#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
LINC00957	255031	genome.wustl.edu	37	7	44079576	44079576	+	lincRNA	SNP	G	G	T			TCGA-PC-A5DL-01A-11D-A26G-09	TCGA-PC-A5DL-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59863adf-efee-4f78-884f-9947c95acec7	ff5644a0-f09f-46ba-b790-9054b5d61ca3	g.chr7:44079576G>T	ENST00000441052.1	+	0	261				RASA4CP_ENST00000446874.1_RNA					long intergenic non-protein coding RNA 957																		acctgggttggaaggtcccgc	0.612																																																	0								ENSG00000235314																																			LINC00957			0			-	HGNC	BC014556		7p13	2013-06-04			ENSG00000235314	ENSG00000235314		"""Long non-coding RNAs"""	22332	non-coding RNA	RNA, long non-coding							Standard	NR_015401		Approved				OTTHUMG00000155351		7.37:g.44079576G>T		Somatic	0	11	0.00		0.7014536215209443	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	9	43.75		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000441052.1	37	NULL		7																																																																																			-	-		0.612	LINC00957-001	KNOWN	basic	lincRNA	LINC00957	lincRNA	OTTHUMT00000339589.1	G		-		44079576	+1	no_errors	ENST00000416824	ensembl	human	known	74_37	rna	SNP	0.020	T
C21orf33	8209	genome.wustl.edu	37	21	45556016	45556016	+	Missense_Mutation	SNP	T	T	C			TCGA-PC-A5DL-01A-11D-A26G-09	TCGA-PC-A5DL-10A-01D-A26G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59863adf-efee-4f78-884f-9947c95acec7	ff5644a0-f09f-46ba-b790-9054b5d61ca3	g.chr21:45556016T>C	ENST00000291577.6	+	3	362	c.269T>C	c.(268-270)aTt>aCt	p.I90T	C21orf33_ENST00000427803.2_Missense_Mutation_p.I90T|C21orf33_ENST00000348499.5_Missense_Mutation_p.I90T|C21orf33_ENST00000493883.1_3'UTR	NM_004649.6	NP_004640	P30042	ES1_HUMAN	chromosome 21 open reading frame 33	90						mitochondrion (GO:0005739)				NS(1)|endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|skin(1)	8				STAD - Stomach adenocarcinoma(101;0.168)|Colorectal(79;0.191)		ATGCACGTGATTGACCACACC	0.587																																																	0								ENSG00000160221						85.0	73.0	77.0					21																	45556016		2203	4300	6503	C21orf33	SO:0001583	missense	0			-	HGNC	Y07572	CCDS33580.1, CCDS33581.1	21q22.3	2008-07-29			ENSG00000160221	ENSG00000160221			1273	protein-coding gene	gene with protein product		601659				9150728, 8975701	Standard	NM_004649		Approved	KNP-Ia, GT335, ES1, HES1, D21S2048E, KNPI, KNPH, KNP-I	uc002zec.4	P30042	OTTHUMG00000086916	ENST00000291577.6:c.269T>C	21.37:g.45556016T>C	ENSP00000291577:p.Ile90Thr	Somatic	0	26	0.00		0.7014536215209443	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	18	45.45	A6NFJ6|A6NJY7|O00650|O00660|O15011|O15012|P55346|P78474|Q92505|Q92507	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ThiJ/PfpI	p.I90T	ENST00000291577.6	37	c.269	CCDS33580.1	21	.	.	.	.	.	.	.	.	.	.	T	26.4	4.735250	0.89482	.	.	ENSG00000248354;ENSG00000160221;ENSG00000160221;ENSG00000160221;ENSG00000160221	ENST00000433711;ENST00000291577;ENST00000427803;ENST00000348499;ENST00000389690	D;D;T;D	0.82255	-1.59;-1.59;1.51;-1.59	4.93	4.93	0.64822	ThiJ/PfpI (1);	0.227296	0.45606	D	0.000347	D	0.89770	0.6811	M	0.90705	3.14	0.44227	D	0.997065	P;P	0.48911	0.917;0.881	P;P	0.51516	0.543;0.672	D	0.92102	0.5689	10	0.87932	D	0	-14.0867	14.9162	0.70798	0.0:0.0:0.0:1.0	.	90;90	P30042-2;P30042	.;ES1_HUMAN	T	69;90;90;90;63	ENSP00000291577:I90T;ENSP00000396655:I90T;ENSP00000344901:I90T;ENSP00000374340:I63T	ENSP00000415634:I69T	I	+	2	0	C21orf33;AP001055.7	44380444	0.997000	0.39634	1.000000	0.80357	0.976000	0.68499	7.604000	0.82830	1.983000	0.57843	0.533000	0.62120	ATT	-	pfam_ThiJ/PfpI		0.587	C21orf33-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	C21orf33	protein_coding	OTTHUMT00000195824.1	T	NM_004649	-		45556016	+1	no_errors	ENST00000291577	ensembl	human	known	74_37	missense	SNP	1.000	C
GOLGA8O	728047	genome.wustl.edu	37	15	32738673	32738673	+	Splice_Site	SNP	A	A	C			TCGA-PC-A5DL-01A-11D-A26G-09	TCGA-PC-A5DL-10A-01D-A26G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59863adf-efee-4f78-884f-9947c95acec7	ff5644a0-f09f-46ba-b790-9054b5d61ca3	g.chr15:32738673A>C	ENST00000509311.2	-	15	1466		c.e15+1		AC135983.1_ENST00000408391.1_RNA|RN7SL539P_ENST00000482670.2_RNA	NM_001277308.1	NP_001264237.1	A6NCC3	GOG8O_HUMAN	golgin A8 family, member O							Golgi apparatus (GO:0005794)											AGTCAGGCTCACCATGGCCTC	0.607																																																	0								ENSG00000206127																																			GOLGA8O	SO:0001630	splice_region_variant	0			-	HGNC		CCDS59252.1	15q13.3	2012-10-05			ENSG00000206127	ENSG00000206127			44406	protein-coding gene	gene with protein product							Standard	NM_001277308		Approved		uc031qrg.1	A6NCC3	OTTHUMG00000162878	ENST00000509311.2:c.1368+1T>G	15.37:g.32738673A>C		Somatic	1	293	0.34		0.7014536215209443	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	66	313	17.41	A6NHZ1|E7ENU5	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e15+2	ENST00000509311.2	37	c.1368+2	CCDS59252.1	15	.	.	.	.	.	.	.	.	.	.	A	11.63	1.697310	0.30142	.	.	ENSG00000206127	ENST00000509311	.	.	.	1.63	1.63	0.23807	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.3918	0.26913	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	RP11-632K20.1	30525965	1.000000	0.71417	0.959000	0.39883	0.198000	0.23893	5.899000	0.69846	1.029000	0.39812	0.113000	0.15668	.	-	-		0.607	GOLGA8O-001	NOVEL	not_best_in_genome_evidence|basic|appris_candidate_longest|CCDS	protein_coding	GOLGA8O	protein_coding	OTTHUMT00000370931.3	A		-	Intron	32738673	-1	no_errors	ENST00000509311	ensembl	human	novel	74_37	splice_site	SNP	1.000	C
UIMC1	51720	genome.wustl.edu	37	5	176396219	176396219	+	Silent	SNP	T	T	C			TCGA-PC-A5DL-01A-11D-A26G-09	TCGA-PC-A5DL-10A-01D-A26G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59863adf-efee-4f78-884f-9947c95acec7	ff5644a0-f09f-46ba-b790-9054b5d61ca3	g.chr5:176396219T>C	ENST00000377227.4	-	6	669	c.537A>G	c.(535-537)agA>agG	p.R179R	UIMC1_ENST00000503273.1_5'Flank|UIMC1_ENST00000511320.1_Silent_p.R179R|UIMC1_ENST00000377219.2_Silent_p.R179R|UIMC1_ENST00000506128.1_Silent_p.R179R			Q96RL1	UIMC1_HUMAN	ubiquitin interaction motif containing 1	179	Necessary for interaction with NR6A1 N- terminus.				double-strand break repair (GO:0006302)|G2 DNA damage checkpoint (GO:0031572)|histone H2A K63-linked deubiquitination (GO:0070537)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of DNA repair (GO:0045739)|response to ionizing radiation (GO:0010212)|transcription, DNA-templated (GO:0006351)	BRCA1-A complex (GO:0070531)|nucleus (GO:0005634)	histone binding (GO:0042393)|K63-linked polyubiquitin binding (GO:0070530)			NS(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(5)|ovary(4)|pancreas(1)|prostate(1)|skin(1)	21	all_cancers(89;7.96e-05)|Renal(175;0.000269)|Lung NSC(126;0.00476)|all_lung(126;0.00806)	Medulloblastoma(196;0.0145)|all_neural(177;0.0325)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			AAGGCTCCTCTCTTTCCTCAG	0.507																																																	0								ENSG00000087206						81.0	82.0	81.0					5																	176396219		2203	4300	6503	UIMC1	SO:0001819	synonymous_variant	0			-	HGNC	AF349313	CCDS4408.1	5q35.2	2008-02-05			ENSG00000087206	ENSG00000087206			30298	protein-coding gene	gene with protein product	"""receptor associated protein 80"""	609433				12080054	Standard	NM_001199297		Approved	RAP80	uc021yin.1	Q96RL1	OTTHUMG00000130852	ENST00000377227.4:c.537A>G	5.37:g.176396219T>C		Somatic	0	48	0.00		0.7014536215209443	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	49	9.26	A8MSA1|B3KMZ1|B4E3N2|Q5XKQ1|Q7Z3W7|Q8N5B9|Q9BZR1|Q9BZR5|Q9UHX7	Silent	SNP	NA	NA	NA	NA	NA	NA	smart_Ubiquitin-int_motif,pfscan_Ubiquitin-int_motif	p.R179	ENST00000377227.4	37	c.537	CCDS4408.1	5																																																																																			-	NULL		0.507	UIMC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	UIMC1	protein_coding	OTTHUMT00000253422.1	T	NM_016290	-		176396219	-1	no_errors	ENST00000377219	ensembl	human	known	74_37	silent	SNP	1.000	C
OR1D2	4991	genome.wustl.edu	37	17	2995908	2995908	+	Missense_Mutation	SNP	C	C	A			TCGA-PC-A5DL-01A-11D-A26G-09	TCGA-PC-A5DL-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59863adf-efee-4f78-884f-9947c95acec7	ff5644a0-f09f-46ba-b790-9054b5d61ca3	g.chr17:2995908C>A	ENST00000331459.1	-	1	382	c.383G>T	c.(382-384)tGc>tTc	p.C128F		NM_002548.2	NP_002539.2	P34982	OR1D2_HUMAN	olfactory receptor, family 1, subfamily D, member 2	128					cellular component movement (GO:0006928)|chemotaxis (GO:0006935)|detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|G-protein coupled receptor signaling pathway (GO:0007186)|protein import into nucleus, translocation (GO:0000060)|sensory perception of smell (GO:0007608)|single fertilization (GO:0007338)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(2)|large_intestine(2)|lung(10)|ovary(1)	15						GTGGAGGGGGCAGCAGATGGC	0.557																																																	0								ENSG00000184166						93.0	98.0	97.0					17																	2995908		2203	4300	6503	OR1D2	SO:0001583	missense	0			-	HGNC	U04678	CCDS11019.1	17p13.3	2012-08-09			ENSG00000184166	ENSG00000184166		"""GPCR / Class A : Olfactory receptors"""	8183	protein-coding gene	gene with protein product		164342		OLFR1		1370859, 1840504	Standard	NM_002548		Approved	OR17-4	uc010vrb.2	P34982	OTTHUMG00000090619	ENST00000331459.1:c.383G>T	17.37:g.2995908C>A	ENSP00000327585:p.Cys128Phe	Somatic	0	84	0.00		0.7014536215209443	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	40	14	74.07	Q6IFL8|Q96RA4|Q9UM78	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.C128F	ENST00000331459.1	37	c.383	CCDS11019.1	17	.	.	.	.	.	.	.	.	.	.	c	9.278	1.047321	0.19827	.	.	ENSG00000184166	ENST00000331459	T	0.00397	7.57	3.0	0.824	0.18818	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00210	0.0006	N	0.17800	0.525	0.24871	N	0.992281	B	0.12013	0.005	B	0.18263	0.021	T	0.31888	-0.9927	9	0.52906	T	0.07	.	5.9627	0.19308	0.0:0.5053:0.0:0.4947	.	128	P34982	OR1D2_HUMAN	F	128	ENSP00000327585:C128F	ENSP00000327585:C128F	C	-	2	0	OR1D2	2942658	0.000000	0.05858	0.997000	0.53966	0.973000	0.67179	-0.423000	0.07034	0.013000	0.14918	0.543000	0.68304	TGC	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM		0.557	OR1D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR1D2	protein_coding	OTTHUMT00000207207.1	C	NM_002548	-		2995908	-1	no_errors	ENST00000331459	ensembl	human	known	74_37	missense	SNP	0.865	A
ZDHHC3	51304	genome.wustl.edu	37	3	44968308	44968308	+	Missense_Mutation	SNP	C	C	A			TCGA-PC-A5DL-01A-11D-A26G-09	TCGA-PC-A5DL-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59863adf-efee-4f78-884f-9947c95acec7	ff5644a0-f09f-46ba-b790-9054b5d61ca3	g.chr3:44968308C>A	ENST00000424952.2	-	7	1041	c.773G>T	c.(772-774)aGa>aTa	p.R258I	ZDHHC3_ENST00000342790.4_Missense_Mutation_p.R292I|ZDHHC3_ENST00000296127.3_Missense_Mutation_p.R286I	NM_001135179.1	NP_001128651.1	Q9NYG2	ZDHC3_HUMAN	zinc finger, DHHC-type containing 3	258					protein palmitoylation (GO:0018345)|protein targeting (GO:0006605)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(3)|lung(4)	8				BRCA - Breast invasive adenocarcinoma(193;0.00943)|KIRC - Kidney renal clear cell carcinoma(197;0.053)|Kidney(197;0.0665)		TTTAGCCCATCTTCTCTCTTC	0.473																																																	0								ENSG00000163812						137.0	126.0	129.0					3																	44968308		2203	4300	6503	ZDHHC3	SO:0001583	missense	0			-	HGNC	AF247703	CCDS2724.1, CCDS46811.1	3p21.31	2010-02-09			ENSG00000163812	ENSG00000163812		"""Zinc fingers, DHHC-type"""	18470	protein-coding gene	gene with protein product	"""golgi-specific DHHC Zinc Finger Protein"""					19955568	Standard	NM_016598		Approved	ZNF373, GODZ	uc003cod.3	Q9NYG2	OTTHUMG00000133093	ENST00000424952.2:c.773G>T	3.37:g.44968308C>A	ENSP00000395502:p.Arg258Ile	Somatic	0	32	0.00		0.7014536215209443	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	12	29.41	Q53A17|Q96BL0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_DHHC_palmitoyltrfase,pfscan_Znf_DHHC_palmitoyltrfase	p.R286I	ENST00000424952.2	37	c.857	CCDS46811.1	3	.	.	.	.	.	.	.	.	.	.	C	21.8	4.200285	0.79015	.	.	ENSG00000163812	ENST00000296127;ENST00000424952;ENST00000342790	T;T;T	0.60299	1.03;1.22;0.2	5.82	5.82	0.92795	.	0.042158	0.85682	D	0.000000	T	0.61813	0.2377	M	0.68593	2.085	0.80722	D	1	B;B	0.29955	0.074;0.263	B;B	0.32090	0.091;0.14	T	0.60281	-0.7294	10	0.49607	T	0.09	.	20.0953	0.97838	0.0:1.0:0.0:0.0	.	258;286	Q9NYG2-2;Q9NYG2	.;ZDHC3_HUMAN	I	286;258;292	ENSP00000296127:R286I;ENSP00000395502:R258I;ENSP00000345268:R292I	ENSP00000296127:R286I	R	-	2	0	ZDHHC3	44943312	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.898000	0.69838	2.767000	0.95098	0.655000	0.94253	AGA	-	NULL		0.473	ZDHHC3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZDHHC3	protein_coding	OTTHUMT00000347004.1	C	NM_016598	-		44968308	-1	no_errors	ENST00000296127	ensembl	human	known	74_37	missense	SNP	1.000	A
PRKAA2	5563	genome.wustl.edu	37	1	57111096	57111096	+	Missense_Mutation	SNP	G	G	C			TCGA-PC-A5DL-01A-11D-A26G-09	TCGA-PC-A5DL-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59863adf-efee-4f78-884f-9947c95acec7	ff5644a0-f09f-46ba-b790-9054b5d61ca3	g.chr1:57111096G>C	ENST00000371244.4	+	1	102	c.36G>C	c.(34-36)aaG>aaC	p.K12N		NM_006252.3	NP_006243.2	P54646	AAPK2_HUMAN	protein kinase, AMP-activated, alpha 2 catalytic subunit	12					autophagy (GO:0006914)|carnitine shuttle (GO:0006853)|cell cycle arrest (GO:0007050)|cellular lipid metabolic process (GO:0044255)|cellular response to glucose starvation (GO:0042149)|cellular response to nutrient levels (GO:0031669)|cholesterol biosynthetic process (GO:0006695)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|fatty acid homeostasis (GO:0055089)|glucose homeostasis (GO:0042593)|insulin receptor signaling pathway (GO:0008286)|lipid biosynthetic process (GO:0008610)|membrane organization (GO:0061024)|negative regulation of apoptotic process (GO:0043066)|negative regulation of TOR signaling (GO:0032007)|positive regulation of autophagy (GO:0010508)|positive regulation of glycolytic process (GO:0045821)|protein phosphorylation (GO:0006468)|regulation of circadian rhythm (GO:0042752)|regulation of energy homeostasis (GO:2000505)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of transcription, DNA-templated (GO:0006355)|response to stress (GO:0006950)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	[acetyl-CoA carboxylase] kinase activity (GO:0050405)|[hydroxymethylglutaryl-CoA reductase (NADPH)] kinase activity (GO:0047322)|AMP-activated protein kinase activity (GO:0004679)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|histone serine kinase activity (GO:0035174)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)			breast(6)|endometrium(1)|large_intestine(6)|lung(7)|ovary(1)|prostate(1)|stomach(1)	23					Acetylsalicylic acid(DB00945)	GGCGGGTGAAGATCGGACACT	0.701																																																	0								ENSG00000162409						37.0	35.0	36.0					1																	57111096		2195	4288	6483	PRKAA2	SO:0001583	missense	0			-	HGNC	BC069823	CCDS605.1	1p31	2011-08-25			ENSG00000162409	ENSG00000162409			9377	protein-coding gene	gene with protein product		600497		PRKAA		7959015	Standard	NM_006252		Approved	AMPK, AMPKa2	uc001cyk.4	P54646	OTTHUMG00000008282	ENST00000371244.4:c.36G>C	1.37:g.57111096G>C	ENSP00000360290:p.Lys12Asn	Somatic	0	33	0.00		0.7014536215209443	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	25	19.35	Q9H1E8|Q9UD43	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_KA1/Ssp2_C,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.K12N	ENST00000371244.4	37	c.36	CCDS605.1	1	.	.	.	.	.	.	.	.	.	.	G	26.3	4.725378	0.89298	.	.	ENSG00000162409	ENST00000371244	T	0.73363	-0.74	4.0	3.09	0.35607	Protein kinase-like domain (1);	0.000000	0.85682	U	0.000000	T	0.71896	0.3394	N	0.20986	0.625	0.80722	D	1	D	0.58970	0.984	P	0.61533	0.89	T	0.71567	-0.4554	10	0.66056	D	0.02	-8.9599	7.9254	0.29872	0.195:0.0:0.805:0.0	.	12	P54646	AAPK2_HUMAN	N	12	ENSP00000360290:K12N	ENSP00000360290:K12N	K	+	3	2	PRKAA2	56883684	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	2.901000	0.48695	0.666000	0.31087	0.306000	0.20318	AAG	-	superfamily_Kinase-like_dom		0.701	PRKAA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKAA2	protein_coding	OTTHUMT00000022753.2	G	NM_006252	-		57111096	+1	no_errors	ENST00000371244	ensembl	human	known	74_37	missense	SNP	1.000	C
