#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
CCDC158	339965	genome.wustl.edu	37	4	77305549	77305549	+	Missense_Mutation	SNP	G	G	T			TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr4:77305549G>T	ENST00000388914.3	-	5	570	c.418C>A	c.(418-420)Cag>Aag	p.Q140K	CCDC158_ENST00000434846.2_Missense_Mutation_p.Q140K	NM_001042784.1	NP_001036249.1	Q5M9N0	CD158_HUMAN	coiled-coil domain containing 158	140										breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(28)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|stomach(1)	56						AAATCCTCCTGGGACTGACTC	0.343																																																	0								ENSG00000163749						75.0	67.0	70.0					4																	77305549		1844	4084	5928	CCDC158	SO:0001583	missense	0			-	HGNC	BC035224	CCDS43242.1	4q21.1	2009-04-06			ENSG00000163749	ENSG00000163749			26374	protein-coding gene	gene with protein product						12477932	Standard	NM_001042784		Approved	FLJ25770	uc003hkb.4	Q5M9N0	OTTHUMG00000160916	ENST00000388914.3:c.418C>A	4.37:g.77305549G>T	ENSP00000373566:p.Gln140Lys	Somatic	0	24	0.00		0.5963777675123697	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	13	18.75	Q8IYQ1|Q8N7D4|Q8N7E3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_Prefoldin	p.Q140K	ENST00000388914.3	37	c.418	CCDS43242.1	4	.	.	.	.	.	.	.	.	.	.	G	18.62	3.663470	0.67700	.	.	ENSG00000163749	ENST00000388914;ENST00000318586;ENST00000434846	T;T	0.39787	1.11;1.06	5.72	4.87	0.63330	.	0.000000	0.52532	D	0.000071	T	0.46852	0.1414	N	0.24115	0.695	0.31455	N	0.670283	P;D	0.58268	0.954;0.982	D;D	0.70227	0.954;0.968	T	0.48186	-0.9057	10	0.16896	T	0.51	.	13.9457	0.64082	0.0:0.1523:0.8477:0.0	.	140;140	Q5M9N0-3;Q5M9N0	.;CD158_HUMAN	K	140	ENSP00000373566:Q140K;ENSP00000401742:Q140K	ENSP00000316815:Q140K	Q	-	1	0	CCDC158	77524573	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.081000	0.71309	1.411000	0.46957	0.655000	0.94253	CAG	-	NULL		0.343	CCDC158-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC158	protein_coding	OTTHUMT00000362694.2	G	NM_001042784	-		77305549	-1	no_errors	ENST00000388914	ensembl	human	known	74_37	missense	SNP	1.000	T
KIAA1549	57670	genome.wustl.edu	37	7	138601629	138601629	+	Missense_Mutation	SNP	C	C	A			TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr7:138601629C>A	ENST00000422774.1	-	2	2791	c.2743G>T	c.(2743-2745)Gct>Tct	p.A915S	KIAA1549_ENST00000440172.1_Missense_Mutation_p.A915S|KIAA1549_ENST00000242365.4_Missense_Mutation_p.A865S			Q9HCM3	K1549_HUMAN	KIAA1549	915						integral component of membrane (GO:0016021)			KIAA1549/BRAF(703)	large_intestine(4)|pancreas(1)|upper_aerodigestive_tract(2)	7						AGGGGAGGAGCAGCACTACTC	0.612			O	BRAF	pilocytic astrocytoma																																NSCLC(119;1534 1718 44213 46230 50068)			Dom	yes		7	7q34	57670	KIAA1549		O	0								ENSG00000122778						38.0	43.0	41.0					7																	138601629		2141	4239	6380	KIAA1549	SO:0001583	missense	0			-	HGNC		CCDS47723.1, CCDS47723.2, CCDS56513.1	7q34	2009-10-09			ENSG00000122778	ENSG00000122778			22219	protein-coding gene	gene with protein product		613344					Standard	NM_020910		Approved		uc011kql.2	Q9HCM3	OTTHUMG00000157214	ENST00000422774.1:c.2743G>T	7.37:g.138601629C>A	ENSP00000416040:p.Ala915Ser	Somatic	0	34	0.00		0.5963777675123697	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	22	24.14	B6HY55|B6HY56|B6HY58|B6HY60|B6HY61|B6HY62|B6HY63|B6HY64|B6HY65|B6HY66|Q5BJD6|Q8IY15|Q9H0M3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.A915S	ENST00000422774.1	37	c.2743	CCDS56513.1	7	.	.	.	.	.	.	.	.	.	.	C	6.545	0.468868	0.12461	.	.	ENSG00000122778	ENST00000440172;ENST00000242365;ENST00000422774	T;T;T	0.24350	1.86;1.87;1.87	4.4	-1.03	0.10102	.	1.204060	0.05991	N	0.646130	T	0.13329	0.0323	N	0.14661	0.345	0.09310	N	1	B;B	0.17268	0.012;0.021	B;B	0.18561	0.01;0.022	T	0.31280	-0.9949	10	0.30078	T	0.28	.	3.8956	0.09138	0.1231:0.2107:0.4935:0.1728	.	915;915	Q9HCM3;Q9HCM3-2	K1549_HUMAN;.	S	915;865;915	ENSP00000406661:A915S;ENSP00000242365:A865S;ENSP00000416040:A915S	ENSP00000242365:A865S	A	-	1	0	KIAA1549	138252169	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.292000	0.08332	0.120000	0.18254	0.561000	0.74099	GCT	-	NULL		0.612	KIAA1549-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA1549	protein_coding	OTTHUMT00000348092.1	C		-		138601629	-1	no_errors	ENST00000422774	ensembl	human	known	74_37	missense	SNP	0.000	A
NCKAP1	10787	genome.wustl.edu	37	2	183817934	183817934	+	Frame_Shift_Del	DEL	T	T	-			TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr2:183817934delT	ENST00000361354.4	-	21	2651	c.2279delA	c.(2278-2280)gatfs	p.D760fs	NCKAP1_ENST00000360982.2_Frame_Shift_Del_p.D766fs	NM_013436.3	NP_038464.1	Q9Y2A7	NCKP1_HUMAN	NCK-associated protein 1	760					apical protein localization (GO:0045176)|apoptotic process (GO:0006915)|basal protein localization (GO:0045175)|central nervous system development (GO:0007417)|embryonic body morphogenesis (GO:0010172)|embryonic foregut morphogenesis (GO:0048617)|embryonic heart tube development (GO:0035050)|endoderm development (GO:0007492)|establishment or maintenance of actin cytoskeleton polarity (GO:0030950)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|lamellipodium assembly (GO:0030032)|mesodermal cell migration (GO:0008078)|neural tube closure (GO:0001843)|notochord morphogenesis (GO:0048570)|paraxial mesoderm morphogenesis (GO:0048340)|positive regulation of Arp2/3 complex-mediated actin nucleation (GO:2000601)|positive regulation of lamellipodium assembly (GO:0010592)|protein stabilization (GO:0050821)|Rac protein signal transduction (GO:0016601)|regulation of protein localization (GO:0032880)|somitogenesis (GO:0001756)|zygotic determination of anterior/posterior axis, embryo (GO:0007354)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|SCAR complex (GO:0031209)	protein complex binding (GO:0032403)			breast(3)|cervix(2)|endometrium(3)|kidney(4)|large_intestine(11)|lung(16)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	45			OV - Ovarian serous cystadenocarcinoma(117;0.0942)|Epithelial(96;0.209)			TCTTGTAATATCAATCTGCAC	0.358																																																	0								ENSG00000061676						140.0	134.0	136.0					2																	183817934		2202	4300	6502	NCKAP1	SO:0001589	frameshift_variant	0				HGNC	AB014509	CCDS2287.1, CCDS2288.1	2q32	2009-08-14			ENSG00000061676	ENSG00000061676			7666	protein-coding gene	gene with protein product		604891				10673335, 12181570, 9344857	Standard	NM_013436		Approved	Nap1, HEM2, NAP125	uc002upb.4	Q9Y2A7	OTTHUMG00000132623	ENST00000361354.4:c.2279delA	2.37:g.183817934delT	ENSP00000355348:p.Asp760fs	Somatic	0	66	0.00		0.5963777675123697	24	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	62	21.52	O60329|Q53QN5|Q53S94|Q53Y35	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Nck-associated_protein-1	p.D766fs	ENST00000361354.4	37	c.2297	CCDS2287.1	2																																																																																			-	pfam_Nck-associated_protein-1		0.358	NCKAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCKAP1	protein_coding	OTTHUMT00000255867.2	T	NM_205842			183817934	-1	no_errors	ENST00000360982	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
KLF8	11279	genome.wustl.edu	37	X	56276720	56276720	+	Missense_Mutation	SNP	A	A	G			TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chrX:56276720A>G	ENST00000468660.1	+	2	352	c.64A>G	c.(64-66)Atg>Gtg	p.M22V	KLF8_ENST00000374928.3_Missense_Mutation_p.M22V	NM_007250.4	NP_009181.2	O95600	KLF8_HUMAN	Kruppel-like factor 8	22					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			kidney(4)|large_intestine(6)|lung(5)|ovary(1)	16						AGGTGGCTCAATGCAGGTATT	0.348																																																	0								ENSG00000102349						121.0	118.0	119.0					X																	56276720		2203	4300	6503	KLF8	SO:0001583	missense	0			-	HGNC	U28282	CCDS14373.1, CCDS55428.1	Xp11.21	2013-01-08			ENSG00000102349	ENSG00000102349		"""Zinc fingers, C2H2-type"", ""Kruppel-like transcription factors"""	6351	protein-coding gene	gene with protein product		300286					Standard	NM_007250		Approved	BKLF3, ZNF741, DXS741	uc004dur.3	O95600	OTTHUMG00000021666	ENST00000468660.1:c.64A>G	X.37:g.56276720A>G	ENSP00000417303:p.Met22Val	Somatic	0	21	0.00		0.5963777675123697	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	23	41.03	B4DJN3|E7EQQ8|L0R3U8|L0R4U2|Q2M246|Q59GV5|Q5HYQ5|Q5JXP7|Q6MZJ7|Q9UGC4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.M22V	ENST00000468660.1	37	c.64	CCDS14373.1	X	.	.	.	.	.	.	.	.	.	.	A	8.173	0.792147	0.16258	.	.	ENSG00000102349	ENST00000374928;ENST00000468660	T	0.05199	3.48	3.03	1.8	0.24995	.	0.145340	0.32372	N	0.006186	T	0.04770	0.0129	L	0.29908	0.895	0.23277	N	0.997995	B;B	0.15930	0.015;0.003	B;B	0.17098	0.017;0.004	T	0.34030	-0.9845	10	0.66056	D	0.02	.	5.422	0.16405	0.7095:0.2905:0.0:0.0	.	22;22	E7EQQ8;O95600	.;KLF8_HUMAN	V	22	ENSP00000417303:M22V	ENSP00000431911:M22V	M	+	1	0	KLF8	56293445	1.000000	0.71417	0.981000	0.43875	0.768000	0.43524	3.451000	0.52964	0.377000	0.24735	0.486000	0.48141	ATG	-	NULL		0.348	KLF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLF8	protein_coding	OTTHUMT00000056887.2	A	NM_007250	-		56276720	+1	no_errors	ENST00000468660	ensembl	human	known	74_37	missense	SNP	0.978	G
SMYD5	10322	genome.wustl.edu	37	2	73447119	73447119	+	Intron	SNP	G	G	T			TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr2:73447119G>T	ENST00000389501.4	+	3	250				SMYD5_ENST00000474652.1_3'UTR	NM_006062.2	NP_006053.2	Q6GMV2	SMYD5_HUMAN	SMYD family member 5								metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			NS(1)|breast(1)|endometrium(1)|large_intestine(3)|lung(5)|pancreas(1)|upper_aerodigestive_tract(1)	13						gtaGGGCTGTGAAAGGGATAG	0.478																																																	0								ENSG00000135632																																			SMYD5	SO:0001627	intron_variant	0			-	HGNC	U50383	CCDS33221.2	2p12	2007-02-09	2003-05-14	2003-05-16	ENSG00000135632	ENSG00000135632		"""Zinc fingers, MYND-type"""	16258	protein-coding gene	gene with protein product			"""retinoic acid induced 15"""	RAI15		8754834	Standard	NM_006062		Approved	RRG1, NN8-4AG, ZMYND23	uc002siw.2	Q6GMV2	OTTHUMG00000150482	ENST00000389501.4:c.206-60G>T	2.37:g.73447119G>T		Somatic	0	47	0.00		0.5963777675123697	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	22	14.81	D6W5H3|Q13558	Nonstop_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.*82L	ENST00000389501.4	37	c.245	CCDS33221.2	2																																																																																			-	NULL		0.478	SMYD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMYD5	protein_coding	OTTHUMT00000318301.1	G	NM_006062	-		73447119	+1	no_errors	ENST00000413491	ensembl	human	known	74_37	nonstop	SNP	0.063	T
WDFY3	23001	genome.wustl.edu	37	4	85625498	85625498	+	Missense_Mutation	SNP	C	C	G			TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr4:85625498C>G	ENST00000295888.4	-	55	8842	c.8435G>C	c.(8434-8436)aGg>aCg	p.R2812T	WDFY3_ENST00000322366.6_Missense_Mutation_p.R2795T	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3	2812	BEACH. {ECO:0000255|PROSITE- ProRule:PRU00026}.|Interaction with SQSTM1.|Sufficient for translocalization to p62 bodies/ALIS.				aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		TACCTGTAGCCTTAAGAATAT	0.358																																																	0								ENSG00000163625						81.0	86.0	84.0					4																	85625498		2203	4300	6503	WDFY3	SO:0001583	missense	0			-	HGNC	AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424	ENST00000295888.4:c.8435G>C	4.37:g.85625498C>G	ENSP00000295888:p.Arg2812Thr	Somatic	0	67	0.00		0.5963777675123697	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	38	32.14	Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_BEACH_dom,pfam_Znf_FYVE,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_Znf_FYVE_PHD,superfamily_ConA-like_lec_gl_sf,superfamily_Cyclin-like,superfamily_ARM-type_fold,smart_WD40_repeat,smart_Znf_FYVE,pfscan_BEACH_dom,pfscan_Znf_FYVE-rel,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R2812T	ENST00000295888.4	37	c.8435	CCDS3609.1	4	.	.	.	.	.	.	.	.	.	.	C	18.37	3.610186	0.66558	.	.	ENSG00000163625	ENST00000322366;ENST00000295888;ENST00000514711	T;T;T	0.79940	-1.32;-1.32;-1.32	6.03	6.03	0.97812	BEACH domain (4);	0.101891	0.64402	D	0.000004	T	0.79707	0.4492	L	0.46614	1.455	0.80722	D	1	P	0.38395	0.629	B	0.40982	0.345	T	0.75491	-0.3299	10	0.29301	T	0.29	.	20.5753	0.99366	0.0:1.0:0.0:0.0	.	2812	Q8IZQ1	WDFY3_HUMAN	T	2795;2812;415	ENSP00000318466:R2795T;ENSP00000295888:R2812T;ENSP00000424987:R415T	ENSP00000295888:R2812T	R	-	2	0	WDFY3	85844522	0.991000	0.36638	0.982000	0.44146	0.978000	0.69477	7.818000	0.86416	2.868000	0.98415	0.557000	0.71058	AGG	-	pfam_BEACH_dom,superfamily_BEACH_dom,pfscan_BEACH_dom		0.358	WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDFY3	protein_coding	OTTHUMT00000252811.2	C	NM_014991	-		85625498	-1	no_errors	ENST00000295888	ensembl	human	known	74_37	missense	SNP	0.997	G
RFPL4A	342931	genome.wustl.edu	37	19	56274126	56274126	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr19:56274126G>A	ENST00000434937.2	+	3	620	c.449G>A	c.(448-450)cGc>cAc	p.R150H		NM_001145014.1	NP_001138486.1	A6NLU0	RFPLA_HUMAN	ret finger protein-like 4A	150	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.						zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(1)|stomach(1)	2						ACTTCCGGCCGCCATTACTGG	0.572																																																	0								ENSG00000223638						14.0	15.0	14.0					19																	56274126		684	1562	2246	RFPL4A	SO:0001583	missense	0			-	HGNC		CCDS46201.1	19q13.42	2013-02-22	2007-01-19	2007-01-19	ENSG00000223638	ENSG00000223638		"""RING-type (C3HC4) zinc fingers"""	16449	protein-coding gene	gene with protein product		612601	"""ret finger protein-like 4"""	RFPL4		11850190	Standard	NM_001145014		Approved	RNF210	uc010yge.2	A6NLU0	OTTHUMG00000165449	ENST00000434937.2:c.449G>A	19.37:g.56274126G>A	ENSP00000392936:p.Arg150His	Somatic	1	185	0.53		0.5963777675123697	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	132	11.41		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RDM_domain_RFPL,pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,smart_PRY,smart_SPla/RYanodine_receptor_subgr,prints_Butyrophylin,pfscan_B30.2/SPRY,pfscan_Znf_RING	p.R150H	ENST00000434937.2	37	c.449	CCDS46201.1	19	.	.	.	.	.	.	.	.	.	.	G	8.232	0.804780	0.16467	.	.	ENSG00000223638	ENST00000434937	T	0.70986	-0.53	2.64	-1.94	0.07571	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);Butyrophylin-like (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	.	.	.	.	T	0.69187	0.3083	M	0.89414	3.03	0.18873	N	0.999983	B	0.30870	0.298	B	0.25884	0.064	T	0.62497	-0.6842	9	0.66056	D	0.02	-12.6675	7.185	0.25795	0.479:0.0:0.521:0.0	.	150	A6NLU0	RFPLA_HUMAN	H	150	ENSP00000392936:R150H	ENSP00000392936:R150H	R	+	2	0	RFPL4A	60965938	0.666000	0.27475	0.003000	0.11579	0.006000	0.05464	3.674000	0.54598	-0.376000	0.07943	-0.794000	0.03295	CGC	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,smart_SPla/RYanodine_receptor_subgr,prints_Butyrophylin,pfscan_B30.2/SPRY		0.572	RFPL4A-001	NOVEL	upstream_ATG|basic|appris_principal|CCDS	protein_coding	RFPL4A	protein_coding	OTTHUMT00000384184.1	G	XM_292796	-		56274126	+1	no_errors	ENST00000434937	ensembl	human	novel	74_37	missense	SNP	0.116	A
LINC01330	646168	genome.wustl.edu	37	3	167621135	167621135	+	lincRNA	SNP	C	C	T			TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr3:167621135C>T	ENST00000481578.1	+	0	179																											ATTTGTCCATCTAATTCATCA	0.388																																																	0								ENSG00000244227																																			RP11-298O21.5			0			-	Clone_based_vega_gene																													3.37:g.167621135C>T		Somatic	0	55	0.00		0.5963777675123697	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	57	10.94		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000481578.1	37	NULL		3																																																																																			-	-		0.388	RP11-298O21.5-002	KNOWN	basic	lincRNA	ENSG00000244227	lincRNA	OTTHUMT00000351188.1	C		-		167621135	+1	no_errors	ENST00000459923	ensembl	human	known	74_37	rna	SNP	0.003	T
KIAA1549L	25758	genome.wustl.edu	37	11	33564330	33564330	+	Missense_Mutation	SNP	G	G	T			TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr11:33564330G>T	ENST00000321505.4	+	1	510	c.330G>T	c.(328-330)aaG>aaT	p.K110N	KIAA1549L_ENST00000265654.5_Missense_Mutation_p.K110N|KIAA1549L_ENST00000389726.3_Missense_Mutation_p.K110N			Q6ZVL6	K154L_HUMAN	KIAA1549-like	110						integral component of membrane (GO:0016021)											CAACTTTTAAGAATACAGAAA	0.522											OREG0020868	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000110427						36.0	37.0	37.0					11																	33564330		1884	4107	5991	KIAA1549L	SO:0001583	missense	0			-	HGNC	U10991	CCDS44565.1, CCDS44565.2	11p13	2012-08-09	2012-08-09	2012-08-09	ENSG00000110427	ENSG00000110427			24836	protein-coding gene	gene with protein product		612297	"""chromosome 11 open reading frame 69"", ""chromosome 11 open reading frame 41"""	C11orf69, C11orf41			Standard	NM_012194		Approved	G2, MGC34830	uc021qfs.1	Q6ZVL6	OTTHUMG00000150410	ENST00000321505.4:c.330G>T	11.37:g.33564330G>T	ENSP00000315295:p.Lys110Asn	Somatic	0	32	0.00	841	0.5963777675123697	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	B0QYU0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.K110N	ENST00000321505.4	37	c.330	CCDS44565.2	11	.	.	.	.	.	.	.	.	.	.	G	11.68	1.710129	0.30322	.	.	ENSG00000110427	ENST00000321505;ENST00000389726;ENST00000265654	.	.	.	5.4	3.51	0.40186	.	.	.	.	.	T	0.24431	0.0592	N	0.19112	0.55	0.09310	N	1	B;P	0.41848	0.281;0.763	B;B	0.41619	0.056;0.361	T	0.05484	-1.0882	8	0.28530	T	0.3	-1.7241	8.8903	0.35429	0.171:0.0:0.829:0.0	.	110;110	E9PAT2;Q6ZVL6-2	.;.	N	110	.	ENSP00000265654:K110N	K	+	3	2	C11orf41	33520906	0.041000	0.20044	0.002000	0.10522	0.014000	0.08584	2.389000	0.44407	1.261000	0.44149	0.561000	0.74099	AAG	-	NULL		0.522	KIAA1549L-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KIAA1549L	protein_coding	OTTHUMT00000317998.1	G	NM_012194	-		33564330	+1	no_errors	ENST00000389726	ensembl	human	known	74_37	missense	SNP	0.004	T
GRIN3A	116443	genome.wustl.edu	37	9	104335644	104335644	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr9:104335644C>T	ENST00000361820.3	-	9	3760	c.3160G>A	c.(3160-3162)Gag>Aag	p.E1054K		NM_133445.2	NP_597702.2	Q8TCU5	NMD3A_HUMAN	glutamate receptor, ionotropic, N-methyl-D-aspartate 3A	1054					calcium ion transport (GO:0006816)|dendrite development (GO:0016358)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|response to ethanol (GO:0045471)|rhythmic process (GO:0048511)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|identical protein binding (GO:0042802)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|protein phosphatase 2A binding (GO:0051721)			breast(2)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(44)|ovary(4)|pancreas(1)|skin(7)|upper_aerodigestive_tract(1)	80		Acute lymphoblastic leukemia(62;0.0568)			Acamprosate(DB00659)|Acetylcysteine(DB06151)|Amantadine(DB00915)|Atomoxetine(DB00289)|Chloroprocaine(DB01161)|Dextromethorphan(DB00514)|Ethanol(DB00898)|Ethopropazine(DB00392)|Felbamate(DB00949)|Gabapentin(DB00996)|Halothane(DB01159)|Ketamine(DB01221)|Ketobemidone(DB06738)|Memantine(DB01043)|Methadone(DB00333)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Procaine(DB00721)|Secobarbital(DB00418)|Tramadol(DB00193)	GCAGGGAGCTCTCTTCTCCTT	0.522																																																	0								ENSG00000198785						134.0	122.0	126.0					9																	104335644		2203	4300	6503	GRIN3A	SO:0001583	missense	0			-	HGNC		CCDS6758.1	9q31.1	2012-08-29			ENSG00000198785	ENSG00000198785		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	16767	protein-coding gene	gene with protein product		606650					Standard	NM_133445		Approved	GluN3A	uc004bbp.2	Q8TCU5	OTTHUMG00000020387	ENST00000361820.3:c.3160G>A	9.37:g.104335644C>T	ENSP00000355155:p.Glu1054Lys	Somatic	0	45	0.00		0.5963777675123697	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	57	8.06	B3DLF9|Q5VTR3|Q8TF29|Q8WXI6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,superfamily_Peripla_BP_I,smart_Glu_rcpt_Glu/Gly-bd,smart_Iontro_glu_rcpt,prints_NMDA_rcpt	p.E1054K	ENST00000361820.3	37	c.3160	CCDS6758.1	9	.	.	.	.	.	.	.	.	.	.	C	20.7	4.032705	0.75504	.	.	ENSG00000198785	ENST00000361820	T	0.11169	2.8	5.38	5.38	0.77491	.	1.446720	0.03974	N	0.292116	T	0.17959	0.0431	M	0.66939	2.045	0.54753	D	0.999983	P	0.42010	0.768	B	0.30316	0.114	T	0.53585	-0.8418	10	0.41790	T	0.15	.	19.4894	0.95044	0.0:1.0:0.0:0.0	.	1054	Q8TCU5	NMD3A_HUMAN	K	1054	ENSP00000355155:E1054K	ENSP00000355155:E1054K	E	-	1	0	GRIN3A	103375465	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	4.206000	0.58473	2.686000	0.91538	0.655000	0.94253	GAG	-	NULL		0.522	GRIN3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIN3A	protein_coding	OTTHUMT00000053453.1	C		-		104335644	-1	no_errors	ENST00000361820	ensembl	human	known	74_37	missense	SNP	1.000	T
FAM182B	728882	genome.wustl.edu	37	20	25755864	25755864	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr20:25755864C>T	ENST00000376403.1	-	3	470	c.92G>A	c.(91-93)gGa>gAa	p.G31E	FAM182B_ENST00000376404.2_Missense_Mutation_p.G28E|FAM182B_ENST00000478164.1_5'UTR			Q5T319	F182B_HUMAN	family with sequence similarity 182, member B	31										lung(1)	1						TGCTGGGCATCCGCAGTGCTG	0.562																																																	0								ENSG00000175170																																			FAM182B	SO:0001583	missense	0			-	HGNC			20p11.1	2010-07-14			ENSG00000175170	ENSG00000175170			34503	pseudogene	pseudogene							Standard	NR_027061		Approved			Q5T319	OTTHUMG00000032136	ENST00000376403.1:c.92G>A	20.37:g.25755864C>T	ENSP00000365585:p.Gly31Glu	Somatic	0	53	0.00		0.5963777675123697	0	100.00	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	52	16.13	Q4G0Q1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.G28E	ENST00000376403.1	37	c.83		20	.	.	.	.	.	.	.	.	.	.	.	0.705	-0.789306	0.02884	.	.	ENSG00000175170	ENST00000376404;ENST00000376403	.	.	.	.	.	.	.	.	.	.	.	T	0.39064	0.1064	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.39187	-0.9626	3	0.87932	D	0	.	.	.	.	.	.	.	.	E	28;31	.	ENSP00000365585:G31E	G	-	2	0	FAM182B	25703864	0.011000	0.17503	0.314000	0.25224	0.317000	0.28152	-0.229000	0.09098	0.064000	0.16427	0.064000	0.15345	GGA	-	NULL		0.562	FAM182B-003	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	FAM182B	protein_coding	OTTHUMT00000078463.2	C	NR_026714	-		25755864	-1	no_errors	ENST00000376404	ensembl	human	known	74_37	missense	SNP	0.317	T
PAPD5	64282	genome.wustl.edu	37	16	50265294	50265294	+	3'UTR	SNP	C	C	T			TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr16:50265294C>T	ENST00000436909.3	+	0	4187				PAPD5_ENST00000573002.1_3'UTR|PAPD5_ENST00000357464.3_3'UTR	NM_001040284.2|NM_001040285.2	NP_001035374.2|NP_001035375.2	Q8NDF8	PAPD5_HUMAN	PAP associated domain containing 5						histone mRNA catabolic process (GO:0071044)|mitotic nuclear division (GO:0007067)|mRNA processing (GO:0006397)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|polynucleotide adenylyltransferase activity (GO:0004652)			endometrium(1)|kidney(1)|lung(2)	4		all_cancers(37;0.0452)		BRCA - Breast invasive adenocarcinoma(181;0.0843)|GBM - Glioblastoma multiforme(240;0.231)		aatattaaatCCAGTATTAGC	0.279																																																	0								ENSG00000121274																																			PAPD5	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AF089897	CCDS54006.1	16q12.1	2010-11-18				ENSG00000121274			30758	protein-coding gene	gene with protein product	"""TUTase3"""	605540				10066793	Standard	NM_001040284		Approved	TRF4-2	uc010vgo.2	Q8NDF8		ENST00000436909.3:c.*2055C>T	16.37:g.50265294C>T		Somatic	0	67	0.00		0.5963777675123697	29	21.62	8	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	38	34.48	B4DV38|Q9NW67|Q9Y6C0	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000436909.3	37	NULL	CCDS54006.1	16																																																																																			-	-		0.279	PAPD5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PAPD5	protein_coding	OTTHUMT00000423149.2	C	NM_022447	-		50265294	+1	no_errors	ENST00000573002	ensembl	human	known	74_37	rna	SNP	1.000	T
CCDC88C	440193	genome.wustl.edu	37	14	91744358	91744358	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr14:91744358C>T	ENST00000389857.6	-	29	5052	c.4966G>A	c.(4966-4968)Gtc>Atc	p.V1656I	CCDC88C_ENST00000331194.7_Missense_Mutation_p.V180I	NM_001080414.3	NP_001073883.2	Q9P219	DAPLE_HUMAN	coiled-coil domain containing 88C	1656					protein destabilization (GO:0031648)|protein homooligomerization (GO:0051260)|regulation of protein phosphorylation (GO:0001932)|Wnt signaling pathway (GO:0016055)		PDZ domain binding (GO:0030165)|protein self-association (GO:0043621)			central_nervous_system(3)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(6)|pancreas(1)|urinary_tract(1)	24		all_cancers(154;0.0468)				CGCACTCCGACGTAGGGAGGG	0.682																																																	0								ENSG00000015133						12.0	16.0	15.0					14																	91744358		1988	4158	6146	CCDC88C	SO:0001583	missense	0			-	HGNC		CCDS45151.1	14q32.12	2014-07-30	2007-05-31	2007-05-31		ENSG00000015133			19967	protein-coding gene	gene with protein product	"""Dvl-associating protein with a high frequency of leucine residues"", ""spinocerebellar ataxia 40"""	611204	"""KIAA1509"""	KIAA1509		17185515, 25062847	Standard	NM_001080414		Approved	DAPLE, HkRP2, SCA40	uc010aty.3	Q9P219		ENST00000389857.6:c.4966G>A	14.37:g.91744358C>T	ENSP00000374507:p.Val1656Ile	Somatic	0	64	0.00		0.5963777675123697	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	42	25.00	Q69YK1|Q7L1M2|Q86SX7|Q8IYG8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Hook-related_fam,superfamily_Prefoldin,superfamily_Fum_Rdtase/Succ_DH_flav-like_C	p.V1656I	ENST00000389857.6	37	c.4966	CCDS45151.1	14	.	.	.	.	.	.	.	.	.	.	C	2.048	-0.418379	0.04766	.	.	ENSG00000015133	ENST00000389857;ENST00000427583;ENST00000331194	T;T	0.42131	2.56;0.98	5.14	-1.17	0.09648	.	0.863662	0.09698	U	0.767420	T	0.17152	0.0412	N	0.08118	0	0.09310	N	1	B;B;B	0.17667	0.023;0.021;0.021	B;B;B	0.13407	0.009;0.004;0.002	T	0.18745	-1.0327	10	0.28530	T	0.3	-0.6117	1.2284	0.01938	0.1255:0.2826:0.2466:0.3453	.	1656;180;106	Q9P219;Q9P219-2;Q9P219-3	DAPLE_HUMAN;.;.	I	1656;180;180	ENSP00000374507:V1656I;ENSP00000330332:V180I	ENSP00000330332:V180I	V	-	1	0	CCDC88C	90814111	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.865000	0.04250	-0.185000	0.10550	-0.448000	0.05591	GTC	-	NULL		0.682	CCDC88C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC88C	protein_coding	OTTHUMT00000411650.1	C	XM_029353	-		91744358	-1	no_errors	ENST00000389857	ensembl	human	known	74_37	missense	SNP	0.000	T
