#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
TAS2R38	5726	genome.wustl.edu	37	7	141673292	141673292	+	Silent	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr7:141673292G>A	ENST00000547270.1	-	1	281	c.198C>T	c.(196-198)ttC>ttT	p.F66F		NM_176817.4	NP_789787	P59533	T2R38_HUMAN	taste receptor, type 2, member 38	66					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)			NS(2)|breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(7)|prostate(1)|skin(1)|stomach(1)	21	Melanoma(164;0.0171)					GTCCATGCAGGAAAAGCCGGC	0.493																																																	0								ENSG00000257138						126.0	119.0	121.0					7																	141673292		2203	4300	6503	TAS2R38	SO:0001819	synonymous_variant	0			-	HGNC	AF494231	CCDS34765.1	7q34	2012-10-03	2003-05-29	2003-05-30	ENSG00000257138	ENSG00000257138		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	9584	protein-coding gene	gene with protein product		607751	"""phenylthiocarbamide tasting"""	PTC		12624758, 12584440	Standard	NM_176817		Approved	T2R61	uc003vwx.1	P59533	OTTHUMG00000158374	ENST00000547270.1:c.198C>T	7.37:g.141673292G>A		Somatic	0	34	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	42	17.65	A4D1U6|P59552|Q2M3E8|Q645W3|Q86UK3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_TAS2_rcpt	p.F66	ENST00000547270.1	37	c.198	CCDS34765.1	7																																																																																			-	pfam_TAS2_rcpt		0.493	TAS2R38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS2R38	protein_coding	OTTHUMT00000350810.2	G	NM_176817	-		141673292	-1	no_errors	ENST00000547270	ensembl	human	known	74_37	silent	SNP	0.912	A
NCSTN	23385	genome.wustl.edu	37	1	160326887	160326887	+	Silent	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr1:160326887C>T	ENST00000294785.5	+	16	1976	c.1851C>T	c.(1849-1851)ctC>ctT	p.L617L	NCSTN_ENST00000368063.1_Silent_p.L597L|NCSTN_ENST00000535857.1_Silent_p.L479L|NCSTN_ENST00000368065.4_Silent_p.L359L|NCSTN_ENST00000392212.4_Silent_p.L597L	NM_015331.2	NP_056146.1	Q92542	NICA_HUMAN	nicastrin	617					amyloid precursor protein catabolic process (GO:0042987)|apoptotic signaling pathway (GO:0097190)|beta-amyloid metabolic process (GO:0050435)|epithelial cell proliferation (GO:0050673)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|membrane protein ectodomain proteolysis (GO:0006509)|membrane protein intracellular domain proteolysis (GO:0031293)|myeloid cell homeostasis (GO:0002262)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of apoptotic process (GO:0043065)|positive regulation of catalytic activity (GO:0043085)|protein processing (GO:0016485)|proteolysis (GO:0006508)|T cell proliferation (GO:0042098)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)	endopeptidase activity (GO:0004175)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(16)|ovary(1)|prostate(1)|skin(2)	34	all_cancers(52;8.15e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			CGGACCGACTCCCCCGGTGTG	0.537																																																	0								ENSG00000162736						186.0	158.0	167.0					1																	160326887		2203	4300	6503	NCSTN	SO:0001819	synonymous_variant	0			-	HGNC	AF240468	CCDS1203.1	1q22-q23	2014-09-17			ENSG00000162736	ENSG00000162736			17091	protein-coding gene	gene with protein product		605254				9039502, 10993067	Standard	XM_005245053		Approved	KIAA0253, APH2	uc001fvx.3	Q92542	OTTHUMG00000033110	ENST00000294785.5:c.1851C>T	1.37:g.160326887C>T		Somatic	0	68	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	67	16.25	Q5T207|Q5T208|Q86VV5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Nicastrin	p.L617	ENST00000294785.5	37	c.1851	CCDS1203.1	1																																																																																			-	NULL		0.537	NCSTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCSTN	protein_coding	OTTHUMT00000080622.1	C	NM_015331	-		160326887	+1	no_errors	ENST00000294785	ensembl	human	known	74_37	silent	SNP	0.872	T
FGFR3	2261	genome.wustl.edu	37	4	1806225	1806225	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr4:1806225C>T	ENST00000260795.2	+	8	1346	c.1244C>T	c.(1243-1245)tCc>tTc	p.S415F	FGFR3_ENST00000340107.4_Missense_Mutation_p.S417F|FGFR3_ENST00000440486.2_Missense_Mutation_p.S415F|FGFR3_ENST00000412135.2_Intron|FGFR3_ENST00000352904.1_Intron|FGFR3_ENST00000481110.2_Missense_Mutation_p.S415F			P22607	FGFR3_HUMAN	fibroblast growth factor receptor 3	415					alveolar secondary septum development (GO:0061144)|axonogenesis involved in innervation (GO:0060385)|bone maturation (GO:0070977)|bone mineralization (GO:0030282)|bone morphogenesis (GO:0060349)|cell-cell signaling (GO:0007267)|central nervous system myelination (GO:0022010)|chondrocyte differentiation (GO:0002062)|chondrocyte proliferation (GO:0035988)|cochlea development (GO:0090102)|digestive tract morphogenesis (GO:0048546)|endochondral bone growth (GO:0003416)|endochondral ossification (GO:0001958)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell fate commitment (GO:0072148)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor apoptotic signaling pathway (GO:1902178)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inner ear receptor cell differentiation (GO:0060113)|insulin receptor signaling pathway (GO:0008286)|JAK-STAT cascade (GO:0007259)|lens fiber cell development (GO:0070307)|lens morphogenesis in camera-type eye (GO:0002089)|MAPK cascade (GO:0000165)|morphogenesis of an epithelium (GO:0002009)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of developmental growth (GO:0048640)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of mitosis (GO:0045839)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|protein autophosphorylation (GO:0046777)|response to axon injury (GO:0048678)|skeletal system development (GO:0001501)|somatic stem cell maintenance (GO:0035019)|substantia nigra development (GO:0021762)	cell surface (GO:0009986)|cytoplasmic side of plasma membrane (GO:0009898)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|protein tyrosine kinase activity (GO:0004713)			NS(1)|central_nervous_system(5)|cervix(6)|endometrium(2)|haematopoietic_and_lymphoid_tissue(40)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|pancreas(2)|prostate(9)|skin(339)|soft_tissue(4)|testis(2)|upper_aerodigestive_tract(58)|urinary_tract(2607)	3091		Breast(71;0.212)|all_epithelial(65;0.241)	all cancers(2;0.000145)|OV - Ovarian serous cystadenocarcinoma(23;0.0019)|Epithelial(3;0.00221)|GBM - Glioblastoma multiforme(2;0.234)		Palifermin(DB00039)|Pazopanib(DB06589)|Ponatinib(DB08901)	CACAAGATCTCCCGCTTCCCG	0.657		1	"""Mis, T"""	"""IGH@, ETV6"""	"""bladder, MM, T-cell lymphoma"""		"""Hypochondroplasia, Thanatophoric dysplasia"""		Saethre-Chotzen syndrome;Muenke syndrome																															Dom	yes		4	4p16.3	2261	fibroblast growth factor receptor 3	yes	"""L, E"""	0								ENSG00000068078						139.0	156.0	150.0					4																	1806225		2203	4299	6502	FGFR3	SO:0001583	missense	0	Familial Cancer Database	Acrocephalosyndactyly type III;Muenke Nonsyndromic Coronal Craniosynostosis, FGFR3-related Craniosynostosis	-	HGNC	M64347	CCDS3353.1, CCDS3354.1, CCDS54706.1	4p16.3	2013-01-11	2008-08-01		ENSG00000068078	ENSG00000068078		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3690	protein-coding gene	gene with protein product		134934	"""achondroplasia, thanatophoric dwarfism"""	ACH		1847508	Standard	NM_000142		Approved	CEK2, JTK4, CD333	uc003gdu.2	P22607	OTTHUMG00000121148	ENST00000260795.2:c.1244C>T	4.37:g.1806225C>T	ENSP00000260795:p.Ser415Phe	Somatic	0	72	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	75	15.56	D3DVP9|D3DVQ0|Q14308|Q16294|Q16608|Q59FL9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_FGF_rcpt_fam,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.S417F	ENST00000260795.2	37	c.1250	CCDS3353.1	4	.	.	.	.	.	.	.	.	.	.	c	27.2	4.805701	0.90623	.	.	ENSG00000068078	ENST00000481110;ENST00000340107;ENST00000440486;ENST00000260795	D;D;D;D	0.87491	-2.26;-2.26;-2.26;-2.26	4.44	4.44	0.53790	.	0.000000	0.85682	D	0.000000	D	0.93969	0.8069	M	0.86651	2.83	0.80722	D	1	D;D;D	0.76494	0.997;0.995;0.999	D;P;D	0.74348	0.981;0.905;0.983	D	0.94400	0.7622	10	0.48119	T	0.1	.	17.4357	0.87552	0.0:1.0:0.0:0.0	.	417;415;415	P22607-2;P22607;F8W9L4	.;FGFR3_HUMAN;.	F	415;417;415;415	ENSP00000420533:S415F;ENSP00000339824:S417F;ENSP00000414914:S415F;ENSP00000260795:S415F	ENSP00000260795:S415F	S	+	2	0	FGFR3	1776023	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.271000	0.78506	2.189000	0.69895	0.462000	0.41574	TCC	-	pirsf_FGF_rcpt_fam		0.657	FGFR3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	FGFR3	protein_coding	OTTHUMT00000241632.2	C	NM_000142	-		1806225	+1	no_errors	ENST00000340107	ensembl	human	known	74_37	missense	SNP	1.000	T
IGF1	3479	genome.wustl.edu	37	12	102796307	102796307	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr12:102796307C>T	ENST00000424202.2	-	4	541	c.392G>A	c.(391-393)gGa>gAa	p.G131E	IGF1_ENST00000456098.1_3'UTR|IGF1_ENST00000481539.1_5'UTR|IGF1_ENST00000392904.1_3'UTR|IGF1_ENST00000337514.6_Missense_Mutation_p.G147E	NM_001111284.1	NP_001104754.1	P05019	IGF1_HUMAN	insulin-like growth factor 1 (somatomedin C)	0					blood coagulation (GO:0007596)|blood vessel remodeling (GO:0001974)|bone mineralization involved in bone maturation (GO:0035630)|branching morphogenesis of an epithelial tube (GO:0048754)|cell activation (GO:0001775)|cellular component movement (GO:0006928)|cellular protein metabolic process (GO:0044267)|chondroitin sulfate proteoglycan biosynthetic process (GO:0050650)|DNA replication (GO:0006260)|exocrine pancreas development (GO:0031017)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|glial cell differentiation (GO:0010001)|glycolate metabolic process (GO:0009441)|inner ear development (GO:0048839)|insulin-like growth factor receptor signaling pathway (GO:0048009)|lung alveolus development (GO:0048286)|lung lobe morphogenesis (GO:0060463)|lung vasculature development (GO:0060426)|mammary gland development (GO:0030879)|multicellular organism growth (GO:0035264)|muscle hypertrophy (GO:0014896)|muscle organ development (GO:0007517)|myoblast differentiation (GO:0045445)|myoblast proliferation (GO:0051450)|myotube cell development (GO:0014904)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell proliferation (GO:0008285)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|negative regulation of smooth muscle cell apoptotic process (GO:0034392)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cerebellar granule cell precursor proliferation (GO:0021940)|positive regulation of DNA binding (GO:0043388)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of glucose import (GO:0046326)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of glycolytic process (GO:0045821)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mitosis (GO:0045840)|positive regulation of myoblast proliferation (GO:2000288)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis (GO:0060527)|prostate gland growth (GO:0060736)|prostate gland stromal morphogenesis (GO:0060741)|proteoglycan biosynthetic process (GO:0030166)|Ras protein signal transduction (GO:0007265)|regulation of establishment or maintenance of cell polarity (GO:0032878)|regulation of multicellular organism growth (GO:0040014)|signal transduction (GO:0007165)|skeletal muscle satellite cell maintenance involved in skeletal muscle regeneration (GO:0014834)|skeletal system development (GO:0001501)|Type I pneumocyte differentiation (GO:0060509)|Type II pneumocyte differentiation (GO:0060510)|water homeostasis (GO:0030104)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|insulin-like growth factor binding protein complex (GO:0016942)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	hormone activity (GO:0005179)|insulin receptor binding (GO:0005158)|insulin-like growth factor receptor binding (GO:0005159)|integrin binding (GO:0005178)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(5)|pancreas(1)	11						GTTCTTGTTTCCTGCACTCCC	0.408																																																	0								ENSG00000017427						294.0	257.0	269.0					12																	102796307		2203	4300	6503	IGF1	SO:0001583	missense	0			-	HGNC	X00173	CCDS9091.1, CCDS44960.1, CCDS44961.1, CCDS44962.1	12q23.2	2014-09-16			ENSG00000017427	ENSG00000017427		"""Endogenous ligands"""	5464	protein-coding gene	gene with protein product		147440				2982726, 6358902	Standard	NM_001111283		Approved	IGF1A, IGFI, IGF-I	uc001tjp.4	P05019	OTTHUMG00000149910	ENST00000424202.2:c.392G>A	12.37:g.102796307C>T	ENSP00000416811:p.Gly131Glu	Somatic	0	35	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	39	22.00	B2RWM7|E9PD02|P01343|Q14620	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Insulin-like,superfamily_Insulin-like,smart_Insulin-like,prints_IGF-I,prints_Insulin_family,prints_Insulin-like_growth_factor	p.G147E	ENST00000424202.2	37	c.440	CCDS44960.1	12	.	.	.	.	.	.	.	.	.	.	C	15.76	2.927403	0.52759	.	.	ENSG00000017427	ENST00000337514;ENST00000424202	D;D	0.98329	-4.87;-4.84	5.77	5.77	0.91146	.	.	.	.	.	D	0.97845	0.9292	M	0.85197	2.74	0.80722	D	1	B;B	0.28900	0.227;0.005	B;B	0.22152	0.038;0.005	D	0.96394	0.9291	9	0.72032	D	0.01	.	20.3627	0.98863	0.0:1.0:0.0:0.0	.	178;131	Q59GC5;Q14620	.;.	E	147;131	ENSP00000337612:G147E;ENSP00000416811:G131E	ENSP00000337612:G147E	G	-	2	0	IGF1	101320437	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.317000	0.65822	2.885000	0.99019	0.655000	0.94253	GGA	-	NULL		0.408	IGF1-004	NOVEL	basic|exp_conf|CCDS	protein_coding	IGF1	protein_coding	OTTHUMT00000313857.1	C	NM_000618	-		102796307	-1	no_errors	ENST00000337514	ensembl	human	known	74_37	missense	SNP	1.000	T
PLIN4	729359	genome.wustl.edu	37	19	4512775	4512775	+	Silent	SNP	C	C	T	rs371797406|rs386806141	byFrequency	TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr19:4512775C>T	ENST00000301286.3	-	3	1154	c.1155G>A	c.(1153-1155)acG>acA	p.T385T		NM_001080400.1	NP_001073869.1	Q96Q06	PLIN4_HUMAN	perilipin 4	385	27 X 33 AA approximate tandem repeat.					cytoplasm (GO:0005737)|lipid particle (GO:0005811)|plasma membrane (GO:0005886)				NS(2)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(14)|ovary(1)|skin(2)|soft_tissue(1)|stomach(2)	41						TCGTGTCTTTCGTACCCATGA	0.567													c|||	9	0.00179712	0.003	0.0014	5008	,	,		18819	0.0		0.001	False		,,,				2504	0.0031																0								ENSG00000167676	C		0,2920		0,0,1460	60.0	79.0	74.0		1155	-3.8	0.5	19		74	8,8242		1,6,4118	no	coding-synonymous	PLIN4	NM_001080400.1		1,6,5578	TT,TC,CC		0.097,0.0,0.0716		385/1358	4512775	8,11162	1460	4125	5585	PLIN4	SO:0001819	synonymous_variant	0			-	HGNC	AB067468	CCDS45927.1	19p13.3	2009-10-06	2009-08-12	2009-08-12	ENSG00000167676	ENSG00000167676		"""Perilipins"""	29393	protein-coding gene	gene with protein product		613247	"""KIAA1881"""	KIAA1881		11572484, 19638644	Standard	NM_001080400		Approved	S3-12	uc002mar.1	Q96Q06	OTTHUMG00000167571	ENST00000301286.3:c.1155G>A	19.37:g.4512775C>T		Somatic	0	73	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	80	17.53	A6NEI2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Perilipin,superfamily_Ankyrin_rpt-contain_dom	p.T385	ENST00000301286.3	37	c.1155	CCDS45927.1	19																																																																																			-	superfamily_Ankyrin_rpt-contain_dom		0.567	PLIN4-001	NOVEL	basic|appris_principal|CCDS	protein_coding	PLIN4	protein_coding	OTTHUMT00000395095.1	C	XM_170901	-		4512775	-1	no_errors	ENST00000301286	ensembl	human	novel	74_37	silent	SNP	0.176	T
DNAH10	196385	genome.wustl.edu	37	12	124343772	124343772	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr12:124343772G>A	ENST00000409039.3	+	37	6377	c.6352G>A	c.(6352-6354)Ggc>Agc	p.G2118S		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	2118	AAA 2. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		CACCAGAGGGGGCAAGTCCGT	0.567																																																	0								ENSG00000197653						35.0	37.0	37.0					12																	124343772		1901	4115	6016	DNAH10	SO:0001583	missense	0			-	HGNC	AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.6352G>A	12.37:g.124343772G>A	ENSP00000386770:p.Gly2118Ser	Somatic	0	52	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	55	15.15	C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,superfamily_PyrdxlP-dep_Trfase,smart_AAA+_ATPase	p.G2118S	ENST00000409039.3	37	c.6352	CCDS9255.2	12	.	.	.	.	.	.	.	.	.	.	G	26.1	4.708491	0.89018	.	.	ENSG00000197653	ENST00000409039	D	0.92048	-2.96	5.44	5.44	0.79542	ATPase, AAA+ type, core (1);ATPase, dynein-related, AAA domain (1);	0.000000	0.64402	U	0.000006	D	0.97636	0.9225	H	0.96996	3.92	0.80722	D	1	D	0.64830	0.994	D	0.73708	0.981	D	0.98660	1.0683	10	0.72032	D	0.01	.	19.2736	0.94021	0.0:0.0:1.0:0.0	.	2118	Q8IVF4	DYH10_HUMAN	S	2118	ENSP00000386770:G2118S	ENSP00000386770:G2118S	G	+	1	0	DNAH10	122909725	1.000000	0.71417	1.000000	0.80357	0.125000	0.20455	9.764000	0.98949	2.546000	0.85860	0.563000	0.77884	GGC	-	pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase		0.567	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH10	protein_coding	OTTHUMT00000335420.3	G		-		124343772	+1	no_errors	ENST00000409039	ensembl	human	known	74_37	missense	SNP	1.000	A
TSEN2	80746	genome.wustl.edu	37	3	12571292	12571292	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr3:12571292C>T	ENST00000284995.6	+	10	1555	c.1168C>T	c.(1168-1170)Cat>Tat	p.H390Y	C3orf83_ENST00000567514.1_Intron|TSEN2_ENST00000314571.7_Missense_Mutation_p.H364Y|TSEN2_ENST00000415684.1_Missense_Mutation_p.H364Y|TSEN2_ENST00000402228.3_Missense_Mutation_p.H390Y|TSEN2_ENST00000454502.2_Missense_Mutation_p.H331Y|TSEN2_ENST00000444864.1_Missense_Mutation_p.H364Y|TSEN2_ENST00000383797.5_Missense_Mutation_p.H373Y	NM_025265.3	NP_079541.1	Q8NCE0	SEN2_HUMAN	TSEN2 tRNA splicing endonuclease subunit	390					mRNA processing (GO:0006397)|tRNA splicing, via endonucleolytic cleavage and ligation (GO:0006388)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|tRNA-intron endonuclease complex (GO:0000214)	lyase activity (GO:0016829)|nucleic acid binding (GO:0003676)|tRNA-intron endonuclease activity (GO:0000213)			central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(5)|lung(7)	19						AGTTGATGACCATTTTGAAGG	0.388																																																	0								ENSG00000154743						105.0	102.0	103.0					3																	12571292		2203	4300	6503	TSEN2	SO:0001583	missense	0			-	HGNC	BC019582	CCDS2611.1, CCDS46757.1, CCDS46758.1, CCDS46759.1	3p25.2	2013-08-06	2013-08-06		ENSG00000154743	ENSG00000154743		"""tRNA splicing endonuclease subunits"""	28422	protein-coding gene	gene with protein product		608753	"""tRNA splicing endonuclease 2 homolog (SEN2, S. cerevisiae)"", ""tRNA splicing endonuclease 2 homolog (S. cerevisiae)"""			15109492	Standard	NM_025265		Approved	SEN2, SEN2L, MGC2776	uc003bxb.3	Q8NCE0	OTTHUMG00000129765	ENST00000284995.6:c.1168C>T	3.37:g.12571292C>T	ENSP00000284995:p.His390Tyr	Somatic	0	44	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	68	12.82	B7Z6K1|C9IZI7|G5E9Q3|Q8WTW7|Q9BPU7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_tRNA_intron_Endonuc_cat-like,pfam_tRNA_intron_Endonuc_N,superfamily_tRNA_intron_Endonuc_cat-like,pirsf_tRNA_splic_SEN2	p.H390Y	ENST00000284995.6	37	c.1168	CCDS2611.1	3	.	.	.	.	.	.	.	.	.	.	C	13.48	2.249369	0.39797	.	.	ENSG00000154743	ENST00000314571;ENST00000454502;ENST00000383797;ENST00000402228;ENST00000284995;ENST00000444864;ENST00000537959;ENST00000415684	T;T;T;T;T;T;T	0.56275	0.47;0.47;0.47;0.47;0.47;0.49;0.47	5.99	1.64	0.23874	tRNA intron endonuclease, catalytic domain-like (2);Endonuclease TnsA, N-terminal/resolvase Hjc/tRNA endonuclease, C-terminal (1);	1.203660	0.05571	N	0.571098	T	0.34774	0.0909	N	0.05230	-0.09	0.09310	N	1	P;B;P;P	0.42827	0.791;0.014;0.461;0.516	B;B;B;B	0.43508	0.422;0.011;0.072;0.106	T	0.28364	-1.0046	10	0.62326	D	0.03	-0.1619	5.1013	0.14760	0.421:0.404:0.1011:0.074	.	364;390;364;331	G5E9Q3;Q8NCE0;Q8NCE0-3;C9IZI7	.;SEN2_HUMAN;.;.	Y	364;331;373;390;390;364;363;364	ENSP00000323188:H364Y;ENSP00000392029:H331Y;ENSP00000373307:H373Y;ENSP00000385976:H390Y;ENSP00000284995:H390Y;ENSP00000407974:H364Y;ENSP00000416510:H364Y	ENSP00000284995:H390Y	H	+	1	0	TSEN2	12546292	0.000000	0.05858	0.005000	0.12908	0.727000	0.41649	-0.194000	0.09559	0.387000	0.25024	-0.169000	0.13324	CAT	-	pfam_tRNA_intron_Endonuc_cat-like,superfamily_tRNA_intron_Endonuc_cat-like,pirsf_tRNA_splic_SEN2		0.388	TSEN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSEN2	protein_coding	OTTHUMT00000251981.1	C	NM_025265	-		12571292	+1	no_errors	ENST00000284995	ensembl	human	known	74_37	missense	SNP	0.000	T
C2orf76	130355	genome.wustl.edu	37	2	120097419	120097419	+	Silent	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr2:120097419G>A	ENST00000409466.2	-	3	638	c.117C>T	c.(115-117)atC>atT	p.I39I	C2orf76_ENST00000498049.1_5'UTR|C2orf76_ENST00000334816.7_Silent_p.I39I|C2orf76_ENST00000409877.1_Silent_p.I39I|C2orf76_ENST00000409523.1_Silent_p.I39I			Q3KRA6	CB076_HUMAN	chromosome 2 open reading frame 76	39										large_intestine(1)|lung(3)|pancreas(1)	5						TTAGAAATACGATAAATTCCT	0.338																																																	0								ENSG00000186132						104.0	96.0	99.0					2																	120097419		1839	4107	5946	C2orf76	SO:0001819	synonymous_variant	0			-	HGNC		CCDS42739.1	2q14.2	2011-05-09			ENSG00000186132	ENSG00000186132			27017	protein-coding gene	gene with protein product						12477932	Standard	NM_001017927		Approved	MGC104437, LOC130355, AIM29	uc002tls.2	Q3KRA6	OTTHUMG00000153298	ENST00000409466.2:c.117C>T	2.37:g.120097419G>A		Somatic	0	56	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	64	16.88	B7ZLS8|Q4VC35	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_UPF0538	p.I39	ENST00000409466.2	37	c.117	CCDS42739.1	2																																																																																			-	pfam_UPF0538		0.338	C2orf76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C2orf76	protein_coding	OTTHUMT00000330582.2	G	NM_001017927	-		120097419	-1	no_errors	ENST00000334816	ensembl	human	known	74_37	silent	SNP	0.997	A
CA5BP1	340591	genome.wustl.edu	37	X	15721141	15721141	+	RNA	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chrX:15721141C>T	ENST00000380334.2	+	0	558							Q8WTZ4	CA5BL_HUMAN	carbonic anhydrase VB pseudogene 1							mitochondrion (GO:0005739)	carbonate dehydratase activity (GO:0004089)|zinc ion binding (GO:0008270)										GAGAGATGGTCCCCGCCCGCA	0.632																																																	0								ENSG00000186312																																			CA5BP1			0			-	HGNC	BC021816		Xp22.2	2012-11-02	2011-02-07	2011-02-07	ENSG00000186312	ENSG00000186312			29544	pseudogene	pseudogene	"""similar to carbonic anhydrase VB, mitochondrial precursor"", ""carbonic dehydratase"""		"""carbonic anhydrase VB-like"", ""carbonic anhydrase VB pseudogene"""	CA5BL, CA5BP		12477932	Standard	NR_026551		Approved	PRO2325	uc011mir.1	Q8WTZ4	OTTHUMG00000021182		X.37:g.15721141C>T		Somatic	0	32	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	36	34.55	A6NEZ4	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000380334.2	37	NULL		X																																																																																			-	-		0.632	CA5BP1-005	KNOWN	basic	processed_transcript	CA5BP1	pseudogene	OTTHUMT00000055884.3	C	NR_026551	-		15721141	+1	no_errors	ENST00000380333	ensembl	human	known	74_37	rna	SNP	0.001	T
IQCE	23288	genome.wustl.edu	37	7	2627481	2627481	+	Silent	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr7:2627481G>A	ENST00000402050.2	+	13	1198	c.1014G>A	c.(1012-1014)cgG>cgA	p.R338R	IQCE_ENST00000438376.2_Silent_p.R322R|IQCE_ENST00000404984.1_Silent_p.R287R|IQCE_ENST00000325979.7_Silent_p.R273R	NM_001100390.1|NM_152558.3	NP_001093860.1|NP_689771.3	Q6IPM2	IQCE_HUMAN	IQ motif containing E	338						mitochondrion (GO:0005739)				breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	30		Ovarian(82;0.0112)		OV - Ovarian serous cystadenocarcinoma(56;1.23e-13)		GCAAGCCCCGGCTGCTGAGGC	0.627																																																	0								ENSG00000106012						103.0	116.0	112.0					7																	2627481		2123	4237	6360	IQCE	SO:0001819	synonymous_variant	0			-	HGNC	AL136792	CCDS43542.1, CCDS47527.1, CCDS47527.2, CCDS75559.1, CCDS75560.1	7p22.3	2006-04-12			ENSG00000106012	ENSG00000106012			29171	protein-coding gene	gene with protein product						10470851	Standard	XR_242067		Approved	KIAA1023	uc003smo.4	Q6IPM2	OTTHUMG00000152047	ENST00000402050.2:c.1014G>A	7.37:g.2627481G>A		Somatic	0	86	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	99	18.18	Q4G0P7|Q6P7T4|Q9H0H7|Q9UPX7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS	p.R338	ENST00000402050.2	37	c.1014	CCDS43542.1	7																																																																																			-	NULL		0.627	IQCE-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	IQCE	protein_coding	OTTHUMT00000325063.2	G	NM_152558	-		2627481	+1	no_errors	ENST00000402050	ensembl	human	known	74_37	silent	SNP	1.000	A
CCDC144A	9720	genome.wustl.edu	37	17	16638166	16638166	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr17:16638166G>A	ENST00000360524.8	+	12	2657	c.2581G>A	c.(2581-2583)Gat>Aat	p.D861N	CCDC144A_ENST00000456009.1_Missense_Mutation_p.D581N|RP11-219A15.1_ENST00000448331.3_Missense_Mutation_p.D861N|CCDC144A_ENST00000443444.2_Missense_Mutation_p.D861N|CCDC144A_ENST00000399273.1_Missense_Mutation_p.D861N	NM_014695.1	NP_055510.1	A2RUR9	C144A_HUMAN	coiled-coil domain containing 144A	861																	AGAAAAGAATGATAACCTTCA	0.323																																																	0								ENSG00000170160						5.0	5.0	5.0					17																	16638166		1670	3759	5429	CCDC144A	SO:0001583	missense	0			-	HGNC	BC133019	CCDS45621.1	17p11.2	2008-10-23			ENSG00000170160	ENSG00000170160			29072	protein-coding gene	gene with protein product						9628581, 11997339	Standard	NM_014695		Approved	KIAA0565, FLJ43983	uc002gqk.1	A2RUR9	OTTHUMG00000059178	ENST00000360524.8:c.2581G>A	17.37:g.16638166G>A	ENSP00000353717:p.Asp861Asn	Somatic	0	32	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	39	16.67	O60311|Q6ZU57	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF3496	p.D861N	ENST00000360524.8	37	c.2581	CCDS45621.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	11.91|11.91	1.780373|1.780373	0.31502|0.31502	.|.	.|.	ENSG00000170160|ENSG00000170160	ENST00000399273;ENST00000443444;ENST00000360524;ENST00000456009|ENST00000328495	T;T;T;T|.	0.17054|.	2.3;2.3;2.3;2.3|.	2.08|2.08	2.08|2.08	0.27032|0.27032	.|.	.|.	.|.	.|.	.|.	T|T	0.42177|0.42177	0.1191|0.1191	L|L	0.49126|0.49126	1.545|1.545	0.20489|0.20489	N|N	0.999897|0.999897	D;D|.	0.76494|.	0.999;0.997|.	D;D|.	0.75484|.	0.986;0.946|.	T|T	0.27806|0.27806	-1.0063|-1.0063	9|5	0.66056|.	D|.	0.02|.	.|.	9.8235|9.8235	0.40896|0.40896	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	581;861|.	A2RUR9-3;A2RUR9|.	.;C144A_HUMAN|.	N|I	861;861;861;581|344	ENSP00000382215:D861N;ENSP00000439262:D861N;ENSP00000353717:D861N;ENSP00000394201:D581N|.	ENSP00000353717:D861N|.	D|M	+|+	1|3	0|0	CCDC144A|CCDC144A	16578891|16578891	1.000000|1.000000	0.71417|0.71417	0.259000|0.259000	0.24435|0.24435	0.023000|0.023000	0.10783|0.10783	5.407000|5.407000	0.66363|0.66363	1.153000|1.153000	0.42468|0.42468	0.393000|0.393000	0.25936|0.25936	GAT|ATG	-	NULL		0.323	CCDC144A-013	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCDC144A	protein_coding	OTTHUMT00000444093.1	G		-		16638166	+1	no_errors	ENST00000360524	ensembl	human	known	74_37	missense	SNP	0.986	A
SPEN	23013	genome.wustl.edu	37	1	16260291	16260291	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr1:16260291C>T	ENST00000375759.3	+	11	7760	c.7556C>T	c.(7555-7557)cCc>cTc	p.P2519L		NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	2519	Pro-rich.|RID.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)			NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		CCAGCTCTTCCCCCAGACACA	0.567																																																	0								ENSG00000065526						151.0	156.0	154.0					1																	16260291		2203	4300	6503	SPEN	SO:0001583	missense	0			-	HGNC		CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.7556C>T	1.37:g.16260291C>T	ENSP00000364912:p.Pro2519Leu	Somatic	0	34	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	44	15.38	Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RRM_dom,pfam_SPOC_C,superfamily_SPOC_like_C_dom,smart_RRM_dom,pfscan_SPOC_met,pfscan_RRM_dom	p.P2519L	ENST00000375759.3	37	c.7556	CCDS164.1	1	.	.	.	.	.	.	.	.	.	.	C	16.73	3.203910	0.58234	.	.	ENSG00000065526	ENST00000375759	T	0.37915	1.17	5.16	5.16	0.70880	.	.	.	.	.	T	0.58133	0.2101	L	0.59436	1.845	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.56792	-0.7920	9	0.45353	T	0.12	-15.021	18.6444	0.91406	0.0:1.0:0.0:0.0	.	2519	Q96T58	MINT_HUMAN	L	2519	ENSP00000364912:P2519L	ENSP00000364912:P2519L	P	+	2	0	SPEN	16132878	1.000000	0.71417	0.999000	0.59377	0.986000	0.74619	7.408000	0.80041	2.418000	0.82041	0.561000	0.74099	CCC	-	NULL		0.567	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPEN	protein_coding	OTTHUMT00000025993.1	C	NM_015001	-		16260291	+1	no_errors	ENST00000375759	ensembl	human	known	74_37	missense	SNP	1.000	T
NPIPA1	9284	genome.wustl.edu	37	16	15018437	15018437	+	3'UTR	SNP	C	C	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr16:15018437C>A	ENST00000472413.1	+	0	732				RP11-958N24.1_ENST00000537889.1_RNA			Q9UND3	NPIA1_HUMAN	nuclear pore complex interacting protein family, member A1						mRNA transport (GO:0051028)|protein transport (GO:0015031)	nuclear pore (GO:0005643)											CGGTTCCAGACCCCTCGGTGG	0.662																																																	0								ENSG00000183426																																			NPIPA1	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AC002045	CCDS10557.1	16p13.11	2013-06-11	2013-06-11	2013-06-11	ENSG00000183426	ENSG00000183426			7909	protein-coding gene	gene with protein product		606406	"""nuclear pore complex interacting protein"""	NPIP		11586358, 18055785	Standard	NM_006985		Approved	morpheus	uc002dcy.4	Q9UND3	OTTHUMG00000090663	ENST00000472413.1:c.*729C>A	16.37:g.15018437C>A		Somatic	0	211	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	35	257	11.99	O15102	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000472413.1	37	NULL		16																																																																																			-	-		0.662	NPIPA1-002	KNOWN	basic|readthrough_transcript	processed_transcript	NPIPA1	protein_coding	OTTHUMT00000207327.1	C	NM_006985	-		15018437	+1	no_errors	ENST00000472413	ensembl	human	known	74_37	rna	SNP	0.374	A
ITK	3702	genome.wustl.edu	37	5	156668658	156668658	+	Silent	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr5:156668658C>T	ENST00000422843.3	+	11	1140	c.988C>T	c.(988-990)Ctg>Ttg	p.L330L	ITK_ENST00000519749.1_3'UTR	NM_005546.3	NP_005537.3	Q08881	ITK_HUMAN	IL2-inducible T-cell kinase	330	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				activation of phospholipase C activity (GO:0007202)|adaptive immune response (GO:0002250)|cellular defense response (GO:0006968)|cytokine production (GO:0001816)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|interferon-gamma production (GO:0032609)|interleukin-4 production (GO:0032633)|intracellular signal transduction (GO:0035556)|NK T cell differentiation (GO:0001865)|peptidyl-tyrosine phosphorylation (GO:0018108)|signal transduction (GO:0007165)|T cell activation (GO:0042110)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)			breast(4)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(25)|ovary(8)|prostate(2)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	70	Renal(175;0.00212)	Medulloblastoma(196;0.0354)|all_neural(177;0.1)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)		Pazopanib(DB06589)	CAACCCAGGCCTGGTGACTCG	0.448			T	SYK	peripheral T-cell lymphoma																																Esophageal Squamous(70;1378 1469 8785 19883)			Dom	yes		5	5q31-q32	3702	IL2-inducible T-cell kinase		L	0								ENSG00000113263						84.0	70.0	75.0					5																	156668658		2203	4300	6503	ITK	SO:0001819	synonymous_variant	0			-	HGNC	D13720	CCDS4336.1	5q31-q32	2014-09-17			ENSG00000113263	ENSG00000113263		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	6171	protein-coding gene	gene with protein product		186973				8364206	Standard	NM_005546		Approved	EMT, PSCTK2, LYK	uc003lwo.1	Q08881	OTTHUMG00000130245	ENST00000422843.3:c.988C>T	5.37:g.156668658C>T		Somatic	0	63	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	67	8.22	B2R752|Q32ML7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_SH2,pfam_Znf_Btk_motif,pfam_SH3_domain,pfam_Pleckstrin_homology,pfam_SH3_2,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_Znf_Btk_motif,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Pleckstrin_homology,pfscan_SH2,pfscan_SH3_domain,pfscan_Znf_Btk_motif,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2	p.L330	ENST00000422843.3	37	c.988	CCDS4336.1	5																																																																																			-	pfscan_SH2		0.448	ITK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITK	protein_coding	OTTHUMT00000252569.2	C		-		156668658	+1	no_errors	ENST00000422843	ensembl	human	known	74_37	silent	SNP	1.000	T
TEC	7006	genome.wustl.edu	37	4	48230594	48230594	+	Missense_Mutation	SNP	T	T	C			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr4:48230594T>C	ENST00000381501.3	-	2	195	c.38A>G	c.(37-39)aAa>aGa	p.K13R		NM_003215.2	NP_003206.2	P42680	TEC_HUMAN	tec protein tyrosine kinase	13	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				B cell receptor signaling pathway (GO:0050853)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of platelet activation (GO:0010543)|tissue regeneration (GO:0042246)	cell-cell junction (GO:0005911)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|lipid binding (GO:0008289)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)			breast(1)|central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(16)|ovary(1)|prostate(2)|skin(2)|stomach(1)	31						CTGTGACCTTTTAATAAGAAT	0.388																																																	0								ENSG00000135605						136.0	129.0	131.0					4																	48230594		2203	4300	6503	TEC	SO:0001583	missense	0			-	HGNC	D29767	CCDS3481.1	4p12	2013-02-14			ENSG00000135605	ENSG00000135605		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	11719	protein-coding gene	gene with protein product		600583				7934162	Standard	NM_003215		Approved	PSCTK4	uc003gxz.3	P42680	OTTHUMG00000128623	ENST00000381501.3:c.38A>G	4.37:g.48230594T>C	ENSP00000370912:p.Lys13Arg	Somatic	0	60	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	64	20.00	B7ZKZ6|Q3MIS5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_SH2,pfam_Pleckstrin_homology,pfam_SH3_domain,pfam_Znf_Btk_motif,pfam_SH3_2,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_Znf_Btk_motif,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Pleckstrin_homology,pfscan_SH2,pfscan_SH3_domain,pfscan_Znf_Btk_motif,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH3_domain,prints_SH2,prints_Znf_Btk_motif	p.K13R	ENST00000381501.3	37	c.38	CCDS3481.1	4	.	.	.	.	.	.	.	.	.	.	T	23.9	4.469883	0.84533	.	.	ENSG00000135605	ENST00000381501	D	0.96554	-4.05	5.3	5.3	0.74995	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.193417	0.42420	D	0.000707	D	0.98419	0.9474	M	0.91818	3.245	0.53005	D	0.999967	D	0.69078	0.997	D	0.79108	0.992	D	0.99667	1.0995	10	0.87932	D	0	.	15.5343	0.75990	0.0:0.0:0.0:1.0	.	13	P42680	TEC_HUMAN	R	13	ENSP00000370912:K13R	ENSP00000370912:K13R	K	-	2	0	TEC	47925351	1.000000	0.71417	1.000000	0.80357	0.867000	0.49689	6.748000	0.74877	2.125000	0.65367	0.482000	0.46254	AAA	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology		0.388	TEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TEC	protein_coding	OTTHUMT00000250492.3	T		-		48230594	-1	no_errors	ENST00000381501	ensembl	human	known	74_37	missense	SNP	1.000	C
DNAH12	201625	genome.wustl.edu	37	3	57443834	57443834	+	Silent	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr3:57443834G>A	ENST00000351747.2	-	21	3156	c.2976C>T	c.(2974-2976)ttC>ttT	p.F992F		NM_178504.4	NP_848599.3	Q6ZR08	DYH12_HUMAN	dynein, axonemal, heavy chain 12	992	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(3)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(4)|lung(7)|pancreas(1)|prostate(1)|skin(1)	25						ACCGAGGGAAGAAAAGACGTT	0.294																																																	0								ENSG00000174844						118.0	101.0	106.0					3																	57443834		692	1591	2283	DNAH12	SO:0001819	synonymous_variant	0			-	HGNC	U53532, AK126276	CCDS33771.1	3p21.1	2009-02-04	2006-09-04		ENSG00000174844	ENSG00000174844		"""Axonemal dyneins"""	2943	protein-coding gene	gene with protein product		603340	"""dynein, axonemal, heavy polypeptide 12"", ""dynein heavy chain domain 2"", ""dynein heavy domain 2"", ""dynein, axonemal, heavy chain 12-like"", ""dynein, axonemal, heavy chain 7-like"""	DNHD2, DNAH12L, DNAH7L		8812413, 8666668	Standard	NM_198564		Approved	DLP12, Dnahc3, HL-19, hdhc3, DHC3, FLJ40427, FLJ44290	uc003dit.2	Q6ZR08	OTTHUMG00000158598	ENST00000351747.2:c.2976C>T	3.37:g.57443834G>A		Somatic	0	46	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	52	18.75	A6NGI2|Q6ZTR8|Q8N7R9|Q8WXK2|Q92816	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.F992	ENST00000351747.2	37	c.2976		3																																																																																			-	pfam_Dynein_heavy_dom-2		0.294	DNAH12-202	KNOWN	basic|appris_principal	protein_coding	DNAH12	protein_coding		G	NM_178504	-		57443834	-1	no_errors	ENST00000351747	ensembl	human	known	74_37	silent	SNP	1.000	A
CNTFR	1271	genome.wustl.edu	37	9	34552181	34552181	+	Missense_Mutation	SNP	T	T	G			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr9:34552181T>G	ENST00000378980.3	-	9	1389	c.1096A>C	c.(1096-1098)Act>Cct	p.T366P	CNTFR_ENST00000351266.4_Missense_Mutation_p.T366P	NM_001207011.1|NM_147164.2	NP_001193940.1|NP_671693.1	P26992	CNTFR_HUMAN	ciliary neurotrophic factor receptor	366					brainstem development (GO:0003360)|ciliary neurotrophic factor-mediated signaling pathway (GO:0070120)|negative regulation of neuron apoptotic process (GO:0043524)|nervous system development (GO:0007399)|positive regulation of cell proliferation (GO:0008284)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|skeletal muscle organ development (GO:0060538)|suckling behavior (GO:0001967)	anchored component of membrane (GO:0031225)|CNTFR-CLCF1 complex (GO:0097059)|extrinsic component of membrane (GO:0019898)|plasma membrane (GO:0005886)	ciliary neurotrophic factor receptor activity (GO:0004897)|cytokine binding (GO:0019955)|receptor binding (GO:0005102)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(4)|ovary(4)|skin(1)	15	all_epithelial(49;0.0899)		STAD - Stomach adenocarcinoma(86;0.212)	GBM - Glioblastoma multiforme(74;0.00494)		CTGCTGGCAGTGGCGGCAGCG	0.682																																																	0								ENSG00000122756						9.0	11.0	10.0					9																	34552181		2136	4226	6362	CNTFR	SO:0001583	missense	0			-	HGNC	M73238	CCDS6558.1	9p13	2013-02-11			ENSG00000122756	ENSG00000122756		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2170	protein-coding gene	gene with protein product		118946				1648265	Standard	NM_001842		Approved		uc003zuq.2	P26992	OTTHUMG00000019821	ENST00000378980.3:c.1096A>C	9.37:g.34552181T>G	ENSP00000368265:p.Thr366Pro	Somatic	0	18	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	23	37.84	Q5U050	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.T366P	ENST00000378980.3	37	c.1096	CCDS6558.1	9	.	.	.	.	.	.	.	.	.	.	T	11.58	1.681468	0.29872	.	.	ENSG00000122756	ENST00000378980;ENST00000351266	T;T	0.54071	0.59;0.59	4.68	-0.302	0.12796	.	0.323032	0.22421	N	0.060291	T	0.28896	0.0717	N	0.25647	0.755	0.31302	N	0.6881550000000001	B	0.31655	0.334	B	0.20577	0.03	T	0.15037	-1.0451	9	0.56958	D	0.05	.	3.7716	0.08643	0.0:0.2972:0.1939:0.5089	.	366	P26992	CNTFR_HUMAN	P	366	ENSP00000368265:T366P;ENSP00000242338:T366P	ENSP00000242338:T366P	T	-	1	0	CNTFR	34542181	1.000000	0.71417	0.951000	0.38953	0.596000	0.36781	1.049000	0.30392	0.172000	0.19760	0.374000	0.22700	ACT	-	NULL		0.682	CNTFR-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CNTFR	protein_coding	OTTHUMT00000052176.1	T		-		34552181	-1	no_errors	ENST00000351266	ensembl	human	known	74_37	missense	SNP	0.544	G
LRRC3	81543	genome.wustl.edu	37	21	45877037	45877037	+	Silent	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr21:45877037C>T	ENST00000291592.4	+	2	827	c.510C>T	c.(508-510)atC>atT	p.I170I	LRRC3-AS1_ENST00000426578.1_RNA|LRRC3DN_ENST00000596691.1_5'Flank	NM_030891.3	NP_112153.1	Q9BY71	LRRC3_HUMAN	leucine rich repeat containing 3	170						integral component of membrane (GO:0016021)				endometrium(2)|kidney(1)|lung(1)|urinary_tract(1)	5		Breast(209;0.00908)		COAD - Colon adenocarcinoma(84;0.148)|Lung(125;0.195)		TGGACGAGATCGCCTGCCACA	0.657																																																	0								ENSG00000160233						63.0	62.0	63.0					21																	45877037		2203	4300	6503	LRRC3	SO:0001819	synonymous_variant	0			-	HGNC	AB058646	CCDS13711.1	21q22.3	2011-12-07	2002-06-20		ENSG00000160233	ENSG00000160233			14965	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 102"""	C21orf102		12036297	Standard	NM_030891		Approved		uc002zfa.3	Q9BY71	OTTHUMG00000040847	ENST00000291592.4:c.510C>T	21.37:g.45877037C>T		Somatic	0	48	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	44	31.82	Q0VDJ2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Leu-rich_rpt,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp	p.I170	ENST00000291592.4	37	c.510	CCDS13711.1	21																																																																																			-	NULL		0.657	LRRC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC3	protein_coding	OTTHUMT00000098095.3	C		-		45877037	+1	no_errors	ENST00000291592	ensembl	human	known	74_37	silent	SNP	0.550	T
CREBRF	153222	genome.wustl.edu	37	5	172537591	172537591	+	Missense_Mutation	SNP	T	T	C			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr5:172537591T>C	ENST00000296953.2	+	6	1803	c.1484T>C	c.(1483-1485)cTc>cCc	p.L495P	CREBRF_ENST00000540014.1_Missense_Mutation_p.L497P	NM_153607.2	NP_705835.2	Q8IUR6	CRERF_HUMAN	CREB3 regulatory factor	495					negative regulation of endoplasmic reticulum unfolded protein response (GO:1900102)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of intracellular transport (GO:0032388)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein transport (GO:0051222)|response to endoplasmic reticulum stress (GO:0034976)|response to unfolded protein (GO:0006986)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)										CCTAAAAAACTCCTCCAGATA	0.413																																																	0								ENSG00000164463						79.0	80.0	80.0					5																	172537591		2203	4300	6503	CREBRF	SO:0001583	missense	0			-	HGNC	AY139008	CCDS34293.1, CCDS54948.1	5q35.2	2012-03-06	2012-03-06	2012-03-06	ENSG00000164463	ENSG00000164463			24050	protein-coding gene	gene with protein product	"""luman/CREB3 recruitment factor"""		"""chromosome 5 open reading frame 41"""	C5orf41		18391022	Standard	NM_153607		Approved	LRF	uc003mch.3	Q8IUR6	OTTHUMG00000163322	ENST00000296953.2:c.1484T>C	5.37:g.172537591T>C	ENSP00000296953:p.Leu495Pro	Somatic	0	29	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	26	23.53	B3DFH2|B3KW49|D3DQM2|F5GXN3|Q5HYG4|Q5HYK0|Q86YR3|Q8IZG1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.L497P	ENST00000296953.2	37	c.1490	CCDS34293.1	5	.	.	.	.	.	.	.	.	.	.	T	23.9	4.471348	0.84533	.	.	ENSG00000164463	ENST00000296953;ENST00000540014;ENST00000538538;ENST00000393776	T;T	0.24908	1.83;1.83	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	T	0.50650	0.1628	M	0.68317	2.08	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	T	0.53099	-0.8486	10	0.87932	D	0	.	15.8962	0.79336	0.0:0.0:0.0:1.0	.	495	Q8IUR6	CE041_HUMAN	P	495;497;495;495	ENSP00000296953:L495P;ENSP00000440075:L497P	ENSP00000296953:L495P	L	+	2	0	C5orf41	172470197	1.000000	0.71417	0.895000	0.35142	0.968000	0.65278	8.031000	0.88826	2.161000	0.67846	0.455000	0.32223	CTC	-	NULL		0.413	CREBRF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CREBRF	protein_coding	OTTHUMT00000372667.1	T	NM_153607	-		172537591	+1	no_errors	ENST00000540014	ensembl	human	known	74_37	missense	SNP	0.998	C
OPALIN	93377	genome.wustl.edu	37	10	98105735	98105735	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr10:98105735C>T	ENST00000371172.3	-	6	794	c.389G>A	c.(388-390)gGa>gAa	p.G130E	OPALIN_ENST00000419479.1_Missense_Mutation_p.G120E|OPALIN_ENST00000393871.1_Missense_Mutation_p.G107E|OPALIN_ENST00000393870.2_Missense_Mutation_p.G119E|OPALIN_ENST00000536387.1_Missense_Mutation_p.G120E	NM_001284326.1|NM_001284327.1|NM_033207.3	NP_001271255.1|NP_001271256.1|NP_149984.1	Q96PE5	OPALI_HUMAN	oligodendrocytic myelin paranodal and inner loop protein	130						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|large_intestine(1)|lung(5)|prostate(2)	9						CCACCACAATCCCCTCCTTCT	0.522																																																	0								ENSG00000197430						156.0	135.0	142.0					10																	98105735		2203	4300	6503	OPALIN	SO:0001583	missense	0			-	HGNC	AF367761	CCDS7448.1, CCDS41556.1, CCDS44466.1, CCDS60602.1, CCDS73172.1, CCDS73173.1	10q23-q24	2010-11-23	2008-05-01	2008-05-01	ENSG00000197430	ENSG00000197430			20707	protein-coding gene	gene with protein product			"""transmembrane protein 10"""	TMEM10		11814680, 17442045	Standard	NM_001284324		Approved	TMP10, HTMP10	uc001kmj.3	Q96PE5	OTTHUMG00000018831	ENST00000371172.3:c.389G>A	10.37:g.98105735C>T	ENSP00000360214:p.Gly130Glu	Somatic	0	53	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	74	20.43	A8MX69|A8MYG4|B4DK96|B4DKH0|Q5W102	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.G130E	ENST00000371172.3	37	c.389	CCDS7448.1	10	.	.	.	.	.	.	.	.	.	.	C	15.30	2.793423	0.50102	.	.	ENSG00000197430	ENST00000371172;ENST00000393871;ENST00000419479;ENST00000393870;ENST00000536387	.	.	.	4.12	2.17	0.27698	.	0.474665	0.18221	N	0.147886	T	0.50017	0.1591	L	0.34521	1.04	0.09310	N	1	D;D;P	0.89917	1.0;1.0;0.944	D;D;P	0.97110	1.0;1.0;0.624	T	0.37549	-0.9701	9	0.87932	D	0	-12.9564	10.3513	0.43937	0.0:0.611:0.389:0.0	.	107;130;120	A8MYG4;Q96PE5;B4DK96	.;OPALI_HUMAN;.	E	130;107;120;119;120	.	ENSP00000360214:G130E	G	-	2	0	OPALIN	98095725	0.002000	0.14202	0.055000	0.19348	0.836000	0.47400	0.621000	0.24418	0.459000	0.27016	0.650000	0.86243	GGA	-	NULL		0.522	OPALIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OPALIN	protein_coding	OTTHUMT00000049606.1	C	NM_033207	-		98105735	-1	no_errors	ENST00000371172	ensembl	human	known	74_37	missense	SNP	0.016	T
SPATA17	128153	genome.wustl.edu	37	1	217955540	217955540	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr1:217955540G>A	ENST00000366933.4	+	8	803	c.748G>A	c.(748-750)Gta>Ata	p.V250I	RP11-415L24.1_ENST00000415765.1_RNA	NM_138796.2	NP_620151.1	Q96L03	SPT17_HUMAN	spermatogenesis associated 17	250						cytoplasm (GO:0005737)				endometrium(1)|kidney(1)|large_intestine(9)|lung(6)|pancreas(2)|prostate(1)|urinary_tract(1)	21				OV - Ovarian serous cystadenocarcinoma(81;0.0516)|all cancers(67;0.0891)|GBM - Glioblastoma multiforme(131;0.117)		TATCACCGAAGTATTAGAACA	0.458																																																	0								ENSG00000162814						82.0	85.0	84.0					1																	217955540		2203	4300	6503	SPATA17	SO:0001583	missense	0			-	HGNC	AK098591	CCDS1519.1	1q41	2008-02-05			ENSG00000162814	ENSG00000162814			25184	protein-coding gene	gene with protein product	"""IQ motif containing H"""	611032				16395525	Standard	NM_138796		Approved	IQCH	uc001hlh.1	Q96L03	OTTHUMG00000037875	ENST00000366933.4:c.748G>A	1.37:g.217955540G>A	ENSP00000355900:p.Val250Ile	Somatic	0	43	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	38	24.00	A5D6N2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS	p.V250I	ENST00000366933.4	37	c.748	CCDS1519.1	1	.	.	.	.	.	.	.	.	.	.	G	35	5.431637	0.96150	.	.	ENSG00000162814	ENST00000366933	T	0.60797	0.16	4.73	4.73	0.59995	.	0.000000	0.64402	D	0.000002	T	0.77598	0.4154	M	0.81942	2.565	0.43103	D	0.994798	D	0.89917	1.0	D	0.73708	0.981	T	0.82063	-0.0643	10	0.87932	D	0	0.6466	18.0694	0.89400	0.0:0.0:1.0:0.0	.	250	Q96L03	SPT17_HUMAN	I	250	ENSP00000355900:V250I	ENSP00000355900:V250I	V	+	1	0	SPATA17	216022163	1.000000	0.71417	0.097000	0.21041	0.655000	0.38815	7.784000	0.85713	2.346000	0.79739	0.650000	0.86243	GTA	-	NULL		0.458	SPATA17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA17	protein_coding	OTTHUMT00000092433.2	G	NM_138796	-		217955540	+1	no_errors	ENST00000366933	ensembl	human	known	74_37	missense	SNP	1.000	A
TACC2	10579	genome.wustl.edu	37	10	124008163	124008163	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr10:124008163G>A	ENST00000369005.1	+	20	8738	c.8398G>A	c.(8398-8400)Gaa>Aaa	p.E2800K	TACC2_ENST00000368999.1_Missense_Mutation_p.E890K|TACC2_ENST00000513429.1_Missense_Mutation_p.E946K|TACC2_ENST00000334433.3_Missense_Mutation_p.E2800K|TACC2_ENST00000515273.1_Missense_Mutation_p.E2727K|TACC2_ENST00000369004.3_Missense_Mutation_p.E860K|TACC2_ENST00000358010.1_Missense_Mutation_p.E946K|TACC2_ENST00000360561.3_Missense_Mutation_p.E848K|TACC2_ENST00000453444.2_Missense_Mutation_p.E2727K|TACC2_ENST00000369000.1_Missense_Mutation_p.E423K|TACC2_ENST00000369001.1_Missense_Mutation_p.E427K|TACC2_ENST00000515603.1_Missense_Mutation_p.E2678K|TACC2_ENST00000260733.3_Missense_Mutation_p.E878K	NM_206862.2	NP_996744.2	O95359	TACC2_HUMAN	transforming, acidic coiled-coil containing protein 2	2800					astral microtubule organization (GO:0030953)|cerebral cortex development (GO:0021987)|interkinetic nuclear migration (GO:0022027)|neurogenesis (GO:0022008)|regulation of microtubule-based process (GO:0032886)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	nuclear hormone receptor binding (GO:0035257)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(15)|lung(27)|ovary(6)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	83		all_neural(114;0.0656)|Lung NSC(174;0.136)|all_lung(145;0.17)|Breast(234;0.197)				GCCAGAGGACGAACAGAGAGA	0.597																																																	0								ENSG00000138162						92.0	100.0	97.0					10																	124008163		2203	4300	6503	TACC2	SO:0001583	missense	0			-	HGNC	AF095791	CCDS7625.1, CCDS7626.1, CCDS7627.1, CCDS7628.1	10q26	2008-07-29			ENSG00000138162	ENSG00000138162			11523	protein-coding gene	gene with protein product		605302				14767476	Standard	XM_005269388		Approved	AZU-1	uc001lfv.3	O95359	OTTHUMG00000019181	ENST00000369005.1:c.8398G>A	10.37:g.124008163G>A	ENSP00000358001:p.Glu2800Lys	Somatic	0	37	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	43	32.81	Q4VXL0|Q4VXL3|Q4VXL6|Q4VXL7|Q5U5T7|Q86WG6|Q86WG7|Q8TCK9|Q9BVQ1|Q9NZ41|Q9NZR5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TACC	p.E2800K	ENST00000369005.1	37	c.8398	CCDS7626.1	10	.	.	.	.	.	.	.	.	.	.	G	15.46	2.841609	0.51057	.	.	ENSG00000138162	ENST00000369005;ENST00000513429;ENST00000515273;ENST00000515603;ENST00000334433;ENST00000358010;ENST00000453444;ENST00000340076;ENST00000369001;ENST00000369000;ENST00000360561;ENST00000368999;ENST00000369004;ENST00000260733	T;T;T;T;T;T;T;T;T;T;T;T;T	0.41400	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	5.29	5.29	0.74685	.	0.000000	0.37669	N	0.001984	T	0.54967	0.1891	L	0.41632	1.29	0.30932	N	0.726771	D;D;D;D;P;B;B;B;D	0.76494	0.998;0.958;0.999;0.999;0.949;0.034;0.06;0.106;0.999	D;B;D;D;B;B;B;B;D	0.72625	0.97;0.419;0.978;0.978;0.355;0.008;0.04;0.017;0.978	T	0.50508	-0.8820	10	0.16896	T	0.51	-10.6815	19.2993	0.94136	0.0:0.0:1.0:0.0	.	2727;860;2678;2727;848;878;423;946;2800	E9PBC6;D6RAA5;E7EMZ9;B7ZMJ9;O95359-6;O95359-1;O95359-2;O95359-5;O95359	.;.;.;.;.;.;.;.;TACC2_HUMAN	K	2800;946;2727;2678;2800;946;2727;2713;427;423;848;890;860;878	ENSP00000358001:E2800K;ENSP00000425062:E946K;ENSP00000424467:E2727K;ENSP00000427618:E2678K;ENSP00000334280:E2800K;ENSP00000350701:E946K;ENSP00000395048:E2727K;ENSP00000357997:E427K;ENSP00000357996:E423K;ENSP00000353763:E848K;ENSP00000357995:E890K;ENSP00000422815:E860K;ENSP00000260733:E878K	ENSP00000260733:E878K	E	+	1	0	TACC2	123998153	1.000000	0.71417	0.730000	0.30809	0.096000	0.18686	9.662000	0.98603	2.617000	0.88574	0.655000	0.94253	GAA	-	pfam_TACC		0.597	TACC2-001	KNOWN	basic|CCDS	protein_coding	TACC2	protein_coding	OTTHUMT00000090004.1	G		-		124008163	+1	no_errors	ENST00000334433	ensembl	human	known	74_37	missense	SNP	0.997	A
CTNND2	1501	genome.wustl.edu	37	5	11023048	11023048	+	Silent	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr5:11023048C>T	ENST00000304623.8	-	17	3021	c.2832G>A	c.(2830-2832)ggG>ggA	p.G944G	CTNND2_ENST00000458100.2_Silent_p.G511G|CTNND2_ENST00000503622.1_Silent_p.G607G|CTNND2_ENST00000495388.2_5'UTR|CTNND2_ENST00000511377.1_Silent_p.G853G|CTNND2_ENST00000359640.2_Silent_p.G886G	NM_001332.2	NP_001323.1	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2	944					cell adhesion (GO:0007155)|learning (GO:0007612)|morphogenesis of a branching structure (GO:0001763)|multicellular organismal development (GO:0007275)|regulation of synaptic plasticity (GO:0048167)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(29)|liver(1)|lung(71)|ovary(4)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	136						TGCTGTTGTTCCCTCCTGGAA	0.493																																																	0								ENSG00000169862						213.0	162.0	179.0					5																	11023048		2203	4300	6503	CTNND2	SO:0001819	synonymous_variant	0			-	HGNC	U52828	CCDS3881.1, CCDS75227.1, CCDS75228.1	5p15.2	2013-02-14	2012-08-15		ENSG00000169862	ENSG00000169862		"""Armadillo repeat containing"""	2516	protein-coding gene	gene with protein product	"""neural plakophilin-related arm-repeat protein"""	604275	"""catenin (cadherin-associated protein), delta 2 (neural plakophilin-related arm-repeat protein)"""			9342840, 9223106	Standard	XM_005248251		Approved	NPRAP, GT24	uc003jfa.1	Q9UQB3	OTTHUMG00000090511	ENST00000304623.8:c.2832G>A	5.37:g.11023048C>T		Somatic	0	74	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	99	11.61	B0FTZ7|O00379|O15390|O43206|O43840|Q13589|Q9UM66|Q9UPM3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.G944	ENST00000304623.8	37	c.2832	CCDS3881.1	5																																																																																			-	superfamily_ARM-type_fold		0.493	CTNND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTNND2	protein_coding	OTTHUMT00000206999.1	C	NM_001332	-		11023048	-1	no_errors	ENST00000304623	ensembl	human	known	74_37	silent	SNP	0.971	T
GAS8	2622	genome.wustl.edu	37	16	90113551	90113551	+	IGR	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr16:90113551C>T	ENST00000268699.4	+	0	3185				URAHP_ENST00000517889.1_RNA	NM_001481.2	NP_001472.1	O95995	GAS8_HUMAN	growth arrest-specific 8						cellular protein localization (GO:0034613)|negative regulation of cell proliferation (GO:0008285)|sperm motility (GO:0030317)	Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile cilium (GO:0031514)				endometrium(3)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	14		all_cancers(9;4.44e-13)|Lung NSC(15;1.56e-06)|all_lung(18;2.18e-06)|all_neural(9;0.00118)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.029)		AGCCCTGTGCCCGCCTACCCA	0.662																																																	0								ENSG00000222019																																			URAHP	SO:0001628	intergenic_variant	0			-	HGNC	AF050079	CCDS10992.1, CCDS67101.1, CCDS73932.1	16q24.3	2014-07-18	2003-01-16	2003-01-17	ENSG00000141013	ENSG00000141013			4166	protein-coding gene	gene with protein product		605178	"""growth arrest-specific 11"""	GAS11		9790751	Standard	NM_001481		Approved		uc002fqi.1	O95995	OTTHUMG00000138988		16.37:g.90113551C>T		Somatic	0	79	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	77	17.89	B2RCT1|B7Z4U1|G3V1L5|Q2M234	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000268699.4	37	NULL	CCDS10992.1	16																																																																																			-	-		0.662	GAS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	URAHP	protein_coding	OTTHUMT00000272877.2	C		-		90113551	-1	no_errors	ENST00000521551	ensembl	human	known	74_37	rna	SNP	0.008	T
LRP1B	53353	genome.wustl.edu	37	2	141359181	141359181	+	Missense_Mutation	SNP	T	T	C			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr2:141359181T>C	ENST00000389484.3	-	42	7798	c.6827A>G	c.(6826-6828)tAt>tGt	p.Y2276C		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	2276					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		GGCTCTGTGATAGGCAAGTCC	0.438										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)												0								ENSG00000168702						115.0	101.0	106.0					2																	141359181		2203	4300	6503	LRP1B	SO:0001583	missense	0			-	HGNC	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.6827A>G	2.37:g.141359181T>C	ENSP00000374135:p.Tyr2276Cys	Somatic	0	54	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	55	25.68	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,pfam_EG-like_dom,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.Y2276C	ENST00000389484.3	37	c.6827	CCDS2182.1	2	.	.	.	.	.	.	.	.	.	.	T	23.9	4.475032	0.84640	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.91407	-2.84	5.04	5.04	0.67666	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.64402	U	0.000002	D	0.95364	0.8495	M	0.82193	2.58	0.58432	D	0.999997	D	0.89917	1.0	D	0.85130	0.997	D	0.95953	0.8956	10	0.72032	D	0.01	.	15.0609	0.71951	0.0:0.0:0.0:1.0	.	2276	Q9NZR2	LRP1B_HUMAN	C	2276;2214	ENSP00000374135:Y2276C	ENSP00000374135:Y2276C	Y	-	2	0	LRP1B	141075651	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.949000	0.87791	2.015000	0.59207	0.459000	0.35465	TAT	-	smart_LDLR_classB_rpt		0.438	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1B	protein_coding	OTTHUMT00000254736.2	T	NM_018557	-		141359181	-1	no_errors	ENST00000389484	ensembl	human	known	74_37	missense	SNP	1.000	C
DYM	54808	genome.wustl.edu	37	18	46645158	46645158	+	Nonsense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr18:46645158G>A	ENST00000269445.6	-	15	2159	c.1702C>T	c.(1702-1704)Cga>Tga	p.R568*	DYM_ENST00000442713.2_Nonsense_Mutation_p.R378*|RP11-15F12.3_ENST00000585251.1_RNA	NM_017653.3	NP_060123.3	Q7RTS9	DYM_HUMAN	dymeclin	568					bone development (GO:0060348)|Golgi organization (GO:0007030)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)	enzyme binding (GO:0019899)			NS(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	18						GGATGAGTTCGAAATTGTTCA	0.358																																																	0								ENSG00000141627						155.0	136.0	142.0					18																	46645158		2203	4300	6503	DYM	SO:0001587	stop_gained	0			-	HGNC	AK000078	CCDS11937.1	18q21.1	2008-03-12			ENSG00000141627	ENSG00000141627			21317	protein-coding gene	gene with protein product		607461					Standard	NM_017653		Approved	FLJ20071, DMC, SMC	uc002ldi.1	Q7RTS9	OTTHUMG00000132659	ENST00000269445.6:c.1702C>T	18.37:g.46645158G>A	ENSP00000269445:p.Arg568*	Somatic	0	66	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	61	22.78	A8K5I8|B2RCF9|B4DKI7|Q3ZTS8|Q6P2P5|Q8N2M0|Q9BVE9|Q9NPU7	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Dymeclin,superfamily_ARM-type_fold	p.R568*	ENST00000269445.6	37	c.1702	CCDS11937.1	18	.	.	.	.	.	.	.	.	.	.	G	43	10.379701	0.99394	.	.	ENSG00000141627	ENST00000442713;ENST00000269445	.	.	.	5.61	4.74	0.60224	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-4.3625	14.6584	0.68850	0.07:0.0:0.93:0.0	.	.	.	.	X	378;568	.	ENSP00000269445:R568X	R	-	1	2	DYM	44899156	1.000000	0.71417	0.993000	0.49108	0.960000	0.62799	3.421000	0.52742	1.384000	0.46424	0.650000	0.86243	CGA	-	pfam_Dymeclin,superfamily_ARM-type_fold		0.358	DYM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYM	protein_coding	OTTHUMT00000255912.3	G	NM_017653	-		46645158	-1	no_errors	ENST00000269445	ensembl	human	known	74_37	nonsense	SNP	1.000	A
ACAN	176	genome.wustl.edu	37	15	89382065	89382065	+	Missense_Mutation	SNP	A	A	T	rs373267308		TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr15:89382065A>T	ENST00000561243.1	+	2	242	c.242A>T	c.(241-243)gAg>gTg	p.E81V	ACAN_ENST00000439576.2_Missense_Mutation_p.E81V|ACAN_ENST00000558207.1_Missense_Mutation_p.E81V|ACAN_ENST00000352105.7_Missense_Mutation_p.E81V|ACAN_ENST00000559004.1_Missense_Mutation_p.E81V			P16112	PGCA_HUMAN	aggrecan	81	G1-A.|Ig-like V-type.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|extracellular matrix structural constituent (GO:0005201)|hyaluronic acid binding (GO:0005540)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(15)|liver(2)|lung(40)|ovary(2)|prostate(5)|skin(5)|stomach(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	93	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			GTGTCCAAGGAGAAGGAGGTA	0.612																																																	0								ENSG00000157766						106.0	122.0	117.0					15																	89382065		2107	4230	6337	ACAN	SO:0001583	missense	0			-	HGNC	M55172	CCDS53970.1, CCDS53971.1	15q26.1	2013-05-07	2007-02-16	2007-02-16	ENSG00000157766	ENSG00000157766		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	319	protein-coding gene	gene with protein product	"""aggrecan proteoglycan"""	155760	"""chondroitin sulfate proteoglycan 1"", ""aggrecan 1"""	MSK16, CSPG1, AGC1		1985970	Standard	NM_013227		Approved	CSPGCP	uc010upo.1	P16112	OTTHUMG00000171989	ENST00000561243.1:c.242A>T	15.37:g.89382065A>T	ENSP00000453342:p.Glu81Val	Somatic	0	51	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	29	30.95	Q13650|Q9UCD3|Q9UCP4|Q9UCP5|Q9UDE0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Link,pfam_C-type_lectin,pfam_Ig_V-set,pfam_Sushi_SCR_CCP,pfam_EG-like_dom,superfamily_C-type_lectin_fold,superfamily_Sushi_SCR_CCP,smart_Ig_sub,smart_Ig_V-set_subgr,smart_Link,smart_EG-like_dom,smart_C-type_lectin,smart_Sushi_SCR_CCP,pfscan_EG-like_dom,pfscan_C-type_lectin,pfscan_Link,pfscan_Sushi_SCR_CCP,pfscan_Ig-like_dom,prints_Link	p.E81V	ENST00000561243.1	37	c.242	CCDS53970.1	15	.	.	.	.	.	.	.	.	.	.	A	16.56	3.157871	0.57368	.	.	ENSG00000157766	ENST00000439576;ENST00000352105;ENST00000268134	T;T	0.67171	-0.25;-0.25	5.66	3.39	0.38822	.	.	.	.	.	T	0.68265	0.2982	L	0.42245	1.32	0.31557	N	0.658006	D;D;P	0.58970	0.984;0.984;0.459	P;P;B	0.57679	0.825;0.825;0.222	T	0.69105	-0.5233	9	0.56958	D	0.05	-12.5453	7.7781	0.29049	0.8336:0.0:0.1664:0.0	.	81;81;81	E7ENV9;E7EX88;Q6PID9	.;.;.	V	81	ENSP00000387356:E81V;ENSP00000341615:E81V	ENSP00000268134:E81V	E	+	2	0	ACAN	87183069	0.908000	0.30866	1.000000	0.80357	0.929000	0.56500	2.233000	0.43027	2.171000	0.68590	0.482000	0.46254	GAG	-	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like_dom		0.612	ACAN-006	NOVEL	basic|appris_principal|CCDS	protein_coding	ACAN	protein_coding	OTTHUMT00000416267.2	A	NM_001135	-		89382065	+1	no_errors	ENST00000439576	ensembl	human	known	74_37	missense	SNP	1.000	T
ZNF560	147741	genome.wustl.edu	37	19	9581134	9581134	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr19:9581134C>T	ENST00000301480.4	-	7	595	c.382G>A	c.(382-384)Gac>Aac	p.D128N		NM_152476.2	NP_689689.2	Q96MR9	ZN560_HUMAN	zinc finger protein 560	128	KRAB 2. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(3)|kidney(2)|large_intestine(16)|liver(2)|lung(24)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(4)	65						TGAGCTGGGTCCAGTAAAGTC	0.483																																																	0								ENSG00000198028						161.0	136.0	144.0					19																	9581134		2203	4300	6503	ZNF560	SO:0001583	missense	0			-	HGNC	AK056548	CCDS12214.1	19p13.2	2013-09-20			ENSG00000198028	ENSG00000198028		"""Zinc fingers, C2H2-type"", ""-"""	26484	protein-coding gene	gene with protein product							Standard	NM_152476		Approved	FLJ31986	uc002mlp.1	Q96MR9	OTTHUMG00000180130	ENST00000301480.4:c.382G>A	19.37:g.9581134C>T	ENSP00000301480:p.Asp128Asn	Somatic	0	53	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	55	20.29	Q495S9|Q495T1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.D128N	ENST00000301480.4	37	c.382	CCDS12214.1	19	.	.	.	.	.	.	.	.	.	.	C	10.54	1.379760	0.24944	.	.	ENSG00000198028	ENST00000301480	T	0.02525	4.26	2.09	-0.0934	0.13649	Krueppel-associated box (4);	.	.	.	.	T	0.05273	0.0140	L	0.53671	1.685	0.09310	N	1	D	0.54397	0.966	P	0.52909	0.713	T	0.38845	-0.9642	9	0.29301	T	0.29	.	4.7791	0.13194	0.0:0.4947:0.0:0.5053	.	128	Q96MR9	ZN560_HUMAN	N	128	ENSP00000301480:D128N	ENSP00000301480:D128N	D	-	1	0	ZNF560	9442134	0.006000	0.16342	0.002000	0.10522	0.405000	0.30901	0.033000	0.13754	0.030000	0.15379	0.557000	0.71058	GAC	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box		0.483	ZNF560-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF560	protein_coding	OTTHUMT00000449901.1	C	NM_152476	-		9581134	-1	no_errors	ENST00000301480	ensembl	human	known	74_37	missense	SNP	0.004	T
FOXI1	2299	genome.wustl.edu	37	5	169533045	169533045	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr5:169533045G>A	ENST00000306268.6	+	1	145	c.84G>A	c.(82-84)atG>atA	p.M28I	FOXI1_ENST00000449804.2_Missense_Mutation_p.M28I			Q12951	FOXI1_HUMAN	forkhead box I1	28	Pro-rich.				embryo development (GO:0009790)|inner ear morphogenesis (GO:0042472)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding, bending (GO:0008301)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(7)|lung(16)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35	Renal(175;0.000159)|Lung NSC(126;0.0267)|all_lung(126;0.04)	Medulloblastoma(196;0.0109)|all_neural(177;0.0298)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CCCCCGAGATGAACCTCTACT	0.697									Pendred syndrome																																								0								ENSG00000168269						26.0	29.0	28.0					5																	169533045		2203	4299	6502	FOXI1	SO:0001583	missense	0	Familial Cancer Database	Goiter-Deafness syndrome	-	HGNC	BC029778	CCDS4372.1, CCDS47337.1	5q34	2008-02-05			ENSG00000168269	ENSG00000168269		"""Forkhead boxes"""	3815	protein-coding gene	gene with protein product		601093		FKHL10		7957066, 8825632	Standard	NM_144769		Approved	FREAC6	uc003mai.4	Q12951	OTTHUMG00000130436	ENST00000306268.6:c.84G>A	5.37:g.169533045G>A	ENSP00000304286:p.Met28Ile	Somatic	0	82	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	93	8.82	Q14518|Q66SR7|Q8N6L8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.M28I	ENST00000306268.6	37	c.84	CCDS4372.1	5	.	.	.	.	.	.	.	.	.	.	G	15.53	2.859483	0.51376	.	.	ENSG00000168269	ENST00000306268;ENST00000449804	D;D	0.94723	-3.39;-3.5	4.5	3.61	0.41365	.	0.180841	0.51477	D	0.000094	D	0.93802	0.8018	M	0.82716	2.605	0.51233	D	0.999914	B;B	0.30914	0.3;0.199	B;B	0.26094	0.066;0.03	D	0.92344	0.5884	10	0.72032	D	0.01	.	14.2615	0.66088	0.0:0.1504:0.8496:0.0	.	28;28	Q12951-2;Q12951	.;FOXI1_HUMAN	I	28	ENSP00000304286:M28I;ENSP00000415483:M28I	ENSP00000304286:M28I	M	+	3	0	FOXI1	169465623	1.000000	0.71417	1.000000	0.80357	0.840000	0.47671	4.484000	0.60271	0.853000	0.35312	0.491000	0.48974	ATG	-	NULL		0.697	FOXI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXI1	protein_coding	OTTHUMT00000252827.2	G	NM_144769, NM_012188	-		169533045	+1	no_errors	ENST00000306268	ensembl	human	known	74_37	missense	SNP	1.000	A
CCDC144A	9720	genome.wustl.edu	37	17	16593774	16593774	+	Silent	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr17:16593774C>T	ENST00000360524.8	+	1	136	c.60C>T	c.(58-60)gtC>gtT	p.V20V	CCDC144A_ENST00000340621.5_Silent_p.V20V|CCDC144A_ENST00000456009.1_Silent_p.V20V|RP11-219A15.1_ENST00000448331.3_Silent_p.V20V|CCDC144A_ENST00000436374.1_3'UTR|RNU6-405P_ENST00000516637.1_RNA|CCDC144A_ENST00000443444.2_Silent_p.V20V|CCDC144A_ENST00000399273.1_Silent_p.V20V	NM_014695.1	NP_055510.1	A2RUR9	C144A_HUMAN	coiled-coil domain containing 144A	20																	AGCCGGCAGTCTACGCCACGA	0.667																																																	0								ENSG00000170160						23.0	26.0	25.0					17																	16593774		2202	4300	6502	CCDC144A	SO:0001819	synonymous_variant	0			-	HGNC	BC133019	CCDS45621.1	17p11.2	2008-10-23			ENSG00000170160	ENSG00000170160			29072	protein-coding gene	gene with protein product						9628581, 11997339	Standard	NM_014695		Approved	KIAA0565, FLJ43983	uc002gqk.1	A2RUR9	OTTHUMG00000059178	ENST00000360524.8:c.60C>T	17.37:g.16593774C>T		Somatic	0	91	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	109	10.66	O60311|Q6ZU57	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF3496	p.V20	ENST00000360524.8	37	c.60	CCDS45621.1	17																																																																																			-	NULL		0.667	CCDC144A-013	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCDC144A	protein_coding	OTTHUMT00000444093.1	C		-		16593774	+1	no_errors	ENST00000360524	ensembl	human	known	74_37	silent	SNP	0.006	T
KIT	3815	genome.wustl.edu	37	4	55589796	55589796	+	Silent	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr4:55589796C>T	ENST00000288135.5	+	8	1375	c.1278C>T	c.(1276-1278)ctC>ctT	p.L426L		NM_000222.2|NM_001093772.1	NP_000213.1|NP_001087241.1	P10721	KIT_HUMAN	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	426	Ig-like C2-type 5.				actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cellular response to thyroid hormone stimulus (GO:0097067)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell cytokine production (GO:0002371)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|digestive tract development (GO:0048565)|ectopic germ cell programmed cell death (GO:0035234)|embryonic hemopoiesis (GO:0035162)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation (GO:0050673)|erythrocyte differentiation (GO:0030218)|erythropoietin-mediated signaling pathway (GO:0038162)|Fc receptor signaling pathway (GO:0038093)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell migration (GO:0008354)|glycosphingolipid metabolic process (GO:0006687)|hemopoiesis (GO:0030097)|immature B cell differentiation (GO:0002327)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|Kit signaling pathway (GO:0038109)|lamellipodium assembly (GO:0030032)|lymphoid progenitor cell differentiation (GO:0002320)|male gonad development (GO:0008584)|mast cell chemotaxis (GO:0002551)|mast cell cytokine production (GO:0032762)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|mast cell proliferation (GO:0070662)|megakaryocyte development (GO:0035855)|melanocyte adhesion (GO:0097326)|melanocyte differentiation (GO:0030318)|melanocyte migration (GO:0097324)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of programmed cell death (GO:0043069)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|pigmentation (GO:0043473)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of developmental pigmentation (GO:0048070)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)|T cell differentiation (GO:0030217)|visual learning (GO:0008542)	acrosomal vesicle (GO:0001669)|cell-cell junction (GO:0005911)|cytoplasmic side of plasma membrane (GO:0009898)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|stem cell factor receptor activity (GO:0005020)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(8)|autonomic_ganglia(1)|bone(21)|breast(2)|central_nervous_system(4)|endometrium(10)|eye(12)|genital_tract(18)|haematopoietic_and_lymphoid_tissue(1820)|kidney(17)|large_intestine(17)|lung(27)|ovary(23)|pancreas(4)|prostate(1)|salivary_gland(15)|skin(228)|soft_tissue(4117)|stomach(3)|testis(55)|thymus(7)|upper_aerodigestive_tract(1)	6411	all_cancers(7;0.00453)|all_lung(4;0.000565)|Lung NSC(11;0.00129)|all_epithelial(27;0.0104)|Glioma(25;0.08)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(32;0.000276)|Epithelial(7;0.209)	Colorectal(1;0.0276)|COAD - Colon adenocarcinoma(1;0.171)	Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	ATGGCATGCTCCAATGTGTGG	0.448		1	"""Mis, O"""		"""GIST, AML, TGCT, mastocytosis, mucosal melanoma"""	"""GIST, epithelioma"""	Piebald trait		Piebaldism;Mast Cell disease, Familial Clustering of;Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Gastrointestinal Stromal Tumors																														yes	Dom	yes	Familial gastrointestinal stromal tumour	4	4q12	3815	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	yes	"""L, M, O, E"""	0								ENSG00000157404						109.0	97.0	101.0					4																	55589796		2203	4300	6503	KIT	SO:0001819	synonymous_variant	0	Familial Cancer Database	Piebald trait;incl.: Familial Cutaneous Mastocytosis (Urticaria Pigmentosum);Sporadic Multiple GIST;Familial GIST, incl. Multiple Familial Gastrointestinal Autonomic Nerve Tumors (GANT)	-	HGNC	S67773	CCDS3496.1, CCDS47058.1	4q12	2014-09-17			ENSG00000157404	ENSG00000157404		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6342	protein-coding gene	gene with protein product		164920	"""piebald trait"""	PBT		9027509	Standard	NM_001093772		Approved	CD117, SCFR, C-Kit	uc010igr.3	P10721	OTTHUMG00000128713	ENST00000288135.5:c.1278C>T	4.37:g.55589796C>T		Somatic	0	95	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	102	16.39	B5A956|D5LXN2|D5M931|F5H8F8|Q6IQ28|Q99662|Q9UM99	Silent	SNP	NA	NA	NA	NA	NA	NA	pirsf_Tyr_kinase_CSF1/PDGF_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.L426	ENST00000288135.5	37	c.1278	CCDS3496.1	4																																																																																			-	pirsf_Tyr_kinase_CSF1/PDGF_rcpt		0.448	KIT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIT	protein_coding	OTTHUMT00000250618.1	C		-		55589796	+1	no_errors	ENST00000288135	ensembl	human	known	74_37	silent	SNP	0.654	T
LPHN2	23266	genome.wustl.edu	37	1	82372860	82372860	+	Nonsense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr1:82372860C>T	ENST00000370728.1	+	6	877	c.232C>T	c.(232-234)Cag>Tag	p.Q78*	LPHN2_ENST00000271029.4_Nonsense_Mutation_p.Q78*|LPHN2_ENST00000370717.2_Nonsense_Mutation_p.Q78*|LPHN2_ENST00000335786.5_Nonsense_Mutation_p.Q78*|LPHN2_ENST00000370727.1_Nonsense_Mutation_p.Q78*|LPHN2_ENST00000370725.1_Nonsense_Mutation_p.Q78*|LPHN2_ENST00000370715.1_Nonsense_Mutation_p.Q78*|LPHN2_ENST00000370713.1_Nonsense_Mutation_p.Q78*|LPHN2_ENST00000370723.1_Nonsense_Mutation_p.Q78*|LPHN2_ENST00000394879.1_Nonsense_Mutation_p.Q78*|LPHN2_ENST00000469377.2_3'UTR|LPHN2_ENST00000370730.1_Nonsense_Mutation_p.Q78*|LPHN2_ENST00000319517.6_Nonsense_Mutation_p.Q78*|LPHN2_ENST00000359929.3_Nonsense_Mutation_p.Q78*|LPHN2_ENST00000370721.1_Nonsense_Mutation_p.Q78*			O95490	LPHN2_HUMAN	latrophilin 2	78	SUEL-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00260}.				G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)|latrotoxin receptor activity (GO:0016524)			NS(3)|breast(6)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(37)|ovary(3)|pancreas(1)|prostate(3)|skin(22)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	119				all cancers(265;0.00142)|Epithelial(280;0.00829)|OV - Ovarian serous cystadenocarcinoma(397;0.077)|STAD - Stomach adenocarcinoma(256;0.248)		TGACCCATTTCAGATGGAGAA	0.423																																																	0								ENSG00000117114						171.0	157.0	162.0					1																	82372860		2203	4300	6503	LPHN2	SO:0001587	stop_gained	0			-	HGNC	AJ131581	CCDS689.1, CCDS72811.1	1p31.1	2014-08-08	2003-03-17	2003-05-02	ENSG00000117114	ENSG00000117114		"""-"", ""GPCR / Class B : Orphans"""	18582	protein-coding gene	gene with protein product		607018	"""latrophilin 1"""	LPHH1		10760572	Standard	XR_248786		Approved	KIAA0786, LEC1	uc001diu.3	O95490	OTTHUMG00000009844	ENST00000370728.1:c.232C>T	1.37:g.82372860C>T	ENSP00000359763:p.Gln78*	Somatic	0	44	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	66	12.99	A5XEI2|B1ALT8|B1ALT9|B1ALU0|B1ALU2|B1ALU4|B1ALU5|B1ALU6|O94882|Q5VX76|Q9UKY5|Q9UKY6	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_2_latrophilin_rcpt_C,pfam_Olfac-like,pfam_DUF3497,pfam_GPCR_2_secretin-like,pfam_Lectin_gal-bd_dom,pfam_GPS_dom,pfam_GPCR_2_extracellular_dom,smart_Olfac-like,smart_GPCR_2_extracellular_dom,smart_GPS_dom,prints_GPCR_2_latrophilin,prints_GPCR_2_secretin-like,pfscan_GPS_dom,pfscan_Lectin_gal-bd_dom,pfscan_Olfac-like,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like	p.Q78*	ENST00000370728.1	37	c.232		1	.	.	.	.	.	.	.	.	.	.	C	42	9.791055	0.99264	.	.	ENSG00000117114	ENST00000370721;ENST00000370728;ENST00000370730;ENST00000370727;ENST00000370725;ENST00000370723;ENST00000359929;ENST00000370715;ENST00000370713;ENST00000319517;ENST00000370717;ENST00000394879;ENST00000271029;ENST00000335786	.	.	.	5.1	5.1	0.69264	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.41790	T	0.15	.	18.8804	0.92353	0.0:1.0:0.0:0.0	.	.	.	.	X	78	.	ENSP00000271029:Q78X	Q	+	1	0	LPHN2	82145448	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.794000	0.69067	2.527000	0.85204	0.557000	0.71058	CAG	-	pfam_Lectin_gal-bd_dom,pfscan_Lectin_gal-bd_dom		0.423	LPHN2-007	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	LPHN2	protein_coding	OTTHUMT00000027188.1	C	NM_012302	-		82372860	+1	no_errors	ENST00000370717	ensembl	human	known	74_37	nonsense	SNP	1.000	T
ADH6	130	genome.wustl.edu	37	4	100129805	100129805	+	Intron	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr4:100129805C>T	ENST00000237653.7	-	6	1213				RP11-696N14.1_ENST00000506454.1_RNA|ADH6_ENST00000504257.1_5'UTR|ADH6_ENST00000407820.2_Intron|RP11-696N14.1_ENST00000506160.1_RNA|ADH6_ENST00000394897.1_Intron|ADH6_ENST00000394899.2_Intron|RP11-696N14.1_ENST00000500358.2_RNA	NM_000672.3	NP_000663	P28332	ADH6_HUMAN	alcohol dehydrogenase 6 (class V)						ethanol oxidation (GO:0006069)|response to ethanol (GO:0045471)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	alcohol dehydrogenase (NAD) activity (GO:0004022)|alcohol dehydrogenase activity, zinc-dependent (GO:0004024)|ethanol binding (GO:0035276)|zinc ion binding (GO:0008270)			breast(1)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|skin(2)	20				OV - Ovarian serous cystadenocarcinoma(123;3.58e-08)	Abacavir(DB01048)	TGGTAATTTTCACTCCAGAGG	0.363																																																	0								ENSG00000172955						90.0	97.0	95.0					4																	100129805		2203	4300	6503	ADH6	SO:0001627	intron_variant	0			-	HGNC	AK092768	CCDS3647.1, CCDS43255.1	4q23	2008-02-05			ENSG00000172955	ENSG00000172955	1.1.1.1	"""Alcohol dehydrogenases"""	255	protein-coding gene	gene with protein product		103735				1881901	Standard	NM_000672		Approved	ADH-5	uc003huo.2	P28332	OTTHUMG00000131024	ENST00000237653.7:c.828+19G>A	4.37:g.100129805C>T		Somatic	0	40	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	52	18.75	B3KS45|Q58F53	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000237653.7	37	NULL	CCDS3647.1	4																																																																																			-	-		0.363	ADH6-003	KNOWN	basic|CCDS	protein_coding	ADH6	protein_coding	OTTHUMT00000253665.1	C	NM_000672	-		100129805	-1	no_errors	ENST00000504257	ensembl	human	putative	74_37	rna	SNP	0.032	T
SPATA31A6	389730	genome.wustl.edu	37	9	43626627	43626627	+	Missense_Mutation	SNP	C	C	T	rs559633705	byFrequency	TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr9:43626627C>T	ENST00000332857.6	-	4	2088	c.2060G>A	c.(2059-2061)cGg>cAg	p.R687Q	SPATA31A6_ENST00000496386.1_5'Flank	NM_001145196.1	NP_001138668.1	Q5VVP1	S31A6_HUMAN	SPATA31 subfamily A, member 6	687					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											CAGAACCTTCCGTGGGAAGCT	0.512													C|||	18	0.00359425	0.0	0.0	5008	,	,		13063	0.005		0.001	False		,,,				2504	0.0123																0								ENSG00000185775						1.0	1.0	1.0					9																	43626627		15	131	146	SPATA31A6	SO:0001583	missense	0			-	HGNC		CCDS75837.1	9p11.2	2012-10-15	2012-10-12	2012-10-12	ENSG00000185775	ENSG00000185775			32006	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member A6"""	FAM75A6		20850414	Standard	NM_001145196		Approved	OTTHUMG00000013224	uc011lrb.2	Q5VVP1	OTTHUMG00000013224	ENST00000332857.6:c.2060G>A	9.37:g.43626627C>T	ENSP00000329825:p.Arg687Gln	Somatic	0	144	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	33	186	15.07		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.R687Q	ENST00000332857.6	37	c.2060	CCDS47973.1	9	.	.	.	.	.	.	.	.	.	.	C	3.858	-0.030503	0.07543	.	.	ENSG00000185775	ENST00000332857	T	0.06371	3.31	2.36	-4.71	0.03279	.	1.927400	0.02603	N	0.101203	T	0.02571	0.0078	N	0.08118	0	0.09310	N	1	B	0.27229	0.172	B	0.15484	0.013	T	0.36744	-0.9735	10	0.13108	T	0.6	3.304	3.6235	0.08104	0.2763:0.3711:0.0:0.3527	.	687	Q5VVP1	F75A6_HUMAN	Q	687	ENSP00000329825:R687Q	ENSP00000329825:R687Q	R	-	2	0	FAM75A6	43566623	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.133000	0.10451	-1.173000	0.02758	-0.932000	0.02703	CGG	-	NULL		0.512	SPATA31A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA31A6	protein_coding	OTTHUMT00000036987.1	C	NM_001145196	-		43626627	-1	no_errors	ENST00000332857	ensembl	human	known	74_37	missense	SNP	0.000	T
KMT2A	4297	genome.wustl.edu	37	11	118348798	118348798	+	Nonsense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr11:118348798C>T	ENST00000389506.5	+	5	3451	c.3451C>T	c.(3451-3453)Cga>Tga	p.R1151*	KMT2A_ENST00000534358.1_Nonsense_Mutation_p.R1151*|KMT2A_ENST00000354520.4_Nonsense_Mutation_p.R1151*			Q03164	KMT2A_HUMAN	lysine (K)-specific methyltransferase 2A	1151					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|DNA methylation (GO:0006306)|embryonic hemopoiesis (GO:0035162)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cellular response to drug (GO:2001040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transporter activity (GO:0032411)|protein complex assembly (GO:0006461)|regulation of histone H3-K4 methylation (GO:0051569)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|identical protein binding (GO:0042802)|lysine-acetylated histone binding (GO:0070577)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)										GAAAGGACGTCGATCGAGGCG	0.512																																																	0								ENSG00000118058						182.0	181.0	181.0					11																	118348798		2200	4296	6496	KMT2A	SO:0001587	stop_gained	0			-	HGNC	L04284	CCDS31686.1, CCDS55791.1	11q23	2014-09-17	2013-05-09	2013-05-09	ENSG00000118058	ENSG00000118058		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7132	protein-coding gene	gene with protein product		159555	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog)"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)"""	MLL		1720549	Standard	NM_001197104		Approved	TRX1, HRX, ALL-1, HTRX1, CXXC7, MLL1A		Q03164	OTTHUMG00000166337	ENST00000389506.5:c.3451C>T	11.37:g.118348798C>T	ENSP00000374157:p.Arg1151*	Somatic	0	56	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	48	14.29	E9PQG7|Q13743|Q13744|Q14845|Q16364|Q59FF2|Q6UBD1|Q9HBJ3|Q9UD94|Q9UMA3	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SET_dom,pfam_FYrich_C,pfam_Znf_PHD-finger,pfam_FYrich_N,pfam_Znf_CXXC,superfamily_Znf_FYVE_PHD,superfamily_Bromodomain,smart_Znf_PHD,smart_Bromodomain,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pirsf_MeTrfase_trithorax,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_CXXC,pfscan_Bromodomain	p.R1151*	ENST00000389506.5	37	c.3451	CCDS31686.1	11	.	.	.	.	.	.	.	.	.	.	C	40	8.126688	0.98667	.	.	ENSG00000118058	ENST00000534358;ENST00000531904;ENST00000389506;ENST00000354520;ENST00000359313;ENST00000533790	.	.	.	6.06	5.14	0.70334	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.3208	0.66484	0.2704:0.7296:0.0:0.0	.	.	.	.	X	1151;1184;1151;1151;61;229	.	ENSP00000346516:R1151X	R	+	1	2	MLL	117854008	0.998000	0.40836	0.993000	0.49108	0.963000	0.63663	2.392000	0.44433	1.550000	0.49438	0.655000	0.94253	CGA	-	pfam_Znf_CXXC,pirsf_MeTrfase_trithorax,pfscan_Znf_CXXC		0.512	KMT2A-015	KNOWN	basic|appris_candidate|CCDS	protein_coding	KMT2A	protein_coding	OTTHUMT00000399085.2	C	NM_005933	-		118348798	+1	no_errors	ENST00000389506	ensembl	human	known	74_37	nonsense	SNP	1.000	T
DSC3	1825	genome.wustl.edu	37	18	28588263	28588263	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr18:28588263G>A	ENST00000360428.4	-	10	1572	c.1492C>T	c.(1492-1494)Ccc>Tcc	p.P498S	DSC3_ENST00000434452.1_Missense_Mutation_p.P498S	NM_001941.3	NP_001932.2	Q14574	DSC3_HUMAN	desmocollin 3	498	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|protein stabilization (GO:0050821)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|desmosome (GO:0030057)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|gamma-catenin binding (GO:0045295)			endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(6)|lung(29)|ovary(2)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	56			OV - Ovarian serous cystadenocarcinoma(10;0.125)			CTATTTTCGGGGTCATATGCC	0.368																																																	0								ENSG00000134762						81.0	73.0	76.0					18																	28588263		2203	4300	6503	DSC3	SO:0001583	missense	0			-	HGNC	X83929	CCDS32810.1	18q12.1	2014-07-30			ENSG00000134762	ENSG00000134762		"""Cadherins / Major cadherins"""	3037	protein-coding gene	gene with protein product		600271		DSC4		7774948, 8486729	Standard	NM_001941		Approved	CDHF3, DSC, DSC1, DSC2	uc002kwj.4	Q14574	OTTHUMG00000179622	ENST00000360428.4:c.1492C>T	18.37:g.28588263G>A	ENSP00000353608:p.Pro498Ser	Somatic	0	54	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	56	23.29	A6NN35|Q14200|Q9HAZ9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,pfam_Cadherin_pro_dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin,prints_Cadherin/Desmocollin,prints_Desmosomal_cadherin	p.P498S	ENST00000360428.4	37	c.1492	CCDS32810.1	18	.	.	.	.	.	.	.	.	.	.	G	16.97	3.268671	0.59540	.	.	ENSG00000134762	ENST00000360428;ENST00000434452	T;T	0.61980	0.06;0.06	5.34	3.42	0.39159	Cadherin (4);Cadherin-like (1);	0.256960	0.20591	N	0.089355	T	0.80188	0.4577	M	0.87097	2.86	0.80722	D	1	D;D	0.67145	0.977;0.996	D;D	0.67900	0.936;0.954	D	0.84908	0.0846	10	0.87932	D	0	.	14.7792	0.69754	0.0:0.0:0.7397:0.2603	.	498;498	Q14574;Q14574-2	DSC3_HUMAN;.	S	498	ENSP00000353608:P498S;ENSP00000392068:P498S	ENSP00000353608:P498S	P	-	1	0	DSC3	26842261	1.000000	0.71417	1.000000	0.80357	0.481000	0.33189	2.954000	0.49113	1.610000	0.50200	0.650000	0.86243	CCC	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.368	DSC3-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_candidate_longest|CCDS	protein_coding	DSC3	protein_coding	OTTHUMT00000447384.1	G	NM_001941, NM_024423	-		28588263	-1	no_errors	ENST00000360428	ensembl	human	known	74_37	missense	SNP	1.000	A
SH2D4B	387694	genome.wustl.edu	37	10	82298269	82298269	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr10:82298269G>A	ENST00000470604.2	+	1	182	c.182G>A	c.(181-183)cGa>cAa	p.R61Q	SH2D4B_ENST00000313455.4_5'Flank|RP11-137H2.4_ENST00000417559.1_RNA|SH2D4B_ENST00000339284.2_Missense_Mutation_p.R61Q			Q5SQS7	SH24B_HUMAN	SH2 domain containing 4B	61										endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(6)	13			Colorectal(32;0.229)			AAGACCAAGCGAGGTACGTGG	0.607																																																	0								ENSG00000178217						21.0	24.0	23.0					10																	82298269		2147	4232	6379	SH2D4B	SO:0001583	missense	0			-	HGNC		CCDS7370.1, CCDS44449.1	10q23.1	2013-02-14			ENSG00000178217	ENSG00000178217		"""SH2 domain containing"""	31440	protein-coding gene	gene with protein product							Standard	NM_207372		Approved		uc001kck.1	Q5SQS7	OTTHUMG00000018617	ENST00000470604.2:c.182G>A	10.37:g.82298269G>A	ENSP00000417953:p.Arg61Gln	Somatic	0	45	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	67	14.10	Q5SQS5|Q6ZVW9|Q6ZVZ3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SH2,smart_SH2,pfscan_SH2,prints_SH2	p.R61Q	ENST00000470604.2	37	c.182		10	.	.	.	.	.	.	.	.	.	.	G	12.53	1.967001	0.34754	.	.	ENSG00000178217	ENST00000339284;ENST00000372147;ENST00000470604	T;T	0.12672	2.66;2.75	5.19	3.31	0.37934	.	0.502662	0.18827	N	0.130089	T	0.09069	0.0224	L	0.27053	0.805	0.80722	D	1	B	0.15719	0.014	B	0.08055	0.003	T	0.14392	-1.0474	10	0.35671	T	0.21	-3.4473	7.5946	0.28041	0.1921:0.0:0.8079:0.0	.	61	Q5SQS7-2	.	Q	61	ENSP00000345295:R61Q;ENSP00000417953:R61Q	ENSP00000345295:R61Q	R	+	2	0	SH2D4B	82288249	1.000000	0.71417	1.000000	0.80357	0.400000	0.30750	0.734000	0.26101	1.311000	0.45024	0.557000	0.71058	CGA	-	NULL		0.607	SH2D4B-202	KNOWN	basic|appris_principal	protein_coding	SH2D4B	protein_coding		G	XM_351984	-		82298269	+1	no_errors	ENST00000470604	ensembl	human	known	74_37	missense	SNP	1.000	A
DOCK2	1794	genome.wustl.edu	37	5	169508871	169508871	+	Silent	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr5:169508871C>T	ENST00000256935.8	+	51	5393	c.5313C>T	c.(5311-5313)atC>atT	p.I1771I	DOCK2_ENST00000520908.1_Silent_p.I1263I|DOCK2_ENST00000523351.1_3'UTR|DOCK2_ENST00000540750.1_Silent_p.I832I	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	1771					actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)			NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TGGCAGGCATCCCTGGGTTGG	0.602																																																	0								ENSG00000134516						72.0	63.0	66.0					5																	169508871		2203	4300	6503	DOCK2	SO:0001819	synonymous_variant	0			-	HGNC	BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.5313C>T	5.37:g.169508871C>T		Somatic	0	79	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	64	17.95	Q2M3I0|Q96AK7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_DOCK_C,pfam_SH3_2,superfamily_SH3_domain,superfamily_Cyt_c-like_dom,superfamily_ARM-type_fold,superfamily_Ferritin-like_SF,smart_SH3_domain,pfscan_SH3_domain	p.I1771	ENST00000256935.8	37	c.5313	CCDS4371.1	5																																																																																			-	NULL		0.602	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK2	protein_coding	OTTHUMT00000252828.2	C	NM_004946	-		169508871	+1	no_errors	ENST00000256935	ensembl	human	known	74_37	silent	SNP	0.000	T
CHRDL2	25884	genome.wustl.edu	37	11	74413853	74413853	+	Nonsense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr11:74413853C>T	ENST00000376332.3	-	9	1602	c.1106G>A	c.(1105-1107)tGg>tAg	p.W369*	CHRDL2_ENST00000263671.5_Nonsense_Mutation_p.W369*|CHRDL2_ENST00000534159.1_5'UTR	NM_001278473.1	NP_001265402.1	Q6WN34	CRDL2_HUMAN	chordin-like 2	369					cartilage development (GO:0051216)|cell differentiation (GO:0030154)|ossification (GO:0001503)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)				endometrium(1)|kidney(1)|large_intestine(6)|lung(4)|prostate(1)|skin(2)	15	Hepatocellular(1;0.098)					TACCAGCTTCCAGAGGTAGAT	0.637											OREG0021223	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000054938						103.0	100.0	101.0					11																	74413853		2200	4293	6493	CHRDL2	SO:0001587	stop_gained	0			-	HGNC	AL110168	CCDS8234.1, CCDS60893.1	11q13.4	2013-09-20			ENSG00000054938	ENSG00000054938			24168	protein-coding gene	gene with protein product		613127				12853144, 12975309	Standard	NM_015424		Approved	BNF1	uc001ovh.3	Q6WN34	OTTHUMG00000165623	ENST00000376332.3:c.1106G>A	11.37:g.74413853C>T	ENSP00000365510:p.Trp369*	Somatic	0	41	0.00	1152	0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	55	14.06	A5PKU9|Q6WN30|Q6WN31|Q6WN32|Q7Z5J3	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_VWF_C,smart_VWF_C,pfscan_VWF_C	p.W369*	ENST00000376332.3	37	c.1106		11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	38|38	6.841818|6.841818	0.97877|0.97877	.|.	.|.	ENSG00000054938|ENSG00000054938	ENST00000525413|ENST00000263671;ENST00000376332;ENST00000376323;ENST00000393519;ENST00000528789	.|.	.|.	.|.	5.09|5.09	5.09|5.09	0.68999|0.68999	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|.	0.35278|.	0.0926|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.31475|.	-0.9942|.	3|.	.|0.02654	.|T	.|1	-13.294|-13.294	14.339|14.339	0.66611|0.66611	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	R|X	169|369;369;255;253;304	.|.	.|ENSP00000263671:W369X	G|W	-|-	1|2	0|0	CHRDL2|CHRDL2	74091501|74091501	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.987000|0.987000	0.75469|0.75469	4.707000|4.707000	0.61852|0.61852	2.517000|2.517000	0.84864|0.84864	0.561000|0.561000	0.74099|0.74099	GGA|TGG	-	NULL		0.637	CHRDL2-002	KNOWN	basic	protein_coding	CHRDL2	protein_coding	OTTHUMT00000385391.1	C		-		74413853	-1	no_errors	ENST00000263671	ensembl	human	known	74_37	nonsense	SNP	1.000	T
EPHA2	1969	genome.wustl.edu	37	1	16456750	16456750	+	Silent	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr1:16456750G>A	ENST00000358432.5	-	15	2794	c.2640C>T	c.(2638-2640)tcC>tcT	p.S880S		NM_004431.3	NP_004422.2	P29317	EPHA2_HUMAN	EPH receptor A2	880	Mediates interaction with ARHGEF16 and ELMO2.				activation of Rac GTPase activity (GO:0032863)|angiogenesis (GO:0001525)|axial mesoderm formation (GO:0048320)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell migration (GO:0016477)|ephrin receptor signaling pathway (GO:0048013)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|keratinocyte differentiation (GO:0030216)|lens fiber cell morphogenesis (GO:0070309)|mammary gland epithelial cell proliferation (GO:0033598)|multicellular organismal development (GO:0007275)|negative regulation of protein kinase B signaling (GO:0051898)|neural tube development (GO:0021915)|neuron differentiation (GO:0030182)|notochord cell development (GO:0060035)|notochord formation (GO:0014028)|osteoblast differentiation (GO:0001649)|osteoclast differentiation (GO:0030316)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|post-anal tail morphogenesis (GO:0036342)|protein kinase B signaling (GO:0043491)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of lamellipodium assembly (GO:0010591)|response to growth factor (GO:0070848)|skeletal system development (GO:0001501)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cell projection (GO:0042995)|cell surface (GO:0009986)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|leading edge membrane (GO:0031256)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(3)|cervix(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|pancreas(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	42		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|Colorectal(212;3.63e-07)|COAD - Colon adenocarcinoma(227;2.25e-05)|BRCA - Breast invasive adenocarcinoma(304;9.58e-05)|Kidney(64;0.000175)|KIRC - Kidney renal clear cell carcinoma(64;0.00261)|STAD - Stomach adenocarcinoma(313;0.00669)|READ - Rectum adenocarcinoma(331;0.0649)	Dasatinib(DB01254)|Regorafenib(DB08896)	GGGTCTTGAGGGAGTCAGGGG	0.572																																																	0								ENSG00000142627						98.0	93.0	95.0					1																	16456750		2203	4300	6503	EPHA2	SO:0001819	synonymous_variant	0			-	HGNC	BC037166	CCDS169.1	1p36	2013-02-11	2004-10-28		ENSG00000142627	ENSG00000142627	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3386	protein-coding gene	gene with protein product		176946	"""EphA2"""	ECK		9119409	Standard	NM_004431		Approved		uc001aya.2	P29317	OTTHUMG00000009527	ENST00000358432.5:c.2640C>T	1.37:g.16456750G>A		Somatic	0	86	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	91	11.65	B5A968|Q8N3Z2	Silent	SNP	NA	NA	NA	NA	NA	NA	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_SAM_type1,pfam_SAM_2,pfam_Interferon_alpha/beta_rcpt_bsu,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt_N_dom,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_dom	p.S880	ENST00000358432.5	37	c.2640	CCDS169.1	1																																																																																			-	pirsf_Tyr_kinase_ephrin_rcpt,superfamily_Kinase-like_dom		0.572	EPHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHA2	protein_coding	OTTHUMT00000026322.1	G	NM_004431	-		16456750	-1	no_errors	ENST00000358432	ensembl	human	known	74_37	silent	SNP	1.000	A
SNHG14	104472715	genome.wustl.edu	37	15	25332918	25332918	+	RNA	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr15:25332918G>A	ENST00000546682.1	+	0	586				SNORD116-18_ENST00000383961.1_RNA|SNORD116-20_ENST00000384507.1_lincRNA|SNHG14_ENST00000549804.2_RNA|SNHG14_ENST00000384430.1_RNA|SNHG14_ENST00000553108.1_RNA|SNORD116-19_ENST00000384729.1_RNA|SNORD116-20_ENST00000384529.1_lincRNA	NR_003361.1				small nucleolar RNA host gene 14 (non-protein coding)																		TACTCCAACAGGGGCTAGACA	0.453																																																	0								ENSG00000261069						188.0	165.0	172.0					15																	25332918		876	1991	2867	SNORD116-20			0			-	HGNC			15q11.2	2014-01-17	2011-08-22	2011-08-22	ENSG00000224078	ENSG00000224078		"""Long non-coding RNAs"""	37462	non-coding RNA	RNA, long non-coding	"""non-protein coding RNA 214"""		"""UBE3A antisense RNA 1 (non-protein coding)"""	UBE3A-AS1		23771028	Standard			Approved	NCRNA00214, UBE3A-AS			OTTHUMG00000056661		15.37:g.25332918G>A		Somatic	0	59	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	62	17.95		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000546682.1	37	NULL		15																																																																																			-	-		0.453	SNHG14-022	KNOWN	basic	antisense	SNORD116-20	processed_transcript	OTTHUMT00000408281.1	G		-		25332918	+1	no_errors	ENST00000567527	ensembl	human	known	74_37	rna	SNP	0.001	A
NLRP2	55655	genome.wustl.edu	37	19	55501975	55501975	+	Silent	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr19:55501975G>A	ENST00000543010.1	+	10	2786	c.2643G>A	c.(2641-2643)ggG>ggA	p.G881G	NLRP2_ENST00000537859.1_Silent_p.G859G|NLRP2_ENST00000391721.4_Silent_p.G857G|NLRP2_ENST00000263437.6_Silent_p.G878G|NLRP2_ENST00000538819.1_Silent_p.G857G|NLRP2_ENST00000448584.2_Silent_p.G881G|NLRP2_ENST00000427260.2_Silent_p.G858G|NLRP2_ENST00000339757.7_Silent_p.G859G	NM_001174081.1	NP_001167552.1	Q9NX02	NALP2_HUMAN	NLR family, pyrin domain containing 2	881					positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|Pyrin domain binding (GO:0032090)			large_intestine(4)|liver(1)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)	11			BRCA - Breast invasive adenocarcinoma(297;0.163)	GBM - Glioblastoma multiforme(193;0.028)		ACCCCATTGGGAATACAGGGG	0.542																																																	0								ENSG00000022556						135.0	133.0	133.0					19																	55501975		2203	4300	6503	NLRP2	SO:0001819	synonymous_variant	0			-	HGNC	AK000517	CCDS12913.1, CCDS54318.1, CCDS54319.1	19q13.42	2008-02-05	2006-12-08	2006-12-08	ENSG00000022556	ENSG00000022556		"""Nucleotide-binding domain and leucine rich repeat containing"""	22948	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 2"""	609364	"""NACHT, leucine rich repeat and PYD containing 2"""	NALP2		12563287, 11270363	Standard	NM_001174081		Approved	FLJ20510, PYPAF2, NBS1, PAN1, CLR19.9	uc021vbq.1	Q9NX02	OTTHUMG00000167763	ENST00000543010.1:c.2643G>A	19.37:g.55501975G>A		Somatic	0	58	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	56	13.85	B4DZL7|I3L0G4|Q53FL5|Q59G09|Q8IXT0|Q9BVN5|Q9H6G6|Q9HAV9|Q9NWK3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_DAPIN,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.G881	ENST00000543010.1	37	c.2643	CCDS12913.1	19																																																																																			-	smart_Leu-rich_rpt_RNase_inh_sub-typ		0.542	NLRP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NLRP2	protein_coding	OTTHUMT00000396152.1	G	NM_017852	-		55501975	+1	no_errors	ENST00000448584	ensembl	human	known	74_37	silent	SNP	0.000	A
C6orf89	221477	genome.wustl.edu	37	6	36882452	36882452	+	Silent	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr6:36882452C>T	ENST00000480824.2	+	6	972	c.678C>T	c.(676-678)ttC>ttT	p.F226F	C6orf89_ENST00000510325.2_Silent_p.F120F|C6orf89_ENST00000355190.3_Silent_p.F233F|C6orf89_ENST00000373685.1_Silent_p.F226F|C6orf89_ENST00000359359.2_Silent_p.F120F			Q6UWU4	CF089_HUMAN	chromosome 6 open reading frame 89	226					epithelial cell proliferation (GO:0050673)|positive regulation of cell cycle (GO:0045787)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(4)|ovary(1)|skin(2)	15						AGCGGTGGTTCCCATTTCCTT	0.547																																																	0								ENSG00000198663						146.0	152.0	150.0					6																	36882452		2203	4300	6503	C6orf89	SO:0001819	synonymous_variant	0			-	HGNC	AK058086	CCDS4827.1, CCDS69100.1, CCDS75444.1	6p21.31	2013-03-14			ENSG00000198663	ENSG00000198663			21114	protein-coding gene	gene with protein product	"""bombesin receptor activated protein"""					21857995, 23460338	Standard	NM_152734		Approved	FLJ25357, BRAP	uc003omw.3	Q6UWU4	OTTHUMG00000014613	ENST00000480824.2:c.678C>T	6.37:g.36882452C>T		Somatic	0	41	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	34	22.73	B4DTT1|F4NAR0|F4NAR1|Q6ZMG5|Q7Z356|Q8IZ35	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.F233	ENST00000480824.2	37	c.699		6																																																																																			-	NULL		0.547	C6orf89-004	KNOWN	alternative_5_UTR|basic	protein_coding	C6orf89	protein_coding	OTTHUMT00000040387.2	C	NM_152734	-		36882452	+1	no_errors	ENST00000355190	ensembl	human	known	74_37	silent	SNP	1.000	T
SH2D6	284948	genome.wustl.edu	37	2	85662200	85662200	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr2:85662200C>T	ENST00000340326.2	+	1	283	c.122C>T	c.(121-123)tCg>tTg	p.S41L	SH2D6_ENST00000481426.2_3'UTR|Y_RNA_ENST00000384478.1_RNA|SH2D6_ENST00000389938.2_Missense_Mutation_p.S37L	NM_198482.1	NP_940884.1	Q7Z4S9	SH2D6_HUMAN	SH2 domain containing 6	41										central_nervous_system(1)|lung(2)	3						GGAAGGAAATCGTCTCTTCCC	0.627																																																	0								ENSG00000152292						27.0	27.0	27.0					2																	85662200		2202	4300	6502	SH2D6	SO:0001583	missense	0			-	HGNC	AF450483	CCDS1976.1	2p11.2	2013-02-14			ENSG00000152292	ENSG00000152292		"""SH2 domain containing"""	30439	protein-coding gene	gene with protein product						12477932	Standard	NM_198482		Approved	FLJ35993	uc002spq.3	Q7Z4S9	OTTHUMG00000130176	ENST00000340326.2:c.122C>T	2.37:g.85662200C>T	ENSP00000341867:p.Ser41Leu	Somatic	0	74	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	70	19.10	A6ND14|Q6R306	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SH2,smart_SH2,pfscan_SH2	p.S41L	ENST00000340326.2	37	c.122	CCDS1976.1	2	.	.	.	.	.	.	.	.	.	.	C	0.110	-1.140376	0.01728	.	.	ENSG00000152292	ENST00000389938;ENST00000340326	T	0.78364	-1.17	3.36	-1.37	0.09056	.	4.273530	0.00792	N	0.001341	T	0.53433	0.1796	N	0.03050	-0.425	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.47355	-0.9124	10	0.15499	T	0.54	0.5663	7.2111	0.25935	0.0:0.5296:0.0:0.4704	.	41	Q7Z4S9	SH2D6_HUMAN	L	37;41	ENSP00000341867:S41L	ENSP00000341867:S41L	S	+	2	0	SH2D6	85515711	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.156000	0.10100	-0.311000	0.08754	-0.463000	0.05309	TCG	-	NULL		0.627	SH2D6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SH2D6	protein_coding	OTTHUMT00000252493.2	C	NM_198482	-		85662200	+1	no_errors	ENST00000340326	ensembl	human	known	74_37	missense	SNP	0.000	T
ITIH1	3697	genome.wustl.edu	37	3	52820317	52820317	+	Nonsense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr3:52820317C>T	ENST00000273283.2	+	13	1624	c.1600C>T	c.(1600-1602)Caa>Taa	p.Q534*	ITIH1_ENST00000537050.1_Nonsense_Mutation_p.Q246*|ITIH1_ENST00000405128.3_5'Flank|ITIH1_ENST00000542827.1_Nonsense_Mutation_p.Q534*|ITIH1_ENST00000540715.1_Nonsense_Mutation_p.Q392*	NM_002215.3	NP_002206.2	P19827	ITIH1_HUMAN	inter-alpha-trypsin inhibitor heavy chain 1	534	Hyaluronan-binding.				hyaluronan metabolic process (GO:0030212)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(16)|lung(18)|ovary(4)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	52				BRCA - Breast invasive adenocarcinoma(193;7.04e-05)|Kidney(197;0.000659)|KIRC - Kidney renal clear cell carcinoma(197;0.000795)|OV - Ovarian serous cystadenocarcinoma(275;0.0498)		TCAGGAGGGACAAGAATTCAG	0.577																																																	0								ENSG00000055957						58.0	43.0	48.0					3																	52820317		2202	4296	6498	ITIH1	SO:0001587	stop_gained	0			-	HGNC		CCDS2864.1, CCDS54595.1	3p21.1	2011-10-26	2011-10-26		ENSG00000055957	ENSG00000055957			6166	protein-coding gene	gene with protein product		147270	"""inter-alpha (globulin) inhibitor, H1 polypeptide"""			1385302, 10100603	Standard	NM_002215		Approved	H1P, IATIH, ITIH	uc003dfs.3	P19827	OTTHUMG00000150312	ENST00000273283.2:c.1600C>T	3.37:g.52820317C>T	ENSP00000273283:p.Gln534*	Somatic	0	34	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	38	22.45	A8K9N5|B2RAH9|B7Z558|B7Z8C0|F5H165|F5H7Y8|P78455|Q01746|Q562G1	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ITI_HC_C,pfam_VIT,pfam_VWF_A,superfamily_PsdUridine_synth_cat_dom,smart_VIT,smart_VWF_A,pfscan_VWF_A	p.Q534*	ENST00000273283.2	37	c.1600	CCDS2864.1	3	.	.	.	.	.	.	.	.	.	.	C	38	7.176339	0.98114	.	.	ENSG00000055957	ENST00000542827;ENST00000273283;ENST00000540715;ENST00000537050;ENST00000428133	.	.	.	5.49	4.56	0.56223	.	0.699813	0.14655	N	0.306358	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-2.4059	10.7457	0.46179	0.1896:0.8104:0.0:0.0	.	.	.	.	X	534;534;392;246;87	.	ENSP00000273283:Q534X	Q	+	1	0	ITIH1	52795357	0.010000	0.17322	0.997000	0.53966	0.640000	0.38277	2.312000	0.43726	2.582000	0.87167	0.462000	0.41574	CAA	-	NULL		0.577	ITIH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITIH1	protein_coding	OTTHUMT00000317522.1	C	NM_002215	-		52820317	+1	no_errors	ENST00000273283	ensembl	human	known	74_37	nonsense	SNP	0.997	T
C8orf34	116328	genome.wustl.edu	37	8	69552622	69552622	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr8:69552622G>A	ENST00000539993.1	+	8	1408	c.859G>A	c.(859-861)Gat>Aat	p.D287N	C8orf34_ENST00000518698.1_Missense_Mutation_p.D373N|C8orf34_ENST00000325233.3_Missense_Mutation_p.D31N|C8orf34_ENST00000337103.4_Missense_Mutation_p.D262N			Q49A92	CH034_HUMAN	chromosome 8 open reading frame 34	287										NS(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(9)|lung(12)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	36			Epithelial(68;0.0117)|OV - Ovarian serous cystadenocarcinoma(28;0.0227)|all cancers(69;0.0502)			GGATCTTAATGATTTAAGAAT	0.398																																																	0								ENSG00000165084						74.0	70.0	71.0					8																	69552622		2203	4300	6503	C8orf34	SO:0001583	missense	0			-	HGNC	AB056652	CCDS6203.1, CCDS6203.2	8q13	2009-10-01			ENSG00000165084	ENSG00000165084			30905	protein-coding gene	gene with protein product	"""vestibule 1"""						Standard	NM_052958		Approved	vest-1, VEST1	uc010lyz.3	Q49A92	OTTHUMG00000164438	ENST00000539993.1:c.859G>A	8.37:g.69552622G>A	ENSP00000438159:p.Asp287Asn	Somatic	0	60	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	70	17.65	A8K5X1|G3XAM6|Q8N1X0|Q8N9M7|Q8ND19|Q96Q28	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_cAMP_dep_PK_reg_su_I/II_a/b	p.D373N	ENST00000539993.1	37	c.1117		8	.	.	.	.	.	.	.	.	.	.	G	27.2	4.806582	0.90623	.	.	ENSG00000165084	ENST00000518698;ENST00000539993;ENST00000337103;ENST00000325233	T;T;T;T	0.64260	0.08;0.15;0.1;-0.09	5.47	5.47	0.80525	.	0.183958	0.56097	D	0.000026	T	0.77691	0.4168	M	0.61703	1.905	0.58432	D	0.999992	D	0.71674	0.998	D	0.81914	0.995	T	0.76008	-0.3116	9	.	.	.	-17.0818	19.333	0.94299	0.0:0.0:1.0:0.0	.	287	Q49A92	CH034_HUMAN	N	373;287;262;31	ENSP00000427820:D373N;ENSP00000438159:D287N;ENSP00000337174:D262N;ENSP00000319532:D31N	.	D	+	1	0	C8orf34	69715176	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.402000	0.97298	2.571000	0.86741	0.591000	0.81541	GAT	-	NULL		0.398	C8orf34-201	KNOWN	basic|appris_candidate	protein_coding	C8orf34	protein_coding		G	NM_052958	-		69552622	+1	no_errors	ENST00000518698	ensembl	human	known	74_37	missense	SNP	1.000	A
KCNK5	8645	genome.wustl.edu	37	6	39159187	39159187	+	Silent	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr6:39159187G>A	ENST00000359534.3	-	5	1317	c.979C>T	c.(979-981)Ctg>Ttg	p.L327L		NM_003740.3	NP_003731.1	O95279	KCNK5_HUMAN	potassium channel, subfamily K, member 5	327					excretion (GO:0007588)|potassium ion transport (GO:0006813)	integral component of plasma membrane (GO:0005887)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(4)|skin(3)	19						TGAGGCCCCAGCCCTGGGCCC	0.627																																																	0								ENSG00000164626						56.0	60.0	58.0					6																	39159187		2203	4299	6502	KCNK5	SO:0001819	synonymous_variant	0			-	HGNC	AF084830	CCDS4841.1	6p21	2012-03-07			ENSG00000164626	ENSG00000164626		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6280	protein-coding gene	gene with protein product		603493				9812978, 16382106	Standard	XM_005249456		Approved	K2p5.1, TASK-2	uc003oon.3	O95279	OTTHUMG00000014642	ENST00000359534.3:c.979C>T	6.37:g.39159187G>A		Somatic	0	34	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	30	26.83	B2RAQ6|B5TJL2|Q5VV76	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_2pore_dom_K_chnl_dom,prints_2pore_dom_K_chnl,prints_2pore_dom_K_chnl_TASK	p.L327	ENST00000359534.3	37	c.979	CCDS4841.1	6																																																																																			-	NULL		0.627	KCNK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNK5	protein_coding	OTTHUMT00000040449.1	G	NM_003740	-		39159187	-1	no_errors	ENST00000359534	ensembl	human	known	74_37	silent	SNP	0.058	A
MYH7	4625	genome.wustl.edu	37	14	23899003	23899003	+	Silent	SNP	C	C	T	rs572672362		TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr14:23899003C>T	ENST00000355349.3	-	12	1281	c.1119G>A	c.(1117-1119)gcG>gcA	p.A373A		NM_000257.2	NP_000248.2	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	373	Myosin motor.				adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)	p.A373A(1)		NS(3)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(19)|lung(57)|ovary(5)|prostate(9)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	137	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		CGTCTGGCTCCGCCTGCTCCT	0.532													c|||	1	0.000199681	0.0008	0.0	5008	,	,		18578	0.0		0.0	False		,,,				2504	0.0																1	Substitution - coding silent(1)	endometrium(1)						ENSG00000092054						80.0	75.0	77.0					14																	23899003		2203	4300	6503	MYH7	SO:0001819	synonymous_variant	0			-	HGNC	M58018	CCDS9601.1	14q11.2-q13	2014-09-17	2006-09-29		ENSG00000092054	ENSG00000092054		"""Myosins / Myosin superfamily : Class II"""	7577	protein-coding gene	gene with protein product		160760	"""myopathy, distal 1"", ""myosin, heavy polypeptide 7, cardiac muscle, beta"""	CMH1, MPD1		2494889, 8483915, 15322983	Standard	XM_005267696		Approved	CMD1S	uc001wjx.3	P12883	OTTHUMG00000028755	ENST00000355349.3:c.1119G>A	14.37:g.23899003C>T		Somatic	0	51	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	60	22.08	A2TDB6|B6D424|Q14836|Q14837|Q14904|Q16579|Q2M1Y6|Q92679|Q9H1D5|Q9UDA2|Q9UMM8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.A373	ENST00000355349.3	37	c.1119	CCDS9601.1	14																																																																																			-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom		0.532	MYH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH7	protein_coding	OTTHUMT00000071798.3	C	NM_000257	-		23899003	-1	no_errors	ENST00000355349	ensembl	human	known	74_37	silent	SNP	0.106	T
TRPC6	7225	genome.wustl.edu	37	11	101359678	101359678	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr11:101359678G>A	ENST00000344327.3	-	4	1707	c.1283C>T	c.(1282-1284)cCa>cTa	p.P428L	TRPC6_ENST00000348423.4_Intron|TRPC6_ENST00000360497.4_Intron|TRPC6_ENST00000532133.1_Missense_Mutation_p.P428L	NM_004621.5	NP_004612.2	Q9Y210	TRPC6_HUMAN	transient receptor potential cation channel, subfamily C, member 6	428					aging (GO:0007568)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|ion transmembrane transport (GO:0034220)|platelet activation (GO:0030168)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ion transmembrane transporter activity (GO:0032414)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)	inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			autonomic_ganglia(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(14)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	55		Acute lymphoblastic leukemia(157;0.000918)|all_hematologic(158;0.0162)		BRCA - Breast invasive adenocarcinoma(274;0.0442)		CTTGCTGCATGGAGCAAACCA	0.438																																					Colon(166;1315 1927 11094 12848 34731)												0								ENSG00000137672						88.0	88.0	88.0					11																	101359678		2203	4299	6502	TRPC6	SO:0001583	missense	0			-	HGNC	AJ006276	CCDS8311.1	11q22.1	2014-02-04				ENSG00000137672		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12338	protein-coding gene	gene with protein product		603652	"""focal segmental glomerulosclerosis 2"""	FSGS2		9925922, 16382100, 15879175	Standard	NM_004621		Approved	TRP6	uc001pgk.4	Q9Y210		ENST00000344327.3:c.1283C>T	11.37:g.101359678G>A	ENSP00000340913:p.Pro428Leu	Somatic	0	39	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	39	26.42	Q52M59|Q9HCW3|Q9NQA8|Q9NQA9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_TRP_dom,pfam_PKD1_2_channel,superfamily_Ankyrin_rpt-contain_dom,superfamily_ARM-type_fold,smart_Ankyrin_rpt,prints_TRPC6_channel,prints_TRPC_channel,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,tigrfam_TRP_channel	p.P428L	ENST00000344327.3	37	c.1283	CCDS8311.1	11	.	.	.	.	.	.	.	.	.	.	G	20.4	3.989516	0.74589	.	.	ENSG00000137672	ENST00000344327;ENST00000532133	T;T	0.63744	-0.06;-0.06	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	D	0.85948	0.5816	H	0.94222	3.51	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.89062	0.3463	10	0.87932	D	0	-13.4116	19.9928	0.97374	0.0:0.0:1.0:0.0	.	428	Q9Y210	TRPC6_HUMAN	L	428	ENSP00000340913:P428L;ENSP00000435574:P428L	ENSP00000340913:P428L	P	-	2	0	TRPC6	100864888	1.000000	0.71417	0.993000	0.49108	0.730000	0.41778	9.797000	0.99108	2.745000	0.94114	0.650000	0.86243	CCA	-	tigrfam_TRP_channel		0.438	TRPC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPC6	protein_coding	OTTHUMT00000394770.1	G	NM_004621	-		101359678	-1	no_errors	ENST00000344327	ensembl	human	known	74_37	missense	SNP	1.000	A
CACNA1G	8913	genome.wustl.edu	37	17	48695414	48695414	+	Silent	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr17:48695414G>A	ENST00000359106.5	+	31	5232	c.5232G>A	c.(5230-5232)ggG>ggA	p.G1744G	CACNA1G_ENST00000507336.1_Silent_p.G1733G|CACNA1G_ENST00000358244.5_Silent_p.G1710G|CACNA1G_ENST00000354983.4_Silent_p.G1710G|CACNA1G_ENST00000510115.1_Silent_p.G1710G|CACNA1G_ENST00000514181.1_Silent_p.G1719G|CACNA1G_ENST00000515411.1_Silent_p.G1726G|CACNA1G_ENST00000514079.1_Silent_p.G1751G|CACNA1G_ENST00000514717.1_Silent_p.G1687G|CACNA1G_ENST00000505165.1_Silent_p.G1744G|CACNA1G_ENST00000512389.1_Silent_p.G1733G|CACNA1G_ENST00000513964.1_Silent_p.G1699G|CACNA1G_ENST00000507609.1_Silent_p.G1737G|CACNA1G_ENST00000513689.2_Silent_p.G1699G|CACNA1G_ENST00000442258.2_Silent_p.G1703G|CACNA1G_ENST00000507510.2_Silent_p.G1744G|CACNA1G_ENST00000502264.1_Silent_p.G1721G|CACNA1G_ENST00000360761.4_Silent_p.G1721G|CACNA1G_ENST00000515165.1_Silent_p.G1744G|CACNA1G_ENST00000510366.1_Silent_p.G1692G|CACNA1G_ENST00000503485.1_Silent_p.G1710G|CACNA1G_ENST00000429973.2_Silent_p.G1726G|CACNA1G_ENST00000352832.5_Silent_p.G1710G|CACNA1G_ENST00000515765.1_Silent_p.G1733G|CACNA1G_ENST00000507896.1_Silent_p.G1733G	NM_018896.4	NP_061496.2	O43497	CAC1G_HUMAN	calcium channel, voltage-dependent, T type, alpha 1G subunit	1744					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|response to nickel cation (GO:0010045)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|scaffold protein binding (GO:0097110)			breast(5)|cervix(1)|endometrium(13)|kidney(5)|lung(23)	47	Breast(11;6.7e-17)		BRCA - Breast invasive adenocarcinoma(22;7.52e-09)		Cinnarizine(DB00568)|Ethosuximide(DB00593)|Flunarizine(DB04841)|Methsuximide(DB05246)|Spironolactone(DB00421)|Trimethadione(DB00347)|Verapamil(DB00661)|Zonisamide(DB00909)	TCCAGGTGGGGAACCTGGGAC	0.557																																																	0								ENSG00000006283						80.0	78.0	79.0					17																	48695414		1853	4105	5958	CACNA1G	SO:0001819	synonymous_variant	0			-	HGNC	AC004590	CCDS45730.1, CCDS45731.1, CCDS45732.1, CCDS45733.1, CCDS45734.1, CCDS45735.1, CCDS45736.1, CCDS45737.1, CCDS54142.1, CCDS54143.1, CCDS54144.1, CCDS54145.1, CCDS54146.1, CCDS58565.1, CCDS58566.1, CCDS58567.1, CCDS58568.1, CCDS58569.1, CCDS58570.1, CCDS58571.1, CCDS58572.1, CCDS58573.1, CCDS58574.1, CCDS58575.1, CCDS58576.1	17q22	2012-03-07	2007-02-16		ENSG00000006283	ENSG00000006283		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1394	protein-coding gene	gene with protein product		604065				9495342, 16382099	Standard	NM_001256334		Approved	Cav3.1, NBR13	uc002irk.2	O43497	OTTHUMG00000162180	ENST00000359106.5:c.5232G>A	17.37:g.48695414G>A		Somatic	0	47	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	45	22.41	D6RA64|E7EPR0|O43498|O94770|Q19QY8|Q19QY9|Q19QZ0|Q19QZ1|Q19QZ2|Q19QZ3|Q19QZ4|Q19QZ5|Q19QZ6|Q19QZ7|Q19QZ8|Q19QZ9|Q19R00|Q19R01|Q19R02|Q19R03|Q19R04|Q19R05|Q19R06|Q19R07|Q19R08|Q19R09|Q19R10|Q19R11|Q19R12|Q19R13|Q19R15|Q19R16|Q19R17|Q19R18|Q2TAC4|Q9NYU4|Q9NYU5|Q9NYU6|Q9NYU7|Q9NYU8|Q9NYU9|Q9NYV0|Q9NYV1|Q9UHN9|Q9UHP0|Q9ULU6|Q9UNG7|Q9Y5T2|Q9Y5T3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_PKD1_2_channel,prints_VDCC_T_a1su,prints_VDCCAlpha1	p.G1744	ENST00000359106.5	37	c.5232	CCDS45730.1	17																																																																																			-	pfam_Ion_trans_dom,pfam_PKD1_2_channel		0.557	CACNA1G-013	KNOWN	basic|CCDS	protein_coding	CACNA1G	protein_coding	OTTHUMT00000367895.1	G	NM_018896	-		48695414	+1	no_errors	ENST00000359106	ensembl	human	known	74_37	silent	SNP	1.000	A
STK33	65975	genome.wustl.edu	37	11	8457588	8457588	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr11:8457588G>A	ENST00000447869.1	-	9	1964	c.1046C>T	c.(1045-1047)tCc>tTc	p.S349F	STK33_ENST00000315204.1_Missense_Mutation_p.S349F|STK33_ENST00000396672.1_Missense_Mutation_p.S349F|STK33_ENST00000473980.1_5'UTR|STK33_ENST00000534493.1_Missense_Mutation_p.S308F|STK33_ENST00000358872.3_Missense_Mutation_p.S162F|STK33_ENST00000396673.1_Missense_Mutation_p.S349F			Q9BYT3	STK33_HUMAN	serine/threonine kinase 33	349	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				protein autophosphorylation (GO:0046777)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)|pancreas(1)|skin(3)	23				Epithelial(150;2.13e-06)|BRCA - Breast invasive adenocarcinoma(625;0.239)		GTCACTTATGGAATTCCAGAC	0.338																																																	0								ENSG00000130413						65.0	60.0	62.0					11																	8457588		2201	4296	6497	STK33	SO:0001583	missense	0			-	HGNC	AJ303380	CCDS7789.1, CCDS73253.1, CCDS73254.1	11p15.3	2010-03-10			ENSG00000130413	ENSG00000130413			14568	protein-coding gene	gene with protein product		607670				11738831	Standard	NM_030906		Approved		uc001mgj.1	Q9BYT3	OTTHUMG00000140275	ENST00000447869.1:c.1046C>T	11.37:g.8457588G>A	ENSP00000416750:p.Ser349Phe	Somatic	0	43	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	86	21.10	Q658S6|Q8NEF5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.S349F	ENST00000447869.1	37	c.1046	CCDS7789.1	11	.	.	.	.	.	.	.	.	.	.	G	8.797	0.931907	0.18131	.	.	ENSG00000130413	ENST00000447869;ENST00000315204;ENST00000396672;ENST00000358872;ENST00000396673;ENST00000444064;ENST00000534493	T;T;T;T;T;T;T	0.68181	-0.31;-0.31;-0.31;-0.31;-0.31;-0.31;-0.31	5.6	3.63	0.41609	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.178860	0.49916	D	0.000128	T	0.59404	0.2191	L	0.49571	1.57	0.19775	N	0.99995	B;B	0.14805	0.011;0.006	B;B	0.21151	0.025;0.033	T	0.56938	-0.7896	10	0.59425	D	0.04	.	10.4936	0.44764	0.0705:0.2337:0.6958:0.0	.	308;349	B4DDH2;Q9BYT3	.;STK33_HUMAN	F	349;349;349;162;349;104;308	ENSP00000416750:S349F;ENSP00000320754:S349F;ENSP00000379905:S349F;ENSP00000351743:S162F;ENSP00000379906:S349F;ENSP00000415688:S104F;ENSP00000436418:S308F	ENSP00000320754:S349F	S	-	2	0	STK33	8414164	0.060000	0.20803	0.885000	0.34714	0.375000	0.29983	1.310000	0.33551	1.502000	0.48669	-0.143000	0.13931	TCC	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.338	STK33-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	STK33	protein_coding	OTTHUMT00000276819.2	G	NM_030906	-		8457588	-1	no_errors	ENST00000315204	ensembl	human	known	74_37	missense	SNP	0.227	A
CACNA1S	779	genome.wustl.edu	37	1	201020239	201020239	+	Missense_Mutation	SNP	A	A	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr1:201020239A>T	ENST00000362061.3	-	33	4212	c.3986T>A	c.(3985-3987)cTa>cAa	p.L1329Q	CACNA1S_ENST00000367338.3_Missense_Mutation_p.L1310Q	NM_000069.2	NP_000060.2	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type, alpha 1S subunit	1329					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport (GO:0006816)|endoplasmic reticulum organization (GO:0007029)|extraocular skeletal muscle development (GO:0002074)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|myoblast fusion (GO:0007520)|neuromuscular junction development (GO:0007528)|skeletal muscle adaptation (GO:0043501)|skeletal muscle fiber development (GO:0048741)|skeletal system development (GO:0001501)|striated muscle contraction (GO:0006941)	cytoplasm (GO:0005737)|I band (GO:0031674)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(19)|lung(37)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	102					Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	GCAGGCCAGTAGGATCTCCTG	0.572																																																	0								ENSG00000081248						129.0	110.0	116.0					1																	201020239		2203	4300	6503	CACNA1S	SO:0001583	missense	0			-	HGNC	L33798	CCDS1407.1	1q32	2012-03-07			ENSG00000081248	ENSG00000081248		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1397	protein-coding gene	gene with protein product		114208		HOKPP, MHS5, CACNL1A3		7916735, 16382099	Standard	NM_000069		Approved	Cav1.1, hypoPP	uc001gvv.3	Q13698	OTTHUMG00000035784	ENST00000362061.3:c.3986T>A	1.37:g.201020239A>T	ENSP00000355192:p.Leu1329Gln	Somatic	0	46	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	35	20.45	A4IF51|B1ALM2|Q12896|Q13934	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCCAlpha1,prints_VDCC_L_a1su,prints_VDCC_L_a1ssu	p.L1329Q	ENST00000362061.3	37	c.3986	CCDS1407.1	1	.	.	.	.	.	.	.	.	.	.	.	22.5	4.301138	0.81136	.	.	ENSG00000081248	ENST00000362061;ENST00000367338	D;D	0.98762	-5.12;-5.12	4.43	4.43	0.53597	Ion transport (1);	0.115815	0.56097	D	0.000025	D	0.98893	0.9625	M	0.77406	2.37	0.48395	D	0.999641	D	0.57899	0.981	D	0.67725	0.953	D	0.99698	1.1003	10	0.87932	D	0	.	14.0248	0.64580	1.0:0.0:0.0:0.0	.	1329	Q13698	CAC1S_HUMAN	Q	1329;1310	ENSP00000355192:L1329Q;ENSP00000356307:L1310Q	ENSP00000355192:L1329Q	L	-	2	0	CACNA1S	199286862	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	9.309000	0.96252	1.775000	0.52247	0.374000	0.22700	CTA	-	pfam_Ion_trans_dom,pfam_PKD1_2_channel		0.572	CACNA1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNA1S	protein_coding	OTTHUMT00000087049.1	A	NM_000069	-		201020239	-1	no_errors	ENST00000362061	ensembl	human	known	74_37	missense	SNP	1.000	T
LRRFIP1	9208	genome.wustl.edu	37	2	238668788	238668788	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr2:238668788C>T	ENST00000392000.4	+	10	946	c.829C>T	c.(829-831)Cct>Tct	p.P277S	LRRFIP1_ENST00000289175.6_Missense_Mutation_p.P221S|LRRFIP1_ENST00000308482.9_Missense_Mutation_p.P467S|LRRFIP1_ENST00000244815.5_Missense_Mutation_p.P253S	NM_001137552.1	NP_001131024.1	Q32MZ4	LRRF1_HUMAN	leucine rich repeat (in FLII) interacting protein 1	277					innate immune response (GO:0045087)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of type I interferon production (GO:0032481)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|protein homodimerization activity (GO:0042803)			NS(1)|breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)	29		Breast(86;0.00257)|Renal(207;0.00571)|Ovarian(221;0.17)|all_hematologic(139;0.182)		Epithelial(121;9.75e-23)|OV - Ovarian serous cystadenocarcinoma(60;1.01e-10)|Kidney(56;4.85e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.31e-07)|BRCA - Breast invasive adenocarcinoma(100;0.000151)|Lung(119;0.0137)|LUSC - Lung squamous cell carcinoma(224;0.0325)|COAD - Colon adenocarcinoma(134;0.228)		ATACCAAGGTCCTACCAAGAT	0.438																																																	0								ENSG00000124831						111.0	105.0	107.0					2																	238668788		2203	4300	6503	LRRFIP1	SO:0001583	missense	0			-	HGNC	AJ223075	CCDS2521.1, CCDS46551.1, CCDS46552.1, CCDS46553.1	2q37.3	2010-09-30			ENSG00000124831	ENSG00000124831			6702	protein-coding gene	gene with protein product	"""GC-binding factor 2"""	603256				9705290, 9525888, 16199883	Standard	NM_004735		Approved	FLAP-1, FLIIAP1, TRIP, GCF-2, HUFI-1	uc002vxe.3	Q32MZ4	OTTHUMG00000133339	ENST00000392000.4:c.829C>T	2.37:g.238668788C>T	ENSP00000375857:p.Pro277Ser	Somatic	0	62	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	70	14.63	E9PGZ2|O75766|O75799|Q32MZ5|Q53T49|Q6PKG2|Q9Y607	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Leu-rich_rep_flightless-int_pr	p.P277S	ENST00000392000.4	37	c.829	CCDS46552.1	2	.	.	.	.	.	.	.	.	.	.	C	14.55	2.567784	0.45798	.	.	ENSG00000124831	ENST00000308482;ENST00000289175;ENST00000391999;ENST00000244815;ENST00000392000	T;T;T;T	0.40756	1.02;1.02;1.02;1.02	5.61	-1.84	0.07809	.	0.642245	0.15702	N	0.248900	T	0.31104	0.0786	L	0.28192	0.835	0.09310	N	1	B;P;P;P;B	0.49635	0.008;0.89;0.926;0.89;0.002	B;P;P;P;B	0.53593	0.026;0.503;0.73;0.526;0.008	T	0.32402	-0.9908	10	0.09843	T	0.71	-0.1469	5.8257	0.18552	0.0:0.3652:0.2379:0.3969	.	221;221;277;253;467	B4DPC0;Q32MZ4-3;Q32MZ4;Q32MZ4-2;E9PGZ2	.;.;LRRF1_HUMAN;.;.	S	467;221;457;253;277	ENSP00000310109:P467S;ENSP00000289175:P221S;ENSP00000244815:P253S;ENSP00000375857:P277S	ENSP00000244815:P253S	P	+	1	0	LRRFIP1	238333527	0.000000	0.05858	0.000000	0.03702	0.092000	0.18411	0.068000	0.14531	-0.311000	0.08754	0.655000	0.94253	CCT	-	pfam_Leu-rich_rep_flightless-int_pr		0.438	LRRFIP1-003	KNOWN	basic|CCDS	protein_coding	LRRFIP1	protein_coding	OTTHUMT00000317198.1	C	NM_004735	-		238668788	+1	no_errors	ENST00000392000	ensembl	human	known	74_37	missense	SNP	0.000	T
PSG9	5678	genome.wustl.edu	37	19	43762226	43762226	+	Intron	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr19:43762226G>A	ENST00000270077.3	-	5	1340				PSG9_ENST00000596730.1_Silent_p.L271L|PSG9_ENST00000418820.2_Intron|PSG9_ENST00000244293.7_Silent_p.L364L|PSG9_ENST00000443718.3_Intron|PSG9_ENST00000291752.5_Intron|PSG9_ENST00000593948.1_Intron	NM_002784.3	NP_002775.3	Q00887	PSG9_HUMAN	pregnancy specific beta-1-glycoprotein 9						female pregnancy (GO:0007565)	extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(15)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	41		Prostate(69;0.00682)				GGTTCAGGAGGAGAATTTGGG	0.453																																																	0								ENSG00000183668																																			PSG9	SO:0001627	intron_variant	0			-	HGNC	M34481	CCDS12618.1	19q13.2	2013-01-29			ENSG00000183668	ENSG00000183668		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9526	protein-coding gene	gene with protein product		176398		PSG11		7806221	Standard	XM_005259076		Approved	PSGII	uc002owd.4	Q00887	OTTHUMG00000182826	ENST00000270077.3:c.1243+127C>T	19.37:g.43762226G>A		Somatic	0	106	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	28	120	18.92	B2R869|Q15227|Q15236|Q15237|Q8WW78|Q9UQ73	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.L364	ENST00000270077.3	37	c.1092	CCDS12618.1	19																																																																																			-	NULL		0.453	PSG9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSG9	protein_coding	OTTHUMT00000323065.1	G	NM_002784	-		43762226	-1	no_errors	ENST00000244293	ensembl	human	putative	74_37	silent	SNP	0.000	A
ZNF804A	91752	genome.wustl.edu	37	2	185803113	185803113	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr2:185803113G>A	ENST00000302277.6	+	4	3584	c.2990G>A	c.(2989-2991)gGa>gAa	p.G997E		NM_194250.1	NP_919226.1	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	997							metal ion binding (GO:0046872)			NS(5)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(22)|liver(2)|lung(79)|ovary(7)|pancreas(1)|prostate(2)|skin(12)|urinary_tract(1)	146						TATAATTCAGGAATCCTTAAC	0.433																																																	0								ENSG00000170396						108.0	101.0	103.0					2																	185803113		2203	4300	6503	ZNF804A	SO:0001583	missense	0			-	HGNC	AF052145	CCDS2291.1	2q32.1	2012-10-05	2006-10-27	2006-10-27	ENSG00000170396	ENSG00000170396			21711	protein-coding gene	gene with protein product		612282		C2orf10		12970790	Standard	NM_194250		Approved		uc002uph.3	Q7Z570	OTTHUMG00000132625	ENST00000302277.6:c.2990G>A	2.37:g.185803113G>A	ENSP00000303252:p.Gly997Glu	Somatic	0	31	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	38	13.64	A7E253|Q6ZN26	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2_jaz	p.G997E	ENST00000302277.6	37	c.2990	CCDS2291.1	2	.	.	.	.	.	.	.	.	.	.	G	15.55	2.867198	0.51588	.	.	ENSG00000170396	ENST00000302277	T	0.12465	2.68	5.14	4.24	0.50183	.	0.591289	0.15004	N	0.285965	T	0.33030	0.0849	L	0.57536	1.79	0.39152	D	0.962233	D	0.76494	0.999	D	0.69824	0.966	T	0.08289	-1.0729	10	0.87932	D	0	-11.7385	13.2689	0.60150	0.0:0.3041:0.6959:0.0	.	997	Q7Z570	Z804A_HUMAN	E	997	ENSP00000303252:G997E	ENSP00000303252:G997E	G	+	2	0	ZNF804A	185511358	1.000000	0.71417	1.000000	0.80357	0.810000	0.45777	2.733000	0.47360	1.108000	0.41662	0.467000	0.42956	GGA	-	NULL		0.433	ZNF804A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF804A	protein_coding	OTTHUMT00000255871.1	G	NM_194250	-		185803113	+1	no_errors	ENST00000302277	ensembl	human	known	74_37	missense	SNP	1.000	A