PTPRR	5801	genome.wustl.edu	37	12	71095059	71095059	+	Missense_Mutation	SNP	C	C	A			TCGA-PC-A5DL-01A-11D-A26G-09	TCGA-PC-A5DL-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59863adf-efee-4f78-884f-9947c95acec7	ff5644a0-f09f-46ba-b790-9054b5d61ca3	g.chr12:71095059C>A	ENST00000283228.2	-	7	1504	c.1052G>T	c.(1051-1053)gGg>gTg	p.G351V	PTPRR_ENST00000378778.1_Missense_Mutation_p.G145V|PTPRR_ENST00000342084.4_Missense_Mutation_p.G239V|PTPRR_ENST00000440835.2_Missense_Mutation_p.G106V|PTPRR_ENST00000549308.1_Missense_Mutation_p.G106V	NM_002849.3	NP_002840.2	Q15256	PTPRR_HUMAN	protein tyrosine phosphatase, receptor type, R	351					ERBB2 signaling pathway (GO:0038128)|in utero embryonic development (GO:0001701)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(22)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	41			GBM - Glioblastoma multiforme(2;5.67e-07)|Lung(24;0.00283)|OV - Ovarian serous cystadenocarcinoma(12;0.00578)|LUSC - Lung squamous cell carcinoma(43;0.132)	COAD - Colon adenocarcinoma(1;0.136)		TTCAATGTTCCCCAAGCTACT	0.433																																																	0								ENSG00000153233						132.0	115.0	120.0					12																	71095059		2203	4300	6503	PTPRR	SO:0001583	missense	0			-	HGNC	D64053	CCDS8998.1, CCDS44945.1, CCDS55847.1, CCDS55848.1	12q15	2011-10-07			ENSG00000153233	ENSG00000153233		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9680	protein-coding gene	gene with protein product		602853		PTPRQ		7557444, 10393441	Standard	NM_002849		Approved	PTPBR7, PTP-SL, EC-PTP, PCPTP1	uc001swi.2	Q15256	OTTHUMG00000169502	ENST00000283228.2:c.1052G>T	12.37:g.71095059C>A	ENSP00000283228:p.Gly351Val	Somatic	0	63	0.00		0.7014536215209443	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	54	21.74	B2R5Z7|B7Z3J1|F5GXR7|O00342|Q92682|Q9UE65	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_Tyr_Pase_rcpt_R/non-rcpt_5,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_KIM-con,prints_Tyr_Pase_rcpt/non-rcpt,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	p.G351V	ENST00000283228.2	37	c.1052	CCDS8998.1	12	.	.	.	.	.	.	.	.	.	.	C	23.1	4.373040	0.82573	.	.	ENSG00000153233	ENST00000440835;ENST00000283228;ENST00000378778;ENST00000342084;ENST00000549308;ENST00000550661	T;T;T;T;T;T	0.24538	4.02;3.76;4.01;3.97;4.02;1.85	5.59	5.59	0.84812	.	0.000000	0.53938	D	0.000053	T	0.51805	0.1696	L	0.61387	1.9	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;1.0;1.0;0.999	T	0.49244	-0.8960	10	0.72032	D	0.01	-14.6063	19.956	0.97218	0.0:1.0:0.0:0.0	.	200;239;145;351	B7Z998;F5GXR7;Q15256-4;Q15256	.;.;.;PTPRR_HUMAN	V	106;351;145;239;106;106	ENSP00000391750:G106V;ENSP00000283228:G351V;ENSP00000368054:G145V;ENSP00000339605:G239V;ENSP00000446943:G106V;ENSP00000449616:G106V	ENSP00000283228:G351V	G	-	2	0	PTPRR	69381326	1.000000	0.71417	0.992000	0.48379	0.737000	0.42083	6.911000	0.75746	2.788000	0.95919	0.557000	0.71058	GGG	-	pirsf_Tyr_Pase_rcpt_R/non-rcpt_5		0.433	PTPRR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRR	protein_coding	OTTHUMT00000404485.1	C	NM_002849	-		71095059	-1	no_errors	ENST00000283228	ensembl	human	known	74_37	missense	SNP	1.000	A
GABRA1	2554	genome.wustl.edu	37	5	161309577	161309577	+	Silent	SNP	A	A	G			TCGA-PC-A5DL-01A-11D-A26G-09	TCGA-PC-A5DL-10A-01D-A26G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59863adf-efee-4f78-884f-9947c95acec7	ff5644a0-f09f-46ba-b790-9054b5d61ca3	g.chr5:161309577A>G	ENST00000428797.2	+	8	928	c.573A>G	c.(571-573)agA>agG	p.R191R	GABRA1_ENST00000393943.4_Silent_p.R191R|GABRA1_ENST00000023897.6_Silent_p.R191R|GABRA1_ENST00000420560.1_Silent_p.R191R|GABRA1_ENST00000437025.2_Silent_p.R191R|GABRA1_ENST00000444819.1_Silent_p.R191R	NM_001127643.1	NP_001121115.1	P14867	GBRA1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 1	191					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|synaptic transmission, GABAergic (GO:0051932)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|drug binding (GO:0008144)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			NS(1)|endometrium(2)|kidney(3)|large_intestine(4)|liver(1)|lung(22)|ovary(2)|pancreas(2)|prostate(1)|skin(3)|urinary_tract(1)	42	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.228)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethanol(DB00898)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Ginkgo biloba(DB01381)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methohexital(DB00474)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Prazepam(DB01588)|Primidone(DB00794)|Progabide(DB00837)|Propofol(DB00818)|Quazepam(DB01589)|Quinidine barbiturate(DB01346)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiamylal(DB01154)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zaleplon(DB00962)|Zolpidem(DB00425)|Zopiclone(DB01198)	CTTATACAAGAGCAGAAGTTG	0.378																																																	0								ENSG00000022355						115.0	108.0	110.0					5																	161309577		2203	4300	6503	GABRA1	SO:0001819	synonymous_variant	0			-	HGNC		CCDS4357.1	5q34	2012-06-22			ENSG00000022355	ENSG00000022355		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4075	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 1"""	137160				1330891	Standard	NM_000806		Approved	EJM5	uc003lyx.4	P14867	OTTHUMG00000163586	ENST00000428797.2:c.573A>G	5.37:g.161309577A>G		Somatic	0	51	0.00		0.7014536215209443	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	33	23	58.93	D3DQK6|Q8N629	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABAAa_rcpt,prints_GABAA_rcpt,prints_GABBAa1_rcpt,prints_Neur_channel,prints_GABBAg_rcpt,tigrfam_Neur_channel	p.R191	ENST00000428797.2	37	c.573	CCDS4357.1	5																																																																																			-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,tigrfam_Neur_channel		0.378	GABRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABRA1	protein_coding	OTTHUMT00000252702.2	A	NM_000806.5	-		161309577	+1	no_errors	ENST00000023897	ensembl	human	known	74_37	silent	SNP	1.000	G
EXD2	55218	genome.wustl.edu	37	14	69697224	69697224	+	Missense_Mutation	SNP	C	C	G			TCGA-PC-A5DL-01A-11D-A26G-09	TCGA-PC-A5DL-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59863adf-efee-4f78-884f-9947c95acec7	ff5644a0-f09f-46ba-b790-9054b5d61ca3	g.chr14:69697224C>G	ENST00000409018.3	+	4	754	c.626C>G	c.(625-627)tCc>tGc	p.S209C	EXD2_ENST00000409949.1_Missense_Mutation_p.S84C|EXD2_ENST00000492815.1_3'UTR|EXD2_ENST00000409675.1_Missense_Mutation_p.S84C|EXD2_ENST00000449989.1_Missense_Mutation_p.S84C|EXD2_ENST00000409242.1_Missense_Mutation_p.S84C|EXD2_ENST00000312994.5_Missense_Mutation_p.S209C|EXD2_ENST00000409014.1_Missense_Mutation_p.S84C	NM_001193361.1	NP_001180290.1	Q9NVH0	EXD2_HUMAN	exonuclease 3'-5' domain containing 2	209	3'-5' exonuclease.						3'-5' exonuclease activity (GO:0008408)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(1)|large_intestine(2)|liver(1)|lung(7)|prostate(1)|urinary_tract(1)	14						AGCCTGAAGTCCCTCGCTGAG	0.433																																																	0								ENSG00000081177						162.0	153.0	156.0					14																	69697224		2203	4300	6503	EXD2	SO:0001583	missense	0			-	HGNC	AK001600	CCDS9793.1, CCDS53902.1	14q24.1	2009-02-24	2009-02-24	2009-02-24	ENSG00000081177	ENSG00000081177			20217	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 114"", ""exonuclease 3'-5' domain-like 2"""	C14orf114, EXDL2			Standard	NM_018199		Approved	FLJ10738	uc001xkv.3	Q9NVH0	OTTHUMG00000154496	ENST00000409018.3:c.626C>G	14.37:g.69697224C>G	ENSP00000387331:p.Ser209Cys	Somatic	0	45	0.00		0.7014536215209443	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	17	52.78	B4DIH6|G5E947|Q6AWB6|Q8N3D3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_3'-5'_exonuclease_dom,superfamily_RNaseH-like_dom,smart_3'-5'_exonuclease_dom	p.S209C	ENST00000409018.3	37	c.626	CCDS53902.1	14	.	.	.	.	.	.	.	.	.	.	C	19.93	3.918738	0.73098	.	.	ENSG00000081177	ENST00000409018;ENST00000193422;ENST00000409014;ENST00000409675;ENST00000409949;ENST00000409242;ENST00000312994;ENST00000413191;ENST00000449989	T;T;T;T;T;T;T;T	0.66099	-0.19;-0.19;-0.19;-0.19;-0.19;-0.19;-0.19;-0.19	5.33	4.43	0.53597	-5&apos (1);Ribonuclease H-like (1); exonuclease (1);3&apos (1);	0.174328	0.52532	D	0.000076	T	0.77205	0.4096	M	0.83774	2.66	0.54753	D	0.999986	D;D	0.69078	0.997;0.992	D;D	0.67382	0.951;0.926	T	0.79626	-0.1725	10	0.72032	D	0.01	-7.3631	10.4882	0.44735	0.0:0.7909:0.1352:0.0739	.	209;84	G5E947;Q9NVH0	.;EXD2_HUMAN	C	209;209;84;84;84;84;209;84;84	ENSP00000387331:S209C;ENSP00000386915:S84C;ENSP00000386762:S84C;ENSP00000386632:S84C;ENSP00000386839:S84C;ENSP00000313140:S209C;ENSP00000409089:S84C;ENSP00000392177:S84C	ENSP00000193422:S209C	S	+	2	0	EXD2	68766977	0.998000	0.40836	0.999000	0.59377	0.881000	0.50899	3.498000	0.53302	2.637000	0.89404	0.655000	0.94253	TCC	-	pfam_3'-5'_exonuclease_dom,superfamily_RNaseH-like_dom,smart_3'-5'_exonuclease_dom		0.433	EXD2-002	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	EXD2	protein_coding	OTTHUMT00000335504.1	C		-		69697224	+1	no_errors	ENST00000312994	ensembl	human	known	74_37	missense	SNP	1.000	G
STRA6	64220	genome.wustl.edu	37	15	74490172	74490172	+	Intron	SNP	T	T	A			TCGA-PC-A5DL-01A-11D-A26G-09	TCGA-PC-A5DL-10A-01D-A26G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59863adf-efee-4f78-884f-9947c95acec7	ff5644a0-f09f-46ba-b790-9054b5d61ca3	g.chr15:74490172T>A	ENST00000323940.5	-	3	359				STRA6_ENST00000563965.1_Intron|STRA6_ENST00000574278.1_Intron|STRA6_ENST00000395105.4_Intron|STRA6_ENST00000574439.1_5'UTR|STRA6_ENST00000416286.3_Intron|STRA6_ENST00000449139.2_Intron|STRA6_ENST00000423167.2_Intron|STRA6_ENST00000535552.1_Intron|STRA6_ENST00000432245.2_Intron	NM_001142617.1|NM_001142618.1|NM_001142619.1	NP_001136089.1|NP_001136090.1|NP_001136091.1	Q9BX79	STRA6_HUMAN	stimulated by retinoic acid 6						adrenal gland development (GO:0030325)|alveolar primary septum development (GO:0061143)|artery morphogenesis (GO:0048844)|blood vessel development (GO:0001568)|cognition (GO:0050890)|developmental growth (GO:0048589)|diaphragm development (GO:0060539)|digestive tract morphogenesis (GO:0048546)|ductus arteriosus closure (GO:0097070)|ear development (GO:0043583)|embryonic camera-type eye formation (GO:0060900)|embryonic digestive tract development (GO:0048566)|eyelid development in camera-type eye (GO:0061029)|face morphogenesis (GO:0060325)|feeding behavior (GO:0007631)|female genitalia development (GO:0030540)|head development (GO:0060322)|head morphogenesis (GO:0060323)|heart development (GO:0007507)|kidney development (GO:0001822)|learning (GO:0007612)|lung alveolus development (GO:0048286)|lung development (GO:0030324)|lung vasculature development (GO:0060426)|neuromuscular process (GO:0050905)|nose morphogenesis (GO:0043585)|paramesonephric duct development (GO:0061205)|phototransduction, visible light (GO:0007603)|positive regulation of behavior (GO:0048520)|positive regulation of JAK-STAT cascade (GO:0046427)|pulmonary artery morphogenesis (GO:0061156)|pulmonary valve morphogenesis (GO:0003184)|retinoic acid metabolic process (GO:0042573)|retinoid metabolic process (GO:0001523)|retinol transport (GO:0034633)|smooth muscle tissue development (GO:0048745)|uterus morphogenesis (GO:0061038)|ventricular septum development (GO:0003281)|vitamin A import (GO:0071939)|vocal learning (GO:0042297)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	receptor activity (GO:0004872)|vitamin transporter activity (GO:0051183)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(4)|lung(5)|skin(1)|stomach(2)	26						GCAGAGCAAATGAAGGCTGGC	0.607																																																	0								ENSG00000137868						95.0	74.0	81.0					15																	74490172		2198	4297	6495	STRA6	SO:0001627	intron_variant	0			-	HGNC	AF352728	CCDS10261.1, CCDS45301.1, CCDS45302.1, CCDS55973.1, CCDS55974.1, CCDS58387.1	15q24.1	2014-07-14	2012-12-07		ENSG00000137868	ENSG00000137868			30650	protein-coding gene	gene with protein product	"""retinol binding protein 4 receptor"""	610745	"""stimulated by retinoic acid gene 6 homolog (mouse)"", ""stimulated by retinoic acid 6 homolog (mouse)"""			17255476, 17273977	Standard	NM_022369		Approved	FLJ12541	uc002axj.3	Q9BX79	OTTHUMG00000138998	ENST00000323940.5:c.114-13A>T	15.37:g.74490172T>A		Somatic	0	37	0.00		0.7014536215209443	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	28	39.13	A8K7F1|B7Z5M9|B7Z862|D3DW54|F5GYI8|I3L1G8|Q6PJF8|Q71RB9|Q7L9G1|Q7Z3U9|Q8TB21|Q9BX78|Q9H9U8	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000323940.5	37	NULL	CCDS10261.1	15																																																																																			-	-		0.607	STRA6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	STRA6	protein_coding	OTTHUMT00000272891.1	T		-		74490172	-1	no_errors	ENST00000573456	ensembl	human	known	74_37	rna	SNP	0.000	A
TNXB	7148	genome.wustl.edu	37	6	32041701	32041701	+	Silent	SNP	G	G	T			TCGA-PC-A5DL-01A-11D-A26G-09	TCGA-PC-A5DL-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59863adf-efee-4f78-884f-9947c95acec7	ff5644a0-f09f-46ba-b790-9054b5d61ca3	g.chr6:32041701G>T	ENST00000375244.3	-	12	4605	c.4404C>A	c.(4402-4404)gcC>gcA	p.A1468A	TNXB_ENST00000375247.2_Silent_p.A1468A			P22105	TENX_HUMAN	tenascin XB	1555	Fibronectin type-III 7. {ECO:0000255|PROSITE-ProRule:PRU00316}.				actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						GGGACTCAGTGGCTGGAGGGG	0.547																																																	0								ENSG00000168477						27.0	29.0	28.0					6																	32041701		1204	2538	3742	TNXB	SO:0001819	synonymous_variant	0			-	HGNC	X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000375244.3:c.4404C>A	6.37:g.32041701G>T		Somatic	0	27	0.00		0.7014536215209443	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	1	90.91	P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Fibronectin_type3,pfam_Fibrinogen_a/b/g_C_dom,pfam_EGF_extracell,superfamily_Fibrinogen_a/b/g_C_dom,superfamily_Fibronectin_type3,smart_EG-like_dom,smart_Fibronectin_type3,smart_Fibrinogen_a/b/g_C_dom,pfscan_EG-like_dom,pfscan_Fibronectin_type3	p.A1468	ENST00000375244.3	37	c.4404		6																																																																																			-	NULL		0.547	TNXB-001	PUTATIVE	not_organism_supported|basic|appris_candidate_longest	protein_coding	TNXB	protein_coding	OTTHUMT00000268927.2	G	NM_019105	-		32041701	-1	no_errors	ENST00000375247	ensembl	human	known	74_37	silent	SNP	0.286	T