DNAH5	1767	genome.wustl.edu	37	5	13922290	13922290	+	Missense_Mutation	SNP	G	G	A	rs200314274		TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr5:13922290G>A	ENST00000265104.4	-	5	690	c.586C>T	c.(586-588)Cgc>Tgc	p.R196C		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	196	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					AACTCCTGGCGAATGTTAGCT	0.557									Kartagener syndrome				G|||	1	0.000199681	0.0008	0.0	5008	,	,		17820	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000039139						88.0	77.0	81.0					5																	13922290		2203	4300	6503	DNAH5	SO:0001583	missense	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	-	HGNC	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.586C>T	5.37:g.13922290G>A	ENSP00000265104:p.Arg196Cys	Somatic	0	60	0.00		0.5963777675123697	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	89	9.18	Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.R196C	ENST00000265104.4	37	c.586	CCDS3882.1	5	.	.	.	.	.	.	.	.	.	.	.	14.28	2.487821	0.44249	.	.	ENSG00000039139	ENST00000265104	T	0.25912	1.77	5.55	5.55	0.83447	.	0.346876	0.27659	N	0.018393	T	0.31295	0.0792	M	0.62723	1.935	0.22156	N	0.999322	D	0.55605	0.972	P	0.44860	0.462	T	0.38222	-0.9671	10	0.87932	D	0	.	12.5941	0.56459	0.0:0.0:0.7218:0.2781	.	196	Q8TE73	DYH5_HUMAN	C	196	ENSP00000265104:R196C	ENSP00000265104:R196C	R	-	1	0	DNAH5	13975290	0.984000	0.35163	0.013000	0.15412	0.263000	0.26337	2.645000	0.46621	2.610000	0.88304	0.561000	0.74099	CGC	-	NULL		0.557	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH5	protein_coding	OTTHUMT00000207057.2	G	NM_001369	rs200314274		13922290	-1	no_errors	ENST00000265104	ensembl	human	known	74_37	missense	SNP	0.152	A
AGO3	192669	genome.wustl.edu	37	1	36475026	36475027	+	Intron	INS	-	-	A	rs556239903|rs3834076|rs397840917	byFrequency	TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr1:36475026_36475027insA	ENST00000373191.4	+	9	1378				AGO3_ENST00000246314.6_Intron|RP4-665N4.8_ENST00000479395.2_RNA|RP4-665N4.8_ENST00000466576.2_RNA	NM_024852.3	NP_079128.2	Q9H9G7	AGO3_HUMAN	argonaute RISC catalytic component 3						epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA catabolic process (GO:0006402)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of stem cell proliferation (GO:0072091)	cytosol (GO:0005829)|membrane (GO:0016020)|micro-ribonucleoprotein complex (GO:0035068)|RISC complex (GO:0016442)	miRNA binding (GO:0035198)|poly(A) RNA binding (GO:0044822)										AAGTAAGAGCTAAAAAAAAAAG	0.277													|||unknown(HR)	192	0.0383387	0.0023	0.0187	5008	,	,		15573	0.1607		0.005	False		,,,				2504	0.0092																0								ENSG00000271554																																			RP4-665N4.8	SO:0001627	intron_variant	0				Clone_based_vega_gene	AB046787	CCDS399.1, CCDS400.1	1p34	2013-06-03	2013-02-15	2013-02-15	ENSG00000126070	ENSG00000126070		"""Argonaute/PIWI family"""	18421	protein-coding gene	gene with protein product	"""argonaute 3"""	607355	"""eukaryotic translation initiation factor 2C, 3"""	EIF2C3		12906857	Standard	NM_024852		Approved	hAGO3, FLJ12765	uc001bzp.3	Q9H9G7	OTTHUMG00000184172	ENST00000373191.4:c.1030-49->A	1.37:g.36475036_36475036dupA		Somatic	0	17	0.00		0.5963777675123697	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	18	18.18	B1ALI0|Q5TA55|Q9H1U6	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000373191.4	37	NULL	CCDS399.1	1																																																																																			-	-		0.277	AGO3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000271554	protein_coding	OTTHUMT00000019831.4	-	NM_024852			36475027	-1	no_errors	ENST00000479395	ensembl	human	known	74_37	rna	INS	0.026:0.011	A
KCNV1	27012	genome.wustl.edu	37	8	110980710	110980710	+	Missense_Mutation	SNP	G	G	C			TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr8:110980710G>C	ENST00000524391.1	-	4	2142	c.1110C>G	c.(1108-1110)agC>agG	p.S370R	KCNV1_ENST00000297404.1_Missense_Mutation_p.S370R			Q6PIU1	KCNV1_HUMAN	potassium channel, subfamily V, member 1	370					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|ion channel inhibitor activity (GO:0008200)|potassium channel regulator activity (GO:0015459)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(20)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	37	all_neural(195;0.219)		OV - Ovarian serous cystadenocarcinoma(57;5.35e-13)			TGTCAGGAATGCTTTGCTCAG	0.473																																																	0								ENSG00000164794						81.0	80.0	80.0					8																	110980710		2203	4300	6503	KCNV1	SO:0001583	missense	0			-	HGNC	AF167082	CCDS6314.1	8q23.2	2011-07-05				ENSG00000164794		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18861	protein-coding gene	gene with protein product		608164				8670833, 16382104	Standard	NM_014379		Approved	Kv8.1	uc003ynr.4	Q6PIU1		ENST00000524391.1:c.1110C>G	8.37:g.110980710G>C	ENSP00000435954:p.Ser370Arg	Somatic	0	32	0.00		0.5963777675123697	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	21	54.35	Q9UHJ4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_T1-type_BTB,pfam_Ion_trans_dom,pfam_2pore_dom_K_chnl_dom,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv8,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv9,prints_K_chnl_volt-dep_Kv3,prints_K_chnl_volt-dep_Kv6,prints_K_chnl_volt-dep_Kv4	p.S370R	ENST00000524391.1	37	c.1110	CCDS6314.1	8	.	.	.	.	.	.	.	.	.	.	G	13.43	2.234753	0.39498	.	.	ENSG00000164794	ENST00000524391;ENST00000297404;ENST00000545728	D;D	0.98381	-4.9;-4.9	5.62	2.86	0.33363	Ion transport (1);	0.209891	0.50627	D	0.000105	D	0.93831	0.8027	N	0.12527	0.23	0.28069	N	0.932669	P	0.44946	0.846	B	0.43445	0.42	D	0.90280	0.4314	10	0.87932	D	0	.	6.3819	0.21540	0.4176:0.0:0.5824:0.0	.	370	Q6PIU1	KCNV1_HUMAN	R	370;370;246	ENSP00000435954:S370R;ENSP00000297404:S370R	ENSP00000297404:S370R	S	-	3	2	KCNV1	111049886	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.920000	0.40025	0.726000	0.32339	-0.140000	0.14226	AGC	-	pfam_Ion_trans_dom,pfam_2pore_dom_K_chnl_dom		0.473	KCNV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNV1	protein_coding	OTTHUMT00000385525.1	G	NM_014379	-		110980710	-1	no_errors	ENST00000297404	ensembl	human	known	74_37	missense	SNP	0.998	C
HEATR2	54919	genome.wustl.edu	37	7	825229	825229	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr7:825229G>A	ENST00000297440.6	+	13	2527	c.2507G>A	c.(2506-2508)cGc>cAc	p.R836H	HEATR2_ENST00000403952.3_Missense_Mutation_p.R261H|HEATR2_ENST00000313147.5_Intron	NM_017802.3	NP_060272.3	Q86Y56	HEAT2_HUMAN	HEAT repeat containing 2	836						cytoplasm (GO:0005737)				breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(3)|ovary(2)|prostate(4)|skin(1)	22		Ovarian(82;0.0112)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0182)|Epithelial(4;5.48e-17)|OV - Ovarian serous cystadenocarcinoma(56;1.95e-16)|all cancers(6;2.98e-14)		CACAAGCACCGCTCGGCCACC	0.607																																																	0								ENSG00000164818						72.0	69.0	70.0					7																	825229		2203	4300	6503	HEATR2	SO:0001583	missense	0			-	HGNC	AL832914, AK000404, NM_017802, AK056233	CCDS34580.1	7p22.3	2014-05-06	2006-05-19		ENSG00000164818	ENSG00000164818			26013	protein-coding gene	gene with protein product		614864				23040496	Standard	NM_017802		Approved	FLJ20397, FLJ31671, FLJ39381, FLJ25564, CILD18	uc010krz.1	Q86Y56	OTTHUMG00000151416	ENST00000297440.6:c.2507G>A	7.37:g.825229G>A	ENSP00000297440:p.Arg836His	Somatic	0	29	0.00		0.5963777675123697	118	10.61	14	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	64	9.72	Q69YL1|Q96FI9|Q9NX75	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_HEAT,superfamily_ARM-type_fold,pfscan_HEAT_type_2	p.R836H	ENST00000297440.6	37	c.2507	CCDS34580.1	7	.	.	.	.	.	.	.	.	.	.	G	24.0	4.487539	0.84854	.	.	ENSG00000164818	ENST00000297440;ENST00000537862;ENST00000403952	T;T	0.66460	0.27;-0.21	4.84	4.84	0.62591	.	0.000000	0.85682	D	0.000000	T	0.81692	0.4876	M	0.82056	2.57	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.79108	0.992;0.945;0.99	T	0.82741	-0.0307	10	0.44086	T	0.13	-45.2734	15.4112	0.74923	0.0:0.0:1.0:0.0	.	836;261;582	Q86Y56;E9PGY2;F5H8D4	HEAT2_HUMAN;.;.	H	836;582;261	ENSP00000297440:R836H;ENSP00000384884:R261H	ENSP00000297440:R836H	R	+	2	0	HEATR2	791755	1.000000	0.71417	0.988000	0.46212	0.621000	0.37620	3.835000	0.55805	2.233000	0.73108	0.462000	0.41574	CGC	-	NULL		0.607	HEATR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEATR2	protein_coding	OTTHUMT00000322542.1	G	NM_017802	-		825229	+1	no_errors	ENST00000297440	ensembl	human	known	74_37	missense	SNP	1.000	A
CABP1	9478	genome.wustl.edu	37	12	121093630	121093635	+	Intron	DEL	GTGCGT	GTGCGT	-	rs74906883|rs200201544|rs10588566|rs112935060	byFrequency	TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	GTGCGT	GTGCGT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr12:121093630_121093635delGTGCGT	ENST00000316803.3	+	2	788				CABP1_ENST00000351200.2_Intron|CABP1_ENST00000288616.3_Intron|CABP1_ENST00000453000.1_In_Frame_Del_p.AC7del	NM_001033677.1	NP_001028849.1	Q9NZU7	CABP1_HUMAN	calcium binding protein 1						negative regulation of catalytic activity (GO:0043086)|negative regulation of cell communication by electrical coupling (GO:0010651)|negative regulation of protein import into nucleus (GO:0042308)|negative regulation of voltage-gated calcium channel activity (GO:1901386)	cell junction (GO:0030054)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendrite (GO:0030425)|extracellular space (GO:0005615)|Golgi membrane (GO:0000139)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)	calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|enzyme inhibitor activity (GO:0004857)|nuclear localization sequence binding (GO:0008139)			central_nervous_system(1)|cervix(1)|large_intestine(1)|lung(6)	9	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					CAgtgcgtgcgtgcgtgtgtgtgtgt	0.539																																																	0								ENSG00000157782																																			CABP1	SO:0001627	intron_variant	0				HGNC	AF169148	CCDS9204.1, CCDS9205.1, CCDS31913.1	12q24.31	2013-01-10	2007-03-12		ENSG00000157782	ENSG00000157782		"""EF-hand domain containing"""	1384	protein-coding gene	gene with protein product	"""calbrain"", ""caldendrin"""	605563				9920909, 10625670	Standard	NM_004276		Approved		uc001tyu.3	Q9NZU7	OTTHUMG00000156794	ENST00000316803.3:c.655-4046GTGCGT>-	12.37:g.121093630_121093635delGTGCGT		Somatic	NA	NA	NA		0.5963777675123697	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	O95663|Q8N6H5|Q9NZU8	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_EF_hand_dom,smart_EF_hand_dom,pfscan_EF_hand_dom	p.AC7in_frame_del	ENST00000316803.3	37	c.17_22	CCDS31913.1	12																																																																																			-	NULL		0.539	CABP1-001	KNOWN	basic|CCDS	protein_coding	CABP1	protein_coding	OTTHUMT00000345822.1	GTGCGT	NM_001033677			121093635	+1	no_errors	ENST00000453000	ensembl	human	putative	74_37	in_frame_del	DEL	0.940:0.982:0.991:0.991:0.991:0.982	-
PIWIL1	9271	genome.wustl.edu	37	12	130833979	130833979	+	Silent	SNP	C	C	A			TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr12:130833979C>A	ENST00000245255.3	+	8	1202	c.930C>A	c.(928-930)acC>acA	p.T310T		NM_001190971.1|NM_004764.4	NP_001177900.1|NP_004755.2	Q96J94	PIWL1_HUMAN	piwi-like RNA-mediated gene silencing 1	310	PAZ. {ECO:0000255|PROSITE- ProRule:PRU00142}.				gene silencing by RNA (GO:0031047)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|regulation of translation (GO:0006417)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|mRNA cap binding complex (GO:0005845)|P granule (GO:0043186)|polysome (GO:0005844)	mRNA binding (GO:0003729)|piRNA binding (GO:0034584)|single-stranded RNA binding (GO:0003727)			breast(6)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(26)|ovary(2)|prostate(4)|skin(3)|urinary_tract(1)	57	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;3.02e-06)|Epithelial(86;3.85e-05)|all cancers(50;4.65e-05)		TTGTTCTTACCAAGTAAGACT	0.299																																																	0								ENSG00000125207						45.0	44.0	44.0					12																	130833979		2203	4300	6503	PIWIL1	SO:0001819	synonymous_variant	0			-	HGNC	AF104260	CCDS9268.1	12q24.33	2014-01-21	2013-02-15		ENSG00000125207	ENSG00000125207		"""Argonaute/PIWI family"""	9007	protein-coding gene	gene with protein product		605571	"""piwi (Drosophila)-like 1"", ""piwi-like 1 (Drosophila)"""			9851978, 12906857	Standard	NM_004764		Approved	PIWI, HIWI, CT80.1	uc001uik.3	Q96J94	OTTHUMG00000168382	ENST00000245255.3:c.930C>A	12.37:g.130833979C>A		Somatic	0	38	0.00		0.5963777675123697	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	27	12.90	A4F266|O95404|Q8NA60|Q8TBY5|Q96JD5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Piwi,pfam_PAZ_dom,pfam_GAGE,superfamily_RNaseH-like_dom,superfamily_PAZ_dom,smart_PAZ_dom,smart_Piwi,pfscan_PAZ_dom,pfscan_Piwi	p.T310	ENST00000245255.3	37	c.930	CCDS9268.1	12																																																																																			-	pfam_PAZ_dom,superfamily_PAZ_dom,smart_PAZ_dom,pfscan_PAZ_dom		0.299	PIWIL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIWIL1	protein_coding	OTTHUMT00000399510.1	C		-		130833979	+1	no_errors	ENST00000245255	ensembl	human	known	74_37	silent	SNP	1.000	A
SFT2D2	375035	genome.wustl.edu	37	1	168215839	168215839	+	3'UTR	SNP	C	C	T	rs553759120		TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr1:168215839C>T	ENST00000271375.4	+	0	4616				ANKRD36BP1_ENST00000358576.4_RNA	NM_199344.2	NP_955376.1			SFT2 domain containing 2											lung(3)|skin(1)	4	all_hematologic(923;0.215)					CTGTAAATGACGCAATTTATC	0.398																																																	0								ENSG00000214262																																			ANKRD36BP1	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AL035297	CCDS1271.1	1q24.2	2008-02-05			ENSG00000213064	ENSG00000213064			25140	protein-coding gene	gene with protein product							Standard	NM_199344		Approved	UNQ512, dJ747L4.C1.2	uc001gfi.4	O95562	OTTHUMG00000034650	ENST00000271375.4:c.*4061C>T	1.37:g.168215839C>T		Somatic	0	66	0.00		0.5963777675123697	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	53	17.19		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000271375.4	37	NULL	CCDS1271.1	1																																																																																			-	-		0.398	SFT2D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD36BP1	protein_coding	OTTHUMT00000083827.2	C	NM_199344	-		168215839	-1	no_errors	ENST00000358576	ensembl	human	known	74_37	rna	SNP	0.703	T
TAF1B	9014	genome.wustl.edu	37	2	10059732	10059732	+	Missense_Mutation	SNP	G	G	T	rs150986511	byFrequency	TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr2:10059732G>T	ENST00000263663.5	+	14	1536	c.1348G>T	c.(1348-1350)Gtg>Ttg	p.V450L	TAF1B_ENST00000396242.3_Missense_Mutation_p.V195L	NM_005680.2	NP_005671	Q53T94	TAF1B_HUMAN	TATA box binding protein (TBP)-associated factor, RNA polymerase I, B, 63kDa	450					gene expression (GO:0010467)|RNA polymerase I transcriptional preinitiation complex assembly at the promoter for the nuclear large rRNA transcript (GO:0001189)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|RNA polymerase I core factor complex (GO:0070860)	metal ion binding (GO:0046872)|RNA polymerase I CORE element sequence-specific DNA binding (GO:0001164)|RNA polymerase I CORE element sequence-specific DNA binding transcription factor recruiting transcription factor activity (GO:0001187)|sequence-specific DNA binding transcription factor activity (GO:0003700)|TBP-class protein binding (GO:0017025)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|lung(4)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	14	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					tccagaaATGGTGGTGAATCT	0.368																																																	0								ENSG00000115750						63.0	61.0	61.0					2																	10059732		2203	4300	6503	TAF1B	SO:0001583	missense	0			-	HGNC	L39061	CCDS33143.1	2p25	2008-06-02	2002-08-29		ENSG00000115750	ENSG00000115750			11533	protein-coding gene	gene with protein product		604904	"""TATA box binding protein (TBP)-associated factor, RNA polymerase I, B, 63kD"""			7801123	Standard	NM_005680		Approved	TAFI63, SL1, RAF1B, RAFI63	uc002qzz.3	Q53T94	OTTHUMG00000151673	ENST00000263663.5:c.1348G>T	2.37:g.10059732G>T	ENSP00000263663:p.Val450Leu	Somatic	0	58	0.00		0.5963777675123697	14	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52	B4DI42|F8WD72|Q15574|Q8WVC3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TF_Rrn7	p.V450L	ENST00000263663.5	37	c.1348	CCDS33143.1	2	.	.	.	.	.	.	.	.	.	.	G	15.32	2.798182	0.50208	.	.	ENSG00000115750	ENST00000263663;ENST00000396242	T;T	0.52295	0.67;0.67	5.32	4.42	0.53409	.	0.337981	0.32488	N	0.006037	T	0.42899	0.1223	M	0.62723	1.935	0.36738	D	0.882099	P;P	0.46512	0.807;0.879	B;B	0.41571	0.197;0.36	T	0.52064	-0.8625	9	.	.	.	-15.5423	8.4968	0.33132	0.0785:0.0:0.7676:0.1539	.	450;450	Q53T94;Q53T94-2	TAF1B_HUMAN;.	L	450;195	ENSP00000263663:V450L;ENSP00000379542:V195L	.	V	+	1	0	TAF1B	9977183	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	1.326000	0.33735	2.646000	0.89796	0.655000	0.94253	GTG	-	NULL		0.368	TAF1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF1B	protein_coding	OTTHUMT00000323426.2	G	NM_005680	-		10059732	+1	no_errors	ENST00000263663	ensembl	human	known	74_37	missense	SNP	1.000	T
CACNA1E	777	genome.wustl.edu	37	1	181680102	181680103	+	Frame_Shift_Del	DEL	AG	AG	-	rs147596634		TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	AG	AG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr1:181680102_181680103delAG	ENST00000367573.2	+	8	1068_1069	c.1068_1069delAG	c.(1066-1071)aaagagfs	p.E357fs	CACNA1E_ENST00000357570.5_Frame_Shift_Del_p.E308fs|CACNA1E_ENST00000358338.5_Frame_Shift_Del_p.E308fs|CACNA1E_ENST00000526775.1_Frame_Shift_Del_p.E357fs|CACNA1E_ENST00000367567.4_5'UTR|CACNA1E_ENST00000367570.1_Frame_Shift_Del_p.E357fs|CACNA1E_ENST00000360108.3_Frame_Shift_Del_p.E357fs	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	357					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						AATTTGCCAAAGAGAGAGAGAG	0.51																																																	0								ENSG00000198216		,,	161,3503		41,79,1712					,,	5.3	1.0		dbSNP_134	61	297,7585		52,193,3696	yes	frameshift,frameshift,frameshift	CACNA1E	NM_001205294.1,NM_001205293.1,NM_000721.3	,,	93,272,5408	A1A1,A1R,RR		3.7681,4.3941,3.9667	,,	,,		458,11088				CACNA1E	SO:0001589	frameshift_variant	0				HGNC	AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.1068_1069delAG	1.37:g.181680112_181680113delAG	ENSP00000356545:p.Glu357fs	Somatic	0	39	0.00		0.5963777675123697	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	23	20.69	B1AM12|B1AM13|B1AM14|Q14580|Q14581	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,pfscan_EF_hand_dom,prints_VDCCAlpha1,prints_VDCC_R_a1su	p.R360fs	ENST00000367573.2	37	c.1068_1069	CCDS55664.1	1																																																																																			-	prints_VDCCAlpha1		0.510	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	CACNA1E	protein_coding	OTTHUMT00000090793.2	AG	NM_000721			181680103	+1	no_errors	ENST00000367573	ensembl	human	known	74_37	frame_shift_del	DEL	1.000:1.000	-
B4GALNT3	283358	genome.wustl.edu	37	12	665772	665772	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr12:665772G>A	ENST00000266383.5	+	15	2133	c.2120G>A	c.(2119-2121)gGt>gAt	p.G707D		NM_173593.3	NP_775864.3	Q6L9W6	B4GN3_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 3	707					metabolic process (GO:0008152)	Golgi cisterna membrane (GO:0032580)|integral component of membrane (GO:0016021)	acetylgalactosaminyltransferase activity (GO:0008376)|N-acetyl-beta-glucosaminyl-glycoprotein 4-beta-N-acetylgalactosaminyltransferase activity (GO:0033842)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(1)|lung(10)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26	all_cancers(10;0.0158)|all_epithelial(11;0.0274)|Ovarian(42;0.0512)|all_lung(10;0.154)|Lung NSC(10;0.215)		OV - Ovarian serous cystadenocarcinoma(31;0.00018)|BRCA - Breast invasive adenocarcinoma(9;0.0262)			CTACGTGGGGGTCGCTACCTC	0.587																																																	0								ENSG00000139044						76.0	75.0	76.0					12																	665772		2203	4300	6503	B4GALNT3	SO:0001583	missense	0			-	HGNC	AB089940	CCDS8504.1	12p13.33	2013-02-19			ENSG00000139044	ENSG00000139044	2.4.1.-	"""Beta 4-glycosyltransferases"""	24137	protein-coding gene	gene with protein product		612220				12966086	Standard	NM_173593		Approved	B4GalNac-T3, FLJ16224, FLJ40362	uc001qii.1	Q6L9W6	OTTHUMG00000129283	ENST00000266383.5:c.2120G>A	12.37:g.665772G>A	ENSP00000266383:p.Gly707Asp	Somatic	0	94	0.00		0.5963777675123697	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	54	21.74	Q6ZNC1|Q8N7T6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PA14,pfam_Chond_GalNAc,smart_PA14	p.G707D	ENST00000266383.5	37	c.2120	CCDS8504.1	12	.	.	.	.	.	.	.	.	.	.	G	15.88	2.963220	0.53507	.	.	ENSG00000139044	ENST00000266383	T	0.15017	2.46	5.76	3.9	0.45041	.	0.176829	0.64402	D	0.000012	T	0.23611	0.0571	L	0.28274	0.84	0.39102	D	0.961305	P	0.46578	0.88	P	0.58660	0.843	T	0.02588	-1.1137	10	0.52906	T	0.07	-19.052	11.0079	0.47646	0.0704:0.1302:0.7994:0.0	.	707	Q6L9W6	B4GN3_HUMAN	D	707	ENSP00000266383:G707D	ENSP00000266383:G707D	G	+	2	0	B4GALNT3	536033	1.000000	0.71417	0.508000	0.27688	0.952000	0.60782	5.956000	0.70315	0.747000	0.32809	0.655000	0.94253	GGT	-	pfam_Chond_GalNAc		0.587	B4GALNT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	B4GALNT3	protein_coding	OTTHUMT00000251406.2	G	NM_173593	-		665772	+1	no_errors	ENST00000266383	ensembl	human	known	74_37	missense	SNP	0.894	A
MACF1	23499	genome.wustl.edu	37	1	39823522	39823522	+	Missense_Mutation	SNP	A	A	T			TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr1:39823522A>T	ENST00000372915.3	+	44	12002	c.11915A>T	c.(11914-11916)aAg>aTg	p.K3972M	MACF1_ENST00000564288.1_Missense_Mutation_p.K3967M|MACF1_ENST00000361689.2_Missense_Mutation_p.K1905M|MACF1_ENST00000567887.1_Missense_Mutation_p.K4004M|MACF1_ENST00000539005.1_Missense_Mutation_p.K1905M|MACF1_ENST00000289893.4_Missense_Mutation_p.K2407M|MACF1_ENST00000317713.7_Missense_Mutation_p.K1905M|MACF1_ENST00000545844.1_Missense_Mutation_p.K1905M|MACF1_ENST00000476350.1_3'UTR			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	3972					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			GTAAAGGACAAGTTGAAGGAT	0.423																																																	0								ENSG00000127603						71.0	66.0	68.0					1																	39823522		2203	4300	6503	MACF1	SO:0001583	missense	0			-	HGNC	AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.11915A>T	1.37:g.39823522A>T	ENSP00000362006:p.Lys3972Met	Somatic	0	56	0.00		0.5963777675123697	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	46	17.86	B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Spectrin_repeat,pfam_CH-domain,pfam_GAS2_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_GAS2_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_EF_hand_dom,smart_GAS2_dom,pfscan_CH-domain,pfscan_EF_hand_dom	p.K1905M	ENST00000372915.3	37	c.5714		1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	18.41|18.41	3.618053|3.618053	0.66787|0.66787	.|.	.|.	ENSG00000127603|ENSG00000127603	ENST00000545844;ENST00000372915;ENST00000361689;ENST00000317713;ENST00000539005;ENST00000289893|ENST00000372925	T;T;T;T;T;T|.	0.37584|.	1.19;1.19;1.19;1.19;1.19;1.19|.	6.07|6.07	3.8|3.8	0.43715|0.43715	.|.	0.085397|.	0.50627|.	D|.	0.000117|.	T|T	0.65196|0.65196	0.2668|0.2668	M|M	0.71036|0.71036	2.16|2.16	0.80722|0.80722	D|D	1|1	D;D;D;D|.	0.89917|.	1.0;1.0;0.998;0.998|.	D;D;D;D|.	0.76071|.	0.984;0.987;0.967;0.959|.	T|T	0.63976|0.63976	-0.6515|-0.6515	10|5	0.87932|.	D|.	0|.	.|.	9.8706|9.8706	0.41170|0.41170	0.8641:0.0:0.1359:0.0|0.8641:0.0:0.1359:0.0	.|.	3972;1905;1905;1870|.	Q9UPN3;F8W8Q1;Q9UPN3-2;Q9UPN3-3|.	MACF1_HUMAN;.;.;.|.	M|H	1905;3972;1905;1905;1905;2407|1038	ENSP00000439537:K1905M;ENSP00000362006:K3972M;ENSP00000354573:K1905M;ENSP00000313438:K1905M;ENSP00000444364:K1905M;ENSP00000289893:K2407M|.	ENSP00000289893:K2407M|.	K|Q	+|+	2|3	0|2	MACF1|MACF1	39596109|39596109	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.981000|0.981000	0.71138|0.71138	3.359000|3.359000	0.52292|0.52292	1.128000|1.128000	0.42052|0.42052	0.533000|0.533000	0.62120|0.62120	AAG|CAA	-	smart_Spectrin/alpha-actinin		0.423	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	MACF1	protein_coding	OTTHUMT00000392096.1	A	NM_033044	-		39823522	+1	no_errors	ENST00000317713	ensembl	human	known	74_37	missense	SNP	0.999	T
DNAJC17	55192	genome.wustl.edu	37	15	41066591	41066591	+	Missense_Mutation	SNP	C	C	A			TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr15:41066591C>A	ENST00000220496.4	-	9	674	c.644G>T	c.(643-645)gGc>gTc	p.G215V		NM_018163.2	NP_060633.1	Q9NVM6	DJC17_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 17	215	RRM.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)		nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(1)|kidney(1)|large_intestine(2)|pancreas(1)|skin(1)	6		all_cancers(109;4.16e-14)|all_epithelial(112;9.68e-12)|Lung NSC(122;3.19e-09)|all_lung(180;6.45e-08)|Melanoma(134;0.091)|Colorectal(260;0.175)|Ovarian(310;0.243)		GBM - Glioblastoma multiforme(113;2.91e-05)|COAD - Colon adenocarcinoma(120;0.153)|BRCA - Breast invasive adenocarcinoma(123;0.166)		CACAGCAGTGCCTGGCTTCTT	0.577																																																	0								ENSG00000104129						141.0	133.0	136.0					15																	41066591		2203	4300	6503	DNAJC17	SO:0001583	missense	0			-	HGNC	AK001496	CCDS10065.1	15q15.1	2014-02-12			ENSG00000104129	ENSG00000104129		"""Heat shock proteins / DNAJ (HSP40)"", ""RNA binding motif (RRM) containing"""	25556	protein-coding gene	gene with protein product						12477932	Standard	NM_018163		Approved	FLJ10634	uc001zms.2	Q9NVM6	OTTHUMG00000130065	ENST00000220496.4:c.644G>T	15.37:g.41066591C>A	ENSP00000220496:p.Gly215Val	Somatic	0	34	0.00		0.5963777675123697	110	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DnaJ_domain,pfam_RRM_dom,superfamily_DnaJ_domain,smart_DnaJ_domain,pfscan_DnaJ_domain,prints_DnaJ_domain	p.G215V	ENST00000220496.4	37	c.644	CCDS10065.1	15	.	.	.	.	.	.	.	.	.	.	C	22.2	4.253698	0.80135	.	.	ENSG00000104129	ENST00000220496	T	0.20463	2.07	5.17	5.17	0.71159	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (1);	0.101427	0.64402	D	0.000002	T	0.56093	0.1962	M	0.91663	3.23	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.65833	-0.6072	10	0.87932	D	0	.	16.6094	0.84858	0.0:1.0:0.0:0.0	.	215	Q9NVM6	DJC17_HUMAN	V	215	ENSP00000220496:G215V	ENSP00000220496:G215V	G	-	2	0	DNAJC17	38853883	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	6.251000	0.72441	2.700000	0.92200	0.561000	0.74099	GGC	-	pfam_RRM_dom		0.577	DNAJC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC17	protein_coding	OTTHUMT00000252356.2	C	NM_018163	-		41066591	-1	no_errors	ENST00000220496	ensembl	human	known	74_37	missense	SNP	1.000	A
