#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
RNF14	9604	genome.wustl.edu	37	5	141353227	141353227	+	Missense_Mutation	SNP	T	T	A			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr5:141353227T>A	ENST00000394520.2	+	3	383	c.74T>A	c.(73-75)tTt>tAt	p.F25Y	RNF14_ENST00000394519.1_Missense_Mutation_p.F25Y|RNF14_ENST00000356143.1_Missense_Mutation_p.F25Y|RNF14_ENST00000347642.3_Missense_Mutation_p.F25Y|AC005740.5_ENST00000520882.1_RNA|RNF14_ENST00000502341.1_3'UTR|RNF14_ENST00000394514.2_5'UTR|RNF14_ENST00000540015.1_Missense_Mutation_p.F25Y|RNF14_ENST00000394515.3_Missense_Mutation_p.F25Y	NM_001201365.1|NM_004290.4	NP_001188294.1|NP_004281.1	Q9UBS8	RNF14_HUMAN	ring finger protein 14	25	RWD. {ECO:0000255|PROSITE- ProRule:PRU00179}.				androgen receptor signaling pathway (GO:0030521)|positive regulation of transcription, DNA-templated (GO:0045893)|protein ubiquitination (GO:0016567)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to estradiol (GO:0032355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|small conjugating protein ligase activity (GO:0019787)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	15		all_hematologic(541;0.0536)|Ovarian(839;0.118)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;0.0407)		GGAGATGAATTTAGAAAAGCA	0.388																																																	0								ENSG00000013561						88.0	90.0	89.0					5																	141353227		2203	4300	6503	RNF14	SO:0001583	missense	0			-	HGNC	AF060544	CCDS4270.1, CCDS4271.1	5q23.3-q31.1	2008-02-05			ENSG00000013561	ENSG00000013561		"""RING-type (C3HC4) zinc fingers"""	10058	protein-coding gene	gene with protein product		605675				10085091, 10320776	Standard	NM_183399		Approved	ARA54, HFB30, TRIAD2	uc003lmc.3	Q9UBS8	OTTHUMG00000129660	ENST00000394520.2:c.74T>A	5.37:g.141353227T>A	ENSP00000378028:p.Phe25Tyr	Somatic	0	55	0.00		0.599270127213081	44	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	41	8.89	A0AV26|A6NMR2|A8MTW5|B3KN72|B7ZLV2|D3DQE4|O94793|Q6IBV0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RWD-domain,pfam_Znf_C6HC,superfamily_UBQ-conjugating_enzyme/RWD,smart_RWD-domain,smart_Znf_C6HC,pfscan_RWD-domain,pfscan_Znf_RING	p.F25Y	ENST00000394520.2	37	c.74	CCDS4270.1	5	.	.	.	.	.	.	.	.	.	.	T	35	5.421024	0.96111	.	.	ENSG00000013561	ENST00000511961;ENST00000506822;ENST00000513019;ENST00000356143;ENST00000394520;ENST00000347642;ENST00000540015;ENST00000506938;ENST00000512565;ENST00000394515;ENST00000507163;ENST00000394519;ENST00000507291	T;T;T;T;T;T;T;T;T;T;T;T;T	0.41400	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	5.82	5.82	0.92795	Ubiquitin-conjugating enzyme/RWD-like (2);RWD domain (3);	0.000000	0.85682	D	0.000000	T	0.72137	0.3423	M	0.91972	3.26	0.80722	D	1	D;D;D	0.89917	0.997;0.997;1.0	D;D;D	0.91635	0.98;0.992;0.999	T	0.78347	-0.2239	10	0.56958	D	0.05	.	16.1639	0.81739	0.0:0.0:0.0:1.0	.	25;25;25	B7Z3J5;B7Z229;Q9UBS8	.;.;RNF14_HUMAN	Y	25	ENSP00000423420:F25Y;ENSP00000423273:F25Y;ENSP00000421780:F25Y;ENSP00000348462:F25Y;ENSP00000378028:F25Y;ENSP00000324956:F25Y;ENSP00000442490:F25Y;ENSP00000420837:F25Y;ENSP00000426832:F25Y;ENSP00000378023:F25Y;ENSP00000422527:F25Y;ENSP00000378027:F25Y;ENSP00000423294:F25Y	ENSP00000324956:F25Y	F	+	2	0	RNF14	141333411	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.983000	0.88140	2.222000	0.72286	0.377000	0.23210	TTT	-	pfam_RWD-domain,superfamily_UBQ-conjugating_enzyme/RWD,smart_RWD-domain,pfscan_RWD-domain		0.388	RNF14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF14	protein_coding	OTTHUMT00000251860.2	T	NM_004290	-		141353227	+1	no_errors	ENST00000347642	ensembl	human	known	74_37	missense	SNP	1.000	A
RASA3	22821	genome.wustl.edu	37	13	114762103	114762103	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr13:114762103C>T	ENST00000334062.7	-	21	2166	c.2045G>A	c.(2044-2046)cGc>cAc	p.R682H	RASA3_ENST00000389544.4_Missense_Mutation_p.R650H	NM_007368.2	NP_031394.2	Q14644	RASA3_HUMAN	RAS p21 protein activator 3	682					calcium ion transmembrane transport (GO:0070588)|intracellular signal transduction (GO:0035556)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	calcium-release channel activity (GO:0015278)|GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|Ras GTPase activator activity (GO:0005099)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(20)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	47	Lung NSC(43;0.00814)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.016)|all_epithelial(44;0.00577)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.188)	BRCA - Breast invasive adenocarcinoma(86;0.128)			GACGGTGAGGCGCTTCTGGTT	0.637																																																	0								ENSG00000185989						169.0	125.0	140.0					13																	114762103		2203	4300	6503	RASA3	SO:0001583	missense	0			-	HGNC		CCDS32016.1	13q34	2013-01-10			ENSG00000185989	ENSG00000185989		"""Pleckstrin homology (PH) domain containing"""	20331	protein-coding gene	gene with protein product		605182				7637787, 9382842	Standard	NM_007368		Approved	GAP1IP4BP, GAPIII	uc001vui.3	Q14644	OTTHUMG00000017399	ENST00000334062.7:c.2045G>A	13.37:g.114762103C>T	ENSP00000335029:p.Arg682His	Somatic	0	44	0.00		0.599270127213081	68	20.00	17	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	38	22.45	A6NL15|F8W6X8|Q8IUY2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RasGAP,pfam_C2_dom,pfam_Znf_Btk_motif,pfam_Pleckstrin_homology,superfamily_Rho_GTPase_activation_prot,superfamily_C2_dom,smart_C2_dom,smart_RasGAP,smart_Pleckstrin_homology,smart_Znf_Btk_motif,pfscan_C2_dom,pfscan_Pleckstrin_homology,pfscan_Znf_Btk_motif,pfscan_RasGAP,prints_Znf_Btk_motif	p.R682H	ENST00000334062.7	37	c.2045	CCDS32016.1	13	.	.	.	.	.	.	.	.	.	.	C	18.65	3.669587	0.67814	.	.	ENSG00000185989	ENST00000334062;ENST00000389544	D;D	0.93763	-3.28;-3.28	5.37	5.37	0.77165	Pleckstrin homology-type (1);Zinc finger, Btk motif (3);	0.000000	0.85682	D	0.000000	D	0.97068	0.9042	M	0.85710	2.77	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97125	0.9814	9	.	.	.	.	19.0948	0.93246	0.0:1.0:0.0:0.0	.	682	Q14644	RASA3_HUMAN	H	682;650	ENSP00000335029:R682H;ENSP00000374195:R650H	.	R	-	2	0	RASA3	113780205	1.000000	0.71417	0.041000	0.18516	0.045000	0.14185	5.426000	0.66476	2.499000	0.84300	0.561000	0.74099	CGC	-	smart_Znf_Btk_motif,pfscan_Znf_Btk_motif,prints_Znf_Btk_motif		0.637	RASA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RASA3	protein_coding	OTTHUMT00000045957.2	C	NM_007368	-		114762103	-1	no_errors	ENST00000334062	ensembl	human	known	74_37	missense	SNP	1.000	T
ZNF234	10780	genome.wustl.edu	37	19	44653051	44653051	+	Splice_Site	SNP	G	G	A			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr19:44653051G>A	ENST00000426739.2	+	4	400		c.e4+1		ZNF234_ENST00000592437.1_Splice_Site	NM_006630.2	NP_006621.1	Q14588	ZN234_HUMAN	zinc finger protein 234						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(11)|ovary(1)|prostate(1)	23		Prostate(69;0.0435)				CTGTCAGTGGGTGAGGACATG	0.498																																																	0								ENSG00000263002						134.0	131.0	132.0					19																	44653051		2203	4300	6503	ZNF234	SO:0001630	splice_region_variant	0			-	HGNC	X78927	CCDS46101.1	19q13	2013-01-08				ENSG00000263002		"""Zinc fingers, C2H2-type"", ""-"""	13027	protein-coding gene	gene with protein product		604750		ZNF269		7865130	Standard	NM_006630		Approved	HZF4	uc002oyl.4	Q14588		ENST00000426739.2:c.142+1G>A	19.37:g.44653051G>A		Somatic	0	87	0.00		0.599270127213081	2	95.92	47	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	83	13.40	A8K1C8|Q96IR4|Q9NS45|Q9NYT7	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e2+1	ENST00000426739.2	37	c.142+1	CCDS46101.1	19	.	.	.	.	.	.	.	.	.	.	G	13.49	2.253489	0.39797	.	.	ENSG00000167380	ENST00000426739	.	.	.	3.85	3.85	0.44370	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.0647	0.71983	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ZNF226	49344891	1.000000	0.71417	0.997000	0.53966	0.455000	0.32408	3.745000	0.55119	2.122000	0.65172	0.561000	0.74099	.	-	-		0.498	ZNF234-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF234	protein_coding	OTTHUMT00000460586.2	G		-	Intron	44653051	+1	no_errors	ENST00000426739	ensembl	human	known	74_37	splice_site	SNP	1.000	A
PLXNA2	5362	genome.wustl.edu	37	1	208391096	208391097	+	Frame_Shift_Ins	INS	-	-	A			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr1:208391096_208391097insA	ENST00000367033.3	-	2	928_929	c.171_172insT	c.(169-174)caagggfs	p.G58fs		NM_025179.3	NP_079455.3	O75051	PLXA2_HUMAN	plexin A2	58	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|centrosome localization (GO:0051642)|cerebellar granule cell precursor tangential migration (GO:0021935)|limb bud formation (GO:0060174)|neural tube development (GO:0021915)|pharyngeal system development (GO:0060037)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|somitogenesis (GO:0001756)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)	80				OV - Ovarian serous cystadenocarcinoma(81;0.199)		GCCCCCGTCCCTTGGTGGACGG	0.599																																																	0								ENSG00000076356																																			PLXNA2	SO:0001589	frameshift_variant	0				HGNC	X87831	CCDS31013.1	1q32.2	2008-07-18			ENSG00000076356	ENSG00000076356		"""Plexins"""	9100	protein-coding gene	gene with protein product	"""plexin 2"", ""plexin-A2"", ""semaphorin receptor OCT"", ""transmembrane protein OCT"""	601054		PLXN2		8570614	Standard	NM_025179		Approved	OCT, FLJ11751, FLJ30634, KIAA0463	uc001hgz.3	O75051	OTTHUMG00000036564	ENST00000367033.3:c.171_172insT	1.37:g.208391096_208391097insA	ENSP00000356000:p.Gly58fs	Somatic	0	54	0.00		0.599270127213081	4	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	51	22.73	A2RTX9|B2RMX7|Q6UX61|Q96GN9|Q9BRL1|Q9UIW1	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_Semap_dom,pfam_IPT,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_IPT,pfscan_Semap_dom	p.G57fs	ENST00000367033.3	37	c.172_171	CCDS31013.1	1																																																																																			-	pfam_Semap_dom,superfamily_Semap_dom,smart_Semap_dom,pfscan_Semap_dom		0.599	PLXNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNA2	protein_coding	OTTHUMT00000088932.6	-	NM_025179			208391097	-1	no_errors	ENST00000367033	ensembl	human	known	74_37	frame_shift_ins	INS	0.302:0.070	A
LAMA3	3909	genome.wustl.edu	37	18	21293904	21293904	+	Silent	SNP	C	C	T			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr18:21293904C>T	ENST00000313654.9	+	2	556	c.315C>T	c.(313-315)tgC>tgT	p.C105C	LAMA3_ENST00000399516.3_Silent_p.C105C	NM_198129.1	NP_937762.1	Q16787	LAMA3_HUMAN	laminin, alpha 3	105	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)			NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(24)|lung(54)|ovary(8)|prostate(6)|skin(7)|urinary_tract(4)	128	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)					GTGACTATTGCAATTCTGAAG	0.393																																																	0								ENSG00000053747						70.0	65.0	67.0					18																	21293904		1883	4118	6001	LAMA3	SO:0001819	synonymous_variant	0			-	HGNC	L34155	CCDS11880.1, CCDS42419.1, CCDS45838.1, CCDS59307.1	18q11.2	2013-03-01	2002-08-29		ENSG00000053747	ENSG00000053747		"""Laminins"""	6483	protein-coding gene	gene with protein product		600805	"""laminin, alpha 3 (nicein (150kD), kalinin (165kD), BM600 (150kD), epilegrin)"""	LAMNA		8077230	Standard	NM_000227		Approved	nicein-150kDa, kalinin-165kDa, BM600-150kDa, epiligrin	uc002kuq.3	Q16787	OTTHUMG00000131874	ENST00000313654.9:c.315C>T	18.37:g.21293904C>T		Somatic	0	40	0.00		0.599270127213081	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	44	10.20	B0YJ33|Q13679|Q13680|Q6VU67|Q6VU68|Q6VU69|Q76E14|Q96TG0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_EGF_laminin,pfam_Laminin_G,pfam_Laminin_I,pfam_Laminin_N,pfam_Laminin_II,pfam_Laminin_B_type_IV,superfamily_ConA-like_lec_gl_sf,superfamily_Growth_fac_rcpt_N_dom,superfamily_Galactose-bd-like,superfamily_STAT_TF_coiled-coil,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N	p.C105	ENST00000313654.9	37	c.315	CCDS42419.1	18																																																																																			-	pfam_Laminin_N,smart_Laminin_N,pfscan_Laminin_N		0.393	LAMA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA3	protein_coding	OTTHUMT00000254824.3	C	NM_000227, NM_198129	-		21293904	+1	no_errors	ENST00000313654	ensembl	human	known	74_37	silent	SNP	1.000	T
TMPRSS9	360200	genome.wustl.edu	37	19	2425956	2425956	+	Missense_Mutation	SNP	A	A	C			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr19:2425956A>C	ENST00000332578.3	+	17	3050	c.3050A>C	c.(3049-3051)gAg>gCg	p.E1017A	TIMM13_ENST00000215570.3_3'UTR	NM_182973.1	NP_892018.1	Q7Z410	TMPS9_HUMAN	transmembrane protease, serine 9	1017	Peptidase S1 3. {ECO:0000255|PROSITE- ProRule:PRU00274}.				plasminogen activation (GO:0031639)	integral component of plasma membrane (GO:0005887)	serine-type endopeptidase activity (GO:0004252)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(3)|lung(12)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCCTGCAGGGAGCCCTCTGGA	0.652																																																	0								ENSG00000178297						61.0	65.0	64.0					19																	2425956		2203	4300	6503	TMPRSS9	SO:0001583	missense	0			-	HGNC	AJ488946	CCDS12088.1	19p13.3	2010-04-13						"""Serine peptidases / Transmembrane"""	30079	protein-coding gene	gene with protein product	"""polyserase 1"""	610477				12886014	Standard	NM_182973		Approved		uc010xgx.2	Q7Z410		ENST00000332578.3:c.3050A>C	19.37:g.2425956A>C	ENSP00000330264:p.Glu1017Ala	Somatic	0	175	0.00		0.599270127213081	3	40.00	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	40	63	38.83	Q6ZND6|Q7Z411	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_Pept_S1A_polyserase-1,pfam_Peptidase_S1,pfam_Peptidase_S1A_nudel,pfam_LDrepeatLR_classA_rpt,superfamily_Trypsin-like_Pept_dom,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_Peptidase_S1,prints_Peptidase_S1A,pfscan_LDrepeatLR_classA_rpt,pfscan_Peptidase_S1	p.E1017A	ENST00000332578.3	37	c.3050	CCDS12088.1	19	.	.	.	.	.	.	.	.	.	.	A	14.59	2.579642	0.46006	.	.	ENSG00000178297	ENST00000332578	D	0.88586	-2.4	4.66	3.65	0.41850	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.53938	D	0.000053	D	0.86209	0.5878	N	0.21545	0.675	0.80722	D	1	P	0.50943	0.94	P	0.55011	0.766	D	0.83805	0.0238	10	0.44086	T	0.13	.	9.2498	0.37549	0.9116:0.0:0.0884:0.0	.	1017	Q7Z410	TMPS9_HUMAN	A	1017	ENSP00000330264:E1017A	ENSP00000330264:E1017A	E	+	2	0	TMPRSS9	2376956	1.000000	0.71417	0.997000	0.53966	0.216000	0.24613	6.151000	0.71806	0.627000	0.30340	-0.411000	0.06167	GAG	-	pirsf_Pept_S1A_polyserase-1,pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1		0.652	TMPRSS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMPRSS9	protein_coding	OTTHUMT00000451330.3	A	NM_182973	-		2425956	+1	no_errors	ENST00000332578	ensembl	human	known	74_37	missense	SNP	1.000	C
ABHD15	116236	genome.wustl.edu	37	17	27889595	27889595	+	Missense_Mutation	SNP	C	C	T	rs528380562		TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr17:27889595C>T	ENST00000307201.4	-	2	1561	c.1391G>A	c.(1390-1392)cGa>cAa	p.R464Q	RP11-68I3.2_ENST00000581474.1_RNA	NM_198147.2	NP_937790.2	Q6UXT9	ABH15_HUMAN	abhydrolase domain containing 15	464						extracellular region (GO:0005576)|membrane (GO:0016020)	hydrolase activity (GO:0016787)			breast(1)|kidney(1)|large_intestine(1)|lung(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	10						TGTGTATGATCGCTTCCAGTT	0.567													C|||	1	0.000199681	0.0	0.0	5008	,	,		16771	0.0		0.001	False		,,,				2504	0.0																0								ENSG00000168792						81.0	89.0	86.0					17																	27889595		2203	4300	6503	ABHD15	SO:0001583	missense	0			-	HGNC	AK056717	CCDS32602.1	17q11.2	2009-11-20			ENSG00000168792	ENSG00000168792		"""Abhydrolase domain containing"""	26971	protein-coding gene	gene with protein product						12975309	Standard	NM_198147		Approved		uc002hed.2	Q6UXT9		ENST00000307201.4:c.1391G>A	17.37:g.27889595C>T	ENSP00000302657:p.Arg464Gln	Somatic	0	37	0.00		0.599270127213081	12	47.83	11	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	20	47.37	Q96EC5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_AB-Hydro_YheT	p.R464Q	ENST00000307201.4	37	c.1391	CCDS32602.1	17	.	.	.	.	.	.	.	.	.	.	C	35	5.419589	0.96111	.	.	ENSG00000168792	ENST00000307201	T	0.39056	1.1	5.77	5.77	0.91146	.	0.000000	0.64402	D	0.000001	T	0.55940	0.1952	L	0.34521	1.04	0.58432	D	0.999996	D	0.89917	1.0	D	0.87578	0.998	T	0.57100	-0.7869	10	0.87932	D	0	-10.1909	17.4866	0.87691	0.0:1.0:0.0:0.0	.	464	Q6UXT9	ABH15_HUMAN	Q	464	ENSP00000302657:R464Q	ENSP00000302657:R464Q	R	-	2	0	ABHD15	24913721	1.000000	0.71417	0.998000	0.56505	0.965000	0.64279	6.412000	0.73303	2.745000	0.94114	0.655000	0.94253	CGA	-	NULL		0.567	ABHD15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABHD15	protein_coding	OTTHUMT00000447796.2	C	NM_198147	-		27889595	-1	no_errors	ENST00000307201	ensembl	human	known	74_37	missense	SNP	1.000	T
RPS26	6231	genome.wustl.edu	37	12	56436288	56436288	+	Missense_Mutation	SNP	G	G	T			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr12:56436288G>T	ENST00000356464.5	+	2	397	c.83G>T	c.(82-84)cGa>cTa	p.R28L	RP11-603J24.4_ENST00000551846.1_RNA|RPS26_ENST00000552361.1_Missense_Mutation_p.R28L			P62854	RS26_HUMAN	ribosomal protein S26	28					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|negative regulation of RNA splicing (GO:0033119)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|small ribosomal subunit (GO:0015935)	mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(2)	7			OV - Ovarian serous cystadenocarcinoma(18;0.123)			AACTGTGCCCGATGCGTGCCC	0.527																																																	0								ENSG00000197728						40.0	41.0	41.0					12																	56436288		2202	4274	6476	RPS26	SO:0001583	missense	0			-	HGNC	AB007160	CCDS31832.1	12q13	2011-04-06				ENSG00000197728		"""S ribosomal proteins"""	10414	protein-coding gene	gene with protein product	"""40S ribosomal protein S26"""	603701				9582194, 8670309	Standard	NM_001029		Approved	S26	uc001sjf.3	P62854	OTTHUMG00000170139	ENST00000356464.5:c.83G>T	12.37:g.56436288G>T	ENSP00000348849:p.Arg28Leu	Somatic	0	70	0.00		0.599270127213081	459	17.27	96	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	74	12.79	P02383|P70394|Q06722|Q3MHD8|Q6IRY4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ribosomal_S26e	p.R28L	ENST00000356464.5	37	c.83	CCDS31832.1	12	.	.	.	.	.	.	.	.	.	.	G	19.91	3.913742	0.72983	.	.	ENSG00000197728	ENST00000356464;ENST00000552361	D;D	0.92099	-2.97;-2.97	4.43	3.51	0.40186	.	0.000000	0.64402	U	0.000002	D	0.93943	0.8061	M	0.91459	3.21	0.58432	D	0.999999	B	0.29805	0.257	B	0.37304	0.246	D	0.93559	0.6893	10	0.59425	D	0.04	.	12.7216	0.57146	0.0:0.0:0.8336:0.1664	.	28	P62854	RS26_HUMAN	L	28	ENSP00000348849:R28L;ENSP00000450339:R28L	ENSP00000348849:R28L	R	+	2	0	RPS26	54722555	1.000000	0.71417	0.969000	0.41365	0.875000	0.50365	9.235000	0.95353	1.156000	0.42514	0.563000	0.77884	CGA	-	pfam_Ribosomal_S26e		0.527	RPS26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPS26	protein_coding	OTTHUMT00000407616.1	G	NM_001029	-		56436288	+1	no_errors	ENST00000356464	ensembl	human	known	74_37	missense	SNP	1.000	T
CAD	790	genome.wustl.edu	37	2	27455315	27455315	+	Splice_Site	SNP	G	G	T			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr2:27455315G>T	ENST00000403525.1	+	17	2600		c.e17-1		CAD_ENST00000464159.1_Splice_Site|CAD_ENST00000264705.4_Splice_Site			O76075	DFFB_HUMAN	carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase						apoptotic chromosome condensation (GO:0030263)|apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|brain development (GO:0007420)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	deoxyribonuclease activity (GO:0004536)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)			NS(1)|breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(40)|ovary(6)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	92	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TTCTATTTTAGCACAGAGCTG	0.512																																																	0								ENSG00000084774						53.0	50.0	51.0					2																	27455315		2203	4300	6503	CAD	SO:0001630	splice_region_variant	0			-	HGNC	D78586	CCDS1742.1	2p22-p21	2012-10-02			ENSG00000084774	ENSG00000084774	2.1.3.2, 3.5.2.-		1424	protein-coding gene	gene with protein product		114010				8619816, 2565865	Standard	NM_004341		Approved		uc002rji.3	P27708	OTTHUMG00000097070	ENST00000403525.1:c.2457-1G>T	2.37:g.27455315G>T		Somatic	0	21	0.00		0.599270127213081	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	14	17.65	O60521|Q5SR22|Q9BYI4|Q9BYI5|Q9BYI6	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e18-1	ENST00000403525.1	37	c.2646-1		2	.	.	.	.	.	.	.	.	.	.	G	18.65	3.670245	0.67814	.	.	ENSG00000084774	ENST00000264705;ENST00000403525	.	.	.	5.37	5.37	0.77165	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.8357	0.88696	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CAD	27308819	1.000000	0.71417	0.998000	0.56505	0.746000	0.42486	8.683000	0.91236	2.797000	0.96272	0.650000	0.86243	.	-	-		0.512	CAD-002	NOVEL	basic|exp_conf	protein_coding	CAD	protein_coding	OTTHUMT00000324970.1	G		-	Intron	27455315	+1	no_errors	ENST00000264705	ensembl	human	known	74_37	splice_site	SNP	1.000	T
L3MBTL1	26013	genome.wustl.edu	37	20	42144663	42144663	+	Intron	SNP	A	A	T			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr20:42144663A>T	ENST00000427442.2	+	7	870				L3MBTL1_ENST00000373135.3_Intron|L3MBTL1_ENST00000457824.1_Intron|L3MBTL1_ENST00000373134.1_Intron|L3MBTL1_ENST00000444063.1_Intron|L3MBTL1_ENST00000418998.1_Intron			Q9Y468	LMBL1_HUMAN	l(3)mbt-like 1 (Drosophila)						chromatin modification (GO:0016568)|hemopoiesis (GO:0030097)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of cell cycle (GO:0051726)|regulation of megakaryocyte differentiation (GO:0045652)|regulation of mitosis (GO:0007088)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|condensed chromosome (GO:0000793)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|identical protein binding (GO:0042802)|methylated histone binding (GO:0035064)|nucleosomal histone binding (GO:0031493)|nucleosome binding (GO:0031491)|SAM domain binding (GO:0032093)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|large_intestine(3)|ovary(1)|skin(2)	7						GGTAGGGGCCAGGATCAGACC	0.567																																																	0								ENSG00000185513																																			L3MBTL1	SO:0001627	intron_variant	0			-	HGNC	U89358	CCDS13319.1, CCDS46602.1, CCDS46602.2	20q13.12	2013-01-10	2010-09-03	2010-09-03	ENSG00000185513	ENSG00000185513		"""Zinc fingers, C2HC-type containing"", ""Sterile alpha motif (SAM) domain containing"""	15905	protein-coding gene	gene with protein product	"""lethal (3) malignant brain tumor l(3)"""	608802	"""l(3)mbt (Drosophila)-like"", ""l(3)mbt-like (Drosophila)"""	L3MBTL		10445843, 17540172	Standard	NM_032107		Approved	ZC2HC3, dJ138B7.3, DKFZp586P1522, KIAA0681	uc010zwh.2	Q9Y468	OTTHUMG00000032503	ENST00000427442.2:c.712-70A>T	20.37:g.42144663A>T		Somatic	0	32	0.00		0.599270127213081	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.30	B4DRC9|E1P5W7|Q5H8Y8|Q5H8Y9|Q8IUV7|Q9H1E6|Q9H1G5|Q9UG06|Q9UJB9|Q9Y4C9	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000427442.2	37	NULL	CCDS46602.2	20																																																																																			-	-		0.567	L3MBTL1-007	KNOWN	upstream_ATG|basic|appris_candidate_longest|CCDS	protein_coding	L3MBTL1	protein_coding	OTTHUMT00000079300.3	A	NM_032107	-		42144663	+1	no_errors	ENST00000473981	ensembl	human	known	74_37	rna	SNP	0.000	T
NRXN2	9379	genome.wustl.edu	37	11	64418820	64418820	+	Missense_Mutation	SNP	A	A	G			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr11:64418820A>G	ENST00000377551.1	-	13	3036	c.2825T>C	c.(2824-2826)cTc>cCc	p.L942P	AP001092.4_ENST00000433606.1_RNA|NRXN2_ENST00000377559.3_Missense_Mutation_p.L902P|NRXN2_ENST00000265459.6_Missense_Mutation_p.L942P|NRXN2_ENST00000409571.1_Missense_Mutation_p.L935P			Q9P2S2	NRX2A_HUMAN	neurexin 2	942	Laminin G-like 5. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|gephyrin clustering (GO:0097116)|neuroligin clustering (GO:0097118)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	calcium channel regulator activity (GO:0005246)|cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)|neuroligin family protein binding (GO:0097109)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(1)|lung(34)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(6)|urinary_tract(1)	71						CTGGAAGAAGAGGTGCATGGA	0.587											OREG0021057	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000110076						94.0	68.0	77.0					11																	64418820		2201	4297	6498	NRXN2	SO:0001583	missense	0			-	HGNC		CCDS8077.1, CCDS31597.1, CCDS8078.1	11q13	2008-07-18			ENSG00000110076	ENSG00000110076			8009	protein-coding gene	gene with protein product	"""neurexin II"""	600566				1621094	Standard	NM_015080		Approved		uc021qkw.1	P58401	OTTHUMG00000045214	ENST00000377551.1:c.2825T>C	11.37:g.64418820A>G	ENSP00000366774:p.Leu942Pro	Somatic	0	39	0.00	1076	0.599270127213081	3	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	A7E2C1|Q9Y2D6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,smart_EG-like_dom,smart_Neurexin-like,pfscan_EG-like_dom,pfscan_Laminin_G	p.L942P	ENST00000377551.1	37	c.2825	CCDS8077.1	11	.	.	.	.	.	.	.	.	.	.	A	21.3	4.128272	0.77549	.	.	ENSG00000110076	ENST00000377551;ENST00000377559;ENST00000265459;ENST00000345863;ENST00000409571	D;D;D;D	0.81996	-1.56;-1.56;-1.56;-1.56	4.17	4.17	0.49024	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);	0.000000	0.38436	U	0.001686	D	0.92430	0.7597	M	0.93462	3.42	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.994	D;D;P	0.97110	1.0;0.99;0.832	D	0.93601	0.6930	10	0.87932	D	0	.	11.2627	0.49093	1.0:0.0:0.0:0.0	.	902;942;688	Q9P2S2-2;Q9P2S2;E7EV67	.;NRX2A_HUMAN;.	P	942;902;942;902;935	ENSP00000366774:L942P;ENSP00000366782:L902P;ENSP00000265459:L942P;ENSP00000386416:L935P	ENSP00000265459:L942P	L	-	2	0	NRXN2	64175396	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.089000	0.94137	1.760000	0.52011	0.454000	0.30748	CTC	-	superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,pfscan_Laminin_G		0.587	NRXN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NRXN2	protein_coding	OTTHUMT00000104967.3	A	NM_015080	-		64418820	-1	no_errors	ENST00000265459	ensembl	human	known	74_37	missense	SNP	1.000	G
ZBTB2	57621	genome.wustl.edu	37	6	151687316	151687316	+	Silent	SNP	G	G	T			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr6:151687316G>T	ENST00000325144.4	-	3	1025	c.885C>A	c.(883-885)ctC>ctA	p.L295L		NM_020861.1	NP_065912.1	Q8N680	ZBTB2_HUMAN	zinc finger and BTB domain containing 2	295					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|large_intestine(2)|lung(6)|skin(1)	12			BRCA - Breast invasive adenocarcinoma(37;0.175)	OV - Ovarian serous cystadenocarcinoma(155;2.63e-11)		CATTGCTACAGAGAGTCAGGG	0.537																																																	0								ENSG00000181472						138.0	127.0	131.0					6																	151687316		2203	4300	6503	ZBTB2	SO:0001819	synonymous_variant	0			-	HGNC	BC020172	CCDS5231.1	6q25.1	2013-01-09			ENSG00000181472	ENSG00000181472		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	20868	protein-coding gene	gene with protein product						10819331	Standard	NM_020861		Approved	KIAA1483, ZNF437, bA351K16.2	uc003qoh.3	Q8N680	OTTHUMG00000015834	ENST00000325144.4:c.885C>A	6.37:g.151687316G>T		Somatic	0	35	0.00		0.599270127213081	15	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	21	12.50	A8K7C7|Q5SZ81|Q9P245	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.L295	ENST00000325144.4	37	c.885	CCDS5231.1	6																																																																																			-	NULL		0.537	ZBTB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB2	protein_coding	OTTHUMT00000042715.1	G	NM_020861	-		151687316	-1	no_errors	ENST00000325144	ensembl	human	known	74_37	silent	SNP	0.053	T
MYH15	22989	genome.wustl.edu	37	3	108158631	108158631	+	Missense_Mutation	SNP	T	T	C			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr3:108158631T>C	ENST00000273353.3	-	25	3144	c.3088A>G	c.(3088-3090)Agc>Ggc	p.S1030G		NM_014981.1	NP_055796.1	Q9Y2K3	MYH15_HUMAN	myosin, heavy chain 15	1030						cytoplasm (GO:0005737)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(1)|breast(3)|central_nervous_system(2)|cervix(4)|endometrium(10)|kidney(4)|large_intestine(14)|lung(47)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	105						CTCAGGCTGCTGAGCTTCTCC	0.468																																																	0								ENSG00000144821						181.0	187.0	185.0					3																	108158631		2193	4297	6490	MYH15	SO:0001583	missense	0			-	HGNC	AB023217	CCDS43127.1	3q13	2011-09-27	2006-09-29		ENSG00000144821	ENSG00000144821		"""Myosins / Myosin superfamily : Class II"""	31073	protein-coding gene	gene with protein product		609929	"""myosin, heavy polypeptide 15"""			15014174, 15042088	Standard	NM_014981		Approved	KIAA1000	uc003dxa.1	Q9Y2K3	OTTHUMG00000159226	ENST00000273353.3:c.3088A>G	3.37:g.108158631T>C	ENSP00000273353:p.Ser1030Gly	Somatic	0	47	0.00		0.599270127213081	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.33		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,superfamily_Lambda_DNA-bd_dom,smart_Myosin_head_motor_dom,prints_Myosin_head_motor_dom	p.S1030G	ENST00000273353.3	37	c.3088	CCDS43127.1	3	.	.	.	.	.	.	.	.	.	.	T	14.13	2.442520	0.43326	.	.	ENSG00000144821	ENST00000273353	D	0.87571	-2.27	5.43	-3.52	0.04682	.	.	.	.	.	T	0.82148	0.4974	L	0.56769	1.78	0.25310	N	0.989203	B	0.29936	0.262	B	0.29524	0.103	T	0.72896	-0.4153	9	0.87932	D	0	.	9.0872	0.36587	0.0:0.1222:0.474:0.4038	.	1030	Q9Y2K3	MYH15_HUMAN	G	1030	ENSP00000273353:S1030G	ENSP00000273353:S1030G	S	-	1	0	MYH15	109641321	1.000000	0.71417	0.000000	0.03702	0.008000	0.06430	1.937000	0.40193	-0.359000	0.08150	-1.272000	0.01410	AGC	-	NULL		0.468	MYH15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH15	protein_coding	OTTHUMT00000353935.1	T	XM_036988	-		108158631	-1	no_errors	ENST00000273353	ensembl	human	known	74_37	missense	SNP	0.650	C
RP11-420N3.2	0	genome.wustl.edu	37	16	5290016	5290016	+	RNA	SNP	C	C	G	rs4047657		TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr16:5290016C>G	ENST00000569895.1	+	0	214																											AGGGGGGAAGCGCACAGCCCG	0.721																																																	0								ENSG00000260411																																			RP11-420N3.2			0			-	Clone_based_vega_gene																													16.37:g.5290016C>G		Somatic	0	21	0.00		0.599270127213081	0	100.00	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	19	26.92		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000569895.1	37	NULL		16																																																																																			-	-		0.721	RP11-420N3.2-001	KNOWN	basic	processed_transcript	ENSG00000260411	processed_transcript	OTTHUMT00000435404.2	C		-		5290016	+1	no_errors	ENST00000569895	ensembl	human	known	74_37	rna	SNP	0.007	G
COG8	84342	genome.wustl.edu	37	16	69368746	69368746	+	Missense_Mutation	SNP	C	C	G			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr16:69368746C>G	ENST00000306875.4	-	3	1205	c.1091G>C	c.(1090-1092)cGg>cCg	p.R364P	COG8_ENST00000562081.1_Missense_Mutation_p.R364P|RP11-343C2.12_ENST00000562949.1_Missense_Mutation_p.R10P	NM_032382.4	NP_115758.3	Q96MW5	COG8_HUMAN	component of oligomeric golgi complex 8	364					protein transport (GO:0015031)	Golgi transport complex (GO:0017119)|membrane (GO:0016020)				breast(3)|kidney(1)|large_intestine(2)|ovary(2)|skin(1)	9						CAACTGACCCCGGAAATCAGC	0.557																																																	0								ENSG00000213380						62.0	67.0	65.0					16																	69368746		2198	4300	6498	COG8	SO:0001583	missense	0			-	HGNC	AK025968	CCDS10876.1	16q22.1	2011-05-31			ENSG00000213380	ENSG00000213380		"""Components of oligomeric golgi complex"""	18623	protein-coding gene	gene with protein product		606979				11980916	Standard	NM_032382		Approved	FLJ22315, DOR1	uc002ewy.2	Q96MW5	OTTHUMG00000154277	ENST00000306875.4:c.1091G>C	16.37:g.69368746C>G	ENSP00000305459:p.Arg364Pro	Somatic	0	27	0.00		0.599270127213081	49	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	32	11.11	Q0VAK2|Q8WVV6|Q9H6F8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_COG8,superfamily_Cullin_repeat-like_dom,pirsf_COG8_Metazoal_Plant	p.R364P	ENST00000306875.4	37	c.1091	CCDS10876.1	16	.	.	.	.	.	.	.	.	.	.	C	18.91	3.724476	0.68959	.	.	ENSG00000213380	ENST00000306875	T	0.56941	0.43	6.04	5.1	0.69264	Cullin repeat-like-containing domain (1);	0.050275	0.85682	N	0.000000	T	0.78362	0.4271	M	0.90309	3.105	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.83303	-0.0027	10	0.56958	D	0.05	-3.9149	17.6091	0.88047	0.0:0.8767:0.1232:0.0	.	391;364	B4DYU2;Q96MW5	.;COG8_HUMAN	P	364	ENSP00000305459:R364P	ENSP00000305459:R364P	R	-	2	0	COG8	67926247	1.000000	0.71417	0.999000	0.59377	0.534000	0.34807	5.743000	0.68655	1.580000	0.49851	-0.223000	0.12442	CGG	-	pfam_COG8,superfamily_Cullin_repeat-like_dom,pirsf_COG8_Metazoal_Plant		0.557	COG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COG8	protein_coding	OTTHUMT00000268948.2	C	NM_032382	-		69368746	-1	no_errors	ENST00000306875	ensembl	human	known	74_37	missense	SNP	1.000	G