VNN2	8875	genome.wustl.edu	37	6	133072574	133072574	+	Missense_Mutation	SNP	C	C	T			TCGA-PC-A5DL-01A-11D-A26G-09	TCGA-PC-A5DL-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59863adf-efee-4f78-884f-9947c95acec7	ff5644a0-f09f-46ba-b790-9054b5d61ca3	g.chr6:133072574C>T	ENST00000326499.6	-	5	1034	c.910G>A	c.(910-912)Gtg>Atg	p.V304M	VNN2_ENST00000525270.1_Missense_Mutation_p.V251M|VNN2_ENST00000526192.1_5'Flank|VNN2_ENST00000525289.1_Intron|RP1-55C23.7_ENST00000430895.1_RNA	NM_004665.2	NP_004656	O95498	VNN2_HUMAN	vanin 2	304	CN hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00054}.				cellular component movement (GO:0006928)|pantothenate metabolic process (GO:0015939)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)	pantetheine hydrolase activity (GO:0017159)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(7)|lung(14)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				OV - Ovarian serous cystadenocarcinoma(155;0.00237)|GBM - Glioblastoma multiforme(226;0.0267)		TGTGAATCCACCTCTGAAAGG	0.428																																																	0								ENSG00000112303						77.0	76.0	77.0					6																	133072574		2202	4295	6497	VNN2	SO:0001583	missense	0			-	HGNC	AB026705	CCDS5161.1, CCDS5162.1, CCDS56451.1	6q23-q24	2013-02-13			ENSG00000112303	ENSG00000112303	3.5.1.92	"""Vanins"""	12706	protein-coding gene	gene with protein product	"""pantetheinase"""	603571				9790769, 11491533	Standard	NM_078488		Approved	FOAP-4, GPI-80	uc003qdt.3	O95498	OTTHUMG00000015588	ENST00000326499.6:c.910G>A	6.37:g.133072574C>T	ENSP00000322276:p.Val304Met	Somatic	0	48	0.00		0.7014536215209443	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	53	10.17	A0AUZ3|A6NDY1|A8K4E3|A8K7W0|B2DFZ0|B2DFZ1|B2DFZ2|B2DFZ3|F6XL73|Q2XUN1|Q9UJF3|Q9UMW2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_Biotinidase_euk,pfam_C-N_Hydrolase,superfamily_C-N_Hydrolase,pfscan_C-N_Hydrolase	p.V304M	ENST00000326499.6	37	c.910	CCDS5161.1	6	.	.	.	.	.	.	.	.	.	.	C	14.72	2.619437	0.46736	.	.	ENSG00000112303	ENST00000326499;ENST00000525270	D;D	0.89343	-2.5;-2.5	5.48	-11.0	0.00169	Nitrilase/cyanide hydratase and apolipoprotein N-acyltransferase (2);	0.510568	0.17256	N	0.180945	T	0.77711	0.4171	M	0.86573	2.825	0.27719	N	0.94519	P	0.46395	0.877	B	0.41510	0.359	T	0.68965	-0.5270	10	0.72032	D	0.01	-3.9906	7.0349	0.24987	0.5761:0.1215:0.2363:0.0661	.	304	O95498	VNN2_HUMAN	M	304;251	ENSP00000322276:V304M;ENSP00000436822:V251M	ENSP00000322276:V304M	V	-	1	0	VNN2	133114267	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-2.009000	0.01455	-1.894000	0.01105	-0.192000	0.12808	GTG	-	pirsf_Biotinidase_euk,pfscan_C-N_Hydrolase		0.428	VNN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VNN2	protein_coding	OTTHUMT00000042264.2	C		-		133072574	-1	no_errors	ENST00000326499	ensembl	human	known	74_37	missense	SNP	0.000	T
HCLS1	3059	genome.wustl.edu	37	3	121350968	121350968	+	Missense_Mutation	SNP	G	G	T			TCGA-PC-A5DL-01A-11D-A26G-09	TCGA-PC-A5DL-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59863adf-efee-4f78-884f-9947c95acec7	ff5644a0-f09f-46ba-b790-9054b5d61ca3	g.chr3:121350968G>T	ENST00000314583.3	-	13	1395	c.1304C>A	c.(1303-1305)gCt>gAt	p.A435D	HCLS1_ENST00000473883.1_5'UTR|HCLS1_ENST00000428394.2_Missense_Mutation_p.A398D	NM_005335.4	NP_005326	P14317	HCLS1_HUMAN	hematopoietic cell-specific Lyn substrate 1	435	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				actin filament polymerization (GO:0030041)|cellular response to cytokine stimulus (GO:0071345)|erythrocyte differentiation (GO:0030218)|intracellular signal transduction (GO:0035556)|negative regulation of leukocyte apoptotic process (GO:2000107)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of cell proliferation (GO:0008284)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tyrosine phosphorylation of STAT protein (GO:0042531)|regulation of actin filament polymerization (GO:0030833)|regulation of transcription, DNA-templated (GO:0006355)|response to hormone (GO:0009725)	cytoplasm (GO:0005737)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	protein kinase binding (GO:0019901)|RNA polymerase II transcription factor binding (GO:0001085)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(13)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	35				GBM - Glioblastoma multiforme(114;0.0912)		ATCATATACAGCCACAGCTGA	0.542																																																	0								ENSG00000180353						77.0	82.0	81.0					3																	121350968		2203	4300	6503	HCLS1	SO:0001583	missense	0			-	HGNC		CCDS3003.1	3q13	2007-08-03			ENSG00000180353	ENSG00000180353			4844	protein-coding gene	gene with protein product	"""cortactin-like"""	601306				8978766, 15710041	Standard	NM_001292041		Approved	HS1, CTTNL	uc003eeh.4	P14317	OTTHUMG00000159409	ENST00000314583.3:c.1304C>A	3.37:g.121350968G>T	ENSP00000320176:p.Ala435Asp	Somatic	0	12	0.00		0.7014536215209443	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	6	50.00	B4DQ69|Q53Y93|Q6IBK9|Q9UDK0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Hs1_Cortactin,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_Hs1_Cortactin,pfscan_SH3_domain,prints_SH3_domain,prints_p67phox	p.A435D	ENST00000314583.3	37	c.1304	CCDS3003.1	3	.	.	.	.	.	.	.	.	.	.	G	13.56	2.274414	0.40194	.	.	ENSG00000180353	ENST00000314583;ENST00000428394	D;D	0.81499	-1.5;-1.5	4.89	4.89	0.63831	Src homology-3 domain (5);	0.047759	0.85682	D	0.000000	D	0.92938	0.7753	H	0.99357	4.53	0.80722	D	1	D;P	0.54601	0.967;0.942	P;P	0.57057	0.812;0.812	D	0.95614	0.8675	10	0.87932	D	0	-6.6303	15.5931	0.76554	0.0:0.0:1.0:0.0	.	398;435	E7EVW7;P14317	.;HCLS1_HUMAN	D	435;398	ENSP00000320176:A435D;ENSP00000387645:A398D	ENSP00000320176:A435D	A	-	2	0	HCLS1	122833658	1.000000	0.71417	0.973000	0.42090	0.076000	0.17211	9.101000	0.94219	2.548000	0.85928	0.561000	0.74099	GCT	-	pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain,prints_SH3_domain,prints_p67phox		0.542	HCLS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCLS1	protein_coding	OTTHUMT00000355144.1	G	NM_005335	-		121350968	-1	no_errors	ENST00000314583	ensembl	human	known	74_37	missense	SNP	0.989	T
GK2	2712	genome.wustl.edu	37	4	80328302	80328302	+	Missense_Mutation	SNP	T	T	A			TCGA-PC-A5DL-01A-11D-A26G-09	TCGA-PC-A5DL-10A-01D-A26G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59863adf-efee-4f78-884f-9947c95acec7	ff5644a0-f09f-46ba-b790-9054b5d61ca3	g.chr4:80328302T>A	ENST00000358842.3	-	1	1070	c.1053A>T	c.(1051-1053)gaA>gaT	p.E351D		NM_033214.2	NP_149991.2	Q01415	GALK2_HUMAN	glycerol kinase 2	0					carbohydrate metabolic process (GO:0005975)|galactose metabolic process (GO:0006012)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|galactokinase activity (GO:0004335)|N-acetylgalactosamine kinase activity (GO:0033858)			autonomic_ganglia(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	39						AAGTTCCTACTTCTTTAGCAA	0.448																																																	0								ENSG00000196475						114.0	109.0	111.0					4																	80328302		2203	4300	6503	GK2	SO:0001583	missense	0			-	HGNC	BC029820	CCDS3585.1	4q13	2008-02-05	2002-10-03	2002-10-04	ENSG00000196475	ENSG00000196475		"""Glycerol kinases"""	4291	protein-coding gene	gene with protein product		600148	"""glycerol kinase pseudogene 2"""	GKP2		7987308	Standard	NM_033214		Approved	GKTA	uc003hlu.3	Q14410	OTTHUMG00000130199	ENST00000358842.3:c.1053A>T	4.37:g.80328302T>A	ENSP00000351706:p.Glu351Asp	Somatic	0	57	0.00		0.7014536215209443	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	35	43.55	Q7Z4Q4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Carb_kinase_FGGY_N,pfam_Carb_kinase_FGGY_C,tigrfam_Glycerol_kin	p.E351D	ENST00000358842.3	37	c.1053	CCDS3585.1	4	.	.	.	.	.	.	.	.	.	.	T	6.256	0.415387	0.11870	.	.	ENSG00000196475	ENST00000358842	D	0.85013	-1.93	4.04	-1.44	0.08856	Carbohydrate kinase, FGGY, C-terminal (1);	0.486124	0.22908	N	0.054166	T	0.70369	0.3216	L	0.31664	0.95	0.38455	D	0.947072	B	0.09022	0.002	B	0.15052	0.012	T	0.54022	-0.8355	10	0.51188	T	0.08	-11.2087	3.0148	0.06055	0.3272:0.1962:0.0:0.4765	.	351	Q14410	GLPK2_HUMAN	D	351	ENSP00000351706:E351D	ENSP00000351706:E351D	E	-	3	2	GK2	80547326	0.896000	0.30565	0.082000	0.20525	0.317000	0.28152	-0.281000	0.08456	-0.212000	0.10109	-0.361000	0.07541	GAA	-	pfam_Carb_kinase_FGGY_C,tigrfam_Glycerol_kin		0.448	GK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GK2	protein_coding	OTTHUMT00000252517.2	T	NM_033214	-		80328302	-1	no_errors	ENST00000358842	ensembl	human	known	74_37	missense	SNP	0.743	A
SPTBN2	6712	genome.wustl.edu	37	11	66482782	66482782	+	Missense_Mutation	SNP	G	G	A			TCGA-PC-A5DL-01A-11D-A26G-09	TCGA-PC-A5DL-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59863adf-efee-4f78-884f-9947c95acec7	ff5644a0-f09f-46ba-b790-9054b5d61ca3	g.chr11:66482782G>A	ENST00000533211.1	-	5	725	c.394C>T	c.(394-396)Cac>Tac	p.H132Y	SPTBN2_ENST00000529997.1_Missense_Mutation_p.H132Y|SPTBN2_ENST00000309996.2_Missense_Mutation_p.H132Y|RN7SL12P_ENST00000473849.2_RNA			O15020	SPTN2_HUMAN	spectrin, beta, non-erythrocytic 2	132	Actin-binding.|CH 1. {ECO:0000255|PROSITE- ProRule:PRU00044}.				actin filament capping (GO:0051693)|adult behavior (GO:0030534)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|cell death (GO:0008219)|cerebellar Purkinje cell layer morphogenesis (GO:0021692)|multicellular organism growth (GO:0035264)|synapse assembly (GO:0007416)|vesicle-mediated transport (GO:0016192)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)|spectrin (GO:0008091)	actin binding (GO:0003779)|phospholipid binding (GO:0005543)|structural constituent of cytoskeleton (GO:0005200)			autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(15)|liver(1)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	74						TTTTCCAAGTGCACTTTCTGC	0.577																																																	0								ENSG00000173898						183.0	144.0	157.0					11																	66482782		2200	4295	6495	SPTBN2	SO:0001583	missense	0			-	HGNC	AB008567, AF026487, AF026488, AF079569	CCDS8150.1	11q13.2	2013-01-10			ENSG00000173898	ENSG00000173898		"""Pleckstrin homology (PH) domain containing"""	11276	protein-coding gene	gene with protein product		604985	"""spinocerebellar ataxia 5"""	SCA5		9826670, 16429157	Standard	NM_006946		Approved		uc001ojd.3	O15020	OTTHUMG00000167262	ENST00000533211.1:c.394C>T	11.37:g.66482782G>A	ENSP00000432568:p.His132Tyr	Somatic	0	85	0.00		0.7014536215209443	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	59	25.32	O14872|O14873	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_Spectrin_bsu,pfam_Spectrin_repeat,pfam_CH-domain,pfam_Pleckstrin_homology,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Pleckstrin_homology,prints_PH_dom-spectrin-type,pfscan_CH-domain,pfscan_Pleckstrin_homology	p.H132Y	ENST00000533211.1	37	c.394	CCDS8150.1	11	.	.	.	.	.	.	.	.	.	.	G	22.2	4.254330	0.80135	.	.	ENSG00000173898	ENST00000533211;ENST00000309996;ENST00000529997;ENST00000443262	T;T;T	0.59502	0.26;0.26;0.26	4.65	4.65	0.58169	Calponin homology domain (5);	0.000000	0.85682	D	0.000000	T	0.77219	0.4098	M	0.80616	2.505	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.80966	-0.1146	10	0.72032	D	0.01	.	16.4528	0.83997	0.0:0.0:1.0:0.0	.	132	O15020	SPTN2_HUMAN	Y	132	ENSP00000432568:H132Y;ENSP00000311489:H132Y;ENSP00000433593:H132Y	ENSP00000311489:H132Y	H	-	1	0	SPTBN2	66239358	1.000000	0.71417	0.959000	0.39883	0.703000	0.40648	9.595000	0.98260	2.417000	0.82017	0.561000	0.74099	CAC	-	pirsf_Spectrin_bsu,pfam_CH-domain,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain		0.577	SPTBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTBN2	protein_coding	OTTHUMT00000393892.2	G	NM_006946	-		66482782	-1	no_errors	ENST00000309996	ensembl	human	known	74_37	missense	SNP	1.000	A
PCGF2	7703	genome.wustl.edu	37	17	36890780	36890781	+	3'UTR	INS	-	-	AA	rs386386025|rs5820265|rs3066488|rs33995757	byFrequency	TCGA-PC-A5DL-01A-11D-A26G-09	TCGA-PC-A5DL-10A-01D-A26G-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59863adf-efee-4f78-884f-9947c95acec7	ff5644a0-f09f-46ba-b790-9054b5d61ca3	g.chr17:36890780_36890781insAA	ENST00000580830.1	-	0	2431_2432				PCGF2_ENST00000360797.2_3'UTR|RNA5SP440_ENST00000363245.1_RNA|PCGF2_ENST00000581345.1_3'UTR|CISD3_ENST00000578573.1_3'UTR|CISD3_ENST00000439660.2_3'UTR			P35227	PCGF2_HUMAN	polycomb group ring finger 2						anterior/posterior pattern specification (GO:0009952)|cellular response to hydrogen peroxide (GO:0070301)|embryonic skeletal system morphogenesis (GO:0048704)|histone acetylation (GO:0016573)|in utero embryonic development (GO:0001701)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|skin(1)	10	Breast(7;9.07e-22)					ACACACACAGGAAAAAAAAAAA	0.47														1040	0.207668	0.0764	0.2493	5008	,	,		20215	0.2123		0.3062	False		,,,				2504	0.2495																0								ENSG00000230055																																			CISD3	SO:0001624	3_prime_UTR_variant	0				HGNC	D13969	CCDS32638.1	17q12	2013-01-09	2005-01-17	2005-01-19		ENSG00000277258		"""RING-type (C3HC4) zinc fingers"", ""Polycomb group ring fingers"""	12929	protein-coding gene	gene with protein product		600346	"""ring finger protein 110"""	ZNF144, RNF110		8325509	Standard	NM_007144		Approved	MEL-18	uc002hqp.1	P35227		ENST00000580830.1:c.*696->TT	17.37:g.36890789_36890790dupAA		Somatic	0	16	0.00		0.7014536215209443	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	13	23.53	A6NGD8	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000580830.1	37	NULL	CCDS32638.1	17																																																																																			-	-		0.470	PCGF2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CISD3	protein_coding	OTTHUMT00000442246.2	-	NM_007144			36890781	+1	no_errors	ENST00000578573	ensembl	human	known	74_37	rna	INS	0.000:0.000	AA
WNT5B	81029	genome.wustl.edu	37	12	1741866	1741866	+	Silent	SNP	C	C	T			TCGA-PC-A5DL-01A-11D-A26G-09	TCGA-PC-A5DL-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59863adf-efee-4f78-884f-9947c95acec7	ff5644a0-f09f-46ba-b790-9054b5d61ca3	g.chr12:1741866C>T	ENST00000397196.2	+	3	355	c.123C>T	c.(121-123)atC>atT	p.I41I	WNT5B_ENST00000310594.3_Silent_p.I41I|WNT5B_ENST00000542408.1_Silent_p.I41I|WNT5B_ENST00000537031.1_Silent_p.I41I	NM_032642.2	NP_116031.1	Q9H1J7	WNT5B_HUMAN	wingless-type MMTV integration site family, member 5B	41					cell fate commitment (GO:0045165)|cellular response to retinoic acid (GO:0071300)|chondrocyte differentiation (GO:0002062)|fat cell differentiation (GO:0045444)|lens fiber cell development (GO:0070307)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|neuron differentiation (GO:0030182)|positive regulation of cell migration (GO:0030335)|positive regulation of fat cell differentiation (GO:0045600)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cell surface (GO:0009986)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)|receptor binding (GO:0005102)			skin(1)	1	Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.00109)			AGATGTTTATCATCGGTGCCC	0.567																																																	0								ENSG00000111186						113.0	118.0	116.0					12																	1741866		2203	4300	6503	WNT5B	SO:0001819	synonymous_variant	0			-	HGNC	AB060966	CCDS8510.1	12p13.3	2008-07-07			ENSG00000111186	ENSG00000111186		"""Wingless-type MMTV integration sites"""	16265	protein-coding gene	gene with protein product		606361				11445850	Standard	NM_030775		Approved		uc001qjk.3	Q9H1J7	OTTHUMG00000090375	ENST00000397196.2:c.123C>T	12.37:g.1741866C>T		Somatic	0	31	0.00		0.7014536215209443	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52	A8K315|D3DUP9|Q96S49|Q9BV04	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Wnt,smart_Wnt,prints_Wnt	p.I41	ENST00000397196.2	37	c.123	CCDS8510.1	12																																																																																			-	NULL		0.567	WNT5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WNT5B	protein_coding	OTTHUMT00000206747.2	C		-		1741866	+1	no_errors	ENST00000310594	ensembl	human	known	74_37	silent	SNP	1.000	T