COMP	1311	genome.wustl.edu	37	19	18898454	18898454	+	Missense_Mutation	SNP	G	G	T			TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr19:18898454G>T	ENST00000222271.2	-	10	1025	c.981C>A	c.(979-981)aaC>aaA	p.N327K	COMP_ENST00000542601.2_Missense_Mutation_p.N294K|COMP_ENST00000425807.1_Missense_Mutation_p.N274K	NM_000095.2	NP_000086.2	P49747	COMP_HUMAN	cartilage oligomeric matrix protein	327					apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|limb development (GO:0060173)|negative regulation of apoptotic process (GO:0043066)|organ morphogenesis (GO:0009887)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)|heparan sulfate proteoglycan binding (GO:0043395)|heparin binding (GO:0008201)|protease binding (GO:0002020)			breast(6)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	32						CCAGCGGGCAGTTGTCCTGGA	0.597																																																	0								ENSG00000105664						117.0	100.0	106.0					19																	18898454		2203	4300	6503	COMP	SO:0001583	missense	0			-	HGNC	L32137	CCDS12385.1	19p13.1	2008-02-05				ENSG00000105664			2227	protein-coding gene	gene with protein product	"""thrombospondin-5"""	600310	"""cartilage oligomeric matrix protein (pseudoachondroplasia, epiphyseal dysplasia 1, multiple)"""	PSACH, EDM1, EPD1		7713493, 8307576	Standard	NM_000095		Approved	MED, THBS5	uc002nke.3	P49747	OTTHUMG00000169318	ENST00000222271.2:c.981C>A	19.37:g.18898454G>T	ENSP00000222271:p.Asn327Lys	Somatic	0	29	0.00		0.5963777675123697	37	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	9.76	B4DKJ3|O14592|Q16388|Q16389|Q2NL86|Q8N4T2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Thrombospondin_C,pfam_EGF-like_Ca-bd_dom,pfam_Thbs/COMP_coiled-coil,pfam_Thrombospondin_3-like_rpt,superfamily_ConA-like_lec_gl_sf,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom	p.N327K	ENST00000222271.2	37	c.981	CCDS12385.1	19	.	.	.	.	.	.	.	.	.	.	G	17.52	3.409746	0.62399	.	.	ENSG00000105664	ENST00000542601;ENST00000222271;ENST00000425807;ENST00000454701	D;D;D	0.99409	-5.85;-5.85;-5.85	3.33	1.14	0.20703	.	0.000000	0.85682	U	0.000000	D	0.99518	0.9828	H	0.95504	3.68	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.74674	0.984;0.96	D	0.99632	1.0986	10	0.87932	D	0	-43.7709	7.4557	0.27266	0.2244:0.0:0.7756:0.0	.	274;327	B4DKJ3;P49747	.;COMP_HUMAN	K	294;327;274;314	ENSP00000439156:N294K;ENSP00000222271:N327K;ENSP00000403792:N274K	ENSP00000222271:N327K	N	-	3	2	COMP	18759454	1.000000	0.71417	0.998000	0.56505	0.858000	0.48976	2.692000	0.47018	0.239000	0.21243	0.313000	0.20887	AAC	-	pfam_Thrombospondin_3-like_rpt		0.597	COMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COMP	protein_coding	OTTHUMT00000403457.1	G	NM_000095	-		18898454	-1	no_errors	ENST00000222271	ensembl	human	known	74_37	missense	SNP	1.000	T
DMRT1	1761	genome.wustl.edu	37	9	916825	916825	+	Silent	SNP	G	G	A			TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr9:916825G>A	ENST00000382276.3	+	4	1034	c.885G>A	c.(883-885)ccG>ccA	p.P295P	DMRT1_ENST00000569227.1_Silent_p.P137P	NM_021951.2	NP_068770.2	Q9Y5R6	DMRT1_HUMAN	doublesex and mab-3 related transcription factor 1	295			P -> L. {ECO:0000269|PubMed:10332030}.		cell morphogenesis (GO:0000902)|germ cell migration (GO:0008354)|intracellular signal transduction (GO:0035556)|male germ cell proliferation (GO:0002176)|male sex determination (GO:0030238)|male sex differentiation (GO:0046661)|negative regulation of meiosis (GO:0045835)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|oocyte development (GO:0048599)|positive regulation of male gonad development (GO:2000020)|positive regulation of meiosis I (GO:0060903)|positive regulation of mitosis (GO:0045840)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of nodal signaling pathway (GO:1900107)|Sertoli cell development (GO:0060009)|Sertoli cell differentiation (GO:0060008)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(2)|lung(10)|ovary(1)	13		all_lung(10;2.66e-10)|Lung NSC(10;2.82e-10)|Breast(48;0.232)		Lung(218;0.037)		CTTACTACCCGCCTCCCTCTT	0.512																																																	0								ENSG00000137090						140.0	119.0	126.0					9																	916825		2203	4300	6503	DMRT1	SO:0001819	synonymous_variant	0			-	HGNC	AF130728	CCDS6442.1	9p24.3	2014-01-21			ENSG00000137090	ENSG00000137090			2934	protein-coding gene	gene with protein product	"""DM domain expressed in testis 1"""	602424				9490411, 10332030	Standard	XM_006716732		Approved	DMT1, CT154	uc003zgv.3	Q9Y5R6	OTTHUMG00000019435	ENST00000382276.3:c.885G>A	9.37:g.916825G>A		Somatic	0	51	0.00		0.5963777675123697	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	73	14.12	B2R913|Q6T1H8|Q6T1H9|Q8IW77	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_DM_DNA-bd,pfam_DMRT1-like,superfamily_DM_DNA-bd,smart_DM_DNA-bd,pfscan_DM_DNA-bd	p.P295	ENST00000382276.3	37	c.885	CCDS6442.1	9																																																																																			-	NULL		0.512	DMRT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMRT1	protein_coding	OTTHUMT00000051489.2	G	NM_021951	-		916825	+1	no_errors	ENST00000382276	ensembl	human	known	74_37	silent	SNP	0.365	A
CSMD2	114784	genome.wustl.edu	37	1	34312507	34312507	+	Silent	SNP	G	G	A	rs143306375		TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr1:34312507G>A	ENST00000373381.4	-	6	1187	c.1011C>T	c.(1009-1011)cgC>cgT	p.R337R		NM_001281956.1|NM_052896.3	NP_001268885.1|NP_443128.2	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	297						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.R297R(2)		NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				CACTGAATCCGCGCTGCCGGT	0.607																																																	2	Substitution - coding silent(2)	lung(2)						ENSG00000121904	G		0,4406		0,0,2203	70.0	64.0	66.0		891	-9.6	0.3	1	dbSNP_134	66	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	CSMD2	NM_052896.3		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		297/3488	34312507	1,13005	2203	4300	6503	CSMD2	SO:0001819	synonymous_variant	0			-	HGNC	AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373381.4:c.1011C>T	1.37:g.34312507G>A		Somatic	0	36	0.00		0.5963777675123697	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	27	20.59	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_CUB_dom,pfam_Sushi_SCR_CCP,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.R337	ENST00000373381.4	37	c.1011		1																																																																																			-	pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom		0.607	CSMD2-201	KNOWN	basic|appris_principal	protein_coding	CSMD2	protein_coding		G	NM_052896	rs143306375		34312507	-1	no_errors	ENST00000373381	ensembl	human	known	74_37	silent	SNP	0.212	A
SOHLH2	54937	genome.wustl.edu	37	13	36765961	36765961	+	Silent	SNP	C	C	T			TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr13:36765961C>T	ENST00000379881.3	-	5	589	c.501G>A	c.(499-501)ctG>ctA	p.L167L	CCDC169-SOHLH2_ENST00000511166.1_Silent_p.L244L|SOHLH2_ENST00000554962.1_Silent_p.L244L|SOHLH2_ENST00000317764.6_Silent_p.L167L	NM_017826.2	NP_060296.2	Q9NX45	SOLH2_HUMAN	spermatogenesis and oogenesis specific basic helix-loop-helix 2	167					multicellular organismal development (GO:0007275)|oogenesis (GO:0048477)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(13)|lung(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.184)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;4.63e-08)|Epithelial(112;2.67e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00272)|BRCA - Breast invasive adenocarcinoma(63;0.00685)|GBM - Glioblastoma multiforme(144;0.0273)		GAAAATATCCCAGGTGTTCGC	0.378																																																	0								ENSG00000250709						116.0	121.0	119.0					13																	36765961		2203	4300	6503	CCDC169-SOHLH2	SO:0001819	synonymous_variant	0			-	HGNC	AK000456	CCDS9355.1, CCDS61309.1	13q13.3	2013-05-21			ENSG00000120669	ENSG00000120669		"""Basic helix-loop-helix proteins"""	26026	protein-coding gene	gene with protein product	"""spermatogenesis associated 28"""					12477932	Standard	NM_017826		Approved	FLJ20449, TEB1, bHLHe81, SPATA28		Q9NX45	OTTHUMG00000016728	ENST00000379881.3:c.501G>A	13.37:g.36765961C>T		Somatic	0	81	0.00		0.5963777675123697	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	67	14.10	B4DX90|Q5EGC3|Q8TC74|Q96QX4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.L244	ENST00000379881.3	37	c.732	CCDS9355.1	13																																																																																			-	NULL		0.378	SOHLH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC169-SOHLH2	protein_coding	OTTHUMT00000044477.2	C	NM_017826	-		36765961	-1	no_errors	ENST00000511166	ensembl	human	known	74_37	silent	SNP	0.000	T
ARID2	196528	genome.wustl.edu	37	12	46246549	46246549	+	Missense_Mutation	SNP	G	G	T			TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr12:46246549G>T	ENST00000334344.6	+	15	4815	c.4643G>T	c.(4642-4644)gGc>gTc	p.G1548V	ARID2_ENST00000457135.1_Missense_Mutation_p.G156V|ARID2_ENST00000479608.1_3'UTR|ARID2_ENST00000422737.1_Missense_Mutation_p.G1399V|ARID2_ENST00000444670.1_Missense_Mutation_p.G1158V	NM_152641.2	NP_689854.2	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)	1548					chromatin modification (GO:0016568)|nucleosome disassembly (GO:0006337)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|liver(20)|lung(34)|ovary(7)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	116	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		AACAATGCTGGCTGCAGCGCA	0.463			"""N, S, F"""		hepatocellular carcinoma																																			Rec	yes		12	12q12	196528	AT rich interactive domain 2		E	0								ENSG00000189079						70.0	63.0	65.0					12																	46246549		2203	4300	6503	ARID2	SO:0001583	missense	0			-	HGNC		CCDS31783.1	12q13.11	2013-02-07			ENSG00000189079	ENSG00000189079		"""-"""	18037	protein-coding gene	gene with protein product		609539					Standard	NM_152641		Approved	KIAA1557, DKFZp686G052, FLJ30619, BAF200	uc001ros.1	Q68CP9	OTTHUMG00000150487	ENST00000334344.6:c.4643G>T	12.37:g.46246549G>T	ENSP00000335044:p.Gly1548Val	Somatic	0	26	0.00		0.5963777675123697	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	34	10.53	Q15KG9|Q5EB51|Q645I3|Q6ZRY5|Q7Z3I5|Q86T28|Q96SJ6|Q9HCL5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ARID/BRIGHT_DNA-bd,pfam_DNA-bd_RFX,superfamily_ARID/BRIGHT_DNA-bd,superfamily_ARM-type_fold,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	p.G1548V	ENST00000334344.6	37	c.4643	CCDS31783.1	12	.	.	.	.	.	.	.	.	.	.	G	14.85	2.657425	0.47467	.	.	ENSG00000189079	ENST00000334344;ENST00000549153;ENST00000338636;ENST00000422737;ENST00000444670;ENST00000457135	T;T	0.48201	0.82;1.59	6.02	5.13	0.70059	.	0.000000	0.85682	D	0.000000	T	0.49406	0.1555	L	0.32530	0.975	0.80722	D	1	P;P;P	0.52577	0.934;0.934;0.954	P;P;B	0.51016	0.656;0.532;0.255	T	0.45145	-0.9281	10	0.36615	T	0.2	-0.4907	17.4487	0.87586	0.0:0.1242:0.8758:0.0	.	1548;1158;1548	Q68CP9-3;F8W108;Q68CP9	.;.;ARID2_HUMAN	V	1548;665;665;1399;1158;156	ENSP00000335044:G1548V;ENSP00000388357:G156V	ENSP00000335044:G1548V	G	+	2	0	ARID2	44532816	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.434000	0.97515	1.550000	0.49438	0.655000	0.94253	GGC	-	NULL		0.463	ARID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARID2	protein_coding	OTTHUMT00000318380.2	G	XM_350875	-		46246549	+1	no_errors	ENST00000334344	ensembl	human	known	74_37	missense	SNP	1.000	T
TMLHE	55217	genome.wustl.edu	37	X	154736707	154736707	+	Missense_Mutation	SNP	G	G	C			TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chrX:154736707G>C	ENST00000334398.3	-	6	992	c.847C>G	c.(847-849)Caa>Gaa	p.Q283E	TMLHE_ENST00000369439.4_Missense_Mutation_p.Q283E|TMLHE-AS1_ENST00000452506.1_RNA	NM_018196.3	NP_060666.1	Q9NVH6	TMLH_HUMAN	trimethyllysine hydroxylase, epsilon	283					carnitine biosynthetic process (GO:0045329)|cellular nitrogen compound metabolic process (GO:0034641)|negative regulation of oxidoreductase activity (GO:0051354)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)|trimethyllysine dioxygenase activity (GO:0050353)			breast(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	20	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Succinic acid(DB00139)|Vitamin C(DB00126)	GGTGCCTTTTGAAGTACCTGT	0.408																																																	0								ENSG00000185973						128.0	121.0	123.0					X																	154736707		2203	4300	6503	TMLHE	SO:0001583	missense	0			-	HGNC	AF373407, X97513	CCDS14768.1, CCDS55547.1	Xq28	2006-07-14			ENSG00000185973	ENSG00000185973			18308	protein-coding gene	gene with protein product	"""butyrobetaine (gamma), 2-oxoglutarate dioxygenase (gamma-butyrobetaine hydroxylase) 2"""	300777				8908511, 11431483	Standard	NM_018196		Approved	TMLH, FLJ10727, BBOX2, XAP130	uc004fnn.3	Q9NVH6	OTTHUMG00000022674	ENST00000334398.3:c.847C>G	X.37:g.154736707G>C	ENSP00000335261:p.Gln283Glu	Somatic	0	37	0.00		0.5963777675123697	14	53.33	16	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	30	41.18	A8K6M9|B4E3R3|Q5TZB5|Q6IA90|Q8TBT0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Taurine_dOase,pfam_DUF971,tigrfam_Trimethyllysine_dOase	p.Q283E	ENST00000334398.3	37	c.847	CCDS14768.1	X	.	.	.	.	.	.	.	.	.	.	G	5.464	0.270626	0.10349	.	.	ENSG00000185973	ENST00000334398;ENST00000369439	D;T	0.81659	-1.52;-0.91	4.42	4.42	0.53409	.	0.249192	0.41194	D	0.000931	T	0.61640	0.2363	N	0.12853	0.265	0.35597	D	0.807523	B;B;B	0.16603	0.018;0.015;0.012	B;B;B	0.17722	0.019;0.017;0.019	T	0.60151	-0.7319	10	0.02654	T	1	-13.3302	13.9524	0.64126	0.0:0.0:1.0:0.0	.	283;283;283	Q9NVH6-2;A8K6M9;Q9NVH6	.;.;TMLH_HUMAN	E	283	ENSP00000335261:Q283E;ENSP00000358447:Q283E	ENSP00000335261:Q283E	Q	-	1	0	TMLHE	154389901	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	3.509000	0.53386	1.951000	0.56629	0.494000	0.49563	CAA	-	pfam_Taurine_dOase,tigrfam_Trimethyllysine_dOase		0.408	TMLHE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMLHE	protein_coding	OTTHUMT00000058817.1	G	NM_018196	-		154736707	-1	no_errors	ENST00000334398	ensembl	human	known	74_37	missense	SNP	0.996	C
DLG4	1742	genome.wustl.edu	37	17	7094060	7094060	+	Silent	SNP	G	G	A			TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr17:7094060G>A	ENST00000399506.2	-	20	2333	c.2142C>T	c.(2140-2142)ccC>ccT	p.P714P	DLG4_ENST00000302955.6_Silent_p.P711P|DLG4_ENST00000399510.2_Silent_p.P757P			P78352	DLG4_HUMAN	discs, large homolog 4 (Drosophila)	714					alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|axon guidance (GO:0007411)|dendritic spine morphogenesis (GO:0060997)|establishment of protein localization (GO:0045184)|learning (GO:0007612)|locomotory exploration behavior (GO:0035641)|negative regulation of receptor internalization (GO:0002091)|nervous system development (GO:0007399)|neuromuscular process controlling balance (GO:0050885)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synaptic transmission (GO:0050806)|protein complex assembly (GO:0006461)|protein localization to synapse (GO:0035418)|receptor localization to synapse (GO:0097120)|regulation of grooming behavior (GO:2000821)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|signal transduction (GO:0007165)|social behavior (GO:0035176)|synaptic transmission (GO:0007268)|synaptic vesicle maturation (GO:0016188)|vocalization behavior (GO:0071625)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|cerebellar mossy fiber (GO:0044300)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|dendrite cytoplasm (GO:0032839)|dendritic spine (GO:0043197)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|excitatory synapse (GO:0060076)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|juxtaparanode region of axon (GO:0044224)|neuron projection terminus (GO:0044306)|neuron spine (GO:0044309)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)|synaptic vesicle (GO:0008021)	acetylcholine receptor binding (GO:0033130)|beta-1 adrenergic receptor binding (GO:0031697)|D1 dopamine receptor binding (GO:0031748)|ionotropic glutamate receptor binding (GO:0035255)|P2Y1 nucleotide receptor binding (GO:0031812)|PDZ domain binding (GO:0030165)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|protein phosphatase binding (GO:0019903)|scaffold protein binding (GO:0097110)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)	18					Guanidine(DB00536)	CCCAGATGTAGGGGCCTGAGA	0.602																																																	0								ENSG00000132535						87.0	92.0	90.0					17																	7094060		2072	4201	6273	DLG4	SO:0001819	synonymous_variant	0			-	HGNC	U83192	CCDS45599.1, CCDS45600.1	17p13.1	2008-12-15	2001-12-04		ENSG00000132535	ENSG00000132535			2903	protein-coding gene	gene with protein product		602887				9286702	Standard	NM_001128827		Approved	PSD-95, PSD95, SAP90, SAP-90	uc010cly.3	P78352	OTTHUMG00000134327	ENST00000399506.2:c.2142C>T	17.37:g.7094060G>A		Somatic	0	72	0.00		0.5963777675123697	42	47.50	38	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	56	30.86	B7Z1S1|G5E939|Q92941|Q9UKK8	Silent	SNP	NA	NA	NA	NA	NA	NA	pirsf_M-assoc_guanylate_kinase,pfam_GK/Ca_channel_bsu,pfam_PDZ,pfam_PDZ_assoc,pfam_MAGUK_PEST_N,pfam_SH3_domain,pfam_SH3_2,pfam_L27_1,superfamily_P-loop_NTPase,superfamily_SH3_domain,superfamily_PDZ,smart_PDZ,smart_SH3_domain,smart_GK/Ca_channel_bsu,pfscan_PDZ,pfscan_SH3_domain,pfscan_Guanylate_kin-like	p.P757	ENST00000399506.2	37	c.2271		17																																																																																			-	pirsf_M-assoc_guanylate_kinase,superfamily_P-loop_NTPase		0.602	DLG4-002	KNOWN	non_canonical_TEC|not_organism_supported|basic|appris_candidate_longest	protein_coding	DLG4	protein_coding	OTTHUMT00000259419.2	G	NM_001365	-		7094060	-1	no_errors	ENST00000399510	ensembl	human	known	74_37	silent	SNP	1.000	A
KNTC1	9735	genome.wustl.edu	37	12	123036012	123036012	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr12:123036012G>A	ENST00000333479.7	+	15	1315	c.1138G>A	c.(1138-1140)Gaa>Aaa	p.E380K	KNTC1_ENST00000450485.2_Missense_Mutation_p.E343K	NM_014708.4	NP_055523.1	P50748	KNTC1_HUMAN	kinetochore associated 1	380					mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|protein complex assembly (GO:0006461)|regulation of exit from mitosis (GO:0007096)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle pole (GO:0000922)				breast(1)|central_nervous_system(1)|cervix(2)|endometrium(12)|kidney(8)|large_intestine(12)|lung(20)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	72	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)		TAGATTGTCTGAAGACTCAGT	0.299																																																	0								ENSG00000184445						68.0	65.0	66.0					12																	123036012		1795	4049	5844	KNTC1	SO:0001583	missense	0			-	HGNC		CCDS45002.1	12q24.31	2013-01-17			ENSG00000184445	ENSG00000184445			17255	protein-coding gene	gene with protein product	"""rough deal homolog (Drosophila)"""	607363				11146660, 11590237	Standard	NM_014708		Approved	KIAA0166, ROD	uc001ucv.3	P50748	OTTHUMG00000168861	ENST00000333479.7:c.1138G>A	12.37:g.123036012G>A	ENSP00000328236:p.Glu380Lys	Somatic	0	73	0.00		0.5963777675123697	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	58	22.67	A7E2C4|B3KSG2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RZZ-complex_KNTC1/ROD_C,superfamily_Quino_amine_DH_bsu,superfamily_WD40_repeat_dom,superfamily_PAH	p.E380K	ENST00000333479.7	37	c.1138	CCDS45002.1	12	.	.	.	.	.	.	.	.	.	.	G	16.76	3.213619	0.58452	.	.	ENSG00000184445	ENST00000450485;ENST00000333479	T;T	0.26373	1.74;2.28	5.55	5.55	0.83447	.	0.057695	0.64402	D	0.000001	T	0.43144	0.1234	L	0.59436	1.845	0.80722	D	1	D;P	0.60575	0.988;0.844	P;B	0.54759	0.76;0.386	T	0.18871	-1.0323	10	0.51188	T	0.08	-25.262	19.4917	0.95052	0.0:0.0:1.0:0.0	.	343;380	E7ES84;P50748	.;KNTC1_HUMAN	K	343;380	ENSP00000397992:E343K;ENSP00000328236:E380K	ENSP00000328236:E380K	E	+	1	0	KNTC1	121601965	1.000000	0.71417	0.993000	0.49108	0.363000	0.29612	4.103000	0.57783	2.608000	0.88229	0.478000	0.44815	GAA	-	NULL		0.299	KNTC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KNTC1	protein_coding	OTTHUMT00000396110.2	G		-		123036012	+1	no_errors	ENST00000333479	ensembl	human	known	74_37	missense	SNP	1.000	A
JAKMIP3	282973	genome.wustl.edu	37	10	133963537	133963537	+	Missense_Mutation	SNP	G	G	A	rs199769239	byFrequency	TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr10:133963537G>A	ENST00000298622.4	+	15	2137	c.1999G>A	c.(1999-2001)Gcc>Acc	p.A667T	JAKMIP3_ENST00000477275.1_3'UTR	NM_001105521.2	NP_001098991.1	Q5VZ66	JKIP3_HUMAN	Janus kinase and microtubule interacting protein 3	667						Golgi apparatus (GO:0005794)				breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(10)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	31		all_cancers(35;5.63e-09)|all_epithelial(44;9.25e-07)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|Colorectal(31;0.0721)|all_neural(114;0.0726)|Breast(234;0.0949)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;0.000104)|Epithelial(32;0.000142)|all cancers(32;0.000185)|BRCA - Breast invasive adenocarcinoma(275;0.224)		GGGCGATAACGCCGTAAGTGT	0.622													G|||	5	0.000998403	0.0	0.0	5008	,	,		11670	0.001		0.0	False		,,,				2504	0.0041																0								ENSG00000188385						147.0	94.0	112.0					10																	133963537		2184	4285	6469	JAKMIP3	SO:0001583	missense	0			GMAF=0.0005	HGNC	AL832756	CCDS44494.1	10q26.3	2009-04-23	2009-04-23	2008-01-28	ENSG00000188385	ENSG00000188385			23523	protein-coding gene	gene with protein product	"""neuroendocrine long coiled-coil 2"""	611198	"""chromosome 10 open reading frame 39"", ""chromosome 10 open reading frame 14"""	C10orf39, C10orf14		15277531, 17572408	Standard	NM_001105521		Approved	FLJ37857, NECC2, KIAA4091, bA140A10.5	uc001lkx.4	Q5VZ66	OTTHUMG00000150167	ENST00000298622.4:c.1999G>A	10.37:g.133963537G>A	ENSP00000298622:p.Ala667Thr	Somatic	0	20	0.00		0.5963777675123697	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	22	24.14	A6PW00|Q69YM6|Q6ZT29	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.A667T	ENST00000298622.4	37	c.1999	CCDS44494.1	10	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	32	5.119771	0.94385	.	.	ENSG00000188385	ENST00000298622	T	0.24908	1.83	3.84	3.84	0.44239	.	.	.	.	.	T	0.40473	0.1118	L	0.47716	1.5	0.48135	D	0.999592	D;D	0.89917	1.0;0.989	D;P	0.69824	0.966;0.498	T	0.13818	-1.0495	9	0.16420	T	0.52	.	15.8081	0.78531	0.0:0.0:1.0:0.0	.	104;667	Q5VZ66-2;Q5VZ66	.;JKIP3_HUMAN	T	667	ENSP00000298622:A667T	ENSP00000298622:A667T	A	+	1	0	JAKMIP3	133813527	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.159000	0.94728	1.697000	0.51169	0.299000	0.19835	GCC	-	NULL		0.622	JAKMIP3-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	JAKMIP3	protein_coding	OTTHUMT00000051049.3	G	NM_194303	rs199769239		133963537	+1	no_errors	ENST00000298622	ensembl	human	known	74_37	missense	SNP	1.000	A
ACCS	84680	genome.wustl.edu	37	11	44104824	44104824	+	Missense_Mutation	SNP	G	G	A	rs138481594		TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr11:44104824G>A	ENST00000263776.8	+	13	1651	c.1217G>A	c.(1216-1218)cGt>cAt	p.R406H		NM_001127219.1|NM_032592.3	NP_001120691.1|NP_115981.1	Q96QU6	1A1L1_HUMAN	1-aminocyclopropane-1-carboxylate synthase homolog (Arabidopsis)(non-functional)	406					biosynthetic process (GO:0009058)		catalytic activity (GO:0003824)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)			breast(4)|endometrium(3)|large_intestine(11)|lung(15)|ovary(1)|skin(1)	35						TTCTTGAGTCGTGGGGCTGGC	0.577													G|||	1	0.000199681	0.0008	0.0	5008	,	,		19046	0.0		0.0	False		,,,				2504	0.0				Esophageal Squamous(158;148 1889 8077 23160 41213)												0								ENSG00000110455	G	HIS/ARG,HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	96.0	90.0	92.0		1217,1217	4.8	0.5	11	dbSNP_134	92	0,8600		0,0,4300	yes	missense,missense	ACCS	NM_001127219.1,NM_032592.3	29,29	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging,probably-damaging	406/502,406/502	44104824	1,13005	2203	4300	6503	ACCS	SO:0001583	missense	0			GMAF=0.0005	HGNC	AY026508	CCDS7907.1	11p11	2008-03-12	2008-01-28		ENSG00000110455	ENSG00000110455			23989	protein-coding gene	gene with protein product		608405				11470512	Standard	NM_032592		Approved	PHACS, ACS	uc009yks.1	Q96QU6	OTTHUMG00000166427	ENST00000263776.8:c.1217G>A	11.37:g.44104824G>A	ENSP00000263776:p.Arg406His	Somatic	0	81	0.00		0.5963777675123697	26	13.33	4	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	58	9.38	B4E219|Q8WUL4|Q96LX5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase	p.R406H	ENST00000263776.8	37	c.1217	CCDS7907.1	11	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	13.45	2.241820	0.39598	2.27E-4	0.0	ENSG00000110455	ENST00000263776	T	0.21734	1.99	5.7	4.76	0.60689	Aminotransferase, class I/classII (1);Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.427181	0.27420	N	0.019451	T	0.25382	0.0617	M	0.65320	2	0.80722	D	1	B	0.22800	0.075	B	0.25291	0.059	T	0.03184	-1.1063	10	0.26408	T	0.33	-0.0882	16.4367	0.83878	0.0:0.131:0.869:0.0	.	406	Q96QU6	1A1L1_HUMAN	H	406	ENSP00000263776:R406H	ENSP00000263776:R406H	R	+	2	0	ACCS	44061400	0.998000	0.40836	0.455000	0.27031	0.921000	0.55340	4.266000	0.58871	2.689000	0.91719	0.511000	0.50034	CGT	-	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase		0.577	ACCS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACCS	protein_coding	OTTHUMT00000389721.1	G	NM_032592	rs138481594		44104824	+1	no_errors	ENST00000263776	ensembl	human	known	74_37	missense	SNP	0.642	A
CCNDBP1	23582	genome.wustl.edu	37	15	43483857	43483857	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr15:43483857G>A	ENST00000300213.4	+	8	1086	c.844G>A	c.(844-846)Gat>Aat	p.D282N	CCNDBP1_ENST00000356633.5_Missense_Mutation_p.D121N|EPB42_ENST00000563128.1_Intron	NM_012142.4	NP_036274.3	O95273	CCDB1_HUMAN	cyclin D-type binding-protein 1	282	Interaction with RPLP0.|Interaction with TCF3.				cell cycle (GO:0007049)|regulation of cell cycle (GO:0051726)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)	13		all_cancers(109;3.31e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;8.42e-07)		GGATATTTCTGATGAAATCAG	0.458																																																	0								ENSG00000166946						87.0	80.0	83.0					15																	43483857		2203	4299	6502	CCNDBP1	SO:0001583	missense	0			-	HGNC	AF082569	CCDS10092.1	15q14-q15	2008-07-18			ENSG00000166946	ENSG00000166946			1587	protein-coding gene	gene with protein product	"""D-type cyclin-interacting protein 1"", ""MAID protein"", ""HHM Protein"", ""grap2 cyclin interacting protein"""	607089				10801854	Standard	NM_012142		Approved	DIP1, GCIP	uc001zqv.3	O95273	OTTHUMG00000130703	ENST00000300213.4:c.844G>A	15.37:g.43483857G>A	ENSP00000300213:p.Asp282Asn	Somatic	0	19	0.00		0.5963777675123697	121	17.12	25	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	22	21.43	A8K3Q0|A8K3U2|Q6ZQN9|Q7Z519|Q8NBS7|Q8NBY2|Q9NS19|Q9NYH3|Q9UHX9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.D282N	ENST00000300213.4	37	c.844	CCDS10092.1	15	.	.	.	.	.	.	.	.	.	.	G	12.35	1.912419	0.33721	.	.	ENSG00000166946	ENST00000300213;ENST00000356633;ENST00000444658	T;T	0.43688	0.94;0.94	5.35	4.36	0.52297	.	0.568124	0.19629	N	0.109726	T	0.29223	0.0727	L	0.41079	1.255	0.33051	D	0.532739	B;B;B	0.17268	0.021;0.011;0.009	B;B;B	0.17098	0.017;0.008;0.005	T	0.21655	-1.0239	10	0.21540	T	0.41	-12.1265	6.0624	0.19844	0.1019:0.1938:0.7043:0.0	.	282;282;154	O95273-2;O95273;O95273-4	.;CCDB1_HUMAN;.	N	282;121;154	ENSP00000300213:D282N;ENSP00000349047:D121N	ENSP00000300213:D282N	D	+	1	0	CCNDBP1	41271149	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	1.791000	0.38744	2.792000	0.96026	0.555000	0.69702	GAT	-	NULL		0.458	CCNDBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCNDBP1	protein_coding	OTTHUMT00000253203.1	G	NM_012142	-		43483857	+1	no_errors	ENST00000300213	ensembl	human	known	74_37	missense	SNP	1.000	A
