#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
LRRC8D	55144	genome.wustl.edu	37	1	90399271	90399271	+	Missense_Mutation	SNP	A	A	G			TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chr1:90399271A>G	ENST00000337338.5	+	3	1051	c.644A>G	c.(643-645)gAg>gGg	p.E215G	LRRC8D_ENST00000394593.3_Missense_Mutation_p.E215G	NM_001134479.1	NP_001127951.1	Q7L1W4	LRC8D_HUMAN	leucine rich repeat containing 8 family, member D	215					ion transport (GO:0006811)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(10)|ovary(2)|skin(1)	29		all_lung(203;0.0894)|Lung NSC(277;0.227)		all cancers(265;0.0109)|Epithelial(280;0.0427)		GCGTTGTCTGAGACAGCATGC	0.428																																																	0								ENSG00000171492						61.0	61.0	61.0					1																	90399271		2203	4300	6503	LRRC8D	SO:0001583	missense	0			-	HGNC	AK001332	CCDS726.1	1p22.2	2008-02-05	2005-06-29	2005-06-29	ENSG00000171492	ENSG00000171492			16992	protein-coding gene	gene with protein product		612890	"""leucine rich repeat containing 5"""	LRRC5			Standard	NM_018103		Approved	FLJ10470	uc001dnn.3	Q7L1W4	OTTHUMG00000010583	ENST00000337338.5:c.644A>G	1.37:g.90399271A>G	ENSP00000338887:p.Glu215Gly	Somatic	0	37	0.00		0.5891488714521174	60	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	32	11.11	D3DT29|Q6UWB2|Q9NVW3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_LRR_protein-8_N,pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.E215G	ENST00000337338.5	37	c.644	CCDS726.1	1	.	.	.	.	.	.	.	.	.	.	A	15.20	2.761682	0.49468	.	.	ENSG00000171492	ENST00000337338;ENST00000394593;ENST00000441269	T;T;T	0.54479	1.24;1.24;0.57	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.48696	0.1514	M	0.74647	2.275	0.80722	D	1	B	0.31859	0.343	B	0.39068	0.289	T	0.49916	-0.8888	9	.	.	.	.	16.8222	0.85835	1.0:0.0:0.0:0.0	.	215	Q7L1W4	LRC8D_HUMAN	G	215	ENSP00000338887:E215G;ENSP00000378093:E215G;ENSP00000405784:E215G	.	E	+	2	0	LRRC8D	90171859	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.339000	0.96797	2.371000	0.80710	0.533000	0.62120	GAG	-	NULL		0.428	LRRC8D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC8D	protein_coding	OTTHUMT00000029203.2	A	NM_018103	-		90399271	+1	no_errors	ENST00000337338	ensembl	human	known	74_37	missense	SNP	1.000	G
NEUROD4	58158	genome.wustl.edu	37	12	55420485	55420485	+	Nonsense_Mutation	SNP	C	C	T			TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chr12:55420485C>T	ENST00000242994.3	+	2	640	c.262C>T	c.(262-264)Cga>Tga	p.R88*		NM_021191.2	NP_067014.2	Q9HD90	NDF4_HUMAN	neuronal differentiation 4	88	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				amacrine cell differentiation (GO:0035881)|cell fate commitment (GO:0045165)|glial cell differentiation (GO:0010001)|neuroblast proliferation (GO:0007405)|neuron development (GO:0048666)|neuron migration (GO:0001764)|Notch signaling pathway (GO:0007219)|positive regulation of cell differentiation (GO:0045597)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.R88*(2)		breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(14)|ovary(3)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)	41						ATTCAGGGCTCGAAGAGTCAA	0.507																																																	2	Substitution - Nonsense(2)	large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)						ENSG00000123307						67.0	67.0	67.0					12																	55420485		2203	4300	6503	NEUROD4	SO:0001587	stop_gained	0			-	HGNC	AF203901	CCDS8886.1	12q13.13	2013-05-21	2012-02-22			ENSG00000123307		"""Basic helix-loop-helix proteins"""	13802	protein-coding gene	gene with protein product		611635	"""neurogenic differentiation 4"""				Standard	NM_021191		Approved	Atoh3, ATH-3, MATH-3, bHLHa4	uc001sgp.4	Q9HD90		ENST00000242994.3:c.262C>T	12.37:g.55420485C>T	ENSP00000242994:p.Arg88*	Somatic	0	34	0.00		0.5891488714521174	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	55	14.06	B2RAC9	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Neurogenic_DUF,pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pirsf_TF_bHLH_NeuroD,pfscan_bHLH_dom	p.R88*	ENST00000242994.3	37	c.262	CCDS8886.1	12	.	.	.	.	.	.	.	.	.	.	C	38	7.232720	0.98154	.	.	ENSG00000123307	ENST00000242994	.	.	.	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.4191	11.7335	0.51752	0.1762:0.8238:0.0:0.0	.	.	.	.	X	88	.	ENSP00000242994:R88X	R	+	1	2	NEUROD4	53706752	0.853000	0.29707	1.000000	0.80357	0.996000	0.88848	2.612000	0.46343	2.603000	0.88011	0.655000	0.94253	CGA	-	pfam_bHLH_dom,superfamily_bHLH_dom,pirsf_TF_bHLH_NeuroD,pfscan_bHLH_dom		0.507	NEUROD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NEUROD4	protein_coding	OTTHUMT00000406104.1	C		-		55420485	+1	no_errors	ENST00000242994	ensembl	human	known	74_37	nonsense	SNP	1.000	T
TLE3	7090	genome.wustl.edu	37	15	70371801	70371801	+	Intron	SNP	A	A	G			TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chr15:70371801A>G	ENST00000558939.1	-	5	1612				MIR629_ENST00000385230.1_RNA|TLE3_ENST00000559191.1_Intron|TLE3_ENST00000317509.8_Intron|TLE3_ENST00000560939.1_Intron|TLE3_ENST00000557907.1_Intron|TLE3_ENST00000442299.2_Intron|TLE3_ENST00000558201.1_Intron|TLE3_ENST00000560589.1_Intron|TLE3_ENST00000539550.1_Intron|TLE3_ENST00000559929.1_Intron|TLE3_ENST00000440567.3_Intron|TLE3_ENST00000559048.1_Intron|TLE3_ENST00000558379.1_Intron|TLE3_ENST00000451782.2_Intron|TLE3_ENST00000557997.1_Intron	NM_001282979.1|NM_001282980.1|NM_001282981.1	NP_001269908.1|NP_001269909.1|NP_001269910.1	Q04726	TLE3_HUMAN	transducin-like enhancer of split 3						Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(16)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						CTCCCCTGGGAAAGGGACATG	0.582																																																	0								ENSG00000207965						18.0	20.0	20.0					15																	70371801		1563	3580	5143	MIR629	SO:0001627	intron_variant	0			-	HGNC	M99438	CCDS45293.1, CCDS45294.1, CCDS58375.1, CCDS61689.1, CCDS61691.1, CCDS61692.1, CCDS73747.1	15q22	2014-03-07	2014-03-07			ENSG00000140332		"""WD repeat domain containing"""	11839	protein-coding gene	gene with protein product		600190	"""transducin-like enhancer of split 3, homolog of Drosophila E(sp1)"", ""transducin-like enhancer of split 3 (E(sp1) homolog, Drosophila)"""			8365415	Standard	XM_005254623		Approved	ESG, ESG3, KIAA1547, HsT18976, GRG3	uc002asm.2	Q04726		ENST00000558939.1:c.235-3304T>C	15.37:g.70371801A>G		Somatic	0	39	0.00		0.5891488714521174	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	44	10.20	B4DPT0|E9PD64|F8W964|Q6PI57|Q8IVV6|Q8WVR2|Q9HCM5	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000558939.1	37	NULL	CCDS45293.1	15																																																																																			-	-		0.582	TLE3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MIR629	protein_coding	OTTHUMT00000416913.1	A	NM_005078	-		70371801	-1	no_errors	ENST00000385230	ensembl	human	known	74_37	rna	SNP	0.001	G
MYT1L	23040	genome.wustl.edu	37	2	1906955	1906955	+	Missense_Mutation	SNP	C	C	G			TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chr2:1906955C>G	ENST00000399161.2	-	14	2676	c.1929G>C	c.(1927-1929)aaG>aaC	p.K643N	MYT1L_ENST00000428368.2_Missense_Mutation_p.K641N	NM_015025.2	NP_055840.2	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	643					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(16)|lung(50)|ovary(5)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	97	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		CAAACGAGGTCTTGGAATATT	0.483																																																	0								ENSG00000186487						146.0	133.0	137.0					2																	1906955		1933	4137	6070	MYT1L	SO:0001583	missense	0			-	HGNC	AF036943	CCDS46222.1	2p25.3	2013-01-10			ENSG00000186487	ENSG00000186487		"""Zinc fingers, C2HC-type containing"""	7623	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 1"""	613084				9373037	Standard	XM_006711862		Approved	KIAA1106, NZF1, ZC2HC4B	uc002qxd.3	Q9UL68	OTTHUMG00000151407	ENST00000399161.2:c.1929G>C	2.37:g.1906955C>G	ENSP00000382114:p.Lys643Asn	Somatic	0	76	0.00		0.5891488714521174	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	42	16.00	A7E2C7|B2RP54|Q6IQ17|Q9UPP6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Myelin_TF,pfam_Znf_C2HC	p.K643N	ENST00000399161.2	37	c.1929		2	.	.	.	.	.	.	.	.	.	.	C	23.5	4.418827	0.83559	.	.	ENSG00000186487	ENST00000399161;ENST00000295067;ENST00000428368	T;T	0.59502	0.26;0.26	5.51	4.64	0.57946	Myelin transcription factor 1 (1);	0.000000	0.85682	D	0.000000	T	0.73281	0.3567	M	0.83953	2.67	0.58432	D	0.999999	D;D	0.59767	0.986;0.977	P;P	0.57204	0.815;0.647	T	0.78881	-0.2029	10	0.87932	D	0	-51.1505	14.589	0.68351	0.0:0.9295:0.0:0.0705	.	643;641	Q9UL68;Q9UL68-4	MYT1L_HUMAN;.	N	643;589;641	ENSP00000382114:K643N;ENSP00000396103:K641N	ENSP00000295067:K589N	K	-	3	2	MYT1L	1885962	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.886000	0.63149	1.338000	0.45544	0.561000	0.74099	AAG	-	pfam_Myelin_TF		0.483	MYT1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	MYT1L	protein_coding	OTTHUMT00000322493.1	C	NM_015025	-		1906955	-1	no_errors	ENST00000399161	ensembl	human	known	74_37	missense	SNP	1.000	G
AR	367	genome.wustl.edu	37	X	66765597	66765597	+	Silent	SNP	C	C	T			TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chrX:66765597C>T	ENST00000374690.3	+	1	1133	c.609C>T	c.(607-609)tcC>tcT	p.S203S	AR_ENST00000396044.3_Silent_p.S203S|AR_ENST00000513847.1_3'UTR|AR_ENST00000504326.1_Silent_p.S203S	NM_000044.3	NP_000035.2	P10275	ANDR_HUMAN	androgen receptor	201	Modulating.				androgen receptor signaling pathway (GO:0030521)|cell death (GO:0008219)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of integrin biosynthetic process (GO:0045720)|positive regulation of cell proliferation (GO:0008284)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein oligomerization (GO:0051259)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	androgen binding (GO:0005497)|androgen receptor activity (GO:0004882)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|prostate(11)|stomach(2)|upper_aerodigestive_tract(3)	67	all_cancers(1;0.173)|Prostate(1;2.27e-16)|all_epithelial(1;0.102)	all_lung(315;1.3e-11)			Bicalutamide(DB01128)|Cyproterone acetate(DB04839)|Danazol(DB01406)|Drospirenone(DB01395)|Drostanolone(DB00858)|Enzalutamide(DB08899)|Fludrocortisone(DB00687)|Fluoxymesterone(DB01185)|Flutamide(DB00499)|Ketoconazole(DB01026)|Levonorgestrel(DB00367)|Methyltestosterone(DB06710)|Nandrolone decanoate(DB08804)|Nandrolone phenpropionate(DB00984)|Nilutamide(DB00665)|Oxandrolone(DB00621)|Spironolactone(DB00421)|Testosterone Propionate(DB01420)|Testosterone(DB00624)	AAGCAGTATCCGAAGGCAGCA	0.587									Androgen Insensitivity Syndrome																																								0			GRCh37	CI920926	AR	I		ENSG00000169083						27.0	27.0	27.0					X																	66765597		2203	4300	6503	AR	SO:0001819	synonymous_variant	0	Familial Cancer Database	CAIS, Testicular Feminisation, AIS, Morris syndrome; incl. Reifenstein Syndrome	-	HGNC	M20132	CCDS14387.1, CCDS43965.1	Xq12	2013-01-16	2008-08-07		ENSG00000169083	ENSG00000169083		"""Nuclear hormone receptors"""	644	protein-coding gene	gene with protein product	"""testicular feminization"", ""Kennedy disease"""	313700	"""dihydrotestosterone receptor"", ""spinal and bulbar muscular atrophy"""	DHTR, SBMA		3353726, 3377788	Standard	NM_000044		Approved	AIS, NR3C4, SMAX1, HUMARA	uc004dwu.2	P10275	OTTHUMG00000021740	ENST00000374690.3:c.609C>T	X.37:g.66765597C>T		Somatic	0	121	0.00		0.5891488714521174	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	77	16.30	A2RUN2|B1AKD7|Q9UD95	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Andrgn_rcpt,pfam_Znf_hrmn_rcpt,pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Andrgn_rcpt,prints_Znf_hrmn_rcpt	p.S203	ENST00000374690.3	37	c.609	CCDS14387.1	X																																																																																			-	pfam_Andrgn_rcpt		0.587	AR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AR	protein_coding	OTTHUMT00000057007.1	C	NM_000044	-		66765597	+1	no_errors	ENST00000374690	ensembl	human	known	74_37	silent	SNP	0.000	T
ZNF808	388558	genome.wustl.edu	37	19	53058345	53058345	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chr19:53058345C>T	ENST00000359798.4	+	5	2356	c.2176C>T	c.(2176-2178)Cgt>Tgt	p.R726C		NM_001039886.3	NP_001034975.2	Q8N4W9	ZN808_HUMAN	zinc finger protein 808	726					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(8)|kidney(3)|lung(12)|urinary_tract(1)	24				OV - Ovarian serous cystadenocarcinoma(262;0.00501)|GBM - Glioblastoma multiforme(134;0.0213)		TGTATGCCATCGTAGAATTCA	0.433																																																	0								ENSG00000198482						212.0	206.0	208.0					19																	53058345		2203	4300	6503	ZNF808	SO:0001583	missense	0			-	HGNC	CR749856	CCDS46167.1	19q13.41	2013-01-08			ENSG00000198482	ENSG00000198482		"""Zinc fingers, C2H2-type"", ""-"""	33230	protein-coding gene	gene with protein product							Standard	NM_001039886		Approved		uc010epq.1	Q8N4W9	OTTHUMG00000158230	ENST00000359798.4:c.2176C>T	19.37:g.53058345C>T	ENSP00000352846:p.Arg726Cys	Somatic	0	130	0.00		0.5891488714521174	9	25.00	3	WXS	Illumina HiSeq 2500	Phase_IV	tier1	37	111	25.00	Q68CN7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R726C	ENST00000359798.4	37	c.2176	CCDS46167.1	19	.	.	.	.	.	.	.	.	.	.	.	12.63	1.995357	0.35226	.	.	ENSG00000198482	ENST00000359798	T	0.18502	2.21	1.58	1.58	0.23477	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.19005	0.0456	L	0.60904	1.88	0.09310	N	0.99999	B	0.18166	0.026	B	0.21546	0.035	T	0.25187	-1.0139	9	0.87932	D	0	.	10.0866	0.42421	0.0:1.0:0.0:0.0	.	726	Q8N4W9	ZN808_HUMAN	C	726	ENSP00000352846:R726C	ENSP00000352846:R726C	R	+	1	0	ZNF808	57750157	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	-0.436000	0.06922	0.846000	0.35142	0.313000	0.20887	CGT	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.433	ZNF808-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF808	protein_coding	OTTHUMT00000350447.3	C	NM_001039886	-		53058345	+1	no_errors	ENST00000359798	ensembl	human	known	74_37	missense	SNP	0.336	T
TAAR2	9287	genome.wustl.edu	37	6	132945357	132945357	+	Nonsense_Mutation	SNP	T	T	A			TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chr6:132945357T>A	ENST00000367931.1	-	1	57	c.58A>T	c.(58-60)Aag>Tag	p.K20*	TAAR2_ENST00000537809.1_5'UTR			Q9P1P5	TAAR2_HUMAN	trace amine associated receptor 2	20					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|trace-amine receptor activity (GO:0001594)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|skin(1)	23	Breast(56;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00608)|GBM - Glioblastoma multiforme(226;0.0151)		GGGCCTACCTTTTTTGTCTGT	0.358																																																	0								ENSG00000146378						170.0	144.0	153.0					6																	132945357		2203	4300	6503	TAAR2	SO:0001587	stop_gained	0			-	HGNC	AF112460	CCDS34541.1, CCDS5157.1	6q24	2012-08-08	2005-02-23	2005-02-24	ENSG00000146378	ENSG00000146378		"""GPCR / Class A : Trace amine associated receptors"""	4514	protein-coding gene	gene with protein product		604849	"""G protein-coupled receptor 58"""	GPR58		10684976, 15718104	Standard	NM_014626		Approved		uc003qdl.1	Q9P1P5	OTTHUMG00000015585	ENST00000367931.1:c.58A>T	6.37:g.132945357T>A	ENSP00000356908:p.Lys20*	Somatic	0	17	0.00		0.5891488714521174	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	31	18.42	Q5QD02|Q6NWS1|Q6NWS2|Q6NWS3	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_TAAR_fam	p.K20*	ENST00000367931.1	37	c.58	CCDS34541.1	6	.	.	.	.	.	.	.	.	.	.	T	23.4	4.414021	0.83449	.	.	ENSG00000146378	ENST00000367931	.	.	.	3.68	1.24	0.21308	.	1.673320	0.03330	N	0.193167	.	.	.	.	.	.	0.22762	N	0.998765	.	.	.	.	.	.	.	.	.	.	0.17369	T	0.5	-2.8966	3.6679	0.08262	0.0:0.1243:0.2424:0.6333	.	.	.	.	X	20	.	ENSP00000356908:K20X	K	-	1	0	TAAR2	132987050	0.001000	0.12720	0.002000	0.10522	0.449000	0.32228	-0.205000	0.09411	0.266000	0.21894	0.528000	0.53228	AAG	-	NULL		0.358	TAAR2-002	KNOWN	basic|CCDS	protein_coding	TAAR2	protein_coding	OTTHUMT00000390735.1	T	NM_014626	-		132945357	-1	no_errors	ENST00000367931	ensembl	human	known	74_37	nonsense	SNP	0.003	A
SRGAP2-AS1	100873165	genome.wustl.edu	37	1	121138882	121138882	+	lincRNA	SNP	A	A	G	rs77721662		TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chr1:121138882A>G	ENST00000417218.1	+	0	269				RP11-343N15.1_ENST00000437515.1_lincRNA																							TGGCTCAGGGATTCTTTGCCT	0.687																																																	0								ENSG00000227082																																			AL592494.5			0			-	Clone_based_vega_gene																													1.37:g.121138882A>G		Somatic	0	16	0.00		0.5891488714521174	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	5	33.33		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000417218.1	37	NULL		1																																																																																			-	-		0.687	AL592494.5-001	KNOWN	basic	lincRNA	ENSG00000227082	lincRNA	OTTHUMT00000036739.1	A		rs77721662		121138882	+1	no_errors	ENST00000417218	ensembl	human	known	74_37	rna	SNP	0.044	G
HIST3H3	8290	genome.wustl.edu	37	1	228612940	228612940	+	Silent	SNP	G	G	A			TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chr1:228612940G>A	ENST00000366696.1	-	1	86	c.87C>T	c.(85-87)agC>agT	p.S29S		NM_003493.2	NP_003484.1	Q16695	H31T_HUMAN	histone cluster 3, H3	29					telomere maintenance (GO:0000723)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			large_intestine(1)|lung(2)|prostate(2)|skin(1)	6		Prostate(94;0.0724)				TGGCAGGTGCGCTCTTGCGAG	0.657																																																	0								ENSG00000168148						33.0	39.0	36.0					1																	228612940		2203	4297	6500	HIST3H3	SO:0001819	synonymous_variant	0			-	HGNC	Z49861	CCDS1572.1	1q42.13	2012-09-19	2006-10-11	2003-02-21	ENSG00000168148	ENSG00000168148		"""Histones / Replication-dependent"""	4778	protein-coding gene	gene with protein product		602820	"""H3 histone family, member T"", ""histone 3, H3"""	H3FT		8834248, 12408966	Standard	NM_003493		Approved	H3t, H3/g, H3.4	uc001hsx.1	Q16695	OTTHUMG00000040044	ENST00000366696.1:c.87C>T	1.37:g.228612940G>A		Somatic	0	35	0.00		0.5891488714521174	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	22	18.52	B2R5K3|Q6FGU4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H3,prints_Histone_H3	p.S29	ENST00000366696.1	37	c.87	CCDS1572.1	1																																																																																			-	superfamily_Histone-fold,prints_Histone_H3		0.657	HIST3H3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST3H3	protein_coding	OTTHUMT00000096595.2	G	NM_003493	-		228612940	-1	no_errors	ENST00000366696	ensembl	human	known	74_37	silent	SNP	1.000	A
MEF2C	4208	genome.wustl.edu	37	5	88025139	88025139	+	Nonsense_Mutation	SNP	G	G	T			TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chr5:88025139G>T	ENST00000437473.2	-	9	1277	c.860C>A	c.(859-861)tCg>tAg	p.S287*	MEF2C_ENST00000510942.1_Nonsense_Mutation_p.S279*|MEF2C_ENST00000514028.1_Nonsense_Mutation_p.S287*|MEF2C_ENST00000539796.1_Nonsense_Mutation_p.S231*|MEF2C_ENST00000503554.1_5'Flank|MEF2C_ENST00000506554.1_Nonsense_Mutation_p.S287*|MEF2C_ENST00000340208.5_Nonsense_Mutation_p.S297*|MEF2C_ENST00000504921.2_Nonsense_Mutation_p.S287*|MEF2C_ENST00000508569.1_Nonsense_Mutation_p.S279*|MEF2C_ENST00000424173.2_Nonsense_Mutation_p.S277*|MEF2C_ENST00000514015.1_Nonsense_Mutation_p.S287*	NM_001193350.1|NM_002397.4	NP_001180279.1|NP_002388.2	Q06413	MEF2C_HUMAN	myocyte enhancer factor 2C	287					apoptotic process (GO:0006915)|B cell homeostasis (GO:0001782)|B cell proliferation (GO:0042100)|B cell receptor signaling pathway (GO:0050853)|blood vessel development (GO:0001568)|blood vessel remodeling (GO:0001974)|cardiac muscle hypertrophy in response to stress (GO:0014898)|cardiac ventricle formation (GO:0003211)|cartilage morphogenesis (GO:0060536)|cell morphogenesis involved in neuron differentiation (GO:0048667)|cellular response to calcium ion (GO:0071277)|cellular response to drug (GO:0035690)|cellular response to fluid shear stress (GO:0071498)|cellular response to glucose stimulus (GO:0071333)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to parathyroid hormone stimulus (GO:0071374)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cellular response to trichostatin A (GO:0035984)|chondrocyte differentiation (GO:0002062)|dentate gyrus development (GO:0021542)|embryonic viscerocranium morphogenesis (GO:0048703)|endochondral ossification (GO:0001958)|epithelial cell proliferation involved in renal tubule morphogenesis (GO:2001013)|germinal center formation (GO:0002467)|glomerulus morphogenesis (GO:0072102)|heart development (GO:0007507)|heart looping (GO:0001947)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|MAPK cascade (GO:0000165)|melanocyte differentiation (GO:0030318)|monocyte differentiation (GO:0030224)|muscle cell differentiation (GO:0042692)|muscle cell fate determination (GO:0007521)|muscle organ development (GO:0007517)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|myotube differentiation (GO:0014902)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of gene expression (GO:0010629)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of ossification (GO:0030279)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nephron tubule epithelial cell differentiation (GO:0072160)|nervous system development (GO:0007399)|neural crest cell differentiation (GO:0014033)|neuron development (GO:0048666)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|osteoblast differentiation (GO:0001649)|outflow tract morphogenesis (GO:0003151)|palate development (GO:0060021)|platelet formation (GO:0030220)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of behavioral fear response (GO:2000987)|positive regulation of bone mineralization (GO:0030501)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell proliferation in bone marrow (GO:0071864)|positive regulation of gene expression (GO:0010628)|positive regulation of macrophage apoptotic process (GO:2000111)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein homodimerization activity (GO:0090073)|positive regulation of skeletal muscle cell differentiation (GO:2001016)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|primary heart field specification (GO:0003138)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of dendritic spine development (GO:0060998)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of germinal center formation (GO:0002634)|regulation of megakaryocyte differentiation (GO:0045652)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuron apoptotic process (GO:0043523)|regulation of neurotransmitter secretion (GO:0046928)|regulation of sarcomere organization (GO:0060297)|regulation of synapse assembly (GO:0051963)|regulation of synaptic activity (GO:0060025)|regulation of synaptic plasticity (GO:0048167)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of transcription, DNA-templated (GO:0006355)|renal tubule morphogenesis (GO:0061333)|response to ischemia (GO:0002931)|response to virus (GO:0009615)|response to vitamin E (GO:0033197)|secondary heart field specification (GO:0003139)|sinoatrial valve morphogenesis (GO:0003185)|skeletal muscle tissue development (GO:0007519)|smooth muscle cell differentiation (GO:0051145)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|ventricular cardiac muscle cell differentiation (GO:0055012)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|sarcomere (GO:0030017)	activating transcription factor binding (GO:0033613)|AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|miRNA binding (GO:0035198)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(9)|lung(9)|ovary(2)|pancreas(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	40		all_cancers(142;6.67e-05)|all_epithelial(76;7.77e-07)|Lung NSC(167;0.00566)|all_lung(232;0.00732)|Colorectal(57;0.0959)|Ovarian(174;0.1)		OV - Ovarian serous cystadenocarcinoma(54;1.04e-33)|Epithelial(54;1.6e-28)|all cancers(79;2.9e-25)		TGACTGAGCCGACTGGGAGTT	0.338										HNSCC(66;0.2)																																							0								ENSG00000081189						59.0	65.0	63.0					5																	88025139		1816	4079	5895	MEF2C	SO:0001587	stop_gained	0			-	HGNC	AL833268	CCDS47244.1, CCDS47245.1, CCDS54877.1, CCDS54878.1	5q14.3	2013-07-03	2007-04-24		ENSG00000081189	ENSG00000081189		"""Myocyte enhancer factors"""	6996	protein-coding gene	gene with protein product		600662				8455629	Standard	NM_002397		Approved		uc003kjl.3	Q06413	OTTHUMG00000162634	ENST00000437473.2:c.860C>A	5.37:g.88025139G>T	ENSP00000396219:p.Ser287*	Somatic	0	22	0.00		0.5891488714521174	34	5.56	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	22	38.89	C9JMZ0|D7F7N5|F8W7V7	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TF_MADSbox,pfam_HJURP_C,superfamily_TF_MADSbox,smart_TF_MADSbox,prints_TF_MADSbox,pfscan_TF_MADSbox	p.S287*	ENST00000437473.2	37	c.860	CCDS47245.1	5	.	.	.	.	.	.	.	.	.	.	G	43	10.398393	0.99398	.	.	ENSG00000081189	ENST00000340208;ENST00000424173;ENST00000504921;ENST00000514028;ENST00000437473;ENST00000510942;ENST00000506554;ENST00000508569;ENST00000514015;ENST00000539796	.	.	.	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-3.9202	20.0919	0.97823	0.0:0.0:1.0:0.0	.	.	.	.	X	297;277;287;287;287;279;287;279;287;231	.	ENSP00000340874:S297X	S	-	2	0	MEF2C	88060895	1.000000	0.71417	1.000000	0.80357	0.916000	0.54674	9.379000	0.97198	2.810000	0.96702	0.650000	0.86243	TCG	-	NULL		0.338	MEF2C-003	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	MEF2C	protein_coding	OTTHUMT00000369817.1	G	NM_002397	-		88025139	-1	no_errors	ENST00000437473	ensembl	human	known	74_37	nonsense	SNP	1.000	T
