#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
BPIFB3	359710	genome.wustl.edu	37	20	31643232	31643232	+	Start_Codon_SNP	SNP	G	G	T			TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr20:31643232G>T	ENST00000375494.3	+	1	3	c.3G>T	c.(1-3)atG>atT	p.M1I	AL121756.1_ENST00000579962.1_RNA	NM_182658.1	NP_872599.1	P59826	BPIB3_HUMAN	BPI fold containing family B, member 3	1					innate immune response (GO:0045087)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	lipid binding (GO:0008289)										TTATAGGCATGCAGCCAGTCA	0.607																																																	0								ENSG00000186190						117.0	113.0	114.0					20																	31643232		2203	4300	6503	BPIFB3	SO:0001582	initiator_codon_variant	0			-	HGNC	AF549189	CCDS13212.1	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000186190	ENSG00000186190		"""BPI fold containing"""	16178	protein-coding gene	gene with protein product		615717	"""chromosome 20 open reading frame 185"""	C20orf185		11971875, 21787333	Standard	NM_182658		Approved	dJ726C3.4, LPLUNC3, RYA3	uc002wym.1	P59826	OTTHUMG00000032234	ENST00000375494.3:c.3G>T	20.37:g.31643232G>T	ENSP00000364643:p.Met1Ile	Somatic	0	31	0.00		0.6643483795556975	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	18	52.63	Q5TDX7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Lipid-bd_serum_glycop_N,pfam_Lipid-bd_serum_glycop_C,superfamily_Bactericidal_perm-incr_a/b_dom,smart_Lipid-bd_serum_glycop_N,smart_Lipid-bd_serum_glycop_C	p.M1I	ENST00000375494.3	37	c.3	CCDS13212.1	20	.	.	.	.	.	.	.	.	.	.	G	12.15	1.850214	0.32699	.	.	ENSG00000186190	ENST00000375494	T	0.01234	5.13	5.07	1.97	0.26223	.	0.741846	0.11060	N	0.604032	T	0.01092	0.0036	.	.	.	0.23950	N	0.996372	B	0.02656	0.0	B	0.01281	0.0	T	0.47471	-0.9115	9	0.39692	T	0.17	-10.5474	3.267	0.06869	0.095:0.1715:0.5562:0.1773	.	1	P59826	BPIB3_HUMAN	I	1	ENSP00000364643:M1I	ENSP00000364643:M1I	M	+	3	0	BPIFB3	31106893	0.301000	0.24444	0.646000	0.29493	0.022000	0.10575	0.429000	0.21412	1.360000	0.45960	0.655000	0.94253	ATG	-	NULL		0.607	BPIFB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BPIFB3	protein_coding	OTTHUMT00000078654.2	G	NM_182658	-	Missense_Mutation	31643232	+1	no_errors	ENST00000375494	ensembl	human	known	74_37	missense	SNP	0.182	T
SHANK2	22941	genome.wustl.edu	37	11	70332048	70332048	+	Silent	SNP	C	C	A			TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr11:70332048C>A	ENST00000423696.2	-	15	3249	c.3213G>T	c.(3211-3213)tcG>tcT	p.S1071S	SHANK2_ENST00000449833.2_Silent_p.S855S|SHANK2_ENST00000409161.1_Silent_p.S854S|SHANK2_ENST00000338508.4_Silent_p.S1451S			Q9UPX8	SHAN2_HUMAN	SH3 and multiple ankyrin repeat domains 2	1071					adult behavior (GO:0030534)|learning (GO:0007612)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell junction (GO:0030054)|ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|growth cone (GO:0030426)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GKAP/Homer scaffold activity (GO:0030160)|ionotropic glutamate receptor binding (GO:0035255)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(30)|ovary(3)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	62			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)			TGGAGTTCAACGAAGGGGACT	0.527																																																	0								ENSG00000162105						78.0	82.0	80.0					11																	70332048		2200	4294	6494	SHANK2	SO:0001819	synonymous_variant	0			-	HGNC	AF141901		11q13.2	2013-01-10			ENSG00000162105	ENSG00000162105		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	14295	protein-coding gene	gene with protein product		603290	"""cortactin binding protein 1"""	CORTBP1		10506216	Standard	XM_005277930		Approved	CTTNBP1, ProSAP1, SHANK, SPANK-3	uc001oqc.3	Q9UPX8	OTTHUMG00000154615	ENST00000423696.2:c.3213G>T	11.37:g.70332048C>A		Somatic	0	33	0.00		0.6643483795556975	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	45	29.69	C0SPG8|C0SPG9|Q3Y8G9|Q52LK2|Q9UKP1	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_SAM_type1,pfam_SAM_2,pfam_SH3_2,pfam_PDZ,pfam_SH3_domain,superfamily_Ankyrin_rpt-contain_dom,superfamily_PDZ,superfamily_SAM/pointed,superfamily_SH3_domain,smart_Ankyrin_rpt,smart_SH3_domain,smart_PDZ,smart_SAM,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_PDZ,pfscan_SAM,pfscan_SH3_domain	p.S1451	ENST00000423696.2	37	c.4353		11																																																																																			-	NULL		0.527	SHANK2-203	KNOWN	basic	protein_coding	SHANK2	protein_coding		C	NM_012309	-		70332048	-1	no_errors	ENST00000338508	ensembl	human	known	74_37	silent	SNP	0.015	A
MTRNR2L1	100462977	genome.wustl.edu	37	17	22024247	22024247	+	IGR	SNP	A	A	G			TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr17:22024247A>G	ENST00000540040.1	+	0	1555				RP11-846F4.12_ENST00000483901.2_RNA|MTND1P15_ENST00000579693.1_RNA	NM_001190452.1	NP_001177381.1			MT-RNR2-like 1																		AATCCTTAAAACCCTCAACGT	0.468																																																	0								ENSG00000264168																																			MTND1P15	SO:0001628	intergenic_variant	0			-	HGNC	CR612552	CCDS54097.1	17p11.2	2014-02-18			ENSG00000256618	ENSG00000256618			37155	protein-coding gene	gene with protein product	"""humanin-like 1"""					19477263	Standard	NM_001190452		Approved		uc002gzb.2	P0CJ68	OTTHUMG00000179068		17.37:g.22024247A>G		Somatic	0	31	0.00		0.6643483795556975	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	19	48.65		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000540040.1	37	NULL	CCDS54097.1	17																																																																																			-	-		0.468	MTRNR2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTND1P15	protein_coding	OTTHUMT00000444600.2	A	NM_001190452	-		22024247	+1	no_errors	ENST00000579693	ensembl	human	known	74_37	rna	SNP	0.988	G
RP11-248J23.6	0	genome.wustl.edu	37	10	97728636	97728636	+	Missense_Mutation	SNP	G	G	T			TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr10:97728636G>T	ENST00000472454.2	+	7	852	c.614G>T	c.(613-615)tGg>tTg	p.W205L	ENTPD1-AS1_ENST00000451364.1_RNA|ENTPD1-AS1_ENST00000454638.1_RNA|ENTPD1-AS1_ENST00000452728.1_RNA|ENTPD1-AS1_ENST00000416301.1_RNA																							TTAATGTATTGGCCTGAAGTG	0.284																																																	0								ENSG00000269948																																			RP11-248J23.6	SO:0001583	missense	0			-	Clone_based_vega_gene																												ENST00000472454.2:c.614G>T	10.37:g.97728636G>T	ENSP00000473658:p.Trp205Leu	Somatic	0	32	0.00		0.6643483795556975	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	29	12.12		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.W205L	ENST00000472454.2	37	c.614		10																																																																																			-	NULL		0.284	RP11-248J23.6-001	NOVEL	basic|appris_principal	protein_coding	CC2D2B	protein_coding	OTTHUMT00000468149.1	G		-		97728636	+1	no_errors	ENST00000472454	ensembl	human	novel	74_37	missense	SNP	1.000	T
KIAA0922	23240	genome.wustl.edu	37	4	154544148	154544148	+	Missense_Mutation	SNP	C	C	T	rs148556115	byFrequency	TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr4:154544148C>T	ENST00000409663.3	+	29	4007	c.3955C>T	c.(3955-3957)Cgg>Tgg	p.R1319W	KIAA0922_ENST00000440693.1_Missense_Mutation_p.R1236W|KIAA0922_ENST00000409959.3_Missense_Mutation_p.R1320W	NM_015196.3	NP_056011.3	A2VDJ0	T131L_HUMAN	KIAA0922	1319	Ser-rich.					integral component of membrane (GO:0016021)				breast(2)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(16)|lung(20)|ovary(1)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	63	all_hematologic(180;0.093)	Renal(120;0.118)				GCGTGCCAGCCGGGGCAGCTG	0.622																																																	0								ENSG00000121210	C	TRP/ARG,TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	60.0	64.0	63.0		3958,3955	3.9	1.0	4	dbSNP_134	63	6,8594	5.0+/-18.6	0,6,4294	yes	missense,missense	KIAA0922	NM_001131007.1,NM_015196.3	101,101	0,7,6496	TT,TC,CC		0.0698,0.0227,0.0538	probably-damaging,probably-damaging	1320/1611,1319/1610	154544148	7,12999	2203	4300	6503	KIAA0922	SO:0001583	missense	0			GMAF=0.0005	HGNC	AK096538	CCDS3783.2, CCDS47148.1	4q31.3	2008-02-05			ENSG00000121210	ENSG00000121210			29146	protein-coding gene	gene with protein product						10231032, 11230166	Standard	NM_015196		Approved	DKFZp586H1322, TMEM131L	uc010ipp.3	A2VDJ0	OTTHUMG00000153244	ENST00000409663.3:c.3955C>T	4.37:g.154544148C>T	ENSP00000386574:p.Arg1319Trp	Somatic	0	16	0.00		0.6643483795556975	4	33.33	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	13	31.58	B3KRV3|Q7LGA7|Q86Y92|Q8WU56|Q9H065|Q9Y2D7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF3651_TMEM131	p.R1320W	ENST00000409663.3	37	c.3958	CCDS3783.2	4	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	22.4	4.287903	0.80803	2.27E-4	6.98E-4	ENSG00000121210	ENST00000409663;ENST00000440693;ENST00000409959;ENST00000240487	T;T;T;T	0.50001	1.06;0.76;1.05;0.79	5.69	3.94	0.45596	.	0.000000	0.85682	D	0.000000	T	0.62490	0.2432	L	0.59436	1.845	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.63220	-0.6686	10	0.87932	D	0	-11.0617	10.824	0.46620	0.1309:0.8012:0.0:0.0679	.	1236;1320;1319	A2VDJ0-3;A2VDJ0-5;A2VDJ0	.;.;T131L_HUMAN	W	1319;1236;1320;1097	ENSP00000386574:R1319W;ENSP00000409663:R1236W;ENSP00000386787:R1320W;ENSP00000240487:R1097W	ENSP00000240487:R1097W	R	+	1	2	KIAA0922	154763598	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	2.543000	0.45752	0.721000	0.32231	0.655000	0.94253	CGG	-	NULL		0.622	KIAA0922-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	KIAA0922	protein_coding	OTTHUMT00000330370.1	C	NM_015196	rs148556115		154544148	+1	no_errors	ENST00000409959	ensembl	human	known	74_37	missense	SNP	1.000	T
RBM19	9904	genome.wustl.edu	37	12	114384227	114384227	+	Silent	SNP	A	A	G			TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr12:114384227A>G	ENST00000545145.2	-	12	1539	c.1461T>C	c.(1459-1461)gaT>gaC	p.D487D	RBM19_ENST00000392561.3_Silent_p.D487D|RBM19_ENST00000261741.5_Silent_p.D487D	NM_001146699.1	NP_001140171.1	Q9Y4C8	RBM19_HUMAN	RNA binding motif protein 19	487					multicellular organismal development (GO:0007275)|positive regulation of embryonic development (GO:0040019)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(10)|liver(1)|lung(22)|ovary(1)|skin(3)|stomach(4)	55	Medulloblastoma(191;0.163)|all_neural(191;0.178)					GGGCACTGGCATCCTCGCTGG	0.557																																																	0								ENSG00000122965						148.0	114.0	125.0					12																	114384227		2203	4300	6503	RBM19	SO:0001819	synonymous_variant	0			-	HGNC	AL117547	CCDS9172.1	12q24.21	2013-02-12				ENSG00000122965		"""RNA binding motif (RRM) containing"""	29098	protein-coding gene	gene with protein product						9734811, 11230166	Standard	NM_016196		Approved	DKFZp586F1023, KIAA0682	uc009zwi.2	Q9Y4C8	OTTHUMG00000169646	ENST00000545145.2:c.1461T>C	12.37:g.114384227A>G		Somatic	0	48	0.00		0.6643483795556975	26	16.13	5	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	19	32.14	A8K5X9|Q9BPY6|Q9UFN5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_RRM_dom,smart_RRM_dom,smart_RRM_dom_euk,pfscan_RRM_dom	p.D487	ENST00000545145.2	37	c.1461	CCDS9172.1	12																																																																																			-	NULL		0.557	RBM19-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	RBM19	protein_coding	OTTHUMT00000405251.1	A	NM_016196	-		114384227	-1	no_errors	ENST00000261741	ensembl	human	known	74_37	silent	SNP	0.000	G
ESPNP	284729	genome.wustl.edu	37	1	17034456	17034463	+	RNA	DEL	GCGCGCGT	GCGCGCGT	-	rs140689885|rs58726851	byFrequency	TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	GCGCGCGT	GCGCGCGT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr1:17034456_17034463delGCGCGCGT	ENST00000492551.1	-	0	304_311					NR_026567.1				espin pseudogene																		CGTCGTGGGCGCGCGCGTGCGGGTCCGC	0.726														1012	0.202077	0.0446	0.2277	5008	,	,		27320	0.3135		0.2028	False		,,,				2504	0.2812																0								ENSG00000268869																																			ESPNP			0				HGNC	AL035288		1p36.13	2013-05-22			ENSG00000268869	ENSG00000268869			23285	pseudogene	pseudogene						15286153	Standard	NR_026567		Approved		uc001azn.1		OTTHUMG00000000803		1.37:g.17034456_17034463delGCGCGCGT		Somatic	NA	NA	NA		0.6643483795556975	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000492551.1	37	NULL		1																																																																																			-	-		0.726	ESPNP-002	KNOWN	basic	processed_transcript	ESPNP	pseudogene	OTTHUMT00000326311.1	GCGCGCGT				17034463	-1	no_errors	ENST00000492551	ensembl	human	known	74_37	rna	DEL	1.000:1.000:0.990:0.984:0.981:0.981:0.989:0.998	-
SALL1	6299	genome.wustl.edu	37	16	51183170	51183171	+	Intron	INS	-	-	T	rs535438423		TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr16:51183170_51183171insT	ENST00000251020.4	-	1	110				SALL1_ENST00000562674.1_Intron|SALL1_ENST00000440970.1_Intron|AC009166.5_ENST00000570060.1_RNA|SALL1_ENST00000541611.1_Intron|SALL1_ENST00000566102.1_Intron	NM_002968.2	NP_002959.2	Q9NSC2	SALL1_HUMAN	spalt-like transcription factor 1						adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic digestive tract development (GO:0048566)|embryonic digit morphogenesis (GO:0042733)|forelimb morphogenesis (GO:0035136)|gonad development (GO:0008406)|heart development (GO:0007507)|hindlimb morphogenesis (GO:0035137)|histone deacetylation (GO:0016575)|inductive cell-cell signaling (GO:0031129)|kidney development (GO:0001822)|kidney epithelium development (GO:0072073)|limb development (GO:0060173)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|olfactory bulb interneuron differentiation (GO:0021889)|olfactory bulb mitral cell layer development (GO:0061034)|olfactory nerve development (GO:0021553)|outer ear morphogenesis (GO:0042473)|pituitary gland development (GO:0021983)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ureteric bud invasion (GO:0072092)|ventricular septum development (GO:0003281)	chromocenter (GO:0010369)|cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(25)|lung(61)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	126		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			AAGGCCGAGACTTTTTTTTTTT	0.317																																					GBM(103;1352 1446 1855 4775 8890)												0								ENSG00000261238																																			AC009166.5	SO:0001627	intron_variant	0				Clone_based_vega_gene	X98833	CCDS10747.1, CCDS45483.1	16q12.1	2014-09-17	2013-10-17		ENSG00000103449	ENSG00000103449		"""Zinc fingers, C2H2-type"""	10524	protein-coding gene	gene with protein product		602218	"""sal (Drosophila)-like 1"", ""sal-like 1 (Drosophila)"""	TBS		9425907	Standard	NM_002968		Approved	Hsal1, ZNF794	uc021tie.1	Q9NSC2	OTTHUMG00000133176	ENST00000251020.4:c.76+1905->A	16.37:g.51183181_51183181dupT		Somatic	0	32	0.00		0.6643483795556975	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	23	11.54	Q99881|Q9NSC3|Q9P1R0	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000251020.4	37	NULL	CCDS10747.1	16																																																																																			-	-		0.317	SALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000261238	protein_coding	OTTHUMT00000256883.2	-	NM_002968			51183171	+1	no_errors	ENST00000570060	ensembl	human	known	74_37	rna	INS	0.000:0.007	T
RPTN	126638	genome.wustl.edu	37	1	152128045	152128045	+	Silent	SNP	G	G	A			TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr1:152128045G>A	ENST00000316073.3	-	3	1594	c.1530C>T	c.(1528-1530)caC>caT	p.H510H		NM_001122965.1	NP_001116437.1	Q6XPR3	RPTN_HUMAN	repetin	510	Gln-rich.					cornified envelope (GO:0001533)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|endometrium(14)|kidney(2)|large_intestine(1)|lung(32)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	59						TCTGACCATAGTGGGAACTTT	0.502																																																	0								ENSG00000215853						824.0	716.0	749.0					1																	152128045		1568	3582	5150	RPTN	SO:0001819	synonymous_variant	0			-	HGNC	AK096436	CCDS41397.1	1q21.3	2013-01-10			ENSG00000215853	ENSG00000215853		"""EF-hand domain containing"""	26809	protein-coding gene	gene with protein product		613259				15854042	Standard	NM_001122965		Approved	FLJ39117	uc001ezs.1	Q6XPR3	OTTHUMG00000154095	ENST00000316073.3:c.1530C>T	1.37:g.152128045G>A		Somatic	0	141	0.00		0.6643483795556975	3	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	92	325	22.06	B7ZBZ3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_S100_Ca-bd_sub,pfscan_EF_hand_dom	p.H510	ENST00000316073.3	37	c.1530	CCDS41397.1	1																																																																																			-	NULL		0.502	RPTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPTN	protein_coding	OTTHUMT00000333867.1	G	XM_371312	-		152128045	-1	no_errors	ENST00000316073	ensembl	human	known	74_37	silent	SNP	0.000	A
GJD3	125111	genome.wustl.edu	37	17	38517389	38517389	+	IGR	SNP	G	G	A			TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr17:38517389G>A	ENST00000578689.1	-	0	885				CTD-2267D19.3_ENST00000578774.1_Splice_Site_p.R49K|GJD3_ENST00000337376.4_Missense_Mutation_p.P246L	NM_152219.3	NP_689343.3	Q8N144	CXD3_HUMAN	gap junction protein, delta 3, 31.9kDa						cell communication (GO:0007154)|gap junction assembly (GO:0016264)	cell surface (GO:0009986)|connexon complex (GO:0005922)|integral component of plasma membrane (GO:0005887)	ion channel activity (GO:0005216)						Breast(137;0.00328)	STAD - Stomach adenocarcinoma(5;0.00143)			GACAACAATAggtgggtgggc	0.582																																																	0								ENSG00000183153																																			GJD3	SO:0001628	intergenic_variant	0			-	HGNC	AF514298	CCDS58547.1	17q21.1	2012-04-19	2007-11-06	2007-11-06	ENSG00000183153	ENSG00000183153		"""Ion channels / Gap junction proteins (connexins)"""	19147	protein-coding gene	gene with protein product	"""connexin 31.9"""	607425	"""gap junction protein, chi 1, 31.9kDa"""	GJC1		12176752	Standard	NM_152219		Approved	CX31.9, GJA11, Cx30.2	uc010cwz.3	Q8N144			17.37:g.38517389G>A		Somatic	0	21	0.00		0.6643483795556975	0	100.00	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	31	32.61	Q6ZUW6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Connexin_N,pfam_Connexin_CCC,smart_Connexin_N,prints_Connexin	p.P246L	ENST00000578689.1	37	c.737	CCDS58547.1	17	.	.	.	.	.	.	.	.	.	.	G	7.728	0.698654	0.15106	.	.	ENSG00000183153	ENST00000337376	D	0.97791	-4.54	2.23	1.24	0.21308	.	4.747970	0.01021	U	0.003986	D	0.93331	0.7874	.	.	.	0.19575	N	0.999961	.	.	.	.	.	.	D	0.88346	0.2978	7	0.17832	T	0.49	.	4.7867	0.13229	0.1873:0.0:0.8127:0.0	.	.	.	.	L	246	ENSP00000336832:P246L	ENSP00000336832:P246L	P	-	2	0	GJD3	35770915	0.022000	0.18835	0.117000	0.21633	0.008000	0.06430	1.075000	0.30716	0.493000	0.27837	-0.339000	0.08088	CCT	-	NULL		0.582	GJD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GJD3	protein_coding	OTTHUMT00000447449.1	G	NM_152219	-		38517389	-1	no_errors	ENST00000337376	ensembl	human	known	74_37	missense	SNP	0.158	A
C6	729	genome.wustl.edu	37	5	41153915	41153915	+	Missense_Mutation	SNP	T	T	C			TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr5:41153915T>C	ENST00000263413.3	-	15	2551	c.2287A>G	c.(2287-2289)Aaa>Gaa	p.K763E	C6_ENST00000337836.5_Missense_Mutation_p.K763E	NM_001115131.1	NP_001108603.2	P13671	CO6_HUMAN	complement component 6	763	C5b-binding domain.|CCP 2.|Sushi 2. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)				central_nervous_system(2)|cervix(2)|endometrium(2)|kidney(7)|large_intestine(16)|liver(1)|lung(51)|ovary(3)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)	96		Breast(839;1.07e-05)|Ovarian(839;0.0228)|Lung SC(612;0.0548)|Lung NSC(810;0.128)|all_neural(839;0.157)				TACTCACCTTTTTCACAGGTG	0.478																																																	0								ENSG00000039537						77.0	65.0	69.0					5																	41153915		2203	4300	6503	C6	SO:0001583	missense	0			-	HGNC	J05024	CCDS3936.1	5p13.1	2014-09-17			ENSG00000039537	ENSG00000039537		"""Complement system"""	1339	protein-coding gene	gene with protein product		217050					Standard	NM_001115131		Approved		uc003jmk.3	P13671	OTTHUMG00000094781	ENST00000263413.3:c.2287A>G	5.37:g.41153915T>C	ENSP00000263413:p.Lys763Glu	Somatic	0	58	0.00		0.6643483795556975	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	45	30.77		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MACPF,pfam_Sushi_SCR_CCP,pfam_Thrombospondin_1_rpt,pfam_LDrepeatLR_classA_rpt,pfam_Kazal_dom,superfamily_Sushi_SCR_CCP,superfamily_Thrombospondin_1_rpt,superfamily_LDrepeatLR_classA_rpt,smart_Thrombospondin_1_rpt,smart_LDrepeatLR_classA_rpt,smart_MACPF,smart_Sushi_SCR_CCP,smart_FacI_MAC,prints_MAC_perforin,pfscan_LDrepeatLR_classA_rpt,pfscan_Sushi_SCR_CCP,pfscan_Thrombospondin_1_rpt	p.K763E	ENST00000263413.3	37	c.2287	CCDS3936.1	5	.	.	.	.	.	.	.	.	.	.	T	10.53	1.375278	0.24857	.	.	ENSG00000039537	ENST00000337836;ENST00000263413	T;T	0.60920	0.15;0.15	5.48	-0.314	0.12750	Sushi/SCR/CCP (1);	0.483231	0.24400	N	0.038859	T	0.33962	0.0881	N	0.17379	0.485	0.80722	D	1	B	0.09022	0.002	B	0.09377	0.004	T	0.07347	-1.0777	10	0.18276	T	0.48	.	9.6154	0.39687	0.0:0.067:0.4197:0.5133	.	763	P13671	CO6_HUMAN	E	763	ENSP00000338861:K763E;ENSP00000263413:K763E	ENSP00000263413:K763E	K	-	1	0	C6	41189672	0.936000	0.31750	1.000000	0.80357	0.949000	0.60115	-0.220000	0.09215	0.353000	0.24079	0.374000	0.22700	AAA	-	pfscan_Sushi_SCR_CCP		0.478	C6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C6	protein_coding	OTTHUMT00000211592.1	T		-		41153915	-1	no_errors	ENST00000263413	ensembl	human	known	74_37	missense	SNP	0.998	C
RNF8	9025	genome.wustl.edu	37	6	37321910	37321910	+	De_novo_Start_InFrame	SNP	G	G	A			TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr6:37321910G>A	ENST00000373479.4	+	0	163				RNF8_ENST00000479516.1_3'UTR|RNF8_ENST00000469731.1_De_novo_Start_InFrame|RNF8_ENST00000394443.4_De_novo_Start_InFrame	NM_003958.3|NM_183078.2	NP_003949.1|NP_898901.1	O76064	RNF8_HUMAN	ring finger protein 8, E3 ubiquitin protein ligase						cellular response to DNA damage stimulus (GO:0006974)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|histone exchange (GO:0043486)|histone H2A K63-linked ubiquitination (GO:0070535)|histone H2A ubiquitination (GO:0033522)|histone H2B ubiquitination (GO:0033523)|interstrand cross-link repair (GO:0036297)|isotype switching (GO:0045190)|mitotic nuclear division (GO:0007067)|negative regulation of translational elongation (GO:0045900)|positive regulation of DNA repair (GO:0045739)|protein autoubiquitination (GO:0051865)|protein K48-linked ubiquitination (GO:0070936)|protein K63-linked ubiquitination (GO:0070534)|response to ionizing radiation (GO:0010212)|spermatid development (GO:0007286)|ubiquitin-dependent protein catabolic process (GO:0006511)	chromosome, telomeric region (GO:0000781)|nucleolus (GO:0005730)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)|ubiquitin ligase complex (GO:0000151)	acid-amino acid ligase activity (GO:0016881)|chromatin binding (GO:0003682)|histone binding (GO:0042393)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|urinary_tract(1)	13						GGTCTCGCTCGGTGCTGACCG	0.652																																																	0								ENSG00000112130						8.0	10.0	9.0					6																	37321910		2136	4198	6334	RNF8			0			-	HGNC	AB012770	CCDS4833.1, CCDS4834.1	6p21.3	2013-01-09	2012-02-23		ENSG00000112130	ENSG00000112130		"""RING-type (C3HC4) zinc fingers"""	10071	protein-coding gene	gene with protein product		611685	"""ring finger protein (C3HC4 type) 8"", ""ring finger protein 8"""			9734811, 9852682	Standard	NM_003958		Approved	KIAA0646	uc003onq.4	O76064	OTTHUMG00000014620		6.37:g.37321910G>A		Somatic	0	13	0.00		0.6643483795556975	18	25.00	6	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	13	31.58	A6NN24|A8MYC0|B4DPG0|Q53H16|Q5NKW5	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000373479.4	37	NULL	CCDS4834.1	6																																																																																			-	-		0.652	RNF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF8	protein_coding	OTTHUMT00000040403.2	G		-		37321910	+1	no_errors	ENST00000479516	ensembl	human	known	74_37	rna	SNP	0.000	A
DGKG	1608	genome.wustl.edu	37	3	185979537	185979537	+	Missense_Mutation	SNP	G	G	T			TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr3:185979537G>T	ENST00000265022.3	-	15	1839	c.1300C>A	c.(1300-1302)Ccc>Acc	p.P434T	DGKG_ENST00000344484.4_Missense_Mutation_p.P434T|DGKG_ENST00000544847.1_Missense_Mutation_p.P375T|DGKG_ENST00000382164.4_Missense_Mutation_p.P395T	NM_001080744.1|NM_001080745.1|NM_001346.2	NP_001074213.1|NP_001074214.1|NP_001337.2	P49619	DGKG_HUMAN	diacylglycerol kinase, gamma 90kDa	434	DAGKc. {ECO:0000255|PROSITE- ProRule:PRU00783}.				blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|neuron development (GO:0048666)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(17)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	42	all_cancers(143;3.26e-12)|Ovarian(172;0.0315)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)	GBM - Glioblastoma multiforme(93;0.0657)	Phosphatidylserine(DB00144)	ACCAGCAGGGGGTGGGTACCC	0.502																																																	0								ENSG00000058866						24.0	22.0	22.0					3																	185979537		2203	4300	6503	DGKG	SO:0001583	missense	0			-	HGNC	AF020945	CCDS3274.1, CCDS43181.1, CCDS43182.1	3q27-q28	2013-01-10	2002-08-29		ENSG00000058866	ENSG00000058866	2.7.1.107	"""EF-hand domain containing"""	2853	protein-coding gene	gene with protein product		601854	"""diacylglycerol kinase, gamma (90kD)"""	DAGK3		8034597	Standard	NM_001080744		Approved		uc003fqa.3	P49619	OTTHUMG00000156617	ENST00000265022.3:c.1300C>A	3.37:g.185979537G>T	ENSP00000265022:p.Pro434Thr	Somatic	0	81	0.00		0.6643483795556975	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	47	45	51.09	B2RAH4|Q2M1H4|Q5FWG1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Diacylglycerol_kin_accessory,pfam_Diacylglycerol_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,smart_EF_hand_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kin_accessory,pfscan_EF_hand_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd	p.P434T	ENST00000265022.3	37	c.1300	CCDS3274.1	3	.	.	.	.	.	.	.	.	.	.	G	31	5.089601	0.94149	.	.	ENSG00000058866	ENST00000265022;ENST00000344484;ENST00000382164;ENST00000544847;ENST00000538691	T;T;T;T	0.44881	0.92;0.91;0.92;0.92	5.52	5.52	0.82312	Diacylglycerol kinase, catalytic domain (2);	0.000000	0.85682	D	0.000000	T	0.78149	0.4238	H	0.97291	3.975	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.86117	0.1566	10	0.87932	D	0	.	18.2113	0.89871	0.0:0.0:1.0:0.0	.	375;434;395;434	F5GX27;P49619-2;P49619-3;P49619	.;.;.;DGKG_HUMAN	T	434;434;395;375;398	ENSP00000265022:P434T;ENSP00000339777:P434T;ENSP00000371599:P395T;ENSP00000440507:P375T	ENSP00000265022:P434T	P	-	1	0	DGKG	187462231	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.706000	0.98722	2.590000	0.87494	0.563000	0.77884	CCC	-	smart_Diacylglycerol_kinase_cat_dom		0.502	DGKG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DGKG	protein_coding	OTTHUMT00000344800.3	G		-		185979537	-1	no_errors	ENST00000265022	ensembl	human	known	74_37	missense	SNP	1.000	T
CSPG4P8	440297	genome.wustl.edu	37	15	82764545	82764545	+	RNA	SNP	C	C	T			TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr15:82764545C>T	ENST00000342039.2	+	0	1437				RP11-152F13.3_ENST00000558577.1_RNA					chondroitin sulfate proteoglycan 4 pseudogene 8																		CGCCCGTGGACGACACCTGGT	0.627																																																	0								ENSG00000188384																																			CSPG4P8			0			-	HGNC			15q25.2	2013-05-10			ENSG00000188384	ENSG00000276710			48359	pseudogene	pseudogene							Standard			Approved				OTTHUMG00000170548		15.37:g.82764545C>T		Somatic	0	9	0.00		0.6643483795556975	19	62.75	32	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	1	88.89		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000342039.2	37	NULL		15																																																																																			-	-		0.627	CSPG4P8-001	KNOWN	basic	processed_transcript	CSPG4P8	pseudogene	OTTHUMT00000409585.1	C		-		82764545	+1	no_errors	ENST00000342039	ensembl	human	known	74_37	rna	SNP	0.999	T
ASXL1	171023	genome.wustl.edu	37	20	31022346	31022346	+	Missense_Mutation	SNP	G	G	A	rs372418554		TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr20:31022346G>A	ENST00000375687.4	+	13	2255	c.1831G>A	c.(1831-1833)Gcc>Acc	p.A611T	ASXL1_ENST00000306058.5_Missense_Mutation_p.A606T	NM_015338.5	NP_056153	Q8IXJ9	ASXL1_HUMAN	additional sex combs like transcriptional regulator 1	611	Interaction with NCOA1. {ECO:0000250}.				bone development (GO:0060348)|monoubiquitinated histone H2A deubiquitination (GO:0035522)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035359)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of retinoic acid receptor signaling pathway (GO:0048386)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to retinoic acid (GO:0032526)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|PR-DUB complex (GO:0035517)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|peroxisome proliferator activated receptor binding (GO:0042975)|retinoic acid receptor binding (GO:0042974)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.Q592fs*5(1)		NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(655)|kidney(5)|large_intestine(18)|liver(1)|lung(27)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	722						TTGGACTGGCGCCAGGACCCT	0.632			"""F, N, Mis"""		"""MDS, CMML"""																																			Rec	yes		20	20q11.1	171023	additional sex combs like 1		L	1	Deletion - Frameshift(1)	haematopoietic_and_lymphoid_tissue(1)						ENSG00000171456	G	THR/ALA	0,4406		0,0,2203	28.0	30.0	29.0		1831	3.5	0.8	20		29	1,8599		0,1,4299	no	missense	ASXL1	NM_015338.5	58	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	611/1542	31022346	1,13005	2203	4300	6503	ASXL1	SO:0001583	missense	0			-	HGNC	AJ438952	CCDS13201.1	20q11	2014-09-17	2014-06-17		ENSG00000171456	ENSG00000171456			18318	protein-coding gene	gene with protein product		612990	"""additional sex combs like 1 (Drosophila)"""			12657473	Standard	NM_015338		Approved	KIAA0978	uc002wxs.3	Q8IXJ9	OTTHUMG00000032218	ENST00000375687.4:c.1831G>A	20.37:g.31022346G>A	ENSP00000364839:p.Ala611Thr	Somatic	0	77	0.00		0.6643483795556975	24	22.58	7	WXS	Illumina HiSeq 2500	Phase_IV	tier1	32	84	27.59	B2RP59|Q5JWS9|Q8IYY7|Q9H466|Q9NQF8|Q9UFJ0|Q9UFP8|Q9Y2I4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.A611T	ENST00000375687.4	37	c.1831	CCDS13201.1	20	.	.	.	.	.	.	.	.	.	.	G	15.14	2.744085	0.49151	0.0	1.16E-4	ENSG00000171456	ENST00000358956;ENST00000375687;ENST00000421155;ENST00000412498;ENST00000306058	T;T	0.56941	0.43;0.43	5.41	3.45	0.39498	.	0.109289	0.64402	D	0.000008	T	0.61489	0.2351	M	0.65975	2.015	0.39708	D	0.971284	B;D	0.71674	0.445;0.998	B;P	0.56216	0.022;0.794	T	0.64271	-0.6447	10	0.52906	T	0.07	-4.905	10.3193	0.43756	0.0718:0.4059:0.5222:0.0	.	606;611	A6NIZ6;Q8IXJ9	.;ASXL1_HUMAN	T	611;611;611;550;606	ENSP00000364839:A611T;ENSP00000305119:A606T	ENSP00000305119:A606T	A	+	1	0	ASXL1	30486007	0.998000	0.40836	0.843000	0.33291	0.961000	0.63080	2.702000	0.47102	0.835000	0.34877	0.561000	0.74099	GCC	-	NULL		0.632	ASXL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ASXL1	protein_coding	OTTHUMT00000078624.2	G	NM_015338	-		31022346	+1	no_errors	ENST00000375687	ensembl	human	known	74_37	missense	SNP	0.406	A
MS4A2	2206	genome.wustl.edu	37	11	59857211	59857211	+	Missense_Mutation	SNP	T	T	C			TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr11:59857211T>C	ENST00000278888.3	+	2	205	c.103T>C	c.(103-105)Tca>Cca	p.S35P		NM_000139.4	NP_000130.1	Q01362	FCERB_HUMAN	membrane-spanning 4-domains, subfamily A, member 2	35					activation of phospholipase C activity (GO:0007202)|cytokine secretion (GO:0050663)|Fc-epsilon receptor signaling pathway (GO:0038095)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of mast cell degranulation (GO:0043306)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|Fc-epsilon receptor I complex (GO:0032998)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)				endometrium(1)|large_intestine(4)|lung(9)|ovary(1)|upper_aerodigestive_tract(2)	17		all_epithelial(135;0.245)			Omalizumab(DB00043)	GGAAGTATCTTCAGGCAGACT	0.468																																																	0								ENSG00000149534						133.0	128.0	130.0					11																	59857211		2201	4295	6496	MS4A2	SO:0001583	missense	0			-	HGNC	M89796	CCDS7980.1, CCDS73292.1	11q12-q13	2012-02-28	2012-02-28		ENSG00000149534	ENSG00000149534			7316	protein-coding gene	gene with protein product	"""Fc fragment of IgE, high affinity I, receptor for; beta polypeptide"""	147138	"""IgE responsiveness (atopic)"", ""membrane-spanning 4-domains, subfamily A, member 2 (Fc fragment of IgE, high affinity I, receptor for; beta polypeptide)"""	FCER1B, IGER, APY		1386024	Standard	NM_000139		Approved	MS4A1	uc001nop.3	Q01362	OTTHUMG00000167239	ENST00000278888.3:c.103T>C	11.37:g.59857211T>C	ENSP00000278888:p.Ser35Pro	Somatic	0	38	0.00		0.6643483795556975	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	25	43.18	Q54A81	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_CD20-like	p.S35P	ENST00000278888.3	37	c.103	CCDS7980.1	11	.	.	.	.	.	.	.	.	.	.	T	7.946	0.743788	0.15642	.	.	ENSG00000149534	ENST00000524868;ENST00000278888	D;T	0.85411	-1.98;2.06	3.89	-3.36	0.04913	.	13.823300	0.00166	N	0.000000	T	0.70954	0.3283	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.57254	-0.7843	10	0.26408	T	0.33	3.3627	5.3408	0.15982	0.1278:0.671:0.0:0.2012	.	35	Q01362	FCERB_HUMAN	P	35	ENSP00000433311:S35P;ENSP00000278888:S35P	ENSP00000278888:S35P	S	+	1	0	MS4A2	59613787	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.849000	0.04322	-0.605000	0.05753	0.377000	0.23210	TCA	-	NULL		0.468	MS4A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MS4A2	protein_coding	OTTHUMT00000393844.1	T		-		59857211	+1	no_errors	ENST00000278888	ensembl	human	known	74_37	missense	SNP	0.000	C
