expressed transcript"""			10087202, 16221885	Standard	NM_004182		Approved	ART-27, STAP1	uc004dim.3	Q9UBK9	OTTHUMG00000021453	ENST00000333119.3:c.407A>C	X.37:g.47511493T>G	ENSP00000327797:p.His136Pro	Somatic	0	73	0.00		0.586032912036718	652	0.46	3	WXS	Illumina HiSeq 2500	Phase_IV	tier1	43	53	44.79	B2R561|Q5JZG3|Q9Y6E5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prefoldin_subunit_alpha,superfamily_Prefoldin,prints_PFD_UXT	p.H148P	ENST00000333119.3	37	c.443	CCDS14285.1	X	.	.	.	.	.	.	.	.	.	.	-	16.37	3.104620	0.56291	.	.	ENSG00000126756	ENST00000333119;ENST00000335890	T;T	0.42513	0.97;0.97	5.43	4.3	0.51218	Prefoldin (1);Prefoldin subunit (1);	0.139088	0.48767	D	0.000170	T	0.24236	0.0587	N	0.14661	0.345	0.31651	N	0.646846	P	0.46784	0.884	B	0.42959	0.403	T	0.26326	-1.0106	10	0.59425	D	0.04	-12.3737	4.0931	0.09978	0.0:0.1949:0.0:0.8051	.	136	Q9UBK9	UXT_HUMAN	P	136;148	ENSP00000327797:H136P;ENSP00000337393:H148P	ENSP00000327797:H136P	H	-	2	0	UXT	47396437	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.336000	0.43938	1.819000	0.53055	0.483000	0.47432	CAC	-	pfam_Prefoldin_subunit_alpha,superfamily_Prefoldin,prints_PFD_UXT		0.483	UXT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UXT	protein_coding	OTTHUMT00000056440.1	T	NM_153477	-		47511493	-1	no_errors	ENST00000335890	ensembl	human	known	74_37	missense	SNP	1.000	G
ANKRD30BP2	149992	genome.wustl.edu	37	21	14424331	14424331	+	IGR	SNP	T	T	C			TCGA-N1-A6IA-01A-12D-A32I-09	TCGA-N1-A6IA-11A-11D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	26f94549-f63a-4c0f-8c70-0341ea0f528f	29f71321-1ce9-42d2-8923-7528a4bff739	g.chr21:14424331T>C								RNU6-614P (4321 upstream) : AL050302.1 (317599 downstream)																							aatatgtcagtatgttcagct	0.388																																																	0								ENSG00000224309																																			ANKRD30BP2	SO:0001628	intergenic_variant	0			-	HGNC																													21.37:g.14424331T>C		Somatic	0	153	0.00		0.586032912036718	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	32	117	21.48		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL		37	NULL		21																																																																																			-	-	0	0.388					ANKRD30BP2			T		-		14424331	+1	no_errors	ENST00000471407	ensembl	human	known	74_37	rna	SNP	0.095	C
PRDM11	56981	genome.wustl.edu	37	11	45117420	45117420	+	Missense_Mutation	SNP	T	T	A			TCGA-N1-A6IA-01A-12D-A32I-09	TCGA-N1-A6IA-11A-11D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	26f94549-f63a-4c0f-8c70-0341ea0f528f	29f71321-1ce9-42d2-8923-7528a4bff739	g.chr11:45117420T>A	ENST00000530656.1	+	1	64	c.64T>A	c.(64-66)Tgc>Agc	p.C22S	PRDM11_ENST00000263765.4_Missense_Mutation_p.C22S			Q9NQV5	PRD11_HUMAN	PR domain containing 11	22							methyltransferase activity (GO:0008168)			endometrium(3)|kidney(3)|large_intestine(5)|lung(10)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	26						ctgcctgagatgctcacctct	0.527																																					NSCLC(118;1511 1736 6472 36603 43224)												0								ENSG00000019485						140.0	113.0	122.0					11																	45117420		2203	4299	6502	PRDM11	SO:0001583	missense	0			-	HGNC	AF275818	CCDS58130.1, CCDS73277.1	11p11	2008-07-21			ENSG00000019485	ENSG00000019485			13996	protein-coding gene	gene with protein product	"""PR-domain containing protein 11"""						Standard	NM_001256695		Approved	PFM8	uc031qab.1	Q9NQV5	OTTHUMG00000166478	ENST00000530656.1:c.64T>A	11.37:g.45117420T>A	ENSP00000435976:p.Cys22Ser	Somatic	0	39	0.00		0.586032912036718	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	22	46.34	Q8N9F1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfscan_SET_dom	p.C22S	ENST00000530656.1	37	c.64		11	.	.	.	.	.	.	.	.	.	.	T	6.374	0.437132	0.12104	.	.	ENSG00000019485	ENST00000263765;ENST00000530656	T;T	0.41400	1.0;1.0	2.93	-3.1	0.05315	.	.	.	.	.	T	0.17195	0.0413	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.17623	-1.0363	9	0.87932	D	0	.	0.4157	0.00448	0.3678:0.1234:0.1877:0.3211	.	22	Q9NQV5	PRD11_HUMAN	S	22	ENSP00000263765:C22S;ENSP00000435976:C22S	ENSP00000263765:C22S	C	+	1	0	PRDM11	45073996	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	-1.037000	0.03557	-0.677000	0.05231	0.459000	0.35465	TGC	-	NULL		0.527	PRDM11-001	KNOWN	basic|appris_candidate_longest	protein_coding	PRDM11	protein_coding	OTTHUMT00000389928.1	T	NM_020229	-		45117420	+1	no_errors	ENST00000263765	ensembl	human	known	74_37	missense	SNP	0.000	A