GPC1	2817	genome.wustl.edu	37	2	241390284	241390284	+	Intron	DEL	C	C	-			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr2:241390284delC	ENST00000264039.2	+	2	414				AC110619.2_ENST00000404327.3_Frame_Shift_Del_p.G41fs|AC110619.2_ENST00000404891.1_3'UTR	NM_002081.2	NP_002072.2	P35052	GPC1_HUMAN	glypican 1						axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan catabolic process (GO:0030200)|myelin assembly (GO:0032288)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|phototransduction, visible light (GO:0007603)|positive regulation of skeletal muscle cell differentiation (GO:2001016)|retinoid metabolic process (GO:0001523)|Schwann cell differentiation (GO:0014037)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	copper ion binding (GO:0005507)|fibroblast growth factor binding (GO:0017134)|laminin binding (GO:0043236)			breast(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(4)|prostate(1)	9		all_epithelial(40;2.79e-15)|Breast(86;2.41e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0335)|Lung NSC(271;0.106)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;4.51e-33)|all cancers(36;1.74e-30)|OV - Ovarian serous cystadenocarcinoma(60;4.73e-15)|Kidney(56;2.99e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;9.1e-06)|Colorectal(34;0.000487)|Lung(119;0.0013)|LUSC - Lung squamous cell carcinoma(224;0.0154)|COAD - Colon adenocarcinoma(134;0.0194)|READ - Rectum adenocarcinoma(96;0.0949)		GGCAGAGGTTCCCTCTGGAAG	0.607																																																	0								ENSG00000218416																																			AC110619.2	SO:0001627	intron_variant	0				Clone_based_vega_gene	AK095397	CCDS2534.1	2q35-q37	2008-02-05			ENSG00000063660	ENSG00000063660		"""Proteoglycans / Cell Surface : Glypicans"""	4449	protein-coding gene	gene with protein product	"""glypican proteoglycan 1"""	600395				7774946	Standard	NM_002081		Approved	glypican	uc002vyw.4	P35052	OTTHUMG00000133349	ENST00000264039.2:c.167-8163C>-	2.37:g.241390284delC		Somatic	0	56	0.00		0.599270127213081	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	28	28	50.00	B3KTD1|Q53QM4	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	NULL	p.N42fs	ENST00000264039.2	37	c.123	CCDS2534.1	2																																																																																			-	NULL		0.607	GPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000218416	protein_coding	OTTHUMT00000257179.3	C	NM_002081			241390284	-1	no_errors	ENST00000404327	ensembl	human	putative	74_37	frame_shift_del	DEL	0.001	-
CROCCP2	84809	genome.wustl.edu	37	1	16945227	16945227	+	lincRNA	SNP	G	G	T	rs9728628	byFrequency	TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr1:16945227G>T	ENST00000412962.1	-	0	2292				RP5-1182A14.5_ENST00000607700.1_lincRNA			Q86T23	CROL1_HUMAN	ciliary rootlet coiled-coil, rootletin pseudogene 2						centrosome organization (GO:0051297)	ciliary rootlet (GO:0035253)											CATTCTTACAGGCATTACCTT	0.373																																																	0								ENSG00000215908																																			CROCCP2			0			-	HGNC	AK090414		1p36.13	2010-07-08	2010-07-08	2010-07-08	ENSG00000215908	ENSG00000215908			28170	pseudogene	pseudogene			"""ciliary rootlet coiled-coil, rootletin-like 1"""	CROCCL1		12477932	Standard	NR_026752		Approved	MGC12760	uc001azf.3	Q86T23	OTTHUMG00000037884		1.37:g.16945227G>T		Somatic	0	8	0.00		0.599270127213081	31	27.91	12	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	17	26.09	Q8NF65|Q96FR5|Q9BRE8	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000412962.1	37	NULL		1																																																																																			-	-		0.373	CROCCP2-003	KNOWN	basic	lincRNA	CROCCP2	lincRNA	OTTHUMT00000092784.1	G	NR_026752.1	rs9728628		16945227	-1	no_errors	ENST00000412962	ensembl	human	known	74_37	rna	SNP	0.004	T
CLEC7A	64581	genome.wustl.edu	37	12	10280387	10280387	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr12:10280387C>T	ENST00000304084.8	-	2	315	c.161G>A	c.(160-162)tGc>tAc	p.C54Y	CLEC7A_ENST00000353231.5_Missense_Mutation_p.C54Y|CLEC7A_ENST00000310002.4_Missense_Mutation_p.C54Y|CLEC7A_ENST00000298523.5_Missense_Mutation_p.C54Y|CLEC7A_ENST00000525605.1_Missense_Mutation_p.C54Y|CLEC7A_ENST00000533022.1_Missense_Mutation_p.C54Y|CLEC7A_ENST00000396484.2_Intron	NM_197947.2	NP_922938.1	Q9BXN2	CLC7A_HUMAN	C-type lectin domain family 7, member A	54					carbohydrate mediated signaling (GO:0009756)|cell recognition (GO:0008037)|defense response to protozoan (GO:0042832)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|pattern recognition receptor signaling pathway (GO:0002221)|phagocytosis, recognition (GO:0006910)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|MHC protein binding (GO:0042287)|signaling pattern recognition receptor activity (GO:0008329)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(1)|upper_aerodigestive_tract(1)	7						TATTACCAAGCATAGGATTCC	0.453																																																	0								ENSG00000172243						51.0	47.0	48.0					12																	10280387		2203	4299	6502	CLEC7A	SO:0001583	missense	0			-	HGNC	AY009090	CCDS8613.1, CCDS8614.1, CCDS8617.1, CCDS41753.1, CCDS41754.1, CCDS53744.1	12p13.2-p12.3	2014-09-17		2005-02-09	ENSG00000172243	ENSG00000172243		"""C-type lectin domain containing"""	14558	protein-coding gene	gene with protein product		606264	"""C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 12"""	CLECSF12			Standard	XM_005253468		Approved	dectin-1, hDectin-1	uc001qxg.2	Q9BXN2	OTTHUMG00000133597	ENST00000304084.8:c.161G>A	12.37:g.10280387C>T	ENSP00000302569:p.Cys54Tyr	Somatic	0	52	0.00		0.599270127213081	34	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52	B2R861|B7Z494|B7Z5A9|B7Z5B9|Q6IPS7|Q96D32|Q96DR9|Q96LD3|Q96PA4|Q96PA5|Q96PA6|Q96PA7|Q96PA8|Q9H1K3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin,prints_AntifreezeII	p.C54Y	ENST00000304084.8	37	c.161	CCDS41753.1	12	.	.	.	.	.	.	.	.	.	.	C	9.819	1.185391	0.21870	.	.	ENSG00000172243	ENST00000353231;ENST00000298523;ENST00000304084;ENST00000533022;ENST00000310002;ENST00000525605	T;T;T;T	0.16196	2.36;2.36;3.14;3.14	4.1	2.19	0.27852	C-type lectin-like (1);	0.135973	0.34484	N	0.003923	T	0.39655	0.1086	M	0.81341	2.54	0.09310	N	1	D;D;D;D;D;P;D	0.76494	0.985;0.959;0.978;0.978;0.999;0.941;0.959	P;P;P;P;D;P;P	0.83275	0.785;0.758;0.756;0.773;0.996;0.635;0.675	T	0.11665	-1.0578	10	0.72032	D	0.01	.	9.5862	0.39517	0.3042:0.6958:0.0:0.0	.	54;54;54;54;54;54;54	Q96D32;Q9BXN2-6;Q9BXN2-4;Q9BXN2-3;Q9BXN2-7;Q9BXN2;Q9BXN2-2	.;.;.;.;.;CLC7A_HUMAN;.	Y	54	ENSP00000266456:C54Y;ENSP00000298523:C54Y;ENSP00000302569:C54Y;ENSP00000431461:C54Y	ENSP00000298523:C54Y	C	-	2	0	CLEC7A	10171654	0.158000	0.22850	0.017000	0.16124	0.119000	0.20118	0.805000	0.27112	0.632000	0.30432	0.591000	0.81541	TGC	-	NULL		0.453	CLEC7A-013	KNOWN	basic|appris_principal|CCDS	protein_coding	CLEC7A	protein_coding	OTTHUMT00000390772.1	C	NM_197954	-		10280387	-1	no_errors	ENST00000304084	ensembl	human	known	74_37	missense	SNP	0.022	T
WNT5A	7474	genome.wustl.edu	37	3	55514826	55514826	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr3:55514826C>T	ENST00000474267.1	-	3	648	c.127G>A	c.(127-129)Gcc>Acc	p.A43T	WNT5A_ENST00000497027.1_Missense_Mutation_p.A28T|WNT5A_ENST00000264634.4_Missense_Mutation_p.A43T			P41221	WNT5A_HUMAN	wingless-type MMTV integration site family, member 5A	43					activation of JUN kinase activity (GO:0007257)|activation of MAPK activity (GO:0000187)|activation of protein kinase B activity (GO:0032148)|ameboidal cell migration (GO:0001667)|anterior/posterior axis specification, embryo (GO:0008595)|axon guidance (GO:0007411)|canonical Wnt signaling pathway (GO:0060070)|cartilage development (GO:0051216)|cell fate commitment (GO:0045165)|cellular protein localization (GO:0034613)|cellular response to calcium ion (GO:0071277)|cellular response to interferon-gamma (GO:0071346)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cervix development (GO:0060067)|cochlea morphogenesis (GO:0090103)|convergent extension involved in organogenesis (GO:0060029)|dopaminergic neuron differentiation (GO:0071542)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system development (GO:0048706)|epithelial cell proliferation involved in mammary gland duct elongation (GO:0060750)|epithelial to mesenchymal transition (GO:0001837)|establishment of planar polarity (GO:0001736)|face development (GO:0060324)|genitalia development (GO:0048806)|heart looping (GO:0001947)|hematopoietic stem cell proliferation (GO:0071425)|hindgut morphogenesis (GO:0007442)|hypophysis morphogenesis (GO:0048850)|keratinocyte differentiation (GO:0030216)|lateral sprouting involved in mammary gland duct morphogenesis (GO:0060599)|lens development in camera-type eye (GO:0002088)|lung development (GO:0030324)|male gonad development (GO:0008584)|mammary gland branching involved in thelarche (GO:0060744)|mesenchymal-epithelial cell signaling (GO:0060638)|midgut development (GO:0007494)|negative chemotaxis (GO:0050919)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of mesenchymal cell proliferation (GO:0072201)|negative regulation of prostatic bud formation (GO:0060686)|negative regulation of synapse assembly (GO:0051964)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|neuron differentiation (GO:0030182)|non-canonical Wnt signaling pathway via JNK cascade (GO:0038031)|olfactory bulb interneuron development (GO:0021891)|optic cup formation involved in camera-type eye development (GO:0003408)|palate development (GO:0060021)|planar cell polarity pathway involved in cardiac muscle tissue morphogenesis (GO:0061350)|planar cell polarity pathway involved in cardiac right atrium morphogenesis (GO:0061349)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar cell polarity pathway involved in outflow tract morphogenesis (GO:0061347)|planar cell polarity pathway involved in pericardium morphogenesis (GO:0061354)|planar cell polarity pathway involved in ventricular septum morphogenesis (GO:0061348)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cartilage development (GO:0061036)|positive regulation of cell-cell adhesion mediated by cadherin (GO:2000049)|positive regulation of cGMP metabolic process (GO:0030825)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of cytokine secretion involved in immune response (GO:0002741)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 secretion (GO:2000484)|positive regulation of JNK cascade (GO:0046330)|positive regulation of macrophage activation (GO:0043032)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of meiosis (GO:0045836)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of ossification (GO:0045778)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of response to cytokine stimulus (GO:0060760)|positive regulation of T cell chemotaxis (GO:0010820)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|post-anal tail morphogenesis (GO:0036342)|primitive streak formation (GO:0090009)|protein phosphorylation (GO:0006468)|regulation of branching involved in mammary gland duct morphogenesis (GO:0060762)|response to organic substance (GO:0010033)|somitogenesis (GO:0001756)|type B pancreatic cell development (GO:0003323)|urinary bladder development (GO:0060157)|uterus development (GO:0060065)|vagina development (GO:0060068)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)|wound healing (GO:0042060)	cell surface (GO:0009986)|clathrin-coated endocytic vesicle membrane (GO:0030669)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)|receptor tyrosine kinase-like orphan receptor binding (GO:0005115)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|endometrium(1)|large_intestine(4)|lung(3)|prostate(2)|urinary_tract(1)	13				KIRC - Kidney renal clear cell carcinoma(284;0.00377)|Kidney(284;0.00408)|OV - Ovarian serous cystadenocarcinoma(275;0.204)		CAAGAATTGGCTTCAATTACA	0.413																																																	0								ENSG00000114251						56.0	55.0	55.0					3																	55514826		1867	4106	5973	WNT5A	SO:0001583	missense	0			-	HGNC	L20861	CCDS46850.1, CCDS58835.1	3p21-p14	2013-02-28			ENSG00000114251	ENSG00000114251		"""Wingless-type MMTV integration sites"", ""Endogenous ligands"""	12784	protein-coding gene	gene with protein product	"""WNT-5A protein"""	164975				8288227	Standard	NM_001256105		Approved	hWNT5A	uc010hmw.4	P41221	OTTHUMG00000158361	ENST00000474267.1:c.127G>A	3.37:g.55514826C>T	ENSP00000417310:p.Ala43Thr	Somatic	0	46	0.00		0.599270127213081	7	80.56	29	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	25	46.94	A8K4A4|Q6P278	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Wnt,smart_Wnt,prints_Wnt	p.A43T	ENST00000474267.1	37	c.127	CCDS46850.1	3	.	.	.	.	.	.	.	.	.	.	C	14.30	2.494264	0.44352	.	.	ENSG00000114251	ENST00000474267;ENST00000264634;ENST00000497027;ENST00000442038;ENST00000482079	T;T;T;D	0.84660	-1.01;-1.01;-1.0;-1.88	5.91	5.91	0.95273	.	0.843002	0.10102	N	0.715819	D	0.84106	0.5399	L	0.43152	1.355	0.48087	D	0.999587	B	0.15141	0.012	B	0.14578	0.011	T	0.72516	-0.4269	10	0.45353	T	0.12	.	20.2985	0.98592	0.0:1.0:0.0:0.0	.	43	P41221	WNT5A_HUMAN	T	43;43;28;43;28	ENSP00000417310:A43T;ENSP00000264634:A43T;ENSP00000420104:A28T;ENSP00000418184:A28T	ENSP00000264634:A43T	A	-	1	0	WNT5A	55489866	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.109000	0.57824	2.793000	0.96121	0.655000	0.94253	GCC	-	NULL		0.413	WNT5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WNT5A	protein_coding	OTTHUMT00000350793.3	C	NM_003392	-		55514826	-1	no_errors	ENST00000264634	ensembl	human	known	74_37	missense	SNP	1.000	T
B3GNT2	10678	genome.wustl.edu	37	2	62449968	62449968	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr2:62449968C>T	ENST00000301998.4	+	2	865	c.613C>T	c.(613-615)Cac>Tac	p.H205Y	B3GNT2_ENST00000405767.1_Missense_Mutation_p.H205Y	NM_006577.5	NP_006568.2	Q9NY97	B3GN2_HUMAN	UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2	205					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|sensory perception of smell (GO:0007608)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	galactosyltransferase activity (GO:0008378)	p.H205Y(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|pancreas(1)	18	Lung NSC(7;0.031)|all_lung(7;0.0634)		LUSC - Lung squamous cell carcinoma(7;3.55e-06)|Epithelial(17;0.0963)			GAGTGAGAAGCACCAAGACAT	0.502																																																	1	Substitution - Missense(1)	pancreas(1)						ENSG00000170340						66.0	61.0	63.0					2																	62449968		2203	4300	6503	B3GNT2	SO:0001583	missense	0			-	HGNC	AB049584	CCDS1870.1	2p15	2013-02-19	2006-04-12	2006-04-12	ENSG00000170340	ENSG00000170340		"""Beta 3-glycosyltransferases"""	15629	protein-coding gene	gene with protein product		605581	"""UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 1"""	B3GNT1		9892646, 11042166	Standard	NM_006577		Approved	B3GNT-2, BETA3GNT, B3GN-T2, B3GN-T1	uc002sbs.3	Q9NY97	OTTHUMG00000129444	ENST00000301998.4:c.613C>T	2.37:g.62449968C>T	ENSP00000305595:p.His205Tyr	Somatic	0	29	0.00		0.599270127213081	9	65.38	17	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	26	38.10	Q54AC1|Q9NQQ9|Q9NQR0|Q9NUT9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Glyco_trans_31	p.H205Y	ENST00000301998.4	37	c.613	CCDS1870.1	2	.	.	.	.	.	.	.	.	.	.	C	9.941	1.217579	0.22373	.	.	ENSG00000170340	ENST00000301998;ENST00000405767	T;T	0.30714	1.52;1.52	5.74	4.86	0.63082	.	0.044035	0.85682	D	0.000000	T	0.16471	0.0396	N	0.12853	0.265	0.80722	D	1	B	0.18013	0.025	B	0.22880	0.042	T	0.04708	-1.0932	10	0.02654	T	1	.	15.1674	0.72840	0.0:0.9314:0.0:0.0686	.	205	Q9NY97	B3GN2_HUMAN	Y	205	ENSP00000305595:H205Y;ENSP00000384692:H205Y	ENSP00000305595:H205Y	H	+	1	0	B3GNT2	62303472	0.998000	0.40836	1.000000	0.80357	0.996000	0.88848	3.894000	0.56250	2.712000	0.92718	0.650000	0.86243	CAC	-	pfam_Glyco_trans_31		0.502	B3GNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	B3GNT2	protein_coding	OTTHUMT00000251606.2	C	NM_006577	-		62449968	+1	no_errors	ENST00000301998	ensembl	human	known	74_37	missense	SNP	1.000	T
DUXAP8	503637	genome.wustl.edu	37	22	16151010	16151010	+	RNA	SNP	T	T	C	rs8137415		TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr22:16151010T>C	ENST00000447898.1	-	0	1104																											AGTTGTTCTCTGGAATCAATC	0.393																																																	0								ENSG00000206195																																			AP000525.9			0			-	Clone_based_vega_gene																													22.37:g.16151010T>C		Somatic	0	9	0.00		0.599270127213081	6	40.00	4	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	7	36.36		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000447898.1	37	NULL		22																																																																																			-	-		0.393	AP000525.9-002	KNOWN	basic	lincRNA	ENSG00000206195	processed_transcript	OTTHUMT00000276780.1	T		-		16151010	-1	no_errors	ENST00000413768	ensembl	human	known	74_37	rna	SNP	0.448	C
DUOX2	50506	genome.wustl.edu	37	15	45404811	45404811	+	Missense_Mutation	SNP	G	G	T			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr15:45404811G>T	ENST00000603300.1	-	4	468	c.266C>A	c.(265-267)aCg>aAg	p.T89K	DUOXA2_ENST00000323030.5_5'Flank|DUOX2_ENST00000389039.6_Missense_Mutation_p.T89K	NM_014080.4	NP_054799.4	Q9NRD8	DUOX2_HUMAN	dual oxidase 2	89	Peroxidase-like; mediates peroxidase activity. {ECO:0000250}.				adenohypophysis morphogenesis (GO:0048855)|bone mineralization (GO:0030282)|cuticle development (GO:0042335)|cytokine-mediated signaling pathway (GO:0019221)|fertilization (GO:0009566)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|inner ear development (GO:0048839)|multicellular organism growth (GO:0035264)|oxidation-reduction process (GO:0055114)|response to cAMP (GO:0051591)|response to virus (GO:0009615)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|NAD(P)H oxidase activity (GO:0016174)|peroxidase activity (GO:0004601)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(28)|ovary(3)|pancreas(1)|prostate(4)|skin(7)|urinary_tract(1)	63		all_cancers(109;3.79e-11)|all_epithelial(112;2.92e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;1.05e-18)|GBM - Glioblastoma multiforme(94;4.23e-07)|COAD - Colon adenocarcinoma(120;0.0668)|Colorectal(133;0.068)		TATGCCCCGCGTGGCTGCGTT	0.672																																																	0								ENSG00000140279						27.0	30.0	29.0					15																	45404811		2191	4277	6468	DUOX2	SO:0001583	missense	0			-	HGNC	AF181972	CCDS10117.1	15q15.3-q21	2013-01-10			ENSG00000140279	ENSG00000140279		"""EF-hand domain containing"""	13273	protein-coding gene	gene with protein product	"""dual oxidase-like domains 2"", ""nicotinamide adenine dinucleotide phosphate oxidase"", ""flavoprotein NADPH oxidase"", ""NADPH thyroid oxidase 2"", ""NADH/NADPH thyroid oxidase p138-tox"", ""NADPH oxidase/peroxidase DUOX2"""	606759				10601291, 10806195	Standard	NM_014080		Approved	P138-TOX, P138(TOX), THOX2, LNOX2	uc010bea.3	Q9NRD8	OTTHUMG00000131355	ENST00000603300.1:c.266C>A	15.37:g.45404811G>T	ENSP00000475084:p.Thr89Lys	Somatic	0	56	0.00		0.599270127213081	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70	A8MQ13|D2XI64|Q9NR02|Q9UHF9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Haem_peroxidase_animal,pfam_Fe_red_NAD-bd_6,pfam_FAD-bd_8,pfam_Fe3_Rdtase_TM_dom,pfam_EF_hand_dom,superfamily_Haem_peroxidase,superfamily_Riboflavin_synthase-like_b-brl,smart_EF_hand_dom,pfscan_EF_hand_dom,pfscan_Haem_peroxidase_animal,prints_Haem_peroxidase_animal_subgr,prints_Recoverin	p.T89K	ENST00000603300.1	37	c.266	CCDS10117.1	15	.	.	.	.	.	.	.	.	.	.	G	12.05	1.822498	0.32237	.	.	ENSG00000140279	ENST00000389039	.	.	.	5.84	-4.17	0.03857	.	0.599472	0.18704	N	0.133484	T	0.41166	0.1147	L	0.56769	1.78	0.09310	N	1	B	0.28208	0.203	B	0.34093	0.175	T	0.45440	-0.9261	9	0.54805	T	0.06	-0.0516	10.917	0.47142	0.198:0.0925:0.7095:0.0	.	89	Q9NRD8	DUOX2_HUMAN	K	89	.	ENSP00000373691:T89K	T	-	2	0	DUOX2	43192103	0.001000	0.12720	0.000000	0.03702	0.006000	0.05464	0.039000	0.13884	-0.650000	0.05423	0.561000	0.74099	ACG	-	pfam_Haem_peroxidase_animal,superfamily_Haem_peroxidase,pfscan_Haem_peroxidase_animal		0.672	DUOX2-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DUOX2	protein_coding		G	NM_014080	-		45404811	-1	no_errors	ENST00000389039	ensembl	human	known	74_37	missense	SNP	0.000	T
PHF21B	112885	genome.wustl.edu	37	22	45312449	45312449	+	Missense_Mutation	SNP	G	G	T			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr22:45312449G>T	ENST00000313237.5	-	4	425	c.275C>A	c.(274-276)cCc>cAc	p.P92H	PHF21B_ENST00000396103.3_Missense_Mutation_p.P92H|PHF21B_ENST00000447824.3_Missense_Mutation_p.P80H|PHF21B_ENST00000404079.2_Missense_Mutation_p.P80H|PHF21B_ENST00000403565.1_5'UTR	NM_138415.4	NP_612424.1	Q96EK2	PF21B_HUMAN	PHD finger protein 21B	92							zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(14)|ovary(2)|prostate(1)|skin(2)	25		all_neural(38;0.00802)|Glioma(61;0.0353)|Ovarian(80;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0203)		GGGCTGCTTGGGTGGCCGGTC	0.637																																																	0								ENSG00000056487						41.0	47.0	45.0					22																	45312449		2203	4300	6503	PHF21B	SO:0001583	missense	0			-	HGNC	AK091480	CCDS14061.1, CCDS56234.1, CCDS63504.1	22q13.31	2013-01-28			ENSG00000056487	ENSG00000056487		"""Zinc fingers, PHD-type"""	25161	protein-coding gene	gene with protein product			"""PHD finger protein 4"""	PHF4		12477932	Standard	NM_138415		Approved	BHC80L, FLJ34161	uc011aql.2	Q96EK2	OTTHUMG00000151199	ENST00000313237.5:c.275C>A	22.37:g.45312449G>T	ENSP00000324403:p.Pro92His	Somatic	0	84	0.00		0.599270127213081	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	41	85	32.54	B0QYW3|B0QYW4|B3KRU4|B7Z4F8|Q5TFL2|Q6ICC0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.P92H	ENST00000313237.5	37	c.275	CCDS14061.1	22	.	.	.	.	.	.	.	.	.	.	G	23.2	4.382996	0.82792	.	.	ENSG00000056487	ENST00000313237;ENST00000396103;ENST00000404079;ENST00000447824;ENST00000420689	T;T;T;T;T	0.21361	2.01;2.01;2.01;2.01;2.01	5.06	5.06	0.68205	.	0.332745	0.25219	N	0.032248	T	0.36663	0.0975	L	0.40543	1.245	0.36206	D	0.851037	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;P;P	0.68621	0.919;0.959;0.903;0.885	T	0.22382	-1.0218	10	0.21540	T	0.41	-6.2259	18.4696	0.90767	0.0:0.0:1.0:0.0	.	80;92;80;92	B7Z657;Q96EK2-3;B7Z4F8;Q96EK2	.;.;.;PF21B_HUMAN	H	92;92;80;80;80	ENSP00000324403:P92H;ENSP00000379410:P92H;ENSP00000385105:P80H;ENSP00000388619:P80H;ENSP00000401294:P80H	ENSP00000324403:P92H	P	-	2	0	PHF21B	43691113	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.575000	0.74018	2.346000	0.79739	0.655000	0.94253	CCC	-	NULL		0.637	PHF21B-001	KNOWN	basic|CCDS	protein_coding	PHF21B	protein_coding	OTTHUMT00000321731.2	G	NM_138415	-		45312449	-1	no_errors	ENST00000313237	ensembl	human	known	74_37	missense	SNP	1.000	T
PTPRU	10076	genome.wustl.edu	37	1	29602104	29602104	+	Missense_Mutation	SNP	G	G	C			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr1:29602104G>C	ENST00000345512.3	+	8	1418	c.1289G>C	c.(1288-1290)aGc>aCc	p.S430T	PTPRU_ENST00000428026.2_Missense_Mutation_p.S430T|PTPRU_ENST00000373779.3_Missense_Mutation_p.S430T|PTPRU_ENST00000356870.3_Missense_Mutation_p.S430T|PTPRU_ENST00000323874.8_Missense_Mutation_p.S430T|PTPRU_ENST00000460170.2_Missense_Mutation_p.S430T	NM_005704.4	NP_005695.3	Q92729	PTPRU_HUMAN	protein tyrosine phosphatase, receptor type, U	430	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				canonical Wnt signaling pathway (GO:0060070)|cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|homotypic cell-cell adhesion (GO:0034109)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|organ regeneration (GO:0031100)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|protein localization to cell surface (GO:0034394)|response to glucocorticoid (GO:0051384)|single organismal cell-cell adhesion (GO:0016337)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cell-cell junction (GO:0005911)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(4)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(26)|ovary(1)|prostate(3)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	79		Colorectal(325;0.000399)|Lung NSC(340;0.00953)|all_lung(284;0.0112)|Breast(348;0.0126)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;6.99e-07)|COAD - Colon adenocarcinoma(152;3.18e-05)|STAD - Stomach adenocarcinoma(196;0.0234)|READ - Rectum adenocarcinoma(331;0.0686)|BRCA - Breast invasive adenocarcinoma(304;0.0871)		CTGGGCAGCAGCCACAACCAG	0.577																																																	0								ENSG00000060656						147.0	124.0	132.0					1																	29602104		2203	4300	6503	PTPRU	SO:0001583	missense	0			-	HGNC	U71075	CCDS334.1, CCDS335.1, CCDS44098.1, CCDS44098.2, CCDS53290.1	1p35.3	2013-02-11			ENSG00000060656	ENSG00000060656		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9683	protein-coding gene	gene with protein product	"""pi R-PTP-Psi"""	602454				8700514, 9434160	Standard	NM_133178		Approved	PTPRO, hPTP-J, PCP-2, FMI, PTP	uc001bru.3	Q92729	OTTHUMG00000003699	ENST00000345512.3:c.1289G>C	1.37:g.29602104G>C	ENSP00000334941:p.Ser430Thr	Somatic	0	45	0.00		0.599270127213081	2	80.00	8	WXS	Illumina HiSeq 2500	Phase_IV	tier1	46	14	76.67	A6H8L1|O00197|P78399|Q59HA4|Q5SYU4|Q5SYU5|Q92735|Q92850	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_MAM_dom,pfam_Fibronectin_type3,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_MAM_dom,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_MAM_dom,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt,prints_MAM_dom	p.S430T	ENST00000345512.3	37	c.1289	CCDS334.1	1	.	.	.	.	.	.	.	.	.	.	G	12.25	1.882549	0.33255	.	.	ENSG00000060656	ENST00000345512;ENST00000373779;ENST00000356870;ENST00000323874;ENST00000428026;ENST00000460170	T;T;T;T;T;T	0.33438	1.45;1.47;1.47;1.47;1.41;1.47	5.4	5.4	0.78164	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.057547	0.64402	D	0.000001	T	0.23611	0.0571	N	0.22421	0.69	0.40185	D	0.977337	B;B;B;B;B	0.13145	0.007;0.007;0.007;0.004;0.004	B;B;B;B;B	0.16289	0.015;0.015;0.015;0.007;0.007	T	0.05818	-1.0862	9	.	.	.	.	18.5309	0.90992	0.0:0.0:1.0:0.0	.	430;430;430;430;430	Q92729-3;Q92729-4;Q92729-2;E9PH42;Q92729	.;.;.;.;PTPRU_HUMAN	T	430	ENSP00000334941:S430T;ENSP00000362884:S430T;ENSP00000349333:S430T;ENSP00000314987:S430T;ENSP00000392332:S430T;ENSP00000432906:S430T	.	S	+	2	0	PTPRU	29474691	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	5.667000	0.68067	2.695000	0.91970	0.643000	0.83706	AGC	-	superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.577	PTPRU-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRU	protein_coding	OTTHUMT00000010447.1	G		-		29602104	+1	no_errors	ENST00000345512	ensembl	human	known	74_37	missense	SNP	1.000	C
DBN1	1627	genome.wustl.edu	37	5	176887695	176887695	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr5:176887695G>A	ENST00000309007.5	-	9	1000	c.781C>T	c.(781-783)Cgg>Tgg	p.R261W	DBN1_ENST00000292385.5_Missense_Mutation_p.R263W|DBN1_ENST00000393565.1_Missense_Mutation_p.R261W|DBN1_ENST00000393563.4_5'UTR|DBN1_ENST00000512501.1_5'UTR	NM_004395.3	NP_004386	Q16643	DREB_HUMAN	drebrin 1	261					actin filament organization (GO:0007015)|cell communication by chemical coupling (GO:0010643)|cell communication by electrical coupling (GO:0010644)|maintenance of protein location in cell (GO:0032507)|neural precursor cell proliferation (GO:0061351)|regulation of dendrite development (GO:0050773)|regulation of neuronal synaptic plasticity (GO:0048168)	actin cytoskeleton (GO:0015629)|actomyosin (GO:0042641)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|gap junction (GO:0005921)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|profilin binding (GO:0005522)			breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(1)|lung(12)|ovary(1)|skin(2)	25	all_cancers(89;2.17e-05)|Renal(175;0.000269)|Lung NSC(126;0.0014)|all_lung(126;0.0025)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TCCTCATCCCGATGGTCACCC	0.517																																																	0								ENSG00000113758						125.0	101.0	109.0					5																	176887695		2203	4300	6503	DBN1	SO:0001583	missense	0			-	HGNC		CCDS4420.1, CCDS4421.1	5q35.3	2008-02-05			ENSG00000113758	ENSG00000113758			2695	protein-coding gene	gene with protein product		126660		D0S117E		8216329	Standard	NM_004395		Approved		uc003mgy.2	Q16643	OTTHUMG00000130856	ENST00000309007.5:c.781C>T	5.37:g.176887695G>A	ENSP00000308532:p.Arg261Trp	Somatic	0	67	0.00		0.599270127213081	101	55.46	127	WXS	Illumina HiSeq 2500	Phase_IV	tier1	28	38	42.42	A8MV58|B2RBG0|Q9UFZ5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Actin-bd_cofilin/tropomyosin,smart_Actin-bd_cofilin/tropomyosin	p.R263W	ENST00000309007.5	37	c.787	CCDS4420.1	5	.	.	.	.	.	.	.	.	.	.	G	18.63	3.664979	0.67700	.	.	ENSG00000113758	ENST00000309007;ENST00000292385;ENST00000393565;ENST00000477391	T;T;T	0.44083	0.93;0.93;1.49	5.07	3.21	0.36854	.	0.844856	0.10589	N	0.657007	T	0.49864	0.1582	L	0.39898	1.24	0.80722	D	1	D;D;D;D	0.76494	0.999;0.999;0.991;0.995	P;P;P;P	0.56700	0.804;0.724;0.549;0.629	T	0.38650	-0.9651	10	0.87932	D	0	-4.6837	11.9559	0.52981	0.0:0.0:0.5455:0.4545	.	211;261;261;263	B3KSQ7;A8MV58;Q16643;Q16643-2	.;.;DREB_HUMAN;.	W	261;263;261;260	ENSP00000308532:R261W;ENSP00000292385:R263W;ENSP00000377195:R261W	ENSP00000292385:R263W	R	-	1	2	DBN1	176820301	0.090000	0.21635	0.995000	0.50966	0.982000	0.71751	0.891000	0.28309	0.483000	0.27608	0.561000	0.74099	CGG	-	NULL		0.517	DBN1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DBN1	protein_coding	OTTHUMT00000253429.2	G	NM_080881	-		176887695	-1	no_errors	ENST00000292385	ensembl	human	known	74_37	missense	SNP	0.985	A
FER1L4	80307	genome.wustl.edu	37	20	34171885	34171885	+	RNA	SNP	A	A	G			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr20:34171885A>G	ENST00000430275.2	-	0	2923							A9Z1Z3	FR1L4_HUMAN	fer-1-like family member 4, pseudogene (functional)							integral component of membrane (GO:0016021)											GCTGGAGGGCAGCCCGGCTGA	0.682																																																	0								ENSG00000088340																																			FER1L4			0			-	HGNC	AL121586		20q11.23	2014-09-11	2014-06-27		ENSG00000088340	ENSG00000088340		"""-"""	15801	pseudogene	pseudogene			"""fer-1-like 4 (C. elegans)"", ""fer-1-like 4 (C. elegans), pseudogene (functional)"""	C20orf124		24063685, 24961353	Standard	XR_425236		Approved	bA563A22B.1, dJ309K20.1	uc002xcx.3	A9Z1Z3	OTTHUMG00000032354		20.37:g.34171885A>G		Somatic	0	47	0.00		0.599270127213081	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	34	17.07	Q9GZQ9|Q9H646|Q9H8L7	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000430275.2	37	NULL		20																																																																																			-	-		0.682	FER1L4-016	KNOWN	basic	processed_transcript	FER1L4	pseudogene	OTTHUMT00000443297.1	A	NR_024377	-		34171885	-1	no_errors	ENST00000430275	ensembl	human	known	74_37	rna	SNP	0.482	G