EXOC7	23265	genome.wustl.edu	37	17	74079821	74079821	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr17:74079821C>T	ENST00000335146.7	-	20	2169	c.2116G>A	c.(2116-2118)Gtg>Atg	p.V706M	EXOC7_ENST00000411744.2_Missense_Mutation_p.V647M|EXOC7_ENST00000467929.2_Missense_Mutation_p.V627M|EXOC7_ENST00000405575.4_Missense_Mutation_p.V664M|EXOC7_ENST00000589210.1_Missense_Mutation_p.V655M|EXOC7_ENST00000332065.5_Missense_Mutation_p.V624M|EXOC7_ENST00000591724.1_5'Flank|EXOC7_ENST00000607838.1_Missense_Mutation_p.V678M			Q9UPT5	EXOC7_HUMAN	exocyst complex component 7	706					cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|membrane organization (GO:0061024)|protein transport (GO:0015031)	centriolar satellite (GO:0034451)|exocyst (GO:0000145)|growth cone membrane (GO:0032584)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|plasma membrane (GO:0005886)				NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|skin(1)	14			LUSC - Lung squamous cell carcinoma(166;0.187)			GTGAAGGGCACGCTGCCAAAC	0.612																																																	0								ENSG00000182473						119.0	92.0	101.0					17																	74079821		2203	4300	6503	EXOC7	SO:0001583	missense	0			-	HGNC	BC029432	CCDS11741.1, CCDS32738.1, CCDS45781.1, CCDS45782.1, CCDS45784.1, CCDS74164.1	17q25.3	2013-01-22			ENSG00000182473	ENSG00000182473			23214	protein-coding gene	gene with protein product		608163				12477932	Standard	NM_001013839		Approved	EXO70, KIAA1067, YJL085W, Exo70p	uc010wsw.2	Q9UPT5	OTTHUMG00000150720	ENST00000335146.7:c.2116G>A	17.37:g.74079821C>T	ENSP00000334100:p.Val706Met	Somatic	0	28	0.00		0.6643483795556975	134	32.50	65	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	25	32.43	B5MC69|B8XXP2|Q8ND93|Q8WV91|Q96FF0|Q9H8C3|Q9H9X3|Q9HA32	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Exo70,superfamily_Cullin_repeat-like_dom	p.V706M	ENST00000335146.7	37	c.2116	CCDS45782.1	17	.	.	.	.	.	.	.	.	.	.	c	11.03	1.518467	0.27211	.	.	ENSG00000182473	ENST00000332065;ENST00000351709;ENST00000405575;ENST00000335146;ENST00000357231;ENST00000425372;ENST00000411744	.	.	.	4.67	4.67	0.58626	Cullin repeat-like-containing domain (1);	0.064517	0.64402	D	0.000009	T	0.73273	0.3566	L	0.46741	1.465	0.80722	D	1	P;P;D;B;P;P;P	0.67145	0.565;0.57;0.996;0.337;0.865;0.871;0.913	B;B;D;B;B;B;B	0.69479	0.132;0.099;0.964;0.067;0.155;0.31;0.303	T	0.74639	-0.3598	9	0.51188	T	0.08	-21.454	17.759	0.88459	0.0:1.0:0.0:0.0	.	647;678;627;592;706;624;655	Q9UPT5-5;Q9UPT5-6;B4DJ07;F5H1P1;Q9UPT5;Q9UPT5-2;Q9UPT5-1	.;.;.;.;EXOC7_HUMAN;.;.	M	624;544;678;706;655;592;647	.	ENSP00000333806:V624M	V	-	1	0	EXOC7	71591416	1.000000	0.71417	0.996000	0.52242	0.073000	0.16967	3.563000	0.53784	2.427000	0.82271	0.556000	0.70494	GTG	-	pfam_Exo70,superfamily_Cullin_repeat-like_dom		0.612	EXOC7-006	KNOWN	basic|CCDS	protein_coding	EXOC7	protein_coding	OTTHUMT00000319768.2	C	NM_015219	-		74079821	-1	no_errors	ENST00000335146	ensembl	human	known	74_37	missense	SNP	1.000	T
SVEP1	79987	genome.wustl.edu	37	9	113139339	113139349	+	Intron	DEL	TTAGATGGATC	TTAGATGGATC	-	rs199857649|rs150807622|rs3831124|rs200967302	byFrequency	TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	TTAGATGGATC	TTAGATGGATC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr9:113139339_113139349delTTAGATGGATC	ENST00000401783.2	-	45	10841				SVEP1_ENST00000297826.5_Intron|SVEP1_ENST00000374469.1_Intron	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1						cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						GAAAATGACTTTAGATGGATCTTAATAACAG	0.379														720	0.14377	0.2133	0.1614	5008	,	,		22497	0.0913		0.1064	False		,,,				2504	0.1299																0								ENSG00000165124																																			SVEP1	SO:0001627	intron_variant	0				HGNC	AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.10504+201GATCCATCTAA>-	9.37:g.113139339_113139349delTTAGATGGATC		Somatic	NA	NA	NA		0.6643483795556975	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000401783.2	37	NULL	CCDS48004.1	9																																																																																			-	-		0.379	SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	SVEP1	protein_coding		TTAGATGGATC				113139349	-1	no_errors	ENST00000476205	ensembl	human	known	74_37	rna	DEL	0.001:0.002:0.000:0.000:0.006:0.013:0.026:0.029:0.025:0.023:0.001	-
ACAD11	84129	genome.wustl.edu	37	3	132378670	132378670	+	5'UTR	SNP	G	G	T			TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr3:132378670G>T	ENST00000264990.6	-	0	897				UBA5_ENST00000494238.2_5'Flank|UBA5_ENST00000264991.4_Intron|ACAD11_ENST00000481970.2_5'UTR|UBA5_ENST00000493720.2_5'Flank|UBA5_ENST00000356232.4_5'UTR|ACAD11_ENST00000355458.3_5'UTR|ACAD11_ENST00000489991.1_5'UTR|UBA5_ENST00000473651.1_5'Flank|ACAD11_ENST00000545291.1_5'UTR	NM_032169.4	NP_115545	Q709F0	ACD11_HUMAN	acyl-CoA dehydrogenase family, member 11						fatty acid beta-oxidation using acyl-CoA dehydrogenase (GO:0033539)	mitochondrial membrane (GO:0031966)|nucleus (GO:0005634)|peroxisome (GO:0005777)	flavin adenine dinucleotide binding (GO:0050660)|long-chain-acyl-CoA dehydrogenase activity (GO:0004466)|medium-chain-acyl-CoA dehydrogenase activity (GO:0070991)|transferase activity, transferring phosphorus-containing groups (GO:0016772)|very-long-chain-acyl-CoA dehydrogenase activity (GO:0017099)			breast(2)|endometrium(6)|kidney(2)|large_intestine(8)|lung(10)|ovary(4)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	36						TTGGGGCAACGTCCCCTCTAG	0.652											OREG0015804	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000240303																																			ACAD11	SO:0001623	5_prime_UTR_variant	0			-	HGNC	BC019607	CCDS3074.1	3q22.1	2010-04-30	2010-04-30		ENSG00000240303	ENSG00000240303			30211	protein-coding gene	gene with protein product		614288	"""acyl-Coenzyme A dehydrogenase family, member 11"""				Standard	NM_032169		Approved	FLJ12592		Q709F0	OTTHUMG00000159780	ENST00000264990.6:c.-75C>A	3.37:g.132378670G>T		Somatic	0	20	0.00	1594	0.6643483795556975	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	10	23.08	Q08AF0|Q658N9|Q658Y2|Q6ZND2|Q8WUT6|Q9H9R3	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000264990.6	37	NULL	CCDS3074.1	3																																																																																			-	-		0.652	ACAD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACAD11	protein_coding	OTTHUMT00000357279.2	G	NM_032169	-		132378670	-1	no_errors	ENST00000489991	ensembl	human	known	74_37	rna	SNP	0.000	T
PTK2B	2185	genome.wustl.edu	37	8	27297937	27297937	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr8:27297937C>T	ENST00000397501.1	+	26	2826	c.2018C>T	c.(2017-2019)aCc>aTc	p.T673I	PTK2B_ENST00000397497.4_Missense_Mutation_p.T419I|PTK2B_ENST00000338238.4_Missense_Mutation_p.T673I|PTK2B_ENST00000544172.1_Missense_Mutation_p.T673I|PTK2B_ENST00000420218.2_Missense_Mutation_p.T673I|PTK2B_ENST00000517339.1_Missense_Mutation_p.T673I|PTK2B_ENST00000346049.5_Missense_Mutation_p.T673I	NM_173174.2	NP_775266.1	Q14289	FAK2_HUMAN	protein tyrosine kinase 2 beta	673	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of Janus kinase activity (GO:0042976)|activation of Rac GTPase activity (GO:0032863)|apoptotic process (GO:0006915)|blood vessel endothelial cell migration (GO:0043534)|bone resorption (GO:0045453)|cell surface receptor signaling pathway (GO:0007166)|cellular defense response (GO:0006968)|cellular response to retinoic acid (GO:0071300)|chemokine-mediated signaling pathway (GO:0070098)|epidermal growth factor receptor signaling pathway (GO:0007173)|focal adhesion assembly (GO:0048041)|glial cell proliferation (GO:0014009)|integrin-mediated signaling pathway (GO:0007229)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term synaptic potentiation (GO:0060291)|MAPK cascade (GO:0000165)|marginal zone B cell differentiation (GO:0002315)|negative regulation of apoptotic process (GO:0043066)|negative regulation of bone mineralization (GO:0030502)|negative regulation of cell proliferation (GO:0008285)|negative regulation of muscle cell apoptotic process (GO:0010656)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of potassium ion transport (GO:0043267)|neuron projection development (GO:0031175)|oocyte maturation (GO:0001556)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of B cell chemotaxis (GO:2000538)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein complex assembly (GO:0006461)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of cell adhesion (GO:0030155)|regulation of cell shape (GO:0008360)|regulation of establishment of cell polarity (GO:2000114)|regulation of inositol trisphosphate biosynthetic process (GO:0032960)|regulation of macrophage chemotaxis (GO:0010758)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000058)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|response to calcium ion (GO:0051592)|response to cAMP (GO:0051591)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to hormone (GO:0009725)|response to hydrogen peroxide (GO:0042542)|response to hypoxia (GO:0001666)|response to lithium ion (GO:0010226)|response to mechanical stimulus (GO:0009612)|response to osmotic stress (GO:0006970)|response to stress (GO:0006950)|signal complex assembly (GO:0007172)|signal transduction (GO:0007165)|sprouting angiogenesis (GO:0002040)|stress fiber assembly (GO:0043149)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	apical dendrite (GO:0097440)|axon (GO:0030424)|cell body (GO:0044297)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|membrane raft (GO:0045121)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)|signal transducer activity (GO:0004871)			breast(2)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(2)|lung(17)|ovary(4)|skin(12)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Ovarian(32;2.72e-05)		UCEC - Uterine corpus endometrioid carcinoma (27;0.023)|Epithelial(17;6.61e-10)|BRCA - Breast invasive adenocarcinoma(99;0.226)|Colorectal(74;0.229)	Leflunomide(DB01097)	CCCCGCTTCACCGAGCTGGTG	0.642																																																	0								ENSG00000120899						50.0	47.0	48.0					8																	27297937		2203	4300	6503	PTK2B	SO:0001583	missense	0			-	HGNC	U33284	CCDS6057.1, CCDS6058.1	8p21.1	2013-02-18	2013-02-18		ENSG00000120899	ENSG00000120899			9612	protein-coding gene	gene with protein product		601212	"""protein tyrosine kinase 2 beta"", ""PTK2B protein tyrosine kinase 2 beta"""	FAK2		7544443, 7499242	Standard	NM_173174		Approved	CAKB, PYK2, RAFTK, PTK, CADTK	uc003xfp.2	Q14289	OTTHUMG00000102082	ENST00000397501.1:c.2018C>T	8.37:g.27297937C>T	ENSP00000380638:p.Thr673Ile	Somatic	0	34	0.00		0.6643483795556975	6	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	39	9.30	D3DST0|Q13475|Q14290|Q16709|Q6PID4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Focal_adhesion_kin_target_dom,pfam_Prot_kinase_dom,pfam_FERM_central,superfamily_Kinase-like_dom,superfamily_Focal_adhesion_kin_target_dom,superfamily_FERM_central,smart_Band_41_domain,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_FERM_domain,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.T673I	ENST00000397501.1	37	c.2018	CCDS6057.1	8	.	.	.	.	.	.	.	.	.	.	C	18.28	3.589283	0.66105	.	.	ENSG00000120899	ENST00000397501;ENST00000539100;ENST00000338238;ENST00000544172;ENST00000346049;ENST00000420218;ENST00000517339;ENST00000397497	D;D;D;D;D;D;D	0.83075	-1.68;-1.68;-1.68;-1.68;-1.68;-1.68;-1.68	5.73	4.85	0.62838	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.089073	0.85682	D	0.000000	D	0.83492	0.5266	L	0.41632	1.29	0.58432	D	0.999999	P;B;B	0.47302	0.893;0.251;0.007	P;B;B	0.52386	0.697;0.205;0.023	D	0.84586	0.0664	10	0.59425	D	0.04	.	13.8652	0.63583	0.1538:0.8462:0.0:0.0	.	419;673;673	E9PBI4;Q14289-2;Q14289	.;.;FAK2_HUMAN	I	673;678;673;673;673;673;673;419	ENSP00000380638:T673I;ENSP00000342242:T673I;ENSP00000440926:T673I;ENSP00000332816:T673I;ENSP00000391995:T673I;ENSP00000427931:T673I;ENSP00000380634:T419I	ENSP00000342242:T673I	T	+	2	0	PTK2B	27353854	0.986000	0.35501	0.899000	0.35326	0.908000	0.53690	2.763000	0.47605	1.407000	0.46875	0.655000	0.94253	ACC	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.642	PTK2B-009	PUTATIVE	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PTK2B	protein_coding	OTTHUMT00000219916.1	C	NM_004103	-		27297937	+1	no_errors	ENST00000346049	ensembl	human	known	74_37	missense	SNP	0.994	T
DNM1P46	196968	genome.wustl.edu	37	15	100332256	100332256	+	RNA	SNP	C	C	T			TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr15:100332256C>T	ENST00000341853.1	-	0	1935				AC090825.1_ENST00000408584.1_RNA|RN7SL484P_ENST00000462651.2_RNA	NR_003260.1		Q6ZS02	DMP46_HUMAN	DNM1 pseudogene 46							microtubule (GO:0005874)	GTPase activity (GO:0003924)										GCCCCAGTGACTAGGGGCCAG	0.652																																																	0								ENSG00000182397						50.0	53.0	52.0					15																	100332256		876	1991	2867	DNM1P46			0			-	HGNC	AJ576275		15q26.3	2013-04-25			ENSG00000182397	ENSG00000182397			35199	pseudogene	pseudogene			"""chromosome 15 open reading frame 51"""	DNM1DN14@, C15orf51			Standard	NR_003260		Approved	DNM1DN14.2, FLJ45937, DKFZp434I1020	uc021sxl.1	Q6ZS02	OTTHUMG00000149852		15.37:g.100332256C>T		Somatic	0	67	0.00		0.6643483795556975	0	100.00	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	59	40	59.60	Q3ZCN3	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000341853.1	37	NULL		15																																																																																			-	-		0.652	DNM1P46-002	KNOWN	basic	processed_transcript	DNM1P46	pseudogene	OTTHUMT00000313543.1	C	NR_003260	-		100332256	-1	no_errors	ENST00000341853	ensembl	human	known	74_37	rna	SNP	0.039	T
PCF11	51585	genome.wustl.edu	37	11	82880377	82880377	+	Silent	SNP	C	C	T			TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr11:82880377C>T	ENST00000298281.4	+	8	3452	c.3000C>T	c.(2998-3000)gtC>gtT	p.V1000V		NM_015885.3	NP_056969.2	O94913	PCF11_HUMAN	PCF11 cleavage and polyadenylation factor subunit	1000	Gly-rich.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage factor complex (GO:0005849)|nucleoplasm (GO:0005654)				cervix(1)|endometrium(3)|kidney(4)|large_intestine(1)|lung(22)|ovary(1)|urinary_tract(1)	33						GCCCTTTAGTCCAACAAGGAG	0.502																																																	0								ENSG00000165494						88.0	87.0	87.0					11																	82880377		1917	4124	6041	PCF11	SO:0001819	synonymous_variant	0			-	HGNC	AB020631	CCDS44689.1	11q13	2013-07-02	2013-07-02		ENSG00000165494	ENSG00000165494			30097	protein-coding gene	gene with protein product		608876	"""PCF11, cleavage and polyadenylation factor II subunit, homolog (S. cerevisiae)"", ""PCF11, cleavage and polyadenylation factor subunit, homolog (S. cerevisiae)"""			11060040	Standard	NM_015885		Approved	KIAA0824	uc001ozx.4	O94913	OTTHUMG00000167031	ENST00000298281.4:c.3000C>T	11.37:g.82880377C>T		Somatic	0	62	0.00		0.6643483795556975	16	33.33	8	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	43	25.86	A6H8W7|O43671|Q6P0X8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_RNA_pol_II-bd,superfamily_ENTH_VHS,smart_CID_dom	p.V1000	ENST00000298281.4	37	c.3000	CCDS44689.1	11																																																																																			-	NULL		0.502	PCF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCF11	protein_coding	OTTHUMT00000392548.2	C	NM_015885	-		82880377	+1	no_errors	ENST00000298281	ensembl	human	known	74_37	silent	SNP	0.276	T
AP006222.2	0	genome.wustl.edu	37	1	234399	234399	+	lincRNA	SNP	G	G	A			TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr1:234399G>A	ENST00000424587.2	-	0	4514																											TCAGTCTTAAGGACAATGAAA	0.567																																																	0								ENSG00000228463																																			AP006222.2			0			-	Clone_based_vega_gene																													1.37:g.234399G>A		Somatic	0	56	0.00		0.6643483795556975	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	43	25.86		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000424587.2	37	NULL		1																																																																																			-	-		0.567	AP006222.2-001	KNOWN	basic	lincRNA	ENSG00000228463	lincRNA	OTTHUMT00000007242.2	G		-		234399	-1	no_errors	ENST00000442116	ensembl	human	known	74_37	rna	SNP	0.015	A
NAV3	89795	genome.wustl.edu	37	12	78334106	78334106	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr12:78334106C>T	ENST00000397909.2	+	2	424	c.251C>T	c.(250-252)aCt>aTt	p.T84I	NAV3_ENST00000536525.2_Missense_Mutation_p.T84I|NAV3_ENST00000228327.6_Missense_Mutation_p.T84I|NAV3_ENST00000266692.7_Missense_Mutation_p.T84I			Q8IVL0	NAV3_HUMAN	neuron navigator 3	84	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.					membrane (GO:0016020)|nuclear envelope (GO:0005635)				NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						CAGATTTACACTGACTGGGCC	0.443										HNSCC(70;0.22)																																							0								ENSG00000067798						160.0	164.0	163.0					12																	78334106		1920	4163	6083	NAV3	SO:0001583	missense	0			-	HGNC	AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.251C>T	12.37:g.78334106C>T	ENSP00000381007:p.Thr84Ile	Somatic	0	23	0.00		0.6643483795556975	8	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	20	23.08	Q8NFW7|Q9Y2E7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_CH-domain,pfam_ATPase_AAA_core,superfamily_CH-domain,superfamily_P-loop_NTPase,smart_CH-domain,smart_AAA+_ATPase,pfscan_CH-domain	p.T84I	ENST00000397909.2	37	c.251		12	.	.	.	.	.	.	.	.	.	.	C	32	5.141575	0.94560	.	.	ENSG00000067798	ENST00000549464;ENST00000536525;ENST00000397909;ENST00000228327;ENST00000266692	D;D;D;D;D	0.94966	-3.57;-3.57;-3.57;-3.57;-3.57	5.6	5.6	0.85130	Calponin homology domain (5);	0.000000	0.39274	U	0.001420	D	0.98128	0.9382	M	0.93197	3.39	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.98863	1.0763	10	0.87932	D	0	-19.4668	19.6128	0.95616	0.0:1.0:0.0:0.0	.	84;84	Q8IVL0;Q8IVL0-2	NAV3_HUMAN;.	I	84	ENSP00000446628:T84I;ENSP00000446132:T84I;ENSP00000381007:T84I;ENSP00000228327:T84I;ENSP00000266692:T84I	ENSP00000228327:T84I	T	+	2	0	NAV3	76858237	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.812000	0.86109	2.628000	0.89032	0.637000	0.83480	ACT	-	pfam_CH-domain,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain		0.443	NAV3-001	KNOWN	basic	protein_coding	NAV3	protein_coding	OTTHUMT00000406812.1	C	NM_001024383	-		78334106	+1	no_errors	ENST00000397909	ensembl	human	known	74_37	missense	SNP	1.000	T
CDH5	1003	genome.wustl.edu	37	16	66423366	66423366	+	Missense_Mutation	SNP	C	C	T	rs543649916		TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr16:66423366C>T	ENST00000341529.3	+	5	870	c.722C>T	c.(721-723)aCg>aTg	p.T241M	CDH5_ENST00000563425.2_Missense_Mutation_p.T241M	NM_001795.3	NP_001786.2	P33151	CADH5_HUMAN	cadherin 5, type 2 (vascular endothelium)	241	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|blood vessel maturation (GO:0001955)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|negative regulation of cell proliferation (GO:0008285)|regulation of establishment of cell polarity (GO:2000114)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(3)|kidney(18)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	54		Ovarian(137;0.0955)		OV - Ovarian serous cystadenocarcinoma(108;0.107)	Lenalidomide(DB00480)	GACTCGGGCACGGCCACCGTG	0.597													C|||	1	0.000199681	0.0	0.0	5008	,	,		16787	0.001		0.0	False		,,,				2504	0.0																0								ENSG00000179776						63.0	62.0	63.0					16																	66423366		2202	4300	6502	CDH5	SO:0001583	missense	0			-	HGNC	X79981	CCDS10804.1	16q22.1	2010-01-26	2008-07-25		ENSG00000179776	ENSG00000179776		"""CD molecules"", ""Cadherins / Major cadherins"""	1764	protein-coding gene	gene with protein product	"""VE-cadherin"""	601120	"""cadherin 5, type 2, VE-cadherin (vascular epithelium)"""			2059658	Standard	NM_001795		Approved	7B4, CD144	uc002eom.4	P33151	OTTHUMG00000137495	ENST00000341529.3:c.722C>T	16.37:g.66423366C>T	ENSP00000344115:p.Thr241Met	Somatic	0	38	0.00		0.6643483795556975	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	7	73.08	Q4VAI5|Q4VAI6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.T241M	ENST00000341529.3	37	c.722	CCDS10804.1	16	.	.	.	.	.	.	.	.	.	.	C	27.8	4.860284	0.91433	.	.	ENSG00000179776	ENST00000341529;ENST00000379531	T	0.57107	0.42	5.69	5.69	0.88448	Cadherin (5);Cadherin-like (1);	.	.	.	.	T	0.78413	0.4279	M	0.88979	2.995	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.82034	-0.0657	9	0.87932	D	0	.	18.8133	0.92068	0.0:1.0:0.0:0.0	.	241	P33151	CADH5_HUMAN	M	241	ENSP00000344115:T241M	ENSP00000344115:T241M	T	+	2	0	CDH5	64980867	1.000000	0.71417	0.985000	0.45067	0.818000	0.46254	5.204000	0.65180	2.692000	0.91855	0.655000	0.94253	ACG	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin		0.597	CDH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH5	protein_coding	OTTHUMT00000268767.1	C	NM_001795	-		66423366	+1	no_errors	ENST00000341529	ensembl	human	known	74_37	missense	SNP	1.000	T
NOP56	10528	genome.wustl.edu	37	20	2633399	2633404	+	Intron	DEL	GCCTGC	GCCTGC	-	rs566242628|rs6115307|rs55762518	byFrequency	TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	GCCTGC	GCCTGC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr20:2633399_2633404delGCCTGC	ENST00000329276.5	+	2	519				SNORA51_ENST00000606420.1_RNA|MIR1292_ENST00000408135.1_RNA|SNORD110_ENST00000408189.1_RNA	NM_006392.3	NP_006383.2	O00567	NOP56_HUMAN	NOP56 ribonucleoprotein						cell death (GO:0008219)|rRNA processing (GO:0006364)	box C/D snoRNP complex (GO:0031428)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|pre-snoRNP complex (GO:0070761)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|snoRNA binding (GO:0030515)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(6)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	25						ctgggcctgggcctgcgcctgcgcct	0.738														1197	0.239018	0.2806	0.2709	5008	,	,		12167	0.1885		0.2356	False		,,,				2504	0.2157																0								ENSG00000101361			1904,1772		510,884,444						-5.3	0.0		dbSNP_129	6	3540,3670		812,1916,877	no	intron	NOP56	NM_006392.3		1322,2800,1321	A1A1,A1R,RR		49.0985,48.2046,49.9908				5444,5442				NOP56	SO:0001627	intron_variant	0				HGNC	Y12065	CCDS13030.1	20p13	2012-12-10	2012-12-10	2009-01-13	ENSG00000101361	ENSG00000101361			15911	protein-coding gene	gene with protein product	"""spinocerebellar ataxia 36"""	614154	"""nucleolar protein 5A (56kD with KKE/D repeat)"", ""nucleolar protein 5A (56kDa with KKE/D repeat)"", ""NOP56 ribonucleoprotein homolog (yeast)"""	NOL5A		9372940, 21683323	Standard	NR_027700		Approved	SCA36	uc002wgh.3	O00567	OTTHUMG00000031703	ENST00000329276.5:c.4-84GCCTGC>-	20.37:g.2633405_2633410delGCCTGC		Somatic	NA	NA	NA		0.6643483795556975	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q2M3T6|Q9NQ05	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000329276.5	37	NULL	CCDS13030.1	20																																																																																			-	-		0.738	NOP56-009	KNOWN	basic|appris_principal|CCDS	protein_coding	NOP56	protein_coding	OTTHUMT00000077631.2	GCCTGC	NM_006392			2633404	+1	no_errors	ENST00000469588	ensembl	human	known	74_37	rna	DEL	0.001:0.002:0.002:0.002:0.001:0.000	-
VPS13D	55187	genome.wustl.edu	37	1	12382722	12382722	+	Missense_Mutation	SNP	G	G	A	rs139303925		TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr1:12382722G>A	ENST00000358136.3	+	34	7964	c.7834G>A	c.(7834-7836)Gtt>Att	p.V2612I	VPS13D_ENST00000356315.4_Missense_Mutation_p.V2612I	NM_015378.2	NP_056193.2			vacuolar protein sorting 13 homolog D (S. cerevisiae)											NS(1)|breast(6)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(28)|lung(44)|ovary(5)|pancreas(1)|prostate(8)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(4)	130	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		GTCAGACTCCGTTGGCACTTA	0.483																																																	0								ENSG00000048707	G	ILE/VAL,ILE/VAL	1,4405	4.2+/-10.8	0,1,2202	120.0	114.0	116.0		7834,7834	-2.0	0.0	1	dbSNP_134	116	0,8600		0,0,4300	no	missense,missense	VPS13D	NM_015378.2,NM_018156.2	29,29	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign,benign	2612/4389,2612/4364	12382722	1,13005	2203	4300	6503	VPS13D	SO:0001583	missense	0			-	HGNC	AJ608774	CCDS30588.1, CCDS30589.1	1p36.21	2008-02-05	2006-04-04		ENSG00000048707	ENSG00000048707			23595	protein-coding gene	gene with protein product		608877	"""vacuolar protein sorting 13D (yeast)"""				Standard	NM_015378		Approved	FLJ10619, KIAA0453	uc001atv.3	Q5THJ4	OTTHUMG00000013155	ENST00000358136.3:c.7834G>A	1.37:g.12382722G>A	ENSP00000350854:p.Val2612Ile	Somatic	0	41	0.00		0.6643483795556975	0	100.00	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	23	51.06		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_VPSAP_dom,pfam_UBA/Ts_N,superfamily_UBA-like,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk	p.V2612I	ENST00000358136.3	37	c.7834	CCDS30588.1	1	.	.	.	.	.	.	.	.	.	.	G	11.71	1.718325	0.30503	2.27E-4	0.0	ENSG00000048707	ENST00000356315;ENST00000358136	T;T	0.52295	0.67;0.67	5.86	-2.03	0.07365	UBA-like (1);	1.403040	0.04658	N	0.408425	T	0.23886	0.0578	N	0.08118	0	0.09310	N	1	B;B;B	0.06786	0.0;0.001;0.0	B;B;B	0.04013	0.0;0.001;0.0	T	0.08452	-1.0721	10	0.35671	T	0.21	.	2.3866	0.04367	0.2188:0.082:0.4165:0.2826	.	519;2612;2612	B1AJZ2;Q5THJ4-2;Q5THJ4	.;.;VP13D_HUMAN	I	2612	ENSP00000348666:V2612I;ENSP00000350854:V2612I	ENSP00000348666:V2612I	V	+	1	0	VPS13D	12305309	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.412000	0.07132	-0.685000	0.05177	-0.126000	0.14955	GTT	-	superfamily_UBA-like		0.483	VPS13D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13D	protein_coding	OTTHUMT00000036897.2	G	NM_015378	rs139303925		12382722	+1	no_errors	ENST00000358136	ensembl	human	known	74_37	missense	SNP	0.000	A
NUMBL	9253	genome.wustl.edu	37	19	41173893	41173898	+	In_Frame_Del	DEL	TGCTGT	TGCTGT	-	rs59088184|rs79747129|rs71173669|rs141662737	byFrequency	TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	TGCTGT	TGCTGT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr19:41173893_41173898delTGCTGT	ENST00000252891.4	-	10	1472_1477	c.1305_1310delACAGCA	c.(1303-1311)caacagcag>cag	p.435_437QQQ>Q	NUMBL_ENST00000540131.1_In_Frame_Del_p.394_396QQQ>Q|NUMBL_ENST00000598779.1_In_Frame_Del_p.394_396QQQ>Q	NM_004756.3	NP_004747.1	Q9Y6R0	NUMBL_HUMAN	numb homolog (Drosophila)-like	435	Poly-Gln.				adherens junction organization (GO:0034332)|axonogenesis (GO:0007409)|cytokine-mediated signaling pathway (GO:0019221)|lateral ventricle development (GO:0021670)|nervous system development (GO:0007399)|neuroblast division in subventricular zone (GO:0021849)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of neurogenesis (GO:0050769)|protein metabolic process (GO:0019538)	cytoplasm (GO:0005737)				NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(6)|ovary(2)	16			Lung(22;0.000393)|LUSC - Lung squamous cell carcinoma(20;0.00105)			ctgctgctgctgctgttgctgttgct	0.66														2856	0.570288	0.7821	0.428	5008	,	,		15157	0.4653		0.5149	False		,,,				2504	0.5501																0								ENSG00000105245																																			NUMBL	SO:0001651	inframe_deletion	0				HGNC	AF015401	CCDS12561.1	19q13.13-q13.2	2008-07-17	2001-11-28			ENSG00000105245			8061	protein-coding gene	gene with protein product		604018	"""numb (Drosophila) homolog-like"""			9225980, 9303539	Standard	XM_006723471		Approved	NUMB-R, CTG3a, CAG3A, TNRC23, NUMBR, NUMBLIKE	uc002oon.3	Q9Y6R0		ENST00000252891.4:c.1305_1310delACAGCA	19.37:g.41173899_41173904delTGCTGT	ENSP00000252891:p.Gln445_Gln446del	Somatic	NA	NA	NA		0.6643483795556975	52	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q7Z4J9	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Numb_domain,pfam_PTB/PI_dom,pfam_PTB,smart_PTB/PI_dom,pirsf_Numb/numb-like,pfscan_PTB/PI_dom	p.QQ439in_frame_del	ENST00000252891.4	37	c.1310_1305	CCDS12561.1	19																																																																																			-	pirsf_Numb/numb-like		0.660	NUMBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUMBL	protein_coding	OTTHUMT00000462749.2	TGCTGT	NM_004756			41173898	-1	no_errors	ENST00000252891	ensembl	human	known	74_37	in_frame_del	DEL	1.000:1.000:1.000:1.000:1.000:0.998	-
PARP8	79668	genome.wustl.edu	37	5	50130780	50130780	+	Missense_Mutation	SNP	A	A	C			TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr5:50130780A>C	ENST00000281631.5	+	25	2551	c.2393A>C	c.(2392-2394)gAc>gCc	p.D798A	PARP8_ENST00000505697.2_Missense_Mutation_p.D798A|PARP8_ENST00000514067.2_Missense_Mutation_p.D756A|PARP8_ENST00000511363.2_3'UTR|PARP8_ENST00000505554.1_Missense_Mutation_p.D777A|PARP8_ENST00000503750.2_Missense_Mutation_p.D756A	NM_001178056.1|NM_024615.3	NP_001171527.1|NP_078891.2	Q8N3A8	PARP8_HUMAN	poly (ADP-ribose) polymerase family, member 8	798	PARP catalytic. {ECO:0000255|PROSITE- ProRule:PRU00397}.					intracellular (GO:0005622)	NAD+ ADP-ribosyltransferase activity (GO:0003950)	p.D798V(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(10)|lung(23)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Lung NSC(810;0.0305)|Breast(144;0.222)				ACCTCATCTGACCTGCACAAA	0.373																																																	1	Substitution - Missense(1)	lung(1)						ENSG00000151883						119.0	113.0	115.0					5																	50130780		2203	4300	6503	PARP8	SO:0001583	missense	0			-	HGNC	AL834477	CCDS3954.1, CCDS54849.1	5q11.2	2010-02-16			ENSG00000151883	ENSG00000151883		"""Poly (ADP-ribose) polymerases"""	26124	protein-coding gene	gene with protein product						15273990	Standard	NM_001178055		Approved	FLJ21308, pART16	uc003joo.3	Q8N3A8	OTTHUMG00000096969	ENST00000281631.5:c.2393A>C	5.37:g.50130780A>C	ENSP00000281631:p.Asp798Ala	Somatic	0	35	0.00		0.6643483795556975	5	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	43	29.51	Q3KRB7|Q6DHZ1|Q9H754	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Poly(ADP-ribose)pol_cat_dom,pfscan_Poly(ADP-ribose)pol_cat_dom	p.D798A	ENST00000281631.5	37	c.2393	CCDS3954.1	5	.	.	.	.	.	.	.	.	.	.	A	18.52	3.641329	0.67244	.	.	ENSG00000151883	ENST00000505697;ENST00000503750;ENST00000281631;ENST00000514067;ENST00000505554	.	.	.	5.81	5.81	0.92471	Poly(ADP-ribose) polymerase, catalytic domain (1);	0.055321	0.64402	D	0.000001	T	0.53594	0.1806	L	0.41356	1.27	0.80722	D	1	B;B;B	0.33694	0.262;0.421;0.262	B;B;B	0.38921	0.285;0.254;0.285	T	0.50013	-0.8877	8	.	.	.	-20.2021	16.1667	0.81768	1.0:0.0:0.0:0.0	.	690;756;798	B4DQ81;Q8N3A8-2;Q8N3A8	.;.;PARP8_HUMAN	A	798;756;798;756;777	.	.	D	+	2	0	PARP8	50166537	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	9.339000	0.96797	2.210000	0.71456	0.533000	0.62120	GAC	-	pfscan_Poly(ADP-ribose)pol_cat_dom		0.373	PARP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARP8	protein_coding	OTTHUMT00000214035.3	A	NM_024615	-		50130780	+1	no_errors	ENST00000281631	ensembl	human	known	74_37	missense	SNP	1.000	C
MYH10	4628	genome.wustl.edu	37	17	8383788	8383788	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr17:8383788C>T	ENST00000269243.4	-	37	5365	c.5227G>A	c.(5227-5229)Gag>Aag	p.E1743K	MYH10_ENST00000379980.4_Missense_Mutation_p.E1759K|MYH10_ENST00000396239.1_Missense_Mutation_p.E1764K|MYH10_ENST00000360416.3_Missense_Mutation_p.E1774K|NDEL1_ENST00000299734.7_Missense_Mutation_p.S317F	NM_005964.3	NP_005955.3	P35580	MYH10_HUMAN	myosin, heavy chain 10, non-muscle	1743					actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cardiac myofibril assembly (GO:0055003)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|cerebellar Purkinje cell layer development (GO:0021680)|exocytosis (GO:0006887)|fourth ventricle development (GO:0021592)|in utero embryonic development (GO:0001701)|lateral ventricle development (GO:0021670)|mitotic cytokinesis (GO:0000281)|neuromuscular process controlling balance (GO:0050885)|neuron migration (GO:0001764)|nuclear migration (GO:0007097)|plasma membrane repair (GO:0001778)|regulation of cell shape (GO:0008360)|retina development in camera-type eye (GO:0060041)|substrate-dependent cell migration, cell extension (GO:0006930)|third ventricle development (GO:0021678)|ventricular cardiac muscle cell development (GO:0055015)	actomyosin (GO:0042641)|axon (GO:0030424)|cell cortex (GO:0005938)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|midbody (GO:0030496)|myosin complex (GO:0016459)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle (GO:0005819)|stress fiber (GO:0001725)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(5)|endometrium(9)|kidney(2)|large_intestine(16)|lung(9)|ovary(3)|prostate(3)|skin(4)|stomach(1)	52						TCCAGCTCCTCCTCCAGCTGT	0.642																																																	0								ENSG00000133026						85.0	58.0	67.0					17																	8383788		2203	4300	6503	MYH10	SO:0001583	missense	0			-	HGNC	M69181	CCDS11144.1, CCDS58515.1, CCDS73984.1	17p13	2011-09-27	2006-09-29		ENSG00000133026	ENSG00000133026		"""Myosins / Myosin superfamily : Class II"""	7568	protein-coding gene	gene with protein product		160776	"""myosin, heavy polypeptide 10, non-muscle"""			1860190	Standard	NM_001256012		Approved	NMMHCB	uc002glm.4	P35580	OTTHUMG00000108195	ENST00000269243.4:c.5227G>A	17.37:g.8383788C>T	ENSP00000269243:p.Glu1743Lys	Somatic	0	27	0.00		0.6643483795556975	2	80.00	8	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	13	48.00	B2RWP9|D3DTS1|F8VTL3|Q12989|Q149N3|Q149N4|Q16087|Q4LE45|Q6PK16|Q9BWG0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,superfamily_Prefoldin,superfamily_HR1_rho-bd,superfamily_UBA-like,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.E1764K	ENST00000269243.4	37	c.5290	CCDS11144.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	36|36	5.654295|5.654295	0.96724|0.96724	.|.	.|.	ENSG00000133026|ENSG00000166579	ENST00000269243;ENST00000360416;ENST00000396239;ENST00000379980|ENST00000299734	D;T;T;T|.	0.83755|.	-1.76;-1.15;-1.15;-1.15|.	4.81|4.81	4.81|4.81	0.61882|0.61882	Myosin tail (1);|.	.|1.850330	.|0.02146	.|N	.|0.057635	T|T	0.77935|0.77935	0.4205|0.4205	M|M	0.71581|0.71581	2.175|2.175	0.80722|0.80722	D|D	1|1	P;P;P|.	0.40000|.	0.698;0.648;0.698|.	P;P;P|.	0.50934|.	0.654;0.523;0.654|.	T|T	0.62358|0.62358	-0.6871|-0.6871	9|7	0.44086|0.27082	T|T	0.13|0.32	.|.	18.4224|18.4224	0.90595|0.90595	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1752;1774;1743|.	B2RWP9;F8VTL3;P35580|.	.;.;MYH10_HUMAN|.	K|F	1743;1774;1764;1759|317	ENSP00000269243:E1743K;ENSP00000353590:E1774K;ENSP00000379539:E1764K;ENSP00000369315:E1759K|.	ENSP00000269243:E1743K|ENSP00000299734:S317F	E|S	-|+	1|2	0|0	MYH10|NDEL1	8324513|8324513	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.988000|0.988000	0.76386|0.76386	7.609000|7.609000	0.82925|0.82925	2.659000|2.659000	0.90383|0.90383	0.655000|0.655000	0.94253|0.94253	GAG|TCC	-	pfam_Myosin_tail		0.642	MYH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH10	protein_coding	OTTHUMT00000227001.2	C		-		8383788	-1	no_errors	ENST00000396239	ensembl	human	known	74_37	missense	SNP	1.000	T