NTN1	9423	genome.wustl.edu	37	17	9083207	9083207	+	Missense_Mutation	SNP	G	G	C			TCGA-N1-A6IA-01A-12D-A32I-09	TCGA-N1-A6IA-11A-11D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	26f94549-f63a-4c0f-8c70-0341ea0f528f	29f71321-1ce9-42d2-8923-7528a4bff739	g.chr17:9083207G>C	ENST00000173229.2	+	4	1398	c.1291G>C	c.(1291-1293)Ggt>Cgt	p.G431R	RP11-85B7.2_ENST00000574307.2_RNA|NTN1_ENST00000546090.1_Missense_Mutation_p.G431R|NTN1_ENST00000538852.1_Missense_Mutation_p.G431R	NM_004822.2	NP_004813.2	O95631	NET1_HUMAN	netrin 1	431	Laminin EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00460}.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|establishment of nucleus localization (GO:0040023)|inner ear morphogenesis (GO:0042472)|mammary gland duct morphogenesis (GO:0060603)|negative regulation of axon extension (GO:0030517)|neuron migration (GO:0001764)|positive regulation of axon extension (GO:0045773)|positive regulation of cell proliferation (GO:0008284)|regulation of cell migration (GO:0030334)|single organismal cell-cell adhesion (GO:0016337)	basement membrane (GO:0005604)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)			NTN1/ACLY(2)	central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(5)|lung(5)	13						CGGCGTGACGGGTATCACCTG	0.592																																																	0								ENSG00000065320						73.0	62.0	66.0					17																	9083207		2203	4300	6503	NTN1	SO:0001583	missense	0			-	HGNC	U75586	CCDS11148.1	17p13-p12	2013-03-01			ENSG00000065320	ENSG00000065320		"""Netrins"""	8029	protein-coding gene	gene with protein product	"""Netrin-1"""	601614				9950216	Standard	NM_004822		Approved	NTN1L	uc002glw.4	O95631	OTTHUMG00000130257	ENST00000173229.2:c.1291G>C	17.37:g.9083207G>C	ENSP00000173229:p.Gly431Arg	Somatic	0	48	0.00		0.586032912036718	50	24.24	16	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	54	14.29	E9KL51	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Laminin_N,pfam_Netrin_module_non-TIMP,pfam_EGF_laminin,superfamily_TIMP-like_OB-fold,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,smart_Netrin_module_non-TIMP,pfscan_EGF_laminin,pfscan_Laminin_N,pfscan_Netrin_domain	p.G431R	ENST00000173229.2	37	c.1291	CCDS11148.1	17	.	.	.	.	.	.	.	.	.	.	G	33	5.205698	0.95033	.	.	ENSG00000065320	ENST00000173229;ENST00000538852;ENST00000546090;ENST00000436734	D;D;D;D	0.85629	-2.01;-2.01;-2.01;-2.01	5.88	5.88	0.94601	EGF-like, laminin (4);EGF-like region, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.95370	0.8497	H	0.96015	3.755	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.95822	0.8850	10	0.62326	D	0.03	.	20.2228	0.98330	0.0:0.0:1.0:0.0	.	431	O95631	NET1_HUMAN	R	431;431;431;51	ENSP00000173229:G431R;ENSP00000443259:G431R;ENSP00000441611:G431R;ENSP00000389375:G51R	ENSP00000173229:G431R	G	+	1	0	NTN1	9023932	1.000000	0.71417	0.998000	0.56505	0.984000	0.73092	9.471000	0.97696	2.789000	0.95967	0.655000	0.94253	GGT	-	pfam_EGF_laminin,smart_EGF_laminin,pfscan_EGF_laminin		0.592	NTN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NTN1	protein_coding	OTTHUMT00000252583.1	G		-		9083207	+1	no_errors	ENST00000173229	ensembl	human	known	74_37	missense	SNP	1.000	C
BX119917.1	0	genome.wustl.edu	37	X	71372202	71372209	+	RNA	DEL	CGCGCGCA	CGCGCGCA	-	rs6625958|rs72357649|rs72197346|rs59980083|rs6625957|rs200056633|rs10856127		TCGA-N1-A6IA-01A-12D-A32I-09	TCGA-N1-A6IA-11A-11D-A32I-09	CGCGCGCA	CGCGCGCA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	26f94549-f63a-4c0f-8c70-0341ea0f528f	29f71321-1ce9-42d2-8923-7528a4bff739	g.chrX:71372202_71372209delCGCGCGCA	ENST00000401114.1	-	0	55_62																											TGTGCATGCGCGCGCGcacacacacaca	0.495																																																	0								ENSG00000215933																																			BX119917.1			0				Clone_based_ensembl_gene																													X.37:g.71372202_71372209delCGCGCGCA		Somatic	NA	NA	NA		0.586032912036718	37	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000401114.1	37	NULL		X																																																																																			-	-		0.495	BX119917.1-201	NOVEL	basic	miRNA	ENSG00000215933	miRNA		CGCGCGCA				71372209	-1	no_errors	ENST00000401114	ensembl	human	novel	74_37	rna	DEL	0.000:0.000:0.000:0.000:0.000:0.001:0.015:0.009	-