FAM92B	339145	genome.wustl.edu	37	16	85141485	85141485	+	Silent	SNP	C	C	A			TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chr16:85141485C>A	ENST00000539556.1	-	4	548	c.393G>T	c.(391-393)ctG>ctT	p.L131L		NM_198491.1	NP_940893.1	Q6ZTR7	FA92B_HUMAN	family with sequence similarity 92, member B	131										breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)	16						ACTTCTGCCTCAGTTTCTCCA	0.502																																																	0								ENSG00000153789						204.0	198.0	200.0					16																	85141485		2198	4300	6498	FAM92B	SO:0001819	synonymous_variant	0			-	HGNC		CCDS32500.1	16q24.1	2005-09-22				ENSG00000153789			24781	protein-coding gene	gene with protein product						12477932	Standard	NM_198491		Approved	FLJ44299	uc021tlz.1	Q6ZTR7		ENST00000539556.1:c.393G>T	16.37:g.85141485C>A		Somatic	0	62	0.00		0.5891488714521174	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	29	19.44		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_FAM92	p.L131	ENST00000539556.1	37	c.393	CCDS32500.1	16																																																																																			-	pfam_FAM92		0.502	FAM92B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM92B	protein_coding		C	NM_198491	-		85141485	-1	no_errors	ENST00000539556	ensembl	human	known	74_37	silent	SNP	0.999	A
DVL1	1855	genome.wustl.edu	37	1	1275822	1275822	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chr1:1275822G>A	ENST00000378888.5	-	6	951	c.667C>T	c.(667-669)Cgg>Tgg	p.R223W	DVL1_ENST00000378891.5_Missense_Mutation_p.R223W			O14640	DVL1_HUMAN	dishevelled segment polarity protein 1	223	Poly-Arg.				axon extension (GO:0048675)|axon guidance (GO:0007411)|canonical Wnt signaling pathway (GO:0060070)|cochlea morphogenesis (GO:0090103)|collateral sprouting (GO:0048668)|convergent extension (GO:0060026)|convergent extension involved in neural plate elongation (GO:0022007)|cytoplasmic microtubule organization (GO:0031122)|dendrite morphogenesis (GO:0048813)|intracellular signal transduction (GO:0035556)|negative regulation of protein binding (GO:0032091)|negative regulation of protein kinase activity (GO:0006469)|neural tube development (GO:0021915)|neuromuscular junction development (GO:0007528)|neurotransmitter secretion (GO:0007269)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of neuron projection development (GO:0010976)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|prepulse inhibition (GO:0060134)|protein localization to microtubule (GO:0035372)|protein localization to nucleus (GO:0034504)|receptor clustering (GO:0043113)|regulation of neurotransmitter levels (GO:0001505)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|social behavior (GO:0035176)|synapse organization (GO:0050808)|transcription from RNA polymerase II promoter (GO:0006366)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	axon (GO:0030424)|cell cortex (GO:0005938)|clathrin-coated vesicle (GO:0030136)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|growth cone (GO:0030426)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synapse (GO:0045202)	enzyme binding (GO:0019899)|frizzled binding (GO:0005109)|identical protein binding (GO:0042802)|protein kinase binding (GO:0019901)|Rac GTPase binding (GO:0048365)			endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	13	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;2.83e-35)|OV - Ovarian serous cystadenocarcinoma(86;3.77e-21)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.0025)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.145)		TGCTTCCTCCGCCGGCGTTTG	0.667																																																	0								ENSG00000107404						34.0	40.0	38.0					1																	1275822		2196	4294	6490	DVL1	SO:0001583	missense	0			-	HGNC	AF006011	CCDS22.1	1p36	2013-05-22	2013-05-22		ENSG00000107404	ENSG00000107404		"""Dishevelled homologs"""	3084	protein-coding gene	gene with protein product		601365	"""dishevelled 1 (homologous to Drosophila dsh)"", ""dishevelled, dsh homolog 1 (Drosophila)"""			8817329	Standard	NM_004421		Approved		uc001aer.4	O14640	OTTHUMG00000003069	ENST00000378888.5:c.667C>T	1.37:g.1275822G>A	ENSP00000368166:p.Arg223Trp	Somatic	0	90	0.00		0.5891488714521174	18	68.42	39	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	57	19.72	Q5TA33|Q5TA35	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Dishevelled_C-dom,pfam_DIX,pfam_Dishevelled_protein_dom,pfam_PDZ,pfam_DEP_dom,superfamily_PDZ,smart_DIX,smart_PDZ,smart_DEP_dom,pfscan_DEP_dom,pfscan_DIX,pfscan_PDZ,prints_Dishevelled_fam	p.R223W	ENST00000378888.5	37	c.667		1	.	.	.	.	.	.	.	.	.	.	G	15.09	2.729294	0.48833	.	.	ENSG00000107404	ENST00000378891;ENST00000378888	T;T	0.07688	3.22;3.17	3.6	1.41	0.22369	.	0.064020	0.64402	D	0.000008	T	0.27313	0.0670	M	0.80422	2.495	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.12578	-1.0542	10	0.87932	D	0	.	12.288	0.54803	0.0:0.0:0.6266:0.3734	.	223	O14640-2	.	W	223	ENSP00000368169:R223W;ENSP00000368166:R223W	ENSP00000368166:R223W	R	-	1	2	DVL1	1265685	1.000000	0.71417	0.960000	0.40013	0.610000	0.37248	2.097000	0.41748	0.815000	0.34398	0.306000	0.20318	CGG	-	superfamily_PDZ		0.667	DVL1-004	KNOWN	basic|appris_principal	protein_coding	DVL1	protein_coding	OTTHUMT00000008490.1	G	NM_004421	-		1275822	-1	no_errors	ENST00000378888	ensembl	human	known	74_37	missense	SNP	1.000	A
TMPRSS11A	339967	genome.wustl.edu	37	4	68784778	68784778	+	Missense_Mutation	SNP	G	G	A	rs572842431		TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chr4:68784778G>A	ENST00000334830.7	-	8	1620	c.874C>T	c.(874-876)Cgc>Tgc	p.R292C	TMPRSS11A_ENST00000396188.2_Missense_Mutation_p.R289C|TMPRSS11A_ENST00000508048.1_Missense_Mutation_p.R288C|UBA6-AS1_ENST00000500538.2_RNA			Q6ZMR5	TM11A_HUMAN	transmembrane protease, serine 11A	292	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cell cycle (GO:0007049)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	serine-type endopeptidase activity (GO:0004252)	p.R292C(1)		breast(1)|cervix(2)|kidney(1)|large_intestine(8)|lung(11)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	29						CAAATCTGGCGTATGTCATCC	0.463													G|||	1	0.000199681	0.0	0.0	5008	,	,		17741	0.001		0.0	False		,,,				2504	0.0				NSCLC(26;2 894 10941 14480 22546)												1	Substitution - Missense(1)	prostate(1)						ENSG00000187054						155.0	158.0	157.0					4																	68784778		2203	4300	6503	TMPRSS11A	SO:0001583	missense	0			-	HGNC	AF071882	CCDS3519.1	4q13.2	2010-04-13			ENSG00000187054	ENSG00000187054		"""Serine peptidases / Transmembrane"""	27954	protein-coding gene	gene with protein product		611704				15328353	Standard	NM_182606		Approved	ECRG1	uc003hdr.1	Q6ZMR5	OTTHUMG00000129303	ENST00000334830.7:c.874C>T	4.37:g.68784778G>A	ENSP00000334611:p.Arg292Cys	Somatic	0	54	0.00		0.5891488714521174	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	57	10.94	J3KNQ8|Q2NKI9|Q6JE90|Q7RTY4|Q86TK8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_S1,pfam_SEA_dom,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pirsf_Pept_S1A_HAT/DESC1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.R292C	ENST00000334830.7	37	c.874	CCDS3519.1	4	.	.	.	.	.	.	.	.	.	.	G	12.97	2.097778	0.37048	.	.	ENSG00000187054	ENST00000508048;ENST00000334830;ENST00000396188;ENST00000513536	D;D;D;D	0.89746	-2.56;-2.56;-2.56;-2.56	5.36	5.36	0.76844	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.56097	D	0.000023	D	0.95098	0.8412	M	0.86740	2.835	0.19300	N	0.99998	D;D	0.89917	1.0;1.0	D;D	0.91635	0.989;0.999	D	0.89808	0.3980	10	0.87932	D	0	.	16.5682	0.84604	0.0:0.0:1.0:0.0	.	289;292	B5MDI9;Q6ZMR5	.;TM11A_HUMAN	C	288;292;289;256	ENSP00000426911:R288C;ENSP00000334611:R292C;ENSP00000379491:R289C;ENSP00000427621:R256C	ENSP00000334611:R292C	R	-	1	0	TMPRSS11A	68467373	0.968000	0.33430	0.013000	0.15412	0.126000	0.20510	5.358000	0.66064	2.512000	0.84698	0.591000	0.81541	CGC	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pirsf_Pept_S1A_HAT/DESC1,pfscan_Peptidase_S1		0.463	TMPRSS11A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TMPRSS11A	protein_coding	OTTHUMT00000251433.3	G	NM_182606	rs141574463		68784778	-1	no_errors	ENST00000334830	ensembl	human	known	74_37	missense	SNP	0.044	A
MAGEC1	9947	genome.wustl.edu	37	X	140994549	140994549	+	Nonsense_Mutation	SNP	C	C	A			TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chrX:140994549C>A	ENST00000285879.4	+	4	1645	c.1359C>A	c.(1357-1359)taC>taA	p.Y453*	MAGEC1_ENST00000406005.2_Intron	NM_005462.4	NP_005453.2	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	453										breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(22)|lung(60)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(1)	127	Acute lymphoblastic leukemia(192;6.56e-05)					CTTTCTCCTACACTTTATTGA	0.468										HNSCC(15;0.026)																																							0								ENSG00000155495						94.0	104.0	100.0					X																	140994549		2197	4291	6488	MAGEC1	SO:0001587	stop_gained	0			-	HGNC	AF064589	CCDS35417.1	Xq26	2009-03-18			ENSG00000155495	ENSG00000155495			6812	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 1"""	300223				9485030, 9618514	Standard	NM_005462		Approved	MAGE-C1, CT7, MGC39366, CT7.1	uc004fbt.3	O60732	OTTHUMG00000022569	ENST00000285879.4:c.1359C>A	X.37:g.140994549C>A	ENSP00000285879:p.Tyr453*	Somatic	0	117	0.00		0.5891488714521174	0	100.00	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	204	11.30	A0PK03|O75451|Q8TCV4	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MAGE,pfscan_MAGE	p.Y453*	ENST00000285879.4	37	c.1359	CCDS35417.1	X	.	.	.	.	.	.	.	.	.	.	c	19.77	3.889818	0.72524	.	.	ENSG00000155495	ENST00000285879	.	.	.	0.131	0.131	0.14755	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	5.9545	0.19265	0.0:0.9994:0.0:6.0E-4	.	.	.	.	X	453	.	ENSP00000285879:Y453X	Y	+	3	2	MAGEC1	140822215	0.000000	0.05858	0.008000	0.14137	0.008000	0.06430	-0.370000	0.07523	0.157000	0.19338	0.158000	0.16466	TAC	-	NULL		0.468	MAGEC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAGEC1	protein_coding	OTTHUMT00000058604.1	C	NM_005462	-		140994549	+1	no_errors	ENST00000285879	ensembl	human	known	74_37	nonsense	SNP	0.001	A
POLE	5426	genome.wustl.edu	37	12	133249233	133249233	+	Missense_Mutation	SNP	T	T	C			TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chr12:133249233T>C	ENST00000320574.5	-	15	1709	c.1666A>G	c.(1666-1668)Atc>Gtc	p.I556V	POLE_ENST00000535270.1_Missense_Mutation_p.I529V	NM_006231.2	NP_006222.2	Q07864	DPOE1_HUMAN	polymerase (DNA directed), epsilon, catalytic subunit	556					base-excision repair, gap-filling (GO:0006287)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA synthesis involved in DNA repair (GO:0000731)|G1/S transition of mitotic cell cycle (GO:0000082)|in utero embryonic development (GO:0001701)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	cytoplasm (GO:0005737)|epsilon DNA polymerase complex (GO:0008622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|nucleotide binding (GO:0000166)|zinc ion binding (GO:0008270)			NS(2)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(41)|ovary(3)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	89	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0416)		OV - Ovarian serous cystadenocarcinoma(86;5.22e-08)|Epithelial(86;4.03e-07)|all cancers(50;1.18e-05)	Cladribine(DB00242)	CGGCAAGGGATATCGCTGCGG	0.567								DNA polymerases (catalytic subunits)																																									0								ENSG00000177084						92.0	92.0	92.0					12																	133249233		2203	4300	6503	POLE	SO:0001583	missense	0			-	HGNC		CCDS9278.1	12q24.3	2014-09-17	2012-05-18		ENSG00000177084	ENSG00000177084		"""DNA polymerases"""	9177	protein-coding gene	gene with protein product	"""DNA polymerase epsilon catalytic subunit A"""	174762	"""polymerase (DNA directed), epsilon"""			8020968	Standard	NM_006231		Approved	POLE1	uc001uks.1	Q07864	OTTHUMG00000168045	ENST00000320574.5:c.1666A>G	12.37:g.133249233T>C	ENSP00000322570:p.Ile556Val	Somatic	0	39	0.00		0.5891488714521174	13	13.33	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	20	23.08	Q13533|Q86VH9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DNA_pol_e_suA_C,pfam_DNA-dir_DNA_pol_B_exonuc,pfam_DNA-dir_DNA_pol_B_multi_dom,pfam_3'-5'_exonuclease_PolB-like,superfamily_RNaseH-like_dom,smart_DNA-dir_DNA_pol_B	p.I556V	ENST00000320574.5	37	c.1666	CCDS9278.1	12	.	.	.	.	.	.	.	.	.	.	T	28.4	4.917377	0.92249	.	.	ENSG00000177084	ENST00000320574;ENST00000455752;ENST00000535270;ENST00000539006;ENST00000376577;ENST00000535934	T;T;T;T	0.18174	3.82;3.82;3.84;2.23	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	T	0.47857	0.1468	M	0.89715	3.055	0.80722	D	1	D;P	0.60160	0.987;0.899	P;P	0.62382	0.901;0.723	T	0.58657	-0.7598	10	0.72032	D	0.01	.	15.8998	0.79365	0.0:0.0:0.0:1.0	.	529;556	F5H1D6;Q07864	.;DPOE1_HUMAN	V	556;567;529;336;491;174	ENSP00000322570:I556V;ENSP00000406383:I567V;ENSP00000445753:I529V;ENSP00000442519:I336V	ENSP00000322570:I556V	I	-	1	0	POLE	131759306	1.000000	0.71417	1.000000	0.80357	0.831000	0.47069	7.956000	0.87863	2.165000	0.68154	0.260000	0.18958	ATC	-	smart_DNA-dir_DNA_pol_B		0.567	POLE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLE	protein_coding	OTTHUMT00000397689.2	T	NM_006231	-		133249233	-1	no_errors	ENST00000320574	ensembl	human	known	74_37	missense	SNP	1.000	C
IFNA16	3449	genome.wustl.edu	37	9	21217127	21217127	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chr9:21217127C>T	ENST00000380216.1	-	1	183	c.178G>A	c.(178-180)Gga>Aga	p.G60R		NM_002173.2	NP_002164.1	P05015	IFN16_HUMAN	interferon, alpha 16	60					adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|natural killer cell activation involved in immune response (GO:0002323)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to exogenous dsRNA (GO:0043330)|T cell activation involved in immune response (GO:0002286)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|type I interferon receptor binding (GO:0005132)			central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)|skin(1)	13				Lung(24;2.12e-22)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.116)		TGGGGGAATCCGAAATCATAT	0.507																																																	0								ENSG00000147885						111.0	111.0	111.0					9																	21217127		2203	4300	6503	IFNA16	SO:0001583	missense	0			-	HGNC		CCDS34996.1	9p22	2010-12-10			ENSG00000147885	ENSG00000147885		"""Interferons"""	5421	protein-coding gene	gene with protein product		147580				1385305	Standard	NM_002173		Approved	IFN-alphaO	uc003zor.1	P05015	OTTHUMG00000019663	ENST00000380216.1:c.178G>A	9.37:g.21217127C>T	ENSP00000369564:p.Gly60Arg	Somatic	0	114	0.00		0.5891488714521174	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	105	18.60	Q5VV12	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Interferon_alpha/beta/delta,superfamily_4_helix_cytokine-like_core,smart_Interferon_alpha/beta/delta,prints_Interferon_alpha/beta/delta	p.G60R	ENST00000380216.1	37	c.178	CCDS34996.1	9	.	.	.	.	.	.	.	.	.	.	-	2.649	-0.282294	0.05642	.	.	ENSG00000147885	ENST00000380216	T	0.03212	4.01	2.51	-0.449	0.12226	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	2.223100	0.01555	N	0.019843	T	0.04092	0.0114	L	0.38175	1.15	0.09310	N	1	B	0.15473	0.013	B	0.25291	0.059	T	0.42749	-0.9433	10	0.33141	T	0.24	.	2.3694	0.04327	0.4346:0.3074:0.0:0.258	.	60	P05015	IFN16_HUMAN	R	60	ENSP00000369564:G60R	ENSP00000369564:G60R	G	-	1	0	IFNA16	21207127	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-1.135000	0.03225	-0.015000	0.14150	0.184000	0.17185	GGA	-	pfam_Interferon_alpha/beta/delta,superfamily_4_helix_cytokine-like_core,smart_Interferon_alpha/beta/delta,prints_Interferon_alpha/beta/delta		0.507	IFNA16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFNA16	protein_coding	OTTHUMT00000051892.1	C	NM_002173	-		21217127	-1	no_errors	ENST00000380216	ensembl	human	known	74_37	missense	SNP	0.000	T
ZFYVE28	57732	genome.wustl.edu	37	4	2321944	2321944	+	Silent	SNP	G	G	A			TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chr4:2321944G>A	ENST00000290974.2	-	7	1095	c.756C>T	c.(754-756)gaC>gaT	p.D252D	ZFYVE28_ENST00000511071.1_Silent_p.D222D|ZFYVE28_ENST00000515312.1_Silent_p.D182D|RP11-478C1.7_ENST00000510632.1_RNA	NM_020972.2	NP_066023.2	Q9HCC9	LST2_HUMAN	zinc finger, FYVE domain containing 28	252					negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)	cytosol (GO:0005829)|early endosome membrane (GO:0031901)	metal ion binding (GO:0046872)|phosphatidylinositol-3-phosphate binding (GO:0032266)			NS(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(17)|ovary(1)|pancreas(1)|prostate(1)|skin(4)	31						GCTCGGACATGTCTTCCACCT	0.612																																																	0								ENSG00000159733						117.0	102.0	107.0					4																	2321944		2203	4300	6503	ZFYVE28	SO:0001819	synonymous_variant	0			-	HGNC	AK126692	CCDS33942.1, CCDS54708.1, CCDS54709.1, CCDS54710.1, CCDS54711.1, CCDS54712.1	4p16.3	2008-05-02			ENSG00000159733	ENSG00000159733		"""Zinc fingers, FYVE domain containing"""	29334	protein-coding gene	gene with protein product		614176				10997877	Standard	NM_020972		Approved	KIAA1643	uc003gex.2	Q9HCC9	OTTHUMG00000160292	ENST00000290974.2:c.756C>T	4.37:g.2321944G>A		Somatic	0	158	0.00		0.5891488714521174	12	7.69	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	125	14.97	B2RP83|B3KX50|B7Z1Q7|B7Z2G9|B7Z2M2|B7ZB19|E9PB54|E9PB64|E9PG77|Q7Z6J3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,smart_Znf_FYVE,pfscan_Znf_FYVE-rel	p.D252	ENST00000290974.2	37	c.756	CCDS33942.1	4																																																																																			-	NULL		0.612	ZFYVE28-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZFYVE28	protein_coding	OTTHUMT00000360078.1	G	XM_035371	-		2321944	-1	no_errors	ENST00000290974	ensembl	human	known	74_37	silent	SNP	1.000	A
MYT1	4661	genome.wustl.edu	37	20	62839308	62839308	+	Silent	SNP	C	C	A			TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chr20:62839308C>A	ENST00000328439.1	+	7	1123	c.759C>A	c.(757-759)ggC>ggA	p.G253G	MYT1_ENST00000360149.4_Intron|MYT1_ENST00000536311.1_Silent_p.G253G	NM_004535.2	NP_004526.1	Q99640	PMYT1_HUMAN	myelin transcription factor 1	0	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of phosphatase activity (GO:0010923)|regulation of cell cycle (GO:0051726)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of mitosis (GO:0007088)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(12)|liver(1)|lung(17)|ovary(5)|prostate(2)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55	all_cancers(38;1.82e-11)|all_epithelial(29;3.3e-13)|Lung NSC(23;5.21e-10)|all_lung(23;1.92e-09)					AGCAGAAAGGCATCCTGAGTC	0.597																																					GBM(59;481 1041 20555 21139 33705)												0								ENSG00000196132						29.0	29.0	29.0					20																	62839308		2203	4300	6503	MYT1	SO:0001819	synonymous_variant	0			-	HGNC	M96980	CCDS13558.1	20q13.33	2014-03-24			ENSG00000196132	ENSG00000196132		"""Zinc fingers, C2HC-type containing"""	7622	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 2"""	600379		PLPB1		1280325, 9268380	Standard	NM_004535		Approved	MTF1, MYTI, ZC2HC4A, NZF2	uc002yii.3	Q01538	OTTHUMG00000149988	ENST00000328439.1:c.759C>A	20.37:g.62839308C>A		Somatic	0	23	0.00		0.5891488714521174	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	15	16.67	B3KUN8|B4DXD4|D3DUA4|F8W164|I3L1V2|O14731|Q7LE24|Q8TCM9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Myelin_TF,pfam_Znf_C2HC	p.G253	ENST00000328439.1	37	c.759	CCDS13558.1	20																																																																																			-	NULL		0.597	MYT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYT1	protein_coding	OTTHUMT00000080297.1	C	NM_004535	-		62839308	+1	no_errors	ENST00000536311	ensembl	human	known	74_37	silent	SNP	0.000	A
DNAH8	1769	genome.wustl.edu	37	6	38980307	38980307	+	Silent	SNP	G	G	T			TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chr6:38980307G>T	ENST00000359357.3	+	89	13211	c.12957G>T	c.(12955-12957)ctG>ctT	p.L4319L	DNAH8_ENST00000441566.1_Silent_p.L4283L			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	4319					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						CGTCCACACTGGGCTTCTGGT	0.423																																																	0								ENSG00000124721						185.0	173.0	177.0					6																	38980307		2203	4300	6503	DNAH8	SO:0001819	synonymous_variant	0			-	HGNC	Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.12957G>T	6.37:g.38980307G>T		Somatic	0	29	0.00		0.5891488714521174	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	39	18.75	O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.L4319	ENST00000359357.3	37	c.12957		6																																																																																			-	pfam_Dynein_heavy_dom		0.423	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	DNAH8	protein_coding	OTTHUMT00000043574.1	G	NM_001206927	-		38980307	+1	no_errors	ENST00000359357	ensembl	human	known	74_37	silent	SNP	1.000	T
VAV1	7409	genome.wustl.edu	37	19	6773005	6773005	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chr19:6773005C>T	ENST00000602142.1	+	1	269	c.187C>T	c.(187-189)Cgc>Tgc	p.R63C	VAV1_ENST00000596764.1_Missense_Mutation_p.R63C|VAV1_ENST00000539284.1_5'UTR|VAV1_ENST00000304076.2_Missense_Mutation_p.R63C	NM_005428.3	NP_005419.2	P15498	VAV_HUMAN	vav 1 guanine nucleotide exchange factor	63	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.|Leu-rich.				apoptotic signaling pathway (GO:0097190)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|reactive oxygen species metabolic process (GO:0072593)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription, DNA-templated (GO:0006355)|small GTPase mediated signal transduction (GO:0007264)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(16)|lung(18)|ovary(5)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	62						GGTCAACCTGCGCCCCCAGAT	0.657																																																	0								ENSG00000141968						115.0	88.0	97.0					19																	6773005		2203	4300	6503	VAV1	SO:0001583	missense	0			-	HGNC		CCDS12174.1, CCDS59341.1, CCDS59342.1	19p13.2	2013-02-14	2007-07-25			ENSG00000141968		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	12657	protein-coding gene	gene with protein product		164875	"""vav 1 oncogene"""	VAV		9438848	Standard	NM_005428		Approved		uc010xjh.2	P15498		ENST00000602142.1:c.187C>T	19.37:g.6773005C>T	ENSP00000472929:p.Arg63Cys	Somatic	0	98	0.00		0.5891488714521174	38	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	48	11.11	B4DVK9|M0QXX6|Q15860	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DH-domain,pfam_SH3_domain,pfam_SH3_2,pfam_CAMSAP_CH,pfam_SH2,pfam_CH-domain,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pleckstrin_homology,superfamily_DH-domain,superfamily_CH-domain,superfamily_SH3_domain,smart_CH-domain,smart_DH-domain,smart_Pleckstrin_homology,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_SH3_domain,smart_SH2,pfscan_CH-domain,pfscan_Pleckstrin_homology,pfscan_SH2,pfscan_SH3_domain,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_DH-domain,prints_SH3_domain,prints_SH2,prints_SM22_calponin	p.R63C	ENST00000602142.1	37	c.187	CCDS12174.1	19	.	.	.	.	.	.	.	.	.	.	c	18.41	3.616960	0.66672	.	.	ENSG00000141968	ENST00000304076	T	0.63417	-0.04	4.32	2.1	0.27182	Calponin homology domain (5);	0.091656	0.43416	N	0.000576	T	0.77644	0.4161	M	0.88570	2.965	0.80722	D	1	D;D	0.60160	0.958;0.987	P;D	0.64410	0.757;0.925	T	0.77493	-0.2567	10	0.87932	D	0	.	8.8227	0.35036	0.0:0.806:0.0:0.194	.	63;63	B2R8B5;P15498	.;VAV_HUMAN	C	63	ENSP00000302269:R63C	ENSP00000302269:R63C	R	+	1	0	VAV1	6724005	1.000000	0.71417	0.999000	0.59377	0.908000	0.53690	1.657000	0.37366	0.267000	0.21916	0.306000	0.20318	CGC	-	pfam_CAMSAP_CH,pfam_CH-domain,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain		0.657	VAV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VAV1	protein_coding	OTTHUMT00000458475.1	C		-		6773005	+1	no_errors	ENST00000602142	ensembl	human	known	74_37	missense	SNP	1.000	T
MTPAP	55149	genome.wustl.edu	37	10	30602633	30602633	+	Nonsense_Mutation	SNP	C	C	A			TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chr10:30602633C>A	ENST00000263063.4	-	9	1697	c.1654G>T	c.(1654-1656)Gaa>Taa	p.E552*	MTPAP_ENST00000488290.1_5'UTR|MTPAP_ENST00000358107.4_Nonsense_Mutation_p.E682*	NM_018109.3	NP_060579.3	Q9NVV4	PAPD1_HUMAN	mitochondrial poly(A) polymerase	552					cell death (GO:0008219)|histone mRNA catabolic process (GO:0071044)|mRNA polyadenylation (GO:0006378)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|poly(A) RNA binding (GO:0044822)|polynucleotide adenylyltransferase activity (GO:0004652)|protein homodimerization activity (GO:0042803)|UTP binding (GO:0002134)			breast(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	33						TTGACTGTTTCAATTGCAAAC	0.388																																																	0								ENSG00000107951						172.0	164.0	167.0					10																	30602633		2203	4300	6503	MTPAP	SO:0001587	stop_gained	0			-	HGNC	AL122121	CCDS7165.1	10p12.1	2014-01-30	2009-01-12	2009-01-12	ENSG00000107951	ENSG00000107951			25532	protein-coding gene	gene with protein product	"""TUTase1"""	613669	"""PAP associated domain containing 1"""	PAPD1		12239557, 15769737, 15547249	Standard	NM_018109		Approved	FLJ10486, mtPAP, SPAX4	uc001iva.4	Q9NVV4	OTTHUMG00000017895	ENST00000263063.4:c.1654G>T	10.37:g.30602633C>A	ENSP00000263063:p.Glu552*	Somatic	0	67	0.00		0.5891488714521174	22	72.15	57	WXS	Illumina HiSeq 2500	Phase_IV	tier1	30	53	36.14	D3DRX0|Q659E3|Q6P7E5|Q9HA74	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PAP_assoc	p.E682*	ENST00000263063.4	37	c.2044	CCDS7165.1	10	.	.	.	.	.	.	.	.	.	.	C	18.38	3.610365	0.66558	.	.	ENSG00000107951	ENST00000358107;ENST00000263063	.	.	.	5.88	4.97	0.65823	.	1.180850	0.05902	N	0.630108	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.23891	T	0.37	-21.1843	14.434	0.67268	0.0:0.9298:0.0:0.0702	.	.	.	.	X	682;552	.	ENSP00000263063:E552X	E	-	1	0	MTPAP	30642639	1.000000	0.71417	0.042000	0.18584	0.003000	0.03518	3.370000	0.52372	2.780000	0.95670	0.655000	0.94253	GAA	-	NULL		0.388	MTPAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTPAP	protein_coding	OTTHUMT00000047426.2	C	NM_018109	-		30602633	-1	no_errors	ENST00000358107	ensembl	human	known	74_37	nonsense	SNP	0.994	A