TBX5	6910	genome.wustl.edu	37	12	114793771	114793771	+	Missense_Mutation	SNP	G	G	A	rs377532269		TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr12:114793771G>A	ENST00000310346.4	-	9	1789	c.1123C>T	c.(1123-1125)Cgg>Tgg	p.R375W	TBX5_ENST00000349716.5_Missense_Mutation_p.R325W|TBX5_ENST00000405440.2_Missense_Mutation_p.R375W	NM_000192.3	NP_000183.2	Q99593	TBX5_HUMAN	T-box 5	375					apoptotic nuclear changes (GO:0030262)|atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|bundle of His development (GO:0003166)|cardiac left ventricle formation (GO:0003218)|cardiac muscle cell differentiation (GO:0055007)|cell migration involved in coronary vasculogenesis (GO:0060980)|cell-cell signaling (GO:0007267)|embryonic forelimb morphogenesis (GO:0035115)|embryonic limb morphogenesis (GO:0030326)|endocardial cushion development (GO:0003197)|forelimb morphogenesis (GO:0035136)|gene expression (GO:0010467)|heart development (GO:0007507)|lung development (GO:0030324)|morphogenesis of an epithelium (GO:0002009)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|pattern specification process (GO:0007389)|pericardium development (GO:0060039)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cardioblast differentiation (GO:0051891)|positive regulation of secondary heart field cardioblast proliferation (GO:0072513)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of execution phase of apoptosis (GO:1900117)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ventricular cardiac muscle tissue development (GO:0003229)|ventricular septum development (GO:0003281)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)	p.R375W(2)		endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(29)|ovary(6)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	Medulloblastoma(191;0.163)|all_neural(191;0.178)			BRCA - Breast invasive adenocarcinoma(302;0.0893)		CAAGCTTGCCGCTGTGCCGAC	0.592																																					NSCLC(152;1358 1980 4050 23898 40356)												2	Substitution - Missense(2)	upper_aerodigestive_tract(1)|ovary(1)						ENSG00000089225	G	TRP/ARG,TRP/ARG,TRP/ARG	0,4406		0,0,2203	96.0	84.0	88.0		1123,973,1123	5.3	1.0	12		88	2,8598	2.2+/-6.3	0,2,4298	no	missense,missense,missense	TBX5	NM_000192.3,NM_080717.2,NM_181486.1	101,101,101	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	probably-damaging,probably-damaging,probably-damaging	375/519,325/469,375/519	114793771	2,13004	2203	4300	6503	TBX5	SO:0001583	missense	0			-	HGNC	U89353	CCDS9173.1, CCDS9174.1	12q24.1	2014-09-17			ENSG00000089225	ENSG00000089225		"""T-boxes"""	11604	protein-coding gene	gene with protein product		601620		HOS		8988165, 8054982	Standard	NM_000192		Approved		uc001tvo.4	Q99593	OTTHUMG00000166191	ENST00000310346.4:c.1123C>T	12.37:g.114793771G>A	ENSP00000309913:p.Arg375Trp	Somatic	0	54	0.00		0.5963777675123697	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	31	24.39	A6ND77|O15301|Q96TB0|Q9Y4I2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TF_T-box,superfamily_p53-like_TF_DNA-bd,smart_TF_T-box,pfscan_TF_T-box,prints_TF_T-box	p.R375W	ENST00000310346.4	37	c.1123	CCDS9173.1	12	.	.	.	.	.	.	.	.	.	.	G	29.1	4.979138	0.92982	0.0	2.33E-4	ENSG00000089225	ENST00000349716;ENST00000310346;ENST00000448888;ENST00000405440	T;T;T	0.53206	0.63;0.63;0.63	5.27	5.27	0.74061	.	0.059422	0.64402	D	0.000001	T	0.71134	0.3304	M	0.80183	2.485	0.80722	D	1	D	0.89917	1.0	D	0.69654	0.965	T	0.75758	-0.3205	10	0.87932	D	0	.	18.8889	0.92391	0.0:0.0:1.0:0.0	.	375	Q99593	TBX5_HUMAN	W	325;375;272;375	ENSP00000337723:R325W;ENSP00000309913:R375W;ENSP00000384152:R375W	ENSP00000309913:R375W	R	-	1	2	TBX5	113278154	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.648000	0.83479	2.463000	0.83235	0.655000	0.94253	CGG	-	NULL		0.592	TBX5-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	TBX5	protein_coding	OTTHUMT00000388297.1	G	NM_080717	-		114793771	-1	no_errors	ENST00000310346	ensembl	human	known	74_37	missense	SNP	1.000	A
RFPL4AL1	729974	genome.wustl.edu	37	19	56284130	56284130	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr19:56284130G>A	ENST00000341750.4	+	3	493	c.449G>A	c.(448-450)cGc>cAc	p.R150H		NM_001277397.1	NP_001264326.1	F8VTS6	RFAL1_HUMAN	ret finger protein-like 4A-like 1	150	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.						zinc ion binding (GO:0008270)										ACTTCCGGCCGCCATTACTGG	0.572																																																	0								ENSG00000229292																																			RFPL4AL1	SO:0001583	missense	0			-	HGNC		CCDS59425.1	19q13.42	2013-02-22			ENSG00000229292	ENSG00000229292			45147	protein-coding gene	gene with protein product							Standard	NM_001277397		Approved		uc031rnc.1	F8VTS6	OTTHUMG00000165450	ENST00000341750.4:c.449G>A	19.37:g.56284130G>A	ENSP00000345151:p.Arg150His	Somatic	0	77	0.00		0.5963777675123697	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	45	11.54		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RDM_domain_RFPL,pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_RING,prints_Butyrophylin	p.R150H	ENST00000341750.4	37	c.449	CCDS59425.1	19	.	.	.	.	.	.	.	.	.	.	g	6.965	0.547963	0.13312	.	.	ENSG00000229292	ENST00000341750	T	0.70986	-0.53	1.95	-1.5	0.08691	.	.	.	.	.	T	0.78155	0.4239	M	0.88450	2.955	.	.	.	.	.	.	.	.	.	T	0.77512	-0.2560	6	0.62326	D	0.03	-12.6675	6.1635	0.20378	0.4396:0.0:0.5604:0.0	.	.	.	.	H	150	ENSP00000345151:R150H	ENSP00000345151:R150H	R	+	2	0	CTD-2611O12.2	60975942	0.007000	0.16637	0.004000	0.12327	0.006000	0.05464	1.464000	0.35288	-0.304000	0.08843	-0.225000	0.12378	CGC	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,prints_Butyrophylin		0.572	RFPL4AL1-001	NOVEL	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	RFPL4AL1	protein_coding	OTTHUMT00000384186.1	G		-		56284130	+1	no_errors	ENST00000341750	ensembl	human	novel	74_37	missense	SNP	0.184	A
ADCY2	108	genome.wustl.edu	37	5	7724664	7724664	+	Missense_Mutation	SNP	G	G	T			TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr5:7724664G>T	ENST00000338316.4	+	13	1799	c.1710G>T	c.(1708-1710)tgG>tgT	p.W570C	RP11-711G10.1_ENST00000514105.2_RNA|ADCY2_ENST00000537121.1_Missense_Mutation_p.W390C	NM_020546.2	NP_065433.2	Q08462	ADCY2_HUMAN	adenylate cyclase 2 (brain)	570					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)			NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(56)|ovary(8)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	119						CCAGGCAATGGCTCAAGTCTG	0.333																																																	0								ENSG00000078295						77.0	76.0	77.0					5																	7724664		2203	4300	6503	ADCY2	SO:0001583	missense	0			-	HGNC	AB028983	CCDS3872.2	5p15.3	2013-02-04			ENSG00000078295	ENSG00000078295	4.6.1.1	"""Adenylate cyclases"""	233	protein-coding gene	gene with protein product		103071				1427768	Standard	NM_020546		Approved	HBAC2, KIAA1060, AC2	uc003jdz.1	Q08462	OTTHUMG00000090476	ENST00000338316.4:c.1710G>T	5.37:g.7724664G>T	ENSP00000342952:p.Trp570Cys	Somatic	0	49	0.00		0.5963777675123697	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	46	28.12	B7Z2C1|Q2NKL8|Q9UDB2|Q9UPU2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_A/G_cyclase,pfam_Adenylate_cyclase-like,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	p.W570C	ENST00000338316.4	37	c.1710	CCDS3872.2	5	.	.	.	.	.	.	.	.	.	.	G	13.38	2.221302	0.39300	.	.	ENSG00000078295	ENST00000338316;ENST00000541993;ENST00000537121	T;D	0.81659	-1.05;-1.52	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	T	0.80864	0.4705	N	0.20845	0.615	0.80722	D	1	P;B	0.50617	0.937;0.104	P;B	0.62435	0.902;0.09	T	0.76764	-0.2839	10	0.21014	T	0.42	.	16.8964	0.86101	0.0:0.0:1.0:0.0	.	390;570	B7Z2C1;Q08462	.;ADCY2_HUMAN	C	570;403;390	ENSP00000342952:W570C;ENSP00000444803:W390C	ENSP00000342952:W570C	W	+	3	0	ADCY2	7777664	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.359000	0.90093	2.788000	0.95919	0.650000	0.86243	TGG	-	pfam_Adenylate_cyclase-like		0.333	ADCY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY2	protein_coding	OTTHUMT00000206930.2	G	NM_020546	-		7724664	+1	no_errors	ENST00000338316	ensembl	human	known	74_37	missense	SNP	1.000	T
GOT1L1	137362	genome.wustl.edu	37	8	37791833	37791834	+	Frame_Shift_Ins	INS	-	-	T	rs370114090	byFrequency	TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr8:37791833_37791834insT	ENST00000307599.4	-	9	1342_1343	c.1243_1244insA	c.(1243-1245)acafs	p.T415fs		NM_152413.2	NP_689626.2	Q8NHS2	AATC2_HUMAN	glutamic-oxaloacetic transaminase 1-like 1	415					biosynthetic process (GO:0009058)|cellular amino acid metabolic process (GO:0006520)	cytoplasm (GO:0005737)	pyridoxal phosphate binding (GO:0030170)|transaminase activity (GO:0008483)			central_nervous_system(1)|endometrium(3)|lung(8)|ovary(1)|prostate(1)	14	Colorectal(12;0.00627)	Lung NSC(58;0.118)|all_lung(54;0.195)	LUSC - Lung squamous cell carcinoma(8;1.37e-11)			TCCAATCAGTGTTTTTTTTTCC	0.371													?|TTTTTTTTT|TTTTTTTTTT|unsure	7	0.00139776	0.0	0.0	5008	,	,		21654	0.0069		0.0	False		,,,				2504	0.0																0								ENSG00000169154																																			GOT1L1	SO:0001589	frameshift_variant	0				HGNC	BC029504	CCDS47839.1	8p12	2005-09-22			ENSG00000169154	ENSG00000169154			28487	protein-coding gene	gene with protein product						12477932	Standard	NM_152413		Approved	MGC33309	uc011lbj.1	Q8NHS2	OTTHUMG00000164027	ENST00000307599.4:c.1244dupA	8.37:g.37791842_37791842dupT	ENSP00000303077:p.Thr415fs	Somatic	0	52	0.00		0.5963777675123697	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	41	10.87	A8MWL4	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase,prints_Asp_trans	p.T415fs	ENST00000307599.4	37	c.1244_1243	CCDS47839.1	8																																																																																			-	NULL		0.371	GOT1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GOT1L1	protein_coding	OTTHUMT00000376823.1	-	NM_152413			37791834	-1	no_errors	ENST00000307599	ensembl	human	known	74_37	frame_shift_ins	INS	0.000:0.000	T
TUSC2	11334	genome.wustl.edu	37	3	50368093	50368095	+	5'Flank	DEL	CTC	CTC	-			TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	CTC	CTC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr3:50368093_50368095delCTC	ENST00000232496.4	-	0	0				RASSF1_ENST00000357043.2_In_Frame_Del_p.E318del|RASSF1_ENST00000327761.3_In_Frame_Del_p.E244del|RASSF1_ENST00000359365.4_In_Frame_Del_p.E314del|RASSF1_ENST00000395126.3_In_Frame_Del_p.E163del|TUSC2_ENST00000462137.1_5'Flank	NM_007275.1	NP_009206.1	O75896	TUSC2_HUMAN	tumor suppressor candidate 2						cell cycle (GO:0007049)|cell maturation (GO:0048469)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|chemokine (C-C motif) ligand 5 production (GO:0071609)|inflammatory response (GO:0006954)|interleukin-15 production (GO:0032618)|natural killer cell differentiation (GO:0001779)|negative regulation of interleukin-17 production (GO:0032700)|neutrophil mediated killing of gram-negative bacterium (GO:0070945)|phagocytosis (GO:0006909)|positive regulation of interleukin-10 production (GO:0032733)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of reactive oxygen species metabolic process (GO:2000377)|response to defense-related host reactive oxygen species production (GO:0052567)	mitochondrion (GO:0005739)				lung(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)		GGCGGAGGTGCTCCTCCTCCTCC	0.591																																																	0								ENSG00000068028																																			RASSF1	SO:0001631	upstream_gene_variant	0				HGNC	AF055479	CCDS2819.1	3p21.3	2010-09-21	2004-01-20	2004-01-21	ENSG00000114383	ENSG00000114383			17034	protein-coding gene	gene with protein product		607052	"""PDGFA associated protein 2"""	PDAP2		8780057, 11593436	Standard	NM_007275		Approved	FUS1, PAP, C3orf11	uc003czy.1	O75896	OTTHUMG00000156877		3.37:g.50368102_50368104delCTC	Exception_encountered	Somatic	0	29	0.00		0.5963777675123697	228	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	30	9.09	B2R4Y9	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Ras-assoc,pfam_Prot_Kinase_C-like_PE/DAG-bd,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Ras-assoc,pfscan_Ras-assoc,pfscan_SARAH_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd	p.E318in_frame_del	ENST00000232496.4	37	c.954_952	CCDS2819.1	3																																																																																			-	pfscan_SARAH_dom		0.591	TUSC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RASSF1	protein_coding	OTTHUMT00000346399.1	CTC	NM_007275			50368095	-1	no_errors	ENST00000357043	ensembl	human	known	74_37	in_frame_del	DEL	0.996:1.000:1.000	-
CARNS1	57571	genome.wustl.edu	37	11	67186392	67186392	+	Missense_Mutation	SNP	C	C	A			TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr11:67186392C>A	ENST00000307823.3	+	4	613	c.161C>A	c.(160-162)gCa>gAa	p.A54E	CARNS1_ENST00000445895.2_Missense_Mutation_p.A177E|CARNS1_ENST00000531040.1_Missense_Mutation_p.A177E|CARNS1_ENST00000423745.2_Missense_Mutation_p.A54E	NM_020811.1	NP_065862.1	A5YM72	CRNS1_HUMAN	carnosine synthase 1	54					ATP catabolic process (GO:0006200)|carnosine biosynthetic process (GO:0035499)		ATP binding (GO:0005524)|ATPase activity (GO:0016887)|carnosine synthase activity (GO:0047730)|metal ion binding (GO:0046872)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(7)	11						TACTTTTTGGCAGGCCTGGGC	0.682																																																	0								ENSG00000172508						14.0	16.0	15.0					11																	67186392		1957	4123	6080	CARNS1	SO:0001583	missense	0			-	HGNC		CCDS44658.1, CCDS53667.1	11q13.1	2010-03-25	2010-03-25	2010-03-25	ENSG00000172508	ENSG00000172508			29268	protein-coding gene	gene with protein product		613368	"""ATP-grasp domain containing 1"""	ATPGD1		20097752	Standard	NM_020811		Approved	KIAA1394	uc010rpr.2	A5YM72		ENST00000307823.3:c.161C>A	11.37:g.67186392C>A	ENSP00000308268:p.Ala54Glu	Somatic	0	72	0.00		0.5963777675123697	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	70	14.63	A8K1M3|B4DFC6|E9PK38|F5H427|Q8N467|Q9P2F3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_PreATP-grasp_dom,superfamily_TIL_dom,pfscan_ATP-grasp	p.A177E	ENST00000307823.3	37	c.530	CCDS44658.1	11	.	.	.	.	.	.	.	.	.	.	C	11.66	1.704259	0.30232	.	.	ENSG00000172508	ENST00000531040;ENST00000307823;ENST00000542831;ENST00000539452;ENST00000423745;ENST00000445895	T;T;T;T	0.32988	1.45;1.49;1.49;1.43	4.06	3.09	0.35607	.	.	.	.	.	T	0.16471	0.0396	N	0.14661	0.345	0.32540	N	0.533808	P;B;P	0.36535	0.557;0.421;0.557	B;B;B	0.33620	0.167;0.08;0.167	T	0.12760	-1.0535	9	0.33940	T	0.23	.	9.4052	0.38457	0.0:0.6837:0.3163:0.0	.	177;54;193	F5H427;A5YM72;A5YM72-3	.;CRNS1_HUMAN;.	E	177;54;177;193;54;177	ENSP00000431670:A177E;ENSP00000308268:A54E;ENSP00000401519:A54E;ENSP00000389009:A177E	ENSP00000308268:A54E	A	+	2	0	CARNS1	66942968	0.165000	0.22948	0.995000	0.50966	0.332000	0.28634	0.605000	0.24179	2.100000	0.63781	0.561000	0.74099	GCA	-	NULL		0.682	CARNS1-001	KNOWN	basic|CCDS	protein_coding	CARNS1	protein_coding	OTTHUMT00000395501.1	C	NM_020811	-		67186392	+1	no_errors	ENST00000445895	ensembl	human	known	74_37	missense	SNP	0.964	A
OR6T1	219874	genome.wustl.edu	37	11	123814023	123814023	+	Missense_Mutation	SNP	C	C	T	rs149839618	byFrequency	TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr11:123814023C>T	ENST00000321252.2	-	1	557	c.523G>A	c.(523-525)Gac>Aac	p.D175N		NM_001005187.1	NP_001005187.1	Q8NGN1	OR6T1_HUMAN	olfactory receptor, family 6, subfamily T, member 1	175						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(18)|ovary(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	40		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0401)		AAGAAGTGGTCAATACCATTG	0.552													C|||	3	0.000599042	0.0023	0.0	5008	,	,		21189	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000181499	C	ASN/ASP	4,4400	11.4+/-27.6	0,4,2198	78.0	65.0	70.0		523	2.8	0.5	11	dbSNP_134	70	0,8598		0,0,4299	yes	missense	OR6T1	NM_001005187.1	23	0,4,6497	TT,TC,CC		0.0,0.0908,0.0308	benign	175/324	123814023	4,12998	2202	4299	6501	OR6T1	SO:0001583	missense	0			GMAF=0.0005	HGNC	AB065759	CCDS31700.1	11q24.1	2012-08-09			ENSG00000181499	ENSG00000181499		"""GPCR / Class A : Olfactory receptors"""	14848	protein-coding gene	gene with protein product							Standard	NM_001005187		Approved		uc010sab.2	Q8NGN1	OTTHUMG00000165962	ENST00000321252.2:c.523G>A	11.37:g.123814023C>T	ENSP00000325203:p.Asp175Asn	Somatic	0	41	0.00		0.5963777675123697	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	24	20.00	Q6IFE7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.D175N	ENST00000321252.2	37	c.523	CCDS31700.1	11	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	11.00	1.509876	0.27036	9.08E-4	0.0	ENSG00000181499	ENST00000321252	T	0.00107	8.72	3.7	2.78	0.32641	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00109	0.0003	N	0.10874	0.06	0.21105	N	0.999785	B	0.18741	0.03	B	0.26614	0.071	T	0.03344	-1.1046	9	0.33940	T	0.23	-23.0359	8.4746	0.33005	0.0:0.8817:0.0:0.1183	.	175	Q8NGN1	OR6T1_HUMAN	N	175	ENSP00000325203:D175N	ENSP00000325203:D175N	D	-	1	0	OR6T1	123319233	0.000000	0.05858	0.544000	0.28141	0.956000	0.61745	-0.453000	0.06778	0.735000	0.32537	0.563000	0.77884	GAC	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.552	OR6T1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6T1	protein_coding	OTTHUMT00000387264.1	C	NM_001005187	rs149839618		123814023	-1	no_errors	ENST00000321252	ensembl	human	known	74_37	missense	SNP	0.887	T
TPRX1	284355	genome.wustl.edu	37	19	48305491	48305502	+	In_Frame_Del	DEL	GATTGGGCCTGG	GATTGGGCCTGG	-	rs567983193	byFrequency	TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	GATTGGGCCTGG	GATTGGGCCTGG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr19:48305491_48305502delGATTGGGCCTGG	ENST00000322175.3	-	2	921_932	c.766_777delCCAGGCCCAATC	c.(766-777)ccaggcccaatcdel	p.PGPI256del	TPRX1_ENST00000543508.1_In_Frame_Del_p.PGPI246del|TPRX1_ENST00000535759.1_In_Frame_Del_p.PGPI353del	NM_198479.2	NP_940881.2	Q8N7U7	TPRX1_HUMAN	tetra-peptide repeat homeobox 1	256	Gly-rich.					nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(5)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|prostate(2)|skin(1)	18		all_cancers(25;3.02e-09)|all_epithelial(76;7e-07)|all_lung(116;2.48e-06)|Lung NSC(112;5.15e-06)|Ovarian(192;0.0139)|all_neural(266;0.0146)|Breast(70;0.133)		OV - Ovarian serous cystadenocarcinoma(262;0.000241)|all cancers(93;0.00036)|Epithelial(262;0.0127)|GBM - Glioblastoma multiforme(486;0.048)		ctgggcctgagattgggcctgggattgggcct	0.656																																					Esophageal Squamous(123;175 2281 3051 32395)												0								ENSG00000178928																																			TPRX1	SO:0001651	inframe_deletion	0				HGNC		CCDS33066.1	19q13.33	2011-07-08			ENSG00000178928	ENSG00000178928		"""Homeoboxes / PRD class"""	32174	protein-coding gene	gene with protein product		611166					Standard	XM_005258788		Approved	FLJ40321	uc002php.2	Q8N7U7		ENST00000322175.3:c.766_777delCCAGGCCCAATC	19.37:g.48305491_48305502delGATTGGGCCTGG	ENSP00000323455:p.Pro256_Ile259del	Somatic	NA	NA	NA		0.5963777675123697	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A5D8Y3|B2RPL5	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	p.PGPI353in_frame_del	ENST00000322175.3	37	c.1068_1057	CCDS33066.1	19																																																																																			-	NULL		0.656	TPRX1-001	KNOWN	basic|CCDS	protein_coding	TPRX1	protein_coding	OTTHUMT00000409868.1	GATTGGGCCTGG	NM_198479			48305502	-1	no_errors	ENST00000535759	ensembl	human	known	74_37	in_frame_del	DEL	0.797:0.775:0.029:0.021:0.020:0.012:0.004:0.004:0.004:0.005:0.013:0.013	-
HMBOX1	79618	genome.wustl.edu	37	8	28909077	28909086	+	3'UTR	DEL	GGATGCAAGC	GGATGCAAGC	-			TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	GGATGCAAGC	GGATGCAAGC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr8:28909077_28909086delGGATGCAAGC	ENST00000397358.3	+	0	2372_2381				HMBOX1_ENST00000355231.5_Frame_Shift_Del_p.RMQA377fs|HMBOX1_ENST00000444075.1_3'UTR|RNA5SP260_ENST00000363849.1_RNA|HMBOX1_ENST00000287701.10_3'UTR|HMBOX1_ENST00000519047.1_Frame_Shift_Del_p.RMQA377fs	NM_024567.3	NP_078843.2	Q6NT76	HMBX1_HUMAN	homeobox containing 1						negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)	11		Ovarian(32;0.0192)		KIRC - Kidney renal clear cell carcinoma(542;0.135)|Kidney(114;0.161)		AAGACTGATAGGATGCAAGCTGAGGTCGTG	0.452																																																	0								ENSG00000147421																																			HMBOX1	SO:0001624	3_prime_UTR_variant	0				HGNC	AY522342	CCDS6071.1	8p12	2013-05-23			ENSG00000147421	ENSG00000147421		"""Homeoboxes / HNF class"""	26137	protein-coding gene	gene with protein product	"""homeobox telomere-binding protein 1"""					16825764	Standard	NM_024567		Approved	HNF1LA, PBHNF, FLJ21616, HOT1	uc003xhd.4	Q6NT76	OTTHUMG00000172138	ENST00000397358.3:c.*414GGATGCAAGC>-	8.37:g.28909077_28909086delGGATGCAAGC		Somatic	NA	NA	NA		0.5963777675123697	5	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A4K385|A8K3R8|B4DHY5|D3DSU0|Q3Y6P1|Q96GS5|Q9H701	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_HNF-1_N,pfam_Homeobox_dom,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	p.R377fs	ENST00000397358.3	37	c.1130_1139	CCDS6071.1	8																																																																																			-	NULL		0.452	HMBOX1-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	HMBOX1	protein_coding	OTTHUMT00000255267.4	GGATGCAAGC	NM_024567			28909086	+1	no_errors	ENST00000355231	ensembl	human	putative	74_37	frame_shift_del	DEL	1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000	-
RASGRF1	5923	genome.wustl.edu	37	15	79298606	79298606	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr15:79298606C>T	ENST00000419573.3	-	15	2310	c.2036G>A	c.(2035-2037)cGc>cAc	p.R679H	RASGRF1_ENST00000394745.3_5'Flank|RASGRF1_ENST00000558480.2_Missense_Mutation_p.R666H|RASGRF1_ENST00000560334.1_5'UTR	NM_002891.4	NP_002882.3	Q13972	RGRF1_HUMAN	Ras protein-specific guanine nucleotide-releasing factor 1	679	N-terminal Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00135}.				activation of Rac GTPase activity (GO:0032863)|cell proliferation (GO:0008283)|long-term memory (GO:0007616)|neuron projection development (GO:0031175)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of Rac protein signal transduction (GO:0035020)|regulation of Ras protein signal transduction (GO:0046578)|regulation of synaptic plasticity (GO:0048167)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|growth cone (GO:0030426)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(18)|lung(23)|ovary(2)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						GGTGAAGACGCGGTAGGAGTG	0.597																																																	0								ENSG00000058335						176.0	146.0	156.0					15																	79298606		2196	4293	6489	RASGRF1	SO:0001583	missense	0			-	HGNC	M91815	CCDS10309.1, CCDS42065.1, CCDS45320.1	15q24	2013-01-10			ENSG00000058335	ENSG00000058335		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	9875	protein-coding gene	gene with protein product		606600		GRF1		7684828, 1379731	Standard	NM_153815		Approved	CDC25L, CDC25, GRF55, H-GRF55, GNRP, PP13187	uc002beq.3	Q13972	OTTHUMG00000144172	ENST00000419573.3:c.2036G>A	15.37:g.79298606C>T	ENSP00000405963:p.Arg679His	Somatic	0	53	0.00		0.5963777675123697	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	49	16.95	F8VPA5|H0YKF2|J3KQP9|Q16027	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RasGRF_CDC25,pfam_Ras-like_Gua-exchang_fac_N,pfam_DH-domain,pfam_Pleckstrin_homology,superfamily_Ras_GEF_dom,superfamily_DH-domain,smart_Pleckstrin_homology,smart_DH-domain,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_DH-domain,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.R679H	ENST00000419573.3	37	c.2036	CCDS10309.1	15	.	.	.	.	.	.	.	.	.	.	C	25.8	4.675616	0.88445	.	.	ENSG00000058335	ENST00000419573;ENST00000394741	T	0.42513	0.97	4.63	4.63	0.57726	Ras guanine nucleotide exchange factor, domain (1);Ras-like guanine nucleotide exchange factor, N-terminal (3);	0.000000	0.85682	D	0.000000	T	0.61899	0.2384	M	0.69358	2.11	0.80722	D	1	D;D;D;D;D	0.76494	0.999;0.998;0.998;0.998;0.997	D;D;D;D;D	0.79108	0.992;0.929;0.957;0.957;0.928	T	0.64084	-0.6490	10	0.54805	T	0.06	.	15.0277	0.71682	0.0:1.0:0.0:0.0	.	75;679;666;679;666	B7Z6Z6;A8K270;Q8IUU5;Q13972;F8VPA5	.;.;.;RGRF1_HUMAN;.	H	679;666	ENSP00000405963:R679H	ENSP00000378224:R666H	R	-	2	0	RASGRF1	77085661	1.000000	0.71417	0.987000	0.45799	0.887000	0.51463	7.473000	0.81007	2.413000	0.81919	0.591000	0.81541	CGC	-	pfam_Ras-like_Gua-exchang_fac_N,superfamily_Ras_GEF_dom,smart_Ras-like_Gua-exchang_fac_N,pfscan_Ras-like_Gua-exchang_fac_N		0.597	RASGRF1-001	KNOWN	basic|CCDS	protein_coding	RASGRF1	protein_coding	OTTHUMT00000291371.3	C	NM_002891	-		79298606	-1	no_errors	ENST00000419573	ensembl	human	known	74_37	missense	SNP	1.000	T
FBXW4	6468	genome.wustl.edu	37	10	103386256	103386257	+	Intron	INS	-	-	TT	rs199557169	byFrequency	TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr10:103386256_103386257insTT	ENST00000331272.7	-	6	1389				FBXW4_ENST00000470093.1_5'UTR	NM_022039.3	NP_071322.1	P57775	FBXW4_HUMAN	F-box and WD repeat domain containing 4						cartilage development (GO:0051216)|embryonic digit morphogenesis (GO:0042733)|embryonic limb morphogenesis (GO:0030326)|positive regulation of mesenchymal cell proliferation (GO:0002053)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)	ubiquitin ligase complex (GO:0000151)				breast(3)|endometrium(2)|large_intestine(4)|lung(4)|skin(1)|stomach(1)	15		Colorectal(252;0.123)		Epithelial(162;4.35e-08)|all cancers(201;1.92e-06)		ACAGGCAtctcttttttttttg	0.53																																																	0								ENSG00000107829																																			FBXW4	SO:0001627	intron_variant	0				HGNC	AF281859	CCDS31271.1	10q24	2013-01-09	2007-02-08	2005-03-12	ENSG00000107829	ENSG00000107829		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	10847	protein-coding gene	gene with protein product		608071	"""split hand/foot malformation (ectrodactyly) type 3"", ""F-box and WD-40 domain protein 4"""	SHFM3		8723077, 7912888	Standard	XM_005270053		Approved	Fbw4, dactylin	uc001kto.3	P57775	OTTHUMG00000018938	ENST00000331272.7:c.771-1689->AA	10.37:g.103386265_103386266dupTT		Somatic	0	30	0.00		0.5963777675123697	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	23	8.00	Q5SVS1|Q96IM6	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000331272.7	37	NULL	CCDS31271.1	10																																																																																			-	-		0.530	FBXW4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXW4	protein_coding	OTTHUMT00000049979.2	-	NM_022039			103386257	-1	no_errors	ENST00000470093	ensembl	human	known	74_37	rna	INS	0.007:0.005	TT
FBN3	84467	genome.wustl.edu	37	19	8154784	8154784	+	Nonsense_Mutation	SNP	G	G	A			TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr19:8154784G>A	ENST00000600128.1	-	50	6658	c.6244C>T	c.(6244-6246)Cga>Tga	p.R2082*	FBN3_ENST00000270509.2_Nonsense_Mutation_p.R2082*|FBN3_ENST00000601739.1_Nonsense_Mutation_p.R2082*			Q75N90	FBN3_HUMAN	fibrillin 3	2082						proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(9)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(15)|lung(53)|ovary(7)|pancreas(2)|prostate(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	132						TCACCTTCTCGGGAGTCATCC	0.652																																																	0								ENSG00000142449						25.0	28.0	27.0					19																	8154784		2202	4298	6500	FBN3	SO:0001587	stop_gained	0			-	HGNC		CCDS12196.1	19p13	2008-02-05							18794	protein-coding gene	gene with protein product		608529					Standard	NM_032447		Approved		uc002mjf.3	Q75N90		ENST00000600128.1:c.6244C>T	19.37:g.8154784G>A	ENSP00000470498:p.Arg2082*	Somatic	0	45	0.00		0.5963777675123697	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	72	8.86	Q75N91|Q75N92|Q75N93|Q86SJ5|Q96JP8	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_EGF-like_Ca-bd_dom,pfam_TB_dom,pfam_EG-like_dom,superfamily_TB_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pirsf_FBN,pfscan_EG-like_dom	p.R2082*	ENST00000600128.1	37	c.6244	CCDS12196.1	19	.	.	.	.	.	.	.	.	.	.	G	47	13.850246	0.99766	.	.	ENSG00000142449	ENST00000270509;ENST00000341066	.	.	.	3.83	-0.959	0.10343	.	0.238731	0.35407	U	0.003238	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09843	T	0.71	.	15.6999	0.77535	0.0:0.0:0.2511:0.7489	.	.	.	.	X	2082;188	.	ENSP00000270509:R2082X	R	-	1	2	FBN3	8060784	0.980000	0.34600	0.072000	0.20136	0.647000	0.38526	0.696000	0.25541	-0.329000	0.08527	0.462000	0.41574	CGA	-	superfamily_TB_dom,pirsf_FBN		0.652	FBN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN3	protein_coding	OTTHUMT00000461428.2	G	NM_032447	-		8154784	-1	no_errors	ENST00000270509	ensembl	human	known	74_37	nonsense	SNP	0.912	A