LOC645752	645752	genome.wustl.edu	37	15	78208175	78208175	+	lincRNA	SNP	C	C	A			TCGA-N1-A6IA-01A-12D-A32I-09	TCGA-N1-A6IA-11A-11D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	26f94549-f63a-4c0f-8c70-0341ea0f528f	29f71321-1ce9-42d2-8923-7528a4bff739	g.chr15:78208175C>A	ENST00000565869.1	+	0	0				RP11-114H24.2_ENST00000567226.1_RNA|RN7SL214P_ENST00000487317.2_RNA																							TCACTCATGCCATCTGTCACT	0.617																																																	0								ENSG00000260776																																			RP11-114H24.2			0			-	Clone_based_vega_gene																													15.37:g.78208175C>A		Somatic	0	159	0.00		0.586032912036718	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	47	119	28.31		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000565869.1	37	NULL		15																																																																																			-	-		0.617	RP11-114H24.7-001	KNOWN	basic	lincRNA	LOC645752	lincRNA	OTTHUMT00000421587.1	C		-		78208175	-1	no_errors	ENST00000563349	ensembl	human	known	74_37	rna	SNP	1.000	A
HTR1E	3354	genome.wustl.edu	37	6	87725415	87725415	+	Silent	SNP	C	C	T			TCGA-N1-A6IA-01A-12D-A32I-09	TCGA-N1-A6IA-11A-11D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	26f94549-f63a-4c0f-8c70-0341ea0f528f	29f71321-1ce9-42d2-8923-7528a4bff739	g.chr6:87725415C>T	ENST00000305344.5	+	2	1066	c.363C>T	c.(361-363)taC>taT	p.Y121Y		NM_000865.2	NP_000856.1	P28566	5HT1E_HUMAN	5-hydroxytryptamine (serotonin) receptor 1E, G protein-coupled	121					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of cAMP metabolic process (GO:0030815)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)			breast(3)|endometrium(2)|kidney(3)|large_intestine(11)|lung(15)|ovary(2)|prostate(2)|skin(3)	41		all_cancers(76;7.11e-06)|Acute lymphoblastic leukemia(125;1.2e-09)|Prostate(29;3.51e-09)|all_hematologic(105;7.43e-06)|all_epithelial(107;0.00819)		BRCA - Breast invasive adenocarcinoma(108;0.055)	Aripiprazole(DB01238)|Clozapine(DB00363)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Ketamine(DB01221)|Loxapine(DB00408)|Methysergide(DB00247)|Olanzapine(DB00334)|Quetiapine(DB01224)|Ziprasidone(DB00246)	TGGACAGGTACTGGGCCATCA	0.557																																																	0								ENSG00000168830						110.0	88.0	95.0					6																	87725415		2203	4300	6503	HTR1E	SO:0001819	synonymous_variant	0			-	HGNC		CCDS5006.1	6q14-q15	2013-06-19	2012-02-03		ENSG00000168830	ENSG00000168830		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5291	protein-coding gene	gene with protein product		182132	"""5-hydroxytryptamine (serotonin) receptor 1E"""			1608964	Standard	NM_000865		Approved	5-HT1E	uc003pli.3	P28566	OTTHUMG00000015154	ENST00000305344.5:c.363C>T	6.37:g.87725415C>T		Somatic	0	33	0.00		0.586032912036718	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	19	29.63	E1P503|Q9P1Y1	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_5HT_rcpt	p.Y121	ENST00000305344.5	37	c.363	CCDS5006.1	6																																																																																			-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.557	HTR1E-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HTR1E	protein_coding	OTTHUMT00000472488.2	C	NM_000865	-		87725415	+1	no_errors	ENST00000305344	ensembl	human	known	74_37	silent	SNP	1.000	T
DAND5	199699	genome.wustl.edu	37	19	13084213	13084213	+	Missense_Mutation	SNP	G	G	C	rs576727348		TCGA-N1-A6IA-01A-12D-A32I-09	TCGA-N1-A6IA-11A-11D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	26f94549-f63a-4c0f-8c70-0341ea0f528f	29f71321-1ce9-42d2-8923-7528a4bff739	g.chr19:13084213G>C	ENST00000317060.2	+	2	514	c.335G>C	c.(334-336)cGg>cCg	p.R112P	DAND5_ENST00000585548.1_3'UTR	NM_152654.2	NP_689867.1	Q8N907	DAND5_HUMAN	DAN domain family member 5, BMP antagonist	112	CTCK.				atrial septum development (GO:0003283)|determination of heart left/right asymmetry (GO:0061371)|determination of left/right asymmetry in lateral mesoderm (GO:0003140)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of nodal signaling pathway (GO:1900108)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|sequestering of nodal from receptor via nodal binding (GO:0038101)|ventricular septum development (GO:0003281)	extracellular region (GO:0005576)	morphogen activity (GO:0016015)	p.R112L(1)		kidney(2)|lung(3)|ovary(1)	6			OV - Ovarian serous cystadenocarcinoma(19;1.87e-18)			GTGTTCTCCCGGCCCGGCTGC	0.622																																																	1	Substitution - Missense(1)	lung(1)						ENSG00000179284						84.0	83.0	84.0					19																	13084213		2203	4300	6503	DAND5	SO:0001583	missense	0			-	HGNC	AK095926	CCDS12291.1	19p13	2013-02-26	2013-02-26			ENSG00000179284			26780	protein-coding gene	gene with protein product		609068	"""DAN domain family, member 5"""			15254711	Standard	NM_152654		Approved	FLJ38607, CKTSF1B3, DANTE, GREM3, CER2, DTE	uc002mwc.1	Q8N907		ENST00000317060.2:c.335G>C	19.37:g.13084213G>C	ENSP00000323155:p.Arg112Pro	Somatic	0	22	0.00		0.586032912036718	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	28	22.22		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DAN,pirsf_Cerberus	p.R112P	ENST00000317060.2	37	c.335	CCDS12291.1	19	.	