TEP1	7011	genome.wustl.edu	37	14	20876097	20876097	+	Missense_Mutation	SNP	G	G	C			TCGA-PC-A5DL-01A-11D-A26G-09	TCGA-PC-A5DL-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59863adf-efee-4f78-884f-9947c95acec7	ff5644a0-f09f-46ba-b790-9054b5d61ca3	g.chr14:20876097G>C	ENST00000262715.5	-	2	542	c.502C>G	c.(502-504)Ctt>Gtt	p.L168V	TEP1_ENST00000556935.1_Missense_Mutation_p.L168V	NM_007110.4	NP_009041.2	Q99973	TEP1_HUMAN	telomerase-associated protein 1	168					RNA-dependent DNA replication (GO:0006278)|telomere maintenance via recombination (GO:0000722)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|ribonucleoprotein complex (GO:0030529)|telomerase holoenzyme complex (GO:0005697)	ATP binding (GO:0005524)|RNA binding (GO:0003723)			NS(4)|breast(1)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(48)|ovary(7)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	96	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;7.42e-08)|all cancers(55;6.46e-07)	GBM - Glioblastoma multiforme(265;0.028)|READ - Rectum adenocarcinoma(17;0.233)		CAGGTTGAAAGGTCTAGTCCC	0.502																																																	0								ENSG00000129566						200.0	197.0	198.0					14																	20876097		2203	4300	6503	TEP1	SO:0001583	missense	0			-	HGNC		CCDS9548.1	14q11.2	2013-01-10			ENSG00000129566	ENSG00000129566		"""WD repeat domain containing"""	11726	protein-coding gene	gene with protein product	"""TROVE domain family, member 1"""	601686				9403057	Standard	NM_007110		Approved	TP1, TLP1, VAULT2, p240, TROVE1	uc001vxe.3	Q99973	OTTHUMG00000029515	ENST00000262715.5:c.502C>G	14.37:g.20876097G>C	ENSP00000262715:p.Leu168Val	Somatic	0	59	0.00		0.7014536215209443	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	35	28.57	A0AUV9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TROVE,pfam_TEP1_N,pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_P-loop_NTPase,smart_WD40_repeat,pfscan_NACHT_NTPase,pfscan_TROVE,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L168V	ENST00000262715.5	37	c.502	CCDS9548.1	14	.	.	.	.	.	.	.	.	.	.	G	3.187	-0.166688	0.06461	.	.	ENSG00000129566	ENST00000262715;ENST00000359243;ENST00000556935	T;T	0.50813	0.87;0.73	3.84	0.913	0.19354	.	1.461800	0.04293	N	0.345955	T	0.33556	0.0867	L	0.29908	0.895	0.09310	N	1	B;B	0.29037	0.231;0.148	B;B	0.22601	0.04;0.018	T	0.22347	-1.0219	10	0.46703	T	0.11	3.0177	4.0555	0.09814	0.2209:0.1953:0.5838:0.0	.	168;168	G3V5X7;Q99973	.;TEP1_HUMAN	V	168	ENSP00000262715:L168V;ENSP00000452574:L168V	ENSP00000262715:L168V	L	-	1	0	TEP1	19945937	0.001000	0.12720	0.000000	0.03702	0.007000	0.05969	0.381000	0.20619	0.194000	0.20326	-0.384000	0.06662	CTT	-	NULL		0.502	TEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TEP1	protein_coding	OTTHUMT00000073563.2	G	NM_007110	-		20876097	-1	no_errors	ENST00000262715	ensembl	human	known	74_37	missense	SNP	0.000	C
OR52N4	390072	genome.wustl.edu	37	11	5776517	5776517	+	Missense_Mutation	SNP	C	C	T			TCGA-PC-A5DL-01A-11D-A26G-09	TCGA-PC-A5DL-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59863adf-efee-4f78-884f-9947c95acec7	ff5644a0-f09f-46ba-b790-9054b5d61ca3	g.chr11:5776517C>T	ENST00000317254.3	+	1	595	c.547C>T	c.(547-549)Cac>Tac	p.H183Y	TRIM5_ENST00000380027.1_Intron	NM_001005175.2	NP_001005175.3	Q8NGI2	O52N4_HUMAN	olfactory receptor, family 52, subfamily N, member 4 (gene/pseudogene)	183						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	26		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;1.87e-10)|LUSC - Lung squamous cell carcinoma(625;0.114)|BRCA - Breast invasive adenocarcinoma(625;0.135)|Lung(200;0.197)		CTACTGTGACCACATGTCTGT	0.468																																																	0								ENSG00000181074						187.0	175.0	179.0					11																	5776517		2182	4291	6473	OR52N4	SO:0001583	missense	0			-	HGNC	AB065813	CCDS44528.1	11p15.4	2013-10-10	2013-10-10		ENSG00000181074	ENSG00000181074		"""GPCR / Class A : Olfactory receptors"""	15230	protein-coding gene	gene with protein product			"""olfactory receptor, family 52, subfamily N, member 4"""				Standard	NM_001005175		Approved		uc001mbu.3	Q8NGI2	OTTHUMG00000066887	ENST00000317254.3:c.547C>T	11.37:g.5776517C>T	ENSP00000323224:p.His183Tyr	Somatic	0	64	0.00		0.7014536215209443	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	39	11.36	B2RNP8|Q6IF77	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.H183Y	ENST00000317254.3	37	c.547	CCDS44528.1	11	.	.	.	.	.	.	.	.	.	.	C	14.74	2.625072	0.46840	.	.	ENSG00000181074	ENST00000317254	T	0.00152	8.66	6.1	6.1	0.99115	GPCR, rhodopsin-like superfamily (1);	0.000000	0.49305	D	0.000153	T	0.00608	0.0020	M	0.87900	2.915	0.29514	N	0.854011	D	0.59767	0.986	D	0.69654	0.965	T	0.48445	-0.9035	10	0.72032	D	0.01	.	19.2784	0.94040	0.0:1.0:0.0:0.0	.	183	Q8NGI2	O52N4_HUMAN	Y	183	ENSP00000323224:H183Y	ENSP00000323224:H183Y	H	+	1	0	OR52N4	5733093	0.038000	0.19896	1.000000	0.80357	0.372000	0.29890	0.382000	0.20635	2.902000	0.99343	0.650000	0.86243	CAC	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt		0.468	OR52N4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52N4	protein_coding	OTTHUMT00000143350.1	C	NM_001005175	-		5776517	+1	no_errors	ENST00000317254	ensembl	human	known	74_37	missense	SNP	0.996	T
SORCS1	114815	genome.wustl.edu	37	10	108434899	108434899	+	Missense_Mutation	SNP	T	T	A			TCGA-PC-A5DL-01A-11D-A26G-09	TCGA-PC-A5DL-10A-01D-A26G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59863adf-efee-4f78-884f-9947c95acec7	ff5644a0-f09f-46ba-b790-9054b5d61ca3	g.chr10:108434899T>A	ENST00000263054.6	-	14	1855	c.1848A>T	c.(1846-1848)gaA>gaT	p.E616D	SORCS1_ENST00000369698.1_Missense_Mutation_p.E151D|SORCS1_ENST00000344440.6_Missense_Mutation_p.E616D	NM_001206570.1|NM_052918.4	NP_001193499.1|NP_443150.3	Q8WY21	SORC1_HUMAN	sortilin-related VPS10 domain containing receptor 1	616					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	neuropeptide receptor activity (GO:0008188)			breast(5)|central_nervous_system(1)|cervix(2)|endometrium(9)|kidney(2)|large_intestine(24)|lung(69)|ovary(1)|prostate(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	127		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		AAGATCTCCCTTCATCAAAAC	0.383																																																	0								ENSG00000108018						97.0	93.0	94.0					10																	108434899		2203	4300	6503	SORCS1	SO:0001583	missense	0			-	HGNC	AF284756	CCDS7559.1	10q23-q25	2004-04-20			ENSG00000108018	ENSG00000108018			16697	protein-coding gene	gene with protein product		606283				11499680	Standard	NM_001206570		Approved	sorCS1	uc001kyl.3	Q8WY21	OTTHUMG00000019018	ENST00000263054.6:c.1848A>T	10.37:g.108434899T>A	ENSP00000263054:p.Glu616Asp	Somatic	0	30	0.00		0.7014536215209443	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	14	39.13	A2RRF4|Q59GG7|Q5JVT7|Q5JVT8|Q5VY14|Q86WQ1|Q86WQ2|Q9H1Y1|Q9H1Y2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PKD_dom,superfamily_PKD_dom,smart_VPS10,pfscan_PKD_dom	p.E616D	ENST00000263054.6	37	c.1848	CCDS7559.1	10	.	.	.	.	.	.	.	.	.	.	T	22.5	4.300777	0.81136	.	.	ENSG00000108018	ENST00000369698;ENST00000263054;ENST00000344440	T;T;T	0.38722	1.12;1.12;1.12	5.92	4.79	0.61399	VPS10 (1);	0.048853	0.85682	D	0.000000	T	0.64983	0.2648	M	0.85542	2.76	0.41029	D	0.985148	D;D;D;D;D	0.89917	0.999;1.0;1.0;0.999;1.0	D;D;D;D;D	0.91635	0.997;0.999;0.999;0.997;0.999	T	0.67933	-0.5542	9	.	.	.	-17.4375	9.0098	0.36135	0.0:0.1413:0.0:0.8587	.	616;616;616;616;616	A8K182;Q8WY21-4;Q8WY21-3;Q8WY21;Q8WY21-2	.;.;.;SORC1_HUMAN;.	D	151;616;616	ENSP00000358712:E151D;ENSP00000263054:E616D;ENSP00000345964:E616D	.	E	-	3	2	SORCS1	108424889	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.290000	0.51755	1.062000	0.40625	0.533000	0.62120	GAA	-	smart_VPS10		0.383	SORCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SORCS1	protein_coding	OTTHUMT00000050232.4	T	NM_052918	-		108434899	-1	no_errors	ENST00000344440	ensembl	human	known	74_37	missense	SNP	1.000	A
RP11-24M17.4	0	genome.wustl.edu	37	15	76054552	76054552	+	RNA	SNP	A	A	G			TCGA-PC-A5DL-01A-11D-A26G-09	TCGA-PC-A5DL-10A-01D-A26G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59863adf-efee-4f78-884f-9947c95acec7	ff5644a0-f09f-46ba-b790-9054b5d61ca3	g.chr15:76054552A>G	ENST00000569596.1	+	0	169				MIR4313_ENST00000580760.1_lincRNA																							CAAGCTGAGGAGTGAGCAGGC	0.637																																																	0								ENSG00000261043																																			MIR4313			0			-	HGNC																													15.37:g.76054552A>G		Somatic	0	48	0.00		0.7014536215209443	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	56	9.68		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000569596.1	37	NULL		15																																																																																			-	-		0.637	RP11-24M17.4-002	KNOWN	basic	lincRNA	MIR4313	processed_transcript	OTTHUMT00000420499.1	A		-		76054552	-1	no_errors	ENST00000561777	ensembl	human	known	74_37	rna	SNP	0.005	G
MDGA1	266727	genome.wustl.edu	37	6	37612423	37612423	+	Missense_Mutation	SNP	T	T	C			TCGA-PC-A5DL-01A-11D-A26G-09	TCGA-PC-A5DL-10A-01D-A26G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59863adf-efee-4f78-884f-9947c95acec7	ff5644a0-f09f-46ba-b790-9054b5d61ca3	g.chr6:37612423T>C	ENST00000434837.3	-	13	3429	c.2251A>G	c.(2251-2253)Aac>Gac	p.N751D	MDGA1_ENST00000505425.1_Missense_Mutation_p.N751D|MDGA1_ENST00000297153.7_Missense_Mutation_p.N755D|MDGA1_ENST00000510077.1_5'Flank	NM_153487.3	NP_705691.1	Q8NFP4	MDGA1_HUMAN	MAM domain containing glycosylphosphatidylinositol anchor 1	751	MAM. {ECO:0000255|PROSITE- ProRule:PRU00128}.				brain development (GO:0007420)|cerebral cortex radially oriented cell migration (GO:0021799)|neuron migration (GO:0001764)|spinal cord association neuron differentiation (GO:0021527)	anchored component of plasma membrane (GO:0046658)|extracellular space (GO:0005615)				central_nervous_system(2)|endometrium(6)|kidney(3)|large_intestine(12)|lung(11)|prostate(1)|skin(2)|urinary_tract(1)	38						TGGCAGGTGTTGTCTGCATTT	0.567																																																	0								ENSG00000112139						74.0	78.0	77.0					6																	37612423		2044	4191	6235	MDGA1	SO:0001583	missense	0			-	HGNC	AF478693	CCDS47417.1	6p21	2013-01-29			ENSG00000112139	ENSG00000112139		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19267	protein-coding gene	gene with protein product		609626				15922729, 15019943	Standard	NM_153487		Approved	GPIM, MAMDC3	uc003onu.1	Q8NFP4	OTTHUMG00000014626	ENST00000434837.3:c.2251A>G	6.37:g.37612423T>C	ENSP00000402584:p.Asn751Asp	Somatic	0	47	0.00		0.7014536215209443	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	5	80.77	A6NHG0|Q8NBE3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_MAM_dom,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_MAM_dom,pfscan_Fibronectin_type3,pfscan_MAM_dom,pfscan_Ig-like_dom	p.N755D	ENST00000434837.3	37	c.2263	CCDS47417.1	6	.	.	.	.	.	.	.	.	.	.	T	11.85	1.763007	0.31228	.	.	ENSG00000112139	ENST00000434837;ENST00000297153;ENST00000505425	T;T;T	0.01981	4.52;4.52;4.52	5.18	5.18	0.71444	Concanavalin A-like lectin/glucanase (1);MAM domain (2);	0.000000	0.51477	D	0.000089	T	0.01061	0.0035	L	0.40543	1.245	0.39226	D	0.96358	B;P	0.38535	0.42;0.635	B;B	0.32289	0.143;0.121	T	0.66666	-0.5866	10	0.30078	T	0.28	.	14.5406	0.67990	0.0:0.0:0.0:1.0	.	751;751	Q8NFP4-2;Q8NFP4	.;MDGA1_HUMAN	D	751;755;751	ENSP00000402584:N751D;ENSP00000297153:N755D;ENSP00000422042:N751D	ENSP00000297153:N755D	N	-	1	0	MDGA1	37720401	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	2.706000	0.47135	2.081000	0.62600	0.533000	0.62120	AAC	-	superfamily_ConA-like_lec_gl_sf,smart_MAM_dom,pfscan_MAM_dom		0.567	MDGA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MDGA1	protein_coding	OTTHUMT00000040419.3	T		-		37612423	-1	no_errors	ENST00000297153	ensembl	human	known	74_37	missense	SNP	1.000	C
NCOR2	9612	genome.wustl.edu	37	12	124824739	124824740	+	Frame_Shift_Ins	INS	-	-	GCCG			TCGA-PC-A5DL-01A-11D-A26G-09	TCGA-PC-A5DL-10A-01D-A26G-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59863adf-efee-4f78-884f-9947c95acec7	ff5644a0-f09f-46ba-b790-9054b5d61ca3	g.chr12:124824739_124824740insGCCG	ENST00000405201.1	-	37	5499_5500	c.5499_5500insCGGC	c.(5497-5502)cagagcfs	p.S1834fs	NCOR2_ENST00000397355.1_Frame_Shift_Ins_p.S1825fs|NCOR2_ENST00000404621.1_Frame_Shift_Ins_p.S1824fs|NCOR2_ENST00000429285.2_Frame_Shift_Ins_p.S1824fs|NCOR2_ENST00000356219.3_Frame_Shift_Ins_p.S1841fs|NCOR2_ENST00000404121.2_Frame_Shift_Ins_p.S1395fs			Q9Y618	NCOR2_HUMAN	nuclear receptor corepressor 2	1845					cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|regulation of cellular ketone metabolic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072365)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|Notch binding (GO:0005112)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(7)|lung(28)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		ctgccgctgctctgctCTGTAC	0.713																																																	0								ENSG00000196498																																			NCOR2	SO:0001589	frameshift_variant	0				HGNC	U37146	CCDS41857.1, CCDS41858.1, CCDS41857.2, CCDS41858.2, CCDS55892.1	12q24	2010-06-10	2010-06-10		ENSG00000196498	ENSG00000196498			7673	protein-coding gene	gene with protein product		600848	"""nuclear receptor co-repressor 2"""			7566127, 8813722	Standard	NM_001077261		Approved	SMRT, SMRTE, TRAC-1, CTG26, TNRC14	uc010tbb.2	Q9Y618	OTTHUMG00000150455	ENST00000405201.1:c.5499_5500insCGGC	12.37:g.124824739_124824740insGCCG	ENSP00000384018:p.Ser1834fs	Somatic	0	41	0.00		0.7014536215209443	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	41	12.77	O00613|O15416|O15421|Q13354|Q56D06|Q59GM0|Q9Y5U0	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_SANT/Myb,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.S1840fs	ENST00000405201.1	37	c.5521_5520	CCDS41858.2	12																																																																																			-	NULL		0.713	NCOR2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	NCOR2	protein_coding	OTTHUMT00000318173.2	-	NM_006312			124824740	-1	no_errors	ENST00000356219	ensembl	human	known	74_37	frame_shift_ins	INS	1.000:1.000	GCCG
XIST	7503	genome.wustl.edu	37	X	73071940	73071941	+	lincRNA	INS	-	-	A	rs397895191|rs36033063		TCGA-PC-A5DL-01A-11D-A26G-09	TCGA-PC-A5DL-10A-01D-A26G-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59863adf-efee-4f78-884f-9947c95acec7	ff5644a0-f09f-46ba-b790-9054b5d61ca3	g.chrX:73071940_73071941insA	ENST00000429829.1	-	0	647_648					NR_001564.2				X inactive specific transcript (non-protein coding)																		CAAGGAAAAATAAAAAAAAAAA	0.45																																																	0								ENSG00000229807																																			XIST			0				HGNC	M97168		Xq13.2	2013-12-18	2013-02-07		ENSG00000229807	ENSG00000229807		"""Long non-coding RNAs"", ""-"""	12810	non-coding RNA	RNA, long non-coding	"""long intergenic non-protein coding RNA 1"""	314670	"""X (inactive)-specific transcript"", ""X (inactive)-specific transcript (non-protein coding)"""	DXS399E		1985261, 2034279	Standard	NR_001564		Approved	NCRNA00001, DXS1089, swd66, LINC00001	uc004ebm.2		OTTHUMG00000021839		X.37:g.73071951_73071951dupA		Somatic	0	24	0.00		0.7014536215209443	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	21	12.50		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000429829.1	37	NULL		X																																																																																			-	-		0.450	XIST-001	KNOWN	basic	lincRNA	XIST	lincRNA	OTTHUMT00000057239.1	-	NR_001564			73071941	-1	no_errors	ENST00000429829	ensembl	human	known	74_37	rna	INS	0.568:0.531	A