TOP2B	7155	genome.wustl.edu	37	3	25685245	25685245	+	Missense_Mutation	SNP	T	T	C			TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr3:25685245T>C	ENST00000264331.4	-	3	270	c.271A>G	c.(271-273)Atg>Gtg	p.M91V	TOP2B_ENST00000435706.2_Missense_Mutation_p.M86V	NM_001068.2	NP_001059.2	Q02880	TOP2B_HUMAN	topoisomerase (DNA) II beta 180kDa	91					ATP catabolic process (GO:0006200)|axonogenesis (GO:0007409)|DNA topological change (GO:0006265)|DNA unwinding involved in DNA replication (GO:0006268)|forebrain development (GO:0030900)|mitotic DNA integrity checkpoint (GO:0044774)|mitotic recombination (GO:0006312)|neuron migration (GO:0001764)|resolution of meiotic recombination intermediates (GO:0000712)|sister chromatid segregation (GO:0000819)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|DNA topoisomerase complex (ATP-hydrolyzing) (GO:0009330)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding, bending (GO:0008301)|DNA topoisomerase type II (ATP-hydrolyzing) activity (GO:0003918)|enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|protein kinase C binding (GO:0005080)			breast(2)|endometrium(5)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|skin(2)|stomach(1)	36					Dactinomycin(DB00970)|Daunorubicin(DB00694)|Dexrazoxane(DB00380)|Etoposide(DB00773)	CTGCAATTCATTCCTACATCT	0.303																																																	0								ENSG00000077097						197.0	189.0	192.0					3																	25685245		1832	4085	5917	TOP2B	SO:0001583	missense	0			-	HGNC	X68060	CCDS46776.1	3p24.2	2012-08-30	2002-08-29		ENSG00000077097	ENSG00000077097	5.99.1.3		11990	protein-coding gene	gene with protein product		126431	"""topoisomerase (DNA) II beta (180kD)"""			1309226, 1333583	Standard	NM_001068		Approved		uc003cdj.3	Q02880	OTTHUMG00000155596	ENST00000264331.4:c.271A>G	3.37:g.25685245T>C	ENSP00000264331:p.Met91Val	Somatic	0	73	0.00		0.6643483795556975	11	38.89	7	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	36	34.55	Q13600|Q9UMG8|Q9UQP8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Topo_IIA_A/C,pfam_Topo_IIA_bsu_dom2,pfam_DTHCT,pfam_HATPase_ATP-bd,superfamily_Topo_IIA_like_dom,superfamily_HATPase_ATP-bd,superfamily_Ribosomal_S5_D2-typ_fold,smart_Topo_IIA,smart_Topo_IIA_A/C,prints_TopoII_euk,prints_Topo_IIA,prints_Transcrpt_fac_NFYB/HAP3	p.M91V	ENST00000264331.4	37	c.271		3	.	.	.	.	.	.	.	.	.	.	T	16.22	3.063001	0.55432	.	.	ENSG00000077097	ENST00000435706;ENST00000264331;ENST00000424225	T;T	0.48836	0.8;0.8	5.08	5.08	0.68730	.	0.072072	0.85682	D	0.000000	T	0.52058	0.1711	M	0.76838	2.35	0.80722	D	1	B	0.33694	0.421	B	0.33960	0.173	T	0.59658	-0.7413	10	0.72032	D	0.01	-16.8437	15.125	0.72475	0.0:0.0:0.0:1.0	.	86	Q02880-2	.	V	86;91;86	ENSP00000396704:M86V;ENSP00000264331:M91V	ENSP00000264331:M91V	M	-	1	0	TOP2B	25660249	1.000000	0.71417	0.999000	0.59377	0.985000	0.73830	4.229000	0.58625	2.038000	0.60285	0.533000	0.62120	ATG	-	superfamily_HATPase_ATP-bd		0.303	TOP2B-201	KNOWN	basic|appris_candidate_longest	protein_coding	TOP2B	protein_coding		T		-		25685245	-1	no_errors	ENST00000264331	ensembl	human	known	74_37	missense	SNP	1.000	C
RP11-383M4.6	0	genome.wustl.edu	37	9	84563040	84563040	+	lincRNA	SNP	C	C	A			TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr9:84563040C>A	ENST00000585776.1	-	0	942				SPATA31D3_ENST00000334208.4_RNA																							AGCTTTATTTCTCAGGGAGAT	0.443																																																	0								ENSG00000186788																																			SPATA31D3			0			-	HGNC																													9.37:g.84563040C>A		Somatic	0	48	0.00		0.6643483795556975	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	43	24.56		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000585776.1	37	NULL		9																																																																																			-	-		0.443	RP11-383M4.6-001	KNOWN	basic	lincRNA	SPATA31D3	lincRNA	OTTHUMT00000453562.1	C		-		84563040	+1	no_errors	ENST00000334208	ensembl	human	known	74_37	rna	SNP	0.030	A
ASIC2	40	genome.wustl.edu	37	17	31439098	31439099	+	Intron	DEL	AG	AG	-	rs140895516		TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	AG	AG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr17:31439098_31439099delAG	ENST00000359872.6	-	2	1317				RP11-40A13.1_ENST00000584688.1_RNA|ASIC2_ENST00000448983.1_Intron|ASIC2_ENST00000225823.2_Intron	NM_001094.4	NP_001085.2	Q16515	ASIC2_HUMAN	acid-sensing (proton-gated) ion channel 2						central nervous system development (GO:0007417)|detection of mechanical stimulus involved in sensory perception (GO:0050974)|ion transmembrane transport (GO:0034220)|monovalent inorganic cation transport (GO:0015672)|negative regulation of apoptotic process (GO:0043066)|peripheral nervous system development (GO:0007422)|phototransduction (GO:0007602)|positive regulation of synapse assembly (GO:0051965)|protein localization to synapse (GO:0035418)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)|regulation of membrane potential (GO:0042391)|regulation of systemic arterial blood pressure by aortic arch baroreceptor feedback (GO:0003026)|regulation of vasoconstriction (GO:0019229)|response to acid chemical (GO:0001101)|response to acidic pH (GO:0010447)|sensory perception of sound (GO:0007605)|sensory perception of sour taste (GO:0050915)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ion gated channel activity (GO:0022839)|ligand-gated sodium channel activity (GO:0015280)|voltage-gated sodium channel activity (GO:0005248)									Amiloride(DB00594)	GAAGGAGAGAAGAGAGAGAGAG	0.53																																																	0								ENSG00000266535																																			RP11-40A13.1	SO:0001627	intron_variant	0				Clone_based_vega_gene	AL834182	CCDS11276.1, CCDS42296.1	17q11.2-q12	2012-02-23	2012-02-22	2012-02-22	ENSG00000108684	ENSG00000108684		"""Ion channels / Acid-sensing (proton-gated) ion channels"""	99	protein-coding gene	gene with protein product	"""degenerin"""	601784	"""amiloride-sensitive cation channel 1, neuronal"""	ACCN, ACCN1		8921408	Standard	NM_183377		Approved	ASIC2a, BNC1, BNaC1, hBNaC1, MDEG	uc002hhu.3	Q16515	OTTHUMG00000132885	ENST00000359872.6:c.556-13CT>-	17.37:g.31439108_31439109delAG		Somatic	0	25	0.00		0.6643483795556975	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	19	9.52	E9PBX2|Q13553|Q6DJU1|Q8N3E2	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000359872.6	37	NULL	CCDS42296.1	17																																																																																			-	-		0.530	ASIC2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000266535	protein_coding	OTTHUMT00000447552.1	AG	NM_183377, NM_001094			31439099	+1	no_errors	ENST00000584688	ensembl	human	known	74_37	rna	DEL	0.563:0.970	-
ATP2B1	490	genome.wustl.edu	37	12	90028611	90028611	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr12:90028611G>A	ENST00000428670.3	-	5	1187	c.731C>T	c.(730-732)aCt>aTt	p.T244I	ATP2B1_ENST00000261173.2_Missense_Mutation_p.T244I|ATP2B1_ENST00000359142.3_Missense_Mutation_p.T244I|ATP2B1_ENST00000348959.3_Missense_Mutation_p.T244I			P20020	AT2B1_HUMAN	ATPase, Ca++ transporting, plasma membrane 1	244					blood coagulation (GO:0007596)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(13)|lung(15)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	45						TGATTCACCAGTCAATGAGCT	0.323																																																	0								ENSG00000070961						57.0	56.0	57.0					12																	90028611		2203	4299	6502	ATP2B1	SO:0001583	missense	0			-	HGNC	J04027	CCDS9035.1, CCDS41817.1	12q21.33	2010-04-20			ENSG00000070961	ENSG00000070961	3.6.3.8	"""ATPases / P-type"""	814	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 1"""	108731				1674727	Standard	NM_001682		Approved	PMCA1	uc001tbh.3	P20020		ENST00000428670.3:c.731C>T	12.37:g.90028611G>A	ENSP00000392043:p.Thr244Ile	Somatic	0	25	0.00		0.6643483795556975	31	34.04	16	WXS	Illumina HiSeq 2500	Phase_IV	tier1	33	62	34.38	Q12992|Q12993|Q13819|Q13820|Q13821|Q16504|Q93082	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_cation-transptr_C,pfam_ATP_Ca_trans_C,pfam_HAD-like_dom,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_P-typ_cyto_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Ca-transp_plasma,tigrfam_Cation_transp_P_typ_ATPase	p.T244I	ENST00000428670.3	37	c.731	CCDS9035.1	12	.	.	.	.	.	.	.	.	.	.	G	28.4	4.913527	0.92178	.	.	ENSG00000070961	ENST00000261173;ENST00000348959;ENST00000359142;ENST00000428670	D;D;D;D	0.94723	-3.5;-3.5;-3.5;-3.5	5.68	5.68	0.88126	.	0.000000	0.85682	D	0.000000	D	0.98785	0.9591	H	0.99435	4.565	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.996;1.0	D	0.99072	1.0834	9	.	.	.	-8.431	20.1615	0.98135	0.0:0.0:1.0:0.0	.	244;244	P20020-3;P20020-2	.;.	I	244	ENSP00000261173:T244I;ENSP00000343599:T244I;ENSP00000352054:T244I;ENSP00000392043:T244I	.	T	-	2	0	ATP2B1	88552742	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.813000	0.99286	2.835000	0.97688	0.650000	0.86243	ACT	-	pfam_ATPase_P-typ_transduc_dom_A,prints_Cation_transp_P_typ_ATPase,tigrfam_Cation_transp_P_typ_ATPase		0.323	ATP2B1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	ATP2B1	protein_coding	OTTHUMT00000406653.1	G	NM_001682	-		90028611	-1	no_errors	ENST00000261173	ensembl	human	known	74_37	missense	SNP	1.000	A
HLA-DQB2	3120	genome.wustl.edu	37	6	32726804	32726804	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr6:32726804G>A	ENST00000437316.2	-	3	532	c.469C>T	c.(469-471)Cgg>Tgg	p.R157W	HLA-DQB2_ENST00000411527.1_Missense_Mutation_p.R157W|HLA-DQB2_ENST00000435145.2_Missense_Mutation_p.R157W			P05538	DQB2_HUMAN	major histocompatibility complex, class II, DQ beta 2	161	Beta-2.|Ig-like C1-type.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|B cell affinity maturation (GO:0002344)|cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of alpha-beta T cell activation (GO:0046635)|positive regulation of antigen processing and presentation (GO:0002579)|positive regulation of T-helper 1 type immune response (GO:0002827)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	clathrin-coated endocytic vesicle membrane (GO:0030669)|early endosome (GO:0005769)|endocytic vesicle membrane (GO:0030666)|ER to Golgi transport vesicle membrane (GO:0012507)|external side of plasma membrane (GO:0009897)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|lysosomal membrane (GO:0005765)|MHC class II protein complex (GO:0042613)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)	MHC class II receptor activity (GO:0032395)|peptide antigen binding (GO:0042605)|toxic substance binding (GO:0015643)			endometrium(1)|kidney(1)|lung(1)|prostate(2)	5						CGAAACCACCGGACTTTGATC	0.552																																																	0								ENSG00000232629																																			HLA-DQB2	SO:0001583	missense	0			-	HGNC	M83890	CCDS56419.1	6p21.3	2013-01-11			ENSG00000232629	ENSG00000232629		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4945	protein-coding gene	gene with protein product		615161		HLA-DXB		2564844	Standard	NM_001198858		Approved		uc003oby.4	P05538	OTTHUMG00000031125	ENST00000437316.2:c.469C>T	6.37:g.32726804G>A	ENSP00000396330:p.Arg157Trp	Somatic	0	39	0.00		0.6643483795556975	75	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	41	44	48.24	A6NIA5|Q29826|Q29870|Q29871|Q29872|Q29873|Q5SR06	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MHC_II_b_N,pfam_Ig_C1-set,pfam_CD80_C2-set,superfamily_MHC_I/II-like_Ag-recog,smart_MHC_II_b_N,smart_Ig_C1-set,pfscan_Ig-like_dom	p.R157W	ENST00000437316.2	37	c.469		6	.	.	.	.	.	.	.	.	.	.	G	12.69	2.012165	0.35511	.	.	ENSG00000232629	ENST00000437316;ENST00000435145;ENST00000411527	T;T;T	0.03035	4.07;4.07;4.07	3.43	2.45	0.29901	.	1.315740	0.05325	U	0.527239	T	0.13543	0.0328	M	0.92784	3.345	0.09310	N	1	D;D	0.89917	1.0;1.0	D;D	0.79108	0.949;0.992	T	0.13072	-1.0523	10	0.87932	D	0	.	7.6757	0.28484	0.0:0.0:0.6185:0.3815	.	157;157	A2ADX3;Q5SR06	.;.	W	157	ENSP00000396330:R157W;ENSP00000410512:R157W;ENSP00000390431:R157W	ENSP00000390431:R157W	R	-	1	2	HLA-DQB2	32834782	0.000000	0.05858	0.780000	0.31762	0.394000	0.30568	0.352000	0.20113	1.916000	0.55485	0.491000	0.48974	CGG	-	pfam_Ig_C1-set,pfam_CD80_C2-set,smart_Ig_C1-set,pfscan_Ig-like_dom		0.552	HLA-DQB2-003	KNOWN	basic|appris_principal	protein_coding	HLA-DQB2	protein_coding	OTTHUMT00000076216.2	G		-		32726804	-1	no_errors	ENST00000435145	ensembl	human	known	74_37	missense	SNP	0.166	A
FAM69B	138311	genome.wustl.edu	37	9	139620999	139621003	+	IGR	DEL	TGACC	TGACC	-	rs4880065		TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	TGACC	TGACC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr9:139620999_139621003delTGACC	ENST00000371692.4	+	0	1668				SNHG7_ENST00000416970.1_RNA|SNHG7_ENST00000414282.1_RNA|SNHG7_ENST00000362567.2_RNA|SNHG7_ENST00000391185.1_RNA|SNHG7_ENST00000436596.1_RNA|SNHG7_ENST00000447221.1_RNA	NM_152421.3	NP_689634.2	Q5VUD6	FA69B_HUMAN	family with sequence similarity 69, member B							endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				NS(1)|endometrium(3)|large_intestine(2)|lung(1)|prostate(1)	8	all_cancers(76;0.0882)|all_epithelial(76;0.228)	Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;1.03e-05)|Epithelial(140;0.00013)		GTACCTCACCTGACCTGACCGATCC	0.571											OREG0019621	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000233016																																			SNHG7	SO:0001628	intergenic_variant	0				HGNC		CCDS7004.1	9q34.3	2012-08-03			ENSG00000165716	ENSG00000165716			28290	protein-coding gene	gene with protein product		614543				21334309	Standard	NM_152421		Approved	MGC20262, C9orf136	uc004cik.3	Q5VUD6	OTTHUMG00000020940		9.37:g.139621004_139621008delTGACC		Somatic	NA	NA	NA	1650	0.6643483795556975	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q5VUD7|Q8N5N0|Q8WYU5	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000371692.4	37	NULL	CCDS7004.1	9																																																																																			-	-		0.571	FAM69B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNHG7	protein_coding	OTTHUMT00000055102.1	TGACC	NM_152421			139621003	-1	no_errors	ENST00000447221	ensembl	human	known	74_37	rna	DEL	0.001:0.001:0.000:0.000:0.000	-
KDM5C	8242	genome.wustl.edu	37	X	53223903	53223903	+	Missense_Mutation	SNP	C	C	G			TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chrX:53223903C>G	ENST00000375401.3	-	23	3988	c.3456G>C	c.(3454-3456)gaG>gaC	p.E1152D	KDM5C_ENST00000375383.3_Missense_Mutation_p.E1111D|KDM5C_ENST00000452825.3_Missense_Mutation_p.E1085D|KDM5C_ENST00000404049.3_Missense_Mutation_p.E1151D|KDM5C_ENST00000375379.3_Missense_Mutation_p.E1152D	NM_001282622.1|NM_004187.3	NP_001269551.1|NP_004178.2	P41229	KDM5C_HUMAN	lysine (K)-specific demethylase 5C	1152					histone H3-K4 demethylation (GO:0034720)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-K4 specific) (GO:0032453)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(30)|large_intestine(9)|lung(17)|oesophagus(1)|ovary(6)|prostate(1)|salivary_gland(1)|skin(1)|upper_aerodigestive_tract(2)	82						TCTGTTCCCCCTCCTTGAAGG	0.612			"""N, F, S"""		clear cell renal carcinoma																																			Rec	yes		X	Xp11.22-p11.21	8242	lysine (K)-specific demethylase 5C (JARID1C)		E	0								ENSG00000126012						179.0	125.0	143.0					X																	53223903		2203	4300	6503	KDM5C	SO:0001583	missense	0			-	HGNC	Z29650	CCDS14351.1, CCDS55417.1, CCDS65269.1	Xp11.22-p11.21	2014-01-31	2009-04-06	2009-04-06	ENSG00000126012	ENSG00000126012		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	11114	protein-coding gene	gene with protein product		314690	"""Jumonji, AT rich interactive domain 1C (RBP2-like)"", ""Smcy homolog, X-linked (mouse)"", ""jumonji, AT rich interactive domain 1C"", ""mental retardation, X-linked 13"""	SMCX, JARID1C, MRX13		7951230, 8162017, 19826449	Standard	NM_004187		Approved	DXS1272E, XE169	uc004drz.3	P41229	OTTHUMG00000021606	ENST00000375401.3:c.3456G>C	X.37:g.53223903C>G	ENSP00000364550:p.Glu1152Asp	Somatic	0	29	0.00		0.6643483795556975	81	51.20	85	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	14	51.72	B0QZ44|B4E3I2|F5H3T1|Q5JUX3|Q5JUX4|Q5JUX5|Q7Z5S5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Lys_sp_deMease_like_dom,pfam_JmjC_dom,pfam_ARID/BRIGHT_DNA-bd,pfam_Znf_C5HC2,pfam_Znf_PHD-finger,pfam_TF_JmjN,superfamily_ARID/BRIGHT_DNA-bd,superfamily_Znf_FYVE_PHD,smart_TF_JmjN,smart_ARID/BRIGHT_DNA-bd,smart_Znf_PHD,smart_JmjC_dom,pfscan_TF_JmjN,pfscan_JmjC_dom,pfscan_Znf_PHD-finger,pfscan_ARID/BRIGHT_DNA-bd	p.E1152D	ENST00000375401.3	37	c.3456	CCDS14351.1	X	.	.	.	.	.	.	.	.	.	.	c	13.64	2.298000	0.40694	.	.	ENSG00000126012	ENST00000452825;ENST00000375401;ENST00000404049;ENST00000375379;ENST00000375383	D;D;D;D;D	0.87103	-2.21;-1.92;-1.92;-1.92;-2.06	4.61	3.74	0.42951	.	0.000000	0.85682	D	0.000000	D	0.82407	0.5030	L	0.54323	1.7	0.36644	D	0.877025	P;P;P	0.37636	0.603;0.468;0.468	B;B;B	0.38842	0.283;0.147;0.147	T	0.80768	-0.1235	10	0.41790	T	0.15	-19.4892	6.655	0.22982	0.0:0.7749:0.0:0.2251	.	1085;1151;1152	F5H3T1;B0QZ44;P41229	.;.;KDM5C_HUMAN	D	1085;1152;1151;1152;1111	ENSP00000445176:E1085D;ENSP00000364550:E1152D;ENSP00000385394:E1151D;ENSP00000364528:E1152D;ENSP00000364532:E1111D	ENSP00000364528:E1152D	E	-	3	2	KDM5C	53240628	0.995000	0.38212	1.000000	0.80357	0.996000	0.88848	0.606000	0.24194	0.762000	0.33152	0.525000	0.51046	GAG	-	NULL		0.612	KDM5C-005	KNOWN	basic|CCDS	protein_coding	KDM5C	protein_coding	OTTHUMT00000056737.2	C	NM_004187	-		53223903	-1	no_errors	ENST00000375401	ensembl	human	known	74_37	missense	SNP	1.000	G
NPTX1	4884	genome.wustl.edu	37	17	78447139	78447139	+	Missense_Mutation	SNP	A	A	G			TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr17:78447139A>G	ENST00000306773.4	-	3	915	c.758T>C	c.(757-759)tTc>tCc	p.F253S	NPTX1_ENST00000575212.1_5'Flank	NM_002522.3	NP_002513.2	Q15818	NPTX1_HUMAN	neuronal pentraxin I	253	Pentaxin.				axonogenesis involved in innervation (GO:0060385)|cellular response to glucose stimulus (GO:0071333)|cellular response to potassium ion (GO:0035865)|central nervous system development (GO:0007417)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|mitochondrial transport (GO:0006839)|synaptic transmission (GO:0007268)|transport (GO:0006810)	cytoplasmic vesicle (GO:0031410)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			kidney(1)|large_intestine(2)|liver(1)|lung(4)|prostate(2)|upper_aerodigestive_tract(1)	11	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0232)|OV - Ovarian serous cystadenocarcinoma(97;0.0487)			GCAGACAGTGAAGGCGTACAT	0.582																																																	0								ENSG00000171246						241.0	206.0	218.0					17																	78447139		2203	4300	6503	NPTX1	SO:0001583	missense	0			-	HGNC	U61849	CCDS32762.1	17q25.3	2008-05-14				ENSG00000171246			7952	protein-coding gene	gene with protein product		602367				8884281	Standard	NM_002522		Approved		uc002jyp.1	Q15818		ENST00000306773.4:c.758T>C	17.37:g.78447139A>G	ENSP00000307549:p.Phe253Ser	Somatic	0	44	0.00		0.6643483795556975	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	42	26.32	B3KXH3|Q5FWE6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Pentaxin,superfamily_ConA-like_lec_gl_sf,smart_Pentaxin,prints_Pentaxin	p.F253S	ENST00000306773.4	37	c.758	CCDS32762.1	17	.	.	.	.	.	.	.	.	.	.	A	25.5	4.642771	0.87859	.	.	ENSG00000171246	ENST00000306773;ENST00000535681	T	0.68479	-0.33	4.17	4.17	0.49024	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.047750	0.85682	D	0.000000	T	0.75057	0.3798	H	0.94345	3.525	0.80722	D	1	P	0.35793	0.521	B	0.35182	0.197	T	0.81629	-0.0846	10	0.87932	D	0	-23.9425	13.0275	0.58823	1.0:0.0:0.0:0.0	.	253	Q15818	NPTX1_HUMAN	S	253;15	ENSP00000307549:F253S	ENSP00000307549:F253S	F	-	2	0	NPTX1	76061734	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.959000	0.93110	1.729000	0.51567	0.418000	0.28097	TTC	-	pfam_Pentaxin,superfamily_ConA-like_lec_gl_sf,smart_Pentaxin,prints_Pentaxin		0.582	NPTX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPTX1	protein_coding	OTTHUMT00000438051.1	A		-		78447139	-1	no_errors	ENST00000306773	ensembl	human	known	74_37	missense	SNP	1.000	G
PASK	23178	genome.wustl.edu	37	2	242047682	242047682	+	Silent	SNP	C	C	A			TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr2:242047682C>A	ENST00000405260.1	-	16	4265	c.3567G>T	c.(3565-3567)ctG>ctT	p.L1189L	PASK_ENST00000475666.1_5'UTR|PASK_ENST00000539818.1_Silent_p.L973L|PASK_ENST00000544142.1_Silent_p.L1003L|PASK_ENST00000234040.4_Silent_p.L1189L|PASK_ENST00000358649.4_Silent_p.L1196L	NM_001252120.1	NP_001239049.1	Q96RG2	PASK_HUMAN	PAS domain containing serine/threonine kinase	1189	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				negative regulation of glycogen biosynthetic process (GO:0045719)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of energy homeostasis (GO:2000505)|regulation of glucagon secretion (GO:0070092)|regulation of respiratory gaseous exchange (GO:0043576)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatidylinositol binding (GO:0035091)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|lung(20)|ovary(4)|prostate(4)|skin(1)|stomach(1)|urinary_tract(2)	53		all_cancers(19;4.46e-39)|all_epithelial(40;1.34e-17)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00481)|Lung NSC(271;0.017)|Ovarian(221;0.0228)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;1.34e-31)|all cancers(36;1e-28)|OV - Ovarian serous cystadenocarcinoma(60;3.53e-14)|Kidney(56;4.31e-09)|KIRC - Kidney renal clear cell carcinoma(57;4.35e-08)|BRCA - Breast invasive adenocarcinoma(100;5.64e-06)|Lung(119;0.000596)|LUSC - Lung squamous cell carcinoma(224;0.00481)|Colorectal(34;0.014)|COAD - Colon adenocarcinoma(134;0.0968)		GAGTGACTCCCAGAGACCACA	0.622																																																	0								ENSG00000115687						109.0	94.0	99.0					2																	242047682		2203	4300	6503	PASK	SO:0001819	synonymous_variant	0			-	HGNC	U79240	CCDS2545.1, CCDS58758.1, CCDS58759.1	2q37.3	2008-05-23			ENSG00000115687	ENSG00000115687			17270	protein-coding gene	gene with protein product		607505				11688972, 11459942, 15148392	Standard	NM_001252119		Approved	PASKIN, KIAA0135, STK37	uc010fzl.2	Q96RG2	OTTHUMG00000133392	ENST00000405260.1:c.3567G>T	2.37:g.242047682C>A		Somatic	0	29	0.00		0.6643483795556975	9	35.71	5	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	24	35.14	G5E9F1|Q05BE4|Q68DY3|Q6GSJ5|Q86XH6|Q99763|Q9UFR7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_PAS_fold,superfamily_Kinase-like_dom,superfamily_PAS,smart_PAS,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_PAS,pfscan_Prot_kinase_dom,tigrfam_PAS	p.L1196	ENST00000405260.1	37	c.3588	CCDS2545.1	2																																																																																			-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.622	PASK-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	PASK	protein_coding	OTTHUMT00000323753.1	C	NM_015148	-		242047682	-1	no_errors	ENST00000358649	ensembl	human	known	74_37	silent	SNP	1.000	A
NF1	4763	genome.wustl.edu	37	17	29667612	29667632	+	In_Frame_Del	DEL	TCTTGAACAAAACCTGCATAC	TCTTGAACAAAACCTGCATAC	-	rs371581213		TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	TCTTGAACAAAACCTGCATAC	TCTTGAACAAAACCTGCATAC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr17:29667612_29667632delTCTTGAACAAAACCTGCATAC	ENST00000358273.4	+	47	7394_7414	c.7011_7031delTCTTGAACAAAACCTGCATAC	c.(7009-7032)cttcttgaacaaaacctgcatact>ctt	p.LEQNLHT2338del	NF1_ENST00000444181.2_In_Frame_Del_p.LEQNLHT131del|NF1_ENST00000356175.3_In_Frame_Del_p.LEQNLHT2317del|NF1_ENST00000417592.2_In_Frame_Del_p.LEQNLHT51del	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	2338					actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(3)|p.L2338H(2)|p.L2338fs*8(1)|p.N2341fs*5(1)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		GTACCGCACTTCTTGAACAAAACCTGCATACTTTAGATAGT	0.434			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																													yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	15	Whole gene deletion(8)|Unknown(3)|Substitution - Missense(2)|Deletion - Frameshift(2)	soft_tissue(7)|lung(3)|autonomic_ganglia(2)|central_nervous_system(2)|large_intestine(1)	GRCh37	CM994667	NF1	M		ENSG00000196712																																			NF1	SO:0001651	inframe_deletion	0	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome		HGNC		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.7011_7031delTCTTGAACAAAACCTGCATAC	17.37:g.29667612_29667632delTCTTGAACAAAACCTGCATAC	ENSP00000351015:p.Leu2338_Thr2344del	Somatic	NA	NA	NA		0.6643483795556975	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	O00662|Q14284|Q14930|Q14931|Q9UMK3	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_RasGAP,superfamily_Rho_GTPase_activation_prot,superfamily_ARM-type_fold,superfamily_CRAL-TRIO_dom,smart_RasGAP,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom,pfscan_RasGAP	p.EQNLHTL2339in_frame_del	ENST00000358273.4	37	c.7011_7031	CCDS42292.1	17																																																																																			-	superfamily_ARM-type_fold		0.434	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NF1	protein_coding	OTTHUMT00000256351.2	TCTTGAACAAAACCTGCATAC	NM_000267			29667632	+1	no_errors	ENST00000358273	ensembl	human	known	74_37	in_frame_del	DEL	0.993:1.000:1.000:0.436:1.000:1.000:0.970:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:0.998:1.000:1.000	-
NF1	4763	genome.wustl.edu	37	17	29667610	29667610	+	Frame_Shift_Del	DEL	C	C	-	rs367734104		TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr17:29667610delC	ENST00000358273.4	+	47	7392	c.7009delC	c.(7009-7011)cttfs	p.L2338fs	NF1_ENST00000444181.2_Frame_Shift_Del_p.L131fs|NF1_ENST00000356175.3_Frame_Shift_Del_p.L2317fs|NF1_ENST00000417592.2_Frame_Shift_Del_p.L51fs	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	2338					actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(3)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		AGGTACCGCACTTCTTGAACA	0.443			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																													yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	11	Whole gene deletion(8)|Unknown(3)	soft_tissue(7)|autonomic_ganglia(2)|lung(1)|central_nervous_system(1)						ENSG00000196712						116.0	103.0	108.0					17																	29667610		2203	4300	6503	NF1	SO:0001589	frameshift_variant	0	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome		HGNC		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.7009delC	17.37:g.29667610delC	ENSP00000351015:p.Leu2338fs	Somatic	0	45	0.00		0.6643483795556975	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	7	56.25	O00662|Q14284|Q14930|Q14931|Q9UMK3	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_RasGAP,superfamily_Rho_GTPase_activation_prot,superfamily_ARM-type_fold,superfamily_CRAL-TRIO_dom,smart_RasGAP,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom,pfscan_RasGAP	p.L2337fs	ENST00000358273.4	37	c.7009	CCDS42292.1	17																																																																																			-	superfamily_ARM-type_fold		0.443	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NF1	protein_coding	OTTHUMT00000256351.2	C	NM_000267			29667610	+1	no_errors	ENST00000358273	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
FAM182B	728882	genome.wustl.edu	37	20	25755685	25755685	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr20:25755685C>T	ENST00000376403.1	-	3	649	c.271G>A	c.(271-273)Gaa>Aaa	p.E91K	FAM182B_ENST00000478164.1_Intron|FAM182B_ENST00000376404.2_Intron			Q5T319	F182B_HUMAN	family with sequence similarity 182, member B	91										lung(1)	1						GCAGGACTTTCCGCTCCCCCA	0.637																																																	0								ENSG00000175170																																			FAM182B	SO:0001583	missense	0			-	HGNC			20p11.1	2010-07-14			ENSG00000175170	ENSG00000175170			34503	pseudogene	pseudogene							Standard	NR_027061		Approved			Q5T319	OTTHUMG00000032136	ENST00000376403.1:c.271G>A	20.37:g.25755685C>T	ENSP00000365585:p.Glu91Lys	Somatic	0	91	0.00		0.6643483795556975	1	50.00	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	30	77	28.04	Q4G0Q1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.E91K	ENST00000376403.1	37	c.271		20	.	.	.	.	.	.	.	.	.	.	.	2.919	-0.223558	0.06061	.	.	ENSG00000175170	ENST00000376403	.	.	.	.	.	.	.	.	.	.	.	T	0.36771	0.0979	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.34354	-0.9832	3	0.52906	T	0.07	.	.	.	.	.	.	.	.	K	91	.	ENSP00000365585:E91K	E	-	1	0	FAM182B	25703685	0.002000	0.14202	0.138000	0.22173	0.138000	0.21146	-0.229000	0.09098	0.064000	0.16427	0.064000	0.15345	GAA	-	NULL		0.637	FAM182B-003	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	FAM182B	protein_coding	OTTHUMT00000078463.2	C	NR_026714	-		25755685	-1	no_errors	ENST00000376403	ensembl	human	putative	74_37	missense	SNP	0.139	T
PCDH17	27253	genome.wustl.edu	37	13	58206991	58206991	+	Missense_Mutation	SNP	T	T	C			TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr13:58206991T>C	ENST00000377918.3	+	1	337	c.311T>C	c.(310-312)cTg>cCg	p.L104P		NM_001040429.2	NP_001035519.1	O14917	PCD17_HUMAN	protocadherin 17	104	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(30)|liver(2)|lung(54)|ovary(4)|pancreas(2)|prostate(5)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	120		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;1.06e-05)		AAGTGCCAGCTGTCCCTCGAG	0.612																																					Melanoma(72;952 1291 1619 12849 33676)												0								ENSG00000118946						80.0	64.0	70.0					13																	58206991		2203	4300	6503	PCDH17	SO:0001583	missense	0			-	HGNC	AF029343	CCDS31986.1	13q21.1	2010-01-26			ENSG00000118946	ENSG00000118946		"""Cadherins / Protocadherins : Non-clustered"""	14267	protein-coding gene	gene with protein product		611760				10835267	Standard	NM_001040429		Approved	PCDH68, PCH68	uc001vhq.1	O14917	OTTHUMG00000016992	ENST00000377918.3:c.311T>C	13.37:g.58206991T>C	ENSP00000367151:p.Leu104Pro	Somatic	0	22	0.00		0.6643483795556975	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	5	66.67	A8K1R5|Q5VVW9|Q5VVX0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.L104P	ENST00000377918.3	37	c.311	CCDS31986.1	13	.	.	.	.	.	.	.	.	.	.	T	19.00	3.741635	0.69304	.	.	ENSG00000118946	ENST00000377918	T	0.46819	0.86	5.54	5.54	0.83059	Cadherin, N-terminal (1);Cadherin (3);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.68449	0.3002	.	.	.	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.77557	0.983;0.99	T	0.69807	-0.5045	8	.	.	.	.	15.8453	0.78883	0.0:0.0:0.0:1.0	.	104;104	O14917-2;O14917	.;PCD17_HUMAN	P	104	ENSP00000367151:L104P	.	L	+	2	0	PCDH17	57104992	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.093000	0.71422	2.330000	0.79161	0.528000	0.53228	CTG	-	pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.612	PCDH17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDH17	protein_coding	OTTHUMT00000045139.1	T	NM_001040429	-		58206991	+1	no_errors	ENST00000377918	ensembl	human	known	74_37	missense	SNP	1.000	C
GAS6	2621	genome.wustl.edu	37	13	114549526	114549526	+	Frame_Shift_Del	DEL	T	T	-			TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr13:114549526delT	ENST00000327773.6	-	4	463	c.317delA	c.(316-318)aacfs	p.N106fs	GAS6_ENST00000355761.4_Frame_Shift_Del_p.N52fs|GAS6_ENST00000357389.3_Frame_Shift_Del_p.N106fs|GAS6_ENST00000476291.1_5'Flank	NM_000820.2	NP_000811.1	Q14393	GAS6_HUMAN	growth arrest-specific 6	106					activation of protein kinase B activity (GO:0032148)|apoptotic cell clearance (GO:0043277)|B cell chemotaxis (GO:0035754)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell-substrate adhesion (GO:0031589)|cellular protein metabolic process (GO:0044267)|cellular response to drug (GO:0035690)|cellular response to glucose stimulus (GO:0071333)|cellular response to growth factor stimulus (GO:0071363)|cellular response to interferon-alpha (GO:0035457)|cellular response to starvation (GO:0009267)|cellular response to vitamin K (GO:0071307)|dendritic cell differentiation (GO:0097028)|enzyme linked receptor protein signaling pathway (GO:0007167)|extracellular matrix assembly (GO:0085029)|fusion of virus membrane with host plasma membrane (GO:0019064)|hematopoietic stem cell migration to bone marrow (GO:0097241)|leukocyte migration (GO:0050900)|macrophage cytokine production (GO:0010934)|negative regulation of apoptotic process (GO:0043066)|negative regulation of biomineral tissue development (GO:0070168)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of dendritic cell apoptotic process (GO:2000669)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-1 secretion (GO:0050711)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of interleukin-6 secretion (GO:1900165)|negative regulation of oligodendrocyte apoptotic process (GO:1900142)|negative regulation of protein import into nucleus, translocation (GO:0033159)|negative regulation of renal albumin absorption (GO:2000533)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|neuron migration (GO:0001764)|organ regeneration (GO:0031100)|peptidyl-glutamic acid carboxylation (GO:0017187)|peptidyl-serine phosphorylation (GO:0018105)|phagocytosis (GO:0006909)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of cytokine-mediated signaling pathway (GO:0001961)|positive regulation of dendritic cell chemotaxis (GO:2000510)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of gene expression (GO:0010628)|positive regulation of glomerular filtration (GO:0003104)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of phagocytosis (GO:0050766)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of TOR signaling (GO:0032008)|post-translational protein modification (GO:0043687)|protein kinase B signaling (GO:0043491)|protein phosphorylation (GO:0006468)|protein targeting to plasma membrane (GO:0072661)|proteolysis (GO:0006508)|receptor-mediated virion attachment to host cell (GO:0046813)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)|viral entry into host cell (GO:0046718)|viral genome replication (GO:0019079)	cytoplasm (GO:0005737)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|platelet alpha granule lumen (GO:0031093)	binding, bridging (GO:0060090)|calcium ion binding (GO:0005509)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|phosphatidylserine binding (GO:0001786)|protein tyrosine kinase activator activity (GO:0030296)|receptor agonist activity (GO:0048018)|receptor binding (GO:0005102)|receptor tyrosine kinase binding (GO:0030971)|voltage-gated calcium channel activity (GO:0005245)			central_nervous_system(4)|ovary(1)	5	Lung NSC(43;0.00976)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0176)|all_epithelial(44;0.0104)|all_lung(25;0.0249)|Lung NSC(25;0.0908)|Breast(118;0.188)				GAAGCCTGAGTTTTTGGTGTA	0.542																																																	0								ENSG00000183087						168.0	147.0	154.0					13																	114549526		2203	4300	6503	GAS6	SO:0001589	frameshift_variant	0				HGNC		CCDS45072.1	13q34	2008-07-18			ENSG00000183087	ENSG00000183087			4168	protein-coding gene	gene with protein product	"""AXL stimulatory factor"""	600441		AXLLG		8336730	Standard	NM_000820		Approved	AXSF, FLJ34709, DKFZp666G247	uc001vud.3	Q14393	OTTHUMG00000017395	ENST00000327773.6:c.317delA	13.37:g.114549526delT	ENSP00000331831:p.Asn106fs	Somatic	0	28	0.00		0.6643483795556975	59	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	23	14.81	B3KRQ7|B3KVL4|E9PBL7|Q6IMN1|Q7Z7N3	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Laminin_G,pfam_EGF-like_Ca-bd_dom,pfam_GLA_domain,superfamily_ConA-like_lec_gl_sf,superfamily_GLA_domain,smart_GLA_domain,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_Laminin_G,pfscan_EG-like_dom,pfscan_GLA_domain,pfscan_Laminin_G,prints_GLA_domain	p.N106fs	ENST00000327773.6	37	c.317	CCDS45072.1	13																																																																																			-	superfamily_GLA_domain		0.542	GAS6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GAS6	protein_coding	OTTHUMT00000045946.2	T	NM_000820			114549526	-1	no_errors	ENST00000357389	ensembl	human	known	74_37	frame_shift_del	DEL	0.003	-