TCF4	6925	genome.wustl.edu	37	18	52921843	52921843	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr18:52921843G>A	ENST00000356073.4	-	15	1846	c.1235C>T	c.(1234-1236)cCt>cTt	p.P412L	TCF4_ENST00000566286.1_Missense_Mutation_p.P409L|TCF4_ENST00000567880.1_Missense_Mutation_p.P352L|TCF4_ENST00000543082.1_Missense_Mutation_p.P370L|TCF4_ENST00000561992.1_Missense_Mutation_p.P282L|TCF4_ENST00000544241.2_Missense_Mutation_p.P341L|TCF4_ENST00000540999.1_Missense_Mutation_p.P388L|TCF4_ENST00000570287.2_Missense_Mutation_p.P252L|TCF4_ENST00000563760.1_5'UTR|TCF4_ENST00000537578.1_Missense_Mutation_p.P388L|TCF4_ENST00000564403.2_Missense_Mutation_p.P418L|TCF4_ENST00000561831.3_Missense_Mutation_p.P252L|TCF4_ENST00000566279.1_Missense_Mutation_p.P352L|TCF4_ENST00000568673.1_Missense_Mutation_p.P388L|TCF4_ENST00000457482.3_Missense_Mutation_p.P252L|TCF4_ENST00000565018.2_Missense_Mutation_p.P412L|TCF4_ENST00000398339.1_Missense_Mutation_p.P514L|TCF4_ENST00000568740.1_Missense_Mutation_p.P387L|TCF4_ENST00000537856.3_Missense_Mutation_p.P282L|TCF4_ENST00000564228.1_Missense_Mutation_p.P341L|TCF4_ENST00000354452.3_Missense_Mutation_p.P412L|TCF4_ENST00000564999.1_Missense_Mutation_p.P412L|TCF4_ENST00000570177.2_Missense_Mutation_p.P282L	NM_003199.2	NP_003190.1	P15884	ITF2_HUMAN	transcription factor 4	412					DNA-templated transcription, initiation (GO:0006352)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein-DNA complex assembly (GO:0065004)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase recruiting transcription factor activity (GO:0001011)|sequence-specific DNA binding transcription factor activity (GO:0003700)|TFIIB-class binding transcription factor activity (GO:0001087)|TFIIB-class transcription factor binding (GO:0001093)			breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(5)|urinary_tract(1)	41				Colorectal(16;0.00108)|READ - Rectum adenocarcinoma(59;0.0649)|COAD - Colon adenocarcinoma(17;0.0718)		ATGACCACCAGGCATAGCTGT	0.507																																																	0								ENSG00000196628						109.0	100.0	103.0					18																	52921843		2203	4300	6503	TCF4	SO:0001583	missense	0			-	HGNC	M74719	CCDS11960.1, CCDS42438.1, CCDS58623.1, CCDS58624.1, CCDS58625.1, CCDS58626.1, CCDS58627.1, CCDS58628.1, CCDS58629.1, CCDS58630.1, CCDS58631.1, CCDS59321.1	18q21.1	2013-05-21			ENSG00000196628	ENSG00000196628		"""Basic helix-loop-helix proteins"""	11634	protein-coding gene	gene with protein product		602272				9302263, 2308860	Standard	NM_001083962		Approved	SEF2-1B, ITF2, bHLHb19, E2-2	uc002lga.3	P15884	OTTHUMG00000132713	ENST00000356073.4:c.1235C>T	18.37:g.52921843G>A	ENSP00000348374:p.Pro412Leu	Somatic	0	37	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	46	9.80	B3KT62|B3KUC0|B4DT37|B4DUG3|B7Z5M6|B7Z6Y1|G0LNT9|G0LNU0|G0LNU1|G0LNU2|G0LNU4|G0LNU5|G0LNU8|G0LNU9|G0LNV0|G0LNV1|G0LNV2|H3BPQ1|Q08AP2|Q08AP3|Q15439|Q15440|Q15441	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.P514L	ENST00000356073.4	37	c.1541	CCDS11960.1	18	.	.	.	.	.	.	.	.	.	.	G	23.1	4.377568	0.82682	.	.	ENSG00000196628	ENST00000354452;ENST00000457482;ENST00000356073;ENST00000543082;ENST00000540999;ENST00000537578;ENST00000544241;ENST00000537856;ENST00000398339	T;T;T;T;T;T;T;T;T	0.58506	0.33;0.33;0.33;0.33;0.33;0.33;0.33;0.33;0.33	5.62	5.62	0.85841	.	0.176896	0.51477	D	0.000096	T	0.70193	0.3196	M	0.62723	1.935	0.80722	D	1	P;P;P;P;B;P;P;B;P	0.52316	0.599;0.721;0.846;0.952;0.139;0.864;0.864;0.131;0.763	B;P;P;P;B;B;B;B;B	0.55455	0.356;0.476;0.543;0.776;0.039;0.434;0.434;0.087;0.173	T	0.72137	-0.4381	10	0.66056	D	0.02	-12.6024	18.4277	0.90614	0.0:0.0:1.0:0.0	.	388;412;252;514;412;370;341;252;409	B7Z5M6;G0LNT9;G0LNV1;E9PH57;P15884;B3KUC0;B3KT62;G0LNU9;G0LNU5	.;.;.;.;ITF2_HUMAN;.;.;.;.	L	412;252;412;370;388;388;341;282;514	ENSP00000346440:P412L;ENSP00000409447:P252L;ENSP00000348374:P412L;ENSP00000439656:P370L;ENSP00000445202:P388L;ENSP00000440731:P388L;ENSP00000441562:P341L;ENSP00000439827:P282L;ENSP00000381382:P514L	ENSP00000346440:P412L	P	-	2	0	TCF4	51072841	1.000000	0.71417	0.999000	0.59377	0.959000	0.62525	7.912000	0.87465	2.653000	0.90120	0.585000	0.79938	CCT	-	NULL		0.507	TCF4-002	KNOWN	upstream_uORF|basic|CCDS	protein_coding	TCF4	protein_coding	OTTHUMT00000256014.1	G	NM_003199	-		52921843	-1	no_errors	ENST00000398339	ensembl	human	known	74_37	missense	SNP	1.000	A
CCDC113	29070	genome.wustl.edu	37	16	58312541	58312541	+	Splice_Site	SNP	G	G	T	rs374568797		TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr16:58312541G>T	ENST00000219299.4	+	8	1126	c.1047G>T	c.(1045-1047)gaG>gaT	p.E349D	CCDC113_ENST00000443128.2_Splice_Site_p.E295D	NM_014157.3	NP_054876.2	Q9H0I3	CC113_HUMAN	coiled-coil domain containing 113	349						cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein complex (GO:0043234)				large_intestine(4)|lung(6)|ovary(1)|urinary_tract(1)	12						AGATAGCAGAGGTGAGCCACG	0.483																																																	0								ENSG00000103021						58.0	60.0	59.0					16																	58312541		2198	4300	6498	CCDC113	SO:0001630	splice_region_variant	0			-	HGNC	AL136785	CCDS10795.1, CCDS45497.1	16q21	2008-02-05			ENSG00000103021	ENSG00000103021			25002	protein-coding gene	gene with protein product						11230166, 11042152	Standard	NM_014157		Approved	HSPC065, DKFZp434N1418	uc002ene.3	Q9H0I3	OTTHUMG00000133489	ENST00000219299.4:c.1047+1G>T	16.37:g.58312541G>T		Somatic	0	17	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	36	20.00	B2RAQ7|B4DR20|Q9NZX2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.E349D	ENST00000219299.4	37	c.1047	CCDS10795.1	16	.	.	.	.	.	.	.	.	.	.	G	27.2	4.807476	0.90623	.	.	ENSG00000103021	ENST00000443128;ENST00000219299	T;T	0.39056	1.17;1.1	5.67	5.67	0.87782	.	0.102167	0.64402	D	0.000003	T	0.68384	0.2995	M	0.82630	2.6	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.70788	-0.4777	10	0.54805	T	0.06	-19.0197	17.2642	0.87081	0.0:0.0:1.0:0.0	.	295;349	B4DR20;Q9H0I3	.;CC113_HUMAN	D	295;349	ENSP00000402588:E295D;ENSP00000219299:E349D	ENSP00000219299:E349D	E	+	3	2	CCDC113	56870042	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	7.161000	0.77505	2.676000	0.91093	0.561000	0.74099	GAG	-	NULL		0.483	CCDC113-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC113	protein_coding	OTTHUMT00000257387.2	G	NM_014157	-	Missense_Mutation	58312541	+1	no_errors	ENST00000219299	ensembl	human	known	74_37	missense	SNP	1.000	T
C11orf97	643037	genome.wustl.edu	37	11	94265128	94265128	+	lincRNA	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr11:94265128G>A	ENST00000542198.1	+	0	391																											GAACGGAGAAGAAACTCAAGC	0.294																																																	0								ENSG00000257057																																			RP11-867G2.2			0			-	Clone_based_vega_gene																													11.37:g.94265128G>A		Somatic	0	55	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	58	17.14		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000542198.1	37	NULL		11																																																																																			-	-		0.294	RP11-867G2.2-001	KNOWN	basic	lincRNA	ENSG00000257057	lincRNA	OTTHUMT00000396326.1	G		-		94265128	+1	no_errors	ENST00000542198	ensembl	human	known	74_37	rna	SNP	0.023	A
RGS4	5999	genome.wustl.edu	37	1	163044073	163044073	+	Intron	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr1:163044073G>A	ENST00000367909.6	+	5	718				RGS4_ENST00000421743.2_Intron|RGS4_ENST00000527809.1_Intron|RGS4_ENST00000367908.4_Intron|RGS4_ENST00000367906.3_Intron|RGS4_ENST00000531057.1_Intron|RGS4_ENST00000491263.1_3'UTR	NM_001113380.1|NM_005613.5	NP_001106851.1|NP_005604.1	P49798	RGS4_HUMAN	regulator of G-protein signaling 4						inactivation of MAPK activity (GO:0000188)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	calmodulin binding (GO:0005516)|GTPase activator activity (GO:0005096)			breast(3)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|upper_aerodigestive_tract(2)	21						CCTCAACAGGGATATAGGTCT	0.478																																					Ovarian(76;1257 1738 3039 6086)												0								ENSG00000117152						95.0	96.0	95.0					1																	163044073		2203	4300	6503	RGS4	SO:0001627	intron_variant	0			-	HGNC	BC051869	CCDS1243.1, CCDS44270.1, CCDS44271.1, CCDS44272.1	1q23.3	2008-05-14	2007-08-14		ENSG00000117152	ENSG00000117152		"""Regulators of G-protein signaling"""	10000	protein-coding gene	gene with protein product		602516	"""regulator of G-protein signalling 4"", ""schizophrenia disorder 9"""	SCZD9		8602223, 8756726	Standard	NM_001102445		Approved		uc001gcl.4	P49798	OTTHUMG00000034417	ENST00000367909.6:c.379-38G>A	1.37:g.163044073G>A		Somatic	0	36	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	35	23.91	A7XA56|A7XA58|A7XA59|A7YVV7|B1APZ3	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000367909.6	37	NULL	CCDS1243.1	1																																																																																			-	-		0.478	RGS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGS4	protein_coding	OTTHUMT00000083197.2	G	NM_005613	-		163044073	+1	no_errors	ENST00000491263	ensembl	human	known	74_37	rna	SNP	0.000	A
DPY19L2P1	554236	genome.wustl.edu	37	7	35144265	35144265	+	RNA	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr7:35144265G>A	ENST00000436258.1	-	0	1801							Q6NXN4	D19P1_HUMAN	DPY19L2 pseudogene 1							integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)										CCTGTCGAGAGCATATCAAGG	0.368																																																	0								ENSG00000189212																																			DPY19L2P1			0			-	HGNC	BC066987		7p14.2	2014-03-18	2013-09-12		ENSG00000189212	ENSG00000189212			22305	pseudogene	pseudogene			"""dpy-19-like 2 pseudogene 1 (C. elegans)"""				Standard	NR_002833		Approved		uc031swy.1	Q6NXN4	OTTHUMG00000155026		7.37:g.35144265G>A		Somatic	0	80	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	82	16.33	B4E2E3	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000436258.1	37	NULL		7																																																																																			-	-		0.368	DPY19L2P1-002	KNOWN	basic	processed_transcript	DPY19L2P1	pseudogene	OTTHUMT00000338113.1	G		-		35144265	-1	no_errors	ENST00000436258	ensembl	human	known	74_37	rna	SNP	0.984	A
PTPN11	5781	genome.wustl.edu	37	12	112926909	112926909	+	Missense_Mutation	SNP	A	A	T	rs121918470		TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr12:112926909A>T	ENST00000351677.2	+	13	1727	c.1529A>T	c.(1528-1530)cAg>cTg	p.Q510L		NM_002834.3	NP_002825.3	Q06124	PTN11_HUMAN	protein tyrosine phosphatase, non-receptor type 11	514	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.		Q -> P (in LEOPARD1). {ECO:0000269|PubMed:14961557, ECO:0000269|PubMed:15121796, ECO:0000269|PubMed:15690106}.|Q -> R (in NS1). {ECO:0000269|PubMed:15948193}.		abortive mitotic cell cycle (GO:0033277)|activation of MAPK activity (GO:0000187)|atrioventricular canal development (GO:0036302)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|brain development (GO:0007420)|cytokine-mediated signaling pathway (GO:0019221)|DNA damage checkpoint (GO:0000077)|ephrin receptor signaling pathway (GO:0048013)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|face morphogenesis (GO:0060325)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|genitalia development (GO:0048806)|glucose homeostasis (GO:0042593)|heart development (GO:0007507)|hormone metabolic process (GO:0042445)|hormone-mediated signaling pathway (GO:0009755)|innate immune response (GO:0045087)|inner ear development (GO:0048839)|insulin receptor signaling pathway (GO:0008286)|integrin-mediated signaling pathway (GO:0007229)|interferon-gamma-mediated signaling pathway (GO:0060333)|leukocyte migration (GO:0050900)|megakaryocyte development (GO:0035855)|multicellular organismal reproductive process (GO:0048609)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of cortisol secretion (GO:0051463)|negative regulation of growth hormone secretion (GO:0060125)|negative regulation of insulin secretion (GO:0046676)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ growth (GO:0035265)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet formation (GO:0030220)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of hormone secretion (GO:0046887)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of multicellular organism growth (GO:0040014)|regulation of protein export from nucleus (GO:0046825)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|T cell costimulation (GO:0031295)|triglyceride metabolic process (GO:0006641)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	insulin receptor binding (GO:0005158)|non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|autonomic_ganglia(2)|breast(1)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(406)|kidney(2)|large_intestine(6)|lung(16)|ovary(1)|skin(1)|soft_tissue(3)|stomach(3)	451						ACAGAAGCACAGTACCGATTT	0.498			Mis		"""JMML, AML, MDS"""		Noonan Syndrome		Noonan syndrome																															Dom	yes		12	12q24.1	5781	"""protein tyrosine phosphatase, non-receptor type 11"""	yes	L	0			GRCh37	CM043070|CM052358	PTPN11	M	rs121918470	ENSG00000179295						182.0	170.0	174.0					12																	112926909		2203	4300	6503	PTPN11	SO:0001583	missense	0	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	-	HGNC	D13540	CCDS9163.1, CCDS58280.1	12q24.1	2014-09-17	2008-07-31		ENSG00000179295	ENSG00000179295		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"", ""SH2 domain containing"""	9644	protein-coding gene	gene with protein product		176876	"""Noonan syndrome 1"""	NS1		7894486, 1280823	Standard	NM_080601		Approved	BPTP3, SH-PTP2, SHP-2, PTP2C, SHP2	uc001ttx.3	Q06124	OTTHUMG00000134334	ENST00000351677.2:c.1529A>T	12.37:g.112926909A>T	ENSP00000340944:p.Gln510Leu	Somatic	0	36	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	45	25.00	A8K1D9|Q96HD7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_SH2,smart_SH2,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pirsf_Tyr_Pase_non-rcpt_typ-6/11,pfscan_SH2,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt,prints_SH2	p.Q510L	ENST00000351677.2	37	c.1529	CCDS9163.1	12	.	.	.	.	.	.	.	.	.	.	A	32	5.128559	0.94473	.	.	ENSG00000179295	ENST00000351677	D	0.99663	-6.33	5.13	5.13	0.70059	.	0.000000	0.85682	D	0.000000	D	0.99764	0.9904	H	0.97051	3.93	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	D	0.96994	0.9724	10	0.87932	D	0	.	15.2256	0.73348	1.0:0.0:0.0:0.0	.	510	Q06124-2	.	L	510	ENSP00000340944:Q510L	ENSP00000340944:Q510L	Q	+	2	0	PTPN11	111411292	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.910000	0.92685	2.064000	0.61679	0.528000	0.53228	CAG	-	pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pirsf_Tyr_Pase_non-rcpt_typ-6/11,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt		0.498	PTPN11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPN11	protein_coding	OTTHUMT00000259496.2	A		-		112926909	+1	no_errors	ENST00000351677	ensembl	human	known	74_37	missense	SNP	1.000	T
SCN11A	11280	genome.wustl.edu	37	3	38938429	38938429	+	Silent	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr3:38938429G>A	ENST00000302328.3	-	14	2508	c.2310C>T	c.(2308-2310)atC>atT	p.I770I	SCN11A_ENST00000444237.2_Silent_p.I770I|SCN11A_ENST00000456224.3_Silent_p.I770I|SCN11A_ENST00000450244.1_Silent_p.I770I	NM_014139.2	NP_054858.2	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha subunit	770					cell death (GO:0008219)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(3)|biliary_tract(1)|breast(4)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|lung(29)|ovary(3)|pancreas(2)|prostate(12)|skin(14)|upper_aerodigestive_tract(5)|urinary_tract(3)	119				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)|Valproic Acid(DB00313)|Zonisamide(DB00909)	ACATATTTTCGATCCATTCCC	0.473																																																	0								ENSG00000168356						123.0	114.0	117.0					3																	38938429		2203	4300	6503	SCN11A	SO:0001819	synonymous_variant	0			-	HGNC	AF126739	CCDS33737.1	3p22.2	2012-02-26	2007-01-23		ENSG00000168356	ENSG00000168356		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10583	protein-coding gene	gene with protein product		604385	"""sodium channel, voltage-gated, type XI, alpha polypeptide"", ""sodium channel, voltage-gated, type XII, alpha"""	SCN12A		10444332, 16382098	Standard	NM_014139		Approved	Nav1.9, NaN, SNS-2	uc021wvy.1	Q9UI33	OTTHUMG00000048246	ENST00000302328.3:c.2310C>T	3.37:g.38938429G>A		Somatic	0	44	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	47	18.97	A6NN05|C9JD48|C9JR31|Q68K15|Q8NDX3|Q9UHE0|Q9UHM0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_Na_trans_assoc,prints_Na_channel_asu	p.I770	ENST00000302328.3	37	c.2310	CCDS33737.1	3																																																																																			-	pfam_Ion_trans_dom		0.473	SCN11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN11A	protein_coding	OTTHUMT00000109746.4	G	NM_014139	-		38938429	-1	no_errors	ENST00000302328	ensembl	human	known	74_37	silent	SNP	0.086	A
DCAF4	26094	genome.wustl.edu	37	14	73409712	73409712	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr14:73409712G>A	ENST00000358377.2	+	6	662	c.442G>A	c.(442-444)Gag>Aag	p.E148K	DCAF4_ENST00000553457.1_Missense_Mutation_p.E48K|DCAF4_ENST00000394234.2_Missense_Mutation_p.E48K|DCAF4_ENST00000509153.1_Intron|DCAF4_ENST00000353777.3_Intron|DCAF4_ENST00000555042.1_Missense_Mutation_p.E148K	NM_001163509.1|NM_015604.3	NP_001156981.1|NP_056419.2	Q8WV16	DCAF4_HUMAN	DDB1 and CUL4 associated factor 4	148					protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)				NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|skin(1)	22						TTTAGCCCACGAGCTGCGTCT	0.567																																																	0								ENSG00000119599						88.0	76.0	80.0					14																	73409712		2203	4300	6503	DCAF4	SO:0001583	missense	0			-	HGNC	BC018979	CCDS9809.1, CCDS9810.1, CCDS41968.1, CCDS41968.2, CCDS55926.1	14q24.3	2013-01-09	2009-07-17	2009-07-17		ENSG00000119599		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	20229	protein-coding gene	gene with protein product			"""WD repeat domain 21"", ""WD repeat domain 21A"""	WDR21, WDR21A			Standard	NM_015604		Approved	DKFZp434K114	uc010ttr.2	Q8WV16		ENST00000358377.2:c.442G>A	14.37:g.73409712G>A	ENSP00000351147:p.Glu148Lys	Somatic	0	37	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	44	21.43	B4DUT6|G3V522|Q86U31|Q8IV10|Q96K22|Q9Y4P5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.E148K	ENST00000358377.2	37	c.442	CCDS9809.1	14	.	.	.	.	.	.	.	.	.	.	G	34	5.307846	0.95629	.	.	ENSG00000119599	ENST00000358377;ENST00000394234;ENST00000555042;ENST00000553457	T;T;T;T	0.70399	-0.05;-0.42;-0.48;0.68	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	D	0.84037	0.5384	M	0.74881	2.28	0.53688	D	0.999974	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.998;0.999;0.998;0.96	D	0.85161	0.0992	10	0.72032	D	0.01	.	16.7076	0.85376	0.0:0.0:1.0:0.0	.	126;148;148;148	B4DN30;Q8WV16-2;G3V522;Q8WV16	.;.;.;DCAF4_HUMAN	K	148;48;148;48	ENSP00000351147:E148K;ENSP00000377781:E48K;ENSP00000452131:E148K;ENSP00000451186:E48K	ENSP00000351147:E148K	E	+	1	0	DCAF4	72479465	1.000000	0.71417	0.980000	0.43619	0.909000	0.53808	7.113000	0.77095	2.722000	0.93159	0.555000	0.69702	GAG	-	NULL		0.567	DCAF4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DCAF4	protein_coding	OTTHUMT00000361058.1	G	NM_015604	-		73409712	+1	no_errors	ENST00000358377	ensembl	human	known	74_37	missense	SNP	0.999	A
SCN3A	6328	genome.wustl.edu	37	2	165947040	165947040	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr2:165947040C>T	ENST00000360093.3	-	28	6114	c.5623G>A	c.(5623-5625)Gaa>Aaa	p.E1875K	SCN3A_ENST00000409101.3_Missense_Mutation_p.E1826K|AC013463.2_ENST00000431341.1_RNA|SCN3A_ENST00000283254.7_Missense_Mutation_p.E1875K|SCN3A_ENST00000540861.1_Missense_Mutation_p.E358K|SCN3A_ENST00000465043.1_5'Flank	NM_001081677.1	NP_001075146.1	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha subunit	1875					membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(19)|liver(2)|lung(47)|ovary(6)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(3)	120					Lacosamide(DB06218)|Valproic Acid(DB00313)|Zonisamide(DB00909)	AACCTGTCTTCCATCTGTATT	0.448																																																	0								ENSG00000153253						84.0	77.0	80.0					2																	165947040		2203	4300	6503	SCN3A	SO:0001583	missense	0			-	HGNC	AF035685	CCDS33312.1, CCDS46440.1	2q24	2012-02-26	2007-01-23		ENSG00000153253	ENSG00000153253		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10590	protein-coding gene	gene with protein product		182391	"""sodium channel, voltage-gated, type III, alpha polypeptide"""			9589372, 16382098	Standard	NM_001081676		Approved	Nav1.3	uc002ucx.3	Q9NY46	OTTHUMG00000044171	ENST00000360093.3:c.5623G>A	2.37:g.165947040C>T	ENSP00000353206:p.Glu1875Lys	Somatic	0	30	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	43	15.69	Q16142|Q53SX0|Q9BZB3|Q9C006|Q9NYK2|Q9P2J1|Q9UPD1|Q9Y6P4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_DUF3451,pfam_Na_trans_assoc,pfam_PKD1_2_channel,pfscan_IQ_motif_EF-hand-BS,prints_Na_channel_asu,prints_PKD_2	p.E1875K	ENST00000360093.3	37	c.5623		2	.	.	.	.	.	.	.	.	.	.	C	22.9	4.345948	0.82022	.	.	ENSG00000153253	ENST00000360093;ENST00000283254;ENST00000409101;ENST00000540861	D;D;D;D	0.97303	-4.12;-4.12;-4.04;-4.33	5.92	5.92	0.95590	.	0.000000	0.64402	D	0.000002	D	0.98871	0.9618	M	0.91406	3.205	0.80722	D	1	D;D;D	0.89917	0.993;0.985;1.0	D;D;D	0.91635	0.989;0.967;0.999	D	0.99297	1.0900	10	0.87932	D	0	.	20.3214	0.98679	0.0:1.0:0.0:0.0	.	1826;1826;1875	Q9NY46-2;Q9NY46-4;Q9NY46-3	.;.;.	K	1875;1875;1826;358	ENSP00000353206:E1875K;ENSP00000283254:E1875K;ENSP00000386726:E1826K;ENSP00000439920:E358K	ENSP00000283254:E1875K	E	-	1	0	SCN3A	165655286	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.818000	0.86416	2.804000	0.96469	0.655000	0.94253	GAA	-	NULL		0.448	SCN3A-201	KNOWN	basic|appris_candidate_longest	protein_coding	SCN3A	protein_coding		C	NM_006922	-		165947040	-1	no_errors	ENST00000283254	ensembl	human	known	74_37	missense	SNP	1.000	T
PIK3C2G	5288	genome.wustl.edu	37	12	18715756	18715756	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr12:18715756C>T	ENST00000266497.5	+	25	3625	c.3587C>T	c.(3586-3588)tCc>tTc	p.S1196F	PIK3C2G_ENST00000538779.1_Missense_Mutation_p.S1237F|PIK3C2G_ENST00000433979.1_Missense_Mutation_p.S1196F			O75747	P3C2G_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 gamma	1196					chemotaxis (GO:0006935)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol phosphate kinase activity (GO:0016307)			breast(5)|central_nervous_system(6)|endometrium(2)|kidney(4)|large_intestine(8)|lung(31)|ovary(2)|prostate(1)|skin(2)|stomach(4)|upper_aerodigestive_tract(1)	66		Hepatocellular(102;0.194)				CCTCAGGAATCCTGTTTGCTG	0.398																																																	0								ENSG00000139144						110.0	108.0	108.0					12																	18715756		1866	4103	5969	PIK3C2G	SO:0001583	missense	0			-	HGNC	AJ000008	CCDS44839.1, CCDS73452.1	12p12	2012-07-13	2012-07-13		ENSG00000139144	ENSG00000139144	2.7.1.154		8973	protein-coding gene	gene with protein product		609001	"""phosphoinositide-3-kinase, class 2, gamma polypeptide"""			9878262	Standard	XM_005253393		Approved		uc001rdt.3	O75747	OTTHUMG00000168841	ENST00000266497.5:c.3587C>T	12.37:g.18715756C>T	ENSP00000266497:p.Ser1196Phe	Somatic	0	33	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	46	17.86	A1L3U0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PI3/4_kinase_cat_dom,pfam_PInositide-3_kin_accessory_dom,pfam_PI3K_C2_dom,pfam_Phox,pfam_PI3K_Ras-bd_dom,pfam_C2_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_dom,superfamily_Phox,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,smart_Phox,smart_C2_dom,pfscan_Phox,pfscan_PI3/4_kinase_cat_dom	p.S1237F	ENST00000266497.5	37	c.3710	CCDS44839.1	12	.	.	.	.	.	.	.	.	.	.	C	10.26	1.301362	0.23736	.	.	ENSG00000139144	ENST00000433979;ENST00000266497;ENST00000538779	T;T;T	0.61040	0.14;0.14;0.16	3.9	2.99	0.34606	Phox homologous domain (2);	1.607240	0.03435	N	0.208438	T	0.62159	0.2405	L	0.54323	1.7	0.34608	D	0.717277	P;P;P	0.50443	0.893;0.935;0.868	B;P;B	0.48815	0.387;0.591;0.312	T	0.56854	-0.7910	10	0.20519	T	0.43	-4.9419	10.8801	0.46933	0.0:0.5987:0.4012:0.0	.	1236;1237;1196	B7ZLY6;F5H369;O75747	.;.;P3C2G_HUMAN	F	1196;1196;1237	ENSP00000404845:S1196F;ENSP00000266497:S1196F;ENSP00000445381:S1237F	ENSP00000266497:S1196F	S	+	2	0	PIK3C2G	18607023	0.214000	0.23563	0.966000	0.40874	0.275000	0.26752	1.535000	0.36061	1.213000	0.43380	0.591000	0.81541	TCC	-	superfamily_Phox		0.398	PIK3C2G-002	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	PIK3C2G	protein_coding	OTTHUMT00000401316.1	C	NM_004570	-		18715756	+1	no_errors	ENST00000538779	ensembl	human	known	74_37	missense	SNP	0.887	T
FLNA	2316	genome.wustl.edu	37	X	153583286	153583286	+	Silent	SNP	G	G	A	rs368399445		TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chrX:153583286G>A	ENST00000369850.3	-	31	5360	c.5124C>T	c.(5122-5124)ttC>ttT	p.F1708F	FLNA_ENST00000422373.1_Silent_p.F1700F|FLNA_ENST00000369856.3_5'UTR|FLNA_ENST00000360319.4_Silent_p.F1700F|FLNA_ENST00000344736.4_Silent_p.F1700F	NM_001110556.1	NP_001104026.1	P21333	FLNA_HUMAN	filamin A, alpha	1708					actin crosslink formation (GO:0051764)|actin cytoskeleton reorganization (GO:0031532)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|blood coagulation (GO:0007596)|cell junction assembly (GO:0034329)|cilium assembly (GO:0042384)|cytoplasmic sequestering of protein (GO:0051220)|early endosome to late endosome transport (GO:0045022)|epithelial to mesenchymal transition (GO:0001837)|establishment of protein localization (GO:0045184)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription factor import into nucleus (GO:0042993)|protein localization to cell surface (GO:0034394)|protein stabilization (GO:0050821)|receptor clustering (GO:0043113)|spindle assembly involved in mitosis (GO:0090307)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|apical dendrite (GO:0097440)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|Myb complex (GO:0031523)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|Fc-gamma receptor I complex binding (GO:0034988)|glycoprotein binding (GO:0001948)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|Rac GTPase binding (GO:0048365)|Ral GTPase binding (GO:0017160)|Rho GTPase binding (GO:0017048)|signal transducer activity (GO:0004871)|small GTPase binding (GO:0031267)|transcription factor binding (GO:0008134)			breast(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					AGAAGATGTCGAAAGTGCCGT	0.597											OREG0003595	type=REGULATORY REGION|Gene=FLNA|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																																					0								ENSG00000196924	G	,	0,3791		0,0,1610,571	58.0	60.0	59.0		5124,5100	-4.3	0.9	X		59	1,6661		0,1,2413,1834	no	coding-synonymous,coding-synonymous	FLNA	NM_001110556.1,NM_001456.3	,	0,1,4023,2405	AA,AG,GG,G		0.015,0.0,0.0096	,	1708/2648,1700/2640	153583286	1,10452	2181	4248	6429	FLNA	SO:0001819	synonymous_variant	0			-	HGNC	X70082	CCDS44021.1, CCDS48194.1	Xq28	2009-07-23	2009-07-23		ENSG00000196924	ENSG00000196924			3754	protein-coding gene	gene with protein product	"""actin binding protein 280"""	300017	"""filamin A, alpha (actin binding protein 280)"""	FLN1, FLN, OPD2, OPD1		8406501, 12612583	Standard	NM_001456		Approved	ABP-280	uc004fkk.2	P21333	OTTHUMG00000022712	ENST00000369850.3:c.5124C>T	X.37:g.153583286G>A		Somatic	0	39	0.00	1756	0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	36	30.77	E9KL45|Q5HY53|Q5HY55|Q8NF52	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Filamin/ABP280_repeat-like,pfam_CH-domain,superfamily_CH-domain,superfamily_Ig_E-set,smart_CH-domain,smart_Filamin,pfscan_CH-domain,pfscan_Filamin/ABP280_repeat-like	p.F1708	ENST00000369850.3	37	c.5124	CCDS48194.1	X																																																																																			-	pfam_Filamin/ABP280_repeat-like,superfamily_Ig_E-set,smart_Filamin,pfscan_Filamin/ABP280_repeat-like		0.597	FLNA-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FLNA	protein_coding	OTTHUMT00000058942.3	G		-		153583286	-1	no_errors	ENST00000369850	ensembl	human	known	74_37	silent	SNP	0.965	A
CENPT	80152	genome.wustl.edu	37	16	67864385	67864385	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr16:67864385G>A	ENST00000562787.1	-	11	1318	c.770C>T	c.(769-771)tCc>tTc	p.S257F	CENPT_ENST00000440851.2_Missense_Mutation_p.S257F|CENPT_ENST00000564817.1_Missense_Mutation_p.S257F|CENPT_ENST00000219172.3_Missense_Mutation_p.S257F|CENPT_ENST00000562947.1_5'UTR	NM_025082.3	NP_079358.3	Q96BT3	CENPT_HUMAN	centromere protein T	257	Flexible stalk domain. {ECO:0000250}.				chromosome organization (GO:0051276)|chromosome segregation (GO:0007059)|kinetochore assembly (GO:0051382)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|lung(6)|urinary_tract(1)	10		Acute lymphoblastic leukemia(13;0.000299)|all_hematologic(13;0.0184)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00429)|Epithelial(162;0.019)|all cancers(182;0.124)		GCAGGGCAGGGAGTGATACAC	0.592																																																	0								ENSG00000102901						84.0	98.0	93.0					16																	67864385		2119	4231	6350	CENPT	SO:0001583	missense	0			-	HGNC	AK056097	CCDS42182.1	16q22.1	2013-11-05	2006-06-15	2006-06-15		ENSG00000102901			25787	protein-coding gene	gene with protein product		611510	"""chromosome 16 open reading frame 56"""	C16orf56		16622420, 16622419	Standard	NM_025082		Approved	FLJ13111, CENP-T	uc002eun.4	Q96BT3		ENST00000562787.1:c.770C>T	16.37:g.67864385G>A	ENSP00000457810:p.Ser257Phe	Somatic	0	27	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	38	22.45	Q96I29|Q96IC6|Q96NK9|Q9H901	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_Histone-fold	p.S257F	ENST00000562787.1	37	c.770	CCDS42182.1	16	.	.	.	.	.	.	.	.	.	.	G	14.99	2.700472	0.48307	.	.	ENSG00000102901	ENST00000440851;ENST00000219172	T;T	0.50548	0.74;0.74	5.2	2.1	0.27182	.	0.310402	0.28488	N	0.015178	T	0.43765	0.1262	M	0.74881	2.28	0.09310	N	0.999999	B;B	0.24882	0.113;0.053	B;B	0.26864	0.074;0.037	T	0.45234	-0.9275	10	0.62326	D	0.03	-6.7762	5.1451	0.14981	0.178:0.0:0.6561:0.1659	.	257;257	Q96BT3;B3KPB2	CENPT_HUMAN;.	F	257	ENSP00000400140:S257F;ENSP00000219172:S257F	ENSP00000219172:S257F	S	-	2	0	CENPT	66421886	1.000000	0.71417	0.008000	0.14137	0.025000	0.11179	2.675000	0.46875	0.395000	0.25257	0.563000	0.77884	TCC	-	NULL		0.592	CENPT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CENPT	protein_coding	OTTHUMT00000422020.1	G	NM_025082	-		67864385	-1	no_errors	ENST00000219172	ensembl	human	known	74_37	missense	SNP	0.036	A
LINC00943	100507206	genome.wustl.edu	37	12	127229561	127229561	+	lincRNA	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr12:127229561G>A	ENST00000535544.1	+	0	1578				LINC00944_ENST00000540684.1_lincRNA					long intergenic non-protein coding RNA 943																		GAGAGTCAAGGGATTGGATTG	0.413																																																	0								ENSG00000189238																																			LINC00943			0			-	HGNC			12q24.32	2013-05-30			ENSG00000189238	ENSG00000189238		"""Long non-coding RNAs"""	48639	non-coding RNA	RNA, long non-coding							Standard	NR_038256		Approved				OTTHUMG00000168479		12.37:g.127229561G>A		Somatic	0	77	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	88	20.00		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000535544.1	37	NULL		12																																																																																			-	-		0.413	LINC00943-002	KNOWN	basic	lincRNA	LINC00943	lincRNA	OTTHUMT00000399867.1	G		-		127229561	+1	no_errors	ENST00000345111	ensembl	human	known	74_37	rna	SNP	0.038	A
OBSCN	84033	genome.wustl.edu	37	1	228487765	228487765	+	Intron	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr1:228487765C>T	ENST00000422127.1	+	43	11703				OBSCN_ENST00000366709.4_Intron|OBSCN_ENST00000366707.4_Missense_Mutation_p.R1243C|OBSCN_ENST00000284548.11_Intron|OBSCN_ENST00000359599.6_3'UTR|RP5-1139B12.4_ENST00000602778.1_RNA|OBSCN_ENST00000570156.2_Missense_Mutation_p.R4553C|OBSCN_ENST00000602685.1_3'UTR	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF						apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				GCTGCAGATTCGTGGCCTGGT	0.577																																																	0								ENSG00000154358						127.0	103.0	110.0					1																	228487765		876	1991	2867	OBSCN	SO:0001627	intron_variant	0			-	HGNC	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.11659+5021C>T	1.37:g.228487765C>T		Somatic	0	37	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	51	13.56	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_DH-domain,pfam_Fibronectin_type3,pfam_IQ_motif_EF-hand-BS,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_IQ_motif_EF-hand-BS,smart_DH-domain,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,pfscan_DH-domain	p.R1243C	ENST00000422127.1	37	c.3727	CCDS58065.1	1	.	.	.	.	.	.	.	.	.	.	C	11.98	1.799566	0.31869	.	.	ENSG00000154358	ENST00000366707	T	0.68479	-0.33	4.37	1.33	0.21861	.	.	.	.	.	T	0.61274	0.2334	.	.	.	0.09310	N	0.999991	.	.	.	.	.	.	T	0.52495	-0.8568	6	0.39692	T	0.17	.	9.0235	0.36215	0.0:0.6106:0.0:0.3894	.	.	.	.	C	1243	ENSP00000355668:R1243C	ENSP00000355668:R1243C	R	+	1	0	OBSCN	226554388	0.000000	0.05858	0.349000	0.25694	0.011000	0.07611	-0.085000	0.11250	0.440000	0.26502	0.561000	0.74099	CGT	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like_dom		0.577	OBSCN-204	KNOWN	basic|CCDS	protein_coding	OBSCN	protein_coding		C	NM_052843	-		228487765	+1	no_errors	ENST00000366707	ensembl	human	known	74_37	missense	SNP	0.022	T
DNAH10	196385	genome.wustl.edu	37	12	124363844	124363844	+	Nonsense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr12:124363844G>A	ENST00000409039.3	+	48	8077	c.8052G>A	c.(8050-8052)tgG>tgA	p.W2684*		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	2684					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		TGAGAGTCTGGAGGAATGAGT	0.512																																																	0								ENSG00000197653						46.0	46.0	46.0					12																	124363844		1968	4165	6133	DNAH10	SO:0001587	stop_gained	0			-	HGNC	AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.8052G>A	12.37:g.124363844G>A	ENSP00000386770:p.Trp2684*	Somatic	0	25	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	38	15.22	C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,superfamily_PyrdxlP-dep_Trfase,smart_AAA+_ATPase	p.W2684*	ENST00000409039.3	37	c.8052	CCDS9255.2	12	.	.	.	.	.	.	.	.	.	.	G	50	16.335834	0.99861	.	.	ENSG00000197653	ENST00000409039	.	.	.	5.89	5.89	0.94794	.	0.000000	0.64402	U	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	20.2617	0.98447	0.0:0.0:1.0:0.0	.	.	.	.	X	2684	.	ENSP00000386770:W2684X	W	+	3	0	DNAH10	122929797	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.869000	0.99810	2.793000	0.96121	0.655000	0.94253	TGG	-	superfamily_P-loop_NTPase		0.512	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH10	protein_coding	OTTHUMT00000335420.3	G		-		124363844	+1	no_errors	ENST00000409039	ensembl	human	known	74_37	nonsense	SNP	1.000	A
ZNF358	140467	genome.wustl.edu	37	19	7585743	7585743	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr19:7585743C>T	ENST00000597229.1	+	2	1785	c.1615C>T	c.(1615-1617)Ccc>Tcc	p.P539S	CTD-2207O23.11_ENST00000602083.1_RNA|ZNF358_ENST00000394341.2_Missense_Mutation_p.P539S|MCOLN1_ENST00000264079.6_5'Flank	NM_018083.4	NP_060553.4	Q9NW07	ZN358_HUMAN	zinc finger protein 358	539					embryonic forelimb morphogenesis (GO:0035115)|neural tube development (GO:0021915)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|kidney(1)|lung(1)|skin(2)	8						CCCCTGTTCTCCCACTCGTGG	0.652																																																	0								ENSG00000198816						105.0	81.0	89.0					19																	7585743		2203	4300	6503	ZNF358	SO:0001583	missense	0			-	HGNC	AK001252	CCDS32890.2	19p13.2	2013-01-08			ENSG00000198816	ENSG00000198816		"""Zinc fingers, C2H2-type"""	16838	protein-coding gene	gene with protein product							Standard	NM_018083		Approved	FLJ10390, ZFEND	uc002mgn.2	Q9NW07		ENST00000597229.1:c.1615C>T	19.37:g.7585743C>T	ENSP00000472305:p.Pro539Ser	Somatic	0	47	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	61	20.78	Q9BTM7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P539S	ENST00000597229.1	37	c.1615	CCDS32890.2	19	.	.	.	.	.	.	.	.	.	.	C	14.44	2.535410	0.45176	.	.	ENSG00000198816	ENST00000361576;ENST00000394341	T	0.07216	3.21	4.23	0.812	0.18744	.	.	.	.	.	T	0.03783	0.0107	N	0.24115	0.695	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.45629	-0.9248	9	0.02654	T	1	.	2.6012	0.04867	0.3344:0.4093:0.1628:0.0936	.	539	Q9NW07	ZN358_HUMAN	S	539	ENSP00000377873:P539S	ENSP00000354703:P539S	P	+	1	0	ZNF358	7491743	0.000000	0.05858	0.016000	0.15963	0.008000	0.06430	-0.327000	0.07955	0.295000	0.22570	-0.182000	0.12963	CCC	-	NULL		0.652	ZNF358-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF358	protein_coding	OTTHUMT00000316747.1	C		-		7585743	+1	no_errors	ENST00000394341	ensembl	human	known	74_37	missense	SNP	0.011	T
TTN	7273	genome.wustl.edu	37	2	179427137	179427137	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr2:179427137C>T	ENST00000591111.1	-	276	79023	c.78799G>A	c.(78799-78801)Gaa>Aaa	p.E26267K	TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.E18968K|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.E19035K|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.E18843K|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.E27908K|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.E25340K|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000591332.1_RNA			Q8WZ42	TITIN_HUMAN	titin	26267	Fibronectin type-III 91. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTCCACTTTTCACTCCCTTTA	0.433																																																	0								ENSG00000155657						100.0	96.0	98.0					2																	179427137		1939	4153	6092	TTN	SO:0001583	missense	0			-	HGNC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.78799G>A	2.37:g.179427137C>T	ENSP00000465570:p.Glu26267Lys	Somatic	0	50	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	55	26.32	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.E25340K	ENST00000591111.1	37	c.76018		2	.	.	.	.	.	.	.	.	.	.	C	16.82	3.228079	0.58777	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.58506	0.33;0.33;0.33;0.33	5.89	5.89	0.94794	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.57417	0.2052	L	0.46819	1.47	0.58432	D	0.999998	P;P;P;P	0.43231	0.801;0.801;0.801;0.684	B;B;B;B	0.40741	0.339;0.339;0.339;0.258	T	0.61802	-0.6988	9	0.87932	D	0	.	20.2618	0.98447	0.0:1.0:0.0:0.0	.	18843;18968;19035;26267	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	K	25340;18843;19035;18968;18841	ENSP00000343764:E25340K;ENSP00000434586:E18843K;ENSP00000340554:E19035K;ENSP00000352154:E18968K	ENSP00000340554:E19035K	E	-	1	0	TTN	179135383	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.361000	0.52306	2.793000	0.96121	0.655000	0.94253	GAA	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.433	TTN-019	PUTATIVE	basic	protein_coding	TTN	protein_coding	OTTHUMT00000460310.1	C	NM_133378	-		179427137	-1	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	SNP	1.000	T
INF2	64423	genome.wustl.edu	37	14	105180850	105180850	+	Silent	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr14:105180850C>T	ENST00000392634.4	+	21	3463	c.3351C>T	c.(3349-3351)tcC>tcT	p.S1117S	INF2_ENST00000330634.7_Silent_p.S1117S	NM_022489.3	NP_071934.3	Q27J81	INF2_HUMAN	inverted formin, FH2 and WH2 domain containing	1117					actin cytoskeleton organization (GO:0030036)|cell death (GO:0008219)|regulation of cellular component size (GO:0032535)|regulation of mitochondrial fission (GO:0090140)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)				large_intestine(3)|lung(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	8		all_cancers(154;0.0896)|Melanoma(154;0.155)|all_epithelial(191;0.172)	all cancers(16;0.00188)|OV - Ovarian serous cystadenocarcinoma(23;0.0191)|Epithelial(46;0.047)|GBM - Glioblastoma multiforme(11;0.116)	Epithelial(152;0.176)		TCAAGTTCTCCAGCAACCAGC	0.642																																																	0								ENSG00000203485						36.0	43.0	41.0					14																	105180850		2026	4178	6204	INF2	SO:0001819	synonymous_variant	0			-	HGNC	AK025709	CCDS9989.2, CCDS45173.1	14q32.33	2009-09-07	2007-11-29	2007-11-29	ENSG00000203485	ENSG00000203485			23791	protein-coding gene	gene with protein product	"""inverted formin 2"""	610982	"""chromosome 14 open reading frame 151"", ""chromosome 14 open reading frame 173"""	C14orf151, C14orf173		16818491	Standard	NM_001031714		Approved	MGC13251	uc001ypb.2	Q27J81	OTTHUMG00000029811	ENST00000392634.4:c.3351C>T	14.37:g.105180850C>T		Somatic	0	56	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	69	13.75	Q27J83|Q69YL8|Q6P1X7|Q6PK22|Q86TR7|Q9BRM1|Q9H6N1	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_FH2_Formin,pfam_FH3_dom,pfam_GTPase-bd,pfam_WH2_dom,superfamily_ARM-type_fold,smart_FH2_Formin,pfscan_WH2_dom	p.S1117	ENST00000392634.4	37	c.3351	CCDS9989.2	14																																																																																			-	NULL		0.642	INF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	INF2	protein_coding	OTTHUMT00000074371.4	C	NM_022489	-		105180850	+1	no_errors	ENST00000392634	ensembl	human	known	74_37	silent	SNP	0.000	T
OR4C15	81309	genome.wustl.edu	37	11	55322124	55322124	+	Silent	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr11:55322124C>T	ENST00000314644.2	+	1	342	c.342C>T	c.(340-342)ttC>ttT	p.F114F		NM_001001920.1	NP_001001920.1	Q8NGM1	OR4CF_HUMAN	olfactory receptor, family 4, subfamily C, member 15	60						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(31)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(5)	56						CTATGTACTTCTTCTTGGGCT	0.443										HNSCC(20;0.049)																																							0								ENSG00000181939						179.0	142.0	155.0					11																	55322124		2201	4296	6497	OR4C15	SO:0001819	synonymous_variant	0			-	HGNC	BK004319	CCDS31501.1	11q11	2012-08-09			ENSG00000181939	ENSG00000181939		"""GPCR / Class A : Olfactory receptors"""	15171	protein-coding gene	gene with protein product							Standard	NM_001001920		Approved		uc010rig.2	Q8NGM1	OTTHUMG00000166714	ENST00000314644.2:c.342C>T	11.37:g.55322124C>T		Somatic	0	65	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	79	21.57	Q6IFE2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.F114	ENST00000314644.2	37	c.342	CCDS31501.1	11																																																																																			-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.443	OR4C15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4C15	protein_coding	OTTHUMT00000391164.1	C	NM_001001920	-		55322124	+1	no_errors	ENST00000314644	ensembl	human	known	74_37	silent	SNP	0.976	T
NDRG4	65009	genome.wustl.edu	37	16	58545342	58545342	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr16:58545342G>A	ENST00000570248.1	+	15	1027	c.921G>A	c.(919-921)atG>atA	p.M307I	NDRG4_ENST00000568640.1_Missense_Mutation_p.M312I|NDRG4_ENST00000566192.1_Missense_Mutation_p.M294I|NDRG4_ENST00000394279.2_Missense_Mutation_p.M326I|NDRG4_ENST00000356752.4_Missense_Mutation_p.M324I|NDRG4_ENST00000258187.5_Missense_Mutation_p.M326I|NDRG4_ENST00000394282.4_Missense_Mutation_p.M346I|NDRG4_ENST00000563799.1_Missense_Mutation_p.M312I|NDRG4_ENST00000562999.1_Missense_Mutation_p.M282I|NDRG4_ENST00000569923.1_Missense_Mutation_p.M239I	NM_001242835.1	NP_001229764.1	Q9ULP0	NDRG4_HUMAN	NDRG family member 4	307					cell differentiation (GO:0030154)|cell growth (GO:0016049)|response to stress (GO:0006950)	cytoplasm (GO:0005737)				breast(1)|endometrium(3)|large_intestine(1)|lung(3)|ovary(1)|skin(1)|urinary_tract(1)	11						CAGCCAGCATGACCCGCCTGG	0.672																																																	0								ENSG00000103034						67.0	66.0	66.0					16																	58545342		2198	4298	6496	NDRG4	SO:0001583	missense	0			-	HGNC	AB044947	CCDS10797.1, CCDS45500.1, CCDS55999.1, CCDS58465.1, CCDS58466.1, CCDS58467.1	16q21-q22.3	2008-07-04			ENSG00000103034	ENSG00000103034			14466	protein-coding gene	gene with protein product		614463				11352569, 16408304	Standard	NM_020465		Approved	KIAA1180, SMAP-8	uc002enk.3	Q9ULP0	OTTHUMG00000133485	ENST00000570248.1:c.921G>A	16.37:g.58545342G>A	ENSP00000457659:p.Met307Ile	Somatic	0	70	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	108	21.17	B3KNU2|B4DK66|B4DSW5|H7C600|Q6ZNE7|Q6ZTI7|Q96PL9|Q9GZM1|Q9GZN3|Q9GZX0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ndr	p.M346I	ENST00000570248.1	37	c.1038	CCDS58466.1	16	.	.	.	.	.	.	.	.	.	.	G	22.8	4.343119	0.82022	.	.	ENSG00000103034	ENST00000258187;ENST00000421602;ENST00000394282;ENST00000394279;ENST00000356752	T;T;T;T	0.19806	2.13;2.12;2.13;2.12	5.57	4.61	0.57282	.	0.000000	0.85682	D	0.000000	T	0.32466	0.0830	M	0.71871	2.18	0.51767	D	0.999934	P;D;D;P;P;P;P	0.60160	0.945;0.987;0.973;0.803;0.931;0.949;0.949	B;P;P;B;B;P;P	0.51516	0.388;0.625;0.672;0.221;0.294;0.546;0.546	T	0.10382	-1.0632	10	0.66056	D	0.02	-33.1248	9.2156	0.37344	0.0758:0.1472:0.777:0.0	.	312;324;312;294;307;346;326	B4DK66;B4DSW5;Q9ULP0-5;Q9ULP0-2;Q9ULP0;Q9ULP0-6;Q9ULP0-3	.;.;.;.;NDRG4_HUMAN;.;.	I	326;252;346;326;324	ENSP00000258187:M326I;ENSP00000377823:M346I;ENSP00000377820:M326I;ENSP00000349193:M324I	ENSP00000258187:M326I	M	+	3	0	NDRG4	57102843	1.000000	0.71417	1.000000	0.80357	0.903000	0.53119	7.690000	0.84178	1.338000	0.45544	0.655000	0.94253	ATG	-	NULL		0.672	NDRG4-009	KNOWN	basic|CCDS	protein_coding	NDRG4	protein_coding	OTTHUMT00000422671.2	G		-		58545342	+1	no_errors	ENST00000394282	ensembl	human	known	74_37	missense	SNP	1.000	A
C1orf87	127795	genome.wustl.edu	37	1	60463384	60463384	+	Silent	SNP	G	G	A	rs368478097		TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr1:60463384G>A	ENST00000371201.3	-	11	1484	c.1377C>T	c.(1375-1377)ttC>ttT	p.F459F	C1orf87_ENST00000395552.1_Silent_p.F93F|C1orf87_ENST00000486478.1_5'UTR|C1orf87_ENST00000450089.2_Silent_p.F230F	NM_152377.2	NP_689590.1	Q8N0U7	CA087_HUMAN	chromosome 1 open reading frame 87	459							calcium ion binding (GO:0005509)			breast(2)|endometrium(2)|large_intestine(6)|lung(19)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	33						CTGGATTCACGAAGGGCTGGG	0.502																																					NSCLC(75;811 1386 4923 13371 51772)												0								ENSG00000162598	G		0,4406		0,0,2203	119.0	115.0	117.0		1377	-10.6	0.0	1		117	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	C1orf87	NM_152377.2		0,2,6501	AA,AG,GG		0.0233,0.0,0.0154		459/547	60463384	2,13004	2203	4300	6503	C1orf87	SO:0001819	synonymous_variant	0			-	HGNC	AK124828	CCDS614.1	1p32.1	2014-04-03			ENSG00000162598	ENSG00000162598			28547	protein-coding gene	gene with protein product	"""carcinoma-related EF-hand protein"""					12477932	Standard	NM_152377		Approved	MGC34837, CREF	uc001czs.2	Q8N0U7	OTTHUMG00000008992	ENST00000371201.3:c.1377C>T	1.37:g.60463384G>A		Somatic	0	70	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	87	20.18	Q6ZU07|Q8IVS0	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.F459	ENST00000371201.3	37	c.1377	CCDS614.1	1																																																																																			-	NULL		0.502	C1orf87-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf87	protein_coding	OTTHUMT00000024943.1	G	NM_152377	-		60463384	-1	no_errors	ENST00000371201	ensembl	human	known	74_37	silent	SNP	0.000	A
NCR3	259197	genome.wustl.edu	37	6	31556769	31556769	+	3'UTR	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr6:31556769G>A	ENST00000340027.5	-	0	944				NCR3_ENST00000491161.1_5'UTR|NCR3_ENST00000376073.4_3'UTR	NM_147130.2	NP_667341.1	O14931	NCTR3_HUMAN	natural cytotoxicity triggering receptor 3						cell recognition (GO:0008037)|immune response (GO:0006955)|inflammatory response (GO:0006954)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)	integral component of plasma membrane (GO:0005887)				cervix(1)|large_intestine(2)|liver(1)|lung(2)|ovary(1)|skin(2)	9						GAGGGTATGTGTGGGCCTGGC	0.542																																																	0								ENSG00000204475																																			NCR3	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AB055881	CCDS34397.1, CCDS47401.1, CCDS47402.1	6p21.3	2013-01-11	2002-11-13	2002-11-15	ENSG00000204475	ENSG00000204475		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	19077	protein-coding gene	gene with protein product		611550	"""lymphocyte antigen 117"""	LY117		8824804, 11782277	Standard	NM_001145466		Approved	1C7, NKp30, CD337	uc003nuv.2	O14931	OTTHUMG00000031123	ENST00000340027.5:c.*75C>T	6.37:g.31556769G>A		Somatic	0	31	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00	B0S8F2|B0S8F4|B0S8F5|O14930|O14932|O95667|O95668|O95669|Q5ST89|Q5ST90|Q5ST91|Q5ST92|Q5STA3	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000340027.5	37	NULL	CCDS34397.1	6																																																																																			-	-		0.542	NCR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NCR3	protein_coding	OTTHUMT00000076210.2	G		-		31556769	-1	no_errors	ENST00000491161	ensembl	human	known	74_37	rna	SNP	0.000	A
CDK5RAP3	80279	genome.wustl.edu	37	17	46058895	46058895	+	3'UTR	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr17:46058895C>T	ENST00000338399.4	+	0	1654				CDK5RAP3_ENST00000578663.1_3'UTR|RP11-6N17.10_ENST00000578239.1_RNA|CDK5RAP3_ENST00000536708.2_3'UTR	NM_176096.1	NP_788276.1	Q96JB5	CK5P3_HUMAN	CDK5 regulatory subunit associated protein 3						brain development (GO:0007420)|protein ufmylation (GO:0071569)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of neuron differentiation (GO:0045664)	membrane (GO:0016020)	protein kinase binding (GO:0019901)			NS(1)|central_nervous_system(2)|cervix(3)|endometrium(3)|large_intestine(2)|lung(5)|prostate(1)|skin(1)	18						GCCTGCCCATCTTCTCCGCTT	0.537																																																	0								ENSG00000108465						67.0	67.0	67.0					17																	46058895		1933	4123	6056	CDK5RAP3	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AF110322	CCDS42356.1, CCDS62232.1	17q21.2	2008-07-18				ENSG00000108465			18673	protein-coding gene	gene with protein product	"""ischemic heart CDK5 activator-binding protein C53"", ""LXXLL/leucine-zipper-containing ARFbinding protein"""	608202				10721722	Standard	NM_176096		Approved	MST016, FLJ13660, C53, IC53, HSF-27, OK/SW-cl.114, LZAP	uc010wlc.3	Q96JB5		ENST00000338399.4:c.*27C>T	17.37:g.46058895C>T		Somatic	0	49	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	59	18.06	B7Z6N4|D3DTU1|D3DTU2|F5H3I5|Q53FA2|Q9H3F8|Q9H8G0|Q9HBR9	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000338399.4	37	NULL	CCDS42356.1	17																																																																																			-	-		0.537	CDK5RAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDK5RAP3	protein_coding	OTTHUMT00000442913.1	C	NM_176096	-		46058895	+1	no_errors	ENST00000578663	ensembl	human	known	74_37	rna	SNP	0.005	T
MANEA	79694	genome.wustl.edu	37	6	96034881	96034882	+	Intron	INS	-	-	TATATG	rs148967607|rs112818736|rs3087829|rs78175628|rs57145057	byFrequency	TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr6:96034881_96034882insTATATG	ENST00000358812.4	+	2	678				MANEA_ENST00000369293.1_In_Frame_Ins_p.189_190YV>YICV	NM_024641.3	NP_078917.2	Q5SRI9	MANEA_HUMAN	mannosidase, endo-alpha						cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	glycoprotein endo-alpha-1,2-mannosidase activity (GO:0004569)			breast(2)|endometrium(3)|kidney(2)|liver(2)|lung(13)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	26		all_cancers(76;1.01e-06)|Acute lymphoblastic leukemia(125;3.58e-09)|all_hematologic(75;1.22e-06)|all_epithelial(107;0.00433)|Colorectal(196;0.0341)		BRCA - Breast invasive adenocarcinoma(108;0.148)		atatatatatatgtgtgtttgt	0.302														261	0.0521166	0.0038	0.062	5008	,	,		13769	0.0546		0.0865	False		,,,				2504	0.0726																0								ENSG00000172469																																			MANEA	SO:0001627	intron_variant	0				HGNC	AK022900	CCDS5032.1	6q16.2	2008-02-05			ENSG00000172469	ENSG00000172469			21072	protein-coding gene	gene with protein product		612327					Standard	NM_024641		Approved	FLJ12838, mandaselin	uc003poo.2	Q5SRI9	OTTHUMG00000016296	ENST00000358812.4:c.544+22->TATATG	6.37:g.96034881_96034882insTATATG		Somatic	NA	NA	NA		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A6H8M6|Q5SRJ0|Q6MZV0|Q70JE9|Q7Z3V7|Q8WWX5|Q9H9D2	In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	NULL	p.190in_frame_insIC	ENST00000358812.4	37	c.566_567	CCDS5032.1	6																																																																																			-	NULL		0.302	MANEA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MANEA	protein_coding	OTTHUMT00000043644.1	-	NM_024641			96034882	+1	no_errors	ENST00000369293	ensembl	human	known	74_37	in_frame_ins	INS	0.000:0.000	TATATG
CXCR2P1	3580	genome.wustl.edu	37	2	218925105	218925105	+	RNA	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr2:218925105G>A	ENST00000439871.1	-	0	1275					NR_002712.1				chemokine (C-X-C motif) receptor 2 pseudogene 1																		GCCAACAAAGGAAGGCCTGCT	0.507																																																	0								ENSG00000229754																																			CXCR2P1			0			-	HGNC	M98335		2q35	2012-05-02	2010-04-14	2010-04-14	ENSG00000229754	ENSG00000229754			6028	pseudogene	pseudogene			"""interleukin 8 receptor, beta pseudogene"", ""chemokine (C-X-C motif) receptor 2 pseudogene"""	IL8RBP, CXCR2P		1427896, 1303245	Standard	NR_002712		Approved		uc002vgx.3		OTTHUMG00000155244		2.37:g.218925105G>A		Somatic	0	55	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	66	17.50		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000439871.1	37	NULL		2																																																																																			-	-		0.507	CXCR2P1-002	KNOWN	basic	processed_transcript	CXCR2P1	pseudogene	OTTHUMT00000338985.1	G	NR_002712	-		218925105	-1	no_errors	ENST00000439871	ensembl	human	known	74_37	rna	SNP	0.874	A
CDH9	1007	genome.wustl.edu	37	5	26885786	26885786	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr5:26885786G>A	ENST00000231021.4	-	11	1991	c.1819C>T	c.(1819-1821)Ctt>Ttt	p.L607F		NM_016279.3	NP_057363.3	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 (T1-cadherin)	607	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(25)|lung(80)|ovary(5)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	137						CCGGCTGAAAGGATCAGGGCT	0.502																																					Melanoma(8;187 585 15745 40864 52829)												0								ENSG00000113100						82.0	68.0	73.0					5																	26885786		2203	4300	6503	CDH9	SO:0001583	missense	0			-	HGNC	AB035302	CCDS3893.1	5p14	2010-01-26			ENSG00000113100	ENSG00000113100		"""Cadherins / Major cadherins"""	1768	protein-coding gene	gene with protein product		609974				2059658	Standard	NM_016279		Approved		uc003jgs.1	Q9ULB4	OTTHUMG00000090671	ENST00000231021.4:c.1819C>T	5.37:g.26885786G>A	ENSP00000231021:p.Leu607Phe	Somatic	0	49	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	62	18.42	Q3B7I5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.L607F	ENST00000231021.4	37	c.1819	CCDS3893.1	5	.	.	.	.	.	.	.	.	.	.	G	12.41	1.931030	0.34096	.	.	ENSG00000113100	ENST00000231021	T	0.56275	0.47	5.89	5.89	0.94794	.	0.249277	0.41097	D	0.000947	T	0.41213	0.1149	L	0.35542	1.07	0.39753	D	0.971916	B;B	0.17465	0.004;0.022	B;B	0.19666	0.019;0.026	T	0.26538	-1.0100	9	.	.	.	.	12.1795	0.54204	0.0781:0.0:0.9219:0.0	.	200;607	B4DFP0;Q9ULB4	.;CADH9_HUMAN	F	607	ENSP00000231021:L607F	.	L	-	1	0	CDH9	26921543	1.000000	0.71417	0.272000	0.24630	0.534000	0.34807	3.834000	0.55798	2.797000	0.96272	0.563000	0.77884	CTT	-	NULL		0.502	CDH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH9	protein_coding	OTTHUMT00000207352.1	G	NM_016279	-		26885786	-1	no_errors	ENST00000231021	ensembl	human	known	74_37	missense	SNP	1.000	A
GPR179	440435	genome.wustl.edu	37	17	36499244	36499244	+	Missense_Mutation	SNP	T	T	G			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr17:36499244T>G	ENST00000342292.4	-	1	449	c.429A>C	c.(427-429)agA>agC	p.R143S		NM_001004334.2	NP_001004334.2	Q6PRD1	GP179_HUMAN	G protein-coupled receptor 179	143					visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(4)|cervix(2)|endometrium(9)|kidney(3)|large_intestine(16)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	60	Breast(7;2.97e-12)	Breast(25;0.0101)|Ovarian(249;0.15)				CCCTGTACACTCTTGGGTCCC	0.627																																																	0								ENSG00000188888						52.0	55.0	54.0					17																	36499244		2104	4218	6322	GPR179	SO:0001583	missense	0			-	HGNC		CCDS42308.1	17q21.1	2014-05-06	2006-02-16	2006-02-16	ENSG00000188888	ENSG00000277399		"""GPCR / Class C : Orphans"""	31371	protein-coding gene	gene with protein product		614515	"""GPR158-like 1"", ""GPR179"""	GPR158L1			Standard	NM_001004334		Approved	CSNB1E	uc002hpz.3	Q6PRD1	OTTHUMG00000188545	ENST00000342292.4:c.429A>C	17.37:g.36499244T>G	ENSP00000345060:p.Arg143Ser	Somatic	0	39	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	59	13.24		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_3_C,superfamily_Growth_fac_rcpt_N_dom,pfscan_GPCR_3_C	p.R143S	ENST00000342292.4	37	c.429	CCDS42308.1	17	.	.	.	.	.	.	.	.	.	.	T	3.964	-0.009825	0.07727	.	.	ENSG00000188888	ENST00000342292	T	0.77750	-1.12	5.67	0.0208	0.14126	.	0.466449	0.22036	N	0.065531	T	0.60287	0.2257	L	0.43152	1.355	0.09310	N	1	P	0.44734	0.842	B	0.36030	0.216	T	0.53676	-0.8405	10	0.23302	T	0.38	-11.7207	6.1618	0.20368	0.0:0.3868:0.1293:0.4839	.	143	Q6PRD1	GP179_HUMAN	S	143	ENSP00000345060:R143S	ENSP00000345060:R143S	R	-	3	2	GPR179	33752770	0.000000	0.05858	0.002000	0.10522	0.033000	0.12548	-1.174000	0.03105	-0.102000	0.12197	-0.766000	0.03442	AGA	-	NULL		0.627	GPR179-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR179	protein_coding	OTTHUMT00000255329.2	T		-		36499244	-1	no_errors	ENST00000342292	ensembl	human	known	74_37	missense	SNP	0.000	G
LIX1	167410	genome.wustl.edu	37	5	96443162	96443162	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr5:96443162C>T	ENST00000274382.4	-	3	584	c.289G>A	c.(289-291)Gtg>Atg	p.V97M	CTD-2215E18.1_ENST00000509481.1_Intron	NM_153234.4	NP_694966.3	Q8N485	LIX1_HUMAN	Lix1 homolog (chicken)	97										endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(2)|ovary(1)	10		all_cancers(142;4.28e-07)|all_epithelial(76;1.06e-09)|all_lung(232;0.00101)|Lung NSC(167;0.00137)|Ovarian(225;0.024)|Colorectal(57;0.0318)|Breast(839;0.244)		COAD - Colon adenocarcinoma(37;0.0733)		ATCAGGGCCACTTTAGCTGCA	0.502																																																	0								ENSG00000145721						111.0	101.0	104.0					5																	96443162		2203	4300	6503	LIX1	SO:0001583	missense	0			-	HGNC		CCDS4088.1	5q15	2008-03-06	2008-03-06	2005-02-07	ENSG00000145721	ENSG00000145721			18581	protein-coding gene	gene with protein product		610466	"""chromosome 5 open reading frame 11"", ""Lix1 homolog (mouse)"""	C5orf11		11731258	Standard	NM_153234		Approved		uc003kmy.4	Q8N485	OTTHUMG00000128720	ENST00000274382.4:c.289G>A	5.37:g.96443162C>T	ENSP00000274382:p.Val97Met	Somatic	0	79	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	82	15.46	A8K4R9|Q8N7I2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.V97M	ENST00000274382.4	37	c.289	CCDS4088.1	5	.	.	.	.	.	.	.	.	.	.	C	26.5	4.739778	0.89573	.	.	ENSG00000145721	ENST00000274382	T	0.55234	0.53	6.17	6.17	0.99709	.	0.053976	0.85682	D	0.000000	T	0.68595	0.3018	L	0.50333	1.59	0.58432	D	0.999993	D	0.65815	0.995	D	0.63877	0.919	T	0.67632	-0.5621	10	0.87932	D	0	-28.7501	20.4745	0.99168	0.0:1.0:0.0:0.0	.	97	Q8N485	LIX1_HUMAN	M	97	ENSP00000274382:V97M	ENSP00000274382:V97M	V	-	1	0	LIX1	96468918	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.048000	0.41278	2.941000	0.99782	0.655000	0.94253	GTG	-	NULL		0.502	LIX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIX1	protein_coding	OTTHUMT00000250625.1	C	NM_153234	-		96443162	-1	no_errors	ENST00000274382	ensembl	human	known	74_37	missense	SNP	1.000	T
CAPN13	92291	genome.wustl.edu	37	2	30976012	30976012	+	Missense_Mutation	SNP	C	C	T	rs373913163		TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr2:30976012C>T	ENST00000295055.8	-	10	1170	c.994G>A	c.(994-996)Gaa>Aaa	p.E332K	CAPN13_ENST00000534090.2_Missense_Mutation_p.E332K	NM_144575.2	NP_653176.2	Q6MZZ7	CAN13_HUMAN	calpain 13	332	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)|stomach(2)|urinary_tract(1)	30	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.155)					ATTGGAATTTCGCTACATATA	0.423																																																	0								ENSG00000162949						238.0	217.0	224.0					2																	30976012		1914	4117	6031	CAPN13	SO:0001583	missense	0			-	HGNC		CCDS46252.1	2p22-p21	2008-02-05			ENSG00000162949	ENSG00000162949			16663	protein-coding gene	gene with protein product		610228				11675017	Standard	NM_144575		Approved	FLJ23523	uc021vfm.1	Q6MZZ7	OTTHUMG00000152053	ENST00000295055.8:c.994G>A	2.37:g.30976012C>T	ENSP00000295055:p.Glu332Lys	Somatic	0	78	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	89	16.67	Q17RF0|Q580X1|Q8TE80	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_C2_calpain_cat,pfam_Calpain_domain_III,superfamily_Calpain_domain_III,smart_Peptidase_C2_calpain_cat,pfscan_Peptidase_C2_calpain_cat,prints_Calpain_cysteine_protease	p.E332K	ENST00000295055.8	37	c.994	CCDS46252.1	2	.	.	.	.	.	.	.	.	.	.	C	6.113	0.389080	0.11581	.	.	ENSG00000162949	ENST00000295055;ENST00000534090	T;T	0.15603	2.41;2.41	5.27	3.36	0.38483	Peptidase C2, calpain, catalytic domain (2);	0.294464	0.24766	N	0.035775	T	0.10252	0.0251	N	0.14661	0.345	0.09310	N	1	B	0.29270	0.24	B	0.25506	0.061	T	0.22695	-1.0209	10	0.62326	D	0.03	.	11.4637	0.50225	0.0:0.3567:0.6433:0.0	.	332	Q6MZZ7	CAN13_HUMAN	K	332	ENSP00000295055:E332K;ENSP00000431298:E332K	ENSP00000295055:E332K	E	-	1	0	CAPN13	30829516	0.888000	0.30383	0.411000	0.26484	0.114000	0.19823	0.525000	0.22956	1.227000	0.43598	-0.234000	0.12200	GAA	-	smart_Peptidase_C2_calpain_cat,pfscan_Peptidase_C2_calpain_cat		0.423	CAPN13-001	KNOWN	basic|CCDS	protein_coding	CAPN13	protein_coding	OTTHUMT00000325101.2	C	NM_144575	-		30976012	-1	no_errors	ENST00000295055	ensembl	human	known	74_37	missense	SNP	0.222	T
MYT1	4661	genome.wustl.edu	37	20	62859350	62859350	+	Missense_Mutation	SNP	C	C	T	rs374090910		TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr20:62859350C>T	ENST00000360149.4	+	16	1956	c.1738C>T	c.(1738-1740)Cat>Tat	p.H580Y	MYT1_ENST00000536311.1_Intron|MYT1_ENST00000328439.1_Intron			Q99640	PMYT1_HUMAN	myelin transcription factor 1	0					G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of phosphatase activity (GO:0010923)|regulation of cell cycle (GO:0051726)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of mitosis (GO:0007088)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(12)|liver(1)|lung(17)|ovary(5)|prostate(2)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55	all_cancers(38;1.82e-11)|all_epithelial(29;3.3e-13)|Lung NSC(23;5.21e-10)|all_lung(23;1.92e-09)					CTGGCTCTTTCATTGCATTGC	0.463																																					GBM(59;481 1041 20555 21139 33705)												0								ENSG00000196132	C		1,4405		0,1,2202	66.0	65.0	66.0			-5.1	0.0	20		66	0,8600		0,0,4300	no	intron	MYT1	NM_004535.2		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077			62859350	1,13005	2203	4300	6503	MYT1	SO:0001583	missense	0			-	HGNC	M96980	CCDS13558.1	20q13.33	2014-03-24			ENSG00000196132	ENSG00000196132		"""Zinc fingers, C2HC-type containing"""	7622	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 2"""	600379		PLPB1		1280325, 9268380	Standard	NM_004535		Approved	MTF1, MYTI, ZC2HC4A, NZF2	uc002yii.3	Q01538	OTTHUMG00000149988	ENST00000360149.4:c.1738C>T	20.37:g.62859350C>T	ENSP00000353269:p.His580Tyr	Somatic	0	49	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	66	12.00	B3KUN8|B4DXD4|D3DUA4|F8W164|I3L1V2|O14731|Q7LE24|Q8TCM9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Myelin_TF,pfam_Znf_C2HC	p.H580Y	ENST00000360149.4	37	c.1738		20	.	.	.	.	.	.	.	.	.	.	C	2.875	-0.233009	0.05983	2.27E-4	0.0	ENSG00000196132	ENST00000360149	T	0.42513	0.97	3.67	-5.08	0.02929	.	.	.	.	.	T	0.18045	0.0433	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.21280	-1.0250	7	.	.	.	.	1.8581	0.03183	0.1291:0.2753:0.1381:0.4575	.	580	Q6P6D5	.	Y	580	ENSP00000353269:H580Y	.	H	+	1	0	MYT1	62329794	0.872000	0.30054	0.000000	0.03702	0.022000	0.10575	0.104000	0.15313	-0.670000	0.05282	-0.827000	0.03088	CAT	-	NULL		0.463	MYT1-201	KNOWN	basic	protein_coding	MYT1	protein_coding		C	NM_004535	-		62859350	+1	no_errors	ENST00000360149	ensembl	human	known	74_37	missense	SNP	0.000	T
SLC38A11	151258	genome.wustl.edu	37	2	165802202	165802202	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr2:165802202G>A	ENST00000409149.3	-	3	388	c.97C>T	c.(97-99)Ctc>Ttc	p.L33F	SLC38A11_ENST00000303735.4_Missense_Mutation_p.L33F|SLC38A11_ENST00000409058.1_Missense_Mutation_p.L64F|SLC38A11_ENST00000409662.1_Missense_Mutation_p.L33F	NM_001199148.1	NP_001186077.1	Q08AI6	S38AB_HUMAN	solute carrier family 38, member 11	33					amino acid transport (GO:0006865)|sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)				endometrium(2)|large_intestine(4)|lung(8)|ovary(1)	15						GTTCCAGAGAGGGCCCCTCCT	0.363																																																	0								ENSG00000169507						91.0	99.0	96.0					2																	165802202		2203	4300	6503	SLC38A11	SO:0001583	missense	0			-	HGNC		CCDS2224.1, CCDS56142.1	2q24.3	2013-05-22			ENSG00000169507	ENSG00000169507		"""Solute carriers"""	26836	protein-coding gene	gene with protein product							Standard	NM_173512		Approved	FLJ39822, AVT2	uc002ucw.2	Q08AI6	OTTHUMG00000132144	ENST00000409149.3:c.97C>T	2.37:g.165802202G>A	ENSP00000386272:p.Leu33Phe	Somatic	0	63	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	64	17.95	B4DF99|Q8N887	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_AA_transpt_TM	p.L33F	ENST00000409149.3	37	c.97	CCDS56142.1	2	.	.	.	.	.	.	.	.	.	.	G	26.0	4.699915	0.88924	.	.	ENSG00000169507	ENST00000303735;ENST00000409149;ENST00000409058;ENST00000409662	T;T;T;T	0.02323	4.34;4.34;4.34;4.34	5.98	5.98	0.97165	.	0.059444	0.64402	D	0.000001	T	0.15609	0.0376	M	0.82323	2.585	0.54753	D	0.999986	D;D	0.63880	0.993;0.992	D;D	0.69142	0.962;0.937	T	0.00023	-1.2329	10	0.46703	T	0.11	-16.1672	14.1106	0.65120	0.0:0.0:0.8496:0.1504	.	33;33	Q08AI6;Q08AI6-2	S38AB_HUMAN;.	F	33;33;64;33	ENSP00000306178:L33F;ENSP00000386272:L33F;ENSP00000387345:L64F;ENSP00000386774:L33F	ENSP00000306178:L33F	L	-	1	0	SLC38A11	165510448	1.000000	0.71417	0.984000	0.44739	0.948000	0.59901	4.425000	0.59875	2.835000	0.97688	0.650000	0.86243	CTC	-	pfam_AA_transpt_TM		0.363	SLC38A11-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC38A11	protein_coding	OTTHUMT00000333390.1	G	NM_173512	-		165802202	-1	no_errors	ENST00000409149	ensembl	human	known	74_37	missense	SNP	0.998	A
TRIM64C	646754	genome.wustl.edu	37	11	49079704	49079704	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr11:49079704C>T	ENST00000530230.1	-	2	432	c.433G>A	c.(433-435)Gac>Aac	p.D145N		NM_001206631.1	NP_001193560.1	A6NLI5	TR64C_HUMAN	tripartite motif containing 64C	144						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(1)|stomach(1)	2						CATAAATAGTCCATTTCCTTT	0.303																																																	0								ENSG00000214891																																			TRIM64C	SO:0001583	missense	0			-	HGNC		CCDS73287.1	11p11.12	2014-04-02	2011-01-25		ENSG00000214891	ENSG00000214891		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	37148	protein-coding gene	gene with protein product			"""tripartite motif-containing 64C"""				Standard	NM_001206631		Approved		uc021qiy.1	A6NLI5	OTTHUMG00000166752	ENST00000530230.1:c.433G>A	11.37:g.49079704C>T	ENSP00000431987:p.Asp145Asn	Somatic	0	76	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	98	20.97		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SPRY_rcpt,pfam_Znf_B-box,superfamily_ConA-like_lec_gl_sf,smart_Znf_B-box,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.D145N	ENST00000530230.1	37	c.433		11	.	.	.	.	.	.	.	.	.	.	C	2.452	-0.326098	0.05350	.	.	ENSG00000214891	ENST00000530230	T	0.61742	0.08	1.31	-1.26	0.09376	.	.	.	.	.	T	0.43077	0.1231	L	0.39397	1.21	0.09310	N	1	.	.	.	.	.	.	T	0.33854	-0.9852	7	0.22109	T	0.4	.	4.1777	0.10360	0.0:0.4426:0.0:0.5574	.	.	.	.	N	145	ENSP00000431987:D145N	ENSP00000431987:D145N	D	-	1	0	TRIM64C	49036280	0.012000	0.17670	0.003000	0.11579	0.429000	0.31625	-0.133000	0.10451	-0.361000	0.08125	0.184000	0.17185	GAC	-	NULL		0.303	TRIM64C-001	KNOWN	basic|appris_principal	protein_coding	TRIM64C	protein_coding	OTTHUMT00000391366.1	C		-		49079704	-1	no_errors	ENST00000530230	ensembl	human	known	74_37	missense	SNP	0.003	T
MXRA5	25878	genome.wustl.edu	37	X	3235787	3235787	+	Missense_Mutation	SNP	C	C	T	rs146622359		TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chrX:3235787C>T	ENST00000217939.6	-	6	6089	c.5935G>A	c.(5935-5937)Gcc>Acc	p.A1979T		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	1979	Ig-like C2-type 4.					extracellular vesicular exosome (GO:0070062)				NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				ATTTGGGGGGCTGGGGTCCCT	0.587																																																	0								ENSG00000101825						59.0	55.0	56.0					X																	3235787		2203	4300	6503	MXRA5	SO:0001583	missense	0			-	HGNC	AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.5935G>A	X.37:g.3235787C>T	ENSP00000217939:p.Ala1979Thr	Somatic	0	46	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	34	39.29	Q6P1M7|Q9Y3Y8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.A1979T	ENST00000217939.6	37	c.5935	CCDS14124.1	X	.	.	.	.	.	.	.	.	.	.	c	0.019	-1.463820	0.01062	.	.	ENSG00000101825	ENST00000381114;ENST00000217939	T	0.66099	-0.19	3.64	1.67	0.24075	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.482604	0.14952	U	0.288846	T	0.27900	0.0687	N	0.02412	-0.56	0.09310	N	1	B	0.24618	0.107	B	0.27076	0.076	T	0.17379	-1.0371	10	0.13853	T	0.58	.	1.9323	0.03330	0.1578:0.2067:0.4562:0.1794	.	1979	Q9NR99	MXRA5_HUMAN	T	1979	ENSP00000217939:A1979T	ENSP00000217939:A1979T	A	-	1	0	MXRA5	3245787	0.000000	0.05858	0.000000	0.03702	0.158000	0.22134	0.182000	0.16900	0.392000	0.25172	0.600000	0.82982	GCC	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.587	MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MXRA5	protein_coding	OTTHUMT00000055655.2	C	NM_015419	-		3235787	-1	no_errors	ENST00000217939	ensembl	human	known	74_37	missense	SNP	0.000	T
SMPD3	55512	genome.wustl.edu	37	16	68405025	68405025	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr16:68405025G>A	ENST00000219334.5	-	3	1663	c.1060C>T	c.(1060-1062)Ccc>Tcc	p.P354S	SMPD3_ENST00000566009.1_5'Flank|SMPD3_ENST00000568373.1_Missense_Mutation_p.P354S|SMPD3_ENST00000563226.1_Missense_Mutation_p.P354S	NM_018667.3	NP_061137.1	Q9NY59	NSMA2_HUMAN	sphingomyelin phosphodiesterase 3, neutral membrane (neutral sphingomyelinase II)	354					cell cycle (GO:0007049)|glycosphingolipid metabolic process (GO:0006687)|hematopoietic progenitor cell differentiation (GO:0002244)|peptide hormone secretion (GO:0030072)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sphingomyelin catabolic process (GO:0006685)	Golgi cis cisterna (GO:0000137)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|sphingomyelin phosphodiesterase activity (GO:0004767)			breast(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	21		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0184)|Epithelial(162;0.0785)	Phosphatidylserine(DB00144)	AGGTTGGCGGGGAAGAAGGCG	0.602																																																	0								ENSG00000103056						55.0	52.0	53.0					16																	68405025		2198	4300	6498	SMPD3	SO:0001583	missense	0			-	HGNC	AJ250460	CCDS10867.1	16q22.1	2008-02-05			ENSG00000103056	ENSG00000103056			14240	protein-coding gene	gene with protein product		605777				10823942	Standard	NM_018667		Approved	NSMASE2	uc002ewa.3	Q9NY59	OTTHUMG00000137559	ENST00000219334.5:c.1060C>T	16.37:g.68405025G>A	ENSP00000219334:p.Pro354Ser	Somatic	0	71	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	30	77	28.04	B7ZL82|Q2M1S8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase	p.P354S	ENST00000219334.5	37	c.1060	CCDS10867.1	16	.	.	.	.	.	.	.	.	.	.	G	23.8	4.464502	0.84425	.	.	ENSG00000103056	ENST00000219334	T	0.28454	1.61	5.48	5.48	0.80851	Endonuclease/exonuclease/phosphatase (2);	0.000000	0.85682	D	0.000000	T	0.51398	0.1672	L	0.49513	1.565	0.80722	D	1	D;D;D	0.89917	0.992;1.0;1.0	D;D;D	0.97110	0.911;1.0;1.0	T	0.51196	-0.8736	10	0.87932	D	0	-14.6389	16.8363	0.85957	0.0:0.0:1.0:0.0	.	354;354;354	B7ZL82;B7ZL84;Q9NY59	.;.;NSMA2_HUMAN	S	354	ENSP00000219334:P354S	ENSP00000219334:P354S	P	-	1	0	SMPD3	66962526	1.000000	0.71417	0.998000	0.56505	0.979000	0.70002	9.435000	0.97529	2.563000	0.86464	0.563000	0.77884	CCC	-	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase		0.602	SMPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMPD3	protein_coding	OTTHUMT00000268895.3	G	NM_018667	-		68405025	-1	no_errors	ENST00000219334	ensembl	human	known	74_37	missense	SNP	1.000	A
NF1	4763	genome.wustl.edu	37	17	29576111	29576111	+	Nonsense_Mutation	SNP	C	C	T	rs137854560		TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr17:29576111C>T	ENST00000358273.4	+	30	4467	c.4084C>T	c.(4084-4086)Cga>Tga	p.R1362*	NF1_ENST00000356175.3_Nonsense_Mutation_p.R1362*	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	1362	Ras-GAP. {ECO:0000255|PROSITE- ProRule:PRU00167}.				actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.R1362*(5)|p.?(4)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		CCCTCAACTTCGAAGTGTGTG	0.403			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																													yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	17	Whole gene deletion(8)|Substitution - Nonsense(5)|Unknown(4)	soft_tissue(10)|autonomic_ganglia(2)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|ovary(1)	GRCh37	CM971046	NF1	M	rs137854560	ENSG00000196712						171.0	155.0	160.0					17																	29576111		2203	4300	6503	NF1	SO:0001587	stop_gained	0	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome	-	HGNC		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.4084C>T	17.37:g.29576111C>T	ENSP00000351015:p.Arg1362*	Somatic	0	37	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	42	25.00	O00662|Q14284|Q14930|Q14931|Q9UMK3	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RasGAP,superfamily_Rho_GTPase_activation_prot,superfamily_ARM-type_fold,superfamily_CRAL-TRIO_dom,smart_RasGAP,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom,pfscan_RasGAP	p.R1362*	ENST00000358273.4	37	c.4084	CCDS42292.1	17	.	.	.	.	.	.	.	.	.	.	C	46	12.889364	0.99704	.	.	ENSG00000196712	ENST00000358273;ENST00000356175;ENST00000456735	.	.	.	5.74	4.77	0.60923	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.5214	0.84318	0.1319:0.8681:0.0:0.0	.	.	.	.	X	1362;1362;1028	.	ENSP00000348498:R1362X	R	+	1	2	NF1	26600237	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.630000	0.54273	1.551000	0.49450	0.563000	0.77884	CGA	-	pfam_RasGAP,superfamily_Rho_GTPase_activation_prot,superfamily_ARM-type_fold,smart_RasGAP,pfscan_RasGAP		0.403	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NF1	protein_coding	OTTHUMT00000256351.2	C	NM_000267	rs137854560		29576111	+1	no_errors	ENST00000358273	ensembl	human	known	74_37	nonsense	SNP	1.000	T
RELN	5649	genome.wustl.edu	37	7	103301848	103301848	+	Silent	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr7:103301848C>T	ENST00000428762.1	-	12	1575	c.1416G>A	c.(1414-1416)ggG>ggA	p.G472G	RELN_ENST00000424685.2_Silent_p.G472G|RELN_ENST00000343529.5_Silent_p.G472G	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	472					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)			NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		ACCTCAGGTTCCCATAACCGG	0.438																																					NSCLC(146;835 1944 15585 22231 52158)												0								ENSG00000189056						166.0	118.0	134.0					7																	103301848		2203	4300	6503	RELN	SO:0001819	synonymous_variant	0			-	HGNC		CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.1416G>A	7.37:g.103301848C>T		Somatic	0	57	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	43	25.42	A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_EGF_extracell,pfam_Reeler_dom,pfam_BNR_rpt,superfamily_Sialidases,superfamily_Growth_fac_rcpt_N_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Reeler_dom	p.G472	ENST00000428762.1	37	c.1416	CCDS47680.1	7																																																																																			-	NULL		0.438	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RELN	protein_coding	OTTHUMT00000348148.1	C	NM_005045	-		103301848	-1	no_errors	ENST00000424685	ensembl	human	known	74_37	silent	SNP	0.998	T
CCDC78	124093	genome.wustl.edu	37	16	775537	775537	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr16:775537C>T	ENST00000293889.6	-	4	416	c.311G>A	c.(310-312)gGa>gAa	p.G104E	HAGHL_ENST00000549114.1_5'Flank|HAGHL_ENST00000389703.3_5'Flank|HAGHL_ENST00000561546.1_5'Flank|HAGHL_ENST00000341413.4_5'Flank|HAGHL_ENST00000564545.1_5'Flank|HAGHL_ENST00000564537.1_5'Flank	NM_001031737.2	NP_001026907.2	A2IDD5	CCD78_HUMAN	coiled-coil domain containing 78	104					cell projection organization (GO:0030030)|de novo centriole assembly (GO:0098535)|skeletal muscle contraction (GO:0003009)	centriole (GO:0005814)|deuterosome (GO:0098536)|perinuclear region of cytoplasm (GO:0048471)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)				central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|lung(2)|skin(3)	9		Hepatocellular(780;0.0218)				GGTGCCATCTCCTCGCAGCTC	0.662																																																	0								ENSG00000162004						51.0	49.0	50.0					16																	775537		2193	4298	6491	CCDC78	SO:0001583	missense	0			-	HGNC	BC042110	CCDS32353.1	16p13.3	2014-07-15		2006-02-20	ENSG00000162004	ENSG00000162004			14153	protein-coding gene	gene with protein product		614666		C16orf25		24075808	Standard	NM_001031737		Approved	FLJ34512	uc002cjg.3	A2IDD5	OTTHUMG00000121176	ENST00000293889.6:c.311G>A	16.37:g.775537C>T	ENSP00000293889:p.Gly104Glu	Somatic	0	26	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	32	13.51	B4DNY4|B4E1U6|Q05BY7|Q05CA0|Q6T2V5|Q6ZR33|Q8IUR3|Q8NAY7|Q96S12	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.G104E	ENST00000293889.6	37	c.311	CCDS32353.1	16	.	.	.	.	.	.	.	.	.	.	C	17.22	3.335081	0.60853	.	.	ENSG00000162004	ENST00000293889	T	0.44881	0.91	4.68	4.68	0.58851	.	0.855421	0.10284	N	0.693117	T	0.57373	0.2049	L	0.50333	1.59	0.09310	N	1	D;D;D;D	0.71674	0.998;0.998;0.998;0.98	D;D;D;P	0.66351	0.924;0.924;0.943;0.762	T	0.46911	-0.9157	10	0.37606	T	0.19	-0.2685	13.4286	0.61042	0.0:1.0:0.0:0.0	.	104;104;178;104	A2IDD5-4;A2IDD5-6;A2IDD5-5;A2IDD5	.;.;.;CCD78_HUMAN	E	104	ENSP00000293889:G104E	ENSP00000293889:G104E	G	-	2	0	CCDC78	715538	0.003000	0.15002	0.006000	0.13384	0.065000	0.16274	1.595000	0.36708	2.344000	0.79699	0.436000	0.28706	GGA	-	NULL		0.662	CCDC78-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC78	protein_coding	OTTHUMT00000241665.3	C	NM_173476	-		775537	-1	no_errors	ENST00000293889	ensembl	human	known	74_37	missense	SNP	0.026	T
CDCP1	64866	genome.wustl.edu	37	3	45153654	45153654	+	Silent	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr3:45153654C>T	ENST00000296129.1	-	3	710	c.576G>A	c.(574-576)gtG>gtA	p.V192V	CDCP1_ENST00000425231.2_Silent_p.V192V|CDCP1_ENST00000490471.1_5'Flank	NM_022842.3	NP_073753.3	Q9H5V8	CDCP1_HUMAN	CUB domain containing protein 1	192						extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(12)|ovary(1)|skin(4)|urinary_tract(1)	29				BRCA - Breast invasive adenocarcinoma(193;0.00928)|KIRC - Kidney renal clear cell carcinoma(197;0.0519)|Kidney(197;0.0651)		AGGCCATTTTCACTCCTTCTT	0.537																																																	0								ENSG00000163814						168.0	159.0	162.0					3																	45153654		2203	4300	6503	CDCP1	SO:0001819	synonymous_variant	0			-	HGNC	AF468010	CCDS2727.1, CCDS46812.1	3p21.3	2006-03-28			ENSG00000163814	ENSG00000163814		"""CD molecules"""	24357	protein-coding gene	gene with protein product		611735				11466621	Standard	NM_022842		Approved	CD318, SIMA135	uc003com.3	Q9H5V8	OTTHUMG00000133090	ENST00000296129.1:c.576G>A	3.37:g.45153654C>T		Somatic	0	41	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	58	9.38	Q49UB4|Q6NT71|Q6U9Y2|Q8WU91|Q96QU7|Q9H676|Q9H8C2	Silent	SNP	NA	NA	NA	NA	NA	NA	superfamily_CUB_dom	p.V192	ENST00000296129.1	37	c.576	CCDS2727.1	3																																																																																			-	NULL		0.537	CDCP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDCP1	protein_coding	OTTHUMT00000256748.3	C	NM_022842	-		45153654	-1	no_errors	ENST00000296129	ensembl	human	known	74_37	silent	SNP	0.125	T
LINC01287	103724390	genome.wustl.edu	37	7	153109985	153109985	+	lincRNA	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr7:153109985G>A	ENST00000416982.1	-	0	1063																											cggcagtgaggaagcaggtag	0.517																																																	0								ENSG00000234722						64.0	74.0	71.0					7																	153109985		692	1591	2283	AC073236.3			0			-	Clone_based_vega_gene																													7.37:g.153109985G>A		Somatic	0	66	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	77	24.51		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000416982.1	37	NULL		7																																																																																			-	-		0.517	AC073236.3-001	KNOWN	basic	lincRNA	ENSG00000234722	lincRNA	OTTHUMT00000280517.1	G		-		153109985	-1	no_errors	ENST00000416982	ensembl	human	known	74_37	rna	SNP	0.078	A
PIN1	5300	genome.wustl.edu	37	19	9949265	9949265	+	Nonsense_Mutation	SNP	C	C	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr19:9949265C>A	ENST00000247970.4	+	2	234	c.212C>A	c.(211-213)tCg>tAg	p.S71*	PIN1_ENST00000587625.1_Nonsense_Mutation_p.S71*|PIN1_ENST00000588695.1_Nonsense_Mutation_p.S71*|PIN1_ENST00000380889.6_3'UTR	NM_006221.3	NP_006212.1	Q13526	PIN1_HUMAN	peptidylprolyl cis/trans isomerase, NIMA-interacting 1	71	PpiC. {ECO:0000255|PROSITE- ProRule:PRU00278}.				cell cycle (GO:0007049)|cytokine-mediated signaling pathway (GO:0019221)|innate immune response (GO:0045087)|negative regulation of cell motility (GO:2000146)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of type I interferon production (GO:0032480)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein folding (GO:0006457)|protein peptidyl-prolyl isomerization (GO:0000413)|regulation of cytokinesis (GO:0032465)|regulation of mitosis (GO:0007088)|regulation of pathway-restricted SMAD protein phosphorylation (GO:0060393)	cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	GTPase activating protein binding (GO:0032794)|mitogen-activated protein kinase kinase binding (GO:0031434)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|phosphoserine binding (GO:0050815)|phosphothreonine binding (GO:0050816)			skin(3)	3						CGGCGGCCCTCGTCCTGGCGG	0.677																																																	0								ENSG00000127445						9.0	11.0	10.0					19																	9949265		2152	4205	6357	PIN1	SO:0001587	stop_gained	0			-	HGNC		CCDS12220.1	19p13	2014-09-17	2008-03-25		ENSG00000127445	ENSG00000127445			8988	protein-coding gene	gene with protein product		601052	"""protein (peptidyl-prolyl cis/trans isomerase) NIMA-interacting 1"""			8606777	Standard	NM_006221		Approved	dod	uc002mml.2	Q13526		ENST00000247970.4:c.212C>A	19.37:g.9949265C>A	ENSP00000247970:p.Ser71*	Somatic	0	122	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	164	13.16	A8K4V9|Q53X75	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PPIase_PpiC,pfam_WW_dom,superfamily_WW_dom,smart_WW_dom,pfscan_WW_dom,pfscan_PPIase_PpiC	p.S71*	ENST00000247970.4	37	c.212	CCDS12220.1	19	.	.	.	.	.	.	.	.	.	.	C	36	5.848189	0.97023	.	.	ENSG00000127445	ENST00000247970;ENST00000424497	.	.	.	4.48	4.48	0.54585	.	0.000000	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-5.2126	14.7168	0.69275	0.0:1.0:0.0:0.0	.	.	.	.	X	71	.	.	S	+	2	0	PIN1	9810265	0.999000	0.42202	0.951000	0.38953	0.991000	0.79684	4.219000	0.58561	2.340000	0.79590	0.555000	0.69702	TCG	-	pfam_PPIase_PpiC,pfscan_PPIase_PpiC		0.677	PIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIN1	protein_coding	OTTHUMT00000451107.1	C		-		9949265	+1	no_errors	ENST00000247970	ensembl	human	known	74_37	nonsense	SNP	0.995	A
DCAF5	8816	genome.wustl.edu	37	14	69521402	69521402	+	Silent	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr14:69521402G>A	ENST00000341516.5	-	9	2148	c.2001C>T	c.(1999-2001)ctC>ctT	p.L667L	DCAF5_ENST00000557386.1_Silent_p.L666L|DCAF5_ENST00000554215.1_Silent_p.L585L|DCAF5_ENST00000556847.1_Silent_p.L585L|DCAF5_ENST00000553293.1_5'Flank	NM_001284206.1|NM_001284207.1|NM_003861.2	NP_001271135.1|NP_001271136.1|NP_003852.1	Q96JK2	DCAF5_HUMAN	DDB1 and CUL4 associated factor 5	667					protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|mitochondrion (GO:0005739)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(15)|ovary(2)|upper_aerodigestive_tract(2)	29						AAGAGTAGCGGAGCCACTTGT	0.478																																																	0								ENSG00000139990						66.0	73.0	71.0					14																	69521402		2203	4300	6503	DCAF5	SO:0001819	synonymous_variant	0			-	HGNC	AB058727	CCDS32106.1, CCDS61480.1, CCDS61481.1, CCDS73646.1	14q23-q24.1	2013-01-09	2009-07-17	2009-07-17				"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	20224	protein-coding gene	gene with protein product		603812	"""WD repeat domain 22"""	WDR22		9740667, 9521877	Standard	NM_003861		Approved	BCRP2, D14S1461E, BCRG2, KIAA1824	uc001xkp.3	Q96JK2		ENST00000341516.5:c.2001C>T	14.37:g.69521402G>A		Somatic	0	56	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	84	16.00	B2RN31|G3V4J7|O60559|Q8N3V3|Q8N3V5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L667	ENST00000341516.5	37	c.2001	CCDS32106.1	14																																																																																			-	NULL		0.478	DCAF5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DCAF5	protein_coding	OTTHUMT00000414806.2	G	NM_003861	-		69521402	-1	no_errors	ENST00000341516	ensembl	human	known	74_37	silent	SNP	0.964	A
HHIPL1	84439	genome.wustl.edu	37	14	100118632	100118632	+	Silent	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr14:100118632G>A	ENST00000330710.5	+	2	425	c.327G>A	c.(325-327)ggG>ggA	p.G109G	HHIPL1_ENST00000357223.2_Silent_p.G109G	NM_001127258.1	NP_001120730.1	Q96JK4	HIPL1_HUMAN	HHIP-like 1	109					carbohydrate metabolic process (GO:0005975)	extracellular region (GO:0005576)|membrane (GO:0016020)	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor (GO:0016901)|quinone binding (GO:0048038)|scavenger receptor activity (GO:0005044)			breast(1)|endometrium(2)|large_intestine(2)|lung(8)|skin(2)	15		Melanoma(154;0.128)				CGGTGCCCGGGCTCTGCCAGG	0.617																																																	0								ENSG00000182218						65.0	65.0	65.0					14																	100118632		2203	4300	6503	HHIPL1	SO:0001819	synonymous_variant	0			-	HGNC	AB058725	CCDS9953.1, CCDS45162.1	14q32	2008-01-16	2008-01-16	2008-01-16		ENSG00000182218			19710	protein-coding gene	gene with protein product			"""KIAA1822"""	KIAA1822			Standard	NM_032425		Approved		uc010avs.3	Q96JK4		ENST00000330710.5:c.327G>A	14.37:g.100118632G>A		Somatic	0	44	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	41	10.87	A2RUF8|B2RN09|Q6UXX2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_SRCR,pfam_Folate_rcpt-like,pfam_Glc/Sorbosone_DH,superfamily_Srcr_rcpt-rel,superfamily_Quinoprot_gluc/sorb_DH,smart_Srcr_rcpt-rel,pfscan_SRCR,prints_SRCR	p.G109	ENST00000330710.5	37	c.327	CCDS45162.1	14																																																																																			-	pfam_Folate_rcpt-like		0.617	HHIPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HHIPL1	protein_coding	OTTHUMT00000413811.1	G	XM_041566	-		100118632	+1	no_errors	ENST00000330710	ensembl	human	known	74_37	silent	SNP	0.984	A
MXRA5	25878	genome.wustl.edu	37	X	3242793	3242793	+	Silent	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chrX:3242793G>A	ENST00000217939.6	-	5	1087	c.933C>T	c.(931-933)ttC>ttT	p.F311F		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	311						extracellular vesicular exosome (GO:0070062)				NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				GGGGCAGTTGGAATTTCTCCA	0.498																																																	0								ENSG00000101825						104.0	83.0	90.0					X																	3242793		2203	4300	6503	MXRA5	SO:0001819	synonymous_variant	0			-	HGNC	AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.933C>T	X.37:g.3242793G>A		Somatic	0	30	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	16	30.43	Q6P1M7|Q9Y3Y8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.F311	ENST00000217939.6	37	c.933	CCDS14124.1	X																																																																																			-	NULL		0.498	MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MXRA5	protein_coding	OTTHUMT00000055655.2	G	NM_015419	-		3242793	-1	no_errors	ENST00000217939	ensembl	human	known	74_37	silent	SNP	0.239	A
IRF6	3664	genome.wustl.edu	37	1	209961786	209961786	+	Silent	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr1:209961786G>A	ENST00000367021.3	-	9	1555	c.1383C>T	c.(1381-1383)ccC>ccT	p.P461P	RP3-434O14.8_ENST00000430751.1_RNA|IRF6_ENST00000542854.1_Silent_p.P366P	NM_006147.3	NP_006138.1	O14896	IRF6_HUMAN	interferon regulatory factor 6	461					cell cycle arrest (GO:0007050)|cell development (GO:0048468)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|keratinocyte differentiation (GO:0030216)|keratinocyte proliferation (GO:0043616)|mammary gland epithelial cell differentiation (GO:0060644)|negative regulation of cell proliferation (GO:0008285)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|large_intestine(4)|lung(12)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	28				OV - Ovarian serous cystadenocarcinoma(81;0.0351)		GCAGGGCAGGGGGCAGTTGCA	0.468										HNSCC(57;0.16)																																							0								ENSG00000117595						57.0	61.0	60.0					1																	209961786		2203	4300	6503	IRF6	SO:0001819	synonymous_variant	0			-	HGNC	AL022398	CCDS1492.1, CCDS55681.1	1q32.2-q32.3	2011-02-10			ENSG00000117595	ENSG00000117595			6121	protein-coding gene	gene with protein product		607199	"""Van der Woude syndrome"""	VWS, LPS		12219090	Standard	NM_006147		Approved	OFC6, VWS1	uc001hhq.2	O14896	OTTHUMG00000036521	ENST00000367021.3:c.1383C>T	1.37:g.209961786G>A		Somatic	0	48	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	33	79	29.46	B4DLE2|D3DT90|F5GWX8|G0ZTL0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Interferon_reg_factor-3,pfam_Interferon_reg_fact_DNA-bd_dom,superfamily_SMAD_FHA_domain,smart_Interferon_reg_fact_DNA-bd_dom,prints_Interferon_reg_fact_DNA-bd_dom	p.P461	ENST00000367021.3	37	c.1383	CCDS1492.1	1																																																																																			-	NULL		0.468	IRF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRF6	protein_coding	OTTHUMT00000088827.1	G	NM_006147	-		209961786	-1	no_errors	ENST00000367021	ensembl	human	known	74_37	silent	SNP	0.061	A
OSGEP	55644	genome.wustl.edu	37	14	20915590	20915590	+	Missense_Mutation	SNP	A	A	G			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr14:20915590A>G	ENST00000206542.4	-	10	1380	c.959T>C	c.(958-960)gTt>gCt	p.V320A	OSGEP_ENST00000555656.1_Missense_Mutation_p.V121A|OSGEP_ENST00000554249.1_Missense_Mutation_p.V138A	NM_017807.3	NP_060277.1			O-sialoglycoprotein endopeptidase											endometrium(3)|kidney(1)|large_intestine(1)|liver(1)|lung(4)|stomach(1)	11	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;1.09e-07)|all cancers(55;1.19e-06)	GBM - Glioblastoma multiforme(265;0.0231)|READ - Rectum adenocarcinoma(17;0.196)		CCTCTGTGTAACCCCAGAATC	0.502																																																	0								ENSG00000092094						63.0	58.0	60.0					14																	20915590		2203	4300	6503	OSGEP	SO:0001583	missense	0			-	HGNC	AB050442	CCDS9549.1	14q12	2010-03-19			ENSG00000092094	ENSG00000092094	3.4.24.57		18028	protein-coding gene	gene with protein product		610107				12039036	Standard	NM_017807		Approved	PRSMG1, GCPL1, OSGEP1, KAE1	uc001vxf.3	Q9NPF4	OTTHUMG00000029543	ENST00000206542.4:c.959T>C	14.37:g.20915590A>G	ENSP00000206542:p.Val320Ala	Somatic	0	53	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	53	20.59		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Gcp-like_dom,prints_KAE1/YgjD,tigrfam_KAE1/YgjD	p.V320A	ENST00000206542.4	37	c.959	CCDS9549.1	14	.	.	.	.	.	.	.	.	.	.	A	17.67	3.446495	0.63178	.	.	ENSG00000092094	ENST00000555656;ENST00000206542;ENST00000554249	T	0.48201	0.82	5.23	5.23	0.72850	.	0.267028	0.41396	D	0.000894	T	0.51261	0.1664	M	0.76328	2.33	0.33957	D	0.645162	B	0.11235	0.004	B	0.22601	0.04	T	0.62992	-0.6736	10	0.59425	D	0.04	-1.7066	14.0954	0.65019	1.0:0.0:0.0:0.0	.	320	Q9NPF4	OSGEP_HUMAN	A	121;320;138	ENSP00000206542:V320A	ENSP00000206542:V320A	V	-	2	0	OSGEP	19985430	1.000000	0.71417	0.776000	0.31678	0.977000	0.68977	8.600000	0.90860	1.973000	0.57446	0.455000	0.32223	GTT	-	NULL		0.502	OSGEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OSGEP	protein_coding	OTTHUMT00000073635.3	A	NM_017807	-		20915590	-1	no_errors	ENST00000206542	ensembl	human	known	74_37	missense	SNP	1.000	G
LINC01164	399827	genome.wustl.edu	37	10	133608270	133608270	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr10:133608270C>T	ENST00000341866.3	-	3	694	c.106G>A	c.(106-108)Gaa>Aaa	p.E36K																								GCACCCACTTCCTTCTCGGTG	0.662																																																	0								ENSG00000189275																																			AL450307.1	SO:0001583	missense	0			-	Clone_based_ensembl_gene																												ENST00000341866.3:c.106G>A	10.37:g.133608270C>T	ENSP00000340261:p.Glu36Lys	Somatic	0	89	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	32	113	22.07		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.E36K	ENST00000341866.3	37	c.106		10	.	.	.	.	.	.	.	.	.	.	C	9.470	1.095485	0.20471	.	.	ENSG00000189275	ENST00000341866	.	.	.	1.57	-0.556	0.11803	.	.	.	.	.	T	0.29588	0.0738	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.34976	-0.9807	5	0.87932	D	0	.	2.1363	0.03763	0.3055:0.489:0.0:0.2055	.	.	.	.	K	36	.	ENSP00000340261:E36K	E	-	1	0	AL450307.1	133458260	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.006000	0.12833	-0.158000	0.11040	0.462000	0.41574	GAA	-	NULL		0.662	AL450307.1-201	KNOWN	basic|appris_principal	protein_coding	ENSG00000189275	protein_coding		C		-		133608270	-1	no_errors	ENST00000341866	ensembl	human	known	74_37	missense	SNP	0.000	T
ABCC3	8714	genome.wustl.edu	37	17	48745306	48745306	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr17:48745306C>T	ENST00000285238.8	+	13	1798	c.1718C>T	c.(1717-1719)tCc>tTc	p.S573F		NM_003786.3	NP_003777.2	O15438	MRP3_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 3	573	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(11)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	33			BRCA - Breast invasive adenocarcinoma(22;3.05e-09)		Cisplatin(DB00515)|Clotrimazole(DB00257)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Doxorubicin(DB00997)|Etoposide(DB00773)|Ezetimibe(DB00973)|Fluorouracil(DB00544)|Folic Acid(DB00158)|Gadoxetate(DB08884)|Glutathione(DB00143)|Glyburide(DB01016)|Indomethacin(DB00328)|Lamivudine(DB00709)|Leucovorin(DB00650)|Methotrexate(DB00563)|Metyrapone(DB01011)|Nifedipine(DB01115)|Omeprazole(DB00338)|Phenobarbital(DB01174)|Probenecid(DB01032)|Rifampicin(DB01045)|Sulfinpyrazone(DB01138)|Verapamil(DB00661)|Vincristine(DB00541)	GTGTCTGTGTCCTTGTTTAAT	0.542																																																	0								ENSG00000108846						198.0	165.0	176.0					17																	48745306		2203	4300	6503	ABCC3	SO:0001583	missense	0			-	HGNC	Y17151	CCDS32681.1, CCDS45739.1	17q21	2012-03-14			ENSG00000108846	ENSG00000108846		"""ATP binding cassette transporters / subfamily C"""	54	protein-coding gene	gene with protein product	"""canalicular multispecific organic anion transporter 2"""	604323				8894702, 9827529	Standard	NM_003786		Approved	MRP3, cMOAT2, EST90757, MLP2, MOAT-D	uc002isl.3	O15438	OTTHUMG00000162245	ENST00000285238.8:c.1718C>T	17.37:g.48745306C>T	ENSP00000285238:p.Ser573Phe	Somatic	0	28	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	34	12.82	B2RPA9|D3DTX9|O60265|O60922|O75621|O95078|O95289|O95290|Q86X85|Q9UN52	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC1_TM_dom,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom,tigrfam_Multidrug-R_assoc	p.S573F	ENST00000285238.8	37	c.1718	CCDS32681.1	17	.	.	.	.	.	.	.	.	.	.	C	21.2	4.120419	0.77323	.	.	ENSG00000108846	ENST00000285238	D	0.90563	-2.69	4.32	4.32	0.51571	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.072454	0.56097	D	0.000023	D	0.96895	0.8986	H	0.96861	3.895	0.80722	D	1	D	0.64830	0.994	D	0.69307	0.963	D	0.98411	1.0572	10	0.87932	D	0	-23.7676	17.385	0.87413	0.0:1.0:0.0:0.0	.	573	O15438	MRP3_HUMAN	F	573	ENSP00000285238:S573F	ENSP00000285238:S573F	S	+	2	0	ABCC3	46100305	1.000000	0.71417	0.989000	0.46669	0.527000	0.34593	7.651000	0.83577	2.406000	0.81754	0.591000	0.81541	TCC	-	pfam_ABC_transptr_TM_dom,superfamily_ABC1_TM_dom,pfscan_ABC1_TM_dom,tigrfam_Multidrug-R_assoc		0.542	ABCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCC3	protein_coding	OTTHUMT00000368083.2	C	NM_020038	-		48745306	+1	no_errors	ENST00000285238	ensembl	human	known	74_37	missense	SNP	1.000	T
AKNAD1	254268	genome.wustl.edu	37	1	109391374	109391374	+	Splice_Site	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr1:109391374C>T	ENST00000370001.3	-	5	1513	c.1245G>A	c.(1243-1245)ctG>ctA	p.L415L	AKNAD1_ENST00000357393.4_Splice_Site_p.L122L|AKNAD1_ENST00000369994.1_Splice_Site_p.L415L|AKNAD1_ENST00000369995.3_Splice_Site_p.L415L	NM_152763.4	NP_689976.2	Q5T1N1	AKND1_HUMAN	AKNA domain containing 1	415						cytoplasm (GO:0005737)				breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(10)|ovary(3)|prostate(6)|skin(3)|stomach(2)	32						AATTCATTACCAGCTTCTTGT	0.333																																																	0								ENSG00000162641						85.0	98.0	94.0					1																	109391374		2202	4298	6500	AKNAD1	SO:0001630	splice_region_variant	0			-	HGNC	AK095517	CCDS791.2	1p13.3	2009-10-29	2009-10-29	2009-10-29	ENSG00000162641	ENSG00000162641			28398	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 62"""	C1orf62			Standard	NM_152763		Approved	MGC26989	uc001dwa.4	Q5T1N1	OTTHUMG00000011231	ENST00000370001.3:c.1245+1G>A	1.37:g.109391374C>T		Somatic	0	50	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	65	12.16	B9EK62|Q5T1N0|Q8N990|Q8NCN9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_TF_AT-hook	p.L415	ENST00000370001.3	37	c.1245	CCDS791.2	1																																																																																			-	pfam_TF_AT-hook		0.333	AKNAD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	AKNAD1	protein_coding	OTTHUMT00000030923.2	C	NM_152763	-	Silent	109391374	-1	no_errors	ENST00000370001	ensembl	human	known	74_37	silent	SNP	0.995	T
CRNN	49860	genome.wustl.edu	37	1	152383410	152383410	+	Missense_Mutation	SNP	C	C	T	rs187547075	byFrequency	TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr1:152383410C>T	ENST00000271835.3	-	3	210	c.148G>A	c.(148-150)Gat>Aat	p.D50N	RP1-91G5.3_ENST00000411804.1_RNA	NM_016190.2	NP_057274.1	Q9UBG3	CRNN_HUMAN	cornulin	50	EF-hand. {ECO:0000255|PROSITE- ProRule:PRU00448}.				response to heat (GO:0009408)|single organismal cell-cell adhesion (GO:0016337)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(16)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			GTTGCTGGATCGTGGGGTTTC	0.547																																																	0								ENSG00000143536						34.0	34.0	34.0					1																	152383410		2176	4254	6430	CRNN	SO:0001583	missense	0			-	HGNC	AF077831	CCDS1010.1	1q21	2014-01-28	2005-06-13	2005-06-13	ENSG00000143536	ENSG00000143536		"""EF-hand domain containing"""	1230	protein-coding gene	gene with protein product		611312	"""chromosome 1 open reading frame 10"""	C1orf10		11056050, 15854041	Standard	NM_016190		Approved	SEP53	uc001ezx.2	Q9UBG3	OTTHUMG00000012383	ENST00000271835.3:c.148G>A	1.37:g.152383410C>T	ENSP00000271835:p.Asp50Asn	Somatic	0	41	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	44	21.43	B2RE60|Q8N613	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_S100_Ca-bd_sub,smart_EF_hand_dom,pfscan_EF_hand_dom	p.D50N	ENST00000271835.3	37	c.148	CCDS1010.1	1	.	.	.	.	.	.	.	.	.	.	C	15.52	2.858241	0.51376	.	.	ENSG00000143536	ENST00000271835;ENST00000451038	T	0.14766	2.48	4.73	4.73	0.59995	EF-hand-like domain (1);	0.000000	0.48286	D	0.000183	T	0.29458	0.0734	M	0.82923	2.615	0.31956	N	0.609071	D	0.89917	1.0	D	0.91635	0.999	T	0.10177	-1.0641	10	0.66056	D	0.02	.	13.0803	0.59109	0.0:1.0:0.0:0.0	.	50	Q9UBG3	CRNN_HUMAN	N	50	ENSP00000271835:D50N	ENSP00000271835:D50N	D	-	1	0	CRNN	150650034	0.914000	0.31030	0.425000	0.26659	0.103000	0.19146	3.788000	0.55446	2.449000	0.82847	0.305000	0.20034	GAT	-	pfscan_EF_hand_dom		0.547	CRNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRNN	protein_coding	OTTHUMT00000034503.1	C	NM_016190	-		152383410	-1	no_errors	ENST00000271835	ensembl	human	known	74_37	missense	SNP	0.752	T
ELL	8178	genome.wustl.edu	37	19	18576666	18576666	+	Silent	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr19:18576666G>A	ENST00000262809.4	-	3	317	c.246C>T	c.(244-246)tcC>tcT	p.S82S	ELL_ENST00000596124.3_5'UTR	NM_006532.3	NP_006523.1	P55199	ELL_HUMAN	elongation factor RNA polymerase II	82					gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of viral transcription (GO:0050434)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|snRNA transcription from RNA polymerase III promoter (GO:0042796)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	Cajal body (GO:0015030)|histone locus body (GO:0035363)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	phosphatase binding (GO:0019902)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|liver(1)|lung(5)|prostate(1)	19				GBM - Glioblastoma multiforme(1328;7.81e-07)		GGCCGATGTTGGAGAGGTAGA	0.677			T	MLL	AL																																			Dom	yes		19	19p13.1	8178	ELL gene (11-19 lysine-rich leukemia gene)		L	0								ENSG00000105656						43.0	45.0	44.0					19																	18576666		2203	4300	6503	ELL	SO:0001819	synonymous_variant	0			-	HGNC	U16282	CCDS12380.1	19p13.1	2012-04-17	2005-05-23			ENSG00000105656		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	23114	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 68"""	600284	"""chromosome 19 open reading frame 17"""	C19orf17		7991593, 8596958	Standard	NM_006532		Approved	Men, ELL1, PPP1R68	uc002njh.3	P55199		ENST00000262809.4:c.246C>T	19.37:g.18576666G>A		Somatic	0	73	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	82	21.15		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_RNA_pol_II_elong_fac_ELL,pfam_Occludin_RNApol2_elong_fac_ELL	p.S82	ENST00000262809.4	37	c.246	CCDS12380.1	19																																																																																			-	pfam_RNA_pol_II_elong_fac_ELL		0.677	ELL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELL	protein_coding	OTTHUMT00000466362.1	G	NM_006532	-		18576666	-1	no_errors	ENST00000262809	ensembl	human	known	74_37	silent	SNP	0.998	A
SMYD1	150572	genome.wustl.edu	37	2	88409874	88409874	+	Splice_Site	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr2:88409874C>T	ENST00000419482.2	+	10	1401	c.1316C>T	c.(1315-1317)gCc>gTc	p.A439V	SMYD1_ENST00000444564.2_Splice_Site_p.A426V|SMYD1_ENST00000438570.1_Intron	NM_198274.3	NP_938015.1	Q8NB12	SMYD1_HUMAN	SET and MYND domain containing 1	439					chromatin remodeling (GO:0006338)|heart development (GO:0007507)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of myotube differentiation (GO:0010831)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|metal ion binding (GO:0046872)|transcription corepressor activity (GO:0003714)			NS(1)|breast(4)|central_nervous_system(1)|large_intestine(6)|lung(19)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	41						GTCCCACAGGCCATGCGGGTG	0.527																																																	0								ENSG00000115593						69.0	54.0	59.0					2																	88409874		2203	4300	6503	SMYD1	SO:0001630	splice_region_variant	0			-	HGNC	AF086123	CCDS33240.1	2p11.1	2011-07-01			ENSG00000115593	ENSG00000115593		"""Zinc fingers, MYND-type"", ""Chromatin-modifying enzymes / K-methyltransferases"""	20986	protein-coding gene	gene with protein product		606846				11923873	Standard	NM_198274		Approved	BOP, ZMYND22, KMT3D	uc002ssr.3	Q8NB12	OTTHUMG00000155045	ENST00000419482.2:c.1315-1C>T	2.37:g.88409874C>T		Somatic	0	53	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	47	11.32	A0AV30|A6NE13	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SET_dom,pfam_Znf_MYND,smart_SET_dom,pfscan_SET_dom,pfscan_Znf_MYND	p.A439V	ENST00000419482.2	37	c.1316	CCDS33240.1	2	.	.	.	.	.	.	.	.	.	.	C	13.80	2.345867	0.41599	.	.	ENSG00000115593	ENST00000419482;ENST00000444564;ENST00000295833	T;T	0.23950	1.88;1.89	5.13	3.25	0.37280	.	0.222920	0.45606	D	0.000345	T	0.14270	0.0345	N	0.22421	0.69	0.80722	D	1	B	0.16166	0.016	B	0.11329	0.006	T	0.10177	-1.0641	10	0.29301	T	0.29	.	5.487	0.16755	0.0:0.4949:0.3461:0.159	.	439	Q8NB12	SMYD1_HUMAN	V	439;426;260	ENSP00000393453:A439V;ENSP00000407888:A426V	ENSP00000295833:A260V	A	+	2	0	SMYD1	88190989	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	3.005000	0.49521	0.505000	0.28104	0.655000	0.94253	GCC	-	NULL		0.527	SMYD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMYD1	protein_coding	OTTHUMT00000338229.2	C	XM_097915	-	Missense_Mutation	88409874	+1	no_errors	ENST00000419482	ensembl	human	known	74_37	missense	SNP	1.000	T
FCGBP	8857	genome.wustl.edu	37	19	40408491	40408491	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr19:40408491C>T	ENST00000221347.6	-	8	4355	c.4348G>A	c.(4348-4350)Gag>Aag	p.E1450K		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	1450	VWFD 3. {ECO:0000255|PROSITE- ProRule:PRU00580}.					extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			TTCTCCAGCTCGGGAGGACAC	0.657																																																	0								ENSG00000090920						55.0	60.0	58.0					19																	40408491		2203	4300	6503	FCGBP	SO:0001583	missense	0			-	HGNC	D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.4348G>A	19.37:g.40408491C>T	ENSP00000221347:p.Glu1450Lys	Somatic	0	87	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	114	19.15	O95784	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,smart_Fol_N,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EG-like_dom,smart_VWF_C,smart_VWC_out	p.E1450K	ENST00000221347.6	37	c.4348	CCDS12546.1	19	.	.	.	.	.	.	.	.	.	.	c	7.649	0.682589	0.14907	.	.	ENSG00000090920	ENST00000221347	T	0.19532	2.14	4.77	2.38	0.29361	von Willebrand factor, type D domain (1);	.	.	.	.	T	0.10852	0.0265	L	0.45698	1.435	0.23204	N	0.998123	P	0.43885	0.82	B	0.27796	0.083	T	0.16364	-1.0405	9	0.17832	T	0.49	.	2.8511	0.05558	0.19:0.5256:0.184:0.1004	.	1450	Q9Y6R7	FCGBP_HUMAN	K	1450	ENSP00000221347:E1450K	ENSP00000221347:E1450K	E	-	1	0	FCGBP	45100331	.	.	0.309000	0.25155	0.016000	0.09150	.	.	0.946000	0.37632	0.644000	0.83932	GAG	-	NULL		0.657	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCGBP	protein_coding	OTTHUMT00000462507.1	C	NM_003890	-		40408491	-1	no_errors	ENST00000221347	ensembl	human	known	74_37	missense	SNP	0.894	T
DPY19L4	286148	genome.wustl.edu	37	8	95746906	95746906	+	Missense_Mutation	SNP	C	C	T	rs147410800		TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr8:95746906C>T	ENST00000414645.2	+	3	275	c.176C>T	c.(175-177)gCg>gTg	p.A59V		NM_181787.2	NP_861452.2	Q7Z388	D19L4_HUMAN	dpy-19-like 4 (C. elegans)	59						integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)			breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(2)|lung(6)|ovary(2)|prostate(2)	21	Breast(36;3.85e-06)					TGTCTTGCAGCGGTTACTAGT	0.348													C|||	1	0.000199681	0.0	0.0	5008	,	,		19094	0.0		0.001	False		,,,				2504	0.0																0								ENSG00000156162						101.0	93.0	96.0					8																	95746906		2203	4300	6503	DPY19L4	SO:0001583	missense	0			GMAF=0.0005	HGNC		CCDS34924.1	8q22.1	2006-11-24			ENSG00000156162	ENSG00000156162			27829	protein-coding gene	gene with protein product		613895					Standard	NM_181787		Approved		uc003ygx.2	Q7Z388	OTTHUMG00000164589	ENST00000414645.2:c.176C>T	8.37:g.95746906C>T	ENSP00000389630:p.Ala59Val	Somatic	0	66	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	64	15.79	Q6ZW32|Q6ZW42|Q7Z329	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Dpy-19	p.A59V	ENST00000414645.2	37	c.176	CCDS34924.1	8	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	29.5	5.008505	0.93346	.	.	ENSG00000156162	ENST00000414645;ENST00000519176	T;T	0.61158	0.13;0.13	5.05	5.05	0.67936	.	0.000000	0.85682	D	0.000000	T	0.75532	0.3862	M	0.66939	2.045	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.77859	-0.2431	10	0.66056	D	0.02	-13.6839	18.7653	0.91869	0.0:1.0:0.0:0.0	.	59	Q7Z388	D19L4_HUMAN	V	59;30	ENSP00000389630:A59V;ENSP00000430417:A30V	ENSP00000389630:A59V	A	+	2	0	DPY19L4	95816082	1.000000	0.71417	0.998000	0.56505	0.991000	0.79684	6.602000	0.74141	2.480000	0.83734	0.591000	0.81541	GCG	-	pfam_Dpy-19		0.348	DPY19L4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPY19L4	protein_coding	OTTHUMT00000379339.1	C	NM_181787	rs147410800		95746906	+1	no_errors	ENST00000414645	ensembl	human	known	74_37	missense	SNP	1.000	T
RSPH6A	81492	genome.wustl.edu	37	19	46308052	46308052	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr19:46308052C>T	ENST00000221538.3	-	3	1253	c.1111G>A	c.(1111-1113)Gag>Aag	p.E371K	RSPH6A_ENST00000597055.1_Missense_Mutation_p.E371K|RSPH6A_ENST00000600188.1_Missense_Mutation_p.E107K	NM_030785.3	NP_110412.1	Q9H0K4	RSH6A_HUMAN	radial spoke head 6 homolog A (Chlamydomonas)	371	Glu-rich.					intracellular (GO:0005622)				central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	32						acctcctcctcctctgcctcc	0.652																																																	0								ENSG00000104941						83.0	68.0	73.0					19																	46308052		2203	4300	6503	RSPH6A	SO:0001583	missense	0			-	HGNC	AL136761	CCDS12675.1	19q13.3	2010-02-17	2009-11-18	2009-11-18	ENSG00000104941	ENSG00000104941			14241	protein-coding gene	gene with protein product		607548	"""radial spokehead-like 1"""	RSHL1		11237735	Standard	NM_030785		Approved	RSP4, RSP6, RSPH4B	uc002pdm.3	Q9H0K4		ENST00000221538.3:c.1111G>A	19.37:g.46308052C>T	ENSP00000221538:p.Glu371Lys	Somatic	0	63	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	94	12.15	Q53FE2|Q6PEZ9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Radial_spoke	p.E371K	ENST00000221538.3	37	c.1111	CCDS12675.1	19	.	.	.	.	.	.	.	.	.	.	C	14.47	2.545857	0.45280	.	.	ENSG00000104941	ENST00000221538	T	0.19105	2.17	3.76	3.76	0.43208	.	0.131525	0.47093	D	0.000254	T	0.16938	0.0407	L	0.58428	1.81	0.33704	D	0.614909	B	0.24963	0.115	B	0.25140	0.058	T	0.09729	-1.0661	10	0.09338	T	0.73	-2.5473	7.4235	0.27085	0.0:0.8831:0.0:0.1169	.	371	Q9H0K4	RSH6A_HUMAN	K	371	ENSP00000221538:E371K	ENSP00000221538:E371K	E	-	1	0	RSPH6A	50999892	1.000000	0.71417	0.999000	0.59377	0.639000	0.38242	5.383000	0.66219	2.391000	0.81399	0.456000	0.33151	GAG	-	pfam_Radial_spoke		0.652	RSPH6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RSPH6A	protein_coding	OTTHUMT00000461657.1	C		-		46308052	-1	no_errors	ENST00000221538	ensembl	human	known	74_37	missense	SNP	1.000	T
EVI5	7813	genome.wustl.edu	37	1	92979091	92979124	+	3'UTR	DEL	TATATATATATATATATATATATATATATATATG	TATATATATATATATATATATATATATATATATG	-	rs11274071|rs146230362|rs12728513|rs202223184|rs199848107|rs201599890|rs201951736|rs200752743|rs200425212|rs6603978|rs201771520|rs200428687|rs201275224|rs200908663|rs201205364	byFrequency	TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	TATATATATATATATATATATATATATATATATG	TATATATATATATATATATATATATATATATATG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr1:92979091_92979124delTATATATATATATATATATATATATATATATATG	ENST00000370331.1	-	0	2531_2564				EVI5_ENST00000540033.1_3'UTR	NM_005665.4	NP_005656.4	O60447	EVI5_HUMAN	ecotropic viral integration site 5						cell cycle (GO:0007049)|cell division (GO:0051301)|cell proliferation (GO:0008283)|multicellular organismal development (GO:0007275)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)|retrograde transport, endosome to Golgi (GO:0042147)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			breast(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(18)|ovary(1)|prostate(1)|skin(1)	38		all_lung(203;0.00146)|Lung NSC(277;0.00565)|all_neural(321;0.185)|Melanoma(281;0.193)|Glioma(108;0.203)		Epithelial(280;8.09e-25)|OV - Ovarian serous cystadenocarcinoma(397;1.27e-22)|all cancers(265;1.74e-21)|GBM - Glioblastoma multiforme(16;0.00233)|BRCA - Breast invasive adenocarcinoma(282;0.211)		tatatatatatatatatatatatatatatatatatatatatatgtacatatGAA	0.261																																																	0								ENSG00000067208																																			EVI5	SO:0001624	3_prime_UTR_variant	0				HGNC	AF008915	CCDS30774.1	1p22	2013-07-09			ENSG00000067208	ENSG00000067208			3501	protein-coding gene	gene with protein product	"""neuroblastoma stage 4S gene"""	602942				9618176	Standard	XM_005271180		Approved	NB4S	uc001dox.3	O60447	OTTHUMG00000010895	ENST00000370331.1:c.*122CATATATATATATATATATATATATATATATATA>-	1.37:g.92979091_92979124delTATATATATATATATATATATATATATATATATG		Somatic	NA	NA	NA		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A6NKX8|B9A6J0|Q9H1Y9	Splice_Site	DEL	NA	NA	NA	NA	NA	NA	-	e19-1	ENST00000370331.1	37	c.2433+4_-29	CCDS30774.1	1																																																																																			-	-		0.261	EVI5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EVI5	protein_coding	OTTHUMT00000030047.1	TATATATATATATATATATATATATATATATATG	NM_005665			92979124	-1	no_errors	ENST00000540033	ensembl	human	known	74_37	splice_site_del	DEL	0.813:0.811:0.805:0.795:0.780:0.757:0.752:0.742:0.726:0.703:0.669:0.621:0.592:0.563:0.533:0.506:0.417:0.346:0.284:0.101:0.051:0.001:0.001:0.001:0.001:0.003:0.005:0.006:0.006:0.005:0.259:0.426:0.412:0.410	-
CMKLR1	1240	genome.wustl.edu	37	12	108685802	108685802	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr12:108685802G>A	ENST00000312143.7	-	3	1301	c.938C>T	c.(937-939)cCc>cTc	p.P313L	CMKLR1_ENST00000552995.1_Missense_Mutation_p.P311L|CMKLR1_ENST00000412676.1_Missense_Mutation_p.P313L|CMKLR1_ENST00000550402.1_Missense_Mutation_p.P313L|CMKLR1_ENST00000397688.2_Missense_Mutation_p.P311L	NM_001142344.1|NM_004072.2	NP_001135816.1|NP_004063.1	Q99788	CML1_HUMAN	chemokine-like receptor 1	313					chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of macrophage chemotaxis (GO:0010759)|regulation of calcium-mediated signaling (GO:0050848)|skeletal system development (GO:0001501)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	chemokine receptor activity (GO:0004950)|G-protein coupled receptor activity (GO:0004930)|receptor activity (GO:0004872)			endometrium(5)|large_intestine(3)|lung(20)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	37						ATACAGAATGGGGTTCATGCA	0.542																																																	0								ENSG00000174600						72.0	75.0	74.0					12																	108685802		2006	4174	6180	CMKLR1	SO:0001583	missense	0			-	HGNC	U79526	CCDS41829.1, CCDS44965.1	12q23.3	2013-07-29			ENSG00000174600	ENSG00000174600		"""GPCR / Class A : Resolvin receptors"""	2121	protein-coding gene	gene with protein product	"""resolvin E1 receptor"", ""chemerin receptor"""	602351					Standard	NM_004072		Approved	RVER1	uc009zuw.3	Q99788	OTTHUMG00000169576	ENST00000312143.7:c.938C>T	12.37:g.108685802G>A	ENSP00000311733:p.Pro313Leu	Somatic	0	34	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	50	13.79	A8K6Y5|O75748|Q3KP37|Q5U0H0|Q99789	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_DEZorph_rcpt,prints_GPCR_Rhodpsn,prints_Formyl_pep_rcpt,prints_Anphylx_rcpt,prints_ATII_rcpt	p.P313L	ENST00000312143.7	37	c.938	CCDS44965.1	12	.	.	.	.	.	.	.	.	.	.	g	26.7	4.758293	0.89843	.	.	ENSG00000174600	ENST00000312143;ENST00000412676;ENST00000397688;ENST00000552995;ENST00000550402	D;D;D;D;D	0.98807	-5.15;-5.15;-5.15;-5.15;-5.15	5.33	5.33	0.75918	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.99524	0.9830	H	0.98238	4.18	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97965	1.0340	10	0.87932	D	0	.	18.065	0.89388	0.0:0.0:1.0:0.0	.	313	Q99788	CML1_HUMAN	L	313;313;311;311;313	ENSP00000311733:P313L;ENSP00000401293:P313L;ENSP00000380803:P311L;ENSP00000447579:P311L;ENSP00000449716:P313L	ENSP00000311733:P313L	P	-	2	0	CMKLR1	107209932	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	9.857000	0.99534	2.494000	0.84150	0.550000	0.68814	CCC	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.542	CMKLR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CMKLR1	protein_coding	OTTHUMT00000404867.1	G		-		108685802	-1	no_errors	ENST00000312143	ensembl	human	known	74_37	missense	SNP	1.000	A
EPHA2	1969	genome.wustl.edu	37	1	16456751	16456751	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr1:16456751G>A	ENST00000358432.5	-	15	2793	c.2639C>T	c.(2638-2640)tCc>tTc	p.S880F		NM_004431.3	NP_004422.2	P29317	EPHA2_HUMAN	EPH receptor A2	880	Mediates interaction with ARHGEF16 and ELMO2.				activation of Rac GTPase activity (GO:0032863)|angiogenesis (GO:0001525)|axial mesoderm formation (GO:0048320)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell migration (GO:0016477)|ephrin receptor signaling pathway (GO:0048013)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|keratinocyte differentiation (GO:0030216)|lens fiber cell morphogenesis (GO:0070309)|mammary gland epithelial cell proliferation (GO:0033598)|multicellular organismal development (GO:0007275)|negative regulation of protein kinase B signaling (GO:0051898)|neural tube development (GO:0021915)|neuron differentiation (GO:0030182)|notochord cell development (GO:0060035)|notochord formation (GO:0014028)|osteoblast differentiation (GO:0001649)|osteoclast differentiation (GO:0030316)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|post-anal tail morphogenesis (GO:0036342)|protein kinase B signaling (GO:0043491)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of lamellipodium assembly (GO:0010591)|response to growth factor (GO:0070848)|skeletal system development (GO:0001501)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cell projection (GO:0042995)|cell surface (GO:0009986)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|leading edge membrane (GO:0031256)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(3)|cervix(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|pancreas(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	42		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|Colorectal(212;3.63e-07)|COAD - Colon adenocarcinoma(227;2.25e-05)|BRCA - Breast invasive adenocarcinoma(304;9.58e-05)|Kidney(64;0.000175)|KIRC - Kidney renal clear cell carcinoma(64;0.00261)|STAD - Stomach adenocarcinoma(313;0.00669)|READ - Rectum adenocarcinoma(331;0.0649)	Dasatinib(DB01254)|Regorafenib(DB08896)	GGTCTTGAGGGAGTCAGGGGC	0.572																																																	0								ENSG00000142627						97.0	93.0	94.0					1																	16456751		2203	4300	6503	EPHA2	SO:0001583	missense	0			-	HGNC	BC037166	CCDS169.1	1p36	2013-02-11	2004-10-28		ENSG00000142627	ENSG00000142627	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3386	protein-coding gene	gene with protein product		176946	"""EphA2"""	ECK		9119409	Standard	NM_004431		Approved		uc001aya.2	P29317	OTTHUMG00000009527	ENST00000358432.5:c.2639C>T	1.37:g.16456751G>A	ENSP00000351209:p.Ser880Phe	Somatic	0	87	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	91	12.50	B5A968|Q8N3Z2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_SAM_type1,pfam_SAM_2,pfam_Interferon_alpha/beta_rcpt_bsu,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt_N_dom,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_dom	p.S880F	ENST00000358432.5	37	c.2639	CCDS169.1	1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.465089	0.84425	.	.	ENSG00000142627	ENST00000358432	T	0.62639	0.01	5.63	5.63	0.86233	Protein kinase-like domain (1);	0.000000	0.56097	D	0.000023	D	0.82435	0.5036	M	0.86502	2.82	0.80722	D	1	D	0.76494	0.999	D	0.79784	0.993	D	0.85126	0.0972	10	0.87932	D	0	.	18.2443	0.89979	0.0:0.0:1.0:0.0	.	880	P29317	EPHA2_HUMAN	F	880	ENSP00000351209:S880F	ENSP00000351209:S880F	S	-	2	0	EPHA2	16329338	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	3.933000	0.56545	2.670000	0.90874	0.655000	0.94253	TCC	-	pirsf_Tyr_kinase_ephrin_rcpt,superfamily_Kinase-like_dom		0.572	EPHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHA2	protein_coding	OTTHUMT00000026322.1	G	NM_004431	-		16456751	-1	no_errors	ENST00000358432	ensembl	human	known	74_37	missense	SNP	1.000	A
CUZD1	50624	genome.wustl.edu	37	10	124600736	124600736	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr10:124600736C>T	ENST00000368904.1	-	4	1140	c.191G>A	c.(190-192)aGa>aAa	p.R64K	CUZD1_ENST00000545804.1_Missense_Mutation_p.R64K|CUZD1_ENST00000392790.1_Missense_Mutation_p.R64K					CUB and zona pellucida-like domains 1											NS(1)|breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)|skin(3)|stomach(1)	39		all_neural(114;0.169)|Glioma(114;0.222)		Colorectal(40;0.126)|COAD - Colon adenocarcinoma(40;0.141)		GTTTTCTGGTCTTTCTATTGT	0.448																																																	0								ENSG00000138161						177.0	167.0	171.0					10																	124600736		2203	4300	6503	CUZD1	SO:0001583	missense	0			-	HGNC	AF305835	CCDS7631.1	10q26.13	2003-11-18			ENSG00000138161	ENSG00000138161			17937	protein-coding gene	gene with protein product						10542259	Standard	NM_022034		Approved	ERG-1, UO-44		Q86UP6	OTTHUMG00000019195	ENST00000368904.1:c.191G>A	10.37:g.124600736C>T	ENSP00000357900:p.Arg64Lys	Somatic	0	41	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	54	16.92		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ZP_dom,pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,smart_ZP_dom,pfscan_CUB_dom,pfscan_ZP_dom,prints_ZP_dom	p.R64K	ENST00000368904.1	37	c.191	CCDS7631.1	10	.	.	.	.	.	.	.	.	.	.	C	10.52	1.372850	0.24857	.	.	ENSG00000138161	ENST00000368904;ENST00000545804;ENST00000392790	T;T;T	0.34275	1.37;1.37;1.37	5.42	1.38	0.22167	CUB (5);	0.409722	0.26058	N	0.026583	T	0.29749	0.0743	M	0.67953	2.075	0.32002	N	0.60326	B	0.12630	0.006	B	0.17098	0.017	T	0.42965	-0.9420	10	0.07030	T	0.85	-6.2359	9.3896	0.38365	0.0:0.6933:0.0:0.3067	.	64	Q86UP6	CUZD1_HUMAN	K	64	ENSP00000357900:R64K;ENSP00000441590:R64K;ENSP00000376540:R64K	ENSP00000357900:R64K	R	-	2	0	CUZD1	124590726	0.931000	0.31567	0.101000	0.21167	0.855000	0.48748	1.325000	0.33724	-0.016000	0.14127	-0.244000	0.11960	AGA	-	pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom		0.448	CUZD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUZD1	protein_coding	OTTHUMT00000050829.2	C	NM_022034	-		124600736	-1	no_errors	ENST00000368904	ensembl	human	known	74_37	missense	SNP	0.949	T
UTP6	55813	genome.wustl.edu	37	17	30202316	30202316	+	Silent	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr17:30202316G>A	ENST00000261708.4	-	14	1379	c.1242C>T	c.(1240-1242)atC>atT	p.I414I	CTC-542B22.2_ENST00000583236.1_lincRNA	NM_018428.2	NP_060898.2	Q9NYH9	UTP6_HUMAN	UTP6, small subunit (SSU) processome component, homolog (yeast)	414					rRNA processing (GO:0006364)	nucleolus (GO:0005730)				breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|skin(1)	21		all_hematologic(16;0.0149)|Ovarian(249;0.021)|Myeloproliferative disorder(56;0.0255)|Acute lymphoblastic leukemia(14;0.0257)|Breast(31;0.231)				TCTTTGACTCGATCAGCACCT	0.468																																																	0								ENSG00000108651						88.0	86.0	87.0					17																	30202316		2203	4300	6503	UTP6	SO:0001819	synonymous_variant	0			-	HGNC	AF116631	CCDS11269.1	17q11.2	2010-06-24	2006-05-16	2006-05-16	ENSG00000108651	ENSG00000108651			18279	protein-coding gene	gene with protein product	"""hepatocellular carcinoma associated antigen 66"""		"""chromosome 17 open reading frame 40"""	C17orf40		10843809, 16138909	Standard	NM_018428		Approved	HCA66	uc002hgr.3	Q9NYH9	OTTHUMG00000132815	ENST00000261708.4:c.1242C>T	17.37:g.30202316G>A		Somatic	0	43	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	84	13.40	Q8IX96|Q96BL2|Q9NQ91	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_U3_snoRNA_assoc-6,smart_HAT	p.I414	ENST00000261708.4	37	c.1242	CCDS11269.1	17																																																																																			-	NULL		0.468	UTP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UTP6	protein_coding	OTTHUMT00000256265.2	G	NM_018428	-		30202316	-1	no_errors	ENST00000261708	ensembl	human	known	74_37	silent	SNP	0.009	A
CACNA1D	776	genome.wustl.edu	37	3	53778779	53778779	+	Silent	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr3:53778779C>T	ENST00000350061.5	+	23	3442	c.2931C>T	c.(2929-2931)atC>atT	p.I977I	CACNA1D_ENST00000422281.2_Silent_p.I977I|CACNA1D_ENST00000288139.4_Silent_p.I997I	NM_001128840.1	NP_001122312.1	Q01668	CAC1D_HUMAN	calcium channel, voltage-dependent, L type, alpha 1D subunit	977					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|energy reserve metabolic process (GO:0006112)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane repolarization during SA node cell action potential (GO:0086052)|positive regulation of calcium ion transport (GO:0051928)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|ankyrin binding (GO:0030506)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)|voltage-gated calcium channel activity involved in cardiac muscle cell action potential (GO:0086007)|voltage-gated calcium channel activity involved SA node cell action potential (GO:0086059)			breast(3)|central_nervous_system(9)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(13)|liver(1)|lung(29)|ovary(6)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	90				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	CCAGTGCCATCTCCGTTGTGA	0.507																																																	0								ENSG00000157388						171.0	135.0	147.0					3																	53778779		2203	4300	6503	CACNA1D	SO:0001819	synonymous_variant	0			-	HGNC	AB209171	CCDS2872.1, CCDS46848.1, CCDS46849.1	3p14.3	2012-03-07			ENSG00000157388	ENSG00000157388		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1391	protein-coding gene	gene with protein product		114206		CCHL1A2, CACNL1A2		1664412	Standard	NM_000720		Approved	Cav1.3, CACH3, CACN4	uc003dgu.5	Q01668	OTTHUMG00000158278	ENST00000350061.5:c.2931C>T	3.37:g.53778779C>T		Somatic	0	54	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	62	20.51	B0FYA3|Q13916|Q13931|Q71UT1|Q9UDC3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCCAlpha1,prints_VDCC_L_a1su,prints_LVDCC_a1dsu	p.I997	ENST00000350061.5	37	c.2991	CCDS46848.1	3																																																																																			-	pfam_Ion_trans_dom		0.507	CACNA1D-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNA1D	protein_coding	OTTHUMT00000350557.1	C	NM_000720	-		53778779	+1	no_errors	ENST00000288139	ensembl	human	known	74_37	silent	SNP	1.000	T
VN1R2	317701	genome.wustl.edu	37	19	53762706	53762706	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr19:53762706C>T	ENST00000341702.3	+	1	1162	c.1078C>T	c.(1078-1080)Cca>Tca	p.P360S	VN1R2_ENST00000598458.1_Intron	NM_173856.2	NP_776255.2	Q8NFZ6	VN1R2_HUMAN	vomeronasal 1 receptor 2	360					response to pheromone (GO:0019236)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	pheromone receptor activity (GO:0016503)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(15)|skin(1)|upper_aerodigestive_tract(1)	31				GBM - Glioblastoma multiforme(134;0.00301)		TGCCTGTTTTCCAACTATTAG	0.443																																																	0								ENSG00000196131						215.0	197.0	203.0					19																	53762706		2203	4300	6503	VN1R2	SO:0001583	missense	0			-	HGNC	AF370359	CCDS12862.1	19q13.42	2012-08-22			ENSG00000196131	ENSG00000196131		"""Vomeronasal receptors / Type 1"", ""GPCR / Unclassified : Vomeronasal receptors, type 1"""	19872	protein-coding gene	gene with protein product						12123587	Standard	NM_173856		Approved	V1RL2	uc002qbi.2	Q8NFZ6		ENST00000341702.3:c.1078C>T	19.37:g.53762706C>T	ENSP00000351244:p.Pro360Ser	Somatic	0	45	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	55	20.29	A1L411|Q8TDU4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Vmron_rcpt_1,pfam_GPCR_Rhodpsn,pfam_TAS2_rcpt,pfscan_GPCR_Rhodpsn_7TM,prints_Vmron_rcpt_1	p.P360S	ENST00000341702.3	37	c.1078	CCDS12862.1	19	.	.	.	.	.	.	.	.	.	.	C	14.26	2.483670	0.44147	.	.	ENSG00000196131	ENST00000341702	T	0.34275	1.37	2.94	2.94	0.34122	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.46560	0.1399	L	0.46819	1.47	0.22446	N	0.999098	D	0.64830	0.994	D	0.67725	0.953	T	0.18398	-1.0338	9	0.59425	D	0.04	.	6.1279	0.20189	0.0:0.861:0.0:0.139	.	360	Q8NFZ6	VN1R2_HUMAN	S	360	ENSP00000351244:P360S	ENSP00000351244:P360S	P	+	1	0	VN1R2	58454518	0.110000	0.22057	0.240000	0.24138	0.044000	0.14063	0.447000	0.21710	1.989000	0.58080	0.596000	0.82720	CCA	-	pfam_Vmron_rcpt_1,pfam_GPCR_Rhodpsn,pfam_TAS2_rcpt,pfscan_GPCR_Rhodpsn_7TM		0.443	VN1R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VN1R2	protein_coding	OTTHUMT00000464285.1	C	NM_173856	-		53762706	+1	no_errors	ENST00000341702	ensembl	human	known	74_37	missense	SNP	0.593	T
OR2L13	284521	genome.wustl.edu	37	1	248263537	248263537	+	Frame_Shift_Del	DEL	T	T	-			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr1:248263537delT	ENST00000358120.2	+	2	1005	c.860delT	c.(859-861)attfs	p.I288fs	OR2L13_ENST00000366478.2_Frame_Shift_Del_p.I288fs			Q8N349	OR2LD_HUMAN	olfactory receptor, family 2, subfamily L, member 13	288						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(12)|lung(32)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	59	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0132)			CTCAATCCCATTATCTACAGC	0.493																																																	0								ENSG00000196071						68.0	70.0	69.0					1																	248263537		2203	4300	6503	OR2L13	SO:0001589	frameshift_variant	0				HGNC	BC028158	CCDS1637.1	1q44	2012-08-09			ENSG00000196071	ENSG00000196071		"""GPCR / Class A : Olfactory receptors"""	19578	protein-coding gene	gene with protein product				OR2L14			Standard	NM_175911		Approved		uc001ids.3	Q8N349	OTTHUMG00000040446	ENST00000358120.2:c.860delT	1.37:g.248263537delT	ENSP00000350836:p.Ile288fs	Somatic	0	46	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	70	12.50	Q5VUR5	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.I288fs	ENST00000358120.2	37	c.860	CCDS1637.1	1																																																																																			-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn		0.493	OR2L13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2L13	protein_coding	OTTHUMT00000097342.1	T	NM_175911			248263537	+1	no_errors	ENST00000358120	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