AC093802.1	0	genome.wustl.edu	37	2	240702074	240702074	+	Nonsense_Mutation	SNP	C	C	T			TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr2:240702074C>T	ENST00000407524.1	+	2	150	c.124C>T	c.(124-126)Cag>Tag	p.Q42*																								CCTTCTAGACCAGCAGAAGCC	0.632																																																	0								ENSG00000220256																																			AC093802.1	SO:0001587	stop_gained	0			-	Clone_based_vega_gene																												ENST00000407524.1:c.124C>T	2.37:g.240702074C>T	ENSP00000385884:p.Gln42*	Somatic	0	114	0.00		0.5963777675123697	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	78	17.89		Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.Q42*	ENST00000407524.1	37	c.124		2	.	.	.	.	.	.	.	.	.	.	C	8.397	0.841012	0.16891	.	.	ENSG00000220256	ENST00000407524	.	.	.	0.739	-0.645	0.11475	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	.	.	.	.	.	.	.	X	42	.	ENSP00000385884:Q42X	Q	+	1	0	AC093802.1	240367011	0.003000	0.15002	0.007000	0.13788	0.002000	0.02628	-0.087000	0.11215	-0.232000	0.09811	-0.411000	0.06167	CAG	-	NULL		0.632	AC093802.1-001	PUTATIVE	basic|appris_principal	protein_coding	ENSG00000220256	protein_coding	OTTHUMT00000326161.1	C		-		240702074	+1	no_errors	ENST00000407524	ensembl	human	putative	74_37	nonsense	SNP	0.009	T
TMPRSS15	5651	genome.wustl.edu	37	21	19744557	19744557	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr21:19744557C>T	ENST00000284885.3	-	6	650	c.617G>A	c.(616-618)gGa>gAa	p.G206E		NM_002772.2	NP_002763	P98073	ENTK_HUMAN	transmembrane protease, serine 15	206	LDL-receptor class A 1. {ECO:0000255|PROSITE-ProRule:PRU00124}.					brush border (GO:0005903)|integral component of membrane (GO:0016021)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(7)|large_intestine(19)|lung(36)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	85						GTTTACTTCTCCATCACAAAA	0.408																																																	0								ENSG00000154646						126.0	108.0	114.0					21																	19744557		2203	4300	6503	TMPRSS15	SO:0001583	missense	0			-	HGNC		CCDS13571.1	21q21	2010-12-09	2010-04-21	2010-04-21	ENSG00000154646	ENSG00000154646		"""Serine peptidases / Transmembrane"""	9490	protein-coding gene	gene with protein product	"""proenterokinase"", ""enteropeptidase"""	606635	"""protease, serine, 7 (enterokinase)"""	PRSS7		8052624	Standard	NM_002772		Approved	ENTK, MGC133046	uc002ykw.3	P98073	OTTHUMG00000074518	ENST00000284885.3:c.617G>A	21.37:g.19744557C>T	ENSP00000284885:p.Gly206Glu	Somatic	0	25	0.00		0.5963777675123697	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	31	13.89	Q2NKL7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_S1,pfam_CUB_dom,pfam_MAM_dom,pfam_SEA_dom,pfam_LDrepeatLR_classA_rpt,pfam_Peptidase_S1A_nudel,pfam_SRCR,superfamily_Trypsin-like_Pept_dom,superfamily_ConA-like_lec_gl_sf,superfamily_CUB_dom,superfamily_LDrepeatLR_classA_rpt,superfamily_Srcr_rcpt-rel,smart_SEA_dom,smart_LDrepeatLR_classA_rpt,smart_CUB_dom,smart_MAM_dom,smart_Srcr_rcpt-rel,smart_Peptidase_S1,pfscan_CUB_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_MAM_dom,pfscan_SEA_dom,pfscan_SRCR,pfscan_Peptidase_S1,prints_Peptidase_S1A,prints_LDrepeatLR_classA_rpt	p.G206E	ENST00000284885.3	37	c.617	CCDS13571.1	21	.	.	.	.	.	.	.	.	.	.	C	21.4	4.144911	0.77888	.	.	ENSG00000154646	ENST00000284885;ENST00000422787	D;D	0.96716	-4.05;-4.1	4.95	4.95	0.65309	Low-density lipoprotein (LDL) receptor class A, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.98460	0.9487	M	0.93763	3.455	0.44660	D	0.997641	D	0.89917	1.0	D	0.97110	1.0	D	0.99063	1.0831	9	.	.	.	.	13.547	0.61709	0.0:1.0:0.0:0.0	.	206	P98073	ENTK_HUMAN	E	206;176	ENSP00000284885:G206E;ENSP00000398253:G176E	.	G	-	2	0	TMPRSS15	18666428	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	4.179000	0.58290	2.567000	0.86603	0.557000	0.71058	GGA	-	pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt,prints_LDrepeatLR_classA_rpt		0.408	TMPRSS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMPRSS15	protein_coding	OTTHUMT00000158231.2	C	NM_002772	-		19744557	-1	no_errors	ENST00000284885	ensembl	human	known	74_37	missense	SNP	1.000	T
SLC5A10	125206	genome.wustl.edu	37	17	18918510	18918511	+	In_Frame_Ins	INS	-	-	CGGTAGGGGGGTGGGGGC	rs62066653|rs56122861		TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr17:18918510_18918511insCGGTAGGGGGGTGGGGGC	ENST00000395645.3	+	11	1257_1258	c.1239_1240insCGGTAGGGGGGTGGGGGC	c.(1240-1242)cgg>CGGTAGGGGGGTGGGGGCcgg	p.414_414R>R*GGGGR	SLC5A10_ENST00000395642.1_In_Frame_Ins_p.347_347R>R*GGGGR|SLC5A10_ENST00000317977.6_In_Frame_Ins_p.347_347R>R*GGGGR|SLC5A10_ENST00000395647.2_In_Frame_Ins_p.430_430R>R*GGGGR|SLC5A10_ENST00000417251.2_In_Frame_Ins_p.378_378R>R*GGGGR|SLC5A10_ENST00000395643.2_In_Frame_Ins_p.387_387R>R*GGGGR	NM_001042450.2	NP_001035915.1	A0PJK1	SC5AA_HUMAN	solute carrier family 5 (sodium/sugar cotransporter), member 10	414					sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(3)|ovary(3)|prostate(3)|skin(3)	24						TGCTGGTGGGACGGTACGGGGG	0.644																																																	0								ENSG00000154025																																			SLC5A10	SO:0001652	inframe_insertion	0				HGNC		CCDS11201.2, CCDS42275.1, CCDS59277.1, CCDS59278.1, CCDS74008.1	17p11.2	2013-07-19	2013-07-19		ENSG00000154025	ENSG00000154025		"""Solute carriers"""	23155	protein-coding gene	gene with protein product			"""solute carrier family 5 (sodium/glucose cotransporter), member 10"""				Standard	NM_152351		Approved	SGLT5	uc002gut.2	A0PJK1	OTTHUMG00000178143	Exception_encountered	17.37:g.18918510_18918511insCGGTAGGGGGGTGGGGGC	Exception_encountered	Somatic	NA	NA	NA		0.5963777675123697	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A8MUC9|B4DPI0|B7WPR4|Q6P5X0|Q8IXM4|Q96LQ1	In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	p.LVI430in_frame_ins*	ENST00000395645.3	37	c.1287_1288	CCDS42275.1	17																																																																																			-	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr		0.644	SLC5A10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC5A10	protein_coding	OTTHUMT00000132129.2	-	NM_152351			18918511	+1	no_errors	ENST00000395647	ensembl	human	known	74_37	in_frame_ins	INS	0.894:0.984	CGGTAGGGGGGTGGGGGC
MYO3B	140469	genome.wustl.edu	37	2	171323084	171323084	+	Silent	SNP	C	C	A			TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr2:171323084C>A	ENST00000408978.4	+	25	3020	c.2877C>A	c.(2875-2877)ccC>ccA	p.P959P	MYO3B_ENST00000602629.1_Intron|MYO3B_ENST00000334231.6_Silent_p.P968P|MYO3B_ENST00000409044.3_Silent_p.P959P	NM_138995.4	NP_620482.3	Q8WXR4	MYO3B_HUMAN	myosin IIIB	959	Myosin motor.				peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|stereocilium bundle tip (GO:0032426)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(25)|ovary(6)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	59						GCATTAAACCCAATGATGACC	0.562																																																	0								ENSG00000071909						96.0	98.0	98.0					2																	171323084		1924	4136	6060	MYO3B	SO:0001819	synonymous_variant	0			-	HGNC		CCDS42773.1, CCDS46446.1	2q31.1-q31.2	2011-09-27			ENSG00000071909	ENSG00000071909		"""Myosins / Myosin superfamily : Class III"""	15576	protein-coding gene	gene with protein product		610040					Standard	NM_001083615		Approved		uc002ufy.3	Q8WXR4	OTTHUMG00000154002	ENST00000408978.4:c.2877C>A	2.37:g.171323084C>A		Somatic	0	37	0.00		0.5963777675123697	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	29	12.12	B8ZZR2|Q53QE1|Q53T08|Q8IX64|Q8IX65|Q8IX66|Q8IX67|Q8IX68|Q96N94	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Myosin_head_motor_dom,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,pfscan_Prot_kinase_dom,prints_Myosin_head_motor_dom	p.P968	ENST00000408978.4	37	c.2904	CCDS42773.1	2																																																																																			-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom		0.562	MYO3B-004	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	MYO3B	protein_coding	OTTHUMT00000333410.1	C		-		171323084	+1	no_errors	ENST00000334231	ensembl	human	known	74_37	silent	SNP	1.000	A
LINC00200	399706	genome.wustl.edu	37	10	1205736	1205736	+	lincRNA	SNP	A	A	G	rs60415666		TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr10:1205736A>G	ENST00000425630.1	+	0	29					NR_015376.2				long intergenic non-protein coding RNA 200																		ATGAGGGATGACGCAGGCACA	0.667																																																	0								ENSG00000229205						15.0	18.0	17.0					10																	1205736		687	1591	2278	LINC00200			0			-	HGNC	AK097673		10p15.3	2012-10-12	2011-08-11	2011-08-11	ENSG00000229205	ENSG00000229205		"""Long non-coding RNAs"""	30974	non-coding RNA	RNA, long non-coding			"""chromosome 10 open reading frame 139"", ""non-protein coding RNA 200"""	C10orf139, NCRNA00200			Standard	NR_015376		Approved	FLJ40354	uc010qag.1		OTTHUMG00000017539		10.37:g.1205736A>G		Somatic	0	18	0.00		0.5963777675123697	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	14	26.32		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000425630.1	37	NULL		10																																																																																			-	-		0.667	LINC00200-001	KNOWN	basic	lincRNA	LINC00200	lincRNA	OTTHUMT00000046417.2	A	NR_015376	rs60415666		1205736	+1	no_errors	ENST00000425630	ensembl	human	known	74_37	rna	SNP	0.155	G
PPP3CC	5533	genome.wustl.edu	37	8	22380189	22380189	+	Missense_Mutation	SNP	C	C	A			TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr8:22380189C>A	ENST00000240139.5	+	8	1197	c.870C>A	c.(868-870)agC>agA	p.S290R	PPP3CC_ENST00000397775.3_Missense_Mutation_p.S290R|PPP3CC_ENST00000289963.8_Missense_Mutation_p.S290R|PPP3CC_ENST00000518852.1_Missense_Mutation_p.S290R	NM_005605.4	NP_005596.2	P48454	PP2BC_HUMAN	protein phosphatase 3, catalytic subunit, gamma isozyme	290					apoptotic process (GO:0006915)|intrinsic apoptotic signaling pathway (GO:0097193)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	17		Prostate(55;0.104)		BRCA - Breast invasive adenocarcinoma(99;0.00756)|Colorectal(74;0.0238)|COAD - Colon adenocarcinoma(73;0.0835)		ACAGGAAGAGCCAAGCCACAG	0.368																																																	0								ENSG00000120910						85.0	86.0	86.0					8																	22380189		2203	4300	6503	PPP3CC	SO:0001583	missense	0			-	HGNC		CCDS34859.1, CCDS59094.1, CCDS59093.1	8p21.3	2010-03-17	2010-03-05		ENSG00000120910	ENSG00000120910	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"""	9316	protein-coding gene	gene with protein product	"""calcineurin A gamma"", ""protein phosphatase 2B, catalytic subunit, gamma isoform"""	114107	"""protein phosphatase 3 (formerly 2B), catalytic subunit, gamma isoform (calcineurin A gamma)"", ""protein phosphatase 3 (formerly 2B), catalytic subunit, gamma isoform"""			1339277	Standard	NM_005605		Approved	CALNA3, PP2Bgamma	uc011kzi.2	P48454	OTTHUMG00000163802	ENST00000240139.5:c.870C>A	8.37:g.22380189C>A	ENSP00000240139:p.Ser290Arg	Somatic	0	31	0.00		0.5963777675123697	24	46.67	21	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	26	39.53	B4DRT5|Q9BSS6|Q9H4M5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PEstase_dom,smart_Ser/Thr-sp_prot-phosphatase,prints_Ser/Thr-sp_prot-phosphatase	p.S290R	ENST00000240139.5	37	c.870	CCDS34859.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.29|12.29	1.892952|1.892952	0.33442|0.33442	.|.	.|.	ENSG00000120910|ENSG00000120910	ENST00000522034;ENST00000521651|ENST00000518852;ENST00000240139;ENST00000289963;ENST00000397775;ENST00000523620	.|T;T;T;T;T	.|0.05025	.|3.51;3.51;3.51;3.51;3.51	5.53|5.53	3.74|3.74	0.42951|0.42951	.|Serine/threonine-specific protein phosphatase/bis(5-nucleosyl)-tetraphosphatase (1);	.|0.161342	.|0.64402	.|D	.|0.000002	T|T	0.04048|0.04048	0.0113|0.0113	N|N	0.04018|0.04018	-0.295|-0.295	0.48185|0.48185	D|D	0.999601|0.999601	.|P;D;P;P	.|0.52996	.|0.929;0.957;0.929;0.797	.|B;B;B;B	.|0.44085	.|0.361;0.44;0.255;0.342	T|T	0.52298|0.52298	-0.8594|-0.8594	5|10	.|0.87932	.|D	.|0	-8.0712|-8.0712	10.9842|10.9842	0.47513|0.47513	0.0:0.8466:0.0:0.1534|0.0:0.8466:0.0:0.1534	.|.	.|290;290;290;290	.|B4DRT5;P48454-2;P48454;G3V111	.|.;.;PP2BC_HUMAN;.	D|R	140;167|290;290;290;290;116	.|ENSP00000429379:S290R;ENSP00000240139:S290R;ENSP00000289963:S290R;ENSP00000380878:S290R;ENSP00000430555:S116R	.|ENSP00000240139:S290R	A|S	+|+	2|3	0|2	PPP3CC|PPP3CC	22436134|22436134	1.000000|1.000000	0.71417|0.71417	0.972000|0.972000	0.41901|0.41901	0.847000|0.847000	0.48162|0.48162	1.134000|1.134000	0.31442|0.31442	0.706000|0.706000	0.31912|0.31912	-0.253000|-0.253000	0.11424|0.11424	GCC|AGC	-	smart_Ser/Thr-sp_prot-phosphatase		0.368	PPP3CC-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PPP3CC	protein_coding	OTTHUMT00000375652.1	C	NM_005605	-		22380189	+1	no_errors	ENST00000240139	ensembl	human	known	74_37	missense	SNP	1.000	A
FAM230A	653203	genome.wustl.edu	37	22	20709096	20709096	+	Silent	SNP	C	C	T			TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr22:20709096C>T	ENST00000434783.3	+	8	1012	c.828C>T	c.(826-828)aaC>aaT	p.N276N	USP41_ENST00000454608.2_Intron|USP41_ENST00000486536.2_Intron					family with sequence similarity 230, member A																		GCATCGCTAACGAGGACGCCG	0.677																																																	0								ENSG00000188280																																			FAM230A	SO:0001819	synonymous_variant	0			-	HGNC	JX456222		22q11.21	2014-08-13			ENSG00000188280	ENSG00000188280			45045	other	unknown							Standard	XM_006724099		Approved	DGCR15			OTTHUMG00000150686	ENST00000434783.3:c.828C>T	22.37:g.20709096C>T		Somatic	0	108	0.00		0.5963777675123697	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	90	14.55		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ret-finger_pr-like_3_antisense,superfamily_Kinase-like_dom	p.N276	ENST00000434783.3	37	c.828		22																																																																																			-	superfamily_Kinase-like_dom		0.677	FAM230A-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	FAM230A	protein_coding	OTTHUMT00000319609.4	C		-		20709096	+1	no_errors	ENST00000434783	ensembl	human	known	74_37	silent	SNP	0.029	T
LONRF2	164832	genome.wustl.edu	37	2	100910724	100910724	+	Missense_Mutation	SNP	C	C	A	rs373744289		TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr2:100910724C>A	ENST00000393437.3	-	9	2363	c.1724G>T	c.(1723-1725)cGg>cTg	p.R575L	LONRF2_ENST00000409647.1_Missense_Mutation_p.R332L	NM_198461.3	NP_940863.3	Q1L5Z9	LONF2_HUMAN	LON peptidase N-terminal domain and ring finger 2	575	Lon.						ATP-dependent peptidase activity (GO:0004176)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(11)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	34						CATGCCAAACCGCTTGGTGCC	0.502																																																	0								ENSG00000170500						113.0	97.0	103.0					2																	100910724		2203	4300	6503	LONRF2	SO:0001583	missense	0			-	HGNC	AK127206	CCDS2046.2	2q11.2	2013-01-09			ENSG00000170500	ENSG00000170500		"""RING-type (C3HC4) zinc fingers"""	24788	protein-coding gene	gene with protein product							Standard	NM_198461		Approved	FLJ45273, RNF192	uc002tal.4	Q1L5Z9	OTTHUMG00000130668	ENST00000393437.3:c.1724G>T	2.37:g.100910724C>A	ENSP00000377086:p.Arg575Leu	Somatic	0	76	0.00		0.5963777675123697	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51	B9A006|Q6ZSR4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Pept_S16_N,pfam_Znf_C3HC4_RING-type,superfamily_PUA-like_domain,smart_Znf_RING,smart_TPR_repeat,smart_Pept_S16_N,pfscan_TPR-contain_dom,pfscan_Znf_RING	p.R575L	ENST00000393437.3	37	c.1724	CCDS2046.2	2	.	.	.	.	.	.	.	.	.	.	C	12.26	1.884373	0.33255	.	.	ENSG00000170500	ENST00000393437;ENST00000409647	T;T	0.40756	1.02;1.02	4.08	2.26	0.28386	Peptidase S16, lon N-terminal (1);PUA-like domain (1);	0.127889	0.52532	D	0.000080	T	0.37404	0.1002	L	0.28054	0.825	0.35542	D	0.803163	P	0.51537	0.946	P	0.53649	0.731	T	0.45963	-0.9225	10	0.62326	D	0.03	-5.2424	6.4261	0.21770	0.0:0.5293:0.0:0.4707	.	575	Q1L5Z9	LONF2_HUMAN	L	575;332	ENSP00000377086:R575L;ENSP00000386823:R332L	ENSP00000377086:R575L	R	-	2	0	LONRF2	100277156	1.000000	0.71417	0.011000	0.14972	0.007000	0.05969	4.186000	0.58337	0.305000	0.22832	-0.136000	0.14681	CGG	-	pfam_Pept_S16_N,superfamily_PUA-like_domain,smart_Pept_S16_N		0.502	LONRF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LONRF2	protein_coding	OTTHUMT00000253161.2	C	NM_198461	-		100910724	-1	no_errors	ENST00000393437	ensembl	human	known	74_37	missense	SNP	0.999	A
C9orf114	51490	genome.wustl.edu	37	9	131591119	131591120	+	Frame_Shift_Ins	INS	-	-	T	rs370087122		TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr9:131591119_131591120insT	ENST00000361256.5	-	3	142_143	c.102_103insA	c.(100-105)aaatggfs	p.W35fs		NM_016390.3	NP_057474.2	Q5T280	CI114_HUMAN	chromosome 9 open reading frame 114	35							poly(A) RNA binding (GO:0044822)			kidney(2)|large_intestine(4)|ovary(1)	7						AGATCCTTCCATTTTTTTTTCT	0.525																																																	0								ENSG00000198917																																			C9orf114	SO:0001589	frameshift_variant	0				HGNC		CCDS6913.1	9q34.11	2014-05-29			ENSG00000198917	ENSG00000198917			26933	protein-coding gene	gene with protein product	"""centromere protein 32"""					20813266	Standard	NM_016390		Approved	HSPC109, CENP-32	uc004bwd.3	Q5T280	OTTHUMG00000020762	ENST00000361256.5:c.103dupA	9.37:g.131591128_131591128dupT	ENSP00000354812:p.Trp35fs	Somatic	0	28	0.00		0.5963777675123697	21	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	19	9.52	Q0D2P6|Q6P469|Q6PGP9|Q6PIJ1|Q6PJV9	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_Put_MeTrfase,superfamily_NA-bd_OB-fold	p.W34fs	ENST00000361256.5	37	c.103_102	CCDS6913.1	9																																																																																			-	NULL		0.525	C9orf114-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf114	protein_coding	OTTHUMT00000054500.1	-	NM_016390			131591120	-1	no_errors	ENST00000361256	ensembl	human	known	74_37	frame_shift_ins	INS	1.000:0.998	T
CAPZA1	829	genome.wustl.edu	37	1	113202197	113202202	+	Intron	DEL	TCTCTC	TCTCTC	-	rs149635516|rs113906793	byFrequency	TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	TCTCTC	TCTCTC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr1:113202197_113202202delTCTCTC	ENST00000263168.3	+	7	1178				CAPZA1_ENST00000476936.1_Intron	NM_006135.2	NP_006126.1	P52907	CAZA1_HUMAN	capping protein (actin filament) muscle Z-line, alpha 1						actin cytoskeleton organization (GO:0030036)|actin filament capping (GO:0051693)|blood coagulation (GO:0007596)|cellular component movement (GO:0006928)|innate immune response (GO:0045087)|protein complex assembly (GO:0006461)	actin cytoskeleton (GO:0015629)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|F-actin capping protein complex (GO:0008290)|WASH complex (GO:0071203)	actin binding (GO:0003779)			breast(1)|kidney(2)|large_intestine(2)|lung(3)|prostate(1)	9	Lung SC(450;0.246)	all_cancers(81;1.44e-07)|all_epithelial(167;7.64e-07)|all_lung(203;2.16e-05)|Lung NSC(69;3.86e-05)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		AATGACAGTTTCTCTCTCTCTCTTTT	0.393																																																	0								ENSG00000116489																																			CAPZA1	SO:0001627	intron_variant	0				HGNC	U56637	CCDS30805.1	1p13.2	2014-05-09			ENSG00000116489	ENSG00000116489			1488	protein-coding gene	gene with protein product		601580				7665558, 9119363	Standard	NM_006135		Approved		uc001ecj.1	P52907	OTTHUMG00000011769	ENST00000263168.3:c.507-121TCTCTC>-	1.37:g.113202203_113202208delTCTCTC		Somatic	NA	NA	NA		0.5963777675123697	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q53FQ6|Q6FHD5	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000263168.3	37	NULL	CCDS30805.1	1																																																																																			-	-		0.393	CAPZA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAPZA1	protein_coding	OTTHUMT00000032567.2	TCTCTC	NM_006135			113202202	+1	no_errors	ENST00000466066	ensembl	human	known	74_37	rna	DEL	0.000:0.008:0.000:0.000:0.000:0.000	-
CDH12	1010	genome.wustl.edu	37	5	21765143	21765143	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr5:21765143G>A	ENST00000382254.1	-	12	2545	c.1459C>T	c.(1459-1461)Cca>Tca	p.P487S	RP11-804N13.1_ENST00000522350.1_RNA|CDH12_ENST00000522262.1_Missense_Mutation_p.P447S|CDH12_ENST00000521384.1_5'UTR|CDH12_ENST00000504376.2_Missense_Mutation_p.P487S	NM_004061.3	NP_004052.2	P55289	CAD12_HUMAN	cadherin 12, type 2 (N-cadherin 2)	487	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(19)|lung(75)|ovary(2)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	120						GATATTTCTGGAGGAAATTCA	0.343										HNSCC(59;0.17)																																							0								ENSG00000154162						111.0	112.0	112.0					5																	21765143		2203	4300	6503	CDH12	SO:0001583	missense	0			-	HGNC	L33477	CCDS3890.1	5p14.3	2010-01-26			ENSG00000154162	ENSG00000154162		"""Cadherins / Major cadherins"""	1751	protein-coding gene	gene with protein product		600562				7731968	Standard	NM_004061		Approved	Br-cadherin, CDHB	uc003jgk.2	P55289	OTTHUMG00000090591	ENST00000382254.1:c.1459C>T	5.37:g.21765143G>A	ENSP00000371689:p.Pro487Ser	Somatic	0	47	0.00		0.5963777675123697	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	113	8.13	B2RBT1|B7Z2U6|Q86UD2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.P487S	ENST00000382254.1	37	c.1459	CCDS3890.1	5	.	.	.	.	.	.	.	.	.	.	G	28.3	4.908498	0.92107	.	.	ENSG00000154162	ENST00000504376;ENST00000382254;ENST00000522262	D;D;D	0.88124	-2.34;-2.34;-2.34	5.46	5.46	0.80206	Cadherin (4);Cadherin-like (1);	0.048062	0.85682	D	0.000000	D	0.96300	0.8793	H	0.97635	4.045	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.996	D	0.97382	0.9983	10	0.87932	D	0	.	19.6743	0.95924	0.0:0.0:1.0:0.0	.	447;487	B7Z2U6;P55289	.;CAD12_HUMAN	S	487;487;447	ENSP00000423577:P487S;ENSP00000371689:P487S;ENSP00000428786:P447S	ENSP00000371689:P487S	P	-	1	0	CDH12	21800900	1.000000	0.71417	0.999000	0.59377	0.999000	0.98932	9.386000	0.97228	2.733000	0.93635	0.637000	0.83480	CCA	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin		0.343	CDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH12	protein_coding	OTTHUMT00000207139.1	G	NM_004061	-		21765143	-1	no_errors	ENST00000382254	ensembl	human	known	74_37	missense	SNP	1.000	A
CUX1	1523	genome.wustl.edu	37	7	101844917	101844917	+	Frame_Shift_Del	DEL	C	C	-			TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr7:101844917delC	ENST00000292535.7	+	18	2378	c.2340delC	c.(2338-2340)aacfs	p.N780fs	CUX1_ENST00000550008.2_Frame_Shift_Del_p.N724fs|CUX1_ENST00000560541.1_Intron|CUX1_ENST00000546411.2_Frame_Shift_Del_p.N678fs|CUX1_ENST00000549414.2_Frame_Shift_Del_p.N758fs|CUX1_ENST00000360264.3_Frame_Shift_Del_p.N791fs|CUX1_ENST00000292538.4_Intron|CUX1_ENST00000393824.3_Intron|CUX1_ENST00000425244.2_Intron|CUX1_ENST00000556210.1_Frame_Shift_Del_p.N622fs|CUX1_ENST00000437600.4_Intron|CUX1_ENST00000547394.2_Intron	NM_181552.3	NP_853530.2	P39880	CUX1_HUMAN	cut-like homeobox 1	780					auditory receptor cell differentiation (GO:0042491)|kidney development (GO:0001822)|lung development (GO:0030324)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|retrograde transport, vesicle recycling within Golgi (GO:0000301)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(8)|lung(26)|ovary(7)|pancreas(1)|prostate(6)|skin(2)|stomach(1)|urinary_tract(5)	70						CTCTGCCGAACCCCCCGGCCC	0.667																																																	0								ENSG00000257923						59.0	68.0	65.0					7																	101844917		2203	4300	6503	CUX1	SO:0001589	frameshift_variant	0				HGNC	M74099	CCDS5720.1, CCDS5721.1, CCDS47672.1, CCDS56498.1, CCDS56499.1, CCDS56500.1, CCDS59071.1	7q22.1	2012-10-03	2007-11-07	2007-11-07	ENSG00000257923	ENSG00000257923		"""Homeoboxes / CUT class"""	2557	protein-coding gene	gene with protein product	"""golgi integral membrane protein 6"""	116896	"""cut (Drosophila)-like 1 (CCAAT displacement protein)"", ""cut-like 1, CCAAT displacement protein (Drosophila)"""	CUTL1		8468066, 9799793, 15004235	Standard	NM_001202543		Approved	CDP, CDP1, CUX, CUT, Clox, CDP/Cut, CDP/Cux, Cux/CDP, CASP, GOLIM6	uc003uyx.4	P39880	OTTHUMG00000157129	ENST00000292535.7:c.2340delC	7.37:g.101844917delC	ENSP00000292535:p.Asn780fs	Somatic	0	64	0.00		0.5963777675123697	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	25	10.71	B3KV79|J3KQV9|Q6NYH4|Q75LE5|Q75MT2|Q75MT3|Q86UJ7|Q9UEV5	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Hmoeo_CUT,pfam_Homeobox_dom,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,superfamily_LemA-like_dom,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Hmoeo_CUT	p.P793fs	ENST00000292535.7	37	c.2373	CCDS5721.1	7																																																																																			-	NULL		0.667	CUX1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	CUX1	protein_coding	OTTHUMT00000347535.1	C	NM_001913			101844917	+1	no_errors	ENST00000360264	ensembl	human	known	74_37	frame_shift_del	DEL	0.983	-
RRN3P2	653390	genome.wustl.edu	37	16	29088081	29088081	+	RNA	SNP	C	C	T	rs546386045	byFrequency	TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr16:29088081C>T	ENST00000564580.1	+	0	251							A6NIE6	RN3P2_HUMAN	RNA polymerase I transcription factor homolog (S. cerevisiae) pseudogene 2																		AAGTACAAAACGGTAAGAGGA	0.358													.|||	2	0.000399361	0.0	0.0029	5008	,	,		16793	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000103472																																			RRN3P2			0			-	HGNC			16p11.2	2011-12-02			ENSG00000103472	ENSG00000103472			37619	pseudogene	pseudogene							Standard	NR_003369		Approved		uc002dsf.4	A6NIE6			16.37:g.29088081C>T		Somatic	0	98	0.00		0.5963777675123697	3	40.00	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	41	99	29.29		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000564580.1	37	NULL		16	.	.	.	.	.	.	.	.	.	.	a	7.883	0.730580	0.15507	.	.	ENSG00000103472	ENST00000415221;ENST00000427965;ENST00000219758	.	.	.	1.4	0.231	0.15377	.	0.452778	0.20677	U	0.087729	T	0.38054	0.1026	.	.	.	.	.	.	.	.	.	.	.	.	T	0.39165	-0.9627	5	0.44086	T	0.13	.	3.2711	0.06882	0.5958:0.2388:0.1654:0.0	.	.	.	.	M	65	.	ENSP00000219758:T65M	T	+	2	0	AC009093.1	28995582	1.000000	0.71417	0.930000	0.37139	0.051000	0.14879	1.388000	0.34442	-0.398000	0.07679	-1.447000	0.01057	ACG	-	-		0.358	RRN3P2-001	KNOWN	basic	processed_transcript	RRN3P2	pseudogene	OTTHUMT00000433243.1	C	NR_003369	-		29088081	+1	no_errors	ENST00000427965	ensembl	human	known	74_37	rna	SNP	0.995	T