LRG1	116844	genome.wustl.edu	37	19	4538518	4538518	+	Missense_Mutation	SNP	G	G	C			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr19:4538518G>C	ENST00000306390.6	-	2	938	c.478C>G	c.(478-480)Cta>Gta	p.L160V	CTB-50L17.14_ENST00000586020.1_Intron|LRG1_ENST00000586883.1_5'UTR	NM_052972.2	NP_443204.1	P02750	A2GL_HUMAN	leucine-rich alpha-2-glycoprotein 1	160					brown fat cell differentiation (GO:0050873)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)				NS(1)|endometrium(2)|large_intestine(4)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	13		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0148)|STAD - Stomach adenocarcinoma(1328;0.18)		AGGCCGTGTAGCCACGAGACC	0.662																																																	0								ENSG00000171236						53.0	59.0	57.0					19																	4538518		2203	4300	6503	LRG1	SO:0001583	missense	0			-	HGNC		CCDS12130.1	19p13.3	2013-09-20			ENSG00000171236	ENSG00000171236			29480	protein-coding gene	gene with protein product	"""leucine rich alpha 2 glycoprotein"""	611289				3856868, 12223515	Standard	NM_052972		Approved	LRG	uc002mau.3	P02750	OTTHUMG00000182010	ENST00000306390.6:c.478C>G	19.37:g.4538518G>C	ENSP00000302621:p.Leu160Val	Somatic	0	60	0.00		0.599270127213081	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	76	15.56	Q8N4F5|Q96QZ4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.L160V	ENST00000306390.6	37	c.478	CCDS12130.1	19	.	.	.	.	.	.	.	.	.	.	.	11.24	1.579411	0.28180	.	.	ENSG00000171236	ENST00000306390;ENST00000538589	T	0.61742	0.08	4.71	4.71	0.59529	.	0.000000	0.32769	N	0.005663	T	0.73032	0.3535	M	0.73962	2.25	0.18873	N	0.999988	D	0.59767	0.986	D	0.66716	0.946	T	0.66073	-0.6014	10	0.66056	D	0.02	-18.1772	13.0078	0.58715	0.0:0.0:1.0:0.0	.	160	P02750	A2GL_HUMAN	V	160;143	ENSP00000302621:L160V	ENSP00000302621:L160V	L	-	1	2	LRG1	4489518	1.000000	0.71417	0.987000	0.45799	0.058000	0.15608	4.161000	0.58170	2.446000	0.82766	0.655000	0.94253	CTA	-	NULL		0.662	LRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRG1	protein_coding	OTTHUMT00000458654.2	G	NM_052972	-		4538518	-1	no_errors	ENST00000306390	ensembl	human	known	74_37	missense	SNP	0.324	C
SYNDIG1L	646658	genome.wustl.edu	37	14	74876371	74876371	+	Missense_Mutation	SNP	G	G	A	rs367970781		TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr14:74876371G>A	ENST00000554823.1	-	1	138	c.77C>T	c.(76-78)cCg>cTg	p.P26L	SYNDIG1L_ENST00000331628.3_Missense_Mutation_p.P26L			A6NDD5	SYN1L_HUMAN	synapse differentiation inducing 1-like	26					response to biotic stimulus (GO:0009607)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(1)|lung(8)|pancreas(1)|prostate(1)|skin(1)	14						TGGGGTCTCCGGGTAGGGATA	0.657																																																	0								ENSG00000183379	G	LEU/PRO	0,3876		0,0,1938	37.0	42.0	40.0		77	2.4	0.5	14		40	1,8275		0,1,4137	no	missense	SYNDIG1L	NM_001105579.1	98	0,1,6075	AA,AG,GG		0.0121,0.0,0.0082	benign	26/239	74876371	1,12151	1938	4138	6076	SYNDIG1L	SO:0001583	missense	0			-	HGNC		CCDS41970.1	14q24.3	2011-06-30	2011-06-30	2011-06-30		ENSG00000183379			32388	protein-coding gene	gene with protein product	"""caudate-and putamen-enriched sequence"", ""interferon induced transmembrane protein domain containing 4"""	609999	"""transmembrane protein 90A"""	TMEM90A		16359841	Standard	NM_001105579		Approved	capucin, IFITMD4	uc001xpx.2	A6NDD5		ENST00000554823.1:c.77C>T	14.37:g.74876371G>A	ENSP00000450439:p.Pro26Leu	Somatic	0	36	0.00		0.599270127213081	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	54	16.92		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_CD225/Dispanin_fam	p.P26L	ENST00000554823.1	37	c.77	CCDS41970.1	14	.	.	.	.	.	.	.	.	.	.	G	1.701	-0.501463	0.04261	0.0	1.21E-4	ENSG00000183379	ENST00000331628;ENST00000554823;ENST00000554953	D;D	0.95001	-3.58;-3.58	4.44	2.42	0.29668	.	0.438428	0.23197	N	0.050839	D	0.84138	0.5406	N	0.22421	0.69	0.18873	N	0.999983	P	0.38745	0.645	B	0.22880	0.042	T	0.75722	-0.3218	10	0.28530	T	0.3	-12.0407	6.6672	0.23047	0.0:0.2835:0.4563:0.2603	.	26	A6NDD5	SYN1L_HUMAN	L	26	ENSP00000331474:P26L;ENSP00000450439:P26L	ENSP00000331474:P26L	P	-	2	0	SYNDIG1L	73946124	0.489000	0.26004	0.456000	0.27044	0.001000	0.01503	0.788000	0.26872	1.082000	0.41137	-0.463000	0.05309	CCG	-	NULL		0.657	SYNDIG1L-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SYNDIG1L	protein_coding	OTTHUMT00000412341.1	G	XM_938515	-		74876371	-1	no_errors	ENST00000331628	ensembl	human	known	74_37	missense	SNP	0.047	A
ANK1	286	genome.wustl.edu	37	8	41519417	41519417	+	Missense_Mutation	SNP	C	C	T	rs143987736		TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr8:41519417C>T	ENST00000347528.4	-	41	5604	c.5521G>A	c.(5521-5523)Gat>Aat	p.D1841N	ANK1_ENST00000379758.2_Intron|RP11-930P14.1_ENST00000520418.1_RNA|ANK1_ENST00000457297.1_Intron|ANK1_ENST00000522231.1_Missense_Mutation_p.D116N|ANK1_ENST00000396945.1_Intron|ANK1_ENST00000289734.7_Missense_Mutation_p.D1841N|RP11-930P14.1_ENST00000585088.1_RNA|ANK1_ENST00000396942.1_Missense_Mutation_p.D1841N|ANK1_ENST00000522543.1_Missense_Mutation_p.D116N|RP11-930P14.1_ENST00000522388.1_RNA|ANK1_ENST00000352337.4_Intron|MIR486_ENST00000408108.1_RNA|ANK1_ENST00000314214.8_Missense_Mutation_p.D116N|ANK1_ENST00000265709.8_Missense_Mutation_p.D1882N	NM_020475.2|NM_020476.2|NM_020477.2	NP_065208.2|NP_065209.2|NP_065210.2	P16157	ANK1_HUMAN	ankyrin 1, erythrocytic	1841	55 kDa regulatory domain.				axon guidance (GO:0007411)|cytoskeleton organization (GO:0007010)|ER to Golgi vesicle-mediated transport (GO:0006888)|erythrocyte development (GO:0048821)|exocytosis (GO:0006887)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|monovalent inorganic cation transport (GO:0015672)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of organelle organization (GO:0010638)|protein targeting to plasma membrane (GO:0072661)|signal transduction (GO:0007165)	axolemma (GO:0030673)|basolateral plasma membrane (GO:0016323)|cortical cytoskeleton (GO:0030863)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|M band (GO:0031430)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|cytoskeletal adaptor activity (GO:0008093)|enzyme binding (GO:0019899)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			breast(5)|central_nervous_system(4)|endometrium(9)|kidney(1)|large_intestine(26)|lung(62)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	122	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			TGGGCGGCATCGGCGCTGGAC	0.572																																																	0								ENSG00000029534	C	ASN/ASP,ASN/ASP,ASN/ASP,ASN/ASP,ASN/ASP,ASN/ASP,ASN/ASP,	0,4406		0,0,2203	50.0	54.0	53.0		5521,346,5644,5521,5521,5035,346,	2.6	0.0	8	dbSNP_134	53	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense,missense,missense,missense,intron	ANK1	NM_000037.3,NM_001142445.1,NM_001142446.1,NM_020475.2,NM_020476.2,NM_020477.2,NM_020478.4,NM_020480.4	23,23,23,23,23,23,23,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging,	1841/1881,116/157,1882/1898,1841/1857,1841/1882,1679/1720,116/156,	41519417	1,13005	2203	4300	6503	ANK1	SO:0001583	missense	0			-	HGNC	M28880	CCDS6119.1, CCDS6121.1, CCDS6122.1, CCDS47849.1, CCDS55227.1	8p11.21	2013-01-10			ENSG00000029534	ENSG00000029534		"""Ankyrin repeat domain containing"""	492	protein-coding gene	gene with protein product		612641		ANK		1689849	Standard	NM_001142445		Approved	SPH1	uc003xom.3	P16157	OTTHUMG00000150281	ENST00000347528.4:c.5521G>A	8.37:g.41519417C>T	ENSP00000339620:p.Asp1841Asn	Somatic	0	49	0.00		0.599270127213081	7	22.22	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	61	14.08	A0PJN8|A6NJ23|E5RFL7|O43400|Q13768|Q53ER1|Q59FP2|Q8N604|Q99407	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ankyrin_rpt,pfam_ZU5,pfam_Death_domain,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like_dom,smart_Ankyrin_rpt,smart_ZU5,smart_Death_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death_domain,pfscan_ZU5,prints_Ankyrin_rpt	p.D1841N	ENST00000347528.4	37	c.5521	CCDS6119.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	2.964|2.964	-0.213985|-0.213985	0.06101|0.06101	0.0|0.0	1.16E-4|1.16E-4	ENSG00000029534|ENSG00000029534	ENST00000347528;ENST00000289734;ENST00000396942;ENST00000522231;ENST00000522543;ENST00000314214;ENST00000265709|ENST00000520299	T;T;T;D;D;D;T|.	0.88201|.	-0.26;-0.29;-0.25;-1.82;-2.24;-2.35;-0.2|.	5.42|5.42	2.57|2.57	0.30868|0.30868	.|.	1.133750|.	0.06697|.	N|.	0.770743|.	T|T	0.32763|0.32763	0.0840|0.0840	L|L	0.29908|0.29908	0.895|0.895	0.09310|0.09310	N|N	1|1	D;P;B;B;B;B;B;P;P|.	0.54397|.	0.966;0.549;0.0;0.079;0.324;0.201;0.003;0.893;0.928|.	P;B;B;B;B;B;B;B;P|.	0.47603|.	0.481;0.073;0.001;0.015;0.038;0.057;0.001;0.386;0.551|.	T|T	0.20940|0.20940	-1.0260|-1.0260	10|5	0.17832|.	T|.	0.49|.	.|.	8.6354|8.6354	0.33945|0.33945	0.0:0.6801:0.0:0.3199|0.0:0.6801:0.0:0.3199	.|.	116;1882;1679;1841;1841;1841;995;116;116|.	Q6PK32;P16157-21;P16157-4;P16157;P16157-5;P16157-3;B3KX39;Q53ER1;E5RFL7|.	.;.;.;ANK1_HUMAN;.;.;.;.;.|.	N|Q	1841;1841;1841;116;116;116;1882|1000	ENSP00000339620:D1841N;ENSP00000289734:D1841N;ENSP00000380147:D1841N;ENSP00000428750:D116N;ENSP00000430368:D116N;ENSP00000319123:D116N;ENSP00000265709:D1882N|.	ENSP00000265709:D1882N|.	D|R	-|-	1|2	0|0	ANK1|ANK1	41638574|41638574	0.002000|0.002000	0.14202|0.14202	0.001000|0.001000	0.08648|0.08648	0.002000|0.002000	0.02628|0.02628	1.702000|1.702000	0.37836|0.37836	0.754000|0.754000	0.32968|0.32968	0.561000|0.561000	0.74099|0.74099	GAT|CGA	-	NULL		0.572	ANK1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ANK1	protein_coding	OTTHUMT00000317297.1	C	NM_020475	rs143987736		41519417	-1	no_errors	ENST00000396942	ensembl	human	known	74_37	missense	SNP	0.000	T
FBLIM1	54751	genome.wustl.edu	37	1	16101426	16101426	+	Intron	SNP	G	G	T			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr1:16101426G>T	ENST00000375766.3	+	7	1530				FBLIM1_ENST00000400773.1_Intron|FBLIM1_ENST00000441801.2_Missense_Mutation_p.R342M|FBLIM1_ENST00000375771.1_Intron|FBLIM1_ENST00000332305.5_Intron	NM_017556.2	NP_060026.2	Q8WUP2	FBLI1_HUMAN	filamin binding LIM protein 1						cell junction assembly (GO:0034329)|regulation of cell shape (GO:0008360)|regulation of integrin activation (GO:0033623)|single organismal cell-cell adhesion (GO:0016337)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|stress fiber (GO:0001725)	filamin binding (GO:0031005)|zinc ion binding (GO:0008270)			large_intestine(2)|lung(4)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	16		Colorectal(325;0.000257)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.56e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|KIRC - Kidney renal clear cell carcinoma(229;0.00244)|READ - Rectum adenocarcinoma(331;0.0649)|STAD - Stomach adenocarcinoma(313;0.138)		gaatattacagggctgggctg	0.577																																																	0								ENSG00000162458						28.0	36.0	33.0					1																	16101426		1209	2200	3409	FBLIM1	SO:0001627	intron_variant	0			-	HGNC		CCDS163.1, CCDS30609.1, CCDS44064.1	1p36.13	2014-04-07			ENSG00000162458	ENSG00000162458			24686	protein-coding gene	gene with protein product		607747				12679033, 12496242	Standard	XM_005245900		Approved	FBLP-1, CAL, migfilin	uc001axe.1	Q8WUP2	OTTHUMG00000003079	ENST00000375766.3:c.890+135G>T	1.37:g.16101426G>T		Somatic	0	22	0.00		0.599270127213081	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	15	16.67	B3KNY0|Q5VVE0|Q5VVE1|Q8IX23|Q96T00|Q9UFD6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	p.R342M	ENST00000375766.3	37	c.1025	CCDS163.1	1	.	.	.	.	.	.	.	.	.	.	G	5.809	0.333617	0.11013	.	.	ENSG00000162458	ENST00000441801	T	0.60920	0.15	0.726	-0.478	0.12093	.	.	.	.	.	T	0.36853	0.0982	.	.	.	0.09310	N	1	P	0.50272	0.933	B	0.37451	0.25	T	0.20907	-1.0261	6	.	.	.	.	.	.	.	.	342	Q8WUP2-2	.	M	342	ENSP00000416387:R342M	.	R	+	2	0	FBLIM1	15974013	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	0.089000	0.15002	-0.183000	0.10585	0.196000	0.17591	AGG	-	NULL		0.577	FBLIM1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	FBLIM1	protein_coding	OTTHUMT00000008511.3	G	NM_001024215	-		16101426	+1	no_errors	ENST00000441801	ensembl	human	known	74_37	missense	SNP	0.000	T
KMT2C	58508	genome.wustl.edu	37	7	151842337	151842337	+	Frame_Shift_Del	DEL	C	C	-			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr7:151842337delC	ENST00000262189.6	-	54	14293	c.14075delG	c.(14074-14076)ggcfs	p.G4692fs	KMT2C_ENST00000355193.2_Frame_Shift_Del_p.G4749fs|KMT2C_ENST00000485655.2_5'Flank	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	4692					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										AGGATTTCGGCCGTATCGGAA	0.473																																																	0								ENSG00000055609						90.0	78.0	82.0					7																	151842337		2203	4300	6503	KMT2C	SO:0001589	frameshift_variant	0				HGNC	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.14075delG	7.37:g.151842337delC	ENSP00000262189:p.Gly4692fs	Somatic	0	88	0.00		0.599270127213081	6	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	43	20.37	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_box_dom,smart_Znf_PHD,smart_Znf_RING,smart_HMG_box_dom,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_DHHC_palmitoyltrfase,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.G4749fs	ENST00000262189.6	37	c.14246	CCDS5931.1	7																																																																																			-	pfam_FYrich_C,smart_FYrich_C		0.473	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KMT2C	protein_coding	OTTHUMT00000318887.3	C				151842337	-1	no_errors	ENST00000355193	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
WDFY3	23001	genome.wustl.edu	37	4	85731189	85731189	+	Silent	SNP	G	G	A			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr4:85731189G>A	ENST00000295888.4	-	14	2603	c.2196C>T	c.(2194-2196)agC>agT	p.S732S	WDFY3-AS1_ENST00000510449.1_RNA|WDFY3_ENST00000322366.6_Silent_p.S732S	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3	732					aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		CATTCATGGCGCTTATTTTTC	0.423																																																	0								ENSG00000163625						149.0	145.0	147.0					4																	85731189		2203	4300	6503	WDFY3	SO:0001819	synonymous_variant	0			-	HGNC	AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424	ENST00000295888.4:c.2196C>T	4.37:g.85731189G>A		Somatic	0	65	0.00		0.599270127213081	4	33.33	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	44	21.43	Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_BEACH_dom,pfam_Znf_FYVE,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_Znf_FYVE_PHD,superfamily_ConA-like_lec_gl_sf,superfamily_Cyclin-like,superfamily_ARM-type_fold,smart_WD40_repeat,smart_Znf_FYVE,pfscan_BEACH_dom,pfscan_Znf_FYVE-rel,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.S732	ENST00000295888.4	37	c.2196	CCDS3609.1	4																																																																																			-	superfamily_ARM-type_fold		0.423	WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDFY3	protein_coding	OTTHUMT00000252811.2	G	NM_014991	-		85731189	-1	no_errors	ENST00000295888	ensembl	human	known	74_37	silent	SNP	0.999	A
UNC5D	137970	genome.wustl.edu	37	8	35650777	35650777	+	IGR	SNP	C	C	T			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr8:35650777C>T	ENST00000404895.2	+	0	3252				UNC5D_ENST00000287272.2_3'UTR|AC012215.1_ENST00000437887.1_Nonsense_Mutation_p.Q127*|UNC5D_ENST00000453357.2_3'UTR	NM_080872.2	NP_543148.2	Q6UXZ4	UNC5D_HUMAN	unc-5 homolog D (C. elegans)						apoptotic process (GO:0006915)|axon guidance (GO:0007411)|pyramidal neuron differentiation (GO:0021859)|regulation of neuron migration (GO:2001222)|signal transduction (GO:0007165)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)				NS(2)|breast(7)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(56)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(6)|urinary_tract(2)	112				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)		ATTTACAGACCAAGGTGTGGT	0.358																																																	0								ENSG00000233863																																			AC012215.1	SO:0001628	intergenic_variant	0			-	Clone_based_ensembl_gene	AB055056	CCDS6093.2	8p12	2013-01-11			ENSG00000156687	ENSG00000156687		"""Immunoglobulin superfamily / I-set domain containing"""	18634	protein-coding gene	gene with protein product						18402767	Standard	NM_080872		Approved	KIAA1777, Unc5h4	uc003xjr.2	Q6UXZ4	OTTHUMG00000157145		8.37:g.35650777C>T		Somatic	0	39	0.00		0.599270127213081	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	42	20.75	Q8WYP7	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.Q127*	ENST00000404895.2	37	c.379	CCDS6093.2	8	.	.	.	.	.	.	.	.	.	.	C	43	9.924703	0.99297	.	.	ENSG00000233863	ENST00000437887	.	.	.	6.06	4.24	0.50183	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	0.999995	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	8.3636	0.32374	0.0:0.7626:0.1555:0.0819	.	.	.	.	X	127	.	ENSP00000409748:Q127X	Q	+	1	0	AC012215.1	35770319	0.000000	0.05858	0.013000	0.15412	0.018000	0.09664	-0.058000	0.11750	0.856000	0.35383	-0.142000	0.14014	CAA	-	NULL		0.358	UNC5D-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ENSG00000233863	protein_coding	OTTHUMT00000347586.2	C		-		35650777	+1	no_errors	ENST00000437887	ensembl	human	known	74_37	nonsense	SNP	0.009	T
PTPRM	5797	genome.wustl.edu	37	18	8376094	8376094	+	Nonsense_Mutation	SNP	G	G	A			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr18:8376094G>A	ENST00000332175.8	+	23	4220	c.3183G>A	c.(3181-3183)tgG>tgA	p.W1061*	PTPRM_ENST00000400060.4_Nonsense_Mutation_p.W1075*|PTPRM_ENST00000400053.4_Nonsense_Mutation_p.W999*|PTPRM_ENST00000444013.1_Nonsense_Mutation_p.W848*|PTPRM_ENST00000580170.1_Nonsense_Mutation_p.W1074*	NM_002845.3	NP_002836.3	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M	1061	Tyrosine-protein phosphatase 1. {ECO:0000255|PROSITE-ProRule:PRU00160}.				homophilic cell adhesion (GO:0007156)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|neuron projection development (GO:0031175)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of vasodilation (GO:0045909)|protein dephosphorylation (GO:0006470)|response to drug (GO:0042493)|retina layer formation (GO:0010842)|retinal ganglion cell axon guidance (GO:0031290)|signal transduction (GO:0007165)	cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|perinuclear region of cytoplasm (GO:0048471)	cadherin binding (GO:0045296)|identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(32)|lung(25)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	90		Colorectal(10;0.234)				TCACTGGCTGGCCGGATCATG	0.562																																																	0								ENSG00000173482						76.0	75.0	76.0					18																	8376094		2203	4300	6503	PTPRM	SO:0001587	stop_gained	0			-	HGNC	X58288	CCDS11840.1, CCDS58613.1	18p11.2	2013-02-11			ENSG00000173482	ENSG00000173482		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9675	protein-coding gene	gene with protein product		176888		PTPRL1		1655529, 8404049	Standard	NM_002845		Approved	RPTPU, hR-PTPu	uc010dkv.3	P28827	OTTHUMG00000131575	ENST00000332175.8:c.3183G>A	18.37:g.8376094G>A	ENSP00000331418:p.Trp1061*	Somatic	0	64	0.00		0.599270127213081	28	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	32	13.51	A7MBN1|D3DUH8|J3QL11	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_MAM_dom,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_MAM_dom,smart_Ig_sub,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_MAM_dom,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Ig-like_dom,prints_Tyr_Pase_rcpt/non-rcpt,prints_MAM_dom	p.W1075*	ENST00000332175.8	37	c.3225	CCDS11840.1	18	.	.	.	.	.	.	.	.	.	.	G	51	17.503901	0.99888	.	.	ENSG00000173482	ENST00000332175;ENST00000400060;ENST00000400053;ENST00000444013	.	.	.	6.04	6.04	0.98038	.	0.113475	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	20.6524	0.99598	0.0:0.0:1.0:0.0	.	.	.	.	X	1061;1075;999;848	.	ENSP00000331418:W1061X	W	+	3	0	PTPRM	8366094	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.890000	0.99128	0.585000	0.79938	TGG	-	pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt		0.562	PTPRM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTPRM	protein_coding	OTTHUMT00000254456.1	G		-		8376094	+1	no_errors	ENST00000400060	ensembl	human	known	74_37	nonsense	SNP	1.000	A
TP53	7157	genome.wustl.edu	37	17	7577114	7577114	+	Frame_Shift_Del	DEL	C	C	-			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr17:7577114delC	ENST00000269305.4	-	8	1013	c.824delG	c.(823-825)tgtfs	p.C275fs	TP53_ENST00000359597.4_Frame_Shift_Del_p.C275fs|TP53_ENST00000420246.2_Frame_Shift_Del_p.C275fs|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Frame_Shift_Del_p.C275fs|TP53_ENST00000445888.2_Frame_Shift_Del_p.C275fs|TP53_ENST00000413465.2_Intron	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	275	Interaction with AXIN1. {ECO:0000250}.|Interaction with DNA.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		C -> F (in sporadic cancers; somatic mutation).|C -> G (in sporadic cancers; somatic mutation).|C -> R (in sporadic cancers; somatic mutation).|C -> S (in sporadic cancers; somatic mutation).|C -> W (in sporadic cancers; somatic mutation).|C -> Y (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:7887414}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.C275Y(53)|p.C275F(37)|p.0?(8)|p.C275fs*70(3)|p.?(2)|p.C275S(2)|p.C275fs*20(1)|p.L265_K305del41(1)|p.R273_C275delRVC(1)|p.F270_D281del12(1)|p.V274_P278del(1)|p.A276fs*29(1)|p.S269fs*21(1)|p.C275fs*67(1)|p.V272_K292del21(1)|p.C275_R283delCACPGRDRR(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AGGACAGGCACAAACACGCAC	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	115	Substitution - Missense(92)|Whole gene deletion(8)|Deletion - Frameshift(7)|Deletion - In frame(6)|Unknown(2)	lung(14)|large_intestine(13)|breast(13)|upper_aerodigestive_tract(12)|central_nervous_system(10)|haematopoietic_and_lymphoid_tissue(10)|ovary(7)|urinary_tract(6)|stomach(5)|oesophagus(5)|bone(5)|liver(5)|skin(3)|pancreas(2)|NS(2)|prostate(2)|biliary_tract(1)	GRCh37	CM076568|CM951234	TP53	M		ENSG00000141510						71.0	61.0	64.0					17																	7577114		2203	4300	6503	TP53	SO:0001589	frameshift_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;		HGNC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.824delG	17.37:g.7577114delC	ENSP00000269305:p.Cys275fs	Somatic	0	32	0.00		0.599270127213081	34	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	12	40.00	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.C275fs	ENST00000269305.4	37	c.824	CCDS11118.1	17																																																																																			-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	C	NM_000546			7577114	-1	no_errors	ENST00000269305	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
SLC22A6	9356	genome.wustl.edu	37	11	62749392	62749392	+	Missense_Mutation	SNP	A	A	T			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr11:62749392A>T	ENST00000377871.3	-	4	985	c.719T>A	c.(718-720)gTg>gAg	p.V240E	SLC22A6_ENST00000421062.2_Missense_Mutation_p.V240E|SLC22A6_ENST00000458333.2_Missense_Mutation_p.V240E|SLC22A6_ENST00000360421.4_Missense_Mutation_p.V240E|SLC22A6_ENST00000537349.1_5'UTR	NM_004790.4|NM_153278.2	NP_004781.2|NP_695010.1	Q4U2R8	S22A6_HUMAN	solute carrier family 22 (organic anion transporter), member 6	240					alpha-ketoglutarate transport (GO:0015742)|organic anion transport (GO:0015711)|protein homooligomerization (GO:0051260)|renal tubular secretion (GO:0097254)|response to methotrexate (GO:0031427)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|caveola (GO:0005901)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	chloride ion binding (GO:0031404)|inorganic anion exchanger activity (GO:0005452)|organic anion transmembrane transporter activity (GO:0008514)|sodium-independent organic anion transmembrane transporter activity (GO:0015347)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(18)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36					Acetaminophen(DB00316)|Acetazolamide(DB00819)|Acetylcysteine(DB06151)|Acetylsalicylic acid(DB00945)|Aciclovir(DB00787)|Adefovir Dipivoxil(DB00718)|Aminohippurate(DB00345)|Aminophenazone(DB01424)|Amoxicillin(DB01060)|Antipyrine(DB01435)|Aspartame(DB00168)|Benzylpenicillin(DB01053)|Bromodiphenhydramine(DB01237)|Bumetanide(DB00887)|Captopril(DB01197)|Carbenicillin(DB00578)|Carprofen(DB00821)|Caspofungin(DB00520)|Cefacetrile(DB01414)|Cefadroxil(DB01140)|Cefalotin(DB00456)|Cefamandole(DB01326)|Cefazolin(DB01327)|Cefoperazone(DB01329)|Cefotaxime(DB00493)|Cefotiam(DB00229)|Cefradine(DB01333)|Ceftazidime(DB00438)|Ceftriaxone(DB01212)|Cephalexin(DB00567)|Chloramphenicol(DB00446)|Chlorothiazide(DB00880)|Chlorpropamide(DB00672)|Cidofovir(DB00369)|Cilastatin(DB01597)|Cimetidine(DB00501)|Cinoxacin(DB00827)|Cloxacillin(DB01147)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Cyclothiazide(DB00606)|Dabrafenib(DB08912)|Diclofenac(DB00586)|Didanosine(DB00900)|Diflunisal(DB00861)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Doxycycline(DB00254)|Enalapril(DB00584)|Ethacrynic acid(DB00903)|Etodolac(DB00749)|Fluorescein(DB00693)|Flurbiprofen(DB00712)|Folic Acid(DB00158)|Foscarnet(DB00529)|Furosemide(DB00695)|Ganciclovir(DB01004)|Gentamicin(DB00798)|Glyburide(DB01016)|Hydrochlorothiazide(DB00999)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Lamivudine(DB00709)|Levofloxacin(DB01137)|Losartan(DB00678)|Meclofenamic acid(DB00939)|Methazolamide(DB00703)|Methotrexate(DB00563)|Minocycline(DB01017)|Nafcillin(DB00607)|Nalidixic Acid(DB00779)|Naproxen(DB00788)|Nateglinide(DB00731)|Norfloxacin(DB01059)|Novobiocin(DB01051)|Ofloxacin(DB01165)|Oxytetracycline(DB00595)|Phenylbutazone(DB00812)|Piperacillin(DB00319)|Piroxicam(DB00554)|Pravastatin(DB00175)|Probenecid(DB01032)|Riboflavin(DB00140)|Salicylic acid(DB00936)|Stavudine(DB00649)|Streptomycin(DB01082)|Sulindac(DB00605)|Tenofovir(DB00300)|Tetracycline(DB00759)|Tolbutamide(DB01124)|Tolmetin(DB00500)|Trifluridine(DB00432)|Valaciclovir(DB00577)|Valproic Acid(DB00313)|Vancomycin(DB00512)|Zalcitabine(DB00943)|Zidovudine(DB00495)	AGCGTAGGCCACACCAGCCAG	0.597																																																	0								ENSG00000197901						61.0	52.0	55.0					11																	62749392		2201	4298	6499	SLC22A6	SO:0001583	missense	0			-	HGNC	AF057039	CCDS8041.1, CCDS31591.1, CCDS44631.1, CCDS44632.1	11q12.3	2013-07-15			ENSG00000197901	ENSG00000197901		"""Solute carriers"""	10970	protein-coding gene	gene with protein product		607582				9762842, 9950961	Standard	NM_004790		Approved	ROAT1, PAHT, OAT1	uc001nwk.3	Q4U2R8	OTTHUMG00000167767	ENST00000377871.3:c.719T>A	11.37:g.62749392A>T	ENSP00000367102:p.Val240Glu	Somatic	0	43	0.00		0.599270127213081	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	A8MY93|B2D0R6|O95187|O95742|Q7LDA0|Q8N192|Q9NQA6|Q9NQC2|Q9UBG6|Q9UEQ8	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.C232*	ENST00000377871.3	37	c.696	CCDS31591.1	11	.	.	.	.	.	.	.	.	.	.	A	26.8	4.768363	0.90020	.	.	ENSG00000197901	ENST00000360421;ENST00000394651;ENST00000377871;ENST00000458333;ENST00000421062	T;T;T;T	0.61510	0.1;0.1;0.1;0.1	5.04	2.69	0.31865	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	1.510670	0.03761	N	0.258237	T	0.71753	0.3377	M	0.83483	2.645	0.19300	N	0.999974	P;P;P;P	0.39094	0.659;0.659;0.537;0.481	P;B;P;B	0.50896	0.522;0.301;0.653;0.394	T	0.52305	-0.8593	10	0.87932	D	0	.	4.6087	0.12391	0.6831:0.214:0.1029:0.0	.	240;240;240;240	Q4U2R8-4;Q4U2R8-3;Q4U2R8;Q4U2R8-2	.;.;S22A6_HUMAN;.	E	240;219;240;240;240	ENSP00000353597:V240E;ENSP00000367102:V240E;ENSP00000396401:V240E;ENSP00000404441:V240E	ENSP00000353597:V240E	V	-	2	0	SLC22A6	62505968	0.035000	0.19736	0.679000	0.29978	0.743000	0.42351	3.258000	0.51507	0.960000	0.38005	0.402000	0.26972	GTG	-	NULL		0.597	SLC22A6-002	KNOWN	basic|CCDS	protein_coding	SLC22A6	protein_coding	OTTHUMT00000396186.1	A	NM_004790	-		62749392	-1	no_errors	ENST00000540654	ensembl	human	known	74_37	nonsense	SNP	0.289	T
CLNK	116449	genome.wustl.edu	37	4	10542196	10542196	+	Missense_Mutation	SNP	G	G	T			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr4:10542196G>T	ENST00000226951.6	-	11	763	c.524C>A	c.(523-525)cCc>cAc	p.P175H	CLNK_ENST00000507719.1_Missense_Mutation_p.P133H|CLNK_ENST00000442825.2_Missense_Mutation_p.P133H	NM_052964.2	NP_443196.2	Q7Z7G1	CLNK_HUMAN	cytokine-dependent hematopoietic cell linker	175	Pro-rich.				immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|positive regulation of signal transduction (GO:0009967)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	intracellular (GO:0005622)	SH3/SH2 adaptor activity (GO:0005070)			NS(1)|endometrium(1)|large_intestine(5)|lung(9)|ovary(1)	17						AGGGGGCAAGGGTTGGTACTT	0.537																																					GBM(87;402 1286 6949 13902 35851)												0								ENSG00000109684						77.0	81.0	80.0					4																	10542196		2012	4187	6199	CLNK	SO:0001583	missense	0			-	HGNC	AB032369	CCDS47024.1	4p16.1	2013-02-14			ENSG00000109684	ENSG00000109684		"""SH2 domain containing"""	17438	protein-coding gene	gene with protein product	"""mast cell immunoreceptor signal transducer"""	611434				10562326, 10744659	Standard	NM_052964		Approved	MIST	uc003gmo.4	Q7Z7G1	OTTHUMG00000160062	ENST00000226951.6:c.524C>A	4.37:g.10542196G>T	ENSP00000226951:p.Pro175His	Somatic	0	82	0.00		0.599270127213081	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	35	50	41.18	Q05C27|Q9P2U9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SH2,smart_SH2,pfscan_SH2,prints_SH2	p.P175H	ENST00000226951.6	37	c.524	CCDS47024.1	4	.	.	.	.	.	.	.	.	.	.	G	16.09	3.024029	0.54683	.	.	ENSG00000109684	ENST00000226951;ENST00000442825;ENST00000507719	T;T;T	0.68624	1.29;-0.34;-0.34	5.76	5.76	0.90799	.	0.000000	0.64402	D	0.000007	T	0.74861	0.3772	L	0.36672	1.1	0.39121	D	0.961658	D;D	0.89917	1.0;1.0	D;D	0.81914	0.995;0.988	T	0.77760	-0.2467	10	0.72032	D	0.01	-16.7434	15.4761	0.75481	0.0:0.0:1.0:0.0	.	133;175	Q7Z7G1-2;Q7Z7G1	.;CLNK_HUMAN	H	175;133;133	ENSP00000226951:P175H;ENSP00000390744:P133H;ENSP00000427208:P133H	ENSP00000226951:P175H	P	-	2	0	CLNK	10151294	1.000000	0.71417	0.982000	0.44146	0.220000	0.24768	4.515000	0.60489	2.713000	0.92767	0.655000	0.94253	CCC	-	NULL		0.537	CLNK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLNK	protein_coding	OTTHUMT00000359047.1	G	NM_052964	-		10542196	-1	no_errors	ENST00000226951	ensembl	human	known	74_37	missense	SNP	0.993	T
PDE1C	5137	genome.wustl.edu	37	7	31855612	31855612	+	Missense_Mutation	SNP	C	C	A			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr7:31855612C>A	ENST00000396191.1	-	15	2194	c.1739G>T	c.(1738-1740)cGg>cTg	p.R580L	PDE1C_ENST00000479980.1_5'UTR|PDE1C_ENST00000321453.7_Missense_Mutation_p.R580L|PDE1C_ENST00000396184.3_Missense_Mutation_p.R580L|PDE1C_ENST00000396193.1_Missense_Mutation_p.R640L|PDE1C_ENST00000396182.2_Missense_Mutation_p.R580L	NM_001191057.1	NP_001177986.1	Q14123	PDE1C_HUMAN	phosphodiesterase 1C, calmodulin-dependent 70kDa	580					activation of phospholipase C activity (GO:0007202)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|metabolic process (GO:0008152)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)	cytosol (GO:0005829)	calmodulin-dependent cyclic-nucleotide phosphodiesterase activity (GO:0004117)|metal ion binding (GO:0046872)	p.R580Q(2)|p.R580L(2)|p.R640Q(1)|p.R640L(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(38)|prostate(4)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	81			GBM - Glioblastoma multiforme(11;0.216)		Caffeine(DB00201)	TTTGTTTGCCCGTGTTCCATT	0.468																																																	6	Substitution - Missense(6)	lung(3)|kidney(3)						ENSG00000154678						269.0	265.0	266.0					7																	31855612		2203	4300	6503	PDE1C	SO:0001583	missense	0			-	HGNC	U40371	CCDS5437.1, CCDS55099.1, CCDS55100.1	7p15.1-p14.3	2008-05-15	2002-08-29		ENSG00000154678	ENSG00000154678	3.1.4.17	"""Phosphodiesterases"""	8776	protein-coding gene	gene with protein product		602987	"""phosphodiesterase 1C, calmodulin-dependent (70kD)"""			8557689	Standard	XM_005249769		Approved	Hcam3	uc003tco.2	Q14123	OTTHUMG00000023836	ENST00000396191.1:c.1739G>T	7.37:g.31855612C>A	ENSP00000379494:p.Arg580Leu	Somatic	0	87	0.00		0.599270127213081	0	100.00	9	WXS	Illumina HiSeq 2500	Phase_IV	tier1	41	36	53.25	B3KPC6|E9PE92|Q14124|Q8NB10	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PDEase_catalytic_dom,pfam_PDEase_N,smart_HD/PDEase_dom,prints_PDEase	p.R580L	ENST00000396191.1	37	c.1739	CCDS55099.1	7	.	.	.	.	.	.	.	.	.	.	C	10.87	1.473893	0.26423	.	.	ENSG00000154678	ENST00000396193;ENST00000396191;ENST00000321453;ENST00000396184;ENST00000396182	T;T;T;T;T	0.73363	-0.74;-0.73;-0.73;-0.66;-0.66	5.34	5.34	0.76211	.	1.317630	0.05318	N	0.526138	T	0.69033	0.3066	L	0.27053	0.805	0.09310	N	0.999994	B;B;B	0.22146	0.065;0.02;0.006	B;B;B	0.20577	0.03;0.008;0.005	T	0.55648	-0.8108	10	0.48119	T	0.1	.	15.8967	0.79341	0.0:1.0:0.0:0.0	.	580;640;580	Q14123-2;E9PE92;Q14123	.;.;PDE1C_HUMAN	L	640;580;580;580;580	ENSP00000379496:R640L;ENSP00000379494:R580L;ENSP00000318105:R580L;ENSP00000379487:R580L;ENSP00000379485:R580L	ENSP00000318105:R580L	R	-	2	0	PDE1C	31822137	0.000000	0.05858	0.029000	0.17559	0.005000	0.04900	0.208000	0.17415	2.779000	0.95612	0.655000	0.94253	CGG	-	NULL		0.468	PDE1C-006	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	PDE1C	protein_coding	OTTHUMT00000328458.1	C		-		31855612	-1	no_errors	ENST00000321453	ensembl	human	known	74_37	missense	SNP	0.122	A