TNRC18	84629	genome.wustl.edu	37	7	5427839	5427839	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr7:5427839G>A	ENST00000430969.1	-	5	1964	c.1616C>T	c.(1615-1617)gCc>gTc	p.A539V	TNRC18_ENST00000399537.4_Missense_Mutation_p.A539V	NM_001080495.2	NP_001073964.2	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	539							chromatin binding (GO:0003682)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)	11		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		GACCACGGCGGCCTCCTCTTC	0.701																																																	0								ENSG00000182095						5.0	7.0	6.0					7																	5427839		1866	4016	5882	TNRC18	SO:0001583	missense	0			-	HGNC	U80753	CCDS47534.1	7p22.1	2012-04-17			ENSG00000182095	ENSG00000182095		"""Trinucleotide (CAG) repeat containing"""	11962	protein-coding gene	gene with protein product						9225980	Standard	NM_001080495		Approved	CAGL79, TNRC18A, KIAA1856	uc003soi.4	O15417	OTTHUMG00000151831	ENST00000430969.1:c.1616C>T	7.37:g.5427839G>A	ENSP00000395538:p.Ala539Val	Somatic	0	11	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	20	23.08	A8MX41|Q96JH1|Q96K91	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_BAH_dom,smart_BAH_dom,pfscan_BAH_dom	p.A539V	ENST00000430969.1	37	c.1616	CCDS47534.1	7	.	.	.	.	.	.	.	.	.	.	g	7.095	0.573014	0.13623	.	.	ENSG00000182095	ENST00000399537;ENST00000430969	T;T	0.13901	2.55;2.55	4.68	1.65	0.23941	.	.	.	.	.	T	0.12732	0.0309	L	0.54323	1.7	0.18873	N	0.999989	B	0.10296	0.003	B	0.06405	0.002	T	0.25293	-1.0136	9	0.42905	T	0.14	.	5.7887	0.18349	0.0975:0.0:0.6006:0.3019	.	539	O15417	TNC18_HUMAN	V	539	ENSP00000382452:A539V;ENSP00000395538:A539V	ENSP00000382452:A539V	A	-	2	0	TNRC18	5394365	0.994000	0.37717	0.235000	0.24058	0.386000	0.30323	1.962000	0.40442	0.342000	0.23796	0.450000	0.29827	GCC	-	NULL		0.701	TNRC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TNRC18	protein_coding		G		-		5427839	-1	no_errors	ENST00000399537	ensembl	human	known	74_37	missense	SNP	0.196	A
DSP	1832	genome.wustl.edu	37	6	7568118	7568118	+	Silent	SNP	G	G	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr6:7568118G>T	ENST00000379802.3	+	10	1586	c.1245G>T	c.(1243-1245)ctG>ctT	p.L415L	DSP_ENST00000418664.2_Silent_p.L415L	NM_004415.2	NP_004406.2	P15924	DESP_HUMAN	desmoplakin	415	Globular 1.|Interacts with plakophilin 1 and junction plakoglobin.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|desmosome organization (GO:0002934)|epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|protein localization to adherens junction (GO:0071896)|regulation of heart rate by cardiac conduction (GO:0086091)|single organismal cell-cell adhesion (GO:0016337)|ventricular cardiac muscle cell action potential (GO:0086005)|ventricular compact myocardium morphogenesis (GO:0003223)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cornified envelope (GO:0001533)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|protein kinase C binding (GO:0005080)|scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			biliary_tract(1)|breast(6)|central_nervous_system(7)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|liver(2)|lung(27)|ovary(4)|prostate(1)|skin(8)|stomach(3)|upper_aerodigestive_tract(7)|urinary_tract(5)	101	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		AGCACCTGCTGGAACAGATCA	0.542																																																	0								ENSG00000096696						65.0	55.0	59.0					6																	7568118		2203	4300	6503	DSP	SO:0001819	synonymous_variant	0			-	HGNC	J05211	CCDS4501.1, CCDS47368.1	6p24.3	2014-09-17	2003-05-20		ENSG00000096696	ENSG00000096696			3052	protein-coding gene	gene with protein product		125647	"""desmoplakin (DPI, DPII)"""			1889810	Standard	NM_004415		Approved	KPPS2, PPKS2, DPI, DPII	uc003mxp.1	P15924	OTTHUMG00000014212	ENST00000379802.3:c.1245G>T	6.37:g.7568118G>T		Somatic	0	34	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	36	12.20	B2RTT2|D7RX09|O75993|Q14189|Q9UHN4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Plectin_repeat,smart_Spectrin/alpha-actinin,smart_Plectin_repeat	p.L415	ENST00000379802.3	37	c.1245	CCDS4501.1	6																																																																																			-	NULL		0.542	DSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSP	protein_coding	OTTHUMT00000039786.2	G	NM_004415	-		7568118	+1	no_errors	ENST00000379802	ensembl	human	known	74_37	silent	SNP	1.000	T
SLC12A7	10723	genome.wustl.edu	37	5	1081841	1081841	+	Missense_Mutation	SNP	T	T	G			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr5:1081841T>G	ENST00000264930.5	-	9	1191	c.1148A>C	c.(1147-1149)tAc>tCc	p.Y383S		NM_006598.2	NP_006589.2	Q9Y666	S12A7_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 7	383					cell volume homeostasis (GO:0006884)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|potassium ion transport (GO:0006813)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)			breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	32	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;5.44e-09)		Epithelial(17;0.000497)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00241)|Lung(60;0.165)		Potassium Chloride(DB00761)	CGCGTGCGCGTACGTACTCCA	0.667																																																	0								ENSG00000113504						64.0	63.0	63.0					5																	1081841		2201	4300	6501	SLC12A7	SO:0001583	missense	0			-	HGNC	AF105365	CCDS34129.1	5p15	2013-07-18	2013-07-18		ENSG00000113504	ENSG00000113504		"""Solute carriers"""	10915	protein-coding gene	gene with protein product		604879				10347194	Standard	NM_006598		Approved	KCC4, DKFZP434F076	uc003jbu.3	Q9Y666	OTTHUMG00000161931	ENST00000264930.5:c.1148A>C	5.37:g.1081841T>G	ENSP00000264930:p.Tyr383Ser	Somatic	0	81	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	66	17.50	A6NDS8|Q4G0F3|Q96I81|Q9H7I3|Q9H7I7|Q9UFW2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_AA-permease/SLC12A_dom,prints_KCL_cotranspt,tigrfam_Na/K/Cl_cotransptS	p.Y383S	ENST00000264930.5	37	c.1148	CCDS34129.1	5	.	.	.	.	.	.	.	.	.	.	T	18.50	3.636736	0.67130	.	.	ENSG00000113504	ENST00000264930	T	0.70516	-0.49	4.09	4.09	0.47781	.	0.065439	0.64402	N	0.000005	D	0.83496	0.5267	M	0.88181	2.935	0.58432	D	0.999999	D	0.64830	0.994	P	0.61275	0.886	D	0.86258	0.1653	10	0.66056	D	0.02	.	11.8858	0.52602	0.0:0.0:0.0:1.0	.	383	Q9Y666	S12A7_HUMAN	S	383	ENSP00000264930:Y383S	ENSP00000264930:Y383S	Y	-	2	0	SLC12A7	1134841	1.000000	0.71417	0.006000	0.13384	0.044000	0.14063	7.172000	0.77604	1.497000	0.48584	0.402000	0.26972	TAC	-	tigrfam_Na/K/Cl_cotransptS		0.667	SLC12A7-001	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	SLC12A7	protein_coding	OTTHUMT00000366446.2	T	NM_006598	-		1081841	-1	no_errors	ENST00000264930	ensembl	human	known	74_37	missense	SNP	0.903	G
ZNF597	146434	genome.wustl.edu	37	16	3486648	3486648	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr16:3486648G>A	ENST00000301744.4	-	4	1286	c.1051C>T	c.(1051-1053)Cct>Tct	p.P351S		NM_152457.1	NP_689670.1	Q96LX8	ZN597_HUMAN	zinc finger protein 597	351					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(1)|urinary_tract(1)	13						gagaaacaaggaaaggtcatg	0.453																																																	0								ENSG00000167981						53.0	49.0	51.0					16																	3486648		2197	4300	6497	ZNF597	SO:0001583	missense	0			-	HGNC	AK057633	CCDS10505.1	16p13.3	2013-01-08			ENSG00000167981	ENSG00000167981		"""Zinc fingers, C2H2-type"", ""-"""	26573	protein-coding gene	gene with protein product		614685				12477932	Standard	NM_152457		Approved	FLJ33071	uc002cvd.3	Q96LX8	OTTHUMG00000129359	ENST00000301744.4:c.1051C>T	16.37:g.3486648G>A	ENSP00000301744:p.Pro351Ser	Somatic	0	47	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	54	16.92		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P351S	ENST00000301744.4	37	c.1051	CCDS10505.1	16	.	.	.	.	.	.	.	.	.	.	G	8.674	0.903597	0.17760	.	.	ENSG00000167981	ENST00000301744	T	0.26373	1.74	4.76	2.67	0.31697	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.519308	0.14416	N	0.320947	T	0.06371	0.0164	N	0.01228	-0.945	0.22001	N	0.999425	B	0.29432	0.244	B	0.26770	0.073	T	0.35450	-0.9788	10	0.02654	T	1	-3.2393	6.4229	0.21754	0.1006:0.2855:0.6139:0.0	.	351	Q96LX8	ZN597_HUMAN	S	351	ENSP00000301744:P351S	ENSP00000301744:P351S	P	-	1	0	ZNF597	3426649	0.000000	0.05858	0.263000	0.24496	0.971000	0.66376	0.003000	0.13083	1.356000	0.45884	0.650000	0.86243	CCT	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.453	ZNF597-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF597	protein_coding	OTTHUMT00000251511.2	G	NM_152457	-		3486648	-1	no_errors	ENST00000301744	ensembl	human	known	74_37	missense	SNP	0.569	A
SMARCD3	6604	genome.wustl.edu	37	7	150936125	150936125	+	3'UTR	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr7:150936125G>A	ENST00000262188.8	-	0	1926				SMARCD3_ENST00000356800.2_3'UTR|SMARCD3_ENST00000392811.2_3'UTR|SMARCD3_ENST00000477169.1_5'Flank|MIR671_ENST00000390183.1_RNA|RP4-548D19.3_ENST00000607902.1_RNA	NM_001003801.1	NP_001003801.1	Q6STE5	SMRD3_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 3						cardiac right ventricle formation (GO:0003219)|cellular lipid metabolic process (GO:0044255)|chromatin remodeling (GO:0006338)|muscle cell differentiation (GO:0042692)|neural retina development (GO:0003407)|nucleosome disassembly (GO:0006337)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of protein binding (GO:0043393)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|secondary heart field specification (GO:0003139)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|receptor binding (GO:0005102)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(6)|ovary(2)	15			OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GCTGGAGCCCGGGGCAAAATG	0.587																																																	0								ENSG00000082014						31.0	29.0	30.0					7																	150936125		692	1591	2283	SMARCD3	SO:0001624	3_prime_UTR_variant	0			-	HGNC	U66619	CCDS5924.1, CCDS34780.1	7q35-q36	2008-07-18			ENSG00000082014	ENSG00000082014			11108	protein-coding gene	gene with protein product	"""mammalian chromatin remodeling complex BRG1-associated factor 60C"", ""Swp73-like protein"", ""SWI/SNF complex 60 kDa subunit C"", ""60kDa BRG-1/Brm associated factor subunit c"""	601737				8804307, 9693044	Standard	NM_001003801		Approved	BAF60C, Rsc6p, CRACD3	uc003wjs.3	Q6STE5	OTTHUMG00000157431	ENST00000262188.8:c.*64C>T	7.37:g.150936125G>A		Somatic	0	31	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	36	30.77	D3DX10|Q2YD86|Q75MJ2|Q75MR8|Q92926|Q9BUH1	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000262188.8	37	NULL	CCDS34780.1	7																																																																																			-	-		0.587	SMARCD3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SMARCD3	protein_coding	OTTHUMT00000348825.1	G	NM_001003801	-		150936125	-1	no_errors	ENST00000496530	ensembl	human	putative	74_37	rna	SNP	0.000	A
BMS1P20	96610	genome.wustl.edu	37	22	22664722	22664722	+	RNA	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr22:22664722G>A	ENST00000426066.1	+	0	903					NR_027293.1				BMS1 pseudogene 20																		ACTCAGGCTTGCCCATGGTGT	0.512																																																	0								ENSG00000236850																																			BMS1P20			0			-	HGNC			22q11.22	2013-09-20			ENSG00000236850	ENSG00000236850			49153	pseudogene	pseudogene							Standard	XR_430414		Approved				OTTHUMG00000151046		22.37:g.22664722G>A		Somatic	0	129	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	143	8.92		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000426066.1	37	NULL		22																																																																																			-	-		0.512	BMS1P20-001	KNOWN	basic|readthrough_transcript	processed_transcript	BMS1P20	processed_transcript	OTTHUMT00000473090.1	G		-		22664722	+1	no_errors	ENST00000426066	ensembl	human	known	74_37	rna	SNP	0.998	A
LOC100129434	100129434	genome.wustl.edu	37	2	56404842	56404842	+	RNA	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr2:56404842C>T	ENST00000596663.1	-	0	313				AC007743.1_ENST00000432793.1_RNA|RP11-482H16.1_ENST00000607540.1_RNA|RP11-481J13.1_ENST00000606639.1_lincRNA|AC007743.1_ENST00000447423.2_RNA																							GTTAGATAAACCCTTCCCTGG	0.478																																																	0								ENSG00000233251																																			AC007743.1			0			-	Clone_based_vega_gene																													2.37:g.56404842C>T		Somatic	0	48	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	33	31.25		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000596663.1	37	NULL		2																																																																																			-	-		0.478	AC007743.1-005	KNOWN	basic	antisense	LOC100129434	antisense	OTTHUMT00000470756.1	C		-		56404842	-1	no_errors	ENST00000432793	ensembl	human	known	74_37	rna	SNP	0.000	T
GPR98	84059	genome.wustl.edu	37	5	90052412	90052412	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr5:90052412G>A	ENST00000405460.2	+	56	11818	c.11722G>A	c.(11722-11724)Gat>Aat	p.D3908N		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	3908	Calx-beta 26. {ECO:0000255}.				detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		AGAAAATGACGATCCCAGAGG	0.443																																																	0								ENSG00000164199						80.0	77.0	78.0					5																	90052412		1886	4107	5993	GPR98	SO:0001583	missense	0			-	HGNC	AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.11722G>A	5.37:g.90052412G>A	ENSP00000384582:p.Asp3908Asn	Somatic	0	37	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	24	22.58	O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Calx_beta,pfam_EPTP,pfam_GPCR_2_secretin-like,pfam_GPS_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Gal_Oxase/kelch_b-propeller,smart_Calx_beta,pfscan_EAR,pfscan_GPS_dom,pfscan_GPCR_2-like	p.D3908N	ENST00000405460.2	37	c.11722	CCDS47246.1	5	.	.	.	.	.	.	.	.	.	.	G	28.0	4.880361	0.91740	.	.	ENSG00000164199	ENST00000405460;ENST00000296619	T	0.37915	1.17	5.82	5.82	0.92795	Na-Ca exchanger/integrin-beta4 (1);	0.042722	0.85682	D	0.000000	T	0.57504	0.2058	M	0.63428	1.95	0.80722	D	1	D;D	0.89917	0.995;1.0	P;D	0.64506	0.797;0.926	T	0.47736	-0.9094	10	0.32370	T	0.25	.	20.0951	0.97834	0.0:0.0:1.0:0.0	.	3908;3908	E7ETI5;Q8WXG9	.;GPR98_HUMAN	N	3908	ENSP00000384582:D3908N	ENSP00000296619:D3908N	D	+	1	0	GPR98	90088168	1.000000	0.71417	1.000000	0.80357	0.570000	0.35934	9.008000	0.93601	2.753000	0.94483	0.467000	0.42956	GAT	-	smart_Calx_beta		0.443	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR98	protein_coding	OTTHUMT00000369993.2	G	NM_032119	-		90052412	+1	no_errors	ENST00000405460	ensembl	human	known	74_37	missense	SNP	1.000	A
BMP1	649	genome.wustl.edu	37	8	22033795	22033795	+	Silent	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr8:22033795C>T	ENST00000306385.5	+	3	1072	c.402C>T	c.(400-402)gtC>gtT	p.V134V	BMP1_ENST00000354870.5_Silent_p.V134V|BMP1_ENST00000397816.3_Silent_p.V134V|BMP1_ENST00000306349.8_Silent_p.V134V|BMP1_ENST00000523849.1_3'UTR|BMP1_ENST00000397814.3_Silent_p.V134V	NM_006129.4	NP_006120.1	P13497	BMP1_HUMAN	bone morphogenetic protein 1	134	Metalloprotease.				cartilage condensation (GO:0001502)|cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|lipoprotein metabolic process (GO:0042157)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|positive regulation of cartilage development (GO:0061036)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane-bounded vesicle (GO:0031988)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)|zinc ion binding (GO:0008270)			breast(1)|endometrium(7)|kidney(2)|large_intestine(7)|lung(7)|ovary(2)|prostate(1)|skin(3)	30				Colorectal(74;0.00229)|COAD - Colon adenocarcinoma(73;0.0661)|READ - Rectum adenocarcinoma(644;0.11)		CCGATGGGGTCATCCCCTTTG	0.647																																																	0								ENSG00000168487						104.0	82.0	89.0					8																	22033795		2203	4300	6503	BMP1	SO:0001819	synonymous_variant	0			-	HGNC		CCDS6026.1, CCDS34856.1	8p21	2013-02-06	2004-08-09		ENSG00000168487	ENSG00000168487	3.4.24.19	"""Bone morphogenetic proteins"""	1067	protein-coding gene	gene with protein product	"""procollagen C-endopeptidase"""	112264	"""procollagen C-endopeptidase"""	PCOLC		2004778	Standard	NM_006129		Approved		uc003xbg.3	P13497	OTTHUMG00000097761	ENST00000306385.5:c.402C>T	8.37:g.22033795C>T		Somatic	0	50	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	56	9.68	A8K6F5|B2RN46|D3DSR0|Q13292|Q13872|Q14874|Q99421|Q99422|Q99423|Q9UL38	Silent	SNP	NA	NA	NA	NA	NA	NA	pirsf_BMP_1/tolloid-like,pfam_CUB_dom,pfam_Peptidase_M12A,pfam_EGF-like_Ca-bd_dom,superfamily_CUB_dom,smart_Peptidase_Metallo,smart_CUB_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,prints_Peptidase_M12A,pfscan_CUB_dom,pfscan_EG-like_dom	p.V134	ENST00000306385.5	37	c.402	CCDS6026.1	8																																																																																			-	pirsf_BMP_1/tolloid-like,pfam_Peptidase_M12A,smart_Peptidase_Metallo		0.647	BMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BMP1	protein_coding	OTTHUMT00000214995.2	C	NM_006132	-		22033795	+1	no_errors	ENST00000306385	ensembl	human	known	74_37	silent	SNP	1.000	T
PCDHA4	56144	genome.wustl.edu	37	5	140188055	140188055	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr5:140188055G>A	ENST00000530339.1	+	1	1283	c.1283G>A	c.(1282-1284)cGa>cAa	p.R428Q	PCDHA4_ENST00000512229.2_Missense_Mutation_p.R428Q|PCDHA2_ENST00000526136.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000356878.4_Missense_Mutation_p.R428Q	NM_018907.2	NP_061730.1	Q9UN74	PCDA4_HUMAN	protocadherin alpha 4	428	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(6)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTGACCGCGCGAGACGGGGGC	0.617																																																	0								ENSG00000204967						113.0	113.0	113.0					5																	140188055		2203	4300	6503	PCDHA4	SO:0001583	missense	0			-	HGNC	AF152482	CCDS54916.1	5q31	2010-11-26				ENSG00000204967		"""Cadherins / Protocadherins : Clustered"""	8670	other	complex locus constituent	"""ortholog of mouse CNR1, KIAA0345-like 10"""	606310				10380929, 10662547	Standard	NM_018907		Approved	CNR1, CRNR1, PCDH-ALPHA4, CNRN1		Q9UN74		ENST00000530339.1:c.1283G>A	5.37:g.140188055G>A	ENSP00000435300:p.Arg428Gln	Somatic	0	95	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	31	152	16.94	O75285|Q2M253	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.R428Q	ENST00000530339.1	37	c.1283	CCDS54916.1	5	.	.	.	.	.	.	.	.	.	.	g	9.602	1.128935	0.21041	.	.	ENSG00000204967	ENST00000512229;ENST00000356878;ENST00000530339	T;T;T	0.52754	0.65;0.65;0.65	4.5	1.73	0.24493	Cadherin (5);Cadherin-like (1);	0.532290	0.13534	N	0.380741	T	0.24084	0.0583	N	0.17248	0.465	0.09310	N	1	B;P;P	0.36789	0.362;0.57;0.57	B;B;B	0.30251	0.072;0.113;0.1	T	0.09015	-1.0694	10	0.40728	T	0.16	.	4.48	0.11762	0.4567:0.0:0.3951:0.1482	.	428;428;428	Q9UN74-2;Q9UN74;D6RA20	.;PCDA4_HUMAN;.	Q	428	ENSP00000423470:R428Q;ENSP00000349344:R428Q;ENSP00000435300:R428Q	ENSP00000349344:R428Q	R	+	2	0	PCDHA4	140168239	0.000000	0.05858	0.002000	0.10522	0.860000	0.49131	-0.995000	0.03712	0.138000	0.18790	-0.210000	0.12710	CGA	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin		0.617	PCDHA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA4	protein_coding	OTTHUMT00000372864.2	G	NM_018907	-		140188055	+1	no_errors	ENST00000530339	ensembl	human	known	74_37	missense	SNP	0.000	A
AMN	81693	genome.wustl.edu	37	14	103394780	103394780	+	Silent	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr14:103394780G>A	ENST00000299155.5	+	4	258	c.225G>A	c.(223-225)ggG>ggA	p.G75G		NM_030943.3	NP_112205.2	Q9BXJ7	AMNLS_HUMAN	amnion associated transmembrane protein	75					cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|excretion (GO:0007588)|Golgi to plasma membrane protein transport (GO:0043001)|lipoprotein metabolic process (GO:0042157)|multicellular organismal development (GO:0007275)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|endocytic vesicle (GO:0030139)|endosome membrane (GO:0010008)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			kidney(2)|large_intestine(1)|lung(2)|skin(1)	6				Colorectal(3;0.00739)|READ - Rectum adenocarcinoma(2;0.0336)|Epithelial(152;0.0363)|all cancers(159;0.147)	Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	CGCTGGATGGGGAACTCGTCC	0.746																																																	0								ENSG00000166126						14.0	14.0	14.0					14																	103394780		2192	4287	6479	AMN	SO:0001819	synonymous_variant	0			-	HGNC	AF328788	CCDS9977.1	14q32.32	2014-09-17	2012-12-07		ENSG00000166126	ENSG00000166126			14604	protein-coding gene	gene with protein product		605799	"""amnionless homolog (mouse)"""			11279523	Standard	NM_030943		Approved	amnionless	uc001ymg.4	Q9BXJ7		ENST00000299155.5:c.225G>A	14.37:g.103394780G>A		Somatic	0	37	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	53	14.29	Q6UX83	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.G75	ENST00000299155.5	37	c.225	CCDS9977.1	14																																																																																			-	NULL		0.746	AMN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMN	protein_coding	OTTHUMT00000415704.1	G		-		103394780	+1	no_errors	ENST00000299155	ensembl	human	known	74_37	silent	SNP	0.261	A
AC021818.1	0	genome.wustl.edu	37	15	70077755	70077756	+	RNA	INS	-	-	TGTGTG	rs140198807|rs57525529		TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr15:70077755_70077756insTGTGTG	ENST00000401139.1	-	0	87_88																											ctcataggatgtgtgtgtgtgt	0.426																																																	0								ENSG00000215958																																			AC021818.1			0				Clone_based_ensembl_gene																													15.37:g.70077756_70077761dupTGTGTG		Somatic	NA	NA	NA		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000401139.1	37	NULL		15																																																																																			-	-		0.426	AC021818.1-201	NOVEL	basic	miRNA	ENSG00000215958	miRNA		-				70077756	-1	no_errors	ENST00000401139	ensembl	human	novel	74_37	rna	INS	0.176:0.181	TGTGTG
RDH13	112724	genome.wustl.edu	37	19	55574429	55574430	+	5'UTR	INS	-	-	GGCGTCC	rs67813353|rs1654457|rs113253419	byFrequency	TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr19:55574429_55574430insGGCGTCC	ENST00000415061.3	-	0	114_115				RDH13_ENST00000396247.3_Intron	NM_001145971.1	NP_001139443.1	Q8NBN7	RDH13_HUMAN	retinol dehydrogenase 13 (all-trans/9-cis)						eye photoreceptor cell development (GO:0042462)|response to high light intensity (GO:0009644)|retina layer formation (GO:0010842)	mitochondrion (GO:0005739)	oxidoreductase activity (GO:0016491)			endometrium(2)|large_intestine(2)|lung(6)|ovary(1)|skin(1)	12			BRCA - Breast invasive adenocarcinoma(297;0.199)	GBM - Glioblastoma multiforme(193;0.0504)	Vitamin A(DB00162)	GTCAGGCGTCAGGGGTCGGCGC	0.738														4256	0.84984	0.7882	0.9035	5008	,	,		10693	0.9692		0.8598	False		,,,				2504	0.7618																0								ENSG00000160439		,	1689,194,481		747,48,147,64,18,158					,		0.0		dbSNP_130	2	3753,491,1004		1682,115,274,167,42,344	no	intron,utr-5	RDH13	NM_138412.3,NM_001145971.1	,	2429,163,421,231,60,502	A1A1,A1A2,A1R,A2A2,A2R,RR		28.487,28.5533,28.5076	,	,		5442,685,1485				RDH13	SO:0001623	5_prime_UTR_variant	0				HGNC		CCDS42627.1, CCDS54320.1	19q13.42	2011-09-14	2006-05-09			ENSG00000160439	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	19978	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 7C, member 3"""		"""retinol dehydrogenase 13 (all-trans and 9-cis)"""			12226107, 19027726	Standard	NM_138412		Approved	SDR7C3	uc002qio.3	Q8NBN7		ENST00000415061.3:c.-30->GGACGCC	19.37:g.55574429_55574430insGGCGTCC		Somatic	NA	NA	NA		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q6UX79|Q96G88	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000415061.3	37	NULL	CCDS54320.1	19																																																																																			-	-		0.738	RDH13-003	KNOWN	basic|appris_principal|CCDS	protein_coding	RDH13	protein_coding	OTTHUMT00000451470.1	-	NM_138412			55574430	-1	no_errors	ENST00000589305	ensembl	human	known	74_37	rna	INS	0.004:0.003	GGCGTCC
HLA-E	3133	genome.wustl.edu	37	6	30458215	30458215	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr6:30458215G>A	ENST00000376630.4	+	3	598	c.533G>A	c.(532-534)aGa>aAa	p.R178K		NM_005516.5	NP_005507.3	P13747	HLAE_HUMAN	major histocompatibility complex, class I, E	178	Alpha-2.		R -> G (in allele E*01:04; dbSNP:rs41562314).		antigen processing and presentation of endogenous peptide antigen via MHC class Ib (GO:0002476)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|innate immune response (GO:0045087)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of natural killer cell mediated immunity (GO:0002717)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|protection from natural killer cell mediated cytotoxicity (GO:0042270)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|ER to Golgi transport vesicle membrane (GO:0012507)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	MHC class I protein binding (GO:0042288)|peptide antigen binding (GO:0042605)			breast(2)|central_nervous_system(4)|endometrium(1)|kidney(3)|large_intestine(2)|lung(1)|ovary(3)|skin(1)|urinary_tract(1)	18						GAGCACCAGAGAGCCTACCTG	0.592																																																	0								ENSG00000204592						65.0	63.0	63.0					6																	30458215		1509	2709	4218	HLA-E	SO:0001583	missense	0			-	HGNC	M20022	CCDS34379.1	6p21.3	2013-01-11			ENSG00000204592	ENSG00000204592		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4962	protein-coding gene	gene with protein product		143010				3131426	Standard	NM_005516		Approved		uc003nqg.3	P13747	OTTHUMG00000031155	ENST00000376630.4:c.533G>A	6.37:g.30458215G>A	ENSP00000365817:p.Arg178Lys	Somatic	0	27	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	42	23.64	Q30169|Q9BT83|Q9GIY7|Q9GIY8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MHC_I_a_a1/a2,pfam_Ig_C1-set,pfam_CD80_C2-set,superfamily_MHC_I/II-like_Ag-recog,smart_Ig_C1-set,pfscan_Ig-like_dom,prints_MHC_I_a	p.R178K	ENST00000376630.4	37	c.533	CCDS34379.1	6	.	.	.	.	.	.	.	.	.	.	.	15.53	2.860434	0.51482	.	.	ENSG00000204592	ENST00000376630	T	0.00760	5.73	1.67	0.706	0.18133	.	0.191155	0.21408	U	0.075030	T	0.00724	0.0024	L	0.35723	1.085	0.09310	N	1	P;P	0.46512	0.879;0.879	D;D	0.70016	0.967;0.967	T	0.53961	-0.8364	10	0.72032	D	0.01	.	4.4634	0.11676	0.2213:0.0:0.7787:0.0	.	219;178	E7ENN9;Q6DU44	.;.	K	178	ENSP00000365817:R178K	ENSP00000365817:R178K	R	+	2	0	HLA-E	30566194	0.000000	0.05858	0.080000	0.20451	0.042000	0.13812	-0.059000	0.11731	0.217000	0.20800	0.462000	0.41574	AGA	-	pfam_MHC_I_a_a1/a2,superfamily_MHC_I/II-like_Ag-recog,prints_MHC_I_a		0.592	HLA-E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLA-E	protein_coding	OTTHUMT00000076282.2	G	NM_005516	-		30458215	+1	no_errors	ENST00000376630	ensembl	human	known	74_37	missense	SNP	0.094	A
DCC	1630	genome.wustl.edu	37	18	50683867	50683867	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr18:50683867G>A	ENST00000442544.2	+	8	2019	c.1403G>A	c.(1402-1404)aGa>aAa	p.R468K	DCC_ENST00000412726.1_Missense_Mutation_p.R316K|DCC_ENST00000581580.1_Missense_Mutation_p.R123K	NM_005215.3	NP_005206.2	P43146	DCC_HUMAN	DCC netrin 1 receptor	468	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|dorsal/ventral axon guidance (GO:0033563)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|neuron migration (GO:0001764)|positive regulation of apoptotic process (GO:0043065)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|regulation of apoptotic process (GO:0042981)|response to amphetamine (GO:0001975)|spinal cord ventral commissure morphogenesis (GO:0021965)	axon (GO:0030424)|cytosol (GO:0005829)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)|transcription coactivator activity (GO:0003713)|transmembrane signaling receptor activity (GO:0004888)			NS(3)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(23)|liver(1)|lung(56)|ovary(7)|pancreas(3)|prostate(2)|skin(16)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(6)	148		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		TTTTTCTCCAGAGAAGGTGAC	0.483																																																	0								ENSG00000187323						64.0	58.0	60.0					18																	50683867		2203	4300	6503	DCC	SO:0001583	missense	0			-	HGNC	X76132	CCDS11952.1	18q21.1	2014-06-20	2014-06-20		ENSG00000187323	ENSG00000187323		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2701	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 1"""	120470	"""deleted in colorectal carcinoma"""			2294591, 24400119	Standard	NM_005215		Approved	IGDCC1, NTN1R1	uc002lfe.2	P43146	OTTHUMG00000132698	ENST00000442544.2:c.1403G>A	18.37:g.50683867G>A	ENSP00000389140:p.Arg468Lys	Somatic	0	48	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	52	20.00		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Neogenin_C,pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.R468K	ENST00000442544.2	37	c.1403	CCDS11952.1	18	.	.	.	.	.	.	.	.	.	.	G	15.12	2.739596	0.49045	.	.	ENSG00000187323	ENST00000442544;ENST00000304775;ENST00000412726	T;T	0.55234	0.53;0.53	5.4	5.4	0.78164	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.076236	0.53938	D	0.000041	T	0.30070	0.0753	N	0.13272	0.32	0.33932	D	0.642197	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.002;0.002;0.002	T	0.27226	-1.0080	10	0.02654	T	1	.	11.4507	0.50151	0.0834:0.0:0.9166:0.0	.	316;316;468	E7EQM8;B4DYX2;P43146	.;.;DCC_HUMAN	K	468;401;316	ENSP00000389140:R468K;ENSP00000397322:R316K	ENSP00000304146:R401K	R	+	2	0	DCC	48937865	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.496000	0.66918	2.546000	0.85860	0.561000	0.74099	AGA	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.483	DCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCC	protein_coding	OTTHUMT00000255996.3	G	NM_005215	-		50683867	+1	no_errors	ENST00000442544	ensembl	human	known	74_37	missense	SNP	1.000	A
POU3F2	5454	genome.wustl.edu	37	6	99283814	99283814	+	Silent	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr6:99283814G>A	ENST00000328345.5	+	1	1235	c.1065G>A	c.(1063-1065)cgG>cgA	p.R355R		NM_005604.3	NP_005595.2	P20265	PO3F2_HUMAN	POU class 3 homeobox 2	355					astrocyte development (GO:0014002)|cellular response to organic substance (GO:0071310)|cerebral cortex radially oriented cell migration (GO:0021799)|epidermis development (GO:0008544)|forebrain ventricular zone progenitor cell division (GO:0021869)|hypothalamus cell differentiation (GO:0021979)|myelination in peripheral nervous system (GO:0022011)|neurohypophysis development (GO:0021985)|neuron differentiation (GO:0030182)|positive regulation of cell proliferation (GO:0008284)|positive regulation of multicellular organism growth (GO:0040018)|regulation of axonogenesis (GO:0050770)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	identical protein binding (GO:0042802)|RNA polymerase II transcription coactivator activity (GO:0001105)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|large_intestine(3)|lung(5)	10		all_cancers(76;1.56e-06)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00893)|Colorectal(196;0.069)|Lung NSC(302;0.197)		BRCA - Breast invasive adenocarcinoma(108;0.0355)		GGCGCAAGCGGAAAAAGCGGA	0.617																																																	0								ENSG00000184486						74.0	82.0	79.0					6																	99283814		2203	4300	6503	POU3F2	SO:0001819	synonymous_variant	0			-	HGNC	Z11933	CCDS5040.1	6q16.2	2011-06-20	2007-07-13		ENSG00000184486	ENSG00000184486		"""Homeoboxes / POU class"""	9215	protein-coding gene	gene with protein product		600494	"""POU domain class 3, transcription factor 2"""	OTF7		8441633	Standard	NM_005604		Approved	POUF3, BRN2, OCT7	uc003ppe.3	P20265	OTTHUMG00000015258	ENST00000328345.5:c.1065G>A	6.37:g.99283814G>A		Somatic	0	42	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	64	17.95	Q14960|Q86V54|Q9UJL0	Silent	SNP	NA	NA	NA	NA	NA	NA	pirsf_Transcription_factor_POU,pfam_POU_specific,pfam_Homeobox_dom,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,smart_POU_specific,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_POU_specific,prints_POU	p.R355	ENST00000328345.5	37	c.1065	CCDS5040.1	6																																																																																			-	pirsf_Transcription_factor_POU,pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_POU		0.617	POU3F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POU3F2	protein_coding	OTTHUMT00000041586.2	G		-		99283814	+1	no_errors	ENST00000328345	ensembl	human	known	74_37	silent	SNP	1.000	A
TNPO1	3842	genome.wustl.edu	37	5	72171473	72171473	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr5:72171473C>T	ENST00000337273.5	+	8	1136	c.710C>T	c.(709-711)cCa>cTa	p.P237L	TNPO1_ENST00000523768.1_Missense_Mutation_p.P187L|TNPO1_ENST00000454282.1_Missense_Mutation_p.P187L|MIR4804_ENST00000581683.1_RNA|TNPO1_ENST00000447967.2_3'UTR|TNPO1_ENST00000506351.2_Missense_Mutation_p.P229L	NM_002270.3	NP_002261.3	Q92973	TNPO1_HUMAN	transportin 1	237					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|protein import into nucleus, translocation (GO:0000060)|RNA metabolic process (GO:0016070)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	nuclear localization sequence binding (GO:0008139)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(10)|lung(6)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	36		Lung NSC(167;0.0053)|Ovarian(174;0.0175)		OV - Ovarian serous cystadenocarcinoma(47;6.14e-54)		GATGAAGAACCAGAGGTACGG	0.398																																																	0								ENSG00000083312						102.0	101.0	102.0					5																	72171473		2203	4300	6503	TNPO1	SO:0001583	missense	0			-	HGNC	U70322	CCDS4016.1, CCDS43329.1	5q13.1	2009-01-12	2004-01-29	2004-01-30	ENSG00000083312	ENSG00000083312		"""Importins"""	6401	protein-coding gene	gene with protein product	"""importin 2"""	602901	"""karyopherin (importin) beta 2"""	KPNB2		8808633, 9144189	Standard	NM_153188		Approved	MIP, TRN, IPO2, MIP1	uc003kci.4	Q92973	OTTHUMG00000100967	ENST00000337273.5:c.710C>T	5.37:g.72171473C>T	ENSP00000336712:p.Pro237Leu	Somatic	0	33	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	45	28.57	B4DVC6|Q92957|Q92975	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_HEAT,pfam_Importin-beta_N,superfamily_ARM-type_fold,smart_Importin-beta_N,pfscan_Importin-beta_N	p.P237L	ENST00000337273.5	37	c.710	CCDS43329.1	5	.	.	.	.	.	.	.	.	.	.	C	19.79	3.893194	0.72524	.	.	ENSG00000083312	ENST00000337273;ENST00000454282;ENST00000523768;ENST00000506351	T;T;T;T	0.69040	-0.37;-0.37;-0.37;-0.37	4.84	4.84	0.62591	Armadillo-like helical (1);Armadillo-type fold (1);	0.049125	0.85682	D	0.000000	T	0.69333	0.3099	M	0.73319	2.225	0.80722	D	1	B;B	0.17667	0.023;0.017	B;B	0.23852	0.049;0.014	T	0.69745	-0.5062	10	0.66056	D	0.02	-4.6034	18.3092	0.90193	0.0:1.0:0.0:0.0	.	187;237	Q92973-3;Q92973	.;TNPO1_HUMAN	L	237;187;187;229	ENSP00000336712:P237L;ENSP00000398524:P187L;ENSP00000428899:P187L;ENSP00000425118:P229L	ENSP00000336712:P237L	P	+	2	0	TNPO1	72207229	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.336000	0.79245	2.395000	0.81488	0.585000	0.79938	CCA	-	pfam_HEAT,superfamily_ARM-type_fold		0.398	TNPO1-001	KNOWN	basic|CCDS	protein_coding	TNPO1	protein_coding	OTTHUMT00000218577.3	C	NM_002270	-		72171473	+1	no_errors	ENST00000337273	ensembl	human	known	74_37	missense	SNP	1.000	T
TTF1	7270	genome.wustl.edu	37	9	135277166	135277166	+	Missense_Mutation	SNP	G	G	A	rs151288177	byFrequency	TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr9:135277166G>A	ENST00000334270.2	-	2	1082	c.1043C>T	c.(1042-1044)gCc>gTc	p.A348V		NM_001205296.1|NM_007344.3	NP_001192225.1|NP_031370.2	Q15361	TTF1_HUMAN	transcription termination factor, RNA polymerase I	348					chromatin remodeling (GO:0006338)|DNA-templated transcription, termination (GO:0006353)|gene expression (GO:0010467)|negative regulation of DNA replication (GO:0008156)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase I transcription (GO:0006363)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			endometrium(3)|kidney(1)|large_intestine(5)|lung(13)|ovary(2)|pancreas(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	30		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;4.25e-06)|Epithelial(140;9.09e-05)		CTCAGGCATGGCCACTGCCTC	0.483																																																	0								ENSG00000125482						124.0	120.0	121.0					9																	135277166		2203	4300	6503	TTF1	SO:0001583	missense	0			-	HGNC	BC050734	CCDS6948.1, CCDS75925.1	9q34.3	2008-02-05			ENSG00000125482	ENSG00000125482			12397	protein-coding gene	gene with protein product		600777				7597036	Standard	NM_007344		Approved		uc004cbl.3	Q15361	OTTHUMG00000020836	ENST00000334270.2:c.1043C>T	9.37:g.135277166G>A	ENSP00000333920:p.Ala348Val	Somatic	0	52	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	45	31.34	A1L160|Q4VXF3|Q58EY2|Q6P5T5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.A348V	ENST00000334270.2	37	c.1043	CCDS6948.1	9	.	.	.	.	.	.	.	.	.	.	G	14.13	2.442189	0.43326	.	.	ENSG00000125482	ENST00000334270;ENST00000245588	T	0.10960	2.82	4.14	0.825	0.18824	.	1.025780	0.07779	N	0.953118	T	0.07188	0.0182	L	0.43152	1.355	0.09310	N	1	P	0.39480	0.675	B	0.26202	0.067	T	0.34601	-0.9822	10	0.46703	T	0.11	.	3.8561	0.08976	0.1219:0.0:0.4467:0.4314	.	348	Q15361	TTF1_HUMAN	V	348	ENSP00000333920:A348V	ENSP00000245588:A348V	A	-	2	0	TTF1	134266987	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	0.254000	0.18314	0.769000	0.33313	0.655000	0.94253	GCC	-	NULL		0.483	TTF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTF1	protein_coding	OTTHUMT00000054784.2	G	NM_007344	-		135277166	-1	no_errors	ENST00000334270	ensembl	human	known	74_37	missense	SNP	0.000	A
TRIM66	9866	genome.wustl.edu	37	11	8646081	8646081	+	Intron	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr11:8646081G>A	ENST00000299550.6	-	12	2590				TRIM66_ENST00000402157.2_Silent_p.S801S	NM_014818.1	NP_055633.1	O15016	TRI66_HUMAN	tripartite motif containing 66							aggresome (GO:0016235)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|kidney(1)|lung(1)|skin(2)	9						TGAAGCGAGTGGAATCCTCAC	0.478																																																	0								ENSG00000166436																																			TRIM66	SO:0001627	intron_variant	0			-	HGNC	AB002296		11p15.4	2013-01-28	2011-01-25		ENSG00000166436	ENSG00000166436		"""Tripartite motif containing / Tripartite motif containing"", ""Zinc fingers, PHD-type"""	29005	protein-coding gene	gene with protein product		612000	"""chromosome 11 open reading frame 29"", ""tripartite motif-containing 66"""	C11orf29		9205841	Standard	NM_014818		Approved	KIAA0298, TIF1D	uc010rbo.2	O15016	OTTHUMG00000150481	ENST00000299550.6:c.2396-80C>T	11.37:g.8646081G>A		Somatic	0	50	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	46	19.30	Q9BQQ4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Bromodomain,pfam_Znf_B-box,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_Znf_B-box,smart_Znf_PHD,smart_Bbox_C,smart_Bromodomain,pfscan_Znf_B-box,pfscan_Znf_PHD-finger,pfscan_Bromodomain	p.S801	ENST00000299550.6	37	c.2403		11																																																																																			-	NULL		0.478	TRIM66-201	KNOWN	basic|appris_candidate	protein_coding	TRIM66	protein_coding		G	XM_084529	-		8646081	-1	no_errors	ENST00000402157	ensembl	human	novel	74_37	silent	SNP	0.006	A
MMP16	4325	genome.wustl.edu	37	8	89086866	89086866	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr8:89086866C>T	ENST00000286614.6	-	7	1470	c.1189G>A	c.(1189-1191)Gaa>Aaa	p.E397K	MMP16_ENST00000544227.1_5'UTR	NM_005941.4	NP_005932.2	P51512	MMP16_HUMAN	matrix metallopeptidase 16 (membrane-inserted)	397					chondrocyte proliferation (GO:0035988)|collagen catabolic process (GO:0030574)|craniofacial suture morphogenesis (GO:0097094)|embryonic cranial skeleton morphogenesis (GO:0048701)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of catalytic activity (GO:0043085)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|enzyme activator activity (GO:0008047)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(5)|liver(1)|lung(51)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	81					Marimastat(DB00786)	TCGCTATTTTCATAAACTGCA	0.418																																																	0								ENSG00000156103						116.0	116.0	116.0					8																	89086866		2203	4300	6503	MMP16	SO:0001583	missense	0			-	HGNC	D85511	CCDS6246.1	8q21	2009-01-09	2005-08-08		ENSG00000156103	ENSG00000156103			7162	protein-coding gene	gene with protein product		602262	"""matrix metalloproteinase 16 (membrane-inserted)"", ""chromosome 8 open reading frame 57"""	C8orf57		7559440	Standard	NM_005941		Approved	MT3-MMP, DKFZp761D112	uc003yeb.4	P51512	OTTHUMG00000163769	ENST00000286614.6:c.1189G>A	8.37:g.89086866C>T	ENSP00000286614:p.Glu397Lys	Somatic	0	47	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	61	15.28	B2RAN7|Q14824|Q52H48	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_Pept_M10A_Metazoans,pfam_Hemopexin-like_repeat,pfam_Pept_M10_metallopeptidase,pfam_Pept_M10A_metallopeptidase_C,pfam_Peptidoglycan-bd-like,superfamily_Hemopexin-like_dom,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,smart_Hemopexin-like_repeat,prints_Pept_M10A	p.E397K	ENST00000286614.6	37	c.1189	CCDS6246.1	8	.	.	.	.	.	.	.	.	.	.	C	35	5.485540	0.96323	.	.	ENSG00000156103	ENST00000286614	T	0.03004	4.08	4.64	4.64	0.57946	Hemopexin/matrixin (2);	0.000000	0.85682	D	0.000000	T	0.26774	0.0655	M	0.93854	3.465	0.80722	D	1	P;D	0.67145	0.907;0.996	P;D	0.71656	0.702;0.974	T	0.40040	-0.9584	10	0.87932	D	0	.	17.8943	0.88881	0.0:1.0:0.0:0.0	.	397;397	P51512-2;P51512	.;MMP16_HUMAN	K	397	ENSP00000286614:E397K	ENSP00000286614:E397K	E	-	1	0	MMP16	89155982	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.776000	0.85560	2.280000	0.76307	0.650000	0.86243	GAA	-	pirsf_Pept_M10A_Metazoans,pfam_Hemopexin-like_repeat,superfamily_Hemopexin-like_dom,smart_Hemopexin-like_repeat		0.418	MMP16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP16	protein_coding	OTTHUMT00000375304.2	C	NM_005941	-		89086866	-1	no_errors	ENST00000286614	ensembl	human	known	74_37	missense	SNP	1.000	T
KL	9365	genome.wustl.edu	37	13	33628363	33628363	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr13:33628363G>A	ENST00000380099.3	+	2	1287	c.1279G>A	c.(1279-1281)Gat>Aat	p.D427N	KL_ENST00000426690.2_Missense_Mutation_p.D120N|KL_ENST00000487852.1_3'UTR	NM_004795.3	NP_004786.2	Q9UEF7	KLOT_HUMAN	klotho	427	Glycosyl hydrolase-1 1.				acute inflammatory response (GO:0002526)|aging (GO:0007568)|calcium ion homeostasis (GO:0055074)|carbohydrate metabolic process (GO:0005975)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of bone mineralization (GO:0030501)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-glucosidase activity (GO:0008422)|beta-glucuronidase activity (GO:0004566)|fibroblast growth factor binding (GO:0017134)|signal transducer activity (GO:0004871)|vitamin D binding (GO:0005499)			breast(2)|endometrium(5)|kidney(3)|large_intestine(10)|lung(14)|ovary(2)|skin(5)	41	all_epithelial(80;0.133)	Ovarian(182;1.78e-06)|Breast(139;4.08e-05)|Hepatocellular(188;0.00886)|Lung SC(185;0.0262)		GBM - Glioblastoma multiforme(144;7.13e-230)|all cancers(112;1.33e-165)|OV - Ovarian serous cystadenocarcinoma(117;1.09e-113)|Epithelial(112;3.79e-112)|Lung(94;8.52e-27)|LUSC - Lung squamous cell carcinoma(192;1.4e-13)|Kidney(163;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(186;5.63e-08)|BRCA - Breast invasive adenocarcinoma(63;1.41e-05)		CAAGAGAGATGATGCCAAATA	0.383																																																	0								ENSG00000133116						100.0	106.0	104.0					13																	33628363		2201	4300	6501	KL	SO:0001583	missense	0			-	HGNC	AB005142	CCDS9347.1	13q12	2008-02-05			ENSG00000133116	ENSG00000133116			6344	protein-coding gene	gene with protein product		604824				9464267	Standard	NM_004795		Approved		uc001uus.3	Q9UEF7	OTTHUMG00000017408	ENST00000380099.3:c.1279G>A	13.37:g.33628363G>A	ENSP00000369442:p.Asp427Asn	Somatic	0	55	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	40	35.48	Q5VZ95|Q96KV5|Q96KW5|Q9UEI9|Q9Y4F0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Glyco_hydro_1,superfamily_Glycoside_hydrolase_SF,prints_Glyco_hydro_1	p.D427N	ENST00000380099.3	37	c.1279	CCDS9347.1	13	.	.	.	.	.	.	.	.	.	.	G	34	5.383349	0.95967	.	.	ENSG00000133116	ENST00000426690;ENST00000380099	T;T	0.62498	0.08;0.02	5.9	5.9	0.94986	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.000000	0.85682	D	0.000000	D	0.88455	0.6441	H	0.98487	4.245	0.80722	D	1	D;D	0.89917	1.0;0.969	D;P	0.87578	0.998;0.795	D	0.92150	0.5727	10	0.87932	D	0	-28.9902	20.2822	0.98520	0.0:0.0:1.0:0.0	.	427;120	Q9UEF7;B3KUJ4	KLOT_HUMAN;.	N	120;427	ENSP00000399513:D120N;ENSP00000369442:D427N	ENSP00000369442:D427N	D	+	1	0	KL	32526363	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	9.574000	0.98184	2.806000	0.96561	0.655000	0.94253	GAT	-	pfam_Glyco_hydro_1,superfamily_Glycoside_hydrolase_SF		0.383	KL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KL	protein_coding	OTTHUMT00000045987.1	G		-		33628363	+1	no_errors	ENST00000380099	ensembl	human	known	74_37	missense	SNP	1.000	A
SRSF1	6426	genome.wustl.edu	37	17	56084431	56084431	+	Missense_Mutation	SNP	A	A	G			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr17:56084431A>G	ENST00000258962.4	-	1	276	c.68T>C	c.(67-69)tTa>tCa	p.L23S	SRSF1_ENST00000584773.1_Missense_Mutation_p.L23S|SRSF1_ENST00000581497.1_5'Flank|SRSF1_ENST00000582730.2_Missense_Mutation_p.L23S|SRSF1_ENST00000585096.1_Missense_Mutation_p.L23S|RP11-159D12.5_ENST00000578794.1_5'Flank	NM_006924.4	NP_008855.1	Q07955	SRSF1_HUMAN	serine/arginine-rich splicing factor 1	23	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cardiac muscle contraction (GO:0060048)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|mRNA 3'-end processing (GO:0031124)|mRNA 5'-splice site recognition (GO:0000395)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splice site selection (GO:0006376)|mRNA splicing, via spliceosome (GO:0000398)|regulation of mRNA splicing, via spliceosome (GO:0048024)|regulation of mRNA stability (GO:0043488)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(1)|lung(7)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						GTCTGGAGGTAAGTTACCCAC	0.587																																																	0								ENSG00000136450						217.0	161.0	180.0					17																	56084431		2203	4300	6503	SRSF1	SO:0001583	missense	0			-	HGNC		CCDS11600.1, CCDS58580.1	17q22	2013-02-12	2010-06-22	2010-06-22	ENSG00000136450	ENSG00000136450		"""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10780	protein-coding gene	gene with protein product	"""splicing factor 2"", ""pre-mRNA-splicing factor SF2, P33 subunit"", ""alternate splicing factor"", ""SR splicing factor 1"""	600812	"""splicing factor, arginine/serine-rich 1"""	SFRS1		8530103, 20516191	Standard	NM_006924		Approved	ASF, SF2, SRp30a, SF2p33, MGC5228	uc002ivi.3	Q07955		ENST00000258962.4:c.68T>C	17.37:g.56084431A>G	ENSP00000258962:p.Leu23Ser	Somatic	0	42	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	61	20.78	B2R6Z7|D3DTZ3|Q13809	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.L23S	ENST00000258962.4	37	c.68	CCDS11600.1	17	.	.	.	.	.	.	.	.	.	.	A	15.31	2.796828	0.50208	.	.	ENSG00000136450	ENST00000258962	T	0.21734	1.99	6.11	6.11	0.99139	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.64402	D	0.000004	T	0.65037	0.2653	H	0.98682	4.3	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.79617	-0.1729	10	0.87932	D	0	.	15.6847	0.77400	1.0:0.0:0.0:0.0	.	55;23	Q59FA2;Q07955	.;SRSF1_HUMAN	S	23	ENSP00000258962:L23S	ENSP00000258962:L23S	L	-	2	0	SRSF1	53439430	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.353000	0.90077	2.343000	0.79666	0.533000	0.62120	TTA	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom		0.587	SRSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRSF1	protein_coding	OTTHUMT00000443335.1	A	NM_006924	-		56084431	-1	no_errors	ENST00000258962	ensembl	human	known	74_37	missense	SNP	1.000	G
CLEC19A	728276	genome.wustl.edu	37	16	19318867	19318867	+	Intron	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr16:19318867G>A	ENST00000493231.1	+	2	367				AC003003.5_ENST00000468219.1_RNA			Q6UXS0	CL19A_HUMAN	C-type lectin domain family 19, member A							extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)										ACCCTCCCAGGAAGGGCAGTT	0.522																																																	0								ENSG00000188477																																			AC003003.5	SO:0001627	intron_variant	0			-	Clone_based_vega_gene			16p12.3	2013-01-07			ENSG00000261210	ENSG00000261210		"""C-type lectin domain containing"""	34522	protein-coding gene	gene with protein product							Standard	NM_001256720		Approved		uc031qvg.1	Q6UXS0	OTTHUMG00000177218	ENST00000493231.1:c.254+8707G>A	16.37:g.19318867G>A		Somatic	0	11	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	22	21.43	Q0VF32	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000493231.1	37	NULL		16																																																																																			-	-		0.522	CLEC19A-003	PUTATIVE	basic|exp_conf	protein_coding	ENSG00000188477	protein_coding	OTTHUMT00000438114.1	G	NM_00125672	-		19318867	+1	no_errors	ENST00000468219	ensembl	human	known	74_37	rna	SNP	1.000	A
PCLO	27445	genome.wustl.edu	37	7	82579048	82579048	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr7:82579048G>A	ENST00000333891.9	-	6	11193	c.10856C>T	c.(10855-10857)tCc>tTc	p.S3619F	PCLO_ENST00000437081.1_Missense_Mutation_p.S339F|PCLO_ENST00000423517.2_Missense_Mutation_p.S3619F	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						GACTTTGGGGGATTTGGGTGG	0.483																																																	0								ENSG00000186472						103.0	104.0	104.0					7																	82579048		2014	4197	6211	PCLO	SO:0001583	missense	0			-	HGNC	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.10856C>T	7.37:g.82579048G>A	ENSP00000334319:p.Ser3619Phe	Somatic	0	56	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	38	26.92		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_piccolo,pfam_C2_dom,pfam_PDZ,superfamily_C2_dom,superfamily_PDZ,superfamily_Znf_FYVE_PHD,smart_PDZ,smart_C2_dom,pfscan_C2_dom,pfscan_PDZ	p.S3619F	ENST00000333891.9	37	c.10856	CCDS47630.1	7	.	.	.	.	.	.	.	.	.	.	G	18.51	3.640055	0.67244	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517;ENST00000437081	T;T	0.30981	1.51;1.57	5.61	5.61	0.85477	.	.	.	.	.	T	0.59280	0.2182	M	0.73962	2.25	0.80722	D	1	D;D;D	0.89917	0.998;1.0;1.0	D;D;D	0.91635	0.995;0.999;0.999	T	0.61768	-0.6995	9	0.87932	D	0	.	19.6465	0.95778	0.0:0.0:1.0:0.0	.	3550;3619;3619	Q9Y6V0;Q9Y6V0-5;Q9Y6V0-6	PCLO_HUMAN;.;.	F	3550;3619;3619;339	ENSP00000334319:S3619F;ENSP00000388393:S3619F	ENSP00000334319:S3619F	S	-	2	0	PCLO	82416984	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.789000	0.99068	2.642000	0.89623	0.650000	0.86243	TCC	-	NULL		0.483	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PCLO	protein_coding	OTTHUMT00000337368.5	G	NM_014510	-		82579048	-1	no_errors	ENST00000333891	ensembl	human	known	74_37	missense	SNP	1.000	A
WDR36	134430	genome.wustl.edu	37	5	110448791	110448791	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr5:110448791C>T	ENST00000513710.2	+	16	1907	c.1903C>T	c.(1903-1905)Cgt>Tgt	p.R635C	WDR36_ENST00000506538.2_Missense_Mutation_p.R635C			Q8NI36	WDR36_HUMAN	WD repeat domain 36	635					regulation of axon extension (GO:0030516)|response to stimulus (GO:0050896)|retina homeostasis (GO:0001895)|rRNA processing (GO:0006364)|visual perception (GO:0007601)	nucleus (GO:0005634)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			cervix(1)|endometrium(9)|kidney(4)|large_intestine(11)|lung(13)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		all_cancers(142;2.72e-05)|all_epithelial(76;4.4e-07)|Prostate(80;0.00955)|Lung NSC(167;0.0418)|Ovarian(225;0.0443)|Colorectal(57;0.0465)|all_lung(232;0.0508)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;1.39e-08)|Epithelial(69;1.82e-07)|all cancers(49;2.04e-05)|COAD - Colon adenocarcinoma(37;0.111)		TCCTGATGGTCGTTGGTTAAT	0.274																																																	0								ENSG00000134987						146.0	138.0	141.0					5																	110448791		2202	4300	6502	WDR36	SO:0001583	missense	0			-	HGNC	AF385437	CCDS4102.1	5q22.2	2013-01-09			ENSG00000134987	ENSG00000134987		"""WD repeat domain containing"""	30696	protein-coding gene	gene with protein product		609669	"""glaucoma 1, open angle, G"""	GLC1G		15590835, 15677485	Standard	NM_139281		Approved	TA-WDRP, UTP21	uc003kpd.3	Q8NI36	OTTHUMG00000128790	ENST00000513710.2:c.1903C>T	5.37:g.110448791C>T	ENSP00000424628:p.Arg635Cys	Somatic	0	99	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	104	18.75	A2RUS4|Q68E02|Q8N1Q2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SSU_processome_Utp21,pfam_WD40_repeat,superfamily_Quinonprotein_ADH-like_supfam,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R635C	ENST00000513710.2	37	c.1903	CCDS4102.1	5	.	.	.	.	.	.	.	.	.	.	C	29.2	4.984511	0.93044	.	.	ENSG00000134987	ENST00000506538;ENST00000513710	T;T	0.60299	0.2;0.2	6.06	6.06	0.98353	WD40/YVTN repeat-like-containing domain (1);Quinonprotein alcohol dehydrogenase-like (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.79563	0.4467	M	0.81112	2.525	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.80188	-0.1486	10	0.87932	D	0	-17.7885	20.6397	0.99537	0.0:1.0:0.0:0.0	.	635	Q8NI36	WDR36_HUMAN	C	635	ENSP00000423067:R635C;ENSP00000424628:R635C	ENSP00000423067:R635C	R	+	1	0	WDR36	110476690	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.762000	0.68809	2.880000	0.98712	0.650000	0.86243	CGT	-	pfam_WD40_repeat,superfamily_Quinonprotein_ADH-like_supfam,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom		0.274	WDR36-008	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	WDR36	protein_coding	OTTHUMT00000373504.3	C	NM_139281	-		110448791	+1	no_errors	ENST00000506538	ensembl	human	known	74_37	missense	SNP	1.000	T
ZDHHC23	254887	genome.wustl.edu	37	3	113679744	113679744	+	3'UTR	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr3:113679744C>T	ENST00000330212.3	+	0	1693				ZDHHC23_ENST00000498275.1_3'UTR|ZDHHC23_ENST00000488129.1_3'UTR	NM_173570.3	NP_775841.2	Q8IYP9	ZDH23_HUMAN	zinc finger, DHHC-type containing 23						protein localization to plasma membrane (GO:0072659)|protein palmitoylation (GO:0018345)	integral component of membrane (GO:0016021)	protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(2)|urinary_tract(2)	16						GAAAAGCCTTCCCAGGCGTCT	0.448																																																	0								ENSG00000184307																																			ZDHHC23	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AK127025	CCDS33827.1	3q13.31	2008-05-02			ENSG00000184307	ENSG00000184307		"""Zinc fingers, DHHC-type"""	28654	protein-coding gene	gene with protein product						12477932	Standard	NM_173570		Approved	MGC42530	uc003eau.3	Q8IYP9	OTTHUMG00000159335	ENST00000330212.3:c.*164C>T	3.37:g.113679744C>T		Somatic	0	14	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	23	23.33	D3DN76	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000330212.3	37	NULL	CCDS33827.1	3																																																																																			-	-		0.448	ZDHHC23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZDHHC23	protein_coding	OTTHUMT00000354702.1	C	NM_173570	-		113679744	+1	no_errors	ENST00000488129	ensembl	human	putative	74_37	rna	SNP	0.000	T
MPPED1	758	genome.wustl.edu	37	22	43831086	43831086	+	Silent	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr22:43831086C>T	ENST00000417669.2	+	3	801	c.357C>T	c.(355-357)ttC>ttT	p.F119F	MPPED1_ENST00000414469.2_Silent_p.F13F|MPPED1_ENST00000443721.1_Silent_p.F119F|MPPED1_ENST00000542779.1_Silent_p.F119F|MPPED1_ENST00000538182.1_Silent_p.F152F|MPPED1_ENST00000439548.1_Intron			O15442	MPPD1_HUMAN	metallophosphoesterase domain containing 1	119							hydrolase activity (GO:0016787)			endometrium(3)|large_intestine(3)|lung(4)|prostate(2)|skin(1)	13		all_neural(38;0.0244)|Ovarian(80;0.0694)				CTGGGGACTTCACTGAGCTGG	0.657																																																	0								ENSG00000186732						63.0	74.0	70.0					22																	43831086		2071	4193	6264	MPPED1	SO:0001819	synonymous_variant	0			-	HGNC	U84894	CCDS46723.1	22q13.2	2013-09-20	2005-10-10	2005-10-10	ENSG00000186732	ENSG00000186732			1306	protein-coding gene	gene with protein product		602112	"""chromosome 22 open reading frame 1"""	C22orf1		9266672, 10591208	Standard	NM_001044370		Approved	239AB, FAM1A	uc011apv.2	O15442	OTTHUMG00000150566	ENST00000417669.2:c.357C>T	22.37:g.43831086C>T		Somatic	0	75	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	60	23.75	A8K159|B7Z2S9|Q8N361	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_PEstase_dom	p.F152	ENST00000417669.2	37	c.456	CCDS46723.1	22																																																																																			-	pfam_PEstase_dom		0.657	MPPED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MPPED1	protein_coding	OTTHUMT00000318938.2	C	NM_001044370	-		43831086	+1	no_errors	ENST00000538182	ensembl	human	known	74_37	silent	SNP	1.000	T
BTN2A3P	54718	genome.wustl.edu	37	6	26428148	26428148	+	RNA	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr6:26428148C>T	ENST00000466808.2	+	0	1117							Q96KV6	BT2A3_HUMAN	butyrophilin, subfamily 2, member A3, pseudogene							integral component of membrane (GO:0016021)											TGCCTGTTATCATGATTATTC	0.423																																																	0								ENSG00000124549						180.0	168.0	172.0					6																	26428148		2203	4300	6503	BTN2A3P			0			-	HGNC	AL021917		6p22.1	2014-01-14	2011-09-06	2011-09-06	ENSG00000124549	ENSG00000124549		"""Butyrophilins"""	13229	pseudogene	pseudogene		613592	"""butyrophilin, subfamily 2, member A3"""	BTN2A3			Standard	NR_027795		Approved	BTN2.3	uc011dkl.1	Q96KV6	OTTHUMG00000014453		6.37:g.26428148C>T		Somatic	0	49	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	49	19.67	A6NEF4	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000466808.2	37	NULL		6																																																																																			-	-		0.423	BTN2A3P-001	KNOWN	basic	processed_transcript	BTN2A3P	pseudogene	OTTHUMT00000040118.4	C	NR_027795	-		26428148	+1	no_errors	ENST00000463944	ensembl	human	known	74_37	rna	SNP	0.000	T
TRPC4AP	26133	genome.wustl.edu	37	20	33632313	33632313	+	Missense_Mutation	SNP	T	T	G			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr20:33632313T>G	ENST00000252015.2	-	7	949	c.860A>C	c.(859-861)aAt>aCt	p.N287T	TRPC4AP_ENST00000432634.2_Missense_Mutation_p.N248T|TRPC4AP_ENST00000451813.2_Missense_Mutation_p.N287T			Q8TEL6	TP4AP_HUMAN	transient receptor potential cation channel, subfamily C, member 4 associated protein	287	Interaction with TNFRSF1A. {ECO:0000250}.				calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|protein ubiquitination (GO:0016567)|transmembrane transport (GO:0055085)|ubiquitin-dependent protein catabolic process (GO:0006511)	Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)|plasma membrane (GO:0005886)	phosphatase binding (GO:0019902)			breast(3)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|skin(1)|stomach(1)|urinary_tract(1)	32			BRCA - Breast invasive adenocarcinoma(18;0.00936)			TTTACCTTGATTGATTTCAGC	0.378																																																	0								ENSG00000100991						89.0	91.0	90.0					20																	33632313		2203	4300	6503	TRPC4AP	SO:0001583	missense	0			-	HGNC	AF055022	CCDS13246.1, CCDS46591.1	20q11.23	2014-06-13	2003-10-06	2003-10-08	ENSG00000100991	ENSG00000100991			16181	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 158"""	608430	"""chromosome 20 open reading frame 188"""	C20orf188			Standard	NM_015638		Approved	DKFZP727M231, DKFZp586C1223, dJ756N5.2, TRRP4AP, PPP1R158	uc002xbk.3	Q8TEL6	OTTHUMG00000032319	ENST00000252015.2:c.860A>C	20.37:g.33632313T>G	ENSP00000252015:p.Asn287Thr	Somatic	0	49	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	47	16.07	E1P5Q0|E1P5Q1|Q96H82|Q9BVB8|Q9H429|Q9UFS6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF3689	p.N287T	ENST00000252015.2	37	c.860	CCDS13246.1	20	.	.	.	.	.	.	.	.	.	.	T	25.4	4.638110	0.87760	.	.	ENSG00000100991	ENST00000252015;ENST00000451813;ENST00000432634;ENST00000541994	T;T;T	0.30981	1.51;1.51;1.51	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	T	0.54240	0.1846	M	0.63843	1.955	0.80722	D	1	D;D;D	0.89917	0.993;1.0;1.0	D;D;D	0.83275	0.984;0.996;0.996	T	0.56860	-0.7909	10	0.87932	D	0	.	16.043	0.80698	0.0:0.0:0.0:1.0	.	248;287;287	B4E0Q1;E1P5Q0;Q8TEL6	.;.;TP4AP_HUMAN	T	287;287;248;272	ENSP00000252015:N287T;ENSP00000400614:N287T;ENSP00000400497:N248T	ENSP00000252015:N287T	N	-	2	0	TRPC4AP	33095974	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.783000	0.85696	2.187000	0.69744	0.477000	0.44152	AAT	-	NULL		0.378	TRPC4AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPC4AP	protein_coding	OTTHUMT00000078832.2	T	NM_015638	-		33632313	-1	no_errors	ENST00000252015	ensembl	human	known	74_37	missense	SNP	1.000	G
KCNRG	283518	genome.wustl.edu	37	13	50594376	50594376	+	Missense_Mutation	SNP	G	G	A	rs369440174		TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr13:50594376G>A	ENST00000312942.1	+	2	845	c.605G>A	c.(604-606)cGa>cAa	p.R202Q	TRIM13_ENST00000478111.1_3'UTR|KCNRG_ENST00000360473.4_3'UTR	NM_173605.1	NP_775876.1	Q8N5I3	KCNRG_HUMAN	potassium channel regulator	202					protein homooligomerization (GO:0051260)	endoplasmic reticulum (GO:0005783)	identical protein binding (GO:0042802)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(3)	9		Acute lymphoblastic leukemia(7;3.41e-06)|Lung NSC(96;3.08e-05)|Breast(56;9.7e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;1.48e-10)|COAD - Colon adenocarcinoma(199;0.204)		CCTGATAACCGAAAATTGGCC	0.348													G|||	1	0.000199681	0.0008	0.0	5008	,	,		16433	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000198553	G	GLN/ARG,	2,4404	4.2+/-10.8	0,2,2201	70.0	69.0	69.0		605,	4.6	1.0	13		69	0,8600		0,0,4300	no	missense,utr-3	KCNRG	NM_173605.1,NM_199464.1	43,	0,2,6501	AA,AG,GG		0.0,0.0454,0.0154	probably-damaging,	202/273,	50594376	2,13004	2203	4300	6503	KCNRG	SO:0001583	missense	0			-	HGNC		CCDS9424.1, CCDS41889.1	13q14.11	2008-05-02			ENSG00000198553	ENSG00000198553			18893	protein-coding gene	gene with protein product							Standard	NM_173605		Approved		uc001vdu.3	Q8N5I3	OTTHUMG00000140140	ENST00000312942.1:c.605G>A	13.37:g.50594376G>A	ENSP00000324191:p.Arg202Gln	Somatic	0	66	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	31	57	34.83	A2A2X9|Q0P6D0|Q8IU75|Q8N3Q9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_T1-type_BTB,superfamily_BTB/POZ_fold,smart_BTB/POZ-like	p.R202Q	ENST00000312942.1	37	c.605	CCDS9424.1	13	.	.	.	.	.	.	.	.	.	.	G	18.27	3.586965	0.66105	4.54E-4	0.0	ENSG00000198553	ENST00000312942	T	0.64803	-0.12	5.49	4.64	0.57946	.	0.099608	0.41500	N	0.000869	T	0.46229	0.1382	L	0.34521	1.04	0.31333	N	0.684538	P	0.40360	0.714	B	0.25140	0.058	T	0.59386	-0.7464	10	0.87932	D	0	.	14.0751	0.64885	0.0723:0.0:0.9277:0.0	.	202	Q8N5I3	KCNRG_HUMAN	Q	202	ENSP00000324191:R202Q	ENSP00000324191:R202Q	R	+	2	0	KCNRG	49492377	1.000000	0.71417	0.992000	0.48379	0.917000	0.54804	2.981000	0.49329	1.335000	0.45486	0.557000	0.71058	CGA	-	NULL		0.348	KCNRG-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNRG	protein_coding	OTTHUMT00000276308.1	G		-		50594376	+1	no_errors	ENST00000312942	ensembl	human	known	74_37	missense	SNP	0.988	A
FARP2	9855	genome.wustl.edu	37	2	242371175	242371175	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr2:242371175C>T	ENST00000264042.3	+	9	1023	c.853C>T	c.(853-855)Cat>Tat	p.H285Y	FARP2_ENST00000373287.4_Missense_Mutation_p.H285Y|FARP2_ENST00000545004.1_Missense_Mutation_p.H285Y	NM_014808.2	NP_055623.1	O94887	FARP2_HUMAN	FERM, RhoGEF and pleckstrin domain protein 2	285	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				actin cytoskeleton reorganization (GO:0031532)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|neuron remodeling (GO:0016322)|osteoclast differentiation (GO:0030316)|podosome assembly (GO:0071800)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of integrin activation (GO:0033623)|regulation of Rac GTPase activity (GO:0032314)|semaphorin-plexin signaling pathway (GO:0071526)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)	Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.H285Y(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(18)|ovary(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	43		all_cancers(19;4.88e-34)|all_epithelial(40;4.81e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Lung NSC(271;0.0886)|Ovarian(221;0.0905)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;1.81e-33)|all cancers(36;1.61e-30)|OV - Ovarian serous cystadenocarcinoma(60;6.83e-15)|Kidney(56;1.19e-08)|KIRC - Kidney renal clear cell carcinoma(57;8.98e-08)|BRCA - Breast invasive adenocarcinoma(100;1.49e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00125)|Colorectal(34;0.0199)|COAD - Colon adenocarcinoma(134;0.121)		TATCAAACTTCATCCAGAGGT	0.313																																																	1	Substitution - Missense(1)	lung(1)						ENSG00000006607						102.0	96.0	98.0					2																	242371175		2203	4300	6503	FARP2	SO:0001583	missense	0			-	HGNC	AB018336	CCDS33424.1, CCDS63197.1	2q37.3	2013-01-10			ENSG00000006607	ENSG00000006607		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	16460	protein-coding gene	gene with protein product						9872452, 12351724	Standard	NM_001282984		Approved	KIAA0793, FIR, PLEKHC3, FRG	uc002wbi.2	O94887	OTTHUMG00000151574	ENST00000264042.3:c.853C>T	2.37:g.242371175C>T	ENSP00000264042:p.His285Tyr	Somatic	0	69	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	77	19.79	B7Z6J8|F5GZ84|Q53QM5|Q8WU27|Q9UFE7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DH-domain,pfam_Pleckstrin_homology,pfam_FERM_PH-like_C,pfam_FERM_N,pfam_FERM_central,pfam_FERM-adjacent,superfamily_DH-domain,superfamily_FERM_central,smart_Band_41_domain,smart_DH-domain,smart_Pleckstrin_homology,pfscan_FERM_domain,pfscan_Pleckstrin_homology,pfscan_DH-domain,prints_Band_41_fam,prints_Ez/rad/moesin_like	p.H285Y	ENST00000264042.3	37	c.853	CCDS33424.1	2	.	.	.	.	.	.	.	.	.	.	c	15.42	2.829417	0.50845	.	.	ENSG00000006607	ENST00000264042;ENST00000545004;ENST00000373287	D;D;D	0.87179	-2.22;-2.22;-2.22	4.84	3.97	0.46021	FERM, C-terminal PH-like domain (1);FERM domain (1);Pleckstrin homology-type (1);	0.058923	0.64402	D	0.000003	D	0.91865	0.7425	M	0.86953	2.85	0.58432	D	0.999999	P;P;P	0.48407	0.886;0.716;0.91	P;B;P	0.53266	0.59;0.381;0.722	D	0.92851	0.6297	10	0.87932	D	0	.	13.2927	0.60280	0.0:0.9225:0.0:0.0775	.	285;285;285	O94887-2;F5GZ84;O94887	.;.;FARP2_HUMAN	Y	285	ENSP00000264042:H285Y;ENSP00000443876:H285Y;ENSP00000362384:H285Y	ENSP00000264042:H285Y	H	+	1	0	FARP2	242019848	1.000000	0.71417	0.999000	0.59377	0.993000	0.82548	4.735000	0.62051	1.170000	0.42753	0.558000	0.71614	CAT	-	pfam_FERM_PH-like_C,pfscan_FERM_domain		0.313	FARP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FARP2	protein_coding	OTTHUMT00000323153.1	C		-		242371175	+1	no_errors	ENST00000264042	ensembl	human	known	74_37	missense	SNP	1.000	T
KIAA1549	57670	genome.wustl.edu	37	7	138583853	138583853	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr7:138583853C>T	ENST00000422774.1	-	9	3743	c.3695G>A	c.(3694-3696)gGa>gAa	p.G1232E	KIAA1549_ENST00000242365.4_Missense_Mutation_p.G1182E|KIAA1549_ENST00000440172.1_Missense_Mutation_p.G1232E			Q9HCM3	K1549_HUMAN	KIAA1549	1232						integral component of membrane (GO:0016021)			KIAA1549/BRAF(703)	large_intestine(4)|pancreas(1)|upper_aerodigestive_tract(2)	7						ATTGTCATCTCCCTCCAGCCT	0.463			O	BRAF	pilocytic astrocytoma																																NSCLC(119;1534 1718 44213 46230 50068)			Dom	yes		7	7q34	57670	KIAA1549		O	0								ENSG00000122778						211.0	197.0	201.0					7																	138583853		2002	4169	6171	KIAA1549	SO:0001583	missense	0			-	HGNC		CCDS47723.1, CCDS47723.2, CCDS56513.1	7q34	2009-10-09			ENSG00000122778	ENSG00000122778			22219	protein-coding gene	gene with protein product		613344					Standard	NM_020910		Approved		uc011kql.2	Q9HCM3	OTTHUMG00000157214	ENST00000422774.1:c.3695G>A	7.37:g.138583853C>T	ENSP00000416040:p.Gly1232Glu	Somatic	0	59	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	68	18.07	B6HY55|B6HY56|B6HY58|B6HY60|B6HY61|B6HY62|B6HY63|B6HY64|B6HY65|B6HY66|Q5BJD6|Q8IY15|Q9H0M3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.G1232E	ENST00000422774.1	37	c.3695	CCDS56513.1	7	.	.	.	.	.	.	.	.	.	.	C	25.1	4.607600	0.87157	.	.	ENSG00000122778	ENST00000440172;ENST00000242365;ENST00000422774	T;T;T	0.65549	-0.14;-0.11;-0.16	4.54	4.54	0.55810	.	0.000000	0.85682	D	0.000000	T	0.79317	0.4425	M	0.78456	2.415	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	T	0.81795	-0.0769	10	0.56958	D	0.05	.	16.4521	0.83994	0.0:1.0:0.0:0.0	.	1232;16;1232;16	Q9HCM3;Q9HCM3-4;Q9HCM3-2;Q9HCM3-3	K1549_HUMAN;.;.;.	E	1232;1182;1232	ENSP00000406661:G1232E;ENSP00000242365:G1182E;ENSP00000416040:G1232E	ENSP00000242365:G1182E	G	-	2	0	KIAA1549	138234393	1.000000	0.71417	0.999000	0.59377	0.948000	0.59901	5.535000	0.67173	2.331000	0.79229	0.462000	0.41574	GGA	-	NULL		0.463	KIAA1549-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA1549	protein_coding	OTTHUMT00000348092.1	C		-		138583853	-1	no_errors	ENST00000422774	ensembl	human	known	74_37	missense	SNP	1.000	T
ANKK1	255239	genome.wustl.edu	37	11	113270707	113270707	+	Silent	SNP	C	C	T	rs564355960	byFrequency	TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr11:113270707C>T	ENST00000303941.3	+	8	2110	c.2016C>T	c.(2014-2016)ttC>ttT	p.F672F		NM_178510.1	NP_848605.1	Q8NFD2	ANKK1_HUMAN	ankyrin repeat and kinase domain containing 1	672							ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(2)|lung(14)|ovary(1)|stomach(1)	29		all_cancers(61;1.53e-11)|all_epithelial(67;3e-06)|Melanoma(852;4.04e-05)|all_hematologic(158;0.000315)|Acute lymphoblastic leukemia(157;0.000966)|Breast(348;0.0461)|Medulloblastoma(222;0.0523)|all_neural(223;0.0663)|Prostate(24;0.194)		BRCA - Breast invasive adenocarcinoma(274;4.82e-06)|Epithelial(105;5.41e-05)|all cancers(92;0.000442)|OV - Ovarian serous cystadenocarcinoma(223;0.238)		GGAGCACCTTCCTGAGTGTCA	0.632													C|||	2	0.000399361	0.0	0.0	5008	,	,		20403	0.0		0.0	False		,,,				2504	0.002																0								ENSG00000170209						69.0	77.0	74.0					11																	113270707		2083	4203	6286	ANKK1	SO:0001819	synonymous_variant	0			-	HGNC	AJ541797	CCDS44734.1	11q23.2	2013-01-10			ENSG00000170209	ENSG00000170209		"""Ankyrin repeat domain containing"""	21027	protein-coding gene	gene with protein product		608774				15146457	Standard	NM_178510		Approved	X-kinase	uc001pny.3	Q8NFD2	OTTHUMG00000167715	ENST00000303941.3:c.2016C>T	11.37:g.113270707C>T		Somatic	0	42	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	61	16.44		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ankyrin_rpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Ankyrin_rpt,prints_Ankyrin_rpt,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Prot_kinase_dom	p.F672	ENST00000303941.3	37	c.2016	CCDS44734.1	11																																																																																			-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom		0.632	ANKK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKK1	protein_coding	OTTHUMT00000395830.1	C	NM_178510	-		113270707	+1	no_errors	ENST00000303941	ensembl	human	known	74_37	silent	SNP	0.998	T
PRR23C	389152	genome.wustl.edu	37	3	138763066	138763066	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr3:138763066C>T	ENST00000413199.1	-	1	668	c.397G>A	c.(397-399)Gaa>Aaa	p.E133K	PRR23C_ENST00000502927.2_Missense_Mutation_p.E133K|MRPS22_ENST00000495075.1_Intron	NM_001134657.1	NP_001128129.1	Q6ZRP0	PR23C_HUMAN	proline rich 23C	133										breast(2)|lung(7)|skin(2)	11						ACGACGTCTTCCCCGTGAGCG	0.647																																																	0								ENSG00000233701						44.0	43.0	44.0					3																	138763066		692	1591	2283	PRR23C	SO:0001583	missense	0			-	HGNC		CCDS46924.1	3q22.3	2014-06-03				ENSG00000233701			37173	protein-coding gene	gene with protein product							Standard	NM_001134657		Approved	FLJ46210	uc011bmt.1	Q6ZRP0		ENST00000413199.1:c.397G>A	3.37:g.138763066C>T	ENSP00000396648:p.Glu133Lys	Somatic	0	42	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	50	19.35		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_UPF0572	p.E133K	ENST00000413199.1	37	c.397	CCDS46924.1	3	.	.	.	.	.	.	.	.	.	.	C	15.97	2.989141	0.53934	.	.	ENSG00000233701	ENST00000413199;ENST00000502927	.	.	.	3.39	1.48	0.22813	.	2.146400	0.02220	N	0.063973	T	0.56381	0.1981	L	0.50333	1.59	0.09310	N	1	D	0.59767	0.986	P	0.58970	0.849	T	0.40776	-0.9545	9	0.72032	D	0.01	.	9.3561	0.38168	0.0:0.5683:0.4317:0.0	.	133	Q6ZRP0	PR23C_HUMAN	K	133	.	ENSP00000396648:E133K	E	-	1	0	PRR23C	140245756	0.000000	0.05858	0.006000	0.13384	0.108000	0.19459	-0.057000	0.11768	0.408000	0.25621	0.455000	0.32223	GAA	-	pfam_UPF0572		0.647	PRR23C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRR23C	protein_coding	OTTHUMT00000361502.1	C	NM_001134657	-		138763066	-1	no_errors	ENST00000413199	ensembl	human	known	74_37	missense	SNP	0.006	T
ACAP1	9744	genome.wustl.edu	37	17	7253484	7253484	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr17:7253484G>A	ENST00000158762.3	+	20	2206	c.2000G>A	c.(1999-2001)gGg>gAg	p.G667E	KCTD11_ENST00000333751.3_5'Flank|ACAP1_ENST00000570504.1_5'Flank|ACAP1_ENST00000575415.1_5'Flank|ACAP1_ENST00000571471.1_5'Flank|RP11-542C16.1_ENST00000572417.1_RNA|ACAP1_ENST00000574499.1_5'Flank	NM_014716.3	NP_055531.1	Q15027	ACAP1_HUMAN	ArfGAP with coiled-coil, ankyrin repeat and PH domains 1	667	Required for interaction with GULP1.				protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)	endosome (GO:0005768)|membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|cervix(3)|endometrium(4)|kidney(1)|large_intestine(7)|liver(1)|lung(6)|prostate(3)|skin(1)|urinary_tract(1)	33						GCTGATCTGGGGGCTCGAGAC	0.632																																																	0								ENSG00000072818						73.0	76.0	75.0					17																	7253484		2203	4300	6503	ACAP1	SO:0001583	missense	0			-	HGNC	D30758	CCDS11101.1	17p13.1	2013-01-11	2008-09-22	2008-09-22	ENSG00000072818	ENSG00000072818		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16467	protein-coding gene	gene with protein product		607763	"""centaurin, beta 1"""	CENTB1		11050434, 11062263	Standard	NM_014716		Approved	KIAA0050	uc002ggd.2	Q15027	OTTHUMG00000102199	ENST00000158762.3:c.2000G>A	17.37:g.7253484G>A	ENSP00000158762:p.Gly667Glu	Somatic	0	94	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	112	18.12	Q53XN9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ArfGAP,pfam_Pleckstrin_homology,superfamily_Ankyrin_rpt-contain_dom,smart_Pleckstrin_homology,smart_ArfGAP,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Pleckstrin_homology,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_ArfGAP,prints_ArfGAP	p.G667E	ENST00000158762.3	37	c.2000	CCDS11101.1	17	.	.	.	.	.	.	.	.	.	.	G	14.29	2.491888	0.44352	.	.	ENSG00000072818	ENST00000158762	T	0.32753	1.44	5.26	4.3	0.51218	Ankyrin repeat-containing domain (4);	0.288882	0.38005	N	0.001853	T	0.14743	0.0356	N	0.11789	0.175	0.80722	D	1	B	0.21905	0.062	B	0.27608	0.081	T	0.07046	-1.0793	10	0.07175	T	0.84	.	7.8982	0.29719	0.1799:0.0:0.82:0.0	.	667	Q15027	ACAP1_HUMAN	E	667	ENSP00000158762:G667E	ENSP00000158762:G667E	G	+	2	0	ACAP1	7194208	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	5.451000	0.66632	1.461000	0.47929	-0.404000	0.06349	GGG	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom		0.632	ACAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACAP1	protein_coding	OTTHUMT00000220049.4	G	NM_014716	-		7253484	+1	no_errors	ENST00000158762	ensembl	human	known	74_37	missense	SNP	1.000	A
TLR2	7097	genome.wustl.edu	37	4	154624787	154624787	+	Missense_Mutation	SNP	C	C	T	rs547628858	byFrequency	TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr4:154624787C>T	ENST00000260010.6	+	1	2136	c.728C>T	c.(727-729)tCc>tTc	p.S243F		NM_003264.3	NP_003255.2	O60603	TLR2_HUMAN	toll-like receptor 2	243					apoptotic process (GO:0006915)|cell surface pattern recognition receptor signaling pathway (GO:0002752)|cellular response to bacterial lipopeptide (GO:0071221)|cellular response to diacyl bacterial lipopeptide (GO:0071726)|cellular response to lipoteichoic acid (GO:0071223)|cellular response to peptidoglycan (GO:0071224)|cellular response to triacyl bacterial lipopeptide (GO:0071727)|central nervous system myelin formation (GO:0032289)|chloramphenicol transport (GO:0042892)|defense response to Gram-positive bacterium (GO:0050830)|detection of diacyl bacterial lipopeptide (GO:0042496)|detection of triacyl bacterial lipopeptide (GO:0042495)|I-kappaB phosphorylation (GO:0007252)|immune response (GO:0006955)|induction by symbiont of defense-related host nitric oxide production (GO:0052063)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|leukotriene metabolic process (GO:0006691)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of cell proliferation (GO:0008285)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of interleukin-17 production (GO:0032700)|nitric oxide metabolic process (GO:0046209)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of chemokine production (GO:0032722)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-18 production (GO:0032741)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of oligodendrocyte differentiation (GO:0048714)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of Wnt signaling pathway (GO:0030177)|response to fatty acid (GO:0070542)|response to hypoxia (GO:0001666)|response to insulin (GO:0032868)|response to molecule of fungal origin (GO:0002238)|response to progesterone (GO:0032570)|response to toxic substance (GO:0009636)|signal transduction (GO:0007165)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)	cell body (GO:0044297)|cell projection (GO:0042995)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|Toll-like receptor 1-Toll-like receptor 2 protein complex (GO:0035354)|Toll-like receptor 2-Toll-like receptor 6 protein complex (GO:0035355)	diacyl lipopeptide binding (GO:0042498)|lipopolysaccharide receptor activity (GO:0001875)|lipoteichoic acid binding (GO:0070891)|peptidoglycan binding (GO:0042834)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)|signaling pattern recognition receptor activity (GO:0008329)|transmembrane signaling receptor activity (GO:0004888)|triacyl lipopeptide binding (GO:0042497)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	29	all_hematologic(180;0.093)	Renal(120;0.117)			OspA lipoprotein(DB00045)	TCAGAACTATCCACTGGTGAA	0.323																																																	0								ENSG00000137462						52.0	52.0	52.0					4																	154624787		2203	4299	6502	TLR2	SO:0001583	missense	0			-	HGNC	U88878	CCDS3784.1	4q32	2008-02-05				ENSG00000137462		"""CD molecules"""	11848	protein-coding gene	gene with protein product		603028				9435236	Standard	XM_005263193		Approved	TIL4, CD282	uc003inq.3	O60603		ENST00000260010.6:c.728C>T	4.37:g.154624787C>T	ENSP00000260010:p.Ser243Phe	Somatic	0	48	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	68	15.00	B3Y612|D1CS45|D1CS48|D1CS49|O15454|Q8NI00	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_Toll-like_receptor,pfam_TIR_dom,pfam_Leu-rich_rpt,superfamily_TIR_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_TIR_dom,pfscan_TIR_dom	p.S243F	ENST00000260010.6	37	c.728	CCDS3784.1	4	.	.	.	.	.	.	.	.	.	.	C	6.712	0.500038	0.12762	.	.	ENSG00000137462	ENST00000260010	T	0.54675	0.56	5.61	3.9	0.45041	.	0.491092	0.22772	N	0.055824	T	0.39009	0.1062	L	0.44542	1.39	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.21415	-1.0246	10	0.25106	T	0.35	.	5.6505	0.17614	0.0:0.6125:0.1533:0.2342	.	243	O60603	TLR2_HUMAN	F	243	ENSP00000260010:S243F	ENSP00000260010:S243F	S	+	2	0	TLR2	154844237	0.000000	0.05858	0.003000	0.11579	0.466000	0.32739	0.527000	0.22987	0.857000	0.35407	0.655000	0.94253	TCC	-	pirsf_Toll-like_receptor		0.323	TLR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLR2	protein_coding	OTTHUMT00000365205.1	C		-		154624787	+1	no_errors	ENST00000260010	ensembl	human	known	74_37	missense	SNP	0.002	T
IGSF9	57549	genome.wustl.edu	37	1	159899162	159899162	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr1:159899162G>A	ENST00000368094.1	-	18	2545	c.2348C>T	c.(2347-2349)cCg>cTg	p.P783L	IGSF9_ENST00000493195.1_5'UTR|IGSF9_ENST00000361509.3_Missense_Mutation_p.P767L	NM_001135050.1	NP_001128522.1	Q9P2J2	TUTLA_HUMAN	immunoglobulin superfamily, member 9	783					dendrite development (GO:0016358)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synapse (GO:0045202)				central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(13)|lung(17)|ovary(3)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	all_hematologic(112;0.0597)	Breast(1374;0.000126)	BRCA - Breast invasive adenocarcinoma(70;0.111)			CTTCCCGGTCGGAGAGAAGAT	0.512																																																	0								ENSG00000085552						123.0	115.0	118.0					1																	159899162		2203	4300	6503	IGSF9	SO:0001583	missense	0			-	HGNC	AB037776	CCDS1190.1, CCDS44254.1	1q22-q23	2013-02-11			ENSG00000085552	ENSG00000085552		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	18132	protein-coding gene	gene with protein product		609738				11991715	Standard	NM_020789		Approved	KIAA1355, Nrt1, IGSF9A	uc001fur.2	Q9P2J2	OTTHUMG00000022794	ENST00000368094.1:c.2348C>T	1.37:g.159899162G>A	ENSP00000357073:p.Pro783Leu	Somatic	0	24	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	28	22.22		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.P783L	ENST00000368094.1	37	c.2348	CCDS44254.1	1	.	.	.	.	.	.	.	.	.	.	G	11.15	1.553786	0.27739	.	.	ENSG00000085552	ENST00000361509;ENST00000368094	T;T	0.64438	-0.1;-0.01	5.28	1.32	0.21799	.	0.000000	0.38605	N	0.001624	T	0.24624	0.0597	L	0.50333	1.59	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.21245	-1.0251	9	.	.	.	-6.3751	1.754	0.02978	0.2304:0.1412:0.4834:0.145	.	783	Q9P2J2	TUTLA_HUMAN	L	767;783	ENSP00000355049:P767L;ENSP00000357073:P783L	.	P	-	2	0	IGSF9	158165786	0.998000	0.40836	0.007000	0.13788	0.110000	0.19582	3.203000	0.51075	-0.010000	0.14271	0.561000	0.74099	CCG	-	NULL		0.512	IGSF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGSF9	protein_coding	OTTHUMT00000059115.1	G	NM_020789	-		159899162	-1	no_errors	ENST00000368094	ensembl	human	known	74_37	missense	SNP	0.004	A
MEX3B	84206	genome.wustl.edu	37	15	82336250	82336250	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr15:82336250G>A	ENST00000329713.4	-	2	1396	c.961C>T	c.(961-963)Cct>Tct	p.P321S	MEX3B_ENST00000558133.1_3'UTR|AC026956.1_ENST00000410589.1_RNA	NM_032246.4	NP_115622.2	Q6ZN04	MEX3B_HUMAN	mex-3 RNA binding family member B	321					protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|kidney(1)|large_intestine(5)|lung(9)|upper_aerodigestive_tract(1)	19						GCGGGGCTAGGGGGGCTGTAG	0.627																																																	0								ENSG00000183496						41.0	48.0	46.0					15																	82336250		2197	4268	6465	MEX3B	SO:0001583	missense	0			-	HGNC	AK131424	CCDS10319.1	15q25.1	2013-08-21	2013-08-21	2007-07-18	ENSG00000183496	ENSG00000183496		"""RING-type (C3HC4) zinc fingers"", ""Mex-3 homologs"""	25297	protein-coding gene	gene with protein product		611008	"""ring finger and KH domain containing 3"", ""mex-3 homolog B (C. elegans)"""	RKHD3		11230166, 17267406	Standard	NM_032246		Approved	DKFZp434J0617, RNF195	uc002bgq.2	Q6ZN04	OTTHUMG00000147356	ENST00000329713.4:c.961C>T	15.37:g.82336250G>A	ENSP00000329918:p.Pro321Ser	Somatic	0	27	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	33	17.50	Q4G0W1|Q8IVG2|Q9H0J0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_KH_dom_type_1,smart_KH_dom,smart_Znf_RING,pfscan_Znf_RING,pfscan_KH_dom_type_1	p.P321S	ENST00000329713.4	37	c.961	CCDS10319.1	15	.	.	.	.	.	.	.	.	.	.	G	13.44	2.238204	0.39598	.	.	ENSG00000183496	ENST00000329713	T	0.23754	1.89	4.85	4.85	0.62838	.	0.142623	0.46758	D	0.000275	T	0.19725	0.0474	L	0.35414	1.06	0.80722	D	1	B	0.24721	0.11	B	0.25884	0.064	T	0.03945	-1.0990	10	0.09590	T	0.72	-23.6302	15.9169	0.79527	0.0:0.0:1.0:0.0	.	321	Q6ZN04	MEX3B_HUMAN	S	321	ENSP00000329918:P321S	ENSP00000329918:P321S	P	-	1	0	MEX3B	80123305	0.906000	0.30813	0.999000	0.59377	0.988000	0.76386	1.237000	0.32695	2.515000	0.84797	0.563000	0.77884	CCT	-	NULL		0.627	MEX3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MEX3B	protein_coding	OTTHUMT00000304000.1	G	XM_290645	-		82336250	-1	no_errors	ENST00000329713	ensembl	human	known	74_37	missense	SNP	1.000	A
MUC16	94025	genome.wustl.edu	37	19	9056817	9056817	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr19:9056817G>A	ENST00000397910.4	-	3	30832	c.30629C>T	c.(30628-30630)tCa>tTa	p.S10210L		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	10212	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GTCTGGGGATGATGTTTTTGC	0.468																																																	0								ENSG00000181143						130.0	128.0	129.0					19																	9056817		1951	4161	6112	MUC16	SO:0001583	missense	0			-	HGNC	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.30629C>T	19.37:g.9056817G>A	ENSP00000381008:p.Ser10210Leu	Somatic	0	24	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	31	16.22	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.S10210L	ENST00000397910.4	37	c.30629	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	g	7.235	0.600087	0.13939	.	.	ENSG00000181143	ENST00000397910	T	0.02656	4.21	3.14	0.885	0.19188	.	.	.	.	.	T	0.02571	0.0078	L	0.34521	1.04	.	.	.	B	0.21381	0.055	B	0.18871	0.023	T	0.29088	-1.0023	8	0.87932	D	0	.	4.7225	0.12926	0.3369:0.0:0.6631:0.0	.	10210	B5ME49	.	L	10210	ENSP00000381008:S10210L	ENSP00000381008:S10210L	S	-	2	0	MUC16	8917817	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.098000	0.15189	0.289000	0.22422	0.467000	0.42956	TCA	-	NULL		0.468	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	protein_coding	OTTHUMT00000402806.1	G	NM_024690	-		9056817	-1	no_errors	ENST00000397910	ensembl	human	known	74_37	missense	SNP	0.000	A
ANKS1A	23294	genome.wustl.edu	37	6	35051241	35051241	+	Silent	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr6:35051241C>T	ENST00000360359.3	+	20	3093	c.2955C>T	c.(2953-2955)atC>atT	p.I985I	ANKS1A_ENST00000535627.1_Intron	NM_015245.2	NP_056060.2	Q92625	ANS1A_HUMAN	ankyrin repeat and sterile alpha motif domain containing 1A	985	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				ephrin receptor signaling pathway (GO:0048013)|neuron remodeling (GO:0016322)|substrate-dependent cell migration (GO:0006929)	cytoplasm (GO:0005737)|neuron projection (GO:0043005)|nucleus (GO:0005634)				cervix(2)|endometrium(3)|large_intestine(4)|lung(16)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31						TCCTGTCCATCACATACAAAG	0.547																																																	0								ENSG00000064999						230.0	182.0	199.0					6																	35051241		2203	4300	6503	ANKS1A	SO:0001819	synonymous_variant	0			-	HGNC	D86982	CCDS4798.1	6p21.31	2013-01-10	2006-02-17	2006-02-17	ENSG00000064999	ENSG00000064999		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	20961	protein-coding gene	gene with protein product		608994	"""ankyrin repeat and SAM domain containing 1"", ""ankyrin repeat and sterile alpha motif domain containing 1"""	ANKS1		9039502	Standard	NM_015245		Approved	KIAA0229	uc003ojx.4	Q92625	OTTHUMG00000014559	ENST00000360359.3:c.2955C>T	6.37:g.35051241C>T		Somatic	0	35	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	40	11.11	A2RUC1|B4DQW8|Q5JYI9|Q5SYR2|Q86WQ7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ankyrin_rpt,pfam_SAM_type1,pfam_PTB/PI_dom,pfam_SAM_2,superfamily_Ankyrin_rpt-contain_dom,superfamily_SAM/pointed,smart_Ankyrin_rpt,smart_SAM,smart_PTB/PI_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_PTB/PI_dom,pfscan_SAM,prints_Ankyrin_rpt	p.I985	ENST00000360359.3	37	c.2955	CCDS4798.1	6																																																																																			-	pfam_PTB/PI_dom,smart_PTB/PI_dom,pfscan_PTB/PI_dom		0.547	ANKS1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKS1A	protein_coding	OTTHUMT00000040262.1	C	XM_166478	-		35051241	+1	no_errors	ENST00000360359	ensembl	human	known	74_37	silent	SNP	1.000	T
SDC2	6383	genome.wustl.edu	37	8	97620692	97620692	+	Silent	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr8:97620692C>T	ENST00000302190.4	+	4	1357	c.436C>T	c.(436-438)Cta>Tta	p.L146L	SDC2_ENST00000522911.1_Silent_p.L117L|SDC2_ENST00000518385.1_Silent_p.L110L|SDC2_ENST00000519914.1_Silent_p.L117L	NM_002998.3	NP_002989.2	P34741	SDC2_HUMAN	syndecan 2	146					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|dendrite morphogenesis (GO:0048813)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|regulation of dendrite morphogenesis (GO:0048814)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|wound healing (GO:0042060)	Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|lysosomal lumen (GO:0043202)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	PDZ domain binding (GO:0030165)			breast(1)|cervix(1)|large_intestine(5)|lung(4)|ovary(2)|prostate(1)|stomach(2)	16	Breast(36;3.41e-05)				Sargramostim(DB00020)	GACAGAAGTCCTAGCAGGTGA	0.478																																																	0								ENSG00000169439						81.0	81.0	81.0					8																	97620692		2203	4300	6503	SDC2	SO:0001819	synonymous_variant	0			-	HGNC	BC030133	CCDS6272.1	8q22-q23	2011-08-11	2007-02-15		ENSG00000169439	ENSG00000169439		"""Proteoglycans / Cell Surface : Syndecans"", ""CD molecules"""	10659	protein-coding gene	gene with protein product	"""syndecan proteoglycan 2"""	142460	"""heparan sulfate proteoglycan 1, cell surface-associated"""	HSPG, HSPG1		8187643	Standard	NM_002998		Approved	fibroglycan, SYND2, CD362	uc003yhv.1	P34741	OTTHUMG00000164689	ENST00000302190.4:c.436C>T	8.37:g.97620692C>T		Somatic	0	27	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	42	20.75	B3KQA3|Q6PIS6|Q9H6V1	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Syndecan/Neurexin_dom,smart_Neurexin-like	p.L146	ENST00000302190.4	37	c.436	CCDS6272.1	8																																																																																			-	pfam_Syndecan/Neurexin_dom		0.478	SDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SDC2	protein_coding	OTTHUMT00000379750.1	C	NM_002998	-		97620692	+1	no_errors	ENST00000302190	ensembl	human	known	74_37	silent	SNP	1.000	T
LAMC1	3915	genome.wustl.edu	37	1	183086567	183086567	+	Silent	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr1:183086567C>T	ENST00000258341.4	+	9	1934	c.1677C>T	c.(1675-1677)ttC>ttT	p.F559F		NM_002293.3	NP_002284.3	P11047	LAMC1_HUMAN	laminin, gamma 1 (formerly LAMB2)	559	Laminin IV type A. {ECO:0000255|PROSITE- ProRule:PRU00458}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|endoderm development (GO:0007492)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|positive regulation of epithelial cell proliferation (GO:0050679)|protein complex assembly (GO:0006461)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(27)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	76						CTCGGTACTTCATTGCTCCTG	0.507																																																	0								ENSG00000135862						132.0	111.0	118.0					1																	183086567		2203	4300	6503	LAMC1	SO:0001819	synonymous_variant	0			-	HGNC	J03202	CCDS1351.1	1q31	2013-03-01			ENSG00000135862	ENSG00000135862		"""Laminins"""	6492	protein-coding gene	gene with protein product		150290		LAMB2		3234037	Standard	NM_002293		Approved		uc001gpy.4	P11047	OTTHUMG00000035418	ENST00000258341.4:c.1677C>T	1.37:g.183086567C>T		Somatic	0	38	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	57	13.64	Q5VYE7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Laminin_N,pfam_EGF_laminin,pfam_Laminin_B_type_IV,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_B_subgr,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_N	p.F559	ENST00000258341.4	37	c.1677	CCDS1351.1	1																																																																																			-	pfam_Laminin_B_type_IV,smart_Laminin_B_subgr,pfscan_Laminin_B_type_IV		0.507	LAMC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMC1	protein_coding	OTTHUMT00000085954.2	C	NM_002293	-		183086567	+1	no_errors	ENST00000258341	ensembl	human	known	74_37	silent	SNP	1.000	T
RASL11A	387496	genome.wustl.edu	37	13	27847334	27847334	+	Silent	SNP	C	C	T	rs149565737		TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr13:27847334C>T	ENST00000241463.4	+	4	1050	c.432C>T	c.(430-432)atC>atT	p.I144I	RASL11A_ENST00000480803.1_3'UTR	NM_206827.1	NP_996563.1			RAS-like, family 11, member A											breast(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(3)|prostate(1)	10		Lung SC(185;0.0161)	Colorectal(13;0.00042)|READ - Rectum adenocarcinoma(15;0.105)	all cancers(112;0.0173)|GBM - Glioblastoma multiforme(144;0.0557)|OV - Ovarian serous cystadenocarcinoma(117;0.152)|Epithelial(112;0.164)		CTGTCATCATCGTGGGCAACA	0.532													C|||	1	0.000199681	0.0	0.0	5008	,	,		18223	0.0		0.001	False		,,,				2504	0.0																0								ENSG00000122035						92.0	74.0	80.0					13																	27847334		2203	4300	6503	RASL11A	SO:0001819	synonymous_variant	0			GMAF=0.0005	HGNC	AY439004	CCDS9321.1	13q12.2	2014-05-09			ENSG00000122035	ENSG00000122035			23802	protein-coding gene	gene with protein product		612403				15033445	Standard	NM_206827		Approved		uc001urd.1	Q6T310	OTTHUMG00000016627	ENST00000241463.4:c.432C>T	13.37:g.27847334C>T		Somatic	0	39	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	33	34.00		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Small_GTPase,pfam_MIRO-like,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.I144	ENST00000241463.4	37	c.432	CCDS9321.1	13																																																																																			-	pfam_Small_GTPase,pfam_MIRO-like,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom		0.532	RASL11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RASL11A	protein_coding	OTTHUMT00000044265.2	C	NM_206827	rs149565737		27847334	+1	no_errors	ENST00000241463	ensembl	human	known	74_37	silent	SNP	0.943	T
COL4A5	1287	genome.wustl.edu	37	X	107898618	107898618	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chrX:107898618G>A	ENST00000361603.2	+	37	3548	c.3304G>A	c.(3304-3306)Gat>Aat	p.D1102N	COL4A5_ENST00000328300.6_Missense_Mutation_p.D1102N	NM_000495.4	NP_000486.1	P29400	CO4A5_HUMAN	collagen, type IV, alpha 5	1102	Triple-helical region.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|neuromuscular junction (GO:0031594)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(32)|ovary(4)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	99						TTCTGTGGGAGATCCTGGTTT	0.478									Alport syndrome with Diffuse Leiomyomatosis																																								0								ENSG00000188153						80.0	76.0	77.0					X																	107898618		2203	4300	6503	COL4A5	SO:0001583	missense	0	Familial Cancer Database		-	HGNC	M90464	CCDS14543.1, CCDS35366.1	Xq22	2014-09-17	2008-07-28		ENSG00000188153	ENSG00000188153		"""Collagens"""	2207	protein-coding gene	gene with protein product		303630	"""Alport syndrome"""	ASLN, ATS			Standard	NM_000495		Approved		uc004enz.2	P29400	OTTHUMG00000022182	ENST00000361603.2:c.3304G>A	X.37:g.107898618G>A	ENSP00000354505:p.Asp1102Asn	Somatic	0	30	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	24	40.00	Q16006|Q16126|Q6LD84|Q7Z700|Q9NUB7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Collagen,pfam_Collagen_VI_NC,superfamily_C-type_lectin_fold,smart_Collagen_VI_NC	p.D1102N	ENST00000361603.2	37	c.3304	CCDS14543.1	X	.	.	.	.	.	.	.	.	.	.	G	7.943	0.743251	0.15642	.	.	ENSG00000188153	ENST00000328300;ENST00000361603;ENST00000508186	D;D	0.93604	-3.25;-3.25	5.52	2.75	0.32379	.	0.906441	0.09669	N	0.771433	D	0.88969	0.6582	L	0.58428	1.81	0.09310	N	0.999998	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.73572	-0.3940	10	0.16420	T	0.52	.	3.4096	0.07353	0.3713:0.1895:0.4392:0.0	.	1102;1102	E7EVY4;P29400	.;CO4A5_HUMAN	N	1102	ENSP00000331902:D1102N;ENSP00000354505:D1102N	ENSP00000331902:D1102N	D	+	1	0	COL4A5	107785274	0.995000	0.38212	0.074000	0.20217	0.564000	0.35744	1.515000	0.35845	0.606000	0.29965	0.594000	0.82650	GAT	-	pfam_Collagen		0.478	COL4A5-001	KNOWN	basic|CCDS	protein_coding	COL4A5	protein_coding	OTTHUMT00000057880.2	G		-		107898618	+1	no_errors	ENST00000328300	ensembl	human	known	74_37	missense	SNP	0.489	A
IRF6	3664	genome.wustl.edu	37	1	209961873	209961873	+	Silent	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr1:209961873G>A	ENST00000367021.3	-	9	1468	c.1296C>T	c.(1294-1296)atC>atT	p.I432I	RP3-434O14.8_ENST00000430751.1_RNA|IRF6_ENST00000542854.1_Silent_p.I337I	NM_006147.3	NP_006138.1	O14896	IRF6_HUMAN	interferon regulatory factor 6	432					cell cycle arrest (GO:0007050)|cell development (GO:0048468)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|keratinocyte differentiation (GO:0030216)|keratinocyte proliferation (GO:0043616)|mammary gland epithelial cell differentiation (GO:0060644)|negative regulation of cell proliferation (GO:0008285)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|large_intestine(4)|lung(12)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	28				OV - Ovarian serous cystadenocarcinoma(81;0.0351)		GCTGAGCAACGATGTTATCCT	0.557										HNSCC(57;0.16)																																							0								ENSG00000117595						98.0	88.0	92.0					1																	209961873		2203	4300	6503	IRF6	SO:0001819	synonymous_variant	0			-	HGNC	AL022398	CCDS1492.1, CCDS55681.1	1q32.2-q32.3	2011-02-10			ENSG00000117595	ENSG00000117595			6121	protein-coding gene	gene with protein product		607199	"""Van der Woude syndrome"""	VWS, LPS		12219090	Standard	NM_006147		Approved	OFC6, VWS1	uc001hhq.2	O14896	OTTHUMG00000036521	ENST00000367021.3:c.1296C>T	1.37:g.209961873G>A		Somatic	0	67	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	81	17.35	B4DLE2|D3DT90|F5GWX8|G0ZTL0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Interferon_reg_factor-3,pfam_Interferon_reg_fact_DNA-bd_dom,superfamily_SMAD_FHA_domain,smart_Interferon_reg_fact_DNA-bd_dom,prints_Interferon_reg_fact_DNA-bd_dom	p.I432	ENST00000367021.3	37	c.1296	CCDS1492.1	1																																																																																			-	superfamily_SMAD_FHA_domain		0.557	IRF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRF6	protein_coding	OTTHUMT00000088827.1	G	NM_006147	-		209961873	-1	no_errors	ENST00000367021	ensembl	human	known	74_37	silent	SNP	0.134	A
SORBS2	8470	genome.wustl.edu	37	4	186578613	186578613	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr4:186578613C>T	ENST00000284776.7	-	6	741	c.232G>A	c.(232-234)Gtg>Atg	p.V78M	SORBS2_ENST00000498125.1_5'Flank|SORBS2_ENST00000431808.1_Missense_Mutation_p.V78M|SORBS2_ENST00000319471.9_Missense_Mutation_p.V164M|SORBS2_ENST00000437304.2_Missense_Mutation_p.V257M|SORBS2_ENST00000418609.1_5'Flank|SORBS2_ENST00000449407.2_Missense_Mutation_p.V164M|SORBS2_ENST00000448662.2_Missense_Mutation_p.V147M|SORBS2_ENST00000393528.3_Missense_Mutation_p.V124M|SORBS2_ENST00000355634.5_Missense_Mutation_p.V178M	NM_021069.4	NP_066547.1	O94875	SRBS2_HUMAN	sorbin and SH3 domain containing 2	78	SoHo. {ECO:0000255|PROSITE- ProRule:PRU00195}.				actin filament organization (GO:0007015)|cell adhesion (GO:0007155)|cell migration (GO:0016477)	actin cytoskeleton (GO:0015629)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	cytoskeletal adaptor activity (GO:0008093)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)			endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(9)|lung(21)|ovary(2)|prostate(2)|skin(4)|urinary_tract(1)	53		all_cancers(14;4.27e-52)|all_epithelial(14;6.58e-39)|all_lung(41;1.42e-13)|Lung NSC(41;3.73e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.00692)|Hepatocellular(41;0.00826)|Renal(120;0.00994)|Prostate(90;0.0101)|all_hematologic(60;0.0174)|all_neural(102;0.244)		OV - Ovarian serous cystadenocarcinoma(60;1.54e-09)|BRCA - Breast invasive adenocarcinoma(30;0.000232)|GBM - Glioblastoma multiforme(59;0.000385)|STAD - Stomach adenocarcinoma(60;0.00109)|LUSC - Lung squamous cell carcinoma(40;0.0205)		GATTCATCCACGGGCCCGATC	0.567																																					Esophageal Squamous(153;41 2433 9491 36028)												0								ENSG00000154556						98.0	95.0	96.0					4																	186578613		2203	4300	6503	SORBS2	SO:0001583	missense	0			-	HGNC		CCDS3845.1, CCDS43289.2, CCDS47173.1, CCDS47174.1, CCDS47175.1, CCDS47176.1, CCDS54825.1, CCDS59482.1	4q35.1	2008-02-05			ENSG00000154556	ENSG00000154556			24098	protein-coding gene	gene with protein product	"""Arg/Abl interacting protein"""					9211900, 9872452	Standard	NM_021069		Approved	ARGBP2, KIAA0777	uc003iym.3	O94875	OTTHUMG00000157215	ENST00000284776.7:c.232G>A	4.37:g.186578613C>T	ENSP00000284776:p.Val78Met	Somatic	0	33	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	A6NEK9|B3KPQ7|B7Z1G5|B7Z3X6|C9JKV9|D3DP62|D3DP63|E9PAS5|E9PAW4|G3XAI0|H7BXR4|J3KNZ5|O60592|O60593|Q96EX0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SH3_domain,pfam_SH3_2,pfam_Sorb,superfamily_SH3_domain,smart_Sorb,smart_SH3_domain,pfscan_Sorb,pfscan_SH3_domain,prints_SH3_domain,prints_p67phox	p.V78M	ENST00000284776.7	37	c.232	CCDS3845.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.6|20.6	4.012035|4.012035	0.75046|0.75046	.|.	.|.	ENSG00000154556|ENSG00000154556	ENST00000438278|ENST00000284776;ENST00000448662;ENST00000431808;ENST00000437304;ENST00000319471;ENST00000449407;ENST00000355634;ENST00000393528;ENST00000319454;ENST00000445343;ENST00000439914;ENST00000444771	.|T;T;T;T;T;T;T;T;T;T;T;T	.|0.27402	.|1.67;1.67;1.67;1.67;1.67;1.67;1.67;1.67;1.67;1.67;1.67;1.67	4.88|4.88	4.88|4.88	0.63580|0.63580	.|Sorbin-like (3);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.48169|0.48169	0.1485|0.1485	L|L	0.39245|0.39245	1.2|1.2	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D;D;D;D;D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	.|D;D;D;D;D;D;D;D;D;D;D;D	.|0.97110	.|1.0;0.999;0.999;0.999;1.0;0.999;0.999;0.997;0.99;0.999;0.999;0.999	T|T	0.33803|0.33803	-0.9854|-0.9854	5|10	.|0.41790	.|T	.|0.15	-22.7382|-22.7382	18.5848|18.5848	0.91185|0.91185	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|141;124;147;124;178;78;164;257;147;124;78;124	.|B7Z3D7;G3XAI0;C9JKV9;O94875-4;B3KPQ7;O94875;E9PAS5;E9PAW4;B7Z1G5;O94875-5;O94875-3;O94875-2	.|.;.;.;.;.;SRBS2_HUMAN;.;.;.;.;.;.	H|M	21|78;147;78;257;164;164;178;124;124;78;78;78	.|ENSP00000284776:V78M;ENSP00000409158:V147M;ENSP00000411764:V78M;ENSP00000396008:V257M;ENSP00000322182:V164M;ENSP00000397262:V164M;ENSP00000347852:V178M;ENSP00000377162:V124M;ENSP00000321983:V124M;ENSP00000399048:V78M;ENSP00000408909:V78M;ENSP00000410483:V78M	.|ENSP00000284776:V78M	R|V	-|-	2|1	0|0	SORBS2|SORBS2	186815607|186815607	1.000000|1.000000	0.71417|0.71417	0.954000|0.954000	0.39281|0.39281	0.939000|0.939000	0.58152|0.58152	7.085000|7.085000	0.76875|0.76875	2.697000|2.697000	0.92050|0.92050	0.563000|0.563000	0.77884|0.77884	CGT|GTG	-	pfam_Sorb,smart_Sorb,pfscan_Sorb		0.567	SORBS2-001	KNOWN	basic|CCDS	protein_coding	SORBS2	protein_coding	OTTHUMT00000347944.3	C	NM_003603	-		186578613	-1	no_errors	ENST00000284776	ensembl	human	known	74_37	missense	SNP	1.000	T
ST6GAL2	84620	genome.wustl.edu	37	2	107460171	107460171	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr2:107460171G>A	ENST00000409382.3	-	2	873	c.263C>T	c.(262-264)tCc>tTc	p.S88F	ST6GAL2_ENST00000409087.3_Missense_Mutation_p.S88F|ST6GAL2_ENST00000361686.4_Missense_Mutation_p.S88F|AC016994.2_ENST00000425419.1_RNA	NM_001142351.1	NP_001135823.1	Q96JF0	SIAT2_HUMAN	ST6 beta-galactosamide alpha-2,6-sialyltranferase 2	88					growth (GO:0040007)|multicellular organismal development (GO:0007275)|oligosaccharide metabolic process (GO:0009311)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	beta-galactoside alpha-2,6-sialyltransferase activity (GO:0003835)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|liver(1)|lung(30)|ovary(5)|pancreas(6)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	65						CGCATGAAAGGAACCGGCTGG	0.632																																																	0								ENSG00000144057						27.0	33.0	31.0					2																	107460171		2167	4258	6425	ST6GAL2	SO:0001583	missense	0			-	HGNC	AB059555	CCDS2073.1, CCDS46380.1	2q11-q12	2008-02-05	2005-02-07	2005-02-07	ENSG00000144057	ENSG00000144057	2.4.99.2		10861	protein-coding gene	gene with protein product		608472	"""sialyltransferase 2 (monosialoganglioside sialyltransferase)"""	SIAT2			Standard	NM_032528		Approved	KIAA1877, St6gal2, St6GalII	uc002tdr.3	Q96JF0	OTTHUMG00000130923	ENST00000409382.3:c.263C>T	2.37:g.107460171G>A	ENSP00000386942:p.Ser88Phe	Somatic	0	46	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	64	17.95	D3DVK3|Q53QP4|Q86Y44|Q8IUG7|Q96HE4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Glyco_trans_29,superfamily_Glyco_hydro/deAcase_b/a-brl	p.S88F	ENST00000409382.3	37	c.263	CCDS2073.1	2	.	.	.	.	.	.	.	.	.	.	G	15.79	2.936928	0.52972	.	.	ENSG00000144057	ENST00000361686;ENST00000409382;ENST00000409087	T;T;T	0.34275	2.39;2.39;1.37	5.24	3.38	0.38709	.	1.240020	0.05282	N	0.519507	T	0.33644	0.0870	L	0.27053	0.805	0.09310	N	1	P;P	0.48503	0.911;0.641	P;B	0.44946	0.465;0.135	T	0.28713	-1.0035	10	0.54805	T	0.06	-5.564	9.5743	0.39447	0.0784:0.1435:0.7781:0.0	.	88;88	Q96JF0-2;Q96JF0	.;SIAT2_HUMAN	F	88	ENSP00000355273:S88F;ENSP00000386942:S88F;ENSP00000387332:S88F	ENSP00000355273:S88F	S	-	2	0	ST6GAL2	106826603	0.498000	0.26075	0.001000	0.08648	0.002000	0.02628	4.308000	0.59129	0.543000	0.28864	0.563000	0.77884	TCC	-	NULL		0.632	ST6GAL2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ST6GAL2	protein_coding	OTTHUMT00000330065.1	G	NM_032528	-		107460171	-1	no_errors	ENST00000361686	ensembl	human	known	74_37	missense	SNP	0.003	A
ABCB5	340273	genome.wustl.edu	37	7	20762706	20762706	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr7:20762706C>T	ENST00000404938.2	+	21	3141	c.2489C>T	c.(2488-2490)tCc>tTc	p.S830F	ABCB5_ENST00000258738.6_Missense_Mutation_p.S385F	NM_001163941.1	NP_001157413.1	Q2M3G0	ABCB5_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 5	830	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				antigen processing and presentation of endogenous peptide antigen via MHC class I via ER pathway, TAP-dependent (GO:0002485)|antigen processing and presentation of endogenous peptide antigen via MHC class Ib via ER pathway, TAP-dependent (GO:0002489)|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent (GO:0002481)|cell differentiation (GO:0030154)|compound eye corneal lens development (GO:0048058)|positive regulation of antigen processing and presentation of peptide antigen via MHC class I (GO:0002591)|regulation of membrane potential (GO:0042391)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|efflux transmembrane transporter activity (GO:0015562)			breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(11)|liver(1)|lung(37)|ovary(1)|pancreas(1)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)	77						GTTATCATTTCCTTTATATAT	0.413																																																	0								ENSG00000004846						162.0	158.0	159.0					7																	20762706		2203	4300	6503	ABCB5	SO:0001583	missense	0			-	HGNC	U66692	CCDS5371.1, CCDS55090.1, CCDS55091.1, CCDS55092.1	7p14	2012-03-14			ENSG00000004846	ENSG00000004846		"""ATP binding cassette transporters / subfamily B"""	46	protein-coding gene	gene with protein product	"""P-glycoprotein ABCB5"", ""ATP-binding cassette protein"""	611785				8894702, 12960149	Standard	NM_001163942		Approved	EST422562, ABCB5beta, ABCB5alpha	uc010kuh.3	Q2M3G0	OTTHUMG00000094789	ENST00000404938.2:c.2489C>T	7.37:g.20762706C>T	ENSP00000384881:p.Ser830Phe	Somatic	0	48	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	45	19.30	A4D131|A7BKA4|B5MD19|B7WPL1|F8QQP8|F8QQP9|J3KQ04|Q2M3I5|Q5I5Q7|Q5I5Q8|Q6KG50|Q6XFQ5|Q8IXA1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,pfam_ABC_ATPase_put,superfamily_P-loop_NTPase,superfamily_ABC1_TM_dom,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom	p.S385F	ENST00000404938.2	37	c.1154	CCDS55090.1	7	.	.	.	.	.	.	.	.	.	.	C	14.79	2.641347	0.47153	.	.	ENSG00000004846	ENST00000404938;ENST00000258738	T;T	0.80304	-1.36;-1.36	4.75	4.75	0.60458	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.103861	0.41712	D	0.000832	D	0.90504	0.7025	M	0.86420	2.815	0.50632	D	0.999885	D;D;D	0.89917	0.996;0.999;1.0	D;D;D	0.79108	0.977;0.982;0.992	D	0.91960	0.5578	10	0.87932	D	0	.	15.6473	0.77065	0.0:1.0:0.0:0.0	.	830;8;385	A7BKA4;A0ASV4;Q2M3G0	.;.;ABCB5_HUMAN	F	830;385	ENSP00000384881:S830F;ENSP00000258738:S385F	ENSP00000258738:S385F	S	+	2	0	ABCB5	20729231	1.000000	0.71417	0.707000	0.30419	0.025000	0.11179	6.241000	0.72369	2.636000	0.89361	0.655000	0.94253	TCC	-	pfam_ABC_transptr_TM_dom,superfamily_ABC1_TM_dom,pfscan_ABC1_TM_dom		0.413	ABCB5-004	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	ABCB5	protein_coding	OTTHUMT00000326736.2	C	NM_178559	-		20762706	+1	no_errors	ENST00000258738	ensembl	human	known	74_37	missense	SNP	1.000	T
FMO6P	388714	genome.wustl.edu	37	1	171118800	171118800	+	Silent	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr1:171118800C>T	ENST00000236166.3	+	5	839	c.729C>T	c.(727-729)ctC>ctT	p.L243L				O60774	FMO6_HUMAN	flavin containing monooxygenase 6 pseudogene	243						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	flavin adenine dinucleotide binding (GO:0050660)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)										CATCCTTTCTCCGGAATGTCC	0.453																																																	0								ENSG00000117507																																			FMO6P	SO:0001819	synonymous_variant	0			-	HGNC	AK130511		1q24.3	2011-08-04	2006-12-04	2006-12-04	ENSG00000117507	ENSG00000117507			24024	pseudogene	pseudogene			"""flavin containing monooxygenase 6"""	FMO6		15077013	Standard	NR_002601		Approved		uc001ghj.1	O60774	OTTHUMG00000035503	ENST00000236166.3:c.729C>T	1.37:g.171118800C>T		Somatic	0	88	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	97	14.16		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Flavin_mOase-like,pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,prints_Flavin_mOase,prints_Flavin_mOase_3,prints_Flavin_mOase_1	p.L243	ENST00000236166.3	37	c.729		1																																																																																			-	pfam_Flavin_mOase-like,pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD		0.453	FMO6P-003	NOVEL	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	FMO6P	protein_coding	OTTHUMT00000385941.4	C	XM_371326	-		171118800	+1	no_errors	ENST00000236166	ensembl	human	novel	74_37	silent	SNP	0.368	T
OR14K1	343170	genome.wustl.edu	37	1	247902365	247902365	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr1:247902365G>A	ENST00000283225.2	+	1	449	c.449G>A	c.(448-450)aGa>aAa	p.R150K	RP11-634B7.4_ENST00000449298.1_RNA			Q8NGZ2	O14K1_HUMAN	olfactory receptor, family 14, subfamily K, member 1	150						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R150I(2)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|lung(18)|ovary(1)|urinary_tract(1)	27						TGGCTCAACAGAGGGGCCTTG	0.527																																																	2	Substitution - Missense(2)	lung(2)						ENSG00000153230						85.0	90.0	88.0					1																	247902365		2127	4251	6378	OR14K1	SO:0001583	missense	0			-	HGNC	BK004377		1q44	2012-08-09	2008-04-02	2008-04-02	ENSG00000153230	ENSG00000153230		"""GPCR / Class A : Olfactory receptors"""	15025	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily AY, member 1"""	OR5AY1			Standard	NG_007559		Approved			Q8NGZ2	OTTHUMG00000040211	ENST00000283225.2:c.449G>A	1.37:g.247902365G>A	ENSP00000283225:p.Arg150Lys	Somatic	0	31	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	30	14.29	A8MPV5|Q6IF85|Q96R53	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.R150K	ENST00000283225.2	37	c.449		1	.	.	.	.	.	.	.	.	.	.	G	12.45	1.942711	0.34283	.	.	ENSG00000153230	ENST00000283225	T	0.37058	1.22	3.81	2.89	0.33648	.	0.183568	0.25299	U	0.031679	T	0.35770	0.0943	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.25082	-1.0142	7	0.87932	D	0	.	5.7451	0.18116	0.1058:0.0:0.7036:0.1906	.	.	.	.	K	150	ENSP00000283225:R150K	ENSP00000283225:R150K	R	+	2	0	OR14K1	245968988	0.000000	0.05858	0.001000	0.08648	0.016000	0.09150	-0.773000	0.04689	0.773000	0.33404	0.543000	0.68304	AGA	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.527	OR14K1-001	KNOWN	basic|appris_principal	protein_coding	OR14K1	protein_coding	OTTHUMT00000096868.1	G	NM_001004732	-		247902365	+1	no_errors	ENST00000283225	ensembl	human	known	74_37	missense	SNP	0.003	A
GABRA6	2559	genome.wustl.edu	37	5	161118974	161118974	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr5:161118974C>T	ENST00000274545.5	+	8	1287	c.854C>T	c.(853-855)aCt>aTt	p.T285I	GABRA6_ENST00000523217.1_Missense_Mutation_p.T275I|RP11-348M17.2_ENST00000521984.1_RNA			Q16445	GBRA6_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 6	285					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			breast(1)|central_nervous_system(2)|endometrium(6)|large_intestine(9)|liver(2)|lung(22)|ovary(7)|skin(6)|urinary_tract(2)	57	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Acamprosate(DB00659)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)	ACTATGACCACTTTGAGCATC	0.403										TCGA Ovarian(5;0.080)																																							0								ENSG00000145863						133.0	126.0	128.0					5																	161118974		2203	4300	6503	GABRA6	SO:0001583	missense	0			-	HGNC		CCDS4356.1	5q34	2012-06-22			ENSG00000145863	ENSG00000145863		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4080	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 6"""	137143				8020978	Standard	NM_000811		Approved		uc003lyu.2	Q16445	OTTHUMG00000130351	ENST00000274545.5:c.854C>T	5.37:g.161118974C>T	ENSP00000274545:p.Thr285Ile	Somatic	0	39	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	45	19.64	A8K096|Q4VAV2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABAAa_rcpt,prints_GABAA_rcpt,prints_GABBAa6_rcpt,prints_Neur_channel,prints_GABBAg_rcpt,tigrfam_Neur_channel	p.T285I	ENST00000274545.5	37	c.854	CCDS4356.1	5	.	.	.	.	.	.	.	.	.	.	C	25.5	4.647968	0.87958	.	.	ENSG00000145863	ENST00000274545;ENST00000523217	D;D	0.85339	-1.97;-1.97	5.32	5.32	0.75619	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.046562	0.85682	D	0.000000	D	0.94978	0.8375	H	0.95402	3.665	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	D	0.96308	0.9226	10	0.87932	D	0	.	18.9984	0.92822	0.0:1.0:0.0:0.0	.	285	Q16445	GBRA6_HUMAN	I	285;275	ENSP00000274545:T285I;ENSP00000430527:T275I	ENSP00000274545:T285I	T	+	2	0	GABRA6	161051552	1.000000	0.71417	0.916000	0.36221	0.936000	0.57629	7.726000	0.84824	2.468000	0.83385	0.650000	0.86243	ACT	-	pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM,prints_GABAA_rcpt,tigrfam_Neur_channel		0.403	GABRA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABRA6	protein_coding	OTTHUMT00000252707.2	C		-		161118974	+1	no_errors	ENST00000274545	ensembl	human	known	74_37	missense	SNP	1.000	T
SCP2D1	140856	genome.wustl.edu	37	20	18794541	18794541	+	Missense_Mutation	SNP	G	G	A	rs575292008		TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr20:18794541G>A	ENST00000377428.2	+	1	172	c.82G>A	c.(82-84)Gtt>Att	p.V28I	C20orf78_ENST00000463425.1_5'Flank|C20orf78_ENST00000278779.4_Intron	NM_178483.2	NP_848578.1	Q9UJQ7	SCP2D_HUMAN	SCP2 sterol-binding domain containing 1	28																	TCTGGGTTCAGTTCCAGAACC	0.517																																																	0								ENSG00000132631						90.0	85.0	86.0					20																	18794541		2203	4300	6503	SCP2D1	SO:0001583	missense	0			-	HGNC	AL035563	CCDS13139.1	20p11.23	2012-10-29	2012-10-29	2012-10-29	ENSG00000132631	ENSG00000132631			16211	protein-coding gene	gene with protein product	"""sterol carrier protein 2-like protein"""		"""chromosome 20 open reading frame 79"""	C20orf79		16501878	Standard	NM_178483		Approved	dJ1068E13.2, HSD22	uc002wrk.3	Q9UJQ7	OTTHUMG00000031983	ENST00000377428.2:c.82G>A	20.37:g.18794541G>A	ENSP00000366645:p.Val28Ile	Somatic	0	39	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	50	12.28	Q548A4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SCP2_sterol-bd_dom,superfamily_SCP2_sterol-bd_dom	p.V28I	ENST00000377428.2	37	c.82	CCDS13139.1	20	.	.	.	.	.	.	.	.	.	.	G	3.460	-0.110186	0.06924	.	.	ENSG00000132631	ENST00000377428	T	0.22539	1.95	5.85	4.89	0.63831	.	0.317484	0.27031	N	0.021262	T	0.13114	0.0318	N	0.14661	0.345	0.09310	N	1	B	0.12013	0.005	B	0.12156	0.007	T	0.18116	-1.0347	10	0.33141	T	0.24	-4.1328	12.1954	0.54294	0.0:0.0:0.8294:0.1706	.	28	Q9UJQ7	CT079_HUMAN	I	28	ENSP00000366645:V28I	ENSP00000366645:V28I	V	+	1	0	C20orf79	18742541	0.184000	0.23200	0.018000	0.16275	0.074000	0.17049	1.910000	0.39927	1.441000	0.47550	0.467000	0.42956	GTT	-	NULL		0.517	SCP2D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCP2D1	protein_coding	OTTHUMT00000078193.1	G	NM_178483	-		18794541	+1	no_errors	ENST00000377428	ensembl	human	known	74_37	missense	SNP	0.075	A
PRAM1	84106	genome.wustl.edu	37	19	8563136	8563136	+	Silent	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr19:8563136G>A	ENST00000423345.4	-	3	1990	c.1470C>T	c.(1468-1470)ttC>ttT	p.F490F	PRAM1_ENST00000255612.3_Silent_p.F490F			Q96QH2	PRAM_HUMAN	PML-RARA regulated adaptor molecule 1	538	Pro-rich.				integrin-mediated signaling pathway (GO:0007229)|regulation of neutrophil degranulation (GO:0043313)		lipid binding (GO:0008289)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(5)|prostate(1)|skin(1)	19						GTCGGTCCTGGAAGTGGAGCC	0.667																																																	0								ENSG00000133246						27.0	30.0	29.0					19																	8563136		2011	4164	6175	PRAM1	SO:0001819	synonymous_variant	0			-	HGNC	BC028012	CCDS45954.1, CCDS45954.2	19p13.2	2009-01-21				ENSG00000133246			30091	protein-coding gene	gene with protein product		606466				11301322, 15572693	Standard	NM_032152		Approved	PML-RAR	uc002mkd.3	Q96QH2		ENST00000423345.4:c.1470C>T	19.37:g.8563136G>A		Somatic	0	125	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	116	17.14	Q8N6W7	Silent	SNP	NA	NA	NA	NA	NA	NA	superfamily_SH3_domain	p.F490	ENST00000423345.4	37	c.1470	CCDS45954.2	19																																																																																			-	NULL		0.667	PRAM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PRAM1	protein_coding	OTTHUMT00000397040.3	G	NM_032152	-		8563136	-1	no_errors	ENST00000423345	ensembl	human	known	74_37	silent	SNP	0.037	A
KRT86	3892	genome.wustl.edu	37	12	52702068	52702068	+	Intron	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr12:52702068C>T	ENST00000423955.2	+	10	1457				KRT86_ENST00000293525.5_Intron|RP11-845M18.6_ENST00000552441.1_RNA|KRT86_ENST00000544024.1_Intron			O43790	KRT86_HUMAN	keratin 86							extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			breast(1)|cervix(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	10				BRCA - Breast invasive adenocarcinoma(357;0.189)		GGGGTCCGTCCCCTCCTCCCG	0.701																																																	0								ENSG00000257829						38.0	44.0	42.0					12																	52702068		2016	4179	6195	RP11-845M18.6	SO:0001627	intron_variant	0			-	Clone_based_vega_gene	X99142	CCDS41785.1	12q13	2013-01-16	2006-07-17	2006-07-17		ENSG00000170442		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6463	protein-coding gene	gene with protein product	"""hard keratin type II 6"""	601928	"""keratin, hair, basic, 6 (monilethrix)"""	KRTHB6		9241275, 16831889	Standard	NM_002284		Approved	MNX, Hb6	uc001sad.3	O43790		ENST00000423955.2:c.1279+20C>T	12.37:g.52702068C>T		Somatic	1	151	0.65		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	33	176	15.79	P78387	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000423955.2	37	NULL	CCDS41785.1	12																																																																																			-	-		0.701	KRT86-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000257829	protein_coding	OTTHUMT00000404911.1	C	NM_002284	-		52702068	-1	no_errors	ENST00000552441	ensembl	human	known	74_37	rna	SNP	0.069	T
OBSCN	84033	genome.wustl.edu	37	1	228547866	228547866	+	Intron	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr1:228547866G>A	ENST00000422127.1	+	80	18705				OBSCN_ENST00000366709.4_Missense_Mutation_p.E3544K|OBSCN_ENST00000366707.4_Intron|OBSCN_ENST00000284548.11_Missense_Mutation_p.E6425K|OBSCN_ENST00000570156.2_Intron	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF						apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				GGGCACCATGGAGGAGGCGGG	0.642																																																	0								ENSG00000154358						43.0	54.0	50.0					1																	228547866		2162	4269	6431	OBSCN	SO:0001627	intron_variant	0			-	HGNC	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.18662-2411G>A	1.37:g.228547866G>A		Somatic	0	22	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	27	25.00	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,pfam_DH-domain,pfam_Fibronectin_type3,pfam_IQ_motif_EF-hand-BS,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_IQ_motif_EF-hand-BS,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Fibronectin_type3,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_Ig-like_dom,pfscan_DH-domain	p.E3544K	ENST00000422127.1	37	c.10630	CCDS58065.1	1	.	.	.	.	.	.	.	.	.	.	G	11.75	1.733217	0.30684	.	.	ENSG00000154358	ENST00000284548;ENST00000366709	T;T	0.56444	0.46;0.61	4.1	3.19	0.36642	.	.	.	.	.	T	0.31702	0.0805	N	0.21448	0.665	0.09310	N	1	P	0.38335	0.627	B	0.34652	0.187	T	0.09037	-1.0693	9	0.07813	T	0.8	.	9.1993	0.37249	0.0856:0.2191:0.6952:0.0	.	6425	Q5VST9-3	.	K	6425;3544	ENSP00000284548:E6425K;ENSP00000355670:E3544K	ENSP00000284548:E6425K	E	+	1	0	OBSCN	226614489	0.001000	0.12720	0.046000	0.18839	0.056000	0.15407	0.678000	0.25277	0.945000	0.37605	0.411000	0.27672	GAG	-	NULL		0.642	OBSCN-204	KNOWN	basic|CCDS	protein_coding	OBSCN	protein_coding		G	NM_052843	-		228547866	+1	no_errors	ENST00000366709	ensembl	human	known	74_37	missense	SNP	0.012	A
KEL	3792	genome.wustl.edu	37	7	142636666	142636666	+	IGR	SNP	C	C	T	rs200663678		TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr7:142636666C>T	ENST00000355265.2	-	0	2812				C7orf34_ENST00000409607.3_Missense_Mutation_p.S8F	NM_000420.2	NP_000411.1	P23276	KELL_HUMAN	Kell blood group, metallo-endopeptidase						vasoconstriction (GO:0042310)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(11)|lung(34)|ovary(3)|prostate(2)|skin(1)	60	Melanoma(164;0.059)					GTGCACGGATCCTGCTGGGCA	0.627																																																	0								ENSG00000165131	C	PHE/SER	5,1379		0,5,687	42.0	50.0	48.0		23	-1.4	0.0	7		48	0,3182		0,0,1591	yes	missense	C7orf34	NM_178829.4	155	0,5,2278	TT,TC,CC		0.0,0.3613,0.1095		8/148	142636666	5,4561	692	1591	2283	C7orf34	SO:0001628	intergenic_variant	0			-	HGNC	BC003135	CCDS34766.1	7q33	2014-07-19	2006-10-10		ENSG00000197993	ENSG00000197993		"""CD molecules"", ""Blood group antigens"""	6308	protein-coding gene	gene with protein product		613883	"""Kell blood group"", ""Kell blood group, metalloendopeptidase"""			1712490, 7683930	Standard	NM_000420		Approved	ECE3, CD238	uc003wcb.3	P23276	OTTHUMG00000157159		7.37:g.142636666C>T		Somatic	0	25	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	17	29.17	B2RBV4|Q96RS8|Q99885	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.S8F	ENST00000355265.2	37	c.23	CCDS34766.1	7	.	.	.	.	.	.	.	.	.	.	c	10.39	1.338103	0.24253	0.003613	0.0	ENSG00000165131	ENST00000409607	.	.	.	3.66	-1.38	0.09027	.	.	.	.	.	T	0.39835	0.1093	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.43393	-0.9394	5	0.62326	D	0.03	.	8.2631	0.31797	0.0:0.329:0.5656:0.1055	.	.	.	.	F	8	.	ENSP00000386450:S8F	S	+	2	0	C7orf34	142346788	0.766000	0.28496	0.000000	0.03702	0.038000	0.13279	0.711000	0.25764	-0.271000	0.09272	-0.280000	0.10049	TCC	-	NULL		0.627	KEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C7orf34	protein_coding	OTTHUMT00000347671.2	C	NM_000420	rs200663678		142636666	+1	no_errors	ENST00000409607	ensembl	human	known	74_37	missense	SNP	0.000	T
HVCN1	84329	genome.wustl.edu	37	12	111087228	111087228	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr12:111087228C>T	ENST00000356742.5	-	7	1562	c.809G>A	c.(808-810)gGt>gAt	p.G270D	TCTN1_ENST00000551590.1_3'UTR|HVCN1_ENST00000439744.2_Missense_Mutation_p.G250D|HVCN1_ENST00000548312.1_Intron|HVCN1_ENST00000242607.8_Missense_Mutation_p.G270D			Q96D96	HVCN1_HUMAN	hydrogen voltage-gated channel 1	270					cellular response to pH (GO:0071467)|cellular response to zinc ion (GO:0071294)|multicellular organism reproduction (GO:0032504)|proton transport (GO:0015992)|response to pH (GO:0009268)|response to zinc ion (GO:0010043)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	voltage-gated cation channel activity (GO:0022843)|voltage-gated proton channel activity (GO:0030171)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(6)|prostate(1)|skin(1)	19						GTTCACTTCACCAAGAAGTCC	0.493																																																	0								ENSG00000122986						88.0	69.0	76.0					12																	111087228		2203	4300	6503	HVCN1	SO:0001583	missense	0			-	HGNC	BC007277	CCDS31900.1, CCDS58278.1	12q24.11	2011-12-09	2006-03-24	2006-03-24	ENSG00000122986	ENSG00000122986		"""Voltage-gated ion channels / Hydrogen voltage-gated channel"""	28240	protein-coding gene	gene with protein product	"""voltage sensor domain-only protein"""	611227				20961760, 16556803, 18356202, 22020278	Standard	NM_032369		Approved	MGC15619, Hv1, VSOP	uc001trs.2	Q96D96		ENST00000356742.5:c.809G>A	12.37:g.111087228C>T	ENSP00000349181:p.Gly270Asp	Somatic	0	91	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	83	14.43	A8MQ37|B4DEB3|F8WCH5|Q6UW11|Q96IS5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom	p.G270D	ENST00000356742.5	37	c.809	CCDS31900.1	12	.	.	.	.	.	.	.	.	.	.	C	10.91	1.484772	0.26598	.	.	ENSG00000122986	ENST00000242607;ENST00000356742;ENST00000439744	T;T;T	0.45668	0.89;0.89;0.93	5.76	3.68	0.42216	.	0.547448	0.21181	N	0.078803	T	0.20941	0.0504	N	0.08118	0	0.09310	N	1	B	0.24258	0.1	B	0.18561	0.022	T	0.11842	-1.0571	10	0.36615	T	0.2	-11.4303	8.4508	0.32869	0.0:0.77:0.0:0.23	.	270	Q96D96	HVCN1_HUMAN	D	270;270;250	ENSP00000242607:G270D;ENSP00000349181:G270D;ENSP00000412052:G250D	ENSP00000242607:G270D	G	-	2	0	HVCN1	109571611	0.000000	0.05858	0.029000	0.17559	0.494000	0.33585	0.364000	0.20325	1.412000	0.46977	0.561000	0.74099	GGT	-	NULL		0.493	HVCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HVCN1	protein_coding	OTTHUMT00000404653.1	C	NM_032369	-		111087228	-1	no_errors	ENST00000242607	ensembl	human	known	74_37	missense	SNP	0.002	T
IGSF22	283284	genome.wustl.edu	37	11	18731163	18731163	+	Nonsense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr11:18731163C>T	ENST00000513874.1	-	18	2908	c.2769G>A	c.(2767-2769)tgG>tgA	p.W923*	RP11-1081L13.4_ENST00000527285.1_RNA	NM_173588.3	NP_775859	Q8N9C0	IGS22_HUMAN	immunoglobulin superfamily, member 22	822										NS(2)|autonomic_ganglia(1)|breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(20)|ovary(4)|prostate(4)|skin(3)	56						CAGGCTCCCGCCAGGCCAGGG	0.577																																																	0								ENSG00000179057						45.0	48.0	48.0					11																	18731163		1930	4131	6061	IGSF22	SO:0001587	stop_gained	0			-	HGNC	AK095113	CCDS41625.1, CCDS41625.2	11p15.1	2014-06-06			ENSG00000179057	ENSG00000179057		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	26750	protein-coding gene	gene with protein product							Standard	NM_173588		Approved	FLJ37794	uc009yht.2	Q8N9C0	OTTHUMG00000160502	ENST00000513874.1:c.2769G>A	11.37:g.18731163C>T	ENSP00000421191:p.Trp923*	Somatic	0	25	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	36	12.20	A6NNA0|D6RGV7	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.W923*	ENST00000513874.1	37	c.2769	CCDS41625.2	11	.	.	.	.	.	.	.	.	.	.	C	41	8.580188	0.98872	.	.	ENSG00000179057	ENST00000513874	.	.	.	4.58	2.67	0.31697	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	6.3447	0.21343	0.0:0.6807:0.1512:0.168	.	.	.	.	X	923	.	ENSP00000322422:W822X	W	-	3	0	IGSF22	18687739	1.000000	0.71417	0.979000	0.43373	0.998000	0.95712	3.407000	0.52644	0.540000	0.28808	0.655000	0.94253	TGG	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.577	IGSF22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGSF22	protein_coding	OTTHUMT00000360850.2	C	NM_173588	-		18731163	-1	no_errors	ENST00000513874	ensembl	human	known	74_37	nonsense	SNP	0.996	T