.	.	.	.	.	.	.	.	.	G	11.22	1.575109	0.28092	.	.	ENSG00000179284	ENST00000317060	T	0.30714	1.52	5.94	1.33	0.21861	DAN (1);	0.739627	0.11567	N	0.551209	T	0.40423	0.1116	L	0.50333	1.59	0.09310	N	1	D	0.71674	0.998	D	0.64776	0.929	T	0.17501	-1.0367	10	0.37606	T	0.19	-11.0784	4.4983	0.11851	0.2523:0.0:0.5956:0.1521	.	112	Q8N907	DAND5_HUMAN	P	112	ENSP00000323155:R112P	ENSP00000323155:R112P	R	+	2	0	DAND5	12945213	0.047000	0.20315	0.000000	0.03702	0.136000	0.21042	0.414000	0.21164	0.091000	0.17302	0.655000	0.94253	CGG	-	pfam_DAN,pirsf_Cerberus		0.622	DAND5-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	DAND5	protein_coding	OTTHUMT00000452761.1	G	NM_152654	-		13084213	+1	no_errors	ENST00000317060	ensembl	human	known	74_37	missense	SNP	0.009	C
CD82	3732	genome.wustl.edu	37	11	44626780	44626782	+	Intron	DEL	GCC	GCC	-			TCGA-N1-A6IA-01A-12D-A32I-09	TCGA-N1-A6IA-11A-11D-A32I-09	GCC	GCC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	26f94549-f63a-4c0f-8c70-0341ea0f528f	29f71321-1ce9-42d2-8923-7528a4bff739	g.chr11:44626780_44626782delGCC	ENST00000227155.4	+	5	509				RP11-58K22.5_ENST00000533814.1_RNA|RP11-58K22.4_ENST00000532524.1_RNA|CD82_ENST00000342935.3_Intron|CD82_ENST00000530931.1_Intron	NM_002231.3	NP_002222.1	P27701	CD82_HUMAN	CD82 molecule							extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				large_intestine(1)|ovary(1)	2						CTCTCATCCAGCCGAGTGCAGCC	0.675																																																	0								ENSG00000254693																																			RP11-58K22.5	SO:0001627	intron_variant	0				Clone_based_vega_gene	U20770	CCDS7909.1, CCDS31469.1	11p11.2	2013-02-14	2006-03-28	2005-03-03		ENSG00000085117		"""CD molecules"", ""Tetraspanins"""	6210	protein-coding gene	gene with protein product	"""suppression of tumorigenicity 6"", ""R2 leukocyte antigen"""	600623	"""kangai 1 (suppression of tumorigenicity 6, prostate; CD82 antigen (R2 leukocyte antigen, antigen detected by monoclonal and antibody IA4))"", ""CD82 antigen"""	ST6, KAI1			Standard	XM_006718222		Approved	R2, IA4, TSPAN27	uc001myc.3	P27701		ENST00000227155.4:c.261+48GCC>-	11.37:g.44626780_44626782delGCC		Somatic	0	26	0.00		0.586032912036718	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	11	54.17	D3DQN6|E9PC70|Q7Z2D4|Q7Z5N2	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000227155.4	37	NULL	CCDS7909.1	11																																																																																			-	-		0.675	CD82-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000254693	protein_coding	OTTHUMT00000389886.1	GCC				44626782	-1	no_errors	ENST00000533814	ensembl	human	known	74_37	rna	DEL	0.000:0.000:0.000	-
PTMA	5757	genome.wustl.edu	37	2	232577666	232577666	+	3'UTR	SNP	A	A	G			TCGA-N1-A6IA-01A-12D-A32I-09	TCGA-N1-A6IA-11A-11D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	26f94549-f63a-4c0f-8c70-0341ea0f528f	29f71321-1ce9-42d2-8923-7528a4bff739	g.chr2:232577666A>G	ENST00000341369.7	+	0	632				PTMA_ENST00000409321.1_3'UTR|PTMA_ENST00000409683.1_3'UTR|PTMA_ENST00000466801.1_3'UTR|PTMA_ENST00000409115.3_3'UTR	NM_001099285.1	NP_001092755.1	P06454	PTMA_HUMAN	prothymosin, alpha						transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)				lung(3)|ovary(1)|prostate(1)|skin(1)	6		Renal(207;0.0112)|all_hematologic(139;0.0315)|Acute lymphoblastic leukemia(138;0.0921)|all_lung(227;0.142)		Epithelial(121;1.75e-12)|BRCA - Breast invasive adenocarcinoma(100;0.00221)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.0139)		TCGAGTAGAGAGGCCCGCCCG	0.522																																																	0								ENSG00000187514																																			PTMA	SO:0001624	3_prime_UTR_variant	0			-	HGNC		CCDS42833.1, CCDS46541.1	2q37.1	2008-07-04	2008-04-03		ENSG00000187514	ENSG00000187514			9623	protein-coding gene	gene with protein product	"""gene sequence 28"""	188390	"""prothymosin, alpha (gene sequence 28)"""	TMSA		1612591	Standard	NM_002823		Approved		uc002vsc.4	P06454	OTTHUMG00000153810	ENST00000341369.7:c.*105A>G	2.37:g.232577666A>G		Somatic	0	60	0.00		0.586032912036718	1670	0.59	10	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	35	14.63	Q15249|Q15592	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000341369.7	37	NULL	CCDS42833.1	2																																																																																			-	-		0.522	PTMA-002	KNOWN	basic|CCDS	protein_coding	PTMA	protein_coding	OTTHUMT00000332553.1	A		-		232577666	+1	no_errors	ENST00000466801	ensembl	human	known	74_37	rna	SNP	0.836	G