EPHA6	285220	genome.wustl.edu	37	3	97439140	97439140	+	Silent	SNP	A	A	G			TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chr3:97439140A>G	ENST00000389672.5	+	15	2858	c.2820A>G	c.(2818-2820)gaA>gaG	p.E940E		NM_001080448.2	NP_001073917.2	Q9UF33	EPHA6_HUMAN	EPH receptor A6	846	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(2)|lung(60)|ovary(3)|skin(11)|stomach(5)|upper_aerodigestive_tract(2)	101						CAGCCCCAGAAGCCATCGCCT	0.443																																																	0								ENSG00000080224						76.0	80.0	79.0					3																	97439140		2014	4230	6244	EPHA6	SO:0001819	synonymous_variant	0			-	HGNC	AK092565	CCDS46876.1, CCDS54616.1, CCDS63697.1	3q12.1	2013-02-11	2004-10-28		ENSG00000080224	ENSG00000080224		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	19296	protein-coding gene	gene with protein product		600066				12471243	Standard	NM_001080448		Approved	FLJ35246	uc010how.1	Q9UF33	OTTHUMG00000159208	ENST00000389672.5:c.2820A>G	3.37:g.97439140A>G		Somatic	0	104	0.00		0.5891488714521174	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	98	21.60	D6RAL5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_SAM_type1,pfam_SAM_2,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt_N_dom,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.E940	ENST00000389672.5	37	c.2820	CCDS46876.1	3																																																																																			-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom		0.443	EPHA6-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	EPHA6	protein_coding	OTTHUMT00000353845.3	A	NM_001080448	-		97439140	+1	no_errors	ENST00000389672	ensembl	human	known	74_37	silent	SNP	1.000	G
ESR2	2100	genome.wustl.edu	37	14	64749427	64749427	+	Missense_Mutation	SNP	G	G	A	rs147382781		TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chr14:64749427G>A	ENST00000341099.4	-	2	694	c.277C>T	c.(277-279)Cgc>Tgc	p.R93C	ESR2_ENST00000553796.1_Missense_Mutation_p.R93C|ESR2_ENST00000357782.2_Missense_Mutation_p.R93C|ESR2_ENST00000353772.3_Missense_Mutation_p.R93C|ESR2_ENST00000555278.1_Missense_Mutation_p.R93C|ESR2_ENST00000542956.1_Missense_Mutation_p.R93C|ESR2_ENST00000557772.1_Missense_Mutation_p.R93C|ESR2_ENST00000267525.6_Missense_Mutation_p.R93C|ESR2_ENST00000358599.5_Missense_Mutation_p.R93C|ESR2_ENST00000554572.1_Missense_Mutation_p.R93C|ESR2_ENST00000555483.1_5'UTR	NM_001437.2	NP_001428.1	Q92731	ESR2_HUMAN	estrogen receptor 2 (ER beta)	93	Modulating.				brain development (GO:0007420)|cell-cell signaling (GO:0007267)|epithelial cell maturation involved in prostate gland development (GO:0060743)|extracellular negative regulation of signal transduction (GO:1900116)|gene expression (GO:0010467)|hormone-mediated apoptotic signaling pathway (GO:0008628)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|ovarian follicle development (GO:0001541)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|prostate gland epithelium morphogenesis (GO:0060740)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|uterus development (GO:0060065)|vagina development (GO:0060068)	extracellular region (GO:0005576)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|estrogen receptor activity (GO:0030284)|estrogen response element binding (GO:0034056)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|receptor antagonist activity (GO:0048019)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	23				all cancers(60;0.00916)|OV - Ovarian serous cystadenocarcinoma(108;0.0111)|BRCA - Breast invasive adenocarcinoma(234;0.0437)	Diethylstilbestrol(DB00255)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estropipate(DB04574)|Raloxifene(DB00481)|Tamoxifen(DB00675)|Trilostane(DB01108)	GATAACTGGCGATGGACCACT	0.507																																																	0								ENSG00000140009	G	CYS/ARG,CYS/ARG,CYS/ARG,CYS/ARG,CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	101.0	96.0	98.0		277,277,277,277,277	3.2	0.2	14	dbSNP_134	98	0,8600		0,0,4300	no	missense,missense,missense,missense,missense	ESR2	NM_001040275.1,NM_001040276.1,NM_001214902.1,NM_001214903.1,NM_001437.2	180,180,180,180,180	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign,benign,benign,benign,benign	93/496,93/496,93/482,93/473,93/531	64749427	1,13005	2203	4300	6503	ESR2	SO:0001583	missense	0			-	HGNC	X99101	CCDS9762.1, CCDS32096.1, CCDS55920.1, CCDS61469.1, CCDS61470.1	14q21-q22	2013-01-16			ENSG00000140009	ENSG00000140009		"""Nuclear hormone receptors"""	3468	protein-coding gene	gene with protein product		601663				8769313	Standard	NM_001214902		Approved	NR3A2, Erb	uc001xha.1	Q92731	OTTHUMG00000141306	ENST00000341099.4:c.277C>T	14.37:g.64749427G>A	ENSP00000343925:p.Arg93Cys	Somatic	0	37	0.00		0.5891488714521174	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	33	17.50	A8K8K5|G3V5M5|O60608|O60685|O60702|O60703|O75583|O75584|Q0MWT5|Q0MWT6|Q86Z31|Q9UEV6|Q9UHD3|Q9UQK9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Estrogen_rcpt_beta_N,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt	p.R93C	ENST00000341099.4	37	c.277	CCDS9762.1	14	.	.	.	.	.	.	.	.	.	.	G	3.700	-0.061802	0.07317	2.27E-4	0.0	ENSG00000140009	ENST00000556275;ENST00000542956;ENST00000554572;ENST00000353772;ENST00000358599;ENST00000555278;ENST00000553796;ENST00000357782;ENST00000557772;ENST00000341099;ENST00000267525	D;D;D;D;D;D;D;D;D;D;D	0.90004	-2.59;-2.54;-2.52;-2.52;-2.52;-2.6;-2.6;-2.6;-2.6;-2.42;-2.13	5.56	3.24	0.37175	Estrogen receptor beta, N-terminal (1);	0.372430	0.32386	N	0.006163	T	0.62490	0.2432	N	0.00300	-1.685	0.30746	N	0.745669	B;B;B;B;B	0.10296	0.003;0.0;0.0;0.0;0.0	B;B;B;B;B	0.04013	0.001;0.001;0.0;0.0;0.001	T	0.58387	-0.7645	10	0.14656	T	0.56	.	9.3477	0.38118	0.8518:0.0:0.1482:0.0	.	93;93;93;93;93	Q92731-7;Q92731;Q92731-6;Q92731-5;F1D8N3	.;ESR2_HUMAN;.;.;.	C	93	ENSP00000452485:R93C;ENSP00000441792:R93C;ENSP00000450699:R93C;ENSP00000335551:R93C;ENSP00000351412:R93C;ENSP00000450488:R93C;ENSP00000452426:R93C;ENSP00000350427:R93C;ENSP00000451582:R93C;ENSP00000343925:R93C;ENSP00000267525:R93C	ENSP00000267525:R93C	R	-	1	0	ESR2	63819180	1.000000	0.71417	0.152000	0.22495	0.011000	0.07611	2.814000	0.48010	0.413000	0.25759	-0.471000	0.05019	CGC	-	pfam_Estrogen_rcpt_beta_N		0.507	ESR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ESR2	protein_coding	OTTHUMT00000280621.1	G		rs147382781		64749427	-1	no_errors	ENST00000341099	ensembl	human	known	74_37	missense	SNP	0.979	A
RUNDC1	146923	genome.wustl.edu	37	17	41143458	41143458	+	Missense_Mutation	SNP	G	G	T			TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chr17:41143458G>T	ENST00000361677.1	+	5	1579	c.1567G>T	c.(1567-1569)Gtg>Ttg	p.V523L		NM_173079.2	NP_775102	Q96C34	RUND1_HUMAN	RUN domain containing 1	523	RUN. {ECO:0000255|PROSITE- ProRule:PRU00178}.									breast(1)|large_intestine(2)|lung(4)|prostate(1)	8		Breast(137;0.00499)		BRCA - Breast invasive adenocarcinoma(366;0.161)		CATCCACATGGTGCTGACAGA	0.567																																																	0								ENSG00000198863						88.0	78.0	81.0					17																	41143458		2203	4300	6503	RUNDC1	SO:0001583	missense	0			-	HGNC	AL831813	CCDS11448.1	17q21.31	2004-02-27				ENSG00000198863			25418	protein-coding gene	gene with protein product						12477932	Standard	NM_173079		Approved	DKFZp761H0421	uc002ici.1	Q96C34		ENST00000361677.1:c.1567G>T	17.37:g.41143458G>T	ENSP00000354622:p.Val523Leu	Somatic	0	68	0.00		0.5891488714521174	28	26.32	10	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51	Q6Y2K8|Q8IXT9|Q8N3W1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Run,smart_Run,pfscan_Run	p.V523L	ENST00000361677.1	37	c.1567	CCDS11448.1	17	.	.	.	.	.	.	.	.	.	.	G	26.3	4.720306	0.89205	.	.	ENSG00000198863	ENST00000361677	T	0.24723	1.84	5.02	5.02	0.67125	RUN (2);	0.000000	0.85682	D	0.000000	T	0.49372	0.1553	M	0.65498	2.005	0.80722	D	1	D	0.61697	0.99	D	0.65323	0.934	T	0.48340	-0.9044	10	0.56958	D	0.05	-26.647	18.5295	0.90986	0.0:0.0:1.0:0.0	.	523	Q96C34	RUND1_HUMAN	L	523	ENSP00000354622:V523L	ENSP00000354622:V523L	V	+	1	0	RUNDC1	38396984	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	9.607000	0.98328	2.598000	0.87819	0.655000	0.94253	GTG	-	pfam_Run,pfscan_Run		0.567	RUNDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RUNDC1	protein_coding	OTTHUMT00000452464.1	G	NM_173079	-		41143458	+1	no_errors	ENST00000361677	ensembl	human	known	74_37	missense	SNP	1.000	T
ATP6V1E1	529	genome.wustl.edu	37	22	18082831	18082831	+	Missense_Mutation	SNP	T	T	A			TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chr22:18082831T>A	ENST00000253413.5	-	6	579	c.397A>T	c.(397-399)Att>Ttt	p.I133F	ATP6V1E1_ENST00000399796.2_Missense_Mutation_p.I103F|ATP6V1E1_ENST00000399798.2_Missense_Mutation_p.I111F	NM_001696.3	NP_001687.1	P36543	VATE1_HUMAN	ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E1	133					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|proton transport (GO:0015992)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|microvillus (GO:0005902)|mitochondrion (GO:0005739)|proton-transporting two-sector ATPase complex (GO:0016469)|proton-transporting two-sector ATPase complex, catalytic domain (GO:0033178)	ATPase binding (GO:0051117)|hydrogen-exporting ATPase activity, phosphorylative mechanism (GO:0008553)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(3)|urinary_tract(1)	10		all_epithelial(15;0.206)		Lung(27;0.19)		CAACGAACAATCATTCGGGGC	0.443																																																	0								ENSG00000131100						50.0	54.0	53.0					22																	18082831		2203	4300	6503	ATP6V1E1	SO:0001583	missense	0			-	HGNC	X76228	CCDS13745.1, CCDS42977.1, CCDS42978.1	22q11.2	2010-04-21	2006-01-13	2002-06-21	ENSG00000131100	ENSG00000131100	3.6.3.14	"""ATPases / V-type"""	857	protein-coding gene	gene with protein product		108746	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump) 31kD"", ""ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E isoform 1"""	ATP6E, ATP6V1E		8004105, 8250920	Standard	NM_001696		Approved	P31, Vma4, ATP6E2	uc002zmr.1	P36543	OTTHUMG00000059320	ENST00000253413.5:c.397A>T	22.37:g.18082831T>A	ENSP00000253413:p.Ile133Phe	Somatic	0	204	0.00		0.5891488714521174	588	25.48	201	WXS	Illumina HiSeq 2500	Phase_IV	tier1	34	205	14.23	A8MUE4|A8MUN4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ATPase_V1/A1-cplx_esu	p.I133F	ENST00000253413.5	37	c.397	CCDS13745.1	22	.	.	.	.	.	.	.	.	.	.	T	13.81	2.346972	0.41599	.	.	ENSG00000131100	ENST00000253413;ENST00000399796;ENST00000399798;ENST00000413576	.	.	.	4.69	2.3	0.28687	.	0.309084	0.36268	N	0.002700	T	0.65984	0.2744	M	0.85630	2.765	0.42755	D	0.993784	B;B;B	0.29341	0.242;0.142;0.242	B;B;B	0.38655	0.278;0.278;0.278	T	0.65319	-0.6197	9	0.56958	D	0.05	-6.2355	6.1587	0.20352	0.1483:0.0:0.2959:0.5559	.	111;103;133	A8MUE4;A8MUN4;P36543	.;.;VATE1_HUMAN	F	133;103;111;134	.	ENSP00000253413:I133F	I	-	1	0	ATP6V1E1	16462831	0.998000	0.40836	1.000000	0.80357	0.586000	0.36452	0.898000	0.28404	0.702000	0.31825	0.472000	0.43445	ATT	-	pfam_ATPase_V1/A1-cplx_esu		0.443	ATP6V1E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP6V1E1	protein_coding	OTTHUMT00000131790.3	T	NM_001696	-		18082831	-1	no_errors	ENST00000253413	ensembl	human	known	74_37	missense	SNP	0.996	A
SUGP1	57794	genome.wustl.edu	37	19	19407813	19407813	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chr19:19407813G>A	ENST00000247001.5	-	8	1575	c.1228C>T	c.(1228-1230)Ccc>Tcc	p.P410S	SUGP1_ENST00000585763.1_5'Flank	NM_172231.3	NP_757386.2	Q8IWZ8	SUGP1_HUMAN	SURP and G patch domain containing 1	410					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	nucleoplasm (GO:0005654)|spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(7)|ovary(1)|prostate(1)|stomach(2)|urinary_tract(2)	22						AGAGGCGAGGGAGAGGCATCC	0.582																																																	0								ENSG00000105705						29.0	25.0	26.0					19																	19407813		2203	4300	6503	SUGP1	SO:0001583	missense	0			-	HGNC	AF521128	CCDS12399.1	19p13	2013-01-28	2010-08-10	2010-08-10		ENSG00000105705		"""G patch domain containing"""	18643	protein-coding gene	gene with protein product		607992	"""splicing factor 4"""	SF4		12594045	Standard	NM_172231		Approved	F23858, DKFZp434E2216, RBP	uc002nmh.3	Q8IWZ8		ENST00000247001.5:c.1228C>T	19.37:g.19407813G>A	ENSP00000247001:p.Pro410Ser	Somatic	0	61	0.00		0.5891488714521174	79	17.71	17	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	54	12.90	O60378|Q6P3X9|Q8TCQ4|Q8WWT4|Q8WWT5|Q9NTG3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Surp,pfam_G_patch_dom,superfamily_Surp,smart_Surp,smart_G_patch_dom,pfscan_Surp,pfscan_G_patch_dom	p.P410S	ENST00000247001.5	37	c.1228	CCDS12399.1	19	.	.	.	.	.	.	.	.	.	.	G	11.10	1.538806	0.27475	.	.	ENSG00000105705	ENST00000247001	T	0.23348	1.91	3.66	3.66	0.41972	.	0.265236	0.37393	N	0.002110	T	0.25121	0.0610	L	0.34521	1.04	0.80722	D	1	D	0.54397	0.966	P	0.48738	0.588	T	0.01617	-1.1311	10	0.34782	T	0.22	.	12.5737	0.56352	0.0:0.0:1.0:0.0	.	410	Q8IWZ8	SUGP1_HUMAN	S	410	ENSP00000247001:P410S	ENSP00000247001:P410S	P	-	1	0	SUGP1	19268813	1.000000	0.71417	0.160000	0.22671	0.717000	0.41224	5.426000	0.66476	2.069000	0.61940	0.491000	0.48974	CCC	-	NULL		0.582	SUGP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUGP1	protein_coding	OTTHUMT00000460128.4	G	NM_021164	-		19407813	-1	no_errors	ENST00000247001	ensembl	human	known	74_37	missense	SNP	0.859	A
GRM7	2917	genome.wustl.edu	37	3	7494313	7494313	+	Missense_Mutation	SNP	A	A	T			TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chr3:7494313A>T	ENST00000357716.4	+	6	1468	c.1194A>T	c.(1192-1194)aaA>aaT	p.K398N	GRM7_ENST00000458641.2_3'UTR|GRM7_ENST00000403881.1_Missense_Mutation_p.K398N|GRM7_ENST00000402647.2_Missense_Mutation_p.K398N|GRM7_ENST00000389336.4_Missense_Mutation_p.K398N|GRM7_ENST00000486284.1_Missense_Mutation_p.K398N	NM_000844.3	NP_000835.1	Q14831	GRM7_HUMAN	glutamate receptor, metabotropic 7	398					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|adult behavior (GO:0030534)|conditioned taste aversion (GO:0001661)|multicellular organismal response to stress (GO:0033555)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of glutamate secretion (GO:0014050)|regulation of cyclase activity (GO:0031279)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of smell (GO:0007608)|sensory perception of sound (GO:0007605)|short-term memory (GO:0007614)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)	asymmetric synapse (GO:0032279)|axon (GO:0030424)|cell cortex (GO:0005938)|dendrite (GO:0030425)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)|receptor complex (GO:0043235)	adenylate cyclase inhibitor activity (GO:0010855)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|glutamate binding (GO:0016595)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)|PDZ domain binding (GO:0030165)|serine binding (GO:0070905)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(35)|ovary(4)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	76						GAATTGGAAAAGATTCCAACT	0.433																																																	0								ENSG00000196277						113.0	101.0	105.0					3																	7494313		2203	4300	6503	GRM7	SO:0001583	missense	0			-	HGNC	U92458	CCDS43042.1	3p26-p25	2014-06-12			ENSG00000196277	ENSG00000196277		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4599	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 87"""	604101				8288585, 8840028	Standard	NM_000844		Approved	GLUR7, GPRC1G, mGlu7, MGLUR7, PPP1R87	uc003bql.2	Q14831	OTTHUMG00000125549	ENST00000357716.4:c.1194A>T	3.37:g.7494313A>T	ENSP00000350348:p.Lys398Asn	Somatic	0	26	0.00		0.5891488714521174	11	21.43	3	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	87	16.35	Q8NFS2|Q8NFS3|Q8NFS4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,superfamily_Peripla_BP_I,pfscan_GPCR_3_C,prints_GPCR_3,prints_GPCR_3_mtglu_rcpt_7,prints_GPCR_3_mtglu_rcpt,prints_GPCR_3_mtglu_rcpt_4	p.K398N	ENST00000357716.4	37	c.1194	CCDS43042.1	3	.	.	.	.	.	.	.	.	.	.	A	13.39	2.224111	0.39300	.	.	ENSG00000196277	ENST00000357716;ENST00000486284;ENST00000389336;ENST00000403881;ENST00000525747;ENST00000402647;ENST00000413492;ENST00000445087	D;D;D;D;D;D	0.82433	-1.61;-1.61;-1.61;-1.61;-1.61;-1.61	5.88	-1.38	0.09027	Extracellular ligand-binding receptor (1);	0.275476	0.39544	N	0.001328	T	0.77198	0.4095	L	0.52126	1.63	0.38176	D	0.939468	B;B;B	0.23128	0.065;0.08;0.056	B;B;B	0.34779	0.035;0.059;0.189	T	0.64989	-0.6277	10	0.19147	T	0.46	.	11.7718	0.51962	0.4081:0.0:0.5919:0.0	.	398;398;398	Q14831-5;Q14831;Q14831-2	.;GRM7_HUMAN;.	N	398;398;398;398;398;398;398;55	ENSP00000350348:K398N;ENSP00000417536:K398N;ENSP00000373987:K398N;ENSP00000385664:K398N;ENSP00000384585:K398N;ENSP00000395035:K55N	ENSP00000350348:K398N	K	+	3	2	GRM7	7469313	0.205000	0.23458	0.965000	0.40720	0.978000	0.69477	0.261000	0.18442	-0.112000	0.11979	-0.408000	0.06270	AAA	-	pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I		0.433	GRM7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRM7	protein_coding	OTTHUMT00000246895.3	A	NM_000844	-		7494313	+1	no_errors	ENST00000402647	ensembl	human	known	74_37	missense	SNP	0.833	T
SLC30A3	7781	genome.wustl.edu	37	2	27478187	27478188	+	Frame_Shift_Ins	INS	-	-	G	rs200706586	byFrequency	TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chr2:27478187_27478188insG	ENST00000233535.4	-	8	1511_1512	c.1159_1160insC	c.(1159-1161)caafs	p.Q387fs	SLC30A3_ENST00000447008.2_Frame_Shift_Ins_p.Q382fs	NM_003459.4	NP_003450.2	Q99726	ZNT3_HUMAN	solute carrier family 30 (zinc transporter), member 3	387					positive regulation of transport (GO:0051050)|regulation of sequestering of zinc ion (GO:0061088)|transmembrane transport (GO:0055085)|transport (GO:0006810)|zinc ion transmembrane transport (GO:0071577)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|membrane (GO:0016020)|neuron projection (GO:0043005)|synaptic vesicle (GO:0008021)|synaptic vesicle membrane (GO:0030672)	zinc transporting ATPase activity (GO:0015633)			NS(1)|breast(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(11)|pancreas(1)	20	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GGCTCAGGCTTGGGGGGGTTCC	0.658																																																	0								ENSG00000115194																																			SLC30A3	SO:0001589	frameshift_variant	0				HGNC	U76010	CCDS1743.1	2p23.3	2013-05-22			ENSG00000115194	ENSG00000115194		"""Solute carriers"""	11014	protein-coding gene	gene with protein product		602878		ZNT3		8962159	Standard	NM_003459		Approved		uc002rjj.3	Q99726	OTTHUMG00000128409	ENST00000233535.4:c.1160dupC	2.37:g.27478194_27478194dupG	ENSP00000233535:p.Gln387fs	Somatic	0	47	0.00		0.5891488714521174	7	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	33	8.33	Q8TC03	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_Cation_efflux,tigrfam_Cation_efflux	p.Q387fs	ENST00000233535.4	37	c.1160_1159	CCDS1743.1	2																																																																																			-	NULL		0.658	SLC30A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC30A3	protein_coding	OTTHUMT00000250189.2	-				27478188	-1	no_errors	ENST00000233535	ensembl	human	known	74_37	frame_shift_ins	INS	0.986:0.942	G
LUZP4	51213	genome.wustl.edu	37	X	114541124	114541124	+	Missense_Mutation	SNP	C	C	T	rs371208058		TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chrX:114541124C>T	ENST00000371920.3	+	4	704	c.697C>T	c.(697-699)Cgt>Tgt	p.R233C	LUZP4_ENST00000451986.2_Missense_Mutation_p.R151C	NM_016383.3	NP_057467.1	Q9P127	LUZP4_HUMAN	leucine zipper protein 4	233						nucleus (GO:0005634)				endometrium(1)|large_intestine(2)|lung(4)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	14						AAAGAGATCTCGTAGCCAGGG	0.473																																																	0								ENSG00000102021	C	CYS/ARG	1,3834		0,1,1631,571	122.0	107.0	112.0		697	1.4	0.0	X		112	0,6728		0,0,2428,1872	no	missense	LUZP4	NM_016383.3	180	0,1,4059,2443	TT,TC,CC,C		0.0,0.0261,0.0095	probably-damaging	233/314	114541124	1,10562	2203	4300	6503	LUZP4	SO:0001583	missense	0			-	HGNC	AF124430	CCDS14567.1	Xq24	2009-03-25			ENSG00000102021	ENSG00000102021			24971	protein-coding gene	gene with protein product	"""cancer/testis antigen 28"""	300616				12032826, 11051238	Standard	XM_005268343		Approved	HOM-TES-85, CT-8, CT28	uc004eqa.3	Q9P127	OTTHUMG00000022234	ENST00000371920.3:c.697C>T	X.37:g.114541124C>T	ENSP00000360988:p.Arg233Cys	Somatic	0	45	0.00		0.5891488714521174	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	48	11.11	B3KSD6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.R233C	ENST00000371920.3	37	c.697	CCDS14567.1	X	.	.	.	.	.	.	.	.	.	.	c	8.738	0.918364	0.17982	2.61E-4	0.0	ENSG00000102021	ENST00000451986;ENST00000371920	T;T	0.78126	-1.15;-1.15	2.3	1.42	0.22433	.	.	.	.	.	T	0.63498	0.2516	N	0.14661	0.345	0.09310	N	1	D;D	0.59767	0.986;0.986	P;B	0.47102	0.537;0.432	T	0.54316	-0.8312	9	0.48119	T	0.1	.	6.4085	0.21678	0.0:0.8324:0.0:0.1676	.	151;233	B3KSD6;Q9P127	.;LUZP4_HUMAN	C	151;233	ENSP00000411212:R151C;ENSP00000360988:R233C	ENSP00000360988:R233C	R	+	1	0	LUZP4	114447380	0.000000	0.05858	0.001000	0.08648	0.004000	0.04260	-0.081000	0.11321	0.436000	0.26393	0.284000	0.19432	CGT	-	NULL		0.473	LUZP4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LUZP4	protein_coding	OTTHUMT00000057972.1	C	NM_016383	-		114541124	+1	no_errors	ENST00000371920	ensembl	human	known	74_37	missense	SNP	0.001	T
HTT	3064	genome.wustl.edu	37	4	3225176	3225176	+	Missense_Mutation	SNP	C	C	G			TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chr4:3225176C>G	ENST00000355072.5	+	55	7659	c.7514C>G	c.(7513-7515)gCc>gGc	p.A2505G		NM_002111.6	NP_002102	P42858	HD_HUMAN	huntingtin	2505					anterior/posterior pattern specification (GO:0009952)|axon cargo transport (GO:0008088)|cell aging (GO:0007569)|citrulline metabolic process (GO:0000052)|determination of adult lifespan (GO:0008340)|dopamine receptor signaling pathway (GO:0007212)|endoplasmic reticulum organization (GO:0007029)|endosomal transport (GO:0016197)|ER to Golgi vesicle-mediated transport (GO:0006888)|establishment of mitotic spindle orientation (GO:0000132)|Golgi organization (GO:0007030)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insulin secretion (GO:0030073)|iron ion homeostasis (GO:0055072)|L-glutamate import (GO:0051938)|lactate biosynthetic process from pyruvate (GO:0019244)|locomotory behavior (GO:0007626)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|neural plate formation (GO:0021990)|neuron apoptotic process (GO:0051402)|neuron development (GO:0048666)|olfactory lobe development (GO:0021988)|organ development (GO:0048513)|paraxial mesoderm formation (GO:0048341)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|protein import into nucleus (GO:0006606)|quinolinate biosynthetic process (GO:0019805)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of protein phosphatase type 2A activity (GO:0034047)|regulation of synaptic plasticity (GO:0048167)|response to calcium ion (GO:0051592)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|social behavior (GO:0035176)|spermatogenesis (GO:0007283)|striatum development (GO:0021756)|urea cycle (GO:0000050)|vesicle transport along microtubule (GO:0047496)|visual learning (GO:0008542)	autophagic vacuole (GO:0005776)|axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	beta-tubulin binding (GO:0048487)|diazepam binding (GO:0050809)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|transcription factor binding (GO:0008134)			breast(1)|cervix(2)|endometrium(14)|kidney(5)|large_intestine(23)|lung(28)|ovary(4)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	87		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		GCCGTGCAGGCCATCACCTCA	0.587																																																	0								ENSG00000197386						71.0	76.0	75.0					4																	3225176		2087	4221	6308	HTT	SO:0001583	missense	0			-	HGNC	L12392	CCDS43206.1	4p16.3	2014-09-17	2007-12-04	2007-12-04	ENSG00000197386	ENSG00000197386		"""Endogenous ligands"""	4851	protein-coding gene	gene with protein product		613004	"""huntingtin (Huntington disease)"""	HD		8458085	Standard	NM_002111		Approved	IT15	uc021xkv.1	P42858	OTTHUMG00000159916	ENST00000355072.5:c.7514C>G	4.37:g.3225176C>G	ENSP00000347184:p.Ala2505Gly	Somatic	0	54	0.00		0.5891488714521174	57	22.97	17	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	57	14.93	Q9UQB7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Huntingtin_middle-repeat,pfam_HEAT,superfamily_ARM-type_fold,prints_Huntingtin	p.A2505G	ENST00000355072.5	37	c.7514	CCDS43206.1	4	.	.	.	.	.	.	.	.	.	.	C	21.6	4.175515	0.78564	.	.	ENSG00000197386	ENST00000355072	T	0.06294	3.32	4.88	4.88	0.63580	.	0.000000	0.85682	D	0.000000	T	0.16727	0.0402	L	0.38175	1.15	0.80722	D	1	D	0.71674	0.998	D	0.77557	0.99	T	0.08868	-1.0701	10	0.24483	T	0.36	.	18.3988	0.90509	0.0:1.0:0.0:0.0	.	2505	P42858	HD_HUMAN	G	2505	ENSP00000347184:A2505G	ENSP00000347184:A2505G	A	+	2	0	HTT	3194974	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	7.445000	0.80570	2.400000	0.81607	0.591000	0.81541	GCC	-	NULL		0.587	HTT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTT	protein_coding	OTTHUMT00000358234.2	C	NM_002111	-		3225176	+1	no_errors	ENST00000355072	ensembl	human	known	74_37	missense	SNP	1.000	G