SLN	6588	genome.wustl.edu	37	11	107578584	107578584	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr11:107578584G>A	ENST00000531293.1	-	3	425	c.73C>T	c.(73-75)Ctt>Ttt	p.L25F	SLN_ENST00000525934.1_Missense_Mutation_p.L25F|SLN_ENST00000305991.2_Missense_Mutation_p.L25F			O00631	SARCO_HUMAN	sarcolipin	25					calcium ion transport (GO:0006816)|negative regulation of calcium ion binding (GO:1901877)|negative regulation of calcium ion import (GO:0090281)|negative regulation of calcium ion transmembrane transporter activity (GO:1901020)|negative regulation of catalytic activity (GO:0043086)|negative regulation of protein complex disassembly (GO:0043242)|positive regulation of protein depolymerization (GO:1901881)|regulation of calcium ion transport (GO:0051924)|regulation of calcium-transporting ATPase activity (GO:1901894)|regulation of relaxation of muscle (GO:1901077)|sarcoplasmic reticulum calcium ion transport (GO:0070296)	integral component of membrane (GO:0016021)|sarcoplasmic reticulum (GO:0016529)	ATPase binding (GO:0051117)|enzyme inhibitor activity (GO:0004857)			large_intestine(1)|lung(1)	2		Melanoma(852;1.46e-05)|all_epithelial(67;1.72e-05)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Breast(348;0.0258)|all_neural(303;0.164)		BRCA - Breast invasive adenocarcinoma(274;2.71e-05)|Epithelial(105;0.000112)|all cancers(92;0.00219)		GACCTCACAAGGAGCCACATA	0.517																																																	0								ENSG00000170290						124.0	122.0	123.0					11																	107578584		2201	4298	6499	SLN	SO:0001583	missense	0			-	HGNC	U96094	CCDS31667.1	11q22.3	2014-04-11			ENSG00000170290	ENSG00000170290			11089	protein-coding gene	gene with protein product		602203				9367679	Standard	NM_003063		Approved	MGC12301, MGC125854, MGC125855	uc001pjp.3	O00631	OTTHUMG00000166364	ENST00000531293.1:c.73C>T	11.37:g.107578584G>A	ENSP00000435380:p.Leu25Phe	Somatic	0	37	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	37	13.95	Q6ICV3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Sarcolipin	p.L25F	ENST00000531293.1	37	c.73	CCDS31667.1	11	.	.	.	.	.	.	.	.	.	.	G	13.68	2.308427	0.40895	.	.	ENSG00000170290	ENST00000531293;ENST00000305991;ENST00000525934	.	.	.	5.66	3.78	0.43462	.	0.000000	0.35615	N	0.003086	T	0.63721	0.2535	.	.	.	0.31486	N	0.666536	D	0.69078	0.997	D	0.81914	0.995	T	0.68405	-0.5417	8	0.87932	D	0	.	7.6793	0.28505	0.1843:0.0:0.8157:0.0	.	25	O00631	SARCO_HUMAN	F	25	.	ENSP00000304707:L25F	L	-	1	0	SLN	107083794	1.000000	0.71417	0.996000	0.52242	0.806000	0.45545	3.100000	0.50275	1.392000	0.46585	0.650000	0.86243	CTT	-	pfam_Sarcolipin		0.517	SLN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLN	protein_coding	OTTHUMT00000389414.1	G	NM_003063	-		107578584	-1	no_errors	ENST00000305991	ensembl	human	known	74_37	missense	SNP	0.996	A
SCN10A	6336	genome.wustl.edu	37	3	38783839	38783839	+	Silent	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr3:38783839G>A	ENST00000449082.2	-	13	2048	c.2049C>T	c.(2047-2049)gcC>gcT	p.A683A		NM_006514.2	NP_006505.2	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha subunit	683					AV node cell to bundle of His cell communication (GO:0086067)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of cardiac muscle contraction (GO:0055117)|regulation of heart rate (GO:0002027)|regulation of ion transmembrane transport (GO:0034765)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(5)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(14)|kidney(5)|large_intestine(33)|lung(54)|ovary(5)|pancreas(1)|prostate(5)|skin(13)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	150				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cinchocaine(DB00527)|Cocaine(DB00907)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Lacosamide(DB06218)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Orphenadrine(DB01173)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)|Valproic Acid(DB00313)	GGTGCTCCATGGCCATGAAGA	0.557																																																	0								ENSG00000185313						131.0	102.0	112.0					3																	38783839		2203	4300	6503	SCN10A	SO:0001819	synonymous_variant	0			-	HGNC	AF117907	CCDS33736.1	3p22.2	2012-02-26	2007-01-23		ENSG00000185313	ENSG00000185313		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10582	protein-coding gene	gene with protein product		604427	"""sodium channel, voltage-gated, type X, alpha polypeptide"""			9839820, 10198179, 16382098	Standard	NM_006514		Approved	Nav1.8, hPN3, SNS, PN3	uc003ciq.3	Q9Y5Y9	OTTHUMG00000048245	ENST00000449082.2:c.2049C>T	3.37:g.38783839G>A		Somatic	0	32	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	29	17.14	A6NDQ1	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_PKD1_2_channel,prints_Na_channel_asu,prints_PKD_2	p.A683	ENST00000449082.2	37	c.2049	CCDS33736.1	3																																																																																			-	NULL		0.557	SCN10A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	SCN10A	protein_coding	OTTHUMT00000109745.3	G	NM_006514	-		38783839	-1	no_errors	ENST00000449082	ensembl	human	known	74_37	silent	SNP	1.000	A
ELN	2006	genome.wustl.edu	37	7	73470692	73470692	+	Silent	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr7:73470692C>T	ENST00000252034.7	+	20	1641	c.1242C>T	c.(1240-1242)atC>atT	p.I414I	ELN_ENST00000320492.7_Intron|ELN_ENST00000445912.1_Silent_p.I414I|ELN_ENST00000358929.4_Silent_p.I414I|ELN_ENST00000380553.4_Silent_p.I297I|ELN_ENST00000357036.5_Silent_p.I419I|ELN_ENST00000380584.4_Silent_p.I400I|ELN_ENST00000458204.1_Silent_p.I404I|ELN_ENST00000429192.1_Silent_p.I419I|ELN_ENST00000414324.1_Silent_p.I409I|ELN_ENST00000466878.1_3'UTR|ELN_ENST00000380575.4_Silent_p.I404I|ELN_ENST00000380562.4_Silent_p.I414I|ELN_ENST00000320399.6_Silent_p.I414I|ELN_ENST00000380576.5_Silent_p.I414I	NM_000501.2|NM_001278915.1	NP_000492.2|NP_001265844.1	P15502	ELN_HUMAN	elastin	0	Ala-rich.				blood circulation (GO:0008015)|blood vessel remodeling (GO:0001974)|cell proliferation (GO:0008283)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|organ morphogenesis (GO:0009887)|regulation of actin filament polymerization (GO:0030833)|respiratory gaseous exchange (GO:0007585)|skeletal muscle tissue development (GO:0007519)|stress fiber assembly (GO:0043149)	elastic fiber (GO:0071953)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix binding (GO:0050840)|extracellular matrix constituent conferring elasticity (GO:0030023)|extracellular matrix structural constituent (GO:0005201)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(10)|ovary(4)|pancreas(2)|prostate(1)|skin(2)|stomach(1)	32		Lung NSC(55;0.159)				TCGGAGGTATCCCTGGAGTCG	0.637			T	PAX5	B-ALL		"""Supravalvular Aortic Stenosis, Cutis laxa , Williams-Beuren Syndrome"""																																	Dom	yes		7	7q11.23	2006	elastin	yes	L	0								ENSG00000049540						114.0	116.0	115.0					7																	73470692		2203	4300	6503	ELN	SO:0001819	synonymous_variant	0			-	HGNC		CCDS5562.2, CCDS43598.1, CCDS43599.1, CCDS47611.1, CCDS47612.1, CCDS64673.1, CCDS64674.1, CCDS64675.1, CCDS64676.1, CCDS64677.1, CCDS64678.1, CCDS75616.1, CCDS75617.1	7q11.1-q21.1	2008-08-01	2008-08-01		ENSG00000049540	ENSG00000049540			3327	protein-coding gene	gene with protein product	"""tropoelastin"", ""supravalvular aortic stenosis"", ""Williams-Beuren syndrome"""	130160				8096434	Standard	NM_001278939		Approved	WBS, WS, SVAS	uc003tzn.3	P15502	OTTHUMG00000150229	ENST00000252034.7:c.1242C>T	7.37:g.73470692C>T		Somatic	0	110	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	101	12.17	B3KTS6|O15336|O15337|Q14233|Q14234|Q14235|Q14238|Q6P0L4|Q6ZWJ6|Q75MU5|Q7Z316|Q7Z3F5|Q9UMF5	Silent	SNP	NA	NA	NA	NA	NA	NA	prints_Tropoelastin	p.I414	ENST00000252034.7	37	c.1242	CCDS5562.2	7																																																																																			-	NULL		0.637	ELN-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ELN	protein_coding	OTTHUMT00000316913.1	C	NM_000501	-		73470692	+1	no_errors	ENST00000358929	ensembl	human	known	74_37	silent	SNP	0.009	T
GVINP1	387751	genome.wustl.edu	37	11	6738447	6738447	+	RNA	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr11:6738447G>A	ENST00000526769.3	-	0	4757					NR_003945.1		Q7Z2Y8	GVIN1_HUMAN	GTPase, very large interferon inducible pseudogene 1							cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)										CCTATCCTTGGATTTGTTGCT	0.453																																																	0								ENSG00000254838																																			GVINP1			0			-	HGNC	BX538318		11p15.4	2014-03-18	2010-09-28	2010-09-28	ENSG00000254838	ENSG00000254838			25813	pseudogene	pseudogene	"""very large inducible GTPase 1"""		"""GTPase, very large interferon inducible 1"", ""GTPase, very large interferon inducible 1, pseudogene"""	GVIN1, GVIN1P		12874213, 19369598	Standard	NR_003945		Approved	VLIG-1, FLJ13373, VLIG1	uc001meo.4	Q7Z2Y8	OTTHUMG00000165506		11.37:g.6738447G>A		Somatic	0	14	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	38	17.39	A6NFL2|Q9H8N5	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000526769.3	37	NULL		11																																																																																			-	-		0.453	GVINP1-002	KNOWN	basic|exp_conf	processed_transcript	GVINP1	pseudogene	OTTHUMT00000386960.3	G	NR_003945	-		6738447	-1	no_errors	ENST00000526769	ensembl	human	known	74_37	rna	SNP	0.999	A
TARSL2	123283	genome.wustl.edu	37	15	102215839	102215839	+	Silent	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr15:102215839G>A	ENST00000335968.3	-	13	1968	c.1752C>T	c.(1750-1752)ttC>ttT	p.F584F		NM_152334.2	NP_689547.2	A2RTX5	SYTC2_HUMAN	threonyl-tRNA synthetase-like 2	584					threonyl-tRNA aminoacylation (GO:0006435)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|threonine-tRNA ligase activity (GO:0004829)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(14)|ovary(2)|skin(1)|urinary_tract(1)	29	Lung NSC(78;0.000991)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000268)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			TCTCTCCTAGGAAGTTTTCCG	0.423																																																	0								ENSG00000185418						150.0	143.0	146.0					15																	102215839		2203	4300	6503	TARSL2	SO:0001819	synonymous_variant	0			-	HGNC	AL833188	CCDS10394.1	15q26.3	2008-02-05			ENSG00000185418	ENSG00000185418			24728	protein-coding gene	gene with protein product							Standard	NM_152334		Approved	FLJ25005	uc002bxm.3	A2RTX5	OTTHUMG00000149869	ENST00000335968.3:c.1752C>T	15.37:g.102215839G>A		Somatic	0	57	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	98	10.91	B2RMP7|Q6B0A1|Q6IS76|Q96LW3|Q96MP4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_aa-tRNA-synt_IIb_cons-dom,pfam_Anticodon-bd,pfam_TGS,pfam_tRNA_SAD,superfamily_Thr/Ala-tRNA-synth_IIc_edit,superfamily_Anticodon-bd,superfamily_TGS-like,smart_tRNA_SAD,pfscan_aa-tRNA-synth_II,prints_Thr-tRNA-ligase_IIa,tigrfam_Thr-tRNA-ligase_IIa	p.F584	ENST00000335968.3	37	c.1752	CCDS10394.1	15																																																																																			-	pfam_aa-tRNA-synt_IIb_cons-dom,pfscan_aa-tRNA-synth_II,tigrfam_Thr-tRNA-ligase_IIa		0.423	TARSL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TARSL2	protein_coding	OTTHUMT00000313619.3	G	NM_152334	-		102215839	-1	no_errors	ENST00000335968	ensembl	human	known	74_37	silent	SNP	1.000	A
OR5K4	403278	genome.wustl.edu	37	3	98072975	98072975	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr3:98072975C>T	ENST00000354924.2	+	1	278	c.278C>T	c.(277-279)tCc>tTc	p.S93F	RP11-325B23.2_ENST00000508616.1_lincRNA	NM_001005517.1	NP_001005517.1	A6NMS3	OR5K4_HUMAN	olfactory receptor, family 5, subfamily K, member 4	93						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(13)|upper_aerodigestive_tract(1)	21						AGAATTATTTCCCTGTATGAA	0.433																																																	0								ENSG00000196098						233.0	243.0	240.0					3																	98072975		2203	4300	6503	OR5K4	SO:0001583	missense	0			-	HGNC		CCDS33802.1	3q11.2	2013-09-23			ENSG00000196098	ENSG00000196098		"""GPCR / Class A : Olfactory receptors"""	31291	protein-coding gene	gene with protein product							Standard	NM_001005517		Approved		uc011bgv.2	A6NMS3	OTTHUMG00000160081	ENST00000354924.2:c.278C>T	3.37:g.98072975C>T	ENSP00000347003:p.Ser93Phe	Somatic	0	47	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	60	20.00		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S93F	ENST00000354924.2	37	c.278	CCDS33802.1	3	.	.	.	.	.	.	.	.	.	.	C	16.18	3.048956	0.55110	.	.	ENSG00000196098	ENST00000354924	T	0.00745	5.75	4.77	4.77	0.60923	GPCR, rhodopsin-like superfamily (1);	0.000000	0.32430	U	0.006117	T	0.07143	0.0181	H	0.94183	3.505	0.49051	D	0.999745	D	0.76494	0.999	D	0.69824	0.966	T	0.00521	-1.1691	10	0.87932	D	0	-34.1048	15.6545	0.77124	0.0:1.0:0.0:0.0	.	93	A6NMS3	OR5K4_HUMAN	F	93	ENSP00000347003:S93F	ENSP00000347003:S93F	S	+	2	0	OR5K4	99555665	0.764000	0.28473	1.000000	0.80357	0.269000	0.26545	3.357000	0.52277	2.618000	0.88619	0.603000	0.83216	TCC	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt		0.433	OR5K4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5K4	protein_coding	OTTHUMT00000359114.1	C		-		98072975	+1	no_errors	ENST00000354924	ensembl	human	known	74_37	missense	SNP	1.000	T
LRIG2	9860	genome.wustl.edu	37	1	113662088	113662088	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr1:113662088C>T	ENST00000361127.5	+	17	3112	c.2914C>T	c.(2914-2916)Ccc>Tcc	p.P972S	LRIG2_ENST00000492207.1_3'UTR	NM_014813.1	NP_055628.1	O94898	LRIG2_HUMAN	leucine-rich repeats and immunoglobulin-like domains 2	972					innervation (GO:0060384)|regulation of platelet-derived growth factor receptor signaling pathway (GO:0010640)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(7)|large_intestine(3)|lung(10)|ovary(4)|prostate(2)|stomach(1)|urinary_tract(1)	31	Lung SC(450;0.246)	all_cancers(81;1.56e-05)|all_epithelial(167;2.62e-05)|all_lung(203;0.000665)|Lung NSC(69;0.000986)		Lung(183;0.0279)|Colorectal(144;0.0885)|COAD - Colon adenocarcinoma(174;0.134)|all cancers(265;0.139)|Epithelial(280;0.143)|LUSC - Lung squamous cell carcinoma(189;0.15)		ATCTGCCTTTCCCACCAACCA	0.453																																																	0								ENSG00000198799						120.0	114.0	116.0					1																	113662088		2203	4300	6503	LRIG2	SO:0001583	missense	0			-	HGNC	AB018349	CCDS30808.1	1p13.1	2013-01-11			ENSG00000198799	ENSG00000198799		"""Immunoglobulin superfamily / I-set domain containing"""	20889	protein-coding gene	gene with protein product		608869					Standard	XM_005271369		Approved	KIAA0806	uc001edf.1	O94898	OTTHUMG00000012133	ENST00000361127.5:c.2914C>T	1.37:g.113662088C>T	ENSP00000355396:p.Pro972Ser	Somatic	0	27	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	31	20.51	Q9NSN2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Leu-rich_rpt,pfam_Immunoglobulin,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.P972S	ENST00000361127.5	37	c.2914	CCDS30808.1	1	.	.	.	.	.	.	.	.	.	.	C	15.27	2.783680	0.49891	.	.	ENSG00000198799	ENST00000361127	T	0.61980	0.06	5.3	5.3	0.74995	.	0.081359	0.49305	D	0.000160	T	0.40546	0.1121	L	0.28054	0.825	0.42283	D	0.992103	B	0.02656	0.0	B	0.04013	0.001	T	0.29366	-1.0014	10	0.51188	T	0.08	.	19.3081	0.94173	0.0:1.0:0.0:0.0	.	972	O94898	LRIG2_HUMAN	S	972	ENSP00000355396:P972S	ENSP00000355396:P972S	P	+	1	0	LRIG2	113463611	1.000000	0.71417	1.000000	0.80357	0.491000	0.33493	2.579000	0.46059	2.638000	0.89438	0.591000	0.81541	CCC	-	NULL		0.453	LRIG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRIG2	protein_coding	OTTHUMT00000033549.2	C	NM_014813	-		113662088	+1	no_errors	ENST00000361127	ensembl	human	known	74_37	missense	SNP	1.000	T
DNAH17	8632	genome.wustl.edu	37	17	76482056	76482056	+	Missense_Mutation	SNP	C	C	T	rs201273328		TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr17:76482056C>T	ENST00000585328.1	-	46	7370	c.7246G>A	c.(7246-7248)Gat>Aat	p.D2416N	DNAH17_ENST00000586052.1_5'UTR|RP11-559N14.5_ENST00000585969.1_RNA|RP11-559N14.5_ENST00000588565.1_RNA|DNAH17_ENST00000389840.5_Missense_Mutation_p.D2407N	NM_173628.3	NP_775899.3	Q9UFH2	DYH17_HUMAN	dynein, axonemal, heavy chain 17	2407	AAA 3. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(7)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(8)|lung(37)|ovary(8)|prostate(7)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	116			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			AGTGGGACATCGGGATCCAGC	0.537													C|||	1	0.000199681	0.0	0.0	5008	,	,		18872	0.0		0.001	False		,,,				2504	0.0																0								ENSG00000187775	C	ASN/ASP	0,3942		0,0,1971	75.0	73.0	73.0		7261	4.3	0.0	17		73	9,8287		0,9,4139	yes	missense	DNAH17	NM_173628.3	23	0,9,6110	TT,TC,CC		0.1085,0.0,0.0735		2421/4463	76482056	9,12229	1971	4148	6119	DNAH17	SO:0001583	missense	0			-	HGNC	AJ000522		17q25.3	2012-04-19	2006-09-04		ENSG00000187775	ENSG00000187775		"""Axonemal dyneins"""	2946	protein-coding gene	gene with protein product		610063	"""dynein, axonemal, heavy polypeptide 17"", ""dynein, axonemal, heavy chain like 1"", ""dynein, axonemal, heavy like 1"""	DNAHL1		9545504	Standard	NM_173628		Approved	DNEL2, FLJ40457	uc010dhp.2	Q9UFH2		ENST00000585328.1:c.7246G>A	17.37:g.76482056C>T	ENSP00000465516:p.Asp2416Asn	Somatic	0	51	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	62	10.14	O00431|O15206|Q2M2Y1|Q6ZRQ2|Q8N7Q7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,superfamily_HR1_rho-bd	p.D2407N	ENST00000585328.1	37	c.7219		17	.	.	.	.	.	.	.	.	.	.	C	16.97	3.267633	0.59540	0.0	0.001085	ENSG00000187775	ENST00000300671;ENST00000389840	T	0.39056	1.1	4.29	4.29	0.51040	.	.	.	.	.	T	0.52386	0.1731	L	0.49640	1.575	0.49299	D	0.99977	.	.	.	.	.	.	T	0.52631	-0.8550	7	0.44086	T	0.13	.	16.93	0.86188	0.0:1.0:0.0:0.0	.	.	.	.	N	2416;2407	ENSP00000374490:D2407N	ENSP00000300671:D2416N	D	-	1	0	DNAH17	73993651	1.000000	0.71417	0.040000	0.18447	0.080000	0.17528	7.394000	0.79862	2.232000	0.73038	0.462000	0.41574	GAT	-	superfamily_P-loop_NTPase		0.537	DNAH17-001	PUTATIVE	not_organism_supported|basic|appris_principal	protein_coding	DNAH17	protein_coding	OTTHUMT00000318962.2	C	NM_173628	rs201273328		76482056	-1	no_errors	ENST00000389840	ensembl	human	known	74_37	missense	SNP	0.990	T
NLRC3	197358	genome.wustl.edu	37	16	3614547	3614547	+	RNA	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr16:3614547G>A	ENST00000301749.7	-	0	796				NLRC3_ENST00000603507.1_RNA|NLRC3_ENST00000448023.2_RNA|NLRC3_ENST00000419350.2_RNA|NLRC3_ENST00000359128.5_RNA|NLRC3_ENST00000324659.8_RNA	NM_178844.2	NP_849172.2	Q7RTR2	NLRC3_HUMAN	NLR family, CARD domain containing 3						I-kappaB kinase/NF-kappaB signaling (GO:0007249)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|regulation of protein ubiquitination (GO:0031396)|response to lipopolysaccharide (GO:0032496)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(1)|liver(1)|lung(16)|ovary(2)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						ACCCGGGAGAGAGGCAGGAAG	0.701																																																	0								ENSG00000167984						21.0	27.0	25.0					16																	3614547		1905	4090	5995	NLRC3			0			-	HGNC	BK001112	CCDS73817.1	16p13.3	2014-03-25			ENSG00000167984	ENSG00000167984		"""Nucleotide-binding domain and leucine rich repeat containing"""	29889	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 3"", ""NOD-like receptor C3"""	615648				15705585, 12766759	Standard	NM_178844		Approved	CLR16.2, FLJ00348, NOD3	uc010btn.3	Q7RTR2	OTTHUMG00000177561		16.37:g.3614547G>A		Somatic	0	19	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	9	35.71	Q5EY36|Q8NF48|Q8NI01|Q8NI02|Q8TEL3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase	p.L178F	ENST00000301749.7	37	c.532		16	.	.	.	.	.	.	.	.	.	.	G	20.2	3.941869	0.73557	.	.	ENSG00000167984	ENST00000419350;ENST00000301749;ENST00000359128;ENST00000448023;ENST00000324659	T;T;T;T	0.78816	-0.66;-0.69;-0.67;-1.21	4.73	3.77	0.43336	.	0.000000	0.64402	D	0.000006	D	0.85044	0.5607	.	.	.	0.28666	N	0.905881	D	0.89917	1.0	D	0.85130	0.997	T	0.78122	-0.2327	9	0.39692	T	0.17	.	10.4868	0.44726	0.0958:0.0:0.9042:0.0	.	178	C9JLH9	.	F	131;131;131;178;113	ENSP00000301749:L131F;ENSP00000352039:L131F;ENSP00000414415:L178F;ENSP00000323897:L113F	ENSP00000301749:L131F	L	-	1	0	NLRC3	3554548	1.000000	0.71417	0.986000	0.45419	0.951000	0.60555	6.378000	0.73150	0.975000	0.38392	0.655000	0.94253	CTC	-	superfamily_P-loop_NTPase		0.701	NLRC3-201	KNOWN	basic|appris_principal	protein_coding	NLRC3	polymorphic_pseudogene		G	NM_178844	-		3614547	-1	no_errors	ENST00000448023	ensembl	human	known	74_37	missense	SNP	0.999	A
DCHS2	54798	genome.wustl.edu	37	4	155156102	155156102	+	Nonsense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr4:155156102C>T	ENST00000357232.4	-	25	8336	c.8337G>A	c.(8335-8337)tgG>tgA	p.W2779*		NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	2779					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		GAAGATAATTCCAGTGATAGT	0.398																																																	0								ENSG00000197410						114.0	112.0	112.0					4																	155156102		2203	4300	6503	DCHS2	SO:0001587	stop_gained	0			-	HGNC	BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.8337G>A	4.37:g.155156102C>T	ENSP00000349768:p.Trp2779*	Somatic	0	26	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	26	16.13	B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_HTH_CenpB_DNA-bd_dom,superfamily_Cadherin-like,superfamily_Homeodomain-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.W2779*	ENST00000357232.4	37	c.8337	CCDS3785.1	4	.	.	.	.	.	.	.	.	.	.	C	49	15.519626	0.99836	.	.	ENSG00000197410	ENST00000357232	.	.	.	5.94	5.94	0.96194	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	20.3552	0.98837	0.0:1.0:0.0:0.0	.	.	.	.	X	2779	.	ENSP00000349768:W2779X	W	-	3	0	DCHS2	155375552	1.000000	0.71417	0.927000	0.36925	0.974000	0.67602	6.095000	0.71439	2.812000	0.96745	0.557000	0.71058	TGG	-	NULL		0.398	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCHS2	protein_coding	OTTHUMT00000365281.2	C	NM_001142552	-		155156102	-1	no_errors	ENST00000357232	ensembl	human	known	74_37	nonsense	SNP	1.000	T
RBFOX1	54715	genome.wustl.edu	37	16	7102075	7102075	+	Start_Codon_SNP	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr16:7102075G>A	ENST00000550418.1	+	4	991	c.3G>A	c.(1-3)atG>atA	p.M1I	RBFOX1_ENST00000552089.1_Missense_Mutation_p.M37I|RBFOX1_ENST00000535565.2_Missense_Mutation_p.M37I|RBFOX1_ENST00000553186.1_Start_Codon_SNP_p.M1I|RBFOX1_ENST00000547427.1_3'UTR|RBFOX1_ENST00000547372.1_Missense_Mutation_p.M44I|RBFOX1_ENST00000422070.4_Missense_Mutation_p.M44I|RBFOX1_ENST00000547338.1_Start_Codon_SNP_p.M1I	NM_018723.3	NP_061193.2	Q9NWB1	RFOX1_HUMAN	RNA binding protein, fox-1 homolog (C. elegans) 1	1					mRNA processing (GO:0006397)|neuromuscular process controlling balance (GO:0050885)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|RNA transport (GO:0050658)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	nucleotide binding (GO:0000166)|protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(11)|lung(17)|ovary(1)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)	55						GACAACAGATGAATTGTGAAA	0.373																																					Ovarian(157;934 2567 15163 39509)												0								ENSG00000078328						77.0	75.0	75.0					16																	7102075		1835	4087	5922	RBFOX1	SO:0001582	initiator_codon_variant	0			-	HGNC	AF107203	CCDS10531.1, CCDS10532.1, CCDS45405.1, CCDS55983.1, CCDS55984.1	16p13.3	2013-02-12			ENSG00000078328	ENSG00000078328		"""RNA binding motif (RRM) containing"""	18222	protein-coding gene	gene with protein product	"""ataxin 2-binding protein 1"", ""hexaribonucleotide binding protein 1"""	605104				10814712, 16260614	Standard	NM_018723		Approved	A2BP1, FOX-1, HRNBP1	uc002cyy.2	Q9NWB1	OTTHUMG00000129551	ENST00000550418.1:c.3G>A	16.37:g.7102075G>A	ENSP00000450031:p.Met1Ile	Somatic	0	51	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	48	18.64	Q7Z7I7|Q8TAE3|Q8TAF2|Q8WYB2|Q9NS20	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Fox-1_C_dom,pfam_RRM_dom,smart_RRM_dom,pirsf_RNA-bd_Fox-1,pfscan_RRM_dom	p.M44I	ENST00000550418.1	37	c.132	CCDS55983.1	16	.	.	.	.	.	.	.	.	.	.	G	13.50	2.256350	0.39896	.	.	ENSG00000078328	ENST00000547605;ENST00000550418;ENST00000553186;ENST00000547372;ENST00000422070;ENST00000535565;ENST00000552089;ENST00000551752;ENST00000547338	T;T;T;T;T;T;T	0.28454	2.13;1.61;1.95;1.79;1.83;2.04;1.61	5.6	5.6	0.85130	.	.	.	.	.	T	0.31263	0.0791	.	.	.	0.80722	D	1	B;B;B;B;B	0.31290	0.318;0.076;0.0;0.0;0.031	B;B;B;B;B	0.34652	0.069;0.014;0.0;0.0;0.187	T	0.06643	-1.0815	8	0.51188	T	0.08	.	15.1225	0.72457	0.0:0.0:1.0:0.0	.	37;44;1;1;44	F5H0M1;B7Z1U7;Q9NWB1-3;Q9NWB1;F8VZG9	.;.;.;RFOX1_HUMAN;.	I	1;1;1;44;44;37;37;1;1	ENSP00000450402:M1I;ENSP00000450031:M1I;ENSP00000447753:M1I;ENSP00000446842:M44I;ENSP00000391269:M44I;ENSP00000447281:M1I;ENSP00000447717:M1I	ENSP00000391269:M44I	M	+	3	0	RBFOX1	7042076	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.424000	0.66464	2.630000	0.89119	0.655000	0.94253	ATG	-	pirsf_RNA-bd_Fox-1		0.373	RBFOX1-003	KNOWN	basic|CCDS	protein_coding	RBFOX1	protein_coding	OTTHUMT00000409492.2	G	NM_145891	-	Missense_Mutation	7102075	+1	no_errors	ENST00000547372	ensembl	human	known	74_37	missense	SNP	1.000	A
SLC34A1	6569	genome.wustl.edu	37	5	176815283	176815283	+	Silent	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr5:176815283C>T	ENST00000324417.5	+	8	937	c.846C>T	c.(844-846)gaC>gaT	p.D282D	SLC34A1_ENST00000512593.1_Silent_p.D282D	NM_003052.4	NP_003043.3	Q06495	NPT2A_HUMAN	solute carrier family 34 (type II sodium/phosphate contransporter), member 1	282					arsenate ion transmembrane transport (GO:1901684)|bone remodeling (GO:0046849)|cellular response to metal ion (GO:0071248)|cellular response to parathyroid hormone stimulus (GO:0071374)|cellular response to staurosporine (GO:0072734)|dentinogenesis (GO:0097187)|gentamycin metabolic process (GO:1901128)|glycoprotein metabolic process (GO:0009100)|indole metabolic process (GO:0042431)|ion transport (GO:0006811)|kidney development (GO:0001822)|ossification (GO:0001503)|phosphate ion homeostasis (GO:0055062)|phosphate ion transport (GO:0006817)|positive regulation of membrane potential (GO:0045838)|positive regulation of phosphate transmembrane transport (GO:2000187)|positive regulation of sodium-dependent phosphate transport (GO:2000120)|protein homooligomerization (GO:0051260)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to growth hormone (GO:0060416)|response to lead ion (GO:0010288)|response to magnesium ion (GO:0032026)|response to mercury ion (GO:0046689)|response to potassium ion (GO:0035864)|response to thyroid hormone (GO:0097066)|response to vitamin A (GO:0033189)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|tricarboxylic acid metabolic process (GO:0072350)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|membrane-bounded vesicle (GO:0031988)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	sodium-dependent phosphate transmembrane transporter activity (GO:0015321)|symporter activity (GO:0015293)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	24	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CACAGCTGGACGAGTCTGTGA	0.592																																																	0								ENSG00000131183						126.0	113.0	118.0					5																	176815283		2203	4300	6503	SLC34A1	SO:0001819	synonymous_variant	0			-	HGNC	L13258	CCDS4418.1, CCDS54953.1	5q35.3	2013-07-17	2013-07-17		ENSG00000131183	ENSG00000131183		"""Solute carriers"""	11019	protein-coding gene	gene with protein product	"""sodium/phosphate co-transporter"", ""solute carrier family 17 (sodium phosphate), member 2"", ""Na+-phosphate cotransporter type II"""	182309	"""solute carrier family 34 (sodium phosphate), member 1"""	NPT2, SLC17A2		8327470, 8693007	Standard	NM_003052		Approved	NAPI-3, NPTIIa, SLC11	uc003mgk.4	Q06495	OTTHUMG00000130857	ENST00000324417.5:c.846C>T	5.37:g.176815283C>T		Somatic	0	34	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	51	17.74	B4DPE3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Na/Pi_transpt,tigrfam_Na/Pi_transpt	p.D282	ENST00000324417.5	37	c.846	CCDS4418.1	5																																																																																			-	tigrfam_Na/Pi_transpt		0.592	SLC34A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC34A1	protein_coding	OTTHUMT00000253431.1	C	NM_003052	-		176815283	+1	no_errors	ENST00000324417	ensembl	human	known	74_37	silent	SNP	1.000	T
KPNA2	3838	genome.wustl.edu	37	17	66041988	66041988	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr17:66041988C>T	ENST00000537025.2	+	10	2068	c.1448C>T	c.(1447-1449)tCt>tTt	p.S483F	KPNA2_ENST00000582898.1_3'UTR|KPNA2_ENST00000330459.3_Missense_Mutation_p.S483F			P52292	IMA1_HUMAN	karyopherin alpha 2 (RAG cohort 1, importin alpha 1)	483					cytokine-mediated signaling pathway (GO:0019221)|DNA metabolic process (GO:0006259)|NLS-bearing protein import into nucleus (GO:0006607)|regulation of DNA recombination (GO:0000018)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	histone deacetylase binding (GO:0042826)|nuclear localization sequence binding (GO:0008139)|poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)			breast(1)|central_nervous_system(2)|cervix(3)|endometrium(2)|kidney(2)|lung(9)|prostate(1)|urinary_tract(2)	22	all_cancers(12;1.18e-09)		BRCA - Breast invasive adenocarcinoma(8;1.03e-07)|LUSC - Lung squamous cell carcinoma(166;0.24)			GAAAATGAGTCTGTGTATAAG	0.348																																																	0								ENSG00000182481						110.0	117.0	115.0					17																	66041988		2203	4295	6498	KPNA2	SO:0001583	missense	0			-	HGNC	U09559	CCDS32713.1	17q24.2	2013-02-14						"""Importins"", ""Armadillo repeat containing"""	6395	protein-coding gene	gene with protein product		600685		RCH1		8016130, 7754385	Standard	NM_002266		Approved	SRP1alpha, IPOA1, QIP2	uc002jgk.3	P52292		ENST00000537025.2:c.1448C>T	17.37:g.66041988C>T	ENSP00000438483:p.Ser483Phe	Somatic	0	53	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	71	17.44	B9EJD6|Q53YE3|Q9BRU5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Armadillo,pfam_Importin-a_IBB,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo,pfscan_Importin-a_IBB	p.S483F	ENST00000537025.2	37	c.1448	CCDS32713.1	17	.	.	.	.	.	.	.	.	.	.	C	12.67	2.006515	0.35415	.	.	ENSG00000182481	ENST00000330459;ENST00000537025	T;T	0.63580	-0.05;-0.05	5.17	2.9	0.33743	Armadillo-like helical (1);Armadillo-type fold (1);	0.697426	0.13187	U	0.407027	T	0.50769	0.1635	L	0.59436	1.845	0.32262	N	0.570039	B	0.28324	0.207	B	0.21546	0.035	T	0.60752	-0.7201	10	0.87932	D	0	.	1.6529	0.02775	0.3993:0.3298:0.147:0.1239	.	483	P52292	IMA2_HUMAN	F	483	ENSP00000332455:S483F;ENSP00000438483:S483F	ENSP00000332455:S483F	S	+	2	0	KPNA2	63472450	0.661000	0.27430	1.000000	0.80357	0.981000	0.71138	0.827000	0.27421	1.139000	0.42245	0.461000	0.40582	TCT	-	superfamily_ARM-type_fold		0.348	KPNA2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	KPNA2	protein_coding	OTTHUMT00000448111.1	C	NM_002266	-		66041988	+1	no_errors	ENST00000330459	ensembl	human	known	74_37	missense	SNP	0.849	T
TMC7	79905	genome.wustl.edu	37	16	19020580	19020580	+	Missense_Mutation	SNP	A	A	G			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr16:19020580A>G	ENST00000304381.5	+	2	284	c.154A>G	c.(154-156)Agg>Ggg	p.R52G	RNU6-1340P_ENST00000384438.1_RNA|TMC7_ENST00000569532.1_Missense_Mutation_p.R52G|TMC7_ENST00000421369.3_5'UTR	NM_024847.3	NP_079123.3	Q7Z402	TMC7_HUMAN	transmembrane channel-like 7	52					ion transport (GO:0006811)	integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|prostate(1)|skin(4)|urinary_tract(1)	28						CATTGCACGTAGGAGAACGAC	0.493																																																	0								ENSG00000170537						95.0	89.0	91.0					16																	19020580		2197	4300	6497	TMC7	SO:0001583	missense	0			-	HGNC	AY263165	CCDS10573.1, CCDS53992.1, CCDS73837.1	16p13.11	2008-02-05			ENSG00000170537	ENSG00000170537			23000	protein-coding gene	gene with protein product						12812529, 12906855	Standard	XM_005255597		Approved	FLJ21240	uc002dfq.3	Q7Z402	OTTHUMG00000131456	ENST00000304381.5:c.154A>G	16.37:g.19020580A>G	ENSP00000304710:p.Arg52Gly	Somatic	0	56	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	45	26.23	E7ERB6|Q5H9Q8|Q7Z5M4|Q86WX0|Q9H766	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TMC	p.R52G	ENST00000304381.5	37	c.154	CCDS10573.1	16	.	.	.	.	.	.	.	.	.	.	A	17.22	3.333452	0.60853	.	.	ENSG00000170537	ENST00000304381	T	0.72835	-0.69	5.33	1.41	0.22369	.	0.170845	0.49916	D	0.000128	T	0.76478	0.3993	L	0.58810	1.83	0.28670	N	0.905652	D;P;P	0.63880	0.993;0.822;0.469	P;B;B	0.62382	0.901;0.424;0.223	T	0.70916	-0.4742	10	0.87932	D	0	.	10.394	0.44190	0.494:0.506:0.0:0.0	.	52;52;52	B4DF02;Q7Z402;B3KSZ3	.;TMC7_HUMAN;.	G	52	ENSP00000304710:R52G	ENSP00000304710:R52G	R	+	1	2	TMC7	18928081	0.675000	0.27558	0.681000	0.30009	0.774000	0.43823	1.843000	0.39259	0.365000	0.24400	0.528000	0.53228	AGG	-	NULL		0.493	TMC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMC7	protein_coding	OTTHUMT00000254276.3	A	NM_024847	-		19020580	+1	no_errors	ENST00000304381	ensembl	human	known	74_37	missense	SNP	0.463	G
MAGEC1	9947	genome.wustl.edu	37	X	140994946	140994946	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chrX:140994946G>A	ENST00000285879.4	+	4	2042	c.1756G>A	c.(1756-1758)Ggg>Agg	p.G586R	MAGEC1_ENST00000406005.2_Intron	NM_005462.4	NP_005453.2	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	586										breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(22)|lung(60)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(1)	127	Acute lymphoblastic leukemia(192;6.56e-05)					GAGCCCTCAGGGGGAGGACTC	0.587										HNSCC(15;0.026)																																							0								ENSG00000155495						232.0	249.0	243.0					X																	140994946		2203	4300	6503	MAGEC1	SO:0001583	missense	0			-	HGNC	AF064589	CCDS35417.1	Xq26	2009-03-18			ENSG00000155495	ENSG00000155495			6812	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 1"""	300223				9485030, 9618514	Standard	NM_005462		Approved	MAGE-C1, CT7, MGC39366, CT7.1	uc004fbt.3	O60732	OTTHUMG00000022569	ENST00000285879.4:c.1756G>A	X.37:g.140994946G>A	ENSP00000285879:p.Gly586Arg	Somatic	0	43	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	43	26.67	A0PK03|O75451|Q8TCV4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MAGE,pfscan_MAGE	p.G586R	ENST00000285879.4	37	c.1756	CCDS35417.1	X	.	.	.	.	.	.	.	.	.	.	g	11.41	1.631021	0.28978	.	.	ENSG00000155495	ENST00000285879	T	0.02863	4.13	0.92	-0.333	0.12671	.	.	.	.	.	T	0.03520	0.0101	N	0.08118	0	0.47037	D	0.999296	D	0.76494	0.999	D	0.83275	0.996	T	0.60141	-0.7321	9	0.87932	D	0	.	1.4078	0.02284	0.3159:0.0:0.3341:0.35	.	586	O60732	MAGC1_HUMAN	R	586	ENSP00000285879:G586R	ENSP00000285879:G586R	G	+	1	0	MAGEC1	140822612	0.019000	0.18553	0.029000	0.17559	0.029000	0.11900	0.292000	0.19011	0.179000	0.19938	0.181000	0.17075	GGG	-	NULL		0.587	MAGEC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAGEC1	protein_coding	OTTHUMT00000058604.1	G	NM_005462	-		140994946	+1	no_errors	ENST00000285879	ensembl	human	known	74_37	missense	SNP	0.675	A
SEC14L4	284904	genome.wustl.edu	37	22	30887889	30887889	+	Silent	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr22:30887889C>T	ENST00000255858.7	-	10	926	c.843G>A	c.(841-843)acG>acA	p.T281T	SEC14L4_ENST00000392772.2_Silent_p.T227T|SEC14L4_ENST00000381982.3_Silent_p.T281T|SEC14L4_ENST00000540456.1_Silent_p.T266T|RP4-539M6.14_ENST00000442126.1_RNA|RP4-539M6.14_ENST00000610156.1_RNA	NM_001161368.1|NM_174977.3	NP_001154840.1|NP_777637.1	Q9UDX3	S14L4_HUMAN	SEC14-like 4 (S. cerevisiae)	281	GOLD. {ECO:0000255|PROSITE- ProRule:PRU00096}.					integral component of membrane (GO:0016021)|intracellular (GO:0005622)	lipid binding (GO:0008289)|transporter activity (GO:0005215)			breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(5)|pancreas(1)|skin(1)	21					Vitamin E(DB00163)	CCACGGACCTCGTGTGCTCAT	0.622																																																	0								ENSG00000133488						41.0	35.0	37.0					22																	30887889		2203	4300	6503	SEC14L4	SO:0001819	synonymous_variant	0			-	HGNC	AY158085	CCDS13878.1, CCDS54517.1	22q12.1	2003-03-10			ENSG00000133488	ENSG00000133488			20627	protein-coding gene	gene with protein product		612825					Standard	NM_174977		Approved	TAP3, dJ130H16.5	uc003aid.2	Q9UDX3	OTTHUMG00000151258	ENST00000255858.7:c.843G>A	22.37:g.30887889C>T		Somatic	0	61	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	52	28.77	A5D6W7|A6NCV4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_CRAL-TRIO_dom,pfam_CRAL/TRIO_N_dom,superfamily_CRAL-TRIO_dom,superfamily_GOLD,superfamily_CRAL/TRIO_N_dom,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom,pfscan_GOLD,prints_CRAL-bd_toc_tran	p.T281	ENST00000255858.7	37	c.843	CCDS13878.1	22																																																																																			-	superfamily_GOLD,pfscan_GOLD		0.622	SEC14L4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC14L4	protein_coding	OTTHUMT00000321946.1	C	NM_174977	-		30887889	-1	no_errors	ENST00000255858	ensembl	human	known	74_37	silent	SNP	0.000	T
AAK1	22848	genome.wustl.edu	37	2	69746219	69746219	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr2:69746219G>A	ENST00000409085.4	-	12	1740	c.1364C>T	c.(1363-1365)gCt>gTt	p.A455V	AAK1_ENST00000409068.1_Missense_Mutation_p.A455V|SNORA36C_ENST00000384289.1_RNA|RN7SL604P_ENST00000492589.2_RNA|AAK1_ENST00000406297.3_Missense_Mutation_p.A455V	NM_014911.3	NP_055726	Q2M2I8	AAK1_HUMAN	AP2 associated kinase 1	455	Gln-rich.				endocytosis (GO:0006897)|positive regulation of Notch signaling pathway (GO:0045747)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)|regulation of clathrin-mediated endocytosis (GO:2000369)|regulation of protein localization (GO:0032880)	cell leading edge (GO:0031252)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|extrinsic component of plasma membrane (GO:0019897)|terminal bouton (GO:0043195)	AP-2 adaptor complex binding (GO:0035612)|ATP binding (GO:0005524)|Notch binding (GO:0005112)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(6)|prostate(1)	17						CTGGGCCTGAGCGGGCAGACC	0.672																																																	0								ENSG00000115977						36.0	42.0	40.0					2																	69746219		2118	4205	6323	AAK1	SO:0001583	missense	0			-	HGNC	AB028971	CCDS1893.2	2p13.3	2012-07-10			ENSG00000115977	ENSG00000115977			19679	protein-coding gene	gene with protein product						11877461, 12471243	Standard	NM_014911		Approved	KIAA1048, DKFZp686K16132	uc002sfp.2	Q2M2I8	OTTHUMG00000129648	ENST00000409085.4:c.1364C>T	2.37:g.69746219G>A	ENSP00000386456:p.Ala455Val	Somatic	0	94	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	131	16.56	Q4ZFZ3|Q53RX6|Q9UPV4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.A455V	ENST00000409085.4	37	c.1364	CCDS1893.2	2	.	.	.	.	.	.	.	.	.	.	G	13.83	2.355526	0.41700	.	.	ENSG00000115977	ENST00000409068;ENST00000409085;ENST00000406297	T;T;T	0.30981	1.51;1.51;1.51	4.57	4.57	0.56435	.	2.171060	0.01614	N	0.022678	T	0.25195	0.0612	N	0.12182	0.205	0.23848	N	0.996674	B;B;B	0.13594	0.005;0.008;0.005	B;B;B	0.18561	0.01;0.022;0.01	T	0.16958	-1.0385	10	0.30078	T	0.28	0.0638	14.2027	0.65714	0.0:0.0:1.0:0.0	.	455;455;455	B7ZLC4;Q2M2I8-2;Q2M2I8	.;.;AAK1_HUMAN	V	455	ENSP00000386342:A455V;ENSP00000386456:A455V;ENSP00000385181:A455V	ENSP00000385181:A455V	A	-	2	0	AAK1	69599723	0.877000	0.30153	0.472000	0.27241	0.757000	0.42996	3.804000	0.55568	2.364000	0.80123	0.655000	0.94253	GCT	-	NULL		0.672	AAK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AAK1	protein_coding	OTTHUMT00000251847.4	G	NM_014911	-		69746219	-1	no_errors	ENST00000409085	ensembl	human	known	74_37	missense	SNP	0.736	A
TUBA4A	7277	genome.wustl.edu	37	2	220118077	220118077	+	Intron	DEL	G	G	-	rs60456844		TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr2:220118077delG	ENST00000248437.4	-	1	177				TUBA4A_ENST00000498660.1_Intron|TUBA4A_ENST00000392088.2_Intron|TUBA4B_ENST00000490341.1_RNA	NM_006000.2	NP_005991.1	P68366	TBA4A_HUMAN	tubulin, alpha 4a						'de novo' posttranslational protein folding (GO:0051084)|blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based process (GO:0007017)|mitotic cell cycle (GO:0000278)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(6)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	20		Renal(207;0.0474)		Epithelial(149;1.16e-06)|all cancers(144;0.000191)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)	Cabazitaxel(DB06772)|Podofilox(DB01179)|Vincristine(DB00541)	GCTGAGTCACGGGGGGGGGGT	0.647																																																	0								ENSG00000243910																																			TUBA4B	SO:0001627	intron_variant	0				HGNC	AK054731	CCDS2438.1, CCDS63131.1	2q36.1	2012-10-02	2007-02-12	2007-02-12	ENSG00000127824	ENSG00000127824		"""Tubulins"""	12407	protein-coding gene	gene with protein product		191110	"""tubulin, alpha 1 (testis specific)"", ""tubulin, alpha 1"""	TUBA1		3785200	Standard	NM_006000		Approved	FLJ30169, H2-ALPHA	uc002vkt.1	P68366	OTTHUMG00000133126	ENST00000248437.4:c.3+500C>-	2.37:g.220118077delG		Somatic	0	15	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	23	17.86	A8MUB1|B3KNQ6|P05215	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000248437.4	37	NULL	CCDS2438.1	2																																																																																			-	-		0.647	TUBA4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBA4B	protein_coding	OTTHUMT00000256816.3	G	NM_006000			220118077	+1	no_errors	ENST00000473885	ensembl	human	known	74_37	rna	DEL	0.000	-
FAM71B	153745	genome.wustl.edu	37	5	156589653	156589653	+	Silent	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr5:156589653G>A	ENST00000302938.4	-	2	1718	c.1623C>T	c.(1621-1623)ctC>ctT	p.L541L		NM_130899.2	NP_570969.2	Q8TC56	FA71B_HUMAN	family with sequence similarity 71, member B	541						nucleus (GO:0005634)				NS(3)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(32)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	68	Renal(175;0.00212)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			GAGTGGCCCTGAGGCTCCTTA	0.463																																																	0								ENSG00000170613						145.0	147.0	146.0					5																	156589653		2203	4300	6503	FAM71B	SO:0001819	synonymous_variant	0			-	HGNC		CCDS4335.1	5q33.3	2005-08-09			ENSG00000170613	ENSG00000170613			28397	protein-coding gene	gene with protein product						12477932	Standard	NM_130899		Approved	MGC26988	uc003lwn.3	Q8TC56	OTTHUMG00000130246	ENST00000302938.4:c.1623C>T	5.37:g.156589653G>A		Somatic	0	75	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	65	18.75	Q1EDD9|Q8TC64|Q96LY8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF3699	p.L541	ENST00000302938.4	37	c.1623	CCDS4335.1	5																																																																																			-	NULL		0.463	FAM71B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM71B	protein_coding	OTTHUMT00000252570.2	G	NM_130899	-		156589653	-1	no_errors	ENST00000302938	ensembl	human	known	74_37	silent	SNP	0.002	A
POLR2J4	84820	genome.wustl.edu	37	7	44005872	44005872	+	RNA	SNP	G	G	A	rs540974450		TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr7:44005872G>A	ENST00000427076.1	-	0	1322				RP5-1165K10.2_ENST00000454572.1_RNA	NR_003655.2				polymerase (RNA) II (DNA directed) polypeptide J4, pseudogene																		CTTTGCCCAGGAAGTCGTTTC	0.662																																																	0								ENSG00000214783																																			POLR2J4			0			-	HGNC			7p13	2008-08-21			ENSG00000214783	ENSG00000214783			28195	pseudogene	pseudogene						15586814	Standard	NR_003655		Approved	MGC13098	uc010kxw.2		OTTHUMG00000155253		7.37:g.44005872G>A		Somatic	0	115	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	38	146	20.54		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000427076.1	37	NULL		7																																																																																			-	-		0.662	POLR2J4-002	KNOWN	basic|readthrough_transcript	processed_transcript	POLR2J4	processed_transcript	OTTHUMT00000473169.1	G	NR_003655	-		44005872	-1	no_errors	ENST00000427076	ensembl	human	known	74_37	rna	SNP	1.000	A
ABR	29	genome.wustl.edu	37	17	913999	913999	+	Missense_Mutation	SNP	G	G	C			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr17:913999G>C	ENST00000302538.5	-	20	2352	c.2206C>G	c.(2206-2208)Cga>Gga	p.R736G	ABR_ENST00000544583.2_Missense_Mutation_p.R690G|ABR_ENST00000536794.2_Missense_Mutation_p.R518G|ABR_ENST00000291107.2_Missense_Mutation_p.R699G|ABR_ENST00000574437.1_Missense_Mutation_p.R690G|ABR_ENST00000572441.1_Intron|ABR_ENST00000543210.2_Missense_Mutation_p.R187G	NM_001282149.1|NM_021962.3	NP_001269078.1|NP_068781.2	Q12979	ABR_HUMAN	active BCR-related	736	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|brain development (GO:0007420)|inner ear morphogenesis (GO:0042472)|negative regulation of cell migration (GO:0030336)|negative regulation of inflammatory response (GO:0050728)|negative regulation of neutrophil degranulation (GO:0043314)|neuromuscular process controlling balance (GO:0050885)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of phagocytosis (GO:0050766)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to lipopolysaccharide (GO:0032496)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|Rac GTPase activator activity (GO:0030675)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	39				UCEC - Uterine corpus endometrioid carcinoma (25;0.0228)		GGGTAGAGTCGGTCCGTGAGG	0.627																																					Esophageal Squamous(197;2016 2115 4129 29033 46447)												0								ENSG00000159842						79.0	76.0	77.0					17																	913999		2203	4300	6503	ABR	SO:0001583	missense	0			-	HGNC	L19704	CCDS10999.1, CCDS11000.1, CCDS54060.1, CCDS58497.1, CCDS73936.1	17p13	2013-01-10	2012-02-27		ENSG00000159842	ENSG00000159842		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	81	protein-coding gene	gene with protein product		600365	"""active BCR-related gene"""			2587217, 7479768	Standard	NM_001092		Approved	MDB	uc002fsd.4	Q12979	OTTHUMG00000090313	ENST00000302538.5:c.2206C>G	17.37:g.913999G>C	ENSP00000303909:p.Arg736Gly	Somatic	0	43	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	33	19.51	B3KW89|B7Z6H7|D3DTH3|D3DTH4|F5H3S2|F5H8B3|Q13693|Q13694	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RhoGAP_dom,pfam_DH-domain,pfam_Pleckstrin_homology,pfam_C2_dom,superfamily_Rho_GTPase_activation_prot,superfamily_DH-domain,superfamily_C2_dom,smart_DH-domain,smart_Pleckstrin_homology,smart_C2_dom,smart_RhoGAP_dom,pfscan_C2_dom,pfscan_Pleckstrin_homology,pfscan_RhoGAP_dom,pfscan_DH-domain	p.R736G	ENST00000302538.5	37	c.2206	CCDS10999.1	17	.	.	.	.	.	.	.	.	.	.	G	12.45	1.942326	0.34283	.	.	ENSG00000159842	ENST00000302538;ENST00000544583;ENST00000291107;ENST00000536794;ENST00000543210;ENST00000382259	T;T;T;T;T	0.19105	2.17;2.17;2.17;2.17;2.17	5.13	-1.89	0.07689	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.068887	0.56097	D	0.000036	T	0.22360	0.0539	L	0.45228	1.405	0.27717	N	0.945272	B;D;P;D;B;P	0.62365	0.006;0.991;0.546;0.975;0.013;0.638	B;P;B;P;B;P	0.52217	0.023;0.693;0.206;0.653;0.023;0.499	T	0.20140	-1.0284	10	0.35671	T	0.21	.	10.9798	0.47488	0.0:0.1026:0.1922:0.7052	.	518;187;344;699;646;736	B7Z683;F5H3S2;Q6ZT60;Q12979-2;B7Z2X0;Q12979	.;.;.;.;.;ABR_HUMAN	G	736;690;699;518;187;345	ENSP00000303909:R736G;ENSP00000442048:R690G;ENSP00000291107:R699G;ENSP00000437429:R518G;ENSP00000445198:R187G	ENSP00000291107:R699G	R	-	1	2	ABR	860749	0.024000	0.19004	0.991000	0.47740	0.909000	0.53808	-0.129000	0.10515	-0.112000	0.11979	0.558000	0.71614	CGA	-	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom		0.627	ABR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABR	protein_coding	OTTHUMT00000206675.4	G		-		913999	-1	no_errors	ENST00000302538	ensembl	human	known	74_37	missense	SNP	0.994	C
SNHG14	104472715	genome.wustl.edu	37	15	25490553	25490553	+	RNA	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr15:25490553C>T	ENST00000453082.2	+	0	2704				SNORD115-41_ENST00000363608.1_RNA|SNORD115-42_ENST00000364273.1_RNA|SNORD115-40_ENST00000606510.1_RNA	NR_003343.1				small nucleolar RNA host gene 14 (non-protein coding)																		ACCCTGGTCTCCTGCACTGAG	0.602																																																	0								ENSG00000224078																																			SNHG14			0			-	HGNC			15q11.2	2014-01-17	2011-08-22	2011-08-22	ENSG00000224078	ENSG00000224078		"""Long non-coding RNAs"""	37462	non-coding RNA	RNA, long non-coding	"""non-protein coding RNA 214"""		"""UBE3A antisense RNA 1 (non-protein coding)"""	UBE3A-AS1		23771028	Standard			Approved	NCRNA00214, UBE3A-AS			OTTHUMG00000056661		15.37:g.25490553C>T		Somatic	0	25	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	41	18.00		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000453082.2	37	NULL		15																																																																																			-	-		0.602	SNHG14-003	KNOWN	non_canonical_TEC|basic	antisense	SNHG14	processed_transcript	OTTHUMT00000126730.2	C		-		25490553	+1	no_errors	ENST00000453082	ensembl	human	known	74_37	rna	SNP	0.080	T
TNIP3	79931	genome.wustl.edu	37	4	122085294	122085294	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr4:122085294C>T	ENST00000509841.1	-	4	296	c.218G>A	c.(217-219)gGa>gAa	p.G73E	TNIP3_ENST00000454328.1_5'UTR|TNIP3_ENST00000057513.3_5'UTR|TNIP3_ENST00000507879.1_Missense_Mutation_p.G66E	NM_001244764.1	NP_001231693.1			TNFAIP3 interacting protein 3											NS(1)|endometrium(4)|large_intestine(4)|lung(9)|ovary(1)|prostate(3)|skin(2)	24						AGCTGTTTTTCCTGGAGTCTT	0.388																																																	0								ENSG00000050730						92.0	88.0	89.0					4																	122085294		2203	4300	6503	TNIP3	SO:0001583	missense	0			-	HGNC	AJ320534	CCDS3718.1, CCDS58925.1, CCDS58926.1	4q27	2008-02-05			ENSG00000050730	ENSG00000050730			19315	protein-coding gene	gene with protein product		608019				11345586	Standard	NM_024873		Approved	LIND, FLJ21162, ABIN-3	uc021xrj.1	Q96KP6	OTTHUMG00000132969	ENST00000509841.1:c.218G>A	4.37:g.122085294C>T	ENSP00000426613:p.Gly73Glu	Somatic	0	37	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	41	19.61		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.G73E	ENST00000509841.1	37	c.218	CCDS58926.1	4	.	.	.	.	.	.	.	.	.	.	C	11.87	1.767477	0.31320	.	.	ENSG00000050730	ENST00000507879;ENST00000509841	T;T	0.53640	0.68;0.61	5.34	3.53	0.40419	.	.	.	.	.	T	0.36193	0.0958	.	.	.	0.80722	D	1	B	0.23540	0.087	B	0.19946	0.027	T	0.17592	-1.0364	8	0.52906	T	0.07	.	7.5889	0.28008	0.0:0.7835:0.0:0.2165	.	66	B4DVF5	.	E	66;73	ENSP00000427106:G66E;ENSP00000426613:G73E	ENSP00000427106:G66E	G	-	2	0	TNIP3	122304744	0.002000	0.14202	0.036000	0.18154	0.690000	0.40134	0.522000	0.22909	0.827000	0.34685	0.650000	0.86243	GGA	-	NULL		0.388	TNIP3-003	PUTATIVE	basic|appris_candidate_longest|CCDS	protein_coding	TNIP3	protein_coding	OTTHUMT00000364000.4	C	NM_024873	-		122085294	-1	no_errors	ENST00000509841	ensembl	human	putative	74_37	missense	SNP	0.575	T
LY6G6C	80740	genome.wustl.edu	37	6	31686914	31686914	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr6:31686914G>A	ENST00000375819.2	-	3	502	c.337C>T	c.(337-339)Ctt>Ttt	p.L113F	LY6G6C_ENST00000495859.1_Missense_Mutation_p.L57F	NM_025261.2	NP_079537.1	O95867	LY66C_HUMAN	lymphocyte antigen 6 complex, locus G6C	113						anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				NS(1)|large_intestine(1)|lung(1)|skin(1)	4						AAGGAGGTAAGGAAGACAAGG	0.612																																																	0								ENSG00000204421						103.0	93.0	97.0					6																	31686914		2203	4300	6503	LY6G6C	SO:0001583	missense	0			-	HGNC		CCDS4714.1	6p21	2008-08-29	2002-07-29	2002-08-01	ENSG00000204421	ENSG00000204421			13936	protein-coding gene	gene with protein product		610435	"""chromosome 6 open reading frame 24"""	C6orf24		10384126, 12079290	Standard	NM_025261		Approved	G6c, NG24	uc003nwh.3	O95867	OTTHUMG00000031251	ENST00000375819.2:c.337C>T	6.37:g.31686914G>A	ENSP00000364978:p.Leu113Phe	Somatic	0	38	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	50	19.35	Q5SRS8|Q8IY94	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.L113F	ENST00000375819.2	37	c.337	CCDS4714.1	6	.	.	.	.	.	.	.	.	.	.	g	11.03	1.517573	0.27123	.	.	ENSG00000204421	ENST00000495859;ENST00000375819	T;T	0.61510	0.1;0.12	4.98	2.0	0.26442	.	0.465144	0.18288	N	0.145802	T	0.19087	0.0458	L	0.27053	0.805	0.20307	N	0.999913	B	0.23735	0.09	B	0.23419	0.046	T	0.13469	-1.0508	10	0.41790	T	0.15	-16.2034	4.4903	0.11810	0.2049:0.1852:0.6099:0.0	.	113	O95867	LY66C_HUMAN	F	57;113	ENSP00000433207:L57F;ENSP00000364978:L113F	ENSP00000364978:L113F	L	-	1	0	LY6G6C	31794893	0.872000	0.30054	0.967000	0.41034	0.231000	0.25187	0.549000	0.23329	0.512000	0.28257	0.282000	0.19409	CTT	-	NULL		0.612	LY6G6C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LY6G6C	protein_coding	OTTHUMT00000076530.2	G		-		31686914	-1	no_errors	ENST00000375819	ensembl	human	known	74_37	missense	SNP	0.697	A
OXGR1	27199	genome.wustl.edu	37	13	97639515	97639515	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr13:97639515G>A	ENST00000298440.1	-	4	742	c.499C>T	c.(499-501)Ccg>Tcg	p.P167S	OXGR1_ENST00000543457.1_Missense_Mutation_p.P167S	NM_080818.3	NP_543008.3	Q96P68	OXGR1_HUMAN	oxoglutarate (alpha-ketoglutarate) receptor 1	167					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|large_intestine(1)|lung(9)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	15	all_neural(89;0.0982)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.186)			AAGGTCATCGGAATGACAGCT	0.458																																																	0								ENSG00000165621						138.0	102.0	114.0					13																	97639515		2203	4300	6503	OXGR1	SO:0001583	missense	0			-	HGNC	AF411109	CCDS9482.1	13q32.2	2014-04-09	2004-07-08	2004-07-09	ENSG00000165621	ENSG00000165621		"""GPCR / Class A : Orphans"""	4531	protein-coding gene	gene with protein product	"""2-oxoglutarate receptor 1"", ""alpha-ketoglutarate receptor 1"""	606922	"""G protein-coupled receptor 80"""	GPR99, GPR80		15141213, 12098360	Standard	NM_080818		Approved	P2RY15, P2Y15, aKGR	uc001vmx.1	Q96P68	OTTHUMG00000017236	ENST00000298440.1:c.499C>T	13.37:g.97639515G>A	ENSP00000298440:p.Pro167Ser	Somatic	0	35	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	31	27.91	Q5T5A7|Q86TL1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.P167S	ENST00000298440.1	37	c.499	CCDS9482.1	13	.	.	.	.	.	.	.	.	.	.	G	22.6	4.312001	0.81358	.	.	ENSG00000165621	ENST00000298440;ENST00000543457	T;T	0.50001	0.76;0.76	5.87	5.87	0.94306	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.72260	0.3438	M	0.78456	2.415	0.52099	D	0.999949	D	0.89917	1.0	D	0.97110	1.0	T	0.72581	-0.4250	10	0.66056	D	0.02	.	20.5827	0.99408	0.0:0.0:1.0:0.0	.	167	Q96P68	OXGR1_HUMAN	S	167	ENSP00000298440:P167S;ENSP00000438800:P167S	ENSP00000298440:P167S	P	-	1	0	OXGR1	96437516	1.000000	0.71417	0.989000	0.46669	0.899000	0.52679	5.499000	0.66937	2.941000	0.99782	0.655000	0.94253	CCG	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.458	OXGR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OXGR1	protein_coding	OTTHUMT00000045521.3	G	NM_080818	-		97639515	-1	no_errors	ENST00000298440	ensembl	human	known	74_37	missense	SNP	1.000	A
OR2L5	81466	genome.wustl.edu	37	1	248185768	248185768	+	Silent	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr1:248185768C>T	ENST00000355281.1	+	1	519	c.519C>T	c.(517-519)atC>atT	p.I173I	OR2L13_ENST00000366478.2_Intron	NM_001258284.1	NP_001245213.1	Q8NG80	OR2L5_HUMAN	olfactory receptor, family 2, subfamily L, member 5	173						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)										CCAGAGCCATCAATCATTTTT	0.428																																																	0								ENSG00000197454																																			OR2L5	SO:0001819	synonymous_variant	0			-	HGNC		CCDS58068.1	1q44	2012-08-09		2004-03-10	ENSG00000197454	ENSG00000197454		"""GPCR / Class A : Olfactory receptors"""	15011	protein-coding gene	gene with protein product				OR2L11, OR2L5P			Standard	NM_001258284		Approved		uc031psy.1	Q8NG80	OTTHUMG00000040194	ENST00000355281.1:c.519C>T	1.37:g.248185768C>T		Somatic	0	65	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	73	17.98	Q6IF04	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.I173	ENST00000355281.1	37	c.519	CCDS58068.1	1																																																																																			-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM		0.428	OR2L5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2L5	protein_coding	OTTHUMT00000096851.1	C		-		248185768	+1	no_errors	ENST00000355281	ensembl	human	known	74_37	silent	SNP	0.003	T
INHBA	3624	genome.wustl.edu	37	7	41729832	41729832	+	Nonsense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr7:41729832G>A	ENST00000242208.4	-	3	943	c.697C>T	c.(697-699)Cag>Tag	p.Q233*	INHBA_ENST00000442711.1_Nonsense_Mutation_p.Q233*|AC005027.3_ENST00000416150.1_RNA|INHBA_ENST00000464515.1_5'UTR	NM_002192.2	NP_002183.1	P08476	INHBA_HUMAN	inhibin, beta A	233					activin receptor signaling pathway (GO:0032924)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular response to cholesterol (GO:0071397)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|defense response (GO:0006952)|endodermal cell differentiation (GO:0035987)|erythrocyte differentiation (GO:0030218)|extrinsic apoptotic signaling pathway (GO:0097191)|eyelid development in camera-type eye (GO:0061029)|G1/S transition of mitotic cell cycle (GO:0000082)|growth (GO:0040007)|hair follicle development (GO:0001942)|hematopoietic progenitor cell differentiation (GO:0002244)|hemoglobin biosynthetic process (GO:0042541)|male gonad development (GO:0008584)|mesodermal cell differentiation (GO:0048333)|negative regulation of B cell differentiation (GO:0045578)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of follicle-stimulating hormone secretion (GO:0046882)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of phosphorylation (GO:0042326)|nervous system development (GO:0007399)|odontogenesis (GO:0042476)|ovarian follicle development (GO:0001541)|palate development (GO:0060021)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of follicle-stimulating hormone secretion (GO:0046881)|positive regulation of ovulation (GO:0060279)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|progesterone secretion (GO:0042701)|regulation of follicle-stimulating hormone secretion (GO:0046880)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to drug (GO:0042493)	activin A complex (GO:0043509)|extracellular region (GO:0005576)|inhibin A complex (GO:0043512)	cytokine activity (GO:0005125)|growth factor activity (GO:0008083)|hormone activity (GO:0005179)|identical protein binding (GO:0042802)|peptide hormone binding (GO:0017046)|type II activin receptor binding (GO:0070699)			biliary_tract(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(15)|lung(26)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55						CTCTTGCCCTGGTCCAGCAAC	0.562										TSP Lung(11;0.080)																																							0								ENSG00000122641						51.0	49.0	50.0					7																	41729832		2203	4300	6503	INHBA	SO:0001587	stop_gained	0			-	HGNC		CCDS5464.1	7p15-p13	2014-01-30	2007-07-30		ENSG00000122641	ENSG00000122641		"""Endogenous ligands"""	6066	protein-coding gene	gene with protein product		147290	"""inhibin, beta A (activin A, activin AB alpha polypeptide)"""			3345731	Standard	NM_002192		Approved		uc003thr.3	P08476	OTTHUMG00000023574	ENST00000242208.4:c.697C>T	7.37:g.41729832G>A	ENSP00000242208:p.Gln233*	Somatic	0	51	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	58	19.44	Q14599	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TGF-b_C,pfam_TGF-b_N,smart_TGF-b_C,prints_Inhibin_betaA,prints_Inhibin_asu	p.Q233*	ENST00000242208.4	37	c.697	CCDS5464.1	7	.	.	.	.	.	.	.	.	.	.	.	37	6.634614	0.97722	.	.	ENSG00000122641	ENST00000242208;ENST00000442711	.	.	.	6.06	6.06	0.98353	.	0.352984	0.31082	N	0.008290	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.38643	T	0.18	-26.8379	20.6208	0.99490	0.0:0.0:1.0:0.0	.	.	.	.	X	233	.	ENSP00000242208:Q233X	Q	-	1	0	INHBA	41696357	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	2.119000	0.41958	2.882000	0.98803	0.655000	0.94253	CAG	-	pfam_TGF-b_N		0.562	INHBA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INHBA	protein_coding	OTTHUMT00000250793.1	G		-		41729832	-1	no_errors	ENST00000242208	ensembl	human	known	74_37	nonsense	SNP	1.000	A
GEMIN5	25929	genome.wustl.edu	37	5	154305483	154305483	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr5:154305483G>A	ENST00000285873.7	-	8	1307	c.1232C>T	c.(1231-1233)tCc>tTc	p.S411F		NM_001252156.1|NM_015465.4	NP_001239085.1|NP_056280.2	Q8TEQ6	GEMI5_HUMAN	gem (nuclear organelle) associated protein 5	411					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|ncRNA metabolic process (GO:0034660)|protein complex assembly (GO:0006461)|RNA metabolic process (GO:0016070)|spliceosomal snRNP assembly (GO:0000387)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMN complex (GO:0032797)|SMN-Sm protein complex (GO:0034719)	poly(A) RNA binding (GO:0044822)|snRNA binding (GO:0017069)			breast(1)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(10)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	38	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			GTTCTTTATGGAGAGTGTATT	0.423																																																	0								ENSG00000082516						87.0	85.0	86.0					5																	154305483		2203	4300	6503	GEMIN5	SO:0001583	missense	0			-	HGNC	AK022748	CCDS4330.1	5q34	2013-01-10			ENSG00000082516	ENSG00000082516		"""WD repeat domain containing"""	20043	protein-coding gene	gene with protein product		607005				11714716	Standard	NM_015465		Approved		uc003lvx.3	Q8TEQ6	OTTHUMG00000130189	ENST00000285873.7:c.1232C>T	5.37:g.154305483G>A	ENSP00000285873:p.Ser411Phe	Somatic	0	22	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	47	17.54	Q14CV0|Q8WWV4|Q969W4|Q9H9K3|Q9UFI5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.S411F	ENST00000285873.7	37	c.1232	CCDS4330.1	5	.	.	.	.	.	.	.	.	.	.	G	29.2	4.987635	0.93106	.	.	ENSG00000082516	ENST00000285873	T	0.73047	-0.71	6.17	6.17	0.99709	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.058498	0.64402	D	0.000001	D	0.86682	0.5991	M	0.84219	2.685	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.85130	0.997;0.997	D	0.86731	0.1948	10	0.87932	D	0	-15.5731	20.8794	0.99867	0.0:0.0:1.0:0.0	.	410;411	B7ZLC9;Q8TEQ6	.;GEMI5_HUMAN	F	411	ENSP00000285873:S411F	ENSP00000285873:S411F	S	-	2	0	GEMIN5	154285676	1.000000	0.71417	0.991000	0.47740	0.985000	0.73830	6.728000	0.74769	2.941000	0.99782	0.655000	0.94253	TCC	-	superfamily_WD40_repeat_dom,pfscan_WD40_repeat_dom		0.423	GEMIN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GEMIN5	protein_coding	OTTHUMT00000252507.1	G		-		154305483	-1	no_errors	ENST00000285873	ensembl	human	known	74_37	missense	SNP	1.000	A
SRSF1	6426	genome.wustl.edu	37	17	56084432	56084432	+	Missense_Mutation	SNP	A	A	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr17:56084432A>T	ENST00000258962.4	-	1	275	c.67T>A	c.(67-69)Tta>Ata	p.L23I	SRSF1_ENST00000584773.1_Missense_Mutation_p.L23I|SRSF1_ENST00000581497.1_5'Flank|SRSF1_ENST00000582730.2_Missense_Mutation_p.L23I|SRSF1_ENST00000585096.1_Missense_Mutation_p.L23I|RP11-159D12.5_ENST00000578794.1_5'Flank	NM_006924.4	NP_008855.1	Q07955	SRSF1_HUMAN	serine/arginine-rich splicing factor 1	23	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cardiac muscle contraction (GO:0060048)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|mRNA 3'-end processing (GO:0031124)|mRNA 5'-splice site recognition (GO:0000395)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splice site selection (GO:0006376)|mRNA splicing, via spliceosome (GO:0000398)|regulation of mRNA splicing, via spliceosome (GO:0048024)|regulation of mRNA stability (GO:0043488)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(1)|lung(7)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						TCTGGAGGTAAGTTACCCACG	0.587																																																	0								ENSG00000136450						218.0	162.0	181.0					17																	56084432		2203	4300	6503	SRSF1	SO:0001583	missense	0			-	HGNC		CCDS11600.1, CCDS58580.1	17q22	2013-02-12	2010-06-22	2010-06-22	ENSG00000136450	ENSG00000136450		"""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10780	protein-coding gene	gene with protein product	"""splicing factor 2"", ""pre-mRNA-splicing factor SF2, P33 subunit"", ""alternate splicing factor"", ""SR splicing factor 1"""	600812	"""splicing factor, arginine/serine-rich 1"""	SFRS1		8530103, 20516191	Standard	NM_006924		Approved	ASF, SF2, SRp30a, SF2p33, MGC5228	uc002ivi.3	Q07955		ENST00000258962.4:c.67T>A	17.37:g.56084432A>T	ENSP00000258962:p.Leu23Ile	Somatic	0	42	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	62	20.51	B2R6Z7|D3DTZ3|Q13809	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.L23I	ENST00000258962.4	37	c.67	CCDS11600.1	17	.	.	.	.	.	.	.	.	.	.	A	15.16	2.751714	0.49362	.	.	ENSG00000136450	ENST00000258962	T	0.17054	2.3	6.11	2.59	0.31030	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.64402	D	0.000004	T	0.28134	0.0694	L	0.43646	1.37	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.01715	-1.1289	10	0.66056	D	0.02	.	6.3574	0.21408	0.4911:0.0:0.5089:0.0	.	55;23	Q59FA2;Q07955	.;SRSF1_HUMAN	I	23	ENSP00000258962:L23I	ENSP00000258962:L23I	L	-	1	2	SRSF1	53439431	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.610000	0.54125	0.566000	0.29273	0.533000	0.62120	TTA	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom		0.587	SRSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRSF1	protein_coding	OTTHUMT00000443335.1	A	NM_006924	-		56084432	-1	no_errors	ENST00000258962	ensembl	human	known	74_37	missense	SNP	1.000	T
PLCB4	5332	genome.wustl.edu	37	20	9370585	9370585	+	Silent	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr20:9370585C>T	ENST00000378493.1	+	13	1233	c.1218C>T	c.(1216-1218)ctC>ctT	p.L406L	PLCB4_ENST00000334005.3_Silent_p.L406L|PLCB4_ENST00000414679.2_Silent_p.L406L|PLCB4_ENST00000278655.4_Silent_p.L406L|PLCB4_ENST00000492632.1_3'UTR|PLCB4_ENST00000378473.3_Silent_p.L406L|PLCB4_ENST00000378501.2_Silent_p.L406L			Q15147	PLCB4_HUMAN	phospholipase C, beta 4	406	PI-PLC X-box. {ECO:0000255|PROSITE- ProRule:PRU00270}.				inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|dendrite (GO:0030425)|nucleus (GO:0005634)|postsynaptic density (GO:0014069)|smooth endoplasmic reticulum (GO:0005790)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			NS(2)|breast(4)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(11)|liver(4)|lung(34)|ovary(3)|pancreas(1)|prostate(1)|skin(19)|upper_aerodigestive_tract(1)	87						CTGTAATTCTCTCCTTTGAAA	0.368																																																	0								ENSG00000101333						124.0	122.0	123.0					20																	9370585		2203	4300	6503	PLCB4	SO:0001819	synonymous_variant	0			-	HGNC		CCDS13104.1, CCDS13105.1, CCDS54447.1	20p12	2008-03-18			ENSG00000101333	ENSG00000101333	3.1.4.11		9059	protein-coding gene	gene with protein product		600810				8530101	Standard	NM_000933		Approved		uc021wam.1	Q15147	OTTHUMG00000031853	ENST00000378493.1:c.1218C>T	20.37:g.9370585C>T		Somatic	0	22	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	35	14.63	B7ZLK6|E2QRH8|Q17R56|Q5JYS8|Q5JYS9|Q5JYT0|Q5JYT3|Q5JYT4|Q9BQW5|Q9BQW6|Q9BQW8|Q9UJQ2	Silent	SNP	NA	NA	NA	NA	NA	NA	pirsf_PLC-beta,pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_PLipase_C_EF-hand-like,pfam_PLC-beta_CS,pfam_C2_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_dom,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_dom,prints_Pinositol_PLipase_C,pfscan_C2_dom,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y	p.L406	ENST00000378493.1	37	c.1218	CCDS13105.1	20																																																																																			-	pirsf_PLC-beta,pfam_PLipase_C_PInositol-sp_X_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,smart_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_PInositol-sp_X_dom		0.368	PLCB4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLCB4	protein_coding	OTTHUMT00000077948.2	C		-		9370585	+1	no_errors	ENST00000334005	ensembl	human	known	74_37	silent	SNP	1.000	T
NWD2	57495	genome.wustl.edu	37	4	37446810	37446810	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr4:37446810C>T	ENST00000309447.5	+	7	4048	c.3200C>T	c.(3199-3201)tCc>tTc	p.S1067F		NM_001144990.1	NP_001138462.1	Q9ULI1	NWD2_HUMAN		1067										breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(1)|prostate(2)|skin(2)	16						TTTACACTGTCCGCCAACCAC	0.493																																																	0								ENSG00000174145						147.0	119.0	127.0					4																	37446810		692	1591	2283	KIAA1239	SO:0001583	missense	0			-	HGNC																												ENST00000309447.5:c.3200C>T	4.37:g.37446810C>T	ENSP00000309501:p.Ser1067Phe	Somatic	0	25	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	29	12.12	A8MRU1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_WD40_repeat_dom,superfamily_P-loop_NTPase,smart_WD40_repeat,pfscan_WD40_repeat_dom	p.S1067F	ENST00000309447.5	37	c.3200	CCDS47040.1	4	.	.	.	.	.	.	.	.	.	.	C	14.74	2.624711	0.46840	.	.	ENSG00000174145	ENST00000309447	T	0.71698	-0.59	5.86	5.86	0.93980	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.76969	0.4062	L	0.27053	0.805	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	T	0.73569	-0.3941	10	0.30854	T	0.27	.	20.1823	0.98208	0.0:1.0:0.0:0.0	.	1067	Q9ULI1	K1239_HUMAN	F	1067	ENSP00000309501:S1067F	ENSP00000309501:S1067F	S	+	2	0	KIAA1239	37123205	1.000000	0.71417	0.906000	0.35671	0.104000	0.19210	7.487000	0.81328	2.771000	0.95319	0.650000	0.86243	TCC	-	superfamily_WD40_repeat_dom		0.493	KIAA1239-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1239	protein_coding	OTTHUMT00000347551.2	C		-		37446810	+1	no_errors	ENST00000309447	ensembl	human	known	74_37	missense	SNP	1.000	T
CNTN6	27255	genome.wustl.edu	37	3	1418690	1418690	+	Splice_Site	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr3:1418690C>T	ENST00000446702.2	+	17	2724	c.2097C>T	c.(2095-2097)gtC>gtT	p.V699V	CNTN6_ENST00000350110.2_Splice_Site_p.V699V|CNTN6_ENST00000539053.1_Splice_Site_p.V627V			Q9UQ52	CNTN6_HUMAN	contactin 6	699					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|Notch signaling pathway (GO:0007219)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(34)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	90		all_cancers(2;0.000164)|all_epithelial(2;0.107)		Epithelial(13;0.000233)|all cancers(10;0.0013)|OV - Ovarian serous cystadenocarcinoma(96;0.0139)		TATTTTTAGTCCCTGTTGTGG	0.383																																																	0								ENSG00000134115						178.0	170.0	173.0					3																	1418690		2203	4300	6503	CNTN6	SO:0001630	splice_region_variant	0			-	HGNC	AB003592	CCDS2557.1	3p26-p25	2013-02-11			ENSG00000134115	ENSG00000134115		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	2176	protein-coding gene	gene with protein product	"""neural adhesion molecule"""	607220				9486763	Standard	NM_014461		Approved	NB-3	uc003bpa.3	Q9UQ52	OTTHUMG00000119030	ENST00000446702.2:c.2096-1C>T	3.37:g.1418690C>T		Somatic	0	57	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	81	19.80	Q2KHM2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.V699	ENST00000446702.2	37	c.2097	CCDS2557.1	3																																																																																			-	NULL		0.383	CNTN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTN6	protein_coding	OTTHUMT00000239235.2	C	NM_014461	-	Silent	1418690	+1	no_errors	ENST00000350110	ensembl	human	known	74_37	silent	SNP	1.000	T
ACTG2	72	genome.wustl.edu	37	2	74146599	74146599	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr2:74146599G>A	ENST00000409624.1	+	10	1671	c.1028G>A	c.(1027-1029)gGg>gAg	p.G343E	ACTG2_ENST00000345517.3_Missense_Mutation_p.G343E|ACTG2_ENST00000409731.3_Missense_Mutation_p.G300E			P63267	ACTH_HUMAN	actin, gamma 2, smooth muscle, enteric	343					muscle contraction (GO:0006936)	blood microparticle (GO:0072562)|cell periphery (GO:0071944)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)			large_intestine(3)|lung(14)|skin(1)	18						GTCTGGATCGGGGGCTCTATC	0.532																																																	0								ENSG00000163017						81.0	84.0	83.0					2																	74146599		2203	4300	6503	ACTG2	SO:0001583	missense	0			-	HGNC		CCDS1930.1, CCDS56124.1	2p13.1	2008-05-20			ENSG00000163017	ENSG00000163017			145	protein-coding gene	gene with protein product		102545		ACTL3, ACTA3		1710027, 1673027	Standard	NM_001199893		Approved	ACTSG	uc002sjw.3	P63267	OTTHUMG00000129813	ENST00000409624.1:c.1028G>A	2.37:g.74146599G>A	ENSP00000386857:p.Gly343Glu	Somatic	0	61	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	61	10.29	B2R7E7|B4E315|D6W5H8|E9PG30|P12718|Q504R1|Q6FI22	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Actin-related,smart_Actin-related,prints_Actin-related	p.G343E	ENST00000409624.1	37	c.1028	CCDS1930.1	2	.	.	.	.	.	.	.	.	.	.	G	16.96	3.265937	0.59540	.	.	ENSG00000163017	ENST00000409731;ENST00000345517;ENST00000409624	D;D;D	0.99906	-7.75;-7.75;-7.75	4.95	4.06	0.47325	.	0.374825	0.20808	N	0.085303	D	0.99951	0.9979	H	0.99962	5.075	0.46028	D	0.998824	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96102	0.9070	10	0.87932	D	0	.	13.9034	0.63819	0.0:0.0:0.846:0.154	.	300;343	E9PG30;P63267	.;ACTH_HUMAN	E	300;343;343	ENSP00000386929:G300E;ENSP00000295137:G343E;ENSP00000386857:G343E	ENSP00000295137:G343E	G	+	2	0	ACTG2	74000107	1.000000	0.71417	0.881000	0.34555	0.944000	0.59088	9.601000	0.98297	1.421000	0.47157	0.591000	0.81541	GGG	-	pfam_Actin-related,smart_Actin-related		0.532	ACTG2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ACTG2	protein_coding	OTTHUMT00000328086.1	G	NM_001615	-		74146599	+1	no_errors	ENST00000345517	ensembl	human	known	74_37	missense	SNP	1.000	A
MYO7B	4648	genome.wustl.edu	37	2	128341770	128341770	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr2:128341770G>A	ENST00000409816.2	+	12	1449	c.1417G>A	c.(1417-1419)Gag>Aag	p.E473K	MYO7B_ENST00000389524.4_Missense_Mutation_p.E473K|MYO7B_ENST00000428314.1_Missense_Mutation_p.E473K			Q6PIF6	MYO7B_HUMAN	myosin VIIB	473	Myosin motor.					extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(46)|ovary(3)|pancreas(1)|prostate(3)|urinary_tract(1)	75	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0753)		GTTCACCATGGAGCAAGAGGA	0.582																																																	0								ENSG00000169994						78.0	84.0	82.0					2																	128341770		2201	4300	6501	MYO7B	SO:0001583	missense	0			-	HGNC		CCDS46405.1	2q21.1	2011-09-27			ENSG00000169994	ENSG00000169994		"""Myosins / Myosin superfamily : Class VII"""	7607	protein-coding gene	gene with protein product		606541				8022818, 8884266	Standard	NM_001080527		Approved		uc002top.3	Q6PIF6	OTTHUMG00000153419	ENST00000409816.2:c.1417G>A	2.37:g.128341770G>A	ENSP00000386461:p.Glu473Lys	Somatic	0	49	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	53	17.19	Q14786|Q8TEE1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Myosin_head_motor_dom,pfam_MyTH4_dom,pfam_FERM_central,pfam_IQ_motif_EF-hand-BS,pfam_SH3_2,superfamily_P-loop_NTPase,superfamily_FERM_central,superfamily_SH3_domain,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,smart_MyTH4_dom,smart_Band_41_domain,smart_SH3_domain,pfscan_FERM_domain,pfscan_IQ_motif_EF-hand-BS,pfscan_MyTH4_dom,pfscan_SH3_domain,prints_Myosin_head_motor_dom	p.E473K	ENST00000409816.2	37	c.1417	CCDS46405.1	2	.	.	.	.	.	.	.	.	.	.	G	35	5.571173	0.96553	.	.	ENSG00000169994	ENST00000389524;ENST00000428314;ENST00000409816	D;D;D	0.91996	-2.95;-2.95;-2.95	4.7	4.7	0.59300	Myosin head, motor domain (2);	0.000000	0.85682	D	0.000000	D	0.97841	0.9291	H	0.98351	4.21	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99357	1.0916	10	0.87932	D	0	.	18.1758	0.89761	0.0:0.0:1.0:0.0	.	473	Q6PIF6	MYO7B_HUMAN	K	473	ENSP00000374175:E473K;ENSP00000415090:E473K;ENSP00000386461:E473K	ENSP00000374175:E473K	E	+	1	0	MYO7B	128058240	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.531000	0.98054	2.603000	0.88011	0.655000	0.94253	GAG	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom		0.582	MYO7B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MYO7B	protein_coding	OTTHUMT00000331124.3	G	XM_291001	-		128341770	+1	no_errors	ENST00000389524	ensembl	human	known	74_37	missense	SNP	1.000	A
SLC13A1	6561	genome.wustl.edu	37	7	122759271	122759271	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr7:122759271C>T	ENST00000194130.2	-	13	1415	c.1376G>A	c.(1375-1377)gGa>gAa	p.G459E	SLC13A1_ENST00000539873.1_3'UTR	NM_022444.3	NP_071889.2	Q9BZW2	S13A1_HUMAN	solute carrier family 13 (sodium/sulfate symporter), member 1	459					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium:sulfate symporter activity (GO:0015382)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(20)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	45					Succinic acid(DB00139)	TAATTTATTTCCTATCCACTT	0.323																																																	0								ENSG00000081800						70.0	75.0	73.0					7																	122759271		2203	4300	6503	SLC13A1	SO:0001583	missense	0			-	HGNC		CCDS5786.1	7q31.32	2013-07-18	2013-07-18		ENSG00000081800	ENSG00000081800		"""Solute carriers"""	10916	protein-coding gene	gene with protein product		606193	"""solute carrier family 13 (sodium/sulphate symporters), member 1"""			11161786	Standard	NM_022444		Approved	NaSi-1, NAS1	uc003vkm.3	Q9BZW2	OTTHUMG00000157087	ENST00000194130.2:c.1376G>A	7.37:g.122759271C>T	ENSP00000194130:p.Gly459Glu	Somatic	0	40	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	22	29.03	Q9H5Z0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Na/sul_symport,pfam_Cit_transptr-like_dom	p.G459E	ENST00000194130.2	37	c.1376	CCDS5786.1	7	.	.	.	.	.	.	.	.	.	.	C	17.93	3.508554	0.64410	.	.	ENSG00000081800	ENST00000194130	T	0.04706	3.57	5.53	4.62	0.57501	.	0.106551	0.64402	D	0.000008	T	0.32164	0.0820	H	0.95950	3.745	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.70935	0.971;0.971	T	0.52480	-0.8570	10	0.87932	D	0	.	14.5294	0.67915	0.0:0.501:0.499:0.0	.	459;459	A4D0X1;Q9BZW2	.;S13A1_HUMAN	E	459	ENSP00000194130:G459E	ENSP00000194130:G459E	G	-	2	0	SLC13A1	122546507	0.652000	0.27349	1.000000	0.80357	0.943000	0.58893	1.238000	0.32707	1.219000	0.43474	0.591000	0.81541	GGA	-	pfam_Na/sul_symport,pfam_Cit_transptr-like_dom		0.323	SLC13A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC13A1	protein_coding	OTTHUMT00000347404.1	C	NM_022444	-		122759271	-1	no_errors	ENST00000194130	ensembl	human	known	74_37	missense	SNP	0.895	T
WDR11	55717	genome.wustl.edu	37	10	122667788	122667789	+	Intron	INS	-	-	TGGGAGAATC	rs113007277|rs66794027|rs59747906|rs201192870	byFrequency	TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr10:122667788_122667789insTGGGAGAATC	ENST00000263461.6	+	29	3763				WDR11_ENST00000604509.1_Intron	NM_018117.11	NP_060587.8	Q8WWQ0	PHIP_HUMAN	WD repeat domain 11						cytoskeleton organization (GO:0007010)|insulin receptor signaling pathway (GO:0008286)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell morphogenesis (GO:0022604)|regulation of growth (GO:0040008)|regulation of protein phosphorylation (GO:0001932)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	insulin receptor binding (GO:0005158)|lysine-acetylated histone binding (GO:0070577)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(9)|prostate(2)|skin(2)|stomach(5)	38						AGTGTAGGTTATGGGAGGATGT	0.455														3247	0.648363	0.8427	0.634	5008	,	,		16749	0.5179		0.5865	False		,,,				2504	0.5941																0								ENSG00000120008																																			WDR11	SO:0001627	intron_variant	0				HGNC	AF320223	CCDS7619.1	10q26	2013-01-21	2010-01-06	2010-01-06	ENSG00000120008	ENSG00000120008		"""WD repeat domain containing"""	13831	protein-coding gene	gene with protein product		606417	"""bromodomain and WD repeat domain containing 2"""	BRWD2		10718198, 11536051	Standard	NM_018117		Approved	KIAA1351, FLJ10506, WDR15, HH14, DR11	uc021pzt.1	Q9BZH6	OTTHUMG00000019171	ENST00000263461.6:c.3518-279->TGGGAGAATC	10.37:g.122667788_122667789insTGGGAGAATC		Somatic	NA	NA	NA		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A7J992|B2RPK4|Q05CQ9|Q5VVH4|Q66I29|Q69YV1|Q8NBZ5|Q96H52|Q96ME2|Q9H261	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000263461.6	37	NULL	CCDS7619.1	10																																																																																			-	-		0.455	WDR11-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	WDR11	protein_coding	OTTHUMT00000050707.2	-				122667789	+1	no_errors	ENST00000604714	ensembl	human	known	74_37	rna	INS	0.000:0.086	TGGGAGAATC
WEE2	494551	genome.wustl.edu	37	7	141427177	141427177	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr7:141427177C>T	ENST00000397541.2	+	10	1872	c.1466C>T	c.(1465-1467)tCc>tTc	p.S489F	WEE2-AS1_ENST00000462383.1_RNA|WEE2-AS1_ENST00000459753.1_RNA|WEE2-AS1_ENST00000488785.1_RNA|WEE2-AS1_ENST00000465110.1_RNA|RNU1-82P_ENST00000390851.1_RNA|WEE2-AS1_ENST00000478332.1_RNA|WEE2-AS1_ENST00000486906.1_RNA|WEE2-AS1_ENST00000484172.1_RNA|WEE2-AS1_ENST00000495800.1_RNA|WEE2-AS1_ENST00000471512.1_RNA	NM_001105558.1	NP_001099028.1	P0C1S8	WEE2_HUMAN	WEE1 homolog 2 (S. pombe)	489					female meiotic division (GO:0007143)|female pronucleus assembly (GO:0035038)|mitotic nuclear division (GO:0007067)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of oocyte maturation (GO:1900194)|regulation of meiosis I (GO:0060631)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|skin(2)|stomach(1)	31	Melanoma(164;0.0171)					CTCCGGCCTTCCCTGGGAAAA	0.468																																																	0								ENSG00000214102						118.0	117.0	117.0					7																	141427177		1850	4093	5943	WEE2	SO:0001583	missense	0			-	HGNC	AK131218	CCDS43660.1	7q32	2008-07-02			ENSG00000214102	ENSG00000214102			19684	protein-coding gene	gene with protein product		614084					Standard	NM_001105558		Approved	FLJ16107	uc003vwn.2	P0C1S8	OTTHUMG00000157536	ENST00000397541.2:c.1466C>T	7.37:g.141427177C>T	ENSP00000380675:p.Ser489Phe	Somatic	0	44	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	32	33.33		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Wee1-like_protein_kinase,pfscan_Prot_kinase_dom	p.S489F	ENST00000397541.2	37	c.1466	CCDS43660.1	7	.	.	.	.	.	.	.	.	.	.	C	4.343	0.063010	0.08388	.	.	ENSG00000214102	ENST00000397541	T	0.38887	1.11	5.6	2.81	0.32909	Protein kinase-like domain (1);	0.498360	0.20028	N	0.100776	T	0.29061	0.0722	L	0.46157	1.445	0.18873	N	0.999988	B	0.13145	0.007	B	0.08055	0.003	T	0.28618	-1.0038	10	0.08837	T	0.75	.	7.1265	0.25475	0.0:0.5918:0.2657:0.1424	.	489	P0C1S8	WEE2_HUMAN	F	489	ENSP00000380675:S489F	ENSP00000380675:S489F	S	+	2	0	WEE2	141073646	0.043000	0.20138	0.364000	0.25888	0.038000	0.13279	0.478000	0.22212	0.401000	0.25424	-0.127000	0.14921	TCC	-	superfamily_Kinase-like_dom,pirsf_Wee1-like_protein_kinase		0.468	WEE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WEE2	protein_coding	OTTHUMT00000349091.1	C	NM_001105558	-		141427177	+1	no_errors	ENST00000397541	ensembl	human	known	74_37	missense	SNP	0.467	T
OR5D14	219436	genome.wustl.edu	37	11	55563415	55563415	+	Silent	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr11:55563415C>T	ENST00000335605.1	+	1	384	c.384C>T	c.(382-384)atC>atT	p.I128I		NM_001004735.1	NP_001004735.1	Q8NGL3	OR5DE_HUMAN	olfactory receptor, family 5, subfamily D, member 14	128						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(30)|ovary(2)|prostate(1)|skin(2)|stomach(3)|urinary_tract(1)	48		all_epithelial(135;0.196)				TTGTGGCCATCTGCAATCCTC	0.537																																																	0								ENSG00000186113						105.0	91.0	96.0					11																	55563415		2200	4296	6496	OR5D14	SO:0001819	synonymous_variant	0			-	HGNC	AB065779	CCDS31508.1	11q11	2012-08-09			ENSG00000186113	ENSG00000186113		"""GPCR / Class A : Olfactory receptors"""	15281	protein-coding gene	gene with protein product							Standard	NM_001004735		Approved		uc010rim.2	Q8NGL3	OTTHUMG00000166809	ENST00000335605.1:c.384C>T	11.37:g.55563415C>T		Somatic	0	77	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	89	15.89	Q6IF69|Q6IFD4|Q96RB5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.I128	ENST00000335605.1	37	c.384	CCDS31508.1	11																																																																																			-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.537	OR5D14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5D14	protein_coding	OTTHUMT00000391513.1	C	NM_001004735	-		55563415	+1	no_errors	ENST00000335605	ensembl	human	known	74_37	silent	SNP	0.994	T
ZNF335	63925	genome.wustl.edu	37	20	44582452	44582452	+	Nonsense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr20:44582452G>A	ENST00000322927.2	-	18	2678	c.2578C>T	c.(2578-2580)Cag>Tag	p.Q860*	ZNF335_ENST00000426788.1_Nonsense_Mutation_p.Q705*	NM_022095.3	NP_071378.1	Q9H4Z2	ZN335_HUMAN	zinc finger protein 335	860					brain development (GO:0007420)|brain morphogenesis (GO:0048854)|cerebral cortex neuron differentiation (GO:0021895)|histone H3-K4 trimethylation (GO:0080182)|in utero embryonic development (GO:0001701)|neuron projection morphogenesis (GO:0048812)|positive regulation of lymphocyte proliferation (GO:0050671)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of neurogenesis (GO:0050769)|regulation of gene expression, epigenetic (GO:0040029)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(13)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	51		Myeloproliferative disorder(115;0.0122)				GGGCCTAGCTGGCTCTCGGCT	0.647																																																	0								ENSG00000198026						74.0	63.0	66.0					20																	44582452		2203	4300	6503	ZNF335	SO:0001587	stop_gained	0			-	HGNC	AK026157	CCDS13389.1	20q13.12	2011-09-12			ENSG00000198026	ENSG00000198026		"""Zinc fingers, C2H2-type"""	15807	protein-coding gene	gene with protein product	"""NRC-interacting factor 1"""	610827				12215545, 19131338	Standard	NM_022095		Approved	bA465L10.2, NIF-1	uc002xqw.3	Q9H4Z2	OTTHUMG00000032637	ENST00000322927.2:c.2578C>T	20.37:g.44582452G>A	ENSP00000325326:p.Gln860*	Somatic	0	56	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	77	17.20	B4DLG7|Q548D0|Q9H684	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Q860*	ENST00000322927.2	37	c.2578	CCDS13389.1	20	.	.	.	.	.	.	.	.	.	.	G	37	6.162494	0.97338	.	.	ENSG00000198026	ENST00000322927;ENST00000243961;ENST00000426788	.	.	.	5.15	4.2	0.49525	.	0.235442	0.34700	N	0.003758	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07325	T	0.83	-17.6722	13.346	0.60573	0.0:0.1576:0.8424:0.0	.	.	.	.	X	860;637;705	.	ENSP00000243961:Q637X	Q	-	1	0	ZNF335	44015859	1.000000	0.71417	1.000000	0.80357	0.313000	0.28021	4.736000	0.62059	1.400000	0.46741	0.655000	0.94253	CAG	-	NULL		0.647	ZNF335-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF335	protein_coding	OTTHUMT00000079553.1	G	NM_022095	-		44582452	-1	no_errors	ENST00000322927	ensembl	human	known	74_37	nonsense	SNP	0.971	A
RAB31	11031	genome.wustl.edu	37	18	9815151	9815151	+	Silent	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr18:9815151G>A	ENST00000578921.1	+	5	553	c.312G>A	c.(310-312)ctG>ctA	p.L104L		NM_006868.3	NP_006859.2	Q13636	RAB31_HUMAN	RAB31, member RAS oncogene family	103					cellular response to insulin stimulus (GO:0032869)|Golgi to plasma membrane protein transport (GO:0043001)|GTP catabolic process (GO:0006184)|phagosome maturation (GO:0090382)|receptor internalization (GO:0031623)|regulated secretory pathway (GO:0045055)|small GTPase mediated signal transduction (GO:0007264)	early endosome (GO:0005769)|phagocytic vesicle (GO:0045335)|trans-Golgi network membrane (GO:0032588)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(2)|endometrium(2)|large_intestine(2)|lung(3)|skin(1)	10						TCAAGGAGCTGAAAGAACATG	0.368																																																	0								ENSG00000168461						72.0	74.0	73.0					18																	9815151		1922	4102	6024	RAB31	SO:0001819	synonymous_variant	0			-	HGNC	U59877	CCDS45826.1	18p11.22	2014-03-18			ENSG00000168461	ENSG00000168461		"""RAB, member RAS oncogene"""	9771	protein-coding gene	gene with protein product		605694				8863739	Standard	NM_006868		Approved	Rab22B	uc002kog.2	Q13636	OTTHUMG00000178513	ENST00000578921.1:c.312G>A	18.37:g.9815151G>A		Somatic	0	41	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	67	8.00	B2RBT7|Q15770|Q9HC00	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Gtr1_RagA,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.L104	ENST00000578921.1	37	c.312	CCDS45826.1	18																																																																																			-	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Gtr1_RagA,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,tigrfam_Small_GTP-bd_dom		0.368	RAB31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB31	protein_coding	OTTHUMT00000442280.3	G		-		9815151	+1	no_errors	ENST00000578921	ensembl	human	known	74_37	silent	SNP	1.000	A
MUC2	4583	genome.wustl.edu	37	11	1084347	1084347	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr11:1084347G>A	ENST00000441003.2	+	19	2506	c.2479G>A	c.(2479-2481)Gac>Aac	p.D827N	MUC2_ENST00000359061.5_Missense_Mutation_p.D827N	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	827					cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	CCATAACAACGACCTGTATTC	0.632																																																	0								ENSG00000198788						96.0	108.0	104.0					11																	1084347		2155	4260	6415	MUC2	SO:0001583	missense	0			-	HGNC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.2479G>A	11.37:g.1084347G>A	ENSP00000415183:p.Asp827Asn	Somatic	0	91	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	87	13.86	Q14878	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,superfamily_Prot_inh_PMP,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.D827N	ENST00000441003.2	37	c.2479		11	.	.	.	.	.	.	.	.	.	.	G	3.159	-0.172553	0.06421	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.31510	1.49;1.49	4.22	2.19	0.27852	.	1.641150	0.03993	N	0.295255	T	0.21347	0.0514	N	0.25094	0.71	0.09310	N	1	B	0.31351	0.32	B	0.24848	0.056	T	0.22941	-1.0202	10	0.17832	T	0.49	.	10.0388	0.42144	0.0:0.1504:0.6935:0.1561	.	827	E7EUV1	.	N	827	ENSP00000415183:D827N;ENSP00000351956:D827N	ENSP00000351956:D827N	D	+	1	0	MUC2	1074347	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	0.910000	0.28571	0.349000	0.23975	0.555000	0.69702	GAC	-	smart_VWC_out,smart_VWF_C		0.632	MUC2-001	KNOWN	basic|appris_principal	protein_coding	MUC2	protein_coding	OTTHUMT00000345894.2	G	NM_002457	-		1084347	+1	no_errors	ENST00000441003	ensembl	human	known	74_37	missense	SNP	0.001	A
BRINP3	339479	genome.wustl.edu	37	1	190423993	190423993	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr1:190423993C>T	ENST00000367462.3	-	2	259	c.28G>A	c.(28-30)Gaa>Aaa	p.E10K	BRINP3_ENST00000534846.1_5'UTR	NM_199051.1	NP_950252.1	Q76B58	BRNP3_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 3	10					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)											GAGAACAATTCAGCACCAGCT	0.488																																																	0								ENSG00000162670						77.0	77.0	77.0					1																	190423993		2203	4300	6503	BRINP3	SO:0001583	missense	0			-	HGNC	AB111893	CCDS1373.1	1q31.1	2013-09-18	2013-09-18	2013-09-18	ENSG00000162670	ENSG00000162670			22393	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member C"""	FAM5C		16018821, 15193423	Standard	NM_199051		Approved	DBCCR1L, DBCCR1L1	uc001gse.1	Q76B58	OTTHUMG00000035533	ENST00000367462.3:c.28G>A	1.37:g.190423993C>T	ENSP00000356432:p.Glu10Lys	Somatic	0	50	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	40	16.67	B3KVP1|B7Z260|O95726|Q2M330	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MACPF,smart_MACPF	p.E10K	ENST00000367462.3	37	c.28	CCDS1373.1	1	.	.	.	.	.	.	.	.	.	.	C	12.38	1.920968	0.33908	.	.	ENSG00000162670	ENST00000367462;ENST00000445957	T;T	0.42131	2.56;0.98	5.57	4.66	0.58398	.	0.268305	0.32518	N	0.006000	T	0.23451	0.0567	N	0.08118	0	0.80722	D	1	B	0.25667	0.131	B	0.19666	0.026	T	0.05500	-1.0881	10	0.38643	T	0.18	.	12.1985	0.54311	0.0:0.9176:0.0:0.0824	.	10	Q76B58	FAM5C_HUMAN	K	10	ENSP00000356432:E10K;ENSP00000393441:E10K	ENSP00000356432:E10K	E	-	1	0	FAM5C	188690616	1.000000	0.71417	1.000000	0.80357	0.821000	0.46438	5.457000	0.66672	1.363000	0.46019	-0.136000	0.14681	GAA	-	NULL		0.488	BRINP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRINP3	protein_coding	OTTHUMT00000086278.1	C	NM_199051	-		190423993	-1	no_errors	ENST00000367462	ensembl	human	known	74_37	missense	SNP	1.000	T
FGFR4	2264	genome.wustl.edu	37	5	176517791	176517791	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr5:176517791G>A	ENST00000292408.4	+	4	646	c.401G>A	c.(400-402)aGg>aAg	p.R134K	FGFR4_ENST00000393648.2_Missense_Mutation_p.R134K|FGFR4_ENST00000393637.1_Missense_Mutation_p.R134K|FGFR4_ENST00000292410.3_Missense_Mutation_p.R134K|FGFR4_ENST00000502906.1_Missense_Mutation_p.R134K	NM_002011.3|NM_213647.1	NP_002002.3|NP_998812.1	P22455	FGFR4_HUMAN	fibroblast growth factor receptor 4	134					alveolar secondary septum development (GO:0061144)|cell migration (GO:0016477)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose homeostasis (GO:0042593)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ induction (GO:0001759)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphate ion homeostasis (GO:0055062)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of metalloenzyme activity (GO:0048554)|positive regulation of proteolysis (GO:0045862)|protein autophosphorylation (GO:0046777)|regulation of bile acid biosynthetic process (GO:0070857)|regulation of cholesterol homeostasis (GO:2000188)|regulation of extracellular matrix disassembly (GO:0010715)|regulation of lipid metabolic process (GO:0019216)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|heparin binding (GO:0008201)|protein tyrosine kinase activity (GO:0004713)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(16)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	34	all_cancers(89;5.93e-05)|Renal(175;0.000269)|Lung NSC(126;0.0088)|all_lung(126;0.0142)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Palifermin(DB00039)|Ponatinib(DB08901)	AAGTCCCATAGGGACCCCTCG	0.567										TSP Lung(9;0.080)																																							0								ENSG00000160867						115.0	106.0	109.0					5																	176517791		2203	4300	6503	FGFR4	SO:0001583	missense	0			-	HGNC	AF202063	CCDS4410.1, CCDS4411.1	5q35.2	2013-09-19			ENSG00000160867	ENSG00000160867		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3691	protein-coding gene	gene with protein product		134935					Standard	XM_005265837		Approved	JTK2, CD334	uc003mfm.3	P22455	OTTHUMG00000151523	ENST00000292408.4:c.401G>A	5.37:g.176517791G>A	ENSP00000292408:p.Arg134Lys	Somatic	0	87	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	83	21.70	G3JVM2|G3JVM5|G3JVM7|G3JVM9|O43785|Q14309|Q71TW8|Q8TDA0|Q96KE5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_FGF_rcpt_fam,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.R134K	ENST00000292408.4	37	c.401	CCDS4410.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	2.272|2.272	-0.366854|-0.366854	0.05069|0.05069	.|.	.|.	ENSG00000160867|ENSG00000160867	ENST00000377207|ENST00000292408;ENST00000503708;ENST00000393648;ENST00000502906;ENST00000292410;ENST00000393637	.|T;T;T;T;T;T	.|0.78364	.|-1.17;-0.89;-1.11;-1.17;-1.17;-1.17	5.01|5.01	0.895|0.895	0.19247|0.19247	.|.	7739.210000|.	0.00166|.	N|.	0.000000|.	T|T	0.52240|0.52240	0.1722|0.1722	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	.|B;B;B;B;B	.|0.16802	.|0.002;0.019;0.0;0.012;0.0	.|B;B;B;B;B	.|0.14578	.|0.001;0.011;0.001;0.008;0.001	T|T	0.33445|0.33445	-0.9868|-0.9868	7|9	0.87932|0.19147	D|T	0|0.46	.|.	4.3323|4.3323	0.11069|0.11069	0.282:0.0:0.566:0.1521|0.282:0.0:0.566:0.1521	.|.	.|134;134;134;134;134	.|B5A965;B4DVP5;P22455-2;E7EWF4;P22455	.|.;.;.;.;FGFR4_HUMAN	R|K	209|134	.|ENSP00000292408:R134K;ENSP00000424905:R134K;ENSP00000377259:R134K;ENSP00000424960:R134K;ENSP00000292410:R134K;ENSP00000377254:R134K	ENSP00000366412:G209R|ENSP00000292408:R134K	G|R	+|+	1|2	0|0	FGFR4|FGFR4	176450397|176450397	0.014000|0.014000	0.17966|0.17966	0.000000|0.000000	0.03702|0.03702	0.047000|0.047000	0.14425|0.14425	1.513000|1.513000	0.35823|0.35823	0.102000|0.102000	0.17638|0.17638	-0.678000|-0.678000	0.03780|0.03780	GGG|AGG	-	pirsf_FGF_rcpt_fam		0.567	FGFR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGFR4	protein_coding	OTTHUMT00000253410.1	G		-		176517791	+1	no_errors	ENST00000292408	ensembl	human	known	74_37	missense	SNP	0.001	A
LINC00639	283547	genome.wustl.edu	37	14	39304592	39304592	+	lincRNA	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr14:39304592G>A	ENST00000553932.1	-	0	3827									long intergenic non-protein coding RNA 639																		AACAGAGAATGATGGAGAAGC	0.567																																																	0								ENSG00000259070																																			LINC00639			0			-	HGNC	AK125018, AK127318, BC035119		14q21.1	2012-10-12			ENSG00000259070	ENSG00000259070		"""Long non-coding RNAs"""	27502	non-coding RNA	RNA, long non-coding							Standard	NR_039982		Approved		uc001wun.3		OTTHUMG00000170746		14.37:g.39304592G>A		Somatic	0	21	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	26	23.53		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000553932.1	37	NULL		14																																																																																			-	-		0.567	LINC00639-001	KNOWN	basic	lincRNA	LINC00639	lincRNA	OTTHUMT00000410191.1	G	NR_039982	-		39304592	-1	no_errors	ENST00000553932	ensembl	human	known	74_37	rna	SNP	0.007	A
SYNGAP1	8831	genome.wustl.edu	37	6	33408709	33408709	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr6:33408709C>T	ENST00000418600.2	+	11	1981	c.1880C>T	c.(1879-1881)gCc>gTc	p.A627V	SYNGAP1_ENST00000428982.2_Missense_Mutation_p.A568V|SYNGAP1_ENST00000293748.5_Missense_Mutation_p.A627V|MIR5004_ENST00000579078.1_RNA|SYNGAP1_ENST00000496374.1_3'UTR	NM_006772.2	NP_006763.2	Q96PV0	SYGP1_HUMAN	synaptic Ras GTPase activating protein 1	627	Ras-GAP. {ECO:0000255|PROSITE- ProRule:PRU00167}.				dendrite development (GO:0016358)|negative regulation of axonogenesis (GO:0050771)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of Ras protein signal transduction (GO:0046580)|pattern specification process (GO:0007389)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|receptor clustering (GO:0043113)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of MAPK cascade (GO:0043408)|regulation of synapse structure and activity (GO:0050803)|regulation of synaptic plasticity (GO:0048167)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	Rab GTPase activator activity (GO:0005097)|Ras GTPase activator activity (GO:0005099)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(15)|ovary(7)|pancreas(1)|stomach(1)|urinary_tract(1)	43						ACCCTCATTGCCAAGGTCATC	0.597																																																	0								ENSG00000197283						89.0	73.0	79.0					6																	33408709		2203	4300	6503	SYNGAP1	SO:0001583	missense	0			-	HGNC	AB067525	CCDS34434.2	6p21.3	2010-06-25	2010-06-25		ENSG00000197283	ENSG00000197283			11497	protein-coding gene	gene with protein product		603384	"""synaptic Ras GTPase activating protein 1 homolog (rat)"""			9581761, 18323856	Standard	NM_006772		Approved	SYNGAP, RASA5, KIAA1938	uc011dri.2	Q96PV0	OTTHUMG00000031096	ENST00000418600.2:c.1880C>T	6.37:g.33408709C>T	ENSP00000403636:p.Ala627Val	Somatic	0	33	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	43	23.21	A2AB17|A2BEL6|A2BEL7|A8MQC4|Q8TCS2|Q9UGE2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF3498,pfam_RasGAP,pfam_C2_dom,superfamily_Rho_GTPase_activation_prot,superfamily_C2_dom,smart_Pleckstrin_homology,smart_C2_dom,smart_RasGAP,pfscan_Pleckstrin_homology,pfscan_RasGAP	p.A627V	ENST00000418600.2	37	c.1880	CCDS34434.2	6	.	.	.	.	.	.	.	.	.	.	C	29.9	5.045194	0.93685	.	.	ENSG00000197283	ENST00000293748;ENST00000418600;ENST00000449372;ENST00000428982	T;T;T	0.34859	1.34;1.34;1.34	5.03	5.03	0.67393	Rho GTPase activation protein (1);Ras GTPase-activating protein (4);	0.000000	0.85682	D	0.000000	T	0.57961	0.2089	M	0.86953	2.85	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.66979	0.948;0.913;0.913	T	0.65631	-0.6121	10	0.87932	D	0	.	15.8854	0.79244	0.0:1.0:0.0:0.0	.	627;627;627	Q96PV0;Q96PV0-2;Q96PV0-4	SYGP1_HUMAN;.;.	V	627;627;627;568	ENSP00000293748:A627V;ENSP00000403636:A627V;ENSP00000412475:A568V	ENSP00000293748:A627V	A	+	2	0	SYNGAP1	33516687	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.647000	0.83462	2.615000	0.88500	0.655000	0.94253	GCC	-	pfam_RasGAP,superfamily_Rho_GTPase_activation_prot,smart_RasGAP,pfscan_RasGAP		0.597	SYNGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNGAP1	protein_coding	OTTHUMT00000076151.4	C	XM_166407	-		33408709	+1	no_errors	ENST00000418600	ensembl	human	known	74_37	missense	SNP	1.000	T
TTN	7273	genome.wustl.edu	37	2	179593002	179593002	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr2:179593002C>T	ENST00000591111.1	-	65	18822	c.18598G>A	c.(18598-18600)Gat>Aat	p.D6200N	TTN_ENST00000359218.5_Intron|TTN_ENST00000342175.6_Intron|TTN_ENST00000460472.2_Intron|TTN_ENST00000589042.1_Missense_Mutation_p.D6517N|TTN-AS1_ENST00000585451.1_RNA|RP11-171I2.1_ENST00000590024.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.D5273N			Q8WZ42	TITIN_HUMAN	titin	12980	Ig-like 43.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCTTTTCCATCCTTAAACCAC	0.378																																																	0								ENSG00000155657						74.0	70.0	72.0					2																	179593002		1860	4097	5957	TTN	SO:0001583	missense	0			-	HGNC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.18598G>A	2.37:g.179593002C>T	ENSP00000465570:p.Asp6200Asn	Somatic	0	27	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	36	21.74	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.D5273N	ENST00000591111.1	37	c.15817		2	.	.	.	.	.	.	.	.	.	.	C	13.63	2.295097	0.40594	.	.	ENSG00000155657	ENST00000342992	T	0.40756	1.02	5.78	4.91	0.64330	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.53658	0.1810	L	0.32530	0.975	0.80722	D	1	D	0.76494	0.999	D	0.72982	0.979	T	0.58418	-0.7640	9	0.87932	D	0	.	15.2633	0.73640	0.0:0.9325:0.0:0.0675	.	6200	Q8WZ42	TITIN_HUMAN	N	5273	ENSP00000343764:D5273N	ENSP00000343764:D5273N	D	-	1	0	TTN	179301247	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.040000	0.70980	1.584000	0.49913	0.591000	0.81541	GAT	-	pfam_Ig_I-set,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like_dom		0.378	TTN-019	PUTATIVE	basic	protein_coding	TTN	protein_coding	OTTHUMT00000460310.1	C	NM_133378	-		179593002	-1	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	SNP	1.000	T
S1PR1	1901	genome.wustl.edu	37	1	101704967	101704967	+	Missense_Mutation	SNP	T	T	C			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr1:101704967T>C	ENST00000305352.6	+	2	802	c.427T>C	c.(427-429)Tat>Cat	p.Y143H	S1PR1_ENST00000475821.1_3'UTR|RP4-575N6.4_ENST00000432195.1_RNA	NM_001400.4	NP_001391.2	P21453	S1PR1_HUMAN	sphingosine-1-phosphate receptor 1	143					actin cytoskeleton reorganization (GO:0031532)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|angiogenesis (GO:0001525)|blood vessel maturation (GO:0001955)|brain development (GO:0007420)|cardiac muscle tissue growth involved in heart morphogenesis (GO:0003245)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|chemotaxis (GO:0006935)|endothelial cell differentiation (GO:0045446)|G-protein coupled receptor signaling pathway (GO:0007186)|heart trabecula morphogenesis (GO:0061384)|lamellipodium assembly (GO:0030032)|negative regulation of stress fiber assembly (GO:0051497)|neuron differentiation (GO:0030182)|positive regulation of cell migration (GO:0030335)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of bone mineralization (GO:0030500)|regulation of bone resorption (GO:0045124)|regulation of cell adhesion (GO:0030155)|sphingosine-1-phosphate signaling pathway (GO:0003376)|T cell migration (GO:0072678)|transmission of nerve impulse (GO:0019226)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|G-protein coupled receptor binding (GO:0001664)|sphingolipid binding (GO:0046625)|sphingosine-1-phosphate receptor activity (GO:0038036)			NS(1)|autonomic_ganglia(1)|breast(1)|large_intestine(7)|lung(23)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	43						CATTGAGCGCTATATCACAAT	0.552											OREG0013620	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000170989						93.0	87.0	89.0					1																	101704967		2203	4300	6503	S1PR1	SO:0001583	missense	0			-	HGNC	M31210	CCDS777.1	1p21	2012-08-08	2008-04-30	2008-04-30	ENSG00000170989	ENSG00000170989		"""GPCR / Class A : Lysophospholipid receptors : Sphingosine 1-phosphate"", ""CD molecules"""	3165	protein-coding gene	gene with protein product		601974	"""endothelial differentiation, sphingolipid G-protein-coupled receptor, 1"""	EDG1		2160972, 9488656	Standard	NM_001400		Approved	edg-1, D1S3362, CD363	uc001dud.2	P21453	OTTHUMG00000010835	ENST00000305352.6:c.427T>C	1.37:g.101704967T>C	ENSP00000305416:p.Tyr143His	Somatic	0	23	0.00	1360	0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	25	19.35	D3DT66|Q9BYY4|Q9NYN8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_EDG1_rcpt,prints_S1P_rcpt,prints_GPCR_Rhodpsn,prints_Melcrt_ACTH_rcpt	p.Y143H	ENST00000305352.6	37	c.427	CCDS777.1	1	.	.	.	.	.	.	.	.	.	.	T	2.279	-0.365174	0.05103	.	.	ENSG00000170989	ENST00000305352;ENST00000424264	D	0.87966	-2.32	5.61	4.49	0.54785	GPCR, rhodopsin-like superfamily (1);	0.110345	0.64402	D	0.000006	T	0.53867	0.1823	N	0.11892	0.195	0.52501	D	0.999958	B	0.06786	0.001	B	0.06405	0.002	T	0.53005	-0.8499	10	0.02654	T	1	.	11.4157	0.49951	0.0:0.0706:0.0:0.9294	.	143	P21453	S1PR1_HUMAN	H	143	ENSP00000305416:Y143H	ENSP00000305416:Y143H	Y	+	1	0	S1PR1	101477555	1.000000	0.71417	1.000000	0.80357	0.872000	0.50106	5.789000	0.69029	0.967000	0.38186	0.374000	0.22700	TAT	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.552	S1PR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	S1PR1	protein_coding	OTTHUMT00000029908.1	T	NM_001400	-		101704967	+1	no_errors	ENST00000305352	ensembl	human	known	74_37	missense	SNP	1.000	C
NXF1	10482	genome.wustl.edu	37	11	62568587	62568587	+	Silent	SNP	G	G	A	rs144471031		TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr11:62568587G>A	ENST00000532297.1	-	10	1514	c.885C>T	c.(883-885)atC>atT	p.I295I	NXF1_ENST00000294172.2_Silent_p.I295I|NXF1_ENST00000531131.1_Silent_p.I158I|NXF1_ENST00000439713.2_Silent_p.I295I|NXF1_ENST00000531709.2_Silent_p.I295I			Q9UBU9	NXF1_HUMAN	nuclear RNA export factor 1	295					gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|poly(A)+ mRNA export from nucleus (GO:0016973)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear inclusion body (GO:0042405)|nuclear pore (GO:0005643)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)	mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(9)|lung(13)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						AAAGGTTTAGGATCTTCAGGT	0.463																																																	0								ENSG00000162231	G	,	0,4402		0,0,2201	112.0	101.0	105.0		885,885	3.5	1.0	11	dbSNP_134	105	1,8597	1.2+/-3.3	0,1,4298	no	coding-synonymous,coding-synonymous	NXF1	NM_001081491.1,NM_006362.4	,	0,1,6499	AA,AG,GG		0.0116,0.0,0.0077	,	295/357,295/620	62568587	1,12999	2201	4299	6500	NXF1	SO:0001819	synonymous_variant	0			-	HGNC	AF112880	CCDS8037.1, CCDS44629.1	11q12-q13	2008-07-21			ENSG00000162231	ENSG00000162231			8071	protein-coding gene	gene with protein product	"""tip associating protein"""	602647				9175835, 9660949	Standard	NM_001081491		Approved	TAP, Mex67, DKFZp667O0311	uc001nvf.1	Q9UBU9	OTTHUMG00000167612	ENST00000532297.1:c.885C>T	11.37:g.62568587G>A		Somatic	0	56	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	44	31.25	B4E269|Q99799|Q9UQL2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Tap_RNA-bd,pfam_NTF2,pfam_TAP_C_dom,pfam_Leu-rich_rpt,superfamily_UBA-like,smart_TAP_C_dom,pfscan_Nuclear_transport_factor_2_euk	p.I295	ENST00000532297.1	37	c.885	CCDS8037.1	11																																																																																			-	pfam_Leu-rich_rpt		0.463	NXF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NXF1	protein_coding	OTTHUMT00000395365.2	G	NM_006362	rs144471031		62568587	-1	no_errors	ENST00000294172	ensembl	human	known	74_37	silent	SNP	1.000	A
NOX4	50507	genome.wustl.edu	37	11	89177369	89177369	+	Silent	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr11:89177369G>A	ENST00000263317.4	-	5	619	c.381C>T	c.(379-381)gcC>gcT	p.A127A	NOX4_ENST00000531342.1_Intron|NOX4_ENST00000527956.1_Silent_p.A103A|NOX4_ENST00000375979.3_Intron|NOX4_ENST00000532825.1_Silent_p.A103A|NOX4_ENST00000343727.5_Silent_p.A103A|NOX4_ENST00000535633.1_Silent_p.A103A|NOX4_ENST00000413594.2_Silent_p.A148A|NOX4_ENST00000527626.1_Intron|NOX4_ENST00000534731.1_Silent_p.A127A|NOX4_ENST00000424319.1_Silent_p.A103A|NOX4_ENST00000525196.1_Silent_p.A127A|NOX4_ENST00000528341.1_Silent_p.A102A|NOX4_ENST00000542487.1_Silent_p.A103A			Q9NPH5	NOX4_HUMAN	NADPH oxidase 4	127	Ferric oxidoreductase.				bone resorption (GO:0045453)|cardiac muscle cell differentiation (GO:0055007)|cell aging (GO:0007569)|cell morphogenesis (GO:0000902)|cellular response to cAMP (GO:0071320)|cellular response to gamma radiation (GO:0071480)|cellular response to glucose stimulus (GO:0071333)|cellular response to transforming growth factor beta stimulus (GO:0071560)|homocysteine metabolic process (GO:0050667)|inflammatory response (GO:0006954)|negative regulation of cell proliferation (GO:0008285)|oxidation-reduction process (GO:0055114)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of stress fiber assembly (GO:0051496)|reactive oxygen species metabolic process (GO:0072593)|response to hypoxia (GO:0001666)|superoxide anion generation (GO:0042554)	apical plasma membrane (GO:0016324)|endoplasmic reticulum (GO:0005783)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|NADPH oxidase complex (GO:0043020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|heme binding (GO:0020037)|modified amino acid binding (GO:0072341)|NAD(P)H oxidase activity (GO:0016174)|nucleotide binding (GO:0000166)|oxygen sensor activity (GO:0019826)|superoxide-generating NADPH oxidase activity (GO:0016175)			NS(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(20)|ovary(2)|prostate(3)|skin(2)	44		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.011)				AGAAGTTGAGGGCATTCACCA	0.453																																																	0								ENSG00000086991						133.0	112.0	119.0					11																	89177369		2201	4299	6500	NOX4	SO:0001819	synonymous_variant	0			-	HGNC	AF254621	CCDS8285.1, CCDS44695.1, CCDS44696.1, CCDS73361.1, CCDS73362.1	11q14.2-q21	2008-02-05			ENSG00000086991	ENSG00000086991			7891	protein-coding gene	gene with protein product		605261					Standard	NM_001143837		Approved	KOX-1, KOX	uc001pct.3	Q9NPH5	OTTHUMG00000167298	ENST00000263317.4:c.381C>T	11.37:g.89177369G>A		Somatic	0	30	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	37	15.91	A8K715|B7Z520|E7EMD7|Q5K3R4|Q5K3R5|Q5K3R6|Q5K3R8|Q7Z7G3|Q86V92	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Fe_red_NAD-bd_6,pfam_Fe3_Rdtase_TM_dom,pfam_FAD-bd_8,superfamily_Riboflavin_synthase-like_b-brl,prints_Cyt_b245_heavy_chain	p.A148	ENST00000263317.4	37	c.444	CCDS8285.1	11																																																																																			-	pfam_Fe3_Rdtase_TM_dom		0.453	NOX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOX4	protein_coding	OTTHUMT00000394054.1	G	NM_016931	-		89177369	-1	no_errors	ENST00000413594	ensembl	human	known	74_37	silent	SNP	0.996	A
KLF13	51621	genome.wustl.edu	37	15	31670093	31670093	+	3'UTR	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr15:31670093C>T	ENST00000307145.3	+	0	6816					NM_015995.2	NP_057079.2	Q9Y2Y9	KLF13_HUMAN	Kruppel-like factor 13						negative regulation of cell proliferation (GO:0008285)|negative regulation of erythrocyte differentiation (GO:0045647)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)	2		all_lung(180;3.71e-11)		all cancers(64;1.11e-18)|Epithelial(43;1.73e-14)|GBM - Glioblastoma multiforme(186;0.00016)|Colorectal(1;0.00158)|BRCA - Breast invasive adenocarcinoma(123;0.00255)|COAD - Colon adenocarcinoma(236;0.0446)|READ - Rectum adenocarcinoma(1;0.13)|Lung(196;0.171)		ATTTATGATTCATTATTTTAT	0.343																																																	0								ENSG00000169926																																			KLF13	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AF132599	CCDS10025.1	15q13.3	2013-01-08			ENSG00000169926	ENSG00000169926		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	13672	protein-coding gene	gene with protein product		605328				10415854, 10023774	Standard	NM_015995		Approved	RFLAT-1, BTEB3, NSLP1, FKLF-2	uc001zfo.3	Q9Y2Y9	OTTHUMG00000172224	ENST00000307145.3:c.*5591C>T	15.37:g.31670093C>T		Somatic	0	33	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	23	23.33	Q9Y356	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000307145.3	37	NULL	CCDS10025.1	15																																																																																			-	-		0.343	KLF13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLF13	protein_coding	OTTHUMT00000251381.1	C	NM_015995	-		31670093	+1	no_errors	ENST00000558673	ensembl	human	known	74_37	rna	SNP	0.987	T
KALRN	8997	genome.wustl.edu	37	3	124207076	124207076	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr3:124207076G>A	ENST00000240874.3	+	29	4461	c.4304G>A	c.(4303-4305)gGg>gAg	p.G1435E	KALRN_ENST00000460856.1_Missense_Mutation_p.G1426E|KALRN_ENST00000360013.3_Missense_Mutation_p.G1435E	NM_003947.4	NP_003938.1	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase	1435	DH 1. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic signaling pathway (GO:0097190)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|protein phosphorylation (GO:0006468)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(21)|lung(28)|ovary(4)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	83						TGTGAAGAAGGGAAAGGGGAG	0.522																																																	0								ENSG00000160145						114.0	93.0	100.0					3																	124207076		2203	4300	6503	KALRN	SO:0001583	missense	0			-	HGNC	U94190	CCDS3027.1, CCDS3028.1	3q21.2	2013-02-11	2005-03-11	2005-03-12	ENSG00000160145	ENSG00000160145		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	4814	protein-coding gene	gene with protein product	"""serine/threonine kinase with Dbl and pleckstrin homology domains"""	604605	"""huntingtin-associated protein interacting protein (duo)"""	HAPIP		9285789, 10023074	Standard	NM_001024660		Approved	duo, Hs.8004, TRAD, DUET, Kalirin, ARHGEF24	uc003ehd.3	O60229	OTTHUMG00000125545	ENST00000240874.3:c.4304G>A	3.37:g.124207076G>A	ENSP00000240874:p.Gly1435Glu	Somatic	0	57	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	40	21.57	A8MSI4|C9JQ37|Q6ZN45|Q8TBQ5|Q9NSZ4|Q9Y2A5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DH-domain,pfam_Prot_kinase_dom,pfam_Spectrin_repeat,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,superfamily_CRAL-TRIO_dom,smart_CRAL-TRIO_dom,smart_Spectrin/alpha-actinin,smart_DH-domain,smart_Pleckstrin_homology,smart_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_CRAL-TRIO_dom,pfscan_Fibronectin_type3,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,pfscan_DH-domain	p.G1435E	ENST00000240874.3	37	c.4304	CCDS3027.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	28.3|28.3	4.906228|4.906228	0.92107|0.92107	.|.	.|.	ENSG00000160145|ENSG00000160145	ENST00000460856;ENST00000240874;ENST00000360013|ENST00000354186	T;T;T|T	0.61392|0.63096	0.11;0.11;0.11|-0.02	4.84|4.84	4.84|4.84	0.62591|0.62591	Dbl homology (DH) domain (5);|.	0.063724|0.063724	0.64402|0.64402	N|D	0.000007|0.000007	T|T	0.67515|0.67515	0.2901|0.2901	L|L	0.37630|0.37630	1.12|1.12	0.80722|0.80722	D|D	1|1	D;D;D;D|.	0.89917|.	1.0;0.993;1.0;1.0|.	D;D;D;D|.	0.97110|.	1.0;0.92;0.997;1.0|.	T|T	0.70930|0.70930	-0.4738|-0.4738	10|8	0.59425|0.87932	D|D	0.04|0	.|.	18.5078|18.5078	0.90904|0.90904	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1426;781;1435;1435|.	C9IZQ6;F2Z3Q6;O60229;O60229-2|.	.;.;KALRN_HUMAN;.|.	E|R	1426;1435;1435|1404	ENSP00000418611:G1426E;ENSP00000240874:G1435E;ENSP00000353109:G1435E|ENSP00000346122:G1404R	ENSP00000240874:G1435E|ENSP00000346122:G1404R	G|G	+|+	2|1	0|0	KALRN|KALRN	125689766|125689766	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	9.601000|9.601000	0.98297|0.98297	2.677000|2.677000	0.91161|0.91161	0.655000|0.655000	0.94253|0.94253	GGG|GGA	-	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,pfscan_DH-domain		0.522	KALRN-005	KNOWN	basic|CCDS	protein_coding	KALRN	protein_coding	OTTHUMT00000258843.4	G	NM_003947	-		124207076	+1	no_errors	ENST00000360013	ensembl	human	known	74_37	missense	SNP	1.000	A
SEL1L3	23231	genome.wustl.edu	37	4	25806367	25806367	+	Silent	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr4:25806367C>T	ENST00000399878.3	-	10	1694	c.1572G>A	c.(1570-1572)agG>agA	p.R524R	SEL1L3_ENST00000264868.5_Silent_p.R489R|SEL1L3_ENST00000502949.1_Silent_p.R371R	NM_015187.3	NP_056002.2	Q68CR1	SE1L3_HUMAN	sel-1 suppressor of lin-12-like 3 (C. elegans)	524						integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)|urinary_tract(2)	14						CATTTTGGTTCCTTGGCACTG	0.388																																																	0								ENSG00000091490						89.0	84.0	86.0					4																	25806367		1861	4102	5963	SEL1L3	SO:0001819	synonymous_variant	0			-	HGNC	BC009945	CCDS47037.1, CCDS75113.1	4p15.2	2009-09-24			ENSG00000091490	ENSG00000091490			29108	protein-coding gene	gene with protein product	"""KIAA0746 protein"""					9872452	Standard	XM_005248143		Approved	KIAA0746	uc003gru.4	Q68CR1	OTTHUMG00000160331	ENST00000399878.3:c.1572G>A	4.37:g.25806367C>T		Somatic	0	45	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	52	13.33	A0PJH6|A8K0X2|O94847|Q6P999|Q96G59	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Sel1-like,superfamily_ConA-like_lec_gl_sf,smart_Sel1-like	p.R524	ENST00000399878.3	37	c.1572	CCDS47037.1	4																																																																																			-	NULL		0.388	SEL1L3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SEL1L3	protein_coding	OTTHUMT00000360261.1	C	NM_015187	-		25806367	-1	no_errors	ENST00000399878	ensembl	human	known	74_37	silent	SNP	0.815	T
PCDHAC2	56134	genome.wustl.edu	37	5	140348244	140348244	+	Silent	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr5:140348244C>T	ENST00000289269.5	+	1	2425	c.1893C>T	c.(1891-1893)gaC>gaT	p.D631D	PCDHA10_ENST00000307360.5_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHAC1_ENST00000253807.2_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA13_ENST00000409494.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA13_ENST00000289272.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA12_ENST00000398631.2_Intron	NM_018899.5|NM_031883.2	NP_061722.1|NP_114089.1	Q9Y5I4	PCDC2_HUMAN	protocadherin alpha subfamily C, 2	631	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(10)|liver(2)|lung(9)|ovary(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(1)	45			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTGACCTGGACCTCTTTAAGG	0.502																																					Melanoma(190;638 2083 3390 11909 52360)												0								ENSG00000243232						66.0	65.0	65.0					5																	140348244		2203	4300	6503	PCDHAC2	SO:0001819	synonymous_variant	0			-	HGNC	AF152474	CCDS4242.1	5q31	2010-11-26			ENSG00000243232	ENSG00000243232		"""Cadherins / Protocadherins : Clustered"""	8677	other	complex locus constituent		606321				10380929	Standard	NM_031883		Approved	PCDH-ALPHA-C2		Q9Y5I4	OTTHUMG00000129607	ENST00000289269.5:c.1893C>T	5.37:g.140348244C>T		Somatic	0	33	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	42	31.15	Q2M3V1|Q9Y5F4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.D631	ENST00000289269.5	37	c.1893	CCDS4242.1	5																																																																																			-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.502	PCDHAC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHAC2	protein_coding	OTTHUMT00000251802.2	C	NM_018899	-		140348244	+1	no_errors	ENST00000289269	ensembl	human	known	74_37	silent	SNP	1.000	T
SLC6A5	9152	genome.wustl.edu	37	11	20673895	20673895	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr11:20673895C>T	ENST00000525748.1	+	15	2404	c.2131C>T	c.(2131-2133)Cct>Tct	p.P711S	SLC6A5_ENST00000528440.1_3'UTR	NM_004211.3	NP_004202.2	Q9Y345	SC6A5_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 5	711					glycine import (GO:0036233)|synaptic transmission (GO:0007268)|synaptic transmission, glycinergic (GO:0060012)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glycine:sodium symporter activity (GO:0015375)|neurotransmitter:sodium symporter activity (GO:0005328)	p.P711N(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(34)|ovary(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	63					Glycine(DB00145)	TTACCGCTATCCTAACTGGTC	0.488																																																	1	Substitution - Missense(1)	lung(1)						ENSG00000165970						234.0	210.0	218.0					11																	20673895		2203	4300	6503	SLC6A5	SO:0001583	missense	0			-	HGNC	AF085412	CCDS7854.1	11p15.1	2013-07-19	2013-07-19		ENSG00000165970	ENSG00000165970		"""Solute carriers"""	11051	protein-coding gene	gene with protein product	"""glycine transporter 2"""	604159	"""solute carrier family 6 (neurotransmitter transporter, glycine), member 5"""	NET1		9845349	Standard	NM_004211		Approved	GLYT2	uc001mqd.3	Q9Y345	OTTHUMG00000166024	ENST00000525748.1:c.2131C>T	11.37:g.20673895C>T	ENSP00000434364:p.Pro711Ser	Somatic	0	53	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	56	13.85	O95288|Q4VAM7|Q9BX77	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport	p.P711S	ENST00000525748.1	37	c.2131	CCDS7854.1	11	.	.	.	.	.	.	.	.	.	.	C	27.0	4.792828	0.90453	.	.	ENSG00000165970	ENST00000525748	D	0.86694	-2.16	5.88	5.88	0.94601	.	0.098661	0.64402	D	0.000001	D	0.91791	0.7403	M	0.81942	2.565	0.80722	D	1	B	0.31077	0.307	B	0.43155	0.41	D	0.90666	0.4594	10	0.87932	D	0	.	20.3017	0.98615	0.0:1.0:0.0:0.0	.	711	Q9Y345	SC6A5_HUMAN	S	711	ENSP00000434364:P711S	ENSP00000434364:P711S	P	+	1	0	SLC6A5	20630471	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.432000	0.80349	2.800000	0.96347	0.650000	0.86243	CCT	-	pfam_Na/ntran_symport,pfscan_Na/ntran_symport		0.488	SLC6A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A5	protein_coding	OTTHUMT00000387497.2	C	NM_004211	-		20673895	+1	no_errors	ENST00000525748	ensembl	human	known	74_37	missense	SNP	1.000	T
PRIM2	5558	genome.wustl.edu	37	6	57512787	57512788	+	3'UTR	INS	-	-	CACCAAGGC	rs373452397|rs376103961|rs386701662|rs79832250		TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr6:57512787_57512788insCACCAAGGC	ENST00000389488.2	+	0	1702_1703				PRIM2_ENST00000607273.1_3'UTR			P49643	PRI2_HUMAN	primase, DNA, polypeptide 2 (58kDa)						DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	nucleoplasm (GO:0005654)|primosome complex (GO:1990077)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA primase activity (GO:0003896)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(34)|prostate(6)|stomach(4)|upper_aerodigestive_tract(1)	59				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		ttgcactctgttgtgtaattgt	0.431																																																	0								ENSG00000146143																																			PRIM2	SO:0001624	3_prime_UTR_variant	0				HGNC		CCDS75476.1, CCDS75477.1	6p12-p11.1	2013-01-31	2007-06-19	2007-06-19	ENSG00000146143	ENSG00000146143			9370	protein-coding gene	gene with protein product		176636	"""primase, polypeptide 2A (58kD)"", ""primase, polypeptide 2A, 58kDa"""	PRIM2A		8530050, 20675616	Standard	NM_001282487		Approved		uc003pdx.3	P49643	OTTHUMG00000016190	ENST00000389488.2:c.*1700->CACCAAGGC	6.37:g.57512787_57512788insCACCAAGGC		Somatic	NA	NA	NA		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q53FJ8|Q6P1Q7|Q8WVL2|Q9H413	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000389488.2	37	NULL		6																																																																																			-	-		0.431	PRIM2-001	KNOWN	sequence_error|basic	processed_transcript	PRIM2	protein_coding	OTTHUMT00000043468.3	-	NM_000947			57512788	+1	no_errors	ENST00000389488	ensembl	human	known	74_37	rna	INS	0.057:0.034	CACCAAGGC
SYT10	341359	genome.wustl.edu	37	12	33538212	33538212	+	Silent	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr12:33538212C>T	ENST00000228567.3	-	4	1388	c.1092G>A	c.(1090-1092)ctG>ctA	p.L364L	SYT10_ENST00000535526.1_Silent_p.L183L	NM_198992.3	NP_945343.1	Q6XYQ8	SYT10_HUMAN	synaptotagmin X	364					regulation of calcium ion-dependent exocytosis (GO:0017158)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	metal ion binding (GO:0046872)|transporter activity (GO:0005215)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(18)|ovary(1)|prostate(3)|skin(4)|urinary_tract(1)	42	Lung NSC(5;8.37e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0334)					TGATTTCACCCAGGTCTATAC	0.398																																																	0								ENSG00000110975						103.0	87.0	93.0					12																	33538212		2203	4300	6503	SYT10	SO:0001819	synonymous_variant	0			-	HGNC	AY198413	CCDS8732.1	12p11	2013-01-21			ENSG00000110975	ENSG00000110975		"""Synaptotagmins"""	19266	protein-coding gene	gene with protein product							Standard	NM_198992		Approved		uc001rll.1	Q6XYQ8	OTTHUMG00000169269	ENST00000228567.3:c.1092G>A	12.37:g.33538212C>T		Somatic	0	37	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	41	14.58	Q495U2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom,prints_Synaptotagmin,prints_C2_dom	p.L364	ENST00000228567.3	37	c.1092	CCDS8732.1	12																																																																																			-	superfamily_C2_dom		0.398	SYT10-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SYT10	protein_coding	OTTHUMT00000403222.1	C	NM_198992	-		33538212	-1	no_errors	ENST00000228567	ensembl	human	known	74_37	silent	SNP	1.000	T
POTEB2	100287399	genome.wustl.edu	37	15	21051205	21051205	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr15:21051205C>T	ENST00000454856.4	-	9	1287	c.1255G>A	c.(1255-1257)Gaa>Aaa	p.E419K		NM_001277303.1	NP_001264232.1	H3BUK9	POTB2_HUMAN	POTE ankyrin domain family, member B2	419																	TGCTGATTTTCAGGTTTTCTG	0.398																																																	0								ENSG00000230031						26.0	34.0	31.0					15																	21051205		1466	3124	4590	POTEB2	SO:0001583	missense	0			-	HGNC		CCDS59248.1	15q11.2	2014-01-29			ENSG00000230031	ENSG00000230031		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	48327	protein-coding gene	gene with protein product							Standard	NM_001277303		Approved			H3BUK9	OTTHUMG00000185829	ENST00000454856.4:c.1255G>A	15.37:g.21051205C>T	ENSP00000456953:p.Glu419Lys	Somatic	0	175	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	190	12.04		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.E419K	ENST00000454856.4	37	c.1255	CCDS59248.1	15																																																																																			-	NULL		0.398	POTEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POTEB2	protein_coding	OTTHUMT00000471435.1	C		-		21051205	-1	no_errors	ENST00000454856	ensembl	human	known	74_37	missense	SNP	0.000	T
MUC16	94025	genome.wustl.edu	37	19	9076249	9076249	+	Silent	SNP	G	G	A	rs564259362		TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr19:9076249G>A	ENST00000397910.4	-	3	11400	c.11197C>T	c.(11197-11199)Ctg>Ttg	p.L3733L		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	3734	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						AGAGTGGACAGAGAATCAAAC	0.498																																																	0								ENSG00000181143						126.0	125.0	126.0					19																	9076249		1983	4173	6156	MUC16	SO:0001819	synonymous_variant	0			-	HGNC	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.11197C>T	19.37:g.9076249G>A		Somatic	0	39	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	49	10.91	Q6ZQW5|Q96RK2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.L3733	ENST00000397910.4	37	c.11197	CCDS54212.1	19																																																																																			-	NULL		0.498	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	protein_coding	OTTHUMT00000402806.1	G	NM_024690	-		9076249	-1	no_errors	ENST00000397910	ensembl	human	known	74_37	silent	SNP	0.002	A
MGAM	8972	genome.wustl.edu	37	7	141756678	141756678	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr7:141756678G>A	ENST00000549489.2	+	30	3724	c.3629G>A	c.(3628-3630)gGa>gAa	p.G1210E	MGAM_ENST00000475668.2_Missense_Mutation_p.G1210E	NM_004668.2	NP_004659.2	O43451	MGA_HUMAN	maltase-glucoamylase (alpha-glucosidase)	1210	Glucoamylase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	13	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	ACCACAGGGGGAGTTCTGGAC	0.493																																																	0								ENSG00000257335						88.0	85.0	86.0					7																	141756678		1931	4134	6065	MGAM	SO:0001583	missense	0			-	HGNC	AF016833	CCDS47727.1	7q34	2012-10-03			ENSG00000257335	ENSG00000257335			7043	protein-coding gene	gene with protein product		154360				9446624	Standard	NM_004668		Approved	MGA	uc003vwy.3	O43451	OTTHUMG00000158395	ENST00000549489.2:c.3629G>A	7.37:g.141756678G>A	ENSP00000447378:p.Gly1210Glu	Somatic	0	78	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	122	17.01	Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Glyco_hydro_31,pfam_P_trefoil,superfamily_Glycoside_hydrolase_SF,superfamily_Gal_mutarotase_SF_dom,smart_P_trefoil	p.G1210E	ENST00000549489.2	37	c.3629	CCDS47727.1	7	.	.	.	.	.	.	.	.	.	.	G	19.80	3.894886	0.72639	.	.	ENSG00000257335	ENST00000549489;ENST00000475668;ENST00000548812	D	0.88354	-2.37	4.17	4.17	0.49024	Glycoside hydrolase-type carbohydrate-binding (1);	0.000000	0.35291	N	0.003319	D	0.95705	0.8603	M	0.93197	3.39	0.52501	D	0.999953	D	0.89917	1.0	D	0.97110	1.0	D	0.96986	0.9718	10	0.87932	D	0	.	15.2099	0.73214	0.0:0.0:1.0:0.0	.	1210	O43451	MGA_HUMAN	E	1210;1210;1087	ENSP00000447378:G1210E	ENSP00000316431:G1087E	G	+	2	0	MGAM	141403147	1.000000	0.71417	0.991000	0.47740	0.575000	0.36095	9.735000	0.98825	1.857000	0.53885	0.313000	0.20887	GGA	-	superfamily_Gal_mutarotase_SF_dom		0.493	MGAM-001	KNOWN	basic|CCDS	protein_coding	MGAM	protein_coding	OTTHUMT00000351244.3	G		-		141756678	+1	no_errors	ENST00000549489	ensembl	human	known	74_37	missense	SNP	1.000	A