IRF6	3664	genome.wustl.edu	37	1	209969876	209969876	+	Nonsense_Mutation	SNP	T	T	A			TCGA-N1-A6IA-01A-12D-A32I-09	TCGA-N1-A6IA-11A-11D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	26f94549-f63a-4c0f-8c70-0341ea0f528f	29f71321-1ce9-42d2-8923-7528a4bff739	g.chr1:209969876T>A	ENST00000367021.3	-	4	368	c.196A>T	c.(196-198)Aag>Tag	p.K66*	IRF6_ENST00000542854.1_5'UTR	NM_006147.3	NP_006138.1	O14896	IRF6_HUMAN	interferon regulatory factor 6	66			K -> T (in PPS). {ECO:0000269|PubMed:12219090}.		cell cycle arrest (GO:0007050)|cell development (GO:0048468)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|keratinocyte differentiation (GO:0030216)|keratinocyte proliferation (GO:0043616)|mammary gland epithelial cell differentiation (GO:0060644)|negative regulation of cell proliferation (GO:0008285)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|large_intestine(4)|lung(12)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	28				OV - Ovarian serous cystadenocarcinoma(81;0.0351)		TCCTGGTACTTCCCTGTCTCT	0.512										HNSCC(57;0.16)																																							0								ENSG00000117595						84.0	60.0	68.0					1																	209969876		2203	4300	6503	IRF6	SO:0001587	stop_gained	0			-	HGNC	AL022398	CCDS1492.1, CCDS55681.1	1q32.2-q32.3	2011-02-10			ENSG00000117595	ENSG00000117595			6121	protein-coding gene	gene with protein product		607199	"""Van der Woude syndrome"""	VWS, LPS		12219090	Standard	NM_006147		Approved	OFC6, VWS1	uc001hhq.2	O14896	OTTHUMG00000036521	ENST00000367021.3:c.196A>T	1.37:g.209969876T>A	ENSP00000355988:p.Lys66*	Somatic	0	40	0.00		0.586032912036718	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	29	32.56	B4DLE2|D3DT90|F5GWX8|G0ZTL0	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Interferon_reg_factor-3,pfam_Interferon_reg_fact_DNA-bd_dom,superfamily_SMAD_FHA_domain,smart_Interferon_reg_fact_DNA-bd_dom,prints_Interferon_reg_fact_DNA-bd_dom	p.K66*	ENST00000367021.3	37	c.196	CCDS1492.1	1	.	.	.	.	.	.	.	.	.	.	T	38	7.054665	0.98032	.	.	ENSG00000117595	ENST00000367021;ENST00000456314	.	.	.	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.87	0.79108	0.0:0.0:0.0:1.0	.	.	.	.	X	66	.	.	K	-	1	0	IRF6	208036499	1.000000	0.71417	0.963000	0.40424	0.996000	0.88848	7.516000	0.81772	2.145000	0.66743	0.533000	0.62120	AAG	-	pfam_Interferon_reg_fact_DNA-bd_dom,smart_Interferon_reg_fact_DNA-bd_dom,prints_Interferon_reg_fact_DNA-bd_dom		0.512	IRF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRF6	protein_coding	OTTHUMT00000088827.1	T	NM_006147	-		209969876	-1	no_errors	ENST00000367021	ensembl	human	known	74_37	nonsense	SNP	1.000	A
PNPT1	87178	genome.wustl.edu	37	2	55882064	55882064	+	Frame_Shift_Del	DEL	C	C	-			TCGA-N1-A6IA-01A-12D-A32I-09	TCGA-N1-A6IA-11A-11D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	26f94549-f63a-4c0f-8c70-0341ea0f528f	29f71321-1ce9-42d2-8923-7528a4bff739	g.chr2:55882064delC	ENST00000447944.2	-	18	1552	c.1466delG	c.(1465-1467)tgtfs	p.C489fs		NM_033109.3	NP_149100.2	Q8TCS8	PNPT1_HUMAN	polyribonucleotide nucleotidyltransferase 1	489					cellular response to interferon-beta (GO:0035458)|cellular response to oxidative stress (GO:0034599)|mitochondrial mRNA catabolic process (GO:0000958)|mitochondrial mRNA polyadenylation (GO:0097222)|mitochondrial RNA 3'-end processing (GO:0000965)|mitochondrial RNA 5'-end processing (GO:0000964)|mitochondrial RNA catabolic process (GO:0000957)|mitochondrion morphogenesis (GO:0070584)|mitotic cell cycle arrest (GO:0071850)|mRNA catabolic process (GO:0006402)|negative regulation of growth (GO:0045926)|nuclear polyadenylation-dependent mRNA catabolic process (GO:0071042)|positive regulation of miRNA catabolic process (GO:2000627)|positive regulation of mitochondrial RNA catabolic process (GO:0000962)|positive regulation of mRNA catabolic process (GO:0061014)|protein homooligomerization (GO:0051260)|protein homotrimerization (GO:0070207)|regulation of cellular respiration (GO:0043457)|regulation of cellular senescence (GO:2000772)|RNA catabolic process (GO:0006401)|RNA import into mitochondrion (GO:0035927)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|RNA polyadenylation (GO:0043631)|rRNA import into mitochondrion (GO:0035928)	cytoplasm (GO:0005737)|membrane (GO:0016020)|mitochondrial degradosome (GO:0045025)|mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)	3'-5'-exoribonuclease activity (GO:0000175)|miRNA binding (GO:0035198)|poly(A) RNA binding (GO:0044822)|poly(G) binding (GO:0034046)|poly(U) RNA binding (GO:0008266)|polyribonucleotide nucleotidyltransferase activity (GO:0004654)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(10)|lung(9)|skin(2)|urinary_tract(1)	27			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			