SGK223	157285	genome.wustl.edu	37	8	8176387	8176388	+	In_Frame_Ins	INS	-	-	GGGGCG	rs143409664|rs369009941|rs71217287		TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chr8:8176387_8176388insGGGGCG	ENST00000520004.1	-	6	3761_3762	c.3497_3498insCGCCCC	c.(3496-3498)ccg>ccCGCCCCg	p.1166_1166P>PAP	SGK223_ENST00000330777.4_In_Frame_Ins_p.1166_1166P>PAP			Q86YV5	SG223_HUMAN		1170	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.						ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)										gggcgggagccggggcgggggc	0.782																																					GBM(34;731 755 10259 33573 33867)												0								ENSG00000182319			1183,1443		406,371,536						-9.8	0.0		dbSNP_134	4	2724,3170		936,852,1159	no	coding	SGK223	NM_001080826.1		1342,1223,1695	A1A1,A1R,RR		46.2165,45.0495,45.8568				3907,4613				SGK223	SO:0001652	inframe_insertion	0				Uniprot_gn																												ENST00000520004.1:c.3492_3497dupCGCCCC	8.37:g.8176388_8176393dupGGGGCG	ENSP00000428054:p.AlaPro1170dup	Somatic	NA	NA	NA		0.5891488714521174	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q8N3N5	In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_dom	p.1170in_frame_insPA	ENST00000520004.1	37	c.3498_3497	CCDS43706.1	8																																																																																			-	pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_dom		0.782	SGK223-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SGK223	protein_coding	OTTHUMT00000374864.1	-				8176388	-1	no_errors	ENST00000330777	ensembl	human	known	74_37	in_frame_ins	INS	0.000:0.034	GGGGCG
FAM167A	83648	genome.wustl.edu	37	8	11301807	11301807	+	Missense_Mutation	SNP	C	C	A			TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chr8:11301807C>A	ENST00000528897.1	-	2	733	c.114G>T	c.(112-114)agG>agT	p.R38S	FAM167A_ENST00000284486.4_Missense_Mutation_p.R38S|FAM167A_ENST00000534308.1_Missense_Mutation_p.R38S|FAM167A_ENST00000531564.1_5'Flank			Q96KS9	F167A_HUMAN	family with sequence similarity 167, member A	38										breast(1)|endometrium(1)|large_intestine(4)|lung(2)|prostate(1)	9						GGGTCTCCAGCCTCAGTTTCT	0.672																																																	0								ENSG00000154319						63.0	72.0	69.0					8																	11301807		2203	4300	6503	FAM167A	SO:0001583	missense	0			-	HGNC		CCDS5981.1	8p23-p22	2010-08-27	2008-06-11	2008-06-11	ENSG00000154319	ENSG00000154319			15549	protein-coding gene	gene with protein product		610085	"""chromosome 8 open reading frame 13"""	C8orf13			Standard	NM_053279		Approved		uc003wtw.2	Q96KS9	OTTHUMG00000129361	ENST00000528897.1:c.114G>T	8.37:g.11301807C>A	ENSP00000436655:p.Arg38Ser	Somatic	0	65	0.00		0.5891488714521174	1	50.00	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	58	29.27	A8K3T9|Q3SXY1|Q3SXY3|Q8N3M3|Q9NSR0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_FAM167	p.R38S	ENST00000528897.1	37	c.114	CCDS5981.1	8	.	.	.	.	.	.	.	.	.	.	C	16.43	3.122312	0.56613	.	.	ENSG00000154319	ENST00000284486;ENST00000534308;ENST00000528897;ENST00000531804	T;T;T;T	0.08102	3.13;3.13;3.13;3.13	5.34	3.53	0.40419	.	0.106557	0.64402	N	0.000006	T	0.08582	0.0213	M	0.64997	1.995	0.46631	D	0.999134	P	0.35174	0.488	B	0.24701	0.055	T	0.09400	-1.0676	10	0.72032	D	0.01	-0.7328	8.2353	0.31622	0.0:0.7224:0.1313:0.1463	.	38	Q96KS9	F167A_HUMAN	S	38	ENSP00000284486:R38S;ENSP00000432232:R38S;ENSP00000436655:R38S;ENSP00000431951:R38S	ENSP00000284486:R38S	R	-	3	2	FAM167A	11339217	0.998000	0.40836	1.000000	0.80357	0.921000	0.55340	0.474000	0.22148	0.806000	0.34183	-0.140000	0.14226	AGG	-	NULL		0.672	FAM167A-003	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	FAM167A	protein_coding	OTTHUMT00000383901.1	C		-		11301807	-1	no_errors	ENST00000284486	ensembl	human	known	74_37	missense	SNP	1.000	A
DUSP10	11221	genome.wustl.edu	37	1	221875661	221875662	+	3'UTR	INS	-	-	A	rs3215279		TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chr1:221875661_221875662insA	ENST00000366899.3	-	0	1779_1780				DUSP10_ENST00000323825.3_3'UTR|DUSP10_ENST00000544095.1_3'UTR|DUSP10_ENST00000468085.1_5'UTR	NM_007207.4	NP_009138.1	Q9Y6W6	DUS10_HUMAN	dual specificity phosphatase 10						inactivation of MAPK activity (GO:0000188)|JNK cascade (GO:0007254)|negative regulation of JNK cascade (GO:0046329)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of respiratory burst involved in inflammatory response (GO:0060266)|oligodendrocyte differentiation (GO:0048709)|protein dephosphorylation (GO:0006470)|regulation of adaptive immune response (GO:0002819)|response to lipopolysaccharide (GO:0032496)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	MAP kinase phosphatase activity (GO:0033549)|MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|phosphatase activity (GO:0016791)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(16)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				GBM - Glioblastoma multiforme(131;0.0103)		CTCCCAACTACAAAAAAAAAAA	0.351																																																	0								ENSG00000143507																																			DUSP10	SO:0001624	3_prime_UTR_variant	0				HGNC	AB026436	CCDS1528.1	1q41	2011-06-09			ENSG00000143507	ENSG00000143507		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3065	protein-coding gene	gene with protein product		608867				10391943, 10597297	Standard	NM_007207		Approved	MKP-5, MKP5	uc001hmy.2	Q9Y6W6	OTTHUMG00000037269	ENST00000366899.3:c.*93->T	1.37:g.221875672_221875672dupA		Somatic	0	11	0.00		0.5891488714521174	192	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	14	26.32	D3DTB4|Q6GSI4|Q9H9Z5	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000366899.3	37	NULL	CCDS1528.1	1																																																																																			-	-		0.351	DUSP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUSP10	protein_coding	OTTHUMT00000090716.1	-	NM_007207			221875662	-1	no_errors	ENST00000468085	ensembl	human	known	74_37	rna	INS	0.001:0.040	A
PCDHB13	56123	genome.wustl.edu	37	5	140595444	140595444	+	Silent	SNP	C	C	A			TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chr5:140595444C>A	ENST00000341948.4	+	1	1936	c.1749C>A	c.(1747-1749)ggC>ggA	p.G583G		NM_018933.2	NP_061756.1	Q9Y5F0	PCDBD_HUMAN	protocadherin beta 13	583	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|liver(4)|lung(24)|ovary(5)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	66			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CCGAGCCGGGCTACCTGGTGA	0.701																																																	0								ENSG00000187372						7.0	11.0	10.0					5																	140595444		1696	3538	5234	PCDHB13	SO:0001819	synonymous_variant	0			-	HGNC	AF152492	CCDS4255.1	5q31	2010-01-26			ENSG00000187372	ENSG00000187372		"""Cadherins / Protocadherins : Clustered"""	8684	other	protocadherin		606339				10380929	Standard	NM_018933		Approved	PCDH-BETA13	uc003lja.1	Q9Y5F0	OTTHUMG00000129615	ENST00000341948.4:c.1749C>A	5.37:g.140595444C>A		Somatic	0	82	0.00		0.5891488714521174	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	54	11.48	A8K9V6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.G583	ENST00000341948.4	37	c.1749	CCDS4255.1	5																																																																																			-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin		0.701	PCDHB13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB13	protein_coding	OTTHUMT00000251810.1	C	NM_018933	-		140595444	+1	no_errors	ENST00000341948	ensembl	human	known	74_37	silent	SNP	0.997	A
NTM	50863	genome.wustl.edu	37	11	132205739	132205739	+	3'UTR	SNP	A	A	G			TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chr11:132205739A>G	ENST00000374786.1	+	0	2213				NTM_ENST00000474900.1_3'UTR|NTM_ENST00000374791.3_3'UTR	NM_001144058.1|NM_016522.2	NP_001137530.1|NP_057606.1	Q9P121	NTRI_HUMAN	neurotrimin						cell adhesion (GO:0007155)|neuron recognition (GO:0008038)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(4)|large_intestine(9)|lung(30)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	56						TACTGCAAAAACAAGACAAAA	0.274																																																	0								ENSG00000182667																																			NTM	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AF126426	CCDS8491.1, CCDS41733.1, CCDS44777.1, CCDS44778.1	11q25	2013-01-11			ENSG00000182667	ENSG00000182667		"""Immunoglobulin superfamily / I-set domain containing"""	17941	protein-coding gene	gene with protein product	"""neurotrimin"", ""IgLON family member 2"""	607938				7891157	Standard	NM_001048209		Approved	HNT, NTRI, IGLON2	uc001qgq.3	Q9P121	OTTHUMG00000066364	ENST00000374786.1:c.*699A>G	11.37:g.132205739A>G		Somatic	0	52	0.00		0.5891488714521174	0	100.00	136	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	24	22.58	A0MTT2|Q6UXJ3|Q86VJ9	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000374786.1	37	NULL	CCDS8491.1	11																																																																																			-	-		0.274	NTM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NTM	protein_coding	OTTHUMT00000141937.1	A	NM_016522	-		132205739	+1	no_errors	ENST00000474900	ensembl	human	known	74_37	rna	SNP	0.983	G
DHX32	55760	genome.wustl.edu	37	10	127531562	127531562	+	Intron	SNP	G	G	A			TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chr10:127531562G>A	ENST00000284690.3	-	7	1842				DHX32_ENST00000368721.1_Intron|AL360176.1_ENST00000401153.1_RNA|BCCIP_ENST00000368759.5_Intron|DHX32_ENST00000284688.6_Intron	NM_018180.2	NP_060650.2	Q7L7V1	DHX32_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 32							mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(2)|stomach(1)	29		all_lung(145;0.00751)|Lung NSC(174;0.0115)|Colorectal(57;0.0846)|all_neural(114;0.0936)				tactttcaatggcaaaaacca	0.303																																																	0								ENSG00000215972																																			AL360176.1	SO:0001627	intron_variant	0			-	Clone_based_ensembl_gene		CCDS7652.1	10q26.11-q26.2	2008-01-07	2004-01-29	2004-01-30	ENSG00000089876	ENSG00000089876		"""DEAH-boxes"""	16717	protein-coding gene	gene with protein product		607960	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 32"""	DDX32			Standard	NM_018180		Approved	FLJ10889, FLJ10694, DHLP1	uc001ljf.1	Q7L7V1	OTTHUMG00000019238	ENST00000284690.3:c.1352-1059C>T	10.37:g.127531562G>A		Somatic	0	87	0.00		0.5891488714521174	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	62	13.70	A8MSV2|D3DRF9|Q49AG5|Q5T3L0|Q5T3L5|Q96NY1|Q9BUN0|Q9H769|Q9NSL5|Q9NV74|Q9NVJ7	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000284690.3	37	NULL	CCDS7652.1	10																																																																																			-	-		0.303	DHX32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000215972	protein_coding	OTTHUMT00000050945.2	G	NM_018180	-		127531562	+1	no_errors	ENST00000401153	ensembl	human	novel	74_37	rna	SNP	0.001	A
AGXT2	64902	genome.wustl.edu	37	5	35049444	35049444	+	5'Flank	SNP	C	C	T			TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chr5:35049444C>T	ENST00000231420.6	-	0	0				PRLR_ENST00000542609.1_Intron|PRLR_ENST00000397391.3_Missense_Mutation_p.S181N|PRLR_ENST00000348262.3_Missense_Mutation_p.S252N|PRLR_ENST00000513753.1_3'UTR|AC010368.2_ENST00000594869.1_5'Flank|PRLR_ENST00000231423.3_Missense_Mutation_p.S360N	NM_031900.3	NP_114106.1	Q9BYV1	AGT2_HUMAN	alanine--glyoxylate aminotransferase 2						cellular nitrogen compound metabolic process (GO:0034641)|glycine biosynthetic process, by transamination of glyoxylate (GO:0019265)|glyoxylate catabolic process (GO:0009436)|glyoxylate metabolic process (GO:0046487)|L-alanine catabolic process, by transamination (GO:0019481)|nucleobase-containing small molecule metabolic process (GO:0055086)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	(R)-3-amino-2-methylpropionate-pyruvate transaminase activity (GO:0047305)|alanine-glyoxylate transaminase activity (GO:0008453)|beta-alanine-pyruvate transaminase activity (GO:0016223)|pyridoxal phosphate binding (GO:0030170)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(18)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	41	all_lung(31;4.52e-05)		COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)	GBM - Glioblastoma multiforme(108;0.181)	Glycine(DB00145)|L-Alanine(DB00160)|Pyruvic acid(DB00119)	TCTTCCTTGACTTGAGATTTT	0.433																																																	0								ENSG00000113494																																			PRLR	SO:0001631	upstream_gene_variant	0			-	HGNC	AJ292204	CCDS3908.1	5p13	2010-05-07	2010-05-07		ENSG00000113492	ENSG00000113492	2.6.1.44		14412	protein-coding gene	gene with protein product	"""beta-alanine-pyruvate aminotransferase"", ""beta-ALAAT II"""	612471	"""alanine-glyoxylate aminotransferase 2"""			15240345	Standard	NM_031900		Approved	AGT2	uc003jjf.3	Q9BYV1	OTTHUMG00000090788		5.37:g.35049444C>T	Exception_encountered	Somatic	0	45	0.00		0.5891488714521174	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	67	10.67	B7ZM47|E9PDL7|Q53FB4|Q53FY7|Q53G03|Q5W7Q1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Growth/epo_recpt_lig-bind,pfam_IL-6_rcpt_alpha-bd,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.S360N	ENST00000231420.6	37	c.1079	CCDS3908.1	5	.	.	.	.	.	.	.	.	.	.	C	8.793	0.931104	0.18131	.	.	ENSG00000113494	ENST00000231423;ENST00000348262;ENST00000397391	T;T;D	0.84070	-1.2;-1.25;-1.8	2.41	-1.93	0.07594	.	.	.	.	.	T	0.67088	0.2856	N	0.22421	0.69	0.09310	N	1	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.08055	0.003;0.002;0.002	T	0.53215	-0.8470	9	0.62326	D	0.03	.	3.4636	0.07541	0.0:0.3816:0.2041:0.4142	.	181;252;360	Q8TD76;P16471-7;P16471-4	.;.;.	N	360;252;181	ENSP00000231423:S360N;ENSP00000311613:S252N;ENSP00000380546:S181N	ENSP00000231423:S360N	S	-	2	0	PRLR	35085201	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	0.094000	0.15107	-0.561000	0.06094	-0.305000	0.09177	AGT	-	NULL		0.433	AGXT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRLR	protein_coding	OTTHUMT00000207574.2	C	NM_031900	-		35049444	-1	no_errors	ENST00000231423	ensembl	human	known	74_37	missense	SNP	0.000	T
TP53	7157	genome.wustl.edu	37	17	7578191	7578191	+	Missense_Mutation	SNP	A	A	G	rs530941076		TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chr17:7578191A>G	ENST00000269305.4	-	6	847	c.658T>C	c.(658-660)Tat>Cat	p.Y220H	TP53_ENST00000574684.1_Intron|TP53_ENST00000420246.2_Missense_Mutation_p.Y220H|TP53_ENST00000413465.2_Missense_Mutation_p.Y220H|TP53_ENST00000455263.2_Missense_Mutation_p.Y220H|TP53_ENST00000445888.2_Missense_Mutation_p.Y220H|TP53_ENST00000359597.4_Missense_Mutation_p.Y220H	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	220	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		Y -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:7682763, ECO:0000269|PubMed:9450901}.|Y -> D (in sporadic cancers; somatic mutation).|Y -> F (in a sporadic cancer; somatic mutation).|Y -> H (in sporadic cancers; somatic mutation).|Y -> N (in sporadic cancers; somatic mutation).|Y -> S (in a brain tumor with no family history; germline mutation and in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.Y220N(12)|p.?(11)|p.Y220H(8)|p.0?(8)|p.Y220D(2)|p.D208fs*1(1)|p.Y220_P223delYEPP(1)|p.V218_E224delVPYEPPE(1)|p.V218_E221delVPYE(1)|p.S215fs*27(1)|p.V218_Y220delVPY(1)|p.Y220fs*25(1)|p.V216_Y220delVVVPY(1)|p.Y220fs*2(1)|p.V218fs*26(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGCGGCTCATAGGGCACCACC	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			A|||	1	0.000199681	0.0008	0.0	5008	,	,		16888	0.0		0.0	False		,,,				2504	0.0				Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	51	Substitution - Missense(22)|Unknown(11)|Whole gene deletion(8)|Deletion - In frame(5)|Deletion - Frameshift(4)|Insertion - Frameshift(1)	breast(10)|biliary_tract(6)|endometrium(5)|oesophagus(5)|haematopoietic_and_lymphoid_tissue(4)|bone(4)|upper_aerodigestive_tract(3)|skin(3)|stomach(2)|central_nervous_system(2)|urinary_tract(2)|lung(2)|liver(2)|ovary(1)						ENSG00000141510						105.0	96.0	99.0					17																	7578191		2203	4300	6503	TP53	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	-	HGNC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.658T>C	17.37:g.7578191A>G	ENSP00000269305:p.Tyr220His	Somatic	1	112	0.88		0.5891488714521174	42	59.22	61	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	51	34.62	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.Y220H	ENST00000269305.4	37	c.658	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	A	22.1	4.245298	0.80024	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99825	-6.97;-6.97;-6.97;-6.97;-6.97;-6.97;-6.97;-6.97	5.28	5.28	0.74379	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99729	0.9894	M	0.72894	2.215	0.58432	D	0.999998	D;D;D;D;D;D;D	0.89917	1.0;1.0;0.997;1.0;1.0;0.999;1.0	D;D;D;D;D;D;D	0.97110	1.0;0.998;0.995;1.0;0.999;0.998;1.0	D	0.97028	0.9748	10	0.87932	D	0	-1.87	13.4753	0.61306	1.0:0.0:0.0:0.0	.	181;220;220;127;220;220;220	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	H	220;220;220;220;220;220;209;127;88;127	ENSP00000410739:Y220H;ENSP00000352610:Y220H;ENSP00000269305:Y220H;ENSP00000398846:Y220H;ENSP00000391127:Y220H;ENSP00000391478:Y220H;ENSP00000425104:Y88H;ENSP00000423862:Y127H	ENSP00000269305:Y220H	Y	-	1	0	TP53	7518916	1.000000	0.71417	0.614000	0.29051	0.991000	0.79684	9.287000	0.95975	2.128000	0.65567	0.460000	0.39030	TAT	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	A	NM_000546	-		7578191	-1	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	SNP	0.998	G
ZNF652	22834	genome.wustl.edu	37	17	47389375	47389375	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chr17:47389375C>T	ENST00000362063.2	-	4	1396	c.1078G>A	c.(1078-1080)Gaa>Aaa	p.E360K	ZNF652_ENST00000430262.2_Missense_Mutation_p.E360K	NM_014897.2	NP_055712.1	Q9Y2D9	ZN652_HUMAN	zinc finger protein 652	360					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	20	all_cancers(4;6.81e-14)|Breast(4;4.97e-29)|all_epithelial(4;1.53e-17)		BRCA - Breast invasive adenocarcinoma(1;3.1e-14)|Epithelial(5;2.92e-06)|all cancers(6;3.15e-05)			CCACAGGTTTCGCATGTAAAT	0.423																																																	0								ENSG00000198740						174.0	149.0	157.0					17																	47389375		2203	4300	6503	ZNF652	SO:0001583	missense	0			-	HGNC	AB023141	CCDS32677.1	17q21.32	2013-01-08				ENSG00000198740		"""Zinc fingers, C2H2-type"""	29147	protein-coding gene	gene with protein product		613907				10231032	Standard	NM_014897		Approved	KIAA0924	uc002iow.3	Q9Y2D9		ENST00000362063.2:c.1078G>A	17.37:g.47389375C>T	ENSP00000354686:p.Glu360Lys	Somatic	0	37	0.00		0.5891488714521174	16	5.88	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	36	16.28	A4QPD9|Q5H9Q0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E360K	ENST00000362063.2	37	c.1078	CCDS32677.1	17	.	.	.	.	.	.	.	.	.	.	C	33	5.287203	0.95517	.	.	ENSG00000198740	ENST00000362063;ENST00000430262	T;T	0.06608	3.28;3.28	4.8	4.8	0.61643	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.14184	0.0343	N	0.25245	0.725	0.80722	D	1	D	0.76494	0.999	D	0.81914	0.995	T	0.20306	-1.0279	10	0.30078	T	0.28	-17.85	17.9956	0.89182	0.0:1.0:0.0:0.0	.	360	Q9Y2D9	ZN652_HUMAN	K	360	ENSP00000354686:E360K;ENSP00000416305:E360K	ENSP00000354686:E360K	E	-	1	0	ZNF652	44744374	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.547000	0.82146	2.639000	0.89480	0.655000	0.94253	GAA	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.423	ZNF652-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF652	protein_coding	OTTHUMT00000364524.1	C	NM_014897	-		47389375	-1	no_errors	ENST00000362063	ensembl	human	known	74_37	missense	SNP	1.000	T
MUC17	140453	genome.wustl.edu	37	7	100680100	100680100	+	Silent	SNP	G	G	A	rs142682652	byFrequency	TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chr7:100680100G>A	ENST00000306151.4	+	3	5467	c.5403G>A	c.(5401-5403)tcG>tcA	p.S1801S		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	1801	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					TACCAACCTCGACTCTTAGTG	0.507													-|||	22	0.00439297	0.0121	0.0	5008	,	,		27811	0.002		0.0	False		,,,				2504	0.0041																0								ENSG00000169876						257.0	261.0	260.0					7																	100680100		2203	4300	6503	MUC17	SO:0001819	synonymous_variant	0			-	HGNC	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.5403G>A	7.37:g.100680100G>A		Somatic	1	117	0.85		0.5891488714521174	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	124	9.49	O14761|Q685J2|Q8TDH7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_SEA_dom,smart_SEA_dom,pfscan_EG-like_dom,pfscan_SEA_dom	p.S1801	ENST00000306151.4	37	c.5403	CCDS34711.1	7																																																																																			-	NULL		0.507	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC17	protein_coding	OTTHUMT00000347161.1	G	NM_001040105	rs142682652		100680100	+1	no_errors	ENST00000306151	ensembl	human	known	74_37	silent	SNP	0.467	A
LOC400743	400743	genome.wustl.edu	37	1	17521055	17521056	+	lincRNA	DEL	CT	CT	-	rs188318003		TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	CT	CT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chr1:17521055_17521056delCT	ENST00000412427.1	+	0	1619_1620																											ctttcctgggctctctctctct	0.465																																																	0								ENSG00000204362																																			RP11-380J14.1			0				Clone_based_vega_gene																													1.37:g.17521065_17521066delCT		Somatic	0	31	0.00		0.5891488714521174	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	32	8.57		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000412427.1	37	NULL		1																																																																																			-	-		0.465	RP11-380J14.1-001	KNOWN	basic	lincRNA	LOC400743	lincRNA	OTTHUMT00000006615.1	CT				17521056	+1	no_errors	ENST00000412427	ensembl	human	known	74_37	rna	DEL	0.001:0.001	-
OR2M3	127062	genome.wustl.edu	37	1	248367161	248367161	+	Silent	SNP	T	T	C			TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chr1:248367161T>C	ENST00000456743.1	+	1	830	c.792T>C	c.(790-792)tcT>tcC	p.S264S		NM_001004689.1	NP_001004689.1	Q8NG83	OR2M3_HUMAN	olfactory receptor, family 2, subfamily M, member 3	264						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(6)|large_intestine(4)|lung(33)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	50	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			GGCCCACATCTGATCGCTCCC	0.502																																																	0								ENSG00000228198						192.0	175.0	181.0					1																	248367161		2203	4300	6503	OR2M3	SO:0001819	synonymous_variant	0			-	HGNC		CCDS31107.1	1q44	2012-08-09		2004-03-10	ENSG00000228198	ENSG00000228198		"""GPCR / Class A : Olfactory receptors"""	8269	protein-coding gene	gene with protein product				OR2M6, OR2M3P			Standard	NM_001004689		Approved	OST003	uc010pzg.2	Q8NG83	OTTHUMG00000040459	ENST00000456743.1:c.792T>C	1.37:g.248367161T>C		Somatic	0	35	0.00		0.5891488714521174	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	38	78	32.76	B9EH06|Q6IEY0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S264	ENST00000456743.1	37	c.792	CCDS31107.1	1																																																																																			-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.502	OR2M3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2M3	protein_coding	OTTHUMT00000097355.1	T	NM_001004689	-		248367161	+1	no_errors	ENST00000456743	ensembl	human	known	74_37	silent	SNP	0.000	C
ANKK1	255239	genome.wustl.edu	37	11	113269853	113269853	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chr11:113269853G>A	ENST00000303941.3	+	8	1256	c.1162G>A	c.(1162-1164)Gtg>Atg	p.V388M		NM_178510.1	NP_848605.1	Q8NFD2	ANKK1_HUMAN	ankyrin repeat and kinase domain containing 1	388							ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(2)|lung(14)|ovary(1)|stomach(1)	29		all_cancers(61;1.53e-11)|all_epithelial(67;3e-06)|Melanoma(852;4.04e-05)|all_hematologic(158;0.000315)|Acute lymphoblastic leukemia(157;0.000966)|Breast(348;0.0461)|Medulloblastoma(222;0.0523)|all_neural(223;0.0663)|Prostate(24;0.194)		BRCA - Breast invasive adenocarcinoma(274;4.82e-06)|Epithelial(105;5.41e-05)|all cancers(92;0.000442)|OV - Ovarian serous cystadenocarcinoma(223;0.238)		CGAGGTAGACGTGGACTGCCA	0.622																																																	0								ENSG00000170209						35.0	37.0	37.0					11																	113269853		2070	4197	6267	ANKK1	SO:0001583	missense	0			-	HGNC	AJ541797	CCDS44734.1	11q23.2	2013-01-10			ENSG00000170209	ENSG00000170209		"""Ankyrin repeat domain containing"""	21027	protein-coding gene	gene with protein product		608774				15146457	Standard	NM_178510		Approved	X-kinase	uc001pny.3	Q8NFD2	OTTHUMG00000167715	ENST00000303941.3:c.1162G>A	11.37:g.113269853G>A	ENSP00000306678:p.Val388Met	Somatic	0	61	0.00		0.5891488714521174	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	44	38.03		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ankyrin_rpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Ankyrin_rpt,prints_Ankyrin_rpt,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Prot_kinase_dom	p.V388M	ENST00000303941.3	37	c.1162	CCDS44734.1	11	.	.	.	.	.	.	.	.	.	.	G	7.497	0.651828	0.14516	.	.	ENSG00000170209	ENST00000303941	T	0.68765	-0.35	4.69	1.79	0.24919	Ankyrin repeat-containing domain (4);	0.257069	0.27464	N	0.019242	T	0.77883	0.4197	M	0.77820	2.39	0.09310	N	1	D	0.89917	1.0	D	0.79784	0.993	T	0.67122	-0.5750	10	0.72032	D	0.01	-16.893	7.9662	0.30100	0.3264:0.0:0.6736:0.0	.	388	Q8NFD2	ANKK1_HUMAN	M	388	ENSP00000306678:V388M	ENSP00000306678:V388M	V	+	1	0	ANKK1	112775063	0.002000	0.14202	0.022000	0.16811	0.001000	0.01503	0.022000	0.13511	0.211000	0.20683	-1.280000	0.01385	GTG	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom		0.622	ANKK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKK1	protein_coding	OTTHUMT00000395830.1	G	NM_178510	-		113269853	+1	no_errors	ENST00000303941	ensembl	human	known	74_37	missense	SNP	0.025	A