KRT33A	3883	genome.wustl.edu	37	17	39503390	39503390	+	Silent	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr17:39503390G>A	ENST00000007735.3	-	4	717	c.673C>T	c.(673-675)Ctg>Ttg	p.L225L		NM_004138.3	NP_004129.2	O76009	KT33A_HUMAN	keratin 33A	225	Coil 2.|Rod.					extracellular space (GO:0005615)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	21		Breast(137;0.000496)				GTCTCATTCAGGACCTGGTTC	0.602																																																	0								ENSG00000006059						86.0	78.0	81.0					17																	39503390		2203	4300	6503	KRT33A	SO:0001819	synonymous_variant	0			-	HGNC	Y16788	CCDS11388.1	17q21.2	2013-06-20	2006-07-17	2006-07-17	ENSG00000006059	ENSG00000006059		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6450	protein-coding gene	gene with protein product	"""hard keratin type I 3I"""	602761	"""keratin, hair, acidic, 3A"""	KRTHA3A		7565656, 16831889	Standard	NM_004138		Approved	Ha-3I, Krt1-3	uc002hwk.2	O76009	OTTHUMG00000133432	ENST00000007735.3:c.673C>T	17.37:g.39503390G>A		Somatic	0	81	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	108	17.42	B2RA87|Q6NTB9|Q6ZZB9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_IF,superfamily_Prefoldin,prints_Keratin_I	p.L225	ENST00000007735.3	37	c.673	CCDS11388.1	17																																																																																			-	pfam_IF,superfamily_Prefoldin,prints_Keratin_I		0.602	KRT33A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT33A	protein_coding	OTTHUMT00000257295.1	G	NM_004138	-		39503390	-1	no_errors	ENST00000007735	ensembl	human	known	74_37	silent	SNP	1.000	A
CILP	8483	genome.wustl.edu	37	15	65499297	65499297	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr15:65499297C>T	ENST00000261883.4	-	4	413	c.247G>A	c.(247-249)Gac>Aac	p.D83N		NM_003613.3	NP_003604	O75339	CILP1_HUMAN	cartilage intermediate layer protein, nucleotide pyrophosphohydrolase	83					negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)	extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)				breast(5)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(14)|lung(17)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(1)	55						CATACACGGTCCCCATAGTAG	0.627																																																	0								ENSG00000138615						48.0	40.0	43.0					15																	65499297		2201	4299	6500	CILP	SO:0001583	missense	0			-	HGNC	AY358904	CCDS10203.1	15q22	2013-01-14			ENSG00000138615	ENSG00000138615		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1980	protein-coding gene	gene with protein product		603489				9722584, 9722583	Standard	NM_003613		Approved	HsT18872	uc002aon.2	O75339	OTTHUMG00000133140	ENST00000261883.4:c.247G>A	15.37:g.65499297C>T	ENSP00000261883:p.Asp83Asn	Somatic	0	52	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	55	12.70	B2R8F7|Q6UW99|Q8IYI5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,superfamily_CarboxyPept-like_regulatory,smart_Thrombospondin_1_rpt,smart_Ig_sub,smart_Ig_sub2,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like_dom	p.D83N	ENST00000261883.4	37	c.247	CCDS10203.1	15	.	.	.	.	.	.	.	.	.	.	C	15.90	2.969073	0.53614	.	.	ENSG00000138615	ENST00000261883	T	0.16196	2.36	5.58	4.66	0.58398	.	0.582262	0.20357	N	0.093936	T	0.13329	0.0323	L	0.34521	1.04	0.26101	N	0.980828	B	0.27316	0.175	B	0.30943	0.122	T	0.20505	-1.0273	10	0.29301	T	0.29	-18.6526	8.0872	0.30780	0.0:0.7555:0.1608:0.0837	.	83	O75339	CILP1_HUMAN	N	83	ENSP00000261883:D83N	ENSP00000261883:D83N	D	-	1	0	CILP	63286350	0.606000	0.26949	0.937000	0.37676	0.993000	0.82548	2.260000	0.43267	1.342000	0.45619	0.561000	0.74099	GAC	-	NULL		0.627	CILP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CILP	protein_coding	OTTHUMT00000256829.1	C	NM_003613	-		65499297	-1	no_errors	ENST00000261883	ensembl	human	known	74_37	missense	SNP	0.917	T
RPRD2	23248	genome.wustl.edu	37	1	150444277	150444277	+	Silent	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr1:150444277C>T	ENST00000369068.4	+	11	2857	c.2853C>T	c.(2851-2853)acC>acT	p.T951T	RPRD2_ENST00000492220.1_3'UTR|RPRD2_ENST00000539519.1_Intron|RPRD2_ENST00000401000.4_Silent_p.T925T	NM_015203.3	NP_056018.2	Q5VT52	RPRD2_HUMAN	regulation of nuclear pre-mRNA domain containing 2	951						DNA-directed RNA polymerase II, holoenzyme (GO:0016591)				central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(20)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	37						CTCAATCTACCACTGGGCATC	0.517																																																	0								ENSG00000163125						295.0	304.0	301.0					1																	150444277		2082	4221	6303	RPRD2	SO:0001819	synonymous_variant	0			-	HGNC	BX641025	CCDS44216.1, CCDS72907.1	1q21.2	2012-02-09	2008-08-15	2008-07-28	ENSG00000163125	ENSG00000163125			29039	protein-coding gene	gene with protein product		614695	"""KIAA0460"""	KIAA0460		22231121	Standard	XM_005245033		Approved	FLJ32145, HSPC099	uc009wlr.3	Q5VT52	OTTHUMG00000012808	ENST00000369068.4:c.2853C>T	1.37:g.150444277C>T		Somatic	0	41	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	61	22.50	A8K6N8|B3KPT1|B4E2Q6|O75048|Q5VT51|Q5VT53|Q6MZL4|Q86XD2|Q9P0D7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_RNA_pol_II-bd,superfamily_ENTH_VHS,superfamily_Ricin_B_lectin,smart_CID_dom	p.T951	ENST00000369068.4	37	c.2853	CCDS44216.1	1																																																																																			-	NULL		0.517	RPRD2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RPRD2	protein_coding	OTTHUMT00000035844.1	C	NM_015203	-		150444277	+1	no_errors	ENST00000369068	ensembl	human	known	74_37	silent	SNP	0.657	T
LMX1A	4009	genome.wustl.edu	37	1	165175183	165175183	+	Silent	SNP	G	G	A	rs267598145		TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr1:165175183G>A	ENST00000342310.3	-	8	1288	c.906C>T	c.(904-906)atC>atT	p.I302I	LMX1A_ENST00000367893.4_Silent_p.I302I|LMX1A_ENST00000489443.2_5'UTR|LMX1A_ENST00000294816.2_Silent_p.I302I	NM_177398.3	NP_796372.1	Q8TE12	LMX1A_HUMAN	LIM homeobox transcription factor 1, alpha	302					axon guidance (GO:0007411)|central nervous system neuron differentiation (GO:0021953)|cerebellum development (GO:0021549)|dentate gyrus development (GO:0021542)|dopaminergic neuron differentiation (GO:0071542)|midbrain development (GO:0030901)|negative regulation of neuron differentiation (GO:0045665)|regulation of cell growth (GO:0001558)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(2)|biliary_tract(1)|central_nervous_system(3)|cervix(2)|endometrium(4)|large_intestine(6)|lung(10)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(4)	35	all_hematologic(923;0.248)					CACTCTGCTCGATGGCCAGGA	0.577																																																	0								ENSG00000162761						115.0	114.0	114.0					1																	165175183		2203	4300	6503	LMX1A	SO:0001819	synonymous_variant	0			-	HGNC	AY078391	CCDS1247.1	1q24.1	2011-06-20			ENSG00000162761	ENSG00000162761		"""Homeoboxes / LIM class"""	6653	protein-coding gene	gene with protein product		600298		LMX1		7698771	Standard	NM_177398		Approved	LMX1.1	uc001gcz.2	Q8TE12	OTTHUMG00000034575	ENST00000342310.3:c.906C>T	1.37:g.165175183G>A		Somatic	0	34	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	34	22.73	B3KXP6|Q0VDB5|Q5VWG4|Q8TE11	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_LIM,pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Znf_LIM,smart_Homeobox_dom,pfscan_Znf_LIM,pfscan_Homeobox_dom	p.I302	ENST00000342310.3	37	c.906	CCDS1247.1	1																																																																																			-	NULL		0.577	LMX1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LMX1A	protein_coding	OTTHUMT00000083668.2	G	NM_177398	-		165175183	-1	no_errors	ENST00000294816	ensembl	human	known	74_37	silent	SNP	0.532	A
AFF2	2334	genome.wustl.edu	37	X	148062301	148062301	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chrX:148062301C>T	ENST00000370460.2	+	19	4083	c.3604C>T	c.(3604-3606)Cca>Tca	p.P1202S	AFF2_ENST00000286437.5_Missense_Mutation_p.P843S|AFF2_ENST00000370457.5_Missense_Mutation_p.P1167S|AFF2_ENST00000342251.3_Missense_Mutation_p.P1169S	NM_001169123.1|NM_002025.3	NP_001162594.1|NP_002016.2	P51816	AFF2_HUMAN	AF4/FMR2 family, member 2	1202					brain development (GO:0007420)|learning or memory (GO:0007611)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)	G-quadruplex RNA binding (GO:0002151)			breast(5)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(29)|liver(2)|lung(39)|ovary(4)|pancreas(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	109	Acute lymphoblastic leukemia(192;6.56e-05)					GATACCCTCTCCATGGGTAAG	0.353																																																	0								ENSG00000155966						91.0	89.0	90.0					X																	148062301		2203	4300	6503	AFF2	SO:0001583	missense	0			-	HGNC	U48436	CCDS14684.1, CCDS55521.1, CCDS76040.1	Xq28	2008-02-05	2005-06-27	2005-06-27	ENSG00000155966	ENSG00000155966			3776	protein-coding gene	gene with protein product		300806	"""fragile X mental retardation 2"""	FMR2			Standard	NM_002025		Approved	FRAXE	uc004fcp.3	P51816	OTTHUMG00000022613	ENST00000370460.2:c.3604C>T	X.37:g.148062301C>T	ENSP00000359489:p.Pro1202Ser	Somatic	0	22	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	15	42.86	A2RTY4|B4DXD5|B7WNQ1|B7ZLD6|B7ZLD9|O43786|O60215|P78407|Q13521|Q14323|Q7Z2F7|Q7Z400|Q9UNA5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TF_AF4/FMR2	p.P1202S	ENST00000370460.2	37	c.3604	CCDS14684.1	X	.	.	.	.	.	.	.	.	.	.	C	8.198	0.797598	0.16327	.	.	ENSG00000155966	ENST00000370460;ENST00000370457;ENST00000342251;ENST00000286437	D;D;D;D	0.82433	-1.61;-1.61;-1.61;-1.61	5.74	4.88	0.63580	.	0.177981	0.48767	N	0.000177	T	0.79587	0.4471	M	0.63428	1.95	0.53688	D	0.999973	B;B;B;P;P;P	0.43024	0.001;0.003;0.0;0.759;0.759;0.798	B;B;B;B;B;B	0.38921	0.014;0.019;0.008;0.187;0.187;0.285	T	0.79478	-0.1787	10	0.49607	T	0.09	.	11.2694	0.49129	0.0:0.8045:0.1239:0.0716	.	843;1167;1167;1163;1192;1202	B4DXD5;P51816-6;P51816-3;P51816-2;P51816-5;P51816	.;.;.;.;.;AFF2_HUMAN	S	1202;1167;1169;843	ENSP00000359489:P1202S;ENSP00000359486:P1167S;ENSP00000345459:P1169S;ENSP00000286437:P843S	ENSP00000286437:P843S	P	+	1	0	AFF2	147869985	1.000000	0.71417	1.000000	0.80357	0.248000	0.25809	3.657000	0.54474	1.320000	0.45209	0.600000	0.82982	CCA	-	pfam_TF_AF4/FMR2		0.353	AFF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AFF2	protein_coding	OTTHUMT00000058673.2	C	NM_002025	-		148062301	+1	no_errors	ENST00000370460	ensembl	human	known	74_37	missense	SNP	1.000	T
CSMD2	114784	genome.wustl.edu	37	1	34209095	34209095	+	Silent	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr1:34209095C>T	ENST00000373381.4	-	14	2135	c.1959G>A	c.(1957-1959)gaG>gaA	p.E653E		NM_001281956.1|NM_052896.3	NP_001268885.1|NP_443128.2	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	613	CUB 4. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				GGATGCGGCTCTCAGGCCTGG	0.607																																																	0								ENSG00000121904						79.0	80.0	79.0					1																	34209095		2203	4300	6503	CSMD2	SO:0001819	synonymous_variant	0			-	HGNC	AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373381.4:c.1959G>A	1.37:g.34209095C>T		Somatic	0	41	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	39	18.75	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_CUB_dom,pfam_Sushi_SCR_CCP,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.E653	ENST00000373381.4	37	c.1959		1																																																																																			-	pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom		0.607	CSMD2-201	KNOWN	basic|appris_principal	protein_coding	CSMD2	protein_coding		C	NM_052896	-		34209095	-1	no_errors	ENST00000373381	ensembl	human	known	74_37	silent	SNP	1.000	T
SYNE1	23345	genome.wustl.edu	37	6	152730338	152730338	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr6:152730338C>T	ENST00000367255.5	-	44	7006	c.6405G>A	c.(6403-6405)atG>atA	p.M2135I	SYNE1_ENST00000341594.5_Missense_Mutation_p.M2172I|RNA5SP223_ENST00000365174.1_RNA|SYNE1_ENST00000423061.1_Missense_Mutation_p.M2142I|SYNE1_ENST00000265368.4_Missense_Mutation_p.M2135I|SYNE1_ENST00000448038.1_Missense_Mutation_p.M2142I	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	2135					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		GTTTGTAATTCATTTTGTTCT	0.313										HNSCC(10;0.0054)																																							0								ENSG00000131018						126.0	121.0	123.0					6																	152730338		2203	4299	6502	SYNE1	SO:0001583	missense	0			-	HGNC	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.6405G>A	6.37:g.152730338C>T	ENSP00000356224:p.Met2135Ile	Somatic	0	58	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	69	24.18	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.M2135I	ENST00000367255.5	37	c.6405	CCDS5236.2	6	.	.	.	.	.	.	.	.	.	.	C	12.99	2.103516	0.37145	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594	T;T;T;T;T	0.27557	1.66;1.66;1.66;1.66;1.66	5.57	5.57	0.84162	.	0.077386	0.56097	D	0.000040	T	0.15349	0.0370	L	0.56769	1.78	0.80722	D	1	P;P;P;P	0.40083	0.702;0.518;0.518;0.459	B;B;B;B	0.34418	0.182;0.114;0.114;0.173	T	0.02852	-1.1102	10	0.30854	T	0.27	.	10.9517	0.47334	0.1446:0.7158:0.1396:0.0	.	2118;2135;2135;2142	B3W695;Q8NF91;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.	I	2135;2142;2135;2142;2172	ENSP00000356224:M2135I;ENSP00000396024:M2142I;ENSP00000265368:M2135I;ENSP00000390975:M2142I;ENSP00000341887:M2172I	ENSP00000265368:M2135I	M	-	3	0	SYNE1	152772031	1.000000	0.71417	0.984000	0.44739	0.855000	0.48748	2.504000	0.45416	2.630000	0.89119	0.655000	0.94253	ATG	-	superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom,smart_Spectrin/alpha-actinin		0.313	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	protein_coding	OTTHUMT00000334755.2	C	NM_182961	-		152730338	-1	no_errors	ENST00000265368	ensembl	human	known	74_37	missense	SNP	1.000	T
SP1	6667	genome.wustl.edu	37	12	53800456	53800456	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr12:53800456G>A	ENST00000327443.4	+	4	1861	c.1763G>A	c.(1762-1764)aGc>aAc	p.S588N	SP1_ENST00000426431.2_Missense_Mutation_p.S581N	NM_001251825.1|NM_138473.2	NP_001238754.1|NP_612482.2	P08047	SP1_HUMAN	Sp1 transcription factor	588	Transactivation domain C (highly charged).				cellular lipid metabolic process (GO:0044255)|definitive hemopoiesis (GO:0060216)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic placenta development (GO:0001892)|embryonic process involved in female pregnancy (GO:0060136)|embryonic skeletal system development (GO:0048706)|enucleate erythrocyte differentiation (GO:0043353)|gene expression (GO:0010467)|liver development (GO:0001889)|lung development (GO:0030324)|megakaryocyte differentiation (GO:0030219)|ossification (GO:0001503)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|rhythmic process (GO:0048511)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|trophectodermal cell differentiation (GO:0001829)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein-DNA complex (GO:0032993)	bHLH transcription factor binding (GO:0043425)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|enhancer binding (GO:0035326)|histone deacetylase binding (GO:0042826)|HMG box domain binding (GO:0071837)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|large_intestine(1)|ovary(1)|skin(1)|stomach(1)	5				BRCA - Breast invasive adenocarcinoma(357;0.00527)		GGAGAAAACAGCCCAGATGCC	0.557																																																	0								ENSG00000185591						84.0	83.0	83.0					12																	53800456		2203	4300	6503	SP1	SO:0001583	missense	0			-	HGNC	J03133	CCDS8857.1, CCDS44898.1	12q13.1	2013-01-08						"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	11205	protein-coding gene	gene with protein product	"""specificity protein 1"""	189906				1662663	Standard	NM_003109		Approved		uc001scw.3	P08047	OTTHUMG00000170047	ENST00000327443.4:c.1763G>A	12.37:g.53800456G>A	ENSP00000329357:p.Ser588Asn	Somatic	0	77	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	85	17.31	E4Z9M7|G5E9M8|Q86TN8|Q9H3Q5|Q9NR51|Q9NY21|Q9NYE7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S588N	ENST00000327443.4	37	c.1763	CCDS8857.1	12	.	.	.	.	.	.	.	.	.	.	G	26.3	4.723228	0.89298	.	.	ENSG00000185591	ENST00000327443;ENST00000426431	T;T	0.08896	3.05;3.04	4.72	4.72	0.59763	.	0.000000	0.64402	D	0.000001	T	0.23451	0.0567	L	0.53249	1.67	0.80722	D	1	D	0.63880	0.993	D	0.70227	0.968	T	0.00366	-1.1786	10	0.32370	T	0.25	.	16.9838	0.86335	0.0:0.0:1.0:0.0	.	588	P08047	SP1_HUMAN	N	588;581	ENSP00000329357:S588N;ENSP00000404263:S581N	ENSP00000329357:S588N	S	+	2	0	SP1	52086723	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	5.500000	0.66943	2.632000	0.89209	0.462000	0.41574	AGC	-	NULL		0.557	SP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SP1	protein_coding	OTTHUMT00000407044.1	G		-		53800456	+1	no_errors	ENST00000327443	ensembl	human	known	74_37	missense	SNP	1.000	A
PTX4	390667	genome.wustl.edu	37	16	1536178	1536178	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr16:1536178G>A	ENST00000447419.2	-	3	1224	c.1199C>T	c.(1198-1200)tCc>tTc	p.S400F	PTX4_ENST00000440447.2_3'UTR|PTX4_ENST00000293922.1_Missense_Mutation_p.S395F			Q96A99	PTX4_HUMAN	pentraxin 4, long	400	Pentaxin.					extracellular region (GO:0005576)	metal ion binding (GO:0046872)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(6)|ovary(1)|skin(2)|urinary_tract(1)	17						CAGCACGAGGGACCCTCCGGG	0.677																																																	0								ENSG00000251692						36.0	36.0	36.0					16																	1536178		2199	4300	6499	PTX4	SO:0001583	missense	0			-	HGNC		CCDS32362.1	16p13.3	2011-01-06	2010-03-30	2010-03-30	ENSG00000251692	ENSG00000251692			14171	protein-coding gene	gene with protein product		613442	"""chromosome 16 open reading frame 38"""	C16orf38			Standard	NM_001013658		Approved		uc010uvf.2	Q96A99		ENST00000447419.2:c.1199C>T	16.37:g.1536178G>A	ENSP00000445277:p.Ser400Phe	Somatic	0	90	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	85	22.02		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Pentaxin,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Pentaxin,prints_Pentaxin	p.S400F	ENST00000447419.2	37	c.1199		16	.	.	.	.	.	.	.	.	.	.	G	12.14	1.847280	0.32606	.	.	ENSG00000251692	ENST00000447419;ENST00000293922	T;T	0.08720	3.06;3.06	5.45	4.46	0.54185	.	0.215178	0.40302	N	0.001125	T	0.23171	0.0560	L	0.58101	1.795	0.39136	D	0.961944	D	0.56968	0.978	D	0.66847	0.947	T	0.00548	-1.1677	10	0.54805	T	0.06	.	14.1245	0.65210	0.0:0.1504:0.8496:0.0	.	395	Q96A99-2	.	F	400;395	ENSP00000445277:S400F;ENSP00000293922:S395F	ENSP00000293922:S395F	S	-	2	0	PTX4	1476179	0.998000	0.40836	0.984000	0.44739	0.229000	0.25112	4.143000	0.58051	2.569000	0.86673	0.563000	0.77884	TCC	-	pfam_Pentaxin,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Pentaxin,prints_Pentaxin		0.677	PTX4-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	PTX4	protein_coding	OTTHUMT00000432526.1	G	NM_001013658	-		1536178	-1	no_errors	ENST00000447419	ensembl	human	known	74_37	missense	SNP	0.927	A
WASH3P	374666	genome.wustl.edu	37	15	102516816	102516816	+	RNA	SNP	G	G	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr15:102516816G>T	ENST00000557932.1	+	0	1679				DDX11L9_ENST00000562189.1_RNA			C4AMC7	WASH3_HUMAN	WAS protein family homolog 3 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)			central_nervous_system(1)|endometrium(6)|kidney(11)|prostate(5)|stomach(1)|urinary_tract(1)	25						GGATGCAAACGTCTCGGGGTC	0.527																																																	0								ENSG00000248472																																			DDX11L9			0			-	HGNC			15q26.3	2014-03-20	2008-01-16	2008-01-16	ENSG00000185596	ENSG00000185596		"""WAS protein homologs"""	24362	pseudogene	pseudogene			"""family with sequence similarity 39, member D pseudogene"""	FAM39DP		11701968, 18159949	Standard	NR_003659		Approved	FLJ25222	uc002cdi.3	C4AMC7	OTTHUMG00000172275		15.37:g.102516816G>T		Somatic	0	12	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	12	25.00		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000557932.1	37	NULL		15																																																																																			-	-		0.527	WASH3P-001	KNOWN	basic	processed_transcript	DDX11L9	pseudogene	OTTHUMT00000417608.1	G	NM_199163	-		102516816	-1	no_errors	ENST00000559159	ensembl	human	known	74_37	rna	SNP	0.000	T
PRKCH	5583	genome.wustl.edu	37	14	61997257	61997257	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr14:61997257G>A	ENST00000332981.5	+	12	2090	c.1705G>A	c.(1705-1707)Gat>Aat	p.D569N	RP11-47I22.4_ENST00000556347.1_Missense_Mutation_p.M73I|PRKCH_ENST00000555082.1_Missense_Mutation_p.D408N	NM_006255.3	NP_006246.2	P24723	KPCL_HUMAN	protein kinase C, eta	569	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				blood coagulation (GO:0007596)|negative regulation of glial cell apoptotic process (GO:0034351)|platelet activation (GO:0030168)|positive regulation of B cell receptor signaling pathway (GO:0050861)|positive regulation of glial cell proliferation (GO:0060252)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein kinase C signaling (GO:0070528)|protein phosphorylation (GO:0006468)|regulation of tight junction assembly (GO:2000810)|signal transduction (GO:0007165)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium-independent protein kinase C activity (GO:0004699)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(4)|ovary(2)|pancreas(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	25				OV - Ovarian serous cystadenocarcinoma(108;0.045)|BRCA - Breast invasive adenocarcinoma(234;0.0906)|KIRC - Kidney renal clear cell carcinoma(182;0.182)		CATACTGAATGATGAGGTGGT	0.498																																					Melanoma(135;863 1779 8064 14443 26348)												0								ENSG00000027075						195.0	155.0	169.0					14																	61997257		2203	4300	6503	PRKCH	SO:0001583	missense	0			-	HGNC	M55284	CCDS9752.1	14q23.1	2009-07-10			ENSG00000027075	ENSG00000027075	2.7.11.1		9403	protein-coding gene	gene with protein product		605437		PRKCL		1986216, 1545821	Standard	NM_006255		Approved	PKC-L, PKCL	uc001xfn.3	P24723	OTTHUMG00000152341	ENST00000332981.5:c.1705G>A	14.37:g.61997257G>A	ENSP00000329127:p.Asp569Asn	Somatic	0	83	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	107	13.71	B4DJN5|Q16246|Q8NE03	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pkinase_C,pfam_C2_dom,superfamily_Kinase-like_dom,superfamily_C2_dom,smart_C2_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pirsf_Prot_kin_PKC_delta,pfscan_C2_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_dom,prints_DAG/PE-bd	p.D569N	ENST00000332981.5	37	c.1705	CCDS9752.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	35|35	5.493615|5.493615	0.96339|0.96339	.|.	.|.	ENSG00000027075|ENSG00000258989	ENST00000555185;ENST00000332981;ENST00000555082|ENST00000556347	T;T;T|.	0.64991|.	-0.13;0.63;0.63|.	5.64|5.64	5.64|5.64	0.86602|0.86602	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);|.	0.000000|.	0.64402|.	D|.	0.000006|.	T|T	0.54822|0.54822	0.1882|0.1882	N|N	0.17872|0.17872	0.535|0.535	0.80722|0.80722	D|D	1|1	D|.	0.54397|.	0.966|.	D|.	0.65874|.	0.939|.	T|T	0.48115|0.48115	-0.9063|-0.9063	10|5	0.56958|.	D|.	0.05|.	.|.	19.7167|19.7167	0.96124|0.96124	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	569|.	P24723|.	KPCL_HUMAN|.	N|I	137;569;408|73	ENSP00000451871:D137N;ENSP00000329127:D569N;ENSP00000450981:D408N|.	ENSP00000329127:D569N|.	D|M	+|+	1|3	0|0	PRKCH|RP11-47I22.4	61067010|61067010	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.968000|0.968000	0.65278|0.65278	9.796000|9.796000	0.99103|0.99103	2.667000|2.667000	0.90743|0.90743	0.655000|0.655000	0.94253|0.94253	GAT|ATG	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Prot_kin_PKC_delta,pfscan_Prot_kinase_dom		0.498	PRKCH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKCH	protein_coding	OTTHUMT00000276974.2	G	NM_006255	-		61997257	+1	no_errors	ENST00000332981	ensembl	human	known	74_37	missense	SNP	1.000	A
KRT86	3892	genome.wustl.edu	37	12	52699530	52699530	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr12:52699530G>A	ENST00000423955.2	+	8	1162	c.984G>A	c.(982-984)atG>atA	p.M328I	KRT86_ENST00000293525.5_Missense_Mutation_p.M328I|RP11-845M18.6_ENST00000552441.1_RNA|KRT86_ENST00000544024.1_Missense_Mutation_p.M328I			O43790	KRT86_HUMAN	keratin 86	328	Coil 2.|Rod.					extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			breast(1)|cervix(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	10				BRCA - Breast invasive adenocarcinoma(357;0.189)		TGAACCGCATGATCCAGAGGC	0.592																																																	0								ENSG00000170442						122.0	110.0	114.0					12																	52699530		2203	4300	6503	KRT86	SO:0001583	missense	0			-	HGNC	X99142	CCDS41785.1	12q13	2013-01-16	2006-07-17	2006-07-17		ENSG00000170442		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6463	protein-coding gene	gene with protein product	"""hard keratin type II 6"""	601928	"""keratin, hair, basic, 6 (monilethrix)"""	KRTHB6		9241275, 16831889	Standard	NM_002284		Approved	MNX, Hb6	uc001sad.3	O43790		ENST00000423955.2:c.984G>A	12.37:g.52699530G>A	ENSP00000444533:p.Met328Ile	Somatic	1	103	0.96		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	28	135	17.18	P78387	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_IF,superfamily_Prefoldin,prints_Keratin_II	p.M328I	ENST00000423955.2	37	c.984	CCDS41785.1	12	.	.	.	.	.	.	.	.	.	.	G	14.15	2.449156	0.43531	.	.	ENSG00000170442;ENSG00000170442;ENSG00000170442;ENSG00000258832	ENST00000544024;ENST00000423955;ENST00000293525;ENST00000553310	D;D;D	0.88664	-2.41;-2.41;-2.41	4.84	1.84	0.25277	Filament (1);	0.379626	0.21954	N	0.066699	D	0.86674	0.5989	M	0.64080	1.96	0.29632	N	0.845405	B	0.02656	0.0	B	0.06405	0.002	T	0.78653	-0.2120	10	0.49607	T	0.09	.	14.713	0.69247	0.0:0.3129:0.6871:0.0	.	328	O43790	KRT86_HUMAN	I	328	ENSP00000443169:M328I;ENSP00000444533:M328I;ENSP00000293525:M328I	ENSP00000293525:M328I	M	+	3	0	AC021066.1;KRT86	50985797	0.679000	0.27596	0.994000	0.49952	0.961000	0.63080	0.965000	0.29319	0.080000	0.16959	0.505000	0.49811	ATG	-	pfam_IF,superfamily_Prefoldin		0.592	KRT86-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT86	protein_coding	OTTHUMT00000404911.1	G	NM_002284	-		52699530	+1	no_errors	ENST00000293525	ensembl	human	known	74_37	missense	SNP	1.000	A
CHODL	140578	genome.wustl.edu	37	21	19629360	19629360	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr21:19629360C>T	ENST00000299295.2	+	3	854	c.463C>T	c.(463-465)Cct>Tct	p.P155S	CHODL_ENST00000543733.1_Missense_Mutation_p.P136S|CHODL_ENST00000400128.1_Missense_Mutation_p.P114S|CHODL_ENST00000338326.3_Missense_Mutation_p.P114S|CHODL_ENST00000400131.1_Missense_Mutation_p.P114S|CHODL_ENST00000400127.1_Missense_Mutation_p.P114S|CHODL_ENST00000400135.1_Missense_Mutation_p.P114S	NM_001204175.1|NM_024944.2	NP_001191104.1|NP_079220.2	Q9H9P2	CHODL_HUMAN	chondrolectin	155	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				muscle organ development (GO:0007517)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)	carbohydrate binding (GO:0030246)			kidney(1)|large_intestine(3)|lung(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	12		all_epithelial(11;0.21)		Epithelial(23;0.000191)|all cancers(11;0.000827)|LUSC - Lung squamous cell carcinoma(23;0.00646)|Lung(58;0.0129)|OV - Ovarian serous cystadenocarcinoma(11;0.017)|COAD - Colon adenocarcinoma(22;0.03)|Colorectal(24;0.0917)		AACTGCCAATCCTGGCCTTGG	0.438																																																	0								ENSG00000154645						92.0	87.0	89.0					21																	19629360		2203	4300	6503	CHODL	SO:0001583	missense	0			-	HGNC	AF257472	CCDS13570.1, CCDS56208.1, CCDS56209.1, CCDS56210.1	21q11.2	2006-04-03	2002-07-04		ENSG00000154645	ENSG00000154645			17807	protein-coding gene	gene with protein product		607247	"""chromosome 21 open reading frame 68"""	C21orf68		12079284	Standard	NM_024944		Approved	FLJ12627, PRED12, MT75	uc021whs.1	Q9H9P2	OTTHUMG00000074519	ENST00000299295.2:c.463C>T	21.37:g.19629360C>T	ENSP00000299295:p.Pro155Ser	Somatic	0	41	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	35	14.63	B2R9C0|B4DJB8|Q7Z798|Q7Z799|Q7Z7A0|Q9HCY3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	p.P155S	ENST00000299295.2	37	c.463	CCDS13570.1	21	.	.	.	.	.	.	.	.	.	.	C	22.9	4.345987	0.82022	.	.	ENSG00000154645	ENST00000400128;ENST00000400131;ENST00000400135;ENST00000400127;ENST00000299295;ENST00000338326;ENST00000543733	T;T;T;T;T;T;T	0.19250	2.19;2.16;2.16;2.19;2.16;2.16;2.18	5.57	5.57	0.84162	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.047421	0.85682	D	0.000000	T	0.36963	0.0986	L	0.35644	1.08	0.53688	D	0.999973	P;D;D	0.76494	0.798;0.999;0.959	B;D;P	0.68943	0.285;0.961;0.749	T	0.01657	-1.1302	9	.	.	.	-14.685	18.5511	0.91065	0.0:1.0:0.0:0.0	.	155;136;114	Q9H9P2;B4DJB8;Q9H9P2-3	CHODL_HUMAN;.;.	S	114;114;114;114;155;114;136	ENSP00000382993:P114S;ENSP00000382996:P114S;ENSP00000383001:P114S;ENSP00000382992:P114S;ENSP00000299295:P155S;ENSP00000339975:P114S;ENSP00000443566:P136S	.	P	+	1	0	CHODL	18551231	0.996000	0.38824	1.000000	0.80357	0.998000	0.95712	3.748000	0.55142	2.619000	0.88677	0.650000	0.86243	CCT	-	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin		0.438	CHODL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHODL	protein_coding	OTTHUMT00000158232.1	C	NM_024944	-		19629360	+1	no_errors	ENST00000299295	ensembl	human	known	74_37	missense	SNP	1.000	T
FAT4	79633	genome.wustl.edu	37	4	126373193	126373193	+	Silent	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr4:126373193C>T	ENST00000394329.3	+	9	11035	c.11022C>T	c.(11020-11022)tcC>tcT	p.S3674S	FAT4_ENST00000335110.5_Silent_p.S1972S	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	3674					branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						AGCCAAGGTCCACAGATGGCA	0.483																																																	0								ENSG00000196159						144.0	137.0	140.0					4																	126373193		2203	4300	6503	FAT4	SO:0001819	synonymous_variant	0			-	HGNC	AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.11022C>T	4.37:g.126373193C>T		Somatic	0	29	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	36	18.18	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Laminin_G,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,superfamily_Cadherin-like,superfamily_ConA-like_lec_gl_sf,smart_Cadherin,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.S3674	ENST00000394329.3	37	c.11022	CCDS3732.3	4																																																																																			-	superfamily_Cadherin-like		0.483	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT4	protein_coding	OTTHUMT00000256765.2	C	NM_024582	-		126373193	+1	no_errors	ENST00000394329	ensembl	human	known	74_37	silent	SNP	0.574	T
HHIPL1	84439	genome.wustl.edu	37	14	100119155	100119155	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr14:100119155G>A	ENST00000330710.5	+	2	948	c.850G>A	c.(850-852)Gag>Aag	p.E284K	HHIPL1_ENST00000357223.2_Missense_Mutation_p.E284K	NM_001127258.1	NP_001120730.1	Q96JK4	HIPL1_HUMAN	HHIP-like 1	284					carbohydrate metabolic process (GO:0005975)	extracellular region (GO:0005576)|membrane (GO:0016020)	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor (GO:0016901)|quinone binding (GO:0048038)|scavenger receptor activity (GO:0005044)			breast(1)|endometrium(2)|large_intestine(2)|lung(8)|skin(2)	15		Melanoma(154;0.128)				CCGCATCAGCGAGTTCAGAGT	0.612																																																	0								ENSG00000182218						41.0	38.0	39.0					14																	100119155		2203	4300	6503	HHIPL1	SO:0001583	missense	0			-	HGNC	AB058725	CCDS9953.1, CCDS45162.1	14q32	2008-01-16	2008-01-16	2008-01-16		ENSG00000182218			19710	protein-coding gene	gene with protein product			"""KIAA1822"""	KIAA1822			Standard	NM_032425		Approved		uc010avs.3	Q96JK4		ENST00000330710.5:c.850G>A	14.37:g.100119155G>A	ENSP00000330601:p.Glu284Lys	Somatic	0	26	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	47	21.67	A2RUF8|B2RN09|Q6UXX2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SRCR,pfam_Folate_rcpt-like,pfam_Glc/Sorbosone_DH,superfamily_Srcr_rcpt-rel,superfamily_Quinoprot_gluc/sorb_DH,smart_Srcr_rcpt-rel,pfscan_SRCR,prints_SRCR	p.E284K	ENST00000330710.5	37	c.850	CCDS45162.1	14	.	.	.	.	.	.	.	.	.	.	g	29.5	5.014100	0.93404	.	.	ENSG00000182218	ENST00000330710;ENST00000357223	T;T	0.10763	2.84;2.84	4.61	4.61	0.57282	Soluble quinoprotein glucose/sorbosone dehydrogenase (1);Six-bladed beta-propeller, TolB-like (1);	0.062472	0.64402	D	0.000006	T	0.36608	0.0973	M	0.82056	2.57	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79108	0.992;0.975	T	0.37150	-0.9718	10	0.87932	D	0	.	17.4611	0.87620	0.0:0.0:1.0:0.0	.	284;284	Q96JK4;Q96JK4-2	HIPL1_HUMAN;.	K	284	ENSP00000330601:E284K;ENSP00000349757:E284K	ENSP00000330601:E284K	E	+	1	0	HHIPL1	99188908	1.000000	0.71417	1.000000	0.80357	0.855000	0.48748	8.017000	0.88712	2.106000	0.64143	0.563000	0.77884	GAG	-	superfamily_Quinoprot_gluc/sorb_DH		0.612	HHIPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HHIPL1	protein_coding	OTTHUMT00000413811.1	G	XM_041566	-		100119155	+1	no_errors	ENST00000330710	ensembl	human	known	74_37	missense	SNP	1.000	A
CHAT	1103	genome.wustl.edu	37	10	50857626	50857626	+	Nonsense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr10:50857626G>A	ENST00000337653.2	+	10	1608	c.1455G>A	c.(1453-1455)tgG>tgA	p.W485*	CHAT_ENST00000351556.3_Nonsense_Mutation_p.W367*|CHAT_ENST00000455728.2_Nonsense_Mutation_p.W367*|CHAT_ENST00000395559.2_Nonsense_Mutation_p.W367*|CHAT_ENST00000339797.1_Nonsense_Mutation_p.W367*|CHAT_ENST00000395562.2_Nonsense_Mutation_p.W403*	NM_001142929.1|NM_020549.4	NP_001136401.1|NP_065574	P28329	CLAT_HUMAN	choline O-acetyltransferase	485					adult walking behavior (GO:0007628)|dendrite development (GO:0016358)|establishment of synaptic specificity at neuromuscular junction (GO:0007529)|glycerophospholipid biosynthetic process (GO:0046474)|muscle organ development (GO:0007517)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter secretion (GO:0007269)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|rhythmic behavior (GO:0007622)|rhythmic excitation (GO:0043179)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	choline O-acetyltransferase activity (GO:0004102)			central_nervous_system(3)|endometrium(2)|kidney(2)|large_intestine(11)|lung(34)|prostate(3)|urinary_tract(1)	56		all_neural(218;0.107)		GBM - Glioblastoma multiforme(2;0.000585)	Choline(DB00122)|Nicotine(DB00184)	GGCTGCGGTGGAAATGCTCCC	0.612																																																	0								ENSG00000070748						40.0	47.0	44.0					10																	50857626		2202	4300	6502	CHAT	SO:0001587	stop_gained	0			-	HGNC	AF305907	CCDS7232.1, CCDS7233.1, CCDS44389.1	10q11.2	2010-05-11	2010-05-11		ENSG00000070748	ENSG00000070748	2.3.1.6		1912	protein-coding gene	gene with protein product		118490	"""choline acetyltransferase"""			1840566	Standard	NM_020984		Approved		uc001jhz.2	P28329	OTTHUMG00000018198	ENST00000337653.2:c.1455G>A	10.37:g.50857626G>A	ENSP00000337103:p.Trp485*	Somatic	0	26	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	29	27.50	A2BDF4|A2BDF5|Q16488|Q9BQ23|Q9BQ35|Q9BQE1	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Carn_acyl_trans	p.W485*	ENST00000337653.2	37	c.1455	CCDS7232.1	10	.	.	.	.	.	.	.	.	.	.	G	41	8.814878	0.98964	.	.	ENSG00000070748	ENST00000339797;ENST00000351556;ENST00000395559;ENST00000337653;ENST00000395562;ENST00000455728	.	.	.	5.04	5.04	0.67666	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-13.0619	18.3655	0.90389	0.0:0.0:1.0:0.0	.	.	.	.	X	367;367;367;485;403;367	.	ENSP00000337103:W485X	W	+	3	0	CHAT	50527632	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	9.476000	0.97823	2.322000	0.78497	0.462000	0.41574	TGG	-	pfam_Carn_acyl_trans		0.612	CHAT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CHAT	protein_coding	OTTHUMT00000047997.1	G	NM_020549	-		50857626	+1	no_errors	ENST00000337653	ensembl	human	known	74_37	nonsense	SNP	1.000	A
A2M	2	genome.wustl.edu	37	12	9225050	9225050	+	Silent	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr12:9225050C>T	ENST00000318602.7	-	31	4315	c.4008G>A	c.(4006-4008)aaG>aaA	p.K1336K		NM_000014.4	NP_000005	P01023	A2MG_HUMAN	alpha-2-macroglobulin	1336					blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of complement activation, lectin pathway (GO:0001869)|negative regulation of endopeptidase activity (GO:0010951)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|stem cell differentiation (GO:0048863)	blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule lumen (GO:0031093)	calcium-dependent protein binding (GO:0048306)|enzyme binding (GO:0019899)|growth factor binding (GO:0019838)|interleukin-1 binding (GO:0019966)|interleukin-8 binding (GO:0019959)|protease binding (GO:0002020)|receptor binding (GO:0005102)|serine-type endopeptidase inhibitor activity (GO:0004867)|tumor necrosis factor binding (GO:0043120)			breast(1)|central_nervous_system(6)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(17)|lung(30)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	77					Bacitracin(DB00626)|Becaplermin(DB00102)|Ocriplasmin(DB08888)	GGAACTCTTCCTTTTCTGGGA	0.443																																																	0								ENSG00000175899						106.0	104.0	104.0					12																	9225050		1969	4190	6159	A2M	SO:0001819	synonymous_variant	0			-	HGNC	BX647329, X68728, M11313	CCDS44827.1	12p13.31	2010-02-24			ENSG00000175899	ENSG00000175899			7	protein-coding gene	gene with protein product		103950					Standard	XM_006719056		Approved	FWP007, S863-7, CPAMD5	uc001qvk.1	P01023	OTTHUMG00000150267	ENST00000318602.7:c.4008G>A	12.37:g.9225050C>T		Somatic	0	58	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	61	19.74	Q13677|Q59F47|Q5QTS0|Q68DN2|Q6PIY3|Q6PN97	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_A2M_comp,pfam_A2M_N_2,pfam_Macroglobln_a2,pfam_A-macroglobulin_rcpt-bd,pfam_A2M_N,pfam_MacrogloblnA2_thiol-ester-bond,superfamily_Terpenoid_cyclase/PrenylTrfase,superfamily_A-macroglobulin_rcpt-bd,superfamily_Beta-lactam/transpept-like,superfamily_Cupredoxin	p.K1336	ENST00000318602.7	37	c.4008	CCDS44827.1	12																																																																																			-	NULL		0.443	A2M-001	KNOWN	basic|appris_principal|CCDS	protein_coding	A2M	protein_coding	OTTHUMT00000317233.2	C	NM_000014	-		9225050	-1	no_errors	ENST00000318602	ensembl	human	known	74_37	silent	SNP	0.000	T
TRIOBP	11078	genome.wustl.edu	37	22	38121467	38121467	+	Silent	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr22:38121467C>T	ENST00000406386.3	+	7	3159	c.2904C>T	c.(2902-2904)acC>acT	p.T968T		NM_001039141.2	NP_001034230.1	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein	968					actin modification (GO:0030047)|barbed-end actin filament capping (GO:0051016)|mitotic nuclear division (GO:0007067)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	actin filament binding (GO:0051015)|GTP-Rho binding (GO:0017049)|myosin II binding (GO:0045159)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	Melanoma(58;0.0574)					TTGGCCCCACCCAGTACAACT	0.642																																																	0								ENSG00000100106						117.0	138.0	131.0					22																	38121467		2055	4204	6259	TRIOBP	SO:0001819	synonymous_variant	0			-	HGNC	AB051449	CCDS33644.1, CCDS43015.1, CCDS43016.1	22q13.1	2014-06-03			ENSG00000100106	ENSG00000100106		"""Pleckstrin homology (PH) domain containing"""	17009	protein-coding gene	gene with protein product		609761		DFNB28		11148140, 16385457, 16385458	Standard	NM_001039141		Approved	HRIHFB2122, KIAA1662, Tara, TAP68	uc003atr.3	Q9H2D6	OTTHUMG00000150657	ENST00000406386.3:c.2904C>T	22.37:g.38121467C>T		Somatic	0	38	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	40	13.04	B1AHD4|B1AHD7|F2Z2W0|F8W6V6|O94797|Q2PZW8|Q2Q3Z9|Q2Q400|Q5R3M6|Q96DW1|Q9BT77|Q9BTL7|Q9BY98|Q9Y3L4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.T968	ENST00000406386.3	37	c.2904	CCDS43015.1	22																																																																																			-	NULL		0.642	TRIOBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRIOBP	protein_coding	OTTHUMT00000319439.2	C		-		38121467	+1	no_errors	ENST00000406386	ensembl	human	known	74_37	silent	SNP	0.000	T
NLRP6	171389	genome.wustl.edu	37	11	285284	285284	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr11:285284G>A	ENST00000312165.5	+	8	2659	c.2659G>A	c.(2659-2661)Gaa>Aaa	p.E887K	RP11-326C3.2_ENST00000534742.1_RNA|RP11-326C3.2_ENST00000533924.1_RNA|RP11-326C3.2_ENST00000525217.1_RNA|NLRP6_ENST00000534750.1_Missense_Mutation_p.E886K	NM_138329.1	NP_612202.2	P59044	NALP6_HUMAN	NLR family, pyrin domain containing 6	887					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of immune response (GO:0050777)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|regulation of inflammatory response (GO:0050727)|response to bacterium (GO:0009617)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|vasopressin receptor activity (GO:0005000)			breast(1)|skin(1)|upper_aerodigestive_tract(2)	4		all_cancers(49;1.12e-06)|all_epithelial(84;0.000375)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;4.28e-28)|Epithelial(43;2.47e-27)|OV - Ovarian serous cystadenocarcinoma(40;4.66e-21)|BRCA - Breast invasive adenocarcinoma(625;3.57e-05)|Lung(200;0.0485)|LUSC - Lung squamous cell carcinoma(625;0.122)		ACCTCCCAAGGAACTCATCTC	0.592																																																	0								ENSG00000174885						73.0	62.0	66.0					11																	285284		2203	4300	6503	NLRP6	SO:0001583	missense	0			-	HGNC	AF479748	CCDS7693.1, CCDS60680.1	11p15	2006-12-08	2006-12-08	2006-12-08	ENSG00000174885	ENSG00000174885		"""Nucleotide-binding domain and leucine rich repeat containing"""	22944	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 6"""	609650	"""NACHT, leucine rich repeat and PYD containing 6"""	NALP6		12563287, 12019269	Standard	NM_138329		Approved	PYPAF5, PAN3, CLR11.4	uc010qvs.3	P59044	OTTHUMG00000119070	ENST00000312165.5:c.2659G>A	11.37:g.285284G>A	ENSP00000309767:p.Glu887Lys	Somatic	0	66	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	87	11.22	A8K9F3|E9PJZ8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DAPIN,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.E887K	ENST00000312165.5	37	c.2659	CCDS7693.1	11	.	.	.	.	.	.	.	.	.	.	G	6.976	0.550032	0.13374	.	.	ENSG00000174885	ENST00000534750;ENST00000312165	T;T	0.74632	-0.86;-0.83	2.17	1.24	0.21308	.	.	.	.	.	T	0.47358	0.1441	N	0.08118	0	0.09310	N	1	B;B	0.09022	0.002;0.002	B;B	0.08055	0.003;0.003	T	0.26430	-1.0103	9	0.19147	T	0.46	.	3.3712	0.07222	0.1663:0.2762:0.5575:0.0	.	886;887	E9PJZ8;P59044	.;NALP6_HUMAN	K	886;887	ENSP00000433617:E886K;ENSP00000309767:E887K	ENSP00000309767:E887K	E	+	1	0	NLRP6	275284	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.489000	0.22387	0.479000	0.27511	0.557000	0.71058	GAA	-	NULL		0.592	NLRP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP6	protein_coding	OTTHUMT00000239283.1	G	NM_138329	-		285284	+1	no_errors	ENST00000312165	ensembl	human	known	74_37	missense	SNP	0.001	A
CAND1	55832	genome.wustl.edu	37	12	67699121	67699121	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr12:67699121C>T	ENST00000545606.1	+	10	2110	c.1673C>T	c.(1672-1674)tCg>tTg	p.S558L		NM_018448.3	NP_060918.2	Q86VP6	CAND1_HUMAN	cullin-associated and neddylation-dissociated 1	558					cell differentiation (GO:0030154)|negative regulation of catalytic activity (GO:0043086)|positive regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045899)|protein ubiquitination (GO:0016567)|SCF complex assembly (GO:0010265)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)				NS(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(12)|prostate(1)|skin(2)|stomach(1)	35			GBM - Glioblastoma multiforme(1;1.13e-10)|Lung(24;0.000342)|LUSC - Lung squamous cell carcinoma(43;0.196)	GBM - Glioblastoma multiforme(28;0.0279)		CAGCCTTCCTCGTTTGATGCA	0.388																																																	0								ENSG00000111530						147.0	143.0	144.0					12																	67699121		2203	4300	6503	CAND1	SO:0001583	missense	0			-	HGNC		CCDS8977.1	12q14	2008-02-05			ENSG00000111530	ENSG00000111530			30688	protein-coding gene	gene with protein product	"""TBP interacting protein"""	607727				10048485, 8954946	Standard	NM_018448		Approved	TIP120A, DKFZp434M1414, KIAA0829, TIP120	uc001stn.2	Q86VP6	OTTHUMG00000169060	ENST00000545606.1:c.1673C>T	12.37:g.67699121C>T	ENSP00000442318:p.Ser558Leu	Somatic	0	36	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	43	10.42	B2RAU3|O94918|Q6PIY4|Q8NDJ4|Q96JZ9|Q96T19|Q9BTC4|Q9H0G2|Q9P0H7|Q9UF85	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TATA-bd_TIP120,pfam_HEAT,superfamily_ARM-type_fold	p.S558L	ENST00000545606.1	37	c.1673	CCDS8977.1	12	.	.	.	.	.	.	.	.	.	.	C	8.925	0.961953	0.18583	.	.	ENSG00000111530	ENST00000545606;ENST00000299218	T	0.69306	-0.39	5.43	5.43	0.79202	Armadillo-like helical (1);Armadillo-type fold (1);	0.334869	0.35838	N	0.002948	T	0.63082	0.2481	L	0.49126	1.545	0.51767	D	0.999937	B	0.02656	0.0	B	0.01281	0.0	T	0.56854	-0.7910	9	.	.	.	-8.4492	19.5983	0.95549	0.0:1.0:0.0:0.0	.	558	Q86VP6	CAND1_HUMAN	L	558	ENSP00000442318:S558L	.	S	+	2	0	CAND1	65985388	0.957000	0.32711	0.982000	0.44146	0.967000	0.64934	2.240000	0.43088	2.704000	0.92352	0.650000	0.86243	TCG	-	superfamily_ARM-type_fold		0.388	CAND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAND1	protein_coding	OTTHUMT00000402105.1	C	NM_018448	-		67699121	+1	no_errors	ENST00000545606	ensembl	human	known	74_37	missense	SNP	0.994	T
RAD51D	5892	genome.wustl.edu	37	17	33448323	33448323	+	5'Flank	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr17:33448323C>T	ENST00000345365.6	-	0	0				RAD51D_ENST00000357906.3_5'Flank|FNDC8_ENST00000158009.5_5'Flank|RAD51D_ENST00000360276.3_5'Flank|RAD51D_ENST00000460118.2_5'Flank|RAD51L3-RFFL_ENST00000593039.1_5'UTR|RAD51D_ENST00000590380.1_5'Flank|RAD51D_ENST00000335858.7_5'Flank|RAD51D_ENST00000590016.1_5'Flank|RAD51D_ENST00000394589.4_5'Flank	NM_002878.3	NP_002869.3	O75771	RA51D_HUMAN	RAD51 paralog D						ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|reciprocal meiotic recombination (GO:0007131)|strand invasion (GO:0042148)|telomere maintenance (GO:0000723)	centrosome (GO:0005813)|chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|Rad51B-Rad51C-Rad51D-XRCC2 complex (GO:0033063)|replication fork (GO:0005657)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|gamma-tubulin binding (GO:0043015)|single-stranded DNA binding (GO:0003697)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(2)|liver(1)|lung(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	13						CCTTATTCTCCTTCCCAGGGC	0.547								Direct reversal of damage																																									0								ENSG00000185379																																			RAD51D	SO:0001631	upstream_gene_variant	0			-	HGNC	AF034956	CCDS11287.1, CCDS11288.1, CCDS45646.1	17q11	2014-09-17	2013-07-02	2011-07-01	ENSG00000185379	ENSG00000185379			9823	protein-coding gene	gene with protein product	"""recombination repair protein"", ""DNA repair protein RAD51 homolog 4"""	602954	"""RAD51 (S. cerevisiae)-like 3"", ""RAD51-like 3 (S. cerevisiae)"", ""RAD51 homolog D (S. cerevisiae)"""	RAD51L3		9570954	Standard	NM_001142571		Approved	R51H3, Trad, HsTRAD	uc010ctj.2	O75771	OTTHUMG00000132930		17.37:g.33448323C>T	Exception_encountered	Somatic	0	69	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	70	21.35	B4DJU7|E1P637|O43537|O60355|O75196|O75847|O75848|O76073|O76085|O94908|Q9UFU5	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000345365.6	37	NULL	CCDS11287.1	17																																																																																			-	-		0.547	RAD51D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAD51D	protein_coding	OTTHUMT00000256446.1	C	NM_002878	-		33448323	-1	no_errors	ENST00000415064	ensembl	human	known	74_37	rna	SNP	0.006	T
ITIH5	80760	genome.wustl.edu	37	10	7679438	7679438	+	Silent	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr10:7679438C>T	ENST00000256861.6	-	5	483	c.405G>A	c.(403-405)gaG>gaA	p.E135E	ITIH5_ENST00000434980.1_5'UTR|ITIH5_ENST00000446830.2_5'UTR|ITIH5_ENST00000397146.2_Silent_p.E135E|ITIH5_ENST00000397145.2_Silent_p.E135E	NM_030569.6	NP_085046.5	Q86UX2	ITIH5_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 5	135	VIT. {ECO:0000255|PROSITE- ProRule:PRU00801}.				hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|kidney(6)|large_intestine(21)|lung(25)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|urinary_tract(3)	75						CAGTCCCCTTCTCTCTGTCAG	0.547																																																	0								ENSG00000123243						55.0	61.0	59.0					10																	7679438		2203	4300	6503	ITIH5	SO:0001819	synonymous_variant	0			-	HGNC			10p14	2011-10-26	2011-10-26		ENSG00000123243	ENSG00000123243			21449	protein-coding gene	gene with protein product		609783	"""inter-alpha (globulin) inhibitor H5"""			14744536	Standard	NM_001001851		Approved	MGC10848	uc021pmv.1	Q86UX2	OTTHUMG00000017635	ENST00000256861.6:c.405G>A	10.37:g.7679438C>T		Somatic	0	32	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	30	20.51	Q5T664|Q5T665|Q5T666|Q6AI60|Q6UXB7|Q8TF48|Q8WYV2|Q96K70	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_ITI_HC_C,pfam_VIT,pfam_VWF_A,smart_VIT,smart_VWF_A,pfscan_VWF_A	p.E135	ENST00000256861.6	37	c.405		10																																																																																			-	pfam_VIT,smart_VIT		0.547	ITIH5-001	KNOWN	basic|appris_principal	protein_coding	ITIH5	protein_coding	OTTHUMT00000046688.1	C	NM_030569	-		7679438	-1	no_errors	ENST00000256861	ensembl	human	known	74_37	silent	SNP	0.980	T
OR2A14	135941	genome.wustl.edu	37	7	143826692	143826692	+	Silent	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr7:143826692C>T	ENST00000408899.2	+	1	542	c.487C>T	c.(487-489)Ctg>Ttg	p.L163L		NM_001001659.1	NP_001001659.1	Q96R47	O2A14_HUMAN	olfactory receptor, family 2, subfamily A, member 14	163						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(4)|lung(17)|skin(1)	22	Melanoma(164;0.0783)					AGTTCTCATCCTGAGCCTGCC	0.542																																																	0								ENSG00000221938						212.0	231.0	225.0					7																	143826692		2095	4236	6331	OR2A14	SO:0001819	synonymous_variant	0			-	HGNC		CCDS43672.1	7q35	2013-09-20		2004-03-08	ENSG00000221938	ENSG00000221938		"""GPCR / Class A : Olfactory receptors"""	15084	protein-coding gene	gene with protein product				OR2A14P, OR2A6			Standard	NM_001001659		Approved	OST182	uc011kua.2	Q96R47	OTTHUMG00000158003	ENST00000408899.2:c.487C>T	7.37:g.143826692C>T		Somatic	0	63	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	57	10.94	Q6IF41|Q8NGT8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L163	ENST00000408899.2	37	c.487	CCDS43672.1	7																																																																																			-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.542	OR2A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2A14	protein_coding	OTTHUMT00000349980.1	C		-		143826692	+1	no_errors	ENST00000408899	ensembl	human	known	74_37	silent	SNP	0.002	T
ASXL3	80816	genome.wustl.edu	37	18	31324429	31324429	+	Silent	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr18:31324429C>T	ENST00000269197.5	+	12	4617	c.4617C>T	c.(4615-4617)ttC>ttT	p.F1539F		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like transcriptional regulator 3	1539					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43						GTTCCACTTTCATTGCTGCTT	0.507											OREG0024911	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000141431						35.0	37.0	36.0					18																	31324429		2080	4214	6294	ASXL3	SO:0001819	synonymous_variant	0			-	HGNC	AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431			29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713		11214970	Standard	NM_030632		Approved		uc010dmg.1	Q9C0F0		ENST00000269197.5:c.4617C>T	18.37:g.31324429C>T		Somatic	0	42	0.00	823	0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	27	27.03	Q6ZMX6|Q96MU3|Q9UFC5	Silent	SNP	NA	NA	NA	NA	NA	NA	superfamily_Znf_FYVE_PHD	p.F1539	ENST00000269197.5	37	c.4617	CCDS45847.1	18																																																																																			-	NULL		0.507	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ASXL3	protein_coding	OTTHUMT00000441865.2	C		-		31324429	+1	no_errors	ENST00000269197	ensembl	human	known	74_37	silent	SNP	0.586	T
CSNK1G2	1455	genome.wustl.edu	37	19	1980163	1980163	+	Silent	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr19:1980163C>T	ENST00000255641.8	+	12	1704	c.1209C>T	c.(1207-1209)ttC>ttT	p.F403F		NM_001319.6	NP_001310.3	P78368	KC1G2_HUMAN	casein kinase 1, gamma 2	403					protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|peptide binding (GO:0042277)|protein serine/threonine kinase activity (GO:0004674)			endometrium(1)|kidney(1)|lung(3)|prostate(1)|skin(1)|stomach(1)	8		Ovarian(11;2.11e-07)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCTGTTTCTTCAAGAGGAGAA	0.652																																					Ovarian(91;880 1392 21236 36928 37598)												0								ENSG00000133275						52.0	54.0	53.0					19																	1980163		2203	4300	6503	CSNK1G2	SO:0001819	synonymous_variant	0			-	HGNC	AF001177	CCDS12077.1	19p13.3	2013-01-17			ENSG00000133275	ENSG00000133275			2455	protein-coding gene	gene with protein product		602214				9403068	Standard	NM_001319		Approved	CK1g2	uc002lul.4	P78368		ENST00000255641.8:c.1209C>T	19.37:g.1980163C>T		Somatic	0	73	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	83	16.16	B5BU42|O00704|Q8WUB1	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Casein_kinase-1_gamma_C,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.F403	ENST00000255641.8	37	c.1209	CCDS12077.1	19																																																																																			-	NULL		0.652	CSNK1G2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSNK1G2	protein_coding	OTTHUMT00000449287.1	C	NM_001319	-		1980163	+1	no_errors	ENST00000255641	ensembl	human	known	74_37	silent	SNP	1.000	T
CBX8	57332	genome.wustl.edu	37	17	77769185	77769185	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr17:77769185C>T	ENST00000269385.4	-	5	536	c.419G>A	c.(418-420)aGc>aAc	p.S140N	CBX8_ENST00000485449.1_5'Flank	NM_020649.2	NP_065700.1	Q9HC52	CBX8_HUMAN	chromobox homolog 8	140					histone ubiquitination (GO:0016574)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	heterochromatin (GO:0000792)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	methylated histone binding (GO:0035064)|single-stranded RNA binding (GO:0003727)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|central_nervous_system(1)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|skin(1)|stomach(1)	14			OV - Ovarian serous cystadenocarcinoma(97;0.0102)|BRCA - Breast invasive adenocarcinoma(99;0.0224)			GCGGCAGGTGCTGCTGGTGCT	0.711																																																	0								ENSG00000141570						23.0	21.0	21.0					17																	77769185		2202	4298	6500	CBX8	SO:0001583	missense	0			-	HGNC	AF174482	CCDS11765.1	17q25.3	2010-07-06	2010-06-24		ENSG00000141570	ENSG00000141570			15962	protein-coding gene	gene with protein product	"""polycomb 3"", ""Pc class 3 homolog (Drosophila)"""		"""chromobox homolog 8 (Drosophila Pc class)"""			10825164	Standard	NM_020649		Approved	RC1, HPC3, PC3	uc002jxd.2	Q9HC52	OTTHUMG00000150416	ENST00000269385.4:c.419G>A	17.37:g.77769185C>T	ENSP00000269385:p.Ser140Asn	Somatic	0	55	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	47	16.07	Q96H39|Q9NR07	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Chromo_domain,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,pfscan_Chromo_domain/shadow	p.S140N	ENST00000269385.4	37	c.419	CCDS11765.1	17	.	.	.	.	.	.	.	.	.	.	C	13.33	2.204170	0.38905	.	.	ENSG00000141570	ENST00000269385;ENST00000427800;ENST00000413392	T;T;T	0.35236	1.57;1.32;1.57	4.66	4.66	0.58398	.	0.879904	0.09848	N	0.747941	T	0.22666	0.0547	N	0.19112	0.55	0.24283	N	0.995192	B	0.30326	0.276	B	0.28553	0.091	T	0.10428	-1.0630	10	0.30078	T	0.28	-18.7718	6.7362	0.23411	0.0:0.7211:0.1819:0.097	.	140	Q9HC52	CBX8_HUMAN	N	140;115;130	ENSP00000269385:S140N;ENSP00000408753:S115N;ENSP00000405058:S130N	ENSP00000269385:S140N	S	-	2	0	CBX8	75383780	1.000000	0.71417	1.000000	0.80357	0.662000	0.39071	1.168000	0.31859	2.110000	0.64415	0.462000	0.41574	AGC	-	NULL		0.711	CBX8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CBX8	protein_coding	OTTHUMT00000318011.1	C	NM_020649	-		77769185	-1	no_errors	ENST00000269385	ensembl	human	known	74_37	missense	SNP	1.000	T
KRTAP10-11	386678	genome.wustl.edu	37	21	46067223	46067223	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr21:46067223C>T	ENST00000334670.8	+	1	893	c.848C>T	c.(847-849)tCc>tTc	p.S283F	TSPEAR_ENST00000323084.4_Intron	NM_198692.2	NP_941965.2	P60412	KR10B_HUMAN	keratin associated protein 10-11	283						keratin filament (GO:0045095)				NS(1)|endometrium(1)|large_intestine(1)|lung(6)|ovary(2)|prostate(1)	12						CCCGCAAGCTCCCGCCTGGCC	0.647																																																	0								ENSG00000243489						35.0	43.0	40.0					21																	46067223		2191	4276	6467	KRTAP10-11	SO:0001583	missense	0			-	HGNC	AB076359	CCDS42962.1	21q22.3	2006-03-13	2004-07-12	2004-07-14	ENSG00000243489	ENSG00000243489		"""Keratin associated proteins"""	20528	protein-coding gene	gene with protein product			"""keratin associated protein 10-11"""	KRTAP18-11			Standard	NM_198692		Approved	KRTAP18.11, KAP18.11, KAP10.11	uc002zfr.4	P60412	OTTHUMG00000057626	ENST00000334670.8:c.848C>T	21.37:g.46067223C>T	ENSP00000334197:p.Ser283Phe	Somatic	0	128	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	82	20.39	A2RRF9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.S283F	ENST00000334670.8	37	c.848	CCDS42962.1	21	.	.	.	.	.	.	.	.	.	.	c	9.066	0.995651	0.19043	.	.	ENSG00000243489	ENST00000334670	T	0.00832	5.64	3.87	2.94	0.34122	.	.	.	.	.	T	0.03739	0.0106	M	0.76170	2.325	0.09310	N	1	D	0.59767	0.986	P	0.59825	0.864	T	0.26744	-1.0094	9	0.62326	D	0.03	.	10.5927	0.45318	0.0:0.7436:0.2564:0.0	.	283	P60412	KR10B_HUMAN	F	283	ENSP00000334197:S283F	ENSP00000334197:S283F	S	+	2	0	KRTAP10-11	44891651	0.005000	0.15991	0.005000	0.12908	0.013000	0.08279	0.339000	0.19875	1.704000	0.51252	0.462000	0.41574	TCC	-	NULL		0.647	KRTAP10-11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP10-11	protein_coding	OTTHUMT00000128029.1	C	NM_198692	-		46067223	+1	no_errors	ENST00000334670	ensembl	human	known	74_37	missense	SNP	0.002	T
ATP2B2	491	genome.wustl.edu	37	3	10417133	10417133	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr3:10417133G>A	ENST00000352432.4	-	10	1466	c.1397C>T	c.(1396-1398)tCg>tTg	p.S466L	ATP2B2_ENST00000397077.1_Missense_Mutation_p.S421L|ATP2B2_ENST00000360273.2_Missense_Mutation_p.S466L|ATP2B2_ENST00000343816.4_Missense_Mutation_p.S452L|ATP2B2_ENST00000383800.4_Missense_Mutation_p.S421L			Q01814	AT2B2_HUMAN	ATPase, Ca++ transporting, plasma membrane 2	466					auditory receptor cell stereocilium organization (GO:0060088)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cerebellar granule cell differentiation (GO:0021707)|cerebellar Purkinje cell differentiation (GO:0021702)|cGMP metabolic process (GO:0046068)|cochlea development (GO:0090102)|cytosolic calcium ion homeostasis (GO:0051480)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|locomotion (GO:0040011)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neuron differentiation (GO:0030182)|organelle organization (GO:0006996)|otolith mineralization (GO:0045299)|positive regulation of calcium ion transport (GO:0051928)|regulation of cell size (GO:0008361)|regulation of synaptic plasticity (GO:0048167)|sensory perception of sound (GO:0007605)|serotonin metabolic process (GO:0042428)|synapse organization (GO:0050808)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cilium (GO:0005929)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-dependent ATPase activity (GO:0030899)|calcium-transporting ATPase activity (GO:0005388)|calmodulin binding (GO:0005516)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein C-terminus binding (GO:0008022)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|large_intestine(19)|lung(29)|ovary(5)|prostate(2)|skin(4)|stomach(2)|urinary_tract(2)	74						ATAGGCCAACGAGATGGTGAC	0.632																																					Ovarian(125;1619 1709 15675 19819 38835)												0								ENSG00000157087						58.0	63.0	61.0					3																	10417133		2203	4300	6503	ATP2B2	SO:0001583	missense	0			-	HGNC	X63575	CCDS2601.1, CCDS33701.1	3p25.3	2010-04-20	2001-12-04		ENSG00000157087	ENSG00000157087	3.6.3.8	"""ATPases / P-type"""	815	protein-coding gene	gene with protein product	"""plasma membrane Ca2+ pump 2"", ""plasma membrane calcium-transporting ATPase 2"""	108733				1313367	Standard	NM_001001331		Approved	PMCA2	uc003bvt.3	Q01814	OTTHUMG00000128679	ENST00000352432.4:c.1397C>T	3.37:g.10417133G>A	ENSP00000324172:p.Ser466Leu	Somatic	0	23	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	31	24.39	O00766|Q12994|Q16818	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_cation-transptr_C,pfam_ATP_Ca_trans_C,pfam_HAD-like_dom,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_P-typ_cyto_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Ca-transp_plasma,tigrfam_Cation_transp_P_typ_ATPase	p.S466L	ENST00000352432.4	37	c.1397	CCDS33701.1	3	.	.	.	.	.	.	.	.	.	.	G	17.33	3.362807	0.61403	.	.	ENSG00000157087	ENST00000352432;ENST00000383800;ENST00000397077;ENST00000360273;ENST00000343816;ENST00000535386;ENST00000452124;ENST00000342354	D;D;D;D;D;D	0.91237	-2.81;-2.81;-2.81;-2.81;-2.81;-2.81	4.34	4.34	0.51931	ATPase, P-type, ATPase-associated domain (1);	0.062054	0.64402	D	0.000002	D	0.93871	0.8039	M	0.82323	2.585	0.80722	D	1	B;P;D	0.56746	0.016;0.845;0.977	B;B;P	0.53185	0.009;0.344;0.72	D	0.95112	0.8239	10	0.87932	D	0	-14.2901	17.0685	0.86567	0.0:0.0:1.0:0.0	.	401;433;466	F5H7F7;Q4LE63;Q01814	.;.;AT2B2_HUMAN	L	466;421;421;466;452;401;322;466	ENSP00000324172:S466L;ENSP00000373311:S421L;ENSP00000380267:S421L;ENSP00000353414:S466L;ENSP00000344677:S452L;ENSP00000414854:S322L	ENSP00000342954:S466L	S	-	2	0	ATP2B2	10392133	1.000000	0.71417	0.932000	0.37286	0.708000	0.40852	9.657000	0.98554	2.234000	0.73211	0.561000	0.74099	TCG	-	pfam_ATPase_P-typ_transduc_dom_A,tigrfam_ATPase_P-typ_Ca-transp_plasma,tigrfam_Cation_transp_P_typ_ATPase		0.632	ATP2B2-001	KNOWN	basic|CCDS	protein_coding	ATP2B2	protein_coding	OTTHUMT00000250576.2	G	NM_001683	-		10417133	-1	no_errors	ENST00000352432	ensembl	human	known	74_37	missense	SNP	1.000	A
LINC01531	100128682	genome.wustl.edu	37	19	35899507	35899507	+	lincRNA	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr19:35899507G>A	ENST00000536898.1	+	0	2096					NR_040046.1																						GTAACCTTttggggaaggagg	0.502																																																	0								ENSG00000205786																																			AC002511.1			0			-	Clone_based_vega_gene																													19.37:g.35899507G>A		Somatic	0	39	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	65	21.69		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000536898.1	37	NULL		19																																																																																			-	-		0.502	AC002511.1-002	KNOWN	basic	lincRNA	LOC100128682	lincRNA	OTTHUMT00000466118.1	G		-		35899507	+1	no_errors	ENST00000536898	ensembl	human	known	74_37	rna	SNP	0.001	A
BHMT2	23743	genome.wustl.edu	37	5	78373369	78373369	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr5:78373369G>A	ENST00000255192.3	+	2	166	c.100G>A	c.(100-102)Gag>Aag	p.E34K	DMGDH_ENST00000520388.1_Intron|BHMT2_ENST00000521567.1_Missense_Mutation_p.E34K	NM_017614.4	NP_060084.2	Q9H2M3	BHMT2_HUMAN	betaine--homocysteine S-methyltransferase 2	34	Hcy-binding. {ECO:0000255|PROSITE- ProRule:PRU00333}.				L-methionine salvage (GO:0071267)|S-adenosylmethionine metabolic process (GO:0046500)|S-methylmethionine metabolic process (GO:0033477)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	S-adenosylmethionine-homocysteine S-methyltransferase activity (GO:0008898)|S-methylmethionine-homocysteine S-methyltransferase activity (GO:0061627)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(8)|lung(2)|ovary(1)|skin(1)|urinary_tract(1)	15		all_lung(232;0.00063)|Lung NSC(167;0.00171)|Ovarian(174;0.0261)|Prostate(461;0.191)		OV - Ovarian serous cystadenocarcinoma(54;2.09e-45)|Epithelial(54;9.3e-41)|all cancers(79;4.09e-36)	L-Methionine(DB00134)	CATTACTCTGGAGAAGAGAGG	0.527																																																	0								ENSG00000132840						146.0	146.0	146.0					5																	78373369		2203	4300	6503	BHMT2	SO:0001583	missense	0			-	HGNC		CCDS4045.1, CCDS54871.1	5q13	2010-04-28	2010-04-28		ENSG00000132840	ENSG00000132840	2.1.1.5		1048	protein-coding gene	gene with protein product		605932				11087663, 18230605	Standard	NM_017614		Approved		uc003kft.3	Q9H2M3	OTTHUMG00000108158	ENST00000255192.3:c.100G>A	5.37:g.78373369G>A	ENSP00000255192:p.Glu34Lys	Somatic	0	67	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	58	18.31	B7Z516|Q9NXX7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_S_MeTrfase,superfamily_S_MeTrfase,pirsf_Betaine-hCys_S-MeTrfase_BHMT,pfscan_S_MeTrfase	p.E34K	ENST00000255192.3	37	c.100	CCDS4045.1	5	.	.	.	.	.	.	.	.	.	.	G	24.1	4.499226	0.85069	.	.	ENSG00000132840	ENST00000255192;ENST00000521567	T;T	0.12039	2.72;2.72	4.83	4.83	0.62350	Homocysteine S-methyltransferase (4);	0.000000	0.85682	D	0.000000	T	0.47838	0.1467	M	0.91663	3.23	0.37862	D	0.929756	D;D	0.89917	0.999;1.0	D;D	0.97110	0.996;1.0	T	0.64960	-0.6284	10	0.66056	D	0.02	-22.3212	17.9262	0.88983	0.0:0.0:1.0:0.0	.	34;34	B7Z516;Q9H2M3	.;BHMT2_HUMAN	K	34	ENSP00000255192:E34K;ENSP00000430278:E34K	ENSP00000255192:E34K	E	+	1	0	BHMT2	78409125	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.444000	0.97578	2.226000	0.72624	0.557000	0.71058	GAG	-	pfam_S_MeTrfase,superfamily_S_MeTrfase,pirsf_Betaine-hCys_S-MeTrfase_BHMT,pfscan_S_MeTrfase		0.527	BHMT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BHMT2	protein_coding	OTTHUMT00000226962.2	G	NM_017614	-		78373369	+1	no_errors	ENST00000255192	ensembl	human	known	74_37	missense	SNP	1.000	A
ADCY7	113	genome.wustl.edu	37	16	50325793	50325793	+	Silent	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr16:50325793C>T	ENST00000394697.2	+	4	862	c.522C>T	c.(520-522)gtC>gtT	p.V174V	ADCY7_ENST00000537579.1_Silent_p.V174V|ADCY7_ENST00000538642.1_Silent_p.V174V|ADCY7_ENST00000254235.3_Silent_p.V174V|ADCY7_ENST00000566433.2_Silent_p.V174V|ADCY7_ENST00000564044.1_Intron			P51828	ADCY7_HUMAN	adenylate cyclase 7	174					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to ethanol (GO:0071361)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|maternal process involved in female pregnancy (GO:0060135)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cAMP biosynthetic process (GO:0030819)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(5)|large_intestine(6)|lung(14)|ovary(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(3)	35		all_cancers(37;0.0127)		GBM - Glioblastoma multiforme(240;0.195)		CACCCAGTGTCCGGGTGGGGC	0.652																																																	0								ENSG00000121281						53.0	52.0	52.0					16																	50325793		2198	4300	6498	ADCY7	SO:0001819	synonymous_variant	0			-	HGNC	D25538	CCDS10741.1, CCDS73882.1	16q12.1	2013-02-04			ENSG00000121281	ENSG00000121281	4.6.1.1	"""Adenylate cyclases"""	238	protein-coding gene	gene with protein product		600385				7860067	Standard	NM_001286057		Approved	KIAA0037, AC7	uc002egd.1	P51828	OTTHUMG00000133172	ENST00000394697.2:c.522C>T	16.37:g.50325793C>T		Somatic	0	53	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	61	20.78	A0AVA6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_A/G_cyclase,pfam_Adenylate_cyclase-like,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	p.V174	ENST00000394697.2	37	c.522	CCDS10741.1	16																																																																																			-	NULL		0.652	ADCY7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY7	protein_coding	OTTHUMT00000256877.3	C		-		50325793	+1	no_errors	ENST00000254235	ensembl	human	known	74_37	silent	SNP	0.000	T
C22orf42	150297	genome.wustl.edu	37	22	32548573	32548573	+	Silent	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr22:32548573C>T	ENST00000382097.3	-	3	420	c.348G>A	c.(346-348)gtG>gtA	p.V116V	C22orf42_ENST00000490640.1_5'Flank	NM_001010859.1	NP_001010859.1	Q6IC83	CV042_HUMAN	chromosome 22 open reading frame 42	116										NS(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(2)	24						TATTCTCCTCCACACCGCCGT	0.458																																																	0								ENSG00000205856						43.0	52.0	49.0					22																	32548573		2201	4299	6500	C22orf42	SO:0001819	synonymous_variant	0			-	HGNC	BC040263	CCDS33639.1	22q12.3	2009-03-05			ENSG00000205856	ENSG00000205856			27160	protein-coding gene	gene with protein product						12477932	Standard	XM_005261369		Approved		uc003amd.3	Q6IC83	OTTHUMG00000030380	ENST00000382097.3:c.348G>A	22.37:g.32548573C>T		Somatic	0	49	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	77	17.20	A4QPH5	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.V116	ENST00000382097.3	37	c.348	CCDS33639.1	22																																																																																			-	NULL		0.458	C22orf42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C22orf42	protein_coding	OTTHUMT00000075268.2	C	NM_001010859	-		32548573	-1	no_errors	ENST00000382097	ensembl	human	known	74_37	silent	SNP	0.003	T
SH2D1B	117157	genome.wustl.edu	37	1	162381845	162381845	+	5'UTR	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr1:162381845G>A	ENST00000367929.2	-	0	71				SH2D1B_ENST00000493550.1_5'UTR|SH2D1B_ENST00000359567.3_5'UTR	NM_053282.4	NP_444512.2	O14796	SH21B_HUMAN	SH2 domain containing 1B						leukocyte activation involved in immune response (GO:0002366)|negative regulation of natural killer cell mediated cytotoxicity (GO:0045953)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of innate immune response (GO:0045089)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|positive regulation of natural killer cell mediated immunity (GO:0002717)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|regulation of natural killer cell activation (GO:0032814)	intracellular (GO:0005622)	protein binding, bridging (GO:0030674)			kidney(1)|large_intestine(1)|lung(4)|pancreas(1)	7	all_hematologic(112;0.115)		BRCA - Breast invasive adenocarcinoma(70;0.126)			CTGTTGGCCTGAAATTCACCC	0.537																																																	0								ENSG00000198574						74.0	72.0	73.0					1																	162381845		2203	4300	6503	SH2D1B	SO:0001623	5_prime_UTR_variant	0			-	HGNC	AF484964	CCDS30928.1	1q23.3	2013-02-14			ENSG00000198574	ENSG00000198574		"""SH2 domain containing"""	30416	protein-coding gene	gene with protein product		608510				9000139, 11689425	Standard	NM_053282		Approved	EAT2	uc001gbz.1	O14796	OTTHUMG00000031377	ENST00000367929.2:c.-39C>T	1.37:g.162381845G>A		Somatic	0	26	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	30	25.00	B2RBN6|Q5T0L1|Q8NI18|Q969K9	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000367929.2	37	NULL	CCDS30928.1	1																																																																																			-	-		0.537	SH2D1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SH2D1B	protein_coding	OTTHUMT00000076794.1	G	NM_053282	-		162381845	-1	no_errors	ENST00000493550	ensembl	human	known	74_37	rna	SNP	0.003	A
TRIM51HP	440041	genome.wustl.edu	37	11	55065005	55065005	+	RNA	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr11:55065005C>T	ENST00000526016.1	-	0	420					NR_038174.2				tripartite motif-containing 51H, pseudogene																		CTGAGATTTTCACAAGCTTTT	0.398																																																	0								ENSG00000166007																																			TRIM51HP			0			-	HGNC			11q11	2012-11-02			ENSG00000166007	ENSG00000166007		"""Triparite motif-containing / Pseudogenes"""	43977	pseudogene	pseudogene							Standard	NR_038174		Approved		uc021qjb.1		OTTHUMG00000166775		11.37:g.55065005C>T		Somatic	0	188	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	48	239	16.72		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000526016.1	37	NULL		11																																																																																			-	-		0.398	TRIM51HP-002	PUTATIVE	basic|exp_conf	processed_transcript	TRIM51HP	pseudogene	OTTHUMT00000391438.1	C		-		55065005	-1	no_errors	ENST00000526016	ensembl	human	putative	74_37	rna	SNP	0.000	T
CYP2C18	1562	genome.wustl.edu	37	10	96495020	96495020	+	Splice_Site	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr10:96495020G>A	ENST00000285979.6	+	9	1491	c.1292G>A	c.(1291-1293)gGa>gAa	p.G431E	CYP2C19_ENST00000464755.1_Intron|CYP2C18_ENST00000339022.5_Splice_Site_p.G372E	NM_000772.2	NP_000763.1	P33260	CP2CI_HUMAN	cytochrome P450, family 2, subfamily C, polypeptide 18	431					small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxygen binding (GO:0019825)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(11)|ovary(3)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	26		Colorectal(252;0.09)		all cancers(201;2.8e-06)|KIRC - Kidney renal clear cell carcinoma(50;0.0646)|Kidney(138;0.0805)	Aminophenazone(DB01424)|Antipyrine(DB01435)|Buprenorphine(DB00921)|Clobazam(DB00349)|Clotiazepam(DB01559)|Cyclophosphamide(DB00531)|Dapsone(DB00250)|Desipramine(DB01151)|Diazepam(DB00829)|Diclofenac(DB00586)|Diphenhydramine(DB01075)|Ifosfamide(DB01181)|Imipramine(DB00458)|Lansoprazole(DB00448)|Lidocaine(DB00281)|Methadone(DB00333)|Omeprazole(DB00338)|Pegvisomant(DB00082)|Perphenazine(DB00850)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Propofol(DB00818)|Tolbutamide(DB01124)|Tretinoin(DB00755)|Troleandomycin(DB01361)|Valproic Acid(DB00313)|Verapamil(DB00661)|Vilazodone(DB06684)|Warfarin(DB00682)	TTATTTTCAGGAAAACGGATG	0.408																																																	0								ENSG00000108242						84.0	80.0	81.0					10																	96495020		2203	4300	6503	CYP2C18	SO:0001630	splice_region_variant	0			-	HGNC	M61853	CCDS7435.1, CCDS44460.1	10q24	2003-11-12	2003-01-14		ENSG00000108242	ENSG00000108242		"""Cytochrome P450s"""	2620	protein-coding gene	gene with protein product		601131	"""cytochrome P450, subfamily IIC (mephenytoin 4-hydroxylase), polypeptide 18"""	CYP2C17		1896026, 2009263	Standard	NM_000772		Approved	P450IIC17, CPCI, CYP2C		P33260	OTTHUMG00000018796	ENST00000285979.6:c.1292-1G>A	10.37:g.96495020G>A		Somatic	0	55	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	80	13.04	B2R8K2|Q16703|Q16751|Q4VAT5|Q6GRG1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_B	p.G431E	ENST00000285979.6	37	c.1292	CCDS7435.1	10	.	.	.	.	.	.	.	.	.	.	g	15.61	2.884892	0.51908	.	.	ENSG00000108242	ENST00000339022;ENST00000285979	D;D	0.98849	-5.18;-5.18	4.09	4.09	0.47781	Cytochrome P450, conserved site (1);	0.000000	0.85682	U	0.000000	D	0.99447	0.9804	H	0.97940	4.11	0.80722	D	1	D;D	0.89917	0.991;1.0	D;D	0.83275	0.92;0.996	D	0.98052	1.0388	9	.	.	.	.	13.8369	0.63415	0.0:0.0:1.0:0.0	.	372;431	Q4VAT5;P33260	.;CP2CI_HUMAN	E	372;431	ENSP00000341293:G372E;ENSP00000285979:G431E	.	G	+	2	0	CYP2C18	96485010	1.000000	0.71417	0.999000	0.59377	0.129000	0.20672	7.930000	0.87610	2.079000	0.62486	0.455000	0.32223	GGA	-	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450,prints_Cyt_P450_E_grp-IV		0.408	CYP2C18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP2C18	protein_coding	OTTHUMT00000049486.1	G	NM_000772	-	Missense_Mutation	96495020	+1	no_errors	ENST00000285979	ensembl	human	known	74_37	missense	SNP	1.000	A
SIRPB2	284759	genome.wustl.edu	37	20	1460499	1460499	+	Silent	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr20:1460499G>A	ENST00000359801.3	-	2	333	c.297C>T	c.(295-297)atC>atT	p.I99I	SIRPB2_ENST00000537284.1_Intron|SIRPB2_ENST00000444444.2_Intron|SIRPB2_ENST00000608747.1_Intron	NM_001122962.1	NP_001116434.1	Q9P1W8	SIRPG_HUMAN	signal-regulatory protein beta 2	92	Ig-like V-type.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of T cell activation (GO:0050870)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				endometrium(2)|kidney(2)|large_intestine(4)|lung(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						ATGTCCGTTGGATCATGGGCA	0.453																																																	0								ENSG00000196209						141.0	126.0	130.0					20																	1460499		1568	3582	5150	SIRPB2	SO:0001819	synonymous_variant	0			-	HGNC	AL109658	CCDS42849.1, CCDS46570.1	20p13	2013-01-11	2006-02-03	2006-02-03	ENSG00000196209	ENSG00000196209		"""Signal-regulatory proteins"", ""Immunoglobulin superfamily / V-set domain containing"""	16247	protein-coding gene	gene with protein product			"""protein tyrosine phosphatase, non-receptor type 1-like"", ""protein tyrosine phosphatase, non-receptor type substrate 1-like 3"""	PTPN1L, PTPNS1L3		16339511	Standard	NM_001122962		Approved	dJ776F14.2	uc002wfg.2	Q5JXA9	OTTHUMG00000031670	ENST00000359801.3:c.297C>T	20.37:g.1460499G>A		Somatic	0	55	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	77	12.50	B1AKP6|Q5D051|Q5JV25|Q5MKL4|Q8WWA5|Q9NQK8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_V-set,pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.I99	ENST00000359801.3	37	c.297	CCDS42849.1	20																																																																																			-	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.453	SIRPB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIRPB2	protein_coding	OTTHUMT00000077544.1	G	NM_178459	-		1460499	-1	no_errors	ENST00000359801	ensembl	human	known	74_37	silent	SNP	0.147	A
PCDHA1	56147	genome.wustl.edu	37	5	140165938	140165938	+	Silent	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr5:140165938C>T	ENST00000504120.2	+	1	63	c.63C>T	c.(61-63)ctC>ctT	p.L21L	PCDHA1_ENST00000394633.3_Silent_p.L21L|PCDHA1_ENST00000378133.3_Silent_p.L21L	NM_018900.2	NP_061723.1	Q9Y5I3	PCDA1_HUMAN	protocadherin alpha 1	21					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(3)|kidney(2)|large_intestine(13)|lung(34)|prostate(3)|skin(4)|upper_aerodigestive_tract(5)|urinary_tract(3)	70			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTCTGCTCCTCGCAGCCTGGG	0.597																																																	0								ENSG00000204970						54.0	67.0	63.0					5																	140165938		2203	4300	6503	PCDHA1	SO:0001819	synonymous_variant	0			-	HGNC	AF152479	CCDS54912.1, CCDS54913.1	5q31	2010-11-26				ENSG00000204970		"""Cadherins / Protocadherins : Clustered"""	8663	other	complex locus constituent	"""KIAA0345-like 13"""	606307				10380929	Standard	NM_018900		Approved			Q9Y5I3		ENST00000504120.2:c.63C>T	5.37:g.140165938C>T		Somatic	0	48	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	74	17.78	O75288|Q9NRT7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.L21	ENST00000504120.2	37	c.63	CCDS54913.1	5																																																																																			-	NULL		0.597	PCDHA1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDHA1	protein_coding	OTTHUMT00000389127.1	C	NM_018900	-		140165938	+1	no_errors	ENST00000504120	ensembl	human	known	74_37	silent	SNP	0.000	T
COL16A1	1307	genome.wustl.edu	37	1	32124108	32124108	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr1:32124108G>A	ENST00000373672.3	-	64	4517	c.4001C>T	c.(4000-4002)cCt>cTt	p.P1334L	RP11-73M7.6_ENST00000609625.1_RNA|RP11-73M7.6_ENST00000609033.1_RNA|RP11-73M7.6_ENST00000589462.1_RNA|RP11-73M7.6_ENST00000610216.1_RNA|RP11-73M7.6_ENST00000607926.1_RNA|RP11-73M7.6_ENST00000609549.1_RNA|RP11-73M7.6_ENST00000609338.1_RNA|COL16A1_ENST00000461217.1_5'Flank|RP11-73M7.6_ENST00000591929.1_RNA|COL16A1_ENST00000271069.6_Missense_Mutation_p.P1334L|RP11-73M7.6_ENST00000608888.1_RNA|RP11-73M7.6_ENST00000588288.1_RNA|RP11-73M7.6_ENST00000593188.1_RNA|RP11-73M7.6_ENST00000585660.1_RNA|RP11-73M7.6_ENST00000585413.1_RNA|RP11-73M7.6_ENST00000608332.1_RNA|RP11-73M7.6_ENST00000609373.1_RNA|RP11-73M7.6_ENST00000587445.1_RNA|RP11-73M7.6_ENST00000445166.1_RNA|RP11-73M7.6_ENST00000608246.1_RNA|RP11-73M7.6_ENST00000610043.1_RNA|RP11-73M7.6_ENST00000591592.1_RNA	NM_001856.3	NP_001847.3	Q07092	COGA1_HUMAN	collagen, type XVI, alpha 1	1334	Triple-helical region 2 (COL2) with 2 imperfections.				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|female pregnancy (GO:0007565)|integrin-mediated signaling pathway (GO:0007229)	collagen type XVI trimer (GO:0005597)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	integrin binding (GO:0005178)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(15)|ovary(8)|prostate(4)	48		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0423)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.059)		AGGGTGTCCAGGGGGGCCGGG	0.602																																					Colon(143;498 1786 21362 25193 36625)												0								ENSG00000084636						12.0	14.0	13.0					1																	32124108		1863	4096	5959	COL16A1	SO:0001583	missense	0			-	HGNC	M92642	CCDS41297.1	1p35-p34	2013-01-16			ENSG00000084636	ENSG00000084636		"""Collagens"""	2193	protein-coding gene	gene with protein product		120326				1631157	Standard	NM_001856		Approved		uc001btk.1	Q07092	OTTHUMG00000003883	ENST00000373672.3:c.4001C>T	1.37:g.32124108G>A	ENSP00000362776:p.Pro1334Leu	Somatic	0	46	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	43	20.37	Q16593|Q59F89|Q71RG9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Collagen,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G	p.P1334L	ENST00000373672.3	37	c.4001	CCDS41297.1	1	.	.	.	.	.	.	.	.	.	.	G	18.69	3.678725	0.68042	.	.	ENSG00000084636	ENST00000373672;ENST00000271069;ENST00000440437	D;D;D	0.94232	-3.38;-3.38;-3.17	4.72	4.72	0.59763	.	0.000000	0.85682	D	0.000000	D	0.96445	0.8840	M	0.84082	2.675	0.80722	D	1	D;D	0.71674	0.997;0.998	P;D	0.64776	0.852;0.929	D	0.96547	0.9405	10	0.51188	T	0.08	.	16.8521	0.85996	0.0:0.0:1.0:0.0	.	1334;1332	Q07092;Q07092-2	COGA1_HUMAN;.	L	1334;1334;191	ENSP00000362776:P1334L;ENSP00000271069:P1334L;ENSP00000390281:P191L	ENSP00000271069:P1334L	P	-	2	0	COL16A1	31896695	1.000000	0.71417	0.943000	0.38184	0.995000	0.86356	5.206000	0.65192	2.321000	0.78463	0.655000	0.94253	CCT	-	NULL		0.602	COL16A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL16A1	protein_coding	OTTHUMT00000011057.2	G	NM_001856	-		32124108	-1	no_errors	ENST00000271069	ensembl	human	known	74_37	missense	SNP	0.998	A
CCDC108	255101	genome.wustl.edu	37	2	219903267	219903267	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr2:219903267G>A	ENST00000341552.5	-	4	270	c.187C>T	c.(187-189)Ccc>Tcc	p.P63S	CCDC108_ENST00000410037.1_5'UTR|CCDC108_ENST00000324264.6_5'UTR|CCDC108_ENST00000441968.1_Missense_Mutation_p.P63S|CCDC108_ENST00000295729.2_5'UTR|CCDC108_ENST00000453220.1_Missense_Mutation_p.P63S|CCDC108_ENST00000409865.3_Missense_Mutation_p.P52S	NM_194302.2	NP_919278.2	Q6ZU64	CC108_HUMAN	coiled-coil domain containing 108	63						integral component of membrane (GO:0016021)	poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(18)|liver(1)|lung(34)|ovary(2)|pancreas(1)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	80		Renal(207;0.0915)		Epithelial(149;1.12e-06)|all cancers(144;0.000196)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		ATGTCCTTGGGACACAGTCCA	0.577																																																	0								ENSG00000181378						59.0	47.0	51.0					2																	219903267		2203	4300	6503	CCDC108	SO:0001583	missense	0			-	HGNC	NM_194302, AL833882, AK127189	CCDS2430.2, CCDS2431.2, CCDS63125.1, CCDS63126.1	2q35	2008-02-05			ENSG00000181378	ENSG00000181378			25325	protein-coding gene	gene with protein product		614270				12477932	Standard	NM_194302		Approved	DKFZp434O0527, MGC35338	uc002vjl.2	Q6ZU64	OTTHUMG00000133013	ENST00000341552.5:c.187C>T	2.37:g.219903267G>A	ENSP00000340776:p.Pro63Ser	Somatic	0	33	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	34	10.53	A2BDD8|E9PCR1|E9PG25|E9PG72|Q6ZSR8|Q8N0T4|Q8NDJ3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_PapD-like,pfscan_MSP_dom	p.P63S	ENST00000341552.5	37	c.187	CCDS2430.2	2	.	.	.	.	.	.	.	.	.	.	G	10.33	1.319819	0.23994	.	.	ENSG00000181378	ENST00000341552;ENST00000441968;ENST00000453220;ENST00000409865;ENST00000457968	T;T;T;T;T	0.29917	1.55;1.55;1.55;1.55;1.55	3.74	1.33	0.21861	.	.	.	.	.	T	0.12518	0.0304	N	0.08118	0	0.09310	N	0.999998	B;B	0.06786	0.001;0.0	B;B	0.01281	0.0;0.0	T	0.26292	-1.0107	9	0.27785	T	0.31	0.206	2.1592	0.03820	0.5935:0.0:0.1588:0.2477	.	52;63	E9PG25;Q6ZU64	.;CC108_HUMAN	S	63;63;63;52;52	ENSP00000340776:P63S;ENSP00000413377:P63S;ENSP00000409117:P63S;ENSP00000386945:P52S;ENSP00000393483:P52S	ENSP00000340776:P63S	P	-	1	0	CCDC108	219611511	0.000000	0.05858	0.005000	0.12908	0.001000	0.01503	0.332000	0.19751	0.271000	0.22005	-0.169000	0.13324	CCC	-	NULL		0.577	CCDC108-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCDC108	protein_coding	OTTHUMT00000256598.4	G	NM_194302	-		219903267	-1	no_errors	ENST00000341552	ensembl	human	known	74_37	missense	SNP	0.007	A
ZNF518A	9849	genome.wustl.edu	37	10	97922324	97922324	+	RNA	DEL	T	T	-			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr10:97922324delT	ENST00000534948.1	+	0	7100							Q6AHZ1	Z518A_HUMAN	zinc finger protein 518A						transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(2)|urinary_tract(2)	24		Colorectal(252;0.0815)		Epithelial(162;4.23e-08)|all cancers(201;1.85e-06)		TAGTGAAGTATTTTTTGTATA	0.274																																																	0								ENSG00000177853																																			ZNF518A			0				HGNC	AB002333	CCDS73170.1	10q23.33	2012-08-08	2007-12-07	2007-12-07	ENSG00000177853	ENSG00000177853		"""Zinc fingers, C2H2-type"""	29009	protein-coding gene	gene with protein product			"""zinc finger protein 518"""	ZNF518		9205841	Standard	NM_014803		Approved	KIAA0335	uc001klp.3	Q6AHZ1	OTTHUMG00000018828		10.37:g.97922324delT		Somatic	0	21	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	23	8.00	A0PJI5|O15044|Q32MP4	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000534948.1	37	NULL		10																																																																																			-	-		0.274	ZNF518A-202	KNOWN	basic	processed_transcript	ZNF518A	processed_transcript		T	NM_014803			97922324	+1	no_errors	ENST00000534948	ensembl	human	known	74_37	rna	DEL	1.000	-
CDH16	1014	genome.wustl.edu	37	16	66949219	66949219	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr16:66949219G>A	ENST00000299752.4	-	6	680	c.487C>T	c.(487-489)Ctt>Ttt	p.L163F	CDH16_ENST00000570262.1_Missense_Mutation_p.L83F|CDH16_ENST00000394055.3_Missense_Mutation_p.L163F|CDH16_ENST00000565796.1_Missense_Mutation_p.L163F|CDH16_ENST00000568632.1_Intron	NM_001204744.1|NM_001204745.1|NM_004062.3	NP_001191673.1|NP_001191674.1|NP_004053.1	O75309	CAD16_HUMAN	cadherin 16, KSP-cadherin	163	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(3)|large_intestine(10)|lung(15)|ovary(2)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	41		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0877)|Epithelial(162;0.203)		TGGAATCGAAGATCCGAGTTG	0.612																																																	0								ENSG00000166589						64.0	64.0	64.0					16																	66949219		2200	4300	6500	CDH16	SO:0001583	missense	0			-	HGNC	AF016272	CCDS10823.1, CCDS56002.1, CCDS58471.1, CCDS58472.1	16q22.1	2010-01-26			ENSG00000166589	ENSG00000166589		"""Cadherins / Major cadherins"""	1755	protein-coding gene	gene with protein product		603118				9721215, 7615566	Standard	NM_004062		Approved		uc002eql.3	O75309	OTTHUMG00000137518	ENST00000299752.4:c.487C>T	16.37:g.66949219G>A	ENSP00000299752:p.Leu163Phe	Somatic	0	40	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	45	27.42	B4DPA8|H3BPD3|Q6UW93	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.L163F	ENST00000299752.4	37	c.487	CCDS10823.1	16	.	.	.	.	.	.	.	.	.	.	G	14.68	2.608270	0.46527	.	.	ENSG00000166589	ENST00000394055;ENST00000299752;ENST00000544875	T;T	0.53640	0.61;0.61	5.12	5.12	0.69794	Cadherin (4);Cadherin-like (1);	0.000000	0.64402	D	0.000013	T	0.70386	0.3218	M	0.82716	2.605	0.58432	D	0.999999	D;D	0.89917	0.999;1.0	D;D	0.97110	0.986;1.0	T	0.75127	-0.3427	10	0.72032	D	0.01	-12.4344	14.0719	0.64865	0.0:0.0:1.0:0.0	.	163;163	O75309-2;O75309	.;CAD16_HUMAN	F	163;163;127	ENSP00000377619:L163F;ENSP00000299752:L163F	ENSP00000299752:L163F	L	-	1	0	CDH16	65506720	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	4.696000	0.61774	2.382000	0.81193	0.563000	0.77884	CTT	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.612	CDH16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH16	protein_coding	OTTHUMT00000268839.2	G	NM_004062	-		66949219	-1	no_errors	ENST00000299752	ensembl	human	known	74_37	missense	SNP	1.000	A
CYP1A2	1544	genome.wustl.edu	37	15	75042719	75042719	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr15:75042719G>A	ENST00000343932.4	+	2	703	c.640G>A	c.(640-642)Gat>Aat	p.D214N		NM_000761.3	NP_000752.2	P05177	CP1A2_HUMAN	cytochrome P450, family 1, subfamily A, polypeptide 2	214					alkaloid metabolic process (GO:0009820)|arachidonic acid metabolic process (GO:0019369)|cellular respiration (GO:0045333)|cellular response to cadmium ion (GO:0071276)|dibenzo-p-dioxin metabolic process (GO:0018894)|drug catabolic process (GO:0042737)|drug metabolic process (GO:0017144)|epoxygenase P450 pathway (GO:0019373)|exogenous drug catabolic process (GO:0042738)|heterocycle metabolic process (GO:0046483)|hydrogen peroxide biosynthetic process (GO:0050665)|lung development (GO:0030324)|methylation (GO:0032259)|monocarboxylic acid metabolic process (GO:0032787)|monoterpenoid metabolic process (GO:0016098)|omega-hydroxylase P450 pathway (GO:0097267)|oxidation-reduction process (GO:0055114)|oxidative deethylation (GO:0071615)|oxidative demethylation (GO:0070989)|porphyrin-containing compound metabolic process (GO:0006778)|post-embryonic development (GO:0009791)|regulation of gene expression (GO:0010468)|response to estradiol (GO:0032355)|response to lipopolysaccharide (GO:0032496)|small molecule metabolic process (GO:0044281)|steroid catabolic process (GO:0006706)|toxin biosynthetic process (GO:0009403)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)	aromatase activity (GO:0070330)|caffeine oxidase activity (GO:0034875)|demethylase activity (GO:0032451)|electron carrier activity (GO:0009055)|enzyme binding (GO:0019899)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity (GO:0016491)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen (GO:0016712)			breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(7)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	33					"""""""Insulin(DB00071)|Acenocoumarol(DB01418)|Acetaminophen(DB00316)|Agomelatine(DB06594)|Albendazole(DB00518)|Alitretinoin(DB00523)|Almotriptan(DB00918)|Alosetron(DB00969)|Aminoglutethimide(DB00357)|Aminophenazone(DB01424)|Aminophylline(DB01223)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amlodipine(DB00381)|Anagrelide(DB00261)|Anastrozole(DB01217)|Antipyrine(DB01435)|Apixaban(DB06605)|Aprepitant(DB00673)|Asenapine(DB06216)|Atropine(DB00572)|Axitinib(DB06626)|Azelastine(DB00972)|Azithromycin(DB00207)|Benzyl alcohol(DB06770)|Betaxolol(DB00195)|Bortezomib(DB00188)|Bromazepam(DB01558)|Bromocriptine(DB01200)|Bupivacaine(DB00297)|Buprenorphine(DB00921)|Bupropion(DB01156)|Caffeine(DB00201)|Carbamazepine(DB00564)|Carmustine(DB00262)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Chlorzoxazone(DB00356)|Cilostazol(DB01166)|Cimetidine(DB00501)|Cinacalcet(DB01012)|Cinnarizine(DB00568)|Ciprofloxacin(DB00537)|Cisapride(DB00604)|Citalopram(DB00215)|Clarithromycin(DB01211)|Clenbuterol(DB01407)|Clevidipine(DB04920)|Clobetasol propionate(DB01013)|Clomifene(DB00882)|Clomipramine(DB01242)|Clonidine(DB00575)|Clopidogrel(DB00758)|Clotrimazole(DB00257)|Clozapine(DB00363)|Conjugated Estrogens(DB00286)|Cyclobenzaprine(DB00924)|Dacarbazine(DB00851)|Dapagliflozin(DB06292)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Delavirdine(DB00705)|Desipramine(DB01151)|Desloratadine(DB00967)|Dexfenfluramine(DB01191)|Dexmedetomidine(DB00633)|Diazepam(DB00829)|Diclofenac(DB00586)|Dinoprostone(DB00917)|Diphenhydramine(DB01075)|Domperidone(DB01184)|Dopamine(DB00988)|Doxepin(DB01142)|Duloxetine(DB00476)|Edetic Acid(DB00974)|Efavirenz(DB00625)|Eltrombopag(DB06210)|Enoxacin(DB00467)|Epinephrine(DB00668)|Ergotamine(DB00696)|Erlotinib(DB00530)|Erythromycin(DB00199)|Estradiol(DB00783)|Estrone(DB00655)|Estropipate(DB04574)|Ethanol(DB00898)|Etoposide(DB00773)|Etoricoxib(DB01628)|Flunarizine(DB04841)|Flunitrazepam(DB01544)|Fluorouracil(DB00544)|Fluoxetine(DB00472)|Fluphenazine(DB00623)|Flutamide(DB00499)|Fluvastatin(DB01095)|Fluvoxamine(DB00176)|Frovatriptan(DB00998)|Gemfibrozil(DB01241)|Griseofulvin(DB00400)|Guanabenz(DB00629)|Haloperidol(DB00502)|Hesperetin(DB01094)|Hexobarbital(DB01355)|Iloperidone(DB04946)|Imatinib(DB00619)|Imipramine(DB00458)|Imiquimod(DB00724)|inhaled insulin(DB05278)|Insulin Aspart(DB01306)|Insulin Detemir(DB01307)|Insulin Glargine(DB00047)|Insulin Glulisine(DB01309)|Insulin Lispro(DB00046)|Insulin Regular(DB00030)|Irbesartan(DB01029)|Isoniazid(DB00951)|Ketoconazole(DB01026)|Lansoprazole(DB00448)|Leflunomide(DB01097)|Levobupivacaine(DB01002)|Levofloxacin(DB01137)|Lidocaine(DB00281)|Lomefloxacin(DB00978)|Lopinavir(DB01601)|Lorcaserin(DB04871)|Losartan(DB00678)|Lumiracoxib(DB01283)|Malathion(DB00772)|Maprotiline(DB00934)|Meclizine(DB00737)|Melatonin(DB01065)|Menadione(DB00170)|Methadone(DB00333)|Methimazole(DB00763)|Methotrimeprazine(DB01403)|Methoxsalen(DB00553)|Methoxyflurane(DB01028)|Mexiletine(DB00379)|Mianserin(DB06148)|Miconazole(DB01110)|Mirtazapine(DB00370)|Moclobemide(DB01171)|Modafinil(DB00745)|Nabumetone(DB00461)|Nafcillin(DB00607)|Naproxen(DB00788)|Nelfinavir(DB00220)|Nevirapine(DB00238)|Niclosamide(DB06803)|Nicotine(DB00184)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nisoldipine(DB00401)|Nitric Oxide(DB00435)|Nitroprusside(DB00325)|Norepinephrine(DB00368)|Norfloxacin(DB01059)|Nortriptyline(DB00540)|Ofloxacin(DB01165)|Olanzapine(DB00334)|Omeprazole(DB00338)|Ondansetron(DB00904)|Oxaliplatin(DB00526)|Oxtriphylline(DB01303)|Palonosetron(DB00377)|Pantoprazole(DB00213)|Pazopanib(DB06589)|Pefloxacin(DB00487)|Pentamidine(DB00738)|Pentoxifylline(DB00806)|Perphenazine(DB00850)|Phenobarbital(DB01174)|Phentermine(DB00191)|Phenylephrine(DB00388)|Phenylpropanolamine(DB00397)|Pimozide(DB01100)|Pipotiazine(DB01621)|Pomalidomide(DB08910)|Praziquantel(DB01058)|Primaquine(DB01087)|Primidone(DB00794)|Progesterone(DB00396)|Proguanil(DB01131)|Promazine(DB00420)|Propafenone(DB01182)|Propofol(DB00818)|Propranolol(DB00571)|Pyrazinamide(DB00339)|Quinidine(DB00908)|Quinine(DB00468)|Rabeprazole(DB01129)|Ramelteon(DB00980)|Ranitidine(DB00863)|Rasagiline(DB01367)|Rifabutin(DB00615)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Riluzole(DB00740)|Ritonavir(DB00503)|Rizatriptan(DB00953)|Ropinirole(DB00268)|Ropivacaine(DB00296)|Rosiglitazone(DB00412)|Rotigotine(DB05271)|Roxithromycin(DB00778)|Secobarbital(DB00418)|Selegiline(DB01037)|Sertraline(DB01104)|SIMEPREVIR(DB06290)|Sorafenib(DB00398)|Streptozocin(DB00428)|Sulindac(DB00605)|Tamoxifen(DB00675)|Telithromycin(DB00976)|Tenofovir(DB00300)|Terbinafine(DB00857)|Thalidomide(DB01041)|Theobromine(DB01412)|Theophylline(DB00277)|Thiabendazole(DB00730)|Thioridazine(DB00679)|Thiothixene(DB01623)|Ticlopidine(DB00208)|Tioconazole(DB01007)|Tizanidine(DB00697)|Tocainide(DB01056)|Toremifene(DB00539)|Tranylcypromine(DB00752)|Triamterene(DB00384)|Trifluoperazine(DB00831)|Valproic Acid(DB00313)|Vemurafenib(DB08881)|Verapamil(DB00661)|Warfarin(DB00682)|Zafirlukast(DB00549)|Zileuton(DB00744)|Ziprasidone(DB00246)|Zolmitriptan(DB00315)|Zolpidem(DB00425)"""	TGAGAGTAGCGATGAGATGCT	0.577																																																	0								ENSG00000140505						283.0	234.0	251.0					15																	75042719		2197	4296	6493	CYP1A2	SO:0001583	missense	0			-	HGNC	AF182274	CCDS32293.1	15q24.1	2013-11-11	2003-01-14		ENSG00000140505	ENSG00000140505	1.14.14.1	"""Cytochrome P450s"""	2596	protein-coding gene	gene with protein product		124060	"""cytochrome P450, subfamily I (aromatic compound-inducible), polypeptide 2"""			15128046	Standard	NM_000761		Approved	P3-450, CP12	uc002ayr.1	P05177	OTTHUMG00000172901	ENST00000343932.4:c.640G>A	15.37:g.75042719G>A	ENSP00000342007:p.Asp214Asn	Somatic	0	46	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	67	16.25	Q16754|Q6NWU5|Q9BXX7|Q9UK49	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-I_CYP1,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450	p.D214N	ENST00000343932.4	37	c.640	CCDS32293.1	15	.	.	.	.	.	.	.	.	.	.	G	9.180	1.023373	0.19433	.	.	ENSG00000140505	ENST00000343932	T	0.79554	-1.28	4.98	0.641	0.17759	.	0.384909	0.32301	N	0.006289	T	0.63153	0.2487	N	0.16266	0.395	0.25696	N	0.985636	B	0.23185	0.081	B	0.22601	0.04	T	0.56147	-0.8027	10	0.56958	D	0.05	.	8.0346	0.30484	0.1694:0.3419:0.4887:0.0	.	214	P05177-2	.	N	214	ENSP00000342007:D214N	ENSP00000342007:D214N	D	+	1	0	CYP1A2	72829772	0.013000	0.17824	0.071000	0.20095	0.009000	0.06853	0.042000	0.13949	0.268000	0.21939	0.561000	0.74099	GAT	-	pfam_Cyt_P450,superfamily_Cyt_P450		0.577	CYP1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP1A2	protein_coding	OTTHUMT00000421263.2	G	NM_000761	-		75042719	+1	no_errors	ENST00000343932	ensembl	human	known	74_37	missense	SNP	0.621	A
ASTL	431705	genome.wustl.edu	37	2	96799753	96799753	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr2:96799753C>T	ENST00000342380.2	-	4	287	c.288G>A	c.(286-288)atG>atA	p.M96I		NM_001002036.3	NP_001002036.3			astacin-like metallo-endopeptidase (M12 family)											endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(13)|ovary(1)|prostate(1)|skin(2)	30						CACTACCACCCATGGGCCATT	0.602																																																	0								ENSG00000188886						140.0	93.0	109.0					2																	96799753		2203	4300	6503	ASTL	SO:0001583	missense	0			-	HGNC	AJ537600	CCDS33249.1	2q11.1	2014-07-23	2006-10-10		ENSG00000188886	ENSG00000188886	3.4.24.21		31704	protein-coding gene	gene with protein product	"""sperm acrosomal SLLP1 binding"""	608860	"""astacin-like metalloendopeptidase (M12 family)"""			15087446	Standard	NM_001002036		Approved	ovastacin, SAS1B	uc010yui.2	Q6HA08	OTTHUMG00000155212	ENST00000342380.2:c.288G>A	2.37:g.96799753C>T	ENSP00000343674:p.Met96Ile	Somatic	0	32	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	36	36.84		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_M12A,smart_Peptidase_Metallo,prints_Peptidase_M12A	p.M96I	ENST00000342380.2	37	c.288	CCDS33249.1	2	.	.	.	.	.	.	.	.	.	.	C	5.492	0.275777	0.10403	.	.	ENSG00000188886	ENST00000342380	T	0.62788	0.0	2.62	1.73	0.24493	Peptidase, metallopeptidase (1);Metallopeptidase, catalytic domain (1);	0.591385	0.14014	N	0.347247	T	0.30230	0.0758	N	0.01493	-0.835	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.23297	-1.0192	10	0.72032	D	0.01	-9.2287	5.2841	0.15692	0.0:0.8372:0.0:0.1628	.	96	Q6HA08	ASTL_HUMAN	I	96	ENSP00000343674:M96I	ENSP00000343674:M96I	M	-	3	0	ASTL	96163480	0.912000	0.30974	0.249000	0.24280	0.049000	0.14656	2.011000	0.40922	0.660000	0.30964	0.644000	0.83932	ATG	-	smart_Peptidase_Metallo		0.602	ASTL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASTL	protein_coding	OTTHUMT00000338801.1	C		-		96799753	-1	no_errors	ENST00000342380	ensembl	human	known	74_37	missense	SNP	0.341	T
FAM25C	644054	genome.wustl.edu	37	10	49199679	49199679	+	5'UTR	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr10:49199679C>T	ENST00000479781.1	-	0	211							B3EWG5	FM25C_HUMAN	family with sequence similarity 25, member C																		CACCCAACACCATGCAGGAAC	0.567																																																	0								ENSG00000188279																																			FAM25C	SO:0001623	5_prime_UTR_variant	0			-	HGNC			10q11.22	2008-08-13			ENSG00000188279				23586	protein-coding gene	gene with protein product							Standard	NM_001137548		Approved	bA164N7.4	uc010qfw.2	B3EWG5	OTTHUMG00000018165	ENST00000479781.1:c.-31G>A	10.37:g.49199679C>T		Somatic	0	109	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	139	12.58	B2RV02|Q5VTM1	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000479781.1	37	NULL		10																																																																																			-	-		0.567	FAM25C-002	KNOWN	basic	processed_transcript	FAM25C	protein_coding	OTTHUMT00000047914.1	C		-		49199679	-1	no_errors	ENST00000479781	ensembl	human	known	74_37	rna	SNP	0.017	T
ADAM28	10863	genome.wustl.edu	37	8	24193162	24193162	+	Intron	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr8:24193162G>A	ENST00000265769.4	+	14	1677				RP11-624C23.1_ENST00000519689.1_RNA|ADAM28_ENST00000540823.1_Silent_p.R292R|RP11-624C23.1_ENST00000523578.1_RNA|RP11-624C23.1_ENST00000518988.1_RNA|ADAM28_ENST00000397649.3_Intron|RP11-624C23.1_ENST00000523700.1_RNA|ADAM28_ENST00000437154.2_Silent_p.R525R	NM_014265.4	NP_055080.2	Q9UKQ2	ADA28_HUMAN	ADAM metallopeptidase domain 28						spermatogenesis (GO:0007283)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|lung(7)|prostate(1)|skin(12)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	42		Prostate(55;0.0959)		Colorectal(74;0.0129)|COAD - Colon adenocarcinoma(73;0.0434)|BRCA - Breast invasive adenocarcinoma(99;0.175)		CAGGTAGGAGGACAAATCCTT	0.517																																					NSCLC(193;488 2149 22258 34798 40734)												0								ENSG00000042980						76.0	70.0	72.0					8																	24193162		2203	4300	6503	ADAM28	SO:0001627	intron_variant	0			-	HGNC	AJ242015	CCDS34865.1, CCDS47830.1	8p21.2	2005-11-29	2005-08-18		ENSG00000042980	ENSG00000042980		"""ADAM metallopeptidase domain containing"""	206	protein-coding gene	gene with protein product		606188	"""a disintegrin and metalloproteinase domain 28"""				Standard	XM_005273378		Approved	eMDCII, MDC-Lm, MDC-Ls, ADAM23	uc003xdy.3	Q9UKQ2	OTTHUMG00000163780	ENST00000265769.4:c.1567+8G>A	8.37:g.24193162G>A		Somatic	0	51	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	56	13.85	B2RMV5|Q9Y339|Q9Y3S0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_Blood-coag_inhib_Disintegrin,pfam_ADAM_Cys-rich,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_Peptidase_M12B,prints_Blood-coag_inhib_Disintegrin	p.R525	ENST00000265769.4	37	c.1575	CCDS34865.1	8																																																																																			-	pfam_ADAM_Cys-rich,smart_ADAM_Cys-rich		0.517	ADAM28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM28	protein_coding	OTTHUMT00000375441.2	G	NM_021778	-		24193162	+1	no_errors	ENST00000437154	ensembl	human	known	74_37	silent	SNP	0.000	A
OR51A2	401667	genome.wustl.edu	37	11	4976386	4976386	+	Silent	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr11:4976386G>A	ENST00000380371.1	-	1	557	c.558C>T	c.(556-558)gtC>gtT	p.V186V	MMP26_ENST00000380390.1_Intron|MMP26_ENST00000477339.1_Intron	NM_001004748.1	NP_001004748.1	Q8NGJ7	O51A2_HUMAN	olfactory receptor, family 51, subfamily A, member 2	186						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(4)|kidney(1)|large_intestine(3)|lung(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;3.22e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)		CCAACTTCATGACATCCTGGT	0.413																																																	0								ENSG00000205496						57.0	49.0	52.0					11																	4976386		2126	4006	6132	OR51A2	SO:0001819	synonymous_variant	0			-	HGNC	AB065797	CCDS31368.1	11p15.4	2012-08-09			ENSG00000205496	ENSG00000205496		"""GPCR / Class A : Olfactory receptors"""	14764	protein-coding gene	gene with protein product							Standard	NM_001004748		Approved		uc010qyt.2	Q8NGJ7	OTTHUMG00000066602	ENST00000380371.1:c.558C>T	11.37:g.4976386G>A		Somatic	0	57	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	60	20.00		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.V186	ENST00000380371.1	37	c.558	CCDS31368.1	11																																																																																			-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt		0.413	OR51A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR51A2	protein_coding	OTTHUMT00000142809.1	G	NM_001004748	-		4976386	-1	no_errors	ENST00000380371	ensembl	human	known	74_37	silent	SNP	0.750	A
ZNF729	100287226	genome.wustl.edu	37	19	22497754	22497754	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr19:22497754G>A	ENST00000601693.1	+	4	1653	c.1535G>A	c.(1534-1536)gGa>gAa	p.G512E	ZNF729_ENST00000357491.6_Missense_Mutation_p.G512E			A6NN14	ZN729_HUMAN	zinc finger protein 729	512					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(1)|lung(32)|ovary(3)	41						ATTCATACTGGAAAGAAACCC	0.373																																																	0								ENSG00000196350																																			ZNF729	SO:0001583	missense	0			-	HGNC		CCDS59368.1	19p12	2014-02-14			ENSG00000196350	ENSG00000196350		"""Zinc fingers, C2H2-type"", ""-"""	32464	protein-coding gene	gene with protein product							Standard	NM_001242680		Approved		uc021urs.1	A6NN14	OTTHUMG00000182938	ENST00000601693.1:c.1535G>A	19.37:g.22497754G>A	ENSP00000469582:p.Gly512Glu	Somatic	0	38	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	54	15.62	M0QY45	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G512E	ENST00000601693.1	37	c.1535	CCDS59368.1	19	.	.	.	.	.	.	.	.	.	.	.	11.88	1.770983	0.31320	.	.	ENSG00000196350	ENST00000357491	T	0.25749	1.78	1.28	1.28	0.21552	.	.	.	.	.	T	0.16471	0.0396	N	0.12422	0.21	.	.	.	.	.	.	.	.	.	T	0.25012	-1.0144	6	0.66056	D	0.02	.	7.5075	0.27553	0.0:0.0:1.0:0.0	.	.	.	.	E	512	ENSP00000350085:G512E	ENSP00000350085:G512E	G	+	2	0	ZNF729	22289594	0.973000	0.33851	0.005000	0.12908	0.013000	0.08279	1.966000	0.40481	0.653000	0.30826	0.491000	0.48974	GGA	-	pfscan_Znf_C2H2		0.373	ZNF729-001	NOVEL	basic|appris_principal|CCDS	protein_coding	ZNF729	protein_coding	OTTHUMT00000464396.1	G	XM_496301	-		22497754	+1	no_errors	ENST00000601693	ensembl	human	novel	74_37	missense	SNP	0.999	A
ADGB	79747	genome.wustl.edu	37	6	147047248	147047248	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr6:147047248C>T	ENST00000397944.3	+	19	2343	c.2267C>T	c.(2266-2268)tCc>tTc	p.S756F	ADGB_ENST00000367493.3_Missense_Mutation_p.S175F	NM_024694.3	NP_078970.3	Q8N7X0	ADGB_HUMAN	androglobin	756					oxygen transport (GO:0015671)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)			breast(1)|endometrium(2)|kidney(2)	5						AACGCATACTCCCCAGTAGGA	0.473																																																	0								ENSG00000118492						168.0	135.0	145.0					6																	147047248		692	1591	2283	ADGB	SO:0001583	missense	0			-	HGNC	AK026774		6q24.2	2012-02-03	2012-02-03	2012-02-03	ENSG00000118492	ENSG00000118492			21212	protein-coding gene	gene with protein product		614630	"""chromosome 6 open reading frame 103"""	C6orf103		22115833	Standard	NM_024694		Approved	FLJ23121, dJ408K24.1	uc010khx.3	Q8N7X0	OTTHUMG00000015758	ENST00000397944.3:c.2267C>T	6.37:g.147047248C>T	ENSP00000381036:p.Ser756Phe	Somatic	0	63	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	74	19.57	Q5T402|Q5T904|Q5T905	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_C2_calpain_cat,superfamily_Globin-like,smart_Peptidase_C2_calpain_cat,pfscan_IQ_motif_EF-hand-BS,pfscan_Peptidase_C2_calpain_cat	p.S756F	ENST00000397944.3	37	c.2267		6	.	.	.	.	.	.	.	.	.	.	C	15.34	2.804222	0.50315	.	.	ENSG00000118492	ENST00000397944;ENST00000367493	T	0.38560	1.13	5.65	5.65	0.86999	.	.	.	.	.	T	0.48021	0.1477	L	0.53249	1.67	0.19775	N	0.99996	D	0.69078	0.997	P	0.61533	0.89	T	0.44574	-0.9319	9	0.72032	D	0.01	.	16.6251	0.84968	0.0:1.0:0.0:0.0	.	756	Q8N7X0	CAN7L_HUMAN	F	756;175	ENSP00000381036:S756F	ENSP00000356463:S175F	S	+	2	0	C6orf103	147088941	0.186000	0.23225	0.148000	0.22405	0.015000	0.08874	3.114000	0.50383	2.651000	0.90000	0.585000	0.79938	TCC	-	NULL		0.473	ADGB-009	KNOWN	basic|appris_principal	protein_coding	ADGB	protein_coding	OTTHUMT00000376350.2	C	NM_024694	-		147047248	+1	no_errors	ENST00000397944	ensembl	human	known	74_37	missense	SNP	0.283	T
VWA3A	146177	genome.wustl.edu	37	16	22157664	22157664	+	Splice_Site	SNP	C	C	T	rs377486149	byFrequency	TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr16:22157664C>T	ENST00000389398.5	+	27	2934	c.2838C>T	c.(2836-2838)tcC>tcT	p.S946S	VWA3A_ENST00000563755.1_Splice_Site_p.S24S|VWA3A_ENST00000389397.4_Splice_Site_p.S24S	NM_173615.3	NP_775886.3	A6NCI4	VWA3A_HUMAN	von Willebrand factor A domain containing 3A	946						extracellular region (GO:0005576)		p.S142S(1)|p.S24S(1)|p.S946S(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(1)|skin(1)	7				GBM - Glioblastoma multiforme(48;0.0439)		GGCTGCTGTCCGGTGAGCCTG	0.602													C|||	2	0.000399361	0.0008	0.0	5008	,	,		15252	0.0		0.0	False		,,,				2504	0.001																3	Substitution - coding silent(3)	large_intestine(3)						ENSG00000175267	C		1,4223		0,1,2111	61.0	64.0	63.0		2838	-4.1	1.0	16		63	0,8460		0,0,4230	no	coding-synonymous-near-splice	VWA3A	NM_173615.3		0,1,6341	TT,TC,CC		0.0,0.0237,0.0079		946/1185	22157664	1,12683	2112	4230	6342	VWA3A	SO:0001630	splice_region_variant	0			-	HGNC	AK128606, AK098260	CCDS45441.1	16p12.1	2008-02-05				ENSG00000175267			27088	protein-coding gene	gene with protein product						12477932	Standard	XM_006721021		Approved	FLJ46765, FLJ40941	uc010vbq.2	A6NCI4		ENST00000389398.5:c.2839+1C>T	16.37:g.22157664C>T		Somatic	0	41	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	40	18.37	A4QMU8|A6NNC0|Q6UTX4|Q6ZQZ9|Q8IUY6|Q8N9W1	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	p.S946	ENST00000389398.5	37	c.2838	CCDS45441.1	16																																																																																			-	NULL		0.602	VWA3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VWA3A	protein_coding	OTTHUMT00000430052.1	C		-	Silent	22157664	+1	no_errors	ENST00000389398	ensembl	human	known	74_37	silent	SNP	0.976	T
PHLDB2	90102	genome.wustl.edu	37	3	111632168	111632168	+	Silent	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr3:111632168G>A	ENST00000431670.2	+	3	1749	c.1338G>A	c.(1336-1338)gaG>gaA	p.E446E	PHLDB2_ENST00000495180.1_Silent_p.E32E|PHLDB2_ENST00000412622.1_Silent_p.E446E|PHLDB2_ENST00000481953.1_Silent_p.E446E|PHLDB2_ENST00000477695.1_Silent_p.E446E|PHLDB2_ENST00000393925.3_Silent_p.E446E|PHLDB2_ENST00000393923.3_Silent_p.E473E	NM_001134438.1	NP_001127910.1	Q86SQ0	PHLB2_HUMAN	pleckstrin homology-like domain, family B, member 2	446						cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)		p.E446D(2)|p.E473D(1)		breast(2)|central_nervous_system(1)|endometrium(7)|large_intestine(8)|lung(23)|ovary(6)|skin(7)|stomach(1)	55						TGTTCCAGGAGAGACAGCGTC	0.498																																																	3	Substitution - Missense(3)	endometrium(3)						ENSG00000144824						118.0	118.0	118.0					3																	111632168		2203	4300	6503	PHLDB2	SO:0001819	synonymous_variant	0			-	HGNC		CCDS2962.1, CCDS46885.1, CCDS46886.1	3q13.13	2013-01-10			ENSG00000144824	ENSG00000144824		"""Pleckstrin homology (PH) domain containing"""	29573	protein-coding gene	gene with protein product		610298				12376540	Standard	NM_145753		Approved	LL5beta, FLJ21791, LL5b	uc003dyg.3	Q86SQ0	OTTHUMG00000159282	ENST00000431670.2:c.1338G>A	3.37:g.111632168G>A		Somatic	0	37	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	31	11.43	A5PKZ3|Q59EA8|Q68CY3|Q6NT98|Q8N8U8|Q8NAB1|Q8NCU5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.E446	ENST00000431670.2	37	c.1338	CCDS46886.1	3																																																																																			-	NULL		0.498	PHLDB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHLDB2	protein_coding	OTTHUMT00000354337.1	G	NM_145753	-		111632168	+1	no_errors	ENST00000393925	ensembl	human	known	74_37	silent	SNP	1.000	A
WDR49	151790	genome.wustl.edu	37	3	167344937	167344937	+	Intron	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr3:167344937C>T	ENST00000308378.3	-	2	241				WDR49_ENST00000479765.1_Nonsense_Mutation_p.W103*	NM_178824.3	NP_849146.1	Q8IV35	WDR49_HUMAN	WD repeat domain 49											breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(28)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	50						TCAGCTTGTCCCAATTAATGA	0.478																																																	0								ENSG00000174776																																			WDR49	SO:0001627	intron_variant	0			-	HGNC	AK097556	CCDS3201.1	3q26.1	2013-01-11			ENSG00000174776	ENSG00000174776		"""WD repeat domain containing"""	26587	protein-coding gene	gene with protein product						12477932	Standard	NM_178824		Approved	FLJ33620	uc003fev.1	Q8IV35	OTTHUMG00000158290	ENST00000308378.3:c.65-22681G>A	3.37:g.167344937C>T		Somatic	0	50	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	44	20.00	Q8N297	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_EF_hand_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.W103*	ENST00000308378.3	37	c.309	CCDS3201.1	3	.	.	.	.	.	.	.	.	.	.	C	13.72	2.321478	0.41096	.	.	ENSG00000174776	ENST00000479765	.	.	.	5.21	4.33	0.51752	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.037	0.71754	0.0:0.8566:0.1434:0.0	.	.	.	.	X	103	.	ENSP00000419749:W103X	W	-	3	0	WDR49	168827631	1.000000	0.71417	1.000000	0.80357	0.072000	0.16883	4.938000	0.63519	1.319000	0.45190	0.655000	0.94253	TGG	-	pfscan_EF_hand_dom		0.478	WDR49-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WDR49	protein_coding	OTTHUMT00000350592.3	C	NM_178824	-		167344937	-1	no_errors	ENST00000479765	ensembl	human	putative	74_37	nonsense	SNP	1.000	T
PENK	5179	genome.wustl.edu	37	8	57353921	57353921	+	Silent	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr8:57353921G>A	ENST00000314922.3	-	2	790	c.714C>T	c.(712-714)gcC>gcT	p.A238A	PENK_ENST00000451791.2_Silent_p.A238A|PENK_ENST00000523274.1_5'Flank	NM_006211.3	NP_006202.1	P01210	PENK_HUMAN	proenkephalin	238					aggressive behavior (GO:0002118)|behavioral fear response (GO:0001662)|locomotory behavior (GO:0007626)|neuropeptide signaling pathway (GO:0007218)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)|startle response (GO:0001964)	extracellular region (GO:0005576)	neuropeptide hormone activity (GO:0005184)			central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|liver(1)|lung(5)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	21		all_lung(136;0.229)	Epithelial(17;0.000873)|all cancers(17;0.0069)			GCAGAGCCTCGGCAAAGCGCT	0.478																																																	0								ENSG00000181195						81.0	87.0	85.0					8																	57353921		2203	4300	6503	PENK	SO:0001819	synonymous_variant	0			-	HGNC		CCDS6168.1	8q23-q24	2013-02-26				ENSG00000181195		"""Endogenous ligands"""	8831	protein-coding gene	gene with protein product	"""preproenkephalin"""	131330				6281660	Standard	NM_006211		Approved		uc003xsz.2	P01210		ENST00000314922.3:c.714C>T	8.37:g.57353921G>A		Somatic	0	63	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	57	13.64	B2RC23|Q6FHC6|Q6FHE6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Opioid_neupept,prints_Proenkphlin_A,prints_Opioid_neupept	p.A238	ENST00000314922.3	37	c.714	CCDS6168.1	8																																																																																			-	NULL		0.478	PENK-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PENK	protein_coding	OTTHUMT00000378645.1	G		-		57353921	-1	no_errors	ENST00000314922	ensembl	human	known	74_37	silent	SNP	0.003	A
PCDHB2	56133	genome.wustl.edu	37	5	140474915	140474915	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr5:140474915C>T	ENST00000194155.4	+	1	689	c.541C>T	c.(541-543)Cat>Tat	p.H181Y		NM_018936.2	NP_061759.1	Q9Y5E7	PCDB2_HUMAN	protocadherin beta 2	181	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(22)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TTTCCACTTTCATCTTAATTT	0.448																																																	0								ENSG00000112852						30.0	32.0	31.0					5																	140474915		2203	4300	6503	PCDHB2	SO:0001583	missense	0			-	HGNC	AF152495	CCDS4244.1	5q31	2010-01-26			ENSG00000112852	ENSG00000112852		"""Cadherins / Protocadherins : Clustered"""	8687	other	protocadherin		606328				10380929	Standard	NM_018936		Approved	PCDH-BETA2	uc003lil.3	Q9Y5E7	OTTHUMG00000129606	ENST00000194155.4:c.541C>T	5.37:g.140474915C>T	ENSP00000194155:p.His181Tyr	Somatic	0	39	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	53	11.67	Q4KMU1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.H181Y	ENST00000194155.4	37	c.541	CCDS4244.1	5	.	.	.	.	.	.	.	.	.	.	C	3.965	-0.009442	0.07727	.	.	ENSG00000112852	ENST00000194155	T	0.59224	0.28	5.32	5.32	0.75619	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.45875	0.1364	L	0.35487	1.065	0.09310	N	1	B	0.16396	0.017	B	0.23852	0.049	T	0.26155	-1.0111	9	0.45353	T	0.12	.	7.1005	0.25333	0.2901:0.6293:0.0:0.0806	.	181	Q9Y5E7	PCDB2_HUMAN	Y	181	ENSP00000194155:H181Y	ENSP00000194155:H181Y	H	+	1	0	PCDHB2	140455099	0.000000	0.05858	0.999000	0.59377	0.260000	0.26232	-1.368000	0.02580	2.648000	0.89879	0.655000	0.94253	CAT	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.448	PCDHB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB2	protein_coding	OTTHUMT00000251801.2	C	NM_018936	-		140474915	+1	no_errors	ENST00000194155	ensembl	human	known	74_37	missense	SNP	0.022	T
RIMS2	9699	genome.wustl.edu	37	8	105260948	105260948	+	Missense_Mutation	SNP	C	C	T	rs539179964		TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr8:105260948C>T	ENST00000436393.2	+	25	3791	c.3550C>T	c.(3550-3552)Cgc>Tgc	p.R1184C	RIMS2_ENST00000507740.1_Missense_Mutation_p.R980C|RIMS2_ENST00000262231.10_Missense_Mutation_p.R1005C|RIMS2_ENST00000339750.2_Missense_Mutation_p.R102C|RIMS2_ENST00000406091.3_Missense_Mutation_p.R1166C			Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	1228					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)	p.R980C(2)|p.R1166C(1)|p.R1184C(1)		NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			CCCTGGTGTTCGCTTGGCCTC	0.463										HNSCC(12;0.0054)																																							4	Substitution - Missense(4)	endometrium(4)						ENSG00000176406						113.0	110.0	111.0					8																	105260948		2106	4251	6357	RIMS2	SO:0001583	missense	0			-	HGNC	AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000436393.2:c.3550C>T	8.37:g.105260948C>T	ENSP00000390665:p.Arg1184Cys	Somatic	0	73	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	78	20.41	B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_C2_dom,pfam_PDZ,superfamily_C2_dom,superfamily_Znf_FYVE_PHD,superfamily_PDZ,smart_PDZ,smart_C2_dom,pfscan_C2_dom,pfscan_PDZ,pfscan_Znf_FYVE-typ,pfscan_Znf_FYVE-rel	p.R1166C	ENST00000436393.2	37	c.3496		8	.	.	.	.	.	.	.	.	.	.	C	18.03	3.531471	0.64972	.	.	ENSG00000176406	ENST00000329869;ENST00000406091;ENST00000402998;ENST00000262231;ENST00000507740;ENST00000408894;ENST00000436393;ENST00000523362;ENST00000339750	T;T;T;T;T;T;T	0.21361	2.53;2.24;2.24;2.01;2.44;2.05;2.03	5.34	4.41	0.53225	.	.	.	.	.	T	0.35998	0.0951	L	0.37697	1.125	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;0.995;1.0;1.0	D;D;D;P;P	0.76575	0.982;0.988;0.975;0.901;0.901	T	0.08371	-1.0725	9	0.87932	D	0	.	14.5838	0.68310	0.2185:0.7815:0.0:0.0	.	1228;1184;1005;980;1166	Q9UQ26;D6RA03;Q9UQ26-1;Q9UQ26-3;F8WD47	RIMS2_HUMAN;.;.;.;.	C	1203;1166;1228;1005;980;1173;1184;102;102	ENSP00000384892:R1166C;ENSP00000262231:R1005C;ENSP00000423559:R980C;ENSP00000386228:R1173C;ENSP00000390665:R1184C;ENSP00000428478:R102C;ENSP00000342051:R102C	ENSP00000262231:R1005C	R	+	1	0	RIMS2	105330124	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	2.562000	0.45914	2.664000	0.90586	0.650000	0.86243	CGC	-	NULL		0.463	RIMS2-007	NOVEL	basic|exp_conf	protein_coding	RIMS2	protein_coding	OTTHUMT00000367217.1	C	NM_001100117	-		105260948	+1	no_errors	ENST00000406091	ensembl	human	known	74_37	missense	SNP	1.000	T
FYCO1	79443	genome.wustl.edu	37	3	46014638	46014638	+	Nonsense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr3:46014638G>A	ENST00000296137.2	-	6	686	c.481C>T	c.(481-483)Cag>Tag	p.Q161*	FYCO1_ENST00000535325.1_Nonsense_Mutation_p.Q161*	NM_024513.3	NP_078789.2	Q9BQS8	FYCO1_HUMAN	FYVE and coiled-coil domain containing 1	161	RUN. {ECO:0000255|PROSITE- ProRule:PRU00178}.				plus-end-directed vesicle transport along microtubule (GO:0072383)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)	metal ion binding (GO:0046872)			NS(4)|breast(3)|central_nervous_system(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(17)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	54				BRCA - Breast invasive adenocarcinoma(193;0.00147)|KIRC - Kidney renal clear cell carcinoma(197;0.0272)|Kidney(197;0.0323)		AGGTCAAACTGAACCTCAGTC	0.493																																																	0								ENSG00000163820						108.0	102.0	104.0					3																	46014638		2203	4300	6503	FYCO1	SO:0001587	stop_gained	0			-	HGNC	AJ292348	CCDS2734.1	3p21.3	2008-02-05			ENSG00000163820	ENSG00000163820		"""Zinc fingers, FYVE domain containing"""	14673	protein-coding gene	gene with protein product		607182				11896456	Standard	NM_024513		Approved	FLJ13335, ZFYVE7	uc003cpb.5	Q9BQS8	OTTHUMG00000133447	ENST00000296137.2:c.481C>T	3.37:g.46014638G>A	ENSP00000296137:p.Gln161*	Somatic	0	40	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	47	14.29	B7ZKT7|Q3MJE6|Q86T41|Q86TB1|Q8TEF9|Q96IV5|Q9H8P9	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_FYVE,pfam_Run,superfamily_GOLD,superfamily_Znf_FYVE_PHD,superfamily_Prefoldin,superfamily_tRNA-bd_arm,smart_Znf_FYVE,pfscan_GOLD,pfscan_Run,pfscan_Znf_FYVE-rel	p.Q161*	ENST00000296137.2	37	c.481	CCDS2734.1	3	.	.	.	.	.	.	.	.	.	.	G	39	7.768480	0.98480	.	.	ENSG00000163820	ENST00000296137;ENST00000535325	.	.	.	6.08	6.08	0.98989	.	0.117022	0.64402	D	0.000013	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-20.5731	18.844	0.92196	0.0:0.0:1.0:0.0	.	.	.	.	X	161	.	ENSP00000296137:Q161X	Q	-	1	0	FYCO1	45989642	1.000000	0.71417	0.993000	0.49108	0.986000	0.74619	9.496000	0.97967	2.894000	0.99253	0.655000	0.94253	CAG	-	pfam_Run,pfscan_Run		0.493	FYCO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FYCO1	protein_coding	OTTHUMT00000257320.2	G	NM_024513	-		46014638	-1	no_errors	ENST00000535325	ensembl	human	known	74_37	nonsense	SNP	1.000	A
PCDHA8	56140	genome.wustl.edu	37	5	140221013	140221013	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr5:140221013C>T	ENST00000531613.1	+	1	107	c.107C>T	c.(106-108)cCc>cTc	p.P36L	PCDHA4_ENST00000530339.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA8_ENST00000378123.3_Missense_Mutation_p.P36L|PCDHA2_ENST00000526136.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA6_ENST00000529310.1_Intron	NM_018911.2	NP_061734.1	Q9Y5H6	PCDA8_HUMAN	protocadherin alpha 8	36	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(31)|ovary(2)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(6)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TACTCCGTCCCCGAGGAGGCC	0.667																																																	0								ENSG00000204962						51.0	56.0	54.0					5																	140221013		2203	4299	6502	PCDHA8	SO:0001583	missense	0			-	HGNC	AF152486	CCDS54919.1	5q31	2010-11-26				ENSG00000204962		"""Cadherins / Protocadherins : Clustered"""	8674	other	complex locus constituent	"""KIAA0345-like 6"""	606314				10380929	Standard	NM_018911		Approved			Q9Y5H6		ENST00000531613.1:c.107C>T	5.37:g.140221013C>T	ENSP00000434655:p.Pro36Leu	Somatic	0	93	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	102	18.40	B9EGT7|O75281	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.P36L	ENST00000531613.1	37	c.107	CCDS54919.1	5	.	.	.	.	.	.	.	.	.	.	C	8.029	0.761384	0.15914	.	.	ENSG00000204962	ENST00000531613;ENST00000378123	T;T	0.39229	1.09;1.09	3.95	0.945	0.19543	Cadherin, N-terminal (1);Cadherin (2);Cadherin-like (1);	0.221355	0.22360	U	0.061087	T	0.32852	0.0843	L	0.49778	1.585	0.09310	N	1	B;B	0.20261	0.003;0.043	B;B	0.21151	0.01;0.033	T	0.24083	-1.0170	10	0.46703	T	0.11	.	7.3397	0.26630	0.0:0.6919:0.14:0.1681	.	36;36	Q9Y5H6;Q9Y5H6-2	PCDA8_HUMAN;.	L	36	ENSP00000434655:P36L;ENSP00000367363:P36L	ENSP00000367363:P36L	P	+	2	0	PCDHA8	140201197	0.000000	0.05858	0.003000	0.11579	0.171000	0.22731	1.064000	0.30579	0.236000	0.21180	0.557000	0.71058	CCC	-	pfam_Cadherin_N,superfamily_Cadherin-like,pfscan_Cadherin		0.667	PCDHA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA8	protein_coding	OTTHUMT00000372830.2	C	NM_018911	-		140221013	+1	no_errors	ENST00000531613	ensembl	human	known	74_37	missense	SNP	0.019	T
DMRTC2	63946	genome.wustl.edu	37	19	42351926	42351926	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr19:42351926G>A	ENST00000269945.3	+	3	398	c.347G>A	c.(346-348)gGa>gAa	p.G116E	DMRTC2_ENST00000596827.1_Missense_Mutation_p.G116E|DMRTC2_ENST00000602098.1_3'UTR	NM_001040283.1	NP_001035373.1	Q8IXT2	DMRTD_HUMAN	DMRT-like family C2	116					male meiosis I (GO:0007141)|positive regulation of histone H3-K9 dimethylation (GO:1900111)|positive regulation of histone H3-K9 trimethylation (GO:1900114)|sex differentiation (GO:0007548)|spermatid nucleus elongation (GO:0007290)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|XY body (GO:0001741)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G116V(1)		endometrium(1)|large_intestine(2)|lung(5)|prostate(1)|skin(1)	10						TTCAGAAAGGGAACCACTCAG	0.597																																																	1	Substitution - Missense(1)	large_intestine(1)						ENSG00000142025						32.0	29.0	30.0					19																	42351926		2202	4299	6501	DMRTC2	SO:0001583	missense	0			-	HGNC	AJ291669	CCDS33034.1	19q13.2	2008-07-16				ENSG00000142025			13911	protein-coding gene	gene with protein product		614806				11863363	Standard	NM_001040283		Approved		uc002ors.3	Q8IXT2		ENST00000269945.3:c.347G>A	19.37:g.42351926G>A	ENSP00000269945:p.Gly116Glu	Somatic	0	34	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	45	19.64	Q8N6Q2|Q96M39|Q96SD4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DM_DNA-bd,superfamily_DM_DNA-bd,smart_DM_DNA-bd,pfscan_DM_DNA-bd	p.G116E	ENST00000269945.3	37	c.347	CCDS33034.1	19	.	.	.	.	.	.	.	.	.	.	G	6.385	0.439210	0.12104	.	.	ENSG00000142025	ENST00000269945	.	.	.	5.23	-0.899	0.10547	.	2.581580	0.01941	N	0.041882	T	0.31544	0.0800	L	0.46157	1.445	0.09310	N	0.999995	B;B	0.12630	0.006;0.005	B;B	0.10450	0.005;0.004	T	0.03829	-1.1000	9	0.14656	T	0.56	0.0185	1.8656	0.03198	0.1719:0.3018:0.3711:0.1552	.	116;116	B4DX56;Q8IXT2	.;DMRTD_HUMAN	E	116	.	ENSP00000269945:G116E	G	+	2	0	DMRTC2	47043766	0.352000	0.24895	0.044000	0.18714	0.010000	0.07245	0.251000	0.18257	0.021000	0.15133	-0.170000	0.13304	GGA	-	NULL		0.597	DMRTC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMRTC2	protein_coding	OTTHUMT00000463045.1	G	NM_001040283	-		42351926	+1	no_errors	ENST00000269945	ensembl	human	known	74_37	missense	SNP	0.062	A
AGAP4	119016	genome.wustl.edu	37	10	51246208	51246208	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr10:51246208G>A	ENST00000425119.2	-	1	327	c.202C>T	c.(202-204)Cgt>Tgt	p.R68C	AGAP8_ENST00000484805.1_5'UTR|AGAP8_ENST00000602930.1_Missense_Mutation_p.R29C	NM_001077686.1|NM_001276344.1	NP_001071154.1|NP_001263273.1	Q5SRD3	AGAP8_HUMAN		68					regulation of ARF GTPase activity (GO:0032312)		ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|lung(2)|ovary(2)	6						TCCCGGTCACGAACGTGGTGC	0.597																																																	0								ENSG00000174194						1.0	1.0	1.0					10																	51246208		282	464	746	AGAP8	SO:0001583	missense	0			-	HGNC																												ENST00000425119.2:c.202C>T	10.37:g.51246208G>A	ENSP00000415452:p.Arg68Cys	Somatic	0	22	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	18	45.45		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ArfGAP,pfam_Pleckstrin_homology,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Pleckstrin_homology,smart_ArfGAP,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Pleckstrin_homology,pfscan_ArfGAP,prints_ArfGAP	p.R68C	ENST00000425119.2	37	c.202	CCDS41522.1	10	.	.	.	.	.	.	.	.	.	.	G	3.256	-0.152133	0.06585	.	.	ENSG00000174194	ENST00000425119	D	0.90133	-2.62	1.38	0.0976	0.14494	.	0.187111	0.47093	D	0.000253	T	0.76513	0.3998	N	0.11427	0.14	0.21064	N	0.999797	P;P;P	0.47106	0.614;0.89;0.614	B;B;B	0.40636	0.18;0.335;0.041	T	0.71991	-0.4425	10	0.72032	D	0.01	.	4.1621	0.10289	0.0:0.0:0.3852:0.6148	.	68;68;68	C9JET2;Q5VW22-2;Q5SRD3	.;.;AGAP8_HUMAN	C	68	ENSP00000415452:R68C	ENSP00000415452:R68C	R	-	1	0	AGAP8	50916214	0.148000	0.22702	0.936000	0.37596	0.012000	0.07955	-0.413000	0.07123	0.024000	0.15214	0.175000	0.17021	CGT	-	NULL		0.597	AGAP8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AGAP8	protein_coding	OTTHUMT00000048022.2	G		-		51246208	-1	no_errors	ENST00000425119	ensembl	human	known	74_37	missense	SNP	0.945	A
TTN	7273	genome.wustl.edu	37	2	179594530	179594530	+	Silent	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr2:179594530C>T	ENST00000591111.1	-	61	17723	c.17499G>A	c.(17497-17499)caG>caA	p.Q5833Q	TTN_ENST00000359218.5_Intron|TTN_ENST00000342175.6_Intron|TTN_ENST00000460472.2_Intron|TTN_ENST00000589042.1_Silent_p.Q6150Q|TTN-AS1_ENST00000585451.1_RNA|RP11-171I2.1_ENST00000590024.1_RNA|TTN_ENST00000342992.6_Silent_p.Q4906Q			Q8WZ42	TITIN_HUMAN	titin	12632	Ig-like 39.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGCCATGTTTCTGAATGGCTG	0.423																																																	0								ENSG00000155657						89.0	86.0	87.0					2																	179594530		1899	4128	6027	TTN	SO:0001819	synonymous_variant	0			-	HGNC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.17499G>A	2.37:g.179594530C>T		Somatic	0	31	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	45	13.46	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.Q4906	ENST00000591111.1	37	c.14718		2																																																																																			-	pfam_Ig_I-set,superfamily_RNaseH-like_dom,smart_Ig_V-set_subgr,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.423	TTN-019	PUTATIVE	basic	protein_coding	TTN	protein_coding	OTTHUMT00000460310.1	C	NM_133378	-		179594530	-1	no_errors	ENST00000342992	ensembl	human	known	74_37	silent	SNP	0.076	T
