#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
ELAVL3	1995	genome.wustl.edu	37	19	11591449	11591449	+	5'UTR	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr19:11591449C>T	ENST00000359227.3	-	0	399				ELAVL3_ENST00000438662.2_5'Flank|CTC-398G3.6_ENST00000585656.1_Intron|ELAVL3_ENST00000592218.1_5'UTR	NM_001420.3|NM_032281.2	NP_001411.2|NP_115657.2	Q14576	ELAV3_HUMAN	ELAV like neuron-specific RNA binding protein 3						cell differentiation (GO:0030154)|nervous system development (GO:0007399)		AU-rich element binding (GO:0017091)|nucleotide binding (GO:0000166)			breast(1)|endometrium(2)|large_intestine(4)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	15						GGGCGCGGTCCGTGTTGAGGG	0.716																																																	0								ENSG00000196361						24.0	27.0	26.0					19																	11591449		2198	4297	6495	ELAVL3	SO:0001623	5_prime_UTR_variant	0			-	HGNC		CCDS32912.1, CCDS45978.1	19p13.2	2013-10-03	2013-10-03			ENSG00000196361		"""RNA binding motif (RRM) containing"""	3314	protein-coding gene	gene with protein product	"""Hu antigen C"", ""paraneoplastic limbic encephalitis antigen 21"", ""paraneoplastic cerebellar degeneration-associated antigen"", ""ELAV-like protein 3"""	603458	"""ELAV (embryonic lethal, abnormal vision, Drosophila)-like 3 (Hu antigen C)"""			9799595	Standard	NM_001420		Approved	HUC, PLE21, DKFZp547J036, HUCL, MGC20653	uc002mry.1	Q14576		ENST00000359227.3:c.-26G>A	19.37:g.11591449C>T		Somatic	0	137	0.00		0.41568620468393047	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	31	62	33.33	Q16135|Q96CL8|Q96QS9	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000359227.3	37	NULL	CCDS32912.1	19																																																																																			-	-		0.716	ELAVL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ELAVL3	protein_coding	OTTHUMT00000458827.2	C	NM_001420	-		11591449	-1	no_errors	ENST00000592218	ensembl	human	putative	74_37	rna	SNP	1.000	T
NUP210L	91181	genome.wustl.edu	37	1	154042843	154042843	+	Missense_Mutation	SNP	C	C	G			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr1:154042843C>G	ENST00000368559.3	-	17	2531	c.2460G>C	c.(2458-2460)tgG>tgC	p.W820C	NUP210L_ENST00000271854.3_Missense_Mutation_p.W820C	NM_207308.2	NP_997191.2	Q5VU65	P210L_HUMAN	nucleoporin 210kDa-like	820					Sertoli cell development (GO:0060009)|spermatid development (GO:0007286)	integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(12)|lung(34)|ovary(4)|pancreas(1)|prostate(2)|skin(6)|urinary_tract(2)	80	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)			TGGAGGATTTCCATTCTAGCA	0.408																																																	0								ENSG00000143552						143.0	130.0	134.0					1																	154042843		1889	4104	5993	NUP210L	SO:0001583	missense	0			-	HGNC	AK125924	CCDS41399.1, CCDS53370.1	1q21.3	2008-02-05			ENSG00000143552	ENSG00000143552			29915	protein-coding gene	gene with protein product							Standard	NM_207308		Approved		uc001fdw.3	Q5VU65	OTTHUMG00000035852	ENST00000368559.3:c.2460G>C	1.37:g.154042843C>G	ENSP00000357547:p.Trp820Cys	Somatic	0	43	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	32	30.43	E7EP56|Q5T4L7|Q6ZRN1|Q6ZRT4|Q6ZU81|Q8NDI6|Q9UF31	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Big_2,superfamily_Invasin/intimin_cell_adhesion,smart_Big_2	p.W820C	ENST00000368559.3	37	c.2460	CCDS41399.1	1	.	.	.	.	.	.	.	.	.	.	C	17.41	3.383095	0.61845	.	.	ENSG00000143552	ENST00000368559;ENST00000271854	T;T	0.23552	1.9;1.9	5.12	5.12	0.69794	.	0.000000	0.51477	D	0.000092	T	0.44414	0.1292	M	0.74647	2.275	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	T	0.46596	-0.9180	10	0.87932	D	0	-2.7505	15.6471	0.77063	0.0:1.0:0.0:0.0	.	820;820	E7EP56;Q5VU65	.;P210L_HUMAN	C	820	ENSP00000357547:W820C;ENSP00000271854:W820C	ENSP00000271854:W820C	W	-	3	0	NUP210L	152309467	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	3.713000	0.54882	2.428000	0.82296	0.498000	0.49722	TGG	-	NULL		0.408	NUP210L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP210L	protein_coding	OTTHUMT00000087270.3	C	NM_207308	-		154042843	-1	no_errors	ENST00000368559	ensembl	human	known	74_37	missense	SNP	1.000	G
TTN	7273	genome.wustl.edu	37	2	179650837	179650837	+	Missense_Mutation	SNP	G	G	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr2:179650837G>T	ENST00000591111.1	-	14	2332	c.2108C>A	c.(2107-2109)gCa>gAa	p.A703E	TTN_ENST00000342992.6_Missense_Mutation_p.A703E|TTN_ENST00000359218.5_Missense_Mutation_p.A657E|TTN_ENST00000460472.2_Missense_Mutation_p.A657E|TTN_ENST00000589042.1_Missense_Mutation_p.A703E|TTN_ENST00000342175.6_Missense_Mutation_p.A657E|TTN_ENST00000360870.5_Missense_Mutation_p.A703E			Q8WZ42	TITIN_HUMAN	titin	0					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AACAACTGTTGCTACAGCTTC	0.498																																																	0								ENSG00000155657						52.0	54.0	53.0					2																	179650837		2203	4300	6503	TTN	SO:0001583	missense	0			-	HGNC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.2108C>A	2.37:g.179650837G>T	ENSP00000465570:p.Ala703Glu	Somatic	0	19	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	19	17.39	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.A703E	ENST00000591111.1	37	c.2108		2	.	.	.	.	.	.	.	.	.	.	G	18.00	3.524913	0.64747	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870;ENST00000436599	T;T;T;T;T;T	0.71817	-0.6;-0.39;-0.38;-0.39;0.26;0.11	5.99	5.99	0.97316	Ribonuclease H-like (1);	.	.	.	.	T	0.80303	0.4598	L	0.36672	1.1	0.44635	D	0.997618	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.996;0.996;0.996;0.996;0.999	T	0.80732	-0.1251	9	0.87932	D	0	.	20.4777	0.99188	0.0:0.0:1.0:0.0	.	657;657;657;703;703	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	E	703;657;657;657;657;703;207	ENSP00000343764:A703E;ENSP00000434586:A657E;ENSP00000340554:A657E;ENSP00000352154:A657E;ENSP00000354117:A703E;ENSP00000405517:A207E	ENSP00000340554:A657E	A	-	2	0	TTN	179359082	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.353000	0.97080	2.840000	0.97914	0.655000	0.94253	GCA	-	superfamily_RNaseH-like_dom		0.498	TTN-019	PUTATIVE	basic	protein_coding	TTN	protein_coding	OTTHUMT00000460310.1	G	NM_133378	-		179650837	-1	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	SNP	1.000	T
NOVA1	4857	genome.wustl.edu	37	14	26949207	26949207	+	Silent	SNP	G	G	T	rs114949068		TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr14:26949207G>T	ENST00000344429.5	-	3	426	c.423C>A	c.(421-423)acC>acA	p.T141T	NOVA1_ENST00000465357.2_Silent_p.T141T|NOVA1_ENST00000547619.1_Silent_p.T141T|NOVA1_ENST00000539517.2_Silent_p.T141T|NOVA1_ENST00000574031.1_Silent_p.T141T|NOVA1_ENST00000267422.7_Silent_p.T19T	NM_006491.2	NP_006482.1	P51513	NOVA1_HUMAN	neuro-oncological ventral antigen 1	144					locomotory behavior (GO:0007626)|mRNA splicing, via spliceosome (GO:0000398)|regulation of RNA metabolic process (GO:0051252)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|synaptic transmission (GO:0007268)	intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|liver(1)|lung(19)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	40				GBM - Glioblastoma multiforme(265;0.0135)		CTGGATTAACGGTGGTCTGGG	0.398																																																	0								ENSG00000139910						223.0	188.0	200.0					14																	26949207		2203	4300	6503	NOVA1	SO:0001819	synonymous_variant	0			-	HGNC	U04840	CCDS9635.1, CCDS32060.1, CCDS32061.1	14q12	2006-06-09			ENSG00000139910	ENSG00000139910			7886	protein-coding gene	gene with protein product		602157				8558240	Standard	NM_006489		Approved		uc001wpy.3	P51513	OTTHUMG00000029385	ENST00000344429.5:c.423C>A	14.37:g.26949207G>T		Somatic	0	54	0.00		0.41568620468393047	27	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	40	9.09	A8K0S4|A8K4Q7|D3DS81|D3DS82|Q6B004	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_KH_dom_type_1,smart_KH_dom,pfscan_KH_dom_type_1	p.T141	ENST00000344429.5	37	c.423	CCDS9635.1	14																																																																																			-	NULL		0.398	NOVA1-001	KNOWN	basic|exp_conf|CCDS	protein_coding	NOVA1	protein_coding	OTTHUMT00000276557.1	G	NM_006491	-		26949207	-1	no_errors	ENST00000539517	ensembl	human	known	74_37	silent	SNP	0.996	T
ANK2	287	genome.wustl.edu	37	4	114275648	114275648	+	Silent	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr4:114275648G>A	ENST00000357077.4	+	38	5927	c.5874G>A	c.(5872-5874)gaG>gaA	p.E1958E	ANK2_ENST00000264366.6_Silent_p.E1925E|ANK2_ENST00000506722.1_Intron|ANK2_ENST00000394537.3_Intron|ANK2_ENST00000510275.2_Intron|ANK2_ENST00000509550.1_Intron	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	1958	Repeat-rich region.				atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		GGAAAACTGAGAAGCACCTGC	0.512																																																	0								ENSG00000145362						79.0	80.0	80.0					4																	114275648		2203	4300	6503	ANK2	SO:0001819	synonymous_variant	0			-	HGNC	M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.5874G>A	4.37:g.114275648G>A		Somatic	0	76	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	44	21.43	Q01485|Q08AC7|Q08AC8|Q7Z3L5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ankyrin_rpt,pfam_ZU5,pfam_Death_domain,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like_dom,smart_Ankyrin_rpt,smart_ZU5,smart_Death_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death_domain,pfscan_ZU5,prints_Ankyrin_rpt	p.E1958	ENST00000357077.4	37	c.5874	CCDS3702.1	4																																																																																			-	NULL		0.512	ANK2-001	KNOWN	basic|CCDS	protein_coding	ANK2	protein_coding	OTTHUMT00000256422.2	G	NM_001148	-		114275648	+1	no_errors	ENST00000357077	ensembl	human	known	74_37	silent	SNP	0.161	A
CSMD3	114788	genome.wustl.edu	37	8	113267508	113267508	+	Nonsense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr8:113267508C>T	ENST00000297405.5	-	62	10255	c.10011G>A	c.(10009-10011)tgG>tgA	p.W3337*	CSMD3_ENST00000352409.3_Nonsense_Mutation_p.W3267*|CSMD3_ENST00000455883.2_Nonsense_Mutation_p.W3168*|CSMD3_ENST00000343508.3_Nonsense_Mutation_p.W3297*	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	3337	Sushi 26. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						ATGAACCACTCCAAGTGCCAT	0.368										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																																							0								ENSG00000164796						126.0	115.0	119.0					8																	113267508		2203	4299	6502	CSMD3	SO:0001587	stop_gained	0			-	HGNC	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.10011G>A	8.37:g.113267508C>T	ENSP00000297405:p.Trp3337*	Somatic	0	75	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	40	27.27	Q96PZ3	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_CUB_dom,pfam_Sushi_SCR_CCP,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.W3337*	ENST00000297405.5	37	c.10011	CCDS6315.1	8	.	.	.	.	.	.	.	.	.	.	C	52	19.202818	0.99916	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	.	.	.	5.2	5.2	0.72013	.	0.000000	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.9452	0.92620	0.0:1.0:0.0:0.0	.	.	.	.	X	3297;3337;2607;3168;3267	.	ENSP00000297405:W3337X	W	-	3	0	CSMD3	113336684	1.000000	0.71417	1.000000	0.80357	0.595000	0.36748	7.581000	0.82535	2.712000	0.92718	0.655000	0.94253	TGG	-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP		0.368	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSMD3	protein_coding	OTTHUMT00000347141.1	C	NM_052900	-		113267508	-1	no_errors	ENST00000297405	ensembl	human	known	74_37	nonsense	SNP	1.000	T
PIM2	11040	genome.wustl.edu	37	X	48771446	48771446	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chrX:48771446C>T	ENST00000376509.4	-	6	1087	c.898G>A	c.(898-900)Gga>Aga	p.G300R	SLC35A2_ENST00000376515.3_5'Flank|SLC35A2_ENST00000452555.2_5'Flank|SLC35A2_ENST00000376512.1_5'Flank|PIM2_ENST00000485431.1_5'UTR|SLC35A2_ENST00000413561.2_5'Flank|SLC35A2_ENST00000445167.2_5'Flank|SLC35A2_ENST00000376529.3_5'Flank|SLC35A2_ENST00000247138.5_5'Flank|SLC35A2_ENST00000376521.1_5'Flank	NM_006875.3	NP_006866.2	Q9P1W9	PIM2_HUMAN	Pim-2 proto-oncogene, serine/threonine kinase	300					apoptotic mitochondrial changes (GO:0008637)|cell proliferation (GO:0008283)|G1/S transition of mitotic cell cycle (GO:0000082)|male meiosis (GO:0007140)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|positive regulation of autophagy (GO:0010508)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)|response to virus (GO:0009615)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			lung(3)|stomach(1)	4						GCAGGGCCTCCTTTGGAGGGG	0.627																																																	0								ENSG00000102096						24.0	20.0	21.0					X																	48771446		2153	4228	6381	PIM2	SO:0001583	missense	0			-	HGNC	U77735	CCDS14312.1	Xp11.23	2014-06-25	2014-06-25		ENSG00000102096	ENSG00000102096			8987	protein-coding gene	gene with protein product		300295	"""pim-2 oncogene"""			9804974	Standard	NM_006875		Approved		uc004dls.3	Q9P1W9	OTTHUMG00000024132	ENST00000376509.4:c.898G>A	X.37:g.48771446C>T	ENSP00000365692:p.Gly300Arg	Somatic	0	93	0.00		0.41568620468393047	15	31.82	7	WXS	Illumina HiSeq 2500	Phase_IV	tier1	33	24	57.89	A8K4G6|Q99739	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.G300R	ENST00000376509.4	37	c.898	CCDS14312.1	X	.	.	.	.	.	.	.	.	.	.	C	2.021	-0.424831	0.04734	.	.	ENSG00000102096	ENST00000376509	T	0.67865	-0.29	4.86	2.98	0.34508	.	0.611497	0.16108	N	0.229235	T	0.43809	0.1264	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.19844	-1.0293	10	0.14656	T	0.56	.	8.3915	0.32531	0.1728:0.6631:0.164:0.0	.	300	Q9P1W9	PIM2_HUMAN	R	300	ENSP00000365692:G300R	ENSP00000365692:G300R	G	-	1	0	PIM2	48656390	0.940000	0.31905	0.051000	0.19133	0.018000	0.09664	1.367000	0.34204	1.027000	0.39758	-0.237000	0.12165	GGA	-	NULL		0.627	PIM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIM2	protein_coding	OTTHUMT00000060805.1	C		-		48771446	-1	no_errors	ENST00000376509	ensembl	human	known	74_37	missense	SNP	0.066	T
ALOX12P2	245	genome.wustl.edu	37	17	6799663	6799663	+	RNA	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr17:6799663C>T	ENST00000574727.1	+	0	1108									arachidonate 12-lipoxygenase pseudogene 2											endometrium(1)	1						GTGGATTTCTCCTTGCTGGAT	0.493																																																	0								ENSG00000262943																																			ALOX12P2			0			-	HGNC	AF020774		17p13.1	2014-03-18			ENSG00000262943	ENSG00000262943			432	pseudogene	pseudogene						9691181	Standard	NR_002710		Approved		uc002gdv.3		OTTHUMG00000177324		17.37:g.6799663C>T		Somatic	0	83	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	44	13.73		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000574727.1	37	NULL		17																																																																																			-	-		0.493	ALOX12P2-003	KNOWN	basic	processed_transcript	ALOX12P2	pseudogene	OTTHUMT00000436284.1	C		-		6799663	+1	no_errors	ENST00000570890	ensembl	human	known	74_37	rna	SNP	0.924	T
AOX2P	344454	genome.wustl.edu	37	2	201619757	201619758	+	IGR	INS	-	-	TGTGTGTG	rs71022335|rs35856862|rs563268698	byFrequency	TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr2:201619757_201619758insTGTGTGTG								AC007163.3 (19857 upstream) : AOX2P (7272 downstream)																							TCCTTTCAAATtgtgtgtgtgt	0.401																																																	0								ENSG00000243478																																			AOX2P	SO:0001628	intergenic_variant	0				HGNC																													2.37:g.201619758_201619765dupTGTGTGTG		Somatic	NA	NA	NA		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL		37	NULL		2																																																																																			-	-	0	0.401					AOX2P			-				201619758	+1	no_errors	ENST00000472376	ensembl	human	known	74_37	rna	INS	0.000:0.000	TGTGTGTG
CC2D2B	387707	genome.wustl.edu	37	10	97756004	97756004	+	Frame_Shift_Del	DEL	T	T	-			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr10:97756004delT	ENST00000371198.2	+	10	1232	c.192delT	c.(190-192)gatfs	p.D64fs	ENTPD1-AS1_ENST00000451364.1_RNA|ENTPD1-AS1_ENST00000416301.1_RNA|RP11-690P14.4_ENST00000475252.2_3'UTR|ENTPD1-AS1_ENST00000452728.1_RNA|ENTPD1-AS1_ENST00000454638.1_RNA			Q6DHV5	C2D2B_HUMAN	coiled-coil and C2 domain containing 2B	0			N -> D (in dbSNP:rs17383738).							large_intestine(1)|lung(7)|ovary(1)|urinary_tract(1)	10		Colorectal(252;0.158)		Epithelial(162;7.08e-08)|all cancers(201;2.71e-06)		TTAAAGTAGATTTTGTGTAAG	0.323																																																	0								ENSG00000188649																																			CC2D2B	SO:0001589	frameshift_variant	0				HGNC	BC075861	CCDS41555.1, CCDS53560.1	10q23.33	2008-11-06	2007-10-19	2007-10-19	ENSG00000188649	ENSG00000188649			31666	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 130"""	C10orf130			Standard	NM_001001732		Approved	bA248J23.4	uc010qop.2	Q6DHV5	OTTHUMG00000018820	ENST00000371198.2:c.192delT	10.37:g.97756004delT	ENSP00000360241:p.Asp64fs	Somatic	0	80	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	A2A3E9|B4DYD4|E9PCC3|Q5VUS0	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	superfamily_C2_dom	p.F65fs	ENST00000371198.2	37	c.192		10																																																																																			-	superfamily_C2_dom		0.323	CC2D2B-201	KNOWN	basic	protein_coding	CC2D2B	protein_coding		T	NM_001001732			97756004	+1	no_errors	ENST00000371198	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
RPL23AP94	106481971	genome.wustl.edu	37	4	113451656	113451656	+	RNA	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr4:113451656G>A	ENST00000504009.1	+	0	380																											GCCGCCGCAAGGTGGGTGACG	0.522																																																	0								ENSG00000249509																																			RP11-402J6.1			0			-	Clone_based_vega_gene																													4.37:g.113451656G>A		Somatic	0	47	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	20	16.67		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000504009.1	37	NULL		4																																																																																			-	-		0.522	RP11-402J6.1-002	KNOWN	basic	antisense	ENSG00000249509	antisense	OTTHUMT00000363894.1	G		-		113451656	+1	no_errors	ENST00000504009	ensembl	human	known	74_37	rna	SNP	1.000	A
RP5-1052I5.2	0	genome.wustl.edu	37	1	87599167	87599167	+	Intron	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr1:87599167C>T	ENST00000370548.2	+	7	839				RP5-1052I5.1_ENST00000484933.2_lincRNA|HS2ST1_ENST00000356813.4_Intron																							GGCTTATTTTCTTCTCCCAGG	0.478																																																	0								ENSG00000267272																																			RP5-1052I5.1	SO:0001627	intron_variant	0			-	Clone_based_vega_gene																												ENST00000370548.2:c.767-130C>T	1.37:g.87599167C>T		Somatic	0	63	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	33	17.50		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000370548.2	37	NULL		1																																																																																			-	-		0.478	RP5-1052I5.2-001	PUTATIVE	basic|appris_principal|readthrough_transcript	protein_coding	LOC339524	protein_coding	OTTHUMT00000457517.1	C		-		87599167	+1	no_errors	ENST00000467438	ensembl	human	known	74_37	rna	SNP	0.000	T
ESPL1	9700	genome.wustl.edu	37	12	53680601	53680601	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr12:53680601C>T	ENST00000257934.4	+	18	4172	c.4081C>T	c.(4081-4083)Ccc>Tcc	p.P1361S	ESPL1_ENST00000552462.1_Missense_Mutation_p.P1361S	NM_012291.4	NP_036423.4	Q14674	ESPL1_HUMAN	extra spindle pole bodies homolog 1 (S. cerevisiae)	1361					apoptotic process (GO:0006915)|cytokinesis (GO:0000910)|establishment of mitotic spindle localization (GO:0040001)|homologous chromosome segregation (GO:0045143)|meiotic spindle organization (GO:0000212)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of sister chromatid cohesion (GO:0045875)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)	centrosome (GO:0005813)|cytosol (GO:0005829)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|cysteine-type peptidase activity (GO:0008234)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(10)|large_intestine(12)|lung(21)|ovary(2)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(8)	70						CCCTCATGTCCCCTTCACGGT	0.582																																					Colon(53;1069 1201 2587 5382)												0								ENSG00000135476						73.0	53.0	60.0					12																	53680601		2203	4300	6503	ESPL1	SO:0001583	missense	0			-	HGNC	D79987	CCDS8852.1	12q13.13	2014-08-04	2013-05-03		ENSG00000135476	ENSG00000135476	3.4.22.49		16856	protein-coding gene	gene with protein product	"""separin"", ""separase"", ""separin, cysteine protease"""	604143	"""extra spindle poles like 1 (S. cerevisiae)"""			8724849, 16258266	Standard	NM_012291		Approved	KIAA0165, ESP1, SEPA	uc001sck.2	Q14674	OTTHUMG00000169674	ENST00000257934.4:c.4081C>T	12.37:g.53680601C>T	ENSP00000257934:p.Pro1361Ser	Somatic	0	50	0.00		0.41568620468393047	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	46	9.80		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_C50,superfamily_DsrEFH-like	p.P1361S	ENST00000257934.4	37	c.4081	CCDS8852.1	12	.	.	.	.	.	.	.	.	.	.	C	13.92	2.381317	0.42207	.	.	ENSG00000135476	ENST00000257934;ENST00000552671;ENST00000552462	T;T	0.12361	2.69;2.69	5.19	4.28	0.50868	.	0.122077	0.56097	D	0.000022	T	0.13586	0.0329	M	0.71581	2.175	0.34442	D	0.699688	P	0.36144	0.539	B	0.28011	0.085	T	0.10776	-1.0615	10	0.31617	T	0.26	.	9.7788	0.40637	0.0:0.9049:0.0:0.0951	.	1361	Q14674	ESPL1_HUMAN	S	1361;1036;1361	ENSP00000257934:P1361S;ENSP00000449831:P1361S	ENSP00000257934:P1361S	P	+	1	0	ESPL1	51966868	0.635000	0.27199	0.983000	0.44433	0.683000	0.39861	2.609000	0.46317	2.709000	0.92574	0.655000	0.94253	CCC	-	NULL		0.582	ESPL1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ESPL1	protein_coding	OTTHUMT00000406899.2	C	NM_012291	-		53680601	+1	no_errors	ENST00000257934	ensembl	human	known	74_37	missense	SNP	0.948	T
LINGO1	84894	genome.wustl.edu	37	15	77907556	77907556	+	Silent	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr15:77907556C>T	ENST00000355300.6	-	2	867	c.693G>A	c.(691-693)cgG>cgA	p.R231R	LINGO1_ENST00000561030.1_Silent_p.R225R	NM_032808.5	NP_116197.4	Q96FE5	LIGO1_HUMAN	leucine rich repeat and Ig domain containing 1	231					central nervous system neuron development (GO:0021954)|negative regulation of axonogenesis (GO:0050771)|negative regulation of oligodendrocyte differentiation (GO:0048715)|neuron projection development (GO:0031175)|neurotrophin TRK receptor signaling pathway (GO:0048011)|protein kinase B signaling (GO:0043491)|regulation of axonogenesis (GO:0050770)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(16)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	31						AGGAGTAGTCCCGGATGGCAT	0.592																																																	0								ENSG00000169783						111.0	121.0	118.0					15																	77907556		2174	4268	6442	LINGO1	SO:0001819	synonymous_variant	0			-	HGNC	AK027500	CCDS45313.1, CCDS73766.1	15q24	2013-01-11	2007-02-01	2007-02-01		ENSG00000169783		"""Immunoglobulin superfamily / I-set domain containing"""	21205	protein-coding gene	gene with protein product		609791	"""leucine rich repeat neuronal 6A"""	LRRN6A		14686891	Standard	XM_006720723		Approved	FLJ14594, LERN1	uc002bct.1	Q96FE5		ENST00000355300.6:c.693G>A	15.37:g.77907556C>T		Somatic	0	29	0.00		0.41568620468393047	13	13.33	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	27	25.00	D3DW80|Q6NUK3|Q6UXM3|Q6VVG0|Q6VVG1|Q6VVG2|Q8N3K5|Q96K52	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Leu-rich_rpt,pfam_Ig_I-set,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.R231	ENST00000355300.6	37	c.693	CCDS45313.1	15																																																																																			-	smart_Leu-rich_rpt_typical-subtyp		0.592	LINGO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LINGO1	protein_coding	OTTHUMT00000419546.1	C	NM_032808	-		77907556	-1	no_errors	ENST00000355300	ensembl	human	known	74_37	silent	SNP	1.000	T
NUP210L	91181	genome.wustl.edu	37	1	154042818	154042818	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr1:154042818G>A	ENST00000368559.3	-	17	2556	c.2485C>T	c.(2485-2487)Cat>Tat	p.H829Y	NUP210L_ENST00000271854.3_Missense_Mutation_p.H829Y	NM_207308.2	NP_997191.2	Q5VU65	P210L_HUMAN	nucleoporin 210kDa-like	829					Sertoli cell development (GO:0060009)|spermatid development (GO:0007286)	integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(12)|lung(34)|ovary(4)|pancreas(1)|prostate(2)|skin(6)|urinary_tract(2)	80	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)			TCTTCGAAATGGGCTAGTGTT	0.378																																																	0								ENSG00000143552						150.0	137.0	141.0					1																	154042818		1905	4112	6017	NUP210L	SO:0001583	missense	0			-	HGNC	AK125924	CCDS41399.1, CCDS53370.1	1q21.3	2008-02-05			ENSG00000143552	ENSG00000143552			29915	protein-coding gene	gene with protein product							Standard	NM_207308		Approved		uc001fdw.3	Q5VU65	OTTHUMG00000035852	ENST00000368559.3:c.2485C>T	1.37:g.154042818G>A	ENSP00000357547:p.His829Tyr	Somatic	0	47	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	41	29.31	E7EP56|Q5T4L7|Q6ZRN1|Q6ZRT4|Q6ZU81|Q8NDI6|Q9UF31	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Big_2,superfamily_Invasin/intimin_cell_adhesion,smart_Big_2	p.H829Y	ENST00000368559.3	37	c.2485	CCDS41399.1	1	.	.	.	.	.	.	.	.	.	.	G	11.09	1.536296	0.27475	.	.	ENSG00000143552	ENST00000368559;ENST00000271854	T;T	0.41758	0.99;0.99	5.12	-1.36	0.09085	.	0.785466	0.11330	N	0.575093	T	0.04318	0.0119	N	0.08118	0	0.22142	N	0.999332	B;B	0.06786	0.001;0.0	B;B	0.06405	0.002;0.001	T	0.42275	-0.9461	10	0.02654	T	1	-15.3064	4.9854	0.14187	0.3951:0.0:0.463:0.1419	.	829;829	E7EP56;Q5VU65	.;P210L_HUMAN	Y	829	ENSP00000357547:H829Y;ENSP00000271854:H829Y	ENSP00000271854:H829Y	H	-	1	0	NUP210L	152309442	0.986000	0.35501	0.970000	0.41538	0.986000	0.74619	0.224000	0.17738	0.125000	0.18397	0.498000	0.49722	CAT	-	NULL		0.378	NUP210L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP210L	protein_coding	OTTHUMT00000087270.3	G	NM_207308	-		154042818	-1	no_errors	ENST00000368559	ensembl	human	known	74_37	missense	SNP	0.933	A
DNMT1	1786	genome.wustl.edu	37	19	10265626	10265628	+	In_Frame_Del	DEL	CTG	CTG	-			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	CTG	CTG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr19:10265626_10265628delCTG	ENST00000340748.4	-	19	1784_1786	c.1549_1551delCAG	c.(1549-1551)cagdel	p.Q517del	DNMT1_ENST00000359526.4_In_Frame_Del_p.Q533del|DNMT1_ENST00000540357.1_In_Frame_Del_p.Q517del			P26358	DNMT1_HUMAN	DNA (cytosine-5-)-methyltransferase 1	517	DNA replication foci-targeting sequence. {ECO:0000250}.|Interaction with the PRC2/EED-EZH2 complex. {ECO:0000250}.				cellular response to amino acid stimulus (GO:0071230)|chromatin modification (GO:0016568)|DNA methylation (GO:0006306)|gene silencing (GO:0016458)|maintenance of DNA methylation (GO:0010216)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of gene expression (GO:0010628)|positive regulation of histone H3-K4 methylation (GO:0051571)|regulation of cell proliferation (GO:0042127)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)|replication fork (GO:0005657)	chromatin binding (GO:0003682)|DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA binding (GO:0003677)|DNA-methyltransferase activity (GO:0009008)|methyl-CpG binding (GO:0008327)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.Q517P(1)		breast(5)|endometrium(8)|kidney(5)|large_intestine(21)|lung(11)|ovary(2)|pancreas(1)|prostate(10)|skin(5)|stomach(1)|urinary_tract(1)	70			OV - Ovarian serous cystadenocarcinoma(20;1.59e-09)|Epithelial(33;2.86e-06)|all cancers(31;6.68e-06)		Azacitidine(DB00928)|Decitabine(DB01262)|Flucytosine(DB01099)|Procainamide(DB01035)	CGGAATTGCTCTGCAGGAACTCC	0.512																																																	1	Substitution - Missense(1)	large_intestine(1)						ENSG00000130816																																			DNMT1	SO:0001651	inframe_deletion	0				HGNC	X63692	CCDS12228.1, CCDS45958.1	19p13.2	2014-09-17				ENSG00000130816	2.1.1.37		2976	protein-coding gene	gene with protein product		126375		DNMT		1594447	Standard	NM_001379		Approved	MCMT, CXXC9	uc010xlc.2	P26358		ENST00000340748.4:c.1549_1551delCAG	19.37:g.10265626_10265628delCTG	ENSP00000345739:p.Gln517del	Somatic	0	74	0.00		0.41568620468393047	14	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	23	8.00	A0AV63|B7ZLW6|Q9UHG5|Q9ULA2|Q9UMZ6	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pirsf_DNA_C5-MeTrfase_1_euk,pfam_C5_MeTfrase,pfam_BAH_dom,pfam_Cytosine_MeTrfase1_RFD,pfam_DMAP1-bd,pfam_Znf_CXXC,smart_BAH_dom,prints_C5_MeTfrase,pfscan_BAH_dom,pfscan_Znf_CXXC	p.Q533in_frame_del	ENST00000340748.4	37	c.1599_1597	CCDS12228.1	19																																																																																			-	pirsf_DNA_C5-MeTrfase_1_euk,pfam_Cytosine_MeTrfase1_RFD		0.512	DNMT1-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	DNMT1	protein_coding	OTTHUMT00000451166.1	CTG	NM_001379			10265628	-1	no_errors	ENST00000359526	ensembl	human	known	74_37	in_frame_del	DEL	0.985:1.000:1.000	-
ZSCAN30	100101467	genome.wustl.edu	37	18	32843492	32843492	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr18:32843492C>T	ENST00000420878.3	-	4	993	c.538G>A	c.(538-540)Gct>Act	p.A180T	ZNF397_ENST00000589420.1_Intron|ZSCAN30_ENST00000601405.1_3'UTR|ZSCAN30_ENST00000589178.1_Missense_Mutation_p.A180T|ZSCAN30_ENST00000333206.5_Missense_Mutation_p.A180T|ZSCAN30_ENST00000383091.2_Missense_Mutation_p.A180T	NM_001166012.1	NP_001159484.1	Q86W11	ZSC30_HUMAN	zinc finger and SCAN domain containing 30	180					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(5)|lung(3)|urinary_tract(1)	9						TCCTGGAAAGCCTGGGACTCC	0.537																																																	0								ENSG00000186814						105.0	97.0	100.0					18																	32843492		1568	3582	5150	ZSCAN30	SO:0001583	missense	0			-	HGNC	AY234408	CCDS42427.1, CCDS74207.1	18q12.2	2013-01-08	2010-07-23	2010-07-23	ENSG00000186814	ENSG00000186814		"""-"", ""Zinc fingers, C2H2-type"""	33517	protein-coding gene	gene with protein product			"""zinc finger protein 397 opposite strand"", ""ZNF397 opposite strand"""	ZNF397OS		12801647	Standard	NM_001166012		Approved	ZNF917	uc002kym.3	Q86W11		ENST00000420878.3:c.538G>A	18.37:g.32843492C>T	ENSP00000392371:p.Ala180Thr	Somatic	0	59	0.00		0.41568620468393047	7	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	42	20.75	B4E0N0|Q6ZNB3|Q96PN3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.A180T	ENST00000420878.3	37	c.538	CCDS42427.1	18	.	.	.	.	.	.	.	.	.	.	C	3.218	-0.160082	0.06502	.	.	ENSG00000186814	ENST00000420878;ENST00000333206;ENST00000383091	T;T;T	0.06687	3.27;3.27;4.27	3.78	0.901	0.19284	.	.	.	.	.	T	0.05547	0.0146	L	0.34521	1.04	0.09310	N	1	B;B	0.17465	0.022;0.003	B;B	0.12837	0.008;0.004	T	0.46911	-0.9157	9	0.10111	T	0.7	.	6.5582	0.22471	0.0:0.677:0.0:0.323	.	180;180	C9JCM2;Q86W11	.;ZSC30_HUMAN	T	180	ENSP00000392371:A180T;ENSP00000329738:A180T;ENSP00000372569:A180T	ENSP00000329738:A180T	A	-	1	0	ZSCAN30	31097490	0.000000	0.05858	0.068000	0.19968	0.661000	0.39034	-0.861000	0.04268	0.172000	0.19760	0.455000	0.32223	GCT	-	NULL		0.537	ZSCAN30-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZSCAN30	protein_coding	OTTHUMT00000442510.1	C	NM_001112734	-		32843492	-1	no_errors	ENST00000333206	ensembl	human	known	74_37	missense	SNP	0.078	T
CNGA4	1262	genome.wustl.edu	37	11	6265537	6265537	+	Silent	SNP	C	C	T	rs560979109		TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr11:6265537C>T	ENST00000379936.2	+	6	1741	c.1626C>T	c.(1624-1626)ccC>ccT	p.P542P		NM_001037329.3	NP_001032406.1	Q8IV77	CNGA4_HUMAN	cyclic nucleotide gated channel alpha 4	542					phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|sensory perception of smell (GO:0007608)	integral component of plasma membrane (GO:0005887)	cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)	p.P542P(1)		endometrium(2)|kidney(1)|large_intestine(9)|lung(24)|prostate(3)|skin(1)	40		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;2.04e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GGCCAATGCCCGAGGACCTGG	0.607													C|||	1	0.000199681	0.0	0.0014	5008	,	,		17683	0.0		0.0	False		,,,				2504	0.0																1	Substitution - coding silent(1)	lung(1)						ENSG00000132259						51.0	53.0	53.0					11																	6265537		2201	4296	6497	CNGA4	SO:0001819	synonymous_variant	0			-	HGNC	AK122736	CCDS31408.1	11p15.4	2011-07-05		2002-01-18		ENSG00000132259		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2152	protein-coding gene	gene with protein product		609472	"""cyclic nucleotide gated channel beta 2"""	CNCA2, CNGB2		11764791, 16382102	Standard	NM_001037329		Approved	OCNC2, OCNCb, CNG5	uc001mco.3	Q8IV77		ENST00000379936.2:c.1626C>T	11.37:g.6265537C>T		Somatic	0	59	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	37	13.95		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_cNMP-bd_dom,pfam_Ion_trans_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom	p.P542	ENST00000379936.2	37	c.1626	CCDS31408.1	11																																																																																			-	NULL		0.607	CNGA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNGA4	protein_coding	OTTHUMT00000383765.2	C	NM_001037329	-		6265537	+1	no_errors	ENST00000379936	ensembl	human	known	74_37	silent	SNP	0.065	T
LMO7	4008	genome.wustl.edu	37	13	76374986	76374986	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr13:76374986C>T	ENST00000341547.4	+	8	2045	c.785C>T	c.(784-786)tCc>tTc	p.S262F	LMO7_ENST00000526202.1_Missense_Mutation_p.S171F|LMO7_ENST00000465261.2_5'UTR|LMO7_ENST00000321797.8_5'UTR|RP11-29G8.3_ENST00000563635.1_RNA|LMO7_ENST00000357063.3_Missense_Mutation_p.S262F|LMO7_ENST00000377534.3_Missense_Mutation_p.S262F	NM_005358.5	NP_005349.3	Q8WWI1	LMO7_HUMAN	LIM domain 7	262					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(20)|lung(15)|ovary(2)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		Breast(118;0.0992)		GBM - Glioblastoma multiforme(99;0.0109)		ACAAGCTGCTCCTCTGATATC	0.468																																																	0								ENSG00000136153						173.0	180.0	178.0					13																	76374986		2203	4300	6503	LMO7	SO:0001583	missense	0			-	HGNC	AF092557	CCDS9454.1, CCDS53876.1	13q22.2	2008-02-05	2004-06-15		ENSG00000136153	ENSG00000136153			6646	protein-coding gene	gene with protein product	"""F-box only protein 20"""	604362	"""LIM domain only 7"""	FBXO20		9826547, 10531035	Standard	NM_005358		Approved	FBX20, KIAA0858	uc021rkq.1	Q8WWI1	OTTHUMG00000017093	ENST00000341547.4:c.785C>T	13.37:g.76374986C>T	ENSP00000342112:p.Ser262Phe	Somatic	0	71	0.00		0.41568620468393047	0	100.00	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	37	22.92	E9PLH4|O15462|O95346|Q5TBK6|Q9UKC1|Q9UQM5|Q9Y6A7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_CH-domain,pfam_PDZ,superfamily_CH-domain,superfamily_PDZ,smart_CH-domain,smart_PDZ,pfscan_CH-domain,pfscan_PDZ,prints_SM22_calponin	p.S262F	ENST00000341547.4	37	c.785	CCDS9454.1	13	.	.	.	.	.	.	.	.	.	.	C	22.4	4.279443	0.80692	.	.	ENSG00000136153	ENST00000341547;ENST00000357063;ENST00000377534;ENST00000377499;ENST00000526202	T;T;T;T;T	0.61392	0.74;0.57;0.58;0.25;0.11	5.61	2.9	0.33743	.	0.137650	0.51477	N	0.000095	T	0.71753	0.3377	M	0.75777	2.31	0.49213	D	0.999767	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.91635	0.998;0.998;0.999	T	0.70605	-0.4826	10	0.87932	D	0	-2.3194	8.6695	0.34140	0.0:0.7364:0.126:0.1376	.	171;262;210	E9PMS6;Q8WWI1-3;F8J2B5	.;.;.	F	262;262;262;210;171	ENSP00000342112:S262F;ENSP00000349571:S262F;ENSP00000366757:S262F;ENSP00000366719:S210F;ENSP00000431129:S171F	ENSP00000342112:S262F	S	+	2	0	LMO7	75272987	1.000000	0.71417	0.998000	0.56505	0.970000	0.65996	2.902000	0.48703	0.298000	0.22638	0.591000	0.81541	TCC	-	NULL		0.468	LMO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LMO7	protein_coding	OTTHUMT00000045297.1	C	NM_005358	-		76374986	+1	no_errors	ENST00000357063	ensembl	human	known	74_37	missense	SNP	1.000	T
MOXD1	26002	genome.wustl.edu	37	6	132619016	132619016	+	Nonsense_Mutation	SNP	C	C	T	rs140134245		TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr6:132619016C>T	ENST00000367963.3	-	11	1705	c.1587G>A	c.(1585-1587)tgG>tgA	p.W529*	MOXD1_ENST00000336749.3_Nonsense_Mutation_p.W461*	NM_015529.2	NP_056344.2	Q6UVY6	MOXD1_HUMAN	monooxygenase, DBH-like 1	529						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	copper ion binding (GO:0005507)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced ascorbate as one donor, and incorporation of one atom of oxygen (GO:0016715)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(15)|ovary(1)|prostate(3)|skin(1)	37	Breast(56;0.0495)			OV - Ovarian serous cystadenocarcinoma(155;0.0132)|GBM - Glioblastoma multiforme(226;0.0191)		CCTTTTTAGTCCATTTAAACT	0.403													C|||	1	0.000199681	0.0008	0.0	5008	,	,		15939	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000079931						114.0	105.0	108.0					6																	132619016		2203	4300	6503	MOXD1	SO:0001587	stop_gained	0			GMAF=0.0005	HGNC	AY007239	CCDS5152.2	6q23.2	2010-09-24			ENSG00000079931	ENSG00000079931			21063	protein-coding gene	gene with protein product		609000				9751809	Standard	XM_006715456		Approved	DKFZP564G202, MOX, dJ248E1.1	uc003qdf.3	Q6UVY6	OTTHUMG00000055853	ENST00000367963.3:c.1587G>A	6.37:g.132619016C>T	ENSP00000356940:p.Trp529*	Somatic	0	83	0.00		0.41568620468393047	52	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	48	15.79	Q5THU6|Q8NC97|Q8WV49|Q9H4M6|Q9Y4U3	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cu2_ascorb_mOase_N,pfam_DOMON_domain,superfamily_PHM/PNGase_F_dom,smart_DOMON_domain,pfscan_DOMON_domain,prints_Dopamine_b_mOase	p.W529*	ENST00000367963.3	37	c.1587	CCDS5152.2	6	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	39	7.475749	0.98306	.	.	ENSG00000079931	ENST00000367963;ENST00000336749	.	.	.	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.6999	18.8014	0.92018	0.0:1.0:0.0:0.0	.	.	.	.	X	529;461	.	ENSP00000336998:W461X	W	-	3	0	MOXD1	132660709	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	5.628000	0.67791	2.882000	0.98803	0.655000	0.94253	TGG	-	NULL		0.403	MOXD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MOXD1	protein_coding	OTTHUMT00000125837.1	C	NM_015529	rs140134245		132619016	-1	no_errors	ENST00000367963	ensembl	human	known	74_37	nonsense	SNP	1.000	T
OR2M2	391194	genome.wustl.edu	37	1	248343813	248343813	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr1:248343813C>T	ENST00000359682.2	+	1	526	c.526C>T	c.(526-528)Cac>Tac	p.H176Y		NM_001004688.1	NP_001004688.1	Q96R28	OR2M2_HUMAN	olfactory receptor, family 2, subfamily M, member 2	176						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(45)|ovary(3)|prostate(1)|skin(3)	70	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			GGAAATAGCCCACTTCTTCTG	0.418																																																	0								ENSG00000198601						234.0	229.0	231.0					1																	248343813		2203	4300	6503	OR2M2	SO:0001583	missense	0			-	HGNC	AF399616	CCDS31106.1	1q44	2012-08-09			ENSG00000198601	ENSG00000198601		"""GPCR / Class A : Olfactory receptors"""	8268	protein-coding gene	gene with protein product						12213199	Standard	NM_001004688		Approved	OST423, OR2M2Q	uc010pzf.2	Q96R28	OTTHUMG00000040460	ENST00000359682.2:c.526C>T	1.37:g.248343813C>T	ENSP00000352710:p.His176Tyr	Somatic	0	110	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	55	22.54	A3KFT4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.H176Y	ENST00000359682.2	37	c.526	CCDS31106.1	1	.	.	.	.	.	.	.	.	.	.	c	13.14	2.149317	0.37923	.	.	ENSG00000198601	ENST00000359682	T	0.00183	8.6	1.88	1.88	0.25563	GPCR, rhodopsin-like superfamily (1);	0.000000	0.31976	U	0.006772	T	0.00608	0.0020	M	0.90252	3.1	0.21675	N	0.999599	D	0.69078	0.997	D	0.68943	0.961	T	0.19844	-1.0293	10	0.87932	D	0	.	11.6433	0.51246	0.0:1.0:0.0:0.0	.	176	Q96R28	OR2M2_HUMAN	Y	176	ENSP00000352710:H176Y	ENSP00000352710:H176Y	H	+	1	0	OR2M2	246410436	0.018000	0.18449	0.216000	0.23742	0.030000	0.12068	1.779000	0.38624	1.056000	0.40484	0.454000	0.30748	CAC	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt		0.418	OR2M2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2M2	protein_coding	OTTHUMT00000097356.2	C	NM_001004688	-		248343813	+1	no_errors	ENST00000359682	ensembl	human	known	74_37	missense	SNP	0.985	T
TECTA	7007	genome.wustl.edu	37	11	121016456	121016456	+	Missense_Mutation	SNP	G	G	A	rs200218954		TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr11:121016456G>A	ENST00000392793.1	+	12	4007	c.3736G>A	c.(3736-3738)Ggc>Agc	p.G1246S	TECTA_ENST00000264037.2_Missense_Mutation_p.G1246S|TECTA_ENST00000478058.1_3'UTR			O75443	TECTA_HUMAN	tectorin alpha	1246	VWFD 3. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cell-matrix adhesion (GO:0007160)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)			TECTA/TBCEL(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|liver(1)|lung(46)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	135	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		CCGCTACAACGGCAACCCTGA	0.542													G|||	1	0.000199681	0.0	0.0	5008	,	,		22553	0.001		0.0	False		,,,				2504	0.0																0								ENSG00000109927						151.0	123.0	132.0					11																	121016456		2203	4299	6502	TECTA	SO:0001583	missense	0			GMAF=0.0005	HGNC	AF055136	CCDS8434.1	11q22-q24	2008-02-05			ENSG00000109927	ENSG00000109927			11720	protein-coding gene	gene with protein product		602574		DFNA12, DFNA8, DFNB21		9503015, 9590290	Standard	NM_005422		Approved		uc010rzo.2	O75443	OTTHUMG00000149908	ENST00000392793.1:c.3736G>A	11.37:g.121016456G>A	ENSP00000376543:p.Gly1246Ser	Somatic	0	48	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	32	13.51		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_ZP_dom,pfam_Nidogen_extracell_dom,pfam_TIL_dom,superfamily_TIL_dom,smart_Nidogen_extracell_dom,smart_VWC_out,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EG-like_dom,smart_ZP_dom,pfscan_ZP_dom	p.G1246S	ENST00000392793.1	37	c.3736	CCDS8434.1	11	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	15.33	2.802809	0.50315	.	.	ENSG00000109927	ENST00000392793;ENST00000264037	T;T	0.63913	-0.07;-0.07	5.76	2.37	0.29283	von Willebrand factor, type D domain (3);	0.277684	0.31370	N	0.007773	T	0.52869	0.1761	L	0.53561	1.675	0.35851	D	0.826744	B	0.27316	0.175	B	0.19148	0.024	T	0.54931	-0.8219	10	0.46703	T	0.11	.	10.4479	0.44505	0.2416:0.0:0.7584:0.0	.	1246	O75443	TECTA_HUMAN	S	1246	ENSP00000376543:G1246S;ENSP00000264037:G1246S	ENSP00000264037:G1246S	G	+	1	0	TECTA	120521666	0.992000	0.36948	0.805000	0.32314	0.925000	0.55904	2.123000	0.41996	0.180000	0.19960	-0.216000	0.12614	GGC	-	pfam_VWF_type-D,smart_VWF_type-D		0.542	TECTA-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	TECTA	protein_coding	OTTHUMT00000313850.1	G	NM_005422	rs200218954		121016456	+1	no_errors	ENST00000264037	ensembl	human	known	74_37	missense	SNP	0.996	A
PMS1	5378	genome.wustl.edu	37	2	190720629	190720629	+	Intron	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr2:190720629C>T	ENST00000441310.2	+	9	2089				PMS1_ENST00000432292.3_Intron|PMS1_ENST00000418224.3_Intron|PMS1_ENST00000421722.1_3'UTR|PMS1_ENST00000447232.2_Intron|PMS1_ENST00000409823.3_Intron	NM_000534.4	NP_000525.1	P54277	PMS1_HUMAN	PMS1 postmeiotic segregation increased 1 (S. cerevisiae)						ATP catabolic process (GO:0006200)|mismatch repair (GO:0006298)|response to drug (GO:0042493)	MutLalpha complex (GO:0032389)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|mismatched DNA binding (GO:0030983)|single-stranded DNA binding (GO:0003697)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(16)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36			OV - Ovarian serous cystadenocarcinoma(117;0.0013)|Epithelial(96;0.0263)|all cancers(119;0.0751)			AATTATACCTCCAATCATATA	0.289			"""Mis, N"""			"""colorectal, endometrial, ovarian"""		Direct reversal of damage;Mismatch excision repair (MMR)																															yes	Rec		Hereditary non-polyposis colorectal cancer	2	2q31-q33	5378	PMS1 postmeiotic segregation increased 1 (S. cerevisiae)		E	0								ENSG00000064933																																			PMS1	SO:0001627	intron_variant	0			-	HGNC		CCDS2302.1, CCDS46473.1, CCDS46474.1, CCDS74615.1	2q31-q33	2014-09-17	2001-11-28		ENSG00000064933	ENSG00000064933			9121	protein-coding gene	gene with protein product		600258	"""postmeiotic segregation increased (S. cerevisiae) 1"""	PMSL1		8072530	Standard	NM_000534		Approved		uc002urh.4	P54277	OTTHUMG00000132664	ENST00000441310.2:c.1856+775C>T	2.37:g.190720629C>T		Somatic	0	104	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	60	16.67	D3DPI1|Q4VAL4|Q5FBZ3|Q5FBZ6|Q5FBZ8	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000441310.2	37	NULL	CCDS2302.1	2																																																																																			-	-		0.289	PMS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PMS1	protein_coding	OTTHUMT00000255918.2	C		-		190720629	+1	no_errors	ENST00000421722	ensembl	human	known	74_37	rna	SNP	0.000	T
SUMF1	285362	genome.wustl.edu	37	3	4452607	4452607	+	Nonsense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr3:4452607C>T	ENST00000272902.5	-	7	931	c.896G>A	c.(895-897)tGg>tAg	p.W299*	SUMF1_ENST00000458465.2_Nonsense_Mutation_p.W167*|SUMF1_ENST00000383843.5_Nonsense_Mutation_p.W274*|SUMF1_ENST00000405420.2_Nonsense_Mutation_p.W299*|SUMF1_ENST00000534863.1_Nonsense_Mutation_p.W299*	NM_182760.3	NP_877437.2	Q8NBK3	SUMF1_HUMAN	sulfatase modifying factor 1	299					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)	metal ion binding (GO:0046872)|oxidoreductase activity (GO:0016491)			breast(1)|endometrium(1)|large_intestine(2)|lung(5)|prostate(1)|upper_aerodigestive_tract(3)	13		Melanoma(143;0.068)|Colorectal(144;0.233)		Epithelial(13;0.0147)|OV - Ovarian serous cystadenocarcinoma(96;0.0444)|all cancers(10;0.0549)		AGTCCATTCCCATGCGTTCCC	0.433																																																	0								ENSG00000144455						202.0	181.0	188.0					3																	4452607		2203	4300	6503	SUMF1	SO:0001587	stop_gained	0			-	HGNC	BC017005	CCDS2564.1, CCDS54548.1, CCDS54549.1	3p26.1	2009-07-23			ENSG00000144455	ENSG00000144455			20376	protein-coding gene	gene with protein product		607939				12757705, 12757706	Standard	NM_182760		Approved	FGE, UNQ3037	uc003bpz.2	Q8NBK3	OTTHUMG00000090269	ENST00000272902.5:c.896G>A	3.37:g.4452607C>T	ENSP00000272902:p.Trp299*	Somatic	0	53	0.00		0.41568620468393047	37	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	39	13.33	B4DXK5|B7XD05|E9PGL0|G5E9B0|Q0VAC6|Q0VAC7|Q2NL78|Q53ZE4|Q6UY39|Q96AK5|Q96DK8	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_FGE_dom,superfamily_C-type_lectin_fold	p.W299*	ENST00000272902.5	37	c.896	CCDS2564.1	3	.	.	.	.	.	.	.	.	.	.	C	21.5	4.162592	0.78226	.	.	ENSG00000144455	ENST00000534982;ENST00000534863;ENST00000272902;ENST00000383843;ENST00000458465;ENST00000405420	.	.	.	5.42	5.42	0.78866	.	0.105878	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-26.0734	17.9951	0.89181	0.0:1.0:0.0:0.0	.	.	.	.	X	299;299;299;274;167;299	.	ENSP00000272902:W299X	W	-	2	0	SUMF1	4427607	1.000000	0.71417	0.996000	0.52242	0.307000	0.27823	6.955000	0.76007	2.544000	0.85801	0.561000	0.74099	TGG	-	pfam_FGE_dom,superfamily_C-type_lectin_fold		0.433	SUMF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUMF1	protein_coding	OTTHUMT00000206591.2	C	NM_182760	-		4452607	-1	no_errors	ENST00000448413	ensembl	human	known	74_37	nonsense	SNP	1.000	T
RP11-509A17.3	0	genome.wustl.edu	37	15	20563402	20563402	+	lincRNA	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr15:20563402C>T	ENST00000557528.1	+	0	1812				AC026495.1_ENST00000581090.1_RNA																							CCTTGTCCTCCCAGAGcctct	0.672																																																	0								ENSG00000265002																																			AC026495.1			0			-	Clone_based_ensembl_gene																													15.37:g.20563402C>T		Somatic	0	49	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	38	15.56		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000557528.1	37	NULL		15																																																																																			-	-		0.672	RP11-509A17.3-001	KNOWN	basic	lincRNA	ENSG00000265002	lincRNA	OTTHUMT00000414658.1	C		-		20563402	+1	no_errors	ENST00000581090	ensembl	human	novel	74_37	rna	SNP	0.067	T
PER3	8863	genome.wustl.edu	37	1	7886594	7886594	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr1:7886594C>T	ENST00000361923.2	+	16	2163	c.1988C>T	c.(1987-1989)cCt>cTt	p.P663L	RP3-467L1.4_ENST00000451646.1_RNA|PER3_ENST00000377532.3_Missense_Mutation_p.P671L	NM_016831.1	NP_058515.1	P56645	PER3_HUMAN	period circadian clock 3	663	CSNK1E binding domain. {ECO:0000250}.				circadian regulation of gene expression (GO:0032922)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of circadian sleep/wake cycle, sleep (GO:0045187)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	signal transducer activity (GO:0004871)			breast(4)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	39	Ovarian(185;0.0634)|all_lung(157;0.178)	all_epithelial(116;9.35e-21)|all_lung(118;7.57e-07)|Lung NSC(185;4.52e-06)|Renal(390;0.000147)|Breast(487;0.00086)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|all cancers(8;8.58e-70)|GBM - Glioblastoma multiforme(8;1.81e-35)|Colorectal(212;2.06e-07)|COAD - Colon adenocarcinoma(227;1.92e-05)|Kidney(185;7.18e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000472)|STAD - Stomach adenocarcinoma(132;0.00118)|KIRC - Kidney renal clear cell carcinoma(229;0.00122)|READ - Rectum adenocarcinoma(331;0.0649)		CAGCCAGCCCCTTTGACCTCG	0.468																																																	0								ENSG00000049246						60.0	58.0	58.0					1																	7886594		2203	4300	6503	PER3	SO:0001583	missense	0			-	HGNC	BC026102	CCDS89.1, CCDS72695.1	1p36.23	2012-12-13	2012-12-13		ENSG00000049246	ENSG00000049246			8847	protein-coding gene	gene with protein product		603427	"""period (Drosophila) homolog 3"", ""period homolog 3 (Drosophila)"""			9427249	Standard	XM_005263520		Approved		uc001aoo.3	P56645	OTTHUMG00000001216	ENST00000361923.2:c.1988C>T	1.37:g.7886594C>T	ENSP00000355031:p.Pro663Leu	Somatic	0	74	0.00		0.41568620468393047	10	41.18	7	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	51	17.74	Q5H8X4|Q5H8X5|Q969K6|Q96S77|Q96S78|Q9C0J3|Q9NSP9|Q9UGU8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Period_circadian-like_C,pfam_PAS_fold_3,pfam_PAS_fold,superfamily_PAS,smart_PAS,pfscan_PAS	p.P663L	ENST00000361923.2	37	c.1988	CCDS89.1	1	.	.	.	.	.	.	.	.	.	.	C	12.60	1.987140	0.35036	.	.	ENSG00000049246	ENST00000377532;ENST00000361923	T;T	0.12672	2.69;2.66	4.62	2.68	0.31781	.	0.809048	0.11240	N	0.584697	T	0.19208	0.0461	M	0.64997	1.995	0.09310	N	1	P;P;D;P	0.53885	0.92;0.938;0.963;0.92	P;B;P;P	0.48921	0.468;0.391;0.595;0.468	T	0.14699	-1.0463	10	0.59425	D	0.04	.	4.801	0.13296	0.1789:0.6407:0.0:0.1804	.	663;671;671;663	A2I2N5;A6H8X0;P56645-2;P56645	.;.;.;PER3_HUMAN	L	671;663	ENSP00000366755:P671L;ENSP00000355031:P663L	ENSP00000355031:P663L	P	+	2	0	PER3	7809181	0.000000	0.05858	0.000000	0.03702	0.016000	0.09150	0.102000	0.15272	0.516000	0.28340	0.655000	0.94253	CCT	-	NULL		0.468	PER3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	PER3	protein_coding	OTTHUMT00000003607.1	C	NM_016831	-		7886594	+1	no_errors	ENST00000361923	ensembl	human	known	74_37	missense	SNP	0.001	T
OR4C13	283092	genome.wustl.edu	37	11	49974639	49974639	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr11:49974639C>T	ENST00000555099.1	+	1	697	c.665C>T	c.(664-666)tCc>tTc	p.S222F		NM_001001955.2	NP_001001955.2	Q8NGP0	OR4CD_HUMAN	olfactory receptor, family 4, subfamily C, member 13	222						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(24)|ovary(2)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	43						ATACTGTACTCCTTAAAGACC	0.478																																																	0								ENSG00000258817						182.0	149.0	160.0					11																	49974639		2201	4296	6497	OR4C13	SO:0001583	missense	0			-	HGNC	AB065750	CCDS31495.1	11p11.12	2012-10-03			ENSG00000258817	ENSG00000258817		"""GPCR / Class A : Olfactory receptors"""	15169	protein-coding gene	gene with protein product							Standard	NM_001001955		Approved		uc010rhz.2	Q8NGP0	OTTHUMG00000166686	ENST00000555099.1:c.665C>T	11.37:g.49974639C>T	ENSP00000452277:p.Ser222Phe	Somatic	0	71	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	56	13.85	A6NJJ3|B9EH30|Q6IF48|Q96R68	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S222F	ENST00000555099.1	37	c.665	CCDS31495.1	11	.	.	.	.	.	.	.	.	.	.	.	5.452	0.268448	0.10349	.	.	ENSG00000258817	ENST00000555099	T	0.00091	8.74	2.7	2.7	0.31948	GPCR, rhodopsin-like superfamily (1);	0.000000	0.46145	D	0.000304	T	0.00300	0.0009	M	0.81682	2.555	0.09310	N	1	B	0.31383	0.321	B	0.43728	0.429	T	0.06303	-1.0834	9	.	.	.	.	11.1932	0.48698	0.0:1.0:0.0:0.0	.	222	Q8NGP0	OR4CD_HUMAN	F	222	ENSP00000452277:S222F	.	S	+	2	0	OR4C13	49931215	0.002000	0.14202	0.024000	0.17045	0.167000	0.22549	1.523000	0.35932	1.524000	0.49035	0.186000	0.17326	TCC	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.478	OR4C13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4C13	protein_coding	OTTHUMT00000391103.1	C	NM_001001955	-		49974639	+1	no_errors	ENST00000555099	ensembl	human	known	74_37	missense	SNP	0.096	T
FEZF1	389549	genome.wustl.edu	37	7	121943276	121943276	+	Silent	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr7:121943276G>A	ENST00000442488.2	-	2	958	c.891C>T	c.(889-891)ttC>ttT	p.F297F	FEZF1-AS1_ENST00000437317.1_RNA|FEZF1_ENST00000427185.2_Silent_p.F247F|FEZF1-AS1_ENST00000428449.1_RNA|FEZF1_ENST00000331178.4_Silent_p.F293F	NM_001024613.2|NM_001160264.1	NP_001019784.2|NP_001153736.1	A0PJY2	FEZF1_HUMAN	FEZ family zinc finger 1	297					axon guidance (GO:0007411)|forebrain anterior/posterior pattern specification (GO:0021797)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)			breast(1)|large_intestine(3)|lung(18)|ovary(2)|prostate(1)	25						TTGCTTGCCTGAAACCTTTTC	0.458																																																	0								ENSG00000128610						144.0	137.0	139.0					7																	121943276		2203	4300	6503	FEZF1	SO:0001819	synonymous_variant	0			-	HGNC	AY726588	CCDS34741.1, CCDS34741.2, CCDS55157.1	7q31.32	2013-01-08	2006-08-15	2006-08-15	ENSG00000128610	ENSG00000128610		"""Zinc fingers, C2H2-type"""	22788	protein-coding gene	gene with protein product		613301	"""zinc finger protein 312B"""	ZNF312B			Standard	NM_001024613		Approved		uc003vkd.3	A0PJY2	OTTHUMG00000157091	ENST00000442488.2:c.891C>T	7.37:g.121943276G>A		Somatic	0	103	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	36	16.28	A0PJY3|A4D0W3|B4DUP9|B7ZM98	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.F297	ENST00000442488.2	37	c.891	CCDS34741.2	7																																																																																			-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.458	FEZF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FEZF1	protein_coding	OTTHUMT00000347410.1	G	NM_001024613	-		121943276	-1	no_errors	ENST00000442488	ensembl	human	known	74_37	silent	SNP	1.000	A
ZNF709	163051	genome.wustl.edu	37	19	12575312	12575312	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr19:12575312G>A	ENST00000397732.3	-	4	1595	c.1424C>T	c.(1423-1425)cCc>cTc	p.P475L	CTD-3105H18.18_ENST00000598753.1_Intron|ZNF709_ENST00000428311.1_Missense_Mutation_p.P475L	NM_152601.3	NP_689814.1	Q8N972	ZN709_HUMAN	zinc finger protein 709	475					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(3)|upper_aerodigestive_tract(3)	6						ACATTCATAGGGTTTCTCTCC	0.403																																					GBM(33;565 669 12371 29134 51667)												0								ENSG00000242852						90.0	96.0	94.0					19																	12575312		2203	4300	6503	ZNF709	SO:0001583	missense	0			-	HGNC	AK095600	CCDS42504.1	19p13.2	2013-01-08			ENSG00000242852	ENSG00000242852		"""Zinc fingers, C2H2-type"", ""-"""	20629	protein-coding gene	gene with protein product							Standard	NM_152601		Approved	FLJ38281	uc002mtv.4	Q8N972	OTTHUMG00000156406	ENST00000397732.3:c.1424C>T	19.37:g.12575312G>A	ENSP00000380840:p.Pro475Leu	Somatic	0	133	0.00		0.41568620468393047	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	66	29.03	A8K4E6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,pfam_Znf_C2H2_jaz,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.P475L	ENST00000397732.3	37	c.1424	CCDS42504.1	19	.	.	.	.	.	.	.	.	.	.	G	25.1	4.604007	0.87157	.	.	ENSG00000242852;ENSG00000196826	ENST00000397732;ENST00000428311	T;T	0.17054	2.3;2.3	3.05	3.05	0.35203	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.33772	N	0.004580	T	0.32496	0.0831	M	0.78223	2.4	0.43982	D	0.996673	P	0.52316	0.952	P	0.51945	0.685	T	0.36817	-0.9732	10	0.62326	D	0.03	.	13.9868	0.64341	0.0:0.0:1.0:0.0	.	475	Q8N972	ZN709_HUMAN	L	475	ENSP00000380840:P475L;ENSP00000404127:P475L	ENSP00000404127:P475L	P	-	2	0	ZNF709;CTD-2192J16.17	12436312	0.513000	0.26194	0.118000	0.21660	0.998000	0.95712	1.256000	0.32921	2.032000	0.59987	0.591000	0.81541	CCC	-	pfscan_Znf_C2H2		0.403	ZNF709-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF709	protein_coding	OTTHUMT00000344088.1	G	NM_152601	-		12575312	-1	no_errors	ENST00000397732	ensembl	human	known	74_37	missense	SNP	0.967	A
PSG11	5680	genome.wustl.edu	37	19	43519381	43519381	+	Missense_Mutation	SNP	T	T	C			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr19:43519381T>C	ENST00000401740.1	-	4	954	c.851A>G	c.(850-852)cAa>cGa	p.Q284R	PSG11_ENST00000403486.1_Missense_Mutation_p.Q162R|PSG11_ENST00000320078.7_Missense_Mutation_p.Q284R|PSG11_ENST00000595312.1_5'Flank|PSG11_ENST00000306322.7_Missense_Mutation_p.Q162R			Q00887	PSG9_HUMAN	pregnancy specific beta-1-glycoprotein 11	293	Ig-like C2-type 2.				female pregnancy (GO:0007565)	extracellular region (GO:0005576)				breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(15)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	26		Prostate(69;0.00682)				AAAGAGCTTTTGTCCTGATAG	0.463																																																	0								ENSG00000243130						166.0	167.0	167.0					19																	43519381		2199	4297	6496	PSG11	SO:0001583	missense	0			-	HGNC	U25988	CCDS12614.2, CCDS12615.2	19q13.2	2013-01-29			ENSG00000243130	ENSG00000243130		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9516	protein-coding gene	gene with protein product	"""pregnancy specific beta-1-glycoprotein 13"""	176401		PSG13, PSG14		7794280	Standard	NM_001113410		Approved	MGC22484	uc002ovm.1	Q9UQ72	OTTHUMG00000151546	ENST00000401740.1:c.851A>G	19.37:g.43519381T>C	ENSP00000384995:p.Gln284Arg	Somatic	0	238	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	38	153	19.90	B2R869|Q15227|Q15236|Q15237|Q8WW78|Q9UQ73	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.Q284R	ENST00000401740.1	37	c.851	CCDS12614.2	19	.	.	.	.	.	.	.	.	.	.	t	3.858	-0.030480	0.07543	.	.	ENSG00000243130	ENST00000320078;ENST00000403486;ENST00000306322;ENST00000401740	T;T;T;T	0.13901	2.55;2.55;2.55;2.55	0.976	-1.1	0.09872	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.10165	0.0249	L	0.38692	1.165	0.09310	N	1	B;B	0.17038	0.02;0.001	B;B	0.27608	0.081;0.017	T	0.39683	-0.9602	9	0.56958	D	0.05	.	3.2439	0.06791	0.0:0.0:0.4496:0.5504	.	162;284	Q9UQ72-2;Q9UQ72	.;PSG11_HUMAN	R	284;162;162;284	ENSP00000319140:Q284R;ENSP00000385427:Q162R;ENSP00000304913:Q162R;ENSP00000384995:Q284R	ENSP00000304913:Q162R	Q	-	2	0	PSG11	48211221	0.001000	0.12720	0.005000	0.12908	0.012000	0.07955	0.056000	0.14256	0.382000	0.24878	0.155000	0.16302	CAA	-	pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.463	PSG11-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PSG11	protein_coding	OTTHUMT00000323079.1	T	NM_002785	-		43519381	-1	no_errors	ENST00000320078	ensembl	human	known	74_37	missense	SNP	0.001	C
RYR2	6262	genome.wustl.edu	37	1	237730046	237730046	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr1:237730046G>A	ENST00000366574.2	+	28	3711	c.3394G>A	c.(3394-3396)Gaa>Aaa	p.E1132K	RYR2_ENST00000360064.6_Missense_Mutation_p.E1130K|RYR2_ENST00000542537.1_Missense_Mutation_p.E1116K	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	1132	4 X approximate repeats.|B30.2/SPRY 2. {ECO:0000255|PROSITE- ProRule:PRU00548}.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TGGCTCAGATGAACGTGCCTT	0.532																																																	0								ENSG00000198626						199.0	198.0	198.0					1																	237730046		2088	4217	6305	RYR2	SO:0001583	missense	0			-	HGNC	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.3394G>A	1.37:g.237730046G>A	ENSP00000355533:p.Glu1132Lys	Somatic	0	55	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	36	25.00	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_hand_dom,pfscan_MIR_motif	p.E1130K	ENST00000366574.2	37	c.3388	CCDS55691.1	1	.	.	.	.	.	.	.	.	.	.	G	24.3	4.512797	0.85389	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	T;T;T	0.70399	-0.48;-0.48;-0.48	5.29	5.29	0.74685	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.260768	0.29861	N	0.011009	T	0.64875	0.2638	L	0.33189	0.99	0.80722	D	1	B	0.33777	0.425	B	0.34418	0.182	T	0.68006	-0.5523	10	0.72032	D	0.01	.	18.9442	0.92615	0.0:0.0:1.0:0.0	.	1132	Q92736	RYR2_HUMAN	K	1132;1130;1116	ENSP00000355533:E1132K;ENSP00000353174:E1130K;ENSP00000443798:E1116K	ENSP00000353174:E1130K	E	+	1	0	RYR2	235796669	1.000000	0.71417	0.571000	0.28486	0.905000	0.53344	9.864000	0.99589	2.465000	0.83290	0.655000	0.94253	GAA	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY		0.532	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	protein_coding	OTTHUMT00000095402.2	G	NM_001035	-		237730046	+1	no_errors	ENST00000360064	ensembl	human	known	74_37	missense	SNP	1.000	A
ZNF385B	151126	genome.wustl.edu	37	2	180307985	180307985	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr2:180307985G>A	ENST00000410066.1	-	10	2011	c.1408C>T	c.(1408-1410)Ccg>Tcg	p.P470S	ZNF385B_ENST00000409343.1_Missense_Mutation_p.P394S|ZNF385B_ENST00000336917.5_Missense_Mutation_p.P368S|ZNF385B_ENST00000466398.1_5'UTR|ZNF385B_ENST00000409692.1_Missense_Mutation_p.P368S	NM_152520.4	NP_689733.3	Q569K4	Z385B_HUMAN	zinc finger protein 385B	470	Interaction with p53/TP53.				intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|p53 binding (GO:0002039)|zinc ion binding (GO:0008270)			breast(1)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)	26			Epithelial(96;0.174)|OV - Ovarian serous cystadenocarcinoma(117;0.201)			CGTTAGTACGGAGCAAAGAGG	0.552																																					Colon(155;204 2491 32774 51842)												0								ENSG00000144331						34.0	38.0	37.0					2																	180307985		2203	4299	6502	ZNF385B	SO:0001583	missense	0			-	HGNC	AK057999	CCDS33339.1, CCDS46463.1, CCDS46464.1	2q31.3-q32.1	2012-10-05	2007-12-06	2007-12-06	ENSG00000144331	ENSG00000144331			26332	protein-coding gene	gene with protein product		612344	"""zinc finger protein 533"""	ZNF533		12477932	Standard	NM_152520		Approved	FLJ25270	uc002unn.4	Q569K4	OTTHUMG00000154559	ENST00000410066.1:c.1408C>T	2.37:g.180307985G>A	ENSP00000386845:p.Pro470Ser	Somatic	0	161	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	79	15.96	Q49A04|Q6ZMZ7|Q8IY01|Q8N8H2|Q96DK4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2_jaz,smart_Znf_U1,smart_Znf_C2H2-like	p.P470S	ENST00000410066.1	37	c.1408	CCDS33339.1	2	.	.	.	.	.	.	.	.	.	.	G	16.71	3.197723	0.58126	.	.	ENSG00000144331	ENST00000410066;ENST00000336917;ENST00000409343;ENST00000409692	T;T;T;T	0.81163	-1.46;-1.14;-1.33;-1.14	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	D	0.88991	0.6588	M	0.64997	1.995	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.994;0.998	D	0.89623	0.3850	10	0.87932	D	0	-11.6332	19.3766	0.94512	0.0:0.0:1.0:0.0	.	470;394	Q569K4;Q569K4-2	Z385B_HUMAN;.	S	470;368;394;368	ENSP00000386845:P470S;ENSP00000338225:P368S;ENSP00000386379:P394S;ENSP00000386507:P368S	ENSP00000338225:P368S	P	-	1	0	ZNF385B	180016230	1.000000	0.71417	0.496000	0.27539	0.341000	0.28922	9.258000	0.95555	2.565000	0.86533	0.561000	0.74099	CCG	-	NULL		0.552	ZNF385B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF385B	protein_coding	OTTHUMT00000335972.1	G	NM_152520	-		180307985	-1	no_errors	ENST00000410066	ensembl	human	known	74_37	missense	SNP	1.000	A
SLFN13	146857	genome.wustl.edu	37	17	33772392	33772392	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr17:33772392C>T	ENST00000285013.6	-	3	583	c.308G>A	c.(307-309)aGg>aAg	p.R103K	SLFN13_ENST00000526861.1_Missense_Mutation_p.R103K|SLFN13_ENST00000533791.1_Missense_Mutation_p.R103K|SLFN13_ENST00000534689.1_Intron|SLFN13_ENST00000542635.1_Missense_Mutation_p.R103K|SLFN13_ENST00000360502.2_Intron	NM_144682.5	NP_653283.3	Q68D06	SLN13_HUMAN	schlafen family member 13	103						intracellular (GO:0005622)	ATP binding (GO:0005524)			NS(1)|breast(1)|endometrium(1)|large_intestine(10)|lung(8)|ovary(3)|pancreas(1)|prostate(5)|stomach(1)	31				UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)		ATAAAAACACCTTCCGTGTTG	0.388																																																	0								ENSG00000154760						68.0	69.0	69.0					17																	33772392		2203	4300	6503	SLFN13	SO:0001583	missense	0			-	HGNC	AL832726	CCDS32620.1	17q12	2006-04-05				ENSG00000154760			26481	protein-coding gene	gene with protein product		614957				9846487	Standard	NM_144682		Approved	FLJ31952	uc002hjl.2	Q68D06		ENST00000285013.6:c.308G>A	17.37:g.33772392C>T	ENSP00000285013:p.Arg103Lys	Somatic	0	45	0.00		0.41568620468393047	5	16.67	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	26	18.75	E1P645|Q658M1|Q6ZS51|Q96A81	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ATPase_AAA-4,pfam_DUF2075,superfamily_P-loop_NTPase	p.R103K	ENST00000285013.6	37	c.308	CCDS32620.1	17	.	.	.	.	.	.	.	.	.	.	C	7.723	0.697587	0.15106	.	.	ENSG00000154760	ENST00000285013;ENST00000526861;ENST00000542635;ENST00000524511	T;T;T;T	0.21361	4.64;4.64;4.64;2.01	3.28	-3.01	0.05463	.	0.864394	0.09594	N	0.781145	T	0.08223	0.0205	N	0.16903	0.455	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.39921	-0.9590	10	0.05959	T	0.93	.	4.2809	0.10833	0.0:0.2811:0.1891:0.5297	.	103	Q68D06	SLN13_HUMAN	K	103	ENSP00000285013:R103K;ENSP00000434439:R103K;ENSP00000444016:R103K;ENSP00000433181:R103K	ENSP00000285013:R103K	R	-	2	0	SLFN13	30796505	0.000000	0.05858	0.000000	0.03702	0.035000	0.12851	-1.589000	0.02104	-0.447000	0.07138	0.205000	0.17691	AGG	-	NULL		0.388	SLFN13-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SLFN13	protein_coding	OTTHUMT00000381883.1	C	NM_144682	-		33772392	-1	no_errors	ENST00000285013	ensembl	human	known	74_37	missense	SNP	0.000	T
ZNF324B	388569	genome.wustl.edu	37	19	58966803	58966803	+	Silent	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr19:58966803C>T	ENST00000336614.4	+	4	599	c.492C>T	c.(490-492)tcC>tcT	p.S164S	ZNF324B_ENST00000391696.1_Silent_p.S154S|ZNF324B_ENST00000545523.1_Silent_p.S164S	NM_207395.2	NP_997278.2	Q6AW86	Z324B_HUMAN	zinc finger protein 324B	164					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(7)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20		all_cancers(17;1.81e-17)|all_epithelial(17;1.21e-12)|Lung NSC(17;2.8e-05)|all_lung(17;0.000139)|Colorectal(82;0.000147)|Renal(17;0.00528)|all_neural(62;0.0133)|Ovarian(87;0.156)|Medulloblastoma(540;0.232)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0164)|Lung(386;0.179)		GACTGACCTCCCCACTCAGGC	0.652																																																	0								ENSG00000249471						52.0	59.0	56.0					19																	58966803		2203	4300	6503	ZNF324B	SO:0001819	synonymous_variant	0			-	HGNC	AK127750	CCDS33138.1	19q13.43	2013-01-08				ENSG00000249471		"""Zinc fingers, C2H2-type"", ""-"""	33107	protein-coding gene	gene with protein product							Standard	NM_207395		Approved	FLJ45850	uc002qsv.1	Q6AW86		ENST00000336614.4:c.492C>T	19.37:g.58966803C>T		Somatic	0	60	0.00		0.41568620468393047	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	29	29.27	B2RTZ6|Q6ZMX8|Q6ZS42	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S164	ENST00000336614.4	37	c.492	CCDS33138.1	19																																																																																			-	NULL		0.652	ZNF324B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF324B	protein_coding	OTTHUMT00000467038.1	C	NM_207395	-		58966803	+1	no_errors	ENST00000336614	ensembl	human	known	74_37	silent	SNP	0.000	T
FRAS1	80144	genome.wustl.edu	37	4	79366787	79366787	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr4:79366787C>T	ENST00000325942.6	+	42	6217	c.5777C>T	c.(5776-5778)cCa>cTa	p.P1926L	FRAS1_ENST00000264895.6_Missense_Mutation_p.P1926L	NM_001166133.1	NP_001159605.1	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1	1926					cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						AGCATTGAGCCAACCCATGAT	0.403																																																	0								ENSG00000138759						219.0	216.0	217.0					4																	79366787		1893	4117	6010	FRAS1	SO:0001583	missense	0			-	HGNC	AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000325942.6:c.5777C>T	4.37:g.79366787C>T	ENSP00000326330:p.Pro1926Leu	Somatic	0	67	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	44	21.43	A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Calx_beta,pfam_VWF_C,superfamily_Growth_fac_rcpt_N_dom,superfamily_Cadherin-like,smart_VWC_out,smart_VWF_C,smart_Furin_repeat,smart_EG-like_dom,smart_Calx_beta,pfscan_VWF_C	p.P1926L	ENST00000325942.6	37	c.5777	CCDS54772.1	4	.	.	.	.	.	.	.	.	.	.	C	20.3	3.961506	0.74016	.	.	ENSG00000138759	ENST00000325942;ENST00000264895	T;T	0.53423	0.62;0.62	5.96	5.96	0.96718	.	0.177571	0.51477	D	0.000095	T	0.67011	0.2848	M	0.83384	2.64	0.80722	D	1	D;D	0.58620	0.983;0.963	P;P	0.53006	0.677;0.715	T	0.71013	-0.4715	10	0.72032	D	0.01	.	20.394	0.98981	0.0:1.0:0.0:0.0	.	1926;1926	E9PHH6;A2RRR8	.;.	L	1926	ENSP00000326330:P1926L;ENSP00000264895:P1926L	ENSP00000264895:P1926L	P	+	2	0	FRAS1	79585811	0.997000	0.39634	0.999000	0.59377	0.996000	0.88848	3.633000	0.54295	2.830000	0.97506	0.585000	0.79938	CCA	-	NULL		0.403	FRAS1-001	NOVEL	basic|CCDS	protein_coding	FRAS1	protein_coding	OTTHUMT00000362706.2	C		-		79366787	+1	no_errors	ENST00000264895	ensembl	human	known	74_37	missense	SNP	1.000	T
IBA57	200205	genome.wustl.edu	37	1	228362718	228362718	+	Nonsense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr1:228362718C>T	ENST00000366711.3	+	2	669	c.667C>T	c.(667-669)Cga>Tga	p.R223*	IBA57_ENST00000484749.1_3'UTR|IBA57_ENST00000546123.1_Nonsense_Mutation_p.R30*	NM_001010867.2	NP_001010867.1	Q5T440	CAF17_HUMAN	IBA57, iron-sulfur cluster assembly homolog (S. cerevisiae)	223					glycine catabolic process (GO:0006546)|heme biosynthetic process (GO:0006783)	mitochondrion (GO:0005739)	aminomethyltransferase activity (GO:0004047)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(7)|prostate(1)	11						TCACCAGCACCGATACCTGCA	0.647																																																	0								ENSG00000181873						24.0	27.0	26.0					1																	228362718		2201	4299	6500	IBA57	SO:0001587	stop_gained	0			-	HGNC	AK022796	CCDS31046.1	1q42.13	2011-03-11	2011-03-11	2011-03-11	ENSG00000181873	ENSG00000181873			27302	protein-coding gene	gene with protein product	"""iron-sulfur cluster assembly factor for biotin synthase- and aconitase-like mitochondrial proteins, with a mass of 57kDa"""	615316	"""chromosome 1 open reading frame 69"""	C1orf69			Standard	NM_001010867		Approved	FLJ12734	uc001hsl.4	Q5T440	OTTHUMG00000039769	ENST00000366711.3:c.667C>T	1.37:g.228362718C>T	ENSP00000355672:p.Arg223*	Somatic	0	72	0.00		0.41568620468393047	6	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	40	24.53		Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GCV_T_N,pfam_GCV_T_C,tigrfam_YgfZ/GcvT_CS	p.R223*	ENST00000366711.3	37	c.667	CCDS31046.1	1	.	.	.	.	.	.	.	.	.	.	C	18.13	3.554450	0.65425	.	.	ENSG00000181873	ENST00000366711;ENST00000546123	.	.	.	5.07	3.04	0.35103	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-19.3565	8.6573	0.34071	0.2032:0.71:0.0:0.0868	.	.	.	.	X	223;30	.	ENSP00000355672:R223X	R	+	1	2	IBA57	226429341	1.000000	0.71417	0.903000	0.35520	0.165000	0.22458	1.921000	0.40035	1.354000	0.45846	0.655000	0.94253	CGA	-	pfam_GCV_T_N,tigrfam_YgfZ/GcvT_CS		0.647	IBA57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IBA57	protein_coding	OTTHUMT00000095980.1	C	NM_001010867	-		228362718	+1	no_errors	ENST00000366711	ensembl	human	known	74_37	nonsense	SNP	1.000	T
ARHGAP5	394	genome.wustl.edu	37	14	32561340	32561340	+	Missense_Mutation	SNP	G	G	A	rs78337553		TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr14:32561340G>A	ENST00000345122.3	+	2	1780	c.1465G>A	c.(1465-1467)Gag>Aag	p.E489K	ARHGAP5_ENST00000432921.1_Missense_Mutation_p.E489K|ARHGAP5_ENST00000556611.1_Missense_Mutation_p.E489K|ARHGAP5_ENST00000539826.2_Missense_Mutation_p.E489K|ARHGAP5_ENST00000433497.1_Intron|ARHGAP5_ENST00000396582.2_Intron	NM_001030055.1	NP_001025226.1	Q13017	RHG05_HUMAN	Rho GTPase activating protein 5	489	FF 4.				cell adhesion (GO:0007155)|GTP catabolic process (GO:0006184)|mammary gland development (GO:0030879)|positive regulation of cell migration (GO:0030335)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell size (GO:0008361)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)	p.E489K(1)		NS(2)|breast(10)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(12)|ovary(4)|skin(1)|stomach(1)|urinary_tract(4)	55	Hepatocellular(127;0.0604)|Prostate(35;0.15)|Breast(36;0.186)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.00714)|BRCA - Breast invasive adenocarcinoma(188;0.0952)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00566)		AGCCAAAGAAGAGTTTCAAGA	0.343																																					NSCLC(9;77 350 3443 29227 41353)												1	Substitution - Missense(1)	stomach(1)						ENSG00000100852						60.0	61.0	61.0					14																	32561340		2203	4298	6501	ARHGAP5	SO:0001583	missense	0			-	HGNC	U17032	CCDS32062.1, CCDS45095.1	14q12	2010-02-05						"""Rho GTPase activating proteins"""	675	protein-coding gene	gene with protein product		602680	"""growth factor independent 2"""	GFI2		8537347	Standard	XM_005267635		Approved	RhoGAP5, p190-B, p190BRhoGAP	uc001wrn.3	Q13017		ENST00000345122.3:c.1465G>A	14.37:g.32561340G>A	ENSP00000371897:p.Glu489Lys	Somatic	1	123	0.80		0.41568620468393047	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	90	8.16	A1L375|A1L376|A8KAA1|D3DS89|D3DS90|Q05BE8|Q05BU8|Q59ER0|Q6DHZ3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RhoGAP_dom,pfam_FF_domain,pfam_Small_GTPase,superfamily_Rho_GTPase_activation_prot,superfamily_P-loop_NTPase,superfamily_FF_domain,smart_FF_domain,smart_RhoGAP_dom,pfscan_RhoGAP_dom,prints_Small_GTPase	p.E489K	ENST00000345122.3	37	c.1465	CCDS32062.1	14	.	.	.	.	.	.	.	.	.	.	G	19.00	3.741262	0.69304	.	.	ENSG00000100852	ENST00000556611;ENST00000539826;ENST00000345122;ENST00000432921	T;T;T;T	0.32023	1.47;1.47;1.47;1.47	6.02	6.02	0.97574	FF domain (2);	0.044905	0.85682	D	0.000000	T	0.39009	0.1062	N	0.22421	0.69	0.80722	D	1	P;P	0.42296	0.734;0.775	P;P	0.52066	0.562;0.689	T	0.11060	-1.0603	10	0.62326	D	0.03	.	20.547	0.99278	0.0:0.0:1.0:0.0	.	489;489	Q13017-2;Q13017	.;RHG05_HUMAN	K	489	ENSP00000452222:E489K;ENSP00000441692:E489K;ENSP00000371897:E489K;ENSP00000393307:E489K	ENSP00000371897:E489K	E	+	1	0	ARHGAP5	31631091	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.850000	0.98022	0.650000	0.86243	GAG	-	pfam_FF_domain,superfamily_FF_domain,smart_FF_domain		0.343	ARHGAP5-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARHGAP5	protein_coding	OTTHUMT00000409735.1	G	NM_001030055	rs78337553		32561340	+1	no_errors	ENST00000345122	ensembl	human	known	74_37	missense	SNP	1.000	A
SPG11	80208	genome.wustl.edu	37	15	44925817	44925817	+	Nonsense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr15:44925817G>A	ENST00000261866.7	-	8	1637	c.1621C>T	c.(1621-1623)Cag>Tag	p.Q541*	SPG11_ENST00000559193.1_Nonsense_Mutation_p.Q541*|SPG11_ENST00000535302.2_Nonsense_Mutation_p.Q541*|SPG11_ENST00000558319.1_Nonsense_Mutation_p.Q541*|SPG11_ENST00000427534.2_Nonsense_Mutation_p.Q541*	NM_025137.3	NP_079413.3	Q96JI7	SPTCS_HUMAN	spastic paraplegia 11 (autosomal recessive)	541					cell death (GO:0008219)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(16)|lung(24)|ovary(5)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	72		all_cancers(109;1.29e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;1.34e-07)|all_lung(180;1.21e-06)|Melanoma(134;0.0122)		all cancers(107;2.93e-22)|GBM - Glioblastoma multiforme(94;1.55e-06)|COAD - Colon adenocarcinoma(120;0.0432)|Colorectal(105;0.0484)|Lung(196;0.104)|LUSC - Lung squamous cell carcinoma(244;0.214)		GTGTCCAGCTGACGATTTTCT	0.318																																																	0								ENSG00000104133						47.0	49.0	49.0					15																	44925817		2198	4298	6496	SPG11	SO:0001587	stop_gained	0			-	HGNC		CCDS10112.1, CCDS53939.1	15q13-q15	2007-11-13			ENSG00000104133	ENSG00000104133			11226	protein-coding gene	gene with protein product	"""spatacsin"""	610844	"""KIAA1840"""	KIAA1840		10408536, 17322883	Standard	NM_001160227		Approved	FLJ21439	uc001ztx.3	Q96JI7	OTTHUMG00000131199	ENST00000261866.7:c.1621C>T	15.37:g.44925817G>A	ENSP00000261866:p.Gln541*	Somatic	0	126	0.00		0.41568620468393047	4	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	71	8.97	A8KAX9|B9EK60|F5H3N6|Q4VC11|Q58G86|Q69YG6|Q6NW01|Q8N270|Q8TBU9|Q9H734	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.Q541*	ENST00000261866.7	37	c.1621	CCDS10112.1	15	.	.	.	.	.	.	.	.	.	.	G	35	5.594314	0.96602	.	.	ENSG00000104133	ENST00000261866;ENST00000535302;ENST00000427534	.	.	.	5.28	5.28	0.74379	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	-3.5014	16.685	0.85303	0.0:0.0:1.0:0.0	.	.	.	.	X	541	.	ENSP00000261866:Q541X	Q	-	1	0	SPG11	42713109	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.558000	0.82253	2.479000	0.83701	0.655000	0.94253	CAG	-	NULL		0.318	SPG11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPG11	protein_coding	OTTHUMT00000253927.1	G		-		44925817	-1	no_errors	ENST00000261866	ensembl	human	known	74_37	nonsense	SNP	1.000	A
DACT1	51339	genome.wustl.edu	37	14	59113171	59113171	+	Silent	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr14:59113171G>A	ENST00000335867.4	+	4	1854	c.1830G>A	c.(1828-1830)aaG>aaA	p.K610K	DACT1_ENST00000395153.3_Silent_p.K573K|DACT1_ENST00000556859.1_Silent_p.K329K|DACT1_ENST00000541264.2_Silent_p.K329K			Q9NYF0	DACT1_HUMAN	dishevelled-binding antagonist of beta-catenin 1	610					dendrite morphogenesis (GO:0048813)|embryonic hindgut morphogenesis (GO:0048619)|gastrulation with mouth forming second (GO:0001702)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of catenin import into nucleus (GO:0035412)|regulation of protein stability (GO:0031647)|regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000095)|synapse organization (GO:0050808)|Wnt signaling pathway (GO:0016055)	beta-catenin destruction complex (GO:0030877)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|synapse (GO:0045202)	beta-catenin binding (GO:0008013)|delta-catenin binding (GO:0070097)|protein kinase A binding (GO:0051018)|protein kinase C binding (GO:0005080)			endometrium(7)|kidney(3)|large_intestine(11)|lung(27)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	53						CCGGGAGCAAGAAGTGTCGCT	0.622																																																	0								ENSG00000165617						18.0	21.0	20.0					14																	59113171		2192	4296	6488	DACT1	SO:0001819	synonymous_variant	0			-	HGNC	AF251079	CCDS9736.1, CCDS41961.1	14q22.3	2013-05-15	2013-05-15		ENSG00000165617	ENSG00000165617			17748	protein-coding gene	gene with protein product		607861	"""dapper homolog 1, antagonist of beta-catenin (xenopus)"", ""dapper, antagonist of beta-catenin, homolog 1 (Xenopus laevis)"""			11970895	Standard	NM_001079520		Approved	DAPPER1, THYEX3, HDPR1, DAPPER, FRODO	uc001xdw.3	Q9NYF0	OTTHUMG00000140324	ENST00000335867.4:c.1830G>A	14.37:g.59113171G>A		Somatic	0	65	0.00		0.41568620468393047	12	42.86	9	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	39	25.00	A8MYJ2|Q86TY0	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.K610	ENST00000335867.4	37	c.1830	CCDS9736.1	14																																																																																			-	NULL		0.622	DACT1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DACT1	protein_coding	OTTHUMT00000325515.1	G	NM_016651	-		59113171	+1	no_errors	ENST00000335867	ensembl	human	known	74_37	silent	SNP	1.000	A
AP3B2	8120	genome.wustl.edu	37	15	83334005	83334005	+	Intron	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr15:83334005G>A	ENST00000261722.3	-	16	2179				AP3B2_ENST00000535359.1_Silent_p.Y674Y|RP11-752G15.3_ENST00000560650.1_RNA|AP3B2_ENST00000535348.1_Intron	NM_004644.3	NP_004635.2	Q13367	AP3B2_HUMAN	adaptor-related protein complex 3, beta 2 subunit						anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|intracellular protein transport (GO:0006886)|post-Golgi vesicle-mediated transport (GO:0006892)	AP-3 adaptor complex (GO:0030123)|COPI-coated vesicle (GO:0030137)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	transporter activity (GO:0005215)			breast(4)|endometrium(1)|kidney(1)|large_intestine(4)|lung(21)|ovary(4)|pancreas(1)|prostate(3)|urinary_tract(2)	41			BRCA - Breast invasive adenocarcinoma(143;0.229)			GGACCTCAGTGTATTCGCCCA	0.597																																																	0								ENSG00000103723																																			AP3B2	SO:0001627	intron_variant	0			-	HGNC	U37673	CCDS45331.1, CCDS61736.1, CCDS61737.1	15q	2008-07-07			ENSG00000103723	ENSG00000103723			567	protein-coding gene	gene with protein product		602166				7671305, 1851215	Standard	NM_004644		Approved	NAPTB	uc010uoh.2	Q13367	OTTHUMG00000168009	ENST00000261722.3:c.1971+203C>T	15.37:g.83334005G>A		Somatic	0	42	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	29	17.14	A4Z4T7|B7ZKR7|B7ZKS0|O14808|Q52LY8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,superfamily_Coatomer/clathrin_app_Ig-like,pirsf_AP3_beta	p.Y674	ENST00000261722.3	37	c.2022	CCDS45331.1	15																																																																																			-	pirsf_AP3_beta		0.597	AP3B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AP3B2	protein_coding	OTTHUMT00000397463.1	G		-		83334005	-1	no_errors	ENST00000535359	ensembl	human	novel	74_37	silent	SNP	0.846	A
ABCA4	24	genome.wustl.edu	37	1	94463579	94463579	+	Silent	SNP	G	G	A	rs63749058		TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr1:94463579G>A	ENST00000370225.3	-	48	6653	c.6567C>T	c.(6565-6567)ttC>ttT	p.F2189F	ABCA4_ENST00000536513.1_Silent_p.F459F|ABCA4_ENST00000535881.1_Silent_p.F308F	NM_000350.2	NP_000341.2	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 4	2189					phospholipid transfer to membrane (GO:0006649)|photoreceptor cell maintenance (GO:0045494)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|phospholipid-translocating ATPase activity (GO:0004012)|transporter activity (GO:0005215)			NS(2)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(10)|large_intestine(25)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(10)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	147		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		AGTTCCCCTGGAAGAACTGCT	0.557																																																	0								ENSG00000198691						124.0	97.0	106.0					1																	94463579		2203	4300	6503	ABCA4	SO:0001819	synonymous_variant	0			-	HGNC	U88667	CCDS747.1	1p22	2013-01-23			ENSG00000198691	ENSG00000198691		"""ATP binding cassette transporters / subfamily A"""	34	protein-coding gene	gene with protein product	"""Stargardt disease"""	601691	"""ATP-binding cassette transporter, retinal-specific"""	STGD1, ABCR, RP19, STGD		9490294	Standard	NM_000350		Approved	FFM, ARMD2, CORD3	uc001dqh.3	P78363	OTTHUMG00000010622	ENST00000370225.3:c.6567C>T	1.37:g.94463579G>A		Somatic	0	75	0.00		0.41568620468393047	6	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	47	32.86	O15112|O60438|O60915|Q0QD48|Q4LE31	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like,tigrfam_Rim_ABC_transpt	p.F2189	ENST00000370225.3	37	c.6567	CCDS747.1	1																																																																																			-	tigrfam_Rim_ABC_transpt		0.557	ABCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA4	protein_coding	OTTHUMT00000029320.1	G	NM_000350	-		94463579	-1	no_errors	ENST00000370225	ensembl	human	known	74_37	silent	SNP	1.000	A
IFT172	26160	genome.wustl.edu	37	2	27682296	27682296	+	Silent	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr2:27682296G>A	ENST00000260570.3	-	25	2839	c.2736C>T	c.(2734-2736)tcC>tcT	p.S912S		NM_015662.1	NP_056477.1	Q9UG01	IF172_HUMAN	intraflagellar transport 172	912					bone development (GO:0060348)|brain development (GO:0007420)|cilium assembly (GO:0042384)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|epidermis development (GO:0008544)|heart looping (GO:0001947)|hindgut development (GO:0061525)|left/right axis specification (GO:0070986)|limb development (GO:0060173)|negative regulation of epithelial cell proliferation (GO:0050680)|neural tube closure (GO:0001843)|Notch signaling pathway (GO:0007219)|palate development (GO:0060021)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|smoothened signaling pathway (GO:0007224)|spinal cord motor neuron differentiation (GO:0021522)	axoneme (GO:0005930)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|intraciliary transport particle B (GO:0030992)|sperm midpiece (GO:0097225)|sperm principal piece (GO:0097228)|vesicle (GO:0031982)				central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(17)|lung(17)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	43	Acute lymphoblastic leukemia(172;0.155)					GATAGTATTTGGATGCAGTGT	0.517																																																	0								ENSG00000138002						113.0	99.0	104.0					2																	27682296		2203	4300	6503	IFT172	SO:0001819	synonymous_variant	0			-	HGNC	AB033005	CCDS1755.1	2p23.3	2014-07-03	2014-07-03		ENSG00000138002	ENSG00000138002		"""Intraflagellar transport homologs"", ""WD repeat domain containing"""	30391	protein-coding gene	gene with protein product	"""wimple homolog"""	607386	"""intraflagellar transport 172 homolog (Chlamydomonas)"""			10788441, 10574461, 24140113	Standard	XM_005264254		Approved	SLB, wim, osm-1, NPHP17	uc002rku.3	Q9UG01	OTTHUMG00000128425	ENST00000260570.3:c.2736C>T	2.37:g.27682296G>A		Somatic	0	39	0.00		0.41568620468393047	7	12.50	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	20	16.67	A5PKZ0|B2RNU5|Q86X44|Q96HW4|Q9UFJ9|Q9ULP1	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat	p.S912	ENST00000260570.3	37	c.2736	CCDS1755.1	2																																																																																			-	NULL		0.517	IFT172-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFT172	protein_coding	OTTHUMT00000250213.2	G	NM_015662	-		27682296	-1	no_errors	ENST00000260570	ensembl	human	known	74_37	silent	SNP	1.000	A
MOAP1	64112	genome.wustl.edu	37	14	93652900	93652900	+	5'Flank	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr14:93652900C>T	ENST00000556883.1	-	0	0				TMEM251_ENST00000283534.4_Missense_Mutation_p.P94S|RP11-371E8.4_ENST00000557048.1_Intron|RP11-371E8.4_ENST00000557574.1_Intron|MOAP1_ENST00000298894.4_5'Flank|TMEM251_ENST00000415050.2_Missense_Mutation_p.P132S			Q96BY2	MOAP1_HUMAN	modulator of apoptosis 1						apoptotic signaling pathway (GO:0097190)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|positive regulation of apoptotic process (GO:0043065)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:0001844)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(4)|ovary(1)|skin(2)	13		all_cancers(154;0.00528)|Acute lymphoblastic leukemia(33;0.0497)|all_epithelial(191;0.125)|all_neural(303;0.13)		Epithelial(152;0.178)|all cancers(159;0.2)|COAD - Colon adenocarcinoma(157;0.204)		AAGAGCTGATCCCAAAACAGT	0.418																																																	0								ENSG00000153485						175.0	168.0	170.0					14																	93652900		1924	4128	6052	TMEM251	SO:0001631	upstream_gene_variant	0			-	HGNC	BC015044	CCDS9908.1	14q32.12	2012-02-09			ENSG00000165943	ENSG00000165943		"""Paraneoplastic Ma antigens"""	16658	protein-coding gene	gene with protein product	"""paraneoplastic Ma antigen family member 4"""	609485				11060313	Standard	NM_022151		Approved	MAP-1, PNMA4	uc001ybj.3	Q96BY2	OTTHUMG00000169184		14.37:g.93652900C>T	Exception_encountered	Somatic	0	64	0.00		0.41568620468393047	70	21.35	19	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	36	16.28	B2RDF6|Q9H833|Q9HAS1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.P132S	ENST00000556883.1	37	c.394	CCDS9908.1	14	.	.	.	.	.	.	.	.	.	.	C	26.8	4.774703	0.90108	.	.	ENSG00000153485	ENST00000283534;ENST00000415050	.	.	.	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	T	0.67088	0.2856	L	0.29908	0.895	0.80722	D	1	D	0.61080	0.989	D	0.63957	0.92	T	0.68938	-0.5277	9	0.87932	D	0	-13.9157	20.2526	0.98410	0.0:1.0:0.0:0.0	.	126	Q8N6I4	CN109_HUMAN	S	94;132	.	ENSP00000283534:P94S	P	+	1	0	C14orf109	92722653	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.670000	0.83925	2.789000	0.95967	0.558000	0.71614	CCC	-	NULL		0.418	MOAP1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TMEM251	protein_coding	OTTHUMT00000412685.1	C		-		93652900	+1	no_errors	ENST00000415050	ensembl	human	known	74_37	missense	SNP	1.000	T
KIF13A	63971	genome.wustl.edu	37	6	17849721	17849721	+	Splice_Site	SNP	C	C	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr6:17849721C>A	ENST00000259711.6	-	9	823		c.e9-1		KIF13A_ENST00000378816.5_Splice_Site|KIF13A_ENST00000378826.2_Splice_Site|KIF13A_ENST00000378843.2_Splice_Site|KIF13A_ENST00000378814.5_Splice_Site	NM_022113.5	NP_071396.4	Q9H1H9	KI13A_HUMAN	kinesin family member 13A						ATP catabolic process (GO:0006200)|cargo loading into vesicle (GO:0035459)|cytokinesis (GO:0000910)|endosome to lysosome transport (GO:0008333)|Golgi to plasma membrane protein transport (GO:0043001)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|plus-end-directed vesicle transport along microtubule (GO:0072383)	centrosome (GO:0005813)|endosome membrane (GO:0010008)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|midbody (GO:0030496)|trans-Golgi network membrane (GO:0032588)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(3)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(16)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	64	Breast(50;0.0107)|Ovarian(93;0.016)	all_hematologic(90;0.125)	all cancers(50;0.0865)|Epithelial(50;0.0974)			CCCCGGAATTCTAGTTATAGG	0.423																																																	0								ENSG00000137177						77.0	66.0	69.0					6																	17849721		1822	4094	5916	KIF13A	SO:0001630	splice_region_variant	0			-	HGNC	AJ291578	CCDS47380.1, CCDS47381.1, CCDS54967.1, CCDS54968.1, CCDS58998.1	6p23	2008-10-21			ENSG00000137177	ENSG00000137177		"""Kinesins"""	14566	protein-coding gene	gene with protein product		605433				11106728	Standard	NM_022113		Approved	bA500C11.2	uc003ncg.4	Q9H1H9	OTTHUMG00000014313	ENST00000259711.6:c.718-1G>T	6.37:g.17849721C>A		Somatic	0	48	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	15	16.67	A0JP21|A0JP22|F2Z382|Q5THQ2|Q5THQ3|Q9H193|Q9H194|Q9H1H8	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e9-1	ENST00000259711.6	37	c.718-1	CCDS47381.1	6	.	.	.	.	.	.	.	.	.	.	C	23.7	4.445840	0.84101	.	.	ENSG00000137177	ENST00000378814;ENST00000259711;ENST00000378826;ENST00000378843;ENST00000378816	.	.	.	5.46	5.46	0.80206	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.3174	0.94220	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	KIF13A	17957700	1.000000	0.71417	0.998000	0.56505	0.793000	0.44817	7.768000	0.85345	2.569000	0.86673	0.650000	0.86243	.	-	-		0.423	KIF13A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIF13A	protein_coding	OTTHUMT00000039954.4	C		-	Intron	17849721	-1	no_errors	ENST00000259711	ensembl	human	known	74_37	splice_site	SNP	1.000	A
PPP1R16A	84988	genome.wustl.edu	37	8	145726915	145726915	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr8:145726915G>A	ENST00000292539.4	+	11	2133	c.1216G>A	c.(1216-1218)Gaa>Aaa	p.E406K	CTD-2517M14.5_ENST00000569326.1_RNA|CTD-2517M22.14_ENST00000532766.1_RNA|GPT_ENST00000528431.1_5'Flank|GPT_ENST00000394955.2_5'Flank|PPP1R16A_ENST00000435887.1_Missense_Mutation_p.E406K			Q96I34	PP16A_HUMAN	protein phosphatase 1, regulatory subunit 16A	406						plasma membrane (GO:0005886)				NS(1)|endometrium(1)|kidney(2)|lung(3)|prostate(1)	8	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)			GGACAACCCCGAAGTGGTCAG	0.632																																																	0								ENSG00000160972						17.0	16.0	17.0					8																	145726915		2179	4277	6456	PPP1R16A	SO:0001583	missense	0			-	HGNC		CCDS6429.1	8q24.3	2013-01-10	2011-10-04		ENSG00000160972	ENSG00000160972		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	14941	protein-coding gene	gene with protein product		609172	"""protein phosphatase 1, regulatory (inhibitor) subunit 16A"""			11948623	Standard	NM_032902		Approved	MGC14333, MYPT3	uc003zdf.3	Q96I34	OTTHUMG00000165173	ENST00000292539.4:c.1216G>A	8.37:g.145726915G>A	ENSP00000292539:p.Glu406Lys	Somatic	0	90	0.00		0.41568620468393047	83	19.42	20	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	47	18.97	D3DWM5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Ankyrin_rpt,pirsf_Pase-1_reg_su_16AB_euk,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.E406K	ENST00000292539.4	37	c.1216	CCDS6429.1	8	.	.	.	.	.	.	.	.	.	.	G	11.31	1.601591	0.28534	.	.	ENSG00000160972	ENST00000292539;ENST00000435887	T;T	0.70399	-0.48;-0.48	4.48	2.67	0.31697	.	1.149250	0.06470	N	0.731033	T	0.56202	0.1969	L	0.44542	1.39	0.09310	N	1	P	0.34587	0.458	B	0.21917	0.037	T	0.29243	-1.0018	10	0.09338	T	0.73	.	8.5492	0.33440	0.1841:0.0:0.8159:0.0	.	406	Q96I34	PP16A_HUMAN	K	406	ENSP00000292539:E406K;ENSP00000391126:E406K	ENSP00000292539:E406K	E	+	1	0	PPP1R16A	145697723	0.196000	0.23350	0.001000	0.08648	0.007000	0.05969	2.380000	0.44327	0.337000	0.23665	0.462000	0.41574	GAA	-	pirsf_Pase-1_reg_su_16AB_euk		0.632	PPP1R16A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R16A	protein_coding	OTTHUMT00000382459.1	G	NM_032902	-		145726915	+1	no_errors	ENST00000292539	ensembl	human	known	74_37	missense	SNP	0.033	A
FOXE1	2304	genome.wustl.edu	37	9	100616701	100616706	+	In_Frame_Del	DEL	GCCGCC	GCCGCC	-	rs371516340|rs565664344|rs71369530	byFrequency	TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	GCCGCC	GCCGCC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr9:100616701_100616706delGCCGCC	ENST00000375123.3	+	1	1166_1171	c.505_510delGCCGCC	c.(505-510)gccgccdel	p.AA177del		NM_004473.3	NP_004464.2	O00358	FOXE1_HUMAN	forkhead box E1 (thyroid transcription factor 2)	177	Ala-rich.|Poly-Ala.				anatomical structure morphogenesis (GO:0009653)|cell migration (GO:0016477)|embryonic organ morphogenesis (GO:0048562)|hair follicle morphogenesis (GO:0031069)|hard palate development (GO:0060022)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|pharynx development (GO:0060465)|positive regulation of transcription, DNA-templated (GO:0045893)|soft palate development (GO:0060023)|thymus development (GO:0048538)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(1)|lung(2)|upper_aerodigestive_tract(1)	5		Acute lymphoblastic leukemia(62;0.158)				Ggctgccgcagccgccgccgccgccg	0.767																																																	0								ENSG00000178919																																			FOXE1	SO:0001651	inframe_deletion	0				HGNC	U89995	CCDS35078.1	9q22	2008-09-05			ENSG00000178919	ENSG00000178919		"""Forkhead boxes"""	3806	protein-coding gene	gene with protein product		602617	"""forkhead box E2"""	FKHL15, TITF2, FOXE2		9169137, 9697705	Standard	NM_004473		Approved	TTF-2, HFKH4	uc004axu.3	O00358	OTTHUMG00000020333	ENST00000375123.3:c.505_510delGCCGCC	9.37:g.100616707_100616712delGCCGCC	ENSP00000364265:p.Ala177_Ala178del	Somatic	NA	NA	NA		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	O75765|Q5T109|Q99526	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.AA172in_frame_del	ENST00000375123.3	37	c.505_510	CCDS35078.1	9																																																																																			-	NULL		0.767	FOXE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXE1	protein_coding	OTTHUMT00000053341.1	GCCGCC				100616706	+1	no_errors	ENST00000375123	ensembl	human	known	74_37	in_frame_del	DEL	0.602:0.620:0.614:0.750:0.779:0.753	-
HDC	3067	genome.wustl.edu	37	15	50540514	50540514	+	Silent	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr15:50540514C>T	ENST00000267845.3	-	10	1470	c.1068G>A	c.(1066-1068)cgG>cgA	p.R356R	HDC_ENST00000543581.1_Intron	NM_002112.3	NP_002103.2	Q9UBI9	HDC_HUMAN	histidine decarboxylase	0					respiratory tube development (GO:0030323)	membrane (GO:0016020)				breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(13)|lung(25)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		all_lung(180;0.0138)		all cancers(107;1.12e-06)|GBM - Glioblastoma multiforme(94;9.95e-05)		CAGAGCGAAACCGTCGGCTCA	0.532																																					GBM(95;1627 1936 6910 9570)												0								ENSG00000140287						85.0	76.0	79.0					15																	50540514		2196	4295	6491	HDC	SO:0001819	synonymous_variant	0			-	HGNC		CCDS10134.1	15q21.2	2013-09-20			ENSG00000140287	ENSG00000140287	4.1.1.22		4855	protein-coding gene	gene with protein product		142704				1487235	Standard	NM_002112		Approved		uc001zxz.3	P19113	OTTHUMG00000131644	ENST00000267845.3:c.1068G>A	15.37:g.50540514C>T		Somatic	0	66	0.00		0.41568620468393047	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	30	14.29		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_PyrdxlP-dep_de-COase,superfamily_PyrdxlP-dep_Trfase,prints_Aromatic_deC	p.R356	ENST00000267845.3	37	c.1068	CCDS10134.1	15																																																																																			-	pfam_PyrdxlP-dep_de-COase,superfamily_PyrdxlP-dep_Trfase,prints_Aromatic_deC		0.532	HDC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HDC	protein_coding	OTTHUMT00000254540.1	C		-		50540514	-1	no_errors	ENST00000267845	ensembl	human	known	74_37	silent	SNP	0.956	T
SIRPB1	10326	genome.wustl.edu	37	20	1600523	1600523	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr20:1600523C>T	ENST00000381605.4	-	1	132	c.68G>A	c.(67-69)aGa>aAa	p.R23K	SIRPB1_ENST00000381603.3_Missense_Mutation_p.R23K|SIRPB1_ENST00000568365.1_Missense_Mutation_p.R23K|SIRPB1_ENST00000279477.7_Missense_Mutation_p.R23K|SIRPB1_ENST00000381596.1_5'UTR|RP4-576H24.4_ENST00000564763.1_Missense_Mutation_p.R23K	NM_006065.3	NP_006056.2	O00241	SIRB1_HUMAN	signal-regulatory protein beta 1	23			R -> G (in dbSNP:rs1535882).		cell surface receptor signaling pathway (GO:0007166)|innate immune response (GO:0045087)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				central_nervous_system(2)|kidney(2)|large_intestine(4)|lung(16)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	31						ACCTGTGAGTCTCCCCAGCAG	0.562																																																	0								ENSG00000101307						97.0	87.0	90.0					20																	1600523		2203	4300	6503	SIRPB1	SO:0001583	missense	0			-	HGNC	Y10376	CCDS13019.1, CCDS42850.1, CCDS46571.1	20p13	2013-01-11			ENSG00000101307	ENSG00000101307		"""Signal-regulatory proteins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C1-set domain containing"""	15928	protein-coding gene	gene with protein product		603889				9062191, 16339511	Standard	NM_001083910		Approved	SIRP-BETA-1, CD172b	uc010gai.3	O00241	OTTHUMG00000031676	ENST00000381605.4:c.68G>A	20.37:g.1600523C>T	ENSP00000371018:p.Arg23Lys	Somatic	0	89	0.00		0.41568620468393047	6	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	38	25.49	A6NLM2|B2R8V0|Q5TFQ9|Q5TFR0|Q8TB12|Q9H1U5|Q9Y4V0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_C1-set,pfam_CD80_C2-set,pfam_Ig_V-set,pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_V-set_subgr,smart_Ig_C1-set,pfscan_Ig-like_dom	p.R23K	ENST00000381605.4	37	c.68	CCDS13019.1	20	.	.	.	.	.	.	.	.	.	.	.	4.782	0.145458	0.09134	.	.	ENSG00000101307	ENST00000381605;ENST00000381603;ENST00000279477;ENST00000381596	T;T;T	0.10192	4.44;4.77;2.9	1.85	-3.11	0.05299	Immunoglobulin-like (2);	3.043770	0.01395	U	0.013381	T	0.06690	0.0171	N	0.22421	0.69	0.09310	N	1	B;B;B	0.17465	0.0;0.004;0.022	B;B;B	0.22601	0.002;0.002;0.04	T	0.26258	-1.0108	10	0.29301	T	0.29	.	0.2242	0.00172	0.2091:0.2806:0.2066:0.3037	.	23;23;23	O00241;Q5TFQ8;O00241-2	SIRB1_HUMAN;SIRBL_HUMAN;.	K	23	ENSP00000371018:R23K;ENSP00000371016:R23K;ENSP00000279477:R23K	ENSP00000279477:R23K	R	-	2	0	SIRPB1	1548523	0.135000	0.22499	0.006000	0.13384	0.002000	0.02628	-0.391000	0.07323	-0.886000	0.03966	-0.485000	0.04761	AGA	-	pfscan_Ig-like_dom		0.562	SIRPB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SIRPB1	protein_coding	OTTHUMT00000077555.2	C	NM_006065	-		1600523	-1	no_errors	ENST00000279477	ensembl	human	known	74_37	missense	SNP	0.008	T
AC011322.1	0	genome.wustl.edu	37	3	196713812	196713812	+	RNA	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr3:196713812G>A	ENST00000445739.1	-	0	1																											AATCTCTTCAGGATCTCTGTA	0.522																																																	0								ENSG00000233487																																			AC011322.1			0			-	Clone_based_vega_gene																													3.37:g.196713812G>A		Somatic	0	67	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	27	32.50		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000445739.1	37	NULL		3																																																																																			-	-		0.522	AC011322.1-002	PUTATIVE	basic|exp_conf	processed_transcript	ENSG00000233487	pseudogene	OTTHUMT00000340485.1	G		-		196713812	-1	no_errors	ENST00000445739	ensembl	human	putative	74_37	rna	SNP	1.000	A
DRP2	1821	genome.wustl.edu	37	X	100513530	100513530	+	Silent	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chrX:100513530C>T	ENST00000395209.3	+	22	3150	c.2623C>T	c.(2623-2625)Ctg>Ttg	p.L875L	DRP2_ENST00000541709.1_Silent_p.L797L|DRP2_ENST00000402866.1_Silent_p.L875L|DRP2_ENST00000538510.1_Silent_p.L875L	NM_001939.2	NP_001930.2	Q13474	DRP2_HUMAN	dystrophin related protein 2	875					central nervous system development (GO:0007417)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(10)|ovary(3)|prostate(1)|skin(2)|urinary_tract(2)	31						GGAGCTTCTCCTGCAGGTGAG	0.592																																																	0								ENSG00000102385						9.0	8.0	8.0					X																	100513530		2176	4227	6403	DRP2	SO:0001819	synonymous_variant	0			-	HGNC	U43519	CCDS14480.2, CCDS55465.1	Xq22	2008-02-05			ENSG00000102385	ENSG00000102385			3032	protein-coding gene	gene with protein product		300052				8640231	Standard	NM_001939		Approved		uc004egz.2	Q13474	OTTHUMG00000022020	ENST00000395209.3:c.2623C>T	X.37:g.100513530C>T		Somatic	0	29	0.00		0.41568620468393047	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	9	47.06	A6ZKI5|A8K1B0|B1B1F3|B4DIZ0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_EF-hand_dom_typ1,pfam_EF-hand_dom_typ2,pfam_Znf_ZZ,pfam_Spectrin_repeat,pfam_WW_dom,superfamily_WW_dom,smart_Spectrin/alpha-actinin,smart_WW_dom,smart_Znf_ZZ,pirsf_Dystrophin-related_2,pfscan_WW_dom,pfscan_Znf_ZZ	p.L875	ENST00000395209.3	37	c.2623	CCDS14480.2	X																																																																																			-	pirsf_Dystrophin-related_2		0.592	DRP2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DRP2	protein_coding	OTTHUMT00000057522.3	C	NM_001939	-		100513530	+1	no_errors	ENST00000395209	ensembl	human	known	74_37	silent	SNP	1.000	T
CTNNA1	1495	genome.wustl.edu	37	5	138268381	138268381	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr5:138268381G>A	ENST00000302763.7	+	17	2503	c.2413G>A	c.(2413-2415)Ggg>Agg	p.G805R	CTNNA1_ENST00000355078.5_Missense_Mutation_p.G702R|CTNNA1_ENST00000540387.1_Missense_Mutation_p.G435R|CTNNA1_ENST00000518825.1_Missense_Mutation_p.G805R	NM_001903.2	NP_001894.2	P35221	CTNA1_HUMAN	catenin (cadherin-associated protein), alpha 1, 102kDa	805					adherens junction organization (GO:0034332)|aging (GO:0007568)|apical junction assembly (GO:0043297)|axon regeneration (GO:0031103)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular protein localization (GO:0034613)|cellular response to indole-3-methanol (GO:0071681)|epithelial cell-cell adhesion (GO:0090136)|establishment or maintenance of cell polarity (GO:0007163)|gap junction assembly (GO:0016264)|male gonad development (GO:0008584)|muscle cell differentiation (GO:0042692)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell motility (GO:2000146)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of integrin-mediated signaling pathway (GO:2001045)|negative regulation of neuroblast proliferation (GO:0007406)|odontogenesis of dentin-containing tooth (GO:0042475)|ovarian follicle development (GO:0001541)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of smoothened signaling pathway (GO:0045880)|protein heterooligomerization (GO:0051291)|response to estrogen (GO:0043627)	acrosomal vesicle (GO:0001669)|actin cytoskeleton (GO:0015629)|catenin complex (GO:0016342)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|intercalated disc (GO:0014704)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|zonula adherens (GO:0005915)	beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|gamma-catenin binding (GO:0045295)|poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)|vinculin binding (GO:0017166)	p.G805R(1)		NS(1)|breast(7)|cervix(2)|endometrium(4)|kidney(6)|large_intestine(16)|lung(9)|oesophagus(2)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	52			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			GAATCTCGGCGGGGAGCTTGT	0.557																																																	1	Substitution - Missense(1)	endometrium(1)						ENSG00000044115						55.0	54.0	54.0					5																	138268381		2203	4300	6503	CTNNA1	SO:0001583	missense	0			-	HGNC	D13866	CCDS34243.1, CCDS75315.1	5q31.2	2008-02-05	2002-08-29			ENSG00000044115			2509	protein-coding gene	gene with protein product		116805	"""catenin (cadherin-associated protein), alpha 1 (102kD)"""			1924379	Standard	XM_005271898		Approved	CAP102	uc003ldh.3	P35221		ENST00000302763.7:c.2413G>A	5.37:g.138268381G>A	ENSP00000304669:p.Gly805Arg	Somatic	0	51	0.00		0.41568620468393047	377	15.06	67	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	25	27.78	Q12795|Q8N1C0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Vinculin/catenin,superfamily_Vinculin/catenin,prints_Alpha_catenin,prints_Vinculin	p.G805R	ENST00000302763.7	37	c.2413	CCDS34243.1	5	.	.	.	.	.	.	.	.	.	.	G	32	5.108831	0.94292	.	.	ENSG00000044115	ENST00000355078;ENST00000302763;ENST00000537034;ENST00000541863;ENST00000518825;ENST00000540387	T;T;T;T	0.39229	1.09;1.09;1.09;1.09	5.65	5.65	0.86999	.	0.116551	0.64402	D	0.000012	T	0.66228	0.2768	M	0.74647	2.275	0.80722	D	1	D;D;P	0.76494	0.999;0.994;0.944	D;P;P	0.68483	0.958;0.903;0.745	T	0.67078	-0.5761	10	0.72032	D	0.01	-17.5493	19.5069	0.95121	0.0:0.0:1.0:0.0	.	805;682;805	G3XAM7;B4DKT9;P35221	.;.;CTNA1_HUMAN	R	702;805;805;790;805;435	ENSP00000347190:G702R;ENSP00000304669:G805R;ENSP00000427821:G805R;ENSP00000438476:G435R	ENSP00000304669:G805R	G	+	1	0	CTNNA1	138296280	1.000000	0.71417	0.827000	0.32855	0.766000	0.43426	9.574000	0.98184	2.941000	0.99782	0.655000	0.94253	GGG	-	pfam_Vinculin/catenin,superfamily_Vinculin/catenin		0.557	CTNNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTNNA1	protein_coding	OTTHUMT00000373868.1	G	NM_001903	-		138268381	+1	no_errors	ENST00000302763	ensembl	human	known	74_37	missense	SNP	1.000	A
ZMYND12	84217	genome.wustl.edu	37	1	42898702	42898702	+	Intron	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr1:42898702G>A	ENST00000372565.3	-	7	1245				ZMYND12_ENST00000475426.1_5'UTR|ZMYND12_ENST00000433602.2_Intron	NM_032257.4	NP_115633.3	Q9H0C1	ZMY12_HUMAN	zinc finger, MYND-type containing 12							intracellular (GO:0005622)	metal ion binding (GO:0046872)			NS(1)|endometrium(2)|large_intestine(3)|lung(5)|ovary(2)|prostate(2)|skin(2)	17	Ovarian(52;0.00744)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				TTGGAGTGAGGGCTTGCTCTG	0.428																																																	0								ENSG00000066185																																			ZMYND12	SO:0001627	intron_variant	0			-	HGNC	AK057384	CCDS467.1	1p34.1	2008-02-05			ENSG00000066185	ENSG00000066185		"""Zinc fingers, MYND-type"""	21192	protein-coding gene	gene with protein product						11230166	Standard	NM_032257		Approved	DKFZp434N2435	uc001chj.3	Q9H0C1	OTTHUMG00000007333	ENST00000372565.3:c.975+111C>T	1.37:g.42898702G>A		Somatic	0	56	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	21	25.00	Q5VUS6|Q8TC87|Q96M51	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000372565.3	37	NULL	CCDS467.1	1																																																																																			-	-		0.428	ZMYND12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZMYND12	protein_coding	OTTHUMT00000019170.1	G	NM_032257	-		42898702	-1	no_errors	ENST00000475426	ensembl	human	known	74_37	rna	SNP	0.005	A
ATP8B4	79895	genome.wustl.edu	37	15	50215659	50215659	+	Missense_Mutation	SNP	A	A	C			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr15:50215659A>C	ENST00000284509.6	-	17	1816	c.1675T>G	c.(1675-1677)Tcc>Gcc	p.S559A	ATP8B4_ENST00000559829.1_Missense_Mutation_p.S559A	NM_024837.2	NP_079113.2	Q8TF62	AT8B4_HUMAN	ATPase, class I, type 8B, member 4	559						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(6)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|lung(27)|ovary(2)|pancreas(1)|prostate(1)|skin(7)|urinary_tract(1)	73		all_lung(180;0.00183)		all cancers(107;2.41e-07)|GBM - Glioblastoma multiforme(94;8.28e-05)		GCTCCTTTGGAATAAAGCTTT	0.378																																																	0								ENSG00000104043						68.0	65.0	66.0					15																	50215659		2196	4295	6491	ATP8B4	SO:0001583	missense	0			-	HGNC	AB075819	CCDS32238.1	15q21.2	2010-04-20	2007-09-19		ENSG00000104043	ENSG00000104043		"""ATPases / P-type"""	13536	protein-coding gene	gene with protein product		609123	"""ATPase, Class I, type 8B, member 4"""			11015572	Standard	NM_024837		Approved	ATPIM, KIAA1939	uc001zxu.3	Q8TF62		ENST00000284509.6:c.1675T>G	15.37:g.50215659A>C	ENSP00000284509:p.Ser559Ala	Somatic	0	81	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	46	21.67	Q9H727	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ATPase_P-typ_transduc_dom_A,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	p.S559A	ENST00000284509.6	37	c.1675	CCDS32238.1	15	.	.	.	.	.	.	.	.	.	.	A	16.41	3.114995	0.56505	.	.	ENSG00000104043	ENST00000284509	D	0.82167	-1.58	4.93	4.93	0.64822	ATPase, cation-transporting, domain N (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.449057	0.22048	N	0.065360	T	0.79851	0.4517	L	0.54323	1.7	0.31675	N	0.643829	B	0.02656	0.0	B	0.12837	0.008	T	0.80804	-0.1219	10	0.72032	D	0.01	.	12.8303	0.57742	1.0:0.0:0.0:0.0	.	559	Q8TF62	AT8B4_HUMAN	A	559	ENSP00000284509:S559A	ENSP00000284509:S559A	S	-	1	0	ATP8B4	48002951	1.000000	0.71417	1.000000	0.80357	0.759000	0.43091	9.037000	0.93765	1.979000	0.57680	0.533000	0.62120	TCC	-	superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,tigrfam_ATPase_P-typ_Plipid-transp		0.378	ATP8B4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP8B4	protein_coding	OTTHUMT00000418100.1	A	NM_024837	-		50215659	-1	no_errors	ENST00000284509	ensembl	human	known	74_37	missense	SNP	1.000	C
FSCB	84075	genome.wustl.edu	37	14	44974210	44974210	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr14:44974210G>A	ENST00000340446.4	-	1	2272	c.1981C>T	c.(1981-1983)Cca>Tca	p.P661S	RP11-163M18.1_ENST00000557465.1_RNA|RP11-163M18.1_ENST00000555433.1_RNA	NM_032135.3	NP_115511.3	Q5H9T9	FSCB_HUMAN	fibrous sheath CABYR binding protein	661	Ala-rich.					sperm fibrous sheath (GO:0035686)|sperm principal piece (GO:0097228)	calcium ion binding (GO:0005509)			breast(4)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(10)|lung(47)|ovary(2)|pancreas(1)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	89				GBM - Glioblastoma multiforme(112;0.128)		TCAGCTGGTGGAGGCTGAACT	0.627																																																	0								ENSG00000189139						3.0	4.0	4.0					14																	44974210		1321	2998	4319	FSCB	SO:0001583	missense	0			-	HGNC	AK124110	CCDS9679.1	14q21.3	2007-11-22	2007-11-22	2007-11-22	ENSG00000189139	ENSG00000189139			20494	protein-coding gene	gene with protein product		611779	"""chromosome 14 open reading frame 155"""	C14orf155		17855365	Standard	NM_032135		Approved	DKFZP434F1017	uc001wvn.3	Q5H9T9	OTTHUMG00000140262	ENST00000340446.4:c.1981C>T	14.37:g.44974210G>A	ENSP00000344579:p.Pro661Ser	Somatic	0	81	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	42	23.64	Q5H9U7|Q86YI2|Q9H0J3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.P661S	ENST00000340446.4	37	c.1981	CCDS9679.1	14	.	.	.	.	.	.	.	.	.	.	G	8.904	0.957018	0.18507	.	.	ENSG00000189139	ENST00000340446;ENST00000537803	T	0.14516	2.5	3.94	2.04	0.26737	.	.	.	.	.	T	0.23688	0.0573	L	0.55481	1.735	0.09310	N	1	D	0.65815	0.995	D	0.63877	0.919	T	0.13202	-1.0518	9	0.20046	T	0.44	.	7.0687	0.25167	0.1014:0.1756:0.7231:0.0	.	661	Q5H9T9	FSCB_HUMAN	S	661;554	ENSP00000344579:P661S	ENSP00000344579:P661S	P	-	1	0	FSCB	44043960	0.000000	0.05858	0.003000	0.11579	0.006000	0.05464	-0.192000	0.09587	0.425000	0.26087	-0.687000	0.03738	CCA	-	NULL		0.627	FSCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FSCB	protein_coding	OTTHUMT00000276788.1	G	NM_032135	-		44974210	-1	no_errors	ENST00000340446	ensembl	human	known	74_37	missense	SNP	0.074	A
ELAVL3	1995	genome.wustl.edu	37	19	11591448	11591448	+	5'UTR	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr19:11591448C>T	ENST00000359227.3	-	0	400				ELAVL3_ENST00000438662.2_5'Flank|CTC-398G3.6_ENST00000585656.1_Intron|ELAVL3_ENST00000592218.1_5'UTR	NM_001420.3|NM_032281.2	NP_001411.2|NP_115657.2	Q14576	ELAV3_HUMAN	ELAV like neuron-specific RNA binding protein 3						cell differentiation (GO:0030154)|nervous system development (GO:0007399)		AU-rich element binding (GO:0017091)|nucleotide binding (GO:0000166)			breast(1)|endometrium(2)|large_intestine(4)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	15						CGGGCGCGGTCCGTGTTGAGG	0.711																																																	0								ENSG00000196361						24.0	27.0	26.0					19																	11591448		2198	4297	6495	ELAVL3	SO:0001623	5_prime_UTR_variant	0			-	HGNC		CCDS32912.1, CCDS45978.1	19p13.2	2013-10-03	2013-10-03			ENSG00000196361		"""RNA binding motif (RRM) containing"""	3314	protein-coding gene	gene with protein product	"""Hu antigen C"", ""paraneoplastic limbic encephalitis antigen 21"", ""paraneoplastic cerebellar degeneration-associated antigen"", ""ELAV-like protein 3"""	603458	"""ELAV (embryonic lethal, abnormal vision, Drosophila)-like 3 (Hu antigen C)"""			9799595	Standard	NM_001420		Approved	HUC, PLE21, DKFZp547J036, HUCL, MGC20653	uc002mry.1	Q14576		ENST00000359227.3:c.-25G>A	19.37:g.11591448C>T		Somatic	0	140	0.00		0.41568620468393047	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	31	63	32.98	Q16135|Q96CL8|Q96QS9	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000359227.3	37	NULL	CCDS32912.1	19																																																																																			-	-		0.711	ELAVL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ELAVL3	protein_coding	OTTHUMT00000458827.2	C	NM_001420	-		11591448	-1	no_errors	ENST00000592218	ensembl	human	putative	74_37	rna	SNP	1.000	T
ERAL1	26284	genome.wustl.edu	37	17	27185427	27185427	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr17:27185427C>T	ENST00000254928.5	+	6	731	c.634C>T	c.(634-636)Cgg>Tgg	p.R212W	MIR144_ENST00000385059.1_lincRNA	NM_005702.2	NP_005693.1	O75616	ERAL1_HUMAN	Era-like 12S mitochondrial rRNA chaperone 1	212	Era-type G.				ribosomal small subunit assembly (GO:0000028)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|poly(A) RNA binding (GO:0044822)|ribosomal small subunit binding (GO:0043024)|rRNA binding (GO:0019843)			endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|skin(2)	11	all_cancers(5;2.12e-15)|all_epithelial(6;3.44e-19)|Lung NSC(42;0.01)		Epithelial(11;1.12e-05)|all cancers(11;5.32e-05)|BRCA - Breast invasive adenocarcinoma(11;0.000272)|OV - Ovarian serous cystadenocarcinoma(11;0.105)			CAAGTGGACACGGAACCAGCT	0.517																																																	0								ENSG00000132591						144.0	107.0	120.0					17																	27185427		2203	4300	6503	ERAL1	SO:0001583	missense	0			-	HGNC	AF082657	CCDS11244.1	17q11.2	2013-05-22	2013-05-22		ENSG00000132591	ENSG00000132591			3424	protein-coding gene	gene with protein product		607435	"""Era (E. coli G-protein homolog)-like 1"", ""Era G-protein-like 1 (E. coli)"""			10945472, 20604745	Standard	NM_005702		Approved	HERA-B	uc002hcy.1	O75616	OTTHUMG00000132675	ENST00000254928.5:c.634C>T	17.37:g.27185427C>T	ENSP00000254928:p.Arg212Trp	Somatic	0	51	0.00		0.41568620468393047	80	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	B3KN21|C9JEC6|O75617|Q8WUY4|Q96LE2|Q96TC0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GTP_binding_domain,pfam_MIRO-like,pfam_Dynamin_GTPase,pfam_AIG1,pfam_EF_GTP-bd_dom,pfam_Fe2_transport_prot_B_N,superfamily_P-loop_NTPase,superfamily_KH_prok-type,prints_GTP_binding_domain,tigrfam_Small_GTP-bd_dom	p.R212W	ENST00000254928.5	37	c.634	CCDS11244.1	17	.	.	.	.	.	.	.	.	.	.	C	11.54	1.667915	0.29604	.	.	ENSG00000132591	ENST00000254928;ENST00000412138	D	0.95554	-3.74	5.37	3.24	0.37175	Small GTP-binding protein domain (1);GTP-binding domain, HSR1-related (1);	0.099564	0.64402	D	0.000002	D	0.97907	0.9312	M	0.92122	3.275	0.80722	D	1	D	0.89917	1.0	D	0.77004	0.989	D	0.98468	1.0599	10	0.87932	D	0	-26.4873	12.3641	0.55219	0.4445:0.5555:0.0:0.0	.	212	O75616	ERAL1_HUMAN	W	212;152	ENSP00000254928:R212W	ENSP00000254928:R212W	R	+	1	2	ERAL1	24209553	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.629000	0.37071	1.449000	0.47699	0.650000	0.86243	CGG	-	pfam_GTP_binding_domain,pfam_MIRO-like,pfam_EF_GTP-bd_dom,pfam_Fe2_transport_prot_B_N,superfamily_P-loop_NTPase,tigrfam_Small_GTP-bd_dom		0.517	ERAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERAL1	protein_coding	OTTHUMT00000255937.2	C		-		27185427	+1	no_errors	ENST00000254928	ensembl	human	known	74_37	missense	SNP	0.999	T
RYR2	6262	genome.wustl.edu	37	1	237754099	237754099	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr1:237754099C>T	ENST00000366574.2	+	31	4284	c.3967C>T	c.(3967-3969)Cct>Tct	p.P1323S	RYR2_ENST00000360064.6_Missense_Mutation_p.P1321S|RYR2_ENST00000542537.1_Missense_Mutation_p.P1307S	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	1323	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TGGAGGGCTCCCTGGGGCTGG	0.512																																																	0								ENSG00000198626						112.0	109.0	110.0					1																	237754099		1921	4134	6055	RYR2	SO:0001583	missense	0			-	HGNC	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.3967C>T	1.37:g.237754099C>T	ENSP00000355533:p.Pro1323Ser	Somatic	0	45	0.00		0.41568620468393047	2	50.00	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	26	29.73	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_hand_dom,pfscan_MIR_motif	p.P1321S	ENST00000366574.2	37	c.3961	CCDS55691.1	1	.	.	.	.	.	.	.	.	.	.	c	14.17	2.455900	0.43634	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	D;D;D	0.96554	-4.05;-4.02;-4.04	5.23	4.32	0.51571	.	0.126422	0.35585	N	0.003103	D	0.88840	0.6546	N	0.03608	-0.345	0.58432	D	0.999999	P	0.47762	0.9	B	0.39419	0.299	D	0.89653	0.3871	10	0.36615	T	0.2	.	14.1028	0.65068	0.0:0.9279:0.0:0.0721	.	1323	Q92736	RYR2_HUMAN	S	1323;1321;1307	ENSP00000355533:P1323S;ENSP00000353174:P1321S;ENSP00000443798:P1307S	ENSP00000353174:P1321S	P	+	1	0	RYR2	235820722	0.975000	0.34042	0.443000	0.26883	0.989000	0.77384	3.216000	0.51176	1.576000	0.49790	0.655000	0.94253	CCT	-	NULL		0.512	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	protein_coding	OTTHUMT00000095402.2	C	NM_001035	-		237754099	+1	no_errors	ENST00000360064	ensembl	human	known	74_37	missense	SNP	0.453	T
HCN4	10021	genome.wustl.edu	37	15	73617297	73617297	+	Splice_Site	SNP	T	T	G			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr15:73617297T>G	ENST00000261917.3	-	6	2970	c.1977A>C	c.(1975-1977)ggA>ggC	p.G659G		NM_005477.2	NP_005468.1	Q9Y3Q4	HCN4_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 4	659					blood circulation (GO:0008015)|cation transport (GO:0006812)|cellular response to cAMP (GO:0071320)|cellular response to cGMP (GO:0071321)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|potassium ion transmembrane transport (GO:0071805)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)|terminal bouton (GO:0043195)	cAMP binding (GO:0030552)|cation channel activity (GO:0005261)|identical protein binding (GO:0042802)|intracellular cAMP activated cation channel activity (GO:0005222)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)			NS(2)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(13)|liver(1)|lung(18)|ovary(6)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	55				COAD - Colon adenocarcinoma(1;0.142)		CTGCCTCACCTCCAAAGTAGG	0.627																																																	0								ENSG00000138622						48.0	44.0	45.0					15																	73617297		2198	4297	6495	HCN4	SO:0001630	splice_region_variant	0			-	HGNC	AJ132429	CCDS10248.1	15q24.1	2011-07-05			ENSG00000138622	ENSG00000138622		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	16882	protein-coding gene	gene with protein product		605206				10228147, 10430953, 16382102	Standard	NM_005477		Approved		uc002avp.3	Q9Y3Q4	OTTHUMG00000137563	ENST00000261917.3:c.1978+1A>C	15.37:g.73617297T>G		Somatic	0	36	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	22	26.67	Q9UMQ7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_N,pfam_cNMP-bd_dom,pfam_Ion_trans_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG/ELK/ERG,pfscan_cNMP-bd_dom	p.G659	ENST00000261917.3	37	c.1977	CCDS10248.1	15																																																																																			-	pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom		0.627	HCN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCN4	protein_coding	OTTHUMT00000268900.2	T	NM_005477	-	Silent	73617297	-1	no_errors	ENST00000261917	ensembl	human	known	74_37	silent	SNP	1.000	G
IFT172	26160	genome.wustl.edu	37	2	27682297	27682297	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr2:27682297G>A	ENST00000260570.3	-	25	2838	c.2735C>T	c.(2734-2736)tCc>tTc	p.S912F		NM_015662.1	NP_056477.1	Q9UG01	IF172_HUMAN	intraflagellar transport 172	912					bone development (GO:0060348)|brain development (GO:0007420)|cilium assembly (GO:0042384)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|epidermis development (GO:0008544)|heart looping (GO:0001947)|hindgut development (GO:0061525)|left/right axis specification (GO:0070986)|limb development (GO:0060173)|negative regulation of epithelial cell proliferation (GO:0050680)|neural tube closure (GO:0001843)|Notch signaling pathway (GO:0007219)|palate development (GO:0060021)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|smoothened signaling pathway (GO:0007224)|spinal cord motor neuron differentiation (GO:0021522)	axoneme (GO:0005930)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|intraciliary transport particle B (GO:0030992)|sperm midpiece (GO:0097225)|sperm principal piece (GO:0097228)|vesicle (GO:0031982)				central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(17)|lung(17)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	43	Acute lymphoblastic leukemia(172;0.155)					ATAGTATTTGGATGCAGTGTT	0.517																																																	0								ENSG00000138002						113.0	99.0	104.0					2																	27682297		2203	4300	6503	IFT172	SO:0001583	missense	0			-	HGNC	AB033005	CCDS1755.1	2p23.3	2014-07-03	2014-07-03		ENSG00000138002	ENSG00000138002		"""Intraflagellar transport homologs"", ""WD repeat domain containing"""	30391	protein-coding gene	gene with protein product	"""wimple homolog"""	607386	"""intraflagellar transport 172 homolog (Chlamydomonas)"""			10788441, 10574461, 24140113	Standard	XM_005264254		Approved	SLB, wim, osm-1, NPHP17	uc002rku.3	Q9UG01	OTTHUMG00000128425	ENST00000260570.3:c.2735C>T	2.37:g.27682297G>A	ENSP00000260570:p.Ser912Phe	Somatic	0	39	0.00		0.41568620468393047	7	12.50	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	20	16.67	A5PKZ0|B2RNU5|Q86X44|Q96HW4|Q9UFJ9|Q9ULP1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat	p.S912F	ENST00000260570.3	37	c.2735	CCDS1755.1	2	.	.	.	.	.	.	.	.	.	.	G	14.97	2.695806	0.48202	.	.	ENSG00000138002	ENST00000260570	T	0.66460	-0.21	5.93	5.04	0.67666	Tetratricopeptide-like helical (1);	0.218844	0.45361	D	0.000362	T	0.48750	0.1517	N	0.03608	-0.345	0.80722	D	1	B	0.25667	0.131	B	0.33690	0.168	T	0.52968	-0.8504	10	0.59425	D	0.04	-7.1097	14.124	0.65208	0.0:0.1502:0.8498:0.0	.	912	Q9UG01	IF172_HUMAN	F	912	ENSP00000260570:S912F	ENSP00000260570:S912F	S	-	2	0	IFT172	27535801	0.988000	0.35896	0.999000	0.59377	0.811000	0.45836	2.384000	0.44362	1.473000	0.48159	0.655000	0.94253	TCC	-	NULL		0.517	IFT172-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFT172	protein_coding	OTTHUMT00000250213.2	G	NM_015662	-		27682297	-1	no_errors	ENST00000260570	ensembl	human	known	74_37	missense	SNP	1.000	A
TMPRSS6	164656	genome.wustl.edu	37	22	37480403	37480403	+	Silent	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr22:37480403G>A	ENST00000346753.3	-	10	1271	c.1155C>T	c.(1153-1155)gcC>gcT	p.A385A	TMPRSS6_ENST00000406725.1_Silent_p.A376A|TMPRSS6_ENST00000442782.2_Silent_p.A385A|TMPRSS6_ENST00000381792.2_Silent_p.A376A|RP5-1170K4.7_ENST00000414203.2_RNA|TMPRSS6_ENST00000406856.1_Silent_p.A376A	NM_153609.2	NP_705837.1	Q8IU80	TMPS6_HUMAN	transmembrane protease, serine 6	385	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.				angiogenesis (GO:0001525)|extracellular matrix organization (GO:0030198)|fibrinolysis (GO:0042730)|intracellular signal transduction (GO:0035556)|iron ion homeostasis (GO:0055072)|proteolysis (GO:0006508)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)			breast(5)|central_nervous_system(4)|endometrium(4)|kidney(4)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(2)|stomach(3)	40						TCAGTGCATAGGCATCAAACC	0.612																																																	0								ENSG00000187045						107.0	69.0	82.0					22																	37480403		2203	4300	6503	TMPRSS6	SO:0001819	synonymous_variant	0			-	HGNC	AY055383	CCDS13941.1, CCDS74856.1, CCDS74857.1	22q13.1	2010-04-13			ENSG00000187045	ENSG00000187045		"""Serine peptidases / Transmembrane"""	16517	protein-coding gene	gene with protein product		609862					Standard	NM_001289000		Approved	FLJ30744	uc003aqs.1	Q8IU80	OTTHUMG00000150541	ENST00000346753.3:c.1155C>T	22.37:g.37480403G>A		Somatic	0	43	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	19	20.83	B0QYB4|B0QYB7|B0QYB8|Q5TI06|Q6ICC2|Q6UXD8|Q8IUE2|Q8IXV8	Silent	SNP	NA	NA	NA	NA	NA	NA	pirsf_Pept_S1A_matriptase-2,pfam_Peptidase_S1,pfam_LDrepeatLR_classA_rpt,pfam_SEA_dom,pfam_Peptidase_S1A_nudel,superfamily_Trypsin-like_Pept_dom,superfamily_CUB_dom,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_Peptidase_S1,prints_Peptidase_S1A,prints_LDrepeatLR_classA_rpt,pfscan_CUB_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_Peptidase_S1	p.A376	ENST00000346753.3	37	c.1128	CCDS13941.1	22																																																																																			-	pirsf_Pept_S1A_matriptase-2,superfamily_CUB_dom,pfscan_CUB_dom		0.612	TMPRSS6-003	NOVEL	basic|CCDS	protein_coding	TMPRSS6	protein_coding	OTTHUMT00000318822.1	G	NM_153609	-		37480403	-1	no_errors	ENST00000381792	ensembl	human	known	74_37	silent	SNP	1.000	A
FAM231D	644634	genome.wustl.edu	37	1	149676402	149676402	+	Silent	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr1:149676402G>A	ENST00000369173.2	+	1	425	c.333G>A	c.(331-333)caG>caA	p.Q111Q	RP11-353N4.5_ENST00000608683.1_lincRNA|RP11-353N4.4_ENST00000443602.2_lincRNA																							CAGACAACCAGAGGGAGAGCA	0.552																																																	0								ENSG00000203815																																			AL358813.2	SO:0001819	synonymous_variant	0			-	Clone_based_ensembl_gene																												ENST00000369173.2:c.333G>A	1.37:g.149676402G>A		Somatic	0	264	0.00		0.41568620468393047	2	66.67	4	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	152	13.56		Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.Q111	ENST00000369173.2	37	c.333		1																																																																																			-	NULL		0.552	AL358813.2-201	NOVEL	basic|appris_principal	protein_coding	LOC100996721	protein_coding		G		-		149676402	+1	no_errors	ENST00000369173	ensembl	human	novel	74_37	silent	SNP	0.105	A
TMEM63A	9725	genome.wustl.edu	37	1	226049966	226049966	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr1:226049966G>A	ENST00000366835.3	-	13	1307	c.1037C>T	c.(1036-1038)cCc>cTc	p.P346L	TMEM63A_ENST00000537914.1_Missense_Mutation_p.P20L|TMEM63A_ENST00000474478.1_5'UTR	NM_014698.2	NP_055513.2	O94886	CSCL1_HUMAN	transmembrane protein 63A	346					ion transport (GO:0006811)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	nucleotide binding (GO:0000166)			breast(2)|endometrium(3)|large_intestine(5)|lung(6)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	24	Breast(184;0.197)					CATTCCCAGGGGCTGGTCCTG	0.577																																																	0								ENSG00000196187						135.0	106.0	116.0					1																	226049966		2203	4300	6503	TMEM63A	SO:0001583	missense	0			-	HGNC		CCDS31042.1	1q42.12	2008-02-05	2005-07-25	2005-07-25	ENSG00000196187	ENSG00000196187			29118	protein-coding gene	gene with protein product			"""KIAA0792"""	KIAA0792		9872452, 9455484	Standard	NM_014698		Approved		uc001hpm.2	O94886	OTTHUMG00000037442	ENST00000366835.3:c.1037C>T	1.37:g.226049966G>A	ENSP00000355800:p.Pro346Leu	Somatic	0	67	0.00		0.41568620468393047	6	40.00	4	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	48	20.00	Q53GI7|Q5TE96|Q8N2U2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF221	p.P346L	ENST00000366835.3	37	c.1037	CCDS31042.1	1	.	.	.	.	.	.	.	.	.	.	G	36	5.773201	0.96922	.	.	ENSG00000196187	ENST00000366835;ENST00000537914	T	0.42513	0.97	5.71	5.71	0.89125	Nucleotide-binding, alpha-beta plait (1);	0.143303	0.64402	D	0.000004	T	0.68293	0.2985	M	0.82056	2.57	0.80722	D	1	D	0.76494	0.999	D	0.72982	0.979	T	0.68606	-0.5364	10	0.49607	T	0.09	-28.4403	19.9223	0.97091	0.0:0.0:1.0:0.0	.	346	O94886	TM63A_HUMAN	L	346;20	ENSP00000355800:P346L	ENSP00000355800:P346L	P	-	2	0	TMEM63A	224116589	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	9.615000	0.98356	2.709000	0.92574	0.555000	0.69702	CCC	-	NULL		0.577	TMEM63A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM63A	protein_coding	OTTHUMT00000091154.2	G	NM_014698	-		226049966	-1	no_errors	ENST00000366835	ensembl	human	known	74_37	missense	SNP	1.000	A
EPB41L4A	64097	genome.wustl.edu	37	5	111643171	111643171	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr5:111643171G>A	ENST00000261486.5	-	2	392	c.116C>T	c.(115-117)tCc>tTc	p.S39F		NM_022140.3	NP_071423	Q9HCS5	E41LA_HUMAN	erythrocyte membrane protein band 4.1 like 4A	39	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.					cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)				breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(10)|ovary(1)|prostate(2)|skin(1)	34		all_cancers(142;4.93e-06)|all_epithelial(76;2.28e-08)|Prostate(80;0.000244)|Colorectal(10;0.000788)|Ovarian(225;0.0448)|Lung NSC(167;0.126)|all_lung(232;0.135)		OV - Ovarian serous cystadenocarcinoma(64;6.24e-09)|Epithelial(69;1.43e-07)|all cancers(49;2.78e-05)|COAD - Colon adenocarcinoma(37;0.0467)|Colorectal(14;0.0791)		AAGGACAACGGAACCTTTCGT	0.388																																																	0								ENSG00000129595						97.0	91.0	93.0					5																	111643171		1868	4104	5972	EPB41L4A	SO:0001583	missense	0			-	HGNC	AB030240	CCDS43350.1	5q21.3	2008-02-05			ENSG00000129595	ENSG00000129595			13278	protein-coding gene	gene with protein product		612141				10874211	Standard	XM_005272043		Approved	NBL4	uc003kpv.1	Q9HCS5	OTTHUMG00000162902	ENST00000261486.5:c.116C>T	5.37:g.111643171G>A	ENSP00000261486:p.Ser39Phe	Somatic	0	58	0.00		0.41568620468393047	5	16.67	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	26	23.53	A4FUI6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_FERM_central,pfam_FERM_N,pfam_FERM_PH-like_C,pfam_FERM-adjacent,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain,prints_Band_41_fam,prints_Ez/rad/moesin_like	p.S39F	ENST00000261486.5	37	c.116	CCDS43350.1	5	.	.	.	.	.	.	.	.	.	.	G	15.98	2.991934	0.54041	.	.	ENSG00000129595	ENST00000261486	T	0.78126	-1.15	5.82	5.82	0.92795	FERM, N-terminal (1);Band 4.1 domain (1);FERM domain (1);	0.131611	0.53938	D	0.000055	T	0.78566	0.4303	L	0.56340	1.77	0.41865	D	0.990243	P	0.35551	0.509	B	0.38712	0.28	T	0.79715	-0.1687	10	0.87932	D	0	.	19.7087	0.96084	0.0:0.0:1.0:0.0	.	39	Q9HCS5	E41LA_HUMAN	F	39	ENSP00000261486:S39F	ENSP00000261486:S39F	S	-	2	0	EPB41L4A	111671070	1.000000	0.71417	0.426000	0.26672	0.972000	0.66771	5.671000	0.68095	2.754000	0.94517	0.643000	0.83706	TCC	-	pfam_FERM_N,smart_Band_41_domain,pfscan_FERM_domain,prints_Ez/rad/moesin_like		0.388	EPB41L4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPB41L4A	protein_coding	OTTHUMT00000370969.1	G		-		111643171	-1	no_errors	ENST00000261486	ensembl	human	known	74_37	missense	SNP	0.917	A
EFEMP1	2202	genome.wustl.edu	37	2	56094300	56094300	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr2:56094300C>T	ENST00000394555.2	-	11	1825	c.1390G>A	c.(1390-1392)Gac>Aac	p.D464N	EFEMP1_ENST00000355426.3_Missense_Mutation_p.D464N|EFEMP1_ENST00000394554.1_Missense_Mutation_p.D464N|EFEMP1_ENST00000424836.2_Missense_Mutation_p.D326N	NM_001039348.2|NM_001039349.2	NP_001034437.1|NP_001034438.1	Q12805	FBLN3_HUMAN	EGF containing fibulin-like extracellular matrix protein 1	464	Mediates interaction with TIMP3.				epidermal growth factor receptor signaling pathway (GO:0007173)|extracellular matrix organization (GO:0030198)|negative regulation of chondrocyte differentiation (GO:0032331)|peptidyl-tyrosine phosphorylation (GO:0018108)|regulation of transcription, DNA-templated (GO:0006355)|visual perception (GO:0007601)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|epidermal growth factor receptor binding (GO:0005154)|epidermal growth factor-activated receptor activity (GO:0005006)			NS(1)|breast(2)|endometrium(4)|large_intestine(6)|lung(5)|ovary(5)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	28			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			ATCTCCAGGTCCACGATATGT	0.408																																					GBM(92;934 1319 7714 28760 40110)												0								ENSG00000115380						121.0	104.0	110.0					2																	56094300		2203	4300	6503	EFEMP1	SO:0001583	missense	0			-	HGNC	U03877	CCDS1857.1	2p16	2013-01-08	2011-01-25		ENSG00000115380	ENSG00000115380		"""Fibulins"""	3218	protein-coding gene	gene with protein product	"""fibulin 3"""	601548	"""fibrillin-like"", ""EGF-containing fibulin-like extracellular matrix protein 1"""	DHRD, FBNL		8812496, 7799918	Standard	NM_001039348		Approved	S1-5, FBLN3, MTLV	uc002rzi.3	Q12805	OTTHUMG00000129343	ENST00000394555.2:c.1390G>A	2.37:g.56094300C>T	ENSP00000378058:p.Asp464Asn	Somatic	0	69	0.00		0.41568620468393047	205	5.96	13	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	39	18.75	A8K3I4|B4DW75|D6W5D2|Q541U7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_EGF-like_Ca-bd_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom	p.D464N	ENST00000394555.2	37	c.1390	CCDS1857.1	2	.	.	.	.	.	.	.	.	.	.	C	16.81	3.225947	0.58668	.	.	ENSG00000115380	ENST00000394555;ENST00000394554;ENST00000405693;ENST00000424836;ENST00000355426	D;D;T;D	0.84800	-1.9;-1.9;-1.36;-1.9	5.28	4.4	0.53042	.	0.000000	0.64402	D	0.000006	D	0.86422	0.5929	L	0.59436	1.845	0.58432	D	0.999995	D;P	0.59357	0.985;0.742	P;P	0.50352	0.638;0.47	D	0.87307	0.2309	10	0.59425	D	0.04	.	14.0486	0.64719	0.0:0.9266:0.0:0.0734	.	326;464	B4DW75;Q12805	.;FBLN3_HUMAN	N	464;464;320;326;464	ENSP00000378058:D464N;ENSP00000378057:D464N;ENSP00000399145:D326N;ENSP00000347596:D464N	ENSP00000347596:D464N	D	-	1	0	EFEMP1	55947804	1.000000	0.71417	1.000000	0.80357	0.748000	0.42578	7.776000	0.85560	1.358000	0.45922	0.591000	0.81541	GAC	-	NULL		0.408	EFEMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EFEMP1	protein_coding	OTTHUMT00000251491.2	C		-		56094300	-1	no_errors	ENST00000355426	ensembl	human	known	74_37	missense	SNP	1.000	T
RABL2A	11159	genome.wustl.edu	37	2	114398551	114398551	+	Silent	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr2:114398551C>T	ENST00000393167.3	+	6	603	c.378C>T	c.(376-378)atC>atT	p.I126I	RABL2A_ENST00000409875.1_Silent_p.I126I|RABL2A_ENST00000409842.1_Intron|RABL2A_ENST00000393165.3_Silent_p.I126I|RABL2A_ENST00000393166.3_Silent_p.I126I|RABL2A_ENST00000376439.3_Intron|RABL2A_ENST00000478880.1_3'UTR	NM_013412.2	NP_038198.1	Q9UBK7	RBL2A_HUMAN	RAB, member of RAS oncogene family-like 2A	126					GTP catabolic process (GO:0006184)|small GTPase mediated signal transduction (GO:0007264)		GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|prostate(1)|skin(1)|stomach(3)	9						GGCCAGAGATCCCATGCATCG	0.517																																																	0								ENSG00000144134						47.0	47.0	47.0					2																	114398551		2201	4295	6496	RABL2A	SO:0001819	synonymous_variant	0			-	HGNC		CCDS2118.1	2q13	2014-05-09			ENSG00000144134	ENSG00000144134		"""RAB, member RAS oncogene"""	9799	protein-coding gene	gene with protein product		605412				10444334	Standard	NM_007082		Approved		uc010flb.3	Q9UBK7	OTTHUMG00000047828	ENST00000393167.3:c.378C>T	2.37:g.114398551C>T		Somatic	0	67	0.00		0.41568620468393047	15	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	23	32.35	B7ZBD6|Q9NU37	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Gtr1_RagA,pfam_EF_GTP-bd_dom,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.I126	ENST00000393167.3	37	c.378	CCDS2118.1	2																																																																																			-	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Gtr1_RagA,pfam_EF_GTP-bd_dom,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom		0.517	RABL2A-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	RABL2A	protein_coding	OTTHUMT00000109047.2	C		-		114398551	+1	no_errors	ENST00000393166	ensembl	human	known	74_37	silent	SNP	1.000	T
SNX7	51375	genome.wustl.edu	37	1	99157162	99157162	+	Silent	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr1:99157162G>A	ENST00000306121.3	+	4	555	c.546G>A	c.(544-546)agG>agA	p.R182R	SNX7_ENST00000529992.1_Intron|SNX7_ENST00000370189.5_Silent_p.R118R	NM_015976.4	NP_057060.2	Q9UNH6	SNX7_HUMAN	sorting nexin 7	118					apoptotic process (GO:0006915)|intracellular protein transport (GO:0006886)	cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|membrane (GO:0016020)	phosphatidylinositol binding (GO:0035091)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)	13		all_epithelial(167;7.64e-07)|all_lung(203;0.0006)|Lung NSC(277;0.00137)		Epithelial(280;0.0521)|all cancers(265;0.0687)|COAD - Colon adenocarcinoma(174;0.15)|Lung(183;0.207)|Colorectal(170;0.234)		AGACACGCAGGAAGGCTTTAC	0.343																																																	0								ENSG00000162627						74.0	73.0	73.0					1																	99157162		2203	4300	6503	SNX7	SO:0001819	synonymous_variant	0			-	HGNC	AF121857	CCDS755.2, CCDS756.1, CCDS756.2	1p21	2008-05-22			ENSG00000162627	ENSG00000162627		"""Sorting nexins"""	14971	protein-coding gene	gene with protein product		614904					Standard	NM_015976		Approved		uc010ouc.2	Q9UNH6	OTTHUMG00000010723	ENST00000306121.3:c.546G>A	1.37:g.99157162G>A		Somatic	0	127	0.00		0.41568620468393047	98	36.13	56	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	75	21.05	A8KAF3|D3DT50|Q53FQ3|Q5VT09|Q5VT10|Q86U82|Q8WVD4|Q96FW9|Q9Y3Z7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Phox,superfamily_Phox,smart_Phox,pfscan_Phox	p.R182	ENST00000306121.3	37	c.546	CCDS755.2	1																																																																																			-	pfam_Phox,superfamily_Phox,smart_Phox,pfscan_Phox		0.343	SNX7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNX7	protein_coding	OTTHUMT00000029609.2	G		-		99157162	+1	no_errors	ENST00000306121	ensembl	human	known	74_37	silent	SNP	0.998	A
ATP8B4	79895	genome.wustl.edu	37	15	50215658	50215658	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr15:50215658G>A	ENST00000284509.6	-	17	1817	c.1676C>T	c.(1675-1677)tCc>tTc	p.S559F	ATP8B4_ENST00000559829.1_Missense_Mutation_p.S559F	NM_024837.2	NP_079113.2	Q8TF62	AT8B4_HUMAN	ATPase, class I, type 8B, member 4	559						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(6)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|lung(27)|ovary(2)|pancreas(1)|prostate(1)|skin(7)|urinary_tract(1)	73		all_lung(180;0.00183)		all cancers(107;2.41e-07)|GBM - Glioblastoma multiforme(94;8.28e-05)		TGCTCCTTTGGAATAAAGCTT	0.373																																																	0								ENSG00000104043						69.0	65.0	66.0					15																	50215658		2196	4295	6491	ATP8B4	SO:0001583	missense	0			-	HGNC	AB075819	CCDS32238.1	15q21.2	2010-04-20	2007-09-19		ENSG00000104043	ENSG00000104043		"""ATPases / P-type"""	13536	protein-coding gene	gene with protein product		609123	"""ATPase, Class I, type 8B, member 4"""			11015572	Standard	NM_024837		Approved	ATPIM, KIAA1939	uc001zxu.3	Q8TF62		ENST00000284509.6:c.1676C>T	15.37:g.50215658G>A	ENSP00000284509:p.Ser559Phe	Somatic	0	79	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	46	22.03	Q9H727	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ATPase_P-typ_transduc_dom_A,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	p.S559F	ENST00000284509.6	37	c.1676	CCDS32238.1	15	.	.	.	.	.	.	.	.	.	.	G	15.66	2.897852	0.52227	.	.	ENSG00000104043	ENST00000284509	D	0.82526	-1.62	4.93	1.54	0.23209	ATPase, cation-transporting, domain N (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.449057	0.22048	N	0.065360	D	0.88351	0.6413	M	0.86097	2.795	0.35412	D	0.792505	P	0.36222	0.544	P	0.47705	0.555	D	0.92210	0.5775	10	0.87932	D	0	.	14.278	0.66194	0.0:0.6405:0.3595:0.0	.	559	Q8TF62	AT8B4_HUMAN	F	559	ENSP00000284509:S559F	ENSP00000284509:S559F	S	-	2	0	ATP8B4	48002950	1.000000	0.71417	1.000000	0.80357	0.754000	0.42855	1.823000	0.39062	0.570000	0.29347	-0.165000	0.13383	TCC	-	superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,tigrfam_ATPase_P-typ_Plipid-transp		0.373	ATP8B4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP8B4	protein_coding	OTTHUMT00000418100.1	G	NM_024837	-		50215658	-1	no_errors	ENST00000284509	ensembl	human	known	74_37	missense	SNP	1.000	A
GNAS	2778	genome.wustl.edu	37	20	57430110	57430110	+	Missense_Mutation	SNP	A	A	G			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr20:57430110A>G	ENST00000371100.4	+	1	2342	c.1790A>G	c.(1789-1791)aAt>aGt	p.N597S	GNAS_ENST00000313949.7_Intron|GNAS_ENST00000371102.4_Missense_Mutation_p.N597S|GNAS_ENST00000371098.2_Intron|GNAS_ENST00000306120.3_Missense_Mutation_p.I534V|GNAS_ENST00000371099.2_Missense_Mutation_p.N597S|GNAS_ENST00000371075.3_Intron|GNAS_ENST00000464624.2_3'UTR	NM_001077490.1|NM_080425.2	NP_001070958.1|NP_536350.2	P63092	GNAS2_HUMAN	GNAS complex locus	0					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|bone development (GO:0060348)|cAMP biosynthetic process (GO:0006171)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|cognition (GO:0050890)|developmental growth (GO:0048589)|energy reserve metabolic process (GO:0006112)|hair follicle placode formation (GO:0060789)|intracellular transport (GO:0046907)|platelet aggregation (GO:0070527)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of insulin secretion (GO:0050796)|sensory perception of smell (GO:0007608)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|intrinsic component of membrane (GO:0031224)|membrane (GO:0016020)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	adenylate cyclase activity (GO:0004016)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			adrenal_gland(12)|autonomic_ganglia(1)|biliary_tract(5)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(37)|liver(9)|lung(9)|ovary(16)|pancreas(56)|parathyroid(5)|pituitary(228)|prostate(2)|small_intestine(1)|stomach(1)|testis(2)|thyroid(35)|upper_aerodigestive_tract(3)|urinary_tract(1)	441	all_lung(29;0.0104)		BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)			CATCGGCGAAATCGCCGCCGC	0.627			Mis		pituitary adenoma		"""McCune-Albright syndrome; pseudohypoparathyroidism, type IA"""			TSP Lung(22;0.16)																											Colon(117;935 1597 6045 8307 46442)			Dom	yes		20	20q13.2	2778	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	yes	E	0								ENSG00000087460						20.0	26.0	24.0					20																	57430110		2001	4165	6166	GNAS	SO:0001583	missense	0			-	HGNC	M21142	CCDS13471.1, CCDS13472.1, CCDS42892.1, CCDS46622.1, CCDS46623.1, CCDS46624.1	20q13.2-q13.3	2010-03-01	2001-12-19	2001-12-20	ENSG00000087460	ENSG00000087460			4392	protein-coding gene	gene with protein product	"""secretogranin VI"""	139320	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	GNAS1			Standard	NM_000516		Approved	NESP55, NESP, GNASXL, GPSA, SCG6	uc002xzw.3	O95467	OTTHUMG00000033069	ENST00000371100.4:c.1790A>G	20.37:g.57430110A>G	ENSP00000360141:p.Asn597Ser	Somatic	0	47	0.00		0.41568620468393047	1	50.00	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	26	13.33	A6NI00|E1P5G5|P04895|Q12927|Q14433|Q32P26|Q5JWD2|Q5JWD4|Q5JWD5|Q6NR75|Q6NXS0|Q8TBC0|Q96H70	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Gprotein_alpha_su,pfam_Small_GTPase_ARF/SAR,superfamily_P-loop_NTPase,superfamily_GproteinA_insert,smart_Gprotein_alpha_su,prints_Gprotein_alpha_S,prints_Gprotein_alpha_su	p.N597S	ENST00000371100.4	37	c.1790	CCDS46622.1	20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	6.112|6.112	0.388856|0.388856	0.11581|0.11581	.|.	.|.	ENSG00000087460|ENSG00000087460	ENST00000306120|ENST00000371099;ENST00000371100;ENST00000371102	.|D;D	.|0.88354	.|-2.37;-2.37	3.84|3.84	-1.0|-1.0	0.10196|0.10196	.|.	.|65.754300	.|0.00166	.|N	.|0.000000	D|D	0.85248|0.85248	0.5653|0.5653	L|L	0.55481|0.55481	1.735|1.735	0.09310|0.09310	N|N	1|1	.|B	.|0.09022	.|0.002	.|B	.|0.04013	.|0.001	T|T	0.65878|0.65878	-0.6061|-0.6061	6|10	0.06365|0.56958	T|D	0.9|0.05	.|.	3.6402|3.6402	0.08163|0.08163	0.4888:0.1994:0.3119:0.0|0.4888:0.1994:0.3119:0.0	.|.	.|597	.|Q5JWF2	.|GNAS1_HUMAN	V|S	534|597	.|ENSP00000360141:N597S;ENSP00000360143:N597S	ENSP00000302237:I534V|ENSP00000360140:N597S	I|N	+|+	1|2	0|0	GNAS|GNAS	56863505|56863505	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.088000|0.088000	0.18126|0.18126	-0.105000|-0.105000	0.10907|0.10907	-0.147000|-0.147000	0.11254|0.11254	0.379000|0.379000	0.24179|0.24179	ATC|AAT	-	NULL		0.627	GNAS-001	PUTATIVE	basic|CCDS	protein_coding	GNAS	protein_coding	OTTHUMT00000080417.3	A	NM_000516	-		57430110	+1	no_errors	ENST00000371100	ensembl	human	putative	74_37	missense	SNP	0.000	G
FCGBP	8857	genome.wustl.edu	37	19	40362864	40362864	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr19:40362864G>A	ENST00000221347.6	-	32	15213	c.15206C>T	c.(15205-15207)cCc>cTc	p.P5069L		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	5069						extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			GTACTCAGAGGGACTCAGCAC	0.647																																																	0								ENSG00000090920						88.0	93.0	92.0					19																	40362864		2203	4300	6503	FCGBP	SO:0001583	missense	0			-	HGNC	D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.15206C>T	19.37:g.40362864G>A	ENSP00000221347:p.Pro5069Leu	Somatic	0	54	0.00		0.41568620468393047	15	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	25	24.24	O95784	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,smart_Fol_N,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EG-like_dom,smart_VWF_C,smart_VWC_out	p.P5069L	ENST00000221347.6	37	c.15206	CCDS12546.1	19	.	.	.	.	.	.	.	.	.	.	G	18.49	3.636101	0.67130	.	.	ENSG00000090920	ENST00000221347	T	0.79033	-1.23	4.68	3.61	0.41365	Uncharacterised domain, cysteine-rich (2);	0.000000	0.64402	U	0.000001	D	0.88566	0.6471	M	0.89715	3.055	0.52099	D	0.999944	D	0.71674	0.998	D	0.76575	0.988	D	0.89115	0.3499	10	0.54805	T	0.06	.	11.0378	0.47811	0.0:0.0:0.8062:0.1938	.	5069	Q9Y6R7	FCGBP_HUMAN	L	5069	ENSP00000221347:P5069L	ENSP00000221347:P5069L	P	-	2	0	FCGBP	45054704	1.000000	0.71417	0.773000	0.31616	0.498000	0.33706	7.498000	0.81546	1.137000	0.42214	0.462000	0.41574	CCC	-	pfam_Unchr_dom_Cys-rich,smart_Unchr_dom_Cys-rich		0.647	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCGBP	protein_coding	OTTHUMT00000462507.1	G	NM_003890	-		40362864	-1	no_errors	ENST00000221347	ensembl	human	known	74_37	missense	SNP	0.998	A
ASXL3	80816	genome.wustl.edu	37	18	31251776	31251776	+	Missense_Mutation	SNP	C	C	T	rs267605172		TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr18:31251776C>T	ENST00000269197.5	+	7	661	c.661C>T	c.(661-663)Ccc>Tcc	p.P221S		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like transcriptional regulator 3	221					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43						GCAAAAATCTCCCACTGGAAA	0.318																																																	0								ENSG00000141431						68.0	62.0	64.0					18																	31251776		1808	4078	5886	ASXL3	SO:0001583	missense	0			-	HGNC	AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431			29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713		11214970	Standard	NM_030632		Approved		uc010dmg.1	Q9C0F0		ENST00000269197.5:c.661C>T	18.37:g.31251776C>T	ENSP00000269197:p.Pro221Ser	Somatic	0	102	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	52	23.53	Q6ZMX6|Q96MU3|Q9UFC5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_Znf_FYVE_PHD	p.P221S	ENST00000269197.5	37	c.661	CCDS45847.1	18	.	.	.	.	.	.	.	.	.	.	C	16.79	3.220671	0.58560	.	.	ENSG00000141431	ENST00000269197	T	0.14893	2.47	5.67	5.67	0.87782	.	.	.	.	.	T	0.23133	0.0559	N	0.08118	0	0.45867	D	0.998724	D	0.89917	1.0	D	0.85130	0.997	T	0.22452	-1.0216	9	0.12766	T	0.61	.	20.1169	0.97940	0.0:1.0:0.0:0.0	.	221	Q9C0F0	ASXL3_HUMAN	S	221	ENSP00000269197:P221S	ENSP00000269197:P221S	P	+	1	0	ASXL3	29505774	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.634000	0.67833	2.835000	0.97688	0.591000	0.81541	CCC	-	NULL		0.318	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ASXL3	protein_coding	OTTHUMT00000441865.2	C		-		31251776	+1	no_errors	ENST00000269197	ensembl	human	known	74_37	missense	SNP	1.000	T
PCDHGC3	5098	genome.wustl.edu	37	5	140855792	140855792	+	Missense_Mutation	SNP	A	A	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr5:140855792A>T	ENST00000308177.3	+	1	213	c.109A>T	c.(109-111)Atc>Ttc	p.I37F	PCDHGB4_ENST00000519479.1_Intron|PCDHGA12_ENST00000252085.3_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA11_ENST00000398587.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA11_ENST00000518882.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA6_ENST00000517434.1_Intron	NM_002588.2|NM_032402.1	NP_002579.2|NP_115778.1	Q9UN70	PCDGK_HUMAN	protocadherin gamma subfamily C, 3	37	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|skin(2)|urinary_tract(1)	29			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCACTATGAGATCCCGGAGGA	0.582																																																	0								ENSG00000240184						143.0	150.0	147.0					5																	140855792		2203	4300	6503	PCDHGC3	SO:0001583	missense	0			-	HGNC	AF152337	CCDS4261.1, CCDS75347.1, CCDS75348.1	5q31	2010-01-26			ENSG00000240184	ENSG00000240184		"""Cadherins / Protocadherins : Clustered"""	8716	other	protocadherin	"""cadherin-like 2"", ""protocadherin 2"", ""protocadherin 43"""	603627		PCDH2		9360932, 8508762	Standard	NM_032402		Approved	PC-43, PC43, PCDH-GAMMA-C3		Q9UN70	OTTHUMG00000129613	ENST00000308177.3:c.109A>T	5.37:g.140855792A>T	ENSP00000312070:p.Ile37Phe	Somatic	0	29	0.00		0.41568620468393047	7	56.25	9	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	21	25.00	O60622|Q08192|Q9Y5C4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.I37F	ENST00000308177.3	37	c.109	CCDS4261.1	5	.	.	.	.	.	.	.	.	.	.	A	16.55	3.155305	0.57259	.	.	ENSG00000240184	ENST00000308177	T	0.36157	1.27	5.65	4.5	0.54988	Cadherin, N-terminal (1);Cadherin (2);Cadherin-like (1);	.	.	.	.	T	0.49064	0.1535	M	0.75264	2.295	0.33940	D	0.643177	D;P	0.54601	0.967;0.928	P;P	0.54759	0.76;0.696	T	0.63479	-0.6628	9	0.48119	T	0.1	.	8.1684	0.31241	0.7962:0.1347:0.0691:0.0	.	37;37	Q9UN70;Q9UN70-2	PCDGK_HUMAN;.	F	37	ENSP00000312070:I37F	ENSP00000312070:I37F	I	+	1	0	PCDHGC3	140835976	0.997000	0.39634	1.000000	0.80357	0.988000	0.76386	2.759000	0.47573	1.161000	0.42604	-0.250000	0.11733	ATC	-	pfam_Cadherin_N,superfamily_Cadherin-like,pfscan_Cadherin		0.582	PCDHGC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGC3	protein_coding	OTTHUMT00000251808.2	A	NM_002588	-		140855792	+1	no_errors	ENST00000308177	ensembl	human	known	74_37	missense	SNP	1.000	T
TLN2	83660	genome.wustl.edu	37	15	62945393	62945393	+	Nonsense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr15:62945393C>T	ENST00000561311.1	+	6	627	c.397C>T	c.(397-399)Caa>Taa	p.Q133*	TLN2_ENST00000306829.6_Nonsense_Mutation_p.Q133*			Q9Y4G6	TLN2_HUMAN	talin 2	133	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				cell adhesion (GO:0007155)|cell-cell junction assembly (GO:0007043)|cytoskeletal anchoring at plasma membrane (GO:0007016)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|synapse (GO:0045202)	actin binding (GO:0003779)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			NS(3)|breast(6)|central_nervous_system(3)|endometrium(8)|kidney(8)|large_intestine(20)|lung(34)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)	99						CTCCTTAATCCAAGAAACTAT	0.358																																																	0								ENSG00000171914						54.0	50.0	51.0					15																	62945393		2203	4300	6503	TLN2	SO:0001587	stop_gained	0			-	HGNC	AB002318	CCDS32261.1	15q15-q21	2008-07-03			ENSG00000171914	ENSG00000171914			15447	protein-coding gene	gene with protein product		607349				9205841, 11527381	Standard	NM_015059		Approved	KIAA0320, ILWEQ	uc002alb.4	Q9Y4G6	OTTHUMG00000133679	ENST00000561311.1:c.397C>T	15.37:g.62945393C>T	ENSP00000453508:p.Gln133*	Somatic	0	51	0.00		0.41568620468393047	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	32	17.95	A6NLB8	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Talin_cent,pfam_ILWEQ_dom,pfam_Vinculin-bd_dom,pfam_FERM_N,pfam_FERM_central,pfam_Insln_rcpt_S1,superfamily_Talin_cent,superfamily_Vinculin/catenin,superfamily_FERM_central,smart_Band_41_domain,smart_ILWEQ_dom,pfscan_FERM_domain,pfscan_ILWEQ_dom	p.Q133*	ENST00000561311.1	37	c.397	CCDS32261.1	15	.	.	.	.	.	.	.	.	.	.	C	40	7.937982	0.98571	.	.	ENSG00000171914	ENST00000306829	.	.	.	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.45353	T	0.12	-9.2852	19.3813	0.94536	0.0:1.0:0.0:0.0	.	.	.	.	X	133	.	ENSP00000303476:Q133X	Q	+	1	0	TLN2	60732685	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.693000	0.84214	2.824000	0.97209	0.655000	0.94253	CAA	-	pfam_FERM_N,smart_Band_41_domain,pfscan_FERM_domain		0.358	TLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLN2	protein_coding	OTTHUMT00000257878.2	C		-		62945393	+1	no_errors	ENST00000306829	ensembl	human	known	74_37	nonsense	SNP	1.000	T
TLR2	7097	genome.wustl.edu	37	4	154624495	154624495	+	Missense_Mutation	SNP	T	T	G			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr4:154624495T>G	ENST00000260010.6	+	1	1844	c.436T>G	c.(436-438)Tct>Gct	p.S146A		NM_003264.3	NP_003255.2	O60603	TLR2_HUMAN	toll-like receptor 2	146					apoptotic process (GO:0006915)|cell surface pattern recognition receptor signaling pathway (GO:0002752)|cellular response to bacterial lipopeptide (GO:0071221)|cellular response to diacyl bacterial lipopeptide (GO:0071726)|cellular response to lipoteichoic acid (GO:0071223)|cellular response to peptidoglycan (GO:0071224)|cellular response to triacyl bacterial lipopeptide (GO:0071727)|central nervous system myelin formation (GO:0032289)|chloramphenicol transport (GO:0042892)|defense response to Gram-positive bacterium (GO:0050830)|detection of diacyl bacterial lipopeptide (GO:0042496)|detection of triacyl bacterial lipopeptide (GO:0042495)|I-kappaB phosphorylation (GO:0007252)|immune response (GO:0006955)|induction by symbiont of defense-related host nitric oxide production (GO:0052063)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|leukotriene metabolic process (GO:0006691)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of cell proliferation (GO:0008285)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of interleukin-17 production (GO:0032700)|nitric oxide metabolic process (GO:0046209)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of chemokine production (GO:0032722)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-18 production (GO:0032741)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of oligodendrocyte differentiation (GO:0048714)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of Wnt signaling pathway (GO:0030177)|response to fatty acid (GO:0070542)|response to hypoxia (GO:0001666)|response to insulin (GO:0032868)|response to molecule of fungal origin (GO:0002238)|response to progesterone (GO:0032570)|response to toxic substance (GO:0009636)|signal transduction (GO:0007165)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)	cell body (GO:0044297)|cell projection (GO:0042995)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|Toll-like receptor 1-Toll-like receptor 2 protein complex (GO:0035354)|Toll-like receptor 2-Toll-like receptor 6 protein complex (GO:0035355)	diacyl lipopeptide binding (GO:0042498)|lipopolysaccharide receptor activity (GO:0001875)|lipoteichoic acid binding (GO:0070891)|peptidoglycan binding (GO:0042834)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)|signaling pattern recognition receptor activity (GO:0008329)|transmembrane signaling receptor activity (GO:0004888)|triacyl lipopeptide binding (GO:0042497)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	29	all_hematologic(180;0.093)	Renal(120;0.117)			OspA lipoprotein(DB00045)	ATCTCTTTTTTCTCATCTCAC	0.373																																																	0								ENSG00000137462						45.0	50.0	48.0					4																	154624495		2196	4299	6495	TLR2	SO:0001583	missense	0			-	HGNC	U88878	CCDS3784.1	4q32	2008-02-05				ENSG00000137462		"""CD molecules"""	11848	protein-coding gene	gene with protein product		603028				9435236	Standard	XM_005263193		Approved	TIL4, CD282	uc003inq.3	O60603		ENST00000260010.6:c.436T>G	4.37:g.154624495T>G	ENSP00000260010:p.Ser146Ala	Somatic	0	31	0.00		0.41568620468393047	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	14	36.36	B3Y612|D1CS45|D1CS48|D1CS49|O15454|Q8NI00	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_Toll-like_receptor,pfam_TIR_dom,pfam_Leu-rich_rpt,superfamily_TIR_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_TIR_dom,pfscan_TIR_dom	p.S146A	ENST00000260010.6	37	c.436	CCDS3784.1	4	.	.	.	.	.	.	.	.	.	.	T	9.680	1.148970	0.21288	.	.	ENSG00000137462	ENST00000260010	T	0.01025	5.43	5.81	1.58	0.23477	.	0.559647	0.19389	N	0.115446	T	0.00845	0.0028	N	0.20845	0.615	0.23416	N	0.997723	B	0.11235	0.004	B	0.27887	0.084	T	0.47898	-0.9081	10	0.25751	T	0.34	.	8.2469	0.31693	0.0:0.0678:0.3764:0.5557	.	146	O60603	TLR2_HUMAN	A	146	ENSP00000260010:S146A	ENSP00000260010:S146A	S	+	1	0	TLR2	154843945	0.029000	0.19370	0.874000	0.34290	0.856000	0.48823	0.132000	0.15891	0.395000	0.25257	0.533000	0.62120	TCT	-	pirsf_Toll-like_receptor		0.373	TLR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLR2	protein_coding	OTTHUMT00000365205.1	T		-		154624495	+1	no_errors	ENST00000260010	ensembl	human	known	74_37	missense	SNP	0.987	G
HEBP2	23593	genome.wustl.edu	37	6	138727221	138727221	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr6:138727221G>A	ENST00000607197.1	+	3	629	c.352G>A	c.(352-354)Gat>Aat	p.D118N	HEBP2_ENST00000367697.3_Intron|HEBP2_ENST00000448741.1_Intron	NM_014320.2	NP_055135.1	Q9Y5Z4	HEBP2_HUMAN	heme binding protein 2	118					negative regulation of mitochondrial membrane potential (GO:0010917)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of necrotic cell death (GO:0010940)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)				endometrium(1)|large_intestine(1)|lung(3)	5	Breast(32;0.0933)			GBM - Glioblastoma multiforme(68;0.000732)|OV - Ovarian serous cystadenocarcinoma(155;0.00171)		ACAGCAATTTGATCCACCCAG	0.443																																																	0								ENSG00000051620						190.0	184.0	186.0					6																	138727221		2203	4300	6503	HEBP2	SO:0001583	missense	0			-	HGNC	AF117616	CCDS5191.1	6q24	2008-08-29	2002-09-23	2002-09-27	ENSG00000051620	ENSG00000051620			15716	protein-coding gene	gene with protein product		605825	"""chromosome 6 open reading frame 34"""	C6orf34		10640688, 17098234	Standard	NM_014320		Approved	SOUL	uc003qhw.1	Q9Y5Z4	OTTHUMG00000015671	ENST00000607197.1:c.352G>A	6.37:g.138727221G>A	ENSP00000475750:p.Asp118Asn	Somatic	0	87	0.00		0.41568620468393047	312	16.80	63	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	54	15.62	Q96P57	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SOUL_haem-bd,superfamily_Reg_factor_effector_dom	p.D118N	ENST00000607197.1	37	c.352	CCDS5191.1	6	.	.	.	.	.	.	.	.	.	.	G	13.96	2.394262	0.42410	.	.	ENSG00000051620	ENST00000058691	T	0.21191	2.02	5.33	5.33	0.75918	Regulatory factor, effector, bacterial (1);	0.295226	0.40908	D	0.000990	T	0.05777	0.0151	N	0.21545	0.675	0.80722	D	1	B	0.15141	0.012	B	0.16289	0.015	T	0.24119	-1.0169	9	.	.	.	.	10.0863	0.42421	0.0921:0.0:0.9079:0.0	.	118	Q9Y5Z4	HEBP2_HUMAN	N	118	ENSP00000058691:D118N	.	D	+	1	0	HEBP2	138768914	0.980000	0.34600	0.949000	0.38748	0.872000	0.50106	1.939000	0.40213	2.498000	0.84270	0.491000	0.48974	GAT	-	pfam_SOUL_haem-bd,superfamily_Reg_factor_effector_dom		0.443	HEBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEBP2	protein_coding	OTTHUMT00000042426.2	G		-		138727221	+1	no_errors	ENST00000607197	ensembl	human	known	74_37	missense	SNP	0.985	A