FAM47C	442444	genome.wustl.edu	37	X	37027073	37027073	+	Missense_Mutation	SNP	G	G	T	rs149352851	byFrequency	TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chrX:37027073G>T	ENST00000358047.3	+	1	642	c.590G>T	c.(589-591)tGt>tTt	p.C197F		NM_001013736.2	NP_001013758.1	Q5HY64	FA47C_HUMAN	family with sequence similarity 47, member C	197										breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	120						CGGGTGTCCTGTCTCCCCCCG	0.637													N|||	2	0.000529801	0.0	0.0029	3775	,	,		10975	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000198173	G	PHE/CYS	0,3833		0,0,0,1631,571	28.0	30.0	29.0		590	-0.5	0.0	X	dbSNP_134	29	3,6725		0,2,1,2426,1871	no	missense	FAM47C	NM_001013736.2	205	0,2,1,4057,2442	TT,TG,T,GG,G		0.0446,0.0,0.0284	possibly-damaging	197/1036	37027073	3,10558	2202	4300	6502	FAM47C	SO:0001583	missense	0			-	HGNC	AK125992	CCDS35227.1	Xp21.1	2006-07-04			ENSG00000198173	ENSG00000198173			25301	protein-coding gene	gene with protein product							Standard	NM_001013736		Approved		uc004ddl.2	Q5HY64	OTTHUMG00000024025	ENST00000358047.3:c.590G>T	X.37:g.37027073G>T	ENSP00000367913:p.Cys197Phe	Somatic	0	192	0.00		0.5891488714521174	1	96.97	32	WXS	Illumina HiSeq 2500	Phase_IV	tier1	405	140	74.31	Q6ZU46	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.C197F	ENST00000358047.3	37	c.590	CCDS35227.1	X	.	.	.	.	.	.	.	.	.	.	G	0.147	-1.095268	0.01858	0.0	4.46E-4	ENSG00000198173	ENST00000358047	T	0.14640	2.49	0.235	-0.47	0.12131	.	.	.	.	.	T	0.14527	0.0351	L	0.36672	1.1	0.09310	N	1	P	0.41498	0.752	P	0.48598	0.583	T	0.21999	-1.0229	9	0.51188	T	0.08	.	5.2535	0.15534	0.49:0.0:0.51:0.0	.	197	Q5HY64	FA47C_HUMAN	F	197	ENSP00000367913:C197F	ENSP00000367913:C197F	C	+	2	0	FAM47C	36936994	.	.	0.000000	0.03702	0.000000	0.00434	.	.	-1.872000	0.01136	-1.854000	0.00565	TGT	-	NULL		0.637	FAM47C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM47C	protein_coding	OTTHUMT00000060508.1	G	NM_001013736	rs149352851		37027073	+1	no_errors	ENST00000358047	ensembl	human	known	74_37	missense	SNP	0.005	T
TMEM253	643382	genome.wustl.edu	37	14	21571307	21571307	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chr14:21571307G>A	ENST00000556585.2	+	7	662	c.544G>A	c.(544-546)Gag>Aag	p.E182K	TMEM253_ENST00000418511.2_Missense_Mutation_p.E182K|ZNF219_ENST00000451119.2_Intron			P0C7T8	TM253_HUMAN	transmembrane protein 253	182						integral component of membrane (GO:0016021)											GGGCTTCTCTGAGTTGGAAGA	0.527																																																	0								ENSG00000232070						152.0	128.0	135.0					14																	21571307		692	1591	2283	TMEM253	SO:0001583	missense	0			-	HGNC		CCDS53884.1	14q11.2	2012-10-24	2012-10-24	2012-10-24	ENSG00000232070	ENSG00000232070			32545	protein-coding gene	gene with protein product			"""non-protein coding RNA 220"", ""chromosome 14 open reading frame 95"", ""chromosome 14 open reading frame 176"""	NCRNA00220, C14orf95, C14orf176			Standard	NM_001146683		Approved		uc010tlo.2	P0C7T8	OTTHUMG00000171361	ENST00000556585.2:c.544G>A	14.37:g.21571307G>A	ENSP00000451229:p.Glu182Lys	Somatic	0	38	0.00		0.5891488714521174	4	50.00	4	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	34	39.29		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.E182K	ENST00000556585.2	37	c.544	CCDS53884.1	14	.	.	.	.	.	.	.	.	.	.	G	27.4	4.830300	0.91036	.	.	ENSG00000258495	ENST00000556585	.	.	.	5.0	5.0	0.66597	.	.	.	.	.	T	0.48714	0.1515	L	0.32530	0.975	0.27571	N	0.949874	D	0.56035	0.974	P	0.57009	0.811	T	0.42481	-0.9449	8	0.87932	D	0	-7.3571	13.6734	0.62438	0.0:0.0:1.0:0.0	.	182	P0C7T8	CN176_HUMAN	K	182	.	ENSP00000395470:E182K	E	+	1	0	C14orf176	20641147	0.999000	0.42202	0.865000	0.33974	0.989000	0.77384	4.235000	0.58666	2.596000	0.87737	0.561000	0.74099	GAG	-	NULL		0.527	TMEM253-003	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM253	protein_coding	OTTHUMT00000413146.2	G	XM_926711	-		21571307	+1	no_errors	ENST00000418511	ensembl	human	known	74_37	missense	SNP	0.695	A
FAM205B	389715	genome.wustl.edu	37	9	34835945	34835945	+	RNA	SNP	G	G	A	rs533004326		TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chr9:34835945G>A	ENST00000455647.2	-	0	448							Q63HN1	F205B_HUMAN	family with sequence similarity 205, member B																		ATTCTCATCCGCCAGCAACTG	0.512													G|||	1	0.000199681	0.0	0.0	5008	,	,		19643	0.0		0.0	False		,,,				2504	0.001																0								ENSG00000257198																																			FAM205B			0			-	HGNC			9p13.3	2013-05-22	2011-08-15	2011-08-15	ENSG00000257198	ENSG00000257198			24504	other	unknown			"""chromosome 9 open reading frame 144"""	C9orf144			Standard	NR_024481		Approved	DKFZp434J193, C9orf144A	uc003zvp.4	Q63HN1	OTTHUMG00000019839		9.37:g.34835945G>A		Somatic	0	23	0.00		0.5891488714521174	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	23	17.86	Q6ZRJ7	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000455647.2	37	NULL		9	.	.	.	.	.	.	.	.	.	.	G	11.18	1.563690	0.27915	.	.	ENSG00000215204	ENST00000399773	.	.	.	4.51	-8.57	0.00900	.	.	.	.	.	T	0.36386	0.0965	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.53500	-0.8430	5	0.87932	D	0	.	8.6329	0.33930	0.1486:0.0:0.5808:0.2706	.	.	.	.	W	118	.	ENSP00000382673:R118W	R	-	1	2	C9orf144	34825945	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-1.516000	0.02250	-1.978000	0.00993	-1.434000	0.01081	CGG	-	-		0.512	FAM205B-001	KNOWN	basic	processed_transcript	FAM205B	pseudogene	OTTHUMT00000052246.5	G	NR_024481	-		34835945	-1	no_errors	ENST00000455647	ensembl	human	known	74_37	rna	SNP	0.000	A
FEZF1	389549	genome.wustl.edu	37	7	121943251	121943251	+	Missense_Mutation	SNP	G	G	T			TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chr7:121943251G>T	ENST00000442488.2	-	2	983	c.916C>A	c.(916-918)Cac>Aac	p.H306N	FEZF1-AS1_ENST00000428449.1_RNA|FEZF1_ENST00000427185.2_Missense_Mutation_p.H256N|FEZF1-AS1_ENST00000437317.1_RNA|FEZF1_ENST00000331178.4_Missense_Mutation_p.H302N	NM_001024613.2|NM_001160264.1	NP_001019784.2|NP_001153736.1	A0PJY2	FEZF1_HUMAN	FEZ family zinc finger 1	306					axon guidance (GO:0007411)|forebrain anterior/posterior pattern specification (GO:0021797)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)			breast(1)|large_intestine(3)|lung(18)|ovary(2)|prostate(1)	25						ATGATCTTGTGCCTGCACAGG	0.468																																																	0								ENSG00000128610						147.0	140.0	142.0					7																	121943251		2203	4300	6503	FEZF1	SO:0001583	missense	0			-	HGNC	AY726588	CCDS34741.1, CCDS34741.2, CCDS55157.1	7q31.32	2013-01-08	2006-08-15	2006-08-15	ENSG00000128610	ENSG00000128610		"""Zinc fingers, C2H2-type"""	22788	protein-coding gene	gene with protein product		613301	"""zinc finger protein 312B"""	ZNF312B			Standard	NM_001024613		Approved		uc003vkd.3	A0PJY2	OTTHUMG00000157091	ENST00000442488.2:c.916C>A	7.37:g.121943251G>T	ENSP00000411145:p.His306Asn	Somatic	0	67	0.00		0.5891488714521174	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	59	13.24	A0PJY3|A4D0W3|B4DUP9|B7ZM98	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.H306N	ENST00000442488.2	37	c.916	CCDS34741.2	7	.	.	.	.	.	.	.	.	.	.	G	28.7	4.938720	0.92526	.	.	ENSG00000128610	ENST00000442488;ENST00000331178;ENST00000427185	D;D;D	0.86865	-2.18;-2.18;-2.18	5.23	5.23	0.72850	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.95950	0.8681	H	0.96208	3.785	0.80722	D	1	D;D	0.71674	0.997;0.998	D;D	0.83275	0.996;0.991	D	0.97106	0.9801	10	0.87932	D	0	-19.5123	19.2154	0.93776	0.0:0.0:1.0:0.0	.	306;256	A0PJY2;A0PJY2-2	FEZF1_HUMAN;.	N	306;302;256	ENSP00000411145:H306N;ENSP00000332777:H302N;ENSP00000392727:H256N	ENSP00000332777:H302N	H	-	1	0	FEZF1	121730487	1.000000	0.71417	0.999000	0.59377	0.987000	0.75469	7.920000	0.87521	2.602000	0.87976	0.650000	0.86243	CAC	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.468	FEZF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FEZF1	protein_coding	OTTHUMT00000347410.1	G	NM_001024613	-		121943251	-1	no_errors	ENST00000442488	ensembl	human	known	74_37	missense	SNP	1.000	T
TPRKB	51002	genome.wustl.edu	37	2	73957880	73957881	+	Intron	INS	-	-	A	rs373860849		TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chr2:73957880_73957881insA	ENST00000272424.5	-	4	371				TPRKB_ENST00000409716.2_Intron|TPRKB_ENST00000318190.7_Intron|TPRKB_ENST00000485758.1_5'UTR	NM_016058.2	NP_057142.1	Q9Y3C4	TPRKB_HUMAN	TP53RK binding protein						tRNA processing (GO:0008033)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)			lung(2)|ovary(1)|skin(1)	4						GAAAAAAAATGAAAAAAAAAAC	0.327																																																	0								ENSG00000144034																																			TPRKB	SO:0001627	intron_variant	0				HGNC	AY157986	CCDS1927.1	2p24.3-p24.1	2008-02-05			ENSG00000144034	ENSG00000144034			24259	protein-coding gene	gene with protein product		608680				10810093, 12659830	Standard	NM_016058		Approved	CGI-121	uc002sjn.2	Q9Y3C4	OTTHUMG00000129815	ENST00000272424.5:c.265-17->T	2.37:g.73957890_73957890dupA		Somatic	0	17	0.00		0.5891488714521174	8	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	15	11.76	D6W5H6|Q8IWR6|Q8IWR7|Q9H3K4	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000272424.5	37	NULL	CCDS1927.1	2																																																																																			-	-		0.327	TPRKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPRKB	protein_coding	OTTHUMT00000252046.2	-	NM_016058			73957881	-1	no_errors	ENST00000485758	ensembl	human	putative	74_37	rna	INS	0.000:0.004	A
KRTAP5-3	387266	genome.wustl.edu	37	11	1628925	1628925	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chr11:1628925G>A	ENST00000399685.1	-	1	768	c.691C>T	c.(691-693)Cca>Tca	p.P231S		NM_001012708.2	NP_001012726.1	Q6L8H2	KRA53_HUMAN	keratin associated protein 5-3	231	11 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)				endometrium(1)|large_intestine(2)|lung(3)|ovary(2)	8		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000618)|Lung(200;0.0684)|LUSC - Lung squamous cell carcinoma(625;0.0822)		CAGCAAATTGGGACACAGCAG	0.587																																																	0								ENSG00000196224						148.0	156.0	153.0					11																	1628925		2202	4299	6501	KRTAP5-3	SO:0001583	missense	0			-	HGNC	AB126072	CCDS41591.1	11p15.5	2008-02-05			ENSG00000196224	ENSG00000196224		"""Keratin associated proteins"""	23598	protein-coding gene	gene with protein product						15144888	Standard	NM_001012708		Approved	KRTAP5.3, KRTAP5-9	uc001ltw.1	Q6L8H2	OTTHUMG00000057559	ENST00000399685.1:c.691C>T	11.37:g.1628925G>A	ENSP00000382592:p.Pro231Ser	Somatic	0	184	0.00		0.5891488714521174	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	109	17.42	Q6PL44|Q701N3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.P231S	ENST00000399685.1	37	c.691	CCDS41591.1	11	.	.	.	.	.	.	.	.	.	.	G	4.246	0.044623	0.08196	.	.	ENSG00000196224	ENST00000399685	T	0.01145	5.27	3.34	3.34	0.38264	.	.	.	.	.	T	0.05731	0.0150	M	0.86420	2.815	0.09310	N	1	D	0.69078	0.997	D	0.63703	0.917	T	0.21965	-1.0230	9	0.37606	T	0.19	.	6.8939	0.24245	0.1364:0.0:0.8636:0.0	.	231	Q6L8H2	KRA53_HUMAN	S	231	ENSP00000382592:P231S	ENSP00000382592:P231S	P	-	1	0	KRTAP5-3	1585501	0.427000	0.25514	0.227000	0.23927	0.162000	0.22319	1.297000	0.33400	1.578000	0.49821	0.298000	0.19748	CCA	-	NULL		0.587	KRTAP5-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP5-3	protein_coding	OTTHUMT00000127924.1	G		-		1628925	-1	no_errors	ENST00000399685	ensembl	human	known	74_37	missense	SNP	0.009	A
BCO1	53630	genome.wustl.edu	37	16	81279115	81279115	+	Missense_Mutation	SNP	C	C	T	rs201320081		TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chr16:81279115C>T	ENST00000258168.2	+	2	561	c.100C>T	c.(100-102)Cgc>Tgc	p.R34C	BCMO1_ENST00000564552.1_Missense_Mutation_p.R34C|BCMO1_ENST00000425577.2_Missense_Mutation_p.P8L	NM_017429.2	NP_059125.2												p.R34C(1)		breast(2)|endometrium(1)|large_intestine(4)|lung(9)|prostate(3)|skin(3)|stomach(1)	23						AACCCTGCTCCGCAATGGGCC	0.527													C|||	1	0.000199681	0.0	0.0	5008	,	,		21364	0.0		0.001	False		,,,				2504	0.0																1	Substitution - Missense(1)	skin(1)						ENSG00000135697						150.0	146.0	147.0					16																	81279115		2202	4300	6502	BCMO1	SO:0001583	missense	0			GMAF=0.0005	HGNC																												ENST00000258168.2:c.100C>T	16.37:g.81279115C>T	ENSP00000258168:p.Arg34Cys	Somatic	0	59	0.00		0.5891488714521174	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	49	19.67		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Carotenoid_Oase	p.R34C	ENST00000258168.2	37	c.100	CCDS10934.1	16	1|1	4.578754578754579E-4|4.578754578754579E-4	0|0	0.0|0.0	0|0	0.0|0.0	0|0	0.0|0.0	1|1	0.0013192612137203166|0.0013192612137203166	C|C	12.56|12.56	1.974608|1.974608	0.34848|0.34848	.|.	.|.	ENSG00000135697|ENSG00000135697	ENST00000425577|ENST00000258168	D|D	0.93366|0.98849	-3.21|-5.18	4.89|4.89	4.89|4.89	0.63831|0.63831	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.99399|0.99399	0.9788|0.9788	H|H	0.94503|0.94503	3.545|3.545	0.45747|0.45747	D|D	0.998646|0.998646	B|D	0.28880|0.89917	0.226|1.0	B|D	0.20184|0.85130	0.028|0.997	D|D	0.98552|0.98552	1.0637|1.0637	9|10	0.87932|0.87932	D|D	0|0	-26.353|-26.353	18.0482|18.0482	0.89340|0.89340	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	8|34	E7EM88|Q9HAY6	.|BCDO1_HUMAN	L|C	8|34	ENSP00000400586:P8L|ENSP00000258168:R34C	ENSP00000400586:P8L|ENSP00000258168:R34C	P|R	+|+	2|1	0|0	BCMO1|BCMO1	79836616|79836616	0.984000|0.984000	0.35163|0.35163	0.243000|0.243000	0.24186|0.24186	0.664000|0.664000	0.39144|0.39144	2.666000|2.666000	0.46799|0.46799	2.411000|2.411000	0.81874|0.81874	0.655000|0.655000	0.94253|0.94253	CCG|CGC	-	pfam_Carotenoid_Oase		0.527	BCMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCMO1	protein_coding	OTTHUMT00000269056.1	C		rs201320081		81279115	+1	no_errors	ENST00000258168	ensembl	human	known	74_37	missense	SNP	0.998	T
IGF2BP2	10644	genome.wustl.edu	37	3	185414435	185414435	+	Frame_Shift_Del	DEL	A	A	-			TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chr3:185414435delA	ENST00000382199.2	-	4	400	c.305delT	c.(304-306)ttgfs	p.L102fs	IGF2BP2_ENST00000457616.2_Frame_Shift_Del_p.L102fs|IGF2BP2_ENST00000421047.2_Frame_Shift_Del_p.L39fs|IGF2BP2_ENST00000346192.3_Frame_Shift_Del_p.L102fs	NM_006548.4	NP_006539.3	Q9Y6M1	IF2B2_HUMAN	insulin-like growth factor 2 mRNA binding protein 2	102	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				anatomical structure morphogenesis (GO:0009653)|gene expression (GO:0010467)|mRNA transport (GO:0051028)|negative regulation of translation (GO:0017148)|regulation of cytokine biosynthetic process (GO:0042035)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nucleus (GO:0005634)	mRNA 3'-UTR binding (GO:0003730)|mRNA 5'-UTR binding (GO:0048027)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|translation regulator activity (GO:0045182)			breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|prostate(1)|skin(3)	20	all_cancers(143;5.84e-11)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(80;7.41e-21)			ATATTGAGCCAAAAGTCCATC	0.383																																																	0								ENSG00000073792						123.0	114.0	117.0					3																	185414435		2203	4300	6503	IGF2BP2	SO:0001589	frameshift_variant	0				HGNC	BC021290	CCDS3273.2, CCDS33903.1	3q27.2	2013-02-12			ENSG00000073792	ENSG00000073792		"""RNA binding motif (RRM) containing"""	28867	protein-coding gene	gene with protein product	"""IGF II mRNA binding protein 2"""	608289				10190901, 9891060	Standard	NM_001007225		Approved	IMP-2	uc003fpo.3	Q9Y6M1	OTTHUMG00000074025	ENST00000382199.2:c.305delT	3.37:g.185414435delA	ENSP00000371634:p.Leu102fs	Somatic	0	19	0.00		0.5891488714521174	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	27	10.00	A0A4Z0|B3FTN2|B3FTN3|B3FTN4	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_KH_dom_type_1,pfam_RRM_dom,smart_RRM_dom,smart_KH_dom,pfscan_KH_dom_type_1,pfscan_RRM_dom	p.L102fs	ENST00000382199.2	37	c.305	CCDS3273.2	3																																																																																			-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom		0.383	IGF2BP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	IGF2BP2	protein_coding	OTTHUMT00000157087.2	A	NM_006548			185414435	-1	no_errors	ENST00000382199	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
CCDC130	81576	genome.wustl.edu	37	19	13865118	13865118	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chr19:13865118G>A	ENST00000586600.1	+	4	522	c.19G>A	c.(19-21)Gtc>Atc	p.V7I	CCDC130_ENST00000221554.8_Missense_Mutation_p.V7I			P13994	CC130_HUMAN	coiled-coil domain containing 130	7					response to virus (GO:0009615)					endometrium(2)|kidney(1)|large_intestine(3)|ovary(1)|skin(2)|urinary_tract(1)	10			OV - Ovarian serous cystadenocarcinoma(19;6.02e-23)|Epithelial(5;2.58e-18)			AAGGAAAGGGGTCAACAAGTA	0.488																																																	0								ENSG00000104957						113.0	91.0	98.0					19																	13865118		2203	4300	6503	CCDC130	SO:0001583	missense	0			-	HGNC	AF250306	CCDS12296.1	19p13.13	2008-02-05				ENSG00000104957			28118	protein-coding gene	gene with protein product						3203696	Standard	NM_030818		Approved	MGC10471	uc002mxc.1	P13994		ENST00000586600.1:c.19G>A	19.37:g.13865118G>A	ENSP00000465776:p.Val7Ile	Somatic	0	100	0.00		0.5891488714521174	73	21.51	20	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	48	21.31	Q9BQ72	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_CWC16	p.V7I	ENST00000586600.1	37	c.19	CCDS12296.1	19	.	.	.	.	.	.	.	.	.	.	G	10.53	1.375940	0.24857	.	.	ENSG00000104957	ENST00000540216;ENST00000221554	T	0.27720	1.65	4.1	1.89	0.25635	.	0.623138	0.16654	N	0.205082	T	0.23054	0.0557	N	0.20807	0.61	0.18873	N	0.999986	B;P	0.42296	0.254;0.775	B;P	0.48873	0.186;0.593	T	0.06427	-1.0827	10	0.41790	T	0.15	-18.043	3.9565	0.09391	0.2248:0.2131:0.5622:0.0	.	7;7	B7Z1U2;P13994	.;CC130_HUMAN	I	7	ENSP00000221554:V7I	ENSP00000221554:V7I	V	+	1	0	CCDC130	13726118	0.585000	0.26774	0.055000	0.19348	0.827000	0.46813	2.602000	0.46257	0.361000	0.24292	0.462000	0.41574	GTC	-	pfam_CWC16		0.488	CCDC130-001	KNOWN	alternative_5_UTR|upstream_uORF|basic|appris_principal|CCDS	protein_coding	CCDC130	protein_coding	OTTHUMT00000453216.2	G	NM_030818	-		13865118	+1	no_errors	ENST00000221554	ensembl	human	known	74_37	missense	SNP	0.211	A
GPAT2	150763	genome.wustl.edu	37	2	96688929	96688929	+	Missense_Mutation	SNP	G	G	A	rs201647131	byFrequency	TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chr2:96688929G>A	ENST00000434632.1	-	20	2533	c.2074C>T	c.(2074-2076)Cgc>Tgc	p.R692C	GPAT2_ENST00000359548.4_Missense_Mutation_p.R692C|GPAT2_ENST00000453542.1_Missense_Mutation_p.R621C|GPAT2_ENST00000377137.3_Intron|FAHD2CP_ENST00000607780.1_RNA			Q6NUI2	GPAT2_HUMAN	glycerol-3-phosphate acyltransferase 2, mitochondrial	692					CDP-diacylglycerol biosynthetic process (GO:0016024)|glycerol-3-phosphate metabolic process (GO:0006072)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	glycerol-3-phosphate O-acyltransferase activity (GO:0004366)	p.R692C(3)		NS(1)|breast(1)|cervix(1)|endometrium(4)|large_intestine(1)|lung(5)|skin(3)	16						CTGAGCAGGCGGCAGAGGAAA	0.652																																																	3	Substitution - Missense(3)	large_intestine(1)|NS(1)|skin(1)						ENSG00000186281						14.0	17.0	16.0					2																	96688929		1816	4045	5861	GPAT2	SO:0001583	missense	0			-	HGNC	BC042847	CCDS42714.1	2q11.2	2010-05-04			ENSG00000186281	ENSG00000186281			27168	protein-coding gene	gene with protein product	"""cancer/testis antigen 123"""					12477932	Standard	NM_207328		Approved	CT123	uc010yuf.1	Q6NUI2	OTTHUMG00000155208	ENST00000434632.1:c.2074C>T	2.37:g.96688929G>A	ENSP00000389395:p.Arg692Cys	Somatic	0	67	0.00		0.5891488714521174	47	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	39	17.02	Q6P2E4|Q6ZNI3|Q6ZNI5|Q6ZWJ4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_Plipid/glycerol_acylTrfase	p.R692C	ENST00000434632.1	37	c.2074	CCDS42714.1	2	152	0.0695970695970696	8	0.016260162601626018	16	0.04419889502762431	27	0.0472027972027972	101	0.13324538258575197	g	16.45	3.127649	0.56721	.	.	ENSG00000186281	ENST00000359548;ENST00000434632;ENST00000453542	T;T;T	0.80480	-1.38;-1.38;-0.41	5.44	5.44	0.79542	.	0.381151	0.27411	N	0.019488	T	0.02727	0.0082	L	0.50333	1.59	0.80722	D	1	P;D;P;B	0.54207	0.584;0.965;0.953;0.354	B;B;B;B	0.42062	0.093;0.374;0.267;0.065	T	0.41840	-0.9486	10	0.66056	D	0.02	-11.9956	16.7485	0.85479	0.0:0.0:1.0:0.0	.	621;698;692;621	E9PE95;Q6NUI2-4;Q6NUI2;B4DNZ9	.;.;GPAT2_HUMAN;.	C	692;692;621	ENSP00000352547:R692C;ENSP00000389395:R692C;ENSP00000393770:R621C	ENSP00000352547:R692C	R	-	1	0	GPAT2	96052656	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	3.041000	0.49807	2.569000	0.86673	0.637000	0.83480	CGC	-	NULL		0.652	GPAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPAT2	protein_coding	OTTHUMT00000338786.1	G	NM_207328	rs201647131		96688929	-1	no_errors	ENST00000359548	ensembl	human	known	74_37	missense	SNP	1.000	A
C14orf105	55195	genome.wustl.edu	37	14	57947400	57947400	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chr14:57947400C>T	ENST00000216445.3	-	5	704	c.568G>A	c.(568-570)Gcc>Acc	p.A190T	C14orf105_ENST00000422976.2_Missense_Mutation_p.A189T|C14orf105_ENST00000534126.1_Missense_Mutation_p.A189T	NM_001283057.1|NM_018168.2	NP_001269986.1|NP_060638.2	Q9NVL8	CN105_HUMAN	chromosome 14 open reading frame 105	190										breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(3)|prostate(1)|skin(1)	11						GTTTTCTTGGCTTTATGGTCC	0.413																																																	0								ENSG00000100557						271.0	258.0	262.0					14																	57947400		2203	4300	6503	C14orf105	SO:0001583	missense	0			-	HGNC	AK001512	CCDS9730.1, CCDS61458.1, CCDS61459.1	14q22.2	2012-09-25			ENSG00000100557	ENSG00000100557			20189	protein-coding gene	gene with protein product							Standard	XM_005267806		Approved	FLJ10650	uc001xcy.2	Q9NVL8	OTTHUMG00000140317	ENST00000216445.3:c.568G>A	14.37:g.57947400C>T	ENSP00000216445:p.Ala190Thr	Somatic	0	54	0.00		0.5891488714521174	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	71	11.11	Q53G04	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.A190T	ENST00000216445.3	37	c.568	CCDS9730.1	14	.	.	.	.	.	.	.	.	.	.	C	13.46	2.244195	0.39697	.	.	ENSG00000100557	ENST00000216445;ENST00000422976;ENST00000534126	T;T;T	0.53857	0.6;0.6;0.6	5.61	3.75	0.43078	.	0.598055	0.15702	N	0.248870	T	0.39886	0.1095	L	0.29908	0.895	0.40274	D	0.978325	B;B;B;B;B	0.21753	0.035;0.06;0.002;0.008;0.008	B;B;B;B;B	0.23419	0.015;0.046;0.012;0.019;0.019	T	0.24657	-1.0154	10	0.56958	D	0.05	-0.0086	7.9765	0.30157	0.0:0.8042:0.0:0.1958	.	189;189;189;189;190	B7ZL43;F5GWJ3;Q17R99;E9PSE9;Q9NVL8	.;.;.;.;CN105_HUMAN	T	190;189;189	ENSP00000216445:A190T;ENSP00000392368:A189T;ENSP00000434003:A189T	ENSP00000216445:A190T	A	-	1	0	C14orf105	57017153	0.002000	0.14202	0.614000	0.29051	0.405000	0.30901	0.250000	0.18235	0.691000	0.31592	0.650000	0.86243	GCC	-	NULL		0.413	C14orf105-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C14orf105	protein_coding	OTTHUMT00000276921.2	C	NM_018168	-		57947400	-1	no_errors	ENST00000216445	ensembl	human	known	74_37	missense	SNP	0.639	T
SULT1C3	442038	genome.wustl.edu	37	2	108875465	108875486	+	Intron	DEL	AAACTTGGTCAGGTGATGTTAT	AAACTTGGTCAGGTGATGTTAT	-	rs13385082|rs540686743|rs149535765	byFrequency	TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	AAACTTGGTCAGGTGATGTTAT	AAACTTGGTCAGGTGATGTTAT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chr2:108875465_108875486delAAACTTGGTCAGGTGATGTTAT	ENST00000329106.2	+	5	621				SULT1C3_ENST00000376700.1_Frame_Shift_Del_p.KTWSGDVI222fs	NM_001008743.1	NP_001008743.1	Q6IMI6	ST1C3_HUMAN	sulfotransferase family, cytosolic, 1C, member 3						sulfur compound metabolic process (GO:0006790)	cytoplasm (GO:0005737)	alcohol sulfotransferase activity (GO:0004027)|aryl sulfotransferase activity (GO:0004062)			breast(1)|kidney(1)|large_intestine(1)|lung(8)|prostate(1)|skin(4)	16						TTCTTGGAGAAAACTTGGTCAGGTGATGTTATAAACAAGATT	0.419														1104	0.220447	0.0219	0.2738	5008	,	,		22524	0.1081		0.3767	False		,,,				2504	0.4059																0								ENSG00000196228																																			SULT1C3	SO:0001627	intron_variant	0				HGNC	BC146362	CCDS33267.1	2q12.3	2007-07-26			ENSG00000196228	ENSG00000196228		"""Sulfotransferases, cytosolic"""	33543	protein-coding gene	gene with protein product						14676822, 17425406	Standard	NM_001008743		Approved		uc010ywo.2	Q6IMI6	OTTHUMG00000153227	ENST00000329106.2:c.621+181AAACTTGGTCAGGTGATGTTAT>-	2.37:g.108875465_108875486delAAACTTGGTCAGGTGATGTTAT		Somatic	NA	NA	NA		0.5891488714521174	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q6IMI5	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase	p.W224fs	ENST00000329106.2	37	c.665_686	CCDS33267.1	2																																																																																			-	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase		0.419	SULT1C3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SULT1C3	protein_coding	OTTHUMT00000330255.1	AAACTTGGTCAGGTGATGTTAT	NM_001008743			108875486	+1	no_errors	ENST00000376700	ensembl	human	known	74_37	frame_shift_del	DEL	0.420:0.382:0.018:0.002:0.000:0.000:0.001:0.000:0.000:0.000:0.002:0.395:0.396:0.268:0.312:0.255:0.004:0.004:0.004:0.002:0.004:0.025	-