DDX58	23586	genome.wustl.edu	37	9	32500870	32500870	+	Silent	SNP	G	G	A			TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr9:32500870G>A	ENST00000379883.2	-	2	331	c.174C>T	c.(172-174)ctC>ctT	p.L58L	DDX58_ENST00000379882.1_Intron|DDX58_ENST00000545044.1_5'UTR|DDX58_ENST00000542096.1_5'UTR|DDX58_ENST00000379868.1_5'UTR	NM_014314.3	NP_055129.2	O95786	DDX58_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 58	58	CARD 1.				cytoplasmic pattern recognition receptor signaling pathway in response to virus (GO:0039528)|detection of virus (GO:0009597)|innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell migration (GO:0030334)|regulation of type III interferon production (GO:0034344)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|RIG-I signaling pathway (GO:0039529)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	ATP binding (GO:0005524)|double-stranded DNA binding (GO:0003690)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|identical protein binding (GO:0042802)|single-stranded RNA binding (GO:0003727)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|liver(1)|lung(9)|ovary(2)|pancreas(1)|prostate(1)	27			LUSC - Lung squamous cell carcinoma(29;0.00813)	GBM - Glioblastoma multiforme(74;0.00056)		ACAGGAACTTGAGAAAAAGTG	0.448																																																	0								ENSG00000107201						90.0	92.0	91.0					9																	32500870		2203	4300	6503	DDX58	SO:0001819	synonymous_variant	0			-	HGNC	AF038963	CCDS6526.1	9p12	2011-08-05			ENSG00000107201	ENSG00000107201		"""DEAD-boxes"""	19102	protein-coding gene	gene with protein product	"""RNA helicase RIG-I"", ""retinoic acid inducible gene I"""	609631				21690088	Standard	NM_014314		Approved	RIG-I, FLJ13599, DKFZp434J1111	uc003zra.3	O95786	OTTHUMG00000019746	ENST00000379883.2:c.174C>T	9.37:g.32500870G>A		Somatic	0	48	0.00		0.5963777675123697	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	65	18.75	A2RU81|Q5HYE1|Q5VYT1|Q9NT04	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_RIG-I_C-RD,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase/UvrB_dom,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_DEATH-like_dom,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.L58	ENST00000379883.2	37	c.174	CCDS6526.1	9																																																																																			-	superfamily_DEATH-like_dom		0.448	DDX58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX58	protein_coding	OTTHUMT00000052011.1	G	NM_014314	-		32500870	-1	no_errors	ENST00000379883	ensembl	human	known	74_37	silent	SNP	0.070	A
ACADVL	37	genome.wustl.edu	37	17	7123240	7123241	+	5'UTR	INS	-	-	GGGCGTGCAGGACGC	rs77051465|rs550196368|rs3835013|rs6145976|rs139223575|rs421019	byFrequency	TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr17:7123240_7123241insGGGCGTGCAGGACGC	ENST00000356839.5	+	0	116_117				DLG4_ENST00000302955.6_5'Flank|ACADVL_ENST00000543245.2_Intron|DLG4_ENST00000399510.2_5'Flank|ACADVL_ENST00000350303.5_5'UTR|DLG4_ENST00000485100.1_5'Flank|DLG4_ENST00000399506.2_5'Flank	NM_000018.3|NM_001270448.1	NP_000009.1|NP_001257377.1	P49748	ACADV_HUMAN	acyl-CoA dehydrogenase, very long chain						activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular lipid metabolic process (GO:0044255)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|energy derivation by oxidation of organic compounds (GO:0015980)|epithelial cell differentiation (GO:0030855)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA dehydrogenase (GO:0033539)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of fatty acid oxidation (GO:0046322)|regulation of cholesterol metabolic process (GO:0090181)|small molecule metabolic process (GO:0044281)|temperature homeostasis (GO:0001659)	cytoplasm (GO:0005737)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)|long-chain-acyl-CoA dehydrogenase activity (GO:0004466)			breast(2)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(2)|liver(2)|lung(1)|ovary(4)|skin(1)	21						CGCCAGGACGTGGGCGTGCAGG	0.713														2343	0.467851	0.2988	0.4769	5008	,	,		14818	0.4712		0.5736	False		,,,				2504	0.5777																0								ENSG00000072778		,,	1193,2759		290,613,1073					,,	-1.0	0.0		dbSNP_130	8	4084,3646		1352,1380,1133	no	utr-5,utr-5,utr-5	ACADVL,DLG4	NM_001365.3,NM_001033859.1,NM_000018.2	,,	1642,1993,2206	A1A1,A1R,RR		47.1669,30.1872,45.1721	,,	,,		5277,6405				ACADVL	SO:0001623	5_prime_UTR_variant	0				HGNC	BC012912	CCDS11090.1, CCDS42249.1, CCDS58509.1	17p13.1	2010-04-30	2010-04-30		ENSG00000072778	ENSG00000072778			92	protein-coding gene	gene with protein product		609575	"""acyl-Coenzyme A dehydrogenase, very long chain"""			8921384	Standard	NM_000018		Approved	VLCAD, LCACD, ACAD6	uc002gev.4	P49748	OTTHUMG00000102157	ENST00000356839.5:c.-63->GGGCGTGCAGGACGC	17.37:g.7123240_7123241insGGGCGTGCAGGACGC		Somatic	NA	NA	NA		0.5963777675123697	6	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B4DEB6|F5H2A9|O76056|Q8WUL0	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000356839.5	37	NULL	CCDS11090.1	17																																																																																			-	-		0.713	ACADVL-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	ACADVL	protein_coding	OTTHUMT00000220001.5	-	NM_000018			7123241	+1	no_errors	ENST00000577857	ensembl	human	known	74_37	rna	INS	0.000:0.000	GGGCGTGCAGGACGC
SDK2	54549	genome.wustl.edu	37	17	71415397	71415397	+	Silent	SNP	G	G	A	rs570731428		TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr17:71415397G>A	ENST00000392650.3	-	16	2094	c.2094C>T	c.(2092-2094)atC>atT	p.I698I	SDK2_ENST00000388726.3_Silent_p.I698I	NM_001144952.1	NP_001138424.1	Q58EX2	SDK2_HUMAN	sidekick cell adhesion molecule 2	698	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(15)|lung(31)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	86						GACCGCTGGCGATGACGTTCT	0.572																																																	0								ENSG00000069188						63.0	55.0	58.0					17																	71415397		2203	4300	6503	SDK2	SO:0001819	synonymous_variant	0			-	HGNC	AB040947	CCDS45769.1	17q21.31	2013-02-11	2011-12-09		ENSG00000069188	ENSG00000069188		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19308	protein-coding gene	gene with protein product		607217	"""sidekick homolog 2 (chicken)"""			12230981, 15213259	Standard	NM_001144952		Approved	FLJ10832, KIAA1514	uc010dfm.3	Q58EX2	OTTHUMG00000152726	ENST00000392650.3:c.2094C>T	17.37:g.71415397G>A		Somatic	0	51	0.00		0.5963777675123697	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	50	18.03	A6NMR8|C9JA57|Q86VY3|Q9NTD2|Q9NVB3|Q9P214	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.I698	ENST00000392650.3	37	c.2094	CCDS45769.1	17																																																																																			-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.572	SDK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SDK2	protein_coding	OTTHUMT00000327598.2	G	NM_019064	-		71415397	-1	no_errors	ENST00000392650	ensembl	human	known	74_37	silent	SNP	0.873	A
VAC14	55697	genome.wustl.edu	37	16	70765497	70765497	+	Missense_Mutation	SNP	G	G	T			TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr16:70765497G>T	ENST00000261776.5	-	14	1822	c.1562C>A	c.(1561-1563)cCc>cAc	p.P521H		NM_018052.3	NP_060522.3	Q08AM6	VAC14_HUMAN	Vac14 homolog (S. cerevisiae)	521					phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|regulation of lipid kinase activity (GO:0043550)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)|PAS complex (GO:0070772)	receptor activity (GO:0004872)			breast(2)|endometrium(2)|kidney(10)|large_intestine(1)|lung(10)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	33		Ovarian(137;0.0699)				ATTCATGGTGGGAGTTGAAGG	0.448																																																	0								ENSG00000103043						132.0	135.0	134.0					16																	70765497		2198	4300	6498	VAC14	SO:0001583	missense	0			-	HGNC	AK056433	CCDS10896.1	16q22.1	2010-03-23	2005-02-09		ENSG00000103043	ENSG00000103043			25507	protein-coding gene	gene with protein product		604632	"""Tax1 (human T-cell leukemia virus type I) binding protein 2"""	TAX1BP2		15542851, 12719380	Standard	NM_018052		Approved	FLJ10305, ArPIKfyve	uc002ezm.3	Q08AM6	OTTHUMG00000137583	ENST00000261776.5:c.1562C>A	16.37:g.70765497G>T	ENSP00000261776:p.Pro521His	Somatic	0	48	0.00		0.5963777675123697	31	3.12	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	28	12.50	B3KPJ5|B3KSM8|Q13174|Q6IA12|Q7L4Y1|Q9BW96|Q9H6V6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_VAC14_Fig4p-bd,pfam_HEAT,superfamily_ARM-type_fold	p.P521H	ENST00000261776.5	37	c.1562	CCDS10896.1	16	.	.	.	.	.	.	.	.	.	.	G	26.8	4.770534	0.90108	.	.	ENSG00000103043	ENST00000261776	T	0.67523	-0.27	5.43	5.43	0.79202	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.77377	0.4121	M	0.67953	2.075	0.80722	D	1	D	0.64830	0.994	P	0.55749	0.783	T	0.77086	-0.2718	10	0.46703	T	0.11	-32.7158	19.6058	0.95582	0.0:0.0:1.0:0.0	.	521	Q08AM6	VAC14_HUMAN	H	521	ENSP00000261776:P521H	ENSP00000261776:P521H	P	-	2	0	VAC14	69322998	1.000000	0.71417	0.995000	0.50966	0.992000	0.81027	9.254000	0.95512	2.722000	0.93159	0.655000	0.94253	CCC	-	superfamily_ARM-type_fold		0.448	VAC14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VAC14	protein_coding	OTTHUMT00000268973.3	G	NM_018052	-		70765497	-1	no_errors	ENST00000261776	ensembl	human	known	74_37	missense	SNP	1.000	T
AMPD3	272	genome.wustl.edu	37	11	10500123	10500123	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr11:10500123C>T	ENST00000396554.3	+	3	640	c.299C>T	c.(298-300)cCg>cTg	p.P100L	AMPD3_ENST00000444303.2_Intron	NM_000480.2	NP_000471.1	Q01432	AMPD3_HUMAN	adenosine monophosphate deaminase 3	91					ADP metabolic process (GO:0046031)|AMP catabolic process (GO:0006196)|ATP metabolic process (GO:0046034)|energy homeostasis (GO:0097009)|IMP salvage (GO:0032264)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	AMP deaminase activity (GO:0003876)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(12)|ovary(1)|prostate(3)|skin(1)	25				all cancers(16;1.14e-08)|Epithelial(150;2.83e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0291)		CTGCAAATGCCGCCACAGCAA	0.572																																																	0								ENSG00000133805						129.0	152.0	144.0					11																	10500123		2201	4294	6495	AMPD3	SO:0001583	missense	0			-	HGNC	M84722	CCDS7802.1, CCDS41617.1, CCDS44537.1, CCDS53601.1	11p15	2010-02-10	2010-02-10			ENSG00000133805	3.5.4.6		470	protein-coding gene	gene with protein product	"""erythrocyte-specific AMP deaminase"""	102772	"""adenosine monophosphate deaminase (isoform E)"""			1400401	Standard	NM_001172430		Approved		uc001min.1	Q01432		ENST00000396554.3:c.299C>T	11.37:g.10500123C>T	ENSP00000379802:p.Pro100Leu	Somatic	0	37	0.00		0.5963777675123697	0	100.00	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	43	24.56	A0AUX0|B7Z2S2|B7Z763|B7Z877	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_A/AMP_deaminase_dom,pirsf_AMP_deaminase,tigrfam_AMP_deaminase	p.P91L	ENST00000396554.3	37	c.272	CCDS7802.1	11	.	.	.	.	.	.	.	.	.	.	C	17.67	3.446950	0.63178	.	.	ENSG00000133805	ENST00000532250;ENST00000396554;ENST00000524866;ENST00000396553;ENST00000528723;ENST00000529507	T;T;T;T;T;T	0.62364	0.03;0.03;0.03;0.03;0.03;0.03	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.60418	0.2267	L	0.61218	1.895	0.80722	D	1	B;D;B	0.53462	0.061;0.96;0.061	B;B;B	0.40329	0.03;0.326;0.03	T	0.59611	-0.7422	10	0.17832	T	0.49	-21.3198	19.8628	0.96789	0.0:1.0:0.0:0.0	.	98;91;100	B7Z763;Q01432;A0AUX0	.;AMPD3_HUMAN;.	L	91;100;91;91;98;91	ENSP00000432707:P91L;ENSP00000379802:P100L;ENSP00000433284:P91L;ENSP00000379801:P91L;ENSP00000436987:P98L;ENSP00000431648:P91L	ENSP00000379801:P91L	P	+	2	0	AMPD3	10456699	1.000000	0.71417	0.964000	0.40570	0.972000	0.66771	5.710000	0.68392	2.697000	0.92050	0.643000	0.83706	CCG	-	pirsf_AMP_deaminase		0.572	AMPD3-001	PUTATIVE	basic|CCDS	protein_coding	AMPD3	protein_coding	OTTHUMT00000385783.2	C	NM_000480	-		10500123	+1	no_errors	ENST00000396553	ensembl	human	known	74_37	missense	SNP	1.000	T
BCL9L	283149	genome.wustl.edu	37	11	118771359	118771359	+	Silent	SNP	G	G	A			TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr11:118771359G>A	ENST00000334801.3	-	6	4057	c.3093C>T	c.(3091-3093)aaC>aaT	p.N1031N	BCL9L_ENST00000526143.1_5'UTR	NM_182557.2	NP_872363.1	Q86UU0	BCL9L_HUMAN	B-cell CLL/lymphoma 9-like	1031	Pro-rich.				canonical Wnt signaling pathway (GO:0060070)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell morphogenesis (GO:0022604)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	beta-catenin binding (GO:0008013)|transcription coactivator activity (GO:0003713)			NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(2)	56	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.103)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.66e-05)		TGGTGGAAGAGTTCATGTTGA	0.632																																																	0								ENSG00000186174						100.0	103.0	102.0					11																	118771359		2200	4295	6495	BCL9L	SO:0001819	synonymous_variant	0			-	HGNC	AB094091	CCDS8403.1	11q23.3	2012-06-06				ENSG00000186174			23688	protein-coding gene	gene with protein product		609004				12964048	Standard	NM_182557		Approved	DLNB11	uc001pug.3	Q86UU0		ENST00000334801.3:c.3093C>T	11.37:g.118771359G>A		Somatic	0	24	0.00		0.5963777675123697	0	100.00	5	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	7	68.18	A1A4C1|Q67FY1|Q6ZWJ0|Q6ZWK2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_BCL9_beta-catenin-bd_dom	p.N1031	ENST00000334801.3	37	c.3093	CCDS8403.1	11	.	.	.	.	.	.	.	.	.	.	G	5.029	0.190955	0.09547	.	.	ENSG00000186174	ENST00000530293	.	.	.	4.96	4.05	0.47172	.	.	.	.	.	T	0.59985	0.2234	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.57394	-0.7819	4	.	.	.	-9.8415	9.7427	0.40429	0.1567:0.0:0.8433:0.0	.	.	.	.	I	51	.	.	T	-	2	0	BCL9L	118276569	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.550000	0.53691	1.304000	0.44892	-0.140000	0.14226	ACT	-	NULL		0.632	BCL9L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCL9L	protein_coding	OTTHUMT00000389653.1	G	NM_182557	-		118771359	-1	no_errors	ENST00000334801	ensembl	human	known	74_37	silent	SNP	1.000	A
FLNC	2318	genome.wustl.edu	37	7	128490862	128490862	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr7:128490862G>A	ENST00000325888.8	+	33	5665	c.5404G>A	c.(5404-5406)Gtg>Atg	p.V1802M	RP11-309L24.2_ENST00000469965.1_RNA|FLNC_ENST00000346177.6_Missense_Mutation_p.V1769M	NM_001458.4	NP_001449.3	Q14315	FLNC_HUMAN	filamin C, gamma	1802					cell junction assembly (GO:0034329)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|cytoskeletal protein binding (GO:0008092)			biliary_tract(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(19)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(59)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	128						TGCAGGAGAGGTGCGGATGCC	0.627																																																	0								ENSG00000128591						70.0	75.0	73.0					7																	128490862		2151	4231	6382	FLNC	SO:0001583	missense	0			-	HGNC	AB208865	CCDS43644.1, CCDS47705.1	7q32-q35	2014-09-17	2009-07-23		ENSG00000128591	ENSG00000128591			3756	protein-coding gene	gene with protein product	"""actin binding protein 280"""	102565	"""filamin C, gamma (actin binding protein 280)"""	FLN2		7689010, 8088838	Standard	NM_001458		Approved	ABP-280, ABPL	uc003vnz.4	Q14315	OTTHUMG00000023627	ENST00000325888.8:c.5404G>A	7.37:g.128490862G>A	ENSP00000327145:p.Val1802Met	Somatic	0	44	0.00		0.5963777675123697	1	80.00	4	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	16	44.83	B2ZZ88|O95303|Q07985|Q9NS12|Q9NYE5|Q9UMR8|Q9Y503	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Filamin/ABP280_repeat-like,pfam_CH-domain,superfamily_CH-domain,superfamily_Ig_E-set,smart_CH-domain,smart_Filamin,pfscan_CH-domain,pfscan_Filamin/ABP280_repeat-like	p.V1802M	ENST00000325888.8	37	c.5404	CCDS43644.1	7	.	.	.	.	.	.	.	.	.	.	G	32	5.185368	0.94885	.	.	ENSG00000128591	ENST00000325888;ENST00000346177	T;T	0.56611	0.45;0.45	5.34	5.34	0.76211	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.80793	0.4691	M	0.93678	3.445	0.80722	D	1	D;D	0.76494	0.999;0.996	D;D	0.91635	0.999;0.984	D	0.86025	0.1509	10	0.87932	D	0	.	19.0452	0.93016	0.0:0.0:1.0:0.0	.	1769;1802	Q14315-2;Q14315	.;FLNC_HUMAN	M	1802;1769	ENSP00000327145:V1802M;ENSP00000344002:V1769M	ENSP00000327145:V1802M	V	+	1	0	FLNC	128278098	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.827000	0.99397	2.479000	0.83701	0.655000	0.94253	GTG	-	pfam_Filamin/ABP280_repeat-like,superfamily_Ig_E-set,smart_Filamin,pfscan_Filamin/ABP280_repeat-like		0.627	FLNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FLNC	protein_coding	OTTHUMT00000059948.3	G		-		128490862	+1	no_errors	ENST00000325888	ensembl	human	known	74_37	missense	SNP	1.000	A
IFNW1	3467	genome.wustl.edu	37	9	21141089	21141089	+	Missense_Mutation	SNP	C	C	T	rs201715468	byFrequency	TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr9:21141089C>T	ENST00000380229.2	-	1	1055	c.481G>A	c.(481-483)Gac>Aac	p.D161N		NM_002177.1	NP_002168.1	P05000	IFNW1_HUMAN	interferon, omega 1	161					adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|cell cycle arrest (GO:0007050)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|natural killer cell activation involved in immune response (GO:0002323)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|regulation of MHC class I biosynthetic process (GO:0045343)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|T cell activation involved in immune response (GO:0002286)	extracellular space (GO:0005615)	cytokine activity (GO:0005125)|cytokine receptor binding (GO:0005126)|type I interferon receptor binding (GO:0005132)			endometrium(1)|kidney(1)|lung(2)|ovary(1)	5				GBM - Glioblastoma multiforme(5;2.35e-185)|Lung(24;2.24e-22)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)		CAGGCACAGTCGCTGTATTTC	0.468																																																	0								ENSG00000177047						113.0	106.0	108.0					9																	21141089		2203	4300	6503	IFNW1	SO:0001583	missense	0			-	HGNC		CCDS6496.1	9p22	2010-12-10			ENSG00000177047	ENSG00000177047		"""Interferons"""	5448	protein-coding gene	gene with protein product	"""IFN-omega 1, interferon omega-1"""	147553				1385305	Standard	NM_002177		Approved		uc003zol.1	P05000	OTTHUMG00000019656	ENST00000380229.2:c.481G>A	9.37:g.21141089C>T	ENSP00000369578:p.Asp161Asn	Somatic	0	46	0.00		0.5963777675123697	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	65	16.67	Q13168|Q5U802|Q5VWD0|Q7M4P5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Interferon_alpha/beta/delta,superfamily_4_helix_cytokine-like_core,smart_Interferon_alpha/beta/delta,prints_Interferon_alpha/beta/delta	p.D161N	ENST00000380229.2	37	c.481	CCDS6496.1	9	.	.	.	.	.	.	.	.	.	.	C	19.06	3.753040	0.69648	.	.	ENSG00000177047	ENST00000380229	T	0.03413	3.94	4.66	1.53	0.23141	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	1.082620	0.06987	N	0.820864	T	0.08537	0.0212	M	0.64404	1.975	0.09310	N	1	P	0.41159	0.74	B	0.42798	0.398	T	0.43081	-0.9413	10	0.52906	T	0.07	.	13.3013	0.60326	0.0:0.4022:0.5978:0.0	.	161	P05000	IFNW1_HUMAN	N	161	ENSP00000369578:D161N	ENSP00000369578:D161N	D	-	1	0	IFNW1	21131089	0.000000	0.05858	0.078000	0.20375	0.752000	0.42762	-0.334000	0.07883	0.525000	0.28522	0.557000	0.71058	GAC	-	pfam_Interferon_alpha/beta/delta,superfamily_4_helix_cytokine-like_core,smart_Interferon_alpha/beta/delta,prints_Interferon_alpha/beta/delta		0.468	IFNW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFNW1	protein_coding	OTTHUMT00000051885.1	C	NM_002177	-		21141089	-1	no_errors	ENST00000380229	ensembl	human	known	74_37	missense	SNP	0.019	T
HAVCR1	26762	genome.wustl.edu	37	5	156482233	156482233	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr5:156482233C>T	ENST00000339252.3	-	2	890	c.358G>A	c.(358-360)Gta>Ata	p.V120I	HAVCR1_ENST00000425854.1_Missense_Mutation_p.V120I|HAVCR1_ENST00000522693.1_Missense_Mutation_p.V120I|HAVCR1_ENST00000523175.1_Missense_Mutation_p.V120I|HAVCR1_ENST00000544197.1_Missense_Mutation_p.V120I	NM_012206.2	NP_036338.2	Q96D42	HAVR1_HUMAN	hepatitis A virus cellular receptor 1	0	Ig-like V-type.				viral process (GO:0016032)	integral component of membrane (GO:0016021)	virus receptor activity (GO:0001618)			endometrium(3)|large_intestine(2)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.0999)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TCCAATGATACGGTGATTTTC	0.378																																																	0								ENSG00000113249						80.0	69.0	73.0					5																	156482233		1929	4148	6077	HAVCR1	SO:0001583	missense	0			-	HGNC	AF043724	CCDS43392.1	5q33.2	2014-01-14			ENSG00000113249	ENSG00000113249		"""Immunoglobulin superfamily / V-set domain containing"""	17866	protein-coding gene	gene with protein product	"""T-cell immunoglobulin mucin family member 1"""	606518				9658108, 11725301	Standard	NM_012206		Approved	HAVCR-1, TIM-1, TIM1, HAVCR, TIMD1	uc021ygj.1	Q96D42	OTTHUMG00000163466	ENST00000339252.3:c.358G>A	5.37:g.156482233C>T	ENSP00000344844:p.Val120Ile	Somatic	0	44	0.00		0.5963777675123697	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	36	20.00	O43656	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like_dom	p.V120I	ENST00000339252.3	37	c.358	CCDS43392.1	5	.	.	.	.	.	.	.	.	.	.	C	2.559	-0.302386	0.05495	.	.	ENSG00000113249	ENST00000522693;ENST00000523175;ENST00000339252;ENST00000425854;ENST00000544197;ENST00000518745	T;T;T;T;T;T	0.47528	0.84;0.84;0.84;0.84;0.84;0.84	5.78	-11.6	0.00059	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.824093	0.10571	N	0.659122	T	0.12347	0.0300	N	0.03917	-0.325	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.12734	-1.0536	10	0.02654	T	1	-1.3323	5.4762	0.16697	0.1391:0.1871:0.0821:0.5917	.	120;120	F1CME6;Q96D42	.;HAVR1_HUMAN	I	120	ENSP00000428524:V120I;ENSP00000427898:V120I;ENSP00000344844:V120I;ENSP00000403333:V120I;ENSP00000440258:V120I;ENSP00000428422:V120I	ENSP00000344844:V120I	V	-	1	0	HAVCR1	156414811	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-7.070000	0.00045	-2.429000	0.00558	-1.188000	0.01700	GTA	-	smart_Ig_sub,pfscan_Ig-like_dom		0.378	HAVCR1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	HAVCR1	protein_coding	OTTHUMT00000373698.1	C		-		156482233	-1	no_errors	ENST00000425854	ensembl	human	known	74_37	missense	SNP	0.000	T
AGBL5	60509	genome.wustl.edu	37	2	27278614	27278614	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr2:27278614G>A	ENST00000360131.4	+	7	1132	c.973G>A	c.(973-975)Gcc>Acc	p.A325T	RP11-503P10.1_ENST00000607407.1_RNA|AGBL5_ENST00000323064.8_Missense_Mutation_p.A325T	NM_021831.5	NP_068603.4	Q8NDL9	CBPC5_HUMAN	ATP/GTP binding protein-like 5	325					protein branching point deglutamylation (GO:0035611)|protein deglutamylation (GO:0035608)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(8)|ovary(3)|pancreas(1)|prostate(2)|skin(1)	28	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCTGCACCCGGCCATCTATGG	0.557																																																	0								ENSG00000084693						103.0	92.0	96.0					2																	27278614		2203	4300	6503	AGBL5	SO:0001583	missense	0			-	HGNC	BC007415	CCDS1732.3, CCDS42665.1	2p23.3	2014-06-23			ENSG00000084693	ENSG00000084693			26147	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 5"""	615900				24022482	Standard	NM_001035507		Approved	FLJ21839, CCP5	uc002rie.3	Q8NDL9	OTTHUMG00000128406	ENST00000360131.4:c.973G>A	2.37:g.27278614G>A	ENSP00000353249:p.Ala325Thr	Somatic	0	20	0.00		0.5963777675123697	14	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	15	21.05	A2VDI7|B7WPG9|B7Z7I7|D6W548|Q53SW0|Q53SZ0|Q96IK8|Q9H6V0|Q9H8P8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_M14	p.A325T	ENST00000360131.4	37	c.973	CCDS1732.3	2	.	.	.	.	.	.	.	.	.	.	G	16.43	3.122436	0.56613	.	.	ENSG00000084693	ENST00000323064;ENST00000360131	T;T	0.12255	2.71;2.7	5.88	5.88	0.94601	.	0.094664	0.85682	D	0.000000	T	0.10937	0.0267	N	0.03967	-0.31	0.43014	D	0.994559	D;P;P	0.60160	0.987;0.939;0.939	P;P;P	0.58660	0.843;0.625;0.625	T	0.16600	-1.0397	10	0.02654	T	1	-27.3619	13.9076	0.63845	0.0:0.0:0.8476:0.1524	.	325;325;325	Q8NDL9;Q8NDL9-3;Q8NDL9-2	CBPC5_HUMAN;.;.	T	325	ENSP00000323681:A325T;ENSP00000353249:A325T	ENSP00000323681:A325T	A	+	1	0	AGBL5	27132118	1.000000	0.71417	0.970000	0.41538	0.717000	0.41224	6.575000	0.74018	2.791000	0.96007	0.491000	0.48974	GCC	-	NULL		0.557	AGBL5-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AGBL5	protein_coding	OTTHUMT00000309033.1	G	NM_021831	-		27278614	+1	no_errors	ENST00000360131	ensembl	human	known	74_37	missense	SNP	0.994	A
PAFAH1B3	5050	genome.wustl.edu	37	19	42804136	42804136	+	Missense_Mutation	SNP	G	G	A	rs200814337		TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr19:42804136G>A	ENST00000262890.3	-	4	655	c.394C>T	c.(394-396)Cgg>Tgg	p.R132W	PRR19_ENST00000341747.3_5'Flank|PRR19_ENST00000598490.1_5'Flank|PAFAH1B3_ENST00000538771.1_Missense_Mutation_p.R132W	NM_002573.3	NP_002564.1	Q15102	PA1B3_HUMAN	platelet-activating factor acetylhydrolase 1b, catalytic subunit 3 (29kDa)	132					brain development (GO:0007420)|lipid catabolic process (GO:0016042)|lipid metabolic process (GO:0006629)|nervous system development (GO:0007399)|spermatogenesis (GO:0007283)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	1-alkyl-2-acetylglycerophosphocholine esterase activity (GO:0003847)			breast(1)|large_intestine(2)|ovary(1)	4		Prostate(69;0.0704)				ACCACAACCCGGGCCTGGGGC	0.592																																																	0								ENSG00000079462						124.0	121.0	122.0					19																	42804136		2203	4300	6503	PAFAH1B3	SO:0001583	missense	0			-	HGNC	D63391	CCDS12602.1	19q13.1	2011-10-24	2010-02-10			ENSG00000079462			8576	protein-coding gene	gene with protein product	"""PAF-AH1b alpha 1 subunit"""	603074	"""platelet-activating factor acetylhydrolase, isoform Ib, gamma subunit (29kD)"", ""platelet-activating factor acetylhydrolase, isoform Ib, gamma subunit 29kDa"", ""platelet-activating factor acetylhydrolase, isoform Ib, subunit 3 (29kDa)"""			7669037	Standard	NM_002573		Approved		uc010xwj.1	Q15102		ENST00000262890.3:c.394C>T	19.37:g.42804136G>A	ENSP00000262890:p.Arg132Trp	Somatic	0	58	0.00		0.5963777675123697	35	20.45	9	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	33	19.51	Q53X88	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.R132W	ENST00000262890.3	37	c.394	CCDS12602.1	19	.	.	.	.	.	.	.	.	.	.	G	17.91	3.504974	0.64410	.	.	ENSG00000079462	ENST00000538771;ENST00000262890	T;T	0.48201	0.82;0.82	5.59	5.59	0.84812	Esterase, SGNH hydrolase-type (1);Esterase, SGNH hydrolase-type, subgroup (1);	0.253571	0.40302	N	0.001122	T	0.54838	0.1883	L	0.43923	1.385	0.34997	D	0.75558	D	0.76494	0.999	P	0.58620	0.842	T	0.66240	-0.5973	10	0.62326	D	0.03	-23.6663	12.078	0.53655	0.0:0.0:0.8281:0.1719	.	132	Q15102	PA1B3_HUMAN	W	132	ENSP00000444935:R132W;ENSP00000262890:R132W	ENSP00000262890:R132W	R	-	1	2	PAFAH1B3	47495976	0.966000	0.33281	1.000000	0.80357	0.986000	0.74619	1.211000	0.32382	2.622000	0.88805	0.563000	0.77884	CGG	-	NULL		0.592	PAFAH1B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAFAH1B3	protein_coding	OTTHUMT00000463726.1	G	NM_002573	rs200814337		42804136	-1	no_errors	ENST00000262890	ensembl	human	known	74_37	missense	SNP	1.000	A