POTEB	100996331	genome.wustl.edu	37	15	22077588	22077588	+	Silent	SNP	A	A	G	rs201906481		TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr15:22077588A>G	ENST00000439682.1	-	3	693	c.642T>C	c.(640-642)gaT>gaC	p.D214D	POTEB_ENST00000553662.2_5'UTR	NM_001277304.1	NP_001264233.1	Q6S5H4	POTEB_HUMAN	POTE ankyrin domain family, member B	251										endometrium(2)|kidney(8)|lung(4)	14						CCATTAATTTATCTTCATTGT	0.338																																																	0								ENSG00000233917						1.0	1.0	1.0					15																	22077588		199	303	502	POTEB	SO:0001819	synonymous_variant	0			-	HGNC	AY465170	CCDS59250.1	15q11.2	2014-01-10	2008-11-26	2008-11-26	ENSG00000233917	ENSG00000233917		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33734	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 5"""	608912	"""ANKRD26-like family B, member 1"""	A26B1			Standard	NM_001277304		Approved	POTE15, POTE-15, CT104.5	uc031qqz.1	Q6S5H4		ENST00000439682.1:c.642T>C	15.37:g.22077588A>G		Somatic	0	14	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	15	40.00	Q6NXN7|Q6S5H7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,prints_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.D214	ENST00000439682.1	37	c.642	CCDS59250.1	15																																																																																			-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom		0.338	POTEB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POTEB	protein_coding	OTTHUMT00000414911.2	A	NM_207355	rs201906481		22077588	-1	no_errors	ENST00000439682	ensembl	human	known	74_37	silent	SNP	0.003	G
ERICH3	127254	genome.wustl.edu	37	1	75038368	75038368	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr1:75038368G>A	ENST00000326665.5	-	14	3244	c.3026C>T	c.(3025-3027)tCg>tTg	p.S1009L	C1orf173_ENST00000433746.2_5'UTR	NM_001002912.4	NP_001002912.4	Q5RHP9	ERIC3_HUMAN		1009	Glu-rich.									NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(23)|lung(123)|ovary(3)|prostate(10)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)	184						GCTGCCCTCCGAAACCTGCAT	0.542																																																	0								ENSG00000178965						105.0	97.0	99.0					1																	75038368		2203	4300	6503	C1orf173	SO:0001583	missense	0			-	HGNC																												ENST00000326665.5:c.3026C>T	1.37:g.75038368G>A	ENSP00000322609:p.Ser1009Leu	Somatic	0	27	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	16	20.00	Q68DL8|Q6GMR8|Q6ZSF9|Q8ND41	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.S1009L	ENST00000326665.5	37	c.3026	CCDS30755.1	1	.	.	.	.	.	.	.	.	.	.	G	10.70	1.423520	0.25639	.	.	ENSG00000178965	ENST00000326665	T	0.11169	2.8	4.48	-4.55	0.03441	.	.	.	.	.	T	0.01558	0.0050	N	0.22421	0.69	0.09310	N	1	B	0.18310	0.027	B	0.12837	0.008	T	0.45934	-0.9227	9	0.27785	T	0.31	3.1012	5.6937	0.17843	0.3599:0.2455:0.3946:0.0	.	1009	Q5RHP9	CA173_HUMAN	L	1009	ENSP00000322609:S1009L	ENSP00000322609:S1009L	S	-	2	0	C1orf173	74810956	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	-0.566000	0.05922	-1.213000	0.02617	-0.481000	0.04817	TCG	-	NULL		0.542	C1orf173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf173	protein_coding	OTTHUMT00000026516.1	G		-		75038368	-1	no_errors	ENST00000326665	ensembl	human	known	74_37	missense	SNP	0.000	A
KIAA0895	23366	genome.wustl.edu	37	7	36423537	36423537	+	Splice_Site	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr7:36423537C>T	ENST00000297063.6	-	2	159	c.109G>A	c.(109-111)Gga>Aga	p.G37R		NM_001100425.1	NP_001093895.1	Q8NCT3	K0895_HUMAN	KIAA0895	37	Arg-rich.									breast(2)|endometrium(1)|kidney(1)|large_intestine(6)|liver(1)|lung(11)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	26						CTTTTCTCTCCCTGTAAAAAT	0.294																																																	0								ENSG00000164542						105.0	94.0	97.0					7																	36423537		1806	4073	5879	KIAA0895	SO:0001630	splice_region_variant	0			-	HGNC	BC028678	CCDS43570.1, CCDS47573.1, CCDS56482.1, CCDS56483.1, CCDS56484.1, CCDS75583.1	7p14.2	2008-11-27			ENSG00000164542	ENSG00000164542			22206	protein-coding gene	gene with protein product							Standard	NM_015314		Approved		uc003tfd.2	Q8NCT3	OTTHUMG00000154939	ENST00000297063.6:c.109-1G>A	7.37:g.36423537C>T		Somatic	0	81	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	27	27.03	B4DF35|B7ZLT4|B9EGB9|O94969|Q0VGC1|Q7Z4L2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF1704	p.G37R	ENST00000297063.6	37	c.109	CCDS43570.1	7	.	.	.	.	.	.	.	.	.	.	C	9.101	1.004049	0.19199	.	.	ENSG00000164542	ENST00000297063;ENST00000429651	.	.	.	4.05	2.04	0.26737	.	.	.	.	.	T	0.26629	0.0651	N	0.22421	0.69	0.28434	N	0.917148	B	0.20052	0.041	B	0.18871	0.023	T	0.21930	-1.0231	8	0.66056	D	0.02	.	5.368	0.16125	0.0:0.7052:0.0:0.2948	.	37	Q8NCT3	K0895_HUMAN	R	37	.	ENSP00000297063:G37R	G	-	1	0	KIAA0895	36390062	0.315000	0.24571	0.464000	0.27143	0.962000	0.63368	0.384000	0.20668	0.550000	0.28991	0.561000	0.74099	GGA	-	NULL		0.294	KIAA0895-001	KNOWN	basic|CCDS	protein_coding	KIAA0895	protein_coding	OTTHUMT00000337717.1	C	NM_015314	-	Missense_Mutation	36423537	-1	no_errors	ENST00000297063	ensembl	human	known	74_37	missense	SNP	0.502	T
NPHP1	4867	genome.wustl.edu	37	2	110917745	110917745	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr2:110917745G>A	ENST00000393272.3	-	11	1304	c.1207C>T	c.(1207-1209)Ctc>Ttc	p.L403F	NPHP1_ENST00000316534.4_Missense_Mutation_p.L404F|NPHP1_ENST00000445609.2_Missense_Mutation_p.L348F|NPHP1_ENST00000355301.4_Missense_Mutation_p.L285F|NPHP1_ENST00000417665.1_Missense_Mutation_p.L347F	NM_000272.3|NM_207181.2	NP_000263.2|NP_997064.2	O15259	NPHP1_HUMAN	nephronophthisis 1 (juvenile)	403					actin cytoskeleton organization (GO:0030036)|cell projection organization (GO:0030030)|cellular protein localization (GO:0034613)|excretion (GO:0007588)|photoreceptor cell outer segment organization (GO:0035845)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|spermatid differentiation (GO:0048515)|visual behavior (GO:0007632)	cell-cell junction (GO:0005911)|ciliary transition zone (GO:0035869)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|motile cilium (GO:0031514)|photoreceptor connecting cilium (GO:0032391)|tight junction (GO:0005923)	structural molecule activity (GO:0005198)			autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(10)|ovary(2)	24						TGTCTGCTGAGAACCTGTATG	0.373																																																	0								ENSG00000144061						124.0	120.0	121.0					2																	110917745		2203	4300	6503	NPHP1	SO:0001583	missense	0			-	HGNC	AF023674	CCDS2086.1, CCDS46384.1, CCDS46385.1, CCDS46386.1	2q13	2014-01-28			ENSG00000144061	ENSG00000144061			7905	protein-coding gene	gene with protein product	"""nephrocystin-1"""	607100		NPH1			Standard	NM_000272		Approved	JBTS4, SLSN1	uc002tfm.4	O15259	OTTHUMG00000131195	ENST00000393272.3:c.1207C>T	2.37:g.110917745G>A	ENSP00000376953:p.Leu403Phe	Somatic	0	90	0.00		0.41568620468393047	6	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	49	18.33	O14837	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain	p.L404F	ENST00000393272.3	37	c.1210	CCDS46385.1	2	.	.	.	.	.	.	.	.	.	.	G	22.9	4.354466	0.82243	.	.	ENSG00000144061	ENST00000316534;ENST00000445609;ENST00000393272;ENST00000355301;ENST00000417665	T;T;T;T;T	0.76448	-1.02;-1.02;-1.02;-1.02;-1.02	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	D	0.87261	0.6133	M	0.65975	2.015	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.91635	0.999;0.999;0.999;0.999;0.999;0.999	D	0.87827	0.2642	10	0.72032	D	0.01	-15.8168	17.3512	0.87324	0.0:0.0:1.0:0.0	.	347;347;285;403;348;404	B4DQY0;C9JNM7;O15259-3;O15259;O15259-2;O15259-4	.;.;.;NPHP1_HUMAN;.;.	F	404;348;403;285;347	ENSP00000313169:L404F;ENSP00000389879:L348F;ENSP00000376953:L403F;ENSP00000347452:L285F;ENSP00000402176:L347F	ENSP00000313169:L404F	L	-	1	0	NPHP1	110275034	1.000000	0.71417	0.608000	0.28969	0.984000	0.73092	4.150000	0.58098	2.685000	0.91497	0.563000	0.77884	CTC	-	NULL		0.373	NPHP1-001	KNOWN	basic|CCDS	protein_coding	NPHP1	protein_coding	OTTHUMT00000253919.3	G	NM_000272	-		110917745	-1	no_errors	ENST00000316534	ensembl	human	known	74_37	missense	SNP	0.987	A
KRT18P19	339781	genome.wustl.edu	37	2	190176485	190176485	+	RNA	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr2:190176485C>T	ENST00000579501.1	-	0	2																											TCAAGCTCCTCTCGGTTCTTC	0.527																																																	0								ENSG00000266817																																			AC118063.1			0			-	Clone_based_ensembl_gene																													2.37:g.190176485C>T		Somatic	0	33	0.00		0.41568620468393047	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	30	11.76		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000579501.1	37	NULL		2																																																																																			-	-		0.527	AC118063.1-201	NOVEL	basic	miRNA	ENSG00000266817	miRNA		C		-		190176485	-1	no_errors	ENST00000579501	ensembl	human	novel	74_37	rna	SNP	0.997	T
ALDH16A1	126133	genome.wustl.edu	37	19	49964114	49964114	+	Frame_Shift_Del	DEL	T	T	-			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr19:49964114delT	ENST00000293350.4	+	5	698	c.535delT	c.(535-537)ttcfs	p.F179fs	ALDH16A1_ENST00000433981.2_Frame_Shift_Del_p.F14fs|ALDH16A1_ENST00000455361.2_Frame_Shift_Del_p.F179fs|ALDH16A1_ENST00000540132.1_Frame_Shift_Del_p.F16fs|CTD-3148I10.9_ENST00000599536.1_5'Flank	NM_153329.3	NP_699160.2	Q8IZ83	A16A1_HUMAN	aldehyde dehydrogenase 16 family, member A1	179						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor (GO:0016620)			cervix(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(5)|skin(2)|urinary_tract(3)	20		all_lung(116;5.39e-06)|Lung NSC(112;1.97e-05)|all_neural(266;0.0966)|Ovarian(192;0.15)		OV - Ovarian serous cystadenocarcinoma(262;0.00156)|GBM - Glioblastoma multiforme(486;0.0251)		CACATTCTCCTTCCTTGAGAT	0.547																																																	0								ENSG00000161618						98.0	89.0	92.0					19																	49964114		2203	4299	6502	ALDH16A1	SO:0001589	frameshift_variant	0				HGNC	AY007096	CCDS12766.1, CCDS46141.1	19q13.33	2014-08-12			ENSG00000161618	ENSG00000161618		"""Aldehyde dehydrogenases"""	28114	protein-coding gene	gene with protein product		613358					Standard	NM_153329		Approved	MGC10204	uc002pnt.3	Q8IZ83	OTTHUMG00000183163	ENST00000293350.4:c.535delT	19.37:g.49964114delT	ENSP00000293350:p.Phe179fs	Somatic	0	33	0.00		0.41568620468393047	23	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	23	8.00	B4DLQ1|C9JBH6|Q86YF0|Q8IYL4|Q8TEI8	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Aldehyde_DH_dom,superfamily_Ald_DH/histidinol_DH,pirsf_Aldehyde_DH	p.F179fs	ENST00000293350.4	37	c.535	CCDS12766.1	19																																																																																			-	pfam_Aldehyde_DH_dom,superfamily_Ald_DH/histidinol_DH,pirsf_Aldehyde_DH		0.547	ALDH16A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALDH16A1	protein_coding	OTTHUMT00000465358.1	T	NM_153329			49964114	+1	no_errors	ENST00000293350	ensembl	human	known	74_37	frame_shift_del	DEL	0.998	-
ABCB4	5244	genome.wustl.edu	37	7	87046812	87046812	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr7:87046812G>A	ENST00000265723.4	-	21	2609	c.2498C>T	c.(2497-2499)gCt>gTt	p.A833V	ABCB4_ENST00000358400.3_Missense_Mutation_p.A833V|ABCB4_ENST00000359206.3_Missense_Mutation_p.A833V|ABCB4_ENST00000545634.1_Missense_Mutation_p.A833V|ABCB4_ENST00000453593.1_Missense_Mutation_p.A833V	NM_000443.3|NM_018849.2	NP_000434.1|NP_061337.1	P21439	MDR3_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 4	833	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				cellular lipid metabolic process (GO:0044255)|lipid metabolic process (GO:0006629)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|xenobiotic-transporting ATPase activity (GO:0008559)			breast(5)|endometrium(7)|kidney(2)|large_intestine(15)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	77	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)				Colchicine(DB01394)|Etravirine(DB06414)|Silodosin(DB06207)	TGCAATTAAAGCCAACCTGGT	0.423																																																	0								ENSG00000005471						64.0	60.0	62.0					7																	87046812		2203	4300	6503	ABCB4	SO:0001583	missense	0			-	HGNC	M23234	CCDS5605.1, CCDS5606.1, CCDS5607.1	7q21	2012-03-14			ENSG00000005471	ENSG00000005471		"""ATP binding cassette transporters / subfamily B"""	45	protein-coding gene	gene with protein product		171060		PGY3, MDR3		2892668, 11313316	Standard	NM_018850		Approved	MDR2, PFIC-3, GBD1	uc003uiv.1	P21439	OTTHUMG00000023396	ENST00000265723.4:c.2498C>T	7.37:g.87046812G>A	ENSP00000265723:p.Ala833Val	Somatic	0	65	0.00		0.41568620468393047	3	50.00	3	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	51	17.74	A0A2V7|A4D1D3|A4D1D4|A4D1D5|D6W5P3|D6W5P4|Q14813	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,pfam_ABC_ATPase_put,pfam_Zeta_toxin_domain,superfamily_P-loop_NTPase,superfamily_ABC1_TM_dom,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom	p.A833V	ENST00000265723.4	37	c.2498	CCDS5606.1	7	.	.	.	.	.	.	.	.	.	.	G	25.5	4.643561	0.87859	.	.	ENSG00000005471	ENST00000359206;ENST00000358400;ENST00000265723;ENST00000453593;ENST00000545634	D;D;D;D;D	0.88975	-2.45;-2.45;-2.45;-2.45;-2.45	5.82	5.82	0.92795	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.95230	0.8453	M	0.88105	2.93	0.80722	D	1	D;D;D	0.89917	0.994;1.0;1.0	D;D;D	0.97110	0.921;1.0;1.0	D	0.95582	0.8647	10	0.87932	D	0	-12.3133	15.5827	0.76459	0.0:0.137:0.863:0.0	.	833;833;833	A4D1D5;P21439-2;P21439	.;.;MDR3_HUMAN	V	833	ENSP00000352135:A833V;ENSP00000351172:A833V;ENSP00000265723:A833V;ENSP00000392983:A833V;ENSP00000437465:A833V	ENSP00000265723:A833V	A	-	2	0	ABCB4	86884748	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.980000	0.93460	2.765000	0.95021	0.650000	0.86243	GCT	-	pfam_ABC_transptr_TM_dom,superfamily_ABC1_TM_dom,pfscan_ABC1_TM_dom		0.423	ABCB4-002	KNOWN	basic|CCDS	protein_coding	ABCB4	protein_coding	OTTHUMT00000336083.1	G	NM_000443	-		87046812	-1	no_errors	ENST00000265723	ensembl	human	known	74_37	missense	SNP	1.000	A
TBL3	10607	genome.wustl.edu	37	16	2027654	2027654	+	Nonsense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr16:2027654C>T	ENST00000568546.1	+	17	2010	c.1882C>T	c.(1882-1884)Cga>Tga	p.R628*		NM_006453.2	NP_006444.2	Q12788	TBL3_HUMAN	transducin (beta)-like 3	628					G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|intracellular signal transduction (GO:0035556)|rRNA processing (GO:0006364)	nucleolus (GO:0005730)|nucleus (GO:0005634)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)|receptor signaling protein activity (GO:0005057)			breast(1)|endometrium(2)|kidney(4)|lung(7)|ovary(1)|prostate(2)|skin(1)	18						CAGTGACTCCCGAGTCATCCT	0.652																																					Melanoma(118;616 1651 35077 38081 48633)												0								ENSG00000183751						31.0	34.0	33.0					16																	2027654		2151	4209	6360	TBL3	SO:0001587	stop_gained	0			-	HGNC	U02609	CCDS10453.1	16p13.3	2013-01-10			ENSG00000183751	ENSG00000183751		"""WD repeat domain containing"""	11587	protein-coding gene	gene with protein product		605915				8307582	Standard	NM_006453		Approved	SAZD, UTP13	uc002cnu.1	Q12788	OTTHUMG00000128710	ENST00000568546.1:c.1882C>T	16.37:g.2027654C>T	ENSP00000454836:p.Arg628*	Somatic	0	54	0.00		0.41568620468393047	89	4.30	4	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	25	16.67	Q59GD6|Q8IVB7|Q96A78	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,pfam_SSU_processome_Utp13,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.R628*	ENST00000568546.1	37	c.1882	CCDS10453.1	16	.	.	.	.	.	.	.	.	.	.	C	37	6.353536	0.97498	.	.	ENSG00000183751	ENST00000332704	.	.	.	5.54	-1.21	0.09524	.	0.634652	0.18146	N	0.150255	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.29301	T	0.29	-0.9817	6.7648	0.23560	0.0:0.3893:0.1236:0.4871	.	.	.	.	X	628	.	ENSP00000331815:R628X	R	+	1	2	TBL3	1967655	0.001000	0.12720	0.925000	0.36789	0.840000	0.47671	-0.077000	0.11394	-0.224000	0.09928	0.561000	0.74099	CGA	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom		0.652	TBL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBL3	protein_coding	OTTHUMT00000250615.3	C	NM_006453	-		2027654	+1	no_errors	ENST00000568546	ensembl	human	known	74_37	nonsense	SNP	0.398	T
KIAA1407	57577	genome.wustl.edu	37	3	113755593	113755593	+	Silent	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr3:113755593G>A	ENST00000295878.3	-	5	602	c.456C>T	c.(454-456)acC>acT	p.T152T	KIAA1407_ENST00000545063.1_5'UTR	NM_020817.1	NP_065868.1	Q8NCU4	K1407_HUMAN	KIAA1407	152										endometrium(9)|large_intestine(7)|lung(19)|ovary(2)|pancreas(1)|prostate(1)|urinary_tract(1)	40						ATTTTTGAACGGTGGTACTTT	0.343																																																	0								ENSG00000163617						105.0	99.0	101.0					3																	113755593		2203	4300	6503	KIAA1407	SO:0001819	synonymous_variant	0			-	HGNC	AF509494	CCDS2977.1	3q13.31	2005-01-10			ENSG00000163617	ENSG00000163617			29272	protein-coding gene	gene with protein product						10718198	Standard	NM_020817		Approved		uc003eax.3	Q8NCU4	OTTHUMG00000159337	ENST00000295878.3:c.456C>T	3.37:g.113755593G>A		Somatic	0	74	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	42	22.22	B4DYL1|Q9P2E0	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.T152	ENST00000295878.3	37	c.456	CCDS2977.1	3																																																																																			-	NULL		0.343	KIAA1407-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1407	protein_coding	OTTHUMT00000354724.2	G	NM_020817	-		113755593	-1	no_errors	ENST00000295878	ensembl	human	known	74_37	silent	SNP	0.763	A
ZMYND12	84217	genome.wustl.edu	37	1	42898703	42898703	+	Intron	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr1:42898703G>A	ENST00000372565.3	-	7	1245				ZMYND12_ENST00000475426.1_5'UTR|ZMYND12_ENST00000433602.2_Intron	NM_032257.4	NP_115633.3	Q9H0C1	ZMY12_HUMAN	zinc finger, MYND-type containing 12							intracellular (GO:0005622)	metal ion binding (GO:0046872)			NS(1)|endometrium(2)|large_intestine(3)|lung(5)|ovary(2)|prostate(2)|skin(2)	17	Ovarian(52;0.00744)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				TGGAGTGAGGGCTTGCTCTGA	0.428																																																	0								ENSG00000066185																																			ZMYND12	SO:0001627	intron_variant	0			-	HGNC	AK057384	CCDS467.1	1p34.1	2008-02-05			ENSG00000066185	ENSG00000066185		"""Zinc fingers, MYND-type"""	21192	protein-coding gene	gene with protein product						11230166	Standard	NM_032257		Approved	DKFZp434N2435	uc001chj.3	Q9H0C1	OTTHUMG00000007333	ENST00000372565.3:c.975+110C>T	1.37:g.42898703G>A		Somatic	0	56	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	21	25.00	Q5VUS6|Q8TC87|Q96M51	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000372565.3	37	NULL	CCDS467.1	1																																																																																			-	-		0.428	ZMYND12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZMYND12	protein_coding	OTTHUMT00000019170.1	G	NM_032257	-		42898703	-1	no_errors	ENST00000475426	ensembl	human	known	74_37	rna	SNP	0.006	A
ZNF570	148268	genome.wustl.edu	37	19	37975503	37975503	+	Nonsense_Mutation	SNP	G	G	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr19:37975503G>T	ENST00000330173.1	+	5	1508	c.979G>T	c.(979-981)Gag>Tag	p.E327*	ZNF570_ENST00000388801.3_Nonsense_Mutation_p.E124*|ZNF570_ENST00000586475.1_Nonsense_Mutation_p.E383*	NM_144694.1	NP_653295.1	Q96NI8	ZN570_HUMAN	zinc finger protein 570	327					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(3)|large_intestine(6)|lung(12)|ovary(1)|prostate(1)|skin(1)	27			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TCACACGGGAGAGAAACCCTA	0.438																																																	0								ENSG00000171827						92.0	88.0	89.0					19																	37975503		2203	4300	6503	ZNF570	SO:0001587	stop_gained	0			-	HGNC	AK055353	CCDS12504.1, CCDS74355.1	19q13.12	2013-09-20			ENSG00000171827	ENSG00000171827		"""Zinc fingers, C2H2-type"", ""-"""	26416	protein-coding gene	gene with protein product							Standard	XM_005258567		Approved	FLJ30791	uc002ogk.1	Q96NI8	OTTHUMG00000048176	ENST00000330173.1:c.979G>T	19.37:g.37975503G>T	ENSP00000331540:p.Glu327*	Somatic	0	58	0.00		0.41568620468393047	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	41	8.89	A1L472|B4DMP1	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E327*	ENST00000330173.1	37	c.979	CCDS12504.1	19	.	.	.	.	.	.	.	.	.	.	G	42	9.454091	0.99175	.	.	ENSG00000171827	ENST00000330173;ENST00000388801	.	.	.	4.18	4.18	0.49190	.	0.000000	0.43110	D	0.000608	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	.	15.7734	0.78190	0.0:0.0:1.0:0.0	.	.	.	.	X	327;124	.	ENSP00000331540:E327X	E	+	1	0	ZNF570	42667343	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	4.355000	0.59424	2.317000	0.78254	0.563000	0.77884	GAG	-	pfscan_Znf_C2H2		0.438	ZNF570-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF570	protein_coding	OTTHUMT00000109600.1	G	NM_144694	-		37975503	+1	no_errors	ENST00000330173	ensembl	human	known	74_37	nonsense	SNP	1.000	T
ZGRF1	55345	genome.wustl.edu	37	4	113460790	113460790	+	Silent	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr4:113460790G>A	ENST00000505019.1	-	28	6353	c.6228C>T	c.(6226-6228)ctC>ctT	p.L2076L	RP11-402J6.1_ENST00000504009.1_RNA	NM_018392.4	NP_060862.3	Q86YA3	ZGRF1_HUMAN		2076						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(6)|lung(21)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	45		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000676)		AATCTTTAAGGAGATGGTTCA	0.318																																																	0								ENSG00000138658						82.0	79.0	80.0					4																	113460790		2203	4300	6503	C4orf21	SO:0001819	synonymous_variant	0			-	HGNC																												ENST00000505019.1:c.6228C>T	4.37:g.113460790G>A		Somatic	0	66	0.00		0.41568620468393047	12	14.29	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	33	19.51	B3KQX2|B4DSN6|B4DYU8|E9PDE1|G5EA02|Q6ZU11|Q9NSW3|Q9NUJ4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF2439,pfam_Znf_GRF,superfamily_P-loop_NTPase	p.L2076	ENST00000505019.1	37	c.6228		4																																																																																			-	NULL		0.318	C4orf21-003	KNOWN	basic|appris_principal	protein_coding	C4orf21	protein_coding	OTTHUMT00000256413.1	G		-		113460790	-1	no_errors	ENST00000505019	ensembl	human	known	74_37	silent	SNP	0.325	A
BTBD8	284697	genome.wustl.edu	37	1	92554331	92554331	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr1:92554331C>T	ENST00000342818.3	+	2	462	c.226C>T	c.(226-228)Ctt>Ttt	p.L76F	BTBD8_ENST00000370382.3_Missense_Mutation_p.L76F|BTBD8_ENST00000540648.1_Missense_Mutation_p.L76F	NM_183242.3	NP_899065.2	Q5XKL5	BTBD8_HUMAN	BTB (POZ) domain containing 8	76	BTB 1. {ECO:0000255|PROSITE- ProRule:PRU00037}.					nucleus (GO:0005634)				breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(8)|ovary(1)	16		all_lung(203;0.0484)|Lung NSC(277;0.126)|Glioma(108;0.222)		all cancers(265;0.0153)|Epithelial(280;0.0982)		CAAAGCAGTCCTTTTAGCAAG	0.368																																																	0								ENSG00000189195						120.0	119.0	119.0					1																	92554331		2203	4299	6502	BTBD8	SO:0001583	missense	0			-	HGNC	AY346333	CCDS737.1	1p22.1	2013-01-08			ENSG00000189195	ENSG00000189195		"""BTB/POZ domain containing"""	21019	protein-coding gene	gene with protein product						14654994	Standard	NM_183242		Approved		uc001doo.3	Q5XKL5	OTTHUMG00000010289	ENST00000342818.3:c.226C>T	1.37:g.92554331C>T	ENSP00000343686:p.Leu76Phe	Somatic	0	114	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	84	15.15	Q6V9S5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pfscan_BTB/POZ-like	p.L76F	ENST00000342818.3	37	c.226	CCDS737.1	1	.	.	.	.	.	.	.	.	.	.	C	15.51	2.856040	0.51376	.	.	ENSG00000189195	ENST00000370382;ENST00000342818;ENST00000540648	D;D;D	0.89681	-2.55;-2.55;-2.55	5.31	3.42	0.39159	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.130764	0.32401	N	0.006157	D	0.88720	0.6513	H	0.94385	3.53	0.36600	D	0.874616	B	0.25563	0.129	B	0.32624	0.149	D	0.87374	0.2352	10	0.87932	D	0	-11.7815	10.4887	0.44737	0.0:0.8472:0.0:0.1528	.	76	Q5XKL5	BTBD8_HUMAN	F	76	ENSP00000359408:L76F;ENSP00000343686:L76F;ENSP00000443397:L76F	ENSP00000343686:L76F	L	+	1	0	BTBD8	92326919	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	1.014000	0.29950	0.718000	0.32166	0.591000	0.81541	CTT	-	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pfscan_BTB/POZ-like		0.368	BTBD8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	BTBD8	protein_coding	OTTHUMT00000028372.1	C	NM_183242	-		92554331	+1	no_errors	ENST00000342818	ensembl	human	known	74_37	missense	SNP	1.000	T
RIPK1	8737	genome.wustl.edu	37	6	3089836	3089836	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr6:3089836C>T	ENST00000259808.4	+	7	1158	c.860C>T	c.(859-861)cCt>cTt	p.P287L	RNA5SP201_ENST00000410316.1_RNA|RIPK1_ENST00000541791.1_Missense_Mutation_p.P241L|RIPK1_ENST00000479389.1_3'UTR|RIPK1_ENST00000380409.2_Missense_Mutation_p.P287L			Q13546	RIPK1_HUMAN	receptor (TNFRSF)-interacting serine-threonine kinase 1	287	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of JUN kinase activity (GO:0007257)|amyloid fibril formation (GO:1990000)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular protein catabolic process (GO:0044257)|cellular response to growth factor stimulus (GO:0071363)|cellular response to tumor necrosis factor (GO:0071356)|extrinsic apoptotic signaling pathway (GO:0097191)|innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|necroptotic process (GO:0070266)|necroptotic signaling pathway (GO:0097527)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|peptidyl-serine autophosphorylation (GO:0036289)|positive regulation of apoptotic process (GO:0043065)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of necroptotic process (GO:0060545)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of programmed cell death (GO:0043068)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type I interferon production (GO:0032481)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|regulation of ATP:ADP antiporter activity (GO:0070926)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|response to tumor necrosis factor (GO:0034612)|ripoptosome assembly (GO:0097343)|ripoptosome assembly involved in necroptotic process (GO:1901026)|T cell apoptotic process (GO:0070231)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	cytosol (GO:0005829)|death-inducing signaling complex (GO:0031264)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|receptor complex (GO:0043235)|ripoptosome (GO:0097342)	ATP binding (GO:0005524)|death domain binding (GO:0070513)|death receptor binding (GO:0005123)|identical protein binding (GO:0042802)|protein complex binding (GO:0032403)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	23	Ovarian(93;0.0386)	all_hematologic(90;0.0895)				AAATTTAGGCCTTTTTATTTA	0.254																																																	0								ENSG00000137275						47.0	55.0	53.0					6																	3089836		2189	4283	6472	RIPK1	SO:0001583	missense	0			-	HGNC	U25994	CCDS4482.1	6p25.2	2008-02-05			ENSG00000137275	ENSG00000137275			10019	protein-coding gene	gene with protein product		603453				7538908, 8612133	Standard	XM_005249458		Approved	RIP	uc003mux.3	Q13546	OTTHUMG00000014134	ENST00000259808.4:c.860C>T	6.37:g.3089836C>T	ENSP00000259808:p.Pro287Leu	Somatic	0	152	0.00		0.41568620468393047	9	43.75	7	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	79	21.00	A0AV89|B2RAG1|B4E3F9|Q13180|Q59H33	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Death_domain,superfamily_Kinase-like_dom,superfamily_DEATH-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Death_domain,pfscan_Death_domain,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.P287L	ENST00000259808.4	37	c.860	CCDS4482.1	6	.	.	.	.	.	.	.	.	.	.	C	26.8	4.768800	0.90020	.	.	ENSG00000137275	ENST00000259808;ENST00000541791;ENST00000380409	T;T;T	0.79554	-1.28;-0.67;-1.28	6.17	6.17	0.99709	Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.044218	0.85682	D	0.000000	D	0.86293	0.5898	L	0.53671	1.685	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.86427	0.1758	10	0.87932	D	0	-11.5138	17.7962	0.88572	0.0:1.0:0.0:0.0	.	241;287	Q13546-2;Q13546	.;RIPK1_HUMAN	L	287;241;287	ENSP00000259808:P287L;ENSP00000442294:P241L;ENSP00000369773:P287L	ENSP00000259808:P287L	P	+	2	0	RIPK1	3034835	1.000000	0.71417	0.996000	0.52242	0.996000	0.88848	2.921000	0.48852	2.941000	0.99782	0.655000	0.94253	CCT	-	superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_dom		0.254	RIPK1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	RIPK1	protein_coding	OTTHUMT00000039659.2	C	NM_003804	-		3089836	+1	no_errors	ENST00000259808	ensembl	human	known	74_37	missense	SNP	1.000	T
BBS4	585	genome.wustl.edu	37	15	73029293	73029293	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr15:73029293C>T	ENST00000268057.4	+	15	1480	c.1439C>T	c.(1438-1440)aCg>aTg	p.T480M	BBS4_ENST00000395205.2_Missense_Mutation_p.T488M|BBS4_ENST00000539603.1_Missense_Mutation_p.T468M|BBS4_ENST00000542334.1_Missense_Mutation_p.T308M	NM_033028.4	NP_149017.2	Q96RK4	BBS4_HUMAN	Bardet-Biedl syndrome 4	480	Required for localization to centrosomes.				adult behavior (GO:0030534)|brain morphogenesis (GO:0048854)|centrosome organization (GO:0051297)|cerebral cortex development (GO:0021987)|cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|convergent extension involved in gastrulation (GO:0060027)|dendrite development (GO:0016358)|fat cell differentiation (GO:0045444)|heart looping (GO:0001947)|hippocampus development (GO:0021766)|intracellular transport (GO:0046907)|maintenance of protein location in nucleus (GO:0051457)|melanosome transport (GO:0032402)|metabolic process (GO:0008152)|microtubule anchoring at centrosome (GO:0034454)|microtubule cytoskeleton organization (GO:0000226)|mitotic cytokinesis (GO:0000281)|negative regulation of appetite by leptin-mediated signaling pathway (GO:0038108)|negative regulation of gene expression (GO:0010629)|negative regulation of systemic arterial blood pressure (GO:0003085)|neural tube closure (GO:0001843)|nonmotile primary cilium assembly (GO:0035058)|photoreceptor cell maintenance (GO:0045494)|pigment granule aggregation in cell center (GO:0051877)|positive regulation of cilium assembly (GO:0045724)|positive regulation of multicellular organism growth (GO:0040018)|protein localization to centrosome (GO:0071539)|protein localization to organelle (GO:0033365)|protein transport (GO:0015031)|regulation of cilium beat frequency involved in ciliary motility (GO:0060296)|regulation of cytokinesis (GO:0032465)|regulation of lipid metabolic process (GO:0019216)|retina homeostasis (GO:0001895)|retinal rod cell development (GO:0046548)|sensory perception of smell (GO:0007608)|sensory processing (GO:0050893)|spermatid development (GO:0007286)|striatum development (GO:0021756)|visual perception (GO:0007601)	BBSome (GO:0034464)|centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|ciliary membrane (GO:0060170)|cilium (GO:0005929)|motile cilium (GO:0031514)|nonmotile primary cilium (GO:0031513)|pericentriolar material (GO:0000242)	alpha-tubulin binding (GO:0043014)|beta-tubulin binding (GO:0048487)|dynactin binding (GO:0034452)|microtubule motor activity (GO:0003777)|RNA polymerase II repressing transcription factor binding (GO:0001103)			autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(7)|prostate(2)|urinary_tract(1)	19						GCATACAGGACGCTCCCCTCA	0.522									Bardet-Biedl syndrome																																								0								ENSG00000140463						111.0	112.0	112.0					15																	73029293		2198	4297	6495	BBS4	SO:0001583	missense	0	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	-	HGNC	AF090947	CCDS10246.1, CCDS58377.1	15q22.3-q23	2013-01-10			ENSG00000140463	ENSG00000140463		"""Tetratricopeptide (TTC) repeat domain containing"""	969	protein-coding gene	gene with protein product		600374				7711739, 11381270	Standard	NM_033028		Approved		uc002avb.3	Q96RK4	OTTHUMG00000133510	ENST00000268057.4:c.1439C>T	15.37:g.73029293C>T	ENSP00000268057:p.Thr480Met	Somatic	0	31	0.00		0.41568620468393047	48	4.00	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	19	17.39	B4E178|Q53DZ5|Q8NHU9|Q96H45	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TPR_2,pfam_TPR_1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.T488M	ENST00000268057.4	37	c.1463	CCDS10246.1	15	.	.	.	.	.	.	.	.	.	.	C	12.22	1.871444	0.33069	.	.	ENSG00000140463	ENST00000542334;ENST00000268057;ENST00000539603;ENST00000395205	D;D;D;D	0.83755	-1.76;-1.76;-1.76;-1.76	5.73	2.12	0.27331	.	0.217699	0.48286	D	0.000190	T	0.66416	0.2787	N	0.08118	0	0.22684	N	0.998855	P;P;P	0.52577	0.954;0.954;0.923	B;B;B	0.40782	0.34;0.34;0.118	T	0.62267	-0.6890	10	0.54805	T	0.06	-11.6378	12.8258	0.57718	0.5427:0.4573:0.0:0.0	.	468;488;480	F5H7I8;Q96RK4-2;Q96RK4	.;.;BBS4_HUMAN	M	308;480;468;488	ENSP00000445964:T308M;ENSP00000268057:T480M;ENSP00000442492:T468M;ENSP00000378631:T488M	ENSP00000268057:T480M	T	+	2	0	BBS4	70816346	1.000000	0.71417	0.009000	0.14445	0.739000	0.42172	1.813000	0.38962	0.107000	0.17824	-0.262000	0.10625	ACG	-	NULL		0.522	BBS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BBS4	protein_coding	OTTHUMT00000257473.2	C	NM_033028	-		73029293	+1	no_errors	ENST00000395205	ensembl	human	known	74_37	missense	SNP	0.713	T
SSC4D	136853	genome.wustl.edu	37	7	76029884	76029884	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr7:76029884C>T	ENST00000275560.3	-	4	541	c.194G>A	c.(193-195)aGc>aAc	p.S65N	ZP3_ENST00000336517.4_Intron	NM_080744.1	NP_542782.1														autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(2)|lung(9)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	21						CCGGCAGCGGCTGGGGCCCCC	0.657																																																	0								ENSG00000146700						4.0	4.0	4.0					7																	76029884		1823	3669	5492	SRCRB4D	SO:0001583	missense	0			-	HGNC																												ENST00000275560.3:c.194G>A	7.37:g.76029884C>T	ENSP00000275560:p.Ser65Asn	Somatic	0	39	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	18	18.18		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SRCR,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_SRCR,prints_SRCR	p.S65N	ENST00000275560.3	37	c.194	CCDS5585.1	7	.	.	.	.	.	.	.	.	.	.	C	7.579	0.668304	0.14776	.	.	ENSG00000146700	ENST00000275560	T	0.31510	1.49	4.73	3.83	0.44106	Speract/scavenger receptor (3);Speract/scavenger receptor-related (2);	0.195628	0.53938	D	0.000055	T	0.21387	0.0515	L	0.28115	0.83	0.80722	D	1	P	0.35575	0.51	B	0.41813	0.367	T	0.03761	-1.1006	10	0.09590	T	0.72	.	8.1213	0.30974	0.0:0.755:0.1611:0.0838	.	65	Q8WTU2	SRB4D_HUMAN	N	65	ENSP00000275560:S65N	ENSP00000275560:S65N	S	-	2	0	SRCRB4D	75867820	1.000000	0.71417	0.950000	0.38849	0.910000	0.53928	1.750000	0.38329	1.331000	0.45412	-0.302000	0.09304	AGC	-	pfam_SRCR,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_SRCR		0.657	SRCRB4D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRCRB4D	protein_coding	OTTHUMT00000253001.3	C		-		76029884	-1	no_errors	ENST00000275560	ensembl	human	known	74_37	missense	SNP	0.928	T
WNT7B	7477	genome.wustl.edu	37	22	46345806	46345806	+	Nonsense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr22:46345806G>A	ENST00000339464.4	-	2	666	c.292C>T	c.(292-294)Cga>Tga	p.R98*	WNT7B_ENST00000410058.1_Nonsense_Mutation_p.R98*|WNT7B_ENST00000409496.3_Nonsense_Mutation_p.R102*|WNT7B_ENST00000410089.1_Nonsense_Mutation_p.R82*	NM_058238.2	NP_478679.1	P56706	WNT7B_HUMAN	wingless-type MMTV integration site family, member 7B	98					activation of JUN kinase activity (GO:0007257)|anatomical structure regression (GO:0060033)|apoptotic process involved in patterning of blood vessels (GO:1902262)|canonical Wnt signaling pathway (GO:0060070)|cell fate commitment (GO:0045165)|cellular metabolic process (GO:0044237)|cellular response to retinoic acid (GO:0071300)|central nervous system vasculogenesis (GO:0022009)|chorio-allantoic fusion (GO:0060710)|developmental growth involved in morphogenesis (GO:0060560)|embryonic organ development (GO:0048568)|embryonic placenta morphogenesis (GO:0060669)|establishment or maintenance of polarity of embryonic epithelium (GO:0016332)|fibroblast proliferation (GO:0048144)|forebrain regionalization (GO:0021871)|homeostatic process (GO:0042592)|in utero embryonic development (GO:0001701)|inner medullary collecting duct development (GO:0072061)|lens fiber cell development (GO:0070307)|lobar bronchus development (GO:0060482)|lung development (GO:0030324)|lung epithelium development (GO:0060428)|lung morphogenesis (GO:0060425)|lung-associated mesenchyme development (GO:0060484)|mammary gland epithelium development (GO:0061180)|metanephric collecting duct development (GO:0072205)|metanephric epithelium development (GO:0072207)|metanephric loop of Henle development (GO:0072236)|metanephros morphogenesis (GO:0003338)|negative regulation of smoothened signaling pathway (GO:0045879)|neuron differentiation (GO:0030182)|neuron projection morphogenesis (GO:0048812)|odontogenesis of dentin-containing tooth (GO:0042475)|outer medullary collecting duct development (GO:0072060)|oxygen homeostasis (GO:0032364)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of JNK cascade (GO:0046330)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of cell projection size (GO:0032536)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|response to glucocorticoid (GO:0051384)|smooth muscle cell differentiation (GO:0051145)|stem cell proliferation (GO:0072089)|synapse organization (GO:0050808)|trachea cartilage morphogenesis (GO:0060535)|Wnt signaling pathway (GO:0016055)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)			endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	19		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)|LUAD - Lung adenocarcinoma(64;0.247)		TTACCTACTCGGAGCTCTTGC	0.657																																																	0								ENSG00000188064						30.0	27.0	28.0					22																	46345806		2203	4300	6503	WNT7B	SO:0001587	stop_gained	0			-	HGNC	AF416743	CCDS33667.1	22q13	2013-02-28			ENSG00000188064	ENSG00000188064		"""Wingless-type MMTV integration sites"", ""Endogenous ligands"""	12787	protein-coding gene	gene with protein product		601967				8168088, 9284940, 11562755	Standard	NM_058238		Approved		uc003bgo.2	P56706	OTTHUMG00000154636	ENST00000339464.4:c.292C>T	22.37:g.46345806G>A	ENSP00000341032:p.Arg98*	Somatic	0	47	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	13	26.32	B8A596|Q96Q12	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Wnt,smart_Wnt,prints_Wnt,prints_Wnt7	p.R98*	ENST00000339464.4	37	c.292	CCDS33667.1	22	.	.	.	.	.	.	.	.	.	.	G	38	6.966030	0.97967	.	.	ENSG00000188064	ENST00000339464;ENST00000410089;ENST00000409496;ENST00000410058;ENST00000428540	.	.	.	3.81	2.75	0.32379	.	0.000000	0.64402	U	0.000005	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.16420	T	0.52	.	11.5026	0.50446	0.0:0.0:0.8192:0.1808	.	.	.	.	X	98;82;102;98;31	.	ENSP00000341032:R98X	R	-	1	2	WNT7B	44724470	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	1.655000	0.37345	0.763000	0.33175	0.555000	0.69702	CGA	-	pfam_Wnt,smart_Wnt		0.657	WNT7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WNT7B	protein_coding	OTTHUMT00000336418.1	G	NM_058238	-		46345806	-1	no_errors	ENST00000339464	ensembl	human	known	74_37	nonsense	SNP	1.000	A
LAMA1	284217	genome.wustl.edu	37	18	6958555	6958555	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr18:6958555G>A	ENST00000389658.3	-	55	7978	c.7885C>T	c.(7885-7887)Cca>Tca	p.P2629S	RP11-781P6.1_ENST00000584722.1_RNA	NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	2629	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				TCTCCCTCTGGAATTCCCCCG	0.463																																																	0								ENSG00000101680						158.0	117.0	131.0					18																	6958555		2203	4300	6503	LAMA1	SO:0001583	missense	0			-	HGNC	X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.7885C>T	18.37:g.6958555G>A	ENSP00000374309:p.Pro2629Ser	Somatic	0	52	0.00		0.41568620468393047	6	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	40	20.00		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Laminin_G,pfam_EGF_laminin,pfam_Laminin_B_type_IV,pfam_Laminin_N,pfam_Laminin_I,pfam_Laminin_II,superfamily_ConA-like_lec_gl_sf,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N	p.P2629S	ENST00000389658.3	37	c.7885	CCDS32787.1	18	.	.	.	.	.	.	.	.	.	.	G	16.32	3.089667	0.55968	.	.	ENSG00000101680	ENST00000389658;ENST00000344342	D	0.81499	-1.5	5.48	5.48	0.80851	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 1 (1);	0.000000	0.85682	D	0.000000	D	0.89691	0.6788	M	0.70903	2.155	0.53688	D	0.99997	D	0.89917	1.0	D	0.97110	1.0	D	0.90136	0.4210	10	0.87932	D	0	.	19.7112	0.96096	0.0:0.0:1.0:0.0	.	2629	P25391	LAMA1_HUMAN	S	2629;82	ENSP00000374309:P2629S	ENSP00000341000:P82S	P	-	1	0	LAMA1	6948555	1.000000	0.71417	0.240000	0.24138	0.197000	0.23852	7.401000	0.79962	2.722000	0.93159	0.655000	0.94253	CCA	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,pfscan_Laminin_G		0.463	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA1	protein_coding	OTTHUMT00000257369.1	G	NM_005559	-		6958555	-1	no_errors	ENST00000389658	ensembl	human	known	74_37	missense	SNP	0.957	A
NBPF9	400818	genome.wustl.edu	37	1	144822954	144822954	+	Intron	SNP	C	C	T	rs587627587	byFrequency	TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr1:144822954C>T	ENST00000468645.1	+	8	1023				NBPF9_ENST00000281815.8_Intron|NBPF9_ENST00000338347.4_Intron|NBPF9_ENST00000440491.2_Intron			Q3BBW0	NBPF9_HUMAN	neuroblastoma breakpoint family, member 9							cytoplasm (GO:0005737)				NS(2)|prostate(1)	3						ATGAAAGAACCCAAGCCAGTT	0.438																																																	0								ENSG00000168614																																			NBPF9	SO:0001627	intron_variant	0			-	HGNC		CCDS72895.1, CCDS72896.1	1q21.1	2013-01-17			ENSG00000168614	ENSG00000269713		"""neuroblastoma breakpoint family"""	31991	protein-coding gene	gene with protein product		613999				16079250	Standard	NM_001037675		Approved	AE01		Q3BBW0	OTTHUMG00000013845	ENST00000468645.1:c.1024-98C>T	1.37:g.144822954C>T		Somatic	0	108	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	54	23.94		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000468645.1	37	NULL		1																																																																																			-	-		0.438	NBPF9-002	KNOWN	not_best_in_genome_evidence|basic	processed_transcript	NBPF9	protein_coding	OTTHUMT00000038846.1	C	NM_001037675	-		144822954	+1	no_errors	ENST00000473761	ensembl	human	known	74_37	rna	SNP	0.000	T
PPP2R5C	5527	genome.wustl.edu	37	14	102359442	102359442	+	Silent	SNP	C	C	G			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr14:102359442C>G	ENST00000334743.5	+	7	843	c.795C>G	c.(793-795)ccC>ccG	p.P265P	PPP2R5C_ENST00000557095.1_Silent_p.P265P|PPP2R5C_ENST00000328724.5_Silent_p.P320P|PPP2R5C_ENST00000445439.3_Silent_p.P265P|PPP2R5C_ENST00000350249.3_Silent_p.P265P|PPP2R5C_ENST00000422945.2_Silent_p.P296P	NM_002719.3	NP_002710.2	Q13362	2A5G_HUMAN	protein phosphatase 2, regulatory subunit B', gamma	265					DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|negative regulation of cell proliferation (GO:0008285)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)	chromosome, centromeric region (GO:0000775)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)			breast(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	20						TCTACCATCCCCAGGTAAGGG	0.438																																																	0								ENSG00000078304						66.0	61.0	62.0					14																	102359442		2203	4300	6503	PPP2R5C	SO:0001819	synonymous_variant	0			-	HGNC	L42375	CCDS9964.1, CCDS9965.1, CCDS45163.1, CCDS53911.1, CCDS53912.1	14q32.31	2010-06-18	2010-04-14		ENSG00000078304	ENSG00000078304		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9311	protein-coding gene	gene with protein product		601645	"""protein phosphatase 2, regulatory subunit B (B56), gamma isoform"", ""protein phosphatase 2, regulatory subunit B', gamma isoform"""			7592815	Standard	NM_002719		Approved	B56G, PR61G	uc001ykk.3	Q13362		ENST00000334743.5:c.795C>G	14.37:g.102359442C>G		Somatic	0	55	0.00		0.41568620468393047	49	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	36	18.18	B4DYJ8|B5BUA5|F5GWP3|Q14391|Q15060|Q15174|Q6ZN33	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_PP2A_B56,superfamily_ARM-type_fold,pirsf_PP2A_B56	p.P296	ENST00000334743.5	37	c.888	CCDS9964.1	14																																																																																			-	pfam_PP2A_B56,superfamily_ARM-type_fold,pirsf_PP2A_B56		0.438	PPP2R5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP2R5C	protein_coding	OTTHUMT00000414373.2	C	NM_002719	-		102359442	+1	no_errors	ENST00000422945	ensembl	human	known	74_37	silent	SNP	0.210	G
APMAP	57136	genome.wustl.edu	37	20	24952105	24952105	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr20:24952105G>A	ENST00000217456.2	-	5	819	c.529C>T	c.(529-531)Ccc>Tcc	p.P177S	RNU6-1257P_ENST00000384625.1_RNA|APMAP_ENST00000447138.1_Missense_Mutation_p.P177S	NM_020531.2	NP_065392.1	Q9HDC9	APMAP_HUMAN	adipocyte plasma membrane associated protein	177					biosynthetic process (GO:0009058)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	arylesterase activity (GO:0004064)|strictosidine synthase activity (GO:0016844)										CGTTTCCAGGGATTTACTTCA	0.418																																																	0								ENSG00000101474						59.0	59.0	59.0					20																	24952105		2203	4300	6503	APMAP	SO:0001583	missense	0			-	HGNC	AB033767	CCDS13166.1	20p11.2	2012-07-20	2012-07-20	2012-07-20	ENSG00000101474	ENSG00000101474			13238	protein-coding gene	gene with protein product		615884	"""chromosome 20 open reading frame 3"""	C20orf3		10945474, 11583587, 20552250	Standard	NM_020531		Approved	BSCv	uc002wty.3	Q9HDC9	OTTHUMG00000032107	ENST00000217456.2:c.529C>T	20.37:g.24952105G>A	ENSP00000217456:p.Pro177Ser	Somatic	0	73	0.00		0.41568620468393047	76	30.28	33	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	42	12.50	A8K514|B4DXG1|Q6UVZ8|Q9GZS8|Q9NUB2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Strictosidine_synth_cons-reg,pfam_SGL	p.P177S	ENST00000217456.2	37	c.529	CCDS13166.1	20	.	.	.	.	.	.	.	.	.	.	G	24.8	4.572105	0.86542	.	.	ENSG00000101474	ENST00000217456;ENST00000447138	T;T	0.34275	1.37;1.37	5.17	5.17	0.71159	Six-bladed beta-propeller, TolB-like (1);	0.049489	0.85682	D	0.000000	T	0.52996	0.1769	M	0.77712	2.385	0.80722	D	1	D;P;P	0.61697	0.99;0.932;0.882	P;P;P	0.60886	0.88;0.469;0.473	T	0.51787	-0.8661	10	0.08381	T	0.77	-18.7832	14.5206	0.67847	0.0:0.0:1.0:0.0	.	177;161;177	Q9HDC9-2;A2A2F9;Q9HDC9	.;.;APMAP_HUMAN	S	177	ENSP00000217456:P177S;ENSP00000415373:P177S	ENSP00000217456:P177S	P	-	1	0	C20orf3	24900105	1.000000	0.71417	0.935000	0.37517	0.968000	0.65278	6.859000	0.75467	2.563000	0.86464	0.561000	0.74099	CCC	-	pfam_SGL		0.418	APMAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APMAP	protein_coding	OTTHUMT00000078380.2	G	NM_020531	-		24952105	-1	no_errors	ENST00000217456	ensembl	human	known	74_37	missense	SNP	0.998	A
RABL2A	11159	genome.wustl.edu	37	2	114398552	114398552	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr2:114398552C>T	ENST00000393167.3	+	6	604	c.379C>T	c.(379-381)Cca>Tca	p.P127S	RABL2A_ENST00000409875.1_Missense_Mutation_p.P127S|RABL2A_ENST00000409842.1_Intron|RABL2A_ENST00000393165.3_Missense_Mutation_p.P127S|RABL2A_ENST00000393166.3_Missense_Mutation_p.P127S|RABL2A_ENST00000376439.3_Intron|RABL2A_ENST00000478880.1_3'UTR	NM_013412.2	NP_038198.1	Q9UBK7	RBL2A_HUMAN	RAB, member of RAS oncogene family-like 2A	127					GTP catabolic process (GO:0006184)|small GTPase mediated signal transduction (GO:0007264)		GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|prostate(1)|skin(1)|stomach(3)	9						GCCAGAGATCCCATGCATCGT	0.517																																																	0								ENSG00000144134						47.0	46.0	46.0					2																	114398552		2201	4294	6495	RABL2A	SO:0001583	missense	0			-	HGNC		CCDS2118.1	2q13	2014-05-09			ENSG00000144134	ENSG00000144134		"""RAB, member RAS oncogene"""	9799	protein-coding gene	gene with protein product		605412				10444334	Standard	NM_007082		Approved		uc010flb.3	Q9UBK7	OTTHUMG00000047828	ENST00000393167.3:c.379C>T	2.37:g.114398552C>T	ENSP00000376872:p.Pro127Ser	Somatic	0	67	0.00		0.41568620468393047	15	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	23	32.35	B7ZBD6|Q9NU37	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Gtr1_RagA,pfam_EF_GTP-bd_dom,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.P127S	ENST00000393167.3	37	c.379	CCDS2118.1	2	.	.	.	.	.	.	.	.	.	.	C	15.92	2.974544	0.53720	.	.	ENSG00000144134	ENST00000393167;ENST00000393165;ENST00000393166;ENST00000409875	D;D;D;D	0.84370	-1.84;-1.84;-1.84;-1.84	3.14	3.14	0.36123	Small GTP-binding protein domain (1);	0.094146	0.85682	N	0.000000	D	0.89849	0.6834	M	0.75264	2.295	0.80722	D	1	D;D;D	0.89917	1.0;0.975;1.0	D;P;D	0.91635	0.999;0.854;0.999	D	0.87284	0.2294	10	0.13470	T	0.59	-11.1265	12.5625	0.56291	0.0:1.0:0.0:0.0	.	127;127;127	Q6IC14;A0AUY0;Q9UBK7	.;.;RBL2A_HUMAN	S	127	ENSP00000376872:P127S;ENSP00000376870:P127S;ENSP00000376871:P127S;ENSP00000387229:P127S	ENSP00000376870:P127S	P	+	1	0	RABL2A	114115022	1.000000	0.71417	0.997000	0.53966	0.141000	0.21300	6.818000	0.75257	1.721000	0.51461	0.505000	0.49811	CCA	-	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Gtr1_RagA,pfam_EF_GTP-bd_dom,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom		0.517	RABL2A-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	RABL2A	protein_coding	OTTHUMT00000109047.2	C		-		114398552	+1	no_errors	ENST00000393166	ensembl	human	known	74_37	missense	SNP	1.000	T
SLA	6503	genome.wustl.edu	37	8	134060111	134060111	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr8:134060111C>T	ENST00000338087.5	-	6	1135	c.316G>A	c.(316-318)Ggc>Agc	p.G106S	TG_ENST00000220616.4_Intron|TG_ENST00000377869.1_Intron|TG_ENST00000519543.1_Intron|SLA_ENST00000517648.1_Missense_Mutation_p.G123S|TG_ENST00000542445.1_Intron|SLA_ENST00000395352.3_Missense_Mutation_p.G123S|SLA_ENST00000524345.1_5'UTR|SLA_ENST00000427060.2_Missense_Mutation_p.G146S|SLA_ENST00000518565.1_5'Flank	NM_001045556.2	NP_001039021.1	Q13239	SLAP1_HUMAN	Src-like-adaptor	106	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				positive regulation of signal transduction (GO:0009967)	endosome (GO:0005768)	SH3/SH2 adaptor activity (GO:0005070)	p.G146R(1)|p.G106R(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|liver(1)|lung(6)|prostate(1)|skin(1)	17	all_epithelial(106;3.51e-21)|Lung NSC(106;4.24e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0279)|Breast(495;0.037)	BRCA - Breast invasive adenocarcinoma(115;0.000701)			ATGAAGGAGCCGACCTTTGTG	0.577																																																	2	Substitution - Missense(2)	lung(2)						ENSG00000155926						74.0	73.0	73.0					8																	134060111		2203	4300	6503	SLA	SO:0001583	missense	0			-	HGNC		CCDS6370.1, CCDS47922.1, CCDS47923.1, CCDS64977.1, CCDS64978.1	8q24.22	2013-09-19	2001-11-28		ENSG00000155926	ENSG00000155926		"""SH2 domain containing"""	10902	protein-coding gene	gene with protein product		601099	"""Src-like-adapter"""			8825655, 11179692	Standard	NM_001045556		Approved	SLA1	uc011ljd.2	Q13239	OTTHUMG00000164439	ENST00000338087.5:c.316G>A	8.37:g.134060111C>T	ENSP00000337548:p.Gly106Ser	Somatic	0	50	0.00		0.41568620468393047	9	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	26	13.33	B7Z4J2|B7Z4L6|Q6FI01|Q9UMQ8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SH2,pfam_SH3_domain,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,pfscan_SH2,pfscan_SH3_domain,prints_SH2	p.G146S	ENST00000338087.5	37	c.436	CCDS6370.1	8	.	.	.	.	.	.	.	.	.	.	C	35	5.535530	0.96460	.	.	ENSG00000155926	ENST00000338087;ENST00000427060;ENST00000395352;ENST00000517648;ENST00000522119	D;D;D;D;D	0.99158	-1.86;-1.86;-1.86;-5.5;-5.5	5.6	5.6	0.85130	SH2 motif (5);	0.000000	0.85682	D	0.000000	D	0.99560	0.9842	H	0.96996	3.92	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;0.999;0.999;1.0	D;D;D;D;D	0.77004	0.978;0.98;0.968;0.989;0.98	D	0.98078	1.0402	10	0.87932	D	0	-50.5173	17.4647	0.87629	0.0:1.0:0.0:0.0	.	123;106;106;106;106	B7Z4J2;Q6FI01;Q5TZW1;E5RJ69;Q13239	.;.;.;.;SLAP1_HUMAN	S	106;146;123;123;106	ENSP00000337548:G106S;ENSP00000394049:G146S;ENSP00000378759:G123S;ENSP00000428559:G123S;ENSP00000430596:G106S	ENSP00000337548:G106S	G	-	1	0	SLA	134129293	1.000000	0.71417	0.983000	0.44433	0.997000	0.91878	7.095000	0.76952	2.793000	0.96121	0.563000	0.77884	GGC	-	pfam_SH2,smart_SH2,pfscan_SH2,prints_SH2		0.577	SLA-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SLA	protein_coding	OTTHUMT00000378771.1	C		-		134060111	-1	no_errors	ENST00000427060	ensembl	human	known	74_37	missense	SNP	1.000	T
PAOX	196743	genome.wustl.edu	37	10	135197627	135197627	+	Silent	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr10:135197627G>A	ENST00000278060.5	+	4	1115	c.1032G>A	c.(1030-1032)gaG>gaA	p.E344E	PAOX_ENST00000357296.3_Silent_p.E344E|PAOX_ENST00000368535.2_3'UTR|PAOX_ENST00000480071.2_Intron|PAOX_ENST00000368539.4_3'UTR	NM_152911.2	NP_690875.1	Q6QHF9	PAOX_HUMAN	polyamine oxidase (exo-N4-amino)	482					cellular nitrogen compound metabolic process (GO:0034641)|oxidation-reduction process (GO:0055114)|polyamine biosynthetic process (GO:0006596)|polyamine catabolic process (GO:0006598)|polyamine metabolic process (GO:0006595)|positive regulation of spermidine biosynthetic process (GO:1901307)|putrescine biosynthetic process (GO:0009446)|putrescine catabolic process (GO:0009447)|small molecule metabolic process (GO:0044281)|spermidine catabolic process (GO:0046203)|spermine catabolic process (GO:0046208)|xenobiotic metabolic process (GO:0006805)	peroxisomal matrix (GO:0005782)	N(1),N(12)-diacetylspermine:oxygen oxidoreductase (3-acetamidopropanal-forming) activity (GO:0052899)|N1-acetylspermidine:oxygen oxidoreductase (3-acetamidopropanal-forming) activity (GO:0052904)|N1-acetylspermine:oxygen oxidoreductase (3-acetamidopropanal-forming) activity (GO:0052903)|polyamine oxidase activity (GO:0046592)|receptor binding (GO:0005102)|spermidine:oxygen oxidoreductase (3-aminopropanal-forming) activity (GO:0052902)|spermine:oxygen oxidoreductase (spermidine-forming) activity (GO:0052901)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(13)|ovary(1)|urinary_tract(2)	23		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		all cancers(32;4.39e-07)|OV - Ovarian serous cystadenocarcinoma(35;1.21e-06)|Epithelial(32;1.94e-06)		TGGTGTGGGAGGACACGTCGC	0.572																																																	0								ENSG00000148832						118.0	100.0	106.0					10																	135197627		2203	4300	6503	PAOX	SO:0001819	synonymous_variant	0			-	HGNC	BC032778	CCDS7682.1, CCDS7683.1, CCDS7684.1	10q26.3	2003-11-13			ENSG00000148832	ENSG00000148832			20837	protein-coding gene	gene with protein product		615853				12660232	Standard	NM_207127		Approved	PAO	uc001lmv.3	Q6QHF9	OTTHUMG00000019318	ENST00000278060.5:c.1032G>A	10.37:g.135197627G>A		Somatic	0	54	0.00		0.41568620468393047	19	24.00	6	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	26	23.53	D3DXI6|Q5VWY0|Q6QHF5|Q6QHF6|Q6QHF7|Q6QHF8|Q6QHG0|Q6QHG1|Q6QHG2|Q6QHG3|Q6QHG4|Q6QHG5|Q6QHG6|Q86WP9|Q8N555|Q8NCX3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Amino_oxidase	p.E344	ENST00000278060.5	37	c.1032	CCDS7683.1	10	.	.	.	.	.	.	.	.	.	.	g	0.796	-0.757222	0.03019	.	.	ENSG00000148832	ENST00000368542	.	.	.	5.19	1.15	0.20763	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.0338	0.19694	0.2397:0.2607:0.4996:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PAOX	135047617	0.993000	0.37304	0.464000	0.27143	0.194000	0.23727	0.209000	0.17435	-0.157000	0.11059	-1.329000	0.01275	.	-	pfam_Amino_oxidase		0.572	PAOX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAOX	protein_coding	OTTHUMT00000051146.2	G	NM_152911	-		135197627	+1	no_errors	ENST00000278060	ensembl	human	known	74_37	silent	SNP	0.998	A
PHTF1	10745	genome.wustl.edu	37	1	114248545	114248546	+	Frame_Shift_Ins	INS	-	-	A	rs201254988		TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr1:114248545_114248546insA	ENST00000369604.1	-	13	2120_2121	c.1637_1638insT	c.(1636-1638)ttcfs	p.F546fs	PHTF1_ENST00000369600.1_Frame_Shift_Ins_p.F493fs|PHTF1_ENST00000357783.2_Frame_Shift_Ins_p.F546fs|PHTF1_ENST00000393357.2_Frame_Shift_Ins_p.F546fs|PHTF1_ENST00000474926.1_5'UTR|PHTF1_ENST00000369596.2_Frame_Shift_Ins_p.F493fs|PHTF1_ENST00000369598.1_Frame_Shift_Ins_p.F501fs			Q9UMS5	PHTF1_HUMAN	putative homeodomain transcription factor 1	546					transcription, DNA-templated (GO:0006351)	cis-Golgi network (GO:0005801)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(3)|kidney(2)|large_intestine(9)|liver(1)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	27	Lung SC(450;0.184)	all_cancers(81;3.78e-08)|all_epithelial(167;5.56e-08)|all_lung(203;6.97e-06)|Lung NSC(69;1.18e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CACACATCATGAAAAAAAACAT	0.327																																																	0								ENSG00000116793																																			PHTF1	SO:0001589	frameshift_variant	0				HGNC	AJ011863	CCDS861.1	1p13-p11	2008-07-18			ENSG00000116793	ENSG00000116793			8939	protein-coding gene	gene with protein product		604950		PHTF		10395808	Standard	NM_006608		Approved		uc009wgp.1	Q9UMS5	OTTHUMG00000011800	ENST00000369604.1:c.1638dupT	1.37:g.114248553_114248553dupA	ENSP00000358617:p.Phe546fs	Somatic	0	41	0.00		0.41568620468393047	52	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	22	8.33	Q5VWP7|Q5VWP8|Q9BUP2|Q9H1X8	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_TF_homeodomain_male	p.M547fs	ENST00000369604.1	37	c.1638_1637	CCDS861.1	1																																																																																			-	NULL		0.327	PHTF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHTF1	protein_coding	OTTHUMT00000032666.1	-	NM_006608			114248546	-1	no_errors	ENST00000369604	ensembl	human	known	74_37	frame_shift_ins	INS	0.997:1.000	A
OR5M1	390168	genome.wustl.edu	37	11	56380933	56380933	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr11:56380933C>T	ENST00000526538.1	-	1	45	c.46G>A	c.(46-48)Gga>Aga	p.G16R		NM_001004740.1	NP_001004740.1	Q8NGP8	OR5M1_HUMAN	olfactory receptor, family 5, subfamily M, member 1	16						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(7)|upper_aerodigestive_tract(1)	12						TCTGTCAGTCCCAAGAGAATG	0.448																																																	0								ENSG00000255012						161.0	149.0	152.0					11																	56380933		1908	4121	6029	OR5M1	SO:0001583	missense	0			-	HGNC	AB065742	CCDS53631.1	11q11	2012-08-09				ENSG00000255012		"""GPCR / Class A : Olfactory receptors"""	8352	protein-coding gene	gene with protein product							Standard	NM_001004740		Approved	OST050	uc001nja.1	Q8NGP8		ENST00000526538.1:c.46G>A	11.37:g.56380933C>T	ENSP00000435416:p.Gly16Arg	Somatic	0	113	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	48	21.31	Q6IF60|Q96RB6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.G16R	ENST00000526538.1	37	c.46	CCDS53631.1	11	.	.	.	.	.	.	.	.	.	.	C	16.90	3.249091	0.59103	.	.	ENSG00000255012	ENST00000526538	T	0.00659	5.94	3.71	3.71	0.42584	.	0.000000	0.38778	N	0.001568	T	0.04092	0.0114	M	0.93939	3.475	0.39667	D	0.970698	P	0.45594	0.862	P	0.50192	0.634	T	0.06972	-1.0797	10	0.87932	D	0	-19.9813	14.3562	0.66740	0.0:1.0:0.0:0.0	.	16	Q8NGP8	OR5M1_HUMAN	R	16	ENSP00000435416:G16R	ENSP00000435416:G16R	G	-	1	0	OR5M1	56137509	0.879000	0.30193	0.996000	0.52242	0.682000	0.39822	4.291000	0.59025	1.949000	0.56562	0.280000	0.19369	GGA	-	NULL		0.448	OR5M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5M1	protein_coding	OTTHUMT00000391610.1	C	NM_001004740	-		56380933	-1	no_errors	ENST00000526538	ensembl	human	known	74_37	missense	SNP	0.996	T
ABCA9	10350	genome.wustl.edu	37	17	66979869	66979869	+	Nonsense_Mutation	SNP	G	G	A	rs537889906		TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr17:66979869G>A	ENST00000340001.4	-	36	4832	c.4621C>T	c.(4621-4623)Cag>Tag	p.Q1541*	ABCA9_ENST00000453985.2_Nonsense_Mutation_p.Q1503*|ABCA9_ENST00000370732.2_3'UTR|ABCA9_ENST00000482072.1_5'Flank	NM_080283.3	NP_525022.2	Q8IUA7	ABCA9_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 9	1541					transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			NS(2)|breast(4)|central_nervous_system(3)|endometrium(8)|kidney(3)|large_intestine(21)|lung(35)|ovary(4)|prostate(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	91	Breast(10;1.47e-12)					TGAGCAGCCTGGGGGAAAAGC	0.458																																																	0								ENSG00000154258						103.0	99.0	100.0					17																	66979869		2203	4300	6503	ABCA9	SO:0001587	stop_gained	0			-	HGNC	AF423307	CCDS11681.1	17q24	2012-03-14			ENSG00000154258	ENSG00000154258		"""ATP binding cassette transporters / subfamily A"""	39	protein-coding gene	gene with protein product		612507					Standard	XM_005256934		Approved	EST640918	uc002jhu.3	Q8IUA7	OTTHUMG00000140371	ENST00000340001.4:c.4621C>T	17.37:g.66979869G>A	ENSP00000342216:p.Gln1541*	Somatic	0	65	0.00		0.41568620468393047	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	36	29.41	Q6P655|Q8N2S4|Q8WWZ5|Q96MD8	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.Q1541*	ENST00000340001.4	37	c.4621	CCDS11681.1	17	.	.	.	.	.	.	.	.	.	.	G	42	9.401955	0.99159	.	.	ENSG00000154258	ENST00000340001;ENST00000453985	.	.	.	4.91	3.88	0.44766	.	0.156137	0.29444	N	0.012137	.	.	.	.	.	.	0.35264	D	0.779829	.	.	.	.	.	.	.	.	.	.	0.37606	T	0.19	.	10.3747	0.44075	0.0:0.1231:0.6594:0.2175	.	.	.	.	X	1541;1486	.	ENSP00000342216:Q1541X	Q	-	1	0	ABCA9	64491464	0.001000	0.12720	1.000000	0.80357	0.952000	0.60782	1.052000	0.30429	2.447000	0.82792	0.655000	0.94253	CAG	-	NULL		0.458	ABCA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA9	protein_coding	OTTHUMT00000277072.2	G	NM_172386	-		66979869	-1	no_errors	ENST00000340001	ensembl	human	known	74_37	nonsense	SNP	0.372	A
GPR119	139760	genome.wustl.edu	37	X	129518774	129518774	+	Silent	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chrX:129518774C>T	ENST00000276218.2	-	1	737	c.648G>A	c.(646-648)cgG>cgA	p.R216R		NM_178471.2	NP_848566.1	Q8TDV5	GP119_HUMAN	G protein-coupled receptor 119	216					insulin secretion (GO:0030073)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)|phosphatidylcholine binding (GO:0031210)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|ovary(3)|prostate(1)	11						CGCTGGGAGTCCGTGGGGATC	0.532																																																	0								ENSG00000147262						98.0	79.0	85.0					X																	129518774		2203	4300	6503	GPR119	SO:0001819	synonymous_variant	0			-	HGNC	AY288416	CCDS14625.1	Xq26.1	2014-01-30			ENSG00000147262	ENSG00000147262		"""GPCR / Class A : Orphans"""	19060	protein-coding gene	gene with protein product		300513				12044878, 14623098	Standard	NM_178471		Approved	hGPCR2, GPCR2	uc011muv.2	Q8TDV5	OTTHUMG00000022397	ENST00000276218.2:c.648G>A	X.37:g.129518774C>T		Somatic	0	15	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	9	52.63	Q495H7|Q4VBN3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.R216	ENST00000276218.2	37	c.648	CCDS14625.1	X																																																																																			-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM		0.532	GPR119-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR119	protein_coding	OTTHUMT00000058270.1	C	NM_178471	-		129518774	-1	no_errors	ENST00000276218	ensembl	human	known	74_37	silent	SNP	0.011	T
SHANK2	22941	genome.wustl.edu	37	11	70319210	70319210	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr11:70319210G>A	ENST00000423696.2	-	16	4213	c.4177C>T	c.(4177-4179)Cca>Tca	p.P1393S	SHANK2_ENST00000449833.2_Missense_Mutation_p.P1177S|SHANK2_ENST00000409161.1_Missense_Mutation_p.P1176S|SHANK2_ENST00000338508.4_Missense_Mutation_p.P1773S			Q9UPX8	SHAN2_HUMAN	SH3 and multiple ankyrin repeat domains 2	1393					adult behavior (GO:0030534)|learning (GO:0007612)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell junction (GO:0030054)|ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|growth cone (GO:0030426)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GKAP/Homer scaffold activity (GO:0030160)|ionotropic glutamate receptor binding (GO:0035255)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(30)|ovary(3)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	62			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)			TTTGAGATTGGCTGTTGCAGT	0.498																																																	0								ENSG00000162105						116.0	116.0	116.0					11																	70319210		2200	4294	6494	SHANK2	SO:0001583	missense	0			-	HGNC	AF141901		11q13.2	2013-01-10			ENSG00000162105	ENSG00000162105		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	14295	protein-coding gene	gene with protein product		603290	"""cortactin binding protein 1"""	CORTBP1		10506216	Standard	XM_005277930		Approved	CTTNBP1, ProSAP1, SHANK, SPANK-3	uc001oqc.3	Q9UPX8	OTTHUMG00000154615	ENST00000423696.2:c.4177C>T	11.37:g.70319210G>A	ENSP00000394536:p.Pro1393Ser	Somatic	0	85	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	40	20.00	C0SPG8|C0SPG9|Q3Y8G9|Q52LK2|Q9UKP1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SAM_type1,pfam_SAM_2,pfam_SH3_2,pfam_PDZ,pfam_SH3_domain,superfamily_Ankyrin_rpt-contain_dom,superfamily_PDZ,superfamily_SAM/pointed,superfamily_SH3_domain,smart_Ankyrin_rpt,smart_SH3_domain,smart_PDZ,smart_SAM,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_PDZ,pfscan_SAM,pfscan_SH3_domain	p.P1773S	ENST00000423696.2	37	c.5317		11	.	.	.	.	.	.	.	.	.	.	G	19.16	3.774293	0.69992	.	.	ENSG00000162105	ENST00000449833;ENST00000409161;ENST00000424924;ENST00000338508;ENST00000423696;ENST00000433693;ENST00000294018	T;T;T;T;T;T	0.49720	2.16;2.17;2.89;0.77;2.26;2.29	5.91	5.91	0.95273	.	0.488053	0.25450	N	0.030587	T	0.57154	0.2034	L	0.50333	1.59	0.80722	D	1	B;D;P	0.57571	0.397;0.98;0.708	B;P;B	0.54664	0.057;0.758;0.227	T	0.42783	-0.9431	10	0.15952	T	0.53	.	20.3018	0.98617	0.0:0.0:1.0:0.0	.	1393;1772;1177	Q9UPX8;Q9UPX8-3;Q9UPX8-4	SHAN2_HUMAN;.;.	S	1177;1176;1051;1773;1393;1411;1396	ENSP00000399423:P1177S;ENSP00000386491:P1176S;ENSP00000402944:P1051S;ENSP00000345193:P1773S;ENSP00000394536:P1393S;ENSP00000294018:P1396S	ENSP00000294018:P1396S	P	-	1	0	SHANK2	69996858	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.811000	0.69187	2.799000	0.96334	0.650000	0.86243	CCA	-	NULL		0.498	SHANK2-203	KNOWN	basic	protein_coding	SHANK2	protein_coding		G	NM_012309	-		70319210	-1	no_errors	ENST00000338508	ensembl	human	known	74_37	missense	SNP	1.000	A
COL9A3	1299	genome.wustl.edu	37	20	61467647	61467647	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr20:61467647C>T	ENST00000343916.3	+	28	1513	c.1510C>T	c.(1510-1512)Ccg>Tcg	p.P504S	COL9A3_ENST00000462700.1_3'UTR	NM_001853.3	NP_001844.3	Q14050	CO9A3_HUMAN	collagen, type IX, alpha 3	504	Triple-helical region 3 (COL3).				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|female gonad development (GO:0008585)|male gonad development (GO:0008584)	collagen type IX trimer (GO:0005594)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(1)|endometrium(3)|large_intestine(1)|lung(18)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	28	Breast(26;5.68e-08)					GCAGGGCGTCCCGGGTGTTCC	0.657																																																	0								ENSG00000092758						33.0	41.0	38.0					20																	61467647		2200	4300	6500	COL9A3	SO:0001583	missense	0			-	HGNC	AK075240	CCDS13505.1	20q13.3	2013-01-16			ENSG00000092758	ENSG00000092758		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2219	protein-coding gene	gene with protein product	"""collagen type IX proteoglycan"""	120270				8586434, 1429648	Standard	NM_001853		Approved	IDD, MED, EDM3, FLJ90759, DJ885L7.4.1	uc002ydm.3	Q14050	OTTHUMG00000032938	ENST00000343916.3:c.1510C>T	20.37:g.61467647C>T	ENSP00000341640:p.Pro504Ser	Somatic	0	67	0.00		0.41568620468393047	3	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	28	31.71	Q13681|Q9H4G9|Q9UPE2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Collagen	p.P504S	ENST00000343916.3	37	c.1510	CCDS13505.1	20	.	.	.	.	.	.	.	.	.	.	C	11.16	1.556310	0.27827	.	.	ENSG00000092758	ENST00000343916	D	0.96587	-4.06	4.63	4.63	0.57726	.	0.192922	0.46758	D	0.000274	D	0.92655	0.7666	L	0.37630	1.12	0.25112	N	0.990702	B	0.16802	0.019	B	0.19148	0.024	T	0.81951	-0.0698	10	0.19590	T	0.45	.	14.0257	0.64584	0.1515:0.8485:0.0:0.0	.	504	Q14050	CO9A3_HUMAN	S	504	ENSP00000341640:P504S	ENSP00000341640:P504S	P	+	1	0	COL9A3	60938092	0.983000	0.35010	0.003000	0.11579	0.002000	0.02628	3.620000	0.54203	2.117000	0.64856	0.561000	0.74099	CCG	-	pfam_Collagen		0.657	COL9A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL9A3	protein_coding	OTTHUMT00000080071.2	C	NM_001853	-		61467647	+1	no_errors	ENST00000343916	ensembl	human	known	74_37	missense	SNP	0.684	T
CUBN	8029	genome.wustl.edu	37	10	17165618	17165618	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr10:17165618G>A	ENST00000377833.4	-	5	523	c.458C>T	c.(457-459)tCc>tTc	p.S153F	CUBN_ENST00000377823.1_Missense_Mutation_p.S153F	NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	153	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	ACAAAAAAAGGAATCATGCAG	0.443																																																	0								ENSG00000107611						74.0	63.0	67.0					10																	17165618		2203	4300	6503	CUBN	SO:0001583	missense	0			-	HGNC	AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.458C>T	10.37:g.17165618G>A	ENSP00000367064:p.Ser153Phe	Somatic	0	34	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	13	45.83	B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_CUB_dom,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,superfamily_CUB_dom,superfamily_Growth_fac_rcpt_N_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_CUB_dom,pfscan_CUB_dom,pfscan_EG-like_dom	p.S153F	ENST00000377833.4	37	c.458	CCDS7113.1	10	.	.	.	.	.	.	.	.	.	.	G	19.92	3.917183	0.73098	.	.	ENSG00000107611	ENST00000377833;ENST00000433666;ENST00000377823	D;D;D	0.92699	-3.09;-3.09;-3.09	5.36	5.36	0.76844	EGF (1);Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.39407	N	0.001374	D	0.96312	0.8797	M	0.88181	2.935	0.45390	D	0.998376	D	0.69078	0.997	D	0.67103	0.949	D	0.96547	0.9405	10	0.56958	D	0.05	.	15.6722	0.77286	0.0:0.1467:0.8533:0.0	.	153	O60494	CUBN_HUMAN	F	153;40;153	ENSP00000367064:S153F;ENSP00000415970:S40F;ENSP00000367054:S153F	ENSP00000367054:S153F	S	-	2	0	CUBN	17205624	1.000000	0.71417	0.530000	0.27963	0.967000	0.64934	6.730000	0.74780	2.513000	0.84729	0.655000	0.94253	TCC	-	pfam_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom		0.443	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUBN	protein_coding	OTTHUMT00000047009.1	G	NM_001081	-		17165618	-1	no_errors	ENST00000377833	ensembl	human	known	74_37	missense	SNP	0.979	A
CHRND	1144	genome.wustl.edu	37	2	233399031	233399031	+	Silent	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr2:233399031G>A	ENST00000258385.3	+	11	1382	c.1350G>A	c.(1348-1350)agG>agA	p.R450R	CHRND_ENST00000543200.1_Silent_p.R435R|CHRND_ENST00000457943.2_Silent_p.R256R	NM_000751.2	NP_000742.1	Q07001	ACHD_HUMAN	cholinergic receptor, nicotinic, delta (muscle)	450					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|muscle contraction (GO:0006936)|musculoskeletal movement (GO:0050881)|neuromuscular process (GO:0050905)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|skeletal muscle tissue growth (GO:0048630)|synaptic transmission (GO:0007268)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine-activated cation-selective channel activity (GO:0004889)			breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|liver(1)|lung(17)|ovary(3)|prostate(1)|skin(1)|stomach(1)	34		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;1.89e-16)|BRCA - Breast invasive adenocarcinoma(100;0.00078)|Lung(119;0.00579)|LUSC - Lung squamous cell carcinoma(224;0.00754)	Galantamine(DB00674)	ACCACATGAGGGACCAGAACA	0.507																																																	0								ENSG00000135902						73.0	72.0	73.0					2																	233399031		2203	4300	6503	CHRND	SO:0001819	synonymous_variant	0			-	HGNC	X55019	CCDS2494.1, CCDS58754.1	2q37.1	2012-02-11	2012-02-07		ENSG00000135902	ENSG00000135902		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1965	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, delta (muscle)"""	100720	"""cholinergic receptor, nicotinic, delta"""	ACHRD			Standard	NM_000751		Approved		uc002vsw.4	Q07001	OTTHUMG00000133261	ENST00000258385.3:c.1350G>A	2.37:g.233399031G>A		Somatic	0	38	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	31	13.89	A8K661|B4DT92|Q52LH4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,prints_Nicotinic_acetylcholine_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.R450	ENST00000258385.3	37	c.1350	CCDS2494.1	2																																																																																			-	pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM,tigrfam_Neur_channel		0.507	CHRND-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRND	protein_coding	OTTHUMT00000257038.2	G		-		233399031	+1	no_errors	ENST00000258385	ensembl	human	known	74_37	silent	SNP	0.008	A
COLGALT2	23127	genome.wustl.edu	37	1	183914594	183914594	+	Missense_Mutation	SNP	A	A	C			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr1:183914594A>C	ENST00000361927.4	-	9	1612	c.1241T>G	c.(1240-1242)tTt>tGt	p.F414C	COLGALT2_ENST00000367520.3_Missense_Mutation_p.F151C|COLGALT2_ENST00000367521.1_Missense_Mutation_p.F22C|COLGALT2_ENST00000546159.1_Missense_Mutation_p.F414C	NM_015101.2	NP_055916.1	Q8IYK4	GT252_HUMAN	collagen beta(1-O)galactosyltransferase 2	414					extracellular matrix organization (GO:0030198)|lipopolysaccharide biosynthetic process (GO:0009103)	endoplasmic reticulum lumen (GO:0005788)	procollagen galactosyltransferase activity (GO:0050211)										GTGGCTGAGAAAGCAGCCGAT	0.453																																																	0								ENSG00000198756						115.0	114.0	114.0					1																	183914594		2203	4300	6503	COLGALT2	SO:0001583	missense	0			-	HGNC	AF288389	CCDS1360.1	1q25	2013-02-27	2013-02-27	2013-02-27	ENSG00000198756	ENSG00000198756			16790	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 17"", ""glycosyltransferase 25 domain containing 2"""	C1orf17, GLT25D2		19075007	Standard	XM_005245008		Approved	KIAA0584	uc001gqr.3	Q8IYK4	OTTHUMG00000035460	ENST00000361927.4:c.1241T>G	1.37:g.183914594A>C	ENSP00000354960:p.Phe414Cys	Somatic	0	66	0.00		0.41568620468393047	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	39	23.53	O60327|Q9BZR0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Glyco_trans_25	p.F414C	ENST00000361927.4	37	c.1241	CCDS1360.1	1	.	.	.	.	.	.	.	.	.	.	A	24.1	4.491180	0.84962	.	.	ENSG00000198756	ENST00000546159;ENST00000361927;ENST00000367521;ENST00000367520	T;T	0.80566	-1.38;-1.39	5.39	5.39	0.77823	.	0.000000	0.85682	D	0.000000	D	0.92417	0.7593	H	0.94582	3.555	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.996	D	0.94462	0.7677	10	0.87932	D	0	-15.2925	15.3979	0.74812	1.0:0.0:0.0:0.0	.	414;414;151	F5H3T5;Q8IYK4;Q5SXQ3	.;GT252_HUMAN;.	C	414;414;22;151	ENSP00000439112:F414C;ENSP00000354960:F414C	ENSP00000354960:F414C	F	-	2	0	GLT25D2	182181217	1.000000	0.71417	0.995000	0.50966	0.984000	0.73092	7.156000	0.77453	2.042000	0.60477	0.455000	0.32223	TTT	-	pfam_Glyco_trans_25		0.453	COLGALT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COLGALT2	protein_coding	OTTHUMT00000086128.1	A	NM_015101	-		183914594	-1	no_errors	ENST00000361927	ensembl	human	known	74_37	missense	SNP	1.000	C
KMT2E	55904	genome.wustl.edu	37	7	104714103	104714103	+	Silent	SNP	C	C	A	rs199652176		TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr7:104714103C>A	ENST00000311117.3	+	7	1080	c.535C>A	c.(535-537)Cgg>Agg	p.R179R	KMT2E_ENST00000334877.4_Silent_p.R179R|KMT2E_ENST00000476671.1_Silent_p.R179R|KMT2E_ENST00000334914.7_5'UTR|KMT2E_ENST00000257745.4_Silent_p.R179R	NM_182931.2	NP_891847.1	Q8IZD2	KMT2E_HUMAN	lysine (K)-specific methyltransferase 2E	179					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|DNA methylation (GO:0006306)|erythrocyte differentiation (GO:0030218)|histone H3-K4 methylation (GO:0051568)|neutrophil activation (GO:0042119)|neutrophil mediated immunity (GO:0002446)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of transcription, DNA-templated (GO:0045893)|retinoic acid receptor signaling pathway (GO:0048384)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|MLL5-L complex (GO:0070688)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)										ACTACAACGCCGGAAAAGGGA	0.328																																																	0								ENSG00000005483						59.0	60.0	60.0					7																	104714103		2203	4300	6503	KMT2E	SO:0001819	synonymous_variant	0			-	HGNC	AF067804	CCDS34723.1	7q22.1	2013-05-09	2013-05-09	2013-05-09	ENSG00000005483	ENSG00000005483		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	18541	protein-coding gene	gene with protein product		608444	"""myeloid/lymphoid or mixed-lineage leukemia 5 (trithorax homolog, Drosophila)"""	MLL5		9218106, 7672722	Standard	XM_005250493		Approved	HDCMC04P		Q8IZD2	OTTHUMG00000157403	ENST00000311117.3:c.535C>A	7.37:g.104714103C>A		Somatic	0	200	0.00		0.41568620468393047	3	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	28	88	24.14	B6ZDE4|B6ZDM3|M4K8J3|Q6P5Y2|Q6PKG4|Q6T316|Q86TI3|Q86W12|Q86WG0|Q86WL2|Q8IV78|Q8IWR5|Q8NFF8|Q9NWE7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_SET_dom,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_SET_dom,pfscan_SET_dom,pfscan_Znf_PHD-finger	p.R179	ENST00000311117.3	37	c.535	CCDS34723.1	7																																																																																			-	NULL		0.328	KMT2E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KMT2E	protein_coding	OTTHUMT00000348697.1	C		-		104714103	+1	no_errors	ENST00000257745	ensembl	human	known	74_37	silent	SNP	1.000	A
TYRO3	7301	genome.wustl.edu	37	15	41854857	41854857	+	Nonsense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr15:41854857G>A	ENST00000263798.3	+	4	745	c.521G>A	c.(520-522)tGg>tAg	p.W174*	TYRO3_ENST00000559066.1_Nonsense_Mutation_p.W129*	NM_006293.3	NP_006284.2	Q06418	TYRO3_HUMAN	TYRO3 protein tyrosine kinase	174	Ig-like C2-type 2.				apoptotic cell clearance (GO:0043277)|cell adhesion (GO:0007155)|forebrain cell migration (GO:0021885)|natural killer cell differentiation (GO:0001779)|negative regulation of inflammatory response (GO:0050728)|negative regulation of innate immune response (GO:0045824)|negative regulation of lymphocyte activation (GO:0051250)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|neuron cellular homeostasis (GO:0070050)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol 3-kinase signaling (GO:0014065)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|protein autophosphorylation (GO:0046777)|protein kinase B signaling (GO:0043491)|secretion by cell (GO:0032940)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|spermatogenesis (GO:0007283)|substrate adhesion-dependent cell spreading (GO:0034446)|vagina development (GO:0060068)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(26)|ovary(3)|prostate(1)	43		all_cancers(109;7.33e-15)|all_epithelial(112;2.8e-12)|Lung NSC(122;3.48e-08)|all_lung(180;1.71e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.31e-18)|GBM - Glioblastoma multiforme(113;9.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.117)		ATTGTCTGGTGGAGAGGAACT	0.552																																																	0								ENSG00000092445						65.0	60.0	62.0					15																	41854857		2203	4300	6503	TYRO3	SO:0001587	stop_gained	0			-	HGNC	D50479	CCDS10080.1	15q15.1-q21.1	2013-02-11			ENSG00000092445	ENSG00000092445	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12446	protein-coding gene	gene with protein product		600341		RSE		7851890	Standard	NM_006293		Approved	Dtk, Brt, Tif, Sky	uc001zof.2	Q06418	OTTHUMG00000130341	ENST00000263798.3:c.521G>A	15.37:g.41854857G>A	ENSP00000263798:p.Trp174*	Somatic	0	102	0.00		0.41568620468393047	5	16.67	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	70	23.91	O14953|Q86VR3	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.W174*	ENST00000263798.3	37	c.521	CCDS10080.1	15	.	.	.	.	.	.	.	.	.	.	g	36	5.911855	0.97093	.	.	ENSG00000092445	ENST00000540218;ENST00000263798	.	.	.	4.8	4.8	0.61643	.	0.000000	0.36628	N	0.002492	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.28530	T	0.3	-10.8229	18.0396	0.89315	0.0:0.0:1.0:0.0	.	.	.	.	X	106;174	.	ENSP00000263798:W174X	W	+	2	0	TYRO3	39642149	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	7.701000	0.84566	2.481000	0.83766	0.472000	0.43445	TGG	-	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.552	TYRO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TYRO3	protein_coding	OTTHUMT00000252693.2	G		-		41854857	+1	no_errors	ENST00000263798	ensembl	human	known	74_37	nonsense	SNP	1.000	A
CUBN	8029	genome.wustl.edu	37	10	16957152	16957152	+	Silent	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr10:16957152G>A	ENST00000377833.4	-	47	7295	c.7230C>T	c.(7228-7230)taC>taT	p.Y2410Y		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	2410	CUB 17. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	TGTTTCCACAGTATCTGCCCA	0.438																																																	0								ENSG00000107611						111.0	99.0	103.0					10																	16957152		2203	4300	6503	CUBN	SO:0001819	synonymous_variant	0			-	HGNC	AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.7230C>T	10.37:g.16957152G>A		Somatic	0	92	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	40	33.33	B0YIZ4|Q5VTA6|Q96RU9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_CUB_dom,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,superfamily_CUB_dom,superfamily_Growth_fac_rcpt_N_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_CUB_dom,pfscan_CUB_dom,pfscan_EG-like_dom	p.Y2410	ENST00000377833.4	37	c.7230	CCDS7113.1	10																																																																																			-	pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom		0.438	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUBN	protein_coding	OTTHUMT00000047009.1	G	NM_001081	-		16957152	-1	no_errors	ENST00000377833	ensembl	human	known	74_37	silent	SNP	1.000	A
ZNF431	170959	genome.wustl.edu	37	19	21326387	21326387	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr19:21326387G>A	ENST00000311048.7	+	2	181	c.37G>A	c.(37-39)Gaa>Aaa	p.E13K	ZNF431_ENST00000594425.1_Missense_Mutation_p.E13K|ZNF431_ENST00000600692.1_Missense_Mutation_p.E13K|ZNF431_ENST00000599296.1_Missense_Mutation_p.E13K	NM_133473.2	NP_597730.2	Q8TF32	ZN431_HUMAN	zinc finger protein 431	13					cell differentiation (GO:0030154)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|core promoter sequence-specific DNA binding (GO:0001046)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(7)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	23						TCCTCTCAAGGAAGCAAGTGG	0.423																																																	0								ENSG00000196705						101.0	96.0	98.0					19																	21326387		2203	4300	6503	ZNF431	SO:0001583	missense	0			-	HGNC	AB075849	CCDS32979.1	19p12	2013-01-08				ENSG00000196705		"""Zinc fingers, C2H2-type"", ""-"""	20809	protein-coding gene	gene with protein product						11853319	Standard	NM_133473		Approved	KIAA1969	uc002npp.2	Q8TF32		ENST00000311048.7:c.37G>A	19.37:g.21326387G>A	ENSP00000308578:p.Glu13Lys	Somatic	0	107	0.00		0.41568620468393047	0	100.00	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	51	15.00	A8KAK7|Q8IWC4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E13K	ENST00000311048.7	37	c.37	CCDS32979.1	19	.	.	.	.	.	.	.	.	.	.	.	2.886	-0.230689	0.05983	.	.	ENSG00000196705	ENST00000311048	T	0.05855	3.38	0.461	-0.922	0.10468	.	.	.	.	.	T	0.02418	0.0074	N	0.08118	0	0.09310	N	1	B	0.19583	0.037	B	0.18263	0.021	T	0.47058	-0.9146	8	0.07325	T	0.83	.	.	.	.	.	13	Q8TF32	ZN431_HUMAN	K	13	ENSP00000308578:E13K	ENSP00000308578:E13K	E	+	1	0	ZNF431	21118227	0.002000	0.14202	0.001000	0.08648	0.054000	0.15201	0.523000	0.22925	-0.484000	0.06763	0.298000	0.19748	GAA	-	NULL		0.423	ZNF431-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF431	protein_coding	OTTHUMT00000463943.1	G	XM_086098	-		21326387	+1	no_errors	ENST00000311048	ensembl	human	known	74_37	missense	SNP	0.001	A
GJB2	2706	genome.wustl.edu	37	13	20763343	20763343	+	Silent	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr13:20763343G>A	ENST00000382844.1	-	1	576	c.378C>T	c.(376-378)gtC>gtT	p.V126V	GJB2_ENST00000382848.4_Silent_p.V126V			P29033	CXB2_HUMAN	gap junction protein, beta 2, 26kDa	126					cell-cell signaling (GO:0007267)|gap junction assembly (GO:0016264)|male genitalia development (GO:0030539)|membrane organization (GO:0061024)|sensory perception of sound (GO:0007605)|transport (GO:0006810)	connexon complex (GO:0005922)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)	gap junction channel activity (GO:0005243)			breast(1)|endometrium(2)|large_intestine(1)|lung(2)|skin(1)	7		all_cancers(29;3.95e-22)|all_epithelial(30;2.36e-19)|all_lung(29;2.27e-18)|Lung SC(185;0.0257)|Ovarian(182;0.0822)		all cancers(112;0.000435)|Epithelial(112;0.000722)|OV - Ovarian serous cystadenocarcinoma(117;0.0096)|Lung(94;0.0236)|LUSC - Lung squamous cell carcinoma(192;0.0738)		CTTCGATGCGGACCTTCTGGG	0.507									Keratitis, Ichthyosis and Deafness syndrome		OREG0022282	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000165474						115.0	108.0	110.0					13																	20763343		2203	4300	6503	GJB2	SO:0001819	synonymous_variant	0	Familial Cancer Database	KID syndrome	-	HGNC	M86849	CCDS9290.1	13q11-q12	2010-01-06	2007-01-16		ENSG00000165474	ENSG00000165474		"""Ion channels / Gap junction proteins (connexins)"""	4284	protein-coding gene	gene with protein product	"""connexin 26"""	121011	"""gap junction protein, beta 2, 26kD (connexin 26)"", ""gap junction protein, beta 2, 26kDa (connexin 26)"""	DFNB1, DFNA3		9139825	Standard	NM_004004		Approved	CX26, NSRD1	uc001umy.3	P29033	OTTHUMG00000016513	ENST00000382844.1:c.378C>T	13.37:g.20763343G>A		Somatic	0	32	0.00	743	0.41568620468393047	55	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	7	30.00	Q508A5|Q508A6|Q5YLL0|Q5YLL1|Q5YLL4|Q6IPV5|Q86U88|Q96AK0|Q9H536|Q9NNY4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Connexin_N,pfam_Connexin_CCC,smart_Connexin_N,prints_Connexin,prints_Connexin26	p.V126	ENST00000382844.1	37	c.378	CCDS9290.1	13																																																																																			-	NULL		0.507	GJB2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GJB2	protein_coding	OTTHUMT00000044064.1	G		-		20763343	-1	no_errors	ENST00000382844	ensembl	human	known	74_37	silent	SNP	0.979	A
CREBZF	58487	genome.wustl.edu	37	11	85375532	85375532	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr11:85375532G>A	ENST00000527447.1	-	1	614	c.388C>T	c.(388-390)Ctc>Ttc	p.L130F	CREBZF_ENST00000398294.2_Missense_Mutation_p.L48F|CREBZF_ENST00000531515.1_Intron|CREBZF_ENST00000534224.1_Intron	NM_001039618.2	NP_001034707.1	Q9NS37	ZHANG_HUMAN	CREB/ATF bZIP transcription factor	130					negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|response to virus (GO:0009615)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	9		Acute lymphoblastic leukemia(157;4.19e-06)|all_hematologic(158;0.0033)				GACGAGGAGAGAGGCCCCGGC	0.657																																					NSCLC(172;674 2044 9050 18334 41735)												0								ENSG00000137504						34.0	40.0	38.0					11																	85375532		1934	4142	6076	CREBZF	SO:0001583	missense	0			-	HGNC	AF039942	CCDS41697.1	11q14.1	2013-01-10			ENSG00000137504	ENSG00000137504		"""basic leucine zipper proteins"""	24905	protein-coding gene	gene with protein product	"""Zhangfei"""	606444				10871379	Standard	NM_001039618		Approved	ZF	uc001pas.2	Q9NS37	OTTHUMG00000133648	ENST00000527447.1:c.388C>T	11.37:g.85375532G>A	ENSP00000433459:p.Leu130Phe	Somatic	0	68	0.00		0.41568620468393047	22	21.43	6	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	31	16.22	B2R8Q9|Q0P5U9|Q52LT3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_bZIP	p.L130F	ENST00000527447.1	37	c.388	CCDS41697.1	11	.	.	.	.	.	.	.	.	.	.	G	26.6	4.758015	0.89843	.	.	ENSG00000137504	ENST00000398294;ENST00000527447	.	.	.	4.41	4.41	0.53225	.	0.000000	0.32987	N	0.005402	T	0.54951	0.1890	N	0.19112	0.55	0.35076	D	0.762984	D	0.71674	0.998	D	0.75484	0.986	T	0.62011	-0.6944	8	.	.	.	-8.8899	12.3863	0.55335	0.0:0.0:1.0:0.0	.	130	Q9NS37	ZHANG_HUMAN	F	48;130	.	.	L	-	1	0	CREBZF	85053180	1.000000	0.71417	0.999000	0.59377	0.988000	0.76386	3.585000	0.53943	2.289000	0.77006	0.561000	0.74099	CTC	-	NULL		0.657	CREBZF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CREBZF	protein_coding	OTTHUMT00000390191.2	G	NM_001039618	-		85375532	-1	no_errors	ENST00000525639	ensembl	human	known	74_37	missense	SNP	0.998	A
DOCK2	1794	genome.wustl.edu	37	5	169494579	169494579	+	Missense_Mutation	SNP	G	G	A	rs148502872	byFrequency	TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr5:169494579G>A	ENST00000256935.8	+	45	4613	c.4533G>A	c.(4531-4533)atG>atA	p.M1511I	DOCK2_ENST00000520908.1_Missense_Mutation_p.M1003I|DOCK2_ENST00000540750.1_Missense_Mutation_p.M572I|DOCK2_ENST00000523351.1_3'UTR	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	1511	DHR-2.				actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)			NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			AGATCCTGATGATGATAAACC	0.502																																																	0								ENSG00000134516						189.0	170.0	176.0					5																	169494579		2203	4300	6503	DOCK2	SO:0001583	missense	0			-	HGNC	BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.4533G>A	5.37:g.169494579G>A	ENSP00000256935:p.Met1511Ile	Somatic	0	105	0.00		0.41568620468393047	30	3.23	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	55	9.84	Q2M3I0|Q96AK7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DOCK_C,pfam_SH3_2,superfamily_SH3_domain,superfamily_Cyt_c-like_dom,superfamily_ARM-type_fold,superfamily_Ferritin-like_SF,smart_SH3_domain,pfscan_SH3_domain	p.M1511I	ENST00000256935.8	37	c.4533	CCDS4371.1	5	.	.	.	.	.	.	.	.	.	.	G	14.76	2.630704	0.46944	.	.	ENSG00000134516	ENST00000256935;ENST00000520908;ENST00000540750	T;T;T	0.17054	2.3;2.3;2.3	4.71	4.71	0.59529	.	0.097056	0.64402	D	0.000001	T	0.12178	0.0296	N	0.14661	0.345	0.36266	D	0.854833	B;B;B	0.31485	0.325;0.073;0.181	B;B;B	0.34385	0.073;0.181;0.024	T	0.25641	-1.0126	10	0.37606	T	0.19	.	14.5027	0.67732	0.0:0.1476:0.8524:0.0	.	1003;67;1511	E7ERW7;B3KY14;Q92608	.;.;DOCK2_HUMAN	I	1511;1003;572	ENSP00000256935:M1511I;ENSP00000429283:M1003I;ENSP00000438827:M572I	ENSP00000256935:M1511I	M	+	3	0	DOCK2	169427157	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	3.486000	0.53215	2.322000	0.78497	0.467000	0.42956	ATG	-	pfam_DOCK_C		0.502	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK2	protein_coding	OTTHUMT00000252828.2	G	NM_004946	-		169494579	+1	no_errors	ENST00000256935	ensembl	human	known	74_37	missense	SNP	1.000	A
DENND2A	27147	genome.wustl.edu	37	7	140273687	140273687	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr7:140273687G>A	ENST00000275884.6	-	5	1784	c.1367C>T	c.(1366-1368)tCc>tTc	p.S456F	DENND2A_ENST00000492720.1_Missense_Mutation_p.S456F|DENND2A_ENST00000496613.1_Missense_Mutation_p.S456F|DENND2A_ENST00000537639.1_Missense_Mutation_p.S456F			Q9ULE3	DEN2A_HUMAN	DENN/MADD domain containing 2A	456					positive regulation of Rab GTPase activity (GO:0032851)|protein transport (GO:0015031)|retrograde transport, endosome to Golgi (GO:0042147)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(22)|ovary(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49	Melanoma(164;0.00956)					GCTGGGAGTGGAGGGAGGGCT	0.502																																																	0								ENSG00000146966						225.0	223.0	223.0					7																	140273687		1918	4133	6051	DENND2A	SO:0001583	missense	0			-	HGNC	AB033103	CCDS43659.1	7q34	2012-10-03	2005-08-17	2005-08-17	ENSG00000146966	ENSG00000146966		"""DENN/MADD domain containing"""	22212	protein-coding gene	gene with protein product			"""KIAA1277"""	KIAA1277			Standard	NM_015689		Approved	FAM31D	uc010lnj.3	Q9ULE3	OTTHUMG00000157411	ENST00000275884.6:c.1367C>T	7.37:g.140273687G>A	ENSP00000275884:p.Ser456Phe	Somatic	0	102	0.00		0.41568620468393047	21	12.50	3	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	73	23.96	C9JUI3|Q1RMD5|Q86XY0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DENN_dom,pfam_uDENN_dom,pfam_dDENN_dom,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom	p.S456F	ENST00000275884.6	37	c.1367	CCDS43659.1	7	.	.	.	.	.	.	.	.	.	.	G	21.9	4.219045	0.79464	.	.	ENSG00000146966	ENST00000275884;ENST00000537639;ENST00000496613;ENST00000492720;ENST00000475837	T;T;T;T	0.14893	3.17;3.17;3.17;2.47	4.85	4.85	0.62838	.	0.138886	0.49916	D	0.000130	T	0.37489	0.1005	L	0.48642	1.525	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.971	T	0.10154	-1.0642	10	0.87932	D	0	-32.0878	18.5136	0.90926	0.0:0.0:1.0:0.0	.	456;456	Q9ULE3-2;Q9ULE3	.;DEN2A_HUMAN	F	456;456;456;456;79	ENSP00000275884:S456F;ENSP00000442245:S456F;ENSP00000419654:S456F;ENSP00000419464:S456F	ENSP00000275884:S456F	S	-	2	0	DENND2A	139920156	1.000000	0.71417	1.000000	0.80357	0.758000	0.43043	9.115000	0.94336	2.683000	0.91414	0.313000	0.20887	TCC	-	NULL		0.502	DENND2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DENND2A	protein_coding	OTTHUMT00000348742.1	G	NM_015689	-		140273687	-1	no_errors	ENST00000275884	ensembl	human	known	74_37	missense	SNP	1.000	A
ANXA6	309	genome.wustl.edu	37	5	150509073	150509073	+	Missense_Mutation	SNP	G	G	T	rs557062451		TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr5:150509073G>T	ENST00000354546.5	-	12	1040	c.813C>A	c.(811-813)gaC>gaA	p.D271E	ANXA6_ENST00000523714.1_Missense_Mutation_p.D239E|ANXA6_ENST00000377751.5_Intron|ANXA6_ENST00000356496.5_Missense_Mutation_p.D271E|ANXA6_ENST00000521512.1_Intron	NM_001155.4	NP_001146.2	P08133	ANXA6_HUMAN	annexin A6	271					calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|protein homooligomerization (GO:0051260)|regulation of muscle contraction (GO:0006937)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|calcium-dependent protein binding (GO:0048306)|cholesterol binding (GO:0015485)|GTP binding (GO:0005525)|ligand-gated ion channel activity (GO:0015276)|lipid binding (GO:0008289)|protein homodimerization activity (GO:0042803)			endometrium(2)|kidney(1)|lung(9)	12		Medulloblastoma(196;0.0912)|all_hematologic(541;0.208)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TCAGGGTGTTGTCCCGAGTCC	0.527													G|||	1	0.000199681	0.0	0.0	5008	,	,		17882	0.0		0.0	False		,,,				2504	0.001																0								ENSG00000197043						47.0	48.0	47.0					5																	150509073		1986	4157	6143	ANXA6	SO:0001583	missense	0			-	HGNC	J03578	CCDS47315.1, CCDS54941.1	5q33.1	2008-02-05			ENSG00000197043	ENSG00000197043		"""Annexins"""	544	protein-coding gene	gene with protein product		114070		ANX6		3258820	Standard	NM_001155		Approved		uc003ltl.2	P08133	OTTHUMG00000164179	ENST00000354546.5:c.813C>A	5.37:g.150509073G>T	ENSP00000346550:p.Asp271Glu	Somatic	0	56	0.00		0.41568620468393047	849	0.12	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51	B7Z8A7|D3DQH4|E9PGK1|Q6ZT79	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Annexin_repeat,smart_Annexin_repeat,prints_Annexin,prints_AnnexinVI,prints_AnnexinIV	p.D271E	ENST00000354546.5	37	c.813	CCDS47315.1	5	.	.	.	.	.	.	.	.	.	.	G	17.40	3.378912	0.61735	.	.	ENSG00000197043	ENST00000354546;ENST00000523714;ENST00000356496;ENST00000540153	T;T;T	0.02158	4.42;4.42;4.42	5.05	5.05	0.67936	Annexin repeat, conserved site (1);	0.044136	0.85682	N	0.000000	T	0.03608	0.0103	L	0.43701	1.375	0.80722	D	1	B;B	0.09022	0.002;0.002	B;B	0.12156	0.007;0.007	T	0.49072	-0.8977	10	0.46703	T	0.11	.	17.1866	0.86868	0.0:0.0:1.0:0.0	.	271;271	A6NN80;P08133	.;ANXA6_HUMAN	E	271;239;271;145	ENSP00000346550:D271E;ENSP00000430517:D239E;ENSP00000348889:D271E	ENSP00000346550:D271E	D	-	3	2	ANXA6	150489266	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.350000	0.52224	2.358000	0.79984	0.511000	0.50034	GAC	-	pfam_Annexin_repeat,smart_Annexin_repeat,prints_Annexin		0.527	ANXA6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANXA6	protein_coding	OTTHUMT00000377668.2	G	NM_001155	-		150509073	-1	no_errors	ENST00000354546	ensembl	human	known	74_37	missense	SNP	1.000	T
LYST	1130	genome.wustl.edu	37	1	235929492	235929492	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr1:235929492G>A	ENST00000389794.3	-	21	6182	c.6008C>T	c.(6007-6009)cCt>cTt	p.P2003L	LYST_ENST00000389793.2_Missense_Mutation_p.P2003L|LYST_ENST00000536965.1_3'UTR			Q99698	LYST_HUMAN	lysosomal trafficking regulator	2003					blood coagulation (GO:0007596)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|leukocyte chemotaxis (GO:0030595)|lysosome organization (GO:0007040)|mast cell secretory granule organization (GO:0033364)|melanosome organization (GO:0032438)|microtubule-based process (GO:0007017)|natural killer cell mediated cytotoxicity (GO:0042267)|neutrophil mediated immunity (GO:0002446)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of natural killer cell activation (GO:0032816)|response to drug (GO:0042493)|secretion of lysosomal enzymes (GO:0033299)|T cell mediated immunity (GO:0002456)	cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)				NS(1)|breast(13)|central_nervous_system(3)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(27)|lung(66)|ovary(7)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	162	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			CAAATCTGGAGGAGATCCAAG	0.378																																																	0								ENSG00000143669						161.0	176.0	171.0					1																	235929492		2203	4300	6503	LYST	SO:0001583	missense	0			-	HGNC	U70064	CCDS31062.1	1q42.1-q42.2	2014-09-17	2004-12-09	2004-12-10	ENSG00000143669	ENSG00000143669		"""WD repeat domain containing"""	1968	protein-coding gene	gene with protein product		606897	"""Chediak-Higashi syndrome 1"""	CHS1		8717042, 8896560	Standard	NM_000081		Approved	CHS	uc001hxj.3	Q99698	OTTHUMG00000040527	ENST00000389794.3:c.6008C>T	1.37:g.235929492G>A	ENSP00000374444:p.Pro2003Leu	Somatic	0	41	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	29	12.12	O43274|Q5T2U9|Q96TD7|Q96TD8|Q99709|Q9H133	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.P2003L	ENST00000389794.3	37	c.6008	CCDS31062.1	1	.	.	.	.	.	.	.	.	.	.	G	32	5.126832	0.94429	.	.	ENSG00000143669	ENST00000389794;ENST00000389793	T;T	0.75260	-0.92;-0.92	5.36	5.36	0.76844	.	0.109062	0.64402	D	0.000007	D	0.85031	0.5604	M	0.67953	2.075	0.80722	D	1	D	0.71674	0.998	D	0.65443	0.935	D	0.86170	0.1599	10	0.87932	D	0	.	19.4366	0.94798	0.0:0.0:1.0:0.0	.	2003	Q99698	LYST_HUMAN	L	2003	ENSP00000374444:P2003L;ENSP00000374443:P2003L	ENSP00000374443:P2003L	P	-	2	0	LYST	233996115	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.534000	0.98061	2.669000	0.90835	0.585000	0.79938	CCT	-	superfamily_ARM-type_fold		0.378	LYST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LYST	protein_coding	OTTHUMT00000097533.5	G		-		235929492	-1	no_errors	ENST00000389793	ensembl	human	known	74_37	missense	SNP	1.000	A
KIAA0226	9711	genome.wustl.edu	37	3	197444872	197444872	+	Silent	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr3:197444872G>A	ENST00000296343.5	-	2	194	c.195C>T	c.(193-195)ctC>ctT	p.L65L	KIAA0226_ENST00000273582.5_Silent_p.L5L|KIAA0226_ENST00000467303.1_Intron|KIAA0226_ENST00000389665.5_Silent_p.L65L|KIAA0226_ENST00000449205.1_Silent_p.L65L	NM_014687.1	NP_055502.1	Q92622	RUBIC_HUMAN	KIAA0226	65	RUN. {ECO:0000255|PROSITE- ProRule:PRU00178}.				autophagy (GO:0006914)|cell death (GO:0008219)|endocytosis (GO:0006897)|negative regulation of autophagy (GO:0010507)|negative regulation of endocytosis (GO:0045806)	early endosome (GO:0005769)|late endosome (GO:0005770)|lysosome (GO:0005764)				NS(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	all_cancers(143;8.26e-10)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;2.19e-23)|all cancers(36;1.39e-21)|OV - Ovarian serous cystadenocarcinoma(49;1.21e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(93;0.0446)		GCCCGTGATAGAGGATGCTCT	0.522																																					Esophageal Squamous(3;167 355 3763 15924)												0								ENSG00000145016						69.0	71.0	70.0					3																	197444872		1974	4152	6126	KIAA0226	SO:0001819	synonymous_variant	0			-	HGNC	D86979	CCDS43195.1, CCDS46987.1	3q29	2011-08-09			ENSG00000145016	ENSG00000145016			28991	protein-coding gene	gene with protein product	"""RUN domain and cysteine-rich domain containing, Beclin 1-interacting protein"""	613516				9039502, 19270693, 20826435	Standard	XM_005269374		Approved	rubicon, rundataxin	uc003fyc.2	Q92622	OTTHUMG00000155452	ENST00000296343.5:c.195C>T	3.37:g.197444872G>A		Somatic	0	33	0.00		0.41568620468393047	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	18	25.00	Q96CK5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Run,smart_Run,pfscan_Run	p.L65	ENST00000296343.5	37	c.195	CCDS43195.1	3																																																																																			-	pfam_Run,pfscan_Run		0.522	KIAA0226-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA0226	protein_coding	OTTHUMT00000340184.1	G	XM_032901	-		197444872	-1	no_errors	ENST00000296343	ensembl	human	known	74_37	silent	SNP	0.995	A
UBAC1	10422	genome.wustl.edu	37	9	138831595	138831595	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr9:138831595G>A	ENST00000371756.3	-	8	1104	c.887C>T	c.(886-888)tCc>tTc	p.S296F	UBAC1_ENST00000465873.1_5'UTR	NM_016172.2	NP_057256.2	Q9BSL1	UBAC1_HUMAN	UBA domain containing 1	296	UBA 2. {ECO:0000255|PROSITE- ProRule:PRU00212}.				protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)				NS(1)|biliary_tract(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(2)|lung(6)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	25		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.1e-06)|Epithelial(140;7.79e-06)		CTCCATCAGGGAAATGACGGC	0.622																																					NSCLC(78;973 1398 27381 29552 42415)												0								ENSG00000130560						234.0	192.0	206.0					9																	138831595		2203	4300	6503	UBAC1	SO:0001583	missense	0			-	HGNC	AF176796	CCDS35177.1	9q34.3	2008-02-05	2007-04-20	2007-04-20	ENSG00000130560	ENSG00000130560			30221	protein-coding gene	gene with protein product		608129	"""ubiquitin associated domain containing 1"""	UBADC1		10857748, 8619474	Standard	NM_016172		Approved	GBDR1	uc004cgt.3	Q9BSL1	OTTHUMG00000020920	ENST00000371756.3:c.887C>T	9.37:g.138831595G>A	ENSP00000360821:p.Ser296Phe	Somatic	0	29	0.00		0.41568620468393047	113	20.42	29	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	23	39.47	O75500|Q9UMW7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_UBA/Ts_N,superfamily_UBA-like,smart_UBA/transl_elong_EF1B_N_euk,smart_STI1_HS-bd,pfscan_UBA/transl_elong_EF1B_N_euk	p.S296F	ENST00000371756.3	37	c.887	CCDS35177.1	9	.	.	.	.	.	.	.	.	.	.	G	18.18	3.567490	0.65651	.	.	ENSG00000130560	ENST00000371756	T	0.23754	1.89	5.01	5.01	0.66863	Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (2);Ubiquitin-associated/translation elongation factor EF1B, N-terminal (1);UBA-like (1);	0.051080	0.85682	D	0.000000	T	0.50051	0.1593	M	0.86343	2.81	0.58432	D	0.999998	P	0.44281	0.831	P	0.51657	0.676	T	0.58896	-0.7555	10	0.62326	D	0.03	-23.4188	17.3218	0.87238	0.0:0.0:1.0:0.0	.	296	Q9BSL1	UBAC1_HUMAN	F	296	ENSP00000360821:S296F	ENSP00000360821:S296F	S	-	2	0	UBAC1	137971416	1.000000	0.71417	0.993000	0.49108	0.141000	0.21300	9.033000	0.93741	2.334000	0.79466	0.561000	0.74099	TCC	-	pfam_UBA/Ts_N,superfamily_UBA-like,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk		0.622	UBAC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBAC1	protein_coding	OTTHUMT00000055034.1	G	NM_016172	-		138831595	-1	no_errors	ENST00000371756	ensembl	human	known	74_37	missense	SNP	1.000	A
ADCK5	203054	genome.wustl.edu	37	8	145616875	145616875	+	Silent	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr8:145616875C>T	ENST00000308860.6	+	8	938	c.894C>T	c.(892-894)gtC>gtT	p.V298V	CPSF1_ENST00000531727.1_5'Flank|ADCK5_ENST00000526231.2_3'UTR|MIR939_ENST00000401314.1_RNA	NM_174922.3	NP_777582.4	Q3MIX3	ADCK5_HUMAN	aarF domain containing kinase 5	298	Protein kinase.					integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	protein serine/threonine kinase activity (GO:0004674)			endometrium(1)|lung(2)|prostate(2)|skin(1)|stomach(2)	8	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;8.96e-41)|Epithelial(56;4.08e-40)|all cancers(56;4.51e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0323)|Colorectal(110;0.055)			TCCCCTACGTCGTGGTGCCCC	0.697																																																	0								ENSG00000173137						14.0	15.0	15.0					8																	145616875		2120	4194	6314	ADCK5	SO:0001819	synonymous_variant	0			-	HGNC	BC032402	CCDS34965.1, CCDS34965.2	8q24.3	2004-07-06			ENSG00000173137	ENSG00000173137			21738	protein-coding gene	gene with protein product							Standard	NM_174922		Approved	FLJ35454	uc003zch.3	Q3MIX3	OTTHUMG00000165190	ENST00000308860.6:c.894C>T	8.37:g.145616875C>T		Somatic	0	33	0.00		0.41568620468393047	9	43.75	7	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	18	18.18	B3KS46|Q5U4P1|Q6P2S4|Q8N5V3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_UbiB_dom,superfamily_Kinase-like_dom	p.V298	ENST00000308860.6	37	c.894	CCDS34965.1	8																																																																																			-	pfam_UbiB_dom,superfamily_Kinase-like_dom		0.697	ADCK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCK5	protein_coding	OTTHUMT00000382556.2	C	NM_174922	-		145616875	+1	no_errors	ENST00000308860	ensembl	human	known	74_37	silent	SNP	0.074	T
TDRD6	221400	genome.wustl.edu	37	6	46659235	46659235	+	Missense_Mutation	SNP	T	T	G			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr6:46659235T>G	ENST00000316081.6	+	1	3370	c.3370T>G	c.(3370-3372)Ttg>Gtg	p.L1124V	TDRD6_ENST00000544460.1_Missense_Mutation_p.L1124V	NM_001010870.2	NP_001010870.1	O60522	TDRD6_HUMAN	tudor domain containing 6	1124					germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|P granule (GO:0043186)				NS(1)|breast(9)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	80			Lung(136;0.192)			AGATAAGTCATTGAAGGCTTT	0.358																																																	0								ENSG00000180113						118.0	120.0	119.0					6																	46659235		2203	4300	6503	TDRD6	SO:0001583	missense	0			-	HGNC	AF039442	CCDS34470.1, CCDS55017.1	6p12.3	2013-01-23			ENSG00000180113	ENSG00000180113		"""Tudor domain containing"""	21339	protein-coding gene	gene with protein product	"""cancer/testis antigen 41.2"", ""spermatogenesis associated 36"""	611200				9610721	Standard	NM_001010870		Approved	NY-CO-45, bA446F17.4, CT41.2, SPATA36	uc003oyj.3	O60522	OTTHUMG00000014788	ENST00000316081.6:c.3370T>G	6.37:g.46659235T>G	ENSP00000346065:p.Leu1124Val	Somatic	0	69	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	30	21.05	B3KWU2|F5H5M3|Q5HYB1|Q5VTS4|Q6ZMX5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Tudor,smart_Tudor,pfscan_Tudor	p.L1124V	ENST00000316081.6	37	c.3370	CCDS34470.1	6	.	.	.	.	.	.	.	.	.	.	T	9.712	1.157357	0.21454	.	.	ENSG00000180113	ENST00000544460;ENST00000316081	T;T	0.19806	2.12;2.13	5.73	-8.21	0.01041	.	0.129757	0.52532	D	0.000069	T	0.11580	0.0282	M	0.68317	2.08	0.21652	N	0.999607	P;P	0.41673	0.759;0.646	P;B	0.49829	0.623;0.419	T	0.06607	-1.0817	10	0.44086	T	0.13	-2.2102	9.8493	0.41046	0.1455:0.4356:0.0:0.4189	.	1124;1124	F5H5M3;O60522	.;TDRD6_HUMAN	V	1124	ENSP00000443299:L1124V;ENSP00000346065:L1124V	ENSP00000346065:L1124V	L	+	1	2	TDRD6	46767194	0.001000	0.12720	0.301000	0.25044	0.244000	0.25665	-0.130000	0.10498	-2.050000	0.00905	-2.200000	0.00306	TTG	-	NULL		0.358	TDRD6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TDRD6	protein_coding	OTTHUMT00000040800.1	T	XM_166443	-		46659235	+1	no_errors	ENST00000316081	ensembl	human	known	74_37	missense	SNP	0.000	G
HCN4	10021	genome.wustl.edu	37	15	73617298	73617298	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr15:73617298C>T	ENST00000261917.3	-	6	2969	c.1976G>A	c.(1975-1977)gGa>gAa	p.G659E		NM_005477.2	NP_005468.1	Q9Y3Q4	HCN4_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 4	659					blood circulation (GO:0008015)|cation transport (GO:0006812)|cellular response to cAMP (GO:0071320)|cellular response to cGMP (GO:0071321)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|potassium ion transmembrane transport (GO:0071805)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)|terminal bouton (GO:0043195)	cAMP binding (GO:0030552)|cation channel activity (GO:0005261)|identical protein binding (GO:0042802)|intracellular cAMP activated cation channel activity (GO:0005222)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)			NS(2)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(13)|liver(1)|lung(18)|ovary(6)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	55				COAD - Colon adenocarcinoma(1;0.142)		TGCCTCACCTCCAAAGTAGGA	0.627																																																	0								ENSG00000138622						48.0	44.0	46.0					15																	73617298		2198	4297	6495	HCN4	SO:0001583	missense	0			-	HGNC	AJ132429	CCDS10248.1	15q24.1	2011-07-05			ENSG00000138622	ENSG00000138622		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	16882	protein-coding gene	gene with protein product		605206				10228147, 10430953, 16382102	Standard	NM_005477		Approved		uc002avp.3	Q9Y3Q4	OTTHUMG00000137563	ENST00000261917.3:c.1976G>A	15.37:g.73617298C>T	ENSP00000261917:p.Gly659Glu	Somatic	0	36	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	21	27.59	Q9UMQ7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_N,pfam_cNMP-bd_dom,pfam_Ion_trans_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG/ELK/ERG,pfscan_cNMP-bd_dom	p.G659E	ENST00000261917.3	37	c.1976	CCDS10248.1	15	.	.	.	.	.	.	.	.	.	.	C	18.72	3.684655	0.68157	.	.	ENSG00000138622	ENST00000261917	D	0.99667	-6.34	3.58	3.58	0.41010	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (3);	.	.	.	.	D	0.99819	0.9920	H	0.99312	4.51	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96386	0.9285	9	0.87932	D	0	.	15.3802	0.74648	0.0:1.0:0.0:0.0	.	659	Q9Y3Q4	HCN4_HUMAN	E	659	ENSP00000261917:G659E	ENSP00000261917:G659E	G	-	2	0	HCN4	71404351	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	7.522000	0.81844	1.841000	0.53522	0.491000	0.48974	GGA	-	pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom		0.627	HCN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCN4	protein_coding	OTTHUMT00000268900.2	C	NM_005477	-		73617298	-1	no_errors	ENST00000261917	ensembl	human	known	74_37	missense	SNP	1.000	T
IFI35	3430	genome.wustl.edu	37	17	41165591	41165591	+	Silent	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr17:41165591C>T	ENST00000415816.2	+	5	697	c.474C>T	c.(472-474)ttC>ttT	p.F158F	IFI35_ENST00000438323.2_Silent_p.F160F	NM_005533.4	NP_005524.2	P80217	IN35_HUMAN	interferon-induced protein 35	158					cytokine-mediated signaling pathway (GO:0019221)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(2)|ovary(1)	8		Breast(137;0.00499)		BRCA - Breast invasive adenocarcinoma(366;0.157)		TAGAGATCTTCTTTGGCAAGA	0.577																																																	0								ENSG00000068079						246.0	244.0	245.0					17																	41165591		2203	4300	6503	IFI35	SO:0001819	synonymous_variant	0			-	HGNC	BC001356	CCDS11450.1	17q21	2006-04-05			ENSG00000068079	ENSG00000068079			5399	protein-coding gene	gene with protein product		600735					Standard	NM_005533		Approved	IFP35	uc021txx.1	P80217	OTTHUMG00000167720	ENST00000415816.2:c.474C>T	17.37:g.41165591C>T		Somatic	0	23	0.00		0.41568620468393047	184	24.28	59	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	9	30.77	C9JGX1|Q92984|Q99537|Q9BV98	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Nmi/IFP35_dom,pfam_Nmi/IFP35_N	p.F160	ENST00000415816.2	37	c.480		17																																																																																			-	pfam_Nmi/IFP35_dom		0.577	IFI35-002	KNOWN	basic|appris_candidate	protein_coding	IFI35	protein_coding	OTTHUMT00000395851.1	C	NM_005533	-		41165591	+1	no_errors	ENST00000438323	ensembl	human	known	74_37	silent	SNP	1.000	T
USH2A	7399	genome.wustl.edu	37	1	216373131	216373131	+	Missense_Mutation	SNP	C	C	T	rs202247801		TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr1:216373131C>T	ENST00000307340.3	-	17	4035	c.3649G>A	c.(3649-3651)Gat>Aat	p.D1217N	USH2A_ENST00000366943.2_Missense_Mutation_p.D1217N|RP5-1099E6.3_ENST00000420867.1_RNA|USH2A_ENST00000366942.3_Missense_Mutation_p.D1217N	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	1217	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)	p.D1217N(1)		NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		ACAGAAAAATCGTACTTGGCA	0.517										HNSCC(13;0.011)																																							1	Substitution - Missense(1)	upper_aerodigestive_tract(1)						ENSG00000042781						84.0	87.0	86.0					1																	216373131		2203	4300	6503	USH2A	SO:0001583	missense	0			-	HGNC	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.3649G>A	1.37:g.216373131C>T	ENSP00000305941:p.Asp1217Asn	Somatic	0	68	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	53	18.46	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Fibronectin_type3,pfam_EGF_laminin,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_LamG-like,smart_Laminin_N,smart_EGF_laminin,smart_Fibronectin_type3,smart_Laminin_G,pfscan_EGF_laminin,pfscan_Fibronectin_type3,pfscan_Laminin_G,pfscan_Laminin_N	p.D1217N	ENST00000307340.3	37	c.3649	CCDS31025.1	1	.	.	.	.	.	.	.	.	.	.	C	0.664	-0.804487	0.02819	.	.	ENSG00000042781	ENST00000307340;ENST00000366943;ENST00000366942	T;T;T	0.55052	0.54;0.54;0.54	5.87	-6.0	0.02206	Fibronectin, type III (4);Immunoglobulin-like fold (1);	1.695440	0.03437	N	0.208746	T	0.16257	0.0391	N	0.01352	-0.895	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.04013	0.0;0.001	T	0.11717	-1.0576	10	0.11182	T	0.66	.	0.3445	0.00339	0.2336:0.2568:0.1986:0.3111	.	1217;1217	O75445-2;O75445	.;USH2A_HUMAN	N	1217	ENSP00000305941:D1217N;ENSP00000355910:D1217N;ENSP00000355909:D1217N	ENSP00000305941:D1217N	D	-	1	0	USH2A	214439754	0.463000	0.25799	0.001000	0.08648	0.023000	0.10783	0.692000	0.25482	-0.944000	0.03686	-2.735000	0.00129	GAT	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.517	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USH2A	protein_coding	OTTHUMT00000128138.1	C	NM_007123	-		216373131	-1	no_errors	ENST00000366943	ensembl	human	known	74_37	missense	SNP	0.000	T
TMEM63A	9725	genome.wustl.edu	37	1	226049967	226049967	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr1:226049967G>A	ENST00000366835.3	-	13	1306	c.1036C>T	c.(1036-1038)Ccc>Tcc	p.P346S	TMEM63A_ENST00000537914.1_Missense_Mutation_p.P20S|TMEM63A_ENST00000474478.1_5'UTR	NM_014698.2	NP_055513.2	O94886	CSCL1_HUMAN	transmembrane protein 63A	346					ion transport (GO:0006811)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	nucleotide binding (GO:0000166)			breast(2)|endometrium(3)|large_intestine(5)|lung(6)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	24	Breast(184;0.197)					ATTCCCAGGGGCTGGTCCTGG	0.572																																																	0								ENSG00000196187						136.0	107.0	117.0					1																	226049967		2203	4300	6503	TMEM63A	SO:0001583	missense	0			-	HGNC		CCDS31042.1	1q42.12	2008-02-05	2005-07-25	2005-07-25	ENSG00000196187	ENSG00000196187			29118	protein-coding gene	gene with protein product			"""KIAA0792"""	KIAA0792		9872452, 9455484	Standard	NM_014698		Approved		uc001hpm.2	O94886	OTTHUMG00000037442	ENST00000366835.3:c.1036C>T	1.37:g.226049967G>A	ENSP00000355800:p.Pro346Ser	Somatic	0	67	0.00		0.41568620468393047	6	40.00	4	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	48	20.00	Q53GI7|Q5TE96|Q8N2U2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF221	p.P346S	ENST00000366835.3	37	c.1036	CCDS31042.1	1	.	.	.	.	.	.	.	.	.	.	G	18.43	3.621386	0.66787	.	.	ENSG00000196187	ENST00000366835;ENST00000537914	T	0.37058	1.22	5.71	4.8	0.61643	Nucleotide-binding, alpha-beta plait (1);	0.143303	0.64402	N	0.000004	T	0.52419	0.1733	M	0.82056	2.57	0.58432	D	0.999999	D	0.54964	0.969	P	0.53401	0.725	T	0.54768	-0.8244	10	0.27082	T	0.32	-28.4403	14.79	0.69833	0.0691:0.0:0.9309:0.0	.	346	O94886	TM63A_HUMAN	S	346;20	ENSP00000355800:P346S	ENSP00000355800:P346S	P	-	1	0	TMEM63A	224116590	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	7.784000	0.85713	1.433000	0.47394	-0.266000	0.10368	CCC	-	NULL		0.572	TMEM63A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM63A	protein_coding	OTTHUMT00000091154.2	G	NM_014698	-		226049967	-1	no_errors	ENST00000366835	ensembl	human	known	74_37	missense	SNP	1.000	A
ERCC8	1161	genome.wustl.edu	37	5	60198336	60198336	+	Splice_Site	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr5:60198336C>T	ENST00000265038.5	-	7	593		c.e7-1		ERCC8_ENST00000543101.1_Splice_Site|ERCC8_ENST00000462279.1_Splice_Site|ERCC8_ENST00000426742.2_Splice_Site	NM_000082.3	NP_000073.1	Q13216	ERCC8_HUMAN	excision repair cross-complementation group 8						cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|nucleotide-excision repair (GO:0006289)|positive regulation of DNA repair (GO:0045739)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein autoubiquitination (GO:0051865)|protein polyubiquitination (GO:0000209)|response to oxidative stress (GO:0006979)|response to UV (GO:0009411)|response to X-ray (GO:0010165)|transcription-coupled nucleotide-excision repair (GO:0006283)	Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleotide-excision repair complex (GO:0000109)|nucleus (GO:0005634)|protein complex (GO:0043234)	protein complex binding (GO:0032403)			breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)	14		Lung NSC(810;1.51e-06)|Prostate(74;0.0322)|Ovarian(174;0.0481)|Breast(144;0.077)				TGTCTGTGACCTGCAAATACA	0.338																																																	0			GRCh37	CS073474	ERCC8	S		ENSG00000049167						94.0	98.0	97.0					5																	60198336		2203	4297	6500	ERCC8	SO:0001630	splice_region_variant	0			-	HGNC	U28413	CCDS3978.1	5q12.1	2014-09-17	2014-03-07		ENSG00000049167	ENSG00000049167		"""WD repeat domain containing"""	3439	protein-coding gene	gene with protein product		609412	"""Cockayne syndrome 1 (classical)"", ""excision repair cross-complementing rodent repair deficiency, complementation group 8"""	CKN1		8596535	Standard	NM_000082		Approved	CSA	uc003jsm.3	Q13216	OTTHUMG00000097741	ENST00000265038.5:c.551-1G>A	5.37:g.60198336C>T		Somatic	0	130	0.00		0.41568620468393047	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	67	17.28	B2RB64|Q6FHX5|Q96GB9	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e7-1	ENST00000265038.5	37	c.551-1	CCDS3978.1	5	.	.	.	.	.	.	.	.	.	.	C	23.2	4.390282	0.82902	.	.	ENSG00000049167	ENST00000426742;ENST00000265038;ENST00000543101;ENST00000536596;ENST00000439176	.	.	.	5.43	5.43	0.79202	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.414	0.87494	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ERCC8	60234093	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	6.685000	0.74543	2.529000	0.85273	0.655000	0.94253	.	-	-		0.338	ERCC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERCC8	protein_coding	OTTHUMT00000214971.2	C	NM_000082	-	Intron	60198336	-1	no_errors	ENST00000265038	ensembl	human	known	74_37	splice_site	SNP	1.000	T
AK9	221264	genome.wustl.edu	37	6	109837058	109837058	+	Splice_Site	SNP	A	A	C			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr6:109837058A>C	ENST00000424296.2	-	31	4142		c.e31+1			NM_001145128.2	NP_001138600.2	Q5TCS8	KAD9_HUMAN	adenylate kinase 9						ADP phosphorylation (GO:0006757)|AMP phosphorylation (GO:0006756)|CDP phosphorylation (GO:0061508)|CMP phosphorylation (GO:0061566)|dADP phosphorylation (GO:0006174)|dAMP phosphorylation (GO:0061565)|dCDP phosphorylation (GO:0061570)|dCMP phosphorylation (GO:0061567)|dGDP phosphorylation (GO:0006186)|GDP phosphorylation (GO:0061568)|TDP phosphorylation (GO:0061571)|UDP phosphorylation (GO:0061569)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|nucleoside diphosphate kinase activity (GO:0004550)|nucleoside phosphate kinase activity (GO:0050145)										TGCTGAAATTACCTTTACAGG	0.358																																																	0								ENSG00000155085						124.0	101.0	108.0					6																	109837058		692	1591	2283	AK9	SO:0001630	splice_region_variant	0			-	HGNC	AK131244, BC146443, BC087860	CCDS5077.1, CCDS55048.1	6q21	2013-04-29	2013-04-29	2013-04-29			2.7.4.3		33814	protein-coding gene	gene with protein product		615358	"""chromosome 6 open reading frame 224"", ""adenylate kinase domain containing 2"", ""chromosome 6 open reading frame 199"", ""adenylate kinase domain containing 1"""	C6orf224, AKD2, C6orf199, AKD1		23416111	Standard	NM_145025		Approved	FLJ42177, FLJ25791, dJ70A9.1, MGC26954		Q5TCS8		ENST00000424296.2:c.4065+1T>G	6.37:g.109837058A>C		Somatic	0	116	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	38	32.14	A6NL75|B2RDJ0|B6ZDM7|Q3MIS4|Q5I0W8|Q6ZNF1|Q6ZVR7|Q8N7C6|Q8WW00|Q96NF4	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e30+2	ENST00000424296.2	37	c.4065+2	CCDS55048.1	6	.	.	.	.	.	.	.	.	.	.	A	21.5	4.152565	0.78001	.	.	ENSG00000155085	ENST00000424296;ENST00000470564	.	.	.	5.55	5.55	0.83447	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.7043	0.77565	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	AKD1	109943751	1.000000	0.71417	0.998000	0.56505	0.841000	0.47740	8.331000	0.90022	2.127000	0.65507	0.528000	0.53228	.	-	-		0.358	AK9-202	KNOWN	basic|appris_principal|CCDS	protein_coding	AK9	protein_coding		A	NM_001145128	-	Intron	109837058	-1	no_errors	ENST00000424296	ensembl	human	known	74_37	splice_site	SNP	1.000	C
DHX32	55760	genome.wustl.edu	37	10	127569269	127569269	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr10:127569269G>A	ENST00000284690.3	-	1	615	c.125C>T	c.(124-126)cCc>cTc	p.P42L	DHX32_ENST00000284688.6_Missense_Mutation_p.P42L	NM_018180.2	NP_060650.2	Q7L7V1	DHX32_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 32	42						mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(2)|stomach(1)	29		all_lung(145;0.00751)|Lung NSC(174;0.0115)|Colorectal(57;0.0846)|all_neural(114;0.0936)				TCCATCAAAGGGGTTAAGTTC	0.403																																																	0								ENSG00000089876						106.0	107.0	107.0					10																	127569269		2203	4300	6503	DHX32	SO:0001583	missense	0			-	HGNC		CCDS7652.1	10q26.11-q26.2	2008-01-07	2004-01-29	2004-01-30	ENSG00000089876	ENSG00000089876		"""DEAH-boxes"""	16717	protein-coding gene	gene with protein product		607960	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 32"""	DDX32			Standard	NM_018180		Approved	FLJ10889, FLJ10694, DHLP1	uc001ljf.1	Q7L7V1	OTTHUMG00000019238	ENST00000284690.3:c.125C>T	10.37:g.127569269G>A	ENSP00000284690:p.Pro42Leu	Somatic	0	90	0.00		0.41568620468393047	3	25.00	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	32	11.11	A8MSV2|D3DRF9|Q49AG5|Q5T3L0|Q5T3L5|Q96NY1|Q9BUN0|Q9H769|Q9NSL5|Q9NV74|Q9NVJ7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Helicase-assoc_dom,pfam_DUF1605,superfamily_P-loop_NTPase,smart_Helicase-assoc_dom,pfscan_Helicase_ATP-bd	p.P42L	ENST00000284690.3	37	c.125	CCDS7652.1	10	.	.	.	.	.	.	.	.	.	.	G	17.09	3.299968	0.60195	.	.	ENSG00000089876	ENST00000284690;ENST00000284688;ENST00000415732	T;T;T	0.16743	2.32;2.32;2.32	4.95	4.95	0.65309	.	0.119914	0.64402	D	0.000019	T	0.22666	0.0547	M	0.71581	2.175	0.39010	D	0.959529	P	0.43094	0.799	B	0.35859	0.212	T	0.24404	-1.0161	10	0.87932	D	0	-22.4599	18.3724	0.90411	0.0:0.0:1.0:0.0	.	42	Q7L7V1	DHX32_HUMAN	L	42	ENSP00000284690:P42L;ENSP00000284688:P42L;ENSP00000406781:P42L	ENSP00000284688:P42L	P	-	2	0	DHX32	127559259	1.000000	0.71417	0.997000	0.53966	0.988000	0.76386	6.170000	0.71920	2.561000	0.86390	0.561000	0.74099	CCC	-	superfamily_P-loop_NTPase		0.403	DHX32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHX32	protein_coding	OTTHUMT00000050945.2	G	NM_018180	-		127569269	-1	no_errors	ENST00000284690	ensembl	human	known	74_37	missense	SNP	1.000	A
COL6A6	131873	genome.wustl.edu	37	3	130293270	130293270	+	Missense_Mutation	SNP	G	G	T	rs148700491	byFrequency	TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr3:130293270G>T	ENST00000358511.6	+	7	3479	c.3448G>T	c.(3448-3450)Ggg>Tgg	p.G1150W	COL6A6_ENST00000453409.2_Missense_Mutation_p.G1150W	NM_001102608.1	NP_001096078.1	A6NMZ7	CO6A6_HUMAN	collagen, type VI, alpha 6	1150	Nonhelical region.|VWFA 6. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(30)|lung(57)|ovary(8)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	134						TCAGATCACCGGGACTGCAGA	0.532																																																	0								ENSG00000206384						60.0	64.0	62.0					3																	130293270		1999	4167	6166	COL6A6	SO:0001583	missense	0			-	HGNC	AL713792	CCDS46911.1	3q22.1	2013-01-16			ENSG00000206384	ENSG00000206384		"""Collagens"""	27023	protein-coding gene	gene with protein product							Standard	NM_001102608		Approved		uc010htl.3	A6NMZ7	OTTHUMG00000159653	ENST00000358511.6:c.3448G>T	3.37:g.130293270G>T	ENSP00000351310:p.Gly1150Trp	Somatic	0	50	0.00		0.41568620468393047	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	A7DZQ0|A7DZQ1|A7DZQ2|Q69YT0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_VWF_A,pfam_Collagen,smart_VWF_A,pfscan_VWF_A	p.G1150W	ENST00000358511.6	37	c.3448	CCDS46911.1	3	.	.	.	.	.	.	.	.	.	.	G	16.84	3.233456	0.58886	.	.	ENSG00000206384	ENST00000358511;ENST00000453409	T;T	0.79554	-1.28;-1.28	5.18	5.18	0.71444	von Willebrand factor, type A (3);	0.000000	0.56097	D	0.000023	D	0.92492	0.7616	M	0.93197	3.39	0.54753	D	0.999985	D	0.89917	1.0	D	0.97110	1.0	D	0.93644	0.6967	10	0.54805	T	0.06	.	18.6465	0.91411	0.0:0.0:1.0:0.0	.	1150	A6NMZ7	CO6A6_HUMAN	W	1150	ENSP00000351310:G1150W;ENSP00000399236:G1150W	ENSP00000351310:G1150W	G	+	1	0	COL6A6	131775960	1.000000	0.71417	0.301000	0.25044	0.260000	0.26232	6.888000	0.75622	2.572000	0.86782	0.655000	0.94253	GGG	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A		0.532	COL6A6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	COL6A6	protein_coding	OTTHUMT00000356705.5	G	NM_001102608	-		130293270	+1	no_errors	ENST00000358511	ensembl	human	known	74_37	missense	SNP	0.994	T
TLR3	7098	genome.wustl.edu	37	4	187003983	187003983	+	Silent	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr4:187003983G>A	ENST00000296795.3	+	4	1247	c.1143G>A	c.(1141-1143)ctG>ctA	p.L381L	TLR3_ENST00000504367.1_Silent_p.L104L	NM_003265.2	NP_003256.1	O15455	TLR3_HUMAN	toll-like receptor 3	381					activation of NF-kappaB-inducing kinase activity (GO:0007250)|cellular response to drug (GO:0035690)|cellular response to exogenous dsRNA (GO:0071360)|cellular response to interferon-beta (GO:0035458)|cellular response to interferon-gamma (GO:0071346)|cellular response to mechanical stimulus (GO:0071260)|defense response to bacterium (GO:0042742)|defense response to virus (GO:0051607)|detection of virus (GO:0009597)|extrinsic apoptotic signaling pathway (GO:0097191)|hyperosmotic response (GO:0006972)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|male gonad development (GO:0008584)|microglial cell activation involved in immune response (GO:0002282)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|necroptotic signaling pathway (GO:0097527)|negative regulation of osteoclast differentiation (GO:0045671)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of apoptotic process (GO:0043065)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of chemokine production (GO:0032722)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type III interferon production (GO:0034346)|response to exogenous dsRNA (GO:0043330)|signal transduction (GO:0007165)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|endolysosome membrane (GO:0036020)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	double-stranded RNA binding (GO:0003725)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|endometrium(5)|large_intestine(8)|lung(8)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	29		all_cancers(14;4.27e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.0066)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.47e-11)|BRCA - Breast invasive adenocarcinoma(30;1.14e-05)|GBM - Glioblastoma multiforme(59;0.000107)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.16)		TGATAAACCTGAAATACTTAA	0.338																																																	0								ENSG00000164342						59.0	57.0	58.0					4																	187003983		2203	4300	6503	TLR3	SO:0001819	synonymous_variant	0			-	HGNC	U88879	CCDS3846.1	4q35	2014-09-17				ENSG00000164342		"""CD molecules"""	11849	protein-coding gene	gene with protein product		603029				9435236	Standard	NM_003265		Approved	CD283	uc003iyq.3	O15455		ENST00000296795.3:c.1143G>A	4.37:g.187003983G>A		Somatic	0	35	0.00		0.41568620468393047	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	15	16.67	B2RAI7|B7Z7K0|E6Y0F0|E6Y0F1|E9PGH4|Q4VAL2|Q504W0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_TIR_dom,pfam_Leu-rich_rpt,superfamily_TIR_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_TIR_dom,pfscan_TIR_dom	p.L381	ENST00000296795.3	37	c.1143	CCDS3846.1	4																																																																																			-	smart_Leu-rich_rpt_typical-subtyp		0.338	TLR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLR3	protein_coding	OTTHUMT00000360313.4	G		-		187003983	+1	no_errors	ENST00000296795	ensembl	human	known	74_37	silent	SNP	0.939	A
FAT3	120114	genome.wustl.edu	37	11	92523348	92523348	+	Silent	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr11:92523348C>T	ENST00000298047.6	+	7	4592	c.4575C>T	c.(4573-4575)gaC>gaT	p.D1525D	FAT3_ENST00000409404.2_Silent_p.D1525D|FAT3_ENST00000525166.1_Silent_p.D1375D			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	1525	Cadherin 14. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				AGAGGCTGGACCATGAGGCCC	0.493										TCGA Ovarian(4;0.039)																																							0								ENSG00000165323						144.0	140.0	141.0					11																	92523348		2017	4192	6209	FAT3	SO:0001819	synonymous_variant	0			-	HGNC	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.4575C>T	11.37:g.92523348C>T		Somatic	0	17	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	18	21.74	B5MDB0|Q96AU6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Laminin_G,pfam_EGF-like_Ca-bd_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,smart_EG-like_dom,smart_Laminin_G,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.D1525	ENST00000298047.6	37	c.4575		11																																																																																			-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.493	FAT3-201	KNOWN	basic	protein_coding	FAT3	protein_coding		C	NM_001008781	-		92523348	+1	no_errors	ENST00000298047	ensembl	human	known	74_37	silent	SNP	1.000	T
N6AMT1	29104	genome.wustl.edu	37	21	30248727	30248727	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr21:30248727G>A	ENST00000303775.5	-	6	650	c.625C>T	c.(625-627)Ctc>Ttc	p.L209F	N6AMT1_ENST00000351429.3_Missense_Mutation_p.L181F	NM_013240.4	NP_037372	Q9Y5N5	HEMK2_HUMAN	N-6 adenine-specific DNA methyltransferase 1 (putative)	209					positive regulation of cell growth (GO:0030307)|protein methylation (GO:0006479)	protein complex (GO:0043234)	nucleic acid binding (GO:0003676)|protein methyltransferase activity (GO:0008276)	p.L209I(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(2)	12						GTGAACTTGAGGACTGAAAGA	0.368																																																	1	Substitution - Missense(1)	lung(1)						ENSG00000156239						190.0	164.0	173.0					21																	30248727		2203	4300	6503	N6AMT1	SO:0001583	missense	0			-	HGNC	AF139682	CCDS33525.1, CCDS33526.1	21q21.3	2006-12-14	2006-12-14	2006-12-14	ENSG00000156239	ENSG00000156239	2.1.1.72		16021	protein-coding gene	gene with protein product		614553	"""chromosome 21 open reading frame 127"", ""HemK methyltransferase family member 2"""	C21orf127, HEMK2			Standard	NM_013240		Approved	PRED28, N6AMT, MTQ2	uc002ymo.2	Q9Y5N5	OTTHUMG00000078750	ENST00000303775.5:c.625C>T	21.37:g.30248727G>A	ENSP00000303584:p.Leu209Phe	Somatic	0	58	0.00		0.41568620468393047	12	33.33	6	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	34	15.00	Q96F73	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Small_mtfrase_dom,pfam_Ribosomal-L11_MeTrfase_PrmA,tigrfam_PrmC_related	p.L209F	ENST00000303775.5	37	c.625	CCDS33526.1	21	.	.	.	.	.	.	.	.	.	.	G	19.44	3.828184	0.71143	.	.	ENSG00000156239	ENST00000303775;ENST00000351429	T;T	0.28454	2.29;1.61	4.93	4.93	0.64822	.	0.000000	0.64402	D	0.000001	T	0.50120	0.1597	M	0.85373	2.75	0.58432	D	0.999991	D;D	0.57899	0.981;0.969	P;P	0.52758	0.664;0.708	T	0.57636	-0.7777	10	0.59425	D	0.04	-18.3497	13.507	0.61489	0.0:0.0:1.0:0.0	.	181;209	Q9Y5N5-2;Q9Y5N5	.;HEMK2_HUMAN	F	209;181	ENSP00000303584:L209F;ENSP00000286764:L181F	ENSP00000303584:L209F	L	-	1	0	N6AMT1	29170598	1.000000	0.71417	1.000000	0.80357	0.809000	0.45718	3.868000	0.56055	2.564000	0.86499	0.467000	0.42956	CTC	-	tigrfam_PrmC_related		0.368	N6AMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	N6AMT1	protein_coding	OTTHUMT00000171738.1	G	NM_013240	-		30248727	-1	no_errors	ENST00000303775	ensembl	human	known	74_37	missense	SNP	1.000	A
TTN	7273	genome.wustl.edu	37	2	179636198	179636198	+	Splice_Site	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr2:179636198C>T	ENST00000591111.1	-	34	8080	c.7856G>A	c.(7855-7857)gGt>gAt	p.G2619D	TTN_ENST00000342992.6_Splice_Site_p.G2619D|TTN_ENST00000359218.5_Splice_Site_p.G2573D|TTN_ENST00000460472.2_Splice_Site_p.G2573D|TTN-AS1_ENST00000610005.1_RNA|TTN_ENST00000589042.1_Splice_Site_p.G2619D|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000584485.1_RNA|TTN_ENST00000342175.6_Splice_Site_p.G2573D|TTN_ENST00000360870.5_Splice_Site_p.G2619D			Q8WZ42	TITIN_HUMAN	titin	12942					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GATGGCCCCACCTTTGGAACA	0.408																																																	0								ENSG00000155657						90.0	80.0	83.0					2																	179636198		2203	4300	6503	TTN	SO:0001630	splice_region_variant	0			-	HGNC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.7856-1G>A	2.37:g.179636198C>T		Somatic	0	93	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	52	22.39	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.G2619D	ENST00000591111.1	37	c.7856		2	.	.	.	.	.	.	.	.	.	.	C	23.8	4.457479	0.84317	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	T;T;T;T;T	0.39229	1.09;1.09;1.09;1.09;1.09	6.17	6.17	0.99709	Ribonuclease H-like (1);	.	.	.	.	T	0.69115	0.3075	M	0.77103	2.36	0.51233	D	0.99991	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.999;0.999;0.999;0.999;1.0	T	0.69320	-0.5176	9	0.87932	D	0	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	2573;2573;2573;2619;2619	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	D	2619;2573;2573;2573;2573;2619	ENSP00000343764:G2619D;ENSP00000434586:G2573D;ENSP00000340554:G2573D;ENSP00000352154:G2573D;ENSP00000354117:G2619D	ENSP00000340554:G2573D	G	-	2	0	TTN	179344443	1.000000	0.71417	0.942000	0.38095	0.645000	0.38454	7.818000	0.86416	2.941000	0.99782	0.655000	0.94253	GGT	-	superfamily_RNaseH-like_dom		0.408	TTN-019	PUTATIVE	basic	protein_coding	TTN	protein_coding	OTTHUMT00000460310.1	C	NM_133378	-	Missense_Mutation	179636198	-1	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	SNP	1.000	T
MAGEC1	9947	genome.wustl.edu	37	X	140994128	140994128	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chrX:140994128C>T	ENST00000285879.4	+	4	1224	c.938C>T	c.(937-939)tCc>tTc	p.S313F	MAGEC1_ENST00000406005.2_Intron	NM_005462.4	NP_005453.2	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	313										breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(22)|lung(60)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(1)	127	Acute lymphoblastic leukemia(192;6.56e-05)					TCCTCCTCCTCCACTTTATTG	0.483										HNSCC(15;0.026)																																							0								ENSG00000155495						131.0	125.0	127.0					X																	140994128		2197	4270	6467	MAGEC1	SO:0001583	missense	0			-	HGNC	AF064589	CCDS35417.1	Xq26	2009-03-18			ENSG00000155495	ENSG00000155495			6812	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 1"""	300223				9485030, 9618514	Standard	NM_005462		Approved	MAGE-C1, CT7, MGC39366, CT7.1	uc004fbt.3	O60732	OTTHUMG00000022569	ENST00000285879.4:c.938C>T	X.37:g.140994128C>T	ENSP00000285879:p.Ser313Phe	Somatic	0	122	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	49	37.18	A0PK03|O75451|Q8TCV4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MAGE,pfscan_MAGE	p.S313F	ENST00000285879.4	37	c.938	CCDS35417.1	X	.	.	.	.	.	.	.	.	.	.	c	7.593	0.671135	0.14776	.	.	ENSG00000155495	ENST00000285879;ENST00000370511;ENST00000370510	T;T	0.18657	4.2;2.2	.	.	.	.	.	.	.	.	T	0.13072	0.0317	N	0.08118	0	0.37731	D	0.925261	D	0.54964	0.969	P	0.49361	0.608	T	0.19451	-1.0305	8	0.87932	D	0	.	5.9409	0.19192	0.0:0.9994:0.0:6.0E-4	.	313	O60732	MAGC1_HUMAN	F	313;115;114	ENSP00000285879:S313F;ENSP00000359542:S115F	ENSP00000285879:S313F	S	+	2	0	MAGEC1	140821794	0.002000	0.14202	0.027000	0.17364	0.027000	0.11550	0.428000	0.21395	0.148000	0.19059	0.150000	0.16122	TCC	-	NULL		0.483	MAGEC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAGEC1	protein_coding	OTTHUMT00000058604.1	C	NM_005462	-		140994128	+1	no_errors	ENST00000285879	ensembl	human	known	74_37	missense	SNP	0.259	T
MYH2	4620	genome.wustl.edu	37	17	10448735	10448735	+	Missense_Mutation	SNP	C	C	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr17:10448735C>A	ENST00000245503.5	-	5	817	c.433G>T	c.(433-435)Ggc>Tgc	p.G145C	CTC-297N7.11_ENST00000587182.2_RNA|MYH2_ENST00000397183.2_Missense_Mutation_p.G145C|MYH2_ENST00000532183.2_Missense_Mutation_p.G145C	NM_017534.5	NP_060004.3	Q9UKX2	MYH2_HUMAN	myosin, heavy chain 2, skeletal muscle, adult	145	Myosin motor.				Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|plasma membrane repair (GO:0001778)|response to activity (GO:0014823)	A band (GO:0031672)|actomyosin contractile ring (GO:0005826)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|protein complex (GO:0043234)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(99)|ovary(6)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(4)	176						CGCTTTTTGCCTCGGTAGGCT	0.532																																																	0								ENSG00000125414						138.0	140.0	140.0					17																	10448735		2203	4300	6503	MYH2	SO:0001583	missense	0			-	HGNC		CCDS11156.1	17p13.1	2014-02-04	2006-09-29		ENSG00000125414	ENSG00000125414		"""Myosins / Myosin superfamily : Class II"""	7572	protein-coding gene	gene with protein product		160740	"""myosin, heavy polypeptide 2, skeletal muscle, adult"", ""inclusion body myopathy 3, autosomal dominant"""	IBM3		7545970, 11889243	Standard	NM_001100112		Approved	MYH2A, MYHSA2, MyHC-IIa, MYHas8, MyHC-2A	uc010coi.3	Q9UKX2	OTTHUMG00000130363	ENST00000245503.5:c.433G>T	17.37:g.10448735C>A	ENSP00000245503:p.Gly145Cys	Somatic	0	159	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	54	21.74	A0AVL4|Q14322|Q16229|Q567P6|Q86T56	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,superfamily_Ribosomal_L29,superfamily_t-SNARE,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.G145C	ENST00000245503.5	37	c.433	CCDS11156.1	17	.	.	.	.	.	.	.	.	.	.	C	16.86	3.239110	0.58995	.	.	ENSG00000125414	ENST00000532183;ENST00000245503;ENST00000397183;ENST00000420805	D;D;D;D	0.92199	-2.99;-2.99;-2.99;-2.99	5.71	5.71	0.89125	Myosin head, motor domain (2);	0.000000	0.40064	U	0.001181	D	0.97766	0.9267	H	0.97415	4	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.97110	1.0;0.99	D	0.98802	1.0740	10	0.87932	D	0	.	18.8439	0.92196	0.0:1.0:0.0:0.0	.	145;145	Q567P6;Q9UKX2	.;MYH2_HUMAN	C	145	ENSP00000433944:G145C;ENSP00000245503:G145C;ENSP00000380367:G145C;ENSP00000399348:G145C	ENSP00000245503:G145C	G	-	1	0	MYH2	10389460	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.815000	0.86186	2.706000	0.92434	0.650000	0.86243	GGC	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom		0.532	MYH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH2	protein_coding	OTTHUMT00000252726.3	C	NM_017534	-		10448735	-1	no_errors	ENST00000245503	ensembl	human	known	74_37	missense	SNP	1.000	A
LTV1	84946	genome.wustl.edu	37	6	144178506	144178506	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr6:144178506C>T	ENST00000367576.5	+	5	598	c.464C>T	c.(463-465)cCa>cTa	p.P155L		NM_032860.3	NP_116249.2	Q96GA3	LTV1_HUMAN	LTV1 ribosome biogenesis factor	155	Asp-rich.					cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(2)|endometrium(1)|large_intestine(2)|lung(5)|ovary(2)|prostate(1)	13				OV - Ovarian serous cystadenocarcinoma(155;2.72e-06)|GBM - Glioblastoma multiforme(68;0.0372)		TTTGATGATCCAGATAATCTG	0.398																																																	0								ENSG00000135521						308.0	299.0	302.0					6																	144178506		2203	4300	6503	LTV1	SO:0001583	missense	0			-	HGNC	BC009855	CCDS5201.1	6q24.2	2014-02-03	2014-02-03	2006-02-06	ENSG00000135521	ENSG00000135521			21173	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 93"", ""LTV1 homolog (S. cerevisiae)"""	C6orf93			Standard	NM_032860		Approved	FLJ14909, dJ468K18.4	uc003qjs.3	Q96GA3	OTTHUMG00000015733	ENST00000367576.5:c.464C>T	6.37:g.144178506C>T	ENSP00000356548:p.Pro155Leu	Somatic	0	58	0.00		0.41568620468393047	12	7.69	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	28	15.15	Q96JX8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_LTV	p.P155L	ENST00000367576.5	37	c.464	CCDS5201.1	6	.	.	.	.	.	.	.	.	.	.	C	30	5.056871	0.93846	.	.	ENSG00000135521	ENST00000367576	.	.	.	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	D	0.82815	0.5119	M	0.88377	2.95	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.84098	0.0394	9	0.48119	T	0.1	.	19.07	0.93130	0.0:1.0:0.0:0.0	.	155	Q96GA3	LTV1_HUMAN	L	155	.	ENSP00000356548:P155L	P	+	2	0	LTV1	144220199	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	7.441000	0.80485	2.522000	0.85027	0.585000	0.79938	CCA	-	pfam_LTV		0.398	LTV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LTV1	protein_coding	OTTHUMT00000042532.1	C	NM_032860	-		144178506	+1	no_errors	ENST00000367576	ensembl	human	known	74_37	missense	SNP	1.000	T
TTN	7273	genome.wustl.edu	37	2	179636199	179636199	+	Splice_Site	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr2:179636199C>T	ENST00000591111.1	-	34	8080		c.e34-1		TTN_ENST00000342992.6_Splice_Site|TTN_ENST00000359218.5_Splice_Site|TTN_ENST00000460472.2_Splice_Site|TTN-AS1_ENST00000610005.1_RNA|TTN_ENST00000589042.1_Splice_Site|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000584485.1_RNA|TTN_ENST00000342175.6_Splice_Site|TTN_ENST00000360870.5_Splice_Site			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ATGGCCCCACCTTTGGAACAA	0.403																																																	0								ENSG00000155657						88.0	79.0	82.0					2																	179636199		2203	4300	6503	TTN	SO:0001630	splice_region_variant	0			-	HGNC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.7856-1G>A	2.37:g.179636199C>T		Somatic	0	93	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	52	22.39	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e33-1	ENST00000591111.1	37	c.7856-1		2	.	.	.	.	.	.	.	.	.	.	C	36	5.645664	0.96704	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	.	.	.	6.17	6.17	0.99709	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TTN	179344444	1.000000	0.71417	0.958000	0.39756	0.633000	0.38033	7.818000	0.86416	2.941000	0.99782	0.655000	0.94253	.	-	-		0.403	TTN-019	PUTATIVE	basic	protein_coding	TTN	protein_coding	OTTHUMT00000460310.1	C	NM_133378	-	Intron	179636199	-1	no_errors	ENST00000342992	ensembl	human	known	74_37	splice_site	SNP	1.000	T
UNC13C	440279	genome.wustl.edu	37	15	54305706	54305706	+	Silent	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr15:54305706C>T	ENST00000260323.11	+	1	606	c.606C>T	c.(604-606)acC>acT	p.T202T	UNC13C_ENST00000537900.1_Silent_p.T202T|UNC13C_ENST00000545554.1_Silent_p.T202T	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	202					exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)			breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		AGTTAAGCACCATGAAAAAAT	0.453																																																	0								ENSG00000137766						95.0	94.0	94.0					15																	54305706		1845	4087	5932	UNC13C	SO:0001819	synonymous_variant	0			-	HGNC	AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.606C>T	15.37:g.54305706C>T		Somatic	0	50	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	23	17.86	Q0P613|Q8ND48|Q96NP3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Munc13_subgr_dom-2,pfam_Ca-dep_secretion_activator,pfam_C2_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_C2_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_C2_dom,pfscan_C2_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,prints_C2_dom	p.T202	ENST00000260323.11	37	c.606	CCDS45264.1	15																																																																																			-	NULL		0.453	UNC13C-001	KNOWN	basic|CCDS	protein_coding	UNC13C	protein_coding	OTTHUMT00000419028.3	C	NM_173166	-		54305706	+1	no_errors	ENST00000260323	ensembl	human	known	74_37	silent	SNP	0.311	T
LINGO1	84894	genome.wustl.edu	37	15	77907555	77907555	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr15:77907555C>T	ENST00000355300.6	-	2	868	c.694G>A	c.(694-696)Gac>Aac	p.D232N	LINGO1_ENST00000561030.1_Missense_Mutation_p.D226N	NM_032808.5	NP_116197.4	Q96FE5	LIGO1_HUMAN	leucine rich repeat and Ig domain containing 1	232					central nervous system neuron development (GO:0021954)|negative regulation of axonogenesis (GO:0050771)|negative regulation of oligodendrocyte differentiation (GO:0048715)|neuron projection development (GO:0031175)|neurotrophin TRK receptor signaling pathway (GO:0048011)|protein kinase B signaling (GO:0043491)|regulation of axonogenesis (GO:0050770)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(16)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	31						AAGGAGTAGTCCCGGATGGCA	0.592																																																	0								ENSG00000169783						112.0	122.0	119.0					15																	77907555		2174	4268	6442	LINGO1	SO:0001583	missense	0			-	HGNC	AK027500	CCDS45313.1, CCDS73766.1	15q24	2013-01-11	2007-02-01	2007-02-01		ENSG00000169783		"""Immunoglobulin superfamily / I-set domain containing"""	21205	protein-coding gene	gene with protein product		609791	"""leucine rich repeat neuronal 6A"""	LRRN6A		14686891	Standard	XM_006720723		Approved	FLJ14594, LERN1	uc002bct.1	Q96FE5		ENST00000355300.6:c.694G>A	15.37:g.77907555C>T	ENSP00000347451:p.Asp232Asn	Somatic	0	29	0.00		0.41568620468393047	15	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	28	26.32	D3DW80|Q6NUK3|Q6UXM3|Q6VVG0|Q6VVG1|Q6VVG2|Q8N3K5|Q96K52	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Leu-rich_rpt,pfam_Ig_I-set,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.D232N	ENST00000355300.6	37	c.694	CCDS45313.1	15	.	.	.	.	.	.	.	.	.	.	C	10.70	1.423543	0.25639	.	.	ENSG00000169783	ENST00000355300	T	0.54866	0.55	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	T	0.50480	0.1618	L	0.53780	1.695	0.80722	D	1	B	0.12630	0.006	B	0.12837	0.008	T	0.44081	-0.9351	10	0.19590	T	0.45	.	19.3317	0.94293	0.0:1.0:0.0:0.0	.	232	Q96FE5	LIGO1_HUMAN	N	232	ENSP00000347451:D232N	ENSP00000347451:D232N	D	-	1	0	LINGO1	75694610	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.999000	0.70665	2.582000	0.87167	0.561000	0.74099	GAC	-	smart_Leu-rich_rpt_typical-subtyp		0.592	LINGO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LINGO1	protein_coding	OTTHUMT00000419546.1	C	NM_032808	-		77907555	-1	no_errors	ENST00000355300	ensembl	human	known	74_37	missense	SNP	1.000	T
ANKS1B	56899	genome.wustl.edu	37	12	99145269	99145269	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr12:99145269C>T	ENST00000547776.2	-	25	3535	c.3536G>A	c.(3535-3537)gGa>gAa	p.G1179E	ANKS1B_ENST00000549493.2_Missense_Mutation_p.G429E|ANKS1B_ENST00000549558.2_Missense_Mutation_p.G345E|ANKS1B_ENST00000546568.1_Missense_Mutation_p.G345E|ANKS1B_ENST00000547010.1_Missense_Mutation_p.G695E|ANKS1B_ENST00000332712.7_Missense_Mutation_p.G369E|ANKS1B_ENST00000341752.7_Missense_Mutation_p.G185E|ANKS1B_ENST00000549025.2_Missense_Mutation_p.G277E|ANKS1B_ENST00000546960.1_Missense_Mutation_p.G405E|ANKS1B_ENST00000550693.2_Missense_Mutation_p.G369E|ANKS1B_ENST00000329257.7_Missense_Mutation_p.G1179E|ANKS1B_ENST00000333732.7_Missense_Mutation_p.G209E|ANKS1B_ENST00000547446.1_Missense_Mutation_p.G314E	NM_152788.4	NP_690001.3	Q7Z6G8	ANS1B_HUMAN	ankyrin repeat and sterile alpha motif domain containing 1B	1179	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.					cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	ephrin receptor binding (GO:0046875)			NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(15)|lung(38)|pancreas(1)|prostate(2)|skin(1)	70		all_cancers(3;0.0197)|all_epithelial(3;0.0101)|Esophageal squamous(3;0.0559)|Breast(359;0.209)		OV - Ovarian serous cystadenocarcinoma(2;2.89e-08)|Epithelial(2;6.12e-08)|all cancers(2;4.07e-06)		GAATGCCTGTCCCAGGGTTAG	0.458																																																	0								ENSG00000185046						160.0	159.0	160.0					12																	99145269		1895	4101	5996	ANKS1B	SO:0001583	missense	0			-	HGNC	AF145204	CCDS55864.1, CCDS55865.1, CCDS55866.1, CCDS55867.1, CCDS55868.1, CCDS55869.1, CCDS55870.1, CCDS55871.1, CCDS55872.1	12q23.1	2013-01-10						"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	24600	protein-coding gene	gene with protein product		607815				10490826, 12415113	Standard	NM_020140		Approved	EB-1, AIDA-1, cajalin-2, ANKS2	uc001tge.2	Q7Z6G8		ENST00000547776.2:c.3536G>A	12.37:g.99145269C>T	ENSP00000449629:p.Gly1179Glu	Somatic	0	87	0.00		0.41568620468393047	3	25.00	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	40	13.04	A5PKY5|A7E259|A8K153|A8MSN4|B4DFP6|B4DH98|F8VPM3|F8VZR9|F8WC27|Q5XLJ0|Q6IVB5|Q6NUS4|Q7Z6G6|Q7Z6G7|Q8TAP3|Q9NRX7|Q9Y5K9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ankyrin_rpt,pfam_SAM_type1,pfam_PTB/PI_dom,pfam_SAM_2,pfam_PTB,superfamily_Ankyrin_rpt-contain_dom,superfamily_SAM/pointed,smart_Ankyrin_rpt,smart_SAM,smart_PTB/PI_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_PTB/PI_dom,pfscan_SAM,prints_Ankyrin_rpt	p.G1179E	ENST00000547776.2	37	c.3536	CCDS55872.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	29.6|29.6	5.017736|5.017736	0.93404|0.93404	.|.	.|.	ENSG00000185046|ENSG00000185046	ENST00000550778|ENST00000341752;ENST00000549558;ENST00000547776;ENST00000547010;ENST00000329257;ENST00000538702;ENST00000550693;ENST00000549025;ENST00000549493;ENST00000547446;ENST00000333732;ENST00000546568;ENST00000332712;ENST00000407362;ENST00000546960	.|T;T;T;T;T;T;T;T;T;T;T;T;T	.|0.26957	.|1.7;1.7;1.7;1.7;1.7;1.7;1.7;1.7;1.7;1.7;1.7;1.7;1.7	5.08|5.08	5.08|5.08	0.68730|0.68730	.|Phosphotyrosine interaction domain (3);Pleckstrin homology-type (1);	.|0.000000	.|0.64402	.|D	.|0.000004	T|T	0.61689|0.61689	0.2367|0.2367	M|M	0.91354|0.91354	3.2|3.2	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D;D;D;D;D;D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	.|D;D;D;D;D;D;D;D;D;D;D;D;D	.|0.97110	.|1.0;0.999;1.0;1.0;1.0;1.0;1.0;1.0;0.999;0.999;1.0;1.0;1.0	T|T	0.72257|0.72257	-0.4346|-0.4346	5|10	.|0.87932	.|D	.|0	-10.7863|-10.7863	18.4626|18.4626	0.90745|0.90745	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|314;209;209;405;369;319;393;345;429;277;695;1179;345	.|F8VPM3;F8VR14;B7Z9I9;Q7Z6G8-4;Q7Z6G8-5;B1VKB5;F8VQW6;Q7Z6G8-2;Q7Z6G8-3;F8VZR9;Q7Z6G8-6;Q7Z6G8;Q7Z6G8-7	.|.;.;.;.;.;.;.;.;.;.;.;ANS1B_HUMAN;.	N|E	451|185;345;1179;695;1179;694;369;277;429;314;209;345;369;270;405	.|ENSP00000345510:G185E;ENSP00000448993:G345E;ENSP00000449629:G1179E;ENSP00000448512:G695E;ENSP00000331381:G1179E;ENSP00000447999:G369E;ENSP00000447312:G277E;ENSP00000448203:G429E;ENSP00000450015:G314E;ENSP00000331256:G209E;ENSP00000448205:G345E;ENSP00000332683:G369E;ENSP00000447839:G405E	.|ENSP00000331381:G1179E	D|G	-|-	1|2	0|0	ANKS1B|ANKS1B	97669400|97669400	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.984000|0.984000	0.73092|0.73092	7.772000|7.772000	0.85439|0.85439	2.368000|2.368000	0.80403|0.80403	0.561000|0.561000	0.74099|0.74099	GAC|GGA	-	pfam_PTB/PI_dom,smart_PTB/PI_dom,pfscan_PTB/PI_dom		0.458	ANKS1B-003	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	ANKS1B	protein_coding	OTTHUMT00000408421.3	C	NM_020140	-		99145269	-1	no_errors	ENST00000329257	ensembl	human	known	74_37	missense	SNP	1.000	T
KRTAP24-1	643803	genome.wustl.edu	37	21	31654816	31654816	+	Silent	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr21:31654816G>A	ENST00000340345.4	-	1	460	c.435C>T	c.(433-435)ctC>ctT	p.L145L		NM_001085455.1	NP_001078924.1	Q3LI83	KR241_HUMAN	keratin associated protein 24-1	145						keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			breast(1)|large_intestine(3)|lung(7)|urinary_tract(3)	14						AACCGTTGCGGAGGGTTTGGC	0.498																																																	0								ENSG00000188694						119.0	122.0	121.0					21																	31654816		1984	4170	6154	KRTAP24-1	SO:0001819	synonymous_variant	0			-	HGNC	AB096935	CCDS42915.1	21q22.11	2007-11-23			ENSG00000188694	ENSG00000188694		"""Keratin associated proteins"""	33902	protein-coding gene	gene with protein product							Standard	NM_001085455		Approved	KAP24.1	uc002ynv.3	Q3LI83	OTTHUMG00000125483	ENST00000340345.4:c.435C>T	21.37:g.31654816G>A		Somatic	0	82	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	54	14.06	Q1XDX0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_KRTAP_PMG	p.L145	ENST00000340345.4	37	c.435	CCDS42915.1	21																																																																																			-	pfam_KRTAP_PMG		0.498	KRTAP24-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP24-1	protein_coding	OTTHUMT00000246806.2	G	NM_001085455	-		31654816	-1	no_errors	ENST00000340345	ensembl	human	known	74_37	silent	SNP	0.000	A
CACNA1E	777	genome.wustl.edu	37	1	181686364	181686364	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr1:181686364G>A	ENST00000367573.2	+	11	1451	c.1451G>A	c.(1450-1452)aGc>aAc	p.S484N	CACNA1E_ENST00000526775.1_Missense_Mutation_p.S484N|CACNA1E_ENST00000360108.3_Missense_Mutation_p.S484N|CACNA1E_ENST00000357570.5_Missense_Mutation_p.S435N|CACNA1E_ENST00000367570.1_Missense_Mutation_p.S484N|CACNA1E_ENST00000358338.5_Missense_Mutation_p.S435N|CACNA1E_ENST00000367567.4_Missense_Mutation_p.S91N	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	484					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						ATTGTGCTGAGCCTTGTGGCA	0.522																																																	0								ENSG00000198216						103.0	105.0	104.0					1																	181686364		1993	4181	6174	CACNA1E	SO:0001583	missense	0			-	HGNC	AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.1451G>A	1.37:g.181686364G>A	ENSP00000356545:p.Ser484Asn	Somatic	0	46	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	14	22.22	B1AM12|B1AM13|B1AM14|Q14580|Q14581	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,pfscan_EF_hand_dom,prints_VDCCAlpha1,prints_VDCC_R_a1su	p.S484N	ENST00000367573.2	37	c.1451	CCDS55664.1	1	.	.	.	.	.	.	.	.	.	.	G	17.55	3.417835	0.62622	.	.	ENSG00000198216	ENST00000367570;ENST00000526775;ENST00000357570;ENST00000358338;ENST00000367567;ENST00000360108;ENST00000367573	D;D;D;D;D;D;D	0.97455	-4.39;-4.39;-4.39;-4.39;-4.39;-4.39;-4.39	5.32	4.4	0.53042	.	0.197383	0.64402	D	0.000011	D	0.94807	0.8323	L	0.50333	1.59	0.35549	D	0.803677	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.002	D	0.94474	0.7687	10	0.41790	T	0.15	.	13.587	0.61937	0.0754:0.0:0.9246:0.0	.	484;484	Q15878-2;Q15878-3	.;.	N	484;484;435;435;91;484;484	ENSP00000356542:S484N;ENSP00000434814:S484N;ENSP00000350183:S435N;ENSP00000351101:S435N;ENSP00000356539:S91N;ENSP00000353222:S484N;ENSP00000356545:S484N	ENSP00000350183:S435N	S	+	2	0	CACNA1E	179952987	1.000000	0.71417	0.997000	0.53966	0.959000	0.62525	9.675000	0.98638	1.367000	0.46095	0.655000	0.94253	AGC	-	NULL		0.522	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	CACNA1E	protein_coding	OTTHUMT00000090793.2	G	NM_000721	-		181686364	+1	no_errors	ENST00000367573	ensembl	human	known	74_37	missense	SNP	1.000	A
GPR97	222487	genome.wustl.edu	37	16	57719753	57719753	+	Silent	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr16:57719753G>A	ENST00000333493.4	+	11	1616	c.1455G>A	c.(1453-1455)ctG>ctA	p.L485L	GPR97_ENST00000327655.6_Silent_p.L275L|GPR97_ENST00000450388.3_Silent_p.L365L|RP11-405F3.4_ENST00000563062.1_RNA	NM_170776.4	NP_740746.4	Q86Y34	GPR97_HUMAN	G protein-coupled receptor 97	485					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(9)|lung(7)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						TCTCGAGCCTGGTGGGTGTGA	0.602																																																	0								ENSG00000182885						110.0	95.0	100.0					16																	57719753		2198	4300	6498	GPR97	SO:0001819	synonymous_variant	0			-	HGNC	AY140959	CCDS10786.1	16q13	2014-08-08			ENSG00000182885	ENSG00000182885		"""-"", ""GPCR / Class B : Orphans"""	13728	protein-coding gene	gene with protein product						12435584, 222487	Standard	NM_170776		Approved	Pb99, PGR26	uc002emh.3	Q86Y34	OTTHUMG00000133458	ENST00000333493.4:c.1455G>A	16.37:g.57719753G>A		Somatic	0	58	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	35	28.57	Q6ZMF4|Q86SL9|Q8IZF1	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_2_secretin-like,pfam_GPS_dom,smart_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like,prints_GPCR_2_orphan_rcpt_GPR56	p.L485	ENST00000333493.4	37	c.1455	CCDS10786.1	16																																																																																			-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like		0.602	GPR97-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR97	protein_coding	OTTHUMT00000257333.2	G	NM_170776	-		57719753	+1	no_errors	ENST00000333493	ensembl	human	known	74_37	silent	SNP	0.999	A
PRSS23	11098	genome.wustl.edu	37	11	86544271	86544271	+	Intron	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr11:86544271C>T	ENST00000533902.2	+	2	348				AP000654.4_ENST00000602510.1_lincRNA			O95084	PRS23_HUMAN	protease, serine, 23							extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(9)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	18		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				TCTTGGGGACCGTGTTGGAGG	0.522																																																	0								ENSG00000269895																																			AP000654.4	SO:0001627	intron_variant	0			-	Clone_based_vega_gene	AF015287	CCDS8278.1	11q14.2	2010-05-12			ENSG00000150687	ENSG00000150687		"""Serine peptidases / Serine peptidases"""	14370	protein-coding gene	gene with protein product							Standard	XM_005273727		Approved	SPUVE, SIG13	uc001pcb.3	O95084		ENST00000533902.2:c.206+9636C>T	11.37:g.86544271C>T		Somatic	0	117	0.00		0.41568620468393047	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	52	25.71	B2RDJ1|B4E2J3|Q6IBI0	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000533902.2	37	NULL		11																																																																																			-	-		0.522	PRSS23-004	PUTATIVE	basic	protein_coding	ENSG00000269895	protein_coding	OTTHUMT00000393807.2	C	NM_007173	-		86544271	+1	no_errors	ENST00000602510	ensembl	human	known	74_37	rna	SNP	0.014	T