ACTTCCGCCACATGCAGATGC	0.363																																																	0								ENSG00000138035						77.0	83.0	81.0					2																	55882064		2203	4300	6503	PNPT1	SO:0001589	frameshift_variant	0				HGNC	BC053660	CCDS1856.1	2p15	2013-01-08			ENSG00000138035	ENSG00000138035			23166	protein-coding gene	gene with protein product	"""polynucleotide phosphorylase"", ""3'-5' RNA exonuclease"""	610316	"""deafness, autosomal recessive 70"""	DFNB70		12419256	Standard	NM_033109		Approved	PNPase, OLD35, old-35	uc002rzf.3	Q8TCS8	OTTHUMG00000129335	ENST00000447944.2:c.1466delG	2.37:g.55882064delC	ENSP00000400646:p.Cys489fs	Somatic	0	44	0.00		0.586032912036718	86	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	48	18.64	Q53SU0|Q68CN1|Q7Z7D1|Q8IWX1|Q96T05|Q9BRU3|Q9BVX0	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_ExoRNase_PH_dom1,pfam_ExoRNase_PH_dom2,pfam_PNPase_PH_RNA-bd_bac/org-type,pfam_KH_dom_type_1,pfam_Rbsml_prot_S1_RNA-bd_dom,superfamily_Ribosomal_S5_D2-typ_fold,superfamily_ExoRNase_PH_dom2,superfamily_PNPase_PH_RNA-bd_bac/org-type,superfamily_NA-bd_OB-fold,smart_KH_dom,smart_RNA-binding_domain_S1,pirsf_PNPase,pfscan_KH_dom_type_1,pfscan_Rbsml_prot_S1_RNA-bd_dom,tigrfam_PNPase	p.C489fs	ENST00000447944.2	37	c.1466	CCDS1856.1	2																																																																																			-	pfam_ExoRNase_PH_dom1,superfamily_Ribosomal_S5_D2-typ_fold,pirsf_PNPase,tigrfam_PNPase		0.363	PNPT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PNPT1	protein_coding	OTTHUMT00000251481.2	C	NM_033109			55882064	-1	no_errors	ENST00000415374	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
RNF170	81790	genome.wustl.edu	37	8	42725241	42725241	+	Silent	SNP	G	G	T			TCGA-N1-A6IA-01A-12D-A32I-09	TCGA-N1-A6IA-11A-11D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	26f94549-f63a-4c0f-8c70-0341ea0f528f	29f71321-1ce9-42d2-8923-7528a4bff739	g.chr8:42725241G>T	ENST00000534961.1	-	4	704	c.228C>A	c.(226-228)gcC>gcA	p.A76A	RNF170_ENST00000319073.4_Missense_Mutation_p.P5Q|RNF170_ENST00000526349.1_5'UTR|RNF170_ENST00000319104.3_Silent_p.A76A|RNF170_ENST00000527424.1_Silent_p.A76A	NM_001160223.1	NP_001153695.1	Q96K19	RN170_HUMAN	ring finger protein 170	76					protein ubiquitination (GO:0016567)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.A76A(1)		lung(3)	3	all_lung(13;1.25e-11)|Lung NSC(13;3.55e-10)|Ovarian(28;0.01)|Prostate(17;0.0119)|Lung SC(25;0.184)	all_lung(54;0.00645)|Lung NSC(58;0.0176)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	Lung(22;0.048)|LUSC - Lung squamous cell carcinoma(45;0.114)			GCTGTCGAGTGGCAGCAGGTG	0.473																																																	1	Substitution - coding silent(1)	lung(1)						ENSG00000120925						112.0	95.0	101.0					8																	42725241		2203	4300	6503	RNF170	SO:0001819	synonymous_variant	0			-	HGNC	AL136620	CCDS6138.1, CCDS55229.1, CCDS55230.1	8p11.21	2014-01-29				ENSG00000120925		"""RING-type (C3HC4) zinc fingers"""	25358	protein-coding gene	gene with protein product		614649	"""sensory ataxia 1 (autosomal dominant)"""	SNAX1		11230166, 21115467	Standard	NR_027668		Approved	DKFZP564A022, ADSA	uc003xpm.3	Q96K19		ENST00000534961.1:c.228C>A	8.37:g.42725241G>T		Somatic	0	44	0.00		0.586032912036718	13	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	56	8.20	D3DSY6|E9PIL4|Q7Z483|Q86YC0|Q8IXR7|Q8N2B5|Q8N5G9|Q8NG30|Q9H0V6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF1232	p.P5Q	ENST00000534961.1	37	c.14	CCDS6138.1	8	.	.	.	.	.	.	.	.	.	.	G	8.987	0.976742	0.18812	.	.	ENSG00000120925	ENST00000319073	T	0.80123	-1.34	5.63	-4.95	0.03048	.	.	.	.	.	T	0.63757	0.2538	.	.	.	0.09310	N	1	B	0.26258	0.145	B	0.21151	0.033	T	0.51301	-0.8723	8	0.51188	T	0.08	-0.2731	3.9045	0.09176	0.4068:0.1082:0.3802:0.1048	.	5	Q96K19-4	.	Q	5	ENSP00000325969:P5Q	ENSP00000325969:P5Q	P	-	2	0	RNF170	42844398	0.002000	0.14202	0.000000	0.03702	0.002000	0.02628	-0.041000	0.12084	-0.781000	0.04548	-1.934000	0.00508	CCA	-	NULL		0.473	RNF170-202	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF170	protein_coding	OTTHUMT00000383166.1	G	NM_030954	-		42725241	-1	no_errors	ENST00000319073	ensembl	human	known	74_37	missense	SNP	0.000	T