POLQ	10721	genome.wustl.edu	37	3	121200587	121200587	+	Missense_Mutation	SNP	G	G	T			TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr3:121200587G>T	ENST00000264233.5	-	19	6171	c.6043C>A	c.(6043-6045)Cat>Aat	p.H2015N		NM_199420.3	NP_955452.3	O75417	DPOLQ_HUMAN	polymerase (DNA directed), theta	2015					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|single-stranded DNA-dependent ATPase activity (GO:0043142)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(55)|ovary(5)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	120				GBM - Glioblastoma multiforme(114;0.0915)		GGAAGCTCATGAGGAAGAAAA	0.478								DNA polymerases (catalytic subunits)																													Pancreas(152;907 1925 26081 31236 36904)												0								ENSG00000051341						74.0	74.0	74.0					3																	121200587		2203	4300	6503	POLQ	SO:0001583	missense	0			-	HGNC	AF052573	CCDS33833.1	3q13.3	2012-05-18			ENSG00000051341	ENSG00000051341	2.7.7.7	"""DNA polymerases"""	9186	protein-coding gene	gene with protein product		604419				10395804	Standard	NM_199420		Approved	POLH	uc003eee.4	O75417	OTTHUMG00000159396	ENST00000264233.5:c.6043C>A	3.37:g.121200587G>T	ENSP00000264233:p.His2015Asn	Somatic	0	32	0.00		0.5963777675123697	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	27	12.90	O95160|Q6VMB5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DNA-dir_DNA_pol_A_palm_dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_RNaseH-like_dom,smart_Helicase_ATP-bd,smart_Helicase_C,smart_DNA-dir_DNA_pol_A_palm_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,prints_DNA_polymerase_A	p.H2015N	ENST00000264233.5	37	c.6043	CCDS33833.1	3	.	.	.	.	.	.	.	.	.	.	G	12.88	2.070357	0.36566	.	.	ENSG00000051341	ENST00000543272;ENST00000264233;ENST00000393672	T	0.22945	1.93	5.17	2.36	0.29203	Ribonuclease H-like (1);	0.622419	0.17637	N	0.167147	T	0.14227	0.0344	L	0.51422	1.61	0.23916	N	0.996479	P;B	0.38922	0.651;0.066	B;B	0.27608	0.081;0.012	T	0.17561	-1.0365	10	0.26408	T	0.33	.	1.3278	0.02129	0.2293:0.2487:0.378:0.144	.	2015;1187	O75417;O75417-2	DPOLQ_HUMAN;.	N	1638;2015;2151	ENSP00000264233:H2015N	ENSP00000264233:H2015N	H	-	1	0	POLQ	122683277	0.981000	0.34729	0.995000	0.50966	0.998000	0.95712	0.760000	0.26475	0.325000	0.23359	0.650000	0.86243	CAT	-	superfamily_RNaseH-like_dom		0.478	POLQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLQ	protein_coding	OTTHUMT00000355097.1	G	NM_199420	-		121200587	-1	no_errors	ENST00000264233	ensembl	human	known	74_37	missense	SNP	0.914	T
ZNF358	140467	genome.wustl.edu	37	19	7584581	7584581	+	Silent	SNP	C	C	T			TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr19:7584581C>T	ENST00000597229.1	+	2	623	c.453C>T	c.(451-453)ttC>ttT	p.F151F	CTD-2207O23.11_ENST00000602083.1_RNA|MCOLN1_ENST00000264079.6_5'Flank|ZNF358_ENST00000394341.2_Silent_p.F151F	NM_018083.4	NP_060553.4	Q9NW07	ZN358_HUMAN	zinc finger protein 358	151					embryonic forelimb morphogenesis (GO:0035115)|neural tube development (GO:0021915)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|kidney(1)|lung(1)|skin(2)	8						cccggcccTTCTCCTGCCCGG	0.741																																																	0								ENSG00000198816						4.0	7.0	6.0					19																	7584581		1787	3545	5332	ZNF358	SO:0001819	synonymous_variant	0			-	HGNC	AK001252	CCDS32890.2	19p13.2	2013-01-08			ENSG00000198816	ENSG00000198816		"""Zinc fingers, C2H2-type"""	16838	protein-coding gene	gene with protein product							Standard	NM_018083		Approved	FLJ10390, ZFEND	uc002mgn.2	Q9NW07		ENST00000597229.1:c.453C>T	19.37:g.7584581C>T		Somatic	0	22	0.00		0.5963777675123697	49	31.94	23	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	31	20.51	Q9BTM7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.F151	ENST00000597229.1	37	c.453	CCDS32890.2	19																																																																																			-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.741	ZNF358-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF358	protein_coding	OTTHUMT00000316747.1	C		-		7584581	+1	no_errors	ENST00000394341	ensembl	human	known	74_37	silent	SNP	1.000	T
RP11-67H24.2	0	genome.wustl.edu	37	16	32822096	32822096	+	lincRNA	SNP	C	C	A			TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr16:32822096C>A	ENST00000569859.1	+	0	297																											CTCGCGCAGCCCACCCCCACC	0.622																																																	0								ENSG00000260158																																			RP11-67H24.2			0			-	Clone_based_vega_gene																													16.37:g.32822096C>A		Somatic	0	10	0.00		0.5963777675123697	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	14	46.15		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000569859.1	37	NULL		16																																																																																			-	-		0.622	RP11-67H24.2-001	KNOWN	basic	lincRNA	ENSG00000260158	lincRNA	OTTHUMT00000432377.1	C		-		32822096	+1	no_errors	ENST00000569859	ensembl	human	known	74_37	rna	SNP	0.676	A
CCL20	6364	genome.wustl.edu	37	2	228680154	228680155	+	Intron	DEL	TT	TT	-	rs34834265		TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	TT	TT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr2:228680154_228680155delTT	ENST00000358813.4	+	2	134				CCL20_ENST00000409189.3_Intron|CCL20_ENST00000473642.1_3'UTR			P78556	CCL20_HUMAN	chemokine (C-C motif) ligand 20						cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|chemokinesis (GO:0042466)|chemotaxis (GO:0006935)|defense response to bacterium (GO:0042742)|immune response (GO:0006955)|inflammatory response (GO:0006954)|positive regulation of T cell migration (GO:2000406)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	chemokine activity (GO:0008009)			cervix(1)|lung(2)	3		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;7.3e-11)|all cancers(144;4.13e-08)|Lung(261;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.0115)		TACCTTTCACTTTTTTTTTTTT	0.366																																																	0								ENSG00000115009																																			CCL20	SO:0001627	intron_variant	0				HGNC	D86955	CCDS2469.1, CCDS46536.1	2q36.3	2013-02-25	2002-08-22	2002-08-23	ENSG00000115009	ENSG00000115009		"""Chemokine ligands"", ""Endogenous ligands"""	10619	protein-coding gene	gene with protein product		601960	"""small inducible cytokine subfamily A (Cys-Cys), member 20"""	SCYA20		9038201, 11352563	Standard	NM_004591		Approved	LARC, MIP-3a, exodus-1, ST38, CKb4	uc002vpl.2	P78556	OTTHUMG00000133189	ENST00000358813.4:c.77-15TT>-	2.37:g.228680164_228680165delTT		Somatic	0	20	0.00		0.5963777675123697	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	23	11.54	Q53S51|Q99664	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000358813.4	37	NULL	CCDS2469.1	2																																																																																			-	-		0.366	CCL20-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCL20	protein_coding	OTTHUMT00000331641.1	TT	NM_004591			228680155	+1	no_errors	ENST00000473642	ensembl	human	known	74_37	rna	DEL	0.010:0.011	-
TMC1	117531	genome.wustl.edu	37	9	75451136	75451137	+	3'UTR	INS	-	-	T	rs71495343|rs78220845		TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr9:75451136_75451137insT	ENST00000297784.5	+	0	3070_3071				TMC1_ENST00000340019.3_3'UTR|TMC1_ENST00000486417.1_3'UTR	NM_138691.2	NP_619636.2	Q8TDI8	TMC1_HUMAN	transmembrane channel-like 1						auditory receptor cell development (GO:0060117)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|vestibular reflex (GO:0060005)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|stereocilium bundle tip (GO:0032426)	voltage-gated calcium channel activity (GO:0005245)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(21)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	36						CATTTCGTGACTTTTTTTTTTT	0.356																																					Pancreas(75;173 1345 14232 34245 43413)												0								ENSG00000165091																																			TMC1	SO:0001624	3_prime_UTR_variant	0				HGNC	AF417578	CCDS6643.1	9q21	2014-01-28			ENSG00000165091	ENSG00000165091			16513	protein-coding gene	gene with protein product		606706	"""transmembrane, cochlear expressed, 1"""	DFNA36, DFNB7, DFNB11		11850618, 11850623	Standard	NM_138691		Approved		uc004aiz.1	Q8TDI8	OTTHUMG00000020014	ENST00000297784.5:c.*248->T	9.37:g.75451147_75451147dupT		Somatic	0	10	0.00		0.5963777675123697	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	18	18.18	A8MVZ2|B1AM91	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000297784.5	37	NULL	CCDS6643.1	9																																																																																			-	-		0.356	TMC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMC1	protein_coding	OTTHUMT00000052655.1	-				75451137	+1	no_errors	ENST00000486417	ensembl	human	known	74_37	rna	INS	0.000:0.000	T
TP53	7157	genome.wustl.edu	37	17	7577046	7577046	+	Nonsense_Mutation	SNP	C	C	A	rs201744589		TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr17:7577046C>A	ENST00000269305.4	-	8	1081	c.892G>T	c.(892-894)Gag>Tag	p.E298*	TP53_ENST00000413465.2_Intron|TP53_ENST00000420246.2_Nonsense_Mutation_p.E298*|TP53_ENST00000455263.2_Nonsense_Mutation_p.E298*|TP53_ENST00000359597.4_Nonsense_Mutation_p.E298*|TP53_ENST00000445888.2_Nonsense_Mutation_p.E298*|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	298	Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		E -> A (in a sporadic cancer; somatic mutation).|E -> D (in sporadic cancers; somatic mutation).|E -> K (in sporadic cancers; somatic mutation).|E -> Q (in sporadic cancers; somatic mutation).|E -> V (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.E298*(49)|p.0?(8)|p.?(2)|p.E298K(1)|p.L299fs*2(1)|p.L265_K305del41(1)|p.E298fs*53(1)|p.G293fs*1(1)|p.E298Q(1)|p.E298_P301delELPP(1)|p.H296_S303delHHELPPGS(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGGGGCAGCTCGTGGTGAGGC	0.567		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	67	Substitution - Nonsense(49)|Whole gene deletion(8)|Deletion - In frame(3)|Unknown(2)|Deletion - Frameshift(2)|Substitution - Missense(2)|Insertion - Frameshift(1)	lung(21)|upper_aerodigestive_tract(13)|breast(6)|bone(5)|haematopoietic_and_lymphoid_tissue(4)|urinary_tract(4)|central_nervous_system(2)|oesophagus(2)|ovary(2)|pancreas(2)|liver(2)|large_intestine(1)|stomach(1)|salivary_gland(1)|skin(1)	GRCh37	CM031387	TP53	M		ENSG00000141510						110.0	96.0	101.0					17																	7577046		2203	4300	6503	TP53	SO:0001587	stop_gained	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	-	HGNC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.892G>T	17.37:g.7577046C>A	ENSP00000269305:p.Glu298*	Somatic	0	62	0.00		0.5963777675123697	11	42.11	8	WXS	Illumina HiSeq 2500	Phase_IV	tier1	51	22	68.92	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.E298*	ENST00000269305.4	37	c.892	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	18.34	3.603544	0.66445	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	.	.	.	5.26	-4.03	0.04021	.	0.553557	0.18174	N	0.149346	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.25106	T	0.35	-12.8318	5.9489	0.19234	0.0:0.2155:0.4162:0.3682	.	.	.	.	X	298;298;298;298;298;287;166	.	ENSP00000269305:E298X	E	-	1	0	TP53	7517771	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.837000	0.04377	-0.441000	0.07201	-0.218000	0.12543	GAG	-	NULL		0.567	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	C	NM_000546	-		7577046	-1	no_errors	ENST00000269305	ensembl	human	known	74_37	nonsense	SNP	0.001	A
PAPSS2	9060	genome.wustl.edu	37	10	89419638	89419639	+	5'UTR	INS	-	-	GCT	rs540045493|rs368634218|rs540138599	byFrequency	TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr10:89419638_89419639insGCT	ENST00000361175.4	+	0	269_270				RP11-57C13.6_ENST00000438082.1_lincRNA|RP11-57C13.3_ENST00000354527.2_RNA|PAPSS2_ENST00000456849.1_5'UTR|PAPSS2_ENST00000427144.2_5'Flank	NM_004670.3	NP_004661.2	O95340	PAPS2_HUMAN	3'-phosphoadenosine 5'-phosphosulfate synthase 2						3'-phosphoadenosine 5'-phosphosulfate biosynthetic process (GO:0050428)|3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|blood coagulation (GO:0007596)|bone development (GO:0060348)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)|sulfate assimilation (GO:0000103)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	adenylylsulfate kinase activity (GO:0004020)|ATP binding (GO:0005524)|nucleotidyltransferase activity (GO:0016779)|sulfate adenylyltransferase (ATP) activity (GO:0004781)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|skin(1)|stomach(1)	20		Melanoma(5;0.019)|Colorectal(252;0.123)		UCEC - Uterine corpus endometrioid carcinoma (6;0.00164)|Colorectal(12;0.000323)|COAD - Colon adenocarcinoma(12;0.00124)		GTCCGGCAgccgctgctgctgc	0.708														1002	0.20008	0.2852	0.1628	5008	,	,		8101	0.0585		0.2435	False		,,,				2504	0.2127																0								ENSG00000196566																																			RP11-57C13.3	SO:0001623	5_prime_UTR_variant	0				Clone_based_vega_gene	AF091242	CCDS7385.1, CCDS44453.1	10q24	2008-02-07			ENSG00000198682	ENSG00000198682	2.7.7.4, 2.7.1.25		8604	protein-coding gene	gene with protein product		603005				9771708	Standard	NM_004670		Approved	ATPSK2	uc001kex.3	O95340	OTTHUMG00000018683	ENST00000361175.4:c.-100->GCT	10.37:g.89419645_89419647dupGCT		Somatic	0	13	0.00		0.5963777675123697	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	5	50.00	Q9BZL2|Q9P0G6|Q9UHM1|Q9UKD3|Q9UP30	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000361175.4	37	NULL	CCDS7385.1	10																																																																																			-	-		0.708	PAPSS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000196566	protein_coding	OTTHUMT00000049229.1	-				89419639	-1	no_errors	ENST00000354527	ensembl	human	known	74_37	rna	INS	0.000:0.000	GCT
ICE1	23379	genome.wustl.edu	37	5	5460964	5460964	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr5:5460964G>A	ENST00000296564.7	+	13	1739	c.1517G>A	c.(1516-1518)cGa>cAa	p.R506Q		NM_015325.2	NP_056140.1	Q9Y2F5	ICE1_HUMAN		506					positive regulation of intracellular protein transport (GO:0090316)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|snRNA transcription from RNA polymerase III promoter (GO:0042796)	Cajal body (GO:0015030)|histone locus body (GO:0035363)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)	35						AAACTCACTCGAGGTCTATGC	0.448																																																	0								ENSG00000164151						102.0	108.0	106.0					5																	5460964		1978	4143	6121	KIAA0947	SO:0001583	missense	0			-	HGNC																												ENST00000296564.7:c.1517G>A	5.37:g.5460964G>A	ENSP00000296564:p.Arg506Gln	Somatic	0	31	0.00		0.5963777675123697	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	55	15.38	Q68DE1|Q6ZT40|Q7L587|Q7Z3A9|Q9NTH9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_Vitellinogen_superhlx	p.R506Q	ENST00000296564.7	37	c.1517	CCDS47187.1	5	.	.	.	.	.	.	.	.	.	.	G	8.538	0.872585	0.17322	.	.	ENSG00000164151	ENST00000296564	T	0.45668	0.89	4.64	1.83	0.25207	.	2.348000	0.01721	N	0.028276	T	0.31765	0.0807	L	0.27053	0.805	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.13683	-1.0500	10	0.22706	T	0.39	-4.1291	7.2811	0.26312	0.3057:0.0:0.6943:0.0	.	506	Q9Y2F5	K0947_HUMAN	Q	506	ENSP00000296564:R506Q	ENSP00000296564:R506Q	R	+	2	0	KIAA0947	5513964	0.000000	0.05858	0.000000	0.03702	0.016000	0.09150	0.233000	0.17911	0.501000	0.28013	-0.680000	0.03767	CGA	-	NULL		0.448	KIAA0947-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0947	protein_coding	OTTHUMT00000365575.1	G		-		5460964	+1	no_errors	ENST00000296564	ensembl	human	known	74_37	missense	SNP	0.000	A
ARHGAP32	9743	genome.wustl.edu	37	11	128934794	128934794	+	Missense_Mutation	SNP	C	C	T	rs377461049		TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr11:128934794C>T	ENST00000310343.9	-	7	661	c.662G>A	c.(661-663)cGc>cAc	p.R221H	ARHGAP32_ENST00000524655.1_Missense_Mutation_p.R147H	NM_001142685.1	NP_001136157.1	A7KAX9	RHG32_HUMAN	Rho GTPase activating protein 32	221	PX; atypical.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell projection (GO:0042995)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)|phosphatidylinositol binding (GO:0035091)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(28)|ovary(3)|prostate(6)|urinary_tract(3)	60						AGCTGAAAGGCGTGACAGGTA	0.423																																																	0								ENSG00000134909	C	HIS/ARG	0,3132		0,0,1566	49.0	45.0	46.0		662	5.6	1.0	11		46	1,7153		0,1,3576	no	missense	ARHGAP32	NM_001142685.1	29	0,1,5142	TT,TC,CC		0.014,0.0,0.0097	probably-damaging	221/2088	128934794	1,10285	1566	3577	5143	ARHGAP32	SO:0001583	missense	0			-	HGNC	AB018255	CCDS31718.1, CCDS44769.1	11q24.3	2011-06-29			ENSG00000134909	ENSG00000134909		"""Rho GTPase activating proteins"""	17399	protein-coding gene	gene with protein product		608541				12446789, 12819203, 17663722	Standard	NM_014715		Approved	GRIT, KIAA0712, MGC1892, RICS, GC-GAP	uc009zcp.3	A7KAX9	OTTHUMG00000165774	ENST00000310343.9:c.662G>A	11.37:g.128934794C>T	ENSP00000310561:p.Arg221His	Somatic	0	62	0.00		0.5963777675123697	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	52	16.13	I7H0B0|O94820|Q86YL6|Q8IUG4|Q9BWG3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RhoGAP_dom,pfam_SH3_domain,pfam_SH3_2,pfam_Phox,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,superfamily_Phox,smart_SH3_domain,smart_RhoGAP_dom,pfscan_SH3_domain,pfscan_RhoGAP_dom	p.R221H	ENST00000310343.9	37	c.662	CCDS44769.1	11	.	.	.	.	.	.	.	.	.	.	C	29.7	5.024272	0.93462	0.0	1.4E-4	ENSG00000134909	ENST00000310343;ENST00000524655;ENST00000457677	T;T	0.42900	0.96;0.96	5.58	5.58	0.84498	Phox homologous domain (3);	.	.	.	.	T	0.68192	0.2974	M	0.82323	2.585	0.80722	D	1	D;D;D	0.89917	0.998;1.0;1.0	D;D;P	0.69307	0.963;0.963;0.879	T	0.72704	-0.4213	9	0.87932	D	0	.	18.3254	0.90252	0.0:1.0:0.0:0.0	.	155;221;39	Q86T64;A7KAX9;Q86UT2	.;RHG32_HUMAN;.	H	221;147;155	ENSP00000310561:R221H;ENSP00000432468:R147H	ENSP00000310561:R221H	R	-	2	0	ARHGAP32	128440004	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	5.621000	0.67743	2.631000	0.89168	0.591000	0.81541	CGC	-	pfam_Phox,superfamily_Phox		0.423	ARHGAP32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP32	protein_coding	OTTHUMT00000386151.3	C	NM_014715	-		128934794	-1	no_errors	ENST00000310343	ensembl	human	known	74_37	missense	SNP	1.000	T
SLC4A9	83697	genome.wustl.edu	37	5	139751126	139751126	+	Missense_Mutation	SNP	C	C	A	rs370347102		TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr5:139751126C>A	ENST00000230993.6	+	19	2694	c.2659C>A	c.(2659-2661)Ctc>Atc	p.L887I	SLC4A9_ENST00000507527.1_Missense_Mutation_p.L887I|SLC4A9_ENST00000506545.1_Missense_Mutation_p.L800I|CTC-329D1.2_ENST00000507521.1_RNA|SLC4A9_ENST00000506757.2_Missense_Mutation_p.L863I|SLC4A9_ENST00000432095.2_Missense_Mutation_p.L849I	NM_001258428.1	NP_001245357.1	Q96Q91	B3A4_HUMAN	solute carrier family 4, sodium bicarbonate cotransporter, member 9	887	Membrane (anion exchange).				bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)			endometrium(4)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)	14			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAGGGTCCACCTCTTCACAGC	0.547																																																	0								ENSG00000113073						145.0	148.0	147.0					5																	139751126		2072	4229	6301	SLC4A9	SO:0001583	missense	0			-	HGNC	AF313465	CCDS47278.1, CCDS58973.1, CCDS58974.1, CCDS58975.1	5q31.3	2013-05-22			ENSG00000113073	ENSG00000113073		"""Solute carriers"""	11035	protein-coding gene	gene with protein product		610207				11305939	Standard	NM_031467		Approved	AE4	uc003lfk.2	Q96Q91	OTTHUMG00000163352	ENST00000230993.6:c.2659C>A	5.37:g.139751126C>A	ENSP00000230993:p.Leu887Ile	Somatic	0	27	0.00		0.5963777675123697	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	25	19.35	B7ZL63|D3DQD4|D3DQD5|D3DQD6|E9PDK1|Q96RM5|Q9BXF2|Q9BXN3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_HCO3_transpt_C,pfam_Band3_cytoplasmic_dom,superfamily_PTrfase/Anion_transptr,prints_HCO3_transpt_euk,prints_Na/HCO3_transpt,tigrfam_HCO3_transpt_euk	p.L887I	ENST00000230993.6	37	c.2659	CCDS58973.1	5	.	.	.	.	.	.	.	.	.	.	C	19.49	3.836922	0.71373	.	.	ENSG00000113073	ENST00000230993;ENST00000506757;ENST00000432095;ENST00000506545;ENST00000507527	D;D;D;D;D	0.81996	-1.56;-1.56;-1.56;-1.56;-1.56	5.09	4.22	0.49857	Bicarbonate transporter, C-terminal (1);	0.000000	0.51477	D	0.000086	D	0.88934	0.6572	M	0.71206	2.165	0.58432	D	0.99999	P;D;D;D	0.89917	0.919;1.0;1.0;1.0	P;D;D;D	0.87578	0.681;0.998;0.996;0.996	D	0.88680	0.3201	10	0.54805	T	0.06	.	10.1557	0.42820	0.0:0.8483:0.0:0.1517	.	800;887;849;863	E9PDK1;Q96Q91;Q96Q91-2;Q96Q91-3	.;B3A4_HUMAN;.;.	I	887;863;849;800;887	ENSP00000230993:L887I;ENSP00000424424:L863I;ENSP00000410056:L849I;ENSP00000422855:L800I;ENSP00000427661:L887I	ENSP00000230993:L887I	L	+	1	0	SLC4A9	139731310	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	3.233000	0.51311	1.391000	0.46566	0.643000	0.83706	CTC	-	pfam_HCO3_transpt_C,tigrfam_HCO3_transpt_euk		0.547	SLC4A9-201	KNOWN	basic|CCDS	protein_coding	SLC4A9	protein_coding	OTTHUMT00000372823.1	C	NM_031467	-		139751126	+1	no_errors	ENST00000230993	ensembl	human	known	74_37	missense	SNP	1.000	A
MYLK2	85366	genome.wustl.edu	37	20	30418869	30418869	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr20:30418869C>T	ENST00000375994.2	+	9	1622	c.1349C>T	c.(1348-1350)tCa>tTa	p.S450L	MYLK2_ENST00000468730.1_3'UTR|MYLK2_ENST00000375985.4_Missense_Mutation_p.S450L			Q9H1R3	MYLK2_HUMAN	myosin light chain kinase 2	450	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cardiac muscle contraction (GO:0060048)|cardiac muscle tissue morphogenesis (GO:0055008)|neuromuscular synaptic transmission (GO:0007274)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of gene expression (GO:0010628)|protein autophosphorylation (GO:0046777)|regulation of muscle filament sliding (GO:0032971)|skeletal muscle cell differentiation (GO:0035914)|skeletal muscle satellite cell differentiation (GO:0014816)|striated muscle contraction (GO:0006941)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|myosin light chain kinase activity (GO:0004687)			NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(17)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	33			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			GAGTTCCTGTCACCTGAGGTG	0.542																																																	0								ENSG00000101306						106.0	94.0	98.0					20																	30418869		2203	4300	6503	MYLK2	SO:0001583	missense	0			-	HGNC	AF325549	CCDS13191.1	20q13.31	2014-09-17	2008-01-23		ENSG00000101306	ENSG00000101306	2.7.11.18		16243	protein-coding gene	gene with protein product	"""skeletal muscle myosin light chain kinase"""	606566	"""myosin light chain kinase 2, skeletal muscle"""				Standard	NM_033118		Approved	skMLCK, KMLC, MLCK2	uc002wwq.2	Q9H1R3	OTTHUMG00000032194	ENST00000375994.2:c.1349C>T	20.37:g.30418869C>T	ENSP00000365162:p.Ser450Leu	Somatic	0	84	0.00		0.5963777675123697	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	32	159	16.67	Q569L1|Q96I84	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.S450L	ENST00000375994.2	37	c.1349	CCDS13191.1	20	.	.	.	.	.	.	.	.	.	.	C	23.7	4.447003	0.84101	.	.	ENSG00000101306	ENST00000375994;ENST00000375985	T;T	0.47528	0.84;0.84	3.96	3.96	0.45880	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	T	0.67534	0.2903	M	0.79475	2.455	0.51233	D	0.999912	D	0.64830	0.994	D	0.67231	0.95	T	0.73877	-0.3844	9	0.87932	D	0	.	15.0963	0.72238	0.0:1.0:0.0:0.0	.	450	Q9H1R3	MYLK2_HUMAN	L	450	ENSP00000365162:S450L;ENSP00000365152:S450L	ENSP00000365152:S450L	S	+	2	0	MYLK2	29882530	1.000000	0.71417	0.998000	0.56505	0.987000	0.75469	7.524000	0.81866	2.172000	0.68678	0.561000	0.74099	TCA	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.542	MYLK2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MYLK2	protein_coding	OTTHUMT00000078583.2	C	NM_033118	-		30418869	+1	no_errors	ENST00000375985	ensembl	human	known	74_37	missense	SNP	1.000	T
NEB	4703	genome.wustl.edu	37	2	152548372	152548377	+	Splice_Site	DEL	ACTTAC	ACTTAC	-			TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	ACTTAC	ACTTAC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr2:152548372_152548377delACTTAC	ENST00000172853.10	-	23	2359		c.e23+1		NEB_ENST00000409198.1_Splice_Site|NEB_ENST00000397345.3_Splice_Site|NEB_ENST00000427231.2_Splice_Site|NEB_ENST00000604864.1_Splice_Site|NEB_ENST00000603639.1_Splice_Site			P20929	NEBU_HUMAN	nebulin						muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		AGGGCAGCTAACTTACATCTTTACAC	0.359																																																	0								ENSG00000183091																																			NEB	SO:0001630	splice_region_variant	0				HGNC	X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.2211+1GTAAGT>-	2.37:g.152548372_152548377delACTTAC		Somatic	NA	NA	NA		0.5963777675123697	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Splice_Site	DEL	NA	NA	NA	NA	NA	NA	-	e21+1	ENST00000172853.10	37	c.2211+1_2211+1		2																																																																																			-	-		0.359	NEB-201	KNOWN	basic	protein_coding	NEB	protein_coding		ACTTAC	NM_004543		Intron	152548377	-1	no_errors	ENST00000397345	ensembl	human	known	74_37	splice_site_del	DEL	0.753:1.000:1.000:1.000:1.000:1.000	-
RASGRF1	5923	genome.wustl.edu	37	15	79350742	79350742	+	Silent	SNP	G	G	A			TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr15:79350742G>A	ENST00000419573.3	-	3	739	c.465C>T	c.(463-465)acC>acT	p.T155T	RASGRF1_ENST00000560334.1_5'UTR|RASGRF1_ENST00000558480.2_Silent_p.T155T	NM_002891.4	NP_002882.3	Q13972	RGRF1_HUMAN	Ras protein-specific guanine nucleotide-releasing factor 1	155					activation of Rac GTPase activity (GO:0032863)|cell proliferation (GO:0008283)|long-term memory (GO:0007616)|neuron projection development (GO:0031175)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of Rac protein signal transduction (GO:0035020)|regulation of Ras protein signal transduction (GO:0046578)|regulation of synaptic plasticity (GO:0048167)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|growth cone (GO:0030426)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(18)|lung(23)|ovary(2)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						GCTTGGCCACGGTCTTCTCTG	0.602																																																	0								ENSG00000058335						129.0	105.0	113.0					15																	79350742		2196	4293	6489	RASGRF1	SO:0001819	synonymous_variant	0			-	HGNC	M91815	CCDS10309.1, CCDS42065.1, CCDS45320.1	15q24	2013-01-10			ENSG00000058335	ENSG00000058335		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	9875	protein-coding gene	gene with protein product		606600		GRF1		7684828, 1379731	Standard	NM_153815		Approved	CDC25L, CDC25, GRF55, H-GRF55, GNRP, PP13187	uc002beq.3	Q13972	OTTHUMG00000144172	ENST00000419573.3:c.465C>T	15.37:g.79350742G>A		Somatic	0	40	0.00		0.5963777675123697	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	22	24.14	F8VPA5|H0YKF2|J3KQP9|Q16027	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_RasGRF_CDC25,pfam_Ras-like_Gua-exchang_fac_N,pfam_DH-domain,pfam_Pleckstrin_homology,superfamily_Ras_GEF_dom,superfamily_DH-domain,smart_Pleckstrin_homology,smart_DH-domain,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_DH-domain,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.T155	ENST00000419573.3	37	c.465	CCDS10309.1	15																																																																																			-	NULL		0.602	RASGRF1-001	KNOWN	basic|CCDS	protein_coding	RASGRF1	protein_coding	OTTHUMT00000291371.3	G	NM_002891	-		79350742	-1	no_errors	ENST00000419573	ensembl	human	known	74_37	silent	SNP	0.009	A
AGFG2	3268	genome.wustl.edu	37	7	100163512	100163512	+	3'UTR	DEL	C	C	-	rs566981535|rs56804763|rs145117814	byFrequency	TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr7:100163512delC	ENST00000300176.4	+	0	2466				AGFG2_ENST00000474713.1_3'UTR	NM_006076.4	NP_006067.3	O95081	AGFG2_HUMAN	ArfGAP with FG repeats 2						regulation of ARF GTPase activity (GO:0032312)	membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						ATTGCCTGGTCTTTTTTTTTT	0.517																																																	0								ENSG00000106351																																			AGFG2	SO:0001624	3_prime_UTR_variant	0				HGNC	AF015042	CCDS5697.1	7q22.1	2008-09-22	2008-09-22	2008-09-22	ENSG00000106351	ENSG00000106351		"""ADP-ribosylation factor GTPase activating proteins"""	5177	protein-coding gene	gene with protein product		604019	"""HIV-1 Rev binding protein-like"""	HRBL		9799793	Standard	XM_005250306		Approved	RABR	uc003uvf.3	O95081	OTTHUMG00000156029	ENST00000300176.4:c.*898C>-	7.37:g.100163512delC		Somatic	0	28	0.00		0.5963777675123697	26	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52	O75429|Q96AB9|Q96GL4	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000300176.4	37	NULL	CCDS5697.1	7																																																																																			-	-		0.517	AGFG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGFG2	protein_coding	OTTHUMT00000342769.1	C	NM_006076			100163512	+1	no_errors	ENST00000474713	ensembl	human	known	74_37	rna	DEL	0.013	-