SERPINA1	5265	genome.wustl.edu	37	14	94847281	94847281	+	Missense_Mutation	SNP	C	C	T	rs370923940		TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr14:94847281C>T	ENST00000448921.1	-	5	1416	c.844G>A	c.(844-846)Ggg>Agg	p.G282R	SERPINA1_ENST00000437397.1_Missense_Mutation_p.G282R|SERPINA1_ENST00000440909.1_Missense_Mutation_p.G282R|SERPINA1_ENST00000449399.3_Missense_Mutation_p.G282R|SERPINA1_ENST00000402629.1_Missense_Mutation_p.G282R|SERPINA1_ENST00000393087.4_Missense_Mutation_p.G282R|SERPINA1_ENST00000555289.1_5'Flank|SERPINA1_ENST00000404814.4_Missense_Mutation_p.G282R|SERPINA1_ENST00000355814.4_Missense_Mutation_p.G282R|SERPINA1_ENST00000393088.4_Missense_Mutation_p.G282R	NM_001002236.2|NM_001127701.1|NM_001127703.1|NM_001127704.1|NM_001127705.1	NP_001002236.1|NP_001121173.1|NP_001121175.1|NP_001121176.1|NP_001121177.1	P01009	A1AT_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 1	282					acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|negative regulation of endopeptidase activity (GO:0010951)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of proteolysis (GO:0030162)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)	glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|protease binding (GO:0002020)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(5)|skin(6)|stomach(1)	24		all_cancers(154;0.0649)|all_epithelial(191;0.223)		Epithelial(152;0.135)|COAD - Colon adenocarcinoma(157;0.207)|all cancers(159;0.221)		TGTAGTTTCCCCTCATCAGGC	0.498																																																	0								ENSG00000197249	C	ARG/GLY,ARG/GLY,ARG/GLY,ARG/GLY,ARG/GLY,ARG/GLY,ARG/GLY,ARG/GLY,ARG/GLY,ARG/GLY,ARG/GLY	1,4405	2.1+/-5.4	0,1,2202	152.0	142.0	146.0		844,844,844,844,844,844,844,844,844,844,844	5.1	0.0	14		146	0,8600		0,0,4300	no	missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense	SERPINA1	NM_000295.4,NM_001002235.2,NM_001002236.2,NM_001127700.1,NM_001127701.1,NM_001127702.1,NM_001127703.1,NM_001127704.1,NM_001127705.1,NM_001127706.1,NM_001127707.1	125,125,125,125,125,125,125,125,125,125,125	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	282/419,282/419,282/419,282/419,282/419,282/419,282/419,282/419,282/419,282/419,282/419	94847281	1,13005	2203	4300	6503	SERPINA1	SO:0001583	missense	0			-	HGNC	X01683	CCDS9925.1	14q32.1	2014-02-18	2005-08-18		ENSG00000197249	ENSG00000197249		"""Serine (or cysteine) peptidase inhibitors"""	8941	protein-coding gene	gene with protein product	"""protease inhibitor 1 (anti-elastase), alpha-1-antitrypsin"""	107400	"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 1"""	PI		24172014	Standard	NM_000295		Approved	AAT, A1A, PI1, alpha-1-antitrypsin, A1AT, alpha1AT	uc010aux.3	P01009	OTTHUMG00000150355	ENST00000448921.1:c.844G>A	14.37:g.94847281C>T	ENSP00000416066:p.Gly282Arg	Somatic	0	66	0.00		0.41568620468393047	141	2.76	4	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	53	27.40	A6PX14|B2RDQ8|Q0PVP5|Q13672|Q53XB8|Q5U0M1|Q7M4R2|Q86U18|Q86U19|Q96BF9|Q96ES1|Q9P1P0|Q9UCE6|Q9UCM3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	p.G282R	ENST00000448921.1	37	c.844	CCDS9925.1	14	.	.	.	.	.	.	.	.	.	.	C	20.6	4.024621	0.75390	2.27E-4	0.0	ENSG00000197249	ENST00000440909;ENST00000448921;ENST00000437397;ENST00000355814;ENST00000393087;ENST00000393088;ENST00000404814;ENST00000449399;ENST00000402629	D;D;D;D;D;D;D;D;D	0.86230	-2.09;-2.09;-2.09;-2.09;-2.09;-2.09;-2.09;-2.09;-2.09	5.05	5.05	0.67936	Serpin domain (3);	0.000000	0.64402	D	0.000004	D	0.92873	0.7733	M	0.76938	2.355	0.58432	D	0.999995	P;D	0.69078	0.854;0.997	P;D	0.63877	0.46;0.919	D	0.93723	0.7034	10	0.87932	D	0	.	17.5559	0.87889	0.0:1.0:0.0:0.0	.	282;282	P01009-2;P01009	.;A1AT_HUMAN	R	282	ENSP00000390299:G282R;ENSP00000416066:G282R;ENSP00000408474:G282R;ENSP00000348068:G282R;ENSP00000376802:G282R;ENSP00000376803:G282R;ENSP00000385960:G282R;ENSP00000416354:G282R;ENSP00000386094:G282R	ENSP00000348068:G282R	G	-	1	0	SERPINA1	93917034	0.199000	0.23386	0.039000	0.18376	0.026000	0.11368	3.375000	0.52410	2.536000	0.85505	0.455000	0.32223	GGG	-	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom		0.498	SERPINA1-203	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPINA1	protein_coding	OTTHUMT00000317768.2	C	NM_001002235	-		94847281	-1	no_errors	ENST00000355814	ensembl	human	known	74_37	missense	SNP	0.976	T
AK5	26289	genome.wustl.edu	37	1	77779527	77779527	+	Intron	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr1:77779527C>T	ENST00000354567.2	+	5	962				AK5_ENST00000344720.5_Intron|AK5_ENST00000317704.4_3'UTR	NM_174858.2	NP_777283.1	Q9Y6K8	KAD5_HUMAN	adenylate kinase 5						ADP biosynthetic process (GO:0006172)|ATP metabolic process (GO:0046034)|dADP biosynthetic process (GO:0006173)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleoside diphosphate phosphorylation (GO:0006165)|nucleoside triphosphate biosynthetic process (GO:0009142)|pyrimidine ribonucleotide biosynthetic process (GO:0009220)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule organizing center (GO:0005815)	adenylate kinase activity (GO:0004017)|ATP binding (GO:0005524)|nucleoside diphosphate kinase activity (GO:0004550)|nucleoside kinase activity (GO:0019206)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(27)|prostate(1)|skin(2)|stomach(1)	40						CAGATCCTCTCCCTTACGCTG	0.502																																																	0								ENSG00000154027						45.0	39.0	40.0					1																	77779527		876	1991	2867	AK5	SO:0001627	intron_variant	0			-	HGNC	AF062595	CCDS675.1, CCDS676.1	1p31	2008-02-05			ENSG00000154027	ENSG00000154027		"""Adenylate kinases"""	365	protein-coding gene	gene with protein product		608009				10215863	Standard	NM_012093		Approved		uc001dhn.3	Q9Y6K8	OTTHUMG00000009796	ENST00000354567.2:c.699+15895C>T	1.37:g.77779527C>T		Somatic	0	63	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	31	26.19	Q5U622|Q6FH66|Q7Z4T5|Q86YS0|Q8N464|Q96EC9	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000354567.2	37	NULL	CCDS675.1	1																																																																																			-	-		0.502	AK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AK5	protein_coding	OTTHUMT00000026993.4	C	NM_174858	-		77779527	+1	no_errors	ENST00000317704	ensembl	human	known	74_37	rna	SNP	0.000	T
CCR9	10803	genome.wustl.edu	37	3	45943138	45943138	+	Silent	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr3:45943138C>T	ENST00000357632.2	+	3	1038	c.858C>T	c.(856-858)atC>atT	p.I286I	CCR9_ENST00000395963.2_Silent_p.I274I|CCR9_ENST00000422395.1_3'UTR|CCR9_ENST00000355983.2_Silent_p.I274I|Y_RNA_ENST00000364765.1_RNA|LZTFL1_ENST00000536047.1_Intron|LZTFL1_ENST00000539217.1_Intron	NM_001256369.1|NM_031200.2	NP_001243298.1|NP_112477.1	P51686	CCR9_HUMAN	chemokine (C-C motif) receptor 9	286					cellular defense response (GO:0006968)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|positive regulation of cytosolic calcium ion concentration (GO:0007204)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|chemokine receptor activity (GO:0004950)			breast(1)|endometrium(4)|large_intestine(8)|lung(2)|ovary(2)|prostate(2)|skin(1)	20				BRCA - Breast invasive adenocarcinoma(193;0.00118)|KIRC - Kidney renal clear cell carcinoma(197;0.0182)|Kidney(197;0.0214)		CCATGTTCATCTCCAACTGTG	0.478																																																	0								ENSG00000173585						210.0	176.0	188.0					3																	45943138		2203	4300	6503	CCR9	SO:0001819	synonymous_variant	0			-	HGNC	AJ132337	CCDS2732.1, CCDS2733.1	3p21.31	2012-09-20			ENSG00000173585	ENSG00000173585		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1610	protein-coding gene	gene with protein product		604738		GPR28		10229797	Standard	NM_006641		Approved	GPR-9-6, CDw199	uc003coz.2	P51686	OTTHUMG00000133450	ENST00000357632.2:c.858C>T	3.37:g.45943138C>T		Somatic	0	56	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	23	23.33	Q4VBM3|Q549E0|Q9UQQ6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_Chemokine_CCR9,prints_Chemokine_rcpt,prints_Chemokine_CCR7,prints_ATII_rcpt,prints_Chemokine_CCRL1,prints_Chemokine_CXCR4	p.I286	ENST00000357632.2	37	c.858	CCDS2732.1	3																																																																																			-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Chemokine_CCR7,prints_ATII_rcpt		0.478	CCR9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCR9	protein_coding	OTTHUMT00000257323.2	C		-		45943138	+1	no_errors	ENST00000357632	ensembl	human	known	74_37	silent	SNP	0.000	T
PROSER1	80209	genome.wustl.edu	37	13	39587630	39587630	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr13:39587630G>A	ENST00000352251.3	-	11	2592	c.1759C>T	c.(1759-1761)Cca>Tca	p.P587S	PROSER1_ENST00000350125.3_Missense_Mutation_p.P565S|PROSER1_ENST00000484434.3_Intron	NM_025138.4	NP_079414.3	Q86XN7	PRSR1_HUMAN	proline and serine rich 1	587	Ser-rich.																GAGGTACCTGGGTGGGGGCCA	0.532																																																	0								ENSG00000120685						102.0	110.0	108.0					13																	39587630		2203	4300	6503	PROSER1	SO:0001583	missense	0			-	HGNC	AK022723	CCDS9368.2	13q13.2	2011-08-09	2011-08-09	2011-08-09	ENSG00000120685	ENSG00000120685			20291	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 23"""	C13orf23			Standard	NM_025138		Approved	bA50D16.2, FLJ12661	uc001uwy.4	Q86XN7	OTTHUMG00000016764	ENST00000352251.3:c.1759C>T	13.37:g.39587630G>A	ENSP00000332034:p.Pro587Ser	Somatic	0	50	0.00		0.41568620468393047	15	11.76	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	41	19.61	A6NJ97|Q6P2S2|Q7Z3X5|Q8N3D2|Q8N3P1|Q9H9M1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.P587S	ENST00000352251.3	37	c.1759	CCDS9368.2	13	.	.	.	.	.	.	.	.	.	.	G	12.96	2.095222	0.36952	.	.	ENSG00000120685	ENST00000352251;ENST00000350125	T;T	0.32988	1.43;1.43	5.05	-1.06	0.10002	.	.	.	.	.	T	0.18509	0.0444	L	0.27053	0.805	0.09310	N	1	P;P	0.42296	0.775;0.775	B;B	0.39660	0.306;0.23	T	0.15464	-1.0436	8	.	.	.	-0.048	7.004	0.24826	0.2118:0.3783:0.4099:0.0	.	565;587	A6NJ97;Q86XN7	.;PRSR1_HUMAN	S	587;565	ENSP00000332034:P587S;ENSP00000339123:P565S	.	P	-	1	0	PROSER1	38485630	1.000000	0.71417	0.000000	0.03702	0.447000	0.32167	0.939000	0.28978	-0.486000	0.06744	-0.258000	0.10820	CCA	-	NULL		0.532	PROSER1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PROSER1	protein_coding	OTTHUMT00000044607.5	G	NM_025138	-		39587630	-1	no_errors	ENST00000352251	ensembl	human	known	74_37	missense	SNP	0.001	A
TSPAN10	83882	genome.wustl.edu	37	17	79612610	79612611	+	RNA	DEL	TG	TG	-			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	TG	TG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr17:79612610_79612611delTG	ENST00000572675.1	+	0	629_630				TSPAN10_ENST00000328585.4_RNA			Q9H1Z9	TSN10_HUMAN	tetraspanin 10						establishment of protein localization to organelle (GO:0072594)	integral component of membrane (GO:0016021)	enzyme binding (GO:0019899)			ovary(1)	1	all_neural(118;0.0878)|all_lung(278;0.175)|Lung NSC(278;0.192)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0101)|OV - Ovarian serous cystadenocarcinoma(97;0.0739)			CAGCTCGGGCTGAGGTGCTGCG	0.658																																																	0								ENSG00000182612																																			TSPAN10			0				HGNC	BC032802		17q25.3	2013-10-02			ENSG00000182612	ENSG00000182612		"""Tetraspanins"""	29942	protein-coding gene	gene with protein product	"""oculospanin"""					12107410	Standard	NM_031945		Approved	OCSP	uc010die.3	Q9H1Z9	OTTHUMG00000178037		17.37:g.79612610_79612611delTG		Somatic	0	44	0.00		0.41568620468393047	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	23	8.00	Q8N548	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2,prints_Tetraspanin	p.L210fs	ENST00000572675.1	37	c.629_630		17																																																																																			-	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2		0.658	TSPAN10-001	KNOWN	basic	polymorphic_pseudogene	TSPAN10	polymorphic_pseudogene	OTTHUMT00000440313.1	TG	NM_031945			79612611	+1	no_errors	ENST00000328585	ensembl	human	known	74_37	frame_shift_del	DEL	1.000:1.000	-
SNW1	22938	genome.wustl.edu	37	14	78184493	78184493	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr14:78184493G>A	ENST00000261531.7	-	14	1611	c.1549C>T	c.(1549-1551)Ccc>Tcc	p.P517S	SLIRP_ENST00000557623.1_Intron|SNW1_ENST00000554775.1_Missense_Mutation_p.P355S|SLIRP_ENST00000557431.1_Intron|SNW1_ENST00000555761.1_Silent_p.D543D	NM_012245.2	NP_036377.1	Q13573	SNW1_HUMAN	SNW domain containing 1	517					cellular response to retinoic acid (GO:0071300)|gene expression (GO:0010467)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of vitamin D receptor signaling pathway (GO:0070564)|regulation of retinoic acid receptor signaling pathway (GO:0048385)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of vitamin D receptor signaling pathway (GO:0070562)|retinoic acid receptor signaling pathway (GO:0048384)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	catalytic step 2 spliceosome (GO:0071013)|chromatin (GO:0000785)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	Notch binding (GO:0005112)|nuclear hormone receptor binding (GO:0035257)|poly(A) RNA binding (GO:0044822)|retinoic acid receptor binding (GO:0042974)|SMAD binding (GO:0046332)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|vitamin D receptor binding (GO:0042809)			NS(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	24			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0291)		CTATCTGAGGGTCTTTTAGAG	0.488																																																	0								ENSG00000100603						176.0	177.0	177.0					14																	78184493		2203	4300	6503	SNW1	SO:0001583	missense	0			-	HGNC	AF045184	CCDS9867.1	14q22.1-q22.3	2005-09-13	2005-09-13	2005-09-13		ENSG00000100603			16696	protein-coding gene	gene with protein product		603055	"""SKI interacting protein"""	SKIIP		8973337, 9632709	Standard	NM_012245		Approved	NCoA-62, SKIP, Prp45, PRPF45, Bx42	uc001xuf.3	Q13573		ENST00000261531.7:c.1549C>T	14.37:g.78184493G>A	ENSP00000261531:p.Pro517Ser	Somatic	0	53	0.00		0.41568620468393047	222	23.71	69	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	30	18.92	A8K8A9|Q13483|Q32N03|Q5D0D6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SKI-int_prot_SKIP_SNW-dom,superfamily_Signal_recog_particl_SRP54_hlx	p.P517S	ENST00000261531.7	37	c.1549	CCDS9867.1	14	.	.	.	.	.	.	.	.	.	.	G	13.24	2.178103	0.38511	.	.	ENSG00000100603	ENST00000261531;ENST00000554775	.	.	.	5.68	5.68	0.88126	.	0.000000	0.85682	D	0.000000	T	0.33556	0.0867	N	0.08118	0	0.80722	D	1	P	0.43750	0.816	B	0.38264	0.269	T	0.17440	-1.0369	9	0.13853	T	0.58	.	19.7896	0.96452	0.0:0.0:1.0:0.0	.	517	Q13573	SNW1_HUMAN	S	517;355	.	ENSP00000261531:P517S	P	-	1	0	SNW1	77254246	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.143000	0.94623	2.694000	0.91930	0.467000	0.42956	CCC	-	NULL		0.488	SNW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNW1	protein_coding	OTTHUMT00000413912.1	G	NM_012245	-		78184493	-1	no_errors	ENST00000261531	ensembl	human	known	74_37	missense	SNP	1.000	A
KMT2E	55904	genome.wustl.edu	37	7	104714102	104714102	+	Silent	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr7:104714102C>T	ENST00000311117.3	+	7	1079	c.534C>T	c.(532-534)cgC>cgT	p.R178R	KMT2E_ENST00000334877.4_Silent_p.R178R|KMT2E_ENST00000476671.1_Silent_p.R178R|KMT2E_ENST00000334914.7_5'UTR|KMT2E_ENST00000257745.4_Silent_p.R178R	NM_182931.2	NP_891847.1	Q8IZD2	KMT2E_HUMAN	lysine (K)-specific methyltransferase 2E	178					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|DNA methylation (GO:0006306)|erythrocyte differentiation (GO:0030218)|histone H3-K4 methylation (GO:0051568)|neutrophil activation (GO:0042119)|neutrophil mediated immunity (GO:0002446)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of transcription, DNA-templated (GO:0045893)|retinoic acid receptor signaling pathway (GO:0048384)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|MLL5-L complex (GO:0070688)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)										TACTACAACGCCGGAAAAGGG	0.323																																																	0								ENSG00000005483						59.0	60.0	60.0					7																	104714102		2203	4300	6503	KMT2E	SO:0001819	synonymous_variant	0			-	HGNC	AF067804	CCDS34723.1	7q22.1	2013-05-09	2013-05-09	2013-05-09	ENSG00000005483	ENSG00000005483		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	18541	protein-coding gene	gene with protein product		608444	"""myeloid/lymphoid or mixed-lineage leukemia 5 (trithorax homolog, Drosophila)"""	MLL5		9218106, 7672722	Standard	XM_005250493		Approved	HDCMC04P		Q8IZD2	OTTHUMG00000157403	ENST00000311117.3:c.534C>T	7.37:g.104714102C>T		Somatic	0	201	0.00		0.41568620468393047	3	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	28	86	24.35	B6ZDE4|B6ZDM3|M4K8J3|Q6P5Y2|Q6PKG4|Q6T316|Q86TI3|Q86W12|Q86WG0|Q86WL2|Q8IV78|Q8IWR5|Q8NFF8|Q9NWE7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_SET_dom,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_SET_dom,pfscan_SET_dom,pfscan_Znf_PHD-finger	p.R178	ENST00000311117.3	37	c.534	CCDS34723.1	7																																																																																			-	NULL		0.323	KMT2E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KMT2E	protein_coding	OTTHUMT00000348697.1	C		-		104714102	+1	no_errors	ENST00000257745	ensembl	human	known	74_37	silent	SNP	1.000	T
CASP4	837	genome.wustl.edu	37	11	104825485	104825485	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr11:104825485G>A	ENST00000444739.2	-	2	1161	c.251C>T	c.(250-252)cCc>cTc	p.P84L	CASP4_ENST00000531333.1_5'UTR|CASP4_ENST00000393150.3_Missense_Mutation_p.P28L	NM_001225.3	NP_001216.1	P49662	CASP4_HUMAN	caspase 4, apoptosis-related cysteine peptidase	84	CARD. {ECO:0000255|PROSITE- ProRule:PRU00046}.				apoptotic process (GO:0006915)|execution phase of apoptosis (GO:0097194)|proteolysis (GO:0006508)|regulation of apoptotic process (GO:0042981)|regulation of inflammatory response (GO:0050727)	AIM2 inflammasome complex (GO:0097169)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|IPAF inflammasome complex (GO:0072557)|membrane (GO:0016020)|mitochondrion (GO:0005739)|NLRP3 inflammasome complex (GO:0072559)	cysteine-type endopeptidase activity (GO:0004197)			central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(11)|ovary(1)|skin(1)|urinary_tract(2)	23		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Melanoma(852;0.0047)		BRCA - Breast invasive adenocarcinoma(274;0.000854)|Epithelial(105;0.00879)|all cancers(92;0.0357)		TTTTTTATTGGGGGATATTTG	0.393																																																	0								ENSG00000196954						110.0	113.0	112.0					11																	104825485		2201	4299	6500	CASP4	SO:0001583	missense	0			-	HGNC	U25804	CCDS8327.1, CCDS41704.1	11q22.2-q22.3	2006-02-17	2005-08-17		ENSG00000196954	ENSG00000196954		"""Caspases"""	1505	protein-coding gene	gene with protein product		602664	"""caspase 4, apoptosis-related cysteine protease"""			7797510, 9250871	Standard	NM_001225		Approved	ICE(rel)II, ICH-2, TX	uc001pid.1	P49662	OTTHUMG00000166078	ENST00000444739.2:c.251C>T	11.37:g.104825485G>A	ENSP00000388566:p.Pro84Leu	Somatic	0	45	0.00		0.41568620468393047	76	1.27	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	28	26.32	A2NHL8|A2NHM0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Pept_C14_caspase,pfam_CARD,superfamily_DEATH-like_dom,smart_CARD,smart_Pept_C14A_p45_core,pirsf_Caspase_IL-1_beta,pfscan_CARD,pfscan_Pept_C14_p10,pfscan_Pept_C14_ICE_p20,prints_Pept_C14A_p45_core	p.P84L	ENST00000444739.2	37	c.251	CCDS8327.1	11	.	.	.	.	.	.	.	.	.	.	G	6.191	0.403493	0.11754	.	.	ENSG00000196954	ENST00000444739;ENST00000393150;ENST00000355546;ENST00000417440	T;T;T	0.12361	2.69;4.49;2.69	3.6	0.0656	0.14357	DEATH-like (2);Caspase Recruitment (1);	0.683220	0.15095	N	0.280852	T	0.08670	0.0215	L	0.36672	1.1	0.09310	N	1	B;B;B	0.27351	0.176;0.013;0.029	B;B;B	0.27500	0.08;0.006;0.029	T	0.36504	-0.9745	10	0.19590	T	0.45	.	5.4086	0.16336	0.1148:0.0:0.4845:0.4006	.	84;84;84	B4DJH5;B4E2D2;P49662	.;.;CASP4_HUMAN	L	84;28;37;84	ENSP00000388566:P84L;ENSP00000376857:P28L;ENSP00000401673:P84L	ENSP00000347741:P37L	P	-	2	0	CASP4	104330695	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.124000	0.10595	0.239000	0.21243	0.655000	0.94253	CCC	-	superfamily_DEATH-like_dom,smart_CARD,pirsf_Caspase_IL-1_beta		0.393	CASP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CASP4	protein_coding	OTTHUMT00000387751.1	G	NM_001225	-		104825485	-1	no_errors	ENST00000444739	ensembl	human	known	74_37	missense	SNP	0.000	A
E2F4	1874	genome.wustl.edu	37	16	67229880	67229880	+	Missense_Mutation	SNP	T	T	G			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr16:67229880T>G	ENST00000379378.3	+	7	1063	c.1004T>G	c.(1003-1005)tTt>tGt	p.F335C		NM_001950.3	NP_001941.2	Q16254	E2F4_HUMAN	E2F transcription factor 4, p107/p130-binding	335					blood circulation (GO:0008015)|cell volume homeostasis (GO:0006884)|cilium assembly (GO:0042384)|epithelial cell development (GO:0002064)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell proliferation (GO:0042127)|regulation of cell size (GO:0008361)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			breast(4)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)	11		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.000697)|Epithelial(162;0.00303)|all cancers(182;0.0325)		TCTACCTCCTTTGAGCCCATC	0.592																																																	0								ENSG00000205250						87.0	88.0	88.0					16																	67229880		2198	4300	6498	E2F4	SO:0001583	missense	0			-	HGNC	BC021050	CCDS32464.1	16q22.1	2014-05-06			ENSG00000205250	ENSG00000205250			3118	protein-coding gene	gene with protein product		600659				7958924, 7892279	Standard	NM_001950		Approved	E2F-4	uc002erz.3	Q16254	OTTHUMG00000172975	ENST00000379378.3:c.1004T>G	16.37:g.67229880T>G	ENSP00000368686:p.Phe335Cys	Somatic	0	117	0.00		0.41568620468393047	117	27.33	44	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	59	29.76	A6NGR8|B5BU56|Q12991|Q15328	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_E2F_TDP	p.F335C	ENST00000379378.3	37	c.1004	CCDS32464.1	16	.	.	.	.	.	.	.	.	.	.	T	22.2	4.263617	0.80358	.	.	ENSG00000205250	ENST00000379378	D	0.89810	-2.57	5.17	5.17	0.71159	.	0.702414	0.14442	N	0.319352	D	0.91002	0.7170	L	0.34521	1.04	0.80722	D	1	D	0.76494	0.999	D	0.77557	0.99	D	0.89392	0.3689	10	0.41790	T	0.15	-3.7679	13.8463	0.63470	0.0:0.0:0.0:1.0	.	335	Q16254	E2F4_HUMAN	C	335	ENSP00000368686:F335C	ENSP00000368686:F335C	F	+	2	0	E2F4	65787381	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	6.326000	0.72905	1.950000	0.56595	0.533000	0.62120	TTT	-	NULL		0.592	E2F4-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	E2F4	protein_coding	OTTHUMT00000421565.1	T	NM_001950	-		67229880	+1	no_errors	ENST00000379378	ensembl	human	known	74_37	missense	SNP	1.000	G
WNK4	65266	genome.wustl.edu	37	17	40947104	40947104	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr17:40947104C>T	ENST00000246914.5	+	14	2686	c.2665C>T	c.(2665-2667)Cca>Tca	p.P889S		NM_032387.4	NP_115763.2	Q96J92	WNK4_HUMAN	WNK lysine deficient protein kinase 4	889					chloride transport (GO:0006821)|distal tubule morphogenesis (GO:0072156)|intracellular signal transduction (GO:0035556)|ion homeostasis (GO:0050801)|ion transport (GO:0006811)|negative regulation of pancreatic juice secretion (GO:0090188)|protein localization (GO:0008104)|protein phosphorylation (GO:0006468)|regulation of cellular process (GO:0050794)|renal sodium ion absorption (GO:0070294)	cytoplasm (GO:0005737)|tight junction (GO:0005923)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(10)|ovary(3)|prostate(1)|skin(5)|stomach(1)	35		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.0749)		CACGACTTCTCCACCTACGTT	0.582																																					Esophageal Squamous(6;201 374 4964 23855 42828)												0								ENSG00000126562						265.0	244.0	251.0					17																	40947104		2203	4300	6503	WNK4	SO:0001583	missense	0			-	HGNC	AJ309861	CCDS11439.1	17q21-q22	2005-01-19	2005-01-19	2005-01-19		ENSG00000126562			14544	protein-coding gene	gene with protein product		601844	"""protein kinase, lysine deficient 4"""	PRKWNK4			Standard	NM_032387		Approved		uc002ibj.3	Q96J92		ENST00000246914.5:c.2665C>T	17.37:g.40947104C>T	ENSP00000246914:p.Pro889Ser	Somatic	0	60	0.00		0.41568620468393047	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	45	10.00	B0LPI0|Q8N8X3|Q8N8Z2|Q96DT8|Q9BYS5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Kinase_OSR1/WNK_CCT,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.P889S	ENST00000246914.5	37	c.2665	CCDS11439.1	17	.	.	.	.	.	.	.	.	.	.	C	8.722	0.914617	0.17907	.	.	ENSG00000126562	ENST00000246914	T	0.24151	1.87	5.32	4.34	0.51931	.	0.000000	0.45867	D	0.000326	T	0.15782	0.0380	N	0.14661	0.345	0.37810	D	0.928	B;B;B	0.32753	0.383;0.264;0.264	B;B;B	0.32724	0.151;0.072;0.072	T	0.13415	-1.0510	10	0.33940	T	0.23	-3.5549	13.4092	0.60933	0.0:0.9227:0.0:0.0773	.	889;889;889	Q96J92-3;B0LPI0;Q96J92	.;.;WNK4_HUMAN	S	889	ENSP00000246914:P889S	ENSP00000246914:P889S	P	+	1	0	WNK4	38200630	0.000000	0.05858	0.645000	0.29479	0.058000	0.15608	-0.468000	0.06656	2.651000	0.90000	0.591000	0.81541	CCA	-	NULL		0.582	WNK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WNK4	protein_coding	OTTHUMT00000452389.1	C		-		40947104	+1	no_errors	ENST00000246914	ensembl	human	known	74_37	missense	SNP	0.984	T
PCDHGB3	56102	genome.wustl.edu	37	5	140750935	140750935	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr5:140750935G>A	ENST00000576222.1	+	1	1105	c.974G>A	c.(973-975)gGa>gAa	p.G325E	PCDHGA1_ENST00000517417.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA6_ENST00000517434.1_5'Flank	NM_018924.2|NM_032097.1	NP_061747.1|NP_115268.1	Q9Y5G1	PCDGF_HUMAN	protocadherin gamma subfamily B, 3	325	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AAGGATGGTGGACATCACACT	0.428																																																	0								ENSG00000262209						98.0	100.0	99.0					5																	140750935		1966	4148	6114	PCDHGB3	SO:0001583	missense	0			-	HGNC	AF152519	CCDS58980.1, CCDS75334.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8710	other	protocadherin		606301				10380929	Standard	NM_018924		Approved	PCDH-GAMMA-B3		Q9Y5G1		ENST00000576222.1:c.974G>A	5.37:g.140750935G>A	ENSP00000461862:p.Gly325Glu	Somatic	0	43	0.00		0.41568620468393047	0	100.00	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	43	15.38	A7E229|Q9Y5C7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.G325E	ENST00000576222.1	37	c.974	CCDS58980.1	5																																																																																			-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.428	PCDHGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGB3	protein_coding	OTTHUMT00000437094.1	G	NM_018924	-		140750935	+1	no_errors	ENST00000576222	ensembl	human	known	74_37	missense	SNP	1.000	A
THSD7B	80731	genome.wustl.edu	37	2	138414659	138414659	+	Nonsense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr2:138414659G>A	ENST00000409968.1	+	24	4482	c.4304G>A	c.(4303-4305)tGg>tAg	p.W1435*	THSD7B_ENST00000413152.2_Nonsense_Mutation_p.W1407*|THSD7B_ENST00000272643.3_Nonsense_Mutation_p.W1438*|THSD7B_ENST00000543459.1_Intron			Q9C0I4	THS7B_HUMAN	thrombospondin, type I, domain containing 7B	1437						integral component of membrane (GO:0016021)				NS(3)|breast(3)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(14)|lung(57)|ovary(4)|pancreas(3)|prostate(11)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	134				BRCA - Breast invasive adenocarcinoma(221;0.19)		CACTACACATGGAAAGCAAGT	0.403																																																	0								ENSG00000144229						117.0	114.0	115.0					2																	138414659		1933	4145	6078	THSD7B	SO:0001587	stop_gained	0			-	HGNC			2q22.1	2006-11-24			ENSG00000144229	ENSG00000144229			29348	protein-coding gene	gene with protein product						11214970	Standard	NM_001080427		Approved	KIAA1679	uc002tva.1	Q9C0I4	OTTHUMG00000153590	ENST00000409968.1:c.4304G>A	2.37:g.138414659G>A	ENSP00000387145:p.Trp1435*	Somatic	0	67	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	42	17.65		Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	p.W1438*	ENST00000409968.1	37	c.4313		2	.	.	.	.	.	.	.	.	.	.	G	45	11.586808	0.99579	.	.	ENSG00000144229	ENST00000409968;ENST00000272643;ENST00000413152	.	.	.	6.13	6.13	0.99165	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	20.8599	0.99761	0.0:0.0:1.0:0.0	.	.	.	.	X	1435;1438;1407	.	ENSP00000272643:W1438X	W	+	2	0	THSD7B	138131129	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.472000	0.97709	2.937000	0.99478	0.650000	0.86243	TGG	-	NULL		0.403	THSD7B-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	THSD7B	protein_coding	OTTHUMT00000331769.2	G	XM_046570.9	-		138414659	+1	no_errors	ENST00000272643	ensembl	human	known	74_37	nonsense	SNP	1.000	A
FREM2	341640	genome.wustl.edu	37	13	39265511	39265511	+	Missense_Mutation	SNP	C	C	T	rs114409305	byFrequency	TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr13:39265511C>T	ENST00000280481.7	+	1	4246	c.4030C>T	c.(4030-4032)Cgt>Tgt	p.R1344C		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	1344					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		TTATATTATTCGTTATGGGCC	0.363																																																	0								ENSG00000150893						72.0	75.0	74.0					13																	39265511		2203	4300	6503	FREM2	SO:0001583	missense	0			GMAF=0.0005	HGNC	BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.4030C>T	13.37:g.39265511C>T	ENSP00000280481:p.Arg1344Cys	Somatic	0	71	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	34	22.73	Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Calx_beta,superfamily_Cadherin-like,smart_Calx_beta	p.R1344C	ENST00000280481.7	37	c.4030	CCDS31960.1	13	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	17.39	3.377434	0.61735	.	.	ENSG00000150893	ENST00000280481	T	0.54866	0.55	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	T	0.75369	0.3840	M	0.88310	2.945	0.80722	D	1	D	0.89917	1.0	D	0.63488	0.915	T	0.79727	-0.1682	10	0.72032	D	0.01	.	15.7452	0.77936	0.1446:0.8554:0.0:0.0	.	1344	Q5SZK8	FREM2_HUMAN	C	1344	ENSP00000280481:R1344C	ENSP00000280481:R1344C	R	+	1	0	FREM2	38163511	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.190000	0.72057	2.746000	0.94184	0.655000	0.94253	CGT	-	NULL		0.363	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FREM2	protein_coding	OTTHUMT00000044599.2	C	NM_207361	rs114409305		39265511	+1	no_errors	ENST00000280481	ensembl	human	known	74_37	missense	SNP	1.000	T
EHD3	30845	genome.wustl.edu	37	2	31484465	31484465	+	Missense_Mutation	SNP	C	C	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr2:31484465C>A	ENST00000322054.5	+	5	1251	c.966C>A	c.(964-966)ttC>ttA	p.F322L	EHD3_ENST00000541626.1_Intron	NM_014600.2	NP_055415.1	Q9NZN3	EHD3_HUMAN	EH-domain containing 3	322					blood coagulation (GO:0007596)|endocytic recycling (GO:0032456)|protein homooligomerization (GO:0051260)|protein targeting to plasma membrane (GO:0072661)|regulation of cardiac muscle cell membrane potential (GO:0086036)	cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|endosome membrane (GO:0010008)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|nucleic acid binding (GO:0003676)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(11)|lung(12)|ovary(1)|skin(3)	33	Acute lymphoblastic leukemia(172;0.155)					CCTCGGTGTTCGGGAAGGACA	0.567																																																	0								ENSG00000013016						147.0	135.0	139.0					2																	31484465		2203	4300	6503	EHD3	SO:0001583	missense	0			-	HGNC	AF181264	CCDS1774.1	2p21	2013-01-10			ENSG00000013016	ENSG00000013016		"""EF-hand domain containing"""	3244	protein-coding gene	gene with protein product		605891		PAST3		10673336	Standard	NM_014600		Approved		uc002rnu.3	Q9NZN3	OTTHUMG00000099365	ENST00000322054.5:c.966C>A	2.37:g.31484465C>A	ENSP00000327116:p.Phe322Leu	Somatic	0	61	0.00		0.41568620468393047	3	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	49	19.67	B4DFR5|D6W574|Q8N514|Q9NZB3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Dynamin_GTPase,superfamily_P-loop_NTPase,smart_EPS15_homology,pfscan_EF_hand_dom,pfscan_EPS15_homology	p.F322L	ENST00000322054.5	37	c.966	CCDS1774.1	2	.	.	.	.	.	.	.	.	.	.	C	17.63	3.436097	0.62955	.	.	ENSG00000013016	ENST00000322054	T	0.19938	2.11	5.83	-8.82	0.00810	.	0.000000	0.85682	D	0.000000	T	0.27967	0.0689	M	0.80982	2.52	0.80722	D	1	B	0.23806	0.091	B	0.31101	0.124	T	0.28138	-1.0053	10	0.59425	D	0.04	-17.3813	21.6523	0.99958	0.0:0.0982:0.0:0.9018	.	322	Q9NZN3	EHD3_HUMAN	L	322	ENSP00000327116:F322L	ENSP00000327116:F322L	F	+	3	2	EHD3	31337969	0.276000	0.24211	0.322000	0.25334	0.899000	0.52679	-0.396000	0.07278	-1.997000	0.00969	-0.258000	0.10820	TTC	-	superfamily_P-loop_NTPase		0.567	EHD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EHD3	protein_coding	OTTHUMT00000216810.1	C	NM_014600	-		31484465	+1	no_errors	ENST00000322054	ensembl	human	known	74_37	missense	SNP	0.751	A
SERPING1	710	genome.wustl.edu	37	11	57373454	57373454	+	Intron	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr11:57373454C>T	ENST00000278407.4	+	5	912				SERPING1_ENST00000378324.2_Intron|SERPING1_ENST00000403558.1_Intron|SERPING1_ENST00000531605.1_3'UTR|SERPING1_ENST00000340687.6_Intron|SERPING1_ENST00000378323.4_Intron	NM_000062.2	NP_000053.2	P05155	IC1_HUMAN	serpin peptidase inhibitor, clade G (C1 inhibitor), member 1						blood circulation (GO:0008015)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|complement activation, classical pathway (GO:0006958)|fibrinolysis (GO:0042730)|innate immune response (GO:0045087)|negative regulation of complement activation, lectin pathway (GO:0001869)|negative regulation of endopeptidase activity (GO:0010951)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule lumen (GO:0031093)	serine-type endopeptidase inhibitor activity (GO:0004867)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(11)|pancreas(2)|prostate(1)|urinary_tract(1)	27						GTTCAGGACTCATGCCTCCCT	0.522																																																	0								ENSG00000149131						126.0	119.0	121.0					11																	57373454		2201	4296	6497	SERPING1	SO:0001627	intron_variant	0			-	HGNC	X54486	CCDS7962.1	11q12.1	2014-09-17	2008-07-31		ENSG00000149131	ENSG00000149131		"""Serine (or cysteine) peptidase inhibitors"""	1228	protein-coding gene	gene with protein product	"""plasma protease C1 inhibitor"", ""angioedema, hereditary"""	606860	"""serine (or cysteine) proteinase inhibitor, clade G (C1 inhibitor), member 1, (angioedema, hereditary)"""	C1NH		2026152, 24172014	Standard	NM_000062		Approved	C1IN, C1-INH, HAE1, HAE2	uc001nkp.1	P05155	OTTHUMG00000150304	ENST00000278407.4:c.686-29C>T	11.37:g.57373454C>T		Somatic	0	49	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	23	25.81	A6NMU0|A8KAI9|B2R6L5|B4E1F0|B4E1H2|Q16304|Q547W3|Q59EI5|Q7Z455|Q96FE0|Q9UC49|Q9UCF9	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000278407.4	37	NULL	CCDS7962.1	11																																																																																			-	-		0.522	SERPING1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SERPING1	protein_coding	OTTHUMT00000317465.1	C	NM_000062	-		57373454	+1	no_errors	ENST00000531605	ensembl	human	known	74_37	rna	SNP	0.174	T
PIGN	23556	genome.wustl.edu	37	18	59824377	59824377	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr18:59824377G>A	ENST00000357637.5	-	6	842	c.427C>T	c.(427-429)Cct>Tct	p.P143S	PIGN_ENST00000400334.3_Missense_Mutation_p.P143S	NM_176787.4	NP_789744.1	O95427	PIGN_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class N	143					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity (GO:0016740)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	22		Colorectal(73;0.187)				GCAAACATAGGCAGGATATCT	0.358																																																	0								ENSG00000197563						68.0	66.0	67.0					18																	59824377		1834	4097	5931	PIGN	SO:0001583	missense	0			-	HGNC	AF109219	CCDS45879.1	18q21.33	2013-02-26	2006-06-28		ENSG00000197563	ENSG00000197563		"""Phosphatidylinositol glycan anchor biosynthesis"""	8967	protein-coding gene	gene with protein product		606097	"""phosphatidylinositol glycan, class N"""			10069808, 10574991	Standard	NM_012327		Approved	MDC4, PIG-N	uc021ulb.1	O95427	OTTHUMG00000180098	ENST00000357637.5:c.427C>T	18.37:g.59824377G>A	ENSP00000350263:p.Pro143Ser	Somatic	0	60	0.00		0.41568620468393047	5	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	40	18.37	Q7L8F8|Q8TC01|Q9NT05	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPI_EtnP_transferase_1_C,pfam_Phosphodiest/P_Trfase,pfam_Sulfatase,superfamily_Alkaline_phosphatase_core	p.P143S	ENST00000357637.5	37	c.427	CCDS45879.1	18	.	.	.	.	.	.	.	.	.	.	G	14.45	2.538908	0.45176	.	.	ENSG00000197563	ENST00000357637;ENST00000400334	T;T	0.70986	-0.53;-0.53	5.17	0.82	0.18793	Alkaline phosphatase-like, alpha/beta/alpha (1);Alkaline-phosphatase-like, core domain (1);	0.304009	0.36268	N	0.002699	T	0.64538	0.2607	M	0.62088	1.915	0.58432	D	0.999991	B;B	0.34147	0.438;0.219	B;B	0.41646	0.362;0.261	T	0.53194	-0.8473	9	.	.	.	-3.4853	3.2932	0.06957	0.1625:0.1353:0.5721:0.1301	.	143;143	B2RCI8;O95427	.;PIGN_HUMAN	S	143	ENSP00000350263:P143S;ENSP00000383188:P143S	.	P	-	1	0	PIGN	57975357	1.000000	0.71417	0.760000	0.31359	0.905000	0.53344	3.187000	0.50950	-0.106000	0.12110	0.561000	0.74099	CCT	-	pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core		0.358	PIGN-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_principal|CCDS	protein_coding	PIGN	protein_coding	OTTHUMT00000449757.2	G	NM_176787	-		59824377	-1	no_errors	ENST00000357637	ensembl	human	known	74_37	missense	SNP	1.000	A
FBXO10	26267	genome.wustl.edu	37	9	37537587	37537587	+	Silent	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr9:37537587G>A	ENST00000432825.2	-	3	987	c.939C>T	c.(937-939)atC>atT	p.I313I	RP11-613M10.8_ENST00000544475.1_5'UTR|FBXO10_ENST00000543968.1_5'Flank|FBXO10_ENST00000541829.1_Intron	NM_012166.2	NP_036298.2	Q9UK96	FBX10_HUMAN	F-box protein 10	313					apoptotic process (GO:0006915)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of apoptotic process (GO:0042981)	cytoplasm (GO:0005737)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(5)|large_intestine(11)|lung(15)|prostate(1)|upper_aerodigestive_tract(1)	34				GBM - Glioblastoma multiforme(29;0.0107)		GGCTGCCCTCGATAACAATGT	0.587																																																	0								ENSG00000147912						31.0	34.0	33.0					9																	37537587		1955	4130	6085	FBXO10	SO:0001819	synonymous_variant	0			-	HGNC	AF174598	CCDS47966.1	9p13.1	2014-01-29	2004-06-15		ENSG00000147912	ENSG00000147912		"""F-boxes /  ""other"""""	13589	protein-coding gene	gene with protein product		609092	"""F-box only protein 10"""			10531035, 10531037, 19300908	Standard	NM_012166		Approved	FBX10	uc004aab.3	Q9UK96	OTTHUMG00000019926	ENST00000432825.2:c.939C>T	9.37:g.37537587G>A		Somatic	0	47	0.00		0.41568620468393047	3	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	41	21.15	Q08AL3|Q08AL4|Q5JRT8|Q9UKC3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_F-box_dom,superfamily_Pectin_lyase_fold/virulence,superfamily_F-box_dom,smart_F-box_dom,smart_PbH1,smart_Carb-bd_sugar_hydrolysis-dom,pfscan_F-box_dom,tigrfam_Para_beta_helix_rpt-2	p.I313	ENST00000432825.2	37	c.939	CCDS47966.1	9																																																																																			-	NULL		0.587	FBXO10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO10	protein_coding	OTTHUMT00000052472.3	G		-		37537587	-1	no_errors	ENST00000432825	ensembl	human	known	74_37	silent	SNP	0.117	A
PGM1	5236	genome.wustl.edu	37	1	64104443	64104443	+	Silent	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr1:64104443C>T	ENST00000371084.3	+	7	1329	c.1116C>T	c.(1114-1116)tcC>tcT	p.S372S	PGM1_ENST00000371083.4_Silent_p.S390S|PGM1_ENST00000540265.1_Silent_p.S175S	NM_002633.2	NP_002624.2	P36871	PGM1_HUMAN	phosphoglucomutase 1	372					carbohydrate metabolic process (GO:0005975)|galactose catabolic process (GO:0019388)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen catabolic process (GO:0005980)|glycolytic process (GO:0006096)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	magnesium ion binding (GO:0000287)|phosphoglucomutase activity (GO:0004614)			breast(3)|endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	20						GCAAACTGTCCCTTTGTGGGG	0.483																																																	0								ENSG00000079739						160.0	151.0	154.0					1																	64104443		2203	4300	6503	PGM1	SO:0001819	synonymous_variant	0			-	HGNC	BC019920	CCDS625.1, CCDS53323.1, CCDS53324.1	1p22.1	2012-10-02			ENSG00000079739	ENSG00000079739	5.4.2.2		8905	protein-coding gene	gene with protein product		171900				4517931, 1530890	Standard	NM_002633		Approved		uc010ooz.2	P36871	OTTHUMG00000008968	ENST00000371084.3:c.1116C>T	1.37:g.64104443C>T		Somatic	0	107	0.00		0.41568620468393047	120	27.65	47	WXS	Illumina HiSeq 2500	Phase_IV	tier1	33	54	37.93	B2R5N9|B4DPV0|Q16105|Q16106|Q5BKZ9|Q6NW22|Q86U74|Q96J40|Q9NTY4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_A-D-PHexomutase_a/b/a-I,pfam_A-D-PHexomutase_a/b/a-III,pfam_A-D-PHexomutase_a/b/a-II,pfam_A-D-PHexomutase_C,superfamily_A-D-PHexomutase_a/b/a-I/II/III,prints_Alpha-D-phosphohexomutase_SF	p.S390	ENST00000371084.3	37	c.1170	CCDS625.1	1																																																																																			-	pfam_A-D-PHexomutase_a/b/a-III,superfamily_A-D-PHexomutase_a/b/a-I/II/III		0.483	PGM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PGM1	protein_coding	OTTHUMT00000024868.1	C	NM_002633	-		64104443	+1	no_errors	ENST00000371083	ensembl	human	known	74_37	silent	SNP	1.000	T
SKAP2	8935	genome.wustl.edu	37	7	26724359	26724359	+	Missense_Mutation	SNP	C	C	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr7:26724359C>A	ENST00000345317.2	-	11	1296	c.983G>T	c.(982-984)aGc>aTc	p.S328I	SKAP2_ENST00000539623.1_Missense_Mutation_p.S156I	NM_003930.3	NP_003921.2	O75563	SKAP2_HUMAN	src kinase associated phosphoprotein 2	328	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				B cell activation (GO:0042113)|negative regulation of cell proliferation (GO:0008285)|positive regulation of signal transduction (GO:0009967)|protein complex assembly (GO:0006461)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)			haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(7)|ovary(1)|pancreas(1)|skin(3)	17						TCTTACCTTGCTAAGAATGTA	0.373																																																	0								ENSG00000005020						95.0	88.0	90.0					7																	26724359		2203	4300	6503	SKAP2	SO:0001583	missense	0			-	HGNC		CCDS5400.1	7p15.2	2013-01-10	2006-09-28	2006-09-28	ENSG00000005020	ENSG00000005020		"""Pleckstrin homology (PH) domain containing"""	15687	protein-coding gene	gene with protein product		605215	"""src family associated phosphoprotein 2"""	SCAP2		9837776, 9755858	Standard	NM_003930		Approved	RA70, SKAP-HOM, SKAP55R, SAPS	uc003syc.3	O75563	OTTHUMG00000023495	ENST00000345317.2:c.983G>T	7.37:g.26724359C>A	ENSP00000005587:p.Ser328Ile	Somatic	0	49	0.00		0.41568620468393047	16	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	22	12.00	A4D173|Q53GP6|Q75MK6|Q75MZ4|Q9UBZ3|Q9UED8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Pleckstrin_homology,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_SH3_domain,pfscan_Pleckstrin_homology,pfscan_SH3_domain,prints_SH3_domain	p.S328I	ENST00000345317.2	37	c.983	CCDS5400.1	7	.	.	.	.	.	.	.	.	.	.	C	26.8	4.770292	0.90108	.	.	ENSG00000005020	ENST00000345317;ENST00000539623;ENST00000535331	T;T	0.32515	1.45;1.45	6.17	6.17	0.99709	Src homology-3 domain (5);	0.000000	0.85682	D	0.000000	T	0.61299	0.2336	M	0.77103	2.36	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.60964	-0.7158	10	0.87932	D	0	-14.2648	20.8794	0.99867	0.0:1.0:0.0:0.0	.	313;328	B7Z5N4;O75563	.;SKAP2_HUMAN	I	328;156;313	ENSP00000005587:S328I;ENSP00000443593:S156I	ENSP00000005587:S328I	S	-	2	0	SKAP2	26690884	1.000000	0.71417	0.999000	0.59377	0.993000	0.82548	7.270000	0.78493	2.941000	0.99782	0.655000	0.94253	AGC	-	pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain,prints_SH3_domain		0.373	SKAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SKAP2	protein_coding	OTTHUMT00000214128.1	C		-		26724359	-1	no_errors	ENST00000345317	ensembl	human	known	74_37	missense	SNP	1.000	A
CCDC7	79741	genome.wustl.edu	37	10	32833209	32833209	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr10:32833209G>A	ENST00000362006.5	+	14	1657	c.1114G>A	c.(1114-1116)Gaa>Aaa	p.E372K	CCDC7_ENST00000277657.6_Missense_Mutation_p.E372K|C10orf68_ENST00000572165.1_3'UTR	NM_145023.4	NP_659460.3	Q96M83	CCDC7_HUMAN	coiled-coil domain containing 7	372										NS(1)|breast(2)|cervix(1)|endometrium(1)|large_intestine(3)|lung(4)|prostate(2)	14		Breast(68;0.000207)|Prostate(175;0.0107)				TAAAATAAAAGAAGATTTGGA	0.303																																																	0								ENSG00000216937						82.0	85.0	84.0					10																	32833209		2203	4287	6490	CCDC7	SO:0001583	missense	0			-	HGNC	BC022020	CCDS7173.1	10p11.23	2013-12-13			ENSG00000216937	ENSG00000216937			26533	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 68"""	C10orf68		12477932	Standard	NM_024688		Approved	FLJ32762, FLJ13031	uc001iwk.3	Q96M83	OTTHUMG00000150517	ENST00000362006.5:c.1114G>A	10.37:g.32833209G>A	ENSP00000355078:p.Glu372Lys	Somatic	0	50	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	17	15.00	Q5VW55|Q8IVQ0|Q8NEQ0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.E372K	ENST00000362006.5	37	c.1114	CCDS7173.1	10	.	.	.	.	.	.	.	.	.	.	G	13.59	2.283173	0.40394	.	.	ENSG00000216937	ENST00000277657;ENST00000362006;ENST00000435402	T;T;T	0.55588	1.17;1.17;0.51	2.91	2.91	0.33838	.	.	.	.	.	T	0.27063	0.0663	N	0.14661	0.345	0.80722	D	1	P	0.41947	0.766	B	0.31101	0.124	T	0.06516	-1.0822	9	0.27785	T	0.31	.	9.519	0.39124	0.0:0.0:1.0:0.0	.	372	Q96M83	CCDC7_HUMAN	K	372;372;41	ENSP00000277657:E372K;ENSP00000355078:E372K;ENSP00000401923:E41K	ENSP00000277657:E372K	E	+	1	0	CCDC7	32873215	0.132000	0.22450	0.558000	0.28319	0.289000	0.27227	2.049000	0.41288	1.898000	0.54952	0.650000	0.86243	GAA	-	NULL		0.303	CCDC7-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	CCDC7	protein_coding	OTTHUMT00000047490.1	G	NM_145023	-		32833209	+1	no_errors	ENST00000277657	ensembl	human	known	74_37	missense	SNP	0.671	A
ZNF566	84924	genome.wustl.edu	37	19	36940504	36940504	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr19:36940504G>A	ENST00000434377.2	-	5	713	c.632C>T	c.(631-633)cCc>cTc	p.P211L	ZNF566_ENST00000392170.2_Missense_Mutation_p.P212L|ZNF566_ENST00000424129.2_Missense_Mutation_p.P211L|ZNF566_ENST00000454319.1_Missense_Mutation_p.P212L|ZNF566_ENST00000493391.1_Missense_Mutation_p.P107L	NM_032838.4	NP_116227.1	Q969W8	ZN566_HUMAN	zinc finger protein 566	211					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(12)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	24	Esophageal squamous(110;0.162)					GAGTCTTGAGGGATGTCTAAA	0.383																																																	0								ENSG00000186017						80.0	81.0	80.0					19																	36940504		2203	4300	6503	ZNF566	SO:0001583	missense	0			-	HGNC	AK074497	CCDS12494.1, CCDS46061.1, CCDS74346.1	19q13.12	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	25919	protein-coding gene	gene with protein product						12477932	Standard	NM_001145343		Approved	FLJ14779, MGC12515	uc010xtf.2	Q969W8		ENST00000434377.2:c.632C>T	19.37:g.36940504G>A	ENSP00000415520:p.Pro211Leu	Somatic	0	68	0.00		0.41568620468393047	1	75.00	3	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	36	21.74	B7ZL95|Q2M3J1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.P212L	ENST00000434377.2	37	c.635	CCDS12494.1	19	.	.	.	.	.	.	.	.	.	.	G	2.050	-0.417870	0.04766	.	.	ENSG00000186017	ENST00000454319;ENST00000434377;ENST00000392170;ENST00000424129;ENST00000452939	T;T;T;T;T	0.14266	2.52;2.52;2.52;2.52;2.53	3.98	0.264	0.15607	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.158580	0.30177	N	0.010233	T	0.06508	0.0167	L	0.28740	0.885	0.37435	D	0.914209	B;B	0.06786	0.001;0.001	B;B	0.16722	0.003;0.016	T	0.28776	-1.0033	10	0.10636	T	0.68	.	1.9429	0.03350	0.1181:0.2031:0.4699:0.2089	.	212;211	B7ZL95;Q969W8	.;ZN566_HUMAN	L	212;211;212;211;211	ENSP00000394207:P212L;ENSP00000415520:P211L;ENSP00000376010:P212L;ENSP00000401259:P211L;ENSP00000411526:P211L	ENSP00000376010:P212L	P	-	2	0	ZNF566	41632344	0.001000	0.12720	0.986000	0.45419	0.767000	0.43475	0.285000	0.18883	0.432000	0.26286	0.555000	0.69702	CCC	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.383	ZNF566-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF566	protein_coding	OTTHUMT00000341054.1	G	NM_032838	-		36940504	-1	no_errors	ENST00000392170	ensembl	human	known	74_37	missense	SNP	0.950	A
PSMG1	8624	genome.wustl.edu	37	21	40552221	40552221	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr21:40552221G>A	ENST00000331573.3	-	3	848	c.383C>T	c.(382-384)tCc>tTc	p.S128F	PSMG1_ENST00000380900.2_Missense_Mutation_p.S128F	NM_001261824.1|NM_003720.3	NP_001248753.1|NP_003711.1	O95456	PSMG1_HUMAN	proteasome (prosome, macropain) assembly chaperone 1	128					cerebellar granule cell precursor proliferation (GO:0021930)|proteasome assembly (GO:0043248)|proteasome core complex assembly (GO:0080129)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)				autonomic_ganglia(1)|endometrium(2)|large_intestine(1)|lung(1)|skin(1)|urinary_tract(2)	8		Prostate(19;8.44e-08)				CGAGGGATTGGATTTTAGATG	0.368																																																	0								ENSG00000183527						81.0	75.0	77.0					21																	40552221		2203	4300	6503	PSMG1	SO:0001583	missense	0			-	HGNC	AJ006291	CCDS13660.1, CCDS13661.1	21q22.3	2007-10-23	2007-10-23	2007-10-23	ENSG00000183527	ENSG00000183527			3043	protein-coding gene	gene with protein product		605296	"""Down syndrome critical region gene 2"""	DSCR2		10872820, 17189198	Standard	NM_003720		Approved	c21-LRP, LRPC21, PAC1	uc002yxi.4	O95456	OTTHUMG00000066034	ENST00000331573.3:c.383C>T	21.37:g.40552221G>A	ENSP00000329915:p.Ser128Phe	Somatic	0	82	0.00		0.41568620468393047	33	23.26	10	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	36	26.53	B5BUN2|Q6FHA3|Q6FHD3|Q6S713	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_Proteasome_assmbl_chp_1	p.S128F	ENST00000331573.3	37	c.383	CCDS13660.1	21	.	.	.	.	.	.	.	.	.	.	G	15.25	2.778471	0.49786	.	.	ENSG00000183527	ENST00000331573;ENST00000380900	T;T	0.52295	0.67;0.67	5.7	3.87	0.44632	.	0.563750	0.19642	N	0.109435	T	0.55081	0.1898	M	0.69823	2.125	0.09310	N	0.999993	P;P	0.45212	0.853;0.853	P;P	0.49999	0.628;0.558	T	0.50915	-0.8771	10	0.87932	D	0	-2.8084	8.816	0.34996	0.0804:0.1501:0.7695:0.0	.	128;128	O95456-2;O95456	.;PSMG1_HUMAN	F	128	ENSP00000329915:S128F;ENSP00000370286:S128F	ENSP00000329915:S128F	S	-	2	0	PSMG1	39474091	0.999000	0.42202	0.008000	0.14137	0.788000	0.44548	3.527000	0.53517	0.731000	0.32448	0.557000	0.71058	TCC	-	pirsf_Proteasome_assmbl_chp_1		0.368	PSMG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMG1	protein_coding	OTTHUMT00000141404.2	G	NM_003720	-		40552221	-1	no_errors	ENST00000331573	ensembl	human	known	74_37	missense	SNP	0.083	A
DCAF8L1	139425	genome.wustl.edu	37	X	27998918	27998918	+	Silent	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chrX:27998918C>T	ENST00000441525.1	-	1	648	c.534G>A	c.(532-534)ggG>ggA	p.G178G		NM_001017930.1	NP_001017930.1	A6NGE4	DC8L1_HUMAN	DDB1 and CUL4 associated factor 8-like 1	178										NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(24)|ovary(3)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	56						AGGTTCTTGCCCCACAGGCCT	0.572																																																	0								ENSG00000226372						36.0	32.0	33.0					X																	27998918		2202	4300	6502	DCAF8L1	SO:0001819	synonymous_variant	0			-	HGNC		CCDS35222.1	Xp22.11	2013-01-09	2009-07-17	2009-07-17	ENSG00000226372	ENSG00000226372		"""WD repeat domain containing"""	31810	protein-coding gene	gene with protein product			"""WD repeat domain 42B"""	WDR42B			Standard	NM_001017930		Approved		uc004dbx.1	A6NGE4	OTTHUMG00000021312	ENST00000441525.1:c.534G>A	X.37:g.27998918C>T		Somatic	0	28	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	5	66.67	B3KXX1	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.G178	ENST00000441525.1	37	c.534	CCDS35222.1	X																																																																																			-	NULL		0.572	DCAF8L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF8L1	protein_coding	OTTHUMT00000056150.2	C	XM_066690	-		27998918	-1	no_errors	ENST00000441525	ensembl	human	known	74_37	silent	SNP	1.000	T
DNAJC10	54431	genome.wustl.edu	37	2	183582840	183582840	+	Silent	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr2:183582840C>T	ENST00000264065.7	+	3	442	c.27C>T	c.(25-27)gaC>gaT	p.D9D	DNAJC10_ENST00000537515.1_Silent_p.D9D|DNAJC10_ENST00000469118.1_Intron	NM_018981.1	NP_061854.1	Q8IXB1	DJC10_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 10	9					cell redox homeostasis (GO:0045454)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of ATPase activity (GO:0032781)|protein folding in endoplasmic reticulum (GO:0034975)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum chaperone complex (GO:0034663)|endoplasmic reticulum lumen (GO:0005788)|membrane (GO:0016020)	ATPase activator activity (GO:0001671)|ATPase binding (GO:0051117)|chaperone binding (GO:0051087)|disulfide oxidoreductase activity (GO:0015036)|Hsp70 protein binding (GO:0030544)|misfolded protein binding (GO:0051787)|oxidoreductase activity, acting on a sulfur group of donors, disulfide as acceptor (GO:0016671)|protein disulfide oxidoreductase activity (GO:0015035)			breast(3)|endometrium(1)|kidney(4)|large_intestine(7)|lung(15)|ovary(1)|skin(1)	32			OV - Ovarian serous cystadenocarcinoma(117;0.0942)|Epithelial(96;0.209)			ATAAAGATGACTATATCAGAG	0.353																																					Pancreas(56;860 1183 25669 35822 48585)												0								ENSG00000077232						95.0	98.0	97.0					2																	183582840		2203	4300	6503	DNAJC10	SO:0001819	synonymous_variant	0			-	HGNC		CCDS33345.1, CCDS74613.1	2q32.1	2011-11-23			ENSG00000077232	ENSG00000077232		"""Heat shock proteins / DNAJ (HSP40)"", ""Protein disulfide isomerases"""	24637	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 19"""	607987				12411443, 12446677	Standard	NM_018981		Approved	ERdj5, PDIA19	uc002uow.2	Q8IXB1	OTTHUMG00000154209	ENST00000264065.7:c.27C>T	2.37:g.183582840C>T		Somatic	0	57	0.00		0.41568620468393047	11	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	34	24.44	Q17RJ6|Q3B7W8|Q4ZG06|Q53QT7|Q6UWZ6|Q86T61|Q8NC82|Q8TD87|Q96K38|Q96K44|Q96K54|Q9NSY6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Thioredoxin_domain,pfam_DnaJ_domain,superfamily_Thioredoxin-like_fold,superfamily_DnaJ_domain,smart_DnaJ_domain,pirsf_DnaJ_homolog_subfam-C,pfscan_DnaJ_domain,prints_DnaJ_domain,prints_Thioredoxin	p.D9	ENST00000264065.7	37	c.27	CCDS33345.1	2																																																																																			-	pirsf_DnaJ_homolog_subfam-C		0.353	DNAJC10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC10	protein_coding	OTTHUMT00000334418.2	C	NM_018981	-		183582840	+1	no_errors	ENST00000264065	ensembl	human	known	74_37	silent	SNP	0.025	T
SNW1	22938	genome.wustl.edu	37	14	78184492	78184492	+	Missense_Mutation	SNP	G	G	C			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr14:78184492G>C	ENST00000261531.7	-	14	1612	c.1550C>G	c.(1549-1551)cCc>cGc	p.P517R	SLIRP_ENST00000557623.1_Intron|SNW1_ENST00000554775.1_Missense_Mutation_p.P355R|SLIRP_ENST00000557431.1_Intron|SNW1_ENST00000555761.1_Missense_Mutation_p.P544A	NM_012245.2	NP_036377.1	Q13573	SNW1_HUMAN	SNW domain containing 1	517					cellular response to retinoic acid (GO:0071300)|gene expression (GO:0010467)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of vitamin D receptor signaling pathway (GO:0070564)|regulation of retinoic acid receptor signaling pathway (GO:0048385)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of vitamin D receptor signaling pathway (GO:0070562)|retinoic acid receptor signaling pathway (GO:0048384)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	catalytic step 2 spliceosome (GO:0071013)|chromatin (GO:0000785)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	Notch binding (GO:0005112)|nuclear hormone receptor binding (GO:0035257)|poly(A) RNA binding (GO:0044822)|retinoic acid receptor binding (GO:0042974)|SMAD binding (GO:0046332)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|vitamin D receptor binding (GO:0042809)			NS(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	24			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0291)		GCTATCTGAGGGTCTTTTAGA	0.488																																																	0								ENSG00000100603						176.0	177.0	177.0					14																	78184492		2203	4300	6503	SNW1	SO:0001583	missense	0			-	HGNC	AF045184	CCDS9867.1	14q22.1-q22.3	2005-09-13	2005-09-13	2005-09-13		ENSG00000100603			16696	protein-coding gene	gene with protein product		603055	"""SKI interacting protein"""	SKIIP		8973337, 9632709	Standard	NM_012245		Approved	NCoA-62, SKIP, Prp45, PRPF45, Bx42	uc001xuf.3	Q13573		ENST00000261531.7:c.1550C>G	14.37:g.78184492G>C	ENSP00000261531:p.Pro517Arg	Somatic	0	53	0.00		0.41568620468393047	222	23.45	68	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	30	18.92	A8K8A9|Q13483|Q32N03|Q5D0D6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SKI-int_prot_SKIP_SNW-dom,superfamily_Signal_recog_particl_SRP54_hlx	p.P517R	ENST00000261531.7	37	c.1550	CCDS9867.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.03|11.03	1.518385|1.518385	0.27211|0.27211	.|.	.|.	ENSG00000100603|ENSG00000100603	ENST00000555761|ENST00000261531;ENST00000554775	.|.	.|.	.|.	5.68|5.68	5.68|5.68	0.88126|0.88126	.|.	0.000000|0.000000	0.85682|0.85682	D|D	0.000000|0.000000	T|T	0.35711|0.35711	0.0941|0.0941	N|N	0.08118|0.08118	0|0	0.32546|0.32546	N|N	0.533049|0.533049	B|B	0.02656|0.15719	0.0|0.014	B|B	0.04013|0.11329	0.001|0.006	T|T	0.24621|0.24621	-1.0155|-1.0155	8|9	.|0.19147	.|T	.|0.46	.|.	19.7896|19.7896	0.96452|0.96452	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	544|517	G3V3A4|Q13573	.|SNW1_HUMAN	A|R	544|517;355	.|.	.|ENSP00000261531:P517R	P|P	-|-	1|2	0|0	SNW1|SNW1	77254245|77254245	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	9.143000|9.143000	0.94623|0.94623	2.694000|2.694000	0.91930|0.91930	0.467000|0.467000	0.42956|0.42956	CCT|CCC	-	NULL		0.488	SNW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNW1	protein_coding	OTTHUMT00000413912.1	G	NM_012245	-		78184492	-1	no_errors	ENST00000261531	ensembl	human	known	74_37	missense	SNP	1.000	C
PLCB1	23236	genome.wustl.edu	37	20	8708034	8708034	+	Missense_Mutation	SNP	T	T	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr20:8708034T>A	ENST00000338037.6	+	17	1784	c.1757T>A	c.(1756-1758)tTt>tAt	p.F586Y	PLCB1_ENST00000494924.1_3'UTR|PLCB1_ENST00000378637.2_Missense_Mutation_p.F586Y|PLCB1_ENST00000378641.3_Missense_Mutation_p.F586Y	NM_015192.2	NP_056007.1	Q9NQ66	PLCB1_HUMAN	phospholipase C, beta 1 (phosphoinositide-specific)	586	PI-PLC Y-box. {ECO:0000255|PROSITE- ProRule:PRU00271}.				activation of meiosis involved in egg activation (GO:0060466)|cerebral cortex development (GO:0021987)|fat cell differentiation (GO:0045444)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G2/M transition of mitotic cell cycle (GO:0000086)|glutamate receptor signaling pathway (GO:0007215)|inositol phosphate metabolic process (GO:0043647)|insulin-like growth factor receptor signaling pathway (GO:0048009)|interleukin-1-mediated signaling pathway (GO:0070498)|interleukin-12-mediated signaling pathway (GO:0035722)|interleukin-15-mediated signaling pathway (GO:0035723)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|memory (GO:0007613)|negative regulation of monocyte extravasation (GO:2000438)|negative regulation of transcription, DNA-templated (GO:0045892)|phosphatidylinositol metabolic process (GO:0046488)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of CD24 biosynthetic process (GO:2000560)|positive regulation of developmental growth (GO:0048639)|positive regulation of embryonic development (GO:0040019)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of GTPase activity (GO:0043547)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of JNK cascade (GO:0046330)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fertilization (GO:0080154)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|phosphatidylinositol phospholipase C activity (GO:0004435)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein homodimerization activity (GO:0042803)|signal transducer activity (GO:0004871)			NS(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(11)|liver(2)|lung(41)|ovary(4)|prostate(3)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	95						CCAGTGGAATTTGTAGAGTAT	0.358																																																	0								ENSG00000182621						78.0	74.0	76.0					20																	8708034		2203	4299	6502	PLCB1	SO:0001583	missense	0			-	HGNC	AB011153	CCDS13102.1, CCDS13103.1	20p12	2008-03-18			ENSG00000182621	ENSG00000182621	3.1.4.11		15917	protein-coding gene	gene with protein product		607120				10760467, 11118617	Standard	NM_015192		Approved	KIAA0581, PLC-I, PLC154	uc002wnb.4	Q9NQ66	OTTHUMG00000031849	ENST00000338037.6:c.1757T>A	20.37:g.8708034T>A	ENSP00000338185:p.Phe586Tyr	Somatic	0	50	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	27	12.90	D3DW12|D3DW13|O60325|Q17RQ6|Q5TFF7|Q5TGC9|Q8IV93|Q9BQW2|Q9H4H2|Q9H8H5|Q9NQ65|Q9NQH9|Q9NTH4|Q9UJP6|Q9UM26	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_PLC-beta,pfam_PLC-beta_C,pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_PLipase_C_EF-hand-like,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_dom,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_dom,prints_Pinositol_PLipase_C,pfscan_C2_dom,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y	p.F586Y	ENST00000338037.6	37	c.1757	CCDS13102.1	20	.	.	.	.	.	.	.	.	.	.	T	32	5.158398	0.94686	.	.	ENSG00000182621	ENST00000378641;ENST00000338037;ENST00000378637;ENST00000441163;ENST00000535719	T;T;T	0.68624	-0.34;-0.34;-0.34	5.77	5.77	0.91146	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);Phospholipase C, phosphatidylinositol-specific, Y domain (3);	0.124882	0.64402	D	0.000015	D	0.84297	0.5441	M	0.86953	2.85	0.58432	D	0.999998	P;D	0.76494	0.844;0.999	D;D	0.91635	0.93;0.999	D	0.87072	0.2160	10	0.87932	D	0	.	16.3892	0.83528	0.0:0.0:0.0:1.0	.	586;586	Q9NQ66;Q9NQ66-2	PLCB1_HUMAN;.	Y	586;586;586;506;506	ENSP00000367908:F586Y;ENSP00000338185:F586Y;ENSP00000367904:F586Y	ENSP00000338185:F586Y	F	+	2	0	PLCB1	8656034	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.040000	0.89188	2.330000	0.79161	0.477000	0.44152	TTT	-	pirsf_PLC-beta,pfam_PLipase_C_Pinositol-sp_Y,superfamily_PLC-like_Pdiesterase_TIM-brl,smart_PLipase_C_Pinositol-sp_Y,pfscan_PLipase_C_Pinositol-sp_Y		0.358	PLCB1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PLCB1	protein_coding	OTTHUMT00000077938.3	T		-		8708034	+1	no_errors	ENST00000338037	ensembl	human	known	74_37	missense	SNP	1.000	A
ABCC3	8714	genome.wustl.edu	37	17	48755231	48755231	+	Missense_Mutation	SNP	G	G	C	rs139738090		TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr17:48755231G>C	ENST00000285238.8	+	24	3585	c.3505G>C	c.(3505-3507)Gat>Cat	p.D1169H		NM_003786.3	NP_003777.2	O15438	MRP3_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 3	1169	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(11)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	33			BRCA - Breast invasive adenocarcinoma(22;3.05e-09)		Cisplatin(DB00515)|Clotrimazole(DB00257)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Doxorubicin(DB00997)|Etoposide(DB00773)|Ezetimibe(DB00973)|Fluorouracil(DB00544)|Folic Acid(DB00158)|Gadoxetate(DB08884)|Glutathione(DB00143)|Glyburide(DB01016)|Indomethacin(DB00328)|Lamivudine(DB00709)|Leucovorin(DB00650)|Methotrexate(DB00563)|Metyrapone(DB01011)|Nifedipine(DB01115)|Omeprazole(DB00338)|Phenobarbital(DB01174)|Probenecid(DB01032)|Rifampicin(DB01045)|Sulfinpyrazone(DB01138)|Verapamil(DB00661)|Vincristine(DB00541)	CCGCAGCCGGGATTTTGAGAT	0.562																																																	0								ENSG00000108846						112.0	118.0	116.0					17																	48755231		2203	4300	6503	ABCC3	SO:0001583	missense	0			-	HGNC	Y17151	CCDS32681.1, CCDS45739.1	17q21	2012-03-14			ENSG00000108846	ENSG00000108846		"""ATP binding cassette transporters / subfamily C"""	54	protein-coding gene	gene with protein product	"""canalicular multispecific organic anion transporter 2"""	604323				8894702, 9827529	Standard	NM_003786		Approved	MRP3, cMOAT2, EST90757, MLP2, MOAT-D	uc002isl.3	O15438	OTTHUMG00000162245	ENST00000285238.8:c.3505G>C	17.37:g.48755231G>C	ENSP00000285238:p.Asp1169His	Somatic	0	43	0.00		0.41568620468393047	0	100.00	5	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	40	11.11	B2RPA9|D3DTX9|O60265|O60922|O75621|O95078|O95289|O95290|Q86X85|Q9UN52	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC1_TM_dom,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom,tigrfam_Multidrug-R_assoc	p.D1169H	ENST00000285238.8	37	c.3505	CCDS32681.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.56|12.56	1.973412|1.973412	0.34848|0.34848	.|.	.|.	ENSG00000108846|ENSG00000108846	ENST00000285238|ENST00000513745	D|.	0.89617|.	-2.54|.	5.7|5.7	5.7|5.7	0.88788|0.88788	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);|.	0.355758|.	0.30723|.	N|.	0.009011|.	T|T	0.46151|0.46151	0.1378|0.1378	L|L	0.45228|0.45228	1.405|1.405	0.31440|0.31440	N|N	0.672027|0.672027	D|.	0.63046|.	0.992|.	P|.	0.62813|.	0.907|.	T|T	0.52457|0.52457	-0.8573|-0.8573	10|5	0.87932|.	D|.	0|.	-27.572|-27.572	8.8074|8.8074	0.34945|0.34945	0.0729:0.0:0.7071:0.22|0.0729:0.0:0.7071:0.22	.|.	1169|.	O15438|.	MRP3_HUMAN|.	H|A	1169|272	ENSP00000285238:D1169H|.	ENSP00000285238:D1169H|.	D|G	+|+	1|2	0|0	ABCC3|ABCC3	46110230|46110230	0.077000|0.077000	0.21312|0.21312	0.821000|0.821000	0.32701|0.32701	0.020000|0.020000	0.10135|0.10135	2.629000|2.629000	0.46485|0.46485	2.687000|2.687000	0.91594|0.91594	0.655000|0.655000	0.94253|0.94253	GAT|GGA	-	pfam_ABC_transptr_TM_dom,superfamily_ABC1_TM_dom,pfscan_ABC1_TM_dom,tigrfam_Multidrug-R_assoc		0.562	ABCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCC3	protein_coding	OTTHUMT00000368083.2	G	NM_020038	-		48755231	+1	no_errors	ENST00000285238	ensembl	human	known	74_37	missense	SNP	0.922	C
OR4K15	81127	genome.wustl.edu	37	14	20443867	20443867	+	Silent	SNP	T	T	C			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr14:20443867T>C	ENST00000305051.5	+	1	265	c.190T>C	c.(190-192)Ttg>Ctg	p.L64L		NM_001005486.1	NP_001005486.1	Q8NH41	OR4KF_HUMAN	olfactory receptor, family 4, subfamily K, member 15	64						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|kidney(2)|large_intestine(6)|lung(23)|ovary(1)|prostate(2)|skin(1)|stomach(1)	39	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;3.58e-06)	GBM - Glioblastoma multiforme(265;0.00327)		AGCAATTCTGTTGGGCAACTT	0.438																																																	0								ENSG00000169488						106.0	122.0	116.0					14																	20443867		2203	4299	6502	OR4K15	SO:0001819	synonymous_variant	0			-	HGNC		CCDS32026.1	14q11.2	2013-09-23			ENSG00000169488	ENSG00000169488		"""GPCR / Class A : Olfactory receptors"""	15353	protein-coding gene	gene with protein product							Standard	NM_001005486		Approved	OR4K15Q	uc010tkx.2	Q8NH41	OTTHUMG00000170635	ENST00000305051.5:c.190T>C	14.37:g.20443867T>C		Somatic	0	95	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	89	15.24	B9EIL3|Q6IEZ4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L64	ENST00000305051.5	37	c.190	CCDS32026.1	14																																																																																			-	pfam_7TM_GPCR_olfarory/Srsx,prints_GPCR_Rhodpsn		0.438	OR4K15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4K15	protein_coding	OTTHUMT00000409883.1	T		-		20443867	+1	no_errors	ENST00000305051	ensembl	human	known	74_37	silent	SNP	0.004	C
MROH5	389690	genome.wustl.edu	37	8	142447003	142447003	+	RNA	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr8:142447003C>T	ENST00000606664.1	+	0	2359				MROH5_ENST00000430863.1_RNA																							GCACTAGGACCCGCTGGCCCC	0.697																																																	0								ENSG00000271959						11.0	13.0	12.0					8																	142447003		2009	4116	6125	CTD-3064M3.7			0			-	Clone_based_vega_gene																													8.37:g.142447003C>T		Somatic	0	19	0.00		0.41568620468393047	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	13	35.00		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000606664.1	37	NULL		8																																																																																			-	-		0.697	CTD-3064M3.7-001	KNOWN	non_canonical_TEC|basic	antisense	ENSG00000271959	antisense	OTTHUMT00000470872.1	C		-		142447003	+1	no_errors	ENST00000606664	ensembl	human	known	74_37	rna	SNP	0.035	T
EFTUD1	79631	genome.wustl.edu	37	15	82444423	82444423	+	Missense_Mutation	SNP	A	A	G			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr15:82444423A>G	ENST00000268206.7	-	18	2540	c.2372T>C	c.(2371-2373)aTg>aCg	p.M791T	EFTUD1_ENST00000359445.3_Missense_Mutation_p.M740T	NM_024580.5	NP_078856.4	Q7Z2Z2	ETUD1_HUMAN	elongation factor Tu GTP binding domain containing 1	791					GTP catabolic process (GO:0006184)|mature ribosome assembly (GO:0042256)		GTP binding (GO:0005525)|GTPase activity (GO:0003924)|ribosome binding (GO:0043022)|translation elongation factor activity (GO:0003746)			cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(14)|ovary(1)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	32						CTGATGAATCATGTGAGTATT	0.408																																																	0								ENSG00000140598						94.0	86.0	89.0					15																	82444423		1845	4099	5944	EFTUD1	SO:0001583	missense	0			-	HGNC	AK056656	CCDS42070.1, CCDS42071.1	15q25.2	2012-07-04			ENSG00000140598	ENSG00000140598			25789	protein-coding gene	gene with protein product	"""ribosome assembly 1 homolog (yeast)"""					14702039	Standard	NM_024580		Approved	FLJ13119, FAM42A, HsT19294, RIA1	uc002bgt.1	Q7Z2Z2	OTTHUMG00000172573	ENST00000268206.7:c.2372T>C	15.37:g.82444423A>G	ENSP00000268206:p.Met791Thr	Somatic	0	43	0.00		0.41568620468393047	7	50.00	7	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	20	35.48	A6NKY5|B7Z6I0|Q9H8Z6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_EF_GTP-bd_dom,pfam_EFG_V,pfam_Transl_elong_EFTu/EF1A_2,superfamily_P-loop_NTPase,superfamily_Ribosomal_S5_D2-typ_fold,superfamily_EFG_III-V,superfamily_Transl_B-barrel,smart_EFG_V,prints_EF_GTP-bd_dom,tigrfam_Small_GTP-bd_dom	p.M791T	ENST00000268206.7	37	c.2372	CCDS42071.1	15	.	.	.	.	.	.	.	.	.	.	A	0.006	-2.101217	0.00360	.	.	ENSG00000140598	ENST00000268206;ENST00000359445	T;T	0.26957	1.7;1.7	5.94	-0.787	0.10943	Ribosomal protein S5 domain 2-type fold (1);Ribosomal protein S5 domain 2-type fold, subgroup (1);	3.010640	0.01413	N	0.014073	T	0.12561	0.0305	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.16276	-1.0408	10	0.15499	T	0.54	-10.8567	5.2591	0.15563	0.2291:0.0:0.3345:0.4364	.	740;791	Q7Z2Z2-2;Q7Z2Z2	.;ETUD1_HUMAN	T	791;740	ENSP00000268206:M791T;ENSP00000352418:M740T	ENSP00000268206:M791T	M	-	2	0	EFTUD1	80231478	0.007000	0.16637	0.000000	0.03702	0.018000	0.09664	0.787000	0.26858	-0.153000	0.11137	0.460000	0.39030	ATG	-	superfamily_Ribosomal_S5_D2-typ_fold		0.408	EFTUD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	EFTUD1	protein_coding	OTTHUMT00000419252.1	A	NM_024580	-		82444423	-1	no_errors	ENST00000268206	ensembl	human	known	74_37	missense	SNP	0.000	G
KLHL30	377007	genome.wustl.edu	37	2	239054443	239054443	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr2:239054443G>A	ENST00000409223.1	+	5	1227	c.1120G>A	c.(1120-1122)Gcc>Acc	p.A374T	KLHL30_ENST00000305959.4_Missense_Mutation_p.A356T			Q0D2K2	KLH30_HUMAN	kelch-like family member 30	374										lung(4)	4		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_hematologic(139;0.158)|all_lung(227;0.198)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;4.71e-24)|OV - Ovarian serous cystadenocarcinoma(60;3.02e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.63e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000109)|Lung(119;0.0108)|LUSC - Lung squamous cell carcinoma(224;0.0253)		CGCCAGCGCGGCCCTCAATGG	0.657																																																	0								ENSG00000168427						25.0	33.0	30.0					2																	239054443		2045	4175	6220	KLHL30	SO:0001583	missense	0			-	HGNC		CCDS46555.1, CCDS46555.2	2q37.3	2013-02-22	2013-02-22		ENSG00000168427	ENSG00000168427		"""Kelch-like"", ""BTB/POZ domain containing"""	24770	protein-coding gene	gene with protein product			"""kelch-like 30 (Drosophila)"""				Standard	NM_198582		Approved	FLJ43374	uc002vxr.2	Q0D2K2	OTTHUMG00000152905	ENST00000409223.1:c.1120G>A	2.37:g.239054443G>A	ENSP00000386389:p.Ala374Thr	Somatic	0	67	0.00		0.41568620468393047	6	40.00	4	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	30	21.05	Q6ZUS1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Kelch_1,pfam_BTB_POZ,pfam_BACK,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.A374T	ENST00000409223.1	37	c.1120	CCDS46555.2	2	.	.	.	.	.	.	.	.	.	.	G	11.86	1.764622	0.31228	.	.	ENSG00000168427	ENST00000409223;ENST00000305959	T;T	0.77620	-1.11;-1.11	4.62	4.62	0.57501	Kelch-type beta propeller (1);	0.295460	0.31963	N	0.006783	T	0.63022	0.2476	N	0.17278	0.47	0.09310	N	1	B	0.29378	0.243	B	0.31686	0.134	T	0.55774	-0.8088	10	0.33940	T	0.23	.	11.4977	0.50419	0.0:0.0:0.8202:0.1798	.	374	Q0D2K2	KLH30_HUMAN	T	374;356	ENSP00000386389:A374T;ENSP00000302386:A356T	ENSP00000302386:A356T	A	+	1	0	KLHL30	238719182	0.980000	0.34600	0.111000	0.21465	0.706000	0.40770	3.744000	0.55112	2.113000	0.64589	0.542000	0.68232	GCC	-	pfam_Kelch_1,smart_Kelch_1,pirsf_Kelch-like_gigaxonin		0.657	KLHL30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL30	protein_coding	OTTHUMT00000328518.1	G	NM_198582	-		239054443	+1	no_errors	ENST00000409223	ensembl	human	known	74_37	missense	SNP	0.080	A
CDH10	1008	genome.wustl.edu	37	5	24537506	24537506	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr5:24537506G>A	ENST00000264463.4	-	3	1016	c.509C>T	c.(508-510)cCc>cTc	p.P170L		NM_006727.3	NP_006718.2	Q9Y6N8	CAD10_HUMAN	cadherin 10, type 2 (T2-cadherin)	170	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(29)|lung(111)|ovary(6)|pancreas(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)	185				STAD - Stomach adenocarcinoma(35;0.0556)		AGACATTTCGGGAACACTAGC	0.338										HNSCC(23;0.051)																																							0								ENSG00000040731						137.0	142.0	141.0					5																	24537506		2203	4299	6502	CDH10	SO:0001583	missense	0			-	HGNC	AF039747	CCDS3892.1	5p14.2	2010-01-26			ENSG00000040731	ENSG00000040731		"""Cadherins / Major cadherins"""	1749	protein-coding gene	gene with protein product		604555				2059658	Standard	NM_006727		Approved		uc003jgr.2	Q9Y6N8	OTTHUMG00000090667	ENST00000264463.4:c.509C>T	5.37:g.24537506G>A	ENSP00000264463:p.Pro170Leu	Somatic	0	49	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	25	24.24	Q9ULB3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.P170L	ENST00000264463.4	37	c.509	CCDS3892.1	5	.	.	.	.	.	.	.	.	.	.	G	16.50	3.139410	0.56936	.	.	ENSG00000040731	ENST00000264463	T	0.55234	0.53	5.72	5.72	0.89469	Cadherin (4);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.66761	0.2822	L	0.41824	1.3	0.80722	D	1	D	0.89917	1.0	D	0.76575	0.988	T	0.68100	-0.5498	10	0.87932	D	0	.	18.8595	0.92266	0.0:0.0:1.0:0.0	.	170	Q9Y6N8	CAD10_HUMAN	L	170	ENSP00000264463:P170L	ENSP00000264463:P170L	P	-	2	0	CDH10	24573263	1.000000	0.71417	0.995000	0.50966	0.062000	0.15995	9.869000	0.99810	2.701000	0.92244	0.557000	0.71058	CCC	-	pfam_Cadherin,superfamily_Cadherin-like,prints_Cadherin,pfscan_Cadherin		0.338	CDH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH10	protein_coding	OTTHUMT00000207345.2	G	NM_006727	-		24537506	-1	no_errors	ENST00000264463	ensembl	human	known	74_37	missense	SNP	1.000	A
KIAA1211	57482	genome.wustl.edu	37	4	57180968	57180968	+	Missense_Mutation	SNP	G	G	A	rs112098777	byFrequency	TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr4:57180968G>A	ENST00000504228.1	+	6	1405	c.1300G>A	c.(1300-1302)Gaa>Aaa	p.E434K	KIAA1211_ENST00000541073.1_Missense_Mutation_p.E427K|KIAA1211_ENST00000264229.6_Missense_Mutation_p.E434K			Q6ZU35	K1211_HUMAN	KIAA1211	434	Glu-rich.									endometrium(7)|large_intestine(10)|lung(39)|ovary(2)|prostate(3)|skin(3)|stomach(1)	65	Glioma(25;0.08)|all_neural(26;0.101)					CGAAGACCAGGAACGCCTGAA	0.612																																																	0								ENSG00000109265						22.0	29.0	27.0					4																	57180968		2021	4177	6198	KIAA1211	SO:0001583	missense	0			-	HGNC	AB033037	CCDS43230.1	4q12	2012-08-03			ENSG00000109265	ENSG00000109265			29219	protein-coding gene	gene with protein product						10574462, 11230166	Standard	NM_020722		Approved		uc003hbk.2	Q6ZU35	OTTHUMG00000160749	ENST00000504228.1:c.1300G>A	4.37:g.57180968G>A	ENSP00000423366:p.Glu434Lys	Somatic	0	176	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	83	17.82	Q9NTE2|Q9NTP8|Q9ULK9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.E434K	ENST00000504228.1	37	c.1300	CCDS43230.1	4	.	.	.	.	.	.	.	.	.	.	G	11.38	1.621063	0.28889	.	.	ENSG00000109265	ENST00000264229;ENST00000504228;ENST00000541073;ENST00000546221	T;T;T	0.13196	2.62;2.62;2.61	5.03	2.99	0.34606	.	.	.	.	.	T	0.09949	0.0244	L	0.27053	0.805	0.09310	N	1	B;B;B	0.11235	0.004;0.004;0.004	B;B;B	0.19391	0.025;0.004;0.004	T	0.24728	-1.0152	9	0.66056	D	0.02	-1.7114	5.6485	0.17602	0.2257:0.1635:0.6108:0.0	.	427;427;434	B7ZVZ4;F5H1N7;Q6ZU35	.;.;K1211_HUMAN	K	434;434;427;344	ENSP00000264229:E434K;ENSP00000423366:E434K;ENSP00000444006:E427K	ENSP00000264229:E434K	E	+	1	0	KIAA1211	56875725	0.000000	0.05858	0.002000	0.10522	0.008000	0.06430	0.474000	0.22148	1.098000	0.41479	0.462000	0.41574	GAA	-	NULL		0.612	KIAA1211-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1211	protein_coding	OTTHUMT00000362097.2	G	NM_020722	-		57180968	+1	no_errors	ENST00000504228	ensembl	human	known	74_37	missense	SNP	0.000	A
ZNF404	342908	genome.wustl.edu	37	19	44378125	44378125	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr19:44378125G>A	ENST00000587539.1	-	3	240	c.241C>T	c.(241-243)Ctt>Ttt	p.L81F	ZNF404_ENST00000324394.6_Missense_Mutation_p.L79F	NM_001033719.2	NP_001028891.2	Q494X3	ZN404_HUMAN	zinc finger protein 404	81					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(3)|skin(1)|stomach(2)|urinary_tract(1)	17		Prostate(69;0.0352)				AACCTCATAAGGTTGAAGGTT	0.328																																																	0								ENSG00000176222						91.0	94.0	93.0					19																	44378125		1834	4076	5910	ZNF404	SO:0001583	missense	0			-	HGNC	XM_092027	CCDS59394.1	19q13.31	2013-01-08				ENSG00000176222		"""Zinc fingers, C2H2-type"", ""-"""	19417	protein-coding gene	gene with protein product							Standard	NM_001033719		Approved		uc002oxs.5	Q494X3		ENST00000587539.1:c.241C>T	19.37:g.44378125G>A	ENSP00000466051:p.Leu81Phe	Somatic	0	44	0.00		0.41568620468393047	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	38	22.45	A4FU30|K7ELF2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.L81F	ENST00000587539.1	37	c.241	CCDS59394.1	19	.	.	.	.	.	.	.	.	.	.	G	0.022	-1.408304	0.01155	.	.	ENSG00000176222	ENST00000324394	T	0.07688	3.17	3.57	-1.53	0.08611	.	.	.	.	.	T	0.03827	0.0108	N	0.08118	0	0.09310	N	1	B	0.32543	0.375	B	0.39590	0.304	T	0.44711	-0.9310	9	0.09084	T	0.74	.	4.1465	0.10219	0.5617:0.1971:0.2412:0.0	.	81	Q494X3	ZN404_HUMAN	F	79	ENSP00000319479:L79F	ENSP00000319479:L79F	L	-	1	0	ZNF404	49069965	0.000000	0.05858	0.011000	0.14972	0.346000	0.29079	-0.022000	0.12480	-0.089000	0.12484	0.536000	0.68110	CTT	-	NULL		0.328	ZNF404-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF404	protein_coding	OTTHUMT00000460019.1	G	NM_001033719	-		44378125	-1	no_errors	ENST00000587539	ensembl	human	known	74_37	missense	SNP	0.015	A
TSSK1B	83942	genome.wustl.edu	37	5	112769637	112769637	+	Silent	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr5:112769637G>A	ENST00000390666.3	-	1	1091	c.900C>T	c.(898-900)ccC>ccT	p.P300P	CTD-2201G3.1_ENST00000510381.2_RNA|CTD-2201G3.1_ENST00000383058.4_RNA|MCC_ENST00000408903.3_Intron|CTD-2201G3.1_ENST00000416046.2_RNA	NM_032028.3	NP_114417.1	Q9BXA7	TSSK1_HUMAN	testis-specific serine kinase 1B	300					multicellular organismal development (GO:0007275)|protein phosphorylation (GO:0006468)|spermatid development (GO:0007286)	cytoplasmic vesicle (GO:0031410)|motile cilium (GO:0031514)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			large_intestine(8)|ovary(2)|skin(2)|stomach(1)	13		all_cancers(142;0.0138)|all_epithelial(76;0.000445)|Colorectal(10;0.00814)|Prostate(80;0.0115)|Ovarian(225;0.156)		Epithelial(69;4.15e-08)|OV - Ovarian serous cystadenocarcinoma(64;4.49e-08)|all cancers(49;3.2e-06)|COAD - Colon adenocarcinoma(37;0.0371)|Colorectal(14;0.0449)		AGCCAGGTTCGGGGGTCCACA	0.622																																																	0								ENSG00000212122						34.0	38.0	37.0					5																	112769637		2110	4256	6366	TSSK1B	SO:0001819	synonymous_variant	0			-	HGNC	AF348076	CCDS4112.1	5q22.2	2008-10-23	2007-01-30	2007-01-30	ENSG00000212122	ENSG00000212122			14968	protein-coding gene	gene with protein product		610709	"""serine/threonine kinase 22D (spermiogenesis associated)"", ""testis-specific serine kinase 1"""	STK22D, TSSK1		15044604	Standard	NM_032028		Approved	SPOGA4, FKSG81	uc003kqm.2	Q9BXA7	OTTHUMG00000128835	ENST00000390666.3:c.900C>T	5.37:g.112769637G>A		Somatic	0	63	0.00		0.41568620468393047	0	100.00	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	21	36.36	B2R8D9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.P300	ENST00000390666.3	37	c.900	CCDS4112.1	5																																																																																			-	superfamily_Kinase-like_dom		0.622	TSSK1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSSK1B	protein_coding	OTTHUMT00000250774.2	G	NM_032028	-		112769637	-1	no_errors	ENST00000390666	ensembl	human	known	74_37	silent	SNP	0.574	A
ZNF404	342908	genome.wustl.edu	37	19	44378126	44378126	+	Silent	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr19:44378126G>A	ENST00000587539.1	-	3	239	c.240C>T	c.(238-240)aaC>aaT	p.N80N	ZNF404_ENST00000324394.6_Silent_p.N78N	NM_001033719.2	NP_001028891.2	Q494X3	ZN404_HUMAN	zinc finger protein 404	80					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(3)|skin(1)|stomach(2)|urinary_tract(1)	17		Prostate(69;0.0352)				ACCTCATAAGGTTGAAGGTTT	0.328																																																	0								ENSG00000176222						90.0	92.0	92.0					19																	44378126		1834	4077	5911	ZNF404	SO:0001819	synonymous_variant	0			-	HGNC	XM_092027	CCDS59394.1	19q13.31	2013-01-08				ENSG00000176222		"""Zinc fingers, C2H2-type"", ""-"""	19417	protein-coding gene	gene with protein product							Standard	NM_001033719		Approved		uc002oxs.5	Q494X3		ENST00000587539.1:c.240C>T	19.37:g.44378126G>A		Somatic	0	44	0.00		0.41568620468393047	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	38	20.83	A4FU30|K7ELF2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.N80	ENST00000587539.1	37	c.240	CCDS59394.1	19																																																																																			-	NULL		0.328	ZNF404-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF404	protein_coding	OTTHUMT00000460019.1	G	NM_001033719	-		44378126	-1	no_errors	ENST00000587539	ensembl	human	known	74_37	silent	SNP	0.004	A
PCGF6	84108	genome.wustl.edu	37	10	105063592	105063592	+	3'UTR	SNP	G	G	C			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr10:105063592G>C	ENST00000369847.3	-	0	1190				PCGF6_ENST00000337211.4_3'UTR|PCGF6_ENST00000490296.1_5'UTR	NM_001011663.1	NP_001011663.1	Q9BYE7	PCGF6_HUMAN	polycomb group ring finger 6						negative regulation of transcription, DNA-templated (GO:0045892)	nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(3)	8		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;2.57e-09)|all cancers(201;7.21e-08)|BRCA - Breast invasive adenocarcinoma(275;0.205)		ACATTTCATGGAAATCTTTGG	0.388																																																	0								ENSG00000156374						41.0	30.0	34.0					10																	105063592		692	1583	2275	PCGF6	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AB047006	CCDS7546.1, CCDS31275.1	10q24.33	2013-01-09	2005-01-17	2005-01-19	ENSG00000156374	ENSG00000156374		"""RING-type (C3HC4) zinc fingers"", ""Polycomb group ring fingers"""	21156	protein-coding gene	gene with protein product		607816	"""ring finger protein 134"""	RNF134		12167161	Standard	NM_032154		Approved	MBLR	uc001kwt.3	Q9BYE7	OTTHUMG00000018982	ENST00000369847.3:c.*70C>G	10.37:g.105063592G>C		Somatic	0	79	0.00		0.41568620468393047	14	33.33	7	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	31	27.91	A8K3R4|Q5SYD1|Q5SYD6|Q96ID9|Q96SJ1	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000369847.3	37	NULL	CCDS31275.1	10																																																																																			-	-		0.388	PCGF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCGF6	protein_coding	OTTHUMT00000050132.1	G	NM_032154	-		105063592	-1	no_errors	ENST00000490296	ensembl	human	known	74_37	rna	SNP	0.006	C
ZNF831	128611	genome.wustl.edu	37	20	57766556	57766556	+	Missense_Mutation	SNP	A	A	C			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr20:57766556A>C	ENST00000371030.2	+	1	482	c.482A>C	c.(481-483)aAg>aCg	p.K161T		NM_178457.1	NP_848552.1	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	161							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(71)|ovary(2)|pancreas(1)|prostate(4)|skin(16)|upper_aerodigestive_tract(2)|urinary_tract(3)	125	all_lung(29;0.0085)					GTTCTAGAGAAGCACATCCGG	0.637																																																	0								ENSG00000124203						82.0	88.0	86.0					20																	57766556		2096	4225	6321	ZNF831	SO:0001583	missense	0			-	HGNC	AL121919	CCDS42894.1	20q13.32	2008-10-20	2008-03-25	2008-03-25	ENSG00000124203	ENSG00000124203			16167	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 174"""	C20orf174			Standard	NM_178457		Approved	dJ492J12.1	uc002yan.3	Q5JPB2	OTTHUMG00000032864	ENST00000371030.2:c.482A>C	20.37:g.57766556A>C	ENSP00000360069:p.Lys161Thr	Somatic	0	57	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	35	28.57	Q5TDR4|Q8TCP0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.K161T	ENST00000371030.2	37	c.482	CCDS42894.1	20	.	.	.	.	.	.	.	.	.	.	A	18.81	3.703903	0.68501	.	.	ENSG00000124203	ENST00000371030	T	0.20463	2.07	5.41	5.41	0.78517	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.34077	0.0885	N	0.26092	0.79	0.47009	D	0.999287	D	0.89917	1.0	D	0.91635	0.999	T	0.13764	-1.0497	9	0.72032	D	0.01	-19.0563	14.6234	0.68602	1.0:0.0:0.0:0.0	.	161	Q5JPB2	ZN831_HUMAN	T	161	ENSP00000360069:K161T	ENSP00000360069:K161T	K	+	2	0	ZNF831	57199951	1.000000	0.71417	1.000000	0.80357	0.761000	0.43186	7.427000	0.80284	2.053000	0.61076	0.459000	0.35465	AAG	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.637	ZNF831-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	ZNF831	protein_coding	OTTHUMT00000079916.2	A	NM_178457	-		57766556	+1	no_errors	ENST00000371030	ensembl	human	novel	74_37	missense	SNP	1.000	C
DQX1	165545	genome.wustl.edu	37	2	74752172	74752172	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr2:74752172G>A	ENST00000404568.3	-	3	614	c.395C>T	c.(394-396)cCc>cTc	p.P132L	DQX1_ENST00000495597.1_5'Flank|DQX1_ENST00000393951.2_Missense_Mutation_p.P132L	NM_133637.2	NP_598376.2	Q8TE96	DQX1_HUMAN	DEAQ box RNA-dependent ATPase 1	132	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.					nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|skin(1)	18						GTCCTCCTGGGGGATGCTGTA	0.577																																																	0								ENSG00000144045						84.0	87.0	86.0					2																	74752172		2203	4300	6503	DQX1	SO:0001583	missense	0			-	HGNC	AK074337	CCDS1949.2	2p12	2010-04-20	2009-01-15		ENSG00000144045	ENSG00000144045			20410	protein-coding gene	gene with protein product			"""DEAQ box polypeptide 1 (RNA-dependent ATPase)"""				Standard	NM_133637		Approved	FLJ23757	uc010yrw.2	Q8TE96	OTTHUMG00000129965	ENST00000404568.3:c.395C>T	2.37:g.74752172G>A	ENSP00000384621:p.Pro132Leu	Somatic	0	77	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	42	10.64	Q6B017|Q8NAM8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Helicase-assoc_dom,pfam_DUF1605,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase-assoc_dom,pfscan_Helicase_ATP-bd	p.P132L	ENST00000404568.3	37	c.395	CCDS1949.2	2	.	.	.	.	.	.	.	.	.	.	G	19.45	3.830297	0.71258	.	.	ENSG00000144045	ENST00000393951;ENST00000404568;ENST00000451518	T;T;T	0.33438	1.41;1.41;1.41	5.21	5.21	0.72293	DEAD-like helicase (2);	0.069769	0.56097	D	0.000022	T	0.54581	0.1867	M	0.72353	2.195	0.80722	D	1	D	0.76494	0.999	D	0.68765	0.96	T	0.57195	-0.7853	10	0.87932	D	0	-10.2521	16.2783	0.82656	0.0:0.0:1.0:0.0	.	132	Q8TE96	DQX1_HUMAN	L	132;132;14	ENSP00000377523:P132L;ENSP00000384621:P132L;ENSP00000392969:P14L	ENSP00000377523:P132L	P	-	2	0	DQX1	74605680	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	4.933000	0.63484	2.694000	0.91930	0.655000	0.94253	CCC	-	superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd		0.577	DQX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DQX1	protein_coding	OTTHUMT00000252230.3	G	NM_133637	-		74752172	-1	no_errors	ENST00000393951	ensembl	human	known	74_37	missense	SNP	1.000	A
C9	735	genome.wustl.edu	37	5	39341679	39341679	+	Missense_Mutation	SNP	T	T	C			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr5:39341679T>C	ENST00000263408.4	-	3	402	c.307A>G	c.(307-309)Aat>Gat	p.N103D	C9_ENST00000509186.1_5'UTR	NM_001737.3	NP_001728.1	P02748	CO9_HUMAN	complement component 9	103	LDL-receptor class A. {ECO:0000255|PROSITE-ProRule:PRU00124}.				complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|hemolysis by symbiont of host erythrocytes (GO:0019836)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane attack complex (GO:0005579)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(17)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	32	all_lung(31;0.000197)	all_neural(839;7.57e-10)|Lung NSC(810;2.62e-08)|Ovarian(839;0.00384)|Breast(839;0.0184)|Myeloproliferative disorder(839;0.0511)	Epithelial(62;0.158)			TGAAAGTCATTTCCGCAGTCA	0.448																																																	0								ENSG00000113600						112.0	99.0	103.0					5																	39341679		2203	4300	6503	C9	SO:0001583	missense	0			-	HGNC		CCDS3929.1	5p14-p12	2014-09-17			ENSG00000113600	ENSG00000113600		"""Complement system"""	1358	protein-coding gene	gene with protein product		120940					Standard	NM_001737		Approved		uc003jlv.4	P02748	OTTHUMG00000094767	ENST00000263408.4:c.307A>G	5.37:g.39341679T>C	ENSP00000263408:p.Asn103Asp	Somatic	0	58	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	33	21.43		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MACPF,pfam_LDrepeatLR_classA_rpt,pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,superfamily_LDrepeatLR_classA_rpt,smart_Thrombospondin_1_rpt,smart_LDrepeatLR_classA_rpt,smart_MACPF,prints_MAC_perforin,pfscan_LDrepeatLR_classA_rpt,pfscan_Thrombospondin_1_rpt	p.N103D	ENST00000263408.4	37	c.307	CCDS3929.1	5	.	.	.	.	.	.	.	.	.	.	T	10.45	1.352547	0.24512	.	.	ENSG00000113600	ENST00000263408	D	0.87809	-2.3	5.51	3.14	0.36123	.	0.262157	0.42964	D	0.000633	T	0.72598	0.3480	N	0.11131	0.1	0.32329	N	0.561303	P	0.43231	0.801	B	0.40741	0.339	T	0.73591	-0.3934	10	0.22706	T	0.39	-20.6868	8.7657	0.34702	0.0:0.1572:0.0:0.8428	.	103	P02748	CO9_HUMAN	D	103	ENSP00000263408:N103D	ENSP00000263408:N103D	N	-	1	0	C9	39377436	0.000000	0.05858	0.745000	0.31077	0.084000	0.17831	0.089000	0.15002	0.920000	0.36970	0.459000	0.35465	AAT	-	pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt		0.448	C9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C9	protein_coding	OTTHUMT00000211576.3	T		-		39341679	-1	no_errors	ENST00000263408	ensembl	human	known	74_37	missense	SNP	0.922	C
MUC17	140453	genome.wustl.edu	37	7	100676336	100676336	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr7:100676336G>A	ENST00000306151.4	+	3	1703	c.1639G>A	c.(1639-1641)Gaa>Aaa	p.E547K		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	547	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					CACTTCTAGTGAAGCCAGTTC	0.498																																																	0								ENSG00000169876						331.0	342.0	338.0					7																	100676336		2203	4300	6503	MUC17	SO:0001583	missense	0			-	HGNC	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.1639G>A	7.37:g.100676336G>A	ENSP00000302716:p.Glu547Lys	Somatic	0	121	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	64	15.79	O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SEA_dom,smart_SEA_dom,pfscan_EG-like_dom,pfscan_SEA_dom	p.E547K	ENST00000306151.4	37	c.1639	CCDS34711.1	7	.	.	.	.	.	.	.	.	.	.	G	5.136	0.210732	0.09757	.	.	ENSG00000169876	ENST00000306151	T	0.02631	4.22	1.45	0.485	0.16830	.	.	.	.	.	T	0.01124	0.0037	N	0.14661	0.345	0.09310	N	1	P	0.47604	0.898	B	0.34824	0.19	T	0.24297	-1.0164	9	0.06236	T	0.91	.	2.1815	0.03876	0.1965:0.0:0.4938:0.3097	.	547	Q685J3	MUC17_HUMAN	K	547	ENSP00000302716:E547K	ENSP00000302716:E547K	E	+	1	0	MUC17	100463056	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.028000	0.13644	0.178000	0.19917	0.501000	0.49751	GAA	-	NULL		0.498	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC17	protein_coding	OTTHUMT00000347161.1	G	NM_001040105	-		100676336	+1	no_errors	ENST00000306151	ensembl	human	known	74_37	missense	SNP	0.000	A
C9orf50	375759	genome.wustl.edu	37	9	132381854	132381854	+	Silent	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr9:132381854G>A	ENST00000372478.4	-	3	862	c.661C>T	c.(661-663)Ctg>Ttg	p.L221L	NTMT1_ENST00000372486.1_Intron	NM_199350.3	NP_955382.3	Q5SZB4	CI050_HUMAN	chromosome 9 open reading frame 50	221										central_nervous_system(1)|endometrium(4)|large_intestine(2)|ovary(1)|skin(1)|urinary_tract(1)	10		Ovarian(14;0.00556)				AGGGGCCCCAGAATAGGTGTC	0.547																																																	0								ENSG00000179058						99.0	99.0	99.0					9																	132381854		2203	4300	6503	C9orf50	SO:0001819	synonymous_variant	0			-	HGNC	AK093122	CCDS35159.1	9q34.2	2012-03-15			ENSG00000179058	ENSG00000179058			23677	protein-coding gene	gene with protein product							Standard	NM_199350		Approved	FLJ35803	uc004byc.4	Q5SZB4	OTTHUMG00000020786	ENST00000372478.4:c.661C>T	9.37:g.132381854G>A		Somatic	0	82	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	47	16.07	Q2M1I2|Q8NA65	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.L221	ENST00000372478.4	37	c.661	CCDS35159.1	9																																																																																			-	NULL		0.547	C9orf50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf50	protein_coding	OTTHUMT00000054593.1	G	NM_199350	-		132381854	-1	no_errors	ENST00000372478	ensembl	human	known	74_37	silent	SNP	0.001	A
ACVR1B	91	genome.wustl.edu	37	12	52369177	52369177	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr12:52369177G>A	ENST00000257963.4	+	2	297	c.220G>A	c.(220-222)Gag>Aag	p.E74K	ACVR1B_ENST00000542485.1_Missense_Mutation_p.E22K|ACVR1B_ENST00000415850.2_Missense_Mutation_p.E74K|ACVR1B_ENST00000541224.1_Missense_Mutation_p.E74K|ACVR1B_ENST00000426655.2_Missense_Mutation_p.E74K	NM_004302.4|NM_020328.3	NP_004293.1|NP_064733.3	P36896	ACV1B_HUMAN	activin A receptor, type IB	74					activin receptor signaling pathway (GO:0032924)|central nervous system development (GO:0007417)|development of primary female sexual characteristics (GO:0046545)|extrinsic apoptotic signaling pathway (GO:0097191)|G1/S transition of mitotic cell cycle (GO:0000082)|hair follicle development (GO:0001942)|in utero embryonic development (GO:0001701)|negative regulation of cell growth (GO:0030308)|nodal signaling pathway (GO:0038092)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of trophoblast cell migration (GO:1901165)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	activin receptor activity, type I (GO:0016361)|ATP binding (GO:0005524)|inhibin binding (GO:0034711)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)|ubiquitin protein ligase binding (GO:0031625)			breast(5)|endometrium(4)|kidney(5)|large_intestine(12)|lung(10)|ovary(1)|pancreas(6)|prostate(1)	44				BRCA - Breast invasive adenocarcinoma(357;0.104)	Adenosine triphosphate(DB00171)	CCCCAAAGTGGAGCTGGTCCC	0.577																																																	0								ENSG00000135503						112.0	89.0	97.0					12																	52369177		2203	4300	6503	ACVR1B	SO:0001583	missense	0			-	HGNC		CCDS8816.1, CCDS44893.1, CCDS44894.1, CCDS44893.2, CCDS44894.2	12q13	2006-11-09			ENSG00000135503	ENSG00000135503			172	protein-coding gene	gene with protein product		601300		ACVRLK4		8397373	Standard	NM_020327		Approved	ALK4, SKR2, ActRIB	uc010snn.2	P36896	OTTHUMG00000167920	ENST00000257963.4:c.220G>A	12.37:g.52369177G>A	ENSP00000257963:p.Glu74Lys	Somatic	0	33	0.00		0.41568620468393047	6	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	15	16.67	B7Z5L8|B7Z5W5|Q15479|Q15480|Q15481|Q15482	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_TGF_beta_rcpt_GS,pfam_Activin_rcpt,superfamily_Kinase-like_dom,smart_TGF_beta_rcpt_GS,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.E74K	ENST00000257963.4	37	c.220	CCDS8816.1	12	.	.	.	.	.	.	.	.	.	.	G	16.43	3.119990	0.56613	.	.	ENSG00000135503	ENST00000257963;ENST00000541224;ENST00000426655;ENST00000536420;ENST00000415850;ENST00000542485	D;D;D;D;D;D	0.97772	-4.53;-4.53;-4.53;-4.53;-4.53;-4.53	4.88	4.88	0.63580	TGF-beta receptor/activin receptor, type I/II (1);	0.438446	0.25839	N	0.027967	D	0.93048	0.7787	N	0.16201	0.385	0.30282	N	0.791178	B;B;B;B	0.13145	0.002;0.001;0.002;0.007	B;B;B;B	0.15052	0.008;0.008;0.012;0.011	D	0.88846	0.3316	10	0.49607	T	0.09	.	10.2452	0.43336	0.1259:0.0:0.8741:0.0	.	74;74;74;74	P36896-4;P36896;P36896-2;P36896-3	.;ACV1B_HUMAN;.;.	K	74;74;74;22;74;22	ENSP00000257963:E74K;ENSP00000442656:E74K;ENSP00000390477:E74K;ENSP00000443218:E22K;ENSP00000397550:E74K;ENSP00000442885:E22K	ENSP00000257963:E74K	E	+	1	0	ACVR1B	50655444	0.994000	0.37717	1.000000	0.80357	0.996000	0.88848	1.490000	0.35573	2.643000	0.89663	0.650000	0.86243	GAG	-	pfam_Activin_rcpt		0.577	ACVR1B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ACVR1B	protein_coding	OTTHUMT00000397000.1	G	NM_020328	-		52369177	+1	no_errors	ENST00000257963	ensembl	human	known	74_37	missense	SNP	1.000	A
PSMC3	5702	genome.wustl.edu	37	11	47445599	47445599	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr11:47445599C>T	ENST00000298852.3	-	6	746	c.589G>A	c.(589-591)Gag>Aag	p.E197K	PSMC3_ENST00000602866.1_Missense_Mutation_p.E181K|PSMC3_ENST00000530912.1_Missense_Mutation_p.E155K	NM_002804.4	NP_002795.2	P17980	PRS6A_HUMAN	proteasome (prosome, macropain) 26S subunit, ATPase, 3	197					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of RNA biosynthetic process (GO:2001141)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(4)|urinary_tract(1)	17				Lung(87;0.0932)|BRCA - Breast invasive adenocarcinoma(625;0.13)		TCCCTCACCTCCTGGATCTGC	0.557																																																	0								ENSG00000165916						207.0	165.0	180.0					11																	47445599		2201	4298	6499	PSMC3	SO:0001583	missense	0			-	HGNC	M34079	CCDS7935.1	11p11.2	2010-04-21			ENSG00000165916	ENSG00000165916		"""Proteasome (prosome, macropain) subunits"", ""ATPases / AAA-type"""	9549	protein-coding gene	gene with protein product		186852				9048938, 9473509	Standard	NM_002804		Approved	TBP1, TBP-1	uc001nfh.2	P17980	OTTHUMG00000167692	ENST00000298852.3:c.589G>A	11.37:g.47445599C>T	ENSP00000298852:p.Glu197Lys	Somatic	0	37	0.00		0.41568620468393047	390	31.35	179	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	19	17.39	B2R8V1|Q3B757|Q3B865|Q53HU5|Q6GPG8|Q6IBS1|Q96HD3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ATPase_AAA_core,pfam_ATPase_dyneun-rel_AAA,pfam_DNA_helicase_Holl-junc_RuvB_N,superfamily_P-loop_NTPase,smart_AAA+_ATPase,tigrfam_26S_Psome_P45	p.E197K	ENST00000298852.3	37	c.589	CCDS7935.1	11	.	.	.	.	.	.	.	.	.	.	C	29.9	5.042803	0.93685	.	.	ENSG00000165916	ENST00000298852;ENST00000530912;ENST00000531051;ENST00000530887;ENST00000530651;ENST00000527906	D;D	0.94931	-3.56;-3.56	5.63	5.63	0.86233	.	0.046723	0.85682	D	0.000000	D	0.95551	0.8554	M	0.87617	2.895	0.80722	D	1	P;P	0.46621	0.881;0.794	B;B	0.42319	0.383;0.17	D	0.96242	0.9176	10	0.87932	D	0	-31.0377	19.6809	0.95962	0.0:1.0:0.0:0.0	.	155;197	E9PM69;P17980	.;PRS6A_HUMAN	K	197;155;141;162;162;162	ENSP00000298852:E197K;ENSP00000433097:E155K	ENSP00000298852:E197K	E	-	1	0	PSMC3	47402175	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	7.818000	0.86416	2.644000	0.89710	0.655000	0.94253	GAG	-	superfamily_P-loop_NTPase,tigrfam_26S_Psome_P45		0.557	PSMC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PSMC3	protein_coding	OTTHUMT00000395660.2	C	NM_002804	-		47445599	-1	no_errors	ENST00000298852	ensembl	human	known	74_37	missense	SNP	1.000	T
NEK1	4750	genome.wustl.edu	37	4	170359399	170359399	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr4:170359399C>T	ENST00000439128.2	-	26	3155	c.2515G>A	c.(2515-2517)Gaa>Aaa	p.E839K	NEK1_ENST00000507142.1_Missense_Mutation_p.E867K|NEK1_ENST00000511633.1_Missense_Mutation_p.E823K|NEK1_ENST00000512193.1_Missense_Mutation_p.E770K|NEK1_ENST00000510533.1_Missense_Mutation_p.E795K	NM_012224.2	NP_036356.1	Q96PY6	NEK1_HUMAN	NIMA-related kinase 1	839					cellular response to DNA damage stimulus (GO:0006974)|cilium assembly (GO:0042384)|mitotic nuclear division (GO:0007067)|response to ionizing radiation (GO:0010212)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|pericentriolar material (GO:0000242)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			NS(1)|breast(3)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|ovary(2)|prostate(2)|stomach(1)	45		Prostate(90;0.00601)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.0287)|KIRC - Kidney renal clear cell carcinoma(143;0.0325)|Kidney(143;0.0385)|LUSC - Lung squamous cell carcinoma(193;0.14)		TTTTCCCCTTCGGGAGAAATC	0.343																																																	0								ENSG00000137601						99.0	88.0	91.0					4																	170359399		1780	4037	5817	NEK1	SO:0001583	missense	0			-	HGNC	AB067488	CCDS47162.1, CCDS56348.1, CCDS56349.1, CCDS56350.1, CCDS56351.1	4q32.3	2012-11-15	2012-11-15		ENSG00000137601	ENSG00000137601			7744	protein-coding gene	gene with protein product		604588	"""NIMA (never in mitosis gene a)-related kinase 1"""			1382974, 8274451	Standard	NM_012224		Approved	NY-REN-55, KIAA1901	uc003isd.2	Q96PY6	OTTHUMG00000160963	ENST00000439128.2:c.2515G>A	4.37:g.170359399C>T	ENSP00000408020:p.Glu839Lys	Somatic	0	35	0.00		0.41568620468393047	0	100.00	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	19	20.83	G5E9Z3|Q05DG5|Q14CB7|Q5H9T1|Q6PIB8|Q96SS2|Q9H6P7|Q9Y594	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.E867K	ENST00000439128.2	37	c.2599	CCDS47162.1	4	.	.	.	.	.	.	.	.	.	.	C	8.254	0.809600	0.16537	.	.	ENSG00000137601	ENST00000439128;ENST00000511633;ENST00000510533;ENST00000507142;ENST00000512193	T;T;T;T;T	0.68903	-0.36;-0.35;-0.36;-0.36;-0.35	5.52	2.55	0.30701	.	0.969423	0.08514	N	0.934452	T	0.50274	0.1606	L	0.31294	0.92	0.30983	N	0.722271	B;B;B;B;B	0.20550	0.046;0.018;0.005;0.046;0.001	B;B;B;B;B	0.13407	0.006;0.009;0.006;0.009;0.002	T	0.47182	-0.9137	10	0.18710	T	0.47	.	6.3677	0.21463	0.0:0.6657:0.1507:0.1836	.	770;823;867;795;839	Q96PY6-4;G5E9Z3;Q96PY6-3;Q96PY6-2;Q96PY6	.;.;.;.;NEK1_HUMAN	K	839;823;795;867;770	ENSP00000408020:E839K;ENSP00000423332:E823K;ENSP00000427653:E795K;ENSP00000424757:E867K;ENSP00000424938:E770K	ENSP00000408020:E839K	E	-	1	0	NEK1	170595974	0.967000	0.33354	0.811000	0.32455	0.054000	0.15201	0.516000	0.22817	0.678000	0.31325	0.650000	0.86243	GAA	-	NULL		0.343	NEK1-001	KNOWN	basic|CCDS	protein_coding	NEK1	protein_coding	OTTHUMT00000363157.3	C		-		170359399	-1	no_errors	ENST00000507142	ensembl	human	known	74_37	missense	SNP	0.896	T
UBQLN3	50613	genome.wustl.edu	37	11	5529535	5529535	+	Silent	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr11:5529535C>T	ENST00000311659.4	-	2	1401	c.1254G>A	c.(1252-1254)gaG>gaA	p.E418E	AC104389.28_ENST00000415970.1_RNA|HBG2_ENST00000380259.2_Intron|HBE1_ENST00000380237.1_5'Flank|HBG2_ENST00000380252.1_5'Flank	NM_017481.2	NP_059509.1	Q9H347	UBQL3_HUMAN	ubiquilin 3	418										NS(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(16)|ovary(4)|prostate(1)|skin(2)	39		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;1.74e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CAGTACTGTTCTCTGTGGGGT	0.557																																					Ovarian(72;684 1260 12332 41642 52180)												0								ENSG00000175520						115.0	116.0	116.0					11																	5529535		2201	4297	6498	UBQLN3	SO:0001819	synonymous_variant	0			-	HGNC	AF230481	CCDS7758.1	11p15	2013-02-12			ENSG00000175520	ENSG00000175520		"""Ubiquilin family"""	12510	protein-coding gene	gene with protein product		605473				10831842	Standard	NM_017481		Approved	TUP-1	uc001may.1	Q9H347	OTTHUMG00000066886	ENST00000311659.4:c.1254G>A	11.37:g.5529535C>T		Somatic	0	112	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	57	31.33	Q9NRE0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ubiquitin_dom,pfam_Rad60/SUMO_like,pfam_UBA/Ts_N,superfamily_UBA-like,superfamily_ARM-type_fold,smart_Ubiquitin_dom,smart_STI1_HS-bd,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Ubiquitin_supergroup	p.E418	ENST00000311659.4	37	c.1254	CCDS7758.1	11																																																																																			-	NULL		0.557	UBQLN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBQLN3	protein_coding	OTTHUMT00000143348.1	C	NM_017481	-		5529535	-1	no_errors	ENST00000311659	ensembl	human	known	74_37	silent	SNP	0.000	T
BBX	56987	genome.wustl.edu	37	3	107451806	107451806	+	Missense_Mutation	SNP	C	C	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr3:107451806C>A	ENST00000325805.8	+	7	892	c.605C>A	c.(604-606)cCt>cAt	p.P202H	BBX_ENST00000406780.1_Missense_Mutation_p.P202H|BBX_ENST00000415149.2_Missense_Mutation_p.P202H|BBX_ENST00000402543.1_Missense_Mutation_p.P202H|BBX_ENST00000416476.2_Missense_Mutation_p.P202H			Q8WY36	BBX_HUMAN	bobby sox homolog (Drosophila)	202					bone development (GO:0060348)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(18)|ovary(4)|pancreas(1)|skin(2)	49			OV - Ovarian serous cystadenocarcinoma(3;0.112)			TATTTAGATCCTACTCAAATG	0.403																																																	0								ENSG00000114439						179.0	151.0	160.0					3																	107451806		2203	4300	6503	BBX	SO:0001583	missense	0			-	HGNC	AF168718	CCDS2950.1, CCDS46881.1, CCDS63712.1	3q13.1	2008-07-18			ENSG00000114439	ENSG00000114439			14422	protein-coding gene	gene with protein product	"""x 001 protein"""					11680820	Standard	NM_001142568		Approved	MDS001, HSPC339, HBP2	uc010hpr.4	Q8WY36	OTTHUMG00000150360	ENST00000325805.8:c.605C>A	3.37:g.107451806C>A	ENSP00000319974:p.Pro202His	Somatic	0	59	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	27	12.90	A2RRM7|Q2TAJ1|Q7L3J8|Q7LBY8|Q8NDB0|Q8WY35|Q9H0J6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TF_HMG_box_BBX_DUF2028,pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	p.P202H	ENST00000325805.8	37	c.605	CCDS46881.1	3	.	.	.	.	.	.	.	.	.	.	C	28.4	4.919996	0.92249	.	.	ENSG00000114439	ENST00000415149;ENST00000325767;ENST00000402543;ENST00000325805;ENST00000416476;ENST00000456419;ENST00000402163;ENST00000406780	D;D;D;D;D;D;D	0.99474	-5.03;-5.05;-5.05;-5.35;-5.97;-5.67;-5.03	5.55	5.55	0.83447	HMG box transcription factor BBX, domain of unknown function DUF2028 (1);	0.000000	0.85682	D	0.000000	D	0.99465	0.9810	M	0.69823	2.125	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;0.999;0.998	D	0.99123	1.0850	10	0.87932	D	0	-9.6754	19.5101	0.95139	0.0:1.0:0.0:0.0	.	202;202;202;202	C9JA69;Q8WY36;A2RRM7;Q8WY36-2	.;BBX_HUMAN;.;.	H	202;53;202;202;202;202;202;202	ENSP00000408358:P202H;ENSP00000385317:P202H;ENSP00000319974:P202H;ENSP00000403860:P202H;ENSP00000413274:P202H;ENSP00000385518:P202H;ENSP00000385530:P202H	ENSP00000319742:P53H	P	+	2	0	BBX	108934496	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.022000	0.76431	2.606000	0.88127	0.591000	0.81541	CCT	-	pfam_TF_HMG_box_BBX_DUF2028		0.403	BBX-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BBX	protein_coding	OTTHUMT00000317820.1	C	NM_020235	-		107451806	+1	no_errors	ENST00000325805	ensembl	human	known	74_37	missense	SNP	1.000	A
PLEKHG4B	153478	genome.wustl.edu	37	5	162046	162046	+	Missense_Mutation	SNP	A	A	C			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr5:162046A>C	ENST00000283426.6	+	10	1618	c.1568A>C	c.(1567-1569)gAg>gCg	p.E523A		NM_052909.3	NP_443141.3	Q96PX9	PKH4B_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 4B	523							Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(1)|large_intestine(2)|lung(2)|prostate(3)|skin(3)	11			all cancers(22;0.0253)|Lung(60;0.113)	Kidney(1;0.119)		CGCTCGTCCGAGTTGTGCGAG	0.632																																																	0								ENSG00000153404						64.0	53.0	57.0					5																	162046		2203	4300	6503	PLEKHG4B	SO:0001583	missense	0			-	HGNC	BC008352	CCDS34124.1	5p15.33	2013-01-11			ENSG00000153404	ENSG00000153404		"""Pleckstrin homology (PH) domain containing"""	29399	protein-coding gene	gene with protein product						11572484	Standard	NM_052909		Approved	KIAA1909	uc003jak.2	Q96PX9	OTTHUMG00000161570	ENST00000283426.6:c.1568A>C	5.37:g.162046A>C	ENSP00000283426:p.Glu523Ala	Somatic	0	66	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	26	33.33		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DH-domain,superfamily_DH-domain,superfamily_CRAL-TRIO_dom,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.E523A	ENST00000283426.6	37	c.1568	CCDS34124.1	5	.	.	.	.	.	.	.	.	.	.	A	8.287	0.816753	0.16607	.	.	ENSG00000153404	ENST00000283426	D	0.92249	-3.0	2.59	-0.487	0.12060	.	.	.	.	.	D	0.83142	0.5190	L	0.29908	0.895	0.09310	N	1	B	0.12013	0.005	B	0.09377	0.004	T	0.65315	-0.6198	9	0.14252	T	0.57	.	6.6947	0.23193	0.523:0.477:0.0:0.0	.	523	Q96PX9	PKH4B_HUMAN	A	523	ENSP00000283426:E523A	ENSP00000283426:E523A	E	+	2	0	PLEKHG4B	215046	0.999000	0.42202	0.000000	0.03702	0.002000	0.02628	3.227000	0.51262	-0.363000	0.08101	-0.661000	0.03856	GAG	-	NULL		0.632	PLEKHG4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHG4B	protein_coding	OTTHUMT00000365359.1	A	NM_052909	-		162046	+1	no_errors	ENST00000283426	ensembl	human	known	74_37	missense	SNP	0.003	C
IBA57	200205	genome.wustl.edu	37	1	228362717	228362717	+	Silent	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr1:228362717C>T	ENST00000366711.3	+	2	668	c.666C>T	c.(664-666)caC>caT	p.H222H	IBA57_ENST00000484749.1_3'UTR|IBA57_ENST00000546123.1_Silent_p.H29H	NM_001010867.2	NP_001010867.1	Q5T440	CAF17_HUMAN	IBA57, iron-sulfur cluster assembly homolog (S. cerevisiae)	222					glycine catabolic process (GO:0006546)|heme biosynthetic process (GO:0006783)	mitochondrion (GO:0005739)	aminomethyltransferase activity (GO:0004047)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(7)|prostate(1)	11						ATCACCAGCACCGATACCTGC	0.652																																																	0								ENSG00000181873						24.0	27.0	26.0					1																	228362717		2201	4299	6500	IBA57	SO:0001819	synonymous_variant	0			-	HGNC	AK022796	CCDS31046.1	1q42.13	2011-03-11	2011-03-11	2011-03-11	ENSG00000181873	ENSG00000181873			27302	protein-coding gene	gene with protein product	"""iron-sulfur cluster assembly factor for biotin synthase- and aconitase-like mitochondrial proteins, with a mass of 57kDa"""	615316	"""chromosome 1 open reading frame 69"""	C1orf69			Standard	NM_001010867		Approved	FLJ12734	uc001hsl.4	Q5T440	OTTHUMG00000039769	ENST00000366711.3:c.666C>T	1.37:g.228362717C>T		Somatic	0	73	0.00		0.41568620468393047	6	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	40	24.53		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GCV_T_N,pfam_GCV_T_C,tigrfam_YgfZ/GcvT_CS	p.H222	ENST00000366711.3	37	c.666	CCDS31046.1	1																																																																																			-	pfam_GCV_T_N,tigrfam_YgfZ/GcvT_CS		0.652	IBA57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IBA57	protein_coding	OTTHUMT00000095980.1	C	NM_001010867	-		228362717	+1	no_errors	ENST00000366711	ensembl	human	known	74_37	silent	SNP	1.000	T
DCAF8L1	139425	genome.wustl.edu	37	X	27998919	27998919	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chrX:27998919C>T	ENST00000441525.1	-	1	647	c.533G>A	c.(532-534)gGg>gAg	p.G178E		NM_001017930.1	NP_001017930.1	A6NGE4	DC8L1_HUMAN	DDB1 and CUL4 associated factor 8-like 1	178										NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(24)|ovary(3)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	56						GGTTCTTGCCCCACAGGCCTC	0.567																																																	0								ENSG00000226372						36.0	32.0	33.0					X																	27998919		2202	4300	6502	DCAF8L1	SO:0001583	missense	0			-	HGNC		CCDS35222.1	Xp22.11	2013-01-09	2009-07-17	2009-07-17	ENSG00000226372	ENSG00000226372		"""WD repeat domain containing"""	31810	protein-coding gene	gene with protein product			"""WD repeat domain 42B"""	WDR42B			Standard	NM_001017930		Approved		uc004dbx.1	A6NGE4	OTTHUMG00000021312	ENST00000441525.1:c.533G>A	X.37:g.27998919C>T	ENSP00000405222:p.Gly178Glu	Somatic	0	28	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	5	66.67	B3KXX1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.G178E	ENST00000441525.1	37	c.533	CCDS35222.1	X	.	.	.	.	.	.	.	.	.	.	C	17.58	3.425960	0.62733	.	.	ENSG00000226372	ENST00000441525	T	0.69175	-0.38	0.842	0.842	0.18927	.	0.000000	0.85682	D	0.000000	T	0.75034	0.3795	M	0.68317	2.08	0.54753	D	0.999987	D	0.89917	1.0	D	0.91635	0.999	T	0.74121	-0.3767	10	0.87932	D	0	-15.0133	7.2758	0.26283	0.0:0.9999:0.0:1.0E-4	.	178	A6NGE4	DC8L1_HUMAN	E	178	ENSP00000405222:G178E	ENSP00000405222:G178E	G	-	2	0	DCAF8L1	27908840	1.000000	0.71417	0.374000	0.26016	0.418000	0.31294	4.465000	0.60141	0.691000	0.31592	0.284000	0.19432	GGG	-	NULL		0.567	DCAF8L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF8L1	protein_coding	OTTHUMT00000056150.2	C	XM_066690	-		27998919	-1	no_errors	ENST00000441525	ensembl	human	known	74_37	missense	SNP	1.000	T
CDC25B	994	genome.wustl.edu	37	20	3781928	3781928	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr20:3781928G>A	ENST00000245960.5	+	8	1430	c.733G>A	c.(733-735)Gtg>Atg	p.V245M	CDC25B_ENST00000439880.2_Missense_Mutation_p.V231M|CDC25B_ENST00000379598.5_Missense_Mutation_p.V181M|CDC25B_ENST00000344256.6_Missense_Mutation_p.V181M|CDC25B_ENST00000340833.4_Missense_Mutation_p.V204M|CDC25B_ENST00000467519.1_3'UTR	NM_004358.3|NM_021872.2|NM_021873.2	NP_004349.1|NP_068658.1|NP_068659.1	P30305	MPIP2_HUMAN	cell division cycle 25B	245					female meiosis I (GO:0007144)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|oocyte maturation (GO:0001556)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of protein kinase activity (GO:0045860)|protein phosphorylation (GO:0006468)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)			NS(1)|large_intestine(4)|lung(10)|ovary(2)|prostate(1)	18						GAAGATGGAAGTGGAGGAGCT	0.547																																																	0								ENSG00000101224						111.0	106.0	108.0					20																	3781928		2203	4300	6503	CDC25B	SO:0001583	missense	0			-	HGNC		CCDS13065.1, CCDS13066.1, CCDS13067.1, CCDS74700.1, CCDS74701.1	20p13	2013-01-17	2013-01-17		ENSG00000101224	ENSG00000101224		"""Protein tyrosine phosphatases / Class III Cys-based PTPs"""	1726	protein-coding gene	gene with protein product		116949	"""cell division cycle 25B"", ""cell division cycle 25 homolog B (S. cerevisiae)"", ""cell division cycle 25 homolog B (S. pombe)"""			1836978	Standard	NM_021873		Approved		uc002wjn.3	P30305	OTTHUMG00000031764	ENST00000245960.5:c.733G>A	20.37:g.3781928G>A	ENSP00000245960:p.Val245Met	Somatic	0	71	0.00		0.41568620468393047	39	9.30	4	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	35	27.08	D3DVY1|D3DVY2|D3DVY3|D3DVY4|O43551|Q13971|Q5JX77|Q6RSS1|Q9BRA6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MPI_Phosphatase,pfam_Rhodanese-like_dom,superfamily_Rhodanese-like_dom,smart_Rhodanese-like_dom,pfscan_Rhodanese-like_dom,prints_MPI_Phosphatase	p.V245M	ENST00000245960.5	37	c.733	CCDS13067.1	20	.	.	.	.	.	.	.	.	.	.	G	0.745	-0.774758	0.02951	.	.	ENSG00000101224	ENST00000344256;ENST00000379598;ENST00000245960;ENST00000439880;ENST00000340833	T;T;T;T;T	0.27256	1.68;1.68;1.68;1.68;1.68	4.53	0.302	0.15786	.	1.046520	0.07505	N	0.907851	T	0.16085	0.0387	N	0.12569	0.235	0.09310	N	1	B;B;B;B;B;B	0.22541	0.033;0.071;0.029;0.023;0.023;0.051	B;B;B;B;B;B	0.31016	0.055;0.123;0.078;0.029;0.047;0.071	T	0.40831	-0.9542	10	0.39692	T	0.17	-2.0736	7.5661	0.27879	0.3752:0.0:0.6248:0.0	.	181;167;181;204;231;245	B4DQZ3;B4DRC3;B4DIG0;P30305-3;P30305-2;P30305	.;.;.;.;.;MPIP2_HUMAN	M	181;181;245;231;204	ENSP00000339125:V181M;ENSP00000368918:V181M;ENSP00000245960:V245M;ENSP00000405972:V231M;ENSP00000339170:V204M	ENSP00000245960:V245M	V	+	1	0	CDC25B	3729928	0.000000	0.05858	0.026000	0.17262	0.043000	0.13939	0.285000	0.18883	-0.004000	0.14419	-1.069000	0.02264	GTG	-	pfam_MPI_Phosphatase		0.547	CDC25B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC25B	protein_coding	OTTHUMT00000077779.2	G	NM_021874	-		3781928	+1	no_errors	ENST00000245960	ensembl	human	known	74_37	missense	SNP	0.001	A
GALNT13	114805	genome.wustl.edu	37	2	155252643	155252643	+	Splice_Site	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr2:155252643G>A	ENST00000392825.3	+	10	1863		c.e10+1		GALNT13_ENST00000409237.1_Splice_Site|GALNT13_ENST00000487047.1_Splice_Site	NM_052917.2	NP_443149.2	Q8IUC8	GLT13_HUMAN	polypeptide N-acetylgalactosaminyltransferase 13						cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			NS(2)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(6)|lung(37)|ovary(3)|pancreas(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	65						ACTTGGTGAGGTATGAATTAT	0.338																																																	0								ENSG00000144278						61.0	63.0	62.0					2																	155252643		2203	4300	6503	GALNT13	SO:0001630	splice_region_variant	0			-	HGNC	AB067505	CCDS2199.1	2q24.1	2014-03-13	2014-03-13		ENSG00000144278	ENSG00000144278	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	23242	protein-coding gene	gene with protein product	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 13"", ""polypeptide GalNAc transferase 13"""	608369	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 13 (GalNAc-T13)"""			11572484, 12407114	Standard	XM_005246267		Approved	KIAA1918, GalNAc-T13	uc002tyr.4	Q8IUC8	OTTHUMG00000131917	ENST00000392825.3:c.1296+1G>A	2.37:g.155252643G>A		Somatic	0	93	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	59	19.18	Q08ER7|Q68VI8|Q6ZWG1|Q96PX0|Q9UIE5	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e8+1	ENST00000392825.3	37	c.1296+1	CCDS2199.1	2	.	.	.	.	.	.	.	.	.	.	G	24.4	4.527392	0.85706	.	.	ENSG00000144278	ENST00000392825;ENST00000409237;ENST00000450838	.	.	.	5.02	5.02	0.67125	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.2651	0.87084	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	GALNT13	154960889	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.626000	0.98410	2.492000	0.84095	0.650000	0.86243	.	-	-		0.338	GALNT13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNT13	protein_coding	OTTHUMT00000254870.2	G	NM_052917	-	Intron	155252643	+1	no_errors	ENST00000409237	ensembl	human	known	74_37	splice_site	SNP	1.000	A
RNF17	56163	genome.wustl.edu	37	13	25367256	25367256	+	Missense_Mutation	SNP	G	G	A	rs572750591		TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr13:25367256G>A	ENST00000255324.5	+	10	1064	c.1012G>A	c.(1012-1014)Gat>Aat	p.D338N	RNF17_ENST00000255326.4_3'UTR|RNF17_ENST00000381921.1_Missense_Mutation_p.D338N|RNF17_ENST00000255325.6_Missense_Mutation_p.D338N	NM_001184993.1|NM_031277.2	NP_001171922.1|NP_112567.2	Q9BXT8	RNF17_HUMAN	ring finger protein 17	338					multicellular organismal development (GO:0007275)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(15)|ovary(1)|prostate(3)|skin(6)	36		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0114)|OV - Ovarian serous cystadenocarcinoma(117;0.0311)|Epithelial(112;0.0524)		TTCTTGTTACGATACATACCC	0.343													G|||	1	0.000199681	0.0	0.0	5008	,	,		20340	0.0		0.0	False		,,,				2504	0.001																0								ENSG00000132972						136.0	133.0	134.0					13																	25367256		2203	4300	6503	RNF17	SO:0001583	missense	0			-	HGNC	AF285602, AK001907	CCDS9308.2	13q12.13	2013-01-23			ENSG00000132972	ENSG00000132972		"""RING-type (C3HC4) zinc fingers"", ""Tudor domain containing"""	10060	protein-coding gene	gene with protein product	"""spermatogenesis associated 23"""	605793	"""tudor domain containing 4"""	TDRD4		11279525	Standard	NM_001184993		Approved	Mmip-2, SPATA23, FLJ11045	uc001upr.3	Q9BXT8	OTTHUMG00000016589	ENST00000255324.5:c.1012G>A	13.37:g.25367256G>A	ENSP00000255324:p.Asp338Asn	Somatic	0	69	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	34	30.61	Q5T2J9|Q6P1W3|Q9BXT7|Q9NUY9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Tudor,smart_Tudor,pfscan_Tudor,pfscan_Znf_RING	p.D338N	ENST00000255324.5	37	c.1012	CCDS9308.2	13	.	.	.	.	.	.	.	.	.	.	G	3.363	-0.129990	0.06753	.	.	ENSG00000132972	ENST00000255324;ENST00000381921;ENST00000429047;ENST00000255325;ENST00000255326	T;T;T	0.30448	2.64;2.66;1.53	5.07	3.33	0.38152	.	0.281525	0.30611	N	0.009250	T	0.33644	0.0870	L	0.32530	0.975	0.09310	N	1	P;P;D	0.89917	0.913;0.913;1.0	B;B;D	0.63703	0.163;0.163;0.917	T	0.11591	-1.0581	10	0.17369	T	0.5	.	6.8838	0.24189	0.0933:0.1763:0.7303:0.0	.	338;338;338	B7Z7S1;Q9BXT8;Q9BXT8-2	.;RNF17_HUMAN;.	N	338;338;197;339;338	ENSP00000255324:D338N;ENSP00000371346:D338N;ENSP00000255325:D339N	ENSP00000255324:D338N	D	+	1	0	RNF17	24265256	0.042000	0.20092	0.003000	0.11579	0.001000	0.01503	1.518000	0.35877	0.723000	0.32274	-0.142000	0.14014	GAT	-	NULL		0.343	RNF17-003	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF17	protein_coding	OTTHUMT00000044217.1	G	NM_031994	-		25367256	+1	no_errors	ENST00000255324	ensembl	human	known	74_37	missense	SNP	0.006	A
DNAH17	8632	genome.wustl.edu	37	17	76567361	76567361	+	Splice_Site	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr17:76567361C>T	ENST00000585328.1	-	5	956	c.832G>A	c.(832-834)Ggg>Agg	p.G278R	DNAH17_ENST00000389840.5_Splice_Site_p.G278R	NM_173628.3	NP_775899.3	Q9UFH2	DYH17_HUMAN	dynein, axonemal, heavy chain 17	278	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(7)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(8)|lung(37)|ovary(8)|prostate(7)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	116			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			ACAGGCTCACCTTCAGTGACG	0.522																																																	0								ENSG00000187775						79.0	81.0	81.0					17																	76567361		2164	4250	6414	DNAH17	SO:0001630	splice_region_variant	0			-	HGNC	AJ000522		17q25.3	2012-04-19	2006-09-04		ENSG00000187775	ENSG00000187775		"""Axonemal dyneins"""	2946	protein-coding gene	gene with protein product		610063	"""dynein, axonemal, heavy polypeptide 17"", ""dynein, axonemal, heavy chain like 1"", ""dynein, axonemal, heavy like 1"""	DNAHL1		9545504	Standard	NM_173628		Approved	DNEL2, FLJ40457	uc010dhp.2	Q9UFH2		ENST00000585328.1:c.832+1G>A	17.37:g.76567361C>T		Somatic	0	39	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	21	22.22	O00431|O15206|Q2M2Y1|Q6ZRQ2|Q8N7Q7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,superfamily_HR1_rho-bd	p.G278R	ENST00000585328.1	37	c.832		17	.	.	.	.	.	.	.	.	.	.	C	14.44	2.537374	0.45176	.	.	ENSG00000187775	ENST00000300671;ENST00000389840	T	0.54279	0.58	4.31	4.31	0.51392	.	.	.	.	.	T	0.52805	0.1757	L	0.48642	1.525	0.36577	D	0.873319	.	.	.	.	.	.	T	0.58323	-0.7656	6	.	.	.	.	9.7717	0.40593	0.0:0.9002:0.0:0.0998	.	.	.	.	R	278	ENSP00000374490:G278R	.	G	-	1	0	DNAH17	74078956	0.999000	0.42202	0.706000	0.30403	0.034000	0.12701	4.635000	0.61332	2.115000	0.64714	0.561000	0.74099	GGG	-	pfam_Dynein_heavy_dom-1		0.522	DNAH17-001	PUTATIVE	not_organism_supported|basic|appris_principal	protein_coding	DNAH17	protein_coding	OTTHUMT00000318962.2	C	NM_173628	-	Missense_Mutation	76567361	-1	no_errors	ENST00000389840	ensembl	human	known	74_37	missense	SNP	0.974	T
ZSCAN2	54993	genome.wustl.edu	37	15	85165025	85165025	+	Silent	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr15:85165025C>T	ENST00000448803.2	+	3	1891	c.1599C>T	c.(1597-1599)ctC>ctT	p.L533L	ZSCAN2_ENST00000541040.1_Intron|ZSCAN2_ENST00000485222.2_Intron|ZSCAN2_ENST00000538076.1_Intron|ZSCAN2_ENST00000546148.1_Silent_p.L533L|ZSCAN2_ENST00000327179.6_Silent_p.L532L|ZSCAN2_ENST00000358472.3_Silent_p.L383L	NM_181877.3	NP_870992.2	Q7Z7L9	ZSCA2_HUMAN	zinc finger and SCAN domain containing 2	533					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(7)|liver(2)|lung(4)|ovary(1)|pancreas(1)	19				UCEC - Uterine corpus endometrioid carcinoma (272;0.168)|all cancers(203;5.43e-22)		ACAAATGCCTCATGTGCGGCA	0.592																																																	0								ENSG00000176371						105.0	108.0	107.0					15																	85165025		2203	4299	6502	ZSCAN2	SO:0001819	synonymous_variant	0			-	HGNC	BC041620	CCDS10329.2, CCDS32315.1, CCDS32316.1	15q25.2	2013-01-08	2004-11-01	2004-11-02	ENSG00000176371	ENSG00000176371		"""-"", ""Zinc fingers, C2H2-type"""	20994	protein-coding gene	gene with protein product			"""zinc finger protein 29"""	ZFP29		1937051	Standard	NM_017894		Approved	FLJ20595, ZNF854	uc002bkr.3	Q7Z7L9	OTTHUMG00000074027	ENST00000448803.2:c.1599C>T	15.37:g.85165025C>T		Somatic	0	42	0.00		0.41568620468393047	2	33.33	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	20	16.67	A6NG83|B2RMQ9|Q6ZQY9|Q9NWU4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.L533	ENST00000448803.2	37	c.1599	CCDS10329.2	15																																																																																			-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.592	ZSCAN2-007	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	ZSCAN2	protein_coding	OTTHUMT00000396956.1	C	NM_017894	-		85165025	+1	no_errors	ENST00000448803	ensembl	human	known	74_37	silent	SNP	0.249	T
LSM1	27257	genome.wustl.edu	37	8	38021012	38021013	+	3'UTR	INS	-	-	A	rs1845|rs397892600	byFrequency	TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr8:38021012_38021013insA	ENST00000311351.4	-	0	972_973				LSM1_ENST00000522515.1_5'UTR|RP11-90P5.7_ENST00000521915.1_RNA|LSM1_ENST00000520755.1_3'UTR|RP11-90P5.2_ENST00000520598.1_RNA	NM_014462.2	NP_055277.1	O15116	LSM1_HUMAN	LSM1, U6 small nuclear RNA associated						exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA metabolic process (GO:0016071)|mRNA processing (GO:0006397)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)			kidney(2)|large_intestine(3)|lung(2)	7	Colorectal(12;0.000442)					ATTTTGTTATTAAAAAAAAAAC	0.322																																																	0								ENSG00000175324																																			LSM1	SO:0001624	3_prime_UTR_variant	0				HGNC	AF000177	CCDS6103.1	8p11.2	2014-02-14	2014-02-14		ENSG00000175324	ENSG00000175324			20472	protein-coding gene	gene with protein product		607281	"""LSM1 homolog, U6 small nuclear RNA associated (S. cerevisiae)"""			12515382, 11953827	Standard	NM_014462		Approved	CASM, YJL124C	uc003xkw.3	O15116	OTTHUMG00000164051	ENST00000311351.4:c.*176->T	8.37:g.38021022_38021022dupA		Somatic	0	54	0.00		0.41568620468393047	104	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	29	9.38	B2R5E6	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000311351.4	37	NULL	CCDS6103.1	8																																																																																			-	-		0.322	LSM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LSM1	protein_coding	OTTHUMT00000376965.1	-	NM_014462			38021013	-1	no_errors	ENST00000520286	ensembl	human	known	74_37	rna	INS	0.404:0.000	A
ERBB3	2065	genome.wustl.edu	37	12	56490844	56490844	+	Missense_Mutation	SNP	G	G	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr12:56490844G>T	ENST00000267101.3	+	20	2730	c.2290G>T	c.(2290-2292)Ggc>Tgc	p.G764C	ERBB3_ENST00000450146.2_Missense_Mutation_p.G121C|ERBB3_ENST00000553131.1_Missense_Mutation_p.G5C|ERBB3_ENST00000549832.1_5'Flank|ERBB3_ENST00000415288.2_Missense_Mutation_p.G705C	NM_001982.3	NP_001973.2	P21860	ERBB3_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 3	764	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cranial nerve development (GO:0021545)|endocardial cushion development (GO:0003197)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|negative regulation of cell adhesion (GO:0007162)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of secretion (GO:0051048)|negative regulation of signal transduction (GO:0009968)|neuron apoptotic process (GO:0051402)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein tyrosine kinase activity (GO:0061098)|regulation of cell proliferation (GO:0042127)|Schwann cell differentiation (GO:0014037)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein tyrosine kinase activator activity (GO:0030296)|transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(2)|lung(3)|ovary(1)|skin(1)|stomach(1)	8			OV - Ovarian serous cystadenocarcinoma(18;0.112)			GCTGGCCATTGGCAGCCTGGA	0.532																																																	0								ENSG00000065361						98.0	81.0	87.0					12																	56490844		2203	4300	6503	ERBB3	SO:0001583	missense	0			-	HGNC	M34309	CCDS31833.1, CCDS44918.1	12q13	2013-07-09	2013-07-09			ENSG00000065361			3431	protein-coding gene	gene with protein product		190151	"""lethal congenital contracture syndrome 2"""	LCCS2			Standard	NM_001982		Approved	HER3	uc001sjh.3	P21860	OTTHUMG00000170140	ENST00000267101.3:c.2290G>T	12.37:g.56490844G>T	ENSP00000267101:p.Gly764Cys	Somatic	0	40	0.00		0.41568620468393047	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	27	10.00	A8K6L6|B4DIK7|B4DV32|E9PDT8|Q9BUD7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_EGF_rcpt_L,pfam_Furin-like_Cys-rich_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,superfamily_Growth_fac_rcpt_N_dom,smart_Furin_repeat,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.G764C	ENST00000267101.3	37	c.2290	CCDS31833.1	12	.	.	.	.	.	.	.	.	.	.	G	25.5	4.641271	0.87859	.	.	ENSG00000065361	ENST00000267101;ENST00000450146;ENST00000415288;ENST00000553131	D;D;D;D	0.82619	-1.63;-1.63;-1.63;-1.63	5.59	5.59	0.84812	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000002	D	0.86310	0.5902	N	0.21583	0.68	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.87890	0.2683	10	0.87932	D	0	.	18.7303	0.91733	0.0:0.0:1.0:0.0	.	764	P21860	ERBB3_HUMAN	C	764;121;705;5	ENSP00000267101:G764C;ENSP00000399178:G121C;ENSP00000408340:G705C;ENSP00000449129:G5C	ENSP00000267101:G764C	G	+	1	0	ERBB3	54777111	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.321000	0.79088	2.793000	0.96121	0.561000	0.74099	GGC	-	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.532	ERBB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERBB3	protein_coding	OTTHUMT00000407619.3	G		-		56490844	+1	no_errors	ENST00000267101	ensembl	human	known	74_37	missense	SNP	1.000	T
FAT3	120114	genome.wustl.edu	37	11	92523349	92523349	+	Missense_Mutation	SNP	C	C	G			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr11:92523349C>G	ENST00000298047.6	+	7	4593	c.4576C>G	c.(4576-4578)Cat>Gat	p.H1526D	FAT3_ENST00000409404.2_Missense_Mutation_p.H1526D|FAT3_ENST00000525166.1_Missense_Mutation_p.H1376D			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	1526	Cadherin 14. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				GAGGCTGGACCATGAGGCCCA	0.498										TCGA Ovarian(4;0.039)																																							0								ENSG00000165323						144.0	139.0	141.0					11																	92523349		2015	4191	6206	FAT3	SO:0001583	missense	0			-	HGNC	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.4576C>G	11.37:g.92523349C>G	ENSP00000298047:p.His1526Asp	Somatic	0	17	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	18	21.74	B5MDB0|Q96AU6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Laminin_G,pfam_EGF-like_Ca-bd_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,smart_EG-like_dom,smart_Laminin_G,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.H1526D	ENST00000298047.6	37	c.4576		11	.	.	.	.	.	.	.	.	.	.	C	29.9	5.045869	0.93685	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166	T;T;T	0.01725	4.67;4.67;4.67	6.17	6.17	0.99709	.	.	.	.	.	T	0.11196	0.0273	M	0.75264	2.295	0.80722	D	1	D	0.89917	1.0	D	0.69824	0.966	T	0.00595	-1.1653	9	0.38643	T	0.18	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	1526	Q8TDW7-3	.	D	1526;1526;1376	ENSP00000298047:H1526D;ENSP00000387040:H1526D;ENSP00000432586:H1376D	ENSP00000298047:H1526D	H	+	1	0	FAT3	92162997	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	6.037000	0.70956	2.941000	0.99782	0.655000	0.94253	CAT	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.498	FAT3-201	KNOWN	basic	protein_coding	FAT3	protein_coding		C	NM_001008781	-		92523349	+1	no_errors	ENST00000298047	ensembl	human	known	74_37	missense	SNP	1.000	G
SLCO1A2	6579	genome.wustl.edu	37	12	21445200	21445200	+	Missense_Mutation	SNP	C	C	G			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr12:21445200C>G	ENST00000307378.6	-	13	2228	c.1508G>C	c.(1507-1509)gGa>gCa	p.G503A	SLCO1A2_ENST00000452078.1_Missense_Mutation_p.G503A|SLCO1A2_ENST00000390670.3_Missense_Mutation_p.G501A|SLCO1A2_ENST00000458504.1_Missense_Mutation_p.G371A|SLCO1A2_ENST00000537524.1_Missense_Mutation_p.G371A	NM_134431.3	NP_602307.1	P46721	SO1A2_HUMAN	solute carrier organic anion transporter family, member 1A2	503					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	organic anion transmembrane transporter activity (GO:0008514)			breast(2)|endometrium(2)|kidney(4)|large_intestine(8)|lung(23)|ovary(1)|pancreas(1)|skin(6)|upper_aerodigestive_tract(1)	48					Aminohippurate(DB00345)|Atorvastatin(DB01076)|Bumetanide(DB00887)|Chlorambucil(DB00291)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dexamethasone(DB01234)|Digitoxin(DB01396)|Digoxin(DB00390)|Dinoprostone(DB00917)|Enalapril(DB00584)|Erythromycin(DB00199)|Estradiol(DB00783)|Estriol(DB04573)|Estrone(DB00655)|Fexofenadine(DB00950)|Glyburide(DB01016)|Hydrocortisone(DB00741)|Ibuprofen(DB01050)|Indinavir(DB00224)|Indomethacin(DB00328)|Ketoconazole(DB01026)|Ketoprofen(DB01009)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Lovastatin(DB00227)|Methotrexate(DB00563)|Methyltestosterone(DB06710)|Mirabegron(DB08893)|Naloxone(DB01183)|Naproxen(DB00788)|Nelfinavir(DB00220)|Ouabain(DB01092)|Pravastatin(DB00175)|Prednisolone(DB00860)|Prednisone(DB00635)|Probenecid(DB01032)|Quinidine(DB00908)|Quinine(DB00468)|Rifampicin(DB01045)|Ritonavir(DB00503)|Rocuronium(DB00728)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|Simvastatin(DB00641)|Spironolactone(DB00421)|Sumatriptan(DB00669)|Tauroursodeoxycholic acid(DB08834)|Testosterone(DB00624)|Tolbutamide(DB01124)|Ursodeoxycholic acid(DB01586)|Verapamil(DB00661)	ACAGTCAGGTCCTTTGTCGCA	0.403																																																	0								ENSG00000084453						82.0	80.0	81.0					12																	21445200		2203	4300	6503	SLCO1A2	SO:0001583	missense	0			-	HGNC		CCDS8686.1	12p12	2013-05-22	2003-11-25	2003-11-26	ENSG00000084453	ENSG00000084453		"""Solute carriers"""	10956	protein-coding gene	gene with protein product		602883	"""solute carrier family 21 (organic anion transporter), member 3"""	SLC21A3		9007731	Standard	NM_134431		Approved	OATP, OATP1A2, OATP-A	uc001rer.3	P46721	OTTHUMG00000156259	ENST00000307378.6:c.1508G>C	12.37:g.21445200C>G	ENSP00000305974:p.Gly503Ala	Somatic	0	82	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	53	20.90	Q9UGP7|Q9UL38	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_OA_transporter,pfam_MFS,pfam_Kazal_dom,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	p.G503A	ENST00000307378.6	37	c.1508	CCDS8686.1	12	.	.	.	.	.	.	.	.	.	.	C	14.02	2.409889	0.42715	.	.	ENSG00000084453	ENST00000307378;ENST00000452078;ENST00000458504;ENST00000537524;ENST00000390670	T;T;T;T;T	0.38077	1.16;1.16;1.16;1.16;1.16	5.09	5.09	0.68999	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.482210	0.23821	N	0.044231	T	0.41627	0.1167	M	0.64170	1.965	0.23708	N	0.997057	P;B	0.48162	0.906;0.051	P;B	0.50440	0.641;0.098	T	0.31916	-0.9926	10	0.09338	T	0.73	.	12.273	0.54716	0.0:0.9195:0.0:0.0805	.	501;503	P46721-2;P46721	.;SO1A2_HUMAN	A	503;503;371;371;501	ENSP00000305974:G503A;ENSP00000393973:G503A;ENSP00000394854:G371A;ENSP00000439401:G371A;ENSP00000375088:G501A	ENSP00000305974:G503A	G	-	2	0	SLCO1A2	21336467	0.367000	0.25023	0.946000	0.38457	0.578000	0.36192	0.750000	0.26334	2.646000	0.89796	0.563000	0.77884	GGA	-	pfam_OA_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter		0.403	SLCO1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLCO1A2	protein_coding	OTTHUMT00000343648.3	C	NM_021094	-		21445200	-1	no_errors	ENST00000307378	ensembl	human	known	74_37	missense	SNP	0.428	G
ARGLU1	55082	genome.wustl.edu	37	13	107220059	107220059	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr13:107220059C>T	ENST00000400198.3	-	1	453	c.209G>A	c.(208-210)cGg>cAg	p.R70Q		NM_018011.3	NP_060481.3	Q9NWB6	ARGL1_HUMAN	arginine and glutamate rich 1	70	Arg-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)|nucleus (GO:0005634)				large_intestine(1)|lung(5)|pancreas(1)	7	Lung NSC(43;0.015)|all_neural(89;0.0741)|Lung SC(71;0.14)|Medulloblastoma(90;0.169)					CTCCCGGTCCCGCTCGCGCCG	0.692																																																	0								ENSG00000134884						20.0	21.0	20.0					13																	107220059		1875	4074	5949	ARGLU1	SO:0001583	missense	0			-	HGNC	BC071587	CCDS41906.1	13q33.3	2011-10-03	2007-11-28		ENSG00000134884	ENSG00000134884			25482	protein-coding gene	gene with protein product		614046				21454576	Standard	NM_018011		Approved	FLJ10154	uc001vqk.4	Q9NWB6	OTTHUMG00000017321	ENST00000400198.3:c.209G>A	13.37:g.107220059C>T	ENSP00000383059:p.Arg70Gln	Somatic	0	46	0.00		0.41568620468393047	32	30.43	14	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	24	22.58	B4E0Y3|Q5T257|Q6IQ34	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.R70Q	ENST00000400198.3	37	c.209	CCDS41906.1	13	.	.	.	.	.	.	.	.	.	.	C	23.1	4.369388	0.82463	.	.	ENSG00000134884	ENST00000400198	T	0.22539	1.95	3.89	3.89	0.44902	.	0.000000	0.47093	D	0.000243	T	0.22205	0.0535	L	0.49778	1.585	0.80722	D	1	P	0.47302	0.893	B	0.43360	0.417	T	0.05683	-1.0870	10	0.15066	T	0.55	-4.5609	16.0497	0.80745	0.0:1.0:0.0:0.0	.	70	Q9NWB6	ARGL1_HUMAN	Q	70	ENSP00000383059:R70Q	ENSP00000383059:R70Q	R	-	2	0	ARGLU1	106018060	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.028000	0.57246	1.997000	0.58415	0.462000	0.41574	CGG	-	NULL		0.692	ARGLU1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARGLU1	protein_coding	OTTHUMT00000045727.1	C	NM_018011	-		107220059	-1	no_errors	ENST00000400198	ensembl	human	known	74_37	missense	SNP	1.000	T
OSBPL6	114880	genome.wustl.edu	37	2	179260226	179260226	+	Silent	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr2:179260226C>T	ENST00000190611.4	+	25	3121	c.2745C>T	c.(2743-2745)acC>acT	p.T915T	OSBPL6_ENST00000409631.1_Silent_p.T879T|OSBPL6_ENST00000392505.2_Silent_p.T940T|OSBPL6_ENST00000359685.3_Silent_p.T879T|OSBPL6_ENST00000409045.3_Silent_p.T884T|OSBPL6_ENST00000315022.2_Silent_p.T919T	NM_032523.3	NP_115912.1	Q9BZF3	OSBL6_HUMAN	oxysterol binding protein-like 6	915					lipid transport (GO:0006869)	cytosol (GO:0005829)|nuclear membrane (GO:0031965)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(13)|lung(18)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	46			OV - Ovarian serous cystadenocarcinoma(117;0.00578)|Epithelial(96;0.00847)|all cancers(119;0.0335)			CTAACGACACCTACTGGGAGC	0.408																																																	0								ENSG00000079156						111.0	113.0	112.0					2																	179260226		2203	4300	6503	OSBPL6	SO:0001819	synonymous_variant	0			-	HGNC	AF392448	CCDS2277.1, CCDS2278.1, CCDS56150.1, CCDS56151.1, CCDS56152.1	2q32.1	2008-05-27			ENSG00000079156	ENSG00000079156		"""Oxysterol binding proteins"""	16388	protein-coding gene	gene with protein product	"""OSBP-related protein 6"""	606734				11483621	Standard	NM_001201480		Approved	ORP6	uc002uly.3	Q9BZF3	OTTHUMG00000132579	ENST00000190611.4:c.2745C>T	2.37:g.179260226C>T		Somatic	0	117	0.00		0.41568620468393047	18	28.00	7	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	58	14.71	B4DTW1|C4AMC0|C4AME4|D3DPF6|D3DPF7|Q4ZG68|Q53T68|Q59H61|Q7Z4Q1|Q86V84|Q8N9T0|Q96SR1	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Oxysterol-bd,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.T919	ENST00000190611.4	37	c.2757	CCDS2277.1	2																																																																																			-	pfam_Oxysterol-bd		0.408	OSBPL6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	OSBPL6	protein_coding	OTTHUMT00000334393.2	C	NM_032523	-		179260226	+1	no_errors	ENST00000315022	ensembl	human	known	74_37	silent	SNP	0.998	T
PHLDB2	90102	genome.wustl.edu	37	3	111637923	111637923	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr3:111637923C>T	ENST00000431670.2	+	4	2135	c.1724C>T	c.(1723-1725)cCa>cTa	p.P575L	PHLDB2_ENST00000393925.3_Missense_Mutation_p.P575L|PHLDB2_ENST00000393923.3_Missense_Mutation_p.P602L|PHLDB2_ENST00000412622.1_Missense_Mutation_p.P575L|PHLDB2_ENST00000481953.1_Missense_Mutation_p.P575L|PHLDB2_ENST00000495180.1_Missense_Mutation_p.P161L	NM_001134438.1	NP_001127910.1	Q86SQ0	PHLB2_HUMAN	pleckstrin homology-like domain, family B, member 2	575						cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(7)|large_intestine(8)|lung(23)|ovary(6)|skin(7)|stomach(1)	55						TCGCAGACCCCAGAGGGTATA	0.433																																																	0								ENSG00000144824						126.0	133.0	131.0					3																	111637923		2203	4300	6503	PHLDB2	SO:0001583	missense	0			-	HGNC		CCDS2962.1, CCDS46885.1, CCDS46886.1	3q13.13	2013-01-10			ENSG00000144824	ENSG00000144824		"""Pleckstrin homology (PH) domain containing"""	29573	protein-coding gene	gene with protein product		610298				12376540	Standard	NM_145753		Approved	LL5beta, FLJ21791, LL5b	uc003dyg.3	Q86SQ0	OTTHUMG00000159282	ENST00000431670.2:c.1724C>T	3.37:g.111637923C>T	ENSP00000405405:p.Pro575Leu	Somatic	0	124	0.00		0.41568620468393047	33	15.38	6	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	37	24.00	A5PKZ3|Q59EA8|Q68CY3|Q6NT98|Q8N8U8|Q8NAB1|Q8NCU5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.P575L	ENST00000431670.2	37	c.1724	CCDS46886.1	3	.	.	.	.	.	.	.	.	.	.	C	17.93	3.509808	0.64522	.	.	ENSG00000144824	ENST00000359729;ENST00000393923;ENST00000431670;ENST00000412622;ENST00000498699;ENST00000393925;ENST00000481953;ENST00000495180	T;T;T;T;T;T;T	0.35048	1.35;1.36;1.36;1.33;1.36;1.36;1.61	5.55	5.55	0.83447	.	0.264236	0.40385	N	0.001113	T	0.31702	0.0805	L	0.43152	1.355	0.50171	D	0.999856	P;P;P;P	0.50156	0.69;0.932;0.794;0.794	B;B;B;B	0.39805	0.15;0.288;0.31;0.31	T	0.03933	-1.0991	10	0.26408	T	0.33	.	16.7824	0.85566	0.0:1.0:0.0:0.0	.	161;575;575;602	E9PGF6;Q86SQ0;Q86SQ0-2;Q86SQ0-3	.;PHLB2_HUMAN;.;.	L	602;602;575;575;575;575;575;161	ENSP00000377500:P602L;ENSP00000405405:P575L;ENSP00000405292:P575L;ENSP00000418296:P575L;ENSP00000377502:P575L;ENSP00000418319:P575L;ENSP00000420303:P161L	ENSP00000352764:P602L	P	+	2	0	PHLDB2	113120613	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	4.054000	0.57434	2.753000	0.94483	0.655000	0.94253	CCA	-	NULL		0.433	PHLDB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHLDB2	protein_coding	OTTHUMT00000354337.1	C	NM_145753	-		111637923	+1	no_errors	ENST00000393925	ensembl	human	known	74_37	missense	SNP	1.000	T
SATB2	23314	genome.wustl.edu	37	2	200246469	200246469	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr2:200246469C>T	ENST00000417098.1	-	4	1237	c.421G>A	c.(421-423)Gac>Aac	p.D141N	SATB2_ENST00000457245.1_Missense_Mutation_p.D141N|SATB2_ENST00000484124.1_5'UTR|SATB2_ENST00000260926.5_Missense_Mutation_p.D141N|SATB2_ENST00000443023.1_Missense_Mutation_p.D82N|SATB2_ENST00000428695.1_Intron	NM_001172509.1	NP_001165980.1	Q9UPW6	SATB2_HUMAN	SATB homeobox 2	141					cartilage development (GO:0051216)|cellular response to organic substance (GO:0071310)|chromatin remodeling (GO:0006338)|embryonic pattern specification (GO:0009880)|embryonic skeletal system morphogenesis (GO:0048704)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|osteoblast development (GO:0002076)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(40)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						TGTAGCATGTCGGCCACTGTC	0.468																																					Colon(30;262 767 11040 24421 36230)												0								ENSG00000119042						124.0	115.0	118.0					2																	200246469		2203	4300	6503	SATB2	SO:0001583	missense	0			-	HGNC	AB028957	CCDS2327.1	2q33.1	2011-06-20	2007-02-15		ENSG00000119042	ENSG00000119042		"""Homeoboxes / CUT class"""	21637	protein-coding gene	gene with protein product		608148	"""SATB family member 2"""				Standard	NM_015265		Approved	KIAA1034, FLJ21474	uc002uva.2	Q9UPW6	OTTHUMG00000132767	ENST00000417098.1:c.421G>A	2.37:g.200246469C>T	ENSP00000401112:p.Asp141Asn	Somatic	0	83	0.00		0.41568620468393047	7	41.67	5	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	47	16.07	A8K5Z8|Q3ZB87|Q4V763	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Hmoeo_CUT,pfam_Homeobox_dom,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Hmoeo_CUT	p.D141N	ENST00000417098.1	37	c.421	CCDS2327.1	2	.	.	.	.	.	.	.	.	.	.	C	28.9	4.961567	0.92791	.	.	ENSG00000119042	ENST00000417098;ENST00000443023;ENST00000260926;ENST00000457245	D;D;D;D	0.85088	-1.94;-1.94;-1.94;-1.94	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	D	0.91071	0.7190	L	0.53249	1.67	0.58432	D	0.999998	D	0.89917	1.0	D	0.91635	0.999	D	0.89811	0.3982	10	0.44086	T	0.13	-29.4463	19.976	0.97309	0.0:1.0:0.0:0.0	.	141	Q9UPW6	SATB2_HUMAN	N	141;82;141;141	ENSP00000401112:D141N;ENSP00000388764:D82N;ENSP00000260926:D141N;ENSP00000405420:D141N	ENSP00000260926:D141N	D	-	1	0	SATB2	199954714	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.818000	0.86416	2.713000	0.92767	0.655000	0.94253	GAC	-	NULL		0.468	SATB2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SATB2	protein_coding	OTTHUMT00000256140.1	C	NM_015265	-		200246469	-1	no_errors	ENST00000260926	ensembl	human	known	74_37	missense	SNP	1.000	T
ZNF214	7761	genome.wustl.edu	37	11	7021487	7021487	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr11:7021487C>T	ENST00000278314.4	-	3	1742	c.1427G>A	c.(1426-1428)gGg>gAg	p.G476E	ZNF214_ENST00000531083.1_5'Flank|ZNF214_ENST00000536068.1_Missense_Mutation_p.G476E	NM_013249.2	NP_037381.2	Q9UL59	ZN214_HUMAN	zinc finger protein 214	476					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(10)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				Epithelial(150;3.87e-08)|BRCA - Breast invasive adenocarcinoma(625;0.081)		GAAGCCCTTCCCACATTCAGG	0.443																																					Ovarian(22;251 657 736 21522 46864)												0								ENSG00000149050						97.0	102.0	100.0					11																	7021487		2201	4295	6496	ZNF214	SO:0001583	missense	0			-	HGNC	AF056617	CCDS31418.1	11p15.4	2013-01-08				ENSG00000149050		"""Zinc fingers, C2H2-type"", ""-"""	13006	protein-coding gene	gene with protein product		605015					Standard	NM_013249		Approved		uc001mfa.2	Q9UL59		ENST00000278314.4:c.1427G>A	11.37:g.7021487C>T	ENSP00000278314:p.Gly476Glu	Somatic	0	59	0.00		0.41568620468393047	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	26	18.75	B2R8Q1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G476E	ENST00000278314.4	37	c.1427	CCDS31418.1	11	.	.	.	.	.	.	.	.	.	.	C	15.91	2.971033	0.53614	.	.	ENSG00000149050	ENST00000278314;ENST00000536068	T;T	0.58210	0.35;0.35	4.05	3.14	0.36123	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.151699	0.31145	N	0.008166	T	0.44644	0.1303	L	0.46157	1.445	0.29359	N	0.864781	P	0.49447	0.924	B	0.42555	0.391	T	0.48328	-0.9045	10	0.51188	T	0.08	.	9.8562	0.41088	0.0:0.8972:0.0:0.1028	.	476	Q9UL59	ZN214_HUMAN	E	476	ENSP00000278314:G476E;ENSP00000445373:G476E	ENSP00000278314:G476E	G	-	2	0	ZNF214	6978063	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	3.533000	0.53561	1.284000	0.44531	0.561000	0.74099	GGG	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.443	ZNF214-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF214	protein_coding	OTTHUMT00000385349.1	C		-		7021487	-1	no_errors	ENST00000278314	ensembl	human	known	74_37	missense	SNP	0.999	T
EMB	133418	genome.wustl.edu	37	5	49701670	49701670	+	Silent	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr5:49701670C>T	ENST00000303221.5	-	5	704	c.489G>A	c.(487-489)ggG>ggA	p.G163G	EMB_ENST00000506190.1_5'UTR|EMB_ENST00000514111.1_Silent_p.G113G|EMB_ENST00000508934.1_Silent_p.G109G	NM_198449.2	NP_940851.1	Q6PCB8	EMB_HUMAN	embigin	163	Ig-like V-type 2.				cell adhesion (GO:0007155)|plasma membrane lactate transport (GO:0035879)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|synapse (GO:0045202)	organic cyclic compound binding (GO:0097159)			breast(2)|endometrium(3)|large_intestine(4)|lung(4)|skin(2)	15	Lung SC(58;0.218)	Lung NSC(810;0.0795)				GCTTGTTTTTCCCATGAAGTT	0.338																																																	0								ENSG00000170571						37.0	39.0	38.0					5																	49701670		2198	4285	6483	EMB	SO:0001819	synonymous_variant	0			-	HGNC	BC059398	CCDS3953.1	5q11.1	2013-01-29	2010-06-24		ENSG00000170571	ENSG00000170571		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	30465	protein-coding gene	gene with protein product		615669	"""embigin homolog (mouse)"""			9438341	Standard	NM_198449		Approved	MGC71745	uc003jom.3	Q6PCB8	OTTHUMG00000131161	ENST00000303221.5:c.489G>A	5.37:g.49701670C>T		Somatic	0	111	0.00		0.41568620468393047	3	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	59	19.18	B7Z6S3|B7Z902	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like_dom	p.G163	ENST00000303221.5	37	c.489	CCDS3953.1	5																																																																																			-	pfam_Ig_I-set,pfscan_Ig-like_dom		0.338	EMB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EMB	protein_coding	OTTHUMT00000253853.1	C	NM_198449	-		49701670	-1	no_errors	ENST00000303221	ensembl	human	known	74_37	silent	SNP	0.853	T
PSMG1	8624	genome.wustl.edu	37	21	40552220	40552220	+	Silent	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr21:40552220G>A	ENST00000331573.3	-	3	849	c.384C>T	c.(382-384)tcC>tcT	p.S128S	PSMG1_ENST00000380900.2_Silent_p.S128S	NM_001261824.1|NM_003720.3	NP_001248753.1|NP_003711.1	O95456	PSMG1_HUMAN	proteasome (prosome, macropain) assembly chaperone 1	128					cerebellar granule cell precursor proliferation (GO:0021930)|proteasome assembly (GO:0043248)|proteasome core complex assembly (GO:0080129)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)				autonomic_ganglia(1)|endometrium(2)|large_intestine(1)|lung(1)|skin(1)|urinary_tract(2)	8		Prostate(19;8.44e-08)				CCGAGGGATTGGATTTTAGAT	0.368																																																	0								ENSG00000183527						81.0	75.0	77.0					21																	40552220		2203	4300	6503	PSMG1	SO:0001819	synonymous_variant	0			-	HGNC	AJ006291	CCDS13660.1, CCDS13661.1	21q22.3	2007-10-23	2007-10-23	2007-10-23	ENSG00000183527	ENSG00000183527			3043	protein-coding gene	gene with protein product		605296	"""Down syndrome critical region gene 2"""	DSCR2		10872820, 17189198	Standard	NM_003720		Approved	c21-LRP, LRPC21, PAC1	uc002yxi.4	O95456	OTTHUMG00000066034	ENST00000331573.3:c.384C>T	21.37:g.40552220G>A		Somatic	0	80	0.00		0.41568620468393047	33	23.26	10	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	36	28.00	B5BUN2|Q6FHA3|Q6FHD3|Q6S713	Silent	SNP	NA	NA	NA	NA	NA	NA	pirsf_Proteasome_assmbl_chp_1	p.S128	ENST00000331573.3	37	c.384	CCDS13660.1	21	.	.	.	.	.	.	.	.	.	.	G	7.825	0.718541	0.15372	.	.	ENSG00000183527	ENST00000440607	.	.	.	5.7	-11.4	0.00090	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	.	.	.	.	.	.	.	-2.8084	7.2123	0.25941	0.0752:0.0923:0.2058:0.6267	.	.	.	.	X	49	.	.	Q	-	1	0	PSMG1	39474090	0.013000	0.17824	0.000000	0.03702	0.790000	0.44656	-1.856000	0.01662	-2.235000	0.00714	0.557000	0.71058	CAA	-	pirsf_Proteasome_assmbl_chp_1		0.368	PSMG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMG1	protein_coding	OTTHUMT00000141404.2	G	NM_003720	-		40552220	-1	no_errors	ENST00000331573	ensembl	human	known	74_37	silent	SNP	0.001	A
RP11-402P6.9	0	genome.wustl.edu	37	X	70884069	70884069	+	RNA	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chrX:70884069G>A	ENST00000422194.1	-	0	408																											GCTCCCGGGGGCTATTGCTGC	0.542											OREG0019860	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000237265																																			RP11-402P6.9			0			-	Clone_based_vega_gene																													X.37:g.70884069G>A		Somatic	0	93	0.00	1125	0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	35	41	46.05		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000422194.1	37	NULL		X																																																																																			-	-		0.542	RP11-402P6.9-001	KNOWN	basic	lincRNA	ENSG00000237265	processed_transcript	OTTHUMT00000058987.1	G		-		70884069	-1	no_errors	ENST00000422194	ensembl	human	known	74_37	rna	SNP	0.000	A
ZNF324B	388569	genome.wustl.edu	37	19	58966802	58966802	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr19:58966802C>T	ENST00000336614.4	+	4	598	c.491C>T	c.(490-492)tCc>tTc	p.S164F	ZNF324B_ENST00000391696.1_Missense_Mutation_p.S154F|ZNF324B_ENST00000545523.1_Missense_Mutation_p.S164F	NM_207395.2	NP_997278.2	Q6AW86	Z324B_HUMAN	zinc finger protein 324B	164					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(7)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20		all_cancers(17;1.81e-17)|all_epithelial(17;1.21e-12)|Lung NSC(17;2.8e-05)|all_lung(17;0.000139)|Colorectal(82;0.000147)|Renal(17;0.00528)|all_neural(62;0.0133)|Ovarian(87;0.156)|Medulloblastoma(540;0.232)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0164)|Lung(386;0.179)		CGACTGACCTCCCCACTCAGG	0.652																																																	0								ENSG00000249471						52.0	59.0	57.0					19																	58966802		2203	4300	6503	ZNF324B	SO:0001583	missense	0			-	HGNC	AK127750	CCDS33138.1	19q13.43	2013-01-08				ENSG00000249471		"""Zinc fingers, C2H2-type"", ""-"""	33107	protein-coding gene	gene with protein product							Standard	NM_207395		Approved	FLJ45850	uc002qsv.1	Q6AW86		ENST00000336614.4:c.491C>T	19.37:g.58966802C>T	ENSP00000337473:p.Ser164Phe	Somatic	0	60	0.00		0.41568620468393047	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	29	29.27	B2RTZ6|Q6ZMX8|Q6ZS42	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S164F	ENST00000336614.4	37	c.491	CCDS33138.1	19	.	.	.	.	.	.	.	.	.	.	C	12.95	2.091918	0.36952	.	.	ENSG00000249471	ENST00000336614;ENST00000545523;ENST00000391696	T;T;T	0.08720	3.3;3.3;3.06	2.53	1.47	0.22746	.	0.198935	0.25250	N	0.032032	T	0.09069	0.0224	L	0.36672	1.1	0.09310	N	1	D;P	0.67145	0.996;0.69	P;B	0.55087	0.768;0.206	T	0.20571	-1.0271	10	0.11794	T	0.64	.	4.6745	0.12705	0.0:0.6926:0.0:0.3074	.	164;154	Q6AW86;C9JTQ8	Z324B_HUMAN;.	F	164;164;154	ENSP00000337473:S164F;ENSP00000438930:S164F;ENSP00000375578:S154F	ENSP00000337473:S164F	S	+	2	0	ZNF324B	63658614	0.433000	0.25562	0.013000	0.15412	0.044000	0.14063	-0.022000	0.12480	0.611000	0.30052	0.491000	0.48974	TCC	-	NULL		0.652	ZNF324B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF324B	protein_coding	OTTHUMT00000467038.1	C	NM_207395	-		58966802	+1	no_errors	ENST00000336614	ensembl	human	known	74_37	missense	SNP	0.032	T
SLCO1A2	6579	genome.wustl.edu	37	12	21445201	21445201	+	Missense_Mutation	SNP	C	C	T	rs373572811		TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr12:21445201C>T	ENST00000307378.6	-	13	2227	c.1507G>A	c.(1507-1509)Gga>Aga	p.G503R	SLCO1A2_ENST00000452078.1_Missense_Mutation_p.G503R|SLCO1A2_ENST00000390670.3_Missense_Mutation_p.G501R|SLCO1A2_ENST00000458504.1_Missense_Mutation_p.G371R|SLCO1A2_ENST00000537524.1_Missense_Mutation_p.G371R	NM_134431.3	NP_602307.1	P46721	SO1A2_HUMAN	solute carrier organic anion transporter family, member 1A2	503					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	organic anion transmembrane transporter activity (GO:0008514)			breast(2)|endometrium(2)|kidney(4)|large_intestine(8)|lung(23)|ovary(1)|pancreas(1)|skin(6)|upper_aerodigestive_tract(1)	48					Aminohippurate(DB00345)|Atorvastatin(DB01076)|Bumetanide(DB00887)|Chlorambucil(DB00291)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dexamethasone(DB01234)|Digitoxin(DB01396)|Digoxin(DB00390)|Dinoprostone(DB00917)|Enalapril(DB00584)|Erythromycin(DB00199)|Estradiol(DB00783)|Estriol(DB04573)|Estrone(DB00655)|Fexofenadine(DB00950)|Glyburide(DB01016)|Hydrocortisone(DB00741)|Ibuprofen(DB01050)|Indinavir(DB00224)|Indomethacin(DB00328)|Ketoconazole(DB01026)|Ketoprofen(DB01009)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Lovastatin(DB00227)|Methotrexate(DB00563)|Methyltestosterone(DB06710)|Mirabegron(DB08893)|Naloxone(DB01183)|Naproxen(DB00788)|Nelfinavir(DB00220)|Ouabain(DB01092)|Pravastatin(DB00175)|Prednisolone(DB00860)|Prednisone(DB00635)|Probenecid(DB01032)|Quinidine(DB00908)|Quinine(DB00468)|Rifampicin(DB01045)|Ritonavir(DB00503)|Rocuronium(DB00728)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|Simvastatin(DB00641)|Spironolactone(DB00421)|Sumatriptan(DB00669)|Tauroursodeoxycholic acid(DB08834)|Testosterone(DB00624)|Tolbutamide(DB01124)|Ursodeoxycholic acid(DB01586)|Verapamil(DB00661)	CAGTCAGGTCCTTTGTCGCAC	0.403																																																	0								ENSG00000084453	C	ARG/GLY,ARG/GLY	1,4405	2.1+/-5.4	0,1,2202	81.0	80.0	81.0		1507,1507	4.1	1.0	12		81	0,8600		0,0,4300	no	missense,missense	SLCO1A2	NM_134431.3,NM_021094.3	125,125	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign,benign	503/671,503/671	21445201	1,13005	2203	4300	6503	SLCO1A2	SO:0001583	missense	0			-	HGNC		CCDS8686.1	12p12	2013-05-22	2003-11-25	2003-11-26	ENSG00000084453	ENSG00000084453		"""Solute carriers"""	10956	protein-coding gene	gene with protein product		602883	"""solute carrier family 21 (organic anion transporter), member 3"""	SLC21A3		9007731	Standard	NM_134431		Approved	OATP, OATP1A2, OATP-A	uc001rer.3	P46721	OTTHUMG00000156259	ENST00000307378.6:c.1507G>A	12.37:g.21445201C>T	ENSP00000305974:p.Gly503Arg	Somatic	0	83	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	53	19.70	Q9UGP7|Q9UL38	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_OA_transporter,pfam_MFS,pfam_Kazal_dom,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	p.G503R	ENST00000307378.6	37	c.1507	CCDS8686.1	12	.	.	.	.	.	.	.	.	.	.	C	10.14	1.267301	0.23136	2.27E-4	0.0	ENSG00000084453	ENST00000307378;ENST00000452078;ENST00000458504;ENST00000537524;ENST00000390670	T;T;T;T;T	0.38401	1.14;1.14;1.14;1.14;1.14	5.09	4.12	0.48240	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.482210	0.23821	N	0.044231	T	0.35480	0.0933	M	0.64170	1.965	0.24791	N	0.992752	B;B	0.29301	0.241;0.004	B;B	0.34242	0.178;0.02	T	0.15752	-1.0426	10	0.30854	T	0.27	.	9.5238	0.39152	0.0:0.7636:0.1487:0.0877	.	501;503	P46721-2;P46721	.;SO1A2_HUMAN	R	503;503;371;371;501	ENSP00000305974:G503R;ENSP00000393973:G503R;ENSP00000394854:G371R;ENSP00000439401:G371R;ENSP00000375088:G501R	ENSP00000305974:G503R	G	-	1	0	SLCO1A2	21336468	0.790000	0.28787	0.984000	0.44739	0.629000	0.37895	1.163000	0.31798	2.646000	0.89796	0.563000	0.77884	GGA	-	pfam_OA_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter		0.403	SLCO1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLCO1A2	protein_coding	OTTHUMT00000343648.3	C	NM_021094	-		21445201	-1	no_errors	ENST00000307378	ensembl	human	known	74_37	missense	SNP	0.442	T
PPP1R9B	84687	genome.wustl.edu	37	17	48213002	48213002	+	Silent	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr17:48213002G>A	ENST00000316878.6	-	11	2312	c.2310C>T	c.(2308-2310)ttC>ttT	p.F770F	PPP1R9B_ENST00000501501.2_5'UTR|AC002401.1_ENST00000451776.1_RNA	NM_032595.3	NP_115984.3	Q96SB3	NEB2_HUMAN	protein phosphatase 1, regulatory subunit 9B	770	Interacts with TGN38. {ECO:0000250}.				actin filament organization (GO:0007015)|calcium-mediated signaling (GO:0019722)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular response to morphine (GO:0071315)|dendrite development (GO:0016358)|filopodium assembly (GO:0046847)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell growth (GO:0030308)|regulation of cell growth by extracellular stimulus (GO:0001560)|regulation of cell proliferation (GO:0042127)|regulation of exit from mitosis (GO:0007096)|regulation of opioid receptor signaling pathway (GO:2000474)|regulation of protein phosphorylation (GO:0001932)|RNA splicing (GO:0008380)	cell junction (GO:0030054)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|protein phosphatase type 1 complex (GO:0000164)|ruffle membrane (GO:0032587)|synapse (GO:0045202)	protein phosphatase 1 binding (GO:0008157)|protein phosphatase inhibitor activity (GO:0004864)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	8						CCTTTTTCAGGAACTCGATCT	0.607																																																	0								ENSG00000108819						39.0	40.0	39.0					17																	48213002		2030	4160	6190	PPP1R9B	SO:0001819	synonymous_variant	0			-	HGNC	AJ401189	CCDS74102.1	17q21.33	2013-01-31	2011-10-04	2001-07-02	ENSG00000108819	ENSG00000108819		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9298	protein-coding gene	gene with protein product	"""spinophilin"", ""Neurabin-2"""	603325	"""protein phosphatase 1, regulatory subunit 9B, spinophilin"", ""protein phosphatase 1, regulatory (inhibitor) subunit 9B"""	PPP1R6, PPP1R9		9275233	Standard	NM_032595		Approved	Spn, SPINO	uc002iqh.4	Q96SB3	OTTHUMG00000162008	ENST00000316878.6:c.2310C>T	17.37:g.48213002G>A		Somatic	0	38	0.00		0.41568620468393047	133	10.74	16	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	17	22.73	Q8TCR9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.F770	ENST00000316878.6	37	c.2310		17																																																																																			-	NULL		0.607	PPP1R9B-201	KNOWN	basic|appris_principal	protein_coding	PPP1R9B	protein_coding		G	NM_032595	-		48213002	-1	no_errors	ENST00000316878	ensembl	human	known	74_37	silent	SNP	1.000	A