SPTAN1	6709	genome.wustl.edu	37	9	131355381	131355381	+	Intron	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr9:131355381C>T	ENST00000372731.4	+	23	3325				SPTAN1_ENST00000372739.3_Intron|SPTAN1_ENST00000475367.1_3'UTR|SPTAN1_ENST00000358161.5_Intron	NM_001195532.1|NM_003127.3	NP_001182461.1|NP_003118.2	Q13813	SPTN1_HUMAN	spectrin, alpha, non-erythrocytic 1						actin filament capping (GO:0051693)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cuticular plate (GO:0032437)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intracellular membrane-bounded organelle (GO:0043231)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|spectrin (GO:0008091)|vesicle (GO:0031982)|Z disc (GO:0030018)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(2)|breast(8)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(21)|liver(1)|lung(25)|ovary(5)|pancreas(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	87						TCCATTCTCCCTCTGCCGCTT	0.547																																					NSCLC(120;833 1744 2558 35612 37579)												0								ENSG00000197694						34.0	35.0	35.0					9																	131355381		692	1591	2283	SPTAN1	SO:0001627	intron_variant	0			-	HGNC	M19725	CCDS6905.1, CCDS48036.1, CCDS75914.1	9q34.11	2013-01-10	2012-06-15		ENSG00000197694	ENSG00000197694		"""EF-hand domain containing"""	11273	protein-coding gene	gene with protein product	"""alpha-fodrin"""	182810				3336352	Standard	NM_003127		Approved		uc004bvm.4	Q13813	OTTHUMG00000020754	ENST00000372731.4:c.3215+60C>T	9.37:g.131355381C>T		Somatic	0	36	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	18	40.00	Q13186|Q15324|Q16606|Q59EF1|Q5VXV5|Q5VXV6|Q7Z6M5|Q9P0V0	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000372731.4	37	NULL	CCDS6905.1	9																																																																																			-	-		0.547	SPTAN1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTAN1	protein_coding	OTTHUMT00000054472.1	C	NM_003127	-		131355381	+1	no_errors	ENST00000475367	ensembl	human	known	74_37	rna	SNP	0.996	T
AQP12B	653437	genome.wustl.edu	37	2	241622024	241622024	+	Silent	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr2:241622024G>A	ENST00000407834.3	-	1	293	c.231C>T	c.(229-231)ttC>ttT	p.F77F		NM_001102467.1	NP_001095937.1	A6NM10	AQ12B_HUMAN	aquaporin 12B	65						integral component of membrane (GO:0016021)	transporter activity (GO:0005215)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|lung(8)|ovary(1)	13		all_epithelial(40;1.71e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0294)|all_neural(83;0.0459)|Lung NSC(271;0.094)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;2.2e-31)|all cancers(36;1.08e-28)|OV - Ovarian serous cystadenocarcinoma(60;2.13e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;7.52e-06)|Lung(119;0.00163)|LUSC - Lung squamous cell carcinoma(224;0.008)|Colorectal(34;0.0124)|COAD - Colon adenocarcinoma(134;0.0757)		GGAAGAGCAGGAAGAGCAGGG	0.682																																																	0								ENSG00000185176						50.0	51.0	51.0					2																	241622024		2203	4296	6499	AQP12B	SO:0001819	synonymous_variant	0			-	HGNC	BC041460	CCDS46560.1	2q37.3	2007-12-14	2005-05-26	2005-05-26	ENSG00000185176	ENSG00000185176		"""Ion channels / Aquaporins"""	6096	protein-coding gene	gene with protein product			"""insulin synthesis associated 3"""	INSSA3			Standard	NM_001102467		Approved		uc010fzj.3	A6NM10	OTTHUMG00000152263	ENST00000407834.3:c.231C>T	2.37:g.241622024G>A		Somatic	0	97	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	134	16.25	A4QPB9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_MIP,superfamily_Aquaporin-like,pirsf_Aquaporin_11/12,prints_Aquaporin_12,prints_MIP	p.F77	ENST00000407834.3	37	c.231	CCDS46560.1	2																																																																																			-	pfam_MIP,superfamily_Aquaporin-like,pirsf_Aquaporin_11/12,prints_MIP		0.682	AQP12B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AQP12B	protein_coding	OTTHUMT00000325625.1	G		-		241622024	-1	no_errors	ENST00000407834	ensembl	human	known	74_37	silent	SNP	1.000	A
RNFT2	84900	genome.wustl.edu	37	12	117217132	117217132	+	Silent	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr12:117217132C>T	ENST00000257575.4	+	7	1094	c.861C>T	c.(859-861)atC>atT	p.I287I	RNU6-558P_ENST00000364512.1_RNA|RNFT2_ENST00000319176.7_Intron|RNFT2_ENST00000407967.3_Silent_p.I287I|RNFT2_ENST00000392549.2_Silent_p.I287I			Q96EX2	RNFT2_HUMAN	ring finger protein, transmembrane 2	287						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(3)|lung(1)|urinary_tract(1)	6	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.034)		TGCCCAAGATCATCCTGGCTG	0.547																																																	0								ENSG00000135119						121.0	95.0	104.0					12																	117217132		2203	4300	6503	RNFT2	SO:0001819	synonymous_variant	0			-	HGNC	AK027533	CCDS9180.2, CCDS44987.1	12q24.22	2013-01-09	2008-02-26	2008-02-26	ENSG00000135119	ENSG00000135119		"""RING-type (C3HC4) zinc fingers"""	25905	protein-coding gene	gene with protein product			"""transmembrane protein 118"""	TMEM118		12477932	Standard	NM_032814		Approved	FLJ14627	uc009zwn.3	Q96EX2	OTTHUMG00000150882	ENST00000257575.4:c.861C>T	12.37:g.117217132C>T		Somatic	0	59	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	70	22.22	E9PAM7|Q96SU5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.I287	ENST00000257575.4	37	c.861	CCDS44987.1	12																																																																																			-	NULL		0.547	RNFT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNFT2	protein_coding	OTTHUMT00000320417.1	C	NM_032814	-		117217132	+1	no_errors	ENST00000257575	ensembl	human	known	74_37	silent	SNP	1.000	T
FCRL1	115350	genome.wustl.edu	37	1	157771909	157771909	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr1:157771909G>A	ENST00000368176.3	-	5	749	c.682C>T	c.(682-684)Cac>Tac	p.H228Y	FCRL1_ENST00000491942.1_Missense_Mutation_p.H228Y|FCRL1_ENST00000358292.3_Missense_Mutation_p.H228Y|FCRL1_ENST00000489998.1_5'UTR	NM_001159398.1|NM_052938.4	NP_001152870.1|NP_443170.1	Q96LA6	FCRL1_HUMAN	Fc receptor-like 1	228	Ig-like C2-type 3.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(24)|ovary(4)|prostate(1)|skin(6)	42	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			GCCTCACAGTGAAGCTCCAGC	0.612																																					GBM(54;482 1003 11223 30131 35730)												0								ENSG00000163534						40.0	41.0	40.0					1																	157771909		2203	4300	6503	FCRL1	SO:0001583	missense	0			-	HGNC	BC033690	CCDS1170.1, CCDS53382.1, CCDS53383.1	1q21-q22	2013-01-14			ENSG00000163534	ENSG00000163534		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18509	protein-coding gene	gene with protein product		606508				11493702, 11929751	Standard	NM_052938		Approved	FCRH1, IRTA5, IFGP1, CD307a	uc001frg.3	Q96LA6	OTTHUMG00000019398	ENST00000368176.3:c.682C>T	1.37:g.157771909G>A	ENSP00000357158:p.His228Tyr	Somatic	0	33	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	26	29.73	B2RE05|Q8N759|Q8NDI0|Q96PJ6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.H228Y	ENST00000368176.3	37	c.682	CCDS1170.1	1	.	.	.	.	.	.	.	.	.	.	G	11.77	1.736339	0.30774	.	.	ENSG00000163534	ENST00000358292;ENST00000368176;ENST00000491942	T;T;T	0.03004	4.08;4.08;4.08	4.86	2.99	0.34606	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.766837	0.12271	N	0.483812	T	0.07052	0.0179	M	0.90977	3.165	0.26818	N	0.96885	P;P;P	0.49559	0.679;0.776;0.925	P;P;P	0.52514	0.535;0.517;0.701	T	0.14811	-1.0459	9	.	.	.	.	7.3763	0.26831	0.1972:0.0:0.8028:0.0	.	228;228;228	Q96LA6-3;Q96LA6-2;Q96LA6	.;.;FCRL1_HUMAN	Y	228	ENSP00000351039:H228Y;ENSP00000357158:H228Y;ENSP00000418130:H228Y	.	H	-	1	0	FCRL1	156038533	0.384000	0.25164	0.964000	0.40570	0.008000	0.06430	1.009000	0.29886	0.751000	0.32900	-0.140000	0.14226	CAC	-	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.612	FCRL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FCRL1	protein_coding	OTTHUMT00000051401.1	G	NM_052938	-		157771909	-1	no_errors	ENST00000368176	ensembl	human	known	74_37	missense	SNP	0.947	A
C12orf43	64897	genome.wustl.edu	37	12	121442845	121442845	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr12:121442845G>A	ENST00000288757.3	-	5	435	c.413C>T	c.(412-414)tCt>tTt	p.S138F	C12orf43_ENST00000537817.1_Missense_Mutation_p.S139F|C12orf43_ENST00000539736.1_Missense_Mutation_p.S127F|C12orf43_ENST00000366211.2_Missense_Mutation_p.S96F|C12orf43_ENST00000536407.2_Intron|C12orf43_ENST00000445832.3_Missense_Mutation_p.S108F	NM_022895.1	NP_075046.1	Q96C57	CL043_HUMAN	chromosome 12 open reading frame 43	138										cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(10)	14	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					GGGTTGGGGAGACTCTTCCTT	0.512																																																	0								ENSG00000157895						59.0	62.0	61.0					12																	121442845		2199	4295	6494	C12orf43	SO:0001583	missense	0			-	HGNC	AK022510	CCDS66486.1, CCDS66487.1	12q24.31	2012-05-30			ENSG00000157895	ENSG00000157895			25719	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_001286195		Approved	FLJ12448	uc001tzh.1	Q96C57	OTTHUMG00000169150	ENST00000288757.3:c.413C>T	12.37:g.121442845G>A	ENSP00000288757:p.Ser138Phe	Somatic	0	147	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	32	132	19.51	Q53HF0|Q9H9Z7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.S138F	ENST00000288757.3	37	c.413	CCDS9210.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.79|13.79	2.342549|2.342549	0.41498|0.41498	.|.	.|.	ENSG00000157895|ENSG00000157895	ENST00000546272|ENST00000445832;ENST00000288757;ENST00000537817;ENST00000366211;ENST00000539736;ENST00000538296;ENST00000535367	.|T;T;T;T;T	.|0.54675	.|0.58;0.56;0.57;0.68;0.61	5.86|5.86	4.03|4.03	0.46877|0.46877	.|.	.|0.765941	.|0.12831	.|N	.|0.435652	T|T	0.58308|0.58308	0.2113|0.2113	L|L	0.50333|0.50333	1.59|1.59	0.09310|0.09310	N|N	1|1	.|D;D;P;D;P	.|0.53151	.|0.958;0.958;0.919;0.958;0.919	.|P;P;P;P;B	.|0.54312	.|0.748;0.66;0.507;0.748;0.329	T|T	0.46638|0.46638	-0.9177|-0.9177	5|10	.|0.49607	.|T	.|0.09	2.4198|2.4198	9.6629|9.6629	0.39965|0.39965	0.0:0.1529:0.6882:0.159|0.0:0.1529:0.6882:0.159	.|.	.|127;96;139;127;138	.|G5EA44;F6TFQ5;F5H7W8;B4DWJ9;Q96C57	.|.;.;.;.;CL043_HUMAN	F|F	91|108;138;139;96;127;75;92	.|ENSP00000409788:S108F;ENSP00000288757:S138F;ENSP00000442224:S139F;ENSP00000437803:S127F;ENSP00000442041:S75F	.|ENSP00000288757:S138F	L|S	-|-	1|2	0|0	C12orf43|C12orf43	119927228|119927228	0.007000|0.007000	0.16637|0.16637	0.003000|0.003000	0.11579|0.11579	0.052000|0.052000	0.14988|0.14988	1.538000|1.538000	0.36094|0.36094	0.921000|0.921000	0.36994|0.36994	0.650000|0.650000	0.86243|0.86243	CTC|TCT	-	NULL		0.512	C12orf43-201	KNOWN	basic|appris_principal|CCDS	protein_coding	C12orf43	protein_coding		G	NM_022895	-		121442845	-1	no_errors	ENST00000288757	ensembl	human	known	74_37	missense	SNP	0.031	A
PTPRS	5802	genome.wustl.edu	37	19	5244376	5244376	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr19:5244376G>A	ENST00000587303.1	-	10	1205	c.1106C>T	c.(1105-1107)tCc>tTc	p.S369F	PTPRS_ENST00000372412.4_Missense_Mutation_p.S370F|PTPRS_ENST00000592099.1_Missense_Mutation_p.S356F|PTPRS_ENST00000348075.2_Missense_Mutation_p.S356F|PTPRS_ENST00000357368.4_Missense_Mutation_p.S369F|PTPRS_ENST00000588552.1_5'UTR|PTPRS_ENST00000588012.1_Missense_Mutation_p.S356F|PTPRS_ENST00000262963.6_Missense_Mutation_p.S365F|PTPRS_ENST00000353284.2_Missense_Mutation_p.S356F			Q13332	PTPRS_HUMAN	protein tyrosine phosphatase, receptor type, S	369	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|corpus callosum development (GO:0022038)|extracellular matrix organization (GO:0030198)|hippocampus development (GO:0021766)|peptidyl-tyrosine dephosphorylation (GO:0035335)|spinal cord development (GO:0021510)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|biliary_tract(1)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(1)|lung(9)|ovary(4)|prostate(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(1)	61				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0321)|Lung(535;0.182)	Alendronate(DB00630)|Etidronic acid(DB01077)	TTGGCTCTTGGATTTATATTC	0.547																																																	0								ENSG00000105426						117.0	102.0	107.0					19																	5244376		2203	4300	6503	PTPRS	SO:0001583	missense	0			-	HGNC	U35234	CCDS12139.1, CCDS12140.1, CCDS45930.1, CCDS74265.1	19p13.3	2013-02-11				ENSG00000105426		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9681	protein-coding gene	gene with protein product		601576				8954782, 8524829	Standard	NM_002850		Approved		uc002mbv.3	Q13332		ENST00000587303.1:c.1106C>T	19.37:g.5244376G>A	ENSP00000467537:p.Ser369Phe	Somatic	0	39	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	54	20.59	O75255|O75870|Q15718|Q16341|Q2M3R7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Fibronectin_type3,pfam_Ig_I-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_rcpt/non-rcpt,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Ig-like_dom	p.S370F	ENST00000587303.1	37	c.1109	CCDS45930.1	19	.	.	.	.	.	.	.	.	.	.	G	18.04	3.534918	0.64972	.	.	ENSG00000105426	ENST00000536396;ENST00000372412;ENST00000357368;ENST00000355005;ENST00000356037;ENST00000262963;ENST00000348075;ENST00000355322;ENST00000544524;ENST00000353284	T;T;T;T;T	0.58652	0.32;0.32;0.32;0.32;0.32	3.87	3.87	0.44632	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.085624	0.48767	U	0.000162	T	0.68081	0.2962	L	0.51422	1.61	0.32268	N	0.569281	P;B;P;D;P;P	0.63046	0.725;0.021;0.928;0.992;0.956;0.927	B;B;P;P;P;P	0.62435	0.431;0.043;0.543;0.902;0.873;0.596	T	0.75921	-0.3147	10	0.59425	D	0.04	.	16.0206	0.80486	0.0:0.0:1.0:0.0	.	369;356;360;356;369;382	F8W800;Q13332-7;F5H2T4;Q13332-6;Q13332;Q59FX6	.;.;.;.;PTPRS_HUMAN;.	F	382;370;369;369;369;365;356;369;360;356	ENSP00000361489:S370F;ENSP00000349932:S369F;ENSP00000262963:S365F;ENSP00000269907:S356F;ENSP00000327313:S356F	ENSP00000262963:S365F	S	-	2	0	PTPRS	5195376	1.000000	0.71417	0.999000	0.59377	0.497000	0.33675	7.567000	0.82357	2.018000	0.59344	0.561000	0.74099	TCC	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.547	PTPRS-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTPRS	protein_coding	OTTHUMT00000450762.2	G		-		5244376	-1	no_errors	ENST00000372412	ensembl	human	known	74_37	missense	SNP	1.000	A
MIR521-1	574494	genome.wustl.edu	37	19	54251935	54251935	+	RNA	SNP	A	A	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr19:54251935A>T	ENST00000384902.1	+	0	46				RNU6-751P_ENST00000516382.1_RNA|MIR522_ENST00000385071.1_RNA	NR_030216.1				microRNA 521-1																		TGTTGTCTAAAAGAAAAGAAC	0.423																																																	0								ENSG00000207634						124.0	118.0	120.0					19																	54251935		1568	3582	5150	MIR521-1			0			-	HGNC			19q13.42	2011-09-12		2008-12-18	ENSG00000207634	ENSG00000207634		"""ncRNAs / Micro RNAs"""	32126	non-coding RNA	RNA, micro				MIRN521-1			Standard	NR_030216		Approved	hsa-mir-521-1	uc021vas.1				19.37:g.54251935A>T		Somatic	0	48	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	53	20.90		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000384902.1	37	NULL		19																																																																																			-	-		0.423	MIR521-1-201	KNOWN	basic	miRNA	MIR521-1	miRNA		A	NR_030216	-		54251935	+1	no_errors	ENST00000384902	ensembl	human	known	74_37	rna	SNP	0.655	T
FREM3	166752	genome.wustl.edu	37	4	144617710	144617710	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr4:144617710C>T	ENST00000329798.5	-	1	4118	c.4119G>A	c.(4117-4119)atG>atA	p.M1373I		NM_001168235.1	NP_001161707.1	P0C091	FREM3_HUMAN	FRAS1 related extracellular matrix 3	1373					cell adhesion (GO:0007155)|cell communication (GO:0007154)	basement membrane (GO:0005604)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(2)|prostate(1)	8						GGGTAAAGTTCATTCCCAGAG	0.458																																																	0								ENSG00000183090						162.0	129.0	139.0					4																	144617710		692	1591	2283	FREM3	SO:0001583	missense	0			-	HGNC	BX091796	CCDS54808.1	4q31.21	2011-06-09			ENSG00000183090	ENSG00000183090			25172	protein-coding gene	gene with protein product		608946				15345741	Standard	NM_001168235		Approved		uc021xsj.1	P0C091	OTTHUMG00000161577	ENST00000329798.5:c.4119G>A	4.37:g.144617710C>T	ENSP00000332886:p.Met1373Ile	Somatic	0	41	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	49	10.91		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Calx_beta,superfamily_Cadherin-like,smart_Calx_beta	p.M1373I	ENST00000329798.5	37	c.4119	CCDS54808.1	4	.	.	.	.	.	.	.	.	.	.	C	21.1	4.102428	0.76983	.	.	ENSG00000183090	ENST00000329798	T	0.52983	0.64	4.33	4.33	0.51752	.	0.000000	0.85682	D	0.000000	T	0.68540	0.3012	M	0.87547	2.89	0.58432	D	0.999999	.	.	.	.	.	.	T	0.72320	-0.4329	8	0.38643	T	0.18	-15.1185	15.7515	0.77989	0.0:1.0:0.0:0.0	.	.	.	.	I	1373	ENSP00000332886:M1373I	ENSP00000332886:M1373I	M	-	3	0	FREM3	144837160	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	4.237000	0.58681	2.229000	0.72834	0.655000	0.94253	ATG	-	NULL		0.458	FREM3-001	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	FREM3	protein_coding	OTTHUMT00000365391.1	C	XM_094074	-		144617710	-1	no_errors	ENST00000329798	ensembl	human	putative	74_37	missense	SNP	1.000	T
OR2AJ1	127608	genome.wustl.edu	37	1	248097772	248097772	+	Silent	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr1:248097772G>A	ENST00000318244.3	+	1	702	c.702G>A	c.(700-702)agG>agA	p.R234R	OR2L13_ENST00000366478.2_5'Flank			Q8NGZ0	O2AJ1_HUMAN	olfactory receptor, family 2, subfamily AJ, member 1	234						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			lung(1)|pancreas(1)	2						CAGAGGCAAGGAAAAAGTCAT	0.398																																																	0								ENSG00000177275																																			OR2AJ1	SO:0001819	synonymous_variant	0			-	HGNC			1q44	2013-03-27	2004-03-04	2004-03-05	ENSG00000177275	ENSG00000177275		"""GPCR / Class A : Olfactory receptors"""	15001	other	unknown			"""olfactory receptor, family 2, subfamily AJ, member 1 pseudogene"""	OR2AJ1P			Standard	NG_004652		Approved	OR2AJ1Q		Q8NGZ0	OTTHUMG00000040206	ENST00000318244.3:c.702G>A	1.37:g.248097772G>A		Somatic	0	42	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	53	19.70		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.R234	ENST00000318244.3	37	c.702		1																																																																																			-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM		0.398	OR2AJ1-001	KNOWN	basic|appris_principal	protein_coding	OR2AJ1	protein_coding	OTTHUMT00000096863.1	G	NG_004652	-		248097772	+1	no_errors	ENST00000318244	ensembl	human	known	74_37	silent	SNP	0.000	A
ZRANB3	84083	genome.wustl.edu	37	2	135975070	135975070	+	Silent	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr2:135975070G>A	ENST00000264159.6	-	17	2576	c.2460C>T	c.(2458-2460)atC>atT	p.I820I	ZRANB3_ENST00000412849.1_5'UTR|ZRANB3_ENST00000536680.1_Silent_p.I818I|ZRANB3_ENST00000401392.1_Silent_p.I818I	NM_032143.2	NP_115519.2	Q5FWF4	ZRAB3_HUMAN	zinc finger, RAN-binding domain containing 3	820					cellular response to DNA damage stimulus (GO:0006974)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|DNA rewinding (GO:0036292)|DNA strand renaturation (GO:0000733)|negative regulation of DNA recombination (GO:0045910)|replication fork processing (GO:0031297)|replication fork protection (GO:0048478)|response to UV (GO:0009411)	nuclear replication fork (GO:0043596)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|endodeoxyribonuclease activity (GO:0004520)|helicase activity (GO:0004386)|K63-linked polyubiquitin binding (GO:0070530)|zinc ion binding (GO:0008270)			NS(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(10)|upper_aerodigestive_tract(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.135)		GTTGCTTTGTGATCTCTTCCA	0.363																																																	0								ENSG00000121988						125.0	113.0	117.0					2																	135975070		1836	4084	5920	ZRANB3	SO:0001819	synonymous_variant	0			-	HGNC	AL136824	CCDS46419.1, CCDS67963.1, CCDS74580.1	2q21.3	2013-05-13			ENSG00000121988	ENSG00000121988		"""Zinc fingers, RAN-binding domain containing"""	25249	protein-coding gene	gene with protein product						11230166	Standard	XM_005263809		Approved	DKFZP434B1727	uc002tum.3	Q5FWF4	OTTHUMG00000150475	ENST00000264159.6:c.2460C>T	2.37:g.135975070G>A		Somatic	0	45	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	75	12.79	B3KYA1|B4E375|B5MDI3|D3DP76|E9PBP0|Q53SM1|Q6P2C4|Q8N1P4|Q9H0E8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_SNF2_N,pfam_Helicase_C,pfam_HNH,pfam_Znf_RanBP2,pfam_Helicase/UvrB_dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Znf_RanBP2,smart_HNH_nuc,pfscan_Znf_RanBP2,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.I820	ENST00000264159.6	37	c.2460	CCDS46419.1	2																																																																																			-	NULL		0.363	ZRANB3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZRANB3	protein_coding	OTTHUMT00000318254.1	G	NM_032143	-		135975070	-1	no_errors	ENST00000264159	ensembl	human	known	74_37	silent	SNP	0.942	A
EPHA4	2043	genome.wustl.edu	37	2	222290846	222290846	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr2:222290846C>T	ENST00000281821.2	-	17	2904	c.2863G>A	c.(2863-2865)Ggt>Agt	p.G955S	EPHA4_ENST00000469354.1_5'Flank|EPHA4_ENST00000409938.1_Missense_Mutation_p.G955S|EPHA4_ENST00000392071.4_Missense_Mutation_p.G904S|EPHA4_ENST00000409854.1_3'UTR	NM_004438.3	NP_004429.1	P54764	EPHA4_HUMAN	EPH receptor A4	955	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.				adult walking behavior (GO:0007628)|cell adhesion (GO:0007155)|corticospinal tract morphogenesis (GO:0021957)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|glial cell migration (GO:0008347)|motor neuron axon guidance (GO:0008045)|negative regulation of axon regeneration (GO:0048681)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of Rho guanyl-nucleotide exchange factor activity (GO:2001108)|protein autophosphorylation (GO:0046777)|regulation of astrocyte differentiation (GO:0048710)|regulation of axonogenesis (GO:0050770)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of Rac GTPase activity (GO:0032314)|regulation of Rap GTPase activity (GO:0032317)	axon (GO:0030424)|axon terminus (GO:0043679)|axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|mitochondrial outer membrane (GO:0005741)|neuromuscular junction (GO:0031594)|perikaryon (GO:0043204)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|DH domain binding (GO:0097161)|GPI-linked ephrin receptor activity (GO:0005004)|PH domain binding (GO:0042731)|protein kinase activity (GO:0004672)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|liver(1)|lung(21)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Renal(207;0.0183)		Epithelial(121;5.38e-09)|all cancers(144;2.47e-06)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(261;0.0154)		GCTGTGATACCAATTCTTGCC	0.498																																																	0								ENSG00000116106						172.0	149.0	156.0					2																	222290846		2203	4300	6503	EPHA4	SO:0001583	missense	0			-	HGNC	L36645	CCDS2447.1	2q36.3	2013-02-11	2004-10-28		ENSG00000116106	ENSG00000116106	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3388	protein-coding gene	gene with protein product		602188	"""EphA4"""	TYRO1		9267020	Standard	NM_004438		Approved	Hek8	uc002vmq.3	P54764	OTTHUMG00000133142	ENST00000281821.2:c.2863G>A	2.37:g.222290846C>T	ENSP00000281821:p.Gly955Ser	Somatic	0	37	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	30	11.76	A8K2P1|B2R601|B7Z6Q8|Q2M380	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_SAM_2,pfam_SAM_type1,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt_N_dom,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.G955S	ENST00000281821.2	37	c.2863	CCDS2447.1	2	.	.	.	.	.	.	.	.	.	.	C	27.2	4.808663	0.90707	.	.	ENSG00000116106	ENST00000281821;ENST00000409938;ENST00000392071	D;D;D	0.92149	-2.98;-2.98;-2.98	5.77	5.77	0.91146	Sterile alpha motif domain (2);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 2 (1);	0.000000	0.85682	D	0.000000	D	0.97467	0.9171	H	0.95328	3.655	0.80722	D	1	D	0.89917	1.0	D	0.71656	0.974	D	0.98074	1.0400	10	0.87932	D	0	.	19.9915	0.97366	0.0:1.0:0.0:0.0	.	955	P54764	EPHA4_HUMAN	S	955;955;904	ENSP00000281821:G955S;ENSP00000386829:G955S;ENSP00000375923:G904S	ENSP00000281821:G955S	G	-	1	0	EPHA4	221999090	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	7.818000	0.86416	2.723000	0.93209	0.655000	0.94253	GGT	-	pirsf_Tyr_kinase_ephrin_rcpt,pfam_SAM_2,pfam_SAM_type1,superfamily_SAM/pointed,smart_SAM,pfscan_SAM		0.498	EPHA4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHA4	protein_coding	OTTHUMT00000256836.3	C		-		222290846	-1	no_errors	ENST00000281821	ensembl	human	known	74_37	missense	SNP	1.000	T
SP140	11262	genome.wustl.edu	37	2	231103060	231103060	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr2:231103060C>T	ENST00000392045.3	+	3	484	c.370C>T	c.(370-372)Cct>Tct	p.P124S	SP140_ENST00000417495.3_Missense_Mutation_p.P124S|SP140_ENST00000544128.1_3'UTR|SP140_ENST00000373645.3_Missense_Mutation_p.P124S|SP140_ENST00000343805.6_Missense_Mutation_p.P124S|SP140_ENST00000420434.3_Missense_Mutation_p.P124S|SP140_ENST00000350136.5_Missense_Mutation_p.P104S|SP140_ENST00000486687.2_Missense_Mutation_p.P124S	NM_007237.4	NP_009168.4	Q13342	SP140_HUMAN	SP140 nuclear body protein	124	HSR. {ECO:0000255|PROSITE- ProRule:PRU00747}.				defense response (GO:0006952)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(1)	12		Renal(207;0.0112)|all_lung(227;0.0221)|Lung NSC(271;0.0977)|all_hematologic(139;0.103)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)		GATGGCCTATCCTGATTTAAA	0.413																																																	0								ENSG00000079263						96.0	86.0	89.0					2																	231103060		2203	4300	6503	SP140	SO:0001583	missense	0			-	HGNC	U63420	CCDS33392.1, CCDS42831.1, CCDS63149.1, CCDS63150.1, CCDS63151.1	2q37.1	2013-01-28			ENSG00000079263	ENSG00000079263		"""Zinc fingers, PHD-type"""	17133	protein-coding gene	gene with protein product		608602				8695863, 8910577, 12368356	Standard	NM_001005176		Approved	LYSP100-B, LYSP100-A	uc002vql.3	Q13342	OTTHUMG00000153670	ENST00000392045.3:c.370C>T	2.37:g.231103060C>T	ENSP00000375899:p.Pro124Ser	Somatic	0	50	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	34	32.00	E7ESH9|E7EUR5|E9PFJ6|Q0VGE5|Q13341|Q3KR17|Q4ZG66|Q53TG1|Q6NSG4|Q92881|Q96TG3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Sp100,pfam_SAND_dom,pfam_Bromodomain,pfam_Znf_PHD-finger,superfamily_SAND_dom-like,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_SAND_dom,smart_Znf_PHD,smart_Bromodomain,pfscan_Znf_PHD-finger,pfscan_SAND_dom,pfscan_Bromodomain	p.P124S	ENST00000392045.3	37	c.370	CCDS42831.1	2	.	.	.	.	.	.	.	.	.	.	C	15.06	2.720210	0.48728	.	.	ENSG00000079263	ENST00000537563;ENST00000486687;ENST00000392044;ENST00000350136;ENST00000392045;ENST00000417495;ENST00000343805;ENST00000420434;ENST00000373645	D;D;D;D;D;D	0.95554	-3.74;-3.74;-3.74;-3.74;-3.74;-3.74	3.7	2.82	0.32997	Sp100 (2);	.	.	.	.	D	0.97040	0.9033	M	0.80332	2.49	0.20764	N	0.999858	D;D;D;D;D;P	0.89917	0.975;0.975;0.969;1.0;0.975;0.952	P;P;P;D;P;P	0.97110	0.897;0.865;0.835;1.0;0.872;0.753	D	0.90389	0.4394	9	0.87932	D	0	-10.0593	7.0994	0.25327	0.0:0.8769:0.0:0.1231	.	124;124;124;124;124;124	E7EUR5;E7ESH9;E9PFJ6;Q13342;E7EX75;Q6NSG4	.;.;.;LY10_HUMAN;.;.	S	124;124;124;104;124;124;124;124;124	ENSP00000440107:P124S;ENSP00000345846:P104S;ENSP00000375899:P124S;ENSP00000342096:P124S;ENSP00000398210:P124S;ENSP00000362749:P124S	ENSP00000342096:P124S	P	+	1	0	SP140	230811304	0.066000	0.20996	0.364000	0.25888	0.748000	0.42578	1.760000	0.38430	1.124000	0.41980	0.655000	0.94253	CCT	-	pfam_Sp100		0.413	SP140-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SP140	protein_coding	OTTHUMT00000332015.1	C	NM_007237	-		231103060	+1	no_errors	ENST00000392045	ensembl	human	known	74_37	missense	SNP	0.529	T
PENK	5179	genome.wustl.edu	37	8	57353922	57353922	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr8:57353922G>A	ENST00000314922.3	-	2	789	c.713C>T	c.(712-714)gCc>gTc	p.A238V	PENK_ENST00000451791.2_Missense_Mutation_p.A238V|PENK_ENST00000523274.1_5'Flank	NM_006211.3	NP_006202.1	P01210	PENK_HUMAN	proenkephalin	238					aggressive behavior (GO:0002118)|behavioral fear response (GO:0001662)|locomotory behavior (GO:0007626)|neuropeptide signaling pathway (GO:0007218)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)|startle response (GO:0001964)	extracellular region (GO:0005576)	neuropeptide hormone activity (GO:0005184)			central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|liver(1)|lung(5)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	21		all_lung(136;0.229)	Epithelial(17;0.000873)|all cancers(17;0.0069)			CAGAGCCTCGGCAAAGCGCTT	0.478																																																	0								ENSG00000181195						81.0	87.0	85.0					8																	57353922		2203	4300	6503	PENK	SO:0001583	missense	0			-	HGNC		CCDS6168.1	8q23-q24	2013-02-26				ENSG00000181195		"""Endogenous ligands"""	8831	protein-coding gene	gene with protein product	"""preproenkephalin"""	131330				6281660	Standard	NM_006211		Approved		uc003xsz.2	P01210		ENST00000314922.3:c.713C>T	8.37:g.57353922G>A	ENSP00000324248:p.Ala238Val	Somatic	0	63	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	55	14.06	B2RC23|Q6FHC6|Q6FHE6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Opioid_neupept,prints_Proenkphlin_A,prints_Opioid_neupept	p.A238V	ENST00000314922.3	37	c.713	CCDS6168.1	8	.	.	.	.	.	.	.	.	.	.	G	15.48	2.845347	0.51164	.	.	ENSG00000181195	ENST00000314922;ENST00000451791	T;T	0.19806	2.12;2.12	5.91	5.02	0.67125	.	0.115747	0.56097	D	0.000029	T	0.21267	0.0512	L	0.49126	1.545	0.80722	D	1	P	0.40578	0.722	B	0.36719	0.231	T	0.01869	-1.1257	10	0.29301	T	0.29	-16.6266	16.111	0.81263	0.0:0.1337:0.8663:0.0	.	238	P01210	PENK_HUMAN	V	238	ENSP00000324248:A238V;ENSP00000400894:A238V	ENSP00000324248:A238V	A	-	2	0	PENK	57516476	0.892000	0.30473	0.599000	0.28851	0.914000	0.54420	4.084000	0.57650	1.459000	0.47892	0.655000	0.94253	GCC	-	NULL		0.478	PENK-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PENK	protein_coding	OTTHUMT00000378645.1	G		-		57353922	-1	no_errors	ENST00000314922	ensembl	human	known	74_37	missense	SNP	0.850	A
REG3G	130120	genome.wustl.edu	37	2	79254218	79254218	+	Missense_Mutation	SNP	G	G	A	rs557732692	byFrequency	TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr2:79254218G>A	ENST00000272324.5	+	4	438	c.254G>A	c.(253-255)gGa>gAa	p.G85E	REG3G_ENST00000409471.1_Intron|REG3G_ENST00000393897.2_Missense_Mutation_p.G85E	NM_001008387.2	NP_001008388.1	Q6UW15	REG3G_HUMAN	regenerating islet-derived 3 gamma	85	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				acute-phase response (GO:0006953)|defense response to Gram-positive bacterium (GO:0050830)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of keratinocyte differentiation (GO:0045617)|positive regulation of keratinocyte proliferation (GO:0010838)|positive regulation of wound healing (GO:0090303)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(27)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						GGGGCTGAGGGATCCTTCGTG	0.552																																																	0								ENSG00000143954						168.0	154.0	159.0					2																	79254218		2203	4300	6503	REG3G	SO:0001583	missense	0			-	HGNC	AY359047	CCDS1962.1, CCDS58714.1	2p12	2005-02-11			ENSG00000143954	ENSG00000143954			29595	protein-coding gene	gene with protein product		609933				12975309	Standard	NM_001008387		Approved	UNQ429, LPPM429, PAP1B	uc002snx.4	Q6UW15	OTTHUMG00000130018	ENST00000272324.5:c.254G>A	2.37:g.79254218G>A	ENSP00000272324:p.Gly85Glu	Somatic	0	56	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	45	26.23	A8K980|D6W5J6|Q3SYE4|Q3SYE6|Q6FH18	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	p.G85E	ENST00000272324.5	37	c.254	CCDS1962.1	2	.	.	.	.	.	.	.	.	.	.	G	13.83	2.353226	0.41700	.	.	ENSG00000143954	ENST00000393897;ENST00000272324	T;T	0.17854	2.25;2.25	4.83	-1.65	0.08291	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.563830	0.15977	N	0.235475	T	0.17365	0.0417	N	0.16478	0.41	0.22096	N	0.999362	B	0.22480	0.07	P	0.49477	0.612	T	0.54043	-0.8352	10	0.24483	T	0.36	.	7.2685	0.26244	0.1096:0.1863:0.6173:0.0869	.	85	Q6UW15	REG3G_HUMAN	E	85	ENSP00000377475:G85E;ENSP00000272324:G85E	ENSP00000272324:G85E	G	+	2	0	REG3G	79107726	0.005000	0.15991	0.050000	0.19076	0.543000	0.35085	-0.653000	0.05360	-0.189000	0.10482	0.655000	0.94253	GGA	-	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin		0.552	REG3G-002	KNOWN	basic|appris_principal|CCDS	protein_coding	REG3G	protein_coding	OTTHUMT00000328247.1	G	NM_198448	-		79254218	+1	no_errors	ENST00000272324	ensembl	human	known	74_37	missense	SNP	0.040	A
SLC17A6	57084	genome.wustl.edu	37	11	22399270	22399270	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr11:22399270G>A	ENST00000263160.3	+	12	2170	c.1733G>A	c.(1732-1734)cGa>cAa	p.R578Q		NM_020346.2	NP_065079.1	Q9P2U8	VGLU2_HUMAN	solute carrier family 17 (vesicular glutamate transporter), member 6	578					ion transport (GO:0006811)|neurotransmitter uptake (GO:0001504)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|synaptic vesicle membrane (GO:0030672)	L-glutamate transmembrane transporter activity (GO:0005313)|symporter activity (GO:0015293)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(28)|ovary(3)|skin(4)|upper_aerodigestive_tract(3)	50						TATAAGGACCGAGTTGATTAT	0.353																																																	0								ENSG00000091664						36.0	37.0	37.0					11																	22399270		2203	4300	6503	SLC17A6	SO:0001583	missense	0			-	HGNC	AB032435	CCDS7856.1	11p14.3	2013-07-18	2013-07-18		ENSG00000091664	ENSG00000091664		"""Solute carriers"""	16703	protein-coding gene	gene with protein product	"""vesicular glutamate transporter 2"", ""differentiation-associated Na-dependent inorganic phosphate cotransporter"""	607563	"""solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 6"""			11306821	Standard	NM_020346		Approved	DNPI, VGLUT2	uc001mqk.3	Q9P2U8	OTTHUMG00000166063	ENST00000263160.3:c.1733G>A	11.37:g.22399270G>A	ENSP00000263160:p.Arg578Gln	Somatic	0	26	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	20	20.00	A6NKS2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.R578Q	ENST00000263160.3	37	c.1733	CCDS7856.1	11	.	.	.	.	.	.	.	.	.	.	G	6.032	0.374216	0.11409	.	.	ENSG00000091664	ENST00000263160;ENST00000546171	T	0.60672	0.17	5.85	1.94	0.25998	.	0.594351	0.17503	N	0.171907	T	0.34308	0.0893	N	0.19112	0.55	0.25321	N	0.989117	B	0.02656	0.0	B	0.04013	0.001	T	0.18023	-1.0350	10	0.14252	T	0.57	.	5.7573	0.18180	0.2981:0.1457:0.5562:0.0	.	578	Q9P2U8	VGLU2_HUMAN	Q	578;466	ENSP00000263160:R578Q	ENSP00000263160:R578Q	R	+	2	0	SLC17A6	22355846	0.990000	0.36364	0.987000	0.45799	0.794000	0.44872	0.380000	0.20602	0.109000	0.17891	-0.993000	0.02533	CGA	-	NULL		0.353	SLC17A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC17A6	protein_coding	OTTHUMT00000387671.1	G	NM_020346	-		22399270	+1	no_errors	ENST00000263160	ensembl	human	known	74_37	missense	SNP	0.998	A
SEPT1	1731	genome.wustl.edu	37	16	30392489	30392489	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr16:30392489C>T	ENST00000571393.1	-	7	703	c.517G>A	c.(517-519)Gat>Aat	p.D173N	SEPT1_ENST00000605106.1_Missense_Mutation_p.D178N|SEPT1_ENST00000321367.3_Missense_Mutation_p.D220N|SEPT1_ENST00000570039.1_5'Flank			Q8WYJ6	SEPT1_HUMAN	septin 1	173	Septin-type G.				cell cycle (GO:0007049)|cell division (GO:0051301)	septin complex (GO:0031105)	GTP binding (GO:0005525)			breast(2)|endometrium(1)|large_intestine(3)|lung(15)|ovary(1)|skin(1)|urinary_tract(1)	24			Colorectal(24;0.193)			ATCAGAGCATCCGCTTTGCCA	0.552																																																	0								ENSG00000180096						190.0	174.0	179.0					16																	30392489		2197	4300	6497	SEPT1	SO:0001583	missense	0			-	HGNC	AF308288	CCDS10678.1, CCDS10678.2, CCDS10678.3	16p11.2	2013-01-21		2001-09-10	ENSG00000180096	ENSG00000180096	3.1.5.1	"""Septins"""	2879	protein-coding gene	gene with protein product		612897		DIFF6		8697812	Standard	NM_052838		Approved	PNUTL3	uc002dxy.4	Q8WYJ6	OTTHUMG00000176984	ENST00000571393.1:c.517G>A	16.37:g.30392489C>T	ENSP00000460441:p.Asp173Asn	Somatic	0	46	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	70	17.65	B4DVE6|Q658T1|Q8NEZ1|Q96EL4|Q9H285	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cell_div_GTP-bd,pfam_Ribosome_biogen_GTPase_RsgA,superfamily_P-loop_NTPase,pirsf_Septin	p.D220N	ENST00000571393.1	37	c.658		16	.	.	.	.	.	.	.	.	.	.	C	33	5.209959	0.95069	.	.	ENSG00000180096	ENST00000321367	.	.	.	5.93	5.93	0.95920	.	0.000000	0.64402	D	0.000003	D	0.87617	0.6222	H	0.94423	3.535	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.90164	0.4230	9	0.87932	D	0	.	19.1152	0.93336	0.0:1.0:0.0:0.0	.	173	Q8WYJ6	SEPT1_HUMAN	N	173	.	ENSP00000324511:D173N	D	-	1	0	SEPT1	30299990	1.000000	0.71417	0.997000	0.53966	0.816000	0.46133	7.818000	0.86416	2.815000	0.96918	0.561000	0.74099	GAT	-	pfam_Cell_div_GTP-bd,superfamily_P-loop_NTPase,pirsf_Septin		0.552	SEPT1-201	KNOWN	basic	protein_coding	SEPT1	protein_coding		C	NM_052838	-		30392489	-1	no_errors	ENST00000321367	ensembl	human	known	74_37	missense	SNP	1.000	T
TNFRSF8	943	genome.wustl.edu	37	1	12183373	12183373	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr1:12183373C>T	ENST00000263932.2	+	9	1201	c.979C>T	c.(979-981)Cca>Tca	p.P327S	TNFRSF8_ENST00000417814.2_Missense_Mutation_p.P216S|TNFRSF8_ENST00000413146.2_5'Flank	NM_001243.3|NM_001281430.1	NP_001234.2|NP_001268359.1	P28908	TNR8_HUMAN	tumor necrosis factor receptor superfamily, member 8	327					cellular response to mechanical stimulus (GO:0071260)|negative regulation of cell proliferation (GO:0008285)|positive regulation of apoptotic process (GO:0043065)|positive regulation of TRAIL biosynthetic process (GO:0045556)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(12)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	27	Ovarian(185;0.249)	Lung NSC(185;8.71e-05)|all_lung(284;9.89e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.66e-06)|COAD - Colon adenocarcinoma(227;0.000261)|BRCA - Breast invasive adenocarcinoma(304;0.000304)|Kidney(185;0.000777)|KIRC - Kidney renal clear cell carcinoma(229;0.00261)|STAD - Stomach adenocarcinoma(313;0.0073)|READ - Rectum adenocarcinoma(331;0.0649)	Brentuximab vedotin(DB08870)	CTTTGAGGCGCCACCCCTGGG	0.617																																																	0								ENSG00000120949						32.0	33.0	33.0					1																	12183373		2203	4300	6503	TNFRSF8	SO:0001583	missense	0			-	HGNC	M83554	CCDS144.1, CCDS59989.1	1p36	2008-02-05			ENSG00000120949	ENSG00000120949		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11923	protein-coding gene	gene with protein product		153243		CD30, D1S166E		1330892, 1310894	Standard	XM_006711049		Approved	KI-1	uc001atq.3	P28908	OTTHUMG00000001827	ENST00000263932.2:c.979C>T	1.37:g.12183373C>T	ENSP00000263932:p.Pro327Ser	Somatic	1	161	0.61		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	160	11.60	B1AN79|B9EGD9|D3YTD8|Q6P4D9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TNFR/NGFR_Cys_rich_reg,smart_TNFR/NGFR_Cys_rich_reg,pfscan_TNFR/NGFR_Cys_rich_reg,prints_TNFR_8	p.P327S	ENST00000263932.2	37	c.979	CCDS144.1	1	.	.	.	.	.	.	.	.	.	.	C	14.43	2.532268	0.45073	.	.	ENSG00000120949	ENST00000263932;ENST00000417814	T;T	0.27104	1.69;1.69	3.0	3.0	0.34707	.	61.967200	0.00166	N	0.000000	T	0.39886	0.1095	L	0.47190	1.495	0.09310	N	1	D;P	0.76494	0.999;0.82	P;B	0.59761	0.863;0.427	T	0.35425	-0.9789	10	0.14252	T	0.57	-1.6098	9.7261	0.40333	0.0:1.0:0.0:0.0	.	216;327	D3YTD8;P28908	.;TNR8_HUMAN	S	327;216	ENSP00000263932:P327S;ENSP00000390650:P216S	ENSP00000263932:P327S	P	+	1	0	TNFRSF8	12105960	0.001000	0.12720	0.004000	0.12327	0.002000	0.02628	1.004000	0.29822	2.009000	0.58944	0.561000	0.74099	CCA	-	NULL		0.617	TNFRSF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFRSF8	protein_coding	OTTHUMT00000005130.1	C		-		12183373	+1	no_errors	ENST00000263932	ensembl	human	known	74_37	missense	SNP	0.004	T
GPRIN1	114787	genome.wustl.edu	37	5	176025456	176025456	+	Silent	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr5:176025456G>A	ENST00000303991.4	-	2	1557	c.1380C>T	c.(1378-1380)tcC>tcT	p.S460S		NM_052899.2	NP_443131.2	Q7Z2K8	GRIN1_HUMAN	G protein regulated inducer of neurite outgrowth 1	460					neuron projection development (GO:0031175)	cell projection (GO:0042995)|plasma membrane (GO:0005886)				NS(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(3)|liver(1)|lung(15)|ovary(2)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	all_cancers(89;0.00263)|Renal(175;0.000269)|Lung NSC(126;0.00902)|all_lung(126;0.0142)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CCCTTCTGGAGGACACCGGGT	0.517																																																	0								ENSG00000169258						90.0	100.0	97.0					5																	176025456		2203	4300	6503	GPRIN1	SO:0001819	synonymous_variant	0			-	HGNC	AB067480	CCDS4405.1	5q35.2	2008-02-05			ENSG00000169258	ENSG00000169258			24835	protein-coding gene	gene with protein product		611239				11572484	Standard	NM_052899		Approved	GRIN1, KIAA1893	uc003meo.1	Q7Z2K8	OTTHUMG00000130659	ENST00000303991.4:c.1380C>T	5.37:g.176025456G>A		Somatic	0	24	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	29	12.12	C9JM70|Q8ND74|Q96PZ4	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.S460	ENST00000303991.4	37	c.1380	CCDS4405.1	5																																																																																			-	NULL		0.517	GPRIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPRIN1	protein_coding	OTTHUMT00000253149.1	G	NM_052899	-		176025456	-1	no_errors	ENST00000303991	ensembl	human	known	74_37	silent	SNP	0.000	A
LOXL4	84171	genome.wustl.edu	37	10	100022501	100022501	+	Splice_Site	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr10:100022501C>T	ENST00000260702.3	-	2	426	c.276G>A	c.(274-276)gaG>gaA	p.E92E		NM_032211.6	NP_115587.6	Q96JB6	LOXL4_HUMAN	lysyl oxidase-like 4	92	SRCR 1. {ECO:0000255|PROSITE- ProRule:PRU00196}.					extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|receptor complex (GO:0043235)	copper ion binding (GO:0005507)|protein-lysine 6-oxidase activity (GO:0004720)|scavenger receptor activity (GO:0005044)			breast(1)|endometrium(6)|kidney(1)|large_intestine(3)|lung(8)|ovary(4)|prostate(1)|skin(2)	26		Colorectal(252;0.234)		Epithelial(162;2.14e-11)|all cancers(201;2.49e-09)		GTCACTCACCCTCCCCTTGGC	0.582											OREG0020428	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000138131						78.0	77.0	77.0					10																	100022501		2202	4296	6498	LOXL4	SO:0001630	splice_region_variant	0			-	HGNC	AF338441	CCDS7473.1	10q24	2008-08-01			ENSG00000138131	ENSG00000138131			17171	protein-coding gene	gene with protein product		607318				11292829	Standard	XM_005270216		Approved	FLJ21889, LOXC	uc001kpa.1	Q96JB6	OTTHUMG00000018874	ENST00000260702.3:c.277+1G>A	10.37:g.100022501C>T		Somatic	0	89	0.00	1348	0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	105	16.00	Q5W0B3|Q96DY1|Q96PC0|Q9H6T5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Lysyl_oxidase,pfam_SRCR,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_SRCR,prints_Lysyl_oxidase,prints_SRCR	p.E92	ENST00000260702.3	37	c.276	CCDS7473.1	10																																																																																			-	pfam_SRCR,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_SRCR		0.582	LOXL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOXL4	protein_coding	OTTHUMT00000049766.1	C	NM_032211	-	Silent	100022501	-1	no_errors	ENST00000260702	ensembl	human	known	74_37	silent	SNP	0.997	T
SDK1	221935	genome.wustl.edu	37	7	4304978	4304978	+	Missense_Mutation	SNP	G	G	C			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr7:4304978G>C	ENST00000404826.2	+	45	6743	c.6604G>C	c.(6604-6606)Gcg>Ccg	p.A2202P	SDK1_ENST00000389531.3_Missense_Mutation_p.A2182P|SDK1_ENST00000466611.1_3'UTR	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	2202					cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		TGGCCCCGGCGCGCGAACTCC	0.692																																																	0								ENSG00000146555						4.0	4.0	4.0					7																	4304978		1895	3821	5716	SDK1	SO:0001583	missense	0			-	HGNC	AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.6604G>C	7.37:g.4304978G>C	ENSP00000385899:p.Ala2202Pro	Somatic	0	55	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	54	21.74	Q8TEN9|Q8TEP5|Q96N44	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.A2202P	ENST00000404826.2	37	c.6604	CCDS34590.1	7	.	.	.	.	.	.	.	.	.	.	G	12.85	2.062858	0.36373	.	.	ENSG00000146555	ENST00000404826;ENST00000446104;ENST00000389531	T;T	0.61859	0.07;0.09	4.49	1.24	0.21308	.	0.372941	0.24933	N	0.034458	T	0.49592	0.1566	L	0.36672	1.1	0.30645	N	0.756032	D;P;P	0.54397	0.966;0.946;0.622	P;P;B	0.51453	0.67;0.521;0.208	T	0.53272	-0.8462	10	0.87932	D	0	.	3.7189	0.08449	0.2311:0.0:0.4242:0.3447	.	2182;262;2202	F8W6X9;Q7Z5N4-2;Q7Z5N4	.;.;SDK1_HUMAN	P	2202;450;2182	ENSP00000385899:A2202P;ENSP00000374182:A2182P	ENSP00000374182:A2182P	A	+	1	0	SDK1	4271504	1.000000	0.71417	0.983000	0.44433	0.515000	0.34225	0.627000	0.24506	0.347000	0.23924	0.456000	0.33151	GCG	-	NULL		0.692	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SDK1	protein_coding	OTTHUMT00000323702.1	G	NM_152744	-		4304978	+1	no_errors	ENST00000404826	ensembl	human	known	74_37	missense	SNP	1.000	C
IL2RB	3560	genome.wustl.edu	37	22	37532306	37532306	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr22:37532306G>A	ENST00000216223.5	-	7	863	c.665C>T	c.(664-666)cCc>cTc	p.P222L	AL022314.1_ENST00000516333.1_RNA	NM_000878.3	NP_000869.1	P14784	IL2RB_HUMAN	interleukin 2 receptor, beta	222	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cytokine-mediated signaling pathway (GO:0019221)|interleukin-2-mediated signaling pathway (GO:0038110)|negative regulation of apoptotic process (GO:0043066)|protein complex assembly (GO:0006461)|signal transduction (GO:0007165)|viral process (GO:0016032)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	interleukin-2 binding (GO:0019976)|interleukin-2 receptor activity (GO:0004911)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)|skin(5)	23					Aldesleukin(DB00041)|Basiliximab(DB00074)|Daclizumab(DB00111)|Denileukin diftitox(DB00004)	CTGGCTCCAGGGGCTCCAGGT	0.647																																																	0								ENSG00000100385						26.0	28.0	28.0					22																	37532306		2203	4300	6503	IL2RB	SO:0001583	missense	0			-	HGNC	M26062	CCDS13942.1	22q13	2011-02-15			ENSG00000100385	ENSG00000100385		"""Interleukins and interleukin receptors"", ""CD molecules"""	6009	protein-coding gene	gene with protein product		146710	"""interleukin 15 receptor, beta"""	IL15RB			Standard	NM_000878		Approved	CD122	uc003aqv.1	P14784	OTTHUMG00000150534	ENST00000216223.5:c.665C>T	22.37:g.37532306G>A	ENSP00000216223:p.Pro222Leu	Somatic	0	106	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	32	110	22.54	B2R765	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.P222L	ENST00000216223.5	37	c.665	CCDS13942.1	22	.	.	.	.	.	.	.	.	.	.	G	12.59	1.982155	0.34942	.	.	ENSG00000100385	ENST00000216223	D	0.96334	-3.98	4.5	2.35	0.29111	Short hematopoietin receptor, family 1, conserved site (1);Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.374117	0.27000	N	0.021440	D	0.91576	0.7339	L	0.43152	1.355	0.48452	D	0.999656	D	0.53745	0.962	B	0.40009	0.316	D	0.88223	0.2898	10	0.59425	D	0.04	-19.3523	4.7807	0.13201	0.1038:0.0:0.511:0.3852	.	222	P14784	IL2RB_HUMAN	L	222	ENSP00000216223:P222L	ENSP00000216223:P222L	P	-	2	0	IL2RB	35862252	1.000000	0.71417	1.000000	0.80357	0.710000	0.40934	2.102000	0.41796	0.858000	0.35431	0.462000	0.41574	CCC	-	superfamily_Fibronectin_type3,pfscan_Fibronectin_type3		0.647	IL2RB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL2RB	protein_coding	OTTHUMT00000318792.1	G		-		37532306	-1	no_errors	ENST00000216223	ensembl	human	known	74_37	missense	SNP	1.000	A
OR10K1	391109	genome.wustl.edu	37	1	158435387	158435387	+	Silent	SNP	C	C	T	rs200159566	byFrequency	TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr1:158435387C>T	ENST00000289451.2	+	1	116	c.36C>T	c.(34-36)ttC>ttT	p.F12F		NM_001004473.1	NP_001004473.1	Q8NGX5	O10K1_HUMAN	olfactory receptor, family 10, subfamily K, member 1	12						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	27	all_hematologic(112;0.0378)					TGAGAGAGTTCGTCGTCCTCG	0.512													C|||	2	0.000399361	0.0	0.0014	5008	,	,		19245	0.0		0.0	False		,,,				2504	0.001																0								ENSG00000173285						97.0	85.0	89.0					1																	158435387		2203	4300	6503	OR10K1	SO:0001819	synonymous_variant	0			GMAF=0.0005	HGNC	AP002532	CCDS30897.1	1q23.1	2012-08-09			ENSG00000173285	ENSG00000173285		"""GPCR / Class A : Olfactory receptors"""	14693	protein-coding gene	gene with protein product							Standard	NM_001004473		Approved		uc010pij.2	Q8NGX5	OTTHUMG00000017517	ENST00000289451.2:c.36C>T	1.37:g.158435387C>T		Somatic	0	58	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	75	9.52	Q6IFS2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.F12	ENST00000289451.2	37	c.36	CCDS30897.1	1																																																																																			-	NULL		0.512	OR10K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10K1	protein_coding	OTTHUMT00000046367.1	C		rs200159566		158435387	+1	no_errors	ENST00000289451	ensembl	human	known	74_37	silent	SNP	0.858	T
CDH12	1010	genome.wustl.edu	37	5	22142502	22142502	+	Intron	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr5:22142502G>A	ENST00000382254.1	-	5	901				CDH12_ENST00000522262.1_Intron|RP11-855C21.1_ENST00000524042.1_RNA|CDH12_ENST00000504376.2_Intron|PMCHL1_ENST00000418902.1_RNA	NM_004061.3	NP_004052.2	P55289	CAD12_HUMAN	cadherin 12, type 2 (N-cadherin 2)						adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(19)|lung(75)|ovary(2)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	120						AAAAACCAAAGAAAAAACATA	0.403										HNSCC(59;0.17)																																							0								ENSG00000168967																																			PMCHL1	SO:0001627	intron_variant	0			-	HGNC	L33477	CCDS3890.1	5p14.3	2010-01-26			ENSG00000154162	ENSG00000154162		"""Cadherins / Major cadherins"""	1751	protein-coding gene	gene with protein product		600562				7731968	Standard	NM_004061		Approved	Br-cadherin, CDHB	uc003jgk.2	P55289	OTTHUMG00000090591	ENST00000382254.1:c.186-63531C>T	5.37:g.22142502G>A		Somatic	0	59	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	63	16.00	B2RBT1|B7Z2U6|Q86UD2	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000382254.1	37	NULL	CCDS3890.1	5																																																																																			-	-		0.403	CDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PMCHL1	protein_coding	OTTHUMT00000207139.1	G	NM_004061	-		22142502	+1	no_errors	ENST00000418902	ensembl	human	known	74_37	rna	SNP	0.030	A
C9	735	genome.wustl.edu	37	5	39315915	39315915	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr5:39315915C>T	ENST00000263408.4	-	6	927	c.832G>A	c.(832-834)Gaa>Aaa	p.E278K	C9_ENST00000509186.1_5'UTR	NM_001737.3	NP_001728.1	P02748	CO9_HUMAN	complement component 9	278	MACPF. {ECO:0000255|PROSITE- ProRule:PRU00745}.				complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|hemolysis by symbiont of host erythrocytes (GO:0019836)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane attack complex (GO:0005579)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(17)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	32	all_lung(31;0.000197)	all_neural(839;7.57e-10)|Lung NSC(810;2.62e-08)|Ovarian(839;0.00384)|Breast(839;0.0184)|Myeloproliferative disorder(839;0.0511)	Epithelial(62;0.158)			TGGTAAGTTTCATTTTTGGAA	0.338																																																	0								ENSG00000113600						68.0	69.0	69.0					5																	39315915		2203	4300	6503	C9	SO:0001583	missense	0			-	HGNC		CCDS3929.1	5p14-p12	2014-09-17			ENSG00000113600	ENSG00000113600		"""Complement system"""	1358	protein-coding gene	gene with protein product		120940					Standard	NM_001737		Approved		uc003jlv.4	P02748	OTTHUMG00000094767	ENST00000263408.4:c.832G>A	5.37:g.39315915C>T	ENSP00000263408:p.Glu278Lys	Somatic	0	39	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	57	12.31		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MACPF,pfam_LDrepeatLR_classA_rpt,pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,superfamily_LDrepeatLR_classA_rpt,smart_Thrombospondin_1_rpt,smart_LDrepeatLR_classA_rpt,smart_MACPF,prints_MAC_perforin,pfscan_LDrepeatLR_classA_rpt,pfscan_Thrombospondin_1_rpt	p.E278K	ENST00000263408.4	37	c.832	CCDS3929.1	5	.	.	.	.	.	.	.	.	.	.	C	12.02	1.812765	0.32053	.	.	ENSG00000113600	ENST00000263408	D	0.83914	-1.78	4.57	0.367	0.16140	Membrane attack complex component/perforin (MACPF) domain (2);	0.903874	0.09510	N	0.792392	T	0.68869	0.3048	L	0.38531	1.155	0.09310	N	1	B	0.21071	0.051	B	0.19946	0.027	T	0.50923	-0.8770	10	0.07644	T	0.81	-21.4696	4.5591	0.12151	0.0:0.3904:0.1614:0.4482	.	278	P02748	CO9_HUMAN	K	278	ENSP00000263408:E278K	ENSP00000263408:E278K	E	-	1	0	C9	39351672	0.000000	0.05858	0.030000	0.17652	0.471000	0.32888	0.082000	0.14847	0.231000	0.21079	0.655000	0.94253	GAA	-	pfam_MACPF		0.338	C9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C9	protein_coding	OTTHUMT00000211576.3	C		-		39315915	-1	no_errors	ENST00000263408	ensembl	human	known	74_37	missense	SNP	0.011	T
DLGAP3	58512	genome.wustl.edu	37	1	35370254	35370254	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr1:35370254C>T	ENST00000373347.1	-	3	999	c.731G>A	c.(730-732)aGc>aAc	p.S244N	DLGAP3_ENST00000495979.1_5'Flank|DLGAP3_ENST00000235180.4_Missense_Mutation_p.S244N			O95886	DLGP3_HUMAN	discs, large (Drosophila) homolog-associated protein 3	244					cell-cell signaling (GO:0007267)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)	beta-amyloid binding (GO:0001540)			central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(23)|ovary(4)|prostate(3)|skin(3)|urinary_tract(1)	46		Myeloproliferative disorder(586;0.0393)				GCGGTCCTTGCTCTTGCTCCT	0.657																																																	0								ENSG00000116544						124.0	107.0	113.0					1																	35370254		2203	4300	6503	DLGAP3	SO:0001583	missense	0			-	HGNC	AF131778	CCDS30670.1	1p35.3-p34.1	2008-02-05			ENSG00000116544	ENSG00000116544			30368	protein-coding gene	gene with protein product		611413				8619474, 9110174	Standard	NM_001080418		Approved	SAPAP3, DAP3	uc001byc.3	O95886	OTTHUMG00000004049	ENST00000373347.1:c.731G>A	1.37:g.35370254C>T	ENSP00000362444:p.Ser244Asn	Somatic	0	63	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	65	20.73	Q5TDD5|Q9H3X7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GKAP	p.S244N	ENST00000373347.1	37	c.731	CCDS30670.1	1	.	.	.	.	.	.	.	.	.	.	C	23.0	4.358488	0.82243	.	.	ENSG00000116544	ENST00000373347;ENST00000235180	T;T	0.36157	1.27;1.27	4.85	4.85	0.62838	.	0.094445	0.64402	D	0.000001	T	0.59689	0.2212	M	0.66439	2.03	0.80722	D	1	D	0.63880	0.993	D	0.72982	0.979	T	0.62676	-0.6804	10	0.59425	D	0.04	-14.8034	18.335	0.90285	0.0:1.0:0.0:0.0	.	244	O95886	DLGP3_HUMAN	N	244	ENSP00000362444:S244N;ENSP00000235180:S244N	ENSP00000235180:S244N	S	-	2	0	DLGAP3	35142841	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.931000	0.70113	2.409000	0.81822	0.655000	0.94253	AGC	-	NULL		0.657	DLGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DLGAP3	protein_coding	OTTHUMT00000011554.1	C	NM_021234	-		35370254	-1	no_errors	ENST00000235180	ensembl	human	known	74_37	missense	SNP	1.000	T
ETNK2	55224	genome.wustl.edu	37	1	204115825	204115825	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr1:204115825G>A	ENST00000367202.4	-	3	736	c.586C>T	c.(586-588)Ctc>Ttc	p.L196F	ETNK2_ENST00000367201.3_Missense_Mutation_p.L196F|ETNK2_ENST00000367198.2_Missense_Mutation_p.L18F|ETNK2_ENST00000367199.2_Intron	NM_018208.2	NP_060678.2	Q9NVF9	EKI2_HUMAN	ethanolamine kinase 2	196					glycerophospholipid biosynthetic process (GO:0046474)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|placenta development (GO:0001890)|post-embryonic development (GO:0009791)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|ethanolamine kinase activity (GO:0004305)			breast(1)|central_nervous_system(1)|large_intestine(4)|ovary(1)	7	all_cancers(21;0.032)|Breast(84;0.116)|all_epithelial(62;0.196)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.109)			TTGTGCCAGAGGATGGGCTTG	0.493																																																	0								ENSG00000143845						181.0	154.0	163.0					1																	204115825		2203	4300	6503	ETNK2	SO:0001583	missense	0			-	HGNC	AK001623	CCDS1442.2, CCDS73006.1	1q32.1	2008-02-05			ENSG00000143845	ENSG00000143845			25575	protein-coding gene	gene with protein product		609859				12477932	Standard	XM_005245302		Approved	FLJ10761, EKI2	uc001hao.4	Q9NVF9	OTTHUMG00000036061	ENST00000367202.4:c.586C>T	1.37:g.204115825G>A	ENSP00000356170:p.Leu196Phe	Somatic	0	35	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	41	18.00	B7Z7K1|Q5SXX5|Q68CK3|Q96G05	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Aminoglycoside_PTrfase,superfamily_Kinase-like_dom	p.L196F	ENST00000367202.4	37	c.586	CCDS1442.2	1	.	.	.	.	.	.	.	.	.	.	G	28.0	4.885259	0.91814	.	.	ENSG00000143845	ENST00000367201;ENST00000367202;ENST00000455266;ENST00000367198;ENST00000422699;ENST00000452983	T;T;T;T;T	0.59638	0.25;0.25;0.25;0.25;0.25	5.34	5.34	0.76211	Protein kinase-like domain (1);Choline/ethanolamine kinase (1);	0.124581	0.56097	D	0.000030	T	0.78799	0.4340	M	0.85710	2.77	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.77557	0.99;0.984	T	0.81378	-0.0960	10	0.66056	D	0.02	-13.2836	16.9799	0.86324	0.0:0.0:1.0:0.0	.	196;196	Q9NVF9;Q9NVF9-2	EKI2_HUMAN;.	F	196;196;62;18;62;53	ENSP00000356169:L196F;ENSP00000356170:L196F;ENSP00000356166:L18F;ENSP00000405497:L62F;ENSP00000398091:L53F	ENSP00000356166:L18F	L	-	1	0	ETNK2	202382448	1.000000	0.71417	0.963000	0.40424	0.991000	0.79684	6.727000	0.74764	2.781000	0.95711	0.655000	0.94253	CTC	-	pfam_Aminoglycoside_PTrfase,superfamily_Kinase-like_dom		0.493	ETNK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ETNK2	protein_coding	OTTHUMT00000087893.1	G	NM_018208	-		204115825	-1	no_errors	ENST00000367201	ensembl	human	known	74_37	missense	SNP	0.999	A
LINC00661	126536	genome.wustl.edu	37	19	16136399	16136399	+	RNA	SNP	T	T	C			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr19:16136399T>C	ENST00000549354.2	+	0	1469					NR_026828.1				long intergenic non-protein coding RNA 661																		ACCGGGGCCCTGAAACCCGGC	0.577											OREG0025325	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000205396																																			LINC00661			0			-	HGNC	AI184190, CR749400		19p13.12	2012-10-12			ENSG00000205396	ENSG00000205396		"""Long non-coding RNAs"""	27002	non-coding RNA	RNA, long non-coding						12477932	Standard	NR_026828		Approved		uc002nbw.2		OTTHUMG00000169715		19.37:g.16136399T>C		Somatic	0	73	0.00	708	0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	64	28.09		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000549354.2	37	NULL		19																																																																																			-	-		0.577	LINC00661-001	KNOWN	basic	lincRNA	LINC00661	processed_transcript	OTTHUMT00000405577.4	T	NR_026828	-		16136399	+1	no_errors	ENST00000549354	ensembl	human	known	74_37	rna	SNP	0.072	C
ADCY1	107	genome.wustl.edu	37	7	45697426	45697426	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr7:45697426G>A	ENST00000297323.7	+	6	1271	c.1249G>A	c.(1249-1251)Gac>Aac	p.D417N	ADCY1_ENST00000432715.1_Missense_Mutation_p.D192N	NM_021116.2	NP_066939.1	Q08828	ADCY1_HUMAN	adenylate cyclase 1 (brain)	417					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|axonogenesis (GO:0007409)|cellular response to glucagon stimulus (GO:0071377)|circadian rhythm (GO:0007623)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of circadian rhythm (GO:0042752)|response to drug (GO:0042493)|response to lithium ion (GO:0010226)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(14)|lung(33)|ovary(4)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	71					Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	GTGGCAGTACGACGTGTGGTC	0.617																																																	0								ENSG00000164742						117.0	85.0	96.0					7																	45697426		2203	4300	6503	ADCY1	SO:0001583	missense	0			-	HGNC	L05500	CCDS34631.1, CCDS75593.1	7p13-p12	2013-02-04			ENSG00000164742	ENSG00000164742	4.6.1.1	"""Adenylate cyclases"""	232	protein-coding gene	gene with protein product		103072				8314585	Standard	NM_021116		Approved	AC1	uc003tne.4	Q08828	OTTHUMG00000155420	ENST00000297323.7:c.1249G>A	7.37:g.45697426G>A	ENSP00000297323:p.Asp417Asn	Somatic	0	68	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	84	15.15	A4D2L8|Q75MI1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_A/G_cyclase,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	p.D417N	ENST00000297323.7	37	c.1249	CCDS34631.1	7	.	.	.	.	.	.	.	.	.	.	G	25.0	4.592770	0.86953	.	.	ENSG00000164742	ENST00000432715;ENST00000297323;ENST00000545300	D;D	0.85411	-1.98;-1.98	4.44	4.44	0.53790	Adenylyl cyclase class-3/4/guanylyl cyclase, conserved site (1);Adenylyl cyclase class-3/4/guanylyl cyclase (5);	0.000000	0.85682	D	0.000000	D	0.95686	0.8597	H	0.99211	4.47	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.996;1.0	D	0.97292	0.9925	10	0.87932	D	0	.	14.9371	0.70964	0.0:0.0:1.0:0.0	.	417;192	Q08828;C9J1J0	ADCY1_HUMAN;.	N	192;417;417	ENSP00000392721:D192N;ENSP00000297323:D417N	ENSP00000297323:D417N	D	+	1	0	ADCY1	45663951	1.000000	0.71417	0.102000	0.21198	0.728000	0.41692	8.926000	0.92839	2.446000	0.82766	0.655000	0.94253	GAC	-	pfam_A/G_cyclase,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase		0.617	ADCY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY1	protein_coding	OTTHUMT00000340055.2	G	NM_021116	-		45697426	+1	no_errors	ENST00000297323	ensembl	human	known	74_37	missense	SNP	0.998	A
RAB4A	5867	genome.wustl.edu	37	1	229422292	229422292	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr1:229422292C>T	ENST00000366690.4	+	2	299	c.91C>T	c.(91-93)Cat>Tat	p.H31Y	RAB4A_ENST00000473894.1_Intron	NM_004578.2	NP_004569.2	P20338	RAB4A_HUMAN	RAB4A, member RAS oncogene family	31					antigen processing and presentation (GO:0019882)|GTP catabolic process (GO:0006184)|membrane organization (GO:0061024)|regulation of endocytosis (GO:0030100)|small GTPase mediated signal transduction (GO:0007264)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|vesicle (GO:0031982)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|protein transporter activity (GO:0008565)			central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)|skin(1)	11	Breast(184;0.0858)|Ovarian(103;0.103)	Prostate(94;0.178)				TTGCTTACTTCATCAGTTTAT	0.323																																					Esophageal Squamous(11;250 603 9619 16563)												0								ENSG00000168118						94.0	92.0	92.0					1																	229422292		2202	4300	6502	RAB4A	SO:0001583	missense	0			-	HGNC	BC004309	CCDS31050.1, CCDS73046.1	1q42-q43	2014-04-03		2002-02-28	ENSG00000168118	ENSG00000168118		"""RAB, member RAS oncogene"""	9781	protein-coding gene	gene with protein product		179511		RAB4			Standard	NM_004578		Approved	HRES-1/RAB4	uc001hth.4	P20338	OTTHUMG00000037627	ENST00000366690.4:c.91C>T	1.37:g.229422292C>T	ENSP00000355651:p.His31Tyr	Somatic	0	38	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	62	12.68	Q5T7P7|Q9BQ44	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_EF_GTP-bd_dom,pfam_Gtr1_RagA,superfamily_P-loop_NTPase,smart_Small_GTPase_ARF,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.H31Y	ENST00000366690.4	37	c.91	CCDS31050.1	1	.	.	.	.	.	.	.	.	.	.	C	17.26	3.344568	0.61073	.	.	ENSG00000168118	ENST00000366690	T	0.79352	-1.26	5.24	5.24	0.73138	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	T	0.74114	0.3674	L	0.31476	0.935	0.80722	D	1	B	0.25743	0.133	B	0.36378	0.223	T	0.69072	-0.5242	10	0.38643	T	0.18	.	19.3787	0.94523	0.0:1.0:0.0:0.0	.	26	P20338	RAB4A_HUMAN	Y	31	ENSP00000355651:H31Y	ENSP00000355651:H31Y	H	+	1	0	RAB4A	227488915	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.062000	0.76706	2.884000	0.98904	0.655000	0.94253	CAT	-	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_EF_GTP-bd_dom,pfam_Gtr1_RagA,superfamily_P-loop_NTPase,smart_Small_GTPase_ARF,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom		0.323	RAB4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB4A	protein_coding	OTTHUMT00000091727.3	C	NM_004578	-		229422292	+1	no_errors	ENST00000366690	ensembl	human	known	74_37	missense	SNP	1.000	T
PTMAP5	150928	genome.wustl.edu	37	13	82264599	82264599	+	RNA	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr13:82264599C>T	ENST00000607242.1	+	0	554									prothymosin, alpha pseudogene 5																		CCCTCCACTTCCCGTCTCAGA	0.522																																																	0								ENSG00000214182																																			PTMAP5			0			-	HGNC	S38627		13q13.1	2008-11-06	2008-04-03		ENSG00000214182	ENSG00000214182			9628	pseudogene	pseudogene	"""gene sequence 150"""		"""prothymosin, alpha pseudogene 5 (gene sequence 150)"""			1612591	Standard	NG_004798		Approved				OTTHUMG00000017147		13.37:g.82264599C>T		Somatic	0	41	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	45	21.05		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000607242.1	37	NULL		13																																																																																			-	-		0.522	PTMAP5-002	KNOWN	basic	processed_transcript	PTMAP5	pseudogene	OTTHUMT00000470311.1	C		-		82264599	+1	no_errors	ENST00000607242	ensembl	human	known	74_37	rna	SNP	1.000	T
TCL6	27004	genome.wustl.edu	37	14	96129896	96129896	+	RNA	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr14:96129896C>T	ENST00000467865.1	+	0	304				RP11-1070N10.6_ENST00000461160.1_RNA					T-cell leukemia/lymphoma 6 (non-protein coding)											large_intestine(1)|lung(7)	8		all_cancers(154;0.103)		Epithelial(152;0.0655)|all cancers(159;0.149)|BRCA - Breast invasive adenocarcinoma(234;0.206)|COAD - Colon adenocarcinoma(157;0.207)		TATCTCAGTTCACCTTCCAGC	0.537			T	TRA@	T-ALL																																			Dom	yes		14	14q32.1	27004	T-cell leukemia/lymphoma 6		L	0								ENSG00000187621						138.0	114.0	122.0					14																	96129896		2203	4300	6503	TCL6			0			-	HGNC	AB035338		14q32.1	2012-10-16	2010-06-01		ENSG00000187621	ENSG00000187621		"""Long non-coding RNAs"""	13463	non-coding RNA	RNA, long non-coding		604412	"""T-cell leukemia/lymphoma 6"""			10588720, 10851082	Standard	NR_028288		Approved	TCL6e1, TNG2, TNG1	uc001yev.2		OTTHUMG00000149979		14.37:g.96129896C>T		Somatic	0	74	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	84	22.94		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000467865.1	37	NULL		14																																																																																			-	-		0.537	TCL6-009	KNOWN	basic	lincRNA	TCL6	processed_transcript	OTTHUMT00000315133.1	C	NM_012468	-		96129896	+1	no_errors	ENST00000352367	ensembl	human	known	74_37	rna	SNP	0.001	T
ULK1	8408	genome.wustl.edu	37	12	132402037	132402037	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr12:132402037C>T	ENST00000321867.4	+	22	2615	c.2264C>T	c.(2263-2265)aCc>aTc	p.T755I	ULK1_ENST00000540647.1_5'Flank	NM_003565.2	NP_003556	O75385	ULK1_HUMAN	unc-51 like autophagy activating kinase 1	755					autophagic vacuole assembly (GO:0000045)|axon extension (GO:0048675)|cellular response to nutrient levels (GO:0031669)|cerebellar granule cell differentiation (GO:0021707)|negative regulation of collateral sprouting (GO:0048671)|neuron projection development (GO:0031175)|neuron projection regeneration (GO:0031102)|positive regulation of autophagy (GO:0010508)|positive regulation of macroautophagy (GO:0016239)|protein autophosphorylation (GO:0046777)|protein localization (GO:0008104)|protein phosphorylation (GO:0006468)|radial glia guided migration of cerebellar granule cell (GO:0021933)|Ras protein signal transduction (GO:0007265)|receptor internalization (GO:0031623)|regulation of autophagy (GO:0010506)|regulation of neurotrophin TRK receptor signaling pathway (GO:0051386)|response to starvation (GO:0042594)	ATG1/UKL1 signaling complex (GO:0034273)|autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|extrinsic component of autophagic vacuole membrane (GO:0097635)|extrinsic component of omegasome membrane (GO:0097629)|extrinsic component of pre-autophagosomal structure membrane (GO:0097632)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|pre-autophagosomal structure membrane (GO:0034045)|ULK1-ATG13-FIP200 complex (GO:0070969)	ATP binding (GO:0005524)|protein complex binding (GO:0032403)|protein serine/threonine kinase activity (GO:0004674)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(11)|ovary(1)|prostate(2)|skin(2)|urinary_tract(2)	29	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.07e-08)|Epithelial(86;2.56e-07)|all cancers(50;3.01e-07)		GTGGTCTTCACCGTGGGCTCT	0.697																																																	0								ENSG00000177169						10.0	14.0	12.0					12																	132402037		2162	4270	6432	ULK1	SO:0001583	missense	0			-	HGNC	AF045458	CCDS9274.1	12q24.3	2014-02-12	2013-07-02		ENSG00000177169	ENSG00000177169			12558	protein-coding gene	gene with protein product	"""ATG1 autophagy related 1 homolog (S. cerevisiae)"""	603168	"""unc-51 (C. elegans)-like kinase 1"", ""unc-51-like kinase 1 (C. elegans)"""			9693035	Standard	NM_003565		Approved	ATG1, ATG1A	uc001uje.3	O75385	OTTHUMG00000168052	ENST00000321867.4:c.2264C>T	12.37:g.132402037C>T	ENSP00000324560:p.Thr755Ile	Somatic	0	74	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	86	12.24	Q9UQ28	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ser/Thr_kinase_C,pfam_LipoPS_kinase,pfam_RIO-like_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Ser/Thr_kin_STPK_Ulk-1/2,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.T755I	ENST00000321867.4	37	c.2264	CCDS9274.1	12	.	.	.	.	.	.	.	.	.	.	c	20.6	4.014811	0.75161	.	.	ENSG00000177169	ENST00000321867;ENST00000541761	T;T	0.56941	0.43;0.43	4.65	4.65	0.58169	.	0.000000	0.85682	D	0.000000	T	0.73768	0.3629	M	0.78049	2.395	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.77635	-0.2514	10	0.59425	D	0.04	-47.7772	17.8905	0.88870	0.0:1.0:0.0:0.0	.	755	O75385	ULK1_HUMAN	I	755;103	ENSP00000324560:T755I;ENSP00000444298:T103I	ENSP00000324560:T755I	T	+	2	0	ULK1	130967990	1.000000	0.71417	0.703000	0.30354	0.432000	0.31715	7.308000	0.78929	2.277000	0.76020	0.424000	0.28305	ACC	-	pirsf_Ser/Thr_kin_STPK_Ulk-1/2		0.697	ULK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ULK1	protein_coding	OTTHUMT00000397769.3	C		-		132402037	+1	no_errors	ENST00000321867	ensembl	human	known	74_37	missense	SNP	1.000	T
RP11-553A10.1	0	genome.wustl.edu	37	3	110612126	110612126	+	Silent	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr3:110612126C>T	ENST00000383686.2	-	1	197	c.84G>A	c.(82-84)agG>agA	p.R28R	PVRL3-AS1_ENST00000474769.1_RNA|PVRL3-AS1_ENST00000476301.1_RNA																							TCTCCTTCCTCCTTCTTTTTG	0.483																																																	0								ENSG00000206532																																			RP11-553A10.1	SO:0001819	synonymous_variant	0			-	Clone_based_vega_gene																												ENST00000383686.2:c.84G>A	3.37:g.110612126C>T		Somatic	0	99	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	33	99	25.00		Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.R28	ENST00000383686.2	37	c.84		3																																																																																			-	NULL		0.483	RP11-553A10.1-001	KNOWN	basic|appris_principal	protein_coding	ENSG00000206532	protein_coding	OTTHUMT00000354057.1	C		-		110612126	-1	no_errors	ENST00000383686	ensembl	human	known	74_37	silent	SNP	0.004	T
RELA	5970	genome.wustl.edu	37	11	65429171	65429171	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr11:65429171G>A	ENST00000406246.3	-	4	583	c.322C>T	c.(322-324)Cgc>Tgc	p.R108C	RELA_ENST00000525693.1_Missense_Mutation_p.R108C|RELA_ENST00000308639.9_Missense_Mutation_p.R108C	NM_001243984.1|NM_001243985.1|NM_021975.3	NP_001230913.1|NP_001230914.1|NP_068810.3	Q04206	TF65_HUMAN	v-rel avian reticuloendotheliosis viral oncogene homolog A	108	RHD. {ECO:0000255|PROSITE- ProRule:PRU00265}.				acetaldehyde metabolic process (GO:0006117)|aging (GO:0007568)|cellular defense response (GO:0006968)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to interleukin-1 (GO:0071347)|cellular response to interleukin-6 (GO:0071354)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to nicotine (GO:0071316)|cellular response to peptide hormone stimulus (GO:0071375)|cellular response to tumor necrosis factor (GO:0071356)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|Fc-epsilon receptor signaling pathway (GO:0038095)|hair follicle development (GO:0001942)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|liver development (GO:0001889)|membrane protein intracellular domain proteolysis (GO:0031293)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070431)|organ morphogenesis (GO:0009887)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of miRNA metabolic process (GO:2000630)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of Schwann cell differentiation (GO:0014040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|regulation of inflammatory response (GO:0050727)|response to amino acid (GO:0043200)|response to cAMP (GO:0051591)|response to cobalamin (GO:0033590)|response to drug (GO:0042493)|response to insulin (GO:0032868)|response to interleukin-1 (GO:0070555)|response to mechanical stimulus (GO:0009612)|response to morphine (GO:0043278)|response to muramyl dipeptide (GO:0032495)|response to organic substance (GO:0010033)|response to progesterone (GO:0032570)|response to UV-B (GO:0010224)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|NF-kappaB binding (GO:0051059)|phosphate ion binding (GO:0042301)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|repressing transcription factor binding (GO:0070491)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(11)|ovary(1)|urinary_tract(1)	19						TGGATGCAGCGGTCCGGGCAG	0.622																																																	0								ENSG00000173039						66.0	61.0	62.0					11																	65429171		2201	4297	6498	RELA	SO:0001583	missense	0			-	HGNC	Z22951	CCDS31609.1, CCDS44651.1, CCDS73322.1	11q13	2013-07-09	2013-07-09		ENSG00000173039	ENSG00000173039			9955	protein-coding gene	gene with protein product		164014	"""nuclear factor of kappa light polypeptide gene enhancer in B-cells 3"""	NFKB3		2001591	Standard	NM_021975		Approved	p65	uc001ofg.3	Q04206	OTTHUMG00000166566	ENST00000406246.3:c.322C>T	11.37:g.65429171G>A	ENSP00000384273:p.Arg108Cys	Somatic	0	51	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	42	20.75	Q6GTV1|Q6SLK1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RHD,superfamily_p53-like_TF_DNA-bd,superfamily_Ig_E-set,smart_IPT,pfscan_RHD,prints_NF_Rel_Dor	p.R108C	ENST00000406246.3	37	c.322	CCDS31609.1	11	.	.	.	.	.	.	.	.	.	.	G	22.2	4.253308	0.80135	.	.	ENSG00000173039	ENST00000406246;ENST00000525693;ENST00000308639;ENST00000426617;ENST00000545816;ENST00000532999;ENST00000534558;ENST00000527749;ENST00000532879;ENST00000533187;ENST00000527874	T;T;T;T;T;T;T;T;T	0.46451	0.87;0.87;0.87;0.87;0.87;0.87;0.87;0.87;0.87	5.45	5.45	0.79879	Rel homology (3);p53-like transcription factor, DNA-binding (1);	0.051448	0.85682	D	0.000000	T	0.67915	0.2944	M	0.85373	2.75	0.58432	D	0.999997	D;D;D;D;D;D	0.89917	0.997;0.999;0.999;0.999;1.0;0.999	P;P;P;P;D;D	0.66716	0.834;0.782;0.782;0.861;0.946;0.92	T	0.73506	-0.3961	10	0.87932	D	0	-21.0697	16.7753	0.85549	0.0:0.0:1.0:0.0	.	108;95;108;108;119;108	Q04206-3;Q04206-2;Q04206-4;Q04206;B4E082;Q2TAM5	.;.;.;TF65_HUMAN;.;.	C	108;108;108;108;119;119;99;77;108;77;77	ENSP00000384273:R108C;ENSP00000432537:R108C;ENSP00000311508:R108C;ENSP00000433526:R119C;ENSP00000434372:R99C;ENSP00000436545:R77C;ENSP00000431153:R108C;ENSP00000434098:R77C;ENSP00000435531:R77C	ENSP00000311508:R108C	R	-	1	0	RELA	65185747	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	5.470000	0.66756	2.571000	0.86741	0.555000	0.69702	CGC	-	pfam_RHD,superfamily_p53-like_TF_DNA-bd,pfscan_RHD		0.622	RELA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RELA	protein_coding	OTTHUMT00000390457.2	G	NM_021975	-		65429171	-1	no_errors	ENST00000406246	ensembl	human	known	74_37	missense	SNP	1.000	A
GOLGA8UP	100507067	genome.wustl.edu	37	15	31093559	31093559	+	RNA	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr15:31093559G>A	ENST00000408452.1	+	0	51				RN7SL82P_ENST00000463782.2_RNA																							CCGTCGGAGGGGCCCCAGCGT	0.592																																																	0								ENSG00000221379																																			AC004460.1			0			-	Clone_based_ensembl_gene																													15.37:g.31093559G>A		Somatic	0	169	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	37	186	16.59		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000408452.1	37	NULL		15																																																																																			-	-		0.592	AC004460.1-201	NOVEL	basic	miRNA	ENSG00000221379	miRNA		G		-		31093559	+1	no_errors	ENST00000408452	ensembl	human	novel	74_37	rna	SNP	0.735	A
SLC10A6	345274	genome.wustl.edu	37	4	87744874	87744874	+	Silent	SNP	G	G	A	rs569333477		TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr4:87744874G>A	ENST00000273905.6	-	6	1248	c.1101C>T	c.(1099-1101)ctC>ctT	p.L367L	SLC10A6_ENST00000505535.1_5'Flank	NM_197965.2	NP_932069.1	Q3KNW5	SOAT_HUMAN	solute carrier family 10 (sodium/bile acid cotransporter), member 6	367					sodium-dependent organic anion transport (GO:0043251)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bile acid:sodium symporter activity (GO:0008508)|sodium-dependent organic anion transmembrane transporter activity (GO:0043250)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(3)	9		Acute lymphoblastic leukemia(40;0.244)|all_hematologic(202;0.248)		OV - Ovarian serous cystadenocarcinoma(123;0.00099)		CAACTGGCTCGAGAGCCCTGT	0.542																																																	0								ENSG00000145283						112.0	94.0	100.0					4																	87744874		2203	4300	6503	SLC10A6	SO:0001819	synonymous_variant	0			-	HGNC	AJ583502	CCDS3614.1	4q22.1	2013-07-18	2013-07-18		ENSG00000145283	ENSG00000145283		"""Solute carriers"""	30603	protein-coding gene	gene with protein product		613366				15020217, 17491011	Standard	NM_197965		Approved	SOAT	uc003hqd.2	Q3KNW5	OTTHUMG00000130596	ENST00000273905.6:c.1101C>T	4.37:g.87744874G>A		Somatic	0	47	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	69	18.82	Q70EX7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_BilAc/Na_symport,tigrfam_Bil_ac_transpt	p.L367	ENST00000273905.6	37	c.1101	CCDS3614.1	4																																																																																			-	NULL		0.542	SLC10A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC10A6	protein_coding	OTTHUMT00000253043.2	G	NM_197965	-		87744874	-1	no_errors	ENST00000273905	ensembl	human	known	74_37	silent	SNP	0.000	A
ABCF3	55324	genome.wustl.edu	37	3	183909015	183909015	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr3:183909015C>T	ENST00000429586.2	+	16	1726	c.1541C>T	c.(1540-1542)tCt>tTt	p.S514F	EIF2B5_ENST00000444495.1_Intron|ABCF3_ENST00000292808.5_Missense_Mutation_p.S508F	NM_018358.2	NP_060828.2	Q9NUQ8	ABCF3_HUMAN	ATP-binding cassette, sub-family F (GCN20), member 3	514	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				defense response to virus (GO:0051607)	membrane (GO:0016020)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(2)|cervix(1)|endometrium(2)|large_intestine(5)|lung(20)|ovary(3)|prostate(5)|upper_aerodigestive_tract(1)	39	all_cancers(143;1.12e-10)|Ovarian(172;0.0339)		Epithelial(37;2.35e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			CTCTCTGTGTCTGCTGATCTC	0.532																																																	0								ENSG00000161204						197.0	170.0	179.0					3																	183909015		2203	4300	6503	ABCF3	SO:0001583	missense	0			-	HGNC	U66685	CCDS3254.1	3q27.1	2012-05-16			ENSG00000161204	ENSG00000161204		"""ATP binding cassette transporters / subfamily F"""	72	protein-coding gene	gene with protein product						8894702	Standard	NM_018358		Approved	EST201864	uc003fmz.2	Q9NUQ8	OTTHUMG00000156824	ENST00000429586.2:c.1541C>T	3.37:g.183909015C>T	ENSP00000411471:p.Ser514Phe	Somatic	0	55	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	94	17.54	A8K241|Q86UA2|Q8NAN1|Q96GS8|Q9H7A8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.S514F	ENST00000429586.2	37	c.1541	CCDS3254.1	3	.	.	.	.	.	.	.	.	.	.	C	28.8	4.951016	0.92660	.	.	ENSG00000161204	ENST00000429586;ENST00000292808	T;T	0.81415	-1.49;-1.49	5.93	5.93	0.95920	ABC transporter-like (1);	0.000000	0.85682	D	0.000000	D	0.89420	0.6710	M	0.70787	2.145	0.80722	D	1	D;D	0.69078	0.997;0.988	D;P	0.70487	0.969;0.805	D	0.89592	0.3828	10	0.87932	D	0	-13.9017	19.3249	0.94258	0.0:1.0:0.0:0.0	.	508;514	Q9NUQ8-2;Q9NUQ8	.;ABCF3_HUMAN	F	514;508	ENSP00000411471:S514F;ENSP00000292808:S508F	ENSP00000292808:S508F	S	+	2	0	ABCF3	185391709	1.000000	0.71417	1.000000	0.80357	0.915000	0.54546	5.779000	0.68948	2.805000	0.96524	0.655000	0.94253	TCT	-	superfamily_P-loop_NTPase,pfscan_ABC_transporter-like		0.532	ABCF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCF3	protein_coding	OTTHUMT00000346047.1	C	NM_018358	-		183909015	+1	no_errors	ENST00000429586	ensembl	human	known	74_37	missense	SNP	1.000	T
KHSRP	8570	genome.wustl.edu	37	19	6416548	6416548	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr19:6416548G>A	ENST00000398148.3	-	14	1533	c.1441C>T	c.(1441-1443)Ccc>Tcc	p.P481S	MIR3940_ENST00000579148.1_RNA	NM_003685.2	NP_003676.2	Q92945	FUBP2_HUMAN	KH-type splicing regulatory protein	481	Gly-rich.|KH 4. {ECO:0000255|PROSITE- ProRule:PRU00117}.				gene expression (GO:0010467)|mRNA catabolic process (GO:0006402)|mRNA metabolic process (GO:0016071)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|regulation of miRNA metabolic process (GO:2000628)|regulation of transcription, DNA-templated (GO:0006355)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|transcription, DNA-templated (GO:0006351)	cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(3)|liver(1)|lung(6)|skin(1)|soft_tissue(1)	17						ATCTGCTGGGGTGAACCCCGG	0.592																																					Colon(55;593 1006 2067 9135 22980)												0								ENSG00000088247						39.0	42.0	41.0					19																	6416548		1897	4119	6016	KHSRP	SO:0001583	missense	0			-	HGNC	U94832	CCDS45936.1	19p13.3	2010-11-23	2008-02-04		ENSG00000088247	ENSG00000088247			6316	protein-coding gene	gene with protein product	"""FUSE binding protein 2"""	603445				9136930, 8940189	Standard	NM_003685		Approved	KSRP, FBP2, FUBP2	uc002mer.4	Q92945		ENST00000398148.3:c.1441C>T	19.37:g.6416548G>A	ENSP00000381216:p.Pro481Ser	Somatic	0	62	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	73	24.74	O00301|Q59EZ9|Q5U4P6|Q9UNT5|Q9UQH5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_KH_dom_type_1,pfam_KH_dom_type_2,pfam_DUF1897,smart_KH_dom,pfscan_KH_dom_type_1	p.P481S	ENST00000398148.3	37	c.1441	CCDS45936.1	19	.	.	.	.	.	.	.	.	.	.	G	20.6	4.023094	0.75275	.	.	ENSG00000088247	ENST00000398148;ENST00000201886	T	0.35048	1.33	5.21	5.21	0.72293	K Homology (1);K Homology, type 1, subgroup (1);K Homology, type 1 (1);	0.051547	0.85682	D	0.000000	T	0.54481	0.1861	L	0.48935	1.535	0.80722	D	1	D	0.71674	0.998	D	0.77557	0.99	T	0.54323	-0.8311	10	0.54805	T	0.06	.	17.5431	0.87853	0.0:0.0:1.0:0.0	.	481	Q92945	FUBP2_HUMAN	S	481	ENSP00000381216:P481S	ENSP00000201886:P481S	P	-	1	0	KHSRP	6367548	1.000000	0.71417	0.959000	0.39883	0.984000	0.73092	9.531000	0.98054	2.425000	0.82216	0.655000	0.94253	CCC	-	pfam_KH_dom_type_1,smart_KH_dom,pfscan_KH_dom_type_1		0.592	KHSRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KHSRP	protein_coding	OTTHUMT00000453305.1	G		-		6416548	-1	no_errors	ENST00000398148	ensembl	human	known	74_37	missense	SNP	1.000	A
LRRC23	10233	genome.wustl.edu	37	12	6994123	6994123	+	Intron	SNP	C	C	T	rs567517826		TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr12:6994123C>T	ENST00000433346.1	+	2	429				DSTNP2_ENST00000602547.1_RNA|RPL13P5_ENST00000412023.1_RNA|SPSB2_ENST00000437851.1_Intron|LRRC23_ENST00000449039.1_Intron			Q53EV4	LRC23_HUMAN	leucine rich repeat containing 23											NS(1)|breast(1)|endometrium(2)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)|stomach(1)	13						CATGAGAGTTCGTAAATGCTC	0.423													C|||	1	0.000199681	0.0	0.0	5008	,	,		-128	0.0		0.0	False		,,,				2504	0.001																0								ENSG00000248593																																			DSTNP2	SO:0001627	intron_variant	0			-	HGNC	BC014450	CCDS8568.1, CCDS8569.1	12p13	2006-02-02			ENSG00000010626	ENSG00000010626			19138	protein-coding gene	gene with protein product						11830501, 11826754	Standard	NM_201650		Approved	B7, LRPB7	uc001qrp.3	Q53EV4	OTTHUMG00000156668	ENST00000433346.1:c.-50+1040C>T	12.37:g.6994123C>T		Somatic	0	36	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70	A8K8C6|D3DUT1|Q8N6K6|Q92977|Q99620	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000433346.1	37	NULL		12																																																																																			-	-		0.423	LRRC23-011	PUTATIVE	basic	protein_coding	DSTNP2	protein_coding	OTTHUMT00000345224.1	C	NM_006992	-		6994123	+1	no_errors	ENST00000602547	ensembl	human	known	74_37	rna	SNP	0.765	T
SEC31B	25956	genome.wustl.edu	37	10	102275970	102275970	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr10:102275970G>A	ENST00000370345.3	-	3	183	c.86C>T	c.(85-87)tCt>tTt	p.S29F	SEC31B_ENST00000451524.1_Missense_Mutation_p.S29F|SEC31B_ENST00000535773.1_5'UTR|SEC31B_ENST00000370329.5_Missense_Mutation_p.S29F|NDUFB8_ENST00000531258.1_3'UTR|NDUFB8_ENST00000557395.1_3'UTR	NM_015490.3	NP_056305.1	Q9NQW1	SC31B_HUMAN	SEC31 homolog B (S. cerevisiae)	29					protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|vesicle coat (GO:0030120)				NS(1)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(3)|lung(17)|ovary(1)|urinary_tract(1)	36		Colorectal(252;0.117)		Epithelial(162;2.36e-10)|all cancers(201;2.09e-08)		CTGTTGGGCAGATGTTCCTAG	0.428																																																	0								ENSG00000075826						88.0	81.0	84.0					10																	102275970		2203	4300	6503	SEC31B	SO:0001583	missense	0			-	HGNC	AF274863	CCDS7495.1	10q24.32	2013-01-10	2006-10-05	2006-09-07	ENSG00000075826	ENSG00000075826		"""WD repeat domain containing"""	23197	protein-coding gene	gene with protein product		610258	"""SEC31-like 2 (S. cerevisiae)"""	SEC31L2		16495487	Standard	NM_015490		Approved	SEC31B-1, DKFZP434M183	uc001krc.1	Q9NQW1	OTTHUMG00000019342	ENST00000370345.3:c.86C>T	10.37:g.102275970G>A	ENSP00000359370:p.Ser29Phe	Somatic	0	46	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	38	15.56	B7ZM75|Q6MZS3|Q86UF0|Q9Y4Q8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.S29F	ENST00000370345.3	37	c.86	CCDS7495.1	10	.	.	.	.	.	.	.	.	.	.	G	18.91	3.724102	0.68959	.	.	ENSG00000075826	ENST00000370345;ENST00000451524;ENST00000370329	T;T;T	0.58358	0.65;0.34;0.45	5.89	4.98	0.66077	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.278705	0.41938	D	0.000794	T	0.71871	0.3391	M	0.75264	2.295	0.80722	D	1	B;P;B;B	0.35774	0.017;0.519;0.007;0.384	B;P;B;P	0.56127	0.017;0.792;0.007;0.625	T	0.74737	-0.3564	10	0.87932	D	0	-9.5841	15.571	0.76337	0.0:0.0:0.8612:0.1388	.	29;29;29;29	B4DGE3;Q9NQW1-5;E9PKR7;Q9NQW1	.;.;.;SC31B_HUMAN	F	29	ENSP00000359370:S29F;ENSP00000391178:S29F;ENSP00000359354:S29F	ENSP00000359354:S29F	S	-	2	0	SEC31B	102265960	1.000000	0.71417	1.000000	0.80357	0.732000	0.41865	9.790000	0.99075	1.492000	0.48499	-0.324000	0.08512	TCT	-	superfamily_WD40_repeat_dom		0.428	SEC31B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC31B	protein_coding	OTTHUMT00000051198.1	G	NM_015490	-		102275970	-1	no_errors	ENST00000370345	ensembl	human	known	74_37	missense	SNP	1.000	A
CSMD2	114784	genome.wustl.edu	37	1	34058088	34058088	+	Splice_Site	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr1:34058088C>T	ENST00000373380.1	-	24	3697	c.3477G>A	c.(3475-3477)ggG>ggA	p.G1159G	CSMD2_ENST00000373381.4_Intron			Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	2288	CUB 7. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				CTGCCAAGTGCCCTGAGGAGC	0.498																																																	0								ENSG00000121904																																			CSMD2	SO:0001630	splice_region_variant	0			-	HGNC	AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373380.1:c.3476-1G>A	1.37:g.34058088C>T		Somatic	0	37	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	47	17.54	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_CUB_dom,pfam_Sushi_SCR_CCP,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.G1159	ENST00000373380.1	37	c.3477		1																																																																																			-	smart_CUB_dom,pfscan_CUB_dom		0.498	CSMD2-002	KNOWN	basic	protein_coding	CSMD2	protein_coding	OTTHUMT00000030635.4	C	NM_052896	-	Silent	34058088	-1	no_errors	ENST00000373380	ensembl	human	known	74_37	silent	SNP	0.013	T
TRIAP1	51499	genome.wustl.edu	37	12	120882635	120882635	+	3'UTR	SNP	A	A	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr12:120882635A>T	ENST00000546954.1	-	0	310				GATC_ENST00000551765.1_5'Flank|TRIAP1_ENST00000302432.3_5'UTR|AL021546.6_ENST00000551806.1_Intron	NM_016399.2	NP_057483.1	O43715	TRIA1_HUMAN	TP53 regulated inhibitor of apoptosis 1						cellular response to UV (GO:0034644)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|phospholipid transport (GO:0015914)|positive regulation of phospholipid transport (GO:2001140)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of membrane lipid distribution (GO:0097035)	mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)|protein complex (GO:0043234)	p53 binding (GO:0002039)					all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					AGAGTCCTCAATTTCTGGACT	0.413																																																	0								ENSG00000170855						138.0	141.0	140.0					12																	120882635		2203	4300	6503	TRIAP1	SO:0001624	3_prime_UTR_variant	0			-	HGNC		CCDS9198.1	12q24.31	2012-10-15			ENSG00000170855	ENSG00000170855			26937	protein-coding gene	gene with protein product	"""p53-inducible cell-survival factor"", ""mitochondrial distribution and morphology 35 homolog (S. cerevisiae)"""	614943				11042152, 15735003	Standard	NM_016399		Approved	P53CSV, WF-1, HSPC132, p53CSV, MDM35	uc001tyg.3	O43715	OTTHUMG00000047787	ENST00000546954.1:c.*40T>A	12.37:g.120882635A>T		Somatic	0	47	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	49	25.76	B2R4Z7|Q5RKS5|Q6LCA7	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000546954.1	37	NULL	CCDS9198.1	12																																																																																			-	-		0.413	TRIAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIAP1	protein_coding	OTTHUMT00000108980.3	A	NM_016399	-		120882635	-1	no_errors	ENST00000302432	ensembl	human	putative	74_37	rna	SNP	0.370	T
RAB11FIP4	84440	genome.wustl.edu	37	17	29844724	29844724	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr17:29844724C>T	ENST00000325874.8	+	4	621	c.392C>T	c.(391-393)cCc>cTc	p.P131L	RAB11FIP4_ENST00000394744.2_Missense_Mutation_p.P29L|RN7SL45P_ENST00000578050.1_RNA	NM_032932.3	NP_116321.2	Q86YS3	RFIP4_HUMAN	RAB11 family interacting protein 4 (class II)	131	Necessary for interaction with RAB11A, subcellular location, homo- or heterooligomerization.				cytokinesis (GO:0000910)|transport (GO:0006810)|viral process (GO:0016032)	cleavage furrow (GO:0032154)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|extracellular space (GO:0005615)|midbody (GO:0030496)|recycling endosome membrane (GO:0055038)	ADP-ribosylation factor binding (GO:0030306)|calcium ion binding (GO:0005509)|protein homodimerization activity (GO:0042803)|Rab GTPase binding (GO:0017137)			endometrium(2)|kidney(1)|large_intestine(5)|lung(3)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		all_cancers(10;3.62e-13)|all_epithelial(10;0.000387)|all_lung(9;0.0132)|Breast(31;0.014)|all_hematologic(16;0.015)|Myeloproliferative disorder(56;0.0255)|Acute lymphoblastic leukemia(14;0.0259)|Ovarian(249;0.0423)|Lung NSC(157;0.066)				CCCAGGGAACCCGGCTTTTTT	0.617																																																	0								ENSG00000131242						27.0	25.0	26.0					17																	29844724		2202	4298	6500	RAB11FIP4	SO:0001583	missense	0			-	HGNC	AB058724	CCDS11267.1	17q11.2	2013-01-10			ENSG00000131242	ENSG00000131242		"""EF-hand domain containing"""	30267	protein-coding gene	gene with protein product		611999				11347906, 11468690	Standard	NM_032932		Approved	RAB11-FIP4, KIAA1821, MGC11316, FLJ00131	uc002hgn.1	Q86YS3	OTTHUMG00000132787	ENST00000325874.8:c.392C>T	17.37:g.29844724C>T	ENSP00000312837:p.Pro131Leu	Somatic	0	64	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	69	20.69	Q52LI1|Q8N829|Q8NDT7|Q969D8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Rab-bd_FIP-RBD,pfscan_EF_hand_dom	p.P131L	ENST00000325874.8	37	c.392	CCDS11267.1	17	.	.	.	.	.	.	.	.	.	.	C	11.77	1.738692	0.30774	.	.	ENSG00000131242	ENST00000325874;ENST00000394744	.	.	.	5.54	5.54	0.83059	.	0.390489	0.26939	N	0.021732	T	0.37544	0.1007	L	0.34521	1.04	0.24412	N	0.994654	B;B	0.06786	0.001;0.001	B;B	0.06405	0.002;0.001	T	0.12604	-1.0541	8	.	.	.	-12.5249	14.9838	0.71330	0.0:1.0:0.0:0.0	.	29;131	Q86YS3-2;Q86YS3	.;RFIP4_HUMAN	L	131	.	.	P	+	2	0	RAB11FIP4	26868844	0.109000	0.22037	0.671000	0.29857	0.747000	0.42532	2.076000	0.41548	2.616000	0.88540	0.505000	0.49811	CCC	-	NULL		0.617	RAB11FIP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB11FIP4	protein_coding	OTTHUMT00000256195.2	C	NM_032932	-		29844724	+1	no_errors	ENST00000325874	ensembl	human	known	74_37	missense	SNP	0.313	T
MAGEB17	645864	genome.wustl.edu	37	X	16189228	16189228	+	Silent	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chrX:16189228G>A	ENST00000400004.2	+	2	1075	c.723G>A	c.(721-723)gaG>gaA	p.E241E	MAGEB17_ENST00000329538.5_Silent_p.E241E|RP11-431J24.2_ENST00000435789.1_RNA|MAGEB17_ENST00000400003.1_Silent_p.E241E	NM_001277307.1	NP_001264236.1	A8MXT2	MAGBH_HUMAN	melanoma antigen family B, 17	241	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.																TCTATGGGGAGCCCCAGGAGC	0.557																																																	0								ENSG00000182798																																			MAGEB17	SO:0001819	synonymous_variant	0			-	HGNC		CCDS59524.1	Xp22.2	2010-05-26	2005-11-07		ENSG00000182798	ENSG00000182798			17418	protein-coding gene	gene with protein product		300763	"""melanoma antigen family B, 17 (pseudogene)"""			11454705	Standard	NM_001277307		Approved		uc031tgu.1	A8MXT2	OTTHUMG00000021188	ENST00000400004.2:c.723G>A	X.37:g.16189228G>A		Somatic	0	23	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	24	29.41	A6NE98	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_MAGE,pfam_Melanoma_ass_antigen_N,pfscan_MAGE	p.E241	ENST00000400004.2	37	c.723	CCDS59524.1	X																																																																																			-	pfam_MAGE,pfscan_MAGE		0.557	MAGEB17-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEB17	protein_coding	OTTHUMT00000251018.2	G	XM_066701	-		16189228	+1	no_errors	ENST00000400003	ensembl	human	known	74_37	silent	SNP	0.811	A
OR5B2	390190	genome.wustl.edu	37	11	58190110	58190110	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr11:58190110G>A	ENST00000302581.2	-	1	676	c.625C>T	c.(625-627)Ctt>Ttt	p.L209F		NM_001005566.2	NP_001005566.1	Q96R09	OR5B2_HUMAN	olfactory receptor, family 5, subfamily B, member 2	209						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|large_intestine(2)|lung(19)|ovary(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32	Esophageal squamous(5;0.0027)	Breast(21;0.0778)				ATAACTAGAAGAACAAAAAAG	0.388																																																	0								ENSG00000172365						62.0	61.0	61.0					11																	58190110		2201	4295	6496	OR5B2	SO:0001583	missense	0			-	HGNC	AB065852	CCDS31550.1	11q12.1	2012-08-09			ENSG00000172365	ENSG00000172365		"""GPCR / Class A : Olfactory receptors"""	8323	protein-coding gene	gene with protein product							Standard	NM_001005566		Approved	OST073	uc010rkg.2	Q96R09	OTTHUMG00000167517	ENST00000302581.2:c.625C>T	11.37:g.58190110G>A	ENSP00000303076:p.Leu209Phe	Somatic	0	26	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	29	19.44	B2RNJ6|B9EGY7|Q6IEV7|Q8NGF5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L209F	ENST00000302581.2	37	c.625	CCDS31550.1	11	.	.	.	.	.	.	.	.	.	.	G	3.378	-0.127046	0.06795	.	.	ENSG00000172365	ENST00000302581	T	0.40476	1.03	3.73	2.71	0.32032	GPCR, rhodopsin-like superfamily (1);	0.269510	0.19656	U	0.109086	T	0.23766	0.0575	N	0.15975	0.35	0.09310	N	1	B	0.20368	0.044	B	0.32022	0.139	T	0.07751	-1.0756	10	0.44086	T	0.13	-13.5428	2.8595	0.05582	0.2152:0.0:0.5482:0.2366	.	209	Q96R09	OR5B2_HUMAN	F	209	ENSP00000303076:L209F	ENSP00000303076:L209F	L	-	1	0	OR5B2	57946686	0.000000	0.05858	0.762000	0.31397	0.043000	0.13939	-0.671000	0.05250	2.098000	0.63641	0.585000	0.79938	CTT	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.388	OR5B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5B2	protein_coding	OTTHUMT00000394887.2	G	NM_001005566	-		58190110	-1	no_errors	ENST00000302581	ensembl	human	known	74_37	missense	SNP	0.004	A
ZMYM3	9203	genome.wustl.edu	37	X	70462039	70462039	+	Silent	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chrX:70462039G>A	ENST00000353904.2	-	23	3970	c.3783C>T	c.(3781-3783)gtC>gtT	p.V1261V	ZMYM3_ENST00000373998.1_Silent_p.V1249V|ZMYM3_ENST00000314425.5_Silent_p.V1261V|ZMYM3_ENST00000373984.3_Intron|ZMYM3_ENST00000373988.1_Silent_p.V1263V|ZMYM3_ENST00000489332.1_5'UTR	NM_005096.3	NP_005087.1	Q14202	ZMYM3_HUMAN	zinc finger, MYM-type 3	1261					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(7)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(12)|lung(17)|ovary(1)|prostate(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	Renal(35;0.156)					TCCTCTGGCGGACTGGGGCAT	0.617																																																	0								ENSG00000147130						39.0	26.0	31.0					X																	70462039		2200	4295	6495	ZMYM3	SO:0001819	synonymous_variant	0			-	HGNC	AB002383	CCDS14409.1, CCDS55443.1, CCDS55444.1	Xq13.1	2013-01-08	2005-12-19	2005-12-19	ENSG00000147130	ENSG00000147130		"""Zinc fingers, MYM type"""	13054	protein-coding gene	gene with protein product		300061	"""zinc finger protein 261"""	ZNF261		10486218	Standard	NM_201599		Approved	ZNF198L2, DXS6673E, KIAA0385, MYM	uc004dzh.2	Q14202	OTTHUMG00000021799	ENST00000353904.2:c.3783C>T	X.37:g.70462039G>A		Somatic	0	58	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	45	36.62	D3DVV3|O15089|Q96E26	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_MYM,pfam_DUF3504,smart_TRASH_dom	p.V1263	ENST00000353904.2	37	c.3789	CCDS14409.1	X																																																																																			-	pfam_DUF3504		0.617	ZMYM3-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZMYM3	protein_coding	OTTHUMT00000057154.1	G	NM_201599	-		70462039	-1	no_errors	ENST00000373988	ensembl	human	known	74_37	silent	SNP	0.115	A
BEST2	54831	genome.wustl.edu	37	19	12867020	12867020	+	Nonsense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr19:12867020G>A	ENST00000549706.1	+	9	1338	c.1014G>A	c.(1012-1014)tgG>tgA	p.W338*	BEST2_ENST00000553030.1_Nonsense_Mutation_p.W338*|BEST2_ENST00000042931.1_Nonsense_Mutation_p.W338*			Q8NFU1	BEST2_HUMAN	bestrophin 2	338					chloride transmembrane transport (GO:1902476)|membrane depolarization (GO:0051899)|sensory perception of smell (GO:0007608)	chloride channel complex (GO:0034707)|cilium (GO:0005929)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)	p.W338C(1)		breast(3)|endometrium(1)|large_intestine(4)|lung(2)|ovary(1)|pancreas(1)	12						ACTTGTACTGGGATGCAGCCG	0.587																																																	1	Substitution - Missense(1)	breast(1)						ENSG00000039987						143.0	150.0	148.0					19																	12867020		2147	4248	6395	BEST2	SO:0001587	stop_gained	0			-	HGNC	AF440756	CCDS42506.1	19p13.13	2014-08-12	2006-10-18	2006-10-18	ENSG00000039987	ENSG00000039987		"""Ion channels / Chloride channels : Calcium activated : Bestrophins"""	17107	protein-coding gene	gene with protein product		607335	"""vitelliform macular dystrophy 2-like 1"""	VMD2L1		12032738, 16912113	Standard	NM_017682		Approved	FLJ20132	uc002mux.3	Q8NFU1	OTTHUMG00000169293	ENST00000549706.1:c.1014G>A	19.37:g.12867020G>A	ENSP00000448310:p.Trp338*	Somatic	0	36	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	38	17.39	Q53YQ8|Q9NXP0	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Bestrophin/UPF0187	p.W338*	ENST00000549706.1	37	c.1014	CCDS42506.1	19	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	37|37	6.201520|6.201520	0.97371|0.97371	.|.	.|.	ENSG00000039987|ENSG00000039987	ENST00000552539|ENST00000549706;ENST00000553030;ENST00000042931	.|.	.|.	.|.	4.03|4.03	4.03|4.03	0.46877|0.46877	.|.	.|0.000000	.|0.64402	.|D	.|0.000002	T|.	0.35098|.	0.0920|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.32455|.	-0.9906|.	3|.	.|0.02654	.|T	.|1	-6.7081|-6.7081	15.0879|15.0879	0.72170|0.72170	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	E|X	48|338	.|.	.|ENSP00000042931:W338X	G|W	+|+	2|3	0|0	BEST2|BEST2	12728020|12728020	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.278000|0.278000	0.26855|0.26855	7.577000|7.577000	0.82486|0.82486	2.086000|2.086000	0.62901|0.62901	0.491000|0.491000	0.48974|0.48974	GGG|TGG	-	NULL		0.587	BEST2-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	BEST2	protein_coding	OTTHUMT00000403343.1	G	NM_017682	-		12867020	+1	no_errors	ENST00000042931	ensembl	human	known	74_37	nonsense	SNP	1.000	A
ZNF702P	79986	genome.wustl.edu	37	19	53512688	53512688	+	lincRNA	SNP	G	G	A	rs549600577	byFrequency	TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr19:53512688G>A	ENST00000596769.1	+	0	315																											gcattgaaacgaaaaagattg	0.453																																																	0								ENSG00000267943																																			CTD-2620I22.3			0			-	Clone_based_vega_gene																													19.37:g.53512688G>A		Somatic	0	45	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	53	10.17		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000596769.1	37	NULL		19																																																																																			-	-		0.453	CTD-2620I22.3-001	KNOWN	basic	lincRNA	ENSG00000267943	lincRNA	OTTHUMT00000463993.1	G		-		53512688	+1	no_errors	ENST00000596769	ensembl	human	known	74_37	rna	SNP	0.595	A
ADAM7	8756	genome.wustl.edu	37	8	24364997	24364997	+	Missense_Mutation	SNP	C	C	T	rs80271195	byFrequency	TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr8:24364997C>T	ENST00000175238.6	+	21	2296	c.2213C>T	c.(2212-2214)cCt>cTt	p.P738L	RP11-624C23.1_ENST00000519689.1_RNA|RP11-624C23.1_ENST00000523578.1_RNA|ADAM7_ENST00000380789.1_Missense_Mutation_p.P760L|ADAM7_ENST00000520720.1_Intron|RP11-561E1.1_ENST00000519364.1_RNA	NM_003817.3	NP_003808.2	Q9H2U9	ADAM7_HUMAN	ADAM metallopeptidase domain 7	738						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|endometrium(5)|kidney(1)|large_intestine(17)|lung(24)|ovary(1)|skin(15)	64		Prostate(55;0.0181)		Colorectal(74;0.0199)|COAD - Colon adenocarcinoma(73;0.0754)|BRCA - Breast invasive adenocarcinoma(99;0.182)		TTATAGAAACCTGCAAGTAAA	0.398													C|||	5	0.000998403	0.003	0.0	5008	,	,		17297	0.0		0.001	False		,,,				2504	0.0																0								ENSG00000069206	C	LEU/PRO	8,4398	14.3+/-33.2	0,8,2195	81.0	87.0	85.0		2213	2.2	0.9	8	dbSNP_131	85	1,8599	1.2+/-3.3	0,1,4299	yes	missense	ADAM7	NM_003817.2	98	0,9,6494	TT,TC,CC		0.0116,0.1816,0.0692	probably-damaging	738/755	24364997	9,12997	2203	4300	6503	ADAM7	SO:0001583	missense	0			GMAF=0	HGNC	AF090327	CCDS6045.1	8p21.2	2005-08-18	2005-08-18		ENSG00000069206	ENSG00000069206		"""ADAM metallopeptidase domain containing"""	214	protein-coding gene	gene with protein product		607310	"""a disintegrin and metalloproteinase domain 7"""				Standard	NM_003817		Approved	GP-83, EAPI	uc003xeb.3	Q9H2U9	OTTHUMG00000097859	ENST00000175238.6:c.2213C>T	8.37:g.24364997C>T	ENSP00000175238:p.Pro738Leu	Somatic	0	41	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	49	15.52	A8K8X7|O75959|Q6PEJ6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_ADAM_Cys-rich,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_Peptidase_M12B,prints_Blood-coag_inhib_Disintegrin	p.P738L	ENST00000175238.6	37	c.2213	CCDS6045.1	8	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	C	14.43	2.534026	0.45073	0.001816	1.16E-4	ENSG00000069206	ENST00000175238;ENST00000380789	T;T	0.27720	1.65;1.65	4.08	2.21	0.28008	.	0.640100	0.13950	N	0.351583	T	0.25121	0.0610	L	0.51422	1.61	0.58432	D	0.999999	B	0.09022	0.002	B	0.06405	0.002	T	0.12502	-1.0545	10	0.72032	D	0.01	.	4.7721	0.13160	0.2128:0.6765:0.0:0.1107	.	738	Q9H2U9	ADAM7_HUMAN	L	738;760	ENSP00000175238:P738L;ENSP00000370166:P760L	ENSP00000175238:P738L	P	+	2	0	ADAM7	24420887	0.999000	0.42202	0.915000	0.36163	0.717000	0.41224	0.936000	0.28938	0.627000	0.30340	0.455000	0.32223	CCT	-	NULL		0.398	ADAM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM7	protein_coding	OTTHUMT00000215150.1	C	NM_003817	rs80271195		24364997	+1	no_errors	ENST00000175238	ensembl	human	known	74_37	missense	SNP	0.936	T
CEACAM4	1089	genome.wustl.edu	37	19	42125953	42125953	+	Intron	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr19:42125953C>T	ENST00000221954.2	-	6	780				CEACAM4_ENST00000600925.1_Silent_p.R251R	NM_001817.2	NP_001808.2	O75871	CEAM4_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 4							integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)				NS(1)|endometrium(1)|large_intestine(3)|lung(4)|prostate(3)|skin(3)|urinary_tract(1)	16						ACTGCATTTTCCTGAATCTGA	0.607																																																	0								ENSG00000105352																																			CEACAM4	SO:0001627	intron_variant	0			-	HGNC	D90276	CCDS33033.1	19q13.2	2013-01-11			ENSG00000105352	ENSG00000105352		"""Immunoglobulin superfamily / V-set domain containing"""	1816	protein-coding gene	gene with protein product				CGM7		2050678	Standard	XM_005258434		Approved		uc002orh.1	O75871	OTTHUMG00000151065	ENST00000221954.2:c.669+89G>A	19.37:g.42125953C>T		Somatic	0	39	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	71	15.48	Q03715|Q7LDZ7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_V-set,pfscan_Ig-like_dom	p.R251	ENST00000221954.2	37	c.753	CCDS33033.1	19																																																																																			-	NULL		0.607	CEACAM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEACAM4	protein_coding	OTTHUMT00000321148.1	C	NM_001817	-		42125953	-1	no_errors	ENST00000600925	ensembl	human	putative	74_37	silent	SNP	0.001	T
FBLN5	10516	genome.wustl.edu	37	14	92403475	92403475	+	Silent	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr14:92403475C>T	ENST00000342058.4	-	4	788	c.195G>A	c.(193-195)ggG>ggA	p.G65G	FBLN5_ENST00000556154.1_Silent_p.G70G|FBLN5_ENST00000267620.10_Silent_p.G106G	NM_006329.3	NP_006320.2	Q9UBX5	FBLN5_HUMAN	fibulin 5	65	EGF-like 1; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cell-matrix adhesion (GO:0007160)|elastic fiber assembly (GO:0048251)|extracellular matrix organization (GO:0030198)|protein localization to cell surface (GO:0034394)|regulation of cell growth (GO:0001558)|regulation of removal of superoxide radicals (GO:2000121)	elastic fiber (GO:0071953)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|protein C-terminus binding (GO:0008022)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(11)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)	28		all_cancers(154;0.0722)				TGCATAAATACCCGCCATTTT	0.552																																																	0								ENSG00000140092						93.0	85.0	87.0					14																	92403475		2203	4300	6503	FBLN5	SO:0001819	synonymous_variant	0			-	HGNC	AJ133490	CCDS9898.1	14q31	2014-09-17				ENSG00000140092		"""Fibulins"""	3602	protein-coding gene	gene with protein product		604580				10640802	Standard	NM_006329		Approved	EVEC, UP50, DANCE, ARMD3	uc001xzx.4	Q9UBX5		ENST00000342058.4:c.195G>A	14.37:g.92403475C>T		Somatic	0	57	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	77	13.48	O75966|Q6IAL4|Q6UWA3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_EGF-like_Ca-bd_dom,superfamily_TIL_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom	p.G65	ENST00000342058.4	37	c.195	CCDS9898.1	14																																																																																			-	pfam_EGF-like_Ca-bd_dom,smart_EGF-like_Ca-bd_dom		0.552	FBLN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBLN5	protein_coding	OTTHUMT00000411787.1	C		-		92403475	-1	no_errors	ENST00000342058	ensembl	human	known	74_37	silent	SNP	0.978	T
RNASEL	6041	genome.wustl.edu	37	1	182555704	182555704	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr1:182555704G>A	ENST00000367559.3	-	2	491	c.238C>T	c.(238-240)Cgt>Tgt	p.R80C	RNASEL_ENST00000539397.1_Missense_Mutation_p.R80C|RNASEL_ENST00000444138.1_Missense_Mutation_p.R80C	NM_021133.3	NP_066956.1	Q05823	RN5A_HUMAN	ribonuclease L (2',5'-oligoisoadenylate synthetase-dependent)	80					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|mRNA processing (GO:0006397)|negative regulation of viral genome replication (GO:0045071)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|rRNA processing (GO:0006364)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nuclear matrix (GO:0016363)	ATP binding (GO:0005524)|endoribonuclease activity (GO:0004521)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|RNA binding (GO:0003723)|rRNA binding (GO:0019843)			NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(9)|ovary(4)|prostate(1)|stomach(1)|urinary_tract(1)	27						GCACCATGACGAAGCAGAAGT	0.522																																																	0								ENSG00000135828						103.0	89.0	94.0					1																	182555704		2203	4300	6503	RNASEL	SO:0001583	missense	0			-	HGNC	L10381	CCDS1347.1	1q25	2013-01-10			ENSG00000135828	ENSG00000135828	3.1.26.-	"""Ankyrin repeat domain containing"""	10050	protein-coding gene	gene with protein product		180435	"""prostate cancer 1"""	RNS4, PRCA1		7514564	Standard	NM_021133		Approved		uc009wxz.2	Q05823	OTTHUMG00000035213	ENST00000367559.3:c.238C>T	1.37:g.182555704G>A	ENSP00000356530:p.Arg80Cys	Somatic	0	38	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	38	13.64	Q5W0L2|Q6AI46	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ankyrin_rpt,pfam_KEN_dom,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,superfamily_Ankyrin_rpt-contain_dom,superfamily_Kinase-like_dom,smart_Ankyrin_rpt,smart_Ser/Thr_dual-sp_kinase_dom,smart_PUG-dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Prot_kinase_dom,prints_Ankyrin_rpt	p.R80C	ENST00000367559.3	37	c.238	CCDS1347.1	1	.	.	.	.	.	.	.	.	.	.	G	13.21	2.170515	0.38315	.	.	ENSG00000135828	ENST00000367559;ENST00000444138;ENST00000539397	T;T;T	0.64991	-0.13;-0.13;-0.13	4.71	-5.89	0.02282	Ankyrin repeat-containing domain (3);	2.343740	0.01503	N	0.017597	T	0.59362	0.2188	M	0.68317	2.08	0.09310	N	1	B;B;B	0.21147	0.052;0.052;0.052	B;B;B	0.16289	0.015;0.009;0.015	T	0.55592	-0.8117	10	0.49607	T	0.09	2.9407	11.6386	0.51220	0.0:0.592:0.1355:0.2725	.	80;80;80	Q5W0L2;Q6AI46;Q05823	.;.;RN5A_HUMAN	C	80	ENSP00000356530:R80C;ENSP00000411147:R80C;ENSP00000440844:R80C	ENSP00000356530:R80C	R	-	1	0	RNASEL	180822327	0.000000	0.05858	0.000000	0.03702	0.021000	0.10359	-0.186000	0.09670	-0.550000	0.06183	0.467000	0.42956	CGT	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom		0.522	RNASEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNASEL	protein_coding	OTTHUMT00000085189.1	G	NM_021133	-		182555704	-1	no_errors	ENST00000367559	ensembl	human	known	74_37	missense	SNP	0.000	A
RP11-402P6.9	0	genome.wustl.edu	37	X	70884813	70884813	+	RNA	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chrX:70884813G>A	ENST00000422194.1	-	0	204																											CGGTGTGTGGGAAGCTAAAAC	0.557																																																	0								ENSG00000237265																																			RP11-402P6.9			0			-	Clone_based_vega_gene																													X.37:g.70884813G>A		Somatic	0	76	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	32	54	37.21		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000422194.1	37	NULL		X																																																																																			-	-		0.557	RP11-402P6.9-001	KNOWN	basic	lincRNA	ENSG00000237265	processed_transcript	OTTHUMT00000058987.1	G		-		70884813	-1	no_errors	ENST00000422194	ensembl	human	known	74_37	rna	SNP	0.018	A
ABCA1	19	genome.wustl.edu	37	9	107555470	107555470	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr9:107555470C>T	ENST00000374736.3	-	41	6012	c.5618G>A	c.(5617-5619)aGa>aAa	p.R1873K		NM_005502.3	NP_005493.2	O95477	ABCA1_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 1	1873					apolipoprotein A-I-mediated signaling pathway (GO:0038027)|cellular lipid metabolic process (GO:0044255)|cellular response to cholesterol (GO:0071397)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to retinoic acid (GO:0071300)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|endosomal transport (GO:0016197)|G-protein coupled receptor signaling pathway (GO:0007186)|high-density lipoprotein particle assembly (GO:0034380)|interleukin-1 beta secretion (GO:0050702)|intracellular cholesterol transport (GO:0032367)|lipoprotein metabolic process (GO:0042157)|lysosome organization (GO:0007040)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|peptide secretion (GO:0002790)|phagocytosis, engulfment (GO:0006911)|phospholipid efflux (GO:0033700)|phospholipid homeostasis (GO:0055091)|phospholipid translocation (GO:0045332)|platelet dense granule organization (GO:0060155)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cholesterol efflux (GO:0010875)|protein lipidation (GO:0006497)|regulation of Cdc42 protein signal transduction (GO:0032489)|response to drug (GO:0042493)|response to laminar fluid shear stress (GO:0034616)|response to low-density lipoprotein particle (GO:0055098)|response to nutrient (GO:0007584)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)	endocytic vesicle (GO:0030139)|external side of plasma membrane (GO:0009897)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	anion transmembrane transporter activity (GO:0008509)|apolipoprotein A-I binding (GO:0034186)|apolipoprotein A-I receptor activity (GO:0034188)|apolipoprotein binding (GO:0034185)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase binding (GO:0051117)|cholesterol binding (GO:0015485)|cholesterol transporter activity (GO:0017127)|phospholipid binding (GO:0005543)|phospholipid transporter activity (GO:0005548)|receptor binding (GO:0005102)|small GTPase binding (GO:0031267)|syntaxin binding (GO:0019905)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(31)|liver(1)|lung(40)|ovary(5)|pancreas(2)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	115				OV - Ovarian serous cystadenocarcinoma(323;0.023)	Adenosine triphosphate(DB00171)|Glyburide(DB01016)|Probucol(DB01599)	GATGAAGAATCTGTACTGGAT	0.527																																																	0								ENSG00000165029						137.0	126.0	130.0					9																	107555470		2203	4300	6503	ABCA1	SO:0001583	missense	0			-	HGNC	AJ012376	CCDS6762.1	9q31	2014-03-14			ENSG00000165029	ENSG00000165029		"""ATP binding cassette transporters / subfamily A"""	29	protein-coding gene	gene with protein product	"""Tangier disease"""	600046		ABC1, HDLDT1		8088782, 10431236, 10431237, 10431238	Standard	NM_005502		Approved	TGD	uc004bcl.3	O95477	OTTHUMG00000020417	ENST00000374736.3:c.5618G>A	9.37:g.107555470C>T	ENSP00000363868:p.Arg1873Lys	Somatic	0	48	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	40	38.46	Q5VX33|Q96S56|Q96T85|Q9NQV4|Q9UN06|Q9UN07|Q9UN08|Q9UN09	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.R1873K	ENST00000374736.3	37	c.5618	CCDS6762.1	9	.	.	.	.	.	.	.	.	.	.	C	16.04	3.011113	0.54361	.	.	ENSG00000165029	ENST00000374736	T	0.74002	-0.8	5.97	5.07	0.68467	.	0.203550	0.47093	D	0.000260	T	0.63331	0.2502	L	0.27053	0.805	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.58194	-0.7679	10	0.37606	T	0.19	.	14.8147	0.70024	0.0:0.9304:0.0:0.0696	.	1873	O95477	ABCA1_HUMAN	K	1873	ENSP00000363868:R1873K	ENSP00000363868:R1873K	R	-	2	0	ABCA1	106595291	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.673000	0.54591	1.539000	0.49286	0.655000	0.94253	AGA	-	NULL		0.527	ABCA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA1	protein_coding	OTTHUMT00000053491.1	C	NM_005502	-		107555470	-1	no_errors	ENST00000374736	ensembl	human	known	74_37	missense	SNP	1.000	T
TNNT3	7140	genome.wustl.edu	37	11	1955791	1955791	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr11:1955791G>A	ENST00000397301.1	+	14	537	c.529G>A	c.(529-531)Ggc>Agc	p.G177S	TNNT3_ENST00000397304.2_Missense_Mutation_p.G147S|TNNT3_ENST00000278317.6_Missense_Mutation_p.G166S|TNNT3_ENST00000381561.4_Missense_Mutation_p.G169S|TNNT3_ENST00000381579.3_Missense_Mutation_p.G158S|TNNT3_ENST00000381549.3_Missense_Mutation_p.G158S|TNNT3_ENST00000381589.3_Missense_Mutation_p.G164S|TNNT3_ENST00000381548.3_Missense_Mutation_p.G168S|TNNT3_ENST00000360603.3_Missense_Mutation_p.G160S|TNNT3_ENST00000381558.1_Missense_Mutation_p.G158S|TNNT3_ENST00000446240.1_Missense_Mutation_p.G147S|TNNT3_ENST00000493234.1_3'UTR			P45378	TNNT3_HUMAN	troponin T type 3 (skeletal, fast)	177					ATP catabolic process (GO:0006200)|muscle filament sliding (GO:0030049)|regulation of ATPase activity (GO:0043462)|regulation of striated muscle contraction (GO:0006942)|skeletal muscle contraction (GO:0003009)	cytosol (GO:0005829)|troponin complex (GO:0005861)	calcium-dependent protein binding (GO:0048306)|tropomyosin binding (GO:0005523)|troponin C binding (GO:0030172)|troponin I binding (GO:0031013)			breast(2)|endometrium(1)|kidney(1)|lung(8)|ovary(1)|prostate(1)|skin(4)|stomach(1)	19		all_epithelial(84;0.000138)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00253)|Lung(200;0.0333)|LUSC - Lung squamous cell carcinoma(625;0.0826)		CCAGAAGAGAGGCAAGAAGCA	0.587																																																	0								ENSG00000130595						28.0	29.0	28.0					11																	1955791		2197	4294	6491	TNNT3	SO:0001583	missense	0			-	HGNC	M21984	CCDS7727.1, CCDS41594.1, CCDS41595.1, CCDS41596.1	11p15.5	2014-09-17	2005-09-12		ENSG00000130595	ENSG00000130595			11950	protein-coding gene	gene with protein product	"""troponin-T3, skeletal, fast"""	600692	"""troponin T3, skeletal, fast"""			8172653	Standard	NM_001042782		Approved	AMCD2B, DA2B, FSSV, DKFZp779M2348	uc001lup.4	P45378	OTTHUMG00000012475	ENST00000397301.1:c.529G>A	11.37:g.1955791G>A	ENSP00000380468:p.Gly177Ser	Somatic	0	32	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	48	15.79	A8MQ76|A8MSW1|B3KPX3|B7WP64|B7ZL26|B7ZVV9|Q12975|Q12976|Q12977|Q12978|Q17RG9|Q6FH29|Q6N056|Q86TH6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Troponin	p.G177S	ENST00000397301.1	37	c.529		11	.	.	.	.	.	.	.	.	.	.	.	19.08	3.757188	0.69648	.	.	ENSG00000130595	ENST00000278317;ENST00000544980;ENST00000397309;ENST00000381561;ENST00000381548;ENST00000360603;ENST00000381549;ENST00000381589;ENST00000381579;ENST00000381557;ENST00000453458;ENST00000381563;ENST00000344578;ENST00000381558;ENST00000397301;ENST00000397304;ENST00000446240	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.92446	-3.04;-3.04;-3.04;-3.04;-3.04;-3.04;-3.04;-3.04;-3.04;-3.04;-3.04;-3.04;-3.04;-3.04;-3.04	3.86	3.86	0.44501	.	0.000000	0.85682	D	0.000000	D	0.93612	0.7960	L	0.56124	1.755	0.80722	D	1	D;D;D;P;D	0.56287	0.969;0.969;0.969;0.919;0.975	P;P;P;P;P	0.57620	0.73;0.73;0.73;0.73;0.824	D	0.94584	0.7782	10	0.87932	D	0	-17.3625	16.3717	0.83364	0.0:0.0:1.0:0.0	.	166;158;164;158;177	P45378-2;P45378-7;P45378-6;P45378-4;P45378	.;.;.;.;TNNT3_HUMAN	S	166;62;178;169;168;160;158;164;158;152;147;169;153;158;177;147;147	ENSP00000278317:G166S;ENSP00000370973:G169S;ENSP00000370960:G168S;ENSP00000353815:G160S;ENSP00000370961:G158S;ENSP00000371001:G164S;ENSP00000370991:G158S;ENSP00000370969:G152S;ENSP00000415614:G147S;ENSP00000370975:G169S;ENSP00000344870:G153S;ENSP00000370970:G158S;ENSP00000380468:G177S;ENSP00000380471:G147S;ENSP00000413203:G147S	ENSP00000278317:G166S	G	+	1	0	TNNT3	1912367	1.000000	0.71417	1.000000	0.80357	0.264000	0.26372	5.980000	0.70516	2.171000	0.68590	0.313000	0.20887	GGC	-	pfam_Troponin		0.587	TNNT3-010	KNOWN	basic	protein_coding	TNNT3	protein_coding	OTTHUMT00000142920.3	G	NM_006757	-		1955791	+1	no_errors	ENST00000397301	ensembl	human	known	74_37	missense	SNP	1.000	A
GZMK	3003	genome.wustl.edu	37	5	54327291	54327291	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr5:54327291G>A	ENST00000231009.2	+	4	533	c.463G>A	c.(463-465)Gga>Aga	p.G155R	CTD-2313F11.1_ENST00000595218.1_RNA|CTD-2313F11.1_ENST00000609699.1_RNA|CTD-2313F11.1_ENST00000609792.1_RNA|CTD-2313F11.1_ENST00000596137.1_RNA	NM_002104.2	NP_002095.1	P49863	GRAK_HUMAN	granzyme K (granzyme 3; tryptase II)	155	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(4)	15		Lung NSC(810;4.08e-05)|Breast(144;0.0433)|Prostate(74;0.183)				TACTGGCTGGGGAGCCACCGA	0.443																																																	0								ENSG00000113088						86.0	89.0	88.0					5																	54327291		2203	4300	6503	GZMK	SO:0001583	missense	0			-	HGNC	BC035802	CCDS3964.1	5q11.2	2008-05-15	2005-08-17		ENSG00000113088	ENSG00000113088			4711	protein-coding gene	gene with protein product		600784	"""granzyme K (serine protease, granzyme 3; tryptase II)"""			7758581	Standard	NM_002104		Approved	TRYP2, PRSS	uc003jpl.1	P49863	OTTHUMG00000097009	ENST00000231009.2:c.463G>A	5.37:g.54327291G>A	ENSP00000231009:p.Gly155Arg	Somatic	0	50	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	58	23.68	B2R563	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_S1,pfam_Peptidase_S1A_nudel,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.G155R	ENST00000231009.2	37	c.463	CCDS3964.1	5	.	.	.	.	.	.	.	.	.	.	G	20.5	3.998501	0.74818	.	.	ENSG00000113088	ENST00000231009	D	0.94000	-3.33	5.16	4.29	0.51040	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.064055	0.64402	D	0.000007	D	0.98182	0.9399	H	0.99600	4.65	0.47511	D	0.999441	D	0.89917	1.0	D	0.97110	1.0	D	0.98528	1.0626	10	0.87932	D	0	.	12.714	0.57105	0.0807:0.0:0.9193:0.0	.	155	P49863	GRAK_HUMAN	R	155	ENSP00000231009:G155R	ENSP00000231009:G155R	G	+	1	0	GZMK	54363048	1.000000	0.71417	0.997000	0.53966	0.931000	0.56810	5.517000	0.67061	1.411000	0.46957	0.655000	0.94253	GGA	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1		0.443	GZMK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GZMK	protein_coding	OTTHUMT00000214098.1	G	NM_002104	-		54327291	+1	no_errors	ENST00000231009	ensembl	human	known	74_37	missense	SNP	1.000	A
PTPN11	5781	genome.wustl.edu	37	12	112888139	112888139	+	Missense_Mutation	SNP	C	C	T	rs397507503		TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr12:112888139C>T	ENST00000351677.2	+	3	353	c.155C>T	c.(154-156)aCc>aTc	p.T52I	PTPN11_ENST00000392597.1_Missense_Mutation_p.T52I	NM_002834.3	NP_002825.3	Q06124	PTN11_HUMAN	protein tyrosine phosphatase, non-receptor type 11	52	SH2 1. {ECO:0000255|PROSITE- ProRule:PRU00191}.				abortive mitotic cell cycle (GO:0033277)|activation of MAPK activity (GO:0000187)|atrioventricular canal development (GO:0036302)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|brain development (GO:0007420)|cytokine-mediated signaling pathway (GO:0019221)|DNA damage checkpoint (GO:0000077)|ephrin receptor signaling pathway (GO:0048013)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|face morphogenesis (GO:0060325)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|genitalia development (GO:0048806)|glucose homeostasis (GO:0042593)|heart development (GO:0007507)|hormone metabolic process (GO:0042445)|hormone-mediated signaling pathway (GO:0009755)|innate immune response (GO:0045087)|inner ear development (GO:0048839)|insulin receptor signaling pathway (GO:0008286)|integrin-mediated signaling pathway (GO:0007229)|interferon-gamma-mediated signaling pathway (GO:0060333)|leukocyte migration (GO:0050900)|megakaryocyte development (GO:0035855)|multicellular organismal reproductive process (GO:0048609)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of cortisol secretion (GO:0051463)|negative regulation of growth hormone secretion (GO:0060125)|negative regulation of insulin secretion (GO:0046676)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ growth (GO:0035265)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet formation (GO:0030220)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of hormone secretion (GO:0046887)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of multicellular organism growth (GO:0040014)|regulation of protein export from nucleus (GO:0046825)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|T cell costimulation (GO:0031295)|triglyceride metabolic process (GO:0006641)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	insulin receptor binding (GO:0005158)|non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|SH3/SH2 adaptor activity (GO:0005070)	p.T52S(2)		NS(1)|autonomic_ganglia(2)|breast(1)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(406)|kidney(2)|large_intestine(6)|lung(16)|ovary(1)|skin(1)|soft_tissue(3)|stomach(3)	451						GGAGCTGTCACCCACATCAAG	0.433			Mis		"""JMML, AML, MDS"""		Noonan Syndrome		Noonan syndrome																															Dom	yes		12	12q24.1	5781	"""protein tyrosine phosphatase, non-receptor type 11"""	yes	L	2	Substitution - Missense(2)	haematopoietic_and_lymphoid_tissue(2)						ENSG00000179295						121.0	115.0	117.0					12																	112888139		2203	4300	6503	PTPN11	SO:0001583	missense	0	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	-	HGNC	D13540	CCDS9163.1, CCDS58280.1	12q24.1	2014-09-17	2008-07-31		ENSG00000179295	ENSG00000179295		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"", ""SH2 domain containing"""	9644	protein-coding gene	gene with protein product		176876	"""Noonan syndrome 1"""	NS1		7894486, 1280823	Standard	NM_080601		Approved	BPTP3, SH-PTP2, SHP-2, PTP2C, SHP2	uc001ttx.3	Q06124	OTTHUMG00000134334	ENST00000351677.2:c.155C>T	12.37:g.112888139C>T	ENSP00000340944:p.Thr52Ile	Somatic	0	31	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	49	9.26	A8K1D9|Q96HD7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_SH2,smart_SH2,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pirsf_Tyr_Pase_non-rcpt_typ-6/11,pfscan_SH2,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt,prints_SH2	p.T52I	ENST00000351677.2	37	c.155	CCDS9163.1	12	.	.	.	.	.	.	.	.	.	.	C	28.8	4.949981	0.92660	.	.	ENSG00000179295	ENST00000392597;ENST00000351677;ENST00000392596	D;D	0.88896	-2.44;-2.44	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	D	0.93115	0.7808	L	0.49350	1.555	0.80722	D	1	D;D	0.76494	0.999;0.997	D;D	0.72982	0.979;0.962	D	0.93416	0.6773	10	0.87932	D	0	.	19.6978	0.96034	0.0:1.0:0.0:0.0	.	52;52	Q06124-2;Q06124-3	.;.	I	52	ENSP00000376376:T52I;ENSP00000340944:T52I	ENSP00000340944:T52I	T	+	2	0	PTPN11	111372522	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.481000	0.81124	2.649000	0.89929	0.650000	0.86243	ACC	-	pfam_SH2,smart_SH2,pirsf_Tyr_Pase_non-rcpt_typ-6/11,pfscan_SH2		0.433	PTPN11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPN11	protein_coding	OTTHUMT00000259496.2	C		-		112888139	+1	no_errors	ENST00000351677	ensembl	human	known	74_37	missense	SNP	1.000	T
C11orf42	160298	genome.wustl.edu	37	11	6232180	6232180	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr11:6232180G>A	ENST00000316375.2	+	3	960	c.910G>A	c.(910-912)Gcc>Acc	p.A304T	FAM160A2_ENST00000529360.1_5'Flank	NM_173525.2	NP_775796.2	Q8N5U0	CK042_HUMAN	chromosome 11 open reading frame 42	304	Pro-rich.									endometrium(3)|kidney(3)|large_intestine(1)|lung(4)|ovary(2)|skin(1)|soft_tissue(1)	15		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;1.95e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TCCACCAGGAGCCCAGGGTGG	0.627																																																	0								ENSG00000180878						17.0	21.0	20.0					11																	6232180		2193	4292	6485	C11orf42	SO:0001583	missense	0			-	HGNC	BC031612	CCDS7759.1	11p15.4	2012-08-09			ENSG00000180878	ENSG00000180878			28541	protein-coding gene	gene with protein product						12477932	Standard	NM_173525		Approved	MGC34805	uc001mcj.3	Q8N5U0	OTTHUMG00000133377	ENST00000316375.2:c.910G>A	11.37:g.6232180G>A	ENSP00000321021:p.Ala304Thr	Somatic	0	42	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	53	17.19		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.A304T	ENST00000316375.2	37	c.910	CCDS7759.1	11	.	.	.	.	.	.	.	.	.	.	G	9.291	1.050534	0.19827	.	.	ENSG00000180878	ENST00000316375	T	0.50001	0.76	4.84	3.84	0.44239	.	0.673420	0.13674	N	0.370674	T	0.26702	0.0653	N	0.12182	0.205	0.26858	N	0.968019	B	0.09022	0.002	B	0.06405	0.002	T	0.04991	-1.0913	10	0.29301	T	0.29	-1.0635	7.1991	0.25871	0.1229:0.0:0.8771:0.0	.	304	Q8N5U0	CK042_HUMAN	T	304	ENSP00000321021:A304T	ENSP00000321021:A304T	A	+	1	0	C11orf42	6188756	0.998000	0.40836	1.000000	0.80357	0.991000	0.79684	2.121000	0.41977	2.497000	0.84241	0.484000	0.47621	GCC	-	NULL		0.627	C11orf42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C11orf42	protein_coding	OTTHUMT00000257227.2	G	NM_173525	-		6232180	+1	no_errors	ENST00000316375	ensembl	human	known	74_37	missense	SNP	1.000	A
CEP170P1	645455	genome.wustl.edu	37	4	119461423	119461423	+	RNA	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr4:119461423C>T	ENST00000412784.2	+	0	320					NR_003135.2		Q96L14	C170L_HUMAN	centrosomal protein 170kDa pseudogene 1								identical protein binding (GO:0042802)										AAGATTCCTCCATTAGTTCAT	0.418																																																	0								ENSG00000154608																																			CEP170P1			0			-	HGNC	BC014590		4q26	2010-10-11	2010-10-11	2010-10-11	ENSG00000154608	ENSG00000154608			28364	pseudogene	pseudogene			"""KIAA0470-like"", ""centrosomal protein 170kDa-like"""	KIAA0470L, CEP170L			Standard	NR_003135		Approved	MGC26143, FAM68B	uc003icb.3	Q96L14	OTTHUMG00000132958		4.37:g.119461423C>T		Somatic	0	66	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	106	18.46		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000412784.2	37	NULL		4																																																																																			-	-		0.418	CEP170P1-002	KNOWN	basic	processed_transcript	CEP170P1	pseudogene	OTTHUMT00000364033.2	C	NR_003135.2	-		119461423	+1	no_errors	ENST00000412784	ensembl	human	known	74_37	rna	SNP	1.000	T