ATP8A1	10396	genome.wustl.edu	37	4	42554560	42554560	+	Missense_Mutation	SNP	C	C	T	rs373156864		TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr4:42554560C>T	ENST00000381668.5	-	17	1712	c.1481G>A	c.(1480-1482)cGa>cAa	p.R494Q	ATP8A1_ENST00000264449.10_Missense_Mutation_p.R479Q	NM_006095.2	NP_006086.1	Q9Y2Q0	AT8A1_HUMAN	ATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1	494					cation transmembrane transport (GO:0098655)|ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	51					Phosphatidylserine(DB00144)	GTCACCTTCTCGCTCTGGCAC	0.363																																																	0								ENSG00000124406						135.0	126.0	129.0					4																	42554560		2203	4300	6503	ATP8A1	SO:0001583	missense	0			-	HGNC	AF067820	CCDS3466.1, CCDS47049.1	4p13	2010-04-20	2007-09-19		ENSG00000124406	ENSG00000124406		"""ATPases / P-type"""	13531	protein-coding gene	gene with protein product		609542	"""ATPase, aminophospholipid transporter (APLT), Class I, type 8A, member 1"""			10198212, 9548971	Standard	NM_006095		Approved	ATPIA	uc003gwr.2	Q9Y2Q0	OTTHUMG00000099403	ENST00000381668.5:c.1481G>A	4.37:g.42554560C>T	ENSP00000371084:p.Arg494Gln	Somatic	0	30	0.00		0.6643483795556975	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	46	13.21	Q32M35|Q32M36|Q4W5J7|Q4W5P2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ATPase_P-typ_transduc_dom_A,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	p.R494Q	ENST00000381668.5	37	c.1481	CCDS3466.1	4	.	.	.	.	.	.	.	.	.	.	C	23.0	4.363898	0.82353	.	.	ENSG00000124406	ENST00000381668;ENST00000264449	T;T	0.66815	-0.23;-0.23	5.75	5.75	0.90469	ATPase, cation-transporting, domain N (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.065654	0.64402	D	0.000008	T	0.76212	0.3956	L	0.41356	1.27	0.80722	D	1	D;B;P	0.69078	0.997;0.346;0.502	D;B;B	0.70227	0.968;0.15;0.223	T	0.72354	-0.4319	10	0.33940	T	0.23	.	19.94	0.97155	0.0:1.0:0.0:0.0	.	479;479;494	B4DII6;Q32M35;Q9Y2Q0	.;.;AT8A1_HUMAN	Q	494;479	ENSP00000371084:R494Q;ENSP00000264449:R479Q	ENSP00000264449:R479Q	R	-	2	0	ATP8A1	42249317	1.000000	0.71417	1.000000	0.80357	0.925000	0.55904	3.325000	0.52030	2.721000	0.93114	0.650000	0.86243	CGA	-	superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,tigrfam_ATPase_P-typ_Plipid-transp		0.363	ATP8A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATP8A1	protein_coding	OTTHUMT00000216861.2	C	NM_006095	-		42554560	-1	no_errors	ENST00000381668	ensembl	human	known	74_37	missense	SNP	1.000	T
ADAM28	10863	genome.wustl.edu	37	8	24157585	24157585	+	Missense_Mutation	SNP	C	C	A			TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr8:24157585C>A	ENST00000265769.4	+	2	255	c.145C>A	c.(145-147)Caa>Aaa	p.Q49K	RP11-624C23.1_ENST00000518988.1_RNA|RP11-624C23.1_ENST00000519689.1_RNA|RP11-624C23.1_ENST00000523578.1_RNA|ADAM28_ENST00000540823.1_5'UTR|RP11-624C23.1_ENST00000523700.1_RNA|ADAM28_ENST00000397649.3_5'UTR|ADAM28_ENST00000437154.2_Missense_Mutation_p.Q49K	NM_014265.4	NP_055080.2	Q9UKQ2	ADA28_HUMAN	ADAM metallopeptidase domain 28	49					spermatogenesis (GO:0007283)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|lung(7)|prostate(1)|skin(12)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	42		Prostate(55;0.0959)		Colorectal(74;0.0129)|COAD - Colon adenocarcinoma(73;0.0434)|BRCA - Breast invasive adenocarcinoma(99;0.175)		AGAGCCAGAGCAACAGGTACA	0.353																																					NSCLC(193;488 2149 22258 34798 40734)												0								ENSG00000042980						85.0	89.0	88.0					8																	24157585		2203	4300	6503	ADAM28	SO:0001583	missense	0			-	HGNC	AJ242015	CCDS34865.1, CCDS47830.1	8p21.2	2005-11-29	2005-08-18		ENSG00000042980	ENSG00000042980		"""ADAM metallopeptidase domain containing"""	206	protein-coding gene	gene with protein product		606188	"""a disintegrin and metalloproteinase domain 28"""				Standard	XM_005273378		Approved	eMDCII, MDC-Lm, MDC-Ls, ADAM23	uc003xdy.3	Q9UKQ2	OTTHUMG00000163780	ENST00000265769.4:c.145C>A	8.37:g.24157585C>A	ENSP00000265769:p.Gln49Lys	Somatic	0	33	0.00		0.6643483795556975	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	23	34.29	B2RMV5|Q9Y339|Q9Y3S0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_ADAM_Cys-rich,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_EG-like_dom,pfscan_Peptidase_M12B,prints_Blood-coag_inhib_Disintegrin	p.Q49K	ENST00000265769.4	37	c.145	CCDS34865.1	8	.	.	.	.	.	.	.	.	.	.	C	0.186	-1.057623	0.01965	.	.	ENSG00000042980	ENST00000265769;ENST00000437154	T;T	0.06068	3.35;3.35	3.75	0.597	0.17504	Peptidase M12B, propeptide (1);	.	.	.	.	T	0.04318	0.0119	L	0.29908	0.895	0.21147	N	0.999778	B;B	0.10296	0.002;0.003	B;B	0.12837	0.008;0.002	T	0.46414	-0.9193	9	0.06236	T	0.91	.	9.613	0.39674	0.6805:0.3195:0.0:0.0	.	49;49	Q9UKQ2;Q9UKQ2-2	ADA28_HUMAN;.	K	49	ENSP00000265769:Q49K;ENSP00000393699:Q49K	ENSP00000265769:Q49K	Q	+	1	0	ADAM28	24213530	0.000000	0.05858	0.086000	0.20670	0.035000	0.12851	-0.340000	0.07821	0.105000	0.17753	0.313000	0.20887	CAA	-	pfam_Peptidase_M12B_N		0.353	ADAM28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM28	protein_coding	OTTHUMT00000375441.2	C	NM_021778	-		24157585	+1	no_errors	ENST00000265769	ensembl	human	known	74_37	missense	SNP	0.084	A
ZFP42	132625	genome.wustl.edu	37	4	188924482	188924482	+	Missense_Mutation	SNP	A	A	G			TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr4:188924482A>G	ENST00000326866.4	+	4	929	c.521A>G	c.(520-522)aAg>aGg	p.K174R	ZFP42_ENST00000509524.1_Missense_Mutation_p.K174R	NM_174900.3	NP_777560.2	Q96MM3	ZFP42_HUMAN	ZFP42 zinc finger protein	174					female gonad development (GO:0008585)|in utero embryonic development (GO:0001701)|male gonad development (GO:0008584)|meiotic nuclear division (GO:0007126)|regulation of genetic imprinting (GO:2000653)|spermatid development (GO:0007286)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein complex (GO:0043234)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|skin(2)|stomach(1)	27		all_cancers(14;6.2e-52)|all_epithelial(14;7.36e-37)|all_lung(41;2.29e-15)|Lung NSC(41;6.7e-15)|Breast(6;1.53e-05)|Melanoma(20;3.01e-05)|Hepatocellular(41;0.00335)|all_hematologic(60;0.014)|Renal(120;0.0183)|Prostate(90;0.0421)|Colorectal(36;0.227)		OV - Ovarian serous cystadenocarcinoma(60;1.54e-11)|BRCA - Breast invasive adenocarcinoma(30;4.21e-06)|GBM - Glioblastoma multiforme(59;8.93e-05)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.157)		TTTGCTAGAAAGAAGCCCCCC	0.468																																																	0								ENSG00000179059						97.0	110.0	106.0					4																	188924482		2203	4300	6503	ZFP42	SO:0001583	missense	0			-	HGNC	AK056719	CCDS3849.1	4q35.2	2014-09-04	2012-11-27		ENSG00000179059	ENSG00000179059		"""Zinc fingers, C2H2-type"""	30949	protein-coding gene	gene with protein product		614572	"""zinc finger protein 42 homolog (mouse)"", ""zinc finger protein 42"""			12110702	Standard	NM_174900		Approved	REX1, ZNF754	uc003izh.1	Q96MM3	OTTHUMG00000160235	ENST00000326866.4:c.521A>G	4.37:g.188924482A>G	ENSP00000317686:p.Lys174Arg	Somatic	0	14	0.00		0.6643483795556975	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	22	21.43	D3DP65|Q8WXE2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.K174R	ENST00000326866.4	37	c.521	CCDS3849.1	4	.	.	.	.	.	.	.	.	.	.	A	12.11	1.839057	0.32513	.	.	ENSG00000179059	ENST00000326866;ENST00000509524	T;T	0.63255	-0.03;-0.03	4.27	0.326	0.15908	.	0.051145	0.85682	U	0.000000	T	0.43344	0.1243	L	0.46157	1.445	0.09310	N	0.999995	P	0.44877	0.845	B	0.37943	0.261	T	0.38001	-0.9681	10	0.16420	T	0.52	.	5.3096	0.15823	0.4679:0.3591:0.0:0.173	.	174	Q96MM3	ZFP42_HUMAN	R	174	ENSP00000317686:K174R;ENSP00000424662:K174R	ENSP00000317686:K174R	K	+	2	0	ZFP42	189161476	0.000000	0.05858	0.124000	0.21820	0.126000	0.20510	-0.423000	0.07034	0.070000	0.16634	0.533000	0.62120	AAG	-	NULL		0.468	ZFP42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFP42	protein_coding	OTTHUMT00000359794.1	A	NM_174900	-		188924482	+1	no_errors	ENST00000326866	ensembl	human	known	74_37	missense	SNP	0.599	G
HOXA4	3201	genome.wustl.edu	37	7	27169165	27169165	+	Missense_Mutation	SNP	C	C	G			TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr7:27169165C>G	ENST00000360046.5	-	2	707	c.642G>C	c.(640-642)gaG>gaC	p.E214D	HOXA-AS3_ENST00000518848.1_RNA|HOXA3_ENST00000317201.2_5'Flank|HOXA3_ENST00000521401.1_Intron|RP1-170O19.22_ENST00000467897.2_RNA|HOXA-AS2_ENST00000521687.1_RNA|HOXA-AS2_ENST00000517550.1_RNA|HOXA4_ENST00000428284.2_Missense_Mutation_p.E214D|HOXA-AS2_ENST00000521159.1_RNA	NM_002141.4	NP_002132.3	Q00056	HXA4_HUMAN	homeobox A4	214					anatomical structure morphogenesis (GO:0009653)|anterior/posterior pattern specification (GO:0009952)|embryonic skeletal system morphogenesis (GO:0048704)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(6)	12						AGCGCTTAGGCTCCCCTCCGT	0.577																																																	0								ENSG00000197576						55.0	55.0	55.0					7																	27169165		2203	4300	6503	HOXA4	SO:0001583	missense	0			-	HGNC		CCDS5405.1	7p15.2	2011-06-20	2005-12-22		ENSG00000197576	ENSG00000197576		"""Homeoboxes / ANTP class : HOXL subclass"""	5105	protein-coding gene	gene with protein product		142953	"""homeo box A4"""	HOX1D, HOX1		1973146, 1358459	Standard	NM_002141		Approved		uc003sym.4	Q00056	OTTHUMG00000023213	ENST00000360046.5:c.642G>C	7.37:g.27169165C>G	ENSP00000353151:p.Glu214Asp	Somatic	0	25	0.00		0.6643483795556975	0	100.00	11	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	2	90.00	A4D180|O43366	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_Homeobox_metazoa,prints_Homeobox_antennapedia	p.E214D	ENST00000360046.5	37	c.642	CCDS5405.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.54|13.54	2.267645|2.267645	0.40095|0.40095	.|.	.|.	ENSG00000197576|ENSG00000197576	ENST00000511914|ENST00000360046;ENST00000428284	.|D;D	.|0.95622	.|-3.76;-3.76	5.29|5.29	1.99|1.99	0.26369|0.26369	.|Homeodomain-related (1);Homeobox (1);Homeodomain-like (1);	.|0.000000	.|0.41605	.|D	.|0.000846	D|D	0.92776|0.92776	0.7703|0.7703	L|L	0.60845|0.60845	1.875|1.875	0.32525|0.32525	N|N	0.53568|0.53568	.|B	.|0.21520	.|0.057	.|B	.|0.26770	.|0.073	D|D	0.91177|0.91177	0.4973|0.4973	5|10	.|0.59425	.|D	.|0.04	.|.	8.9809|8.9809	0.35964|0.35964	0.0:0.6358:0.0:0.3642|0.0:0.6358:0.0:0.3642	.|.	.|214	.|Q00056	.|HXA4_HUMAN	P|D	34|214	.|ENSP00000353151:E214D;ENSP00000408845:E214D	.|ENSP00000353151:E214D	A|E	-|-	1|3	0|2	HOXA4|HOXA4	27135690|27135690	0.988000|0.988000	0.35896|0.35896	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	0.273000|0.273000	0.18662|0.18662	0.596000|0.596000	0.29794|0.29794	0.555000|0.555000	0.69702|0.69702	GCC|GAG	-	superfamily_Homeodomain-like,pfscan_Homeobox_dom		0.577	HOXA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOXA4	protein_coding	OTTHUMT00000059534.4	C		-		27169165	-1	no_errors	ENST00000360046	ensembl	human	known	74_37	missense	SNP	1.000	G
KLK13	26085	genome.wustl.edu	37	19	51563083	51563083	+	Splice_Site	SNP	C	C	A			TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr19:51563083C>A	ENST00000595793.1	-	3	549	c.507G>T	c.(505-507)caG>caT	p.Q169H	KLK13_ENST00000335422.3_Intron|KLK13_ENST00000595547.1_Intron|KLK13_ENST00000596955.1_Missense_Mutation_p.Q169H	NM_015596.1	NP_056411.1	Q9UKR3	KLK13_HUMAN	kallikrein-related peptidase 13	169	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				protein processing (GO:0016485)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|secretory granule (GO:0030141)	hydrolase activity (GO:0016787)|serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(6)|prostate(1)|skin(1)	16		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00224)|GBM - Glioblastoma multiforme(134;0.00432)		GGTGCATACCCTGGGGGCTGG	0.602																																																	0								ENSG00000167759						36.0	36.0	36.0					19																	51563083		2203	4300	6503	KLK13	SO:0001630	splice_region_variant	0			-	HGNC		CCDS12822.1	19q13.33	2008-02-05	2006-10-27			ENSG00000167759		"""Kallikreins"""	6361	protein-coding gene	gene with protein product		605505	"""kallikrein 13"""			16800724, 16800723	Standard	NM_015596		Approved	KLK-L4	uc002pvn.3	Q9UKR3		ENST00000595793.1:c.508+1G>T	19.37:g.51563083C>A		Somatic	0	53	0.00		0.6643483795556975	0	100.00	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	52	34.18	A7UNK6|Q86VI8|Q9Y433	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_S1,pfam_Peptidase_S1A_nudel,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.Q169H	ENST00000595793.1	37	c.507	CCDS12822.1	19	.	.	.	.	.	.	.	.	.	.	C	11.82	1.753226	0.31046	.	.	ENSG00000167759	ENST00000156476	.	.	.	3.91	3.91	0.45181	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.42172	D	0.000745	T	0.43055	0.1230	N	0.20610	0.595	0.80722	D	1	B;B	0.15473	0.013;0.013	B;B	0.16289	0.015;0.015	T	0.43637	-0.9379	9	0.59425	D	0.04	.	13.7712	0.63026	0.0:1.0:0.0:0.0	.	169;169	B5BUM9;Q9UKR3	.;KLK13_HUMAN	H	169	.	ENSP00000156476:Q169H	Q	-	3	2	KLK13	56254895	0.997000	0.39634	1.000000	0.80357	0.930000	0.56654	1.205000	0.32308	2.180000	0.69256	0.655000	0.94253	CAG	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1		0.602	KLK13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLK13	protein_coding	OTTHUMT00000464298.2	C	NM_015596	-	Missense_Mutation	51563083	-1	no_errors	ENST00000595793	ensembl	human	known	74_37	missense	SNP	1.000	A
ZCCHC9	84240	genome.wustl.edu	37	5	80604773	80604773	+	Missense_Mutation	SNP	C	C	G			TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr5:80604773C>G	ENST00000254037.2	+	3	3699	c.544C>G	c.(544-546)Cct>Gct	p.P182A	ZCCHC9_ENST00000506458.1_3'UTR|ZCCHC9_ENST00000407610.3_Missense_Mutation_p.P182A|ZCCHC9_ENST00000380199.5_Missense_Mutation_p.P182A|ZCCHC9_ENST00000438268.2_Missense_Mutation_p.P182A			Q8N567	ZCHC9_HUMAN	zinc finger, CCHC domain containing 9	182					negative regulation of phosphatase activity (GO:0010923)		poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(3)|ovary(1)	13		Lung NSC(167;0.0427)|all_lung(232;0.0464)|Ovarian(174;0.135)		OV - Ovarian serous cystadenocarcinoma(54;8.18e-45)|Epithelial(54;2.72e-39)|all cancers(79;7.33e-34)		AGGCGAATTTCCTTTTGCAAA	0.333																																																	0								ENSG00000131732						104.0	96.0	98.0					5																	80604773		2203	4300	6503	ZCCHC9	SO:0001583	missense	0			-	HGNC	BC014841	CCDS4054.1	5q14.1	2013-01-09			ENSG00000131732	ENSG00000131732		"""Zinc fingers, CCHC domain containing"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	25424	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 41"""					12477932	Standard	NM_032280		Approved	DKFZp761J139, PPP1R41	uc003khi.3	Q8N567	OTTHUMG00000119014	ENST00000254037.2:c.544C>G	5.37:g.80604773C>G	ENSP00000254037:p.Pro182Ala	Somatic	0	51	0.00		0.6643483795556975	90	2.17	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	41	12.77	B2RAE7|Q9H027	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_CCHC,superfamily_Znf_CCHC,smart_Znf_CCHC,pfscan_Znf_CCHC	p.P182A	ENST00000254037.2	37	c.544	CCDS4054.1	5	.	.	.	.	.	.	.	.	.	.	C	22.8	4.336601	0.81801	.	.	ENSG00000131732	ENST00000254037;ENST00000407610;ENST00000380199;ENST00000438268	T;T;T;T	0.52057	0.68;0.68;0.68;0.68	6.02	5.15	0.70609	Zinc finger, CCHC retroviral-type (1);	0.045183	0.85682	D	0.000000	T	0.62159	0.2405	M	0.75085	2.285	0.80722	D	1	D	0.61697	0.99	P	0.56434	0.798	T	0.62210	-0.6902	10	0.45353	T	0.12	-6.3586	14.383	0.66923	0.0:0.9291:0.0:0.0709	.	182	Q8N567	ZCHC9_HUMAN	A	182	ENSP00000254037:P182A;ENSP00000385047:P182A;ENSP00000369546:P182A;ENSP00000412637:P182A	ENSP00000254037:P182A	P	+	1	0	ZCCHC9	80640529	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.639000	0.67868	2.865000	0.98341	0.655000	0.94253	CCT	-	superfamily_Znf_CCHC		0.333	ZCCHC9-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZCCHC9	protein_coding	OTTHUMT00000239213.1	C	NM_032280	-		80604773	+1	no_errors	ENST00000254037	ensembl	human	known	74_37	missense	SNP	1.000	G
SETD2	29072	genome.wustl.edu	37	3	47163488	47163488	+	Missense_Mutation	SNP	C	C	A			TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr3:47163488C>A	ENST00000409792.3	-	3	2680	c.2638G>T	c.(2638-2640)Gct>Tct	p.A880S		NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	880					angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)			breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		AGAGATGAAGCAATACCTGAA	0.403			"""N, F, S, Mis"""		clear cell renal carcinoma																																			Rec	yes		3	3p21.31	29072	SET domain containing 2		E	0								ENSG00000181555						80.0	82.0	81.0					3																	47163488		2203	4300	6503	SETD2	SO:0001583	missense	0			-	HGNC	AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.2638G>T	3.37:g.47163488C>A	ENSP00000386759:p.Ala880Ser	Somatic	0	25	0.00		0.6643483795556975	3	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	21	12.50	O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SRI,pfam_SET_dom,pfam_WW_dom,superfamily_WW_dom,superfamily_Ferritin-like_SF,smart_AWS,smart_SET_dom,smart_Post-SET_dom,smart_WW_dom,pfscan_AWS,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_WW_dom	p.A880S	ENST00000409792.3	37	c.2638	CCDS2749.2	3	.	.	.	.	.	.	.	.	.	.	C	9.571	1.121014	0.20877	.	.	ENSG00000181555	ENST00000451092;ENST00000543224;ENST00000409792;ENST00000412450	D;T	0.89270	-2.49;1.38	4.99	4.09	0.47781	.	0.248699	0.28130	N	0.016497	T	0.79690	0.4489	N	0.14661	0.345	0.20703	N	0.999864	B;B	0.10296	0.003;0.003	B;B	0.06405	0.002;0.001	T	0.68849	-0.5300	10	0.42905	T	0.14	.	12.7858	0.57504	0.1694:0.8306:0.0:0.0	.	880;880	F2Z317;Q9BYW2	.;SETD2_HUMAN	S	880;880;880;836	ENSP00000386759:A880S;ENSP00000416401:A836S	ENSP00000386759:A880S	A	-	1	0	SETD2	47138492	1.000000	0.71417	0.912000	0.35992	0.670000	0.39368	3.232000	0.51302	1.254000	0.44035	0.655000	0.94253	GCT	-	NULL		0.403	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETD2	protein_coding	OTTHUMT00000257479.2	C	NM_014159	-		47163488	-1	no_errors	ENST00000409792	ensembl	human	known	74_37	missense	SNP	0.944	A
MYO6	4646	genome.wustl.edu	37	6	76617358	76617358	+	Silent	SNP	T	T	C			TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr6:76617358T>C	ENST00000369977.3	+	31	3352	c.3213T>C	c.(3211-3213)ggT>ggC	p.G1071G	MYO6_ENST00000369975.1_Silent_p.G1048G|MYO6_ENST00000369981.3_Silent_p.G1081G|MYO6_ENST00000369985.4_Silent_p.G1048G	NM_004999.3	NP_004990.3	Q9UM54	MYO6_HUMAN	myosin VI	1080					actin filament-based movement (GO:0030048)|auditory receptor cell differentiation (GO:0042491)|cellular response to electrical stimulus (GO:0071257)|dendrite development (GO:0016358)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|endocytosis (GO:0006897)|glutamate secretion (GO:0014047)|inner ear morphogenesis (GO:0042472)|intracellular protein transport (GO:0006886)|locomotory behavior (GO:0007626)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein targeting (GO:0006605)|regulation of secretion (GO:0051046)|regulation of synaptic plasticity (GO:0048167)|response to drug (GO:0042493)|sensory perception of sound (GO:0007605)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	apical part of cell (GO:0045177)|axon (GO:0030424)|cell cortex (GO:0005938)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|microvillus (GO:0005902)|neuronal cell body (GO:0043025)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|ruffle membrane (GO:0032587)|unconventional myosin complex (GO:0016461)|vesicle membrane (GO:0012506)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|minus-end directed microfilament motor activity (GO:0060001)|motor activity (GO:0003774)			breast(2)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(16)|lung(19)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	58		all_hematologic(105;0.189)		BRCA - Breast invasive adenocarcinoma(397;0.223)		CAGCTGCTGGTACTAAGAAAT	0.343																																																	0								ENSG00000196586						110.0	105.0	107.0					6																	76617358		2203	4300	6503	MYO6	SO:0001819	synonymous_variant	0			-	HGNC	U90236, AB002387	CCDS34487.1, CCDS75481.1	6q14.1	2014-09-17	2004-05-19		ENSG00000196586	ENSG00000196586		"""Myosins / Myosin superfamily : Class VI"""	7605	protein-coding gene	gene with protein product		600970	"""deafness, autosomal recessive 37"""	DFNA22, DFNB37		9259267, 11468689	Standard	XM_005248719		Approved	KIAA0389	uc003pih.1	Q9UM54	OTTHUMG00000015061	ENST00000369977.3:c.3213T>C	6.37:g.76617358T>C		Somatic	0	50	0.00		0.6643483795556975	8	42.86	6	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	25	50.00	A6H8V4|E1P540|Q5TEM5|Q5TEM6|Q5TEM7|Q9BZZ7|Q9UEG2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom,prints_Myosin_head_motor_dom	p.G1081	ENST00000369977.3	37	c.3243	CCDS34487.1	6																																																																																			-	NULL		0.343	MYO6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO6	protein_coding	OTTHUMT00000041279.2	T	NM_004999	-		76617358	+1	no_errors	ENST00000369981	ensembl	human	known	74_37	silent	SNP	0.992	C
FAM27B	100133121	genome.wustl.edu	37	9	67793766	67793766	+	Intron	DEL	A	A	-	rs372691371		TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr9:67793766delA	ENST00000377484.3	-	1	215				RP11-12A20.7_ENST00000315762.5_RNA			Q5VT28	FAM27_HUMAN	family with sequence similarity 27, member B																		acacaccaccaggcaacccct	0.587																																																	0								ENSG00000236233																																			RP11-12A20.7	SO:0001627	intron_variant	0				Clone_based_vega_gene			9q13	2014-05-06			ENSG00000170215	ENSG00000278763			23667	other	unknown							Standard	NR_027422		Approved	bA12A20.3, FAM27A2	uc004aet.4	Q5VT28	OTTHUMG00000188586	ENST00000377484.3:c.78+130T>-	9.37:g.67793766delA		Somatic	0	8	0.00		0.6643483795556975	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	10	33.33		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000377484.3	37	NULL		9																																																																																			-	-		0.587	FAM27B-001	KNOWN	basic|appris_principal	protein_coding	ENSG00000236233	protein_coding	OTTHUMT00000037106.1	A	NR_027422			67793766	+1	no_errors	ENST00000315762	ensembl	human	known	74_37	rna	DEL	0.015	-
GOLGA2P7	388152	genome.wustl.edu	37	15	84873329	84873329	+	RNA	SNP	C	C	T			TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr15:84873329C>T	ENST00000559668.1	-	0	452				AC136698.1_ENST00000408081.1_RNA|RN7SL331P_ENST00000461138.2_RNA	NR_049748.1																						CTCCCCCCAGCGGTGCCCTAG	0.597																																																	0								ENSG00000225151																																			AC103965.1			0			-	Clone_based_vega_gene																													15.37:g.84873329C>T		Somatic	0	13	0.00		0.6643483795556975	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	16	38.46		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000559668.1	37	NULL		15																																																																																			-	-		0.597	AC103965.1-008	KNOWN	basic	processed_transcript	LOC101929847	pseudogene	OTTHUMT00000418802.1	C		-		84873329	-1	no_errors	ENST00000561015	ensembl	human	known	74_37	rna	SNP	0.219	T
MUC1	4582	genome.wustl.edu	37	1	155161899	155161899	+	Silent	SNP	G	G	A			TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr1:155161899G>A	ENST00000368395.1	-	2	305	c.234C>T	c.(232-234)gtC>gtT	p.V78V	MUC1_ENST00000457295.2_Intron|MUC1_ENST00000338684.5_Intron|MUC1_ENST00000438413.1_Intron|MUC1_ENST00000368393.3_Intron|MUC1_ENST00000337604.5_Intron|MUC1_ENST00000343256.5_Intron|MUC1_ENST00000368389.2_Intron|MUC1_ENST00000368396.4_Intron|MUC1_ENST00000368392.3_Intron|MUC1_ENST00000368390.3_Intron|RP11-201K10.3_ENST00000473363.2_5'Flank|MUC1_ENST00000462215.1_Intron|MUC1_ENST00000342482.4_Intron|MUC1_ENST00000368398.3_Intron	NM_001204285.1|NM_001204286.1	NP_001191214.1|NP_001191215.1	P15941	MUC1_HUMAN	mucin 1, cell surface associated	858					cellular protein metabolic process (GO:0044267)|cellular response to retinoic acid (GO:0071300)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|epithelial cell differentiation (GO:0030855)|female pregnancy (GO:0007565)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|negative regulation of transcription by competitive promoter binding (GO:0010944)|O-glycan processing (GO:0016266)|positive regulation of histone H4 acetylation (GO:0090240)|positive regulation of transcription from RNA polymerase II promoter in response to stress (GO:0036003)|post-translational protein modification (GO:0043687)|regulation of transcription from RNA polymerase II promoter in response to stress (GO:0043618)|response to hypoxia (GO:0001666)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|nuclear chromatin (GO:0000790)|vesicle (GO:0031982)	p53 binding (GO:0002039)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|transcription cofactor activity (GO:0003712)			breast(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|pancreas(1)|skin(2)	10	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;5.31e-10)|all cancers(21;2.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			GGGCCAGAGTGACATCCTGTC	0.627			T	IGH@	B-NHL																																			Dom	yes		1	1q21	4582	"""mucin 1, transmembrane"""		L	0								ENSG00000185499																																			MUC1	SO:0001819	synonymous_variant	0			-	HGNC	J05581	CCDS1098.1, CCDS30882.1, CCDS30883.1, CCDS41408.1, CCDS41409.1, CCDS55640.1, CCDS55641.1, CCDS55642.1, CCDS55640.2, CCDS72933.1, CCDS72934.1, CCDS72935.1, CCDS72936.1	1q22	2014-01-31	2006-03-14		ENSG00000185499	ENSG00000185499		"""CD molecules"", ""Mucins"""	7508	protein-coding gene	gene with protein product		158340	"""mucin 1, transmembrane"", ""medullary cystic kidney disease 1 (autosomal dominant)"""	PUM, MCKD1		1697589, 23396133	Standard	NM_002456		Approved	CD227, PEM, ADMCKD, ADMCKD1, MCKD, MCD	uc031ppv.1	P15941	OTTHUMG00000035681	ENST00000368395.1:c.234C>T	1.37:g.155161899G>A		Somatic	0	14	0.00		0.6643483795556975	1	50.00	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	1	96.15	A5YRV1|A6ZID9|A6ZIE0|B1AVQ8|B1AVR0|B6ECA1|E7ESE5|E7EUG9|P13931|P15942|P17626|Q0VAP5|Q0VAP6|Q14128|Q14876|Q16437|Q16442|Q16615|Q6S4Y3|Q7Z547|Q7Z548|Q7Z550|Q7Z552|Q9BXA4|Q9UE75|Q9UE76|Q9UQL1|Q9Y4J2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.V78	ENST00000368395.1	37	c.234	CCDS55640.1	1																																																																																			-	NULL		0.627	MUC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MUC1	protein_coding	OTTHUMT00000086735.1	G	NM_002456	-		155161899	-1	no_errors	ENST00000368395	ensembl	human	known	74_37	silent	SNP	0.019	A
NLRP11	204801	genome.wustl.edu	37	19	56320357	56320357	+	Missense_Mutation	SNP	G	G	C	rs374796362		TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr19:56320357G>C	ENST00000589093.1	-	3	1712	c.1619C>G	c.(1618-1620)aCg>aGg	p.T540R	NLRP11_ENST00000443188.1_Missense_Mutation_p.T540R|NLRP11_ENST00000592953.1_Missense_Mutation_p.T441R|NLRP11_ENST00000589824.2_Missense_Mutation_p.T540R|NLRP11_ENST00000360133.3_Missense_Mutation_p.T540R			P59045	NAL11_HUMAN	NLR family, pyrin domain containing 11	540							ATP binding (GO:0005524)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced ascorbate as one donor, and incorporation of one atom of oxygen (GO:0016715)|poly(A) RNA binding (GO:0044822)	p.T540M(2)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(14)|lung(22)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	66		Colorectal(82;0.0002)		GBM - Glioblastoma multiforme(193;0.0325)		CATATGGTGCGTCAACTTTTC	0.448																																																	2	Substitution - Missense(2)	large_intestine(1)|lung(1)						ENSG00000179873						163.0	151.0	155.0					19																	56320357		2203	4300	6503	NLRP11	SO:0001583	missense	0			-	HGNC	AY095145	CCDS12935.1, CCDS74458.1	19q13.43	2008-02-05	2006-12-08	2006-12-08		ENSG00000179873		"""Nucleotide-binding domain and leucine rich repeat containing"""	22945	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 11"""	609664	"""NACHT, leucine rich repeat and PYD containing 11"""	NALP11		12563287, 12019269	Standard	NM_145007		Approved	PYPAF6, NOD17, PAN10, CLR19.6	uc010ygf.2	P59045		ENST00000589093.1:c.1619C>G	19.37:g.56320357G>C	ENSP00000466285:p.Thr540Arg	Somatic	0	18	0.00		0.6643483795556975	4	33.33	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	6	40.00	C9JSF5|Q2TV85|Q2TV86|Q53ZZ0|Q8NBF5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DAPIN,superfamily_DEATH-like_dom,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.T540R	ENST00000589093.1	37	c.1619	CCDS12935.1	19	.	.	.	.	.	.	.	.	.	.	G	1.689	-0.504532	0.04261	.	.	ENSG00000179873	ENST00000443188;ENST00000360133	T;T	0.74002	-0.8;-0.74	1.99	-3.99	0.04069	.	.	.	.	.	T	0.48187	0.1486	N	0.22421	0.69	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.08055	0.001;0.003	T	0.33317	-0.9873	9	0.13470	T	0.59	.	0.2614	0.00219	0.3264:0.2693:0.1804:0.224	.	540;540	P59045;P59045-2	NAL11_HUMAN;.	R	540	ENSP00000409898:T540R;ENSP00000353251:T540R	ENSP00000353251:T540R	T	-	2	0	NLRP11	61012169	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-4.189000	0.00277	-1.949000	0.01031	-1.153000	0.01818	ACG	-	NULL		0.448	NLRP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP11	protein_coding	OTTHUMT00000453657.1	G	NM_145007	-		56320357	-1	no_errors	ENST00000443188	ensembl	human	known	74_37	missense	SNP	0.000	C
AKR7L	246181	genome.wustl.edu	37	1	19593931	19593931	+	RNA	SNP	G	G	A			TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr1:19593931G>A	ENST00000429712.1	-	0	978				AKR7L_ENST00000420396.2_RNA			Q8NHP1	ARK74_HUMAN	aldo-keto reductase family 7-like							extracellular vesicular exosome (GO:0070062)	oxidoreductase activity (GO:0016491)			breast(1)|endometrium(2)|ovary(1)|prostate(1)|urinary_tract(1)	6						GACATGCCCAGGATGACCGCG	0.647																																																	0								ENSG00000211454						38.0	41.0	40.0					1																	19593931		2202	4277	6479	AKR7L			0			-	HGNC			1p36.1-p35	2008-12-09			ENSG00000211454	ENSG00000211454			24056	protein-coding gene	gene with protein product		608478				12879023	Standard	NR_040288		Approved	AFAR3	uc021ohn.1	Q8NHP1	OTTHUMG00000002520		1.37:g.19593931G>A		Somatic	0	50	0.00		0.6643483795556975	21	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	34	44.26	Q5U614	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_NADP_OxRdtase_dom,superfamily_NADP_OxRdtase_dom	p.L109	ENST00000429712.1	37	c.325		1																																																																																			-	pfam_NADP_OxRdtase_dom,superfamily_NADP_OxRdtase_dom		0.647	AKR7L-001	KNOWN	basic	polymorphic_pseudogene	AKR7L	polymorphic_pseudogene	OTTHUMT00000007163.3	G	NM_201252	-		19593931	-1	no_errors	ENST00000420396	ensembl	human	known	74_37	silent	SNP	1.000	A