ARAP2	116984	genome.wustl.edu	37	4	36126536	36126536	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr4:36126536G>A	ENST00000303965.4	-	22	4183	c.3694C>T	c.(3694-3696)Ctt>Ttt	p.L1232F		NM_015230.3	NP_056045.2	Q8WZ64	ARAP2_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2	1232	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of ARF GTPase activity (GO:0032312)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(32)|ovary(2)|pancreas(1)|prostate(3)|skin(7)|urinary_tract(1)	82						ACCCCTGGAAGAGAACGTATA	0.368																																																	0								ENSG00000047365						177.0	177.0	177.0					4																	36126536		2203	4300	6503	ARAP2	SO:0001583	missense	0			-	HGNC	AF411982	CCDS3441.1	4p15.1	2013-01-11	2008-09-22	2008-09-22	ENSG00000047365	ENSG00000047365		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16924	protein-coding gene	gene with protein product		606645	"""centaurin, delta 1"""	CENTD1			Standard	NM_015230		Approved	PARX	uc003gsq.2	Q8WZ64	OTTHUMG00000097811	ENST00000303965.4:c.3694C>T	4.37:g.36126536G>A	ENSP00000302895:p.Leu1232Phe	Somatic	0	51	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	37	15.91	Q4W5D2|Q7Z2L5|Q96L70|Q96P49|Q9Y4E4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RhoGAP_dom,pfam_Pleckstrin_homology,pfam_ArfGAP,pfam_SAM_type1,pfam_SAM_2,pfam_Ras-assoc,superfamily_Rho_GTPase_activation_prot,superfamily_SAM/pointed,smart_SAM,smart_Pleckstrin_homology,smart_ArfGAP,smart_RhoGAP_dom,pfscan_Pleckstrin_homology,pfscan_Ras-assoc,pfscan_SAM,pfscan_ArfGAP,pfscan_RhoGAP_dom,prints_ArfGAP	p.L1232F	ENST00000303965.4	37	c.3694	CCDS3441.1	4	.	.	.	.	.	.	.	.	.	.	G	19.63	3.863834	0.71949	.	.	ENSG00000047365	ENST00000303965	T	0.42513	0.97	5.24	5.24	0.73138	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.081511	0.49305	D	0.000143	T	0.65678	0.2714	M	0.88979	2.995	0.47441	D	0.99942	D	0.56968	0.978	P	0.58721	0.844	T	0.73379	-0.4001	10	0.87932	D	0	.	14.4331	0.67264	0.0:0.1472:0.8528:0.0	.	1232	Q8WZ64	ARAP2_HUMAN	F	1232	ENSP00000302895:L1232F	ENSP00000302895:L1232F	L	-	1	0	ARAP2	35802931	1.000000	0.71417	0.972000	0.41901	0.983000	0.72400	3.708000	0.54845	2.443000	0.82685	0.585000	0.79938	CTT	-	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom		0.368	ARAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARAP2	protein_coding	OTTHUMT00000215074.2	G	NM_015230	-		36126536	-1	no_errors	ENST00000303965	ensembl	human	known	74_37	missense	SNP	0.966	A
COL9A1	1297	genome.wustl.edu	37	6	70950397	70950397	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr6:70950397C>T	ENST00000357250.6	-	32	2232	c.2074G>A	c.(2074-2076)Gaa>Aaa	p.E692K	RP1-149L1.1_ENST00000522264.1_RNA|COL9A1_ENST00000489611.1_5'UTR|COL9A1_ENST00000370499.4_Missense_Mutation_p.E449K|COL9A1_ENST00000320755.7_Missense_Mutation_p.E449K	NM_001851.4	NP_001842.3	P20849	CO9A1_HUMAN	collagen, type IX, alpha 1	692	Collagen-like 7.|Triple-helical region (COL2).				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|organ morphogenesis (GO:0009887)|tissue homeostasis (GO:0001894)	collagen type IX trimer (GO:0005594)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(44)|ovary(5)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)	80						CTTACAAGTTCCCCCCTTTCT	0.323																																																	0								ENSG00000112280						76.0	94.0	88.0					6																	70950397		2203	4300	6503	COL9A1	SO:0001583	missense	0			-	HGNC		CCDS4971.1, CCDS47447.1	6q13	2013-05-07			ENSG00000112280	ENSG00000112280		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2217	protein-coding gene	gene with protein product		120210				1429648	Standard	NM_001851		Approved		uc003pfg.4	P20849	OTTHUMG00000014988	ENST00000357250.6:c.2074G>A	6.37:g.70950397C>T	ENSP00000349790:p.Glu692Lys	Somatic	0	54	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	28	22.22	Q13699|Q13700|Q5TF52|Q6P467|Q96BM8|Q99225|Q9H151|Q9H152|Q9Y6P2|Q9Y6P3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Collagen,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G	p.E692K	ENST00000357250.6	37	c.2074	CCDS4971.1	6	.	.	.	.	.	.	.	.	.	.	C	18.90	3.721241	0.68959	.	.	ENSG00000112280	ENST00000357250;ENST00000320755;ENST00000370499	D;D;D	0.93659	-3.26;-3.26;-3.26	5.61	5.61	0.85477	.	0.281587	0.44097	D	0.000483	D	0.92961	0.7760	L	0.41124	1.26	0.54753	D	0.999989	P;P;B	0.51653	0.947;0.731;0.379	P;B;B	0.56563	0.801;0.397;0.11	D	0.91959	0.5577	10	0.39692	T	0.17	.	19.6282	0.95689	0.0:1.0:0.0:0.0	.	692;449;241	P20849;P20849-2;B3KWS8	CO9A1_HUMAN;.;.	K	692;449;449	ENSP00000349790:E692K;ENSP00000315252:E449K;ENSP00000359530:E449K	ENSP00000315252:E449K	E	-	1	0	COL9A1	71007118	1.000000	0.71417	1.000000	0.80357	0.642000	0.38348	6.170000	0.71920	2.633000	0.89246	0.650000	0.86243	GAA	-	pfam_Collagen		0.323	COL9A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL9A1	protein_coding	OTTHUMT00000041131.2	C		-		70950397	-1	no_errors	ENST00000357250	ensembl	human	known	74_37	missense	SNP	1.000	T
PLEKHG5	57449	genome.wustl.edu	37	1	6533333	6533333	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr1:6533333G>A	ENST00000400915.3	-	9	1007	c.941C>T	c.(940-942)cCc>cTc	p.P314L	PLEKHG5_ENST00000377728.3_Missense_Mutation_p.P258L|PLEKHG5_ENST00000377737.2_Missense_Mutation_p.P258L|PLEKHG5_ENST00000377740.3_Missense_Mutation_p.P335L|PLEKHG5_ENST00000537245.1_Missense_Mutation_p.P337L|PLEKHG5_ENST00000544978.1_Missense_Mutation_p.P258L|PLEKHG5_ENST00000340850.5_Missense_Mutation_p.P258L|PLEKHG5_ENST00000535355.1_Missense_Mutation_p.P327L|PLEKHG5_ENST00000377732.1_Missense_Mutation_p.P295L|PLEKHG5_ENST00000377748.1_Missense_Mutation_p.P335L|PLEKHG5_ENST00000400913.1_Missense_Mutation_p.P258L|PLEKHG5_ENST00000377725.1_Missense_Mutation_p.P258L	NM_001042663.1	NP_001036128.1	O94827	PKHG5_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 5	314					apoptotic signaling pathway (GO:0097190)|endothelial cell chemotaxis (GO:0035767)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)			liver(1)	1	Ovarian(185;0.02)|all_lung(157;0.154)	all_cancers(23;1.7e-35)|all_epithelial(116;2.78e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|Colorectal(325;4.47e-05)|all_hematologic(16;0.00014)|Breast(487;0.000688)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0448)		Epithelial(90;5.51e-35)|GBM - Glioblastoma multiforme(13;3.57e-27)|Colorectal(212;6.23e-08)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000894)|BRCA - Breast invasive adenocarcinoma(365;0.00107)|STAD - Stomach adenocarcinoma(132;0.00159)|READ - Rectum adenocarcinoma(331;0.0419)		GCTGGTGCTGGGGCCGGAGCT	0.657																																																	0								ENSG00000171680						17.0	23.0	21.0					1																	6533333		2199	4295	6494	PLEKHG5	SO:0001583	missense	0			-	HGNC	AK024676	CCDS79.1, CCDS41240.1, CCDS41241.1, CCDS57967.1, CCDS57968.1, CCDS57969.1	1p36.31	2014-09-17		2005-08-09	ENSG00000171680	ENSG00000171680		"""Pleckstrin homology (PH) domain containing"""	29105	protein-coding gene	gene with protein product	"""synectin-binding guanine exchange factor"""	611101				17564964	Standard	NM_001042663		Approved	KIAA0720, Syx, GEF720, Tech	uc010nzr.1	O94827	OTTHUMG00000000905	ENST00000400915.3:c.941C>T	1.37:g.6533333G>A	ENSP00000383706:p.Pro314Leu	Somatic	0	11	0.00		0.41568620468393047	12	14.29	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	6	53.85	B3KU07|B7Z2M3|B7Z5X2|F5GZ21|F5H1I0|Q5SY17|Q5T8W5|Q5T8W9|Q6ZNM0|Q7Z436|Q86YD8|Q96BS1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.P337L	ENST00000400915.3	37	c.1010	CCDS41241.1	1	.	.	.	.	.	.	.	.	.	.	G	13.25	2.180865	0.38511	.	.	ENSG00000171680	ENST00000377748;ENST00000340850;ENST00000400913;ENST00000400915;ENST00000377740;ENST00000377732;ENST00000377728;ENST00000377725;ENST00000535355;ENST00000377737;ENST00000535966;ENST00000537245;ENST00000544978	T;T;T;T;T;T;T;T;T;T;T;T	0.66815	-0.22;-0.22;-0.22;-0.22;-0.2;-0.22;-0.22;-0.23;-0.23;-0.22;-0.23;-0.23	5.24	3.37	0.38596	.	0.149829	0.45606	D	0.000349	T	0.51398	0.1672	L	0.31578	0.945	0.37726	D	0.925109	B;B;B;B;B	0.14012	0.008;0.008;0.009;0.008;0.005	B;B;B;B;B	0.13407	0.005;0.005;0.004;0.009;0.004	T	0.51164	-0.8740	10	0.33940	T	0.23	-27.2896	10.2093	0.43131	0.1633:0.0:0.8367:0.0	.	327;258;335;335;314	F5GZ21;O94827-4;Q5SY18;O94827-2;O94827	.;.;.;.;PKHG5_HUMAN	L	335;258;258;314;335;295;258;258;327;258;164;337;258	ENSP00000366977:P335L;ENSP00000344570:P258L;ENSP00000383704:P258L;ENSP00000383706:P314L;ENSP00000366969:P335L;ENSP00000366961:P295L;ENSP00000366957:P258L;ENSP00000366954:P258L;ENSP00000441445:P327L;ENSP00000366966:P258L;ENSP00000439625:P337L;ENSP00000437710:P258L	ENSP00000344570:P258L	P	-	2	0	PLEKHG5	6455920	1.000000	0.71417	1.000000	0.80357	0.814000	0.46013	3.412000	0.52679	1.230000	0.43646	-0.254000	0.11334	CCC	-	NULL		0.657	PLEKHG5-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLEKHG5	protein_coding	OTTHUMT00000002631.1	G	NM_020631	-		6533333	-1	no_errors	ENST00000537245	ensembl	human	known	74_37	missense	SNP	1.000	A
ZNF214	7761	genome.wustl.edu	37	11	7021488	7021488	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr11:7021488C>T	ENST00000278314.4	-	3	1741	c.1426G>A	c.(1426-1428)Ggg>Agg	p.G476R	ZNF214_ENST00000531083.1_5'Flank|ZNF214_ENST00000536068.1_Missense_Mutation_p.G476R	NM_013249.2	NP_037381.2	Q9UL59	ZN214_HUMAN	zinc finger protein 214	476					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(10)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				Epithelial(150;3.87e-08)|BRCA - Breast invasive adenocarcinoma(625;0.081)		AAGCCCTTCCCACATTCAGGA	0.438																																					Ovarian(22;251 657 736 21522 46864)												0								ENSG00000149050						96.0	101.0	100.0					11																	7021488		2201	4295	6496	ZNF214	SO:0001583	missense	0			-	HGNC	AF056617	CCDS31418.1	11p15.4	2013-01-08				ENSG00000149050		"""Zinc fingers, C2H2-type"", ""-"""	13006	protein-coding gene	gene with protein product		605015					Standard	NM_013249		Approved		uc001mfa.2	Q9UL59		ENST00000278314.4:c.1426G>A	11.37:g.7021488C>T	ENSP00000278314:p.Gly476Arg	Somatic	0	58	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	27	18.18	B2R8Q1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G476R	ENST00000278314.4	37	c.1426	CCDS31418.1	11	.	.	.	.	.	.	.	.	.	.	C	17.98	3.519883	0.64634	.	.	ENSG00000149050	ENST00000278314;ENST00000536068	T;T	0.58506	0.33;0.33	4.05	3.14	0.36123	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.151699	0.31145	N	0.008166	T	0.52435	0.1734	M	0.70787	2.145	0.31921	N	0.61348	P	0.46142	0.873	B	0.38264	0.269	T	0.67397	-0.5681	10	0.87932	D	0	.	9.9786	0.41800	0.0:0.8982:0.0:0.1018	.	476	Q9UL59	ZN214_HUMAN	R	476	ENSP00000278314:G476R;ENSP00000445373:G476R	ENSP00000278314:G476R	G	-	1	0	ZNF214	6978064	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	2.885000	0.48570	1.286000	0.44565	0.561000	0.74099	GGG	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.438	ZNF214-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF214	protein_coding	OTTHUMT00000385349.1	C		-		7021488	-1	no_errors	ENST00000278314	ensembl	human	known	74_37	missense	SNP	1.000	T
FAM83F	113828	genome.wustl.edu	37	22	40417726	40417726	+	Silent	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr22:40417726C>T	ENST00000333407.6	+	4	1306	c.1212C>T	c.(1210-1212)gtC>gtT	p.V404V	FAM83F_ENST00000473717.1_Silent_p.V236V	NM_138435.2	NP_612444.2	Q8NEG4	FA83F_HUMAN	family with sequence similarity 83, member F	404										breast(1)|endometrium(2)|large_intestine(1)|lung(4)|skin(4)|urinary_tract(2)	14						GCAGGATGGTCTCTCACATGC	0.657																																																	0								ENSG00000133477						36.0	29.0	31.0					22																	40417726		2203	4300	6503	FAM83F	SO:0001819	synonymous_variant	0			-	HGNC		CCDS14000.2	22q13.1	2006-03-22			ENSG00000133477	ENSG00000133477			25148	protein-coding gene	gene with protein product						12477932	Standard	NM_138435		Approved		uc003ayk.1	Q8NEG4	OTTHUMG00000150688	ENST00000333407.6:c.1212C>T	22.37:g.40417726C>T		Somatic	0	101	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	46	23.33	Q96FD6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF1669	p.V404	ENST00000333407.6	37	c.1212	CCDS14000.2	22																																																																																			-	NULL		0.657	FAM83F-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM83F	protein_coding	OTTHUMT00000319624.3	C	NM_138435	-		40417726	+1	no_errors	ENST00000333407	ensembl	human	known	74_37	silent	SNP	0.001	T
GLIS3	169792	genome.wustl.edu	37	9	4118552	4118552	+	Missense_Mutation	SNP	G	G	C			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr9:4118552G>C	ENST00000324333.10	-	3	654	c.461C>G	c.(460-462)tCc>tGc	p.S154C	GLIS3_ENST00000381971.3_Missense_Mutation_p.S309C	NM_152629.3	NP_689842.3	Q8NEA6	GLIS3_HUMAN	GLIS family zinc finger 3	154	Ser-rich.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(12)|lung(4)|ovary(2)|prostate(1)|skin(1)	26		Acute lymphoblastic leukemia(2;0.00464)|Breast(48;0.148)		Lung(2;0.00163)|GBM - Glioblastoma multiforme(50;0.00301)|LUSC - Lung squamous cell carcinoma(2;0.0148)		GATGCCATCGGACAGCGGGGA	0.607																																																	0								ENSG00000107249						106.0	93.0	97.0					9																	4118552		2203	4300	6503	GLIS3	SO:0001583	missense	0			-	HGNC	BC033899	CCDS6451.1, CCDS43784.1	9p24.2	2008-05-02	2004-07-16	2004-07-16	ENSG00000107249	ENSG00000107249		"""Zinc fingers, C2H2-type"""	28510	protein-coding gene	gene with protein product		610192	"""zinc finger protein 515"""	ZNF515		14500813	Standard	NM_152629		Approved	MGC33662	uc003zhx.1	Q8NEA6	OTTHUMG00000019463	ENST00000324333.10:c.461C>G	9.37:g.4118552G>C	ENSP00000325494:p.Ser154Cys	Somatic	0	46	0.00		0.41568620468393047	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	39	15.22	B1AL19|Q1PHK5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S309C	ENST00000324333.10	37	c.926	CCDS6451.1	9	.	.	.	.	.	.	.	.	.	.	G	17.03	3.285315	0.59867	.	.	ENSG00000107249	ENST00000324333;ENST00000381971	T;T	0.38401	1.14;1.15	5.59	5.59	0.84812	.	0.000000	0.51477	D	0.000092	T	0.67002	0.2847	M	0.86028	2.79	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.996	T	0.71800	-0.4483	10	0.87932	D	0	.	19.5869	0.95493	0.0:0.0:1.0:0.0	.	309;154	Q8NEA6-2;Q8NEA6	.;GLIS3_HUMAN	C	154;309	ENSP00000325494:S154C;ENSP00000371398:S309C	ENSP00000325494:S154C	S	-	2	0	GLIS3	4108552	1.000000	0.71417	0.581000	0.28614	0.279000	0.26890	9.793000	0.99091	2.633000	0.89246	0.655000	0.94253	TCC	-	NULL		0.607	GLIS3-003	KNOWN	basic|CCDS	protein_coding	GLIS3	protein_coding	OTTHUMT00000051559.1	G	NM_152629	-		4118552	-1	no_errors	ENST00000381971	ensembl	human	known	74_37	missense	SNP	1.000	C
SLC44A5	204962	genome.wustl.edu	37	1	76007151	76007151	+	5'UTR	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr1:76007151C>T	ENST00000370855.5	-	0	95				SLC44A5_ENST00000469525.1_5'UTR|SLC44A5_ENST00000370859.3_5'UTR	NM_152697.4	NP_689910.2	Q8NCS7	CTL5_HUMAN	solute carrier family 44, member 5						glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				kidney(1)|large_intestine(13)|lung(35)|ovary(2)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	61						AAGGCTGTCTCTTCAGAAGTA	0.323																																																	0								ENSG00000137968						74.0	73.0	74.0					1																	76007151		2203	4300	6503	SLC44A5	SO:0001623	5_prime_UTR_variant	0			-	HGNC	BC034580	CCDS667.1, CCDS44164.1	1p31.1	2013-05-22			ENSG00000137968	ENSG00000137968		"""Solute carriers"""	28524	protein-coding gene	gene with protein product						15715662	Standard	NM_152697		Approved	MGC34032, CTL5	uc001dgu.3	Q8NCS7	OTTHUMG00000009721	ENST00000370855.5:c.-19G>A	1.37:g.76007151C>T		Somatic	0	83	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	50	20.63	B5MCU3|Q4G0K0|Q8NA44|Q8NB86	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000370855.5	37	NULL	CCDS667.1	1																																																																																			-	-		0.323	SLC44A5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC44A5	protein_coding	OTTHUMT00000026921.1	C	NM_152697	-		76007151	-1	no_errors	ENST00000469525	ensembl	human	known	74_37	rna	SNP	0.671	T
HINT2	84681	genome.wustl.edu	37	9	35813318	35813318	+	Silent	SNP	G	G	C			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr9:35813318G>C	ENST00000259667.5	-	4	386	c.345C>G	c.(343-345)ctC>ctG	p.L115L	HINT2_ENST00000474908.1_5'UTR|SPAG8_ENST00000340291.2_5'Flank|SPAG8_ENST00000396638.2_5'Flank|SPAG8_ENST00000479751.1_5'Flank|AL133410.1_ENST00000582432.1_RNA|SPAG8_ENST00000484764.1_5'Flank|TMEM8B_ENST00000377996.1_5'Flank	NM_032593.2	NP_115982.1	Q9BX68	HINT2_HUMAN	histidine triad nucleotide binding protein 2	115	HIT. {ECO:0000255|PROSITE- ProRule:PRU00464}.				apoptotic process (GO:0006915)|steroid biosynthetic process (GO:0006694)	mitochondrion (GO:0005739)	hydrolase activity (GO:0016787)|nucleotide binding (GO:0000166)			NS(2)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	7	all_epithelial(49;0.161)		LUSC - Lung squamous cell carcinoma(32;0.00521)|Lung(28;0.00697)|STAD - Stomach adenocarcinoma(86;0.194)			TGGCCACAAGGAGTAGGTGTC	0.547											OREG0019179	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									GBM(185;1694 2122 5473 25431 37228)												0								ENSG00000137133						138.0	135.0	136.0					9																	35813318		2203	4300	6503	HINT2	SO:0001819	synonymous_variant	0			-	HGNC	AY033094	CCDS6594.1	9p11.2	2005-12-20			ENSG00000137133	ENSG00000137133			18344	protein-coding gene	gene with protein product		609997					Standard	NM_032593		Approved		uc003zyh.3	Q9BX68	OTTHUMG00000019886	ENST00000259667.5:c.345C>G	9.37:g.35813318G>C		Somatic	0	47	0.00	858	0.41568620468393047	256	17.95	56	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	24	25.00	Q5TCW3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Histidine_triad_HIT,superfamily_HIT-like,pfscan_HIT-like,prints_Histidine_triad_HIT	p.L115	ENST00000259667.5	37	c.345	CCDS6594.1	9																																																																																			-	pfam_Histidine_triad_HIT,superfamily_HIT-like,pfscan_HIT-like		0.547	HINT2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HINT2	protein_coding	OTTHUMT00000052390.1	G	NM_032593	-		35813318	-1	no_errors	ENST00000259667	ensembl	human	known	74_37	silent	SNP	1.000	C
DMBT1P1	375940	genome.wustl.edu	37	10	124516507	124516507	+	RNA	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr10:124516507G>A	ENST00000439464.2	+	0	298					NR_003570.1																						CACAACTGTGGGCACCTGGAG	0.502																																																	0								ENSG00000176584																																			RP11-318C4.2			0			-	Clone_based_vega_gene																													10.37:g.124516507G>A		Somatic	0	38	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	22	37.14		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000439464.2	37	NULL		10																																																																																			-	-		0.502	RP11-318C4.2-001	KNOWN	basic	processed_transcript	FLJ46361	pseudogene	OTTHUMT00000471298.1	G		-		124516507	+1	no_errors	ENST00000439464	ensembl	human	known	74_37	rna	SNP	0.034	A
RYR2	6262	genome.wustl.edu	37	1	237754098	237754098	+	Silent	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr1:237754098C>T	ENST00000366574.2	+	31	4283	c.3966C>T	c.(3964-3966)ctC>ctT	p.L1322L	RYR2_ENST00000360064.6_Silent_p.L1320L|RYR2_ENST00000542537.1_Silent_p.L1306L	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	1322	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CTGGAGGGCTCCCTGGGGCTG	0.512																																																	0								ENSG00000198626						113.0	110.0	111.0					1																	237754098		1923	4134	6057	RYR2	SO:0001819	synonymous_variant	0			-	HGNC	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.3966C>T	1.37:g.237754098C>T		Somatic	0	46	0.00		0.41568620468393047	2	50.00	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	26	29.73	Q15411|Q546N8|Q5T3P2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_hand_dom,pfscan_MIR_motif	p.L1320	ENST00000366574.2	37	c.3960	CCDS55691.1	1																																																																																			-	NULL		0.512	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	protein_coding	OTTHUMT00000095402.2	C	NM_001035	-		237754098	+1	no_errors	ENST00000360064	ensembl	human	known	74_37	silent	SNP	0.088	T
LOC101927795	101927795	genome.wustl.edu	37	2	201645537	201645537	+	RNA	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr2:201645537G>A	ENST00000447972.3	-	0	582				AOX2P_ENST00000467645.1_RNA																							TCACAGAAATGGTAGGAAATT	0.428																																																	0								ENSG00000243478																																			AOX2P			0			-	HGNC																													2.37:g.201645537G>A		Somatic	0	24	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	18	25.00		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000447972.3	37	NULL		2																																																																																			-	-		0.428	AC007163.6-001	KNOWN	basic	antisense	AOX2P	antisense	OTTHUMT00000335879.3	G		-		201645537	+1	no_errors	ENST00000467645	ensembl	human	known	74_37	rna	SNP	1.000	A
ASTN1	460	genome.wustl.edu	37	1	177001985	177001985	+	Splice_Site	SNP	C	C	T	rs143158997		TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr1:177001985C>T	ENST00000367654.3	-	3	683	c.472G>A	c.(472-474)Ggt>Agt	p.G158S	ASTN1_ENST00000361833.2_Splice_Site_p.G158S|ASTN1_ENST00000424564.2_Splice_Site_p.G158S|ASTN1_ENST00000367657.3_Splice_Site_p.G158S|ASTN1_ENST00000281881.3_5'UTR	NM_004319.1	NP_004310.1	O14525	ASTN1_HUMAN	astrotactin 1	158					locomotory behavior (GO:0007626)|neuron cell-cell adhesion (GO:0007158)|neuron migration (GO:0001764)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)				NS(4)|breast(5)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(23)|liver(1)|lung(81)|ovary(6)|prostate(5)|skin(10)|urinary_tract(3)	153						ATCATGCCACCCTAGGAAGAG	0.557																																																	0								ENSG00000152092						46.0	41.0	43.0					1																	177001985		2201	4299	6500	ASTN1	SO:0001630	splice_region_variant	0			-	HGNC	AB006627	CCDS1319.1, CCDS44280.1, CCDS65732.1	1q25.2	2008-02-05	2006-08-24	2006-08-24	ENSG00000152092	ENSG00000152092			773	protein-coding gene	gene with protein product		600904	"""astrotactin"""	ASTN		9070947	Standard	NM_001286164		Approved		uc001glc.3	O14525	OTTHUMG00000035041	ENST00000367654.3:c.472-1G>A	1.37:g.177001985C>T		Somatic	0	23	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	20	20.00	A5PL12|B4DHI9|E9PFR8|O60799|Q5W0V7|Q5W0V8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_Fibronectin_type3,smart_EG-like_dom,smart_MACPF,pfscan_Fibronectin_type3	p.G158S	ENST00000367654.3	37	c.472		1	.	.	.	.	.	.	.	.	.	.	C	33	5.250245	0.95305	.	.	ENSG00000152092	ENST00000367657;ENST00000361833;ENST00000367654;ENST00000424564;ENST00000541808	T;T;T;T	0.18338	2.22;2.63;2.63;2.22	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	T	0.39253	0.1071	L	0.53249	1.67	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.02774	-1.1112	10	0.39692	T	0.17	-19.5497	18.8102	0.92054	0.0:1.0:0.0:0.0	.	158;158;158	O14525;O14525-2;B1AJS1	ASTN1_HUMAN;.;.	S	158	ENSP00000356629:G158S;ENSP00000354536:G158S;ENSP00000356626:G158S;ENSP00000395041:G158S	ENSP00000354536:G158S	G	-	1	0	ASTN1	175268608	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	7.676000	0.84012	2.509000	0.84616	0.655000	0.94253	GGT	-	NULL		0.557	ASTN1-201	KNOWN	basic	protein_coding	ASTN1	protein_coding		C	NM_004319	-	Missense_Mutation	177001985	-1	no_errors	ENST00000367654	ensembl	human	known	74_37	missense	SNP	1.000	T
DISP2	85455	genome.wustl.edu	37	15	40661929	40661929	+	Silent	SNP	C	C	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr15:40661929C>A	ENST00000267889.3	+	8	3703	c.3616C>A	c.(3616-3618)Cgg>Agg	p.R1206R	LINC00594_ENST00000561261.1_lincRNA|RP11-64K12.4_ENST00000558421.1_RNA	NM_033510.1	NP_277045.1	A7MBM2	DISP2_HUMAN	dispatched homolog 2 (Drosophila)	1206					smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)				breast(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(12)|ovary(4)	30		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;3.39e-06)|Colorectal(105;0.0114)|READ - Rectum adenocarcinoma(2;0.0649)|BRCA - Breast invasive adenocarcinoma(123;0.0798)|Lung(196;0.15)|LUAD - Lung adenocarcinoma(183;0.247)		GTGCTGTTCCCGGCCCCCACC	0.647																																																	0								ENSG00000140323						40.0	45.0	43.0					15																	40661929		2203	4299	6502	DISP2	SO:0001819	synonymous_variant	0			-	HGNC	AB051529	CCDS10056.1	15q14	2004-01-15			ENSG00000140323	ENSG00000140323			19712	protein-coding gene	gene with protein product		607503				11214970, 10619433	Standard	NM_033510		Approved	DISPB, KIAA1742, HsT16908	uc001zlk.1	A7MBM2	OTTHUMG00000129983	ENST00000267889.3:c.3616C>A	15.37:g.40661929C>A		Somatic	0	60	0.00		0.41568620468393047	6	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	30	11.43	Q6AHW3|Q9C0C1	Silent	SNP	NA	NA	NA	NA	NA	NA	pfscan_SSD	p.R1206	ENST00000267889.3	37	c.3616	CCDS10056.1	15																																																																																			-	NULL		0.647	DISP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DISP2	protein_coding	OTTHUMT00000252249.1	C	NM_033510	-		40661929	+1	no_errors	ENST00000267889	ensembl	human	known	74_37	silent	SNP	0.023	A
LEO1	123169	genome.wustl.edu	37	15	52246734	52246734	+	Silent	SNP	T	T	C			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr15:52246734T>C	ENST00000299601.5	-	7	1344	c.1284A>G	c.(1282-1284)gaA>gaG	p.E428E	LEO1_ENST00000315141.5_Intron	NM_138792.2	NP_620147.1	Q8WVC0	LEO1_HUMAN	Leo1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)	428					endodermal cell fate commitment (GO:0001711)|histone H2B ubiquitination (GO:0033523)|histone monoubiquitination (GO:0010390)|mRNA polyadenylation (GO:0006378)|negative regulation of myeloid cell differentiation (GO:0045638)|positive regulation of mRNA 3'-end processing (GO:0031442)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	Cdc73/Paf1 complex (GO:0016593)				endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(5)|skin(1)	14				all cancers(107;0.00264)		CATTTCCTTCTTCATCTCGGC	0.383																																					Esophageal Squamous(40;229 896 18505 32465 43844)|Ovarian(53;886 1123 14462 18432 23189)												0								ENSG00000166477						234.0	201.0	212.0					15																	52246734		2195	4293	6488	LEO1	SO:0001819	synonymous_variant	0			-	HGNC	AY302186	CCDS10146.1, CCDS66767.1	15q21.2	2008-02-05			ENSG00000166477	ENSG00000166477			30401	protein-coding gene	gene with protein product		610507				15632063	Standard	NM_001286430		Approved		uc002abo.3	Q8WVC0	OTTHUMG00000131843	ENST00000299601.5:c.1284A>G	15.37:g.52246734T>C		Somatic	0	42	0.00		0.41568620468393047	60	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	22	15.38	Q96N99	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Leo1	p.E428	ENST00000299601.5	37	c.1284	CCDS10146.1	15																																																																																			-	pfam_Leo1		0.383	LEO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LEO1	protein_coding	OTTHUMT00000254791.2	T	NM_138792	-		52246734	-1	no_errors	ENST00000299601	ensembl	human	known	74_37	silent	SNP	0.997	C
SPEF2	79925	genome.wustl.edu	37	5	35753864	35753864	+	Splice_Site	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr5:35753864G>A	ENST00000356031.3	+	24	3622		c.e24+1		CTD-2113L7.1_ENST00000510433.1_RNA|SPEF2_ENST00000440995.2_Splice_Site	NM_024867.3	NP_079143.3	Q9C093	SPEF2_HUMAN	sperm flagellar 2						axoneme assembly (GO:0035082)|brain morphogenesis (GO:0048854)|embryonic neurocranium morphogenesis (GO:0048702)|fertilization (GO:0009566)|immune system development (GO:0002520)|multicellular organismal aging (GO:0010259)|respiratory system development (GO:0060541)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)|manchette (GO:0002177)|sperm midpiece (GO:0097225)				breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(15)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	37	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			CCTGATGCAGGTAAGAGCAGC	0.478																																																	0								ENSG00000152582						103.0	107.0	106.0					5																	35753864		1954	4157	6111	SPEF2	SO:0001630	splice_region_variant	0			-	HGNC	AB051557	CCDS3910.1, CCDS43309.1	5p13.2	2010-05-04			ENSG00000152582	ENSG00000152582			26293	protein-coding gene	gene with protein product	"""cancer/testis antigen 122"""	610172				11214970, 16549801, 17610085	Standard	NM_024867		Approved	KPL2, FLJ23577, CT122	uc003jjo.3	Q9C093	OTTHUMG00000131111	ENST00000356031.3:c.3468+1G>A	5.37:g.35753864G>A		Somatic	0	47	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	13	23.53	Q2TAC9|Q96LL6|Q9H5C7|Q9H5Q7	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e24+1	ENST00000356031.3	37	c.3468+1	CCDS43309.1	5	.	.	.	.	.	.	.	.	.	.	G	17.90	3.503168	0.64298	.	.	ENSG00000152582	ENST00000356031;ENST00000440995	.	.	.	5.35	5.35	0.76521	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.0136	0.92884	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SPEF2	35789621	1.000000	0.71417	1.000000	0.80357	0.614000	0.37383	7.039000	0.76544	2.673000	0.90976	0.491000	0.48974	.	-	-		0.478	SPEF2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SPEF2	protein_coding	OTTHUMT00000367199.1	G	NM_144722	-	Intron	35753864	+1	no_errors	ENST00000356031	ensembl	human	known	74_37	splice_site	SNP	1.000	A
KLHL30	377007	genome.wustl.edu	37	2	239054442	239054442	+	Silent	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr2:239054442G>A	ENST00000409223.1	+	5	1226	c.1119G>A	c.(1117-1119)gcG>gcA	p.A373A	KLHL30_ENST00000305959.4_Silent_p.A355A			Q0D2K2	KLH30_HUMAN	kelch-like family member 30	373										lung(4)	4		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_hematologic(139;0.158)|all_lung(227;0.198)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;4.71e-24)|OV - Ovarian serous cystadenocarcinoma(60;3.02e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.63e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000109)|Lung(119;0.0108)|LUSC - Lung squamous cell carcinoma(224;0.0253)		ACGCCAGCGCGGCCCTCAATG	0.652																																																	0								ENSG00000168427						25.0	33.0	30.0					2																	239054442		2040	4173	6213	KLHL30	SO:0001819	synonymous_variant	0			-	HGNC		CCDS46555.1, CCDS46555.2	2q37.3	2013-02-22	2013-02-22		ENSG00000168427	ENSG00000168427		"""Kelch-like"", ""BTB/POZ domain containing"""	24770	protein-coding gene	gene with protein product			"""kelch-like 30 (Drosophila)"""				Standard	NM_198582		Approved	FLJ43374	uc002vxr.2	Q0D2K2	OTTHUMG00000152905	ENST00000409223.1:c.1119G>A	2.37:g.239054442G>A		Somatic	0	65	0.00		0.41568620468393047	6	40.00	4	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	30	23.08	Q6ZUS1	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Kelch_1,pfam_BTB_POZ,pfam_BACK,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.A373	ENST00000409223.1	37	c.1119	CCDS46555.2	2																																																																																			-	pfam_Kelch_1,smart_Kelch_1,pirsf_Kelch-like_gigaxonin		0.652	KLHL30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL30	protein_coding	OTTHUMT00000328518.1	G	NM_198582	-		239054442	+1	no_errors	ENST00000409223	ensembl	human	known	74_37	silent	SNP	0.005	A
ITPR3	3710	genome.wustl.edu	37	6	33630708	33630708	+	Silent	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr6:33630708C>T	ENST00000374316.5	+	10	1939	c.879C>T	c.(877-879)tgC>tgT	p.C293C	ITPR3_ENST00000605930.1_Silent_p.C293C			Q14573	ITPR3_HUMAN	inositol 1,4,5-trisphosphate receptor, type 3	293					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport into cytosol (GO:0060402)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|response to calcium ion (GO:0051592)|sensory perception of bitter taste (GO:0050913)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|nuclear outer membrane (GO:0005640)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)	inositol 1,3,4,5 tetrakisphosphate binding (GO:0043533)|inositol 1,4,5 trisphosphate binding (GO:0070679)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|inositol hexakisphosphate binding (GO:0000822)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(24)|ovary(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	85					Caffeine(DB00201)	ACGACCCCTGCCGTGGAGGAG	0.627																																																	0								ENSG00000096433						61.0	51.0	55.0					6																	33630708		2203	4300	6503	ITPR3	SO:0001819	synonymous_variant	0			-	HGNC	D26351	CCDS4783.1	6p21.31	2011-11-24	2011-04-28		ENSG00000096433	ENSG00000096433		"""Ion channels / Inositol triphosphate receptors"""	6182	protein-coding gene	gene with protein product		147267	"""inositol 1,4,5-triphosphate receptor, type 3"""			8081734, 8288584	Standard	NM_002224		Approved	IP3R3	uc021ywr.1	Q14573	OTTHUMG00000014532	ENST00000374316.5:c.879C>T	6.37:g.33630708C>T		Somatic	0	44	0.00		0.41568620468393047	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	9	40.00	Q14649|Q5TAQ2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ca-rel_channel,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ARM-type_fold,smart_MIR_motif,prints_InsP3_rcpt-bd,pfscan_MIR_motif	p.C293	ENST00000374316.5	37	c.879	CCDS4783.1	6																																																																																			-	pfam_MIR_motif,superfamily_MIR_motif,prints_InsP3_rcpt-bd		0.627	ITPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITPR3	protein_coding	OTTHUMT00000040204.2	C	NM_002224	-		33630708	+1	no_errors	ENST00000374316	ensembl	human	known	74_37	silent	SNP	1.000	T
CTNNA1	1495	genome.wustl.edu	37	5	138268382	138268382	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr5:138268382G>A	ENST00000302763.7	+	17	2504	c.2414G>A	c.(2413-2415)gGg>gAg	p.G805E	CTNNA1_ENST00000355078.5_Missense_Mutation_p.G702E|CTNNA1_ENST00000540387.1_Missense_Mutation_p.G435E|CTNNA1_ENST00000518825.1_Missense_Mutation_p.G805E	NM_001903.2	NP_001894.2	P35221	CTNA1_HUMAN	catenin (cadherin-associated protein), alpha 1, 102kDa	805					adherens junction organization (GO:0034332)|aging (GO:0007568)|apical junction assembly (GO:0043297)|axon regeneration (GO:0031103)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular protein localization (GO:0034613)|cellular response to indole-3-methanol (GO:0071681)|epithelial cell-cell adhesion (GO:0090136)|establishment or maintenance of cell polarity (GO:0007163)|gap junction assembly (GO:0016264)|male gonad development (GO:0008584)|muscle cell differentiation (GO:0042692)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell motility (GO:2000146)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of integrin-mediated signaling pathway (GO:2001045)|negative regulation of neuroblast proliferation (GO:0007406)|odontogenesis of dentin-containing tooth (GO:0042475)|ovarian follicle development (GO:0001541)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of smoothened signaling pathway (GO:0045880)|protein heterooligomerization (GO:0051291)|response to estrogen (GO:0043627)	acrosomal vesicle (GO:0001669)|actin cytoskeleton (GO:0015629)|catenin complex (GO:0016342)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|intercalated disc (GO:0014704)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|zonula adherens (GO:0005915)	beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|gamma-catenin binding (GO:0045295)|poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)|vinculin binding (GO:0017166)			NS(1)|breast(7)|cervix(2)|endometrium(4)|kidney(6)|large_intestine(16)|lung(9)|oesophagus(2)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	52			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			AATCTCGGCGGGGAGCTTGTT	0.557																																																	0								ENSG00000044115						55.0	54.0	55.0					5																	138268382		2203	4300	6503	CTNNA1	SO:0001583	missense	0			-	HGNC	D13866	CCDS34243.1, CCDS75315.1	5q31.2	2008-02-05	2002-08-29			ENSG00000044115			2509	protein-coding gene	gene with protein product		116805	"""catenin (cadherin-associated protein), alpha 1 (102kD)"""			1924379	Standard	XM_005271898		Approved	CAP102	uc003ldh.3	P35221		ENST00000302763.7:c.2414G>A	5.37:g.138268382G>A	ENSP00000304669:p.Gly805Glu	Somatic	0	51	0.00		0.41568620468393047	405	16.12	78	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	25	28.57	Q12795|Q8N1C0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Vinculin/catenin,superfamily_Vinculin/catenin,prints_Alpha_catenin,prints_Vinculin	p.G805E	ENST00000302763.7	37	c.2414	CCDS34243.1	5	.	.	.	.	.	.	.	.	.	.	G	28.0	4.881585	0.91740	.	.	ENSG00000044115	ENST00000355078;ENST00000302763;ENST00000537034;ENST00000541863;ENST00000518825;ENST00000540387	T;T;T;T	0.38240	1.15;1.15;1.15;1.15	5.65	5.65	0.86999	.	0.116551	0.64402	D	0.000012	T	0.62986	0.2473	M	0.74647	2.275	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.989	D;D;D	0.80764	0.994;0.983;0.964	T	0.63157	-0.6700	10	0.66056	D	0.02	-17.5493	19.5069	0.95121	0.0:0.0:1.0:0.0	.	805;682;805	G3XAM7;B4DKT9;P35221	.;.;CTNA1_HUMAN	E	702;805;805;790;805;435	ENSP00000347190:G702E;ENSP00000304669:G805E;ENSP00000427821:G805E;ENSP00000438476:G435E	ENSP00000304669:G805E	G	+	2	0	CTNNA1	138296281	1.000000	0.71417	0.842000	0.33263	0.753000	0.42808	9.574000	0.98184	2.941000	0.99782	0.655000	0.94253	GGG	-	pfam_Vinculin/catenin,superfamily_Vinculin/catenin		0.557	CTNNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTNNA1	protein_coding	OTTHUMT00000373868.1	G	NM_001903	-		138268382	+1	no_errors	ENST00000302763	ensembl	human	known	74_37	missense	SNP	1.000	A
ASTN1	460	genome.wustl.edu	37	1	177001986	177001986	+	Splice_Site	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr1:177001986C>T	ENST00000367654.3	-	3	683		c.e3-1		ASTN1_ENST00000361833.2_Splice_Site|ASTN1_ENST00000424564.2_Splice_Site|ASTN1_ENST00000367657.3_Splice_Site|ASTN1_ENST00000281881.3_Splice_Site	NM_004319.1	NP_004310.1	O14525	ASTN1_HUMAN	astrotactin 1						locomotory behavior (GO:0007626)|neuron cell-cell adhesion (GO:0007158)|neuron migration (GO:0001764)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)				NS(4)|breast(5)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(23)|liver(1)|lung(81)|ovary(6)|prostate(5)|skin(10)|urinary_tract(3)	153						TCATGCCACCCTAGGAAGAGA	0.562																																																	0								ENSG00000152092						45.0	40.0	42.0					1																	177001986		2201	4298	6499	ASTN1	SO:0001630	splice_region_variant	0			-	HGNC	AB006627	CCDS1319.1, CCDS44280.1, CCDS65732.1	1q25.2	2008-02-05	2006-08-24	2006-08-24	ENSG00000152092	ENSG00000152092			773	protein-coding gene	gene with protein product		600904	"""astrotactin"""	ASTN		9070947	Standard	NM_001286164		Approved		uc001glc.3	O14525	OTTHUMG00000035041	ENST00000367654.3:c.472-1G>A	1.37:g.177001986C>T		Somatic	0	23	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	21	16.00	A5PL12|B4DHI9|E9PFR8|O60799|Q5W0V7|Q5W0V8	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e3-1	ENST00000367654.3	37	c.472-1		1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.086270	0.76642	.	.	ENSG00000152092	ENST00000367657;ENST00000361833;ENST00000367654;ENST00000424564;ENST00000541808	.	.	.	5.42	5.42	0.78866	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.8102	0.92054	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ASTN1	175268609	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	7.676000	0.84012	2.509000	0.84616	0.655000	0.94253	.	-	-		0.562	ASTN1-201	KNOWN	basic	protein_coding	ASTN1	protein_coding		C	NM_004319	-	Intron	177001986	-1	no_errors	ENST00000367654	ensembl	human	known	74_37	splice_site	SNP	1.000	T
COL6A3	1293	genome.wustl.edu	37	2	238303535	238303535	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr2:238303535C>T	ENST00000295550.4	-	3	856	c.404G>A	c.(403-405)gGa>gAa	p.G135E	COL6A3_ENST00000346358.4_Missense_Mutation_p.G135E|COL6A3_ENST00000409809.1_Intron|COL6A3_ENST00000392004.3_Intron|COL6A3_ENST00000472056.1_Intron|COL6A3_ENST00000347401.3_Missense_Mutation_p.G135E|COL6A3_ENST00000392003.2_Intron|COL6A3_ENST00000353578.4_Intron	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	135	Nonhelical region.|VWFA 1. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		GGCCCGGCTTCCAGCAGCCTT	0.493																																																	0								ENSG00000163359						76.0	80.0	78.0					2																	238303535		2203	4300	6503	COL6A3	SO:0001583	missense	0			-	HGNC	X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.404G>A	2.37:g.238303535C>T	ENSP00000295550:p.Gly135Glu	Somatic	0	33	0.00		0.41568620468393047	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	11	35.29	A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_VWF_A,pfam_Collagen,pfam_Prot_inh_Kunz-m,superfamily_Prot_inh_Kunz-m,superfamily_Fibronectin_type3,smart_VWF_A,smart_Prot_inh_Kunz-m,pfscan_Fibronectin_type3,pfscan_VWF_A,pfscan_Prot_inh_Kunz-m,prints_Prot_inh_Kunz-m	p.G135E	ENST00000295550.4	37	c.404	CCDS33412.1	2	.	.	.	.	.	.	.	.	.	.	C	14.56	2.572364	0.45798	.	.	ENSG00000163359	ENST00000295550;ENST00000347401;ENST00000346358;ENST00000433762	D;D;D;D	0.82255	-1.59;-1.59;-1.59;-1.59	4.93	4.93	0.64822	von Willebrand factor, type A (3);	0.000000	0.46145	U	0.000301	D	0.94162	0.8127	H	0.96518	3.835	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.997	D	0.95850	0.8874	10	0.62326	D	0.03	.	18.1609	0.89707	0.0:1.0:0.0:0.0	.	135;135	E9PCV6;P12111	.;CO6A3_HUMAN	E	135	ENSP00000295550:G135E;ENSP00000315609:G135E;ENSP00000295546:G135E;ENSP00000389539:G135E	ENSP00000295550:G135E	G	-	2	0	COL6A3	237968274	1.000000	0.71417	0.852000	0.33557	0.842000	0.47809	7.631000	0.83237	2.268000	0.75426	0.455000	0.32223	GGA	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A		0.493	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL6A3	protein_coding	OTTHUMT00000315790.2	C	NM_004369	-		238303535	-1	no_errors	ENST00000295550	ensembl	human	known	74_37	missense	SNP	1.000	T
DMBT1P1	375940	genome.wustl.edu	37	10	124545555	124545555	+	RNA	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr10:124545555G>A	ENST00000439464.2	+	0	2562					NR_003570.1																						TCTCCATGGGGAAGTTCTGTG	0.468																																																	0								ENSG00000176584																																			RP11-318C4.2			0			-	Clone_based_vega_gene																													10.37:g.124545555G>A		Somatic	0	88	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	39	23.53		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000439464.2	37	NULL		10																																																																																			-	-		0.468	RP11-318C4.2-001	KNOWN	basic	processed_transcript	FLJ46361	pseudogene	OTTHUMT00000471298.1	G		-		124545555	+1	no_errors	ENST00000439464	ensembl	human	known	74_37	rna	SNP	0.907	A
SLC4A5	57835	genome.wustl.edu	37	2	74480151	74480151	+	Silent	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr2:74480151G>A	ENST00000377634.4	-	15	1617	c.1218C>T	c.(1216-1218)gaC>gaT	p.D406D	RP11-287D1.3_ENST00000451608.2_3'UTR|SLC4A5_ENST00000423644.1_Silent_p.D406D|SLC4A5_ENST00000357822.5_Silent_p.D406D|SLC4A5_ENST00000346834.4_Silent_p.D406D|SLC4A5_ENST00000483195.1_5'UTR|SLC4A5_ENST00000394019.2_Silent_p.D406D|SLC4A5_ENST00000377632.1_Silent_p.D406D|SLC4A5_ENST00000359484.4_Silent_p.D342D|SLC4A5_ENST00000358683.4_Silent_p.D342D					solute carrier family 4 (sodium bicarbonate cotransporter), member 5											breast(5)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(12)|lung(13)|ovary(5)|pancreas(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	48						GGATATTTGGGTCCCATTCTC	0.517																																																	0								ENSG00000188687						70.0	67.0	68.0					2																	74480151		2203	4300	6503	SLC4A5	SO:0001819	synonymous_variant	0			-	HGNC	AF243499	CCDS1936.1, CCDS1937.1	2p13.1	2013-07-19	2013-07-19		ENSG00000188687	ENSG00000188687		"""Solute carriers"""	18168	protein-coding gene	gene with protein product		606757	"""solute carrier family 4, sodium bicarbonate cotransporter, member 5"""			10978526, 11087115	Standard	NM_133478		Approved	NBC4	uc002sko.1	Q9BY07	OTTHUMG00000090263	ENST00000377634.4:c.1218C>T	2.37:g.74480151G>A		Somatic	0	91	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	37	22.92		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_HCO3_transpt_C,pfam_Band3_cytoplasmic_dom,superfamily_PTrfase/Anion_transptr,prints_HCO3_transpt_euk,prints_Na/HCO3_transpt,tigrfam_HCO3_transpt_euk	p.D406	ENST00000377634.4	37	c.1218	CCDS1936.1	2																																																																																			-	pfam_Band3_cytoplasmic_dom,superfamily_PTrfase/Anion_transptr,prints_Na/HCO3_transpt,tigrfam_HCO3_transpt_euk		0.517	SLC4A5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC4A5	protein_coding	OTTHUMT00000206583.3	G		-		74480151	-1	no_errors	ENST00000357822	ensembl	human	known	74_37	silent	SNP	1.000	A
CSNK1G2	1455	genome.wustl.edu	37	19	1954140	1954140	+	Intron	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr19:1954140C>T	ENST00000255641.8	+	1	230				CSNK1G2-AS1_ENST00000586395.1_RNA|CSNK1G2-AS1_ENST00000314315.3_RNA	NM_001319.6	NP_001310.3	P78368	KC1G2_HUMAN	casein kinase 1, gamma 2						protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|peptide binding (GO:0042277)|protein serine/threonine kinase activity (GO:0004674)			endometrium(1)|kidney(1)|lung(3)|prostate(1)|skin(1)|stomach(1)	8		Ovarian(11;2.11e-07)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AAACCCATTACCGGCCTAGGT	0.622																																					Ovarian(91;880 1392 21236 36928 37598)												0								ENSG00000180846																																			CSNK1G2-AS1	SO:0001627	intron_variant	0			-	HGNC	AF001177	CCDS12077.1	19p13.3	2013-01-17			ENSG00000133275	ENSG00000133275			2455	protein-coding gene	gene with protein product		602214				9403068	Standard	NM_001319		Approved	CK1g2	uc002lul.4	P78368		ENST00000255641.8:c.-266+12723C>T	19.37:g.1954140C>T		Somatic	0	40	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	16	27.27	B5BU42|O00704|Q8WUB1	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000255641.8	37	NULL	CCDS12077.1	19																																																																																			-	-		0.622	CSNK1G2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSNK1G2-AS1	protein_coding	OTTHUMT00000449287.1	C	NM_001319	-		1954140	-1	no_errors	ENST00000314315	ensembl	human	known	74_37	rna	SNP	0.000	T
COL6A3	1293	genome.wustl.edu	37	2	238303536	238303536	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr2:238303536C>T	ENST00000295550.4	-	3	855	c.403G>A	c.(403-405)Gga>Aga	p.G135R	COL6A3_ENST00000346358.4_Missense_Mutation_p.G135R|COL6A3_ENST00000409809.1_Intron|COL6A3_ENST00000392004.3_Intron|COL6A3_ENST00000472056.1_Intron|COL6A3_ENST00000347401.3_Missense_Mutation_p.G135R|COL6A3_ENST00000392003.2_Intron|COL6A3_ENST00000353578.4_Intron	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	135	Nonhelical region.|VWFA 1. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		GCCCGGCTTCCAGCAGCCTTG	0.493																																																	0								ENSG00000163359						75.0	80.0	78.0					2																	238303536		2203	4300	6503	COL6A3	SO:0001583	missense	0			-	HGNC	X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.403G>A	2.37:g.238303536C>T	ENSP00000295550:p.Gly135Arg	Somatic	0	34	0.00		0.41568620468393047	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	11	38.89	A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_VWF_A,pfam_Collagen,pfam_Prot_inh_Kunz-m,superfamily_Prot_inh_Kunz-m,superfamily_Fibronectin_type3,smart_VWF_A,smart_Prot_inh_Kunz-m,pfscan_Fibronectin_type3,pfscan_VWF_A,pfscan_Prot_inh_Kunz-m,prints_Prot_inh_Kunz-m	p.G135R	ENST00000295550.4	37	c.403	CCDS33412.1	2	.	.	.	.	.	.	.	.	.	.	C	13.11	2.140249	0.37825	.	.	ENSG00000163359	ENST00000295550;ENST00000347401;ENST00000346358;ENST00000433762	D;D;D;D	0.82255	-1.59;-1.59;-1.59;-1.59	4.93	4.93	0.64822	von Willebrand factor, type A (3);	0.000000	0.46145	U	0.000301	D	0.92980	0.7766	M	0.92219	3.285	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.92930	0.6363	10	0.33141	T	0.24	.	18.1609	0.89707	0.0:1.0:0.0:0.0	.	135;135	E9PCV6;P12111	.;CO6A3_HUMAN	R	135	ENSP00000295550:G135R;ENSP00000315609:G135R;ENSP00000295546:G135R;ENSP00000389539:G135R	ENSP00000295550:G135R	G	-	1	0	COL6A3	237968275	1.000000	0.71417	0.819000	0.32651	0.802000	0.45316	5.897000	0.69831	2.268000	0.75426	0.455000	0.32223	GGA	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A		0.493	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL6A3	protein_coding	OTTHUMT00000315790.2	C	NM_004369	-		238303536	-1	no_errors	ENST00000295550	ensembl	human	known	74_37	missense	SNP	0.999	T
HNF1A	6927	genome.wustl.edu	37	12	121432117	121432118	+	Frame_Shift_Ins	INS	-	-	C	rs56348580	byFrequency	TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr12:121432117_121432118insC	ENST00000257555.6	+	4	1090_1091	c.864_865insC	c.(865-867)cccfs	p.P289fs	HNF1A_ENST00000541395.1_Frame_Shift_Ins_p.P289fs|HNF1A_ENST00000402929.1_Frame_Shift_Ins_p.P289fs|HNF1A_ENST00000538626.1_Intron|HNF1A_ENST00000543427.1_Frame_Shift_Ins_p.P172fs|HNF1A_ENST00000544413.1_Frame_Shift_Ins_p.P289fs|HNF1A_ENST00000400024.2_Frame_Shift_Ins_p.P289fs			P20823	HNF1A_HUMAN	HNF1 homeobox A	289					glucose homeostasis (GO:0042593)|glucose import (GO:0046323)|insulin secretion (GO:0030073)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|renal glucose absorption (GO:0035623)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(8)|large_intestine(19)|liver(175)|lung(9)|ovary(2)|prostate(1)|urinary_tract(1)	221	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					CGTACAGCGGGCCCCCCCCAGG	0.663									Hepatic Adenoma, Familial Clustering of																																								0			GRCh37	CI064741|CM067044|CM082856	HNF1A	I|M	rs56348580	ENSG00000135100																																			HNF1A	SO:0001589	frameshift_variant	0	Familial Cancer Database	incl. Maturity-Onset Diabetes of the Young type 3, MODY3		HGNC	M57732	CCDS9209.1	12q24.31	2014-09-17	2007-08-24	2007-08-24	ENSG00000135100	ENSG00000135100		"""Homeoboxes / HNF class"""	11621	protein-coding gene	gene with protein product		142410	"""transcription factor 1, hepatic; LF-B1, hepatic nuclear factor (HNF1), albumin proximal factor"""	MODY3, TCF1		1535333, 7795649	Standard	NM_000545		Approved	HNF1, LFB1	uc001tzg.3	P20823	OTTHUMG00000151015	ENST00000257555.6:c.872dupC	12.37:g.121432125_121432125dupC	ENSP00000257555:p.Pro289fs	Somatic	0	36	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	29	9.38	A5Z2R8|E0YMJ5|E0YMK0|E0YMK1|E2I9R4|E2I9R5|F5H5U3|Q2M3H2|Q99861	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_HNF1b_C,pfam_HNF-1_N,pfam_HNF1a_C,pfam_Homeobox_dom,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,superfamily_HNF1_dimer_dom,smart_Homeobox_dom,pfscan_Homeobox_dom	p.G291fs	ENST00000257555.6	37	c.864_865	CCDS9209.1	12																																																																																			-	pfam_HNF1b_C		0.663	HNF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HNF1A	protein_coding	OTTHUMT00000320957.5	-	NM_000545			121432118	+1	no_errors	ENST00000257555	ensembl	human	known	74_37	frame_shift_ins	INS	0.998:1.000	C
COG6	57511	genome.wustl.edu	37	13	40253752	40253752	+	Silent	SNP	G	G	A	rs147738794		TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr13:40253752G>A	ENST00000455146.3	+	6	668	c.618G>A	c.(616-618)acG>acA	p.T206T	COG6_ENST00000416691.1_Silent_p.T206T|COG6_ENST00000465775.1_3'UTR	NM_020751.2	NP_065802.1	Q9Y2V7	COG6_HUMAN	component of oligomeric golgi complex 6	206					glycosylation (GO:0070085)|intra-Golgi vesicle-mediated transport (GO:0006891)|protein transport (GO:0015031)	Golgi transport complex (GO:0017119)|membrane (GO:0016020)				NS(1)|kidney(2)|large_intestine(5)|lung(4)|skin(1)	13		Lung NSC(96;0.000124)|Breast(139;0.0199)|Prostate(109;0.0233)|Lung SC(185;0.0367)		all cancers(112;6.03e-09)|Epithelial(112;7e-07)|OV - Ovarian serous cystadenocarcinoma(117;0.00015)|BRCA - Breast invasive adenocarcinoma(63;0.00438)|GBM - Glioblastoma multiforme(144;0.0168)		ATCAACAAACGGCAGGGTGAG	0.328																																																	0								ENSG00000133103	G	,	2,4404	4.2+/-10.8	0,2,2201	97.0	90.0	93.0		618,618	-6.1	1.0	13	dbSNP_134	93	0,8598		0,0,4299	no	coding-synonymous,coding-synonymous	COG6	NM_001145079.1,NM_020751.2	,	0,2,6500	AA,AG,GG		0.0,0.0454,0.0154	,	206/616,206/658	40253752	2,13002	2203	4299	6502	COG6	SO:0001819	synonymous_variant	0			-	HGNC	AK026638	CCDS9370.1, CCDS45042.1	13q13.2	2011-08-01			ENSG00000133103	ENSG00000133103		"""Components of oligomeric golgi complex"""	18621	protein-coding gene	gene with protein product		606977				11980916	Standard	NM_020751		Approved	COD2, KIAA1134	uc001uxh.2	Q9Y2V7	OTTHUMG00000016768	ENST00000455146.3:c.618G>A	13.37:g.40253752G>A		Somatic	0	47	0.00		0.41568620468393047	5	16.67	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	33	15.38	Q5T0U1|Q6AI19|Q86V49|Q9ULT5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_COG6	p.T206	ENST00000455146.3	37	c.618	CCDS9370.1	13																																																																																			-	pfam_COG6		0.328	COG6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	COG6	protein_coding	OTTHUMT00000044622.3	G		rs147738794		40253752	+1	no_errors	ENST00000455146	ensembl	human	known	74_37	silent	SNP	0.642	A
LINC01140	339524	genome.wustl.edu	37	1	87633842	87633842	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr1:87633842G>A	ENST00000370548.2	+	8	968	c.895G>A	c.(895-897)Gga>Aga	p.G299R																								TTCCAGGAATGGACTTTCTGC	0.463																																																	0								ENSG00000267561						12.0	11.0	11.0					1																	87633842		876	1988	2864	RP5-1052I5.2	SO:0001583	missense	0			-	Clone_based_vega_gene																												ENST00000370548.2:c.895G>A	1.37:g.87633842G>A	ENSP00000359579:p.Gly299Arg	Somatic	0	52	0.00		0.41568620468393047	51	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	27	10.00		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Sulfotransferase,superfamily_P-loop_NTPase	p.G299R	ENST00000370548.2	37	c.895		1	.	.	.	.	.	.	.	.	.	.	G	4.892	0.165711	0.09339	.	.	ENSG00000153936	ENST00000370548	.	.	.	5.55	-0.86	0.10680	.	.	.	.	.	T	0.14830	0.0358	.	.	.	0.19945	N	0.999947	B	0.06786	0.001	B	0.11329	0.006	T	0.18681	-1.0329	6	0.87932	D	0	.	4.5561	0.12136	0.3382:0.0:0.4531:0.2087	.	299	Q7LGA3-2	.	R	299	.	ENSP00000359579:G299R	G	+	1	0	HS2ST1	87406430	0.724000	0.28038	0.001000	0.08648	0.271000	0.26615	0.874000	0.28065	0.068000	0.16574	-0.150000	0.13652	GGA	-	NULL		0.463	RP5-1052I5.2-001	PUTATIVE	basic|appris_principal|readthrough_transcript	protein_coding	ENSG00000267561	protein_coding	OTTHUMT00000457517.1	G		-		87633842	+1	no_errors	ENST00000370548	ensembl	human	putative	74_37	missense	SNP	0.033	A
OR4C13	283092	genome.wustl.edu	37	11	49974640	49974640	+	Silent	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr11:49974640C>T	ENST00000555099.1	+	1	698	c.666C>T	c.(664-666)tcC>tcT	p.S222S		NM_001001955.2	NP_001001955.2	Q8NGP0	OR4CD_HUMAN	olfactory receptor, family 4, subfamily C, member 13	222						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S222S(1)		autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(24)|ovary(2)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	43						TACTGTACTCCTTAAAGACCC	0.478																																																	1	Substitution - coding silent(1)	lung(1)						ENSG00000258817						180.0	148.0	159.0					11																	49974640		2201	4296	6497	OR4C13	SO:0001819	synonymous_variant	0			-	HGNC	AB065750	CCDS31495.1	11p11.12	2012-10-03			ENSG00000258817	ENSG00000258817		"""GPCR / Class A : Olfactory receptors"""	15169	protein-coding gene	gene with protein product							Standard	NM_001001955		Approved		uc010rhz.2	Q8NGP0	OTTHUMG00000166686	ENST00000555099.1:c.666C>T	11.37:g.49974640C>T		Somatic	0	69	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	55	14.06	A6NJJ3|B9EH30|Q6IF48|Q96R68	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S222	ENST00000555099.1	37	c.666	CCDS31495.1	11																																																																																			-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.478	OR4C13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4C13	protein_coding	OTTHUMT00000391103.1	C	NM_001001955	-		49974640	+1	no_errors	ENST00000555099	ensembl	human	known	74_37	silent	SNP	0.040	T
C22orf24	25775	genome.wustl.edu	37	22	32334105	32334105	+	Intron	DEL	A	A	-			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr22:32334105delA	ENST00000248984.3	-	2	118				C22orf24_ENST00000543051.1_Frame_Shift_Del_p.F50fs|C22orf24_ENST00000486651.1_Intron	NM_015372.1	NP_056187.1	Q9Y442	CV024_HUMAN	chromosome 22 open reading frame 24							integral component of membrane (GO:0016021)				central_nervous_system(1)|urinary_tract(1)	2						ttcagagctgaaaaaaaaagg	0.453																																																	0								ENSG00000128254			24,3632		1,22,1805						-2.0	0.0			28	37,7849		0,37,3906	no	intron	C22orf24	NM_015372.1		1,59,5711	A1A1,A1R,RR		0.4692,0.6565,0.5285				61,11481				C22orf24	SO:0001627	intron_variant	0				HGNC		CCDS46693.1	22q12.1-q12.3	2004-05-05			ENSG00000128254	ENSG00000128254			23051	protein-coding gene	gene with protein product							Standard	XM_005261497		Approved	HSN44A4A	uc003aly.3	Q9Y442	OTTHUMG00000030834	ENST00000248984.3:c.49-4T>-	22.37:g.32334105delA		Somatic	0	47	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	21	12.50	B2RCT4|Q5K3R1	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	NULL	p.F50fs	ENST00000248984.3	37	c.149	CCDS46693.1	22																																																																																			-	NULL		0.453	C22orf24-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	C22orf24	protein_coding	OTTHUMT00000075722.2	A	NM_015372			32334105	-1	no_errors	ENST00000543051	ensembl	human	known	74_37	frame_shift_del	DEL	0.000	-
HDC	3067	genome.wustl.edu	37	15	50540515	50540515	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr15:50540515C>T	ENST00000267845.3	-	10	1469	c.1067G>A	c.(1066-1068)cGg>cAg	p.R356Q	HDC_ENST00000543581.1_Intron	NM_002112.3	NP_002103.2	Q9UBI9	HDC_HUMAN	histidine decarboxylase	0					respiratory tube development (GO:0030323)	membrane (GO:0016020)				breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(13)|lung(25)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		all_lung(180;0.0138)		all cancers(107;1.12e-06)|GBM - Glioblastoma multiforme(94;9.95e-05)		AGAGCGAAACCGTCGGCTCAG	0.532																																					GBM(95;1627 1936 6910 9570)												0								ENSG00000140287						84.0	75.0	78.0					15																	50540515		2196	4295	6491	HDC	SO:0001583	missense	0			-	HGNC		CCDS10134.1	15q21.2	2013-09-20			ENSG00000140287	ENSG00000140287	4.1.1.22		4855	protein-coding gene	gene with protein product		142704				1487235	Standard	NM_002112		Approved		uc001zxz.3	P19113	OTTHUMG00000131644	ENST00000267845.3:c.1067G>A	15.37:g.50540515C>T	ENSP00000267845:p.Arg356Gln	Somatic	0	66	0.00		0.41568620468393047	3	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	30	14.29		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PyrdxlP-dep_de-COase,superfamily_PyrdxlP-dep_Trfase,prints_Aromatic_deC	p.R356Q	ENST00000267845.3	37	c.1067	CCDS10134.1	15	.	.	.	.	.	.	.	.	.	.	C	36	5.888796	0.97068	.	.	ENSG00000140287	ENST00000267845	T	0.46819	0.86	5.47	5.47	0.80525	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.109619	0.64402	D	0.000006	T	0.80747	0.4682	H	0.97540	4.025	0.80722	D	1	D	0.89917	1.0	D	0.70487	0.969	D	0.87687	0.2551	10	0.87932	D	0	-26.9886	19.4109	0.94671	0.0:1.0:0.0:0.0	.	356	P19113	DCHS_HUMAN	Q	356	ENSP00000267845:R356Q	ENSP00000267845:R356Q	R	-	2	0	HDC	48327807	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.543000	0.82106	2.579000	0.87056	0.650000	0.86243	CGG	-	pfam_PyrdxlP-dep_de-COase,superfamily_PyrdxlP-dep_Trfase,prints_Aromatic_deC		0.532	HDC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HDC	protein_coding	OTTHUMT00000254540.1	C		-		50540515	-1	no_errors	ENST00000267845	ensembl	human	known	74_37	missense	SNP	1.000	T
OTUB1	55611	genome.wustl.edu	37	11	63764973	63764973	+	Silent	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr11:63764973C>T	ENST00000538426.1	+	7	815	c.771C>T	c.(769-771)gtC>gtT	p.V257V	OTUB1_ENST00000543988.1_Silent_p.V227V|OTUB1_ENST00000535715.1_Intron|OTUB1_ENST00000422031.2_Silent_p.V294V|OTUB1_ENST00000541478.1_Silent_p.V156V|OTUB1_ENST00000543004.1_Silent_p.V266V|OTUB1_ENST00000428192.2_Silent_p.V257V	NM_017670.2	NP_060140.2	Q96FW1	OTUB1_HUMAN	OTU deubiquitinase, ubiquitin aldehyde binding 1	257	OTU. {ECO:0000255|PROSITE- ProRule:PRU00139}.				cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|immune system process (GO:0002376)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|protein K48-linked deubiquitination (GO:0071108)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	NEDD8-specific protease activity (GO:0019784)|omega peptidase activity (GO:0008242)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(1)	6						AGCCCAAGGTCTACCTTCTCT	0.642																																																	0								ENSG00000167770						100.0	97.0	98.0					11																	63764973		2201	4297	6498	OTUB1	SO:0001819	synonymous_variant	0			-	HGNC	AY177200	CCDS8055.1	11q13.1	2014-02-24	2014-02-24			ENSG00000167770		"""OTU domain containing"""	23077	protein-coding gene	gene with protein product		608337	"""OTU domain, ubiquitin aldehyde binding 1"""			12704427, 19383985	Standard	NM_017670		Approved	FLJ20113, FLJ40710	uc001nyf.1	Q96FW1		ENST00000538426.1:c.771C>T	11.37:g.63764973C>T		Somatic	0	35	0.00		0.41568620468393047	332	25.23	112	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	18	18.18	Q32Q78|Q96II3|Q9NXQ4|Q9P0B8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_C65_otubain,pfam_OTU,pirsf_Ubiquitin_thioesterase_Otubain,pfscan_OTU	p.V294	ENST00000538426.1	37	c.882	CCDS8055.1	11																																																																																			-	pfam_Peptidase_C65_otubain,pfam_OTU,pirsf_Ubiquitin_thioesterase_Otubain,pfscan_OTU		0.642	OTUB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OTUB1	protein_coding	OTTHUMT00000396277.1	C	NM_017670	-		63764973	+1	no_errors	ENST00000422031	ensembl	human	known	74_37	silent	SNP	1.000	T
BPIFA4P	317716	genome.wustl.edu	37	20	31787179	31787179	+	RNA	SNP	C	C	G			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr20:31787179C>G	ENST00000375465.3	+	0	210					NR_026760.1		Q86YQ2	LATH_HUMAN	BPI fold containing family A, member 4, pseudogene							extracellular region (GO:0005576)	lipid binding (GO:0008289)										CAACTGGCCTCCAGAAACCAT	0.498																																																	0								ENSG00000183566						144.0	125.0	131.0					20																	31787179		692	1591	2283	BPIFA4P			0			-	HGNC	AY180924		20q11.21	2013-01-24			ENSG00000183566	ENSG00000183566		"""BPI fold containing"""	20469	pseudogene	pseudogene	"""breast cancer and salivary gland expression gene"", ""PLUNC family pseudogene"""	607627				12538848, 21787333	Standard	NR_026760		Approved	BASE	uc002wyq.2	Q86YQ2	OTTHUMG00000032251		20.37:g.31787179C>G		Somatic	0	88	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	61	21.79		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000375465.3	37	NULL		20																																																																																			-	-		0.498	BPIFA4P-003	KNOWN	basic	processed_transcript	BPIFA4P	pseudogene	OTTHUMT00000469705.1	C	NR_026760	-		31787179	+1	no_errors	ENST00000375465	ensembl	human	known	74_37	rna	SNP	0.000	G
HGF	3082	genome.wustl.edu	37	7	81374339	81374339	+	Silent	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr7:81374339G>A	ENST00000222390.5	-	6	949	c.723C>T	c.(721-723)caC>caT	p.H241H	HGF_ENST00000453411.1_Silent_p.H236H|HGF_ENST00000444829.2_Silent_p.H241H|HGF_ENST00000457544.2_Silent_p.H236H	NM_000601.4	NP_000592.3	P14210	HGF_HUMAN	hepatocyte growth factor (hepapoietin A; scatter factor)	241	Kringle 2. {ECO:0000255|PROSITE- ProRule:PRU00121}.				activation of MAPK activity (GO:0000187)|blood coagulation (GO:0007596)|cell chemotaxis (GO:0060326)|cellular response to hepatocyte growth factor stimulus (GO:0035729)|epithelial to mesenchymal transition (GO:0001837)|hepatocyte growth factor receptor signaling pathway (GO:0048012)|hyaluronan metabolic process (GO:0030212)|liver development (GO:0001889)|mitotic nuclear division (GO:0007067)|myoblast proliferation (GO:0051450)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of hydrogen peroxide-mediated programmed cell death (GO:1901299)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|organ regeneration (GO:0031100)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive chemotaxis (GO:0050918)|positive regulation of cell migration (GO:0030335)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of branching involved in salivary gland morphogenesis by mesenchymal-epithelial signaling (GO:0060665)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|platelet alpha granule lumen (GO:0031093)	catalytic activity (GO:0003824)|chemoattractant activity (GO:0042056)|growth factor activity (GO:0008083)|identical protein binding (GO:0042802)			NS(2)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|liver(2)|lung(41)|ovary(2)|prostate(2)|skin(6)|urinary_tract(1)	75						ATTTGTGCCGGTGTGGTGTCT	0.408																																																	0								ENSG00000019991						89.0	87.0	87.0					7																	81374339		2203	4300	6503	HGF	SO:0001819	synonymous_variant	0			-	HGNC		CCDS5597.1, CCDS47626.1, CCDS47627.1, CCDS47628.1, CCDS47629.1	7q21.1	2009-09-11			ENSG00000019991	ENSG00000019991			4893	protein-coding gene	gene with protein product	"""hepatopoietin A"", ""fibroblast-derived tumor cytotoxic factor"", ""scatter factor"", ""lung fibroblast-derived mitogen"""	142409	"""deafness, autosomal recessive 39"""	DFNB39		1837206, 19576567	Standard	XM_006715956		Approved	SF, F-TCF, HGFB, HPTA	uc003uhl.3	P14210	OTTHUMG00000023804	ENST00000222390.5:c.723C>T	7.37:g.81374339G>A		Somatic	0	67	0.00		0.41568620468393047	10	9.09	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	38	26.92	A1L3U6|Q02935|Q13494|Q14519|Q3KRB2|Q8TCE2|Q9BYL9|Q9BYM0|Q9UDU6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Kringle,pfam_Peptidase_S1,pfam_PAN-1_domain,superfamily_Trypsin-like_Pept_dom,superfamily_Kringle-like,smart_Pan_app,smart_Kringle,smart_Peptidase_S1,pfscan_Pan_app,pfscan_Kringle,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.H241	ENST00000222390.5	37	c.723	CCDS5597.1	7																																																																																			-	pfam_Kringle,superfamily_Kringle-like,smart_Kringle,pfscan_Kringle		0.408	HGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HGF	protein_coding	OTTHUMT00000253315.2	G	NM_000601	-		81374339	-1	no_errors	ENST00000222390	ensembl	human	known	74_37	silent	SNP	0.994	A
LOXL3	84695	genome.wustl.edu	37	2	74776523	74776523	+	Missense_Mutation	SNP	T	T	G			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr2:74776523T>G	ENST00000264094.3	-	4	736	c.665A>C	c.(664-666)gAa>gCa	p.E222A	LOXL3_ENST00000409249.1_Missense_Mutation_p.E222A|DOK1_ENST00000409429.1_Intron|LOXL3_ENST00000409549.1_Missense_Mutation_p.E222A|LOXL3_ENST00000393937.2_Intron|LOXL3_ENST00000409986.1_Intron|LOXL3_ENST00000484369.1_5'UTR	NM_032603.2	NP_115992.1	P58215	LOXL3_HUMAN	lysyl oxidase-like 3	222	SRCR 2. {ECO:0000255|PROSITE- ProRule:PRU00196}.				epithelial to mesenchymal transition (GO:0001837)|negative regulation of transcription, DNA-templated (GO:0045892)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)|nucleus (GO:0005634)	copper ion binding (GO:0005507)|protein-lysine 6-oxidase activity (GO:0004720)|scavenger receptor activity (GO:0005044)			endometrium(7)|kidney(2)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|urinary_tract(1)	30						GACCCTCTTTTCGCTGGGGAA	0.652																																																	0								ENSG00000115318						18.0	19.0	19.0					2																	74776523		2203	4300	6503	LOXL3	SO:0001583	missense	0			-	HGNC	AF282619	CCDS1953.1, CCDS74527.1	2p13	2008-05-23			ENSG00000115318	ENSG00000115318			13869	protein-coding gene	gene with protein product		607163				11386757	Standard	NM_032603		Approved		uc002smp.1	P58215	OTTHUMG00000129953	ENST00000264094.3:c.665A>C	2.37:g.74776523T>G	ENSP00000264094:p.Glu222Ala	Somatic	0	101	0.00		0.41568620468393047	10	28.57	4	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	51	12.07	D6W5J1|Q2EHP2|Q6IPL7|Q96RS1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Lysyl_oxidase,pfam_SRCR,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_SRCR,prints_Lysyl_oxidase,prints_SRCR	p.E222A	ENST00000264094.3	37	c.665	CCDS1953.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	18.87|18.87	3.715669|3.715669	0.68844|0.68844	.|.	.|.	ENSG00000115318|ENSG00000115318	ENST00000264094;ENST00000409249;ENST00000409549;ENST00000413469|ENST00000420535	T;T;T;T|.	0.55413|.	0.52;0.52;0.52;0.52|.	5.11|5.11	3.93|3.93	0.45458|0.45458	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);|.	0.153563|.	0.56097|.	D|.	0.000022|.	T|T	0.30479|0.30479	0.0766|0.0766	N|N	0.04116|0.04116	-0.275|-0.275	0.80722|0.80722	D|D	1|1	P;P|.	0.41420|.	0.722;0.749|.	B;P|.	0.45753|.	0.42;0.492|.	T|T	0.07271|0.07271	-1.0781|-1.0781	10|5	0.02654|.	T|.	1|.	.|.	10.1492|10.1492	0.42782|0.42782	0.0:0.0:0.1682:0.8318|0.0:0.0:0.1682:0.8318	.|.	222;222|.	E7END4;P58215|.	.;LOXL3_HUMAN|.	A|Q	222|22	ENSP00000264094:E222A;ENSP00000387103:E222A;ENSP00000386696:E222A;ENSP00000398260:E222A|.	ENSP00000264094:E222A|.	E|K	-|-	2|1	0|0	LOXL3|LOXL3	74630031|74630031	1.000000|1.000000	0.71417|0.71417	0.207000|0.207000	0.23584|0.23584	0.981000|0.981000	0.71138|0.71138	4.969000|4.969000	0.63735|0.63735	0.926000|0.926000	0.37118|0.37118	0.460000|0.460000	0.39030|0.39030	GAA|AAA	-	pfam_SRCR,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_SRCR		0.652	LOXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOXL3	protein_coding	OTTHUMT00000252215.1	T	NM_032603	-		74776523	-1	no_errors	ENST00000264094	ensembl	human	known	74_37	missense	SNP	0.996	G
ZNF678	339500	genome.wustl.edu	37	1	227842879	227842879	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr1:227842879C>T	ENST00000343776.5	+	4	1273	c.928C>T	c.(928-930)Cgt>Tgt	p.R310C	ZNF678_ENST00000608949.1_Intron|ZNF678_ENST00000397097.3_Missense_Mutation_p.R365C	NM_178549.3	NP_848644.2	Q5SXM1	ZN678_HUMAN	zinc finger protein 678	310					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(7)|pancreas(1)|prostate(1)	24		Prostate(94;0.0885)				AAGCCTTACTCGTCATAAAAG	0.393																																																	0								ENSG00000181450						48.0	53.0	52.0					1																	227842879		2203	4298	6501	ZNF678	SO:0001583	missense	0			-	HGNC	BC042500		1q42.13	2013-01-08			ENSG00000181450	ENSG00000181450		"""Zinc fingers, C2H2-type"", ""-"""	28652	protein-coding gene	gene with protein product	"""hypothetical protein MGC42493"""					12477932	Standard	NM_178549		Approved	MGC42493	uc021pjy.1	Q5SXM1	OTTHUMG00000037700	ENST00000343776.5:c.928C>T	1.37:g.227842879C>T	ENSP00000344828:p.Arg310Cys	Somatic	0	47	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	29	21.62	Q8IVQ9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R365C	ENST00000343776.5	37	c.1093		1	.	.	.	.	.	.	.	.	.	.	C	4.388	0.071582	0.08436	.	.	ENSG00000181450	ENST00000343776;ENST00000397097	T;T	0.36878	1.23;1.72	1.62	-3.25	0.05079	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.48786	0.1519	M	0.69463	2.115	0.09310	N	1	D	0.89917	1.0	D	0.77004	0.989	T	0.41448	-0.9508	9	0.62326	D	0.03	.	4.5004	0.11862	0.5705:0.2381:0.1914:0.0	.	310	Q5SXM1	ZN678_HUMAN	C	310;365	ENSP00000344828:R310C;ENSP00000440403:R365C	ENSP00000344828:R310C	R	+	1	0	ZNF678	225909502	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	-3.700000	0.00389	-0.792000	0.04480	-1.297000	0.01338	CGT	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.393	ZNF678-001	KNOWN	basic	protein_coding	ZNF678	protein_coding	OTTHUMT00000091976.2	C	NM_178549	-		227842879	+1	no_errors	ENST00000397097	ensembl	human	known	74_37	missense	SNP	0.000	T
CPNE1	8904	genome.wustl.edu	37	20	34214297	34214297	+	Silent	SNP	G	G	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr20:34214297G>T	ENST00000317619.3	-	18	1874	c.1480C>A	c.(1480-1482)Cgg>Agg	p.R494R	CPNE1_ENST00000397446.1_Silent_p.R494R|CPNE1_ENST00000397442.1_Silent_p.R438R|CPNE1_ENST00000317677.5_Silent_p.R499R|CPNE1_ENST00000397445.1_Silent_p.R494R|CPNE1_ENST00000397443.1_Silent_p.R494R|CPNE1_ENST00000352393.4_Silent_p.R494R			Q99829	CPNE1_HUMAN	copine I	494	VWFA.				lipid metabolic process (GO:0006629)|vesicle-mediated transport (GO:0016192)	extracellular vesicular exosome (GO:0070062)	calcium-dependent phospholipid binding (GO:0005544)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)			breast(2)|kidney(2)|large_intestine(6)|lung(4)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	21	Lung NSC(9;0.0053)|all_lung(11;0.00785)		BRCA - Breast invasive adenocarcinoma(18;0.00953)			AATGCCTCCCGAGGGGCCTGC	0.572																																																	0								ENSG00000214078						63.0	73.0	70.0					20																	34214297		2203	4300	6503	CPNE1	SO:0001819	synonymous_variant	0			-	HGNC	U83246	CCDS13260.1, CCDS46595.1	20q11.22	2009-06-01			ENSG00000214078	ENSG00000214078			2314	protein-coding gene	gene with protein product		604205				9430674	Standard	NM_152925		Approved	CPN1	uc002xdm.3	Q99829	OTTHUMG00000032356	ENST00000317619.3:c.1480C>A	20.37:g.34214297G>T		Somatic	0	62	0.00		0.41568620468393047	256	44.59	206	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	26	25.71	E1P5Q4|Q6IBL3|Q9H243|Q9NTZ7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Copine,pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,smart_VWF_A,pfscan_C2_dom	p.R499	ENST00000317619.3	37	c.1495	CCDS13260.1	20																																																																																			-	NULL		0.572	CPNE1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CPNE1	protein_coding	OTTHUMT00000078909.3	G	NM_152930	-		34214297	-1	no_errors	ENST00000317677	ensembl	human	known	74_37	silent	SNP	0.923	T
ACSM4	341392	genome.wustl.edu	37	12	7459151	7459151	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr12:7459151C>T	ENST00000399422.4	+	2	272	c.224C>T	c.(223-225)cCa>cTa	p.P75L		NM_001080454.1	NP_001073923.1	P0C7M7	ACSM4_HUMAN	acyl-CoA synthetase medium-chain family member 4	75					acyl-CoA metabolic process (GO:0006637)|fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|fatty-acyl-CoA synthase activity (GO:0004321)|metal ion binding (GO:0046872)			endometrium(6)|kidney(1)|lung(14)	21						CCAGCTAACCCAGCCCTGTGG	0.532																																																	0								ENSG00000215009						37.0	45.0	42.0					12																	7459151		2055	4242	6297	ACSM4	SO:0001583	missense	0			-	HGNC		CCDS44825.1	12p13.31	2008-06-12			ENSG00000215009	ENSG00000215009		"""Acyl-CoA synthetase family"""	32016	protein-coding gene	gene with protein product	"""similar to olfactory specific medium-chain acyl CoA synthetase"""	614360				17762044	Standard	NM_001080454		Approved		uc001qsx.1	P0C7M7	OTTHUMG00000154975	ENST00000399422.4:c.224C>T	12.37:g.7459151C>T	ENSP00000382349:p.Pro75Leu	Somatic	0	106	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	43	24.56	A8MTI6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_AMP-dep_Synth/Lig	p.P75L	ENST00000399422.4	37	c.224	CCDS44825.1	12	.	.	.	.	.	.	.	.	.	.	C	14.08	2.429342	0.43122	.	.	ENSG00000215009	ENST00000399422	T	0.11277	2.79	5.13	5.13	0.70059	.	0.000000	0.38959	U	0.001514	T	0.17619	0.0423	N	0.25144	0.715	0.58432	D	0.999992	D	0.89917	1.0	D	0.74674	0.984	T	0.07809	-1.0753	10	0.09084	T	0.74	-21.8173	16.4313	0.83844	0.0:1.0:0.0:0.0	.	75	P0C7M7	ACSM4_HUMAN	L	75	ENSP00000382349:P75L	ENSP00000382349:P75L	P	+	2	0	ACSM4	7350418	1.000000	0.71417	1.000000	0.80357	0.802000	0.45316	6.398000	0.73244	2.557000	0.86248	0.655000	0.94253	CCA	-	NULL		0.532	ACSM4-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	ACSM4	protein_coding	OTTHUMT00000337866.2	C	NM_001080454	-		7459151	+1	no_errors	ENST00000399422	ensembl	human	novel	74_37	missense	SNP	1.000	T
RBFOX3	146713	genome.wustl.edu	37	17	77111712	77111712	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr17:77111712G>A	ENST00000453134.2	-	5	598	c.86C>T	c.(85-87)cCc>cTc	p.P29L	RBFOX3_ENST00000583458.1_Missense_Mutation_p.P29L|RBFOX3_ENST00000415831.1_Missense_Mutation_p.P29L|RBFOX3_ENST00000584778.1_Missense_Mutation_p.P29L|RBFOX3_ENST00000582043.1_Missense_Mutation_p.P29L|RBFOX3_ENST00000580155.1_Missense_Mutation_p.P29L			A6NFN3	RFOX3_HUMAN	RNA binding protein, fox-1 homolog (C. elegans) 3	29	Pro-rich.				mRNA processing (GO:0006397)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perikaryon (GO:0043204)	DNA binding (GO:0003677)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(2)	2						GTCCTGCGTGGGGTGCGGTGG	0.716																																																	0								ENSG00000167281						67.0	59.0	61.0					17																	77111712		692	1591	2283	RBFOX3	SO:0001583	missense	0			-	HGNC		CCDS45805.1	17q25.3	2013-02-12			ENSG00000167281	ENSG00000167281		"""RNA binding motif (RRM) containing"""	27097	protein-coding gene	gene with protein product	"""neuronal nuclei"", ""hexaribonucleotide binding protein 3"""					16260614	Standard	NM_001082575		Approved	FOX-3, NeuN, HRNBP3	uc010dhs.4	A6NFN3	OTTHUMG00000150183	ENST00000453134.2:c.86C>T	17.37:g.77111712G>A	ENSP00000393262:p.Pro29Leu	Somatic	0	36	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	20	33.33	B4DEG6|B4DF29	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Fox-1_C_dom,pfam_RRM_dom,smart_RRM_dom,pirsf_RNA-bd_Fox-1,pfscan_RRM_dom	p.P29L	ENST00000453134.2	37	c.86	CCDS45805.1	17	.	.	.	.	.	.	.	.	.	.	G	14.14	2.445831	0.43429	.	.	ENSG00000167281	ENST00000338834;ENST00000415831;ENST00000453134	T;T	0.25414	1.8;1.8	4.14	4.14	0.48551	.	0.078242	0.50627	D	0.000119	T	0.46073	0.1374	L	0.60455	1.87	0.80722	D	1	D;P	0.71674	0.998;0.919	D;P	0.68765	0.96;0.534	T	0.49762	-0.8905	10	0.87932	D	0	-8.1933	15.3274	0.74176	0.0:0.0:1.0:0.0	.	29;29	B4DF29;A6NFN3	.;RFOX3_HUMAN	L	29	ENSP00000408395:P29L;ENSP00000393262:P29L	ENSP00000344726:P29L	P	-	2	0	RBFOX3	74623307	1.000000	0.71417	1.000000	0.80357	0.912000	0.54170	6.551000	0.73909	2.143000	0.66587	0.462000	0.41574	CCC	-	pirsf_RNA-bd_Fox-1		0.716	RBFOX3-202	KNOWN	basic|appris_principal|CCDS	protein_coding	RBFOX3	protein_coding	OTTHUMT00000437658.1	G	NM_001082575	-		77111712	-1	no_errors	ENST00000415831	ensembl	human	known	74_37	missense	SNP	1.000	A
F11	2160	genome.wustl.edu	37	4	187207625	187207625	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr4:187207625G>A	ENST00000403665.2	+	13	1889	c.1537G>A	c.(1537-1539)Gat>Aat	p.D513N	F11_ENST00000264692.4_Missense_Mutation_p.D461N|F11-AS1_ENST00000505103.1_RNA	NM_000128.3	NP_000119.1	P03951	FA11_HUMAN	coagulation factor XI	513	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|plasminogen activation (GO:0031639)|positive regulation of fibrinolysis (GO:0051919)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|serine-type aminopeptidase activity (GO:0070009)|serine-type endopeptidase activity (GO:0004252)			NS(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(15)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	32		all_cancers(14;6.2e-52)|all_epithelial(14;1.62e-38)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|Colorectal(36;0.0161)|all_neural(102;0.202)		OV - Ovarian serous cystadenocarcinoma(60;2.13e-11)|BRCA - Breast invasive adenocarcinoma(30;4.59e-06)|GBM - Glioblastoma multiforme(59;0.000149)|STAD - Stomach adenocarcinoma(60;0.000314)|LUSC - Lung squamous cell carcinoma(40;0.00112)|READ - Rectum adenocarcinoma(43;0.176)	Coagulation Factor IX(DB00100)	AATATACACTGATTGCTGGGT	0.378																																																	0								ENSG00000088926						144.0	156.0	152.0					4																	187207625		2203	4300	6503	F11	SO:0001583	missense	0			-	HGNC	M13142	CCDS3847.1	4q35	2008-08-01	2008-08-01		ENSG00000088926	ENSG00000088926	3.4.21.27		3529	protein-coding gene	gene with protein product	"""plasma thromboplastin antecedent"""	264900					Standard	NM_000128		Approved	FXI	uc003iza.1	P03951	OTTHUMG00000150311	ENST00000403665.2:c.1537G>A	4.37:g.187207625G>A	ENSP00000384957:p.Asp513Asn	Somatic	0	64	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	43	20.37	D3DP64|Q4W5C2|Q9Y495	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_S1,pfam_PAN-1_domain,superfamily_Trypsin-like_Pept_dom,smart_Apple,smart_Peptidase_S1,pfscan_Pan_app,pfscan_Peptidase_S1,prints_Apple,prints_Peptidase_S1A	p.D513N	ENST00000403665.2	37	c.1537	CCDS3847.1	4	.	.	.	.	.	.	.	.	.	.	G	0.051	-1.251032	0.01469	.	.	ENSG00000088926	ENST00000403665;ENST00000264692	D;D	0.88431	-2.38;-2.38	5.25	4.41	0.53225	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.423693	0.24269	N	0.040015	T	0.71434	0.3339	N	0.02916	-0.46	0.31756	N	0.63394	B	0.13145	0.007	B	0.12156	0.007	T	0.63629	-0.6594	10	0.05620	T	0.96	.	12.7894	0.57523	0.076:0.0:0.924:0.0	.	513	P03951	FA11_HUMAN	N	513;461	ENSP00000384957:D513N;ENSP00000264692:D461N	ENSP00000264692:D461N	D	+	1	0	F11	187444619	0.026000	0.19158	0.046000	0.18839	0.064000	0.16182	0.229000	0.17833	1.578000	0.49821	0.655000	0.94253	GAT	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1		0.378	F11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	F11	protein_coding	OTTHUMT00000317519.4	G		-		187207625	+1	no_errors	ENST00000403665	ensembl	human	known	74_37	missense	SNP	0.851	A
CHIAP2	149620	genome.wustl.edu	37	1	111827805	111827805	+	RNA	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr1:111827805C>T	ENST00000369743.4	+	0	1904					NR_003928.1				chitinase, acidic pseudogene 2																		CCAAAGGTTCCTTGGAAGTCA	0.453																																																	0								ENSG00000203878																																			CHIAP2			0			-	HGNC			1p13.2	2012-10-11			ENSG00000203878	ENSG00000203878			44463	pseudogene	pseudogene							Standard	NR_003928		Approved		uc009wgb.3		OTTHUMG00000012173		1.37:g.111827805C>T		Somatic	0	31	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	27	32.50		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000369743.4	37	NULL		1																																																																																			-	-		0.453	CHIAP2-001	KNOWN	basic	processed_transcript	CHIAP2	pseudogene	OTTHUMT00000033667.3	C		-		111827805	+1	no_errors	ENST00000369743	ensembl	human	known	74_37	rna	SNP	0.000	T
GUCY2C	2984	genome.wustl.edu	37	12	14825853	14825853	+	Missense_Mutation	SNP	A	A	G	rs147742759		TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr12:14825853A>G	ENST00000261170.3	-	9	1260	c.1124T>C	c.(1123-1125)gTt>gCt	p.V375A	RP11-174G6.1_ENST00000501178.2_RNA	NM_004963.3	NP_004954.2	P25092	GUC2C_HUMAN	guanylate cyclase 2C (heat stable enterotoxin receptor)	375					intracellular signal transduction (GO:0035556)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of cell proliferation (GO:0042127)|response to toxic substance (GO:0009636)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|toxic substance binding (GO:0015643)			breast(3)|endometrium(7)|kidney(3)|large_intestine(9)|lung(17)|ovary(4)|skin(7)|urinary_tract(1)	51					Linaclotide(DB08890)	GGTACTGTCAACATCCCCCCA	0.483													A|||	1	0.000199681	0.0	0.0	5008	,	,		16901	0.001		0.0	False		,,,				2504	0.0																0								ENSG00000070019	A	ALA/VAL	0,4406		0,0,2203	195.0	163.0	174.0		1124	5.0	0.2	12	dbSNP_134	174	4,8596	3.7+/-12.6	0,4,4296	no	missense	GUCY2C	NM_004963.3	64	0,4,6499	GG,GA,AA		0.0465,0.0,0.0308	benign	375/1074	14825853	4,13002	2203	4300	6503	GUCY2C	SO:0001583	missense	0			GMAF=0	HGNC		CCDS8664.1	12p12	2008-08-18			ENSG00000070019	ENSG00000070019			4688	protein-coding gene	gene with protein product		601330		GUC2C		8661067	Standard	NM_004963		Approved	STAR	uc001rcd.3	P25092	OTTHUMG00000168732	ENST00000261170.3:c.1124T>C	12.37:g.14825853A>G	ENSP00000261170:p.Val375Ala	Somatic	0	57	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	47	12.96	B2RMY6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_A/G_cyclase,pfam_ANF_lig-bd_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_A/G_cyclase,superfamily_Peripla_BP_I,superfamily_Kinase-like_dom,smart_Tyr_kinase_cat_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_A/G_cyclase,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_A/G_cyclase	p.V375A	ENST00000261170.3	37	c.1124	CCDS8664.1	12	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	A	8.160	0.789274	0.16258	0.0	4.65E-4	ENSG00000070019	ENST00000261170	T	0.73469	-0.75	4.99	4.99	0.66335	Extracellular ligand-binding receptor (1);	0.193487	0.42294	D	0.000736	T	0.61035	0.2315	N	0.22421	0.69	0.09310	N	0.99999	B	0.25719	0.132	B	0.27262	0.078	T	0.54549	-0.8277	10	0.39692	T	0.17	.	11.3817	0.49761	1.0:0.0:0.0:0.0	.	375	P25092	GUC2C_HUMAN	A	375	ENSP00000261170:V375A	ENSP00000261170:V375A	V	-	2	0	GUCY2C	14717120	0.998000	0.40836	0.166000	0.22797	0.017000	0.09413	4.534000	0.60622	2.005000	0.58758	0.533000	0.62120	GTT	-	pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I		0.483	GUCY2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GUCY2C	protein_coding	OTTHUMT00000400835.1	A		rs147742759		14825853	-1	no_errors	ENST00000261170	ensembl	human	known	74_37	missense	SNP	0.459	G
CCM2	83605	genome.wustl.edu	37	7	45104166	45104166	+	Silent	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr7:45104166C>T	ENST00000258781.6	+	4	542	c.393C>T	c.(391-393)atC>atT	p.I131I	CCM2_ENST00000541586.1_Silent_p.I73I|CCM2_ENST00000544363.1_Silent_p.I131I|CCM2_ENST00000474617.1_Silent_p.I125I|CCM2_ENST00000475551.1_Silent_p.I125I|CCM2_ENST00000381112.3_Silent_p.I152I|CCM2_ENST00000461377.1_3'UTR	NM_031443.3	NP_113631.1	Q9BSQ5	CCM2_HUMAN	cerebral cavernous malformation 2	131	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				blood vessel endothelial cell differentiation (GO:0060837)|cell-cell junction organization (GO:0045216)|endothelial cell development (GO:0001885)|endothelial tube morphogenesis (GO:0061154)|in utero embryonic development (GO:0001701)|inner ear development (GO:0048839)|integrin-mediated signaling pathway (GO:0007229)|multicellular organism growth (GO:0035264)|pericardium development (GO:0060039)|stress-activated MAPK cascade (GO:0051403)|vasculogenesis (GO:0001570)|venous blood vessel morphogenesis (GO:0048845)	cytoplasm (GO:0005737)|protein complex (GO:0043234)				NS(1)|endometrium(3)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19						AGGATATCATCCTCAGGGTGC	0.607																																																	0								ENSG00000136280						88.0	57.0	67.0					7																	45104166		2203	4300	6503	CCM2	SO:0001819	synonymous_variant	0			-	HGNC	BC004903	CCDS5500.1, CCDS34630.1, CCDS55108.1, CCDS55109.1	7p13	2014-09-17	2004-02-13	2004-02-18	ENSG00000136280	ENSG00000136280			21708	protein-coding gene	gene with protein product	"""malcavernin"""	607929	"""chromosome 7 open reading frame 22"""	C7orf22		9811928	Standard	NM_001029835		Approved	MGC4607	uc003tms.3	Q9BSQ5	OTTHUMG00000129246	ENST00000258781.6:c.393C>T	7.37:g.45104166C>T		Somatic	0	32	0.00		0.41568620468393047	155	24.02	49	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	17	32.00	A4D2L4|B3KUV0|D3DVL4|E9PDJ3|F5H0E1|F5H551|Q71RE5|Q8TAT4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfscan_PTB/PI_dom	p.I152	ENST00000258781.6	37	c.456	CCDS5500.1	7																																																																																			-	pfscan_PTB/PI_dom		0.607	CCM2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CCM2	protein_coding	OTTHUMT00000251348.1	C	NM_031443	-		45104166	+1	no_errors	ENST00000381112	ensembl	human	known	74_37	silent	SNP	1.000	T
PLEKHG4B	153478	genome.wustl.edu	37	5	162045	162045	+	Missense_Mutation	SNP	G	G	A	rs568109142		TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr5:162045G>A	ENST00000283426.6	+	10	1617	c.1567G>A	c.(1567-1569)Gag>Aag	p.E523K		NM_052909.3	NP_443141.3	Q96PX9	PKH4B_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 4B	523							Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(1)|large_intestine(2)|lung(2)|prostate(3)|skin(3)	11			all cancers(22;0.0253)|Lung(60;0.113)	Kidney(1;0.119)		CCGCTCGTCCGAGTTGTGCGA	0.627													G|||	1	0.000199681	0.0	0.0	5008	,	,		15391	0.001		0.0	False		,,,				2504	0.0																0								ENSG00000153404						63.0	52.0	56.0					5																	162045		2203	4300	6503	PLEKHG4B	SO:0001583	missense	0			-	HGNC	BC008352	CCDS34124.1	5p15.33	2013-01-11			ENSG00000153404	ENSG00000153404		"""Pleckstrin homology (PH) domain containing"""	29399	protein-coding gene	gene with protein product						11572484	Standard	NM_052909		Approved	KIAA1909	uc003jak.2	Q96PX9	OTTHUMG00000161570	ENST00000283426.6:c.1567G>A	5.37:g.162045G>A	ENSP00000283426:p.Glu523Lys	Somatic	0	67	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	25	34.21		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DH-domain,superfamily_DH-domain,superfamily_CRAL-TRIO_dom,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.E523K	ENST00000283426.6	37	c.1567	CCDS34124.1	5	.	.	.	.	.	.	.	.	.	.	G	9.714	1.157777	0.21454	.	.	ENSG00000153404	ENST00000283426	D	0.92348	-3.02	2.59	-0.499	0.12015	.	.	.	.	.	D	0.82651	0.5083	L	0.29908	0.895	0.09310	N	1	B	0.23058	0.079	B	0.15052	0.012	T	0.65203	-0.6225	9	0.15499	T	0.54	.	5.4779	0.16706	0.4516:0.0:0.5484:0.0	.	523	Q96PX9	PKH4B_HUMAN	K	523	ENSP00000283426:E523K	ENSP00000283426:E523K	E	+	1	0	PLEKHG4B	215045	0.992000	0.36948	0.000000	0.03702	0.001000	0.01503	1.197000	0.32211	-0.530000	0.06349	-0.375000	0.07067	GAG	-	NULL		0.627	PLEKHG4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHG4B	protein_coding	OTTHUMT00000365359.1	G	NM_052909	-		162045	+1	no_errors	ENST00000283426	ensembl	human	known	74_37	missense	SNP	0.001	A
PCDHGC3	5098	genome.wustl.edu	37	5	140855793	140855793	+	Missense_Mutation	SNP	T	T	C			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr5:140855793T>C	ENST00000308177.3	+	1	214	c.110T>C	c.(109-111)aTc>aCc	p.I37T	PCDHGB4_ENST00000519479.1_Intron|PCDHGA12_ENST00000252085.3_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA11_ENST00000398587.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA11_ENST00000518882.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA6_ENST00000517434.1_Intron	NM_002588.2|NM_032402.1	NP_002579.2|NP_115778.1	Q9UN70	PCDGK_HUMAN	protocadherin gamma subfamily C, 3	37	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|skin(2)|urinary_tract(1)	29			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CACTATGAGATCCCGGAGGAA	0.582																																																	0								ENSG00000240184						143.0	150.0	148.0					5																	140855793		2203	4300	6503	PCDHGC3	SO:0001583	missense	0			-	HGNC	AF152337	CCDS4261.1, CCDS75347.1, CCDS75348.1	5q31	2010-01-26			ENSG00000240184	ENSG00000240184		"""Cadherins / Protocadherins : Clustered"""	8716	other	protocadherin	"""cadherin-like 2"", ""protocadherin 2"", ""protocadherin 43"""	603627		PCDH2		9360932, 8508762	Standard	NM_032402		Approved	PC-43, PC43, PCDH-GAMMA-C3		Q9UN70	OTTHUMG00000129613	ENST00000308177.3:c.110T>C	5.37:g.140855793T>C	ENSP00000312070:p.Ile37Thr	Somatic	0	28	0.00		0.41568620468393047	7	56.25	9	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	21	25.00	O60622|Q08192|Q9Y5C4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.I37T	ENST00000308177.3	37	c.110	CCDS4261.1	5	.	.	.	.	.	.	.	.	.	.	T	18.98	3.738152	0.69304	.	.	ENSG00000240184	ENST00000308177	T	0.35973	1.28	5.65	5.65	0.86999	Cadherin, N-terminal (1);Cadherin (2);Cadherin-like (1);	.	.	.	.	T	0.57548	0.2061	M	0.86864	2.845	0.34702	D	0.72687	D;P	0.54601	0.967;0.928	P;B	0.52159	0.691;0.44	T	0.75563	-0.3274	9	0.87932	D	0	.	16.0399	0.80667	0.0:0.0:0.0:1.0	.	37;37	Q9UN70;Q9UN70-2	PCDGK_HUMAN;.	T	37	ENSP00000312070:I37T	ENSP00000312070:I37T	I	+	2	0	PCDHGC3	140835977	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.941000	0.70195	2.371000	0.80710	0.533000	0.62120	ATC	-	pfam_Cadherin_N,superfamily_Cadherin-like,pfscan_Cadherin		0.582	PCDHGC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGC3	protein_coding	OTTHUMT00000251808.2	T	NM_002588	-		140855793	+1	no_errors	ENST00000308177	ensembl	human	known	74_37	missense	SNP	1.000	C
SLC22A10	387775	genome.wustl.edu	37	11	63064849	63064849	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr11:63064849C>T	ENST00000332793.6	+	3	583	c.581C>T	c.(580-582)cCc>cTc	p.P194L	SLC22A10_ENST00000544661.1_Missense_Mutation_p.P39L|SLC22A10_ENST00000535888.1_5'UTR|SLC22A10_ENST00000525620.1_3'UTR|SLC22A10_ENST00000526800.1_Intron	NM_001039752.3	NP_001034841.3	Q63ZE4	S22AA_HUMAN	solute carrier family 22, member 10	194						integral component of membrane (GO:0016021)	transmembrane transporter activity (GO:0022857)			breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28					Conjugated Estrogens(DB00286)|Probenecid(DB01032)|Salicylic acid(DB00936)	GCCTTCGCTCCCACCTTCCCT	0.433																																																	0								ENSG00000184999						173.0	173.0	173.0					11																	63064849		2075	4240	6315	SLC22A10	SO:0001583	missense	0			-	HGNC	AP003420	CCDS41661.1	11q12.3	2013-05-22	2008-01-11		ENSG00000184999	ENSG00000184999		"""Solute carriers"""	18057	protein-coding gene	gene with protein product		607580	"""solute carrier family 22 (organic anion/cation transporter), member 10"""			11327718	Standard	NM_001039752		Approved	OAT5, hOAT5	uc009yor.3	Q63ZE4	OTTHUMG00000165197	ENST00000332793.6:c.581C>T	11.37:g.63064849C>T	ENSP00000327569:p.Pro194Leu	Somatic	0	49	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	29	19.44	Q68CJ0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.P194L	ENST00000332793.6	37	c.581	CCDS41661.1	11	.	.	.	.	.	.	.	.	.	.	C	15.76	2.928663	0.52759	.	.	ENSG00000184999	ENST00000544661;ENST00000332793	T;T	0.61158	0.13;0.13	3.26	2.23	0.28157	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.213097	0.39759	U	0.001263	T	0.81987	0.4939	H	0.97783	4.075	0.41389	D	0.987608	D	0.89917	1.0	D	0.91635	0.999	D	0.85754	0.1345	10	0.87932	D	0	.	9.5176	0.39115	0.2104:0.7896:0.0:0.0	.	194	Q63ZE4	S22AA_HUMAN	L	39;194	ENSP00000445667:P39L;ENSP00000327569:P194L	ENSP00000327569:P194L	P	+	2	0	SLC22A10	62821425	0.022000	0.18835	0.101000	0.21167	0.008000	0.06430	1.920000	0.40025	1.882000	0.54519	0.447000	0.29281	CCC	-	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom		0.433	SLC22A10-004	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC22A10	protein_coding	OTTHUMT00000382622.3	C	NM_001039752	-		63064849	+1	no_errors	ENST00000332793	ensembl	human	known	74_37	missense	SNP	0.909	T
HIVEP1	3096	genome.wustl.edu	37	6	12161889	12161889	+	Silent	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr6:12161889C>T	ENST00000379388.2	+	8	7037	c.6705C>T	c.(6703-6705)acC>acT	p.T2235T	HIVEP1_ENST00000541134.1_Silent_p.T100T	NM_002114.2	NP_002105.2	P15822	ZEP1_HUMAN	human immunodeficiency virus type I enhancer binding protein 1	2235					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(11)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	90	Breast(50;0.0639)|Ovarian(93;0.0816)	all_hematologic(90;0.117)				TCAGGATCACCGATTGCTTTT	0.552																																																	0								ENSG00000095951						93.0	100.0	98.0					6																	12161889		2129	4250	6379	HIVEP1	SO:0001819	synonymous_variant	0			-	HGNC	J05011	CCDS43426.1	6p24-p22.3	2012-10-05	2001-11-28		ENSG00000095951	ENSG00000095951		"""Zinc fingers, C2H2-type"""	4920	protein-coding gene	gene with protein product		194540	"""human immunodeficiency virus type I enhancer-binding protein 1"", ""zinc finger protein 40"""	ZNF40		2037300	Standard	XR_241895		Approved	CIRIP, MBP-1, CRYBP1, PRDII-BF1, ZAS1, Schnurri-1, ZNF40A	uc003nac.3	P15822	OTTHUMG00000014265	ENST00000379388.2:c.6705C>T	6.37:g.12161889C>T		Somatic	0	28	0.00		0.41568620468393047	5	28.57	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	4	55.56	B2RTU3|Q14122|Q5MPB1|Q5VW60	Silent	SNP	NA	NA	NA	NA	NA	NA	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.T2235	ENST00000379388.2	37	c.6705	CCDS43426.1	6																																																																																			-	NULL		0.552	HIVEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIVEP1	protein_coding	OTTHUMT00000039870.2	C	NM_002114	-		12161889	+1	no_errors	ENST00000379388	ensembl	human	known	74_37	silent	SNP	0.000	T
HINT2	84681	genome.wustl.edu	37	9	35813317	35813317	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr9:35813317G>A	ENST00000259667.5	-	4	387	c.346C>T	c.(346-348)Ctt>Ttt	p.L116F	HINT2_ENST00000474908.1_5'UTR|SPAG8_ENST00000340291.2_5'Flank|SPAG8_ENST00000396638.2_5'Flank|SPAG8_ENST00000479751.1_5'Flank|AL133410.1_ENST00000582432.1_RNA|SPAG8_ENST00000484764.1_5'Flank|TMEM8B_ENST00000377996.1_5'Flank	NM_032593.2	NP_115982.1	Q9BX68	HINT2_HUMAN	histidine triad nucleotide binding protein 2	116	HIT. {ECO:0000255|PROSITE- ProRule:PRU00464}.				apoptotic process (GO:0006915)|steroid biosynthetic process (GO:0006694)	mitochondrion (GO:0005739)	hydrolase activity (GO:0016787)|nucleotide binding (GO:0000166)			NS(2)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	7	all_epithelial(49;0.161)		LUSC - Lung squamous cell carcinoma(32;0.00521)|Lung(28;0.00697)|STAD - Stomach adenocarcinoma(86;0.194)			TTGGCCACAAGGAGTAGGTGT	0.552											OREG0019179	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									GBM(185;1694 2122 5473 25431 37228)												0								ENSG00000137133						138.0	135.0	136.0					9																	35813317		2203	4300	6503	HINT2	SO:0001583	missense	0			-	HGNC	AY033094	CCDS6594.1	9p11.2	2005-12-20			ENSG00000137133	ENSG00000137133			18344	protein-coding gene	gene with protein product		609997					Standard	NM_032593		Approved		uc003zyh.3	Q9BX68	OTTHUMG00000019886	ENST00000259667.5:c.346C>T	9.37:g.35813317G>A	ENSP00000259667:p.Leu116Phe	Somatic	0	48	0.00	858	0.41568620468393047	261	17.41	55	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	25	24.24	Q5TCW3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Histidine_triad_HIT,superfamily_HIT-like,pfscan_HIT-like,prints_Histidine_triad_HIT	p.L116F	ENST00000259667.5	37	c.346	CCDS6594.1	9	.	.	.	.	.	.	.	.	.	.	G	15.90	2.968614	0.53614	.	.	ENSG00000137133	ENST00000259667	T	0.76578	-1.03	4.64	3.74	0.42951	Histidine triad motif (1);Histidine triad-like motif (1);	0.153902	0.41294	D	0.000917	T	0.72993	0.3530	L	0.47078	1.49	0.44619	D	0.997598	P	0.36171	0.541	B	0.43274	0.414	T	0.69989	-0.4995	10	0.40728	T	0.16	-9.9644	7.8897	0.29672	0.0:0.1777:0.6382:0.1841	.	116	Q9BX68	HINT2_HUMAN	F	116	ENSP00000259667:L116F	ENSP00000259667:L116F	L	-	1	0	HINT2	35803317	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	1.639000	0.37176	1.160000	0.42584	-0.152000	0.13540	CTT	-	pfam_Histidine_triad_HIT,superfamily_HIT-like,pfscan_HIT-like		0.552	HINT2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HINT2	protein_coding	OTTHUMT00000052390.1	G	NM_032593	-		35813317	-1	no_errors	ENST00000259667	ensembl	human	known	74_37	missense	SNP	1.000	A
WWC2	80014	genome.wustl.edu	37	4	184019230	184019230	+	5'Flank	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr4:184019230C>T	ENST00000403733.3	+	0	0				WWC2_ENST00000448232.2_5'Flank|WWC2-AS2_ENST00000578387.1_lincRNA|WWC2_ENST00000513834.1_5'Flank|WWC2_ENST00000378925.3_5'Flank	NM_024949.5	NP_079225.5	Q6AWC2	WWC2_HUMAN	WW and C2 domain containing 2						negative regulation of hippo signaling (GO:0035331)|negative regulation of organ growth (GO:0046621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	cytosol (GO:0005829)	kinase binding (GO:0019900)|protein complex scaffold (GO:0032947)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(15)|ovary(2)|prostate(1)|stomach(1)|urinary_tract(3)	32		all_lung(41;5.28e-14)|Lung NSC(41;1.35e-13)|Colorectal(36;0.00681)|Hepatocellular(41;0.00886)|Renal(120;0.00992)|Prostate(90;0.0237)|all_hematologic(60;0.0592)|Esophageal squamous(56;0.179)|all_neural(102;0.202)		all cancers(43;3.38e-24)|Epithelial(43;1.4e-20)|OV - Ovarian serous cystadenocarcinoma(60;1.09e-09)|GBM - Glioblastoma multiforme(59;3.33e-05)|Colorectal(24;3.58e-05)|STAD - Stomach adenocarcinoma(60;4.21e-05)|COAD - Colon adenocarcinoma(29;0.000171)|LUSC - Lung squamous cell carcinoma(40;0.0145)|READ - Rectum adenocarcinoma(43;0.242)		GGAGGCGCCCCCTCTGACTGA	0.662																																																	0								ENSG00000251359						25.0	32.0	30.0					4																	184019230		692	1591	2283	WWC2-AS2	SO:0001631	upstream_gene_variant	0			-	HGNC	BC017957	CCDS34109.2	4q35.1	2010-08-05	2006-11-09		ENSG00000151718	ENSG00000151718		"""WW, C2 and coiled-coil domain containing"""	24148	protein-coding gene	gene with protein product			"""WW, C2 and coiled-coil domain containing 2"""			12477932	Standard	NM_024949		Approved	BOMB, FLJ22029	uc010irx.3	Q6AWC2	OTTHUMG00000150685		4.37:g.184019230C>T	Exception_encountered	Somatic	0	59	0.00		0.41568620468393047	3	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	28	15.15	Q32Q84|Q69YQ1|Q6AWB8|Q6ZSY9|Q6ZU09|Q7Z620|Q8TEB8|Q9H6P0	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000403733.3	37	NULL	CCDS34109.2	4	.	.	.	.	.	.	.	.	.	.	C	7.619	0.676480	0.14841	.	.	ENSG00000251359	ENST00000506413	.	.	.	2.68	-2.44	0.06502	.	.	.	.	.	T	0.33673	0.0871	.	.	.	.	.	.	B	0.14012	0.009	B	0.12837	0.008	T	0.29822	-0.9999	6	0.87932	D	0	.	7.489	0.27449	0.0:0.6033:0.0:0.3967	.	171	Q96NR7	CD038_HUMAN	R	171	.	ENSP00000421843:G171R	G	-	1	0	C4orf38	184256224	0.000000	0.05858	0.000000	0.03702	0.017000	0.09413	-0.483000	0.06536	-0.563000	0.06078	0.313000	0.20887	GGG	-	-		0.662	WWC2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	WWC2-AS2	protein_coding	OTTHUMT00000319608.1	C	NM_024949	-		184019230	-1	no_errors	ENST00000506413	ensembl	human	known	74_37	rna	SNP	0.000	T
ANKRD20A11P	391267	genome.wustl.edu	37	21	15326422	15326422	+	RNA	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr21:15326422C>T	ENST00000344693.5	-	0	785					NR_027270.1				ankyrin repeat domain 20 family, member A11, pseudogene																		GTTTCCTTTTCCATGGGAAGG	0.398																																																	0								ENSG00000215559																																			ANKRD20A11P			0			-	HGNC			21q11.2	2011-11-23			ENSG00000215559	ENSG00000215559			42024	pseudogene	pseudogene			"""chromosome 21 open reading frame 81"""	C21orf81			Standard	NR_027270		Approved		uc002yjj.4		OTTHUMG00000074237		21.37:g.15326422C>T		Somatic	0	174	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	110	13.39		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000344693.5	37	NULL		21																																																																																			-	-		0.398	ANKRD20A11P-005	KNOWN	basic	processed_transcript	ANKRD20A11P	pseudogene	OTTHUMT00000157750.1	C		-		15326422	-1	no_errors	ENST00000344693	ensembl	human	known	74_37	rna	SNP	0.002	T
C1orf168	199920	genome.wustl.edu	37	1	57285087	57285087	+	5'Flank	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr1:57285087C>T	ENST00000343433.6	-	0	0				C1orf168_ENST00000484327.1_5'UTR	NM_001004303.4	NP_001004303.3	Q5VWT5	CA168_HUMAN	chromosome 1 open reading frame 168											NS(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(13)|ovary(3)|skin(6)|stomach(1)|urinary_tract(2)	46						CAGGACACACCTGAGCCCAGG	0.657																																																	0								ENSG00000187889																																			C1orf168	SO:0001631	upstream_gene_variant	0			-	HGNC	BX648439	CCDS30729.1	1p32.2	2011-02-22			ENSG00000187889	ENSG00000187889			27295	protein-coding gene	gene with protein product						14702039	Standard	NM_001004303		Approved	RP4-758N20.2, FLJ43208	uc001cym.4	Q5VWT5	OTTHUMG00000008281		1.37:g.57285087C>T	Exception_encountered	Somatic	0	38	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	25	35.90	Q63HM3|Q6ZUY6	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000343433.6	37	NULL	CCDS30729.1	1																																																																																			-	-		0.657	C1orf168-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf168	protein_coding	OTTHUMT00000022751.2	C	NM_001004303	-		57285087	-1	no_errors	ENST00000484327	ensembl	human	known	74_37	rna	SNP	0.043	T
GLIS3	169792	genome.wustl.edu	37	9	4118551	4118551	+	Silent	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr9:4118551G>A	ENST00000324333.10	-	3	655	c.462C>T	c.(460-462)tcC>tcT	p.S154S	GLIS3_ENST00000381971.3_Silent_p.S309S	NM_152629.3	NP_689842.3	Q8NEA6	GLIS3_HUMAN	GLIS family zinc finger 3	154	Ser-rich.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(12)|lung(4)|ovary(2)|prostate(1)|skin(1)	26		Acute lymphoblastic leukemia(2;0.00464)|Breast(48;0.148)		Lung(2;0.00163)|GBM - Glioblastoma multiforme(50;0.00301)|LUSC - Lung squamous cell carcinoma(2;0.0148)		CGATGCCATCGGACAGCGGGG	0.612																																																	0								ENSG00000107249						106.0	92.0	97.0					9																	4118551		2203	4300	6503	GLIS3	SO:0001819	synonymous_variant	0			-	HGNC	BC033899	CCDS6451.1, CCDS43784.1	9p24.2	2008-05-02	2004-07-16	2004-07-16	ENSG00000107249	ENSG00000107249		"""Zinc fingers, C2H2-type"""	28510	protein-coding gene	gene with protein product		610192	"""zinc finger protein 515"""	ZNF515		14500813	Standard	NM_152629		Approved	MGC33662	uc003zhx.1	Q8NEA6	OTTHUMG00000019463	ENST00000324333.10:c.462C>T	9.37:g.4118551G>A		Somatic	0	46	0.00		0.41568620468393047	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	38	13.64	B1AL19|Q1PHK5	Silent	SNP	NA	NA	NA	NA	NA	NA	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S309	ENST00000324333.10	37	c.927	CCDS6451.1	9																																																																																			-	NULL		0.612	GLIS3-003	KNOWN	basic|CCDS	protein_coding	GLIS3	protein_coding	OTTHUMT00000051559.1	G	NM_152629	-		4118551	-1	no_errors	ENST00000381971	ensembl	human	known	74_37	silent	SNP	0.020	A
C2orf49	79074	genome.wustl.edu	37	2	105953985	105953985	+	5'UTR	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr2:105953985C>T	ENST00000258457.2	+	0	170				C2orf49_ENST00000437250.2_Missense_Mutation_p.P19S|RP11-332H14.2_ENST00000610036.1_lincRNA|C2orf49_ENST00000410049.1_5'Flank			Q9BVC5	ASHWN_HUMAN	chromosome 2 open reading frame 49						embryonic morphogenesis (GO:0048598)	tRNA-splicing ligase complex (GO:0072669)				endometrium(1)|kidney(1)|large_intestine(3)|lung(1)	6						TACGTCACTTCCGCAACGCTT	0.672																																																	0								ENSG00000135974																																			C2orf49	SO:0001623	5_prime_UTR_variant	0			-	HGNC	BC001310	CCDS2068.1, CCDS74550.1	2q12.2	2009-04-22			ENSG00000135974	ENSG00000135974			28772	protein-coding gene	gene with protein product	"""ashwin"""					12477932	Standard	NM_001286537		Approved	MGC5509, asw	uc002tcs.1	Q9BVC5	OTTHUMG00000130808	ENST00000258457.2:c.-60C>T	2.37:g.105953985C>T		Somatic	0	106	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	61	16.44	B3KXN3|B4E2G9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.P19S	ENST00000258457.2	37	c.55	CCDS2068.1	2	.	.	.	.	.	.	.	.	.	.	C	32	5.160131	0.94727	.	.	ENSG00000135974	ENST00000437250	T	0.49432	0.78	5.54	5.54	0.83059	.	.	.	.	.	T	0.62998	0.2474	.	.	.	0.30373	N	0.782681	.	.	.	.	.	.	T	0.63633	-0.6593	6	0.87932	D	0	.	18.6556	0.91452	0.0:1.0:0.0:0.0	.	.	.	.	S	19	ENSP00000400208:P19S	ENSP00000400208:P19S	P	+	1	0	C2orf49	105320417	0.995000	0.38212	1.000000	0.80357	0.555000	0.35460	2.003000	0.40844	2.884000	0.98904	0.655000	0.94253	CCG	-	NULL		0.672	C2orf49-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C2orf49	protein_coding	OTTHUMT00000253353.2	C	NM_024093	-		105953985	+1	no_errors	ENST00000437250	ensembl	human	known	74_37	missense	SNP	1.000	T
DNAJC10	54431	genome.wustl.edu	37	2	183616418	183616418	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr2:183616418C>T	ENST00000264065.7	+	15	1755	c.1340C>T	c.(1339-1341)gCc>gTc	p.A447V		NM_018981.1	NP_061854.1	Q8IXB1	DJC10_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 10	447	Trxb 2.				cell redox homeostasis (GO:0045454)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of ATPase activity (GO:0032781)|protein folding in endoplasmic reticulum (GO:0034975)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum chaperone complex (GO:0034663)|endoplasmic reticulum lumen (GO:0005788)|membrane (GO:0016020)	ATPase activator activity (GO:0001671)|ATPase binding (GO:0051117)|chaperone binding (GO:0051087)|disulfide oxidoreductase activity (GO:0015036)|Hsp70 protein binding (GO:0030544)|misfolded protein binding (GO:0051787)|oxidoreductase activity, acting on a sulfur group of donors, disulfide as acceptor (GO:0016671)|protein disulfide oxidoreductase activity (GO:0015035)			breast(3)|endometrium(1)|kidney(4)|large_intestine(7)|lung(15)|ovary(1)|skin(1)	32			OV - Ovarian serous cystadenocarcinoma(117;0.0942)|Epithelial(96;0.209)			CTTGCCTTTGCCAAAGAAAGT	0.368																																					Pancreas(56;860 1183 25669 35822 48585)												0								ENSG00000077232						142.0	145.0	144.0					2																	183616418		2203	4300	6503	DNAJC10	SO:0001583	missense	0			-	HGNC		CCDS33345.1, CCDS74613.1	2q32.1	2011-11-23			ENSG00000077232	ENSG00000077232		"""Heat shock proteins / DNAJ (HSP40)"", ""Protein disulfide isomerases"""	24637	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 19"""	607987				12411443, 12446677	Standard	NM_018981		Approved	ERdj5, PDIA19	uc002uow.2	Q8IXB1	OTTHUMG00000154209	ENST00000264065.7:c.1340C>T	2.37:g.183616418C>T	ENSP00000264065:p.Ala447Val	Somatic	0	90	0.00		0.41568620468393047	14	17.65	3	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	50	12.28	Q17RJ6|Q3B7W8|Q4ZG06|Q53QT7|Q6UWZ6|Q86T61|Q8NC82|Q8TD87|Q96K38|Q96K44|Q96K54|Q9NSY6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Thioredoxin_domain,pfam_DnaJ_domain,superfamily_Thioredoxin-like_fold,superfamily_DnaJ_domain,smart_DnaJ_domain,pirsf_DnaJ_homolog_subfam-C,pfscan_DnaJ_domain,prints_DnaJ_domain,prints_Thioredoxin	p.A447V	ENST00000264065.7	37	c.1340	CCDS33345.1	2	.	.	.	.	.	.	.	.	.	.	C	35	5.523098	0.96431	.	.	ENSG00000077232	ENST00000264065;ENST00000392392	T	0.19105	2.17	6.03	6.03	0.97812	Thioredoxin-like fold (4);	0.000000	0.85682	D	0.000000	T	0.39809	0.1092	L	0.39692	1.235	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.91635	0.968;0.999	T	0.01182	-1.1426	10	0.22109	T	0.4	.	20.5666	0.99351	0.0:1.0:0.0:0.0	.	401;447	Q8IXB1-2;Q8IXB1	.;DJC10_HUMAN	V	447;401	ENSP00000264065:A447V	ENSP00000264065:A447V	A	+	2	0	DNAJC10	183324663	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.167000	0.77562	2.854000	0.98071	0.655000	0.94253	GCC	-	superfamily_Thioredoxin-like_fold,pirsf_DnaJ_homolog_subfam-C		0.368	DNAJC10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC10	protein_coding	OTTHUMT00000334418.2	C	NM_018981	-		183616418	+1	no_errors	ENST00000264065	ensembl	human	known	74_37	missense	SNP	1.000	T
EIF4A2	1974	genome.wustl.edu	37	3	186502839	186502839	+	Silent	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr3:186502839C>T	ENST00000323963.5	+	4	361	c.297C>T	c.(295-297)ttC>ttT	p.F99F	RP11-573D15.9_ENST00000577781.1_RNA|SNORA4_ENST00000584302.1_RNA|EIF4A2_ENST00000356531.5_Intron|SNORA63_ENST00000363450.1_RNA|SNORD2_ENST00000459163.1_RNA|EIF4A2_ENST00000440191.2_Silent_p.F100F|SNORA63_ENST00000363548.1_RNA|SNORA81_ENST00000408493.2_RNA			Q14240	IF4A2_HUMAN	eukaryotic translation initiation factor 4A2	99	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				cellular protein metabolic process (GO:0044267)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of translational initiation (GO:0006446)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|translation initiation factor activity (GO:0003743)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(2)|prostate(2)|urinary_tract(1)	28	all_cancers(143;2.68e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.07e-20)	GBM - Glioblastoma multiforme(93;0.0704)		AGATTGAGTTCAAGGAGACCC	0.443			T	BCL6	NHL																																			Dom	yes		3	3q27.3	1974	"""eukaryotic translation initiation factor 4A, isoform 2"""		L	0								ENSG00000156976						179.0	169.0	173.0					3																	186502839		2203	4300	6503	EIF4A2	SO:0001819	synonymous_variant	0			-	HGNC	D30655	CCDS3282.1	3q28	2012-02-23	2010-02-10		ENSG00000156976	ENSG00000156976	3.6.1.1	"""DEAD-boxes"""	3284	protein-coding gene	gene with protein product		601102	"""eukaryotic translation initiation factor 4A, isoform 2"""	EIF4F		8521730	Standard	NM_001967		Approved	DDX2B, EIF4A, BM-010	uc003fqs.3	Q14240	OTTHUMG00000156564	ENST00000323963.5:c.297C>T	3.37:g.186502839C>T		Somatic	0	44	0.00		0.41568620468393047	130	14.94	23	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	20	20.00	D3DNU9|Q53XJ6|Q96B90|Q96EA8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.F100	ENST00000323963.5	37	c.300	CCDS3282.1	3																																																																																			-	pfam_DNA/RNA_helicase_DEAD/DEAH_N,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd		0.443	EIF4A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF4A2	protein_coding	OTTHUMT00000344609.1	C	NM_001967	-		186502839	+1	no_errors	ENST00000440191	ensembl	human	known	74_37	silent	SNP	1.000	T
PLA2G5	5322	genome.wustl.edu	37	1	20416384	20416384	+	Silent	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr1:20416384C>T	ENST00000375108.3	+	4	556	c.288C>T	c.(286-288)acC>acT	p.T96T	PLA2G5_ENST00000486277.1_3'UTR	NM_000929.2	NP_000920.1	P39877	PA2G5_HUMAN	phospholipase A2, group V	96					arachidonic acid secretion (GO:0050482)|glycerophospholipid biosynthetic process (GO:0046474)|leukotriene biosynthetic process (GO:0019370)|lipid catabolic process (GO:0016042)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|platelet activating factor biosynthetic process (GO:0006663)|response to cAMP (GO:0051591)|response to cytokine (GO:0034097)|small molecule metabolic process (GO:0044281)	cell surface (GO:0009986)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase A2 activity (GO:0047498)|heparin binding (GO:0008201)			NS(1)|large_intestine(1)|lung(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	14		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000249)|Lung NSC(340;0.000287)|Breast(348;0.000812)|Ovarian(437;0.00328)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(152;1.22e-05)|BRCA - Breast invasive adenocarcinoma(304;8.15e-05)|Kidney(64;0.000184)|GBM - Glioblastoma multiforme(114;0.00089)|KIRC - Kidney renal clear cell carcinoma(64;0.0027)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0652)		GCGTGGTCACCTGCGGTAAGG	0.582																																																	0								ENSG00000127472						88.0	73.0	78.0					1																	20416384		2203	4300	6503	PLA2G5	SO:0001819	synonymous_variant	0			-	HGNC	U03090	CCDS202.1	1p36-p34	2008-09-19			ENSG00000127472	ENSG00000127472	3.1.1.4		9038	protein-coding gene	gene with protein product		601192				8838795, 8300559	Standard	NM_000929		Approved		uc001bcy.3	P39877	OTTHUMG00000002698	ENST00000375108.3:c.288C>T	1.37:g.20416384C>T		Somatic	0	61	0.00		0.41568620468393047	8	50.00	8	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	36	14.29	Q8N435	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_PLipase_A2_dom,superfamily_PLipase_A2_dom,smart_PLipase_A2_dom,prints_PLipase_A2	p.T96	ENST00000375108.3	37	c.288	CCDS202.1	1																																																																																			-	pfam_PLipase_A2_dom,superfamily_PLipase_A2_dom,smart_PLipase_A2_dom,prints_PLipase_A2		0.582	PLA2G5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLA2G5	protein_coding	OTTHUMT00000007668.1	C	NM_000929	-		20416384	+1	no_errors	ENST00000375108	ensembl	human	known	74_37	silent	SNP	1.000	T
ADAR	103	genome.wustl.edu	37	1	154569412	154569412	+	Silent	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr1:154569412G>A	ENST00000368474.4	-	6	2338	c.2139C>T	c.(2137-2139)gtC>gtT	p.V713V	ADAR_ENST00000292205.5_Silent_p.V756V|ADAR_ENST00000368471.3_Silent_p.V418V	NM_001111.4|NM_015840.3|NM_015841.3	NP_001102|NP_056655.2|NP_056656.2	P55265	DSRAD_HUMAN	adenosine deaminase, RNA-specific	713					adenosine to inosine editing (GO:0006382)|base conversion or substitution editing (GO:0016553)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|miRNA loading onto RISC involved in gene silencing by miRNA (GO:0035280)|mRNA modification (GO:0016556)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein kinase activity by regulation of protein phosphorylation (GO:0044387)|negative regulation of viral genome replication (GO:0045071)|positive regulation of viral genome replication (GO:0045070)|pre-miRNA processing (GO:0031054)|protein export from nucleus (GO:0006611)|protein import into nucleus (GO:0006606)|response to interferon-alpha (GO:0035455)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|supraspliceosomal complex (GO:0044530)	DNA binding (GO:0003677)|double-stranded RNA adenosine deaminase activity (GO:0003726)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|lung(20)|ovary(4)|prostate(2)|skin(2)	51	all_lung(78;2.22e-29)|Lung NSC(65;3.66e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.0997)		LUSC - Lung squamous cell carcinoma(543;0.185)	Colorectal(1306;0.115)		CAATCTTCCTGACCTTGTTGG	0.493																																																	0								ENSG00000160710						122.0	103.0	109.0					1																	154569412		2203	4300	6503	ADAR	SO:0001819	synonymous_variant	0			-	HGNC	BC038227	CCDS1071.1, CCDS30879.1	1q21.3	2012-03-22			ENSG00000160710	ENSG00000160710	3.5.4.-		225	protein-coding gene	gene with protein product		146920	"""interferon-induced protein 4"""	IFI4, G1P1		7972084	Standard	NM_001111		Approved	ADAR1	uc001ffh.3	P55265	OTTHUMG00000037261	ENST00000368474.4:c.2139C>T	1.37:g.154569412G>A		Somatic	0	69	0.00		0.41568620468393047	31	22.50	9	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	41	12.77	B1AQQ9|B1AQR0|D3DV76|O15223|O43859|O43860|Q9BYM3|Q9BYM4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_A_deamin,pfam_dsRNA_A_deaminase,pfam_dsRNA-bd_dom,smart_dsRNA_A_deaminase,smart_dsRNA-bd_dom,smart_A_deamin,pfscan_dsRNA-bd_dom,pfscan_dsRNA_A_deaminase,pfscan_A_deamin	p.V756	ENST00000368474.4	37	c.2268	CCDS1071.1	1																																																																																			-	NULL		0.493	ADAR-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ADAR	protein_coding	OTTHUMT00000090691.2	G	NM_001111	-		154569412	-1	no_errors	ENST00000292205	ensembl	human	known	74_37	silent	SNP	0.870	A
E2F8	79733	genome.wustl.edu	37	11	19246951	19246951	+	Silent	SNP	G	G	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr11:19246951G>T	ENST00000527884.1	-	12	2470	c.2238C>A	c.(2236-2238)ccC>ccA	p.P746P	E2F8_ENST00000529188.1_5'Flank|RP11-428C19.4_ENST00000527978.1_RNA|E2F8_ENST00000250024.4_Silent_p.P746P	NM_001256371.1|NM_001256372.1	NP_001243300.1|NP_001243301.1	A0AVK6	E2F8_HUMAN	E2F transcription factor 8	746					cell cycle comprising mitosis without cytokinesis (GO:0033301)|chorionic trophoblast cell differentiation (GO:0060718)|hepatocyte differentiation (GO:0070365)|negative regulation of cytokinesis (GO:0032466)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|placenta development (GO:0001890)|positive regulation of DNA endoreduplication (GO:0032877)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|sprouting angiogenesis (GO:0002040)|trophoblast giant cell differentiation (GO:0060707)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter binding (GO:0001047)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						ACTGCACATTGGGTGAGATGA	0.542																																																	0								ENSG00000129173						124.0	108.0	114.0					11																	19246951		2199	4293	6492	E2F8	SO:0001819	synonymous_variant	0			-	HGNC		CCDS7849.1	11p15	2008-02-05			ENSG00000129173	ENSG00000129173			24727	protein-coding gene	gene with protein product		612047				15722552	Standard	NM_024680		Approved	FLJ23311	uc001mpo.2	A0AVK6	OTTHUMG00000166102	ENST00000527884.1:c.2238C>A	11.37:g.19246951G>T		Somatic	0	54	0.00		0.41568620468393047	4	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52	A8K9H3|Q2VPJ3|Q3C1U6|Q5BKY4|Q8N340|Q9H5M0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_E2F_TDP	p.P746	ENST00000527884.1	37	c.2238	CCDS7849.1	11																																																																																			-	NULL		0.542	E2F8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	E2F8	protein_coding	OTTHUMT00000387830.1	G	NM_024680	-		19246951	-1	no_errors	ENST00000250024	ensembl	human	known	74_37	silent	SNP	0.079	T
DMRT1	1761	genome.wustl.edu	37	9	894113	894113	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr9:894113C>T	ENST00000382276.3	+	3	889	c.740C>T	c.(739-741)cCc>cTc	p.P247L	DMRT1_ENST00000569227.1_Missense_Mutation_p.P89L	NM_021951.2	NP_068770.2	Q9Y5R6	DMRT1_HUMAN	doublesex and mab-3 related transcription factor 1	247					cell morphogenesis (GO:0000902)|germ cell migration (GO:0008354)|intracellular signal transduction (GO:0035556)|male germ cell proliferation (GO:0002176)|male sex determination (GO:0030238)|male sex differentiation (GO:0046661)|negative regulation of meiosis (GO:0045835)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|oocyte development (GO:0048599)|positive regulation of male gonad development (GO:2000020)|positive regulation of meiosis I (GO:0060903)|positive regulation of mitosis (GO:0045840)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of nodal signaling pathway (GO:1900107)|Sertoli cell development (GO:0060009)|Sertoli cell differentiation (GO:0060008)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(2)|lung(10)|ovary(1)	13		all_lung(10;2.66e-10)|Lung NSC(10;2.82e-10)|Breast(48;0.232)		Lung(218;0.037)		GTGGGAAATCCCCTCGGGGGA	0.537											OREG0019071	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000137090						77.0	78.0	78.0					9																	894113		2203	4300	6503	DMRT1	SO:0001583	missense	0			-	HGNC	AF130728	CCDS6442.1	9p24.3	2014-01-21			ENSG00000137090	ENSG00000137090			2934	protein-coding gene	gene with protein product	"""DM domain expressed in testis 1"""	602424				9490411, 10332030	Standard	XM_006716732		Approved	DMT1, CT154	uc003zgv.3	Q9Y5R6	OTTHUMG00000019435	ENST00000382276.3:c.740C>T	9.37:g.894113C>T	ENSP00000371711:p.Pro247Leu	Somatic	0	49	0.00	591	0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	32	15.79	B2R913|Q6T1H8|Q6T1H9|Q8IW77	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DM_DNA-bd,pfam_DMRT1-like,superfamily_DM_DNA-bd,smart_DM_DNA-bd,pfscan_DM_DNA-bd	p.P247L	ENST00000382276.3	37	c.740	CCDS6442.1	9	.	.	.	.	.	.	.	.	.	.	C	17.66	3.445074	0.63178	.	.	ENSG00000137090	ENST00000382276	T	0.18016	2.24	5.92	5.92	0.95590	.	0.494722	0.22737	N	0.056260	T	0.19127	0.0459	L	0.43152	1.355	0.20821	N	0.999846	B;B	0.24092	0.049;0.097	B;B	0.24701	0.026;0.055	T	0.10314	-1.0635	10	0.28530	T	0.3	.	18.5462	0.91047	0.0:1.0:0.0:0.0	.	247;247	Q9Y5R6;Q6T1H9	DMRT1_HUMAN;.	L	247	ENSP00000371711:P247L	ENSP00000371711:P247L	P	+	2	0	DMRT1	884113	0.036000	0.19791	0.203000	0.23512	0.888000	0.51559	3.419000	0.52728	2.820000	0.97059	0.650000	0.86243	CCC	-	NULL		0.537	DMRT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMRT1	protein_coding	OTTHUMT00000051489.2	C	NM_021951	-		894113	+1	no_errors	ENST00000382276	ensembl	human	known	74_37	missense	SNP	0.090	T
DHX32	55760	genome.wustl.edu	37	10	127569270	127569270	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr10:127569270G>A	ENST00000284690.3	-	1	614	c.124C>T	c.(124-126)Ccc>Tcc	p.P42S	DHX32_ENST00000284688.6_Missense_Mutation_p.P42S	NM_018180.2	NP_060650.2	Q7L7V1	DHX32_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 32	42						mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(2)|stomach(1)	29		all_lung(145;0.00751)|Lung NSC(174;0.0115)|Colorectal(57;0.0846)|all_neural(114;0.0936)				CCATCAAAGGGGTTAAGTTCC	0.398																																																	0								ENSG00000089876						107.0	108.0	108.0					10																	127569270		2203	4300	6503	DHX32	SO:0001583	missense	0			-	HGNC		CCDS7652.1	10q26.11-q26.2	2008-01-07	2004-01-29	2004-01-30	ENSG00000089876	ENSG00000089876		"""DEAH-boxes"""	16717	protein-coding gene	gene with protein product		607960	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 32"""	DDX32			Standard	NM_018180		Approved	FLJ10889, FLJ10694, DHLP1	uc001ljf.1	Q7L7V1	OTTHUMG00000019238	ENST00000284690.3:c.124C>T	10.37:g.127569270G>A	ENSP00000284690:p.Pro42Ser	Somatic	0	88	0.00		0.41568620468393047	3	25.00	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	34	10.53	A8MSV2|D3DRF9|Q49AG5|Q5T3L0|Q5T3L5|Q96NY1|Q9BUN0|Q9H769|Q9NSL5|Q9NV74|Q9NVJ7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Helicase-assoc_dom,pfam_DUF1605,superfamily_P-loop_NTPase,smart_Helicase-assoc_dom,pfscan_Helicase_ATP-bd	p.P42S	ENST00000284690.3	37	c.124	CCDS7652.1	10	.	.	.	.	.	.	.	.	.	.	G	16.53	3.148457	0.57151	.	.	ENSG00000089876	ENST00000284690;ENST00000284688;ENST00000415732	T;T;T	0.16457	2.34;2.34;2.34	4.95	4.95	0.65309	.	0.119914	0.64402	D	0.000019	T	0.16685	0.0401	L	0.49778	1.585	0.27682	N	0.946423	P	0.39282	0.666	B	0.33339	0.162	T	0.17961	-1.0352	10	0.87932	D	0	-22.4599	14.1468	0.65355	0.0:0.0:0.8496:0.1504	.	42	Q7L7V1	DHX32_HUMAN	S	42	ENSP00000284690:P42S;ENSP00000284688:P42S;ENSP00000406781:P42S	ENSP00000284688:P42S	P	-	1	0	DHX32	127559260	1.000000	0.71417	0.999000	0.59377	0.990000	0.78478	5.378000	0.66190	2.561000	0.86390	0.561000	0.74099	CCC	-	superfamily_P-loop_NTPase		0.398	DHX32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHX32	protein_coding	OTTHUMT00000050945.2	G	NM_018180	-		127569270	-1	no_errors	ENST00000284690	ensembl	human	known	74_37	missense	SNP	1.000	A
SLC38A1	81539	genome.wustl.edu	37	12	46623406	46623406	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr12:46623406G>A	ENST00000398637.5	-	4	833	c.139C>T	c.(139-141)Cgt>Tgt	p.R47C	SLC38A1_ENST00000549633.1_5'UTR|SLC38A1_ENST00000439706.1_Missense_Mutation_p.R47C|SLC38A1_ENST00000546893.1_Missense_Mutation_p.R47C|SLC38A1_ENST00000549049.1_Missense_Mutation_p.R47C|SLC38A1_ENST00000552197.1_Missense_Mutation_p.R47C	NM_001077484.1|NM_001278387.1|NM_001278388.1|NM_001278389.1|NM_030674.3	NP_001070952.1|NP_001265316.1|NP_001265317.1|NP_001265318.1|NP_109599.3	Q9H2H9	S38A1_HUMAN	solute carrier family 38, member 1	47					amino acid transmembrane transport (GO:0003333)|amino acid transport (GO:0006865)|ion transport (GO:0006811)|neurotransmitter uptake (GO:0001504)|neutral amino acid transport (GO:0015804)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neutral amino acid transmembrane transporter activity (GO:0015175)|sodium:amino acid symporter activity (GO:0005283)			NS(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)|skin(2)	23	Lung SC(27;0.137)|Renal(347;0.236)		all cancers(1;0.00805)|OV - Ovarian serous cystadenocarcinoma(5;0.0106)|Epithelial(2;0.0344)			CTACTTTCACGATCAGAAATA	0.284																																																	0								ENSG00000111371						109.0	104.0	105.0					12																	46623406		1818	4078	5896	SLC38A1	SO:0001583	missense	0			-	HGNC	AF271070	CCDS41774.1, CCDS61106.1	12q13.11	2013-05-22				ENSG00000111371		"""Solute carriers"""	13447	protein-coding gene	gene with protein product		608490				10891391	Standard	NM_030674		Approved	ATA1, NAT2, SAT1	uc001rpc.3	Q9H2H9		ENST00000398637.5:c.139C>T	12.37:g.46623406G>A	ENSP00000381634:p.Arg47Cys	Somatic	0	42	0.00		0.41568620468393047	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	27	10.00	Q8NC61|Q8NCF8|Q96JX2|Q9H2Q2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_AA_transpt_TM	p.R47C	ENST00000398637.5	37	c.139	CCDS41774.1	12	.	.	.	.	.	.	.	.	.	.	G	20.5	3.998963	0.74818	.	.	ENSG00000111371	ENST00000549049;ENST00000439706;ENST00000398637;ENST00000546893;ENST00000552197;ENST00000550173	T;T;T;T;T	0.07567	3.34;3.34;3.34;3.34;3.18	5.32	4.38	0.52667	.	0.208899	0.33916	N	0.004429	T	0.08492	0.0211	N	0.08118	0	0.49915	D	0.99983	B;P;D	0.64830	0.103;0.584;0.994	B;B;P	0.50440	0.006;0.059;0.641	T	0.37820	-0.9689	10	0.56958	D	0.05	-12.4356	16.6068	0.84832	0.0:0.1297:0.8703:0.0	.	47;47;47	B5MEC5;F8VX04;Q9H2H9	.;.;S38A1_HUMAN	C	47	ENSP00000449607:R47C;ENSP00000398142:R47C;ENSP00000381634:R47C;ENSP00000447853:R47C;ENSP00000449756:R47C	ENSP00000381634:R47C	R	-	1	0	SLC38A1	44909673	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.622000	0.54217	2.661000	0.90470	0.650000	0.86243	CGT	-	NULL		0.284	SLC38A1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC38A1	protein_coding	OTTHUMT00000404218.2	G		-		46623406	-1	no_errors	ENST00000398637	ensembl	human	known	74_37	missense	SNP	0.998	A
SMCR2	140768	genome.wustl.edu	37	17	17578726	17578726	+	lincRNA	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr17:17578726G>A	ENST00000456090.2	-	0	386									Smith-Magenis syndrome chromosome region, candidate 2 (non-protein coding)																		CTTGAAGGAAGGAAGCCCAAG	0.562																																																	0								ENSG00000223979																																			SMCR2			0			-	HGNC	AI821758		17p11.2	2012-10-16	2011-06-10		ENSG00000223979	ENSG00000223979		"""Long non-coding RNAs"""	17914	non-coding RNA	RNA, long non-coding			"""Smith-Magenis syndrome chromosome region, candidate 2"""			11997338	Standard			Approved				OTTHUMG00000059291		17.37:g.17578726G>A		Somatic	0	48	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	25	24.24		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000456090.2	37	NULL		17																																																																																			-	-		0.562	SMCR2-001	KNOWN	basic	lincRNA	SMCR2	lincRNA	OTTHUMT00000131667.2	G		-		17578726	-1	no_errors	ENST00000456090	ensembl	human	known	74_37	rna	SNP	0.154	A
SYT15	83849	genome.wustl.edu	37	10	46965865	46965865	+	Silent	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr10:46965865G>A	ENST00000374321.4	-	5	738	c.672C>T	c.(670-672)acC>acT	p.T224T	SYT15_ENST00000374323.4_Silent_p.T277T|SYT15_ENST00000374325.3_Silent_p.T224T|RP11-38L15.3_ENST00000506914.1_RNA|SYT15_ENST00000503753.1_Silent_p.T224T	NM_031912.4	NP_114118.2	Q9BQS2	SYT15_HUMAN	synaptotagmin XV	224	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				cervix(1)|endometrium(5)|kidney(2)|lung(5)	13						GCACCCTCTGGGTGATGGTCT	0.592																																					Ovarian(57;1152 1428 19651 37745)												0								ENSG00000204176						39.0	42.0	41.0					10																	46965865		2121	4238	6359	SYT15	SO:0001819	synonymous_variant	0			-	HGNC	AJ303363	CCDS73103.1, CCDS73104.1	10q11.1	2013-01-21			ENSG00000204176	ENSG00000204176		"""Synaptotagmins"""	17167	protein-coding gene	gene with protein product		608081				11543631	Standard	NM_031912		Approved	CHR10SYT	uc001jea.3	Q9BQS2	OTTHUMG00000018103	ENST00000374321.4:c.672C>T	10.37:g.46965865G>A		Somatic	0	68	0.00		0.41568620468393047	12	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	32	11.11	A5D6W8|Q5VY53|Q5VY55|Q7Z439|Q7Z440	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	p.T277	ENST00000374321.4	37	c.831	CCDS44376.1	10																																																																																			-	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom		0.592	SYT15-004	KNOWN	basic|appris_principal|CCDS	protein_coding	SYT15	protein_coding	OTTHUMT00000367008.1	G	NM_031912	-		46965865	-1	no_errors	ENST00000374323	ensembl	human	known	74_37	silent	SNP	0.031	A
OR11A1	26531	genome.wustl.edu	37	6	29395205	29395205	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr6:29395205C>T	ENST00000377149.1	-	5	686	c.214G>A	c.(214-216)Gat>Aat	p.D72N	OR5V1_ENST00000377154.1_Intron|OR11A1_ENST00000377147.2_Missense_Mutation_p.D72N|OR11A1_ENST00000377148.1_Missense_Mutation_p.D72N			Q9GZK7	O11A1_HUMAN	olfactory receptor, family 11, subfamily A, member 1	72						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|large_intestine(1)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	19						TAGAGAATATCCAGGAAGGAC	0.458																																																	0								ENSG00000204694						79.0	73.0	75.0					6																	29395205		1511	2709	4220	OR11A1	SO:0001583	missense	0			-	HGNC		CCDS34363.1	6p22.2-p21.31	2014-02-19	2002-02-28		ENSG00000204694	ENSG00000204694		"""GPCR / Class A : Olfactory receptors"""	8176	protein-coding gene	gene with protein product			"""olfactory receptor, family 11, subfamily A, member 2"""	OR11A2			Standard	XM_005249001		Approved	hs6M1-18	uc003nmg.3	Q9GZK7	OTTHUMG00000031225	ENST00000377149.1:c.214G>A	6.37:g.29395205C>T	ENSP00000366354:p.Asp72Asn	Somatic	0	38	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	15	34.78	A2BF33|A6NFQ3|B0S7T2|Q5ST16|Q9GZK8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_GPCR_Rhodpsn,prints_Olfact_rcpt,pfscan_GPCR_Rhodpsn_7TM	p.D72N	ENST00000377149.1	37	c.214	CCDS34363.1	6	.	.	.	.	.	.	.	.	.	.	C	18.27	3.586864	0.66105	.	.	ENSG00000204694	ENST00000377148;ENST00000377149;ENST00000377147	T;T;T	0.01165	5.24;5.24;5.24	3.81	3.81	0.43845	GPCR, rhodopsin-like superfamily (1);	0.248228	0.20658	U	0.088078	T	0.02047	0.0064	M	0.89214	3.015	0.32989	D	0.524751	P	0.41710	0.76	P	0.45037	0.467	T	0.03662	-1.1015	10	0.87932	D	0	-12.1833	14.4235	0.67200	0.0:1.0:0.0:0.0	.	72	Q9GZK7	O11A1_HUMAN	N	72	ENSP00000366353:D72N;ENSP00000366354:D72N;ENSP00000366352:D72N	ENSP00000366352:D72N	D	-	1	0	OR11A1	29503184	0.890000	0.30428	0.991000	0.47740	0.419000	0.31324	3.223000	0.51231	1.931000	0.55961	0.411000	0.27672	GAT	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.458	OR11A1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	OR11A1	protein_coding	OTTHUMT00000193778.1	C		-		29395205	-1	no_errors	ENST00000377147	ensembl	human	known	74_37	missense	SNP	1.000	T
PCLO	27445	genome.wustl.edu	37	7	82764729	82764729	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr7:82764729G>A	ENST00000333891.9	-	3	2474	c.2137C>T	c.(2137-2139)Cat>Tat	p.H713Y	PCLO_ENST00000423517.2_Missense_Mutation_p.H713Y	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						GGAGAGCCATGAAGGGTTGGT	0.537																																																	0								ENSG00000186472						164.0	161.0	162.0					7																	82764729		1965	4158	6123	PCLO	SO:0001583	missense	0			-	HGNC	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.2137C>T	7.37:g.82764729G>A	ENSP00000334319:p.His713Tyr	Somatic	0	73	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	38	17.39		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_piccolo,pfam_C2_dom,pfam_PDZ,superfamily_C2_dom,superfamily_PDZ,superfamily_Znf_FYVE_PHD,smart_PDZ,smart_C2_dom,pfscan_C2_dom,pfscan_PDZ	p.H713Y	ENST00000333891.9	37	c.2137	CCDS47630.1	7	.	.	.	.	.	.	.	.	.	.	G	7.072	0.568444	0.13560	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517	T;T	0.15952	2.38;2.38	5.79	4.91	0.64330	.	.	.	.	.	T	0.13798	0.0334	L	0.29908	0.895	0.80722	D	1	P;P	0.47604	0.898;0.898	B;B	0.40165	0.321;0.321	T	0.01405	-1.1363	9	0.87932	D	0	.	12.5743	0.56355	0.0761:0.0:0.9239:0.0	.	713;713	Q9Y6V0-5;Q9Y6V0-6	.;.	Y	659;713;713	ENSP00000334319:H713Y;ENSP00000388393:H713Y	ENSP00000334319:H713Y	H	-	1	0	PCLO	82602665	0.270000	0.24152	0.974000	0.42286	0.360000	0.29518	1.801000	0.38843	2.735000	0.93741	0.591000	0.81541	CAT	-	NULL		0.537	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PCLO	protein_coding	OTTHUMT00000337368.5	G	NM_014510	-		82764729	-1	no_errors	ENST00000333891	ensembl	human	known	74_37	missense	SNP	0.888	A
EXPH5	23086	genome.wustl.edu	37	11	108381888	108381888	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr11:108381888C>T	ENST00000265843.4	-	6	4456	c.4346G>A	c.(4345-4347)gGg>gAg	p.G1449E	EXPH5_ENST00000524840.1_5'Flank|EXPH5_ENST00000525344.1_Missense_Mutation_p.G1442E|EXPH5_ENST00000428840.1_Missense_Mutation_p.G1373E|EXPH5_ENST00000443411.1_Missense_Mutation_p.G1261E	NM_015065.2	NP_055880	Q8NEV8	EXPH5_HUMAN	exophilin 5	1449					intracellular protein transport (GO:0006886)|keratinocyte development (GO:0003334)|multivesicular body sorting pathway (GO:0071985)|positive regulation of exocytosis (GO:0045921)|positive regulation of protein secretion (GO:0050714)	endosome (GO:0005768)	Rab GTPase binding (GO:0017137)			breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(13)|liver(1)|lung(34)|ovary(3)|pancreas(2)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(1)	91		all_cancers(61;3.99e-08)|Acute lymphoblastic leukemia(157;3.97e-05)|Melanoma(852;4.04e-05)|all_epithelial(67;0.000116)|all_hematologic(158;0.000315)|Breast(348;0.104)|all_neural(303;0.16)		Epithelial(105;8.1e-06)|BRCA - Breast invasive adenocarcinoma(274;1.22e-05)|all cancers(92;0.000129)|OV - Ovarian serous cystadenocarcinoma(223;0.11)|Colorectal(284;0.184)		TCTACCACTCCCTGTACACTC	0.458																																																	0								ENSG00000110723						84.0	77.0	79.0					11																	108381888		2201	4298	6499	EXPH5	SO:0001583	missense	0			-	HGNC		CCDS8341.1	11q22.3	2008-02-05			ENSG00000110723	ENSG00000110723			30578	protein-coding gene	gene with protein product	"""synaptotagmin-like homologue lacking C2 domains b"""	612878				9734811, 11773082	Standard	NM_015065		Approved	SLAC2-B	uc001pkk.3	Q8NEV8	OTTHUMG00000166536	ENST00000265843.4:c.4346G>A	11.37:g.108381888C>T	ENSP00000265843:p.Gly1449Glu	Somatic	0	44	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	14	30.00	Q2KHM1|Q9Y4D6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_Znf_FYVE_PHD,pfscan_Znf_FYVE-typ	p.G1449E	ENST00000265843.4	37	c.4346	CCDS8341.1	11	.	.	.	.	.	.	.	.	.	.	C	15.95	2.984982	0.53934	.	.	ENSG00000110723	ENST00000265843;ENST00000428840;ENST00000443411;ENST00000525344;ENST00000526312	T;T;T;T;T	0.03094	4.27;4.2;4.05;4.27;4.11	5.73	-1.43	0.08884	.	0.889159	0.09667	N	0.771653	T	0.02929	0.0087	L	0.60455	1.87	0.09310	N	1	B	0.27700	0.186	B	0.25759	0.063	T	0.47394	-0.9121	10	0.02654	T	1	0.1292	1.6895	0.02849	0.1159:0.3762:0.2268:0.281	.	1449	Q8NEV8	EXPH5_HUMAN	E	1449;1373;1261;1442;1373	ENSP00000265843:G1449E;ENSP00000391966:G1373E;ENSP00000411390:G1261E;ENSP00000432546:G1442E;ENSP00000432683:G1373E	ENSP00000265843:G1449E	G	-	2	0	EXPH5	107887098	0.000000	0.05858	0.003000	0.11579	0.042000	0.13812	-0.550000	0.06034	0.071000	0.16664	0.591000	0.81541	GGG	-	NULL		0.458	EXPH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EXPH5	protein_coding	OTTHUMT00000390279.1	C	NM_015065	-		108381888	-1	no_errors	ENST00000265843	ensembl	human	known	74_37	missense	SNP	0.000	T
SUPT5H	6829	genome.wustl.edu	37	19	39961028	39961028	+	Frame_Shift_Del	DEL	C	C	-			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr19:39961028delC	ENST00000599117.1	+	19	1909	c.1542delC	c.(1540-1542)ctcfs	p.L514fs	SUPT5H_ENST00000432763.2_Frame_Shift_Del_p.L514fs|SUPT5H_ENST00000402194.2_Frame_Shift_Del_p.L510fs|SUPT5H_ENST00000598725.1_Frame_Shift_Del_p.L514fs|SUPT5H_ENST00000359191.6_Frame_Shift_Del_p.L510fs			O00267	SPT5H_HUMAN	suppressor of Ty 5 homolog (S. cerevisiae)	514					7-methylguanosine mRNA capping (GO:0006370)|cell cycle (GO:0007049)|chromatin remodeling (GO:0006338)|DNA-templated transcription, elongation (GO:0006354)|gene expression (GO:0010467)|negative regulation of DNA-templated transcription, elongation (GO:0032785)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of macroautophagy (GO:0016239)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|response to organic substance (GO:0010033)|single stranded viral RNA replication via double stranded DNA intermediate (GO:0039692)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	DSIF complex (GO:0032044)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)			breast(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(13)|lung(12)|ovary(3)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	51	all_cancers(60;6.69e-07)|all_lung(34;2.66e-08)|Lung NSC(34;3e-08)|all_epithelial(25;1.57e-06)|Ovarian(47;0.159)		Epithelial(26;3.9e-26)|all cancers(26;1.35e-23)|LUSC - Lung squamous cell carcinoma(53;0.000657)			TGAAGGTGCTCCCCCGGGACC	0.647																																																	0								ENSG00000196235						81.0	80.0	80.0					19																	39961028		2203	4300	6503	SUPT5H	SO:0001589	frameshift_variant	0				HGNC	U56402	CCDS12536.1, CCDS46072.1	19q13	2008-07-22	2001-11-28			ENSG00000196235			11469	protein-coding gene	gene with protein product		602102	"""suppressor of Ty (S.cerevisiae) 5 homolog"""			8975720	Standard	NM_003169		Approved	SPT5H, SPT5, FLJ34157	uc002olp.4	O00267		ENST00000599117.1:c.1542delC	19.37:g.39961028delC	ENSP00000470252:p.Leu514fs	Somatic	0	44	0.00		0.41568620468393047	54	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	33	23.26	O43279|Q59G52|Q99639	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_TF_Spt5_NGN-domain,pfam_KOW,pfam_Spt5_N,superfamily_Translation_prot_SH3-like,smart_Transcrpt_antiterm_NusG_N_dom,smart_KOW,pirsf_TF_Spt5	p.R516fs	ENST00000599117.1	37	c.1542	CCDS12536.1	19																																																																																			-	superfamily_Translation_prot_SH3-like,pirsf_TF_Spt5		0.647	SUPT5H-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SUPT5H	protein_coding	OTTHUMT00000464918.1	C	NM_003169			39961028	+1	no_errors	ENST00000432763	ensembl	human	known	74_37	frame_shift_del	DEL	0.993	-
RIOK3	8780	genome.wustl.edu	37	18	21055006	21055006	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr18:21055006C>T	ENST00000339486.3	+	9	1725	c.1108C>T	c.(1108-1110)Cct>Tct	p.P370S	RIOK3_ENST00000577501.1_Missense_Mutation_p.P370S|RIOK3_ENST00000581585.1_Missense_Mutation_p.P354S	NM_003831.3	NP_003822.2	O14730	RIOK3_HUMAN	RIO kinase 3	370	Protein kinase.				chromosome segregation (GO:0007059)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(1)|kidney(3)|large_intestine(1)|lung(3)|ovary(2)	10	all_cancers(21;0.000106)|all_epithelial(16;6.74e-07)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0202)|Ovarian(20;0.127)					AGTTCCAGCCCCTAAATTAAA	0.353																																																	0								ENSG00000101782						74.0	73.0	73.0					18																	21055006		2203	4300	6503	RIOK3	SO:0001583	missense	0			-	HGNC	AF013591	CCDS11877.1	18q11.2	2012-12-10	2012-12-10	2003-06-25	ENSG00000101782	ENSG00000101782			11451	protein-coding gene	gene with protein product		603579	"""sudD (suppressor of bimD6, Aspergillus nidulans) homolog"", ""RIO kinase 3 (yeast)"""	SUDD		9602165	Standard	NM_003831		Approved		uc002kui.4	O14730	OTTHUMG00000131813	ENST00000339486.3:c.1108C>T	18.37:g.21055006C>T	ENSP00000341874:p.Pro370Ser	Somatic	0	94	0.00		0.41568620468393047	17	32.00	8	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	67	16.25	Q8IXN9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RIO-like_kinase,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_RIO_kinase,pirsf_Ser/Thr_kinase_Rio3	p.P370S	ENST00000339486.3	37	c.1108	CCDS11877.1	18	.	.	.	.	.	.	.	.	.	.	C	32	5.132530	0.94473	.	.	ENSG00000101782	ENST00000339486	T	0.07567	3.18	5.98	5.98	0.97165	RIO kinase (1);Protein kinase-like domain (1);RIO-like kinase (1);	0.000000	0.85682	D	0.000000	T	0.41328	0.1154	M	0.91818	3.245	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.998;0.996;0.993;0.996	T	0.45585	-0.9251	10	0.87932	D	0	-28.0463	20.521	0.99222	0.0:1.0:0.0:0.0	.	114;354;370;370	E7ESK5;B4E1Q4;O14730-2;O14730	.;.;.;RIOK3_HUMAN	S	370	ENSP00000341874:P370S	ENSP00000341874:P370S	P	+	1	0	RIOK3	19309004	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.394000	0.79862	2.861000	0.98227	0.650000	0.86243	CCT	-	pfam_RIO-like_kinase,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_RIO_kinase,pirsf_Ser/Thr_kinase_Rio3		0.353	RIOK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RIOK3	protein_coding	OTTHUMT00000254756.1	C	NM_003831	-		21055006	+1	no_errors	ENST00000339486	ensembl	human	known	74_37	missense	SNP	1.000	T
CAPN3	825	genome.wustl.edu	37	15	42678474	42678474	+	Silent	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr15:42678474C>T	ENST00000397163.3	+	3	708	c.489C>T	c.(487-489)ttC>ttT	p.F163F	CAPN3_ENST00000357568.3_Silent_p.F163F|RP11-164J13.1_ENST00000495723.1_RNA|CAPN3_ENST00000356316.3_Silent_p.F76F|CAPN3_ENST00000318023.7_Silent_p.F163F|CAPN3_ENST00000349748.3_Silent_p.F163F	NM_000070.2	NP_000061.1	P20807	CAN3_HUMAN	calpain 3, (p94)	163	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				apoptotic process (GO:0006915)|autolysis (GO:0001896)|cellular response to calcium ion (GO:0071277)|cellular response to salt stress (GO:0071472)|G1 to G0 transition involved in cell differentiation (GO:0070315)|muscle cell cellular homeostasis (GO:0046716)|muscle organ development (GO:0007517)|muscle structure development (GO:0061061)|myofibril assembly (GO:0030239)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of proteolysis (GO:0045862)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of satellite cell activation involved in skeletal muscle regeneration (GO:0014718)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein localization to membrane (GO:0072657)|proteolysis (GO:0006508)|regulation of catalytic activity (GO:0050790)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of myoblast differentiation (GO:0045661)|response to calcium ion (GO:0051592)|response to muscle activity (GO:0014850)|sarcomere organization (GO:0045214)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|myofibril (GO:0030016)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|T-tubule (GO:0030315)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|catalytic activity (GO:0003824)|cysteine-type peptidase activity (GO:0008234)|ligase regulator activity (GO:0055103)|peptidase activity (GO:0008233)|protein complex scaffold (GO:0032947)|signal transducer activity (GO:0004871)|sodium ion binding (GO:0031402)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(21)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	47		all_cancers(109;1.65e-16)|all_epithelial(112;8.34e-15)|Lung NSC(122;3.56e-09)|all_lung(180;1.68e-08)|Melanoma(134;0.0574)|Colorectal(260;0.152)		GBM - Glioblastoma multiforme(94;7.36e-07)		CAGGGATCTTCCACTTCCAGG	0.542																																																	0								ENSG00000092529						115.0	99.0	104.0					15																	42678474		2203	4299	6502	CAPN3	SO:0001819	synonymous_variant	0			-	HGNC	X85030	CCDS10085.1, CCDS10086.1, CCDS32207.1, CCDS45245.1, CCDS45246.1	15q15.1	2014-09-17			ENSG00000092529	ENSG00000092529	3.4.22.52	"""EF-hand domain containing"""	1480	protein-coding gene	gene with protein product		114240		LGMD2, LGMD2A		2555341, 7720071	Standard	NM_024344		Approved	CANP3, p94, nCL-1	uc001zpn.1	P20807	OTTHUMG00000130619	ENST00000397163.3:c.489C>T	15.37:g.42678474C>T		Somatic	0	42	0.00		0.41568620468393047	4	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	31	27.91	A6H8K6|Q7L4R0|Q9BQC8|Q9BTU4|Q9Y5S6|Q9Y5S7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_C2_calpain_cat,pfam_Calpain_domain_III,superfamily_Calpain_domain_III,smart_Peptidase_C2_calpain_cat,smart_Calpain_III,smart_EF_hand_dom,pfscan_EF_hand_dom,pfscan_Peptidase_C2_calpain_cat,prints_Calpain_cysteine_protease	p.F163	ENST00000397163.3	37	c.489	CCDS45245.1	15																																																																																			-	pfam_Peptidase_C2_calpain_cat,smart_Peptidase_C2_calpain_cat,pfscan_Peptidase_C2_calpain_cat,prints_Calpain_cysteine_protease		0.542	CAPN3-009	KNOWN	basic|CCDS	protein_coding	CAPN3	protein_coding	OTTHUMT00000421075.1	C		-		42678474	+1	no_errors	ENST00000397163	ensembl	human	known	74_37	silent	SNP	1.000	T
CEACAM18	729767	genome.wustl.edu	37	19	51981872	51981872	+	5'Flank	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr19:51981872C>T	ENST00000396477.4	+	0	0				CEACAM18_ENST00000451626.1_Silent_p.L53L	NM_001278392.1	NP_001265321.1	A8MTB9	CEA18_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 18											breast(1)|endometrium(4)|large_intestine(3)|lung(8)|skin(1)	17		all_neural(266;0.0529)		GBM - Glioblastoma multiforme(134;0.00148)|OV - Ovarian serous cystadenocarcinoma(262;0.00979)		AGGGACCCCTCCTCCTGGAGG	0.627																																																	0								ENSG00000213822						30.0	35.0	33.0					19																	51981872		1976	4142	6118	CEACAM18	SO:0001631	upstream_gene_variant	0			-	HGNC			19q13.41	2013-01-29				ENSG00000213822		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	31949	protein-coding gene	gene with protein product							Standard	NM_001278392		Approved		uc002pwv.1	A8MTB9			19.37:g.51981872C>T	Exception_encountered	Somatic	0	58	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	57	14.93	C9JN24	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.L53	ENST00000396477.4	37	c.159		19																																																																																			-	NULL		0.627	CEACAM18-001	PUTATIVE	not_organism_supported|basic|appris_candidate	protein_coding	CEACAM18	protein_coding	OTTHUMT00000323114.2	C		-		51981872	+1	no_errors	ENST00000451626	ensembl	human	known	74_37	silent	SNP	0.000	T
ALG12	79087	genome.wustl.edu	37	22	50297507	50297507	+	Silent	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr22:50297507C>T	ENST00000330817.6	-	10	1719	c.1446G>A	c.(1444-1446)gaG>gaA	p.E482E	CITF22-1A6.3_ENST00000610245.1_lincRNA	NM_024105.3	NP_077010.1	Q9BV10	ALG12_HUMAN	ALG12, alpha-1,6-mannosyltransferase	482					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|mannosylation (GO:0097502)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	alpha-1,6-mannosyltransferase activity (GO:0000009)|dol-P-Man:Man(7)GlcNAc(2)-PP-Dol alpha-1,6-mannosyltransferase activity (GO:0052917)			endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|prostate(3)	12		all_cancers(38;8.58e-10)|all_epithelial(38;1.15e-08)|all_lung(38;0.000109)|Lung NSC(38;0.0018)|Breast(42;0.00191)|Ovarian(80;0.0164)|Lung SC(80;0.164)		BRCA - Breast invasive adenocarcinoma(115;0.199)|LUAD - Lung adenocarcinoma(64;0.247)		GGGGGAGCCTCTCCAGAAGCA	0.627																																																	0								ENSG00000182858						51.0	59.0	56.0					22																	50297507		2203	4300	6503	ALG12	SO:0001819	synonymous_variant	0			-	HGNC	AJ303120	CCDS14081.1	22q13.33	2013-02-26	2013-02-26		ENSG00000182858	ENSG00000182858	2.4.1.260	"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"""	19358	protein-coding gene	gene with protein product	"""dolichyl-P-Man:Man(7)GlcNAc(2)-PP-dolichol alpha-1,6-mannosyltransferase"", ""dol-P-Man dependent alpha-1,6-mannosyltransferase"""	607144	"""asparagine-linked glycosylation 12 homolog (yeast, alpha-1,6-mannosyltransferase)"", ""asparagine-linked glycosylation 12, alpha-1,6-mannosyltransferase homolog (S. cerevisiae)"""			11983712	Standard	NM_024105		Approved	ECM39	uc003biy.3	Q9BV10	OTTHUMG00000150289	ENST00000330817.6:c.1446G>A	22.37:g.50297507C>T		Somatic	0	105	0.00		0.41568620468393047	72	17.24	15	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	63	21.25	A6PWM1|Q4KMH4|Q8NG10|Q96AA4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPI_mannosylTrfase	p.E482	ENST00000330817.6	37	c.1446	CCDS14081.1	22	.	.	.	.	.	.	.	.	.	.	C	11.32	1.603097	0.28534	.	.	ENSG00000182858	ENST00000332276	.	.	.	5.41	-0.383	0.12477	.	0.000000	0.85682	D	0.000000	T	0.58481	0.2125	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.56914	-0.7900	6	0.87932	D	0	-9.7553	5.9982	0.19505	0.0:0.3912:0.1322:0.4766	.	.	.	.	K	128	.	ENSP00000329560:E128K	E	-	1	0	ALG12	48683511	0.998000	0.40836	0.236000	0.24074	0.375000	0.29983	0.808000	0.27154	0.025000	0.15241	-0.140000	0.14226	GAG	-	NULL		0.627	ALG12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALG12	protein_coding	OTTHUMT00000317405.2	C	NM_024105	-		50297507	-1	no_errors	ENST00000330817	ensembl	human	known	74_37	silent	SNP	0.643	T
HIVEP2	3097	genome.wustl.edu	37	6	143094200	143094200	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr6:143094200G>A	ENST00000367604.1	-	4	2315	c.1676C>T	c.(1675-1677)tCt>tTt	p.S559F	HIVEP2_ENST00000367603.2_Missense_Mutation_p.S559F|HIVEP2_ENST00000012134.2_Missense_Mutation_p.S559F			P31629	ZEP2_HUMAN	human immunodeficiency virus type I enhancer binding protein 2	559					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S559Y(1)		NS(2)|breast(4)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(19)|lung(35)|ovary(4)|prostate(6)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	100				OV - Ovarian serous cystadenocarcinoma(155;1.61e-05)|GBM - Glioblastoma multiforme(68;0.0102)		TCCTCTCAAAGAAGGAGGAAT	0.468																																					Esophageal Squamous(107;843 1510 13293 16805 42198)												1	Substitution - Missense(1)	large_intestine(1)						ENSG00000010818						90.0	89.0	89.0					6																	143094200		1902	4127	6029	HIVEP2	SO:0001583	missense	0			-	HGNC	M60119	CCDS43510.1	6q23-q24	2013-01-08	2001-11-28		ENSG00000010818	ENSG00000010818		"""Zinc fingers, C2H2-type"""	4921	protein-coding gene	gene with protein product	"""c-myc intron binding protein 1"""	143054	"""human immunodeficiency virus type I enhancer-binding protein 2"""			1733857, 2022670	Standard	NM_006734		Approved	MBP-2, HIV-EP2, MIBP1, ZAS2, Schnurri-2, ZNF40B	uc003qjd.3	P31629	OTTHUMG00000015713	ENST00000367604.1:c.1676C>T	6.37:g.143094200G>A	ENSP00000356576:p.Ser559Phe	Somatic	0	38	0.00		0.41568620468393047	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	31	18.42	Q02646|Q5THT5|Q9NS05	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Znf_C2H2_jaz,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S559F	ENST00000367604.1	37	c.1676	CCDS43510.1	6	.	.	.	.	.	.	.	.	.	.	G	14.19	2.462779	0.43736	.	.	ENSG00000010818	ENST00000367604;ENST00000367603;ENST00000012134	T;T;T	0.11930	2.73;2.73;2.73	5.48	5.48	0.80851	.	0.374019	0.31624	N	0.007324	T	0.08935	0.0221	L	0.53249	1.67	0.31908	N	0.615116	P	0.49961	0.93	B	0.41723	0.365	T	0.03240	-1.1057	10	0.72032	D	0.01	-21.5276	14.217	0.65800	0.0:0.0:0.8507:0.1493	.	559	P31629	ZEP2_HUMAN	F	559	ENSP00000356576:S559F;ENSP00000356575:S559F;ENSP00000012134:S559F	ENSP00000012134:S559F	S	-	2	0	HIVEP2	143135893	0.981000	0.34729	1.000000	0.80357	0.996000	0.88848	3.893000	0.56243	2.566000	0.86566	0.655000	0.94253	TCT	-	NULL		0.468	HIVEP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIVEP2	protein_coding	OTTHUMT00000042495.1	G		-		143094200	-1	no_errors	ENST00000012134	ensembl	human	known	74_37	missense	SNP	0.998	A
RIOK3	8780	genome.wustl.edu	37	18	21055005	21055005	+	Silent	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr18:21055005C>T	ENST00000339486.3	+	9	1724	c.1107C>T	c.(1105-1107)gcC>gcT	p.A369A	RIOK3_ENST00000577501.1_Silent_p.A369A|RIOK3_ENST00000581585.1_Silent_p.A353A	NM_003831.3	NP_003822.2	O14730	RIOK3_HUMAN	RIO kinase 3	369	Protein kinase.				chromosome segregation (GO:0007059)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(1)|kidney(3)|large_intestine(1)|lung(3)|ovary(2)	10	all_cancers(21;0.000106)|all_epithelial(16;6.74e-07)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0202)|Ovarian(20;0.127)					AAGTTCCAGCCCCTAAATTAA	0.348																																																	0								ENSG00000101782						75.0	73.0	74.0					18																	21055005		2203	4300	6503	RIOK3	SO:0001819	synonymous_variant	0			-	HGNC	AF013591	CCDS11877.1	18q11.2	2012-12-10	2012-12-10	2003-06-25	ENSG00000101782	ENSG00000101782			11451	protein-coding gene	gene with protein product		603579	"""sudD (suppressor of bimD6, Aspergillus nidulans) homolog"", ""RIO kinase 3 (yeast)"""	SUDD		9602165	Standard	NM_003831		Approved		uc002kui.4	O14730	OTTHUMG00000131813	ENST00000339486.3:c.1107C>T	18.37:g.21055005C>T		Somatic	0	94	0.00		0.41568620468393047	17	26.09	6	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	67	16.25	Q8IXN9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_RIO-like_kinase,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_RIO_kinase,pirsf_Ser/Thr_kinase_Rio3	p.A369	ENST00000339486.3	37	c.1107	CCDS11877.1	18																																																																																			-	pfam_RIO-like_kinase,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_RIO_kinase,pirsf_Ser/Thr_kinase_Rio3		0.348	RIOK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RIOK3	protein_coding	OTTHUMT00000254756.1	C	NM_003831	-		21055005	+1	no_errors	ENST00000339486	ensembl	human	known	74_37	silent	SNP	0.971	T
LYZL2	119180	genome.wustl.edu	37	10	30900941	30900941	+	Silent	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr10:30900941C>T	ENST00000375318.2	-	5	584	c.528G>A	c.(526-528)aaG>aaA	p.K176K		NM_183058.2	NP_898881.2	Q7Z4W2	LYZL2_HUMAN	lysozyme-like 2	130					cell wall macromolecule catabolic process (GO:0016998)	extracellular region (GO:0005576)	lysozyme activity (GO:0003796)			NS(2)|central_nervous_system(1)|large_intestine(1)|lung(14)|prostate(1)	19		Prostate(175;0.151)				CACAGTGTTTCTTCCAGCCTT	0.493																																																	0								ENSG00000151033						249.0	229.0	236.0					10																	30900941		2203	4300	6503	LYZL2	SO:0001819	synonymous_variant	0			-	HGNC	AF139543	CCDS7167.2	10p11.23	2009-12-04			ENSG00000151033	ENSG00000151033			29613	protein-coding gene	gene with protein product		612748					Standard	NM_183058		Approved		uc001ivk.3	Q7Z4W2	OTTHUMG00000017898	ENST00000375318.2:c.528G>A	10.37:g.30900941C>T		Somatic	0	111	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	46	28.12	Q6NZ69	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Glyco_hydro_22,superfamily_Lysozyme-like_dom,smart_Glyco_hydro_22,prints_Glyco_hydro_22,prints_Glyco_hydro_22_lys	p.K176	ENST00000375318.2	37	c.528	CCDS7167.2	10																																																																																			-	pfam_Glyco_hydro_22,superfamily_Lysozyme-like_dom,smart_Glyco_hydro_22,prints_Glyco_hydro_22,prints_Glyco_hydro_22_lys		0.493	LYZL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LYZL2	protein_coding	OTTHUMT00000047434.1	C	NM_183058	-		30900941	-1	no_errors	ENST00000375318	ensembl	human	known	74_37	silent	SNP	0.982	T
CST9L	128821	genome.wustl.edu	37	20	23548949	23548949	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr20:23548949G>A	ENST00000376979.3	-	1	437	c.139C>T	c.(139-141)Ctc>Ttc	p.L47F		NM_080610.2	NP_542177.1	Q9H4G1	CST9L_HUMAN	cystatin 9-like	47						extracellular region (GO:0005576)	cysteine-type endopeptidase inhibitor activity (GO:0004869)			breast(1)|endometrium(1)|large_intestine(1)|lung(4)|prostate(1)	8	Colorectal(13;0.0431)|Lung NSC(19;0.235)					GTGGCAGGGAGGTAACGAGCC	0.517																																																	0								ENSG00000101435						159.0	123.0	135.0					20																	23548949		2203	4300	6503	CST9L	SO:0001583	missense	0			-	HGNC		CCDS13157.1	20p11.21	2012-08-14	2008-03-06		ENSG00000101435	ENSG00000101435			16233	protein-coding gene	gene with protein product			"""cystatin 9 (mouse)-like"""			20565543	Standard	NM_080610		Approved	bA218C14.1, CTES7B	uc002wtk.4	Q9H4G1	OTTHUMG00000032073	ENST00000376979.3:c.139C>T	20.37:g.23548949G>A	ENSP00000366178:p.Leu47Phe	Somatic	0	84	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	35	28.57	B2R5A1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_inh_cystat	p.L47F	ENST00000376979.3	37	c.139	CCDS13157.1	20	.	.	.	.	.	.	.	.	.	.	G	2.015	-0.426236	0.04701	.	.	ENSG00000101435	ENST00000376979	T	0.13307	2.6	1.36	-0.841	0.10752	Proteinase inhibitor I25, cystatin (1);	1.562760	0.04631	N	0.403623	T	0.07324	0.0185	N	0.11698	0.16	0.09310	N	1	B	0.17268	0.021	B	0.22386	0.039	T	0.37526	-0.9702	10	0.20046	T	0.44	.	3.9494	0.09363	0.4735:0.0:0.5265:0.0	.	47	Q9H4G1	CST9L_HUMAN	F	47	ENSP00000366178:L47F	ENSP00000366178:L47F	L	-	1	0	CST9L	23496949	0.000000	0.05858	0.006000	0.13384	0.771000	0.43674	-0.615000	0.05597	-0.264000	0.09365	0.313000	0.20887	CTC	-	NULL		0.517	CST9L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CST9L	protein_coding	OTTHUMT00000078338.1	G	NM_080610	-		23548949	-1	no_errors	ENST00000376979	ensembl	human	known	74_37	missense	SNP	0.008	A
PCGF6	84108	genome.wustl.edu	37	10	105063591	105063591	+	3'UTR	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr10:105063591G>A	ENST00000369847.3	-	0	1191				PCGF6_ENST00000337211.4_3'UTR|PCGF6_ENST00000490296.1_5'UTR	NM_001011663.1	NP_001011663.1	Q9BYE7	PCGF6_HUMAN	polycomb group ring finger 6						negative regulation of transcription, DNA-templated (GO:0045892)	nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(3)	8		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;2.57e-09)|all cancers(201;7.21e-08)|BRCA - Breast invasive adenocarcinoma(275;0.205)		TACATTTCATGGAAATCTTTG	0.388																																																	0								ENSG00000156374						39.0	29.0	32.0					10																	105063591		692	1586	2278	PCGF6	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AB047006	CCDS7546.1, CCDS31275.1	10q24.33	2013-01-09	2005-01-17	2005-01-19	ENSG00000156374	ENSG00000156374		"""RING-type (C3HC4) zinc fingers"", ""Polycomb group ring fingers"""	21156	protein-coding gene	gene with protein product		607816	"""ring finger protein 134"""	RNF134		12167161	Standard	NM_032154		Approved	MBLR	uc001kwt.3	Q9BYE7	OTTHUMG00000018982	ENST00000369847.3:c.*71C>T	10.37:g.105063591G>A		Somatic	0	78	0.00		0.41568620468393047	14	33.33	7	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	31	27.91	A8K3R4|Q5SYD1|Q5SYD6|Q96ID9|Q96SJ1	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000369847.3	37	NULL	CCDS31275.1	10																																																																																			-	-		0.388	PCGF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCGF6	protein_coding	OTTHUMT00000050132.1	G	NM_032154	-		105063591	-1	no_errors	ENST00000490296	ensembl	human	known	74_37	rna	SNP	0.001	A