TUBB	203068	genome.wustl.edu	37	6	30692042	30692042	+	Silent	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr6:30692042G>A	ENST00000327892.8	+	4	1509	c.1203G>A	c.(1201-1203)gaG>gaA	p.E401E	TUBB_ENST00000330914.3_Silent_p.E329E|TUBB_ENST00000396389.1_Silent_p.E383E|TUBB_ENST00000396384.1_Silent_p.E329E|TUBB_ENST00000435534.1_Silent_p.E200E|XXbac-BPG252P9.9_ENST00000607476.1_RNA	NM_178014.2	NP_821133.1	P07437	TBB5_HUMAN	tubulin, beta class I	401			E -> K (in CDCBM6; arrests the assembly pathway of alpha/beta-tubulin; the mutant protein is unable to coassemble into a tubulin heterodimer but is instead distributed throughout the cytoplasm). {ECO:0000269|PubMed:23246003}.		cell division (GO:0051301)|cellular component movement (GO:0006928)|cellular process (GO:0009987)|cytoskeleton-dependent intracellular transport (GO:0030705)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based process (GO:0007017)|mitotic cell cycle (GO:0000278)|natural killer cell mediated cytotoxicity (GO:0042267)|protein polymerization (GO:0051258)|spindle assembly (GO:0051225)	cell body (GO:0044297)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nuclear envelope lumen (GO:0005641)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|MHC class I protein binding (GO:0042288)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			breast(1)|endometrium(1)|kidney(8)|large_intestine(3)|lung(1)|ovary(1)|urinary_tract(1)	16					Colchicine(DB01394)|Podofilox(DB01179)|Vinblastine(DB00570)|Vincristine(DB00541)|Vinorelbine(DB00361)	ACACAGGCGAGGGCATGGACG	0.577																																																	0								ENSG00000196230						78.0	71.0	73.0					6																	30692042		2203	4298	6501	TUBB	SO:0001819	synonymous_variant	0			-	HGNC	AB062393	CCDS4687.1	6p21.33	2011-10-10	2011-10-10		ENSG00000196230	ENSG00000196230		"""Tubulins"""	20778	protein-coding gene	gene with protein product	"""class I beta-tubulin"", ""beta1-tubulin"""	191130	"""tubulin, beta polypeptide"", ""tubulin, beta"""			11504633, 8270253	Standard	NM_001293212		Approved	OK/SW-cl.56, MGC16435, M40, Tubb5	uc003nrl.3	P07437	OTTHUMG00000031059	ENST00000327892.8:c.1203G>A	6.37:g.30692042G>A		Somatic	0	64	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	110	12.00	P05218|Q8WUC1|Q9CY33	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,pfam_Misato_II_tubulin-like,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Beta_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Gamma_tubulin,prints_Delta_tubulin,prints_Alpha_tubulin	p.E401	ENST00000327892.8	37	c.1203	CCDS4687.1	6																																																																																			-	superfamily_Tub_FtsZ_C,prints_Delta_tubulin		0.577	TUBB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBB	protein_coding	OTTHUMT00000076074.2	G	NM_178014	-		30692042	+1	no_errors	ENST00000327892	ensembl	human	known	74_37	silent	SNP	1.000	A
TMIE	259236	genome.wustl.edu	37	3	46751105	46751105	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr3:46751105G>A	ENST00000326431.3	+	4	553	c.398G>A	c.(397-399)aGt>aAt	p.S133N		NM_147196.2	NP_671729.2	Q8NEW7	TMIE_HUMAN	transmembrane inner ear	133	Lys-rich.				inner ear morphogenesis (GO:0042472)|sensory perception of sound (GO:0007605)	integral component of membrane (GO:0016021)				endometrium(1)|lung(1)|skin(1)	3				BRCA - Breast invasive adenocarcinoma(193;0.000688)|KIRC - Kidney renal clear cell carcinoma(197;0.0177)|Kidney(197;0.0208)		aagaagGACAGTGTGGACACA	0.512																																																	0								ENSG00000181585						115.0	122.0	120.0					3																	46751105		1982	4161	6143	TMIE	SO:0001583	missense	0			-	HGNC	AY081842	CCDS43081.1	3p21	2010-01-06	2004-05-19		ENSG00000181585	ENSG00000181585			30800	protein-coding gene	gene with protein product		607237	"""deafness, autosomal recessive 6"""	DFNB6		12140191, 12145746	Standard	NM_147196		Approved		uc010hjk.1	Q8NEW7	OTTHUMG00000149909	ENST00000326431.3:c.398G>A	3.37:g.46751105G>A	ENSP00000324775:p.Ser133Asn	Somatic	0	32	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	37	27.45	A0AV93|A8K0R0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.S133N	ENST00000326431.3	37	c.398	CCDS43081.1	3	.	.	.	.	.	.	.	.	.	.	g	16.96	3.265260	0.59431	.	.	ENSG00000181585	ENST00000326431	D	0.91011	-2.77	4.45	2.52	0.30459	.	0.517070	0.20876	N	0.084086	T	0.81922	0.4925	L	0.29908	0.895	0.20307	N	0.999912	P	0.36535	0.557	B	0.29785	0.107	T	0.74100	-0.3774	10	0.46703	T	0.11	-7.1931	10.5533	0.45101	0.0:0.3831:0.6169:0.0	.	133	Q8NEW7	TMIE_HUMAN	N	133	ENSP00000324775:S133N	ENSP00000324775:S133N	S	+	2	0	TMIE	46726109	0.988000	0.35896	0.998000	0.56505	0.973000	0.67179	1.535000	0.36061	1.231000	0.43661	-0.121000	0.15023	AGT	-	NULL		0.512	TMIE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMIE	protein_coding	OTTHUMT00000313853.1	G	NM_147196	-		46751105	+1	no_errors	ENST00000326431	ensembl	human	known	74_37	missense	SNP	0.981	A
DMBT1	1755	genome.wustl.edu	37	10	124389895	124389895	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr10:124389895G>A	ENST00000338354.3	+	45	5633	c.5527G>A	c.(5527-5529)Gat>Aat	p.D1843N	DMBT1_ENST00000330163.4_Missense_Mutation_p.D1215N|DMBT1_ENST00000344338.3_Missense_Mutation_p.D1833N|DMBT1_ENST00000368956.2_Missense_Mutation_p.D1215N|DMBT1_ENST00000359586.6_Missense_Mutation_p.D563N|DMBT1_ENST00000368955.3_Missense_Mutation_p.D1833N|DMBT1_ENST00000368909.3_Missense_Mutation_p.D1843N			Q9UGM3	DMBT1_HUMAN	deleted in malignant brain tumors 1	1843	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.				defense response to virus (GO:0051607)|epithelial cell differentiation (GO:0030855)|induction of bacterial agglutination (GO:0043152)|innate immune response (GO:0045087)|inner cell mass cell proliferation (GO:0001833)|pattern recognition receptor signaling pathway (GO:0002221)|positive regulation of epithelial cell differentiation (GO:0030858)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|phagocytic vesicle membrane (GO:0030670)|proteinaceous extracellular matrix (GO:0005578)|zymogen granule membrane (GO:0042589)	calcium-dependent protein binding (GO:0048306)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)|zymogen binding (GO:0035375)			breast(2)|central_nervous_system(7)|cervix(3)|endometrium(8)|kidney(1)|large_intestine(1)|lung(46)|prostate(1)|urinary_tract(3)	72		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				AATCTGTAATGATACCAGGCA	0.388																																					Ovarian(182;93 2026 18125 22222 38972)												0								ENSG00000187908						135.0	126.0	129.0					10																	124389895		1860	4109	5969	DMBT1	SO:0001583	missense	0			-	HGNC		CCDS44490.1, CCDS44491.1, CCDS44492.1	10q25.3-q26.1	2008-08-01			ENSG00000187908	ENSG00000187908			2926	protein-coding gene	gene with protein product		601969				9288095, 17548659	Standard	NM_004406		Approved	GP340, muclin	uc001lgk.1	Q9UGM3	OTTHUMG00000019185	ENST00000338354.3:c.5527G>A	10.37:g.124389895G>A	ENSP00000342210:p.Asp1843Asn	Somatic	0	42	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	38	20.83	A6NDG4|A6NDJ5|A8E4R5|B1ARE7|B1ARE8|B1ARE9|B1ARF0|B7Z8Y2|F8WEF7|Q59EX0|Q5JR26|Q6MZN4|Q96DU4|Q9UGM2|Q9UJ57|Q9UKJ4|Q9Y211|Q9Y4V9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SRCR,pfam_CUB_dom,pfam_ZP_dom,superfamily_Srcr_rcpt-rel,superfamily_CUB_dom,smart_Srcr_rcpt-rel,smart_CUB_dom,smart_ZP_dom,pfscan_CUB_dom,pfscan_SRCR,pfscan_ZP_dom,prints_SRCR	p.D1843N	ENST00000338354.3	37	c.5527		10	.	.	.	.	.	.	.	.	.	.	G	6.763	0.509681	0.12883	.	.	ENSG00000187908	ENST00000338354;ENST00000368915;ENST00000341278;ENST00000368953;ENST00000339871;ENST00000368942;ENST00000327438;ENST00000344338;ENST00000339712;ENST00000330163;ENST00000368909;ENST00000368955;ENST00000368956;ENST00000359586	T;T;T;T;T;T;T	0.26957	1.7;1.7;1.7;1.7;1.7;1.7;1.7	4.45	-4.9	0.03094	CUB (5);	.	.	.	.	T	0.20333	0.0489	N	0.17082	0.46	0.09310	N	1	B;D;B;D;B;D;B	0.60575	0.002;0.978;0.002;0.988;0.002;0.983;0.078	B;P;B;P;B;P;B	0.61070	0.001;0.832;0.001;0.883;0.002;0.79;0.246	T	0.08911	-1.0699	9	0.36615	T	0.2	.	1.7551	0.02980	0.4462:0.1029:0.2429:0.208	.	563;1823;1092;1972;1215;1833;1843	F8WEF7;Q9UGM3-5;Q9UGM3-8;Q9UGM3-6;Q9UGM3-2;Q9UGM3-3;Q9UGM3	.;.;.;.;.;.;DMBT1_HUMAN	N	1843;1972;1843;1843;1843;1843;1215;1833;1215;1215;1843;1833;1215;563	ENSP00000342210:D1843N;ENSP00000343175:D1833N;ENSP00000327747:D1215N;ENSP00000357905:D1843N;ENSP00000357951:D1833N;ENSP00000357952:D1215N;ENSP00000352593:D563N	ENSP00000331522:D1215N	D	+	1	0	DMBT1	124379885	0.000000	0.05858	0.000000	0.03702	0.027000	0.11550	-2.517000	0.00954	-0.848000	0.04163	-0.140000	0.14226	GAT	-	pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom		0.388	DMBT1-001	KNOWN	basic|appris_principal	protein_coding	DMBT1	protein_coding	OTTHUMT00000050792.2	G	NM_004406	-		124389895	+1	no_errors	ENST00000338354	ensembl	human	known	74_37	missense	SNP	0.000	A
CCHCR1	54535	genome.wustl.edu	37	6	31113065	31113065	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr6:31113065G>A	ENST00000376266.5	-	13	1609	c.1487C>T	c.(1486-1488)cCa>cTa	p.P496L	CCHCR1_ENST00000451521.2_Missense_Mutation_p.P549L|CCHCR1_ENST00000396263.2_Missense_Mutation_p.P443L|CCHCR1_ENST00000396268.3_Missense_Mutation_p.P585L	NM_019052.3	NP_061925.2	Q8TD31	CCHCR_HUMAN	coiled-coil alpha-helical rod protein 1	496					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|protein export from nucleus (GO:0006611)	centriole (GO:0005814)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(13)|skin(1)	23						TGTGACCGGTGGTGGTAGGGG	0.587																																																	0								ENSG00000204536						37.0	32.0	34.0					6																	31113065		1511	2709	4220	CCHCR1	SO:0001583	missense	0			-	HGNC	AF216493	CCDS4695.1, CCDS43445.1, CCDS47397.1	6p21.3	2007-08-01	2005-02-15	2005-02-16	ENSG00000204536	ENSG00000204536			13930	protein-coding gene	gene with protein product		605310	"""chromosome 6 open reading frame 18"""	C6orf18		10888604, 10545595	Standard	NM_019052		Approved	HCR	uc003nsp.4	Q8TD31	OTTHUMG00000031112	ENST00000376266.5:c.1487C>T	6.37:g.31113065G>A	ENSP00000365442:p.Pro496Leu	Somatic	0	61	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	62	13.89	A2ABH6|E9PE84|Q2TB67|Q5SQ82|Q5STE9|Q9NRK8|Q9NWY9|Q9NXJ4|Q9NXK3|Q9Y6W1|Q9Y6W2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_HCR	p.P585L	ENST00000376266.5	37	c.1754	CCDS4695.1	6	.	.	.	.	.	.	.	.	.	.	G	8.748	0.920591	0.17982	.	.	ENSG00000204536	ENST00000396268;ENST00000376266;ENST00000396263;ENST00000440185;ENST00000451521	T;T;T;T	0.03496	3.91;3.91;3.91;3.91	5.0	4.1	0.47936	.	0.307281	0.26761	N	0.022637	T	0.01489	0.0048	L	0.40543	1.245	0.39691	D	0.97104	B;B;B;B;B	0.18166	0.007;0.001;0.006;0.026;0.026	B;B;B;B;B	0.19391	0.018;0.007;0.017;0.025;0.015	T	0.46470	-0.9189	10	0.29301	T	0.29	-0.434	10.3852	0.44136	0.0:0.0:0.8038:0.1962	.	496;496;496;549;585	B4DIA2;A8K081;Q8TD31;E9PE84;Q8TD31-2	.;.;CCHCR_HUMAN;.;.	L	585;496;443;496;549	ENSP00000379566:P585L;ENSP00000365442:P496L;ENSP00000379561:P443L;ENSP00000401039:P549L	ENSP00000365442:P496L	P	-	2	0	CCHCR1	31221044	0.970000	0.33590	0.311000	0.25182	0.155000	0.21991	2.344000	0.44010	1.039000	0.40074	0.478000	0.44815	CCA	-	pfam_HCR		0.587	CCHCR1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CCHCR1	protein_coding	OTTHUMT00000076190.5	G	NM_019052	-		31113065	-1	no_errors	ENST00000396268	ensembl	human	known	74_37	missense	SNP	0.831	A
TRIM67	440730	genome.wustl.edu	37	1	231355688	231355688	+	IGR	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr1:231355688C>T	ENST00000366653.5	+	0	3936				TRIM67_ENST00000366652.2_Missense_Mutation_p.S754F|TRIM67_ENST00000444294.3_3'UTR			Q6ZTA4	TRI67_HUMAN	tripartite motif containing 67						negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	zinc ion binding (GO:0008270)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29	Breast(184;0.0871)	all_cancers(173;0.189)|Prostate(94;0.167)				TCGGTTACTTCCCTCTTTTAA	0.453																																																	0								ENSG00000119283																																			TRIM67	SO:0001628	intergenic_variant	0			-	HGNC	AK126782	CCDS44333.1, CCDS73048.1	1q42.2	2014-02-17	2011-01-25		ENSG00000119283	ENSG00000119283		"""Tripartite motif containing / Tripartite motif containing"", ""Fibronectin type III domain containing"", ""RING-type (C3HC4) zinc fingers"""	31859	protein-coding gene	gene with protein product		610584	"""tripartite motif-containing 67"""				Standard	NM_001004342		Approved	TNL	uc009xfn.1	Q6ZTA4	OTTHUMG00000037958		1.37:g.231355688C>T		Somatic	0	61	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	77	16.30	Q5TER7|Q5TER8|Q7Z4K7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Fibronectin_type3,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Znf_RING,smart_Znf_B-box,smart_Bbox_C,smart_Fibronectin_type3,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Fibronectin_type3,pfscan_Znf_B-box	p.S754F	ENST00000366653.5	37	c.2261	CCDS44333.1	1	.	.	.	.	.	.	.	.	.	.	C	7.338	0.620375	0.14193	.	.	ENSG00000119283	ENST00000366652	T	0.69561	-0.41	4.03	-7.32	0.01436	.	6.075450	0.00481	N	0.000126	T	0.61899	0.2384	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.62642	-0.6811	7	0.87932	D	0	.	9.3544	0.38157	0.1791:0.6386:0.1824:0.0	.	.	.	.	F	754	ENSP00000355612:S754F	ENSP00000355612:S754F	S	+	2	0	TRIM67	229422311	0.000000	0.05858	0.000000	0.03702	0.043000	0.13939	-1.863000	0.01651	-1.275000	0.02417	0.655000	0.94253	TCC	-	smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY		0.453	TRIM67-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	TRIM67	protein_coding	OTTHUMT00000092649.3	C	NM_001004342	-		231355688	+1	no_errors	ENST00000366652	ensembl	human	known	74_37	missense	SNP	0.000	T
C6	729	genome.wustl.edu	37	5	41176764	41176764	+	Silent	SNP	C	C	T	rs146851023		TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr5:41176764C>T	ENST00000263413.3	-	8	1245	c.981G>A	c.(979-981)acG>acA	p.T327T	C6_ENST00000475349.1_5'UTR|C6_ENST00000337836.5_Silent_p.T327T	NM_001115131.1	NP_001108603.2	P13671	CO6_HUMAN	complement component 6	327	MACPF. {ECO:0000255|PROSITE- ProRule:PRU00745}.				complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)		p.T327T(1)		central_nervous_system(2)|cervix(2)|endometrium(2)|kidney(7)|large_intestine(16)|liver(1)|lung(51)|ovary(3)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)	96		Breast(839;1.07e-05)|Ovarian(839;0.0228)|Lung SC(612;0.0548)|Lung NSC(810;0.128)|all_neural(839;0.157)				CTTTAGCTTTCGTTGTGAAGT	0.338																																																	1	Substitution - coding silent(1)	large_intestine(1)						ENSG00000039537	C	,	2,4404	2.1+/-5.4	0,2,2201	109.0	111.0	110.0		981,981	5.7	1.0	5	dbSNP_134	110	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	C6	NM_000065.2,NM_001115131.1	,	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	,	327/935,327/935	41176764	2,13004	2203	4300	6503	C6	SO:0001819	synonymous_variant	0			-	HGNC	J05024	CCDS3936.1	5p13.1	2014-09-17			ENSG00000039537	ENSG00000039537		"""Complement system"""	1339	protein-coding gene	gene with protein product		217050					Standard	NM_001115131		Approved		uc003jmk.3	P13671	OTTHUMG00000094781	ENST00000263413.3:c.981G>A	5.37:g.41176764C>T		Somatic	0	39	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	34	24.44		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_MACPF,pfam_Sushi_SCR_CCP,pfam_Thrombospondin_1_rpt,pfam_LDrepeatLR_classA_rpt,pfam_Kazal_dom,superfamily_Sushi_SCR_CCP,superfamily_Thrombospondin_1_rpt,superfamily_LDrepeatLR_classA_rpt,smart_Thrombospondin_1_rpt,smart_LDrepeatLR_classA_rpt,smart_MACPF,smart_Sushi_SCR_CCP,smart_FacI_MAC,prints_MAC_perforin,pfscan_LDrepeatLR_classA_rpt,pfscan_Sushi_SCR_CCP,pfscan_Thrombospondin_1_rpt	p.T327	ENST00000263413.3	37	c.981	CCDS3936.1	5																																																																																			-	pfam_MACPF,smart_MACPF		0.338	C6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C6	protein_coding	OTTHUMT00000211592.1	C		rs146851023		41176764	-1	no_errors	ENST00000263413	ensembl	human	known	74_37	silent	SNP	1.000	T
SCN10A	6336	genome.wustl.edu	37	3	38783840	38783840	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr3:38783840G>A	ENST00000449082.2	-	13	2047	c.2048C>T	c.(2047-2049)gCc>gTc	p.A683V		NM_006514.2	NP_006505.2	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha subunit	683					AV node cell to bundle of His cell communication (GO:0086067)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of cardiac muscle contraction (GO:0055117)|regulation of heart rate (GO:0002027)|regulation of ion transmembrane transport (GO:0034765)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(5)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(14)|kidney(5)|large_intestine(33)|lung(54)|ovary(5)|pancreas(1)|prostate(5)|skin(13)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	150				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cinchocaine(DB00527)|Cocaine(DB00907)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Lacosamide(DB06218)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Orphenadrine(DB01173)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)|Valproic Acid(DB00313)	GTGCTCCATGGCCATGAAGAT	0.552																																																	0								ENSG00000185313						132.0	103.0	113.0					3																	38783840		2203	4300	6503	SCN10A	SO:0001583	missense	0			-	HGNC	AF117907	CCDS33736.1	3p22.2	2012-02-26	2007-01-23		ENSG00000185313	ENSG00000185313		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10582	protein-coding gene	gene with protein product		604427	"""sodium channel, voltage-gated, type X, alpha polypeptide"""			9839820, 10198179, 16382098	Standard	NM_006514		Approved	Nav1.8, hPN3, SNS, PN3	uc003ciq.3	Q9Y5Y9	OTTHUMG00000048245	ENST00000449082.2:c.2048C>T	3.37:g.38783840G>A	ENSP00000390600:p.Ala683Val	Somatic	0	30	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	28	17.65	A6NDQ1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_PKD1_2_channel,prints_Na_channel_asu,prints_PKD_2	p.A683V	ENST00000449082.2	37	c.2048	CCDS33736.1	3	.	.	.	.	.	.	.	.	.	.	G	22.7	4.328768	0.81690	.	.	ENSG00000185313	ENST00000449082	D	0.97404	-4.37	4.42	4.42	0.53409	.	0.059628	0.64402	D	0.000003	D	0.97838	0.9290	M	0.91196	3.185	0.44780	D	0.997783	P	0.46706	0.883	P	0.47346	0.544	D	0.99620	1.0983	10	0.87932	D	0	.	17.1821	0.86858	0.0:0.0:1.0:0.0	.	683	Q9Y5Y9	SCNAA_HUMAN	V	683	ENSP00000390600:A683V	ENSP00000390600:A683V	A	-	2	0	SCN10A	38758844	1.000000	0.71417	1.000000	0.80357	0.715000	0.41141	9.503000	0.97984	2.445000	0.82738	0.585000	0.79938	GCC	-	NULL		0.552	SCN10A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	SCN10A	protein_coding	OTTHUMT00000109745.3	G	NM_006514	-		38783840	-1	no_errors	ENST00000449082	ensembl	human	known	74_37	missense	SNP	1.000	A
DMRT2	10655	genome.wustl.edu	37	9	1056594	1056594	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr9:1056594C>T	ENST00000358146.2	+	3	1007	c.1007C>T	c.(1006-1008)cCc>cTc	p.P336L	DMRT2_ENST00000259622.6_3'UTR|DMRT2_ENST00000382251.3_Missense_Mutation_p.P336L|DMRT2_ENST00000302441.6_Missense_Mutation_p.P336L|DMRT2_ENST00000382255.3_3'UTR			Q9Y5R5	DMRT2_HUMAN	doublesex and mab-3 related transcription factor 2	336					embryonic skeletal system development (GO:0048706)|positive regulation of myotome development (GO:2000287)|regulation of somitogenesis (GO:0014807)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(1)|lung(1)|prostate(2)	4		all_lung(10;1.49e-09)|Lung NSC(10;1.86e-09)		Lung(218;0.0195)|GBM - Glioblastoma multiforme(50;0.0388)		AGACAGTATCCCTTGTCCTCA	0.478																																																	0								ENSG00000173253						97.0	102.0	100.0					9																	1056594		2203	4300	6503	DMRT2	SO:0001583	missense	0			-	HGNC	AF130729	CCDS6444.1, CCDS6445.1	9p24.3	2008-07-21			ENSG00000173253	ENSG00000173253			2935	protein-coding gene	gene with protein product	"""terra-like protein"""	604935				10332030	Standard	NM_181872		Approved		uc003zha.3	Q9Y5R5	OTTHUMG00000019437	ENST00000358146.2:c.1007C>T	9.37:g.1056594C>T	ENSP00000350865:p.Pro336Leu	Somatic	0	37	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	23	36.11	B1ANC0|B9EGJ1|Q9NPG6|Q9NQR6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DM_DNA-bd,superfamily_DM_DNA-bd,smart_DM_DNA-bd,pfscan_DM_DNA-bd	p.P336L	ENST00000358146.2	37	c.1007	CCDS6444.1	9	.	.	.	.	.	.	.	.	.	.	C	21.1	4.092363	0.76756	.	.	ENSG00000173253	ENST00000382251;ENST00000302441;ENST00000358146	T;T;T	0.47869	0.83;0.83;0.83	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	T	0.69233	0.3088	M	0.65975	2.015	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	T	0.71031	-0.4710	10	0.87932	D	0	-17.206	19.2807	0.94051	0.0:1.0:0.0:0.0	.	336;180	Q9Y5R5;Q5HYK2	DMRT2_HUMAN;.	L	336	ENSP00000371686:P336L;ENSP00000305785:P336L;ENSP00000350865:P336L	ENSP00000305785:P336L	P	+	2	0	DMRT2	1046594	1.000000	0.71417	0.978000	0.43139	0.936000	0.57629	7.276000	0.78559	2.665000	0.90641	0.650000	0.86243	CCC	-	NULL		0.478	DMRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMRT2	protein_coding	OTTHUMT00000051492.1	C	NM_006557	-		1056594	+1	no_errors	ENST00000302441	ensembl	human	known	74_37	missense	SNP	1.000	T
EP400NL	347918	genome.wustl.edu	37	12	132589042	132589042	+	Silent	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr12:132589042C>T	ENST00000376625.4	+	1	503	c.477C>T	c.(475-477)ttC>ttT	p.F159F	EP400NL_ENST00000392352.1_Intron|EP400NL_ENST00000389560.2_Silent_p.F90F|EP400NL_ENST00000361109.5_Intron|EP400NL_ENST00000443539.2_Intron			Q6ZTU2	E400N_HUMAN	EP400 N-terminal like	159										endometrium(1)|lung(1)|prostate(2)|urinary_tract(1)	5						CAGGGGACTTCGTGGATGCCA	0.667																																																	0								ENSG00000185684						54.0	79.0	71.0					12																	132589042		640	1586	2226	EP400NL	SO:0001819	synonymous_variant	0			-	HGNC	AK091234		12q24.33	2013-02-15			ENSG00000185684	ENSG00000185684			26602	protein-coding gene	gene with protein product						12477932	Standard	NR_003290		Approved	FLJ33915	uc009zyq.3	Q6ZTU2	OTTHUMG00000168251	ENST00000376625.4:c.477C>T	12.37:g.132589042C>T		Somatic	0	70	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	69	25.00	A6NLB7|A8K0Z5|B3KQY2|Q6NXP1|Q8N253|Q8N7S7|Q9UFJ3	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.F159	ENST00000376625.4	37	c.477		12																																																																																			-	NULL		0.667	EP400NL-202	KNOWN	basic|appris_candidate_longest	protein_coding	EP400NL	protein_coding		C	NM_182613	-		132589042	+1	no_errors	ENST00000376625	ensembl	human	known	74_37	silent	SNP	0.999	T
GRK7	131890	genome.wustl.edu	37	3	141499263	141499263	+	Silent	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr3:141499263G>A	ENST00000264952.2	+	2	797	c.660G>A	c.(658-660)aaG>aaA	p.K220K		NM_139209.2	NP_631948.1	Q8WTQ7	GRK7_HUMAN	G protein-coupled receptor kinase 7	220	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				protein autophosphorylation (GO:0046777)|signal transduction (GO:0007165)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|visual perception (GO:0007601)	membrane (GO:0016020)	ATP binding (GO:0005524)|G-protein coupled receptor kinase activity (GO:0004703)|rhodopsin kinase activity (GO:0050254)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(14)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	26						ATGCCTGTAAGAAACTGGACA	0.453																																																	0								ENSG00000114124						77.0	77.0	77.0					3																	141499263		2203	4300	6503	GRK7	SO:0001819	synonymous_variant	0			-	HGNC		CCDS3120.1	3q24	2004-02-04	2004-02-04	2004-02-04	ENSG00000114124	ENSG00000114124			17031	protein-coding gene	gene with protein product		606987		GPRK7		11717351, 11754336	Standard	NM_139209		Approved		uc011bnd.2	Q8WTQ7	OTTHUMG00000159068	ENST00000264952.2:c.660G>A	3.37:g.141499263G>A		Somatic	0	33	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	39	25.00		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_RGS_dom,superfamily_Kinase-like_dom,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal_superfam,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_Regulat_G_prot_signal_superfam,pfscan_Prot_kinase_dom,prints_GPCR_kinase	p.K220	ENST00000264952.2	37	c.660	CCDS3120.1	3																																																																																			-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.453	GRK7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRK7	protein_coding	OTTHUMT00000353168.1	G	NM_139209	-		141499263	+1	no_errors	ENST00000264952	ensembl	human	known	74_37	silent	SNP	1.000	A
PRSS41	360226	genome.wustl.edu	37	16	2855019	2855019	+	RNA	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr16:2855019C>T	ENST00000399677.1	+	0	843							Q7RTY9	PRS41_HUMAN	protease, serine, 41							anchored component of membrane (GO:0031225)|intracellular organelle (GO:0043229)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)										GGCCTGGTGTCTACACCAACA	0.572																																																	0								ENSG00000215148						216.0	185.0	194.0					16																	2855019		692	1591	2283	PRSS41			0			-	HGNC			16p13.3	2014-04-01			ENSG00000215148	ENSG00000215148		"""Serine peptidases / Serine peptidases"""	30715	other	unknown	"""testis serine protease 1"""					12838346	Standard	NM_001135086		Approved	TESSP1	uc010uwi.2	Q7RTY9	OTTHUMG00000128932		16.37:g.2855019C>T		Somatic	0	51	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	42	22.22		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000399677.1	37	NULL		16																																																																																			-	-		0.572	PRSS41-002	KNOWN	basic	processed_transcript	PRSS41	pseudogene	OTTHUMT00000436450.1	C	NM_183379	-		2855019	+1	no_errors	ENST00000399677	ensembl	human	known	74_37	rna	SNP	0.999	T
ARHGEF38	54848	genome.wustl.edu	37	4	106588413	106588413	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr4:106588413G>A	ENST00000420470.2	+	12	1961	c.1817G>A	c.(1816-1818)gGa>gAa	p.G606E	ARHGEF38_ENST00000508036.2_3'UTR	NM_001242729.1	NP_001229658.1	Q9NXL2	ARH38_HUMAN	Rho guanine nucleotide exchange factor (GEF) 38	606						cytoplasm (GO:0005737)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|endometrium(1)|large_intestine(2)|lung(4)|ovary(3)	11						CTTCTGGAAGGAGACTTGGTG	0.453																																																	0								ENSG00000236699																																			ARHGEF38	SO:0001583	missense	0			-	HGNC	AK000191	CCDS3670.1, CCDS56338.1	4q24	2012-07-24			ENSG00000236699	ENSG00000236699		"""Rho guanine nucleotide exchange factors"""	25968	protein-coding gene	gene with protein product							Standard	NM_001242729		Approved	FLJ20184	uc003hxv.2	Q9NXL2	OTTHUMG00000154752	ENST00000420470.2:c.1817G>A	4.37:g.106588413G>A	ENSP00000416125:p.Gly606Glu	Somatic	0	32	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	46	14.81	C9JIB4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DH-domain,pfam_BAR_dom,pfam_SH3_2,pfam_SH3_domain,superfamily_DH-domain,superfamily_SH3_domain,smart_DH-domain,smart_BAR_dom,smart_SH3_domain,pfscan_BAR_dom,pfscan_SH3_domain,pfscan_DH-domain	p.G606E	ENST00000420470.2	37	c.1817	CCDS56338.1	4	.	.	.	.	.	.	.	.	.	.	G	32	5.111944	0.94339	.	.	ENSG00000236699	ENST00000420470	T	0.37915	1.17	5.73	5.73	0.89815	.	.	.	.	.	T	0.70482	0.3229	M	0.91090	3.175	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.76838	-0.2811	9	0.87932	D	0	-9.0247	19.9155	0.97058	0.0:0.0:1.0:0.0	.	606	C9JIB4	.	E	606	ENSP00000416125:G606E	ENSP00000416125:G606E	G	+	2	0	ARHGEF38	106807862	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.110000	0.94302	2.699000	0.92147	0.650000	0.86243	GGA	-	pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain		0.453	ARHGEF38-001	PUTATIVE	basic|appris_principal|readthrough_transcript|exp_conf|CCDS	protein_coding	ARHGEF38	protein_coding	OTTHUMT00000336934.3	G	NM_017700	-		106588413	+1	no_errors	ENST00000420470	ensembl	human	putative	74_37	missense	SNP	1.000	A
CNGB3	54714	genome.wustl.edu	37	8	87670098	87670098	+	Intron	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr8:87670098C>T	ENST00000320005.5	-	7	900				AC013751.1_ENST00000408210.1_RNA	NM_019098.4	NP_061971.3	Q9NQW8	CNGB3_HUMAN	cyclic nucleotide gated channel beta 3						cation transport (GO:0006812)|phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment (GO:0001750)|transmembrane transporter complex (GO:1902495)	cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(2)|endometrium(4)|kidney(6)|large_intestine(15)|lung(44)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	80						GATGTACTTTCCTGCGGGAGG	0.597																																																	0								ENSG00000221137																																			AC013751.1	SO:0001627	intron_variant	0			-	Clone_based_ensembl_gene	AF228520	CCDS6244.1	8q21.3	2013-01-23	2003-06-25		ENSG00000170289	ENSG00000170289		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2153	protein-coding gene	gene with protein product		605080	"""achromatopsia (rod monochromacy) 3"", ""achromatopsia (rod monochromacy) 1"""	ACHM3, ACHM1, RMCH		10888875, 10958649, 16382102	Standard	NM_019098		Approved		uc003ydx.3	Q9NQW8	OTTHUMG00000163738	ENST00000320005.5:c.853-3808G>A	8.37:g.87670098C>T		Somatic	0	40	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	58	23.68	C9JA51|Q9NRE9	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000320005.5	37	NULL	CCDS6244.1	8																																																																																			-	-		0.597	CNGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000221137	protein_coding	OTTHUMT00000375107.1	C	NM_019098	-		87670098	-1	no_errors	ENST00000408210	ensembl	human	novel	74_37	rna	SNP	1.000	T
LILRA3	11026	genome.wustl.edu	37	19	54802114	54802114	+	Silent	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr19:54802114G>A	ENST00000251390.3	-	6	1165	c.1074C>T	c.(1072-1074)acC>acT	p.T358T	LILRA3_ENST00000391745.1_Silent_p.T375T|LILRA3_ENST00000391744.3_Silent_p.T294T	NM_006865.3	NP_006856.3	Q8N6C8	LIRA3_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (without TM domain), member 3	358	Ig-like C2-type 4.				defense response (GO:0006952)|immune system process (GO:0002376)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|receptor activity (GO:0004872)			NS(3)|breast(1)|kidney(1)|large_intestine(3)|lung(12)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	28	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		CCCCCTCCTTGGTCAAAAGGA	0.592																																																	0								ENSG00000170866						98.0	86.0	90.0					19																	54802114		2194	4158	6352	LILRA3	SO:0001819	synonymous_variant	0			-	HGNC	U91926		19q13.4	2013-01-11						"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6604	protein-coding gene	gene with protein product		604818				9278324, 9548455	Standard	XM_006710242		Approved	LIR-4, HM43, ILT6, HM31, LIR4, CD85e		Q8N6C8		ENST00000251390.3:c.1074C>T	19.37:g.54802114G>A		Somatic	0	82	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	94	18.26	J3KPM2|O15469|O15470|O75016|Q8N151|Q8N154|Q8NHJ1|Q8NHJ2|Q8NHJ3|Q8NHJ4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pirsf_A1B_glyco/leuk_Ig-like_rcpt,pfscan_Ig-like_dom	p.T358	ENST00000251390.3	37	c.1074	CCDS12887.1	19																																																																																			-	pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pirsf_A1B_glyco/leuk_Ig-like_rcpt,pfscan_Ig-like_dom		0.592	LILRA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LILRA3	protein_coding	OTTHUMT00000140236.1	G		-		54802114	-1	no_errors	ENST00000251390	ensembl	human	known	74_37	silent	SNP	0.026	A
COL4A6	1288	genome.wustl.edu	37	X	107424153	107424153	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chrX:107424153C>T	ENST00000372216.4	-	24	2100	c.2000G>A	c.(1999-2001)gGa>gAa	p.G667E	COL4A6_ENST00000394872.2_Missense_Mutation_p.G667E|COL4A6_ENST00000538570.1_Missense_Mutation_p.G666E|COL4A6_ENST00000334504.7_Missense_Mutation_p.G666E|COL4A6_ENST00000545689.1_Missense_Mutation_p.G666E	NM_001847.2	NP_001838.2	Q14031	CO4A6_HUMAN	collagen, type IV, alpha 6	667	Triple-helical region.				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(41)|ovary(7)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	92						GCCTGGAAATCCTGATGGACC	0.488									Alport syndrome with Diffuse Leiomyomatosis																												Melanoma(87;1895 1945 2589 7165)												0								ENSG00000197565						121.0	100.0	107.0					X																	107424153		2203	4300	6503	COL4A6	SO:0001583	missense	0	Familial Cancer Database		-	HGNC	U04845	CCDS14541.1, CCDS14542.1, CCDS76008.1, CCDS76009.1, CCDS76010.1	Xq22	2014-09-17			ENSG00000197565	ENSG00000197565		"""Collagens"""	2208	protein-coding gene	gene with protein product		303631				8356449	Standard	NM_033641		Approved		uc004env.4	Q14031	OTTHUMG00000022179	ENST00000372216.4:c.2000G>A	X.37:g.107424153C>T	ENSP00000361290:p.Gly667Glu	Somatic	0	32	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	33	40.00	Q12823|Q14053|Q5JYH6|Q5JYH8|Q9NQM5|Q9NTX3|Q9UJ76|Q9UMG6|Q9Y4L4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Collagen,pfam_Collagen_VI_NC,superfamily_C-type_lectin_fold,smart_Collagen_VI_NC	p.G667E	ENST00000372216.4	37	c.2000	CCDS14541.1	X	.	.	.	.	.	.	.	.	.	.	C	16.33	3.094027	0.56075	.	.	ENSG00000197565	ENST00000372216;ENST00000334504;ENST00000394872;ENST00000541389;ENST00000545689;ENST00000538570	D;D;D;D;D	0.99353	-5.77;-5.77;-5.77;-5.77;-5.77	4.77	4.77	0.60923	.	0.000000	0.41605	D	0.000850	D	0.99694	0.9884	H	0.98295	4.195	0.47905	D	0.999545	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.97102	0.9798	10	0.87932	D	0	.	17.6736	0.88224	0.0:1.0:0.0:0.0	.	666;666;667;666	F5H851;F5H3Q5;Q14031;Q14031-2	.;.;CO4A6_HUMAN;.	E	667;666;667;666;666;666	ENSP00000361290:G667E;ENSP00000334733:G666E;ENSP00000378340:G667E;ENSP00000443707:G666E;ENSP00000445236:G666E	ENSP00000334733:G666E	G	-	2	0	COL4A6	107310809	1.000000	0.71417	0.936000	0.37596	0.763000	0.43281	5.760000	0.68793	2.299000	0.77371	0.506000	0.49869	GGA	-	pfam_Collagen		0.488	COL4A6-001	KNOWN	basic|CCDS	protein_coding	COL4A6	protein_coding	OTTHUMT00000057875.2	C		-		107424153	-1	no_errors	ENST00000372216	ensembl	human	known	74_37	missense	SNP	0.996	T
KRT75	9119	genome.wustl.edu	37	12	52826886	52826886	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr12:52826886C>T	ENST00000252245.5	-	2	869	c.649G>A	c.(649-651)Gag>Aag	p.E217K		NM_004693.2	NP_004684.2	O95678	K2C75_HUMAN	keratin 75	217	Coil 1B.|Rod.				hematopoietic progenitor cell differentiation (GO:0002244)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(13)|lung(10)|prostate(1)|skin(1)	28				BRCA - Breast invasive adenocarcinoma(357;0.192)		CTGCCCCTCTCGGTGGTGATG	0.557																																																	0								ENSG00000170454						115.0	107.0	110.0					12																	52826886		2203	4300	6503	KRT75	SO:0001583	missense	0			-	HGNC	Y19212	CCDS8827.1	12q13.13	2013-06-25			ENSG00000170454	ENSG00000170454		"""-"", ""Intermediate filaments type II, keratins (basic)"""	24431	protein-coding gene	gene with protein product		609025				9856802, 10692104, 16831889	Standard	NM_004693		Approved	K6HF	uc001saj.2	O95678	OTTHUMG00000169592	ENST00000252245.5:c.649G>A	12.37:g.52826886C>T	ENSP00000252245:p.Glu217Lys	Somatic	0	31	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	39	20.41	B4DQU4|Q9NSA9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_IF,superfamily_Prefoldin,prints_Keratin_II	p.E217K	ENST00000252245.5	37	c.649	CCDS8827.1	12	.	.	.	.	.	.	.	.	.	.	C	21.7	4.191405	0.78902	.	.	ENSG00000170454	ENST00000252245	D	0.90324	-2.65	5.77	3.95	0.45737	Filament (1);	0.000000	0.53938	D	0.000042	D	0.95790	0.8630	M	0.93241	3.395	0.41051	D	0.985301	D	0.65815	0.995	D	0.63381	0.914	D	0.96056	0.9035	10	0.87932	D	0	.	12.7179	0.57125	0.0:0.866:0.0:0.134	.	217	O95678	K2C75_HUMAN	K	217	ENSP00000252245:E217K	ENSP00000252245:E217K	E	-	1	0	KRT75	51113153	1.000000	0.71417	0.640000	0.29408	0.511000	0.34104	6.042000	0.70996	0.788000	0.33755	0.655000	0.94253	GAG	-	pfam_IF		0.557	KRT75-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT75	protein_coding	OTTHUMT00000404968.1	C	NM_004693	-		52826886	-1	no_errors	ENST00000252245	ensembl	human	known	74_37	missense	SNP	0.998	T
TJP3	27134	genome.wustl.edu	37	19	3747891	3747891	+	Missense_Mutation	SNP	G	G	A	rs144472063	byFrequency	TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr19:3747891G>A	ENST00000541714.2	+	19	2884	c.2422G>A	c.(2422-2424)Gag>Aag	p.E808K	TJP3_ENST00000587686.1_Missense_Mutation_p.E827K|TJP3_ENST00000262968.9_Missense_Mutation_p.E841K|TJP3_ENST00000539908.2_Missense_Mutation_p.E772K|TJP3_ENST00000589378.1_Missense_Mutation_p.E817K|TJP3_ENST00000382008.3_Missense_Mutation_p.E822K	NM_001267560.1	NP_001254489.1	O95049	ZO3_HUMAN	tight junction protein 3	808					regulation of G1/S transition of mitotic cell cycle (GO:2000045)	apical plasma membrane (GO:0016324)|nucleus (GO:0005634)|tight junction (GO:0005923)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	26				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0118)|STAD - Stomach adenocarcinoma(1328;0.18)		CAGCGACTACGAGACGGACGG	0.677													G|||	2	0.000399361	0.0008	0.0014	5008	,	,		16795	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000105289	G	LYS/GLU	1,4403	2.1+/-5.4	0,1,2201	35.0	30.0	32.0		2521	4.5	0.8	19	dbSNP_134	32	0,8596		0,0,4298	no	missense	TJP3	NM_014428.1	56	0,1,6499	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	841/953	3747891	1,12999	2202	4298	6500	TJP3	SO:0001583	missense	0			GMAF=0.0005	HGNC	AC005954	CCDS32873.1, CCDS32873.2, CCDS59332.1	19p13.3	2012-07-12	2012-07-12			ENSG00000105289			11829	protein-coding gene	gene with protein product	"""zona occludens 3"""	612689					Standard	NM_001267560		Approved	ZO-3	uc010xhu.3	O95049		ENST00000541714.2:c.2422G>A	19.37:g.3747891G>A	ENSP00000439278:p.Glu808Lys	Somatic	1	165	0.60		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	31	139	18.24	A6NFP3|B3KR73|B3KXZ0|B4E2W6|F5H2X0|F5H4S9|K7EK22|Q32N01	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PDZ,pfam_SH3_2,pfam_GK/Ca_channel_bsu,superfamily_PDZ,superfamily_P-loop_NTPase,superfamily_SH3_domain,smart_PDZ,smart_SH3_domain,smart_GK/Ca_channel_bsu,pfscan_PDZ,pfscan_SH3_domain,pfscan_Guanylate_kin-like,prints_ZonOcculS3,prints_ZonOcculdens	p.E841K	ENST00000541714.2	37	c.2521	CCDS32873.2	19	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	21.2	4.114574	0.77210	2.27E-4	0.0	ENSG00000105289	ENST00000541714;ENST00000539908;ENST00000382008;ENST00000262968	T;T;T;T	0.11821	2.76;2.93;2.74;2.81	4.54	4.54	0.55810	.	0.112463	0.64402	D	0.000016	T	0.39410	0.1077	M	0.77820	2.39	0.51482	D	0.999924	D;D;D;D	0.89917	1.0;1.0;0.998;1.0	D;D;P;D	0.76575	0.946;0.988;0.771;0.946	T	0.40850	-0.9541	10	0.87932	D	0	.	16.2624	0.82553	0.0:0.0:1.0:0.0	.	827;841;822;808	O95049-3;O95049-2;O95049;F5H2X0	.;.;ZO3_HUMAN;.	K	808;772;822;841	ENSP00000439278:E808K;ENSP00000439991:E772K;ENSP00000371438:E822K;ENSP00000262968:E841K	ENSP00000262968:E841K	E	+	1	0	TJP3	3698891	1.000000	0.71417	0.841000	0.33234	0.048000	0.14542	7.375000	0.79646	2.062000	0.61559	0.561000	0.74099	GAG	-	prints_ZonOcculdens		0.677	TJP3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	TJP3	protein_coding	OTTHUMT00000453434.1	G		rs144472063		3747891	+1	no_errors	ENST00000262968	ensembl	human	known	74_37	missense	SNP	1.000	A
ABCC12	94160	genome.wustl.edu	37	16	48145570	48145570	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr16:48145570G>A	ENST00000311303.3	-	15	2473	c.2128C>T	c.(2128-2130)Cct>Tct	p.P710S	ABCC12_ENST00000416054.1_3'UTR|ABCC12_ENST00000448542.1_Missense_Mutation_p.P710S	NM_033226.2	NP_150229.2	Q96J65	MRP9_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 12	710						integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			NS(1)|breast(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|liver(1)|lung(43)|ovary(2)|prostate(3)|skin(7)|urinary_tract(1)	90		all_cancers(37;0.0474)|all_lung(18;0.047)				AGGTGTTCAGGATCCTGGAGA	0.498																																																	0								ENSG00000140798						200.0	208.0	206.0					16																	48145570		2201	4300	6501	ABCC12	SO:0001583	missense	0			-	HGNC	AY040220	CCDS10730.1	16q12.1	2012-03-14			ENSG00000140798	ENSG00000140798		"""ATP binding cassette transporters / subfamily C"""	14640	protein-coding gene	gene with protein product		607041				11435397, 11483364	Standard	NM_033226		Approved	MRP9	uc002efc.1	Q96J65	OTTHUMG00000133143	ENST00000311303.3:c.2128C>T	16.37:g.48145570G>A	ENSP00000311030:p.Pro710Ser	Somatic	0	60	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	57	10.94	Q49AL2|Q8TAF0|Q8TEY2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_P-loop_NTPase,superfamily_ABC1_TM_dom,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom	p.P710S	ENST00000311303.3	37	c.2128	CCDS10730.1	16	.	.	.	.	.	.	.	.	.	.	G	10.42	1.346201	0.24426	.	.	ENSG00000140798	ENST00000311303;ENST00000448542;ENST00000449939	D;D	0.92495	-2.78;-3.05	5.19	5.19	0.71726	.	0.401974	0.25151	N	0.032757	D	0.87830	0.6276	L	0.45470	1.425	0.80722	D	1	B	0.12630	0.006	B	0.14023	0.01	T	0.82510	-0.0421	10	0.10377	T	0.69	.	14.2008	0.65703	0.0:0.0:1.0:0.0	.	710	Q96J65	MRP9_HUMAN	S	710;710;652	ENSP00000311030:P710S;ENSP00000401855:P710S	ENSP00000311030:P710S	P	-	1	0	ABCC12	46703071	1.000000	0.71417	1.000000	0.80357	0.202000	0.24057	5.182000	0.65059	2.417000	0.82017	0.561000	0.74099	CCT	-	NULL		0.498	ABCC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCC12	protein_coding	OTTHUMT00000256837.1	G	NM_033226	-		48145570	-1	no_errors	ENST00000311303	ensembl	human	known	74_37	missense	SNP	1.000	A
ATOH8	84913	genome.wustl.edu	37	2	86014817	86014817	+	3'UTR	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr2:86014817C>T	ENST00000306279.3	+	0	2066					NM_032827.6	NP_116216.2	Q96SQ7	ATOH8_HUMAN	atonal homolog 8 (Drosophila)						cell differentiation (GO:0030154)|nervous system development (GO:0007399)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			cervix(1)|endometrium(1)|large_intestine(1)|lung(2)	5						GCCAGCCTCTCCTCACTGTGA	0.597																																																	0								ENSG00000168874																																			ATOH8	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AK074681	CCDS1985.1	2p11.2	2013-05-21			ENSG00000168874	ENSG00000168874		"""Basic helix-loop-helix proteins"""	24126	protein-coding gene	gene with protein product	"""basic helix loop helix transcription factor 6"""					12419857	Standard	NM_032827		Approved	HATH6, FLJ14708, bHLHa21	uc002sqn.3	Q96SQ7	OTTHUMG00000130178	ENST00000306279.3:c.*804C>T	2.37:g.86014817C>T		Somatic	0	36	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	25	13.79	Q504S2|Q659B0	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000306279.3	37	NULL	CCDS1985.1	2																																																																																			-	-		0.597	ATOH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATOH8	protein_coding	OTTHUMT00000252496.1	C	NM_032827	-		86014817	+1	no_errors	ENST00000469442	ensembl	human	known	74_37	rna	SNP	0.000	T
LRRD1	401387	genome.wustl.edu	37	7	91793031	91793031	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr7:91793031C>T	ENST00000458448.1	-	2	1686	c.1486G>A	c.(1486-1488)Gga>Aga	p.G496R	CTB-161K23.1_ENST00000453068.1_RNA|LRRD1_ENST00000430130.2_Missense_Mutation_p.G496R|LRRD1_ENST00000343318.5_Intron|LRRD1_ENST00000422722.1_Intron|LRRD1_ENST00000454089.2_5'UTR			A4D1F6	LRRD1_HUMAN	leucine-rich repeats and death domain containing 1	496					signal transduction (GO:0007165)					breast(4)|endometrium(1)	5						ATATAATTTCCATTAACACTC	0.279																																																	0								ENSG00000240720						31.0	27.0	28.0					7																	91793031		692	1571	2263	LRRD1	SO:0001583	missense	0			-	HGNC	BC026112	CCDS55124.1	7q21.2	2011-05-23			ENSG00000240720	ENSG00000240720			34300	protein-coding gene	gene with protein product							Standard	NM_001161528		Approved	IMAGE:4798971	uc011khp.1	A4D1F6	OTTHUMG00000155861	ENST00000458448.1:c.1486G>A	7.37:g.91793031C>T	ENSP00000405987:p.Gly496Arg	Somatic	0	47	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	38	13.64	B7ZMM9|Q49AT9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Leu-rich_rpt,superfamily_DEATH-like_dom,smart_Leu-rich_rpt_typical-subtyp,pfscan_Death_domain	p.G496R	ENST00000458448.1	37	c.1486	CCDS55124.1	7	.	.	.	.	.	.	.	.	.	.	C	15.57	2.873636	0.51695	.	.	ENSG00000240720	ENST00000458448;ENST00000430130	T;T	0.26223	1.75;1.75	5.5	5.5	0.81552	.	.	.	.	.	T	0.36331	0.0963	L	0.38175	1.15	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.04103	-1.0977	9	0.27082	T	0.32	.	9.3756	0.38281	0.0:0.7786:0.1454:0.0759	.	496	A4D1F6	LRRD1_HUMAN	R	496	ENSP00000405987:G496R;ENSP00000411568:G496R	ENSP00000411568:G496R	G	-	1	0	LRRD1	91630967	1.000000	0.71417	1.000000	0.80357	0.915000	0.54546	2.544000	0.45761	2.576000	0.86940	0.585000	0.79938	GGA	-	smart_Leu-rich_rpt_typical-subtyp		0.279	LRRD1-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	LRRD1	protein_coding	OTTHUMT00000342027.2	C	NM_001045475	-		91793031	-1	no_errors	ENST00000430130	ensembl	human	known	74_37	missense	SNP	1.000	T
RTL1	388015	genome.wustl.edu	37	14	101350316	101350316	+	Silent	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr14:101350316G>A	ENST00000534062.1	-	1	868	c.810C>T	c.(808-810)ttC>ttT	p.F270F	MIR431_ENST00000385266.1_RNA|MIR432_ENST00000606207.1_RNA|MIR127_ENST00000384876.1_RNA|MIR136_ENST00000385207.1_RNA|MIR433_ENST00000384837.1_RNA	NM_001134888.2	NP_001128360.1	A6NKG5	RTL1_HUMAN	retrotransposon-like 1	270					multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)				breast(1)|endometrium(5)|kidney(4)|large_intestine(1)|lung(5)|pancreas(1)|prostate(2)|skin(2)	21						TGGCCTCCAGGAAGGCTGGGA	0.577																																																	0								ENSG00000254656						66.0	58.0	60.0					14																	101350316		692	1591	2283	RTL1	SO:0001819	synonymous_variant	0			-	HGNC		CCDS53910.1	14q32.2	2012-04-18			ENSG00000254656	ENSG00000254656			14665	protein-coding gene	gene with protein product		611896				16155747, 15854907, 12796779	Standard	NM_001134888		Approved	PEG11, MART1, Mar1	uc010txj.1	A6NKG5	OTTHUMG00000167573	ENST00000534062.1:c.810C>T	14.37:g.101350316G>A		Somatic	0	38	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	26	25.71	E9PKS8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Retrotrans_gag_dom,superfamily_Peptidase_aspartic_dom	p.F270	ENST00000534062.1	37	c.810	CCDS53910.1	14																																																																																			-	pfam_Retrotrans_gag_dom		0.577	RTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RTL1	protein_coding	OTTHUMT00000395127.1	G	NM_001134888	-		101350316	-1	no_errors	ENST00000534062	ensembl	human	known	74_37	silent	SNP	1.000	A
DMRT3	58524	genome.wustl.edu	37	9	990189	990189	+	Silent	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr9:990189G>A	ENST00000190165.2	+	2	641	c.603G>A	c.(601-603)gaG>gaA	p.E201E		NM_021240.2	NP_067063.1	Q9NQL9	DMRT3_HUMAN	doublesex and mab-3 related transcription factor 3	201					adult walking behavior (GO:0007628)|male sex differentiation (GO:0046661)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|sex differentiation (GO:0007548)|transcription, DNA-templated (GO:0006351)|transmission of nerve impulse (GO:0019226)|ventral spinal cord interneuron specification (GO:0021521)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|large_intestine(5)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	26		all_lung(10;1.39e-08)|Lung NSC(10;1.42e-08)		Lung(218;0.0196)		TGTCCGTGGAGGAAGGGGGAT	0.582																																																	0								ENSG00000064218						55.0	61.0	59.0					9																	990189		2203	4300	6503	DMRT3	SO:0001819	synonymous_variant	0			-	HGNC	AJ301581	CCDS6443.1	9p24.3	2008-07-21	2001-12-17	2001-12-07	ENSG00000064218	ENSG00000064218			13909	protein-coding gene	gene with protein product	"""testis-specific protein"""	614754	"""DMRT-like family A3"""	DMRTA3		11543627, 10729223	Standard	NM_021240		Approved		uc003zgw.2	Q9NQL9	OTTHUMG00000019436	ENST00000190165.2:c.603G>A	9.37:g.990189G>A		Somatic	0	37	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	30	33.33	Q7LA03|Q7LCH8|Q96SC7|Q9NRQ9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_DM_DNA-bd,pfam_DMA,superfamily_DM_DNA-bd,superfamily_UBA-like,smart_DM_DNA-bd,pfscan_DM_DNA-bd	p.E201	ENST00000190165.2	37	c.603	CCDS6443.1	9																																																																																			-	NULL		0.582	DMRT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMRT3	protein_coding	OTTHUMT00000051490.1	G	NM_021240	-		990189	+1	no_errors	ENST00000190165	ensembl	human	known	74_37	silent	SNP	0.909	A
HNRNPM	4670	genome.wustl.edu	37	19	8538588	8538588	+	Missense_Mutation	SNP	G	G	A	rs140407642	byFrequency	TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr19:8538588G>A	ENST00000325495.4	+	11	1079	c.1038G>A	c.(1036-1038)atG>atA	p.M346I	HNRNPM_ENST00000348943.3_Missense_Mutation_p.M307I	NM_005968.4	NP_005959.2	P52272	HNRPM_HUMAN	heterogeneous nuclear ribonucleoprotein M	346					alternative mRNA splicing, via spliceosome (GO:0000380)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|paraspeckles (GO:0042382)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein domain specific binding (GO:0019904)|RNA binding (GO:0003723)			endometrium(5)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)	25						TAAATAAAATGGGAGGTAAGA	0.303													G|||	3	0.000599042	0.0023	0.0	5008	,	,		16919	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000099783	G	ILE/MET,ILE/MET	4,4402	8.1+/-20.4	0,4,2199	67.0	67.0	67.0		1038,921	1.5	1.0	19	dbSNP_134	67	0,8592		0,0,4296	no	missense,missense	HNRNPM	NM_005968.4,NM_031203.3	10,10	0,4,6495	AA,AG,GG		0.0,0.0908,0.0308	benign,benign	346/731,307/692	8538588	4,12994	2203	4296	6499	HNRNPM	SO:0001583	missense	0			-	HGNC	L03532	CCDS12203.1, CCDS12204.1	19p13.2	2013-06-12		2008-04-18	ENSG00000099783	ENSG00000099783		"""RNA binding motif (RRM) containing"""	5046	protein-coding gene	gene with protein product	"""CEA receptor"""	160994		NAGR1, HNRPM		8441656, 7558047	Standard	NM_005968		Approved	HTGR1, HNRNPM4, HNRPM4, CEAR	uc010dwe.3	P52272	OTTHUMG00000182383	ENST00000325495.4:c.1038G>A	19.37:g.8538588G>A	ENSP00000325376:p.Met346Ile	Somatic	0	23	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	35	18.60	Q15584|Q8WZ44|Q96H56|Q9BWL9|Q9Y492	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RRM_dom,pfam_HnRNP_M_PY-NLS,smart_RRM_dom,pfscan_RRM_dom	p.M346I	ENST00000325495.4	37	c.1038	CCDS12203.1	19	.	.	.	.	.	.	.	.	.	.	G	9.363	1.068499	0.20067	9.08E-4	0.0	ENSG00000099783	ENST00000325495;ENST00000348943	T;T	0.15256	2.44;2.74	4.9	1.48	0.22813	.	0.444441	0.23389	N	0.048702	T	0.12135	0.0295	L	0.52126	1.63	0.41948	D	0.990644	B;B	0.17667	0.023;0.001	B;B	0.14578	0.011;0.002	T	0.15549	-1.0433	10	0.13108	T	0.6	.	5.6068	0.17385	0.0792:0.1392:0.6374:0.1441	.	346;307	P52272;P52272-2	HNRPM_HUMAN;.	I	346;307	ENSP00000325376:M346I;ENSP00000325732:M307I	ENSP00000325376:M346I	M	+	3	0	HNRNPM	8444588	1.000000	0.71417	0.999000	0.59377	0.949000	0.60115	2.396000	0.44468	0.194000	0.20326	0.485000	0.47835	ATG	-	NULL		0.303	HNRNPM-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HNRNPM	protein_coding	OTTHUMT00000460894.1	G		rs140407642		8538588	+1	no_errors	ENST00000325495	ensembl	human	known	74_37	missense	SNP	1.000	A
GBP2	2634	genome.wustl.edu	37	1	89582835	89582835	+	Silent	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr1:89582835G>A	ENST00000370466.3	-	6	976	c.708C>T	c.(706-708)ttC>ttT	p.F236F	GBP2_ENST00000463660.1_5'UTR	NM_004120.3	NP_004111.2	P32456	GBP2_HUMAN	guanylate binding protein 2, interferon-inducible	236	GB1/RHD3-type G.|GTPase domain (Globular). {ECO:0000250}.				cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|interferon-gamma-mediated signaling pathway (GO:0060333)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(2)|skin(1)	20		Lung NSC(277;0.0908)		all cancers(265;0.0151)|Epithelial(280;0.0284)		CGGGCCAATCGAAGACGAAGC	0.428																																																	0								ENSG00000162645						98.0	92.0	94.0					1																	89582835		2203	4300	6503	GBP2	SO:0001819	synonymous_variant	0			-	HGNC	BC073163	CCDS719.1	1p22.2	2008-02-05			ENSG00000162645	ENSG00000162645			4183	protein-coding gene	gene with protein product		600412				1715024	Standard	NM_004120		Approved		uc001dmz.1	P32456	OTTHUMG00000010662	ENST00000370466.3:c.708C>T	1.37:g.89582835G>A		Somatic	0	41	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	58	10.77	Q6GPH0|Q6IAU2|Q86TB0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Guanylate-bd_C,pfam_Guanylate-bd_N,superfamily_Guanylate-bd_C,superfamily_P-loop_NTPase	p.F236	ENST00000370466.3	37	c.708	CCDS719.1	1																																																																																			-	pfam_Guanylate-bd_N,superfamily_P-loop_NTPase		0.428	GBP2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	GBP2	protein_coding	OTTHUMT00000029406.2	G	NM_004120	-		89582835	-1	no_errors	ENST00000370466	ensembl	human	known	74_37	silent	SNP	0.954	A
GRIN2B	2904	genome.wustl.edu	37	12	13906442	13906442	+	Silent	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr12:13906442G>A	ENST00000609686.1	-	3	1028	c.819C>T	c.(817-819)ttC>ttT	p.F273F		NM_000834.3	NP_000825.2	Q13224	NMDE2_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2B	273					behavioral fear response (GO:0001662)|behavioral response to pain (GO:0048266)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|glutamate receptor signaling pathway (GO:0007215)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning (GO:0007612)|learning or memory (GO:0007611)|memory (GO:0007613)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic plasticity (GO:0048167)|response to ethanol (GO:0045471)|sensory organ development (GO:0007423)|startle response (GO:0001964)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(12)|liver(1)|lung(70)|ovary(4)|prostate(6)|skin(10)|upper_aerodigestive_tract(5)|urinary_tract(1)	143					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Haloperidol(DB00502)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	GCCCAGTGGGGAACTCCGCAG	0.542																																																	0								ENSG00000273079						85.0	77.0	80.0					12																	13906442		2203	4300	6503	GRIN2B	SO:0001819	synonymous_variant	0			-	HGNC		CCDS8662.1	12p13.1	2014-07-16			ENSG00000273079			"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4586	protein-coding gene	gene with protein product		138252		NMDAR2B		1350383	Standard	NM_000834		Approved	GluN2B	uc001rbt.2	Q13224	OTTHUMG00000137373	ENST00000609686.1:c.819C>T	12.37:g.13906442G>A		Somatic	0	24	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	34	20.93	Q12919|Q13220|Q13225|Q14CU4|Q9UM56	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_NMDAR2_C,pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.F273	ENST00000609686.1	37	c.819	CCDS8662.1	12																																																																																			-	pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I		0.542	GRIN2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIN2B	protein_coding	OTTHUMT00000268014.2	G		-		13906442	-1	no_errors	ENST00000609686	ensembl	human	known	74_37	silent	SNP	1.000	A
PTPRB	5787	genome.wustl.edu	37	12	70988263	70988263	+	Nonsense_Mutation	SNP	C	C	T	rs267603653		TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr12:70988263C>T	ENST00000261266.5	-	4	875	c.846G>A	c.(844-846)tgG>tgA	p.W282*	PTPRB_ENST00000538174.2_5'UTR|PTPRB_ENST00000538708.1_Nonsense_Mutation_p.W282*|PTPRB_ENST00000550857.1_Nonsense_Mutation_p.W282*|PTPRB_ENST00000451516.2_Nonsense_Mutation_p.W282*|PTPRB_ENST00000550358.1_Nonsense_Mutation_p.W500*|PTPRB_ENST00000334414.6_Nonsense_Mutation_p.W500*|PTPRB_ENST00000551525.1_Nonsense_Mutation_p.W499*	NM_002837.4	NP_002828.3	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	282	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|dephosphorylation (GO:0016311)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|protein dephosphorylation (GO:0006470)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(4)|central_nervous_system(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(46)|prostate(4)|skin(18)|upper_aerodigestive_tract(1)|urinary_tract(3)	107	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			TGACTAGTTTCCACCTGTAGT	0.428																																																	0								ENSG00000127329						117.0	114.0	115.0					12																	70988263		1933	4136	6069	PTPRB	SO:0001587	stop_gained	0			-	HGNC	X54131	CCDS44943.1, CCDS44944.1, CCDS55845.1, CCDS55846.1	12q15-q21	2013-02-11						"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9665	protein-coding gene	gene with protein product		176882		PTPB		2169617	Standard	NM_001109754		Approved		uc001swc.4	P23467	OTTHUMG00000169499	ENST00000261266.5:c.846G>A	12.37:g.70988263C>T	ENSP00000261266:p.Trp282*	Somatic	0	72	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	77	14.44	B7ZKS8|B7ZKT0|C9JX87|F5H3G6|Q14D85|Q3MIV7	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Fibronectin_type3,pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Ricin_B_lectin,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.W500*	ENST00000261266.5	37	c.1500	CCDS44944.1	12	.	.	.	.	.	.	.	.	.	.	C	32	5.191638	0.94923	.	.	ENSG00000127329	ENST00000334414;ENST00000451516;ENST00000550358;ENST00000544694;ENST00000538708;ENST00000550857;ENST00000261266;ENST00000551525;ENST00000548122	.	.	.	5.61	2.52	0.30459	.	0.336013	0.32884	N	0.005531	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.37606	T	0.19	.	5.1898	0.15203	0.3355:0.4876:0.0:0.1769	.	.	.	.	X	500;282;500;500;282;282;282;499;379	.	ENSP00000261266:W282X	W	-	3	0	PTPRB	69274530	0.999000	0.42202	0.400000	0.26346	0.879000	0.50718	1.024000	0.30077	0.738000	0.32606	0.655000	0.94253	TGG	-	pfscan_Fibronectin_type3		0.428	PTPRB-007	KNOWN	basic|CCDS	protein_coding	PTPRB	protein_coding	OTTHUMT00000404439.1	C		-		70988263	-1	no_errors	ENST00000334414	ensembl	human	known	74_37	nonsense	SNP	0.765	T
EFCAB6	64800	genome.wustl.edu	37	22	44079699	44079699	+	Silent	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr22:44079699G>A	ENST00000262726.7	-	12	1432	c.1179C>T	c.(1177-1179)atC>atT	p.I393I	EFCAB6_ENST00000396231.2_Silent_p.I241I|EFCAB6_ENST00000358439.4_Intron	NM_022785.3	NP_073622.2	Q5THR3	EFCB6_HUMAN	EF-hand calcium binding domain 6	393					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(16)|lung(25)|ovary(4)|pancreas(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	68		Ovarian(80;0.0247)|all_neural(38;0.025)				ACTTTGTGATGATGTTTTCCT	0.343																																																	0								ENSG00000186976						285.0	258.0	267.0					22																	44079699		2203	4300	6503	EFCAB6	SO:0001819	synonymous_variant	0			-	HGNC	Z82201	CCDS14049.1, CCDS14050.1	22q13.2	2013-01-10			ENSG00000186976	ENSG00000186976		"""EF-hand domain containing"""	24204	protein-coding gene	gene with protein product						11258795, 12612053	Standard	NM_022785		Approved	FLJ23588, DJBP, HSCBCIP1, KIAA1672, dJ185D5.1	uc003bdy.2	Q5THR3	OTTHUMG00000150522	ENST00000262726.7:c.1179C>T	22.37:g.44079699G>A		Somatic	0	62	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	41	22.64	A8K8P6|A8K8Y3|B0QYI4|B0QYI6|Q5U5T6|Q9BY88|Q9H5C4|Q9NSF5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_EF_hand_Ca-bd_contain_6,smart_EF_hand_dom,pfscan_EF_hand_dom	p.I393	ENST00000262726.7	37	c.1179	CCDS14049.1	22																																																																																			-	NULL		0.343	EFCAB6-010	KNOWN	basic|appris_principal|CCDS	protein_coding	EFCAB6	protein_coding	OTTHUMT00000353176.1	G	NM_022785	-		44079699	-1	no_errors	ENST00000262726	ensembl	human	known	74_37	silent	SNP	0.000	A
WDR72	256764	genome.wustl.edu	37	15	53994475	53994475	+	Silent	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr15:53994475C>T	ENST00000396328.1	-	12	1664	c.1425G>A	c.(1423-1425)tcG>tcA	p.S475S	WDR72_ENST00000360509.5_Silent_p.S475S|WDR72_ENST00000557913.1_Silent_p.S472S|WDR72_ENST00000559418.1_Silent_p.S485S	NM_001277176.1|NM_182758.2	NP_001264105.1|NP_877435.3	Q3MJ13	WDR72_HUMAN	WD repeat domain 72	475										NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(18)|lung(29)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	71				all cancers(107;0.0511)		GGTCTAATTTCGAAGAGAGAC	0.388																																																	0								ENSG00000166415						123.0	119.0	120.0					15																	53994475		2194	4293	6487	WDR72	SO:0001819	synonymous_variant	0			-	HGNC	BX537884	CCDS10151.1, CCDS73730.1	15q21.3	2013-01-09			ENSG00000166415	ENSG00000166415		"""WD repeat domain containing"""	26790	protein-coding gene	gene with protein product		613214					Standard	NM_182758		Approved	FLJ38736	uc002acj.2	Q3MJ13	OTTHUMG00000131939	ENST00000396328.1:c.1425G>A	15.37:g.53994475C>T		Somatic	0	70	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	71	17.44	Q7Z3I3|Q8N8X2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.S475	ENST00000396328.1	37	c.1425	CCDS10151.1	15																																																																																			-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom		0.388	WDR72-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WDR72	protein_coding	OTTHUMT00000254893.2	C	NM_182758	-		53994475	-1	no_errors	ENST00000360509	ensembl	human	known	74_37	silent	SNP	0.786	T
CGNL1	84952	genome.wustl.edu	37	15	57821011	57821011	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr15:57821011G>A	ENST00000281282.5	+	13	3277	c.3199G>A	c.(3199-3201)Gag>Aag	p.E1067K	CTD-2515H24.4_ENST00000566990.1_lincRNA	NM_001252335.1|NM_032866.4	NP_001239264.1|NP_116255.2	Q0VF96	CGNL1_HUMAN	cingulin-like 1	1067						myosin complex (GO:0016459)|tight junction (GO:0005923)	motor activity (GO:0003774)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(14)|ovary(4)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(1)	60				all cancers(107;0.121)|GBM - Glioblastoma multiforme(80;0.186)		CAAGCAGATGGAGGTCTGTGG	0.582																																																	0								ENSG00000128849						47.0	41.0	43.0					15																	57821011		2192	4292	6484	CGNL1	SO:0001583	missense	0			-	HGNC	AY274808	CCDS10161.1	15q21.3	2011-06-10			ENSG00000128849	ENSG00000128849			25931	protein-coding gene	gene with protein product		607856				11214970	Standard	NM_001252335		Approved	FLJ14957, JACOP, KIAA1749, paracingulin	uc002aeg.3	Q0VF96	OTTHUMG00000166485	ENST00000281282.5:c.3199G>A	15.37:g.57821011G>A	ENSP00000281282:p.Glu1067Lys	Somatic	0	40	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	31	13.89	Q05BZ4|Q52LR0|Q695C7|Q7Z2L3|Q96JV2|Q96MN6|Q9C0B4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Myosin_tail,prints_Tropomyosin	p.E1067K	ENST00000281282.5	37	c.3199	CCDS10161.1	15	.	.	.	.	.	.	.	.	.	.	G	35	5.438638	0.96168	.	.	ENSG00000128849	ENST00000281282	D	0.85861	-2.04	5.02	5.02	0.67125	Myosin tail (1);	0.286456	0.25622	N	0.029403	D	0.93959	0.8066	M	0.90814	3.15	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.95050	0.8186	10	0.87932	D	0	-38.0483	18.7116	0.91659	0.0:0.0:1.0:0.0	.	1067	Q0VF96	CGNL1_HUMAN	K	1067	ENSP00000281282:E1067K	ENSP00000281282:E1067K	E	+	1	0	CGNL1	55608303	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	8.759000	0.91667	2.469000	0.83416	0.563000	0.77884	GAG	-	pfam_Myosin_tail		0.582	CGNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CGNL1	protein_coding	OTTHUMT00000255482.2	G	NM_032866	-		57821011	+1	no_errors	ENST00000281282	ensembl	human	known	74_37	missense	SNP	1.000	A
DNAH7	56171	genome.wustl.edu	37	2	196729166	196729166	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr2:196729166C>T	ENST00000312428.6	-	41	7313	c.7213G>A	c.(7213-7215)Gaa>Aaa	p.E2405K		NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	2405	AAA 4. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)			NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						AAAGACTCTTCTTTAATTTGA	0.383																																																	0								ENSG00000118997						91.0	87.0	88.0					2																	196729166		1883	4106	5989	DNAH7	SO:0001583	missense	0			-	HGNC	AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.7213G>A	2.37:g.196729166C>T	ENSP00000311273:p.Glu2405Lys	Somatic	0	39	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	39	18.75	B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,superfamily_P-loop_NTPase,superfamily_Signal_recog_particle_SRP9/14,smart_AAA+_ATPase,pfscan_EF_hand_dom	p.E2405K	ENST00000312428.6	37	c.7213	CCDS42794.1	2	.	.	.	.	.	.	.	.	.	.	T	8.342	0.828912	0.16749	.	.	ENSG00000118997	ENST00000312428	T	0.39997	1.05	5.34	2.88	0.33553	Dynein heavy chain, P-loop containing D4 domain (1);	0.397553	0.26907	N	0.021899	T	0.36054	0.0953	L	0.57130	1.785	0.09310	N	1	B	0.06786	0.001	B	0.17722	0.019	T	0.27123	-1.0083	10	0.34782	T	0.22	.	7.7812	0.29066	0.0:0.0686:0.2614:0.67	.	2405	Q8WXX0	DYH7_HUMAN	K	2405	ENSP00000311273:E2405K	ENSP00000311273:E2405K	E	-	1	0	DNAH7	196437411	0.636000	0.27207	0.504000	0.27639	0.646000	0.38490	1.648000	0.37271	0.113000	0.18004	-1.179000	0.01719	GAA	-	superfamily_P-loop_NTPase		0.383	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH7	protein_coding	OTTHUMT00000335202.3	C	NM_018897	-		196729166	-1	no_errors	ENST00000312428	ensembl	human	known	74_37	missense	SNP	0.038	T
GRM8	2918	genome.wustl.edu	37	7	126078688	126078688	+	3'UTR	SNP	A	A	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr7:126078688A>T	ENST00000339582.2	-	0	4020				GRM8_ENST00000444921.2_3'UTR|GRM8_ENST00000358373.3_3'UTR			O00222	GRM8_HUMAN	glutamate receptor, metabotropic 8						adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of cAMP biosynthetic process (GO:0030818)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of smell (GO:0007608)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(16)|lung(62)|ovary(5)|pancreas(1)|prostate(1)|skin(14)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(4)	125		Prostate(267;0.186)				ttagaaataaattatttgtat	0.333										HNSCC(24;0.065)																																							0								ENSG00000179603																																			GRM8	SO:0001624	3_prime_UTR_variant	0			-	HGNC		CCDS5794.1, CCDS47696.1	7q31.3-q32.1	2012-08-29			ENSG00000179603	ENSG00000179603		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4600	protein-coding gene	gene with protein product		601116				8824806	Standard	NM_000845		Approved	GLUR8, GPRC1H, mGlu8, MGLUR8	uc003vlr.2	O00222	OTTHUMG00000022888	ENST00000339582.2:c.*485T>A	7.37:g.126078688A>T		Somatic	0	45	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	48	18.64	A4D0Y3|B0FZ74|B0M0L0|O15493|O95945|O95946|Q3MIV9|Q52M02|Q6J165	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000339582.2	37	NULL	CCDS5794.1	7																																																																																			-	-		0.333	GRM8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRM8	protein_coding	OTTHUMT00000059209.4	A		-		126078688	-1	no_errors	ENST00000489939	ensembl	human	known	74_37	rna	SNP	1.000	T
GRIK1	2897	genome.wustl.edu	37	21	30959769	30959769	+	Silent	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr21:30959769G>A	ENST00000399907.1	-	12	2121	c.1710C>T	c.(1708-1710)ttC>ttT	p.F570F	GRIK1_ENST00000399909.1_Silent_p.F555F|GRIK1_ENST00000389124.2_Silent_p.F570F|GRIK1_ENST00000309434.7_Silent_p.F572F|GRIK1_ENST00000535441.1_Silent_p.F572F|GRIK1_ENST00000327783.4_Silent_p.F570F|GRIK1_ENST00000399914.1_Silent_p.F555F|GRIK1_ENST00000389125.3_Silent_p.F555F|GRIK1_ENST00000399913.1_Silent_p.F570F	NM_000830.3	NP_000821.1	P39086	GRIK1_HUMAN	glutamate receptor, ionotropic, kainate 1	570					adult behavior (GO:0030534)|behavioral response to pain (GO:0048266)|central nervous system development (GO:0007417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|nervous system development (GO:0007399)|positive regulation of gamma-aminobutyric acid secretion (GO:0014054)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(18)|ovary(1)|prostate(4)|skin(1)|stomach(1)|urinary_tract(1)	45					Topiramate(DB00273)	GGGGGTTGAGGAAGGAGAAAA	0.483																																																	0								ENSG00000171189						96.0	81.0	86.0					21																	30959769		2203	4300	6503	GRIK1	SO:0001819	synonymous_variant	0			-	HGNC		CCDS33530.1, CCDS42913.1	21q22	2012-08-29			ENSG00000171189	ENSG00000171189		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4579	protein-coding gene	gene with protein product		138245		GLUR5		8468067	Standard	XM_005260942		Approved	GluK1	uc002yno.1	P39086	OTTHUMG00000078879	ENST00000399907.1:c.1710C>T	21.37:g.30959769G>A		Somatic	0	44	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	49	9.26	Q13001|Q86SU9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.F572	ENST00000399907.1	37	c.1716	CCDS42913.1	21																																																																																			-	pfam_SBP_bac_3,smart_Iontro_glu_rcpt		0.483	GRIK1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRIK1	protein_coding	OTTHUMT00000171979.1	G		-		30959769	-1	no_errors	ENST00000535441	ensembl	human	known	74_37	silent	SNP	1.000	A
CTD-2555A7.2	0	genome.wustl.edu	37	16	89114070	89114070	+	lincRNA	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr16:89114070C>T	ENST00000537498.1	-	0	663																											GAAGGCAGATCGTCCCGAGGC	0.617																																																	0								ENSG00000256982																																			CTD-2555A7.2			0			-	Clone_based_vega_gene																													16.37:g.89114070C>T		Somatic	0	53	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	67	24.72		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000537498.1	37	NULL		16																																																																																			-	-		0.617	CTD-2555A7.2-001	KNOWN	basic	lincRNA	ENSG00000256982	lincRNA	OTTHUMT00000430645.1	C		-		89114070	-1	no_errors	ENST00000537498	ensembl	human	known	74_37	rna	SNP	0.000	T
RSF1	51773	genome.wustl.edu	37	11	77378474	77378474	+	Nonsense_Mutation	SNP	G	G	A	rs374487749		TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr11:77378474G>A	ENST00000308488.6	-	16	4116	c.3814C>T	c.(3814-3816)Cga>Tga	p.R1272*	RSF1_ENST00000480887.1_Nonsense_Mutation_p.R1020*|RSF1_ENST00000360355.2_Nonsense_Mutation_p.R1241*			Q96T23	RSF1_HUMAN	remodeling and spacing factor 1	1272					CENP-A containing nucleosome assembly (GO:0034080)|chromatin remodeling (GO:0006338)|DNA-templated transcription, initiation (GO:0006352)|negative regulation of DNA binding (GO:0043392)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of viral transcription (GO:0050434)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|RSF complex (GO:0031213)	histone binding (GO:0042393)|zinc ion binding (GO:0008270)	p.R1272*(1)		breast(3)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(9)|lung(14)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	43	all_cancers(14;1.54e-17)|all_epithelial(13;4.06e-20)|Ovarian(111;0.152)		Epithelial(5;3e-50)|all cancers(3;6.37e-47)|BRCA - Breast invasive adenocarcinoma(5;9.82e-31)			CCCCGCTTTCGAACTGACCGC	0.483																																																	1	Substitution - Nonsense(1)	large_intestine(1)						ENSG00000048649						74.0	74.0	74.0					11																	77378474		2200	4292	6492	RSF1	SO:0001587	stop_gained	0			-	HGNC	AF380176, AF227948	CCDS8253.1	11q14.1	2013-01-28	2006-05-25	2006-05-25	ENSG00000048649	ENSG00000048649		"""Zinc fingers, PHD-type"""	18118	protein-coding gene	gene with protein product		608522	"""hepatitis B virus x associated protein"""	HBXAP		11788598, 12972596	Standard	NM_016578		Approved	XAP8, RSF-1, p325	uc001oyn.3	Q96T23	OTTHUMG00000150433	ENST00000308488.6:c.3814C>T	11.37:g.77378474G>A	ENSP00000311513:p.Arg1272*	Somatic	0	45	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	49	16.95	Q86X86|Q9H3L8|Q9NVZ8|Q9NYU0	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.R1272*	ENST00000308488.6	37	c.3814	CCDS8253.1	11	.	.	.	.	.	.	.	.	.	.	G	48	13.910734	0.99770	.	.	ENSG00000048649	ENST00000308488;ENST00000480887;ENST00000360355	.	.	.	5.13	4.22	0.49857	.	0.182394	0.26987	N	0.021485	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-5.4901	13.1533	0.59503	0.0776:0.0:0.9223:0.0	.	.	.	.	X	1272;1020;1241	.	ENSP00000311513:R1272X	R	-	1	2	RSF1	77056122	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	3.917000	0.56424	1.397000	0.46682	0.462000	0.41574	CGA	-	NULL		0.483	RSF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RSF1	protein_coding	OTTHUMT00000318075.2	G	NM_016578	-		77378474	-1	no_errors	ENST00000308488	ensembl	human	known	74_37	nonsense	SNP	1.000	A
GRID2	2895	genome.wustl.edu	37	4	94436461	94436461	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr4:94436461C>T	ENST00000282020.4	+	13	2350	c.2092C>T	c.(2092-2094)Cct>Tct	p.P698S	GRID2_ENST00000510992.1_Missense_Mutation_p.P603S	NM_001510.2	NP_001501.2	O43424	GRID2_HUMAN	glutamate receptor, ionotropic, delta 2	698					cellular protein localization (GO:0034613)|cerebellar granule cell differentiation (GO:0021707)|glutamate receptor signaling pathway (GO:0007215)|heterophilic cell-cell adhesion (GO:0007157)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|ionotropic glutamate receptor complex (GO:0008328)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|PDZ domain binding (GO:0030165)|scaffold protein binding (GO:0097110)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(18)|lung(45)|ovary(3)|prostate(6)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(1)	100		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)		AGGACTGAATCCTTTTGAGAG	0.478																																																	0								ENSG00000152208						120.0	106.0	110.0					4																	94436461		2203	4300	6503	GRID2	SO:0001583	missense	0			-	HGNC	AF009014	CCDS3637.1, CCDS68758.1	4q22	2012-08-29			ENSG00000152208	ENSG00000152208		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4576	protein-coding gene	gene with protein product		602368				9465309	Standard	NM_001510		Approved	GluD2, GluR-delta-2	uc011cdt.2	O43424	OTTHUMG00000130975	ENST00000282020.4:c.2092C>T	4.37:g.94436461C>T	ENSP00000282020:p.Pro698Ser	Somatic	0	43	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	68	16.05	E9PH24|Q4KKU8|Q4KKU9|Q4KKV0|Q59FZ1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Iontro_glu_rcpt,pfam_ANF_lig-bd_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.P698S	ENST00000282020.4	37	c.2092	CCDS3637.1	4	.	.	.	.	.	.	.	.	.	.	C	29.1	4.976546	0.92982	.	.	ENSG00000152208	ENST00000282020;ENST00000510992	T;T	0.14766	2.53;2.48	5.1	5.1	0.69264	Extracellular solute-binding protein, family 3 (1);Ionotropic glutamate receptor (2);	0.000000	0.85682	D	0.000000	T	0.41604	0.1166	M	0.76838	2.35	0.80722	D	1	D;D	0.89917	0.998;1.0	D;D	0.83275	0.985;0.996	T	0.36456	-0.9747	10	0.72032	D	0.01	.	18.8725	0.92320	0.0:1.0:0.0:0.0	.	603;698	E9PH24;O43424	.;GRID2_HUMAN	S	698;603	ENSP00000282020:P698S;ENSP00000421257:P603S	ENSP00000282020:P698S	P	+	1	0	GRID2	94655484	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.772000	0.85439	2.529000	0.85273	0.585000	0.79938	CCT	-	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,smart_Iontro_glu_rcpt		0.478	GRID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRID2	protein_coding	OTTHUMT00000253588.2	C		-		94436461	+1	no_errors	ENST00000282020	ensembl	human	known	74_37	missense	SNP	1.000	T
ICOSLG	23308	genome.wustl.edu	37	21	45649640	45649641	+	Intron	INS	-	-	ACG	rs7280853	byFrequency	TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr21:45649640_45649641insACG	ENST00000407780.3	-	6	1026				ICOSLG_ENST00000400377.3_Intron|ICOSLG_ENST00000400379.3_In_Frame_Ins_p.398_399PD>PRD|ICOSLG_ENST00000344330.4_Intron	NM_001283052.1	NP_001269981.1	O75144	ICOSL_HUMAN	inducible T-cell co-stimulator ligand						B cell activation (GO:0042113)|defense response (GO:0006952)|hyperosmotic response (GO:0006972)|positive regulation of activated T cell proliferation (GO:0042104)|signal transduction (GO:0007165)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			endometrium(2)|lung(1)|stomach(1)|urinary_tract(1)	5				Colorectal(79;0.0163)|READ - Rectum adenocarcinoma(84;0.0772)		ACACCCTGGTCGGGGCTGGGCA	0.683																																																	0								ENSG00000160223																																			ICOSLG	SO:0001627	intron_variant	0				HGNC	AB014553	CCDS42952.1, CCDS63377.1, CCDS63379.1	21q22.3	2014-01-30		2005-01-12	ENSG00000160223	ENSG00000160223		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Endogenous ligands"""	17087	protein-coding gene	gene with protein product	"""B7-related protein 1"", ""B7 homologue 2"", ""B7 homolog 2"""	605717		ICOSL		9734811, 11007762	Standard	NM_001283050		Approved	KIAA0653, GL50, B7-H2, B7RP-1, B7H2, B7RP1, ICOS-L, CD275	uc002zee.3	O75144	OTTHUMG00000086920	ENST00000407780.3:c.898+295->CGT	21.37:g.45649640_45649641insACG		Somatic	0	17	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	16	23.81	A8MUZ1|Q9HD18|Q9NRQ1	In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_Ig_V-set,pfam_CD80_C2-set,smart_Ig_sub,pfscan_Ig-like_dom	p.398in_frame_insR	ENST00000407780.3	37	c.1195_1194	CCDS42952.1	21																																																																																			-	NULL		0.683	ICOSLG-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ICOSLG	protein_coding	OTTHUMT00000195838.1	-	NM_015259			45649641	-1	no_errors	ENST00000400379	ensembl	human	putative	74_37	in_frame_ins	INS	0.000:0.001	ACG
HCFC1	3054	genome.wustl.edu	37	X	153222933	153222933	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chrX:153222933C>T	ENST00000310441.7	-	13	3151	c.2185G>A	c.(2185-2187)Gat>Aat	p.D729N	HCFC1_ENST00000369984.4_Missense_Mutation_p.D729N|HCFC1_ENST00000461098.1_5'Flank|HCFC1_ENST00000354233.3_Missense_Mutation_p.D660N	NM_005334.2	NP_005325.2	P51610	HCFC1_HUMAN	host cell factor C1	729					cell cycle (GO:0007049)|chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell cycle (GO:0045787)|positive regulation of gene expression (GO:0010628)|protein stabilization (GO:0050821)|regulation of protein complex assembly (GO:0043254)|regulation of transcription, DNA-templated (GO:0006355)|release from viral latency (GO:0019046)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|membrane (GO:0016020)|mitochondrion (GO:0005739)|MLL1 complex (GO:0071339)|MLL5-L complex (GO:0070688)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	chromatin binding (GO:0003682)|identical protein binding (GO:0042802)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(12)|kidney(3)|large_intestine(3)|lung(18)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	all_cancers(53;6.23e-16)|all_epithelial(53;5.61e-10)|all_lung(58;3.99e-07)|Lung NSC(58;5.02e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GGCTTGCCATCTGCTGAGGTC	0.627																																																	0								ENSG00000172534						90.0	90.0	90.0					X																	153222933		2133	4211	6344	HCFC1	SO:0001583	missense	0			-	HGNC		CCDS44020.1	Xq28	2014-06-12	2014-06-09		ENSG00000172534	ENSG00000172534			4839	protein-coding gene	gene with protein product	"""VP16-accessory protein"", ""protein phosphatase 1, regulatory subunit 89"""	300019	"""mental retardation, X-linked 3"", ""host cell factor C1 (VP16-accessory protein)"""	HFC1, MRX3		8392914, 23000143	Standard	XM_005274664		Approved	HCF-1, HCF1, CFF, VCAF, MGC70925, PPP1R89	uc004fjp.3	P51610	OTTHUMG00000024222	ENST00000310441.7:c.2185G>A	X.37:g.153222933C>T	ENSP00000309555:p.Asp729Asn	Somatic	0	63	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	40	36.51	Q6P4G5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Kelch_2,pfam_Kelch_1,superfamily_Fibronectin_type3,smart_Fibronectin_type3	p.D729N	ENST00000310441.7	37	c.2185	CCDS44020.1	X	.	.	.	.	.	.	.	.	.	.	C	35	5.515256	0.96402	.	.	ENSG00000172534	ENST00000310441;ENST00000369984;ENST00000354233	T;T;T	0.03181	4.05;4.05;4.02	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	T	0.10723	0.0262	L	0.29908	0.895	0.58432	D	0.999996	D	0.89917	1.0	D	0.83275	0.996	T	0.42396	-0.9454	10	0.26408	T	0.33	.	17.3314	0.87265	0.0:1.0:0.0:0.0	.	729	P51610	HCFC1_HUMAN	N	729;729;660	ENSP00000309555:D729N;ENSP00000359001:D729N;ENSP00000346174:D660N	ENSP00000309555:D729N	D	-	1	0	HCFC1	152876127	1.000000	0.71417	0.939000	0.37840	0.978000	0.69477	7.318000	0.79029	2.360000	0.80028	0.600000	0.82982	GAT	-	NULL		0.627	HCFC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCFC1	protein_coding	OTTHUMT00000061099.4	C	NM_005334	-		153222933	-1	no_errors	ENST00000310441	ensembl	human	known	74_37	missense	SNP	1.000	T
CYP3A4	1576	genome.wustl.edu	37	7	99358558	99358558	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr7:99358558G>A	ENST00000336411.2	-	12	1483	c.1300C>T	c.(1300-1302)Ccc>Tcc	p.P434S	CYP3A4_ENST00000354593.2_Missense_Mutation_p.P284S	NM_001202855.2|NM_017460.5	NP_001189784.1|NP_059488.2	P08684	CP3A4_HUMAN	cytochrome P450, family 3, subfamily A, polypeptide 4	434					alkaloid catabolic process (GO:0009822)|androgen metabolic process (GO:0008209)|calcitriol biosynthetic process from calciol (GO:0036378)|drug catabolic process (GO:0042737)|drug metabolic process (GO:0017144)|exogenous drug catabolic process (GO:0042738)|heterocycle metabolic process (GO:0046483)|lipid metabolic process (GO:0006629)|monoterpenoid metabolic process (GO:0016098)|oxidation-reduction process (GO:0055114)|oxidative demethylation (GO:0070989)|small molecule metabolic process (GO:0044281)|steroid catabolic process (GO:0006706)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	albendazole monooxygenase activity (GO:0047638)|caffeine oxidase activity (GO:0034875)|enzyme binding (GO:0019899)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity (GO:0016491)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen (GO:0016712)|oxygen binding (GO:0019825)|quinine 3-monooxygenase activity (GO:0050591)|steroid binding (GO:0005496)|steroid hydroxylase activity (GO:0008395)|taurochenodeoxycholate 6alpha-hydroxylase activity (GO:0033780)|testosterone 6-beta-hydroxylase activity (GO:0050649)|vitamin D 24-hydroxylase activity (GO:0070576)|vitamin D3 25-hydroxylase activity (GO:0030343)			breast(3)|central_nervous_system(3)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|pancreas(1)|skin(2)	18	Lung NSC(181;0.0144)|Esophageal squamous(72;0.0166)|all_lung(186;0.0228)				Abiraterone(DB05812)|Acenocoumarol(DB01418)|Acetaminophen(DB00316)|Acetazolamide(DB00819)|Adinazolam(DB00546)|ado-trastuzumab emtansine(DB05773)|Albendazole(DB00518)|Alclometasone(DB00240)|Aldesleukin(DB00041)|Alfentanil(DB00802)|Alfuzosin(DB00346)|Alimemazine(DB01246)|Aliskiren(DB01258)|Allylestrenol(DB01431)|Almotriptan(DB00918)|Alogliptin(DB06203)|Alosetron(DB00969)|Alprazolam(DB00404)|Ambroxol(DB06742)|Aminoglutethimide(DB00357)|Aminophenazone(DB01424)|Aminophylline(DB01223)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amlodipine(DB00381)|Amprenavir(DB00701)|Anastrozole(DB01217)|Antipyrine(DB01435)|Apixaban(DB06605)|Aprepitant(DB00673)|Argatroban(DB00278)|Aripiprazole(DB01238)|Arsenic trioxide(DB01169)|Artemether(DB06697)|Asenapine(DB06216)|Astemizole(DB00637)|Atazanavir(DB01072)|Atomoxetine(DB00289)|Atorvastatin(DB01076)|Avanafil(DB06237)|Axitinib(DB06626)|Azatadine(DB00719)|Azelastine(DB00972)|Azithromycin(DB00207)|Bedaquiline(DB08903)|Benzphetamine(DB00865)|Benzyl alcohol(DB06770)|Betamethasone(DB00443)|Bexarotene(DB00307)|Bezafibrate(DB01393)|Bicalutamide(DB01128)|Bifonazole(DB04794)|Bisoprolol(DB00612)|Boceprevir(DB08873)|Bortezomib(DB00188)|Bosentan(DB00559)|Bosutinib(DB06616)|Brentuximab vedotin(DB08870)|Brinzolamide(DB01194)|Bromazepam(DB01558)|Bromocriptine(DB01200)|Brompheniramine(DB00835)|Budesonide(DB01222)|Bupivacaine(DB00297)|Buprenorphine(DB00921)|Bupropion(DB01156)|Buspirone(DB00490)|Busulfan(DB01008)|Cabazitaxel(DB06772)|Cabergoline(DB00248)|Cabozantinib(DB08875)|Caffeine(DB00201)|Calcitriol(DB00136)|Canagliflozin(DB08907)|Carbamazepine(DB00564)|Carbinoxamine(DB00748)|Carvedilol(DB01136)|Caspofungin(DB00520)|Cefradine(DB01333)|Celecoxib(DB00482)|Cephalexin(DB00567)|Cevimeline(DB00185)|Chenodeoxycholic acid(DB06777)|Chloramphenicol(DB00446)|Chlordiazepoxide(DB00475)|Chloroquine(DB00608)|Chlorphenamine(DB01114)|Chlorphenesin(DB00856)|Chlorpromazine(DB00477)|Chlorzoxazone(DB00356)|Cholecalciferol(DB00169)|Ciclesonide(DB01410)|Cilostazol(DB01166)|Cimetidine(DB00501)|Cinacalcet(DB01012)|Ciprofloxacin(DB00537)|Cisapride(DB00604)|Citalopram(DB00215)|Clarithromycin(DB01211)|Clemastine(DB00283)|Clevidipine(DB04920)|Clindamycin(DB01190)|Clobazam(DB00349)|Clofazimine(DB00845)|Clofibrate(DB00636)|Clomifene(DB00882)|Clomipramine(DB01242)|Clonazepam(DB01068)|Clonidine(DB00575)|Clopidogrel(DB00758)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Clotrimazole(DB00257)|Clozapine(DB00363)|Cocaine(DB00907)|Codeine(DB00318)|Colchicine(DB01394)|Conivaptan(DB00872)|Conjugated Estrogens(DB00286)|Cortisone acetate(DB01380)|Crizotinib(DB08865)|Cyclobenzaprine(DB00924)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Cytarabine(DB00987)|Dabrafenib(DB08912)|Dalfopristin(DB01764)|Danazol(DB01406)|Dantrolene(DB01219)|Dapagliflozin(DB06292)|Dapsone(DB00250)|Darifenacin(DB00496)|Darunavir(DB01264)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Deferasirox(DB01609)|Delavirdine(DB00705)|Desipramine(DB01151)|Desvenlafaxine(DB06700)|Dexamethasone(DB01234)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Diazepam(DB00829)|Diclofenac(DB00586)|Dicloxacillin(DB00485)|Diethylstilbestrol(DB00255)|Digitoxin(DB01396)|Digoxin(DB00390)|Dihydrocodeine(DB01551)|Dihydroergotamine(DB00320)|Diltiazem(DB00343)|Dimethyl sulfoxide(DB01093)|Disopyramide(DB00280)|Disulfiram(DB00822)|Docetaxel(DB01248)|Dofetilide(DB00204)|Dolasetron(DB00757)|Dolutegravir(DB08930)|Domperidone(DB01184)|Donepezil(DB00843)|Dorzolamide(DB00869)|Doxepin(DB01142)|Doxorubicin(DB00997)|Doxycycline(DB00254)|Dronabinol(DB00470)|Dronedarone(DB04855)|Dutasteride(DB01126)|Econazole(DB01127)|Efavirenz(DB00625)|Eletriptan(DB00216)|Enalapril(DB00584)|Enzalutamide(DB08899)|Epinastine(DB00751)|Epinephrine(DB00668)|Eplerenone(DB00700)|Ergocalciferol(DB00153)|Ergoloid mesylate(DB01049)|Ergonovine(DB01253)|Ergotamine(DB00696)|Erlotinib(DB00530)|Erythromycin(DB00199)|Escitalopram(DB01175)|Esomeprazole(DB00736)|Estazolam(DB01215)|Estradiol valerate/Dienogest(DB08866)|Estradiol(DB00783)|Estramustine(DB01196)|Estrone(DB00655)|Estropipate(DB04574)|Eszopiclone(DB00402)|Ethanol(DB00898)|Ethinyl Estradiol(DB00977)|Ethosuximide(DB00593)|Ethylmorphine(DB01466)|Etonogestrel(DB00294)|Etoposide(DB00773)|Etoricoxib(DB01628)|Etravirine(DB06414)|Everolimus(DB01590)|Exemestane(DB00990)|Ezetimibe(DB00973)|Famciclovir(DB00426)|Felbamate(DB00949)|Felodipine(DB01023)|Fenofibrate(DB01039)|Fentanyl(DB00813)|Fesoterodine(DB06702)|Finasteride(DB01216)|Fingolimod(DB08868)|Flucloxacillin(DB00301)|Fluconazole(DB00196)|Flunisolide(DB00180)|Flunitrazepam(DB01544)|Fluorometholone(DB00324)|Fluoxetine(DB00472)|Flurazepam(DB00690)|Flutamide(DB00499)|Fluticasone furoate(DB08906)|Fluticasone Propionate(DB00588)|Fluvastatin(DB01095)|Fluvoxamine(DB00176)|Fosamprenavir(DB01319)|Fosphenytoin(DB01320)|Fulvestrant(DB00947)|Galantamine(DB00674)|Gefitinib(DB00317)|Gemfibrozil(DB01241)|Glipizide(DB01067)|Glyburide(DB01016)|Granisetron(DB00889)|Griseofulvin(DB00400)|Guanethidine(DB01170)|Guanfacine(DB01018)|Halofantrine(DB01218)|Haloperidol(DB00502)|Halothane(DB01159)|Hexobarbital(DB01355)|Histamine Phosphate(DB00667)|Hydralazine(DB01275)|Hydrocodone(DB00956)|Hydrocortamate(DB00769)|Hydrocortisone(DB00741)|Hydromorphone(DB00327)|Ifosfamide(DB01181)|Iloperidone(DB04946)|Imatinib(DB00619)|Imipramine(DB00458)|Imiquimod(DB00724)|Indacaterol(DB05039)|Indapamide(DB00808)|Indinavir(DB00224)|Ipratropium bromide(DB00332)|Irbesartan(DB01029)|Irinotecan(DB00762)|Isoniazid(DB00951)|Isosorbide Dinitrate(DB00883)|Isosorbide Mononitrate(DB01020)|Isradipine(DB00270)|Itraconazole(DB01167)|Ivacaftor(DB08820)|Ivermectin(DB00602)|Ixabepilone(DB04845)|Josamycin(DB01321)|Ketamine(DB01221)|Ketazolam(DB01587)|Ketobemidone(DB06738)|Ketoconazole(DB01026)|Lansoprazole(DB00448)|Lapatinib(DB01259)|Lercanidipine(DB00528)|Letrozole(DB01006)|Levobupivacaine(DB01002)|Levofloxacin(DB01137)|Levomethadyl Acetate(DB01227)|Levomilnacipran(DB08918)|Levonorgestrel(DB00367)|Levothyroxine(DB00451)|Lidocaine(DB00281)|Linagliptin(DB08882)|Lisuride(DB00589)|Lomitapide(DB08827)|Lomustine(DB01206)|Loperamide(DB00836)|Lopinavir(DB01601)|Loratadine(DB00455)|Lorcaserin(DB04871)|Losartan(DB00678)|Lovastatin(DB00227)|LULICONAZOLE(DB08933)|Lumefantrine(DB06708)|Lurasidone(DB08815)|MACITENTAN(DB08932)|Maraviroc(DB04835)|Mebendazole(DB00643)|Medroxyprogesterone Acetate(DB00603)|Mefloquine(DB00358)|Meloxicam(DB00814)|Mequitazine(DB01071)|Methadone(DB00333)|Methazolamide(DB00703)|Methimazole(DB00763)|Methoxsalen(DB00553)|Methoxyflurane(DB01028)|Methylergometrine(DB00353)|Methylprednisolone(DB00959)|Methyltestosterone(DB06710)|Metronidazole(DB00916)|Metyrapone(DB01011)|Mexiletine(DB00379)|Mianserin(DB06148)|Miconazole(DB01110)|Midazolam(DB00683)|Mifepristone(DB00834)|Mirabegron(DB08893)|Mirtazapine(DB00370)|Mitoxantrone(DB01204)|Modafinil(DB00745)|Montelukast(DB00471)|Morphine(DB00295)|Mycophenolate mofetil(DB00688)|Nafcillin(DB00607)|Naloxone(DB01183)|Nateglinide(DB00731)|Nefazodone(DB01149)|Nelfinavir(DB00220)|Nevirapine(DB00238)|Nicardipine(DB00622)|Nicotine(DB00184)|Nifedipine(DB01115)|Nilotinib(DB04868)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrazepam(DB01595)|Nitrendipine(DB01054)|Nitric Oxide(DB00435)|Norethindrone(DB00717)|Norfloxacin(DB01059)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Olopatadine(DB00768)|Omeprazole(DB00338)|Ondansetron(DB00904)|Orlistat(DB01083)|Orphenadrine(DB01173)|Ospemifene(DB04938)|Oxazepam(DB00842)|Oxcarbazepine(DB00776)|Oxiconazole(DB00239)|Oxybutynin(DB01062)|Oxycodone(DB00497)|Oxymorphone(DB01192)|Paclitaxel(DB01229)|Paliperidone(DB01267)|Palonosetron(DB00377)|Pantoprazole(DB00213)|Paramethadione(DB00617)|Paramethasone(DB01384)|Paricalcitol(DB00910)|Pazopanib(DB06589)|Pegvisomant(DB00082)|Pentamidine(DB00738)|Pentobarbital(DB00312)|Perampanel(DB08883)|Pergolide(DB01186)|Perhexiline(DB01074)|Permethrin(DB04930)|Perphenazine(DB00850)|Pethidine(DB00454)|Phenelzine(DB00780)|Phenobarbital(DB01174)|Phenoxybenzamine(DB00925)|Phenprocoumon(DB00946)|Phenylbutazone(DB00812)|Phenytoin(DB00252)|Pilocarpine(DB01085)|Pimecrolimus(DB00337)|Pimozide(DB01100)|Pioglitazone(DB01132)|Pipotiazine(DB01621)|Podofilox(DB01179)|Pomalidomide(DB08910)|Ponatinib(DB08901)|Posaconazole(DB01263)|Pranlukast(DB01411)|Prasugrel(DB06209)|Pravastatin(DB00175)|Prazepam(DB01588)|Praziquantel(DB01058)|Prednisolone(DB00860)|Prednisone(DB00635)|Primaquine(DB01087)|Primidone(DB00794)|Probenecid(DB01032)|Prochlorperazine(DB00433)|Progesterone(DB00396)|Proguanil(DB01131)|Promazine(DB00420)|Propafenone(DB01182)|Propofol(DB00818)|Propranolol(DB00571)|Pyrazinamide(DB00339)|Pyridostigmine(DB00545)|Quazepam(DB01589)|Quetiapine(DB01224)|Quinacrine(DB01103)|Quinidine(DB00908)|Quinine(DB00468)|Quinupristin(DB01369)|Rabeprazole(DB01129)|Raloxifene(DB00481)|Ramelteon(DB00980)|Ranitidine(DB00863)|Ranolazine(DB00243)|Reboxetine(DB00234)|Regorafenib(DB08896)|Repaglinide(DB00912)|Retapamulin(DB01256)|Rifabutin(DB00615)|Rifampicin(DB01045)|Rifapentine(DB01201)|Rifaximin(DB01220)|Rilpivirine(DB08864)|Rimonabant(DB06155)|Risperidone(DB00734)|Ritonavir(DB00503)|Rivaroxaban(DB06228)|Rivastigmine(DB00989)|Rolitetracycline(DB01301)|Ropinirole(DB00268)|Ropivacaine(DB00296)|Rosuvastatin(DB01098)|Rotigotine(DB05271)|Roxithromycin(DB00778)|Rufinamide(DB06201)|Ruxolitinib(DB08877)|Salbutamol(DB01001)|Salmeterol(DB00938)|Saquinavir(DB01232)|Saxagliptin(DB06335)|Selegiline(DB01037)|Sertindole(DB06144)|Sertraline(DB01104)|Sevoflurane(DB01236)|Sibutramine(DB01105)|Sildenafil(DB00203)|Silodosin(DB06207)|SIMEPREVIR(DB06290)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sitagliptin(DB01261)|Sitaxentan(DB06268)|Solifenacin(DB01591)|Sorafenib(DB00398)|Sufentanil(DB00708)|Sulfadiazine(DB00359)|Sulfamethoxazole(DB01015)|Sulfanilamide(DB00259)|Sulfinpyrazone(DB01138)|Sunitinib(DB01268)|Tacrolimus(DB00864)|Tadalafil(DB00820)|Tamoxifen(DB00675)|Tamsulosin(DB00706)|Tasosartan(DB01349)|Telaprevir(DB05521)|Telithromycin(DB00976)|Temazepam(DB00231)|Temozolomide(DB00853)|Temsirolimus(DB06287)|Teniposide(DB00444)|Terbinafine(DB00857)|Testosterone(DB00624)|Tetracycline(DB00759)|Theophylline(DB00277)|Thiopental(DB00599)|Thiotepa(DB04572)|Tiagabine(DB00906)|Ticagrelor(DB08816)|Ticlopidine(DB00208)|Tinidazole(DB00911)|Tioconazole(DB01007)|Tiotropium(DB01409)|Tipranavir(DB00932)|Tofacitinib(DB08895)|Tofisopam(DB08811)|Tolterodine(DB01036)|Tolvaptan(DB06212)|Topiramate(DB00273)|Topotecan(DB01030)|Toremifene(DB00539)|Trabectedin(DB05109)|Tramadol(DB00193)|Trametinib(DB08911)|Tranylcypromine(DB00752)|Trazodone(DB00656)|Tretinoin(DB00755)|Triamcinolone(DB00620)|Triazolam(DB00897)|Trimethadione(DB00347)|Trimethoprim(DB00440)|Trimipramine(DB00726)|Troleandomycin(DB01361)|Udenafil(DB06267)|Valproic Acid(DB00313)|Vandetanib(DB05294)|Vardenafil(DB00862)|Vemurafenib(DB08881)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vilazodone(DB06684)|Vinblastine(DB00570)|Vincristine(DB00541)|Vindesine(DB00309)|Vinorelbine(DB00361)|Vismodegib(DB08828)|Voriconazole(DB00582)|Warfarin(DB00682)|Yohimbine(DB01392)|Zafirlukast(DB00549)|Zalcitabine(DB00943)|Zaleplon(DB00962)|Zidovudine(DB00495)|Zileuton(DB00744)|Ziprasidone(DB00246)|Zolpidem(DB00425)|Zonisamide(DB00909)|Zopiclone(DB01198)	CTTCCAAAGGGTGTGTATATG	0.403																																																	0								ENSG00000160868						363.0	318.0	333.0					7																	99358558		2203	4300	6503	CYP3A4	SO:0001583	missense	0			-	HGNC	AF280107	CCDS5674.1	7q21.1	2011-06-21	2003-01-14		ENSG00000160868	ENSG00000160868	1.1.1.161	"""Cytochrome P450s"""	2637	protein-coding gene	gene with protein product		124010	"""cytochrome P450, subfamily IIIA (niphedipine oxidase), polypeptide 4"""	CYP3A3		8269949, 1391968	Standard	NM_001202855		Approved		uc003urv.2	P08684	OTTHUMG00000156651	ENST00000336411.2:c.1300C>T	7.37:g.99358558G>A	ENSP00000337915:p.Pro434Ser	Somatic	0	82	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	98	16.95	P05184|Q16757|Q9UK50	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_CYP3A,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-II,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450,prints_Cyt_P450_B	p.P434S	ENST00000336411.2	37	c.1300	CCDS5674.1	7	.	.	.	.	.	.	.	.	.	.	G	14.36	2.513318	0.44660	.	.	ENSG00000160868	ENST00000354593;ENST00000336411	D;D	0.83837	-1.77;-1.77	4.47	4.47	0.54385	.	0.000000	0.85682	D	0.000000	D	0.93471	0.7917	H	0.95151	3.63	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.999;1.0;0.997;0.997;0.997	D	0.95319	0.8419	10	0.87932	D	0	.	14.9515	0.71077	0.0:0.0:1.0:0.0	.	284;361;434;434;434	E7EVM8;Q7Z448;Q6GRK0;Q86SK3;P08684	.;.;.;.;CP3A4_HUMAN	S	284;434	ENSP00000346607:P284S;ENSP00000337915:P434S	ENSP00000337915:P434S	P	-	1	0	CYP3A4	99196494	1.000000	0.71417	0.896000	0.35187	0.036000	0.12997	6.202000	0.72131	2.192000	0.70111	0.563000	0.77884	CCC	-	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450,prints_Cyt_P450_B		0.403	CYP3A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP3A4	protein_coding	OTTHUMT00000345059.1	G		-		99358558	-1	no_errors	ENST00000336411	ensembl	human	known	74_37	missense	SNP	1.000	A
RPS5	6193	genome.wustl.edu	37	19	58904510	58904510	+	Silent	SNP	C	C	T	rs61731810	byFrequency	TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr19:58904510C>T	ENST00000596046.1	+	2	1125	c.276C>T	c.(274-276)atC>atT	p.I92I	RPS5_ENST00000196551.3_Silent_p.I92I|RPS5_ENST00000598098.1_Intron|RPS5_ENST00000601521.1_Silent_p.I92I|RPS5_ENST00000598495.1_Silent_p.I113I|AC012313.1_ENST00000601382.1_5'Flank			P46782	RS5_HUMAN	ribosomal protein S5	92					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of translational fidelity (GO:0006450)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|ribonucleoprotein complex (GO:0030529)	mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			cervix(1)|large_intestine(1)|lung(1)|prostate(1)	4		all_cancers(17;1.71e-22)|all_epithelial(17;1.69e-16)|Lung NSC(17;2.25e-06)|all_lung(17;9.97e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Breast(46;0.0194)|Ovarian(87;0.0443)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.171)|GBM - Glioblastoma multiforme(193;0.0323)|Lung(386;0.0543)|LUSC - Lung squamous cell carcinoma(496;0.176)		CTGTGCGCATCGTCAAGCATG	0.582																																																	0								ENSG00000083845						98.0	79.0	85.0					19																	58904510		2203	4300	6503	RPS5	SO:0001819	synonymous_variant	0			-	HGNC	U14970	CCDS12978.1	19q13.4	2011-04-05				ENSG00000083845		"""S ribosomal proteins"""	10426	protein-coding gene	gene with protein product	"""40S ribosomal protein S5"""	603630				7772601, 9582194	Standard	NM_001009		Approved	S5	uc002qsn.3	P46782		ENST00000596046.1:c.276C>T	19.37:g.58904510C>T		Somatic	0	35	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	44	15.38	B2R4T2|Q96BN0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ribosomal_S7_dom,superfamily_Ribosomal_S7_dom,tigrfam_Ribosomal_S5/S7_euk/arc	p.I92	ENST00000596046.1	37	c.276	CCDS12978.1	19																																																																																			-	pfam_Ribosomal_S7_dom,superfamily_Ribosomal_S7_dom,tigrfam_Ribosomal_S5/S7_euk/arc		0.582	RPS5-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RPS5	protein_coding	OTTHUMT00000467016.1	C	NM_001009	-		58904510	+1	no_errors	ENST00000196551	ensembl	human	known	74_37	silent	SNP	0.899	T
ESAM	90952	genome.wustl.edu	37	11	124626140	124626140	+	Silent	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr11:124626140C>T	ENST00000278927.5	-	4	699	c.570G>A	c.(568-570)caG>caA	p.Q190Q	ESAM_ENST00000442070.2_Intron|RP11-677M14.3_ENST00000504932.2_RNA	NM_138961.2	NP_620411.2	Q96AP7	ESAM_HUMAN	endothelial cell adhesion molecule	190	Ig-like C2-type.				blood coagulation (GO:0007596)|homophilic cell adhesion (GO:0007156)|leukocyte migration (GO:0050900)|single organismal cell-cell adhesion (GO:0016337)	adherens junction (GO:0005912)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				endometrium(2)|kidney(1)|large_intestine(6)|lung(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	16	all_hematologic(175;0.215)	Breast(109;0.00109)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.022)		AGGATGGAAGCTGCCGATCCC	0.572																																																	0								ENSG00000149564						62.0	54.0	56.0					11																	124626140		2201	4299	6500	ESAM	SO:0001819	synonymous_variant	0			-	HGNC	AK075396	CCDS8453.1	11q24.2	2013-01-29			ENSG00000149564	ENSG00000149564		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17474	protein-coding gene	gene with protein product		614281				11279107, 11906820	Standard	NM_138961		Approved	W117m	uc001qav.4	Q96AP7	OTTHUMG00000151986	ENST00000278927.5:c.570G>A	11.37:g.124626140C>T		Somatic	0	51	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	86	16.50	B4DVN8|Q96T50	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.Q190	ENST00000278927.5	37	c.570	CCDS8453.1	11																																																																																			-	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.572	ESAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ESAM	protein_coding	OTTHUMT00000324686.1	C	NM_138961	-		124626140	-1	no_errors	ENST00000278927	ensembl	human	known	74_37	silent	SNP	0.000	T
SPTBN1	6711	genome.wustl.edu	37	2	54839468	54839468	+	Silent	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr2:54839468C>T	ENST00000356805.4	+	4	752	c.471C>T	c.(469-471)ttC>ttT	p.F157F	SPTBN1_ENST00000333896.5_Silent_p.F144F	NM_003128.2	NP_003119.2	Q01082	SPTB2_HUMAN	spectrin, beta, non-erythrocytic 1	157	Actin-binding.|CH 1. {ECO:0000255|PROSITE- ProRule:PRU00044}.				actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi to plasma membrane protein transport (GO:0043001)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|plasma membrane organization (GO:0007009)|protein targeting to plasma membrane (GO:0072661)	axolemma (GO:0030673)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phospholipid binding (GO:0005543)|poly(A) RNA binding (GO:0044822)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(8)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(27)|ovary(4)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	82			Lung(47;0.24)			TCCTGCGCTTCCAGGTAAGGG	0.557																																																	0								ENSG00000115306						102.0	93.0	96.0					2																	54839468		2203	4300	6503	SPTBN1	SO:0001819	synonymous_variant	0			-	HGNC		CCDS33198.1, CCDS33199.1	2p21	2013-01-10			ENSG00000115306	ENSG00000115306		"""Pleckstrin homology (PH) domain containing"""	11275	protein-coding gene	gene with protein product		182790					Standard	NM_003128		Approved		uc002rxu.3	Q01082	OTTHUMG00000133746	ENST00000356805.4:c.471C>T	2.37:g.54839468C>T		Somatic	0	43	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	62	8.82	B2RP63|O60837|Q16057|Q53R99|Q59ER3|Q8IX99	Silent	SNP	NA	NA	NA	NA	NA	NA	pirsf_Spectrin_bsu,pfam_Spectrin_repeat,pfam_CH-domain,pfam_Pleckstrin_homology,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Pleckstrin_homology,prints_PH_dom-spectrin-type,pfscan_CH-domain,pfscan_Pleckstrin_homology	p.F157	ENST00000356805.4	37	c.471	CCDS33198.1	2																																																																																			-	pirsf_Spectrin_bsu,pfam_CH-domain,superfamily_CH-domain,pfscan_CH-domain		0.557	SPTBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTBN1	protein_coding	OTTHUMT00000258115.3	C		-		54839468	+1	no_errors	ENST00000356805	ensembl	human	known	74_37	silent	SNP	1.000	T
CUL7	9820	genome.wustl.edu	37	6	43019973	43019973	+	Missense_Mutation	SNP	A	A	G			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr6:43019973A>G	ENST00000265348.3	-	2	639	c.554T>C	c.(553-555)aTa>aCa	p.I185T	CUL7_ENST00000535468.1_Missense_Mutation_p.I237T			Q14999	CUL7_HUMAN	cullin 7	185					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|epithelial to mesenchymal transition (GO:0001837)|Golgi organization (GO:0007030)|microtubule cytoskeleton organization (GO:0000226)|mitotic cytokinesis (GO:0000281)|placenta development (GO:0001890)|positive regulation of dendrite morphogenesis (GO:0050775)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of mitosis (GO:0007088)|ubiquitin-dependent protein catabolic process (GO:0006511)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	3M complex (GO:1990393)|anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|Cul7-RING ubiquitin ligase complex (GO:0031467)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)				breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(8)|liver(1)|lung(11)|ovary(3)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	49			all cancers(41;0.00231)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|OV - Ovarian serous cystadenocarcinoma(102;0.0442)|KIRC - Kidney renal clear cell carcinoma(15;0.133)|Kidney(15;0.188)			CAGGGCTTGTATCATCCGGCC	0.577																																																	0								ENSG00000044090						64.0	57.0	60.0					6																	43019973		2203	4300	6503	CUL7	SO:0001583	missense	0			-	HGNC	BC033647	CCDS4881.1, CCDS55003.1	6p21.1	2011-05-24	2004-03-22	2004-03-22	ENSG00000044090	ENSG00000044090			21024	protein-coding gene	gene with protein product		609577	"""KIAA0076"""	KIAA0076		12481031, 12904573	Standard	NM_014780		Approved	dJ20C7.5	uc011dvb.2	Q14999	OTTHUMG00000014718	ENST00000265348.3:c.554T>C	6.37:g.43019973A>G	ENSP00000265348:p.Ile185Thr	Somatic	0	40	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	50	15.25	B4DYZ0|F5H0L1|Q5T654	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cullin_N,pfam_CPH_domain,pfam_APC_su10/DOC_dom,superfamily_Galactose-bd-like,superfamily_Cullin_homology,superfamily_ARM-type_fold,smart_Cullin_neddylation_domain,pfscan_Cullin_homology	p.I237T	ENST00000265348.3	37	c.710	CCDS4881.1	6	.	.	.	.	.	.	.	.	.	.	A	19.68	3.873008	0.72180	.	.	ENSG00000044090	ENST00000265348;ENST00000535468	T;T	0.69175	-0.34;-0.38	5.6	4.44	0.53790	Armadillo-like helical (1);	0.429940	0.24158	N	0.041018	T	0.28400	0.0702	N	0.08118	0	0.80722	D	1	B;B	0.33637	0.42;0.322	B;B	0.29176	0.099;0.086	T	0.35525	-0.9785	10	0.87932	D	0	-20.4604	11.2114	0.48802	0.9281:0.0:0.0719:0.0	.	237;185	F5H0L1;Q14999	.;CUL7_HUMAN	T	185;237	ENSP00000265348:I185T;ENSP00000438788:I237T	ENSP00000265348:I185T	I	-	2	0	CUL7	43127951	1.000000	0.71417	0.977000	0.42913	0.981000	0.71138	7.462000	0.80851	0.958000	0.37956	0.459000	0.35465	ATA	-	superfamily_ARM-type_fold		0.577	CUL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUL7	protein_coding	OTTHUMT00000040575.1	A	NM_014780	-		43019973	-1	no_errors	ENST00000535468	ensembl	human	known	74_37	missense	SNP	1.000	G
ZNF331	55422	genome.wustl.edu	37	19	54080238	54080238	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr19:54080238C>T	ENST00000253144.9	+	7	1757	c.424C>T	c.(424-426)Cgt>Tgt	p.R142C	ZNF331_ENST00000511154.1_Missense_Mutation_p.R142C|ZNF331_ENST00000411977.2_Missense_Mutation_p.R142C|ZNF331_ENST00000511593.2_Missense_Mutation_p.R142C|ZNF331_ENST00000513265.1_Intron|ZNF331_ENST00000512387.1_Missense_Mutation_p.R142C|ZNF331_ENST00000449416.1_Missense_Mutation_p.R142C|ZNF331_ENST00000513999.1_Missense_Mutation_p.R142C	NM_001253801.1|NM_018555.5	NP_001240730.1|NP_061025.5	Q9NQX6	ZN331_HUMAN	zinc finger protein 331	142					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|large_intestine(1)|lung(1)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	10				GBM - Glioblastoma multiforme(134;0.00555)		GGCCTTTAGTCGTGGCTATCA	0.433			T	?	follicular thyroid adenoma																																			Dom	yes		19	19q13.3-q13.4	55422	zinc finger protein 331		E	0								ENSG00000130844						99.0	104.0	102.0					19																	54080238		2203	4300	6503	ZNF331	SO:0001583	missense	0			-	HGNC	AF251515	CCDS33102.1	19q13	2013-12-10				ENSG00000130844		"""Zinc fingers, C2H2-type"", ""-"""	15489	protein-coding gene	gene with protein product	"""rearranged in thyroid adenomas"""	606043					Standard	NM_001079906		Approved	RITA, ZNF463, ZNF361	uc021uzh.1	Q9NQX6		ENST00000253144.9:c.424C>T	19.37:g.54080238C>T	ENSP00000253144:p.Arg142Cys	Somatic	0	33	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	44	22.81	Q96GJ4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R142C	ENST00000253144.9	37	c.424	CCDS33102.1	19	.	.	.	.	.	.	.	.	.	.	C	14.67	2.603397	0.46423	.	.	ENSG00000130844	ENST00000253144;ENST00000511593;ENST00000449416;ENST00000411977;ENST00000511154;ENST00000513999;ENST00000512387;ENST00000514022;ENST00000505949	T;T;T;T;T;T;T;T;T	0.61627	3.18;3.18;3.18;3.18;3.18;3.18;3.18;2.14;0.09	3.68	3.68	0.42216	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.35585	N	0.003107	T	0.50752	0.1634	L	0.35249	1.045	0.09310	N	1	D	0.76494	0.999	P	0.50754	0.649	T	0.40608	-0.9554	10	0.40728	T	0.16	.	8.6448	0.33998	0.2285:0.7715:0.0:0.0	.	142	Q9NQX6	ZN331_HUMAN	C	142	ENSP00000253144:R142C;ENSP00000427439:R142C;ENSP00000393817:R142C;ENSP00000393336:R142C;ENSP00000421014:R142C;ENSP00000423156:R142C;ENSP00000421728:R142C;ENSP00000422471:R142C;ENSP00000427532:R142C	ENSP00000253144:R142C	R	+	1	0	ZNF331	58772050	0.000000	0.05858	0.960000	0.40013	0.961000	0.63080	-0.821000	0.04452	2.049000	0.60858	0.563000	0.77884	CGT	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.433	ZNF331-008	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF331	protein_coding	OTTHUMT00000371366.1	C	NM_018555	-		54080238	+1	no_errors	ENST00000253144	ensembl	human	known	74_37	missense	SNP	0.026	T
OR2AP1	121129	genome.wustl.edu	37	12	55968256	55968256	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr12:55968256G>A	ENST00000321688.1	+	1	58	c.58G>A	c.(58-60)Gaa>Aaa	p.E20K	RP11-110A12.2_ENST00000556750.1_RNA|RP11-110A12.2_ENST00000555138.1_RNA	NM_001258285.1	NP_001245214.1	Q8NGE2	O2AP1_HUMAN	olfactory receptor, family 2, subfamily AP, member 1	20						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			lung(2)|ovary(1)	3						AGATGTCCCTGAACTCCAGGT	0.403																																																	0								ENSG00000179615																																			OR2AP1	SO:0001583	missense	0			-	HGNC	BK004260	CCDS58241.1	12q13.2	2012-08-09	2004-12-10	2004-03-10	ENSG00000179615	ENSG00000179615		"""GPCR / Class A : Olfactory receptors"""	15335	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily AP, member 1 pseudogene"""	OR2AP1P			Standard	NM_001258285		Approved		uc031qhr.1	Q8NGE2	OTTHUMG00000169960	ENST00000321688.1:c.58G>A	12.37:g.55968256G>A	ENSP00000323423:p.Glu20Lys	Somatic	0	54	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	75	11.76		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.E20K	ENST00000321688.1	37	c.58	CCDS58241.1	12	.	.	.	.	.	.	.	.	.	.	G	16.03	3.007011	0.54361	.	.	ENSG00000179615	ENST00000321688	T	0.00441	7.41	5.14	0.669	0.17918	.	0.504996	0.18054	N	0.153182	T	0.00300	0.0009	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.46541	-0.9184	7	0.33940	T	0.23	.	7.5531	0.27808	0.1561:0.3629:0.4811:0.0	.	.	.	.	K	20	ENSP00000323423:E20K	ENSP00000323423:E20K	E	+	1	0	OR2AP1	54254523	0.000000	0.05858	0.004000	0.12327	0.994000	0.84299	-0.237000	0.08990	0.541000	0.28827	0.644000	0.83932	GAA	-	NULL		0.403	OR2AP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2AP1	protein_coding	OTTHUMT00000406679.1	G		-		55968256	+1	no_errors	ENST00000321688	ensembl	human	known	74_37	missense	SNP	0.000	A
FAT1	2195	genome.wustl.edu	37	4	187541765	187541765	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr4:187541765G>A	ENST00000441802.2	-	10	6184	c.5975C>T	c.(5974-5976)tCc>tTc	p.S1992F		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	1992	Cadherin 18. {ECO:0000255|PROSITE- ProRule:PRU00043}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						GGCCTCGGTGGAATTCTCTTT	0.408										HNSCC(5;0.00058)																											Colon(197;1040 2055 4143 4984 49344)												0								ENSG00000083857						220.0	220.0	220.0					4																	187541765		1861	4102	5963	FAT1	SO:0001583	missense	0			-	HGNC	X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.5975C>T	4.37:g.187541765G>A	ENSP00000406229:p.Ser1992Phe	Somatic	0	44	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	59	21.33		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Laminin_G,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,smart_EG-like_dom,smart_Laminin_G,smart_EGF-like_Ca-bd_dom,prints_Cadherin,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin	p.S1992F	ENST00000441802.2	37	c.5975	CCDS47177.1	4	.	.	.	.	.	.	.	.	.	.	G	8.647	0.897372	0.17686	.	.	ENSG00000083857	ENST00000441802;ENST00000260147	T	0.01821	4.62	5.26	5.26	0.73747	Cadherin (3);Cadherin-like (1);	0.114186	0.64402	D	0.000006	T	0.05227	0.0139	M	0.80982	2.52	0.54753	D	0.999987	B	0.12013	0.005	B	0.18871	0.023	T	0.19289	-1.0310	10	0.56958	D	0.05	.	19.0552	0.93062	0.0:0.0:1.0:0.0	.	1992	Q14517	FAT1_HUMAN	F	1992;1994	ENSP00000406229:S1992F	ENSP00000260147:S1994F	S	-	2	0	FAT1	187778759	1.000000	0.71417	1.000000	0.80357	0.462000	0.32619	6.451000	0.73481	2.740000	0.93945	0.561000	0.74099	TCC	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin		0.408	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT1	protein_coding	OTTHUMT00000360209.3	G	NM_005245	-		187541765	-1	no_errors	ENST00000441802	ensembl	human	known	74_37	missense	SNP	1.000	A
CCDC171	203238	genome.wustl.edu	37	9	15578931	15578931	+	Silent	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr9:15578931C>T	ENST00000380701.3	+	4	590	c.262C>T	c.(262-264)Cta>Tta	p.L88L	CCDC171_ENST00000297641.3_Silent_p.L88L|CCDC171_ENST00000535968.1_Silent_p.L88L	NM_173550.2	NP_775821.2	Q6TFL3	CC171_HUMAN	coiled-coil domain containing 171	88																	GGAATATGACCTAGCTGTTGC	0.473																																																	0								ENSG00000164989						114.0	108.0	110.0					9																	15578931		2203	4300	6503	CCDC171	SO:0001819	synonymous_variant	0			-	HGNC	AY422473	CCDS6481.1	9p22.2	2012-03-26	2012-03-26	2012-03-26	ENSG00000164989	ENSG00000164989			29828	protein-coding gene	gene with protein product	"""myosin tail domain containing protein"""		"""chromosome 9 open reading frame 93"""	C9orf93		14702039	Standard	NM_173550		Approved	FLJ39267, FLJ46740, Em:AL513423.1, bA778P13.1, bA536D16.1	uc003zmd.3	Q6TFL3	OTTHUMG00000019584	ENST00000380701.3:c.262C>T	9.37:g.15578931C>T		Somatic	0	76	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	53	28.38	B7ZM22|Q5SU58|Q6P1W1|Q6ZR13|Q8N1Z4|Q8N8L3|Q8TBR2	Silent	SNP	NA	NA	NA	NA	NA	NA	superfamily_STAT_TF_coiled-coil	p.L88	ENST00000380701.3	37	c.262	CCDS6481.1	9																																																																																			-	NULL		0.473	CCDC171-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC171	protein_coding	OTTHUMT00000051768.4	C	NM_173550	-		15578931	+1	no_errors	ENST00000380701	ensembl	human	known	74_37	silent	SNP	1.000	T
PSG5	5673	genome.wustl.edu	37	19	43680253	43680253	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr19:43680253C>T	ENST00000366175.3	-	3	608	c.478G>A	c.(478-480)Gag>Aag	p.E160K	PSG5_ENST00000407568.1_Intron|PSG5_ENST00000599812.1_Missense_Mutation_p.E253K|PSG5_ENST00000342951.6_Missense_Mutation_p.E160K|PSG5_ENST00000404580.1_Missense_Mutation_p.E160K|PSG5_ENST00000407356.1_Missense_Mutation_p.E160K			Q15238	PSG5_HUMAN	pregnancy specific beta-1-glycoprotein 5	160	Ig-like C2-type 1.				female pregnancy (GO:0007565)	extracellular region (GO:0005576)		p.E160K(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(18)|prostate(1)|skin(6)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	35		Prostate(69;0.00899)				TCCTTATTCTCCCTGGGTTTT	0.493																																																	1	Substitution - Missense(1)	skin(1)						ENSG00000204941						238.0	223.0	228.0					19																	43680253		2202	4296	6498	PSG5	SO:0001583	missense	0			-	HGNC		CCDS12617.1	19q13.2	2013-01-29			ENSG00000204941	ENSG00000204941		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9522	protein-coding gene	gene with protein product	"""pregnancy-specific beta-1 glycoprotein"", ""pregnancy-specific beta 1 glycoprotein"""	176394				2735907	Standard	NM_002781		Approved	FL-NCA-3, PSG	uc002ovx.3	Q15238	OTTHUMG00000151539	ENST00000366175.3:c.478G>A	19.37:g.43680253C>T	ENSP00000382334:p.Glu160Lys	Somatic	0	147	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	34	158	17.71	Q15239|Q96QJ1|Q9UQ75	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.E160K	ENST00000366175.3	37	c.478	CCDS12617.1	19	.	.	.	.	.	.	.	.	.	.	c	13.03	2.116264	0.37339	.	.	ENSG00000204941	ENST00000366175;ENST00000407356;ENST00000342951;ENST00000404580	T;T;T;T	0.14766	2.48;2.48;2.48;2.48	1.23	1.23	0.21249	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.35278	0.0926	M	0.85197	2.74	0.09310	N	0.999995	D;P	0.69078	0.997;0.874	D;P	0.79784	0.993;0.853	T	0.06197	-1.0840	9	0.72032	D	0.01	.	5.7748	0.18273	0.0:1.0:0.0:0.0	.	253;160	Q15228;Q15238	.;PSG5_HUMAN	K	160	ENSP00000382334:E160K;ENSP00000386008:E160K;ENSP00000344413:E160K;ENSP00000385250:E160K	ENSP00000344413:E160K	E	-	1	0	PSG5	48372093	0.009000	0.17119	0.007000	0.13788	0.015000	0.08874	0.036000	0.13819	0.630000	0.30394	0.184000	0.17185	GAG	-	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.493	PSG5-001	KNOWN	basic|CCDS	protein_coding	PSG5	protein_coding	OTTHUMT00000323055.1	C	NM_002781	-		43680253	-1	no_errors	ENST00000342951	ensembl	human	known	74_37	missense	SNP	0.024	T
DCAF8L2	347442	genome.wustl.edu	37	X	27766187	27766187	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chrX:27766187G>A	ENST00000451261.2	+	5	1574	c.1175G>A	c.(1174-1176)aGg>aAg	p.R392K		NM_001136533.1	NP_001130005.1	P0C7V8	DC8L2_HUMAN	DDB1 and CUL4 associated factor 8-like 2	392										central_nervous_system(1)|endometrium(9)|kidney(3)|lung(7)|pancreas(1)|skin(3)	24						CAGTTTGTAAGGATTTATGAC	0.378																																																	0								ENSG00000189186						163.0	112.0	128.0					X																	27766187		692	1591	2283	DCAF8L2	SO:0001583	missense	0			-	HGNC		CCDS59162.1	Xp22.11	2013-01-09	2009-07-17	2009-07-17		ENSG00000189186		"""WD repeat domain containing"""	31811	protein-coding gene	gene with protein product			"""WD repeat domain 42C"""	WDR42C			Standard	NM_001136533		Approved		uc011mjy.2	P0C7V8		ENST00000451261.2:c.1175G>A	X.37:g.27766187G>A	ENSP00000462745:p.Arg392Lys	Somatic	0	23	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	18	40.00	B2RXH9|J3KT06	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R392K	ENST00000451261.2	37	c.1175	CCDS59162.1	X																																																																																			-	superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom		0.378	DCAF8L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF8L2	protein_coding	OTTHUMT00000056143.4	G	XM_293354	-		27766187	+1	no_errors	ENST00000451261	ensembl	human	known	74_37	missense	SNP	0.979	A
DLAT	1737	genome.wustl.edu	37	11	111904147	111904147	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr11:111904147C>T	ENST00000280346.6	+	5	1339	c.680C>T	c.(679-681)tCt>tTt	p.S227F	DLAT_ENST00000393051.1_Intron|DLAT_ENST00000537636.1_Intron|RNU6-893P_ENST00000458841.1_RNA	NM_001931.4	NP_001922.2	P10515	ODP2_HUMAN	dihydrolipoamide S-acetyltransferase	227	Lipoyl-binding 2. {ECO:0000255|PROSITE- ProRule:PRU01066}.				cellular metabolic process (GO:0044237)|glucose metabolic process (GO:0006006)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	mitochondrial matrix (GO:0005759)|mitochondrial pyruvate dehydrogenase complex (GO:0005967)|mitochondrion (GO:0005739)	dihydrolipoyllysine-residue acetyltransferase activity (GO:0004742)			breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(10)|ovary(1)|skin(1)	22		all_cancers(61;4.53e-11)|all_epithelial(67;2.76e-06)|Melanoma(852;9.42e-06)|all_hematologic(158;0.000885)|Acute lymphoblastic leukemia(157;0.000966)|Breast(348;0.0512)|Medulloblastoma(222;0.0523)|all_neural(223;0.0663)		Epithelial(105;4.87e-07)|BRCA - Breast invasive adenocarcinoma(274;6.83e-07)|all cancers(92;9.63e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.0557)		CCTGCCCTCTCTCCCACCATG	0.428																																																	0								ENSG00000150768						72.0	69.0	70.0					11																	111904147		2201	4297	6498	DLAT	SO:0001583	missense	0			-	HGNC	Y00978	CCDS8354.1	11q23.1	2008-02-05	2008-02-04		ENSG00000150768	ENSG00000150768	2.3.1.12		2896	protein-coding gene	gene with protein product	"""E2 component of pyruvate dehydrogenase complex"""	608770		DLTA		8102256	Standard	NM_001931		Approved	PDC-E2	uc001pmo.3	P10515	OTTHUMG00000133751	ENST00000280346.6:c.680C>T	11.37:g.111904147C>T	ENSP00000280346:p.Ser227Phe	Somatic	0	51	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	62	15.07	Q16783|Q53EP3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_2-oxoacid_DH_actylTfrase,pfam_Biotin_lipoyl,pfam_E3-bd,superfamily_Single_hybrid_motif,superfamily_E3-bd,pfscan_Biotin_lipoyl,tigrfam_LAT1	p.S227F	ENST00000280346.6	37	c.680	CCDS8354.1	11	.	.	.	.	.	.	.	.	.	.	C	33	5.289575	0.95546	.	.	ENSG00000150768	ENST00000280346;ENST00000534998	T	0.59638	0.25	6.16	6.16	0.99307	Single hybrid motif (1);Biotin/lipoyl attachment (2);	0.000000	0.85682	D	0.000000	T	0.81837	0.4907	M	0.88241	2.94	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.83320	-0.0018	10	0.87932	D	0	-21.203	20.8598	0.99761	0.0:1.0:0.0:0.0	.	227	P10515	ODP2_HUMAN	F	227;195	ENSP00000280346:S227F	ENSP00000280346:S227F	S	+	2	0	DLAT	111409357	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.461000	0.80834	2.937000	0.99478	0.650000	0.86243	TCT	-	pfam_Biotin_lipoyl,superfamily_Single_hybrid_motif,pfscan_Biotin_lipoyl,tigrfam_LAT1		0.428	DLAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DLAT	protein_coding	OTTHUMT00000258167.1	C	NM_001931	-		111904147	+1	no_errors	ENST00000280346	ensembl	human	known	74_37	missense	SNP	1.000	T
OGDHL	55753	genome.wustl.edu	37	10	50952755	50952755	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr10:50952755C>T	ENST00000374103.4	-	13	1758	c.1673G>A	c.(1672-1674)gGc>gAc	p.G558D	OGDHL_ENST00000432695.1_Missense_Mutation_p.G349D|OGDHL_ENST00000419399.1_Missense_Mutation_p.G501D	NM_018245.2	NP_060715.2	Q9ULD0	OGDHL_HUMAN	oxoglutarate dehydrogenase-like	558					glycolytic process (GO:0006096)|tricarboxylic acid cycle (GO:0006099)	mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|oxoglutarate dehydrogenase (succinyl-transferring) activity (GO:0004591)|thiamine pyrophosphate binding (GO:0030976)			central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|lung(30)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(1)	61						CTTGGACCTGCCATAAGCCTC	0.557																																																	0								ENSG00000197444						132.0	126.0	128.0					10																	50952755		2203	4300	6503	OGDHL	SO:0001583	missense	0			-	HGNC	AK001713	CCDS7234.1, CCDS44390.1, CCDS44391.1	10q11.23	2013-09-20			ENSG00000197444	ENSG00000197444			25590	protein-coding gene	gene with protein product						10574462	Standard	NM_018245		Approved	FLJ10851	uc001jie.3	Q9ULD0	OTTHUMG00000018200	ENST00000374103.4:c.1673G>A	10.37:g.50952755C>T	ENSP00000363216:p.Gly558Asp	Somatic	0	41	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	55	9.84	A8K2G1|B4DKG2|B4E193|Q8TAN9|Q9NVA0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DH_E1,pfam_Transketolase-like_Pyr-bd,smart_Transketolase-like_Pyr-bd,pirsf_2oxoglutarate_DH_E1,tigrfam_2oxoglutarate_DH_E1	p.G558D	ENST00000374103.4	37	c.1673	CCDS7234.1	10	.	.	.	.	.	.	.	.	.	.	C	13.87	2.366494	0.41902	.	.	ENSG00000197444	ENST00000374103;ENST00000419399;ENST00000432695	D;D;D	0.95412	-3.7;-3.7;-3.7	5.45	4.48	0.54585	Dehydrogenase, E1 component (1);	0.308709	0.35349	N	0.003263	D	0.83862	0.5346	N	0.00890	-1.11	0.35925	D	0.832071	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.001;0.001;0.002	T	0.81682	-0.0822	10	0.16896	T	0.51	.	14.939	0.70978	0.0:0.7381:0.2619:0.0	.	501;349;558	Q9ULD0-2;Q9ULD0-3;Q9ULD0	.;.;OGDHL_HUMAN	D	558;501;349	ENSP00000363216:G558D;ENSP00000401356:G501D;ENSP00000390240:G349D	ENSP00000363216:G558D	G	-	2	0	OGDHL	50622761	1.000000	0.71417	0.999000	0.59377	0.992000	0.81027	3.996000	0.57009	2.732000	0.93576	0.650000	0.86243	GGC	-	pfam_DH_E1,pirsf_2oxoglutarate_DH_E1,tigrfam_2oxoglutarate_DH_E1		0.557	OGDHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OGDHL	protein_coding	OTTHUMT00000048007.1	C	NM_018245	-		50952755	-1	no_errors	ENST00000374103	ensembl	human	known	74_37	missense	SNP	1.000	T
PDE6C	5146	genome.wustl.edu	37	10	95422806	95422806	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr10:95422806G>A	ENST00000371447.3	+	21	2527	c.2389G>A	c.(2389-2391)Gaa>Aaa	p.E797K	PDE6C_ENST00000475427.2_Intron	NM_006204.3	NP_006195.3	P51160	PDE6C_HUMAN	phosphodiesterase 6C, cGMP-specific, cone, alpha prime	797					phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|visual perception (GO:0007601)	plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|cGMP binding (GO:0030553)|metal ion binding (GO:0046872)			breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(12)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	42		Colorectal(252;0.123)			Caffeine(DB00201)	GTTTCACAAAGAAATCACACC	0.383																																																	0								ENSG00000095464						67.0	70.0	69.0					10																	95422806		2203	4300	6503	PDE6C	SO:0001583	missense	0			-	HGNC	U31973	CCDS7429.1	10q24	2013-01-23			ENSG00000095464	ENSG00000095464	3.1.4.17	"""Phosphodiesterases"""	8787	protein-coding gene	gene with protein product		600827					Standard	NM_006204		Approved	PDEA2, ACHM5, COD4	uc001kiu.4	P51160	OTTHUMG00000018775	ENST00000371447.3:c.2389G>A	10.37:g.95422806G>A	ENSP00000360502:p.Glu797Lys	Somatic	0	48	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	49	19.67	A6NCR6|Q5VY29	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PDEase_catalytic_dom,pfam_GAF,smart_GAF,smart_HD/PDEase_dom,prints_PDEase	p.E797K	ENST00000371447.3	37	c.2389	CCDS7429.1	10	.	.	.	.	.	.	.	.	.	.	G	25.6	4.656961	0.88154	.	.	ENSG00000095464	ENST00000371447	T	0.80909	-1.43	5.02	5.02	0.67125	5&apos (2);-cyclic nucleotide phosphodiesterase, catalytic domain (2);3&apos (2);	0.044828	0.85682	N	0.000000	D	0.84951	0.5586	L	0.37750	1.13	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.82331	-0.0510	10	0.27785	T	0.31	.	18.126	0.89586	0.0:0.0:1.0:0.0	.	797	P51160	PDE6C_HUMAN	K	797	ENSP00000360502:E797K	ENSP00000360502:E797K	E	+	1	0	PDE6C	95412796	1.000000	0.71417	0.999000	0.59377	0.990000	0.78478	7.365000	0.79537	2.607000	0.88179	0.655000	0.94253	GAA	-	pfam_PDEase_catalytic_dom		0.383	PDE6C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDE6C	protein_coding	OTTHUMT00000049437.1	G	NM_006204	-		95422806	+1	no_errors	ENST00000371447	ensembl	human	known	74_37	missense	SNP	1.000	A
PRR23C	389152	genome.wustl.edu	37	3	138762997	138762997	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr3:138762997C>T	ENST00000413199.1	-	1	737	c.466G>A	c.(466-468)Gag>Aag	p.E156K	PRR23C_ENST00000502927.2_Missense_Mutation_p.E156K|MRPS22_ENST00000495075.1_Intron	NM_001134657.1	NP_001128129.1	Q6ZRP0	PR23C_HUMAN	proline rich 23C	156										breast(2)|lung(7)|skin(2)	11						GCGTCCTCCTCGTAGGCCTCT	0.632																																																	0								ENSG00000233701						32.0	35.0	34.0					3																	138762997		692	1591	2283	PRR23C	SO:0001583	missense	0			-	HGNC		CCDS46924.1	3q22.3	2014-06-03				ENSG00000233701			37173	protein-coding gene	gene with protein product							Standard	NM_001134657		Approved	FLJ46210	uc011bmt.1	Q6ZRP0		ENST00000413199.1:c.466G>A	3.37:g.138762997C>T	ENSP00000396648:p.Glu156Lys	Somatic	0	50	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	57	17.39		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_UPF0572	p.E156K	ENST00000413199.1	37	c.466	CCDS46924.1	3	.	.	.	.	.	.	.	.	.	.	C	14.82	2.650348	0.47362	.	.	ENSG00000233701	ENST00000413199;ENST00000502927	.	.	.	3.08	-2.66	0.06077	.	1.910920	0.03139	N	0.166321	T	0.57036	0.2026	M	0.68952	2.095	0.09310	N	1	D	0.76494	0.999	D	0.77004	0.989	T	0.50110	-0.8866	9	0.39692	T	0.17	.	4.0409	0.09751	0.0:0.3061:0.3452:0.3487	.	156	Q6ZRP0	PR23C_HUMAN	K	156	.	ENSP00000396648:E156K	E	-	1	0	PRR23C	140245687	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-0.192000	0.09587	-0.641000	0.05487	0.455000	0.32223	GAG	-	pfam_UPF0572		0.632	PRR23C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRR23C	protein_coding	OTTHUMT00000361502.1	C	NM_001134657	-		138762997	-1	no_errors	ENST00000413199	ensembl	human	known	74_37	missense	SNP	0.000	T
MTTP	4547	genome.wustl.edu	37	4	100515993	100515993	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr4:100515993C>T	ENST00000265517.5	+	7	1065	c.862C>T	c.(862-864)Ccc>Tcc	p.P288S	MTTP_ENST00000511045.1_Missense_Mutation_p.P315S|RP11-766F14.1_ENST00000508578.1_RNA|MTTP_ENST00000457717.1_Missense_Mutation_p.P288S			P55157	MTP_HUMAN	microsomal triglyceride transfer protein	288	Vitellogenin. {ECO:0000255|PROSITE- ProRule:PRU00557}.				cholesterol homeostasis (GO:0042632)|lipid metabolic process (GO:0006629)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|protein lipidation (GO:0006497)|response to calcium ion (GO:0051592)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)|membrane-bounded vesicle (GO:0031988)|microvillus membrane (GO:0031528)|receptor complex (GO:0043235)|rough endoplasmic reticulum (GO:0005791)	lipid binding (GO:0008289)|lipid transporter activity (GO:0005319)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(14)|lung(19)|ovary(4)|prostate(5)|skin(1)|urinary_tract(1)	57				OV - Ovarian serous cystadenocarcinoma(123;6.04e-09)	Hesperetin(DB01094)|Lomitapide(DB08827)	CACGGCCATTCCCATTGTGGG	0.448																																																	0								ENSG00000138823						115.0	105.0	108.0					4																	100515993		2203	4300	6503	MTTP	SO:0001583	missense	0			-	HGNC		CCDS3651.1, CCDS75169.1	4q24	2008-02-05	2005-11-04	2005-11-04	ENSG00000138823	ENSG00000138823			7467	protein-coding gene	gene with protein product		157147	"""microsomal triglyceride transfer protein (large polypeptide, 88kD)"", ""microsomal triglyceride transfer protein (large polypeptide, 88kDa)"""	MTP		8111381	Standard	XM_005263025		Approved	ABL	uc003hvc.4	P55157	OTTHUMG00000131023	ENST00000265517.5:c.862C>T	4.37:g.100515993C>T	ENSP00000265517:p.Pro288Ser	Somatic	0	50	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	61	15.28	A8K428|Q08AM4|Q6P5T3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Lipid_transpt_N,superfamily_Vitellinogen_superhlx,superfamily_Lipid_transp_b-sht_shell,smart_Lipid_transpt_N,pfscan_Lipid_transpt_N	p.P288S	ENST00000265517.5	37	c.862	CCDS3651.1	4	.	.	.	.	.	.	.	.	.	.	C	6.945	0.544108	0.13312	.	.	ENSG00000138823	ENST00000511045;ENST00000457717;ENST00000265517;ENST00000538053	T;T;T	0.56776	0.44;0.44;0.44	4.96	4.12	0.48240	Lipid transport protein, N-terminal (3);Vitellinogen, superhelical (1);	0.104471	0.64402	D	0.000003	T	0.42787	0.1218	L	0.48877	1.53	0.38066	D	0.936215	B;B	0.10296	0.003;0.003	B;B	0.14023	0.01;0.005	T	0.35025	-0.9805	10	0.18710	T	0.47	-34.4157	10.7807	0.46376	0.0:0.8454:0.0:0.1546	.	315;288	E9PBP6;P55157	.;MTP_HUMAN	S	315;288;288;288	ENSP00000427679:P315S;ENSP00000400821:P288S;ENSP00000265517:P288S	ENSP00000265517:P288S	P	+	1	0	MTTP	100735016	1.000000	0.71417	0.988000	0.46212	0.110000	0.19582	0.792000	0.26929	1.209000	0.43321	0.563000	0.77884	CCC	-	pfam_Lipid_transpt_N,superfamily_Vitellinogen_superhlx,smart_Lipid_transpt_N,pfscan_Lipid_transpt_N		0.448	MTTP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTTP	protein_coding	OTTHUMT00000253662.3	C		-		100515993	+1	no_errors	ENST00000265517	ensembl	human	known	74_37	missense	SNP	0.951	T