UBA3	9039	genome.wustl.edu	37	3	69105348	69105348	+	Silent	SNP	G	G	C			TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chr3:69105348G>C	ENST00000361055.4	-	15	1224	c.1170C>G	c.(1168-1170)acC>acG	p.T390T	UBA3_ENST00000540295.1_Silent_p.T213T|CTD-2013N24.2_ENST00000595925.1_RNA|UBA3_ENST00000415609.2_Silent_p.T349T|UBA3_ENST00000349511.4_Silent_p.T376T	NM_003968.3	NP_003959.3	Q8TBC4	UBA3_HUMAN	ubiquitin-like modifier activating enzyme 3	390	Interaction with UBE2M core domain.				cellular protein modification process (GO:0006464)|endomitotic cell cycle (GO:0007113)|protein neddylation (GO:0045116)|proteolysis (GO:0006508)|regulation of cell cycle (GO:0051726)	cytosol (GO:0005829)|nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|NEDD8 activating enzyme activity (GO:0019781)|protein heterodimerization activity (GO:0046982)			endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	19		Lung NSC(201;0.0193)|Prostate(884;0.174)		BRCA - Breast invasive adenocarcinoma(55;7.98e-05)|Epithelial(33;0.000363)|LUSC - Lung squamous cell carcinoma(21;0.012)|Lung(16;0.0191)|KIRC - Kidney renal clear cell carcinoma(39;0.206)|Kidney(39;0.241)		AAGCACTATTGGTTAGATAAT	0.299																																																	0								ENSG00000144744						58.0	58.0	58.0					3																	69105348		2203	4299	6502	UBA3	SO:0001819	synonymous_variant	0			-	HGNC	AB012190	CCDS2909.1, CCDS2910.1	3p14.1	2013-09-26	2007-11-30	2007-11-30	ENSG00000144744	ENSG00000144744		"""Ubiquitin-like modifier activating enzymes"""	12470	protein-coding gene	gene with protein product	"""NEDD8-activating enzyme E1 catalytic subunit"", ""NEDD8-activating enzyme E1 subunit 2"""	603172	"""ubiquitin-activating enzyme E1C (homologous to yeast UBA3)"", ""ubiquitin-activating enzyme E1C (UBA3 homolog, yeast)"""	UBE1C		9694792	Standard	NM_003968		Approved	hUba3, NAE2	uc003dno.3	Q8TBC4	OTTHUMG00000154325	ENST00000361055.4:c.1170C>G	3.37:g.69105348G>C		Somatic	0	68	0.00		0.5891488714521174	106	17.83	23	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	69	13.75	A6NLB5|A8K027|O76088|Q9NTU3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_ThiF_NAD_FAD-bd,pfam_E2_binding,pfam_UBact_repeat,pfam_Ubiquitin-activating_enzyme,superfamily_Molybdenum_cofac_synth_MoeB	p.T390	ENST00000361055.4	37	c.1170	CCDS2909.1	3																																																																																			-	pfam_E2_binding,superfamily_Molybdenum_cofac_synth_MoeB		0.299	UBA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBA3	protein_coding	OTTHUMT00000334839.1	G	NM_198195	-		69105348	-1	no_errors	ENST00000361055	ensembl	human	known	74_37	silent	SNP	0.998	C
FLT4	2324	genome.wustl.edu	37	5	180047941	180047941	+	Missense_Mutation	SNP	C	C	T	rs184409663		TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chr5:180047941C>T	ENST00000261937.6	-	15	2312	c.2234G>A	c.(2233-2235)cGc>cAc	p.R745H	FLT4_ENST00000393347.3_Missense_Mutation_p.R745H|FLT4_ENST00000424276.2_5'Flank|FLT4_ENST00000502649.1_Missense_Mutation_p.R745H	NM_182925.4	NP_891555.2	P35916	VGFR3_HUMAN	fms-related tyrosine kinase 4	745	Ig-like C2-type 7.			R -> P (in Ref. 3; CAA49505 and 7; AAO89504/AAO89505). {ECO:0000305}.	blood vessel morphogenesis (GO:0048514)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|lymph vessel development (GO:0001945)|lymphangiogenesis (GO:0001946)|negative regulation of apoptotic process (GO:0043066)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of JNK cascade (GO:0046330)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation vascular endothelial growth factor production (GO:0010575)|protein autophosphorylation (GO:0046777)|regulation of blood vessel remodeling (GO:0060312)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein phosphatase binding (GO:0019903)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|kidney(6)|large_intestine(5)|liver(2)|lung(37)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(89;2.21e-05)|all_epithelial(37;5.29e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00245)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.134)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	GCACAGATAGCGTCCCGCATC	0.667													C|||	1	0.000199681	0.0	0.0	5008	,	,		17746	0.001		0.0	False		,,,				2504	0.0				Colon(97;1075 1466 27033 27547 35871)												0								ENSG00000037280						33.0	31.0	32.0					5																	180047941		2201	4300	6501	FLT4	SO:0001583	missense	0			GMAF=0.0005	HGNC	X68203	CCDS4457.1, CCDS43412.1	5q34-q35	2013-01-29			ENSG00000037280	ENSG00000037280	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3767	protein-coding gene	gene with protein product		136352				1319394	Standard	NM_002020		Approved	VEGFR3, PCL	uc003mlz.4	P35916	OTTHUMG00000130931	ENST00000261937.6:c.2234G>A	5.37:g.180047941C>T	ENSP00000261937:p.Arg745His	Somatic	0	58	0.00		0.5891488714521174	88	1.12	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	30	11.76	A8K6L4|B5A926|Q16067|Q86W07|Q86W08	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Ig_I-set,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,prints_VEGFR3_rcpt	p.R745H	ENST00000261937.6	37	c.2234	CCDS4457.1	5	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	12.36	1.914504	0.33815	.	.	ENSG00000037280	ENST00000261937;ENST00000393347;ENST00000502649;ENST00000376868	T;T;T	0.67698	-0.28;-0.28;-0.28	4.72	0.91	0.19337	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.50514	0.1620	L	0.35644	1.08	0.26137	N	0.980337	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.10450	0.004;0.005;0.005	T	0.35649	-0.9780	9	0.33940	T	0.23	.	4.4212	0.11481	0.2267:0.4451:0.0:0.3281	.	555;745;745	E9PFB0;E9PD35;P35916	.;.;VGFR3_HUMAN	H	745;745;745;555	ENSP00000261937:R745H;ENSP00000377016:R745H;ENSP00000426057:R745H	ENSP00000261937:R745H	R	-	2	0	FLT4	179980547	1.000000	0.71417	0.201000	0.23476	0.512000	0.34134	2.029000	0.41098	-0.050000	0.13356	-0.463000	0.05309	CGC	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.667	FLT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLT4	protein_coding	OTTHUMT00000253527.4	C		rs184409663		180047941	-1	no_errors	ENST00000261937	ensembl	human	known	74_37	missense	SNP	0.619	T
DMXL2	23312	genome.wustl.edu	37	15	51828727	51828727	+	Silent	SNP	T	T	C			TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chr15:51828727T>C	ENST00000251076.5	-	12	2237	c.1950A>G	c.(1948-1950)cgA>cgG	p.R650R	DMXL2_ENST00000449909.3_Silent_p.R650R|DMXL2_ENST00000543779.2_Silent_p.R650R	NM_001174116.1|NM_015263.3	NP_001167587.1|NP_056078.2	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2	650						cell junction (GO:0030054)|extracellular space (GO:0005615)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	Rab GTPase binding (GO:0017137)			breast(4)|central_nervous_system(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(26)|liver(1)|lung(28)|ovary(7)|prostate(7)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	101				all cancers(107;0.00494)		TGAGGTGAAATCGATGACCGC	0.393																																																	0								ENSG00000104093						86.0	84.0	84.0					15																	51828727		2195	4293	6488	DMXL2	SO:0001819	synonymous_variant	0			-	HGNC	AB020663	CCDS10141.1, CCDS53945.1, CCDS53946.1	15q21.2	2013-01-10			ENSG00000104093	ENSG00000104093		"""WD repeat domain containing"""	2938	protein-coding gene	gene with protein product	"""rabconnectin 3"""	612186					Standard	NM_001174116		Approved	RC3, KIAA0856	uc010ufy.2	Q8TDJ6	OTTHUMG00000131749	ENST00000251076.5:c.1950A>G	15.37:g.51828727T>C		Somatic	0	17	0.00		0.5891488714521174	1	50.00	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	18	50.00	B2RTR3|B7ZMH3|F5GWF1|O94938	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Rav1p_C,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R650	ENST00000251076.5	37	c.1950	CCDS10141.1	15																																																																																			-	NULL		0.393	DMXL2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	DMXL2	protein_coding	OTTHUMT00000254671.2	T	NM_015263	-		51828727	-1	no_errors	ENST00000543779	ensembl	human	known	74_37	silent	SNP	0.822	C
FAM47B	170062	genome.wustl.edu	37	X	34961413	34961413	+	Silent	SNP	C	C	T			TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chrX:34961413C>T	ENST00000329357.5	+	1	501	c.465C>T	c.(463-465)ccC>ccT	p.P155P		NM_152631.2	NP_689844.2	Q8NA70	FA47B_HUMAN	family with sequence similarity 47, member B	155										breast(3)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|lung(28)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)	71						AGCTGGATCCCGAGAGGAAGC	0.562																																																	0								ENSG00000189132						56.0	50.0	52.0					X																	34961413		2202	4300	6502	FAM47B	SO:0001819	synonymous_variant	0			-	HGNC	BC035026	CCDS14236.1	Xp21.1	2004-08-09			ENSG00000189132	ENSG00000189132			26659	protein-coding gene	gene with protein product						14702039	Standard	NM_152631		Approved	FLJ35782	uc004ddi.2	Q8NA70	OTTHUMG00000021345	ENST00000329357.5:c.465C>T	X.37:g.34961413C>T		Somatic	0	132	0.00		0.5891488714521174	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	262	78	77.06	Q5JQN5|Q6PIG3	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.P155	ENST00000329357.5	37	c.465	CCDS14236.1	X																																																																																			-	NULL		0.562	FAM47B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM47B	protein_coding	OTTHUMT00000056211.1	C	NM_152631	-		34961413	+1	no_errors	ENST00000329357	ensembl	human	known	74_37	silent	SNP	0.113	T
CTBS	1486	genome.wustl.edu	37	1	85039999	85040007	+	In_Frame_Del	DEL	GCAGCGCCA	GCAGCGCCA	-	rs142534762|rs3217269|rs199701060|rs201060055	byFrequency	TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	GCAGCGCCA	GCAGCGCCA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chr1:85039999_85040007delGCAGCGCCA	ENST00000370630.5	-	1	140_148	c.92_100delTGGCGCTGC	c.(91-102)ctggcgctgcgg>cgg	p.LAL31del	CTBS_ENST00000477677.1_5'UTR	NM_004388.2	NP_004379.1	Q01459	DIAC_HUMAN	chitobiase, di-N-acetyl-	31					chitin catabolic process (GO:0006032)|oligosaccharide catabolic process (GO:0009313)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	chitinase activity (GO:0004568)			breast(1)|endometrium(1)|large_intestine(4)|lung(2)|ovary(1)	9				all cancers(265;0.00727)|Epithelial(280;0.0192)|OV - Ovarian serous cystadenocarcinoma(397;0.166)		GCCGCGAGCCgcagcgccagcagcgccag	0.718														1537	0.306909	0.5038	0.2954	5008	,	,		11352	0.0556		0.2624	False		,,,				2504	0.3538																0								ENSG00000117151			865,21,1798		349,2,165,3,13,810						-3.6	0.0		dbSNP_134	4	1279,4,4361		415,1,448,1,1,1956	no	codingComplex	CTBS	NM_004388.2		764,3,613,4,14,2766	A1A1,A1A2,A1R,A2A2,A2R,RR		22.7321,33.0104,26.0447				2144,25,6159				CTBS	SO:0001651	inframe_deletion	0				HGNC	M95767	CCDS698.1	1p22	2010-05-04			ENSG00000117151	ENSG00000117151	3.2.1.-		2496	protein-coding gene	gene with protein product		600873		CTB		1549114, 7606925	Standard	NM_004388		Approved		uc001dka.2	Q01459	OTTHUMG00000009922	ENST00000370630.5:c.92_100delTGGCGCTGC	1.37:g.85040008_85040016delGCAGCGCCA	ENSP00000359664:p.Leu31_Leu33del	Somatic	NA	NA	NA		0.5891488714521174	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q5VX50	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Glyco_hydro18cat,superfamily_Glycoside_hydrolase_SF,smart_Chitinase_II	p.LAL31in_frame_del	ENST00000370630.5	37	c.100_92	CCDS698.1	1																																																																																			-	NULL		0.718	CTBS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTBS	protein_coding	OTTHUMT00000027457.2	GCAGCGCCA	NM_004388			85040007	-1	no_errors	ENST00000370630	ensembl	human	known	74_37	in_frame_del	DEL	0.000:0.011:0.000:0.000:0.002:0.000:0.000:0.649:0.644	-
CCDC110	256309	genome.wustl.edu	37	4	186379436	186379436	+	Nonsense_Mutation	SNP	G	G	A	rs199552759		TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chr4:186379436G>A	ENST00000307588.3	-	6	2380	c.2305C>T	c.(2305-2307)Cga>Tga	p.R769*	CCDC110_ENST00000507501.1_5'Flank|CCDC110_ENST00000393540.3_Nonsense_Mutation_p.R732*|CCDC110_ENST00000510617.1_Nonsense_Mutation_p.R769*	NM_152775.3	NP_689988.1	Q8TBZ0	CC110_HUMAN	coiled-coil domain containing 110	769						nucleus (GO:0005634)				NS(1)|breast(1)|central_nervous_system(2)|endometrium(6)|kidney(3)|large_intestine(8)|lung(9)	30		all_lung(41;1.3e-11)|Lung NSC(41;2.25e-11)|Melanoma(20;7.86e-05)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|Colorectal(36;0.0381)|all_hematologic(60;0.0749)		OV - Ovarian serous cystadenocarcinoma(60;1.13e-10)|BRCA - Breast invasive adenocarcinoma(30;8.01e-05)|GBM - Glioblastoma multiforme(59;0.00014)|STAD - Stomach adenocarcinoma(60;0.000777)|LUSC - Lung squamous cell carcinoma(40;0.00921)|COAD - Colon adenocarcinoma(29;0.0105)|READ - Rectum adenocarcinoma(43;0.164)		AAATATTCTCGTTGAAGATGC	0.308													G|||	1	0.000199681	0.0	0.0	5008	,	,		17760	0.0		0.001	False		,,,				2504	0.0																0								ENSG00000168491						66.0	65.0	65.0					4																	186379436		2202	4300	6502	CCDC110	SO:0001587	stop_gained	0			GMAF=0.0005	HGNC	AB080722	CCDS3843.1, CCDS47170.1	4q35.1	2010-12-24			ENSG00000168491	ENSG00000168491			28504	protein-coding gene	gene with protein product	"""cancer/testis antigen 52"""	609488				18160854	Standard	NM_152775		Approved	KM-HN-1, MGC33607, CT52	uc003ixu.4	Q8TBZ0	OTTHUMG00000160415	ENST00000307588.3:c.2305C>T	4.37:g.186379436G>A	ENSP00000306776:p.Arg769*	Somatic	0	28	0.00		0.5891488714521174	0	100.00	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	45	21.05	Q86YI9|Q8N7W0	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_4_helix_cytokine-like_core	p.R769*	ENST00000307588.3	37	c.2305	CCDS3843.1	4	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	38	7.250614	0.98164	.	.	ENSG00000168491	ENST00000393540;ENST00000307588;ENST00000510617	.	.	.	5.54	3.54	0.40534	.	0.136921	0.32655	N	0.005804	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-6.1587	11.4987	0.50424	0.0:0.0:0.3859:0.6141	.	.	.	.	X	732;769;769	.	ENSP00000306776:R769X	R	-	1	2	CCDC110	186616430	0.999000	0.42202	1.000000	0.80357	0.994000	0.84299	0.984000	0.29565	1.326000	0.45319	0.650000	0.86243	CGA	-	superfamily_4_helix_cytokine-like_core		0.308	CCDC110-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CCDC110	protein_coding	OTTHUMT00000360519.2	G	NM_152775	rs199552759		186379436	-1	no_errors	ENST00000307588	ensembl	human	known	74_37	nonsense	SNP	0.993	A
FAM92B	339145	genome.wustl.edu	37	16	85141486	85141486	+	Missense_Mutation	SNP	A	A	T			TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chr16:85141486A>T	ENST00000539556.1	-	4	547	c.392T>A	c.(391-393)cTg>cAg	p.L131Q		NM_198491.1	NP_940893.1	Q6ZTR7	FA92B_HUMAN	family with sequence similarity 92, member B	131										breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)	16						CTTCTGCCTCAGTTTCTCCAG	0.502																																																	0								ENSG00000153789						207.0	201.0	203.0					16																	85141486		2198	4300	6498	FAM92B	SO:0001583	missense	0			-	HGNC		CCDS32500.1	16q24.1	2005-09-22				ENSG00000153789			24781	protein-coding gene	gene with protein product						12477932	Standard	NM_198491		Approved	FLJ44299	uc021tlz.1	Q6ZTR7		ENST00000539556.1:c.392T>A	16.37:g.85141486A>T	ENSP00000443411:p.Leu131Gln	Somatic	0	62	0.00		0.5891488714521174	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	28	20.00		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_FAM92	p.L131Q	ENST00000539556.1	37	c.392	CCDS32500.1	16	.	.	.	.	.	.	.	.	.	.	A	21.2	4.110945	0.77210	.	.	ENSG00000153789	ENST00000393246;ENST00000539556	T	0.64803	-0.12	5.71	5.71	0.89125	.	0.000000	0.51477	D	0.000081	T	0.78375	0.4273	M	0.78916	2.43	0.37924	D	0.931773	D	0.69078	0.997	D	0.71656	0.974	T	0.82872	-0.0242	10	0.59425	D	0.04	-27.8268	13.9293	0.63983	1.0:0.0:0.0:0.0	.	131	Q6ZTR7	FA92B_HUMAN	Q	131	ENSP00000443411:L131Q	ENSP00000376937:L131Q	L	-	2	0	FAM92B	83698987	0.991000	0.36638	1.000000	0.80357	0.956000	0.61745	4.599000	0.61076	2.181000	0.69327	0.408000	0.27601	CTG	-	pfam_FAM92		0.502	FAM92B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM92B	protein_coding		A	NM_198491	-		85141486	-1	no_errors	ENST00000539556	ensembl	human	known	74_37	missense	SNP	1.000	T
ANKRD20A4	728747	genome.wustl.edu	37	9	69423558	69423558	+	Silent	SNP	C	C	T	rs199996482		TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chr9:69423558C>T	ENST00000357336.3	+	15	2135	c.1854C>T	c.(1852-1854)agC>agT	p.S618S		NM_001098805.1	NP_001092275.1	Q4UJ75	A20A4_HUMAN	ankyrin repeat domain 20 family, member A4	618										breast(1)|large_intestine(1)|liver(1)|lung(9)|pancreas(2)|skin(2)	16						CTGCTATAAGCAAACACAGTG	0.378																																																	0								ENSG00000172014						5.0	8.0	7.0					9																	69423558		1307	3030	4337	ANKRD20A4	SO:0001819	synonymous_variant	0			-	HGNC		CCDS43828.1	9q21.11	2013-01-10			ENSG00000172014	ENSG00000172014		"""Ankyrin repeat domain containing"""	31982	protein-coding gene	gene with protein product							Standard	NM_001098805		Approved	OTTHUMG00000066855	uc004afn.3	Q4UJ75	OTTHUMG00000066855	ENST00000357336.3:c.1854C>T	9.37:g.69423558C>T		Somatic	0	19	0.00		0.5891488714521174	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	81	19.80		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.S618	ENST00000357336.3	37	c.1854	CCDS43828.1	9																																																																																			-	NULL		0.378	ANKRD20A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD20A4	protein_coding	OTTHUMT00000143287.3	C	NM_001098805	rs199996482		69423558	+1	no_errors	ENST00000357336	ensembl	human	known	74_37	silent	SNP	0.000	T
HEMK1	51409	genome.wustl.edu	37	3	50609193	50609193	+	Missense_Mutation	SNP	T	T	C			TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chr3:50609193T>C	ENST00000232854.4	+	3	833	c.281T>C	c.(280-282)cTa>cCa	p.L94P	HEMK1_ENST00000455834.1_Missense_Mutation_p.L94P|HEMK1_ENST00000434410.1_Missense_Mutation_p.L94P|C3orf18_ENST00000449241.1_5'Flank	NM_016173.3	NP_057257.1	Q9Y5R4	HEMK1_HUMAN	HemK methyltransferase family member 1	94					DNA methylation (GO:0006306)	mitochondrion (GO:0005739)	DNA binding (GO:0003677)|N-methyltransferase activity (GO:0008170)|protein methyltransferase activity (GO:0008276)			lung(3)	3				BRCA - Breast invasive adenocarcinoma(193;0.000283)|KIRC - Kidney renal clear cell carcinoma(197;0.0179)|Kidney(197;0.0212)		TCTCAGCAACTACAGTGTATC	0.587											OREG0015589	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000114735						121.0	125.0	124.0					3																	50609193		2203	4300	6503	HEMK1	SO:0001583	missense	0			-	HGNC	AF172244	CCDS2830.1	3p21	2008-02-05			ENSG00000114735	ENSG00000114735			24923	protein-coding gene	gene with protein product						10690633	Standard	XM_005265218		Approved	MTQ1	uc003dav.3	Q9Y5R4	OTTHUMG00000156849	ENST00000232854.4:c.281T>C	3.37:g.50609193T>C	ENSP00000232854:p.Leu94Pro	Somatic	0	101	0.00	971	0.5891488714521174	79	23.30	24	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	44	16.98		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Small_mtfrase_dom,pfam_RNA_methylase_dom,pfam_Ribosomal-L11_MeTrfase_PrmA,pfam_RNA_MeTrfase_RsmD,pfam_Methyltransf_11,prints_D21N6_MeTrfase,tigrfam_Release_fac_Glu-N5_MeTfrase,tigrfam_Modification_methylase_HemK	p.L94P	ENST00000232854.4	37	c.281	CCDS2830.1	3	.	.	.	.	.	.	.	.	.	.	t	9.868	1.198123	0.22037	.	.	ENSG00000114735	ENST00000434410;ENST00000232854;ENST00000455834	T;T;T	0.14893	2.47;2.47;2.47	5.53	4.3	0.51218	.	0.422579	0.21670	N	0.070897	T	0.13457	0.0326	L	0.41079	1.255	0.24368	N	0.994847	B	0.34181	0.44	B	0.32677	0.15	T	0.13202	-1.0518	10	0.35671	T	0.21	-5.6093	9.1693	0.37072	0.1622:0.0:0.0:0.8378	.	94	Q9Y5R4	HEMK1_HUMAN	P	94	ENSP00000404843:L94P;ENSP00000232854:L94P;ENSP00000404334:L94P	ENSP00000232854:L94P	L	+	2	0	HEMK1	50584197	0.005000	0.15991	0.184000	0.23157	0.298000	0.27526	1.439000	0.35013	2.240000	0.73641	0.529000	0.55759	CTA	-	tigrfam_Release_fac_Glu-N5_MeTfrase,tigrfam_Modification_methylase_HemK		0.587	HEMK1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	HEMK1	protein_coding	OTTHUMT00000346231.1	T	NM_016173	-		50609193	+1	no_errors	ENST00000232854	ensembl	human	known	74_37	missense	SNP	0.117	C
HTN3	3347	genome.wustl.edu	37	4	70897717	70897717	+	Splice_Site	SNP	G	G	T			TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chr4:70897717G>T	ENST00000530128.1	+	3	147		c.e3+1		HTN3_ENST00000526767.1_Splice_Site|HTN3_ENST00000381057.3_Splice_Site			P15516	HIS3_HUMAN	histatin 3						biomineral tissue development (GO:0031214)|defense response to bacterium (GO:0042742)|defense response to fungus (GO:0050832)|killing of cells of other organism (GO:0031640)	extracellular region (GO:0005576)	metal ion binding (GO:0046872)			breast(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)	8						ACATGCAAAGGTAAGACATTT	0.249																																																	0								ENSG00000205649						47.0	49.0	48.0					4																	70897717		2168	4256	6424	HTN3	SO:0001630	splice_region_variant	0			-	HGNC		CCDS33999.1	4q13	2008-08-29							5284	protein-coding gene	gene with protein product		142702					Standard	NM_000200		Approved	HIS2	uc003hew.2	P15516		ENST00000530128.1:c.72+1G>T	4.37:g.70897717G>T		Somatic	0	83	0.00		0.5891488714521174	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	72	10.00	Q16243|Q502Z1	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e2+1	ENST00000530128.1	37	c.72+1	CCDS33999.1	4	.	.	.	.	.	.	.	.	.	.	G	8.444	0.851601	0.17034	.	.	ENSG00000205649	ENST00000526767;ENST00000530128;ENST00000381057	.	.	.	2.77	1.92	0.25849	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	5.8055	0.18438	0.1532:0.0:0.8468:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	HTN3	70932306	0.988000	0.35896	0.948000	0.38648	0.060000	0.15804	1.175000	0.31944	0.742000	0.32697	0.505000	0.49811	.	-	-		0.249	HTN3-006	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	HTN3	protein_coding	OTTHUMT00000387375.1	G	NM_000200	-	Intron	70897717	+1	no_errors	ENST00000526767	ensembl	human	known	74_37	splice_site	SNP	0.964	T
TIA1	7072	genome.wustl.edu	37	2	70443577	70443577	+	Missense_Mutation	SNP	T	T	A			TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chr2:70443577T>A	ENST00000433529.2	-	9	848	c.638A>T	c.(637-639)aAc>aTc	p.N213I	TIA1_ENST00000445587.1_Missense_Mutation_p.N202I|TIA1_ENST00000282574.4_Missense_Mutation_p.N213I|C2orf42_ENST00000470096.1_Intron|TIA1_ENST00000415783.2_Missense_Mutation_p.N202I|TIA1_ENST00000482876.1_5'UTR	NM_022173.2	NP_071505.2	P31483	TIA1_HUMAN	TIA1 cytotoxic granule-associated RNA binding protein	213					apoptotic process (GO:0006915)|negative regulation of cytokine biosynthetic process (GO:0042036)|negative regulation of translation (GO:0017148)|regulation of mRNA splicing, via spliceosome (GO:0048024)	cytoplasmic stress granule (GO:0010494)|nuclear stress granule (GO:0097165)	AU-rich element binding (GO:0017091)|nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(2)|large_intestine(2)|lung(8)|skin(1)|urinary_tract(1)	17						TACAGTACAGTTGCTTGGACT	0.363																																																	0								ENSG00000116001						120.0	110.0	113.0					2																	70443577		2203	4300	6503	TIA1	SO:0001583	missense	0			-	HGNC		CCDS1900.1, CCDS1901.1	2p13	2013-02-12	2001-11-28		ENSG00000116001	ENSG00000116001		"""RNA binding motif (RRM) containing"""	11802	protein-coding gene	gene with protein product	"""T-cell-restricted intracellular antigen-1"", ""nucleolysin TIA-1 isoform p40"""	603518	"""TIA1 cytotoxic granule-associated RNA-binding protein"""			8176212, 12486009	Standard	NM_022173		Approved		uc002sgj.4	P31483	OTTHUMG00000129644	ENST00000433529.2:c.638A>T	2.37:g.70443577T>A	ENSP00000401371:p.Asn213Ile	Somatic	0	42	0.00		0.5891488714521174	182	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	Q53SS9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RRM_dom,smart_RRM_dom_euk,smart_RRM_dom,pfscan_RRM_dom	p.N213I	ENST00000433529.2	37	c.638	CCDS1901.1	2	.	.	.	.	.	.	.	.	.	.	T	21.8	4.203751	0.79127	.	.	ENSG00000116001	ENST00000433529;ENST00000415783;ENST00000477807;ENST00000282574;ENST00000445587	T;T;T;T	0.74632	-0.86;-0.86;1.55;3.37	5.24	5.24	0.73138	Nucleotide-binding, alpha-beta plait (1);	0.116753	0.85682	D	0.000000	D	0.87763	0.6259	M	0.91872	3.25	0.80722	D	1	D;D	0.69078	0.99;0.997	P;D	0.64410	0.847;0.925	D	0.90494	0.4469	10	0.87932	D	0	-6.8603	14.0926	0.65000	0.0:0.0:0.0:1.0	.	202;213	P31483-2;P31483	.;TIA1_HUMAN	I	213;202;291;213;202	ENSP00000401371:N213I;ENSP00000404023:N202I;ENSP00000282574:N213I;ENSP00000399567:N202I	ENSP00000282574:N213I	N	-	2	0	TIA1	70297081	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.836000	0.86788	2.199000	0.70637	0.533000	0.62120	AAC	-	NULL		0.363	TIA1-001	KNOWN	basic|CCDS	protein_coding	TIA1	protein_coding	OTTHUMT00000251842.2	T	NM_022037	-		70443577	-1	no_errors	ENST00000433529	ensembl	human	known	74_37	missense	SNP	1.000	A