CHD9	80205	genome.wustl.edu	37	16	53326964	53326964	+	Splice_Site	SNP	G	G	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr16:53326964G>T	ENST00000398510.3	+	28	5597	c.5510G>T	c.(5509-5511)aGa>aTa	p.R1837I	CHD9_ENST00000566029.1_Splice_Site_p.R1837I|CHD9_ENST00000564845.1_Splice_Site_p.R1837I|CHD9_ENST00000447540.1_Splice_Site_p.R1837I			Q3L8U1	CHD9_HUMAN	chromodomain helicase DNA binding protein 9	1837					cellular lipid metabolic process (GO:0044255)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(21)|lung(32)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	78		all_cancers(37;0.0212)				AGACAGCAAAGGTAAGACAAT	0.378																																																	0								ENSG00000177200						45.0	39.0	41.0					16																	53326964		1867	4107	5974	CHD9	SO:0001630	splice_region_variant	0			-	HGNC	AK022240	CCDS45485.1	16q12.2	2006-04-12				ENSG00000177200			25701	protein-coding gene	gene with protein product						9205841	Standard	XM_005256168		Approved	FLJ12178, KIAA0308, BC022889	uc002egy.3	Q3L8U1		ENST00000398510.3:c.5510+1G>T	16.37:g.53326964G>T		Somatic	0	44	0.00		0.41568620468393047	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	24	11.11	B2RTU2|B9ZVQ0|O15025|Q1WF12|Q6DTK9|Q9H9V7|Q9UHM2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SNF2_N,pfam_BRK_domain,pfam_Chromo_domain,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,smart_BRK_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.R1837I	ENST00000398510.3	37	c.5510		16	.	.	.	.	.	.	.	.	.	.	G	31	5.071650	0.93950	.	.	ENSG00000177200	ENST00000447540;ENST00000398510;ENST00000450543	D;D	0.92911	-3.13;-3.13	5.35	5.35	0.76521	.	0.000000	0.64402	D	0.000010	D	0.96528	0.8867	M	0.85197	2.74	0.80722	D	1	D;D;D;D	0.71674	0.995;0.998;0.995;0.997	D;D;D;D	0.78314	0.979;0.986;0.979;0.991	D	0.96993	0.9723	10	0.87932	D	0	-14.7544	19.0531	0.93053	0.0:0.0:1.0:0.0	.	205;1837;1837;1837	C9JR69;Q3L8U1-3;Q3L8U1;Q3L8U1-2	.;.;CHD9_HUMAN;.	I	1837;1837;205	ENSP00000396345:R1837I;ENSP00000381522:R1837I	ENSP00000381522:R1837I	R	+	2	0	CHD9	51884465	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.322000	0.96357	2.500000	0.84329	0.591000	0.81541	AGA	-	NULL		0.378	CHD9-020	KNOWN	basic	protein_coding	CHD9	protein_coding	OTTHUMT00000422345.1	G	NM_025134	-	Missense_Mutation	53326964	+1	no_errors	ENST00000398510	ensembl	human	known	74_37	missense	SNP	1.000	T
RAB11FIP1	80223	genome.wustl.edu	37	8	37732414	37732414	+	Missense_Mutation	SNP	G	G	C			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr8:37732414G>C	ENST00000330843.4	-	3	1253	c.1241C>G	c.(1240-1242)cCc>cGc	p.P414R	RAB11FIP1_ENST00000522727.1_Missense_Mutation_p.P266R|RAB11FIP1_ENST00000523182.1_5'Flank|RAB11FIP1_ENST00000287263.4_Missense_Mutation_p.P414R|RAB11FIP1_ENST00000524118.1_Missense_Mutation_p.P266R	NM_001002814.2	NP_001002814.2	Q6WKZ4	RFIP1_HUMAN	RAB11 family interacting protein 1 (class I)	414					protein transport (GO:0015031)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)				NS(1)|breast(1)|central_nervous_system(4)|endometrium(3)|large_intestine(6)|lung(20)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	49		Lung NSC(58;0.118)|all_lung(54;0.195)	LUSC - Lung squamous cell carcinoma(8;3.62e-11)			TGAGTTTGCGGGGGCCATGTT	0.562																																																	0								ENSG00000156675						62.0	59.0	60.0					8																	37732414		2203	4300	6503	RAB11FIP1	SO:0001583	missense	0			-	HGNC	AK092296	CCDS34881.1, CCDS34882.1	8p11.22	2005-10-04			ENSG00000156675	ENSG00000156675			30265	protein-coding gene	gene with protein product		608737				11786538, 11495908	Standard	NM_001002814		Approved	RCP, FLJ22622, FLJ22524, Rab11-FIP1	uc003xkm.2	Q6WKZ4	OTTHUMG00000164026	ENST00000330843.4:c.1241C>G	8.37:g.37732414G>C	ENSP00000331342:p.Pro414Arg	Somatic	0	35	0.00		0.41568620468393047	6	25.00	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	23	28.12	J3KNP0|Q307T1|Q6AZK4|Q6WKZ2|Q6WKZ6|Q86YV4|Q8TDL1|Q9H642	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Rab-bd_FIP-RBD,pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	p.P414R	ENST00000330843.4	37	c.1241	CCDS34882.1	8	.	.	.	.	.	.	.	.	.	.	G	9.004	0.980784	0.18812	.	.	ENSG00000156675	ENST00000287263;ENST00000330843;ENST00000522727;ENST00000524118	T;T;T;T	0.32272	2.22;2.53;1.5;1.46	4.91	2.09	0.27110	.	0.411423	0.23404	N	0.048548	T	0.48059	0.1479	M	0.72894	2.215	0.09310	N	1	D;P;D;P	0.63880	0.993;0.904;0.979;0.933	D;P;P;P	0.62955	0.909;0.667;0.777;0.564	T	0.37865	-0.9687	10	0.59425	D	0.04	0.2384	10.4391	0.44455	0.2174:0.0:0.7826:0.0	.	266;266;414;414	E7EX40;Q6WKZ4-2;Q6WKZ4-3;Q6WKZ4	.;.;.;RFIP1_HUMAN	R	414;414;266;266	ENSP00000287263:P414R;ENSP00000331342:P414R;ENSP00000430009:P266R;ENSP00000430680:P266R	ENSP00000287263:P414R	P	-	2	0	RAB11FIP1	37851572	0.016000	0.18221	0.001000	0.08648	0.015000	0.08874	1.363000	0.34159	0.123000	0.18342	-0.253000	0.11424	CCC	-	NULL		0.562	RAB11FIP1-002	KNOWN	basic|CCDS	protein_coding	RAB11FIP1	protein_coding	OTTHUMT00000376816.1	G	NM_025151	-		37732414	-1	no_errors	ENST00000330843	ensembl	human	known	74_37	missense	SNP	0.014	C
OR2A14	135941	genome.wustl.edu	37	7	143826735	143826736	+	Frame_Shift_Del	DEL	TC	TC	-	rs527649074	byFrequency	TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	TC	TC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr7:143826735_143826736delTC	ENST00000408899.2	+	1	585_586	c.530_531delTC	c.(529-531)ttcfs	p.F177fs		NM_001001659.1	NP_001001659.1	Q96R47	O2A14_HUMAN	olfactory receptor, family 2, subfamily A, member 14	177				Missing (in Ref. 2; AAK95081). {ECO:0000305}.		integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(4)|lung(17)|skin(1)	22	Melanoma(164;0.0783)					AACCACTTCTTCTGTGAAATCC	0.559																																																	0								ENSG00000221938																																			OR2A14	SO:0001589	frameshift_variant	0				HGNC		CCDS43672.1	7q35	2013-09-20		2004-03-08	ENSG00000221938	ENSG00000221938		"""GPCR / Class A : Olfactory receptors"""	15084	protein-coding gene	gene with protein product				OR2A14P, OR2A6			Standard	NM_001001659		Approved	OST182	uc011kua.2	Q96R47	OTTHUMG00000158003	ENST00000408899.2:c.530_531delTC	7.37:g.143826735_143826736delTC	ENSP00000386137:p.Phe177fs	Somatic	0	57	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	42	12.50	Q6IF41|Q8NGT8	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.F177fs	ENST00000408899.2	37	c.530_531	CCDS43672.1	7																																																																																			-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt		0.559	OR2A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2A14	protein_coding	OTTHUMT00000349980.1	TC				143826736	+1	no_errors	ENST00000408899	ensembl	human	known	74_37	frame_shift_del	DEL	1.000:1.000	-
MAP1A	4130	genome.wustl.edu	37	15	43814473	43814473	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr15:43814473C>T	ENST00000300231.5	+	4	1252	c.802C>T	c.(802-804)Cca>Tca	p.P268S	MAP1A_ENST00000399453.1_Missense_Mutation_p.P268S|MAP1A_ENST00000382031.1_Missense_Mutation_p.P506S			P78559	MAP1A_HUMAN	microtubule-associated protein 1A	268					microtubule cytoskeleton organization (GO:0000226)|sensory perception of sound (GO:0007605)	cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	structural molecule activity (GO:0005198)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(5)|pancreas(3)|prostate(2)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	66		all_cancers(109;1.03e-14)|all_epithelial(112;2.23e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.05e-06)	Estramustine(DB01196)	TGTGCTTTTTCCAGGAAATGC	0.542																																																	0								ENSG00000166963						78.0	78.0	78.0					15																	43814473		1955	4133	6088	MAP1A	SO:0001583	missense	0			-	HGNC	U38292	CCDS42031.1	15q15.3	2006-06-15			ENSG00000166963	ENSG00000166963			6835	protein-coding gene	gene with protein product		600178		MAP1L		7806212, 7629894	Standard	XM_005254385		Approved		uc001zrt.3	P78559	OTTHUMG00000059756	ENST00000300231.5:c.802C>T	15.37:g.43814473C>T	ENSP00000300231:p.Pro268Ser	Somatic	0	50	0.00		0.41568620468393047	3	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	29	34.09	O95643|Q12973|Q15882|Q9UJT4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.P268S	ENST00000300231.5	37	c.802	CCDS42031.1	15	.	.	.	.	.	.	.	.	.	.	C	16.07	3.017601	0.54576	.	.	ENSG00000166963	ENST00000382031;ENST00000399453;ENST00000300231;ENST00000442025	T;T;T	0.04083	3.71;3.71;3.71	5.07	5.07	0.68467	.	0.000000	0.33670	N	0.004661	T	0.23611	0.0571	M	0.86420	2.815	0.80722	D	1	P	0.50443	0.935	P	0.58210	0.835	T	0.01583	-1.1319	10	0.87932	D	0	-8.8513	18.6371	0.91383	0.0:1.0:0.0:0.0	.	268	P78559	MAP1A_HUMAN	S	506;268;268;268	ENSP00000371462:P506S;ENSP00000382380:P268S;ENSP00000300231:P268S	ENSP00000300231:P268S	P	+	1	0	MAP1A	41601765	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.651000	0.83577	2.653000	0.90120	0.561000	0.74099	CCA	-	NULL		0.542	MAP1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MAP1A	protein_coding	OTTHUMT00000132894.5	C	NM_002373	-		43814473	+1	no_errors	ENST00000399453	ensembl	human	known	74_37	missense	SNP	1.000	T
DUSP10	11221	genome.wustl.edu	37	1	221875662	221875662	+	3'UTR	DEL	A	A	-	rs3215279		TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr1:221875662delA	ENST00000366899.3	-	0	1779				DUSP10_ENST00000323825.3_3'UTR|DUSP10_ENST00000544095.1_3'UTR|DUSP10_ENST00000468085.1_5'UTR	NM_007207.4	NP_009138.1	Q9Y6W6	DUS10_HUMAN	dual specificity phosphatase 10						inactivation of MAPK activity (GO:0000188)|JNK cascade (GO:0007254)|negative regulation of JNK cascade (GO:0046329)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of respiratory burst involved in inflammatory response (GO:0060266)|oligodendrocyte differentiation (GO:0048709)|protein dephosphorylation (GO:0006470)|regulation of adaptive immune response (GO:0002819)|response to lipopolysaccharide (GO:0032496)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	MAP kinase phosphatase activity (GO:0033549)|MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|phosphatase activity (GO:0016791)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(16)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				GBM - Glioblastoma multiforme(131;0.0103)		TCCCAACTACAAAAAAAAAAA	0.348																																																	0								ENSG00000143507																																			DUSP10	SO:0001624	3_prime_UTR_variant	0				HGNC	AB026436	CCDS1528.1	1q41	2011-06-09			ENSG00000143507	ENSG00000143507		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3065	protein-coding gene	gene with protein product		608867				10391943, 10597297	Standard	NM_007207		Approved	MKP-5, MKP5	uc001hmy.2	Q9Y6W6	OTTHUMG00000037269	ENST00000366899.3:c.*92T>-	1.37:g.221875662delA		Somatic	0	18	0.00		0.41568620468393047	52	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	9	18.18	D3DTB4|Q6GSI4|Q9H9Z5	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000366899.3	37	NULL	CCDS1528.1	1																																																																																			-	-		0.348	DUSP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUSP10	protein_coding	OTTHUMT00000090716.1	A	NM_007207			221875662	-1	no_errors	ENST00000468085	ensembl	human	known	74_37	rna	DEL	0.040	-
NCKAP5L	57701	genome.wustl.edu	37	12	50190165	50190165	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr12:50190165G>A	ENST00000335999.6	-	8	1679	c.1478C>T	c.(1477-1479)tCa>tTa	p.S493L		NM_001037806.3	NP_001032895.2	Q9HCH0	NCK5L_HUMAN	NCK-associated protein 5-like	489	Pro-rich.									central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(8)|prostate(2)	18						GCTGCCGTCTGAGCCACTGTT	0.692																																																	0								ENSG00000167566						11.0	13.0	13.0					12																	50190165		1958	4149	6107	NCKAP5L	SO:0001583	missense	0			-	HGNC	AB046822	CCDS41781.2	12q13.12	2009-08-14	2009-08-14	2009-08-14	ENSG00000167566	ENSG00000167566			29321	protein-coding gene	gene with protein product		615104	"""KIAA1602"""	KIAA1602			Standard	NM_001037806		Approved		uc009zlk.2	Q9HCH0	OTTHUMG00000156969	ENST00000335999.6:c.1478C>T	12.37:g.50190165G>A	ENSP00000337998:p.Ser493Leu	Somatic	0	26	0.00		0.41568620468393047	12	29.41	5	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	21	30.00	Q2TB26|Q71RH1|Q8N4W1|Q96HX2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.S493L	ENST00000335999.6	37	c.1478	CCDS41781.2	12	.	.	.	.	.	.	.	.	.	.	G	14.22	2.469711	0.43839	.	.	ENSG00000167566	ENST00000335999;ENST00000354423	T	0.46063	0.88	4.73	4.73	0.59995	.	0.000000	0.38272	N	0.001755	T	0.27313	0.0670	N	0.19112	0.55	0.33213	D	0.553631	B;B	0.33103	0.397;0.397	B;B	0.37047	0.24;0.24	T	0.29852	-0.9998	10	0.11794	T	0.64	-13.9629	10.7924	0.46440	0.0:0.0:0.6949:0.3051	.	489;489	E2QRB5;Q9HCH0-2	.;.	L	493;489	ENSP00000337998:S493L	ENSP00000337998:S493L	S	-	2	0	NCKAP5L	48476432	1.000000	0.71417	0.998000	0.56505	0.972000	0.66771	3.414000	0.52693	2.374000	0.81015	0.561000	0.74099	TCA	-	NULL		0.692	NCKAP5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCKAP5L	protein_coding	OTTHUMT00000346884.2	G	XM_035497	-		50190165	-1	no_errors	ENST00000335999	ensembl	human	known	74_37	missense	SNP	1.000	A
ARSEP1	10033	genome.wustl.edu	37	Y	14467979	14467979	+	RNA	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chrY:14467979G>A	ENST00000430152.1	+	0	252									arylsulfatase E pseudogene 1																		AGTCCACCACGATCTACCTTT	0.542																																																	0								ENSG00000224060																																			ARSEP1			0			-	HGNC			Yq11.21	2010-07-27	2010-01-12	2010-01-12	ENSG00000224060	ENSG00000224060			720	pseudogene	pseudogene			"""arylsulfatase E pseudogene"""	ARSEP		8845834	Standard	NG_000880		Approved				OTTHUMG00000036379		Y.37:g.14467979G>A		Somatic	0	40	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	17	41.38		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000430152.1	37	NULL		Y																																																																																			-	-		0.542	ARSEP1-002	KNOWN	basic|exp_conf	processed_transcript	ARSEP1	pseudogene	OTTHUMT00000471811.1	G	NG_000880	-		14467979	+1	no_errors	ENST00000430152	ensembl	human	known	74_37	rna	SNP	0.982	A
FLG2	388698	genome.wustl.edu	37	1	152323447	152323447	+	Missense_Mutation	SNP	G	G	A	rs554543735		TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr1:152323447G>A	ENST00000388718.5	-	3	6887	c.6815C>T	c.(6814-6816)tCa>tTa	p.S2272L	FLG-AS1_ENST00000445097.1_RNA|FLG-AS1_ENST00000392688.2_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	2272					establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			AATGTGTCCTGAATGTGTGTG	0.522													G|||	1	0.000199681	0.0	0.0	5008	,	,		25014	0.0		0.0	False		,,,				2504	0.001																0								ENSG00000143520						310.0	286.0	294.0					1																	152323447		2203	4300	6503	FLG2	SO:0001583	missense	0			-	HGNC	AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.6815C>T	1.37:g.152323447G>A	ENSP00000373370:p.Ser2272Leu	Somatic	0	138	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	74	19.57	Q9H4U1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_S100_Ca-bd_sub,pfscan_EF_hand_dom,prints_Filaggrin	p.S2272L	ENST00000388718.5	37	c.6815	CCDS30861.1	1	.	.	.	.	.	.	.	.	.	.	G	17.20	3.329507	0.60743	.	.	ENSG00000143520	ENST00000388718	T	0.08370	3.1	3.83	3.83	0.44106	.	.	.	.	.	T	0.14056	0.0340	M	0.68593	2.085	0.09310	N	0.999999	D	0.67145	0.996	D	0.74348	0.983	T	0.03608	-1.1020	9	0.39692	T	0.17	4.7473	12.0961	0.53755	0.0:0.0:1.0:0.0	.	2272	Q5D862	FILA2_HUMAN	L	2272	ENSP00000373370:S2272L	ENSP00000373370:S2272L	S	-	2	0	FLG2	150590071	0.067000	0.21026	0.012000	0.15200	0.037000	0.13140	3.180000	0.50895	2.134000	0.65973	0.449000	0.29647	TCA	-	NULL		0.522	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG2	protein_coding	OTTHUMT00000034018.5	G	NM_001014342	-		152323447	-1	no_errors	ENST00000388718	ensembl	human	known	74_37	missense	SNP	0.231	A
CACNA1E	777	genome.wustl.edu	37	1	181701549	181701549	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr1:181701549C>T	ENST00000367573.2	+	20	2327	c.2327C>T	c.(2326-2328)tCc>tTc	p.S776F	CACNA1E_ENST00000526775.1_Missense_Mutation_p.S757F|CACNA1E_ENST00000360108.3_Missense_Mutation_p.S757F|CACNA1E_ENST00000357570.5_Missense_Mutation_p.S727F|CACNA1E_ENST00000367570.1_Missense_Mutation_p.S776F|CACNA1E_ENST00000358338.5_Missense_Mutation_p.S708F|CACNA1E_ENST00000367567.4_Missense_Mutation_p.S383F	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	776					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						CACCACATGTCCGTGTGGGAG	0.677																																																	0								ENSG00000198216						30.0	43.0	38.0					1																	181701549		1742	3193	4935	CACNA1E	SO:0001583	missense	0			-	HGNC	AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.2327C>T	1.37:g.181701549C>T	ENSP00000356545:p.Ser776Phe	Somatic	0	46	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	27	22.86	B1AM12|B1AM13|B1AM14|Q14580|Q14581	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,pfscan_EF_hand_dom,prints_VDCCAlpha1,prints_VDCC_R_a1su	p.S776F	ENST00000367573.2	37	c.2327	CCDS55664.1	1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.288889	0.80914	.	.	ENSG00000198216	ENST00000367570;ENST00000526775;ENST00000357570;ENST00000358338;ENST00000367567;ENST00000360108;ENST00000367573	D;D;D;D;D;D;D	0.97529	-4.37;-4.12;-4.42;-4.09;-4.25;-4.12;-4.38	3.82	3.82	0.43975	.	10.743100	0.00166	N	0.000000	D	0.98099	0.9373	L	0.43923	1.385	0.80722	D	1	D;D;D	0.69078	0.997;0.995;0.997	D;D;D	0.80764	0.994;0.986;0.994	D	0.91844	0.5486	10	0.87932	D	0	.	16.6042	0.84824	0.0:1.0:0.0:0.0	.	757;776;776	Q15878-2;Q15878;Q15878-3	.;CAC1E_HUMAN;.	F	776;757;727;708;383;757;776	ENSP00000356542:S776F;ENSP00000434814:S757F;ENSP00000350183:S727F;ENSP00000351101:S708F;ENSP00000356539:S383F;ENSP00000353222:S757F;ENSP00000356545:S776F	ENSP00000350183:S727F	S	+	2	0	CACNA1E	179968172	1.000000	0.71417	0.956000	0.39512	0.978000	0.69477	7.417000	0.80156	2.437000	0.82529	0.561000	0.74099	TCC	-	NULL		0.677	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	CACNA1E	protein_coding	OTTHUMT00000090793.2	C	NM_000721	-		181701549	+1	no_errors	ENST00000367573	ensembl	human	known	74_37	missense	SNP	0.999	T
ALG12	79087	genome.wustl.edu	37	22	50297506	50297506	+	Silent	SNP	T	T	G			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr22:50297506T>G	ENST00000330817.6	-	10	1720	c.1447A>C	c.(1447-1449)Agg>Cgg	p.R483R	CITF22-1A6.3_ENST00000610245.1_lincRNA	NM_024105.3	NP_077010.1	Q9BV10	ALG12_HUMAN	ALG12, alpha-1,6-mannosyltransferase	483					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|mannosylation (GO:0097502)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	alpha-1,6-mannosyltransferase activity (GO:0000009)|dol-P-Man:Man(7)GlcNAc(2)-PP-Dol alpha-1,6-mannosyltransferase activity (GO:0052917)			endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|prostate(3)	12		all_cancers(38;8.58e-10)|all_epithelial(38;1.15e-08)|all_lung(38;0.000109)|Lung NSC(38;0.0018)|Breast(42;0.00191)|Ovarian(80;0.0164)|Lung SC(80;0.164)		BRCA - Breast invasive adenocarcinoma(115;0.199)|LUAD - Lung adenocarcinoma(64;0.247)		CGGGGGAGCCTCTCCAGAAGC	0.622																																																	0								ENSG00000182858						51.0	58.0	56.0					22																	50297506		2203	4300	6503	ALG12	SO:0001819	synonymous_variant	0			-	HGNC	AJ303120	CCDS14081.1	22q13.33	2013-02-26	2013-02-26		ENSG00000182858	ENSG00000182858	2.4.1.260	"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"""	19358	protein-coding gene	gene with protein product	"""dolichyl-P-Man:Man(7)GlcNAc(2)-PP-dolichol alpha-1,6-mannosyltransferase"", ""dol-P-Man dependent alpha-1,6-mannosyltransferase"""	607144	"""asparagine-linked glycosylation 12 homolog (yeast, alpha-1,6-mannosyltransferase)"", ""asparagine-linked glycosylation 12, alpha-1,6-mannosyltransferase homolog (S. cerevisiae)"""			11983712	Standard	NM_024105		Approved	ECM39	uc003biy.3	Q9BV10	OTTHUMG00000150289	ENST00000330817.6:c.1447A>C	22.37:g.50297506T>G		Somatic	0	104	0.00		0.41568620468393047	71	18.39	16	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	63	23.17	A6PWM1|Q4KMH4|Q8NG10|Q96AA4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPI_mannosylTrfase	p.R483	ENST00000330817.6	37	c.1447	CCDS14081.1	22	.	.	.	.	.	.	.	.	.	.	T	12.05	1.822241	0.32237	.	.	ENSG00000182858	ENST00000332276	.	.	.	5.41	0.494	0.16884	.	.	.	.	.	T	0.72914	0.3520	.	.	.	0.40763	D	0.983027	.	.	.	.	.	.	T	0.76291	-0.3013	5	0.87932	D	0	-14.8882	14.707	0.69198	0.0:0.0:0.5648:0.4352	.	.	.	.	A	128	.	ENSP00000329560:E128A	E	-	2	0	ALG12	48683510	0.997000	0.39634	0.221000	0.23827	0.361000	0.29550	0.797000	0.26999	-0.185000	0.10550	0.533000	0.62120	GAG	-	NULL		0.622	ALG12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALG12	protein_coding	OTTHUMT00000317405.2	T	NM_024105	-		50297506	-1	no_errors	ENST00000330817	ensembl	human	known	74_37	silent	SNP	0.646	G
C11orf86	254439	genome.wustl.edu	37	11	66743715	66743715	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr11:66743715C>T	ENST00000308963.4	+	2	427	c.341C>T	c.(340-342)tCc>tTc	p.S114F		NM_001136485.1	NP_001129957.1	A6NJI1	CK086_HUMAN	chromosome 11 open reading frame 86	114										NS(1)|skin(1)	2						CAGCCGGCCTCCCCGTAGCCC	0.622											OREG0021116	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000173237						44.0	46.0	45.0					11																	66743715		692	1591	2283	C11orf86	SO:0001583	missense	0			-	HGNC	AK026328, AP003176	CCDS44656.1	11q13.1	2012-08-10			ENSG00000173237	ENSG00000173237			34442	protein-coding gene	gene with protein product							Standard	NM_001136485		Approved	FLJ22675	uc010rpm.2	A6NJI1	OTTHUMG00000153671	ENST00000308963.4:c.341C>T	11.37:g.66743715C>T	ENSP00000311479:p.Ser114Phe	Somatic	0	43	0.00	1094	0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	19	17.39		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.S114F	ENST00000308963.4	37	c.341	CCDS44656.1	11	.	.	.	.	.	.	.	.	.	.	C	14.57	2.574019	0.45902	.	.	ENSG00000173237	ENST00000308963	.	.	.	4.36	4.36	0.52297	.	0.527792	0.17588	N	0.168875	T	0.59649	0.2209	L	0.34521	1.04	0.34973	D	0.753382	D	0.76494	0.999	D	0.66351	0.943	T	0.69672	-0.5082	9	0.87932	D	0	-9.74	12.6199	0.56597	0.0:1.0:0.0:0.0	.	114	A6NJI1	CK086_HUMAN	F	114	.	ENSP00000311479:S114F	S	+	2	0	C11orf86	66500291	0.996000	0.38824	0.990000	0.47175	0.083000	0.17756	3.237000	0.51344	2.421000	0.82119	0.555000	0.69702	TCC	-	NULL		0.622	C11orf86-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C11orf86	protein_coding	OTTHUMT00000332022.2	C	NM_001136485	-		66743715	+1	no_errors	ENST00000308963	ensembl	human	known	74_37	missense	SNP	0.973	T
CXorf57	55086	genome.wustl.edu	37	X	105882718	105882718	+	Intron	SNP	G	G	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chrX:105882718G>T	ENST00000372548.4	+	9	1682				MIR548AN_ENST00000408286.2_RNA|CXorf57_ENST00000372544.2_Intron	NM_018015.5	NP_060485.4	Q6NSI4	CX057_HUMAN	chromosome X open reading frame 57								poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(5)|large_intestine(6)|lung(11)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	31						TATCATTTCAGTTCTTTAAAA	0.318																																																	0								ENSG00000147231						41.0	40.0	40.0					X																	105882718		2199	4296	6495	CXorf57	SO:0001627	intron_variant	0			-	HGNC	AK024253	CCDS14519.1, CCDS55470.1	Xq22.3	2008-02-05			ENSG00000147231	ENSG00000147231			25486	protein-coding gene	gene with protein product							Standard	NM_018015		Approved	FLJ14191, FLJ10178	uc004emi.4	Q6NSI4	OTTHUMG00000022150	ENST00000372548.4:c.1574-39G>T	X.37:g.105882718G>T		Somatic	0	33	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	21	12.50	H7BY89|Q4G0L7|Q5JQS1|Q5JRF9|Q6PHY5|Q6PII9|Q6PJU8|Q9H7W5|Q9NWA6	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000372548.4	37	NULL	CCDS14519.1	X																																																																																			-	-		0.318	CXorf57-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CXorf57	protein_coding	OTTHUMT00000057800.2	G	NM_018015	-		105882718	+1	no_errors	ENST00000478395	ensembl	human	known	74_37	rna	SNP	0.185	T
ARHGEF16	27237	genome.wustl.edu	37	1	3397101	3397101	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr1:3397101G>A	ENST00000378378.4	+	15	2485	c.2080G>A	c.(2080-2082)Gag>Aag	p.E694K	ARHGEF16_ENST00000413250.2_Missense_Mutation_p.E398K|ARHGEF16_ENST00000378373.1_Missense_Mutation_p.E406K|ARHGEF16_ENST00000378371.2_Missense_Mutation_p.E406K	NM_014448.3	NP_055263.2	Q5VV41	ARHGG_HUMAN	Rho guanine nucleotide exchange factor (GEF) 16	694					activation of Cdc42 GTPase activity (GO:0032864)|activation of Rac GTPase activity (GO:0032863)|apoptotic signaling pathway (GO:0097190)|cell chemotaxis (GO:0060326)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	PDZ domain binding (GO:0030165)|receptor tyrosine kinase binding (GO:0030971)|Rho GTPase binding (GO:0017048)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			lung(6)|ovary(1)	7	all_cancers(77;0.00276)|all_epithelial(69;0.00102)|Ovarian(185;0.0634)|Lung NSC(156;0.0969)|all_lung(157;0.101)	all_epithelial(116;7.14e-21)|all_lung(118;2.24e-08)|Lung NSC(185;3.55e-06)|Breast(487;0.000765)|Renal(390;0.00121)|Hepatocellular(190;0.0046)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.211)		Epithelial(90;8.62e-38)|OV - Ovarian serous cystadenocarcinoma(86;3.62e-22)|GBM - Glioblastoma multiforme(42;2.49e-12)|Colorectal(212;4.25e-05)|COAD - Colon adenocarcinoma(227;0.000196)|Kidney(185;0.000342)|BRCA - Breast invasive adenocarcinoma(365;0.000681)|KIRC - Kidney renal clear cell carcinoma(229;0.00549)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.201)		TGTGGCCGTGGAGGGCAATGT	0.662																																																	0								ENSG00000130762						48.0	43.0	45.0					1																	3397101		2201	4293	6494	ARHGEF16	SO:0001583	missense	0			-	HGNC	D89016	CCDS46.2	1p36.3	2013-01-10	2010-04-13		ENSG00000130762	ENSG00000130762		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	15515	protein-coding gene	gene with protein product	"""putative neuroblastoma protein"""						Standard	NM_014448		Approved	NBR, GEF16	uc001akg.4	Q5VV41	OTTHUMG00000000625	ENST00000378378.4:c.2080G>A	1.37:g.3397101G>A	ENSP00000367629:p.Glu694Lys	Somatic	0	96	0.00		0.41568620468393047	13	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	52	18.75	Q86TF0|Q99434	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DH-domain,pfam_SH3_domain,pfam_Pleckstrin_homology,superfamily_DH-domain,superfamily_SH3_domain,smart_DH-domain,smart_Pleckstrin_homology,smart_SH3_domain,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_DH-domain	p.E694K	ENST00000378378.4	37	c.2080	CCDS46.2	1	.	.	.	.	.	.	.	.	.	.	G	24.7	4.564582	0.86439	.	.	ENSG00000130762	ENST00000378378;ENST00000378373;ENST00000378371;ENST00000413250	T;T;T;T	0.69561	-0.08;-0.05;-0.05;-0.41	5.21	5.21	0.72293	.	0.056413	0.64402	D	0.000002	T	0.72503	0.3468	L	0.54908	1.71	0.58432	D	0.999999	P;D	0.56035	0.945;0.974	P;P	0.52957	0.459;0.714	T	0.69811	-0.5044	10	0.29301	T	0.29	-36.2096	18.7336	0.91746	0.0:0.0:1.0:0.0	.	398;694	B4DJM7;Q5VV41	.;ARHGG_HUMAN	K	694;406;406;398	ENSP00000367629:E694K;ENSP00000367624:E406K;ENSP00000367622:E406K;ENSP00000408887:E398K	ENSP00000367622:E406K	E	+	1	0	ARHGEF16	3386961	1.000000	0.71417	1.000000	0.80357	0.662000	0.39071	5.748000	0.68697	2.437000	0.82529	0.462000	0.41574	GAG	-	NULL		0.662	ARHGEF16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGEF16	protein_coding	OTTHUMT00000001515.1	G	NM_014448	-		3397101	+1	no_errors	ENST00000378378	ensembl	human	known	74_37	missense	SNP	1.000	A
ZNF281	23528	genome.wustl.edu	37	1	200378098	200378098	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr1:200378098C>T	ENST00000294740.3	-	2	860	c.736G>A	c.(736-738)Gtt>Att	p.V246I	ZNF281_ENST00000367352.3_Missense_Mutation_p.V210I|ZNF281_ENST00000367353.1_Missense_Mutation_p.V246I	NM_001281293.1|NM_001281294.1|NM_012482.4	NP_001268222.1|NP_001268223.1|NP_036614.1	Q9Y2X9	ZN281_HUMAN	zinc finger protein 281	246					embryonic body morphogenesis (GO:0010172)|negative regulation of gene expression (GO:0010629)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|stem cell differentiation (GO:0048863)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	core promoter binding (GO:0001047)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			breast(4)|endometrium(3)|kidney(3)|large_intestine(6)|lung(7)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	27						CCATCTCCAACCAAAGAAGGT	0.478																																																	0								ENSG00000162702						150.0	139.0	143.0					1																	200378098		2203	4300	6503	ZNF281	SO:0001583	missense	0			-	HGNC	AF125158	CCDS1402.1, CCDS60384.1	1q32.1	2012-08-08			ENSG00000162702	ENSG00000162702		"""Zinc fingers, C2H2-type"""	13075	protein-coding gene	gene with protein product						10448078	Standard	NM_012482		Approved	ZBP-99	uc001gve.3	Q9Y2X9	OTTHUMG00000035724	ENST00000294740.3:c.736G>A	1.37:g.200378098C>T	ENSP00000294740:p.Val246Ile	Somatic	0	40	0.00		0.41568620468393047	1	66.67	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	18	21.74	A6NF48|B3KMX2|Q5RKW5|Q9NY92	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.V246I	ENST00000294740.3	37	c.736	CCDS1402.1	1	.	.	.	.	.	.	.	.	.	.	C	13.92	2.382357	0.42207	.	.	ENSG00000162702	ENST00000294740;ENST00000367353;ENST00000367352	T;T;T	0.07688	3.17;3.17;3.17	5.64	5.64	0.86602	.	0.294486	0.32147	N	0.006503	T	0.06554	0.0168	N	0.22421	0.69	0.33588	D	0.600737	B;B	0.25105	0.118;0.118	B;B	0.18871	0.023;0.023	T	0.24835	-1.0149	10	0.23302	T	0.38	-6.3344	13.9361	0.64026	0.0:0.9276:0.0:0.0723	.	210;246	A6NF48;Q9Y2X9	.;ZN281_HUMAN	I	246;246;210	ENSP00000294740:V246I;ENSP00000356322:V246I;ENSP00000356321:V210I	ENSP00000294740:V246I	V	-	1	0	ZNF281	198644721	0.999000	0.42202	0.543000	0.28128	0.997000	0.91878	4.101000	0.57769	2.644000	0.89710	0.655000	0.94253	GTT	-	NULL		0.478	ZNF281-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF281	protein_coding	OTTHUMT00000086879.2	C	NM_012482	-		200378098	-1	no_errors	ENST00000294740	ensembl	human	known	74_37	missense	SNP	0.967	T
ULK2	9706	genome.wustl.edu	37	17	19687131	19687131	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr17:19687131G>A	ENST00000395544.4	-	22	2838	c.2339C>T	c.(2338-2340)tCc>tTc	p.S780F	ULK2_ENST00000361658.2_Missense_Mutation_p.S780F	NM_014683.3	NP_055498.3	Q8IYT8	ULK2_HUMAN	unc-51 like autophagy activating kinase 2	780					autophagic vacuole assembly (GO:0000045)|axon extension (GO:0048675)|negative regulation of collateral sprouting (GO:0048671)|protein autophosphorylation (GO:0046777)|regulation of autophagy (GO:0010506)|response to starvation (GO:0042594)|signal transduction (GO:0007165)	ATG1/UKL1 signaling complex (GO:0034273)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|pre-autophagosomal structure membrane (GO:0034045)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			large_intestine(1)|skin(4)|stomach(1)	6	all_cancers(12;4.97e-05)|all_epithelial(12;0.00362)|Breast(13;0.186)					TCCTGGAGGGGAAGAGCCGAA	0.642																																																	0								ENSG00000083290						47.0	55.0	52.0					17																	19687131		2203	4300	6503	ULK2	SO:0001583	missense	0			-	HGNC	AB014523	CCDS11213.1	17p11.2	2014-02-12	2013-07-02		ENSG00000083290	ENSG00000083290	2.7.11.1		13480	protein-coding gene	gene with protein product		608650	"""unc-51 (C. elegans)-like kinase 2"", ""unc-51-like kinase 2 (C. elegans)"""			10557072	Standard	NM_014683		Approved	KIAA0623, Unc51.2, ATG1B	uc002gwn.3	Q8IYT8	OTTHUMG00000059511	ENST00000395544.4:c.2339C>T	17.37:g.19687131G>A	ENSP00000378914:p.Ser780Phe	Somatic	0	36	0.00		0.41568620468393047	18	21.74	5	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	23	17.86	A8MY69|O75119	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser/Thr_kinase_C,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,pfam_RIO-like_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Ser/Thr_kin_STPK_Ulk-1/2,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.S780F	ENST00000395544.4	37	c.2339	CCDS11213.1	17	.	.	.	.	.	.	.	.	.	.	G	15.12	2.740146	0.49045	.	.	ENSG00000083290	ENST00000361658;ENST00000395544	T;T	0.68765	-0.35;-0.35	5.58	5.58	0.84498	.	0.107756	0.64402	D	0.000003	T	0.67344	0.2883	L	0.57536	1.79	0.50632	D	0.99988	P	0.48503	0.911	P	0.46585	0.521	T	0.63418	-0.6642	10	0.10111	T	0.7	-2.7762	18.5624	0.91105	0.0:0.0:1.0:0.0	.	780	Q8IYT8	ULK2_HUMAN	F	780	ENSP00000354877:S780F;ENSP00000378914:S780F	ENSP00000354877:S780F	S	-	2	0	ULK2	19627723	1.000000	0.71417	0.841000	0.33234	0.074000	0.17049	9.165000	0.94761	2.611000	0.88343	0.655000	0.94253	TCC	-	pirsf_Ser/Thr_kin_STPK_Ulk-1/2		0.642	ULK2-001	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	ULK2	protein_coding	OTTHUMT00000132375.2	G	NM_014683	-		19687131	-1	no_errors	ENST00000361658	ensembl	human	known	74_37	missense	SNP	1.000	A
NUP210L	91181	genome.wustl.edu	37	1	154042844	154042844	+	Nonsense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr1:154042844C>T	ENST00000368559.3	-	17	2530	c.2459G>A	c.(2458-2460)tGg>tAg	p.W820*	NUP210L_ENST00000271854.3_Nonsense_Mutation_p.W820*	NM_207308.2	NP_997191.2	Q5VU65	P210L_HUMAN	nucleoporin 210kDa-like	820					Sertoli cell development (GO:0060009)|spermatid development (GO:0007286)	integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(12)|lung(34)|ovary(4)|pancreas(1)|prostate(2)|skin(6)|urinary_tract(2)	80	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)			GGAGGATTTCCATTCTAGCAT	0.408																																																	0								ENSG00000143552						143.0	129.0	134.0					1																	154042844		1887	4103	5990	NUP210L	SO:0001587	stop_gained	0			-	HGNC	AK125924	CCDS41399.1, CCDS53370.1	1q21.3	2008-02-05			ENSG00000143552	ENSG00000143552			29915	protein-coding gene	gene with protein product							Standard	NM_207308		Approved		uc001fdw.3	Q5VU65	OTTHUMG00000035852	ENST00000368559.3:c.2459G>A	1.37:g.154042844C>T	ENSP00000357547:p.Trp820*	Somatic	0	44	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	32	30.43	E7EP56|Q5T4L7|Q6ZRN1|Q6ZRT4|Q6ZU81|Q8NDI6|Q9UF31	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Big_2,superfamily_Invasin/intimin_cell_adhesion,smart_Big_2	p.W820*	ENST00000368559.3	37	c.2459	CCDS41399.1	1	.	.	.	.	.	.	.	.	.	.	C	39	7.501112	0.98322	.	.	ENSG00000143552	ENST00000368559;ENST00000271854	.	.	.	5.12	5.12	0.69794	.	0.000000	0.51477	D	0.000092	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-2.7505	15.6471	0.77063	0.0:1.0:0.0:0.0	.	.	.	.	X	820	.	ENSP00000271854:W820X	W	-	2	0	NUP210L	152309468	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	5.427000	0.66483	2.428000	0.82296	0.498000	0.49722	TGG	-	NULL		0.408	NUP210L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP210L	protein_coding	OTTHUMT00000087270.3	C	NM_207308	-		154042844	-1	no_errors	ENST00000368559	ensembl	human	known	74_37	nonsense	SNP	1.000	T
TFR2	7036	genome.wustl.edu	37	7	100224890	100224890	+	Silent	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr7:100224890G>A	ENST00000462107.1	-	17	2279	c.1992C>T	c.(1990-1992)ctC>ctT	p.L664L	TFR2_ENST00000223051.3_Silent_p.L664L|TFR2_ENST00000431692.1_3'UTR|TFR2_ENST00000544242.1_Silent_p.L205L			Q9UP52	TFR2_HUMAN	transferrin receptor 2	664					cellular iron ion homeostasis (GO:0006879)|iron ion transport (GO:0006826)|receptor-mediated endocytosis (GO:0006898)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)	transferrin receptor activity (GO:0004998)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(6)|liver(1)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	23	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)				Gallium nitrate(DB05260)	CTTGAACCTTGAGGTCCCCAG	0.657																																																	0								ENSG00000106327						9.0	8.0	8.0					7																	100224890		1949	3789	5738	TFR2	SO:0001819	synonymous_variant	0			-	HGNC	AF053356	CCDS34707.1	7q22	2003-01-27			ENSG00000106327	ENSG00000106327			11762	protein-coding gene	gene with protein product		604720				9799793, 12130528	Standard	NM_003227		Approved	HFE3, TFRC2	uc003uvv.1	Q9UP52	OTTHUMG00000159598	ENST00000462107.1:c.1992C>T	7.37:g.100224890G>A		Somatic	0	188	0.00		0.41568620468393047	4	55.56	5	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	96	19.33	A6NGM7|O75422|Q1HE13|Q9HA99|Q9NX67	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_TFR-like_dimer_dom,pfam_Peptidase_M28,pfam_Protease-assoc_domain,superfamily_TFR-like_dimer_dom	p.L664	ENST00000462107.1	37	c.1992	CCDS34707.1	7																																																																																			-	superfamily_TFR-like_dimer_dom		0.657	TFR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TFR2	protein_coding	OTTHUMT00000356392.3	G	NM_003227	-		100224890	-1	no_errors	ENST00000223051	ensembl	human	known	74_37	silent	SNP	1.000	A
PHF12	57649	genome.wustl.edu	37	17	27233377	27233377	+	Silent	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr17:27233377G>A	ENST00000332830.4	-	15	3649	c.2839C>T	c.(2839-2841)Ctg>Ttg	p.L947L	PHF12_ENST00000577226.1_3'UTR	NM_001033561.1	NP_001028733.1			PHD finger protein 12											breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(8)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	30	all_cancers(5;1.95e-14)|all_epithelial(6;5e-18)|Lung NSC(42;0.01)		Epithelial(11;1.64e-05)|all cancers(11;7.47e-05)|BRCA - Breast invasive adenocarcinoma(11;9.79e-05)			CCATGGTGCAGTAAGGCTGTG	0.617																																																	0								ENSG00000109118						53.0	54.0	54.0					17																	27233377		2203	4300	6503	PHF12	SO:0001819	synonymous_variant	0			-	HGNC	AB040956	CCDS11247.1, CCDS32598.1	17q11.2	2013-01-28			ENSG00000109118	ENSG00000109118		"""Zinc fingers, PHD-type"""	20816	protein-coding gene	gene with protein product						11390640	Standard	XM_005258015		Approved	PF1, KIAA1523	uc002hdg.1	Q96QT6	OTTHUMG00000132676	ENST00000332830.4:c.2839C>T	17.37:g.27233377G>A		Somatic	0	46	0.00		0.41568620468393047	77	19.59	19	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	34	15.00		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,superfamily_SMAD_FHA_domain,smart_Znf_PHD,pfscan_FHA_dom,pfscan_Znf_PHD-finger	p.L947	ENST00000332830.4	37	c.2839	CCDS32598.1	17																																																																																			-	NULL		0.617	PHF12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHF12	protein_coding	OTTHUMT00000255941.1	G	NM_020889	-		27233377	-1	no_errors	ENST00000332830	ensembl	human	known	74_37	silent	SNP	1.000	A
ABL2	27	genome.wustl.edu	37	1	179078352	179078352	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr1:179078352C>T	ENST00000502732.1	-	12	2253	c.2050G>A	c.(2050-2052)Gaa>Aaa	p.E684K	ABL2_ENST00000367623.4_Missense_Mutation_p.E663K|ABL2_ENST00000504405.1_Missense_Mutation_p.E648K|ABL2_ENST00000512653.1_Missense_Mutation_p.E669K|ABL2_ENST00000344730.3_Missense_Mutation_p.E669K|ABL2_ENST00000507173.1_Missense_Mutation_p.E663K|ABL2_ENST00000511413.1_Missense_Mutation_p.E684K|ABL2_ENST00000408940.3_Missense_Mutation_p.E648K	NM_001168236.1|NM_001168237.1|NM_001168238.1|NM_007314.3	NP_001161708.1|NP_001161709.1|NP_001161710.1|NP_009298.1	P42684	ABL2_HUMAN	ABL proto-oncogene 2, non-receptor tyrosine kinase	684					actin filament bundle assembly (GO:0051017)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cellular protein modification process (GO:0006464)|cellular response to retinoic acid (GO:0071300)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of neuron projection development (GO:0010976)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of phospholipase C activity (GO:0010863)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of autophagy (GO:0010506)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of endocytosis (GO:0030100)|signal transduction (GO:0007165)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)	actin filament binding (GO:0051015)|actin monomer binding (GO:0003785)|ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)	p.E648K(1)		breast(8)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	65					Adenosine triphosphate(DB00171)|Dasatinib(DB01254)	CCCGTGAGTTCGTATTTCTTA	0.512			T	ETV6	AML																																			Dom	yes		1	1q24-q25	27	v-abl Abelson murine leukemia viral oncogene homolog 2		L	1	Substitution - Missense(1)	large_intestine(1)						ENSG00000143322						189.0	198.0	195.0					1																	179078352		2203	4300	6503	ABL2	SO:0001583	missense	0			-	HGNC	M14904	CCDS30947.1, CCDS41441.1, CCDS44282.1, CCDS44283.1, CCDS41441.2, CCDS53435.1, CCDS53436.1, CCDS53437.1, CCDS53438.1	1q25.2	2014-06-26	2014-06-26		ENSG00000143322	ENSG00000143322		"""SH2 domain containing"""	77	protein-coding gene	gene with protein product	"""Abelson-related gene"""	164690	"""v-abl Abelson murine leukemia viral oncogene homolog 2 (arg, Abelson-related gene)"", ""v-abl Abelson murine leukemia viral oncogene homolog 2"", ""c-abl oncogene 2, non-receptor tyrosine kinase"""	ABLL		3787260	Standard	NM_001136001		Approved	ARG	uc001gmi.4	P42684	OTTHUMG00000035199	ENST00000502732.1:c.2050G>A	1.37:g.179078352C>T	ENSP00000427562:p.Glu684Lys	Somatic	0	53	0.00		0.41568620468393047	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	36	21.28	A0M8X0|B7UEF2|B7UEF3|B7UEF4|B7UEF5|Q5T0X6|Q5W0C5|Q6NZY6|Q7Z301	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_F-actin_binding,pfam_Prot_kinase_dom,pfam_SH2,pfam_SH3_domain,pfam_SH3_2,pfam_SH3-like_bac-type,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_F-actin_binding,pfscan_SH2,pfscan_SH3_domain,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2	p.E684K	ENST00000502732.1	37	c.2050	CCDS30947.1	1	.	.	.	.	.	.	.	.	.	.	C	15.97	2.988498	0.53934	.	.	ENSG00000143322	ENST00000502732;ENST00000408940;ENST00000344730;ENST00000512653;ENST00000504405;ENST00000367623;ENST00000507173;ENST00000511413	T;T;T;T;T;T;T;T	0.16196	3.0;3.0;2.36;3.0;2.36;3.0;2.36;2.36	5.7	5.7	0.88788	.	0.000000	0.51477	D	0.000097	T	0.37376	0.1001	L	0.48642	1.525	0.80722	D	1	D;D;D;B;P;D;D;D	0.89917	0.997;0.997;0.997;0.069;0.474;1.0;0.979;0.977	P;P;P;B;B;D;P;P	0.79108	0.728;0.654;0.654;0.08;0.056;0.992;0.512;0.481	T	0.01252	-1.1405	10	0.46703	T	0.11	.	18.8208	0.92096	0.0:1.0:0.0:0.0	.	663;663;684;648;684;669;648;669	P42684-6;P42684-7;P42684-5;P42684-4;P42684;P42684-3;D1MPS6;P42684-10	.;.;.;.;ABL2_HUMAN;.;.;.	K	684;648;669;669;648;663;663;684	ENSP00000427562:E684K;ENSP00000386152:E648K;ENSP00000339209:E669K;ENSP00000423578:E669K;ENSP00000426831:E648K;ENSP00000356595:E663K;ENSP00000423413:E663K;ENSP00000424697:E684K	ENSP00000339209:E669K	E	-	1	0	ABL2	177344975	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.636000	0.83301	2.686000	0.91538	0.591000	0.81541	GAA	-	NULL		0.512	ABL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ABL2	protein_coding	OTTHUMT00000085174.3	C	NM_005158	-		179078352	-1	no_errors	ENST00000502732	ensembl	human	known	74_37	missense	SNP	1.000	T
FGFR1	2260	genome.wustl.edu	37	8	38279355	38279355	+	Silent	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr8:38279355G>A	ENST00000447712.2	-	8	1982	c.1041C>T	c.(1039-1041)atC>atT	p.I347I	FGFR1_ENST00000532791.1_Silent_p.I347I|FGFR1_ENST00000397091.5_Silent_p.I345I|FGFR1_ENST00000397113.2_Silent_p.I345I|FGFR1_ENST00000397108.4_Silent_p.I345I|FGFR1_ENST00000326324.6_Silent_p.I256I|FGFR1_ENST00000397103.1_Intron|FGFR1_ENST00000356207.5_Silent_p.I258I|RP11-350N15.4_ENST00000528407.1_RNA|FGFR1_ENST00000341462.5_Intron|FGFR1_ENST00000425967.3_Silent_p.I378I|FGFR1_ENST00000335922.5_Silent_p.I339I	NM_001174063.1|NM_015850.3|NM_023110.2	NP_001167534.1|NP_056934.2|NP_075598.2	P11362	FGFR1_HUMAN	fibroblast growth factor receptor 1	347	Ig-like C2-type 3.				angiogenesis (GO:0001525)|auditory receptor cell development (GO:0060117)|axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell maturation (GO:0048469)|cell migration (GO:0016477)|chondrocyte differentiation (GO:0002062)|chordate embryonic development (GO:0043009)|embryonic limb morphogenesis (GO:0030326)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|fibroblast growth factor receptor signaling pathway involved in orbitofrontal cortex development (GO:0035607)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|insulin receptor signaling pathway (GO:0008286)|lung-associated mesenchyme development (GO:0060484)|MAPK cascade (GO:0000165)|mesenchymal cell differentiation (GO:0048762)|midbrain development (GO:0030901)|middle ear morphogenesis (GO:0042474)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ induction (GO:0001759)|outer ear morphogenesis (GO:0042473)|paraxial mesoderm development (GO:0048339)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of phospholipase C activity (GO:0010863)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of branching involved in salivary gland morphogenesis by mesenchymal-epithelial signaling (GO:0060665)|regulation of cell differentiation (GO:0045595)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|regulation of lateral mesodermal cell fate specification (GO:0048378)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|skeletal system morphogenesis (GO:0048705)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ventricular zone neuroblast division (GO:0021847)	cytoplasmic vesicle (GO:0031410)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)		FGFR1/ZNF703(2)	breast(2)|central_nervous_system(7)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(18)|ovary(1)|prostate(1)|stomach(2)|urinary_tract(2)	50	all_cancers(2;9.05e-47)|all_epithelial(2;2.64e-50)|all_lung(3;1.71e-23)|Lung NSC(2;3.61e-23)|Colorectal(12;0.000442)	Breast(189;1.48e-05)|all_lung(54;0.00354)|Lung NSC(58;0.0138)|Hepatocellular(245;0.065)	Epithelial(3;3.96e-34)|all cancers(3;3.06e-30)|BRCA - Breast invasive adenocarcinoma(5;2.28e-21)|COAD - Colon adenocarcinoma(9;0.24)		Palifermin(DB00039)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)	GGGAGAGTCCGATAGAGTTAC	0.537		1	T	"""BCR, FOP, ZNF198, CEP1"""	"""MPD, NHL"""		"""Pfeiffer syndrome, Kallman syndrome"""																														Melanoma(146;1153 1840 21453 21841 43625)			Dom	yes		8	8p11.2-p11.1	2260	fibroblast growth factor receptor 1	yes	L	0								ENSG00000077782						108.0	113.0	111.0					8																	38279355		2142	4288	6430	FGFR1	SO:0001819	synonymous_variant	0			-	HGNC	M34185	CCDS6107.2, CCDS43730.1, CCDS43731.1, CCDS43732.1, CCDS55221.1, CCDS55222.1, CCDS55223.1	8p11.23-p11.22	2014-04-03	2008-08-01		ENSG00000077782	ENSG00000077782	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3688	protein-coding gene	gene with protein product	"""Pfeiffer syndrome"""	136350	"""fms-related tyrosine kinase 2"""	FLT2, KAL2		2162671	Standard	NM_015850		Approved	H2, H3, H4, H5, CEK, FLG, BFGFR, N-SAM, CD331	uc011lbu.2	P11362	OTTHUMG00000147366	ENST00000447712.2:c.1041C>T	8.37:g.38279355G>A		Somatic	0	60	0.00		0.41568620468393047	132	29.79	56	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	36	23.40	A8K6T9|A8K8V5|C1KBH8|P17049|Q02063|Q02065|Q14306|Q14307|Q53H63|Q59H40|Q5BJG2|Q8N685|Q9UD50|Q9UDF0|Q9UDF1|Q9UDF2	Silent	SNP	NA	NA	NA	NA	NA	NA	pirsf_FGF_rcpt_fam,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.I378	ENST00000447712.2	37	c.1134	CCDS6107.2	8																																																																																			-	pirsf_FGF_rcpt_fam,pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.537	FGFR1-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FGFR1	protein_coding		G		-		38279355	-1	no_errors	ENST00000425967	ensembl	human	known	74_37	silent	SNP	1.000	A
ATG3	64422	genome.wustl.edu	37	3	112256658	112256658	+	Missense_Mutation	SNP	G	G	C			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr3:112256658G>C	ENST00000283290.5	-	9	1024	c.590C>G	c.(589-591)aCc>aGc	p.T197S	ATG3_ENST00000495756.1_5'UTR|ATG3_ENST00000402314.2_Missense_Mutation_p.T197S	NM_022488.3	NP_071933.2	Q9NT62	ATG3_HUMAN	autophagy related 3	197					autophagic vacuole assembly (GO:0000045)|cellular protein modification process (GO:0006464)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)|protein targeting to membrane (GO:0006612)|protein ubiquitination (GO:0016567)|regulation of cilium assembly (GO:1902017)	cytoplasmic ubiquitin ligase complex (GO:0000153)|cytosol (GO:0005829)	Atg12 ligase activity (GO:0019777)|Atg8 ligase activity (GO:0019776)|enzyme binding (GO:0019899)|small conjugating protein ligase activity (GO:0019787)			breast(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(3)	9						ATAAGTTCTGGTTTGCAAAAT	0.338																																																	0								ENSG00000144848						112.0	106.0	108.0					3																	112256658		2203	4300	6503	ATG3	SO:0001583	missense	0			-	HGNC		CCDS2966.1, CCDS63721.1	3q13.2	2014-02-12	2012-06-06	2005-09-11	ENSG00000144848	ENSG00000144848			20962	protein-coding gene	gene with protein product		609606	"""APG3 autophagy 3-like (S. cerevisiae)"", ""ATG3 autophagy related 3 homolog (S. cerevisiae)"""	APG3L		11825910	Standard	NM_022488		Approved	PC3-96, FLJ22125, MGC15201, DKFZp564M1178	uc003dzd.3	Q9NT62	OTTHUMG00000159260	ENST00000283290.5:c.590C>G	3.37:g.112256658G>C	ENSP00000283290:p.Thr197Ser	Somatic	0	98	0.00		0.41568620468393047	188	22.31	54	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	53	19.70	Q6PKC5|Q9H6L9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Autophagy-rel_prot_3_N,pfam_Autophagy-rel_prot_3,pfam_Autophagy-rel_prot_3_C	p.T197S	ENST00000283290.5	37	c.590	CCDS2966.1	3	.	.	.	.	.	.	.	.	.	.	G	25.5	4.644782	0.87859	.	.	ENSG00000144848	ENST00000283290;ENST00000402314	.	.	.	5.82	4.94	0.65067	.	0.000000	0.85682	D	0.000000	T	0.81029	0.4738	M	0.84683	2.71	0.80722	D	1	D;D	0.89917	0.994;1.0	D;D	0.97110	0.947;1.0	T	0.82633	-0.0361	9	0.41790	T	0.15	-9.9685	16.3503	0.83202	0.0:0.0:0.867:0.133	.	197;197	Q9NT62;Q9NT62-2	ATG3_HUMAN;.	S	197	.	ENSP00000283290:T197S	T	-	2	0	ATG3	113739348	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.553000	0.82203	1.442000	0.47568	0.655000	0.94253	ACC	-	NULL		0.338	ATG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATG3	protein_coding	OTTHUMT00000354147.1	G	NM_022488	-		112256658	-1	no_errors	ENST00000283290	ensembl	human	known	74_37	missense	SNP	1.000	C
CABP2	51475	genome.wustl.edu	37	11	67287292	67287292	+	Silent	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr11:67287292G>A	ENST00000294288.4	-	6	678	c.609C>T	c.(607-609)ctC>ctT	p.L203L	CABP2_ENST00000353903.5_Silent_p.L146L	NM_016366.2	NP_057450.2	Q9NPB3	CABP2_HUMAN	calcium binding protein 2	203	EF-hand 4. {ECO:0000255|PROSITE- ProRule:PRU00448}.				signal transduction (GO:0007165)	Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(2)|large_intestine(1)|lung(3)|prostate(1)|skin(2)	9						CGTCCCCATTGAGGTCCACGT	0.652																																																	0								ENSG00000167791						93.0	90.0	91.0					11																	67287292		2200	4295	6495	CABP2	SO:0001819	synonymous_variant	0			-	HGNC	AF169154	CCDS8170.1	11q13.1	2013-01-10			ENSG00000167791	ENSG00000167791		"""EF-hand domain containing"""	1385	protein-coding gene	gene with protein product		607314				10625670	Standard	NM_016366		Approved		uc001omc.1	Q9NPB3	OTTHUMG00000168014	ENST00000294288.4:c.609C>T	11.37:g.67287292G>A		Somatic	0	47	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	20	20.00		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_EF_hand_dom,smart_EF_hand_dom,pfscan_EF_hand_dom	p.L203	ENST00000294288.4	37	c.609	CCDS8170.1	11																																																																																			-	pfam_EF_hand_dom,smart_EF_hand_dom,pfscan_EF_hand_dom		0.652	CABP2-002	KNOWN	basic|CCDS	protein_coding	CABP2	protein_coding	OTTHUMT00000397516.1	G		-		67287292	-1	no_errors	ENST00000294288	ensembl	human	known	74_37	silent	SNP	1.000	A
HLA-V	352962	genome.wustl.edu	37	6	29764888	29764888	+	RNA	SNP	T	T	C			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr6:29764888T>C	ENST00000457107.1	+	0	4114									major histocompatibility complex, class I, V (pseudogene)																		acaagaagtatttgatttaca	0.279																																																	0								ENSG00000181126																																			HLA-V			0			-	HGNC	M96332		6p21.3	2012-10-05	2007-12-12	2007-12-12	ENSG00000181126	ENSG00000181126		"""Histocompatibility complex"""	23482	pseudogene	pseudogene			"""HLA-75 pseudogene"""	HLA-75			Standard	NG_002729		Approved	dJ377H14.4			OTTHUMG00000031277		6.37:g.29764888T>C		Somatic	0	39	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	24	22.58		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000457107.1	37	NULL		6																																																																																			-	-		0.279	HLA-V-003	KNOWN	basic	processed_transcript	HLA-V	pseudogene	OTTHUMT00000105231.1	T	NG_002729	-		29764888	+1	no_errors	ENST00000457107	ensembl	human	known	74_37	rna	SNP	0.191	C
ARPP21	10777	genome.wustl.edu	37	3	35779763	35779763	+	Intron	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr3:35779763C>T	ENST00000187397.4	+	16	2100				ARPP21_ENST00000444190.1_Missense_Mutation_p.P514S|ARPP21_ENST00000337271.5_Missense_Mutation_p.P514S|ARPP21_ENST00000417925.1_Missense_Mutation_p.P534S|ARPP21_ENST00000458225.1_Missense_Mutation_p.P534S	NM_016300.4	NP_057384.2	Q9UBL0	ARP21_HUMAN	cAMP-regulated phosphoprotein, 21kDa						cellular response to heat (GO:0034605)	cytoplasm (GO:0005737)	nucleic acid binding (GO:0003676)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(31)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	61						AGTCTCTTTTCCTCCCCAGCA	0.478																																																	0								ENSG00000172995																																			ARPP21	SO:0001627	intron_variant	0			-	HGNC	AA733082	CCDS2661.1, CCDS43063.1, CCDS58823.1, CCDS58824.1	3p24.3	2010-08-12			ENSG00000172995	ENSG00000172995			16968	protein-coding gene	gene with protein product	"""R3H domain containing 3"""	605488				8120638	Standard	NM_198399		Approved	ARPP-21, TARPP, R3HDM3	uc011axy.2	Q9UBL0	OTTHUMG00000130795	ENST00000187397.4:c.1644+909C>T	3.37:g.35779763C>T		Somatic	0	45	0.00		0.41568620468393047	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	25	10.71	B4DG96|Q49AK3|Q49AS6|Q4G0V4|Q6NYC3|Q86V31|Q9UF93	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_R3H_ss-bd,smart_R3H_ss-bd,pfscan_R3H_ss-bd	p.P534S	ENST00000187397.4	37	c.1600	CCDS2661.1	3	.	.	.	.	.	.	.	.	.	.	C	15.34	2.805461	0.50315	.	.	ENSG00000172995	ENST00000458225;ENST00000337271;ENST00000444190;ENST00000417925	T;T;T;T	0.39056	1.1;1.1;1.1;1.1	6.07	5.19	0.71726	.	.	.	.	.	T	0.42675	0.1213	.	.	.	0.22880	N	0.998611	P;P;P	0.42296	0.775;0.617;0.775	B;B;B	0.39660	0.306;0.306;0.306	T	0.40136	-0.9579	8	0.87932	D	0	.	17.6597	0.88188	0.0:0.8773:0.1227:0.0	.	534;56;514	Q9UBL0-3;Q9UBL0-5;Q9UBL0-4	.;.;.	S	534;514;514;534	ENSP00000414351:P534S;ENSP00000337792:P514S;ENSP00000405276:P514S;ENSP00000412326:P534S	ENSP00000337792:P514S	P	+	1	0	ARPP21	35754767	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.709000	0.54853	1.568000	0.49683	0.655000	0.94253	CCT	-	NULL		0.478	ARPP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARPP21	protein_coding	OTTHUMT00000253334.2	C	NM_198399	-		35779763	+1	no_errors	ENST00000417925	ensembl	human	known	74_37	missense	SNP	1.000	T
KCNK10	54207	genome.wustl.edu	37	14	88693813	88693813	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr14:88693813C>T	ENST00000340700.5	-	4	1023	c.572G>A	c.(571-573)gGa>gAa	p.G191E	KCNK10_ENST00000312350.5_Missense_Mutation_p.G196E|KCNK10_ENST00000319231.5_Missense_Mutation_p.G196E	NM_021161.4	NP_066984.1	P57789	KCNKA_HUMAN	potassium channel, subfamily K, member 10	191					signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transport (GO:0006810)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(3)|pancreas(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	47						GAGTGGAATTCCAAAGATGGC	0.423																																																	0								ENSG00000100433						121.0	125.0	123.0					14																	88693813		2203	4300	6503	KCNK10	SO:0001583	missense	0			-	HGNC	AF279890	CCDS9880.1, CCDS9881.1, CCDS9882.1	14q31	2014-06-12						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6273	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 97"""	605873				10880510, 16382106	Standard	NM_021161		Approved	K2p10.1, TREK-2, TREK2, PPP1R97	uc001xwn.3	P57789		ENST00000340700.5:c.572G>A	14.37:g.88693813C>T	ENSP00000343104:p.Gly191Glu	Somatic	0	88	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	39	27.78	B2R8T4|B2RCT3|B5TJL4|Q6B014|Q8TDK7|Q8TDK8|Q9HB59	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_2pore_dom_K_chnl_dom,prints_2pore_dom_K_chnl_TREK,prints_2pore_dom_K_chnl,prints_2pore_dom_K_chnl_TRAAK,prints_2pore_dom_K_chnl_TASK	p.G196E	ENST00000340700.5	37	c.587	CCDS9880.1	14	.	.	.	.	.	.	.	.	.	.	C	24.4	4.523811	0.85600	.	.	ENSG00000100433	ENST00000340700;ENST00000312350;ENST00000319231	T;T;T	0.61859	0.07;0.07;0.07	6.17	5.28	0.74379	Ion transport 2 (1);	0.045672	0.85682	D	0.000000	D	0.85392	0.5686	H	0.98218	4.175	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.997;0.997;0.997	D	0.91365	0.5115	10	0.87932	D	0	.	17.0009	0.86381	0.1285:0.8715:0.0:0.0	.	191;196;196	P57789;B2R8T4;Q6B014	KCNKA_HUMAN;.;.	E	191;196;196	ENSP00000343104:G191E;ENSP00000310568:G196E;ENSP00000312811:G196E	ENSP00000310568:G196E	G	-	2	0	KCNK10	87763566	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.818000	0.86416	1.606000	0.50161	-0.182000	0.12963	GGA	-	pfam_2pore_dom_K_chnl_dom,prints_2pore_dom_K_chnl_TREK,prints_2pore_dom_K_chnl		0.423	KCNK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNK10	protein_coding	OTTHUMT00000410167.1	C	NM_021161	-		88693813	-1	no_errors	ENST00000312350	ensembl	human	known	74_37	missense	SNP	1.000	T
PAXBP1	94104	genome.wustl.edu	37	21	34131506	34131506	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr21:34131506G>A	ENST00000331923.4	-	7	1457	c.1268C>T	c.(1267-1269)tCt>tTt	p.S423F	PAXBP1_ENST00000472588.1_5'UTR|PAXBP1_ENST00000290178.4_Missense_Mutation_p.S423F	NM_016631.3	NP_057715.2	Q9Y5B6	PAXB1_HUMAN	PAX3 and PAX7 binding protein 1	423	Necessary and sufficient for interaction with PAX7. {ECO:0000250}.				muscle organ development (GO:0007517)|positive regulation of histone methylation (GO:0031062)|positive regulation of myoblast proliferation (GO:2000288)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of satellite cell proliferation (GO:0014842)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)										AGCCCTGGTAGAGTCCACTCG	0.418																																																	0								ENSG00000159086						135.0	133.0	134.0					21																	34131506		2203	4300	6503	PAXBP1	SO:0001583	missense	0			-	HGNC	AF231920	CCDS13619.1, CCDS33541.1	21q22.11	2014-01-23	2013-01-08	2013-01-08	ENSG00000159086	ENSG00000159086			13579	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 105"", ""GC-rich sequence DNA-binding factor candidate"""		"""chromosome 21 open reading frame 66"", ""GC-rich sequence DNA-binding factor 1"""	C21orf66, GCFC1		11707072, 22862948	Standard	NM_016631		Approved	GCFC, fSAP105	uc002yqn.3	Q9Y5B6	OTTHUMG00000064980	ENST00000331923.4:c.1268C>T	21.37:g.34131506G>A	ENSP00000328992:p.Ser423Phe	Somatic	0	56	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	39	22.00	D3DSE7|Q96DU8|Q9NYQ0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GCFC_dom	p.S423F	ENST00000331923.4	37	c.1268	CCDS13619.1	21	.	.	.	.	.	.	.	.	.	.	G	23.8	4.461131	0.84317	.	.	ENSG00000159086	ENST00000331923;ENST00000290178	T;T	0.37584	1.61;1.19	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	T	0.64136	0.2571	M	0.78049	2.395	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.76071	0.987;0.97	T	0.64262	-0.6449	10	0.56958	D	0.05	-15.1574	19.7959	0.96481	0.0:0.0:1.0:0.0	.	423;423	Q9Y5B6-2;Q9Y5B6	.;GCFC1_HUMAN	F	423	ENSP00000328992:S423F;ENSP00000290178:S423F	ENSP00000290178:S423F	S	-	2	0	GCFC1	33053377	1.000000	0.71417	0.977000	0.42913	0.991000	0.79684	9.349000	0.97066	2.767000	0.95098	0.591000	0.81541	TCT	-	NULL		0.418	PAXBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAXBP1	protein_coding	OTTHUMT00000139563.1	G	NM_013329	-		34131506	-1	no_errors	ENST00000331923	ensembl	human	known	74_37	missense	SNP	1.000	A
DRP2	1821	genome.wustl.edu	37	X	100513529	100513529	+	Silent	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chrX:100513529C>T	ENST00000395209.3	+	22	3149	c.2622C>T	c.(2620-2622)ctC>ctT	p.L874L	DRP2_ENST00000541709.1_Silent_p.L796L|DRP2_ENST00000402866.1_Silent_p.L874L|DRP2_ENST00000538510.1_Silent_p.L874L	NM_001939.2	NP_001930.2	Q13474	DRP2_HUMAN	dystrophin related protein 2	874					central nervous system development (GO:0007417)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(10)|ovary(3)|prostate(1)|skin(2)|urinary_tract(2)	31						GGGAGCTTCTCCTGCAGGTGA	0.592																																																	0								ENSG00000102385						9.0	8.0	8.0					X																	100513529		2177	4230	6407	DRP2	SO:0001819	synonymous_variant	0			-	HGNC	U43519	CCDS14480.2, CCDS55465.1	Xq22	2008-02-05			ENSG00000102385	ENSG00000102385			3032	protein-coding gene	gene with protein product		300052				8640231	Standard	NM_001939		Approved		uc004egz.2	Q13474	OTTHUMG00000022020	ENST00000395209.3:c.2622C>T	X.37:g.100513529C>T		Somatic	0	30	0.00		0.41568620468393047	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	9	47.06	A6ZKI5|A8K1B0|B1B1F3|B4DIZ0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_EF-hand_dom_typ1,pfam_EF-hand_dom_typ2,pfam_Znf_ZZ,pfam_Spectrin_repeat,pfam_WW_dom,superfamily_WW_dom,smart_Spectrin/alpha-actinin,smart_WW_dom,smart_Znf_ZZ,pirsf_Dystrophin-related_2,pfscan_WW_dom,pfscan_Znf_ZZ	p.L874	ENST00000395209.3	37	c.2622	CCDS14480.2	X																																																																																			-	pirsf_Dystrophin-related_2		0.592	DRP2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DRP2	protein_coding	OTTHUMT00000057522.3	C	NM_001939	-		100513529	+1	no_errors	ENST00000395209	ensembl	human	known	74_37	silent	SNP	0.999	T
PIGN	23556	genome.wustl.edu	37	18	59824376	59824376	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr18:59824376G>A	ENST00000357637.5	-	6	843	c.428C>T	c.(427-429)cCt>cTt	p.P143L	PIGN_ENST00000400334.3_Missense_Mutation_p.P143L	NM_176787.4	NP_789744.1	O95427	PIGN_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class N	143					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity (GO:0016740)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	22		Colorectal(73;0.187)				GGCAAACATAGGCAGGATATC	0.358																																																	0								ENSG00000197563						69.0	67.0	67.0					18																	59824376		1834	4098	5932	PIGN	SO:0001583	missense	0			-	HGNC	AF109219	CCDS45879.1	18q21.33	2013-02-26	2006-06-28		ENSG00000197563	ENSG00000197563		"""Phosphatidylinositol glycan anchor biosynthesis"""	8967	protein-coding gene	gene with protein product		606097	"""phosphatidylinositol glycan, class N"""			10069808, 10574991	Standard	NM_012327		Approved	MDC4, PIG-N	uc021ulb.1	O95427	OTTHUMG00000180098	ENST00000357637.5:c.428C>T	18.37:g.59824376G>A	ENSP00000350263:p.Pro143Leu	Somatic	0	61	0.00		0.41568620468393047	5	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	40	20.00	Q7L8F8|Q8TC01|Q9NT05	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPI_EtnP_transferase_1_C,pfam_Phosphodiest/P_Trfase,pfam_Sulfatase,superfamily_Alkaline_phosphatase_core	p.P143L	ENST00000357637.5	37	c.428	CCDS45879.1	18	.	.	.	.	.	.	.	.	.	.	G	18.42	3.619616	0.66787	.	.	ENSG00000197563	ENST00000357637;ENST00000400334	T;T	0.70986	-0.53;-0.53	5.17	5.17	0.71159	Alkaline phosphatase-like, alpha/beta/alpha (1);Alkaline-phosphatase-like, core domain (1);	0.304009	0.36268	N	0.002699	D	0.83811	0.5335	M	0.82823	2.61	0.80722	D	1	P;P	0.52170	0.951;0.874	P;P	0.58873	0.847;0.695	D	0.84785	0.0775	9	.	.	.	-3.4853	19.028	0.92941	0.0:0.0:1.0:0.0	.	143;143	B2RCI8;O95427	.;PIGN_HUMAN	L	143	ENSP00000350263:P143L;ENSP00000383188:P143L	.	P	-	2	0	PIGN	57975356	1.000000	0.71417	0.955000	0.39395	0.928000	0.56348	5.556000	0.67307	2.554000	0.86153	0.561000	0.74099	CCT	-	pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core		0.358	PIGN-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_principal|CCDS	protein_coding	PIGN	protein_coding	OTTHUMT00000449757.2	G	NM_176787	-		59824376	-1	no_errors	ENST00000357637	ensembl	human	known	74_37	missense	SNP	1.000	A
SLC5A12	159963	genome.wustl.edu	37	11	26714026	26714026	+	Intron	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr11:26714026C>T	ENST00000396005.3	-	9	1463				SLC5A12_ENST00000280467.6_Missense_Mutation_p.S388N	NM_178498.3	NP_848593.2	Q1EHB4	SC5AC_HUMAN	solute carrier family 5 (sodium/monocarboxylate cotransporter), member 12						sodium ion transport (GO:0006814)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(2)|prostate(1)|skin(2)|stomach(1)	35						AGTCCACCAGCTGTACCTACA	0.428																																																	0								ENSG00000148942						95.0	85.0	88.0					11																	26714026		2203	4299	6502	SLC5A12	SO:0001627	intron_variant	0			-	HGNC	BC049207	CCDS7860.2	11p14.2	2013-07-19	2013-07-19		ENSG00000148942	ENSG00000148942		"""Solute carriers"""	28750	protein-coding gene	gene with protein product		612455	"""solute carrier family 5 (sodium/glucose cotransporter), member 12"""			12477932	Standard	NM_178498		Approved	MGC52019, SMCT2	uc001mra.2	Q1EHB4	OTTHUMG00000150706	ENST00000396005.3:c.1153+9G>A	11.37:g.26714026C>T		Somatic	0	64	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	38	22.45	Q86UC7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	p.S388N	ENST00000396005.3	37	c.1163	CCDS7860.2	11	.	.	.	.	.	.	.	.	.	.	C	11.12	1.546486	0.27652	.	.	ENSG00000148942	ENST00000280467	D	0.82619	-1.63	5.88	2.85	0.33270	.	.	.	.	.	T	0.71728	0.3374	.	.	.	0.22226	N	0.999274	B	0.06786	0.001	B	0.08055	0.003	T	0.59397	-0.7462	8	0.41790	T	0.15	.	5.4059	0.16320	0.1471:0.6335:0.1421:0.0773	.	388	Q1EHB4-2	.	N	388	ENSP00000280467:S388N	ENSP00000280467:S388N	S	-	2	0	SLC5A12	26670602	0.005000	0.15991	0.918000	0.36340	0.972000	0.66771	-0.233000	0.09041	0.832000	0.34804	-0.218000	0.12543	AGC	-	pfscan_Na/solute_symporter		0.428	SLC5A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC5A12	protein_coding	OTTHUMT00000319681.1	C	NM_178498	-		26714026	-1	no_errors	ENST00000280467	ensembl	human	known	74_37	missense	SNP	0.852	T
MAGEC1	9947	genome.wustl.edu	37	X	140995998	140995998	+	Silent	SNP	G	G	A	rs368536858		TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chrX:140995998G>A	ENST00000285879.4	+	4	3094	c.2808G>A	c.(2806-2808)acG>acA	p.T936T	MAGEC1_ENST00000406005.2_Silent_p.T3T	NM_005462.4	NP_005453.2	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	936	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(22)|lung(60)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(1)	127	Acute lymphoblastic leukemia(192;6.56e-05)					AGATGCTGACGAATGTCATCA	0.468										HNSCC(15;0.026)																																							0								ENSG00000155495	G		0,3835		0,0,0,1632,571	156.0	145.0	149.0		2808	-0.2	0.0	X		149	1,6727		0,0,1,2428,1871	no	coding-synonymous	MAGEC1	NM_005462.4		0,0,1,4060,2442	AA,AG,A,GG,G		0.0149,0.0,0.0095		936/1143	140995998	1,10562	2203	4300	6503	MAGEC1	SO:0001819	synonymous_variant	0			-	HGNC	AF064589	CCDS35417.1	Xq26	2009-03-18			ENSG00000155495	ENSG00000155495			6812	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 1"""	300223				9485030, 9618514	Standard	NM_005462		Approved	MAGE-C1, CT7, MGC39366, CT7.1	uc004fbt.3	O60732	OTTHUMG00000022569	ENST00000285879.4:c.2808G>A	X.37:g.140995998G>A		Somatic	0	17	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	11	38.89	A0PK03|O75451|Q8TCV4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_MAGE,pfscan_MAGE	p.T936	ENST00000285879.4	37	c.2808	CCDS35417.1	X																																																																																			-	pfam_MAGE,pfscan_MAGE		0.468	MAGEC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAGEC1	protein_coding	OTTHUMT00000058604.1	G	NM_005462	-		140995998	+1	no_errors	ENST00000285879	ensembl	human	known	74_37	silent	SNP	0.001	A
NCAPG2	54892	genome.wustl.edu	37	7	158486169	158486169	+	Silent	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr7:158486169G>A	ENST00000409423.1	-	4	271	c.99C>T	c.(97-99)ttC>ttT	p.F33F	NCAPG2_ENST00000449727.2_Silent_p.F33F|NCAPG2_ENST00000479022.1_5'UTR|NCAPG2_ENST00000356309.3_Silent_p.F33F|NCAPG2_ENST00000409339.3_Silent_p.F33F	NM_001281932.1	NP_001268861.1	Q86XI2	CNDG2_HUMAN	non-SMC condensin II complex, subunit G2	33					chromosome condensation (GO:0030261)|inner cell mass cell proliferation (GO:0001833)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	methylated histone binding (GO:0035064)			NS(1)|breast(1)|endometrium(5)|kidney(5)|large_intestine(7)|liver(1)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	39	Ovarian(565;0.152)	all_cancers(7;3.44e-11)|all_epithelial(9;3.05e-05)|all_hematologic(28;0.014)	OV - Ovarian serous cystadenocarcinoma(82;0.00174)	UCEC - Uterine corpus endometrioid carcinoma (81;0.187)|STAD - Stomach adenocarcinoma(7;0.18)		CATTTAGGCTGAAAGGATCAG	0.318																																																	0								ENSG00000146918						95.0	85.0	88.0					7																	158486169		1816	4087	5903	NCAPG2	SO:0001819	synonymous_variant	0			-	HGNC	BC043404	CCDS43686.1, CCDS64816.1	7q36.3	2006-09-04	2006-09-04	2006-09-04	ENSG00000146918	ENSG00000146918			21904	protein-coding gene	gene with protein product		608532	"""leucine zipper protein 5"""	LUZP5		14532007	Standard	NM_001281933		Approved	FLJ20311, MTB, CAP-G2, hCAP-G2	uc003wnv.1	Q86XI2	OTTHUMG00000151438	ENST00000409423.1:c.99C>T	7.37:g.158486169G>A		Somatic	0	27	0.00		0.41568620468393047	3	80.00	12	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	27	20.59	A4D228|Q7Z3J9|Q8WUG8|Q9BRX6|Q9H8S2|Q9H9K6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Condensin2_G2,superfamily_ARM-type_fold	p.F33	ENST00000409423.1	37	c.99	CCDS43686.1	7																																																																																			-	superfamily_ARM-type_fold		0.318	NCAPG2-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	NCAPG2	protein_coding	OTTHUMT00000327111.1	G	NM_017760	-		158486169	-1	no_errors	ENST00000409339	ensembl	human	known	74_37	silent	SNP	1.000	A
KCNK10	54207	genome.wustl.edu	37	14	88693814	88693814	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr14:88693814C>T	ENST00000340700.5	-	4	1022	c.571G>A	c.(571-573)Gga>Aga	p.G191R	KCNK10_ENST00000312350.5_Missense_Mutation_p.G196R|KCNK10_ENST00000319231.5_Missense_Mutation_p.G196R	NM_021161.4	NP_066984.1	P57789	KCNKA_HUMAN	potassium channel, subfamily K, member 10	191					signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transport (GO:0006810)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(3)|pancreas(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	47						AGTGGAATTCCAAAGATGGCA	0.428																																																	0								ENSG00000100433						120.0	125.0	123.0					14																	88693814		2203	4300	6503	KCNK10	SO:0001583	missense	0			-	HGNC	AF279890	CCDS9880.1, CCDS9881.1, CCDS9882.1	14q31	2014-06-12						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6273	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 97"""	605873				10880510, 16382106	Standard	NM_021161		Approved	K2p10.1, TREK-2, TREK2, PPP1R97	uc001xwn.3	P57789		ENST00000340700.5:c.571G>A	14.37:g.88693814C>T	ENSP00000343104:p.Gly191Arg	Somatic	0	89	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	38	29.63	B2R8T4|B2RCT3|B5TJL4|Q6B014|Q8TDK7|Q8TDK8|Q9HB59	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_2pore_dom_K_chnl_dom,prints_2pore_dom_K_chnl_TREK,prints_2pore_dom_K_chnl,prints_2pore_dom_K_chnl_TRAAK,prints_2pore_dom_K_chnl_TASK	p.G196R	ENST00000340700.5	37	c.586	CCDS9880.1	14	.	.	.	.	.	.	.	.	.	.	C	33	5.213041	0.95069	.	.	ENSG00000100433	ENST00000340700;ENST00000312350;ENST00000319231	T;T;T	0.61627	0.09;0.09;0.09	6.17	6.17	0.99709	Ion transport 2 (1);	0.045672	0.85682	D	0.000000	D	0.86514	0.5951	H	0.98218	4.175	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.994;0.994;0.996	D	0.90179	0.4241	10	0.87932	D	0	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	191;196;196	P57789;B2R8T4;Q6B014	KCNKA_HUMAN;.;.	R	191;196;196	ENSP00000343104:G191R;ENSP00000310568:G196R;ENSP00000312811:G196R	ENSP00000310568:G196R	G	-	1	0	KCNK10	87763567	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.818000	0.86416	2.941000	0.99782	0.655000	0.94253	GGA	-	pfam_2pore_dom_K_chnl_dom,prints_2pore_dom_K_chnl_TREK,prints_2pore_dom_K_chnl		0.428	KCNK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNK10	protein_coding	OTTHUMT00000410167.1	C	NM_021161	-		88693814	-1	no_errors	ENST00000312350	ensembl	human	known	74_37	missense	SNP	1.000	T
FAM167A	83648	genome.wustl.edu	37	8	11301820	11301820	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr8:11301820G>A	ENST00000528897.1	-	2	720	c.101C>T	c.(100-102)aCc>aTc	p.T34I	FAM167A_ENST00000284486.4_Missense_Mutation_p.T34I|FAM167A_ENST00000534308.1_Missense_Mutation_p.T34I|FAM167A_ENST00000531564.1_5'Flank			Q96KS9	F167A_HUMAN	family with sequence similarity 167, member A	34										breast(1)|endometrium(1)|large_intestine(4)|lung(2)|prostate(1)	9						CAGTTTCTCGGTGAGGGCCTT	0.667																																																	0								ENSG00000154319						67.0	76.0	73.0					8																	11301820		2203	4300	6503	FAM167A	SO:0001583	missense	0			-	HGNC		CCDS5981.1	8p23-p22	2010-08-27	2008-06-11	2008-06-11	ENSG00000154319	ENSG00000154319			15549	protein-coding gene	gene with protein product		610085	"""chromosome 8 open reading frame 13"""	C8orf13			Standard	NM_053279		Approved		uc003wtw.2	Q96KS9	OTTHUMG00000129361	ENST00000528897.1:c.101C>T	8.37:g.11301820G>A	ENSP00000436655:p.Thr34Ile	Somatic	0	60	0.00		0.41568620468393047	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	60	9.09	A8K3T9|Q3SXY1|Q3SXY3|Q8N3M3|Q9NSR0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_FAM167	p.T34I	ENST00000528897.1	37	c.101	CCDS5981.1	8	.	.	.	.	.	.	.	.	.	.	G	23.9	4.471133	0.84533	.	.	ENSG00000154319	ENST00000284486;ENST00000534308;ENST00000528897;ENST00000531804	T;T;T;T	0.09073	3.02;3.02;3.02;3.02	5.34	4.47	0.54385	.	0.118903	0.56097	N	0.000034	T	0.14960	0.0361	M	0.76574	2.34	0.53005	D	0.999968	P	0.47106	0.89	B	0.43623	0.425	T	0.01869	-1.1257	10	0.87932	D	0	-41.5097	13.0846	0.59133	0.0766:0.0:0.9234:0.0	.	34	Q96KS9	F167A_HUMAN	I	34	ENSP00000284486:T34I;ENSP00000432232:T34I;ENSP00000436655:T34I;ENSP00000431951:T34I	ENSP00000284486:T34I	T	-	2	0	FAM167A	11339230	1.000000	0.71417	0.785000	0.31869	0.980000	0.70556	9.080000	0.94040	1.497000	0.48584	0.655000	0.94253	ACC	-	NULL		0.667	FAM167A-003	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	FAM167A	protein_coding	OTTHUMT00000383901.1	G		-		11301820	-1	no_errors	ENST00000284486	ensembl	human	known	74_37	missense	SNP	0.995	A
PALB2	79728	genome.wustl.edu	37	16	23647329	23647329	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr16:23647329C>T	ENST00000261584.4	-	4	690	c.538G>A	c.(538-540)Gaa>Aaa	p.E180K		NM_024675.3	NP_078951.2	Q86YC2	PALB2_HUMAN	partner and localizer of BRCA2	180	DNA-binding (with the preference D loop > dsDNA > ssDNA).|Interaction with BRCA1.|Interaction with RAD51.				DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|inner cell mass cell proliferation (GO:0001833)|mesoderm development (GO:0007498)|negative regulation of apoptotic process (GO:0043066)|organ morphogenesis (GO:0009887)|post-anal tail morphogenesis (GO:0036342)|somitogenesis (GO:0001756)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(5)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(21)|ovary(3)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(3)	55				GBM - Glioblastoma multiforme(48;0.0167)		CTGATTTCTTCCTGTTCCTTT	0.393			"""F, N, Mis"""			"""Wilms tumor, medulloblastoma, AML ,breast"""		Involved in tolerance or repair of DNA crosslinks																															yes	Rec		"""Fanconi anaemia N, breast cancer susceptibility """	16	16p12.1	79728	partner and localizer of BRCA2		"""L, O, E"""	0								ENSG00000083093						168.0	167.0	168.0					16																	23647329		2197	4300	6497	PALB2	SO:0001583	missense	0			-	HGNC		CCDS32406.1	16p12.1	2014-09-17				ENSG00000083093		"""Fanconi anemia, complementation groups"""	26144	protein-coding gene	gene with protein product	"""Fanconi anemia, complementation group N"""	610355				16793542, 17200672	Standard	NM_024675		Approved	FLJ21816, FANCN	uc002dlx.1	Q86YC2		ENST00000261584.4:c.538G>A	16.37:g.23647329C>T	ENSP00000261584:p.Glu180Lys	Somatic	0	43	0.00		0.41568620468393047	2	33.33	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	20	16.67	A6NIE1|Q8N7Y6|Q8ND31|Q9H6W1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_WD40_repeat_dom	p.E180K	ENST00000261584.4	37	c.538	CCDS32406.1	16	.	.	.	.	.	.	.	.	.	.	C	12.77	2.036877	0.35893	.	.	ENSG00000083093	ENST00000261584	T	0.16743	2.32	6.08	1.97	0.26223	.	0.583945	0.17460	N	0.173483	T	0.13884	0.0336	M	0.63428	1.95	0.09310	N	1	B	0.32653	0.379	B	0.28553	0.091	T	0.21314	-1.0249	10	0.25106	T	0.35	-5.317	4.8954	0.13748	0.1484:0.623:0.0:0.2286	.	180	Q86YC2	PALB2_HUMAN	K	180	ENSP00000261584:E180K	ENSP00000261584:E180K	E	-	1	0	PALB2	23554830	0.025000	0.19082	0.001000	0.08648	0.102000	0.19082	0.280000	0.18790	0.154000	0.19237	-0.469000	0.05056	GAA	-	NULL		0.393	PALB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PALB2	protein_coding	OTTHUMT00000435287.2	C	NM_024675	-		23647329	-1	no_errors	ENST00000261584	ensembl	human	known	74_37	missense	SNP	0.002	T
ATF7IP	55729	genome.wustl.edu	37	12	14609520	14609520	+	Missense_Mutation	SNP	C	C	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr12:14609520C>A	ENST00000540793.1	+	6	2176	c.2021C>A	c.(2020-2022)cCa>cAa	p.P674Q	ATF7IP_ENST00000541654.1_3'UTR|ATF7IP_ENST00000543189.1_Missense_Mutation_p.P673Q|ATF7IP_ENST00000261168.4_Missense_Mutation_p.P674Q|ATF7IP_ENST00000536444.1_Missense_Mutation_p.P673Q|ATF7IP_ENST00000544627.1_Missense_Mutation_p.P682Q			Q6VMQ6	MCAF1_HUMAN	activating transcription factor 7 interacting protein	674	Interaction with SETDB1.				DNA methylation (GO:0006306)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045898)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)				cervix(1)|endometrium(7)|kidney(5)|large_intestine(10)|liver(2)|lung(22)|ovary(1)|prostate(4)|skin(1)|urinary_tract(1)	54						CCAGTATCACCAGGAAAAACT	0.338																																																	0								ENSG00000171681						109.0	98.0	101.0					12																	14609520		2203	4300	6503	ATF7IP	SO:0001583	missense	0			-	HGNC	AJ242978	CCDS8663.1, CCDS66326.1, CCDS66327.1, CCDS73449.1	12p13.1	2005-11-18				ENSG00000171681			20092	protein-coding gene	gene with protein product		613644				10976766, 10777215	Standard	XM_005253424		Approved	FLJ10688, p621	uc001rbw.3	Q6VMQ6		ENST00000540793.1:c.2021C>A	12.37:g.14609520C>A	ENSP00000444589:p.Pro674Gln	Somatic	0	58	0.00		0.41568620468393047	14	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52	F5GX74|G3V1U0|Q4G0T9|Q6P3T3|Q86XW5|Q9NVJ9|Q9NWC2|Q9Y4X8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	p.P674Q	ENST00000540793.1	37	c.2021	CCDS8663.1	12	.	.	.	.	.	.	.	.	.	.	C	18.31	3.596047	0.66332	.	.	ENSG00000171681	ENST00000261168;ENST00000543189;ENST00000536444;ENST00000544627;ENST00000540793	T;T;T;T;T	0.26373	1.85;1.74;1.85;1.85;1.85	5.75	5.75	0.90469	.	0.085896	0.51477	D	0.000090	T	0.50257	0.1605	L	0.59436	1.845	0.47341	D	0.999395	D;D;D;D;D;D	0.89917	0.999;1.0;0.996;0.998;1.0;1.0	D;D;P;D;D;D	0.81914	0.974;0.995;0.899;0.962;0.992;0.995	T	0.43572	-0.9383	10	0.87932	D	0	-14.0076	19.2924	0.94105	0.0:1.0:0.0:0.0	.	682;673;673;674;673;285	B4E2A2;B4DRL6;G3V1U0;Q6VMQ6;Q6VMQ6-2;B3KQF8	.;.;.;MCAF1_HUMAN;.;.	Q	674;673;673;682;674	ENSP00000261168:P674Q;ENSP00000443179:P673Q;ENSP00000445955:P673Q;ENSP00000440440:P682Q;ENSP00000444589:P674Q	ENSP00000261168:P674Q	P	+	2	0	ATF7IP	14500787	1.000000	0.71417	1.000000	0.80357	0.427000	0.31564	4.686000	0.61700	2.878000	0.98634	0.650000	0.86243	CCA	-	NULL		0.338	ATF7IP-024	KNOWN	basic|appris_candidate|CCDS	protein_coding	ATF7IP	protein_coding	OTTHUMT00000401400.1	C	NM_018179	-		14609520	+1	no_errors	ENST00000261168	ensembl	human	known	74_37	missense	SNP	1.000	A
LRP1B	53353	genome.wustl.edu	37	2	142238083	142238083	+	Silent	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr2:142238083G>A	ENST00000389484.3	-	3	1196	c.225C>T	c.(223-225)atC>atT	p.I75I		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	75					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		AGGGGCACTTGATTTCTACCT	0.408										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)												0								ENSG00000168702						128.0	115.0	120.0					2																	142238083		2203	4300	6503	LRP1B	SO:0001819	synonymous_variant	0			-	HGNC	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.225C>T	2.37:g.142238083G>A		Somatic	0	74	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	41	10.87	Q8WY29|Q8WY30|Q8WY31	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,pfam_EG-like_dom,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.I75	ENST00000389484.3	37	c.225	CCDS2182.1	2																																																																																			-	superfamily_LDrepeatLR_classA_rpt		0.408	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1B	protein_coding	OTTHUMT00000254736.2	G	NM_018557	-		142238083	-1	no_errors	ENST00000389484	ensembl	human	known	74_37	silent	SNP	1.000	A
DDHD1	80821	genome.wustl.edu	37	14	53522448	53522448	+	Silent	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr14:53522448C>T	ENST00000323669.5	-	10	2174	c.2175G>A	c.(2173-2175)gtG>gtA	p.V725V	DDHD1_ENST00000555621.1_5'Flank|DDHD1_ENST00000395606.1_Silent_p.V732V|DDHD1_ENST00000357758.3_Silent_p.V725V	NM_001160148.1	NP_001153620.1	Q8NEL9	DDHD1_HUMAN	DDHD domain containing 1	725	DDHD. {ECO:0000255|PROSITE- ProRule:PRU00378}.				cell death (GO:0008219)|lipid catabolic process (GO:0016042)	cytoplasm (GO:0005737)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|lung(11)|ovary(3)|prostate(1)	25	Breast(41;0.037)					CTGGTGAGGTCACAGGGCTTG	0.398																																																	0								ENSG00000100523						202.0	196.0	198.0					14																	53522448		2203	4300	6503	DDHD1	SO:0001819	synonymous_variant	0			-	HGNC	AB051492	CCDS9714.1, CCDS53895.1, CCDS53896.1	14q21	2012-11-23			ENSG00000100523	ENSG00000100523			19714	protein-coding gene	gene with protein product	"""phosphatidic acid-preferring phospholipase A1"""	614603	"""spastic paraplegia 28 (autosomal recessive)"""	SPG28		11214970, 20359546	Standard	NM_030637		Approved	KIAA1705, PA-PLA1	uc001xai.3	Q8NEL9	OTTHUMG00000140305	ENST00000323669.5:c.2175G>A	14.37:g.53522448C>T		Somatic	0	104	0.00		0.41568620468393047	7	12.50	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	70	23.08	G5E9D1|Q8WVH3|Q96LL2|Q9C0F8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_DDHD,pfscan_DDHD	p.V725	ENST00000323669.5	37	c.2175	CCDS53895.1	14																																																																																			-	pfam_DDHD,pfscan_DDHD		0.398	DDHD1-003	KNOWN	basic|exp_conf|CCDS	protein_coding	DDHD1	protein_coding	OTTHUMT00000276901.1	C		-		53522448	-1	no_errors	ENST00000323669	ensembl	human	known	74_37	silent	SNP	0.841	T
ZMYM4	9202	genome.wustl.edu	37	1	35857875	35857875	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr1:35857875C>T	ENST00000314607.6	+	16	2730	c.2650C>T	c.(2650-2652)Cca>Tca	p.P884S	ZMYM4_ENST00000373297.2_Missense_Mutation_p.P795S	NM_005095.2	NP_005086.2	Q5VZL5	ZMYM4_HUMAN	zinc finger, MYM-type 4	884					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(13)|lung(16)|ovary(2)|prostate(3)|skin(2)	54		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				AGATTCGACTCCAGTTATAGC	0.418																																																	0								ENSG00000146463						77.0	74.0	75.0					1																	35857875		2203	4300	6503	ZMYM4	SO:0001583	missense	0			-	HGNC	AB007885	CCDS389.1	1p34-p32	2013-01-08	2005-12-19	2005-12-19	ENSG00000146463	ENSG00000146463		"""Zinc fingers, MYM type"""	13055	protein-coding gene	gene with protein product		613568	"""zinc finger protein 262"""	ZNF262		10449923	Standard	NM_005095		Approved	KIAA0425, ZNF198L3, MYM	uc001byt.3	Q5VZL5	OTTHUMG00000004241	ENST00000314607.6:c.2650C>T	1.37:g.35857875C>T	ENSP00000322915:p.Pro884Ser	Somatic	0	48	0.00		0.41568620468393047	10	28.57	4	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	28	15.15	A0JP19|A0JP20|O43308|Q5T5E1|Q5T5E2|Q7L3Q4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF3504,pfam_Znf_MYM,smart_TRASH_dom	p.P884S	ENST00000314607.6	37	c.2650	CCDS389.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	26.3|26.3	4.723103|4.723103	0.89298|0.89298	.|.	.|.	ENSG00000146463|ENSG00000146463	ENST00000314607;ENST00000373297|ENST00000457946	T;T|.	0.37235|.	1.23;1.21|.	4.98|4.98	4.98|4.98	0.66077|0.66077	.|.	0.057676|.	0.64402|.	D|.	0.000001|.	T|T	0.76463|0.76463	0.3991|0.3991	M|M	0.74647|0.74647	2.275|2.275	0.58432|0.58432	D|D	0.999997|0.999997	P|.	0.49307|.	0.922|.	P|.	0.51355|.	0.667|.	T|T	0.76691|0.76691	-0.2866|-0.2866	10|5	0.39692|.	T|.	0.17|.	-8.3923|-8.3923	18.5957|18.5957	0.91228|0.91228	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	884|.	Q5VZL5|.	ZMYM4_HUMAN|.	S|F	884;795|543	ENSP00000322915:P884S;ENSP00000362394:P795S|.	ENSP00000322915:P884S|.	P|S	+|+	1|2	0|0	ZMYM4|ZMYM4	35630462|35630462	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.984000|0.984000	0.73092|0.73092	6.475000|6.475000	0.73582|0.73582	2.465000|2.465000	0.83290|0.83290	0.591000|0.591000	0.81541|0.81541	CCA|TCC	-	NULL		0.418	ZMYM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZMYM4	protein_coding	OTTHUMT00000012207.3	C	NM_005095	-		35857875	+1	no_errors	ENST00000314607	ensembl	human	known	74_37	missense	SNP	1.000	T
HMBOX1	79618	genome.wustl.edu	37	8	28906844	28906844	+	Intron	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr8:28906844G>A	ENST00000397358.3	+	10	1829				HMBOX1_ENST00000355231.5_Intron|HMBOX1_ENST00000519047.1_Intron|RNA5SP260_ENST00000363849.1_RNA|HMBOX1_ENST00000524238.1_Missense_Mutation_p.G387E|HMBOX1_ENST00000287701.10_Intron|HMBOX1_ENST00000444075.1_Missense_Mutation_p.G387E|HMBOX1_ENST00000558662.1_Missense_Mutation_p.G387E|HMBOX1_ENST00000517386.1_Intron	NM_024567.3	NP_078843.2	Q6NT76	HMBX1_HUMAN	homeobox containing 1						negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)	11		Ovarian(32;0.0192)		KIRC - Kidney renal clear cell carcinoma(542;0.135)|Kidney(114;0.161)		gaggaggagggaagaagttca	0.463																																																	0								ENSG00000147421																																			HMBOX1	SO:0001627	intron_variant	0			-	HGNC	AY522342	CCDS6071.1	8p12	2013-05-23			ENSG00000147421	ENSG00000147421		"""Homeoboxes / HNF class"""	26137	protein-coding gene	gene with protein product	"""homeobox telomere-binding protein 1"""					16825764	Standard	NM_024567		Approved	HNF1LA, PBHNF, FLJ21616, HOT1	uc003xhd.4	Q6NT76	OTTHUMG00000172138	ENST00000397358.3:c.1125+279G>A	8.37:g.28906844G>A		Somatic	0	33	0.00		0.41568620468393047	1	66.67	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	20	28.57	A4K385|A8K3R8|B4DHY5|D3DSU0|Q3Y6P1|Q96GS5|Q9H701	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_HNF-1_N,pfam_Homeobox_dom,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	p.G387E	ENST00000397358.3	37	c.1160	CCDS6071.1	8	.	.	.	.	.	.	.	.	.	.	G	13.27	2.187133	0.38609	.	.	ENSG00000147421	ENST00000444075;ENST00000524238;ENST00000355231	D;D	0.99853	-7.18;-7.18	4.97	4.97	0.65823	.	.	.	.	.	D	0.99077	0.9683	.	.	.	0.80722	D	1	B;B	0.33964	0.434;0.434	B;B	0.28465	0.09;0.09	D	0.99982	1.2661	8	0.30078	T	0.28	.	13.2113	0.59825	0.0:0.0:0.8406:0.1594	.	387;387	Q6NT76-5;Q6NT76-2	.;.	E	387	ENSP00000401769:G387E;ENSP00000430110:G387E	ENSP00000347371:G387E	G	+	2	0	HMBOX1	28962763	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.023000	0.70848	2.290000	0.77057	0.561000	0.74099	GGA	-	NULL		0.463	HMBOX1-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	HMBOX1	protein_coding	OTTHUMT00000255267.4	G	NM_024567	-		28906844	+1	no_errors	ENST00000444075	ensembl	human	known	74_37	missense	SNP	1.000	A
POFUT1	23509	genome.wustl.edu	37	20	30822451	30822451	+	Missense_Mutation	SNP	G	G	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr20:30822451G>T	ENST00000375749.3	+	7	1216	c.1154G>T	c.(1153-1155)cGg>cTg	p.R385L	POFUT1_ENST00000539210.1_Missense_Mutation_p.R174L	NM_015352.1	NP_056167.1	Q9H488	OFUT1_HUMAN	protein O-fucosyltransferase 1	385					angiogenesis (GO:0001525)|embryo development (GO:0009790)|fucose metabolic process (GO:0006004)|heart development (GO:0007507)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|O-glycan processing (GO:0016266)|protein O-linked fucosylation (GO:0036066)|protein O-linked glycosylation (GO:0006493)|regulation of transcription, DNA-templated (GO:0006355)|somitogenesis (GO:0001756)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	fucosyltransferase activity (GO:0008417)|peptide-O-fucosyltransferase activity (GO:0046922)			breast(1)|endometrium(1)|large_intestine(1)|lung(2)|urinary_tract(1)	6			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)			CCTAAGCTGCGGGACGAGTTC	0.627																																																	0								ENSG00000101346						56.0	56.0	56.0					20																	30822451		2203	4300	6503	POFUT1	SO:0001583	missense	0			-	HGNC	AF375884	CCDS13198.1, CCDS13199.1	20q11	2013-03-06			ENSG00000101346	ENSG00000101346	2.4.1.221	"""Fucosyltransferases"""	14988	protein-coding gene	gene with protein product	"""peptide-O-fucosyltransferase"", ""GDP-fucose protein O-fucosyltransferase 1"""	607491				9023546, 9525914	Standard	NM_015352		Approved	O-FUT, O-Fuc-T, KIAA0180, FUT12	uc002wxp.3	Q9H488	OTTHUMG00000133268	ENST00000375749.3:c.1154G>T	20.37:g.30822451G>T	ENSP00000364902:p.Arg385Leu	Somatic	0	20	0.00		0.41568620468393047	43	2.17	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	16	20.00	A8K4R8|E1P5M4|Q14685|Q5W185|Q9BW76	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GDP-Fuc_O-FucTrfase	p.R385L	ENST00000375749.3	37	c.1154	CCDS13198.1	20	.	.	.	.	.	.	.	.	.	.	G	18.82	3.705015	0.68615	.	.	ENSG00000101346	ENST00000375749;ENST00000539210	T;T	0.33865	1.39;1.4	5.37	5.37	0.77165	.	0.249820	0.40728	N	0.001039	T	0.34948	0.0915	L	0.56769	1.78	0.51482	D	0.999923	P	0.40794	0.729	B	0.37480	0.251	T	0.18241	-1.0343	10	0.49607	T	0.09	-24.0802	12.7758	0.57445	0.0753:0.0:0.9247:0.0	.	385	Q9H488	OFUT1_HUMAN	L	385;174	ENSP00000364902:R385L;ENSP00000446154:R174L	ENSP00000364902:R385L	R	+	2	0	POFUT1	30286112	1.000000	0.71417	1.000000	0.80357	0.872000	0.50106	6.368000	0.73104	2.670000	0.90874	0.650000	0.86243	CGG	-	NULL		0.627	POFUT1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	POFUT1	protein_coding	OTTHUMT00000078613.1	G	NM_015352	-		30822451	+1	no_errors	ENST00000375749	ensembl	human	known	74_37	missense	SNP	1.000	T
GTF2IRD2P1	401375	genome.wustl.edu	37	7	72664015	72664016	+	RNA	INS	-	-	G	rs202030378|rs372212945	byFrequency	TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr7:72664015_72664016insG	ENST00000425256.1	-	0	884_885									GTF2I repeat domain containing 2 pseudogene 1																		ATACCACCCCCGGGGCATGCCA	0.505													GGGGG|GGGG|GGGGG|deletion	3786	0.75599	0.7247	0.8242	5008	,	,		6539	0.7212		0.8101	False		,,,				2504	0.7301																0								ENSG00000214544																																			GTF2IRD2P1			0				HGNC	AY312852		7q11.23	2010-03-19	2010-02-09	2010-02-09	ENSG00000214544	ENSG00000214544			33127	pseudogene	pseudogene			"""GTF2I repeat domain containing 2 pseudogene"""	GTF2IRD2P		15100712	Standard	NG_033736		Approved		uc003txs.1		OTTHUMG00000156803		7.37:g.72664019_72664019dupG		Somatic	0	19	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	11	26.67		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000425256.1	37	NULL		7																																																																																			-	-		0.505	GTF2IRD2P1-002	KNOWN	basic	processed_transcript	GTF2IRD2P1	pseudogene	OTTHUMT00000345921.1	-	NR_002164			72664016	-1	no_errors	ENST00000425256	ensembl	human	known	74_37	rna	INS	0.912:0.964	G
IGSF22	283284	genome.wustl.edu	37	11	18735572	18735572	+	Missense_Mutation	SNP	C	C	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr11:18735572C>A	ENST00000513874.1	-	14	2061	c.1922G>T	c.(1921-1923)tGg>tTg	p.W641L	RP11-1081L13.4_ENST00000527285.1_RNA	NM_173588.3	NP_775859	Q8N9C0	IGS22_HUMAN	immunoglobulin superfamily, member 22	641	Ig-like 4.									NS(2)|autonomic_ganglia(1)|breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(20)|ovary(4)|prostate(4)|skin(3)	56						ATCCTTGTACCATGTCACTTT	0.597																																																	0								ENSG00000179057						117.0	122.0	120.0					11																	18735572		2176	4259	6435	IGSF22	SO:0001583	missense	0			-	HGNC	AK095113	CCDS41625.1, CCDS41625.2	11p15.1	2014-06-06			ENSG00000179057	ENSG00000179057		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	26750	protein-coding gene	gene with protein product							Standard	NM_173588		Approved	FLJ37794	uc009yht.2	Q8N9C0	OTTHUMG00000160502	ENST00000513874.1:c.1922G>T	11.37:g.18735572C>A	ENSP00000421191:p.Trp641Leu	Somatic	0	69	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	A6NNA0|D6RGV7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.W641L	ENST00000513874.1	37	c.1922	CCDS41625.2	11	.	.	.	.	.	.	.	.	.	.	C	19.70	3.876618	0.72180	.	.	ENSG00000179057	ENST00000513874	D	0.96265	-3.96	4.11	2.2	0.27929	.	0.000000	0.32503	U	0.006018	D	0.98807	0.9598	H	0.99834	4.825	0.24000	N	0.996212	D	0.64830	0.994	D	0.76575	0.988	D	0.93987	0.7263	10	0.45353	T	0.12	.	7.7158	0.28704	0.0:0.7948:0.0:0.2052	.	641	D6RGV7	.	L	641	ENSP00000421191:W641L	ENSP00000322422:W641L	W	-	2	0	IGSF22	18692148	1.000000	0.71417	0.945000	0.38365	0.991000	0.79684	4.140000	0.58031	0.384000	0.24942	0.551000	0.68910	TGG	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.597	IGSF22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGSF22	protein_coding	OTTHUMT00000360850.2	C	NM_173588	-		18735572	-1	no_errors	ENST00000513874	ensembl	human	known	74_37	missense	SNP	1.000	A
PCSK1	5122	genome.wustl.edu	37	5	95728839	95728839	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr5:95728839G>A	ENST00000311106.3	-	14	2365	c.2128C>T	c.(2128-2130)Cct>Tct	p.P710S	PCSK1_ENST00000508626.1_Missense_Mutation_p.P663S|CTD-2337A12.1_ENST00000502645.2_RNA|PCSK1_ENST00000513085.1_5'UTR	NM_000439.4|NM_001177876.1	NP_000430.3|NP_001171347.1	P29120	NEC1_HUMAN	proprotein convertase subtilisin/kexin type 1	710					cell-cell signaling (GO:0007267)|cellular protein metabolic process (GO:0044267)|metabolic process (GO:0008152)|peptide biosynthetic process (GO:0043043)|peptide hormone processing (GO:0016486)|proteolysis (GO:0006508)|regulation of insulin secretion (GO:0050796)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|secretory granule lumen (GO:0034774)	serine-type endopeptidase activity (GO:0004252)			NS(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(14)|ovary(2)|prostate(3)|skin(3)|urinary_tract(2)	36		all_cancers(142;2.67e-06)|all_epithelial(76;6.92e-09)|all_lung(232;0.00307)|Lung NSC(167;0.00452)|Ovarian(225;0.0112)|Colorectal(57;0.0341)|Breast(839;0.244)		all cancers(79;3.44e-16)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	AGCTGGGAAGGTTTGTTCAGC	0.418																																																	0								ENSG00000175426						123.0	129.0	127.0					5																	95728839		2203	4300	6503	PCSK1	SO:0001583	missense	0			-	HGNC		CCDS4081.1, CCDS54881.1	5q15-q21	2008-07-18			ENSG00000175426	ENSG00000175426			8743	protein-coding gene	gene with protein product	"""prohormone convertase 3"", ""prohormone convertase 1"", ""neuroendocrine convertase 1"", ""proprotein convertase 1"""	162150		NEC1		1765368	Standard	NM_000439		Approved	PC1, PC3, SPC3	uc003kls.2	P29120	OTTHUMG00000122089	ENST00000311106.3:c.2128C>T	5.37:g.95728839G>A	ENSP00000308024:p.Pro710Ser	Somatic	0	80	0.00		0.41568620468393047	7	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	58	18.31	B7Z8T7|E9PHA1|P78478|Q92532	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_S8/S53_dom,pfam_PrprotnconvertsP,pfam_Proho_convert,superfamily_Peptidase_S8/S53_dom,superfamily_Galactose-bd-like,superfamily_Prot_inh_propept,prints_Peptidase_S8_subtilisin-rel	p.P710S	ENST00000311106.3	37	c.2128	CCDS4081.1	5	.	.	.	.	.	.	.	.	.	.	G	15.42	2.829656	0.50845	.	.	ENSG00000175426	ENST00000311106;ENST00000508626	T;T	0.65178	0.02;-0.14	5.76	5.76	0.90799	.	0.187119	0.47852	D	0.000202	T	0.54062	0.1835	L	0.47716	1.5	0.40281	D	0.97839	B;B	0.30068	0.267;0.075	B;B	0.22753	0.041;0.018	T	0.51639	-0.8680	10	0.26408	T	0.33	-15.1607	15.903	0.79397	0.0:0.1354:0.8646:0.0	.	663;710	E9PHA1;P29120	.;NEC1_HUMAN	S	710;663	ENSP00000308024:P710S;ENSP00000421600:P663S	ENSP00000308024:P710S	P	-	1	0	PCSK1	95754595	1.000000	0.71417	0.987000	0.45799	0.997000	0.91878	3.901000	0.56303	2.713000	0.92767	0.655000	0.94253	CCT	-	NULL		0.418	PCSK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCSK1	protein_coding	OTTHUMT00000242851.1	G	NM_000439	-		95728839	-1	no_errors	ENST00000311106	ensembl	human	known	74_37	missense	SNP	0.970	A
CHRND	1144	genome.wustl.edu	37	2	233399032	233399032	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr2:233399032G>A	ENST00000258385.3	+	11	1383	c.1351G>A	c.(1351-1353)Gac>Aac	p.D451N	CHRND_ENST00000543200.1_Missense_Mutation_p.D436N|CHRND_ENST00000457943.2_Missense_Mutation_p.D257N	NM_000751.2	NP_000742.1	Q07001	ACHD_HUMAN	cholinergic receptor, nicotinic, delta (muscle)	451					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|muscle contraction (GO:0006936)|musculoskeletal movement (GO:0050881)|neuromuscular process (GO:0050905)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|skeletal muscle tissue growth (GO:0048630)|synaptic transmission (GO:0007268)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine-activated cation-selective channel activity (GO:0004889)			breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|liver(1)|lung(17)|ovary(3)|prostate(1)|skin(1)|stomach(1)	34		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;1.89e-16)|BRCA - Breast invasive adenocarcinoma(100;0.00078)|Lung(119;0.00579)|LUSC - Lung squamous cell carcinoma(224;0.00754)	Galantamine(DB00674)	CCACATGAGGGACCAGAACAA	0.507																																																	0								ENSG00000135902						73.0	72.0	72.0					2																	233399032		2203	4300	6503	CHRND	SO:0001583	missense	0			-	HGNC	X55019	CCDS2494.1, CCDS58754.1	2q37.1	2012-02-11	2012-02-07		ENSG00000135902	ENSG00000135902		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1965	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, delta (muscle)"""	100720	"""cholinergic receptor, nicotinic, delta"""	ACHRD			Standard	NM_000751		Approved		uc002vsw.4	Q07001	OTTHUMG00000133261	ENST00000258385.3:c.1351G>A	2.37:g.233399032G>A	ENSP00000258385:p.Asp451Asn	Somatic	0	39	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	31	13.89	A8K661|B4DT92|Q52LH4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,prints_Nicotinic_acetylcholine_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.D451N	ENST00000258385.3	37	c.1351	CCDS2494.1	2	.	.	.	.	.	.	.	.	.	.	g	15.19	2.760849	0.49468	.	.	ENSG00000135902	ENST00000543200;ENST00000258385;ENST00000457943	D;D;D	0.85258	-1.96;-1.96;-1.96	5.19	5.19	0.71726	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.250123	0.45361	D	0.000364	T	0.72875	0.3515	N	0.17723	0.515	0.43054	D	0.994668	P;B;B;B	0.34615	0.459;0.033;0.033;0.033	B;B;B;B	0.35114	0.196;0.064;0.038;0.038	T	0.70022	-0.4986	10	0.09590	T	0.72	.	12.1201	0.53887	0.0786:0.0:0.9214:0.0	.	257;436;451;451	B4E3W4;B4DT92;A8K661;Q07001	.;.;.;ACHD_HUMAN	N	436;451;257	ENSP00000438380:D436N;ENSP00000258385:D451N;ENSP00000391055:D257N	ENSP00000258385:D451N	D	+	1	0	CHRND	233107276	0.924000	0.31332	0.996000	0.52242	0.990000	0.78478	2.969000	0.49232	2.430000	0.82344	0.457000	0.33378	GAC	-	pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM,tigrfam_Neur_channel		0.507	CHRND-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRND	protein_coding	OTTHUMT00000257038.2	G		-		233399032	+1	no_errors	ENST00000258385	ensembl	human	known	74_37	missense	SNP	0.933	A
PNP	4860	genome.wustl.edu	37	14	20943187	20943187	+	Intron	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr14:20943187C>T	ENST00000361505.5	+	5	607				RP11-203M5.8_ENST00000554678.1_lincRNA	NM_000270.3	NP_000261.2	P01298	PAHO_HUMAN	purine nucleoside phosphorylase						digestion (GO:0007586)|protein secretion (GO:0009306)	extracellular region (GO:0005576)	hormone activity (GO:0005179)|receptor binding (GO:0005102)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(2)|stomach(2)	10						TTTTAAAATTCCGTTTATGTG	0.443																																																	0								ENSG00000258908						55.0	57.0	56.0					14																	20943187		2203	4300	6503	RP11-203M5.8	SO:0001627	intron_variant	0			-	Clone_based_vega_gene		CCDS9552.1	14q11.2	2014-09-17	2009-12-02	2009-12-02	ENSG00000198805	ENSG00000198805	2.4.2.1		7892	protein-coding gene	gene with protein product		164050	"""nucleoside phosphorylase"""	NP		6087295	Standard	NM_000270		Approved	PUNP	uc001vxo.4	P00491	OTTHUMG00000029546	ENST00000361505.5:c.462-34C>T	14.37:g.20943187C>T		Somatic	0	39	0.00		0.41568620468393047	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	24	25.00		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000361505.5	37	NULL	CCDS9552.1	14																																																																																			-	-		0.443	PNP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000258908	protein_coding	OTTHUMT00000073646.2	C	NM_000270.2	-		20943187	-1	no_errors	ENST00000554678	ensembl	human	known	74_37	rna	SNP	0.000	T
FAM120C	54954	genome.wustl.edu	37	X	54209302	54209303	+	In_Frame_Ins	INS	-	-	GGCGGC			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chrX:54209302_54209303insGGCGGC	ENST00000375180.2	-	1	385_386	c.329_330insGCCGCC	c.(328-330)ccc>ccGCCGCCc	p.110_110P>PPP	FAM120C_ENST00000497680.1_5'Flank|FAM120C_ENST00000477084.1_In_Frame_Ins_p.110_110P>PPP|FAM120C_ENST00000328235.4_In_Frame_Ins_p.110_110P>PPP	NM_017848.4	NP_060318.3	Q9NX05	F120C_HUMAN	family with sequence similarity 120C	110							poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	28						GCAGCTGAGGGGGCGGCGGCGG	0.748														77	0.0203974	0.0045	0.0159	3775	,	,		9228	0.0		0.0467	False		,,,				2504	0.0133																0								ENSG00000184083																																			FAM120C	SO:0001652	inframe_insertion	0				HGNC	AY150025	CCDS14356.1, CCDS55421.1, CCDS75987.1	Xp11.22	2011-04-13	2006-07-04	2006-07-04	ENSG00000184083	ENSG00000184083			16949	protein-coding gene	gene with protein product		300741	"""chromosome X open reading frame 17"""	CXorf17		14585507	Standard	XM_006724589		Approved	ORF34, FLJ20506	uc004dsz.4	Q9NX05	OTTHUMG00000021625	ENST00000375180.2:c.324_329dupGCCGCC	X.37:g.54209303_54209308dupGGCGGC	ENSP00000364324:p.ProPro110dup	Somatic	NA	NA	NA		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B2RMT7	In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	NULL	p.112in_frame_insPP	ENST00000375180.2	37	c.330_329	CCDS14356.1	X																																																																																			-	NULL		0.748	FAM120C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM120C	protein_coding	OTTHUMT00000056795.2	-	NM_017848			54209303	-1	no_errors	ENST00000375180	ensembl	human	known	74_37	in_frame_ins	INS	0.999:0.998	GGCGGC
TTN	7273	genome.wustl.edu	37	2	179655564	179655564	+	Silent	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr2:179655564C>T	ENST00000591111.1	-	11	1895	c.1671G>A	c.(1669-1671)caG>caA	p.Q557Q	TTN_ENST00000342992.6_Silent_p.Q557Q|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN_ENST00000589042.1_Silent_p.Q557Q|TTN_ENST00000342175.6_Intron|TTN_ENST00000360870.5_Silent_p.Q557Q			Q8WZ42	TITIN_HUMAN	titin	0					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCTCAGTTTCCTGTCTTATCT	0.403																																																	0								ENSG00000155657						150.0	138.0	143.0					2																	179655564		2203	4300	6503	TTN	SO:0001819	synonymous_variant	0			-	HGNC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.1671G>A	2.37:g.179655564C>T		Somatic	0	108	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	56	11.11	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.Q557	ENST00000591111.1	37	c.1671		2																																																																																			-	pfam_Titin_Z,superfamily_RNaseH-like_dom		0.403	TTN-019	PUTATIVE	basic	protein_coding	TTN	protein_coding	OTTHUMT00000460310.1	C	NM_133378	-		179655564	-1	no_errors	ENST00000342992	ensembl	human	known	74_37	silent	SNP	1.000	T
TSPAN8	7103	genome.wustl.edu	37	12	71533551	71533551	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr12:71533551C>T	ENST00000393330.2	-	7	753	c.201G>A	c.(199-201)atG>atA	p.M67I	TSPAN8_ENST00000552786.1_5'Flank|TSPAN8_ENST00000247829.3_Missense_Mutation_p.M67I|TSPAN8_ENST00000552128.1_5'Flank|TSPAN8_ENST00000546561.1_Missense_Mutation_p.M67I			P19075	TSN8_HUMAN	tetraspanin 8	67					negative regulation of blood coagulation (GO:0030195)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|cervix(2)|kidney(1)|large_intestine(3)|lung(7)|skin(3)|urinary_tract(1)	19			LUSC - Lung squamous cell carcinoma(43;0.24)|OV - Ovarian serous cystadenocarcinoma(12;0.244)			AGCCCAGAATCATGATGATGG	0.443																																																	0								ENSG00000127324						167.0	161.0	163.0					12																	71533551		2203	4300	6503	TSPAN8	SO:0001583	missense	0			-	HGNC	M35252	CCDS8999.1	12q14.1-q21.1	2013-02-14	2005-03-21	2005-03-21		ENSG00000127324		"""Tetraspanins"""	11855	protein-coding gene	gene with protein product		600769	"""transmembrane 4 superfamily member 3"""	TM4SF3		2395876	Standard	NM_004616		Approved	CO-029	uc001swj.1	P19075		ENST00000393330.2:c.201G>A	12.37:g.71533551C>T	ENSP00000377003:p.Met67Ile	Somatic	0	33	0.00		0.41568620468393047	3	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	19	34.48	B2R7T7|Q9BS78	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2,prints_Tetraspanin	p.M67I	ENST00000393330.2	37	c.201	CCDS8999.1	12	.	.	.	.	.	.	.	.	.	.	C	15.57	2.871811	0.51695	.	.	ENSG00000127324	ENST00000393330;ENST00000247829;ENST00000546561	T;T;T	0.78707	-1.2;-1.2;-1.2	5.18	5.18	0.71444	Tetraspanin, conserved site (1);	0.131415	0.64402	D	0.000004	D	0.87676	0.6237	M	0.81112	2.525	0.80722	D	1	D	0.76494	0.999	D	0.68621	0.959	D	0.87253	0.2274	10	0.40728	T	0.16	.	16.5795	0.84711	0.0:1.0:0.0:0.0	.	67	P19075	TSN8_HUMAN	I	67	ENSP00000377003:M67I;ENSP00000247829:M67I;ENSP00000447160:M67I	ENSP00000247829:M67I	M	-	3	0	TSPAN8	69819818	1.000000	0.71417	0.997000	0.53966	0.126000	0.20510	2.495000	0.45337	2.572000	0.86782	0.655000	0.94253	ATG	-	pfam_Tetraspanin/Peripherin,prints_Tetraspanin		0.443	TSPAN8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSPAN8	protein_coding	OTTHUMT00000404737.1	C	NM_004616	-		71533551	-1	no_errors	ENST00000247829	ensembl	human	known	74_37	missense	SNP	1.000	T
HGF	3082	genome.wustl.edu	37	7	81374338	81374338	+	Missense_Mutation	SNP	G	G	A	rs202185530		TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr7:81374338G>A	ENST00000222390.5	-	6	950	c.724C>T	c.(724-726)Cgg>Tgg	p.R242W	HGF_ENST00000453411.1_Missense_Mutation_p.R237W|HGF_ENST00000444829.2_Missense_Mutation_p.R242W|HGF_ENST00000457544.2_Missense_Mutation_p.R237W	NM_000601.4	NP_000592.3	P14210	HGF_HUMAN	hepatocyte growth factor (hepapoietin A; scatter factor)	242	Kringle 2. {ECO:0000255|PROSITE- ProRule:PRU00121}.				activation of MAPK activity (GO:0000187)|blood coagulation (GO:0007596)|cell chemotaxis (GO:0060326)|cellular response to hepatocyte growth factor stimulus (GO:0035729)|epithelial to mesenchymal transition (GO:0001837)|hepatocyte growth factor receptor signaling pathway (GO:0048012)|hyaluronan metabolic process (GO:0030212)|liver development (GO:0001889)|mitotic nuclear division (GO:0007067)|myoblast proliferation (GO:0051450)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of hydrogen peroxide-mediated programmed cell death (GO:1901299)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|organ regeneration (GO:0031100)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive chemotaxis (GO:0050918)|positive regulation of cell migration (GO:0030335)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of branching involved in salivary gland morphogenesis by mesenchymal-epithelial signaling (GO:0060665)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|platelet alpha granule lumen (GO:0031093)	catalytic activity (GO:0003824)|chemoattractant activity (GO:0042056)|growth factor activity (GO:0008083)|identical protein binding (GO:0042802)			NS(2)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|liver(2)|lung(41)|ovary(2)|prostate(2)|skin(6)|urinary_tract(1)	75						AATTTGTGCCGGTGTGGTGTC	0.408																																																	0								ENSG00000019991						87.0	85.0	86.0					7																	81374338		2203	4300	6503	HGF	SO:0001583	missense	0			-	HGNC		CCDS5597.1, CCDS47626.1, CCDS47627.1, CCDS47628.1, CCDS47629.1	7q21.1	2009-09-11			ENSG00000019991	ENSG00000019991			4893	protein-coding gene	gene with protein product	"""hepatopoietin A"", ""fibroblast-derived tumor cytotoxic factor"", ""scatter factor"", ""lung fibroblast-derived mitogen"""	142409	"""deafness, autosomal recessive 39"""	DFNB39		1837206, 19576567	Standard	XM_006715956		Approved	SF, F-TCF, HGFB, HPTA	uc003uhl.3	P14210	OTTHUMG00000023804	ENST00000222390.5:c.724C>T	7.37:g.81374338G>A	ENSP00000222390:p.Arg242Trp	Somatic	0	66	0.00		0.41568620468393047	10	9.09	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	38	26.42	A1L3U6|Q02935|Q13494|Q14519|Q3KRB2|Q8TCE2|Q9BYL9|Q9BYM0|Q9UDU6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Kringle,pfam_Peptidase_S1,pfam_PAN-1_domain,superfamily_Trypsin-like_Pept_dom,superfamily_Kringle-like,smart_Pan_app,smart_Kringle,smart_Peptidase_S1,pfscan_Pan_app,pfscan_Kringle,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.R242W	ENST00000222390.5	37	c.724	CCDS5597.1	7	.	.	.	.	.	.	.	.	.	.	G	21.3	4.135641	0.77662	.	.	ENSG00000019991	ENST00000222390;ENST00000457544;ENST00000444829;ENST00000453411;ENST00000394769	T;T;T;T	0.68479	-0.33;-0.33;-0.33;-0.33	4.63	3.68	0.42216	Kringle (4);Kringle-like fold (1);	0.099482	0.64402	D	0.000005	T	0.71937	0.3399	L	0.45137	1.4	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;P;D;D	0.69142	0.957;0.885;0.962;0.953	T	0.72047	-0.4408	10	0.54805	T	0.06	.	10.5082	0.44847	0.0:0.0:0.6236:0.3764	.	237;242;237;242	P14210-5;P14210-2;P14210-3;P14210	.;.;.;HGF_HUMAN	W	242;237;242;237;242	ENSP00000222390:R242W;ENSP00000391238:R237W;ENSP00000389854:R242W;ENSP00000408270:R237W	ENSP00000222390:R242W	R	-	1	2	HGF	81212274	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.255000	0.51484	2.562000	0.86427	0.655000	0.94253	CGG	-	pfam_Kringle,superfamily_Kringle-like,smart_Kringle,pfscan_Kringle		0.408	HGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HGF	protein_coding	OTTHUMT00000253315.2	G	NM_000601	rs202185530		81374338	-1	no_errors	ENST00000222390	ensembl	human	known	74_37	missense	SNP	1.000	A
TOX3	27324	genome.wustl.edu	37	16	52473609	52473609	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr16:52473609C>T	ENST00000219746.9	-	7	1543	c.1259G>A	c.(1258-1260)gGa>gAa	p.G420E	TOX3_ENST00000407228.3_Missense_Mutation_p.G415E	NM_001080430.2	NP_001073899.2	O15405	TOX3_HUMAN	TOX high mobility group box family member 3	420					apoptotic process (GO:0006915)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|estrogen response element binding (GO:0034056)|phosphoprotein binding (GO:0051219)|protein homodimerization activity (GO:0042803)			NS(2)|endometrium(6)|kidney(1)|lung(8)|prostate(3)|stomach(3)|upper_aerodigestive_tract(1)	24						CATGGTCGTTCCCATGGAGCT	0.542																																																	0								ENSG00000103460						153.0	150.0	151.0					16																	52473609		2173	4282	6455	TOX3	SO:0001583	missense	0			-	HGNC	U80736	CCDS54008.1, CCDS54009.1	16q12.1	2008-02-05	2007-03-20	2007-03-20		ENSG00000103460		"""Trinucleotide (CAG) repeat containing"""	11972	protein-coding gene	gene with protein product		611416	"""trinucleotide repeat containing 9"""	TNRC9		9225980	Standard	NM_001080430		Approved	CAGF9	uc002egw.2	O15405		ENST00000219746.9:c.1259G>A	16.37:g.52473609C>T	ENSP00000219746:p.Gly420Glu	Somatic	0	61	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	45	16.67	B4DRD0|B5MCW4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	p.G420E	ENST00000219746.9	37	c.1259	CCDS54009.1	16	.	.	.	.	.	.	.	.	.	.	C	16.56	3.156177	0.57259	.	.	ENSG00000103460	ENST00000219746;ENST00000407228	T;T	0.11063	2.82;2.81	5.49	4.54	0.55810	.	0.363259	0.28790	N	0.014125	T	0.06508	0.0167	L	0.27053	0.805	0.80722	D	1	P;P	0.38535	0.635;0.635	B;B	0.32805	0.153;0.153	T	0.08493	-1.0719	10	0.02654	T	1	.	14.4399	0.67309	0.0:0.9288:0.0:0.0712	.	415;420	B4DRD0;O15405	.;TOX3_HUMAN	E	420;415	ENSP00000219746:G420E;ENSP00000385705:G415E	ENSP00000219746:G420E	G	-	2	0	TOX3	51031110	1.000000	0.71417	0.862000	0.33874	0.987000	0.75469	7.253000	0.78320	1.308000	0.44962	0.655000	0.94253	GGA	-	NULL		0.542	TOX3-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	TOX3	protein_coding	OTTHUMT00000422534.1	C	XM_049037	-		52473609	-1	no_errors	ENST00000219746	ensembl	human	known	74_37	missense	SNP	0.998	T
PFKM	5213	genome.wustl.edu	37	12	48535750	48535750	+	Silent	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr12:48535750C>T	ENST00000312352.7	+	17	1593	c.1554C>T	c.(1552-1554)ctC>ctT	p.L518L	PFKM_ENST00000547587.1_Silent_p.L518L|PFKM_ENST00000359794.5_Silent_p.L518L|PFKM_ENST00000551804.1_Silent_p.L487L|PFKM_ENST00000340802.6_Silent_p.L589L|PFKM_ENST00000395233.2_Silent_p.L487L	NM_001166687.1	NP_001160159.1	P08237	PFKAM_HUMAN	phosphofructokinase, muscle	518	C-terminal regulatory PFK domain 2.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose 6-phosphate metabolic process (GO:0006002)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|muscle cell cellular homeostasis (GO:0046716)|positive regulation of insulin secretion (GO:0032024)|protein oligomerization (GO:0051259)|small molecule metabolic process (GO:0044281)	6-phosphofructokinase complex (GO:0005945)|apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|sperm principal piece (GO:0097228)	6-phosphofructokinase activity (GO:0003872)|ATP binding (GO:0005524)|fructose binding (GO:0070061)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			NS(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(16)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	35						TTGATGAGCTCTGCATCCCAT	0.537																																																	0								ENSG00000152556						209.0	164.0	179.0					12																	48535750		2203	4300	6503	PFKM	SO:0001819	synonymous_variant	0			-	HGNC	M26066	CCDS8760.1, CCDS53786.1	12q13.11	2014-06-13					2.7.1.11		8877	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 122"""	610681	"""phosphofructokinase, polypeptide X"""	PFKX			Standard	NM_001166686		Approved	PFK-1, PPP1R122	uc001rrb.2	P08237		ENST00000312352.7:c.1554C>T	12.37:g.48535750C>T		Somatic	0	57	0.00		0.41568620468393047	54	43.75	42	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	49	23.08	J3KNX3|Q16814|Q16815|Q6ZTT1	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Phosphofructokinase_dom,superfamily_Phosphofructokinase_dom,pirsf_6-phosphofructokinase_euk,prints_Phosphofructokinase,tigrfam_6-phosphofructokinase_euk	p.L518	ENST00000312352.7	37	c.1554	CCDS8760.1	12																																																																																			-	pfam_Phosphofructokinase_dom,superfamily_Phosphofructokinase_dom,pirsf_6-phosphofructokinase_euk,tigrfam_6-phosphofructokinase_euk		0.537	PFKM-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PFKM	protein_coding	OTTHUMT00000406490.1	C	NM_000289	-		48535750	+1	no_errors	ENST00000312352	ensembl	human	known	74_37	silent	SNP	1.000	T
TP53	7157	genome.wustl.edu	37	17	7577540	7577540	+	Silent	SNP	G	G	A	rs397516437		TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr17:7577540G>A	ENST00000269305.4	-	7	930	c.741C>T	c.(739-741)aaC>aaT	p.N247N	TP53_ENST00000445888.2_Silent_p.N247N|TP53_ENST00000455263.2_Silent_p.N247N|TP53_ENST00000359597.4_Silent_p.N247N|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Silent_p.N247N|TP53_ENST00000420246.2_Silent_p.N247N	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	247	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		N -> D (in sporadic cancers; somatic mutation).|N -> F (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|N -> I (in sporadic cancers; somatic mutation).|N -> K (in sporadic cancers; somatic mutation).|N -> S (in sporadic cancers; somatic mutation).|N -> T (in sporadic cancers; somatic mutation).|N -> Y (in sporadic cancers; somatic mutation).|NR -> IP (in a sporadic cancer; somatic mutation).|NR -> KW (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R248W(16)|p.N247N(10)|p.0?(8)|p.?(5)|p.N247K(2)|p.N247_R248delNR(2)|p.N247_R248>KW(2)|p.M246_P250delMNRRP(2)|p.N247I(1)|p.N247_R249delNRR(1)|p.N247_P250delNRRP(1)|p.G245fs*14(1)|p.N247_R248>IP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TGGGCCTCCGGTTCATGCCGC	0.572		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	52	Substitution - Missense(19)|Substitution - coding silent(10)|Whole gene deletion(8)|Deletion - In frame(6)|Unknown(5)|Complex - compound substitution(3)|Deletion - Frameshift(1)	skin(10)|upper_aerodigestive_tract(5)|biliary_tract(5)|lung(4)|breast(4)|bone(4)|stomach(3)|haematopoietic_and_lymphoid_tissue(3)|urinary_tract(2)|central_nervous_system(2)|oesophagus(2)|ovary(2)|peritoneum(1)|soft_tissue(1)|liver(1)|large_intestine(1)|penis(1)|pancreas(1)						ENSG00000141510						152.0	113.0	126.0					17																	7577540		2203	4300	6503	TP53	SO:0001819	synonymous_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	-	HGNC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.741C>T	17.37:g.7577540G>A		Somatic	0	50	0.00		0.41568620468393047	20	47.37	18	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	21	25.00	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.N247	ENST00000269305.4	37	c.741	CCDS11118.1	17																																																																																			-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor		0.572	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	G	NM_000546	-		7577540	-1	no_errors	ENST00000269305	ensembl	human	known	74_37	silent	SNP	1.000	A
SLC35C2	51006	genome.wustl.edu	37	20	44979027	44979027	+	3'UTR	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr20:44979027G>A	ENST00000372227.1	-	0	1644				SLC35C2_ENST00000493599.1_5'UTR|SLC35C2_ENST00000543605.1_3'UTR|SLC35C2_ENST00000317734.8_3'UTR|SLC35C2_ENST00000243896.2_3'UTR|SLC35C2_ENST00000372230.5_3'UTR|SLC35C2_ENST00000372229.1_3'UTR	NM_001281458.1|NM_001281460.1	NP_001268387.1|NP_001268389.1	Q9NQQ7	S35C2_HUMAN	solute carrier family 35 (GDP-fucose transporter), member C2						negative regulation of gene expression (GO:0010629)|positive regulation of Notch signaling pathway (GO:0045747)|protein O-linked fucosylation (GO:0036066)|transport (GO:0006810)	cis-Golgi network (GO:0005801)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)	16		Myeloproliferative disorder(115;0.0122)				CATTTGCCCTGGCTGGTCACT	0.642																																																	0								ENSG00000080189						80.0	65.0	70.0					20																	44979027		2203	4300	6503	SLC35C2	SO:0001624	3_prime_UTR_variant	0			-	HGNC		CCDS13396.1, CCDS13397.1, CCDS63292.1	20q13.12	2013-07-17	2013-07-17	2003-10-10	ENSG00000080189	ENSG00000080189		"""Solute carriers"""	17117	protein-coding gene	gene with protein product			"""ovarian cancer overexpressed 1"", ""solute carrier family 35, member C2"""	C20orf5, OVCOV1		10810093, 11549316	Standard	NM_173179		Approved	CGI-15, bA394O2.1	uc002xrq.3	Q9NQQ7	OTTHUMG00000033050	ENST00000372227.1:c.*6C>T	20.37:g.44979027G>A		Somatic	0	83	0.00		0.41568620468393047	187	26.27	67	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	26	29.73	B7Z6V6|E1P5T0|Q53GK3|Q5JW05|Q96CJ8|Q9Y304	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000372227.1	37	NULL	CCDS13396.1	20																																																																																			-	-		0.642	SLC35C2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLC35C2	protein_coding	OTTHUMT00000080363.1	G	NM_015945	-		44979027	-1	no_errors	ENST00000480329	ensembl	human	known	74_37	rna	SNP	0.036	A
CTAGE8	100142659	genome.wustl.edu	37	7	143965765	143965765	+	Silent	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr7:143965765G>A	ENST00000487179.1	-	1	616	c.579C>T	c.(577-579)atC>atT	p.I193I	OR2A1-AS1_ENST00000463561.1_RNA|OR2A1-AS1_ENST00000478806.1_RNA|ARHGEF35_ENST00000543357.1_Intron|OR2A1-AS1_ENST00000489488.1_RNA|OR2A1-AS1_ENST00000487102.1_RNA|OR2A1-AS1_ENST00000476560.1_RNA|OR2A1-AS1_ENST00000461843.1_RNA|RP4-545C24.1_ENST00000460955.1_RNA			P0CG41	CTGE8_HUMAN	CTAGE family, member 8	193						integral component of membrane (GO:0016021)											TCTTGCAGATGATTTTGGCTT	0.348																																																	0								ENSG00000244693																																			CTAGE8	SO:0001819	synonymous_variant	0			-	HGNC	AK292236	CCDS64791.1	7q35	2014-08-13			ENSG00000244693	ENSG00000244693			37294	protein-coding gene	gene with protein product							Standard	NM_001278507		Approved			P0CG41	OTTHUMG00000158009	ENST00000487179.1:c.579C>T	7.37:g.143965765G>A		Somatic	0	21	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	9	25.00		Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.I193	ENST00000487179.1	37	c.579		7																																																																																			-	NULL		0.348	CTAGE8-001	KNOWN	basic|appris_principal	protein_coding	CTAGE8	protein_coding	OTTHUMT00000349996.1	G		-		143965765	-1	no_errors	ENST00000487179	ensembl	human	known	74_37	silent	SNP	0.094	A
DENND4A	10260	genome.wustl.edu	37	15	66015249	66015249	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr15:66015249G>A	ENST00000431932.2	-	12	1733	c.1525C>T	c.(1525-1527)Cca>Tca	p.P509S	DENND4A_ENST00000443035.3_Missense_Mutation_p.P509S	NM_005848.3	NP_005839.3	Q7Z401	MYCPP_HUMAN	DENN/MADD domain containing 4A	509					positive regulation of Rab GTPase activity (GO:0032851)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(11)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	51						GGCTTCTTTGGAAGTATCTTC	0.318																																																	0								ENSG00000174485						109.0	92.0	97.0					15																	66015249		1801	4066	5867	DENND4A	SO:0001583	missense	0			-	HGNC	AF534403	CCDS45285.1, CCDS53949.1	15q22.31	2012-10-03	2006-01-27	2006-01-27				"""DENN/MADD domain containing"""	24321	protein-coding gene	gene with protein product		600382	"""c-myc promoter binding protein"""	MYCPBP		8056341, 12906859	Standard	NM_005848		Approved	IRLB	uc002api.3	Q7Z401		ENST00000431932.2:c.1525C>T	15.37:g.66015249G>A	ENSP00000396830:p.Pro509Ser	Somatic	0	85	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	52	25.71	E7EPL3|Q14655|Q86T77|Q8IVX2|Q8NB93	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DENN_dom,pfam_dDENN_dom,pfam_uDENN_dom,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom,tigrfam_Pentatricopeptide_repeat	p.P509S	ENST00000431932.2	37	c.1525	CCDS45285.1	15	.	.	.	.	.	.	.	.	.	.	G	29.0	4.968831	0.92855	.	.	ENSG00000174485	ENST00000443035;ENST00000431932	T;T	0.11930	2.73;2.79	5.12	5.12	0.69794	.	0.182641	0.53938	N	0.000060	T	0.39655	0.1086	M	0.71206	2.165	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.999;0.998	T	0.23332	-1.0191	10	0.87932	D	0	.	18.9095	0.92477	0.0:0.0:1.0:0.0	.	509;509;509	B7Z5Y3;E7EPL3;Q7Z401	.;.;MYCPP_HUMAN	S	509	ENSP00000391167:P509S;ENSP00000396830:P509S	ENSP00000396830:P509S	P	-	1	0	DENND4A	63802303	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.767000	0.98960	2.533000	0.85409	0.655000	0.94253	CCA	-	NULL		0.318	DENND4A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	DENND4A	protein_coding	OTTHUMT00000419611.1	G	NM_005848	-		66015249	-1	no_errors	ENST00000443035	ensembl	human	known	74_37	missense	SNP	1.000	A
RIN3	79890	genome.wustl.edu	37	14	93119342	93119342	+	Nonsense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr14:93119342C>T	ENST00000216487.7	+	6	2107	c.1948C>T	c.(1948-1950)Cag>Tag	p.Q650*	RIN3_ENST00000418924.2_3'UTR	NM_024832.3	NP_079108.3	Q8TB24	RIN3_HUMAN	Ras and Rab interactor 3	650	Interaction with RAB5B.				endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|signal transduction (GO:0007165)	cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)	GTPase activator activity (GO:0005096)|Rab GTPase binding (GO:0017137)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)			endometrium(4)|kidney(2)|large_intestine(7)|lung(19)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	36		all_cancers(154;0.0701)				CATGATGACCCAGCTCAAGAG	0.637																																																	0								ENSG00000100599						44.0	37.0	39.0					14																	93119342		2203	4300	6503	RIN3	SO:0001587	stop_gained	0			-	HGNC	BC025248	CCDS32144.1	14q32.13	2008-08-29				ENSG00000100599			18751	protein-coding gene	gene with protein product		610223				11733506	Standard	NM_024832		Approved	FLJ22439	uc001yap.3	Q8TB24		ENST00000216487.7:c.1948C>T	14.37:g.93119342C>T	ENSP00000216487:p.Gln650*	Somatic	0	26	0.00		0.41568620468393047	55	3.51	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	16	27.27	Q76LB3|Q8NF30|Q8TEE8|Q8WYP4|Q9H6A5|Q9HAG1	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_VPS9,smart_SH2,smart_VPS9_subgr,pfscan_Ras-assoc,pfscan_SH2,pfscan_VPS9	p.Q650*	ENST00000216487.7	37	c.1948	CCDS32144.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	41|41	9.042801|9.042801	0.99046|0.99046	.|.	.|.	ENSG00000100599|ENSG00000100599	ENST00000556418|ENST00000216487;ENST00000428147	.|.	.|.	.|.	4.58|4.58	4.58|4.58	0.56647|0.56647	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|.	0.76601|.	0.4010|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.80460|.	-0.1373|.	4|.	.|0.66056	.|D	.|0.02	-16.3007|-16.3007	17.4162|17.4162	0.87500|0.87500	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	L|X	166|650;574	.|.	.|ENSP00000216487:Q650X	P|Q	+|+	2|1	0|0	RIN3|RIN3	92189095|92189095	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.681000|7.681000	0.84073|0.84073	2.117000|2.117000	0.64856|0.64856	0.561000|0.561000	0.74099|0.74099	CCA|CAG	-	NULL		0.637	RIN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RIN3	protein_coding	OTTHUMT00000412269.1	C		-		93119342	+1	no_errors	ENST00000216487	ensembl	human	known	74_37	nonsense	SNP	1.000	T
RABEP1	9135	genome.wustl.edu	37	17	5284765	5284765	+	Missense_Mutation	SNP	C	C	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr17:5284765C>A	ENST00000546142.2	+	17	2639	c.2452C>A	c.(2452-2454)Cag>Aag	p.Q818K	NUP88_ENST00000573169.1_Intron|RABEP1_ENST00000262477.6_Missense_Mutation_p.Q818K|RABEP1_ENST00000408982.2_Missense_Mutation_p.Q785K|RABEP1_ENST00000537505.1_Missense_Mutation_p.Q775K|RABEP1_ENST00000341923.6_Missense_Mutation_p.Q785K			Q15276	RABE1_HUMAN	rabaptin, RAB GTPase binding effector protein 1	818					apoptotic process (GO:0006915)|endocytosis (GO:0006897)|membrane fusion (GO:0061025)|protein transport (GO:0015031)	early endosome (GO:0005769)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)	GTPase activator activity (GO:0005096)|protein homodimerization activity (GO:0042803)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)	8						TGAGCAAGTCCAGAGGGATTT	0.428																																																	0								ENSG00000029725						87.0	89.0	88.0					17																	5284765		1880	4110	5990	RABEP1	SO:0001583	missense	0			-	HGNC	AF098638	CCDS42243.1, CCDS45592.1	17p13.2	2008-02-05				ENSG00000029725			17677	protein-coding gene	gene with protein product		603616				8521472	Standard	NM_001291582		Approved	neurocrescin, RAB5EP, RABPT5, rabaptin-5	uc002gbm.4	Q15276		ENST00000546142.2:c.2452C>A	17.37:g.5284765C>A	ENSP00000437701:p.Gln818Lys	Somatic	0	91	0.00		0.41568620468393047	5	16.67	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	43	12.24	B2RAG7|O95369|Q8IVX3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Rabaptin_coiled-coil,pfam_Rabaptin_Rab5-bd_dom,prints_Rabaptin	p.Q818K	ENST00000546142.2	37	c.2452	CCDS45592.1	17	.	.	.	.	.	.	.	.	.	.	C	20.4	3.983100	0.74474	.	.	ENSG00000029725	ENST00000262477;ENST00000408982;ENST00000546142;ENST00000341923;ENST00000537505	T;T;T;T;T	0.66815	-0.22;-0.18;-0.22;-0.18;-0.23	4.8	4.8	0.61643	.	0.000000	0.85682	D	0.000000	T	0.65417	0.2689	M	0.78049	2.395	0.80722	D	1	B;B;B	0.33940	0.433;0.376;0.3	B;B;B	0.29598	0.104;0.06;0.104	T	0.64736	-0.6337	10	0.17832	T	0.49	-16.4194	17.4148	0.87497	0.0:1.0:0.0:0.0	.	775;818;785	F5H355;Q15276;Q15276-2	.;RABE1_HUMAN;.	K	818;785;818;785;775	ENSP00000262477:Q818K;ENSP00000386150:Q785K;ENSP00000437701:Q818K;ENSP00000339569:Q785K;ENSP00000445408:Q775K	ENSP00000262477:Q818K	Q	+	1	0	RABEP1	5225489	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.468000	0.80943	2.655000	0.90218	0.655000	0.94253	CAG	-	NULL		0.428	RABEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RABEP1	protein_coding	OTTHUMT00000439349.1	C	NM_004703	-		5284765	+1	no_errors	ENST00000262477	ensembl	human	known	74_37	missense	SNP	1.000	A
FAT2	2196	genome.wustl.edu	37	5	150887105	150887105	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr5:150887105C>T	ENST00000261800.5	-	22	12139	c.12127G>A	c.(12127-12129)Gac>Aac	p.D4043N	CTC-251D13.1_ENST00000606930.1_RNA	NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	4043					epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TGCCCCCAGTCCCCCCTTTGG	0.562																																																	0								ENSG00000086570						53.0	51.0	51.0					5																	150887105		2203	4300	6503	FAT2	SO:0001583	missense	0			-	HGNC	AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.12127G>A	5.37:g.150887105C>T	ENSP00000261800:p.Asp4043Asn	Somatic	0	80	0.00		0.41568620468393047	3	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	36	20.00	O75091|Q9NSR7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Laminin_G,superfamily_Cadherin-like,superfamily_ConA-like_lec_gl_sf,smart_Cadherin,smart_Laminin_G,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.D4043N	ENST00000261800.5	37	c.12127	CCDS4317.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.40|10.40	1.340452|1.340452	0.24339|0.24339	.|.	.|.	ENSG00000086570|ENSG00000086570	ENST00000261800|ENST00000520200	T|T	0.69306|0.71934	-0.39|-0.61	5.46|5.46	4.59|4.59	0.56863|0.56863	Concanavalin A-like lectin/glucanase, subgroup (1);|.	0.425701|.	0.22025|.	N|.	0.065670|.	T|T	0.62060|0.62060	0.2397|0.2397	N|N	0.24115|0.24115	0.695|0.695	0.30538|0.30538	N|N	0.766764|0.766764	B;P|.	0.44195|.	0.255;0.828|.	B;B|.	0.29663|.	0.053;0.105|.	T|T	0.62431|0.62431	-0.6856|-0.6856	10|7	0.06625|0.37606	T|T	0.88|0.19	.|.	11.2964|11.2964	0.49280|0.49280	0.0:0.9166:0.0:0.0834|0.0:0.9166:0.0:0.0834	.|.	4043;1148|.	Q9NYQ8;E9PDJ8|.	FAT2_HUMAN;.|.	N|E	4043|815	ENSP00000261800:D4043N|ENSP00000429678:G815E	ENSP00000261800:D4043N|ENSP00000429678:G815E	D|G	-|-	1|2	0|0	FAT2|FAT2	150867298|150867298	0.923000|0.923000	0.31300|0.31300	0.994000|0.994000	0.49952|0.49952	0.547000|0.547000	0.35210|0.35210	1.823000|1.823000	0.39062|0.39062	1.295000|1.295000	0.44724|0.44724	0.655000|0.655000	0.94253|0.94253	GAC|GGA	-	NULL		0.562	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT2	protein_coding	OTTHUMT00000252434.1	C	NM_001447	-		150887105	-1	no_errors	ENST00000261800	ensembl	human	known	74_37	missense	SNP	0.999	T
ESPL1	9700	genome.wustl.edu	37	12	53680600	53680600	+	Silent	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr12:53680600C>T	ENST00000257934.4	+	18	4171	c.4080C>T	c.(4078-4080)gtC>gtT	p.V1360V	ESPL1_ENST00000552462.1_Silent_p.V1360V	NM_012291.4	NP_036423.4	Q14674	ESPL1_HUMAN	extra spindle pole bodies homolog 1 (S. cerevisiae)	1360					apoptotic process (GO:0006915)|cytokinesis (GO:0000910)|establishment of mitotic spindle localization (GO:0040001)|homologous chromosome segregation (GO:0045143)|meiotic spindle organization (GO:0000212)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of sister chromatid cohesion (GO:0045875)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)	centrosome (GO:0005813)|cytosol (GO:0005829)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|cysteine-type peptidase activity (GO:0008234)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(10)|large_intestine(12)|lung(21)|ovary(2)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(8)	70						GCCCTCATGTCCCCTTCACGG	0.582																																					Colon(53;1069 1201 2587 5382)												0								ENSG00000135476						73.0	53.0	60.0					12																	53680600		2203	4300	6503	ESPL1	SO:0001819	synonymous_variant	0			-	HGNC	D79987	CCDS8852.1	12q13.13	2014-08-04	2013-05-03		ENSG00000135476	ENSG00000135476	3.4.22.49		16856	protein-coding gene	gene with protein product	"""separin"", ""separase"", ""separin, cysteine protease"""	604143	"""extra spindle poles like 1 (S. cerevisiae)"""			8724849, 16258266	Standard	NM_012291		Approved	KIAA0165, ESP1, SEPA	uc001sck.2	Q14674	OTTHUMG00000169674	ENST00000257934.4:c.4080C>T	12.37:g.53680600C>T		Somatic	0	51	0.00		0.41568620468393047	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	47	9.62		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_C50,superfamily_DsrEFH-like	p.V1360	ENST00000257934.4	37	c.4080	CCDS8852.1	12																																																																																			-	NULL		0.582	ESPL1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ESPL1	protein_coding	OTTHUMT00000406899.2	C	NM_012291	-		53680600	+1	no_errors	ENST00000257934	ensembl	human	known	74_37	silent	SNP	0.855	T
PPP2R5C	5527	genome.wustl.edu	37	14	102359443	102359443	+	Nonsense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr14:102359443C>T	ENST00000334743.5	+	7	844	c.796C>T	c.(796-798)Cag>Tag	p.Q266*	PPP2R5C_ENST00000557095.1_Nonsense_Mutation_p.Q266*|PPP2R5C_ENST00000328724.5_Nonsense_Mutation_p.Q321*|PPP2R5C_ENST00000445439.3_Nonsense_Mutation_p.Q266*|PPP2R5C_ENST00000350249.3_Nonsense_Mutation_p.Q266*|PPP2R5C_ENST00000422945.2_Nonsense_Mutation_p.Q297*	NM_002719.3	NP_002710.2	Q13362	2A5G_HUMAN	protein phosphatase 2, regulatory subunit B', gamma	266					DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|negative regulation of cell proliferation (GO:0008285)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)	chromosome, centromeric region (GO:0000775)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)			breast(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	20						CTACCATCCCCAGGTAAGGGG	0.438																																																	0								ENSG00000078304						64.0	59.0	61.0					14																	102359443		2203	4300	6503	PPP2R5C	SO:0001587	stop_gained	0			-	HGNC	L42375	CCDS9964.1, CCDS9965.1, CCDS45163.1, CCDS53911.1, CCDS53912.1	14q32.31	2010-06-18	2010-04-14		ENSG00000078304	ENSG00000078304		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9311	protein-coding gene	gene with protein product		601645	"""protein phosphatase 2, regulatory subunit B (B56), gamma isoform"", ""protein phosphatase 2, regulatory subunit B', gamma isoform"""			7592815	Standard	NM_002719		Approved	B56G, PR61G	uc001ykk.3	Q13362		ENST00000334743.5:c.796C>T	14.37:g.102359443C>T	ENSP00000333905:p.Gln266*	Somatic	0	56	0.00		0.41568620468393047	49	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	36	20.00	B4DYJ8|B5BUA5|F5GWP3|Q14391|Q15060|Q15174|Q6ZN33	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PP2A_B56,superfamily_ARM-type_fold,pirsf_PP2A_B56	p.Q297*	ENST00000334743.5	37	c.889	CCDS9964.1	14	.	.	.	.	.	.	.	.	.	.	C	37	6.163614	0.97338	.	.	ENSG00000078304	ENST00000422945;ENST00000328724;ENST00000557268;ENST00000350249;ENST00000334756;ENST00000445439;ENST00000334743;ENST00000557095;ENST00000557716	.	.	.	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-21.467	19.3508	0.94384	0.0:1.0:0.0:0.0	.	.	.	.	X	297;321;295;266;164;266;266;266;62	.	ENSP00000329009:Q321X	Q	+	1	0	PPP2R5C	101429196	1.000000	0.71417	0.974000	0.42286	0.880000	0.50808	7.776000	0.85560	2.567000	0.86603	0.591000	0.81541	CAG	-	pfam_PP2A_B56,superfamily_ARM-type_fold,pirsf_PP2A_B56		0.438	PPP2R5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP2R5C	protein_coding	OTTHUMT00000414373.2	C	NM_002719	-		102359443	+1	no_errors	ENST00000422945	ensembl	human	known	74_37	nonsense	SNP	1.000	T
ZNF709	163051	genome.wustl.edu	37	19	12575311	12575311	+	Silent	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr19:12575311G>A	ENST00000397732.3	-	4	1596	c.1425C>T	c.(1423-1425)ccC>ccT	p.P475P	CTD-3105H18.18_ENST00000598753.1_Intron|ZNF709_ENST00000428311.1_Silent_p.P475P	NM_152601.3	NP_689814.1	Q8N972	ZN709_HUMAN	zinc finger protein 709	475					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(3)|upper_aerodigestive_tract(3)	6						TACATTCATAGGGTTTCTCTC	0.398																																					GBM(33;565 669 12371 29134 51667)												0								ENSG00000242852						89.0	96.0	93.0					19																	12575311		2202	4300	6502	ZNF709	SO:0001819	synonymous_variant	0			-	HGNC	AK095600	CCDS42504.1	19p13.2	2013-01-08			ENSG00000242852	ENSG00000242852		"""Zinc fingers, C2H2-type"", ""-"""	20629	protein-coding gene	gene with protein product							Standard	NM_152601		Approved	FLJ38281	uc002mtv.4	Q8N972	OTTHUMG00000156406	ENST00000397732.3:c.1425C>T	19.37:g.12575311G>A		Somatic	0	133	0.00		0.41568620468393047	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	67	27.96	A8K4E6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,pfam_Znf_C2H2_jaz,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.P475	ENST00000397732.3	37	c.1425	CCDS42504.1	19																																																																																			-	pfscan_Znf_C2H2		0.398	ZNF709-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF709	protein_coding	OTTHUMT00000344088.1	G	NM_152601	-		12575311	-1	no_errors	ENST00000397732	ensembl	human	known	74_37	silent	SNP	0.034	A
RP11-402P6.9	0	genome.wustl.edu	37	X	70884068	70884068	+	RNA	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chrX:70884068G>A	ENST00000422194.1	-	0	409																											GGCTCCCGGGGGCTATTGCTG	0.547											OREG0019860	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000237265																																			RP11-402P6.9			0			-	Clone_based_vega_gene																													X.37:g.70884068G>A		Somatic	0	93	0.00	1125	0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	34	41	45.33		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000422194.1	37	NULL		X																																																																																			-	-		0.547	RP11-402P6.9-001	KNOWN	basic	lincRNA	ENSG00000237265	processed_transcript	OTTHUMT00000058987.1	G		-		70884068	-1	no_errors	ENST00000422194	ensembl	human	known	74_37	rna	SNP	0.000	A
PTPRZ1	5803	genome.wustl.edu	37	7	121668616	121668616	+	Nonsense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr7:121668616C>T	ENST00000393386.2	+	14	5410	c.4999C>T	c.(4999-5001)Cag>Tag	p.Q1667*	PTPRZ1_ENST00000449182.1_Nonsense_Mutation_p.Q807*	NM_001206838.1|NM_002851.2	NP_001193767.1|NP_002842.2	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type, Z polypeptide 1	1667					axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|hematopoietic progenitor cell differentiation (GO:0002244)|learning or memory (GO:0007611)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of oligodendrocyte progenitor proliferation (GO:0070445)	integral component of plasma membrane (GO:0005887)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(12)|large_intestine(17)|liver(1)|lung(42)|ovary(4)|prostate(5)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	106						GAAATGCTTCCAGACTGCACA	0.363																																																	0								ENSG00000106278						152.0	132.0	139.0					7																	121668616		2203	4300	6503	PTPRZ1	SO:0001587	stop_gained	0			-	HGNC	M93426	CCDS34740.1, CCDS56505.1	7q31.3	2013-02-11			ENSG00000106278	ENSG00000106278		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9685	protein-coding gene	gene with protein product		176891		PTPZ, PTPRZ		7736789, 8387522	Standard	NM_001206838		Approved	PTP18, RPTPB, phosphacan	uc003vjy.3	P23471	OTTHUMG00000157057	ENST00000393386.2:c.4999C>T	7.37:g.121668616C>T	ENSP00000377047:p.Gln1667*	Somatic	0	61	0.00		0.41568620468393047	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	32	21.95	A4D0W5|C9JFM0|O76043|Q9UDR6	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Carbonic_anhydrase_a,pfam_Fibronectin_type3,superfamily_Carbonic_anhydrase_a,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Carbonic_anhydrase_a,prints_Tyr_Pase_rcpt/non-rcpt	p.Q1667*	ENST00000393386.2	37	c.4999	CCDS34740.1	7	.	.	.	.	.	.	.	.	.	.	C	42	9.744281	0.99253	.	.	ENSG00000106278	ENST00000393386;ENST00000449182	.	.	.	5.8	5.8	0.92144	.	0.000000	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	.	20.0637	0.97700	0.0:1.0:0.0:0.0	.	.	.	.	X	1667;807	.	ENSP00000377047:Q1667X	Q	+	1	0	PTPRZ1	121455852	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.373000	0.79623	2.751000	0.94390	0.650000	0.86243	CAG	-	NULL		0.363	PTPRZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRZ1	protein_coding	OTTHUMT00000347288.1	C	NM_002851	-		121668616	+1	no_errors	ENST00000393386	ensembl	human	known	74_37	nonsense	SNP	1.000	T
LDLRAD4	753	genome.wustl.edu	37	18	13645200	13645200	+	Silent	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr18:13645200C>T	ENST00000359446.5	+	6	933	c.465C>T	c.(463-465)ttC>ttT	p.F155F	LDLRAD4_ENST00000587757.1_Silent_p.F118F|RP11-701H16.4_ENST00000588397.1_RNA|LDLRAD4_ENST00000361205.4_Silent_p.F155F|LDLRAD4_ENST00000585931.1_Silent_p.F78F|LDLRAD4_ENST00000586765.1_Silent_p.F100F|LDLRAD4_ENST00000592991.1_Silent_p.F57F|LDLRAD4_ENST00000399848.3_Silent_p.F137F	NM_001276251.1	NP_001263180.1	O15165	LRAD4_HUMAN	low density lipoprotein receptor class A domain containing 4	155					negative regulation of cell migration (GO:0030336)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of SMAD protein complex assembly (GO:0010991)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)	early endosome membrane (GO:0031901)|endosome (GO:0005768)|integral component of membrane (GO:0016021)	R-SMAD binding (GO:0070412)										TCAGCCGCTTCCAGCCCACCT	0.607																																																	0								ENSG00000168675						101.0	101.0	101.0					18																	13645200		2203	4300	6503	LDLRAD4	SO:0001819	synonymous_variant	0			-	HGNC	AF009424, AF009428	CCDS32793.1, CCDS32794.1, CCDS32795.1, CCDS42415.1, CCDS62392.1, CCDS62393.1	18p11.21	2014-04-29	2012-10-24	2012-10-24	ENSG00000168675	ENSG00000168675			1224	protein-coding gene	gene with protein product	"""clone 22"""	606571	"""chromosome 18 open reading frame 1"""	C18orf1		9479497, 9129712, 24627487	Standard	NM_181482		Approved		uc002ksb.3	O15165	OTTHUMG00000181925	ENST00000359446.5:c.465C>T	18.37:g.13645200C>T		Somatic	0	53	0.00		0.41568620468393047	23	34.29	12	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	29	19.44	B3KNT9|E9PAY9|K7EN38|O15166|O15167|O15168|Q5U646|Q6NXP3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt	p.F155	ENST00000359446.5	37	c.465	CCDS32793.1	18																																																																																			-	NULL		0.607	LDLRAD4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LDLRAD4	protein_coding	OTTHUMT00000458326.1	C	NM_181481	-		13645200	+1	no_errors	ENST00000359446	ensembl	human	known	74_37	silent	SNP	1.000	T
FAT2	2196	genome.wustl.edu	37	5	150931138	150931138	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr5:150931138C>T	ENST00000261800.5	-	6	4198	c.4186G>A	c.(4186-4188)Gag>Aag	p.E1396K		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	1396	Cadherin 12. {ECO:0000255|PROSITE- ProRule:PRU00043}.				epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GTGGTCTTCTCAATGTCAAAG	0.498																																																	0								ENSG00000086570						189.0	160.0	170.0					5																	150931138		2203	4300	6503	FAT2	SO:0001583	missense	0			-	HGNC	AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.4186G>A	5.37:g.150931138C>T	ENSP00000261800:p.Glu1396Lys	Somatic	0	53	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	31	16.22	O75091|Q9NSR7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Laminin_G,superfamily_Cadherin-like,superfamily_ConA-like_lec_gl_sf,smart_Cadherin,smart_Laminin_G,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.E1396K	ENST00000261800.5	37	c.4186	CCDS4317.1	5	.	.	.	.	.	.	.	.	.	.	C	29.9	5.044697	0.93685	.	.	ENSG00000086570	ENST00000261800	T	0.38560	1.13	5.43	5.43	0.79202	Cadherin (4);Cadherin-like (1);	0.000000	0.64402	D	0.000010	T	0.64283	0.2584	M	0.77712	2.385	0.49915	D	0.999836	D	0.62365	0.991	P	0.60012	0.867	T	0.66264	-0.5967	10	0.51188	T	0.08	.	19.2351	0.93855	0.0:1.0:0.0:0.0	.	1396	Q9NYQ8	FAT2_HUMAN	K	1396	ENSP00000261800:E1396K	ENSP00000261800:E1396K	E	-	1	0	FAT2	150911331	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.562000	0.60816	2.538000	0.85594	0.561000	0.74099	GAG	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.498	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT2	protein_coding	OTTHUMT00000252434.1	C	NM_001447	-		150931138	-1	no_errors	ENST00000261800	ensembl	human	known	74_37	missense	SNP	1.000	T
LOC101927209	101927209	genome.wustl.edu	37	1	142713836	142713844	+	lincRNA	DEL	AATTTTCAT	AATTTTCAT	-	rs199550477		TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	AATTTTCAT	AATTTTCAT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr1:142713836_142713844delAATTTTCAT	ENST00000610091.1	-	0	1814_1822																											TTCAAAATGCAATTTTCATCCATCAGATC	0.278																																																	0								ENSG00000203849																																			RP11-417J8.6			0				Clone_based_vega_gene																													1.37:g.142713836_142713844delAATTTTCAT		Somatic	NA	NA	NA		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000610091.1	37	NULL		1																																																																																			-	-		0.278	RP11-417J8.6-001	KNOWN	basic	lincRNA	ENSG00000203849	lincRNA	OTTHUMT00000037265.2	AATTTTCAT				142713844	-1	no_errors	ENST00000369381	ensembl	human	known	74_37	rna	DEL	0.107:0.108:0.114:0.112:0.099:0.091:0.068:0.052:0.040	-
ZNF281	23528	genome.wustl.edu	37	1	200378099	200378099	+	Silent	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr1:200378099C>T	ENST00000294740.3	-	2	859	c.735G>A	c.(733-735)ttG>ttA	p.L245L	ZNF281_ENST00000367352.3_Silent_p.L209L|ZNF281_ENST00000367353.1_Silent_p.L245L	NM_001281293.1|NM_001281294.1|NM_012482.4	NP_001268222.1|NP_001268223.1|NP_036614.1	Q9Y2X9	ZN281_HUMAN	zinc finger protein 281	245					embryonic body morphogenesis (GO:0010172)|negative regulation of gene expression (GO:0010629)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|stem cell differentiation (GO:0048863)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	core promoter binding (GO:0001047)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			breast(4)|endometrium(3)|kidney(3)|large_intestine(6)|lung(7)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	27						CATCTCCAACCAAAGAAGGTT	0.483																																																	0								ENSG00000162702						150.0	139.0	143.0					1																	200378099		2203	4300	6503	ZNF281	SO:0001819	synonymous_variant	0			-	HGNC	AF125158	CCDS1402.1, CCDS60384.1	1q32.1	2012-08-08			ENSG00000162702	ENSG00000162702		"""Zinc fingers, C2H2-type"""	13075	protein-coding gene	gene with protein product						10448078	Standard	NM_012482		Approved	ZBP-99	uc001gve.3	Q9Y2X9	OTTHUMG00000035724	ENST00000294740.3:c.735G>A	1.37:g.200378099C>T		Somatic	0	40	0.00		0.41568620468393047	1	66.67	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	19	20.83	A6NF48|B3KMX2|Q5RKW5|Q9NY92	Silent	SNP	NA	NA	NA	NA	NA	NA	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L245	ENST00000294740.3	37	c.735	CCDS1402.1	1																																																																																			-	NULL		0.483	ZNF281-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF281	protein_coding	OTTHUMT00000086879.2	C	NM_012482	-		200378099	-1	no_errors	ENST00000294740	ensembl	human	known	74_37	silent	SNP	0.966	T
PRORY	100533178	genome.wustl.edu	37	Y	23545489	23545489	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chrY:23545489G>A	ENST00000382764.1	-	3	379	c.283C>T	c.(283-285)Cct>Tct	p.P95S		NM_001282471.1	NP_001269400.1	Q9H606	PRORY_HUMAN		95	Pro-rich.																GGAGAGGCAGGAGGAGGATCA	0.652																																																	0								ENSG00000183146																																			CYorf17	SO:0001583	missense	0			-	HGNC																												ENST00000382764.1:c.283C>T	Y.37:g.23545489G>A	ENSP00000372213:p.Pro95Ser	Somatic	0	82	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	24	45.45		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF1725	p.P95S	ENST00000382764.1	37	c.283		Y																																																																																			-	NULL		0.652	CYorf17-001	KNOWN	basic|appris_principal	protein_coding	CYorf17	protein_coding	OTTHUMT00000100103.1	G		-		23545489	-1	no_errors	ENST00000382764	ensembl	human	known	74_37	missense	SNP	0.202	A
CCNT2	905	genome.wustl.edu	37	2	135705305	135705305	+	Splice_Site	SNP	G	G	C			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr2:135705305G>C	ENST00000264157.5	+	7	569		c.e7-1		CCNT2_ENST00000295238.6_Splice_Site|CCNT2_ENST00000537343.1_Splice_Site	NM_001241.3|NM_058241.2	NP_001232.1|NP_490595.1	O60583	CCNT2_HUMAN	cyclin T2						cell cycle (GO:0007049)|cell division (GO:0051301)|gene expression (GO:0010467)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)				endometrium(2)|kidney(3)|large_intestine(10)|lung(6)|ovary(2)|prostate(1)|skin(1)	25				BRCA - Breast invasive adenocarcinoma(221;0.107)		CTCTGCAACAGTCTGCATCTT	0.363																																																	0								ENSG00000082258						155.0	143.0	147.0					2																	135705305		2203	4300	6503	CCNT2	SO:0001630	splice_region_variant	0			-	HGNC	AF048731	CCDS2174.1, CCDS2175.1	2q21.3	2010-11-15			ENSG00000082258	ENSG00000082258			1600	protein-coding gene	gene with protein product		603862				9499409, 10465067	Standard	NM_001241		Approved		uc002tuc.2	O60583	OTTHUMG00000131712	ENST00000264157.5:c.540-1G>C	2.37:g.135705305G>C		Somatic	0	56	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	28	12.50	A8KA48|D3DP73|D3DP74|O60582|Q29R66|Q53SR4|Q5I1Y0	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e7-1	ENST00000264157.5	37	c.540-1	CCDS2174.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.74|19.74	3.884364|3.884364	0.72410|0.72410	.|.	.|.	ENSG00000082258|ENSG00000082258	ENST00000446247;ENST00000537343;ENST00000295238;ENST00000264157|ENST00000452521	.|.	.|.	.|.	5.48|5.48	5.48|5.48	0.80851|0.80851	.|.	.|.	.|.	.|.	.|.	.|T	.|0.75369	.|0.3840	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.73582	.|-0.3937	.|4	.|.	.|.	.|.	.|.	19.338|19.338	0.94326|0.94326	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	.|H	-1|2	.|.	.|.	.|Q	+|+	.|3	.|2	CCNT2|CCNT2	135421775|135421775	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	9.727000|9.727000	0.98787|0.98787	2.575000|2.575000	0.86900|0.86900	0.591000|0.591000	0.81541|0.81541	.|CAG	-	-		0.363	CCNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCNT2	protein_coding	OTTHUMT00000254629.1	G	NM_058241	-	Intron	135705305	+1	no_errors	ENST00000264157	ensembl	human	known	74_37	splice_site	SNP	1.000	C
C11orf86	254439	genome.wustl.edu	37	11	66743716	66743716	+	Silent	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr11:66743716C>T	ENST00000308963.4	+	2	428	c.342C>T	c.(340-342)tcC>tcT	p.S114S		NM_001136485.1	NP_001129957.1	A6NJI1	CK086_HUMAN	chromosome 11 open reading frame 86	114										NS(1)|skin(1)	2						AGCCGGCCTCCCCGTAGCCCA	0.617											OREG0021116	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000173237						43.0	45.0	45.0					11																	66743716		692	1591	2283	C11orf86	SO:0001819	synonymous_variant	0			-	HGNC	AK026328, AP003176	CCDS44656.1	11q13.1	2012-08-10			ENSG00000173237	ENSG00000173237			34442	protein-coding gene	gene with protein product							Standard	NM_001136485		Approved	FLJ22675	uc010rpm.2	A6NJI1	OTTHUMG00000153671	ENST00000308963.4:c.342C>T	11.37:g.66743716C>T		Somatic	0	43	0.00	1094	0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	19	17.39		Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.S114	ENST00000308963.4	37	c.342	CCDS44656.1	11																																																																																			-	NULL		0.617	C11orf86-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C11orf86	protein_coding	OTTHUMT00000332022.2	C	NM_001136485	-		66743716	+1	no_errors	ENST00000308963	ensembl	human	known	74_37	silent	SNP	0.926	T
MMP27	64066	genome.wustl.edu	37	11	102567514	102567514	+	Silent	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr11:102567514G>A	ENST00000260229.4	-	5	763	c.672C>T	c.(670-672)ctC>ctT	p.L224L		NM_022122.2	NP_071405.2	Q9H306	MMP27_HUMAN	matrix metallopeptidase 27	224					collagen catabolic process (GO:0030574)	proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(12)|ovary(2)|prostate(2)|skin(11)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	45	all_cancers(8;0.000843)|all_epithelial(12;0.00362)|Lung NSC(15;0.21)	all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.0509)|Lung(13;0.0696)|LUSC - Lung squamous cell carcinoma(19;0.13)|all cancers(10;0.176)	BRCA - Breast invasive adenocarcinoma(274;0.0151)	Marimastat(DB00786)	TGGAGTGAGAGAGCCCCAGTG	0.418																																																	0								ENSG00000137675						88.0	76.0	80.0					11																	102567514		2203	4299	6502	MMP27	SO:0001819	synonymous_variant	0			-	HGNC	AF195192	CCDS8319.1	11q24	2008-07-18	2005-08-08		ENSG00000137675	ENSG00000137675			14250	protein-coding gene	gene with protein product	"""matrix metalloprotease 27"""		"""matrix metalloproteinase 27"""			10419448	Standard	NM_022122		Approved		uc001phd.1	Q9H306	OTTHUMG00000168099	ENST00000260229.4:c.672C>T	11.37:g.102567514G>A		Somatic	0	51	0.00		0.41568620468393047	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	32	11.11	Q6UWK6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Pept_M10_metallopeptidase,pfam_Hemopexin-like_repeat,pfam_Peptidoglycan-bd-like,superfamily_Hemopexin-like_dom,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,smart_Hemopexin-like_repeat,pirsf_Pept_M10A_Metazoans,prints_Pept_M10A	p.L224	ENST00000260229.4	37	c.672	CCDS8319.1	11																																																																																			-	pfam_Pept_M10_metallopeptidase,smart_Peptidase_Metallo,pirsf_Pept_M10A_Metazoans,prints_Pept_M10A		0.418	MMP27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP27	protein_coding	OTTHUMT00000398128.1	G	NM_022122	-		102567514	-1	no_errors	ENST00000260229	ensembl	human	known	74_37	silent	SNP	0.985	A
KIF26A	26153	genome.wustl.edu	37	14	104639375	104639375	+	Silent	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr14:104639375C>T	ENST00000423312.2	+	8	1482	c.1482C>T	c.(1480-1482)tgC>tgT	p.C494C	KIF26A_ENST00000315264.7_Silent_p.C355C	NM_015656.1	NP_056471.1	Q9ULI4	KI26A_HUMAN	kinesin family member 26A	494	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|blood coagulation (GO:0007596)|enteric nervous system development (GO:0048484)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of signal transduction (GO:0009968)|regulation of cell growth by extracellular stimulus (GO:0001560)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	21		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0767)	Epithelial(46;0.152)	Epithelial(152;0.161)		TCGTGCCCTGCGCCATCTCCT	0.687																																																	0								ENSG00000066735						21.0	27.0	25.0					14																	104639375		2118	4212	6330	KIF26A	SO:0001819	synonymous_variant	0			-	HGNC	AB033062	CCDS45171.1	14q32.33	2009-03-19			ENSG00000066735	ENSG00000066735		"""Kinesins"""	20226	protein-coding gene	gene with protein product		613231				10574462, 11416179	Standard	NM_015656		Approved	KIAA1236, DKFZP434N178	uc001yos.4	Q9ULI4	OTTHUMG00000154986	ENST00000423312.2:c.1482C>T	14.37:g.104639375C>T		Somatic	0	37	0.00		0.41568620468393047	3	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00	Q8TAZ7|Q96GK3|Q9UFL3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,prints_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	p.C494	ENST00000423312.2	37	c.1482	CCDS45171.1	14																																																																																			-	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom		0.687	KIF26A-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	KIF26A	protein_coding	OTTHUMT00000414356.1	C		-		104639375	+1	no_errors	ENST00000423312	ensembl	human	known	74_37	silent	SNP	0.984	T
COL6A4P1	344875	genome.wustl.edu	37	3	15195282	15195282	+	IGR	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr3:15195282C>T								AC090954.1 (19245 upstream) : COL6A4P1 (11499 downstream)																							TATGCAAACCCTCTGCCAAAT	0.438																																																	0								ENSG00000230524																																			COL6A4P1	SO:0001628	intergenic_variant	0			-	HGNC																													3.37:g.15195282C>T		Somatic	0	67	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	29	12.12		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL		37	NULL		3																																																																																			-	-	0	0.438					COL6A4P1			C		-		15195282	-1	no_errors	ENST00000508169	ensembl	human	known	74_37	rna	SNP	1.000	T
RP6-206I17.1	0	genome.wustl.edu	37	1	143663940	143663940	+	lincRNA	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr1:143663940C>T	ENST00000445753.1	-	0	466																											TGGCTCTTCCCGTTCTTTGCG	0.637																																																	0								ENSG00000223804																																			RP6-206I17.1			0			-	Clone_based_vega_gene																													1.37:g.143663940C>T		Somatic	0	81	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	58	21.62		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000445753.1	37	NULL		1																																																																																			-	-		0.637	RP6-206I17.1-001	KNOWN	basic	lincRNA	ENSG00000223804	lincRNA	OTTHUMT00000037956.1	C		-		143663940	-1	no_errors	ENST00000440199	ensembl	human	known	74_37	rna	SNP	0.035	T
ARGLU1	55082	genome.wustl.edu	37	13	107220058	107220058	+	Silent	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr13:107220058C>T	ENST00000400198.3	-	1	454	c.210G>A	c.(208-210)cgG>cgA	p.R70R		NM_018011.3	NP_060481.3	Q9NWB6	ARGL1_HUMAN	arginine and glutamate rich 1	70	Arg-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)|nucleus (GO:0005634)				large_intestine(1)|lung(5)|pancreas(1)	7	Lung NSC(43;0.015)|all_neural(89;0.0741)|Lung SC(71;0.14)|Medulloblastoma(90;0.169)					GCTCCCGGTCCCGCTCGCGCC	0.692																																																	0								ENSG00000134884						20.0	21.0	21.0					13																	107220058		1879	4080	5959	ARGLU1	SO:0001819	synonymous_variant	0			-	HGNC	BC071587	CCDS41906.1	13q33.3	2011-10-03	2007-11-28		ENSG00000134884	ENSG00000134884			25482	protein-coding gene	gene with protein product		614046				21454576	Standard	NM_018011		Approved	FLJ10154	uc001vqk.4	Q9NWB6	OTTHUMG00000017321	ENST00000400198.3:c.210G>A	13.37:g.107220058C>T		Somatic	0	44	0.00		0.41568620468393047	34	30.61	15	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	24	22.58	B4E0Y3|Q5T257|Q6IQ34	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.R70	ENST00000400198.3	37	c.210	CCDS41906.1	13																																																																																			-	NULL		0.692	ARGLU1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARGLU1	protein_coding	OTTHUMT00000045727.1	C	NM_018011	-		107220058	-1	no_errors	ENST00000400198	ensembl	human	known	74_37	silent	SNP	1.000	T
KRTAP21-3	100288323	genome.wustl.edu	37	21	32091030	32091030	+	Silent	SNP	A	A	C			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr21:32091030A>C	ENST00000444335.1	-	1	65	c.48T>G	c.(46-48)tcT>tcG	p.S16S		NM_001164435.1	NP_001157907.1	Q3LHN1	KR213_HUMAN	keratin associated protein 21-3	16						intermediate filament (GO:0005882)											AACCATAGCAAGAGCCAAATC	0.403																																																	0								ENSG00000231068						102.0	94.0	96.0					21																	32091030		692	1591	2283	KRTAP21-3	SO:0001819	synonymous_variant	0			-	HGNC	AB180042	CCDS54481.1	21q22.11	2011-02-24			ENSG00000231068	ENSG00000231068		"""Keratin associated proteins"""	34216	protein-coding gene	gene with protein product							Standard	NM_001164435		Approved		uc021wii.1	Q3LHN1	OTTHUMG00000125533	ENST00000444335.1:c.48T>G	21.37:g.32091030A>C		Somatic	0	65	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	29	23.68		Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.S16	ENST00000444335.1	37	c.48	CCDS54481.1	21																																																																																			-	NULL		0.403	KRTAP21-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP21-3	protein_coding	OTTHUMT00000246864.1	A	XM_002343741	-		32091030	-1	no_errors	ENST00000444335	ensembl	human	known	74_37	silent	SNP	0.000	C