TP53	7157	genome.wustl.edu	37	17	7578284	7578284	+	Frame_Shift_Del	DEL	C	C	-			TCGA-N1-A6IA-01A-12D-A32I-09	TCGA-N1-A6IA-11A-11D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	26f94549-f63a-4c0f-8c70-0341ea0f528f	29f71321-1ce9-42d2-8923-7528a4bff739	g.chr17:7578284delC	ENST00000269305.4	-	6	754	c.565delG	c.(565-567)gccfs	p.A189fs	TP53_ENST00000574684.1_Intron|TP53_ENST00000445888.2_Frame_Shift_Del_p.A189fs|TP53_ENST00000413465.2_Frame_Shift_Del_p.A189fs|TP53_ENST00000420246.2_Frame_Shift_Del_p.A189fs|TP53_ENST00000455263.2_Frame_Shift_Del_p.A189fs|TP53_ENST00000359597.4_Frame_Shift_Del_p.A189fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	189	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		A -> D (in a sporadic cancer; somatic mutation).|A -> G (in sporadic cancers; somatic mutation).|A -> P (in sporadic cancers; somatic mutation).|A -> S (in a sporadic cancer; somatic mutation).|A -> T (in sporadic cancers; somatic mutation).|A -> V (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.A189_V197delAPPQHLIRV(4)|p.A189T(3)|p.G187fs*16(2)|p.A189P(2)|p.A189fs*19(1)|p.D186_P191delDGLAPP(1)|p.?(1)|p.A189S(1)|p.A189fs*58(1)|p.G187fs*64(1)|p.L188_P191del(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TGAGGAGGGGCCAGACCTAAG	0.547		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	26	Whole gene deletion(8)|Deletion - In frame(6)|Substitution - Missense(6)|Deletion - Frameshift(4)|Complex - frameshift(1)|Unknown(1)	skin(4)|bone(4)|large_intestine(3)|liver(3)|ovary(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|breast(2)|stomach(1)|haematopoietic_and_lymphoid_tissue(1)|lung(1)						ENSG00000141510						87.0	78.0	81.0					17																	7578284		2203	4300	6503	TP53	SO:0001589	frameshift_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;		HGNC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.565delG	17.37:g.7578284delC	ENSP00000269305:p.Ala189fs	Somatic	0	78	0.00		0.586032912036718	27	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	59	18	76.62	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.A189fs	ENST00000269305.4	37	c.565	CCDS11118.1	17																																																																																			-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd		0.547	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	C	NM_000546			7578284	-1	no_errors	ENST00000269305	ensembl	human	known	74_37	frame_shift_del	DEL	0.997	-
MACF1	23499	genome.wustl.edu	37	1	39888564	39888564	+	Nonsense_Mutation	SNP	G	G	T			TCGA-N1-A6IA-01A-12D-A32I-09	TCGA-N1-A6IA-11A-11D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	26f94549-f63a-4c0f-8c70-0341ea0f528f	29f71321-1ce9-42d2-8923-7528a4bff739	g.chr1:39888564G>T	ENST00000372915.3	+	59	16243	c.16156G>T	c.(16156-16158)Gaa>Taa	p.E5386*	MACF1_ENST00000539005.1_Nonsense_Mutation_p.E3298*|MACF1_ENST00000317713.7_Nonsense_Mutation_p.E3319*|MACF1_ENST00000567887.1_Nonsense_Mutation_p.E5418*|MACF1_ENST00000564288.1_Nonsense_Mutation_p.E5381*|MACF1_ENST00000545844.1_Nonsense_Mutation_p.E3319*|MACF1_ENST00000289893.4_Nonsense_Mutation_p.E3821*|MACF1_ENST00000361689.2_Nonsense_Mutation_p.E3319*			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	5386					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			ACAGATCCAAGAACAGAAGGT	0.453																																																	0								ENSG00000127603						61.0	61.0	61.0					1																	39888564		2203	4300	6503	MACF1	SO:0001587	stop_gained	0			-	HGNC	AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.16156G>T	1.37:g.39888564G>T	ENSP00000362006:p.Glu5386*	Somatic	0	54	0.00		0.586032912036718	61	6.15	4	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	41	24.07	B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Spectrin_repeat,pfam_CH-domain,pfam_GAS2_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_GAS2_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_EF_hand_dom,smart_GAS2_dom,pfscan_CH-domain,pfscan_EF_hand_dom	p.E3319*	ENST00000372915.3	37	c.9955		1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	49|49	14.981501|14.981501	0.99818|0.99818	.|.	.|.	ENSG00000127603|ENSG00000127603	ENST00000545844;ENST00000372915;ENST00000361689;ENST00000317713;ENST00000539005;ENST00000289893;ENST00000482035|ENST00000372925	.|.	.|.	.|.	5.96|5.96	5.96|5.96	0.96718|0.96718	.|.	0.000000|.	0.64402|.	D|.	0.000004|.	.|T	.|0.77011	.|0.4068	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.73987	.|-0.3809	.|4	0.66056|.	D|.	0.02|.	.|.	20.4043|20.4043	0.99006|0.99006	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	X|I	3319;5386;3319;3319;3298;3821;135|2431	.|.	ENSP00000289893:E3821X|.	E|R	+|+	1|2	0|0	MACF1|MACF1	39661151|39661151	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	9.864000|9.864000	0.99589|0.99589	2.823000|2.823000	0.97156|0.97156	0.650000|0.650000	0.86243|0.86243	GAA|AGA	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin		0.453	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	MACF1	protein_coding	OTTHUMT00000392096.1	G	NM_033044	-		39888564	+1	no_errors	ENST00000317713	ensembl	human	known	74_37	nonsense	SNP	1.000	T