MAGI1	9223	genome.wustl.edu	37	3	65342712	65342712	+	Missense_Mutation	SNP	A	A	T			TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr3:65342712A>T	ENST00000402939.2	-	23	3729	c.3730T>A	c.(3730-3732)Tcc>Acc	p.S1244T	RP11-88H12.2_ENST00000602316.1_RNA|MAGI1_ENST00000330909.8_3'UTR	NM_001033057.1	NP_001028229.1	Q96QZ7	MAGI1_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 1	1273					cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|neuron death (GO:0070997)|protein complex assembly (GO:0006461)	cell junction (GO:0030054)|cell projection (GO:0042995)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	alpha-actinin binding (GO:0051393)|ATP binding (GO:0005524)|protein C-terminus binding (GO:0008022)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|liver(1)|lung(21)|pancreas(1)|skin(5)	51		Lung NSC(201;0.0016)		BRCA - Breast invasive adenocarcinoma(55;0.00138)|KIRC - Kidney renal clear cell carcinoma(15;0.0988)|Kidney(15;0.133)		GGGTAACTGGACTCCAATGAC	0.627																																																	0								ENSG00000151276						104.0	103.0	103.0					3																	65342712		2203	4300	6503	MAGI1	SO:0001583	missense	0			-	HGNC	AB010894	CCDS33780.1, CCDS33781.1, CCDS2904.1	3p14.1	2009-10-06	2005-05-10	2005-05-10	ENSG00000151276	ENSG00000151276			946	protein-coding gene	gene with protein product		602625	"""BAI1-associated protein 1"""	BAIAP1		9647739, 9225980	Standard	XM_005265563		Approved	BAP1, MAGI-1, TNRC19, AIP3, WWP3	uc003dmn.3	Q96QZ7	OTTHUMG00000157554	ENST00000402939.2:c.3730T>A	3.37:g.65342712A>T	ENSP00000385450:p.Ser1244Thr	Somatic	0	32	0.00		0.6643483795556975	1	83.33	5	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	0	93.75	A8K188|O00309|O43863|O75085|Q96QZ8|Q96QZ9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PDZ,pfam_WW_dom,pfam_GK/Ca_channel_bsu,superfamily_PDZ,superfamily_P-loop_NTPase,superfamily_WW_dom,smart_PDZ,smart_GK/Ca_channel_bsu,smart_WW_dom,pfscan_PDZ,pfscan_WW_dom,pfscan_Guanylate_kin-like	p.S1244T	ENST00000402939.2	37	c.3730	CCDS33780.1	3	.	.	.	.	.	.	.	.	.	.	A	12.58	1.979407	0.34942	.	.	ENSG00000151276	ENST00000402939	T	0.13657	2.57	4.6	4.6	0.57074	.	0.064498	0.64402	D	0.000006	T	0.08670	0.0215	L	0.29908	0.895	0.80722	D	1	P	0.36249	0.545	B	0.32677	0.15	T	0.30592	-0.9973	10	0.16896	T	0.51	-4.9093	9.4315	0.38612	0.9152:0.0:0.0848:0.0	.	1244	Q96QZ7-2	.	T	1244	ENSP00000385450:S1244T	ENSP00000385450:S1244T	S	-	1	0	MAGI1	65317752	1.000000	0.71417	1.000000	0.80357	0.866000	0.49608	3.886000	0.56190	1.704000	0.51252	0.402000	0.26972	TCC	-	NULL		0.627	MAGI1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAGI1	protein_coding	OTTHUMT00000349126.1	A	NM_004742	-		65342712	-1	no_errors	ENST00000402939	ensembl	human	known	74_37	missense	SNP	1.000	T
TBC1D22A	25771	genome.wustl.edu	37	22	47243850	47243855	+	Intron	DEL	GTGCGC	GTGCGC	-	rs137955823|rs146524849|rs62233855|rs62233856|rs62233857|rs111929620	byFrequency	TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	GTGCGC	GTGCGC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr22:47243850_47243855delGTGCGC	ENST00000337137.4	+	5	803				Z97351.1_ENST00000408745.1_RNA|TBC1D22A_ENST00000406733.1_Intron|TBC1D22A_ENST00000355704.3_Intron|TBC1D22A_ENST00000407381.3_Intron|TBC1D22A_ENST00000380995.1_Intron	NM_001284304.1|NM_001284305.1|NM_014346.2	NP_001271233.1|NP_001271234.1|NP_055161.1	Q8WUA7	TB22A_HUMAN	TBC1 domain family, member 22A								protein homodimerization activity (GO:0042803)|Rab GTPase activator activity (GO:0005097)			breast(1)|endometrium(3)|large_intestine(10)|lung(5)|ovary(2)|prostate(1)	22		all_cancers(38;4.44e-05)|all_epithelial(38;0.000507)|Breast(42;0.0488)|all_lung(38;0.0682)|Ovarian(80;0.0731)|all_neural(38;0.0966)|Glioma(61;0.222)|Lung SC(80;0.236)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0347)|BRCA - Breast invasive adenocarcinoma(115;0.231)		gtgtgtgtgtgtgCGCGCGCGCACGC	0.49																																																	0								ENSG00000221672																																			Z97351.1	SO:0001627	intron_variant	0				Clone_based_ensembl_gene	AK125705	CCDS14078.1, CCDS63511.1, CCDS63512.1, CCDS74877.1	22q13	2008-01-22	2005-01-05	2005-01-05	ENSG00000054611	ENSG00000054611			1309	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 4"""	C22orf4			Standard	XM_005261496		Approved		uc003bib.3	Q8WUA7	OTTHUMG00000150332	ENST00000337137.4:c.638-30694GTGCGC>-	22.37:g.47243850_47243855delGTGCGC		Somatic	NA	NA	NA		0.6643483795556975	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B0QYI2|B0QYI3|B9A6M3|Q5TE47|Q6ZUH2|Q92680|Q9BVD6|Q9UGG0|Q9UGT2|Q9UGU6|Q9UH25|Q9Y4W5	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000337137.4	37	NULL	CCDS14078.1	22																																																																																			-	-		0.490	TBC1D22A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000221672	protein_coding	OTTHUMT00000317600.3	GTGCGC	NM_014346			47243855	+1	no_errors	ENST00000408745	ensembl	human	novel	74_37	rna	DEL	0.002:0.003:0.004:0.001:0.001:0.001	-
EML2-AS1	100287177	genome.wustl.edu	37	19	46145741	46145741	+	Silent	SNP	A	A	G			TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr19:46145741A>G	ENST00000593161.1	+	3	529	c.282A>G	c.(280-282)ggA>ggG	p.G94G	EML2_ENST00000587152.1_Intron|AC006132.1_ENST00000591087.1_3'UTR|EML2_ENST00000536630.1_Intron	NM_001242348.1	NP_001229277.1																					TGGGGCTGGGACACTTGGACA	0.657																																																	0								ENSG00000267757																																			AC006132.1	SO:0001819	synonymous_variant	0			-	Clone_based_vega_gene																												ENST00000593161.1:c.282A>G	19.37:g.46145741A>G		Somatic	0	23	0.00		0.6643483795556975	24	48.94	23	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	22	50.00		Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.G94	ENST00000593161.1	37	c.282	CCDS59398.1	19																																																																																			-	NULL		0.657	AC006132.1-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	LOC100287177	protein_coding	OTTHUMT00000459639.1	A		-		46145741	+1	no_errors	ENST00000593161	ensembl	human	putative	74_37	silent	SNP	0.068	G
VPS13A	23230	genome.wustl.edu	37	9	79999548	79999550	+	Intron	DEL	TGA	TGA	-	rs142234061|rs373635958		TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	TGA	TGA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr9:79999548_79999550delTGA	ENST00000360280.3	+	68	9449				VPS13A_ENST00000376636.3_Intron|VPS13A_ENST00000357409.5_In_Frame_Del_p.D3089del	NM_033305.2	NP_150648.2	Q96RL7	VP13A_HUMAN	vacuolar protein sorting 13 homolog A (S. cerevisiae)						cell death (GO:0008219)|Golgi to endosome transport (GO:0006895)|locomotory behavior (GO:0007626)|nervous system development (GO:0007399)|protein localization (GO:0008104)|protein transport (GO:0015031)|social behavior (GO:0035176)	dense core granule (GO:0031045)|intracellular (GO:0005622)				breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(28)|liver(1)|lung(42)|ovary(3)|pancreas(3)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						GTAGCAGTAGtgatgatgatgat	0.33																																																	0								ENSG00000197969																																			VPS13A	SO:0001627	intron_variant	0				HGNC	AB023203	CCDS6655.1, CCDS6656.1, CCDS47983.1, CCDS55321.1	9q21	2014-01-30	2006-04-04	2004-02-11	ENSG00000197969	ENSG00000197969			1908	protein-coding gene	gene with protein product	"""chorein"""	605978	"""chorea acanthocytosis"", ""vacuolar protein sorting 13A (yeast)"""	CHAC		9382101, 11381253	Standard	NM_001018038		Approved	KIAA0986	uc004akr.3	Q96RL7	OTTHUMG00000020055	ENST00000360280.3:c.9189+2545TGA>-	9.37:g.79999557_79999559delTGA		Somatic	0	15	0.00		0.6643483795556975	9	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	16	11.11	Q5JSX9|Q5JSY0|Q5VYR5|Q702P4|Q709D0|Q86YF8|Q96S61|Q9H995|Q9Y2J1	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_VPSAP_dom,pfam_Autophagy-rel_C	p.D3083in_frame_del	ENST00000360280.3	37	c.9237_9239	CCDS6655.1	9																																																																																			-	NULL		0.330	VPS13A-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13A	protein_coding	OTTHUMT00000052753.2	TGA	NM_015186			79999550	+1	no_errors	ENST00000357409	ensembl	human	known	74_37	in_frame_del	DEL	0.999:0.998:0.997	-
GLYR1	84656	genome.wustl.edu	37	16	4861209	4861209	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr16:4861209C>T	ENST00000321919.9	-	15	1625	c.1549G>A	c.(1549-1551)Gtc>Atc	p.V517I	GLYR1_ENST00000381983.3_Missense_Mutation_p.V500I|GLYR1_ENST00000591451.1_Missense_Mutation_p.V511I|GLYR1_ENST00000436648.5_Missense_Mutation_p.V436I	NM_032569.3	NP_115958	Q49A26	GLYR1_HUMAN	glyoxylate reductase 1 homolog (Arabidopsis)	517					pentose-phosphate shunt (GO:0006098)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	DNA binding (GO:0003677)|methylated histone binding (GO:0035064)|NAD binding (GO:0051287)|phosphogluconate dehydrogenase (decarboxylating) activity (GO:0004616)			endometrium(1)|kidney(1)|large_intestine(7)|lung(6)|prostate(2)|skin(1)|urinary_tract(1)	19						GGATGGTTGACCGCATCACCC	0.463																																																	0								ENSG00000140632						133.0	125.0	128.0					16																	4861209		2197	4300	6497	GLYR1	SO:0001583	missense	0			-	HGNC	AF244907	CCDS10524.1	16p13.3	2010-02-17			ENSG00000140632	ENSG00000140632			24434	protein-coding gene	gene with protein product	"""nuclear protein 60kDa"""	610660				16352664	Standard	NM_032569		Approved	BM045, HIBDL, NP60, N-PAC	uc002cxx.4	Q49A26	OTTHUMG00000129530	ENST00000321919.9:c.1549G>A	16.37:g.4861209C>T	ENSP00000322716:p.Val517Ile	Somatic	0	47	0.00		0.6643483795556975	60	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.16	B4DL47|C9JJ40|C9JJ60|Q5U632|Q6P1Q2|Q6V3W7|Q9BTI1|Q9BXK2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_6PGDH_NADP-bd,pfam_PWWP_dom,superfamily_6-PGluconate_DH_C-like,smart_PWWP_dom,pfscan_PWWP_dom	p.V517I	ENST00000321919.9	37	c.1549	CCDS10524.1	16	.	.	.	.	.	.	.	.	.	.	C	13.60	2.285278	0.40394	.	.	ENSG00000140632	ENST00000321919;ENST00000381983;ENST00000436648	T;T;T	0.30714	1.52;1.52;1.52	5.72	5.72	0.89469	Dehydrogenase, multihelical (1);6-phosphogluconate dehydrogenase, C-terminal-like (1);	0.055471	0.64402	D	0.000001	T	0.35682	0.0940	M	0.64997	1.995	0.58432	D	0.999994	B;B;B;B	0.21520	0.003;0.024;0.01;0.057	B;B;B;B	0.16289	0.005;0.012;0.007;0.015	T	0.07328	-1.0778	10	0.45353	T	0.12	-22.4547	18.6366	0.91380	0.0:1.0:0.0:0.0	.	436;511;500;517	Q49A26-5;Q49A26-3;Q49A26-2;Q49A26	.;.;.;GLYR1_HUMAN	I	517;500;436	ENSP00000322716:V517I;ENSP00000371413:V500I;ENSP00000390276:V436I	ENSP00000322716:V517I	V	-	1	0	GLYR1	4801210	1.000000	0.71417	0.991000	0.47740	0.111000	0.19643	5.948000	0.70249	2.700000	0.92200	0.561000	0.74099	GTC	-	superfamily_6-PGluconate_DH_C-like		0.463	GLYR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GLYR1	protein_coding	OTTHUMT00000251717.2	C	NM_032569	-		4861209	-1	no_errors	ENST00000321919	ensembl	human	known	74_37	missense	SNP	1.000	T
STARD9	57519	genome.wustl.edu	37	15	42985060	42985060	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr15:42985060G>A	ENST00000290607.7	+	23	11341	c.11284G>A	c.(11284-11286)Gaa>Aaa	p.E3762K		NM_020759.2	NP_065810.2	Q9P2P6	STAR9_HUMAN	StAR-related lipid transfer (START) domain containing 9	3762					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spindle assembly (GO:0051225)	centriole (GO:0005814)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|kinesin complex (GO:0005871)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|lipid binding (GO:0008289)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			haematopoietic_and_lymphoid_tissue(1)|stomach(1)	2						TGTGATCCTTGAAGGGCTAGG	0.552																																																	0								ENSG00000159433						58.0	58.0	58.0					15																	42985060		692	1590	2282	STARD9	SO:0001583	missense	0			-	HGNC	AB037721	CCDS53935.1	15q15.2	2013-10-16	2007-08-16		ENSG00000159433	ENSG00000159433		"""StAR-related lipid transfer (START) domain containing"""	19162	protein-coding gene	gene with protein product		614642	"""START domain containing 9"""			10718198	Standard	NM_020759		Approved	KIAA1300	uc010udj.2	Q9P2P6	OTTHUMG00000175799	ENST00000290607.7:c.11284G>A	15.37:g.42985060G>A	ENSP00000290607:p.Glu3762Lys	Somatic	0	30	0.00		0.6643483795556975	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	38	28.30	Q68DG2|Q6AI01|Q6ZWK0|Q9UF70	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Kinesin_motor_dom,pfam_START_lipid-bd_dom,pfam_FHA_dom,superfamily_P-loop_NTPase,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,smart_FHA_dom,pfscan_START_lipid-bd_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.E3762K	ENST00000290607.7	37	c.11284	CCDS53935.1	15	.	.	.	.	.	.	.	.	.	.	G	18.62	3.662480	0.67700	.	.	ENSG00000159433	ENST00000290607	T	0.63417	-0.04	5.86	1.6	0.23607	.	.	.	.	.	T	0.47097	0.1427	L	0.39898	1.24	0.09310	N	1	B	0.14012	0.009	B	0.11329	0.006	T	0.29027	-1.0025	9	0.25751	T	0.34	.	5.3114	0.15833	0.09:0.393:0.3949:0.1221	.	3676	Q9P2P6	STAR9_HUMAN	K	3762	ENSP00000290607:E3762K	ENSP00000290607:E3762K	E	+	1	0	STARD9	40772352	0.002000	0.14202	0.889000	0.34880	0.379000	0.30106	1.356000	0.34079	0.761000	0.33130	0.563000	0.77884	GAA	-	NULL		0.552	STARD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STARD9	protein_coding	OTTHUMT00000431094.1	G		-		42985060	+1	no_errors	ENST00000290607	ensembl	human	known	74_37	missense	SNP	0.000	A
KPRP	448834	genome.wustl.edu	37	1	152733278	152733278	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr1:152733278G>A	ENST00000606109.1	+	1	1242	c.1214G>A	c.(1213-1215)cGt>cAt	p.R405H	KPRP_ENST00000368773.1_Missense_Mutation_p.R405H			Q5T749	KPRP_HUMAN	keratinocyte proline-rich protein	405	Pro-rich.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				NS(1)|breast(1)|endometrium(9)|kidney(1)|large_intestine(10)|lung(21)|ovary(6)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCTGCTCCACGTCCACGTCTG	0.567																																																	0								ENSG00000203786						158.0	157.0	157.0					1																	152733278		2203	4300	6503	KPRP	SO:0001583	missense	0			-	HGNC	AY960854	CCDS30862.1	1q21.3	2008-02-05	2007-02-02	2006-12-07	ENSG00000203786	ENSG00000203786			31823	protein-coding gene	gene with protein product		613260	"""chromosome 1 open reading frame 45"""	C1orf45		16297201	Standard	NM_001025231		Approved		uc001fal.1	Q5T749	OTTHUMG00000012402	ENST00000606109.1:c.1214G>A	1.37:g.152733278G>A	ENSP00000475216:p.Arg405His	Somatic	0	13	0.00		0.6643483795556975	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	4	87.10		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.R405H	ENST00000606109.1	37	c.1214	CCDS30862.1	1	.	.	.	.	.	.	.	.	.	.	G	17.12	3.309013	0.60414	.	.	ENSG00000203786	ENST00000368773	T	0.23348	1.91	4.88	3.96	0.45880	.	0.416647	0.20883	N	0.083964	T	0.15435	0.0372	L	0.54323	1.7	0.09310	N	1	D	0.56521	0.976	P	0.48795	0.59	T	0.06770	-1.0808	10	0.66056	D	0.02	-4.6039	6.4326	0.21805	0.0906:0.0:0.7264:0.183	.	405	Q5T749	KPRP_HUMAN	H	405	ENSP00000357762:R405H	ENSP00000357762:R405H	R	+	2	0	KPRP	150999902	0.010000	0.17322	0.010000	0.14722	0.869000	0.49853	1.824000	0.39072	1.439000	0.47511	-0.361000	0.07541	CGT	-	NULL		0.567	KPRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KPRP	protein_coding	OTTHUMT00000034522.2	G	NM_001025231	-		152733278	+1	no_errors	ENST00000368773	ensembl	human	known	74_37	missense	SNP	0.049	A
AIFM1	9131	genome.wustl.edu	37	X	129290459	129290459	+	Missense_Mutation	SNP	T	T	A			TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chrX:129290459T>A	ENST00000287295.3	-	2	455	c.225A>T	c.(223-225)ttA>ttT	p.L75F	AIFM1_ENST00000535724.1_Intron|AIFM1_ENST00000346424.2_Intron|AIFM1_ENST00000319908.3_Intron	NM_001130847.3|NM_004208.3	NP_001124319.1|NP_004199.1	O95831	AIFM1_HUMAN	apoptosis-inducing factor, mitochondrion-associated, 1	75					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|cell redox homeostasis (GO:0045454)|chromosome condensation (GO:0030261)|DNA catabolic process (GO:0006308)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|mitochondrial respiratory chain complex I assembly (GO:0032981)|neuron apoptotic process (GO:0051402)|neuron differentiation (GO:0030182)|positive regulation of apoptotic process (GO:0043065)|regulation of apoptotic DNA fragmentation (GO:1902510)	cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)|electron carrier activity (GO:0009055)|FAD binding (GO:0071949)|NAD(P)H oxidase activity (GO:0016174)|oxidoreductase activity, acting on NAD(P)H (GO:0016651)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(4)|liver(2)|lung(8)|ovary(4)|prostate(2)|urinary_tract(1)	30					Flavin adenine dinucleotide(DB03147)	CTACTGTTGATAAGCCCACAA	0.433																																																	0								ENSG00000156709						170.0	143.0	152.0					X																	129290459		2203	4300	6503	AIFM1	SO:0001583	missense	0			-	HGNC	AF100928	CCDS14618.1, CCDS14619.1, CCDS48167.1	Xq26.1	2014-01-30	2006-11-16	2006-11-16	ENSG00000156709	ENSG00000156709			8768	protein-coding gene	gene with protein product		300169	"""programmed cell death 8 (apoptosis-inducing factor)"", ""neuropathy, axonal, motor-sensory with deafness and mental retardation (Cowchock syndrome)"""	PDCD8, NAMSD		9989411, 23217327	Standard	NM_004208		Approved	AIF, CMTX4	uc004evg.3	O95831	OTTHUMG00000022392	ENST00000287295.3:c.225A>T	X.37:g.129290459T>A	ENSP00000287295:p.Leu75Phe	Somatic	0	59	0.00		0.6643483795556975	34	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	20	13.04	A4QPB4|B1ALN1|B2RB08|D3DTE9|Q1L6K4|Q1L6K6|Q2QKE4|Q5JUZ7|Q6I9X6|Q9Y3I3|Q9Y3I4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,pfam_Pyr_OxRdtase_NAD-bd_dom,superfamily_FAD/NAD-linked_Rdtase_dimer,prints_FAD_pyr_nucl-diS_OxRdtase	p.L75F	ENST00000287295.3	37	c.225	CCDS14618.1	X	.	.	.	.	.	.	.	.	.	.	T	11.48	1.650896	0.29336	.	.	ENSG00000156709	ENST00000287295	T	0.42900	0.96	5.5	0.576	0.17380	.	0.260161	0.36303	N	0.002666	T	0.31482	0.0798	L	0.50333	1.59	0.80722	D	1	B;B	0.06786	0.001;0.0	B;B	0.08055	0.003;0.0	T	0.06917	-1.0800	10	0.46703	T	0.11	-8.3579	6.259	0.20889	0.0:0.3914:0.1387:0.47	.	75;75	Q1L6K6;O95831	.;AIFM1_HUMAN	F	75	ENSP00000287295:L75F	ENSP00000287295:L75F	L	-	3	2	AIFM1	129118140	0.974000	0.33945	0.999000	0.59377	0.986000	0.74619	-0.164000	0.09983	-0.018000	0.14079	-0.488000	0.04728	TTA	-	NULL		0.433	AIFM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AIFM1	protein_coding	OTTHUMT00000058247.2	T		-		129290459	-1	no_errors	ENST00000287295	ensembl	human	known	74_37	missense	SNP	0.990	A
AHNAK	79026	genome.wustl.edu	37	11	62286369	62286369	+	Missense_Mutation	SNP	T	T	C			TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr11:62286369T>C	ENST00000378024.4	-	5	15794	c.15520A>G	c.(15520-15522)Aac>Gac	p.N5174D	AHNAK_ENST00000530124.1_Intron|AHNAK_ENST00000257247.7_Intron|AHNAK_ENST00000525875.1_5'Flank	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	5174					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				CCTTCGATGTTGATGTCAGGT	0.488																																																	0								ENSG00000124942						110.0	108.0	109.0					11																	62286369		2202	4299	6501	AHNAK	SO:0001583	missense	0			-	HGNC	M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.15520A>G	11.37:g.62286369T>C	ENSP00000367263:p.Asn5174Asp	Somatic	0	31	0.00		0.6643483795556975	354	47.48	320	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	25	37.50	A1A586	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.N5174D	ENST00000378024.4	37	c.15520	CCDS31584.1	11	.	.	.	.	.	.	.	.	.	.	T	0.523	-0.861495	0.02610	.	.	ENSG00000124942	ENST00000378024	T	0.00557	6.62	4.84	2.36	0.29203	.	0.353012	0.25660	N	0.029143	T	0.00580	0.0019	L	0.38175	1.15	0.19300	N	0.999976	P	0.35507	0.506	B	0.43783	0.431	T	0.42783	-0.9431	10	0.09590	T	0.72	-22.6947	10.0799	0.42384	0.0:0.0:0.3241:0.6759	.	5174	Q09666	AHNK_HUMAN	D	5174	ENSP00000367263:N5174D	ENSP00000367263:N5174D	N	-	1	0	AHNAK	62042945	0.000000	0.05858	0.041000	0.18516	0.035000	0.12851	0.767000	0.26575	0.242000	0.21303	0.523000	0.50628	AAC	-	NULL		0.488	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AHNAK	protein_coding	OTTHUMT00000395572.1	T	NM_024060	-		62286369	-1	no_errors	ENST00000378024	ensembl	human	known	74_37	missense	SNP	0.569	C
FAT3	120114	genome.wustl.edu	37	11	92531098	92531098	+	Missense_Mutation	SNP	C	C	A			TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr11:92531098C>A	ENST00000298047.6	+	9	4936	c.4919C>A	c.(4918-4920)tCc>tAc	p.S1640Y	FAT3_ENST00000409404.2_Missense_Mutation_p.S1640Y|FAT3_ENST00000525166.1_Missense_Mutation_p.S1490Y			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	1640	Cadherin 15. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				TTTGTCCTATCCATCAAAGTC	0.478										TCGA Ovarian(4;0.039)																																							0								ENSG00000165323						105.0	104.0	104.0					11																	92531098		1998	4162	6160	FAT3	SO:0001583	missense	0			-	HGNC	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.4919C>A	11.37:g.92531098C>A	ENSP00000298047:p.Ser1640Tyr	Somatic	0	44	0.00		0.6643483795556975	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	B5MDB0|Q96AU6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Laminin_G,pfam_EGF-like_Ca-bd_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,smart_EG-like_dom,smart_Laminin_G,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.S1640Y	ENST00000298047.6	37	c.4919		11	.	.	.	.	.	.	.	.	.	.	C	15.27	2.783119	0.49891	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166	T;T;T	0.52295	0.67;0.67;0.67	5.81	5.81	0.92471	.	.	.	.	.	T	0.59128	0.2171	L	0.31476	0.935	0.80722	D	1	D	0.76494	0.999	D	0.68483	0.958	T	0.56780	-0.7922	9	0.45353	T	0.12	.	20.0805	0.97772	0.0:1.0:0.0:0.0	.	1640	Q8TDW7-3	.	Y	1640;1640;1490	ENSP00000298047:S1640Y;ENSP00000387040:S1640Y;ENSP00000432586:S1490Y	ENSP00000298047:S1640Y	S	+	2	0	FAT3	92170746	0.995000	0.38212	0.998000	0.56505	0.020000	0.10135	3.249000	0.51437	2.755000	0.94549	0.650000	0.86243	TCC	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.478	FAT3-201	KNOWN	basic	protein_coding	FAT3	protein_coding		C	NM_001008781	-		92531098	+1	no_errors	ENST00000298047	ensembl	human	known	74_37	missense	SNP	1.000	A
RNPS1	10921	genome.wustl.edu	37	16	2320736	2320736	+	5'Flank	SNP	T	T	A			TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr16:2320736T>A	ENST00000320225.5	-	0	0				MIR3677_ENST00000578964.1_RNA|AC009065.2_ENST00000384982.1_RNA|RNPS1_ENST00000569598.2_5'Flank|MIR940_ENST00000401276.1_lincRNA|RNPS1_ENST00000566458.1_5'Flank|RNPS1_ENST00000567147.1_5'Flank|RNPS1_ENST00000301730.8_5'Flank|RNPS1_ENST00000397086.2_5'Flank|RNPS1_ENST00000561718.1_5'Flank|RNPS1_ENST00000568631.1_5'Flank	NM_080594.2	NP_542161.1	Q15287	RNPS1_HUMAN	RNA binding protein S1, serine-rich domain						gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|positive regulation of apoptotic process (GO:0043065)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)	ASAP complex (GO:0061574)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(1)|large_intestine(1)|lung(4)|ovary(2)|urinary_tract(1)	9						AGCCCTGCAGTGCTGGGCATG	0.662																																																	0								ENSG00000266643																																			MIR3677	SO:0001631	upstream_gene_variant	0			-	HGNC	AF015608	CCDS10465.1, CCDS66907.1, CCDS73811.1	16p13.3	2013-02-12	2001-11-28		ENSG00000205937	ENSG00000205937		"""RNA binding motif (RRM) containing"""	10080	protein-coding gene	gene with protein product		606447	"""RNA-binding protein S1, serine-rich domain"""			9580558, 8543184	Standard	XM_005255048		Approved		uc002cpu.3	Q15287	OTTHUMG00000128828		16.37:g.2320736T>A	Exception_encountered	Somatic	0	42	0.00		0.6643483795556975	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	42	16.00	A8K1P0|B4DDU8|B4DZU7|B7ZA17|O75308|Q32P25|Q8WY42|Q9NYG3	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000320225.5	37	NULL	CCDS10465.1	16																																																																																			-	-		0.662	RNPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIR3677	protein_coding	OTTHUMT00000250766.2	T	NM_080594	-		2320736	+1	no_errors	ENST00000578964	ensembl	human	known	74_37	rna	SNP	0.000	A
ZNF728	388523	genome.wustl.edu	37	19	23158575	23158575	+	Missense_Mutation	SNP	T	T	G			TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr19:23158575T>G	ENST00000594710.1	-	4	1709	c.1564A>C	c.(1564-1566)Aac>Cac	p.N522H		NM_001267716.1	NP_001254645.1	P0DKX0	ZN728_HUMAN	zinc finger protein 728	522					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)										TTAGTAAGGTTTGCAACCTTA	0.378																																																	0								ENSG00000269067																																			ZNF728	SO:0001583	missense	0			-	HGNC	BC128130	CCDS59370.1	19p12	2014-02-14			ENSG00000269067	ENSG00000269067		"""Zinc fingers, C2H2-type"", ""-"""	32463	protein-coding gene	gene with protein product							Standard	NM_001267716		Approved		uc002nqz.2	P0DKX0	OTTHUMG00000183124	ENST00000594710.1:c.1564A>C	19.37:g.23158575T>G	ENSP00000471593:p.Asn522His	Somatic	0	14	0.00		0.6643483795556975	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	8	69.23		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.N522H	ENST00000594710.1	37	c.1564	CCDS59370.1	19																																																																																			-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.378	ZNF728-001	NOVEL	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	ZNF728	protein_coding	OTTHUMT00000465176.1	T	NM_001267716	-		23158575	-1	no_errors	ENST00000594710	ensembl	human	novel	74_37	missense	SNP	0.000	G
ZBED3-AS1	728723	genome.wustl.edu	37	5	76442965	76442967	+	RNA	DEL	GAT	GAT	-	rs148649553|rs398109059|rs201965780|rs398064921|rs77016507|rs28502128	byFrequency	TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	GAT	GAT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr5:76442965_76442967delGAT	ENST00000508401.1	+	0	200				ZBED3-AS1_ENST00000515356.2_RNA|ZBED3-AS1_ENST00000503969.1_RNA|ZBED3-AS1_ENST00000512001.1_RNA|ZBED3-AS1_ENST00000515419.1_RNA|ZBED3-AS1_ENST00000513406.1_RNA|ZBED3-AS1_ENST00000513591.1_RNA|ZBED3-AS1_ENST00000514114.1_RNA|ZBED3-AS1_ENST00000511547.1_RNA					ZBED3 antisense RNA 1																		GGAAgatgaagatgatgatgatg	0.365														4058	0.810304	0.8192	0.67	5008	,	,		21233	0.9425		0.7137	False		,,,				2504	0.8609																0								ENSG00000250802																																			ZBED3-AS1			0				HGNC			5q13.3	2012-10-12	2012-08-15		ENSG00000250802	ENSG00000250802		"""Long non-coding RNAs"""	44188	non-coding RNA	RNA, long non-coding			"""ZBED3 antisense RNA 1 (non-protein coding)"""				Standard	NR_024398		Approved		uc003kez.3		OTTHUMG00000162473		5.37:g.76442974_76442976delGAT		Somatic	0	14	0.00		0.6643483795556975	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	8	46.67		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000508401.1	37	NULL		5																																																																																			-	-		0.365	ZBED3-AS1-016	KNOWN	basic|exp_conf	antisense	ZBED3-AS1	antisense	OTTHUMT00000369077.2	GAT	NR_024398			76442967	+1	no_errors	ENST00000515356	ensembl	human	known	74_37	rna	DEL	1.000:0.998:0.997	-
PAX4	5078	genome.wustl.edu	37	7	127251688	127251688	+	Nonsense_Mutation	SNP	C	C	A			TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr7:127251688C>A	ENST00000341640.2	-	8	995	c.790G>T	c.(790-792)Gaa>Taa	p.E264*	PAX4_ENST00000338516.3_Missense_Mutation_p.G253V|PAX4_ENST00000378740.2_Nonsense_Mutation_p.E264*|PAX4_ENST00000463946.1_Nonsense_Mutation_p.E262*	NM_006193.2	NP_006184.2	O43316	PAX4_HUMAN	paired box 4	272					cell differentiation (GO:0030154)|circadian rhythm (GO:0007623)|endocrine pancreas development (GO:0031018)|negative regulation of apoptotic process (GO:0043066)|organ morphogenesis (GO:0009887)|positive regulation of cell differentiation (GO:0045597)|response to cAMP (GO:0051591)|response to drug (GO:0042493)|retina development in camera-type eye (GO:0060041)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001206)			cervix(1)|kidney(2)|large_intestine(6)|lung(20)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	35						CCCAGTGGTTCCAGGGCAGGC	0.562																																					Ovarian(113;737 1605 7858 27720 34092)												0								ENSG00000106331						63.0	68.0	66.0					7																	127251688		2203	4300	6503	PAX4	SO:0001587	stop_gained	0			-	HGNC		CCDS5797.1	7q32.1	2011-06-20	2007-07-12		ENSG00000106331	ENSG00000106331		"""Paired boxes"", ""Homeoboxes / PRD class"""	8618	protein-coding gene	gene with protein product		167413	"""paired box gene 4"""				Standard	NM_006193		Approved	MODY9	uc010lld.1	O43316	OTTHUMG00000157562	ENST00000341640.2:c.790G>T	7.37:g.127251688C>A	ENSP00000339906:p.Glu264*	Somatic	0	32	0.00		0.6643483795556975	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70	O95161|Q6B0H0	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Paired_dom,pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Paired_dom,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Paired_dom,prints_Paired_dom	p.E264*	ENST00000341640.2	37	c.790	CCDS5797.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	22.3|22.3	4.269646|4.269646	0.80469|0.80469	.|.	.|.	ENSG00000106331|ENSG00000106331	ENST00000341640;ENST00000378740;ENST00000463946|ENST00000338516	.|D	.|0.93763	.|-3.28	5.24|5.24	2.3|2.3	0.28687|0.28687	.|.	1.737350|.	0.02971|.	N|.	0.144436|.	.|D	.|0.84374	.|0.5458	.|.	.|.	.|.	0.21386|0.21386	N|N	0.999704|0.999704	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.72465	.|-0.4285	.|6	0.32370|0.14252	T|T	0.25|0.57	.|.	4.524|4.524	0.11973|0.11973	0.0:0.6192:0.1845:0.1963|0.0:0.6192:0.1845:0.1963	.|.	.|.	.|.	.|.	X|V	264;272;262|253	.|ENSP00000344297:G253V	ENSP00000339906:E264X|ENSP00000344297:G253V	E|G	-|-	1|2	0|0	PAX4|PAX4	127038924|127038924	0.006000|0.006000	0.16342|0.16342	0.625000|0.625000	0.29200|0.29200	0.070000|0.070000	0.16714|0.16714	1.301000|1.301000	0.33447|0.33447	1.352000|1.352000	0.45808|0.45808	0.561000|0.561000	0.74099|0.74099	GAA|GGA	-	NULL		0.562	PAX4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PAX4	protein_coding	OTTHUMT00000349165.1	C		-		127251688	-1	no_errors	ENST00000341640	ensembl	human	known	74_37	nonsense	SNP	0.212	A
HNRNPA3	220988	genome.wustl.edu	37	2	178081298	178081298	+	Missense_Mutation	SNP	G	G	T			TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr2:178081298G>T	ENST00000392524.2	+	5	858	c.621G>T	c.(619-621)atG>atT	p.M207I	HNRNPA3_ENST00000411529.2_Missense_Mutation_p.M185I|HNRNPA3_ENST00000435711.1_Missense_Mutation_p.M207I			P51991	ROA3_HUMAN	heterogeneous nuclear ribonucleoprotein A3	207					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|urinary_tract(1)	16						AACAAGAGATGCAGTCTGCTG	0.363																																																	0								ENSG00000170144						132.0	132.0	132.0					2																	178081298		2203	4300	6503	HNRNPA3	SO:0001583	missense	0			-	HGNC	AF517524	CCDS2273.1	2q31.2	2013-02-12		2008-04-18	ENSG00000170144	ENSG00000170144		"""RNA binding motif (RRM) containing"""	24941	protein-coding gene	gene with protein product		605372		HNRPA3		11886857, 15776420	Standard	XM_005246380		Approved		uc002ulc.1	P51991	OTTHUMG00000132529	ENST00000392524.2:c.621G>T	2.37:g.178081298G>T	ENSP00000376309:p.Met207Ile	Somatic	0	48	0.00		0.6643483795556975	310	16.67	62	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	53	11.67	D3DPF4|Q53RW7|Q6URK5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.M207I	ENST00000392524.2	37	c.621	CCDS2273.1	2	.	.	.	.	.	.	.	.	.	.	G	17.09	3.301156	0.60195	.	.	ENSG00000170144	ENST00000392524;ENST00000411529;ENST00000416446;ENST00000420139;ENST00000435711;ENST00000432457	D;D;D;D	0.89681	-2.55;-2.55;-2.55;-2.55	3.68	3.68	0.42216	Nucleotide-binding, alpha-beta plait (1);	0.000000	0.56097	D	0.000024	D	0.87970	0.6312	M	0.70842	2.15	0.80722	D	1	B;B	0.19445	0.036;0.029	B;B	0.12156	0.007;0.005	D	0.87072	0.2160	10	0.52906	T	0.07	.	15.9668	0.79979	0.0:0.0:1.0:0.0	.	185;207	B4DDB6;P51991	.;ROA3_HUMAN	I	207;185;185;185;207;15	ENSP00000376309:M207I;ENSP00000408487:M185I;ENSP00000416340:M207I;ENSP00000400688:M15I	ENSP00000376309:M207I	M	+	3	0	HNRNPA3	177789544	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.504000	0.97986	2.085000	0.62840	0.551000	0.68910	ATG	-	NULL		0.363	HNRNPA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HNRNPA3	protein_coding	OTTHUMT00000255729.3	G	NM_194247	-		178081298	+1	no_errors	ENST00000392524	ensembl	human	known	74_37	missense	SNP	1.000	T
RXRA	6256	genome.wustl.edu	37	9	137328351	137328351	+	Missense_Mutation	SNP	C	C	A			TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr9:137328351C>A	ENST00000481739.1	+	10	1332	c.1280C>A	c.(1279-1281)tCc>tAc	p.S427Y	RXRA_ENST00000356384.4_3'UTR|RXRA_ENST00000540193.1_Missense_Mutation_p.S330Y	NM_002957.4	NP_002948.1	P19793	RXRA_HUMAN	retinoid X receptor, alpha	427	Ligand-binding.				camera-type eye development (GO:0043010)|cardiac muscle cell proliferation (GO:0060038)|cellular lipid metabolic process (GO:0044255)|cholesterol metabolic process (GO:0008203)|embryo implantation (GO:0007566)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|maternal placenta development (GO:0001893)|modulation by virus of host morphology or physiology (GO:0019048)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peroxisome proliferator activated receptor signaling pathway (GO:0035357)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homotetramerization (GO:0051289)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|response to retinoic acid (GO:0032526)|retinoic acid receptor signaling pathway (GO:0048384)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ventricular cardiac muscle cell differentiation (GO:0055012)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|vitamin metabolic process (GO:0006766)	nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	9-cis retinoic acid receptor activity (GO:0004886)|chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein heterodimerization activity (GO:0046982)|retinoic acid receptor activity (GO:0003708)|retinoic acid-responsive element binding (GO:0044323)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|vitamin D receptor binding (GO:0042809)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	19				OV - Ovarian serous cystadenocarcinoma(145;4.66e-08)|Epithelial(140;6.72e-08)|all cancers(34;2.22e-07)	Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Bexarotene(DB00307)|Etodolac(DB00749)	GCTCTGCGCTCCATCGGGCTC	0.607																																																	0								ENSG00000186350						132.0	117.0	122.0					9																	137328351		2203	4300	6503	RXRA	SO:0001583	missense	0			-	HGNC	X52773	CCDS35172.1	9q34	2013-01-16			ENSG00000186350	ENSG00000186350		"""Nuclear hormone receptors"""	10477	protein-coding gene	gene with protein product	"""nuclear receptor subfamily 2 group B member 1"""	180245				2159111	Standard	XM_005263409		Approved	NR2B1	uc004cfa.1	P19793	OTTHUMG00000020887	ENST00000481739.1:c.1280C>A	9.37:g.137328351C>A	ENSP00000419692:p.Ser427Tyr	Somatic	0	40	0.00		0.6643483795556975	208	19.07	49	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	81	15.62	B3KY83|Q2NL52|Q2V504	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Nuc_recep-AF1,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Retinoid-X_rcpt/HNF4,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt,prints_COUP_TF,prints_Retinoic_acid_rcpt	p.S427Y	ENST00000481739.1	37	c.1280	CCDS35172.1	9	.	.	.	.	.	.	.	.	.	.	C	26.7	4.763145	0.89932	.	.	ENSG00000186350	ENST00000481739;ENST00000540193	D;D	0.96913	-4.17;-4.17	4.76	4.76	0.60689	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.000000	0.85682	D	0.000000	D	0.98501	0.9500	M	0.91768	3.24	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99823	1.1048	10	0.87932	D	0	.	17.7817	0.88526	0.0:1.0:0.0:0.0	.	427	P19793	RXRA_HUMAN	Y	427;330	ENSP00000419692:S427Y;ENSP00000442123:S330Y	ENSP00000419692:S427Y	S	+	2	0	RXRA	136468172	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	7.532000	0.81985	2.193000	0.70182	0.591000	0.81541	TCC	-	pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Nucl_hrmn_rcpt_lig-bd_core,prints_Str_hrmn_rcpt,prints_COUP_TF,prints_Retinoic_acid_rcpt		0.607	RXRA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RXRA	protein_coding	OTTHUMT00000054949.1	C	NM_002957	-		137328351	+1	no_errors	ENST00000481739	ensembl	human	known	74_37	missense	SNP	1.000	A