SLFN13	146857	genome.wustl.edu	37	17	33772391	33772391	+	Silent	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr17:33772391C>T	ENST00000285013.6	-	3	584	c.309G>A	c.(307-309)agG>agA	p.R103R	SLFN13_ENST00000526861.1_Silent_p.R103R|SLFN13_ENST00000533791.1_Silent_p.R103R|SLFN13_ENST00000534689.1_Intron|SLFN13_ENST00000542635.1_Silent_p.R103R|SLFN13_ENST00000360502.2_Intron	NM_144682.5	NP_653283.3	Q68D06	SLN13_HUMAN	schlafen family member 13	103						intracellular (GO:0005622)	ATP binding (GO:0005524)			NS(1)|breast(1)|endometrium(1)|large_intestine(10)|lung(8)|ovary(3)|pancreas(1)|prostate(5)|stomach(1)	31				UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)		TATAAAAACACCTTCCGTGTT	0.383																																																	0								ENSG00000154760						67.0	68.0	68.0					17																	33772391		2203	4300	6503	SLFN13	SO:0001819	synonymous_variant	0			-	HGNC	AL832726	CCDS32620.1	17q12	2006-04-05				ENSG00000154760			26481	protein-coding gene	gene with protein product		614957				9846487	Standard	NM_144682		Approved	FLJ31952	uc002hjl.2	Q68D06		ENST00000285013.6:c.309G>A	17.37:g.33772391C>T		Somatic	0	46	0.00		0.41568620468393047	4	20.00	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	26	18.75	E1P645|Q658M1|Q6ZS51|Q96A81	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e1+1	ENST00000285013.6	37	c.308+1	CCDS32620.1	17																																																																																			-	-		0.383	SLFN13-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SLFN13	protein_coding	OTTHUMT00000381883.1	C	NM_144682	-		33772391	-1	no_errors	ENST00000530782	ensembl	human	known	74_37	splice_site	SNP	0.000	T
RP11-509A17.3	0	genome.wustl.edu	37	15	20563401	20563401	+	lincRNA	SNP	C	C	G			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr15:20563401C>G	ENST00000557528.1	+	0	1812				AC026495.1_ENST00000581090.1_RNA																							CCCTTGTCCTCCCAGAGcctc	0.672																																																	0								ENSG00000265002																																			AC026495.1			0			-	Clone_based_ensembl_gene																													15.37:g.20563401C>G		Somatic	0	51	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	39	15.22		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000557528.1	37	NULL		15																																																																																			-	-		0.672	RP11-509A17.3-001	KNOWN	basic	lincRNA	ENSG00000265002	lincRNA	OTTHUMT00000414658.1	C		-		20563401	+1	no_errors	ENST00000581090	ensembl	human	novel	74_37	rna	SNP	0.068	G
SRRM2	23524	genome.wustl.edu	37	16	2815847	2815847	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr16:2815847C>T	ENST00000301740.8	+	11	5867	c.5318C>T	c.(5317-5319)tCc>tTc	p.S1773F		NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	1773	Arg-rich.|Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						CTCCAGAGGTCCCGTTCCCGC	0.582																																																	0								ENSG00000167978						51.0	54.0	53.0					16																	2815847		2198	4300	6498	SRRM2	SO:0001583	missense	0			-	HGNC	AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.5318C>T	16.37:g.2815847C>T	ENSP00000301740:p.Ser1773Phe	Somatic	0	100	0.00		0.41568620468393047	52	36.59	30	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	59	26.25	A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_mRNA_splic_Cwf21	p.S1773F	ENST00000301740.8	37	c.5318	CCDS32373.1	16	.	.	.	.	.	.	.	.	.	.	C	8.520	0.868451	0.17322	.	.	ENSG00000167978	ENST00000301740;ENST00000382301;ENST00000544933	T	0.36699	1.24	5.46	5.46	0.80206	.	0.000000	0.64402	D	0.000013	T	0.41673	0.1169	N	0.08118	0	0.39573	D	0.969305	D	0.71674	0.998	D	0.80764	0.994	T	0.55244	-0.8171	10	0.87932	D	0	-8.7336	16.7967	0.85604	0.0:1.0:0.0:0.0	.	1773	Q9UQ35	SRRM2_HUMAN	F	1773;1773;1025	ENSP00000301740:S1773F	ENSP00000301740:S1773F	S	+	2	0	SRRM2	2755848	0.998000	0.40836	1.000000	0.80357	0.990000	0.78478	4.475000	0.60210	2.562000	0.86427	0.650000	0.86243	TCC	-	NULL		0.582	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRRM2	protein_coding	OTTHUMT00000436411.1	C		-		2815847	+1	no_errors	ENST00000301740	ensembl	human	known	74_37	missense	SNP	1.000	T
CDC25B	994	genome.wustl.edu	37	20	3781927	3781927	+	Silent	SNP	A	A	G			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr20:3781927A>G	ENST00000245960.5	+	8	1429	c.732A>G	c.(730-732)gaA>gaG	p.E244E	CDC25B_ENST00000439880.2_Silent_p.E230E|CDC25B_ENST00000379598.5_Silent_p.E180E|CDC25B_ENST00000344256.6_Silent_p.E180E|CDC25B_ENST00000340833.4_Silent_p.E203E|CDC25B_ENST00000467519.1_3'UTR	NM_004358.3|NM_021872.2|NM_021873.2	NP_004349.1|NP_068658.1|NP_068659.1	P30305	MPIP2_HUMAN	cell division cycle 25B	244					female meiosis I (GO:0007144)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|oocyte maturation (GO:0001556)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of protein kinase activity (GO:0045860)|protein phosphorylation (GO:0006468)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)			NS(1)|large_intestine(4)|lung(10)|ovary(2)|prostate(1)	18						GGAAGATGGAAGTGGAGGAGC	0.552																																																	0								ENSG00000101224						110.0	105.0	107.0					20																	3781927		2203	4300	6503	CDC25B	SO:0001819	synonymous_variant	0			-	HGNC		CCDS13065.1, CCDS13066.1, CCDS13067.1, CCDS74700.1, CCDS74701.1	20p13	2013-01-17	2013-01-17		ENSG00000101224	ENSG00000101224		"""Protein tyrosine phosphatases / Class III Cys-based PTPs"""	1726	protein-coding gene	gene with protein product		116949	"""cell division cycle 25B"", ""cell division cycle 25 homolog B (S. cerevisiae)"", ""cell division cycle 25 homolog B (S. pombe)"""			1836978	Standard	NM_021873		Approved		uc002wjn.3	P30305	OTTHUMG00000031764	ENST00000245960.5:c.732A>G	20.37:g.3781927A>G		Somatic	0	72	0.00		0.41568620468393047	39	9.30	4	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	35	27.08	D3DVY1|D3DVY2|D3DVY3|D3DVY4|O43551|Q13971|Q5JX77|Q6RSS1|Q9BRA6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_MPI_Phosphatase,pfam_Rhodanese-like_dom,superfamily_Rhodanese-like_dom,smart_Rhodanese-like_dom,pfscan_Rhodanese-like_dom,prints_MPI_Phosphatase	p.E244	ENST00000245960.5	37	c.732	CCDS13067.1	20																																																																																			-	pfam_MPI_Phosphatase		0.552	CDC25B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC25B	protein_coding	OTTHUMT00000077779.2	A	NM_021874	-		3781927	+1	no_errors	ENST00000245960	ensembl	human	known	74_37	silent	SNP	0.007	G
LCOR	84458	genome.wustl.edu	37	10	98714935	98714935	+	Missense_Mutation	SNP	C	C	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr10:98714935C>A	ENST00000371097.4	+	8	1104	c.558C>A	c.(556-558)caC>caA	p.H186Q	LCOR_ENST00000371103.3_Missense_Mutation_p.H186Q|LCOR_ENST00000498444.1_Intron|LCOR_ENST00000540664.1_Missense_Mutation_p.H186Q|LCOR_ENST00000356016.3_Missense_Mutation_p.H186Q			Q96JN0	LCOR_HUMAN	ligand dependent nuclear receptor corepressor	186					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(1)|large_intestine(3)|lung(1)|ovary(3)|prostate(1)|urinary_tract(1)	13		Colorectal(252;0.162)		Epithelial(162;4.43e-09)|all cancers(201;2.96e-07)		ATGGACAACACTTAATATTAT	0.478																																																	0								ENSG00000196233						67.0	65.0	66.0					10																	98714935		2203	4300	6503	LCOR	SO:0001583	missense	0			-	HGNC		CCDS7451.1, CCDS53561.1	10q24	2006-06-28			ENSG00000196233	ENSG00000196233			29503	protein-coding gene	gene with protein product		607698				12535528, 15193453	Standard	NM_001170765		Approved	MLR2, FLJ38026, KIAA1795		Q96JN0	OTTHUMG00000018841	ENST00000371097.4:c.558C>A	10.37:g.98714935C>A	ENSP00000360138:p.His186Gln	Somatic	0	51	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	29	12.12	D3DR47|Q5VW16|Q7Z723|Q86T32|Q86T33|Q8N3L6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_HTH_Psq,superfamily_Homeodomain-like,pfscan_HTH_Psq	p.H186Q	ENST00000371097.4	37	c.558	CCDS7451.1	10	.	.	.	.	.	.	.	.	.	.	C	6.037	0.375172	0.11409	.	.	ENSG00000196233	ENST00000540664;ENST00000371103;ENST00000371097;ENST00000356016	.	.	.	5.34	4.39	0.52855	.	0.333409	0.32416	N	0.006125	T	0.18002	0.0432	N	0.08118	0	0.28624	N	0.90802	P;P	0.42827	0.791;0.689	B;B	0.37508	0.128;0.252	T	0.06023	-1.0850	9	0.18276	T	0.48	-3.6359	13.3432	0.60557	0.0:0.919:0.0:0.081	.	186;186	Q96JN0;Q96JN0-2	LCOR_HUMAN;.	Q	186	.	ENSP00000348298:H186Q	H	+	3	2	LCOR	98704925	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	1.742000	0.38248	1.296000	0.44742	-0.355000	0.07637	CAC	-	NULL		0.478	LCOR-009	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	LCOR	protein_coding	OTTHUMT00000049628.2	C		-		98714935	+1	no_errors	ENST00000356016	ensembl	human	known	74_37	missense	SNP	1.000	A
IL36RN	26525	genome.wustl.edu	37	2	113820212	113820212	+	Nonsense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr2:113820212G>A	ENST00000393200.2	+	5	587	c.426G>A	c.(424-426)tgG>tgA	p.W142*	IL36RN_ENST00000346807.3_Nonsense_Mutation_p.W142*	NM_012275.2	NP_036407.1	Q9UBH0	I36RA_HUMAN	interleukin 36 receptor antagonist	142					antifungal humoral response (GO:0019732)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|negative regulation of interferon-gamma secretion (GO:1902714)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of interleukin-6 production (GO:0032715)	extracellular space (GO:0005615)	interleukin-1 receptor antagonist activity (GO:0005152)			large_intestine(3)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	11						ATGGTGGCTGGAATGCCCCCA	0.627																																																	0								ENSG00000136695						44.0	42.0	43.0					2																	113820212		2203	4300	6503	IL36RN	SO:0001587	stop_gained	0			-	HGNC	AF201830	CCDS2111.1	2q14	2014-09-17	2011-06-06	2011-06-06	ENSG00000136695	ENSG00000136695		"""Interleukins and interleukin receptors"""	15561	protein-coding gene	gene with protein product	"""family of interleukin 1-delta"", ""interleukin-1 receptor antagonist homolog 1"", ""interleukin-1 HY1"", ""IL-1 related protein 3"""	605507	"""interleukin 1 family, member 5 (delta)"""	IL1F5		10625660, 10512743, 11574262	Standard	NM_012275		Approved	FIL1, FIL1(DELTA), FIL1D, IL1HY1, IL1RP3, IL1L1, IL-1F5, IL36RA, MGC29840	uc002tit.3	Q9UBH0	OTTHUMG00000131337	ENST00000393200.2:c.426G>A	2.37:g.113820212G>A	ENSP00000376896:p.Trp142*	Somatic	0	62	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	23	25.81	A8K2I4|Q56AT9|Q7RTZ6	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_IL-1,superfamily_Cytokine_IL1-like,smart_IL-1,prints_IL-1RA/IL-36,prints_IL-1,prints_IL-1_alpha/beta	p.W142*	ENST00000393200.2	37	c.426	CCDS2111.1	2	.	.	.	.	.	.	.	.	.	.	G	12.86	2.063907	0.36373	.	.	ENSG00000136695	ENST00000346807;ENST00000393200	.	.	.	4.81	2.89	0.33648	.	1.078780	0.07131	N	0.845674	.	.	.	.	.	.	0.47065	D	0.999305	.	.	.	.	.	.	.	.	.	.	0.45353	T	0.12	0.0073	11.6017	0.51006	0.0:0.3472:0.6528:0.0	.	.	.	.	X	142	.	ENSP00000259212:W142X	W	+	3	0	IL36RN	113536683	0.152000	0.22762	0.008000	0.14137	0.006000	0.05464	1.293000	0.33353	0.634000	0.30469	0.655000	0.94253	TGG	-	pfam_IL-1,superfamily_Cytokine_IL1-like,smart_IL-1		0.627	IL36RN-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	IL36RN	protein_coding	OTTHUMT00000330729.1	G	NM_173170	-		113820212	+1	no_errors	ENST00000346807	ensembl	human	known	74_37	nonsense	SNP	0.012	A
AFF2	2334	genome.wustl.edu	37	X	148035201	148035201	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chrX:148035201G>A	ENST00000370460.2	+	10	1968	c.1489G>A	c.(1489-1491)Gat>Aat	p.D497N	AFF2_ENST00000286437.5_Missense_Mutation_p.D138N|AFF2_ENST00000342251.3_Missense_Mutation_p.D464N|AFF2_ENST00000370457.5_Missense_Mutation_p.D464N	NM_001169123.1|NM_002025.3	NP_001162594.1|NP_002016.2	P51816	AFF2_HUMAN	AF4/FMR2 family, member 2	497					brain development (GO:0007420)|learning or memory (GO:0007611)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)	G-quadruplex RNA binding (GO:0002151)	p.D497Y(2)|p.D138Y(1)		breast(5)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(29)|liver(2)|lung(39)|ovary(4)|pancreas(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	109	Acute lymphoblastic leukemia(192;6.56e-05)					CTCTGAGTCGGATTCAGACAC	0.587																																																	3	Substitution - Missense(3)	lung(3)						ENSG00000155966						128.0	120.0	122.0					X																	148035201		2203	4300	6503	AFF2	SO:0001583	missense	0			-	HGNC	U48436	CCDS14684.1, CCDS55521.1, CCDS76040.1	Xq28	2008-02-05	2005-06-27	2005-06-27	ENSG00000155966	ENSG00000155966			3776	protein-coding gene	gene with protein product		300806	"""fragile X mental retardation 2"""	FMR2			Standard	NM_002025		Approved	FRAXE	uc004fcp.3	P51816	OTTHUMG00000022613	ENST00000370460.2:c.1489G>A	X.37:g.148035201G>A	ENSP00000359489:p.Asp497Asn	Somatic	0	32	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	12	29.41	A2RTY4|B4DXD5|B7WNQ1|B7ZLD6|B7ZLD9|O43786|O60215|P78407|Q13521|Q14323|Q7Z2F7|Q7Z400|Q9UNA5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TF_AF4/FMR2	p.D497N	ENST00000370460.2	37	c.1489	CCDS14684.1	X	.	.	.	.	.	.	.	.	.	.	G	15.35	2.807960	0.50421	.	.	ENSG00000155966	ENST00000370460;ENST00000370457;ENST00000342251;ENST00000286437	T;T;T;T	0.78924	-1.22;-1.22;-1.22;-1.22	5.01	5.01	0.66863	.	0.054538	0.64402	N	0.000002	D	0.87704	0.6244	M	0.74647	2.275	0.58432	D	0.999997	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.91635	0.999;0.998;0.998;0.998;0.998;0.999	D	0.87628	0.2514	10	0.42905	T	0.14	.	17.756	0.88449	0.0:0.0:1.0:0.0	.	138;462;464;458;487;497	B4DXD5;P51816-6;P51816-3;P51816-2;P51816-5;P51816	.;.;.;.;.;AFF2_HUMAN	N	497;464;464;138	ENSP00000359489:D497N;ENSP00000359486:D464N;ENSP00000345459:D464N;ENSP00000286437:D138N	ENSP00000286437:D138N	D	+	1	0	AFF2	147842901	1.000000	0.71417	0.839000	0.33178	0.127000	0.20565	8.782000	0.91809	2.211000	0.71520	0.600000	0.82982	GAT	-	pfam_TF_AF4/FMR2		0.587	AFF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AFF2	protein_coding	OTTHUMT00000058673.2	G	NM_002025	-		148035201	+1	no_errors	ENST00000370460	ensembl	human	known	74_37	missense	SNP	0.999	A
ARAP2	116984	genome.wustl.edu	37	4	36214909	36214909	+	Missense_Mutation	SNP	G	G	A	rs141950924		TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr4:36214909G>A	ENST00000303965.4	-	4	1486	c.997C>T	c.(997-999)Cct>Tct	p.P333S		NM_015230.3	NP_056045.2	Q8WZ64	ARAP2_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2	333					regulation of ARF GTPase activity (GO:0032312)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|zinc ion binding (GO:0008270)	p.P333S(1)		breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(32)|ovary(2)|pancreas(1)|prostate(3)|skin(7)|urinary_tract(1)	82						TCTCCATAAGGAAAGATGGAA	0.323																																																	1	Substitution - Missense(1)	skin(1)						ENSG00000047365						66.0	71.0	70.0					4																	36214909		2202	4299	6501	ARAP2	SO:0001583	missense	0			-	HGNC	AF411982	CCDS3441.1	4p15.1	2013-01-11	2008-09-22	2008-09-22	ENSG00000047365	ENSG00000047365		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16924	protein-coding gene	gene with protein product		606645	"""centaurin, delta 1"""	CENTD1			Standard	NM_015230		Approved	PARX	uc003gsq.2	Q8WZ64	OTTHUMG00000097811	ENST00000303965.4:c.997C>T	4.37:g.36214909G>A	ENSP00000302895:p.Pro333Ser	Somatic	0	71	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	46	11.54	Q4W5D2|Q7Z2L5|Q96L70|Q96P49|Q9Y4E4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RhoGAP_dom,pfam_Pleckstrin_homology,pfam_ArfGAP,pfam_SAM_type1,pfam_SAM_2,pfam_Ras-assoc,superfamily_Rho_GTPase_activation_prot,superfamily_SAM/pointed,smart_SAM,smart_Pleckstrin_homology,smart_ArfGAP,smart_RhoGAP_dom,pfscan_Pleckstrin_homology,pfscan_Ras-assoc,pfscan_SAM,pfscan_ArfGAP,pfscan_RhoGAP_dom,prints_ArfGAP	p.P333S	ENST00000303965.4	37	c.997	CCDS3441.1	4	.	.	.	.	.	.	.	.	.	.	G	22.4	4.291236	0.80914	.	.	ENSG00000047365	ENST00000303965	T	0.26223	1.75	5.57	5.57	0.84162	.	0.167718	0.42548	D	0.000695	T	0.50051	0.1593	M	0.68952	2.095	0.41384	D	0.98757	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.996	T	0.49380	-0.8946	10	0.87932	D	0	.	15.4084	0.74900	0.0:0.0:1.0:0.0	.	263;333	A7E2A5;Q8WZ64	.;ARAP2_HUMAN	S	333	ENSP00000302895:P333S	ENSP00000302895:P333S	P	-	1	0	ARAP2	35891304	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.702000	0.61817	2.785000	0.95823	0.591000	0.81541	CCT	-	NULL		0.323	ARAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARAP2	protein_coding	OTTHUMT00000215074.2	G	NM_015230	rs141950924		36214909	-1	no_errors	ENST00000303965	ensembl	human	known	74_37	missense	SNP	1.000	A
EVPL	2125	genome.wustl.edu	37	17	74006348	74006348	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr17:74006348C>T	ENST00000301607.3	-	22	3191	c.2938G>A	c.(2938-2940)Gag>Aag	p.E980K	EVPL_ENST00000586740.1_Missense_Mutation_p.E1002K	NM_001988.2	NP_001979.2	Q92817	EVPL_HUMAN	envoplakin	980	Central fibrous rod domain.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)	cell junction (GO:0030054)|cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)			breast(4)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(14)|ovary(2)|pancreas(2)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	54						CCCTCCTCCTCCACCTGGGCC	0.652																																																	0								ENSG00000167880						41.0	44.0	43.0					17																	74006348		2203	4300	6503	EVPL	SO:0001583	missense	0			-	HGNC	U53786	CCDS11737.1	17q25	2008-07-18				ENSG00000167880			3503	protein-coding gene	gene with protein product		601590				8938451, 10409435	Standard	NM_001988		Approved	EVPK	uc002jqi.2	Q92817		ENST00000301607.3:c.2938G>A	17.37:g.74006348C>T	ENSP00000301607:p.Glu980Lys	Somatic	0	51	0.00		0.41568620468393047	13	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	21	27.59	A0AUV5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Plectin_repeat,superfamily_Ferritin-like_SF,smart_Spectrin/alpha-actinin,smart_Plectin_repeat	p.E980K	ENST00000301607.3	37	c.2938	CCDS11737.1	17	.	.	.	.	.	.	.	.	.	.	C	7.676	0.688086	0.14973	.	.	ENSG00000167880	ENST00000301607	T	0.65178	-0.14	4.57	4.57	0.56435	.	0.181442	0.47852	D	0.000206	T	0.67970	0.2950	M	0.72118	2.19	0.42298	D	0.992164	B;P	0.52577	0.177;0.954	B;P	0.47206	0.022;0.541	T	0.71965	-0.4433	10	0.40728	T	0.16	-38.3436	17.7297	0.88374	0.0:1.0:0.0:0.0	.	1002;980	B7ZLH8;Q92817	.;EVPL_HUMAN	K	980	ENSP00000301607:E980K	ENSP00000301607:E980K	E	-	1	0	EVPL	71517943	1.000000	0.71417	0.722000	0.30670	0.020000	0.10135	3.962000	0.56766	2.246000	0.74042	0.491000	0.48974	GAG	-	NULL		0.652	EVPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EVPL	protein_coding	OTTHUMT00000449483.1	C	NM_001988	-		74006348	-1	no_errors	ENST00000301607	ensembl	human	known	74_37	missense	SNP	0.999	T
PRRT2	112476	genome.wustl.edu	37	16	29824915	29824915	+	Silent	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr16:29824915G>A	ENST00000358758.7	+	2	823	c.540G>A	c.(538-540)gaG>gaA	p.E180E	AC009133.14_ENST00000569981.1_RNA|PRRT2_ENST00000567551.1_Intron|AC009133.20_ENST00000569039.1_RNA|PAGR1_ENST00000609618.1_5'Flank|PRRT2_ENST00000567659.1_Silent_p.E180E|PAGR1_ENST00000320330.6_5'Flank|PRRT2_ENST00000300797.6_Silent_p.E180E	NM_001256442.1|NM_001256443.1|NM_145239.2	NP_001243371.1|NP_001243372.1|NP_660282.2	Q7Z6L0	PRRT2_HUMAN	proline-rich transmembrane protein 2	180	Pro-rich.				neuromuscular process controlling posture (GO:0050884)|response to biotic stimulus (GO:0009607)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synapse (GO:0045202)				central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	8						AAAAGCAAGAGAATGGGGCAG	0.612																																																	0								ENSG00000167371						26.0	28.0	27.0					16																	29824915		2194	4298	6492	PRRT2	SO:0001819	synonymous_variant	0			-	HGNC	BC011405	CCDS10654.1, CCDS58445.1, CCDS58446.1	16p11.2	2014-02-03			ENSG00000167371	ENSG00000167371		"""Proline-rich transmembrane proteins"""	30500	protein-coding gene	gene with protein product	"""interferon induced transmembrane protein domain containing 1"""	614386	"""infantile convulsions and paroxysmal choreoathetosis"""	ICCA		22101681, 22243967	Standard	NM_145239		Approved	FLJ25513, DKFZp547J199, IFITMD1, FICCA	uc002dud.3	Q7Z6L0	OTTHUMG00000177142	ENST00000358758.7:c.540G>A	16.37:g.29824915G>A		Somatic	0	62	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	39	13.33	A8K8M8|Q8N2N8|Q8NAQ7|Q8ND36|Q96FA8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_CD225/Dispanin_fam	p.E180	ENST00000358758.7	37	c.540	CCDS10654.1	16																																																																																			-	NULL		0.612	PRRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRRT2	protein_coding	OTTHUMT00000255161.3	G	NM_145239	-		29824915	+1	no_errors	ENST00000567659	ensembl	human	known	74_37	silent	SNP	0.998	A
GRM7	2917	genome.wustl.edu	37	3	7188273	7188273	+	Nonsense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr3:7188273G>A	ENST00000357716.4	+	2	928	c.654G>A	c.(652-654)tgG>tgA	p.W218*	GRM7_ENST00000389336.4_Nonsense_Mutation_p.W218*|GRM7_ENST00000402647.2_Nonsense_Mutation_p.W218*|GRM7_ENST00000486284.1_Nonsense_Mutation_p.W218*|GRM7_ENST00000403881.1_Nonsense_Mutation_p.W218*	NM_000844.3	NP_000835.1	Q14831	GRM7_HUMAN	glutamate receptor, metabotropic 7	218					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|adult behavior (GO:0030534)|conditioned taste aversion (GO:0001661)|multicellular organismal response to stress (GO:0033555)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of glutamate secretion (GO:0014050)|regulation of cyclase activity (GO:0031279)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of smell (GO:0007608)|sensory perception of sound (GO:0007605)|short-term memory (GO:0007614)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)	asymmetric synapse (GO:0032279)|axon (GO:0030424)|cell cortex (GO:0005938)|dendrite (GO:0030425)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)|receptor complex (GO:0043235)	adenylate cyclase inhibitor activity (GO:0010855)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|glutamate binding (GO:0016595)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)|PDZ domain binding (GO:0030165)|serine binding (GO:0070905)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(35)|ovary(4)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	76						CCCTAGGCTGGAATTATGTGT	0.517																																																	0								ENSG00000196277						107.0	101.0	103.0					3																	7188273		2203	4300	6503	GRM7	SO:0001587	stop_gained	0			-	HGNC	U92458	CCDS43042.1	3p26-p25	2014-06-12			ENSG00000196277	ENSG00000196277		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4599	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 87"""	604101				8288585, 8840028	Standard	NM_000844		Approved	GLUR7, GPRC1G, mGlu7, MGLUR7, PPP1R87	uc003bql.2	Q14831	OTTHUMG00000125549	ENST00000357716.4:c.654G>A	3.37:g.7188273G>A	ENSP00000350348:p.Trp218*	Somatic	0	62	0.00		0.41568620468393047	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	22	24.14	Q8NFS2|Q8NFS3|Q8NFS4	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,superfamily_Peripla_BP_I,pfscan_GPCR_3_C,prints_GPCR_3,prints_GPCR_3_mtglu_rcpt_7,prints_GPCR_3_mtglu_rcpt,prints_GPCR_3_mtglu_rcpt_4	p.W218*	ENST00000357716.4	37	c.654	CCDS43042.1	3	.	.	.	.	.	.	.	.	.	.	G	25.5	4.647079	0.87958	.	.	ENSG00000196277	ENST00000448328;ENST00000357716;ENST00000486284;ENST00000389336;ENST00000403881;ENST00000525747;ENST00000402647;ENST00000413492	.	.	.	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.1458	0.93467	0.0:0.0:1.0:0.0	.	.	.	.	X	10;218;218;218;218;218;218;218	.	ENSP00000350348:W218X	W	+	3	0	GRM7	7163273	1.000000	0.71417	1.000000	0.80357	0.850000	0.48378	9.813000	0.99286	2.941000	0.99782	0.655000	0.94253	TGG	-	pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I,prints_GPCR_3		0.517	GRM7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRM7	protein_coding	OTTHUMT00000246895.3	G	NM_000844	-		7188273	+1	no_errors	ENST00000402647	ensembl	human	known	74_37	nonsense	SNP	1.000	A
ST6GALNAC1	55808	genome.wustl.edu	37	17	74622777	74622777	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr17:74622777G>A	ENST00000156626.7	-	5	1466	c.1267C>T	c.(1267-1269)Ctt>Ttt	p.L423F	ST6GALNAC1_ENST00000590878.1_5'Flank	NM_018414.3	NP_060884.1	Q9NSC7	SIA7A_HUMAN	ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 1	423					oligosaccharide biosynthetic process (GO:0009312)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	alpha-N-acetylgalactosaminide alpha-2,6-sialyltransferase activity (GO:0001665)|sialyltransferase activity (GO:0008373)			breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(11)|prostate(1)|upper_aerodigestive_tract(1)	22						CCCAATATAAGGAGTGACTGG	0.552																																																	0								ENSG00000070526						287.0	306.0	299.0					17																	74622777		2203	4300	6503	ST6GALNAC1	SO:0001583	missense	0			-	HGNC	Y11339	CCDS11748.1	17q25.3	2013-03-01	2005-02-07	2005-02-07	ENSG00000070526	ENSG00000070526		"""Sialyltransferases"""	23614	protein-coding gene	gene with protein product		610138	"""sialyltransferase 7 ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialyltransferase) A"""	SIAT7A			Standard	NM_001289107		Approved	ST6GalNAcI	uc002jsh.3	Q9NSC7	OTTHUMG00000180369	ENST00000156626.7:c.1267C>T	17.37:g.74622777G>A	ENSP00000156626:p.Leu423Phe	Somatic	0	69	0.00		0.41568620468393047	6	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	57	8.06	Q6UW90|Q9NSC6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Glyco_trans_29	p.L423F	ENST00000156626.7	37	c.1267	CCDS11748.1	17	.	.	.	.	.	.	.	.	.	.	G	16.31	3.085964	0.55861	.	.	ENSG00000070526	ENST00000156626;ENST00000359088	T;T	0.26810	1.72;1.71	5.06	-5.06	0.02946	.	0.914872	0.09164	N	0.839823	T	0.27489	0.0675	M	0.75264	2.295	0.09310	N	1	P	0.45348	0.856	P	0.47470	0.548	T	0.20075	-1.0286	10	0.45353	T	0.12	-5.505	2.0532	0.03575	0.1366:0.203:0.2476:0.4129	.	423	Q9NSC7	SIA7A_HUMAN	F	423	ENSP00000156626:L423F;ENSP00000351991:L423F	ENSP00000156626:L423F	L	-	1	0	ST6GALNAC1	72134372	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-0.842000	0.04354	-0.626000	0.05596	0.609000	0.83330	CTT	-	pfam_Glyco_trans_29		0.552	ST6GALNAC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ST6GALNAC1	protein_coding	OTTHUMT00000450974.1	G	NM_018414	-		74622777	-1	no_errors	ENST00000156626	ensembl	human	known	74_37	missense	SNP	0.000	A
RB1	5925	genome.wustl.edu	37	13	48954210	48954210	+	Nonsense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr13:48954210C>T	ENST00000267163.4	+	15	1549	c.1411C>T	c.(1411-1413)Caa>Taa	p.Q471*		NM_000321.2	NP_000312.2	P06400	RB_HUMAN	retinoblastoma 1	471	Domain A.|Pocket; binds T and E1A.				androgen receptor signaling pathway (GO:0030521)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell morphogenesis involved in neuron differentiation (GO:0048667)|chromatin remodeling (GO:0006338)|digestive tract development (GO:0048565)|enucleate erythrocyte differentiation (GO:0043353)|G1/S transition of mitotic cell cycle (GO:0000082)|glial cell apoptotic process (GO:0034349)|hepatocyte apoptotic process (GO:0097284)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|myoblast differentiation (GO:0045445)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|neuron maturation (GO:0042551)|neuron projection development (GO:0031175)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to chromosome, centromeric region (GO:0071459)|Ras protein signal transduction (GO:0007265)|regulation of centromere complex assembly (GO:0090230)|regulation of cohesin localization to chromatin (GO:0071922)|regulation of lipid kinase activity (GO:0043550)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|sister chromatid biorientation (GO:0031134)|skeletal muscle cell differentiation (GO:0035914)|striated muscle cell differentiation (GO:0051146)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|Rb-E2F complex (GO:0035189)|spindle (GO:0005819)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|phosphoprotein binding (GO:0051219)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.0?(15)|p.?(8)|p.Q471*(1)		NS(3)|adrenal_gland(1)|bone(22)|breast(30)|central_nervous_system(48)|cervix(3)|endometrium(14)|eye(95)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(20)|kidney(3)|large_intestine(10)|liver(3)|lung(153)|oesophagus(1)|ovary(13)|pancreas(5)|pituitary(1)|prostate(14)|salivary_gland(2)|skin(9)|soft_tissue(9)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(31)	496		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	ATTATCCATTCAAAATTTTAG	0.199		6	"""D, Mis, N, F, S"""		"""retinoblastoma, sarcoma, breast, small cell lung"""	"""retinoblastoma, sarcoma, breast, small cell lung"""			Hereditary Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)																													yes	Rec	yes	Familial retinoblastoma	13	13q14	5925	retinoblastoma gene		"""L, E, M, O"""	24	Whole gene deletion(15)|Unknown(8)|Substitution - Nonsense(1)	bone(11)|breast(5)|central_nervous_system(2)|adrenal_gland(1)|eye(1)|soft_tissue(1)|haematopoietic_and_lymphoid_tissue(1)|endometrium(1)|skin(1)						ENSG00000139687						5.0	5.0	5.0					13																	48954210		1731	3825	5556	RB1	SO:0001587	stop_gained	0	Familial Cancer Database		-	HGNC	M15400	CCDS31973.1	13q14.2	2014-09-17	2008-07-31		ENSG00000139687	ENSG00000139687		"""Endogenous ligands"""	9884	protein-coding gene	gene with protein product	"""prepro-retinoblastoma-associated protein"", ""protein phosphatase 1, regulatory subunit 130"""	614041	"""osteosarcoma"""	OSRC		1857421, 15057823	Standard	NM_000321		Approved	RB, PPP1R130	uc001vcb.3	P06400	OTTHUMG00000016900	ENST00000267163.4:c.1411C>T	13.37:g.48954210C>T	ENSP00000267163:p.Gln471*	Somatic	0	38	0.00		0.41568620468393047	4	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	25	19.35	A8K5E3|P78499|Q5VW46|Q8IZL4	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RB_C,pfam_RB_A,pfam_RB_B,pfam_RB_N,superfamily_Cyclin-like,smart_Cyclin-like	p.Q471*	ENST00000267163.4	37	c.1411	CCDS31973.1	13	.	.	.	.	.	.	.	.	.	.	C	39	7.537207	0.98345	.	.	ENSG00000139687	ENST00000542917;ENST00000267163	.	.	.	5.58	5.58	0.84498	.	0.113654	0.64402	D	0.000008	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.20519	T	0.43	.	19.922	0.97089	0.0:1.0:0.0:0.0	.	.	.	.	X	450;471	.	ENSP00000267163:Q471X	Q	+	1	0	RB1	47852211	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.962000	0.76048	2.780000	0.95670	0.655000	0.94253	CAA	-	pfam_RB_A,superfamily_Cyclin-like		0.199	RB1-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	RB1	protein_coding	OTTHUMT00000044884.1	C		-		48954210	+1	no_errors	ENST00000267163	ensembl	human	known	74_37	nonsense	SNP	1.000	T
FGF13	2258	genome.wustl.edu	37	X	137715093	137715093	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chrX:137715093C>T	ENST00000315930.6	-	5	1317	c.656G>A	c.(655-657)gGa>gAa	p.G219E	FGF13_ENST00000370603.3_Missense_Mutation_p.G229E|FGF13_ENST00000441825.2_Missense_Mutation_p.G200E|FGF13_ENST00000541469.1_Missense_Mutation_p.G173E|FGF13_ENST00000305414.4_Missense_Mutation_p.G166E	NM_004114.3	NP_004105.1	Q92913	FGF13_HUMAN	fibroblast growth factor 13	219					cell-cell signaling (GO:0007267)|cerebral cortex cell migration (GO:0021795)|establishment of neuroblast polarity (GO:0045200)|hippocampus development (GO:0021766)|learning (GO:0007612)|MAPK cascade (GO:0000165)|memory (GO:0007613)|microtubule polymerization (GO:0046785)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of microtubule depolymerization (GO:0007026)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|positive regulation of protein kinase activity (GO:0045860)|protein localization to plasma membrane (GO:0072659)|signal transduction (GO:0007165)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular region (GO:0005576)|filopodium (GO:0030175)|growth cone (GO:0030426)|intercalated disc (GO:0014704)|microtubule (GO:0005874)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	beta-tubulin binding (GO:0048487)|growth factor activity (GO:0008083)|ion channel binding (GO:0044325)|microtubule binding (GO:0008017)|protein kinase activator activity (GO:0030295)|sodium channel regulator activity (GO:0017080)			breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(10)|ovary(1)|prostate(1)	24	Acute lymphoblastic leukemia(192;0.000127)					GGTCCCGCTTCCAGATCGGGA	0.512																																																	0								ENSG00000129682						159.0	124.0	136.0					X																	137715093		2203	4300	6503	FGF13	SO:0001583	missense	0			-	HGNC	BC034340	CCDS14664.1, CCDS14665.1, CCDS55511.1	Xq26.3	2008-02-05			ENSG00000129682	ENSG00000129682			3670	protein-coding gene	gene with protein product	"""fibroblast growth factor homologous factor 2"""	300070				8790420	Standard	NM_033642		Approved	FHF2, FGF2	uc011mwj.2	Q92913	OTTHUMG00000022532	ENST00000315930.6:c.656G>A	X.37:g.137715093C>T	ENSP00000322390:p.Gly219Glu	Somatic	0	42	0.00		0.41568620468393047	3	80.00	12	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	12	36.84	B1AK18|B7Z4M7|B7Z8N0|D3DWH4|O95830|Q9NZH9|Q9NZI0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Fibroblast_GF_fam,superfamily_Cytokine_IL1-like,smart_Fibroblast_GF_fam,prints_IL-1_fam/FGF_fam,prints_Fibroblast_GF_fam	p.G229E	ENST00000315930.6	37	c.686	CCDS14665.1	X	.	.	.	.	.	.	.	.	.	.	C	16.96	3.265814	0.59540	.	.	ENSG00000129682	ENST00000315930;ENST00000305414;ENST00000441825;ENST00000370603;ENST00000541469	T;T;T;T;T	0.78364	-0.96;-1.13;-1.14;-1.17;-1.14	5.88	5.88	0.94601	.	0.000000	0.85682	D	0.000000	T	0.66925	0.2839	N	0.22421	0.69	0.80722	D	1	B;P;P;B	0.38863	0.138;0.65;0.486;0.243	B;B;B;B	0.36922	0.065;0.186;0.236;0.065	T	0.65109	-0.6248	10	0.20519	T	0.43	.	18.0496	0.89343	0.0:1.0:0.0:0.0	.	173;229;166;219	B7Z8N0;B7Z4M7;Q92913-2;Q92913	.;.;.;FGF13_HUMAN	E	219;166;200;229;173	ENSP00000322390:G219E;ENSP00000303391:G166E;ENSP00000409276:G200E;ENSP00000359635:G229E;ENSP00000437903:G173E	ENSP00000303391:G166E	G	-	2	0	FGF13	137542759	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.487000	0.81328	2.485000	0.83878	0.600000	0.82982	GGA	-	NULL		0.512	FGF13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGF13	protein_coding	OTTHUMT00000058534.2	C	NM_004114	-		137715093	-1	no_errors	ENST00000370603	ensembl	human	known	74_37	missense	SNP	1.000	T
DNAAF1	123872	genome.wustl.edu	37	16	84203831	84203831	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr16:84203831G>A	ENST00000378553.5	+	8	1521	c.1397G>A	c.(1396-1398)gGg>gAg	p.G466E	DNAAF1_ENST00000334315.5_Intron|DNAAF1_ENST00000563818.1_3'UTR	NM_178452.4	NP_848547.4	Q8NEP3	DAAF1_HUMAN	dynein, axonemal, assembly factor 1	466	Pro-rich.				axonemal dynein complex assembly (GO:0070286)|cilium morphogenesis (GO:0060271)|cilium movement (GO:0003341)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|inner dynein arm assembly (GO:0036159)|left/right pattern formation (GO:0060972)|lung development (GO:0030324)|motile cilium assembly (GO:0044458)|outer dynein arm assembly (GO:0036158)|regulation of cilium beat frequency (GO:0003356)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	dynein binding (GO:0045502)			NS(1)|endometrium(7)|kidney(1)|large_intestine(6)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|stomach(4)|urinary_tract(1)	41						GAGCCAGAGGGGACCCTCCCA	0.632																																																	0								ENSG00000154099						53.0	52.0	52.0					16																	84203831		2199	4300	6499	DNAAF1	SO:0001583	missense	0			-	HGNC	BC024009	CCDS10943.2	16q24.1	2012-05-03	2011-06-09	2011-06-09	ENSG00000154099	ENSG00000154099			30539	protein-coding gene	gene with protein product	"""outer row dynein assembly 7 homolog (Chlamydomonas)"""	613190	"""leucine rich repeat containing 50"""	LRRC50		19944405	Standard	NM_178452		Approved	FLJ25330, ODA7, CILD13	uc002fhl.4	Q8NEP3	OTTHUMG00000128517	ENST00000378553.5:c.1397G>A	16.37:g.84203831G>A	ENSP00000367815:p.Gly466Glu	Somatic	0	146	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	92	8.82	B4DJA3|Q69YI8|Q69YJ0|Q69YW5|Q96LP3|Q96MB6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.G466E	ENST00000378553.5	37	c.1397	CCDS10943.2	16	.	.	.	.	.	.	.	.	.	.	G	12.41	1.929345	0.34096	.	.	ENSG00000154099	ENST00000378553	T	0.26373	1.74	0.622	-0.42	0.12336	.	.	.	.	.	T	0.21962	0.0529	L	0.40543	1.245	0.51482	D	0.999921	B;D	0.67145	0.264;0.996	B;P	0.50314	0.041;0.637	T	0.21759	-1.0236	8	0.09843	T	0.71	.	.	.	.	.	230;466	Q8NEP3-2;Q8NEP3	.;DAAF1_HUMAN	E	466	ENSP00000367815:G466E	ENSP00000367815:G466E	G	+	2	0	DNAAF1	82761332	0.019000	0.18553	0.015000	0.15790	0.272000	0.26649	-0.238000	0.08977	-0.186000	0.10533	-0.360000	0.07572	GGG	-	NULL		0.632	DNAAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAAF1	protein_coding	OTTHUMT00000250328.3	G	NM_178452	-		84203831	+1	no_errors	ENST00000378553	ensembl	human	known	74_37	missense	SNP	0.819	A
ATRNL1	26033	genome.wustl.edu	37	10	117059681	117059681	+	Silent	SNP	A	A	G			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr10:117059681A>G	ENST00000355044.3	+	16	2679	c.2553A>G	c.(2551-2553)gaA>gaG	p.E851E	ATRNL1_ENST00000423111.2_5'Flank|ATRNL1_ENST00000303745.7_5'Flank	NM_207303.2	NP_997186.1	Q5VV63	ATRN1_HUMAN	attractin-like 1	851	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(11)|liver(2)|lung(44)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)		CATATCTGGAAAGGGCTGCAG	0.438																																																	0								ENSG00000107518						93.0	89.0	91.0					10																	117059681		2203	4300	6503	ATRNL1	SO:0001819	synonymous_variant	0			-	HGNC	AB011106	CCDS7592.1, CCDS73204.1	10q26	2004-03-04			ENSG00000107518	ENSG00000107518			29063	protein-coding gene	gene with protein product		612869				9628581	Standard	NM_001276282		Approved	KIAA0534, FLJ45344, ALP	uc001lcg.3	Q5VV63	OTTHUMG00000019096	ENST00000355044.3:c.2553A>G	10.37:g.117059681A>G		Somatic	0	78	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	33	17.50	O60283|Q5JSE8|Q5T5Y9|Q6T256|Q6ZSN4|Q86WX2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Kelch_1,pfam_Kelch_2,pfam_Plexin_repeat,pfam_CUB_dom,pfam_EGF_extracell,superfamily_C-type_lectin_fold,superfamily_CUB_dom,superfamily_Plexin-like_fold,smart_EG-like_dom,smart_CUB_dom,smart_Plexin-like_fold,smart_C-type_lectin,smart_EGF_laminin,pfscan_CUB_dom,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_C-type_lectin	p.E851	ENST00000355044.3	37	c.2553	CCDS7592.1	10																																																																																			-	superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin		0.438	ATRNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATRNL1	protein_coding	OTTHUMT00000050507.3	A	XM_049349	-		117059681	+1	no_errors	ENST00000355044	ensembl	human	known	74_37	silent	SNP	0.997	G
CEP170P1	645455	genome.wustl.edu	37	4	119459025	119459025	+	RNA	SNP	A	A	C			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr4:119459025A>C	ENST00000412784.2	+	0	183					NR_003135.2		Q96L14	C170L_HUMAN	centrosomal protein 170kDa pseudogene 1								identical protein binding (GO:0042802)										GGATCAGCCAAGATCTTGCTC	0.393																																																	0								ENSG00000154608																																			CEP170P1			0			-	HGNC	BC014590		4q26	2010-10-11	2010-10-11	2010-10-11	ENSG00000154608	ENSG00000154608			28364	pseudogene	pseudogene			"""KIAA0470-like"", ""centrosomal protein 170kDa-like"""	KIAA0470L, CEP170L			Standard	NR_003135		Approved	MGC26143, FAM68B	uc003icb.3	Q96L14	OTTHUMG00000132958		4.37:g.119459025A>C		Somatic	0	52	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	37	24.49		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000412784.2	37	NULL		4																																																																																			-	-		0.393	CEP170P1-002	KNOWN	basic	processed_transcript	CEP170P1	pseudogene	OTTHUMT00000364033.2	A	NR_003135.2	-		119459025	+1	no_errors	ENST00000412784	ensembl	human	known	74_37	rna	SNP	1.000	C
SUMF1	285362	genome.wustl.edu	37	3	4452606	4452606	+	Nonsense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr3:4452606C>T	ENST00000272902.5	-	7	932	c.897G>A	c.(895-897)tgG>tgA	p.W299*	SUMF1_ENST00000458465.2_Nonsense_Mutation_p.W167*|SUMF1_ENST00000383843.5_Nonsense_Mutation_p.W274*|SUMF1_ENST00000405420.2_Nonsense_Mutation_p.W299*|SUMF1_ENST00000534863.1_Nonsense_Mutation_p.W299*	NM_182760.3	NP_877437.2	Q8NBK3	SUMF1_HUMAN	sulfatase modifying factor 1	299					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)	metal ion binding (GO:0046872)|oxidoreductase activity (GO:0016491)			breast(1)|endometrium(1)|large_intestine(2)|lung(5)|prostate(1)|upper_aerodigestive_tract(3)	13		Melanoma(143;0.068)|Colorectal(144;0.233)		Epithelial(13;0.0147)|OV - Ovarian serous cystadenocarcinoma(96;0.0444)|all cancers(10;0.0549)		AAGTCCATTCCCATGCGTTCC	0.438																																																	0								ENSG00000144455						202.0	181.0	188.0					3																	4452606		2203	4300	6503	SUMF1	SO:0001587	stop_gained	0			-	HGNC	BC017005	CCDS2564.1, CCDS54548.1, CCDS54549.1	3p26.1	2009-07-23			ENSG00000144455	ENSG00000144455			20376	protein-coding gene	gene with protein product		607939				12757705, 12757706	Standard	NM_182760		Approved	FGE, UNQ3037	uc003bpz.2	Q8NBK3	OTTHUMG00000090269	ENST00000272902.5:c.897G>A	3.37:g.4452606C>T	ENSP00000272902:p.Trp299*	Somatic	0	52	0.00		0.41568620468393047	43	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	37	13.95	B4DXK5|B7XD05|E9PGL0|G5E9B0|Q0VAC6|Q0VAC7|Q2NL78|Q53ZE4|Q6UY39|Q96AK5|Q96DK8	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_FGE_dom,superfamily_C-type_lectin_fold	p.W299*	ENST00000272902.5	37	c.897	CCDS2564.1	3	.	.	.	.	.	.	.	.	.	.	C	23.0	4.368287	0.82463	.	.	ENSG00000144455	ENST00000534982;ENST00000534863;ENST00000272902;ENST00000383843;ENST00000458465;ENST00000405420	.	.	.	5.42	5.42	0.78866	.	0.105878	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-26.0734	17.9951	0.89181	0.0:1.0:0.0:0.0	.	.	.	.	X	299;299;299;274;167;299	.	ENSP00000272902:W299X	W	-	3	0	SUMF1	4427606	1.000000	0.71417	1.000000	0.80357	0.380000	0.30137	6.955000	0.76007	2.544000	0.85801	0.561000	0.74099	TGG	-	pfam_FGE_dom,superfamily_C-type_lectin_fold		0.438	SUMF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUMF1	protein_coding	OTTHUMT00000206591.2	C	NM_182760	-		4452606	-1	no_errors	ENST00000448413	ensembl	human	known	74_37	nonsense	SNP	1.000	T
ZNF138	7697	genome.wustl.edu	37	7	64293004	64293004	+	3'UTR	SNP	C	C	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr7:64293004C>A	ENST00000359735.3	+	0	1560				ZNF138_ENST00000397136.2_3'UTR|ZNF138_ENST00000440598.1_3'UTR|ZNF138_ENST00000437743.1_3'UTR|ZNF138_ENST00000430838.2_3'UTR	NM_001271637.1|NM_001271639.1	NP_001258566.1|NP_001258568.1	P52744	ZN138_HUMAN	zinc finger protein 138						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(1)|large_intestine(3)|lung(2)|stomach(1)	7		Lung NSC(55;0.0795)|all_lung(88;0.18)				GTCCTCACACCTTATGAGACA	0.368																																																	0								ENSG00000197008																																			ZNF138	SO:0001624	3_prime_UTR_variant	0			-	HGNC	U09847	CCDS34645.1, CCDS34645.2, CCDS55115.1, CCDS64659.1, CCDS64660.1, CCDS64661.1, CCDS75607.1	7q11.21	2013-01-08	2005-07-11		ENSG00000197008	ENSG00000197008		"""Zinc fingers, C2H2-type"", ""-"""	12922	protein-coding gene	gene with protein product		604080	"""zinc finger protein 138 (clone pHZ-32)"""				Standard	NM_006524		Approved	pHZ-32	uc031sxl.1	P52744	OTTHUMG00000156603	ENST00000359735.3:c.*424C>A	7.37:g.64293004C>A		Somatic	0	65	0.00		0.41568620468393047	4	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	41	8.89	B4DFX2|B4DP87|E9PHI7|E9PHK7	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000359735.3	37	NULL		7																																																																																			-	-		0.368	ZNF138-201	KNOWN	basic	protein_coding	ZNF138	protein_coding		C	NM_006524	-		64293004	+1	no_errors	ENST00000430838	ensembl	human	known	74_37	rna	SNP	0.036	A
ZNF287	57336	genome.wustl.edu	37	17	16469915	16469915	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr17:16469915G>A	ENST00000395824.1	-	3	1042	c.425C>T	c.(424-426)tCc>tTc	p.S142F	ZNF287_ENST00000395825.3_Missense_Mutation_p.S142F|ZNF287_ENST00000461555.1_5'Flank			Q9HBT7	ZN287_HUMAN	zinc finger protein 287	135					positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokine biosynthetic process (GO:0042035)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(5)|prostate(1)|urinary_tract(1)	20				UCEC - Uterine corpus endometrioid carcinoma (92;0.083)		GGTATCTTGGGAAAGGGTAGA	0.458																																																	0								ENSG00000141040						140.0	145.0	143.0					17																	16469915		2203	4300	6503	ZNF287	SO:0001583	missense	0			-	HGNC	AF217227	CCDS11179.2	17p11.2	2013-01-09			ENSG00000141040	ENSG00000141040		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13502	protein-coding gene	gene with protein product							Standard	NM_020653		Approved	ZKSCAN13, ZSCAN45	uc002gqi.2	Q9HBT7	OTTHUMG00000058993	ENST00000395824.1:c.425C>T	17.37:g.16469915G>A	ENSP00000379168:p.Ser142Phe	Somatic	0	76	0.00		0.41568620468393047	30	26.83	11	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	55	17.91	Q6IAG1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.S142F	ENST00000395824.1	37	c.425	CCDS11179.2	17	.	.	.	.	.	.	.	.	.	.	G	12.57	1.976530	0.34848	.	.	ENSG00000141040	ENST00000395825;ENST00000395824	T;T	0.06068	3.35;3.35	4.28	1.11	0.20524	Transcription regulator SCAN (1);	0.517876	0.16498	N	0.211800	T	0.02970	0.0088	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.43702	-0.9375	10	0.32370	T	0.25	.	6.3516	0.21379	0.0992:0.361:0.5398:0.0	.	135	Q9HBT7	ZN287_HUMAN	F	142	ENSP00000379169:S142F;ENSP00000379168:S142F	ENSP00000379168:S142F	S	-	2	0	ZNF287	16410640	0.998000	0.40836	0.069000	0.20011	0.993000	0.82548	2.951000	0.49089	0.314000	0.23086	0.655000	0.94253	TCC	-	smart_Tscrpt_reg_SCAN		0.458	ZNF287-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF287	protein_coding	OTTHUMT00000130504.1	G		-		16469915	-1	no_errors	ENST00000395824	ensembl	human	known	74_37	missense	SNP	0.096	A
COL7A1	1294	genome.wustl.edu	37	3	48626426	48626426	+	Missense_Mutation	SNP	G	G	C			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr3:48626426G>C	ENST00000328333.8	-	18	2424	c.2317C>G	c.(2317-2319)Cct>Gct	p.P773A	COL7A1_ENST00000454817.1_Missense_Mutation_p.P773A	NM_000094.3	NP_000085.1	Q02388	CO7A1_HUMAN	collagen, type VII, alpha 1	773	Fibronectin type-III 6. {ECO:0000255|PROSITE-ProRule:PRU00316}.|Nonhelical region (NC1).				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|collagen type VII trimer (GO:0005590)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(3)|breast(8)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(57)|ovary(7)|prostate(5)|skin(9)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	137				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		ACAGGCTCAGGGGCTGGGGAC	0.577																																																	0								ENSG00000114270						67.0	68.0	68.0					3																	48626426		2203	4300	6503	COL7A1	SO:0001583	missense	0			-	HGNC	L02870	CCDS2773.1	3p21.1	2014-09-17	2008-08-01		ENSG00000114270	ENSG00000114270		"""Collagens"", ""Fibronectin type III domain containing"""	2214	protein-coding gene	gene with protein product	"""collagen VII, alpha-1 polypeptide"", ""LC collagen"""	120120	"""epidermolysis bullosa, dystrophic, dominant and recessive"""	EBDCT, EBD1, EBR1		1871109	Standard	NM_000094		Approved		uc003ctz.2	Q02388	OTTHUMG00000133541	ENST00000328333.8:c.2317C>G	3.37:g.48626426G>C	ENSP00000332371:p.Pro773Ala	Somatic	0	30	0.00		0.41568620468393047	6	14.29	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	15	21.05	Q14054|Q16507	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Collagen,pfam_Fibronectin_type3,pfam_VWF_A,pfam_Prot_inh_Kunz-m,superfamily_Fibronectin_type3,superfamily_Prot_inh_Kunz-m,smart_VWF_A,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_VWF_A,pfscan_Prot_inh_Kunz-m,prints_Prot_inh_Kunz-m	p.P773A	ENST00000328333.8	37	c.2317	CCDS2773.1	3	.	.	.	.	.	.	.	.	.	.	G	12.28	1.889885	0.33348	.	.	ENSG00000114270	ENST00000328333;ENST00000454817	T;T	0.52526	0.66;0.66	5.08	5.08	0.68730	Immunoglobulin-like fold (1);	0.166035	0.28371	N	0.015583	T	0.42177	0.1191	L	0.34521	1.04	0.36637	D	0.876655	D	0.55172	0.97	P	0.49332	0.607	T	0.31251	-0.9950	10	0.08837	T	0.75	.	14.3442	0.66649	0.0:0.0:1.0:0.0	.	773	Q02388	CO7A1_HUMAN	A	773	ENSP00000332371:P773A;ENSP00000412569:P773A	ENSP00000332371:P773A	P	-	1	0	COL7A1	48601430	0.989000	0.36119	1.000000	0.80357	0.884000	0.51177	2.621000	0.46418	2.531000	0.85337	0.462000	0.41574	CCT	-	NULL		0.577	COL7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL7A1	protein_coding	OTTHUMT00000257519.1	G	NM_000094	-		48626426	-1	no_errors	ENST00000328333	ensembl	human	known	74_37	missense	SNP	1.000	C
TAS2R40	259286	genome.wustl.edu	37	7	142919827	142919827	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr7:142919827C>T	ENST00000408947.3	+	1	698	c.656C>T	c.(655-657)tCt>tTt	p.S219F	AC073342.1_ENST00000595842.1_5'Flank	NM_176882.1	NP_795363.1	P59535	T2R40_HUMAN	taste receptor, type 2, member 40	219					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)			kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)	8	Melanoma(164;0.059)					CTGATCCTCTCTCTCAAGAGA	0.507																																																	0								ENSG00000221937						112.0	108.0	109.0					7																	142919827		1947	4146	6093	TAS2R40	SO:0001583	missense	0			-	HGNC	AF494229	CCDS43662.1	7q34	2012-08-22	2003-12-16		ENSG00000221937	ENSG00000221937		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	18885	protein-coding gene	gene with protein product		613964	"""G protein-coupled receptor 60"""	GPR60		12379855	Standard	NM_176882		Approved		uc011ksx.2	P59535	OTTHUMG00000152638	ENST00000408947.3:c.656C>T	7.37:g.142919827C>T	ENSP00000386210:p.Ser219Phe	Somatic	0	34	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	19	20.83	A4D2I2|Q645W6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TAS2_rcpt	p.S219F	ENST00000408947.3	37	c.656	CCDS43662.1	7	.	.	.	.	.	.	.	.	.	.	C	23.1	4.377720	0.82682	.	.	ENSG00000221937	ENST00000408947	T	0.01572	4.76	5.74	5.74	0.90152	.	0.178264	0.37393	U	0.002110	T	0.14743	0.0356	M	0.89414	3.03	0.48341	D	0.999636	D	0.89917	1.0	D	0.97110	1.0	T	0.00126	-1.2020	10	0.87932	D	0	.	18.9022	0.92448	0.0:1.0:0.0:0.0	.	219	P59535	T2R40_HUMAN	F	219	ENSP00000386210:S219F	ENSP00000386210:S219F	S	+	2	0	TAS2R40	142629949	1.000000	0.71417	0.996000	0.52242	0.933000	0.57130	5.285000	0.65633	2.700000	0.92200	0.655000	0.94253	TCT	-	pfam_TAS2_rcpt		0.507	TAS2R40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS2R40	protein_coding	OTTHUMT00000327097.1	C		-		142919827	+1	no_errors	ENST00000408947	ensembl	human	known	74_37	missense	SNP	1.000	T
OLFM4	10562	genome.wustl.edu	37	13	53624877	53624877	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr13:53624877G>A	ENST00000219022.2	+	5	1582	c.1504G>A	c.(1504-1506)Gat>Aat	p.D502N		NM_006418.4	NP_006409.3	Q6UX06	OLFM4_HUMAN	olfactomedin 4	502	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				cell adhesion (GO:0007155)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of immune response (GO:0050777)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|protein homooligomerization (GO:0051260)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|specific granule (GO:0042581)	cadherin binding (GO:0045296)|catalytic activity (GO:0003824)|protein homodimerization activity (GO:0042803)			breast(2)|endometrium(4)|kidney(4)|large_intestine(5)|lung(20)|skin(3)|urinary_tract(1)	39		Breast(56;0.000776)|Lung NSC(96;0.000814)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;3.13e-08)		TCTGAATTATGATCTTTCTGT	0.358																																																	0								ENSG00000102837						73.0	75.0	74.0					13																	53624877		2203	4299	6502	OLFM4	SO:0001583	missense	0			-	HGNC	AY358567	CCDS9440.1	13q14	2004-06-25			ENSG00000102837	ENSG00000102837			17190	protein-coding gene	gene with protein product		614061					Standard	NM_006418		Approved	OlfD, GW112, GC1	uc001vhl.3	Q6UX06	OTTHUMG00000016981	ENST00000219022.2:c.1504G>A	13.37:g.53624877G>A	ENSP00000219022:p.Asp502Asn	Somatic	0	55	0.00		0.41568620468393047	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	28	24.32	O95362|Q5VWG0|Q86T22	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Olfac-like,superfamily_Quinoprot_gluc/sorb_DH,smart_Olfac-like,pfscan_Olfac-like	p.D502N	ENST00000219022.2	37	c.1504	CCDS9440.1	13	.	.	.	.	.	.	.	.	.	.	G	14.80	2.643717	0.47258	.	.	ENSG00000102837	ENST00000219022	T	0.19669	2.13	5.64	4.8	0.61643	Olfactomedin-like (3);	0.222293	0.45867	D	0.000336	T	0.22936	0.0554	L	0.50919	1.6	0.47441	D	0.999427	B	0.21905	0.062	B	0.31016	0.123	T	0.03545	-1.1026	10	0.18710	T	0.47	.	14.4363	0.67282	0.0708:0.0:0.9292:0.0	.	502	Q6UX06	OLFM4_HUMAN	N	502	ENSP00000219022:D502N	ENSP00000219022:D502N	D	+	1	0	OLFM4	52522878	0.814000	0.29104	0.780000	0.31762	0.708000	0.40852	1.115000	0.31209	1.378000	0.46305	0.585000	0.79938	GAT	-	pfam_Olfac-like,superfamily_Quinoprot_gluc/sorb_DH,smart_Olfac-like,pfscan_Olfac-like		0.358	OLFM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OLFM4	protein_coding	OTTHUMT00000045112.2	G	NM_006418	-		53624877	+1	no_errors	ENST00000219022	ensembl	human	known	74_37	missense	SNP	1.000	A
CSMD2	114784	genome.wustl.edu	37	1	34090122	34090122	+	Silent	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr1:34090122G>A	ENST00000373380.1	-	14	2461	c.2241C>T	c.(2239-2241)atC>atT	p.I747I	CSMD2_ENST00000373381.4_Silent_p.I1874I|CSMD2_ENST00000373388.2_5'UTR|CSMD2_ENST00000373377.1_5'UTR			Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	1834	Sushi 4. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				CCCCTACCTGGATGCCAGCGC	0.657																																																	0								ENSG00000121904						104.0	89.0	94.0					1																	34090122		2203	4300	6503	CSMD2	SO:0001819	synonymous_variant	0			-	HGNC	AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373380.1:c.2241C>T	1.37:g.34090122G>A		Somatic	0	32	0.00		0.41568620468393047	1	50.00	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	23	20.69	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_CUB_dom,pfam_Sushi_SCR_CCP,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.I1874	ENST00000373380.1	37	c.5622		1																																																																																			-	pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom		0.657	CSMD2-002	KNOWN	basic	protein_coding	CSMD2	protein_coding	OTTHUMT00000030635.4	G	NM_052896	-		34090122	-1	no_errors	ENST00000373381	ensembl	human	known	74_37	silent	SNP	1.000	A
UAP1L1	91373	genome.wustl.edu	37	9	139975182	139975182	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr9:139975182C>T	ENST00000409858.3	+	7	1252	c.1220C>T	c.(1219-1221)tCc>tTc	p.S407F	UAP1L1_ENST00000360271.3_Missense_Mutation_p.S284F	NM_207309.2	NP_997192.2	Q3KQV9	UAP1L_HUMAN	UDP-N-acetylglucosamine pyrophosphorylase 1 like 1	407							uridylyltransferase activity (GO:0070569)			kidney(1)|large_intestine(1)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	8	all_cancers(76;0.0926)	Myeloproliferative disorder(178;0.0821)	STAD - Stomach adenocarcinoma(284;0.0878)	OV - Ovarian serous cystadenocarcinoma(145;2.96e-05)|Epithelial(140;0.000486)		GAGGAATTTTCCCCACTGAAG	0.667																																																	0								ENSG00000197355						76.0	80.0	79.0					9																	139975182		2203	4298	6501	UAP1L1	SO:0001583	missense	0			-	HGNC	AK022632	CCDS7028.2	9q34.3	2014-07-31	2014-07-31		ENSG00000197355	ENSG00000197355			28082	protein-coding gene	gene with protein product							Standard	NM_207309		Approved		uc010ncb.3	Q3KQV9	OTTHUMG00000020962	ENST00000409858.3:c.1220C>T	9.37:g.139975182C>T	ENSP00000386935:p.Ser407Phe	Somatic	0	69	0.00		0.41568620468393047	17	22.73	5	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	41	21.15	A2AMJ8|Q5SPZ2|Q69YQ3|Q6ZR38	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_UDPGP_trans	p.S407F	ENST00000409858.3	37	c.1220	CCDS7028.2	9	.	.	.	.	.	.	.	.	.	.	C	19.90	3.912197	0.72983	.	.	ENSG00000197355	ENST00000409858;ENST00000360271	T;T	0.20332	2.08;2.08	4.24	4.24	0.50183	.	0.000000	0.85682	D	0.000000	T	0.59059	0.2166	H	0.95437	3.67	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.74542	-0.3631	10	0.87932	D	0	.	15.6034	0.76642	0.0:1.0:0.0:0.0	.	407;284	Q3KQV9;Q3KQV9-2	UAP1L_HUMAN;.	F	407;284	ENSP00000386935:S407F;ENSP00000353409:S284F	ENSP00000353409:S284F	S	+	2	0	UAP1L1	139095003	1.000000	0.71417	0.999000	0.59377	0.624000	0.37722	5.884000	0.69729	1.914000	0.55421	0.484000	0.47621	TCC	-	pfam_UDPGP_trans		0.667	UAP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UAP1L1	protein_coding	OTTHUMT00000055216.2	C	XM_038063	-		139975182	+1	no_errors	ENST00000409858	ensembl	human	known	74_37	missense	SNP	1.000	T
OBSCN	84033	genome.wustl.edu	37	1	228466451	228466451	+	Silent	SNP	T	T	G			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr1:228466451T>G	ENST00000422127.1	+	26	6965	c.6921T>G	c.(6919-6921)ggT>ggG	p.G2307G	RP5-1139B12.3_ENST00000602947.1_RNA|OBSCN_ENST00000366707.4_5'UTR|RP5-1139B12.3_ENST00000602529.1_RNA|OBSCN_ENST00000366709.4_5'UTR|OBSCN_ENST00000570156.2_Silent_p.G2736G|OBSCN_ENST00000284548.11_Silent_p.G2307G|OBSCN_ENST00000359599.6_Silent_p.G1154G	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	2307	Ig-like 23.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				AGCACCGCGGTGTGCTGGAGT	0.657																																																	0								ENSG00000154358						44.0	53.0	50.0					1																	228466451		2102	4224	6326	OBSCN	SO:0001819	synonymous_variant	0			-	HGNC	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.6921T>G	1.37:g.228466451T>G		Somatic	0	61	0.00		0.41568620468393047	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	25	35.90	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Fibronectin_type3,pfam_DH-domain,pfam_IQ_motif_EF-hand-BS,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_IQ_motif_EF-hand-BS,smart_DH-domain,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,pfscan_DH-domain	p.G2307	ENST00000422127.1	37	c.6921	CCDS58065.1	1																																																																																			-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.657	OBSCN-204	KNOWN	basic|CCDS	protein_coding	OBSCN	protein_coding		T	NM_052843	-		228466451	+1	no_errors	ENST00000422127	ensembl	human	known	74_37	silent	SNP	0.000	G
CSMD3	114788	genome.wustl.edu	37	8	113694742	113694742	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr8:113694742C>T	ENST00000297405.5	-	16	2850	c.2606G>A	c.(2605-2607)gGa>gAa	p.G869E	CSMD3_ENST00000352409.3_Missense_Mutation_p.G869E|CSMD3_ENST00000455883.2_Missense_Mutation_p.G765E|CSMD3_ENST00000343508.3_Missense_Mutation_p.G829E	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	869	Sushi 4. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						TGTTTCTGTTCCCTGGGTTTT	0.373										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																																							0								ENSG00000164796						136.0	132.0	134.0					8																	113694742		2203	4300	6503	CSMD3	SO:0001583	missense	0			-	HGNC	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.2606G>A	8.37:g.113694742C>T	ENSP00000297405:p.Gly869Glu	Somatic	0	76	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	50	18.03	Q96PZ3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_CUB_dom,pfam_Sushi_SCR_CCP,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.G869E	ENST00000297405.5	37	c.2606	CCDS6315.1	8	.	.	.	.	.	.	.	.	.	.	C	29.0	4.964959	0.92855	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.72167	-0.63;-0.63;-0.63;-0.63;-0.63	5.68	5.68	0.88126	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.64402	D	0.000001	D	0.90256	0.6953	H	0.96996	3.92	0.52099	D	0.999949	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.92986	0.6410	10	0.87932	D	0	.	19.7925	0.96464	0.0:1.0:0.0:0.0	.	765;869;829	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	E	829;869;209;765;869	ENSP00000345799:G829E;ENSP00000297405:G869E;ENSP00000341558:G209E;ENSP00000412263:G765E;ENSP00000343124:G869E	ENSP00000297405:G869E	G	-	2	0	CSMD3	113763918	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.681000	0.91329	0.650000	0.86243	GGA	-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP		0.373	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSMD3	protein_coding	OTTHUMT00000347141.1	C	NM_052900	-		113694742	-1	no_errors	ENST00000297405	ensembl	human	known	74_37	missense	SNP	1.000	T
RAPGEF5	9771	genome.wustl.edu	37	7	22259605	22259605	+	Silent	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr7:22259605C>T	ENST00000405243.1	-	9	959	c.876G>A	c.(874-876)ggG>ggA	p.G292G	RAPGEF5_ENST00000475788.1_5'UTR|RAPGEF5_ENST00000344041.6_Silent_p.G139G			Q92565	RPGF5_HUMAN	Rap guanine nucleotide exchange factor (GEF) 5	0					nervous system development (GO:0007399)|positive regulation of Rap GTPase activity (GO:0032854)|positive regulation of Ras GTPase activity (GO:0032320)|small GTPase mediated signal transduction (GO:0007264)	nucleus (GO:0005634)	GTP-dependent protein binding (GO:0030742)|Rap guanyl-nucleotide exchange factor activity (GO:0017034)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			central_nervous_system(1)|endometrium(1)|kidney(1)|lung(2)|ovary(1)	6						TGCACATCACCCCTGCCTTAA	0.418																																																	0								ENSG00000136237						73.0	69.0	70.0					7																	22259605		1879	4104	5983	RAPGEF5	SO:0001819	synonymous_variant	0			-	HGNC	D87467	CCDS55093.1	7p15.3	2004-03-01			ENSG00000136237	ENSG00000136237			16862	protein-coding gene	gene with protein product	"""M-Ras-regulated GEF"""	609527				9039502, 10486569	Standard	NM_012294		Approved	KIAA0277, GFR, MR-GEF	uc003svg.3	Q92565	OTTHUMG00000152525	ENST00000405243.1:c.876G>A	7.37:g.22259605C>T		Somatic	0	56	0.00		0.41568620468393047	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	35	23.91	A4D140|Q8IXU5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_RasGRF_CDC25,pfam_Ras-like_Gua-exchang_fac_N,superfamily_Ras_GEF_dom,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.G139	ENST00000405243.1	37	c.417		7																																																																																			-	NULL		0.418	RAPGEF5-002	PUTATIVE	basic	protein_coding	RAPGEF5	protein_coding	OTTHUMT00000326591.1	C	NM_012294	-		22259605	-1	no_errors	ENST00000344041	ensembl	human	known	74_37	silent	SNP	0.951	T
PLEKHG5	57449	genome.wustl.edu	37	1	6533332	6533332	+	Silent	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr1:6533332G>A	ENST00000400915.3	-	9	1008	c.942C>T	c.(940-942)ccC>ccT	p.P314P	PLEKHG5_ENST00000377728.3_Silent_p.P258P|PLEKHG5_ENST00000377737.2_Silent_p.P258P|PLEKHG5_ENST00000377740.3_Silent_p.P335P|PLEKHG5_ENST00000537245.1_Silent_p.P337P|PLEKHG5_ENST00000544978.1_Silent_p.P258P|PLEKHG5_ENST00000340850.5_Silent_p.P258P|PLEKHG5_ENST00000535355.1_Silent_p.P327P|PLEKHG5_ENST00000377732.1_Silent_p.P295P|PLEKHG5_ENST00000377748.1_Silent_p.P335P|PLEKHG5_ENST00000400913.1_Silent_p.P258P|PLEKHG5_ENST00000377725.1_Silent_p.P258P	NM_001042663.1	NP_001036128.1	O94827	PKHG5_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 5	314					apoptotic signaling pathway (GO:0097190)|endothelial cell chemotaxis (GO:0035767)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)			liver(1)	1	Ovarian(185;0.02)|all_lung(157;0.154)	all_cancers(23;1.7e-35)|all_epithelial(116;2.78e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|Colorectal(325;4.47e-05)|all_hematologic(16;0.00014)|Breast(487;0.000688)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0448)		Epithelial(90;5.51e-35)|GBM - Glioblastoma multiforme(13;3.57e-27)|Colorectal(212;6.23e-08)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000894)|BRCA - Breast invasive adenocarcinoma(365;0.00107)|STAD - Stomach adenocarcinoma(132;0.00159)|READ - Rectum adenocarcinoma(331;0.0419)		CGCTGGTGCTGGGGCCGGAGC	0.662																																																	0								ENSG00000171680						17.0	22.0	21.0					1																	6533332		2197	4296	6493	PLEKHG5	SO:0001819	synonymous_variant	0			-	HGNC	AK024676	CCDS79.1, CCDS41240.1, CCDS41241.1, CCDS57967.1, CCDS57968.1, CCDS57969.1	1p36.31	2014-09-17		2005-08-09	ENSG00000171680	ENSG00000171680		"""Pleckstrin homology (PH) domain containing"""	29105	protein-coding gene	gene with protein product	"""synectin-binding guanine exchange factor"""	611101				17564964	Standard	NM_001042663		Approved	KIAA0720, Syx, GEF720, Tech	uc010nzr.1	O94827	OTTHUMG00000000905	ENST00000400915.3:c.942C>T	1.37:g.6533332G>A		Somatic	0	10	0.00		0.41568620468393047	13	13.33	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	6	53.85	B3KU07|B7Z2M3|B7Z5X2|F5GZ21|F5H1I0|Q5SY17|Q5T8W5|Q5T8W9|Q6ZNM0|Q7Z436|Q86YD8|Q96BS1	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.P337	ENST00000400915.3	37	c.1011	CCDS41241.1	1																																																																																			-	NULL		0.662	PLEKHG5-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLEKHG5	protein_coding	OTTHUMT00000002631.1	G	NM_020631	-		6533332	-1	no_errors	ENST00000537245	ensembl	human	known	74_37	silent	SNP	1.000	A
N6AMT1	29104	genome.wustl.edu	37	21	30248728	30248728	+	Silent	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr21:30248728G>A	ENST00000303775.5	-	6	649	c.624C>T	c.(622-624)gtC>gtT	p.V208V	N6AMT1_ENST00000351429.3_Silent_p.V180V	NM_013240.4	NP_037372	Q9Y5N5	HEMK2_HUMAN	N-6 adenine-specific DNA methyltransferase 1 (putative)	208					positive regulation of cell growth (GO:0030307)|protein methylation (GO:0006479)	protein complex (GO:0043234)	nucleic acid binding (GO:0003676)|protein methyltransferase activity (GO:0008276)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(2)	12						TGAACTTGAGGACTGAAAGAG	0.368																																																	0								ENSG00000156239						192.0	166.0	175.0					21																	30248728		2203	4300	6503	N6AMT1	SO:0001819	synonymous_variant	0			-	HGNC	AF139682	CCDS33525.1, CCDS33526.1	21q21.3	2006-12-14	2006-12-14	2006-12-14	ENSG00000156239	ENSG00000156239	2.1.1.72		16021	protein-coding gene	gene with protein product		614553	"""chromosome 21 open reading frame 127"", ""HemK methyltransferase family member 2"""	C21orf127, HEMK2			Standard	NM_013240		Approved	PRED28, N6AMT, MTQ2	uc002ymo.2	Q9Y5N5	OTTHUMG00000078750	ENST00000303775.5:c.624C>T	21.37:g.30248728G>A		Somatic	0	59	0.00		0.41568620468393047	12	33.33	6	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	35	16.67	Q96F73	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Small_mtfrase_dom,pfam_Ribosomal-L11_MeTrfase_PrmA,tigrfam_PrmC_related	p.V208	ENST00000303775.5	37	c.624	CCDS33526.1	21																																																																																			-	tigrfam_PrmC_related		0.368	N6AMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	N6AMT1	protein_coding	OTTHUMT00000171738.1	G	NM_013240	-		30248728	-1	no_errors	ENST00000303775	ensembl	human	known	74_37	silent	SNP	1.000	A
CFAP54	144535	genome.wustl.edu	37	12	97073485	97073485	+	Silent	SNP	C	C	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr12:97073485C>A	ENST00000524981.4	+	40	5694	c.5671C>A	c.(5671-5673)Cga>Aga	p.R1891R				Q96N23	CL055_HUMAN		0																	CAGATCAATCCGACACAGCAG	0.453																																																	0								ENSG00000188596						161.0	154.0	157.0					12																	97073485		2203	4300	6503	C12orf55	SO:0001819	synonymous_variant	0			-	HGNC																												ENST00000524981.4:c.5671C>A	12.37:g.97073485C>A		Somatic	0	36	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	24	11.11		Silent	SNP	NA	NA	NA	NA	NA	NA	superfamily_Fibronectin_type3	p.R1891	ENST00000524981.4	37	c.5671		12																																																																																			-	NULL		0.453	C12orf55-003	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	C12orf55	protein_coding	OTTHUMT00000395046.4	C		-		97073485	+1	no_errors	ENST00000524981	ensembl	human	putative	74_37	silent	SNP	0.976	A
RBM5	10181	genome.wustl.edu	37	3	50152992	50152992	+	Silent	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr3:50152992G>A	ENST00000347869.3	+	21	2146	c.1971G>A	c.(1969-1971)ccG>ccA	p.P657P	RP11-493K19.3_ENST00000437204.1_RNA|RP11-493K19.3_ENST00000425674.1_RNA	NM_005778.3	NP_005769.1	P52756	RBM5_HUMAN	RNA binding motif protein 5	657	Required for interaction with U2AF2.				apoptotic process (GO:0006915)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of cell proliferation (GO:0008285)|positive regulation of apoptotic process (GO:0043065)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|spliceosomal complex assembly (GO:0000245)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	DNA binding (GO:0003677)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(2)|cervix(2)|endometrium(3)|large_intestine(4)|lung(6)|prostate(2)	19				BRCA - Breast invasive adenocarcinoma(193;0.000121)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		GCCAGTTCCCGAACAAAGATG	0.567																																																	0								ENSG00000003756						97.0	101.0	100.0					3																	50152992		2203	4300	6503	RBM5	SO:0001819	synonymous_variant	0			-	HGNC	U23946	CCDS2810.1	3p21.3	2013-08-15			ENSG00000003756	ENSG00000003756		"""G patch domain containing"", ""RNA binding motif (RRM) containing"""	9902	protein-coding gene	gene with protein product		606884				10352938, 23935508	Standard	NM_005778		Approved	LUCA15, H37	uc003cyg.3	P52756	OTTHUMG00000156785	ENST00000347869.3:c.1971G>A	3.37:g.50152992G>A		Somatic	0	43	0.00		0.41568620468393047	199	13.10	30	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	22	15.38	B2RA45|B4DM16|B4DMF9|B4DZ63|Q93021|Q9BU14|Q9HDA6|Q9UKY8|Q9UL24	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_G_patch_dom,pfam_RRM_dom,pfam_Znf_RanBP2,smart_RRM_dom,smart_Znf_RanBP2,smart_G_patch_dom,pfscan_Znf_RanBP2,pfscan_Znf_C2H2,pfscan_G_patch_dom,pfscan_RRM_dom	p.P657	ENST00000347869.3	37	c.1971	CCDS2810.1	3																																																																																			-	pfscan_Znf_C2H2		0.567	RBM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM5	protein_coding	OTTHUMT00000345797.3	G	NM_005778	-		50152992	+1	no_errors	ENST00000347869	ensembl	human	known	74_37	silent	SNP	0.980	A
DLC1	10395	genome.wustl.edu	37	8	13357080	13357080	+	Silent	SNP	A	A	G			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr8:13357080A>G	ENST00000276297.4	-	2	910	c.501T>C	c.(499-501)gcT>gcC	p.A167A	DLC1_ENST00000511869.1_Silent_p.A167A|DLC1_ENST00000316609.5_Silent_p.A167A	NM_182643.2	NP_872584.2	Q96QB1	RHG07_HUMAN	DLC1 Rho GTPase activating protein	167					actin cytoskeleton organization (GO:0030036)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|focal adhesion assembly (GO:0048041)|forebrain development (GO:0030900)|heart morphogenesis (GO:0003007)|hindbrain morphogenesis (GO:0021575)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of stress fiber assembly (GO:0051497)|neural tube closure (GO:0001843)|positive regulation of execution phase of apoptosis (GO:1900119)|positive regulation of protein dephosphorylation (GO:0035307)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	lipid binding (GO:0008289)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)			NS(2)|breast(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(39)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	110						CAGTTTCACCAGCTATTCCCC	0.413																																																	0								ENSG00000164741						127.0	132.0	131.0					8																	13357080		2202	4298	6500	DLC1	SO:0001819	synonymous_variant	0			-	HGNC	AF035119	CCDS5989.1, CCDS5990.1, CCDS5991.1, CCDS5991.2, CCDS55201.1	8p22	2014-06-20	2014-06-20		ENSG00000164741	ENSG00000164741		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	2897	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 12"""	604258	"""deleted in liver cancer 1"""			9605766, 11214970	Standard	NM_182643		Approved	HP, ARHGAP7, STARD12, DLC-1, p122-RhoGAP	uc003wwm.2	Q96QB1	OTTHUMG00000090825	ENST00000276297.4:c.501T>C	8.37:g.13357080A>G		Somatic	0	28	0.00		0.41568620468393047	3	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	18	21.74	B4DR10|B8PTI0|E9PDZ8|E9PF76|E9PGY9|O14868|O43199|Q7Z5R8|Q86UC6|Q9C0E0|Q9H7A2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_START_lipid-bd_dom,pfam_RhoGAP_dom,pfam_SAM_2,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,smart_START_lipid-bd_dom,pfscan_START_lipid-bd_dom,pfscan_RhoGAP_dom	p.A167	ENST00000276297.4	37	c.501	CCDS5989.1	8																																																																																			-	NULL		0.413	DLC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DLC1	protein_coding	OTTHUMT00000207632.2	A	NM_182643, NM_006094	-		13357080	-1	no_errors	ENST00000276297	ensembl	human	known	74_37	silent	SNP	0.002	G
LIPC	3990	genome.wustl.edu	37	15	58837997	58837997	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr15:58837997C>T	ENST00000356113.6	+	7	1246	c.631C>T	c.(631-633)Cca>Tca	p.P211S	LIPC_ENST00000414170.3_Missense_Mutation_p.P211S|LIPC_ENST00000433326.2_Missense_Mutation_p.P150S|LIPC_ENST00000299022.5_Missense_Mutation_p.P211S			P11150	LIPC_HUMAN	lipase, hepatic	211					cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|chylomicron remnant clearance (GO:0034382)|fatty acid biosynthetic process (GO:0006633)|high-density lipoprotein particle remodeling (GO:0034375)|intermediate-density lipoprotein particle remodeling (GO:0034373)|low-density lipoprotein particle remodeling (GO:0034374)|phosphatidylcholine catabolic process (GO:0034638)|reverse cholesterol transport (GO:0043691)|triglyceride catabolic process (GO:0019433)|triglyceride homeostasis (GO:0070328)|very-low-density lipoprotein particle remodeling (GO:0034372)	extracellular space (GO:0005615)|high-density lipoprotein particle (GO:0034364)	apolipoprotein binding (GO:0034185)|heparin binding (GO:0008201)|low-density lipoprotein particle binding (GO:0030169)|phospholipase activity (GO:0004620)|triglyceride lipase activity (GO:0004806)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31		Colorectal(260;0.215)		GBM - Glioblastoma multiforme(80;0.00213)|all cancers(107;0.00548)		TCGTCTTTCTCCAGATGATGC	0.537																																																	0								ENSG00000166035						98.0	93.0	95.0					15																	58837997		2192	4292	6484	LIPC	SO:0001583	missense	0			-	HGNC		CCDS10166.1	15q21-q23	2012-10-02			ENSG00000166035	ENSG00000166035	3.1.1.3		6619	protein-coding gene	gene with protein product		151670					Standard	NM_000236		Approved	HL, HTGL	uc002afa.2	P11150	OTTHUMG00000132632	ENST00000356113.6:c.631C>T	15.37:g.58837997C>T	ENSP00000348425:p.Pro211Ser	Somatic	0	59	0.00		0.41568620468393047	6	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	39	29.09	A2RUB4|A8K9B6|O43571|P78529|Q99465	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Lipase_N,pfam_PLAT/LH2_dom,superfamily_Lipase_LipOase,smart_PLAT/LH2_dom,pirsf_Lipoprotein_lipase_LIPH,pfscan_PLAT/LH2_dom,prints_Lipase_hep,prints_Lipase,prints_Lipo_Lipase	p.P211S	ENST00000356113.6	37	c.631	CCDS10166.1	15	.	.	.	.	.	.	.	.	.	.	C	23.4	4.413784	0.83449	.	.	ENSG00000166035	ENST00000356113;ENST00000414170;ENST00000299022;ENST00000433326	D;D;D;D	0.91068	-2.78;-2.78;-2.78;-2.78	5.44	5.44	0.79542	Lipase, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.94528	0.8238	L	0.57130	1.785	0.80722	D	1	P;D	0.89917	0.798;1.0	P;D	0.97110	0.475;1.0	D	0.94499	0.7708	10	0.59425	D	0.04	.	19.2665	0.93988	0.0:1.0:0.0:0.0	.	150;211	E7EUK6;P11150	.;LIPC_HUMAN	S	211;211;211;150	ENSP00000348425:P211S;ENSP00000395569:P211S;ENSP00000299022:P211S;ENSP00000395002:P150S	ENSP00000299022:P211S	P	+	1	0	LIPC	56625289	1.000000	0.71417	1.000000	0.80357	0.442000	0.32017	6.066000	0.71185	2.548000	0.85928	0.563000	0.77884	CCA	-	pfam_Lipase_N,pirsf_Lipoprotein_lipase_LIPH		0.537	LIPC-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LIPC	protein_coding	OTTHUMT00000416209.1	C		-		58837997	+1	no_errors	ENST00000299022	ensembl	human	known	74_37	missense	SNP	1.000	T
MLLT10	8028	genome.wustl.edu	37	10	21827846	21827846	+	Intron	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr10:21827846G>A	ENST00000307729.7	+	3	418				MLLT10_ENST00000377072.3_Intron|MLLT10_ENST00000377059.3_Intron|MLLT10_ENST00000377091.2_Intron|MLLT10_ENST00000446906.2_Intron|MLLT10_ENST00000377100.3_Intron|MLLT10_ENST00000495130.1_Intron			P55197	AF10_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10						positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|large_intestine(2)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	6						AGAGTGGTAAGGACTATTTAT	0.403			T	"""MLL, PICALM, CDK6"""	AL																																			Dom	yes		10	10p12	8028	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10 (AF10)"""		L	0								ENSG00000078403						87.0	85.0	86.0					10																	21827846		2203	4300	6503	MLLT10	SO:0001627	intron_variant	0			-	HGNC	U13948	CCDS7135.1, CCDS55706.1, CCDS55707.1, CCDS55708.1	10p12	2013-01-28	2001-11-28		ENSG00000078403	ENSG00000078403		"""Zinc fingers, PHD-type"""	16063	protein-coding gene	gene with protein product		602409	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 10"""			7888665	Standard	NM_004641		Approved	AF10	uc021pny.1	P55197	OTTHUMG00000017799	ENST00000307729.7:c.240+5G>A	10.37:g.21827846G>A		Somatic	0	73	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	22	37.14	B1ANA8|Q5JT37|Q5VX90|Q66K63	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000307729.7	37	NULL	CCDS55708.1	10																																																																																			-	-		0.403	MLLT10-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MLLT10	protein_coding	OTTHUMT00000047136.1	G		-		21827846	+1	no_errors	ENST00000471315	ensembl	human	known	74_37	rna	SNP	1.000	A
SUPT5H	6829	genome.wustl.edu	37	19	39961030	39961030	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr19:39961030C>T	ENST00000599117.1	+	19	1911	c.1544C>T	c.(1543-1545)cCc>cTc	p.P515L	SUPT5H_ENST00000432763.2_Missense_Mutation_p.P515L|SUPT5H_ENST00000402194.2_Missense_Mutation_p.P511L|SUPT5H_ENST00000598725.1_Missense_Mutation_p.P515L|SUPT5H_ENST00000359191.6_Missense_Mutation_p.P511L			O00267	SPT5H_HUMAN	suppressor of Ty 5 homolog (S. cerevisiae)	515					7-methylguanosine mRNA capping (GO:0006370)|cell cycle (GO:0007049)|chromatin remodeling (GO:0006338)|DNA-templated transcription, elongation (GO:0006354)|gene expression (GO:0010467)|negative regulation of DNA-templated transcription, elongation (GO:0032785)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of macroautophagy (GO:0016239)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|response to organic substance (GO:0010033)|single stranded viral RNA replication via double stranded DNA intermediate (GO:0039692)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	DSIF complex (GO:0032044)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)			breast(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(13)|lung(12)|ovary(3)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	51	all_cancers(60;6.69e-07)|all_lung(34;2.66e-08)|Lung NSC(34;3e-08)|all_epithelial(25;1.57e-06)|Ovarian(47;0.159)		Epithelial(26;3.9e-26)|all cancers(26;1.35e-23)|LUSC - Lung squamous cell carcinoma(53;0.000657)			AAGGTGCTCCCCCGGGACCTG	0.647																																																	0								ENSG00000196235						81.0	80.0	80.0					19																	39961030		2203	4300	6503	SUPT5H	SO:0001583	missense	0			-	HGNC	U56402	CCDS12536.1, CCDS46072.1	19q13	2008-07-22	2001-11-28			ENSG00000196235			11469	protein-coding gene	gene with protein product		602102	"""suppressor of Ty (S.cerevisiae) 5 homolog"""			8975720	Standard	NM_003169		Approved	SPT5H, SPT5, FLJ34157	uc002olp.4	O00267		ENST00000599117.1:c.1544C>T	19.37:g.39961030C>T	ENSP00000470252:p.Pro515Leu	Somatic	0	44	0.00		0.41568620468393047	59	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	33	23.26	O43279|Q59G52|Q99639	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TF_Spt5_NGN-domain,pfam_KOW,pfam_Spt5_N,superfamily_Translation_prot_SH3-like,smart_Transcrpt_antiterm_NusG_N_dom,smart_KOW,pirsf_TF_Spt5	p.P515L	ENST00000599117.1	37	c.1544	CCDS12536.1	19	.	.	.	.	.	.	.	.	.	.	C	33	5.211557	0.95069	.	.	ENSG00000196235	ENST00000432763;ENST00000402194;ENST00000378524;ENST00000359191	.	.	.	5.89	5.89	0.94794	Translation protein SH3-like (1);	0.000000	0.85682	D	0.000000	D	0.83954	0.5366	M	0.86178	2.8	0.80722	D	1	D;D;D	0.69078	0.994;0.997;0.984	P;D;P	0.69824	0.904;0.966;0.885	D	0.84683	0.0718	8	.	.	.	-20.0724	19.0242	0.92926	0.0:1.0:0.0:0.0	.	307;511;515	B4DJK4;O00267-2;O00267	.;.;SPT5H_HUMAN	L	515;511;493;515	.	.	P	+	2	0	SUPT5H	44652870	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	5.939000	0.70179	2.788000	0.95919	0.557000	0.71058	CCC	-	superfamily_Translation_prot_SH3-like,pirsf_TF_Spt5		0.647	SUPT5H-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SUPT5H	protein_coding	OTTHUMT00000464918.1	C	NM_003169	-		39961030	+1	no_errors	ENST00000432763	ensembl	human	known	74_37	missense	SNP	1.000	T
SCAF1	58506	genome.wustl.edu	37	19	50155916	50155918	+	In_Frame_Del	DEL	CCT	CCT	-			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	CCT	CCT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr19:50155916_50155918delCCT	ENST00000360565.3	+	7	2394_2396	c.2270_2272delCCT	c.(2269-2274)gcctcc>gcc	p.S763del		NM_021228.2	NP_067051.2	Q9H7N4	SFR19_HUMAN	SR-related CTD-associated factor 1	763	Ser-rich.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(2)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	20		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.196)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00113)|GBM - Glioblastoma multiforme(134;0.0204)		TCGGGGGCCGCCTCCTCCTCCTC	0.69																																																	0								ENSG00000126461			77,3773		7,63,1855						2.4	0.3			7	232,7408		7,218,3595	no	coding	SCAF1	NM_021228.2		14,281,5450	A1A1,A1R,RR		3.0366,2.0,2.6893				309,11181				SCAF1	SO:0001651	inframe_deletion	0				HGNC	AK024444	CCDS33074.1	19q13.3-q13.4	2011-01-10			ENSG00000126461	ENSG00000126461			30403	protein-coding gene	gene with protein product						11461075	Standard	NM_021228		Approved	SR-A1, FLJ00034	uc002poq.3	Q9H7N4		ENST00000360565.3:c.2270_2272delCCT	19.37:g.50155925_50155927delCCT	ENSP00000353769:p.Ser763del	Somatic	0	67	0.00		0.41568620468393047	164	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	34	10.53	Q7Z5V7|Q8WVA1|Q9NR59	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	NULL	p.S761in_frame_del	ENST00000360565.3	37	c.2270_2272	CCDS33074.1	19																																																																																			-	NULL		0.690	SCAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCAF1	protein_coding	OTTHUMT00000465764.1	CCT	NM_021228			50155918	+1	no_errors	ENST00000360565	ensembl	human	known	74_37	in_frame_del	DEL	0.015:0.014:0.362	-
NCKAP1L	3071	genome.wustl.edu	37	12	54929946	54929946	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr12:54929946C>T	ENST00000293373.6	+	28	3069	c.2990C>T	c.(2989-2991)gCc>gTc	p.A997V	NCKAP1L_ENST00000545638.2_Missense_Mutation_p.A947V	NM_005337.4	NP_005328.2	P55160	NCKPL_HUMAN	NCK-associated protein 1-like	997					actin polymerization-dependent cell motility (GO:0070358)|B cell homeostasis (GO:0001782)|B cell receptor signaling pathway (GO:0050853)|chemotaxis (GO:0006935)|cortical actin cytoskeleton organization (GO:0030866)|erythrocyte development (GO:0048821)|maintenance of cell polarity (GO:0030011)|myeloid cell homeostasis (GO:0002262)|negative regulation of apoptotic process (GO:0043066)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of myosin-light-chain-phosphatase activity (GO:0035509)|neutrophil chemotaxis (GO:0030593)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043372)|positive regulation of CD8-positive, alpha-beta T cell differentiation (GO:0043378)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of gamma-delta T cell differentiation (GO:0045588)|positive regulation of lymphocyte differentiation (GO:0045621)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of phagocytosis, engulfment (GO:0060100)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of T cell proliferation (GO:0042102)|protein complex assembly (GO:0006461)|response to drug (GO:0042493)|T cell homeostasis (GO:0043029)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|SCAR complex (GO:0031209)	protein complex binding (GO:0032403)|protein kinase activator activity (GO:0030295)|Rac GTPase activator activity (GO:0030675)			NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(37)|ovary(3)|prostate(3)|skin(3)|stomach(2)	80						TATAAGGTGGCCTGCCTGCTC	0.443																																																	0								ENSG00000123338						182.0	150.0	161.0					12																	54929946		2203	4300	6503	NCKAP1L	SO:0001583	missense	0			-	HGNC	AI924363	CCDS31813.1, CCDS53799.1	12q13.1	2005-10-11	2005-10-11	2005-10-11		ENSG00000123338			4862	protein-coding gene	gene with protein product		141180	"""hematopoietic protein 1"""	HEM1		1932118	Standard	NM_005337		Approved		uc001sgc.4	P55160	OTTHUMG00000169843	ENST00000293373.6:c.2990C>T	12.37:g.54929946C>T	ENSP00000293373:p.Ala997Val	Somatic	0	61	0.00		0.41568620468393047	86	2.27	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	22	29.03	B4DUT5|Q52LW0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Nck-associated_protein-1,superfamily_Nucl_hormone_rcpt_ligand-bd	p.A997V	ENST00000293373.6	37	c.2990	CCDS31813.1	12	.	.	.	.	.	.	.	.	.	.	C	15.70	2.912441	0.52439	.	.	ENSG00000123338	ENST00000293373;ENST00000545638	T;T	0.31247	1.5;1.5	4.31	4.31	0.51392	.	0.129745	0.51477	D	0.000098	T	0.38188	0.1031	L	0.39245	1.2	0.43054	D	0.994662	D	0.65815	0.995	D	0.64595	0.927	T	0.10154	-1.0642	10	0.02654	T	1	-14.6766	14.6721	0.68951	0.0:1.0:0.0:0.0	.	997	P55160	NCKPL_HUMAN	V	997;947	ENSP00000293373:A997V;ENSP00000445596:A947V	ENSP00000293373:A997V	A	+	2	0	NCKAP1L	53216213	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.201000	0.65163	2.407000	0.81776	0.655000	0.94253	GCC	-	pfam_Nck-associated_protein-1		0.443	NCKAP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCKAP1L	protein_coding	OTTHUMT00000406195.1	C	NM_005337	-		54929946	+1	no_errors	ENST00000293373	ensembl	human	known	74_37	missense	SNP	1.000	T
RP11-24M17.5	0	genome.wustl.edu	37	15	76071746	76071746	+	RNA	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr15:76071746G>A	ENST00000395215.3	+	0	258																											TCGGTACCAAGAACTGGAATT	0.507																																																	0								ENSG00000187812																																			RP11-24M17.5			0			-	Clone_based_vega_gene																													15.37:g.76071746G>A		Somatic	0	174	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	84	17.65		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000395215.3	37	NULL		15	.	.	.	.	.	.	.	.	.	.	.	8.484	0.860384	0.17178	.	.	ENSG00000187812	ENST00000395215	.	.	.	0.756	0.756	0.18421	.	.	.	.	.	T	0.49440	0.1557	.	.	.	.	.	.	P	0.48230	0.907	P	0.52109	0.69	T	0.56733	-0.7930	6	0.66056	D	0.02	.	4.8311	0.13441	0.0:0.0:1.0:0.0	.	73	B4DZE6	.	K	73	.	ENSP00000378641:E73K	E	+	1	0	AC019294.2	73858801	1.000000	0.71417	0.956000	0.39512	0.202000	0.24057	6.339000	0.72969	0.706000	0.31912	0.162000	0.16502	GAA	-	-		0.507	RP11-24M17.5-001	KNOWN	basic	processed_transcript	ENSG00000187812	pseudogene	OTTHUMT00000420501.1	G		-		76071746	+1	no_errors	ENST00000395215	ensembl	human	known	74_37	rna	SNP	1.000	A
C20orf196	149840	genome.wustl.edu	37	20	5843685	5843686	+	Frame_Shift_Del	DEL	AT	AT	-			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	AT	AT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr20:5843685_5843686delAT	ENST00000303142.6	+	3	281_282	c.194_195delAT	c.(193-195)aatfs	p.N65fs		NM_152504.2	NP_689717.2	Q8IYI0	CT196_HUMAN	chromosome 20 open reading frame 196	65										endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|stomach(1)	9						AGTAACTTAAATATAGAACAAA	0.421																																																	0								ENSG00000171984																																			C20orf196	SO:0001589	frameshift_variant	0				HGNC	AK057796	CCDS13091.1	20p12.3	2006-07-07			ENSG00000171984	ENSG00000171984			26318	protein-coding gene	gene with protein product						12477932	Standard	NM_152504		Approved	FLJ25067	uc002wmf.3	Q8IYI0	OTTHUMG00000031813	ENST00000303142.6:c.194_195delAT	20.37:g.5843687_5843688delAT	ENSP00000305875:p.Asn65fs	Somatic	0	28	0.00		0.41568620468393047	9	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	26	21.21	A8K9J3|Q5TGA9|Q96LU1	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	NULL	p.I66fs	ENST00000303142.6	37	c.194_195	CCDS13091.1	20																																																																																			-	NULL		0.421	C20orf196-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C20orf196	protein_coding	OTTHUMT00000077882.2	AT	NM_152504			5843686	+1	no_errors	ENST00000303142	ensembl	human	known	74_37	frame_shift_del	DEL	0.004:0.003	-
AFF3	3899	genome.wustl.edu	37	2	100209981	100209981	+	Silent	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr2:100209981G>A	ENST00000409236.2	-	13	2254	c.2142C>T	c.(2140-2142)aaC>aaT	p.N714N	AFF3_ENST00000409579.1_Silent_p.N739N|AFF3_ENST00000317233.4_Silent_p.N714N|AFF3_ENST00000356421.2_Silent_p.N739N			P51826	AFF3_HUMAN	AF4/FMR2 family, member 3	714					embryonic hindlimb morphogenesis (GO:0035116)|regulation of transcription, DNA-templated (GO:0006355)|response to tumor necrosis factor (GO:0034612)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)			NS(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(9)|kidney(4)|large_intestine(20)|liver(1)|lung(28)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(3)	86						CACTGCCCCCGTTGGCAGCGG	0.627																																																	0								ENSG00000144218						55.0	60.0	58.0					2																	100209981		2203	4299	6502	AFF3	SO:0001819	synonymous_variant	0			-	HGNC	U34360	CCDS33258.1, CCDS42723.1	2q11.2-q12	2008-02-05	2005-06-27	2005-06-27	ENSG00000144218	ENSG00000144218			6473	protein-coding gene	gene with protein product		601464	"""lymphoid nuclear protein related to AF4"""	LAF4		8662235, 8555498	Standard	XM_005263945		Approved	MLLT2-like	uc002taf.3	P51826	OTTHUMG00000153011	ENST00000409236.2:c.2142C>T	2.37:g.100209981G>A		Somatic	0	52	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	19	29.63	B7ZM46|B9EGL9|D3DVI6|Q53RD6|Q53S47|Q53SI6|Q53TB9|Q59F27|Q8IWJ5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_TF_AF4/FMR2	p.N739	ENST00000409236.2	37	c.2217	CCDS42723.1	2																																																																																			-	pfam_TF_AF4/FMR2		0.627	AFF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AFF3	protein_coding	OTTHUMT00000328982.3	G	NM_002285	-		100209981	-1	no_errors	ENST00000356421	ensembl	human	known	74_37	silent	SNP	0.002	A
RAB11FIP1	80223	genome.wustl.edu	37	8	37730425	37730425	+	Missense_Mutation	SNP	G	G	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr8:37730425G>T	ENST00000330843.4	-	4	1907	c.1895C>A	c.(1894-1896)cCt>cAt	p.P632H	RAB11FIP1_ENST00000522727.1_Intron|RAB11FIP1_ENST00000523182.1_5'UTR|RAB11FIP1_ENST00000287263.4_Intron|RAB11FIP1_ENST00000524118.1_Intron	NM_001002814.2	NP_001002814.2	Q6WKZ4	RFIP1_HUMAN	RAB11 family interacting protein 1 (class I)	632					protein transport (GO:0015031)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)				NS(1)|breast(1)|central_nervous_system(4)|endometrium(3)|large_intestine(6)|lung(20)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	49		Lung NSC(58;0.118)|all_lung(54;0.195)	LUSC - Lung squamous cell carcinoma(8;3.62e-11)			CTCTGCCTTAGGGAGCAAGGG	0.498																																																	0								ENSG00000156675						112.0	105.0	107.0					8																	37730425		2203	4300	6503	RAB11FIP1	SO:0001583	missense	0			-	HGNC	AK092296	CCDS34881.1, CCDS34882.1	8p11.22	2005-10-04			ENSG00000156675	ENSG00000156675			30265	protein-coding gene	gene with protein product		608737				11786538, 11495908	Standard	NM_001002814		Approved	RCP, FLJ22622, FLJ22524, Rab11-FIP1	uc003xkm.2	Q6WKZ4	OTTHUMG00000164026	ENST00000330843.4:c.1895C>A	8.37:g.37730425G>T	ENSP00000331342:p.Pro632His	Somatic	0	46	0.00		0.41568620468393047	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	39	9.30	J3KNP0|Q307T1|Q6AZK4|Q6WKZ2|Q6WKZ6|Q86YV4|Q8TDL1|Q9H642	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Rab-bd_FIP-RBD,pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	p.P632H	ENST00000330843.4	37	c.1895	CCDS34882.1	8	.	.	.	.	.	.	.	.	.	.	G	13.81	2.347401	0.41599	.	.	ENSG00000156675	ENST00000330843	T	0.11712	2.75	5.49	1.81	0.25067	.	0.532845	0.17216	N	0.182508	T	0.05364	0.0142	N	0.14661	0.345	0.25769	N	0.98486	B	0.06786	0.001	B	0.04013	0.001	T	0.33904	-0.9850	10	0.45353	T	0.12	-4.8755	3.4883	0.07627	0.5704:0.0:0.2688:0.1608	.	632	Q6WKZ4	RFIP1_HUMAN	H	632	ENSP00000331342:P632H	ENSP00000331342:P632H	P	-	2	0	RAB11FIP1	37849583	0.012000	0.17670	0.003000	0.11579	0.008000	0.06430	0.370000	0.20433	0.064000	0.16427	-0.302000	0.09304	CCT	-	NULL		0.498	RAB11FIP1-002	KNOWN	basic|CCDS	protein_coding	RAB11FIP1	protein_coding	OTTHUMT00000376816.1	G	NM_025151	-		37730425	-1	no_errors	ENST00000330843	ensembl	human	known	74_37	missense	SNP	0.009	T
PSG3	5671	genome.wustl.edu	37	19	43226144	43226144	+	3'UTR	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr19:43226144G>A	ENST00000327495.5	-	0	1610				PSG3_ENST00000595140.1_Missense_Mutation_p.L448F	NM_021016.3	NP_066296.2	Q16557	PSG3_HUMAN	pregnancy specific beta-1-glycoprotein 3						defense response (GO:0006952)|female pregnancy (GO:0007565)	extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	36		Prostate(69;0.00682)				ttgtattcaagagtccttgtc	0.343																																																	0								ENSG00000221826																																			PSG3	SO:0001624	3_prime_UTR_variant	0			-	HGNC		CCDS12611.1	19q13.2	2013-01-29			ENSG00000221826	ENSG00000221826		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9520	protein-coding gene	gene with protein product		176392				2341148	Standard	NM_021016		Approved		uc002oue.3	Q16557	OTTHUMG00000151120	ENST00000327495.5:c.*139C>T	19.37:g.43226144G>A		Somatic	0	129	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	76	20.83	Q08265|Q9BRW2|Q9UPL4|Q9UQ77	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.L448F	ENST00000327495.5	37	c.1342	CCDS12611.1	19																																																																																			-	NULL		0.343	PSG3-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	PSG3	protein_coding	OTTHUMT00000321423.2	G	NM_021016	-		43226144	-1	no_errors	ENST00000595140	ensembl	human	putative	74_37	missense	SNP	0.185	A
GPR98	84059	genome.wustl.edu	37	5	89988518	89988518	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr5:89988518G>A	ENST00000405460.2	+	32	7144	c.7048G>A	c.(7048-7050)Ggt>Agt	p.G2350S		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	2350					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		TGATCCTTATGGTACAGTAGC	0.408																																																	0								ENSG00000164199						96.0	91.0	93.0					5																	89988518		1868	4099	5967	GPR98	SO:0001583	missense	0			-	HGNC	AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.7048G>A	5.37:g.89988518G>A	ENSP00000384582:p.Gly2350Ser	Somatic	0	67	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	37	13.95	O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Calx_beta,pfam_EPTP,pfam_GPCR_2_secretin-like,pfam_GPS_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Gal_Oxase/kelch_b-propeller,smart_Calx_beta,pfscan_EAR,pfscan_GPS_dom,pfscan_GPCR_2-like	p.G2350S	ENST00000405460.2	37	c.7048	CCDS47246.1	5	.	.	.	.	.	.	.	.	.	.	G	35	5.580593	0.96565	.	.	ENSG00000164199	ENST00000405460;ENST00000296619	T	0.47869	0.83	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	T	0.77519	0.4142	M	0.91140	3.18	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.81335	-0.0979	10	0.87932	D	0	.	20.3931	0.98965	0.0:0.0:1.0:0.0	.	2350	Q8WXG9	GPR98_HUMAN	S	2350	ENSP00000384582:G2350S	ENSP00000296619:G2350S	G	+	1	0	GPR98	90024274	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	9.587000	0.98229	2.824000	0.97209	0.655000	0.94253	GGT	-	NULL		0.408	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR98	protein_coding	OTTHUMT00000369993.2	G	NM_032119	-		89988518	+1	no_errors	ENST00000405460	ensembl	human	known	74_37	missense	SNP	1.000	A
HRCT1	646962	genome.wustl.edu	37	9	35906348	35906350	+	In_Frame_Del	DEL	CTG	CTG	-	rs370606246		TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	CTG	CTG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr9:35906348_35906350delCTG	ENST00000354323.2	+	1	160_162	c.64_66delCTG	c.(64-66)ctgdel	p.L28del		NM_001039792.1	NP_001034881.1	Q6UXD1	HRCT1_HUMAN	histidine rich carboxyl terminus 1	28						integral component of membrane (GO:0016021)				NS(1)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|prostate(1)	4						TGTGGCGGTCctgctgctgctgc	0.67																																																	0								ENSG00000196196			367,3839		38,291,1774						-8.3	0.0			23	737,7385		88,561,3412	no	coding	HRCT1	NM_001039792.1		126,852,5186	A1A1,A1R,RR		9.0741,8.7256,8.9552				1104,11224				HRCT1	SO:0001651	inframe_deletion	0				HGNC		CCDS35012.1	9p13.3	2008-09-30			ENSG00000196196	ENSG00000196196			33872	protein-coding gene	gene with protein product						12975309	Standard	NM_001039792		Approved	LGLL338, PRO537, UNQ338	uc003zyr.1	Q6UXD1	OTTHUMG00000154146	ENST00000354323.2:c.64_66delCTG	9.37:g.35906357_35906359delCTG	ENSP00000346283:p.Leu28del	Somatic	0	40	0.00		0.41568620468393047	58	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	24	14.29	B7ZBJ1	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	NULL	p.L25in_frame_del	ENST00000354323.2	37	c.64_66	CCDS35012.1	9																																																																																			-	NULL		0.670	HRCT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HRCT1	protein_coding	OTTHUMT00000334099.1	CTG	NM_001039792			35906350	+1	no_errors	ENST00000354323	ensembl	human	known	74_37	in_frame_del	DEL	0.168:0.493:0.516	-
FLG	2312	genome.wustl.edu	37	1	152287822	152287822	+	Silent	SNP	C	C	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr1:152287822C>A	ENST00000368799.1	-	2	146	c.111G>T	c.(109-111)ctG>ctT	p.L37L	FLG-AS1_ENST00000392688.2_RNA|FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	37	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			ATTCCTTTTCCAGAAGTTCCT	0.333									Ichthyosis																																								0								ENSG00000143631						172.0	176.0	174.0					1																	152287822		2203	4300	6503	FLG	SO:0001819	synonymous_variant	0	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	-	HGNC	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.111G>T	1.37:g.152287822C>A		Somatic	0	49	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	34	10.26	Q01720|Q5T583|Q9UC71	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Filaggrin,pfam_S100_Ca-bd_sub,pfscan_EF_hand_dom,prints_Filaggrin	p.L37	ENST00000368799.1	37	c.111	CCDS30860.1	1																																																																																			-	pfam_S100_Ca-bd_sub		0.333	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG	protein_coding	OTTHUMT00000033742.1	C	NM_002016	-		152287822	-1	no_errors	ENST00000368799	ensembl	human	known	74_37	silent	SNP	1.000	A
GUCA1C	9626	genome.wustl.edu	37	3	108634968	108634968	+	Intron	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr3:108634968C>T	ENST00000261047.3	-	3	575				GUCA1C_ENST00000471108.1_Missense_Mutation_p.G150R|GUCA1C_ENST00000393963.3_Missense_Mutation_p.G150R	NM_005459.3	NP_005450.3	O95843	GUC1C_HUMAN	guanylate cyclase activator 1C						phototransduction, visible light (GO:0007603)|positive regulation of guanylate cyclase activity (GO:0031284)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|signal transduction (GO:0007165)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)	calcium ion binding (GO:0005509)|calcium sensitive guanylate cyclase activator activity (GO:0008048)			endometrium(2)|large_intestine(1)|liver(1)|lung(8)|pancreas(1)|skin(1)	14						AGAGTAGCTCCATTACCATCA	0.433																																					NSCLC(157;1360 1999 30631 40189 44208)												0								ENSG00000138472						160.0	152.0	155.0					3																	108634968		2203	4300	6503	GUCA1C	SO:0001627	intron_variant	0			-	HGNC	AF110002	CCDS2954.1	3q13.1	2013-01-10			ENSG00000138472	ENSG00000138472		"""EF-hand domain containing"""	4680	protein-coding gene	gene with protein product	"""guanylyl cyclase-activating protein 3"""	605128				10037746, 11860507	Standard	NM_005459		Approved	GCAP3	uc003dxj.2	O95843	OTTHUMG00000159204	ENST00000261047.3:c.442+5G>A	3.37:g.108634968C>T		Somatic	0	83	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	60	23.08	O95844|Q9UNM0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_EF_hand_dom,smart_EF_hand_dom,pfscan_EF_hand_dom,prints_Recoverin	p.G150R	ENST00000261047.3	37	c.448	CCDS2954.1	3	.	.	.	.	.	.	.	.	.	.	c	13.44	2.237667	0.39598	.	.	ENSG00000138472	ENST00000393963;ENST00000471108	T;T	0.67698	-0.28;-0.22	3.41	1.53	0.23141	.	.	.	.	.	T	0.49150	0.1540	.	.	.	0.22199	N	0.9993	P	0.40476	0.718	B	0.32864	0.154	T	0.42899	-0.9424	8	0.87932	D	0	.	4.3566	0.11181	0.2214:0.6526:0.0:0.1261	.	150	C9JNI2	.	R	150	ENSP00000377535:G150R;ENSP00000417761:G150R	ENSP00000377535:G150R	G	-	1	0	GUCA1C	110117658	0.000000	0.05858	0.007000	0.13788	0.870000	0.49936	-0.060000	0.11712	0.090000	0.17273	0.651000	0.88453	GGA	-	NULL		0.433	GUCA1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GUCA1C	protein_coding	OTTHUMT00000353819.1	C	NM_005459	-		108634968	-1	no_errors	ENST00000393963	ensembl	human	known	74_37	missense	SNP	0.996	T
PTCHD2	57540	genome.wustl.edu	37	1	11590009	11590009	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr1:11590009G>A	ENST00000294484.6	+	15	3233	c.3095G>A	c.(3094-3096)gGa>gAa	p.G1032E	PTCHD2_ENST00000389575.3_Missense_Mutation_p.G1032E	NM_020780.1	NP_065831.1	Q9P2K9	PTHD2_HUMAN	patched domain containing 2	1032					cholesterol homeostasis (GO:0042632)|regulation of lipid transport (GO:0032368)|smoothened signaling pathway (GO:0007224)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)	hedgehog receptor activity (GO:0008158)			NS(3)|breast(2)|endometrium(9)|kidney(4)|large_intestine(5)|lung(34)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	76	Ovarian(185;0.249)	Lung NSC(185;4.16e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.13e-07)|COAD - Colon adenocarcinoma(227;4.83e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000325)|Kidney(185;0.000877)|KIRC - Kidney renal clear cell carcinoma(229;0.00273)|STAD - Stomach adenocarcinoma(313;0.00766)|READ - Rectum adenocarcinoma(331;0.0549)		CACGTCATTGGAGACCCGGTA	0.617																																																	0								ENSG00000204624						65.0	76.0	73.0					1																	11590009		2000	4175	6175	PTCHD2	SO:0001583	missense	0			-	HGNC	AB037758	CCDS41247.1	1p36.22	2010-02-17			ENSG00000204624	ENSG00000204624			29251	protein-coding gene	gene with protein product		611251				15738394	Standard	NM_020780		Approved	KIAA1337, DISP3	uc001ash.4	Q9P2K9	OTTHUMG00000002074	ENST00000294484.6:c.3095G>A	1.37:g.11590009G>A	ENSP00000294484:p.Gly1032Glu	Somatic	0	34	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	27	15.62	Q5VTU9|Q9UJD6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Patched,pfam_MMPL_dom,pfscan_SSD	p.G1032E	ENST00000294484.6	37	c.3095	CCDS41247.1	1	.	.	.	.	.	.	.	.	.	.	G	17.95	3.514361	0.64522	.	.	ENSG00000204624	ENST00000294484;ENST00000389575	D;D	0.90261	-2.64;-2.61	5.35	5.35	0.76521	.	0.065095	0.64402	D	0.000011	D	0.83211	0.5205	N	0.14661	0.345	0.58432	D	0.999992	B	0.13145	0.007	B	0.17098	0.017	T	0.77945	-0.2397	10	0.30854	T	0.27	-2.8172	16.2325	0.82356	0.0:0.0:1.0:0.0	.	1032	Q9P2K9	PTHD2_HUMAN	E	1032	ENSP00000294484:G1032E;ENSP00000374226:G1032E	ENSP00000294484:G1032E	G	+	2	0	PTCHD2	11512596	1.000000	0.71417	0.823000	0.32752	0.856000	0.48823	7.016000	0.76393	2.518000	0.84900	0.561000	0.74099	GGA	-	NULL		0.617	PTCHD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PTCHD2	protein_coding	OTTHUMT00000005770.2	G	XM_052561	-		11590009	+1	no_errors	ENST00000294484	ensembl	human	known	74_37	missense	SNP	1.000	A
MSH3	4437	genome.wustl.edu	37	5	80064660	80064660	+	Silent	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr5:80064660G>A	ENST00000265081.6	+	15	2171	c.2091G>A	c.(2089-2091)ggG>ggA	p.G697G		NM_002439.4	NP_002430.3	P20585	MSH3_HUMAN	mutS homolog 3	697					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|maintenance of DNA repeat elements (GO:0043570)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|positive regulation of helicase activity (GO:0051096)|reciprocal meiotic recombination (GO:0007131)|somatic recombination of immunoglobulin gene segments (GO:0016447)	membrane (GO:0016020)|MutSbeta complex (GO:0032302)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)	ATP binding (GO:0005524)|centromeric DNA binding (GO:0019237)|damaged DNA binding (GO:0003684)|DNA-dependent ATPase activity (GO:0008094)|double-strand/single-strand DNA junction binding (GO:0000406)|enzyme binding (GO:0019899)|heteroduplex DNA loop binding (GO:0000404)|Y-form DNA binding (GO:0000403)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(12)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	29		Lung NSC(167;0.00479)|all_lung(232;0.00507)|Ovarian(174;0.0261)|Breast(144;0.244)		OV - Ovarian serous cystadenocarcinoma(54;2.38e-45)|Epithelial(54;1.58e-38)|all cancers(79;4.93e-33)		TTAGAGTTGGGGATAAAACTG	0.313								Mismatch excision repair (MMR)																													Melanoma(88;1010 1399 13793 26548 36275)												0								ENSG00000113318						70.0	81.0	77.0					5																	80064660		2197	4289	6486	MSH3	SO:0001819	synonymous_variant	0			-	HGNC	U61981	CCDS34195.1	5q11-q12	2013-09-12	2013-09-12		ENSG00000113318	ENSG00000113318			7326	protein-coding gene	gene with protein product	"""Divergent upstream protein"", ""Mismatch repair protein 1"""	600887	"""mutS (E. coli) homolog 3"", ""mutS homolog 3 (E. coli)"""				Standard	NM_002439		Approved	DUP, MRP1	uc003kgz.4	P20585	OTTHUMG00000162540	ENST00000265081.6:c.2091G>A	5.37:g.80064660G>A		Somatic	0	90	0.00		0.41568620468393047	8	38.46	5	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	54	23.94	A1L480|A1L482|A6NMM6|Q6PJT5|Q86UQ6|Q92867	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_DNA_mismatch_repair_MutS_C,pfam_DNA_mismatch_repair_MutS_core,pfam_DNA_mmatch_repair_MutS_con_dom,pfam_DNA_mismatch_repair_MutS-lik_N,pfam_DNA_mismatch_repair_MutS_clamp,superfamily_DNA_mismatch_repair_MutS_core,superfamily_P-loop_NTPase,superfamily_DNA_mismatch_repair_MutS_N,superfamily_DNA_mmatch_repair_MutS_con_dom,smart_DNA_mismatch_repair_MutS_core,smart_DNA_mismatch_repair_MutS_C	p.G697	ENST00000265081.6	37	c.2091	CCDS34195.1	5																																																																																			-	pfam_DNA_mismatch_repair_MutS_core,superfamily_DNA_mismatch_repair_MutS_core,smart_DNA_mismatch_repair_MutS_core		0.313	MSH3-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	MSH3	protein_coding	OTTHUMT00000369471.1	G	NM_002439	-		80064660	+1	no_errors	ENST00000265081	ensembl	human	known	74_37	silent	SNP	0.992	A
FRAS1	80144	genome.wustl.edu	37	4	79366786	79366786	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr4:79366786C>T	ENST00000325942.6	+	42	6216	c.5776C>T	c.(5776-5778)Cca>Tca	p.P1926S	FRAS1_ENST00000264895.6_Missense_Mutation_p.P1926S	NM_001166133.1	NP_001159605.1	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1	1926					cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						AAGCATTGAGCCAACCCATGA	0.403																																																	0								ENSG00000138759						219.0	216.0	217.0					4																	79366786		1893	4118	6011	FRAS1	SO:0001583	missense	0			-	HGNC	AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000325942.6:c.5776C>T	4.37:g.79366786C>T	ENSP00000326330:p.Pro1926Ser	Somatic	0	69	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	44	21.43	A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Calx_beta,pfam_VWF_C,superfamily_Growth_fac_rcpt_N_dom,superfamily_Cadherin-like,smart_VWC_out,smart_VWF_C,smart_Furin_repeat,smart_EG-like_dom,smart_Calx_beta,pfscan_VWF_C	p.P1926S	ENST00000325942.6	37	c.5776	CCDS54772.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	26.5|26.5	4.746216|4.746216	0.89663|0.89663	.|.	.|.	ENSG00000138759|ENSG00000138759	ENST00000510944;ENST00000512123|ENST00000325942;ENST00000264895	.|T;T	.|0.52754	.|0.65;0.65	5.96|5.96	5.96|5.96	0.96718|0.96718	.|.	.|0.177571	.|0.51477	.|D	.|0.000095	T|T	0.63510|0.63510	0.2517|0.2517	M|M	0.63428|0.63428	1.95|1.95	0.80722|0.80722	D|D	1|1	.|D;D	.|0.58620	.|0.983;0.981	.|P;P	.|0.55615	.|0.78;0.715	T|T	0.63198|0.63198	-0.6691|-0.6691	5|10	.|0.62326	.|D	.|0.03	.|.	20.394|20.394	0.98981|0.98981	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|1926;1926	.|E9PHH6;A2RRR8	.|.;.	V|S	375;154|1926	.|ENSP00000326330:P1926S;ENSP00000264895:P1926S	.|ENSP00000264895:P1926S	A|P	+|+	2|1	0|0	FRAS1|FRAS1	79585810|79585810	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	3.741000|3.741000	0.55090|0.55090	2.830000|2.830000	0.97506|0.97506	0.585000|0.585000	0.79938|0.79938	GCC|CCA	-	NULL		0.403	FRAS1-001	NOVEL	basic|CCDS	protein_coding	FRAS1	protein_coding	OTTHUMT00000362706.2	C		-		79366786	+1	no_errors	ENST00000264895	ensembl	human	known	74_37	missense	SNP	1.000	T
AP000525.9	0	genome.wustl.edu	37	22	16158873	16158873	+	RNA	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr22:16158873G>A	ENST00000447898.1	-	0	293																											GAATGACCAGGATCTGGGCCC	0.522																																																	0								ENSG00000206195																																			AP000525.9			0			-	Clone_based_vega_gene																													22.37:g.16158873G>A		Somatic	0	46	0.00		0.41568620468393047	3	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	31	16.22		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000447898.1	37	NULL		22																																																																																			-	-		0.522	AP000525.9-002	KNOWN	basic	lincRNA	ENSG00000206195	processed_transcript	OTTHUMT00000276780.1	G		-		16158873	-1	no_errors	ENST00000383038	ensembl	human	known	74_37	rna	SNP	0.008	A
MLLT10	8028	genome.wustl.edu	37	10	21827847	21827847	+	Intron	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr10:21827847G>A	ENST00000307729.7	+	3	418				MLLT10_ENST00000377072.3_Intron|MLLT10_ENST00000377059.3_Intron|MLLT10_ENST00000377091.2_Intron|MLLT10_ENST00000446906.2_Intron|MLLT10_ENST00000377100.3_Intron|MLLT10_ENST00000495130.1_Intron			P55197	AF10_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10						positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|large_intestine(2)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	6						GAGTGGTAAGGACTATTTATC	0.403			T	"""MLL, PICALM, CDK6"""	AL																																			Dom	yes		10	10p12	8028	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10 (AF10)"""		L	0								ENSG00000078403						86.0	84.0	85.0					10																	21827847		2203	4300	6503	MLLT10	SO:0001627	intron_variant	0			-	HGNC	U13948	CCDS7135.1, CCDS55706.1, CCDS55707.1, CCDS55708.1	10p12	2013-01-28	2001-11-28		ENSG00000078403	ENSG00000078403		"""Zinc fingers, PHD-type"""	16063	protein-coding gene	gene with protein product		602409	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 10"""			7888665	Standard	NM_004641		Approved	AF10	uc021pny.1	P55197	OTTHUMG00000017799	ENST00000307729.7:c.240+6G>A	10.37:g.21827847G>A		Somatic	0	72	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	22	37.14	B1ANA8|Q5JT37|Q5VX90|Q66K63	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000307729.7	37	NULL	CCDS55708.1	10																																																																																			-	-		0.403	MLLT10-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MLLT10	protein_coding	OTTHUMT00000047136.1	G		-		21827847	+1	no_errors	ENST00000471315	ensembl	human	known	74_37	rna	SNP	0.955	A
CALCB	797	genome.wustl.edu	37	11	15096298	15096298	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr11:15096298C>T	ENST00000533448.1	+	2	145	c.34C>T	c.(34-36)Ctc>Ttc	p.L12F	CALCB_ENST00000523376.1_Missense_Mutation_p.L23F|CALCB_ENST00000324229.6_Missense_Mutation_p.L12F			P10092	CALCB_HUMAN	calcitonin-related polypeptide beta	12					cellular calcium ion homeostasis (GO:0006874)|signal transduction (GO:0007165)	extracellular region (GO:0005576)	neuropeptide hormone activity (GO:0005184)			endometrium(1)|large_intestine(1)|lung(1)|skin(2)	5						CTTCCTGGCTCTCAGTATCTT	0.602											OREG0020793	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000175868						92.0	87.0	88.0					11																	15096298		2200	4294	6494	CALCB	SO:0001583	missense	0			-	HGNC		CCDS7820.1	11p14.2-p12	2013-02-25	2008-02-20			ENSG00000175868		"""Endogenous ligands"""	1438	protein-coding gene	gene with protein product		114160	"""calcitonin 2"""	CALC2			Standard	NM_000728		Approved	FLJ30166, CGRP-II	uc001mlx.1	P10092		ENST00000533448.1:c.34C>T	11.37:g.15096298C>T	ENSP00000433490:p.Leu12Phe	Somatic	0	58	0.00	700	0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	37	15.91	A8K573|D3DQX4|Q569I0|Q9UCN9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Procalcitonin/adrenomedullin,smart_Calcitonin_peptide-like,prints_Calcitonin_gene-rel_peptide,prints_Pro-islet_amyloid_polypep	p.L12F	ENST00000533448.1	37	c.34	CCDS7820.1	11	.	.	.	.	.	.	.	.	.	.	C	10.98	1.505903	0.26949	.	.	ENSG00000175868	ENST00000523376;ENST00000324229;ENST00000533448	T;T;T	0.23348	1.91;1.91;1.91	5.39	-7.25	0.01470	.	0.801389	0.10911	N	0.620549	T	0.16811	0.0404	L	0.46157	1.445	0.22968	N	0.998492	B	0.11235	0.004	B	0.14578	0.011	T	0.27606	-1.0069	10	0.33940	T	0.23	-7.0976	7.9852	0.30207	0.0:0.3216:0.3404:0.338	.	12	P10092	CALCB_HUMAN	F	23;12;12	ENSP00000428882:L23F;ENSP00000346017:L12F;ENSP00000433490:L12F	ENSP00000346017:L12F	L	+	1	0	CALCB	15052874	0.994000	0.37717	0.869000	0.34112	0.147000	0.21601	0.113000	0.15499	-0.940000	0.03705	-0.136000	0.14681	CTC	-	pfam_Procalcitonin/adrenomedullin		0.602	CALCB-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	CALCB	protein_coding	OTTHUMT00000387433.1	C	NM_000728	-		15096298	+1	no_errors	ENST00000324229	ensembl	human	known	74_37	missense	SNP	0.972	T
LTV1	84946	genome.wustl.edu	37	6	144178505	144178505	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr6:144178505C>T	ENST00000367576.5	+	5	597	c.463C>T	c.(463-465)Cca>Tca	p.P155S		NM_032860.3	NP_116249.2	Q96GA3	LTV1_HUMAN	LTV1 ribosome biogenesis factor	155	Asp-rich.					cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(2)|endometrium(1)|large_intestine(2)|lung(5)|ovary(2)|prostate(1)	13				OV - Ovarian serous cystadenocarcinoma(155;2.72e-06)|GBM - Glioblastoma multiforme(68;0.0372)		CTTTGATGATCCAGATAATCT	0.393																																																	0								ENSG00000135521						309.0	300.0	303.0					6																	144178505		2203	4300	6503	LTV1	SO:0001583	missense	0			-	HGNC	BC009855	CCDS5201.1	6q24.2	2014-02-03	2014-02-03	2006-02-06	ENSG00000135521	ENSG00000135521			21173	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 93"", ""LTV1 homolog (S. cerevisiae)"""	C6orf93			Standard	NM_032860		Approved	FLJ14909, dJ468K18.4	uc003qjs.3	Q96GA3	OTTHUMG00000015733	ENST00000367576.5:c.463C>T	6.37:g.144178505C>T	ENSP00000356548:p.Pro155Ser	Somatic	0	59	0.00		0.41568620468393047	11	15.38	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	29	14.71	Q96JX8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_LTV	p.P155S	ENST00000367576.5	37	c.463	CCDS5201.1	6	.	.	.	.	.	.	.	.	.	.	C	28.5	4.929459	0.92389	.	.	ENSG00000135521	ENST00000367576	.	.	.	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	T	0.75421	0.3847	M	0.78223	2.4	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.72821	-0.4177	9	0.33141	T	0.24	.	19.07	0.93130	0.0:1.0:0.0:0.0	.	155	Q96GA3	LTV1_HUMAN	S	155	.	ENSP00000356548:P155S	P	+	1	0	LTV1	144220198	1.000000	0.71417	0.998000	0.56505	0.960000	0.62799	7.441000	0.80485	2.522000	0.85027	0.585000	0.79938	CCA	-	pfam_LTV		0.393	LTV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LTV1	protein_coding	OTTHUMT00000042532.1	C	NM_032860	-		144178505	+1	no_errors	ENST00000367576	ensembl	human	known	74_37	missense	SNP	1.000	T
PHLDB2	90102	genome.wustl.edu	37	3	111637922	111637922	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr3:111637922C>T	ENST00000431670.2	+	4	2134	c.1723C>T	c.(1723-1725)Cca>Tca	p.P575S	PHLDB2_ENST00000393925.3_Missense_Mutation_p.P575S|PHLDB2_ENST00000393923.3_Missense_Mutation_p.P602S|PHLDB2_ENST00000412622.1_Missense_Mutation_p.P575S|PHLDB2_ENST00000481953.1_Missense_Mutation_p.P575S|PHLDB2_ENST00000495180.1_Missense_Mutation_p.P161S	NM_001134438.1	NP_001127910.1	Q86SQ0	PHLB2_HUMAN	pleckstrin homology-like domain, family B, member 2	575						cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(7)|large_intestine(8)|lung(23)|ovary(6)|skin(7)|stomach(1)	55						ATCGCAGACCCCAGAGGGTAT	0.428																																																	0								ENSG00000144824						126.0	132.0	130.0					3																	111637922		2203	4300	6503	PHLDB2	SO:0001583	missense	0			-	HGNC		CCDS2962.1, CCDS46885.1, CCDS46886.1	3q13.13	2013-01-10			ENSG00000144824	ENSG00000144824		"""Pleckstrin homology (PH) domain containing"""	29573	protein-coding gene	gene with protein product		610298				12376540	Standard	NM_145753		Approved	LL5beta, FLJ21791, LL5b	uc003dyg.3	Q86SQ0	OTTHUMG00000159282	ENST00000431670.2:c.1723C>T	3.37:g.111637922C>T	ENSP00000405405:p.Pro575Ser	Somatic	0	123	0.00		0.41568620468393047	35	14.63	6	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	38	25.49	A5PKZ3|Q59EA8|Q68CY3|Q6NT98|Q8N8U8|Q8NAB1|Q8NCU5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.P575S	ENST00000431670.2	37	c.1723	CCDS46886.1	3	.	.	.	.	.	.	.	.	.	.	C	19.64	3.865977	0.71949	.	.	ENSG00000144824	ENST00000359729;ENST00000393923;ENST00000431670;ENST00000412622;ENST00000498699;ENST00000393925;ENST00000481953;ENST00000495180	T;T;T;T;T;T;T	0.34472	1.38;1.4;1.39;1.36;1.4;1.39;1.69	5.55	5.55	0.83447	.	0.264236	0.40385	N	0.001113	T	0.39733	0.1089	L	0.38175	1.15	0.36174	D	0.848978	P;D;D;D	0.60575	0.956;0.988;0.974;0.974	P;P;P;P	0.52793	0.549;0.709;0.647;0.647	T	0.20840	-1.0263	10	0.13853	T	0.58	.	16.7824	0.85566	0.0:1.0:0.0:0.0	.	161;575;575;602	E9PGF6;Q86SQ0;Q86SQ0-2;Q86SQ0-3	.;PHLB2_HUMAN;.;.	S	602;602;575;575;575;575;575;161	ENSP00000377500:P602S;ENSP00000405405:P575S;ENSP00000405292:P575S;ENSP00000418296:P575S;ENSP00000377502:P575S;ENSP00000418319:P575S;ENSP00000420303:P161S	ENSP00000352764:P602S	P	+	1	0	PHLDB2	113120612	0.990000	0.36364	1.000000	0.80357	0.976000	0.68499	0.619000	0.24388	2.753000	0.94483	0.655000	0.94253	CCA	-	NULL		0.428	PHLDB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHLDB2	protein_coding	OTTHUMT00000354337.1	C	NM_145753	-		111637922	+1	no_errors	ENST00000393925	ensembl	human	known	74_37	missense	SNP	1.000	T
USP39	10713	genome.wustl.edu	37	2	85866379	85866379	+	Missense_Mutation	SNP	G	G	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr2:85866379G>T	ENST00000323701.6	+	9	1159	c.1149G>T	c.(1147-1149)atG>atT	p.M383I	USP39_ENST00000409470.1_Missense_Mutation_p.M383I|USP39_ENST00000409025.1_Missense_Mutation_p.M383I|USP39_ENST00000459775.1_3'UTR|USP39_ENST00000450066.2_Missense_Mutation_p.M280I|USP39_ENST00000409766.3_Missense_Mutation_p.M383I	NM_006590.3	NP_006581.2	Q53GS9	SNUT2_HUMAN	ubiquitin specific peptidase 39	383	USP.				cell cycle (GO:0007049)|cell division (GO:0051301)|mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|spliceosomal complex assembly (GO:0000245)|ubiquitin-dependent protein catabolic process (GO:0006511)	spliceosomal complex (GO:0005681)	ubiquitinyl hydrolase activity (GO:0036459)|zinc ion binding (GO:0008270)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	19						AGGAGACAATGGTGGAGTCCA	0.488																																																	0								ENSG00000168883						131.0	113.0	119.0					2																	85866379		2203	4300	6503	USP39	SO:0001583	missense	0			-	HGNC	AF132955	CCDS33234.1, CCDS58716.1, CCDS58717.1, CCDS74534.1	2p11.2	2009-01-06	2005-08-08		ENSG00000168883	ENSG00000168883		"""Ubiquitin-specific peptidases"""	20071	protein-coding gene	gene with protein product	"""snRNP assembly defective 1 homolog (S.cerevisiae)"", ""small nuclear ribonucleoprotein 65kDa (U4/U6.U5)"""	611594	"""ubiquitin specific protease 39"""			12838346	Standard	NM_006590		Approved	SAD1, CGI-21, SNRNP65	uc002sqg.4	Q53GS9	OTTHUMG00000153090	ENST00000323701.6:c.1149G>T	2.37:g.85866379G>T	ENSP00000312981:p.Met383Ile	Somatic	0	78	0.00		0.41568620468393047	77	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	39	9.30	A8K086|B3KM40|B4DHT4|D6W5L4|G5E9H0|Q6NX47|Q96RK9|Q9BV89|Q9H381|Q9P050|Q9Y310	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_C19/C67,pfam_Znf_UBP,smart_Znf_UBP,pfscan_Znf_UBP,pfscan_Peptidase_C19/C67	p.M383I	ENST00000323701.6	37	c.1149	CCDS33234.1	2	.	.	.	.	.	.	.	.	.	.	G	15.12	2.740362	0.49045	.	.	ENSG00000168883	ENST00000450066;ENST00000409025;ENST00000409470;ENST00000323701;ENST00000409766	T;T;T;T;T	0.27104	1.69;4.26;1.69;1.69;1.69	5.75	5.75	0.90469	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.85682	D	0.000000	T	0.12902	0.0313	N	0.02379	-0.575	0.58432	D	0.999998	B;B;B;B;B;B	0.13594	0.004;0.001;0.003;0.008;0.004;0.004	B;B;B;B;B;B	0.18871	0.001;0.001;0.007;0.023;0.013;0.001	T	0.19647	-1.0299	10	0.25751	T	0.34	-10.774	17.4249	0.87524	0.0:0.0:1.0:0.0	.	280;305;383;383;383;383	B4DHT4;B7Z7L9;G5E9H0;B3KM40;B9A018;Q53GS9	.;.;.;.;.;SNUT2_HUMAN	I	280;383;383;383;383	ENSP00000396133:M280I;ENSP00000386572:M383I;ENSP00000386864:M383I;ENSP00000312981:M383I;ENSP00000386803:M383I	ENSP00000312981:M383I	M	+	3	0	USP39	85719890	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.477000	0.81069	2.721000	0.93114	0.655000	0.94253	ATG	-	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67		0.488	USP39-009	NOVEL	basic|appris_principal|CCDS	protein_coding	USP39	protein_coding	OTTHUMT00000329892.1	G	NM_006590	-		85866379	+1	no_errors	ENST00000409470	ensembl	human	known	74_37	missense	SNP	1.000	T
MAP2	4133	genome.wustl.edu	37	2	210557733	210557733	+	Nonsense_Mutation	SNP	T	T	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr2:210557733T>A	ENST00000360351.4	+	7	1345	c.839T>A	c.(838-840)tTa>tAa	p.L280*	MAP2_ENST00000199940.6_Intron|MAP2_ENST00000447185.1_Nonsense_Mutation_p.L276*|MAP2_ENST00000392194.1_Intron|MAP2_ENST00000361559.4_Intron	NM_002374.3	NP_002365.3	P11137	MTAP2_HUMAN	microtubule-associated protein 2	280					axonogenesis (GO:0007409)|cellular response to organic substance (GO:0071310)|central nervous system neuron development (GO:0021954)|dendrite morphogenesis (GO:0048813)|microtubule bundle formation (GO:0001578)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|nuclear periphery (GO:0034399)	dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)			breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(36)|liver(2)|lung(42)|ovary(11)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	124		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Docetaxel(DB01248)|Estramustine(DB01196)|Paclitaxel(DB01229)	GAGTGGGGTTTAGTTGCCCCC	0.463																																					Pancreas(27;423 979 28787 29963)												0								ENSG00000078018						51.0	52.0	52.0					2																	210557733		2203	4300	6503	MAP2	SO:0001587	stop_gained	0			-	HGNC		CCDS2384.1, CCDS2385.1, CCDS33369.1	2q34-q35	2008-05-27			ENSG00000078018	ENSG00000078018		"""A-kinase anchor proteins"""	6839	protein-coding gene	gene with protein product		157130				3103857, 7479905	Standard	XM_005246554		Approved	MAP2A, MAP2B, MAP2C	uc002vde.1	P11137	OTTHUMG00000132962	ENST00000360351.4:c.839T>A	2.37:g.210557733T>A	ENSP00000353508:p.Leu280*	Somatic	0	57	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	36	25.00	Q17S04|Q8IUX2|Q99975|Q99976	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MAP2_projctn,pfam_MAP_tubulin-bd_rpt	p.L280*	ENST00000360351.4	37	c.839	CCDS2384.1	2	.	.	.	.	.	.	.	.	.	.	T	19.35	3.810152	0.70797	.	.	ENSG00000078018	ENST00000360351;ENST00000445941;ENST00000447185	.	.	.	5.94	4.81	0.61882	.	0.430258	0.19925	N	0.102988	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.0767	3.8036	0.08768	0.0:0.2181:0.0:0.7819	.	.	.	.	X	280;362;276	.	ENSP00000353508:L280X	L	+	2	0	MAP2	210265978	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	2.629000	0.46485	2.286000	0.76751	0.529000	0.55759	TTA	-	NULL		0.463	MAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAP2	protein_coding	OTTHUMT00000256521.2	T	NM_001039538	-		210557733	+1	no_errors	ENST00000360351	ensembl	human	known	74_37	nonsense	SNP	0.993	A
KIF1C	10749	genome.wustl.edu	37	17	4925690	4925690	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr17:4925690G>A	ENST00000320785.5	+	22	2671	c.2314G>A	c.(2314-2316)Gag>Aag	p.E772K	AC109333.10_ENST00000438266.1_RNA	NM_006612.5	NP_006603.2	O43896	KIF1C_HUMAN	kinesin family member 1C	772					ATP catabolic process (GO:0006200)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)|poly(A) RNA binding (GO:0044822)			NS(2)|breast(4)|endometrium(4)|kidney(2)|large_intestine(8)|lung(6)|skin(1)|urinary_tract(3)	30						GGCTGAGATTGAGGCCCTGGC	0.682																																					Melanoma(96;1023 1447 10250 19259 33730)												0								ENSG00000129250						21.0	20.0	20.0					17																	4925690		2198	4291	6489	KIF1C	SO:0001583	missense	0			-	HGNC	U91329	CCDS11065.1	17p13.2	2014-03-03			ENSG00000129250	ENSG00000129250		"""Kinesins"""	6317	protein-coding gene	gene with protein product		603060	"""spastic ataxia 2 (autosomal recessive)"""	SAX2		9685376, 24319291, 24482476	Standard	NM_006612		Approved	SPAX2, SPG58	uc002gan.2	O43896	OTTHUMG00000099451	ENST00000320785.5:c.2314G>A	17.37:g.4925690G>A	ENSP00000320821:p.Glu772Lys	Somatic	0	30	0.00		0.41568620468393047	211	16.60	42	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	26	16.13	D3DTL6|O75186|Q5U618	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Kinesin_motor_dom,pfam_FHA_dom,superfamily_P-loop_NTPase,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.E772K	ENST00000320785.5	37	c.2314	CCDS11065.1	17	.	.	.	.	.	.	.	.	.	.	G	36	5.675335	0.96764	.	.	ENSG00000129250	ENST00000320785	T	0.73363	-0.74	4.67	4.67	0.58626	.	.	.	.	.	T	0.81356	0.4805	L	0.47190	1.495	0.51012	D	0.999901	D	0.63880	0.993	D	0.68192	0.956	T	0.82762	-0.0297	9	0.62326	D	0.03	.	15.1017	0.72284	0.0:0.0:1.0:0.0	.	772	O43896	KIF1C_HUMAN	K	772	ENSP00000320821:E772K	ENSP00000320821:E772K	E	+	1	0	KIF1C	4866414	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.679000	0.84048	2.436000	0.82500	0.655000	0.94253	GAG	-	NULL		0.682	KIF1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF1C	protein_coding	OTTHUMT00000216916.1	G		-		4925690	+1	no_errors	ENST00000320785	ensembl	human	known	74_37	missense	SNP	1.000	A
LIPE	3991	genome.wustl.edu	37	19	42912445	42912445	+	Silent	SNP	C	C	T	rs140139139		TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr19:42912445C>T	ENST00000244289.4	-	3	1725	c.1449G>A	c.(1447-1449)caG>caA	p.Q483Q	LIPE-AS1_ENST00000593491.2_RNA|LIPE_ENST00000602000.1_5'UTR|LIPE-AS1_ENST00000597203.1_RNA|LIPE-AS1_ENST00000594624.2_RNA|LIPE-AS1_ENST00000599276.1_RNA	NM_005357.2	NP_005348.2	Q05469	LIPS_HUMAN	lipase, hormone-sensitive	483					cholesterol metabolic process (GO:0008203)|diacylglycerol catabolic process (GO:0046340)|lipid catabolic process (GO:0016042)|long-chain fatty acid catabolic process (GO:0042758)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)	cytosol (GO:0005829)|lipid particle (GO:0005811)|plasma membrane (GO:0005886)	hormone-sensitive lipase activity (GO:0033878)|triglyceride lipase activity (GO:0004806)			breast(2)|endometrium(4)|kidney(7)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	32		Prostate(69;0.00682)				TGGAGATGGTCTGCAGGAATG	0.617																																																	0								ENSG00000079435	C		1,4405	2.1+/-5.4	0,1,2202	164.0	154.0	157.0		1449	4.3	1.0	19	dbSNP_134	157	0,8600		0,0,4300	no	coding-synonymous	LIPE	NM_005357.2		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		483/1077	42912445	1,13005	2203	4300	6503	LIPE	SO:0001819	synonymous_variant	0			-	HGNC	L11706	CCDS12607.1	19q13.1-q13.2	2014-03-14			ENSG00000079435	ENSG00000079435	3.1.1.3		6621	protein-coding gene	gene with protein product		151750				8506334	Standard	NM_005357		Approved	HSL	uc002otr.3	Q05469	OTTHUMG00000182814	ENST00000244289.4:c.1449G>A	19.37:g.42912445C>T		Somatic	0	27	0.00		0.41568620468393047	114	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	29	17.14	Q3LRT2|Q6NSL7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_HSL_N,pfam_AB_hydrolase_3,pfam_Steryl_acetyl_hydrolase	p.Q483	ENST00000244289.4	37	c.1449	CCDS12607.1	19																																																																																			-	pfam_HSL_N		0.617	LIPE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIPE	protein_coding	OTTHUMT00000463861.1	C	NM_005357	rs140139139		42912445	-1	no_errors	ENST00000244289	ensembl	human	known	74_37	silent	SNP	1.000	T
UPK1B	7348	genome.wustl.edu	37	3	118905609	118905609	+	Silent	SNP	T	T	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr3:118905609T>A	ENST00000264234.3	+	2	170	c.21T>A	c.(19-21)acT>acA	p.T7T	UPK1B_ENST00000460625.1_Silent_p.T7T|UPK1B_ENST00000497685.1_Intron|RP11-484M3.5_ENST00000490594.1_Intron	NM_006952.3	NP_008883.2	O75841	UPK1B_HUMAN	uroplakin 1B	7					epithelial cell differentiation (GO:0030855)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	structural molecule activity (GO:0005198)			breast(1)|endometrium(3)|large_intestine(2)|lung(6)|pancreas(1)|skin(1)	14				GBM - Glioblastoma multiforme(114;0.222)		ACAACTCAACTGTTCGTTGCT	0.393																																																	0								ENSG00000114638						173.0	158.0	163.0					3																	118905609		2203	4300	6503	UPK1B	SO:0001819	synonymous_variant	0			-	HGNC	AF082888	CCDS2985.1	3q13.32	2013-02-14			ENSG00000114638	ENSG00000114638		"""Tetraspanins"""	12578	protein-coding gene	gene with protein product		602380		UPK1		9935153, 9846985	Standard	NM_006952		Approved	TSPAN20	uc003ecc.3	O75841	OTTHUMG00000159354	ENST00000264234.3:c.21T>A	3.37:g.118905609T>A		Somatic	0	82	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	33	25.00	O60753|Q9UIM2|Q9UNX6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2,prints_Tetraspanin	p.T7	ENST00000264234.3	37	c.21	CCDS2985.1	3																																																																																			-	NULL		0.393	UPK1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UPK1B	protein_coding	OTTHUMT00000354883.2	T		-		118905609	+1	no_errors	ENST00000264234	ensembl	human	known	74_37	silent	SNP	0.410	A
FAT4	79633	genome.wustl.edu	37	4	126241960	126241960	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr4:126241960G>A	ENST00000394329.3	+	1	4407	c.4394G>A	c.(4393-4395)aGa>aAa	p.R1465K		NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	1465	Cadherin 14. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						CAGATGCCAAGAGGCAACCAC	0.398																																																	0								ENSG00000196159						118.0	106.0	110.0					4																	126241960		1899	4121	6020	FAT4	SO:0001583	missense	0			-	HGNC	AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.4394G>A	4.37:g.126241960G>A	ENSP00000377862:p.Arg1465Lys	Somatic	0	37	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	22	26.67	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Laminin_G,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,superfamily_Cadherin-like,superfamily_ConA-like_lec_gl_sf,smart_Cadherin,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.R1465K	ENST00000394329.3	37	c.4394	CCDS3732.3	4	.	.	.	.	.	.	.	.	.	.	G	19.09	3.759699	0.69763	.	.	ENSG00000196159	ENST00000394329	T	0.60672	0.17	4.87	4.87	0.63330	Cadherin (4);Cadherin-like (1);	0.000000	0.32055	U	0.006651	T	0.54498	0.1862	N	0.05414	-0.055	0.80722	D	1	D	0.69078	0.997	D	0.80764	0.994	T	0.48703	-0.9012	10	0.06625	T	0.88	.	18.1883	0.89799	0.0:0.0:1.0:0.0	.	1465	Q6V0I7	FAT4_HUMAN	K	1465	ENSP00000377862:R1465K	ENSP00000377862:R1465K	R	+	2	0	FAT4	126461410	1.000000	0.71417	0.989000	0.46669	0.926000	0.56050	7.480000	0.81109	2.535000	0.85469	0.655000	0.94253	AGA	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.398	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT4	protein_coding	OTTHUMT00000256765.2	G	NM_024582	-		126241960	+1	no_errors	ENST00000394329	ensembl	human	known	74_37	missense	SNP	0.967	A
PDZRN4	29951	genome.wustl.edu	37	12	41961623	41961623	+	Silent	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr12:41961623C>T	ENST00000402685.2	+	9	1514	c.1506C>T	c.(1504-1506)ttC>ttT	p.F502F	PDZRN4_ENST00000298919.7_Silent_p.F242F|PDZRN4_ENST00000539469.2_Silent_p.F244F	NM_001164595.1	NP_001158067.1	Q6ZMN7	PZRN4_HUMAN	PDZ domain containing ring finger 4	502							ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(29)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	77	all_cancers(12;0.000673)	Lung NSC(34;0.0205)|all_lung(34;0.0264)				GGAATGAATTCTTAGAGGAGT	0.393																																																	0								ENSG00000165966						83.0	79.0	80.0					12																	41961623		2203	4300	6503	PDZRN4	SO:0001819	synonymous_variant	0			-	HGNC	AK094690	CCDS8739.1, CCDS53777.1	12q12	2008-08-14	2008-08-14			ENSG00000165966		"""RING-type (C3HC4) zinc fingers"""	30552	protein-coding gene	gene with protein product	"""similar to semaF cytoplasmic domain associated protein 3"""	609730				11230166, 15010864	Standard	NM_013377		Approved	DKFZp434B0417, LNX4, FLJ33777, IMAGE5767589	uc010skn.2	Q6ZMN7		ENST00000402685.2:c.1506C>T	12.37:g.41961623C>T		Somatic	0	114	0.00		0.41568620468393047	6	14.29	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	51	28.17	Q52LY3|Q52LY4|Q6N052|Q8IUU1|Q9NTP7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_PDZ,superfamily_PDZ,superfamily_TRAF-like,smart_Znf_RING,smart_PDZ,pfscan_PDZ,pfscan_Znf_RING	p.F502	ENST00000402685.2	37	c.1506	CCDS53777.1	12																																																																																			-	NULL		0.393	PDZRN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDZRN4	protein_coding	OTTHUMT00000403701.1	C	NM_013377	-		41961623	+1	no_errors	ENST00000402685	ensembl	human	known	74_37	silent	SNP	1.000	T
SAMD9	54809	genome.wustl.edu	37	7	92734623	92734623	+	Missense_Mutation	SNP	T	T	G			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr7:92734623T>G	ENST00000379958.2	-	3	1057	c.788A>C	c.(787-789)cAt>cCt	p.H263P		NM_001193307.1|NM_017654.3	NP_001180236.1|NP_060124.2	Q5K651	SAMD9_HUMAN	sterile alpha motif domain containing 9	263						cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)				NS(1)|breast(4)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(20)|lung(32)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	88	all_cancers(62;5.71e-11)|all_epithelial(64;3.25e-10)|Breast(17;0.000675)|Lung NSC(181;0.0969)|all_lung(186;0.125)		STAD - Stomach adenocarcinoma(171;0.000302)			CAGATTGAAATGGTTAATGAG	0.393																																																	0								ENSG00000205413						159.0	154.0	156.0					7																	92734623		2203	4300	6503	SAMD9	SO:0001583	missense	0			-	HGNC	AB095925	CCDS34680.1	7q21.2	2013-01-10	2004-07-15	2004-07-16	ENSG00000205413	ENSG00000205413		"""Sterile alpha motif (SAM) domain containing"""	1348	protein-coding gene	gene with protein product		610456	"""chromosome 7 open reading frame 5"""	C7orf5			Standard	NM_017654		Approved	KIAA2004, FLJ20073	uc003umg.3	Q5K651	OTTHUMG00000155809	ENST00000379958.2:c.788A>C	7.37:g.92734623T>G	ENSP00000369292:p.His263Pro	Somatic	0	37	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	33	22.73	A2RU68|Q5K649|Q6P080|Q75N21|Q8IVG6|Q9NXS8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,superfamily_P-loop_NTPase,smart_SAM,pfscan_SAM	p.H263P	ENST00000379958.2	37	c.788	CCDS34680.1	7	.	.	.	.	.	.	.	.	.	.	T	13.39	2.221948	0.39300	.	.	ENSG00000205413	ENST00000379958;ENST00000446617	T;T	0.14893	2.47;2.47	4.34	3.17	0.36434	.	0.180712	0.35124	U	0.003440	T	0.20861	0.0502	L	0.52573	1.65	0.09310	N	0.999998	D	0.56968	0.978	P	0.49012	0.598	T	0.05115	-1.0905	10	0.56958	D	0.05	-6.9793	9.035	0.36282	0.0:0.0907:0.0:0.9093	.	263	Q5K651	SAMD9_HUMAN	P	263	ENSP00000369292:H263P;ENSP00000414529:H263P	ENSP00000369292:H263P	H	-	2	0	SAMD9	92572559	0.002000	0.14202	0.929000	0.37066	0.712000	0.41017	0.549000	0.23329	0.800000	0.34041	0.491000	0.48974	CAT	-	NULL		0.393	SAMD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAMD9	protein_coding	OTTHUMT00000341761.1	T	NM_017654	-		92734623	-1	no_errors	ENST00000379958	ensembl	human	known	74_37	missense	SNP	0.263	G
EIF2B3	8891	genome.wustl.edu	37	1	45407283	45407283	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr1:45407283C>T	ENST00000360403.2	-	4	475	c.349G>A	c.(349-351)Gtt>Att	p.V117I	EIF2B3_ENST00000372183.3_Missense_Mutation_p.V117I|EIF2B3_ENST00000480675.1_5'UTR	NM_001261418.1|NM_020365.4	NP_001248347.1|NP_065098.1	Q9NR50	EI2BG_HUMAN	eukaryotic translation initiation factor 2B, subunit 3 gamma, 58kDa	117					cellular protein metabolic process (GO:0044267)|cellular response to stimulus (GO:0051716)|gene expression (GO:0010467)|negative regulation of translational initiation in response to stress (GO:0032057)|oligodendrocyte development (GO:0014003)|positive regulation of GTPase activity (GO:0043547)|response to glucose (GO:0009749)|response to heat (GO:0009408)|response to peptide hormone (GO:0043434)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation initiation factor 2B complex (GO:0005851)	guanyl-nucleotide exchange factor activity (GO:0005085)|nucleotidyltransferase activity (GO:0016779)|translation initiation factor activity (GO:0003743)			endometrium(2)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)	17	Acute lymphoblastic leukemia(166;0.155)					AGGTCCACAACCTCATGTAAG	0.418																																					Colon(26;357 658 2581 11857 12657)												0								ENSG00000070785						209.0	187.0	194.0					1																	45407283		2203	4300	6503	EIF2B3	SO:0001583	missense	0			-	HGNC	AF257077	CCDS517.1, CCDS53313.1, CCDS72775.1	1p34.1	2008-02-05	2002-08-29		ENSG00000070785	ENSG00000070785			3259	protein-coding gene	gene with protein product		606273	"""eukaryotic translation initiation factor 2B, subunit 3 (gamma, 58kD)"""			10900014	Standard	NM_020365		Approved	EIF2Bgamma, EIF-2B	uc001cmt.3	Q9NR50	OTTHUMG00000008585	ENST00000360403.2:c.349G>A	1.37:g.45407283C>T	ENSP00000353575:p.Val117Ile	Somatic	0	48	0.00		0.41568620468393047	21	34.38	11	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	36	14.29	B2RBH8|D3DPZ2|Q5QP89|Q5QP90|Q8NDB5|Q8WV57|Q9H850	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_NTP_transferase	p.V117I	ENST00000360403.2	37	c.349	CCDS517.1	1	.	.	.	.	.	.	.	.	.	.	C	15.62	2.886036	0.51908	.	.	ENSG00000070785	ENST00000360403;ENST00000372183;ENST00000372182	D;D;T	0.94046	-3.34;-3.34;-0.7	5.43	5.43	0.79202	Nucleotidyl transferase (1);	0.061489	0.64402	D	0.000004	D	0.88001	0.6320	L	0.31371	0.925	0.58432	D	0.99999	B;B;B	0.26975	0.165;0.075;0.043	B;B;B	0.25140	0.051;0.058;0.058	D	0.84332	0.0522	10	0.28530	T	0.3	-8.6332	12.5645	0.56301	0.0:0.9238:0.0:0.0762	.	117;117;117	Q9NR50-2;Q9NR50-3;Q9NR50	.;.;EI2BG_HUMAN	I	117	ENSP00000353575:V117I;ENSP00000361257:V117I;ENSP00000361256:V117I	ENSP00000353575:V117I	V	-	1	0	EIF2B3	45179870	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	5.578000	0.67450	2.552000	0.86080	0.591000	0.81541	GTT	-	pfam_NTP_transferase		0.418	EIF2B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF2B3	protein_coding	OTTHUMT00000023724.1	C	NM_020365	-		45407283	-1	no_errors	ENST00000360403	ensembl	human	known	74_37	missense	SNP	1.000	T
AC011322.1	0	genome.wustl.edu	37	3	196713813	196713813	+	RNA	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr3:196713813G>A	ENST00000445739.1	-	0	0																											ATCTCTTCAGGATCTCTGTAG	0.527																																																	0								ENSG00000233487																																			AC011322.1			0			-	Clone_based_vega_gene																													3.37:g.196713813G>A		Somatic	0	67	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	28	30.00		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000445739.1	37	NULL		3																																																																																			-	-		0.527	AC011322.1-002	PUTATIVE	basic|exp_conf	processed_transcript	ENSG00000233487	pseudogene	OTTHUMT00000340485.1	G		-		196713813	-1	no_errors	ENST00000445739	ensembl	human	putative	74_37	rna	SNP	1.000	A
SERPINB12	89777	genome.wustl.edu	37	18	61233951	61233951	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr18:61233951G>A	ENST00000269491.1	+	7	925	c.925G>A	c.(925-927)Gat>Aat	p.D309N	SERPINB12_ENST00000382768.1_Missense_Mutation_p.D329N	NM_080474.1	NP_536722.1	Q96P63	SPB12_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 12	309					hematopoietic progenitor cell differentiation (GO:0002244)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of protein catabolic process (GO:0042177)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	enzyme binding (GO:0019899)|serine-type endopeptidase inhibitor activity (GO:0004867)			kidney(1)|large_intestine(5)|lung(19)|skin(1)	26						AGACAGCTATGATCTCAATTC	0.453																																																	0								ENSG00000166634						190.0	186.0	187.0					18																	61233951		2203	4300	6503	SERPINB12	SO:0001583	missense	0			-	HGNC	AF411191	CCDS11984.1	18q21.33	2014-02-18	2005-08-18		ENSG00000166634	ENSG00000166634		"""Serine (or cysteine) peptidase inhibitors"""	14220	protein-coding gene	gene with protein product		615662	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 12"""			24172014	Standard	NM_080474		Approved	YUKOPIN	uc010xen.2	Q96P63	OTTHUMG00000132789	ENST00000269491.1:c.925G>A	18.37:g.61233951G>A	ENSP00000269491:p.Asp309Asn	Somatic	0	59	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	Q3SYB4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	p.D309N	ENST00000269491.1	37	c.925	CCDS11984.1	18	.	.	.	.	.	.	.	.	.	.	G	10.11	1.259999	0.23051	.	.	ENSG00000166634	ENST00000269491;ENST00000382768	D;D	0.83914	-1.78;-1.78	5.81	3.1	0.35709	Serpin domain (3);	0.346611	0.27991	N	0.017029	T	0.73853	0.3640	L	0.42529	1.33	0.09310	N	1	B;B	0.28419	0.128;0.211	B;B	0.29524	0.103;0.053	T	0.63256	-0.6678	10	0.46703	T	0.11	.	5.8332	0.18593	0.2669:0.0:0.6097:0.1234	.	329;309	Q3SYB4;Q96P63	.;SPB12_HUMAN	N	309;329	ENSP00000269491:D309N;ENSP00000372218:D329N	ENSP00000269491:D309N	D	+	1	0	SERPINB12	59384931	0.000000	0.05858	0.002000	0.10522	0.632000	0.37999	0.954000	0.29175	0.394000	0.25230	-0.136000	0.14681	GAT	-	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom		0.453	SERPINB12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPINB12	protein_coding	OTTHUMT00000256197.1	G	NM_080474	-		61233951	+1	no_errors	ENST00000269491	ensembl	human	known	74_37	missense	SNP	0.000	A
CSMD3	114788	genome.wustl.edu	37	8	113694743	113694743	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr8:113694743C>T	ENST00000297405.5	-	16	2849	c.2605G>A	c.(2605-2607)Gga>Aga	p.G869R	CSMD3_ENST00000352409.3_Missense_Mutation_p.G869R|CSMD3_ENST00000455883.2_Missense_Mutation_p.G765R|CSMD3_ENST00000343508.3_Missense_Mutation_p.G829R	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	869	Sushi 4. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						GTTTCTGTTCCCTGGGTTTTA	0.373										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																																							0								ENSG00000164796						135.0	132.0	133.0					8																	113694743		2203	4300	6503	CSMD3	SO:0001583	missense	0			-	HGNC	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.2605G>A	8.37:g.113694743C>T	ENSP00000297405:p.Gly869Arg	Somatic	0	79	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	49	18.03	Q96PZ3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_CUB_dom,pfam_Sushi_SCR_CCP,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.G869R	ENST00000297405.5	37	c.2605	CCDS6315.1	8	.	.	.	.	.	.	.	.	.	.	C	31	5.078377	0.94000	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.72725	-0.68;-0.68;-0.68;-0.68;-0.68	5.68	5.68	0.88126	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.64402	D	0.000001	D	0.89312	0.6679	H	0.94734	3.575	0.52501	D	0.999956	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.91663	0.5344	10	0.87932	D	0	.	19.7925	0.96464	0.0:1.0:0.0:0.0	.	765;869;829	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	R	829;869;209;765;869	ENSP00000345799:G829R;ENSP00000297405:G869R;ENSP00000341558:G209R;ENSP00000412263:G765R;ENSP00000343124:G869R	ENSP00000297405:G869R	G	-	1	0	CSMD3	113763919	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.818000	0.86416	2.681000	0.91329	0.650000	0.86243	GGA	-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP		0.373	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSMD3	protein_coding	OTTHUMT00000347141.1	C	NM_052900	-		113694743	-1	no_errors	ENST00000297405	ensembl	human	known	74_37	missense	SNP	1.000	T
MEIS2	4212	genome.wustl.edu	37	15	37242598	37242598	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr15:37242598G>A	ENST00000561208.1	-	9	1322	c.904C>T	c.(904-906)Ccg>Tcg	p.P302S	MEIS2_ENST00000397620.2_Missense_Mutation_p.P214S|MEIS2_ENST00000557796.2_Missense_Mutation_p.P289S|MEIS2_ENST00000340545.5_Missense_Mutation_p.P289S|MEIS2_ENST00000559085.1_Missense_Mutation_p.P289S|MEIS2_ENST00000559561.1_Missense_Mutation_p.P302S|MEIS2_ENST00000382766.2_Missense_Mutation_p.P302S|MEIS2_ENST00000219869.9_Missense_Mutation_p.P156S|MEIS2_ENST00000397624.3_Missense_Mutation_p.P214S|MEIS2_ENST00000338564.5_Missense_Mutation_p.P302S|MEIS2_ENST00000424352.2_Missense_Mutation_p.P302S|MEIS2_ENST00000444725.1_Missense_Mutation_p.P302S			O14770	MEIS2_HUMAN	Meis homeobox 2	302					eye development (GO:0001654)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|pancreas development (GO:0031016)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to growth factor (GO:0070848)|response to mechanical stimulus (GO:0009612)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(7)|lung(17)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	36		all_epithelial(112;9.77e-14)|Lung NSC(122;1.42e-09)|all_lung(180;2.2e-08)|Ovarian(310;0.134)|Melanoma(134;0.155)		all cancers(64;9.33e-21)|GBM - Glioblastoma multiforme(113;1.71e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0288)		GAAGGGTACGGATGCTAATGG	0.373																																																	0								ENSG00000134138						173.0	164.0	167.0					15																	37242598		2201	4297	6498	MEIS2	SO:0001583	missense	0			-	HGNC	AF017418	CCDS10044.1, CCDS10045.1, CCDS42014.1, CCDS45217.1, CCDS45218.1, CCDS45219.1, CCDS45220.1	15q14	2011-06-20	2007-02-15		ENSG00000134138	ENSG00000134138		"""Homeoboxes / TALE class"""	7001	protein-coding gene	gene with protein product		601740	"""Meis (mouse) homolog 2"", ""Meis1, myeloid ecotropic viral integration site 1 homolog 2 (mouse)"""			9383298	Standard	NM_172315		Approved	MRG1, HsT18361	uc001zjr.4	O14770	OTTHUMG00000129781	ENST00000561208.1:c.904C>T	15.37:g.37242598G>A	ENSP00000453793:p.Pro302Ser	Somatic	0	70	0.00		0.41568620468393047	14	26.32	5	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	19	26.92	A6NJI5|A8MWD5|B3KP98|B3KPQ6|Q96DI2|Q96KI4|Q96KI5|Q9NRS1|Q9NRS2|Q9NRS3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Homeobox_dom,pfam_Homeobox_KN_domain,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	p.P302S	ENST00000561208.1	37	c.904	CCDS10044.1	15	.	.	.	.	.	.	.	.	.	.	G	18.83	3.706889	0.68615	.	.	ENSG00000134138	ENST00000314177;ENST00000338564;ENST00000382766;ENST00000424352;ENST00000444725;ENST00000340545;ENST00000397624;ENST00000397620;ENST00000219869	D;D;D;D;D;D;D;D	0.99245	-5.62;-5.62;-5.62;-5.62;-5.62;-2.1;-5.62;-5.62	5.49	5.49	0.81192	Homeodomain-related (1);Homeobox (2);Homeobox KN domain (1);Homeodomain-like (1);	0.103326	0.64402	D	0.000002	D	0.99612	0.9859	H	0.94620	3.56	0.80722	D	1	P;D;D;D;D;D;D;D	0.89917	0.95;0.985;0.998;0.987;1.0;0.998;1.0;0.975	P;P;D;P;D;D;D;D	0.97110	0.859;0.868;0.98;0.858;0.999;0.971;1.0;0.919	D	0.98206	1.0470	10	0.54805	T	0.06	-1.0548	19.5721	0.95425	0.0:0.0:1.0:0.0	.	289;302;302;302;302;156;214;289	Q96DI2;O14770-4;O14770;O14770-3;O14770-2;B3KP81;B3KPQ6;B3KP98	.;.;MEIS2_HUMAN;.;.;.;.;.	S	302;302;302;302;302;289;289;214;156	ENSP00000341400:P302S;ENSP00000372216:P302S;ENSP00000404185:P302S;ENSP00000391887:P302S;ENSP00000339549:P289S;ENSP00000380749:P289S;ENSP00000380745:P214S;ENSP00000219869:P156S	ENSP00000219869:P156S	P	-	1	0	MEIS2	35029890	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.657000	0.98554	2.857000	0.98124	0.650000	0.86243	CCG	-	pfam_Homeobox_dom,pfam_Homeobox_KN_domain,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom		0.373	MEIS2-001	KNOWN	basic|CCDS	protein_coding	MEIS2	protein_coding	OTTHUMT00000252003.2	G	NM_170677	-		37242598	-1	no_errors	ENST00000561208	ensembl	human	known	74_37	missense	SNP	1.000	A
OSBPL7	114881	genome.wustl.edu	37	17	45891082	45891082	+	Silent	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr17:45891082G>A	ENST00000007414.3	-	15	1661	c.1470C>T	c.(1468-1470)gaC>gaT	p.D490D	OSBPL7_ENST00000392507.3_Silent_p.D490D	NM_145798.2	NP_665741.1	Q9BZF2	OSBL7_HUMAN	oxysterol binding protein-like 7	490					cellular response to cholesterol (GO:0071397)|lipid transport (GO:0006869)|positive regulation of proteasomal protein catabolic process (GO:1901800)	autophagic vacuole (GO:0005776)|cytosol (GO:0005829)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)	cholesterol binding (GO:0015485)			autonomic_ganglia(1)|endometrium(6)|kidney(2)|large_intestine(5)|liver(2)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	32						CCTTGGACAGGTCTTTGCCGA	0.657																																																	0								ENSG00000006025						67.0	62.0	64.0					17																	45891082		2203	4300	6503	OSBPL7	SO:0001819	synonymous_variant	0			-	HGNC	AF392446	CCDS11515.1	17q21	2013-01-10				ENSG00000006025		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16387	protein-coding gene	gene with protein product		606735				14593528, 11735225	Standard	NM_145798		Approved	ORP7, MGC71150	uc002ilx.1	Q9BZF2		ENST00000007414.3:c.1470C>T	17.37:g.45891082G>A		Somatic	0	76	0.00		0.41568620468393047	8	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	47	9.62	D3DTT6|Q6PIV6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Oxysterol-bd,pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.D490	ENST00000007414.3	37	c.1470	CCDS11515.1	17																																																																																			-	pfam_Oxysterol-bd		0.657	OSBPL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OSBPL7	protein_coding	OTTHUMT00000441367.1	G	NM_017731	-		45891082	-1	no_errors	ENST00000007414	ensembl	human	known	74_37	silent	SNP	1.000	A
GUCA1C	9626	genome.wustl.edu	37	3	108634967	108634967	+	Intron	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr3:108634967C>T	ENST00000261047.3	-	3	575				GUCA1C_ENST00000471108.1_Missense_Mutation_p.G150E|GUCA1C_ENST00000393963.3_Missense_Mutation_p.G150E	NM_005459.3	NP_005450.3	O95843	GUC1C_HUMAN	guanylate cyclase activator 1C						phototransduction, visible light (GO:0007603)|positive regulation of guanylate cyclase activity (GO:0031284)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|signal transduction (GO:0007165)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)	calcium ion binding (GO:0005509)|calcium sensitive guanylate cyclase activator activity (GO:0008048)			endometrium(2)|large_intestine(1)|liver(1)|lung(8)|pancreas(1)|skin(1)	14						GAGAGTAGCTCCATTACCATC	0.433																																					NSCLC(157;1360 1999 30631 40189 44208)												0								ENSG00000138472						159.0	151.0	154.0					3																	108634967		2203	4300	6503	GUCA1C	SO:0001627	intron_variant	0			-	HGNC	AF110002	CCDS2954.1	3q13.1	2013-01-10			ENSG00000138472	ENSG00000138472		"""EF-hand domain containing"""	4680	protein-coding gene	gene with protein product	"""guanylyl cyclase-activating protein 3"""	605128				10037746, 11860507	Standard	NM_005459		Approved	GCAP3	uc003dxj.2	O95843	OTTHUMG00000159204	ENST00000261047.3:c.442+6G>A	3.37:g.108634967C>T		Somatic	0	85	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	60	23.08	O95844|Q9UNM0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_EF_hand_dom,smart_EF_hand_dom,pfscan_EF_hand_dom,prints_Recoverin	p.G150E	ENST00000261047.3	37	c.449	CCDS2954.1	3	.	.	.	.	.	.	.	.	.	.	c	11.08	1.532163	0.27387	.	.	ENSG00000138472	ENST00000393963;ENST00000471108	T;T	0.67698	-0.28;-0.21	3.73	0.383	0.16239	.	.	.	.	.	T	0.48241	0.1489	.	.	.	0.22401	N	0.999137	B	0.14438	0.01	B	0.09377	0.004	T	0.44390	-0.9331	8	0.87932	D	0	.	1.0837	0.01648	0.1774:0.3172:0.3338:0.1715	.	150	C9JNI2	.	E	150	ENSP00000377535:G150E;ENSP00000417761:G150E	ENSP00000377535:G150E	G	-	2	0	GUCA1C	110117657	0.000000	0.05858	0.016000	0.15963	0.845000	0.48019	-1.479000	0.02327	0.163000	0.19507	0.651000	0.88453	GGA	-	NULL		0.433	GUCA1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GUCA1C	protein_coding	OTTHUMT00000353819.1	C	NM_005459	-		108634967	-1	no_errors	ENST00000393963	ensembl	human	known	74_37	missense	SNP	0.992	T
WNT7B	7477	genome.wustl.edu	37	22	46345807	46345807	+	Silent	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr22:46345807G>A	ENST00000339464.4	-	2	665	c.291C>T	c.(289-291)ctC>ctT	p.L97L	WNT7B_ENST00000410058.1_Silent_p.L97L|WNT7B_ENST00000409496.3_Silent_p.L101L|WNT7B_ENST00000410089.1_Silent_p.L81L	NM_058238.2	NP_478679.1	P56706	WNT7B_HUMAN	wingless-type MMTV integration site family, member 7B	97					activation of JUN kinase activity (GO:0007257)|anatomical structure regression (GO:0060033)|apoptotic process involved in patterning of blood vessels (GO:1902262)|canonical Wnt signaling pathway (GO:0060070)|cell fate commitment (GO:0045165)|cellular metabolic process (GO:0044237)|cellular response to retinoic acid (GO:0071300)|central nervous system vasculogenesis (GO:0022009)|chorio-allantoic fusion (GO:0060710)|developmental growth involved in morphogenesis (GO:0060560)|embryonic organ development (GO:0048568)|embryonic placenta morphogenesis (GO:0060669)|establishment or maintenance of polarity of embryonic epithelium (GO:0016332)|fibroblast proliferation (GO:0048144)|forebrain regionalization (GO:0021871)|homeostatic process (GO:0042592)|in utero embryonic development (GO:0001701)|inner medullary collecting duct development (GO:0072061)|lens fiber cell development (GO:0070307)|lobar bronchus development (GO:0060482)|lung development (GO:0030324)|lung epithelium development (GO:0060428)|lung morphogenesis (GO:0060425)|lung-associated mesenchyme development (GO:0060484)|mammary gland epithelium development (GO:0061180)|metanephric collecting duct development (GO:0072205)|metanephric epithelium development (GO:0072207)|metanephric loop of Henle development (GO:0072236)|metanephros morphogenesis (GO:0003338)|negative regulation of smoothened signaling pathway (GO:0045879)|neuron differentiation (GO:0030182)|neuron projection morphogenesis (GO:0048812)|odontogenesis of dentin-containing tooth (GO:0042475)|outer medullary collecting duct development (GO:0072060)|oxygen homeostasis (GO:0032364)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of JNK cascade (GO:0046330)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of cell projection size (GO:0032536)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|response to glucocorticoid (GO:0051384)|smooth muscle cell differentiation (GO:0051145)|stem cell proliferation (GO:0072089)|synapse organization (GO:0050808)|trachea cartilage morphogenesis (GO:0060535)|Wnt signaling pathway (GO:0016055)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)			endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	19		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)|LUAD - Lung adenocarcinoma(64;0.247)		TACCTACTCGGAGCTCTTGCC	0.652																																																	0								ENSG00000188064						30.0	28.0	29.0					22																	46345807		2203	4300	6503	WNT7B	SO:0001819	synonymous_variant	0			-	HGNC	AF416743	CCDS33667.1	22q13	2013-02-28			ENSG00000188064	ENSG00000188064		"""Wingless-type MMTV integration sites"", ""Endogenous ligands"""	12787	protein-coding gene	gene with protein product		601967				8168088, 9284940, 11562755	Standard	NM_058238		Approved		uc003bgo.2	P56706	OTTHUMG00000154636	ENST00000339464.4:c.291C>T	22.37:g.46345807G>A		Somatic	0	47	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	14	26.32	B8A596|Q96Q12	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Wnt,smart_Wnt,prints_Wnt,prints_Wnt7	p.L97	ENST00000339464.4	37	c.291	CCDS33667.1	22																																																																																			-	pfam_Wnt,smart_Wnt		0.652	WNT7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WNT7B	protein_coding	OTTHUMT00000336418.1	G	NM_058238	-		46345807	-1	no_errors	ENST00000339464	ensembl	human	known	74_37	silent	SNP	1.000	A
SLC22A10	387775	genome.wustl.edu	37	11	63057946	63057946	+	Silent	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr11:63057946G>A	ENST00000332793.6	+	1	311	c.309G>A	c.(307-309)ggG>ggA	p.G103G	SLC22A10_ENST00000544661.1_5'UTR|SLC22A10_ENST00000535888.1_Intron|SLC22A10_ENST00000525620.1_Intron|SLC22A10_ENST00000526800.1_Silent_p.G51G	NM_001039752.3	NP_001034841.3	Q63ZE4	S22AA_HUMAN	solute carrier family 22, member 10	103						integral component of membrane (GO:0016021)	transmembrane transporter activity (GO:0022857)			breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28					Conjugated Estrogens(DB00286)|Probenecid(DB01032)|Salicylic acid(DB00936)	ACCTGAATGGGACTATCCACA	0.498																																																	0								ENSG00000184999						96.0	101.0	99.0					11																	63057946		2201	4298	6499	SLC22A10	SO:0001819	synonymous_variant	0			-	HGNC	AP003420	CCDS41661.1	11q12.3	2013-05-22	2008-01-11		ENSG00000184999	ENSG00000184999		"""Solute carriers"""	18057	protein-coding gene	gene with protein product		607580	"""solute carrier family 22 (organic anion/cation transporter), member 10"""			11327718	Standard	NM_001039752		Approved	OAT5, hOAT5	uc009yor.3	Q63ZE4	OTTHUMG00000165197	ENST00000332793.6:c.309G>A	11.37:g.63057946G>A		Somatic	0	64	0.00		0.41568620468393047	0	100.00	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	26	27.78	Q68CJ0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.G103	ENST00000332793.6	37	c.309	CCDS41661.1	11																																																																																			-	NULL		0.498	SLC22A10-004	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC22A10	protein_coding	OTTHUMT00000382622.3	G	NM_001039752	-		63057946	+1	no_errors	ENST00000332793	ensembl	human	known	74_37	silent	SNP	0.000	A
HLA-DOA	3111	genome.wustl.edu	37	6	32975875	32975875	+	Silent	SNP	C	C	T	rs550573091		TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr6:32975875C>T	ENST00000229829.5	-	2	321	c.246G>A	c.(244-246)ccG>ccA	p.P82P	HLA-DOA_ENST00000450833.2_Silent_p.P52P|HLA-DOA_ENST00000495532.1_5'UTR	NM_002119.3	NP_002110.1	P06340	DOA_HUMAN	major histocompatibility complex, class II, DO alpha	82	Alpha-1.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|immune response (GO:0006955)|negative regulation of antigen processing and presentation of peptide antigen via MHC class II (GO:0002587)|regulation of T cell differentiation (GO:0045580)|signal transduction (GO:0007165)	endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)	MHC class II protein complex binding (GO:0023026)|MHC class II receptor activity (GO:0032395)			NS(1)|breast(1)|central_nervous_system(1)|large_intestine(2)|lung(3)|prostate(1)	9						GCCCGCCCTGCGGGTCAAAGC	0.607													C|||	1	0.000199681	0.0008	0.0	5008	,	,		16508	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000204252						50.0	50.0	50.0					6																	32975875		1511	2709	4220	HLA-DOA	SO:0001819	synonymous_variant	0			-	HGNC	M31525	CCDS4763.1	6p21.3	2013-01-11		2001-10-05	ENSG00000204252	ENSG00000204252		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4936	protein-coding gene	gene with protein product		142930		HLA-DZA, HLA-DNA		2370084	Standard	XM_005272804		Approved	HLA-D0-alpha	uc003ocr.3	P06340	OTTHUMG00000031211	ENST00000229829.5:c.246G>A	6.37:g.32975875C>T		Somatic	0	103	0.00		0.41568620468393047	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	40	33.33	Q58HU0|Q58HU1|Q5STC7|Q9TQC6|Q9TQC7|Q9TQC8|Q9TQC9|Q9TQD0|Q9TQD1|Q9TQD2|Q9TQD3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_MHC_II_a_N,pfam_Ig_C1-set,pfam_CD80_C2-set,superfamily_MHC_I/II-like_Ag-recog,smart_MHC_II_a_N,smart_Ig_C1-set,pfscan_Ig-like_dom	p.P82	ENST00000229829.5	37	c.246	CCDS4763.1	6																																																																																			-	pfam_MHC_II_a_N,superfamily_MHC_I/II-like_Ag-recog,smart_MHC_II_a_N		0.607	HLA-DOA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLA-DOA	protein_coding	OTTHUMT00000076426.2	C	NM_002119	-		32975875	-1	no_errors	ENST00000229829	ensembl	human	known	74_37	silent	SNP	0.123	T