COG4	25839	genome.wustl.edu	37	16	70530315	70530315	+	Silent	SNP	G	G	A			TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chr16:70530315G>A	ENST00000323786.5	-	12	1522	c.1501C>T	c.(1501-1503)Ctg>Ttg	p.L501L		NM_001195139.1|NM_015386.2	NP_001182068.1|NP_056201.2	Q9H9E3	COG4_HUMAN	component of oligomeric golgi complex 4	497					Golgi organization (GO:0007030)|Golgi vesicle prefusion complex stabilization (GO:0048213)|protein transport (GO:0015031)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	Golgi transport complex (GO:0017119)|membrane (GO:0016020)				breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(12)|pancreas(1)|prostate(2)	33		Ovarian(137;0.0694)				CCCATCCGCAGCTTATTACAC	0.552																																																	0								ENSG00000103051						87.0	72.0	77.0					16																	70530315		2198	4300	6498	COG4	SO:0001819	synonymous_variant	0			-	HGNC	AL050101	CCDS10892.2, CCDS73909.1	16q22.1	2013-09-20			ENSG00000103051	ENSG00000103051		"""Components of oligomeric golgi complex"""	18620	protein-coding gene	gene with protein product		606976				11980916	Standard	NM_015386		Approved	COD1, DKFZP586E1519	uc002ezc.3	Q9H9E3	OTTHUMG00000128515	ENST00000323786.5:c.1501C>T	16.37:g.70530315G>A		Somatic	0	55	0.00		0.5891488714521174	96	14.91	17	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	45	10.00	B4DMN8|C9JS23|Q96D40|Q9BRF0|Q9BVZ2|Q9H5Y4|Q9Y3W3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_COG_su4,smart_COG_su4	p.L501	ENST00000323786.5	37	c.1501	CCDS10892.2	16																																																																																			-	pfam_COG_su4,smart_COG_su4		0.552	COG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COG4	protein_coding	OTTHUMT00000250326.3	G		-		70530315	-1	no_errors	ENST00000323786	ensembl	human	known	74_37	silent	SNP	1.000	A
ALMS1	7840	genome.wustl.edu	37	2	73613032	73613037	+	In_Frame_Del	DEL	GGAGGA	GGAGGA	-	rs61156725|rs70965731|rs72319667|rs3074417	byFrequency	TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	GGAGGA	GGAGGA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chr2:73613032_73613037delGGAGGA	ENST00000264448.6	+	1	147_152	c.36_41delGGAGGA	c.(34-42)ctggaggag>ctg	p.EE27del	ALMS1_ENST00000377715.1_In_Frame_Del_p.EE27del|ALMS1_ENST00000409009.1_In_Frame_Del_p.EE27del	NM_015120.4	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	27	Glu-rich.				endosomal transport (GO:0016197)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of stress fiber assembly (GO:0051492)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)		p.E27_E28delEE(1)|p.E28_A29insE(1)		breast(4)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(31)|lung(68)|ovary(4)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	147						CGGGCGAGCTggaggaggaggaggag	0.694														3836	0.765974	0.9183	0.7176	5008	,	,		6363	0.7024		0.6819	False		,,,				2504	0.7464																2	Insertion - In frame(1)|Deletion - In frame(1)	ovary(1)|breast(1)						ENSG00000116127																																			ALMS1	SO:0001651	inframe_deletion	0				HGNC	AB002326	CCDS42697.1	2p13.1	2014-09-17			ENSG00000116127	ENSG00000116127			428	protein-coding gene	gene with protein product		606844				9063741	Standard	NM_015120		Approved	KIAA0328	uc002sje.1	Q8TCU4	OTTHUMG00000152812	ENST00000264448.6:c.36_41delGGAGGA	2.37:g.73613038_73613043delGGAGGA	ENSP00000264448:p.Glu27_Glu28del	Somatic	NA	NA	NA		0.5891488714521174	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q53S05|Q580Q8|Q86VP9|Q9Y4G4	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	NULL	p.EE16in_frame_del	ENST00000264448.6	37	c.36_41	CCDS42697.1	2																																																																																			-	NULL		0.694	ALMS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ALMS1	protein_coding	OTTHUMT00000327776.1	GGAGGA	NM_015120			73613037	+1	no_errors	ENST00000264448	ensembl	human	known	74_37	in_frame_del	DEL	0.989:0.996:1.000:1.000:1.000:1.000	-
TTN	7273	genome.wustl.edu	37	2	179439275	179439275	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chr2:179439275G>A	ENST00000591111.1	-	276	66885	c.66661C>T	c.(66661-66663)Cat>Tat	p.H22221Y	TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.H23862Y|TTN-AS1_ENST00000419746.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.H21294Y|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.H14989Y|RP11-171I2.5_ENST00000604215.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.H14922Y|TTN_ENST00000460472.2_Missense_Mutation_p.H14797Y|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000592600.1_RNA			Q8WZ42	TITIN_HUMAN	titin	22221	Fibronectin type-III 61. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTTTCAACATGATATCCTAAA	0.428																																																	0								ENSG00000155657						135.0	131.0	132.0					2																	179439275		1889	4119	6008	TTN	SO:0001583	missense	0			-	HGNC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.66661C>T	2.37:g.179439275G>A	ENSP00000465570:p.His22221Tyr	Somatic	0	15	0.00		0.5891488714521174	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	47	17.54	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.H21294Y	ENST00000591111.1	37	c.63880		2	.	.	.	.	.	.	.	.	.	.	G	13.12	2.142354	0.37825	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.56776	0.44;0.44;0.44;0.44	5.7	5.7	0.88788	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.64962	0.2646	L	0.28649	0.875	0.80722	D	1	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.83275	0.996;0.996;0.996;0.996	T	0.67373	-0.5687	9	0.87932	D	0	.	19.8266	0.96619	0.0:0.0:1.0:0.0	.	14797;14922;14989;22221	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	Y	21294;14797;14989;14922;14795	ENSP00000343764:H21294Y;ENSP00000434586:H14797Y;ENSP00000340554:H14989Y;ENSP00000352154:H14922Y	ENSP00000340554:H14989Y	H	-	1	0	TTN	179147521	1.000000	0.71417	0.995000	0.50966	0.825000	0.46686	6.782000	0.75073	2.699000	0.92147	0.650000	0.86243	CAT	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.428	TTN-019	PUTATIVE	basic	protein_coding	TTN	protein_coding	OTTHUMT00000460310.1	G	NM_133378	-		179439275	-1	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	SNP	1.000	A
GTF2IRD2P1	401375	genome.wustl.edu	37	7	72664015	72664016	+	RNA	INS	-	-	G	rs202030378|rs372212945	byFrequency	TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chr7:72664015_72664016insG	ENST00000425256.1	-	0	884_885									GTF2I repeat domain containing 2 pseudogene 1																		ATACCACCCCCGGGGCATGCCA	0.505													GGGGG|GGGG|GGGGG|deletion	3786	0.75599	0.7247	0.8242	5008	,	,		6539	0.7212		0.8101	False		,,,				2504	0.7301																0								ENSG00000214544																																			GTF2IRD2P1			0				HGNC	AY312852		7q11.23	2010-03-19	2010-02-09	2010-02-09	ENSG00000214544	ENSG00000214544			33127	pseudogene	pseudogene			"""GTF2I repeat domain containing 2 pseudogene"""	GTF2IRD2P		15100712	Standard	NG_033736		Approved		uc003txs.1		OTTHUMG00000156803		7.37:g.72664019_72664019dupG		Somatic	0	18	0.00		0.5891488714521174	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	22	15.38		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000425256.1	37	NULL		7																																																																																			-	-		0.505	GTF2IRD2P1-002	KNOWN	basic	processed_transcript	GTF2IRD2P1	pseudogene	OTTHUMT00000345921.1	-	NR_002164			72664016	-1	no_errors	ENST00000425256	ensembl	human	known	74_37	rna	INS	0.912:0.964	G
NRXN1	9378	genome.wustl.edu	37	2	50147836	50147853	+	3'UTR	DEL	GTGTGTGTGTGTGTGTGT	GTGTGTGTGTGTGTGTGT	-	rs200264093|rs201814381|rs199597709|rs199689866|rs368179294|rs201801805|rs200666696|rs200969250|rs66612444		TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	GTGTGTGTGTGTGTGTGT	GTGTGTGTGTGTGTGTGT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chr2:50147836_50147853delGTGTGTGTGTGTGTGTGT	ENST00000406316.2	-	0	7139_7156				NRXN1_ENST00000404971.1_3'UTR|NRXN1_ENST00000401710.1_3'UTR|NRXN1_ENST00000342183.5_3'UTR	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1						adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			CTGTGGATTCgtgtgtgtgtgtgtgtgtgtgtgtgtgt	0.385																																																	0								ENSG00000179915																																			NRXN1	SO:0001624	3_prime_UTR_variant	0				HGNC	AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.*1246ACACACACACACACACAC>-	2.37:g.50147836_50147853delGTGTGTGTGTGTGTGTGT		Somatic	NA	NA	NA		0.5891488714521174	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000406316.2	37	NULL	CCDS54360.1	2																																																																																			-	-		0.385	NRXN1-001	KNOWN	basic|CCDS	protein_coding	NRXN1	protein_coding	OTTHUMT00000325291.2	GTGTGTGTGTGTGTGTGT				50147853	-1	no_errors	ENST00000484192	ensembl	human	known	74_37	rna	DEL	0.000:0.001:0.005:0.106:0.113:0.127:0.107:0.109:0.093:0.096:0.025:0.055:0.070:0.324:0.354:0.283:0.295:0.258	-
SCOC	60592	genome.wustl.edu	37	4	141302168	141302188	+	In_Frame_Del	DEL	AGAAAACCAAGTTCTTGGACA	AGAAAACCAAGTTCTTGGACA	-			TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	AGAAAACCAAGTTCTTGGACA	AGAAAACCAAGTTCTTGGACA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chr4:141302168_141302188delAGAAAACCAAGTTCTTGGACA	ENST00000608372.1	+	4	417_437	c.390_410delAGAAAACCAAGTTCTTGGACA	c.(388-411)tcagaaaaccaagttcttggacaa>tca	p.ENQVLGQ131del	SCOC_ENST00000394201.4_In_Frame_Del_p.ENQVLGQ54del|SCOC_ENST00000338517.4_In_Frame_Del_p.ENQVLGQ94del|SCOC_ENST00000506322.1_In_Frame_Del_p.ENQVLGQ54del|SCOC_ENST00000394205.3_In_Frame_Del_p.ENQVLGQ94del|SCOC_ENST00000510586.1_In_Frame_Del_p.ENQVLGQ54del|SCOC_ENST00000394203.3_In_Frame_Del_p.ENQVLGQ94del|SCOC_ENST00000512749.1_In_Frame_Del_p.ENQVLGQ54del|SCOC_ENST00000506597.1_In_Frame_Del_p.ENQVLGQ103del|SCOC_ENST00000502535.1_In_Frame_Del_p.ENQVLGQ54del			Q9UIL1	SCOC_HUMAN	short coiled-coil protein	131					positive regulation of macroautophagy (GO:0016239)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)				kidney(1)|large_intestine(1)|lung(2)|skin(1)	5	all_hematologic(180;0.162)					AGCTAAAATCAGAAAACCAAGTTCTTGGACAATATATAGAA	0.312																																																	0								ENSG00000153130																																			SCOC	SO:0001651	inframe_deletion	0				HGNC	AK027797	CCDS3750.1, CCDS54806.1, CCDS54807.1	4q28.3	2014-05-22	2003-03-19		ENSG00000153130	ENSG00000153130			20335	protein-coding gene	gene with protein product			"""short coiled coil protein"""			11303027	Standard	NM_032547		Approved	HRIHFB2072, SCOCO	uc011che.1	Q9UIL1	OTTHUMG00000133416	ENST00000608372.1:c.390_410delAGAAAACCAAGTTCTTGGACA	4.37:g.141302168_141302188delAGAAAACCAAGTTCTTGGACA	ENSP00000477352:p.Glu131_Gln137del	Somatic	NA	NA	NA		0.5891488714521174	41	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B7WPH7|D3DNY7|E9PB65|Q6P5T9|Q7L2Y0|Q7Z4P2|Q96JY9|Q9BZB2	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_DUF2205_coiled-coil	p.ENQVLGQ131in_frame_del	ENST00000608372.1	37	c.390_410	CCDS54806.1	4																																																																																			-	pfam_DUF2205_coiled-coil		0.312	SCOC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SCOC	protein_coding	OTTHUMT00000257274.2	AGAAAACCAAGTTCTTGGACA				141302188	+1	no_errors	ENST00000608372	ensembl	human	known	74_37	in_frame_del	DEL	0.984:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:0.999:1.000:1.000:0.999:1.000:1.000	-
MUC17	140453	genome.wustl.edu	37	7	100680117	100680117	+	Missense_Mutation	SNP	T	T	C	rs147353603	byFrequency	TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chr7:100680117T>C	ENST00000306151.4	+	3	5484	c.5420T>C	c.(5419-5421)aTg>aCg	p.M1807T		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	1807	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					AGTGAAGGAATGACTCCATTA	0.507													-|||	4	0.000798722	0.0008	0.0	5008	,	,		27011	0.003		0.0	False		,,,				2504	0.0																0								ENSG00000169876						250.0	253.0	252.0					7																	100680117		2203	4300	6503	MUC17	SO:0001583	missense	0			-	HGNC	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.5420T>C	7.37:g.100680117T>C	ENSP00000302716:p.Met1807Thr	Somatic	0	108	0.00		0.5891488714521174	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	122	9.63	O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SEA_dom,smart_SEA_dom,pfscan_EG-like_dom,pfscan_SEA_dom	p.M1807T	ENST00000306151.4	37	c.5420	CCDS34711.1	7	.	.	.	.	.	.	.	.	.	.	N	0.005	-2.166907	0.00318	.	.	ENSG00000169876	ENST00000306151	T	0.01854	4.6	0.373	-0.746	0.11095	.	.	.	.	.	T	0.00998	0.0033	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.48670	-0.9015	8	0.09338	T	0.73	.	.	.	.	.	1807	Q685J3	MUC17_HUMAN	T	1807	ENSP00000302716:M1807T	ENSP00000302716:M1807T	M	+	2	0	MUC17	100466837	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-3.274000	0.00531	-4.523000	0.00044	-3.958000	0.00015	ATG	-	NULL		0.507	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC17	protein_coding	OTTHUMT00000347161.1	T	NM_001040105	rs147353603		100680117	+1	no_errors	ENST00000306151	ensembl	human	known	74_37	missense	SNP	0.000	C
CAPN13	92291	genome.wustl.edu	37	2	30987032	30987032	+	Missense_Mutation	SNP	G	G	T			TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chr2:30987032G>T	ENST00000295055.8	-	6	841	c.665C>A	c.(664-666)gCa>gAa	p.A222E	CAPN13_ENST00000465960.2_5'UTR|CAPN13_ENST00000534090.2_Missense_Mutation_p.A222E	NM_144575.2	NP_653176.2	Q6MZZ7	CAN13_HUMAN	calpain 13	222	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)|stomach(2)|urinary_tract(1)	30	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.155)					CAGGGAGCCTGCCTTGGTCGC	0.582																																																	0								ENSG00000162949						59.0	60.0	60.0					2																	30987032		2069	4198	6267	CAPN13	SO:0001583	missense	0			-	HGNC		CCDS46252.1	2p22-p21	2008-02-05			ENSG00000162949	ENSG00000162949			16663	protein-coding gene	gene with protein product		610228				11675017	Standard	NM_144575		Approved	FLJ23523	uc021vfm.1	Q6MZZ7	OTTHUMG00000152053	ENST00000295055.8:c.665C>A	2.37:g.30987032G>T	ENSP00000295055:p.Ala222Glu	Somatic	0	48	0.00		0.5891488714521174	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	34	8.11	Q17RF0|Q580X1|Q8TE80	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_C2_calpain_cat,pfam_Calpain_domain_III,superfamily_Calpain_domain_III,smart_Peptidase_C2_calpain_cat,pfscan_Peptidase_C2_calpain_cat,prints_Calpain_cysteine_protease	p.A222E	ENST00000295055.8	37	c.665	CCDS46252.1	2	.	.	.	.	.	.	.	.	.	.	G	12.54	1.968058	0.34754	.	.	ENSG00000162949	ENST00000295055;ENST00000534090	D;D	0.87029	-2.2;-2.2	5.44	1.2	0.21068	Peptidase C2, calpain, catalytic domain (3);	1.441260	0.04059	N	0.305996	D	0.83815	0.5336	L	0.39898	1.24	0.09310	N	1	B	0.19445	0.036	B	0.25291	0.059	T	0.68112	-0.5495	10	0.44086	T	0.13	.	10.3007	0.43650	0.0:0.1243:0.4903:0.3854	.	222	Q6MZZ7	CAN13_HUMAN	E	222	ENSP00000295055:A222E;ENSP00000431298:A222E	ENSP00000295055:A222E	A	-	2	0	CAPN13	30840536	0.002000	0.14202	0.003000	0.11579	0.020000	0.10135	1.171000	0.31896	0.208000	0.20626	-0.521000	0.04368	GCA	-	pfam_Peptidase_C2_calpain_cat,smart_Peptidase_C2_calpain_cat,pfscan_Peptidase_C2_calpain_cat		0.582	CAPN13-001	KNOWN	basic|CCDS	protein_coding	CAPN13	protein_coding	OTTHUMT00000325101.2	G	NM_144575	-		30987032	-1	no_errors	ENST00000295055	ensembl	human	known	74_37	missense	SNP	0.001	T
PHB	5245	genome.wustl.edu	37	17	47482200	47482200	+	3'UTR	SNP	G	G	A			TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chr17:47482200G>A	ENST00000300408.3	-	0	1045				PHB_ENST00000511832.1_3'UTR|PHB_ENST00000508009.1_5'Flank|RP11-81K2.1_ENST00000576461.1_Intron|RP11-1079K10.4_ENST00000506504.3_RNA	NM_001281496.1|NM_001281715.1|NM_002634.2	NP_001268425.1|NP_001268644.1|NP_002625.1	P35232	PHB_HUMAN	prohibitin						cellular response to interleukin-6 (GO:0071354)|DNA replication (GO:0006260)|histone deacetylation (GO:0016575)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glucocorticoid receptor signaling pathway (GO:2000323)|negative regulation of transcription by competitive promoter binding (GO:0010944)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoblast differentiation (GO:0001649)|positive regulation of transcription, DNA-templated (GO:0045893)|progesterone receptor signaling pathway (GO:0050847)|regulation of apoptotic process (GO:0042981)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|transcription regulatory region DNA binding (GO:0044212)			endometrium(4)|large_intestine(2)|lung(4)	10	all_cancers(4;2.62e-14)|Breast(4;4.21e-29)|all_epithelial(4;6.9e-18)		Epithelial(5;8.1e-06)|all cancers(6;7.71e-05)			AGACTAATTAGAGATCTGAAG	0.383																																																	0								ENSG00000250186																																			RP11-1079K10.4	SO:0001624	3_prime_UTR_variant	0			-	Clone_based_vega_gene		CCDS11548.1, CCDS62244.1	17q21	2010-11-25			ENSG00000167085	ENSG00000167085			8912	protein-coding gene	gene with protein product		176705				10376528, 8244394	Standard	NM_001281496		Approved	PHB1	uc002iox.1	P35232	OTTHUMG00000134271	ENST00000300408.3:c.*154C>T	17.37:g.47482200G>A		Somatic	0	40	0.00		0.5891488714521174	57	27.50	22	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	32	13.51	B4DY47|Q4VBQ0	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000300408.3	37	NULL	CCDS11548.1	17																																																																																			-	-		0.383	PHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000250186	protein_coding	OTTHUMT00000258826.1	G	NM_002634	-		47482200	+1	no_errors	ENST00000506504	ensembl	human	known	74_37	rna	SNP	0.893	A
IL1RN	3557	genome.wustl.edu	37	2	113890420	113890420	+	Missense_Mutation	SNP	C	C	A			TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chr2:113890420C>A	ENST00000409930.3	+	4	570	c.506C>A	c.(505-507)aCc>aAc	p.T169N	IL1RN_ENST00000354115.2_Missense_Mutation_p.T151N|IL1RN_ENST00000259206.5_Missense_Mutation_p.T172N|IL1RN_ENST00000361779.3_Missense_Mutation_p.T135N|IL1RN_ENST00000409052.1_Missense_Mutation_p.T135N	NM_173842.2	NP_776214.1	P18510	IL1RA_HUMAN	interleukin 1 receptor antagonist	169					acute-phase response (GO:0006953)|carboxylic acid metabolic process (GO:0019752)|chronic inflammatory response to antigenic stimulus (GO:0002439)|female pregnancy (GO:0007565)|fever generation (GO:0001660)|immune response (GO:0006955)|insulin secretion (GO:0030073)|lipid metabolic process (GO:0006629)|memory (GO:0007613)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell migration (GO:0030336)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|negative regulation of glutamate secretion (GO:0014050)|negative regulation of heterotypic cell-cell adhesion (GO:0034115)|negative regulation of interleukin-1-mediated signaling pathway (GO:2000660)|negative regulation of membrane potential (GO:0045837)|positive regulation of JUN kinase activity (GO:0043507)|response to drug (GO:0042493)|response to glucocorticoid (GO:0051384)|response to interleukin-4 (GO:0070670)|response to lipopolysaccharide (GO:0032496)|response to organonitrogen compound (GO:0010243)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	interleukin-1 receptor antagonist activity (GO:0005152)|interleukin-1 receptor binding (GO:0005149)|interleukin-1 Type I receptor antagonist activity (GO:0045352)|interleukin-1 Type II receptor antagonist activity (GO:0045353)|interleukin-1, Type I receptor binding (GO:0005150)|interleukin-1, Type II receptor binding (GO:0005151)			breast(1)|large_intestine(2)|lung(4)|ovary(1)|skin(2)	10					Rilonacept(DB06372)	GTCATGGTCACCAAATTCTAC	0.597									Lichen Sclerosis et Atrophicus, Familial Clustering of																																								0								ENSG00000136689						111.0	95.0	101.0					2																	113890420		2203	4300	6503	IL1RN	SO:0001583	missense	0	Familial Cancer Database	Lichen Sclerosis, Familial	-	HGNC	M55646	CCDS2113.1, CCDS2114.1, CCDS2115.1, CCDS46396.1	2q14.2	2014-09-17			ENSG00000136689	ENSG00000136689		"""Interleukins and interleukin receptors"", ""Endogenous ligands"""	6000	protein-coding gene	gene with protein product	"""interleukin-1 receptor antagonist protein"", ""intracellular interleukin-1 receptor antagonist"""	147679				1386337, 8432529	Standard	NM_000577		Approved	IL1RA, ICIL-1RA, IL1F3, IRAP, IL-1RN, MGC10430	uc002tjb.3	P18510	OTTHUMG00000131341	ENST00000409930.3:c.506C>A	2.37:g.113890420C>A	ENSP00000387173:p.Thr169Asn	Somatic	0	36	0.00		0.5891488714521174	20	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	28	15.15	A8K4G1|Q14628|Q53SC2|Q7RTZ4|Q96GD6|Q9UPC0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_IL-1,superfamily_Cytokine_IL1-like,smart_IL-1,prints_IL-1RA/IL-36,prints_IL-1	p.T172N	ENST00000409930.3	37	c.515	CCDS46396.1	2	.	.	.	.	.	.	.	.	.	.	C	20.4	3.986330	0.74589	.	.	ENSG00000136689	ENST00000409052;ENST00000361779;ENST00000259206;ENST00000354115;ENST00000409930	T;T;T;T;T	0.20881	2.04;2.04;2.04;2.04;2.04	5.8	5.8	0.92144	.	0.629307	0.17384	N	0.176190	T	0.57592	0.2064	M	0.92317	3.295	0.40835	D	0.983623	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.87578	0.997;0.998;0.998	T	0.66344	-0.5947	10	0.87932	D	0	-19.1731	15.561	0.76244	0.0:1.0:0.0:0.0	.	169;151;172	P18510;P18510-2;Q53SC2	IL1RA_HUMAN;.;.	N	135;135;172;151;169	ENSP00000387210:T135N;ENSP00000354816:T135N;ENSP00000259206:T172N;ENSP00000329072:T151N;ENSP00000387173:T169N	ENSP00000259206:T172N	T	+	2	0	IL1RN	113606891	0.997000	0.39634	1.000000	0.80357	0.648000	0.38561	3.891000	0.56227	2.755000	0.94549	0.655000	0.94253	ACC	-	pfam_IL-1,superfamily_Cytokine_IL1-like,smart_IL-1,prints_IL-1RA/IL-36		0.597	IL1RN-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	IL1RN	protein_coding	OTTHUMT00000330802.1	C	NM_173841	-		113890420	+1	no_errors	ENST00000259206	ensembl	human	known	74_37	missense	SNP	1.000	A
MAPK10	5602	genome.wustl.edu	37	4	87023109	87023109	+	Missense_Mutation	SNP	A	A	G			TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chr4:87023109A>G	ENST00000359221.3	-	7	1028	c.502T>C	c.(502-504)Tac>Cac	p.Y168H	MAPK10_ENST00000395161.2_Missense_Mutation_p.Y168H|MAPK10_ENST00000395160.3_Missense_Mutation_p.Y23H|MAPK10_ENST00000395166.1_Missense_Mutation_p.Y130H|MAPK10_ENST00000449047.2_Missense_Mutation_p.Y23H|MAPK10_ENST00000361569.2_Missense_Mutation_p.Y168H|MAPK10_ENST00000395157.3_Missense_Mutation_p.Y23H|MAPK10_ENST00000513839.1_5'UTR|MAPK10_ENST00000395169.3_Missense_Mutation_p.Y130H			P53779	MK10_HUMAN	mitogen-activated protein kinase 10	168	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|JUN phosphorylation (GO:0007258)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|JUN kinase activity (GO:0004705)|MAP kinase kinase activity (GO:0004708)			breast(1)|central_nervous_system(1)|stomach(1)	3		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.243)		OV - Ovarian serous cystadenocarcinoma(123;0.002)		TACAGCAGGTAAGACATTCGC	0.403																																																	0								ENSG00000109339						261.0	243.0	249.0					4																	87023109		2203	4300	6503	MAPK10	SO:0001583	missense	0			-	HGNC	U07620	CCDS3612.1, CCDS3613.1, CCDS34026.1, CCDS43247.1	4q22-q23	2011-06-09			ENSG00000109339	ENSG00000109339	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinases"""	6872	protein-coding gene	gene with protein product		602897		PRKM10		8654373, 12436199	Standard	NM_002753		Approved	JNK3, p493F12, p54bSAPK	uc003hpt.3	P53779	OTTHUMG00000130604	ENST00000359221.3:c.502T>C	4.37:g.87023109A>G	ENSP00000352157:p.Tyr168His	Somatic	0	20	0.00		0.5891488714521174	2	88.24	15	WXS	Illumina HiSeq 2500	Phase_IV	tier1	33	35	48.53	A6NFS3|A6NG28|B3KQ94|Q15707|Q49AP1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_MAPK_JNK,pfscan_Prot_kinase_dom	p.Y168H	ENST00000359221.3	37	c.502	CCDS34026.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	31|31	5.066348|5.066348	0.93898|0.93898	.|.	.|.	ENSG00000109339|ENSG00000109339	ENST00000515400|ENST00000395169;ENST00000359221;ENST00000395157;ENST00000361569;ENST00000395166;ENST00000395160;ENST00000449047;ENST00000395161	.|T;T;T;T;T;T;T;T	.|0.64438	.|-0.1;-0.1;-0.1;-0.1;-0.1;-0.1;-0.1;-0.1	5.94|5.94	5.94|5.94	0.96194|0.96194	.|Serine/threonine-protein kinase-like domain (1);MAP kinase, conserved site (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.73194|0.73194	0.3556|0.3556	L|L	0.41236|0.41236	1.265|1.265	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D	.|0.89917	.|1.0;1.0;0.999;1.0;0.999	.|D;D;D;D;D	.|0.97110	.|0.998;1.0;0.994;0.994;0.997	T|T	0.75701|0.75701	-0.3226|-0.3226	5|10	.|0.87932	.|D	.|0	-16.476|-16.476	16.4127|16.4127	0.83723|0.83723	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|54;23;130;168;168	.|B7Z1Z1;Q499Y8;P53779-3;P53779-2;P53779	.|.;.;.;.;MK10_HUMAN	S|H	80|130;168;23;168;130;23;23;168	.|ENSP00000378598:Y130H;ENSP00000352157:Y168H;ENSP00000378586:Y23H;ENSP00000355297:Y168H;ENSP00000378595:Y130H;ENSP00000378589:Y23H;ENSP00000414469:Y23H;ENSP00000378590:Y168H	.|ENSP00000352157:Y168H	L|Y	-|-	2|1	0|0	MAPK10|MAPK10	87242133|87242133	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	9.231000|9.231000	0.95317|0.95317	2.279000|2.279000	0.76181|0.76181	0.528000|0.528000	0.53228|0.53228	TTA|TAC	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.403	MAPK10-012	KNOWN	basic|CCDS	protein_coding	MAPK10	protein_coding	OTTHUMT00000361363.2	A		-		87023109	-1	no_errors	ENST00000359221	ensembl	human	known	74_37	missense	SNP	1.000	G