SS18	6760	genome.wustl.edu	37	18	23612405	23612405	+	Silent	SNP	T	T	C			TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr18:23612405T>C	ENST00000415083.2	-	10	1243	c.1188A>G	c.(1186-1188)ggA>ggG	p.G396G	SS18_ENST00000269137.7_Silent_p.G365G|SS18_ENST00000539849.1_Silent_p.G314G|SS18_ENST00000542743.1_Silent_p.G313G|SS18_ENST00000542420.2_Silent_p.G373G|SS18_ENST00000545952.1_Silent_p.G313G	NM_001007559.1|NM_005637.2	NP_001007560.1|NP_005628.2	Q15532	SSXT_HUMAN	synovial sarcoma translocation, chromosome 18	396	Gln-rich.				cell morphogenesis (GO:0000902)|ephrin receptor signaling pathway (GO:0048013)|intracellular signal transduction (GO:0035556)|microtubule cytoskeleton organization (GO:0000226)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to drug (GO:0042493)|transcription, DNA-templated (GO:0006351)	cytoplasmic microtubule (GO:0005881)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)		SS18/SSX2(706)|SS18/SSX1(1169)|SS18/SSX4(12)	endometrium(1)|kidney(2)|large_intestine(4)|lung(11)|ovary(1)	19	all_cancers(21;0.000194)|Lung NSC(5;0.000413)|all_lung(6;0.00118)|Ovarian(20;0.124)					GCTGTGGTGGTCCAGGCTGTG	0.507			T	"""SSX1,  SSX2"""	synovial sarcoma																																			Dom	yes		18	18q11.2	6760	"""synovial sarcoma translocation, chromosome 18"""		M	0								ENSG00000141380						224.0	190.0	201.0					18																	23612405		2203	4300	6503	SS18	SO:0001819	synonymous_variant	0			-	HGNC	X79201	CCDS32807.1, CCDS54183.1	18q11.2	2008-07-28				ENSG00000141380			11340	protein-coding gene	gene with protein product		600192		SSXT		8152806, 7951320, 16484776	Standard	XM_005258334		Approved	SYT	uc002kvm.3	Q15532		ENST00000415083.2:c.1188A>G	18.37:g.23612405T>C		Somatic	0	105	0.00		0.6643483795556975	59	32.95	29	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	55	34.52	B0YJ95|Q16404|Q4VAX1|Q9BXC6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_SS18_fam	p.G396	ENST00000415083.2	37	c.1188	CCDS32807.1	18																																																																																			-	NULL		0.507	SS18-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SS18	protein_coding	OTTHUMT00000446226.1	T		-		23612405	-1	no_errors	ENST00000415083	ensembl	human	known	74_37	silent	SNP	1.000	C
MMP27	64066	genome.wustl.edu	37	11	102567418	102567418	+	Silent	SNP	G	G	T			TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr11:102567418G>T	ENST00000260229.4	-	5	859	c.768C>A	c.(766-768)atC>atA	p.I256I		NM_022122.2	NP_071405.2	Q9H306	MMP27_HUMAN	matrix metallopeptidase 27	256					collagen catabolic process (GO:0030574)	proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(12)|ovary(2)|prostate(2)|skin(11)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	45	all_cancers(8;0.000843)|all_epithelial(12;0.00362)|Lung NSC(15;0.21)	all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.0509)|Lung(13;0.0696)|LUSC - Lung squamous cell carcinoma(19;0.13)|all cancers(10;0.176)	BRCA - Breast invasive adenocarcinoma(274;0.0151)	Marimastat(DB00786)	AGATGGACTGGATTCCATTGA	0.363																																																	0								ENSG00000137675						83.0	81.0	82.0					11																	102567418		2203	4299	6502	MMP27	SO:0001819	synonymous_variant	0			-	HGNC	AF195192	CCDS8319.1	11q24	2008-07-18	2005-08-08		ENSG00000137675	ENSG00000137675			14250	protein-coding gene	gene with protein product	"""matrix metalloprotease 27"""		"""matrix metalloproteinase 27"""			10419448	Standard	NM_022122		Approved		uc001phd.1	Q9H306	OTTHUMG00000168099	ENST00000260229.4:c.768C>A	11.37:g.102567418G>T		Somatic	0	35	0.00		0.6643483795556975	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00	Q6UWK6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Pept_M10_metallopeptidase,pfam_Hemopexin-like_repeat,pfam_Peptidoglycan-bd-like,superfamily_Hemopexin-like_dom,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,smart_Hemopexin-like_repeat,pirsf_Pept_M10A_Metazoans,prints_Pept_M10A	p.I256	ENST00000260229.4	37	c.768	CCDS8319.1	11																																																																																			-	pfam_Pept_M10_metallopeptidase,smart_Peptidase_Metallo,pirsf_Pept_M10A_Metazoans,prints_Pept_M10A		0.363	MMP27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP27	protein_coding	OTTHUMT00000398128.1	G	NM_022122	-		102567418	-1	no_errors	ENST00000260229	ensembl	human	known	74_37	silent	SNP	0.999	T
APEH	327	genome.wustl.edu	37	3	49717990	49717990	+	Missense_Mutation	SNP	C	C	A			TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr3:49717990C>A	ENST00000296456.5	+	14	1627	c.1227C>A	c.(1225-1227)agC>agA	p.S409R	APEH_ENST00000438011.1_Missense_Mutation_p.S409R	NM_001640.3	NP_001631.3	P13798	ACPH_HUMAN	acylaminoacyl-peptide hydrolase	409					beta-amyloid metabolic process (GO:0050435)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear membrane (GO:0031965)	omega peptidase activity (GO:0008242)|poly(A) RNA binding (GO:0044822)|serine-type endopeptidase activity (GO:0004252)			endometrium(3)|large_intestine(1)|lung(6)|ovary(1)|skin(1)|stomach(2)|urinary_tract(1)	15				BRCA - Breast invasive adenocarcinoma(193;4.53e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		CAGGTGGGAGCTGGAAGTTGC	0.557																																																	0								ENSG00000164062						126.0	102.0	110.0					3																	49717990		2203	4300	6503	APEH	SO:0001583	missense	0			-	HGNC	D38441	CCDS2801.1	3p21	2013-05-29	2013-05-29		ENSG00000164062	ENSG00000164062	3.4.19.1		586	protein-coding gene	gene with protein product	"""acylaminoacyl-peptidase"""	102645	"""N-acylaminoacyl-peptide hydrolase"""	D3F15S2, DNF15S2, D3S48E		2392324	Standard	NM_001640		Approved		uc003cxf.3	P13798	OTTHUMG00000156882	ENST00000296456.5:c.1227C>A	3.37:g.49717990C>A	ENSP00000296456:p.Ser409Arg	Somatic	0	47	0.00		0.6643483795556975	71	44.96	58	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	28	41.67	Q9BQ33|Q9P0Y2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_S9,pfam_AB_hydrolase_1,pfam_Dienelactn_hydro	p.S409R	ENST00000296456.5	37	c.1227	CCDS2801.1	3	.	.	.	.	.	.	.	.	.	.	C	20.4	3.991661	0.74703	.	.	ENSG00000164062	ENST00000296456;ENST00000438011	T;T	0.45668	0.89;0.89	5.2	4.33	0.51752	Peptidase S9A/B/C, oligopeptidase, N-terminal beta-propeller (1);	0.036116	0.85682	D	0.000000	T	0.58977	0.2160	M	0.75615	2.305	0.58432	D	0.999994	D;D	0.62365	0.991;0.985	D;P	0.66196	0.942;0.843	T	0.58875	-0.7559	10	0.39692	T	0.17	-15.4203	9.9568	0.41671	0.0:0.8422:0.0:0.1578	.	409;409	C9JIF9;P13798	.;ACPH_HUMAN	R	409	ENSP00000296456:S409R;ENSP00000415862:S409R	ENSP00000296456:S409R	S	+	3	2	APEH	49692994	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	2.639000	0.46570	1.325000	0.45301	0.561000	0.74099	AGC	-	NULL		0.557	APEH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APEH	protein_coding	OTTHUMT00000346415.2	C		-		49717990	+1	no_errors	ENST00000296456	ensembl	human	known	74_37	missense	SNP	1.000	A
PKD2	5311	genome.wustl.edu	37	4	88929174	88929176	+	In_Frame_Del	DEL	GAG	GAG	-			TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	GAG	GAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr4:88929174_88929176delGAG	ENST00000237596.2	+	1	355_357	c.289_291delGAG	c.(289-291)gagdel	p.E102del		NM_000297.3	NP_000288.1	Q9BZL6	KPCD2_HUMAN	polycystic kidney disease 2 (autosomal dominant)	0					angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|endothelial tube morphogenesis (GO:0061154)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell adhesion (GO:0045785)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of T cell receptor signaling pathway (GO:0050862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|T cell receptor signaling pathway (GO:0050852)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(4)|kidney(1)|large_intestine(8)|liver(2)|lung(15)|skin(4)|upper_aerodigestive_tract(1)	36		Hepatocellular(203;0.114)|Acute lymphoblastic leukemia(40;0.221)		OV - Ovarian serous cystadenocarcinoma(123;9.98e-10)|COAD - Colon adenocarcinoma(81;0.0237)		CTTCGAGGCCgaggaggaggagg	0.739																																																	0								ENSG00000118762			18,82,2250		6,0,6,18,46,1099						-3.4	0.9			2	8,117,4707		2,0,4,14,89,2307	no	codingComplex	PKD2	NM_000297.3		8,0,10,32,135,3406	A1A1,A1A2,A1R,A2A2,A2R,RR		2.5869,4.2553,3.1328				26,199,6957				PKD2	SO:0001651	inframe_deletion	0				HGNC	U50928	CCDS3627.1	4q22.1	2014-01-28			ENSG00000118762	ENSG00000118762		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""EF-hand domain containing"""	9009	protein-coding gene	gene with protein product	"""transient receptor potential cation channel, subfamily P, member 2"""	173910				8298643	Standard	NM_000297		Approved	PKD4, PC2, Pc-2, TRPP2	uc003hre.3	Q13563	OTTHUMG00000160982	ENST00000237596.2:c.289_291delGAG	4.37:g.88929183_88929185delGAG	ENSP00000237596:p.Glu102del	Somatic	0	26	0.00		0.6643483795556975	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	23	8.00	Q8TB08|Q9P0T6|Q9Y3X8	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_PKD1_2_channel,pfam_Ion_trans_dom,pfscan_EF_hand_dom,prints_PKD_2,prints_PKD_1	p.E100in_frame_del	ENST00000237596.2	37	c.289_291	CCDS3627.1	4																																																																																			-	NULL		0.739	PKD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKD2	protein_coding	OTTHUMT00000253042.4	GAG	NM_000297			88929176	+1	no_errors	ENST00000237596	ensembl	human	known	74_37	in_frame_del	DEL	1.000:1.000:1.000	-
TAS1R1	80835	genome.wustl.edu	37	1	6637055	6637055	+	Nonsense_Mutation	SNP	C	C	T	rs61740593	byFrequency	TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr1:6637055C>T	ENST00000333172.6	+	5	1712	c.1519C>T	c.(1519-1521)Cga>Tga	p.R507*	TAS1R1_ENST00000351136.3_Nonsense_Mutation_p.R253*|TAS1R1_ENST00000328191.4_Intron	NM_138697.3	NP_619642.2	Q7RTX1	TS1R1_HUMAN	taste receptor, type 1, member 1	507			R -> Q (in dbSNP:rs35118458).		detection of chemical stimulus involved in sensory perception of taste (GO:0050912)|sensory perception of umami taste (GO:0050917)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein heterodimerization activity (GO:0046982)|taste receptor activity (GO:0008527)			NS(2)|central_nervous_system(1)|endometrium(2)|large_intestine(7)|lung(13)|ovary(1)|skin(1)|urinary_tract(2)	29	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;8.73e-34)|all_epithelial(116;9.26e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|Breast(487;0.000353)|Renal(390;0.0007)|Colorectal(325;0.00104)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0443)		Colorectal(212;1.29e-07)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000896)|BRCA - Breast invasive adenocarcinoma(365;0.00108)|STAD - Stomach adenocarcinoma(132;0.0167)|READ - Rectum adenocarcinoma(331;0.0642)		AGGGCACCAGCGAGTGGTTAC	0.577																																																	0								ENSG00000173662						160.0	149.0	153.0					1																	6637055		2203	4300	6503	TAS1R1	SO:0001587	stop_gained	0			-	HGNC		CCDS81.1, CCDS82.1	1p36.23	2012-08-22	2003-03-24		ENSG00000173662	ENSG00000173662		"""Taste receptors / Type 1"", ""GPCR / Unclassified : Taste receptors"""	14448	protein-coding gene	gene with protein product		606225	"""G protein-coupled receptor 70"""	GPR70			Standard	NM_138697		Approved	T1R1, TR1	uc001ant.3	Q7RTX1	OTTHUMG00000001441	ENST00000333172.6:c.1519C>T	1.37:g.6637055C>T	ENSP00000331867:p.Arg507*	Somatic	0	56	0.00		0.6643483795556975	0	100.00	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	41	3	93.18	B2RMX0|Q5SY22|Q5SY24|Q8NGZ7|Q8TDJ7|Q8TDJ8|Q8TDJ9|Q8TDK0	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,superfamily_Peripla_BP_I,pfscan_GPCR_3_C,prints_GPCR_3	p.R507*	ENST00000333172.6	37	c.1519	CCDS81.1	1	.	.	.	.	.	.	.	.	.	.	C	29.4	5.006058	0.93287	.	.	ENSG00000173662	ENST00000333172;ENST00000437392;ENST00000351136	.	.	.	4.86	1.73	0.24493	.	0.259107	0.36932	N	0.002335	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.34782	T	0.22	.	12.6943	0.56994	0.6079:0.3921:0.0:0.0	.	.	.	.	X	507;175;253	.	ENSP00000331867:R507X	R	+	1	2	TAS1R1	6559642	0.122000	0.22280	0.001000	0.08648	0.892000	0.51952	1.245000	0.32790	0.043000	0.15746	0.491000	0.48974	CGA	-	pfam_GPCR_3_9-Cys_dom		0.577	TAS1R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS1R1	protein_coding	OTTHUMT00000004211.1	C		-		6637055	+1	no_errors	ENST00000333172	ensembl	human	known	74_37	nonsense	SNP	0.000	T
FANCC	2176	genome.wustl.edu	37	9	98011420	98011420	+	Missense_Mutation	SNP	A	A	T			TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr9:98011420A>T	ENST00000289081.3	-	2	408	c.154T>A	c.(154-156)Ttg>Atg	p.L52M	FANCC_ENST00000375305.1_Missense_Mutation_p.L52M	NM_000136.2	NP_000127.2	Q00597	FANCC_HUMAN	Fanconi anemia, complementation group C	52					DNA repair (GO:0006281)|germ cell development (GO:0007281)|myeloid cell homeostasis (GO:0002262)|nucleotide-excision repair (GO:0006289)|protein complex assembly (GO:0006461)|removal of superoxide radicals (GO:0019430)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				kidney(1)|skin(1)|upper_aerodigestive_tract(1)	3		Acute lymphoblastic leukemia(62;0.138)				ATCTCTTTCAAGGCTTCATAC	0.458			"""D, Mis, N, F, S"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																														yes	Rec		Fanconi anaemia C	9	9q22.3	2176	"""Fanconi anemia, complementation group C"""		L	0								ENSG00000158169						113.0	105.0	108.0					9																	98011420		2203	4300	6503	FANCC	SO:0001583	missense	0	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	-	HGNC	BC006303	CCDS35071.1, CCDS75861.1	9q22.3	2014-09-17			ENSG00000158169	ENSG00000158169		"""Fanconi anemia, complementation groups"""	3584	protein-coding gene	gene with protein product		613899		FACC		1303234	Standard	NM_001243743		Approved	FAC, FA3	uc004avh.3	Q00597	OTTHUMG00000020279	ENST00000289081.3:c.154T>A	9.37:g.98011420A>T	ENSP00000289081:p.Leu52Met	Somatic	0	27	0.00		0.6643483795556975	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	32	31.91	B1ALR8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Fanconi,pirsf_Fanconi,prints_Fanconi	p.L52M	ENST00000289081.3	37	c.154	CCDS35071.1	9	.	.	.	.	.	.	.	.	.	.	A	14.68	2.608764	0.46527	.	.	ENSG00000158169	ENST00000289081;ENST00000375305;ENST00000433829	T;T;T	0.64438	-0.1;-0.1;-0.1	5.13	3.99	0.46301	.	0.079487	0.50627	D	0.000102	T	0.71316	0.3325	M	0.65498	2.005	0.36645	D	0.87707	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.73726	-0.3892	10	0.44086	T	0.13	-12.3358	4.2155	0.10531	0.6386:0.0:0.2198:0.1416	.	52;52	B1ALR7;Q00597	.;FANCC_HUMAN	M	52	ENSP00000289081:L52M;ENSP00000364454:L52M;ENSP00000406908:L52M	ENSP00000289081:L52M	L	-	1	2	FANCC	97051241	0.991000	0.36638	0.997000	0.53966	0.972000	0.66771	1.631000	0.37092	1.087000	0.41251	0.528000	0.53228	TTG	-	pfam_Fanconi,pirsf_Fanconi,prints_Fanconi		0.458	FANCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FANCC	protein_coding	OTTHUMT00000053219.1	A	NM_000136	-		98011420	-1	no_errors	ENST00000289081	ensembl	human	known	74_37	missense	SNP	0.963	T
PIWIL1	9271	genome.wustl.edu	37	12	130834413	130834413	+	Missense_Mutation	SNP	G	G	T			TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr12:130834413G>T	ENST00000245255.3	+	9	1217	c.945G>T	c.(943-945)aaG>aaT	p.K315N		NM_001190971.1|NM_004764.4	NP_001177900.1|NP_004755.2	Q96J94	PIWL1_HUMAN	piwi-like RNA-mediated gene silencing 1	315	PAZ. {ECO:0000255|PROSITE- ProRule:PRU00142}.				gene silencing by RNA (GO:0031047)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|regulation of translation (GO:0006417)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|mRNA cap binding complex (GO:0005845)|P granule (GO:0043186)|polysome (GO:0005844)	mRNA binding (GO:0003729)|piRNA binding (GO:0034584)|single-stranded RNA binding (GO:0003727)			breast(6)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(26)|ovary(2)|prostate(4)|skin(3)|urinary_tract(1)	57	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;3.02e-06)|Epithelial(86;3.85e-05)|all cancers(50;4.65e-05)		ATAACAATAAGACATACAGAG	0.393																																																	0								ENSG00000125207						81.0	82.0	82.0					12																	130834413		2203	4300	6503	PIWIL1	SO:0001583	missense	0			-	HGNC	AF104260	CCDS9268.1	12q24.33	2014-01-21	2013-02-15		ENSG00000125207	ENSG00000125207		"""Argonaute/PIWI family"""	9007	protein-coding gene	gene with protein product		605571	"""piwi (Drosophila)-like 1"", ""piwi-like 1 (Drosophila)"""			9851978, 12906857	Standard	NM_004764		Approved	PIWI, HIWI, CT80.1	uc001uik.3	Q96J94	OTTHUMG00000168382	ENST00000245255.3:c.945G>T	12.37:g.130834413G>T	ENSP00000245255:p.Lys315Asn	Somatic	0	68	0.00		0.6643483795556975	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	32	72	30.77	A4F266|O95404|Q8NA60|Q8TBY5|Q96JD5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Piwi,pfam_PAZ_dom,pfam_GAGE,superfamily_RNaseH-like_dom,superfamily_PAZ_dom,smart_PAZ_dom,smart_Piwi,pfscan_PAZ_dom,pfscan_Piwi	p.K315N	ENST00000245255.3	37	c.945	CCDS9268.1	12	.	.	.	.	.	.	.	.	.	.	G	14.05	2.420552	0.42918	.	.	ENSG00000125207	ENST00000245255	T	0.13089	2.62	5.57	-5.04	0.02964	Argonaute/Dicer protein, PAZ (4);	0.090107	0.85682	D	0.000000	T	0.27900	0.0687	M	0.67569	2.06	0.53688	D	0.999974	D;P	0.58268	0.982;0.947	D;P	0.66196	0.942;0.633	T	0.06338	-1.0832	10	0.49607	T	0.09	-21.4515	15.3716	0.74570	0.3395:0.0:0.6605:0.0	.	315;315	Q96J94;Q96J94-2	PIWL1_HUMAN;.	N	315	ENSP00000245255:K315N	ENSP00000245255:K315N	K	+	3	2	PIWIL1	129400366	0.999000	0.42202	0.680000	0.29994	0.075000	0.17131	0.622000	0.24433	-0.791000	0.04486	-1.166000	0.01754	AAG	-	pfam_PAZ_dom,superfamily_PAZ_dom,smart_PAZ_dom,pfscan_PAZ_dom		0.393	PIWIL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIWIL1	protein_coding	OTTHUMT00000399510.1	G		-		130834413	+1	no_errors	ENST00000245255	ensembl	human	known	74_37	missense	SNP	0.843	T
PPP6R2	9701	genome.wustl.edu	37	22	50857777	50857777	+	Splice_Site	SNP	G	G	T			TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr22:50857777G>T	ENST00000216061.5	+	9	1101		c.e9-1		PPP6R2_ENST00000395741.3_Missense_Mutation_p.R245M|PPP6R2_ENST00000359139.3_Splice_Site|PPP6R2_ENST00000395744.3_Splice_Site			O75170	PP6R2_HUMAN	protein phosphatase 6, regulatory subunit 2							cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)				NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|liver(1)|lung(6)|ovary(2)|skin(1)|urinary_tract(1)	22						GTGTCCAGCAGGCAGGACTGT	0.567																																																	0								ENSG00000100239						105.0	79.0	88.0					22																	50857777		2203	4300	6503	PPP6R2	SO:0001630	splice_region_variant	0			-	HGNC	AB014585	CCDS33681.1, CCDS56235.1, CCDS56236.1, CCDS74881.1	22q13.33	2012-04-17	2010-06-28	2010-06-28	ENSG00000100239	ENSG00000100239		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"""	19253	protein-coding gene	gene with protein product		610877	"""KIAA0685"", ""SAPS domain family, member 2"""	KIAA0685, SAPS2		16769727	Standard	NM_014678		Approved	dJ579N16.1, SAP190	uc003blc.3	O75170	OTTHUMG00000150199	ENST00000216061.5:c.732-1G>T	22.37:g.50857777G>T		Somatic	0	32	0.00		0.6643483795556975	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	28	12.50	A6PVG3|B7Z7T3|Q5U5P3|Q7Z2L2|Q7Z5G5|Q7Z731|Q9UGB9	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e6-1	ENST00000216061.5	37	c.732-1		22	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	25.2|25.2	4.608493|4.608493	0.87258|0.87258	.|.	.|.	ENSG00000100239|ENSG00000100239	ENST00000359139;ENST00000395744;ENST00000216061|ENST00000395741	.|T	.|0.32023	.|1.47	5.63|5.63	5.63|5.63	0.86233|0.86233	.|.	.|.	.|.	.|.	.|.	.|T	.|0.58750	.|0.2144	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.91635	.|0.999	.|T	.|0.61997	.|-0.6947	.|8	.|0.87932	.|D	.|0	.|.	17.1792|17.1792	0.86850|0.86850	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|245	.|O75170-3	.|.	.|M	-1|245	.|ENSP00000379090:R245M	.|ENSP00000379090:R245M	.|R	+|+	.|2	.|0	PPP6R2|PPP6R2	49204643|49204643	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.927000|0.927000	0.56198|0.56198	9.549000|9.549000	0.98106|0.98106	2.657000|2.657000	0.90304|0.90304	0.549000|0.549000	0.68633|0.68633	.|AGG	-	-		0.567	PPP6R2-004	KNOWN	basic|appris_candidate_longest	protein_coding	PPP6R2	protein_coding	OTTHUMT00000316809.1	G	NM_014678	-	Intron	50857777	+1	no_errors	ENST00000216061	ensembl	human	known	74_37	splice_site	SNP	1.000	T
IRF5	3663	genome.wustl.edu	37	7	128587589	128587589	+	Splice_Site	SNP	C	C	A			TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr7:128587589C>A	ENST00000402030.2	+	6	811	c.739C>A	c.(739-741)Ctg>Atg	p.L247M	IRF5_ENST00000477535.1_Intron|IRF5_ENST00000357234.5_Splice_Site_p.L263M|IRF5_ENST00000473745.1_Splice_Site_p.L247M|IRF5_ENST00000249375.4_Splice_Site_p.L247M	NM_001098629.1|NM_001098630.1	NP_001092099.1|NP_001092100.1	Q13568	IRF5_HUMAN	interferon regulatory factor 5	247					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of apoptotic process (GO:0043065)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to muramyl dipeptide (GO:0032495)|response to peptidoglycan (GO:0032494)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(1)|prostate(1)	15						CATGCTGCCTCGTAAGGACCC	0.652																																																	0								ENSG00000128604						17.0	19.0	18.0					7																	128587589		2108	4170	6278	IRF5	SO:0001630	splice_region_variant	0			-	HGNC		CCDS5808.1, CCDS43645.1, CCDS56512.1	7q32	2008-07-18			ENSG00000128604	ENSG00000128604			6120	protein-coding gene	gene with protein product		607218					Standard	XM_005250317		Approved		uc003vog.3	Q13568	OTTHUMG00000158410	ENST00000402030.2:c.739+1C>A	7.37:g.128587589C>A		Somatic	0	33	0.00		0.6643483795556975	3	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.16	A4D1J8|A8DUA8|A8DUA9|E7EQ16|E7EW54|Q1A7B4|Q64GA9|Q64GB1|Q64GB2|Q6RCM8|Q9BQF0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Interferon_reg_factor-3,pfam_Interferon_reg_fact_DNA-bd_dom,superfamily_SMAD_FHA_domain,smart_Interferon_reg_fact_DNA-bd_dom,prints_Interferon_reg_fact_DNA-bd_dom	p.L263M	ENST00000402030.2	37	c.787	CCDS5808.1	7	.	.	.	.	.	.	.	.	.	.	C	11.45	1.642444	0.29246	.	.	ENSG00000128604	ENST00000357234;ENST00000402030;ENST00000249375;ENST00000473745;ENST00000412326	D;D;D;D	0.95272	-3.66;-3.66;-3.66;-3.66	5.26	-7.45	0.01374	SMAD domain-like (1);SMAD/FHA domain (1);	0.532158	0.15805	N	0.243778	D	0.92570	0.7640	N	0.21282	0.65	0.26611	N	0.97285	D;P	0.76494	0.999;0.779	D;P	0.77557	0.99;0.585	D	0.86621	0.1879	10	0.21540	T	0.41	-0.869	15.9499	0.79827	0.0:0.2802:0.0:0.7198	.	247;263	Q13568;Q13568-2	IRF5_HUMAN;.	M	263;247;247;247;237	ENSP00000349770:L263M;ENSP00000385352:L247M;ENSP00000249375:L247M;ENSP00000419149:L247M	ENSP00000249375:L247M	L	+	1	2	IRF5	128374825	0.000000	0.05858	0.016000	0.15963	0.944000	0.59088	-1.501000	0.02281	-1.664000	0.01479	-0.254000	0.11334	CTG	-	superfamily_SMAD_FHA_domain		0.652	IRF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRF5	protein_coding	OTTHUMT00000350934.1	C	NM_001098627	-	Missense_Mutation	128587589	+1	no_errors	ENST00000357234	ensembl	human	known	74_37	missense	SNP	0.005	A
EPM2A	7957	genome.wustl.edu	37	6	145948787	145948787	+	Missense_Mutation	SNP	G	G	A	rs138798058		TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr6:145948787G>A	ENST00000367519.3	-	4	1286	c.761C>T	c.(760-762)gCg>gTg	p.A254V		NM_005670.3	NP_005661.1	O95278	EPM2A_HUMAN	epilepsy, progressive myoclonus type 2A, Lafora disease (laforin)	254	Tyrosine-protein phosphatase.				autophagy (GO:0006914)|carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen metabolic process (GO:0005977)|habituation (GO:0046959)|inositol phosphate dephosphorylation (GO:0046855)|nervous system development (GO:0007399)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polysome (GO:0005844)	carbohydrate phosphatase activity (GO:0019203)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|starch binding (GO:2001070)			kidney(1)|large_intestine(2)|lung(2)|pancreas(1)|skin(1)	7		Ovarian(120;0.162)		OV - Ovarian serous cystadenocarcinoma(155;3.38e-07)|GBM - Glioblastoma multiforme(68;0.0203)		CTCCAGCAGCGCATGCAGCAG	0.627																																																	0								ENSG00000112425	G	VAL/ALA,VAL/ALA	1,4405	2.1+/-5.4	0,1,2202	44.0	42.0	42.0		761,761	3.8	1.0	6	dbSNP_134	42	0,8600		0,0,4300	no	missense,missense	EPM2A	NM_001018041.1,NM_005670.3	64,64	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign,benign	254/318,254/332	145948787	1,13005	2203	4300	6503	EPM2A	SO:0001583	missense	0			-	HGNC	AF284580	CCDS5206.1	6q24	2011-06-09			ENSG00000112425	ENSG00000112425		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	3413	protein-coding gene	gene with protein product		607566	"""epilepsy, progressive myoclonus type 2, Lafora disease (laforin)"""			9222970, 7485240	Standard	XM_006715564		Approved	LDE, LD	uc003qkw.3	B3EWF7	OTTHUMG00000015747	ENST00000367519.3:c.761C>T	6.37:g.145948787G>A	ENSP00000356489:p.Ala254Val	Somatic	0	34	0.00		0.6643483795556975	16	5.88	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	56	25.33	B3KMU5|B4DRZ2|O95483|Q5T3F5|Q6IS15|Q8IU96|Q8IX24|Q8IX25|Q9BS66|Q9UEN2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Dual-sp_phosphatase_cat-dom,pfam_CBM_fam20,superfamily_Carb-bd-like_fold,smart_Dual-sp_phosphatase_subgr_cat,pfscan_CBM_fam20,pfscan_Tyr/Dual-sp_Pase,pfscan_Dual-sp_phosphatase_subgr_cat	p.A254V	ENST00000367519.3	37	c.761	CCDS5206.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.0|21.0	4.074823|4.074823	0.76415|0.76415	2.27E-4|2.27E-4	0.0|0.0	ENSG00000112425|ENSG00000112425	ENST00000367519;ENST00000392304;ENST00000324857|ENST00000435470	D|.	0.86297|.	-2.1|.	5.72|5.72	3.85|3.85	0.44370|0.44370	Dual specificity phosphatase, catalytic domain (1);Protein-tyrosine/Dual-specificity phosphatase (1);Dual specificity phosphatase, subgroup, catalytic domain (1);|.	0.141111|.	0.64402|.	D|.	0.000005|.	T|T	0.48333|0.48333	0.1494|0.1494	L|L	0.46157|0.46157	1.445|1.445	0.40506|0.40506	D|D	0.980693|0.980693	P;P;B|.	0.44521|.	0.776;0.837;0.174|.	B;B;B|.	0.38880|.	0.284;0.254;0.054|.	T|T	0.48019|0.48019	-0.9071|-0.9071	10|5	0.42905|.	T|.	0.14|.	-20.5894|-20.5894	14.4639|14.4639	0.67470|0.67470	0.0:0.58:0.42:0.0|0.0:0.58:0.42:0.0	.|.	254;254;116|.	O95278;O95278-2;E1P599|.	EPM2A_HUMAN;.;.|.	V|C	254|174	ENSP00000356489:A254V|.	ENSP00000320279:A254V|.	A|R	-|-	2|1	0|0	EPM2A|EPM2A	145990480|145990480	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.828000|0.828000	0.46876|0.46876	4.388000|4.388000	0.59633|0.59633	1.362000|1.362000	0.46000|0.46000	0.557000|0.557000	0.71058|0.71058	GCG|CGC	-	pfam_Dual-sp_phosphatase_cat-dom,smart_Dual-sp_phosphatase_subgr_cat,pfscan_Tyr/Dual-sp_Pase,pfscan_Dual-sp_phosphatase_subgr_cat		0.627	EPM2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	EPM2A	protein_coding	OTTHUMT00000042564.1	G		rs138798058		145948787	-1	no_errors	ENST00000367519	ensembl	human	known	74_37	missense	SNP	1.000	A
MGAM	8972	genome.wustl.edu	37	7	141736023	141736023	+	Missense_Mutation	SNP	C	C	T	rs374646574		TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr7:141736023C>T	ENST00000549489.2	+	17	2109	c.2014C>T	c.(2014-2016)Cgg>Tgg	p.R672W	MGAM_ENST00000475668.2_Missense_Mutation_p.R672W	NM_004668.2	NP_004659.2	O43451	MGA_HUMAN	maltase-glucoamylase (alpha-glucosidase)	672	Maltase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	13	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	GCTCTGTAGGCGGTGGATGCA	0.483																																																	0								ENSG00000257335	C	TRP/ARG	0,3908		0,0,1954	127.0	123.0	125.0		2014	-0.5	0.4	7		125	1,8303		0,1,4151	no	missense	MGAM	NM_004668.2	101	0,1,6105	TT,TC,CC		0.012,0.0,0.0082	probably-damaging	672/1858	141736023	1,12211	1954	4152	6106	MGAM	SO:0001583	missense	0			-	HGNC	AF016833	CCDS47727.1	7q34	2012-10-03			ENSG00000257335	ENSG00000257335			7043	protein-coding gene	gene with protein product		154360				9446624	Standard	NM_004668		Approved	MGA	uc003vwy.3	O43451	OTTHUMG00000158395	ENST00000549489.2:c.2014C>T	7.37:g.141736023C>T	ENSP00000447378:p.Arg672Trp	Somatic	0	56	0.00		0.6643483795556975	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	64	63	50.39	Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Glyco_hydro_31,pfam_P_trefoil,superfamily_Glycoside_hydrolase_SF,superfamily_Gal_mutarotase_SF_dom,smart_P_trefoil	p.R672W	ENST00000549489.2	37	c.2014	CCDS47727.1	7	.	.	.	.	.	.	.	.	.	.	C	19.93	3.918703	0.73098	0.0	1.2E-4	ENSG00000257335	ENST00000549489;ENST00000475668;ENST00000548812	D	0.97430	-4.38	5.34	-0.462	0.12168	Glycoside hydrolase, superfamily (1);	0.000000	0.50627	D	0.000101	D	0.99177	0.9715	H	0.99726	4.73	0.39518	D	0.968466	D	0.89917	1.0	D	0.97110	1.0	D	0.99548	1.0965	10	0.87932	D	0	.	17.0597	0.86543	0.7229:0.2771:0.0:0.0	.	672	O43451	MGA_HUMAN	W	672;672;549	ENSP00000447378:R672W	ENSP00000316431:R549W	R	+	1	2	MGAM	141382492	0.763000	0.28462	0.382000	0.26119	0.965000	0.64279	1.089000	0.30890	-0.197000	0.10350	0.650000	0.86243	CGG	-	pfam_Glyco_hydro_31,superfamily_Glycoside_hydrolase_SF		0.483	MGAM-001	KNOWN	basic|CCDS	protein_coding	MGAM	protein_coding	OTTHUMT00000351244.3	C		-		141736023	+1	no_errors	ENST00000549489	ensembl	human	known	74_37	missense	SNP	0.918	T
OR9K2	441639	genome.wustl.edu	37	12	55524485	55524485	+	Silent	SNP	G	G	A			TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr12:55524485G>A	ENST00000305377.5	+	1	1021	c.933G>A	c.(931-933)ttG>ttA	p.L311L		NM_001005243.1	NP_001005243.1	Q8NGE7	OR9K2_HUMAN	olfactory receptor, family 9, subfamily K, member 2	311						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(3)|central_nervous_system(1)|kidney(3)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(2)	31						TGAATCCTTTGATTTACTCTC	0.348																																																	0								ENSG00000170605						112.0	109.0	110.0					12																	55524485		2203	4300	6503	OR9K2	SO:0001819	synonymous_variant	0			-	HGNC	BK004326	CCDS31814.1	12q13.2	2012-08-09						"""GPCR / Class A : Olfactory receptors"""	15339	protein-coding gene	gene with protein product							Standard	NM_001005243		Approved		uc010spe.2	Q8NGE7	OTTHUMG00000169827	ENST00000305377.5:c.933G>A	12.37:g.55524485G>A		Somatic	0	62	0.00		0.6643483795556975	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	60	26.83	B9EH19|Q6IFD6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L311	ENST00000305377.5	37	c.933	CCDS31814.1	12																																																																																			-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn		0.348	OR9K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR9K2	protein_coding	OTTHUMT00000406105.1	G		-		55524485	+1	no_errors	ENST00000305377	ensembl	human	known	74_37	silent	SNP	0.901	A
HOOK1	51361	genome.wustl.edu	37	1	60338568	60338568	+	Silent	SNP	G	G	A			TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr1:60338568G>A	ENST00000371208.3	+	22	2375	c.2118G>A	c.(2116-2118)gcG>gcA	p.A706A	HOOK1_ENST00000465876.1_3'UTR|HOOK1_ENST00000395561.2_Silent_p.A664A	NM_015888.4	NP_056972.1	Q9UJC3	HOOK1_HUMAN	hook microtubule-tethering protein 1	706	Sufficient for interaction with AKTIP and VPS18.				early endosome to late endosome transport (GO:0045022)|endosome organization (GO:0007032)|endosome to lysosome transport (GO:0008333)|lysosome organization (GO:0007040)|multicellular organismal development (GO:0007275)|protein transport (GO:0015031)|spermatid development (GO:0007286)	FHF complex (GO:0070695)|microtubule (GO:0005874)	identical protein binding (GO:0042802)			biliary_tract(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(14)|ovary(1)|urinary_tract(1)	29	all_cancers(7;0.000129)					CTTTCTTAGCGCAGCAACGGC	0.468																																																	0								ENSG00000134709						33.0	29.0	31.0					1																	60338568		2049	3922	5971	HOOK1	SO:0001819	synonymous_variant	0			-	HGNC	AF044923	CCDS612.1	1p32.1	2013-08-21	2013-08-21		ENSG00000134709	ENSG00000134709			19884	protein-coding gene	gene with protein product		607820	"""hook homolog 1 (Drosophila)"""			9927460	Standard	XM_005270922		Approved	HK1	uc001czo.3	Q9UJC3	OTTHUMG00000008990	ENST00000371208.3:c.2118G>A	1.37:g.60338568G>A		Somatic	0	45	0.00		0.6643483795556975	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	38	6	86.36	A8K8E9|A8MU44|B4DX15|O60561|Q5TG44	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Hook-related_fam,superfamily_Prefoldin	p.A706	ENST00000371208.3	37	c.2118	CCDS612.1	1																																																																																			-	pfam_Hook-related_fam		0.468	HOOK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOOK1	protein_coding	OTTHUMT00000024934.1	G	NM_015888	-		60338568	+1	no_errors	ENST00000371208	ensembl	human	known	74_37	silent	SNP	0.835	A