LEO1	123169	genome.wustl.edu	37	15	52246731	52246731	+	Frame_Shift_Del	DEL	T	T	-			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr15:52246731delT	ENST00000299601.5	-	7	1347	c.1287delA	c.(1285-1287)gaafs	p.E429fs	LEO1_ENST00000315141.5_Intron	NM_138792.2	NP_620147.1	Q8WVC0	LEO1_HUMAN	Leo1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)	429					endodermal cell fate commitment (GO:0001711)|histone H2B ubiquitination (GO:0033523)|histone monoubiquitination (GO:0010390)|mRNA polyadenylation (GO:0006378)|negative regulation of myeloid cell differentiation (GO:0045638)|positive regulation of mRNA 3'-end processing (GO:0031442)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	Cdc73/Paf1 complex (GO:0016593)				endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(5)|skin(1)	14				all cancers(107;0.00264)		TTTCATTTCCTTCTTCATCTC	0.388																																					Esophageal Squamous(40;229 896 18505 32465 43844)|Ovarian(53;886 1123 14462 18432 23189)												0								ENSG00000166477						236.0	203.0	214.0					15																	52246731		2195	4293	6488	LEO1	SO:0001589	frameshift_variant	0				HGNC	AY302186	CCDS10146.1, CCDS66767.1	15q21.2	2008-02-05			ENSG00000166477	ENSG00000166477			30401	protein-coding gene	gene with protein product		610507				15632063	Standard	NM_001286430		Approved		uc002abo.3	Q8WVC0	OTTHUMG00000131843	ENST00000299601.5:c.1287delA	15.37:g.52246731delT	ENSP00000299601:p.Glu429fs	Somatic	0	42	0.00		0.41568620468393047	69	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	23	14.81	Q96N99	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Leo1	p.G430fs	ENST00000299601.5	37	c.1287	CCDS10146.1	15																																																																																			-	pfam_Leo1		0.388	LEO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LEO1	protein_coding	OTTHUMT00000254791.2	T	NM_138792			52246731	-1	no_errors	ENST00000299601	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
CDR1	1038	genome.wustl.edu	37	X	139866052	139866052	+	Silent	SNP	G	G	A	rs146276960		TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chrX:139866052G>A	ENST00000370532.2	-	1	671	c.480C>T	c.(478-480)tcC>tcT	p.S160S		NM_004065.2	NP_004056.2	P51861	CDR1_HUMAN	cerebellar degeneration-related protein 1, 34kDa	160	6 X 6 AA approximate repeats.							p.S160S(1)		breast(1)|endometrium(3)|large_intestine(3)|lung(11)|prostate(2)|skin(4)|urinary_tract(1)	25	Acute lymphoblastic leukemia(192;7.65e-05)	Lung SC(4;0.051)				CAAGTCTTCCGGATAATTTGG	0.443													G|||	1	0.000264901	0.0	0.0	3775	,	,		15094	0.0		0.0	False		,,,				2504	0.001																1	Substitution - coding silent(1)	large_intestine(1)						ENSG00000184258	G		1,3832		0,1,1630,571	134.0	140.0	138.0		480	-7.0	0.0	X	dbSNP_134	138	1,6727		0,1,2427,1872	no	coding-synonymous	CDR1	NM_004065.2		0,2,4057,2443	AA,AG,GG,G		0.0149,0.0261,0.0189		160/263	139866052	2,10559	2202	4300	6502	CDR1	SO:0001819	synonymous_variant	0			-	HGNC		CCDS14670.1	Xq27.1	2013-06-13	2002-08-29		ENSG00000184258	ENSG00000184258			1798	protein-coding gene	gene with protein product	"""Cerebellar degeneration-related protein-1 (34kD)"""	302650	"""cerebellar degeneration-related protein (34kD)"""	CDR		2326268	Standard	NM_004065		Approved	CDR62A, CDR34	uc004fbg.1	P51861	OTTHUMG00000137398	ENST00000370532.2:c.480C>T	X.37:g.139866052G>A		Somatic	0	55	0.00		0.41568620468393047	3	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	26	43.48	Q5JXH6	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.S160	ENST00000370532.2	37	c.480	CCDS14670.1	X																																																																																			-	NULL		0.443	CDR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDR1	protein_coding	OTTHUMT00000058583.1	G	NM_004065	rs146276960		139866052	-1	no_errors	ENST00000370532	ensembl	human	known	74_37	silent	SNP	0.000	A
PAX4	5078	genome.wustl.edu	37	7	127255454	127255454	+	Splice_Site	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr7:127255454C>T	ENST00000341640.2	-	1	326		c.e1+1		PAX4_ENST00000378740.2_Splice_Site|PAX4_ENST00000338516.3_Splice_Site|PAX4_ENST00000463946.1_5'UTR	NM_006193.2	NP_006184.2	O43316	PAX4_HUMAN	paired box 4						cell differentiation (GO:0030154)|circadian rhythm (GO:0007623)|endocrine pancreas development (GO:0031018)|negative regulation of apoptotic process (GO:0043066)|organ morphogenesis (GO:0009887)|positive regulation of cell differentiation (GO:0045597)|response to cAMP (GO:0051591)|response to drug (GO:0042493)|retina development in camera-type eye (GO:0060041)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001206)			cervix(1)|kidney(2)|large_intestine(6)|lung(20)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	35						TGGCCCATTACCTTAAGGATC	0.592																																					Ovarian(113;737 1605 7858 27720 34092)												0								ENSG00000106331						81.0	82.0	81.0					7																	127255454		2203	4300	6503	PAX4	SO:0001630	splice_region_variant	0			-	HGNC		CCDS5797.1	7q32.1	2011-06-20	2007-07-12		ENSG00000106331	ENSG00000106331		"""Paired boxes"", ""Homeoboxes / PRD class"""	8618	protein-coding gene	gene with protein product		167413	"""paired box gene 4"""				Standard	NM_006193		Approved	MODY9	uc010lld.1	O43316	OTTHUMG00000157562	ENST00000341640.2:c.120+1G>A	7.37:g.127255454C>T		Somatic	0	58	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	32	30.43	O95161|Q6B0H0	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e1+1	ENST00000341640.2	37	c.120+1	CCDS5797.1	7	.	.	.	.	.	.	.	.	.	.	C	19.27	3.795384	0.70452	.	.	ENSG00000106331	ENST00000341640;ENST00000338516;ENST00000378740	.	.	.	5.73	5.73	0.89815	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.4002	0.87458	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PAX4	127042690	1.000000	0.71417	1.000000	0.80357	0.730000	0.41778	7.381000	0.79718	2.693000	0.91896	0.655000	0.94253	.	-	-		0.592	PAX4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PAX4	protein_coding	OTTHUMT00000349165.1	C		-	Intron	127255454	-1	no_errors	ENST00000341640	ensembl	human	known	74_37	splice_site	SNP	1.000	T
GDAP2	54834	genome.wustl.edu	37	1	118462869	118462869	+	Nonsense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr1:118462869G>A	ENST00000369443.5	-	2	361	c.112C>T	c.(112-114)Cag>Tag	p.Q38*	GDAP2_ENST00000369442.3_Nonsense_Mutation_p.Q38*	NM_017686.3	NP_060156.1	Q9NXN4	GDAP2_HUMAN	ganglioside induced differentiation associated protein 2	38					response to retinoic acid (GO:0032526)	lysosomal membrane (GO:0005765)				kidney(2)|large_intestine(3)|lung(9)|ovary(2)	16		all_cancers(81;0.0156)|all_lung(203;5.81e-05)|Lung NSC(69;0.000446)|all_epithelial(167;0.00295)		Lung(183;0.0583)|LUSC - Lung squamous cell carcinoma(189;0.194)		GTGTCTTCCTGAAATATTTCA	0.383																																																	0								ENSG00000196505						101.0	100.0	100.0					1																	118462869		2203	4300	6503	GDAP2	SO:0001587	stop_gained	0			-	HGNC	AK000149	CCDS897.1, CCDS44201.1	1q11	2011-10-20			ENSG00000196505	ENSG00000196505			18010	protein-coding gene	gene with protein product						1021725	Standard	NM_017686		Approved	FLJ20142, dJ776P7.1, MACROD3	uc001ehf.3	Q9NXN4	OTTHUMG00000012199	ENST00000369443.5:c.112C>T	1.37:g.118462869G>A	ENSP00000358451:p.Gln38*	Somatic	0	72	0.00		0.41568620468393047	1	50.00	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	36	21.74	Q96DZ0	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Macro_dom,superfamily_CRAL-TRIO_dom,smart_Macro_dom,smart_CRAL-TRIO_dom,pfscan_Macro_dom	p.Q38*	ENST00000369443.5	37	c.112	CCDS897.1	1	.	.	.	.	.	.	.	.	.	.	G	37	6.594304	0.97692	.	.	ENSG00000196505	ENST00000369443;ENST00000369442	.	.	.	5.22	4.31	0.51392	.	0.567613	0.18439	N	0.141193	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06494	T	0.89	0.5343	14.0861	0.64957	0.0722:0.0:0.9278:0.0	.	.	.	.	X	38	.	ENSP00000358450:Q38X	Q	-	1	0	GDAP2	118264392	1.000000	0.71417	0.122000	0.21767	0.868000	0.49771	7.431000	0.80335	1.572000	0.49736	0.650000	0.86243	CAG	-	NULL		0.383	GDAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GDAP2	protein_coding	OTTHUMT00000033732.2	G	NM_017686	-		118462869	-1	no_errors	ENST00000369443	ensembl	human	known	74_37	nonsense	SNP	0.851	A
USP5	8078	genome.wustl.edu	37	12	6973341	6973341	+	Silent	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr12:6973341G>A	ENST00000229268.8	+	17	2278	c.2226G>A	c.(2224-2226)ttG>ttA	p.L742L	USP5_ENST00000389231.5_Silent_p.L719L|TPI1_ENST00000229270.4_5'Flank	NM_001098536.1	NP_001092006.1	P45974	UBP5_HUMAN	ubiquitin specific peptidase 5 (isopeptidase T)	742	UBA 2. {ECO:0000255|PROSITE- ProRule:PRU00212}.|USP.				positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)	lysosome (GO:0005764)	cysteine-type endopeptidase activity (GO:0004197)|omega peptidase activity (GO:0008242)|ubiquitin thiolesterase activity (GO:0004221)|zinc ion binding (GO:0008270)			breast(6)|endometrium(4)|kidney(2)|large_intestine(6)|lung(14)|skin(2)|urinary_tract(2)	36						ACCAGGCCTTGAAAGCGCTGC	0.647																																																	0								ENSG00000111667						52.0	55.0	54.0					12																	6973341		2203	4300	6503	USP5	SO:0001819	synonymous_variant	0			-	HGNC	U35116	CCDS31733.1, CCDS41743.1	12p13	2007-03-02	2005-08-08		ENSG00000111667	ENSG00000111667		"""Ubiquitin-specific peptidases"""	12628	protein-coding gene	gene with protein product		601447	"""ubiquitin specific protease 5 (isopeptidase T)"""			12838346, 8723724	Standard	NM_003481		Approved	IsoT	uc001qri.4	P45974	OTTHUMG00000169233	ENST00000229268.8:c.2226G>A	12.37:g.6973341G>A		Somatic	0	49	0.00		0.41568620468393047	173	13.50	27	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	27	22.86	D3DUS7|D3DUS8|Q96J22	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_C19/C67,pfam_UBA/Ts_N,pfam_Znf_UBP,superfamily_UBA-like,smart_Znf_UBP,smart_UBA/transl_elong_EF1B_N_euk,pirsf_Ubiquitinyl_hydrolase,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Znf_UBP,pfscan_Peptidase_C19/C67	p.L742	ENST00000229268.8	37	c.2226	CCDS41743.1	12																																																																																			-	pfam_Peptidase_C19/C67,pfam_UBA/Ts_N,superfamily_UBA-like,smart_UBA/transl_elong_EF1B_N_euk,pirsf_Ubiquitinyl_hydrolase,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Peptidase_C19/C67		0.647	USP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP5	protein_coding	OTTHUMT00000402982.1	G		-		6973341	+1	no_errors	ENST00000229268	ensembl	human	known	74_37	silent	SNP	1.000	A
POLR3GL	84265	genome.wustl.edu	37	1	145457040	145457042	+	In_Frame_Del	DEL	TCT	TCT	-	rs587765256		TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	TCT	TCT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr1:145457040_145457042delTCT	ENST00000369314.1	-	7	625_627	c.519_521delAGA	c.(517-522)gaagag>gag	p.173_174EE>E	POLR3GL_ENST00000369313.3_In_Frame_Del_p.150_151EE>E	NM_032305.1	NP_115681.1	Q9BT43	RPC7L_HUMAN	polymerase (RNA) III (DNA directed) polypeptide G (32kD)-like	173	Glu-rich.				gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase III promoter (GO:0006384)	cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)				endometrium(2)|large_intestine(1)|lung(1)	4	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					ctcttccttctcttcttcttctt	0.448																																																	0								ENSG00000121851																																			POLR3GL	SO:0001651	inframe_deletion	0				HGNC	BC004355	CCDS72875.1	1q21.1	2008-02-05	2006-12-14		ENSG00000121851	ENSG00000121851			28466	protein-coding gene	gene with protein product			"""polymerase (RNA) III (DNA directed) polypeptide G (32kD) like"""			12477932	Standard	NM_032305		Approved	flj32422, MGC3200	uc001enp.1	Q9BT43	OTTHUMG00000013739	ENST00000369314.1:c.519_521delAGA	1.37:g.145457049_145457051delTCT	ENSP00000358320:p.Glu174del	Somatic	0	62	0.00		0.41568620468393047	522	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	28	9.68	B1MVG5	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_RNA_pol_III_Rpc31	p.E174in_frame_del	ENST00000369314.1	37	c.521_519	CCDS914.1	1																																																																																			-	pfam_RNA_pol_III_Rpc31		0.448	POLR3GL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR3GL	protein_coding	OTTHUMT00000038510.1	TCT	NM_032305			145457042	-1	no_errors	ENST00000369314	ensembl	human	known	74_37	in_frame_del	DEL	1.000:1.000:1.000	-
TGFBR2	7048	genome.wustl.edu	37	3	30713642	30713642	+	Silent	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr3:30713642C>T	ENST00000295754.5	+	4	1349	c.967C>T	c.(967-969)Ctg>Ttg	p.L323L	TGFBR2_ENST00000359013.4_Silent_p.L348L	NM_003242.5	NP_003233.4	P37173	TGFR2_HUMAN	transforming growth factor, beta receptor II (70/80kDa)	323	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of protein kinase activity (GO:0032147)|aging (GO:0007568)|apoptotic process (GO:0006915)|blood vessel development (GO:0001568)|brain development (GO:0007420)|bronchus morphogenesis (GO:0060434)|cartilage development (GO:0051216)|common-partner SMAD protein phosphorylation (GO:0007182)|digestive tract development (GO:0048565)|embryo implantation (GO:0007566)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic hemopoiesis (GO:0035162)|gastrulation (GO:0007369)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|lens development in camera-type eye (GO:0002088)|lens fiber cell apoptotic process (GO:1990086)|lung lobe morphogenesis (GO:0060463)|mammary gland morphogenesis (GO:0060443)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|organ regeneration (GO:0031100)|palate development (GO:0060021)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|patterning of blood vessels (GO:0001569)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of angiogenesis (GO:0045766)|positive regulation of B cell tolerance induction (GO:0002663)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of NK T cell differentiation (GO:0051138)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of skeletal muscle tissue regeneration (GO:0043415)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of T cell tolerance induction (GO:0002666)|positive regulation of tolerance induction to self antigen (GO:0002651)|protein phosphorylation (GO:0006468)|receptor-mediated endocytosis (GO:0006898)|regulation of cell proliferation (GO:0042127)|response to cholesterol (GO:0070723)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to glucose (GO:0009749)|response to mechanical stimulus (GO:0009612)|response to nutrient (GO:0007584)|smoothened signaling pathway (GO:0007224)|trachea formation (GO:0060440)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vasculogenesis (GO:0001570)|wound healing (GO:0042060)	caveola (GO:0005901)|cytosol (GO:0005829)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|transforming growth factor beta receptor homodimeric complex (GO:0070022)	ATP binding (GO:0005524)|glycosaminoglycan binding (GO:0005539)|metal ion binding (GO:0046872)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type II (GO:0005026)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)|type I transforming growth factor beta receptor binding (GO:0034713)|type III transforming growth factor beta receptor binding (GO:0034714)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(15)|lung(10)|ovary(3)|pancreas(12)|skin(1)|stomach(5)|upper_aerodigestive_tract(2)	53						ACAATACTGGCTGATCACCGC	0.572																																																	0								ENSG00000163513						92.0	81.0	85.0					3																	30713642		2203	4300	6503	TGFBR2	SO:0001819	synonymous_variant	0			-	HGNC		CCDS2648.1, CCDS33727.1	3p22	2014-09-17	2002-08-29		ENSG00000163513	ENSG00000163513			11773	protein-coding gene	gene with protein product		190182	"""transforming growth factor, beta receptor II (70-80kD)"""	MFS2		1319842, 15235604	Standard	NM_001024847		Approved		uc003cen.3	P37173	OTTHUMG00000130569	ENST00000295754.5:c.967C>T	3.37:g.30713642C>T		Somatic	0	42	0.00		0.41568620468393047	47	2.04	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	30	14.29	B4DTV5|Q15580|Q6DKT6|Q99474	Silent	SNP	NA	NA	NA	NA	NA	NA	pirsf_Transform_growth_fac-b_typ-2,pfam_Transforming_GF_b_rcpt_2_ecto,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_TGFB_receptor,pfscan_Prot_kinase_dom	p.L348	ENST00000295754.5	37	c.1042	CCDS2648.1	3																																																																																			-	pirsf_Transform_growth_fac-b_typ-2,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.572	TGFBR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGFBR2	protein_coding	OTTHUMT00000252994.2	C		-		30713642	+1	no_errors	ENST00000359013	ensembl	human	known	74_37	silent	SNP	1.000	T
WDFY4	57705	genome.wustl.edu	37	10	50098736	50098736	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr10:50098736C>T	ENST00000325239.5	+	43	7307	c.7280C>T	c.(7279-7281)aCg>aTg	p.T2427M	WDFY4_ENST00000413659.2_3'UTR|RP11-523O18.7_ENST00000430438.1_RNA	NM_020945.1	NP_065996.1	Q6ZS81	WDFY4_HUMAN	WDFY family member 4	2427						integral component of membrane (GO:0016021)				NS(2)|breast(5)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(3)|pancreas(2)|prostate(5)|skin(6)|stomach(1)	48						CTGTCTCCCACGGGTGATGTC	0.542																																																	0								ENSG00000128815						113.0	88.0	95.0					10																	50098736		692	1591	2283	WDFY4	SO:0001583	missense	0			-	HGNC	AK074085	CCDS44385.1	10q11.23	2013-01-10			ENSG00000128815	ENSG00000128815		"""WD repeat domain containing"""	29323	protein-coding gene	gene with protein product		613316	"""chromosome 10 open reading frame 64"""	C10orf64		10997877	Standard	NM_020945		Approved	KIAA1607, Em:AC060234.3, FLJ45748	uc001jha.4	Q6ZS81	OTTHUMG00000018180	ENST00000325239.5:c.7280C>T	10.37:g.50098736C>T	ENSP00000320563:p.Thr2427Met	Somatic	0	53	0.00		0.41568620468393047	5	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	15	34.78	B9ZVP2|Q86WZ4|Q8N4A3|Q8TEN7|Q96BE1|Q9H7H8|Q9HCG5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.T2427M	ENST00000325239.5	37	c.7280	CCDS44385.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.17|11.17	1.558885|1.558885	0.27827|0.27827	.|.	.|.	ENSG00000128815|ENSG00000128815	ENST00000265453|ENST00000426033;ENST00000325239	.|T	.|0.56941	.|0.43	4.83|4.83	2.51|2.51	0.30379|0.30379	.|PH-BEACH domain (1);	.|1.230310	.|0.05550	.|N	.|0.567253	T|T	0.38134|0.38134	0.1029|0.1029	L|L	0.27053|0.27053	0.805|0.805	0.20074|0.20074	N|N	0.999933|0.999933	.|B	.|0.23806	.|0.091	.|B	.|0.19391	.|0.025	T|T	0.23547|0.23547	-1.0185|-1.0185	5|9	.|.	.|.	.|.	.|.	5.3719|5.3719	0.16144|0.16144	0.0:0.2447:0.0:0.7553|0.0:0.2447:0.0:0.7553	.|.	.|2427	.|Q6ZS81	.|WDFY4_HUMAN	W|M	514|2427	.|ENSP00000320563:T2427M	.|.	R|T	+|+	1|2	2|0	WDFY4|WDFY4	49768742|49768742	0.181000|0.181000	0.23161|0.23161	0.323000|0.323000	0.25347|0.25347	0.926000|0.926000	0.56050|0.56050	1.374000|1.374000	0.34283|0.34283	0.306000|0.306000	0.22856|0.22856	-0.367000|-0.367000	0.07326|0.07326	CGG|ACG	-	NULL		0.542	WDFY4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	WDFY4	protein_coding		C	XM_033379	-		50098736	+1	no_errors	ENST00000325239	ensembl	human	known	74_37	missense	SNP	0.279	T
WWC2	80014	genome.wustl.edu	37	4	184019229	184019229	+	5'Flank	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr4:184019229C>T	ENST00000403733.3	+	0	0				WWC2_ENST00000448232.2_5'Flank|WWC2-AS2_ENST00000578387.1_lincRNA|WWC2_ENST00000513834.1_5'Flank|WWC2_ENST00000378925.3_5'Flank	NM_024949.5	NP_079225.5	Q6AWC2	WWC2_HUMAN	WW and C2 domain containing 2						negative regulation of hippo signaling (GO:0035331)|negative regulation of organ growth (GO:0046621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	cytosol (GO:0005829)	kinase binding (GO:0019900)|protein complex scaffold (GO:0032947)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(15)|ovary(2)|prostate(1)|stomach(1)|urinary_tract(3)	32		all_lung(41;5.28e-14)|Lung NSC(41;1.35e-13)|Colorectal(36;0.00681)|Hepatocellular(41;0.00886)|Renal(120;0.00992)|Prostate(90;0.0237)|all_hematologic(60;0.0592)|Esophageal squamous(56;0.179)|all_neural(102;0.202)		all cancers(43;3.38e-24)|Epithelial(43;1.4e-20)|OV - Ovarian serous cystadenocarcinoma(60;1.09e-09)|GBM - Glioblastoma multiforme(59;3.33e-05)|Colorectal(24;3.58e-05)|STAD - Stomach adenocarcinoma(60;4.21e-05)|COAD - Colon adenocarcinoma(29;0.000171)|LUSC - Lung squamous cell carcinoma(40;0.0145)|READ - Rectum adenocarcinoma(43;0.242)		GGGAGGCGCCCCCTCTGACTG	0.662																																																	0								ENSG00000251359						26.0	33.0	31.0					4																	184019229		692	1591	2283	WWC2-AS2	SO:0001631	upstream_gene_variant	0			-	HGNC	BC017957	CCDS34109.2	4q35.1	2010-08-05	2006-11-09		ENSG00000151718	ENSG00000151718		"""WW, C2 and coiled-coil domain containing"""	24148	protein-coding gene	gene with protein product			"""WW, C2 and coiled-coil domain containing 2"""			12477932	Standard	NM_024949		Approved	BOMB, FLJ22029	uc010irx.3	Q6AWC2	OTTHUMG00000150685		4.37:g.184019229C>T	Exception_encountered	Somatic	0	59	0.00		0.41568620468393047	3	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	28	15.15	Q32Q84|Q69YQ1|Q6AWB8|Q6ZSY9|Q6ZU09|Q7Z620|Q8TEB8|Q9H6P0	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000403733.3	37	NULL	CCDS34109.2	4	.	.	.	.	.	.	.	.	.	.	C	4.797	0.148120	0.09134	.	.	ENSG00000251359	ENST00000506413	.	.	.	2.68	-5.37	0.02681	.	.	.	.	.	T	0.27098	0.0664	.	.	.	.	.	.	B	0.21606	0.058	B	0.19666	0.026	T	0.26155	-1.0111	6	0.87932	D	0	.	5.2871	0.15708	0.0:0.4578:0.3206:0.2216	.	171	Q96NR7	CD038_HUMAN	E	171	.	ENSP00000421843:G171E	G	-	2	0	C4orf38	184256223	0.000000	0.05858	0.000000	0.03702	0.018000	0.09664	-0.482000	0.06544	-1.466000	0.01897	-0.802000	0.03209	GGG	-	-		0.662	WWC2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	WWC2-AS2	protein_coding	OTTHUMT00000319608.1	C	NM_024949	-		184019229	-1	no_errors	ENST00000506413	ensembl	human	known	74_37	rna	SNP	0.000	T
MUC16	94025	genome.wustl.edu	37	19	9086552	9086552	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr19:9086552G>A	ENST00000397910.4	-	1	5466	c.5263C>T	c.(5263-5265)Cct>Tct	p.P1755S		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	1755	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GGAGTTGTAGGAGATGAGGTT	0.498																																																	0								ENSG00000181143						127.0	118.0	121.0					19																	9086552		1969	4157	6126	MUC16	SO:0001583	missense	0			-	HGNC	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.5263C>T	19.37:g.9086552G>A	ENSP00000381008:p.Pro1755Ser	Somatic	0	40	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	33	23.26	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.P1755S	ENST00000397910.4	37	c.5263	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	g	0.413	-0.912388	0.02415	.	.	ENSG00000181143	ENST00000397910	T	0.03124	4.04	1.33	-2.65	0.06095	.	.	.	.	.	T	0.01765	0.0056	N	0.08118	0	.	.	.	B	0.19817	0.039	B	0.14023	0.01	T	0.44787	-0.9305	8	0.87932	D	0	.	0.8391	0.01146	0.2293:0.3808:0.1943:0.1956	.	1755	B5ME49	.	S	1755	ENSP00000381008:P1755S	ENSP00000381008:P1755S	P	-	1	0	MUC16	8947552	0.000000	0.05858	0.000000	0.03702	0.043000	0.13939	-2.207000	0.01230	-2.224000	0.00725	0.313000	0.20887	CCT	-	NULL		0.498	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	protein_coding	OTTHUMT00000402806.1	G	NM_024690	-		9086552	-1	no_errors	ENST00000397910	ensembl	human	known	74_37	missense	SNP	0.000	A
TLE1	7088	genome.wustl.edu	37	9	84230928	84230928	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr9:84230928G>A	ENST00000376499.3	-	11	1951	c.887C>T	c.(886-888)tCc>tTc	p.S296F	TLE1_ENST00000376472.1_5'UTR|TLE1_ENST00000464999.1_Intron|TLE1_ENST00000376484.1_5'Flank	NM_005077.3	NP_005068.2	Q04724	TLE1_HUMAN	transducin-like enhancer of split 1 (E(sp1) homolog, Drosophila)	296	Pro/Ser-rich.				multicellular organismal development (GO:0007275)|negative regulation of anoikis (GO:2000811)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation of gene expression (GO:0010628)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|identical protein binding (GO:0042802)|RNA polymerase II transcription corepressor activity (GO:0001106)|transcription factor binding (GO:0008134)			NS(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	29						CAAAGAAGTGGAACTTGCCGA	0.483																																					NSCLC(155;1437 1995 30668 39354 45875)|Melanoma(16;266 781 14000 47728 51870)												0								ENSG00000196781						86.0	86.0	86.0					9																	84230928		2203	4300	6503	TLE1	SO:0001583	missense	0			-	HGNC		CCDS6661.1	9q21.32	2013-01-10	2001-11-28		ENSG00000196781	ENSG00000196781		"""WD repeat domain containing"""	11837	protein-coding gene	gene with protein product	"""enhancer of split groucho 1"""	600189	"""transducin-like enhancer of split 1, homolog of Drosophila E(sp1)"""			8365415, 8808280	Standard	NM_005077		Approved	ESG1, GRG1, ESG	uc004aly.3	Q04724	OTTHUMG00000021008	ENST00000376499.3:c.887C>T	9.37:g.84230928G>A	ENSP00000365682:p.Ser296Phe	Somatic	0	39	0.00		0.41568620468393047	6	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	24	17.24	A8K495|Q5T3G4|Q969V9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Groucho/TLE_N,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Groucho_enhance	p.S296F	ENST00000376499.3	37	c.887	CCDS6661.1	9	.	.	.	.	.	.	.	.	.	.	G	22.7	4.326086	0.81580	.	.	ENSG00000196781	ENST00000376499	T	0.48836	0.8	5.41	4.51	0.55191	.	0.000000	0.85682	D	0.000000	T	0.63792	0.2541	L	0.61218	1.895	0.80722	D	1	P;B;P;P	0.49862	0.86;0.349;0.929;0.577	P;B;P;B	0.60789	0.879;0.304;0.775;0.304	T	0.68557	-0.5377	10	0.87932	D	0	-8.7108	15.7589	0.78063	0.0:0.0:0.8628:0.1371	.	222;296;323;296	B4E345;B4DEF9;Q59EF7;Q04724	.;.;.;TLE1_HUMAN	F	296	ENSP00000365682:S296F	ENSP00000365682:S296F	S	-	2	0	TLE1	83420748	1.000000	0.71417	0.930000	0.37139	0.660000	0.38997	9.657000	0.98554	1.516000	0.48900	0.655000	0.94253	TCC	-	NULL		0.483	TLE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLE1	protein_coding	OTTHUMT00000055407.1	G	NM_005077	-		84230928	-1	no_errors	ENST00000376499	ensembl	human	known	74_37	missense	SNP	1.000	A
SENP7	57337	genome.wustl.edu	37	3	101083777	101083777	+	Missense_Mutation	SNP	C	C	G			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr3:101083777C>G	ENST00000394095.2	-	10	1430	c.1377G>C	c.(1375-1377)aaG>aaC	p.K459N	SENP7_ENST00000394094.2_Missense_Mutation_p.K394N|SENP7_ENST00000348610.3_Missense_Mutation_p.K426N|SENP7_ENST00000358203.3_Missense_Mutation_p.K295N|SENP7_ENST00000314261.7_Missense_Mutation_p.K393N|SENP7_ENST00000394091.1_Missense_Mutation_p.K295N	NM_001282802.1|NM_020654.3	NP_001269731.1|NP_065705.3	Q9BQF6	SENP7_HUMAN	SUMO1/sentrin specific peptidase 7	459						intracellular (GO:0005622)|nucleus (GO:0005634)	cysteine-type peptidase activity (GO:0008234)			breast(2)|endometrium(1)|kidney(1)|large_intestine(16)|lung(15)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44						TAGATTGTAACTTAAGAATTT	0.313																																																	0								ENSG00000138468						96.0	91.0	92.0					3																	101083777		2203	4296	6499	SENP7	SO:0001583	missense	0			-	HGNC		CCDS2941.2, CCDS43121.1, CCDS63704.1, CCDS63705.1, CCDS63706.1	3q12	2008-02-05	2005-08-17		ENSG00000138468	ENSG00000138468			30402	protein-coding gene	gene with protein product		612846	"""SUMO1/sentrin specific protease 7"""			11214970, 11230166	Standard	NM_001282802		Approved		uc003dut.3	Q9BQF6	OTTHUMG00000149927	ENST00000394095.2:c.1377G>C	3.37:g.101083777C>G	ENSP00000377655:p.Lys459Asn	Somatic	0	59	0.00		0.41568620468393047	5	16.67	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	19	29.63	A1L3A5|A8MW39|B7WNW8|Q7Z3F4|Q96PS5|Q9C0F6|Q9HBT5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_C48,pfscan_Peptidase_C48	p.K459N	ENST00000394095.2	37	c.1377	CCDS2941.2	3	.	.	.	.	.	.	.	.	.	.	C	7.077	0.569379	0.13560	.	.	ENSG00000138468	ENST00000394095;ENST00000394094;ENST00000314261;ENST00000394091;ENST00000358203;ENST00000348610	T;T;T;T;T;T	0.18657	2.2;2.22;2.22;2.21;2.21;2.2	5.57	-3.64	0.04515	.	0.506048	0.20347	N	0.094139	T	0.11750	0.0286	L	0.39633	1.23	0.26323	N	0.977638	B;B;B;B	0.20887	0.023;0.049;0.029;0.037	B;B;B;B	0.17433	0.018;0.008;0.012;0.011	T	0.30031	-0.9992	10	0.18710	T	0.47	-16.7391	6.5765	0.22569	0.1443:0.4252:0.0:0.4305	.	295;393;426;459	Q9BQF6-4;Q9BQF6-5;Q9BQF6-2;Q9BQF6	.;.;.;SENP7_HUMAN	N	459;394;393;295;295;426	ENSP00000377655:K459N;ENSP00000377654:K394N;ENSP00000313624:K393N;ENSP00000377651:K295N;ENSP00000350936:K295N;ENSP00000342159:K426N	ENSP00000313624:K393N	K	-	3	2	SENP7	102566467	0.980000	0.34600	0.907000	0.35723	0.666000	0.39218	-0.142000	0.10311	-0.401000	0.07644	-0.312000	0.09012	AAG	-	NULL		0.313	SENP7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SENP7	protein_coding	OTTHUMT00000313957.2	C	NM_020654	-		101083777	-1	no_errors	ENST00000394095	ensembl	human	known	74_37	missense	SNP	0.607	G
COL9A3	1299	genome.wustl.edu	37	20	61467646	61467646	+	Silent	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr20:61467646C>T	ENST00000343916.3	+	28	1512	c.1509C>T	c.(1507-1509)gtC>gtT	p.V503V	COL9A3_ENST00000462700.1_3'UTR	NM_001853.3	NP_001844.3	Q14050	CO9A3_HUMAN	collagen, type IX, alpha 3	503	Triple-helical region 3 (COL3).				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|female gonad development (GO:0008585)|male gonad development (GO:0008584)	collagen type IX trimer (GO:0005594)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(1)|endometrium(3)|large_intestine(1)|lung(18)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	28	Breast(26;5.68e-08)					TGCAGGGCGTCCCGGGTGTTC	0.657																																																	0								ENSG00000092758						32.0	41.0	38.0					20																	61467646		2201	4300	6501	COL9A3	SO:0001819	synonymous_variant	0			-	HGNC	AK075240	CCDS13505.1	20q13.3	2013-01-16			ENSG00000092758	ENSG00000092758		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2219	protein-coding gene	gene with protein product	"""collagen type IX proteoglycan"""	120270				8586434, 1429648	Standard	NM_001853		Approved	IDD, MED, EDM3, FLJ90759, DJ885L7.4.1	uc002ydm.3	Q14050	OTTHUMG00000032938	ENST00000343916.3:c.1509C>T	20.37:g.61467646C>T		Somatic	0	67	0.00		0.41568620468393047	3	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	28	31.71	Q13681|Q9H4G9|Q9UPE2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Collagen	p.V503	ENST00000343916.3	37	c.1509	CCDS13505.1	20																																																																																			-	pfam_Collagen		0.657	COL9A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL9A3	protein_coding	OTTHUMT00000080071.2	C	NM_001853	-		61467646	+1	no_errors	ENST00000343916	ensembl	human	known	74_37	silent	SNP	0.043	T
CLN3	1201	genome.wustl.edu	37	16	28497920	28497920	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr16:28497920G>A	ENST00000569430.1	-	9	1331	c.512C>T	c.(511-513)tCc>tTc	p.S171F	CLN3_ENST00000568224.1_Missense_Mutation_p.S93F|CLN3_ENST00000567963.1_Missense_Mutation_p.S171F|CLN3_ENST00000355477.5_Missense_Mutation_p.S171F|CLN3_ENST00000395653.4_Missense_Mutation_p.S71F|CLN3_ENST00000535392.1_Missense_Mutation_p.S93F|CLN3_ENST00000357857.9_Missense_Mutation_p.S117F|CLN3_ENST00000354630.5_Missense_Mutation_p.S171F|CLN3_ENST00000360019.2_Missense_Mutation_p.S171F|CLN3_ENST00000357076.5_Intron|CLN3_ENST00000357806.7_Intron|CLN3_ENST00000565316.1_Missense_Mutation_p.S171F|CLN3_ENST00000359984.7_Missense_Mutation_p.S171F|CLN3_ENST00000333496.9_Missense_Mutation_p.S147F			Q13286	CLN3_HUMAN	ceroid-lipofuscinosis, neuronal 3	171					action potential (GO:0001508)|amyloid precursor protein catabolic process (GO:0042987)|arginine transport (GO:0015809)|associative learning (GO:0008306)|autophagic vacuole fusion (GO:0000046)|cell death (GO:0008219)|cellular amino acid metabolic process (GO:0006520)|ceramide metabolic process (GO:0006672)|cytosolic calcium ion homeostasis (GO:0051480)|galactosylceramide metabolic process (GO:0006681)|globoside metabolic process (GO:0001575)|glucosylceramide metabolic process (GO:0006678)|ionotropic glutamate receptor signaling pathway (GO:0035235)|lysosomal lumen acidification (GO:0007042)|lysosomal lumen pH elevation (GO:0035752)|lysosome organization (GO:0007040)|macroautophagy (GO:0016236)|membrane organization (GO:0061024)|negative regulation of apoptotic process (GO:0043066)|negative regulation of catalytic activity (GO:0043086)|negative regulation of macroautophagy (GO:0016242)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of proteolysis (GO:0045861)|neuromuscular process controlling balance (GO:0050885)|neurotransmitter metabolic process (GO:0042133)|protein catabolic process (GO:0030163)|protein processing (GO:0016485)|receptor-mediated endocytosis (GO:0006898)|sphingomyelin metabolic process (GO:0006684)|vacuolar transport (GO:0007034)|vesicle transport along microtubule (GO:0047496)	autophagic vacuole (GO:0005776)|caveola (GO:0005901)|cytoplasm (GO:0005737)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|trans-Golgi network (GO:0005802)	unfolded protein binding (GO:0051082)			breast(1)|large_intestine(2)|lung(11)|upper_aerodigestive_tract(1)	15						GGCAGTGAGGGAGAGGAAGGT	0.592																																																	0								ENSG00000188603						86.0	65.0	72.0					16																	28497920		2196	4299	6495	CLN3	SO:0001583	missense	0			-	HGNC	U32680	CCDS10632.1, CCDS73852.1, CCDS73853.1, CCDS73854.1, CCDS73855.1	16p12	2014-09-17	2008-07-29		ENSG00000188603	ENSG00000188603			2074	protein-coding gene	gene with protein product	"""juvenile neuronal ceroid lipofuscinosis"""	607042	"""Batten, Spielmeyer-Vogt disease"""	BTS		18317235	Standard	NM_001042432		Approved	JNCL	uc002dpp.3	Q13286	OTTHUMG00000097024	ENST00000569430.1:c.512C>T	16.37:g.28497920G>A	ENSP00000454229:p.Ser171Phe	Somatic	0	71	0.00		0.41568620468393047	65	25.56	23	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	31	16.22	B2R7J1|O00668|O95089|Q549S9|Q9UP09|Q9UP11|Q9UP12|Q9UP13|Q9UP14	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Battenin_disease_Cln3,superfamily_MFS_dom_general_subst_transpt,pirsf_Battenin_disease_Cln3_subgr,prints_Battenin_disease_Cln3	p.S171F	ENST00000569430.1	37	c.512	CCDS10632.1	16	.	.	.	.	.	.	.	.	.	.	G	22.6	4.313632	0.81358	.	.	ENSG00000188603	ENST00000535392;ENST00000359984;ENST00000360019;ENST00000354630;ENST00000355477;ENST00000357857;ENST00000395653	T;T;T;T;T;T;T	0.60548	0.18;0.18;0.18;0.18;0.18;0.18;0.18	5.72	5.72	0.89469	Major facilitator superfamily domain, general substrate transporter (1);	0.221723	0.39687	N	0.001292	T	0.75932	0.3917	M	0.81942	2.565	0.80722	D	1	D;D;D;D;D;D;D;D;D	0.76494	0.999;0.997;0.984;0.999;0.999;0.997;0.999;0.996;0.998	D;D;P;D;D;D;D;D;D	0.76071	0.972;0.975;0.862;0.943;0.987;0.966;0.966;0.957;0.975	T	0.78234	-0.2283	10	0.66056	D	0.02	-8.2826	13.0166	0.58762	0.0:0.1618:0.8381:0.0	.	71;147;171;171;222;117;71;171;171	B4DFT5;B4DXL3;Q13286-3;Q13286-4;B4DIA8;O95086;B4DMY6;Q13286-2;Q13286	.;.;.;.;.;.;.;.;CLN3_HUMAN	F	93;171;171;171;171;117;71	ENSP00000443221:S93F;ENSP00000353073:S171F;ENSP00000353116:S171F;ENSP00000346650:S171F;ENSP00000347660:S171F;ENSP00000350523:S117F;ENSP00000379014:S71F	ENSP00000346650:S171F	S	-	2	0	CLN3	28405421	0.975000	0.34042	0.996000	0.52242	0.956000	0.61745	5.803000	0.69129	2.716000	0.92895	0.586000	0.80456	TCC	-	pfam_Battenin_disease_Cln3,superfamily_MFS_dom_general_subst_transpt,pirsf_Battenin_disease_Cln3_subgr,prints_Battenin_disease_Cln3		0.592	CLN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLN3	protein_coding	OTTHUMT00000214115.2	G		-		28497920	-1	no_errors	ENST00000359984	ensembl	human	known	74_37	missense	SNP	0.846	A
EXTL3	2137	genome.wustl.edu	37	8	28595072	28595072	+	Missense_Mutation	SNP	C	C	G	rs375444536		TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr8:28595072C>G	ENST00000220562.4	+	5	3215	c.2313C>G	c.(2311-2313)ttC>ttG	p.F771L	EXTL3_ENST00000519886.1_Intron|EXTL3_ENST00000523149.1_Missense_Mutation_p.F387L	NM_001440.2	NP_001431.1	O43909	EXTL3_HUMAN	exostosin-like glycosyltransferase 3	771					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|positive regulation of cell growth (GO:0030307)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)	glucuronyl-galactosyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity (GO:0001888)|metal ion binding (GO:0046872)			biliary_tract(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(8)|ovary(1)|prostate(2)|skin(2)|soft_tissue(1)|urinary_tract(1)	36		Ovarian(32;0.069)		KIRC - Kidney renal clear cell carcinoma(542;0.107)|Kidney(114;0.129)|Colorectal(74;0.228)		TCGTGGGCTTCCCTGGCCGTT	0.542																																																	0								ENSG00000012232						195.0	158.0	171.0					8																	28595072		2203	4300	6503	EXTL3	SO:0001583	missense	0			-	HGNC	U76188	CCDS6070.1	8p22-p12	2013-03-01	2013-03-01		ENSG00000012232	ENSG00000012232	2.4.1.223	"""Exostosin glycosyltransferase family"""	3518	protein-coding gene	gene with protein product	"""REG receptor"", ""glucuronyl-galactosyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase"""	605744	"""exostoses (multiple)-like 3"""			9479495, 9450183, 11257457	Standard	NM_001440		Approved	botv, REGR	uc003xgz.2	O43909	OTTHUMG00000102146	ENST00000220562.4:c.2313C>G	8.37:g.28595072C>G	ENSP00000220562:p.Phe771Leu	Somatic	0	111	0.00		0.41568620468393047	21	43.24	16	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	87	18.69	D3DST8|O00225|Q53XT3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_HexNAc_Trfase_a,pfam_Exostosin	p.F771L	ENST00000220562.4	37	c.2313	CCDS6070.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.84|15.84	2.953181|2.953181	0.53293|0.53293	.|.	.|.	ENSG00000012232|ENSG00000012232	ENST00000523149;ENST00000220562;ENST00000521532;ENST00000517738|ENST00000521473	D;D;D;D|.	0.87256|.	-2.23;-2.23;-2.23;-2.23|.	5.18|5.18	2.2|2.2	0.27929|0.27929	EXTL2, alpha-1,4-N-acetylhexosaminyltransferase (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.63977|0.63977	0.2557|0.2557	M|M	0.72624|0.72624	2.21|2.21	0.80722|0.80722	D|D	1|1	P|.	0.40431|.	0.717|.	P|.	0.49853|.	0.624|.	T|T	0.61520|0.61520	-0.7046|-0.7046	10|5	0.62326|.	D|.	0.03|.	-27.5837|-27.5837	9.0632|9.0632	0.36447|0.36447	0.0:0.6792:0.0:0.3208|0.0:0.6792:0.0:0.3208	.|.	771|.	O43909|.	EXTL3_HUMAN|.	L|A	387;771;69;17|105	ENSP00000428691:F387L;ENSP00000220562:F771L;ENSP00000431013:F69L;ENSP00000430652:F17L|.	ENSP00000220562:F771L|.	F|P	+|+	3|1	2|0	EXTL3|EXTL3	28650991|28650991	0.997000|0.997000	0.39634|0.39634	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	0.567000|0.567000	0.23608|0.23608	0.763000|0.763000	0.33175|0.33175	0.650000|0.650000	0.86243|0.86243	TTC|CCC	-	pfam_HexNAc_Trfase_a		0.542	EXTL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EXTL3	protein_coding	OTTHUMT00000219987.3	C	NM_001440	-		28595072	+1	no_errors	ENST00000220562	ensembl	human	known	74_37	missense	SNP	1.000	G
ZBBX	79740	genome.wustl.edu	37	3	167000220	167000220	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr3:167000220G>A	ENST00000392766.2	-	19	2283	c.1943C>T	c.(1942-1944)tCc>tTc	p.S648F	ZBBX_ENST00000455345.2_Missense_Mutation_p.S687F|ZBBX_ENST00000307529.5_Missense_Mutation_p.S687F|ZBBX_ENST00000392764.1_Missense_Mutation_p.S619F|ZBBX_ENST00000392767.2_Missense_Mutation_p.S648F	NM_001199201.1|NM_024687.3	NP_001186130.1|NP_078963.2	A8MT70	ZBBX_HUMAN	zinc finger, B-box domain containing	648	Ser-rich.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(5)|kidney(5)|large_intestine(9)|liver(1)|lung(38)|ovary(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	70						AAGGCAACTGGAGCTTTCTTT	0.338																																																	0								ENSG00000169064						141.0	136.0	138.0					3																	167000220		1838	4076	5914	ZBBX	SO:0001583	missense	0			-	HGNC	AK026702	CCDS3199.2, CCDS56295.1, CCDS56296.1	3q26.1	2010-03-23			ENSG00000169064	ENSG00000169064			26245	protein-coding gene	gene with protein product						12477932	Standard	NM_024687		Approved	FLJ23049	uc011bpc.2	A8MT70	OTTHUMG00000133560	ENST00000392766.2:c.1943C>T	3.37:g.167000220G>A	ENSP00000376519:p.Ser648Phe	Somatic	0	76	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	31	24.39	A8MV69|B3KSC1|B5MDJ6|F2Z370|Q9H5T8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_B-box	p.S687F	ENST00000392766.2	37	c.2060	CCDS3199.2	3	.	.	.	.	.	.	.	.	.	.	G	8.966	0.971742	0.18736	.	.	ENSG00000169064	ENST00000392766;ENST00000392767;ENST00000455345;ENST00000307529;ENST00000392764	T;T;T;T;T	0.13089	2.8;2.8;2.8;2.8;2.62	5.28	4.35	0.52113	.	0.155915	0.41605	D	0.000856	T	0.25195	0.0612	L	0.48642	1.525	0.09310	N	1	D;P	0.55385	0.971;0.952	P;P	0.60473	0.875;0.753	T	0.01805	-1.1270	10	0.87932	D	0	-0.8455	11.0602	0.47942	0.0:0.1874:0.8126:0.0	.	687;648	A8MT70-2;A8MT70	.;ZBBX_HUMAN	F	648;648;687;687;619	ENSP00000376519:S648F;ENSP00000376520:S648F;ENSP00000390232:S687F;ENSP00000305065:S687F;ENSP00000376517:S619F	ENSP00000305065:S687F	S	-	2	0	ZBBX	168482914	0.044000	0.20184	0.054000	0.19295	0.021000	0.10359	1.356000	0.34079	2.463000	0.83235	0.650000	0.86243	TCC	-	NULL		0.338	ZBBX-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZBBX	protein_coding	OTTHUMT00000257657.3	G	NM_024687	-		167000220	-1	no_errors	ENST00000307529	ensembl	human	known	74_37	missense	SNP	0.006	A
PARP8	79668	genome.wustl.edu	37	5	50137955	50137955	+	3'UTR	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr5:50137955G>A	ENST00000281631.5	+	0	2776				PARP8_ENST00000503750.2_3'UTR|PARP8_ENST00000514067.2_3'UTR|PARP8_ENST00000511363.2_3'UTR|PARP8_ENST00000505554.1_3'UTR	NM_001178056.1|NM_024615.3	NP_001171527.1|NP_078891.2	Q8N3A8	PARP8_HUMAN	poly (ADP-ribose) polymerase family, member 8							intracellular (GO:0005622)	NAD+ ADP-ribosyltransferase activity (GO:0003950)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(10)|lung(23)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Lung NSC(810;0.0305)|Breast(144;0.222)				GTTCAAAGCTGGATTTTGAAC	0.308																																																	0								ENSG00000151883																																			PARP8	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AL834477	CCDS3954.1, CCDS54849.1	5q11.2	2010-02-16			ENSG00000151883	ENSG00000151883		"""Poly (ADP-ribose) polymerases"""	26124	protein-coding gene	gene with protein product						15273990	Standard	NM_001178055		Approved	FLJ21308, pART16	uc003joo.3	Q8N3A8	OTTHUMG00000096969	ENST00000281631.5:c.*53G>A	5.37:g.50137955G>A		Somatic	0	153	0.00		0.41568620468393047	4	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	80	8.05	Q3KRB7|Q6DHZ1|Q9H754	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000281631.5	37	NULL	CCDS3954.1	5																																																																																			-	-		0.308	PARP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARP8	protein_coding	OTTHUMT00000214035.3	G	NM_024615	-		50137955	+1	no_errors	ENST00000503561	ensembl	human	known	74_37	rna	SNP	1.000	A
ZNF613	79898	genome.wustl.edu	37	19	52443921	52443921	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr19:52443921C>T	ENST00000293471.6	+	5	873	c.194C>T	c.(193-195)cCa>cTa	p.P65L	ZNF613_ENST00000391794.4_Missense_Mutation_p.P29L	NM_001031721.3	NP_001026891.2	Q6PF04	ZN613_HUMAN	zinc finger protein 613	65	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|skin(1)|urinary_tract(1)	19		all_neural(266;0.117)		GBM - Glioblastoma multiforme(134;0.00148)|OV - Ovarian serous cystadenocarcinoma(262;0.0183)		CAAGGAGAGCCATGGACAGTA	0.463																																																	0								ENSG00000176024						135.0	114.0	121.0					19																	52443921		2203	4300	6503	ZNF613	SO:0001583	missense	0			-	HGNC	AK027565	CCDS12844.1, CCDS33089.1	19q13.41	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	25827	protein-coding gene	gene with protein product						12477932	Standard	NM_001031721		Approved	FLJ13590	uc002pxz.2	Q6PF04		ENST00000293471.6:c.194C>T	19.37:g.52443921C>T	ENSP00000293471:p.Pro65Leu	Somatic	0	53	0.00		0.41568620468393047	6	25.00	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	35	14.63	Q96SS9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.P65L	ENST00000293471.6	37	c.194	CCDS33089.1	19	.	.	.	.	.	.	.	.	.	.	C	8.236	0.805693	0.16467	.	.	ENSG00000176024	ENST00000293471;ENST00000391794	T;T	0.08458	3.17;3.09	2.78	-3.34	0.04943	Krueppel-associated box (2);	3.297840	0.01124	N	0.005844	T	0.08758	0.0217	L	0.49513	1.565	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.35226	-0.9797	10	0.42905	T	0.14	.	4.1519	0.10242	0.0:0.3505:0.1819:0.4676	.	65	Q6PF04	ZN613_HUMAN	L	65;29	ENSP00000293471:P65L;ENSP00000375671:P29L	ENSP00000293471:P65L	P	+	2	0	ZNF613	57135733	0.000000	0.05858	0.000000	0.03702	0.094000	0.18550	-1.291000	0.02775	-0.672000	0.05266	-0.253000	0.11424	CCA	-	smart_Krueppel-associated_box,pfscan_Krueppel-associated_box		0.463	ZNF613-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF613	protein_coding	OTTHUMT00000461104.2	C	NM_024840	-		52443921	+1	no_errors	ENST00000293471	ensembl	human	known	74_37	missense	SNP	0.000	T
GPR63	81491	genome.wustl.edu	37	6	97247515	97247515	+	Silent	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr6:97247515G>A	ENST00000229955.3	-	2	438	c.93C>T	c.(91-93)ctC>ctT	p.L31L	GPR63_ENST00000417980.1_Silent_p.L31L	NM_001143957.2|NM_030784.3	NP_001137429.1|NP_110411.1	Q9BZJ6	GPR63_HUMAN	G protein-coupled receptor 63	31						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)			kidney(1)|large_intestine(5)|lung(13)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		all_cancers(76;6.89e-05)|Acute lymphoblastic leukemia(125;7.02e-10)|all_hematologic(75;1.23e-06)|all_epithelial(107;0.0618)|Colorectal(196;0.0721)		BRCA - Breast invasive adenocarcinoma(108;0.0912)		ATGGTGGAGGGAGTGTAATAT	0.458																																																	0								ENSG00000112218						127.0	116.0	119.0					6																	97247515		2203	4300	6503	GPR63	SO:0001819	synonymous_variant	0			-	HGNC	AF317654	CCDS5036.1	6q16.1-q16.3	2012-08-21			ENSG00000112218	ENSG00000112218		"""GPCR / Class A : Orphans"""	13302	protein-coding gene	gene with protein product		606915					Standard	NM_030784		Approved	PSP24(beta), PSP24B	uc003pou.3	Q9BZJ6	OTTHUMG00000015245	ENST00000229955.3:c.93C>T	6.37:g.97247515G>A		Somatic	0	80	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	35	27.08	Q9UJH3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.L31	ENST00000229955.3	37	c.93	CCDS5036.1	6																																																																																			-	NULL		0.458	GPR63-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR63	protein_coding	OTTHUMT00000041566.2	G		-		97247515	-1	no_errors	ENST00000229955	ensembl	human	known	74_37	silent	SNP	0.252	A
PTMAP5	150928	genome.wustl.edu	37	13	82264754	82264754	+	RNA	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr13:82264754G>A	ENST00000607242.1	+	0	709									prothymosin, alpha pseudogene 5																		AACTTCCAAGGCCATGCTTTT	0.368																																																	0								ENSG00000214182																																			PTMAP5			0			-	HGNC	S38627		13q13.1	2008-11-06	2008-04-03		ENSG00000214182	ENSG00000214182			9628	pseudogene	pseudogene	"""gene sequence 150"""		"""prothymosin, alpha pseudogene 5 (gene sequence 150)"""			1612591	Standard	NG_004798		Approved				OTTHUMG00000017147		13.37:g.82264754G>A		Somatic	0	89	0.00		0.41568620468393047	217	3.12	7	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	35	20.45		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000607242.1	37	NULL		13																																																																																			-	-		0.368	PTMAP5-002	KNOWN	basic	processed_transcript	PTMAP5	pseudogene	OTTHUMT00000470311.1	G		-		82264754	+1	no_errors	ENST00000607242	ensembl	human	known	74_37	rna	SNP	0.996	A
ZFHX2	85446	genome.wustl.edu	37	14	23994485	23994485	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr14:23994485C>T	ENST00000419474.3	-	9	5021	c.4666G>A	c.(4666-4668)Gag>Aag	p.E1556K	RP11-66N24.4_ENST00000556354.1_RNA|RP11-66N24.4_ENST00000554403.1_RNA|RP11-66N24.4_ENST00000553985.1_RNA	NM_033400.2	NP_207646.2	Q9C0A1	ZFHX2_HUMAN	zinc finger homeobox 2	1556					adult behavior (GO:0030534)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|pancreas(1)	5						GCCTCAGGCTCTGGGACCAGG	0.612																																																	0								ENSG00000136367																																			ZFHX2	SO:0001583	missense	0			-	HGNC	AB051549	CCDS55907.1	14q11.2	2012-03-09			ENSG00000136367	ENSG00000136367		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	20152	protein-coding gene	gene with protein product			"""zinc finger protein 409"""	ZNF409		11214970, 10470851	Standard	NM_033400		Approved	KIAA1762, KIAA1056, ZFH-5	uc010tno.2	Q9C0A1	OTTHUMG00000156894	ENST00000419474.3:c.4666G>A	14.37:g.23994485C>T	ENSP00000413418:p.Glu1556Lys	Somatic	0	69	0.00		0.41568620468393047	0	100.00	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	53	20.90	Q9UPU6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Homeobox_dom,superfamily_Homeodomain-like,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Znf_C2H2-like,smart_Znf_U1,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Znf_C2H2	p.E1556K	ENST00000419474.3	37	c.4666	CCDS55907.1	14	.	.	.	.	.	.	.	.	.	.	C	11.75	1.732638	0.30684	.	.	ENSG00000136367	ENST00000419474	T	0.78595	-1.19	4.14	4.14	0.48551	.	0.000000	0.40818	N	0.001018	T	0.64338	0.2589	L	0.51422	1.61	0.19775	N	0.999957	B	0.30068	0.267	B	0.22386	0.039	T	0.48433	-0.9036	10	0.11794	T	0.64	.	7.22	0.25981	0.191:0.6238:0.1852:0.0	.	1556	Q9C0A1	ZFHX2_HUMAN	K	1556	ENSP00000413418:E1556K	ENSP00000413418:E1556K	E	-	1	0	ZFHX2	23064325	0.864000	0.29904	0.996000	0.52242	0.924000	0.55760	1.146000	0.31589	2.120000	0.65058	0.455000	0.32223	GAG	-	NULL		0.612	ZFHX2-001	KNOWN	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	ZFHX2	protein_coding	OTTHUMT00000346484.3	C	NM_014894	-		23994485	-1	no_errors	ENST00000419474	ensembl	human	known	74_37	missense	SNP	0.303	T
GNE	10020	genome.wustl.edu	37	9	36223481	36223481	+	Missense_Mutation	SNP	A	A	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr9:36223481A>T	ENST00000539815.1	-	7	1340	c.1300T>A	c.(1300-1302)Tat>Aat	p.Y434N	GNE_ENST00000447283.2_Missense_Mutation_p.Y434N|GNE_ENST00000539208.1_Missense_Mutation_p.Y324N|GNE_ENST00000377902.5_Missense_Mutation_p.Y434N|GNE_ENST00000396594.3_Missense_Mutation_p.Y465N|GNE_ENST00000543356.2_Missense_Mutation_p.Y429N			Q9Y223	GLCNE_HUMAN	glucosamine (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase	434	N-acetylmannosamine kinase.				carbohydrate phosphorylation (GO:0046835)|cell adhesion (GO:0007155)|N-acetylglucosamine biosynthetic process (GO:0006045)|N-acetylneuraminate metabolic process (GO:0006054)|UDP-N-acetylglucosamine metabolic process (GO:0006047)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|metal ion binding (GO:0046872)|N-acylmannosamine kinase activity (GO:0009384)|UDP-N-acetylglucosamine 2-epimerase activity (GO:0008761)			endometrium(8)|kidney(1)|large_intestine(3)|lung(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	19			STAD - Stomach adenocarcinoma(86;0.228)			AACTGAGTATACTTCTTAACT	0.368																																					GBM(184;106 2118 20004 35750 50727)												0								ENSG00000159921						75.0	77.0	76.0					9																	36223481		2203	4299	6502	GNE	SO:0001583	missense	0			-	HGNC	AF051852	CCDS6602.1, CCDS47965.1, CCDS55308.1, CCDS55309.1, CCDS55310.1	9p13.1	2008-02-05	2003-12-01		ENSG00000159921	ENSG00000159921			23657	protein-coding gene	gene with protein product		603824	"""UDP-N-acetylglucosamine-2-epimerase/N-acetylmannosamine kinase"""	IBM2		9305887, 9305888	Standard	NM_005476		Approved	Uae1	uc010mli.3	Q9Y223	OTTHUMG00000019899	ENST00000539815.1:c.1300T>A	9.37:g.36223481A>T	ENSP00000439155:p.Tyr434Asn	Somatic	0	60	0.00		0.41568620468393047	8	33.33	4	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	41	16.33	A6PZH2|A6PZH3|A7UNU7|B2R6E1|B7Z372|B7Z428|D3DRP7|F5H499|H0YFA7|Q0VA94	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_UDP_GlcNAc_Epimerase_2,pfam_ROK,prints_Hexokinase,tigrfam_UDP-GlcNAc_Epase	p.Y465N	ENST00000539815.1	37	c.1393	CCDS6602.1	9	.	.	.	.	.	.	.	.	.	.	A	16.50	3.140953	0.56936	.	.	ENSG00000159921	ENST00000377902;ENST00000396594;ENST00000339267;ENST00000539815;ENST00000543356;ENST00000539208;ENST00000447283	D;D;D;D;D	0.99545	-3.95;-3.95;-3.95;-3.95;-6.13	5.68	5.68	0.88126	.	0.000000	0.85682	D	0.000000	D	0.97592	0.9211	N	0.14661	0.345	0.80722	D	1	B;B;B;B;P	0.42827	0.032;0.078;0.078;0.096;0.791	B;B;B;B;B	0.38056	0.015;0.023;0.023;0.023;0.264	D	0.98667	1.0686	10	0.46703	T	0.11	-25.9119	14.1732	0.65525	1.0:0.0:0.0:0.0	.	324;393;465;434;434	F5H499;Q9Y223-3;Q9Y223-2;Q9Y223;A7UNU7	.;.;.;GLCNE_HUMAN;.	N	434;465;429;434;406;324;434	ENSP00000367134:Y434N;ENSP00000379839:Y465N;ENSP00000439155:Y434N;ENSP00000445117:Y324N;ENSP00000414760:Y434N	ENSP00000340770:Y429N	Y	-	1	0	GNE	36213481	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.347000	0.59373	2.296000	0.77279	0.482000	0.46254	TAT	-	pfam_ROK		0.368	GNE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	GNE	protein_coding	OTTHUMT00000052412.4	A	NM_005476	-		36223481	-1	no_errors	ENST00000396594	ensembl	human	known	74_37	missense	SNP	1.000	T
SLAIN1	122060	genome.wustl.edu	37	13	78318545	78318545	+	Silent	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr13:78318545C>T	ENST00000466548.1	+	4	854	c.828C>T	c.(826-828)atC>atT	p.I276I	SLAIN1_ENST00000267219.8_Silent_p.I57I|SLAIN1_ENST00000488699.1_Silent_p.I134I|SLAIN1_ENST00000351546.3_Silent_p.I13I|SLAIN1_ENST00000418532.1_Silent_p.I57I|SLAIN1_ENST00000465831.1_3'UTR|SLAIN1_ENST00000358679.3_Silent_p.I13I|SLAIN1_ENST00000314070.5_Silent_p.I13I	NM_001242868.1	NP_001229797.1	Q8ND83	SLAI1_HUMAN	SLAIN motif family, member 1	276										breast(1)|endometrium(3)|large_intestine(1)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	14		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.037)		GBM - Glioblastoma multiforme(99;0.0853)		ATGTTCAGATCATGGCTCGTC	0.438																																																	0								ENSG00000139737						82.0	75.0	77.0					13																	78318545		2203	4300	6503	SLAIN1	SO:0001819	synonymous_variant	0			-	HGNC	AK054608	CCDS9460.1, CCDS31995.1, CCDS31995.2, CCDS55901.1, CCDS73588.1, CCDS73589.1	13q22.3	2006-09-12	2006-09-12	2006-09-12	ENSG00000139737	ENSG00000139737			26387	protein-coding gene	gene with protein product		610491	"""chromosome 13 open reading frame 32"""	C13orf32		16546155	Standard	NM_001040153		Approved	FLJ30046	uc001vkk.3	Q8ND83	OTTHUMG00000017110	ENST00000466548.1:c.828C>T	13.37:g.78318545C>T		Somatic	0	61	0.00		0.41568620468393047	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	33	19.51	A8K0Z9|B7Z209|Q5T6P4|Q5T6P7|Q8ND10|Q96NV0	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.I276	ENST00000466548.1	37	c.828		13																																																																																			-	NULL		0.438	SLAIN1-009	KNOWN	not_organism_supported|basic	protein_coding	SLAIN1	protein_coding	OTTHUMT00000355018.1	C	NM_144595	-		78318545	+1	no_errors	ENST00000466548	ensembl	human	known	74_37	silent	SNP	1.000	T
MMRN1	22915	genome.wustl.edu	37	4	90874525	90874525	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr4:90874525C>T	ENST00000394980.1	+	9	3962	c.3643C>T	c.(3643-3645)Ccc>Tcc	p.P1215S	MMRN1_ENST00000264790.2_Missense_Mutation_p.P1215S|MMRN1_ENST00000394981.1_Missense_Mutation_p.P518S|MMRN1_ENST00000508372.1_Missense_Mutation_p.P957S			Q13201	MMRN1_HUMAN	multimerin 1	1215	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|platelet alpha granule lumen (GO:0031093)				breast(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(12)|liver(2)|lung(34)|ovary(5)|prostate(1)|skin(6)|stomach(1)|urinary_tract(2)	72		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;6.96e-05)		AGCCAAGTTTCCCCCTGTTAC	0.363																																																	0								ENSG00000138722						60.0	61.0	61.0					4																	90874525		2203	4300	6503	MMRN1	SO:0001583	missense	0			-	HGNC	U27109	CCDS3635.1	4q22	2008-02-05	2004-03-02	2004-03-02	ENSG00000138722	ENSG00000138722		"""EMI domain containing"""	7178	protein-coding gene	gene with protein product	"""glycoprotein Ia*"""	601456	"""multimerin"""	MMRN		7629143, 10828608	Standard	NM_007351		Approved	ECM, EMILIN4, GPIa*	uc003hst.3	Q13201	OTTHUMG00000130947	ENST00000394980.1:c.3643C>T	4.37:g.90874525C>T	ENSP00000378431:p.Pro1215Ser	Somatic	0	80	0.00		0.41568620468393047	23	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	52	14.75	Q4W5L1|Q6P3T8|Q6ZUL9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_C1q,pfam_EMI_domain,pfam_EG-like_dom,superfamily_Tumour_necrosis_fac-like_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_C1q,prints_C1q,pfscan_C1q,pfscan_EG-like_dom,pfscan_EMI_domain	p.P1215S	ENST00000394980.1	37	c.3643	CCDS3635.1	4	.	.	.	.	.	.	.	.	.	.	C	19.40	3.819990	0.71028	.	.	ENSG00000138722	ENST00000394980;ENST00000264790;ENST00000394981;ENST00000508372	T;T;T;T	0.74106	-0.81;-0.81;-0.81;-0.81	5.25	5.25	0.73442	Tumour necrosis factor-like (2);Complement C1q protein (3);	0.000000	0.64402	D	0.000006	D	0.84786	0.5549	M	0.62723	1.935	0.43512	D	0.99577	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.85022	0.0912	10	0.59425	D	0.04	.	17.9019	0.88906	0.0:1.0:0.0:0.0	.	518;1215	Q13201-2;Q13201	.;MMRN1_HUMAN	S	1215;1215;518;957	ENSP00000378431:P1215S;ENSP00000264790:P1215S;ENSP00000378432:P518S;ENSP00000426461:P957S	ENSP00000264790:P1215S	P	+	1	0	MMRN1	91093548	1.000000	0.71417	0.996000	0.52242	0.642000	0.38348	4.991000	0.63883	2.833000	0.97629	0.585000	0.79938	CCC	-	pfam_C1q,superfamily_Tumour_necrosis_fac-like_dom,smart_C1q,pfscan_C1q		0.363	MMRN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMRN1	protein_coding	OTTHUMT00000253546.2	C	NM_007351	-		90874525	+1	no_errors	ENST00000264790	ensembl	human	known	74_37	missense	SNP	1.000	T
ZDHHC15	158866	genome.wustl.edu	37	X	74742745	74742745	+	Missense_Mutation	SNP	A	A	G			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chrX:74742745A>G	ENST00000373367.3	-	1	345	c.115T>C	c.(115-117)Tac>Cac	p.Y39H	ZDHHC15_ENST00000541184.1_Missense_Mutation_p.Y39H|ZDHHC15_ENST00000373361.3_Missense_Mutation_p.Y39H|ZDHHC15_ENST00000482827.1_5'UTR	NM_144969.2	NP_659406.1	Q96MV8	ZDH15_HUMAN	zinc finger, DHHC-type containing 15	39					establishment of protein localization (GO:0045184)|protein palmitoylation (GO:0018345)|synaptic vesicle maturation (GO:0016188)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(3)|large_intestine(5)|liver(1)|lung(11)|ovary(2)|skin(2)	26						TCAAAGACGTAGGCATAGTAG	0.562																																																	0								ENSG00000102383						107.0	82.0	91.0					X																	74742745		2203	4300	6503	ZDHHC15	SO:0001583	missense	0			-	HGNC	AK056374	CCDS14430.1, CCDS55454.1	Xq13.3	2008-05-02			ENSG00000102383	ENSG00000102383		"""Zinc fingers, DHHC-type"""	20342	protein-coding gene	gene with protein product		300576					Standard	NM_144969		Approved	FLJ31812, MRX91	uc004ecg.3	Q96MV8	OTTHUMG00000021866	ENST00000373367.3:c.115T>C	X.37:g.74742745A>G	ENSP00000362465:p.Tyr39His	Somatic	0	68	0.00		0.41568620468393047	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	B3KVG7|Q3SY30|Q6UWH3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_DHHC_palmitoyltrfase,superfamily_Plexin-like_fold,pfscan_Znf_DHHC_palmitoyltrfase	p.Y39H	ENST00000373367.3	37	c.115	CCDS14430.1	X	.	.	.	.	.	.	.	.	.	.	A	25.7	4.668477	0.88348	.	.	ENSG00000102383	ENST00000373367;ENST00000541184;ENST00000373361	T;T;T	0.77098	0.74;1.04;-1.07	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	D	0.88295	0.6398	M	0.85630	2.765	0.80722	D	1	D;D;D	0.89917	0.999;1.0;0.972	D;D;P	0.85130	0.997;0.99;0.832	D	0.89107	0.3493	10	0.51188	T	0.08	-15.1548	12.4271	0.55553	1.0:0.0:0.0:0.0	.	39;39;39	Q96MV8-2;B3KVG7;Q96MV8	.;.;ZDH15_HUMAN	H	39	ENSP00000362465:Y39H;ENSP00000445420:Y39H;ENSP00000362459:Y39H	ENSP00000362459:Y39H	Y	-	1	0	ZDHHC15	74659470	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.618000	0.83043	1.840000	0.53500	0.430000	0.28490	TAC	-	NULL		0.562	ZDHHC15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZDHHC15	protein_coding	OTTHUMT00000057283.1	A	NM_144969	-		74742745	-1	no_errors	ENST00000373367	ensembl	human	known	74_37	missense	SNP	1.000	G
COL25A1	84570	genome.wustl.edu	37	4	109753543	109753543	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr4:109753543C>T	ENST00000399132.1	-	32	2233	c.1703G>A	c.(1702-1704)gGa>gAa	p.G568E	COL25A1_ENST00000399126.1_Missense_Mutation_p.G568E|COL25A1_ENST00000399127.1_Missense_Mutation_p.G580E	NM_198721.2	NP_942014.1			collagen, type XXV, alpha 1											NS(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(8)|lung(19)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	49		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000173)		TACTCTTTCTCCTTTGGGACC	0.378																																																	0								ENSG00000188517						61.0	58.0	59.0					4																	109753543		1816	4077	5893	COL25A1	SO:0001583	missense	0			-	HGNC	AF293340	CCDS43258.1, CCDS43259.1, CCDS58922.1	4q25	2013-01-16			ENSG00000188517	ENSG00000188517		"""Collagens"""	18603	protein-coding gene	gene with protein product		610004				11927537	Standard	NM_001256074		Approved		uc003hze.2	Q9BXS0	OTTHUMG00000150039	ENST00000399132.1:c.1703G>A	4.37:g.109753543C>T	ENSP00000382083:p.Gly568Glu	Somatic	0	48	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	27	15.62		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Collagen	p.G568E	ENST00000399132.1	37	c.1703	CCDS43258.1	4	.	.	.	.	.	.	.	.	.	.	C	16.86	3.240039	0.58995	.	.	ENSG00000188517	ENST00000399132;ENST00000333642;ENST00000401873;ENST00000399127;ENST00000399126	D;D;D	0.99619	-6.28;-5.77;-6.28	5.68	5.68	0.88126	.	0.000000	0.85682	D	0.000000	D	0.99785	0.9910	H	0.95470	3.675	0.54753	D	0.999989	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97383	0.9984	9	.	.	.	-7.9316	20.1325	0.98004	0.0:1.0:0.0:0.0	.	568;568	Q9BXS0-2;Q9BXS0	.;COPA1_HUMAN	E	568;570;549;580;568	ENSP00000382083:G568E;ENSP00000382078:G580E;ENSP00000382077:G568E	.	G	-	2	0	COL25A1	109972992	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.871000	0.69628	2.839000	0.97877	0.650000	0.86243	GGA	-	pfam_Collagen		0.378	COL25A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL25A1	protein_coding	OTTHUMT00000315938.2	C	NM_032518	-		109753543	-1	no_errors	ENST00000399132	ensembl	human	known	74_37	missense	SNP	1.000	T
MTL5	9633	genome.wustl.edu	37	11	68478401	68478401	+	Missense_Mutation	SNP	T	T	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr11:68478401T>A	ENST00000255087.5	-	9	1458	c.1275A>T	c.(1273-1275)gaA>gaT	p.E425D		NM_004923.3	NP_004914.2	Q9Y4I5	MTL5_HUMAN	metallothionein-like 5, testis-specific (tesmin)	425					cell differentiation (GO:0030154)|cellular metal ion homeostasis (GO:0006875)|multicellular organismal development (GO:0007275)|response to metal ion (GO:0010038)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(2)|cervix(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)	15	Esophageal squamous(3;4.37e-12)		LUAD - Lung adenocarcinoma(13;0.0676)|STAD - Stomach adenocarcinoma(18;0.185)			AATGGCTGCCTTCCAAACCTC	0.423																																																	0								ENSG00000132749						130.0	114.0	120.0					11																	68478401		2200	4294	6494	MTL5	SO:0001583	missense	0			-	HGNC	U86074	CCDS8184.1, CCDS44661.1	11q13.2-q13.3	2007-01-03			ENSG00000132749	ENSG00000132749			7446	protein-coding gene	gene with protein product	"""CXC domain containing 2"""	604374				1091092	Standard	XR_428932		Approved	CXCDC2	uc001ooc.3	Q9Y4I5	OTTHUMG00000167891	ENST00000255087.5:c.1275A>T	11.37:g.68478401T>A	ENSP00000255087:p.Glu425Asp	Somatic	0	76	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	49	16.95	A8K8J3|Q4G182|Q6P2E2|Q8NCC8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_CRC,superfamily_Thionin	p.E425D	ENST00000255087.5	37	c.1275	CCDS8184.1	11	.	.	.	.	.	.	.	.	.	.	T	13.26	2.184254	0.38609	.	.	ENSG00000132749	ENST00000255087	T	0.32988	1.43	5.02	-1.12	0.09808	.	0.434976	0.21958	N	0.066640	T	0.23572	0.0570	M	0.65975	2.015	0.80722	D	1	B	0.14012	0.009	B	0.10450	0.005	T	0.07809	-1.0753	10	0.20519	T	0.43	-16.9072	4.6648	0.12660	0.0:0.2281:0.3295:0.4424	.	425	Q9Y4I5	MTL5_HUMAN	D	425	ENSP00000255087:E425D	ENSP00000255087:E425D	E	-	3	2	MTL5	68234977	0.981000	0.34729	0.019000	0.16419	0.090000	0.18270	0.280000	0.18790	-0.477000	0.06832	0.454000	0.30748	GAA	-	NULL		0.423	MTL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTL5	protein_coding	OTTHUMT00000396844.1	T	NM_004923	-		68478401	-1	no_errors	ENST00000255087	ensembl	human	known	74_37	missense	SNP	0.981	A
TP53	7157	genome.wustl.edu	37	17	7577539	7577539	+	Missense_Mutation	SNP	G	G	A	rs397516437|rs121912651		TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr17:7577539G>A	ENST00000269305.4	-	7	931	c.742C>T	c.(742-744)Cgg>Tgg	p.R248W	TP53_ENST00000445888.2_Missense_Mutation_p.R248W|TP53_ENST00000455263.2_Missense_Mutation_p.R248W|TP53_ENST00000359597.4_Missense_Mutation_p.R248W|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Missense_Mutation_p.R248W|TP53_ENST00000420246.2_Missense_Mutation_p.R248W	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	248	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		NR -> IP (in a sporadic cancer; somatic mutation).|NR -> KW (in sporadic cancers; somatic mutation).|R -> C (in a sporadic cancer; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:7682763}.|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs11540652). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:2263646, ECO:0000269|PubMed:7682763, ECO:0000269|PubMed:7887414}.|R -> W (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1978757, ECO:0000269|PubMed:8829627}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R248W(544)|p.R155W(28)|p.R248G(12)|p.0?(8)|p.?(5)|p.N247_R248delNR(2)|p.R248fs*16(2)|p.N247_R248>KW(2)|p.M246_P250delMNRRP(2)|p.R248fs*97(2)|p.R248R(2)|p.R248fs*>39(1)|p.R248_P250delRRP(1)|p.unknown(1)|p.N247_R249delNRR(1)|p.N247_P250delNRRP(1)|p.R248C(1)|p.G245fs*14(1)|p.N247_R248>IP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ATGGGCCTCCGGTTCATGCCG	0.577	R248W(786O_KIDNEY)|R248W(CAS1_CENTRAL_NERVOUS_SYSTEM)|R248W(COLO320_LARGE_INTESTINE)|R248W(COLO680N_OESOPHAGUS)|R248W(DB_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248W(GCT_SOFT_TISSUE)|R248W(HCC2157_BREAST)|R248W(JIMT1_BREAST)|R248W(KO52_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248W(LUDLU1_LUNG)|R248W(LXF289_LUNG)|R248W(MIAPACA2_PANCREAS)|R248W(RD_SOFT_TISSUE)|R248W(SW837_LARGE_INTESTINE)|R248W(VCAP_PROSTATE)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	617	Substitution - Missense(585)|Whole gene deletion(8)|Deletion - In frame(7)|Unknown(6)|Insertion - Frameshift(3)|Deletion - Frameshift(3)|Complex - compound substitution(3)|Substitution - coding silent(2)	large_intestine(156)|breast(72)|ovary(42)|endometrium(38)|oesophagus(38)|skin(37)|haematopoietic_and_lymphoid_tissue(37)|central_nervous_system(35)|stomach(27)|lung(26)|upper_aerodigestive_tract(25)|urinary_tract(19)|biliary_tract(17)|pancreas(12)|prostate(10)|soft_tissue(6)|bone(6)|thyroid(4)|liver(4)|penis(2)|peritoneum(1)|vulva(1)|kidney(1)|cervix(1)	GRCh37	CM010465|CM900211	TP53	M	rs121912651	ENSG00000141510						151.0	112.0	125.0					17																	7577539		2203	4300	6503	TP53	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	-	HGNC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.742C>T	17.37:g.7577539G>A	ENSP00000269305:p.Arg248Trp	Somatic	0	50	0.00		0.41568620468393047	21	50.00	21	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	21	25.00	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R248W	ENST00000269305.4	37	c.742	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	G	18.84	3.710019	0.68730	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99869	-7.34;-7.34;-7.34;-7.34;-7.34;-7.34;-7.34;-7.34	4.62	2.56	0.30785	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99843	0.9928	M	0.92507	3.315	0.58432	A	0.999997	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0	D	0.97208	0.9869	9	0.87932	D	0	-9.5643	7.568	0.27890	0.0893:0.0:0.7471:0.1636	.	248;248;155;248;248;248	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	W	248;248;248;248;248;248;237;155;116;155	ENSP00000410739:R248W;ENSP00000352610:R248W;ENSP00000269305:R248W;ENSP00000398846:R248W;ENSP00000391127:R248W;ENSP00000391478:R248W;ENSP00000425104:R116W;ENSP00000423862:R155W	ENSP00000269305:R248W	R	-	1	2	TP53	7518264	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	1.447000	0.35101	0.644000	0.30656	0.462000	0.41574	CGG	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor		0.577	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	G	NM_000546	rs121912651		7577539	-1	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	SNP	1.000	A
DUOX1	53905	genome.wustl.edu	37	15	45457031	45457031	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr15:45457031G>A	ENST00000321429.4	+	35	4995	c.4588G>A	c.(4588-4590)Gaa>Aaa	p.E1530K	CTD-2651B20.1_ENST00000558039.1_lincRNA|DUOX1_ENST00000561166.1_Missense_Mutation_p.E1176K|DUOX1_ENST00000389037.3_Missense_Mutation_p.E1530K	NM_017434.3	NP_059130.2	Q9NRD9	DUOX1_HUMAN	dual oxidase 1	1530					cuticle development (GO:0042335)|cytokine-mediated signaling pathway (GO:0019221)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide biosynthetic process (GO:0050665)|hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)|response to cAMP (GO:0051591)|superoxide anion generation (GO:0042554)|thyroid hormone generation (GO:0006590)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|NAD(P)H oxidase activity (GO:0016174)|NADP binding (GO:0050661)|peroxidase activity (GO:0004601)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(13)|lung(16)|ovary(6)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)	57		all_cancers(109;5.7e-11)|all_epithelial(112;4.65e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;5.77e-18)|GBM - Glioblastoma multiforme(94;5.11e-07)|COAD - Colon adenocarcinoma(120;0.071)|Colorectal(133;0.0717)		CAAGAATGTGGAAAAGGCCTG	0.572																																																	0								ENSG00000137857						186.0	178.0	181.0					15																	45457031		2198	4298	6496	DUOX1	SO:0001583	missense	0			-	HGNC	AF213465	CCDS32221.1	15q21	2013-01-10				ENSG00000137857		"""EF-hand domain containing"""	3062	protein-coding gene	gene with protein product	"""NADPH thyroid oxidase 1"", ""flavoprotein NADPH oxidase"", ""nicotinamide adenine dinucleotide phosphate oxidase"""	606758				10806195	Standard	XM_005254463		Approved	NOXEF1, THOX1, LNOX1	uc001zut.1	Q9NRD9		ENST00000321429.4:c.4588G>A	15.37:g.45457031G>A	ENSP00000317997:p.Glu1530Lys	Somatic	0	68	0.00		0.41568620468393047	16	15.79	3	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	37	24.49	A6NH28|Q14C94|Q6ZMB3|Q6ZR09|Q9NZC1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Haem_peroxidase_animal,pfam_Fe_red_NAD-bd_6,pfam_FAD-bd_8,pfam_Fe3_Rdtase_TM_dom,pfam_EF_hand_dom,superfamily_Haem_peroxidase,superfamily_Riboflavin_synthase-like_b-brl,smart_EF_hand_dom,prints_Haem_peroxidase_animal_subgr,prints_Recoverin,pfscan_EF_hand_dom,pfscan_Haem_peroxidase_animal	p.E1530K	ENST00000321429.4	37	c.4588	CCDS32221.1	15	.	.	.	.	.	.	.	.	.	.	G	32	5.148643	0.94603	.	.	ENSG00000137857	ENST00000431588;ENST00000321429;ENST00000389037	D;D	0.94376	-3.41;-3.41	4.32	4.32	0.51571	Ferric reductase, NAD binding (1);	0.000000	0.85682	D	0.000000	D	0.93579	0.7950	L	0.31578	0.945	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.92115	0.5699	10	0.28530	T	0.3	-13.9361	14.3496	0.66691	0.0:0.0:1.0:0.0	.	1530	Q9NRD9	DUOX1_HUMAN	K	1530	ENSP00000317997:E1530K;ENSP00000373689:E1530K	ENSP00000317997:E1530K	E	+	1	0	DUOX1	43244323	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.607000	0.98328	2.226000	0.72624	0.561000	0.74099	GAA	-	pfam_Fe_red_NAD-bd_6		0.572	DUOX1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	DUOX1	protein_coding	OTTHUMT00000416251.1	G	NM_017434	-		45457031	+1	no_errors	ENST00000321429	ensembl	human	known	74_37	missense	SNP	1.000	A
CDK18	5129	genome.wustl.edu	37	1	205500526	205500526	+	3'UTR	SNP	G	G	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr1:205500526G>T	ENST00000360066.2	+	0	1746				CDK18_ENST00000506784.1_3'UTR|CDK18_ENST00000509056.1_3'UTR	NM_002596.3|NM_212502.2|NM_212503.2	NP_002587.2|NP_997667.1|NP_997668.1	Q07002	CDK18_HUMAN	cyclin-dependent kinase 18								ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)			breast(2)|endometrium(2)|large_intestine(2)|lung(10)|stomach(2)|urinary_tract(1)	19						ACCTTGCTGTGGCCAAGGGAC	0.607																																					Pancreas(180;489 2072 28461 40831 44265)												0								ENSG00000117266						72.0	62.0	66.0					1																	205500526		2203	4300	6503	CDK18	SO:0001624	3_prime_UTR_variant	0			-	HGNC	X66362	CCDS1454.1, CCDS44300.1	1q31-q32	2011-11-08	2009-12-16	2009-12-16	ENSG00000117266	ENSG00000117266		"""Cyclin-dependent kinases"""	8751	protein-coding gene	gene with protein product		169190	"""PCTAIRE protein kinase 3"""	PCTK3		1437147, 19884882	Standard	NM_002596		Approved	PCTAIRE3	uc010pri.2	Q07002	OTTHUMG00000037203	ENST00000360066.2:c.*20G>T	1.37:g.205500526G>T		Somatic	0	68	0.00		0.41568620468393047	25	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51	Q5VXQ2|Q6V3A2|Q6V3A3|Q96F90	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000360066.2	37	NULL	CCDS44300.1	1																																																																																			-	-		0.607	CDK18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDK18	protein_coding	OTTHUMT00000090407.2	G	NM_002596	-		205500526	+1	no_errors	ENST00000459862	ensembl	human	known	74_37	rna	SNP	0.002	T
ADAT1	23536	genome.wustl.edu	37	16	75654573	75654573	+	Missense_Mutation	SNP	G	G	T	rs138703520		TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr16:75654573G>T	ENST00000307921.3	-	3	270	c.125C>A	c.(124-126)tCt>tAt	p.S42Y		NM_012091.3	NP_036223.2	Q9BUB4	ADAT1_HUMAN	adenosine deaminase, tRNA-specific 1	42					tRNA processing (GO:0008033)		metal ion binding (GO:0046872)|RNA binding (GO:0003723)|tRNA-specific adenosine deaminase activity (GO:0008251)			breast(1)|endometrium(4)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)|skin(1)|stomach(1)	19						GTCAGCTGGAGATTGTATCTT	0.502																																																	0								ENSG00000065457						114.0	112.0	113.0					16																	75654573		2198	4300	6498	ADAT1	SO:0001583	missense	0			-	HGNC	AF125188	CCDS10922.1	16q23	2008-02-05			ENSG00000065457	ENSG00000065457			228	protein-coding gene	gene with protein product		604230				10430867	Standard	NM_012091		Approved		uc002feo.2	Q9BUB4	OTTHUMG00000137611	ENST00000307921.3:c.125C>A	16.37:g.75654573G>T	ENSP00000310015:p.Ser42Tyr	Somatic	0	51	0.00		0.41568620468393047	4	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	24	14.29	Q9NVB7|Q9UNG3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_A_deamin,smart_A_deamin,pfscan_A_deamin	p.S42Y	ENST00000307921.3	37	c.125	CCDS10922.1	16	.	.	.	.	.	.	.	.	.	.	G	25.4	4.632773	0.87660	.	.	ENSG00000065457	ENST00000307921;ENST00000542252	T	0.15952	2.38	5.57	1.37	0.22104	Adenosine deaminase/editase (1);	0.989943	0.08255	N	0.974050	T	0.22437	0.0541	L	0.53249	1.67	0.09310	N	1	P	0.48998	0.918	P	0.47645	0.553	T	0.18871	-1.0323	10	0.62326	D	0.03	.	7.2583	0.26189	0.1959:0.1256:0.6785:0.0	.	42	Q9BUB4	ADAT1_HUMAN	Y	42;13	ENSP00000310015:S42Y	ENSP00000310015:S42Y	S	-	2	0	ADAT1	74212074	0.013000	0.17824	0.000000	0.03702	0.826000	0.46750	1.792000	0.38754	0.045000	0.15804	0.561000	0.74099	TCT	-	smart_A_deamin		0.502	ADAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAT1	protein_coding	OTTHUMT00000269027.1	G	NM_012091	-		75654573	-1	no_errors	ENST00000307921	ensembl	human	known	74_37	missense	SNP	0.002	T
ZNF428	126299	genome.wustl.edu	37	19	44111875	44111877	+	In_Frame_Del	DEL	TCC	TCC	-			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	TCC	TCC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr19:44111875_44111877delTCC	ENST00000300811.3	-	3	905_907	c.459_461delGGA	c.(457-462)gaggaa>gaa	p.153_154EE>E	SRRM5_ENST00000526798.1_Intron|SRRM5_ENST00000607544.1_Intron	NM_182498.3	NP_872304.2	Q96B54	ZN428_HUMAN	zinc finger protein 428	153	Glu-rich.						metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|prostate(1)	5		Prostate(69;0.0153)				ctcctcctcttcctcctcctcct	0.66																																																	0								ENSG00000131116																																			ZNF428	SO:0001651	inframe_deletion	0				HGNC	AY257197	CCDS12626.1	19q13.31	2008-05-02	2006-07-04	2006-07-04				"""Zinc fingers, C2H2-type"""	20804	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 37"""	C19orf37			Standard	NM_182498		Approved	MGC51082, Zfp428	uc002oxa.3	Q96B54		ENST00000300811.3:c.459_461delGGA	19.37:g.44111884_44111886delTCC	ENSP00000300811:p.Glu158del	Somatic	0	55	0.00		0.41568620468393047	131	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	31	11.43	O95054|Q6X3Y3	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfscan_Znf_C2H2	p.E157in_frame_del	ENST00000300811.3	37	c.461_459	CCDS12626.1	19																																																																																			-	NULL		0.660	ZNF428-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF428	protein_coding	OTTHUMT00000463349.1	TCC	NM_182498			44111877	-1	no_errors	ENST00000300811	ensembl	human	known	74_37	in_frame_del	DEL	0.006:0.005:0.000	-
MPEG1	219972	genome.wustl.edu	37	11	58978337	58978337	+	Silent	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr11:58978337G>A	ENST00000361050.3	-	1	2087	c.2002C>T	c.(2002-2004)Ctg>Ttg	p.L668L		NM_001039396.1	NP_001034485.1	Q2M385	MPEG1_HUMAN	macrophage expressed 1	668						integral component of membrane (GO:0016021)				NS(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(21)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		all_epithelial(135;0.125)				ACAACAGCCAGAATGGTGGTG	0.557																																																	0								ENSG00000197629						119.0	125.0	123.0					11																	58978337		2046	4178	6224	MPEG1	SO:0001819	synonymous_variant	0			-	HGNC	AK097211	CCDS41650.1	11q12.1	2013-07-31				ENSG00000197629			29619	protein-coding gene	gene with protein product	"""macrophage expressed gene 1"""	610390				7888681, 23257510	Standard	NM_001039396		Approved	MPG1	uc001nnu.4	Q2M385		ENST00000361050.3:c.2002C>T	11.37:g.58978337G>A		Somatic	0	33	0.00		0.41568620468393047	48	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	24	22.58	Q2M1T6|Q8TEF8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_MACPF,smart_MACPF	p.L668	ENST00000361050.3	37	c.2002	CCDS41650.1	11																																																																																			-	NULL		0.557	MPEG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MPEG1	protein_coding	OTTHUMT00000370027.1	G	NM_001039396	-		58978337	-1	no_errors	ENST00000361050	ensembl	human	known	74_37	silent	SNP	0.081	A
LIPC	3990	genome.wustl.edu	37	15	58837998	58837998	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr15:58837998C>T	ENST00000356113.6	+	7	1247	c.632C>T	c.(631-633)cCa>cTa	p.P211L	LIPC_ENST00000414170.3_Missense_Mutation_p.P211L|LIPC_ENST00000433326.2_Missense_Mutation_p.P150L|LIPC_ENST00000299022.5_Missense_Mutation_p.P211L			P11150	LIPC_HUMAN	lipase, hepatic	211					cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|chylomicron remnant clearance (GO:0034382)|fatty acid biosynthetic process (GO:0006633)|high-density lipoprotein particle remodeling (GO:0034375)|intermediate-density lipoprotein particle remodeling (GO:0034373)|low-density lipoprotein particle remodeling (GO:0034374)|phosphatidylcholine catabolic process (GO:0034638)|reverse cholesterol transport (GO:0043691)|triglyceride catabolic process (GO:0019433)|triglyceride homeostasis (GO:0070328)|very-low-density lipoprotein particle remodeling (GO:0034372)	extracellular space (GO:0005615)|high-density lipoprotein particle (GO:0034364)	apolipoprotein binding (GO:0034185)|heparin binding (GO:0008201)|low-density lipoprotein particle binding (GO:0030169)|phospholipase activity (GO:0004620)|triglyceride lipase activity (GO:0004806)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31		Colorectal(260;0.215)		GBM - Glioblastoma multiforme(80;0.00213)|all cancers(107;0.00548)		CGTCTTTCTCCAGATGATGCC	0.532																																																	0								ENSG00000166035						99.0	94.0	96.0					15																	58837998		2192	4292	6484	LIPC	SO:0001583	missense	0			-	HGNC		CCDS10166.1	15q21-q23	2012-10-02			ENSG00000166035	ENSG00000166035	3.1.1.3		6619	protein-coding gene	gene with protein product		151670					Standard	NM_000236		Approved	HL, HTGL	uc002afa.2	P11150	OTTHUMG00000132632	ENST00000356113.6:c.632C>T	15.37:g.58837998C>T	ENSP00000348425:p.Pro211Leu	Somatic	0	59	0.00		0.41568620468393047	5	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	38	28.30	A2RUB4|A8K9B6|O43571|P78529|Q99465	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Lipase_N,pfam_PLAT/LH2_dom,superfamily_Lipase_LipOase,smart_PLAT/LH2_dom,pirsf_Lipoprotein_lipase_LIPH,pfscan_PLAT/LH2_dom,prints_Lipase_hep,prints_Lipase,prints_Lipo_Lipase	p.P211L	ENST00000356113.6	37	c.632	CCDS10166.1	15	.	.	.	.	.	.	.	.	.	.	C	24.2	4.500349	0.85176	.	.	ENSG00000166035	ENST00000356113;ENST00000414170;ENST00000299022;ENST00000433326	D;D;D;D	0.91577	-2.87;-2.87;-2.87;-2.87	5.44	5.44	0.79542	Lipase, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.96399	0.8825	M	0.89904	3.07	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.97110	0.954;1.0	D	0.96936	0.9684	10	0.87932	D	0	.	19.2665	0.93988	0.0:1.0:0.0:0.0	.	150;211	E7EUK6;P11150	.;LIPC_HUMAN	L	211;211;211;150	ENSP00000348425:P211L;ENSP00000395569:P211L;ENSP00000299022:P211L;ENSP00000395002:P150L	ENSP00000299022:P211L	P	+	2	0	LIPC	56625290	1.000000	0.71417	1.000000	0.80357	0.440000	0.31957	6.072000	0.71238	2.548000	0.85928	0.563000	0.77884	CCA	-	pfam_Lipase_N,pirsf_Lipoprotein_lipase_LIPH		0.532	LIPC-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LIPC	protein_coding	OTTHUMT00000416209.1	C		-		58837998	+1	no_errors	ENST00000299022	ensembl	human	known	74_37	missense	SNP	1.000	T
HNF4A	3172	genome.wustl.edu	37	20	43057040	43057040	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr20:43057040G>A	ENST00000316099.4	+	9	1284	c.1195G>A	c.(1195-1197)Gga>Aga	p.G399R	HNF4A_ENST00000457232.1_Missense_Mutation_p.G377R|HNF4A_ENST00000415691.2_Missense_Mutation_p.G399R|HNF4A_ENST00000316673.4_Missense_Mutation_p.G377R	NM_000457.4|NM_001258355.1|NM_178849.2	NP_000448.3|NP_001245284.1|NP_849180.1	P41235	HNF4A_HUMAN	hepatocyte nuclear factor 4, alpha	399					blood coagulation (GO:0007596)|endocrine pancreas development (GO:0031018)|gene expression (GO:0010467)|glucose homeostasis (GO:0042593)|lipid homeostasis (GO:0055088)|lipid metabolic process (GO:0006629)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|ornithine metabolic process (GO:0006591)|phospholipid homeostasis (GO:0055091)|positive regulation of cholesterol homeostasis (GO:2000189)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gastrulation (GO:0010470)|regulation of growth hormone receptor signaling pathway (GO:0060398)|regulation of insulin secretion (GO:0050796)|regulation of lipid metabolic process (GO:0019216)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to glucose (GO:0009749)|sex differentiation (GO:0007548)|signal transduction involved in regulation of gene expression (GO:0023019)|SMAD protein signal transduction (GO:0060395)|transcription initiation from RNA polymerase II promoter (GO:0006367)|triglyceride homeostasis (GO:0070328)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|fatty acid binding (GO:0005504)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			endometrium(4)|large_intestine(7)|lung(17)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(2)	34		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)			GGAACATATGGGAACCAACGT	0.602																																					Colon(79;2 1269 8820 14841 52347)												0								ENSG00000101076						119.0	85.0	97.0					20																	43057040		2203	4300	6503	HNF4A	SO:0001583	missense	0			-	HGNC	X76930	CCDS13330.1, CCDS13331.1, CCDS42876.1, CCDS46604.1, CCDS46605.1, CCDS68131.1, CCDS74728.1	20q13.12	2014-09-17			ENSG00000101076	ENSG00000101076		"""Nuclear hormone receptors"""	5024	protein-coding gene	gene with protein product		600281		TCF14, MODY, MODY1		7926813, 9048927	Standard	NM_001030003		Approved	NR2A1, HNF4	uc010zwo.1	P41235	OTTHUMG00000032531	ENST00000316099.4:c.1195G>A	20.37:g.43057040G>A	ENSP00000312987:p.Gly399Arg	Somatic	0	61	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	15	28.57	A5JW41|B2RPP8|O00659|O00723|Q14540|Q5QPB8|Q6B4V5|Q6B4V6|Q6B4V7|Q92653|Q92654|Q92655|Q99864|Q9NQH0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt,prints_COUP_TF,prints_Retinoid-X_rcpt/HNF4	p.G399R	ENST00000316099.4	37	c.1195	CCDS13330.1	20	.	.	.	.	.	.	.	.	.	.	G	14.47	2.546189	0.45383	.	.	ENSG00000101076	ENST00000316673;ENST00000457232;ENST00000316099;ENST00000338692;ENST00000415691	T;T;T;T	0.70631	-0.5;-0.5;-0.5;-0.5	5.93	4.99	0.66335	.	0.461691	0.25091	N	0.033210	T	0.58566	0.2131	N	0.22421	0.69	0.42205	D	0.991783	B;B;B;B;B	0.12013	0.001;0.003;0.001;0.005;0.002	B;B;B;B;B	0.12837	0.003;0.006;0.003;0.006;0.008	T	0.54330	-0.8310	10	0.38643	T	0.18	.	15.0935	0.72215	0.0677:0.0:0.9323:0.0	.	392;399;399;377;377	Q5QPB7;P41235;F1D8S2;F1D8T0;P41235-6	.;HNF4A_HUMAN;.;.;.	R	377;377;399;429;399	ENSP00000315180:G377R;ENSP00000396216:G377R;ENSP00000312987:G399R;ENSP00000412111:G399R	ENSP00000312987:G399R	G	+	1	0	HNF4A	42490454	1.000000	0.71417	1.000000	0.80357	0.636000	0.38137	7.264000	0.78432	1.526000	0.49068	-0.251000	0.11542	GGA	-	NULL		0.602	HNF4A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HNF4A	protein_coding	OTTHUMT00000079363.3	G		-		43057040	+1	no_errors	ENST00000316099	ensembl	human	known	74_37	missense	SNP	1.000	A
DEK	7913	genome.wustl.edu	37	6	18264079	18264081	+	In_Frame_Del	DEL	TCC	TCC	-	rs377513079		TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	TCC	TCC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr6:18264079_18264081delTCC	ENST00000397239.3	-	2	585_587	c.138_140delGGA	c.(136-141)gaggaa>gaa	p.46_47EE>E	DEK_ENST00000244776.7_In_Frame_Del_p.46_47EE>E	NM_003472.3	NP_003463.1	P35659	DEK_HUMAN	DEK proto-oncogene	46	Asp/Glu-rich (highly acidic).				chromatin modification (GO:0016568)|regulation of double-strand break repair (GO:2000779)|regulation of double-strand break repair via nonhomologous end joining (GO:2001032)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)|viral genome replication (GO:0019079)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|prostate(1)|upper_aerodigestive_tract(1)	7	Ovarian(93;0.00769)|Breast(50;0.0495)	all_hematologic(90;0.053)	OV - Ovarian serous cystadenocarcinoma(7;0.00291)|all cancers(50;0.031)|Epithelial(50;0.0332)			CCCACCTTTTtcctcctcctcct	0.532			T	NUP214	AML																																			Dom	yes		6	6p23	7913	DEK oncogene (DNA binding)		L	0								ENSG00000124795		,	77,1,4184		12,0,53,0,1,2065					,	-0.3	1.0			50	90,5,8159		17,0,56,0,5,4049	no	codingComplex,codingComplex	DEK	NM_003472.3,NM_001134709.1	,	29,0,109,0,6,6114	A1A1,A1A2,A1R,A2A2,A2R,RR		1.151,1.8301,1.3822	,	,		167,6,12343				DEK	SO:0001651	inframe_deletion	0				HGNC	X64229	CCDS34344.1, CCDS47382.1	6p23	2014-06-25	2014-06-25		ENSG00000124795	ENSG00000124795			2768	protein-coding gene	gene with protein product		125264	"""DEK oncogene (DNA binding)"", ""DEK oncogene"""			1549122	Standard	NM_003472		Approved	D6S231E	uc003ncr.1	P35659	OTTHUMG00000014319	ENST00000397239.3:c.138_140delGGA	6.37:g.18264088_18264090delTCC	ENSP00000380414:p.Glu47del	Somatic	0	31	0.00		0.41568620468393047	157	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	18	10.00	B2R6K6|B4DN37|Q5TGV4|Q5TGV5	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_DEK_C,pfam_SAP_dom,smart_SAP_dom	p.E47in_frame_del	ENST00000397239.3	37	c.140_138	CCDS34344.1	6																																																																																			-	NULL		0.532	DEK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DEK	protein_coding	OTTHUMT00000039962.4	TCC				18264081	-1	no_errors	ENST00000397239	ensembl	human	known	74_37	in_frame_del	DEL	0.991:0.975:0.803	-
SPANXC	64663	genome.wustl.edu	37	X	140336558	140336558	+	Silent	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chrX:140336558C>T	ENST00000358993.2	-	1	71	c.33G>A	c.(31-33)aaG>aaA	p.K11K		NM_022661.2	NP_073152.1	Q9NY87	SPNXC_HUMAN	SPANX family, member C	11						cytoplasm (GO:0005737)|nucleus (GO:0005634)				large_intestine(2)|lung(3)|pancreas(1)	6	Acute lymphoblastic leukemia(192;7.65e-05)					GGACGCTCCTCTTCACCCCGC	0.507																																																	0								ENSG00000198573						88.0	119.0	108.0					X																	140336558		2198	4292	6490	SPANXC	SO:0001819	synonymous_variant	0			-	HGNC	AJ238277	CCDS14673.1	Xq27.2	2009-03-25			ENSG00000198573	ENSG00000198573			14331	protein-coding gene	gene with protein product	"""cancer/testis antigen family 11, member 3"""	300330				10626816	Standard	NM_022661		Approved	CTp11, CT11.3	uc004fbk.3	Q9NY87	OTTHUMG00000022556	ENST00000358993.2:c.33G>A	X.37:g.140336558C>T		Somatic	0	187	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	48	70	40.68	Q32WL9|Q5JX88	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_SPANX_prot	p.K11	ENST00000358993.2	37	c.33	CCDS14673.1	X																																																																																			-	pfam_SPANX_prot		0.507	SPANXC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPANXC	protein_coding	OTTHUMT00000058590.1	C	NM_022661	-		140336558	-1	no_errors	ENST00000358993	ensembl	human	known	74_37	silent	SNP	0.001	T
OTX1	5013	genome.wustl.edu	37	2	63281318	63281318	+	Silent	SNP	G	G	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr2:63281318G>T	ENST00000282549.2	+	4	510	c.234G>T	c.(232-234)ccG>ccT	p.P78P	OTX1_ENST00000366671.3_Silent_p.P78P	NM_014562.3	NP_055377.1	P32242	OTX1_HUMAN	orthodenticle homeobox 1	78					anterior/posterior pattern specification (GO:0009952)|diencephalon morphogenesis (GO:0048852)|inner ear morphogenesis (GO:0042472)|metencephalon development (GO:0022037)|midbrain development (GO:0030901)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			endometrium(1)|kidney(2)|large_intestine(6)|lung(6)|pancreas(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	20	Lung NSC(7;0.121)|all_lung(7;0.211)					TCAACCTGCCGGAGTCTAGAG	0.617																																																	0								ENSG00000115507						81.0	79.0	80.0					2																	63281318		2203	4300	6503	OTX1	SO:0001819	synonymous_variant	0			-	HGNC		CCDS1873.1	2p15	2011-06-20	2007-02-15		ENSG00000115507	ENSG00000115507		"""Homeoboxes / PRD class"""	8521	protein-coding gene	gene with protein product		600036	"""orthodenticle (Drosophila) homolog 1"", ""orthodenticle homolog 1 (Drosophila)"""			7959790	Standard	NM_001199770		Approved		uc002scd.3	P32242	OTTHUMG00000129454	ENST00000282549.2:c.234G>T	2.37:g.63281318G>T		Somatic	0	38	0.00		0.41568620468393047	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	35	10.26	A6NHA2|B3KTJ4|Q53TG6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Otx_TF_C,pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_Otx1_TF,prints_Otx_TF	p.P78	ENST00000282549.2	37	c.234	CCDS1873.1	2																																																																																			-	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom		0.617	OTX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OTX1	protein_coding	OTTHUMT00000251617.1	G		-		63281318	+1	no_errors	ENST00000282549	ensembl	human	known	74_37	silent	SNP	0.000	T
UNC13C	440279	genome.wustl.edu	37	15	54305705	54305705	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr15:54305705C>T	ENST00000260323.11	+	1	605	c.605C>T	c.(604-606)aCc>aTc	p.T202I	UNC13C_ENST00000537900.1_Missense_Mutation_p.T202I|UNC13C_ENST00000545554.1_Missense_Mutation_p.T202I	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	202					exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)			breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		GAGTTAAGCACCATGAAAAAA	0.458																																																	0								ENSG00000137766						94.0	93.0	93.0					15																	54305705		1846	4086	5932	UNC13C	SO:0001583	missense	0			-	HGNC	AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.605C>T	15.37:g.54305705C>T	ENSP00000260323:p.Thr202Ile	Somatic	0	50	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	23	17.86	Q0P613|Q8ND48|Q96NP3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Munc13_subgr_dom-2,pfam_Ca-dep_secretion_activator,pfam_C2_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_C2_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_C2_dom,pfscan_C2_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,prints_C2_dom	p.T202I	ENST00000260323.11	37	c.605	CCDS45264.1	15	.	.	.	.	.	.	.	.	.	.	C	11.95	1.792765	0.31685	.	.	ENSG00000137766	ENST00000260323;ENST00000545554;ENST00000537900	T;T;T	0.79749	-1.3;-1.3;-1.3	4.97	4.97	0.65823	.	.	.	.	.	T	0.74366	0.3707	N	0.19112	0.55	0.34978	D	0.753859	P	0.44578	0.838	B	0.44315	0.446	D	0.83447	0.0046	9	0.72032	D	0.01	.	17.243	0.87019	0.0:1.0:0.0:0.0	.	202	Q8NB66	UN13C_HUMAN	I	202	ENSP00000260323:T202I;ENSP00000438156:T202I;ENSP00000442569:T202I	ENSP00000260323:T202I	T	+	2	0	UNC13C	52092997	1.000000	0.71417	0.932000	0.37286	0.587000	0.36485	4.816000	0.62642	2.281000	0.76405	0.650000	0.86243	ACC	-	NULL		0.458	UNC13C-001	KNOWN	basic|CCDS	protein_coding	UNC13C	protein_coding	OTTHUMT00000419028.3	C	NM_173166	-		54305705	+1	no_errors	ENST00000260323	ensembl	human	known	74_37	missense	SNP	0.995	T
TTLL13	440307	genome.wustl.edu	37	15	90799449	90799449	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr15:90799449G>A	ENST00000339615.5	+	6	915	c.625G>A	c.(625-627)Gga>Aga	p.G209R	TTLL13_ENST00000438251.1_Missense_Mutation_p.G209R|RP11-697E2.6_ENST00000561573.1_Intron	NM_001029964.2	NP_001025135.2			tubulin tyrosine ligase-like family, member 13											NS(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(4)|lung(3)|prostate(1)	16	Melanoma(11;0.00551)|Lung NSC(78;0.0178)|all_lung(78;0.0378)		KIRC - Kidney renal clear cell carcinoma(17;0.0286)|BRCA - Breast invasive adenocarcinoma(143;0.0323)|Kidney(142;0.0514)			TGGCTGTCAGGGACGTGGCAT	0.547																																																	0								ENSG00000213471						99.0	94.0	96.0					15																	90799449		2199	4298	6497	TTLL13	SO:0001583	missense	0			-	HGNC	BC036668		15q26.1	2013-02-14				ENSG00000213471		"""Tubulin tyrosine ligase-like family"""	32484	protein-coding gene	gene with protein product						15890843	Standard	NR_104604		Approved	FLJ46079, MGC33417	uc002bpd.1	A6NNM8		ENST00000339615.5:c.625G>A	15.37:g.90799449G>A	ENSP00000345294:p.Gly209Arg	Somatic	0	47	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	19	47.22		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TTL/TTLL_fam	p.G209R	ENST00000339615.5	37	c.625	CCDS32328.1	15	.	.	.	.	.	.	.	.	.	.	G	32	5.109563	0.94292	.	.	ENSG00000213471	ENST00000438251;ENST00000339615	T;T	0.18016	2.24;2.24	5.09	5.09	0.68999	.	0.154217	0.45361	D	0.000379	T	0.63070	0.2480	H	0.99074	4.42	0.58432	D	0.999998	D	0.89917	1.0	D	0.97110	1.0	T	0.80188	-0.1486	10	0.87932	D	0	.	17.6537	0.88172	0.0:0.0:1.0:0.0	.	209	A6NNM8-2	.	R	209	ENSP00000413362:G209R;ENSP00000345294:G209R	ENSP00000345294:G209R	G	+	1	0	TTLL13	88600453	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.046000	0.93817	2.658000	0.90341	0.491000	0.48974	GGA	-	pfam_TTL/TTLL_fam		0.547	TTLL13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTLL13	protein_coding	OTTHUMT00000435854.1	G	NM_001029964	-		90799449	+1	no_errors	ENST00000438251	ensembl	human	known	74_37	missense	SNP	1.000	A
ARHGEF16	27237	genome.wustl.edu	37	1	3397100	3397100	+	Silent	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr1:3397100G>A	ENST00000378378.4	+	15	2484	c.2079G>A	c.(2077-2079)gtG>gtA	p.V693V	ARHGEF16_ENST00000413250.2_Silent_p.V397V|ARHGEF16_ENST00000378373.1_Silent_p.V405V|ARHGEF16_ENST00000378371.2_Silent_p.V405V	NM_014448.3	NP_055263.2	Q5VV41	ARHGG_HUMAN	Rho guanine nucleotide exchange factor (GEF) 16	693					activation of Cdc42 GTPase activity (GO:0032864)|activation of Rac GTPase activity (GO:0032863)|apoptotic signaling pathway (GO:0097190)|cell chemotaxis (GO:0060326)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	PDZ domain binding (GO:0030165)|receptor tyrosine kinase binding (GO:0030971)|Rho GTPase binding (GO:0017048)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			lung(6)|ovary(1)	7	all_cancers(77;0.00276)|all_epithelial(69;0.00102)|Ovarian(185;0.0634)|Lung NSC(156;0.0969)|all_lung(157;0.101)	all_epithelial(116;7.14e-21)|all_lung(118;2.24e-08)|Lung NSC(185;3.55e-06)|Breast(487;0.000765)|Renal(390;0.00121)|Hepatocellular(190;0.0046)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.211)		Epithelial(90;8.62e-38)|OV - Ovarian serous cystadenocarcinoma(86;3.62e-22)|GBM - Glioblastoma multiforme(42;2.49e-12)|Colorectal(212;4.25e-05)|COAD - Colon adenocarcinoma(227;0.000196)|Kidney(185;0.000342)|BRCA - Breast invasive adenocarcinoma(365;0.000681)|KIRC - Kidney renal clear cell carcinoma(229;0.00549)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.201)		GTGTGGCCGTGGAGGGCAATG	0.662																																																	0								ENSG00000130762						49.0	43.0	45.0					1																	3397100		2201	4293	6494	ARHGEF16	SO:0001819	synonymous_variant	0			-	HGNC	D89016	CCDS46.2	1p36.3	2013-01-10	2010-04-13		ENSG00000130762	ENSG00000130762		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	15515	protein-coding gene	gene with protein product	"""putative neuroblastoma protein"""						Standard	NM_014448		Approved	NBR, GEF16	uc001akg.4	Q5VV41	OTTHUMG00000000625	ENST00000378378.4:c.2079G>A	1.37:g.3397100G>A		Somatic	0	97	0.00		0.41568620468393047	13	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	53	18.46	Q86TF0|Q99434	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_DH-domain,pfam_SH3_domain,pfam_Pleckstrin_homology,superfamily_DH-domain,superfamily_SH3_domain,smart_DH-domain,smart_Pleckstrin_homology,smart_SH3_domain,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_DH-domain	p.V693	ENST00000378378.4	37	c.2079	CCDS46.2	1																																																																																			-	NULL		0.662	ARHGEF16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGEF16	protein_coding	OTTHUMT00000001515.1	G	NM_014448	-		3397100	+1	no_errors	ENST00000378378	ensembl	human	known	74_37	silent	SNP	1.000	A
SYT9	143425	genome.wustl.edu	37	11	7324340	7324340	+	Silent	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr11:7324340C>T	ENST00000318881.6	+	2	453	c.216C>T	c.(214-216)ttC>ttT	p.F72F	SYT9_ENST00000396716.2_Silent_p.F40F	NM_175733.3	NP_783860.1	Q86SS6	SYT9_HUMAN	synaptotagmin IX	72					positive regulation of calcium ion-dependent exocytosis (GO:0045956)|regulation of insulin secretion (GO:0050796)	cell junction (GO:0030054)|dense core granule (GO:0031045)|integral component of membrane (GO:0016021)|secretory granule membrane (GO:0030667)|synaptic vesicle (GO:0008021)	metal ion binding (GO:0046872)|transporter activity (GO:0005215)			NS(1)|endometrium(2)|large_intestine(9)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	38				Epithelial(150;1.34e-07)|LUSC - Lung squamous cell carcinoma(625;0.0949)		TGTCTCTCTTCGTATCTTGGA	0.527																																																	0								ENSG00000170743						224.0	201.0	209.0					11																	7324340		2201	4296	6497	SYT9	SO:0001819	synonymous_variant	0			-	HGNC	AK055003	CCDS7778.1	11p15.4	2013-01-21			ENSG00000170743	ENSG00000170743		"""Synaptotagmins"""	19265	protein-coding gene	gene with protein product		613528				11543631	Standard	NM_175733		Approved		uc001mfe.3	Q86SS6	OTTHUMG00000165499	ENST00000318881.6:c.216C>T	11.37:g.7324340C>T		Somatic	0	49	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	28	17.65		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom,prints_Synaptotagmin,prints_C2_dom	p.F72	ENST00000318881.6	37	c.216	CCDS7778.1	11																																																																																			-	NULL		0.527	SYT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYT9	protein_coding	OTTHUMT00000384483.1	C	NM_175733	-		7324340	+1	no_errors	ENST00000318881	ensembl	human	known	74_37	silent	SNP	1.000	T
CSMD3	114788	genome.wustl.edu	37	8	113267509	113267509	+	Missense_Mutation	SNP	C	C	G			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr8:113267509C>G	ENST00000297405.5	-	62	10254	c.10010G>C	c.(10009-10011)tGg>tCg	p.W3337S	CSMD3_ENST00000352409.3_Missense_Mutation_p.W3267S|CSMD3_ENST00000455883.2_Missense_Mutation_p.W3168S|CSMD3_ENST00000343508.3_Missense_Mutation_p.W3297S	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	3337	Sushi 26. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						TGAACCACTCCAAGTGCCATC	0.373										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																																							0								ENSG00000164796						127.0	115.0	119.0					8																	113267509		2203	4299	6502	CSMD3	SO:0001583	missense	0			-	HGNC	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.10010G>C	8.37:g.113267509C>G	ENSP00000297405:p.Trp3337Ser	Somatic	0	76	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	39	27.78	Q96PZ3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_CUB_dom,pfam_Sushi_SCR_CCP,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.W3337S	ENST00000297405.5	37	c.10010	CCDS6315.1	8	.	.	.	.	.	.	.	.	.	.	C	19.98	3.927068	0.73327	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.79749	-1.3;-1.3;-1.3;-1.3;-1.3	5.2	5.2	0.72013	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.64402	D	0.000002	D	0.95007	0.8384	H	0.99705	4.715	0.80722	D	1	D;D;B	0.89917	0.999;1.0;0.146	D;D;B	0.91635	0.977;0.999;0.099	D	0.97261	0.9904	10	0.87932	D	0	.	18.9452	0.92620	0.0:1.0:0.0:0.0	.	3168;3337;3297	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	S	3297;3337;2607;3168;3267	ENSP00000345799:W3297S;ENSP00000297405:W3337S;ENSP00000341558:W2607S;ENSP00000412263:W3168S;ENSP00000343124:W3267S	ENSP00000297405:W3337S	W	-	2	0	CSMD3	113336685	1.000000	0.71417	1.000000	0.80357	0.683000	0.39861	7.581000	0.82535	2.712000	0.92718	0.655000	0.94253	TGG	-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP		0.373	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSMD3	protein_coding	OTTHUMT00000347141.1	C	NM_052900	-		113267509	-1	no_errors	ENST00000297405	ensembl	human	known	74_37	missense	SNP	1.000	G
C16orf70	80262	genome.wustl.edu	37	16	67174002	67174002	+	Silent	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr16:67174002C>T	ENST00000219139.3	+	9	965	c.777C>T	c.(775-777)ttC>ttT	p.F259F	C16orf70_ENST00000569600.1_Silent_p.F259F	NM_025187.3	NP_079463.2	Q9BSU1	CP070_HUMAN	chromosome 16 open reading frame 70	259										cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(3)|skin(1)	17		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0017)|Epithelial(162;0.00655)|all cancers(182;0.0579)		ACAAAGTCTTCTATAAATCAG	0.368																																																	0								ENSG00000125149						82.0	75.0	78.0					16																	67174002		2199	4300	6499	C16orf70	SO:0001819	synonymous_variant	0			-	HGNC	AK022138	CCDS10828.1	16q22.1	2011-01-25	2006-04-12	2006-04-12	ENSG00000125149	ENSG00000125149			29564	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 6"""	C16orf6, LIN10		12477932	Standard	NM_025187		Approved	lin-10, FLJ12076	uc002erd.3	Q9BSU1	OTTHUMG00000137510	ENST00000219139.3:c.777C>T	16.37:g.67174002C>T		Somatic	0	82	0.00		0.41568620468393047	10	9.09	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	55	14.06	Q9HA86	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_UPF0183	p.F259	ENST00000219139.3	37	c.777	CCDS10828.1	16																																																																																			-	pfam_UPF0183		0.368	C16orf70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C16orf70	protein_coding	OTTHUMT00000268829.2	C	NM_025187	-		67174002	+1	no_errors	ENST00000219139	ensembl	human	known	74_37	silent	SNP	1.000	T
CNTNAP5	129684	genome.wustl.edu	37	2	125405445	125405445	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr2:125405445G>A	ENST00000431078.1	+	13	2348	c.1984G>A	c.(1984-1986)Gaa>Aaa	p.E662K		NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	662	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		GGGCAGCATGGAACAGCTGGA	0.627																																																	0								ENSG00000155052						34.0	38.0	37.0					2																	125405445		2105	4213	6318	CNTNAP5	SO:0001583	missense	0			-	HGNC	AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.1984G>A	2.37:g.125405445G>A	ENSP00000399013:p.Glu662Lys	Somatic	0	45	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	23	14.29	Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Laminin_G,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,superfamily_ConA-like_lec_gl_sf,superfamily_Fibrinogen_a/b/g_C_dom,smart_Coagulation_fac_5/8-C_type_dom,smart_Laminin_G,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Laminin_G	p.E662K	ENST00000431078.1	37	c.1984	CCDS46401.1	2	.	.	.	.	.	.	.	.	.	.	G	22.8	4.338688	0.81911	.	.	ENSG00000155052	ENST00000431078	T	0.14144	2.53	5.2	4.32	0.51571	.	0.382971	0.21593	N	0.072070	T	0.19208	0.0461	M	0.78916	2.43	0.58432	D	0.999999	B	0.32573	0.376	B	0.30855	0.121	T	0.02167	-1.1202	10	0.39692	T	0.17	.	13.2541	0.60068	0.0771:0.0:0.9229:0.0	.	662	Q8WYK1	CNTP5_HUMAN	K	662	ENSP00000399013:E662K	ENSP00000399013:E662K	E	+	1	0	CNTNAP5	125121915	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	9.705000	0.98719	1.329000	0.45376	0.561000	0.74099	GAA	-	NULL		0.627	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP5	protein_coding	OTTHUMT00000330864.3	G		-		125405445	+1	no_errors	ENST00000431078	ensembl	human	known	74_37	missense	SNP	1.000	A
PTPRZ1	5803	genome.wustl.edu	37	7	121668615	121668615	+	Silent	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr7:121668615C>T	ENST00000393386.2	+	14	5409	c.4998C>T	c.(4996-4998)ttC>ttT	p.F1666F	PTPRZ1_ENST00000449182.1_Silent_p.F806F	NM_001206838.1|NM_002851.2	NP_001193767.1|NP_002842.2	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type, Z polypeptide 1	1666					axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|hematopoietic progenitor cell differentiation (GO:0002244)|learning or memory (GO:0007611)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of oligodendrocyte progenitor proliferation (GO:0070445)	integral component of plasma membrane (GO:0005887)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(12)|large_intestine(17)|liver(1)|lung(42)|ovary(4)|prostate(5)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	106						GGAAATGCTTCCAGACTGCAC	0.363																																																	0								ENSG00000106278						153.0	133.0	139.0					7																	121668615		2203	4300	6503	PTPRZ1	SO:0001819	synonymous_variant	0			-	HGNC	M93426	CCDS34740.1, CCDS56505.1	7q31.3	2013-02-11			ENSG00000106278	ENSG00000106278		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9685	protein-coding gene	gene with protein product		176891		PTPZ, PTPRZ		7736789, 8387522	Standard	NM_001206838		Approved	PTP18, RPTPB, phosphacan	uc003vjy.3	P23471	OTTHUMG00000157057	ENST00000393386.2:c.4998C>T	7.37:g.121668615C>T		Somatic	0	61	0.00		0.41568620468393047	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	32	21.95	A4D0W5|C9JFM0|O76043|Q9UDR6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Carbonic_anhydrase_a,pfam_Fibronectin_type3,superfamily_Carbonic_anhydrase_a,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Carbonic_anhydrase_a,prints_Tyr_Pase_rcpt/non-rcpt	p.F1666	ENST00000393386.2	37	c.4998	CCDS34740.1	7																																																																																			-	NULL		0.363	PTPRZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRZ1	protein_coding	OTTHUMT00000347288.1	C	NM_002851	-		121668615	+1	no_errors	ENST00000393386	ensembl	human	known	74_37	silent	SNP	1.000	T
TECTA	7007	genome.wustl.edu	37	11	121016457	121016457	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr11:121016457G>A	ENST00000392793.1	+	12	4008	c.3737G>A	c.(3736-3738)gGc>gAc	p.G1246D	TECTA_ENST00000264037.2_Missense_Mutation_p.G1246D|TECTA_ENST00000478058.1_3'UTR			O75443	TECTA_HUMAN	tectorin alpha	1246	VWFD 3. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cell-matrix adhesion (GO:0007160)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)			TECTA/TBCEL(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|liver(1)|lung(46)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	135	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		CGCTACAACGGCAACCCTGAT	0.547																																																	0								ENSG00000109927						152.0	123.0	133.0					11																	121016457		2203	4299	6502	TECTA	SO:0001583	missense	0			-	HGNC	AF055136	CCDS8434.1	11q22-q24	2008-02-05			ENSG00000109927	ENSG00000109927			11720	protein-coding gene	gene with protein product		602574		DFNA12, DFNA8, DFNB21		9503015, 9590290	Standard	NM_005422		Approved		uc010rzo.2	O75443	OTTHUMG00000149908	ENST00000392793.1:c.3737G>A	11.37:g.121016457G>A	ENSP00000376543:p.Gly1246Asp	Somatic	0	48	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	32	13.51		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_ZP_dom,pfam_Nidogen_extracell_dom,pfam_TIL_dom,superfamily_TIL_dom,smart_Nidogen_extracell_dom,smart_VWC_out,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EG-like_dom,smart_ZP_dom,pfscan_ZP_dom	p.G1246D	ENST00000392793.1	37	c.3737	CCDS8434.1	11	.	.	.	.	.	.	.	.	.	.	G	16.19	3.052780	0.55218	.	.	ENSG00000109927	ENST00000392793;ENST00000264037	T;T	0.63096	-0.02;-0.02	5.76	5.76	0.90799	von Willebrand factor, type D domain (3);	0.277684	0.31370	N	0.007773	T	0.58793	0.2147	L	0.56396	1.775	0.39703	D	0.971215	B	0.10296	0.003	B	0.12156	0.007	T	0.55010	-0.8207	10	0.33141	T	0.24	.	14.1598	0.65438	0.0716:0.0:0.9284:0.0	.	1246	O75443	TECTA_HUMAN	D	1246	ENSP00000376543:G1246D;ENSP00000264037:G1246D	ENSP00000264037:G1246D	G	+	2	0	TECTA	120521667	1.000000	0.71417	0.930000	0.37139	0.929000	0.56500	4.264000	0.58859	2.721000	0.93114	0.591000	0.81541	GGC	-	pfam_VWF_type-D,smart_VWF_type-D		0.547	TECTA-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	TECTA	protein_coding	OTTHUMT00000313850.1	G	NM_005422	-		121016457	+1	no_errors	ENST00000264037	ensembl	human	known	74_37	missense	SNP	1.000	A
RYR1	6261	genome.wustl.edu	37	19	39051805	39051805	+	Missense_Mutation	SNP	C	C	T	rs193922847		TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr19:39051805C>T	ENST00000359596.3	+	90	12335	c.12335C>T	c.(12334-12336)tCg>tTg	p.S4112L	RYR1_ENST00000360985.3_Missense_Mutation_p.S4107L|RYR1_ENST00000355481.4_Missense_Mutation_p.S4107L			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	4112					calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	TTCCTGCTTTCGTGCTCCGAA	0.597																																																	0			GRCh37	CM071983	RYR1	M		ENSG00000196218						60.0	55.0	57.0					19																	39051805		2203	4300	6503	RYR1	SO:0001583	missense	0			-	HGNC	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.12335C>T	19.37:g.39051805C>T	ENSP00000352608:p.Ser4112Leu	Somatic	0	72	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	43	24.56	Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,superfamily_MG_RAP_rcpt_1,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_MIR_motif	p.S4112L	ENST00000359596.3	37	c.12335	CCDS33011.1	19	.	.	.	.	.	.	.	.	.	.	C	14.87	2.665540	0.47677	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	T;T;T	0.79454	-1.27;-1.27;-1.27	3.52	3.52	0.40303	EF-hand-like domain (1);	0.000000	0.64402	U	0.000004	D	0.87204	0.6119	M	0.78049	2.395	0.58432	D	0.999998	D;D;D	0.71674	0.998;0.998;0.998	D;D;D	0.79108	0.986;0.986;0.992	D	0.89130	0.3509	10	0.62326	D	0.03	.	15.2699	0.73693	0.0:1.0:0.0:0.0	.	4107;4107;4112	P21817-3;P21817-2;P21817	.;.;RYR1_HUMAN	L	4112;4107;4107	ENSP00000352608:S4112L;ENSP00000347667:S4107L;ENSP00000354254:S4107L	ENSP00000347667:S4107L	S	+	2	0	RYR1	43743645	1.000000	0.71417	0.981000	0.43875	0.844000	0.47949	7.569000	0.82380	1.992000	0.58205	0.478000	0.44815	TCG	-	NULL		0.597	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR1	protein_coding	OTTHUMT00000462137.1	C		rs193922847		39051805	+1	no_errors	ENST00000359596	ensembl	human	known	74_37	missense	SNP	0.999	T
NLRC3	197358	genome.wustl.edu	37	16	3614928	3614928	+	RNA	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr16:3614928C>T	ENST00000301749.7	-	0	515				NLRC3_ENST00000448023.2_RNA|NLRC3_ENST00000419350.2_RNA|NLRC3_ENST00000603507.1_RNA|NLRC3_ENST00000324659.8_RNA|NLRC3_ENST00000359128.5_RNA	NM_178844.2	NP_849172.2	Q7RTR2	NLRC3_HUMAN	NLR family, CARD domain containing 3						I-kappaB kinase/NF-kappaB signaling (GO:0007249)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|regulation of protein ubiquitination (GO:0031396)|response to lipopolysaccharide (GO:0032496)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(1)|liver(1)|lung(16)|ovary(2)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						GGAGCCTTGACTGCCCTTCCC	0.706																																																	0								ENSG00000167984						20.0	25.0	24.0					16																	3614928		1934	4116	6050	NLRC3			0			-	HGNC	BK001112	CCDS73817.1	16p13.3	2014-03-25			ENSG00000167984	ENSG00000167984		"""Nucleotide-binding domain and leucine rich repeat containing"""	29889	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 3"", ""NOD-like receptor C3"""	615648				15705585, 12766759	Standard	NM_178844		Approved	CLR16.2, FLJ00348, NOD3	uc010btn.3	Q7RTR2	OTTHUMG00000177561		16.37:g.3614928C>T		Somatic	0	19	0.00		0.41568620468393047	0	100.00	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	18	30.77	Q5EY36|Q8NF48|Q8NI01|Q8NI02|Q8TEL3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase	p.S84N	ENST00000301749.7	37	c.251		16	.	.	.	.	.	.	.	.	.	.	C	4.809	0.150408	0.09185	.	.	ENSG00000167984	ENST00000419350;ENST00000301749;ENST00000359128;ENST00000448023;ENST00000324659	T;T;T;D	0.81579	-0.6;-0.64;-0.56;-1.51	4.33	2.19	0.27852	.	0.878451	0.09868	N	0.745297	T	0.64271	0.2583	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.49093	-0.8975	9	0.25751	T	0.34	.	3.8534	0.08965	0.0:0.5723:0.2046:0.2232	.	84	C9JLH9	.	N	37;37;37;84;54	ENSP00000301749:S37N;ENSP00000352039:S37N;ENSP00000414415:S84N;ENSP00000323897:S54N	ENSP00000301749:S37N	S	-	2	0	NLRC3	3554929	0.000000	0.05858	0.061000	0.19648	0.100000	0.18952	-0.174000	0.09839	0.833000	0.34828	0.650000	0.86243	AGT	-	NULL		0.706	NLRC3-201	KNOWN	basic|appris_principal	protein_coding	NLRC3	polymorphic_pseudogene		C	NM_178844	-		3614928	-1	no_errors	ENST00000448023	ensembl	human	known	74_37	missense	SNP	0.079	T
PHF10	55274	genome.wustl.edu	37	6	170118904	170118904	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr6:170118904G>A	ENST00000339209.4	-	3	428	c.305C>T	c.(304-306)tCc>tTc	p.S102F	PHF10_ENST00000366780.4_Missense_Mutation_p.S102F|PHF10_ENST00000464779.1_5'UTR	NM_018288.3|NM_133325.2	NP_060758.2|NP_579866.2	Q8WUB8	PHF10_HUMAN	PHD finger protein 10	102	Essential to induce neural progenitor proliferation. {ECO:0000250}.|SAY.				nervous system development (GO:0007399)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	npBAF complex (GO:0071564)	zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|liver(3)|lung(4)|prostate(2)|urinary_tract(1)	14		Breast(66;5.08e-05)|Ovarian(120;0.208)		OV - Ovarian serous cystadenocarcinoma(33;1.4e-21)|BRCA - Breast invasive adenocarcinoma(81;1.4e-07)|GBM - Glioblastoma multiforme(31;0.00176)		CCTTTTAAAGGAGGTCACACC	0.313																																																	0								ENSG00000130024						79.0	85.0	83.0					6																	170118904		2203	4293	6496	PHF10	SO:0001583	missense	0			-	HGNC	AF338735	CCDS5308.2, CCDS5309.2	6q27	2014-05-13			ENSG00000130024	ENSG00000130024		"""Zinc fingers, PHD-type"""	18250	protein-coding gene	gene with protein product		613069				11827455	Standard	NM_018288		Approved	FLJ10975, XAP135, BAF45a	uc011egy.2	Q8WUB8	OTTHUMG00000016058	ENST00000339209.4:c.305C>T	6.37:g.170118904G>A	ENSP00000341805:p.Ser102Phe	Somatic	0	83	0.00		0.41568620468393047	18	25.00	6	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	35	32.69	Q2YDA3|Q53HG8|Q9BXD2|Q9NV26	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.S102F	ENST00000339209.4	37	c.305	CCDS5308.2	6	.	.	.	.	.	.	.	.	.	.	G	24.1	4.497240	0.85069	.	.	ENSG00000130024	ENST00000366780;ENST00000339209	T;T	0.31510	1.49;1.49	5.49	5.49	0.81192	.	0.105878	0.64402	D	0.000002	T	0.52354	0.1729	M	0.80616	2.505	0.80722	D	1	D;D	0.71674	0.998;0.995	D;P	0.79108	0.992;0.903	T	0.56685	-0.7938	10	0.87932	D	0	-17.0443	16.8851	0.86074	0.0:0.0:1.0:0.0	.	102;102	Q8WUB8-2;Q8WUB8	.;PHF10_HUMAN	F	102	ENSP00000355743:S102F;ENSP00000341805:S102F	ENSP00000341805:S102F	S	-	2	0	PHF10	169860829	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.084000	0.94076	2.724000	0.93272	0.557000	0.71058	TCC	-	NULL		0.313	PHF10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PHF10	protein_coding	OTTHUMT00000346732.1	G	NM_018288	-		170118904	-1	no_errors	ENST00000339209	ensembl	human	known	74_37	missense	SNP	1.000	A
DNAAF1	123872	genome.wustl.edu	37	16	84203832	84203832	+	Silent	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr16:84203832G>A	ENST00000378553.5	+	8	1522	c.1398G>A	c.(1396-1398)ggG>ggA	p.G466G	DNAAF1_ENST00000334315.5_Intron|DNAAF1_ENST00000563818.1_3'UTR	NM_178452.4	NP_848547.4	Q8NEP3	DAAF1_HUMAN	dynein, axonemal, assembly factor 1	466	Pro-rich.				axonemal dynein complex assembly (GO:0070286)|cilium morphogenesis (GO:0060271)|cilium movement (GO:0003341)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|inner dynein arm assembly (GO:0036159)|left/right pattern formation (GO:0060972)|lung development (GO:0030324)|motile cilium assembly (GO:0044458)|outer dynein arm assembly (GO:0036158)|regulation of cilium beat frequency (GO:0003356)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	dynein binding (GO:0045502)			NS(1)|endometrium(7)|kidney(1)|large_intestine(6)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|stomach(4)|urinary_tract(1)	41						AGCCAGAGGGGACCCTCCCAG	0.632																																																	0								ENSG00000154099						53.0	52.0	52.0					16																	84203832		2199	4300	6499	DNAAF1	SO:0001819	synonymous_variant	0			-	HGNC	BC024009	CCDS10943.2	16q24.1	2012-05-03	2011-06-09	2011-06-09	ENSG00000154099	ENSG00000154099			30539	protein-coding gene	gene with protein product	"""outer row dynein assembly 7 homolog (Chlamydomonas)"""	613190	"""leucine rich repeat containing 50"""	LRRC50		19944405	Standard	NM_178452		Approved	FLJ25330, ODA7, CILD13	uc002fhl.4	Q8NEP3	OTTHUMG00000128517	ENST00000378553.5:c.1398G>A	16.37:g.84203832G>A		Somatic	0	146	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	93	8.82	B4DJA3|Q69YI8|Q69YJ0|Q69YW5|Q96LP3|Q96MB6	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.G466	ENST00000378553.5	37	c.1398	CCDS10943.2	16																																																																																			-	NULL		0.632	DNAAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAAF1	protein_coding	OTTHUMT00000250328.3	G	NM_178452	-		84203832	+1	no_errors	ENST00000378553	ensembl	human	known	74_37	silent	SNP	0.858	A
CEACAM1	634	genome.wustl.edu	37	19	43031473	43031473	+	Silent	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr19:43031473C>T	ENST00000161559.6	-	2	278	c.144G>A	c.(142-144)ggG>ggA	p.G48G	CEACAM1_ENST00000599389.1_Silent_p.G48G|LIPE-AS1_ENST00000594688.1_RNA|CEACAM1_ENST00000352591.5_Silent_p.G48G|CEACAM1_ENST00000403461.1_Silent_p.G48G|LIPE-AS1_ENST00000457234.2_RNA|CEACAM1_ENST00000358394.3_Silent_p.G48G|CEACAM1_ENST00000308072.4_Silent_p.G8G|CEACAM1_ENST00000351134.3_Silent_p.G48G|CEACAM1_ENST00000403444.3_Silent_p.G48G|LIPE-AS1_ENST00000594624.2_RNA	NM_001712.4	NP_001703.2	P13688	CEAM1_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein)	48	Ig-like V-type.				angiogenesis (GO:0001525)|cell migration (GO:0016477)|homophilic cell adhesion (GO:0007156)|integrin-mediated signaling pathway (GO:0007229)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(1)	17		Prostate(69;0.00682)		GBM - Glioblastoma multiforme(486;0.00148)	Arcitumomab(DB00113)	GAACCTCCTTCCCCTCTGCAA	0.512																																																	0								ENSG00000079385						181.0	154.0	163.0					19																	43031473		2203	4300	6503	CEACAM1	SO:0001819	synonymous_variant	0			-	HGNC	M72238	CCDS12609.1, CCDS46089.1, CCDS54272.1, CCDS54273.1, CCDS54274.1	19q13.2	2014-05-16			ENSG00000079385	ENSG00000079385		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1814	protein-coding gene	gene with protein product		109770		BGP		2457922, 2025273	Standard	NM_001712		Approved	BGP1, CD66a	uc002otv.3	P13688	OTTHUMG00000151078	ENST00000161559.6:c.144G>A	19.37:g.43031473C>T		Somatic	0	118	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	65	19.75	A6NE38|A8MY49|O60430|Q069I7|Q13854|Q13857|Q13858|Q13859|Q13860|Q15600|Q15601|Q16170|Q5UB49|Q7KYP5|Q96CA7|Q9UQV9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_V-set,pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.G48	ENST00000161559.6	37	c.144	CCDS12609.1	19																																																																																			-	pfam_Ig_V-set,smart_Ig_sub		0.512	CEACAM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CEACAM1	protein_coding	OTTHUMT00000321190.2	C	NM_001712	-		43031473	-1	no_errors	ENST00000161559	ensembl	human	known	74_37	silent	SNP	0.002	T
GPC3	2719	genome.wustl.edu	37	X	132887634	132887634	+	Missense_Mutation	SNP	G	G	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chrX:132887634G>T	ENST00000370818.3	-	3	1352	c.907C>A	c.(907-909)Ctt>Att	p.L303I	GPC3_ENST00000543339.1_Missense_Mutation_p.L249I|GPC3_ENST00000394299.2_Missense_Mutation_p.L303I	NM_001164618.1|NM_004484.3	NP_001158090.1|NP_004475.1	P51654	GPC3_HUMAN	glypican 3	303					anatomical structure morphogenesis (GO:0009653)|anterior/posterior axis specification (GO:0009948)|body morphogenesis (GO:0010171)|bone mineralization (GO:0030282)|branching involved in ureteric bud morphogenesis (GO:0001658)|carbohydrate metabolic process (GO:0005975)|cell proliferation involved in metanephros development (GO:0072203)|chondroitin sulfate metabolic process (GO:0030204)|coronary vasculature development (GO:0060976)|embryonic hindlimb morphogenesis (GO:0035116)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lung development (GO:0030324)|mesenchymal cell proliferation involved in ureteric bud development (GO:0072138)|mesonephric duct morphogenesis (GO:0072180)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of growth (GO:0045926)|negative regulation of smoothened signaling pathway (GO:0045879)|osteoclast differentiation (GO:0030316)|phototransduction, visible light (GO:0007603)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of endocytosis (GO:0045807)|positive regulation of glucose import (GO:0046326)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of plasma membrane (GO:0046658)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	peptidyl-dipeptidase inhibitor activity (GO:0060422)			breast(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(17)|prostate(1)|skin(2)	36	Acute lymphoblastic leukemia(192;0.000127)					AGTTCTTCAAGGGACAGAATG	0.443			"""T, D, Mis, N, F, S"""			Wilms tumour			Simpson-Golabi-Behmel syndrome																														yes	Rec/X		Simpson-Golabi-Behmel syndrome	X	Xq26.1	2719	glypican 3		O	0								ENSG00000147257						606.0	392.0	465.0					X																	132887634		2203	4300	6503	GPC3	SO:0001583	missense	0	Familial Cancer Database	SGBS	-	HGNC	L47125	CCDS14638.1, CCDS55496.1	Xq26	2014-09-17			ENSG00000147257	ENSG00000147257		"""Proteoglycans / Cell Surface : Glypicans"""	4451	protein-coding gene	gene with protein product	"""glypican proteoglycan 3"""	300037		SDYS		8589713, 9787072	Standard	NM_004484		Approved	OCI-5, SGBS, SGBS1, SGB, DGSX	uc010nrn.2	P51654	OTTHUMG00000022448	ENST00000370818.3:c.907C>A	X.37:g.132887634G>T	ENSP00000359854:p.Leu303Ile	Somatic	0	26	0.00		0.41568620468393047	239	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	13	18.75	C9JLE3|G3V1R0|Q2L880|Q2L882	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Glypican	p.L303I	ENST00000370818.3	37	c.907	CCDS14638.1	X	.	.	.	.	.	.	.	.	.	.	G	15.63	2.889360	0.52014	.	.	ENSG00000147257	ENST00000370818;ENST00000394299;ENST00000543339	T;T;T	0.64085	-0.08;-0.08;-0.08	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	T	0.70605	0.3243	L	0.61218	1.895	0.43693	D	0.996147	D;D;P;D	0.55605	0.972;0.966;0.88;0.972	P;P;P;P	0.60415	0.874;0.872;0.773;0.773	T	0.72581	-0.4250	10	0.54805	T	0.06	.	8.1831	0.31322	0.0828:0.0:0.7602:0.157	.	287;249;303;303	B4DTD8;G3V1R0;C9JLE3;P51654	.;.;.;GPC3_HUMAN	I	303;303;249	ENSP00000359854:L303I;ENSP00000377836:L303I;ENSP00000444222:L249I	ENSP00000359854:L303I	L	-	1	0	GPC3	132715300	1.000000	0.71417	0.982000	0.44146	0.935000	0.57460	3.709000	0.54853	2.397000	0.81536	0.594000	0.82650	CTT	-	pfam_Glypican		0.443	GPC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPC3	protein_coding	OTTHUMT00000058356.1	G	NM_004484	-		132887634	-1	no_errors	ENST00000394299	ensembl	human	known	74_37	missense	SNP	1.000	T
IGSF10	285313	genome.wustl.edu	37	3	151156058	151156058	+	Silent	SNP	G	G	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr3:151156058G>T	ENST00000282466.3	-	6	6290	c.6291C>A	c.(6289-6291)acC>acA	p.T2097T	IGSF10_ENST00000495443.1_5'UTR	NM_001178145.1|NM_001178146.1|NM_178822.4	NP_001171616.1|NP_001171617.1|NP_849144.2	Q6WRI0	IGS10_HUMAN	immunoglobulin superfamily, member 10	2097	Ig-like C2-type 7.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)	extracellular region (GO:0005576)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(24)|liver(4)|lung(43)|ovary(8)|prostate(4)|skin(9)|stomach(1)|urinary_tract(3)	116			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			TGTTGAAAAGGGTATATCTCC	0.458																																																	0								ENSG00000152580						150.0	145.0	147.0					3																	151156058		2203	4300	6503	IGSF10	SO:0001819	synonymous_variant	0			-	HGNC	AY273815	CCDS3160.1	3q25.1	2013-01-11			ENSG00000152580	ENSG00000152580		"""Immunoglobulin superfamily / I-set domain containing"""	26384	protein-coding gene	gene with protein product						12477932	Standard	NM_178822		Approved	FLJ25972, CMF608	uc011bod.2	Q6WRI0	OTTHUMG00000159856	ENST00000282466.3:c.6291C>A	3.37:g.151156058G>T		Somatic	0	64	0.00		0.41568620468393047	4	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52	Q86YJ9|Q8N772|Q8NA84	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	p.T2097	ENST00000282466.3	37	c.6291	CCDS3160.1	3																																																																																			-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.458	IGSF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGSF10	protein_coding	OTTHUMT00000357782.1	G	NM_178822	-		151156058	-1	no_errors	ENST00000282466	ensembl	human	known	74_37	silent	SNP	0.071	T
DMBT1P1	375940	genome.wustl.edu	37	10	124516506	124516506	+	RNA	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr10:124516506G>A	ENST00000439464.2	+	0	297					NR_003570.1																						GCACAACTGTGGGCACCTGGA	0.507																																																	0								ENSG00000176584																																			RP11-318C4.2			0			-	Clone_based_vega_gene																													10.37:g.124516506G>A		Somatic	0	39	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	22	37.14		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000439464.2	37	NULL		10																																																																																			-	-		0.507	RP11-318C4.2-001	KNOWN	basic	processed_transcript	FLJ46361	pseudogene	OTTHUMT00000471298.1	G		-		124516506	+1	no_errors	ENST00000439464	ensembl	human	known	74_37	rna	SNP	0.156	A
GPR97	222487	genome.wustl.edu	37	16	57719754	57719754	+	Missense_Mutation	SNP	G	G	C			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr16:57719754G>C	ENST00000333493.4	+	11	1617	c.1456G>C	c.(1456-1458)Gtg>Ctg	p.V486L	GPR97_ENST00000327655.6_Missense_Mutation_p.V276L|GPR97_ENST00000450388.3_Missense_Mutation_p.V366L|RP11-405F3.4_ENST00000563062.1_RNA	NM_170776.4	NP_740746.4	Q86Y34	GPR97_HUMAN	G protein-coupled receptor 97	486					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(9)|lung(7)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						CTCGAGCCTGGTGGGTGTGAC	0.607																																																	0								ENSG00000182885						111.0	95.0	100.0					16																	57719754		2198	4300	6498	GPR97	SO:0001583	missense	0			-	HGNC	AY140959	CCDS10786.1	16q13	2014-08-08			ENSG00000182885	ENSG00000182885		"""-"", ""GPCR / Class B : Orphans"""	13728	protein-coding gene	gene with protein product						12435584, 222487	Standard	NM_170776		Approved	Pb99, PGR26	uc002emh.3	Q86Y34	OTTHUMG00000133458	ENST00000333493.4:c.1456G>C	16.37:g.57719754G>C	ENSP00000332900:p.Val486Leu	Somatic	0	56	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	35	27.08	Q6ZMF4|Q86SL9|Q8IZF1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_2_secretin-like,pfam_GPS_dom,smart_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like,prints_GPCR_2_orphan_rcpt_GPR56	p.V486L	ENST00000333493.4	37	c.1456	CCDS10786.1	16	.	.	.	.	.	.	.	.	.	.	G	8.152	0.787506	0.16258	.	.	ENSG00000182885	ENST00000333493;ENST00000327655;ENST00000450388	T;T;T	0.24723	1.84;1.84;1.84	5.62	1.29	0.21616	GPCR, family 2-like (1);	0.541334	0.16523	N	0.210712	T	0.07143	0.0181	N	0.01464	-0.85	0.26545	N	0.974018	B	0.09022	0.002	B	0.14023	0.01	T	0.40478	-0.9561	10	0.02654	T	1	.	8.3447	0.32266	0.0654:0.3954:0.4409:0.0983	.	486	Q86Y34	GPR97_HUMAN	L	486;276;366	ENSP00000332900:V486L;ENSP00000331199:V276L;ENSP00000404803:V366L	ENSP00000331199:V276L	V	+	1	0	GPR97	56277255	1.000000	0.71417	0.991000	0.47740	0.352000	0.29268	1.142000	0.31540	-0.182000	0.10602	-0.808000	0.03180	GTG	-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like		0.607	GPR97-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR97	protein_coding	OTTHUMT00000257333.2	G	NM_170776	-		57719754	+1	no_errors	ENST00000333493	ensembl	human	known	74_37	missense	SNP	0.999	C
ALG10	84920	genome.wustl.edu	37	12	34179346	34179346	+	Silent	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr12:34179346C>T	ENST00000266483.2	+	3	1237	c.918C>T	c.(916-918)ctC>ctT	p.L306L	AC046130.1_ENST00000401300.2_RNA|RP11-847H18.2_ENST00000501954.2_RNA|ALG10_ENST00000538927.1_Intron	NM_032834.3	NP_116223.3	Q5BKT4	AG10A_HUMAN	ALG10, alpha-1,2-glucosyltransferase	306					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	transferase activity, transferring hexosyl groups (GO:0016758)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	26	Lung NSC(5;3.82e-05)|Acute lymphoblastic leukemia(23;0.0142)|all_hematologic(23;0.0429)	Lung NSC(34;0.204)|all_lung(34;0.235)				TTCCTCATCTCCTGTCTCCTA	0.343																																																	0								ENSG00000139133						126.0	134.0	131.0					12																	34179346		2203	4296	6499	ALG10	SO:0001819	synonymous_variant	0			-	HGNC	AJ312278	CCDS41769.1	12p11.21	2013-03-04	2013-03-04		ENSG00000139133	ENSG00000139133	2.4.1.256		23162	protein-coding gene	gene with protein product	"""derepression of ITR1 expression 2 homolog (S. cerevisiae)"", ""dolichyl-P-Glc:Glc(2)Man(9)GlcNAc(2)-PP-dolichol alpha-1,2- glucosyltransferase"""	603313	"""asparagine-linked glycosylation 10, alpha-1,2-glucosyltransferase homolog (yeast)"", ""asparagine-linked glycosylation 10, alpha-1,2-glucosyltransferase homolog (S. pombe)"""				Standard	NM_032834		Approved	FLJ14751, DIE2, ALG10A	uc001rlm.3	Q5BKT4	OTTHUMG00000169285	ENST00000266483.2:c.918C>T	12.37:g.34179346C>T		Somatic	0	62	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	47	12.96	Q6NS98|Q96DU0|Q96SM6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Alg10,pirsf_Alg10	p.L306	ENST00000266483.2	37	c.918	CCDS41769.1	12																																																																																			-	pfam_Alg10,pirsf_Alg10		0.343	ALG10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALG10	protein_coding	OTTHUMT00000403309.1	C	NM_032834	-		34179346	+1	no_errors	ENST00000266483	ensembl	human	known	74_37	silent	SNP	0.938	T
IL2RB	3560	genome.wustl.edu	37	22	37524772	37524772	+	Missense_Mutation	SNP	C	C	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr22:37524772C>A	ENST00000216223.5	-	10	1218	c.1020G>T	c.(1018-1020)caG>caT	p.Q340H		NM_000878.3	NP_000869.1	P14784	IL2RB_HUMAN	interleukin 2 receptor, beta	340					cytokine-mediated signaling pathway (GO:0019221)|interleukin-2-mediated signaling pathway (GO:0038110)|negative regulation of apoptotic process (GO:0043066)|protein complex assembly (GO:0006461)|signal transduction (GO:0007165)|viral process (GO:0016032)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	interleukin-2 binding (GO:0019976)|interleukin-2 receptor activity (GO:0004911)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)|skin(5)	23					Aldesleukin(DB00041)|Basiliximab(DB00074)|Daclizumab(DB00111)|Denileukin diftitox(DB00004)	GCACCTTGTCCTGCTGCAGGA	0.607																																																	0								ENSG00000100385						73.0	62.0	66.0					22																	37524772		2203	4300	6503	IL2RB	SO:0001583	missense	0			-	HGNC	M26062	CCDS13942.1	22q13	2011-02-15			ENSG00000100385	ENSG00000100385		"""Interleukins and interleukin receptors"", ""CD molecules"""	6009	protein-coding gene	gene with protein product		146710	"""interleukin 15 receptor, beta"""	IL15RB			Standard	NM_000878		Approved	CD122	uc003aqv.1	P14784	OTTHUMG00000150534	ENST00000216223.5:c.1020G>T	22.37:g.37524772C>A	ENSP00000216223:p.Gln340His	Somatic	0	46	0.00		0.41568620468393047	6	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	24	14.29	B2R765	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.Q340H	ENST00000216223.5	37	c.1020	CCDS13942.1	22	.	.	.	.	.	.	.	.	.	.	C	14.37	2.515613	0.44763	.	.	ENSG00000100385	ENST00000216223	T	0.09163	3.01	4.64	2.36	0.29203	.	1.225600	0.05641	N	0.583505	T	0.23727	0.0574	L	0.57536	1.79	0.09310	N	1	D	0.62365	0.991	P	0.60473	0.875	T	0.10917	-1.0609	10	0.46703	T	0.11	-12.6628	5.0629	0.14566	0.0:0.612:0.1761:0.2119	.	340	P14784	IL2RB_HUMAN	H	340	ENSP00000216223:Q340H	ENSP00000216223:Q340H	Q	-	3	2	IL2RB	35854718	0.017000	0.18338	0.960000	0.40013	0.498000	0.33706	0.509000	0.22707	1.060000	0.40578	0.655000	0.94253	CAG	-	NULL		0.607	IL2RB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL2RB	protein_coding	OTTHUMT00000318792.1	C		-		37524772	-1	no_errors	ENST00000216223	ensembl	human	known	74_37	missense	SNP	0.005	A
GPR116	221395	genome.wustl.edu	37	6	46830777	46830777	+	Missense_Mutation	SNP	T	T	C			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr6:46830777T>C	ENST00000283296.7	-	15	2335	c.2047A>G	c.(2047-2049)Atc>Gtc	p.I683V	GPR116_ENST00000265417.7_Missense_Mutation_p.I683V|GPR116_ENST00000545669.1_Missense_Mutation_p.I112V|GPR116_ENST00000456426.2_Missense_Mutation_p.I541V|GPR116_ENST00000362015.4_Missense_Mutation_p.I683V	NM_001098518.1	NP_001091988.1	Q8IZF2	GP116_HUMAN	G protein-coupled receptor 116	683					energy reserve metabolic process (GO:0006112)|fat cell differentiation (GO:0045444)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|neuropeptide signaling pathway (GO:0007218)|regulation of lipid metabolic process (GO:0019216)|surfactant homeostasis (GO:0043129)	cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(21)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	59			Lung(136;0.192)			AGCTTCTGGATGACTTTCCCC	0.507																																					NSCLC(59;410 1274 8751 36715 50546)												0								ENSG00000069122						92.0	87.0	89.0					6																	46830777		2203	4300	6503	GPR116	SO:0001583	missense	0			-	HGNC	AB018301	CCDS4919.1	6p12.3	2014-08-08			ENSG00000069122	ENSG00000069122		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19030	protein-coding gene	gene with protein product						12435584	Standard	NM_001098518		Approved	DKFZp564O1923, KIAA0758	uc003oyo.3	Q8IZF2	OTTHUMG00000014793	ENST00000283296.7:c.2047A>G	6.37:g.46830777T>C	ENSP00000283296:p.Ile683Val	Somatic	0	46	0.00		0.41568620468393047	29	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	30	11.76	O94858|Q5TF06|Q6RGN2|Q86SP0|Q9Y3Z2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_2_secretin-like,pfam_SEA_dom,pfam_GPS_dom,pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,smart_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,pfscan_Ig-like_dom,prints_GPCR_2_Ig-hepta_rcpt,prints_GPCR_2_secretin-like	p.I683V	ENST00000283296.7	37	c.2047	CCDS4919.1	6	.	.	.	.	.	.	.	.	.	.	T	11.17	1.559197	0.27827	.	.	ENSG00000069122	ENST00000452370;ENST00000283296;ENST00000362015;ENST00000456426;ENST00000545557;ENST00000265417;ENST00000545669	T;T;T;T;T	0.25912	1.81;2.19;1.83;1.81;1.77	5.33	2.92	0.33932	.	0.417811	0.22259	N	0.062430	T	0.07638	0.0192	M	0.72118	2.19	0.23524	N	0.997495	P;B;P;B;P	0.36027	0.459;0.063;0.533;0.064;0.533	B;B;B;B;B	0.30943	0.122;0.032;0.076;0.07;0.076	T	0.31530	-0.9940	10	0.17369	T	0.5	-16.4765	4.0825	0.09932	0.1506:0.1661:0.0:0.6833	.	112;238;683;541;683	F5GWK9;B4DTV3;E9PBS6;Q8IZF2-3;Q8IZF2	.;.;.;.;GP116_HUMAN	V	683;683;683;541;54;683;112	ENSP00000283296:I683V;ENSP00000354563:I683V;ENSP00000412866:I541V;ENSP00000265417:I683V;ENSP00000441581:I112V	ENSP00000265417:I683V	I	-	1	0	GPR116	46938736	0.434000	0.25570	0.998000	0.56505	0.587000	0.36485	1.070000	0.30653	0.422000	0.26005	-0.290000	0.09829	ATC	-	prints_GPCR_2_Ig-hepta_rcpt		0.507	GPR116-201	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR116	protein_coding	OTTHUMT00000040806.2	T	NM_015234	-		46830777	-1	no_errors	ENST00000265417	ensembl	human	known	74_37	missense	SNP	0.987	C
LINC00662	148189	genome.wustl.edu	37	19	28248296	28248296	+	lincRNA	SNP	G	G	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr19:28248296G>T	ENST00000562493.1	-	0	3461																											ATGGGCTTTTGGGGACCTTTA	0.428																																																	0								ENSG00000261770																																			CTC-459F4.1			0			-	Clone_based_vega_gene																													19.37:g.28248296G>T		Somatic	0	27	0.00		0.41568620468393047	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	14	17.65		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000562493.1	37	NULL		19																																																																																			-	-		0.428	CTC-459F4.1-001	KNOWN	basic	lincRNA	ENSG00000261770	lincRNA	OTTHUMT00000431028.1	G		-		28248296	-1	no_errors	ENST00000562493	ensembl	human	known	74_37	rna	SNP	0.043	T
PDE4B	5142	genome.wustl.edu	37	1	66723501	66723501	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr1:66723501G>A	ENST00000329654.4	+	6	726	c.539G>A	c.(538-540)aGa>aAa	p.R180K	PDE4B_ENST00000371048.3_3'UTR|PDE4B_ENST00000371049.3_Missense_Mutation_p.R180K|PDE4B_ENST00000423207.2_Missense_Mutation_p.R165K	NM_001037341.1	NP_001032418.1	Q07343	PDE4B_HUMAN	phosphodiesterase 4B, cAMP-specific	180					cAMP catabolic process (GO:0006198)|cellular response to drug (GO:0035690)|cellular response to epinephrine stimulus (GO:0071872)|cellular response to lipopolysaccharide (GO:0071222)|leukocyte migration (GO:0050900)|negative regulation of relaxation of cardiac muscle (GO:1901898)|neutrophil chemotaxis (GO:0030593)|neutrophil homeostasis (GO:0001780)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-2 production (GO:0032743)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of high voltage-gated calcium channel activity (GO:1901841)|T cell receptor signaling pathway (GO:0050852)	cell periphery (GO:0071944)|cytosol (GO:0005829)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|Z disc (GO:0030018)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(14)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	37					Adenosine monophosphate(DB00131)|Amrinone(DB01427)|Caffeine(DB00201)|Dyphylline(DB00651)|Enprofylline(DB00824)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Papaverine(DB01113)|Pentoxifylline(DB00806)|Roflumilast(DB01656)|Theobromine(DB01412)|Theophylline(DB00277)	CGAAGTGTGAGAAACAACTTC	0.378																																																	0								ENSG00000184588						124.0	115.0	118.0					1																	66723501		2203	4300	6503	PDE4B	SO:0001583	missense	0			-	HGNC	L20971	CCDS632.1, CCDS30742.1, CCDS30743.1, CCDS72802.1	1p31	2010-06-24	2010-06-24		ENSG00000184588	ENSG00000184588		"""Phosphodiesterases"""	8781	protein-coding gene	gene with protein product	"""phosphodiesterase E4 dunce homolog (Drosophila)"""	600127	"""phosphodiesterase 4B, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E4)"", ""phosphodiesterase 4B, cAMP-specific (phosphodiesterase E4 dunce homolog, Drosophila)"""	DPDE4			Standard	XM_005270925		Approved		uc001dco.3	Q07343	OTTHUMG00000009088	ENST00000329654.4:c.539G>A	1.37:g.66723501G>A	ENSP00000332116:p.Arg180Lys	Somatic	0	45	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	31	24.39	A5YW33|O15443|Q13945|Q5TEK4|Q5TEK5|Q5TEK6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PDEase_catalytic_dom,smart_HD/PDEase_dom,prints_PDEase	p.R180K	ENST00000329654.4	37	c.539	CCDS632.1	1	.	.	.	.	.	.	.	.	.	.	G	26.9	4.785068	0.90282	.	.	ENSG00000184588	ENST00000329654;ENST00000341517;ENST00000371049;ENST00000423207;ENST00000412480	T;T;T;T;D	0.85013	-1.13;-1.13;-1.13;-1.14;-1.93	5.07	4.16	0.48862	.	0.081308	0.85682	D	0.000000	D	0.85839	0.5790	M	0.78916	2.43	0.58432	D	0.999995	P;P;P	0.52170	0.951;0.919;0.919	P;P;P	0.51974	0.686;0.489;0.489	D	0.88044	0.2783	10	0.87932	D	0	.	12.7438	0.57268	0.0798:0.0:0.9202:0.0	.	165;170;180	Q07343-3;Q59GM8;Q07343	.;.;PDE4B_HUMAN	K	180;180;180;165;88	ENSP00000332116:R180K;ENSP00000342637:R180K;ENSP00000360088:R180K;ENSP00000392947:R165K;ENSP00000397548:R88K	ENSP00000332116:R180K	R	+	2	0	PDE4B	66496089	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.461000	0.90372	1.505000	0.48720	0.650000	0.86243	AGA	-	NULL		0.378	PDE4B-001	KNOWN	basic|CCDS	protein_coding	PDE4B	protein_coding	OTTHUMT00000025188.3	G	NM_002600	-		66723501	+1	no_errors	ENST00000329654	ensembl	human	known	74_37	missense	SNP	1.000	A
PTPN5	84867	genome.wustl.edu	37	11	18759455	18759455	+	Silent	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr11:18759455C>T	ENST00000358540.2	-	9	1402	c.972G>A	c.(970-972)cgG>cgA	p.R324R	PTPN5_ENST00000396167.2_Silent_p.R292R|PTPN5_ENST00000496201.2_5'Flank|RP11-1081L13.4_ENST00000527285.1_RNA|PTPN5_ENST00000396171.4_Silent_p.R324R|PTPN5_ENST00000396168.1_Silent_p.R300R|PTPN5_ENST00000396170.1_Silent_p.R292R|PTPN5_ENST00000477854.1_Silent_p.R128R	NM_006906.1	NP_008837.1	P54829	PTN5_HUMAN	protein tyrosine phosphatase, non-receptor type 5 (striatum-enriched)	324	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	phosphotyrosine binding (GO:0001784)|protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(13)|ovary(2)|prostate(1)|skin(4)	27						ACCGGTTCTTCCGCACCAGCC	0.582																																																	0								ENSG00000110786						158.0	128.0	138.0					11																	18759455		2199	4293	6492	PTPN5	SO:0001819	synonymous_variant	0			-	HGNC	BC064807	CCDS7845.1, CCDS41626.1, CCDS60746.1	11p15.1	2011-06-09			ENSG00000110786	ENSG00000110786		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9657	protein-coding gene	gene with protein product		176879				1714595	Standard	NM_001278236		Approved	STEP, PTPSTEP	uc001mpc.4	P54829	OTTHUMG00000134304	ENST00000358540.2:c.972G>A	11.37:g.18759455C>T		Somatic	0	94	0.00		0.41568620468393047	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	38	15.56	B3KXG7|B7Z386|B7ZAF5|D3DQY7|Q6P1Z2|Q8N2A1|Q8NDP8	Silent	SNP	NA	NA	NA	NA	NA	NA	pirsf_Tyr_Pase_rcpt_R/non-rcpt_5,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_KIM-con,prints_Tyr_Pase_rcpt/non-rcpt,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	p.R324	ENST00000358540.2	37	c.972	CCDS7845.1	11																																																																																			-	pirsf_Tyr_Pase_rcpt_R/non-rcpt_5,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,pfscan_Tyr_Pase_rcpt/non-rcpt		0.582	PTPN5-001	KNOWN	basic|CCDS	protein_coding	PTPN5	protein_coding	OTTHUMT00000259196.2	C	NM_001039970	-		18759455	-1	no_errors	ENST00000358540	ensembl	human	known	74_37	silent	SNP	0.992	T
PRORY	100533178	genome.wustl.edu	37	Y	23545488	23545488	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chrY:23545488G>A	ENST00000382764.1	-	3	380	c.284C>T	c.(283-285)cCt>cTt	p.P95L		NM_001282471.1	NP_001269400.1	Q9H606	PRORY_HUMAN		95	Pro-rich.																TGGAGAGGCAGGAGGAGGATC	0.647																																																	0								ENSG00000183146																																			CYorf17	SO:0001583	missense	0			-	HGNC																												ENST00000382764.1:c.284C>T	Y.37:g.23545488G>A	ENSP00000372213:p.Pro95Leu	Somatic	0	82	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	24	45.45		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF1725	p.P95L	ENST00000382764.1	37	c.284		Y																																																																																			-	NULL		0.647	CYorf17-001	KNOWN	basic|appris_principal	protein_coding	CYorf17	protein_coding	OTTHUMT00000100103.1	G		-		23545488	-1	no_errors	ENST00000382764	ensembl	human	known	74_37	missense	SNP	0.208	A
PRIMPOL	201973	genome.wustl.edu	37	4	185599481	185599481	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr4:185599481C>T	ENST00000314970.6	+	8	1373	c.940C>T	c.(940-942)Cct>Tct	p.P314S	PRIMPOL_ENST00000512834.1_Missense_Mutation_p.P314S|PRIMPOL_ENST00000515774.1_Missense_Mutation_p.P185S|PRIMPOL_ENST00000503752.1_Missense_Mutation_p.P314S	NM_152683.2	NP_689896	Q96LW4	PRIPO_HUMAN	primase and polymerase (DNA-directed)	314					mitochondrial DNA replication (GO:0006264)|replication fork processing (GO:0031297)|response to UV (GO:0009411)|translesion synthesis (GO:0019985)	mitochondrial matrix (GO:0005759)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA primase activity (GO:0003896)|DNA-directed DNA polymerase activity (GO:0003887)|manganese ion binding (GO:0030145)										CAAATTTTTTCCTATACAGTC	0.328																																																	0								ENSG00000164306						49.0	51.0	51.0					4																	185599481		2201	4291	6492	PRIMPOL	SO:0001583	missense	0			-	HGNC	AK057729	CCDS3837.1, CCDS75211.1, CCDS75212.1	4q35.1	2013-09-27	2013-09-27	2013-09-27	ENSG00000164306	ENSG00000164306			26575	protein-coding gene	gene with protein product		615421	"""coiled-coil domain containing 111"""	CCDC111		12477932	Standard	XM_005262814		Approved	FLJ33167	uc003iwk.2	Q96LW4	OTTHUMG00000160495	ENST00000314970.6:c.940C>T	4.37:g.185599481C>T	ENSP00000313816:p.Pro314Ser	Somatic	0	47	0.00		0.41568620468393047	5	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	26	27.78	D3DP55|D6RDM1|Q5HYJ9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DNA_primase_UL52/UL70_Herpvir,pfam_DNA_primase_S	p.P314S	ENST00000314970.6	37	c.940	CCDS3837.1	4	.	.	.	.	.	.	.	.	.	.	C	7.407	0.633957	0.14322	.	.	ENSG00000164306	ENST00000314970;ENST00000515774;ENST00000503752;ENST00000512834	T;T;T;T	0.32515	1.46;1.45;1.46;1.45	5.95	5.95	0.96441	.	0.310402	0.34700	N	0.003759	T	0.29355	0.0731	M	0.66506	2.035	0.40883	D	0.984013	B;B	0.31227	0.314;0.177	B;B	0.25405	0.06;0.048	T	0.10086	-1.0645	10	0.07813	T	0.8	-22.4777	15.1469	0.72662	0.1412:0.8588:0.0:0.0	.	314;314	Q96LW4;D6RDM1	CC111_HUMAN;.	S	314;185;314;314	ENSP00000313816:P314S;ENSP00000421913:P185S;ENSP00000420860:P314S;ENSP00000425316:P314S	ENSP00000313816:P314S	P	+	1	0	CCDC111	185836475	0.672000	0.27530	0.976000	0.42696	0.049000	0.14656	2.444000	0.44890	2.824000	0.97209	0.655000	0.94253	CCT	-	NULL		0.328	PRIMPOL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PRIMPOL	protein_coding	OTTHUMT00000360827.1	C	NM_152683	-		185599481	+1	no_errors	ENST00000314970	ensembl	human	known	74_37	missense	SNP	0.921	T
CADM3	57863	genome.wustl.edu	37	1	159163736	159163736	+	Silent	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr1:159163736C>T	ENST00000368125.4	+	5	754	c.597C>T	c.(595-597)acC>acT	p.T199T	CTA-134P22.2_ENST00000415675.2_RNA|CADM3_ENST00000368124.4_Silent_p.T233T	NM_001127173.1	NP_001120645.1	Q8N126	CADM3_HUMAN	cell adhesion molecule 3	199	Ig-like C2-type 1.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|protein localization (GO:0008104)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(20)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	55	all_hematologic(112;0.0429)					TCCAGGTTACCCGGGAGGATG	0.498																																																	0								ENSG00000162706						110.0	95.0	100.0					1																	159163736		2203	4300	6503	CADM3	SO:0001819	synonymous_variant	0			-	HGNC	AY046418	CCDS1182.1, CCDS44251.1	1q21.2-q22	2013-01-29	2007-02-07	2007-02-07	ENSG00000162706	ENSG00000162706		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17601	protein-coding gene	gene with protein product	"""nectin-like 1"""	609743	"""immunoglobulin superfamily, member 4B"""	IGSF4B		11536053	Standard	NM_021189		Approved	BIgR, FLJ10698, TSLL1, NECL1, SynCAM3, Necl-1	uc001ftk.2	Q8N126	OTTHUMG00000037177	ENST00000368125.4:c.597C>T	1.37:g.159163736C>T		Somatic	0	66	0.00		0.41568620468393047	23	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	29	25.64	Q8IZQ9|Q9NVJ5|Q9UJP1	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_CD80_C2-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Ig_C1-set,smart_Ig_sub,smart_Ig_sub2,smart_Neurexin-like,pfscan_Ig-like_dom	p.T233	ENST00000368125.4	37	c.699	CCDS44251.1	1																																																																																			-	pfam_CD80_C2-set,pfam_Ig_C1-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.498	CADM3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CADM3	protein_coding	OTTHUMT00000090330.1	C	NM_021189	-		159163736	+1	no_errors	ENST00000368124	ensembl	human	known	74_37	silent	SNP	0.990	T
NRXN1	9378	genome.wustl.edu	37	2	50147836	50147845	+	3'UTR	DEL	GTGTGTGTGT	GTGTGTGTGT	-	rs200264093|rs201814381|rs199597709|rs199689866|rs368179294|rs200969250|rs66612444		TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	GTGTGTGTGT	GTGTGTGTGT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr2:50147836_50147845delGTGTGTGTGT	ENST00000406316.2	-	0	7147_7156				NRXN1_ENST00000342183.5_3'UTR|NRXN1_ENST00000401710.1_3'UTR|NRXN1_ENST00000404971.1_3'UTR	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1						adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			CTGTGGATTCgtgtgtgtgtgtgtgtgtgt	0.395																																																	0								ENSG00000179915																																			NRXN1	SO:0001624	3_prime_UTR_variant	0				HGNC	AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.*1246ACACACACAC>-	2.37:g.50147846_50147855delGTGTGTGTGT		Somatic	NA	NA	NA		0.41568620468393047	4	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000406316.2	37	NULL	CCDS54360.1	2																																																																																			-	-		0.395	NRXN1-001	KNOWN	basic|CCDS	protein_coding	NRXN1	protein_coding	OTTHUMT00000325291.2	GTGTGTGTGT				50147845	-1	no_errors	ENST00000484192	ensembl	human	known	74_37	rna	DEL	0.000:0.001:0.005:0.106:0.113:0.127:0.107:0.109:0.093:0.096	-
KIF24	347240	genome.wustl.edu	37	9	34255997	34255997	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr9:34255997C>T	ENST00000402558.2	-	10	3632	c.3608G>A	c.(3607-3609)gGa>gAa	p.G1203E	KIF24_ENST00000345050.2_Missense_Mutation_p.G1069E|KIF24_ENST00000379166.2_Missense_Mutation_p.G1203E|KIF24_ENST00000379174.3_Missense_Mutation_p.G1069E			Q5T7B8	KIF24_HUMAN	kinesin family member 24	1203					ATP catabolic process (GO:0006200)|cilium assembly (GO:0042384)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)	centriole (GO:0005814)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(4)|liver(1)|lung(13)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	32			LUSC - Lung squamous cell carcinoma(29;0.0107)			GAGTGTAGGTCCAGAATGGGG	0.557																																																	0								ENSG00000186638						114.0	111.0	112.0					9																	34255997		2203	4300	6503	KIF24	SO:0001583	missense	0			-	HGNC	AK001795	CCDS6551.2	9p13.3	2013-01-10			ENSG00000186638	ENSG00000186638		"""Kinesins"", ""Sterile alpha motif (SAM) domain containing"""	19916	protein-coding gene	gene with protein product		613747	"""chromosome 9 open reading frame 48"""	C9orf48		12477932	Standard	NM_194313		Approved	bA571F15.4, FLJ10933, FLJ43884	uc003zua.4	Q5T7B8	OTTHUMG00000019810	ENST00000402558.2:c.3608G>A	9.37:g.34255997C>T	ENSP00000384433:p.Gly1203Glu	Somatic	0	46	0.00		0.41568620468393047	0	100.00	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	35	30.00	Q2TB93|Q5T7B5|Q5T7B7|Q6ZU97|Q6ZUZ2|Q86XZ0|Q9NV43	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Kinesin_motor_dom,pfam_SAM_type1,superfamily_P-loop_NTPase,superfamily_SAM/pointed,smart_Kinesin_motor_dom,pfscan_SAM,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.G1203E	ENST00000402558.2	37	c.3608	CCDS6551.2	9	.	.	.	.	.	.	.	.	.	.	C	9.396	1.076739	0.20227	.	.	ENSG00000186638	ENST00000402558;ENST00000379174;ENST00000379166;ENST00000345050	T;T;T;T	0.71341	-0.35;-0.56;-0.35;-0.56	4.44	0.341	0.15991	.	1.057170	0.07441	N	0.897362	T	0.49729	0.1574	N	0.16478	0.41	0.09310	N	1	B	0.10296	0.003	B	0.08055	0.003	T	0.26258	-1.0108	9	.	.	.	.	5.0606	0.14555	0.0:0.4612:0.345:0.1938	.	1203	Q5T7B8	KIF24_HUMAN	E	1203;1069;1203;1069	ENSP00000384433:G1203E;ENSP00000368472:G1069E;ENSP00000368464:G1203E;ENSP00000340179:G1069E	.	G	-	2	0	KIF24	34245997	0.002000	0.14202	0.076000	0.20297	0.623000	0.37688	0.096000	0.15147	-0.028000	0.13850	0.655000	0.94253	GGA	-	NULL		0.557	KIF24-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF24	protein_coding	OTTHUMT00000052150.5	C		-		34255997	-1	no_errors	ENST00000379166	ensembl	human	known	74_37	missense	SNP	0.010	T
SMCHD1	23347	genome.wustl.edu	37	18	2762122	2762122	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr18:2762122C>T	ENST00000320876.6	+	36	4792	c.4454C>T	c.(4453-4455)cCt>cTt	p.P1485L	SMCHD1_ENST00000261598.8_Missense_Mutation_p.P1485L|RP11-703M24.5_ENST00000583546.1_RNA	NM_015295.2	NP_056110.2	A6NHR9	SMHD1_HUMAN	structural maintenance of chromosomes flexible hinge domain containing 1	1485					chromosome organization (GO:0051276)|inactivation of X chromosome by DNA methylation (GO:0060821)	Barr body (GO:0001740)	ATP binding (GO:0005524)			NS(3)|breast(3)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(16)|lung(15)|pancreas(1)	45						GAAGTCCTGCCTAATCAACCT	0.378																																																	0								ENSG00000101596						186.0	171.0	176.0					18																	2762122		1850	4103	5953	SMCHD1	SO:0001583	missense	0			-	HGNC	AB014550	CCDS45822.1	18p11.32	2010-05-12			ENSG00000101596	ENSG00000101596			29090	protein-coding gene	gene with protein product		614982				9734811	Standard	NM_015295		Approved	KIAA0650	uc002klm.4	A6NHR9		ENST00000320876.6:c.4454C>T	18.37:g.2762122C>T	ENSP00000326603:p.Pro1485Leu	Somatic	0	48	0.00		0.41568620468393047	2	33.33	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	16	15.79	O75141|Q6AHX6|Q6ZTQ8|Q9H6Q2|Q9UG39	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SMC_hinge,superfamily_SMC_hinge,superfamily_HATPase_ATP-bd,smart_SMC_hinge	p.P1485L	ENST00000320876.6	37	c.4454	CCDS45822.1	18	.	.	.	.	.	.	.	.	.	.	C	24.5	4.537834	0.85917	.	.	ENSG00000101596	ENST00000320876;ENST00000261598	T;T	0.36699	1.24;1.26	5.34	5.34	0.76211	.	0.113873	0.64402	D	0.000012	T	0.62109	0.2401	M	0.71581	2.175	0.58432	D	0.999994	D	0.89917	1.0	D	0.83275	0.996	T	0.65455	-0.6164	10	0.87932	D	0	-12.6505	19.0383	0.92987	0.0:1.0:0.0:0.0	.	1485	A6NHR9	SMHD1_HUMAN	L	1485	ENSP00000326603:P1485L;ENSP00000261598:P1485L	ENSP00000261598:P1485L	P	+	2	0	SMCHD1	2752122	1.000000	0.71417	0.996000	0.52242	0.974000	0.67602	5.614000	0.67695	2.492000	0.84095	0.650000	0.86243	CCT	-	NULL		0.378	SMCHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMCHD1	protein_coding	OTTHUMT00000441082.2	C		-		2762122	+1	no_errors	ENST00000320876	ensembl	human	known	74_37	missense	SNP	1.000	T
ECE2	9718	genome.wustl.edu	37	3	183975449	183975449	+	Nonsense_Mutation	SNP	G	G	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr3:183975449G>T	ENST00000402825.3	+	2	385	c.385G>T	c.(385-387)Gag>Tag	p.E129*	ECE2_ENST00000324557.4_Nonsense_Mutation_p.E129*|EIF2B5_ENST00000444495.1_Intron	NM_014693.3	NP_055508.3	O60344	ECE2_HUMAN	endothelin converting enzyme 2	129	Methyltransferase-like region.				brain development (GO:0007420)|cardioblast differentiation (GO:0010002)|cell-cell signaling (GO:0007267)|heart development (GO:0007507)|peptide hormone processing (GO:0016486)	cytoplasmic vesicle membrane (GO:0030659)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|methyltransferase activity (GO:0008168)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|lung(13)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(4)	49	all_cancers(143;1.39e-10)|Ovarian(172;0.0339)		Epithelial(37;8.28e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			TGTGGTGCTCGAGAAGGGCAC	0.612																																																	0								ENSG00000145194						60.0	58.0	59.0					3																	183975449		2203	4300	6503	ECE2	SO:0001587	stop_gained	0			-	HGNC	AF428263	CCDS3255.1, CCDS33899.1, CCDS3256.2, CCDS43179.1, CCDS46969.1	3q27.1	2007-07-26			ENSG00000145194	ENSG00000145194			13275	protein-coding gene	gene with protein product		610145				11718899	Standard	NM_032331		Approved	KIAA0604, MGC2408	uc003fni.4	O60344	OTTHUMG00000150551	ENST00000402825.3:c.385G>T	3.37:g.183975449G>T	ENSP00000384223:p.Glu129*	Somatic	0	37	0.00		0.41568620468393047	20	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	35	10.26	A5PLK8|Q6NTG7|Q6UW36|Q8NFD7|Q96NX3|Q96NX4|Q9BRZ8	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_M13_N,pfam_Peptidase_M13_C,pfam_Methyltransf_11,prints_Peptidase_M13_C	p.E129*	ENST00000402825.3	37	c.385	CCDS3256.2	3	.	.	.	.	.	.	.	.	.	.	G	34	5.386457	0.95967	.	.	ENSG00000145194	ENST00000324557;ENST00000402825	.	.	.	5.99	5.99	0.97316	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-6.926	19.4659	0.94939	0.0:0.0:1.0:0.0	.	.	.	.	X	129	.	ENSP00000314295:E129X	E	+	1	0	ECE2	185458143	1.000000	0.71417	0.969000	0.41365	0.907000	0.53573	8.692000	0.91284	2.840000	0.97914	0.655000	0.94253	GAG	-	pfam_Methyltransf_11		0.612	ECE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ECE2	protein_coding	OTTHUMT00000318874.3	G	NM_014693	-		183975449	+1	no_errors	ENST00000402825	ensembl	human	known	74_37	nonsense	SNP	1.000	T
C17orf51	339263	genome.wustl.edu	37	17	21476999	21476999	+	Intron	SNP	C	C	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr17:21476999C>A	ENST00000535846.1	-	1	219				RP11-822E23.6_ENST00000536958.2_RNA|RP11-822E23.8_ENST00000426261.2_RNA			A8MQB3	CQ051_HUMAN	chromosome 17 open reading frame 51											endometrium(1)	1						TCCTCTTGATCCTAGAAAAGA	0.577																																																	0								ENSG00000272780																																			RP11-822E23.8	SO:0001627	intron_variant	0			-	Clone_based_vega_gene	BC010612	CCDS45629.1	17p11.2	2012-10-11			ENSG00000212719	ENSG00000212719			27904	protein-coding gene	gene with protein product							Standard	XM_005256621		Approved	FLJ12977, FLJ31874, FLJ33618	uc002gyw.4	A8MQB3	OTTHUMG00000132832	ENST00000535846.1:c.489+504G>T	17.37:g.21476999C>A		Somatic	0	33	0.00		0.41568620468393047	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	12	25.00	B2RN29|B5MCL4	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000535846.1	37	NULL		17																																																																																			-	-		0.577	C17orf51-003	KNOWN	basic|readthrough_transcript	processed_transcript	ENSG00000272780	protein_coding	OTTHUMT00000395737.1	C	NM_001113434	-		21476999	-1	no_errors	ENST00000426261	ensembl	human	known	74_37	rna	SNP	0.003	A
BCL9	607	genome.wustl.edu	37	1	147094275	147094275	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr1:147094275G>A	ENST00000234739.3	+	9	3846	c.3106G>A	c.(3106-3108)Gat>Aat	p.D1036N		NM_004326.2	NP_004317.2	O00512	BCL9_HUMAN	B-cell CLL/lymphoma 9	1036	Pro-rich.				canonical Wnt signaling pathway (GO:0060070)|myotube differentiation involved in skeletal muscle regeneration (GO:0014908)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell maintenance (GO:0035019)	cis-Golgi network (GO:0005801)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)				breast(1)|large_intestine(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	7	all_hematologic(923;0.115)					GGCCAGCTCAGATGACGACTC	0.483			T	"""IGH@, IGL@"""	B-ALL																																			Dom	yes		1	1q21	607	B-cell CLL/lymphoma 9		L	0								ENSG00000116128						147.0	138.0	141.0					1																	147094275		2203	4300	6503	BCL9	SO:0001583	missense	0			-	HGNC	Y13620	CCDS30833.1	1q21	2008-02-05			ENSG00000116128	ENSG00000116128			1008	protein-coding gene	gene with protein product		602597				9490669	Standard	NM_004326		Approved		uc001epq.3	O00512	OTTHUMG00000014031	ENST00000234739.3:c.3106G>A	1.37:g.147094275G>A	ENSP00000234739:p.Asp1036Asn	Somatic	0	55	0.00		0.41568620468393047	24	4.00	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	39	11.11	Q5T489	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_BCL9_beta-catenin-bd_dom	p.D1036N	ENST00000234739.3	37	c.3106	CCDS30833.1	1	.	.	.	.	.	.	.	.	.	.	G	36	5.803867	0.96967	.	.	ENSG00000116128	ENST00000234739	T	0.52057	0.68	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	T	0.60235	0.2253	L	0.54323	1.7	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.69307	0.963;0.963	T	0.61559	-0.7038	10	0.87932	D	0	-13.4833	20.063	0.97692	0.0:0.0:1.0:0.0	.	1036;1036	Q1JQ81;O00512	.;BCL9_HUMAN	N	1036	ENSP00000234739:D1036N	ENSP00000234739:D1036N	D	+	1	0	BCL9	145560899	1.000000	0.71417	0.995000	0.50966	0.996000	0.88848	9.869000	0.99810	2.735000	0.93741	0.655000	0.94253	GAT	-	NULL		0.483	BCL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCL9	protein_coding	OTTHUMT00000039468.1	G	NM_004326	-		147094275	+1	no_errors	ENST00000234739	ensembl	human	known	74_37	missense	SNP	1.000	A