PSPC1	55269	genome.wustl.edu	37	13	20325550	20325550	+	Silent	SNP	T	T	C			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr13:20325550T>C	ENST00000338910.4	-	4	987	c.828A>G	c.(826-828)gcA>gcG	p.A276A		NM_001042414.2	NP_001035879.1	Q8WXF1	PSPC1_HUMAN	paraspeckle component 1	276	Sufficient for paraspeckles localization.|Sufficient for perinucleolar caps localization and interaction with NONO.				negative regulation of transcription, DNA-templated (GO:0045892)|regulation of circadian rhythm (GO:0042752)|rhythmic process (GO:0048511)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|paraspeckles (GO:0042382)	core promoter binding (GO:0001047)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|large_intestine(4)|lung(10)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	23		all_cancers(29;1.25e-22)|all_lung(29;1.97e-20)|all_epithelial(30;2.29e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;4.63e-06)|Epithelial(112;2.29e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00256)|Lung(94;0.00975)|LUSC - Lung squamous cell carcinoma(192;0.0483)		TCCATCGAGATGCATACTCAA	0.403																																																	0								ENSG00000121390						132.0	119.0	123.0					13																	20325550		1900	4121	6021	PSPC1	SO:0001819	synonymous_variant	0			-	HGNC	AK001817	CCDS41870.1	13q11	2013-02-12			ENSG00000121390	ENSG00000121390		"""RNA binding motif (RRM) containing"""	20320	protein-coding gene	gene with protein product		612408				11790299	Standard	NM_001042414		Approved	PSP1, FLJ10955	uc021rgx.1	Q8WXF1	OTTHUMG00000016502	ENST00000338910.4:c.828A>G	13.37:g.20325550T>C		Somatic	0	68	0.00		0.599270127213081	17	82.29	79	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	23	39.47	Q5JTQ3|Q8NCZ9|Q8WXE8|Q9NV36	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_RRM_dom,pfam_NOPS,smart_RRM_dom,pfscan_RRM_dom	p.A276	ENST00000338910.4	37	c.828	CCDS41870.1	13																																																																																			-	pfam_NOPS		0.403	PSPC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PSPC1	protein_coding	OTTHUMT00000044037.2	T		-		20325550	-1	no_errors	ENST00000338910	ensembl	human	known	74_37	silent	SNP	0.983	C
DOK3	79930	genome.wustl.edu	37	5	176936610	176936610	+	Missense_Mutation	SNP	C	C	T	rs372299396		TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr5:176936610C>T	ENST00000357198.4	-	2	104	c.100G>A	c.(100-102)Gag>Aag	p.E34K	DOK3_ENST00000312943.6_Intron|DOK3_ENST00000377112.4_5'UTR|DOK3_ENST00000501403.2_5'UTR	NM_024872.2	NP_079148.2	Q7L591	DOK3_HUMAN	docking protein 3	34					Ras protein signal transduction (GO:0007265)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|lung(7)	13	all_cancers(89;0.00033)|Renal(175;0.000269)|Lung NSC(126;0.00161)|all_lung(126;0.00286)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.191)			GACGGGAACTCCTCACACTTC	0.657																																																	0								ENSG00000146094	C	,,LYS/GLU	0,4406		0,0,2203	68.0	72.0	71.0		,,100	1.7	1.0	5		71	1,8599		0,1,4299	no	intron,utr-5,missense	DOK3	NM_001144875.1,NM_001144876.1,NM_024872.2	,,56	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,,possibly-damaging	,,34/497	176936610	1,13005	2203	4300	6503	DOK3	SO:0001583	missense	0			-	HGNC	AK026223	CCDS4426.1, CCDS47349.1, CCDS47350.1	5q35	2008-02-05			ENSG00000146094	ENSG00000146094			24583	protein-coding gene	gene with protein product		611435				10733577, 12595900	Standard	NM_024872		Approved	FLJ22570	uc003mhk.3	Q7L591	OTTHUMG00000130850	ENST00000357198.4:c.100G>A	5.37:g.176936610C>T	ENSP00000349727:p.Glu34Lys	Somatic	0	51	0.00		0.599270127213081	12	7.69	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	34	22	60.71	E9PAT0|H7BXS0|Q8N864|Q9BQB3|Q9H666	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Insln_rcpt_S1,smart_Pleckstrin_homology,smart_Insln_rcpt_S1,pfscan_Insln_rcpt_S1	p.E34K	ENST00000357198.4	37	c.100	CCDS4426.1	5	.	.	.	.	.	.	.	.	.	.	C	17.08	3.296787	0.60086	0.0	1.16E-4	ENSG00000146094	ENST00000357198	T	0.20069	2.1	4.18	1.67	0.24075	.	1.247490	0.06104	N	0.665998	T	0.15565	0.0375	L	0.34521	1.04	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	T	0.26883	-1.0090	10	0.87932	D	0	-16.2589	1.876	0.03218	0.1516:0.4511:0.2376:0.1597	.	34	Q7L591	DOK3_HUMAN	K	34	ENSP00000349727:E34K	ENSP00000349727:E34K	E	-	1	0	DOK3	176869216	0.997000	0.39634	1.000000	0.80357	0.994000	0.84299	0.256000	0.18351	0.173000	0.19788	0.491000	0.48974	GAG	-	NULL		0.657	DOK3-001	KNOWN	basic|CCDS	protein_coding	DOK3	protein_coding	OTTHUMT00000253420.4	C	NM_024872	-		176936610	-1	no_errors	ENST00000357198	ensembl	human	known	74_37	missense	SNP	1.000	T
WRN	7486	genome.wustl.edu	37	8	30916696	30916696	+	Missense_Mutation	SNP	G	G	T			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr8:30916696G>T	ENST00000298139.5	+	3	373	c.124G>T	c.(124-126)Gat>Tat	p.D42Y		NM_000553.4	NP_000544.2	Q14191	WRN_HUMAN	Werner syndrome, RecQ helicase-like	42	Interaction with WRNIP1. {ECO:0000250}.				aging (GO:0007568)|ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|cell aging (GO:0007569)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to starvation (GO:0009267)|DNA duplex unwinding (GO:0032508)|DNA metabolic process (GO:0006259)|DNA recombination (GO:0006310)|DNA replication (GO:0006260)|DNA synthesis involved in DNA repair (GO:0000731)|double-strand break repair (GO:0006302)|multicellular organismal aging (GO:0010259)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleolus to nucleoplasm transport (GO:0032066)|positive regulation of hydrolase activity (GO:0051345)|regulation of apoptotic process (GO:0042981)|regulation of growth rate (GO:0040009)|replication fork processing (GO:0031297)|replicative cell aging (GO:0001302)|response to oxidative stress (GO:0006979)|response to UV-C (GO:0010225)|telomere maintenance (GO:0000723)	centrosome (GO:0005813)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	3'-5' DNA helicase activity (GO:0043138)|3'-5' exonuclease activity (GO:0008408)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|ATPase activity (GO:0016887)|bubble DNA binding (GO:0000405)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|exonuclease activity (GO:0004527)|four-way junction helicase activity (GO:0009378)|G-quadruplex DNA binding (GO:0051880)|helicase activity (GO:0004386)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|protein complex binding (GO:0032403)|protein homodimerization activity (GO:0042803)|Y-form DNA binding (GO:0000403)			central_nervous_system(2)|endometrium(4)|kidney(4)|large_intestine(13)|lung(28)|ovary(3)|skin(3)|upper_aerodigestive_tract(3)	60		Breast(100;0.195)		KIRC - Kidney renal clear cell carcinoma(542;0.147)|Kidney(114;0.176)|Colorectal(111;0.192)		TGTTTTTGAAGATGACCTCCC	0.348			"""Mis, N, F, S"""			"""osteosarcoma, meningioma, others"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Werner syndrome																												Ovarian(18;161 598 2706 14834 27543)		yes	Rec		Werner Syndrome	8	8p12-p11.2	7486	Werner syndrome (RECQL2)		"""L, E, M, O"""	0								ENSG00000165392						248.0	222.0	231.0					8																	30916696		2203	4300	6503	WRN	SO:0001583	missense	0	Familial Cancer Database	WS, Adult Progeria	-	HGNC		CCDS6082.1	8p12	2014-09-17	2009-03-19		ENSG00000165392	ENSG00000165392			12791	protein-coding gene	gene with protein product		604611	"""Werner syndrome"""			9288107	Standard	NM_000553		Approved	RECQL2, RECQ3	uc003xio.4	Q14191	OTTHUMG00000163894	ENST00000298139.5:c.124G>T	8.37:g.30916696G>T	ENSP00000298139:p.Asp42Tyr	Somatic	0	48	0.00		0.599270127213081	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	21	12.50	A1KYY9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_3'-5'_exonuclease_dom,pfam_Helicase_C,pfam_RQC_domain,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_HRDC_dom,superfamily_P-loop_NTPase,superfamily_RNaseH-like_dom,superfamily_HRDC-like,smart_3'-5'_exonuclease_dom,smart_Helicase_ATP-bd,smart_Helicase_C,smart_RQC_domain,smart_HRDC_dom,pfscan_HRDC_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,tigrfam_DNA_helicase_ATP-dep_RecQ	p.D42Y	ENST00000298139.5	37	c.124	CCDS6082.1	8	.	.	.	.	.	.	.	.	.	.	G	13.37	2.216443	0.39201	.	.	ENSG00000165392	ENST00000298139	T	0.50001	0.76	5.94	5.06	0.68205	.	0.000000	0.85682	D	0.000000	T	0.66208	0.2766	M	0.76002	2.32	0.37232	D	0.905722	D	0.89917	1.0	D	0.75020	0.985	T	0.74137	-0.3762	10	0.87932	D	0	-29.7264	11.0953	0.48141	0.0:0.1388:0.7171:0.1442	.	42	Q14191	WRN_HUMAN	Y	42	ENSP00000298139:D42Y	ENSP00000298139:D42Y	D	+	1	0	WRN	31036238	1.000000	0.71417	0.997000	0.53966	0.092000	0.18411	3.236000	0.51336	1.506000	0.48736	0.650000	0.86243	GAT	-	NULL		0.348	WRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WRN	protein_coding	OTTHUMT00000376248.1	G		-		30916696	+1	no_errors	ENST00000298139	ensembl	human	known	74_37	missense	SNP	0.999	T
TMX2	51075	genome.wustl.edu	37	11	57505354	57505354	+	Intron	SNP	C	C	T			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr11:57505354C>T	ENST00000278422.4	+	3	262				TMX2-CTNND1_ENST00000528395.1_Intron|TMX2_ENST00000378312.4_Intron	NM_015959.3	NP_057043.1	Q9Y320	TMX2_HUMAN	thioredoxin-related transmembrane protein 2						cell redox homeostasis (GO:0045454)	integral component of membrane (GO:0016021)				NS(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|urinary_tract(2)	12						GTGCACAGCCCAGCCTGACCT	0.453																																																	0								ENSG00000213593						106.0	95.0	99.0					11																	57505354		2201	4296	6497	TMX2	SO:0001627	intron_variant	0			-	HGNC	AF132965	CCDS7967.1, CCDS44601.1	11q12.1	2012-09-20	2009-02-23	2009-02-23	ENSG00000213593	ENSG00000213593		"""Protein disulfide isomerases"""	30739	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 12"""		"""thioredoxin domain containing 14"""	TXNDC14		12670024	Standard	NM_015959		Approved	PDIA12	uc001nlc.2	Q9Y320	OTTHUMG00000167200	ENST00000278422.4:c.251-31C>T	11.37:g.57505354C>T		Somatic	0	31	0.00		0.599270127213081	12	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	34	10.53	B7Z4R4|Q53G73|Q561W0|Q5J7Q7|Q8NBP9|Q9H3L1	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.P99	ENST00000278422.4	37	c.297	CCDS7967.1	11																																																																																			-	NULL		0.453	TMX2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TMX2	protein_coding	OTTHUMT00000393708.1	C	NM_015959	-		57505354	+1	no_errors	ENST00000525035	ensembl	human	known	74_37	silent	SNP	0.122	T
SMARCAL1	50485	genome.wustl.edu	37	2	217343021	217343021	+	Splice_Site	SNP	A	A	G			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr2:217343021A>G	ENST00000357276.4	+	17	2954	c.2624A>G	c.(2623-2625)aAg>aGg	p.K875R	AC098820.3_ENST00000453157.1_RNA|SMARCAL1_ENST00000358207.5_Splice_Site_p.K875R	NM_014140.3	NP_054859.2	Q9NZC9	SMAL1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a-like 1	875					cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|DNA metabolic process (GO:0006259)|DNA strand renaturation (GO:0000733)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|replication fork processing (GO:0031297)	nucleus (GO:0005634)|site of double-strand break (GO:0035861)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)			NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(10)|liver(1)|lung(15)|ovary(3)|prostate(1)|skin(1)	42		Renal(323;0.0458)		Epithelial(149;9.48e-06)|all cancers(144;0.000621)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0111)		TACCTCTACAAGGTAATGCCA	0.483									Schimke Immuno-Osseous Dysplasia																																								0								ENSG00000138375						81.0	85.0	84.0					2																	217343021		2203	4300	6503	SMARCAL1	SO:0001630	splice_region_variant	0	Familial Cancer Database	SIOD	-	HGNC	AF210833	CCDS2403.1	2q35	2014-09-17			ENSG00000138375	ENSG00000138375			11102	protein-coding gene	gene with protein product	"""HepA-related protein"", ""ATP-driven annealing helicase"""	606622				10713074, 10857751, 18974355	Standard	NM_014140		Approved	HHARP, HARP	uc002vgd.4	Q9NZC9	OTTHUMG00000133055	ENST00000357276.4:c.2625+1A>G	2.37:g.217343021A>G		Somatic	0	40	0.00		0.599270127213081	22	4.35	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	14	63.16	A6NEH0|Q53R00|Q96AY1|Q9NXQ5|Q9UFH3|Q9UI93	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_HARP_dom,pfam_SNF2_N,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.K875R	ENST00000357276.4	37	c.2624	CCDS2403.1	2	.	.	.	.	.	.	.	.	.	.	A	14.73	2.622589	0.46840	.	.	ENSG00000138375	ENST00000357276;ENST00000358207;ENST00000392128	D;D;T	0.86366	-2.11;-2.11;-1.0	5.23	5.23	0.72850	.	0.193434	0.43747	D	0.000528	D	0.84902	0.5575	L	0.59436	1.845	0.43263	D	0.995201	B	0.24882	0.113	B	0.23018	0.043	T	0.82804	-0.0276	10	0.49607	T	0.09	-22.9374	14.4586	0.67433	1.0:0.0:0.0:0.0	.	875	Q9NZC9	SMAL1_HUMAN	R	875;875;717	ENSP00000349823:K875R;ENSP00000350940:K875R;ENSP00000375974:K717R	ENSP00000349823:K875R	K	+	2	0	SMARCAL1	217051266	1.000000	0.71417	1.000000	0.80357	0.607000	0.37147	5.737000	0.68606	2.194000	0.70268	0.533000	0.62120	AAG	-	superfamily_P-loop_NTPase		0.483	SMARCAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMARCAL1	protein_coding	OTTHUMT00000256671.2	A		-	Missense_Mutation	217343021	+1	no_errors	ENST00000357276	ensembl	human	known	74_37	missense	SNP	1.000	G
SPHKAP	80309	genome.wustl.edu	37	2	228855866	228855866	+	Missense_Mutation	SNP	G	G	T	rs16824283	byFrequency	TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr2:228855866G>T	ENST00000392056.3	-	11	4855	c.4809C>A	c.(4807-4809)agC>agA	p.S1603R	SPHKAP_ENST00000344657.5_Missense_Mutation_p.S1574R	NM_001142644.1	NP_001136116.1	Q2M3C7	SPKAP_HUMAN	SPHK1 interactor, AKAP domain containing	1603			S -> R (in dbSNP:rs16824283).			extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|Z disc (GO:0030018)	protein kinase A binding (GO:0051018)			NS(5)|breast(5)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(25)|lung(86)|ovary(6)|pancreas(1)|prostate(6)|skin(17)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	185		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		TCCTCTGGGGGCTGGCTGTTC	0.577																																																	0								ENSG00000153820						43.0	45.0	44.0					2																	228855866		2203	4300	6503	SPHKAP	SO:0001583	missense	0			-	HGNC		CCDS33389.1, CCDS46537.1	2q36.3	2010-08-20			ENSG00000153820	ENSG00000153820		"""A-kinase anchor proteins"""	30619	protein-coding gene	gene with protein product	"""sphingosine kinase type 1-interacting protein"""	611646				12080051, 11214970	Standard	NM_030623		Approved	SKIP	uc002vpq.2	Q2M3C7	OTTHUMG00000153584	ENST00000392056.3:c.4809C>A	2.37:g.228855866G>T	ENSP00000375909:p.Ser1603Arg	Somatic	0	33	0.00		0.599270127213081	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	45	11.76	Q68DA3|Q68DR8|Q9C0I5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_AKAP_110_C	p.S1603R	ENST00000392056.3	37	c.4809	CCDS46537.1	2	.	.	.	.	.	.	.	.	.	.	G	11.84	1.759335	0.31137	.	.	ENSG00000153820	ENST00000392056;ENST00000344657	T;T	0.06608	3.28;3.28	6.17	-2.19	0.07015	A-kinase anchor 110kDa, C-terminal (1);	0.300797	0.43919	D	0.000501	T	0.11965	0.0291	L	0.48362	1.52	0.80722	P	0.0	D;P	0.54397	0.966;0.935	P;P	0.55923	0.787;0.613	T	0.01657	-1.1302	9	0.59425	D	0.04	.	13.8991	0.63792	0.6506:0.0:0.3494:0.0	.	1603;1574	Q2M3C7;Q2M3C7-2	SPKAP_HUMAN;.	R	1603;1574	ENSP00000375909:S1603R;ENSP00000339886:S1574R	ENSP00000339886:S1574R	S	-	3	2	SPHKAP	228564110	0.088000	0.21588	0.000000	0.03702	0.090000	0.18270	0.210000	0.17455	-0.511000	0.06514	-0.137000	0.14449	AGC	-	pfam_AKAP_110_C		0.577	SPHKAP-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPHKAP	protein_coding	OTTHUMT00000331750.1	G	NM_030623	-		228855866	-1	no_errors	ENST00000392056	ensembl	human	known	74_37	missense	SNP	0.000	T
RBM10	8241	genome.wustl.edu	37	X	47030467	47030469	+	In_Frame_Del	DEL	GGC	GGC	-			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	GGC	GGC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chrX:47030467_47030469delGGC	ENST00000377604.3	+	4	984_986	c.242_244delGGC	c.(241-246)aggcgg>agg	p.81_82RR>R	RBM10_ENST00000329236.7_Intron|RBM10_ENST00000345781.6_Intron	NM_001204467.1|NM_001204468.1|NM_005676.4	NP_001191396.1|NP_001191397.1|NP_005667.2	P98175	RBM10_HUMAN	RNA binding motif protein 10	81	Poly-Arg.				3'-UTR-mediated mRNA stabilization (GO:0070935)|mRNA processing (GO:0006397)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|zinc ion binding (GO:0008270)	p.R85delR(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|large_intestine(10)|liver(1)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	48						ACTCAGCGTAGGCGGCGGCGGCG	0.68																																					Melanoma(171;120 2705 19495 39241)												1	Deletion - In frame(1)	large_intestine(1)						ENSG00000182872		,,,,	44,3546		4,27,9,1518,483					,,,,	3.8	1.0			15	76,6190		7,32,30,2270,1618	no	intron,coding,coding,coding,intron	RBM10	NM_152856.2,NM_005676.4,NM_001204468.1,NM_001204467.1,NM_001204466.1	,,,,	11,59,39,3788,2101	A1A1,A1R,A1,RR,R		1.2129,1.2256,1.2175	,,,,	,,,,		120,9736				RBM10	SO:0001651	inframe_deletion	0				HGNC	U35373	CCDS14274.1, CCDS56600.1, CCDS75969.1	Xp11.3	2014-06-09			ENSG00000182872	ENSG00000182872		"""Zinc fingers, RAN-binding domain containing"", ""G patch domain containing"", ""RNA binding motif (RRM) containing"""	9896	protein-coding gene	gene with protein product		300080				8590280, 8808293	Standard	NM_005676		Approved	DXS8237E, KIAA0122, GPATC9, ZRANB5, GPATCH9	uc004dhi.3	P98175	OTTHUMG00000021432	ENST00000377604.3:c.242_244delGGC	X.37:g.47030476_47030478delGGC	ENSP00000366829:p.Arg85del	Somatic	0	24	0.00		0.599270127213081	37	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	13	18.75	C4AM81|Q14136|Q5JRR2|Q9BTE4|Q9BTX0|Q9NTB1	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_G_patch_dom,pfam_RRM_dom,pfam_Znf_RanBP2,smart_RRM_dom,smart_Znf_RanBP2,smart_G_patch_dom,pfscan_Znf_RanBP2,pfscan_Znf_C2H2,pfscan_G_patch_dom,pfscan_RRM_dom	p.R85in_frame_del	ENST00000377604.3	37	c.242_244	CCDS14274.1	X																																																																																			-	NULL		0.680	RBM10-005	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM10	protein_coding	OTTHUMT00000056381.1	GGC	NM_005676			47030469	+1	no_errors	ENST00000377604	ensembl	human	known	74_37	in_frame_del	DEL	1.000:1.000:1.000	-
CCR4	1233	genome.wustl.edu	37	3	32995907	32995907	+	Silent	SNP	C	C	T			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr3:32995907C>T	ENST00000330953.5	+	2	1161	c.993C>T	c.(991-993)taC>taT	p.Y331Y		NM_005508.4	NP_005499.1	P51679	CCR4_HUMAN	chemokine (C-C motif) receptor 4	331					chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|immune response (GO:0006955)|inflammatory response (GO:0006954)|neuron migration (GO:0001764)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of positive chemotaxis (GO:0050927)|response to antibiotic (GO:0046677)|response to bacterium (GO:0009617)|response to radiation (GO:0009314)|tolerance induction (GO:0002507)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|chemokine receptor activity (GO:0004950)			NS(1)|kidney(1)|large_intestine(2)|lung(7)|prostate(1)|skin(3)|stomach(1)	16						TCTGCCAATACTGTGGGCTCC	0.463																																																	0								ENSG00000183813						53.0	55.0	54.0					3																	32995907		2200	4300	6500	CCR4	SO:0001819	synonymous_variant	0			-	HGNC	X85740	CCDS2656.1	3p24-p21.3	2012-08-08			ENSG00000183813	ENSG00000183813		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1605	protein-coding gene	gene with protein product		604836				7642634, 8884276	Standard	NM_005508		Approved	CC-CKR-4, CMKBR4, CKR4, k5-5, ChemR13, CD194	uc003cfg.1	P51679	OTTHUMG00000130752	ENST00000330953.5:c.993C>T	3.37:g.32995907C>T		Somatic	0	29	0.00		0.599270127213081	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	28	15.15	Q9ULY6|Q9ULY7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Chemokine_CCR4,prints_GPCR_Rhodpsn,prints_Chemokine_rcpt,prints_Chemokine_CXCR4,prints_ATII_rcpt,prints_Duffy_chemokine_rcpt	p.Y331	ENST00000330953.5	37	c.993	CCDS2656.1	3																																																																																			-	prints_Chemokine_CCR4		0.463	CCR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCR4	protein_coding	OTTHUMT00000253252.2	C		-		32995907	+1	no_errors	ENST00000330953	ensembl	human	known	74_37	silent	SNP	0.627	T
RSU1	6251	genome.wustl.edu	37	10	16858999	16858999	+	Missense_Mutation	SNP	A	A	T			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr10:16858999A>T	ENST00000377921.3	-	1	383	c.82T>A	c.(82-84)Tcc>Acc	p.S28T	RSU1_ENST00000345264.5_Missense_Mutation_p.S28T|RSU1_ENST00000602389.1_Intron|RSU1_ENST00000464074.2_Intron			Q15404	RSU1_HUMAN	Ras suppressor protein 1	28					cell junction assembly (GO:0034329)|positive regulation of neural precursor cell proliferation (GO:2000179)|Ras protein signal transduction (GO:0007265)|signal transduction (GO:0007165)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)				central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(7)|stomach(1)|upper_aerodigestive_tract(1)	14				GBM - Glioblastoma multiforme(1;7.54e-08)		AGCATGTTGGAGATGCCCCGG	0.557																																																	0								ENSG00000148484						126.0	108.0	114.0					10																	16858999		2203	4300	6503	RSU1	SO:0001583	missense	0			-	HGNC	AK055596	CCDS7112.1, CCDS31157.1	10p13	2012-09-20			ENSG00000148484	ENSG00000148484			10464	protein-coding gene	gene with protein product		179555				8288261	Standard	NM_152724		Approved	RSP-1, FLJ31034	uc001iol.3	Q15404	OTTHUMG00000017740	ENST00000377921.3:c.82T>A	10.37:g.16858999A>T	ENSP00000367154:p.Ser28Thr	Somatic	0	67	0.00		0.599270127213081	217	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	28	12.50	A8KA46|D3DRU3|Q6FI17	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.S28T	ENST00000377921.3	37	c.82	CCDS7112.1	10	.	.	.	.	.	.	.	.	.	.	A	10.68	1.417758	0.25552	.	.	ENSG00000148484	ENST00000345264;ENST00000377921	T;T	0.50548	0.74;0.74	5.21	4.07	0.47477	.	.	.	.	.	T	0.27933	0.0688	L	0.28344	0.845	0.53688	D	0.999972	B;B	0.18741	0.03;0.0	B;B	0.16289	0.015;0.001	T	0.05683	-1.0870	9	0.07644	T	0.81	.	7.0176	0.24897	0.7758:0.1482:0.076:0.0	.	28;28	B0YJ73;Q15404	.;RSU1_HUMAN	T	28	ENSP00000339521:S28T;ENSP00000367154:S28T	ENSP00000339521:S28T	S	-	1	0	RSU1	16899005	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	6.438000	0.73426	1.001000	0.39076	0.454000	0.30748	TCC	-	NULL		0.557	RSU1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RSU1	protein_coding	OTTHUMT00000047006.1	A	NM_012425, NM_152724	-		16858999	-1	no_errors	ENST00000345264	ensembl	human	known	74_37	missense	SNP	1.000	T
CRNKL1	51340	genome.wustl.edu	37	20	20024254	20024254	+	Missense_Mutation	SNP	T	T	C			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr20:20024254T>C	ENST00000377340.2	-	8	1368	c.1337A>G	c.(1336-1338)cAa>cGa	p.Q446R	CRNKL1_ENST00000377327.4_Missense_Mutation_p.Q434R|CRNKL1_ENST00000536226.1_Missense_Mutation_p.Q285R	NM_001278628.1|NM_016652.4	NP_001265557.1|NP_057736.4	Q9BZJ0	CRNL1_HUMAN	crooked neck pre-mRNA splicing factor 1	446	Mediates interaction with HSP90. {ECO:0000250|UniProtKB:P63154}.				mRNA splicing, via spliceosome (GO:0000398)|spliceosomal complex assembly (GO:0000245)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(2)|cervix(2)|endometrium(7)|large_intestine(11)|lung(12)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(6)	45						TTGGGCATCTTGTTTTGAAAT	0.378																																																	0								ENSG00000101343						98.0	100.0	99.0					20																	20024254		2203	4300	6503	CRNKL1	SO:0001583	missense	0			-	HGNC	AF255443	CCDS33446.1, CCDS63238.1, CCDS63239.1	20p11.2	2013-10-03	2013-10-03		ENSG00000101343	ENSG00000101343			15762	protein-coding gene	gene with protein product	"""SYF3 pre-mRNA-splicing factor"""	610952	"""crooked neck (Drosophila Crn homolog)-like 1"", ""Crn, crooked neck-like 1 (Drosophila)"", ""crooked neck pre-mRNA splicing factor-like 1 (Drosophila)"""				Standard	NM_016652		Approved	CRN, CLF, SYF3, Clf1	uc002wrs.3	Q9BZJ0	OTTHUMG00000032000	ENST00000377340.2:c.1337A>G	20.37:g.20024254T>C	ENSP00000366557:p.Gln446Arg	Somatic	0	60	0.00		0.599270127213081	10	76.74	33	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	27	42.55	A8K9T4|Q5JY64|Q8WYI5|Q9BZI9|Q9BZJ1|Q9BZJ2|Q9GZW7|Q9H8F8|Q9NQH5|Q9NYD8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_HAT,pfam_Suf,smart_HAT,pfscan_TPR-contain_dom	p.Q446R	ENST00000377340.2	37	c.1337	CCDS33446.1	20	.	.	.	.	.	.	.	.	.	.	T	17.39	3.376385	0.61735	.	.	ENSG00000101343	ENST00000377327;ENST00000377340;ENST00000536226	T;T;T	0.08984	3.03;3.03;3.03	6.07	6.07	0.98685	.	0.302356	0.39909	N	0.001229	T	0.10766	0.0263	L	0.43152	1.355	0.58432	D	0.999999	B	0.22480	0.07	B	0.25987	0.065	T	0.12630	-1.0540	10	0.30078	T	0.28	-11.7156	16.6288	0.85011	0.0:0.0:0.0:1.0	.	446	Q9BZJ0	CRNL1_HUMAN	R	434;446;285	ENSP00000366544:Q434R;ENSP00000366557:Q446R;ENSP00000440733:Q285R	ENSP00000366544:Q434R	Q	-	2	0	CRNKL1	19972254	1.000000	0.71417	0.963000	0.40424	0.996000	0.88848	6.177000	0.71961	2.326000	0.78906	0.533000	0.62120	CAA	-	smart_HAT		0.378	CRNKL1-002	KNOWN	basic|CCDS	protein_coding	CRNKL1	protein_coding	OTTHUMT00000127787.1	T		-		20024254	-1	no_errors	ENST00000377340	ensembl	human	known	74_37	missense	SNP	1.000	C
KIAA1244	57221	genome.wustl.edu	37	6	138645275	138645275	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr6:138645275G>A	ENST00000251691.4	+	31	5151	c.4985G>A	c.(4984-4986)cGa>cAa	p.R1662Q		NM_020340.4	NP_065073.3			KIAA1244											NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(11)|lung(17)|ovary(2)|skin(2)	44	Breast(32;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00102)|GBM - Glioblastoma multiforme(68;0.00259)		TGGCGCATCCGAGCCATGGCC	0.627																																																	0								ENSG00000112379						36.0	40.0	38.0					6																	138645275		2203	4298	6501	KIAA1244	SO:0001583	missense	0			-	HGNC	AB033070	CCDS5189.2	6q23.3	2012-04-17			ENSG00000112379	ENSG00000112379		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	21213	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 33"""		"""chromosome 6 open reading frame 92"""	C6orf92			Standard	NM_020340		Approved	dJ171N11.1, BIG3, PPP1R33	uc003qhu.3	Q5TH69	OTTHUMG00000015670	ENST00000251691.4:c.4985G>A	6.37:g.138645275G>A	ENSP00000251691:p.Arg1662Gln	Somatic	0	34	0.00		0.599270127213081	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	33	19.51		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF1981_Sec7_assoc,superfamily_ARM-type_fold,superfamily_Sec7_dom,smart_Sec7_dom	p.R1662Q	ENST00000251691.4	37	c.4985	CCDS5189.2	6	.	.	.	.	.	.	.	.	.	.	G	17.48	3.399651	0.62177	.	.	ENSG00000112379	ENST00000251691	T	0.18016	2.24	5.44	5.44	0.79542	.	0.064498	0.64402	D	0.000010	T	0.07503	0.0189	L	0.33485	1.01	0.39875	D	0.973551	D	0.52996	0.957	B	0.39068	0.289	T	0.27331	-1.0077	10	0.19147	T	0.46	-12.3311	19.6229	0.95667	0.0:0.0:1.0:0.0	.	1662	Q5TH69	BIG3_HUMAN	Q	1662	ENSP00000251691:R1662Q	ENSP00000251691:R1662Q	R	+	2	0	KIAA1244	138686968	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.324000	0.79115	2.708000	0.92522	0.650000	0.86243	CGA	-	NULL		0.627	KIAA1244-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	KIAA1244	protein_coding	OTTHUMT00000042425.4	G	NM_020340	-		138645275	+1	no_errors	ENST00000251691	ensembl	human	known	74_37	missense	SNP	1.000	A
ATP2B1	490	genome.wustl.edu	37	12	90028950	90028950	+	Missense_Mutation	SNP	G	G	C			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr12:90028950G>C	ENST00000428670.3	-	4	941	c.485C>G	c.(484-486)tCt>tGt	p.S162C	ATP2B1_ENST00000359142.3_Missense_Mutation_p.S162C|ATP2B1_ENST00000261173.2_Missense_Mutation_p.S162C|ATP2B1_ENST00000348959.3_Missense_Mutation_p.S162C			P20020	AT2B1_HUMAN	ATPase, Ca++ transporting, plasma membrane 1	162					blood coagulation (GO:0007596)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(13)|lung(15)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	45						ACACACTACAGACAAGAGGAT	0.413																																																	0								ENSG00000070961						123.0	105.0	111.0					12																	90028950		2203	4300	6503	ATP2B1	SO:0001583	missense	0			-	HGNC	J04027	CCDS9035.1, CCDS41817.1	12q21.33	2010-04-20			ENSG00000070961	ENSG00000070961	3.6.3.8	"""ATPases / P-type"""	814	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 1"""	108731				1674727	Standard	NM_001682		Approved	PMCA1	uc001tbh.3	P20020		ENST00000428670.3:c.485C>G	12.37:g.90028950G>C	ENSP00000392043:p.Ser162Cys	Somatic	0	71	0.00		0.599270127213081	11	26.67	4	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	68	20.00	Q12992|Q12993|Q13819|Q13820|Q13821|Q16504|Q93082	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_cation-transptr_C,pfam_ATP_Ca_trans_C,pfam_HAD-like_dom,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_P-typ_cyto_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Ca-transp_plasma,tigrfam_Cation_transp_P_typ_ATPase	p.S162C	ENST00000428670.3	37	c.485	CCDS9035.1	12	.	.	.	.	.	.	.	.	.	.	G	27.4	4.828077	0.90955	.	.	ENSG00000070961	ENST00000261173;ENST00000348959;ENST00000359142;ENST00000428670	D;D;D;D	0.88741	-2.42;-2.42;-2.42;-2.42	5.68	5.68	0.88126	.	0.000000	0.85682	D	0.000000	D	0.94689	0.8287	M	0.78916	2.43	0.80722	D	1	D;D	0.89917	1.0;0.964	D;D	0.85130	0.997;0.946	D	0.93736	0.7046	9	.	.	.	0.6682	20.1615	0.98135	0.0:0.0:1.0:0.0	.	162;162	P20020-3;P20020-2	.;.	C	162	ENSP00000261173:S162C;ENSP00000343599:S162C;ENSP00000352054:S162C;ENSP00000392043:S162C	.	S	-	2	0	ATP2B1	88553081	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.813000	0.99286	2.835000	0.97688	0.650000	0.86243	TCT	-	pfam_ATPase_P-typ_transduc_dom_A,tigrfam_Cation_transp_P_typ_ATPase		0.413	ATP2B1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	ATP2B1	protein_coding	OTTHUMT00000406653.1	G	NM_001682	-		90028950	-1	no_errors	ENST00000261173	ensembl	human	known	74_37	missense	SNP	1.000	C
KMT2C	58508	genome.wustl.edu	37	7	151874147	151874148	+	Frame_Shift_Ins	INS	-	-	T			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr7:151874147_151874148insT	ENST00000262189.6	-	38	8608_8609	c.8390_8391insA	c.(8389-8391)aagfs	p.K2797fs	KMT2C_ENST00000355193.2_Frame_Shift_Ins_p.K2797fs	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	2797				K -> R (in Ref. 1; AAK00583). {ECO:0000305}.	histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.K2797fs*26(20)									TTTCTTGTTCCTTTTTTTTTGG	0.347																																																	20	Deletion - Frameshift(20)	large_intestine(18)|liver(2)						ENSG00000055609																																			KMT2C	SO:0001589	frameshift_variant	0				HGNC	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.8391dupA	7.37:g.151874156_151874156dupT	ENSP00000262189:p.Lys2797fs	Somatic	0	35	0.00		0.599270127213081	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	29	12.12	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_box_dom,smart_Znf_PHD,smart_Znf_RING,smart_HMG_box_dom,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_DHHC_palmitoyltrfase,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.E2798fs	ENST00000262189.6	37	c.8391_8390	CCDS5931.1	7																																																																																			-	NULL		0.347	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KMT2C	protein_coding	OTTHUMT00000318887.3	-				151874148	-1	no_errors	ENST00000355193	ensembl	human	known	74_37	frame_shift_ins	INS	0.017:0.019	T
TC2N	123036	genome.wustl.edu	37	14	92251695	92251695	+	Silent	SNP	C	C	A			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr14:92251695C>A	ENST00000435962.2	-	11	1496	c.1173G>T	c.(1171-1173)gtG>gtT	p.V391V	TC2N_ENST00000340892.5_Silent_p.V391V|TC2N_ENST00000360594.5_Silent_p.V391V|TC2N_ENST00000556018.1_Silent_p.V327V	NM_001128596.1	NP_001122068	Q8N9U0	TAC2N_HUMAN	tandem C2 domains, nuclear	391	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)	nucleus (GO:0005634)				breast(1)|endometrium(2)|large_intestine(6)|liver(1)|lung(5)|skin(1)|upper_aerodigestive_tract(2)	18				COAD - Colon adenocarcinoma(157;0.218)		TTCCCACCTTCACGAAAAAAC	0.323																																																	0								ENSG00000165929						110.0	123.0	118.0					14																	92251695		2203	4299	6502	TC2N	SO:0001819	synonymous_variant	0			-	HGNC	AA243837	CCDS9897.1, CCDS73679.1	14q32.12	2007-10-17	2007-08-17	2007-08-17		ENSG00000165929			19859	protein-coding gene	gene with protein product	"""C2 calcium-dependent domain containing 1"""		"""chromosome 14 open reading frame 47"", ""membrane targeting (tandem) C2 domain containing 1"""	C14orf47, MTAC2D1		11526914	Standard	NM_001128596		Approved	FLJ36557, Tac2-N, C2CD1	uc001xzt.4	Q8N9U0		ENST00000435962.2:c.1173G>T	14.37:g.92251695C>A		Somatic	0	39	0.00		0.599270127213081	5	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	38	20.83		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	p.V391	ENST00000435962.2	37	c.1173	CCDS9897.1	14																																																																																			-	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom		0.323	TC2N-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TC2N	protein_coding	OTTHUMT00000411778.1	C	NM_152332	-		92251695	-1	no_errors	ENST00000340892	ensembl	human	known	74_37	silent	SNP	1.000	A