RAP2C	57826	genome.wustl.edu	37	X	131351130	131351130	+	Missense_Mutation	SNP	A	A	G			TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chrX:131351130A>G	ENST00000342983.2	-	2	913	c.167T>C	c.(166-168)cTg>cCg	p.L56P	RAP2C-AS1_ENST00000421483.2_RNA|RAP2C_ENST00000460462.1_5'UTR|RAP2C_ENST00000370874.1_Missense_Mutation_p.L56P|RAP2C-AS1_ENST00000441399.2_RNA	NM_001271187.1|NM_021183.4	NP_001258116.1|NP_067006.3	Q9Y3L5	RAP2C_HUMAN	RAP2C, member of RAS oncogene family	56					GTP catabolic process (GO:0006184)|negative regulation of cell migration (GO:0030336)|positive regulation of protein autophosphorylation (GO:0031954)|Rap protein signal transduction (GO:0032486)|regulation of protein tyrosine kinase activity (GO:0061097)|regulation of RNA biosynthetic process (GO:2001141)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|transcription coactivator activity (GO:0003713)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|ovary(1)|upper_aerodigestive_tract(2)	8	Acute lymphoblastic leukemia(192;0.000127)					TGCGGTGTCCAGAATTTCCAG	0.463																																																	0								ENSG00000123728						117.0	112.0	113.0					X																	131351130		2203	4300	6503	RAP2C	SO:0001583	missense	0			-	HGNC	BC051467	CCDS14632.1, CCDS76024.1	Xq25	2014-05-09			ENSG00000123728	ENSG00000123728			21165	protein-coding gene	gene with protein product							Standard	NM_001271186		Approved	DKFZp313B211	uc004ewp.4	Q9Y3L5	OTTHUMG00000022424	ENST00000342983.2:c.167T>C	X.37:g.131351130A>G	ENSP00000340274:p.Leu56Pro	Somatic	0	49	0.00		0.6643483795556975	3	91.67	33	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	2	92.59	B3KWD6|Q5H9H9|Q9BTS0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_EF_GTP-bd_dom,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.L56P	ENST00000342983.2	37	c.167	CCDS14632.1	X	.	.	.	.	.	.	.	.	.	.	a	24.8	4.572713	0.86542	.	.	ENSG00000123728	ENST00000342983;ENST00000370874	T;T	0.80738	-1.41;-1.41	5.09	5.09	0.68999	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.92189	0.7523	H	0.94808	3.585	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94175	0.7427	10	0.87932	D	0	.	14.1647	0.65469	1.0:0.0:0.0:0.0	.	56	Q9Y3L5	RAP2C_HUMAN	P	56	ENSP00000340274:L56P;ENSP00000359911:L56P	ENSP00000340274:L56P	L	-	2	0	RAP2C	131178811	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.165000	0.94761	1.791000	0.52520	0.409000	0.27619	CTG	-	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_EF_GTP-bd_dom,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom		0.463	RAP2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAP2C	protein_coding	OTTHUMT00000058312.1	A	NM_021183	-		131351130	-1	no_errors	ENST00000342983	ensembl	human	known	74_37	missense	SNP	1.000	G
RIMBP3	85376	genome.wustl.edu	37	22	20458271	20458271	+	Missense_Mutation	SNP	T	T	C			TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr22:20458271T>C	ENST00000426804.1	-	1	3515	c.3031A>G	c.(3031-3033)Atc>Gtc	p.I1011V	SCARNA17_ENST00000516762.1_RNA|SCARNA18_ENST00000516215.1_RNA|RN7SKP131_ENST00000363006.1_RNA	NM_015672.1	NP_056487.1	Q9UFD9	RIM3A_HUMAN	RIMS binding protein 3	1011	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.									breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(1)|prostate(1)|skin(1)|urinary_tract(1)	13	Colorectal(54;0.0993)|Melanoma(16;0.165)		LUSC - Lung squamous cell carcinoma(15;0.0405)|Lung(15;0.224)			ACCCAGGTGATGTTGGCTGAT	0.602																																																	0								ENSG00000196622						5.0	8.0	7.0					22																	20458271		1603	3705	5308	RIMBP3	SO:0001583	missense	0			-	HGNC	AB051453	CCDS46665.1	22q11.21	2014-05-06			ENSG00000196622	ENSG00000275793			29344	protein-coding gene	gene with protein product		612699				11258795, 17855024	Standard	NM_015672		Approved	KIAA1666, RIMBP3.1, RIMBP3A	uc002zsd.4	Q9UFD9	OTTHUMG00000188355	ENST00000426804.1:c.3031A>G	22.37:g.20458271T>C	ENSP00000391564:p.Ile1011Val	Somatic	0	61	0.00		0.6643483795556975	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	61	26.51	Q8IYP7|Q9BY94|Q9UFQ5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SH3_2,superfamily_SH3_domain,superfamily_Fibronectin_type3,smart_SH3_domain,pfscan_SH3_domain	p.I1011V	ENST00000426804.1	37	c.3031	CCDS46665.1	22	.	.	.	.	.	.	.	.	.	.	T	0.369	-0.934896	0.02340	.	.	ENSG00000196622	ENST00000355186;ENST00000426804	T	0.49432	0.78	3.56	1.38	0.22167	Fibronectin, type III (2);	0.383974	0.24557	N	0.037513	T	0.28863	0.0716	N	0.25144	0.715	0.09310	N	1	B	0.18013	0.025	B	0.22152	0.038	T	0.14980	-1.0453	10	0.30854	T	0.27	-9.3439	6.6067	0.22729	0.0:0.2102:0.0:0.7898	.	917	Q9UFD9	RIM3A_HUMAN	V	917;1011	ENSP00000391564:I1011V	ENSP00000347318:I917V	I	-	1	0	RIMBP3	18838271	0.928000	0.31464	0.004000	0.12327	0.060000	0.15804	0.978000	0.29488	0.116000	0.18110	0.327000	0.21459	ATC	-	superfamily_Fibronectin_type3		0.602	RIMBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RIMBP3	protein_coding	OTTHUMT00000318945.2	T	NM_015672	-		20458271	-1	no_errors	ENST00000426804	ensembl	human	known	74_37	missense	SNP	0.007	C
LHCGR	3973	genome.wustl.edu	37	2	48982755	48982756	+	In_Frame_Ins	INS	-	-	GCTGCA	rs188002889|rs376653903|rs58356637|rs142537840	byFrequency	TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr2:48982755_48982756insGCTGCA	ENST00000294954.7	-	1	76_77	c.55_56insTGCAGC	c.(55-57)ccg>cTGCAGCcg	p.18_19insLQ	LHCGR_ENST00000344775.3_In_Frame_Ins_p.18_19insLQ|STON1-GTF2A1L_ENST00000402114.2_Intron|LHCGR_ENST00000401907.1_In_Frame_Ins_p.18_19insLQ|LHCGR_ENST00000403273.1_In_Frame_Ins_p.18_19insLQ|LHCGR_ENST00000405626.1_In_Frame_Ins_p.18_19insLQ	NM_000233.3	NP_000224.2	P22888	LSHR_HUMAN	luteinizing hormone/choriogonadotropin receptor	18			Q -> QLQ (may be associated with earlier age of onset of breast cancer and poor prognosis). {ECO:0000269|PubMed:9851790, ECO:0000269|PubMed:9858858}.	P -> A (in Ref. 3; AAA70231). {ECO:0000305}.	activation of adenylate cyclase activity (GO:0007190)|cellular response to gonadotropin stimulus (GO:0071371)|cognition (GO:0050890)|development of secondary male sexual characteristics (GO:0046544)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|male genitalia development (GO:0030539)|male gonad development (GO:0008584)|ovarian follicle development (GO:0001541)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of inositol trisphosphate biosynthetic process (GO:0032962)|regulation of steroid hormone biosynthetic process (GO:0090030)|seminiferous tubule development (GO:0072520)|spermatogenesis (GO:0007283)|uterus development (GO:0060065)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	choriogonadotropin hormone binding (GO:0038106)|choriogonadotropin hormone receptor activity (GO:0035472)|luteinizing hormone receptor activity (GO:0004964)			NS(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|liver(1)|lung(23)|ovary(3)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	56		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.176)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Buserelin(DB06719)|Cetrorelix(DB00050)|Choriogonadotropin alfa(DB00097)|Goserelin(DB00014)|Lutropin alfa(DB00044)|Menotropins(DB00032)	TGgcagcggcggctgcagcagc	0.723														724	0.144569	0.1959	0.1455	5008	,	,		10728	0.0139		0.2624	False		,,,				2504	0.0879																0			GRCh37	CI035605	LHCGR	I	rs188002889	ENSG00000138039		,	191,1163		76,39,562					,	-7.2	0.0		dbSNP_130	2	644,2246		207,230,1008	no	intron,coding	LHCGR,STON1-GTF2A1L	NM_001198593.1,NM_000233.3	,	283,269,1570	A1A1,A1R,RR		22.2837,14.1064,19.6748	,	,		835,3409				LHCGR	SO:0001652	inframe_insertion	0				HGNC		CCDS1842.1	2p21	2012-08-10			ENSG00000138039	ENSG00000138039		"""GPCR / Class A : Gonadotropin and TSH receptors"""	6585	protein-coding gene	gene with protein product		152790	"""hypergonadotropic hypogonadism"""	HHG			Standard	NM_000233		Approved	LHR, LCGR, LGR2, ULG5	uc002rwu.4	P22888	OTTHUMG00000129257	ENST00000294954.7:c.50_55dupTGCAGC	2.37:g.48982756_48982761dupGCTGCA	ENSP00000294954:p.Leu17_Gln18dup	Somatic	NA	NA	NA		0.6643483795556975	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q14751|Q15996|Q9UEW9	In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,prints_LSH_rcpt,prints_Gphrmn_rcpt_fam,prints_GPCR_Rhodpsn,prints_TSH_rcpt,pfscan_GPCR_Rhodpsn_7TM	p.19in_frame_insLQ	ENST00000294954.7	37	c.56_55	CCDS1842.1	2																																																																																			-	prints_TSH_rcpt		0.723	LHCGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LHCGR	protein_coding	OTTHUMT00000251364.4	-	NM_000233.3			48982756	-1	no_errors	ENST00000294954	ensembl	human	known	74_37	in_frame_ins	INS	0.000:0.001	GCTGCA
FOXP1	27086	genome.wustl.edu	37	3	71008341	71008342	+	3'UTR	INS	-	-	T	rs543490335|rs398062446|rs112773801|rs202147567	byFrequency	TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr3:71008341_71008342insT	ENST00000318789.4	-	0	2615_2616				FOXP1_ENST00000475937.1_3'UTR|FOXP1_ENST00000491238.1_Intron	NM_001244810.1|NM_001244813.1|NM_032682.5	NP_001231739.1|NP_001231742.1|NP_116071.2	Q9H334	FOXP1_HUMAN	forkhead box P1						negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(8)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	31		Lung NSC(201;4.62e-05)|Prostate(10;0.0181)|Hepatocellular(537;0.186)|Myeloproliferative disorder(1037;0.209)		BRCA - Breast invasive adenocarcinoma(55;1.17e-05)|Epithelial(33;1.39e-05)|LUSC - Lung squamous cell carcinoma(21;2.35e-05)|Lung(16;4.26e-05)		CTTTTGACGTGTTTTTTTTTTT	0.411			T	PAX5	ALL								|||unknown(HR)	1601	0.319688	0.4236	0.1859	5008	,	,		19556	0.4514		0.1342	False		,,,				2504	0.3292							Dom	yes		3	3p14.1	27086	forkhead box P1		L	0								ENSG00000114861																																			FOXP1	SO:0001624	3_prime_UTR_variant	0				HGNC	AF146696	CCDS2914.1, CCDS33785.1, CCDS58837.1, CCDS58838.1, CCDS58839.1, CCDS74963.1, CCDS74964.1	3p14.1	2008-07-18			ENSG00000114861	ENSG00000114861		"""Forkhead boxes"""	3823	protein-coding gene	gene with protein product	"""fork head-related protein like B"", ""glutamine-rich factor 1"", ""PAX5/FOXP1 fusion protein"""	605515				8265594, 11751404	Standard	NM_032682		Approved	QRF1, 12CC4, HSPC215, hFKH1B	uc003doj.3	Q9H334	OTTHUMG00000158803	ENST00000318789.4:c.*57->A	3.37:g.71008352_71008352dupT		Somatic	0	41	0.00		0.6643483795556975	44	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	32	11.11	A3QVP8|B3KV70|G5E9V8|Q8NAN6|Q9BSG9|Q9H332|Q9H333|Q9P0R1	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000318789.4	37	NULL	CCDS2914.1	3																																																																																			-	-		0.411	FOXP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FOXP1	protein_coding	OTTHUMT00000352250.1	-	NM_032682			71008342	-1	no_errors	ENST00000460805	ensembl	human	known	74_37	rna	INS	0.616:0.439	T
TESK2	10420	genome.wustl.edu	37	1	45809609	45809610	+	3'UTR	INS	-	-	A	rs201765742|rs370623280		TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr1:45809609_45809610insA	ENST00000372086.3	-	0	3018_3019				TOE1_ENST00000372090.5_3'UTR|TESK2_ENST00000341771.6_3'UTR|TESK2_ENST00000486676.1_5'UTR|TOE1_ENST00000495703.1_3'UTR|TESK2_ENST00000372084.1_3'UTR	NM_007170.2	NP_009101.2	Q96S53	TESK2_HUMAN	testis-specific kinase 2						actin cytoskeleton organization (GO:0030036)|focal adhesion assembly (GO:0048041)|protein phosphorylation (GO:0006468)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|liver(1)|lung(9)|ovary(2)|pancreas(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	32	Acute lymphoblastic leukemia(166;0.155)					GAAAGTTTTACAAAAAAAAAAA	0.366																																																	0								ENSG00000070759																																			TESK2	SO:0001624	3_prime_UTR_variant	0				HGNC	AJ132545	CCDS41323.1	1p32	2010-04-27			ENSG00000070759	ENSG00000070759	2.7.12.1		11732	protein-coding gene	gene with protein product		604746				10512679	Standard	NM_007170		Approved		uc001cns.1	Q96S53	OTTHUMG00000007680	ENST00000372086.3:c.*903->T	1.37:g.45809620_45809620dupA		Somatic	0	40	0.00		0.6643483795556975	23	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	45	11.76	Q5T422|Q5T423|Q8N520|Q9Y3Q6	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000372086.3	37	NULL	CCDS41323.1	1																																																																																			-	-		0.366	TESK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TESK2	protein_coding	OTTHUMT00000020523.1	-	NM_007170			45809610	-1	no_errors	ENST00000486676	ensembl	human	known	74_37	rna	INS	0.501:0.794	A
TTN	7273	genome.wustl.edu	37	2	179623770	179623770	+	Missense_Mutation	SNP	G	G	T			TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr2:179623770G>T	ENST00000591111.1	-	44	10468	c.10244C>A	c.(10243-10245)aCg>aAg	p.T3415K	TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000590773.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.T3415K|TTN-AS1_ENST00000578746.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.T3415K|TTN_ENST00000360870.5_Missense_Mutation_p.T3415K|TTN-AS1_ENST00000610005.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.T3369K|TTN_ENST00000460472.2_Missense_Mutation_p.T3369K|TTN_ENST00000342175.6_Missense_Mutation_p.T3369K			Q8WZ42	TITIN_HUMAN	titin	13731	Ig-like 20.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGCAACAAACGTGTAAGTTCC	0.383																																																	0								ENSG00000155657						144.0	131.0	135.0					2																	179623770		2203	4300	6503	TTN	SO:0001583	missense	0			-	HGNC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.10244C>A	2.37:g.179623770G>T	ENSP00000465570:p.Thr3415Lys	Somatic	0	37	0.00		0.6643483795556975	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	8	74.19	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.T3415K	ENST00000591111.1	37	c.10244		2	.	.	.	.	.	.	.	.	.	.	G	16.21	3.058009	0.55325	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870;ENST00000446208	T;T;T;T;T	0.68903	-0.36;-0.36;-0.36;-0.36;-0.36	5.92	5.92	0.95590	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.61198	0.2328	L	0.33093	0.98	0.30576	N	0.762973	B;B;B;B;P	0.37612	0.004;0.004;0.034;0.01;0.602	B;B;B;B;B	0.35240	0.013;0.013;0.029;0.029;0.198	T	0.66340	-0.5948	9	0.87932	D	0	.	20.3214	0.98679	0.0:0.0:1.0:0.0	.	3369;3369;3369;3415;3415	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	K	3415;3369;3369;3369;3369;3415;20	ENSP00000343764:T3415K;ENSP00000434586:T3369K;ENSP00000340554:T3369K;ENSP00000352154:T3369K;ENSP00000354117:T3415K	ENSP00000340554:T3369K	T	-	2	0	TTN	179332015	1.000000	0.71417	0.976000	0.42696	0.963000	0.63663	7.822000	0.86651	2.804000	0.96469	0.655000	0.94253	ACG	-	pfam_Ig_I-set,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.383	TTN-019	PUTATIVE	basic	protein_coding	TTN	protein_coding	OTTHUMT00000460310.1	G	NM_133378	-		179623770	-1	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	SNP	1.000	T
AC008836.1	0	genome.wustl.edu	37	5	60853135	60853135	+	RNA	SNP	T	T	A			TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr5:60853135T>A	ENST00000411268.1	+	0	26																											TTTAttaggttggtgcaaaag	0.313																																																	0								ENSG00000223200																																			AC008836.1			0			-	Clone_based_ensembl_gene																													5.37:g.60853135T>A		Somatic	0	22	0.00		0.6643483795556975	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	24	22.58		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000411268.1	37	NULL		5																																																																																			-	-		0.313	AC008836.1-201	NOVEL	basic	miRNA	ENSG00000223200	miRNA		T		-		60853135	+1	no_errors	ENST00000411268	ensembl	human	novel	74_37	rna	SNP	0.281	A
SCN11A	11280	genome.wustl.edu	37	3	38948822	38948841	+	Intron	DEL	TGTGTGTGTGTGTATATATC	TGTGTGTGTGTGTATATATC	-	rs138466233|rs371006611|rs200809384|rs62242293	byFrequency	TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	TGTGTGTGTGTGTATATATC	TGTGTGTGTGTGTATATATC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr3:38948822_38948841delTGTGTGTGTGTGTATATATC	ENST00000302328.3	-	10	1672				SCN11A_ENST00000444237.2_Intron|SCN11A_ENST00000450244.1_Intron|SCN11A_ENST00000456224.3_Intron|AC116038.1_ENST00000401122.1_RNA	NM_014139.2	NP_054858.2	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha subunit						cell death (GO:0008219)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(3)|biliary_tract(1)|breast(4)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|lung(29)|ovary(3)|pancreas(2)|prostate(12)|skin(14)|upper_aerodigestive_tract(5)|urinary_tract(3)	119				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)|Valproic Acid(DB00313)|Zonisamide(DB00909)	tgtgtgtgtgtgtgtgtgtgtgtATATATCTATATATaca	0.386																																																	0								ENSG00000215941																																			AC116038.1	SO:0001627	intron_variant	0				Clone_based_ensembl_gene	AF126739	CCDS33737.1	3p22.2	2012-02-26	2007-01-23		ENSG00000168356	ENSG00000168356		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10583	protein-coding gene	gene with protein product		604385	"""sodium channel, voltage-gated, type XI, alpha polypeptide"", ""sodium channel, voltage-gated, type XII, alpha"""	SCN12A		10444332, 16382098	Standard	NM_014139		Approved	Nav1.9, NaN, SNS-2	uc021wvy.1	Q9UI33	OTTHUMG00000048246	ENST00000302328.3:c.1473+598GATATATACACACACACACA>-	3.37:g.38948822_38948841delTGTGTGTGTGTGTATATATC		Somatic	NA	NA	NA		0.6643483795556975	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A6NN05|C9JD48|C9JR31|Q68K15|Q8NDX3|Q9UHE0|Q9UHM0	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000302328.3	37	NULL	CCDS33737.1	3																																																																																			-	-		0.386	SCN11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000215941	protein_coding	OTTHUMT00000109746.4	TGTGTGTGTGTGTATATATC	NM_014139			38948841	+1	no_errors	ENST00000401122	ensembl	human	novel	74_37	rna	DEL	0.193:0.195:0.137:0.126:0.125:0.119:0.107:0.069:0.062:0.049:0.028:0.020:0.007:0.002:0.001:0.001:0.002:0.002:0.002:0.001	-
FAM27B	100133121	genome.wustl.edu	37	9	67793683	67793684	+	Intron	INS	-	-	CT			TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr9:67793683_67793684insCT	ENST00000377484.3	-	1	215				RP11-12A20.7_ENST00000315762.5_RNA			Q5VT28	FAM27_HUMAN	family with sequence similarity 27, member B																		acacacacacacactcacacac	0.515																																																	0								ENSG00000236233																																			RP11-12A20.7	SO:0001627	intron_variant	0				Clone_based_vega_gene			9q13	2014-05-06			ENSG00000170215	ENSG00000278763			23667	other	unknown							Standard	NR_027422		Approved	bA12A20.3, FAM27A2	uc004aet.4	Q5VT28	OTTHUMG00000188586	ENST00000377484.3:c.78+212->AG	9.37:g.67793683_67793684insCT		Somatic	0	16	0.00		0.6643483795556975	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	15	31.82		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000377484.3	37	NULL		9																																																																																			-	-		0.515	FAM27B-001	KNOWN	basic|appris_principal	protein_coding	ENSG00000236233	protein_coding	OTTHUMT00000037106.1	-	NR_027422			67793684	+1	no_errors	ENST00000315762	ensembl	human	known	74_37	rna	INS	0.063:0.065	CT
FRMPD2	143162	genome.wustl.edu	37	10	49371536	49371536	+	Missense_Mutation	SNP	T	T	C			TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr10:49371536T>C	ENST00000374201.3	-	28	4018	c.3716A>G	c.(3715-3717)cAa>cGa	p.Q1239R	FRMPD2_ENST00000407470.4_Missense_Mutation_p.Q1207R|FRMPD2_ENST00000474573.1_Missense_Mutation_p.Q191R|FRMPD2_ENST00000305531.3_Missense_Mutation_p.Q1214R|FRMPD2_ENST00000463706.1_5'UTR	NM_001018071.3|NM_001042512.2	NP_001018081|NP_001035977.2	Q68DX3	FRPD2_HUMAN	FERM and PDZ domain containing 2	1239					tight junction assembly (GO:0070830)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|tight junction (GO:0005923)	1-phosphatidylinositol binding (GO:0005545)			NS(2)|autonomic_ganglia(2)|breast(5)|cervix(1)|endometrium(3)|kidney(7)|large_intestine(15)|lung(24)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	66				Kidney(211;0.201)		CTCTCTGTTTTGGCCCCATTG	0.547																																																	0								ENSG00000170324						1.0	1.0	1.0					10																	49371536		501	1145	1646	FRMPD2	SO:0001583	missense	0			-	HGNC	AK123038	CCDS31195.1	10q11	2010-10-13			ENSG00000170324	ENSG00000170324			28572	protein-coding gene	gene with protein product		613323	"""PDZ domain containing 5C"""	PDZD5C, PDZK5C			Standard	NM_001018071		Approved	MGC35285	uc001jdv.3	Q68DX3	OTTHUMG00000018171	ENST00000374201.3:c.3716A>G	10.37:g.49371536T>C	ENSP00000363317:p.Gln1239Arg	Somatic	0	36	0.00		0.6643483795556975	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	19	41.18	B7WNW0|B7ZML5|Q2VY07|Q6GMQ9|Q6ZN38|Q6ZWI2|Q8N5T9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PDZ,pfam_FERM_central,pfam_FERM_PH-like_C,pfam_FERM_N,superfamily_PDZ,superfamily_FERM_central,superfamily_Kinase-like_dom,smart_KIND,smart_Band_41_domain,smart_PDZ,pfscan_FERM_domain,pfscan_PDZ,prints_Band_41_fam	p.Q1239R	ENST00000374201.3	37	c.3716	CCDS31195.1	10	.	.	.	.	.	.	.	.	.	.	T	9.600	1.128464	0.21041	.	.	ENSG00000170324	ENST00000474573;ENST00000374201;ENST00000305531;ENST00000407470	T;T;T;T	0.64260	3.62;-0.05;-0.09;-0.09	3.42	0.767	0.18482	.	.	.	.	.	T	0.40791	0.1131	N	0.17082	0.46	0.09310	N	1	B;B;B;B;B	0.11235	0.002;0.002;0.001;0.002;0.004	B;B;B;B;B	0.11329	0.006;0.004;0.002;0.004;0.004	T	0.23440	-1.0188	9	0.34782	T	0.22	.	5.4707	0.16668	0.0:0.3725:0.0:0.6275	.	191;1214;1239;1207;250	Q68DX3-5;Q68DX3-2;Q68DX3;F8WCT2;Q68DX3-4	.;.;FRPD2_HUMAN;.;.	R	191;1239;1214;1207	ENSP00000422446:Q191R;ENSP00000363317:Q1239R;ENSP00000307079:Q1214R;ENSP00000384339:Q1207R	ENSP00000307079:Q1214R	Q	-	2	0	FRMPD2	49041542	0.000000	0.05858	0.025000	0.17156	0.210000	0.24377	-0.560000	0.05964	0.381000	0.24851	0.454000	0.30748	CAA	-	NULL		0.547	FRMPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRMPD2	protein_coding	OTTHUMT00000047923.3	T	NM_152428	-		49371536	-1	no_errors	ENST00000374201	ensembl	human	known	74_37	missense	SNP	0.011	C
C12orf66	144577	genome.wustl.edu	37	12	64588028	64588028	+	Missense_Mutation	SNP	G	G	T			TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr12:64588028G>T	ENST00000398055.3	-	3	985	c.932C>A	c.(931-933)gCc>gAc	p.A311D	C12orf66_ENST00000544871.1_Missense_Mutation_p.A258D|C12orf66_ENST00000311915.8_Missense_Mutation_p.A311D	NM_152440.4	NP_689653	Q96MD2	CL066_HUMAN	chromosome 12 open reading frame 66	311										central_nervous_system(1)|large_intestine(1)|lung(2)|ovary(1)	5						GGACACATTGGCAGCATCATA	0.448																																																	0								ENSG00000174206						97.0	91.0	93.0					12																	64588028		1845	4096	5941	C12orf66	SO:0001583	missense	0			-	HGNC		CCDS41803.1, CCDS73490.1	12q14.2	2008-08-08			ENSG00000174206	ENSG00000174206			26517	protein-coding gene	gene with protein product						12477932	Standard	NM_152440		Approved	FLJ32549	uc001srw.4	Q96MD2	OTTHUMG00000168763	ENST00000398055.3:c.932C>A	12.37:g.64588028G>T	ENSP00000381132:p.Ala311Asp	Somatic	0	29	0.00		0.6643483795556975	8	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52	C9JX54|Q8IYA0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF2003	p.A311D	ENST00000398055.3	37	c.932	CCDS41803.1	12	.	.	.	.	.	.	.	.	.	.	G	7.096	0.573064	0.13623	.	.	ENSG00000174206	ENST00000311915;ENST00000544871;ENST00000398055	T;T;T	0.34667	1.35;1.35;1.35	6.07	6.07	0.98685	.	0.245141	0.48767	D	0.000165	T	0.40347	0.1113	L	0.47716	1.5	0.35750	D	0.819356	B;B	0.20887	0.039;0.049	B;B	0.42653	0.394;0.107	T	0.49899	-0.8890	9	.	.	.	-22.8935	7.9988	0.30284	0.1837:0.0:0.8163:0.0	.	258;311	F5H2Q3;Q96MD2	.;CL066_HUMAN	D	311;258;311	ENSP00000311486:A311D;ENSP00000445481:A258D;ENSP00000381132:A311D	.	A	-	2	0	C12orf66	62874295	1.000000	0.71417	1.000000	0.80357	0.791000	0.44710	4.112000	0.57845	2.885000	0.99019	0.655000	0.94253	GCC	-	pfam_DUF2003		0.448	C12orf66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C12orf66	protein_coding	OTTHUMT00000400921.1	G	NM_152440	-		64588028	-1	no_errors	ENST00000398055	ensembl	human	known	74_37	missense	SNP	1.000	T
PKHD1	5314	genome.wustl.edu	37	6	51923201	51923201	+	Missense_Mutation	SNP	G	G	T			TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr6:51923201G>T	ENST00000371117.3	-	16	1707	c.1432C>A	c.(1432-1434)Ctg>Atg	p.L478M	PKHD1_ENST00000340994.4_Missense_Mutation_p.L478M	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	478					cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					TCAGGATTCAGCCAGGTGTTG	0.552																																																	0								ENSG00000170927						183.0	167.0	172.0					6																	51923201		2203	4300	6503	PKHD1	SO:0001583	missense	0			-	HGNC	AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.1432C>A	6.37:g.51923201G>T	ENSP00000360158:p.Leu478Met	Somatic	0	32	0.00		0.6643483795556975	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	54	31.65	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_IPT,pfam_G8_domain,superfamily_Ig_E-set,superfamily_Pectin_lyase_fold/virulence,smart_IPT,smart_PbH1	p.L478M	ENST00000371117.3	37	c.1432	CCDS4935.1	6	.	.	.	.	.	.	.	.	.	.	G	19.11	3.764158	0.69878	.	.	ENSG00000170927	ENST00000371117;ENST00000340994;ENST00000393616	D;D	0.88431	-2.38;-2.38	5.94	4.13	0.48395	.	0.000000	0.56097	D	0.000032	D	0.90577	0.7046	M	0.73598	2.24	0.28944	N	0.890791	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.85596	0.1249	10	0.34782	T	0.22	.	12.5954	0.56465	0.1372:0.0:0.8628:0.0	.	478;478	P08F94-2;P08F94	.;PKHD1_HUMAN	M	478	ENSP00000360158:L478M;ENSP00000341097:L478M	ENSP00000341097:L478M	L	-	1	2	PKHD1	52031160	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.985000	0.49362	0.811000	0.34303	0.650000	0.86243	CTG	-	NULL		0.552	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PKHD1	protein_coding	OTTHUMT00000040893.1	G	NM_138694	-		51923201	-1	no_errors	ENST00000371117	ensembl	human	known	74_37	missense	SNP	1.000	T
QRICH1	54870	genome.wustl.edu	37	3	49114374	49114374	+	Missense_Mutation	SNP	C	C	A			TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr3:49114374C>A	ENST00000395443.2	-	2	549	c.77G>T	c.(76-78)aGg>aTg	p.R26M	QRICH1_ENST00000424300.1_Missense_Mutation_p.R26M|QRICH1_ENST00000357496.2_Missense_Mutation_p.R26M	NM_198880.1	NP_942581.1	Q2TAL8	QRIC1_HUMAN	glutamine-rich 1	26	CARD.					nucleus (GO:0005634)				breast(2)|endometrium(5)|large_intestine(8)|lung(8)|ovary(1)|skin(1)	25				BRCA - Breast invasive adenocarcinoma(193;8.88e-05)|Kidney(197;0.00239)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)		TTCCTTCATCCTGTGTTGCGG	0.512																																																	0								ENSG00000198218						128.0	124.0	125.0					3																	49114374		2203	4300	6503	QRICH1	SO:0001583	missense	0			-	HGNC		CCDS2787.1	3p21.31	2011-06-03			ENSG00000198218	ENSG00000198218			24713	protein-coding gene	gene with protein product						12477932	Standard	NM_017730		Approved	FLJ20259	uc003cvv.3	Q2TAL8	OTTHUMG00000156772	ENST00000395443.2:c.77G>T	3.37:g.49114374C>A	ENSP00000378830:p.Arg26Met	Somatic	0	43	0.00		0.6643483795556975	21	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	40	9.09	Q4G0F7|Q7L621|Q8TEA5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF3504,superfamily_DEATH-like_dom	p.R26M	ENST00000395443.2	37	c.77	CCDS2787.1	3	.	.	.	.	.	.	.	.	.	.	C	24.2	4.502553	0.85176	.	.	ENSG00000198218	ENST00000395443;ENST00000357496;ENST00000424300;ENST00000437939;ENST00000450685;ENST00000411682;ENST00000430979	T;T;T;T;T;T;T	0.55234	0.53;0.53;0.53;0.53;0.53;0.53;0.53	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	T	0.52933	0.1765	N	0.24115	0.695	0.58432	D	0.999997	D	0.56968	0.978	P	0.51415	0.669	T	0.58831	-0.7567	10	0.87932	D	0	.	19.2513	0.93926	0.0:1.0:0.0:0.0	.	26	Q2TAL8	QRIC1_HUMAN	M	26	ENSP00000378830:R26M;ENSP00000350094:R26M;ENSP00000412890:R26M;ENSP00000416133:R26M;ENSP00000413051:R26M;ENSP00000412870:R26M;ENSP00000405505:R26M	ENSP00000350094:R26M	R	-	2	0	QRICH1	49089378	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.797000	0.55514	2.556000	0.86216	0.655000	0.94253	AGG	-	superfamily_DEATH-like_dom		0.512	QRICH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	QRICH1	protein_coding	OTTHUMT00000345669.1	C	NM_017730	-		49114374	-1	no_errors	ENST00000357496	ensembl	human	known	74_37	missense	SNP	1.000	A
EOGT	285203	genome.wustl.edu	37	3	69026829	69026829	+	Silent	SNP	A	A	G			TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr3:69026829A>G	ENST00000383701.3	-	18	2266	c.1524T>C	c.(1522-1524)gcT>gcC	p.A508A	EOGT_ENST00000540764.1_Silent_p.A407A|EOGT_ENST00000540955.1_Silent_p.A232A|EOGT_ENST00000295571.5_Silent_p.A424A	NM_001278689.1	NP_001265618.1	Q5NDL2	EOGT_HUMAN	EGF domain-specific O-linked N-acetylglucosamine (GlcNAc) transferase	508					protein O-linked glycosylation (GO:0006493)	endoplasmic reticulum (GO:0005783)	protein N-acetylglucosaminyltransferase activity (GO:0016262)										CGTGGTCTGCAGCCTGAAGGA	0.428																																																	0								ENSG00000163378						111.0	109.0	110.0					3																	69026829		2203	4300	6503	EOGT	SO:0001819	synonymous_variant	0			-	HGNC	AK091089	CCDS2908.1, CCDS63684.1	3p14.1	2013-10-11	2012-05-21	2012-05-21	ENSG00000163378	ENSG00000163378	2.4.1.255		28526	protein-coding gene	gene with protein product	"""AER61 glycosyltransferase"""	614789	"""chromosome 3 open reading frame 64"""	C3orf64		22310717	Standard	NM_001278689		Approved	AER61, FLJ33770	uc003dnk.3	Q5NDL2	OTTHUMG00000156279	ENST00000383701.3:c.1524T>C	3.37:g.69026829A>G		Somatic	0	57	0.00		0.6643483795556975	0	100.00	16	WXS	Illumina HiSeq 2500	Phase_IV	tier1	76	8	90.48	A8K2U1|B4DFH5|L7X1M5|Q6MZY0|Q6P985|Q6ZTV0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Glycosyltransferase_AER61	p.A508	ENST00000383701.3	37	c.1524		3																																																																																			-	NULL		0.428	EOGT-002	KNOWN	basic|appris_principal	protein_coding	EOGT	protein_coding	OTTHUMT00000343722.1	A	NM_173654	-		69026829	-1	no_errors	ENST00000383701	ensembl	human	known	74_37	silent	SNP	0.997	G
CCDC168	643677	genome.wustl.edu	37	13	103386903	103386903	+	Missense_Mutation	SNP	C	C	A			TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr13:103386903C>A	ENST00000322527.2	-	1	2256	c.2257G>T	c.(2257-2259)Gat>Tat	p.D753Y		NM_001146197.1	NP_001139669.1	Q8NDH2	CC168_HUMAN	coiled-coil domain containing 168	753																	AAAGTTATATCTGTGCCTCTC	0.398																																																	0								ENSG00000175820						400.0	289.0	323.0					13																	103386903		692	1591	2283	CCDC168	SO:0001583	missense	0			-	HGNC		CCDS73596.1	13q33.1	2014-06-17	2011-08-09	2011-08-09	ENSG00000175820	ENSG00000175820			26851	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 40"""	C13orf40			Standard	NM_001146197		Approved	FLJ40176	uc001vpm.3	Q8NDH2	OTTHUMG00000187287	ENST00000322527.2:c.2257G>T	13.37:g.103386903C>A	ENSP00000320232:p.Asp753Tyr	Somatic	0	22	0.00		0.6643483795556975	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	0	100.00	Q8N800	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.D753Y	ENST00000322527.2	37	c.2257		13	.	.	.	.	.	.	.	.	.	.	C	10.33	1.320030	0.23994	.	.	ENSG00000175820	ENST00000322527	T	0.10288	2.89	3.99	1.17	0.20885	.	.	.	.	.	T	0.06917	0.0176	N	0.19112	0.55	0.09310	N	1	P	0.35844	0.524	B	0.38500	0.275	T	0.33369	-0.9871	9	0.62326	D	0.03	.	2.3269	0.04225	0.2006:0.4962:0.1944:0.1088	.	753	Q8NDH2	CC168_HUMAN	Y	753	ENSP00000320232:D753Y	ENSP00000320232:D753Y	D	-	1	0	CCDC168	102184904	0.000000	0.05858	0.000000	0.03702	0.329000	0.28539	0.103000	0.15292	0.207000	0.20607	0.563000	0.77884	GAT	-	NULL		0.398	CCDC168-201	KNOWN	basic|appris_principal	protein_coding	CCDC168	protein_coding		C	NM_001146197	-		103386903	-1	no_errors	ENST00000322527	ensembl	human	known	74_37	missense	SNP	0.000	A
ROBO2	6092	genome.wustl.edu	37	3	77651591	77651591	+	Missense_Mutation	SNP	G	G	T	rs144253225		TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr3:77651591G>T	ENST00000461745.1	+	20	3985	c.3085G>T	c.(3085-3087)Gat>Tat	p.D1029Y	ROBO2_ENST00000487694.3_Missense_Mutation_p.D1045Y|ROBO2_ENST00000332191.8_Missense_Mutation_p.D1029Y	NM_002942.4	NP_002933.1	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2 (Drosophila)	1029					apoptotic process involved in luteolysis (GO:0061364)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|cellular response to hormone stimulus (GO:0032870)|central nervous system development (GO:0007417)|homophilic cell adhesion (GO:0007156)|metanephros development (GO:0001656)|negative regulation of negative chemotaxis (GO:0050925)|negative regulation of synapse assembly (GO:0051964)|olfactory bulb interneuron development (GO:0021891)|positive regulation of axonogenesis (GO:0050772)|retinal ganglion cell axon guidance (GO:0031290)|ureteric bud development (GO:0001657)	axolemma (GO:0030673)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)	p.D1029N(1)|p.D1045N(1)		NS(1)|biliary_tract(5)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(23)|liver(1)|lung(52)|ovary(2)|pancreas(2)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	117				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)		GCAAAAAACAGATCTGATGGG	0.423																																																	2	Substitution - Missense(2)	skin(2)						ENSG00000185008						114.0	107.0	109.0					3																	77651591		1916	4137	6053	ROBO2	SO:0001583	missense	0			-	HGNC	AF040991	CCDS43109.1, CCDS54609.1	3p12.3	2013-02-11	2001-11-28		ENSG00000185008	ENSG00000185008		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10250	protein-coding gene	gene with protein product		602431	"""roundabout (axon guidance receptor, Drosophila) homolog 2"""			9458045	Standard	NM_002942		Approved	KIAA1568	uc003dpy.4	Q9HCK4	OTTHUMG00000158935	ENST00000461745.1:c.3085G>T	3.37:g.77651591G>T	ENSP00000417164:p.Asp1029Tyr	Somatic	0	40	0.00		0.6643483795556975	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	14	41.67	O43608|Q19AB4|Q19AB5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.D1029Y	ENST00000461745.1	37	c.3085	CCDS43109.1	3	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	17.55|17.55|17.55	3.418281|3.418281|3.418281	0.62622|0.62622|0.62622	.|.|.	.|.|.	ENSG00000185008|ENSG00000185008|ENSG00000185008	ENST00000487694;ENST00000403211;ENST00000343019;ENST00000461745;ENST00000332191|ENST00000490991|ENST00000471893	T;T;T|.|.	0.62364|.|.	0.03;0.07;0.06|.|.	5.84|5.84|5.84	5.84|5.84|5.84	0.93424|0.93424|0.93424	.|.|.	0.000000|.|.	0.47455|.|.	D|.|.	0.000232|.|.	T|T|T	0.64204|0.64204|0.64204	0.2577|0.2577|0.2577	L|L|L	0.29908|0.29908|0.29908	0.895|0.895|0.895	0.34319|.|.	D|.|.	0.686377|.|.	D;D;D|.|.	0.57571|.|.	0.98;0.98;0.98|.|.	P;P;P|.|.	0.56700|.|.	0.641;0.804;0.641|.|.	T|T|T	0.57289|0.57289|0.57289	-0.7837|-0.7837|-0.7837	9|4|4	0.56958|.|.	D|.|.	0.05|.|.	.|.|.	20.1432|20.1432|20.1432	0.98067|0.98067|0.98067	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.|.	1045;1029;1029|.|.	Q19AB5;F8W703;Q9HCK4|.|.	.;.;ROBO2_HUMAN|.|.	Y|H|I	1045;1045;1049;1029;1029|185|103	ENSP00000417335:D1045Y;ENSP00000417164:D1029Y;ENSP00000327536:D1029Y|.|.	ENSP00000327536:D1029Y|.|.	D|Q|R	+|+|+	1|3|2	0|2|0	ROBO2|ROBO2|ROBO2	77734281|77734281|77734281	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.998000|0.998000|0.998000	0.95712|0.95712|0.95712	9.476000|9.476000|9.476000	0.97823|0.97823|0.97823	2.769000|2.769000|2.769000	0.95229|0.95229|0.95229	0.561000|0.561000|0.561000	0.74099|0.74099|0.74099	GAT|CAG|AGA	-	NULL		0.423	ROBO2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ROBO2	protein_coding	OTTHUMT00000352600.2	G	XM_031246	-		77651591	+1	no_errors	ENST00000461745	ensembl	human	known	74_37	missense	SNP	1.000	T