LMO7	4008	genome.wustl.edu	37	13	76374987	76374987	+	Silent	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr13:76374987C>T	ENST00000341547.4	+	8	2046	c.786C>T	c.(784-786)tcC>tcT	p.S262S	LMO7_ENST00000526202.1_Silent_p.S171S|LMO7_ENST00000465261.2_5'UTR|LMO7_ENST00000321797.8_5'UTR|RP11-29G8.3_ENST00000563635.1_RNA|LMO7_ENST00000357063.3_Silent_p.S262S|LMO7_ENST00000377534.3_Silent_p.S262S	NM_005358.5	NP_005349.3	Q8WWI1	LMO7_HUMAN	LIM domain 7	262					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(20)|lung(15)|ovary(2)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		Breast(118;0.0992)		GBM - Glioblastoma multiforme(99;0.0109)		CAAGCTGCTCCTCTGATATCA	0.463																																																	0								ENSG00000136153						173.0	180.0	178.0					13																	76374987		2203	4300	6503	LMO7	SO:0001819	synonymous_variant	0			-	HGNC	AF092557	CCDS9454.1, CCDS53876.1	13q22.2	2008-02-05	2004-06-15		ENSG00000136153	ENSG00000136153			6646	protein-coding gene	gene with protein product	"""F-box only protein 20"""	604362	"""LIM domain only 7"""	FBXO20		9826547, 10531035	Standard	NM_005358		Approved	FBX20, KIAA0858	uc021rkq.1	Q8WWI1	OTTHUMG00000017093	ENST00000341547.4:c.786C>T	13.37:g.76374987C>T		Somatic	0	72	0.00		0.41568620468393047	1	66.67	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	37	22.92	E9PLH4|O15462|O95346|Q5TBK6|Q9UKC1|Q9UQM5|Q9Y6A7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_CH-domain,pfam_PDZ,superfamily_CH-domain,superfamily_PDZ,smart_CH-domain,smart_PDZ,pfscan_CH-domain,pfscan_PDZ,prints_SM22_calponin	p.S262	ENST00000341547.4	37	c.786	CCDS9454.1	13																																																																																			-	NULL		0.463	LMO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LMO7	protein_coding	OTTHUMT00000045297.1	C	NM_005358	-		76374987	+1	no_errors	ENST00000357063	ensembl	human	known	74_37	silent	SNP	1.000	T
CHRNB4	1143	genome.wustl.edu	37	15	78917389	78917389	+	3'UTR	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr15:78917389G>A	ENST00000261751.3	-	0	1694				CHRNB4_ENST00000412074.2_Silent_p.L202L|RP11-335K5.2_ENST00000559120.1_RNA	NM_000750.3	NP_000741.1	P30926	ACHB4_HUMAN	cholinergic receptor, nicotinic, beta 4 (neuronal)						action potential (GO:0001508)|behavioral response to nicotine (GO:0035095)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|locomotory behavior (GO:0007626)|regulation of neurotransmitter secretion (GO:0046928)|regulation of smooth muscle contraction (GO:0006940)|signal transduction (GO:0007165)|smooth muscle contraction (GO:0006939)|synaptic transmission (GO:0007268)|synaptic transmission involved in micturition (GO:0060084)|synaptic transmission, cholinergic (GO:0007271)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ligand-gated ion channel activity (GO:0015276)			endometrium(7)|kidney(1)|lung(13)|prostate(1)	22					Dextromethorphan(DB00514)|Galantamine(DB00674)|Levomethadyl Acetate(DB01227)|Nicotine(DB00184)|Pentolinium(DB01090)	TATTTACTTAGGGCCTCATCA	0.592																																																	0								ENSG00000117971																																			CHRNB4	SO:0001624	3_prime_UTR_variant	0			-	HGNC	U48861	CCDS10306.1, CCDS58392.1	15q24	2012-02-11	2012-02-07		ENSG00000117971	ENSG00000117971		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1964	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, beta 4 (neuronal)"""	118509	"""cholinergic receptor, nicotinic, beta polypeptide 4"""			2004777	Standard	NM_000750		Approved		uc002bed.1	P30926	OTTHUMG00000143860	ENST00000261751.3:c.*86C>T	15.37:g.78917389G>A		Somatic	0	73	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	42	23.64	A4FTX5|E9PHE8|Q16607|Q4VBA5|Q8WXC8|Q9BQR4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,prints_Nicotinic_acetylcholine_rcpt,prints_Neur_channel	p.L202	ENST00000261751.3	37	c.604	CCDS10306.1	15																																																																																			-	NULL		0.592	CHRNB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRNB4	protein_coding	OTTHUMT00000290108.1	G		-		78917389	-1	no_errors	ENST00000412074	ensembl	human	putative	74_37	silent	SNP	0.093	A
LOC400794	400794	genome.wustl.edu	37	1	165551316	165551316	+	RNA	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr1:165551316C>T	ENST00000438275.1	-	0	49				RP11-280O1.2_ENST00000421273.1_RNA|RP11-280O1.2_ENST00000416424.1_RNA																							CCTAGCTCTCCATTGTCCCCA	0.617																																																	0								ENSG00000237463																																			RP11-280O1.2			0			-	Clone_based_vega_gene																													1.37:g.165551316C>T		Somatic	0	110	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	59	15.71		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000438275.1	37	NULL		1																																																																																			-	-		0.617	RP11-280O1.2-002	KNOWN	non_canonical_TEC|basic	antisense	LOC400794	antisense	OTTHUMT00000083787.1	C		-		165551316	-1	no_errors	ENST00000416424	ensembl	human	known	74_37	rna	SNP	1.000	T
ITPRIPL2	162073	genome.wustl.edu	37	16	19132639	19132639	+	3'UTR	SNP	T	T	G			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr16:19132639T>G	ENST00000381440.3	+	0	7386				CTD-2349B8.1_ENST00000564808.2_Intron|RP11-626G11.3_ENST00000567236.1_RNA	NM_001034841.3	NP_001030013.1	Q3MIP1	IPIL2_HUMAN	inositol 1,4,5-trisphosphate receptor interacting protein-like 2							integral component of membrane (GO:0016021)				endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	9						AGAACATTCATCCTATTTTAT	0.368																																																	0								ENSG00000261759																																			RP11-626G11.3	SO:0001624	3_prime_UTR_variant	0			-	Clone_based_vega_gene		CCDS32395.1	16p12.3	2011-04-28	2011-04-28		ENSG00000205730	ENSG00000205730			27257	protein-coding gene	gene with protein product			"""inositol 1,4,5-triphosphate receptor interacting protein-like 2"""				Standard	NM_001034841		Approved	FLJ22994, MGC126798, MGC126800, LOC162073	uc002dfu.4	Q3MIP1		ENST00000381440.3:c.*5248T>G	16.37:g.19132639T>G		Somatic	0	79	0.00		0.41568620468393047	106	17.19	22	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	31	24.39		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000381440.3	37	NULL	CCDS32395.1	16																																																																																			-	-		0.368	ITPRIPL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000261759	protein_coding	OTTHUMT00000435827.3	T	NM_001034841	-		19132639	-1	no_errors	ENST00000567236	ensembl	human	known	74_37	rna	SNP	1.000	G
ADGB	79747	genome.wustl.edu	37	6	147136210	147136210	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr6:147136210G>A	ENST00000397944.3	+	36	4937	c.4861G>A	c.(4861-4863)Gaa>Aaa	p.E1621K	ADGB_ENST00000367493.3_3'UTR|ADGB_ENST00000367488.1_3'UTR	NM_024694.3	NP_078970.3	Q8N7X0	ADGB_HUMAN	androglobin	1621					oxygen transport (GO:0015671)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)			breast(1)|endometrium(2)|kidney(2)	5						CGACATCCGGGAAGAGTACAG	0.468																																																	0								ENSG00000118492						15.0	16.0	16.0					6																	147136210		691	1591	2282	ADGB	SO:0001583	missense	0			-	HGNC	AK026774		6q24.2	2012-02-03	2012-02-03	2012-02-03	ENSG00000118492	ENSG00000118492			21212	protein-coding gene	gene with protein product		614630	"""chromosome 6 open reading frame 103"""	C6orf103		22115833	Standard	NM_024694		Approved	FLJ23121, dJ408K24.1	uc010khx.3	Q8N7X0	OTTHUMG00000015758	ENST00000397944.3:c.4861G>A	6.37:g.147136210G>A	ENSP00000381036:p.Glu1621Lys	Somatic	0	91	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	48	14.29	Q5T402|Q5T904|Q5T905	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_C2_calpain_cat,superfamily_Globin-like,smart_Peptidase_C2_calpain_cat,pfscan_IQ_motif_EF-hand-BS,pfscan_Peptidase_C2_calpain_cat	p.E1621K	ENST00000397944.3	37	c.4861		6	.	.	.	.	.	.	.	.	.	.	g	16.51	3.143139	0.57044	.	.	ENSG00000118492	ENST00000397944;ENST00000367490	T;T	0.67171	0.38;-0.25	4.1	4.1	0.47936	.	.	.	.	.	T	0.60919	0.2306	N	0.19112	0.55	0.29510	N	0.854264	D;P	0.76494	0.999;0.93	D;B	0.80764	0.994;0.365	T	0.61133	-0.7124	9	0.72032	D	0.01	-14.3004	14.2201	0.65820	0.0:0.0:1.0:0.0	.	1621;566	Q8N7X0;Q8N7X0-2	CAN7L_HUMAN;.	K	1621;579	ENSP00000381036:E1621K;ENSP00000356460:E579K	ENSP00000356460:E579K	E	+	1	0	C6orf103	147177903	1.000000	0.71417	0.799000	0.32177	0.210000	0.24377	5.784000	0.68990	1.999000	0.58509	0.398000	0.26397	GAA	-	NULL		0.468	ADGB-009	KNOWN	basic|appris_principal	protein_coding	ADGB	protein_coding	OTTHUMT00000376350.2	G	NM_024694	-		147136210	+1	no_errors	ENST00000397944	ensembl	human	known	74_37	missense	SNP	0.992	A
CRY1	1407	genome.wustl.edu	37	12	107393622	107393622	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr12:107393622G>A	ENST00000008527.5	-	7	1711	c.844C>T	c.(844-846)Cct>Tct	p.P282S		NM_004075.4	NP_004066.1	Q16526	CRY1_HUMAN	cryptochrome circadian clock 1	282					blue light signaling pathway (GO:0009785)|circadian regulation of gene expression (GO:0032922)|DNA damage induced protein phosphorylation (GO:0006975)|DNA repair (GO:0006281)|entrainment of circadian clock by photoperiod (GO:0043153)|gluconeogenesis (GO:0006094)|glucose homeostasis (GO:0042593)|lipid storage (GO:0019915)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|negative regulation of glucocorticoid receptor signaling pathway (GO:2000323)|negative regulation of glucocorticoid secretion (GO:2000850)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein-chromophore linkage (GO:0018298)|regulation of circadian rhythm (GO:0042752)|regulation of DNA damage checkpoint (GO:2000001)|response to glucagon (GO:0033762)|response to insulin (GO:0032868)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	blue light photoreceptor activity (GO:0009882)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|DNA photolyase activity (GO:0003913)|double-stranded DNA binding (GO:0003690)|nuclear hormone receptor binding (GO:0035257)|nucleotide binding (GO:0000166)|phosphatase binding (GO:0019902)|transcription factor binding transcription factor activity (GO:0000989)|ubiquitin binding (GO:0043130)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(11)|ovary(3)|skin(1)	29						GAAAGGGGAGGGGAACTGTTC	0.333																																																	0								ENSG00000008405						44.0	47.0	46.0					12																	107393622		2203	4300	6503	CRY1	SO:0001583	missense	0			-	HGNC	BC030519	CCDS9112.1	12q23-q24.1	2014-01-17	2014-01-17		ENSG00000008405	ENSG00000008405			2384	protein-coding gene	gene with protein product		601933	"""cryptochrome 1 (photolyase-like)"""	PHLL1		8921389	Standard	NM_004075		Approved		uc001tmi.4	Q16526	OTTHUMG00000170005	ENST00000008527.5:c.844C>T	12.37:g.107393622G>A	ENSP00000008527:p.Pro282Ser	Somatic	0	74	0.00		0.41568620468393047	42	32.26	20	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	34	16.28		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Photolyase_FAD-bd/Cryptochr_C,pfam_DNA_photolyase_N,superfamily_Photolyase_FAD-bd/Cryptochr_C,superfamily_DNA_photolyase_N	p.P282S	ENST00000008527.5	37	c.844	CCDS9112.1	12	.	.	.	.	.	.	.	.	.	.	G	29.3	4.996798	0.93167	.	.	ENSG00000008405	ENST00000008527	.	.	.	5.88	5.88	0.94601	DNA photolyase, FAD-binding/Cryptochrome, C-terminal (2);	0.000000	0.85682	D	0.000000	T	0.68016	0.2955	L	0.32530	0.975	0.80722	D	1	D	0.65815	0.995	D	0.67103	0.949	T	0.65598	-0.6129	9	0.44086	T	0.13	-14.7658	20.2381	0.98363	0.0:0.0:1.0:0.0	.	282	Q16526	CRY1_HUMAN	S	282	.	ENSP00000008527:P282S	P	-	1	0	CRY1	105917752	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	9.865000	0.99609	2.779000	0.95612	0.650000	0.86243	CCT	-	pfam_Photolyase_FAD-bd/Cryptochr_C,superfamily_Photolyase_FAD-bd/Cryptochr_C		0.333	CRY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRY1	protein_coding	OTTHUMT00000406827.1	G	NM_004075	-		107393622	-1	no_errors	ENST00000008527	ensembl	human	known	74_37	missense	SNP	1.000	A
BTBD8	284697	genome.wustl.edu	37	1	92554330	92554330	+	Silent	SNP	C	C	G			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr1:92554330C>G	ENST00000342818.3	+	2	461	c.225C>G	c.(223-225)gtC>gtG	p.V75V	BTBD8_ENST00000370382.3_Silent_p.V75V|BTBD8_ENST00000540648.1_Silent_p.V75V	NM_183242.3	NP_899065.2	Q5XKL5	BTBD8_HUMAN	BTB (POZ) domain containing 8	75	BTB 1. {ECO:0000255|PROSITE- ProRule:PRU00037}.					nucleus (GO:0005634)				breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(8)|ovary(1)	16		all_lung(203;0.0484)|Lung NSC(277;0.126)|Glioma(108;0.222)		all cancers(265;0.0153)|Epithelial(280;0.0982)		ACAAAGCAGTCCTTTTAGCAA	0.368																																																	0								ENSG00000189195						120.0	119.0	119.0					1																	92554330		2203	4299	6502	BTBD8	SO:0001819	synonymous_variant	0			-	HGNC	AY346333	CCDS737.1	1p22.1	2013-01-08			ENSG00000189195	ENSG00000189195		"""BTB/POZ domain containing"""	21019	protein-coding gene	gene with protein product						14654994	Standard	NM_183242		Approved		uc001doo.3	Q5XKL5	OTTHUMG00000010289	ENST00000342818.3:c.225C>G	1.37:g.92554330C>G		Somatic	0	114	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	84	15.15	Q6V9S5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pfscan_BTB/POZ-like	p.V75	ENST00000342818.3	37	c.225	CCDS737.1	1																																																																																			-	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pfscan_BTB/POZ-like		0.368	BTBD8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	BTBD8	protein_coding	OTTHUMT00000028372.1	C	NM_183242	-		92554330	+1	no_errors	ENST00000342818	ensembl	human	known	74_37	silent	SNP	1.000	G
COL11A2	1302	genome.wustl.edu	37	6	33130539	33130539	+	3'UTR	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr6:33130539C>T	ENST00000374708.4	-	0	6127				COL11A2_ENST00000361917.1_3'UTR|COL11A2_ENST00000374713.1_3'UTR|COL11A2_ENST00000341947.2_3'UTR|COL11A2_ENST00000374714.1_3'UTR|COL11A2_ENST00000477772.1_5'UTR|COL11A2_ENST00000357486.1_3'UTR|COL11A2_ENST00000395197.1_3'UTR|COL11A2_ENST00000374712.1_3'UTR	NM_080681.2	NP_542412.2	P13942	COBA2_HUMAN	collagen, type XI, alpha 2						cartilage development (GO:0051216)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|palate development (GO:0060021)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|soft palate development (GO:0060023)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			biliary_tract(1)|breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|liver(1)|lung(27)|ovary(5)|prostate(5)|skin(6)	68						cctgggagtcccttccatatg	0.512																																					Melanoma(1;90 116 3946 5341 17093)												0								ENSG00000204248																																			COL11A2	SO:0001624	3_prime_UTR_variant	0			-	HGNC	U32169	CCDS43452.1, CCDS54992.1	6p21.3	2013-01-16			ENSG00000204248	ENSG00000204248		"""Collagens"""	2187	protein-coding gene	gene with protein product		120290		DFNA13, DFNB53		7559422, 10581026	Standard	NM_080679		Approved	HKE5	uc003ocx.1	P13942	OTTHUMG00000031036	ENST00000374708.4:c.*916G>A	6.37:g.33130539C>T		Somatic	0	55	0.00		0.41568620468393047	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	24	33.33	A6NLX2|E7ER90|Q07751|Q13271|Q13272|Q13273|Q5JP94|Q5SUI8|Q7Z6C3|Q99866|Q9UIP9	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000374708.4	37	NULL	CCDS43452.1	6																																																																																			-	-		0.512	COL11A2-001	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	COL11A2	protein_coding	OTTHUMT00000076032.2	C		-		33130539	-1	no_errors	ENST00000477772	ensembl	human	known	74_37	rna	SNP	0.360	T
CHRNB4	1143	genome.wustl.edu	37	15	78917390	78917390	+	3'UTR	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr15:78917390G>A	ENST00000261751.3	-	0	1693				CHRNB4_ENST00000412074.2_Silent_p.A201A|RP11-335K5.2_ENST00000559120.1_RNA	NM_000750.3	NP_000741.1	P30926	ACHB4_HUMAN	cholinergic receptor, nicotinic, beta 4 (neuronal)						action potential (GO:0001508)|behavioral response to nicotine (GO:0035095)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|locomotory behavior (GO:0007626)|regulation of neurotransmitter secretion (GO:0046928)|regulation of smooth muscle contraction (GO:0006940)|signal transduction (GO:0007165)|smooth muscle contraction (GO:0006939)|synaptic transmission (GO:0007268)|synaptic transmission involved in micturition (GO:0060084)|synaptic transmission, cholinergic (GO:0007271)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ligand-gated ion channel activity (GO:0015276)			endometrium(7)|kidney(1)|lung(13)|prostate(1)	22					Dextromethorphan(DB00514)|Galantamine(DB00674)|Levomethadyl Acetate(DB01227)|Nicotine(DB00184)|Pentolinium(DB01090)	ATTTACTTAGGGCCTCATCAG	0.587																																																	0								ENSG00000117971																																			CHRNB4	SO:0001624	3_prime_UTR_variant	0			-	HGNC	U48861	CCDS10306.1, CCDS58392.1	15q24	2012-02-11	2012-02-07		ENSG00000117971	ENSG00000117971		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1964	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, beta 4 (neuronal)"""	118509	"""cholinergic receptor, nicotinic, beta polypeptide 4"""			2004777	Standard	NM_000750		Approved		uc002bed.1	P30926	OTTHUMG00000143860	ENST00000261751.3:c.*85C>T	15.37:g.78917390G>A		Somatic	0	72	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	41	22.64	A4FTX5|E9PHE8|Q16607|Q4VBA5|Q8WXC8|Q9BQR4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,prints_Nicotinic_acetylcholine_rcpt,prints_Neur_channel	p.A201	ENST00000261751.3	37	c.603	CCDS10306.1	15																																																																																			-	NULL		0.587	CHRNB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRNB4	protein_coding	OTTHUMT00000290108.1	G		-		78917390	-1	no_errors	ENST00000412074	ensembl	human	putative	74_37	silent	SNP	0.120	A
HMCN1	83872	genome.wustl.edu	37	1	186106679	186106679	+	Silent	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr1:186106679C>T	ENST00000271588.4	+	88	13861	c.13632C>T	c.(13630-13632)acC>acT	p.T4544T	HMCN1_ENST00000367492.2_Silent_p.T4544T	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	4544	TSP type-1 1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						GCAGTGTCACCTGTGGAAAAG	0.463																																																	0								ENSG00000143341						69.0	68.0	68.0					1																	186106679		2203	4300	6503	HMCN1	SO:0001819	synonymous_variant	0			-	HGNC	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.13632C>T	1.37:g.186106679C>T		Somatic	0	50	0.00		0.41568620468393047	13	23.53	4	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	43	17.31	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_G2_nidogen/fibulin_G2F,pfam_EGF-like_Ca-bd_dom,pfam_Thrombospondin_1_rpt,superfamily_GFP,superfamily_Thrombospondin_1_rpt,superfamily_Growth_fac_rcpt_N_dom,superfamily_Cadherin-like,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Thrombospondin_1_rpt,smart_G2_nidogen/fibulin_G2F,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_G2_nidogen/fibulin_G2F,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like_dom	p.T4544	ENST00000271588.4	37	c.13632	CCDS30956.1	1																																																																																			-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt		0.463	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMCN1	protein_coding	OTTHUMT00000131848.1	C	NM_031935	-		186106679	+1	no_errors	ENST00000271588	ensembl	human	known	74_37	silent	SNP	1.000	T
ITPR3	3710	genome.wustl.edu	37	6	33630709	33630709	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr6:33630709C>T	ENST00000374316.5	+	10	1940	c.880C>T	c.(880-882)Cgt>Tgt	p.R294C	ITPR3_ENST00000605930.1_Missense_Mutation_p.R294C			Q14573	ITPR3_HUMAN	inositol 1,4,5-trisphosphate receptor, type 3	294					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport into cytosol (GO:0060402)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|response to calcium ion (GO:0051592)|sensory perception of bitter taste (GO:0050913)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|nuclear outer membrane (GO:0005640)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)	inositol 1,3,4,5 tetrakisphosphate binding (GO:0043533)|inositol 1,4,5 trisphosphate binding (GO:0070679)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|inositol hexakisphosphate binding (GO:0000822)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)	p.R294C(1)		NS(1)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(24)|ovary(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	85					Caffeine(DB00201)	CGACCCCTGCCGTGGAGGAGC	0.632																																																	1	Substitution - Missense(1)	large_intestine(1)						ENSG00000096433						61.0	51.0	55.0					6																	33630709		2203	4300	6503	ITPR3	SO:0001583	missense	0			-	HGNC	D26351	CCDS4783.1	6p21.31	2011-11-24	2011-04-28		ENSG00000096433	ENSG00000096433		"""Ion channels / Inositol triphosphate receptors"""	6182	protein-coding gene	gene with protein product		147267	"""inositol 1,4,5-triphosphate receptor, type 3"""			8081734, 8288584	Standard	NM_002224		Approved	IP3R3	uc021ywr.1	Q14573	OTTHUMG00000014532	ENST00000374316.5:c.880C>T	6.37:g.33630709C>T	ENSP00000363435:p.Arg294Cys	Somatic	0	45	0.00		0.41568620468393047	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	9	37.50	Q14649|Q5TAQ2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ca-rel_channel,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ARM-type_fold,smart_MIR_motif,prints_InsP3_rcpt-bd,pfscan_MIR_motif	p.R294C	ENST00000374316.5	37	c.880	CCDS4783.1	6	.	.	.	.	.	.	.	.	.	.	c	23.1	4.378282	0.82682	.	.	ENSG00000096433	ENST00000374316	D	0.88277	-2.36	5.34	5.34	0.76211	MIR (2);	0.000000	0.85682	D	0.000000	D	0.94404	0.8200	M	0.88570	2.965	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95124	0.8249	10	0.87932	D	0	-13.3863	13.9414	0.64057	0.1519:0.8481:0.0:0.0	.	294	Q14573	ITPR3_HUMAN	C	294	ENSP00000363435:R294C	ENSP00000363435:R294C	R	+	1	0	ITPR3	33738687	1.000000	0.71417	0.996000	0.52242	0.767000	0.43475	2.408000	0.44574	2.494000	0.84150	0.306000	0.20318	CGT	-	pfam_MIR_motif,superfamily_MIR_motif,prints_InsP3_rcpt-bd		0.632	ITPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITPR3	protein_coding	OTTHUMT00000040204.2	C	NM_002224	-		33630709	+1	no_errors	ENST00000374316	ensembl	human	known	74_37	missense	SNP	1.000	T
BDH2	56898	genome.wustl.edu	37	4	104006543	104006543	+	Silent	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr4:104006543G>A	ENST00000296424.4	-	7	615	c.495C>T	c.(493-495)ttC>ttT	p.F165F		NM_020139.3	NP_064524.3	Q9BUT1	BDH2_HUMAN	3-hydroxybutyrate dehydrogenase, type 2	165					epithelial cell differentiation (GO:0030855)|fatty acid beta-oxidation (GO:0006635)|heme metabolic process (GO:0042168)|iron ion homeostasis (GO:0055072)|siderophore biosynthetic process (GO:0019290)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	3-hydroxybutyrate dehydrogenase activity (GO:0003858)|NAD binding (GO:0051287)|oxidoreductase activity, acting on the CH-CH group of donors, NAD or NADP as acceptor (GO:0016628)			breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(4)|urinary_tract(1)	10		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.02e-08)		CCTGCTGGATGAAATCTGCAG	0.493																																																	0								ENSG00000164039						57.0	47.0	51.0					4																	104006543		2203	4299	6502	BDH2	SO:0001819	synonymous_variant	0			-	HGNC	AF164790	CCDS3663.1	4q24	2011-09-14			ENSG00000164039	ENSG00000164039	1.1.1.30	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	32389	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 15C, member 1"""		"""dehydrogenase/reductase (SDR family) member 6"""	DHRS6		16380372, 19027726	Standard	XM_005263140		Approved	UCPA-OR, FLJ13261, UNQ6308, PRO20933, SDR15C1	uc003hwz.3	Q9BUT1	OTTHUMG00000074039	ENST00000296424.4:c.495C>T	4.37:g.104006543G>A		Somatic	0	74	0.00		0.41568620468393047	57	8.06	5	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	22	40.54	A8K295|B4DUF6|Q503A0|Q6IA46|Q6UWD3|Q9H8S8|Q9NRX8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_DH_sc/Rdtase_SDR,prints_Glc/ribitol_DH,prints_DHB_DH,prints_DH_sc/Rdtase_SDR,prints_ADH_insect	p.F165	ENST00000296424.4	37	c.495	CCDS3663.1	4																																																																																			-	prints_Glc/ribitol_DH,prints_DHB_DH,prints_DH_sc/Rdtase_SDR		0.493	BDH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BDH2	protein_coding	OTTHUMT00000157159.2	G	NM_020139	-		104006543	-1	no_errors	ENST00000296424	ensembl	human	known	74_37	silent	SNP	1.000	A
PCDHA9	9752	genome.wustl.edu	37	5	140230348	140230348	+	Silent	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr5:140230348G>A	ENST00000532602.1	+	1	3301	c.2268G>A	c.(2266-2268)caG>caA	p.Q756Q	PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA9_ENST00000378122.3_Silent_p.Q756Q|PCDHA5_ENST00000529619.1_Intron	NM_031857.1	NP_114063.1	Q9Y5H5	PCDA9_HUMAN	protocadherin alpha 9	756	5 X 4 AA repeats of P-X-X-P.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(18)|ovary(4)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	59			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGAGGAGGCAGAGGGTGTGCT	0.647																																					Melanoma(55;1800 1972 14909)												0								ENSG00000204961						87.0	84.0	85.0					5																	140230348		2197	4270	6467	PCDHA9	SO:0001819	synonymous_variant	0			-	HGNC	AF152487	CCDS54920.1	5q31	2010-11-26				ENSG00000204961		"""Cadherins / Protocadherins : Clustered"""	8675	other	complex locus constituent	"""KIAA0345-like 5"""	606315				10380929	Standard	NM_031857		Approved	KIAA0345, PCDH-ALPHA9		Q9Y5H5		ENST00000532602.1:c.2268G>A	5.37:g.140230348G>A		Somatic	0	64	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	33	15.38	O15053|Q2M3S5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.Q756	ENST00000532602.1	37	c.2268	CCDS54920.1	5																																																																																			-	NULL		0.647	PCDHA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA9	protein_coding	OTTHUMT00000372896.2	G	NM_031857	-		140230348	+1	no_errors	ENST00000532602	ensembl	human	known	74_37	silent	SNP	0.945	A
GJB2	2706	genome.wustl.edu	37	13	20763342	20763342	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr13:20763342G>A	ENST00000382844.1	-	1	577	c.379C>T	c.(379-381)Cgc>Tgc	p.R127C	GJB2_ENST00000382848.4_Missense_Mutation_p.R127C			P29033	CXB2_HUMAN	gap junction protein, beta 2, 26kDa	127			R -> H (very common polymorphism in India; dbSNP:rs111033196). {ECO:0000269|PubMed:12746422, ECO:0000269|PubMed:14722929, ECO:0000269|PubMed:15666300}.		cell-cell signaling (GO:0007267)|gap junction assembly (GO:0016264)|male genitalia development (GO:0030539)|membrane organization (GO:0061024)|sensory perception of sound (GO:0007605)|transport (GO:0006810)	connexon complex (GO:0005922)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)	gap junction channel activity (GO:0005243)			breast(1)|endometrium(2)|large_intestine(1)|lung(2)|skin(1)	7		all_cancers(29;3.95e-22)|all_epithelial(30;2.36e-19)|all_lung(29;2.27e-18)|Lung SC(185;0.0257)|Ovarian(182;0.0822)		all cancers(112;0.000435)|Epithelial(112;0.000722)|OV - Ovarian serous cystadenocarcinoma(117;0.0096)|Lung(94;0.0236)|LUSC - Lung squamous cell carcinoma(192;0.0738)		CCTTCGATGCGGACCTTCTGG	0.512									Keratitis, Ichthyosis and Deafness syndrome		OREG0022282	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0			GRCh37	CM014710	GJB2	M		ENSG00000165474						114.0	107.0	109.0					13																	20763342		2203	4300	6503	GJB2	SO:0001583	missense	0	Familial Cancer Database	KID syndrome	-	HGNC	M86849	CCDS9290.1	13q11-q12	2010-01-06	2007-01-16		ENSG00000165474	ENSG00000165474		"""Ion channels / Gap junction proteins (connexins)"""	4284	protein-coding gene	gene with protein product	"""connexin 26"""	121011	"""gap junction protein, beta 2, 26kD (connexin 26)"", ""gap junction protein, beta 2, 26kDa (connexin 26)"""	DFNB1, DFNA3		9139825	Standard	NM_004004		Approved	CX26, NSRD1	uc001umy.3	P29033	OTTHUMG00000016513	ENST00000382844.1:c.379C>T	13.37:g.20763342G>A	ENSP00000372295:p.Arg127Cys	Somatic	0	33	0.00	743	0.41568620468393047	63	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	7	30.00	Q508A5|Q508A6|Q5YLL0|Q5YLL1|Q5YLL4|Q6IPV5|Q86U88|Q96AK0|Q9H536|Q9NNY4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Connexin_N,pfam_Connexin_CCC,smart_Connexin_N,prints_Connexin,prints_Connexin26	p.R127C	ENST00000382844.1	37	c.379	CCDS9290.1	13	.	.	.	.	.	.	.	.	.	.	G	18.77	3.694148	0.68386	.	.	ENSG00000165474	ENST00000382848;ENST00000382844	D;D	0.97791	-4.54;-4.54	5.47	5.47	0.80525	.	0.000000	0.64402	D	0.000002	D	0.96188	0.8757	L	0.55481	1.735	0.80722	D	1	D	0.64830	0.994	B	0.43536	0.423	D	0.95978	0.8975	10	0.56958	D	0.05	.	14.5272	0.67897	0.0:0.0:0.8535:0.1465	.	127	P29033	CXB2_HUMAN	C	127	ENSP00000372299:R127C;ENSP00000372295:R127C	ENSP00000372295:R127C	R	-	1	0	GJB2	19661342	0.998000	0.40836	0.999000	0.59377	0.862000	0.49288	4.443000	0.59994	2.723000	0.93209	0.655000	0.94253	CGC	-	NULL		0.512	GJB2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GJB2	protein_coding	OTTHUMT00000044064.1	G		-		20763342	-1	no_errors	ENST00000382844	ensembl	human	known	74_37	missense	SNP	0.995	A
WDR59	79726	genome.wustl.edu	37	16	74983665	74983665	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr16:74983665G>A	ENST00000262144.6	-	5	488	c.358C>T	c.(358-360)Ctc>Ttc	p.L120F	WDR59_ENST00000562331.1_5'Flank	NM_030581.3	NP_085058.3	Q6PJI9	WDR59_HUMAN	WD repeat domain 59	120										breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|ovary(1)|prostate(1)	27						GTAACCAGGAGGTCAGGCTCA	0.463																																																	0								ENSG00000103091						95.0	86.0	89.0					16																	74983665		2198	4300	6498	WDR59	SO:0001583	missense	0			-	HGNC	AB067510	CCDS32488.1	16q22.3	2013-01-09				ENSG00000103091		"""WD repeat domain containing"""	25706	protein-coding gene	gene with protein product						11572484	Standard	XM_005256146		Approved	FLJ12270	uc002fdh.1	Q6PJI9		ENST00000262144.6:c.358C>T	16.37:g.74983665G>A	ENSP00000262144:p.Leu120Phe	Somatic	0	72	0.00		0.41568620468393047	1	75.00	3	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	32	21.95	B3KRC3|Q71RE7|Q96PW5|Q9BSW6|Q9HA43	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_UBQ-conjugating_enzyme/RWD,smart_WD40_repeat,smart_RWD-domain,pfscan_RWD-domain,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L120F	ENST00000262144.6	37	c.358	CCDS32488.1	16	.	.	.	.	.	.	.	.	.	.	G	14.34	2.507313	0.44558	.	.	ENSG00000103091	ENST00000262144;ENST00000536050	T	0.61274	0.12	5.62	4.47	0.54385	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.142094	0.47852	D	0.000220	T	0.46171	0.1379	L	0.36672	1.1	0.42291	D	0.992134	B;B	0.14438	0.01;0.005	B;B	0.18263	0.021;0.007	T	0.41342	-0.9514	10	0.41790	T	0.15	-19.8962	10.9341	0.47235	0.0785:0.1333:0.7882:0.0	.	120;120	Q6PJI9-2;Q6PJI9	.;WDR59_HUMAN	F	120;99	ENSP00000262144:L120F	ENSP00000262144:L120F	L	-	1	0	WDR59	73541166	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	1.887000	0.39698	2.656000	0.90262	0.563000	0.77884	CTC	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom		0.463	WDR59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR59	protein_coding	OTTHUMT00000410601.3	G	NM_030581	-		74983665	-1	no_errors	ENST00000262144	ensembl	human	known	74_37	missense	SNP	0.999	A
MROH5	389690	genome.wustl.edu	37	8	142447004	142447004	+	RNA	SNP	C	C	T	rs369455335		TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr8:142447004C>T	ENST00000606664.1	+	0	2360				MROH5_ENST00000430863.1_RNA																							CACTAGGACCCGCTGGCCCCA	0.697																																																	0								ENSG00000271959																																			CTD-3064M3.7			0			-	Clone_based_vega_gene																													8.37:g.142447004C>T		Somatic	0	19	0.00		0.41568620468393047	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	12	36.84		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000606664.1	37	NULL		8																																																																																			-	-		0.697	CTD-3064M3.7-001	KNOWN	non_canonical_TEC|basic	antisense	ENSG00000271959	antisense	OTTHUMT00000470872.1	C		-		142447004	+1	no_errors	ENST00000606664	ensembl	human	known	74_37	rna	SNP	0.000	T
MCTP1	79772	genome.wustl.edu	37	5	94224612	94224612	+	Silent	SNP	C	C	T	rs571380057		TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr5:94224612C>T	ENST00000515393.1	-	12	1904	c.1905G>A	c.(1903-1905)gcG>gcA	p.A635A	MCTP1_ENST00000429576.2_Silent_p.A368A|MCTP1_ENST00000505078.1_Silent_p.A151A|MCTP1_ENST00000312216.8_Silent_p.A414A|MCTP1_ENST00000505208.1_Silent_p.A414A	NM_024717.4	NP_078993.4	Q6DN14	MCTP1_HUMAN	multiple C2 domains, transmembrane 1	635	C2 3. {ECO:0000255|PROSITE- ProRule:PRU00041}.				calcium-mediated signaling (GO:0019722)	integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)			breast(1)|endometrium(3)|large_intestine(13)|liver(2)|lung(13)|ovary(2)|skin(4)|stomach(2)|urinary_tract(1)	41		all_cancers(142;1.68e-05)|all_epithelial(76;1.51e-07)|all_lung(232;0.0167)|Lung NSC(167;0.0207)|Ovarian(225;0.0218)|Colorectal(57;0.207)		all cancers(79;9.1e-17)		TTAACCCTTCCGCTCTGATGA	0.438													C|||	1	0.000199681	0.0	0.0	5008	,	,		15818	0.0		0.001	False		,,,				2504	0.0																0								ENSG00000175471						108.0	108.0	108.0					5																	94224612		2203	4300	6503	MCTP1	SO:0001819	synonymous_variant	0			-	HGNC		CCDS34203.1, CCDS47247.1, CCDS75275.1	5q15	2008-02-05			ENSG00000175471	ENSG00000175471			26183	protein-coding gene	gene with protein product						15528213	Standard	XM_005272082		Approved	FLJ22344	uc003kkx.2	Q6DN14	OTTHUMG00000162742	ENST00000515393.1:c.1905G>A	5.37:g.94224612C>T		Somatic	0	71	0.00		0.41568620468393047	11	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	37	11.90	Q6DN13|Q8N2W1|Q8NBA2|Q96LX0|Q9H6E8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_C2_dom,pfam_PRibTrfase_C,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom,prints_C2_dom	p.A635	ENST00000515393.1	37	c.1905	CCDS34203.1	5	.	.	.	.	.	.	.	.	.	.	C	9.987	1.229860	0.22542	.	.	ENSG00000175471	ENST00000415885	.	.	.	5.65	-2.62	0.06152	.	.	.	.	.	T	0.58566	0.2131	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.59611	-0.7422	5	0.72032	D	0.01	-14.0663	6.7496	0.23480	0.1033:0.2565:0.0:0.6402	.	.	.	.	R	236	.	ENSP00000405735:G236R	G	-	1	0	MCTP1	94250368	0.099000	0.21834	0.977000	0.42913	0.948000	0.59901	-0.728000	0.04925	-0.615000	0.05679	-1.099000	0.02127	GGA	-	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom		0.438	MCTP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MCTP1	protein_coding	OTTHUMT00000370280.3	C	NM_024717	-		94224612	-1	no_errors	ENST00000515393	ensembl	human	known	74_37	silent	SNP	0.905	T
MPHOSPH10	10199	genome.wustl.edu	37	2	71360032	71360032	+	Nonsense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr2:71360032C>T	ENST00000244230.2	+	2	446	c.94C>T	c.(94-96)Caa>Taa	p.Q32*	MPHOSPH10_ENST00000498451.2_Nonsense_Mutation_p.Q32*|MPHOSPH10_ENST00000468427.1_3'UTR|MCEE_ENST00000244217.5_5'Flank	NM_005791.2	NP_005782.1	O00566	MPP10_HUMAN	M-phase phosphoprotein 10 (U3 small nucleolar ribonucleoprotein)	32					negative regulation of phosphatase activity (GO:0010923)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|rRNA processing (GO:0006364)	chromosome (GO:0005694)|nucleolus (GO:0005730)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(2)|pancreas(2)|skin(2)|stomach(1)	26						CAATAGGATTCAAGAGGGATT	0.308																																																	0								ENSG00000124383						35.0	40.0	39.0					2																	71360032		2072	4218	6290	MPHOSPH10	SO:0001587	stop_gained	0			-	HGNC	X98494	CCDS1916.1	2p13.3	2014-06-12			ENSG00000124383	ENSG00000124383			7213	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 106"""	605503				8885239, 9450966	Standard	NM_005791		Approved	MPP10, MPP10P, CT90, PPP1R106	uc002sht.2	O00566	OTTHUMG00000129715	ENST00000244230.2:c.94C>T	2.37:g.71360032C>T	ENSP00000244230:p.Gln32*	Somatic	0	85	0.00		0.41568620468393047	19	24.00	6	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	66	17.50	A0AVJ8	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Mpp10,pirsf_snoRNP_Mpp10	p.Q32*	ENST00000244230.2	37	c.94	CCDS1916.1	2	.	.	.	.	.	.	.	.	.	.	C	38	7.256829	0.98168	.	.	ENSG00000124383	ENST00000244230	.	.	.	4.32	4.32	0.51571	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.29301	T	0.29	.	14.6902	0.69080	0.0:1.0:0.0:0.0	.	.	.	.	X	32	.	ENSP00000244230:Q32X	Q	+	1	0	MPHOSPH10	71213540	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.251000	0.78297	2.403000	0.81681	0.555000	0.69702	CAA	-	pfam_Mpp10,pirsf_snoRNP_Mpp10		0.308	MPHOSPH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MPHOSPH10	protein_coding	OTTHUMT00000251924.2	C	NM_005791	-		71360032	+1	no_errors	ENST00000244230	ensembl	human	known	74_37	nonsense	SNP	1.000	T
MURC	347273	genome.wustl.edu	37	9	103348640	103348640	+	Silent	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr9:103348640C>T	ENST00000307584.5	+	2	1067	c.1002C>T	c.(1000-1002)atC>atT	p.I334I		NM_001018116.1	NP_001018126.1	Q5BKX8	MURC_HUMAN	muscle-related coiled-coil protein	334					cell differentiation (GO:0030154)|muscle organ development (GO:0007517)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	Z disc (GO:0030018)				endometrium(1)|kidney(1)|large_intestine(6)|lung(7)|ovary(1)	16		Acute lymphoblastic leukemia(62;0.0461)				GAAGGGAAATCCCCACCCCCG	0.473																																																	0								ENSG00000170681						45.0	49.0	48.0					9																	103348640		2203	4300	6503	MURC	SO:0001819	synonymous_variant	0			-	HGNC	BC090888	CCDS35083.1	9q31.1	2014-09-17			ENSG00000170681	ENSG00000170681			33742	protein-coding gene	gene with protein product	"""muscle-restricted coiled-coil protein"""					18508909, 18332105	Standard	NM_001018116		Approved	cavin-4, CAVIN4	uc004bba.3	Q5BKX8	OTTHUMG00000020368	ENST00000307584.5:c.1002C>T	9.37:g.103348640C>T		Somatic	0	81	0.00		0.41568620468393047	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	38	20.83	B1PRL3|B4DT88	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.I334	ENST00000307584.5	37	c.1002	CCDS35083.1	9																																																																																			-	NULL		0.473	MURC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MURC	protein_coding	OTTHUMT00000053419.2	C	NM_001018116	-		103348640	+1	no_errors	ENST00000307584	ensembl	human	known	74_37	silent	SNP	0.000	T
ZC3H15	55854	genome.wustl.edu	37	2	187368862	187368862	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr2:187368862C>T	ENST00000337859.6	+	6	865	c.638C>T	c.(637-639)cCt>cTt	p.P213L	ZC3H15_ENST00000544130.1_Missense_Mutation_p.P8L|AC018867.2_ENST00000595956.1_5'Flank	NM_018471.2	NP_060941.2	Q8WU90	ZC3HF_HUMAN	zinc finger CCCH-type containing 15	213					cytokine-mediated signaling pathway (GO:0019221)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(1)|kidney(1)|large_intestine(4)|lung(5)|skin(1)	15			OV - Ovarian serous cystadenocarcinoma(117;0.0148)|Epithelial(96;0.0922)|all cancers(119;0.233)			GCACTTCCTCCTGGATTTGTG	0.383																																																	0								ENSG00000065548						135.0	124.0	128.0					2																	187368862		1832	4086	5918	ZC3H15	SO:0001583	missense	0			-	HGNC		CCDS42791.1	2q32.1	2012-07-05			ENSG00000065548	ENSG00000065548		"""Zinc fingers, CCCH-type domain containing"""	29528	protein-coding gene	gene with protein product	"""likely ortholog of mouse immediate early response, erythropoietin 4"""					10880228	Standard	NM_018471		Approved	LEREPO4	uc002upo.3	Q8WU90	OTTHUMG00000154251	ENST00000337859.6:c.638C>T	2.37:g.187368862C>T	ENSP00000338788:p.Pro213Leu	Somatic	0	59	0.00		0.41568620468393047	56	34.12	29	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	50	19.35	B4DMW2|D3DPG7|Q5QTQ4|Q8WZ06|Q9NUZ3|Q9NZ37|Q9P079	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_CCCH,smart_Znf_CCCH	p.P213L	ENST00000337859.6	37	c.638	CCDS42791.1	2	.	.	.	.	.	.	.	.	.	.	C	25.2	4.609646	0.87258	.	.	ENSG00000065548	ENST00000337859;ENST00000544130;ENST00000536434	T	0.36878	1.23	5.87	4.98	0.66077	.	0.156231	0.64402	D	0.000019	T	0.58850	0.2151	M	0.90595	3.13	0.80722	D	1	D	0.55605	0.972	P	0.50659	0.647	T	0.71616	-0.4539	10	0.72032	D	0.01	-11.1417	17.2558	0.87056	0.0:0.8742:0.1258:0.0	.	213	Q8WU90	ZC3HF_HUMAN	L	213;8;213	ENSP00000338788:P213L	ENSP00000338788:P213L	P	+	2	0	ZC3H15	187077107	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.970000	0.70431	1.593000	0.50029	0.655000	0.94253	CCT	-	NULL		0.383	ZC3H15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZC3H15	protein_coding	OTTHUMT00000334547.2	C	NM_018471	-		187368862	+1	no_errors	ENST00000337859	ensembl	human	known	74_37	missense	SNP	1.000	T
RBAK	57786	genome.wustl.edu	37	7	5104552	5104552	+	Nonsense_Mutation	SNP	G	G	T	rs539259619		TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr7:5104552G>T	ENST00000353796.3	+	6	1789	c.1465G>T	c.(1465-1467)Gaa>Taa	p.E489*	RBAK_ENST00000396912.1_Nonsense_Mutation_p.E489*|RBAK-RBAKDN_ENST00000407184.1_Intron|RBAK-RBAKDN_ENST00000396904.2_Intron	NM_001204456.1	NP_001191385.1	Q9NYW8	RBAK_HUMAN	RB-associated KRAB zinc finger	489	Interaction with AR.				negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|kidney(1)|large_intestine(2)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)	10		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0916)|OV - Ovarian serous cystadenocarcinoma(56;2.44e-14)		TGAATGTAGTGAATGTGGAAA	0.378																																																	0								ENSG00000146587						64.0	64.0	64.0					7																	5104552		2203	4299	6502	RBAK	SO:0001587	stop_gained	0			-	HGNC	AF226869	CCDS5337.1	7p22.1	2013-01-08			ENSG00000146587	ENSG00000146587		"""Zinc fingers, C2H2-type"", ""-"""	17680	protein-coding gene	gene with protein product		608191					Standard	NM_021163		Approved	ZNF769	uc003sns.1	Q9NYW8	OTTHUMG00000121155	ENST00000353796.3:c.1465G>T	7.37:g.5104552G>T	ENSP00000275423:p.Glu489*	Somatic	0	72	0.00		0.41568620468393047	4	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	43	10.42	A6NDF2|A8KAK4|B2RN44|B9EGS1|F8W6M7	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E489*	ENST00000353796.3	37	c.1465	CCDS5337.1	7	.	.	.	.	.	.	.	.	.	.	G	38	7.041349	0.98021	.	.	ENSG00000146587	ENST00000353796;ENST00000396912	.	.	.	3.77	3.77	0.43336	.	0.129029	0.35495	N	0.003169	.	.	.	.	.	.	0.80722	D	1.000000	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.8757	0.63651	0.0:0.0:1.0:0.0	.	.	.	.	X	489	.	.	E	+	1	0	RBAK	5071078	0.000000	0.05858	0.991000	0.47740	0.993000	0.82548	0.296000	0.19083	2.391000	0.81399	0.561000	0.74099	GAA	-	smart_Znf_C2H2-like		0.378	RBAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBAK	protein_coding	OTTHUMT00000241640.2	G	NM_021163	-		5104552	+1	no_errors	ENST00000353796	ensembl	human	known	74_37	nonsense	SNP	0.358	T
RP11-291L22.4	0	genome.wustl.edu	37	10	38754946	38754946	+	lincRNA	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr10:38754946C>T	ENST00000428915.2	+	0	569																											ATCCAGGATTCAATGAAGAAC	0.289																																																	0								ENSG00000203496																																			RP11-291L22.4			0			-	Clone_based_vega_gene																													10.37:g.38754946C>T		Somatic	0	434	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	79	168	31.98		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000428915.2	37	NULL		10																																																																																			-	-		0.289	RP11-291L22.4-002	KNOWN	not_best_in_genome_evidence|basic	lincRNA	ENSG00000203496	lincRNA	OTTHUMT00000047653.3	C		-		38754946	+1	no_errors	ENST00000428915	ensembl	human	known	74_37	rna	SNP	0.002	T
HPN	3249	genome.wustl.edu	37	19	35550807	35550807	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr19:35550807G>A	ENST00000262626.2	+	6	1145	c.320G>A	c.(319-321)cGa>cAa	p.R107Q	HPN_ENST00000597419.1_Intron|HPN_ENST00000392226.1_Missense_Mutation_p.R107Q|HPN_ENST00000600675.1_3'UTR|HPN-AS1_ENST00000392227.2_RNA	NM_182983.2	NP_892028.1	P05981	HEPS_HUMAN	hepsin	107	SRCR.				basement membrane disassembly (GO:0034769)|cholesterol homeostasis (GO:0042632)|cochlea morphogenesis (GO:0090103)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|epithelium development (GO:0060429)|negative regulation of alkaline phosphatase activity (GO:0010693)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|pilomotor reflex (GO:0097195)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of cell growth (GO:0030307)|positive regulation of gene expression (GO:0010628)|positive regulation of hepatocyte proliferation (GO:2000347)|positive regulation of plasminogen activation (GO:0010756)|positive regulation of thyroid hormone generation (GO:2000611)|potassium ion transmembrane transport (GO:0071805)|proteolysis (GO:0006508)|regulation of cell shape (GO:0008360)|response to thyroid hormone (GO:0097066)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calcium-activated potassium channel activity (GO:0015269)|peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)|serine-type exopeptidase activity (GO:0070008)|serine-type peptidase activity (GO:0008236)			central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(6)|ovary(2)|upper_aerodigestive_tract(2)	19	all_lung(56;5.38e-08)|Lung NSC(56;8.61e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)		Coagulation factor VIIa(DB00036)	CTGGACGTGCGAACGGCGGGC	0.706																																																	0								ENSG00000105707						10.0	10.0	10.0					19																	35550807		2171	4244	6415	HPN	SO:0001583	missense	0			-	HGNC		CCDS32993.1	19q13.12	2013-04-25	2008-12-08		ENSG00000105707	ENSG00000105707		"""Serine peptidases / Transmembrane"""	5155	protein-coding gene	gene with protein product	"""transmembrane protease, serine 1"""	142440				2835076	Standard	NM_182983		Approved	TMPRSS1	uc002nxq.2	P05981	OTTHUMG00000182474	ENST00000262626.2:c.320G>A	19.37:g.35550807G>A	ENSP00000262626:p.Arg107Gln	Somatic	0	33	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	17	29.17	B2RDS4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_S1,pfam_Hepsin-SRCR,superfamily_Trypsin-like_Pept_dom,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.R107Q	ENST00000262626.2	37	c.320	CCDS32993.1	19	.	.	.	.	.	.	.	.	.	.	G	12.37	1.917251	0.33815	.	.	ENSG00000105707	ENST00000262626;ENST00000392226;ENST00000541345	T;T	0.60920	0.15;0.15	5.17	4.07	0.47477	Speract/scavenger receptor-related (1);Hepsin, SRCR (2);	0.218535	0.40469	N	0.001082	T	0.33411	0.0862	L	0.27053	0.805	0.80722	D	1	B;B	0.31581	0.329;0.098	B;B	0.14578	0.011;0.006	T	0.13791	-1.0496	10	0.13853	T	0.58	.	6.5301	0.22322	0.0964:0.1846:0.719:0.0	.	79;107	B7Z1L4;P05981	.;HEPS_HUMAN	Q	107;107;79	ENSP00000262626:R107Q;ENSP00000376060:R107Q	ENSP00000262626:R107Q	R	+	2	0	HPN	40242647	0.861000	0.29849	0.992000	0.48379	0.513000	0.34164	1.570000	0.36439	2.420000	0.82092	0.505000	0.49811	CGA	-	pfam_Hepsin-SRCR,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel		0.706	HPN-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	HPN	protein_coding	OTTHUMT00000461573.1	G	NM_002151	-		35550807	+1	no_errors	ENST00000262626	ensembl	human	known	74_37	missense	SNP	0.886	A
MYH2	4620	genome.wustl.edu	37	17	10448734	10448734	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr17:10448734C>T	ENST00000245503.5	-	5	818	c.434G>A	c.(433-435)gGc>gAc	p.G145D	CTC-297N7.11_ENST00000587182.2_RNA|MYH2_ENST00000397183.2_Missense_Mutation_p.G145D|MYH2_ENST00000532183.2_Missense_Mutation_p.G145D	NM_017534.5	NP_060004.3	Q9UKX2	MYH2_HUMAN	myosin, heavy chain 2, skeletal muscle, adult	145	Myosin motor.				Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|plasma membrane repair (GO:0001778)|response to activity (GO:0014823)	A band (GO:0031672)|actomyosin contractile ring (GO:0005826)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|protein complex (GO:0043234)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(99)|ovary(6)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(4)	176						GCGCTTTTTGCCTCGGTAGGC	0.537																																																	0								ENSG00000125414						140.0	142.0	141.0					17																	10448734		2203	4300	6503	MYH2	SO:0001583	missense	0			-	HGNC		CCDS11156.1	17p13.1	2014-02-04	2006-09-29		ENSG00000125414	ENSG00000125414		"""Myosins / Myosin superfamily : Class II"""	7572	protein-coding gene	gene with protein product		160740	"""myosin, heavy polypeptide 2, skeletal muscle, adult"", ""inclusion body myopathy 3, autosomal dominant"""	IBM3		7545970, 11889243	Standard	NM_001100112		Approved	MYH2A, MYHSA2, MyHC-IIa, MYHas8, MyHC-2A	uc010coi.3	Q9UKX2	OTTHUMG00000130363	ENST00000245503.5:c.434G>A	17.37:g.10448734C>T	ENSP00000245503:p.Gly145Asp	Somatic	0	157	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	54	22.86	A0AVL4|Q14322|Q16229|Q567P6|Q86T56	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,superfamily_Ribosomal_L29,superfamily_t-SNARE,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.G145D	ENST00000245503.5	37	c.434	CCDS11156.1	17	.	.	.	.	.	.	.	.	.	.	C	17.80	3.479266	0.63849	.	.	ENSG00000125414	ENST00000532183;ENST00000245503;ENST00000397183;ENST00000420805	D;D;D;D	0.91740	-2.9;-2.9;-2.9;-2.9	5.71	5.71	0.89125	Myosin head, motor domain (2);	0.000000	0.40064	U	0.001181	D	0.96827	0.8964	M	0.88906	2.99	0.80722	D	1	D;D	0.76494	0.999;0.976	D;D	0.97110	1.0;0.963	D	0.97169	0.9843	10	0.87932	D	0	.	18.8439	0.92196	0.0:1.0:0.0:0.0	.	145;145	Q567P6;Q9UKX2	.;MYH2_HUMAN	D	145	ENSP00000433944:G145D;ENSP00000245503:G145D;ENSP00000380367:G145D;ENSP00000399348:G145D	ENSP00000245503:G145D	G	-	2	0	MYH2	10389459	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.815000	0.86186	2.706000	0.92434	0.650000	0.86243	GGC	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom		0.537	MYH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH2	protein_coding	OTTHUMT00000252726.3	C	NM_017534	-		10448734	-1	no_errors	ENST00000245503	ensembl	human	known	74_37	missense	SNP	1.000	T
FAM87A	157693	genome.wustl.edu	37	8	327878	327878	+	lincRNA	SNP	C	C	G	rs544061676		TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr8:327878C>G	ENST00000330148.2	-	0	2583					NR_103537.1		P0C7U9	FA87A_HUMAN	family with sequence similarity 87, member A							integral component of membrane (GO:0016021)											CCAAGGCACTCTTCAGGGACT	0.527													C|||	1	0.000199681	0.0	0.0014	5008	,	,		24114	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000182366																																			FAM87A			0			-	HGNC	BC037297		8p23.3	2013-02-15				ENSG00000182366		"""Long non-coding RNAs"""	27233	non-coding RNA	RNA, long non-coding						12477932	Standard	NR_103537		Approved			P0C7U9			8.37:g.327878C>G		Somatic	0	134	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	74	13.95		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000330148.2	37	NULL		8																																																																																			-	-		0.527	FAM87A-001	KNOWN	basic	lincRNA	FAM87A	lincRNA	OTTHUMT00000384563.2	C		-		327878	-1	no_errors	ENST00000330148	ensembl	human	known	74_37	rna	SNP	0.000	G
STK32B	55351	genome.wustl.edu	37	4	5448438	5448438	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr4:5448438G>A	ENST00000282908.5	+	7	1023	c.601G>A	c.(601-603)Gga>Aga	p.G201R	STK32B_ENST00000512636.1_Missense_Mutation_p.G124R|STK32B_ENST00000510398.1_Missense_Mutation_p.G154R|STK32B_ENST00000508728.1_3'UTR	NM_018401.1	NP_060871.1			serine/threonine kinase 32B									p.G201R(2)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(16)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	39						CAGAGGCCCCGGATACTCGTA	0.577																																																	2	Substitution - Missense(2)	lung(1)|endometrium(1)						ENSG00000152953						88.0	80.0	83.0					4																	5448438		2203	4300	6503	STK32B	SO:0001583	missense	0			-	HGNC	AJ250839	CCDS3380.1	4p16	2009-09-30			ENSG00000152953	ENSG00000152953			14217	protein-coding gene	gene with protein product						10700184	Standard	XM_005247982		Approved	STKG6, YANK2, STK32, HSA250839	uc003gih.1	Q9NY57	OTTHUMG00000090423	ENST00000282908.5:c.601G>A	4.37:g.5448438G>A	ENSP00000282908:p.Gly201Arg	Somatic	0	90	0.00		0.41568620468393047	4	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	46	19.30		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.G201R	ENST00000282908.5	37	c.601	CCDS3380.1	4	.	.	.	.	.	.	.	.	.	.	G	21.7	4.192624	0.78902	.	.	ENSG00000152953	ENST00000282908;ENST00000512636;ENST00000510398	T;T;T	0.66280	-0.2;-0.2;-0.2	5.39	5.39	0.77823	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.43747	U	0.000524	T	0.74427	0.3715	L	0.48218	1.51	0.58432	D	0.999999	D	0.89917	1.0	D	0.87578	0.998	T	0.76589	-0.2904	10	0.87932	D	0	.	16.6579	0.85233	0.0:0.0:1.0:0.0	.	201	Q9NY57	ST32B_HUMAN	R	201;124;154	ENSP00000282908:G201R;ENSP00000423209:G124R;ENSP00000420984:G154R	ENSP00000282908:G201R	G	+	1	0	STK32B	5499339	1.000000	0.71417	0.994000	0.49952	0.725000	0.41563	5.332000	0.65911	2.523000	0.85059	0.561000	0.74099	GGA	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.577	STK32B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STK32B	protein_coding	OTTHUMT00000206854.4	G	NM_018401	-		5448438	+1	no_errors	ENST00000282908	ensembl	human	known	74_37	missense	SNP	0.986	A
BRD7	29117	genome.wustl.edu	37	16	50383335	50383336	+	Intron	INS	-	-	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr16:50383335_50383336insA	ENST00000394688.3	-	5	751				BRD7_ENST00000401491.3_5'UTR|snoU13_ENST00000459559.1_RNA|BRD7_ENST00000394689.2_Intron			Q9NPI1	BRD7_HUMAN	bromodomain containing 7						cell cycle (GO:0007049)|negative regulation of cell proliferation (GO:0008285)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone acetylation (GO:0035066)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	histone binding (GO:0042393)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(7)|prostate(2)|urinary_tract(2)	22		all_cancers(37;0.0127)				GTAAACCATCTAAAAAAAAAAA	0.366																																																	0								ENSG00000166164																																			BRD7	SO:0001627	intron_variant	0				HGNC	AF213969	CCDS10742.1, CCDS54007.1	16q12.1	2008-11-18	2002-01-14		ENSG00000166164	ENSG00000166164			14310	protein-coding gene	gene with protein product			"""bromodomain-containing 7"""			10526152, 18809673	Standard	NM_013263		Approved	CELTIX1, BP75	uc002ege.2	Q9NPI1	OTTHUMG00000133170	ENST00000394688.3:c.591+597->T	16.37:g.50383346_50383346dupA		Somatic	0	8	0.00		0.41568620468393047	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	7	22.22	Q4VC09|Q8N2L9|Q96KA4|Q9BV48|Q9UH59	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000394688.3	37	NULL	CCDS10742.1	16																																																																																			-	-		0.366	BRD7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	BRD7	protein_coding	OTTHUMT00000256874.3	-	NM_013263			50383336	-1	no_errors	ENST00000401491	ensembl	human	known	74_37	rna	INS	0.993:0.995	A
E2F4	1874	genome.wustl.edu	37	16	67228596	67228596	+	Missense_Mutation	SNP	A	A	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr16:67228596A>T	ENST00000379378.3	+	6	580	c.521A>T	c.(520-522)aAt>aTt	p.N174I	E2F4_ENST00000564718.1_3'UTR	NM_001950.3	NP_001941.2	Q16254	E2F4_HUMAN	E2F transcription factor 4, p107/p130-binding	174	Dimerization. {ECO:0000255}.				blood circulation (GO:0008015)|cell volume homeostasis (GO:0006884)|cilium assembly (GO:0042384)|epithelial cell development (GO:0002064)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell proliferation (GO:0042127)|regulation of cell size (GO:0008361)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			breast(4)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)	11		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.000697)|Epithelial(162;0.00303)|all cancers(182;0.0325)		TAGGGTCTCAATGGGCAGAAG	0.562																																																	0								ENSG00000205250						90.0	90.0	90.0					16																	67228596		2198	4300	6498	E2F4	SO:0001583	missense	0			-	HGNC	BC021050	CCDS32464.1	16q22.1	2014-05-06			ENSG00000205250	ENSG00000205250			3118	protein-coding gene	gene with protein product		600659				7958924, 7892279	Standard	NM_001950		Approved	E2F-4	uc002erz.3	Q16254	OTTHUMG00000172975	ENST00000379378.3:c.521A>T	16.37:g.67228596A>T	ENSP00000368686:p.Asn174Ile	Somatic	0	38	0.00		0.41568620468393047	87	27.87	34	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	28	12.50	A6NGR8|B5BU56|Q12991|Q15328	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_E2F_TDP	p.N174I	ENST00000379378.3	37	c.521	CCDS32464.1	16	.	.	.	.	.	.	.	.	.	.	A	14.47	2.546045	0.45383	.	.	ENSG00000205250	ENST00000379378	D	0.85861	-2.04	5.72	5.72	0.89469	.	0.043913	0.85682	D	0.000000	D	0.88269	0.6391	L	0.41415	1.275	0.58432	D	0.999999	D	0.71674	0.998	D	0.63488	0.915	D	0.89380	0.3681	10	0.72032	D	0.01	-14.6752	14.8506	0.70295	1.0:0.0:0.0:0.0	.	174	Q16254	E2F4_HUMAN	I	174	ENSP00000368686:N174I	ENSP00000368686:N174I	N	+	2	0	E2F4	65786097	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.292000	0.72725	2.189000	0.69895	0.533000	0.62120	AAT	-	NULL		0.562	E2F4-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	E2F4	protein_coding	OTTHUMT00000421565.1	A	NM_001950	-		67228596	+1	no_errors	ENST00000379378	ensembl	human	known	74_37	missense	SNP	1.000	T
SIGLEC10	89790	genome.wustl.edu	37	19	51919600	51919600	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr19:51919600C>T	ENST00000339313.5	-	4	834	c.718G>A	c.(718-720)Gac>Aac	p.D240N	CTD-2616J11.2_ENST00000526996.1_RNA|SIGLEC10_ENST00000356298.5_Missense_Mutation_p.D240N|SIGLEC10_ENST00000432469.2_Missense_Mutation_p.D157N|CTD-2616J11.2_ENST00000532688.1_RNA|SIGLEC10_ENST00000439889.2_Missense_Mutation_p.D182N|SIGLEC10_ENST00000353836.5_Missense_Mutation_p.D240N|SIGLEC10_ENST00000525998.1_Missense_Mutation_p.D240N|CTD-2616J11.3_ENST00000532473.1_RNA|SIGLEC10_ENST00000442846.3_Missense_Mutation_p.D182N|SIGLEC10_ENST00000441969.3_Missense_Mutation_p.D182N|SIGLEC10_ENST00000436984.2_Missense_Mutation_p.D192N			Q96LC7	SIG10_HUMAN	sialic acid binding Ig-like lectin 10	240					cell adhesion (GO:0007155)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(27)|ovary(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000668)|OV - Ovarian serous cystadenocarcinoma(262;0.0101)		ATAACAAGGTCTCTGGGGGCA	0.522																																																	0								ENSG00000142512						117.0	117.0	117.0					19																	51919600		2203	4300	6503	SIGLEC10	SO:0001583	missense	0			-	HGNC	AF310233	CCDS12832.1, CCDS54301.1, CCDS54302.1, CCDS54303.1, CCDS54304.1, CCDS54305.1	19q13.3	2013-01-29			ENSG00000142512	ENSG00000142512		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15620	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 10 Ig-like lectin 7"", ""siglec-like gene 2"""	606091				11284738	Standard	NM_033130		Approved	SIGLEC-10, SLG2, PRO940, MGC126774	uc002pwo.3	Q96LC7	OTTHUMG00000165521	ENST00000339313.5:c.718G>A	19.37:g.51919600C>T	ENSP00000345243:p.Asp240Asn	Somatic	0	334	0.00		0.41568620468393047	3	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	57	160	26.27	A8K1I5|A8K3C7|C9JJ33|C9JM10|F8W917|Q3MIR5|Q6UXI8|Q96G54|Q96LC8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_CD80_C2-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.D240N	ENST00000339313.5	37	c.718	CCDS12832.1	19	.	.	.	.	.	.	.	.	.	.	.	2.814	-0.246397	0.05867	.	.	ENSG00000142512	ENST00000353836;ENST00000432469;ENST00000442846;ENST00000356298;ENST00000441969;ENST00000525998;ENST00000439889;ENST00000436984;ENST00000339313;ENST00000529627	T;T;T;T;T;T;T;T;T;T	0.60920	1.06;2.15;1.77;0.93;2.12;1.96;0.78;2.03;0.93;0.15	4.41	-4.18	0.03846	Immunoglobulin-like fold (1);	1.268410	0.05440	N	0.547427	T	0.23370	0.0565	N	0.02960	-0.455	0.09310	N	1	B;B;B;B;B;B;B	0.27765	0.058;0.188;0.014;0.044;0.095;0.003;0.026	B;B;B;B;B;B;B	0.26969	0.023;0.062;0.013;0.051;0.075;0.006;0.056	T	0.10543	-1.0625	10	0.11485	T	0.65	.	1.5562	0.02585	0.1396:0.3743:0.1297:0.3564	.	192;240;182;240;182;182;240	C9JM10;E9PL79;C9JJ33;Q96LC7-2;Q96LC7-6;Q96LC7-3;Q96LC7	.;.;.;.;.;.;SIG10_HUMAN	N	240;157;182;240;182;240;182;192;240;54	ENSP00000342389:D240N;ENSP00000396742:D157N;ENSP00000395475:D182N;ENSP00000348646:D240N;ENSP00000408387:D182N;ENSP00000431444:D240N;ENSP00000389132:D182N;ENSP00000414324:D192N;ENSP00000345243:D240N;ENSP00000435281:D54N	ENSP00000345243:D240N	D	-	1	0	SIGLEC10	56611412	0.000000	0.05858	0.004000	0.12327	0.279000	0.26890	-0.765000	0.04730	-0.542000	0.06249	0.313000	0.20887	GAC	-	NULL		0.522	SIGLEC10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SIGLEC10	protein_coding	OTTHUMT00000384620.2	C	NM_033130	-		51919600	-1	no_errors	ENST00000339313	ensembl	human	known	74_37	missense	SNP	0.004	T
PAOX	196743	genome.wustl.edu	37	10	135197628	135197628	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr10:135197628G>A	ENST00000278060.5	+	4	1116	c.1033G>A	c.(1033-1035)Gac>Aac	p.D345N	PAOX_ENST00000357296.3_Missense_Mutation_p.D345N|PAOX_ENST00000368535.2_3'UTR|PAOX_ENST00000480071.2_Intron|PAOX_ENST00000368539.4_3'UTR	NM_152911.2	NP_690875.1	Q6QHF9	PAOX_HUMAN	polyamine oxidase (exo-N4-amino)	483					cellular nitrogen compound metabolic process (GO:0034641)|oxidation-reduction process (GO:0055114)|polyamine biosynthetic process (GO:0006596)|polyamine catabolic process (GO:0006598)|polyamine metabolic process (GO:0006595)|positive regulation of spermidine biosynthetic process (GO:1901307)|putrescine biosynthetic process (GO:0009446)|putrescine catabolic process (GO:0009447)|small molecule metabolic process (GO:0044281)|spermidine catabolic process (GO:0046203)|spermine catabolic process (GO:0046208)|xenobiotic metabolic process (GO:0006805)	peroxisomal matrix (GO:0005782)	N(1),N(12)-diacetylspermine:oxygen oxidoreductase (3-acetamidopropanal-forming) activity (GO:0052899)|N1-acetylspermidine:oxygen oxidoreductase (3-acetamidopropanal-forming) activity (GO:0052904)|N1-acetylspermine:oxygen oxidoreductase (3-acetamidopropanal-forming) activity (GO:0052903)|polyamine oxidase activity (GO:0046592)|receptor binding (GO:0005102)|spermidine:oxygen oxidoreductase (3-aminopropanal-forming) activity (GO:0052902)|spermine:oxygen oxidoreductase (spermidine-forming) activity (GO:0052901)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(13)|ovary(1)|urinary_tract(2)	23		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		all cancers(32;4.39e-07)|OV - Ovarian serous cystadenocarcinoma(35;1.21e-06)|Epithelial(32;1.94e-06)		GGTGTGGGAGGACACGTCGCC	0.572																																																	0								ENSG00000148832						120.0	101.0	107.0					10																	135197628		2203	4300	6503	PAOX	SO:0001583	missense	0			-	HGNC	BC032778	CCDS7682.1, CCDS7683.1, CCDS7684.1	10q26.3	2003-11-13			ENSG00000148832	ENSG00000148832			20837	protein-coding gene	gene with protein product		615853				12660232	Standard	NM_207127		Approved	PAO	uc001lmv.3	Q6QHF9	OTTHUMG00000019318	ENST00000278060.5:c.1033G>A	10.37:g.135197628G>A	ENSP00000278060:p.Asp345Asn	Somatic	0	53	0.00		0.41568620468393047	19	24.00	6	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	26	23.53	D3DXI6|Q5VWY0|Q6QHF5|Q6QHF6|Q6QHF7|Q6QHF8|Q6QHG0|Q6QHG1|Q6QHG2|Q6QHG3|Q6QHG4|Q6QHG5|Q6QHG6|Q86WP9|Q8N555|Q8NCX3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Amino_oxidase	p.D345N	ENST00000278060.5	37	c.1033	CCDS7683.1	10	.	.	.	.	.	.	.	.	.	.	g	18.59	3.656630	0.67586	.	.	ENSG00000148832	ENST00000368542;ENST00000278060;ENST00000357296	D;D	0.93189	-3.18;-3.18	5.19	4.28	0.50868	.	0.197546	0.52532	D	0.000061	D	0.95108	0.8415	M	0.66506	2.035	0.80722	D	1	P;D	0.69078	0.602;0.997	P;D	0.64687	0.469;0.928	D	0.94445	0.7662	10	0.48119	T	0.1	-28.7253	11.2699	0.49133	0.0883:0.0:0.9117:0.0	.	345;345	Q6QHF9-4;Q6QHF9-2	.;.	N	297;345;345	ENSP00000278060:D345N;ENSP00000349847:D345N	ENSP00000278060:D345N	D	+	1	0	PAOX	135047618	1.000000	0.71417	0.447000	0.26932	0.180000	0.23129	6.010000	0.70753	1.407000	0.46875	0.558000	0.71614	GAC	-	pfam_Amino_oxidase		0.572	PAOX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAOX	protein_coding	OTTHUMT00000051146.2	G	NM_152911	-		135197628	+1	no_errors	ENST00000278060	ensembl	human	known	74_37	missense	SNP	1.000	A
LOC101928401	101928401	genome.wustl.edu	37	7	56604444	56604444	+	lincRNA	SNP	T	T	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr7:56604444T>A	ENST00000429367.1	-	0	219																											ttcaaaatcttgcagtaaaat	0.423																																																	0								ENSG00000233288																																			RP11-760D2.5			0			-	Clone_based_vega_gene																													7.37:g.56604444T>A		Somatic	0	8	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	4	60.00		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000429367.1	37	NULL		7																																																																																			-	-		0.423	RP11-760D2.5-001	KNOWN	basic	lincRNA	LOC101928401	lincRNA	OTTHUMT00000343750.1	T		-		56604444	-1	no_errors	ENST00000429367	ensembl	human	known	74_37	rna	SNP	0.255	A
OSBPL6	114880	genome.wustl.edu	37	2	179260225	179260225	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr2:179260225C>T	ENST00000190611.4	+	25	3120	c.2744C>T	c.(2743-2745)aCc>aTc	p.T915I	OSBPL6_ENST00000409631.1_Missense_Mutation_p.T879I|OSBPL6_ENST00000392505.2_Missense_Mutation_p.T940I|OSBPL6_ENST00000359685.3_Missense_Mutation_p.T879I|OSBPL6_ENST00000409045.3_Missense_Mutation_p.T884I|OSBPL6_ENST00000315022.2_Missense_Mutation_p.T919I	NM_032523.3	NP_115912.1	Q9BZF3	OSBL6_HUMAN	oxysterol binding protein-like 6	915					lipid transport (GO:0006869)	cytosol (GO:0005829)|nuclear membrane (GO:0031965)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(13)|lung(18)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	46			OV - Ovarian serous cystadenocarcinoma(117;0.00578)|Epithelial(96;0.00847)|all cancers(119;0.0335)			TCTAACGACACCTACTGGGAG	0.408																																																	0								ENSG00000079156						112.0	114.0	113.0					2																	179260225		2203	4300	6503	OSBPL6	SO:0001583	missense	0			-	HGNC	AF392448	CCDS2277.1, CCDS2278.1, CCDS56150.1, CCDS56151.1, CCDS56152.1	2q32.1	2008-05-27			ENSG00000079156	ENSG00000079156		"""Oxysterol binding proteins"""	16388	protein-coding gene	gene with protein product	"""OSBP-related protein 6"""	606734				11483621	Standard	NM_001201480		Approved	ORP6	uc002uly.3	Q9BZF3	OTTHUMG00000132579	ENST00000190611.4:c.2744C>T	2.37:g.179260225C>T	ENSP00000190611:p.Thr915Ile	Somatic	0	117	0.00		0.41568620468393047	19	26.92	7	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	59	14.49	B4DTW1|C4AMC0|C4AME4|D3DPF6|D3DPF7|Q4ZG68|Q53T68|Q59H61|Q7Z4Q1|Q86V84|Q8N9T0|Q96SR1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Oxysterol-bd,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.T919I	ENST00000190611.4	37	c.2756	CCDS2277.1	2	.	.	.	.	.	.	.	.	.	.	C	22.7	4.327697	0.81690	.	.	ENSG00000079156	ENST00000392505;ENST00000359685;ENST00000409045;ENST00000190611;ENST00000409631;ENST00000315022	T;T;T;T;T;T	0.32023	1.47;1.47;1.47;1.47;1.47;1.47	5.93	5.93	0.95920	.	0.043712	0.85682	D	0.000000	T	0.58278	0.2111	M	0.88775	2.98	0.80722	D	1	B;P;P;P;P	0.51449	0.298;0.529;0.94;0.945;0.533	B;B;P;P;B	0.54759	0.26;0.156;0.76;0.713;0.334	T	0.59757	-0.7394	10	0.39692	T	0.17	-14.9461	20.3363	0.98740	0.0:1.0:0.0:0.0	.	884;919;879;940;915	Q9BZF3-4;Q9BZF3-3;Q9BZF3-2;Q9BZF3-5;Q9BZF3	.;.;.;.;OSBL6_HUMAN	I	940;879;884;915;879;919	ENSP00000376293:T940I;ENSP00000352713:T879I;ENSP00000387248:T884I;ENSP00000190611:T915I;ENSP00000386885:T879I;ENSP00000318723:T919I	ENSP00000190611:T915I	T	+	2	0	OSBPL6	178968471	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.993000	0.56987	2.814000	0.96858	0.563000	0.77884	ACC	-	pfam_Oxysterol-bd		0.408	OSBPL6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	OSBPL6	protein_coding	OTTHUMT00000334393.2	C	NM_032523	-		179260225	+1	no_errors	ENST00000315022	ensembl	human	known	74_37	missense	SNP	1.000	T
OR11H6	122748	genome.wustl.edu	37	14	20692781	20692781	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr14:20692781C>T	ENST00000315519.2	+	1	991	c.913C>T	c.(913-915)Ccc>Tcc	p.P305S		NM_001004480.1	NP_001004480.1	Q8NGC7	O11H6_HUMAN	olfactory receptor, family 11, subfamily H, member 6	305						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(13)|ovary(2)|prostate(1)|skin(2)	29	all_cancers(95;0.00108)		Epithelial(56;1.75e-06)|all cancers(55;1.22e-05)	GBM - Glioblastoma multiforme(265;0.0143)		ATTCTTAAATCCCCTTATCTA	0.413																																																	0								ENSG00000176219						102.0	104.0	104.0					14																	20692781		2203	4300	6503	OR11H6	SO:0001583	missense	0			-	HGNC		CCDS32033.1	14q11.2	2013-09-24			ENSG00000176219	ENSG00000176219		"""GPCR / Class A : Olfactory receptors"""	15349	protein-coding gene	gene with protein product							Standard	NM_001004480		Approved		uc010tlc.2	Q8NGC7	OTTHUMG00000170850	ENST00000315519.2:c.913C>T	14.37:g.20692781C>T	ENSP00000319071:p.Pro305Ser	Somatic	0	48	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	26	25.71	Q6IF08	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.P305S	ENST00000315519.2	37	c.913	CCDS32033.1	14	.	.	.	.	.	.	.	.	.	.	C	13.57	2.276246	0.40294	.	.	ENSG00000176219	ENST00000315519	T	0.63417	-0.04	5.0	4.12	0.48240	GPCR, rhodopsin-like superfamily (1);	0.000000	0.51477	D	0.000081	D	0.84051	0.5387	H	0.96301	3.8	0.36515	D	0.869831	D	0.89917	1.0	D	0.97110	1.0	D	0.90024	0.4130	10	0.87932	D	0	.	11.3302	0.49470	0.0:0.9108:0.0:0.0892	.	305	Q8NGC7	O11H6_HUMAN	S	305	ENSP00000319071:P305S	ENSP00000319071:P305S	P	+	1	0	OR11H6	19762621	1.000000	0.71417	0.987000	0.45799	0.146000	0.21551	7.193000	0.77780	1.328000	0.45358	0.471000	0.43371	CCC	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn		0.413	OR11H6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR11H6	protein_coding	OTTHUMT00000410676.1	C		-		20692781	+1	no_errors	ENST00000315519	ensembl	human	known	74_37	missense	SNP	0.999	T
ABL1	25	genome.wustl.edu	37	9	133750394	133750394	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr9:133750394G>A	ENST00000318560.5	+	7	1606	c.1225G>A	c.(1225-1227)Gag>Aag	p.E409K		NM_005157.4	NP_005148.2	P00519	ABL1_HUMAN	ABL proto-oncogene 1, non-receptor tyrosine kinase	409	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton organization (GO:0030036)|autophagy (GO:0006914)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cellular protein modification process (GO:0006464)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to dopamine (GO:1903351)|cellular response to oxidative stress (GO:0034599)|DNA damage induced protein phosphorylation (GO:0006975)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mismatch repair (GO:0006298)|mitochondrial depolarization (GO:0051882)|mitotic nuclear division (GO:0007067)|muscle cell differentiation (GO:0042692)|negative regulation of phospholipase C activity (GO:1900275)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of ubiquitin-protein transferase activity (GO:0051444)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of autophagy (GO:0010506)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of endocytosis (GO:0030100)|regulation of response to DNA damage stimulus (GO:2001020)|regulation of transcription, DNA-templated (GO:0006355)|response to oxidative stress (GO:0006979)|signal transduction in response to DNA damage (GO:0042770)	actin cytoskeleton (GO:0015629)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	actin monomer binding (GO:0003785)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|mitogen-activated protein kinase binding (GO:0051019)|nicotinate-nucleotide adenylyltransferase activity (GO:0004515)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|proline-rich region binding (GO:0070064)|protein C-terminus binding (GO:0008022)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|SH3 domain binding (GO:0017124)|syntaxin binding (GO:0019905)	p.?(1)		breast(3)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1149)|kidney(3)|large_intestine(7)|lung(15)|ovary(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	1195		all_hematologic(13;0.0361)|Acute lymphoblastic leukemia(5;0.0543)|Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.4e-05)	Adenosine triphosphate(DB00171)|Bosutinib(DB06616)|Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Ponatinib(DB08901)|Regorafenib(DB08896)	GACTGCACCCGAGAGCCTGGC	0.542			"""T, Mis"""	"""BCR, ETV6, NUP214"""	"""CML, ALL, T-ALL"""																																			Dom	yes		9	9q34.1	25	v-abl Abelson murine leukemia viral oncogene homolog 1		L	1	Unknown(1)	haematopoietic_and_lymphoid_tissue(1)						ENSG00000097007						101.0	80.0	88.0					9																	133750394		2203	4300	6503	ABL1	SO:0001583	missense	0			-	HGNC	M14752	CCDS35165.1, CCDS35166.1	9q34.1	2014-09-17	2014-06-26		ENSG00000097007	ENSG00000097007		"""SH2 domain containing"""	76	protein-coding gene	gene with protein product		189980	"""v-abl Abelson murine leukemia viral oncogene homolog 1"", ""c-abl oncogene 1, receptor tyrosine kinase"", ""c-abl oncogene 1, non-receptor tyrosine kinase"""	ABL		1857987, 12626632	Standard	NM_007313		Approved	JTK7, c-ABL, p150	uc004bzv.3	P00519	OTTHUMG00000020813	ENST00000318560.5:c.1225G>A	9.37:g.133750394G>A	ENSP00000323315:p.Glu409Lys	Somatic	0	86	0.00		0.41568620468393047	34	30.61	15	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	52	15.87	A3KFJ3|Q13869|Q13870|Q16133|Q17R61|Q45F09	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_F-actin_binding,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_SH2,pfam_SH3_domain,pfam_SH3_2,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_F-actin_binding,pfscan_SH2,pfscan_SH3_domain,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2	p.E428K	ENST00000318560.5	37	c.1282	CCDS35166.1	9	.	.	.	.	.	.	.	.	.	.	G	36	5.788883	0.96945	.	.	ENSG00000097007	ENST00000444970;ENST00000372348;ENST00000318560	D;D	0.84370	-1.84;-1.84	5.23	5.23	0.72850	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.96476	0.8850	H	0.99851	4.845	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.996	D	0.98771	1.0728	10	0.87932	D	0	.	17.802	0.88590	0.0:0.0:1.0:0.0	.	409;446	P00519;Q59FK4	ABL1_HUMAN;.	K	224;428;409	ENSP00000361423:E428K;ENSP00000323315:E409K	ENSP00000323315:E409K	E	+	1	0	ABL1	132740215	1.000000	0.71417	0.774000	0.31636	0.977000	0.68977	9.858000	0.99539	2.450000	0.82876	0.655000	0.94253	GAG	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom		0.542	ABL1-001	KNOWN	basic|CCDS	protein_coding	ABL1	protein_coding	OTTHUMT00000054684.1	G	NM_007313	-		133750394	+1	no_errors	ENST00000372348	ensembl	human	known	74_37	missense	SNP	1.000	A
TMEM183A	92703	genome.wustl.edu	37	1	202984051	202984051	+	Silent	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr1:202984051C>T	ENST00000367242.3	+	4	482	c.402C>T	c.(400-402)ccC>ccT	p.P134P	TMEM183A_ENST00000468449.1_3'UTR	NM_001079809.1|NM_138391.4	NP_001073277.1|NP_612400.3	Q8IXX5	T183A_HUMAN	transmembrane protein 183A	134						integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(2)|lung(1)|skin(3)	7			BRCA - Breast invasive adenocarcinoma(75;0.18)			AAGAGTATCCCATGGATATTT	0.413																																																	0								ENSG00000163444						82.0	80.0	80.0					1																	202984051		2203	4300	6503	TMEM183A	SO:0001819	synonymous_variant	0			-	HGNC	BC013073	CCDS1432.1	1q31.1	2008-09-09	2006-12-18	2006-12-18	ENSG00000163444	ENSG00000163444			20173	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 37"""	C1orf37			Standard	NM_138391		Approved		uc001gyu.1	Q8IXX5	OTTHUMG00000042051	ENST00000367242.3:c.402C>T	1.37:g.202984051C>T		Somatic	0	92	0.00		0.41568620468393047	35	23.91	11	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	43	29.51	A8K5W1|Q6NW15|Q96E06	Silent	SNP	NA	NA	NA	NA	NA	NA	superfamily_F-box_dom	p.P134	ENST00000367242.3	37	c.402	CCDS1432.1	1																																																																																			-	superfamily_F-box_dom		0.413	TMEM183A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM183A	protein_coding	OTTHUMT00000100129.1	C	NM_138391	-		202984051	+1	no_errors	ENST00000367242	ensembl	human	known	74_37	silent	SNP	1.000	T
MMD	23531	genome.wustl.edu	37	17	53488776	53488776	+	Silent	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr17:53488776G>A	ENST00000262065.3	-	3	407	c.111C>T	c.(109-111)ttC>ttT	p.F37F		NM_012329.2	NP_036461.2	Q15546	PAQRB_HUMAN	monocyte to macrophage differentiation-associated	37					cytolysis (GO:0019835)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)|membrane (GO:0016020)	receptor activity (GO:0004872)			breast(1)|large_intestine(1)|lung(4)|prostate(1)	7						GAACAATGAGGAACTGAGGGA	0.428																																																	0								ENSG00000108960						61.0	59.0	60.0					17																	53488776		2203	4300	6503	MMD	SO:0001819	synonymous_variant	0			-	HGNC	X85750	CCDS11586.1	17q	2008-05-02				ENSG00000108960			7153	protein-coding gene	gene with protein product		604467				7503749, 16044242	Standard	NM_012329		Approved	MMA, PAQR11	uc002iui.3	Q15546		ENST00000262065.3:c.111C>T	17.37:g.53488776G>A		Somatic	0	65	0.00		0.41568620468393047	5	16.67	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	36	25.00	B2R6X9|D3DTY6|Q8TAN7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_HlyIII-related,tigrfam_HylIII	p.F37	ENST00000262065.3	37	c.111	CCDS11586.1	17																																																																																			-	pfam_HlyIII-related,tigrfam_HylIII		0.428	MMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMD	protein_coding	OTTHUMT00000439214.1	G		-		53488776	-1	no_errors	ENST00000262065	ensembl	human	known	74_37	silent	SNP	1.000	A
LYST	1130	genome.wustl.edu	37	1	235929493	235929493	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr1:235929493G>A	ENST00000389794.3	-	21	6181	c.6007C>T	c.(6007-6009)Cct>Tct	p.P2003S	LYST_ENST00000389793.2_Missense_Mutation_p.P2003S|LYST_ENST00000536965.1_3'UTR			Q99698	LYST_HUMAN	lysosomal trafficking regulator	2003					blood coagulation (GO:0007596)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|leukocyte chemotaxis (GO:0030595)|lysosome organization (GO:0007040)|mast cell secretory granule organization (GO:0033364)|melanosome organization (GO:0032438)|microtubule-based process (GO:0007017)|natural killer cell mediated cytotoxicity (GO:0042267)|neutrophil mediated immunity (GO:0002446)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of natural killer cell activation (GO:0032816)|response to drug (GO:0042493)|secretion of lysosomal enzymes (GO:0033299)|T cell mediated immunity (GO:0002456)	cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)				NS(1)|breast(13)|central_nervous_system(3)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(27)|lung(66)|ovary(7)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	162	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			AAATCTGGAGGAGATCCAAGG	0.378																																																	0								ENSG00000143669						161.0	176.0	171.0					1																	235929493		2203	4300	6503	LYST	SO:0001583	missense	0			-	HGNC	U70064	CCDS31062.1	1q42.1-q42.2	2014-09-17	2004-12-09	2004-12-10	ENSG00000143669	ENSG00000143669		"""WD repeat domain containing"""	1968	protein-coding gene	gene with protein product		606897	"""Chediak-Higashi syndrome 1"""	CHS1		8717042, 8896560	Standard	NM_000081		Approved	CHS	uc001hxj.3	Q99698	OTTHUMG00000040527	ENST00000389794.3:c.6007C>T	1.37:g.235929493G>A	ENSP00000374444:p.Pro2003Ser	Somatic	0	41	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	29	12.12	O43274|Q5T2U9|Q96TD7|Q96TD8|Q99709|Q9H133	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.P2003S	ENST00000389794.3	37	c.6007	CCDS31062.1	1	.	.	.	.	.	.	.	.	.	.	G	34	5.364678	0.95877	.	.	ENSG00000143669	ENST00000389794;ENST00000389793	T;T	0.74947	-0.89;-0.89	5.36	5.36	0.76844	.	0.109062	0.64402	D	0.000007	D	0.84000	0.5376	M	0.67953	2.075	0.80722	D	1	D	0.67145	0.996	P	0.60415	0.874	D	0.85305	0.1075	10	0.72032	D	0.01	.	19.4366	0.94798	0.0:0.0:1.0:0.0	.	2003	Q99698	LYST_HUMAN	S	2003	ENSP00000374444:P2003S;ENSP00000374443:P2003S	ENSP00000374443:P2003S	P	-	1	0	LYST	233996116	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.534000	0.98061	2.669000	0.90835	0.585000	0.79938	CCT	-	superfamily_ARM-type_fold		0.378	LYST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LYST	protein_coding	OTTHUMT00000097533.5	G		-		235929493	-1	no_errors	ENST00000389793	ensembl	human	known	74_37	missense	SNP	1.000	A
MURC	347273	genome.wustl.edu	37	9	103348641	103348641	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr9:103348641C>T	ENST00000307584.5	+	2	1068	c.1003C>T	c.(1003-1005)Ccc>Tcc	p.P335S		NM_001018116.1	NP_001018126.1	Q5BKX8	MURC_HUMAN	muscle-related coiled-coil protein	335					cell differentiation (GO:0030154)|muscle organ development (GO:0007517)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	Z disc (GO:0030018)				endometrium(1)|kidney(1)|large_intestine(6)|lung(7)|ovary(1)	16		Acute lymphoblastic leukemia(62;0.0461)				AAGGGAAATCCCCACCCCCGA	0.473																																																	0								ENSG00000170681						45.0	49.0	48.0					9																	103348641		2203	4300	6503	MURC	SO:0001583	missense	0			-	HGNC	BC090888	CCDS35083.1	9q31.1	2014-09-17			ENSG00000170681	ENSG00000170681			33742	protein-coding gene	gene with protein product	"""muscle-restricted coiled-coil protein"""					18508909, 18332105	Standard	NM_001018116		Approved	cavin-4, CAVIN4	uc004bba.3	Q5BKX8	OTTHUMG00000020368	ENST00000307584.5:c.1003C>T	9.37:g.103348641C>T	ENSP00000418668:p.Pro335Ser	Somatic	0	83	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	38	20.83	B1PRL3|B4DT88	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.P335S	ENST00000307584.5	37	c.1003	CCDS35083.1	9	.	.	.	.	.	.	.	.	.	.	C	7.772	0.707626	0.15239	.	.	ENSG00000170681	ENST00000307584	T	0.62941	-0.01	5.28	-3.93	0.04143	.	1.190580	0.05886	N	0.627338	T	0.35682	0.0940	N	0.17082	0.46	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.13764	-1.0497	10	0.12103	T	0.63	0.027	2.3459	0.04271	0.1162:0.3142:0.3429:0.2267	.	335	Q5BKX8	MURC_HUMAN	S	335	ENSP00000418668:P335S	ENSP00000418668:P335S	P	+	1	0	MURC	102388462	0.000000	0.05858	0.000000	0.03702	0.120000	0.20174	-1.172000	0.03112	-0.548000	0.06199	0.555000	0.69702	CCC	-	NULL		0.473	MURC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MURC	protein_coding	OTTHUMT00000053419.2	C	NM_001018116	-		103348641	+1	no_errors	ENST00000307584	ensembl	human	known	74_37	missense	SNP	0.000	T
PIM2	11040	genome.wustl.edu	37	X	48771445	48771445	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chrX:48771445C>T	ENST00000376509.4	-	6	1088	c.899G>A	c.(898-900)gGa>gAa	p.G300E	SLC35A2_ENST00000376515.3_5'Flank|SLC35A2_ENST00000452555.2_5'Flank|SLC35A2_ENST00000376512.1_5'Flank|PIM2_ENST00000485431.1_5'UTR|SLC35A2_ENST00000413561.2_5'Flank|SLC35A2_ENST00000445167.2_5'Flank|SLC35A2_ENST00000376529.3_5'Flank|SLC35A2_ENST00000247138.5_5'Flank|SLC35A2_ENST00000376521.1_5'Flank	NM_006875.3	NP_006866.2	Q9P1W9	PIM2_HUMAN	Pim-2 proto-oncogene, serine/threonine kinase	300					apoptotic mitochondrial changes (GO:0008637)|cell proliferation (GO:0008283)|G1/S transition of mitotic cell cycle (GO:0000082)|male meiosis (GO:0007140)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|positive regulation of autophagy (GO:0010508)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)|response to virus (GO:0009615)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			lung(3)|stomach(1)	4						GGCAGGGCCTCCTTTGGAGGG	0.627																																																	0								ENSG00000102096						24.0	20.0	21.0					X																	48771445		2155	4222	6377	PIM2	SO:0001583	missense	0			-	HGNC	U77735	CCDS14312.1	Xp11.23	2014-06-25	2014-06-25		ENSG00000102096	ENSG00000102096			8987	protein-coding gene	gene with protein product		300295	"""pim-2 oncogene"""			9804974	Standard	NM_006875		Approved		uc004dls.3	Q9P1W9	OTTHUMG00000024132	ENST00000376509.4:c.899G>A	X.37:g.48771445C>T	ENSP00000365692:p.Gly300Glu	Somatic	0	93	0.00		0.41568620468393047	15	31.82	7	WXS	Illumina HiSeq 2500	Phase_IV	tier1	34	25	57.63	A8K4G6|Q99739	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.G300E	ENST00000376509.4	37	c.899	CCDS14312.1	X	.	.	.	.	.	.	.	.	.	.	C	2.357	-0.347389	0.05208	.	.	ENSG00000102096	ENST00000376509	T	0.67345	-0.26	4.86	4.86	0.63082	.	0.611497	0.16108	N	0.229235	T	0.39436	0.1078	N	0.03608	-0.345	0.09310	N	1	B	0.18166	0.026	B	0.15870	0.014	T	0.05954	-1.0854	10	0.02654	T	1	.	13.9013	0.63806	0.0:1.0:0.0:0.0	.	300	Q9P1W9	PIM2_HUMAN	E	300	ENSP00000365692:G300E	ENSP00000365692:G300E	G	-	2	0	PIM2	48656389	0.811000	0.29063	0.052000	0.19188	0.022000	0.10575	0.644000	0.24766	2.250000	0.74265	0.600000	0.82982	GGA	-	NULL		0.627	PIM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIM2	protein_coding	OTTHUMT00000060805.1	C		-		48771445	-1	no_errors	ENST00000376509	ensembl	human	known	74_37	missense	SNP	0.074	T
ZNF264	9422	genome.wustl.edu	37	19	57705380	57705380	+	Intron	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr19:57705380C>T	ENST00000263095.6	+	2	574				ZNF264_ENST00000599653.1_Silent_p.F57F|ZNF264_ENST00000600531.1_Intron|ZNF264_ENST00000536056.1_Intron	NM_003417.4	NP_003408.1	O43296	ZN264_HUMAN	zinc finger protein 264						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(8)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	27		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0135)		GTAAGGCCTTCCTTCCCCCTC	0.587																																																	0								ENSG00000083844						81.0	85.0	84.0					19																	57705380		2203	4300	6503	ZNF264	SO:0001627	intron_variant	0			-	HGNC	AB007872	CCDS33127.1	19q13.4	2013-01-08				ENSG00000083844		"""Zinc fingers, C2H2-type"", ""-"""	13057	protein-coding gene	gene with protein product		604668				9455477	Standard	NM_003417		Approved	KIAA0412	uc002qob.3	O43296		ENST00000263095.6:c.160+11C>T	19.37:g.57705380C>T		Somatic	0	97	0.00		0.41568620468393047	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	55	23.61	A8K8Y9|Q9P1V0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	p.F57	ENST00000263095.6	37	c.171	CCDS33127.1	19																																																																																			-	superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box		0.587	ZNF264-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF264	protein_coding	OTTHUMT00000465080.1	C		-		57705380	+1	no_errors	ENST00000599653	ensembl	human	putative	74_37	silent	SNP	0.000	T
DNAJC10	54431	genome.wustl.edu	37	2	183616419	183616419	+	Silent	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr2:183616419C>T	ENST00000264065.7	+	15	1756	c.1341C>T	c.(1339-1341)gcC>gcT	p.A447A		NM_018981.1	NP_061854.1	Q8IXB1	DJC10_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 10	447	Trxb 2.				cell redox homeostasis (GO:0045454)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of ATPase activity (GO:0032781)|protein folding in endoplasmic reticulum (GO:0034975)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum chaperone complex (GO:0034663)|endoplasmic reticulum lumen (GO:0005788)|membrane (GO:0016020)	ATPase activator activity (GO:0001671)|ATPase binding (GO:0051117)|chaperone binding (GO:0051087)|disulfide oxidoreductase activity (GO:0015036)|Hsp70 protein binding (GO:0030544)|misfolded protein binding (GO:0051787)|oxidoreductase activity, acting on a sulfur group of donors, disulfide as acceptor (GO:0016671)|protein disulfide oxidoreductase activity (GO:0015035)			breast(3)|endometrium(1)|kidney(4)|large_intestine(7)|lung(15)|ovary(1)|skin(1)	32			OV - Ovarian serous cystadenocarcinoma(117;0.0942)|Epithelial(96;0.209)			TTGCCTTTGCCAAAGAAAGTG	0.368																																					Pancreas(56;860 1183 25669 35822 48585)												0								ENSG00000077232						143.0	147.0	145.0					2																	183616419		2203	4300	6503	DNAJC10	SO:0001819	synonymous_variant	0			-	HGNC		CCDS33345.1, CCDS74613.1	2q32.1	2011-11-23			ENSG00000077232	ENSG00000077232		"""Heat shock proteins / DNAJ (HSP40)"", ""Protein disulfide isomerases"""	24637	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 19"""	607987				12411443, 12446677	Standard	NM_018981		Approved	ERdj5, PDIA19	uc002uow.2	Q8IXB1	OTTHUMG00000154209	ENST00000264065.7:c.1341C>T	2.37:g.183616419C>T		Somatic	0	92	0.00		0.41568620468393047	14	17.65	3	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	51	12.07	Q17RJ6|Q3B7W8|Q4ZG06|Q53QT7|Q6UWZ6|Q86T61|Q8NC82|Q8TD87|Q96K38|Q96K44|Q96K54|Q9NSY6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Thioredoxin_domain,pfam_DnaJ_domain,superfamily_Thioredoxin-like_fold,superfamily_DnaJ_domain,smart_DnaJ_domain,pirsf_DnaJ_homolog_subfam-C,pfscan_DnaJ_domain,prints_DnaJ_domain,prints_Thioredoxin	p.A447	ENST00000264065.7	37	c.1341	CCDS33345.1	2																																																																																			-	superfamily_Thioredoxin-like_fold,pirsf_DnaJ_homolog_subfam-C		0.368	DNAJC10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC10	protein_coding	OTTHUMT00000334418.2	C	NM_018981	-		183616419	+1	no_errors	ENST00000264065	ensembl	human	known	74_37	silent	SNP	1.000	T
ZC3H15	55854	genome.wustl.edu	37	2	187368861	187368861	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr2:187368861C>T	ENST00000337859.6	+	6	864	c.637C>T	c.(637-639)Cct>Tct	p.P213S	ZC3H15_ENST00000544130.1_Missense_Mutation_p.P8S|AC018867.2_ENST00000595956.1_5'Flank	NM_018471.2	NP_060941.2	Q8WU90	ZC3HF_HUMAN	zinc finger CCCH-type containing 15	213					cytokine-mediated signaling pathway (GO:0019221)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(1)|kidney(1)|large_intestine(4)|lung(5)|skin(1)	15			OV - Ovarian serous cystadenocarcinoma(117;0.0148)|Epithelial(96;0.0922)|all cancers(119;0.233)			TGCACTTCCTCCTGGATTTGT	0.388																																																	0								ENSG00000065548						138.0	127.0	130.0					2																	187368861		1835	4087	5922	ZC3H15	SO:0001583	missense	0			-	HGNC		CCDS42791.1	2q32.1	2012-07-05			ENSG00000065548	ENSG00000065548		"""Zinc fingers, CCCH-type domain containing"""	29528	protein-coding gene	gene with protein product	"""likely ortholog of mouse immediate early response, erythropoietin 4"""					10880228	Standard	NM_018471		Approved	LEREPO4	uc002upo.3	Q8WU90	OTTHUMG00000154251	ENST00000337859.6:c.637C>T	2.37:g.187368861C>T	ENSP00000338788:p.Pro213Ser	Somatic	0	58	0.00		0.41568620468393047	56	34.12	29	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	50	19.35	B4DMW2|D3DPG7|Q5QTQ4|Q8WZ06|Q9NUZ3|Q9NZ37|Q9P079	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_CCCH,smart_Znf_CCCH	p.P213S	ENST00000337859.6	37	c.637	CCDS42791.1	2	.	.	.	.	.	.	.	.	.	.	C	24.1	4.490604	0.84962	.	.	ENSG00000065548	ENST00000337859;ENST00000544130;ENST00000536434	T	0.35973	1.28	5.87	5.87	0.94306	.	0.156231	0.64402	D	0.000019	T	0.54727	0.1876	M	0.79011	2.435	0.48901	D	0.999725	D	0.55605	0.972	P	0.50659	0.647	T	0.55982	-0.8054	10	0.54805	T	0.06	-11.1417	20.5827	0.99408	0.0:1.0:0.0:0.0	.	213	Q8WU90	ZC3HF_HUMAN	S	213;8;213	ENSP00000338788:P213S	ENSP00000338788:P213S	P	+	1	0	ZC3H15	187077106	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.798000	0.55522	2.941000	0.99782	0.655000	0.94253	CCT	-	NULL		0.388	ZC3H15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZC3H15	protein_coding	OTTHUMT00000334547.2	C	NM_018471	-		187368861	+1	no_errors	ENST00000337859	ensembl	human	known	74_37	missense	SNP	1.000	T
DDX21	9188	genome.wustl.edu	37	10	70719688	70719688	+	Missense_Mutation	SNP	C	C	T	rs374486646		TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr10:70719688C>T	ENST00000354185.4	+	2	312	c.214C>T	c.(214-216)Cct>Tct	p.P72S		NM_001256910.1|NM_004728.3	NP_001243839.1|NP_004719.2	Q9NR30	DDX21_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 21	72					ATP catabolic process (GO:0006200)|osteoblast differentiation (GO:0001649)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(6)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)	20						CATGAATTCTCCTAAATCCAA	0.358																																																	0								ENSG00000165732						46.0	50.0	49.0					10																	70719688		2203	4300	6503	DDX21	SO:0001583	missense	0			-	HGNC	U41387	CCDS31211.1, CCDS73144.1	10q21	2013-05-13	2012-02-23		ENSG00000165732	ENSG00000165732		"""DEAD-boxes"""	2744	protein-coding gene	gene with protein product		606357	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 21"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 21"""			8614622, 18180292	Standard	NM_004728		Approved	RH-II/GU, GURDB	uc001jov.2	Q9NR30	OTTHUMG00000018366	ENST00000354185.4:c.214C>T	10.37:g.70719688C>T	ENSP00000346120:p.Pro72Ser	Somatic	0	58	0.00		0.41568620468393047	1	66.67	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	24	20.00	B2RDL0|Q13436|Q5VX41|Q68D35	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_GUCT,pfam_Helicase_C,pfam_Helicase/UvrB_dom,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.P72S	ENST00000354185.4	37	c.214	CCDS31211.1	10	.	.	.	.	.	.	.	.	.	.	C	6.271	0.418145	0.11870	.	.	ENSG00000165732	ENST00000354185;ENST00000541642	T	0.23147	1.92	5.76	3.93	0.45458	.	1.914650	0.01979	N	0.044670	T	0.21427	0.0516	N	0.19112	0.55	0.33950	D	0.644369	B	0.12630	0.006	B	0.10450	0.005	T	0.12993	-1.0526	10	0.38643	T	0.18	-22.1039	9.1223	0.36795	0.0:0.8322:0.0:0.1678	.	72	Q9NR30	DDX21_HUMAN	S	72	ENSP00000346120:P72S	ENSP00000346120:P72S	P	+	1	0	DDX21	70389694	0.914000	0.31030	0.984000	0.44739	0.202000	0.24057	1.036000	0.30228	0.908000	0.36671	-0.143000	0.13931	CCT	-	NULL		0.358	DDX21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX21	protein_coding	OTTHUMT00000048374.1	C	NM_004728	-		70719688	+1	no_errors	ENST00000354185	ensembl	human	known	74_37	missense	SNP	0.999	T
CSMD1	64478	genome.wustl.edu	37	8	2820869	2820869	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr8:2820869C>T	ENST00000520002.1	-	61	9887	c.9332G>A	c.(9331-9333)gGa>gAa	p.G3111E	CSMD1_ENST00000602723.1_Missense_Mutation_p.G2934E|CSMD1_ENST00000537824.1_Missense_Mutation_p.G3110E|CSMD1_ENST00000542608.1_Missense_Mutation_p.G2933E|CSMD1_ENST00000400186.3_Missense_Mutation_p.G2934E|CSMD1_ENST00000602557.1_Missense_Mutation_p.G3111E			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	3111	Sushi 25. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		GAAATCACTTCCCTCCACTGT	0.582																																																	0								ENSG00000183117						137.0	143.0	141.0					8																	2820869		1942	4158	6100	CSMD1	SO:0001583	missense	0			-	HGNC			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.9332G>A	8.37:g.2820869C>T	ENSP00000430733:p.Gly3111Glu	Somatic	0	39	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	20	23.08	Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_CUB_dom,pfam_Sushi_SCR_CCP,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.G3111E	ENST00000520002.1	37	c.9332		8	.	.	.	.	.	.	.	.	.	.	C	16.66	3.184531	0.57909	.	.	ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608	T;T;T;T	0.26067	1.76;1.76;1.76;1.76	5.93	5.93	0.95920	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.64402	D	0.000001	T	0.60287	0.2257	M	0.86573	2.825	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	T	0.64032	-0.6502	10	0.66056	D	0.02	.	20.3312	0.98718	0.0:1.0:0.0:0.0	.	3111;3111;2933	E5RIG2;Q96PZ7;F5H2I8	.;CSMD1_HUMAN;.	E	2934;3111;2972;3110;2933	ENSP00000383047:G2934E;ENSP00000430733:G3111E;ENSP00000441462:G3110E;ENSP00000446243:G2933E	ENSP00000320445:G2972E	G	-	2	0	CSMD1	2808276	1.000000	0.71417	0.963000	0.40424	0.099000	0.18886	7.642000	0.83385	2.797000	0.96272	0.655000	0.94253	GGA	-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP		0.582	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	CSMD1	protein_coding	OTTHUMT00000374500.2	C	NM_033225	-		2820869	-1	no_errors	ENST00000520002	ensembl	human	known	74_37	missense	SNP	1.000	T
COL7A1	1294	genome.wustl.edu	37	3	48626427	48626427	+	Splice_Site	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr3:48626427G>A	ENST00000328333.8	-	18	2423	c.2316C>T	c.(2314-2316)gcC>gcT	p.A772A	COL7A1_ENST00000454817.1_Splice_Site_p.A772A	NM_000094.3	NP_000085.1	Q02388	CO7A1_HUMAN	collagen, type VII, alpha 1	772	Fibronectin type-III 6. {ECO:0000255|PROSITE-ProRule:PRU00316}.|Nonhelical region (NC1).				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|collagen type VII trimer (GO:0005590)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(3)|breast(8)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(57)|ovary(7)|prostate(5)|skin(9)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	137				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		CAGGCTCAGGGGCTGGGGACA	0.572																																																	0								ENSG00000114270						67.0	67.0	67.0					3																	48626427		2203	4300	6503	COL7A1	SO:0001630	splice_region_variant	0			-	HGNC	L02870	CCDS2773.1	3p21.1	2014-09-17	2008-08-01		ENSG00000114270	ENSG00000114270		"""Collagens"", ""Fibronectin type III domain containing"""	2214	protein-coding gene	gene with protein product	"""collagen VII, alpha-1 polypeptide"", ""LC collagen"""	120120	"""epidermolysis bullosa, dystrophic, dominant and recessive"""	EBDCT, EBD1, EBR1		1871109	Standard	NM_000094		Approved		uc003ctz.2	Q02388	OTTHUMG00000133541	ENST00000328333.8:c.2315-1C>T	3.37:g.48626427G>A		Somatic	0	30	0.00		0.41568620468393047	6	14.29	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	15	21.05	Q14054|Q16507	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Collagen,pfam_Fibronectin_type3,pfam_VWF_A,pfam_Prot_inh_Kunz-m,superfamily_Fibronectin_type3,superfamily_Prot_inh_Kunz-m,smart_VWF_A,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_VWF_A,pfscan_Prot_inh_Kunz-m,prints_Prot_inh_Kunz-m	p.A772	ENST00000328333.8	37	c.2316	CCDS2773.1	3																																																																																			-	superfamily_Fibronectin_type3		0.572	COL7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL7A1	protein_coding	OTTHUMT00000257519.1	G	NM_000094	-	Silent	48626427	-1	no_errors	ENST00000328333	ensembl	human	known	74_37	silent	SNP	1.000	A
RUNX1T1	862	genome.wustl.edu	37	8	93017458	93017458	+	Missense_Mutation	SNP	T	T	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr8:93017458T>A	ENST00000523629.1	-	6	1080	c.626A>T	c.(625-627)cAg>cTg	p.Q209L	RUNX1T1_ENST00000520724.1_Missense_Mutation_p.Q172L|RUNX1T1_ENST00000436581.2_Missense_Mutation_p.Q220L|RUNX1T1_ENST00000265814.3_Missense_Mutation_p.Q209L|RUNX1T1_ENST00000518844.1_Missense_Mutation_p.Q182L|RUNX1T1_ENST00000360348.2_Missense_Mutation_p.Q172L|RUNX1T1_ENST00000521553.1_Missense_Mutation_p.Q172L|RUNX1T1_ENST00000396218.1_Missense_Mutation_p.Q182L|RUNX1T1_ENST00000422361.2_Missense_Mutation_p.Q172L	NM_001198626.1|NM_001198630.1|NM_001198633.1|NM_175634.2	NP_001185555.1|NP_001185559.1|NP_001185562.1|NP_783552.1	Q06455	MTG8_HUMAN	runt-related transcription factor 1; translocated to, 1 (cyclin D-related)	209	TAFH. {ECO:0000255|PROSITE- ProRule:PRU00440}.				fat cell differentiation (GO:0045444)|generation of precursor metabolites and energy (GO:0006091)|regulation of DNA binding (GO:0051101)|transcription, DNA-templated (GO:0006351)	nuclear matrix (GO:0016363)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(17)|lung(54)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	86			BRCA - Breast invasive adenocarcinoma(11;0.0141)			GGCGAGGTACTGGGCAGGGTT	0.582																																																	0								ENSG00000079102						168.0	131.0	144.0					8																	93017458		2203	4300	6503	RUNX1T1	SO:0001583	missense	0			-	HGNC	D43638	CCDS6256.1, CCDS6257.1, CCDS47891.1, CCDS56544.1, CCDS75766.1, CCDS75767.1	8q22	2007-01-29	2005-01-20	2005-01-22	ENSG00000079102	ENSG00000079102		"""Zinc fingers, MYND-type"""	1535	protein-coding gene	gene with protein product		133435	"""core-binding factor, runt domain, alpha subunit 2; translocated to, 1; cyclin D-related"""	AML1T1, CBFA2T1		1391946, 9790752	Standard	NM_004349		Approved	CDR, ETO, MTG8, ZMYND2	uc011lgi.2	Q06455	OTTHUMG00000164066	ENST00000523629.1:c.626A>T	8.37:g.93017458T>A	ENSP00000428543:p.Gln209Leu	Somatic	0	26	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	10	23.08	B7Z4P4|E7EPN4|O14784|Q06456|Q14873|Q16239|Q16346|Q16347|Q6IBL1|Q6NXH1|Q7Z4J5|Q92479|Q9BRZ0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_NHR2,pfam_TAFH_NHR1,pfam_Znf_MYND,smart_TAFH_NHR1,pfscan_TAFH_NHR1,pfscan_Znf_MYND,prints_ETO,prints_MTG8	p.Q220L	ENST00000523629.1	37	c.659	CCDS6256.1	8	.	.	.	.	.	.	.	.	.	.	T	29.6	5.021530	0.93462	.	.	ENSG00000079102	ENST00000523629;ENST00000396218;ENST00000265814;ENST00000360348;ENST00000422361;ENST00000520724;ENST00000436581;ENST00000518844;ENST00000521553;ENST00000518992	T;T;T;T;T;T;T;T;T;T	0.50277	0.75;0.75;0.75;0.75;0.75;0.75;0.75;0.75;0.75;0.75	5.67	5.67	0.87782	TAFH/NHR1 (3);	0.000000	0.85682	D	0.000000	T	0.69342	0.3100	M	0.73962	2.25	0.80722	D	1	D;P;D	0.71674	0.988;0.954;0.998	D;D;D	0.87578	0.963;0.932;0.998	T	0.73385	-0.3999	10	0.87932	D	0	-16.6896	15.8933	0.79318	0.0:0.0:0.0:1.0	.	220;209;182	E7EPN4;Q06455;Q06455-2	.;MTG8_HUMAN;.	L	209;182;209;172;172;172;220;182;172;209	ENSP00000428543:Q209L;ENSP00000379520:Q182L;ENSP00000265814:Q209L;ENSP00000353504:Q172L;ENSP00000390137:Q172L;ENSP00000428742:Q172L;ENSP00000402257:Q220L;ENSP00000430728:Q182L;ENSP00000429728:Q172L;ENSP00000431094:Q209L	ENSP00000265814:Q209L	Q	-	2	0	RUNX1T1	93086634	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.040000	0.89188	2.158000	0.67659	0.533000	0.62120	CAG	-	pfam_TAFH_NHR1,smart_TAFH_NHR1,pfscan_TAFH_NHR1,prints_ETO		0.582	RUNX1T1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RUNX1T1	protein_coding	OTTHUMT00000377045.3	T	NM_004349, NM_175635	-		93017458	-1	no_errors	ENST00000436581	ensembl	human	known	74_37	missense	SNP	1.000	A
TUNAR	100507043	genome.wustl.edu	37	14	96389338	96389338	+	lincRNA	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr14:96389338C>T	ENST00000503525.2	+	0	627					NR_038861.1																						CTCAGAATGGCCAAAGACGGA	0.522																																																	0								ENSG00000250366																																			LINC00617			0			-	HGNC																													14.37:g.96389338C>T		Somatic	0	19	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	8	46.67		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000503525.2	37	NULL		14																																																																																			-	-		0.522	LINC00617-002	KNOWN	basic	lincRNA	LINC00617	lincRNA	OTTHUMT00000413257.1	C		-		96389338	+1	no_errors	ENST00000503525	ensembl	human	known	74_37	rna	SNP	0.646	T
FBN2	2201	genome.wustl.edu	37	5	127627260	127627260	+	Missense_Mutation	SNP	G	G	A	rs34845843	byFrequency	TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr5:127627260G>A	ENST00000508053.1	-	55	7227	c.6253C>T	c.(6253-6255)Cct>Tct	p.P2085S	FBN2_ENST00000262464.4_Missense_Mutation_p.P2085S			P35556	FBN2_HUMAN	fibrillin 2	2085	EGF-like 35; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		ACAAAGCCAGGGGGGCAGAGG	0.438																																																	0								ENSG00000138829						91.0	101.0	98.0					5																	127627260		2203	4300	6503	FBN2	SO:0001583	missense	0			-	HGNC	U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.6253C>T	5.37:g.127627260G>A	ENSP00000424571:p.Pro2085Ser	Somatic	0	45	0.00		0.41568620468393047	6	40.00	4	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	41	21.15	B4DU01|Q59ES6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_FBN,pfam_EGF-like_Ca-bd_dom,pfam_EG-like_dom,pfam_TB_dom,superfamily_TB_dom,superfamily_Cadherin-like,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom	p.P2085S	ENST00000508053.1	37	c.6253	CCDS34222.1	5	.	.	.	.	.	.	.	.	.	.	G	13.48	2.248488	0.39797	.	.	ENSG00000138829	ENST00000262464;ENST00000508053	D;D	0.91686	-2.89;-2.89	5.35	4.42	0.53409	EGF-like region, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.093773	0.46758	D	0.000270	D	0.87014	0.6072	L	0.28504	0.86	0.32896	D	0.512551	B	0.23735	0.09	B	0.28385	0.089	D	0.85494	0.1187	10	0.32370	T	0.25	.	13.8806	0.63680	0.0:0.0:0.7934:0.2066	.	2085	P35556	FBN2_HUMAN	S	2085	ENSP00000262464:P2085S;ENSP00000424571:P2085S	ENSP00000262464:P2085S	P	-	1	0	FBN2	127655159	0.930000	0.31532	1.000000	0.80357	0.914000	0.54420	1.532000	0.36029	2.941000	0.99782	0.655000	0.94253	CCT	-	pirsf_FBN,pfam_EGF-like_Ca-bd_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom		0.438	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN2	protein_coding	OTTHUMT00000371618.2	G	NM_001999	-		127627260	-1	no_errors	ENST00000262464	ensembl	human	known	74_37	missense	SNP	0.964	A
PHF20L1	51105	genome.wustl.edu	37	8	133854715	133854715	+	Intron	DEL	T	T	-			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr8:133854715delT	ENST00000395386.2	+	19	2686				AF230666.2_ENST00000608375.1_RNA|PHF20L1_ENST00000395390.2_Intron|PHF20L1_ENST00000220847.7_Intron|AF230666.2_ENST00000429151.1_RNA	NM_016018.4	NP_057102.4	A8MW92	P20L1_HUMAN	PHD finger protein 20-like 1								zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|large_intestine(1)|lung(10)|ovary(2)	15	all_neural(3;2.72e-06)|Medulloblastoma(3;7.08e-05)|Ovarian(258;0.00438)|Esophageal squamous(12;0.00507)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;4.46e-05)			TGTTAATAGATTTTTTTTTTT	0.353																																																	0								ENSG00000223697			771,404,58,2217		4,7,7,749,7,1,382,4,42,522	29.0	27.0	28.0			1.7	0.0	8	dbSNP_130	30	1671,958,90,5033		27,10,2,1605,5,4,934,0,84,1205	no	intron	PHF20L1	NM_016018.4		31,17,9,2354,12,5,1316,4,126,1727	A1A1,A1A2,A1A3,A1R,A2A2,A2A3,A2R,A3A3,A3R,RR		35.0748,35.7391,35.2794			133854715	2442,1362,148,7250	1781	4050	5831	AF230666.2	SO:0001627	intron_variant	0				Clone_based_vega_gene	AF230666	CCDS6367.2, CCDS6368.1, CCDS75791.1	8q24.22	2014-03-24			ENSG00000129292	ENSG00000129292		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	24280	protein-coding gene	gene with protein product	"""tudor domain containing 20B"""					10810093, 24492612	Standard	NM_016018		Approved	CGI-72, FLJ13649, MGC64923, FLJ21615, TDRD20B	uc003ytt.3	A8MW92	OTTHUMG00000148656	ENST00000395386.2:c.2388-45T>-	8.37:g.133854715delT		Somatic	0	34	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	24	25.00	A8MZC9|Q86U89|Q86W43|Q96BT0|Q9H702|Q9HBK3|Q9NYR3|Q9Y381	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000395386.2	37	NULL	CCDS6367.2	8																																																																																			-	-		0.353	PHF20L1-008	PUTATIVE	basic|appris_principal|CCDS	protein_coding	ENSG00000223697	protein_coding	OTTHUMT00000308949.3	T	NM_016018			133854715	-1	no_errors	ENST00000608375	ensembl	human	known	74_37	rna	DEL	0.003	-
CASP8AP2	9994	genome.wustl.edu	37	6	90576756	90576756	+	RNA	SNP	C	C	T	rs376295745		TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr6:90576756C>T	ENST00000551025.1	+	0	5184									caspase 8 associated protein 2											NS(1)|endometrium(7)|kidney(6)|large_intestine(12)|lung(21)|ovary(2)|urinary_tract(2)	51		all_cancers(76;3.64e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;4.69e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0953)		ACTCTCAATCCGAAGAGCGCT	0.373													C|||	1	0.000199681	0.0	0.0	5008	,	,		18055	0.0		0.0	False		,,,				2504	0.001				Colon(187;1656 2025 17045 31481 39901)												0								ENSG00000118412	C	,,	1,3677		0,1,1838	37.0	38.0	38.0		3747,3747,3747	-1.9	0.0	6		38	2,8174		0,2,4086	no	coding-synonymous,coding-synonymous,coding-synonymous	CASP8AP2	NM_001137667.1,NM_001137668.1,NM_012115.3	,,	0,3,5924	TT,TC,CC		0.0245,0.0272,0.0253	,,	1249/1967,1249/1967,1249/1967	90576756	3,11851	1839	4088	5927	CASP8AP2			0			-	HGNC	AB037736		6q15	2012-04-19	2008-10-30		ENSG00000118412	ENSG00000118412			1510	protein-coding gene	gene with protein product	"""FLICE-associated huge protein"""	606880	"""CASP8 associated protein 2"""			10235259, 17245429, 17003126	Standard	NM_001137668		Approved	FLASH, CED-4, RIP25, FLJ11208, KIAA1315	uc011dzz.2	Q9UKL3	OTTHUMG00000015212		6.37:g.90576756C>T		Somatic	0	25	0.00		0.41568620468393047	0	100.00	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	10	44.44		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000551025.1	37	NULL		6																																																																																			-	-		0.373	CASP8AP2-202	KNOWN	basic	processed_transcript	CASP8AP2	processed_transcript		C	NM_001137667	-		90576756	+1	no_errors	ENST00000237177	ensembl	human	known	74_37	rna	SNP	0.000	T
EOMES	8320	genome.wustl.edu	37	3	27763770	27763770	+	Missense_Mutation	SNP	G	G	T	rs200789175	byFrequency	TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr3:27763770G>T	ENST00000295743.4	-	1	219	c.16C>A	c.(16-18)Cag>Aag	p.Q6K	EOMES_ENST00000537516.1_Intron|EOMES_ENST00000461503.1_Intron|EOMES_ENST00000449599.1_Missense_Mutation_p.Q6K			O95936	EOMES_HUMAN	eomesodermin	6					brain development (GO:0007420)|cardioblast differentiation (GO:0010002)|CD8-positive, alpha-beta T cell differentiation involved in immune response (GO:0002302)|cell differentiation involved in embryonic placenta development (GO:0060706)|cerebral cortex neuron differentiation (GO:0021895)|cerebral cortex regionalization (GO:0021796)|endoderm formation (GO:0001706)|endodermal cell fate specification (GO:0001714)|interferon-gamma production (GO:0032609)|mesoderm formation (GO:0001707)|mesodermal to mesenchymal transition involved in gastrulation (GO:0060809)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|olfactory bulb development (GO:0021772)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of neuron differentiation (GO:0045664)|skeletal muscle cell differentiation (GO:0035914)|stem cell maintenance (GO:0019827)|trophectodermal cell differentiation (GO:0001829)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(7)|ovary(3)|prostate(1)	21						ACCAAGAGCTGCTCCCCTAAC	0.657																																																	0								ENSG00000163508						12.0	13.0	13.0					3																	27763770		1933	4048	5981	EOMES	SO:0001583	missense	0			-	HGNC	BC025363	CCDS2646.1, CCDS63585.1	3p24.1	2011-06-13	2010-06-24		ENSG00000163508	ENSG00000163508		"""T-boxes"""	3372	protein-coding gene	gene with protein product	"""T-box brain2"""	604615	"""eomesodermin (Xenopus laevis) homolog"""			9888994, 9434949	Standard	NM_005442		Approved	TBR2	uc003cdy.4	O95936	OTTHUMG00000130570	ENST00000295743.4:c.16C>A	3.37:g.27763770G>T	ENSP00000295743:p.Gln6Lys	Somatic	0	26	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	12	20.00	B7Z4I2|B7ZA51|G3XAI5|Q8TAZ2|Q9UPM7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TF_T-box,superfamily_p53-like_TF_DNA-bd,smart_TF_T-box,pfscan_TF_T-box,prints_TF_T-box	p.Q6K	ENST00000295743.4	37	c.16	CCDS2646.1	3	.	.	.	.	.	.	.	.	.	.	G	14.60	2.584510	0.46110	.	.	ENSG00000163508	ENST00000295743;ENST00000449599	D;D	0.85773	-2.03;-2.02	4.68	4.68	0.58851	.	3.542420	0.03256	U	0.182527	D	0.83202	0.5203	L	0.34521	1.04	0.80722	D	1	B;B;B	0.31817	0.341;0.341;0.231	B;B;B	0.32762	0.152;0.08;0.037	T	0.60357	-0.7279	10	0.37606	T	0.19	.	16.5707	0.84612	0.0:0.0:1.0:0.0	.	6;6;6	F5H3K1;G3XAI5;O95936	.;.;EOMES_HUMAN	K	6	ENSP00000295743:Q6K;ENSP00000388620:Q6K	ENSP00000295743:Q6K	Q	-	1	0	EOMES	27738774	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.676000	0.46883	2.450000	0.82876	0.456000	0.33151	CAG	-	NULL		0.657	EOMES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EOMES	protein_coding	OTTHUMT00000252995.1	G	NM_005442	-		27763770	-1	no_errors	ENST00000449599	ensembl	human	known	74_37	missense	SNP	1.000	T
GPR63	81491	genome.wustl.edu	37	6	97247514	97247514	+	Missense_Mutation	SNP	G	G	C			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr6:97247514G>C	ENST00000229955.3	-	2	439	c.94C>G	c.(94-96)Cct>Gct	p.P32A	GPR63_ENST00000417980.1_Missense_Mutation_p.P32A	NM_001143957.2|NM_030784.3	NP_001137429.1|NP_110411.1	Q9BZJ6	GPR63_HUMAN	G protein-coupled receptor 63	32						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)	p.P32T(1)		kidney(1)|large_intestine(5)|lung(13)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		all_cancers(76;6.89e-05)|Acute lymphoblastic leukemia(125;7.02e-10)|all_hematologic(75;1.23e-06)|all_epithelial(107;0.0618)|Colorectal(196;0.0721)		BRCA - Breast invasive adenocarcinoma(108;0.0912)		AATGGTGGAGGGAGTGTAATA	0.458																																																	1	Substitution - Missense(1)	lung(1)						ENSG00000112218						127.0	115.0	119.0					6																	97247514		2203	4300	6503	GPR63	SO:0001583	missense	0			-	HGNC	AF317654	CCDS5036.1	6q16.1-q16.3	2012-08-21			ENSG00000112218	ENSG00000112218		"""GPCR / Class A : Orphans"""	13302	protein-coding gene	gene with protein product		606915					Standard	NM_030784		Approved	PSP24(beta), PSP24B	uc003pou.3	Q9BZJ6	OTTHUMG00000015245	ENST00000229955.3:c.94C>G	6.37:g.97247514G>C	ENSP00000229955:p.Pro32Ala	Somatic	0	79	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	34	27.66	Q9UJH3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.P32A	ENST00000229955.3	37	c.94	CCDS5036.1	6	.	.	.	.	.	.	.	.	.	.	G	9.198	1.027870	0.19512	.	.	ENSG00000112218	ENST00000536583;ENST00000417980;ENST00000229955;ENST00000369268	T;T;T	0.59083	0.29;0.29;0.29	5.15	5.15	0.70609	.	0.164450	0.28841	N	0.013965	T	0.29288	0.0729	N	0.14661	0.345	0.41960	D	0.990708	B	0.06786	0.001	B	0.04013	0.001	T	0.18681	-1.0329	10	0.66056	D	0.02	-5.1132	16.0686	0.80907	0.0:0.134:0.866:0.0	.	32	Q9BZJ6	GPR63_HUMAN	A	56;32;32;32	ENSP00000393170:P32A;ENSP00000229955:P32A;ENSP00000358273:P32A	ENSP00000229955:P32A	P	-	1	0	GPR63	97354235	0.998000	0.40836	0.116000	0.21606	0.642000	0.38348	2.747000	0.47475	2.569000	0.86673	0.650000	0.86243	CCT	-	NULL		0.458	GPR63-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR63	protein_coding	OTTHUMT00000041566.2	G		-		97247514	-1	no_errors	ENST00000229955	ensembl	human	known	74_37	missense	SNP	0.895	C
PRG4	10216	genome.wustl.edu	37	1	186281401	186281401	+	Silent	SNP	G	G	A	rs565193791		TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr1:186281401G>A	ENST00000445192.2	+	11	3933	c.3888G>A	c.(3886-3888)acG>acA	p.T1296T	RNU6-1240P_ENST00000365155.1_RNA|TPR_ENST00000367478.4_3'UTR|PRG4_ENST00000367484.3_Silent_p.T825T|PRG4_ENST00000367483.4_Silent_p.T1255T|PRG4_ENST00000367486.3_Silent_p.T1253T|PRG4_ENST00000367485.4_Silent_p.T1203T	NM_005807.3	NP_005798.2	Q92954	PRG4_HUMAN	proteoglycan 4	1296			T -> M (in dbSNP:rs12134934). {ECO:0000269|Ref.1}.		cell proliferation (GO:0008283)|hematopoietic stem cell proliferation (GO:0071425)|immune response (GO:0006955)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|regulation of cell proliferation (GO:0042127)	extracellular space (GO:0005615)	polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(33)|prostate(7)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(1)	102						ATGGAGAAACGACACAGGTTA	0.443													G|||	1	0.000199681	0.0008	0.0	5008	,	,		15340	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000116690						132.0	129.0	130.0					1																	186281401		2203	4300	6503	PRG4	SO:0001819	synonymous_variant	0			-	HGNC	U70136	CCDS1369.1, CCDS44287.1, CCDS44288.1	1q25-q31	2008-07-18	2004-11-15		ENSG00000116690	ENSG00000116690			9364	protein-coding gene	gene with protein product	"""lubricin"", ""megakaryocyte stimulating factor"", ""articular superficial zone protein"", ""Jacobs camptodactyly-arthropathy-pericarditis syndrome"", ""camptodactyly, arthropathy, coxa vara, pericarditis syndrome"", ""bG174L6.2 (MSF: megakaryocyte stimulating factor )"""	604283	"""proteoglycan 4, (megakaryocyte stimulating factor, articular superficial zone protein, camptodactyly, arthropathy, coxa vara, pericarditis syndrome)"""	CACP		10545950, 9920774	Standard	NM_005807		Approved	JCAP, SZP, MSF, HAPO, bG174L6.2, FLJ32635	uc001gru.4	Q92954	OTTHUMG00000035574	ENST00000445192.2:c.3888G>A	1.37:g.186281401G>A		Somatic	0	95	0.00		0.41568620468393047	22	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	54	20.29	Q6DNC4|Q6DNC5|Q6ZMZ5|Q9BX49	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Somatomedin_B_dom,pfam_Hemopexin-like_repeat,superfamily_Hemopexin-like_dom,smart_Somatomedin_B_dom,smart_Hemopexin-like_repeat,prints_Somatomedin_B_chordata,pfscan_Somatomedin_B_dom	p.T1296	ENST00000445192.2	37	c.3888	CCDS1369.1	1																																																																																			-	superfamily_Hemopexin-like_dom		0.443	PRG4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PRG4	protein_coding	OTTHUMT00000086346.1	G	NM_005807	-		186281401	+1	no_errors	ENST00000445192	ensembl	human	known	74_37	silent	SNP	0.000	A
ZNF385D	79750	genome.wustl.edu	37	3	21706429	21706429	+	Silent	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr3:21706429G>A	ENST00000281523.2	-	2	632	c.114C>T	c.(112-114)ccC>ccT	p.P38P	ZNF385D_ENST00000494118.1_Intron	NM_024697.2	NP_078973.1	Q9H6B1	Z385D_HUMAN	zinc finger protein 385D	38						nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(2)|breast(2)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|ovary(1)|prostate(1)|skin(4)	46						CAAGAGGAAAGGGAAGAAATG	0.502																																																	0								ENSG00000151789						111.0	104.0	106.0					3																	21706429		2203	4300	6503	ZNF385D	SO:0001819	synonymous_variant	0			-	HGNC	BC007212	CCDS2636.1	3p24.3	2012-10-05	2007-12-06	2007-12-06	ENSG00000151789	ENSG00000151789			26191	protein-coding gene	gene with protein product			"""zinc finger protein 659"""	ZNF659		12477932	Standard	NM_024697		Approved	FLJ22419	uc003cce.3	Q9H6B1	OTTHUMG00000130484	ENST00000281523.2:c.114C>T	3.37:g.21706429G>A		Somatic	0	92	0.00		0.41568620468393047	16	58.97	23	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	38	24.00		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2_jaz,smart_Znf_U1,smart_Znf_C2H2-like	p.P38	ENST00000281523.2	37	c.114	CCDS2636.1	3																																																																																			-	NULL		0.502	ZNF385D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF385D	protein_coding	OTTHUMT00000252884.1	G	NM_024697	-		21706429	-1	no_errors	ENST00000281523	ensembl	human	known	74_37	silent	SNP	0.767	A
CAPN3	825	genome.wustl.edu	37	15	42678475	42678475	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr15:42678475C>T	ENST00000397163.3	+	3	709	c.490C>T	c.(490-492)Cac>Tac	p.H164Y	CAPN3_ENST00000357568.3_Missense_Mutation_p.H164Y|RP11-164J13.1_ENST00000495723.1_RNA|CAPN3_ENST00000356316.3_Missense_Mutation_p.H77Y|CAPN3_ENST00000318023.7_Missense_Mutation_p.H164Y|CAPN3_ENST00000349748.3_Missense_Mutation_p.H164Y	NM_000070.2	NP_000061.1	P20807	CAN3_HUMAN	calpain 3, (p94)	164	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				apoptotic process (GO:0006915)|autolysis (GO:0001896)|cellular response to calcium ion (GO:0071277)|cellular response to salt stress (GO:0071472)|G1 to G0 transition involved in cell differentiation (GO:0070315)|muscle cell cellular homeostasis (GO:0046716)|muscle organ development (GO:0007517)|muscle structure development (GO:0061061)|myofibril assembly (GO:0030239)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of proteolysis (GO:0045862)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of satellite cell activation involved in skeletal muscle regeneration (GO:0014718)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein localization to membrane (GO:0072657)|proteolysis (GO:0006508)|regulation of catalytic activity (GO:0050790)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of myoblast differentiation (GO:0045661)|response to calcium ion (GO:0051592)|response to muscle activity (GO:0014850)|sarcomere organization (GO:0045214)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|myofibril (GO:0030016)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|T-tubule (GO:0030315)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|catalytic activity (GO:0003824)|cysteine-type peptidase activity (GO:0008234)|ligase regulator activity (GO:0055103)|peptidase activity (GO:0008233)|protein complex scaffold (GO:0032947)|signal transducer activity (GO:0004871)|sodium ion binding (GO:0031402)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(21)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	47		all_cancers(109;1.65e-16)|all_epithelial(112;8.34e-15)|Lung NSC(122;3.56e-09)|all_lung(180;1.68e-08)|Melanoma(134;0.0574)|Colorectal(260;0.152)		GBM - Glioblastoma multiforme(94;7.36e-07)		AGGGATCTTCCACTTCCAGGT	0.537																																																	0								ENSG00000092529						113.0	98.0	103.0					15																	42678475		2203	4299	6502	CAPN3	SO:0001583	missense	0			-	HGNC	X85030	CCDS10085.1, CCDS10086.1, CCDS32207.1, CCDS45245.1, CCDS45246.1	15q15.1	2014-09-17			ENSG00000092529	ENSG00000092529	3.4.22.52	"""EF-hand domain containing"""	1480	protein-coding gene	gene with protein product		114240		LGMD2, LGMD2A		2555341, 7720071	Standard	NM_024344		Approved	CANP3, p94, nCL-1	uc001zpn.1	P20807	OTTHUMG00000130619	ENST00000397163.3:c.490C>T	15.37:g.42678475C>T	ENSP00000380349:p.His164Tyr	Somatic	0	42	0.00		0.41568620468393047	4	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	31	27.91	A6H8K6|Q7L4R0|Q9BQC8|Q9BTU4|Q9Y5S6|Q9Y5S7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_C2_calpain_cat,pfam_Calpain_domain_III,superfamily_Calpain_domain_III,smart_Peptidase_C2_calpain_cat,smart_Calpain_III,smart_EF_hand_dom,pfscan_EF_hand_dom,pfscan_Peptidase_C2_calpain_cat,prints_Calpain_cysteine_protease	p.H164Y	ENST00000397163.3	37	c.490	CCDS45245.1	15	.	.	.	.	.	.	.	.	.	.	C	34	5.341464	0.95783	.	.	ENSG00000092529	ENST00000356316;ENST00000397163;ENST00000357568;ENST00000349748;ENST00000318023	D;D;D;D;D	0.88664	-2.41;-2.41;-2.41;-2.41;-2.41	6.07	6.07	0.98685	Peptidase C2, calpain, catalytic domain (3);	0.000000	0.85682	U	0.000000	D	0.96990	0.9017	H	0.97440	4.005	0.80722	D	1	P;D;D;D;D;D	0.89917	0.95;0.989;1.0;1.0;1.0;0.99	P;P;D;D;D;D	0.97110	0.577;0.831;1.0;0.998;1.0;0.917	D	0.97465	1.0037	10	0.87932	D	0	.	20.6439	0.99570	0.0:1.0:0.0:0.0	.	77;77;164;164;164;77	C6EVS4;C6EVS3;P20807-2;P20807-3;P20807;Q762C8	.;.;.;.;CAN3_HUMAN;.	Y	77;164;164;164;164	ENSP00000348667:H77Y;ENSP00000380349:H164Y;ENSP00000350181:H164Y;ENSP00000183936:H164Y;ENSP00000326281:H164Y	ENSP00000326281:H164Y	H	+	1	0	CAPN3	40465767	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	7.763000	0.85283	2.890000	0.99128	0.650000	0.86243	CAC	-	pfam_Peptidase_C2_calpain_cat,smart_Peptidase_C2_calpain_cat,pfscan_Peptidase_C2_calpain_cat,prints_Calpain_cysteine_protease		0.537	CAPN3-009	KNOWN	basic|CCDS	protein_coding	CAPN3	protein_coding	OTTHUMT00000421075.1	C		-		42678475	+1	no_errors	ENST00000397163	ensembl	human	known	74_37	missense	SNP	1.000	T
NCOA6	23054	genome.wustl.edu	37	20	33345744	33345744	+	Silent	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr20:33345744C>T	ENST00000374796.2	-	8	3377	c.807G>A	c.(805-807)caG>caA	p.Q269Q	NCOA6_ENST00000359003.2_Silent_p.Q269Q			Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6	269	CREBBP-binding region.|Gln-rich.|NCOA1-binding region.|TBP/GTF2A-binding region.				brain development (GO:0007420)|cellular lipid metabolic process (GO:0044255)|cellular response to DNA damage stimulus (GO:0006974)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-templated transcription, initiation (GO:0006352)|glucocorticoid receptor signaling pathway (GO:0042921)|heart development (GO:0007507)|intracellular estrogen receptor signaling pathway (GO:0030520)|labyrinthine layer blood vessel development (GO:0060716)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)	histone methyltransferase complex (GO:0035097)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)	p.Q269Q(15)		NS(2)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(8)|large_intestine(16)|lung(37)|ovary(4)|prostate(5)|skin(13)|upper_aerodigestive_tract(2)|urinary_tract(1)	107						gctgctgctgctgttgttgtt	0.537																																																	15	Substitution - coding silent(15)	lung(5)|prostate(4)|endometrium(3)|central_nervous_system(1)|urinary_tract(1)|kidney(1)						ENSG00000198646						64.0	52.0	56.0					20																	33345744		2203	4300	6503	NCOA6	SO:0001819	synonymous_variant	0			-	HGNC	AF128458	CCDS13241.1, CCDS74720.1	20q11	2008-08-01			ENSG00000198646	ENSG00000198646			15936	protein-coding gene	gene with protein product	"""nuclear receptor coactivator RAP250"", ""activating signal cointegrator-2"", ""peroxisome proliferator-activated receptor interacting protein"""	605299				8724849, 8263591	Standard	NM_014071		Approved	KIAA0181, RAP250, ASC2, AIB3, PRIP, TRBP, NRC	uc002xaw.3	Q14686	OTTHUMG00000032311	ENST00000374796.2:c.807G>A	20.37:g.33345744C>T		Somatic	0	37	0.00		0.41568620468393047	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	A6NLF1|B2RMN5|E1P5P7|Q9NTZ9|Q9UH74|Q9UK86	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.Q269	ENST00000374796.2	37	c.807	CCDS13241.1	20																																																																																			-	NULL		0.537	NCOA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCOA6	protein_coding	OTTHUMT00000078811.2	C	NM_014071	-		33345744	-1	no_errors	ENST00000359003	ensembl	human	known	74_37	silent	SNP	0.002	T
PTMAP5	150928	genome.wustl.edu	37	13	82264753	82264753	+	RNA	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr13:82264753G>A	ENST00000607242.1	+	0	708									prothymosin, alpha pseudogene 5																		AAACTTCCAAGGCCATGCTTT	0.373																																																	0								ENSG00000214182																																			PTMAP5			0			-	HGNC	S38627		13q13.1	2008-11-06	2008-04-03		ENSG00000214182	ENSG00000214182			9628	pseudogene	pseudogene	"""gene sequence 150"""		"""prothymosin, alpha pseudogene 5 (gene sequence 150)"""			1612591	Standard	NG_004798		Approved				OTTHUMG00000017147		13.37:g.82264753G>A		Somatic	0	89	0.00		0.41568620468393047	434	1.58	7	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	33	21.43		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000607242.1	37	NULL		13																																																																																			-	-		0.373	PTMAP5-002	KNOWN	basic	processed_transcript	PTMAP5	pseudogene	OTTHUMT00000470311.1	G		-		82264753	+1	no_errors	ENST00000607242	ensembl	human	known	74_37	rna	SNP	0.996	A
PLCL1	5334	genome.wustl.edu	37	2	198949937	198949937	+	Nonsense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr2:198949937C>T	ENST00000428675.1	+	2	2094	c.1696C>T	c.(1696-1698)Cga>Tga	p.R566*	PLCL1_ENST00000437704.2_Nonsense_Mutation_p.R468*	NM_006226.3	NP_006217.3	Q15111	PLCL1_HUMAN	phospholipase C-like 1	566	Interaction with GABA A beta subunit. {ECO:0000250}.				gamma-aminobutyric acid signaling pathway (GO:0007214)|intracellular signal transduction (GO:0035556)|lipid metabolic process (GO:0006629)|positive regulation of receptor binding (GO:1900122)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|inositol 1,4,5 trisphosphate binding (GO:0070679)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(14)|lung(44)|ovary(1)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	80					Quinacrine(DB01103)	TGAAATGTCTCGAAGGATGTC	0.393																																																	0								ENSG00000115896						80.0	78.0	79.0					2																	198949937		2203	4300	6503	PLCL1	SO:0001587	stop_gained	0			-	HGNC	D42108	CCDS2326.1, CCDS2326.2	2q33	2014-06-13	2002-02-18	2002-02-22	ENSG00000115896	ENSG00000115896			9063	protein-coding gene	gene with protein product	"""phospholipase C related, but catalytically inactive protein"", ""protein phosphatase 1, regulatory subunit 127"""	600597	"""phospholipase C, epsilon"""	PLCE		7633416	Standard	NM_006226		Approved	PLC-L, PLCL, PRIP, PPP1R127	uc010fsp.3	Q15111	OTTHUMG00000132750	ENST00000428675.1:c.1696C>T	2.37:g.198949937C>T	ENSP00000402861:p.Arg566*	Somatic	0	78	0.00		0.41568620468393047	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	42	23.64	Q3MJ90|Q53SD3|Q7Z3S3	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_PLipase_C_EF-hand-like,pfam_C2_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_dom,smart_Pleckstrin_homology,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_dom,pfscan_C2_dom,pfscan_Pleckstrin_homology,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,prints_Pinositol_PLipase_C	p.R566*	ENST00000428675.1	37	c.1696	CCDS2326.2	2	.	.	.	.	.	.	.	.	.	.	C	38	6.674919	0.97755	.	.	ENSG00000115896	ENST00000428675;ENST00000437704	.	.	.	5.51	5.51	0.81932	.	0.230919	0.31156	N	0.008142	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.614	0.95622	0.0:1.0:0.0:0.0	.	.	.	.	X	566;468	.	.	R	+	1	2	PLCL1	198658182	1.000000	0.71417	0.996000	0.52242	0.929000	0.56500	5.903000	0.69877	2.873000	0.98535	0.561000	0.74099	CGA	-	superfamily_PLC-like_Pdiesterase_TIM-brl		0.393	PLCL1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	PLCL1	protein_coding	OTTHUMT00000340210.1	C	NM_006226	-		198949937	+1	no_errors	ENST00000428675	ensembl	human	known	74_37	nonsense	SNP	1.000	T
MUC5B	727897	genome.wustl.edu	37	11	1270733	1270733	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr11:1270733G>A	ENST00000529681.1	+	31	12681	c.12623G>A	c.(12622-12624)gGg>gAg	p.G4208E	MUC5B_ENST00000447027.1_Missense_Mutation_p.G4211E|RP11-532E4.2_ENST00000532061.2_RNA	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	4208	7 X Cys-rich subdomain repeats.|Thr-rich.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		GAGCAGGTGGGGAAGTTCAAG	0.632																																																	0								ENSG00000117983																																			MUC5B	SO:0001583	missense	0			-	HGNC	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.12623G>A	11.37:g.1270733G>A	ENSP00000436812:p.Gly4208Glu	Somatic	0	96	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	59	11.94	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_VWF_C,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.G4211E	ENST00000529681.1	37	c.12632	CCDS44515.2	11	.	.	.	.	.	.	.	.	.	.	g	8.627	0.892820	0.17613	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.16073	2.37;2.37	3.69	3.69	0.42338	.	.	.	.	.	T	0.34542	0.0901	L	0.58583	1.82	0.09310	N	1	P;P	0.52316	0.952;0.952	P;P	0.57371	0.819;0.819	T	0.12502	-1.0545	9	0.87932	D	0	.	15.8489	0.78912	0.0:0.0:1.0:0.0	.	4681;4211	A7Y9J9;E9PBJ0	.;.	E	4208;4211;4152;4058	ENSP00000436812:G4208E;ENSP00000415793:G4211E	ENSP00000343037:G4152E	G	+	2	0	MUC5B	1227309	0.071000	0.21146	0.006000	0.13384	0.004000	0.04260	0.903000	0.28475	1.819000	0.53055	0.393000	0.25936	GGG	-	NULL		0.632	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	MUC5B	protein_coding	OTTHUMT00000390041.2	G	XM_001126093	-		1270733	+1	no_errors	ENST00000447027	ensembl	human	known	74_37	missense	SNP	0.096	A
GRB14	2888	genome.wustl.edu	37	2	165365038	165365038	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr2:165365038C>T	ENST00000263915.3	-	8	1488	c.950G>A	c.(949-951)cGa>cAa	p.R317Q	GRB14_ENST00000543549.1_Missense_Mutation_p.R230Q	NM_004490.2	NP_004481.2	Q14449	GRB14_HUMAN	growth factor receptor-bound protein 14	317	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				blood coagulation (GO:0007596)|leukocyte migration (GO:0050900)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)			breast(3)|endometrium(2)|large_intestine(6)|lung(10)|ovary(7)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	32						TTTCAGGTCTCGGGGCCCTCC	0.463																																																	0								ENSG00000115290						77.0	75.0	76.0					2																	165365038		2203	4300	6503	GRB14	SO:0001583	missense	0			-	HGNC		CCDS2222.1	2q22-q24	2013-02-14			ENSG00000115290	ENSG00000115290		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	4565	protein-coding gene	gene with protein product		601524				8812444	Standard	XM_005246477		Approved		uc002ucl.3	Q14449	OTTHUMG00000132135	ENST00000263915.3:c.950G>A	2.37:g.165365038C>T	ENSP00000263915:p.Arg317Gln	Somatic	0	32	0.00		0.41568620468393047	2	50.00	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	15	25.00	B7Z7F9|Q7Z6I1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_BPS-dom,pfam_SH2,pfam_Ras-assoc,pfam_Pleckstrin_homology,smart_Ras-assoc,smart_Pleckstrin_homology,smart_SH2,pfscan_Pleckstrin_homology,pfscan_Ras-assoc,pfscan_SH2,prints_SH2	p.R317Q	ENST00000263915.3	37	c.950	CCDS2222.1	2	.	.	.	.	.	.	.	.	.	.	C	32	5.169184	0.94768	.	.	ENSG00000115290	ENST00000263915;ENST00000543549;ENST00000446413	T;T;T	0.28895	1.99;2.01;1.59	5.84	5.84	0.93424	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.059140	0.64402	D	0.000003	T	0.18841	0.0452	N	0.25485	0.75	0.80722	D	1	P;P	0.42584	0.642;0.784	B;B	0.30855	0.069;0.121	T	0.03060	-1.1077	10	0.37606	T	0.19	-7.9283	13.3536	0.60615	0.0:0.9283:0.0:0.0717	.	230;317	B7Z7F9;Q14449	.;GRB14_HUMAN	Q	317;230;272	ENSP00000263915:R317Q;ENSP00000443699:R230Q;ENSP00000416786:R272Q	ENSP00000263915:R317Q	R	-	2	0	GRB14	165073284	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.485000	0.60279	2.748000	0.94277	0.650000	0.86243	CGA	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology		0.463	GRB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRB14	protein_coding	OTTHUMT00000255180.2	C		-		165365038	-1	no_errors	ENST00000263915	ensembl	human	known	74_37	missense	SNP	1.000	T
ZNF613	79898	genome.wustl.edu	37	19	52443920	52443920	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr19:52443920C>T	ENST00000293471.6	+	5	872	c.193C>T	c.(193-195)Cca>Tca	p.P65S	ZNF613_ENST00000391794.4_Missense_Mutation_p.P29S	NM_001031721.3	NP_001026891.2	Q6PF04	ZN613_HUMAN	zinc finger protein 613	65	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|skin(1)|urinary_tract(1)	19		all_neural(266;0.117)		GBM - Glioblastoma multiforme(134;0.00148)|OV - Ovarian serous cystadenocarcinoma(262;0.0183)		ACAAGGAGAGCCATGGACAGT	0.468																																																	0								ENSG00000176024						137.0	116.0	123.0					19																	52443920		2203	4300	6503	ZNF613	SO:0001583	missense	0			-	HGNC	AK027565	CCDS12844.1, CCDS33089.1	19q13.41	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	25827	protein-coding gene	gene with protein product						12477932	Standard	NM_001031721		Approved	FLJ13590	uc002pxz.2	Q6PF04		ENST00000293471.6:c.193C>T	19.37:g.52443920C>T	ENSP00000293471:p.Pro65Ser	Somatic	0	53	0.00		0.41568620468393047	6	25.00	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	35	14.63	Q96SS9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.P65S	ENST00000293471.6	37	c.193	CCDS33089.1	19	.	.	.	.	.	.	.	.	.	.	C	2.073	-0.412563	0.04799	.	.	ENSG00000176024	ENST00000293471;ENST00000391794	T;T	0.08282	3.21;3.11	2.78	1.73	0.24493	Krueppel-associated box (2);	3.297840	0.01124	N	0.005844	T	0.13157	0.0319	M	0.73319	2.225	0.09310	N	1	B	0.22346	0.068	B	0.15870	0.014	T	0.32455	-0.9906	10	0.54805	T	0.06	.	5.8151	0.18488	0.0:0.8509:0.0:0.1491	.	65	Q6PF04	ZN613_HUMAN	S	65;29	ENSP00000293471:P65S;ENSP00000375671:P29S	ENSP00000293471:P65S	P	+	1	0	ZNF613	57135732	0.000000	0.05858	0.001000	0.08648	0.100000	0.18952	0.005000	0.13129	0.738000	0.32606	0.563000	0.77884	CCA	-	smart_Krueppel-associated_box,pfscan_Krueppel-associated_box		0.468	ZNF613-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF613	protein_coding	OTTHUMT00000461104.2	C	NM_024840	-		52443920	+1	no_errors	ENST00000293471	ensembl	human	known	74_37	missense	SNP	0.002	T
RB1	5925	genome.wustl.edu	37	13	49039374	49039374	+	Nonsense_Mutation	SNP	C	C	T	rs137853293		TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr13:49039374C>T	ENST00000267163.4	+	23	2497	c.2359C>T	c.(2359-2361)Cga>Tga	p.R787*		NM_000321.2	NP_000312.2	P06400	RB_HUMAN	retinoblastoma 1	787	Domain C; mediates interaction with E4F1.|Interaction with LIMD1.				androgen receptor signaling pathway (GO:0030521)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell morphogenesis involved in neuron differentiation (GO:0048667)|chromatin remodeling (GO:0006338)|digestive tract development (GO:0048565)|enucleate erythrocyte differentiation (GO:0043353)|G1/S transition of mitotic cell cycle (GO:0000082)|glial cell apoptotic process (GO:0034349)|hepatocyte apoptotic process (GO:0097284)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|myoblast differentiation (GO:0045445)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|neuron maturation (GO:0042551)|neuron projection development (GO:0031175)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to chromosome, centromeric region (GO:0071459)|Ras protein signal transduction (GO:0007265)|regulation of centromere complex assembly (GO:0090230)|regulation of cohesin localization to chromatin (GO:0071922)|regulation of lipid kinase activity (GO:0043550)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|sister chromatid biorientation (GO:0031134)|skeletal muscle cell differentiation (GO:0035914)|striated muscle cell differentiation (GO:0051146)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|Rb-E2F complex (GO:0035189)|spindle (GO:0005819)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|phosphoprotein binding (GO:0051219)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.0?(15)|p.?(11)|p.R787*(4)		NS(3)|adrenal_gland(1)|bone(22)|breast(30)|central_nervous_system(48)|cervix(3)|endometrium(14)|eye(95)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(20)|kidney(3)|large_intestine(10)|liver(3)|lung(153)|oesophagus(1)|ovary(13)|pancreas(5)|pituitary(1)|prostate(14)|salivary_gland(2)|skin(9)|soft_tissue(9)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(31)	496		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	TCACATTCCTCGAAGCCCTTA	0.393		6	"""D, Mis, N, F, S"""		"""retinoblastoma, sarcoma, breast, small cell lung"""	"""retinoblastoma, sarcoma, breast, small cell lung"""			Hereditary Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)																													yes	Rec	yes	Familial retinoblastoma	13	13q14	5925	retinoblastoma gene		"""L, E, M, O"""	30	Whole gene deletion(15)|Unknown(11)|Substitution - Nonsense(4)	bone(11)|haematopoietic_and_lymphoid_tissue(4)|breast(4)|adrenal_gland(1)|eye(1)|soft_tissue(1)|central_nervous_system(1)|endometrium(1)|urinary_tract(1)|lung(1)|oesophagus(1)|ovary(1)|prostate(1)|liver(1)	GRCh37	CM900196	RB1	M	rs137853293	ENSG00000139687						155.0	160.0	158.0					13																	49039374		2203	4300	6503	RB1	SO:0001587	stop_gained	0	Familial Cancer Database		-	HGNC	M15400	CCDS31973.1	13q14.2	2014-09-17	2008-07-31		ENSG00000139687	ENSG00000139687		"""Endogenous ligands"""	9884	protein-coding gene	gene with protein product	"""prepro-retinoblastoma-associated protein"", ""protein phosphatase 1, regulatory subunit 130"""	614041	"""osteosarcoma"""	OSRC		1857421, 15057823	Standard	NM_000321		Approved	RB, PPP1R130	uc001vcb.3	P06400	OTTHUMG00000016900	ENST00000267163.4:c.2359C>T	13.37:g.49039374C>T	ENSP00000267163:p.Arg787*	Somatic	0	69	0.00		0.41568620468393047	10	9.09	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	33	15.38	A8K5E3|P78499|Q5VW46|Q8IZL4	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RB_C,pfam_RB_A,pfam_RB_B,pfam_RB_N,superfamily_Cyclin-like,smart_Cyclin-like	p.R787*	ENST00000267163.4	37	c.2359	CCDS31973.1	13	.	.	.	.	.	.	.	.	.	.	C	39	7.630709	0.98399	.	.	ENSG00000139687	ENST00000542917;ENST00000267163	.	.	.	5.87	5.87	0.94306	.	0.072182	0.56097	D	0.000028	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.6067	0.62052	0.271:0.729:0.0:0.0	.	.	.	.	X	766;787	.	ENSP00000267163:R787X	R	+	1	2	RB1	47937375	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	2.152000	0.42272	2.779000	0.95612	0.591000	0.81541	CGA	-	pfam_RB_C		0.393	RB1-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	RB1	protein_coding	OTTHUMT00000044884.1	C		rs137853293		49039374	+1	no_errors	ENST00000267163	ensembl	human	known	74_37	nonsense	SNP	1.000	T
CASC5	57082	genome.wustl.edu	37	15	40913904	40913904	+	Missense_Mutation	SNP	A	A	G			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr15:40913904A>G	ENST00000346991.5	+	11	1910	c.1520A>G	c.(1519-1521)gAg>gGg	p.E507G	CASC5_ENST00000527044.1_3'UTR|CASC5_ENST00000399668.2_Missense_Mutation_p.E481G			Q8NG31	CASC5_HUMAN	cancer susceptibility candidate 5	507	Interaction with BUB1 and BUB1B.				acrosome assembly (GO:0001675)|attachment of spindle microtubules to kinetochore (GO:0008608)|CENP-A containing nucleosome assembly (GO:0034080)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of phosphatase activity (GO:0010923)|nucleosome assembly (GO:0006334)|protein localization to kinetochore (GO:0034501)|spindle assembly checkpoint (GO:0071173)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				NS(1)|breast(7)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(13)|lung(16)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	57		all_cancers(109;2.03e-18)|all_epithelial(112;4.26e-15)|Lung NSC(122;1.12e-10)|all_lung(180;2.59e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;4.99e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0861)|COAD - Colon adenocarcinoma(120;0.211)		TATTCCGGAGAGGAGAACATG	0.358																																																	0								ENSG00000137812						50.0	49.0	49.0					15																	40913904		1862	4093	5955	CASC5	SO:0001583	missense	0			-	HGNC	AF173994	CCDS42023.1, CCDS42024.1	15q14	2013-07-03			ENSG00000137812	ENSG00000137812		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	24054	protein-coding gene	gene with protein product	"""cancer/testis antigen 29"", ""kinetochore null 1 homolog (C. elegans)"", ""blinkin, bub-linking kinetochore protein"", ""protein phosphatase 1, regulatory subunit 55"""	609173				10980622, 10780384, 18045986	Standard	NM_170589		Approved	D40, AF15Q14, CT29, hKNL-1, KNL1, hSpc105, PPP1R55, Spc7	uc010bbt.1	Q8NG31	OTTHUMG00000166532	ENST00000346991.5:c.1520A>G	15.37:g.40913904A>G	ENSP00000335463:p.Glu507Gly	Somatic	0	43	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	25	19.35	Q8NHE1|Q8WXA6|Q9HCK2|Q9NR92	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.E507G	ENST00000346991.5	37	c.1520	CCDS42023.1	15	.	.	.	.	.	.	.	.	.	.	A	12.43	1.935273	0.34189	.	.	ENSG00000137812	ENST00000346991;ENST00000260369;ENST00000399668	T;T	0.21361	2.01;2.01	5.94	5.94	0.96194	.	0.118602	0.37809	N	0.001921	T	0.36552	0.0971	L	0.39898	1.24	0.32474	N	0.542415	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.71656	0.964;0.964;0.974	T	0.46721	-0.9171	10	0.59425	D	0.04	.	13.3885	0.60809	0.8693:0.1307:0.0:0.0	.	481;507;481	Q8NG31-2;Q8NG31;Q8NG31-4	.;CASC5_HUMAN;.	G	507;481;481	ENSP00000335463:E507G;ENSP00000382576:E481G	ENSP00000260369:E481G	E	+	2	0	CASC5	38701196	0.748000	0.28294	1.000000	0.80357	0.764000	0.43329	1.289000	0.33307	2.269000	0.75478	0.455000	0.32223	GAG	-	NULL		0.358	CASC5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CASC5	protein_coding	OTTHUMT00000390224.2	A	NM_144508	-		40913904	+1	no_errors	ENST00000346991	ensembl	human	known	74_37	missense	SNP	0.991	G
MACF1	23499	genome.wustl.edu	37	1	39788365	39788365	+	Missense_Mutation	SNP	C	C	A			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr1:39788365C>A	ENST00000372915.3	+	31	4217	c.4130C>A	c.(4129-4131)tCt>tAt	p.S1377Y	MACF1_ENST00000476350.1_3'UTR|MACF1_ENST00000564288.1_Missense_Mutation_p.S1372Y|MACF1_ENST00000545844.1_Missense_Mutation_p.S1377Y|MACF1_ENST00000317713.7_Missense_Mutation_p.S1377Y|MACF1_ENST00000539005.1_Missense_Mutation_p.S1377Y|MACF1_ENST00000567887.1_Missense_Mutation_p.S1409Y|MACF1_ENST00000361689.2_Missense_Mutation_p.S1377Y			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	1377					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			ATGCTTTCCTCTTCAGATGCC	0.478																																																	0								ENSG00000127603						92.0	95.0	94.0					1																	39788365		2203	4300	6503	MACF1	SO:0001583	missense	0			-	HGNC	AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.4130C>A	1.37:g.39788365C>A	ENSP00000362006:p.Ser1377Tyr	Somatic	0	63	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Spectrin_repeat,pfam_CH-domain,pfam_GAS2_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_GAS2_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_EF_hand_dom,smart_GAS2_dom,pfscan_CH-domain,pfscan_EF_hand_dom	p.S1377Y	ENST00000372915.3	37	c.4130		1	.	.	.	.	.	.	.	.	.	.	C	28.9	4.961251	0.92791	.	.	ENSG00000127603	ENST00000545844;ENST00000372915;ENST00000361689;ENST00000317713;ENST00000539005;ENST00000524432;ENST00000530262	T;T;T;T;T;T;T	0.64803	-0.09;-0.12;-0.09;-0.12;0.07;1.75;1.75	5.73	5.73	0.89815	.	.	.	.	.	T	0.79034	0.4378	M	0.68952	2.095	0.80722	D	1	D;D;P	0.71674	0.998;0.998;0.917	D;D;P	0.72075	0.976;0.965;0.789	T	0.79722	-0.1684	9	0.72032	D	0.01	.	19.8919	0.96932	0.0:1.0:0.0:0.0	.	1377;1377;1342	F8W8Q1;Q9UPN3-2;Q9UPN3-3	.;.;.	Y	1377;1377;1377;1377;1377;1335;1526	ENSP00000439537:S1377Y;ENSP00000362006:S1377Y;ENSP00000354573:S1377Y;ENSP00000313438:S1377Y;ENSP00000444364:S1377Y;ENSP00000435070:S1335Y;ENSP00000437059:S1526Y	ENSP00000313438:S1377Y	S	+	2	0	MACF1	39560952	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.760000	0.85248	2.699000	0.92147	0.655000	0.94253	TCT	-	smart_Spectrin/alpha-actinin		0.478	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	MACF1	protein_coding	OTTHUMT00000392096.1	C	NM_033044	-		39788365	+1	no_errors	ENST00000317713	ensembl	human	known	74_37	missense	SNP	1.000	A
ACSM4	341392	genome.wustl.edu	37	12	7459150	7459150	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr12:7459150C>T	ENST00000399422.4	+	2	271	c.223C>T	c.(223-225)Cca>Tca	p.P75S		NM_001080454.1	NP_001073923.1	P0C7M7	ACSM4_HUMAN	acyl-CoA synthetase medium-chain family member 4	75					acyl-CoA metabolic process (GO:0006637)|fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|fatty-acyl-CoA synthase activity (GO:0004321)|metal ion binding (GO:0046872)			endometrium(6)|kidney(1)|lung(14)	21						ACCAGCTAACCCAGCCCTGTG	0.532																																																	0								ENSG00000215009						36.0	45.0	42.0					12																	7459150		2054	4242	6296	ACSM4	SO:0001583	missense	0			-	HGNC		CCDS44825.1	12p13.31	2008-06-12			ENSG00000215009	ENSG00000215009		"""Acyl-CoA synthetase family"""	32016	protein-coding gene	gene with protein product	"""similar to olfactory specific medium-chain acyl CoA synthetase"""	614360				17762044	Standard	NM_001080454		Approved		uc001qsx.1	P0C7M7	OTTHUMG00000154975	ENST00000399422.4:c.223C>T	12.37:g.7459150C>T	ENSP00000382349:p.Pro75Ser	Somatic	0	106	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	44	24.14	A8MTI6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_AMP-dep_Synth/Lig	p.P75S	ENST00000399422.4	37	c.223	CCDS44825.1	12	.	.	.	.	.	.	.	.	.	.	C	18.91	3.723826	0.68959	.	.	ENSG00000215009	ENST00000399422	T	0.12361	2.69	5.13	5.13	0.70059	.	0.000000	0.38959	U	0.001514	T	0.21761	0.0524	L	0.60067	1.865	0.43110	D	0.994811	D	0.55800	0.973	P	0.48552	0.581	T	0.01262	-1.1402	10	0.28530	T	0.3	-21.8173	16.4313	0.83844	0.0:1.0:0.0:0.0	.	75	P0C7M7	ACSM4_HUMAN	S	75	ENSP00000382349:P75S	ENSP00000382349:P75S	P	+	1	0	ACSM4	7350417	0.997000	0.39634	0.997000	0.53966	0.695000	0.40330	3.743000	0.55104	2.557000	0.86248	0.655000	0.94253	CCA	-	NULL		0.532	ACSM4-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	ACSM4	protein_coding	OTTHUMT00000337866.2	C	NM_001080454	-		7459150	+1	no_errors	ENST00000399422	ensembl	human	novel	74_37	missense	SNP	1.000	T
DENND2A	27147	genome.wustl.edu	37	7	140273686	140273686	+	Silent	SNP	G	G	A	rs528367786		TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr7:140273686G>A	ENST00000275884.6	-	5	1785	c.1368C>T	c.(1366-1368)tcC>tcT	p.S456S	DENND2A_ENST00000492720.1_Silent_p.S456S|DENND2A_ENST00000496613.1_Silent_p.S456S|DENND2A_ENST00000537639.1_Silent_p.S456S			Q9ULE3	DEN2A_HUMAN	DENN/MADD domain containing 2A	456					positive regulation of Rab GTPase activity (GO:0032851)|protein transport (GO:0015031)|retrograde transport, endosome to Golgi (GO:0042147)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(22)|ovary(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49	Melanoma(164;0.00956)					TGCTGGGAGTGGAGGGAGGGC	0.502																																																	0								ENSG00000146966						223.0	222.0	222.0					7																	140273686		1922	4133	6055	DENND2A	SO:0001819	synonymous_variant	0			-	HGNC	AB033103	CCDS43659.1	7q34	2012-10-03	2005-08-17	2005-08-17	ENSG00000146966	ENSG00000146966		"""DENN/MADD domain containing"""	22212	protein-coding gene	gene with protein product			"""KIAA1277"""	KIAA1277			Standard	NM_015689		Approved	FAM31D	uc010lnj.3	Q9ULE3	OTTHUMG00000157411	ENST00000275884.6:c.1368C>T	7.37:g.140273686G>A		Somatic	0	100	0.00		0.41568620468393047	21	12.50	3	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	74	22.92	C9JUI3|Q1RMD5|Q86XY0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_DENN_dom,pfam_uDENN_dom,pfam_dDENN_dom,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom	p.S456	ENST00000275884.6	37	c.1368	CCDS43659.1	7																																																																																			-	NULL		0.502	DENND2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DENND2A	protein_coding	OTTHUMT00000348742.1	G	NM_015689	-		140273686	-1	no_errors	ENST00000275884	ensembl	human	known	74_37	silent	SNP	0.990	A
SLC22A24	283238	genome.wustl.edu	37	11	62849038	62849038	+	Silent	SNP	G	G	A	rs567410787		TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr11:62849038G>A	ENST00000417740.1	-	8	1827	c.1386C>T	c.(1384-1386)acC>acT	p.T462T		NM_001136506.2	NP_001129978.2	Q8N4F4	S22AO_HUMAN	solute carrier family 22, member 24	0					ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)				kidney(1)|stomach(1)	2						ACCTCAATATGGTGGGGACGA	0.418													G|||	0	0.0	0.0	0.0	5008	,	,		2806	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000197658						129.0	106.0	113.0					11																	62849038		692	1591	2283	SLC22A24	SO:0001819	synonymous_variant	0			-	HGNC		CCDS73308.1	11q12.3	2013-05-22			ENSG00000197658	ENSG00000197658		"""Solute carriers"""	28542	protein-coding gene	gene with protein product		611698				17714910	Standard	NM_001136506		Approved	MGC34821, NET46	uc021qkp.1	Q8N4F4	OTTHUMG00000165372	ENST00000417740.1:c.1386C>T	11.37:g.62849038G>A		Somatic	0	68	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	25	24.24		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.T462	ENST00000417740.1	37	c.1386		11																																																																																			-	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom		0.418	SLC22A24-003	PUTATIVE	non_canonical_polymorphism|basic|appris_principal|exp_conf	protein_coding	SLC22A24	protein_coding	OTTHUMT00000383747.1	G	NM_173586	-		62849038	-1	no_errors	ENST00000417740	ensembl	human	putative	74_37	silent	SNP	0.004	A
SCTR	6344	genome.wustl.edu	37	2	120223381	120223381	+	Missense_Mutation	SNP	T	T	G			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr2:120223381T>G	ENST00000019103.5	-	5	754	c.487A>C	c.(487-489)Atc>Ctc	p.I163L		NM_002980.2	NP_002971.2	P47872	SCTR_HUMAN	secretin receptor	163					digestion (GO:0007586)|excretion (GO:0007588)|G-protein coupled receptor signaling pathway (GO:0007186)	cytoplasmic microtubule (GO:0005881)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	secretin receptor activity (GO:0015055)			central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)|skin(3)	19					Secretin(DB00021)	GCACAGAGGATGCCAAGGGCG	0.572																																																	0								ENSG00000080293						160.0	128.0	139.0					2																	120223381		2203	4300	6503	SCTR	SO:0001583	missense	0			-	HGNC		CCDS2127.1	2q14.1	2012-08-10			ENSG00000080293	ENSG00000080293		"""GPCR / Class B : Glucagon receptors"""	10608	protein-coding gene	gene with protein product		182098				1646711	Standard	NM_002980		Approved		uc002tma.3	P47872	OTTHUMG00000131407	ENST00000019103.5:c.487A>C	2.37:g.120223381T>G	ENSP00000019103:p.Ile163Leu	Somatic	0	113	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	59	9.23	Q12961|Q13213|Q53T00	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_2_secretin-like,pfam_GPCR_2_extracellular_dom,smart_GPCR_2_extracellular_dom,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like,prints_GPCR_2_secretin_rcpt,prints_GPCR_2_VIP_rcpt_1	p.I163L	ENST00000019103.5	37	c.487	CCDS2127.1	2	.	.	.	.	.	.	.	.	.	.	T	13.13	2.146410	0.37923	.	.	ENSG00000080293	ENST00000019103	T	0.52057	0.68	4.91	3.75	0.43078	GPCR, family 2-like (1);	0.220751	0.31772	N	0.007094	T	0.60843	0.2300	M	0.80183	2.485	0.30338	N	0.785953	B	0.33212	0.402	P	0.48982	0.597	T	0.64437	-0.6408	10	0.66056	D	0.02	.	7.4272	0.27107	0.0:0.1859:0.0:0.8141	.	163	P47872	SCTR_HUMAN	L	163	ENSP00000019103:I163L	ENSP00000019103:I163L	I	-	1	0	SCTR	119939851	0.997000	0.39634	1.000000	0.80357	0.045000	0.14185	2.558000	0.45879	0.899000	0.36444	0.533000	0.62120	ATC	-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like		0.572	SCTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCTR	protein_coding	OTTHUMT00000254198.2	T		-		120223381	-1	no_errors	ENST00000019103	ensembl	human	known	74_37	missense	SNP	1.000	G
PRSS50	29122	genome.wustl.edu	37	3	46759225	46759226	+	In_Frame_Ins	INS	-	-	ATA			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr3:46759225_46759226insATA	ENST00000460241.1	-	6	1759_1760	c.89_90insTAT	c.(88-90)ctg>ctTATg	p.30_31insM	PRSS50_ENST00000315170.7_In_Frame_Ins_p.30_31insM			Q9UI38	TSP50_HUMAN	protease, serine, 50	30					proteolysis (GO:0006508)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)	serine-type endopeptidase activity (GO:0004252)|threonine-type endopeptidase activity (GO:0004298)			endometrium(2)|kidney(2)|large_intestine(1)|lung(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	11						ACCTCAGCAACAGAAGCAGCAG	0.718																																					Pancreas(41;915 1239 11561 17469)												0								ENSG00000206549																																			PRSS50	SO:0001652	inframe_insertion	0				HGNC	AF100707	CCDS2745.1	3p21.31	2011-05-24			ENSG00000206549	ENSG00000206549		"""Serine peptidases / Serine peptidases"""	17910	protein-coding gene	gene with protein product	"""cancer/testis antigen 20"", ""testes specific protease 50"""	607950				10397268	Standard	NM_013270		Approved	TSP50, CT20	uc003cqe.1	Q9UI38	OTTHUMG00000164067	ENST00000460241.1:c.89_90insTAT	3.37:g.46759225_46759226insATA	ENSP00000418875:p.Leu30_Leu31insMet	Somatic	0	29	0.00		0.41568620468393047	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	9	18.18		In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_Peptidase_S1,pfam_Peptidase_S1A_nudel,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.31in_frame_insM	ENST00000460241.1	37	c.90_89	CCDS2745.1	3																																																																																			-	NULL		0.718	PRSS50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRSS50	protein_coding	OTTHUMT00000354544.1	-				46759226	-1	no_errors	ENST00000315170	ensembl	human	known	74_37	in_frame_ins	INS	0.978:0.984	ATA
LAMB1	3912	genome.wustl.edu	37	7	107626666	107626666	+	Missense_Mutation	SNP	A	A	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr7:107626666A>T	ENST00000222399.6	-	6	796	c.566T>A	c.(565-567)aTt>aAt	p.I189N	LAMB1_ENST00000393560.1_Missense_Mutation_p.I189N|LAMB1_ENST00000393561.1_Missense_Mutation_p.I213N	NM_002291.2	NP_002282.2	P07942	LAMB1_HUMAN	laminin, beta 1	189	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell adhesion (GO:0007162)|neuron projection development (GO:0031175)|neuronal-glial interaction involved in cerebral cortex radial glia guided migration (GO:0021812)|odontogenesis (GO:0042476)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell proliferation (GO:0050679)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-2 complex (GO:0005607)|laminin-8 complex (GO:0043257)|perinuclear region of cytoplasm (GO:0048471)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)|structural molecule activity (GO:0005198)			NS(3)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(37)|ovary(6)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)	82						AGAATCACAAATTATGTCATC	0.398																																																	0								ENSG00000091136						110.0	108.0	109.0					7																	107626666		2203	4300	6503	LAMB1	SO:0001583	missense	0			-	HGNC	M61916	CCDS5750.1	7q22	2013-03-01			ENSG00000091136	ENSG00000091136		"""Laminins"""	6486	protein-coding gene	gene with protein product		150240	"""cutis laxa with marfanoid phenotype"""	CLM		2563160, 2704655, 1864606	Standard	NM_002291		Approved		uc003vew.2	P07942	OTTHUMG00000149966	ENST00000222399.6:c.566T>A	7.37:g.107626666A>T	ENSP00000222399:p.Ile189Asn	Somatic	0	81	0.00		0.41568620468393047	18	25.00	6	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	26	35.00	Q14D91	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_EGF_laminin,pfam_Laminin_N,superfamily_Prefoldin,superfamily_t-SNARE,superfamily_P-loop_NTPase,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,pfscan_Laminin_IV,pfscan_EGF_laminin,pfscan_Laminin_N	p.I189N	ENST00000222399.6	37	c.566	CCDS5750.1	7	.	.	.	.	.	.	.	.	.	.	A	26.8	4.769300	0.90020	.	.	ENSG00000091136	ENST00000393561;ENST00000222399;ENST00000393560	T;T;T	0.79454	-1.27;-1.27;-1.27	5.86	5.86	0.93980	Laminin, N-terminal (3);	.	.	.	.	D	0.88680	0.6502	M	0.83953	2.67	0.80722	D	1	D;D;D	0.76494	0.989;0.998;0.999	D;D;D	0.71414	0.928;0.972;0.973	D	0.90257	0.4298	9	0.87932	D	0	.	16.2565	0.82519	1.0:0.0:0.0:0.0	.	189;189;213	E7EPA6;P07942;G3XAI2	.;LAMB1_HUMAN;.	N	213;189;189	ENSP00000377191:I213N;ENSP00000222399:I189N;ENSP00000377190:I189N	ENSP00000222399:I189N	I	-	2	0	LAMB1	107413902	1.000000	0.71417	0.973000	0.42090	0.913000	0.54294	9.339000	0.96797	2.235000	0.73313	0.533000	0.62120	ATT	-	pfam_Laminin_N,smart_Laminin_N,pfscan_Laminin_N		0.398	LAMB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMB1	protein_coding	OTTHUMT00000314584.1	A	NM_002291	-		107626666	-1	no_errors	ENST00000222399	ensembl	human	known	74_37	missense	SNP	1.000	T
CHL1	10752	genome.wustl.edu	37	3	419527	419527	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A5VD-01A-21D-A32I-09	TCGA-QQ-A5VD-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	2c9fa8fc-5b5a-438e-882c-ff14c5a3405a	e9ecae33-6999-4f53-a303-69e56ddb9c3e	g.chr3:419527C>T	ENST00000256509.2	+	16	2420	c.1778C>T	c.(1777-1779)aCc>aTc	p.T593I	CHL1_ENST00000397491.2_Missense_Mutation_p.T577I|CHL1-AS1_ENST00000417612.1_RNA	NM_001253387.1|NM_001253388.1|NM_006614.3	NP_001240316.1|NP_001240317.1|NP_006605.2	Q96FC9	DDX11_HUMAN	cell adhesion molecule L1-like	379					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|sister chromatid cohesion (GO:0007062)|viral process (GO:0016032)	midbody (GO:0030496)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA-dependent ATPase activity (GO:0008094)|double-stranded DNA binding (GO:0003690)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			NS(1)|central_nervous_system(5)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|lung(31)|ovary(1)|prostate(4)|skin(10)|stomach(1)	93		all_cancers(2;1.14e-06)|all_epithelial(2;0.00367)|all_lung(1;0.061)|Lung NSC(2;0.201)		Epithelial(13;5.36e-06)|all cancers(10;1.4e-05)|OV - Ovarian serous cystadenocarcinoma(96;0.00323)|COAD - Colon adenocarcinoma(1;0.00925)|Colorectal(20;0.0198)		GCTAATTTGACCATATCTAAT	0.338																																																	0								ENSG00000134121						124.0	119.0	121.0					3																	419527		2202	4300	6502	CHL1	SO:0001583	missense	0			-	HGNC	AF002246	CCDS2556.1, CCDS58812.1, CCDS74887.1	3p26	2013-05-01	2013-05-01		ENSG00000134121	ENSG00000134121		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	1939	protein-coding gene	gene with protein product	"""neural cell adhesion molecule"", ""close homolog of L1"""	607416	"""cell adhesion molecule with homology to L1CAM (close homologue of L1)"", ""cell adhesion molecule with homology to L1CAM (close homolog of L1)"""			9799093	Standard	NM_006614		Approved	CALL, L1CAM2, FLJ44930, MGC132578	uc003bot.3	O00533	OTTHUMG00000090601	ENST00000256509.2:c.1778C>T	3.37:g.419527C>T	ENSP00000256509:p.Thr593Ile	Somatic	0	43	0.00		0.41568620468393047	3	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	20	28.57	Q13333|Q86VQ4|Q86W62|Q92498|Q92770|Q92998|Q92999	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.T593I	ENST00000256509.2	37	c.1778	CCDS2556.1	3	.	.	.	.	.	.	.	.	.	.	C	18.06	3.540246	0.65085	.	.	ENSG00000134121	ENST00000256509;ENST00000397491	T;T	0.11495	2.77;2.77	5.69	5.69	0.88448	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.362564	0.30538	N	0.009411	T	0.13884	0.0336	L	0.49699	1.58	0.35269	D	0.780241	P;P;P	0.43857	0.668;0.819;0.778	B;P;B	0.44772	0.363;0.46;0.299	T	0.06770	-1.0808	10	0.72032	D	0.01	.	8.8148	0.34989	0.0:0.8739:0.0:0.1261	.	577;577;593	B3KX75;O00533;O00533-2	.;CHL1_HUMAN;.	I	593;577	ENSP00000256509:T593I;ENSP00000380628:T577I	ENSP00000256509:T593I	T	+	2	0	CHL1	394527	0.987000	0.35691	0.965000	0.40720	0.952000	0.60782	2.233000	0.43027	2.695000	0.91970	0.655000	0.94253	ACC	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.338	CHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHL1	protein_coding	OTTHUMT00000207155.2	C	NM_006614	-		419527	+1	no_errors	ENST00000256509	ensembl	human	known	74_37	missense	SNP	0.996	T