ZBTB38	253461	genome.wustl.edu	37	3	141162834	141162834	+	Missense_Mutation	SNP	A	A	G			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr3:141162834A>G	ENST00000514251.1	+	4	1883	c.1604A>G	c.(1603-1605)cAg>cGg	p.Q535R	ZBTB38_ENST00000321464.5_Missense_Mutation_p.Q536R|ZBTB38_ENST00000441582.2_Missense_Mutation_p.Q535R					zinc finger and BTB domain containing 38											breast(3)|cervix(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(3)|lung(14)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	41						AAAAATCATCAGAAGTCTTTC	0.378																																																	0								ENSG00000177311						68.0	64.0	65.0					3																	141162834		1861	4096	5957	ZBTB38	SO:0001583	missense	0			-	HGNC	BC015444	CCDS43157.1	3q23	2014-06-13			ENSG00000177311	ENSG00000177311		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	26636	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 171"""	612218				12477932	Standard	NM_001080412		Approved	FLJ35036, CIBZ, ZNF921, PPP1R171	uc003etw.3	Q8NAP3	OTTHUMG00000160128	ENST00000514251.1:c.1604A>G	3.37:g.141162834A>G	ENSP00000426387:p.Gln535Arg	Somatic	0	40	0.00		0.599270127213081	12	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	21	16.00		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_BTB_POZ,pfam_Znf_C2H2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.Q536R	ENST00000514251.1	37	c.1607	CCDS43157.1	3	.	.	.	.	.	.	.	.	.	.	A	21.2	4.109455	0.77096	.	.	ENSG00000177311	ENST00000509883;ENST00000514251;ENST00000441582;ENST00000321464	T;T;T;T	0.10005	3.37;2.92;2.92;2.92	5.39	5.39	0.77823	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.31231	0.0790	M	0.68593	2.085	0.47698	D	0.999493	D;D	0.71674	0.998;0.998	D;D	0.78314	0.988;0.991	T	0.01440	-1.1354	9	.	.	.	-24.3094	15.4254	0.75045	1.0:0.0:0.0:0.0	.	536;535	B4DYR8;Q8NAP3	.;ZBT38_HUMAN	R	535;535;535;536	ENSP00000424254:Q535R;ENSP00000426387:Q535R;ENSP00000406955:Q535R;ENSP00000372635:Q536R	.	Q	+	2	0	ZBTB38	142645524	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.152000	0.77419	2.058000	0.61347	0.528000	0.53228	CAG	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.378	ZBTB38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB38	protein_coding	OTTHUMT00000359329.2	A		-		141162834	+1	no_errors	ENST00000321464	ensembl	human	known	74_37	missense	SNP	1.000	G
SLC22A7	10864	genome.wustl.edu	37	6	43269949	43269949	+	Missense_Mutation	SNP	A	A	T			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr6:43269949A>T	ENST00000372585.5	+	8	1168	c.1073A>T	c.(1072-1074)aAc>aTc	p.N358I	SLC22A7_ENST00000372589.3_Missense_Mutation_p.N356I|SLC22A7_ENST00000372574.3_Missense_Mutation_p.N356I	NM_153320.2	NP_696961.2	Q9Y694	S22A7_HUMAN	solute carrier family 22 (organic anion transporter), member 7	358					organic anion transport (GO:0015711)|response to stilbenoid (GO:0035634)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium-independent organic anion transmembrane transporter activity (GO:0015347)			NS(2)|endometrium(1)|kidney(1)|large_intestine(8)|lung(10)|prostate(1)|skin(3)	26			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00998)|OV - Ovarian serous cystadenocarcinoma(102;0.0305)		Acetylsalicylic acid(DB00945)|Allopurinol(DB00437)|Aminohippurate(DB00345)|Bumetanide(DB00887)|Cefalotin(DB00456)|Cefamandole(DB01326)|Cefoperazone(DB01329)|Cefotaxime(DB00493)|Cimetidine(DB00501)|Clarithromycin(DB01211)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Docetaxel(DB01248)|Enalapril(DB00584)|Erythromycin(DB00199)|Fluorouracil(DB00544)|Ganciclovir(DB01004)|Glyburide(DB01016)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Methotrexate(DB00563)|Minocycline(DB01017)|Oxtriphylline(DB01303)|Oxytetracycline(DB00595)|Pravastatin(DB00175)|Probenecid(DB01032)|Rifampicin(DB01045)|Salicylic acid(DB00936)|Testosterone(DB00624)|Tetracycline(DB00759)|Theophylline(DB00277)|Valproic Acid(DB00313)|Zalcitabine(DB00943)|Zidovudine(DB00495)	TTCGGAGTGAACTTCTCCTAT	0.562																																																	0								ENSG00000137204						128.0	120.0	122.0					6																	43269949		2203	4300	6503	SLC22A7	SO:0001583	missense	0			-	HGNC	AF097518	CCDS4892.1, CCDS4893.2	6p21.1	2013-05-22			ENSG00000137204	ENSG00000137204		"""Solute carriers"""	10971	protein-coding gene	gene with protein product		604995				9650585, 10773670	Standard	XM_006714970		Approved	NLT, OAT2	uc003out.3	Q9Y694	OTTHUMG00000014726	ENST00000372585.5:c.1073A>T	6.37:g.43269949A>T	ENSP00000361666:p.Asn358Ile	Somatic	0	86	0.00		0.599270127213081	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	57	25.97	B2CZX6|Q5T046|Q5T048|Q5T050|Q9H2W5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MFS,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Orgcat_transp	p.N358I	ENST00000372585.5	37	c.1073	CCDS4893.2	6	.	.	.	.	.	.	.	.	.	.	A	19.98	3.926265	0.73327	.	.	ENSG00000137204	ENST00000372589;ENST00000372585;ENST00000372574;ENST00000436107	T;T;T;D	0.82526	0.31;0.31;0.31;-1.62	5.27	5.27	0.74061	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.186903	0.47093	D	0.000250	D	0.82430	0.5035	L	0.52266	1.64	0.80722	D	1	P;P;D	0.57899	0.947;0.935;0.981	P;P;P	0.61722	0.893;0.828;0.888	D	0.85399	0.1130	10	0.87932	D	0	.	9.4249	0.38574	0.8211:0.1789:0.0:0.0	.	358;356;356	Q9Y694;Q9Y694-2;Q9Y694-3	S22A7_HUMAN;.;.	I	356;358;356;51	ENSP00000361670:N356I;ENSP00000361666:N358I;ENSP00000361655:N356I;ENSP00000393836:N51I	ENSP00000361655:N356I	N	+	2	0	SLC22A7	43377927	0.690000	0.27699	1.000000	0.80357	0.990000	0.78478	0.812000	0.27211	1.997000	0.58415	0.379000	0.24179	AAC	-	pfam_MFS,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Orgcat_transp		0.562	SLC22A7-004	KNOWN	basic|CCDS	protein_coding	SLC22A7	protein_coding	OTTHUMT00000040588.1	A		-		43269949	+1	no_errors	ENST00000372585	ensembl	human	known	74_37	missense	SNP	1.000	T
PRKDC	5591	genome.wustl.edu	37	8	48701570	48701570	+	Frame_Shift_Del	DEL	G	G	-			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr8:48701570delG	ENST00000314191.2	-	77	10852	c.10796delC	c.(10795-10797)cctfs	p.P3599fs	PRKDC_ENST00000338368.3_Frame_Shift_Del_p.P3599fs|PRKDC_ENST00000523565.1_5'UTR	NM_006904.6	NP_008835.5	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic polypeptide	3600					B cell lineage commitment (GO:0002326)|brain development (GO:0007420)|cellular protein modification process (GO:0006464)|cellular response to insulin stimulus (GO:0032869)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|ectopic germ cell programmed cell death (GO:0035234)|heart development (GO:0007507)|immunoglobulin V(D)J recombination (GO:0033152)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of protein phosphorylation (GO:0001933)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|pro-B cell differentiation (GO:0002328)|protein destabilization (GO:0031648)|regulation of circadian rhythm (GO:0042752)|response to gamma radiation (GO:0010332)|rhythmic process (GO:0048511)|signal transduction involved in mitotic G1 DNA damage checkpoint (GO:0072431)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell receptor V(D)J recombination (GO:0033153)|telomere maintenance (GO:0000723)	cytosol (GO:0005829)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription factor binding (GO:0008134)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(9)|cervix(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(30)|lung(56)|ovary(6)|pancreas(1)|prostate(8)|skin(7)	147		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)			Caffeine(DB00201)	TTTATTTACAGGGGTTTTTGC	0.378								Non-homologous end-joining																													Esophageal Squamous(79;1091 1253 12329 31680 40677)												0								ENSG00000253729						82.0	74.0	76.0					8																	48701570		1791	4062	5853	PRKDC	SO:0001589	frameshift_variant	0				HGNC		CCDS75734.1, CCDS75735.1	8q11	2014-09-17				ENSG00000253729	2.7.11.1		9413	protein-coding gene	gene with protein product		600899		HYRC, HYRC1		7638222	Standard	NM_001081640		Approved	DNPK1, p350, DNAPK, XRCC7, DNA-PKcs	uc003xqi.3	P78527		ENST00000314191.2:c.10796delC	8.37:g.48701570delG	ENSP00000313420:p.Pro3599fs	Somatic	0	65	0.00		0.599270127213081	10	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	55	32	63.22	P78528|Q13327|Q13337|Q14175|Q59H99|Q7Z611|Q96SE6|Q9UME3	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_NUC194,pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.P3599fs	ENST00000314191.2	37	c.10796		8																																																																																			-	NULL		0.378	PRKDC-201	KNOWN	basic|appris_principal	protein_coding	PRKDC	protein_coding		G	NM_001081640			48701570	-1	no_errors	ENST00000314191	ensembl	human	known	74_37	frame_shift_del	DEL	0.002	-
CES5A	221223	genome.wustl.edu	37	16	55909115	55909115	+	Missense_Mutation	SNP	G	G	T			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr16:55909115G>T	ENST00000290567.9	-	1	140	c.19C>A	c.(19-21)Cac>Aac	p.H7N	CES5A_ENST00000319165.9_Missense_Mutation_p.H7N|CES5A_ENST00000541580.1_Intron|CES5A_ENST00000518005.1_Intron|CES5A_ENST00000520435.1_Missense_Mutation_p.H7N|CES5A_ENST00000521992.1_Intron	NM_001143685.1	NP_001137157.1	Q6NT32	EST5A_HUMAN	carboxylesterase 5A	7						extracellular region (GO:0005576)	carboxylic ester hydrolase activity (GO:0052689)			breast(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(13)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	39						TGGCCTGGGTGCACCCAATTC	0.567																																																	0								ENSG00000159398						113.0	108.0	110.0					16																	55909115		2198	4300	6498	CES5A	SO:0001583	missense	0			-	HGNC	AK090997	CCDS10755.1, CCDS45490.1, CCDS54012.1	16q13	2010-10-12	2010-10-12	2010-10-12	ENSG00000159398	ENSG00000159398	3.1.1.1	"""Carboxylesterases"""	26459	protein-coding gene	gene with protein product			"""carboxylesterase 7"""	CES7		20931200	Standard	NM_145024		Approved	FLJ31547, CES4C1, CES5, CAUXIN	uc021tir.1	Q6NT32	OTTHUMG00000133236	ENST00000290567.9:c.19C>A	16.37:g.55909115G>T	ENSP00000290567:p.His7Asn	Somatic	0	52	0.00		0.599270127213081	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	44	18.52	B7Z252|B7ZLB6|Q8NBC8|Q96DN9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_CarbesteraseB,pfam_AB_hydrolase_3	p.H7N	ENST00000290567.9	37	c.19	CCDS45490.1	16	.	.	.	.	.	.	.	.	.	.	G	4.289	0.052877	0.08291	.	.	ENSG00000159398	ENST00000319165;ENST00000290567;ENST00000520435	T;T;T	0.67865	-0.29;-0.18;-0.29	4.31	0.19	0.15125	.	2.038100	0.02043	N	0.049443	T	0.49218	0.1544	N	0.19112	0.55	0.09310	N	1	B;P	0.36535	0.421;0.557	B;B	0.32864	0.107;0.154	T	0.39057	-0.9632	10	0.28530	T	0.3	.	6.6574	0.22994	0.3984:0.0:0.6016:0.0	.	7;7	Q6NT32;Q6NT32-2	EST5A_HUMAN;.	N	7	ENSP00000324271:H7N;ENSP00000290567:H7N;ENSP00000428887:H7N	ENSP00000290567:H7N	H	-	1	0	CES5A	54466616	0.000000	0.05858	0.020000	0.16555	0.029000	0.11900	0.187000	0.16998	0.081000	0.16988	-0.157000	0.13467	CAC	-	NULL		0.567	CES5A-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	CES5A	protein_coding	OTTHUMT00000256975.3	G	NM_145024	-		55909115	-1	no_errors	ENST00000290567	ensembl	human	known	74_37	missense	SNP	0.021	T
KIF19	124602	genome.wustl.edu	37	17	72339230	72339230	+	Silent	SNP	C	C	T			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr17:72339230C>T	ENST00000389916.4	+	5	525	c.387C>T	c.(385-387)aaC>aaT	p.N129N		NM_153209.3	NP_694941.2	Q2TAC6	KIF19_HUMAN	kinesin family member 19	129	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|axonemal microtubule depolymerization (GO:0060404)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|plus-end specific microtubule depolymerization (GO:0070462)	cilium (GO:0005929)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|plus-end-directed microtubule motor activity (GO:0008574)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(3)|lung(16)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	41						AGACCCTCAACGACCTCTTCC	0.592																																																	0								ENSG00000196169						97.0	75.0	82.0					17																	72339230		2203	4300	6503	KIF19	SO:0001819	synonymous_variant	0			-	HGNC	AK094619	CCDS32718.2	17q25	2007-02-13			ENSG00000196169	ENSG00000196169		"""Kinesins"""	26735	protein-coding gene	gene with protein product						11416179	Standard	NM_153209		Approved	FLJ37300, KIF19A	uc031rei.1	Q2TAC6	OTTHUMG00000150694	ENST00000389916.4:c.387C>T	17.37:g.72339230C>T		Somatic	0	46	0.00		0.599270127213081	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	25	21.88	A6NLG2|B7ZKR1|Q52M87|Q8N1X8|Q8TAB6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,prints_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	p.N129	ENST00000389916.4	37	c.387	CCDS32718.2	17																																																																																			-	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom		0.592	KIF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF19	protein_coding	OTTHUMT00000319644.2	C	NM_153209	-		72339230	+1	no_errors	ENST00000389916	ensembl	human	known	74_37	silent	SNP	0.903	T
M1AP	130951	genome.wustl.edu	37	2	74834340	74834340	+	Missense_Mutation	SNP	A	A	T			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr2:74834340A>T	ENST00000290536.5	-	4	553	c.437T>A	c.(436-438)cTg>cAg	p.L146Q	M1AP_ENST00000536235.1_Missense_Mutation_p.L146Q|M1AP_ENST00000358434.2_5'UTR|M1AP_ENST00000409585.1_Missense_Mutation_p.L146Q	NM_001281296.1|NM_138804.3	NP_001268225.1|NP_620159.2	Q8TC57	M1AP_HUMAN	meiosis 1 associated protein	146					cell differentiation (GO:0030154)|chromatin assembly (GO:0031497)|female gamete generation (GO:0007292)|male meiosis chromosome separation (GO:0051308)|RNA processing (GO:0006396)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)											CTGAGAAGTCAGAATAGTAAT	0.438																																																	0								ENSG00000159374						112.0	109.0	110.0					2																	74834340		2203	4300	6503	M1AP	SO:0001583	missense	0			-	HGNC		CCDS33229.1, CCDS62941.1	2p13.1	2013-02-05	2013-02-05	2013-01-16	ENSG00000159374	ENSG00000159374			25183	protein-coding gene	gene with protein product	"""meiosis 1 arresting protein"", ""spermatogenesis associated 37"""		"""chromosome 2 open reading frame 65"""	C2orf65		16881047, 23269666	Standard	NM_138804		Approved	D6Mm5e, SPATA37	uc002smy.3	Q8TC57	OTTHUMG00000152918	ENST00000290536.5:c.437T>A	2.37:g.74834340A>T	ENSP00000290536:p.Leu146Gln	Somatic	0	54	0.00		0.599270127213081	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00	B7Z6E7|E9PGG8|Q6ZP30|Q96L07	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.L146Q	ENST00000290536.5	37	c.437	CCDS33229.1	2	.	.	.	.	.	.	.	.	.	.	A	22.2	4.261989	0.80358	.	.	ENSG00000159374	ENST00000290536;ENST00000409585;ENST00000536235	T;T;T	0.54279	0.58;0.58;0.58	5.98	5.98	0.97165	.	0.159488	0.44285	D	0.000469	T	0.69958	0.3169	M	0.67953	2.075	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.73049	-0.4105	10	0.87932	D	0	-5.8058	12.8646	0.57932	1.0:0.0:0.0:0.0	.	146;146;146	E9PGG8;Q8TC57-2;Q8TC57	.;.;CB065_HUMAN	Q	146	ENSP00000290536:L146Q;ENSP00000386793:L146Q;ENSP00000445662:L146Q	ENSP00000290536:L146Q	L	-	2	0	C2orf65	74687848	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	5.592000	0.67543	2.296000	0.77279	0.482000	0.46254	CTG	-	NULL		0.438	M1AP-001	KNOWN	basic|CCDS	protein_coding	M1AP	protein_coding	OTTHUMT00000328569.1	A	NM_138804	-		74834340	-1	no_errors	ENST00000290536	ensembl	human	known	74_37	missense	SNP	1.000	T
MUC19	283463	genome.wustl.edu	37	12	40867002	40867002	+	Missense_Mutation	SNP	A	A	G			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr12:40867002A>G	ENST00000454784.4	+	45	4742	c.4009A>G	c.(4009-4011)Aca>Gca	p.T1337A				Q7Z5P9	MUC19_HUMAN	mucin 19, oligomeric	1337	Approximate repeats of G-V-T-G-T-T-G-P-S- A.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				lung(2)	2						CACAGCTGGAACATCAGGTAC	0.468																																																	0								ENSG00000205592																																			MUC19	SO:0001583	missense	0			-	HGNC	AY236870		12q12	2012-04-20	2006-03-14		ENSG00000205592	ENSG00000205592		"""Mucins"""	14362	protein-coding gene	gene with protein product		612170				12882755	Standard	NM_173600		Approved	FLJ35746	uc021qxa.1	Q7Z5P9	OTTHUMG00000060732	ENST00000454784.4:c.4009A>G	12.37:g.40867002A>G	ENSP00000476404:p.Thr1337Ala	Somatic	0	31	0.00		0.599270127213081	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	33	31.25	Q8NA85	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,smart_VWC_out,smart_VWF_type-D,smart_Unchr_dom_Cys-rich	p.T1337A	ENST00000454784.4	37	c.4009		12	.	.	.	.	.	.	.	.	.	.	A	9.529	1.110452	0.20714	.	.	ENSG00000205592	ENST00000425730	.	.	.	2.43	-4.86	0.03132	.	.	.	.	.	T	0.12817	0.0311	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.28332	-1.0047	6	0.11485	T	0.65	.	6.0008	0.19519	0.2843:0.2187:0.4971:0.0	.	.	.	.	A	1566	.	ENSP00000395253:T1566A	T	+	1	0	MUC19	39153269	0.000000	0.05858	0.000000	0.03702	0.020000	0.10135	-2.088000	0.01359	-1.748000	0.01332	0.338000	0.21704	ACA	-	NULL		0.468	MUC19-001	NOVEL	non_canonical_conserved|non_canonical_genome_sequence_error|basic|appris_principal	protein_coding	MUC19	protein_coding	OTTHUMT00000384257.6	A	XM_003403524	-		40867002	+1	no_errors	ENST00000454784	ensembl	human	novel	74_37	missense	SNP	0.000	G
MKRN3	7681	genome.wustl.edu	37	15	23811912	23811912	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr15:23811912G>A	ENST00000314520.3	+	1	1459	c.983G>A	c.(982-984)cGc>cAc	p.R328H	MKRN3_ENST00000564592.1_Intron|MKRN3_ENST00000568945.1_Intron|MKRN3_ENST00000568252.1_Intron|RP11-73C9.1_ENST00000563044.1_RNA	NM_005664.3	NP_005655.1	Q13064	MKRN3_HUMAN	makorin ring finger protein 3	328					protein ubiquitination (GO:0016567)	ribonucleoprotein complex (GO:0030529)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(33)|ovary(2)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	61		all_cancers(20;8.44e-25)|all_epithelial(15;3.69e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000353)|Colorectal(260;0.14)		all cancers(64;3.02e-06)|Epithelial(43;1.94e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0012)		AATGACCGCCGCTTTGGCATT	0.493																																																	0								ENSG00000179455						113.0	95.0	101.0					15																	23811912		2203	4300	6503	MKRN3	SO:0001583	missense	0			-	HGNC	U19107	CCDS10013.1	15q11-q13	2013-01-09	2008-08-13		ENSG00000179455	ENSG00000179455		"""RING-type (C3HC4) zinc fingers"""	7114	protein-coding gene	gene with protein product	"""zinc finger protein 127"""	603856		ZNF127, D15S9		10196367	Standard	NM_005664		Approved	RNF63, ZFP127, MGC88288	uc001ywh.4	Q13064	OTTHUMG00000129160	ENST00000314520.3:c.983G>A	15.37:g.23811912G>A	ENSP00000313881:p.Arg328His	Somatic	0	49	0.00		0.599270127213081	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	32	36.00		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C3HC4_RING-type,smart_Znf_CCCH,smart_Znf_RING,pfscan_Znf_RING	p.R328H	ENST00000314520.3	37	c.983	CCDS10013.1	15	.	.	.	.	.	.	.	.	.	.	G	23.3	4.399679	0.83120	.	.	ENSG00000179455	ENST00000314520	T	0.67698	-0.28	4.07	4.07	0.47477	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, C3HC4 RING-type (1);	0.000000	0.85682	D	0.000000	D	0.82563	0.5064	M	0.85041	2.73	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.85421	0.1143	10	0.72032	D	0.01	.	14.5895	0.68354	0.0:0.0:1.0:0.0	.	328	Q13064	MKRN3_HUMAN	H	328	ENSP00000313881:R328H	ENSP00000313881:R328H	R	+	2	0	MKRN3	21363005	1.000000	0.71417	1.000000	0.80357	0.727000	0.41649	8.986000	0.93492	2.567000	0.86603	0.655000	0.94253	CGC	-	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING		0.493	MKRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MKRN3	protein_coding	OTTHUMT00000251225.1	G	NM_005664	-		23811912	+1	no_errors	ENST00000314520	ensembl	human	known	74_37	missense	SNP	1.000	A
PAQR5	54852	genome.wustl.edu	37	15	69682069	69682069	+	Silent	SNP	C	C	A			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr15:69682069C>A	ENST00000340965.3	+	6	1130	c.462C>A	c.(460-462)gcC>gcA	p.A154A	PAQR5_ENST00000561153.1_Silent_p.A154A|PAQR5_ENST00000395407.2_Silent_p.A154A|RP11-253M7.6_ENST00000560870.1_RNA|PAQR5_ENST00000561027.1_3'UTR	NM_001104554.1	NP_001098024.1	Q9NXK6	MPRG_HUMAN	progestin and adipoQ receptor family member V	154					multicellular organismal development (GO:0007275)|oogenesis (GO:0048477)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)|steroid binding (GO:0005496)			endometrium(3)|kidney(2)|large_intestine(1)|lung(2)|ovary(2)|skin(1)	11						ACTACGTGGCCCTGGCTGTAC	0.582																																																	0								ENSG00000137819						166.0	122.0	137.0					15																	69682069		2199	4298	6497	PAQR5	SO:0001819	synonymous_variant	0			-	HGNC		CCDS10232.1	15q22.31	2012-08-10			ENSG00000137819	ENSG00000137819			29645	protein-coding gene	gene with protein product	"""membrane progestin receptor gamma"""	607781				12574519	Standard	NM_001104554		Approved	FLJ20190, MPRG	uc002arz.2	Q9NXK6	OTTHUMG00000133322	ENST00000340965.3:c.462C>A	15.37:g.69682069C>A		Somatic	0	53	0.00		0.599270127213081	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	34	15.00	Q8IXU2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_HlyIII-related	p.A154	ENST00000340965.3	37	c.462	CCDS10232.1	15																																																																																			-	pfam_HlyIII-related		0.582	PAQR5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PAQR5	protein_coding	OTTHUMT00000416671.1	C	NM_017705	-		69682069	+1	no_errors	ENST00000340965	ensembl	human	known	74_37	silent	SNP	0.213	A
THSD7B	80731	genome.wustl.edu	37	2	138373835	138373835	+	Nonsense_Mutation	SNP	C	C	T			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr2:138373835C>T	ENST00000409968.1	+	18	3692	c.3514C>T	c.(3514-3516)Cag>Tag	p.Q1172*	THSD7B_ENST00000543459.1_Intron|THSD7B_ENST00000272643.3_Nonsense_Mutation_p.Q1175*|THSD7B_ENST00000413152.2_Nonsense_Mutation_p.Q1144*			Q9C0I4	THS7B_HUMAN	thrombospondin, type I, domain containing 7B	1174	TSP type-1 14. {ECO:0000255|PROSITE- ProRule:PRU00210}.					integral component of membrane (GO:0016021)				NS(3)|breast(3)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(14)|lung(57)|ovary(4)|pancreas(3)|prostate(11)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	134				BRCA - Breast invasive adenocarcinoma(221;0.19)		CTCACAGGTGCAGCCTTGCCT	0.438																																																	0								ENSG00000144229						169.0	180.0	177.0					2																	138373835		2098	4223	6321	THSD7B	SO:0001587	stop_gained	0			-	HGNC			2q22.1	2006-11-24			ENSG00000144229	ENSG00000144229			29348	protein-coding gene	gene with protein product						11214970	Standard	NM_001080427		Approved	KIAA1679	uc002tva.1	Q9C0I4	OTTHUMG00000153590	ENST00000409968.1:c.3514C>T	2.37:g.138373835C>T	ENSP00000387145:p.Gln1172*	Somatic	0	39	0.00		0.599270127213081	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00		Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	p.Q1175*	ENST00000409968.1	37	c.3523		2	.	.	.	.	.	.	.	.	.	.	C	42	9.770890	0.99260	.	.	ENSG00000144229	ENST00000409968;ENST00000272643;ENST00000413152	.	.	.	5.2	4.3	0.51218	.	0.582307	0.19276	N	0.118295	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.26408	T	0.33	.	9.7545	0.40496	0.1587:0.6881:0.1532:0.0	.	.	.	.	X	1172;1175;1144	.	ENSP00000272643:Q1175X	Q	+	1	0	THSD7B	138090305	1.000000	0.71417	1.000000	0.80357	0.895000	0.52256	2.014000	0.40951	1.379000	0.46325	0.650000	0.86243	CAG	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt		0.438	THSD7B-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	THSD7B	protein_coding	OTTHUMT00000331769.2	C	XM_046570.9	-		138373835	+1	no_errors	ENST00000272643	ensembl	human	known	74_37	nonsense	SNP	0.993	T
UNC79	57578	genome.wustl.edu	37	14	94008839	94008839	+	Missense_Mutation	SNP	A	A	C			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr14:94008839A>C	ENST00000393151.2	+	14	1552	c.1552A>C	c.(1552-1554)Acg>Ccg	p.T518P	UNC79_ENST00000555664.1_Missense_Mutation_p.T518P|UNC79_ENST00000256339.4_Missense_Mutation_p.T341P|UNC79_ENST00000553484.1_Missense_Mutation_p.T518P			Q9P2D8	UNC79_HUMAN	unc-79 homolog (C. elegans)	518					behavioral response to ethanol (GO:0048149)|ion transmembrane transport (GO:0034220)|multicellular organism growth (GO:0035264)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(3)|cervix(2)|endometrium(10)|kidney(7)|large_intestine(18)|liver(1)|lung(64)|ovary(1)|prostate(5)|skin(3)|urinary_tract(4)	118						CAGTGAGAACACGCCTACAGA	0.468																																																	0								ENSG00000133958						88.0	71.0	77.0					14																	94008839		2203	4300	6503	UNC79	SO:0001583	missense	0			-	HGNC	AB037830	CCDS9911.2	14q32.13	2011-08-18	2011-08-18	2011-08-18	ENSG00000133958	ENSG00000133958			19966	protein-coding gene	gene with protein product			"""KIAA1409"""	KIAA1409		20714347, 21040849	Standard	NM_020818		Approved		uc001ybs.1	Q9P2D8	OTTHUMG00000029783	ENST00000393151.2:c.1552A>C	14.37:g.94008839A>C	ENSP00000376858:p.Thr518Pro	Somatic	0	69	0.00		0.599270127213081	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	75	15.73	B5MDL6|Q6ZUT7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_P-loop_NTPase,superfamily_ARM-type_fold	p.T518P	ENST00000393151.2	37	c.1552		14	.	.	.	.	.	.	.	.	.	.	A	27.0	4.786510	0.90367	.	.	ENSG00000133958	ENST00000256339;ENST00000555664;ENST00000553484;ENST00000393151;ENST00000393153	T;T;T;T	0.20598	2.06;2.06;2.06;2.06	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	T	0.42539	0.1207	L	0.52573	1.65	0.58432	D	0.999999	D	0.89917	1.0	D	0.83275	0.996	T	0.25537	-1.0129	10	0.72032	D	0.01	-16.4124	16.1673	0.81777	1.0:0.0:0.0:0.0	.	518	C9JQL1	.	P	341;518;518;518;518	ENSP00000256339:T341P;ENSP00000450868:T518P;ENSP00000451360:T518P;ENSP00000376858:T518P	ENSP00000256339:T341P	T	+	1	0	KIAA1409	93078592	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.292000	0.96076	2.207000	0.71202	0.533000	0.62120	ACG	-	NULL		0.468	UNC79-006	KNOWN	basic	protein_coding	UNC79	protein_coding	OTTHUMT00000412766.1	A	XM_028395	-		94008839	+1	no_errors	ENST00000553484	ensembl	human	known	74_37	missense	SNP	1.000	C
ASRGL1	80150	genome.wustl.edu	37	11	62156674	62156674	+	Silent	SNP	C	C	T	rs150568119	byFrequency	TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr11:62156674C>T	ENST00000415229.2	+	5	776	c.561C>T	c.(559-561)ggC>ggT	p.G187G	CTD-2531D15.5_ENST00000526045.1_RNA|ASRGL1_ENST00000301776.5_Silent_p.G187G|ASRGL1_ENST00000535727.1_Silent_p.G59G	NM_001083926.1	NP_001077395.1	Q7L266	ASGL1_HUMAN	asparaginase like 1	187					asparagine catabolic process via L-aspartate (GO:0033345)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	asparaginase activity (GO:0004067)|beta-aspartyl-peptidase activity (GO:0008798)			endometrium(1)|kidney(1)|lung(1)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	7					L-Asparagine(DB00174)|L-Aspartic Acid(DB00128)	CCTCCACAGGCGGTATCGTTA	0.542																																																	0								ENSG00000162174	C	,	1,4403		0,1,2201	125.0	117.0	120.0		561,561	-1.4	0.1	11	dbSNP_134	120	6,8592		0,6,4293	no	coding-synonymous,coding-synonymous	ASRGL1	NM_001083926.1,NM_025080.3	,	0,7,6494	TT,TC,CC		0.0698,0.0227,0.0538	,	187/309,187/309	62156674	7,12995	2202	4299	6501	ASRGL1	SO:0001819	synonymous_variant	0			-	HGNC		CCDS8019.1	11q12.3	2008-07-18			ENSG00000162174	ENSG00000162174			16448	protein-coding gene	gene with protein product	"""asparaginase-like 1 protein"""	609212					Standard	NM_025080		Approved	FLJ22316, ALP1, ALP	uc001ntf.4	Q7L266	OTTHUMG00000167513	ENST00000415229.2:c.561C>T	11.37:g.62156674C>T		Somatic	0	86	0.00		0.599270127213081	6	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	75	17.58	B2R7Q0|Q567Q4|Q6P1P0|Q8NI34|Q9H6F7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_T2	p.G187	ENST00000415229.2	37	c.561	CCDS8019.1	11																																																																																			-	pfam_Peptidase_T2		0.542	ASRGL1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ASRGL1	protein_coding	OTTHUMT00000394865.1	C	NM_001083926	rs150568119		62156674	+1	no_errors	ENST00000301776	ensembl	human	known	74_37	silent	SNP	0.965	T
MYH7B	57644	genome.wustl.edu	37	20	33583296	33583296	+	Missense_Mutation	SNP	A	A	G			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr20:33583296A>G	ENST00000262873.7	+	26	3076	c.2984A>G	c.(2983-2985)gAg>gGg	p.E995G		NM_020884.3	NP_065935.2	A7E2Y1	MYH7B_HUMAN	myosin, heavy chain 7B, cardiac muscle, beta	953						membrane (GO:0016020)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(5)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(19)|ovary(5)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	54			BRCA - Breast invasive adenocarcinoma(18;0.00691)			CTGGAGGACGAGTGCACGGAG	0.617																																																	0								ENSG00000078814						64.0	57.0	59.0					20																	33583296		2203	4300	6503	MYH7B	SO:0001583	missense	0			-	HGNC	AB040945	CCDS42869.1	20q11	2011-09-27	2006-09-29		ENSG00000078814	ENSG00000078814		"""Myosins / Myosin superfamily : Class II"""	15906	protein-coding gene	gene with protein product		609928	"""myosin, heavy polypeptide 7B, cardiac muscle, beta"""			11919279, 15014174	Standard	XM_006723839		Approved	KIAA1512, dJ756N5.1, MYH14, MHC14	uc002xbi.2	A7E2Y1	OTTHUMG00000032320	ENST00000262873.7:c.2984A>G	20.37:g.33583296A>G	ENSP00000262873:p.Glu995Gly	Somatic	0	48	0.00		0.599270127213081	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	40	9.09	Q5JVW7|Q6NT44|Q6NT57|Q6WG75|Q96I57|Q9NWE2|Q9P216	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Myosin_S1_N,superfamily_Prefoldin,superfamily_tRNA-bd_arm,superfamily_t-SNARE,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.E995G	ENST00000262873.7	37	c.2984	CCDS42869.1	20	.	.	.	.	.	.	.	.	.	.	A	29.4	5.006340	0.93287	.	.	ENSG00000078814	ENST00000262873	D	0.87029	-2.2	5.35	5.35	0.76521	.	0.000000	0.36338	N	0.002653	D	0.95890	0.8662	H	0.97564	4.03	0.58432	D	0.999999	D	0.76494	0.999	D	0.80764	0.994	D	0.97420	1.0008	10	0.87932	D	0	.	15.545	0.76090	1.0:0.0:0.0:0.0	.	953	A7E2Y1	MYH7B_HUMAN	G	995	ENSP00000262873:E995G	ENSP00000262873:E995G	E	+	2	0	MYH7B	33046957	1.000000	0.71417	0.993000	0.49108	0.865000	0.49528	9.135000	0.94478	2.266000	0.75297	0.529000	0.55759	GAG	-	superfamily_tRNA-bd_arm		0.617	MYH7B-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	MYH7B	protein_coding	OTTHUMT00000078833.2	A	NM_020884	-		33583296	+1	no_errors	ENST00000262873	ensembl	human	novel	74_37	missense	SNP	1.000	G
PCDHA2	56146	genome.wustl.edu	37	5	140175282	140175285	+	Frame_Shift_Del	DEL	TCAG	TCAG	-			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	TCAG	TCAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr5:140175282_140175285delTCAG	ENST00000526136.1	+	1	733_736	c.733_736delTCAG	c.(733-738)tcagttfs	p.SV245fs	PCDHA1_ENST00000394633.3_Intron|PCDHA2_ENST00000520672.2_Frame_Shift_Del_p.SV245fs|PCDHA2_ENST00000378132.1_Frame_Shift_Del_p.SV245fs|PCDHA1_ENST00000504120.2_Intron	NM_018905.2	NP_061728.1	Q9Y5H9	PCDA2_HUMAN	protocadherin alpha 2	245	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(16)|lung(26)|ovary(4)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTTTGCCCAATCAGTTTACAAAGT	0.417																																																	0								ENSG00000204969																																			PCDHA2	SO:0001589	frameshift_variant	0				HGNC	AF152480	CCDS54914.1, CCDS64269.1	5q31	2010-11-26				ENSG00000204969		"""Cadherins / Protocadherins : Clustered"""	8668	other	complex locus constituent	"""KIAA0345-like 12"""	606308				10380929	Standard	NM_018905		Approved			Q9Y5H9		ENST00000526136.1:c.733_736delTCAG	5.37:g.140175282_140175285delTCAG	ENSP00000431748:p.Ser245fs	Somatic	0	30	0.00		0.599270127213081	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	9	43.75	O75287|Q9BTV3	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.S245fs	ENST00000526136.1	37	c.733_736	CCDS54914.1	5																																																																																			-	superfamily_Cadherin-like,prints_Cadherin,pfscan_Cadherin		0.417	PCDHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA2	protein_coding	OTTHUMT00000372877.3	TCAG	NM_018905			140175285	+1	no_errors	ENST00000526136	ensembl	human	known	74_37	frame_shift_del	DEL	0.000:0.000:0.000:0.000	-