XYLB	9942	genome.wustl.edu	37	3	38411731	38411732	+	Intron	INS	-	-	CACACACACA	rs196387|rs71085317|rs150130857	byFrequency	TCGA-PC-A5DL-01A-11D-A26G-09	TCGA-PC-A5DL-10A-01D-A26G-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59863adf-efee-4f78-884f-9947c95acec7	ff5644a0-f09f-46ba-b790-9054b5d61ca3	g.chr3:38411731_38411732insCACACACACA	ENST00000207870.3	+	9	855				XYLB_ENST00000542835.1_Intron	NM_005108.3	NP_005099.2	O75191	XYLB_HUMAN	xylulokinase homolog (H. influenzae)						carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|D-xylose metabolic process (GO:0042732)|generation of precursor metabolites and energy (GO:0006091)|xylulose catabolic process (GO:0005998)|xylulose metabolic process (GO:0005997)	extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|xylulokinase activity (GO:0004856)			endometrium(3)|kidney(3)|large_intestine(3)|liver(1)|lung(12)|ovary(1)|prostate(1)	24				KIRC - Kidney renal clear cell carcinoma(284;0.00372)|Kidney(284;0.00405)		GCACTGTAGCGcacacacacac	0.5														304	0.0607029	0.0484	0.0548	5008	,	,		17817	0.0655		0.0825	False		,,,				2504	0.0542																0								ENSG00000093217																																			XYLB	SO:0001627	intron_variant	0				HGNC	AB015046	CCDS2678.1	3p22-p21.3	2006-12-18	2001-12-04		ENSG00000093217	ENSG00000093217			12839	protein-coding gene	gene with protein product		604049	"""xylulokinase (H. influenzae) homolog"""			9763671	Standard	NM_005108		Approved	FLJ10343, FLJ12539	uc003cic.2	O75191	OTTHUMG00000131294	ENST00000207870.3:c.765+66->CACACACACA	3.37:g.38411732_38411741dupCACACACACA		Somatic	NA	NA	NA		0.7014536215209443	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B2RAW4|B4DDT2|B9EH64	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000207870.3	37	NULL	CCDS2678.1	3																																																																																			-	-		0.500	XYLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XYLB	protein_coding	OTTHUMT00000254062.2	-	NM_005108			38411732	+1	no_errors	ENST00000487569	ensembl	human	putative	74_37	rna	INS	0.000:0.000	CACACACACA
LINC00969	440993	genome.wustl.edu	37	3	195390553	195390553	+	lincRNA	SNP	A	A	G	rs201494538		TCGA-PC-A5DL-01A-11D-A26G-09	TCGA-PC-A5DL-10A-01D-A26G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59863adf-efee-4f78-884f-9947c95acec7	ff5644a0-f09f-46ba-b790-9054b5d61ca3	g.chr3:195390553A>G	ENST00000445430.1	+	0	397									long intergenic non-protein coding RNA 969																		TGGCATTTCTATGACACCGTG	0.592																																																	0								ENSG00000242086																																			LINC00969			0			-	HGNC	AK128346		3q29	2013-06-07			ENSG00000242086	ENSG00000242086		"""Long non-coding RNAs"""	48729	non-coding RNA	RNA, long non-coding							Standard	XR_427455		Approved				OTTHUMG00000155834		3.37:g.195390553A>G		Somatic	0	30	0.00		0.7014536215209443	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	7	22.22		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000445430.1	37	NULL		3																																																																																			-	-		0.592	LINC00969-038	KNOWN	basic	lincRNA	LINC00969	lincRNA	OTTHUMT00000341951.1	A		rs201494538		195390553	+1	no_errors	ENST00000414625	ensembl	human	known	74_37	rna	SNP	1.000	G
MUC4	4585	genome.wustl.edu	37	3	195507032	195507032	+	Missense_Mutation	SNP	T	T	A			TCGA-PC-A5DL-01A-11D-A26G-09	TCGA-PC-A5DL-10A-01D-A26G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59863adf-efee-4f78-884f-9947c95acec7	ff5644a0-f09f-46ba-b790-9054b5d61ca3	g.chr3:195507032T>A	ENST00000463781.3	-	2	11878	c.11419A>T	c.(11419-11421)Acc>Tcc	p.T3807S	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.T3807S	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GGAAGAGGGGTGGCCTGACCT	0.612																																																	0								ENSG00000145113						9.0	7.0	8.0					3																	195507032		651	1539	2190	MUC4	SO:0001583	missense	0			-	HGNC	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.11419A>T	3.37:g.195507032T>A	ENSP00000417498:p.Thr3807Ser	Somatic	0	143	0.00		0.7014536215209443	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	81	10.00	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EG-like_dom,pfscan_AMOP,pfscan_EG-like_dom	p.T3807S	ENST00000463781.3	37	c.11419	CCDS54700.1	3	.	.	.	.	.	.	.	.	.	.	t	3.824	-0.037094	0.07497	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.39406	1.08;1.15	.	.	.	.	.	.	.	.	T	0.19765	0.0475	N	0.19112	0.55	0.09310	N	1	P	0.37985	0.613	B	0.30029	0.11	T	0.10989	-1.0606	7	.	.	.	.	4.4978	0.11848	0.0:7.0E-4:0.0:0.9993	.	3679	E7ESK3	.	S	3807	ENSP00000417498:T3807S;ENSP00000420243:T3807S	.	T	-	1	0	MUC4	196991811	0.000000	0.05858	0.020000	0.16555	0.020000	0.10135	-2.590000	0.00899	0.056000	0.16144	0.055000	0.15244	ACC	-	NULL		0.612	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	protein_coding	OTTHUMT00000324081.6	T	NM_018406	-		195507032	-1	no_errors	ENST00000463781	ensembl	human	known	74_37	missense	SNP	0.318	A
OTOP1	133060	genome.wustl.edu	37	4	4199618	4199618	+	Missense_Mutation	SNP	C	C	T	rs561501386		TCGA-PC-A5DL-01A-11D-A26G-09	TCGA-PC-A5DL-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59863adf-efee-4f78-884f-9947c95acec7	ff5644a0-f09f-46ba-b790-9054b5d61ca3	g.chr4:4199618C>T	ENST00000296358.4	-	5	967	c.943G>A	c.(943-945)Gca>Aca	p.A315T		NM_177998.1	NP_819056.1	Q7RTM1	OTOP1_HUMAN	otopetrin 1	315					biomineral tissue development (GO:0031214)|detection of gravity (GO:0009590)|inner ear morphogenesis (GO:0042472)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|liver(4)|lung(14)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		CCCAGGACTGCGCCCACCATG	0.567													C|||	1	0.000199681	0.0	0.0	5008	,	,		19032	0.0		0.0	False		,,,				2504	0.001																0								ENSG00000163982						59.0	54.0	55.0					4																	4199618		2203	4300	6503	OTOP1	SO:0001583	missense	0			-	HGNC	BK000653	CCDS3372.1	4p16.2	2008-02-05			ENSG00000163982	ENSG00000163982			19656	protein-coding gene	gene with protein product		607806				12651873	Standard	NM_177998		Approved		uc003ghp.1	Q7RTM1	OTTHUMG00000090301	ENST00000296358.4:c.943G>A	4.37:g.4199618C>T	ENSP00000296358:p.Ala315Thr	Somatic	0	61	0.00		0.7014536215209443	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	28	38	42.42	A1L476	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Otopetrin	p.A315T	ENST00000296358.4	37	c.943	CCDS3372.1	4	.	.	.	.	.	.	.	.	.	.	C	0.925	-0.714741	0.03206	.	.	ENSG00000163982	ENST00000296358	T	0.21734	1.99	4.8	1.94	0.25998	.	0.464440	0.21353	N	0.075923	T	0.04497	0.0123	N	0.00926	-1.1	0.23089	N	0.998317	B	0.09022	0.002	B	0.06405	0.002	T	0.40683	-0.9550	10	0.06099	T	0.92	.	4.3301	0.11059	0.4535:0.143:0.0:0.4035	.	315	Q7RTM1	OTOP1_HUMAN	T	315	ENSP00000296358:A315T	ENSP00000296358:A315T	A	-	1	0	OTOP1	4250519	0.999000	0.42202	0.480000	0.27341	0.011000	0.07611	1.890000	0.39728	0.789000	0.33779	0.404000	0.27445	GCA	-	pfam_Otopetrin		0.567	OTOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OTOP1	protein_coding	OTTHUMT00000206661.2	C	NM_177998	-		4199618	-1	no_errors	ENST00000296358	ensembl	human	known	74_37	missense	SNP	0.965	T
PDXDC2P	283970	genome.wustl.edu	37	16	70057280	70057280	+	RNA	DEL	A	A	-			TCGA-PC-A5DL-01A-11D-A26G-09	TCGA-PC-A5DL-10A-01D-A26G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59863adf-efee-4f78-884f-9947c95acec7	ff5644a0-f09f-46ba-b790-9054b5d61ca3	g.chr16:70057280delA	ENST00000531894.1	-	0	1132					NR_003610.1		Q6P474	PDXD2_HUMAN	pyridoxal-dependent decarboxylase domain containing 2, pseudogene						carboxylic acid metabolic process (GO:0019752)		carboxy-lyase activity (GO:0016831)|pyridoxal phosphate binding (GO:0030170)										GGGGAAACTTACCAAGGCAGG	0.502																																																	0								ENSG00000196696																																			PDXDC2P			0				HGNC			16q22.1	2014-03-20	2010-09-02	2010-09-02	ENSG00000196696	ENSG00000196696			27559	pseudogene	pseudogene			"""pyridoxal-dependent decarboxylase domain containing 2"""	PDXDC2			Standard	NR_003610		Approved	DKFZp761H1120	uc010vlq.1	Q6P474	OTTHUMG00000167595		16.37:g.70057280delA		Somatic	0	19	0.00		0.7014536215209443	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	5	64.29	A8K9Z5	Splice_Site	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000531894.1	37	c.NULL		16																																																																																			-	-		0.502	PDXDC2P-001	KNOWN	basic|readthrough_transcript	processed_transcript	PDXDC2P	processed_transcript	OTTHUMT00000395258.1	A				70057280	-1	no_errors	ENST00000325845	ensembl	human	known	74_37	splice_site_del	DEL	1.000	-
PTPRM	5797	genome.wustl.edu	37	18	7955245	7955245	+	Missense_Mutation	SNP	C	C	T			TCGA-PC-A5DL-01A-11D-A26G-09	TCGA-PC-A5DL-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59863adf-efee-4f78-884f-9947c95acec7	ff5644a0-f09f-46ba-b790-9054b5d61ca3	g.chr18:7955245C>T	ENST00000332175.8	+	7	2002	c.965C>T	c.(964-966)aCg>aTg	p.T322M	PTPRM_ENST00000400060.4_Missense_Mutation_p.T322M|PTPRM_ENST00000580170.1_Missense_Mutation_p.T322M|PTPRM_ENST00000400053.4_Missense_Mutation_p.T260M|PTPRM_ENST00000444013.1_Missense_Mutation_p.T109M	NM_002845.3	NP_002836.3	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M	322	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				homophilic cell adhesion (GO:0007156)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|neuron projection development (GO:0031175)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of vasodilation (GO:0045909)|protein dephosphorylation (GO:0006470)|response to drug (GO:0042493)|retina layer formation (GO:0010842)|retinal ganglion cell axon guidance (GO:0031290)|signal transduction (GO:0007165)	cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|perinuclear region of cytoplasm (GO:0048471)	cadherin binding (GO:0045296)|identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(32)|lung(25)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	90		Colorectal(10;0.234)				GAGTACTGCACGGCCAGTGGG	0.552																																																	0								ENSG00000173482						49.0	47.0	47.0					18																	7955245		2203	4300	6503	PTPRM	SO:0001583	missense	0			-	HGNC	X58288	CCDS11840.1, CCDS58613.1	18p11.2	2013-02-11			ENSG00000173482	ENSG00000173482		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9675	protein-coding gene	gene with protein product		176888		PTPRL1		1655529, 8404049	Standard	NM_002845		Approved	RPTPU, hR-PTPu	uc010dkv.3	P28827	OTTHUMG00000131575	ENST00000332175.8:c.965C>T	18.37:g.7955245C>T	ENSP00000331418:p.Thr322Met	Somatic	0	16	0.00		0.7014536215209443	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	5	68.75	A7MBN1|D3DUH8|J3QL11	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_MAM_dom,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_MAM_dom,smart_Ig_sub,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_MAM_dom,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Ig-like_dom,prints_Tyr_Pase_rcpt/non-rcpt,prints_MAM_dom	p.T322M	ENST00000332175.8	37	c.965	CCDS11840.1	18	.	.	.	.	.	.	.	.	.	.	C	16.12	3.034330	0.54896	.	.	ENSG00000173482	ENST00000332175;ENST00000400060;ENST00000400053;ENST00000444013	T;T;T;T	0.57907	0.37;0.37;0.37;0.37	6.02	6.02	0.97574	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.58595	0.2133	N	0.12471	0.22	0.80722	D	1	D;D;D	0.89917	0.986;1.0;1.0	P;D;D	0.97110	0.741;1.0;1.0	T	0.59289	-0.7482	10	0.34782	T	0.22	.	20.5407	0.99260	0.0:1.0:0.0:0.0	.	109;322;322	E7EVX9;A7MBN1;P28827	.;.;PTPRM_HUMAN	M	322;322;260;109	ENSP00000331418:T322M;ENSP00000382933:T322M;ENSP00000382927:T260M;ENSP00000387608:T109M	ENSP00000331418:T322M	T	+	2	0	PTPRM	7945245	1.000000	0.71417	0.951000	0.38953	0.986000	0.74619	7.818000	0.86416	2.865000	0.98341	0.655000	0.94253	ACG	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.552	PTPRM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTPRM	protein_coding	OTTHUMT00000254456.1	C		-		7955245	+1	no_errors	ENST00000400060	ensembl	human	known	74_37	missense	SNP	1.000	T
TRPC3	7222	genome.wustl.edu	37	4	122853578	122853578	+	Missense_Mutation	SNP	C	C	T			TCGA-PC-A5DL-01A-11D-A26G-09	TCGA-PC-A5DL-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59863adf-efee-4f78-884f-9947c95acec7	ff5644a0-f09f-46ba-b790-9054b5d61ca3	g.chr4:122853578C>T	ENST00000379645.3	-	2	908	c.835G>A	c.(835-837)Gac>Aac	p.D279N	TRPC3_ENST00000264811.5_Missense_Mutation_p.D206N|TRPC3_ENST00000513531.1_Missense_Mutation_p.D206N	NM_001130698.1	NP_001124170.1	Q13507	TRPC3_HUMAN	transient receptor potential cation channel, subfamily C, member 3	194					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|phototransduction (GO:0007602)|platelet activation (GO:0030168)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of cardiac muscle hypertrophy in response to stress (GO:1903244)|response to ATP (GO:0033198)|response to calcium ion (GO:0051592)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(1)|large_intestine(12)|lung(13)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	51						CTGAAGGAGTCGTGCCTCTGC	0.602																																																	0								ENSG00000138741						50.0	45.0	46.0					4																	122853578		2203	4300	6503	TRPC3	SO:0001583	missense	0			-	HGNC	Y13758	CCDS3725.1, CCDS47130.1	4q27	2011-12-14			ENSG00000138741	ENSG00000138741		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12335	protein-coding gene	gene with protein product		602345				8646775, 16382100	Standard	NM_003305		Approved		uc003ieg.2	Q13507	OTTHUMG00000133069	ENST00000379645.3:c.835G>A	4.37:g.122853578C>T	ENSP00000368966:p.Asp279Asn	Somatic	0	25	0.00		0.7014536215209443	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	23	37.84	A7VJS1|E9PCJ9|O00593|Q15660|Q52M35|Q5G1L5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_TRP_dom,pfam_PKD1_2_channel,superfamily_Ankyrin_rpt-contain_dom,superfamily_ARM-type_fold,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_TRPC3_channel,prints_TRPC_channel,tigrfam_TRP_channel	p.D279N	ENST00000379645.3	37	c.835	CCDS47130.1	4	.	.	.	.	.	.	.	.	.	.	C	17.48	3.401147	0.62288	.	.	ENSG00000138741	ENST00000264811;ENST00000379645;ENST00000513531	D;D;D	0.84873	-1.91;-1.91;-1.91	5.34	4.5	0.54988	.	0.000000	0.85682	D	0.000000	D	0.92561	0.7637	M	0.85945	2.785	0.50039	D	0.999843	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.93466	0.6815	10	0.87932	D	0	-16.0276	13.8389	0.63426	0.0:0.9268:0.0:0.0732	.	206;279	E9PCJ9;Q5G1L5	.;.	N	206;279;206	ENSP00000264811:D206N;ENSP00000368966:D279N;ENSP00000426899:D206N	ENSP00000264811:D206N	D	-	1	0	TRPC3	123073028	1.000000	0.71417	0.993000	0.49108	0.140000	0.21249	7.652000	0.83633	1.249000	0.43950	0.655000	0.94253	GAC	-	pfam_TRP_dom,tigrfam_TRP_channel		0.602	TRPC3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRPC3	protein_coding	OTTHUMT00000364252.1	C	NM_003305	-		122853578	-1	no_errors	ENST00000379645	ensembl	human	known	74_37	missense	SNP	1.000	T