MTHFD1	4522	genome.wustl.edu	37	14	64884678	64884679	+	Frame_Shift_Ins	INS	-	-	G			TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chr14:64884678_64884679insG	ENST00000545908.1	+	7	948_949	c.719_720insG	c.(718-723)ttgcttfs	p.L241fs	MTHFD1_ENST00000216605.8_Frame_Shift_Ins_p.L185fs			P11586	C1TC_HUMAN	methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1, methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate synthetase	185	Methylenetetrahydrofolate dehydrogenase and cyclohydrolase.				folic acid metabolic process (GO:0046655)|folic acid-containing compound biosynthetic process (GO:0009396)|histidine biosynthetic process (GO:0000105)|methionine biosynthetic process (GO:0009086)|one-carbon metabolic process (GO:0006730)|purine nucleotide biosynthetic process (GO:0006164)|small molecule metabolic process (GO:0044281)|tetrahydrofolate interconversion (GO:0035999)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|formate-tetrahydrofolate ligase activity (GO:0004329)|methenyltetrahydrofolate cyclohydrolase activity (GO:0004477)|methylenetetrahydrofolate dehydrogenase (NADP+) activity (GO:0004488)|methylenetetrahydrofolate dehydrogenase [NAD(P)+] activity (GO:0004486)			endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|ovary(2)|pancreas(1)|prostate(2)|skin(2)	30				OV - Ovarian serous cystadenocarcinoma(108;8.7e-12)|all cancers(60;3.29e-11)|BRCA - Breast invasive adenocarcinoma(234;0.0488)	Tetrahydrofolic acid(DB00116)	ATGCATGACTTGCTTCTGTGGA	0.559																																					Colon(18;220 581 13419 18191 31512)|GBM(126;343 1658 28700 44425 52519)												0								ENSG00000100714																																			MTHFD1	SO:0001589	frameshift_variant	0				HGNC	J04031	CCDS9763.1	14q24	2004-12-13			ENSG00000100714	ENSG00000100714	1.5.1.15, 3.5.4.-		7432	protein-coding gene	gene with protein product		172460		MTHFC, MTHFD		3053686, 2786332	Standard	NM_005956		Approved		uc001xhb.3	P11586	OTTHUMG00000141309	ENST00000545908.1:c.720dupG	14.37:g.64884679_64884679dupG	ENSP00000438588:p.Leu241fs	Somatic	0	59	0.00		0.5891488714521174	61	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	34	20.93	B2R5Y2|G3V2B8|Q86VC9|Q9BVP5	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_Formate_THF_ligase,pfam_THF_DH/CycHdrlase_NAD-bd_dom,pfam_THF_DH/CycHdrlase_cat_dom,superfamily_P-loop_NTPase,prints_THF_DH/CycHdrlase	p.L185fs	ENST00000545908.1	37	c.551_552		14																																																																																			-	pfam_THF_DH/CycHdrlase_NAD-bd_dom		0.559	MTHFD1-002	NOVEL	basic|exp_conf	protein_coding	MTHFD1	protein_coding	OTTHUMT00000412167.1	-				64884679	+1	no_errors	ENST00000216605	ensembl	human	known	74_37	frame_shift_ins	INS	1.000:1.000	G
GON4L	54856	genome.wustl.edu	37	1	155785776	155785777	+	Intron	INS	-	-	A			TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chr1:155785776_155785777insA	ENST00000368331.1	-	8	1114				GON4L_ENST00000437809.1_Intron|GON4L_ENST00000271883.5_Intron|GON4L_ENST00000361040.5_Intron|GON4L_ENST00000471341.1_5'UTR	NM_001282858.1|NM_001282860.1	NP_001269787.1|NP_001269789.1	Q3T8J9	GON4L_HUMAN	gon-4-like (C. elegans)						regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(4)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	45	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					AAGCAGGGCAGAAAAAAAAAAA	0.351																																																	0								ENSG00000116580																																			GON4L	SO:0001627	intron_variant	0				HGNC	AB046826	CCDS1121.1, CCDS44242.1, CCDS60296.1	1q22	2013-10-31	2006-11-08	2006-02-16	ENSG00000116580	ENSG00000116580			25973	protein-coding gene	gene with protein product		610393	"""gon-4 homolog (C.elegans)"""	GON4		16545939, 21454521	Standard	XM_005245283		Approved	FLJ20203, GON-4	uc001fly.1	Q3T8J9	OTTHUMG00000014106	ENST00000368331.1:c.1066-85->T	1.37:g.155785787_155785787dupA		Somatic	0	29	0.00		0.5891488714521174	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	49	12.50	B7ZBL4|Q14C93|Q3T8J8|Q5VYZ5|Q5W0D5|Q6AWA6|Q6P1Q6|Q7Z3L3|Q8IY79|Q9BQI1|Q9HCG6	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000368331.1	37	NULL		1																																																																																			-	-		0.351	GON4L-201	KNOWN	basic|appris_candidate_longest	protein_coding	GON4L	protein_coding		-	NM_032292			155785777	-1	no_errors	ENST00000471341	ensembl	human	known	74_37	rna	INS	0.000:0.000	A
TLE3	7090	genome.wustl.edu	37	15	70371803	70371803	+	Intron	SNP	A	A	G			TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chr15:70371803A>G	ENST00000558939.1	-	5	1612				MIR629_ENST00000385230.1_RNA|TLE3_ENST00000559191.1_Intron|TLE3_ENST00000317509.8_Intron|TLE3_ENST00000560939.1_Intron|TLE3_ENST00000557907.1_Intron|TLE3_ENST00000442299.2_Intron|TLE3_ENST00000558201.1_Intron|TLE3_ENST00000560589.1_Intron|TLE3_ENST00000539550.1_Intron|TLE3_ENST00000559929.1_Intron|TLE3_ENST00000440567.3_Intron|TLE3_ENST00000559048.1_Intron|TLE3_ENST00000558379.1_Intron|TLE3_ENST00000451782.2_Intron|TLE3_ENST00000557997.1_Intron	NM_001282979.1|NM_001282980.1|NM_001282981.1	NP_001269908.1|NP_001269909.1|NP_001269910.1	Q04726	TLE3_HUMAN	transducin-like enhancer of split 3						Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(16)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						CCCCTGGGAAAGGGACATGAA	0.577																																																	0								ENSG00000207965						17.0	20.0	19.0					15																	70371803		1563	3580	5143	MIR629	SO:0001627	intron_variant	0			-	HGNC	M99438	CCDS45293.1, CCDS45294.1, CCDS58375.1, CCDS61689.1, CCDS61691.1, CCDS61692.1, CCDS73747.1	15q22	2014-03-07	2014-03-07			ENSG00000140332		"""WD repeat domain containing"""	11839	protein-coding gene	gene with protein product		600190	"""transducin-like enhancer of split 3, homolog of Drosophila E(sp1)"", ""transducin-like enhancer of split 3 (E(sp1) homolog, Drosophila)"""			8365415	Standard	XM_005254623		Approved	ESG, ESG3, KIAA1547, HsT18976, GRG3	uc002asm.2	Q04726		ENST00000558939.1:c.235-3306T>C	15.37:g.70371803A>G		Somatic	0	41	0.00		0.5891488714521174	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	46	9.80	B4DPT0|E9PD64|F8W964|Q6PI57|Q8IVV6|Q8WVR2|Q9HCM5	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000558939.1	37	NULL	CCDS45293.1	15																																																																																			-	-		0.577	TLE3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MIR629	protein_coding	OTTHUMT00000416913.1	A	NM_005078	-		70371803	-1	no_errors	ENST00000385230	ensembl	human	known	74_37	rna	SNP	0.000	G
HOXA7	3204	genome.wustl.edu	37	7	27192088	27192089	+	IGR	INS	-	-	GGCCT	rs117819065|rs71823962|rs145281130|rs3216926	byFrequency	TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chr7:27192088_27192089insGGCCT	ENST00000242159.3	-	0	2020				HOXA6_ENST00000521478.1_5'Flank|HOXA-AS3_ENST00000518947.2_RNA|HOXA-AS3_ENST00000521231.1_RNA|RP1-170O19.23_ENST00000498652.1_RNA|HOXA-AS3_ENST00000521197.1_RNA|HOXA7_ENST00000523796.2_5'Flank|HOXA-AS3_ENST00000524304.1_RNA|RP1-170O19.22_ENST00000467897.2_RNA|HOXA-AS3_ENST00000518848.1_RNA	NM_006896.3	NP_008827.2	P31268	HXA7_HUMAN	homeobox A7						angiogenesis (GO:0001525)|anterior/posterior pattern specification (GO:0009952)|embryonic skeletal system morphogenesis (GO:0048704)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of keratinocyte differentiation (GO:0045617)|negative regulation of leukocyte migration (GO:0002686)|negative regulation of monocyte differentiation (GO:0045656)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell differentiation (GO:0048863)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			endometrium(3)|large_intestine(1)|lung(10)|prostate(1)|urinary_tract(1)	16						GGGAGCCGCCAGGCCTGGCCTG	0.693														940	0.1877	0.0416	0.2334	5008	,	,		12775	0.1379		0.2843	False		,,,				2504	0.3047																0								ENSG00000273433																																			RP1-170O19.22	SO:0001628	intergenic_variant	0				Clone_based_vega_gene		CCDS5408.1	7p15.2	2011-06-20	2005-12-22		ENSG00000122592	ENSG00000122592		"""Homeoboxes / ANTP class : HOXL subclass"""	5108	protein-coding gene	gene with protein product		142950	"""homeo box A7"""	HOX1A, HOX1		1973146, 1358459	Standard	NM_006896		Approved		uc003sys.3	P31268	OTTHUMG00000023217		7.37:g.27192094_27192098dupGGCCT		Somatic	NA	NA	NA		0.5891488714521174	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A4D191|O43368|O43486|O95655|Q9NSC8|Q9UDM1	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000242159.3	37	NULL	CCDS5408.1	7																																																																																			-	-		0.693	HOXA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000273433	protein_coding	OTTHUMT00000358695.1	-				27192089	-1	no_errors	ENST00000467897	ensembl	human	known	74_37	rna	INS	0.007:0.074	GGCCT
PNPLA7	375775	genome.wustl.edu	37	9	140409907	140409907	+	Silent	SNP	C	C	T			TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chr9:140409907C>T	ENST00000277531.4	-	11	1260	c.1074G>A	c.(1072-1074)gcG>gcA	p.A358A	PNPLA7_ENST00000371457.1_5'UTR|PNPLA7_ENST00000406427.1_Silent_p.A383A	NM_152286.3	NP_689499.3	Q6ZV29	PLPL7_HUMAN	patatin-like phospholipase domain containing 7	358					lipid metabolic process (GO:0006629)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	lysophospholipase activity (GO:0004622)			breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	all_cancers(76;0.126)			OV - Ovarian serous cystadenocarcinoma(145;0.000268)|Epithelial(140;0.000839)		GAATGGAAGGCGCGGGGACGG	0.657																																																	0								ENSG00000130653						18.0	20.0	19.0					9																	140409907		2169	4276	6445	PNPLA7	SO:0001819	synonymous_variant	0			-	HGNC	AK126267	CCDS7045.1, CCDS48070.1	9q34.3	2009-01-12	2006-06-12	2006-06-12	ENSG00000130653	ENSG00000130653		"""Patatin-like phospholipase domain containing"""	24768	protein-coding gene	gene with protein product		612122	"""chromosome 9 open reading frame 111"""	C9orf111		16799181, 12640454, 19029121	Standard	XM_005266082		Approved	FLJ43070, FLJ31318, FLJ44279, RP11-48C7.2, NTEL1, NTE-R1	uc010ncj.1	Q6ZV29	OTTHUMG00000020990	ENST00000277531.4:c.1074G>A	9.37:g.140409907C>T		Somatic	0	109	0.00		0.5891488714521174	5	44.44	4	WXS	Illumina HiSeq 2500	Phase_IV	tier1	30	63	32.26	B5MDD3|Q5T364|Q658X0|Q658Y3|Q6ZTS1|Q86YU8|Q8TAY5|Q96N75|Q9H7N5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_cNMP-bd_dom,pfam_Patatin/PLipase_A2-rel,superfamily_Acyl_Trfase/lysoPLipase,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom	p.A383	ENST00000277531.4	37	c.1149	CCDS7045.1	9																																																																																			-	NULL		0.657	PNPLA7-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	PNPLA7	protein_coding	OTTHUMT00000254787.1	C	NM_152286	-		140409907	-1	no_errors	ENST00000406427	ensembl	human	known	74_37	silent	SNP	0.224	T
NEFH	4744	genome.wustl.edu	37	22	29884864	29884864	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chr22:29884864G>A	ENST00000310624.6	+	4	1268	c.1235G>A	c.(1234-1236)cGg>cAg	p.R412Q		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	412	Coil 2B.|Rod.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.R412L(1)		cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						GAAGAGTGTCGGATTGGCTTT	0.448																																																	1	Substitution - Missense(1)	lung(1)						ENSG00000100285						80.0	82.0	82.0					22																	29884864		2203	4300	6503	NEFH	SO:0001583	missense	0			-	HGNC		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.1235G>A	22.37:g.29884864G>A	ENSP00000311997:p.Arg412Gln	Somatic	0	116	0.00		0.5891488714521174	2	33.33	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	66	17.50	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_IF,pfam_DUF1388	p.R412Q	ENST00000310624.6	37	c.1235	CCDS13858.1	22	.	.	.	.	.	.	.	.	.	.	G	20.8	4.047913	0.75846	.	.	ENSG00000100285	ENST00000328842;ENST00000310624	D	0.90844	-2.74	6.17	5.16	0.70880	Filament (1);	0.000000	0.47093	D	0.000259	D	0.91442	0.7299	M	0.89968	3.075	0.48341	D	0.999633	P	0.45531	0.86	B	0.37198	0.243	D	0.92586	0.6079	10	0.87932	D	0	.	14.5336	0.67944	0.0692:0.0:0.9308:0.0	.	412	P12036	NFH_HUMAN	Q	412	ENSP00000311997:R412Q	ENSP00000311997:R412Q	R	+	2	0	NEFH	28214864	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.246000	0.58740	1.633000	0.50488	0.655000	0.94253	CGG	-	pfam_IF		0.448	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NEFH	protein_coding	OTTHUMT00000321553.2	G	NM_021076	-		29884864	+1	no_errors	ENST00000310624	ensembl	human	known	74_37	missense	SNP	1.000	A
COL4A3BP	10087	genome.wustl.edu	37	5	74722305	74722306	+	Splice_Site	INS	-	-	A	rs540751366	byFrequency	TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chr5:74722305_74722306insA	ENST00000405807.4	-	4	770		c.e4-2		COL4A3BP_ENST00000261415.7_Splice_Site|COL4A3BP_ENST00000380494.5_Splice_Site	NM_005713.2	NP_005704.1	Q9Y5P4	C43BP_HUMAN	collagen, type IV, alpha 3 (Goodpasture antigen) binding protein						cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|ceramide metabolic process (GO:0006672)|endoplasmic reticulum organization (GO:0007029)|ER to Golgi ceramide transport (GO:0035621)|heart morphogenesis (GO:0003007)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|lipid homeostasis (GO:0055088)|mitochondrion morphogenesis (GO:0070584)|muscle contraction (GO:0006936)|protein phosphorylation (GO:0006468)|response to endoplasmic reticulum stress (GO:0034976)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ceramide binding (GO:0097001)|ceramide transporter activity (GO:0035620)|phosphatidylinositol-4-phosphate binding (GO:0070273)|protein kinase activity (GO:0004672)			breast(1)|kidney(1)|large_intestine(5)|lung(4)|skin(3)|stomach(1)|urinary_tract(1)	16		all_lung(232;0.00101)|Lung NSC(167;0.00278)|Ovarian(174;0.0129)|Prostate(461;0.174)		OV - Ovarian serous cystadenocarcinoma(47;1e-53)		AGATTCAGTCTAAAAAAAAAAG	0.366																																																	0								ENSG00000113163																																			COL4A3BP	SO:0001630	splice_region_variant	0				HGNC	AF136450	CCDS4028.1, CCDS4029.1, CCDS47235.1	5q13.3	2013-01-10	2007-06-08	2007-06-08	ENSG00000113163	ENSG00000113163		"""StAR-related lipid transfer (START) domain containing"", ""Pleckstrin homology (PH) domain containing"""	2205	protein-coding gene	gene with protein product	"""ceramide transporter"", ""StAR-related lipid transfer (START) domain containing 11"""	604677				10212244	Standard	NM_001130105		Approved	GPBP, STARD11, CERT	uc003kdt.3	Q9Y5P4	OTTHUMG00000102068	ENST00000405807.4:c.349-2->T	5.37:g.74722315_74722315dupA		Somatic	0	21	0.00		0.5891488714521174	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	A8K7S2|B3KUB7|Q53YV1|Q53YV2|Q96Q85|Q96Q88|Q9H2S7|Q9H2S8	Splice_Site	INS	NA	NA	NA	NA	NA	NA	-	e5-2	ENST00000405807.4	37	c.733-3_733-2	CCDS4028.1	5																																																																																			-	-		0.366	COL4A3BP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	COL4A3BP	protein_coding	OTTHUMT00000219875.2	-	NM_005713		Intron	74722306	-1	no_errors	ENST00000380494	ensembl	human	known	74_37	splice_site_ins	INS	1.000:0.996	A
KMT2C	58508	genome.wustl.edu	37	7	151900117	151900117	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chr7:151900117C>T	ENST00000262189.6	-	26	4212	c.3994G>A	c.(3994-3996)Gat>Aat	p.D1332N	KMT2C_ENST00000355193.2_Missense_Mutation_p.D1332N	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	1332					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										ACAGATTCATCAACTAAAGTA	0.333																																																	0								ENSG00000055609						104.0	102.0	103.0					7																	151900117		2202	4297	6499	KMT2C	SO:0001583	missense	0			-	HGNC	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.3994G>A	7.37:g.151900117C>T	ENSP00000262189:p.Asp1332Asn	Somatic	0	15	0.00		0.5891488714521174	0	100.00	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	34	30.61	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_box_dom,smart_Znf_PHD,smart_Znf_RING,smart_HMG_box_dom,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_DHHC_palmitoyltrfase,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.D1332N	ENST00000262189.6	37	c.3994	CCDS5931.1	7	.	.	.	.	.	.	.	.	.	.	C	21.8	4.199997	0.79015	.	.	ENSG00000055609	ENST00000262189;ENST00000355193	D;D	0.84660	-1.88;-1.87	5.26	5.26	0.73747	.	0.140591	0.31660	N	0.007264	D	0.90034	0.6888	M	0.71581	2.175	0.80722	D	1	P;D	0.60575	0.952;0.988	P;P	0.58721	0.612;0.844	D	0.87761	0.2598	10	0.23891	T	0.37	.	18.4445	0.90678	0.0:1.0:0.0:0.0	.	1332;393	Q8NEZ4;Q8NEZ4-2	MLL3_HUMAN;.	N	1332	ENSP00000262189:D1332N;ENSP00000347325:D1332N	ENSP00000262189:D1332N	D	-	1	0	MLL3	151531050	1.000000	0.71417	0.991000	0.47740	0.997000	0.91878	7.023000	0.76437	2.471000	0.83476	0.585000	0.79938	GAT	-	NULL		0.333	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KMT2C	protein_coding	OTTHUMT00000318887.3	C		-		151900117	-1	no_errors	ENST00000355193	ensembl	human	known	74_37	missense	SNP	1.000	T
GAPVD1	26130	genome.wustl.edu	37	9	128025963	128025989	+	Intron	DEL	CAGCACTCCATCTGTAGGTATGTCTGT	CAGCACTCCATCTGTAGGTATGTCTGT	-	rs551743640|rs71374244|rs143312600	byFrequency	TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	CAGCACTCCATCTGTAGGTATGTCTGT	CAGCACTCCATCTGTAGGTATGTCTGT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chr9:128025963_128025989delCAGCACTCCATCTGTAGGTATGTCTGT	ENST00000495955.1	+	1	92				GAPVD1_ENST00000469528.1_3'UTR|GAPVD1_ENST00000265956.4_Intron|GAPVD1_ENST00000297933.6_Intron|GAPVD1_ENST00000394105.2_Intron|GAPVD1_ENST00000394104.2_Intron|GAPVD1_ENST00000394084.1_Intron|GAPVD1_ENST00000470056.1_Intron|GAPVD1_ENST00000394083.2_Intron			Q14C86	GAPD1_HUMAN	GTPase activating protein and VPS9 domains 1						endocytosis (GO:0006897)|positive regulation of GTPase activity (GO:0043547)|regulation of protein transport (GO:0051223)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)	cytosol (GO:0005829)|endosome (GO:0005768)|membrane (GO:0016020)	GTPase activating protein binding (GO:0032794)|GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)			central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(10)|lung(11)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	44						CTAAGTGGCACAGCACTCCATCTGTAGGTATGTCTGTCAGCACTCCA	0.564														2105	0.420327	0.4516	0.3818	5008	,	,		19587	0.4454		0.3777	False		,,,				2504	0.4233																0								ENSG00000165219																																			GAPVD1	SO:0001627	intron_variant	0				HGNC		CCDS65130.1, CCDS65131.1, CCDS65132.1	9q34.11	2008-02-05			ENSG00000165219	ENSG00000165219			23375	protein-coding gene	gene with protein product		611714					Standard	XM_005251901		Approved	DKFZP434C212, KIAA1521	uc004bpr.3	Q14C86	OTTHUMG00000020678	ENST00000495955.1:c.-199+1725CAGCACTCCATCTGTAGGTATGTCTGT>-	9.37:g.128025963_128025989delCAGCACTCCATCTGTAGGTATGTCTGT		Somatic	NA	NA	NA		0.5891488714521174	5	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A8MYK3|B0QZ62|B0QZ63|B0QZ64|Q14C76|Q2Q1W1|Q8ND92|Q8WU86|Q96CZ4|Q9NXQ1|Q9P207|Q9Y4N0	Splice_Site	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000495955.1	37	c.NULL		9																																																																																			-	-		0.564	GAPVD1-014	KNOWN	alternative_5_UTR|basic	protein_coding	GAPVD1	protein_coding	OTTHUMT00000355644.1	CAGCACTCCATCTGTAGGTATGTCTGT				128025989	+1	no_errors	ENST00000469528	ensembl	human	known	74_37	splice_site_del	DEL	1.000:1.000:1.000:1.000:1.000:0.999:0.996:0.980:0.970:0.963:0.961:0.959:0.952:0.948:0.947:0.950:0.961:0.966:0.966:0.969:0.974:0.982:0.984:0.985:0.984:0.985:0.993	-
DENND5B	160518	genome.wustl.edu	37	12	31648769	31648769	+	Missense_Mutation	SNP	G	G	C			TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chr12:31648769G>C	ENST00000389082.5	-	2	476	c.212C>G	c.(211-213)cCt>cGt	p.P71R	DENND5B_ENST00000545147.1_5'UTR|DENND5B_ENST00000306833.6_Missense_Mutation_p.P106R|DENND5B_ENST00000354285.4_Missense_Mutation_p.P93R|DENND5B_ENST00000536562.1_Missense_Mutation_p.P106R	NM_144973.3	NP_659410.3	Q6ZUT9	DEN5B_HUMAN	DENN/MADD domain containing 5B	71	UDENN.				positive regulation of Rab GTPase activity (GO:0032851)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(8)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38						TTGATCAAAAGGGTTCCATTC	0.358																																																	0								ENSG00000170456						120.0	114.0	116.0					12																	31648769		1844	4097	5941	DENND5B	SO:0001583	missense	0			-	HGNC	AF086301	CCDS44857.1	12p11.21	2012-10-03			ENSG00000170456	ENSG00000170456		"""DENN/MADD domain containing"""	28338	protein-coding gene	gene with protein product						12477932	Standard	NM_144973		Approved	MGC24039	uc001rki.1	Q6ZUT9	OTTHUMG00000169034	ENST00000389082.5:c.212C>G	12.37:g.31648769G>C	ENSP00000373734:p.Pro71Arg	Somatic	0	205	0.00		0.5891488714521174	5	16.67	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	48	163	22.64	B5ME75|Q59FW8|Q68CZ7|Q6NUJ0|Q7Z3F9|Q8N973|Q8WUC8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DENN_dom,pfam_Run,pfam_uDENN_dom,pfam_dDENN_dom,pfam_PLAT/LH2_dom,superfamily_Lipase_LipOase,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,smart_Run,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom,pfscan_PLAT/LH2_dom,pfscan_Run	p.P106R	ENST00000389082.5	37	c.317	CCDS44857.1	12	.	.	.	.	.	.	.	.	.	.	G	18.95	3.731772	0.69189	.	.	ENSG00000170456	ENST00000389082;ENST00000306833;ENST00000536562;ENST00000354285;ENST00000546299	T;T;T;T;T	0.44881	0.91;0.91;0.91;0.91;0.91	4.52	4.52	0.55395	uDENN (3);	0.000000	0.64402	D	0.000001	T	0.68100	0.2964	M	0.86028	2.79	0.80722	D	1	D;D;D	0.71674	0.995;0.998;0.997	D;D;D	0.76575	0.985;0.988;0.979	T	0.74284	-0.3715	10	0.66056	D	0.02	-18.1295	16.4982	0.84251	0.0:0.0:1.0:0.0	.	93;71;106	Q6ZUT9-4;Q6ZUT9;G3V1S3	.;DEN5B_HUMAN;.	R	71;106;106;93;23	ENSP00000373734:P71R;ENSP00000306482:P106R;ENSP00000444889:P106R;ENSP00000346238:P93R;ENSP00000442938:P23R	ENSP00000306482:P106R	P	-	2	0	DENND5B	31540036	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.051000	0.76627	2.483000	0.83821	0.650000	0.86243	CCT	-	pfam_uDENN_dom,smart_uDENN_dom,pfscan_uDENN_dom		0.358	DENND5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DENND5B	protein_coding	OTTHUMT00000402040.1	G	NM_144973	-		31648769	-1	no_errors	ENST00000306833	ensembl	human	known	74_37	missense	SNP	1.000	C
SLC25A19	60386	genome.wustl.edu	37	17	73269841	73269842	+	Intron	INS	-	-	TTATT	rs3082641|rs35986946|rs55758835	byFrequency	TCGA-QQ-A5VA-01A-12D-A32I-09	TCGA-QQ-A5VA-11A-11D-A32I-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	785de115-c037-46d5-84c5-34a20ade7a78	52b82f28-4796-456a-8523-59c171707336	g.chr17:73269841_73269842insTTATT	ENST00000402418.3	-	6	1684				SLC25A19_ENST00000320362.3_Intron|MIF4GD_ENST00000325102.8_5'Flank|MIF4GD_ENST00000578305.1_5'Flank|MIF4GD_ENST00000577542.1_5'Flank|SLC25A19_ENST00000375261.4_Intron|MIF4GD_ENST00000580571.1_5'Flank|SLC25A19_ENST00000416858.2_Intron|MIF4GD_ENST00000579297.1_5'Flank|SLC25A19_ENST00000442286.2_Intron|SLC25A19_ENST00000580994.1_Intron|RP11-649A18.12_ENST00000582668.1_RNA|RP11-649A18.12_ENST00000585075.1_RNA|MIF4GD_ENST00000245551.5_5'Flank			Q9HC21	TPC_HUMAN	solute carrier family 25 (mitochondrial thiamine pyrophosphate carrier), member 19						deoxynucleotide transport (GO:0030302)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|nucleus (GO:0005634)	deoxynucleotide transmembrane transporter activity (GO:0030233)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)|skin(1)	9	all_cancers(13;5.98e-08)|all_epithelial(9;1.16e-08)|Breast(9;3.1e-08)		all cancers(21;6.82e-07)|Epithelial(20;6.86e-06)			AAAATAGCAAAttattttattt	0.465														4192	0.837061	0.7103	0.879	5008	,	,		24978	0.9256		0.7992	False		,,,				2504	0.9264																0								ENSG00000263843																																			RP11-649A18.12	SO:0001627	intron_variant	0				Clone_based_vega_gene		CCDS11720.1	17q25.1	2013-05-22	2007-03-08		ENSG00000125454	ENSG00000125454		"""Solute carriers"""	14409	protein-coding gene	gene with protein product		606521	"""solute carrier family 25 (mitochondrial deoxynucleotide carrier), member 19"", ""microcephaly, Amish"""	MCPHA		11474176, 11226231, 19798730	Standard	NM_021734		Approved	DNC, MUP1, TPC	uc002jnw.4	Q9HC21		ENST00000402418.3:c.775-121->AATAA	17.37:g.73269847_73269851dupTTATT		Somatic	NA	NA	NA		0.5891488714521174	13	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	E9PF74|Q6V9R7	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000402418.3	37	NULL	CCDS11720.1	17																																																																																			-	-		0.465	SLC25A19-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LOC100287042	protein_coding	OTTHUMT00000447282.1	-	NM_021734			73269842	+1	no_errors	ENST00000585075	ensembl	human	known	74_37	rna	INS	0.003:0.004	TTATT