CHERP	10523	genome.wustl.edu	37	19	16643459	16643459	+	Silent	SNP	G	G	A			TCGA-N1-A6IA-01A-12D-A32I-09	TCGA-N1-A6IA-11A-11D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	26f94549-f63a-4c0f-8c70-0341ea0f528f	29f71321-1ce9-42d2-8923-7528a4bff739	g.chr19:16643459G>A	ENST00000198939.6	-	5	660	c.624C>T	c.(622-624)ttC>ttT	p.F208F	CHERP_ENST00000546361.2_Silent_p.F208F|CTD-3222D19.2_ENST00000409035.1_Intron					calcium homeostasis endoplasmic reticulum protein											endometrium(3)|kidney(2)|large_intestine(4)|lung(9)|ovary(2)|stomach(1)|urinary_tract(3)	24						GCCGCAGCTCGAAGTGTGCCC	0.647																																																	0								ENSG00000085872						54.0	64.0	61.0					19																	16643459		2175	4275	6450	CHERP	SO:0001819	synonymous_variant	0			-	HGNC	U94836	CCDS42518.1	19p13.1	2013-01-28				ENSG00000085872		"""G patch domain containing"""	16930	protein-coding gene	gene with protein product						8896557, 10794731	Standard	NM_006387		Approved	ERPROT213-21, DAN16	uc002nei.1	Q8IWX8	OTTHUMG00000169304	ENST00000198939.6:c.624C>T	19.37:g.16643459G>A		Somatic	0	130	0.00		0.586032912036718	7	91.36	74	WXS	Illumina HiSeq 2500	Phase_IV	tier1	161	37	80.90		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Surp,pfam_G_patch_dom,pfam_RNA_pol_II-bd,superfamily_Surp,superfamily_ENTH_VHS,smart_Surp,smart_G_patch_dom,pfscan_Surp,pfscan_G_patch_dom	p.F208	ENST00000198939.6	37	c.624		19																																																																																			-	superfamily_ENTH_VHS		0.647	CHERP-003	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	CHERP	protein_coding	OTTHUMT00000403372.1	G	NM_006387	-		16643459	-1	no_errors	ENST00000546361	ensembl	human	known	74_37	silent	SNP	0.700	A
FCER1A	2205	genome.wustl.edu	37	1	159277654	159277654	+	Missense_Mutation	SNP	A	A	G			TCGA-N1-A6IA-01A-12D-A32I-09	TCGA-N1-A6IA-11A-11D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	26f94549-f63a-4c0f-8c70-0341ea0f528f	29f71321-1ce9-42d2-8923-7528a4bff739	g.chr1:159277654A>G	ENST00000368115.1	+	6	805	c.706A>G	c.(706-708)Att>Gtt	p.I236V	FCER1A_ENST00000368114.1_Missense_Mutation_p.I203V	NM_002001.3	NP_001992.1	P12319	FCERA_HUMAN	Fc fragment of IgE, high affinity I, receptor for; alpha polypeptide	236					activation of JUN kinase activity (GO:0007257)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|leukotriene biosynthetic process (GO:0019370)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of granulocyte macrophage colony-stimulating factor biosynthetic process (GO:0045425)|positive regulation of interleukin-3 biosynthetic process (GO:0045401)|positive regulation of mast cell degranulation (GO:0043306)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of type I hypersensitivity (GO:0001812)|serotonin secretion (GO:0001820)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	IgE receptor activity (GO:0019767)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(19)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	33	all_hematologic(112;0.0429)				Benzylpenicilloyl Polylysine(DB00895)|Omalizumab(DB00043)	TCTCTTGAAGATTAAGAGAAC	0.388																																																	0								ENSG00000179639						101.0	97.0	98.0					1																	159277654		2203	4300	6503	FCER1A	SO:0001583	missense	0			-	HGNC	BC015195	CCDS1184.1	1q23	2013-01-11			ENSG00000179639	ENSG00000179639		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3609	protein-coding gene	gene with protein product		147140		FCE1A		8245459	Standard	NM_002001		Approved		uc001ftq.3	P12319	OTTHUMG00000037176	ENST00000368115.1:c.706A>G	1.37:g.159277654A>G	ENSP00000357097:p.Ile236Val	Somatic	0	67	0.00		0.586032912036718	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	52	39	57.14		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.I236V	ENST00000368115.1	37	c.706	CCDS1184.1	1	.	.	.	.	.	.	.	.	.	.	A	13.77	2.335421	0.41398	.	.	ENSG00000179639	ENST00000368115;ENST00000368114	T;T	0.02177	4.85;4.41	5.37	1.54	0.23209	.	6.380780	0.00397	N	0.000050	T	0.00784	0.0026	L	0.50333	1.59	0.09310	N	1	B	0.30406	0.278	B	0.24974	0.057	T	0.50591	-0.8810	10	0.14656	T	0.56	.	5.1399	0.14954	0.5099:0.1678:0.0:0.3223	.	236	P12319	FCERA_HUMAN	V	236;203	ENSP00000357097:I236V;ENSP00000357096:I203V	ENSP00000357096:I203V	I	+	1	0	FCER1A	157544278	0.061000	0.20836	0.159000	0.22649	0.535000	0.34838	0.538000	0.23160	0.083000	0.17047	0.528000	0.53228	ATT	-	NULL		0.388	FCER1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCER1A	protein_coding	OTTHUMT00000090328.2	A	NM_002001	-		159277654	+1	no_errors	ENST00000368115	ensembl	human	known	74_37	missense	SNP	0.106	G