FCHO1	23149	genome.wustl.edu	37	19	17886885	17886885	+	Missense_Mutation	SNP	C	C	A			TCGA-PC-A5DL-01A-11D-A26G-09	TCGA-PC-A5DL-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59863adf-efee-4f78-884f-9947c95acec7	ff5644a0-f09f-46ba-b790-9054b5d61ca3	g.chr19:17886885C>A	ENST00000596536.1	+	16	1380	c.1097C>A	c.(1096-1098)gCc>gAc	p.A366D	FCHO1_ENST00000539407.1_Missense_Mutation_p.A366D|FCHO1_ENST00000595033.1_Missense_Mutation_p.A316D|FCHO1_ENST00000389133.4_Missense_Mutation_p.A366D|FCHO1_ENST00000600676.1_Missense_Mutation_p.A366D|FCHO1_ENST00000597512.1_Missense_Mutation_p.A373D|FCHO1_ENST00000594202.1_Missense_Mutation_p.A366D|FCHO1_ENST00000252771.7_Missense_Mutation_p.A366D|FCHO1_ENST00000596951.1_Missense_Mutation_p.A366D	NM_015122.2	NP_055937.1	O14526	FCHO1_HUMAN	FCH domain only 1	366	Mediates interaction with the adaptor protein complex AP-2.				clathrin coat assembly (GO:0048268)|clathrin-mediated endocytosis (GO:0072583)	coated pit (GO:0005905)|plasma membrane (GO:0005886)	AP-2 adaptor complex binding (GO:0035612)			NS(2)|breast(1)|large_intestine(6)|liver(1)|lung(12)	22						CCTGCCCCGGCCCGGGCTCCA	0.697																																																	0								ENSG00000130475						41.0	44.0	43.0					19																	17886885		2203	4299	6502	FCHO1	SO:0001583	missense	0			-	HGNC	AB006628	CCDS32955.1, CCDS59365.1, CCDS59366.1	19p13.12	2008-02-05				ENSG00000130475			29002	protein-coding gene	gene with protein product		613437				12477932	Standard	NM_001161357		Approved	KIAA0290	uc002nhg.3	O14526		ENST00000596536.1:c.1097C>A	19.37:g.17886885C>A	ENSP00000470731:p.Ala366Asp	Somatic	0	43	0.00		0.7014536215209443	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	26	43.48	A6NHE6|A8K5U5|B4E120|Q05C93|Q8IW22	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Muniscin_C-term_mu_dom,pfam_FCH_dom,superfamily_Clathrin_mu_C,smart_FCH_dom,pfscan_FCH_dom	p.A366D	ENST00000596536.1	37	c.1097	CCDS32955.1	19	.	.	.	.	.	.	.	.	.	.	C	13.30	2.197261	0.38806	.	.	ENSG00000130475	ENST00000252771;ENST00000389133;ENST00000539407	T;T;T	0.35605	1.3;1.3;1.3	4.58	4.58	0.56647	.	0.536774	0.19265	N	0.118575	T	0.30727	0.0774	L	0.29908	0.895	0.40553	D	0.981132	P;P	0.42203	0.664;0.773	B;B	0.43274	0.235;0.414	T	0.06862	-1.0803	10	0.33940	T	0.23	-9.7988	12.8696	0.57957	0.0:1.0:0.0:0.0	.	366;366	O14526;O14526-2	FCHO1_HUMAN;.	D	366	ENSP00000252771:A366D;ENSP00000373785:A366D;ENSP00000437978:A366D	ENSP00000252771:A366D	A	+	2	0	FCHO1	17747885	0.995000	0.38212	0.718000	0.30602	0.802000	0.45316	3.762000	0.55250	2.078000	0.62432	0.491000	0.48974	GCC	-	NULL		0.697	FCHO1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	FCHO1	protein_coding	OTTHUMT00000466946.2	C	NM_015122	-		17886885	+1	no_errors	ENST00000252771	ensembl	human	known	74_37	missense	SNP	0.821	A
FRG1	2483	genome.wustl.edu	37	4	190874255	190874255	+	Missense_Mutation	SNP	A	A	T	rs17425201		TCGA-PC-A5DL-01A-11D-A26G-09	TCGA-PC-A5DL-10A-01D-A26G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59863adf-efee-4f78-884f-9947c95acec7	ff5644a0-f09f-46ba-b790-9054b5d61ca3	g.chr4:190874255A>T	ENST00000226798.4	+	4	514	c.292A>T	c.(292-294)Acg>Tcg	p.T98S	FRG1_ENST00000514482.1_3'UTR	NM_004477.2	NP_004468.1	Q14331	FRG1_HUMAN	FSHD region gene 1	98					mRNA splicing, via spliceosome (GO:0000398)|muscle organ development (GO:0007517)|rRNA processing (GO:0006364)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)	p.T98S(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|lung(11)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|urinary_tract(1)	32		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)		all cancers(3;1.73e-30)|Epithelial(3;5.85e-30)|OV - Ovarian serous cystadenocarcinoma(60;5.56e-15)|BRCA - Breast invasive adenocarcinoma(30;9.14e-06)|Lung(3;3.54e-05)|STAD - Stomach adenocarcinoma(60;8.83e-05)|LUSC - Lung squamous cell carcinoma(40;0.000198)|GBM - Glioblastoma multiforme(59;0.00892)|READ - Rectum adenocarcinoma(43;0.161)		AGAGCAGTTTACGGCTGTCAA	0.269																																																	1	Substitution - Missense(1)	NS(1)						ENSG00000109536																																			FRG1	SO:0001583	missense	0			-	HGNC	L76159	CCDS34121.1	4q35	2008-02-05			ENSG00000109536	ENSG00000109536			3954	protein-coding gene	gene with protein product		601278				8733123	Standard	XM_005262880		Approved	FSG1, FRG1A	uc003izs.3	Q14331	OTTHUMG00000160202	ENST00000226798.4:c.292A>T	4.37:g.190874255A>T	ENSP00000226798:p.Thr98Ser	Somatic	0	136	0.00		0.7014536215209443	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	116	13.43	A8K775	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_FRG1,pfam_Fascin-domain,superfamily_Actin_cross-linking	p.T98S	ENST00000226798.4	37	c.292	CCDS34121.1	4	.	.	.	.	.	.	.	.	.	.	.	15.38	2.815686	0.50527	.	.	ENSG00000109536	ENST00000226798;ENST00000531991	T;T	0.52057	1.8;0.68	3.71	3.71	0.42584	Actin cross-linking (1);	0.093692	0.64402	D	0.000001	T	0.23926	0.0579	N	0.02539	-0.55	0.58432	D	0.999999	B	0.20261	0.043	B	0.27796	0.083	T	0.08207	-1.0733	10	0.39692	T	0.17	-1.9466	11.0497	0.47880	1.0:0.0:0.0:0.0	rs17425201	98	Q14331	FRG1_HUMAN	S	98;35	ENSP00000226798:T98S;ENSP00000435943:T35S	ENSP00000226798:T98S	T	+	1	0	FRG1	191111249	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	6.637000	0.74304	1.645000	0.50612	0.514000	0.50259	ACG	-	pfam_FRG1,pfam_Fascin-domain,superfamily_Actin_cross-linking		0.269	FRG1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	FRG1	protein_coding	OTTHUMT00000359622.4	A	NM_004477	rs75162394		190874255	+1	no_errors	ENST00000226798	ensembl	human	known	74_37	missense	SNP	1.000	T
DQX1	165545	genome.wustl.edu	37	2	74751281	74751281	+	Silent	SNP	C	C	A			TCGA-PC-A5DL-01A-11D-A26G-09	TCGA-PC-A5DL-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59863adf-efee-4f78-884f-9947c95acec7	ff5644a0-f09f-46ba-b790-9054b5d61ca3	g.chr2:74751281C>A	ENST00000404568.3	-	4	804	c.585G>T	c.(583-585)ccG>ccT	p.P195P	DQX1_ENST00000495597.1_5'UTR|DQX1_ENST00000393951.2_Silent_p.P195P	NM_133637.2	NP_598376.2	Q8TE96	DQX1_HUMAN	DEAQ box RNA-dependent ATPase 1	195	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.					nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|skin(1)	18						TGAGGTCCCCCGGAAGTTTTT	0.572																																																	0								ENSG00000144045						75.0	78.0	77.0					2																	74751281		2203	4300	6503	DQX1	SO:0001819	synonymous_variant	0			-	HGNC	AK074337	CCDS1949.2	2p12	2010-04-20	2009-01-15		ENSG00000144045	ENSG00000144045			20410	protein-coding gene	gene with protein product			"""DEAQ box polypeptide 1 (RNA-dependent ATPase)"""				Standard	NM_133637		Approved	FLJ23757	uc010yrw.2	Q8TE96	OTTHUMG00000129965	ENST00000404568.3:c.585G>T	2.37:g.74751281C>A		Somatic	0	49	0.00		0.7014536215209443	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	49	28.99	Q6B017|Q8NAM8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Helicase-assoc_dom,pfam_DUF1605,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase-assoc_dom,pfscan_Helicase_ATP-bd	p.P195	ENST00000404568.3	37	c.585	CCDS1949.2	2																																																																																			-	superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd		0.572	DQX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DQX1	protein_coding	OTTHUMT00000252230.3	C	NM_133637	-		74751281	-1	no_errors	ENST00000393951	ensembl	human	known	74_37	silent	SNP	0.843	A
CFAP43	80217	genome.wustl.edu	37	10	105903296	105903296	+	Missense_Mutation	SNP	A	A	T			TCGA-PC-A5DL-01A-11D-A26G-09	TCGA-PC-A5DL-10A-01D-A26G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59863adf-efee-4f78-884f-9947c95acec7	ff5644a0-f09f-46ba-b790-9054b5d61ca3	g.chr10:105903296A>T	ENST00000357060.3	-	32	4161	c.4046T>A	c.(4045-4047)aTg>aAg	p.M1349K	WDR96_ENST00000428666.1_Missense_Mutation_p.M1321K|WDR96_ENST00000479392.1_5'Flank	NM_025145.5	NP_079421.5														NS(1)|breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(14)|lung(21)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						CATAGCTTTCATTAACTGGGC	0.438																																																	0								ENSG00000197748						140.0	131.0	134.0					10																	105903296		2203	4300	6503	WDR96	SO:0001583	missense	0			-	HGNC																												ENST00000357060.3:c.4046T>A	10.37:g.105903296A>T	ENSP00000349568:p.Met1349Lys	Somatic	0	50	0.00		0.7014536215209443	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	20	53.49		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_WD40_repeat_dom,superfamily_Quino_amine_DH_bsu	p.M1349K	ENST00000357060.3	37	c.4046	CCDS31281.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	26.7|26.7	4.766053|4.766053	0.90020|0.90020	.|.	.|.	ENSG00000197748|ENSG00000197748	ENST00000357060;ENST00000428666|ENST00000457071;ENST00000434629	T;T|.	0.14022|.	2.54;2.6|.	6.02|6.02	6.02|6.02	0.97574|0.97574	.|.	0.040458|.	0.85682|.	D|.	0.000000|.	T|.	0.75788|.	0.3897|.	M|M	0.75447|0.75447	2.3|2.3	0.58432|0.58432	D|D	0.999999|0.999999	D;D|.	0.54047|.	0.964;0.963|.	P;P|.	0.56434|.	0.775;0.798|.	T|.	0.75850|.	-0.3172|.	10|.	0.11794|.	T|.	0.64|.	.|.	16.2035|16.2035	0.82105|0.82105	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	1321;1349|.	G5E9L1;Q8NDM7|.	.;WDR96_HUMAN|.	K|R	1349;1321|198;681	ENSP00000349568:M1349K;ENSP00000400289:M1321K|.	ENSP00000349568:M1349K|.	M|X	-|-	2|1	0|0	WDR96|WDR96	105893286|105893286	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.975000|0.975000	0.68041|0.68041	5.927000|5.927000	0.70080|0.70080	2.304000|2.304000	0.77564|0.77564	0.528000|0.528000	0.53228|0.53228	ATG|TGA	-	NULL		0.438	WDR96-201	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR96	protein_coding		A		-		105903296	-1	no_errors	ENST00000357060	ensembl	human	known	74_37	missense	SNP	1.000	T
KSR2	283455	genome.wustl.edu	37	12	118199050	118199050	+	Missense_Mutation	SNP	G	G	A			TCGA-PC-A5DL-01A-11D-A26G-09	TCGA-PC-A5DL-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59863adf-efee-4f78-884f-9947c95acec7	ff5644a0-f09f-46ba-b790-9054b5d61ca3	g.chr12:118199050G>A	ENST00000339824.5	-	4	1479	c.752C>T	c.(751-753)tCg>tTg	p.S251L	KSR2_ENST00000425217.1_Missense_Mutation_p.S222L			Q6VAB6	KSR2_HUMAN	kinase suppressor of ras 2	251	Pro-rich.				intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(25)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	67	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CTGCCGGGGCGATGGGGGCAG	0.726																																																	0								ENSG00000171435						22.0	30.0	27.0					12																	118199050		1794	3933	5727	KSR2	SO:0001583	missense	0			-	HGNC	AY345972	CCDS61250.1	12q24.22-q24.23	2014-08-12			ENSG00000171435	ENSG00000171435			18610	protein-coding gene	gene with protein product		610737				12471243	Standard	NM_173598		Approved	FLJ25965	uc001two.2	Q6VAB6	OTTHUMG00000169020	ENST00000339824.5:c.752C>T	12.37:g.118199050G>A	ENSP00000339952:p.Ser251Leu	Somatic	0	23	0.00		0.7014536215209443	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	10	60.00	A0PJT2|Q3B828|Q8N775	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_dom	p.S251L	ENST00000339824.5	37	c.752		12	.	.	.	.	.	.	.	.	.	.	G	20.7	4.034605	0.75617	.	.	ENSG00000171435	ENST00000425217;ENST00000339824	T;T	0.56275	0.47;0.47	5.16	5.16	0.70880	.	0.081487	0.52532	N	0.000064	T	0.48114	0.1482	L	0.44542	1.39	0.47214	D	0.999355	D	0.57571	0.98	P	0.45037	0.467	T	0.41413	-0.9510	10	0.10636	T	0.68	.	18.2313	0.89936	0.0:0.0:1.0:0.0	.	251	Q6VAB6	KSR2_HUMAN	L	222;251	ENSP00000389715:S222L;ENSP00000339952:S251L	ENSP00000339952:S251L	S	-	2	0	KSR2	116683433	1.000000	0.71417	0.861000	0.33841	0.918000	0.54935	7.484000	0.81180	2.385000	0.81259	0.491000	0.48974	TCG	-	NULL		0.726	KSR2-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	KSR2	protein_coding	OTTHUMT00000401987.2	G	NM_173598	-		118199050	-1	no_errors	ENST00000339824	ensembl	human	known	74_37	missense	SNP	0.999	A
FAM157A	728262	genome.wustl.edu	37	3	197880131	197880139	+	lincRNA	DEL	GCAGCAGCA	GCAGCAGCA	-	rs56683636		TCGA-PC-A5DL-01A-11D-A26G-09	TCGA-PC-A5DL-10A-01D-A26G-09	GCAGCAGCA	GCAGCAGCA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59863adf-efee-4f78-884f-9947c95acec7	ff5644a0-f09f-46ba-b790-9054b5d61ca3	g.chr3:197880131_197880139delGCAGCAGCA	ENST00000437428.2	+	0	11_19							C9JC47	F157A_HUMAN	family with sequence similarity 157, member A											NS(1)|skin(1)	2						ACAAGAACTGgcagcagcagcagcagcag	0.536																																																	0								ENSG00000236438																																			FAM157A			0				HGNC			3q29	2013-01-30			ENSG00000236438	ENSG00000236438			34079	other	unknown							Standard	NM_001145248		Approved		uc011bup.1	C9JC47			3.37:g.197880140_197880148delGCAGCAGCA		Somatic	NA	NA	NA		0.7014536215209443	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000437428.2	37	NULL		3																																																																																			-	-		0.536	FAM157A-001	KNOWN	not_best_in_genome_evidence|mRNA_end_NF|basic	lincRNA	FAM157A	lincRNA	OTTHUMT00000340078.2	GCAGCAGCA	NM_001145248			197880139	+1	no_errors	ENST00000431569	ensembl	human	known	74_37	rna	DEL	0.115:0.118:0.119:0.120:0.121:0.121:0.120:0.119:0.118	-
SLC9A3	6550	genome.wustl.edu	37	5	475338	475355	+	Intron	DEL	GGAAAGTTAGGGTCACCG	GGAAAGTTAGGGTCACCG	-	rs527309103|rs371054000|rs56093108|rs200907923|rs2247107	byFrequency	TCGA-PC-A5DL-01A-11D-A26G-09	TCGA-PC-A5DL-10A-01D-A26G-09	GGAAAGTTAGGGTCACCG	GGAAAGTTAGGGTCACCG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59863adf-efee-4f78-884f-9947c95acec7	ff5644a0-f09f-46ba-b790-9054b5d61ca3	g.chr5:475338_475355delGGAAAGTTAGGGTCACCG	ENST00000264938.3	-	16	2261				CTD-2228K2.7_ENST00000606288.1_RNA|CTD-2228K2.5_ENST00000510604.1_5'Flank|CTD-2228K2.7_ENST00000607286.1_RNA|CTD-2228K2.7_ENST00000607005.1_RNA|CTD-2228K2.5_ENST00000510714.1_5'Flank|SLC9A3_ENST00000514375.1_Intron|CTD-2228K2.5_ENST00000342584.3_5'Flank|CTD-2228K2.7_ENST00000606319.1_RNA	NM_004174.2	NP_004165.2	P48764	SL9A3_HUMAN	solute carrier family 9, subfamily A (NHE3, cation proton antiporter 3), member 3						ion transport (GO:0006811)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border (GO:0005903)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	PDZ domain binding (GO:0030165)|sodium:proton antiporter activity (GO:0015385)			NS(2)|biliary_tract(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|liver(2)|lung(16)|prostate(3)|skin(2)|urinary_tract(1)	37			Epithelial(17;0.000529)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|all cancers(22;0.00186)|Lung(60;0.0863)			TGGGTGCCTTGGAAAGTTAGGGTCACCGGGAAGGTTAG	0.633														966	0.192891	0.1687	0.2349	5008	,	,		16601	0.1339		0.2634	False		,,,				2504	0.184																0								ENSG00000225138																																			CTD-2228K2.7	SO:0001627	intron_variant	0				Clone_based_vega_gene		CCDS3855.1, CCDS64116.1	5p15.3	2013-05-22	2012-03-22		ENSG00000066230	ENSG00000066230		"""Solute carriers"""	11073	protein-coding gene	gene with protein product		182307	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 3"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 3"""	NHE3		8096830	Standard	NM_004174		Approved		uc003jbe.2	P48764	OTTHUMG00000090315	ENST00000264938.3:c.2252-91CGGTGACCCTAACTTTCC>-	5.37:g.475338_475355delGGAAAGTTAGGGTCACCG		Somatic	NA	NA	NA		0.7014536215209443	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B7ZKR2|E9PF67|Q3MIW3	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000264938.3	37	NULL	CCDS3855.1	5																																																																																			-	-		0.633	SLC9A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC100288152	protein_coding	OTTHUMT00000206677.2	GGAAAGTTAGGGTCACCG	NM_004174			475355	+1	no_errors	ENST00000607286	ensembl	human	known	74_37	rna	DEL	0.005:0.003:0.004:0.003:0.002:0.001:0.001:0.000:0.000:0.000:0.000:0.001:0.002:0.002:0.003:0.010:0.018:0.018	-