CHPF	79586	genome.wustl.edu	37	2	220405754	220405754	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr2:220405754G>A	ENST00000243776.6	-	3	1230	c.982C>T	c.(982-984)Cgt>Tgt	p.R328C	TMEM198_ENST00000373883.3_5'Flank|CHPF_ENST00000535926.1_Missense_Mutation_p.R166C|TMEM198_ENST00000344458.2_5'Flank	NM_024536.5	NP_078812	Q8IZ52	CHSS2_HUMAN	chondroitin polymerizing factor	328					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047238)|metal ion binding (GO:0046872)|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity (GO:0050510)			central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)	21		Renal(207;0.0183)		Epithelial(149;3.02e-08)|all cancers(144;3.41e-06)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00802)		ACAGGGTCACGCACAGGGTGG	0.602																																																	0								ENSG00000123989						87.0	70.0	76.0					2																	220405754		2203	4300	6503	CHPF	SO:0001583	missense	0			-	HGNC	BC008878	CCDS2443.1, CCDS56169.1	2q35	2014-02-12			ENSG00000123989	ENSG00000123989	2.4.1.175, 2.4.1.226	"""Beta 3-glycosyltransferases"", ""Beta 4-glycosyltransferases"""	24291	protein-coding gene	gene with protein product	"""chondroitin sulfate synthase 2"""	610405				11230166, 12716890	Standard	NM_024536		Approved	CSS2, CHSY2	uc002vmc.4	Q8IZ52	OTTHUMG00000058929	ENST00000243776.6:c.982C>T	2.37:g.220405754G>A	ENSP00000243776:p.Arg328Cys	Somatic	0	72	0.00		0.599270127213081	805	33.00	397	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	46	20.69	B4DXU0|Q6UXD6|Q7L4G1|Q9H0F8|Q9H618	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Chond_GalNAc	p.R328C	ENST00000243776.6	37	c.982	CCDS2443.1	2	.	.	.	.	.	.	.	.	.	.	G	15.61	2.883049	0.51908	.	.	ENSG00000123989	ENST00000243776;ENST00000535926	T;T	0.15834	2.39;2.39	4.63	3.68	0.42216	.	0.802027	0.11649	N	0.542939	T	0.22551	0.0544	L	0.34521	1.04	0.09310	N	0.999995	P	0.42518	0.782	P	0.49140	0.601	T	0.09975	-1.0650	10	0.39692	T	0.17	0.0	14.8615	0.70384	0.0:0.0:0.8564:0.1436	.	328	Q8IZ52	CHSS2_HUMAN	C	328;166	ENSP00000243776:R328C;ENSP00000445571:R166C	ENSP00000243776:R328C	R	-	1	0	CHPF	220113998	0.113000	0.22115	0.687000	0.30102	0.943000	0.58893	1.335000	0.33839	2.575000	0.86900	0.655000	0.94253	CGT	-	pfam_Chond_GalNAc		0.602	CHPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHPF	protein_coding	OTTHUMT00000130268.1	G	NM_024536	-		220405754	-1	no_errors	ENST00000243776	ensembl	human	known	74_37	missense	SNP	0.078	A
TAOK3	51347	genome.wustl.edu	37	12	118604619	118604619	+	Intron	SNP	G	G	A	rs370989080|rs535817182		TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr12:118604619G>A	ENST00000392533.3	-	18	2390				AC026366.1_ENST00000408353.1_RNA|TAOK3_ENST00000537952.1_Intron|TAOK3_ENST00000419821.2_Intron	NM_016281.3	NP_057365.3	Q9H2K8	TAOK3_HUMAN	TAO kinase 3						cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|MAPK cascade (GO:0000165)|mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of JNK cascade (GO:0046329)|negative regulation of protein kinase activity (GO:0006469)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase inhibitor activity (GO:0004860)|protein serine/threonine kinase activity (GO:0004674)|transferase activity (GO:0016740)			central_nervous_system(1)|lung(5)|skin(1)	7	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GTGTGTGTGTGTATATATATA	0.378																																																	0								ENSG00000221280																																			AC026366.1	SO:0001627	intron_variant	0			-	Clone_based_ensembl_gene	AF135158	CCDS9188.1	12q	2007-08-03				ENSG00000135090			18133	protein-coding gene	gene with protein product						10559204, 10924369	Standard	NM_016281		Approved	JIK, DPK, MAP3K18	uc001twy.4	Q9H2K8		ENST00000392533.3:c.1900-4787C>T	12.37:g.118604619G>A		Somatic	0	29	0.00		0.599270127213081	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	22	18.52	Q658N1|Q8IUM4|Q9HC79|Q9NZM9|Q9UHG7	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000392533.3	37	NULL	CCDS9188.1	12																																																																																			-	-		0.378	TAOK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000221280	protein_coding	OTTHUMT00000401456.2	G	NM_016281	-		118604619	+1	no_errors	ENST00000408353	ensembl	human	novel	74_37	rna	SNP	0.000	A
EYS	346007	genome.wustl.edu	37	6	66204592	66204592	+	Missense_Mutation	SNP	G	G	T			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr6:66204592G>T	ENST00000370621.3	-	4	1238	c.712C>A	c.(712-714)Caa>Aaa	p.Q238K	EYS_ENST00000503581.1_Missense_Mutation_p.Q238K|EYS_ENST00000393380.2_Missense_Mutation_p.Q238K|EYS_ENST00000342421.5_Missense_Mutation_p.Q238K|EYS_ENST00000370616.2_Missense_Mutation_p.Q238K|EYS_ENST00000370618.3_Missense_Mutation_p.Q238K			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)	238	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.				detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)	p.Q238K(2)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						TCATATGCTTGCTCATCCCAA	0.303																																																	2	Substitution - Missense(2)	lung(2)						ENSG00000188107						21.0	21.0	21.0					6																	66204592		2202	4297	6499	EYS	SO:0001583	missense	0			-	HGNC		CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.712C>A	6.37:g.66204592G>T	ENSP00000359655:p.Gln238Lys	Somatic	0	51	0.00		0.599270127213081	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00	A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Laminin_G,pfam_EG-like_dom,superfamily_ConA-like_lec_gl_sf,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G	p.Q238K	ENST00000370621.3	37	c.712		6	.	.	.	.	.	.	.	.	.	.	G	3.134	-0.177806	0.06380	.	.	ENSG00000188107	ENST00000503581;ENST00000370621;ENST00000370616;ENST00000393380;ENST00000342421;ENST00000370618	D;D;D;D;D;D	0.87571	-2.27;-2.27;-2.27;-2.27;-2.27;-2.27	4.69	1.71	0.24356	.	.	.	.	.	T	0.65428	0.2690	N	0.17345	0.48	0.09310	N	1	P;P;P	0.43826	0.557;0.782;0.818	B;B;P	0.47864	0.116;0.423;0.559	T	0.60535	-0.7244	9	0.44086	T	0.13	.	1.076	0.01632	0.2078:0.1767:0.4332:0.1823	.	238;238;238	Q5T1H1-1;Q5T1H1-2;Q5SZM4	.;.;.	K	238	ENSP00000424243:Q238K;ENSP00000359655:Q238K;ENSP00000359650:Q238K;ENSP00000377042:Q238K;ENSP00000341818:Q238K;ENSP00000359652:Q238K	ENSP00000341818:Q238K	Q	-	1	0	EYS	66261313	0.151000	0.22747	0.068000	0.19968	0.416000	0.31233	0.684000	0.25364	1.078000	0.41014	0.591000	0.81541	CAA	-	pfam_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom		0.303	EYS-001	KNOWN	basic	protein_coding	EYS	protein_coding	OTTHUMT00000351351.3	G	XM_294050	-		66204592	-1	no_errors	ENST00000370616	ensembl	human	known	74_37	missense	SNP	0.000	T
AOX2P	344454	genome.wustl.edu	37	2	201619757	201619758	+	IGR	INS	-	-	TGTGTGTG	rs71022335|rs35856862|rs563268698	byFrequency	TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr2:201619757_201619758insTGTGTGTG								AC007163.3 (19857 upstream) : AOX2P (7272 downstream)																							TCCTTTCAAATtgtgtgtgtgt	0.401																																																	0								ENSG00000243478																																			AOX2P	SO:0001628	intergenic_variant	0				HGNC																													2.37:g.201619758_201619765dupTGTGTGTG		Somatic	NA	NA	NA		0.599270127213081	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL		37	NULL		2																																																																																			-	-	0	0.401					AOX2P			-				201619758	+1	no_errors	ENST00000472376	ensembl	human	known	74_37	rna	INS	0.000:0.000	TGTGTGTG
STK36	27148	genome.wustl.edu	37	2	219561892	219561892	+	Missense_Mutation	SNP	G	G	A	rs375090724		TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr2:219561892G>A	ENST00000295709.3	+	23	2996	c.2717G>A	c.(2716-2718)aGt>aAt	p.S906N	STK36_ENST00000392105.3_Missense_Mutation_p.S885N|STK36_ENST00000392106.2_Missense_Mutation_p.S885N|STK36_ENST00000440309.1_Missense_Mutation_p.S906N	NM_015690.4	NP_056505.2			serine/threonine kinase 36											biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(6)|lung(20)|ovary(4)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	52		Renal(207;0.0915)		Epithelial(149;9.65e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(261;0.00984)		TCGCTATCCAGTCCACCAAGC	0.532																																																	0								ENSG00000163482						111.0	115.0	114.0					2																	219561892		2203	4300	6503	STK36	SO:0001583	missense	0			-	HGNC	AB033104	CCDS2421.1, CCDS58750.1	2q35	2010-06-25	2010-06-25		ENSG00000163482	ENSG00000163482			17209	protein-coding gene	gene with protein product	"""fused homolog (Drosophila)"""	607652	"""serine/threonine kinase 36 (fused homolog, Drosophila)"""			10806483	Standard	NM_001243313		Approved	KIAA1278, FU	uc002viu.3	Q9NRP7	OTTHUMG00000133079	ENST00000295709.3:c.2717G>A	2.37:g.219561892G>A	ENSP00000295709:p.Ser906Asn	Somatic	0	29	0.00		0.599270127213081	9	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	13	18.75		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.S906N	ENST00000295709.3	37	c.2717	CCDS2421.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	0.005|0.005	-2.145565|-2.145565	0.00332|0.00332	.|.	.|.	ENSG00000163482|ENSG00000163482	ENST00000295709;ENST00000392106;ENST00000392105;ENST00000440309|ENST00000431040	T;T;T;T|.	0.71461|.	-0.52;-0.56;-0.57;-0.52|.	5.02|5.02	0.0563|0.0563	0.14319|0.14319	.|.	0.279809|.	0.25514|.	N|.	0.030160|.	T|T	0.22820|0.22820	0.0551|0.0551	N|N	0.24115|0.24115	0.695|0.695	0.09310|0.09310	N|N	1|1	B;B;B|.	0.23735|.	0.09;0.082;0.002|.	B;B;B|.	0.26416|.	0.034;0.069;0.003|.	T|T	0.28170|0.28170	-1.0052|-1.0052	10|5	0.28530|.	T|.	0.3|.	3.9809|3.9809	6.4372|6.4372	0.21829|0.21829	0.2873:0.0:0.5925:0.1202|0.2873:0.0:0.5925:0.1202	.|.	885;885;906|.	A8MU99;Q9NRP7-2;Q9NRP7|.	.;.;STK36_HUMAN|.	N|I	906;885;885;906|99	ENSP00000295709:S906N;ENSP00000375955:S885N;ENSP00000375954:S885N;ENSP00000394095:S906N|.	ENSP00000295709:S906N|.	S|V	+|+	2|1	0|0	STK36|STK36	219270136|219270136	0.002000|0.002000	0.14202|0.14202	0.001000|0.001000	0.08648|0.08648	0.055000|0.055000	0.15305|0.15305	0.372000|0.372000	0.20467|0.20467	-0.433000|-0.433000	0.07286|0.07286	-0.797000|-0.797000	0.03246|0.03246	AGT|GTC	-	NULL		0.532	STK36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STK36	protein_coding	OTTHUMT00000256723.2	G		-		219561892	+1	no_errors	ENST00000295709	ensembl	human	known	74_37	missense	SNP	0.000	A
PTPN1	5770	genome.wustl.edu	37	20	49195040	49195040	+	Missense_Mutation	SNP	G	G	T	rs376902895		TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr20:49195040G>T	ENST00000371621.3	+	6	750	c.576G>T	c.(574-576)ttG>ttT	p.L192F	PTPN1_ENST00000541713.1_Missense_Mutation_p.L119F|RP4-530I15.9_ENST00000431019.1_RNA	NM_001278618.1|NM_002827.2	NP_001265547.1|NP_002818.1	P18031	PTN1_HUMAN	protein tyrosine phosphatase, non-receptor type 1	192	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				actin cytoskeleton reorganization (GO:0031532)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|endoplasmic reticulum unfolded protein response (GO:0030968)|insulin receptor signaling pathway (GO:0008286)|interferon-gamma-mediated signaling pathway (GO:0060333)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|peptidyl-tyrosine dephosphorylation (GO:0035335)|peptidyl-tyrosine dephosphorylation involved in inactivation of protein kinase activity (GO:1990264)|platelet activation (GO:0030168)|platelet-derived growth factor receptor-beta signaling pathway (GO:0035791)|regulation of endocytosis (GO:0030100)|regulation of hepatocyte growth factor receptor signaling pathway (GO:1902202)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of signal transduction (GO:0009966)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|type I interferon signaling pathway (GO:0060337)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|sorting endosome (GO:0097443)	enzyme binding (GO:0019899)|ephrin receptor binding (GO:0046875)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|receptor tyrosine kinase binding (GO:0030971)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(5)|skin(2)	16		Lung NSC(126;0.163)			Tiludronate(DB01133)	CCTCATTCTTGAACTTTCTTT	0.507																																																	0								ENSG00000196396						161.0	166.0	164.0					20																	49195040		2203	4300	6503	PTPN1	SO:0001583	missense	0			-	HGNC		CCDS13430.1, CCDS63309.1	20q13.1-q13.2	2011-06-09			ENSG00000196396	ENSG00000196396		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9642	protein-coding gene	gene with protein product		176885		PTP1B		2164224	Standard	NM_002827		Approved		uc002xvl.3	P18031	OTTHUMG00000032729	ENST00000371621.3:c.576G>T	20.37:g.49195040G>T	ENSP00000360683:p.Leu192Phe	Somatic	0	56	0.00		0.599270127213081	32	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	Q5TGD8|Q9BQV9|Q9NQQ4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_Ptpn1/Ptpn2,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_rcpt/non-rcpt,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	p.L192F	ENST00000371621.3	37	c.576	CCDS13430.1	20	.	.	.	.	.	.	.	.	.	.	G	17.41	3.383178	0.61845	.	.	ENSG00000196396	ENST00000371621;ENST00000541713	D;D	0.86230	-2.09;-2.09	5.24	-1.62	0.08372	Protein-tyrosine phosphatase, receptor/non-receptor type (3);Protein-tyrosine/Dual-specificity phosphatase (1);	0.000000	0.53938	D	0.000055	D	0.91885	0.7431	M	0.92219	3.285	0.58432	D	0.999999	D	0.71674	0.998	D	0.68765	0.96	D	0.87798	0.2623	10	0.87932	D	0	.	3.2933	0.06957	0.0962:0.3702:0.2506:0.283	.	192	P18031	PTN1_HUMAN	F	192;119	ENSP00000360683:L192F;ENSP00000437732:L119F	ENSP00000360683:L192F	L	+	3	2	PTPN1	48628447	0.435000	0.25577	0.976000	0.42696	0.932000	0.56968	-0.208000	0.09371	0.147000	0.19030	0.462000	0.41574	TTG	-	pirsf_Ptpn1/Ptpn2,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt		0.507	PTPN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPN1	protein_coding	OTTHUMT00000079694.2	G		-		49195040	+1	no_errors	ENST00000371621	ensembl	human	known	74_37	missense	SNP	0.738	T
NRXN1	9378	genome.wustl.edu	37	2	50923314	50923319	+	Intron	DEL	GTGTGT	GTGTGT	-	rs202071380|rs201534178|rs200473527		TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	GTGTGT	GTGTGT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr2:50923314_50923319delGTGTGT	ENST00000406316.2	-	6	2309				NRXN1_ENST00000402717.3_Intron|NRXN1_ENST00000404971.1_Intron|NRXN1_ENST00000406859.3_Intron|NRXN1_ENST00000405472.3_Intron|NRXN1_ENST00000401669.2_Intron|AC009234.2_ENST00000401372.1_RNA	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1						adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			Gtacatatacgtgtgtgtgtgtgtgt	0.437																																																	0								ENSG00000216191																																			AC009234.2	SO:0001627	intron_variant	0				Clone_based_ensembl_gene	AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.833-72561ACACAC>-	2.37:g.50923320_50923325delGTGTGT		Somatic	NA	NA	NA		0.599270127213081	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000406316.2	37	NULL	CCDS54360.1	2																																																																																			-	-		0.437	NRXN1-001	KNOWN	basic|CCDS	protein_coding	ENSG00000216191	protein_coding	OTTHUMT00000325291.2	GTGTGT				50923319	-1	no_errors	ENST00000401372	ensembl	human	novel	74_37	rna	DEL	0.006:0.004:0.003:0.002:0.002:0.000	-
ZNF536	9745	genome.wustl.edu	37	19	30935048	30935048	+	Silent	SNP	C	C	T			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr19:30935048C>T	ENST00000355537.3	+	2	726	c.579C>T	c.(577-579)cgC>cgT	p.R193R		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	193					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)			NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					GGCGTGTGCGCGAGGAGAACC	0.692																																																	0								ENSG00000198597						17.0	13.0	15.0					19																	30935048		2193	4290	6483	ZNF536	SO:0001819	synonymous_variant	0			-	HGNC		CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.579C>T	19.37:g.30935048C>T		Somatic	0	48	0.00		0.599270127213081	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	55	9.84	A2RU18	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R193	ENST00000355537.3	37	c.579	CCDS32984.1	19																																																																																			-	NULL		0.692	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF536	protein_coding	OTTHUMT00000459667.2	C	NM_014717	-		30935048	+1	no_errors	ENST00000355537	ensembl	human	known	74_37	silent	SNP	0.622	T
FBXO5	26271	genome.wustl.edu	37	6	153293556	153293556	+	Frame_Shift_Del	DEL	T	T	-			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr6:153293556delT	ENST00000229758.3	-	4	1001	c.943delA	c.(943-945)accfs	p.T315fs	FBXO5_ENST00000477822.1_5'UTR|FBXO5_ENST00000367241.3_Frame_Shift_Del_p.T269fs	NM_012177.3	NP_036309.1	Q9UKT4	FBX5_HUMAN	F-box protein 5	315					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|G1/S transition of mitotic cell cycle (GO:0000082)|inhibition of mitotic anaphase-promoting complex activity (GO:0060565)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|microtubule polymerization (GO:0046785)|mitotic cell cycle (GO:0000278)|negative regulation of meiosis (GO:0045835)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|oocyte maturation (GO:0001556)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|spindle assembly involved in female meiosis I (GO:0007057)|vesicle organization (GO:0016050)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(3)|prostate(2)|upper_aerodigestive_tract(1)	15		Ovarian(120;0.125)		OV - Ovarian serous cystadenocarcinoma(155;4.38e-10)|BRCA - Breast invasive adenocarcinoma(81;0.0893)		TATTCTCTGGTTGAAGCATGA	0.323																																					NSCLC(121;372 1757 17721 17977 29669)												0								ENSG00000112029						98.0	96.0	97.0					6																	153293556		2203	4300	6503	FBXO5	SO:0001589	frameshift_variant	0				HGNC	AF129535	CCDS5242.1, CCDS47501.1	6q25-q26	2008-02-05	2004-06-15		ENSG00000112029	ENSG00000112029		"""F-boxes /  ""other"""""	13584	protein-coding gene	gene with protein product		606013	"""F-box only protein 5"""			10531035, 10531037	Standard	NM_012177		Approved	FBX5, Fbxo31, EMI1	uc003qpg.3	Q9UKT4	OTTHUMG00000015854	ENST00000229758.3:c.943delA	6.37:g.153293556delT	ENSP00000229758:p.Thr315fs	Somatic	0	48	0.00		0.599270127213081	57	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	44	13.73	B3KNX5|Q5TF47|Q8WV29|Q9UGC8	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_F-box_dom,superfamily_F-box_dom	p.T315fs	ENST00000229758.3	37	c.943	CCDS5242.1	6																																																																																			-	NULL		0.323	FBXO5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO5	protein_coding	OTTHUMT00000042757.1	T				153293556	-1	no_errors	ENST00000229758	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
WBP1L	54838	genome.wustl.edu	37	10	104572682	104572683	+	Frame_Shift_Ins	INS	-	-	G	rs138842285|rs146098584	byFrequency	TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr10:104572682_104572683insG	ENST00000369889.4	+	4	765_766	c.623_624insG	c.(622-627)ccggggfs	p.PG208fs	WBP1L_ENST00000448841.1_Frame_Shift_Ins_p.PG229fs	NM_017787.4	NP_060257.4	Q9NX94	WBP1L_HUMAN	WW domain binding protein 1-like	208						integral component of membrane (GO:0016021)											GAGCTGGACCCGGGGGCCTTCC	0.619																																																	0								ENSG00000166272																																			WBP1L	SO:0001589	frameshift_variant	0				HGNC	AK056285	CCDS7540.1, CCDS44473.1	10q24.33	2012-05-02	2012-05-02	2012-05-02	ENSG00000166272	ENSG00000166272			23510	protein-coding gene	gene with protein product	"""outcome predictor in acute leukemia 1"""	611129	"""chromosome 10 open reading frame 26"""	C10orf26			Standard	NM_017787		Approved	FLJ20154, OPAL1	uc001kwf.4	Q9NX94	OTTHUMG00000018968	ENST00000369889.4:c.628dupG	10.37:g.104572687_104572687dupG	ENSP00000358905:p.Pro208fs	Somatic	0	57	0.00		0.599270127213081	30	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	31	8.82	B3KPF4|B7Z6S7|D3DR90|Q1EG70|Q2HIY7|Q5F2G6	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_Uncharacterised_WW-bd	p.A231fs	ENST00000369889.4	37	c.686_687	CCDS7540.1	10																																																																																			-	NULL		0.619	WBP1L-001	KNOWN	basic|CCDS	protein_coding	WBP1L	protein_coding	OTTHUMT00000050100.1	-	NM_017787			104572683	+1	no_errors	ENST00000448841	ensembl	human	known	74_37	frame_shift_ins	INS	0.540:0.000	G
LAMA5	3911	genome.wustl.edu	37	20	60889624	60889624	+	Missense_Mutation	SNP	A	A	T			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr20:60889624A>T	ENST00000252999.3	-	61	8420	c.8354T>A	c.(8353-8355)aTg>aAg	p.M2785K		NM_005560.3	NP_005551.3	O15230	LAMA5_HUMAN	laminin, alpha 5	2785	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				angiogenesis (GO:0001525)|branching involved in salivary gland morphogenesis (GO:0060445)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell recognition (GO:0008037)|cilium assembly (GO:0042384)|cytoskeleton organization (GO:0007010)|embryo development (GO:0009790)|endothelial cell differentiation (GO:0045446)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|focal adhesion assembly (GO:0048041)|hair follicle development (GO:0001942)|integrin-mediated signaling pathway (GO:0007229)|lung development (GO:0030324)|morphogenesis of a polarized epithelium (GO:0001738)|morphogenesis of embryonic epithelium (GO:0016331)|muscle organ development (GO:0007517)|neural crest cell migration (GO:0001755)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of embryonic development (GO:0045995)|substrate adhesion-dependent cell spreading (GO:0034446)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)|laminin-5 complex (GO:0005610)|nucleus (GO:0005634)	integrin binding (GO:0005178)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|lung(40)|ovary(1)|pancreas(1)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	81	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			GCGGCTGCCCATGTACATCAC	0.637																																																	0								ENSG00000130702						50.0	54.0	53.0					20																	60889624		2203	4298	6501	LAMA5	SO:0001583	missense	0			-	HGNC	AF443072	CCDS33502.1	20q13.2-q13.3	2013-03-01			ENSG00000130702	ENSG00000130702		"""Laminins"""	6485	protein-coding gene	gene with protein product		601033				9271224	Standard	NM_005560		Approved		uc002ycq.3	O15230	OTTHUMG00000032908	ENST00000252999.3:c.8354T>A	20.37:g.60889624A>T	ENSP00000252999:p.Met2785Lys	Somatic	0	41	0.00		0.599270127213081	15	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	34	10.53	Q8TDF8|Q8WZA7|Q9H1P1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_EGF_laminin,pfam_Laminin_I,pfam_Laminin_G,pfam_Laminin_N,pfam_Laminin_II,pfam_Laminin_B_type_IV,superfamily_ConA-like_lec_gl_sf,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N,pfscan_TNFR/NGFR_Cys_rich_reg	p.M2785K	ENST00000252999.3	37	c.8354	CCDS33502.1	20	.	.	.	.	.	.	.	.	.	.	a	20.4	3.986127	0.74589	.	.	ENSG00000130702	ENST00000252999	T	0.77877	-1.13	3.88	3.88	0.44766	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.064906	0.64402	U	0.000006	T	0.79764	0.4502	L	0.51422	1.61	0.80722	D	1	D	0.53619	0.961	P	0.54759	0.76	T	0.81337	-0.0978	10	0.87932	D	0	.	10.9185	0.47150	1.0:0.0:0.0:0.0	.	2785	O15230	LAMA5_HUMAN	K	2785	ENSP00000252999:M2785K	ENSP00000252999:M2785K	M	-	2	0	LAMA5	60323019	1.000000	0.71417	1.000000	0.80357	0.799000	0.45148	5.874000	0.69652	1.396000	0.46663	0.375000	0.23000	ATG	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,pfscan_Laminin_G		0.637	LAMA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA5	protein_coding	OTTHUMT00000080014.2	A	NM_005560	-		60889624	-1	no_errors	ENST00000252999	ensembl	human	known	74_37	missense	SNP	1.000	T
AKR7A2	8574	genome.wustl.edu	37	1	19638441	19638441	+	Missense_Mutation	SNP	C	C	A			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr1:19638441C>A	ENST00000235835.3	-	1	199	c.178G>T	c.(178-180)Gtg>Ttg	p.V60L	PQLC2_ENST00000400548.2_5'Flank|PQLC2_ENST00000375155.3_5'Flank|PQLC2_ENST00000375153.3_5'Flank	NM_003689.3	NP_003680.2	O43488	ARK72_HUMAN	aldo-keto reductase family 7, member A2 (aflatoxin aldehyde reductase)	60					carbohydrate metabolic process (GO:0005975)|cellular aldehyde metabolic process (GO:0006081)|daunorubicin metabolic process (GO:0044597)|doxorubicin metabolic process (GO:0044598)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	alditol:NADP+ 1-oxidoreductase activity (GO:0004032)|electron carrier activity (GO:0009055)|phenanthrene-9,10-epoxide hydrolase activity (GO:0019119)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	9		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Breast(348;0.00049)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00461)|BRCA - Breast invasive adenocarcinoma(304;1.83e-05)|Kidney(64;0.000167)|GBM - Glioblastoma multiforme(114;0.00115)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		AAGGCGCGCACGGCCGCGGCG	0.746																																																	0								ENSG00000053371						6.0	8.0	7.0					1																	19638441		2137	4202	6339	AKR7A2	SO:0001583	missense	0			-	HGNC	AF026947	CCDS194.1	1p36.13	2010-09-30			ENSG00000053371	ENSG00000053371		"""Aldo-keto reductases"""	389	protein-coding gene	gene with protein product		603418				9576847	Standard	NM_003689		Approved	AFAR	uc001bbw.3	O43488	OTTHUMG00000002522	ENST00000235835.3:c.178G>T	1.37:g.19638441C>A	ENSP00000235835:p.Val60Leu	Somatic	0	12	0.00		0.599270127213081	12	45.45	10	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	9	30.77	O75749|Q5TG63	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_NADP_OxRdtase_dom,superfamily_NADP_OxRdtase_dom	p.V60L	ENST00000235835.3	37	c.178	CCDS194.1	1	.	.	.	.	.	.	.	.	.	.	C	13.10	2.135666	0.37728	.	.	ENSG00000053371	ENST00000235835;ENST00000330072	T;T	0.18338	2.22;2.22	4.38	4.38	0.52667	NADP-dependent oxidoreductase domain (3);	0.070993	0.56097	D	0.000034	T	0.07999	0.0200	N	0.11427	0.14	0.45607	D	0.99854	B;B;B	0.09022	0.001;0.002;0.002	B;B;B	0.15052	0.009;0.009;0.012	T	0.10382	-1.0632	10	0.02654	T	1	.	12.6797	0.56914	0.0:0.8327:0.1673:0.0	.	31;31;60	C9JSL3;B4DZX4;O43488	.;.;ARK72_HUMAN	L	60;50	ENSP00000235835:V60L;ENSP00000339084:V50L	ENSP00000235835:V60L	V	-	1	0	AKR7A2	19511028	1.000000	0.71417	0.943000	0.38184	0.369000	0.29798	2.718000	0.47236	2.165000	0.68154	0.305000	0.20034	GTG	-	pfam_NADP_OxRdtase_dom,superfamily_NADP_OxRdtase_dom		0.746	AKR7A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKR7A2	protein_coding	OTTHUMT00000007165.2	C	NM_003689	-		19638441	-1	no_errors	ENST00000235835	ensembl	human	known	74_37	missense	SNP	0.994	A
SI	6476	genome.wustl.edu	37	3	164700196	164700196	+	Silent	SNP	G	G	T			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr3:164700196G>T	ENST00000264382.3	-	47	5312	c.5250C>A	c.(5248-5250)acC>acA	p.T1750T		NM_001041.3	NP_001032.2	P14410	SUIS_HUMAN	sucrase-isomaltase (alpha-glucosidase)	1750	Sucrase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	brush border (GO:0005903)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|oligo-1,6-glucosidase activity (GO:0004574)|sucrose alpha-glucosidase activity (GO:0004575)			NS(4)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(6)|kidney(10)|large_intestine(18)|lung(124)|ovary(9)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(16)|urinary_tract(1)	218		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)|Scopolamine(DB00747)	TTGTTAAGGTGGTCTATAAAT	0.318										HNSCC(35;0.089)																																							0								ENSG00000090402						88.0	86.0	87.0					3																	164700196		2202	4300	6502	SI	SO:0001819	synonymous_variant	0			-	HGNC	X63597	CCDS3196.1	3q25.2-q26.2	2004-04-06	2004-04-06		ENSG00000090402	ENSG00000090402	3.2.1.10		10856	protein-coding gene	gene with protein product	"""Oligosaccharide alpha-1,6-glucosidase"""	609845	"""sucrase-isomaltase"""			2962903, 1353958	Standard	NM_001041		Approved		uc003fei.3	P14410	OTTHUMG00000158065	ENST00000264382.3:c.5250C>A	3.37:g.164700196G>T		Somatic	0	40	0.00		0.599270127213081	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	33	10.81	A2RUC3|Q1JQ80|Q1RMC2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Glyco_hydro_31,pfam_P_trefoil,superfamily_Glycoside_hydrolase_SF,superfamily_Gal_mutarotase_SF_dom,smart_P_trefoil	p.T1750	ENST00000264382.3	37	c.5250	CCDS3196.1	3																																																																																			-	NULL		0.318	SI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SI	protein_coding	OTTHUMT00000350116.1	G	NM_001041	-		164700196	-1	no_errors	ENST00000264382	ensembl	human	known	74_37	silent	SNP	0.001	T
SNORD3B-1	26851	genome.wustl.edu	37	17	18967187	18967187	+	lincRNA	SNP	G	G	A			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr17:18967187G>A	ENST00000363359.1	+	0	432				SNORD3B-2_ENST00000364880.1_lincRNA					small nucleolar RNA, C/D box 3B-1																		GAAACGCCCCGGAGTTTACGA	0.547																																																	0								ENSG00000262074						68.0	166.0	145.0					17																	18967187		506	1952	2458	SNORD3B-2			0			-	HGNC	AF020534, AF020533, AF020532		17p11.2	2013-09-05	2006-11-28	2006-11-28	ENSG00000200229	ENSG00000265185			10168	non-coding RNA	RNA, small nucleolar			"""RNA, U3A1 small nucleolar, RNA, U3A1 small nucleolar"""	RNU3A1		9365252	Standard	NR_003271		Approved	U3a, U3b1, U3b2					17.37:g.18967187G>A		Somatic	0	68	0.00		0.599270127213081	5	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	133	10.07		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000363359.1	37	NULL		17																																																																																			-	-		0.547	SNORD3B-1-201	KNOWN	basic	snoRNA	SNORD3B-2	lincRNA		G	NR_003271	-		18967187	-1	no_errors	ENST00000571722	ensembl	human	known	74_37	rna	SNP	0.000	A
SEC22B	9554	genome.wustl.edu	37	1	145112520	145112520	+	RNA	SNP	G	G	C			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr1:145112520G>C	ENST00000453618.1	+	0	820							O75396	SC22B_HUMAN	SEC22 vesicle trafficking protein homolog B (S. cerevisiae) (gene/pseudogene)						ER to Golgi vesicle-mediated transport (GO:0006888)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)											GCACTCTCAGGTATCTAAAAG	0.403																																																	0								ENSG00000223380						153.0	144.0	147.0					1																	145112520		2095	4238	6333	SEC22B			0			-	HGNC	AF047442		1q21.1	2012-04-20	2010-03-12	2006-04-25	ENSG00000223380				10700	protein-coding gene	gene with protein product		604029	"""SEC22, vesicle trafficking protein (S. cerevisiae)-like 1"", ""SEC22 vesicle trafficking protein-like 1 (S. cerevisiae)"", ""SEC22 vesicle trafficking protein homolog B (S. cerevisiae)"""	SEC22L1		9094723, 16354670	Standard	NM_004892		Approved	sec22b, ERS-24	uc031poa.1	O75396	OTTHUMG00000013745		1.37:g.145112520G>C		Somatic	0	176	0.00		0.599270127213081	0	100.00	8	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	175	9.79	A8K1G0	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000453618.1	37	c.NULL		1																																																																																			-	-		0.403	SEC22B-001	KNOWN	basic	processed_transcript	SEC22B	processed_transcript	OTTHUMT00000038523.5	G	NM_004892	-		145112520	+1	no_errors	ENST00000453618	ensembl	human	known	74_37	splice_site	SNP	1.000	C
MALAT1	378938	genome.wustl.edu	37	11	65271780	65271780	+	lincRNA	DEL	T	T	-	rs36002528		TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr11:65271780delT	ENST00000534336.1	+	0	6548					NR_002819.2		Q9UHZ2	MALAT_HUMAN	metastasis associated lung adenocarcinoma transcript 1 (non-protein coding)																		TTGTTGTAGCTTTTTTTTTTT	0.433																																																	0								ENSG00000251562						25.0	28.0	27.0					11																	65271780		874	1988	2862	MALAT1			0				HGNC	AF001540		11q13.1	2013-12-11	2007-11-20		ENSG00000251562	ENSG00000251562		"""Long non-coding RNAs"", ""-"""	29665	non-coding RNA	RNA, long non-coding	"""metastasis associated in lung adenocarcinoma transcript 1"", ""non-protein coding RNA 47"", ""hepcarcin"", ""nuclear enriched abundant transcript 2"", ""nuclear paraspeckle assembly transcript 2 (non-protein coding)"", ""long intergenic non-protein coding RNA 47"""	607924				12970751, 22560368	Standard	NR_002819		Approved	PRO1073, MALAT-1, NCRNA00047, HCN, NEAT2, LINC00047, mascRNA	uc010roh.3	Q9UHZ2	OTTHUMG00000166322		11.37:g.65271780delT		Somatic	0	27	0.00		0.599270127213081	10	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	25	13.79		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000534336.1	37	NULL		11																																																																																			-	-		0.433	MALAT1-001	KNOWN	basic	lincRNA	MALAT1	lincRNA	OTTHUMT00000389143.1	T	NR_002819			65271780	+1	no_errors	ENST00000534336	ensembl	human	known	74_37	rna	DEL	0.994	-