NIFKP6	100132796	genome.wustl.edu	37	19	51906690	51906690	+	lincRNA	SNP	G	G	T			TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr19:51906690G>T	ENST00000600765.1	+	0	345																											TGGGTTATGTGCTTGCAAACC	0.473																																																	0								ENSG00000268889																																			CTD-2616J11.14			0			-	Clone_based_vega_gene																													19.37:g.51906690G>T		Somatic	0	35	0.00		0.6643483795556975	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	39	9.30		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000600765.1	37	NULL		19																																																																																			-	-		0.473	CTD-2616J11.14-001	KNOWN	basic	lincRNA	ENSG00000268889	lincRNA	OTTHUMT00000465204.1	G		-		51906690	+1	no_errors	ENST00000600765	ensembl	human	known	74_37	rna	SNP	0.001	T
GOLGB1	2804	genome.wustl.edu	37	3	121448877	121448877	+	Intron	DEL	A	A	-			TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr3:121448877delA	ENST00000340645.5	-	3	222				GOLGB1_ENST00000472829.1_5'UTR|GOLGB1_ENST00000393667.3_Intron	NM_001256487.1|NM_001256488.1|NM_004487.4	NP_001243416.1|NP_001243417.1|NP_004478.3	Q14789	GOGB1_HUMAN	golgin B1						Golgi organization (GO:0007030)	cis-Golgi network (GO:0005801)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(2)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(26)|liver(2)|lung(36)|ovary(7)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(13)	119				GBM - Glioblastoma multiforme(114;0.0989)		AATATTTAGGAAAAAAGTTGC	0.373																																																	0								ENSG00000173230						46.0	43.0	44.0					3																	121448877		2203	4300	6503	GOLGB1	SO:0001627	intron_variant	0				HGNC	X75304	CCDS3004.1, CCDS58847.1, CCDS74989.1	3q13	2010-02-12	2010-02-12	2007-07-27	ENSG00000173230	ENSG00000173230			4429	protein-coding gene	gene with protein product	"""macrogolgin"", ""golgi integral membrane protein 1"""	602500	"""golgi autoantigen, golgin subfamily b, macrogolgin (with transmembrane signal), 1"", ""golgin B1, golgi integral membrane protein"""			7691276, 15004235	Standard	NM_001256486		Approved	GCP, GCP372, giantin, GOLIM1	uc010hrc.4	Q14789	OTTHUMG00000159411	ENST00000340645.5:c.97-13T>-	3.37:g.121448877delA		Somatic	0	28	0.00		0.6643483795556975	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	17	10.53	B2ZZ91|D3DN92|E7EP74|Q14398	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000340645.5	37	NULL	CCDS3004.1	3																																																																																			-	-		0.373	GOLGB1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GOLGB1	protein_coding	OTTHUMT00000355159.1	A	NM_004487			121448877	-1	no_errors	ENST00000472829	ensembl	human	known	74_37	rna	DEL	0.000	-
GUCY2EP	390226	genome.wustl.edu	37	11	76415291	76415291	+	lincRNA	SNP	G	G	A			TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr11:76415291G>A	ENST00000533588.1	+	0	904				GUCY2EP_ENST00000526984.1_RNA																							GGTCCTCCAGGTTCTGGGAAT	0.502																																																	0								ENSG00000204529																																			GUCY2EP			0			-	HGNC																													11.37:g.76415291G>A		Somatic	0	42	0.00		0.6643483795556975	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	99	44	69.23		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000533588.1	37	NULL		11																																																																																			-	-		0.502	RP11-672A2.3-001	KNOWN	basic|exp_conf	lincRNA	GUCY2EP	lincRNA	OTTHUMT00000383015.2	G		-		76415291	-1	no_errors	ENST00000526984	ensembl	human	known	74_37	rna	SNP	0.995	A
SPEG	10290	genome.wustl.edu	37	2	220330645	220330656	+	Intron	DEL	GCGCGCGTGTGC	GCGCGCGTGTGC	-	rs370532066|rs1976618	byFrequency	TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	GCGCGCGTGTGC	GCGCGCGTGTGC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr2:220330645_220330656delGCGCGCGTGTGC	ENST00000312358.7	+	10	3013				SPEG_ENST00000396686.1_Intron|SPEG_ENST00000485813.1_Intron|SPEG_ENST00000396689.2_Intron|SPEG_ENST00000396688.1_Intron|SPEG_ENST00000396695.2_Intron|SPEG_ENST00000396698.1_Intron	NM_005876.4	NP_005867.3	Q15772	SPEG_HUMAN	SPEG complex locus						cardiac muscle cell development (GO:0055013)|in utero embryonic development (GO:0001701)|muscle organ development (GO:0007517)|negative regulation of cell proliferation (GO:0008285)|respiratory system development (GO:0060541)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(3)|endometrium(10)|kidney(2)|large_intestine(9)|lung(42)|ovary(5)|pancreas(1)|prostate(8)|skin(1)|stomach(9)|upper_aerodigestive_tract(4)|urinary_tract(4)	100		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		gtgtgtgtgtgcgcgcgtgtgcgtgcacgtgt	0.604																																																	0								ENSG00000072195																																			SPEG	SO:0001627	intron_variant	0				HGNC	BC006346	CCDS42824.1, CCDS54432.1	2q35	2013-01-11	2006-04-27	2006-04-27	ENSG00000072195	ENSG00000072195		"""Immunoglobulin superfamily / I-set domain containing"""	16901	protein-coding gene	gene with protein product		615950	"""aortic preferentially expressed gene 1"""	APEG1		8663449, 10973969	Standard	NM_005876		Approved	MGC12676, KIAA1297, SPEGalpha, SPEGbeta, BPEG	uc010fwg.3	Q15772	OTTHUMG00000058925	ENST00000312358.7:c.2882-1240GCGCGCGTGTGC>-	2.37:g.220330645_220330656delGCGCGCGTGTGC		Somatic	NA	NA	NA		0.6643483795556975	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A8K0G6|A8MRU0|Q27J74|Q695L1|Q6FGA6|Q6ZQW1|Q6ZTL8|Q9P2P9	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000312358.7	37	NULL	CCDS42824.1	2																																																																																			-	-		0.604	SPEG-004	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SPEG	protein_coding	OTTHUMT00000130252.2	GCGCGCGTGTGC	NM_005876			220330656	+1	no_errors	ENST00000462545	ensembl	human	known	74_37	rna	DEL	0.015:0.006:0.004:0.001:0.002:0.003:0.005:0.006:0.006:0.000:0.000:0.000	-
MGAT4C	25834	genome.wustl.edu	37	12	86383241	86383241	+	Missense_Mutation	SNP	G	G	T	rs138787902		TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr12:86383241G>T	ENST00000604798.1	-	6	1288	c.84C>A	c.(82-84)ttC>ttA	p.F28L	MGAT4C_ENST00000548651.1_Missense_Mutation_p.F28L|MGAT4C_ENST00000552808.2_Missense_Mutation_p.F28L|MGAT4C_ENST00000549405.2_Missense_Mutation_p.F28L|MGAT4C_ENST00000552435.2_Missense_Mutation_p.F28L|MGAT4C_ENST00000393205.2_Missense_Mutation_p.F57L|MGAT4C_ENST00000332156.1_Missense_Mutation_p.F28L			Q9UBM8	MGT4C_HUMAN	MGAT4 family, member C	28					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity (GO:0008454)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(17)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	41						GAACTCCCAAGAATGACACTG	0.313																																																	0								ENSG00000182050						91.0	79.0	83.0					12																	86383241		2203	4299	6502	MGAT4C	SO:0001583	missense	0			-	HGNC		CCDS9030.1	12q21	2014-07-14	2014-07-14		ENSG00000182050	ENSG00000182050		"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	30871	protein-coding gene	gene with protein product		607385	"""mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme C (putative)"""			10570912	Standard	NM_013244		Approved	HGNT-IV-H	uc001tal.4	Q9UBM8	OTTHUMG00000169846	ENST00000604798.1:c.84C>A	12.37:g.86383241G>T	ENSP00000474896:p.Phe28Leu	Somatic	0	46	0.00		0.6643483795556975	4	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	44	25.42	B4DRH2|Q4G199|Q9UIU5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Glyco_transf_54,superfamily_LSM_dom	p.F57L	ENST00000604798.1	37	c.171	CCDS9030.1	12	.	.	.	.	.	.	.	.	.	.	G	14.07	2.426896	0.43020	.	.	ENSG00000182050	ENST00000332156;ENST00000393205;ENST00000549405;ENST00000550460;ENST00000552808;ENST00000548651;ENST00000547225;ENST00000552435	T;T;T;T;T;T	0.41758	1.62;1.58;1.62;1.62;1.62;0.99	5.69	1.84	0.25277	.	0.055996	0.64402	D	0.000001	T	0.23492	0.0568	L	0.32530	0.975	0.38571	D	0.949953	P;B	0.37441	0.595;0.063	B;B	0.31016	0.123;0.023	T	0.10917	-1.0609	10	0.10377	T	0.69	-15.826	9.7365	0.40390	0.339:0.0:0.661:0.0	.	57;28	B4DRH2;Q9UBM8	.;MGT4C_HUMAN	L	28;57;28;28;28;28;28;28	ENSP00000331664:F28L;ENSP00000376900:F57L;ENSP00000449022:F28L;ENSP00000446647:F28L;ENSP00000447253:F28L;ENSP00000449172:F28L	ENSP00000331664:F28L	F	-	3	2	MGAT4C	84907372	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.896000	0.28377	0.331000	0.23511	0.655000	0.94253	TTC	-	superfamily_LSM_dom		0.313	MGAT4C-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MGAT4C	protein_coding	OTTHUMT00000406212.2	G	NM_013244	-		86383241	-1	no_errors	ENST00000393205	ensembl	human	known	74_37	missense	SNP	1.000	T
RP1L1	94137	genome.wustl.edu	37	8	10467681	10467686	+	In_Frame_Del	DEL	TCCTTC	TCCTTC	-	rs386722181		TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	TCCTTC	TCCTTC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr8:10467681_10467686delTCCTTC	ENST00000382483.3	-	4	4145_4150	c.3922_3927delGAAGGA	c.(3922-3927)gaaggadel	p.EG1308del		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	1326	8 X 16 AA approximate tandem repeats of T-E-E-G-L-Q-E-E-G-V-Q-L-E-E-T-K.				cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)				breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		ctccttctgttccttcttTAGTTTCC	0.485																																																	0								ENSG00000183638			43,79,3686		3,0,37,3,73,1788						-0.4	0.0			135	362,29,7561		4,0,354,0,29,3589	no	codingComplex	RP1L1	NM_178857.5		7,0,391,3,102,5377	A1A1,A1A2,A1R,A2A2,A2R,RR		4.917,3.2038,4.3622				405,108,11247				RP1L1	SO:0001651	inframe_deletion	0				HGNC	AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.3922_3927delGAAGGA	8.37:g.10467681_10467686delTCCTTC	ENSP00000371923:p.Glu1308_Gly1309del	Somatic	NA	NA	NA		0.6643483795556975	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Doublecortin_dom,smart_Doublecortin_dom,pfscan_Doublecortin_dom	p.EG1308in_frame_del	ENST00000382483.3	37	c.3927_3922	CCDS43708.1	8																																																																																			-	NULL		0.485	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RP1L1	protein_coding	OTTHUMT00000375673.1	TCCTTC				10467686	-1	no_errors	ENST00000382483	ensembl	human	known	74_37	in_frame_del	DEL	0.001:0.000:0.001:0.001:0.000:0.001	-
SEC62	7095	genome.wustl.edu	37	3	169703617	169703617	+	Missense_Mutation	SNP	G	G	T			TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr3:169703617G>T	ENST00000337002.4	+	6	632	c.574G>T	c.(574-576)Gtt>Ttt	p.V192F	SEC62-AS1_ENST00000479626.1_RNA|SEC62_ENST00000480708.1_Missense_Mutation_p.V192F|SEC62_ENST00000470355.1_3'UTR	NM_003262.3	NP_003253.1	Q99442	SEC62_HUMAN	SEC62 homolog (S. cerevisiae)	192					cotranslational protein targeting to membrane (GO:0006613)|posttranslational protein targeting to membrane (GO:0006620)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|rough endoplasmic reticulum (GO:0005791)	protein transporter activity (GO:0008565)|receptor activity (GO:0004872)			NS(1)|endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|skin(1)	9						CTATGACCCAGTTCACTTTAA	0.299																																																	0								ENSG00000008952						137.0	139.0	138.0					3																	169703617		2203	4299	6502	SEC62	SO:0001583	missense	0			-	HGNC	D87127	CCDS3210.1	3q26.2	2008-04-22	2008-04-22	2008-04-22	ENSG00000008952	ENSG00000008952			11846	protein-coding gene	gene with protein product		602173	"""translocation protein 1"""	TLOC1		9020021, 10799540	Standard	NM_003262		Approved	Dtrp1, HTP1	uc003fgh.3	Q99442	OTTHUMG00000158753	ENST00000337002.4:c.574G>T	3.37:g.169703617G>T	ENSP00000337688:p.Val192Phe	Somatic	0	42	0.00		0.6643483795556975	84	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	41	8.89	D3DNQ0|O00682|O00729	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Sec62,superfamily_ABC1_TM_dom	p.V192F	ENST00000337002.4	37	c.574	CCDS3210.1	3	.	.	.	.	.	.	.	.	.	.	G	29.3	4.996712	0.93167	.	.	ENSG00000008952	ENST00000337002;ENST00000480708	.	.	.	5.32	5.32	0.75619	.	0.000000	0.85682	D	0.000000	T	0.76962	0.4061	M	0.73598	2.24	0.80722	D	1	D	0.71674	0.998	D	0.75484	0.986	T	0.71490	-0.4577	9	0.10111	T	0.7	-14.2878	18.3811	0.90451	0.0:0.0:1.0:0.0	.	192	Q99442	SEC62_HUMAN	F	192	.	ENSP00000337688:V192F	V	+	1	0	SEC62	171186311	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.614000	0.90917	2.648000	0.89879	0.650000	0.86243	GTT	-	pfam_Sec62,superfamily_ABC1_TM_dom		0.299	SEC62-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC62	protein_coding	OTTHUMT00000352043.1	G		-		169703617	+1	no_errors	ENST00000337002	ensembl	human	known	74_37	missense	SNP	1.000	T
HIST1H2AG	8969	genome.wustl.edu	37	6	27100857	27100857	+	Missense_Mutation	SNP	G	G	C			TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr6:27100857G>C	ENST00000359193.2	+	1	26	c.7G>C	c.(7-9)Gga>Cga	p.G3R	HIST1H2BJ_ENST00000607124.1_5'Flank|HIST1H2BJ_ENST00000541790.1_5'Flank|HIST1H2BJ_ENST00000339812.2_5'Flank	NM_021064.4	NP_066408.1	P0C0S8	H2A1_HUMAN	histone cluster 1, H2ag	3						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)			biliary_tract(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(1)|lung(4)|ovary(1)|urinary_tract(1)	17						CGCTATGTCTGGACGTGGCAA	0.582																																																	0								ENSG00000196787						41.0	47.0	45.0					6																	27100857		2198	4299	6497	HIST1H2AG	SO:0001583	missense	0			-	HGNC	L19778	CCDS4619.1	6p22.1	2011-01-27	2006-10-11	2003-02-21	ENSG00000196787	ENSG00000196787		"""Histones / Replication-dependent"""	4737	protein-coding gene	gene with protein product		615012	"""H2A histone family, member P"", ""histone 1, H2ag"""	H2AFP		8179821, 12408966	Standard	NM_021064		Approved	pH2A/f, H2A/p, H2A.1b	uc003niw.3	P0C0S8	OTTHUMG00000014469	ENST00000359193.2:c.7G>C	6.37:g.27100857G>C	ENSP00000352119:p.Gly3Arg	Somatic	0	42	0.00		0.6643483795556975	13	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00	P02261|Q2M1R2|Q76PA6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2A,prints_Histone_H2A	p.G3R	ENST00000359193.2	37	c.7	CCDS4619.1	6	.	.	.	.	.	.	.	.	.	.	G	11.28	1.591516	0.28357	.	.	ENSG00000196787	ENST00000359193	D	0.94376	-3.41	4.08	4.08	0.47627	Histone-fold (2);Histone H2A (1);	0.000000	0.39475	N	0.001347	D	0.95149	0.8428	.	.	.	0.42671	D	0.993519	D	0.63046	0.992	P	0.60886	0.88	D	0.95680	0.8731	9	0.87932	D	0	.	14.6102	0.68510	0.0:0.0:1.0:0.0	.	3	P0C0S8	H2A1_HUMAN	R	3	ENSP00000352119:G3R	ENSP00000352119:G3R	G	+	1	0	HIST1H2AG	27208836	1.000000	0.71417	0.999000	0.59377	0.159000	0.22180	8.726000	0.91474	2.217000	0.71921	0.655000	0.94253	GGA	-	superfamily_Histone-fold,smart_Histone_H2A		0.582	HIST1H2AG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H2AG	protein_coding	OTTHUMT00000040137.1	G	NM_021064	-		27100857	+1	no_errors	ENST00000359193	ensembl	human	known	74_37	missense	SNP	1.000	C
PAPD5	64282	genome.wustl.edu	37	16	50265726	50265726	+	3'UTR	SNP	A	A	G			TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr16:50265726A>G	ENST00000436909.3	+	0	4619				PAPD5_ENST00000357464.3_3'UTR|PAPD5_ENST00000573002.1_3'UTR	NM_001040284.2|NM_001040285.2	NP_001035374.2|NP_001035375.2	Q8NDF8	PAPD5_HUMAN	PAP associated domain containing 5						histone mRNA catabolic process (GO:0071044)|mitotic nuclear division (GO:0007067)|mRNA processing (GO:0006397)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|polynucleotide adenylyltransferase activity (GO:0004652)			endometrium(1)|kidney(1)|lung(2)	4		all_cancers(37;0.0452)		BRCA - Breast invasive adenocarcinoma(181;0.0843)|GBM - Glioblastoma multiforme(240;0.231)		GAAGTAAAATACTTTCAAGAA	0.303																																																	0								ENSG00000121274																																			PAPD5	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AF089897	CCDS54006.1	16q12.1	2010-11-18				ENSG00000121274			30758	protein-coding gene	gene with protein product	"""TUTase3"""	605540				10066793	Standard	NM_001040284		Approved	TRF4-2	uc010vgo.2	Q8NDF8		ENST00000436909.3:c.*2487A>G	16.37:g.50265726A>G		Somatic	0	9	0.00		0.6643483795556975	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	1	88.89	B4DV38|Q9NW67|Q9Y6C0	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000436909.3	37	NULL	CCDS54006.1	16																																																																																			-	-		0.303	PAPD5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PAPD5	protein_coding	OTTHUMT00000423149.2	A	NM_022447	-		50265726	+1	no_errors	ENST00000573002	ensembl	human	known	74_37	rna	SNP	1.000	G
STXBP3	6814	genome.wustl.edu	37	1	109322344	109322345	+	Intron	INS	-	-	ATATTT	rs66596961|rs10637771|rs200042192|rs142753375		TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr1:109322344_109322345insATATTT	ENST00000370008.3	+	9	859				STXBP3_ENST00000485167.1_3'UTR	NM_007269.2	NP_009200.2	O00186	STXB3_HUMAN	syntaxin binding protein 3						blood coagulation (GO:0007596)|membrane organization (GO:0061024)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|neutrophil degranulation (GO:0043312)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|protein heterooligomerization (GO:0051291)|protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|specific granule (GO:0042581)|tertiary granule (GO:0070820)	syntaxin binding (GO:0019905)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(2)|ovary(3)|urinary_tract(1)	13		all_epithelial(167;0.000154)|all_lung(203;0.00026)|Lung NSC(277;0.000508)		Colorectal(144;0.0386)|Lung(183;0.104)|COAD - Colon adenocarcinoma(174;0.137)|Epithelial(280;0.231)		GGCTCACTATCATTGAAGGAGA	0.322														5007	0.9998	0.9992	1.0	5008	,	,		17316	1.0		1.0	False		,,,				2504	1.0																0								ENSG00000116266																																			STXBP3	SO:0001627	intron_variant	0				HGNC	D63506	CCDS790.1	1p13.3	2008-02-05			ENSG00000116266	ENSG00000116266			11446	protein-coding gene	gene with protein product		608339				10194441	Standard	NM_007269		Approved	UNC-18C	uc001dvy.3	O00186	OTTHUMG00000011122	ENST00000370008.3:c.809+312->ATATTT	1.37:g.109322344_109322345insATATTT		Somatic	NA	NA	NA		0.6643483795556975	4	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A8K269|A8K5K7|Q53FW1|Q86YJ3|Q9UPD7	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000370008.3	37	NULL	CCDS790.1	1																																																																																			-	-		0.322	STXBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STXBP3	protein_coding	OTTHUMT00000030591.1	-	NM_007269			109322345	+1	no_errors	ENST00000485167	ensembl	human	known	74_37	rna	INS	0.001:0.000	ATATTT
PFKFB1	5207	genome.wustl.edu	37	X	54978378	54978378	+	Missense_Mutation	SNP	C	C	T	rs376959812		TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chrX:54978378C>T	ENST00000375006.3	-	8	876	c.806G>A	c.(805-807)cGc>cAc	p.R269H	PFKFB1_ENST00000545676.1_Missense_Mutation_p.R204H|PFKFB1_ENST00000374992.2_Intron	NM_002625.2	NP_002616.2	P16118	F261_HUMAN	6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 1	269	Fructose-2,6-bisphosphatase.				carbohydrate metabolic process (GO:0005975)|dephosphorylation (GO:0016311)|energy reserve metabolic process (GO:0006112)|fructose 2,6-bisphosphate metabolic process (GO:0006003)|fructose metabolic process (GO:0006000)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|intracellular signal transduction (GO:0035556)|organ regeneration (GO:0031100)|positive regulation of glucokinase activity (GO:0033133)|response to cAMP (GO:0051591)|response to glucagon (GO:0033762)|response to glucocorticoid (GO:0051384)|response to insulin (GO:0032868)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	6-phosphofructo-2-kinase/fructose-2,6-biphosphatase complex (GO:0043540)|cytosol (GO:0005829)	6-phosphofructo-2-kinase activity (GO:0003873)|ATP binding (GO:0005524)|fructose-2,6-bisphosphate 2-phosphatase activity (GO:0004331)|fructose-6-phosphate binding (GO:0070095)			central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(11)|ovary(1)	24						ACCTCCGATGCGGCCTCTGAT	0.582																																																	0								ENSG00000158571	C	HIS/ARG	0,3835		0,0,1632,571	117.0	73.0	88.0		806	4.5	1.0	X		88	1,6727		0,1,2427,1872	no	missense	PFKFB1	NM_002625.2	29	0,1,4059,2443	TT,TC,CC,C		0.0149,0.0,0.0095	benign	269/472	54978378	1,10562	2203	4300	6503	PFKFB1	SO:0001583	missense	0			-	HGNC		CCDS14364.1, CCDS65273.1	Xp11.21	2012-07-13			ENSG00000158571	ENSG00000158571	2.7.1.105, 3.1.3.46		8872	protein-coding gene	gene with protein product		311790		PFRX		9119406	Standard	NM_002625		Approved		uc004dty.2	P16118	OTTHUMG00000021643	ENST00000375006.3:c.806G>A	X.37:g.54978378C>T	ENSP00000364145:p.Arg269His	Somatic	0	24	0.00		0.6643483795556975	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	15	40.00	B2RA88|B4DUN5|Q5JXS5|Q99951	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_6Phosfructo_kin,pfam_His_Pase_superF_clade-1,pfam_Zeta_toxin_domain,superfamily_P-loop_NTPase,smart_His_Pase_superF_clade-1,pirsf_Bifunct_6PFK/fruc_bisP_Ptase,prints_6Pfruct_kin	p.R269H	ENST00000375006.3	37	c.806	CCDS14364.1	X	.	.	.	.	.	.	.	.	.	.	C	27.8	4.860217	0.91433	0.0	1.49E-4	ENSG00000158571	ENST00000375006;ENST00000545676	T;T	0.74315	-0.83;-0.83	4.53	4.53	0.55603	Histidine phosphatase superfamily, clade-1 (2);	0.000000	0.85682	D	0.000000	D	0.86264	0.5891	H	0.95365	3.66	0.80722	D	1	D;P	0.58620	0.983;0.616	P;B	0.51079	0.658;0.096	D	0.90767	0.4669	10	0.62326	D	0.03	-12.7247	15.6194	0.76793	0.0:1.0:0.0:0.0	.	204;269	B4DUN5;P16118	.;F261_HUMAN	H	269;204	ENSP00000364145:R269H;ENSP00000444074:R204H	ENSP00000364145:R269H	R	-	2	0	PFKFB1	54995103	0.924000	0.31332	1.000000	0.80357	0.935000	0.57460	2.997000	0.49457	2.015000	0.59207	0.519000	0.50382	CGC	-	pfam_His_Pase_superF_clade-1,smart_His_Pase_superF_clade-1,pirsf_Bifunct_6PFK/fruc_bisP_Ptase,prints_6Pfruct_kin		0.582	PFKFB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PFKFB1	protein_coding	OTTHUMT00000056847.1	C		-		54978378	-1	no_errors	ENST00000375006	ensembl	human	known	74_37	missense	SNP	1.000	T
UBE2I	7329	genome.wustl.edu	37	16	1358487	1358488	+	5'Flank	INS	-	-	AGGGGA			TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr16:1358487_1358488insAGGGGA	ENST00000355803.4	+	0	0				UBE2I_ENST00000397515.2_5'Flank|UBE2I_ENST00000339021.3_3'UTR|UBE2I_ENST00000566587.1_5'Flank|UBE2I_ENST00000325437.5_5'Flank|UBE2I_ENST00000403747.2_5'Flank|UBE2I_ENST00000397514.3_5'Flank	NM_194260.2	NP_919236.1	P63279	UBC9_HUMAN	ubiquitin-conjugating enzyme E2I						cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|chromosome segregation (GO:0007059)|mitotic nuclear division (GO:0007067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of intracellular steroid hormone receptor signaling pathway (GO:0033145)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|post-translational protein modification (GO:0043687)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein sumoylation (GO:0016925)|regulation of receptor activity (GO:0010469)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|fibrillar center (GO:0001650)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|synapse (GO:0045202)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|RING-like zinc finger domain binding (GO:0071535)|SUMO ligase activity (GO:0019789)|transcription factor binding (GO:0008134)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|large_intestine(2)|skin(1)|upper_aerodigestive_tract(1)	5		Hepatocellular(780;0.00369)				aatgagtgagtgggaatgaatg	0.515																																																	0								ENSG00000103275																																			UBE2I	SO:0001631	upstream_gene_variant	0				HGNC	D45050	CCDS10433.1	16p13.3	2011-05-19	2011-05-19		ENSG00000103275	ENSG00000103275	6.3.2.19	"""Ubiquitin-conjugating enzymes E2"""	12485	protein-coding gene	gene with protein product		601661	"""ubiquitin-conjugating enzyme E2I (homologous to yeast UBC9)"", ""ubiquitin-conjugating enzyme E2I (UBC9 homolog, yeast)"""			8565643	Standard	NM_003345		Approved	UBC9	uc002cld.2	P63279	OTTHUMG00000047845		16.37:g.1358487_1358488insAGGGGA	Exception_encountered	Somatic	NA	NA	NA		0.6643483795556975	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	D3DU69|P50550|Q15698|Q59GX1|Q86VB3	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000355803.4	37	NULL	CCDS10433.1	16																																																																																			-	-		0.515	UBE2I-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	UBE2I	protein_coding	OTTHUMT00000250317.2	-	NM_003345			1358488	+1	no_errors	ENST00000339021	ensembl	human	known	74_37	rna	INS	0.000:0.000	AGGGGA
TBC1D8B	54885	genome.wustl.edu	37	X	106117042	106117042	+	Missense_Mutation	SNP	G	G	T			TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chrX:106117042G>T	ENST00000357242.5	+	21	3384	c.3210G>T	c.(3208-3210)agG>agT	p.R1070S	TBC1D8B_ENST00000276175.3_Missense_Mutation_p.R1064S	NM_017752.2	NP_060222.2	Q0IIM8	TBC8B_HUMAN	TBC1 domain family, member 8B (with GRAM domain)	1070							calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(6)|liver(4)|lung(15)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						GTTCCTTTAGGGAGGAACCTC	0.448																																																	0								ENSG00000133138						97.0	91.0	93.0					X																	106117042		2203	4300	6503	TBC1D8B	SO:0001583	missense	0			-	HGNC	AK123957	CCDS14522.1, CCDS14523.1	Xq22.3	2013-01-10			ENSG00000133138	ENSG00000133138		"""EF-hand domain containing"""	24715	protein-coding gene	gene with protein product						8889548	Standard	NM_017752		Approved	FLJ20298, RP11-321G1.1	uc004emo.3	Q0IIM8	OTTHUMG00000022152	ENST00000357242.5:c.3210G>T	X.37:g.106117042G>T	ENSP00000349781:p.Arg1070Ser	Somatic	0	56	0.00		0.6643483795556975	6	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	20	13.04	B9A6K5|B9A6K6|Q5JRB7|Q6ZVX5|Q9NXE3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Rab-GTPase-TBC_dom,pfam_GRAM,superfamily_Rab-GTPase-TBC_dom,smart_GRAM,smart_Rab-GTPase-TBC_dom,pfscan_EF_hand_dom,pfscan_Rab-GTPase-TBC_dom	p.R1070S	ENST00000357242.5	37	c.3210	CCDS14522.1	X	.	.	.	.	.	.	.	.	.	.	G	0.060	-1.226030	0.01518	.	.	ENSG00000133138	ENST00000357242;ENST00000276175	T;T	0.07567	3.18;3.18	5.62	2.46	0.29980	.	0.695030	0.14264	N	0.330614	T	0.04452	0.0122	N	0.17594	0.5	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.46119	-0.9214	10	0.09084	T	0.74	-1.1222	7.475	0.27371	0.4323:0.0:0.5677:0.0	.	1070	Q0IIM8	TBC8B_HUMAN	S	1070;1064	ENSP00000349781:R1070S;ENSP00000276175:R1064S	ENSP00000276175:R1064S	R	+	3	2	TBC1D8B	106003698	0.974000	0.33945	0.192000	0.23308	0.228000	0.25075	1.947000	0.40293	0.554000	0.29061	0.586000	0.80456	AGG	-	NULL		0.448	TBC1D8B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TBC1D8B	protein_coding	OTTHUMT00000057807.2	G	NM_017752	-		106117042	+1	no_errors	ENST00000357242	ensembl	human	known	74_37	missense	SNP	0.021	T
KRT75	9119	genome.wustl.edu	37	12	52818504	52818504	+	Missense_Mutation	SNP	T	T	A	rs298104	byFrequency	TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr12:52818504T>A	ENST00000252245.5	-	9	1673	c.1453A>T	c.(1453-1455)Agc>Tgc	p.S485C	RP11-1020M18.10_ENST00000548135.1_RNA	NM_004693.2	NP_004684.2	O95678	K2C75_HUMAN	keratin 75	485	Tail.		S -> R (in dbSNP:rs298104). {ECO:0000269|PubMed:10692104, ECO:0000269|PubMed:9856802}.		hematopoietic progenitor cell differentiation (GO:0002244)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(13)|lung(10)|prostate(1)|skin(1)	28				BRCA - Breast invasive adenocarcinoma(357;0.192)		CTGCTGCCGCTTCCATAGCCA	0.617																																																	0								ENSG00000170454						56.0	58.0	58.0					12																	52818504		2203	4300	6503	KRT75	SO:0001583	missense	0			-	HGNC	Y19212	CCDS8827.1	12q13.13	2013-06-25			ENSG00000170454	ENSG00000170454		"""-"", ""Intermediate filaments type II, keratins (basic)"""	24431	protein-coding gene	gene with protein product		609025				9856802, 10692104, 16831889	Standard	NM_004693		Approved	K6HF	uc001saj.2	O95678	OTTHUMG00000169592	ENST00000252245.5:c.1453A>T	12.37:g.52818504T>A	ENSP00000252245:p.Ser485Cys	Somatic	0	35	0.00		0.6643483795556975	8	42.86	6	WXS	Illumina HiSeq 2500	Phase_IV	tier1	74	49	57.36	B4DQU4|Q9NSA9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_IF,superfamily_Prefoldin,prints_Keratin_II	p.S485C	ENST00000252245.5	37	c.1453	CCDS8827.1	12	.	.	.	.	.	.	.	.	.	.	G	0.007	-1.988626	0.00443	.	.	ENSG00000170454	ENST00000252245	D	0.87809	-2.3	4.88	-3.45	0.04781	.	0.870040	0.09748	N	0.761018	T	0.81536	0.4843	M	0.71581	2.175	0.80722	P	0.0	P	0.51653	0.947	B	0.40199	0.322	T	0.74420	-0.3671	9	0.16896	T	0.51	.	8.4498	0.32864	0.0:0.1452:0.1428:0.712	.	485	O95678	K2C75_HUMAN	C	485	ENSP00000252245:S485C	ENSP00000252245:S485C	S	-	1	0	KRT75	51104771	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.323000	0.07997	-1.252000	0.02491	-2.506000	0.00189	AGC	-	NULL		0.617	KRT75-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT75	protein_coding	OTTHUMT00000404968.1	T	NM_004693	-		52818504	-1	no_errors	ENST00000252245	ensembl	human	known	74_37	missense	SNP	0.000	A
RNPS1	10921	genome.wustl.edu	37	16	2320734	2320734	+	5'Flank	SNP	A	A	T			TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr16:2320734A>T	ENST00000320225.5	-	0	0				MIR3677_ENST00000578964.1_RNA|AC009065.2_ENST00000384982.1_RNA|RNPS1_ENST00000569598.2_5'Flank|MIR940_ENST00000401276.1_lincRNA|RNPS1_ENST00000566458.1_5'Flank|RNPS1_ENST00000567147.1_5'Flank|RNPS1_ENST00000301730.8_5'Flank|RNPS1_ENST00000397086.2_5'Flank|RNPS1_ENST00000561718.1_5'Flank|RNPS1_ENST00000568631.1_5'Flank	NM_080594.2	NP_542161.1	Q15287	RNPS1_HUMAN	RNA binding protein S1, serine-rich domain						gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|positive regulation of apoptotic process (GO:0043065)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)	ASAP complex (GO:0061574)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(1)|large_intestine(1)|lung(4)|ovary(2)|urinary_tract(1)	9						AGAGCCCTGCAGTGCTGGGCA	0.667																																																	0								ENSG00000266643																																			MIR3677	SO:0001631	upstream_gene_variant	0			-	HGNC	AF015608	CCDS10465.1, CCDS66907.1, CCDS73811.1	16p13.3	2013-02-12	2001-11-28		ENSG00000205937	ENSG00000205937		"""RNA binding motif (RRM) containing"""	10080	protein-coding gene	gene with protein product		606447	"""RNA-binding protein S1, serine-rich domain"""			9580558, 8543184	Standard	XM_005255048		Approved		uc002cpu.3	Q15287	OTTHUMG00000128828		16.37:g.2320734A>T	Exception_encountered	Somatic	0	42	0.00		0.6643483795556975	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	42	14.29	A8K1P0|B4DDU8|B4DZU7|B7ZA17|O75308|Q32P25|Q8WY42|Q9NYG3	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000320225.5	37	NULL	CCDS10465.1	16																																																																																			-	-		0.667	RNPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIR3677	protein_coding	OTTHUMT00000250766.2	A	NM_080594	-		2320734	+1	no_errors	ENST00000578964	ensembl	human	known	74_37	rna	SNP	0.001	T
ZNF671	79891	genome.wustl.edu	37	19	58238816	58238816	+	Silent	SNP	C	C	T			TCGA-QQ-A5VC-01A-31D-A32I-09	TCGA-QQ-A5VC-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d32637db-0977-496a-a037-e5d83bd5b23b	d387978b-317e-41be-bf28-99e243e7d023	g.chr19:58238816C>T	ENST00000317398.6	-	1	176	c.81G>A	c.(79-81)ccG>ccA	p.P27P	ZNF671_ENST00000594803.1_5'UTR|AC003006.7_ENST00000599221.1_Intron|AC003006.7_ENST00000594684.1_Intron|ZNF671_ENST00000596939.1_Silent_p.P27P|ZNF671_ENST00000335820.3_5'UTR	NM_024833.2	NP_079109.2	Q8TAW3	ZN671_HUMAN	zinc finger protein 671	27					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			kidney(1)|large_intestine(6)|liver(1)|lung(7)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	22		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		CTGCCGGGAGCGGCAGGCGTC	0.682																																																	0								ENSG00000083814						26.0	29.0	28.0					19																	58238816		2199	4294	6493	ZNF671	SO:0001819	synonymous_variant	0			-	HGNC		CCDS12961.1	19q13.43	2013-01-08				ENSG00000083814		"""Zinc fingers, C2H2-type"", ""-"""	26279	protein-coding gene	gene with protein product	"""hypothetical protein FLJ23506"""					12477932	Standard	NM_024833		Approved	FLJ23506	uc002qpz.4	Q8TAW3		ENST00000317398.6:c.81G>A	19.37:g.58238816C>T		Somatic	0	74	0.00		0.6643483795556975	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	30	45.61	A6NF07|Q9H5E9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.P27	ENST00000317398.6	37	c.81	CCDS12961.1	19																																																																																			-	NULL		0.682	ZNF671-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF671	protein_coding	OTTHUMT00000466817.1	C	NM_024833	-		58238816	-1	no_errors	ENST00000317398	ensembl	human	known	74_37	silent	SNP	0.000	T