LIMS2	55679	genome.wustl.edu	37	2	128396037	128396038	+	3'UTR	INS	-	-	AACA	rs367641486|rs539129364|rs34246242	byFrequency	TCGA-PC-A5DL-01A-11D-A26G-09	TCGA-PC-A5DL-10A-01D-A26G-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59863adf-efee-4f78-884f-9947c95acec7	ff5644a0-f09f-46ba-b790-9054b5d61ca3	g.chr2:128396037_128396038insAACA	ENST00000355119.4	-	0	2009_2010				LIMS2_ENST00000410011.1_3'UTR|LIMS2_ENST00000409808.2_3'UTR|LIMS2_ENST00000409455.1_3'UTR|LIMS2_ENST00000409754.1_3'UTR|LIMS2_ENST00000409286.1_3'UTR|LIMS2_ENST00000324938.5_3'UTR|LIMS2_ENST00000494613.1_5'UTR	NM_001161403.1	NP_001154875.1	Q7Z4I7	LIMS2_HUMAN	LIM and senescent cell antigen-like domains 2						cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|negative regulation of apoptotic process (GO:0043066)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of neural precursor cell proliferation (GO:2000178)|positive regulation of integrin-mediated signaling pathway (GO:2001046)|single organismal cell-cell adhesion (GO:0016337)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)			endometrium(3)|kidney(1)|large_intestine(2)|lung(5)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	15	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0681)		AGCGTGAGCCCAACAAACAAAC	0.609																																																	0								ENSG00000072163																																			LIMS2	SO:0001624	3_prime_UTR_variant	0				HGNC	AF520987	CCDS2147.1, CCDS54394.1, CCDS54395.1, CCDS54396.1, CCDS58725.1	2q21.1	2008-02-05			ENSG00000072163	ENSG00000072163			16084	protein-coding gene	gene with protein product		607908					Standard	NM_017980		Approved		uc002tox.3	Q7Z4I7	OTTHUMG00000131529	ENST00000355119.4:c.*819->TGTT	2.37:g.128396042_128396045dupAACA		Somatic	0	38	0.00		0.7014536215209443	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	44	10.20	A6NLH0|B4DMV1|F5H6E6|Q7Z4I2|Q7Z4I6|Q7Z4I8|Q8NFE7|Q9HA13	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000355119.4	37	NULL	CCDS54395.1	2																																																																																			-	-		0.609	LIMS2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LIMS2	protein_coding	OTTHUMT00000331133.2	-	NM_017980			128396038	-1	no_errors	ENST00000494613	ensembl	human	known	74_37	rna	INS	0.001:0.000	AACA
PTPN13	5783	genome.wustl.edu	37	4	87685826	87685826	+	Silent	SNP	C	C	A			TCGA-PC-A5DL-01A-11D-A26G-09	TCGA-PC-A5DL-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59863adf-efee-4f78-884f-9947c95acec7	ff5644a0-f09f-46ba-b790-9054b5d61ca3	g.chr4:87685826C>A	ENST00000411767.2	+	25	4161	c.4098C>A	c.(4096-4098)atC>atA	p.I1366I	PTPN13_ENST00000427191.2_Silent_p.I1347I|PTPN13_ENST00000436978.1_Silent_p.I1366I|PTPN13_ENST00000511467.1_Silent_p.I1366I|PTPN13_ENST00000316707.6_Silent_p.I1175I			Q12923	PTN13_HUMAN	protein tyrosine phosphatase, non-receptor type 13 (APO-1/CD95 (Fas)-associated phosphatase)	1366					peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein tyrosine phosphatase activity (GO:0004725)			NS(4)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(23)|lung(24)|ovary(4)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	93		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.00082)		CTGGAGATATCTTTGAGGTTG	0.353																																																	0								ENSG00000163629						94.0	89.0	91.0					4																	87685826		1807	4084	5891	PTPN13	SO:0001819	synonymous_variant	0			-	HGNC		CCDS47093.1, CCDS47094.1, CCDS47095.1, CCDS47096.1	4q21.3	2011-06-09			ENSG00000163629	ENSG00000163629		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9646	protein-coding gene	gene with protein product		600267				8287977	Standard	NM_006264		Approved	PTP1E, PTP-BAS, PTPL1, PTP-BL	uc003hpy.3	Q12923	OTTHUMG00000160968	ENST00000411767.2:c.4098C>A	4.37:g.87685826C>A		Somatic	0	34	0.00		0.7014536215209443	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	34	26.09	B2RTR0|Q15159|Q15263|Q15264|Q15265|Q15674|Q16826|Q8IWH7|Q9NYN9|Q9UDA8	Silent	SNP	NA	NA	NA	NA	NA	NA	pirsf_Tyr_Pase_non-rcpt_typ-13,pfam_Tyr_Pase_rcpt/non-rcpt,pfam_PDZ,pfam_FERM_central,pfam_FERM_PH-like_C,pfam_FERM_N,superfamily_FERM_central,superfamily_PDZ,superfamily_PAZ_dom,smart_KIND,smart_Band_41_domain,smart_PDZ,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_rcpt/non-rcpt,prints_Band_41_fam,pfscan_FERM_domain,pfscan_PDZ,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	p.I1366	ENST00000411767.2	37	c.4098	CCDS47094.1	4																																																																																			-	pirsf_Tyr_Pase_non-rcpt_typ-13,superfamily_PDZ		0.353	PTPN13-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTPN13	protein_coding	OTTHUMT00000363191.1	C		-		87685826	+1	no_errors	ENST00000436978	ensembl	human	known	74_37	silent	SNP	1.000	A
CNTNAP3	79937	genome.wustl.edu	37	9	39174373	39174374	+	Intron	INS	-	-	T			TCGA-PC-A5DL-01A-11D-A26G-09	TCGA-PC-A5DL-10A-01D-A26G-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59863adf-efee-4f78-884f-9947c95acec7	ff5644a0-f09f-46ba-b790-9054b5d61ca3	g.chr9:39174373_39174374insT	ENST00000297668.6	-	7	1145				CNTNAP3_ENST00000358144.2_Intron|CNTNAP3_ENST00000377653.2_5'UTR|CNTNAP3_ENST00000377656.2_Intron|CNTNAP3_ENST00000323947.7_Intron|CNTNAP3_ENST00000377659.1_Intron	NM_033655.3	NP_387504.2	Q9BZ76	CNTP3_HUMAN	contactin associated protein-like 3						cell adhesion (GO:0007155)|cell recognition (GO:0008037)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|liver(2)|lung(8)|ovary(1)|upper_aerodigestive_tract(2)	24				GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)		TCAAACCCATCTTTTTTTTTTT	0.347																																																	0								ENSG00000106714																																			CNTNAP3	SO:0001627	intron_variant	0				HGNC	AF333769	CCDS6616.1	9q12	2008-02-05			ENSG00000106714	ENSG00000106714			13834	protein-coding gene	gene with protein product	"""cell recognition molecule CASPR3 (FLJ14195, KIAA1714)"""	610517				12093160	Standard	NM_033655		Approved	CASPR3, KIAA1714, FLJ14195, CNTNAP3A	uc004abi.3	Q9BZ76	OTTHUMG00000019954	ENST00000297668.6:c.1071+1571->A	9.37:g.39174384_39174384dupT		Somatic	0	33	0.00		0.7014536215209443	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	24	11.11	B1AMA0|Q9C0E9	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000297668.6	37	NULL	CCDS6616.1	9																																																																																			-	-		0.347	CNTNAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP3	protein_coding	OTTHUMT00000052511.1	-	NM_033655			39174374	-1	no_errors	ENST00000377653	ensembl	human	known	74_37	rna	INS	0.708:0.574	T
FABP7	2173	genome.wustl.edu	37	6	123100972	123100972	+	Silent	SNP	G	G	C			TCGA-PC-A5DL-01A-11D-A26G-09	TCGA-PC-A5DL-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59863adf-efee-4f78-884f-9947c95acec7	ff5644a0-f09f-46ba-b790-9054b5d61ca3	g.chr6:123100972G>C	ENST00000368444.3	+	1	353	c.33G>C	c.(31-33)ctG>ctC	p.L11L	FABP7_ENST00000356535.4_Silent_p.L11L	NM_001446.3	NP_001437.1	O15540	FABP7_HUMAN	fatty acid binding protein 7, brain	11					cell proliferation in forebrain (GO:0021846)|epithelial cell proliferation (GO:0050673)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neurogenesis (GO:0022008)|prepulse inhibition (GO:0060134)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	lipid binding (GO:0008289)|transporter activity (GO:0005215)			kidney(1)|large_intestine(1)|lung(2)|stomach(1)	5				GBM - Glioblastoma multiforme(226;0.226)	Alpha-Linolenic Acid(DB00132)|Dihomo-gamma-linolenic acid(DB00154)|Icosapent(DB00159)	CCTGGAAGCTGACCAACAGTC	0.483																																																	0								ENSG00000164434						101.0	80.0	87.0					6																	123100972		2203	4300	6503	FABP7	SO:0001819	synonymous_variant	0			-	HGNC	D88648	CCDS5127.1	6q22-q23	2013-03-01			ENSG00000164434	ENSG00000164434		"""Fatty acid binding protein family"""	3562	protein-coding gene	gene with protein product	"""brain lipid binding protein"""	602965				9375786	Standard	NM_001446		Approved	B-FABP, BLBP	uc003pzf.3	O15540	OTTHUMG00000015489	ENST00000368444.3:c.33G>C	6.37:g.123100972G>C		Somatic	0	30	0.00		0.7014536215209443	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	20	23.08	B2R4L1|O14951|Q6IAU7|Q9H047	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Lipocln_cytosolic_FA-bd_dom,superfamily_Calycin-like,prints_Fatty_acid-bd	p.L11	ENST00000368444.3	37	c.33	CCDS5127.1	6																																																																																			-	pfam_Lipocln_cytosolic_FA-bd_dom,superfamily_Calycin-like,prints_Fatty_acid-bd		0.483	FABP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FABP7	protein_coding	OTTHUMT00000042037.1	G	NM_001446	-		123100972	+1	no_errors	ENST00000356535	ensembl	human	known	74_37	silent	SNP	1.000	C
XRCC1	7515	genome.wustl.edu	37	19	44057586	44057586	+	Missense_Mutation	SNP	G	G	C			TCGA-PC-A5DL-01A-11D-A26G-09	TCGA-PC-A5DL-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59863adf-efee-4f78-884f-9947c95acec7	ff5644a0-f09f-46ba-b790-9054b5d61ca3	g.chr19:44057586G>C	ENST00000262887.5	-	6	1115	c.568C>G	c.(568-570)Ctc>Gtc	p.L190V	L34079.3_ENST00000597119.1_RNA|XRCC1_ENST00000543982.1_Missense_Mutation_p.L159V			P18887	XRCC1_HUMAN	X-ray repair complementing defective repair in Chinese hamster cells 1	190					base-excision repair (GO:0006284)|DNA repair (GO:0006281)|hippocampus development (GO:0021766)|response to drug (GO:0042493)|response to hypoxia (GO:0001666)|response to organic substance (GO:0010033)|single strand break repair (GO:0000012)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	damaged DNA binding (GO:0003684)			breast(2)|endometrium(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		Prostate(69;0.0153)				CTGAAGAAGAGAGCCCCCGGC	0.577								Other BER factors																																									0								ENSG00000073050						84.0	79.0	81.0					19																	44057586		2203	4300	6503	XRCC1	SO:0001583	missense	0			-	HGNC	M36089	CCDS12624.1	19q13.2	2014-09-17				ENSG00000073050			12828	protein-coding gene	gene with protein product		194360		RCC		2247054	Standard	NM_006297		Approved		uc002owt.2	P18887		ENST00000262887.5:c.568C>G	19.37:g.44057586G>C	ENSP00000262887:p.Leu190Val	Somatic	0	37	0.00		0.7014536215209443	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	35	18	66.04	Q6IBS4|Q9HCB1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Xrcc1_N,pfam_BRCT_dom,superfamily_Galactose-bd-like,superfamily_BRCT_dom,smart_BRCT_dom,pfscan_BRCT_dom	p.L190V	ENST00000262887.5	37	c.568	CCDS12624.1	19	.	.	.	.	.	.	.	.	.	.	G	21.4	4.148001	0.78001	.	.	ENSG00000073050	ENST00000458471;ENST00000262887;ENST00000543982;ENST00000538738	T;T	0.03524	3.91;3.9	4.73	4.73	0.59995	.	0.000000	0.85682	D	0.000000	T	0.11836	0.0288	M	0.72894	2.215	0.58432	D	0.999992	P;P	0.51537	0.946;0.92	P;B	0.54026	0.74;0.366	T	0.06588	-1.0818	10	0.28530	T	0.3	-19.9431	16.0189	0.80464	0.0:0.0:1.0:0.0	.	159;190	F5H8D7;P18887	.;XRCC1_HUMAN	V	204;190;159;190	ENSP00000262887:L190V;ENSP00000443671:L159V	ENSP00000262887:L190V	L	-	1	0	XRCC1	48749426	1.000000	0.71417	0.994000	0.49952	0.667000	0.39255	3.582000	0.53921	2.571000	0.86741	0.655000	0.94253	CTC	-	NULL		0.577	XRCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XRCC1	protein_coding	OTTHUMT00000463194.1	G	NM_006297	-		44057586	-1	no_errors	ENST00000262887	ensembl	human	known	74_37	missense	SNP	1.000	C
PTGES3	10728	genome.wustl.edu	37	12	57064237	57064237	+	Intron	DEL	G	G	-			TCGA-PC-A5DL-01A-11D-A26G-09	TCGA-PC-A5DL-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59863adf-efee-4f78-884f-9947c95acec7	ff5644a0-f09f-46ba-b790-9054b5d61ca3	g.chr12:57064237delG	ENST00000262033.6	-	5	586				PTGES3_ENST00000436399.2_Intron|PTGES3_ENST00000456859.2_Intron|PTGES3_ENST00000414274.3_Intron|PTGES3_ENST00000537473.1_Intron|RN7SL809P_ENST00000482040.2_RNA|PTGES3_ENST00000448157.2_Intron	NM_006601.5	NP_006592.3	Q15185	TEBP_HUMAN	prostaglandin E synthase 3 (cytosolic)						arachidonic acid metabolic process (GO:0019369)|cell proliferation (GO:0008283)|chaperone cofactor-dependent protein refolding (GO:0070389)|cyclooxygenase pathway (GO:0019371)|glucocorticoid receptor signaling pathway (GO:0042921)|glycogen biosynthetic process (GO:0005978)|lung saccule development (GO:0060430)|prostaglandin biosynthetic process (GO:0001516)|RNA-dependent DNA replication (GO:0006278)|signal transduction (GO:0007165)|skin development (GO:0043588)|small molecule metabolic process (GO:0044281)|telomere maintenance (GO:0000723)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|telomerase holoenzyme complex (GO:0005697)	prostaglandin-E synthase activity (GO:0050220)|telomerase activity (GO:0003720)|unfolded protein binding (GO:0051082)			large_intestine(1)|lung(1)	2						cttctaaagagaccaggtctt	0.403																																																	0								ENSG00000241217																																			RN7SL809P	SO:0001627	intron_variant	0				HGNC	BC003005	CCDS31836.1, CCDS61158.1, CCDS61159.1, CCDS61160.1, CCDS73485.1	12q13.13	2012-03-14			ENSG00000110958	ENSG00000110958			16049	protein-coding gene	gene with protein product		607061				8114727, 12077419	Standard	XR_245889		Approved	p23, TEBP, cPGES	uc001slu.4	Q15185	OTTHUMG00000170217	ENST00000262033.6:c.286-89C>-	12.37:g.57064237delG		Somatic	0	9	0.00		0.7014536215209443	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	10	33.33	A8K7D0|B4DHP2|B4DP11|B4DP21|Q8WU70	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000262033.6	37	NULL	CCDS31836.1	12																																																																																			-	-		0.403	PTGES3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RN7SL809P	protein_coding	OTTHUMT00000408054.1	G	NM_006601			57064237	-1	no_errors	ENST00000482040	ensembl	human	known	74_37	rna	DEL	0.001	-
CLDN20	49861	genome.wustl.edu	37	6	155597310	155597310	+	Missense_Mutation	SNP	C	C	T	rs200032175		TCGA-PC-A5DL-01A-11D-A26G-09	TCGA-PC-A5DL-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59863adf-efee-4f78-884f-9947c95acec7	ff5644a0-f09f-46ba-b790-9054b5d61ca3	g.chr6:155597310C>T	ENST00000367165.3	+	2	837	c.457C>T	c.(457-459)Cca>Tca	p.P153S	TFB1M_ENST00000367166.4_Intron	NM_001001346.3	NP_001001346.1	P56880	CLD20_HUMAN	claudin 20	153					calcium-independent cell-cell adhesion (GO:0016338)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|tight junction assembly (GO:0070830)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			endometrium(1)|lung(2)	3				OV - Ovarian serous cystadenocarcinoma(155;7.82e-13)|BRCA - Breast invasive adenocarcinoma(81;0.0114)		TCTGACAGTTCCAGAAAGCAA	0.423																																																	0								ENSG00000171217						100.0	95.0	97.0					6																	155597310		2203	4300	6503	CLDN20	SO:0001583	missense	0			-	HGNC	BC020838	CCDS5249.1	6q25	2008-08-01			ENSG00000171217	ENSG00000171217		"""Claudins"""	2042	protein-coding gene	gene with protein product						16836752	Standard	NM_001001346		Approved		uc003qql.2	P56880	OTTHUMG00000015882	ENST00000367165.3:c.457C>T	6.37:g.155597310C>T	ENSP00000356133:p.Pro153Ser	Somatic	0	30	0.00		0.7014536215209443	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PMP22/EMP/MP20/Claudin,prints_Claudin	p.P153S	ENST00000367165.3	37	c.457	CCDS5249.1	6	.	.	.	.	.	.	.	.	.	.	C	15.74	2.922756	0.52653	.	.	ENSG00000171217	ENST00000367165	D	0.88741	-2.42	5.71	3.9	0.45041	.	0.056815	0.64402	N	0.000001	T	0.82102	0.4964	M	0.82923	2.615	0.48696	D	0.999699	P	0.41475	0.751	B	0.37387	0.248	T	0.79443	-0.1801	10	0.33141	T	0.24	.	9.6664	0.39988	0.0:0.662:0.2677:0.0704	.	153	P56880	CLD20_HUMAN	S	153	ENSP00000356133:P153S	ENSP00000356133:P153S	P	+	1	0	CLDN20	155639002	1.000000	0.71417	0.057000	0.19452	0.935000	0.57460	3.749000	0.55150	0.740000	0.32651	0.563000	0.77884	CCA	-	pfam_PMP22/EMP/MP20/Claudin		0.423	CLDN20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLDN20	protein_coding	OTTHUMT00000042818.1	C	NM_001001346	rs200032175		155597310	+1	no_errors	ENST00000367165	ensembl	human	known	74_37	missense	SNP	0.999	T