LRP1B	53353	genome.wustl.edu	37	2	141660728	141660728	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr2:141660728C>T	ENST00000389484.3	-	23	4498	c.3527G>A	c.(3526-3528)tGt>tAt	p.C1176Y		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	1176	EGF-like 5. {ECO:0000255|PROSITE- ProRule:PRU00076}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		GTTCAGCGAACACTCATCTAT	0.398										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)												0								ENSG00000168702						73.0	64.0	67.0					2																	141660728		2203	4300	6503	LRP1B	SO:0001583	missense	0			-	HGNC	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.3527G>A	2.37:g.141660728C>T	ENSP00000374135:p.Cys1176Tyr	Somatic	0	20	0.00		0.599270127213081	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	15	21.05	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,pfam_EG-like_dom,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.C1176Y	ENST00000389484.3	37	c.3527	CCDS2182.1	2	.	.	.	.	.	.	.	.	.	.	C	17.35	3.367376	0.61513	.	.	ENSG00000168702	ENST00000389484;ENST00000544579;ENST00000434794	D;D	0.99966	-10.09;-10.09	5.43	5.43	0.79202	Epidermal growth factor-like (1);	0.000000	0.85682	D	0.000000	D	0.99984	0.9995	H	0.99261	4.49	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.97110	1.0;0.996	D	0.99712	1.1007	10	0.59425	D	0.04	.	19.6188	0.95647	0.0:1.0:0.0:0.0	.	359;1176	Q96NT6;Q9NZR2	.;LRP1B_HUMAN	Y	1176;1114;321	ENSP00000374135:C1176Y;ENSP00000413239:C321Y	ENSP00000374135:C1176Y	C	-	2	0	LRP1B	141377198	1.000000	0.71417	1.000000	0.80357	0.751000	0.42716	7.722000	0.84778	2.699000	0.92147	0.650000	0.86243	TGT	-	smart_EG-like_dom		0.398	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1B	protein_coding	OTTHUMT00000254736.2	C	NM_018557	-		141660728	-1	no_errors	ENST00000389484	ensembl	human	known	74_37	missense	SNP	1.000	T
CUX2	23316	genome.wustl.edu	37	12	111472033	111472033	+	Missense_Mutation	SNP	C	C	T	rs576939929	byFrequency	TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr12:111472033C>T	ENST00000261726.6	+	1	206	c.52C>T	c.(52-54)Cgg>Tgg	p.R18W		NM_015267.3	NP_056082.2	O14529	CUX2_HUMAN	cut-like homeobox 2	18					cellular response to organic substance (GO:0071310)|cognition (GO:0050890)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of synapse assembly (GO:0051965)|short-term memory (GO:0007614)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(24)|ovary(5)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	55						ATTTGATCTACGGCGACTCCA	0.647													C|||	2	0.000399361	0.0008	0.0014	5008	,	,		4097	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000111249						68.0	72.0	71.0					12																	111472033		2203	4300	6503	CUX2	SO:0001583	missense	0			-	HGNC	AB006631	CCDS41837.1	12q24.12	2011-06-20	2007-11-07	2007-11-07	ENSG00000111249	ENSG00000111249		"""Homeoboxes / CUT class"""	19347	protein-coding gene	gene with protein product		610648	"""cut-like 2 (Drosophila)"""	CUTL2			Standard	NM_015267		Approved	KIAA0293, CDP2	uc001tsa.2	O14529	OTTHUMG00000169546	ENST00000261726.6:c.52C>T	12.37:g.111472033C>T	ENSP00000261726:p.Arg18Trp	Somatic	0	31	0.00		0.599270127213081	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	35	10.26	A7E2Y4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Hmoeo_CUT,pfam_Homeobox_dom,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,superfamily_Prefoldin,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Hmoeo_CUT	p.R18W	ENST00000261726.6	37	c.52	CCDS41837.1	12	.	.	.	.	.	.	.	.	.	.	C	14.83	2.651393	0.47362	.	.	ENSG00000111249	ENST00000261726	T	0.30714	1.52	2.52	2.52	0.30459	.	1.179390	0.06457	U	0.728833	T	0.21347	0.0514	N	0.08118	0	0.31003	N	0.720116	D	0.56287	0.975	B	0.42798	0.398	T	0.38134	-0.9675	10	0.66056	D	0.02	-1.6837	13.4269	0.61030	0.0:1.0:0.0:0.0	.	18	O14529	CUX2_HUMAN	W	18	ENSP00000261726:R18W	ENSP00000261726:R18W	R	+	1	2	CUX2	109956416	1.000000	0.71417	1.000000	0.80357	0.616000	0.37450	3.811000	0.55620	1.395000	0.46643	0.306000	0.20318	CGG	-	NULL		0.647	CUX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUX2	protein_coding	OTTHUMT00000404765.1	C	NM_015267	-		111472033	+1	no_errors	ENST00000261726	ensembl	human	known	74_37	missense	SNP	1.000	T
C9	735	genome.wustl.edu	37	5	39308430	39308430	+	Missense_Mutation	SNP	A	A	G			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr5:39308430A>G	ENST00000263408.4	-	8	1237	c.1142T>C	c.(1141-1143)cTt>cCt	p.L381P		NM_001737.3	NP_001728.1	P02748	CO9_HUMAN	complement component 9	381	MACPF. {ECO:0000255|PROSITE- ProRule:PRU00745}.				complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|hemolysis by symbiont of host erythrocytes (GO:0019836)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane attack complex (GO:0005579)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(17)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	32	all_lung(31;0.000197)	all_neural(839;7.57e-10)|Lung NSC(810;2.62e-08)|Ovarian(839;0.00384)|Breast(839;0.0184)|Myeloproliferative disorder(839;0.0511)	Epithelial(62;0.158)			ATGATACCCAAGGCATCTCTT	0.343																																																	0								ENSG00000113600						116.0	113.0	114.0					5																	39308430		2203	4300	6503	C9	SO:0001583	missense	0			-	HGNC		CCDS3929.1	5p14-p12	2014-09-17			ENSG00000113600	ENSG00000113600		"""Complement system"""	1358	protein-coding gene	gene with protein product		120940					Standard	NM_001737		Approved		uc003jlv.4	P02748	OTTHUMG00000094767	ENST00000263408.4:c.1142T>C	5.37:g.39308430A>G	ENSP00000263408:p.Leu381Pro	Somatic	0	43	0.00		0.599270127213081	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MACPF,pfam_LDrepeatLR_classA_rpt,pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,superfamily_LDrepeatLR_classA_rpt,smart_Thrombospondin_1_rpt,smart_LDrepeatLR_classA_rpt,smart_MACPF,prints_MAC_perforin,pfscan_LDrepeatLR_classA_rpt,pfscan_Thrombospondin_1_rpt	p.L381P	ENST00000263408.4	37	c.1142	CCDS3929.1	5	.	.	.	.	.	.	.	.	.	.	A	13.29	2.192078	0.38707	.	.	ENSG00000113600	ENST00000263408	D	0.85861	-2.04	5.46	5.46	0.80206	Membrane attack complex component/perforin (MACPF) domain (3);	0.146099	0.47093	D	0.000259	D	0.92224	0.7534	M	0.83483	2.645	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.92946	0.6376	10	0.62326	D	0.03	-24.678	12.913	0.58190	1.0:0.0:0.0:0.0	.	381	P02748	CO9_HUMAN	P	381	ENSP00000263408:L381P	ENSP00000263408:L381P	L	-	2	0	C9	39344187	0.998000	0.40836	0.973000	0.42090	0.019000	0.09904	4.935000	0.63498	2.073000	0.62155	0.482000	0.46254	CTT	-	pfam_MACPF,smart_MACPF		0.343	C9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C9	protein_coding	OTTHUMT00000211576.3	A		-		39308430	-1	no_errors	ENST00000263408	ensembl	human	known	74_37	missense	SNP	0.999	G
CCR3	1232	genome.wustl.edu	37	3	46306890	46306890	+	Silent	SNP	C	C	T			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr3:46306890C>T	ENST00000357422.2	+	4	784	c.241C>T	c.(241-243)Ctg>Ttg	p.L81L	CCR3_ENST00000395940.2_Silent_p.L81L|CCR3_ENST00000541018.1_Silent_p.L81L|CCR3_ENST00000545097.1_Silent_p.L102L|CCR3_ENST00000395942.2_Silent_p.L81L			P51677	CCR3_HUMAN	chemokine (C-C motif) receptor 3	81				LL -> QG (in Ref. 7; AAL85630). {ECO:0000305}.	adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cell adhesion (GO:0007155)|cellular defense response (GO:0006968)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|inflammatory response (GO:0006954)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of endothelial cell proliferation (GO:0001938)|viral process (GO:0016032)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|chemokine receptor activity (GO:0004950)			breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(5)|ovary(3)|urinary_tract(1)	18				BRCA - Breast invasive adenocarcinoma(193;0.00119)|KIRC - Kidney renal clear cell carcinoma(197;0.0183)|Kidney(197;0.0216)		CATTTCGGACCTGCTCTTCCT	0.507																																																	0								ENSG00000183625						187.0	161.0	170.0					3																	46306890		2203	4300	6503	CCR3	SO:0001819	synonymous_variant	0			-	HGNC	AF247361	CCDS2738.1, CCDS54574.1	3p21.3	2012-08-08			ENSG00000183625	ENSG00000183625		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1604	protein-coding gene	gene with protein product		601268		CMKBR3			Standard	NM_178328		Approved	CC-CKR-3, CKR3, CD193	uc003cpk.2	P51677	OTTHUMG00000133484	ENST00000357422.2:c.241C>T	3.37:g.46306890C>T		Somatic	0	21	0.00		0.599270127213081	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	15	16.67	B3KVQ1|F5GWL6|Q15748|Q2YDB9|Q86WD2|Q8TDP6|Q9ULY8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_Chemokine_rcpt,prints_Chemokine_CCR3,prints_Chemokine_CCR1	p.L102	ENST00000357422.2	37	c.304	CCDS2738.1	3																																																																																			-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.507	CCR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCR3	protein_coding	OTTHUMT00000257380.2	C		-		46306890	+1	no_errors	ENST00000545097	ensembl	human	known	74_37	silent	SNP	0.999	T
BNC1	646	genome.wustl.edu	37	15	83926276	83926276	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr15:83926276G>A	ENST00000345382.2	-	5	2988	c.2903C>T	c.(2902-2904)tCg>tTg	p.S968L	RP11-382A20.4_ENST00000565495.1_RNA|BNC1_ENST00000569704.1_Missense_Mutation_p.S961L	NM_001717.3	NP_001708.3	Q01954	BNC1_HUMAN	basonuclin 1	968					chromosome organization (GO:0051276)|epidermis development (GO:0008544)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|regulation of transcription from RNA polymerase I promoter (GO:0006356)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(18)|ovary(4)|prostate(2)|skin(4)|urinary_tract(1)	56						GCGAACAGACGAAAACATGGT	0.498																																																	0								ENSG00000169594						154.0	148.0	150.0					15																	83926276		2203	4300	6503	BNC1	SO:0001583	missense	0			-	HGNC	L03427	CCDS10324.1, CCDS73771.1	15q25.1	2013-05-20	2004-04-30	2004-05-04	ENSG00000169594	ENSG00000169594		"""Zinc fingers, C2H2-type"""	1081	protein-coding gene	gene with protein product		601930	"""basonuclin"""	BNC		1332044	Standard	NM_001717		Approved	HsT19447	uc002bjt.1	Q01954	OTTHUMG00000147362	ENST00000345382.2:c.2903C>T	15.37:g.83926276G>A	ENSP00000307041:p.Ser968Leu	Somatic	0	58	0.00		0.599270127213081	0	100.00	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	32	24	57.14	Q15840	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S968L	ENST00000345382.2	37	c.2903	CCDS10324.1	15	.	.	.	.	.	.	.	.	.	.	G	35	5.571926	0.96553	.	.	ENSG00000169594	ENST00000345382;ENST00000541809	T	0.52983	0.64	5.93	5.93	0.95920	Zinc finger, C2H2-like (1);	0.000000	0.85682	D	0.000000	T	0.70727	0.3257	M	0.69823	2.125	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.992	T	0.71464	-0.4585	10	0.87932	D	0	-14.6891	20.3398	0.98759	0.0:0.0:1.0:0.0	.	961;968	F5GY04;Q01954	.;BNC1_HUMAN	L	968;961	ENSP00000307041:S968L	ENSP00000307041:S968L	S	-	2	0	BNC1	81717280	1.000000	0.71417	0.983000	0.44433	0.993000	0.82548	9.787000	0.99055	2.811000	0.96726	0.557000	0.71058	TCG	-	smart_Znf_C2H2-like		0.498	BNC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BNC1	protein_coding	OTTHUMT00000304006.1	G	NM_001717	-		83926276	-1	no_errors	ENST00000345382	ensembl	human	known	74_37	missense	SNP	1.000	A
LRBA	987	genome.wustl.edu	37	4	151829832	151829832	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr4:151829832G>A	ENST00000357115.3	-	10	1582	c.1339C>T	c.(1339-1341)Cca>Tca	p.P447S	LRBA_ENST00000510413.1_Missense_Mutation_p.P447S|LRBA_ENST00000535741.1_Missense_Mutation_p.P447S|LRBA_ENST00000507224.1_Missense_Mutation_p.P447S	NM_006726.4	NP_006717.2	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and anchor containing	447						cytoplasmic membrane-bounded vesicle (GO:0016023)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(20)|lung(32)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	91	all_hematologic(180;0.151)					AGTGCATGTGGTGAATGAACA	0.388																																																	0								ENSG00000198589						148.0	139.0	142.0					4																	151829832		2203	4300	6503	LRBA	SO:0001583	missense	0			-	HGNC	AF216648	CCDS3773.1, CCDS58928.1	4q13	2013-01-10		2001-10-05	ENSG00000198589	ENSG00000198589		"""WD repeat domain containing"""	1742	protein-coding gene	gene with protein product		606453		CDC4L		1505956, 11254716	Standard	NM_006726		Approved	BGL, LAB300, LBA	uc010ipj.3	P50851	OTTHUMG00000161443	ENST00000357115.3:c.1339C>T	4.37:g.151829832G>A	ENSP00000349629:p.Pro447Ser	Somatic	0	48	0.00		0.599270127213081	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	53	8.62	Q4W5J4|Q4W5L6|Q8NFQ0|Q9H2U3|Q9H2U4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_BEACH_dom,pfam_DUF1088,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_ConA-like_lec_gl_sf,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom	p.P447S	ENST00000357115.3	37	c.1339	CCDS3773.1	4	.	.	.	.	.	.	.	.	.	.	G	24.1	4.490966	0.84962	.	.	ENSG00000198589	ENST00000535741;ENST00000510413;ENST00000357115;ENST00000507224	T;T;T;T	0.65178	-0.14;-0.14;-0.14;-0.14	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	T	0.79557	0.4466	M	0.73598	2.24	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.996;0.999;0.998	T	0.76130	-0.3072	10	0.32370	T	0.25	.	19.7083	0.96083	0.0:0.0:1.0:0.0	.	447;447;447	E9PEM5;P50851;P50851-2	.;LRBA_HUMAN;.	S	447	ENSP00000446299:P447S;ENSP00000421552:P447S;ENSP00000349629:P447S;ENSP00000422180:P447S	ENSP00000349629:P447S	P	-	1	0	LRBA	152049282	1.000000	0.71417	0.967000	0.41034	0.977000	0.68977	9.809000	0.99208	2.726000	0.93360	0.563000	0.77884	CCA	-	NULL		0.388	LRBA-002	KNOWN	basic|CCDS	protein_coding	LRBA	protein_coding	OTTHUMT00000364939.1	G		-		151829832	-1	no_errors	ENST00000357115	ensembl	human	known	74_37	missense	SNP	1.000	A
SLC6A19	340024	genome.wustl.edu	37	5	1217031	1217031	+	Missense_Mutation	SNP	A	A	G			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr5:1217031A>G	ENST00000304460.10	+	8	1200	c.1144A>G	c.(1144-1146)Acc>Gcc	p.T382A		NM_001003841.2	NP_001003841.1	Q695T7	S6A19_HUMAN	solute carrier family 6 (neutral amino acid transporter), member 19	382					amino acid transport (GO:0006865)|ion transport (GO:0006811)|response to nutrient (GO:0007584)|transmembrane transport (GO:0055085)	brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neurotransmitter:sodium symporter activity (GO:0005328)|neutral amino acid transmembrane transporter activity (GO:0015175)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|lung(25)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	44	all_cancers(3;3.55e-15)|Lung NSC(6;2.89e-14)|all_lung(6;2.2e-13)|all_epithelial(6;3.75e-10)		Epithelial(17;0.000356)|all cancers(22;0.00137)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)			GGTGTTCCAGACCTGCGACAT	0.647																																																	0								ENSG00000174358						135.0	129.0	131.0					5																	1217031		2203	4300	6503	SLC6A19	SO:0001583	missense	0			-	HGNC	AK096054	CCDS34130.1	5p15	2013-07-19			ENSG00000174358	ENSG00000174358		"""Solute carriers"""	27960	protein-coding gene	gene with protein product	"""Hartnup disease"""	608893					Standard	NM_001003841		Approved		uc003jbw.4	Q695T7	OTTHUMG00000161636	ENST00000304460.10:c.1144A>G	5.37:g.1217031A>G	ENSP00000305302:p.Thr382Ala	Somatic	0	37	0.00		0.599270127213081	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51	A8K446	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport,prints_Na/ntran_symport_orphan	p.T382A	ENST00000304460.10	37	c.1144	CCDS34130.1	5	.	.	.	.	.	.	.	.	.	.	A	11.73	1.724646	0.30593	.	.	ENSG00000174358	ENST00000304460	T	0.73152	-0.72	4.85	4.85	0.62838	.	0.578057	0.19119	N	0.122232	T	0.63271	0.2497	L	0.48877	1.53	0.41849	D	0.990161	B	0.16166	0.016	B	0.25405	0.06	T	0.57441	-0.7811	10	0.14656	T	0.56	.	12.982	0.58570	1.0:0.0:0.0:0.0	.	382	Q695T7	S6A19_HUMAN	A	382	ENSP00000305302:T382A	ENSP00000305302:T382A	T	+	1	0	SLC6A19	1270031	0.977000	0.34250	1.000000	0.80357	0.687000	0.40016	1.493000	0.35605	1.817000	0.53016	0.402000	0.26972	ACC	-	pfam_Na/ntran_symport,pfscan_Na/ntran_symport		0.647	SLC6A19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A19	protein_coding	OTTHUMT00000365557.1	A	XM_291120	-		1217031	+1	no_errors	ENST00000304460	ensembl	human	known	74_37	missense	SNP	1.000	G
BRD7	29117	genome.wustl.edu	37	16	50368678	50368679	+	Frame_Shift_Del	DEL	CT	CT	-	rs145896392		TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	CT	CT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr16:50368678_50368679delCT	ENST00000394688.3	-	7	989_990	c.830_831delAG	c.(829-831)gagfs	p.E277fs	BRD7_ENST00000394689.2_Frame_Shift_Del_p.E277fs			Q9NPI1	BRD7_HUMAN	bromodomain containing 7	277					cell cycle (GO:0007049)|negative regulation of cell proliferation (GO:0008285)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone acetylation (GO:0035066)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	histone binding (GO:0042393)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(7)|prostate(2)|urinary_tract(2)	22		all_cancers(37;0.0127)				CTCCAGAGTCCTCTCTCTCTCT	0.47																																																	0								ENSG00000166164																																			BRD7	SO:0001589	frameshift_variant	0				HGNC	AF213969	CCDS10742.1, CCDS54007.1	16q12.1	2008-11-18	2002-01-14		ENSG00000166164	ENSG00000166164			14310	protein-coding gene	gene with protein product			"""bromodomain-containing 7"""			10526152, 18809673	Standard	NM_013263		Approved	CELTIX1, BP75	uc002ege.2	Q9NPI1	OTTHUMG00000133170	ENST00000394688.3:c.830_831delAG	16.37:g.50368688_50368689delCT	ENSP00000378180:p.Glu277fs	Somatic	0	34	0.00		0.599270127213081	55	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	14	17.65	Q4VC09|Q8N2L9|Q96KA4|Q9BV48|Q9UH59	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_DUF3512,pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain,prints_Bromodomain,pfscan_Bromodomain	p.E277fs	ENST00000394688.3	37	c.831_830	CCDS10742.1	16																																																																																			-	NULL		0.470	BRD7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	BRD7	protein_coding	OTTHUMT00000256874.3	CT	NM_013263			50368679	-1	no_errors	ENST00000394689	ensembl	human	known	74_37	frame_shift_del	DEL	0.079:0.258	-
FOXE1	2304	genome.wustl.edu	37	9	100616701	100616706	+	In_Frame_Del	DEL	GCCGCC	GCCGCC	-	rs371516340|rs565664344|rs71369530	byFrequency	TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	GCCGCC	GCCGCC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr9:100616701_100616706delGCCGCC	ENST00000375123.3	+	1	1166_1171	c.505_510delGCCGCC	c.(505-510)gccgccdel	p.AA177del		NM_004473.3	NP_004464.2	O00358	FOXE1_HUMAN	forkhead box E1 (thyroid transcription factor 2)	177	Ala-rich.|Poly-Ala.				anatomical structure morphogenesis (GO:0009653)|cell migration (GO:0016477)|embryonic organ morphogenesis (GO:0048562)|hair follicle morphogenesis (GO:0031069)|hard palate development (GO:0060022)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|pharynx development (GO:0060465)|positive regulation of transcription, DNA-templated (GO:0045893)|soft palate development (GO:0060023)|thymus development (GO:0048538)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(1)|lung(2)|upper_aerodigestive_tract(1)	5		Acute lymphoblastic leukemia(62;0.158)				Ggctgccgcagccgccgccgccgccg	0.767																																																	0								ENSG00000178919																																			FOXE1	SO:0001651	inframe_deletion	0				HGNC	U89995	CCDS35078.1	9q22	2008-09-05			ENSG00000178919	ENSG00000178919		"""Forkhead boxes"""	3806	protein-coding gene	gene with protein product		602617	"""forkhead box E2"""	FKHL15, TITF2, FOXE2		9169137, 9697705	Standard	NM_004473		Approved	TTF-2, HFKH4	uc004axu.3	O00358	OTTHUMG00000020333	ENST00000375123.3:c.505_510delGCCGCC	9.37:g.100616707_100616712delGCCGCC	ENSP00000364265:p.Ala177_Ala178del	Somatic	NA	NA	NA		0.599270127213081	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	O75765|Q5T109|Q99526	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.AA172in_frame_del	ENST00000375123.3	37	c.505_510	CCDS35078.1	9																																																																																			-	NULL		0.767	FOXE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXE1	protein_coding	OTTHUMT00000053341.1	GCCGCC				100616706	+1	no_errors	ENST00000375123	ensembl	human	known	74_37	in_frame_del	DEL	0.602:0.620:0.614:0.750:0.779:0.753	-
SORBS2	8470	genome.wustl.edu	37	4	186544971	186544971	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr4:186544971C>T	ENST00000284776.7	-	13	2109	c.1600G>A	c.(1600-1602)Gta>Ata	p.V534I	SORBS2_ENST00000498125.1_Intron|SORBS2_ENST00000418609.1_Missense_Mutation_p.V438I|SORBS2_ENST00000437304.2_Intron|SORBS2_ENST00000431808.1_Missense_Mutation_p.V534I|SORBS2_ENST00000449407.2_Intron|SORBS2_ENST00000355634.5_Missense_Mutation_p.V634I|SORBS2_ENST00000393528.3_Intron|SORBS2_ENST00000448662.2_Intron|SORBS2_ENST00000319471.9_Intron	NM_021069.4	NP_066547.1	O94875	SRBS2_HUMAN	sorbin and SH3 domain containing 2	534					actin filament organization (GO:0007015)|cell adhesion (GO:0007155)|cell migration (GO:0016477)	actin cytoskeleton (GO:0015629)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	cytoskeletal adaptor activity (GO:0008093)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)			endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(9)|lung(21)|ovary(2)|prostate(2)|skin(4)|urinary_tract(1)	53		all_cancers(14;4.27e-52)|all_epithelial(14;6.58e-39)|all_lung(41;1.42e-13)|Lung NSC(41;3.73e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.00692)|Hepatocellular(41;0.00826)|Renal(120;0.00994)|Prostate(90;0.0101)|all_hematologic(60;0.0174)|all_neural(102;0.244)		OV - Ovarian serous cystadenocarcinoma(60;1.54e-09)|BRCA - Breast invasive adenocarcinoma(30;0.000232)|GBM - Glioblastoma multiforme(59;0.000385)|STAD - Stomach adenocarcinoma(60;0.00109)|LUSC - Lung squamous cell carcinoma(40;0.0205)		TCTAGGGTTACGGGAGACAGC	0.542																																					Esophageal Squamous(153;41 2433 9491 36028)												0								ENSG00000154556						76.0	69.0	72.0					4																	186544971		2203	4300	6503	SORBS2	SO:0001583	missense	0			-	HGNC		CCDS3845.1, CCDS43289.2, CCDS47173.1, CCDS47174.1, CCDS47175.1, CCDS47176.1, CCDS54825.1, CCDS59482.1	4q35.1	2008-02-05			ENSG00000154556	ENSG00000154556			24098	protein-coding gene	gene with protein product	"""Arg/Abl interacting protein"""					9211900, 9872452	Standard	NM_021069		Approved	ARGBP2, KIAA0777	uc003iym.3	O94875	OTTHUMG00000157215	ENST00000284776.7:c.1600G>A	4.37:g.186544971C>T	ENSP00000284776:p.Val534Ile	Somatic	0	18	0.00		0.599270127213081	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	23	20.69	A6NEK9|B3KPQ7|B7Z1G5|B7Z3X6|C9JKV9|D3DP62|D3DP63|E9PAS5|E9PAW4|G3XAI0|H7BXR4|J3KNZ5|O60592|O60593|Q96EX0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SH3_domain,pfam_SH3_2,pfam_Sorb,superfamily_SH3_domain,smart_Sorb,smart_SH3_domain,pfscan_Sorb,pfscan_SH3_domain,prints_SH3_domain,prints_p67phox	p.V534I	ENST00000284776.7	37	c.1600	CCDS3845.1	4	.	.	.	.	.	.	.	.	.	.	C	0.007	-1.956246	0.00470	.	.	ENSG00000154556	ENST00000284776;ENST00000431808;ENST00000418609;ENST00000355634	T;T;T;T	0.35421	1.41;1.41;1.31;1.41	5.88	-1.36	0.09085	.	0.477787	0.22867	N	0.054670	T	0.14830	0.0358	N	0.16478	0.41	0.09310	N	1	B;B;B	0.09022	0.002;0.002;0.002	B;B;B	0.06405	0.002;0.001;0.002	T	0.34527	-0.9825	10	0.02654	T	1	-2.105	7.5849	0.27987	0.097:0.4898:0.0:0.4132	.	438;634;534	B7Z3X6;B3KPQ7;O94875	.;.;SRBS2_HUMAN	I	534;534;438;634	ENSP00000284776:V534I;ENSP00000411764:V534I;ENSP00000397482:V438I;ENSP00000347852:V634I	ENSP00000284776:V534I	V	-	1	0	SORBS2	186781965	0.001000	0.12720	0.000000	0.03702	0.003000	0.03518	0.113000	0.15499	-0.704000	0.05042	0.561000	0.74099	GTA	-	NULL		0.542	SORBS2-001	KNOWN	basic|CCDS	protein_coding	SORBS2	protein_coding	OTTHUMT00000347944.3	C	NM_003603	-		186544971	-1	no_errors	ENST00000284776	ensembl	human	known	74_37	missense	SNP	0.000	T
MYOM3	127294	genome.wustl.edu	37	1	24400760	24400760	+	Splice_Site	SNP	C	C	G			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr1:24400760C>G	ENST00000374434.3	-	23	3021		c.e23-1		RP11-293P20.2_ENST00000439239.2_RNA|MYOM3_ENST00000330966.7_Splice_Site|MYOM3_ENST00000329601.7_Splice_Site|RP11-293P20.4_ENST00000429191.1_RNA	NM_152372.3	NP_689585.3	Q5VTT5	MYOM3_HUMAN	myomesin 3							M band (GO:0031430)	protein homodimerization activity (GO:0042803)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(3)|lung(40)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	68		Colorectal(325;3.55e-05)|Renal(390;0.000703)|Lung NSC(340;0.001)|all_lung(284;0.0014)|Ovarian(437;0.00351)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;5.31e-24)|Colorectal(126;7.52e-08)|COAD - Colon adenocarcinoma(152;4.01e-06)|GBM - Glioblastoma multiforme(114;4.36e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00108)|KIRC - Kidney renal clear cell carcinoma(1967;0.00404)|STAD - Stomach adenocarcinoma(196;0.00966)|READ - Rectum adenocarcinoma(331;0.0678)|Lung(427;0.153)		GACCTTGGACCTGGCAGAGAG	0.582																																																	0								ENSG00000142661						60.0	62.0	62.0					1																	24400760		1989	4151	6140	MYOM3	SO:0001630	splice_region_variant	0			-	HGNC	AK093280	CCDS41281.1	1p36	2013-02-11	2012-10-17		ENSG00000142661	ENSG00000142661		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	26679	protein-coding gene	gene with protein product			"""myomesin family, member 3"""			18177667	Standard	NM_152372		Approved	FLJ35961	uc001bin.4	Q5VTT5	OTTHUMG00000002969	ENST00000374434.3:c.2859-1G>C	1.37:g.24400760C>G		Somatic	0	51	0.00		0.599270127213081	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	32	17.95	A6NF75|Q5VTT6|Q6AWC0|Q6AWC1|Q6NXF9|Q6ZRG7|Q7Z3G9|Q8NA11|Q96C54	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e22-1	ENST00000374434.3	37	c.2862-1	CCDS41281.1	1	.	.	.	.	.	.	.	.	.	.	C	22.0	4.223985	0.79576	.	.	ENSG00000142661	ENST00000374434;ENST00000330966;ENST00000329601	.	.	.	5.81	5.81	0.92471	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.259	0.90028	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	MYOM3	24273347	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	6.120000	0.71596	2.736000	0.93811	0.655000	0.94253	.	-	-		0.582	MYOM3-001	NOVEL	basic|appris_candidate|CCDS	protein_coding	MYOM3	protein_coding	OTTHUMT00000008272.2	C	NM_152372	-	Intron	24400760	-1	no_errors	ENST00000330966	ensembl	human	known	74_37	splice_site	SNP	1.000	G
FAM183B	340286	genome.wustl.edu	37	7	38725207	38725207	+	Silent	SNP	G	G	T			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr7:38725207G>T	ENST00000409072.3	-	2	1333	c.399C>A	c.(397-399)cgC>cgA	p.R133R				Q6ZVS7	F183B_HUMAN	family with sequence similarity 183, member B	133										endometrium(1)|lung(7)	8						GCTACTTGTGGCGATCATCTT	0.488																																																	0								ENSG00000164556						185.0	184.0	184.0					7																	38725207		2048	4200	6248	FAM183B	SO:0001819	synonymous_variant	0			-	HGNC	AK124132, BC045803		7p14.1	2008-08-11			ENSG00000164556	ENSG00000164556			34511	protein-coding gene	gene with protein product							Standard	NR_028347		Approved	LOC340286	uc011kbd.2	Q6ZVS7	OTTHUMG00000153653	ENST00000409072.3:c.399C>A	7.37:g.38725207G>T		Somatic	0	38	0.00		0.599270127213081	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	27	18.18	A4D1Y1	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.R133	ENST00000409072.3	37	c.399		7																																																																																			-	NULL		0.488	FAM183B-001	NOVEL	basic|appris_principal	protein_coding	FAM183B	protein_coding	OTTHUMT00000331972.1	G	NM_001105282	-		38725207	-1	no_errors	ENST00000409072	ensembl	human	novel	74_37	silent	SNP	0.019	T
JUN	3725	genome.wustl.edu	37	1	59248098	59248100	+	In_Frame_Del	DEL	CAT	CAT	-			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	CAT	CAT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr1:59248098_59248100delCAT	ENST00000371222.2	-	1	1685_1687	c.643_645delATG	c.(643-645)atgdel	p.M215del	RP4-794H19.2_ENST00000419531.2_lincRNA	NM_002228.3	NP_002219.1	P05412	JUN_HUMAN	jun proto-oncogene	215					aging (GO:0007568)|angiogenesis (GO:0001525)|axon regeneration (GO:0031103)|cellular response to calcium ion (GO:0071277)|cellular response to potassium ion starvation (GO:0051365)|circadian rhythm (GO:0007623)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|leading edge cell differentiation (GO:0035026)|learning (GO:0007612)|liver development (GO:0001889)|membrane depolarization (GO:0051899)|microglial cell activation (GO:0001774)|monocyte differentiation (GO:0030224)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation by host of viral transcription (GO:0043922)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA binding (GO:0043392)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of transcription from RNA polymerase II promoter in response to endoplasmic reticulum stress (GO:1990441)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of DNA replication (GO:0045740)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of monocyte differentiation (GO:0045657)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell cycle (GO:0051726)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|release of cytochrome c from mitochondria (GO:0001836)|response to cAMP (GO:0051591)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|response to radiation (GO:0009314)|SMAD protein import into nucleus (GO:0007184)|SMAD protein signal transduction (GO:0060395)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transforming growth factor beta receptor signaling pathway (GO:0007179)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|nuclear chromosome (GO:0000228)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	cAMP response element binding (GO:0035497)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|R-SMAD binding (GO:0070412)|Rho GTPase activator activity (GO:0005100)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|kidney(2)|lung(5)|skin(1)	10	all_cancers(7;8.55e-07)				Arsenic trioxide(DB01169)|Irbesartan(DB01029)|Pseudoephedrine(DB00852)|Vinblastine(DB00570)	GCTGCACGGGCATCTGCTGGGGC	0.739			A		sarcoma																																			Dom	yes		1	1p32-p31	3725	jun oncogene		M	0								ENSG00000177606																																			JUN	SO:0001651	inframe_deletion	0				HGNC	AY217548	CCDS610.1	1p32-p31	2013-01-10	2010-08-27		ENSG00000177606	ENSG00000177606		"""basic leucine zipper proteins"""	6204	protein-coding gene	gene with protein product		165160	"""v-jun avian sarcoma virus 17 oncogene homolog"", ""v-jun sarcoma virus 17 oncogene homolog (avian)"", ""jun oncogene"""			3194415	Standard	NM_002228		Approved	c-Jun, AP-1	uc001cze.3	P05412	OTTHUMG00000008376	ENST00000371222.2:c.643_645delATG	1.37:g.59248098_59248100delCAT	ENSP00000360266:p.Met215del	Somatic	0	20	0.00		0.599270127213081	439	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	18	18.18	Q6FHM7|Q96G93	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_JNK,pfam_bZIP,superfamily_TF_DNA-bd,smart_bZIP,pfscan_bZIP,prints_Leuzip_Jun	p.M215in_frame_del	ENST00000371222.2	37	c.645_643	CCDS610.1	1																																																																																			-	pfam_JNK		0.739	JUN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JUN	protein_coding	OTTHUMT00000023042.1	CAT	NM_002228			59248100	-1	no_errors	ENST00000371222	ensembl	human	known	74_37	in_frame_del	DEL	0.997:0.997:0.983	-