IPO5	3843	genome.wustl.edu	37	13	98655019	98655019	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr13:98655019C>T	ENST00000490680.1	+	12	1380	c.1315C>T	c.(1315-1317)Cat>Tat	p.H439Y	IPO5_ENST00000539640.1_Missense_Mutation_p.H314Y|IPO5_ENST00000261574.5_Missense_Mutation_p.H457Y			O00410	IPO5_HUMAN	importin 5	439					cellular response to amino acid stimulus (GO:0071230)|negative regulation of catalytic activity (GO:0043086)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of protein import into nucleus (GO:0042307)|ribosomal protein import into nucleus (GO:0006610)|viral process (GO:0016032)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	GTPase inhibitor activity (GO:0005095)|poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)|Ran GTPase binding (GO:0008536)			breast(2)|endometrium(2)|large_intestine(8)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	27						AAAGAAATTTCATGAGAAGGT	0.418																																																	0								ENSG00000065150						98.0	95.0	96.0					13																	98655019		2203	4300	6503	IPO5	SO:0001583	missense	0			-	HGNC	U72761	CCDS31999.1	13q32.2	2012-05-02	2008-04-15	2008-04-15	ENSG00000065150	ENSG00000065150		"""Importins"""	6402	protein-coding gene	gene with protein product		602008	"""karyopherin (importin) beta 3"", ""RAN binding protein 5"""	KPNB3, RANBP5		9114010, 9271386, 17005651	Standard	NM_002271		Approved	IMB3, MGC2068, Pse1	uc001vne.3	O00410	OTTHUMG00000017244	ENST00000490680.1:c.1315C>T	13.37:g.98655019C>T	ENSP00000418393:p.His439Tyr	Somatic	0	11	0.00		0.5963777675123697	3	75.00	9	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	12	45.45	B4DZA0|O15257|Q5T578|Q86XC7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_HEAT,superfamily_ARM-type_fold,pfscan_Importin-beta_N	p.H457Y	ENST00000490680.1	37	c.1369		13	.	.	.	.	.	.	.	.	.	.	C	28.0	4.877992	0.91664	.	.	ENSG00000065150	ENST00000261574;ENST00000357602;ENST00000490680;ENST00000539640	T;T;T;T	0.67523	-0.27;-0.27;-0.27;-0.27	5.71	5.71	0.89125	Armadillo-like helical (1);Armadillo-type fold (1);	0.100019	0.64402	D	0.000001	T	0.80423	0.4620	L	0.60904	1.88	0.80722	D	1	D;D;D	0.71674	0.998;0.988;0.993	D;P;D	0.74674	0.984;0.864;0.955	T	0.80529	-0.1342	10	0.62326	D	0.03	5.0338	19.8579	0.96771	0.0:1.0:0.0:0.0	.	314;439;457	B4E0R6;O00410;O00410-3	.;IPO5_HUMAN;.	Y	457;439;439;314	ENSP00000261574:H457Y;ENSP00000350219:H439Y;ENSP00000418393:H439Y;ENSP00000445126:H314Y	ENSP00000261574:H457Y	H	+	1	0	IPO5	97453020	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.752000	0.85141	2.683000	0.91414	0.557000	0.71058	CAT	-	superfamily_ARM-type_fold		0.418	IPO5-006	NOVEL	alternative_5_UTR|basic|appris_principal	protein_coding	IPO5	protein_coding	OTTHUMT00000354655.1	C	NM_002271	-		98655019	+1	no_errors	ENST00000261574	ensembl	human	known	74_37	missense	SNP	1.000	T
IGSF22	283284	genome.wustl.edu	37	11	18729766	18729766	+	Silent	SNP	A	A	G			TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr11:18729766A>G	ENST00000513874.1	-	19	3214	c.3075T>C	c.(3073-3075)caT>caC	p.H1025H	RP11-1081L13.4_ENST00000527285.1_RNA|IGSF22_ENST00000510673.1_5'Flank	NM_173588.3	NP_775859	Q8N9C0	IGS22_HUMAN	immunoglobulin superfamily, member 22	628										NS(2)|autonomic_ganglia(1)|breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(20)|ovary(4)|prostate(4)|skin(3)	56						AGAAGGCTGCATGGATGCAGA	0.552																																																	0								ENSG00000179057						151.0	144.0	146.0					11																	18729766		692	1591	2283	IGSF22	SO:0001819	synonymous_variant	0			-	HGNC	AK095113	CCDS41625.1, CCDS41625.2	11p15.1	2014-06-06			ENSG00000179057	ENSG00000179057		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	26750	protein-coding gene	gene with protein product							Standard	NM_173588		Approved	FLJ37794	uc009yht.2	Q8N9C0	OTTHUMG00000160502	ENST00000513874.1:c.3075T>C	11.37:g.18729766A>G		Somatic	0	39	0.00		0.5963777675123697	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	34	19.05	A6NNA0|D6RGV7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.H1025	ENST00000513874.1	37	c.3075	CCDS41625.2	11																																																																																			-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.552	IGSF22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGSF22	protein_coding	OTTHUMT00000360850.2	A	NM_173588	-		18729766	-1	no_errors	ENST00000513874	ensembl	human	known	74_37	silent	SNP	0.002	G
HDAC7	51564	genome.wustl.edu	37	12	48189100	48189100	+	Missense_Mutation	SNP	G	G	C			TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr12:48189100G>C	ENST00000427332.2	-	11	1190	c.1034C>G	c.(1033-1035)tCt>tGt	p.S345C	HDAC7_ENST00000380610.4_Missense_Mutation_p.S401C|HDAC7_ENST00000080059.7_Missense_Mutation_p.S384C|HDAC7_ENST00000552960.1_Missense_Mutation_p.S367C|HDAC7_ENST00000354334.3_Missense_Mutation_p.S347C			Q8WUI4	HDAC7_HUMAN	histone deacetylase 7	345	Transcription repression 2. {ECO:0000250}.				cell-cell junction assembly (GO:0007043)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	14-3-3 protein binding (GO:0071889)|activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|metal ion binding (GO:0046872)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein kinase binding (GO:0019901)|protein kinase C binding (GO:0005080)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)			breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25				GBM - Glioblastoma multiforme(48;0.137)		GCCTGACCCAGAGAGCCGCTC	0.682																																																	0								ENSG00000061273						15.0	19.0	17.0					12																	48189100		2196	4288	6484	HDAC7	SO:0001583	missense	0			-	HGNC	AF239243	CCDS8756.2, CCDS41776.1	12q13.1	2008-02-25	2008-02-25	2008-02-25	ENSG00000061273	ENSG00000061273			14067	protein-coding gene	gene with protein product		606542	"""histone deacetylase 7A"""	HDAC7A		10922406, 10640276	Standard	NM_015401		Approved	DKFZP586J0917	uc010slo.2	Q8WUI4	OTTHUMG00000152968	ENST00000427332.2:c.1034C>G	12.37:g.48189100G>C	ENSP00000404394:p.Ser345Cys	Somatic	0	96	0.00		0.5963777675123697	9	60.87	14	WXS	Illumina HiSeq 2500	Phase_IV	tier1	44	43	50.57	B3KY08|B4DWI0|B4E0Q5|Q6P1W9|Q6W9G7|Q7Z4K2|Q7Z5I1|Q96K01|Q9BR73|Q9H7L0|Q9NW41|Q9NWA9|Q9NYK9|Q9UFU7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_His_deacetylse_dom,pirsf_Histone_deAcase_II_euk,prints_His_deacetylse	p.S401C	ENST00000427332.2	37	c.1202		12	.	.	.	.	.	.	.	.	.	.	G	17.20	3.329470	0.60743	.	.	ENSG00000061273	ENST00000080059;ENST00000354334;ENST00000552960;ENST00000380610;ENST00000427332	T;T;T;T;T	0.60040	0.25;0.32;0.25;0.22;0.25	4.51	4.51	0.55191	.	0.483471	0.22578	N	0.058256	T	0.68247	0.2980	M	0.62723	1.935	0.28778	N	0.900019	D;D;D	0.54207	0.965;0.965;0.965	P;P;P	0.57101	0.813;0.813;0.813	T	0.65619	-0.6124	10	0.62326	D	0.03	.	14.4437	0.67336	0.0:0.0:1.0:0.0	.	384;367;347	Q8WUI4-5;Q8WUI4-6;Q8WUI4-7	.;.;.	C	384;347;367;401;345	ENSP00000080059:S384C;ENSP00000351326:S347C;ENSP00000448532:S367C;ENSP00000369984:S401C;ENSP00000404394:S345C	ENSP00000080059:S384C	S	-	2	0	HDAC7	46475367	0.271000	0.24162	1.000000	0.80357	0.929000	0.56500	1.325000	0.33724	2.499000	0.84300	0.561000	0.74099	TCT	-	pirsf_Histone_deAcase_II_euk		0.682	HDAC7-013	NOVEL	basic|appris_principal	protein_coding	HDAC7	protein_coding	OTTHUMT00000328804.2	G		-		48189100	-1	no_errors	ENST00000380610	ensembl	human	known	74_37	missense	SNP	0.883	C
PRICKLE2	166336	genome.wustl.edu	37	3	64133374	64133374	+	Silent	SNP	G	G	T			TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr3:64133374G>T	ENST00000295902.6	-	7	1377	c.792C>A	c.(790-792)atC>atA	p.I264I	PRICKLE2_ENST00000564377.1_Silent_p.I320I	NM_198859.3	NP_942559.1	Q7Z3G6	PRIC2_HUMAN	prickle homolog 2 (Drosophila)	264	LIM zinc-binding 3. {ECO:0000255|PROSITE- ProRule:PRU00125}.				establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|neuron projection development (GO:0031175)	apicolateral plasma membrane (GO:0016327)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|large_intestine(9)|liver(1)|lung(10)|ovary(4)|prostate(2)|skin(2)|stomach(1)	32		Lung NSC(201;0.136)		BRCA - Breast invasive adenocarcinoma(55;0.000971)|KIRC - Kidney renal clear cell carcinoma(15;0.00443)|Kidney(15;0.00497)		GACCTTGGTCGATACCTAAAA	0.512																																																	0								ENSG00000163637						50.0	50.0	50.0					3																	64133374		2198	4295	6493	PRICKLE2	SO:0001819	synonymous_variant	0			-	HGNC	AK127839	CCDS2902.1	3p14.3	2006-09-12	2006-09-12		ENSG00000163637	ENSG00000163637			20340	protein-coding gene	gene with protein product		608501	"""prickle-like 2 (Drosophila)"""			12525887	Standard	NM_198859		Approved	DKFZp686D143	uc003dmf.3	Q7Z3G6	OTTHUMG00000158789	ENST00000295902.6:c.792C>A	3.37:g.64133374G>T		Somatic	0	23	0.00		0.5963777675123697	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	23	14.81	Q0VF44	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_PET_domain,pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	p.I264	ENST00000295902.6	37	c.792	CCDS2902.1	3																																																																																			-	pfam_Znf_LIM,smart_Znf_LIM		0.512	PRICKLE2-001	KNOWN	basic|CCDS	protein_coding	PRICKLE2	protein_coding	OTTHUMT00000352219.1	G	NM_198859	-		64133374	-1	no_errors	ENST00000295902	ensembl	human	known	74_37	silent	SNP	0.090	T
IKZF4	64375	genome.wustl.edu	37	12	56427018	56427018	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr12:56427018C>T	ENST00000262032.5	+	11	1277	c.910C>T	c.(910-912)Cac>Tac	p.H304Y	RP11-603J24.4_ENST00000551846.1_RNA|IKZF4_ENST00000547791.1_Missense_Mutation_p.H259Y|IKZF4_ENST00000547167.1_Missense_Mutation_p.H304Y|IKZF4_ENST00000431367.2_Missense_Mutation_p.H202Y			Q9H2S9	IKZF4_HUMAN	IKAROS family zinc finger 4 (Eos)	304					negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(2)|lung(3)|ovary(1)|prostate(1)	8			UCEC - Uterine corpus endometrioid carcinoma (6;0.025)|OV - Ovarian serous cystadenocarcinoma(18;0.123)			CTCCATGCTGCACTCATCCTC	0.527																																																	0								ENSG00000123411						122.0	117.0	119.0					12																	56427018		2045	4194	6239	IKZF4	SO:0001583	missense	0			-	HGNC	AF230809	CCDS44917.1	12q13	2013-01-08	2006-08-25	2006-08-25		ENSG00000123411		"""Zinc fingers, C2H2-type"", ""IKAROS zinc fingers"""	13179	protein-coding gene	gene with protein product		606239	"""zinc finger protein, subfamily 1A, 4 (Eos)"""	ZNFN1A4		10978333	Standard	NM_022465		Approved	Eos	uc001sjc.1	Q9H2S9		ENST00000262032.5:c.910C>T	12.37:g.56427018C>T	ENSP00000262032:p.His304Tyr	Somatic	0	43	0.00		0.5963777675123697	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	35	28.57	Q96JP3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.H304Y	ENST00000262032.5	37	c.910	CCDS44917.1	12	.	.	.	.	.	.	.	.	.	.	C	18.11	3.550896	0.65311	.	.	ENSG00000123411	ENST00000262032;ENST00000431367;ENST00000547167;ENST00000547791	T;T;T;T	0.07021	3.23;3.23;3.23;3.24	4.9	4.9	0.64082	.	0.000000	0.52532	D	0.000067	T	0.05868	0.0153	N	0.08118	0	0.43942	D	0.996609	B;P;B;P	0.49185	0.004;0.77;0.005;0.92	B;B;B;B	0.42692	0.001;0.395;0.004;0.346	T	0.54084	-0.8346	10	0.23891	T	0.37	-11.5658	17.0178	0.86424	0.0:1.0:0.0:0.0	.	202;259;263;304	G5E9S4;F8VPL6;Q9H2S9-2;Q9H2S9	.;.;.;IKZF4_HUMAN	Y	304;202;304;259	ENSP00000262032:H304Y;ENSP00000412101:H202Y;ENSP00000448419:H304Y;ENSP00000450020:H259Y	ENSP00000262032:H304Y	H	+	1	0	IKZF4	54713285	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.182000	0.77689	2.546000	0.85860	0.455000	0.32223	CAC	-	NULL		0.527	IKZF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IKZF4	protein_coding	OTTHUMT00000407590.1	C	NM_022465	-		56427018	+1	no_errors	ENST00000262032	ensembl	human	known	74_37	missense	SNP	1.000	T
PTPN18	26469	genome.wustl.edu	37	2	131128341	131128341	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr2:131128341G>A	ENST00000175756.5	+	10	921	c.820G>A	c.(820-822)Gcc>Acc	p.A274T	PTPN18_ENST00000347849.3_Missense_Mutation_p.A167T	NM_014369.3	NP_055184.2	Q99952	PTN18_HUMAN	protein tyrosine phosphatase, non-receptor type 18 (brain-derived)	274	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)			endometrium(1)|kidney(3)|large_intestine(2)|lung(5)|ovary(3)|prostate(1)	15	Colorectal(110;0.1)					GCGGCCTGCGGCCGTGCAGAC	0.572																																																	0								ENSG00000072135						85.0	84.0	85.0					2																	131128341		2203	4300	6503	PTPN18	SO:0001583	missense	0			-	HGNC	X79568	CCDS2161.1, CCDS46410.1	2q21	2011-06-09			ENSG00000072135	ENSG00000072135		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9649	protein-coding gene	gene with protein product		606587				8950995	Standard	NM_014369		Approved	BDP1	uc002trc.3	Q99952	OTTHUMG00000131630	ENST00000175756.5:c.820G>A	2.37:g.131128341G>A	ENSP00000175756:p.Ala274Thr	Somatic	0	42	0.00		0.5963777675123697	13	13.33	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	26	25.71	B4E1E6|Q53P42	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.A274T	ENST00000175756.5	37	c.820	CCDS2161.1	2	.	.	.	.	.	.	.	.	.	.	G	16.54	3.150951	0.57151	.	.	ENSG00000072135	ENST00000175756;ENST00000347849;ENST00000409022	D;D	0.84370	-1.84;-1.84	4.88	3.08	0.35506	Protein-tyrosine phosphatase, receptor/non-receptor type (4);Protein-tyrosine/Dual-specificity phosphatase (1);	1.128640	0.06870	N	0.800599	D	0.87613	0.6221	L	0.42487	1.325	0.09310	N	1	D;P;P	0.63880	0.993;0.934;0.934	P;P;P	0.58620	0.842;0.624;0.646	T	0.74051	-0.3789	10	0.59425	D	0.04	.	9.5447	0.39273	0.1777:0.0:0.8223:0.0	.	253;274;167	E7EMB8;Q99952;B4E1E6	.;PTN18_HUMAN;.	T	274;167;253	ENSP00000175756:A274T;ENSP00000310092:A167T	ENSP00000175756:A274T	A	+	1	0	PTPN18	130844811	0.001000	0.12720	0.001000	0.08648	0.047000	0.14425	0.715000	0.25822	0.743000	0.32719	-0.218000	0.12543	GCC	-	pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt		0.572	PTPN18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPN18	protein_coding	OTTHUMT00000254523.2	G		-		131128341	+1	no_errors	ENST00000175756	ensembl	human	known	74_37	missense	SNP	0.001	A
ACOT11	26027	genome.wustl.edu	37	1	55050380	55050380	+	Missense_Mutation	SNP	C	C	T	rs150203501		TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr1:55050380C>T	ENST00000371316.3	+	2	168	c.86C>T	c.(85-87)gCg>gTg	p.A29V	ACOT11_ENST00000343744.2_Missense_Mutation_p.A29V|ACOT11_ENST00000481208.1_3'UTR	NM_015547.3	NP_056362.1	Q8WXI4	ACO11_HUMAN	acyl-CoA thioesterase 11	29	Acyl coenzyme A hydrolase 1.				fatty acid metabolic process (GO:0006631)|intracellular signal transduction (GO:0035556)|response to cold (GO:0009409)|response to temperature stimulus (GO:0009266)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	acyl-CoA hydrolase activity (GO:0047617)|carboxylic ester hydrolase activity (GO:0052689)|lipid binding (GO:0008289)			NS(1)|central_nervous_system(1)|endometrium(6)|large_intestine(3)|lung(5)|ovary(1)	17						GCCTTACGTGCGGGGAACGAC	0.637																																					Ovarian(148;1440 1861 22015 32453 51933)												0								ENSG00000162390	C	VAL/ALA,VAL/ALA	1,4405	2.1+/-5.4	0,1,2202	89.0	76.0	80.0		86,86	2.3	0.0	1	dbSNP_134	80	1,8599	1.2+/-3.3	0,1,4299	yes	missense,missense	ACOT11	NM_015547.3,NM_147161.3	64,64	0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154	benign,benign	29/608,29/595	55050380	2,13004	2203	4300	6503	ACOT11	SO:0001583	missense	0			-	HGNC	AB014607	CCDS592.1, CCDS593.1	1p32.3	2011-09-13	2005-09-08	2005-09-08	ENSG00000162390	ENSG00000162390	3.1.2.-	"""Acyl CoA thioesterases"", ""StAR-related lipid transfer (START) domain containing"""	18156	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 14"""	606803	"""thioesterase, adipose associated"""	THEA		11696000, 16103133, 16940157	Standard	NM_015547		Approved	STARD14, BFIT, KIAA0707, BFIT1, THEM1	uc001cxl.2	Q8WXI4	OTTHUMG00000009891	ENST00000371316.3:c.86C>T	1.37:g.55050380C>T	ENSP00000360366:p.Ala29Val	Somatic	0	65	0.00		0.5963777675123697	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	33	15	68.75	B1AQ22|D3DQ50|O75187|Q52LP1|Q53ER9|Q96DI1|Q9H883	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_START_lipid-bd_dom,pfam_Thioestr_supf,smart_START_lipid-bd_dom,pfscan_START_lipid-bd_dom	p.A29V	ENST00000371316.3	37	c.86	CCDS592.1	1	.	.	.	.	.	.	.	.	.	.	C	13.40	2.224441	0.39300	2.27E-4	1.16E-4	ENSG00000162390	ENST00000343744;ENST00000371316	T;T	0.10288	2.95;2.89	5.27	2.35	0.29111	.	0.676414	0.15172	N	0.276591	T	0.05135	0.0137	N	0.08118	0	0.09310	N	1	B;B	0.22480	0.07;0.002	B;B	0.10450	0.003;0.005	T	0.34477	-0.9827	10	0.49607	T	0.09	-21.2261	6.4123	0.21698	0.0:0.5594:0.2857:0.1548	.	29;29	Q8WXI4;Q8WXI4-2	ACO11_HUMAN;.	V	29	ENSP00000340260:A29V;ENSP00000360366:A29V	ENSP00000340260:A29V	A	+	2	0	ACOT11	54822968	0.068000	0.21057	0.001000	0.08648	0.004000	0.04260	0.430000	0.21428	0.720000	0.32209	-0.165000	0.13383	GCG	-	NULL		0.637	ACOT11-001	KNOWN	basic|CCDS	protein_coding	ACOT11	protein_coding	OTTHUMT00000027356.1	C	NM_015547	rs150203501		55050380	+1	no_errors	ENST00000371316	ensembl	human	known	74_37	missense	SNP	0.014	T
ZNF850	342892	genome.wustl.edu	37	19	37266356	37266356	+	5'Flank	SNP	C	C	T			TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr19:37266356C>T	ENST00000591344.1	-	0	0				CTD-2162K18.3_ENST00000588717.1_lincRNA|ZNF850_ENST00000589390.1_5'Flank|CTD-2162K18.4_ENST00000590750.1_Missense_Mutation_p.R68C	NM_001193552.1|NM_001267779.1	NP_001180481.1|NP_001254708.1	A8MQ14	ZN850_HUMAN	zinc finger protein 850						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)										TGCAAACACCCGCCACTCAAA	0.468																																																	0								ENSG00000267260																																			CTD-2162K18.4	SO:0001631	upstream_gene_variant	0			-	Clone_based_vega_gene	BC052603	CCDS59379.1, CCDS74350.1	19q13.12	2013-01-08	2010-08-02	2010-08-02		ENSG00000267041		"""Zinc fingers, C2H2-type"", ""-"""	27994	protein-coding gene	gene with protein product			"""zinc finger protein 850 pseudogene"", ""zinc finger protein 850 (pseudogene)"""	ZNF850P		12477932	Standard	NM_001193552		Approved		uc010efc.3	A8MQ14			19.37:g.37266356C>T	Exception_encountered	Somatic	0	115	0.00		0.5963777675123697	0	100.00	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	35	56	38.46		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.R68C	ENST00000591344.1	37	c.202	CCDS59379.1	19																																																																																			-	NULL		0.468	ZNF850-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000267260	protein_coding	OTTHUMT00000453557.1	C	XM_001720258	-		37266356	+1	no_errors	ENST00000590750	ensembl	human	putative	74_37	missense	SNP	0.029	T
LOC100631378	100631378	genome.wustl.edu	37	19	38321666	38321666	+	lincRNA	SNP	G	G	A			TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr19:38321666G>A	ENST00000443870.1	+	0	1476				AC016582.2_ENST00000592640.1_lincRNA																							CAGCAGACCCGCTGCACTTGC	0.498																																																	0								ENSG00000229481																																			CTD-2554C21.3			0			-	Clone_based_vega_gene																													19.37:g.38321666G>A		Somatic	0	42	0.00		0.5963777675123697	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	36	12.20		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000443870.1	37	NULL		19																																																																																			-	-		0.498	CTD-2554C21.3-001	KNOWN	basic	lincRNA	ENSG00000229481	lincRNA	OTTHUMT00000459795.1	G		-		38321666	+1	no_errors	ENST00000443870	ensembl	human	known	74_37	rna	SNP	0.099	A
CARD10	29775	genome.wustl.edu	37	22	37904671	37904671	+	Frame_Shift_Del	DEL	C	C	-			TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr22:37904671delC	ENST00000403299.1	-	6	1144	c.928delG	c.(928-930)gccfs	p.A310fs	CARD10_ENST00000251973.5_Frame_Shift_Del_p.A310fs|CARD10_ENST00000406271.3_Frame_Shift_Del_p.A24fs|CARD10_ENST00000494166.1_5'UTR			Q9BWT7	CAR10_HUMAN	caspase recruitment domain family, member 10	310					activation of NF-kappaB-inducing kinase activity (GO:0007250)|protein complex assembly (GO:0006461)|regulation of apoptotic process (GO:0042981)	CBM complex (GO:0032449)|cytoplasm (GO:0005737)	receptor signaling complex scaffold activity (GO:0030159)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	17	Melanoma(58;0.0574)					GAGCCCGGGGCCCCCGGCCGG	0.697																																																	0								ENSG00000100065						7.0	8.0	8.0					22																	37904671		2168	4224	6392	CARD10	SO:0001589	frameshift_variant	0				HGNC	AF086324	CCDS13948.1	22q13.1	2008-05-22			ENSG00000100065	ENSG00000100065			16422	protein-coding gene	gene with protein product		607209				11259443, 11356195	Standard	NM_014550		Approved	CARMA3, BIMP1	uc003asu.1	Q9BWT7	OTTHUMG00000150592	ENST00000403299.1:c.928delG	22.37:g.37904671delC	ENSP00000384570:p.Ala310fs	Somatic	0	16	0.00		0.5963777675123697	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	22	8.33	Q14CQ8|Q5TFG6|Q8NC81|Q9UGR5|Q9UGR6|Q9Y3H0	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_CARD,superfamily_DEATH-like_dom,pfscan_CARD	p.A310fs	ENST00000403299.1	37	c.928	CCDS13948.1	22																																																																																			-	NULL		0.697	CARD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CARD10	protein_coding	OTTHUMT00000318997.1	C	NM_014550			37904671	-1	no_errors	ENST00000251973	ensembl	human	known	74_37	frame_shift_del	DEL	0.999	-
PAX6	5080	genome.wustl.edu	37	11	31823240	31823240	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5V9-01A-11D-A32I-09	TCGA-QQ-A5V9-11A-31D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1ae3de4e-4700-435a-add1-586224c5838b	f3212ce3-7a66-415a-9ef8-f1669ed8940e	g.chr11:31823240G>A	ENST00000379132.3	-	5	506	c.226C>T	c.(226-228)Ccg>Tcg	p.P76S	PAX6_ENST00000241001.8_Missense_Mutation_p.P76S|PAX6_ENST00000419022.1_Missense_Mutation_p.P90S|PAX6_ENST00000379129.2_Missense_Mutation_p.P90S|PAX6_ENST00000533156.1_5'Flank|PAX6_ENST00000379111.2_Missense_Mutation_p.P76S|PAX6_ENST00000379115.4_Missense_Mutation_p.P90S|PAX6_ENST00000379123.5_Missense_Mutation_p.P76S|PAX6_ENST00000379107.2_Missense_Mutation_p.P90S			P26367	PAX6_HUMAN	paired box 6	76	Paired. {ECO:0000255|PROSITE- ProRule:PRU00381}.				astrocyte differentiation (GO:0048708)|axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|cerebral cortex regionalization (GO:0021796)|commitment of neuronal cell to specific neuron type in forebrain (GO:0021902)|cornea development in camera-type eye (GO:0061303)|dorsal/ventral axis specification (GO:0009950)|embryonic camera-type eye morphogenesis (GO:0048596)|eye development (GO:0001654)|eye photoreceptor cell development (GO:0042462)|forebrain anterior/posterior pattern specification (GO:0021797)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain-midbrain boundary formation (GO:0021905)|glucose homeostasis (GO:0042593)|hindbrain development (GO:0030902)|iris morphogenesis (GO:0061072)|keratinocyte differentiation (GO:0030216)|lacrimal gland development (GO:0032808)|lens development in camera-type eye (GO:0002088)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|neuron migration (GO:0001764)|oligodendrocyte cell fate specification (GO:0021778)|organ morphogenesis (GO:0009887)|pancreatic A cell development (GO:0003322)|pituitary gland development (GO:0021983)|positive regulation of cell fate specification (GO:0042660)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of gene expression (GO:0010628)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to organelle (GO:0033365)|protein ubiquitination (GO:0016567)|regulation of cell migration (GO:0030334)|regulation of timing of cell differentiation (GO:0048505)|regulation of transcription from RNA polymerase II promoter involved in somatic motor neuron fate commitment (GO:0021918)|regulation of transcription from RNA polymerase II promoter involved in spinal cord motor neuron fate specification (GO:0021912)|regulation of transcription from RNA polymerase II promoter involved in ventral spinal cord interneuron specification (GO:0021913)|response to wounding (GO:0009611)|retina development in camera-type eye (GO:0060041)|salivary gland morphogenesis (GO:0007435)|signal transduction involved in regulation of gene expression (GO:0023019)|smoothened signaling pathway (GO:0007224)|transcription from RNA polymerase II promoter (GO:0006366)|type B pancreatic cell differentiation (GO:0003309)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|histone acetyltransferase binding (GO:0035035)|protein kinase binding (GO:0019901)|R-SMAD binding (GO:0070412)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|ubiquitin-protein transferase activity (GO:0004842)			central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|skin(2)	35	Lung SC(675;0.225)					GCTACTCTCGGTTTACTACCA	0.507									Wilms' tumor-Aniridia-ambiguous Genitals-mental Retardation																																								0								ENSG00000007372						96.0	91.0	93.0					11																	31823240		2202	4299	6501	PAX6	SO:0001583	missense	0	Familial Cancer Database	WAGR syndrome	-	HGNC	AY707088	CCDS31451.1, CCDS31452.1	11p13	2014-09-17	2007-07-12		ENSG00000007372	ENSG00000007372		"""Paired boxes"", ""Homeoboxes / PRD class"""	8620	protein-coding gene	gene with protein product	"""aniridia, keratitis"""	607108	"""paired box gene 6 (aniridia, keratitis)"""	AN2		1302030	Standard	NM_001127612		Approved	D11S812E, AN, WAGR	uc021qfm.1	P26367	OTTHUMG00000041447	ENST00000379132.3:c.226C>T	11.37:g.31823240G>A	ENSP00000368427:p.Pro76Ser	Somatic	0	54	0.00		0.5963777675123697	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	57	19.72	Q6N006|Q99413	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Paired_dom,pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Paired_dom,smart_Homeobox_dom,prints_Paired_dom,pfscan_Homeobox_dom,pfscan_Paired_dom	p.P90S	ENST00000379132.3	37	c.268	CCDS31451.1	11	.	.	.	.	.	.	.	.	.	.	G	25.4	4.632375	0.87660	.	.	ENSG00000007372	ENST00000419022;ENST00000379132;ENST00000379129;ENST00000379107;ENST00000241001;ENST00000379115;ENST00000379111;ENST00000379123;ENST00000379109;ENST00000533333	D;D;D;D;D;D;D;D;D;D	0.99701	-6.45;-6.45;-6.45;-6.45;-6.45;-6.45;-6.45;-6.45;-6.45;-6.45	5.35	5.35	0.76521	Paired box protein, N-terminal (4);Winged helix-turn-helix transcription repressor DNA-binding (1);Homeodomain-like (1);	0.188712	0.64402	D	0.000018	D	0.99782	0.9909	M	0.91717	3.235	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.97232	0.9885	10	0.87932	D	0	.	19.0586	0.93078	0.0:0.0:1.0:0.0	.	90;76	F1T0F8;P26367	.;PAX6_HUMAN	S	90;76;90;90;76;90;76;76;76;31	ENSP00000404100:P90S;ENSP00000368427:P76S;ENSP00000368424:P90S;ENSP00000368401:P90S;ENSP00000241001:P76S;ENSP00000368410:P90S;ENSP00000368406:P76S;ENSP00000368418:P76S;ENSP00000368403:P76S;ENSP00000451372:P31S	ENSP00000241001:P76S	P	-	1	0	PAX6	31779816	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.824000	0.99380	2.488000	0.83962	0.650000	0.86243	CCG	-	pfam_Paired_dom,superfamily_Homeodomain-like,smart_Paired_dom,prints_Paired_dom,pfscan_Paired_dom		0.507	PAX6-008	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	PAX6	protein_coding	OTTHUMT00000099293.4	G	NM_001604	-		31823240	-1	no_errors	ENST00000379107	ensembl	human	known	74_37	missense	SNP	1.000	A