PTPRJ	5795	genome.wustl.edu	37	11	48152268	48152268	+	Splice_Site	SNP	G	G	A			TCGA-PC-A5DL-01A-11D-A26G-09	TCGA-PC-A5DL-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59863adf-efee-4f78-884f-9947c95acec7	ff5644a0-f09f-46ba-b790-9054b5d61ca3	g.chr11:48152268G>A	ENST00000418331.2	+	8	1967	c.1615G>A	c.(1615-1617)Gtt>Att	p.V539I	PTPRJ_ENST00000440289.2_Splice_Site_p.G539R	NM_002843.3	NP_002834.3	Q12913	PTPRJ_HUMAN	protein tyrosine phosphatase, receptor type, J	539	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				contact inhibition (GO:0060242)|heart development (GO:0007507)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of platelet-derived growth factor receptor signaling pathway (GO:0010642)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of T cell receptor signaling pathway (GO:0050860)|negative regulation of vascular permeability (GO:0043116)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive chemotaxis (GO:0050918)|positive regulation of cell adhesion (GO:0045785)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of cell adhesion (GO:0030155)|vasculogenesis (GO:0001570)	cell projection (GO:0042995)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|mitogen-activated protein kinase binding (GO:0051019)|phosphatase activity (GO:0016791)|platelet-derived growth factor receptor binding (GO:0005161)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)			breast(3)|endometrium(7)|kidney(7)|large_intestine(5)|lung(15)|ovary(1)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	52						CAATAGAACTGGTAAGCAAAT	0.343																																																	0								ENSG00000149177						60.0	64.0	63.0					11																	48152268		2201	4297	6498	PTPRJ	SO:0001630	splice_region_variant	0			-	HGNC	U10886	CCDS7945.1, CCDS44596.1	11p11.2	2013-02-11			ENSG00000149177	ENSG00000149177		"""CD molecules"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9673	protein-coding gene	gene with protein product		600925				7937872, 7994032	Standard	NM_001098503		Approved	DEP1, HPTPeta, CD148	uc001ngp.4	Q12913	OTTHUMG00000166573	ENST00000418331.2:c.1615+1G>A	11.37:g.48152268G>A		Somatic	0	27	0.00		0.7014536215209443	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	16	40.74	Q15255|Q6P4H4|Q8NHM2|Q9UDA9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.V539I	ENST00000418331.2	37	c.1615	CCDS7945.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.73|12.73	2.024157|2.024157	0.35701|0.35701	.|.	.|.	ENSG00000149177|ENSG00000149177	ENST00000440289|ENST00000418331	T|T	0.39787|0.55930	1.06|0.49	5.71|5.71	4.8|4.8	0.61643|0.61643	.|Fibronectin, type III (1);Immunoglobulin-like fold (1);	.|.	.|.	.|.	.|.	T|T	0.33147|0.33147	0.0853|0.0853	N|N	0.08118|0.08118	0|0	0.24361|0.24361	N|N	0.994871|0.994871	B|B	0.21309|0.20261	0.054|0.043	B|B	0.09377|0.25759	0.004|0.063	T|T	0.10636|0.10636	-1.0621|-1.0621	9|9	0.66056|0.37606	D|T	0.02|0.19	.|.	9.6371|9.6371	0.39817|0.39817	0.0923:0.0:0.9077:0.0|0.0923:0.0:0.9077:0.0	.|.	539|539	Q6P4H4|Q12913	.|PTPRJ_HUMAN	R|I	539|539	ENSP00000409733:G539R|ENSP00000400010:V539I	ENSP00000409733:G539R|ENSP00000400010:V539I	G|V	+|+	1|1	0|0	PTPRJ|PTPRJ	48108844|48108844	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.323000|0.323000	0.28346|0.28346	2.132000|2.132000	0.42083|0.42083	2.689000|2.689000	0.91719|0.91719	0.655000|0.655000	0.94253|0.94253	GGA|GTT	-	superfamily_Fibronectin_type3		0.343	PTPRJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRJ	protein_coding	OTTHUMT00000390525.1	G		-	Missense_Mutation	48152268	+1	no_errors	ENST00000418331	ensembl	human	known	74_37	missense	SNP	1.000	A
MEX3B	84206	genome.wustl.edu	37	15	82338002	82338007	+	In_Frame_Del	DEL	GCCGCT	GCCGCT	-			TCGA-PC-A5DL-01A-11D-A26G-09	TCGA-PC-A5DL-10A-01D-A26G-09	GCCGCT	GCCGCT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59863adf-efee-4f78-884f-9947c95acec7	ff5644a0-f09f-46ba-b790-9054b5d61ca3	g.chr15:82338002_82338007delGCCGCT	ENST00000329713.4	-	1	475_480	c.40_45delAGCGGC	c.(40-45)agcggcdel	p.SG14del	MEX3B_ENST00000558133.1_In_Frame_Del_p.SG14del|AC026956.1_ENST00000410589.1_RNA	NM_032246.4	NP_115622.2	Q6ZN04	MEX3B_HUMAN	mex-3 RNA binding family member B	14					protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|kidney(1)|large_intestine(5)|lung(9)|upper_aerodigestive_tract(1)	19						cgccgccgccgccgctgccgTTGCGC	0.757																																																	0								ENSG00000183496																																			MEX3B	SO:0001651	inframe_deletion	0				HGNC	AK131424	CCDS10319.1	15q25.1	2013-08-21	2013-08-21	2007-07-18	ENSG00000183496	ENSG00000183496		"""RING-type (C3HC4) zinc fingers"", ""Mex-3 homologs"""	25297	protein-coding gene	gene with protein product		611008	"""ring finger and KH domain containing 3"", ""mex-3 homolog B (C. elegans)"""	RKHD3		11230166, 17267406	Standard	NM_032246		Approved	DKFZp434J0617, RNF195	uc002bgq.2	Q6ZN04	OTTHUMG00000147356	ENST00000329713.4:c.40_45delAGCGGC	15.37:g.82338002_82338007delGCCGCT	ENSP00000329918:p.Ser14_Gly15del	Somatic	NA	NA	NA		0.7014536215209443	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q4G0W1|Q8IVG2|Q9H0J0	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_KH_dom_type_1,smart_KH_dom,smart_Znf_RING,pfscan_Znf_RING,pfscan_KH_dom_type_1	p.SG14in_frame_del	ENST00000329713.4	37	c.45_40	CCDS10319.1	15																																																																																			-	NULL		0.757	MEX3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MEX3B	protein_coding	OTTHUMT00000304000.1	GCCGCT	XM_290645			82338007	-1	no_errors	ENST00000329713	ensembl	human	known	74_37	in_frame_del	DEL	1.000:1.000:1.000:1.000:1.000:1.000	-
SMARCC2	6601	genome.wustl.edu	37	12	56557112	56557112	+	IGR	DEL	T	T	-	rs200590204	byFrequency	TCGA-PC-A5DL-01A-11D-A26G-09	TCGA-PC-A5DL-10A-01D-A26G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59863adf-efee-4f78-884f-9947c95acec7	ff5644a0-f09f-46ba-b790-9054b5d61ca3	g.chr12:56557112delT	ENST00000267064.4	-	0	4076				MYL6_ENST00000551954.1_3'UTR|SMARCC2_ENST00000394023.3_3'UTR|SMARCC2_ENST00000550164.1_3'UTR|RP11-977G19.5_ENST00000553176.1_RNA	NM_003075.3	NP_003066.2	Q8TAQ2	SMRC2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2						ATP-dependent chromatin remodeling (GO:0043044)|chromatin remodeling (GO:0006338)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome disassembly (GO:0006337)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase II promoter involved in forebrain neuron fate commitment (GO:0021882)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(3)|endometrium(6)|kidney(3)|large_intestine(3)|lung(20)|ovary(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)	41			OV - Ovarian serous cystadenocarcinoma(18;0.123)			TAAAATCTACTTTTTTTTTTT	0.348													|||unknown(HR)	1253	0.2502	0.1672	0.2233	5008	,	,		13772	0.1716		0.2903	False		,,,				2504	0.4213																0								ENSG00000092841																																			MYL6	SO:0001628	intergenic_variant	0				HGNC	U66616	CCDS8907.1, CCDS8908.1, CCDS55835.1	12q13.2	2008-05-14				ENSG00000139613			11105	protein-coding gene	gene with protein product		601734				8804307, 9693044	Standard	NM_001130420		Approved	BAF170, Rsc8, CRACC2	uc001skb.3	Q8TAQ2	OTTHUMG00000170288		12.37:g.56557112delT		Somatic	0	12	0.00		0.7014536215209443	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	16	11.11	F8VTJ5|Q59GV3|Q92923|Q96E12|Q96GY4	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000267064.4	37	NULL	CCDS8907.1	12																																																																																			-	-		0.348	SMARCC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MYL6	protein_coding	OTTHUMT00000408370.1	T				56557112	+1	no_errors	ENST00000551954	ensembl	human	known	74_37	rna	DEL	0.826	-
ZFR	51663	genome.wustl.edu	37	5	32390512	32390512	+	Missense_Mutation	SNP	T	T	C			TCGA-PC-A5DL-01A-11D-A26G-09	TCGA-PC-A5DL-10A-01D-A26G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59863adf-efee-4f78-884f-9947c95acec7	ff5644a0-f09f-46ba-b790-9054b5d61ca3	g.chr5:32390512T>C	ENST00000265069.8	-	12	2113	c.2011A>G	c.(2011-2013)Atg>Gtg	p.M671V		NM_016107.3	NP_057191.2	Q96KR1	ZFR_HUMAN	zinc finger RNA binding protein	671					multicellular organismal development (GO:0007275)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.M671V(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(14)|upper_aerodigestive_tract(2)	32				STAD - Stomach adenocarcinoma(35;0.19)		TCTTCCTCCATTCTCCTCCAG	0.463																																																	1	Substitution - Missense(1)	lung(1)						ENSG00000056097						143.0	138.0	140.0					5																	32390512		2203	4300	6503	ZFR	SO:0001583	missense	0			-	HGNC	AF100742	CCDS34139.1	5p15.2	2014-03-03			ENSG00000056097	ENSG00000056097			17277	protein-coding gene	gene with protein product		615635				11574164, 24482476	Standard	NM_016107		Approved	ZFR1, SPG71	uc003jhr.1	Q96KR1	OTTHUMG00000161979	ENST00000265069.8:c.2011A>G	5.37:g.32390512T>C	ENSP00000265069:p.Met671Val	Somatic	0	22	0.00		0.7014536215209443	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	13	38.10	B2RNR5|Q05C08|Q3B7X5|Q6P5A3|Q86UA0|Q9H6V4|Q9NTI1|Q9Y687	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DZF,pfam_Znf_C2H2_jaz,smart_Znf_U1,smart_Znf_C2H2-like,smart_DZF	p.M671V	ENST00000265069.8	37	c.2011	CCDS34139.1	5	.	.	.	.	.	.	.	.	.	.	T	12.13	1.845438	0.32606	.	.	ENSG00000056097	ENST00000265069;ENST00000382126	T	0.04758	3.56	5.28	5.28	0.74379	.	0.035534	0.85682	D	0.000000	T	0.06645	0.0170	L	0.52364	1.645	0.52501	D	0.999958	B	0.02656	0.0	B	0.01281	0.0	T	0.29427	-1.0012	10	0.20046	T	0.44	.	15.2048	0.73169	0.0:0.0:0.0:1.0	.	671	Q96KR1	ZFR_HUMAN	V	671;649	ENSP00000265069:M671V	ENSP00000265069:M671V	M	-	1	0	ZFR	32426269	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	4.616000	0.61197	1.993000	0.58246	0.459000	0.35465	ATG	-	NULL		0.463	ZFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFR	protein_coding	OTTHUMT00000366586.1	T		-		32390512	-1	no_errors	ENST00000265069	ensembl	human	known	74_37	missense	SNP	1.000	C
HOXA7	3204	genome.wustl.edu	37	7	27192088	27192089	+	IGR	INS	-	-	GGCCT	rs117819065|rs71823962|rs145281130|rs3216926	byFrequency	TCGA-PC-A5DL-01A-11D-A26G-09	TCGA-PC-A5DL-10A-01D-A26G-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59863adf-efee-4f78-884f-9947c95acec7	ff5644a0-f09f-46ba-b790-9054b5d61ca3	g.chr7:27192088_27192089insGGCCT	ENST00000242159.3	-	0	2020				RP1-170O19.23_ENST00000498652.1_RNA|RP1-170O19.22_ENST00000467897.2_RNA|HOXA-AS3_ENST00000521197.1_RNA|HOXA-AS3_ENST00000521231.1_RNA|HOXA7_ENST00000523796.2_5'Flank|HOXA-AS3_ENST00000524304.1_RNA|HOXA6_ENST00000521478.1_5'Flank|HOXA-AS3_ENST00000518848.1_RNA|HOXA-AS3_ENST00000518947.2_RNA	NM_006896.3	NP_008827.2	P31268	HXA7_HUMAN	homeobox A7						angiogenesis (GO:0001525)|anterior/posterior pattern specification (GO:0009952)|embryonic skeletal system morphogenesis (GO:0048704)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of keratinocyte differentiation (GO:0045617)|negative regulation of leukocyte migration (GO:0002686)|negative regulation of monocyte differentiation (GO:0045656)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell differentiation (GO:0048863)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			endometrium(3)|large_intestine(1)|lung(10)|prostate(1)|urinary_tract(1)	16						GGGAGCCGCCAGGCCTGGCCTG	0.693														940	0.1877	0.0416	0.2334	5008	,	,		12775	0.1379		0.2843	False		,,,				2504	0.3047																0								ENSG00000273433																																			RP1-170O19.22	SO:0001628	intergenic_variant	0				Clone_based_vega_gene		CCDS5408.1	7p15.2	2011-06-20	2005-12-22		ENSG00000122592	ENSG00000122592		"""Homeoboxes / ANTP class : HOXL subclass"""	5108	protein-coding gene	gene with protein product		142950	"""homeo box A7"""	HOX1A, HOX1		1973146, 1358459	Standard	NM_006896		Approved		uc003sys.3	P31268	OTTHUMG00000023217		7.37:g.27192094_27192098dupGGCCT		Somatic	NA	NA	NA		0.7014536215209443	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A4D191|O43368|O43486|O95655|Q9NSC8|Q9UDM1	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000242159.3	37	NULL	CCDS5408.1	7																																																																																			-	-		0.693	HOXA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000273433	protein_coding	OTTHUMT00000358695.1	-				27192089	-1	no_errors	ENST00000467897	ensembl	human	known	74_37	rna	INS	0.007:0.074	GGCCT
CHRNA4	1137	genome.wustl.edu	37	20	61981730	61981730	+	Missense_Mutation	SNP	G	G	A	rs142260793		TCGA-PC-A5DL-01A-11D-A26G-09	TCGA-PC-A5DL-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	59863adf-efee-4f78-884f-9947c95acec7	ff5644a0-f09f-46ba-b790-9054b5d61ca3	g.chr20:61981730G>A	ENST00000370263.4	-	5	1254	c.1033C>T	c.(1033-1035)Cgc>Tgc	p.R345C	CHRNA4_ENST00000463705.1_5'UTR	NM_000744.6|NM_001256573.1	NP_000735.1|NP_001243502.1	P43681	ACHA4_HUMAN	cholinergic receptor, nicotinic, alpha 4 (neuronal)	345					action potential (GO:0001508)|B cell activation (GO:0042113)|behavioral response to nicotine (GO:0035095)|calcium ion transport (GO:0006816)|cation transmembrane transport (GO:0098655)|cognition (GO:0050890)|DNA repair (GO:0006281)|exploration behavior (GO:0035640)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|neurological system process (GO:0050877)|regulation of dopamine secretion (GO:0014059)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of membrane potential (GO:0042391)|respiratory gaseous exchange (GO:0007585)|response to hypoxia (GO:0001666)|response to nicotine (GO:0035094)|response to oxidative stress (GO:0006979)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ligand-gated ion channel activity (GO:0015276)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(19)|prostate(3)|skin(3)|soft_tissue(1)	33	all_cancers(38;1.71e-10)				Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Dextromethorphan(DB00514)|Galantamine(DB00674)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Nicotine(DB00184)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)|Varenicline(DB01273)	AAGACCCTGCGTACCCAGGTG	0.602																																																	0								ENSG00000101204	G	CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	140.0	99.0	113.0		1033	5.2	1.0	20	dbSNP_134	113	0,8598		0,0,4299	yes	missense	CHRNA4	NM_000744.5	180	0,1,6501	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	345/628	61981730	1,13003	2203	4299	6502	CHRNA4	SO:0001583	missense	0			-	HGNC		CCDS13517.1	20q13.33	2013-09-20	2012-02-07		ENSG00000101204	ENSG00000101204		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1958	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 4 (neuronal)"""	118504	"""cholinergic receptor, nicotinic, alpha polypeptide 4"""	EBN, EBN1		1505988	Standard	NM_000744		Approved	BFNC	uc002yes.3	P43681	OTTHUMG00000033080	ENST00000370263.4:c.1033C>T	20.37:g.61981730G>A	ENSP00000359285:p.Arg345Cys	Somatic	0	31	0.00		0.7014536215209443	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	37	38.33	Q4JGR7|Q4VAQ5|Q4VAQ6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Neurotrans-gated_channel_TM,pfam_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,prints_Nicotinic_acetylcholine_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.R345C	ENST00000370263.4	37	c.1033	CCDS13517.1	20	.	.	.	.	.	.	.	.	.	.	G	21.3	4.126035	0.77436	2.27E-4	0.0	ENSG00000101204	ENST00000370258;ENST00000370263;ENST00000539366	T	0.74315	-0.83	5.15	5.15	0.70609	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.000000	0.85682	D	0.000000	D	0.88001	0.6320	M	0.90082	3.085	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.937	D	0.90178	0.4240	10	0.87932	D	0	.	13.509	0.61499	0.0:0.0:0.8038:0.1962	.	274;345	Q4VAQ5;P43681	.;ACHA4_HUMAN	C	251;345;274	ENSP00000359285:R345C	ENSP00000359280:R251C	R	-	1	0	CHRNA4	61452174	1.000000	0.71417	0.990000	0.47175	0.828000	0.46876	4.842000	0.62831	2.390000	0.81377	0.655000	0.94253	CGC	-	pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM,tigrfam_Neur_channel		0.602	CHRNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRNA4	protein_coding	OTTHUMT00000080508.3	G		rs142260793		61981730	-1	no_errors	ENST00000370263	ensembl	human	known	74_37	missense	SNP	1.000	A