SREBF1	6720	genome.wustl.edu	37	17	17721201	17721201	+	Missense_Mutation	SNP	C	C	A			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr17:17721201C>A	ENST00000261646.5	-	7	1397	c.1213G>T	c.(1213-1215)Ggc>Tgc	p.G405C	SREBF1_ENST00000395757.1_Missense_Mutation_p.G151C|SREBF1_ENST00000355815.4_Missense_Mutation_p.G435C|SREBF1_ENST00000435530.2_Missense_Mutation_p.G405C|SREBF1_ENST00000583732.1_5'Flank|SREBF1_ENST00000338854.5_Missense_Mutation_p.G405C	NM_004176.4	NP_004167.3	P36956	SRBP1_HUMAN	sterol regulatory element binding transcription factor 1	405	Interaction with LMNA. {ECO:0000250}.				aging (GO:0007568)|cellular lipid metabolic process (GO:0044255)|cellular response to fatty acid (GO:0071398)|cellular response to starvation (GO:0009267)|cholesterol metabolic process (GO:0008203)|circadian rhythm (GO:0007623)|insulin receptor signaling pathway (GO:0008286)|lipid biosynthetic process (GO:0008610)|lipid metabolic process (GO:0006629)|lung development (GO:0030324)|negative regulation of insulin secretion (GO:0046676)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cholesterol biosynthetic process (GO:0045542)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of triglyceride biosynthetic process (GO:0010867)|regulation of fatty acid metabolic process (GO:0019217)|regulation of heart rate by chemical signal (GO:0003062)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cAMP (GO:0051591)|response to drug (GO:0042493)|response to food (GO:0032094)|response to glucagon (GO:0033762)|response to glucose (GO:0009749)|response to progesterone (GO:0032570)|response to retinoic acid (GO:0032526)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|sterol response element binding (GO:0032810)			cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(5)|skin(1)|urinary_tract(1)	14						CCTCCACTGCCACAGGCCGAC	0.582																																																	0								ENSG00000072310						85.0	87.0	87.0					17																	17721201		2203	4300	6503	SREBF1	SO:0001583	missense	0			-	HGNC	BC057388	CCDS11189.1, CCDS32583.1	17p11.2	2013-05-21			ENSG00000072310	ENSG00000072310		"""Basic helix-loop-helix proteins"""	11289	protein-coding gene	gene with protein product		184756				8402897, 7759101	Standard	NM_001005291		Approved	SREBP1, bHLHd1, SREBP-1c	uc002grt.2	P36956	OTTHUMG00000059313	ENST00000261646.5:c.1213G>T	17.37:g.17721201C>A	ENSP00000261646:p.Gly405Cys	Somatic	0	46	0.00		0.599270127213081	141	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.16	B0I4X3|B0I4X4|D3DXC4|Q16062|Q59F52|Q6P4R7|Q6PFW7|Q6PJ36|Q8TAK9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.G435C	ENST00000261646.5	37	c.1303	CCDS11189.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	7.143|7.143	0.582211|0.582211	0.13749|0.13749	.|.	.|.	ENSG00000072310|ENSG00000072310	ENST00000338854;ENST00000355815;ENST00000261646;ENST00000395757;ENST00000418712;ENST00000423161;ENST00000435530|ENST00000395751	T;T;T;T;T|.	0.78816|.	0.49;0.52;0.52;0.94;-1.21|.	4.61|4.61	-1.41|-1.41	0.08941|0.08941	Helix-loop-helix DNA-binding (1);|.	0.370146|.	0.27478|.	N|.	0.019185|.	T|T	0.53867|0.53867	0.1823|0.1823	M|M	0.69823|0.69823	2.125|2.125	0.32490|0.32490	N|N	0.540301|0.540301	B;B;B;B|.	0.27013|.	0.166;0.013;0.025;0.035|.	B;B;B;B|.	0.19666|.	0.017;0.009;0.01;0.026|.	T|T	0.60682|0.60682	-0.7215|-0.7215	10|5	0.54805|.	T|.	0.06|.	-11.9634|-11.9634	5.8848|5.8848	0.18876|0.18876	0.1263:0.4574:0.0:0.4163|0.1263:0.4574:0.0:0.4163	.|.	405;381;405;435|.	B0I4X3;B0I4X4;P36956;P36956-4|.	.;.;SRBP1_HUMAN;.|.	C|L	405;435;405;151;242;331;405|412	ENSP00000345822:G405C;ENSP00000348069:G435C;ENSP00000261646:G405C;ENSP00000379106:G151C;ENSP00000413389:G405C|.	ENSP00000261646:G405C|.	G|W	-|-	1|2	0|0	SREBF1|SREBF1	17661926|17661926	0.002000|0.002000	0.14202|0.14202	0.024000|0.024000	0.17045|0.17045	0.065000|0.065000	0.16274|0.16274	-0.017000|-0.017000	0.12590|0.12590	0.078000|0.078000	0.16900|0.16900	0.561000|0.561000	0.74099|0.74099	GGC|TGG	-	superfamily_bHLH_dom		0.582	SREBF1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SREBF1	protein_coding	OTTHUMT00000131771.1	C	NM_004176	-		17721201	-1	no_errors	ENST00000355815	ensembl	human	known	74_37	missense	SNP	0.199	A
ACIN1	22985	genome.wustl.edu	37	14	23528502	23528503	+	Frame_Shift_Del	DEL	TC	TC	-			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	TC	TC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr14:23528502_23528503delTC	ENST00000262710.1	-	19	4207_4208	c.3880_3881delGA	c.(3880-3882)gaafs	p.E1294fs	ACIN1_ENST00000555053.1_Frame_Shift_Del_p.E1281fs|ACIN1_ENST00000397341.3_Frame_Shift_Del_p.E536fs|CDH24_ENST00000397359.3_5'Flank|CDH24_ENST00000487137.2_5'Flank|ACIN1_ENST00000338631.6_Frame_Shift_Del_p.E567fs|ACIN1_ENST00000557515.1_Frame_Shift_Del_p.E535fs|ACIN1_ENST00000605057.1_Frame_Shift_Del_p.E1236fs|ACIN1_ENST00000357481.2_Frame_Shift_Del_p.E536fs|ACIN1_ENST00000457657.1_Frame_Shift_Del_p.E1254fs	NM_001164814.1|NM_014977.3	NP_001158286.1|NP_055792	Q9UKV3	ACINU_HUMAN	apoptotic chromatin condensation inducer 1	1294	Arg/Asp/Glu/Lys-rich.				apoptotic chromosome condensation (GO:0030263)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|erythrocyte differentiation (GO:0030218)|mRNA processing (GO:0006397)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|positive regulation of apoptotic process (GO:0043065)|positive regulation of monocyte differentiation (GO:0045657)|RNA splicing (GO:0008380)	ASAP complex (GO:0061574)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATPase activity (GO:0016887)|enzyme binding (GO:0019899)|nucleic acid binding (GO:0003676)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(6)|kidney(4)|large_intestine(9)|lung(10)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	37	all_cancers(95;1.36e-05)			GBM - Glioblastoma multiforme(265;0.00816)		ccgctccctttctctctctctc	0.629											OREG0022595	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000100813																																			ACIN1	SO:0001589	frameshift_variant	0				HGNC	AB014570	CCDS9587.1, CCDS53887.1, CCDS53888.1, CCDS53889.1, CCDS55905.1	14q11.2	2008-11-25	2004-03-31	2004-04-01	ENSG00000100813	ENSG00000100813			17066	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 152"""	604562	"""apoptotic chromatin condensation inducer in the nucleus"""	ACINUS		9734811, 10490026	Standard	NM_014977		Approved	KIAA0670, fSAP152	uc001wit.4	Q9UKV3	OTTHUMG00000028716	ENST00000262710.1:c.3880_3881delGA	14.37:g.23528512_23528513delTC	ENSP00000262710:p.Glu1294fs	Somatic	0	36	0.00	764	0.599270127213081	108	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	22	12.00	B2RTT4|D3DS45|O75158|Q9UG91|Q9UKV1|Q9UKV2	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_SAP_dom,smart_SAP_dom,pfscan_SAP_dom	p.E1294fs	ENST00000262710.1	37	c.3881_3880	CCDS9587.1	14																																																																																			-	NULL		0.629	ACIN1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ACIN1	protein_coding	OTTHUMT00000071707.3	TC	NM_014977			23528503	-1	no_errors	ENST00000262710	ensembl	human	known	74_37	frame_shift_del	DEL	0.413:0.452	-
OPN4	94233	genome.wustl.edu	37	10	88416016	88416016	+	Silent	SNP	G	G	T	rs370827317		TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr10:88416016G>T	ENST00000241891.5	+	2	416	c.249G>T	c.(247-249)acG>acT	p.T83T	OPN4_ENST00000372071.2_Silent_p.T83T	NM_033282.3	NP_150598.1	Q9UHM6	OPN4_HUMAN	opsin 4	83					phototransduction (GO:0007602)|protein-chromophore linkage (GO:0018298)|regulation of circadian rhythm (GO:0042752)|rhodopsin mediated signaling pathway (GO:0016056)|rhythmic process (GO:0048511)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	11-cis retinal binding (GO:0005502)|G-protein coupled photoreceptor activity (GO:0008020)			breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|liver(2)|lung(5)|ovary(3)	18						TGGGACTCACGGGGATGCTGG	0.627																																																	0								ENSG00000122375						162.0	149.0	153.0					10																	88416016		2203	4300	6503	OPN4	SO:0001819	synonymous_variant	0			-	HGNC	AF147788	CCDS7376.1, CCDS31237.1	10q22	2012-08-08	2008-04-16		ENSG00000122375	ENSG00000122375		"""GPCR / Class A : Opsin receptors"""	14449	protein-coding gene	gene with protein product	"""melanopsin"""	606665	"""opsin 4 (melanopsin)"""			10632589	Standard	NM_001030015		Approved	MOP, melanopsin	uc001kdp.3	Q9UHM6	OTTHUMG00000018654	ENST00000241891.5:c.249G>T	10.37:g.88416016G>T		Somatic	0	60	0.00		0.599270127213081	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	B7ZLB3|Q14D01|Q2PP22|Q8NGQ9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_Opsin	p.T83	ENST00000241891.5	37	c.249	CCDS7376.1	10																																																																																			-	prints_GPCR_Rhodpsn		0.627	OPN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OPN4	protein_coding	OTTHUMT00000049158.2	G	NM_033282	-		88416016	+1	no_errors	ENST00000372071	ensembl	human	known	74_37	silent	SNP	0.150	T
RIMS2	9699	genome.wustl.edu	37	8	105106900	105106900	+	Missense_Mutation	SNP	A	A	G			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr8:105106900A>G	ENST00000436393.2	+	22	3330	c.3089A>G	c.(3088-3090)gAa>gGa	p.E1030G	RIMS2_ENST00000507740.1_Intron|RIMS2_ENST00000262231.10_Intron|RIMS2_ENST00000406091.3_Intron			Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	0					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			CAAGGGAAAGAAAAAGAACAG	0.358										HNSCC(12;0.0054)																																							0								ENSG00000176406																																			RIMS2	SO:0001583	missense	0			-	HGNC	AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000436393.2:c.3089A>G	8.37:g.105106900A>G	ENSP00000390665:p.Glu1030Gly	Somatic	0	19	0.00		0.599270127213081	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	17	57.50	B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_C2_dom,pfam_PDZ,superfamily_C2_dom,superfamily_PDZ,smart_PDZ,smart_C2_dom,pfscan_C2_dom,pfscan_PDZ	p.E1030G	ENST00000436393.2	37	c.3089		8	.	.	.	.	.	.	.	.	.	.	A	15.34	2.804228	0.50315	.	.	ENSG00000176406	ENST00000436393	T	0.12774	2.65	5.66	4.51	0.55191	.	.	.	.	.	T	0.11239	0.0274	.	.	.	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	T	0.08597	-1.0714	8	0.30854	T	0.27	.	11.5755	0.50858	0.9303:0.0:0.0697:0.0	.	1030	D6RA03	.	G	1030	ENSP00000390665:E1030G	ENSP00000390665:E1030G	E	+	2	0	RIMS2	105176076	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.491000	0.60326	1.081000	0.41110	0.533000	0.62120	GAA	-	NULL		0.358	RIMS2-007	NOVEL	basic|exp_conf	protein_coding	RIMS2	protein_coding	OTTHUMT00000367217.1	A	NM_001100117	-		105106900	+1	no_errors	ENST00000436393	ensembl	human	novel	74_37	missense	SNP	1.000	G
SLC39A12	221074	genome.wustl.edu	37	10	18250639	18250639	+	Missense_Mutation	SNP	T	T	C			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr10:18250639T>C	ENST00000377369.2	+	3	664	c.391T>C	c.(391-393)Tca>Cca	p.S131P	SLC39A12_ENST00000377371.3_Missense_Mutation_p.S131P|SLC39A12_ENST00000377374.4_Missense_Mutation_p.S131P|SLC39A12_ENST00000539911.1_5'UTR	NM_001145195.1|NM_001282733.1|NM_001282734.1	NP_001138667.1|NP_001269662.1|NP_001269663.1	Q504Y0	S39AC_HUMAN	solute carrier family 39 (zinc transporter), member 12	131					regulation of microtubule polymerization (GO:0031113)|regulation of neuron projection development (GO:0010975)|signal transduction (GO:0007165)|zinc ion transmembrane import (GO:0071578)	integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	zinc ion transmembrane transporter activity (GO:0005385)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|kidney(3)|large_intestine(5)|lung(38)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	60						GATCTGTTCTTCAAAGCTCAA	0.393																																																	0								ENSG00000148482						92.0	98.0	96.0					10																	18250639		2203	4300	6503	SLC39A12	SO:0001583	missense	0			-	HGNC		CCDS7124.1, CCDS44362.1, CCDS60493.1, CCDS60494.1	10p12.33	2013-05-22			ENSG00000148482	ENSG00000148482		"""Solute carriers"""	20860	protein-coding gene	gene with protein product		608734	"""solute carrier family 39 (metal ion transporter), member 12"""			12659941	Standard	NM_152725		Approved	FLJ30499	uc001ipo.2	Q504Y0	OTTHUMG00000017759	ENST00000377369.2:c.391T>C	10.37:g.18250639T>C	ENSP00000366586:p.Ser131Pro	Somatic	0	34	0.00		0.599270127213081	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	24	11.11	B7ZL35|C9JJL4|Q49AN8|Q4G0L3|Q5VWV8|Q5VWV9|Q6NZY5|Q96NN4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ZIP	p.S131P	ENST00000377369.2	37	c.391	CCDS44362.1	10	.	.	.	.	.	.	.	.	.	.	T	14.87	2.665573	0.47677	.	.	ENSG00000148482	ENST00000377369;ENST00000377374;ENST00000377371;ENST00000425219	T;T;T	0.23552	1.9;1.9;1.9	5.32	4.2	0.49525	.	0.319390	0.29791	N	0.011200	T	0.31263	0.0791	L	0.61036	1.89	0.80722	D	1	P;P;P	0.43024	0.798;0.696;0.661	P;B;B	0.45639	0.488;0.294;0.338	T	0.04752	-1.0929	10	0.41790	T	0.15	-12.3472	10.5407	0.45031	0.0:0.0759:0.0:0.9241	.	131;131;131	Q504Y0-4;Q504Y0;Q504Y0-3	.;S39AC_HUMAN;.	P	131;131;131;51	ENSP00000366586:S131P;ENSP00000366591:S131P;ENSP00000366588:S131P	ENSP00000366586:S131P	S	+	1	0	SLC39A12	18290645	1.000000	0.71417	0.998000	0.56505	0.991000	0.79684	2.920000	0.48844	2.005000	0.58758	0.528000	0.53228	TCA	-	NULL		0.393	SLC39A12-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC39A12	protein_coding		T	NM_152725	-		18250639	+1	no_errors	ENST00000377369	ensembl	human	known	74_37	missense	SNP	0.994	C
GRIN1	2902	genome.wustl.edu	37	9	140059670	140059670	+	Silent	SNP	T	T	A			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr9:140059670T>A	ENST00000371561.3	+	19	3719	c.2622T>A	c.(2620-2622)ccT>ccA	p.P874P	GRIN1_ENST00000471122.1_3'UTR|GRIN1_ENST00000371553.3_Silent_p.P895P|GRIN1_ENST00000371555.4_Intron|GRIN1_ENST00000371559.4_Intron|GRIN1_ENST00000371546.4_Silent_p.P895P|GRIN1_ENST00000371550.4_Intron|GRIN1_ENST00000315048.3_Silent_p.P874P|GRIN1_ENST00000371560.3_Intron|GRIN1_ENST00000350902.5_3'UTR	NM_007327.3	NP_015566.1	Q05586	NMDZ1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 1	874					adult locomotory behavior (GO:0008344)|calcium ion homeostasis (GO:0055074)|calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|cellular calcium ion homeostasis (GO:0006874)|cellular response to manganese ion (GO:0071287)|cerebral cortex development (GO:0021987)|conditioned taste aversion (GO:0001661)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term memory (GO:0007616)|male mating behavior (GO:0060179)|negative regulation of neuron apoptotic process (GO:0043524)|olfactory learning (GO:0008355)|pons maturation (GO:0021586)|positive regulation of apoptotic process (GO:0043065)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prepulse inhibition (GO:0060134)|propylene metabolic process (GO:0018964)|protein tetramerization (GO:0051262)|regulation of axonogenesis (GO:0050770)|regulation of dendrite morphogenesis (GO:0048814)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of membrane potential (GO:0042391)|regulation of respiratory gaseous exchange (GO:0043576)|regulation of synapse assembly (GO:0051963)|respiratory gaseous exchange (GO:0007585)|response to amphetamine (GO:0001975)|response to calcium ion (GO:0051592)|response to ethanol (GO:0045471)|response to fungicide (GO:0060992)|response to morphine (GO:0043278)|rhythmic process (GO:0048511)|sensory perception of pain (GO:0019233)|social behavior (GO:0035176)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|dendrite membrane (GO:0032590)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|excitatory synapse (GO:0060076)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)|synaptic cleft (GO:0043083)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate binding (GO:0016595)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|voltage-gated cation channel activity (GO:0022843)			NS(1)|breast(1)|endometrium(1)|kidney(1)|lung(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0878)	OV - Ovarian serous cystadenocarcinoma(145;6.87e-05)|Epithelial(140;0.00095)	Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	AGCCTGACCCTAAAAAGAAAG	0.522																																					NSCLC(113;717 1653 2089 20474 37618)												0								ENSG00000176884						152.0	152.0	152.0					9																	140059670		2203	4300	6503	GRIN1	SO:0001819	synonymous_variant	0			-	HGNC		CCDS7031.1, CCDS7032.1, CCDS43910.1, CCDS55354.1, CCDS55355.1	9q34.3	2013-01-11			ENSG00000176884	ENSG00000176884		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4584	protein-coding gene	gene with protein product		138249	"""N-methyl-D-aspartate receptor subunit NR1"""	NMDAR1		1350383	Standard	NM_000832		Approved	GluN1	uc004cln.3	Q05586	OTTHUMG00000020976	ENST00000371561.3:c.2622T>A	9.37:g.140059670T>A		Somatic	0	65	0.00		0.599270127213081	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.00	A6NLK7|A6NLR1|C9K0X1|P35437|Q12867|Q12868|Q5VSF3|Q5VSF4|Q5VSF5|Q5VSF6|Q5VSF7|Q5VSF8|Q9UPF8|Q9UPF9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Iontro_glu_rcpt,pfam_ANF_lig-bd_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,pfam_CaM-bd_C0_NMDA_rcpt_NR1,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.P874	ENST00000371561.3	37	c.2622	CCDS7031.1	9																																																																																			-	NULL		0.522	GRIN1-002	KNOWN	basic|CCDS	protein_coding	GRIN1	protein_coding	OTTHUMT00000055267.3	T	NM_007327	-		140059670	+1	no_errors	ENST00000371561	ensembl	human	known	74_37	silent	SNP	1.000	A
KRTAP10-9	386676	genome.wustl.edu	37	21	46048138	46048138	+	3'UTR	SNP	C	C	G	rs112351109		TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr21:46048138C>G	ENST00000397911.3	+	0	1099				TSPEAR_ENST00000323084.4_Intron|KRTAP10-9_ENST00000484861.1_3'UTR	NM_198690.2	NP_941963.2	P60411	KR109_HUMAN	keratin associated protein 10-9							keratin filament (GO:0045095)				endometrium(1)|kidney(1)|large_intestine(1)|lung(6)	9						ACCTCCCCCCCGGGCAGGCGA	0.697																																																	0								ENSG00000221837																																			KRTAP10-9	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AJ566386	CCDS42961.1	21q22.3	2007-10-05			ENSG00000221837	ENSG00000221837		"""Keratin associated proteins"""	22971	protein-coding gene	gene with protein product				KRTAP18-9			Standard	NM_198690		Approved	KAP10.9, KAP18.9	uc002zfp.4	P60411	OTTHUMG00000057637	ENST00000397911.3:c.*171C>G	21.37:g.46048138C>G		Somatic	0	55	0.00		0.599270127213081	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	28	15.15	A2RRG1|A6NIR9|Q70LJ1	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000397911.3	37	NULL	CCDS42961.1	21																																																																																			-	-		0.697	KRTAP10-9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP10-9	protein_coding	OTTHUMT00000128040.1	C		rs112351109		46048138	+1	no_errors	ENST00000484861	ensembl	human	known	74_37	rna	SNP	0.000	G
GAS2L3	283431	genome.wustl.edu	37	12	100994198	100994198	+	Silent	SNP	T	T	C			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr12:100994198T>C	ENST00000539410.1	+	3	443	c.57T>C	c.(55-57)agT>agC	p.S19S	GAS2L3_ENST00000266754.5_Silent_p.S19S|GAS2L3_ENST00000547754.1_Silent_p.S19S|GAS2L3_ENST00000537247.1_5'UTR			Q86XJ1	GA2L3_HUMAN	growth arrest-specific 2 like 3	19					actin cytoskeleton organization (GO:0030036)|cell cycle arrest (GO:0007050)|microtubule cytoskeleton organization (GO:0000226)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)	actin binding (GO:0003779)|microtubule binding (GO:0008017)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(15)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	35						GTCCTCGGAGTCCTCTGACTC	0.423																																																	0								ENSG00000139354						141.0	131.0	134.0					12																	100994198		2203	4300	6503	GAS2L3	SO:0001819	synonymous_variant	0			-	HGNC	AK095594	CCDS9079.1	12q23.1	2014-09-11			ENSG00000139354	ENSG00000139354			27475	protein-coding gene	gene with protein product							Standard	NM_174942		Approved		uc001thu.3	Q86XJ1	OTTHUMG00000170439	ENST00000539410.1:c.57T>C	12.37:g.100994198T>C		Somatic	0	52	0.00		0.599270127213081	3	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	53	10.17	B2RCN2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GAS2_dom,pfam_CH-domain,superfamily_CH-domain,superfamily_GAS2_dom,smart_CH-domain,smart_GAS2_dom,pfscan_CH-domain	p.S19	ENST00000539410.1	37	c.57	CCDS9079.1	12																																																																																			-	NULL		0.423	GAS2L3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	GAS2L3	protein_coding	OTTHUMT00000409143.1	T	NM_174942	-		100994198	+1	no_errors	ENST00000266754	ensembl	human	known	74_37	silent	SNP	1.000	C
KCNA7	3743	genome.wustl.edu	37	19	49575626	49575626	+	Missense_Mutation	SNP	G	G	T			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr19:49575626G>T	ENST00000221444.1	-	1	572	c.217C>A	c.(217-219)Cag>Aag	p.Q73K		NM_031886.2	NP_114092.2	Q96RP8	KCNA7_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 7	73					protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(4)|skin(2)	11		all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_epithelial(76;3.83e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		all cancers(93;0.000397)|OV - Ovarian serous cystadenocarcinoma(262;0.000519)|GBM - Glioblastoma multiforme(486;0.00541)|Epithelial(262;0.0441)	Dalfampridine(DB06637)	CCACCGGACTGGTAGTAGTAG	0.726																																					Colon(74;686 1235 3793 23366 48562)												0								ENSG00000104848						10.0	13.0	12.0					19																	49575626		2095	4074	6169	KCNA7	SO:0001583	missense	0			-	HGNC	AF315818	CCDS12755.1	19q13.3	2012-07-05				ENSG00000104848		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6226	protein-coding gene	gene with protein product		176268				16382104	Standard	NM_031886		Approved	Kv1.7, HAK6	uc002pmg.3	Q96RP8		ENST00000221444.1:c.217C>A	19.37:g.49575626G>T	ENSP00000221444:p.Gln73Lys	Somatic	0	20	0.00		0.599270127213081	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	21	16.00	A1KYX7|Q9BYS4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_2pore_dom_K_chnl_dom,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv1	p.Q73K	ENST00000221444.1	37	c.217	CCDS12755.1	19	.	.	.	.	.	.	.	.	.	.	g	31	5.104755	0.94245	.	.	ENSG00000104848	ENST00000221444	T	0.76186	-1.0	3.54	3.54	0.40534	BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	0.065445	0.64402	D	0.000005	D	0.87815	0.6272	M	0.91406	3.205	0.58432	D	0.99999	D	0.76494	0.999	D	0.71184	0.972	D	0.90808	0.4699	10	0.72032	D	0.01	.	14.453	0.67397	0.0:0.0:1.0:0.0	.	73	Q96RP8	KCNA7_HUMAN	K	73	ENSP00000221444:Q73K	ENSP00000221444:Q73K	Q	-	1	0	KCNA7	54267438	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	9.074000	0.93998	2.031000	0.59945	0.473000	0.43528	CAG	-	pfam_T1-type_BTB,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl		0.726	KCNA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNA7	protein_coding	OTTHUMT00000466263.1	G	NM_031886	-		49575626	-1	no_errors	ENST00000221444	ensembl	human	known	74_37	missense	SNP	1.000	T
ZNF366	167465	genome.wustl.edu	37	5	71757176	71757176	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr5:71757176C>T	ENST00000318442.5	-	2	638	c.148G>A	c.(148-150)Ggg>Agg	p.G50R		NM_152625.1	NP_689838.1	Q8N895	ZN366_HUMAN	zinc finger protein 366	50					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|estrogen receptor binding (GO:0030331)|metal ion binding (GO:0046872)|transcription corepressor activity (GO:0003714)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(9)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	35		Lung NSC(167;0.0247)|Ovarian(174;0.0908)|Prostate(461;0.155)		OV - Ovarian serous cystadenocarcinoma(47;2.51e-53)		GAAAATGGCCCTCGGAGAGCT	0.602																																																	0								ENSG00000178175						50.0	55.0	53.0					5																	71757176		2203	4300	6503	ZNF366	SO:0001583	missense	0			-	HGNC	AK097115	CCDS4015.1	5q13.1	2013-01-08			ENSG00000178175	ENSG00000178175		"""Zinc fingers, C2H2-type"""	18316	protein-coding gene	gene with protein product		610159					Standard	NM_152625		Approved	FLJ39796	uc003kce.1	Q8N895	OTTHUMG00000100965	ENST00000318442.5:c.148G>A	5.37:g.71757176C>T	ENSP00000313158:p.Gly50Arg	Somatic	0	49	0.00		0.599270127213081	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00	Q5HYI9|Q7RTV4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.G50R	ENST00000318442.5	37	c.148	CCDS4015.1	5	.	.	.	.	.	.	.	.	.	.	C	12.75	2.032673	0.35893	.	.	ENSG00000178175	ENST00000318442;ENST00000414109	T;T	0.44083	0.93;0.93	5.7	5.7	0.88788	.	0.272821	0.32081	N	0.006620	T	0.27866	0.0686	L	0.29908	0.895	0.09310	N	1	P	0.41947	0.766	B	0.37198	0.243	T	0.36866	-0.9730	10	0.66056	D	0.02	-38.8101	6.8502	0.24010	0.0:0.7132:0.1657:0.1211	.	50	Q8N895	ZN366_HUMAN	R	50	ENSP00000313158:G50R;ENSP00000391333:G50R	ENSP00000313158:G50R	G	-	1	0	ZNF366	71792932	0.000000	0.05858	0.998000	0.56505	0.888000	0.51559	0.299000	0.19138	2.695000	0.91970	0.561000	0.74099	GGG	-	NULL		0.602	ZNF366-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF366	protein_coding	OTTHUMT00000218574.3	C		-		71757176	-1	no_errors	ENST00000318442	ensembl	human	known	74_37	missense	SNP	0.145	T
KRTAP4-7	100132476	genome.wustl.edu	37	17	39240828	39240828	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr17:39240828G>A	ENST00000391417.4	+	1	370	c.370G>A	c.(370-372)Gtc>Atc	p.V124I		NM_033061.3	NP_149050.3	Q9BYR0	KRA47_HUMAN	keratin associated protein 4-7	179	31 X 5 AA repeats of C-C-[GIKRQVHEML]- [SPTRV]-[STVQRCP].		Missing. {ECO:0000269|PubMed:15955084}.		aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)				NS(1)|endometrium(3)|kidney(1)|lung(1)|prostate(2)|urinary_tract(1)	9						cCTGCGTCCAGTCTGTGGCCG	0.657																																																	0								ENSG00000240871						36.0	36.0	36.0					17																	39240828		692	1591	2283	KRTAP4-7	SO:0001583	missense	0			-	HGNC	AJ406939	CCDS45673.1	17q21.2	2013-06-25			ENSG00000240871	ENSG00000240871		"""Keratin associated proteins"""	18898	protein-coding gene	gene with protein product						11279113	Standard	NM_033061		Approved	KAP4.7	uc010wfn.2	Q9BYR0	OTTHUMG00000133582	ENST00000391417.4:c.370G>A	17.37:g.39240828G>A	ENSP00000375236:p.Val124Ile	Somatic	0	104	0.00		0.599270127213081	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	37	28	56.06	A0AVM6|A8MQ08|A8MTL4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Keratin-assoc	p.V124I	ENST00000391417.4	37	c.370	CCDS45673.1	17	.	.	.	.	.	.	.	.	.	.	.	13.10	2.136137	0.37728	.	.	ENSG00000240871	ENST00000391417	T	0.00605	6.27	3.17	2.15	0.27550	.	.	.	.	.	T	0.00637	0.0021	.	.	.	0.25808	N	0.98443	P	0.38280	0.625	B	0.38156	0.266	T	0.51309	-0.8722	8	0.72032	D	0.01	.	7.4682	0.27334	0.0:0.0:0.7416:0.2584	.	179	Q9BYR0	KRA47_HUMAN	I	124	ENSP00000375236:V124I	ENSP00000375236:V124I	V	+	1	0	KRTAP4-7	36494354	0.141000	0.22595	0.919000	0.36401	0.874000	0.50279	-0.503000	0.06383	0.610000	0.30035	0.305000	0.20034	GTC	-	NULL		0.657	KRTAP4-7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP4-7	protein_coding	OTTHUMT00000257686.1	G		-		39240828	+1	no_errors	ENST00000391417	ensembl	human	known	74_37	missense	SNP	0.993	A
DNM1P46	196968	genome.wustl.edu	37	15	100340186	100340186	+	RNA	SNP	C	C	A	rs200975818	byFrequency	TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr15:100340186C>A	ENST00000341853.1	-	0	740					NR_003260.1		Q6ZS02	DMP46_HUMAN	DNM1 pseudogene 46							microtubule (GO:0005874)	GTPase activity (GO:0003924)										CTCGTTCCCACGCGAGTCTCG	0.627																																																	0								ENSG00000182397						16.0	17.0	17.0					15																	100340186		1378	3412	4790	DNM1P46			0			-	HGNC	AJ576275		15q26.3	2013-04-25			ENSG00000182397	ENSG00000182397			35199	pseudogene	pseudogene			"""chromosome 15 open reading frame 51"""	DNM1DN14@, C15orf51			Standard	NR_003260		Approved	DNM1DN14.2, FLJ45937, DKFZp434I1020	uc021sxl.1	Q6ZS02	OTTHUMG00000149852		15.37:g.100340186C>A		Somatic	0	29	0.00		0.599270127213081	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	18	21.74	Q3ZCN3	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000341853.1	37	NULL		15																																																																																			-	-		0.627	DNM1P46-002	KNOWN	basic	processed_transcript	DNM1P46	pseudogene	OTTHUMT00000313543.1	C	NR_003260	rs200975818		100340186	-1	no_errors	ENST00000341853	ensembl	human	known	74_37	rna	SNP	0.981	A
HMBOX1	79618	genome.wustl.edu	37	8	28908583	28908583	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr8:28908583G>A	ENST00000397358.3	+	11	1878	c.1174G>A	c.(1174-1176)Gtg>Atg	p.V392M	HMBOX1_ENST00000444075.1_Missense_Mutation_p.V415M|HMBOX1_ENST00000524238.1_Missense_Mutation_p.V415M|HMBOX1_ENST00000519047.1_Intron|HMBOX1_ENST00000355231.5_Intron|RNA5SP260_ENST00000363849.1_RNA|HMBOX1_ENST00000287701.10_Missense_Mutation_p.V392M	NM_024567.3	NP_078843.2	Q6NT76	HMBX1_HUMAN	homeobox containing 1	392					negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)	11		Ovarian(32;0.0192)		KIRC - Kidney renal clear cell carcinoma(542;0.135)|Kidney(114;0.161)		CTCATTAGCTGTGGAAATGGC	0.463																																																	0								ENSG00000147421						176.0	144.0	155.0					8																	28908583		2203	4300	6503	HMBOX1	SO:0001583	missense	0			-	HGNC	AY522342	CCDS6071.1	8p12	2013-05-23			ENSG00000147421	ENSG00000147421		"""Homeoboxes / HNF class"""	26137	protein-coding gene	gene with protein product	"""homeobox telomere-binding protein 1"""					16825764	Standard	NM_024567		Approved	HNF1LA, PBHNF, FLJ21616, HOT1	uc003xhd.4	Q6NT76	OTTHUMG00000172138	ENST00000397358.3:c.1174G>A	8.37:g.28908583G>A	ENSP00000380516:p.Val392Met	Somatic	0	41	0.00		0.599270127213081	0	100.00	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	11	31.25	A4K385|A8K3R8|B4DHY5|D3DSU0|Q3Y6P1|Q96GS5|Q9H701	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_HNF-1_N,pfam_Homeobox_dom,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	p.V415M	ENST00000397358.3	37	c.1243	CCDS6071.1	8	.	.	.	.	.	.	.	.	.	.	G	19.45	3.830482	0.71258	.	.	ENSG00000147421	ENST00000287701;ENST00000444075;ENST00000397358;ENST00000524238;ENST00000517340	D;D;D;D	0.99898	-7.54;-7.61;-7.54;-7.61	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	D	0.99718	0.9891	L	0.27053	0.805	0.80722	D	1	D;D;D	0.71674	0.994;0.998;0.99	D;D;D	0.70487	0.931;0.943;0.969	D	0.97247	0.9895	10	0.46703	T	0.11	-4.7992	19.6056	0.95580	0.0:0.0:1.0:0.0	.	415;390;392	Q6NT76-5;Q6NT76-3;Q6NT76	.;.;HMBX1_HUMAN	M	392;415;392;415;390	ENSP00000287701:V392M;ENSP00000401769:V415M;ENSP00000380516:V392M;ENSP00000430110:V415M	ENSP00000287701:V392M	V	+	1	0	HMBOX1	28964502	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.538000	0.90634	2.625000	0.88918	0.655000	0.94253	GTG	-	NULL		0.463	HMBOX1-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	HMBOX1	protein_coding	OTTHUMT00000255267.4	G	NM_024567	-		28908583	+1	no_errors	ENST00000444075	ensembl	human	known	74_37	missense	SNP	1.000	A
ZNF407	55628	genome.wustl.edu	37	18	72775903	72775903	+	Frame_Shift_Del	DEL	T	T	-			TCGA-QQ-A5VB-01A-11D-A36J-09	TCGA-QQ-A5VB-11B-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d400acc7-dfdd-43c8-87ba-7fa730843de4	48693237-2b03-410f-8ac9-7d5ca5a4edb1	g.chr18:72775903delT	ENST00000299687.5	+	8	6226	c.6226delT	c.(6226-6228)ttcfs	p.F2076fs		NM_017757.2	NP_060227.2	Q9C0G0	ZN407_HUMAN	zinc finger protein 407	2076					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(21)|lung(23)|ovary(4)|prostate(3)|upper_aerodigestive_tract(2)	67		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.184)		ACAGGTGGCCTTCAAGAAGAT	0.667																																																	0								ENSG00000215421						43.0	50.0	47.0					18																	72775903		2126	4233	6359	ZNF407	SO:0001589	frameshift_variant	0				HGNC	AB051490	CCDS45885.1, CCDS54191.1, CCDS58634.1	18q23	2013-01-08			ENSG00000215421	ENSG00000215421		"""Zinc fingers, C2H2-type"""	19904	protein-coding gene	gene with protein product		615894				11214970	Standard	NM_017757		Approved	FLJ20307, FLJ13839, KIAA1703	uc002llw.2	Q9C0G0		ENST00000299687.5:c.6226delT	18.37:g.72775903delT	ENSP00000299687:p.Phe2076fs	Somatic	0	33	0.00		0.599270127213081	4	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	14	12.50	B5MD54|Q96MY0|Q9H8A1|Q9NXD4|Q9NXD7	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,smart_Znf_C2H2-like,smart_Znf_U1,pfscan_Znf_C2H2	p.F2076fs	ENST00000299687.5	37	c.6226	CCDS45885.1	18																																																																																			-	NULL		0.667	ZNF407-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF407	protein_coding	OTTHUMT00000444903.1	T	NM_017757			72775903	+1	no_errors	ENST00000299687	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