ZER1	10444	genome.wustl.edu	37	9	131516096	131516096	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr9:131516096G>A	ENST00000291900.2	-	3	707	c.301C>T	c.(301-303)Cgc>Tgc	p.R101C	ZER1_ENST00000494461.1_5'UTR	NM_006336.2	NP_006327.2	Q7Z7L7	ZER1_HUMAN	zyg-11 related, cell cycle regulator	101					protein ubiquitination (GO:0016567)|regulation of ubiquitin-protein transferase activity (GO:0051438)	Cul2-RING ubiquitin ligase complex (GO:0031462)	ubiquitin-protein transferase activity (GO:0004842)			endometrium(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	15						ACCTGCTTGCGGATGGCCTCC	0.697																																																	0								ENSG00000160445						26.0	21.0	23.0					9																	131516096		2200	4297	6497	ZER1	SO:0001583	missense	0			-	HGNC	X99802	CCDS6910.1	9q33.3	2013-01-17	2012-12-10	2007-01-04	ENSG00000160445	ENSG00000160445		"""ZYG11 cell cycle regulator family"""	30960	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 60"", ""zyg-11 homolog B (C. elegans)-like"", ""zer-1 homolog (C. elegans)"""	C9orf60, ZYG11BL		11719588	Standard	NM_006336		Approved	ZYG, Hzyg	uc004bwa.2	Q7Z7L7	OTTHUMG00000020759	ENST00000291900.2:c.301C>T	9.37:g.131516096G>A	ENSP00000291900:p.Arg101Cys	Somatic	0	49	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	33	42.11	O00156|Q5T272|Q5T273	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_ARM-type_fold,smart_Armadillo	p.R101C	ENST00000291900.2	37	c.301	CCDS6910.1	9	.	.	.	.	.	.	.	.	.	.	G	22.0	4.228173	0.79576	.	.	ENSG00000160445	ENST00000291900;ENST00000414921;ENST00000427848	T;T	0.16457	2.34;2.34	5.25	5.25	0.73442	.	0.099309	0.64402	D	0.000005	T	0.16642	0.0400	L	0.29908	0.895	0.58432	D	0.999998	D	0.69078	0.997	P	0.47470	0.548	T	0.00759	-1.1578	10	0.39692	T	0.17	-34.67	11.9776	0.53100	0.0:0.0:0.7272:0.2728	.	101	Q7Z7L7	ZER1_HUMAN	C	101	ENSP00000291900:R101C;ENSP00000393051:R101C	ENSP00000291900:R101C	R	-	1	0	ZER1	130555917	0.996000	0.38824	0.999000	0.59377	0.958000	0.62258	3.470000	0.53100	2.617000	0.88574	0.555000	0.69702	CGC	-	NULL		0.697	ZER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZER1	protein_coding	OTTHUMT00000054491.1	G	NM_006336	-		131516096	-1	no_errors	ENST00000291900	ensembl	human	known	74_37	missense	SNP	0.991	A
KIAA0195	9772	genome.wustl.edu	37	17	73494563	73494563	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr17:73494563C>T	ENST00000314256.7	+	29	4071	c.3677C>T	c.(3676-3678)gCc>gTc	p.A1226V	KIAA0195_ENST00000375248.5_Missense_Mutation_p.A1236V|AC100787.1_ENST00000579379.1_RNA|KIAA0195_ENST00000579208.1_Missense_Mutation_p.A877V	NM_014738.4	NP_055553.3	Q12767	K0195_HUMAN	KIAA0195	1226						integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(2)|endometrium(5)|kidney(2)|large_intestine(7)|lung(17)|ovary(5)|skin(2)|stomach(1)|urinary_tract(1)	42	all_cancers(13;3.15e-09)|all_epithelial(9;5.94e-10)|Breast(9;1.85e-09)|all_lung(278;0.246)		all cancers(21;5.01e-07)|Epithelial(20;5e-06)|Lung(188;0.0809)|LUSC - Lung squamous cell carcinoma(166;0.154)			GAGGACTTTGCCAATGGACTG	0.642																																																	0								ENSG00000177728						61.0	55.0	57.0					17																	73494563		2203	4300	6503	KIAA0195	SO:0001583	missense	0			-	HGNC		CCDS32732.1	17q25.1	2012-03-01			ENSG00000177728	ENSG00000177728			28983	protein-coding gene	gene with protein product						8724849	Standard	NM_014738		Approved	TMEM94	uc002jnz.4	Q12767		ENST00000314256.7:c.3677C>T	17.37:g.73494563C>T	ENSP00000313885:p.Ala1226Val	Somatic	0	31	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	27	12.90	O75536|Q86XF1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ATPase_P-typ_cation-transptr_C	p.A1226V	ENST00000314256.7	37	c.3677	CCDS32732.1	17	.	.	.	.	.	.	.	.	.	.	C	16.73	3.205006	0.58234	.	.	ENSG00000177728	ENST00000314256;ENST00000375248	D;D	0.88124	-2.34;-2.34	5.07	5.07	0.68467	ATPase, P-type cation-transporter, C-terminal (1);ATPase, P-type,  transmembrane domain (1);	0.065918	0.64402	D	0.000008	T	0.73345	0.3575	N	0.08118	0	0.41578	D	0.988722	B;B;P;B	0.39665	0.273;0.275;0.682;0.322	B;B;B;B	0.34824	0.134;0.12;0.158;0.19	T	0.74954	-0.3488	10	0.22109	T	0.4	-24.8984	15.5517	0.76158	0.0:0.8619:0.1381:0.0	.	1236;1236;1226;1226	B4DGC6;C9JL75;Q12767-2;Q12767	.;.;.;K0195_HUMAN	V	1226;1236	ENSP00000313885:A1226V;ENSP00000364397:A1236V	ENSP00000313885:A1226V	A	+	2	0	KIAA0195	71006158	1.000000	0.71417	0.997000	0.53966	0.979000	0.70002	4.376000	0.59556	2.346000	0.79739	0.467000	0.42956	GCC	-	pfam_ATPase_P-typ_cation-transptr_C		0.642	KIAA0195-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0195	protein_coding	OTTHUMT00000447303.1	C	NM_014738	-		73494563	+1	no_errors	ENST00000314256	ensembl	human	known	74_37	missense	SNP	1.000	T
SGK223	157285	genome.wustl.edu	37	8	8235440	8235440	+	Missense_Mutation	SNP	G	G	A	rs566296772		TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr8:8235440G>A	ENST00000520004.1	-	3	743	c.479C>T	c.(478-480)aCc>aTc	p.T160I	SGK223_ENST00000330777.4_Missense_Mutation_p.T160I			Q86YV5	SG223_HUMAN		160							ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)										GCCGACCATGGTGTAAGCTGG	0.612													G|||	1	0.000199681	0.0	0.0014	5008	,	,		18388	0.0		0.0	False		,,,				2504	0.0				GBM(34;731 755 10259 33573 33867)												0								ENSG00000182319						71.0	78.0	75.0					8																	8235440		2034	4183	6217	SGK223	SO:0001583	missense	0			-	Uniprot_gn																												ENST00000520004.1:c.479C>T	8.37:g.8235440G>A	ENSP00000428054:p.Thr160Ile	Somatic	0	57	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	69	17.86	Q8N3N5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_dom	p.T160I	ENST00000520004.1	37	c.479	CCDS43706.1	8	.	.	.	.	.	.	.	.	.	.	G	13.36	2.215304	0.39102	.	.	ENSG00000182319	ENST00000330777;ENST00000520004	T;T	0.58060	0.36;0.36	4.98	4.98	0.66077	.	0.993514	0.08159	N	0.988766	T	0.43433	0.1247	N	0.19112	0.55	0.36421	D	0.864291	B	0.26672	0.156	B	0.21917	0.037	T	0.34825	-0.9813	10	0.49607	T	0.09	.	16.2821	0.82697	0.0:0.0:1.0:0.0	.	160	Q86YV5	SG223_HUMAN	I	160	ENSP00000330930:T160I;ENSP00000428054:T160I	ENSP00000330930:T160I	T	-	2	0	AC068353.1	8272850	1.000000	0.71417	0.921000	0.36526	0.694000	0.40290	5.708000	0.68377	2.686000	0.91538	0.655000	0.94253	ACC	-	NULL		0.612	SGK223-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SGK223	protein_coding	OTTHUMT00000374864.1	G		-		8235440	-1	no_errors	ENST00000330777	ensembl	human	known	74_37	missense	SNP	0.990	A
SPTA1	6708	genome.wustl.edu	37	1	158612247	158612247	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr1:158612247G>A	ENST00000368147.4	-	33	4871	c.4691C>T	c.(4690-4692)tCc>tTc	p.S1564F		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1564					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)	p.S1564Y(1)		NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					CTCAATCAGGGAGTTCCCCAG	0.473																																																	1	Substitution - Missense(1)	lung(1)						ENSG00000163554						104.0	104.0	104.0					1																	158612247		1991	4172	6163	SPTA1	SO:0001583	missense	0			-	HGNC	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.4691C>T	1.37:g.158612247G>A	ENSP00000357129:p.Ser1564Phe	Somatic	0	44	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	60	17.81	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Spectrin_repeat,pfam_EF-hand_Ca_insen,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_Spectrin/alpha-actinin,smart_SH3_domain,pfscan_EF_hand_dom,pfscan_SH3_domain,prints_Spectrin_alpha_SH3	p.S1564F	ENST00000368147.4	37	c.4691	CCDS41423.1	1	.	.	.	.	.	.	.	.	.	.	G	18.71	3.683251	0.68157	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.52057	0.68;0.68	5.26	5.26	0.73747	.	0.278867	0.19449	N	0.113989	T	0.59142	0.2172	M	0.70275	2.135	0.46954	D	0.999269	P	0.44659	0.84	P	0.57009	0.811	T	0.60414	-0.7268	10	0.66056	D	0.02	.	17.63	0.88103	0.0:0.0:1.0:0.0	.	1564	P02549	SPTA1_HUMAN	F	1564	ENSP00000357130:S1564F;ENSP00000357129:S1564F	ENSP00000357129:S1564F	S	-	2	0	SPTA1	156878871	1.000000	0.71417	0.749000	0.31150	0.297000	0.27493	8.584000	0.90798	2.733000	0.93635	0.655000	0.94253	TCC	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin		0.473	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTA1	protein_coding	OTTHUMT00000051851.3	G	NM_003126	-		158612247	-1	no_errors	ENST00000368147	ensembl	human	known	74_37	missense	SNP	1.000	A
TSPAN10	83882	genome.wustl.edu	37	17	79612351	79612351	+	RNA	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr17:79612351C>T	ENST00000572675.1	+	0	370				TSPAN10_ENST00000328585.4_RNA			Q9H1Z9	TSN10_HUMAN	tetraspanin 10						establishment of protein localization to organelle (GO:0072594)	integral component of membrane (GO:0016021)	enzyme binding (GO:0019899)			ovary(1)	1	all_neural(118;0.0878)|all_lung(278;0.175)|Lung NSC(278;0.192)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0101)|OV - Ovarian serous cystadenocarcinoma(97;0.0739)			CATGCTGGGGCTGGCACTGGG	0.692																																																	0								ENSG00000182612						25.0	32.0	30.0					17																	79612351		1944	4149	6093	TSPAN10			0			-	HGNC	BC032802		17q25.3	2013-10-02			ENSG00000182612	ENSG00000182612		"""Tetraspanins"""	29942	protein-coding gene	gene with protein product	"""oculospanin"""					12107410	Standard	NM_031945		Approved	OCSP	uc010die.3	Q9H1Z9	OTTHUMG00000178037		17.37:g.79612351C>T		Somatic	0	103	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	41	161	20.30	Q8N548	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2,prints_Tetraspanin	p.L124	ENST00000572675.1	37	c.370		17																																																																																			-	pfam_Tetraspanin/Peripherin		0.692	TSPAN10-001	KNOWN	basic	polymorphic_pseudogene	TSPAN10	polymorphic_pseudogene	OTTHUMT00000440313.1	C	NM_031945	-		79612351	+1	no_errors	ENST00000328585	ensembl	human	known	74_37	silent	SNP	0.084	T
KIAA0232	9778	genome.wustl.edu	37	4	6864253	6864253	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr4:6864253C>T	ENST00000307659.5	+	7	2599	c.2144C>T	c.(2143-2145)tCc>tTc	p.S715F	KIAA0232_ENST00000425103.1_Missense_Mutation_p.S715F	NM_014743.2	NP_055558.2	Q92628	K0232_HUMAN	KIAA0232	715							ATP binding (GO:0005524)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(12)|ovary(2)|prostate(4)|skin(1)|urinary_tract(1)	41						AGTCCATGGTCCCATTCAGAA	0.343																																																	0								ENSG00000170871						65.0	60.0	62.0					4																	6864253		1842	4090	5932	KIAA0232	SO:0001583	missense	0			-	HGNC	D86985	CCDS43209.1	4p16.1	2012-11-29			ENSG00000170871	ENSG00000170871			28992	protein-coding gene	gene with protein product						9039502	Standard	NM_014743		Approved		uc003gjq.4	Q92628	OTTHUMG00000160072	ENST00000307659.5:c.2144C>T	4.37:g.6864253C>T	ENSP00000303928:p.Ser715Phe	Somatic	0	28	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	29	12.12	A7E2D2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.S715F	ENST00000307659.5	37	c.2144	CCDS43209.1	4	.	.	.	.	.	.	.	.	.	.	C	20.9	4.059204	0.76074	.	.	ENSG00000170871	ENST00000425103;ENST00000307659	.	.	.	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.79452	0.4448	M	0.66939	2.045	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.80254	-0.1459	9	0.87932	D	0	-20.5855	19.8991	0.96978	0.0:1.0:0.0:0.0	.	715	Q92628	K0232_HUMAN	F	715	.	ENSP00000303928:S715F	S	+	2	0	KIAA0232	6915154	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.385000	0.79763	2.708000	0.92522	0.655000	0.94253	TCC	-	NULL		0.343	KIAA0232-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0232	protein_coding	OTTHUMT00000359102.2	C	NM_014743	-		6864253	+1	no_errors	ENST00000307659	ensembl	human	known	74_37	missense	SNP	1.000	T
DNAH6	1768	genome.wustl.edu	37	2	84784863	84784863	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr2:84784863G>A	ENST00000237449.6	+	10	1615	c.1607G>A	c.(1606-1608)gGt>gAt	p.G536D	DNAH6_ENST00000398278.2_Missense_Mutation_p.G536D|DNAH6_ENST00000389394.3_Missense_Mutation_p.G536D			Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy chain 6	536	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.G536V(1)|p.G115V(1)		NS(2)|breast(9)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	57						TAACAGGATGGTATTTTGGGT	0.313																																																	2	Substitution - Missense(2)	endometrium(2)						ENSG00000115423						137.0	129.0	131.0					2																	84784863		2203	4300	6503	DNAH6	SO:0001583	missense	0			-	HGNC	U61736	CCDS46348.1	2p11.2	2011-05-24	2006-09-04		ENSG00000115423	ENSG00000115423		"""Axonemal dyneins"""	2951	protein-coding gene	gene with protein product		603336	"""dynein, axonemal, heavy polypeptide 6"", ""dynein heavy chain-like 1"""	DNHL1		8812413	Standard	NM_001370		Approved	Dnahc6, HL-2, FLJ37357	uc010fgb.3	Q9C0G6	OTTHUMG00000128957	ENST00000237449.6:c.1607G>A	2.37:g.84784863G>A	ENSP00000237449:p.Gly536Asp	Somatic	0	60	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	83	15.31	A0PJN9|B5MEE0|B7ZL99|O95493|Q53QZ1|Q53TE5|Q8N1W6|Q92861|Q96BL6|Q9H030|Q9H5E1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.G536D	ENST00000237449.6	37	c.1607	CCDS46348.1	2	.	.	.	.	.	.	.	.	.	.	G	0.764	-0.768110	0.02974	.	.	ENSG00000115423	ENST00000389394;ENST00000398278;ENST00000237449	T;T;T	0.24151	1.87;1.99;1.87	5.22	4.35	0.52113	.	0.117524	0.38217	N	0.001772	T	0.30603	0.0770	M	0.67953	2.075	0.29694	N	0.840672	B;P	0.47910	0.079;0.902	B;P	0.46718	0.065;0.525	T	0.21245	-1.0251	10	0.34782	T	0.22	.	7.9736	0.30143	0.0813:0.0:0.7573:0.1614	.	536;115	Q9C0G6;Q9C0G6-3	DYH6_HUMAN;.	D	536	ENSP00000374045:G536D;ENSP00000381326:G536D;ENSP00000237449:G536D	ENSP00000237449:G536D	G	+	2	0	DNAH6	84638374	1.000000	0.71417	0.997000	0.53966	0.039000	0.13416	2.164000	0.42387	1.210000	0.43336	-0.122000	0.15005	GGT	-	NULL		0.313	DNAH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH6	protein_coding	OTTHUMT00000328537.2	G	NM_001370	-		84784863	+1	no_errors	ENST00000237449	ensembl	human	known	74_37	missense	SNP	1.000	A
C7	730	genome.wustl.edu	37	5	40947843	40947843	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr5:40947843G>A	ENST00000313164.9	+	8	1237	c.878G>A	c.(877-879)cGa>cAa	p.R293Q		NM_000587.2	NP_000578.2	P10643	CO7_HUMAN	complement component 7	293	MACPF. {ECO:0000255|PROSITE- ProRule:PRU00745}.				cellular sodium ion homeostasis (GO:0006883)|complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)							Ovarian(839;0.0112)				AGTGCCTACCGAAGATTAATC	0.413																																																	0								ENSG00000112936						90.0	86.0	87.0					5																	40947843		1839	4091	5930	C7	SO:0001583	missense	0			-	HGNC	J03507	CCDS47201.1	5p13.1	2014-09-17			ENSG00000112936	ENSG00000112936		"""Complement system"""	1346	protein-coding gene	gene with protein product		217070					Standard	NM_000587		Approved		uc003jmh.3	P10643	OTTHUMG00000150340	ENST00000313164.9:c.878G>A	5.37:g.40947843G>A	ENSP00000322061:p.Arg293Gln	Somatic	0	50	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	42	23.64	Q6P3T5|Q92489	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MACPF,pfam_Sushi_SCR_CCP,pfam_LDrepeatLR_classA_rpt,pfam_Thrombospondin_1_rpt,superfamily_Sushi_SCR_CCP,superfamily_Thrombospondin_1_rpt,superfamily_LDrepeatLR_classA_rpt,smart_Thrombospondin_1_rpt,smart_LDrepeatLR_classA_rpt,smart_MACPF,smart_Sushi_SCR_CCP,smart_FacI_MAC,pfscan_LDrepeatLR_classA_rpt,pfscan_Sushi_SCR_CCP,pfscan_Thrombospondin_1_rpt,prints_MAC_perforin	p.R293Q	ENST00000313164.9	37	c.878	CCDS47201.1	5	.	.	.	.	.	.	.	.	.	.	G	24.6	4.549069	0.86127	.	.	ENSG00000112936	ENST00000313164;ENST00000515157	D	0.84873	-1.91	5.9	5.9	0.94986	Membrane attack complex component/perforin domain, conserved site (1);Membrane attack complex component/perforin (MACPF) domain (3);	0.000000	0.85682	D	0.000000	D	0.93090	0.7800	M	0.84326	2.69	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	D	0.93136	0.6537	10	0.62326	D	0.03	-13.7453	18.4666	0.90758	0.0:0.0:1.0:0.0	.	293	P10643	CO7_HUMAN	Q	293	ENSP00000322061:R293Q	ENSP00000322061:R293Q	R	+	2	0	C7	40983600	1.000000	0.71417	1.000000	0.80357	0.886000	0.51366	7.833000	0.86765	2.786000	0.95864	0.650000	0.86243	CGA	-	pfam_MACPF,smart_MACPF,prints_MAC_perforin		0.413	C7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C7	protein_coding	OTTHUMT00000317680.1	G		-		40947843	+1	no_errors	ENST00000313164	ensembl	human	known	74_37	missense	SNP	1.000	A
NCF4	4689	genome.wustl.edu	37	22	37273721	37273721	+	Silent	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr22:37273721G>A	ENST00000248899.6	+	10	1060	c.876G>A	c.(874-876)ggG>ggA	p.G292G	NCF4_ENST00000397147.4_3'UTR	NM_000631.4	NP_000622.2	Q15080	NCF4_HUMAN	neutrophil cytosolic factor 4, 40kDa	292	OPR.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|immune response (GO:0006955)|interaction with host (GO:0051701)|oxidation-reduction process (GO:0055114)|phagosome maturation (GO:0090382)|positive regulation of catalytic activity (GO:0043085)	cytosol (GO:0005829)|endosome membrane (GO:0010008)|membrane (GO:0016020)|NADPH oxidase complex (GO:0043020)|phagolysosome (GO:0032010)	phosphatidylinositol-3-phosphate binding (GO:0032266)|protein dimerization activity (GO:0046983)|superoxide-generating NADPH oxidase activator activity (GO:0016176)			cervix(1)|endometrium(4)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)	16					Dextromethorphan(DB00514)	ACGCTGAGGGGGATCTGGTTC	0.597																																																	0								ENSG00000100365						62.0	59.0	60.0					22																	37273721		2203	4300	6503	NCF4	SO:0001819	synonymous_variant	0			-	HGNC	X77094	CCDS13934.1, CCDS13935.1	22q13.1	2014-09-17	2002-08-29		ENSG00000100365	ENSG00000100365			7662	protein-coding gene	gene with protein product	"""neutrophil NADPH oxidase factor 4"""	601488	"""neutrophil cytosolic factor 4 (40kD)"""			8839867	Standard	NM_013416		Approved	p40phox, SH3PXD4	uc003apy.4	Q15080	OTTHUMG00000150548	ENST00000248899.6:c.876G>A	22.37:g.37273721G>A		Somatic	0	59	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	70	14.63	A8K4F9|O60808|Q86U56|Q9BU98|Q9NP45	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Phox,pfam_OPR_PB1,pfam_SH3_domain,pfam_SH3_2,superfamily_Phox,superfamily_SH3_domain,smart_Phox,smart_SH3_domain,smart_OPR_PB1,pfscan_Phox,pfscan_SH3_domain,prints_NCF_P40,prints_p67phox	p.G292	ENST00000248899.6	37	c.876	CCDS13934.1	22																																																																																			-	pfam_OPR_PB1,smart_OPR_PB1		0.597	NCF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCF4	protein_coding	OTTHUMT00000318863.1	G	NM_000631	-		37273721	+1	no_errors	ENST00000248899	ensembl	human	known	74_37	silent	SNP	0.952	A
GOLGA6L6	727832	genome.wustl.edu	37	15	20739961	20739961	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr15:20739961C>T	ENST00000427390.2	-	8	1879	c.1789G>A	c.(1789-1791)Gag>Aag	p.E597K		NM_001145004.1	NP_001138476.1	A8MZA4	GG6L6_HUMAN	golgin A6 family-like 6	597	Gln-rich.|Glu-rich.									NS(3)|endometrium(4)|kidney(1)|skin(3)	11						ctcttttcctcctgctcccgt	0.557																																																	0								ENSG00000215405						5.0	6.0	6.0					15																	20739961		636	1477	2113	GOLGA6L6	SO:0001583	missense	0			-	HGNC	AK093450	CCDS45184.1	15q11.2	2014-02-12	2010-02-12		ENSG00000215405	ENSG00000277322			37225	protein-coding gene	gene with protein product			"""golgi autoantigen, golgin subfamily a, 6-like 6"""				Standard	NM_001145004		Approved	FLJ36131	uc001ytk.2	A8MZA4	OTTHUMG00000171663	ENST00000427390.2:c.1789G>A	15.37:g.20739961C>T	ENSP00000398615:p.Glu597Lys	Somatic	0	47	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	48	34.25	D3YTC0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_Ribosomal_L7/12_C/ClpS-like,prints_Tropomyosin	p.E597K	ENST00000427390.2	37	c.1789	CCDS45184.1	15	.	.	.	.	.	.	.	.	.	.	C	3.088	-0.187588	0.06299	.	.	ENSG00000215405	ENST00000427390	T	0.10382	2.88	.	.	.	.	.	.	.	.	T	0.09069	0.0224	L	0.46157	1.445	0.20074	N	0.999937	B	0.22800	0.075	B	0.27170	0.077	T	0.43766	-0.9371	7	0.16420	T	0.52	.	.	.	.	.	597	A8MZA4	GG6L6_HUMAN	K	597	ENSP00000398615:E597K	ENSP00000398615:E597K	E	-	1	0	GOLGA6L6	18999975	0.000000	0.05858	0.012000	0.15200	0.013000	0.08279	-0.131000	0.10482	0.159000	0.19401	0.162000	0.16502	GAG	-	NULL		0.557	GOLGA6L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GOLGA6L6	protein_coding	OTTHUMT00000414660.3	C	NM_001145004	-		20739961	-1	no_errors	ENST00000427390	ensembl	human	known	74_37	missense	SNP	0.879	T
FSD2	123722	genome.wustl.edu	37	15	83430979	83430979	+	Nonsense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr15:83430979C>T	ENST00000334574.8	-	12	2053	c.1872G>A	c.(1870-1872)tgG>tgA	p.W624*	FSD2_ENST00000541889.1_Nonsense_Mutation_p.W579*			A1L4K1	FSD2_HUMAN	fibronectin type III and SPRY domain containing 2	624	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.									breast(2)|central_nervous_system(1)|large_intestine(5)|lung(10)	18						CCTCCACCTCCCAGTAATGGT	0.522																																																	0								ENSG00000186628						105.0	105.0	105.0					15																	83430979		2049	4187	6236	FSD2	SO:0001587	stop_gained	0			-	HGNC	AK122875	CCDS45332.1, CCDS61738.1	15q25.2	2013-02-11	2006-01-11	2006-01-11		ENSG00000186628		"""Fibronectin type III domain containing"""	18024	protein-coding gene	gene with protein product			"""SPRY domain containing 1"""	SPRYD1			Standard	NM_001007122		Approved	RP11-127F21	uc002bjd.2	A1L4K1		ENST00000334574.8:c.1872G>A	15.37:g.83430979C>T	ENSP00000335651:p.Trp624*	Somatic	0	26	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	29	29.27	B3KVG1|B7ZM02	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Fibronectin_type3,pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Fibronectin_type3,prints_Butyrophylin	p.W624*	ENST00000334574.8	37	c.1872	CCDS45332.1	15	.	.	.	.	.	.	.	.	.	.	C	39	7.800938	0.98498	.	.	ENSG00000186628	ENST00000334574;ENST00000541889	.	.	.	5.73	5.73	0.89815	.	0.112278	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-16.8359	18.8873	0.92383	0.0:1.0:0.0:0.0	.	.	.	.	X	624;579	.	ENSP00000335651:W624X	W	-	3	0	FSD2	81228033	1.000000	0.71417	1.000000	0.80357	0.887000	0.51463	7.212000	0.77941	2.708000	0.92522	0.655000	0.94253	TGG	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,prints_Butyrophylin		0.522	FSD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FSD2	protein_coding	OTTHUMT00000418385.1	C	NM_001007122	-		83430979	-1	no_errors	ENST00000334574	ensembl	human	known	74_37	nonsense	SNP	1.000	T
ASTN1	460	genome.wustl.edu	37	1	176913033	176913033	+	Silent	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr1:176913033G>A	ENST00000367654.3	-	14	2606	c.2395C>T	c.(2395-2397)Ctg>Ttg	p.L799L	ASTN1_ENST00000424564.2_Silent_p.L791L|ASTN1_ENST00000367657.3_Silent_p.L791L|ASTN1_ENST00000361833.2_Silent_p.L791L|ASTN1_ENST00000281881.3_5'UTR	NM_004319.1	NP_004310.1	O14525	ASTN1_HUMAN	astrotactin 1	799					locomotory behavior (GO:0007626)|neuron cell-cell adhesion (GO:0007158)|neuron migration (GO:0001764)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)				NS(4)|breast(5)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(23)|liver(1)|lung(81)|ovary(6)|prostate(5)|skin(10)|urinary_tract(3)	153						TCACCAGTCAGGAAGTCAGGG	0.493																																																	0								ENSG00000152092						88.0	76.0	80.0					1																	176913033		2203	4300	6503	ASTN1	SO:0001819	synonymous_variant	0			-	HGNC	AB006627	CCDS1319.1, CCDS44280.1, CCDS65732.1	1q25.2	2008-02-05	2006-08-24	2006-08-24	ENSG00000152092	ENSG00000152092			773	protein-coding gene	gene with protein product		600904	"""astrotactin"""	ASTN		9070947	Standard	NM_001286164		Approved		uc001glc.3	O14525	OTTHUMG00000035041	ENST00000367654.3:c.2395C>T	1.37:g.176913033G>A		Somatic	0	51	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	40	23.08	A5PL12|B4DHI9|E9PFR8|O60799|Q5W0V7|Q5W0V8	Silent	SNP	NA	NA	NA	NA	NA	NA	superfamily_Fibronectin_type3,smart_EG-like_dom,smart_MACPF,pfscan_Fibronectin_type3	p.L799	ENST00000367654.3	37	c.2395		1																																																																																			-	NULL		0.493	ASTN1-201	KNOWN	basic	protein_coding	ASTN1	protein_coding		G	NM_004319	-		176913033	-1	no_errors	ENST00000367654	ensembl	human	known	74_37	silent	SNP	1.000	A
HSP90AB1	3326	genome.wustl.edu	37	6	44218310	44218310	+	Missense_Mutation	SNP	G	G	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr6:44218310G>T	ENST00000371554.1	+	6	1145	c.931G>T	c.(931-933)Gac>Tac	p.D311Y	HSP90AB1_ENST00000353801.3_Missense_Mutation_p.D311Y|HSP90AB1_ENST00000371646.5_Missense_Mutation_p.D311Y			P08238	HS90B_HUMAN	heat shock protein 90kDa alpha (cytosolic), class B member 1	311					axon guidance (GO:0007411)|cellular response to interleukin-4 (GO:0071353)|cellular response to organic cyclic compound (GO:0071407)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|placenta development (GO:0001890)|positive regulation of cell size (GO:0045793)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of protein binding (GO:0032092)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|protein folding (GO:0006457)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to salt stress (GO:0009651)|response to unfolded protein (GO:0006986)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|inclusion body (GO:0016234)|membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|CTP binding (GO:0002135)|dATP binding (GO:0032564)|double-stranded RNA binding (GO:0003725)|GTP binding (GO:0005525)|MHC class II protein complex binding (GO:0023026)|nitric-oxide synthase regulator activity (GO:0030235)|poly(A) RNA binding (GO:0044822)|TPR domain binding (GO:0030911)|UTP binding (GO:0002134)			NS(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(12)|prostate(2)|skin(2)|urinary_tract(2)	33	all_cancers(18;1.7e-05)|all_lung(25;0.00747)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			CCTCACTAATGACTGGGAAGA	0.463																																																	0								ENSG00000096384						73.0	69.0	71.0					6																	44218310		2203	4300	6503	HSP90AB1	SO:0001583	missense	0			-	HGNC	AF275719	CCDS4909.1	6p12	2011-09-02	2006-02-24	2006-02-24	ENSG00000096384	ENSG00000096384		"""Heat shock proteins / HSPC"""	5258	protein-coding gene	gene with protein product		140572	"""heat shock 90kD protein 1, beta"", ""heat shock 90kDa protein 1, beta"""	HSPC2, HSPCB		2768249, 16269234	Standard	NM_001271969		Approved		uc031sor.1	P08238	OTTHUMG00000014761	ENST00000371554.1:c.931G>T	6.37:g.44218310G>T	ENSP00000360609:p.Asp311Tyr	Somatic	0	30	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	32	21.95	B2R5P0|Q5T9W7|Q9NQW0|Q9NTK6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Hsp90_fam,pfam_HATPase_ATP-bd,superfamily_Ribosomal_S5_D2-typ_fold,superfamily_HATPase_ATP-bd,smart_HATPase_ATP-bd,pirsf_Hsp90_fam,prints_Hsp90_N	p.D311Y	ENST00000371554.1	37	c.931	CCDS4909.1	6	.	.	.	.	.	.	.	.	.	.	G	24.3	4.519223	0.85495	.	.	ENSG00000096384	ENST00000371646;ENST00000353801;ENST00000371554	T;T;T	0.15487	2.42;2.42;2.42	4.41	4.41	0.53225	Ribosomal protein S5 domain 2-type fold (1);	0.000000	0.64402	U	0.000001	T	0.58793	0.2147	H	0.99719	4.725	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.99;0.999;0.999	T	0.80906	-0.1173	10	0.87932	D	0	-31.7124	17.0182	0.86425	0.0:0.0:1.0:0.0	.	273;301;311	B4DMA2;B4DGL0;P08238	.;.;HS90B_HUMAN	Y	311	ENSP00000360709:D311Y;ENSP00000325875:D311Y;ENSP00000360609:D311Y	ENSP00000325875:D311Y	D	+	1	0	HSP90AB1	44326288	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.852000	0.99516	2.018000	0.59344	0.460000	0.39030	GAC	-	pfam_Hsp90_fam,superfamily_Ribosomal_S5_D2-typ_fold,pirsf_Hsp90_fam		0.463	HSP90AB1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	HSP90AB1	protein_coding	OTTHUMT00000040730.1	G	NM_007355	-		44218310	+1	no_errors	ENST00000353801	ensembl	human	known	74_37	missense	SNP	1.000	T
SCN2A	6326	genome.wustl.edu	37	2	166179976	166179976	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr2:166179976C>T	ENST00000375437.2	+	12	2272	c.1982C>T	c.(1981-1983)tCt>tTt	p.S661F	SCN2A_ENST00000375427.2_Missense_Mutation_p.S661F|SCN2A_ENST00000357398.3_Missense_Mutation_p.S661F|SCN2A_ENST00000283256.6_Missense_Mutation_p.S661F	NM_001040142.1	NP_001035232.1	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha subunit	661					intrinsic apoptotic signaling pathway in response to osmotic stress (GO:0008627)|membrane depolarization during action potential (GO:0086010)|myelination (GO:0042552)|neuron apoptotic process (GO:0051402)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intrinsic component of plasma membrane (GO:0031226)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|liver(2)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	118					Lamotrigine(DB00555)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	GGGGGCCCTTCTACCCTCACA	0.572																																																	0								ENSG00000136531						31.0	30.0	30.0					2																	166179976		2201	4300	6501	SCN2A	SO:0001583	missense	0			-	HGNC	AB208888	CCDS33313.1, CCDS33314.1	2q24.3	2012-02-26	2007-01-23	2007-01-23	ENSG00000136531	ENSG00000136531		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10588	protein-coding gene	gene with protein product		182390	"""sodium channel, voltage-gated, type II, alpha 2 polypeptide"", ""sodium channel, voltage-gated, type II, alpha 1 polypeptide"""	SCN2A1, SCN2A2		1317301, 16382098	Standard	XM_005246753		Approved	Nav1.2, HBSCII, HBSCI	uc002ude.3	Q99250	OTTHUMG00000044172	ENST00000375437.2:c.1982C>T	2.37:g.166179976C>T	ENSP00000364586:p.Ser661Phe	Somatic	0	19	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	12	29.41	A6NC14|A6NIQ5|Q14472|Q53T77|Q9BZC9|Q9BZD0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_DUF3451,pfam_PKD1_2_channel,smart_IQ_motif_EF-hand-BS,prints_Na_channel_asu,prints_PKD_2,pfscan_IQ_motif_EF-hand-BS	p.S661F	ENST00000375437.2	37	c.1982	CCDS33314.1	2	.	.	.	.	.	.	.	.	.	.	C	22.4	4.288629	0.80914	.	.	ENSG00000136531	ENST00000375437;ENST00000357398;ENST00000283256;ENST00000375427	D;D;D;D	0.91521	-2.86;-2.86;-2.86;-2.86	5.53	5.53	0.82687	Domain of unknown function DUF3451 (1);	0.382752	0.19037	U	0.124386	D	0.94387	0.8195	M	0.78916	2.43	0.51012	D	0.999901	B;P	0.44877	0.432;0.845	B;P	0.58077	0.121;0.832	D	0.93938	0.7220	10	0.51188	T	0.08	.	14.9951	0.71425	0.0:0.8578:0.1421:0.0	.	661;661	Q99250-2;Q99250	.;SCN2A_HUMAN	F	661	ENSP00000364586:S661F;ENSP00000349973:S661F;ENSP00000283256:S661F;ENSP00000364576:S661F	ENSP00000283256:S661F	S	+	2	0	SCN2A	165888222	0.882000	0.30256	0.979000	0.43373	0.964000	0.63967	5.818000	0.69236	2.595000	0.87683	0.637000	0.83480	TCT	-	pfam_DUF3451		0.572	SCN2A-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SCN2A	protein_coding	OTTHUMT00000102659.2	C	NM_021007	-		166179976	+1	no_errors	ENST00000283256	ensembl	human	known	74_37	missense	SNP	0.992	T
CCDC114	93233	genome.wustl.edu	37	19	48801542	48801542	+	Silent	SNP	G	G	A	rs267605561		TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr19:48801542G>A	ENST00000315396.7	-	11	1867	c.1185C>T	c.(1183-1185)ctC>ctT	p.L395L		NM_144577.3	NP_653178.3	Q96M63	CC114_HUMAN	coiled-coil domain containing 114	395					outer dynein arm assembly (GO:0036158)	cilium (GO:0005929)|outer dynein arm (GO:0036157)				cervix(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|stomach(1)	24		all_epithelial(76;9.64e-05)|all_lung(116;0.000147)|Lung NSC(112;0.000251)|Prostate(7;0.0187)|all_neural(266;0.0228)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000134)|all cancers(93;0.000162)|Epithelial(262;0.0134)|GBM - Glioblastoma multiforme(486;0.0143)		TGACCCCAAGGAGGTCATCGA	0.602																																																	0								ENSG00000105479						107.0	99.0	102.0					19																	48801542		2203	4300	6503	CCDC114	SO:0001819	synonymous_variant	0			-	HGNC	BC025752	CCDS12714.2	19q13.32	2013-02-22			ENSG00000105479	ENSG00000105479			26560	protein-coding gene	gene with protein product		615038				23261302, 23261303	Standard	NM_144577		Approved	FLJ32926, CILD20	uc002pir.2	Q96M63	OTTHUMG00000156161	ENST00000315396.7:c.1185C>T	19.37:g.48801542G>A		Somatic	0	45	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	52	17.46	Q6ZRL4|Q96M06|Q9UFG8	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.L395	ENST00000315396.7	37	c.1185	CCDS12714.2	19																																																																																			-	NULL		0.602	CCDC114-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC114	protein_coding	OTTHUMT00000343207.1	G	NM_144577	-		48801542	-1	no_errors	ENST00000315396	ensembl	human	known	74_37	silent	SNP	0.996	A
CALCRL	10203	genome.wustl.edu	37	2	188247945	188247945	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr2:188247945C>T	ENST00000409998.1	-	6	920	c.139G>A	c.(139-141)Gaa>Aaa	p.E47K	CALCRL_ENST00000410068.1_Missense_Mutation_p.E47K|AC007319.1_ENST00000412276.1_RNA|CALCRL_ENST00000392370.3_Missense_Mutation_p.E47K|AC007319.1_ENST00000453517.1_RNA			Q16602	CALRL_HUMAN	calcitonin receptor-like	47					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|angiogenesis (GO:0001525)|calcium ion transport (GO:0006816)|cAMP biosynthetic process (GO:0006171)|cellular response to sucrose stimulus (GO:0071329)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|heart development (GO:0007507)|negative regulation of inflammatory response (GO:0050728)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of smooth muscle cell proliferation (GO:0048661)|protein transport (GO:0015031)|receptor internalization (GO:0031623)|regulation of muscle contraction (GO:0006937)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	adrenomedullin receptor activity (GO:0001605)|calcitonin gene-related polypeptide receptor activity (GO:0001635)|calcitonin receptor activity (GO:0004948)|G-protein coupled receptor activity (GO:0004930)|protein transporter activity (GO:0008565)			endometrium(1)|large_intestine(7)|lung(21)|ovary(1)|prostate(1)|skin(1)	32			OV - Ovarian serous cystadenocarcinoma(117;0.0554)|Epithelial(96;0.227)			TGGTAACATTCATATTGAGCT	0.338																																																	0								ENSG00000064989						172.0	163.0	166.0					2																	188247945		2203	4300	6503	CALCRL	SO:0001583	missense	0			-	HGNC	U17473	CCDS2293.1	2q21.1-q21.3	2012-08-10			ENSG00000064989	ENSG00000064989		"""GPCR / Class B : Calcitonin receptors"""	16709	protein-coding gene	gene with protein product		114190				7818539, 8626685	Standard	NM_005795		Approved	CGRPR, CRLR	uc010frt.4	Q16602	OTTHUMG00000132636	ENST00000409998.1:c.139G>A	2.37:g.188247945C>T	ENSP00000386972:p.Glu47Lys	Somatic	0	43	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	41	19.61	A8K6G5|A8KAD3|Q53S02|Q53TS5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_2_secretin-like,pfam_GPCR_2_extracellular_dom,smart_GPCR_2_extracellular_dom,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GCPR_2_calcitonin_rcpt_fam,prints_GPCR_2_CGRP1_rcpt,prints_GPCR_2_secretin-like,prints_GPCR_2_calcitonin_rcpt	p.E47K	ENST00000409998.1	37	c.139	CCDS2293.1	2	.	.	.	.	.	.	.	.	.	.	C	21.3	4.132197	0.77662	.	.	ENSG00000064989	ENST00000392370;ENST00000409998;ENST00000410068;ENST00000447403	T;T;T;T	0.53640	0.61;0.61;0.61;0.61	5.78	5.78	0.91487	GPCR, family 2, extracellular hormone receptor domain (1);	0.000000	0.64402	D	0.000009	T	0.37758	0.1015	L	0.45137	1.4	0.80722	D	1	B	0.25105	0.118	B	0.25405	0.06	T	0.19712	-1.0297	10	0.02654	T	1	.	15.5166	0.75830	0.0:1.0:0.0:0.0	.	47	Q16602	CALRL_HUMAN	K	47	ENSP00000376177:E47K;ENSP00000386972:E47K;ENSP00000387190:E47K;ENSP00000415626:E47K	ENSP00000376177:E47K	E	-	1	0	CALCRL	187956190	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	6.174000	0.71943	2.736000	0.93811	0.557000	0.71058	GAA	-	pfscan_GPCR_2_extracellular_dom,prints_GCPR_2_calcitonin_rcpt_fam,prints_GPCR_2_CGRP1_rcpt,prints_GPCR_2_calcitonin_rcpt		0.338	CALCRL-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CALCRL	protein_coding	OTTHUMT00000334648.1	C	NM_005795	-		188247945	-1	no_errors	ENST00000392370	ensembl	human	known	74_37	missense	SNP	1.000	T
COL19A1	1310	genome.wustl.edu	37	6	70637854	70637854	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr6:70637854G>A	ENST00000322773.4	+	5	422	c.320G>A	c.(319-321)cGa>cAa	p.R107Q		NM_001858.4	NP_001849.2	Q14993	COJA1_HUMAN	collagen, type XIX, alpha 1	107	Laminin G-like.			FRVRRNAKKERWFL -> ETTVPFWRFFVLET (in Ref. 6; AAA36358). {ECO:0000305}.	cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|single organismal cell-cell adhesion (GO:0016337)|skeletal muscle tissue development (GO:0007519)|skeletal system development (GO:0001501)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|protein binding, bridging (GO:0030674)			breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(8)|lung(54)|ovary(3)|prostate(2)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	109						GCCATGTTTCGAGTACGAAGA	0.438																																																	0								ENSG00000082293						132.0	131.0	131.0					6																	70637854		2203	4300	6503	COL19A1	SO:0001583	missense	0			-	HGNC		CCDS4970.1	6q12-q13	2013-01-16			ENSG00000082293	ENSG00000082293		"""Collagens"""	2196	protein-coding gene	gene with protein product		120165				7916703, 9143499	Standard	NM_001858		Approved		uc003pfc.1	Q14993	OTTHUMG00000014987	ENST00000322773.4:c.320G>A	6.37:g.70637854G>A	ENSP00000316030:p.Arg107Gln	Somatic	0	65	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	58	22.67	Q00559|Q05850|Q12885|Q13676|Q14DH1|Q5JUF0|Q5T424|Q9H572|Q9NPZ2|Q9NQP2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Collagen,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G	p.R107Q	ENST00000322773.4	37	c.320	CCDS4970.1	6	.	.	.	.	.	.	.	.	.	.	G	13.62	2.292174	0.40594	.	.	ENSG00000082293	ENST00000322773	T	0.02258	4.37	5.71	5.71	0.89125	Concanavalin A-like lectin/glucanase (1);Laminin G, thrombospondin-type, N-terminal (1);	0.000000	0.64402	D	0.000001	T	0.09598	0.0236	M	0.78456	2.415	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.02333	-1.1175	10	0.59425	D	0.04	.	19.8644	0.96799	0.0:0.0:1.0:0.0	.	107	Q14993	COJA1_HUMAN	Q	107	ENSP00000316030:R107Q	ENSP00000316030:R107Q	R	+	2	0	COL19A1	70694575	1.000000	0.71417	1.000000	0.80357	0.363000	0.29612	5.202000	0.65169	2.691000	0.91804	0.655000	0.94253	CGA	-	superfamily_ConA-like_lec_gl_sf,smart_Laminin_G		0.438	COL19A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL19A1	protein_coding	OTTHUMT00000041127.1	G		-		70637854	+1	no_errors	ENST00000322773	ensembl	human	known	74_37	missense	SNP	1.000	A
ABTB2	25841	genome.wustl.edu	37	11	34180930	34180930	+	Silent	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr11:34180930G>A	ENST00000435224.2	-	14	3034	c.2610C>T	c.(2608-2610)ttC>ttT	p.F870F	ABTB2_ENST00000298992.2_Silent_p.F684F	NM_145804.2	NP_665803.2	Q8N961	ABTB2_HUMAN	ankyrin repeat and BTB (POZ) domain containing 2	870	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				cellular response to toxic substance (GO:0097237)	nucleus (GO:0005634)				breast(2)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		Acute lymphoblastic leukemia(5;0.0508)|all_hematologic(20;0.0691)				TTAGTGTCTTGAACCTGGAGC	0.483																																																	0								ENSG00000166016						226.0	166.0	186.0					11																	34180930		2202	4298	6500	ABTB2	SO:0001819	synonymous_variant	0			-	HGNC	AK056863	CCDS7890.1, CCDS7890.2	11p13	2013-10-02			ENSG00000166016	ENSG00000166016		"""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	23842	protein-coding gene	gene with protein product							Standard	NM_145804		Approved	DKFZP586C1619, BTBD22, ABTB2A	uc001mvl.2	Q8N961	OTTHUMG00000044382	ENST00000435224.2:c.2610C>T	11.37:g.34180930G>A		Somatic	0	30	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	23	20.69	A8K6S9|E9PRW7|Q52LD6|Q6MZW4|Q8NB44	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_BTB_POZ,pfam_Ankyrin_rpt,superfamily_Histone-fold,superfamily_BTB/POZ_fold,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_BTB/POZ-like,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_BTB/POZ-like	p.F870	ENST00000435224.2	37	c.2610	CCDS7890.2	11																																																																																			-	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pfscan_BTB/POZ-like		0.483	ABTB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABTB2	protein_coding	OTTHUMT00000388703.3	G	NM_145804	-		34180930	-1	no_errors	ENST00000435224	ensembl	human	known	74_37	silent	SNP	1.000	A
CHIAP2	149620	genome.wustl.edu	37	1	111824826	111824827	+	RNA	INS	-	-	AA	rs386354237|rs36004308|rs528702045|rs74360455	byFrequency	TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr1:111824826_111824827insAA	ENST00000369743.4	+	0	710_711					NR_003928.1				chitinase, acidic pseudogene 2																		aaagtatatttaaaaaaaaaaC	0.371																																																	0								ENSG00000203878																																			CHIAP2			0				HGNC			1p13.2	2012-10-11			ENSG00000203878	ENSG00000203878			44463	pseudogene	pseudogene							Standard	NR_003928		Approved		uc009wgb.3		OTTHUMG00000012173		1.37:g.111824835_111824836dupAA		Somatic	0	12	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	20	13.04		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000369743.4	37	NULL		1																																																																																			-	-		0.371	CHIAP2-001	KNOWN	basic	processed_transcript	CHIAP2	pseudogene	OTTHUMT00000033667.3	-				111824827	+1	no_errors	ENST00000369743	ensembl	human	known	74_37	rna	INS	0.013:0.029	AA
GON4L	54856	genome.wustl.edu	37	1	155723175	155723175	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr1:155723175C>T	ENST00000368331.1	-	29	5710	c.5662G>A	c.(5662-5664)Gag>Aag	p.E1888K	GON4L_ENST00000271883.5_Missense_Mutation_p.E1888K|GON4L_ENST00000437809.1_Missense_Mutation_p.E1888K	NM_001282858.1|NM_001282860.1	NP_001269787.1|NP_001269789.1	Q3T8J9	GON4L_HUMAN	gon-4-like (C. elegans)	1888					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(4)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	45	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					TCATGGGGCTCCTTGCTCTTG	0.567																																																	0								ENSG00000116580						116.0	114.0	114.0					1																	155723175		1928	4132	6060	GON4L	SO:0001583	missense	0			-	HGNC	AB046826	CCDS1121.1, CCDS44242.1, CCDS60296.1	1q22	2013-10-31	2006-11-08	2006-02-16	ENSG00000116580	ENSG00000116580			25973	protein-coding gene	gene with protein product		610393	"""gon-4 homolog (C.elegans)"""	GON4		16545939, 21454521	Standard	XM_005245283		Approved	FLJ20203, GON-4	uc001fly.1	Q3T8J9	OTTHUMG00000014106	ENST00000368331.1:c.5662G>A	1.37:g.155723175C>T	ENSP00000357315:p.Glu1888Lys	Somatic	0	40	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	36	24.49	B7ZBL4|Q14C93|Q3T8J8|Q5VYZ5|Q5W0D5|Q6AWA6|Q6P1Q6|Q7Z3L3|Q8IY79|Q9BQI1|Q9HCG6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PAH,superfamily_PAH,superfamily_Homeodomain-like,pfscan_Myb-like_dom	p.E1888K	ENST00000368331.1	37	c.5662		1	.	.	.	.	.	.	.	.	.	.	C	33	5.234159	0.95207	.	.	ENSG00000116580	ENST00000437809;ENST00000368331;ENST00000271883	T;T;T	0.10763	2.84;2.84;2.84	5.15	5.15	0.70609	.	0.233058	0.38837	N	0.001557	T	0.09992	0.0245	N	0.22421	0.69	0.42153	D	0.991565	P;D	0.55605	0.953;0.972	P;P	0.53912	0.551;0.737	T	0.10497	-1.0627	10	0.51188	T	0.08	.	18.4163	0.90571	0.0:1.0:0.0:0.0	.	1888;1888	Q3T8J9;Q3T8J9-3	GON4L_HUMAN;.	K	1888	ENSP00000396117:E1888K;ENSP00000357315:E1888K;ENSP00000271883:E1888K	ENSP00000271883:E1888K	E	-	1	0	GON4L	153989799	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	5.185000	0.65076	2.683000	0.91414	0.455000	0.32223	GAG	-	NULL		0.567	GON4L-201	KNOWN	basic|appris_candidate_longest	protein_coding	GON4L	protein_coding		C	NM_032292	-		155723175	-1	no_errors	ENST00000368331	ensembl	human	known	74_37	missense	SNP	1.000	T
HAUS4	54930	genome.wustl.edu	37	14	23421835	23421835	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr14:23421835G>A	ENST00000206474.7	-	3	365	c.113C>T	c.(112-114)cCa>cTa	p.P38L	HAUS4_ENST00000555367.1_Missense_Mutation_p.P38L|RP11-298I3.1_ENST00000548819.1_RNA|HAUS4_ENST00000541587.1_Missense_Mutation_p.P38L|HAUS4_ENST00000490506.1_Intron|RP11-298I3.5_ENST00000555074.1_Intron|HAUS4_ENST00000397409.4_Missense_Mutation_p.P38L|HAUS4_ENST00000347758.2_Missense_Mutation_p.P38L|HAUS4_ENST00000555986.1_Missense_Mutation_p.P38L|RP11-298I3.1_ENST00000548322.1_RNA|HAUS4_ENST00000342454.8_Missense_Mutation_p.P38L|HAUS4_ENST00000554446.1_5'UTR			Q9H6D7	HAUS4_HUMAN	HAUS augmin-like complex, subunit 4	38					centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|HAUS complex (GO:0070652)|microtubule (GO:0005874)				breast(3)|cervix(1)|endometrium(2)|lung(6)|ovary(1)|skin(1)	14						GCTGAAGTATGGGTTCTGTAA	0.468																																																	0								ENSG00000092036						101.0	97.0	99.0					14																	23421835		2203	4300	6503	HAUS4	SO:0001583	missense	0			-	HGNC	AK000431	CCDS9580.1, CCDS53886.1	14q11.1	2011-10-24	2009-04-20	2009-04-20	ENSG00000092036	ENSG00000092036		"""HAUS augmin-like complex subunits"""	20163	protein-coding gene	gene with protein product		613431	"""chromosome 14 open reading frame 94"""	C14orf94		19427217	Standard	NM_017815		Approved	FLJ20424	uc001wht.3	Q9H6D7	OTTHUMG00000028710	ENST00000206474.7:c.113C>T	14.37:g.23421835G>A	ENSP00000206474:p.Pro38Leu	Somatic	0	32	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	37	17.78	B7WP17|D3DS34|Q86T15|Q86T16|Q86U43|Q9NX59	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.P38L	ENST00000206474.7	37	c.113	CCDS9580.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	24.7|24.7	4.556879|4.556879	0.86231|0.86231	.|.	.|.	ENSG00000092036|ENSG00000092036	ENST00000553420|ENST00000206474;ENST00000541587;ENST00000342454;ENST00000347758;ENST00000397409;ENST00000555367;ENST00000555986;ENST00000555040;ENST00000556915;ENST00000554516;ENST00000557591	.|.	.|.	.|.	5.72|5.72	5.72|5.72	0.89469|0.89469	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.77525|0.77525	0.4143|0.4143	M|M	0.61703|0.61703	1.905|1.905	0.36633|0.36633	D|D	0.876438|0.876438	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.91635	.|0.998;0.998;0.999	T|T	0.82016|0.82016	-0.0666|-0.0666	5|9	.|0.87932	.|D	.|0	-13.4203|-13.4203	16.8031|16.8031	0.85619|0.85619	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|38;38;38	.|Q9H6D7-4;Q9H6D7-2;Q9H6D7	.|.;.;HAUS4_HUMAN	Y|L	20|38	.|.	.|ENSP00000206474:P38L	H|P	-|-	1|2	0|0	HAUS4|HAUS4	22491675|22491675	1.000000|1.000000	0.71417|0.71417	0.962000|0.962000	0.40283|0.40283	0.996000|0.996000	0.88848|0.88848	6.059000|6.059000	0.71133|0.71133	2.706000|2.706000	0.92434|0.92434	0.561000|0.561000	0.74099|0.74099	CAT|CCA	-	NULL		0.468	HAUS4-003	KNOWN	basic|appris_principal|CCDS	protein_coding	HAUS4	protein_coding	OTTHUMT00000071680.3	G		-		23421835	-1	no_errors	ENST00000206474	ensembl	human	known	74_37	missense	SNP	0.991	A
EFCAB5	374786	genome.wustl.edu	37	17	28405481	28405481	+	Silent	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr17:28405481C>T	ENST00000394835.3	+	15	3178	c.2986C>T	c.(2986-2988)Cta>Tta	p.L996L	EFCAB5_ENST00000394832.2_Intron|EFCAB5_ENST00000320856.5_Silent_p.L872L	NM_198529.3	NP_940931	A4FU69	EFCB5_HUMAN	EF-hand calcium binding domain 5	996							calcium ion binding (GO:0005509)			breast(7)|endometrium(2)|kidney(4)|large_intestine(11)|lung(14)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	43						TGGGGTGTCCCTAGAGCCGGT	0.483																																																	0								ENSG00000176927						46.0	46.0	46.0					17																	28405481		1950	4144	6094	EFCAB5	SO:0001819	synonymous_variant	0			-	HGNC	AL833911	CCDS11254.2, CCDS54103.1	17q11.2	2013-01-10			ENSG00000176927	ENSG00000176927		"""EF-hand domain containing"""	24801	protein-coding gene	gene with protein product							Standard	NM_198529		Approved	FLJ46247	uc002het.3	A4FU69	OTTHUMG00000132753	ENST00000394835.3:c.2986C>T	17.37:g.28405481C>T		Somatic	0	51	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	55	16.67	B2RPN0|B4DS75|B4DZR5|F5GYL2|Q0VD68|Q6ZRM6|Q8NDG9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfscan_EF_hand_dom	p.L996	ENST00000394835.3	37	c.2986	CCDS11254.2	17																																																																																			-	NULL		0.483	EFCAB5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	EFCAB5	protein_coding	OTTHUMT00000256120.4	C	NM_198529	-		28405481	+1	no_errors	ENST00000394835	ensembl	human	known	74_37	silent	SNP	0.263	T
SHISA3	152573	genome.wustl.edu	37	4	42403081	42403081	+	Silent	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr4:42403081C>T	ENST00000319234.4	+	2	548	c.330C>T	c.(328-330)atC>atT	p.I110I		NM_001080505.1	NP_001073974.1	A0PJX4	SHSA3_HUMAN	shisa family member 3	110					multicellular organismal development (GO:0007275)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(1)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	12						TTGCGTTCATCATCCTGGGCT	0.507																																																	0								ENSG00000178343						220.0	221.0	221.0					4																	42403081		2203	4300	6503	SHISA3	SO:0001819	synonymous_variant	0			-	HGNC	BC012029	CCDS33979.1	4p13	2013-07-31	2013-07-31		ENSG00000178343	ENSG00000178343		"""Shisa homologs"""	25159	protein-coding gene	gene with protein product			"""shisa homolog 3 (Xenopus laevis)"""				Standard	NM_001080505		Approved	hShisa3	uc003gwp.3	A0PJX4	OTTHUMG00000161043	ENST00000319234.4:c.330C>T	4.37:g.42403081C>T		Somatic	0	84	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	87	15.53	A0PJX3|Q96EQ5	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.I110	ENST00000319234.4	37	c.330	CCDS33979.1	4																																																																																			-	NULL		0.507	SHISA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHISA3	protein_coding	OTTHUMT00000363539.1	C	NM_001080505	-		42403081	+1	no_errors	ENST00000319234	ensembl	human	known	74_37	silent	SNP	0.997	T
PRAMEF12	390999	genome.wustl.edu	37	1	12835790	12835790	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr1:12835790G>A	ENST00000357726.4	+	2	419	c.392G>A	c.(391-393)cGa>cAa	p.R131Q		NM_001080830.1	NP_001074299.1	O95522	PRA12_HUMAN	PRAME family member 12	131					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					NS(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(9)|ovary(3)|skin(1)|urinary_tract(1)	23	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00818)|Colorectal(212;5.04e-06)|Kidney(185;4.99e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000198)|COAD - Colon adenocarcinoma(227;0.000245)|BRCA - Breast invasive adenocarcinoma(304;0.000295)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		AGTAAGAGACGAACAGCAGGG	0.542																																																	0								ENSG00000116726						108.0	122.0	118.0					1																	12835790		2177	4296	6473	PRAMEF12	SO:0001583	missense	0			-	HGNC		CCDS41254.1	1p36.21	2013-01-17			ENSG00000116726	ENSG00000116726		"""-"""	22125	protein-coding gene	gene with protein product							Standard	NM_001080830		Approved	OTTHUMG00000001927	uc001aui.3	O95522	OTTHUMG00000001927	ENST00000357726.4:c.392G>A	1.37:g.12835790G>A	ENSP00000350358:p.Arg131Gln	Somatic	0	87	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	105	19.08		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.R131Q	ENST00000357726.4	37	c.392	CCDS41254.1	1	.	.	.	.	.	.	.	.	.	.	.	0.017	-1.499776	0.01001	.	.	ENSG00000116726	ENST00000357726	T	0.12361	2.69	2.8	-5.6	0.02497	.	6.292790	0.00896	N	0.002291	T	0.02230	0.0069	N	0.00317	-1.655	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.29549	-1.0008	10	0.02654	T	1	.	1.0684	0.01616	0.2012:0.1765:0.3636:0.2587	.	131	O95522	PRA12_HUMAN	Q	131	ENSP00000350358:R131Q	ENSP00000350358:R131Q	R	+	2	0	PRAMEF12	12758377	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	-0.925000	0.03992	-1.812000	0.01227	-0.752000	0.03492	CGA	-	NULL		0.542	PRAMEF12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRAMEF12	protein_coding	OTTHUMT00000005457.1	G	XM_372760	-		12835790	+1	no_errors	ENST00000357726	ensembl	human	known	74_37	missense	SNP	0.000	A
RPN2	6185	genome.wustl.edu	37	20	35826834	35826834	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr20:35826834C>T	ENST00000237530.6	+	3	553	c.242C>T	c.(241-243)cCc>cTc	p.P81L	RPN2_ENST00000373622.5_Intron	NM_002951.3	NP_002942.2	P04844	RPN2_HUMAN	ribophorin II	81					aging (GO:0007568)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|gene expression (GO:0010467)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|response to drug (GO:0042493)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	autophagic vacuole membrane (GO:0000421)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)|oligosaccharyltransferase complex (GO:0008250)|rough endoplasmic reticulum (GO:0005791)	ribosome binding (GO:0043022)|transferase activity, transferring glycosyl groups (GO:0016757)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)|pancreas(1)|skin(2)|stomach(1)	24		Myeloproliferative disorder(115;0.00878)				AACCTTGATCCCAGCAATGTG	0.493																																																	0								ENSG00000118705						147.0	123.0	131.0					20																	35826834		2203	4300	6503	RPN2	SO:0001583	missense	0			-	HGNC	Y00282	CCDS13291.1, CCDS46599.1	20q12-q13.1	2013-03-06			ENSG00000118705	ENSG00000118705			10382	protein-coding gene	gene with protein product	"""oligosaccharyltransferase complex subunit (non-catalytic)"""	180490					Standard	NM_002951		Approved	SWP1, RPNII, RIBIIR, RPN-II	uc002xgp.3	P04844	OTTHUMG00000032409	ENST00000237530.6:c.242C>T	20.37:g.35826834C>T	ENSP00000237530:p.Pro81Leu	Somatic	0	30	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	25	28.57	Q5JYR6|Q6IBA5|Q96E21|Q9BUQ3|Q9UBE1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Swp1	p.P81L	ENST00000237530.6	37	c.242	CCDS13291.1	20	.	.	.	.	.	.	.	.	.	.	C	18.28	3.588764	0.66105	.	.	ENSG00000118705	ENST00000237530;ENST00000373632;ENST00000338768	T;T	0.42513	0.97;0.97	5.25	4.31	0.51392	.	0.239125	0.43579	D	0.000543	T	0.35799	0.0944	L	0.44542	1.39	0.80722	D	1	P;P	0.36086	0.536;0.536	B;B	0.40256	0.324;0.229	T	0.07539	-1.0767	10	0.15499	T	0.54	-10.3348	11.3069	0.49340	0.0:0.9132:0.0:0.0868	.	81;81	P04844;B2RE46	RPN2_HUMAN;.	L	81	ENSP00000237530:P81L;ENSP00000362735:P81L	ENSP00000237530:P81L	P	+	2	0	RPN2	35260248	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.383000	0.66219	1.444000	0.47605	0.563000	0.77884	CCC	-	pfam_Swp1		0.493	RPN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPN2	protein_coding	OTTHUMT00000079076.2	C	NM_002951	-		35826834	+1	no_errors	ENST00000237530	ensembl	human	known	74_37	missense	SNP	1.000	T
PI16	221476	genome.wustl.edu	37	6	36931377	36931377	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr6:36931377C>T	ENST00000373674.3	+	5	1587	c.1259C>T	c.(1258-1260)tCg>tTg	p.S420L	PI16_ENST00000491324.1_Intron	NM_001199159.1|NM_153370.2	NP_001186088.1|NP_699201.2	Q6UXB8	PI16_HUMAN	peptidase inhibitor 16	420					negative regulation of cell growth involved in cardiac muscle cell development (GO:0061052)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	peptidase inhibitor activity (GO:0030414)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(13)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						GCTCTGCAGTCGTCCTTGCCA	0.607																																																	0								ENSG00000164530						56.0	56.0	56.0					6																	36931377		2203	4300	6503	PI16	SO:0001583	missense	0			-	HGNC		CCDS34440.1	6p21.31	2014-01-28	2005-08-17		ENSG00000164530	ENSG00000164530			21245	protein-coding gene	gene with protein product	"""microseminoprotein, beta-binding protein"""		"""protease inhibitor 16"""				Standard	NM_001199159		Approved	MGC45378, dJ90K10.5, MSMBBP	uc003ona.3	Q6UXB8	OTTHUMG00000014611	ENST00000373674.3:c.1259C>T	6.37:g.36931377C>T	ENSP00000362778:p.Ser420Leu	Somatic	0	14	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	15	31.82	Q6ZVG9|Q8IYL8|Q8NBK0|Q8TCB8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_CAP_domain,superfamily_CAP_domain,smart_Allrgn_V5/Tpx1,prints_Allrgn_V5/Tpx1	p.S420L	ENST00000373674.3	37	c.1259	CCDS34440.1	6	.	.	.	.	.	.	.	.	.	.	C	20.2	3.941714	0.73557	.	.	ENSG00000164530	ENST00000373674;ENST00000539035	T	0.17370	2.28	4.94	4.08	0.47627	.	0.000000	0.40469	N	0.001084	T	0.05731	0.0150	L	0.32530	0.975	0.80722	D	1	B	0.33549	0.417	B	0.25987	0.065	T	0.12941	-1.0528	10	0.87932	D	0	.	11.1757	0.48598	0.0:0.9107:0.0:0.0893	.	420	Q6UXB8	PI16_HUMAN	L	420;272	ENSP00000362778:S420L	ENSP00000362778:S420L	S	+	2	0	PI16	37039355	0.957000	0.32711	0.883000	0.34634	0.781000	0.44180	2.361000	0.44160	1.318000	0.45170	0.561000	0.74099	TCG	-	NULL		0.607	PI16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PI16	protein_coding	OTTHUMT00000040380.1	C	NM_153370	-		36931377	+1	no_errors	ENST00000373674	ensembl	human	known	74_37	missense	SNP	0.901	T
GOLPH3	64083	genome.wustl.edu	37	5	32126496	32126496	+	Missense_Mutation	SNP	A	A	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr5:32126496A>T	ENST00000265070.6	-	4	1034	c.719T>A	c.(718-720)aTt>aAt	p.I240N	GOLPH3_ENST00000512668.1_5'Flank	NM_022130.3	NP_071413.1	Q9H4A6	GOLP3_HUMAN	golgi phosphoprotein 3 (coat-protein)	240					cell adhesion molecule production (GO:0060352)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|gene expression (GO:0010467)|glycoprotein biosynthetic process (GO:0009101)|Golgi organization (GO:0007030)|Golgi to plasma membrane protein transport (GO:0043001)|Golgi vesicle budding (GO:0048194)|lamellipodium assembly (GO:0030032)|leukocyte tethering or rolling (GO:0050901)|positive regulation of protein secretion (GO:0050714)|positive regulation of TOR signaling (GO:0032008)|protein retention in Golgi apparatus (GO:0045053)|protein secretion (GO:0009306)|regulation of mitochondrion organization (GO:0010821)	cytosol (GO:0005829)|endosome (GO:0005768)|Golgi cisterna (GO:0031985)|Golgi membrane (GO:0000139)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	enzyme binding (GO:0019899)|phosphatidylinositol-4-phosphate binding (GO:0070273)			kidney(2)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)	11						AGCCAGGTAAATGAGGGCCAG	0.527																																																	0								ENSG00000113384						145.0	127.0	133.0					5																	32126496		2203	4300	6503	GOLPH3	SO:0001583	missense	0			-	HGNC	AK075156	CCDS3896.1	5p13.2	2008-07-18			ENSG00000113384	ENSG00000113384			15452	protein-coding gene	gene with protein product	"""golgi peripheral membrane protein 1, 34 kDa"", ""golgi protein"", ""coat-protein"", ""golgi-associated protein"""	612207				11042173, 16263763	Standard	NM_022130		Approved	GPP34, GOPP1, MIDAS	uc003jhp.1	Q9H4A6	OTTHUMG00000090679	ENST00000265070.6:c.719T>A	5.37:g.32126496A>T	ENSP00000265070:p.Ile240Asn	Somatic	0	123	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	143	13.33	Q9UIW5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPP34	p.I240N	ENST00000265070.6	37	c.719	CCDS3896.1	5	.	.	.	.	.	.	.	.	.	.	A	11.97	1.797799	0.31777	.	.	ENSG00000113384	ENST00000265070;ENST00000542582	.	.	.	6.17	5.02	0.67125	.	0.044892	0.85682	D	0.000000	T	0.80232	0.4585	M	0.85710	2.77	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.82760	-0.0298	9	0.87932	D	0	-4.8608	12.2882	0.54803	0.9345:0.0:0.0655:0.0	.	240	Q9H4A6	GOLP3_HUMAN	N	240;223	.	ENSP00000265070:I240N	I	-	2	0	GOLPH3	32162253	1.000000	0.71417	0.867000	0.34043	0.001000	0.01503	8.904000	0.92590	1.161000	0.42604	-0.250000	0.11733	ATT	-	pfam_GPP34		0.527	GOLPH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GOLPH3	protein_coding	OTTHUMT00000207363.2	A	NM_022130	-		32126496	-1	no_errors	ENST00000265070	ensembl	human	known	74_37	missense	SNP	0.999	T
PLCZ1	89869	genome.wustl.edu	37	12	18852761	18852761	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr12:18852761C>T	ENST00000538330.1	-	6	868	c.487G>A	c.(487-489)Gag>Aag	p.E163K	PLCZ1_ENST00000542762.1_5'UTR|PLCZ1_ENST00000266505.7_Missense_Mutation_p.E381K|PLCZ1_ENST00000435379.1_Missense_Mutation_p.E186K|PLCZ1_ENST00000539875.1_Missense_Mutation_p.E188K|PLCZ1_ENST00000447925.2_Missense_Mutation_p.E379K|PLCZ1_ENST00000541695.1_Missense_Mutation_p.E244K					phospholipase C, zeta 1											NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	31	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.0241)					GCTTGTGTCTCCCCAATAGAA	0.323																																																	0								ENSG00000139151						46.0	51.0	49.0					12																	18852761		2202	4294	6496	PLCZ1	SO:0001583	missense	0			-	HGNC	AY035866	CCDS8680.1	12p13.31	2013-01-10			ENSG00000139151	ENSG00000139151	3.1.4.11	"""EF-hand domain containing"""	19218	protein-coding gene	gene with protein product		608075				12117804	Standard	NM_033123		Approved	NYD-SP27, PLCzeta	uc021qvx.2	Q86YW0	OTTHUMG00000168937	ENST00000538330.1:c.487G>A	12.37:g.18852761C>T	ENSP00000445880:p.Glu163Lys	Somatic	0	104	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	28	122	18.67		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_PLipase_C_EF-hand-like,pfam_C2_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_dom,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_dom,pfscan_EF_hand_dom,pfscan_C2_dom,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,prints_Pinositol_PLipase_C	p.E381K	ENST00000538330.1	37	c.1141		12	.	.	.	.	.	.	.	.	.	.	C	29.9	5.048366	0.93740	.	.	ENSG00000139151	ENST00000538330;ENST00000266505;ENST00000447925;ENST00000435379;ENST00000541695;ENST00000539875;ENST00000540421;ENST00000543242	T;T;T;T;T;T;T;T	0.77750	-1.12;-1.12;-1.12;-1.12;-1.12;-1.12;-1.12;-0.2	5.88	5.88	0.94601	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);Phospholipase C, phosphatidylinositol-specific, Y domain (3);	0.000000	0.85682	D	0.000000	D	0.91713	0.7380	H	0.95470	3.675	0.49299	D	0.999774	D;D	0.89917	1.0;1.0	D;D	0.81914	0.995;0.993	D	0.93563	0.6897	10	0.87932	D	0	.	16.9709	0.86298	0.0:1.0:0.0:0.0	.	381;163	Q86YW0;Q8N7S5	PLCZ1_HUMAN;.	K	163;381;379;186;244;188;116;122	ENSP00000445880:E163K;ENSP00000266505:E381K;ENSP00000402358:E379K;ENSP00000400504:E186K;ENSP00000443349:E244K;ENSP00000445026:E188K;ENSP00000445889:E116K;ENSP00000443762:E122K	ENSP00000266505:E381K	E	-	1	0	PLCZ1	18744028	1.000000	0.71417	0.901000	0.35422	0.991000	0.79684	5.556000	0.67307	2.779000	0.95612	0.650000	0.86243	GAG	-	pfam_PLipase_C_Pinositol-sp_Y,superfamily_PLC-like_Pdiesterase_TIM-brl,smart_PLipase_C_Pinositol-sp_Y,pfscan_PLipase_C_Pinositol-sp_Y		0.323	PLCZ1-002	PUTATIVE	basic|exp_conf	protein_coding	PLCZ1	protein_coding	OTTHUMT00000401666.3	C	NM_033123	-		18852761	-1	no_errors	ENST00000266505	ensembl	human	known	74_37	missense	SNP	0.996	T
NFAT5	10725	genome.wustl.edu	37	16	69681482	69681482	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr16:69681482G>A	ENST00000354436.2	+	3	1069	c.751G>A	c.(751-753)Gga>Aga	p.G251R	NFAT5_ENST00000567239.1_Missense_Mutation_p.G269R|NFAT5_ENST00000566899.1_Missense_Mutation_p.G175R|NFAT5_ENST00000393742.2_Missense_Mutation_p.G175R|NFAT5_ENST00000432919.1_Missense_Mutation_p.G269R|NFAT5_ENST00000349945.1_Missense_Mutation_p.G175R	NM_006599.3	NP_006590.1	O94916	NFAT5_HUMAN	nuclear factor of activated T-cells 5, tonicity-responsive	251					cytokine production (GO:0001816)|excretion (GO:0007588)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of calcineurin-NFAT signaling cascade (GO:0070884)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(11)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	37						CTCAAAAGCGGGAAATGGGTT	0.358																																																	0								ENSG00000102908						63.0	62.0	62.0					16																	69681482		2193	4293	6486	NFAT5	SO:0001583	missense	0			-	HGNC	AF134870	CCDS10881.1, CCDS10882.1, CCDS45519.1	16q22.1	2009-11-24			ENSG00000102908	ENSG00000102908		"""Nuclear factor of activated T-cells"""	7774	protein-coding gene	gene with protein product		604708				10377394	Standard	NM_173214		Approved	TONEBP, KIAA0827, NFATL1, OREBP, NFATZ, NF-AT5	uc002exl.2	O94916	OTTHUMG00000137572	ENST00000354436.2:c.751G>A	16.37:g.69681482G>A	ENSP00000346420:p.Gly251Arg	Somatic	0	34	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	40	13.04	A2RRB4|A6H8V5|E9PHR7|O95693|Q7LA65|Q969Q8|Q96QH3|Q9UN18	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RHD,superfamily_p53-like_TF_DNA-bd,superfamily_Ig_E-set,smart_IPT,pfscan_RHD,prints_NFAT	p.G269R	ENST00000354436.2	37	c.805	CCDS10881.1	16	.	.	.	.	.	.	.	.	.	.	G	18.58	3.653884	0.67472	.	.	ENSG00000102908	ENST00000432919;ENST00000426654;ENST00000349945;ENST00000354436;ENST00000393742	T;T;T;T	0.52295	0.68;0.67;0.68;0.67	5.47	5.47	0.80525	.	0.178871	0.50627	D	0.000113	T	0.56891	0.2016	N	0.19112	0.55	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.76575	0.96;0.988;0.988	T	0.61879	-0.6972	10	0.62326	D	0.03	-1.9472	19.3142	0.94206	0.0:0.0:1.0:0.0	.	269;251;269	A2RRB4;O94916;E9PHR7	.;NFAT5_HUMAN;.	R	269;269;175;251;175	ENSP00000396538:G269R;ENSP00000338806:G175R;ENSP00000346420:G251R;ENSP00000377343:G175R	ENSP00000338806:G175R	G	+	1	0	NFAT5	68238983	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.596000	0.74113	2.550000	0.86006	0.585000	0.79938	GGA	-	NULL		0.358	NFAT5-001	KNOWN	basic|CCDS	protein_coding	NFAT5	protein_coding	OTTHUMT00000268952.2	G	NM_138714	-		69681482	+1	no_errors	ENST00000432919	ensembl	human	known	74_37	missense	SNP	1.000	A
YLPM1	56252	genome.wustl.edu	37	14	75266069	75266069	+	Nonsense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr14:75266069C>T	ENST00000325680.7	+	5	4193	c.4069C>T	c.(4069-4071)Cga>Tga	p.R1357*	YLPM1_ENST00000552421.1_Intron|YLPM1_ENST00000238571.3_Nonsense_Mutation_p.R1162*	NM_019589.2	NP_062535.2	P49750	YLPM1_HUMAN	YLP motif containing 1	1162					regulation of telomere maintenance (GO:0032204)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)	p.R1357*(1)|p.R1162*(1)		breast(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(12)|lung(24)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	62			KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00162)		AGAAAGAAATCGAGAGCATGG	0.473																																																	2	Substitution - Nonsense(2)	large_intestine(2)						ENSG00000119596						170.0	160.0	163.0					14																	75266069		1882	4122	6004	YLPM1	SO:0001587	stop_gained	0			-	HGNC	AK090435	CCDS45135.1	14q24.3	2014-06-13	2004-07-15	2004-07-15	ENSG00000119596	ENSG00000119596			17798	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 169"""		"""chromosome 14 open reading frame 170"""	C14orf170		7596406	Standard	NM_019589		Approved	ZAP, PPP1R169	uc001xqj.4	P49750	OTTHUMG00000172503	ENST00000325680.7:c.4069C>T	14.37:g.75266069C>T	ENSP00000324463:p.Arg1357*	Somatic	0	24	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	27	22.86	P49752|Q96I64|Q9P1V7	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_P-loop_NTPase	p.R1357*	ENST00000325680.7	37	c.4069	CCDS45135.1	14	.	.	.	.	.	.	.	.	.	.	C	37	6.382028	0.97520	.	.	ENSG00000119596	ENST00000325680;ENST00000238571;ENST00000423680	.	.	.	5.97	5.01	0.66863	.	0.000000	0.53938	D	0.000053	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.5401	13.708	0.62651	0.2119:0.7881:0.0:0.0	.	.	.	.	X	1357;1162;1070	.	ENSP00000238571:R1162X	R	+	1	2	YLPM1	74335822	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.759000	0.47573	2.855000	0.98099	0.537000	0.68136	CGA	-	NULL		0.473	YLPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YLPM1	protein_coding	OTTHUMT00000404451.1	C	NM_019589	-		75266069	+1	no_errors	ENST00000325680	ensembl	human	known	74_37	nonsense	SNP	1.000	T
KCNT2	343450	genome.wustl.edu	37	1	196438156	196438156	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr1:196438156C>T	ENST00000294725.9	-	6	1342	c.427G>A	c.(427-429)Gaa>Aaa	p.E143K	KCNT2_ENST00000367433.5_Missense_Mutation_p.E143K|KCNT2_ENST00000609185.1_Missense_Mutation_p.E143K|KCNT2_ENST00000451324.2_5'UTR|KCNT2_ENST00000367431.4_Missense_Mutation_p.E143K			Q6UVM3	KCNT2_HUMAN	potassium channel, subfamily T, member 2	143					potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(16)|lung(43)|ovary(5)|pancreas(1)|prostate(1)|skin(11)|stomach(2)|upper_aerodigestive_tract(1)	97						TTAATTATTTCCAAGATGAAG	0.313																																																	0								ENSG00000162687						45.0	46.0	45.0					1																	196438156		2200	4297	6497	KCNT2	SO:0001583	missense	0			-	HGNC	BX647852, AY359444, AK127807	CCDS1384.1, CCDS72994.1, CCDS72995.1	1q31.3	2012-07-05			ENSG00000162687	ENSG00000162687		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18866	protein-coding gene	gene with protein product	"""sodium and chloride activated ATP sensitive potassium channel"""	610044				16382103	Standard	NM_198503		Approved	KCa4.2, SLICK, SLO2.1	uc001gtd.1	Q6UVM3	OTTHUMG00000035611	ENST00000294725.9:c.427G>A	1.37:g.196438156C>T	ENSP00000294725:p.Glu143Lys	Somatic	0	91	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	121	14.79	Q3SY59|Q5VTN1|Q6ZMT3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_K_chnl_Ca-activ_BK_asu,pfam_2pore_dom_K_chnl_dom	p.E143K	ENST00000294725.9	37	c.427	CCDS1384.1	1	.	.	.	.	.	.	.	.	.	.	C	34	5.391978	0.95988	.	.	ENSG00000162687	ENST00000367433;ENST00000367431;ENST00000294725	T;T;T	0.19938	2.11;2.15;2.36	5.41	5.41	0.78517	.	0.000000	0.64402	D	0.000015	T	0.49558	0.1564	M	0.77313	2.365	0.80722	D	1	D;D;D;D	0.76494	0.999;0.992;0.998;0.999	D;D;D;D	0.75020	0.968;0.985;0.985;0.968	T	0.50482	-0.8823	10	0.87932	D	0	-24.2561	18.1303	0.89599	0.0:1.0:0.0:0.0	.	143;143;143;143	A9LNM6;Q6UVM3-2;Q6UVM3-3;Q6UVM3	.;.;.;KCNT2_HUMAN	K	143	ENSP00000356403:E143K;ENSP00000356401:E143K;ENSP00000294725:E143K	ENSP00000294725:E143K	E	-	1	0	KCNT2	194704779	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.776000	0.75023	2.812000	0.96745	0.557000	0.71058	GAA	-	NULL		0.313	KCNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNT2	protein_coding	OTTHUMT00000086418.2	C	NM_198503	-		196438156	-1	no_errors	ENST00000294725	ensembl	human	known	74_37	missense	SNP	1.000	T
CMKLR1	1240	genome.wustl.edu	37	12	108685801	108685801	+	Silent	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr12:108685801G>A	ENST00000312143.7	-	3	1302	c.939C>T	c.(937-939)ccC>ccT	p.P313P	CMKLR1_ENST00000552995.1_Silent_p.P311P|CMKLR1_ENST00000412676.1_Silent_p.P313P|CMKLR1_ENST00000550402.1_Silent_p.P313P|CMKLR1_ENST00000397688.2_Silent_p.P311P	NM_001142344.1|NM_004072.2	NP_001135816.1|NP_004063.1	Q99788	CML1_HUMAN	chemokine-like receptor 1	313					chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of macrophage chemotaxis (GO:0010759)|regulation of calcium-mediated signaling (GO:0050848)|skeletal system development (GO:0001501)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	chemokine receptor activity (GO:0004950)|G-protein coupled receptor activity (GO:0004930)|receptor activity (GO:0004872)			endometrium(5)|large_intestine(3)|lung(20)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	37						CATACAGAATGGGGTTCATGC	0.542																																																	0								ENSG00000174600						72.0	75.0	74.0					12																	108685801		2004	4174	6178	CMKLR1	SO:0001819	synonymous_variant	0			-	HGNC	U79526	CCDS41829.1, CCDS44965.1	12q23.3	2013-07-29			ENSG00000174600	ENSG00000174600		"""GPCR / Class A : Resolvin receptors"""	2121	protein-coding gene	gene with protein product	"""resolvin E1 receptor"", ""chemerin receptor"""	602351					Standard	NM_004072		Approved	RVER1	uc009zuw.3	Q99788	OTTHUMG00000169576	ENST00000312143.7:c.939C>T	12.37:g.108685801G>A		Somatic	0	34	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	49	16.95	A8K6Y5|O75748|Q3KP37|Q5U0H0|Q99789	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_DEZorph_rcpt,prints_GPCR_Rhodpsn,prints_Formyl_pep_rcpt,prints_Anphylx_rcpt,prints_ATII_rcpt	p.P313	ENST00000312143.7	37	c.939	CCDS44965.1	12																																																																																			-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.542	CMKLR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CMKLR1	protein_coding	OTTHUMT00000404867.1	G		-		108685801	-1	no_errors	ENST00000312143	ensembl	human	known	74_37	silent	SNP	0.998	A
GPR115	221393	genome.wustl.edu	37	6	47681807	47681807	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr6:47681807C>T	ENST00000283303.2	+	6	1084	c.826C>T	c.(826-828)Ccc>Tcc	p.P276S	GPR115_ENST00000327753.3_Missense_Mutation_p.P276S|RN7SKP116_ENST00000516902.1_RNA|GPR115_ENST00000371220.1_Missense_Mutation_p.P333S	NM_153838.3	NP_722580.3	Q8IZF3	GP115_HUMAN	G protein-coupled receptor 115	276					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(24)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	52						GGTACAGATTCCCAGGCAAGA	0.448																																					GBM(22;431 510 9010 26644 32828)												0								ENSG00000153294						57.0	59.0	58.0					6																	47681807		2203	4300	6503	GPR115	SO:0001583	missense	0			-	HGNC	AK095395	CCDS4922.2	6p12.3	2014-08-08			ENSG00000153294	ENSG00000153294		"""-"", ""GPCR / Class B : Orphans"""	19011	protein-coding gene	gene with protein product		614268				12435584	Standard	NM_153838		Approved	FLJ38076, PGR18	uc003oza.1	Q8IZF3	OTTHUMG00000014800	ENST00000283303.2:c.826C>T	6.37:g.47681807C>T	ENSP00000283303:p.Pro276Ser	Somatic	0	27	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	33	25.00	B3KTD0|Q2PNZ0|Q5T5B5|Q5T5B6|Q86SN9|Q8IXE6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like,prints_GPCR_2_Ig-hepta_rcpt	p.P333S	ENST00000283303.2	37	c.997	CCDS4922.2	6	.	.	.	.	.	.	.	.	.	.	C	5.258	0.232964	0.09969	.	.	ENSG00000153294	ENST00000371220;ENST00000327753;ENST00000283303	T;T;T	0.39056	1.33;1.1;1.1	5.19	5.19	0.71726	.	0.000000	0.64402	D	0.000002	T	0.10766	0.0263	L	0.37630	1.12	0.30510	N	0.769502	P	0.37141	0.584	B	0.30251	0.113	T	0.13361	-1.0512	10	0.02654	T	1	-22.5927	11.5523	0.50726	0.0:0.9181:0.0:0.0819	.	276	Q8IZF3	GP115_HUMAN	S	333;276;276	ENSP00000360264:P333S;ENSP00000328319:P276S;ENSP00000283303:P276S	ENSP00000283303:P276S	P	+	1	0	GPR115	47789766	1.000000	0.71417	0.999000	0.59377	0.117000	0.20001	2.322000	0.43814	2.578000	0.87016	0.655000	0.94253	CCC	-	NULL		0.448	GPR115-201	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR115	protein_coding	OTTHUMT00000040819.2	C	NM_153838	-		47681807	+1	no_errors	ENST00000371220	ensembl	human	known	74_37	missense	SNP	0.989	T
SLC12A7	10723	genome.wustl.edu	37	5	1081840	1081840	+	Silent	SNP	G	G	A	rs199523332		TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr5:1081840G>A	ENST00000264930.5	-	9	1192	c.1149C>T	c.(1147-1149)taC>taT	p.Y383Y		NM_006598.2	NP_006589.2	Q9Y666	S12A7_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 7	383					cell volume homeostasis (GO:0006884)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|potassium ion transport (GO:0006813)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)			breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	32	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;5.44e-09)		Epithelial(17;0.000497)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00241)|Lung(60;0.165)		Potassium Chloride(DB00761)	CCGCGTGCGCGTACGTACTCC	0.667																																																	0								ENSG00000113504	G		0,4402		0,0,2201	64.0	63.0	63.0		1149	-6.4	0.0	5		63	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	SLC12A7	NM_006598.2		0,1,6500	AA,AG,GG		0.0116,0.0,0.0077		383/1084	1081840	1,13001	2201	4300	6501	SLC12A7	SO:0001819	synonymous_variant	0			-	HGNC	AF105365	CCDS34129.1	5p15	2013-07-18	2013-07-18		ENSG00000113504	ENSG00000113504		"""Solute carriers"""	10915	protein-coding gene	gene with protein product		604879				10347194	Standard	NM_006598		Approved	KCC4, DKFZP434F076	uc003jbu.3	Q9Y666	OTTHUMG00000161931	ENST00000264930.5:c.1149C>T	5.37:g.1081840G>A		Somatic	0	82	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	68	17.07	A6NDS8|Q4G0F3|Q96I81|Q9H7I3|Q9H7I7|Q9UFW2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_AA-permease/SLC12A_dom,prints_KCL_cotranspt,tigrfam_Na/K/Cl_cotransptS	p.Y383	ENST00000264930.5	37	c.1149	CCDS34129.1	5																																																																																			-	tigrfam_Na/K/Cl_cotransptS		0.667	SLC12A7-001	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	SLC12A7	protein_coding	OTTHUMT00000366446.2	G	NM_006598	rs199523332		1081840	-1	no_errors	ENST00000264930	ensembl	human	known	74_37	silent	SNP	0.001	A
ZSCAN18	65982	genome.wustl.edu	37	19	58596421	58596421	+	Silent	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr19:58596421G>A	ENST00000240727.6	-	7	1563	c.1164C>T	c.(1162-1164)tcC>tcT	p.S388S	ZSCAN18_ENST00000600404.1_Silent_p.S444S|ZSCAN18_ENST00000601144.1_Silent_p.S388S|ZSCAN18_ENST00000421612.2_Silent_p.S252S	NM_023926.4	NP_076415.3	Q8TBC5	ZSC18_HUMAN	zinc finger and SCAN domain containing 18	388					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			NS(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|skin(3)	19		Colorectal(82;0.000256)|all_neural(62;0.0412)|Breast(46;0.114)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0152)		CGCTGTCGCCGGAGCTAGAGA	0.736																																																	0								ENSG00000121413						14.0	16.0	16.0					19																	58596421		2195	4296	6491	ZSCAN18	SO:0001819	synonymous_variant	0			-	HGNC	AY280799, AY279352	CCDS12971.1, CCDS46214.1, CCDS46215.1	19q13.43	2013-01-09	2007-02-20	2007-02-20		ENSG00000121413		"""-"", ""Zinc fingers, C2H2-type"""	21037	protein-coding gene	gene with protein product			"""zinc finger protein 447"""	ZNF447			Standard	NM_001145542		Approved	FLJ12895	uc010yht.1	Q8TBC5		ENST00000240727.6:c.1164C>T	19.37:g.58596421G>A		Somatic	0	25	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	23	25.81	B4DG23|E9PBI0|Q9BRK7|Q9H9A0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.S444	ENST00000240727.6	37	c.1332	CCDS12971.1	19																																																																																			-	NULL		0.736	ZSCAN18-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	ZSCAN18	protein_coding	OTTHUMT00000466706.1	G	NM_023926	-		58596421	-1	no_errors	ENST00000600404	ensembl	human	known	74_37	silent	SNP	0.000	A
OR8K5	219453	genome.wustl.edu	37	11	55927455	55927455	+	Silent	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr11:55927455G>A	ENST00000313447.1	-	1	338	c.339C>T	c.(337-339)ttC>ttT	p.F113F		NM_001004058.2	NP_001004058.2	Q8NH50	OR8K5_HUMAN	olfactory receptor, family 8, subfamily K, member 5	113						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(3)|lung(24)|ovary(2)|pancreas(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	34	Esophageal squamous(21;0.00693)	Lung NSC(402;0.197)|all_epithelial(135;0.236)				CTGACAGGATGAAAAATTCAC	0.428																																																	0								ENSG00000181752						85.0	85.0	85.0					11																	55927455		2201	4295	6496	OR8K5	SO:0001819	synonymous_variant	0			-	HGNC	BK004347	CCDS31521.1	11q11	2012-08-09			ENSG00000181752	ENSG00000181752		"""GPCR / Class A : Olfactory receptors"""	15315	protein-coding gene	gene with protein product							Standard	NM_001004058		Approved		uc010rja.2	Q8NH50	OTTHUMG00000166820	ENST00000313447.1:c.339C>T	11.37:g.55927455G>A		Somatic	0	32	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	31	18.42	Q6IFB5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.F113	ENST00000313447.1	37	c.339	CCDS31521.1	11																																																																																			-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.428	OR8K5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8K5	protein_coding	OTTHUMT00000391543.1	G	NM_001004058	-		55927455	-1	no_errors	ENST00000313447	ensembl	human	known	74_37	silent	SNP	0.015	A
MYH7B	57644	genome.wustl.edu	37	20	33572897	33572897	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr20:33572897C>T	ENST00000262873.7	+	11	988	c.896C>T	c.(895-897)cCc>cTc	p.P299L		NM_020884.3	NP_065935.2	A7E2Y1	MYH7B_HUMAN	myosin, heavy chain 7B, cardiac muscle, beta	257	Myosin motor.					membrane (GO:0016020)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(5)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(19)|ovary(5)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	54			BRCA - Breast invasive adenocarcinoma(18;0.00691)			CACTTTGGTCCCTCTGGGAAG	0.667																																																	0								ENSG00000078814						72.0	77.0	76.0					20																	33572897		2106	4219	6325	MYH7B	SO:0001583	missense	0			-	HGNC	AB040945	CCDS42869.1	20q11	2011-09-27	2006-09-29		ENSG00000078814	ENSG00000078814		"""Myosins / Myosin superfamily : Class II"""	15906	protein-coding gene	gene with protein product		609928	"""myosin, heavy polypeptide 7B, cardiac muscle, beta"""			11919279, 15014174	Standard	XM_006723839		Approved	KIAA1512, dJ756N5.1, MYH14, MHC14	uc002xbi.2	A7E2Y1	OTTHUMG00000032320	ENST00000262873.7:c.896C>T	20.37:g.33572897C>T	ENSP00000262873:p.Pro299Leu	Somatic	1	114	0.87		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	139	12.58	Q5JVW7|Q6NT44|Q6NT57|Q6WG75|Q96I57|Q9NWE2|Q9P216	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Myosin_S1_N,superfamily_Prefoldin,superfamily_tRNA-bd_arm,superfamily_t-SNARE,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.P299L	ENST00000262873.7	37	c.896	CCDS42869.1	20	.	.	.	.	.	.	.	.	.	.	C	19.90	3.912210	0.72983	.	.	ENSG00000078814	ENST00000262873	D	0.86164	-2.08	5.15	5.15	0.70609	Myosin head, motor domain (2);	0.000000	0.35555	N	0.003129	D	0.84456	0.5476	N	0.21282	0.65	0.58432	D	0.999999	P	0.43578	0.811	P	0.46419	0.516	D	0.85476	0.1176	10	0.48119	T	0.1	.	18.9917	0.92794	0.0:1.0:0.0:0.0	.	257	A7E2Y1	MYH7B_HUMAN	L	299	ENSP00000262873:P299L	ENSP00000262873:P299L	P	+	2	0	MYH7B	33036558	0.658000	0.27402	1.000000	0.80357	0.972000	0.66771	3.925000	0.56484	2.555000	0.86185	0.655000	0.94253	CCC	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom		0.667	MYH7B-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	MYH7B	protein_coding	OTTHUMT00000078833.2	C	NM_020884	-		33572897	+1	no_errors	ENST00000262873	ensembl	human	novel	74_37	missense	SNP	0.989	T
RP11-1166P10.1	0	genome.wustl.edu	37	16	31993285	31993285	+	RNA	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr16:31993285G>A	ENST00000568570.1	+	0	95																											gggagcccgggctggcggcgg	0.746																																																	0								ENSG00000260628																																			RP11-1166P10.1			0			-	Clone_based_vega_gene																													16.37:g.31993285G>A		Somatic	0	74	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	71	17.44		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000568570.1	37	NULL		16																																																																																			-	-		0.746	RP11-1166P10.1-002	KNOWN	basic	processed_transcript	ENSG00000260628	pseudogene	OTTHUMT00000432457.1	G		-		31993285	+1	no_errors	ENST00000568570	ensembl	human	known	74_37	rna	SNP	1.000	A
REXO1	57455	genome.wustl.edu	37	19	1828546	1828546	+	Missense_Mutation	SNP	G	G	A	rs147534740		TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr19:1828546G>A	ENST00000170168.4	-	2	336	c.242C>T	c.(241-243)cCg>cTg	p.P81L	REXO1_ENST00000587524.1_5'UTR	NM_020695.3	NP_065746.3	Q8N1G1	REXO1_HUMAN	REX1, RNA exonuclease 1 homolog (S. cerevisiae)	81						nucleus (GO:0005634)	exonuclease activity (GO:0004527)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	16		Ovarian(11;1.78e-06)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ATCCGGGCGCGGCTCCTCCCC	0.682																																																	0								ENSG00000079313	G	LEU/PRO	1,4403		0,1,2201	19.0	21.0	20.0		242	3.4	0.0	19	dbSNP_134	20	0,8584		0,0,4292	no	missense	REXO1	NM_020695.3	98	0,1,6493	AA,AG,GG		0.0,0.0227,0.0077	possibly-damaging	81/1222	1828546	1,12987	2202	4292	6494	REXO1	SO:0001583	missense	0			-	HGNC	AB032964	CCDS32866.1	19p13.3	2014-05-28	2005-08-22	2005-08-22	ENSG00000079313	ENSG00000079313			24616	protein-coding gene	gene with protein product	"""elongin A binding protein 1"""	609614	"""transcription elongation factor B polypeptide 3 binding protein 1"""	TCEB3BP1		10574461	Standard	NM_020695		Approved	EloA-BP1, KIAA1138	uc002lua.4	Q8N1G1	OTTHUMG00000179991	ENST00000170168.4:c.242C>T	19.37:g.1828546G>A	ENSP00000170168:p.Pro81Leu	Somatic	0	117	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	28	141	16.57	Q9ULT2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Exonuclease_RNaseT/DNA_pol3,superfamily_RNaseH-like_dom,smart_Exonuclease	p.P81L	ENST00000170168.4	37	c.242	CCDS32866.1	19	.	.	.	.	.	.	.	.	.	.	G	6.493	0.459075	0.12342	2.27E-4	0.0	ENSG00000079313	ENST00000170168;ENST00000413153	T	0.10960	2.82	3.4	3.4	0.38934	.	0.325837	0.27609	U	0.018605	T	0.09468	0.0233	L	0.53249	1.67	0.09310	N	1	P;P	0.51240	0.876;0.943	B;B	0.35470	0.091;0.203	T	0.30416	-0.9979	10	0.35671	T	0.21	-10.5892	12.0404	0.53450	0.0:0.1751:0.8248:0.0	.	35;81	F5H016;Q8N1G1	.;REXO1_HUMAN	L	81;35	ENSP00000170168:P81L	ENSP00000170168:P81L	P	-	2	0	REXO1	1779546	0.740000	0.28207	0.006000	0.13384	0.034000	0.12701	1.267000	0.33050	1.893000	0.54813	0.462000	0.41574	CCG	-	NULL		0.682	REXO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	REXO1	protein_coding	OTTHUMT00000449200.1	G	NM_020695	rs147534740		1828546	-1	no_errors	ENST00000170168	ensembl	human	known	74_37	missense	SNP	0.006	A
IFNL2	282616	genome.wustl.edu	37	19	39759385	39759385	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr19:39759385C>T	ENST00000331982.5	+	2	134	c.79C>T	c.(79-81)Cct>Tct	p.P27S		NM_172138.1	NP_742150.1	Q8IZJ0	IFNL2_HUMAN	interferon, lambda 2	27					defense response to virus (GO:0051607)|JAK-STAT cascade (GO:0007259)|mucosal immune response (GO:0002385)|positive regulation of immune response (GO:0050778)	extracellular space (GO:0005615)											TGGAGCAGTTCCTGTCGCCAG	0.622																																																	0								ENSG00000183709						51.0	54.0	53.0					19																	39759385		2200	4300	6500	IFNL2	SO:0001583	missense	0			-	HGNC	AY129148	CCDS42567.1	19q13.13	2014-05-22	2012-11-26	2012-11-26	ENSG00000183709	ENSG00000183709		"""Interferons"""	18364	protein-coding gene	gene with protein product		607401	"""interleukin 28A"", ""interleukin 28A (interferon, lambda 2)"""	IL28A			Standard	NM_172138		Approved	IL-28A	uc002oku.1	Q8IZJ0		ENST00000331982.5:c.79C>T	19.37:g.39759385C>T	ENSP00000333639:p.Pro27Ser	Somatic	0	43	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	57	18.57	Q45KQ8|Q6VN55|Q8IWL7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.P27S	ENST00000331982.5	37	c.79	CCDS42567.1	19	.	.	.	.	.	.	.	.	.	.	C	15.16	2.750484	0.49257	.	.	ENSG00000183709	ENST00000331982	T	0.16743	2.32	2.97	2.97	0.34412	.	0.244071	0.29106	N	0.013136	T	0.37785	0.1016	M	0.73598	2.24	0.09310	N	1	D	0.76494	0.999	D	0.87578	0.998	T	0.04255	-1.0965	10	0.72032	D	0.01	-1.611	9.5434	0.39266	0.0:1.0:0.0:0.0	.	27	Q8IZJ0	IL28A_HUMAN	S	27	ENSP00000333639:P27S	ENSP00000333639:P27S	P	+	1	0	IL28A	44451225	0.015000	0.18098	0.016000	0.15963	0.224000	0.24922	1.763000	0.38461	1.679000	0.50963	0.195000	0.17529	CCT	-	NULL		0.622	IFNL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFNL2	protein_coding	OTTHUMT00000463833.1	C	NM_172138	-		39759385	+1	no_errors	ENST00000331982	ensembl	human	known	74_37	missense	SNP	0.030	T
NOS2	4843	genome.wustl.edu	37	17	26107795	26107795	+	Silent	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr17:26107795G>A	ENST00000313735.6	-	9	1235	c.1002C>T	c.(1000-1002)ccC>ccT	p.P334P		NM_000625.4	NP_000616.3	P35228	NOS2_HUMAN	nitric oxide synthase 2, inducible	334					arginine catabolic process (GO:0006527)|blood coagulation (GO:0007596)|cellular response to interferon-gamma (GO:0071346)|cellular response to lipopolysaccharide (GO:0071222)|circadian rhythm (GO:0007623)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|inflammatory response (GO:0006954)|innate immune response in mucosa (GO:0002227)|interaction with host (GO:0051701)|negative regulation of blood pressure (GO:0045776)|negative regulation of gene expression (GO:0010629)|negative regulation of protein catabolic process (GO:0042177)|nitric oxide biosynthetic process (GO:0006809)|nitric oxide mediated signal transduction (GO:0007263)|peptidyl-cysteine S-nitrosylation (GO:0018119)|phagosome maturation (GO:0090382)|positive regulation of guanylate cyclase activity (GO:0031284)|positive regulation of killing of cells of other organism (GO:0051712)|positive regulation of leukocyte mediated cytotoxicity (GO:0001912)|positive regulation of vasodilation (GO:0045909)|regulation of cell proliferation (GO:0042127)|regulation of cellular respiration (GO:0043457)|regulation of insulin secretion (GO:0050796)|response to bacterium (GO:0009617)|response to hypoxia (GO:0001666)|superoxide metabolic process (GO:0006801)	cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|peroxisome (GO:0005777)	arginine binding (GO:0034618)|flavin adenine dinucleotide binding (GO:0050660)|FMN binding (GO:0010181)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|NADP binding (GO:0050661)|NADPH-hemoprotein reductase activity (GO:0003958)|nitric-oxide synthase activity (GO:0004517)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|tetrahydrobiopterin binding (GO:0034617)			autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(28)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	56					Dexamethasone(DB01234)|Doxorubicin(DB00997)|L-Arginine(DB00125)|L-Citrulline(DB00155)|Miconazole(DB01110)|Triflusal(DB08814)	CTACTTACTTGGGATGTTCCA	0.587																																																	0								ENSG00000007171						72.0	63.0	66.0					17																	26107795		2203	4300	6503	NOS2	SO:0001819	synonymous_variant	0			-	HGNC	U20141	CCDS11223.1	17q11.2	2014-06-12	2008-09-16	2008-09-16	ENSG00000007171	ENSG00000007171	1.14.13.39		7873	protein-coding gene	gene with protein product		163730	"""nitric oxide synthase 2A (inducible, hepatocytes)"""	NOS2A		7682706	Standard	NM_000625		Approved	iNOS, NOS, HEP-NOS	uc002gzu.3	P35228	OTTHUMG00000132445	ENST00000313735.6:c.1002C>T	17.37:g.26107795G>A		Somatic	0	49	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	53	24.29	A1L3U5|B7ZLY2|O60757|O94994|Q16263|Q16692|Q4TTS5|Q9UD42	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_NO_synthase_oxygenase_dom,pfam_FAD-binding_1,pfam_Flavodoxin/NO_synth,pfam_OxRdtase_FAD/NAD-bd,superfamily_NO_synthase_oxygenase_dom,superfamily_Riboflavin_synthase-like_b-brl,pirsf_NOS_euk,pfscan_Flavodoxin/NO_synth,prints_Flavoprot_Pyr_Nucl_cyt_Rdtase,prints_Flavdoxin	p.P334	ENST00000313735.6	37	c.1002	CCDS11223.1	17																																																																																			-	pfam_NO_synthase_oxygenase_dom,superfamily_NO_synthase_oxygenase_dom,pirsf_NOS_euk		0.587	NOS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOS2	protein_coding	OTTHUMT00000255597.1	G	NM_000625	-		26107795	-1	no_errors	ENST00000313735	ensembl	human	known	74_37	silent	SNP	1.000	A
CYP2C19	1557	genome.wustl.edu	37	10	96609693	96609693	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr10:96609693C>T	ENST00000371321.3	+	8	1251	c.1169C>T	c.(1168-1170)tCc>tTc	p.S390F	CYP2C19_ENST00000464755.1_3'UTR	NM_000769.1	NP_000760	P33261	CP2CJ_HUMAN	cytochrome P450, family 2, subfamily C, polypeptide 19	390					arachidonic acid metabolic process (GO:0019369)|drug metabolic process (GO:0017144)|epoxygenase P450 pathway (GO:0019373)|exogenous drug catabolic process (GO:0042738)|heterocycle metabolic process (GO:0046483)|monoterpenoid metabolic process (GO:0016098)|omega-hydroxylase P450 pathway (GO:0097267)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)	(R)-limonene 6-monooxygenase activity (GO:0052741)|(S)-limonene 6-monooxygenase activity (GO:0018675)|(S)-limonene 7-monooxygenase activity (GO:0018676)|enzyme binding (GO:0019899)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity (GO:0016491)|oxygen binding (GO:0019825)|steroid hydroxylase activity (GO:0008395)			central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(5)|lung(17)|ovary(4)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	43		Colorectal(252;0.09)		all cancers(201;6.02e-07)|KIRC - Kidney renal clear cell carcinoma(50;0.0672)|Kidney(138;0.0838)	Acenocoumarol(DB01418)|Acetylsalicylic acid(DB00945)|Adinazolam(DB00546)|Almotriptan(DB00918)|Aminoglutethimide(DB00357)|Aminophenazone(DB01424)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amoxicillin(DB01060)|Amprenavir(DB00701)|Antipyrine(DB01435)|Apixaban(DB06605)|Aprepitant(DB00673)|Arformoterol(DB01274)|Artemether(DB06697)|Atomoxetine(DB00289)|Atorvastatin(DB01076)|Axitinib(DB06626)|Azelastine(DB00972)|Benzatropine(DB00245)|Bicalutamide(DB01128)|Bifonazole(DB04794)|Bortezomib(DB00188)|Bromazepam(DB01558)|Brompheniramine(DB00835)|Bupivacaine(DB00297)|Buprenorphine(DB00921)|Carbamazepine(DB00564)|Carbinoxamine(DB00748)|Carisoprodol(DB00395)|Chloramphenicol(DB00446)|Chlorpropamide(DB00672)|Cholecalciferol(DB00169)|Cilostazol(DB01166)|Cimetidine(DB00501)|Cisapride(DB00604)|Citalopram(DB00215)|Clarithromycin(DB01211)|Clevidipine(DB04920)|Clobazam(DB00349)|Clomipramine(DB01242)|Clopidogrel(DB00758)|Clotiazepam(DB01559)|Clotrimazole(DB00257)|Clozapine(DB00363)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dapsone(DB00250)|Delavirdine(DB00705)|Desipramine(DB01151)|Desloratadine(DB00967)|Dexamethasone(DB01234)|Dexfenfluramine(DB01191)|Dextromethorphan(DB00514)|Diazepam(DB00829)|Diclofenac(DB00586)|Diltiazem(DB00343)|Dimethyl sulfoxide(DB01093)|Diphenhydramine(DB01075)|Dopamine(DB00988)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronabinol(DB00470)|Efavirenz(DB00625)|Eletriptan(DB00216)|Enfuvirtide(DB00109)|Enzalutamide(DB08899)|Escitalopram(DB01175)|Esomeprazole(DB00736)|Estradiol(DB00783)|Ethanol(DB00898)|Ethotoin(DB00754)|Etoricoxib(DB01628)|Etravirine(DB06414)|Famotidine(DB00927)|Felbamate(DB00949)|Fluconazole(DB00196)|Flunitrazepam(DB01544)|Fluoxetine(DB00472)|Flutamide(DB00499)|Fluvastatin(DB01095)|Fluvoxamine(DB00176)|Formoterol(DB00983)|Fosphenytoin(DB01320)|Gefitinib(DB00317)|Gemfibrozil(DB01241)|Gliclazide(DB01120)|Glucosamine(DB01296)|Glyburide(DB01016)|Guanfacine(DB01018)|Haloperidol(DB00502)|Hexobarbital(DB01355)|Ibuprofen(DB01050)|Ifosfamide(DB01181)|Imatinib(DB00619)|Imipramine(DB00458)|Indinavir(DB00224)|Indomethacin(DB00328)|Isoniazid(DB00951)|Ketobemidone(DB06738)|Ketoconazole(DB01026)|Lansoprazole(DB00448)|Lapatinib(DB01259)|Levomilnacipran(DB08918)|Lopinavir(DB01601)|Loratadine(DB00455)|Lorcaserin(DB04871)|Losartan(DB00678)|Lovastatin(DB00227)|LULICONAZOLE(DB08933)|Lumiracoxib(DB01283)|MACITENTAN(DB08932)|Melatonin(DB01065)|Memantine(DB01043)|Meprobamate(DB00371)|Methadone(DB00333)|Methazolamide(DB00703)|Methimazole(DB00763)|Methsuximide(DB05246)|Methylphenobarbital(DB00849)|Metoprolol(DB00264)|Miconazole(DB01110)|Moclobemide(DB01171)|Modafinil(DB00745)|Nelfinavir(DB00220)|Nicardipine(DB00622)|Nicotine(DB00184)|Nilutamide(DB00665)|Nilvadipine(DB06712)|Norethindrone(DB00717)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Omeprazole(DB00338)|Ospemifene(DB04938)|Oxcarbazepine(DB00776)|Oxiconazole(DB00239)|Pantoprazole(DB00213)|Pegvisomant(DB00082)|Pentamidine(DB00738)|Pentobarbital(DB00312)|Perphenazine(DB00850)|Pethidine(DB00454)|Phenelzine(DB00780)|Phenobarbital(DB01174)|Phensuximide(DB00832)|Phenytoin(DB00252)|Pimozide(DB01100)|Pioglitazone(DB01132)|Pipotiazine(DB01621)|Podofilox(DB01179)|Prasugrel(DB06209)|Praziquantel(DB01058)|Prednisone(DB00635)|Primidone(DB00794)|Probenecid(DB01032)|Progesterone(DB00396)|Proguanil(DB01131)|Promazine(DB00420)|Propofol(DB00818)|Propranolol(DB00571)|Quazepam(DB01589)|Quetiapine(DB01224)|Quinine(DB00468)|Rabeprazole(DB01129)|Ramelteon(DB00980)|Ranitidine(DB00863)|Regorafenib(DB08896)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Ritonavir(DB00503)|Rosiglitazone(DB00412)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|Selegiline(DB01037)|Sertraline(DB01104)|Sildenafil(DB00203)|Simvastatin(DB00641)|Sitaxentan(DB06268)|Sorafenib(DB00398)|Sulfanilamide(DB00259)|Tamoxifen(DB00675)|Tapentadol(DB06204)|Telmisartan(DB00966)|Temazepam(DB00231)|Teniposide(DB00444)|Terbinafine(DB00857)|Testosterone(DB00624)|Thalidomide(DB01041)|Thioridazine(DB00679)|Ticlopidine(DB00208)|Timolol(DB00373)|Tioconazole(DB01007)|Tipranavir(DB00932)|Tofacitinib(DB08895)|Tolbutamide(DB01124)|Tolterodine(DB01036)|Topiramate(DB00273)|Torasemide(DB00214)|Trabectedin(DB05109)|Tranylcypromine(DB00752)|Trimethadione(DB00347)|Trimipramine(DB00726)|Troleandomycin(DB01361)|Valproic Acid(DB00313)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vismodegib(DB08828)|Voriconazole(DB00582)|Warfarin(DB00682)|Zafirlukast(DB00549)|Zidovudine(DB00495)|Zolpidem(DB00425)|Zonisamide(DB00909)	ATATTAACTTCCCTCACTTCT	0.393																																																	0								ENSG00000165841						172.0	158.0	163.0					10																	96609693		2203	4300	6503	CYP2C19	SO:0001583	missense	0			-	HGNC	M61854	CCDS7436.1	10q24	2007-12-14	2003-01-14		ENSG00000165841	ENSG00000165841		"""Cytochrome P450s"""	2621	protein-coding gene	gene with protein product		124020	"""cytochrome P450, subfamily IIC (mephenytoin 4-hydroxylase), polypeptide 19"""	CYP2C		2009263, 8530044	Standard	NM_000769		Approved	P450IIC19, CPCJ	uc010qnz.2	P33261	OTTHUMG00000018799	ENST00000371321.3:c.1169C>T	10.37:g.96609693C>T	ENSP00000360372:p.Ser390Phe	Somatic	0	56	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	89	14.42	P33259|Q8WZB1|Q8WZB2|Q9UCD4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_B	p.S390F	ENST00000371321.3	37	c.1169	CCDS7436.1	10	.	.	.	.	.	.	.	.	.	.	C	2.687	-0.274058	0.05679	.	.	ENSG00000165841	ENST00000371321	T	0.13657	2.57	3.5	1.02	0.19986	.	0.431057	0.18979	U	0.125924	T	0.09598	0.0236	L	0.39397	1.21	0.09310	N	1	P	0.44877	0.845	B	0.40101	0.319	T	0.17930	-1.0353	10	0.48119	T	0.1	.	4.5192	0.11950	0.0:0.5021:0.0:0.4979	.	390	P33261	CP2CJ_HUMAN	F	390	ENSP00000360372:S390F	ENSP00000360372:S390F	S	+	2	0	CYP2C19	96599683	0.000000	0.05858	0.002000	0.10522	0.011000	0.07611	0.123000	0.15708	0.576000	0.29452	0.603000	0.83216	TCC	-	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_B		0.393	CYP2C19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP2C19	protein_coding	OTTHUMT00000049490.1	C	NM_000769	-		96609693	+1	no_errors	ENST00000371321	ensembl	human	known	74_37	missense	SNP	0.000	T
BRINP1	1620	genome.wustl.edu	37	9	122075558	122075558	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr9:122075558C>T	ENST00000265922.3	-	2	537	c.76G>A	c.(76-78)Gaa>Aaa	p.E26K	BRINP1_ENST00000373964.2_Missense_Mutation_p.E26K	NM_014618.2	NP_055433.2	O60477	BRNP1_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 1	26					cell cycle arrest (GO:0007050)|cell death (GO:0008219)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell cycle (GO:0045786)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	cytoplasm (GO:0005737)		p.E26K(1)									CCAGCTGGTTCCTGGTGGGAG	0.517																																																	1	Substitution - Missense(1)	skin(1)						ENSG00000078725						115.0	110.0	111.0					9																	122075558		2203	4300	6503	BRINP1	SO:0001583	missense	0			-	HGNC	AF027734	CCDS6822.1	9q32-q33	2013-08-06	2013-08-06	2013-07-31	ENSG00000078725	ENSG00000078725			2687	protein-coding gene	gene with protein product		602865	"""deleted in bladder cancer chromosome region candidate 1"", ""deleted in bladder cancer 1"""	DBCCR1, DBC1		9175739, 10444335, 15193422	Standard	NM_014618		Approved	FAM5A	uc004bkc.2	O60477	OTTHUMG00000021020	ENST00000265922.3:c.76G>A	9.37:g.122075558C>T	ENSP00000265922:p.Glu26Lys	Somatic	0	51	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	54	30.38	Q6IPV6|Q6P1A0|Q8WU22	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MACPF,smart_MACPF	p.E26K	ENST00000265922.3	37	c.76	CCDS6822.1	9	.	.	.	.	.	.	.	.	.	.	C	20.1	3.935373	0.73442	.	.	ENSG00000078725	ENST00000373969;ENST00000265922;ENST00000373964	T;T	0.44881	2.5;0.91	5.39	5.39	0.77823	.	0.096535	0.64402	D	0.000001	T	0.27205	0.0667	N	0.14661	0.345	0.58432	D	0.999995	B;B	0.31318	0.241;0.319	B;B	0.24155	0.051;0.037	T	0.06716	-1.0811	10	0.18710	T	0.47	-11.9944	19.1592	0.93524	0.0:1.0:0.0:0.0	.	26;26	O60477-2;O60477	.;DBC1_HUMAN	K	26	ENSP00000265922:E26K;ENSP00000363075:E26K	ENSP00000265922:E26K	E	-	1	0	DBC1	121115379	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.741000	0.68638	2.543000	0.85770	0.655000	0.94253	GAA	-	NULL		0.517	BRINP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRINP1	protein_coding	OTTHUMT00000055440.2	C	NM_014618	-		122075558	-1	no_errors	ENST00000265922	ensembl	human	known	74_37	missense	SNP	1.000	T
ZNF160	90338	genome.wustl.edu	37	19	53571974	53571974	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr19:53571974G>A	ENST00000429604.1	-	7	2228	c.1813C>T	c.(1813-1815)Cgt>Tgt	p.R605C	ZNF160_ENST00000599056.1_Missense_Mutation_p.R605C|ZNF160_ENST00000418871.1_Missense_Mutation_p.R605C|ZNF160_ENST00000601421.1_Missense_Mutation_p.R569C	NM_001102603.1|NM_198893.2	NP_001096073.1|NP_942596.1	Q9HCG1	ZN160_HUMAN	zinc finger protein 160	605					hemopoiesis (GO:0030097)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(8)|lung(10)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	35				GBM - Glioblastoma multiforme(134;0.02)		AGGCTTGAACGATCACTAAAG	0.408																																																	0								ENSG00000170949						86.0	85.0	86.0					19																	53571974		2203	4300	6503	ZNF160	SO:0001583	missense	0			-	HGNC	X78928	CCDS12859.1	19q13.42	2013-01-08				ENSG00000170949		"""Zinc fingers, C2H2-type"", ""-"""	12948	protein-coding gene	gene with protein product		600398				7774943, 7865130	Standard	NM_198893		Approved	HZF5, F11, KR18, HKr18, FLJ00032, KIAA1611	uc002qar.4	Q9HCG1		ENST00000429604.1:c.1813C>T	19.37:g.53571974G>A	ENSP00000406201:p.Arg605Cys	Somatic	0	53	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	55	15.38	Q14589|Q504Q8|Q96JC5|Q9BVY9|Q9H7N6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R605C	ENST00000429604.1	37	c.1813	CCDS12859.1	19	.	.	.	.	.	.	.	.	.	.	G	11.55	1.672137	0.29693	.	.	ENSG00000170949	ENST00000429604;ENST00000418871	T;T	0.36157	1.27;1.27	2.36	-4.71	0.03279	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.37183	0.0994	L	0.46157	1.445	0.09310	N	1	D	0.89917	1.0	P	0.57371	0.819	T	0.28522	-1.0041	9	0.40728	T	0.16	.	4.8442	0.13505	0.146:0.0:0.3679:0.4861	.	605	Q9HCG1	ZN160_HUMAN	C	605	ENSP00000406201:R605C;ENSP00000409597:R605C	ENSP00000409597:R605C	R	-	1	0	ZNF160	58263786	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-4.918000	0.00170	-0.739000	0.04809	0.655000	0.94253	CGT	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.408	ZNF160-202	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF160	protein_coding	OTTHUMT00000463994.2	G	NM_033288	-		53571974	-1	no_errors	ENST00000418871	ensembl	human	known	74_37	missense	SNP	0.000	A
ASH1L	55870	genome.wustl.edu	37	1	155450339	155450339	+	Silent	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr1:155450339G>A	ENST00000368346.3	-	3	2961	c.2322C>T	c.(2320-2322)ttC>ttT	p.F774F	ASH1L_ENST00000392403.3_Silent_p.F774F			Q9NR48	ASH1L_HUMAN	ash1 (absent, small, or homeotic)-like (Drosophila)	774					cell-cell signaling (GO:0007267)|DNA packaging (GO:0006323)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|tight junction (GO:0005923)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(13)|large_intestine(28)|lung(39)|ovary(2)|pancreas(1)|prostate(6)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(4)	124	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			GGCGTTTAAGGAAGTCATGAT	0.383																																																	0								ENSG00000116539						152.0	153.0	152.0					1																	155450339		2202	4296	6498	ASH1L	SO:0001819	synonymous_variant	0			-	HGNC	AB037841	CCDS1113.2	1q22	2013-01-28			ENSG00000116539	ENSG00000116539		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	19088	protein-coding gene	gene with protein product		607999				10860993, 16545939	Standard	NM_018489		Approved	huASH1, ASH1, ASH1L1, KMT2H	uc001fkt.3	Q9NR48	OTTHUMG00000014011	ENST00000368346.3:c.2322C>T	1.37:g.155450339G>A		Somatic	0	45	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	39	17.02	Q59GP1|Q5T714|Q5T715|Q9P2C7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_SET_dom,pfam_BAH_dom,pfam_Bromodomain,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_AT_hook_DNA-bd_motif,smart_AWS,smart_SET_dom,smart_Bromodomain,smart_Znf_PHD,smart_BAH_dom,pfscan_AWS,pfscan_BAH_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Bromodomain	p.F774	ENST00000368346.3	37	c.2322		1																																																																																			-	NULL		0.383	ASH1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	ASH1L	protein_coding	OTTHUMT00000039400.1	G	NM_018489	-		155450339	-1	no_errors	ENST00000368346	ensembl	human	known	74_37	silent	SNP	1.000	A
OR10W1	81341	genome.wustl.edu	37	11	58035306	58035306	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr11:58035306G>A	ENST00000395079.2	-	1	426	c.25C>T	c.(25-27)Ccc>Tcc	p.P9S		NM_207374.3	NP_997257.2	Q8NGF6	O10W1_HUMAN	olfactory receptor, family 10, subfamily W, member 1	9						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.P9S(1)		kidney(2)|large_intestine(2)|lung(19)|ovary(2)|skin(1)	26		Breast(21;0.0589)				GGGCAGGAGGGATAGGCCAGG	0.453																																																	1	Substitution - Missense(1)	lung(1)						ENSG00000172772						64.0	57.0	59.0					11																	58035306		2201	4295	6496	OR10W1	SO:0001583	missense	0			-	HGNC	AB065850	CCDS7968.1	11q12.1	2012-08-09	2004-03-04	2004-03-05		ENSG00000172772		"""GPCR / Class A : Olfactory receptors"""	15139	protein-coding gene	gene with protein product			"""olfactory receptor, family 10, subfamily W, member 1 pseudogene"""	OR10W1P			Standard	NM_207374		Approved		uc001nmq.1	Q8NGF6		ENST00000395079.2:c.25C>T	11.37:g.58035306G>A	ENSP00000378516:p.Pro9Ser	Somatic	0	39	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	47	16.07	A2RUD2|A8MTE1|Q6UXQ2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.P9S	ENST00000395079.2	37	c.25	CCDS7968.1	11	.	.	.	.	.	.	.	.	.	.	G	2.353	-0.348457	0.05208	.	.	ENSG00000172772	ENST00000395079	T	0.00495	6.99	4.82	3.86	0.44501	.	0.000000	0.48767	D	0.000173	T	0.00271	0.0008	N	0.00630	-1.315	0.31888	N	0.617536	D	0.60160	0.987	P	0.56612	0.802	T	0.64824	-0.6316	10	0.02654	T	1	.	11.7879	0.52053	0.0:0.0:0.8252:0.1748	.	9	Q8NGF6	O10W1_HUMAN	S	9	ENSP00000378516:P9S	ENSP00000378516:P9S	P	-	1	0	OR10W1	57791882	0.000000	0.05858	0.995000	0.50966	0.008000	0.06430	-0.686000	0.05161	2.507000	0.84556	0.591000	0.81541	CCC	-	NULL		0.453	OR10W1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10W1	protein_coding	OTTHUMT00000394704.1	G	NM_207374	-		58035306	-1	no_errors	ENST00000395079	ensembl	human	known	74_37	missense	SNP	0.983	A
OR4D9	390199	genome.wustl.edu	37	11	59283138	59283138	+	Silent	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr11:59283138C>T	ENST00000329328.3	+	1	753	c.753C>T	c.(751-753)ttC>ttT	p.F251F		NM_001004711.1	NP_001004711.1	Q8NGE8	OR4D9_HUMAN	olfactory receptor, family 4, subfamily D, member 9	251						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(2)|large_intestine(3)|lung(14)|prostate(5)|upper_aerodigestive_tract(1)	26						CCCTGCATTTCGTGCCCTGCA	0.562																																																	0								ENSG00000172742						254.0	223.0	234.0					11																	59283138		2201	4295	6496	OR4D9	SO:0001819	synonymous_variant	0			-	HGNC	AB065861	CCDS31564.1	11q12.1	2012-08-09	2003-12-15		ENSG00000172742	ENSG00000172742		"""GPCR / Class A : Olfactory receptors"""	15178	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily D, member 9 pseudogene"""				Standard	NM_001004711		Approved		uc010rkv.2	Q8NGE8	OTTHUMG00000167343	ENST00000329328.3:c.753C>T	11.37:g.59283138C>T		Somatic	0	70	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	109	18.66	Q6IFF3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.F251	ENST00000329328.3	37	c.753	CCDS31564.1	11																																																																																			-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.562	OR4D9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4D9	protein_coding	OTTHUMT00000394237.1	C	NM_001004711	-		59283138	+1	no_errors	ENST00000329328	ensembl	human	known	74_37	silent	SNP	0.087	T
OTOF	9381	genome.wustl.edu	37	2	26687736	26687736	+	Splice_Site	SNP	C	C	T	rs80356602		TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr2:26687736C>T	ENST00000272371.2	-	39	5087		c.e39+1		OTOF_ENST00000402415.3_Splice_Site|OTOF_ENST00000403946.3_Splice_Site|OTOF_ENST00000338581.6_Splice_Site|OTOF_ENST00000339598.3_Splice_Site	NM_194248.2	NP_919224.1	Q9HC10	OTOF_HUMAN	otoferlin						membrane fusion (GO:0061025)|sensory perception of sound (GO:0007605)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(9)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(35)|ovary(8)|pancreas(1)|prostate(5)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	106	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGCCCCATTACCGTTCTCGTC	0.647																																					GBM(102;732 1451 20652 24062 31372)												0								ENSG00000115155						47.0	53.0	51.0					2																	26687736		2203	4300	6503	OTOF	SO:0001630	splice_region_variant	0			-	HGNC	AF107403	CCDS1724.1, CCDS1725.1, CCDS1726.1, CCDS46241.1, CCDS74497.1	2p23.1	2014-06-27			ENSG00000115155	ENSG00000115155			8515	protein-coding gene	gene with protein product	"""fer-1-like family member 2"""	603681		DFNB9		10192385, 18381613	Standard	NM_194248		Approved	FER1L2, DFNB6	uc002rhk.3	Q9HC10	OTTHUMG00000096977	ENST00000272371.2:c.4960+1G>A	2.37:g.26687736C>T		Somatic	0	90	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	125	17.76	B4DJX0|B5MCC1|B9A0H6|Q53R90|Q9HC08|Q9HC09|Q9Y650	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e39+1	ENST00000272371.2	37	c.4960+1	CCDS1725.1	2	.	.	.	.	.	.	.	.	.	.	C	15.05	2.717636	0.48622	.	.	ENSG00000115155	ENST00000338581;ENST00000339598;ENST00000402415;ENST00000272371;ENST00000403946	.	.	.	4.91	4.91	0.64330	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.7125	0.88326	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	OTOF	26541240	1.000000	0.71417	0.997000	0.53966	0.267000	0.26476	7.818000	0.86416	2.260000	0.74910	0.561000	0.74099	.	-	-		0.647	OTOF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OTOF	protein_coding	OTTHUMT00000214047.3	C		-	Intron	26687736	-1	no_errors	ENST00000272371	ensembl	human	known	74_37	splice_site	SNP	1.000	T
TCF12	6938	genome.wustl.edu	37	15	57574769	57574769	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr15:57574769C>T	ENST00000267811.5	+	19	2337	c.2033C>T	c.(2032-2034)cCt>cTt	p.P678L	TCF12_ENST00000559703.1_Missense_Mutation_p.P335L|TCF12_ENST00000543579.1_Missense_Mutation_p.P532L|TCF12_ENST00000333725.5_Missense_Mutation_p.P702L|TCF12_ENST00000452095.2_Missense_Mutation_p.P698L|TCF12_ENST00000438423.2_Missense_Mutation_p.P702L|TCF12_ENST00000343827.3_Missense_Mutation_p.P508L|TCF12_ENST00000537840.1_Missense_Mutation_p.P442L|TCF12_ENST00000557843.1_Missense_Mutation_p.P678L|TCF12_ENST00000559710.1_Missense_Mutation_p.P312L	NM_003205.3|NM_207038.1	NP_003196.1|NP_996921.1	Q99081	HTF4_HUMAN	transcription factor 12	678					immune response (GO:0006955)|muscle organ development (GO:0007517)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	bHLH transcription factor binding (GO:0043425)|E-box binding (GO:0070888)|enhancer binding (GO:0035326)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SMAD binding (GO:0046332)|transcription factor binding (GO:0008134)		TCF12/NR4A3(2)	breast(2)|central_nervous_system(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(1)|lung(13)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	36		Colorectal(260;0.0907)		all cancers(107;0.000313)|GBM - Glioblastoma multiforme(80;0.00878)|STAD - Stomach adenocarcinoma(283;0.239)		ACTACCAACCCTATGGGTCAT	0.443			T	TEC	extraskeletal myxoid chondrosarcoma																																			Dom	yes		15	15q21	6938	"""transcription factor 12 (HTF4, helix-loop-helix transcription factors 4)"""		M	0								ENSG00000140262						131.0	131.0	131.0					15																	57574769		2192	4292	6484	TCF12	SO:0001583	missense	0			-	HGNC	BC050556	CCDS10159.1, CCDS10160.1, CCDS42042.1	15q21	2013-05-21	2008-07-31		ENSG00000140262	ENSG00000140262		"""Basic helix-loop-helix proteins"""	11623	protein-coding gene	gene with protein product	"""helix-loop-helix transcription factor 4"""	600480				1886779	Standard	NM_003205		Approved	HEB, HTF4, HsT17266, bHLHb20	uc002aeb.3	Q99081	OTTHUMG00000132047	ENST00000267811.5:c.2033C>T	15.37:g.57574769C>T	ENSP00000267811:p.Pro678Leu	Somatic	0	47	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	57	16.18	Q7Z3D9|Q86TC1|Q86VM2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.P702L	ENST00000267811.5	37	c.2105	CCDS10159.1	15	.	.	.	.	.	.	.	.	.	.	C	22.3	4.277830	0.80692	.	.	ENSG00000140262	ENST00000267811;ENST00000438423;ENST00000452095;ENST00000333725;ENST00000543579;ENST00000537840;ENST00000343827;ENST00000543417	T;T;T;T;T;T;T	0.28895	2.17;2.17;2.17;2.17;1.94;1.59;1.95	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	T	0.55386	0.1917	L	0.59436	1.845	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;0.999;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D	0.91635	0.996;0.998;0.998;0.991;0.999;0.998;0.996;0.998	T	0.54302	-0.8314	10	0.72032	D	0.01	-7.566	19.8788	0.96888	0.0:1.0:0.0:0.0	.	312;532;442;698;532;508;678;702	B4DZP2;B4DH96;B4E1W1;E9PGY0;F5GY10;Q99081-2;Q99081;Q99081-3	.;.;.;.;.;.;HTF4_HUMAN;.	L	678;702;698;702;532;442;508;290	ENSP00000267811:P678L;ENSP00000388940:P702L;ENSP00000396881:P698L;ENSP00000331057:P702L;ENSP00000440017:P532L;ENSP00000444696:P442L;ENSP00000342459:P508L	ENSP00000267811:P678L	P	+	2	0	TCF12	55362061	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.747000	0.85070	2.708000	0.92522	0.650000	0.86243	CCT	-	NULL		0.443	TCF12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	TCF12	protein_coding	OTTHUMT00000255069.3	C	NM_003205	-		57574769	+1	no_errors	ENST00000438423	ensembl	human	known	74_37	missense	SNP	1.000	T
KCNMB4	27345	genome.wustl.edu	37	12	70824430	70824430	+	Silent	SNP	T	T	C			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr12:70824430T>C	ENST00000258111.4	+	3	1089	c.630T>C	c.(628-630)tcT>tcC	p.S210S		NM_014505.5	NP_055320.4	Q86W47	KCMB4_HUMAN	potassium large conductance calcium-activated channel, subfamily M, beta member 4	210					action potential (GO:0001508)|blood coagulation (GO:0007596)|detection of calcium ion (GO:0005513)|neuronal action potential (GO:0019228)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of neurotransmitter secretion (GO:0046928)|regulation of vasoconstriction (GO:0019229)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)			kidney(1)|large_intestine(4)|lung(5)	10	Renal(347;0.236)		Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00243)|STAD - Stomach adenocarcinoma(21;0.0118)		Miconazole(DB01110)|Procaine(DB00721)	GCAAGTTCTCTTAAAGGGGAA	0.547																																																	0								ENSG00000135643						63.0	56.0	58.0					12																	70824430		2203	4300	6503	KCNMB4	SO:0001819	synonymous_variant	0			-	HGNC	AF207992	CCDS8997.1	12q15	2006-06-10			ENSG00000135643	ENSG00000135643		"""Potassium channels"""	6289	protein-coding gene	gene with protein product		605223				10692449, 10828459	Standard	NM_014505		Approved		uc001svx.3	Q86W47	OTTHUMG00000167586	ENST00000258111.4:c.630T>C	12.37:g.70824430T>C		Somatic	0	36	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	23	17.86	Q8IVR3|Q9NPA4|Q9P0G5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_K_chnl_Ca-activ_BK_bsu	p.S210	ENST00000258111.4	37	c.630	CCDS8997.1	12																																																																																			-	NULL		0.547	KCNMB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNMB4	protein_coding	OTTHUMT00000395208.1	T	NM_014505	-		70824430	+1	no_errors	ENST00000258111	ensembl	human	known	74_37	silent	SNP	0.997	C
PRKCQ	5588	genome.wustl.edu	37	10	6540470	6540470	+	Nonsense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr10:6540470G>A	ENST00000263125.5	-	5	529	c.430C>T	c.(430-432)Cag>Tag	p.Q144*	PRKCQ_ENST00000539722.1_Nonsense_Mutation_p.Q19*|PRKCQ_ENST00000397176.2_Nonsense_Mutation_p.Q144*	NM_001282644.1|NM_006257.3	NP_001269573.1|NP_006248.1	Q04759	KPCT_HUMAN	protein kinase C, theta	144					apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|Fc-epsilon receptor signaling pathway (GO:0038095)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|membrane protein ectodomain proteolysis (GO:0006509)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of T cell apoptotic process (GO:0070233)|phototransduction, visible light (GO:0007603)|platelet activation (GO:0030168)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of T-helper 17 type immune response (GO:2000318)|positive regulation of T-helper 2 cell activation (GO:2000570)|protein ubiquitination (GO:0016567)|regulation of cell growth (GO:0001558)|regulation of platelet aggregation (GO:0090330)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|regulation of transcription, DNA-templated (GO:0006355)|rhodopsin mediated signaling pathway (GO:0016056)|T cell receptor signaling pathway (GO:0050852)	cytosol (GO:0005829)|immunological synapse (GO:0001772)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|liver(1)|lung(13)|ovary(4)|prostate(1)|skin(4)|stomach(2)	45					Tamoxifen(DB00675)	CCCCGGCGCTGATGCAAAGCA	0.517																																					Ovarian(50;572 1126 10530 25349 30594)												0								ENSG00000065675						208.0	170.0	183.0					10																	6540470		2203	4300	6503	PRKCQ	SO:0001587	stop_gained	0			-	HGNC	L07032	CCDS7079.1, CCDS55701.1, CCDS60482.1	10p15	2009-07-10			ENSG00000065675	ENSG00000065675	2.7.11.1		9410	protein-coding gene	gene with protein product		600448				8444877	Standard	NM_001282645		Approved		uc001ijj.2	Q04759	OTTHUMG00000017623	ENST00000263125.5:c.430C>T	10.37:g.6540470G>A	ENSP00000263125:p.Gln144*	Somatic	0	52	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	61	19.74	B4DF52|Q14DH6|Q3MJF1|Q64FY5|Q9H508|Q9H549	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_C2_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pirsf_Prot_kin_PKC_delta,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_dom,prints_DAG/PE-bd,prints_Ser-Thr/Tyr_kinase_cat_dom	p.Q144*	ENST00000263125.5	37	c.430	CCDS7079.1	10	.	.	.	.	.	.	.	.	.	.	G	23.5	4.426689	0.83667	.	.	ENSG00000065675	ENST00000263125;ENST00000397176;ENST00000539722	.	.	.	5.62	5.62	0.85841	.	0.356526	0.33180	N	0.005188	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.14252	T	0.57	.	19.6767	0.95936	0.0:0.0:1.0:0.0	.	.	.	.	X	144;144;19	.	ENSP00000263125:Q144X	Q	-	1	0	PRKCQ	6580476	1.000000	0.71417	0.972000	0.41901	0.170000	0.22686	7.731000	0.84895	2.634000	0.89283	0.655000	0.94253	CAG	-	pirsf_Prot_kin_PKC_delta		0.517	PRKCQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKCQ	protein_coding	OTTHUMT00000046665.1	G	NM_006257	-		6540470	-1	no_errors	ENST00000263125	ensembl	human	known	74_37	nonsense	SNP	1.000	A
ZNF628	89887	genome.wustl.edu	37	19	55994117	55994117	+	Silent	SNP	C	C	T	rs551631262		TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr19:55994117C>T	ENST00000598519.1	+	3	2110	c.1557C>T	c.(1555-1557)ttC>ttT	p.F519F	NAT14_ENST00000587400.1_5'Flank|NAT14_ENST00000591590.1_5'Flank|NAT14_ENST00000205194.4_5'Flank|ZNF628_ENST00000391718.2_Silent_p.F515F			Q5EBL2	ZN628_HUMAN	zinc finger protein 628	519					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|kidney(1)|lung(2)	7	Breast(117;0.155)		BRCA - Breast invasive adenocarcinoma(297;0.18)|LUSC - Lung squamous cell carcinoma(43;0.193)	GBM - Glioblastoma multiforme(193;0.0531)		GCCTCACCTTCAAGTGGTCGT	0.682													N|||	1	0.000199681	0.0008	0.0	5008	,	,		10604	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000197483						38.0	39.0	39.0					19																	55994117		2203	4297	6500	ZNF628	SO:0001819	synonymous_variant	0			-	HGNC	AF367249	CCDS33116.3	19q13.43	2013-01-08			ENSG00000197483	ENSG00000197483		"""Zinc fingers, C2H2-type"""	28054	protein-coding gene	gene with protein product	"""Zinc finger expressed in Embryonal cells and Certain adult organs"""	610671					Standard	NM_033113		Approved	ZEC, Zfp628	uc002qld.3	Q5EBL2	OTTHUMG00000150396	ENST00000598519.1:c.1557C>T	19.37:g.55994117C>T		Somatic	0	75	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	83	11.70	Q86X34	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.F519	ENST00000598519.1	37	c.1557	CCDS33116.3	19																																																																																			-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.682	ZNF628-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF628	protein_coding	OTTHUMT00000317934.2	C	XM_058964	-		55994117	+1	no_errors	ENST00000598519	ensembl	human	known	74_37	silent	SNP	1.000	T
ITGAX	3687	genome.wustl.edu	37	16	31371384	31371384	+	Silent	SNP	C	C	T	rs372032821		TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr16:31371384C>T	ENST00000268296.4	+	7	826	c.705C>T	c.(703-705)gtC>gtT	p.V235V	ITGAX_ENST00000562522.1_Silent_p.V235V	NM_000887.3	NP_000878.2	P20702	ITAX_HUMAN	integrin, alpha X (complement component 3 receptor 4 subunit)	235	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|organ morphogenesis (GO:0009887)	cell surface (GO:0009986)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(42)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	77						TCCAAAATGTCGTGTGAGTCC	0.552																																																	0								ENSG00000140678						80.0	79.0	80.0					16																	31371384		2197	4300	6497	ITGAX	SO:0001819	synonymous_variant	0			-	HGNC	BC038237	CCDS10711.1, CCDS67014.1	16p11.2	2010-03-23	2006-02-10		ENSG00000140678	ENSG00000140678		"""CD molecules"", ""Complement system"", ""Integrins"""	6152	protein-coding gene	gene with protein product		151510	"""integrin, alpha X (antigen CD11C (p150), alpha polypeptide)"""	CD11C		3284962, 2303426	Standard	NM_001286375		Approved	CD11c	uc002ebu.1	P20702	OTTHUMG00000132465	ENST00000268296.4:c.705C>T	16.37:g.31371384C>T		Somatic	0	28	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	39	13.33	Q8IVA6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Integrin_alpha-2,pfam_VWF_A,pfam_FG-GAP,pfam_Integrin_alpha_C_CS,smart_Int_alpha_beta-p,smart_VWF_A,pfscan_VWF_A,prints_Integrin_alpha	p.V235	ENST00000268296.4	37	c.705	CCDS10711.1	16																																																																																			-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A		0.552	ITGAX-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ITGAX	protein_coding	OTTHUMT00000255628.2	C	NM_000887	-		31371384	+1	no_errors	ENST00000268296	ensembl	human	known	74_37	silent	SNP	0.723	T
PADI2	11240	genome.wustl.edu	37	1	17422425	17422425	+	Silent	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr1:17422425C>T	ENST00000375486.4	-	4	453	c.390G>A	c.(388-390)gtG>gtA	p.V130V	PADI2_ENST00000444885.2_Silent_p.V130V|PADI2_ENST00000375481.1_Silent_p.V130V	NM_007365.2	NP_031391.2	Q9Y2J8	PADI2_HUMAN	peptidyl arginine deiminase, type II	130					chromatin-mediated maintenance of transcription (GO:0048096)|histone H3-R26 citrullination (GO:0036413)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of lymphocyte chemotaxis (GO:1901624)|protein citrullination (GO:0018101)|regulation of chromatin disassembly (GO:0010848)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|transcriptionally active chromatin (GO:0035327)	calcium ion binding (GO:0005509)|estrogen receptor binding (GO:0030331)|protein-arginine deiminase activity (GO:0004668)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(12)|ovary(4)|pancreas(1)|skin(5)|urinary_tract(3)	29		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000422)|Renal(390;0.000518)|all_lung(284;0.000546)|Ovarian(437;0.00671)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00583)|BRCA - Breast invasive adenocarcinoma(304;1.49e-05)|COAD - Colon adenocarcinoma(227;1.54e-05)|Kidney(64;0.000258)|KIRC - Kidney renal clear cell carcinoma(64;0.00348)|STAD - Stomach adenocarcinoma(196;0.0072)|READ - Rectum adenocarcinoma(331;0.0698)|Lung(427;0.201)	L-Citrulline(DB00155)	TGTTCTTCTCCACCACACCAT	0.617																																																	0								ENSG00000117115						211.0	182.0	192.0					1																	17422425		2203	4300	6503	PADI2	SO:0001819	synonymous_variant	0			-	HGNC	AB030176	CCDS177.1	1p35.2-p35.1	2008-02-05			ENSG00000117115	ENSG00000117115	3.5.3.15	"""Peptidyl arginine deiminases"""	18341	protein-coding gene	gene with protein product		607935				2768262	Standard	NM_007365		Approved	KIAA0994, PDI2	uc001baf.3	Q9Y2J8	OTTHUMG00000002295	ENST00000375486.4:c.390G>A	1.37:g.17422425C>T		Somatic	0	64	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	49	20.97	Q96DA7|Q9UPN2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_PAD_C,pfam_Prot_Arg_deaminase_cen_dom,pfam_PAD_N,superfamily_Prot_Arg_deaminase_cen_dom,superfamily_Cupredoxin,pirsf_Protein-arginine_deiminase_sub	p.V130	ENST00000375486.4	37	c.390	CCDS177.1	1																																																																																			-	pfam_Prot_Arg_deaminase_cen_dom,superfamily_Prot_Arg_deaminase_cen_dom,pirsf_Protein-arginine_deiminase_sub		0.617	PADI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PADI2	protein_coding	OTTHUMT00000006624.1	C		-		17422425	-1	no_errors	ENST00000375486	ensembl	human	known	74_37	silent	SNP	1.000	T
CLCA1	1179	genome.wustl.edu	37	1	86959980	86959980	+	Silent	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr1:86959980G>A	ENST00000234701.3	+	12	2142	c.1791G>A	c.(1789-1791)acG>acA	p.T597T	CLCA1_ENST00000394711.1_Silent_p.T597T			A8K7I4	CLCA1_HUMAN	chloride channel accessory 1	597					calcium ion transport (GO:0006816)|cellular response to hypoxia (GO:0071456)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|transport (GO:0006810)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|microvillus (GO:0005902)|zymogen granule membrane (GO:0042589)	chloride channel activity (GO:0005254)			NS(1)|breast(3)|endometrium(1)|kidney(3)|large_intestine(9)|lung(14)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	38		Lung NSC(277;0.239)		all cancers(265;0.0249)|Epithelial(280;0.0476)		CTTCCAAAACGAACAAGGACA	0.517																																																	0								ENSG00000016490						101.0	88.0	92.0					1																	86959980		2203	4300	6503	CLCA1	SO:0001819	synonymous_variant	0			-	HGNC		CCDS709.1	1p22.3	2012-02-26	2009-01-29		ENSG00000016490	ENSG00000016490			2015	protein-coding gene	gene with protein product		603906	"""chloride channel, calcium activated, family member 1"", ""chloride channel regulator 1"""			9828122	Standard	NM_001285		Approved	CaCC, CLCRG1	uc001dlt.3	A8K7I4	OTTHUMG00000010254	ENST00000234701.3:c.1791G>A	1.37:g.86959980G>A		Somatic	0	66	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	61	17.57	B2RAV5|O95151|Q5TDF4|Q9UNF6|Q9UPC6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Cl_channel_Ca,pfam_DUF1973,pfam_VWF_A,superfamily_Fibronectin_type3,smart_VWF_A,pfscan_VWF_A,tigrfam_CaCC_prot	p.T597	ENST00000234701.3	37	c.1791	CCDS709.1	1																																																																																			-	pfam_DUF1973,tigrfam_CaCC_prot		0.517	CLCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLCA1	protein_coding	OTTHUMT00000028277.1	G	NM_001285	-		86959980	+1	no_errors	ENST00000234701	ensembl	human	known	74_37	silent	SNP	0.994	A
AK9	221264	genome.wustl.edu	37	6	109907239	109907239	+	Missense_Mutation	SNP	G	G	A	rs374212368		TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr6:109907239G>A	ENST00000424296.2	-	18	1955	c.1879C>T	c.(1879-1881)Cca>Tca	p.P627S	AK9_ENST00000368948.2_Missense_Mutation_p.P627S|AK9_ENST00000341338.6_5'UTR	NM_001145128.2	NP_001138600.2	Q5TCS8	KAD9_HUMAN	adenylate kinase 9	627					ADP phosphorylation (GO:0006757)|AMP phosphorylation (GO:0006756)|CDP phosphorylation (GO:0061508)|CMP phosphorylation (GO:0061566)|dADP phosphorylation (GO:0006174)|dAMP phosphorylation (GO:0061565)|dCDP phosphorylation (GO:0061570)|dCMP phosphorylation (GO:0061567)|dGDP phosphorylation (GO:0006186)|GDP phosphorylation (GO:0061568)|TDP phosphorylation (GO:0061571)|UDP phosphorylation (GO:0061569)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|nucleoside diphosphate kinase activity (GO:0004550)|nucleoside phosphate kinase activity (GO:0050145)										CCATATTTTGGGGCACCAGGA	0.378																																																	0								ENSG00000155085						108.0	87.0	93.0					6																	109907239		692	1591	2283	AK9	SO:0001583	missense	0			-	HGNC	AK131244, BC146443, BC087860	CCDS5077.1, CCDS55048.1	6q21	2013-04-29	2013-04-29	2013-04-29			2.7.4.3		33814	protein-coding gene	gene with protein product		615358	"""chromosome 6 open reading frame 224"", ""adenylate kinase domain containing 2"", ""chromosome 6 open reading frame 199"", ""adenylate kinase domain containing 1"""	C6orf224, AKD2, C6orf199, AKD1		23416111	Standard	NM_145025		Approved	FLJ42177, FLJ25791, dJ70A9.1, MGC26954		Q5TCS8		ENST00000424296.2:c.1879C>T	6.37:g.109907239G>A	ENSP00000410186:p.Pro627Ser	Somatic	0	54	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	54	14.29	A6NL75|B2RDJ0|B6ZDM7|Q3MIS4|Q5I0W8|Q6ZNF1|Q6ZVR7|Q8N7C6|Q8WW00|Q96NF4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Adenylate_kin,pfam_YHS_dom,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.P627S	ENST00000424296.2	37	c.1879	CCDS55048.1	6	.	.	.	.	.	.	.	.	.	.	G	11.86	1.764909	0.31228	.	.	ENSG00000155085	ENST00000424296;ENST00000368948	T;T	0.66280	-0.2;1.63	5.43	4.55	0.56014	.	0.000000	0.52532	D	0.000080	T	0.33990	0.0882	L	0.36672	1.1	0.80722	D	1	B	0.30193	0.272	B	0.28553	0.091	T	0.19484	-1.0304	9	.	.	.	-8.9231	13.3295	0.60479	0.0:0.0:0.8406:0.1594	.	627	Q5TCS8	AKD1_HUMAN	S	627	ENSP00000410186:P627S;ENSP00000357944:P627S	.	P	-	1	0	AKD1	110013932	1.000000	0.71417	0.933000	0.37362	0.507000	0.33981	2.319000	0.43788	1.291000	0.44653	-0.194000	0.12790	CCA	-	superfamily_P-loop_NTPase		0.378	AK9-202	KNOWN	basic|appris_principal|CCDS	protein_coding	AK9	protein_coding		G	NM_001145128	-		109907239	-1	no_errors	ENST00000424296	ensembl	human	known	74_37	missense	SNP	0.970	A
SHANK1	50944	genome.wustl.edu	37	19	51170823	51170823	+	Missense_Mutation	SNP	T	T	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr19:51170823T>A	ENST00000293441.1	-	22	4412	c.4394A>T	c.(4393-4395)gAg>gTg	p.E1465V	SHANK1_ENST00000359082.3_Missense_Mutation_p.E1456V|SHANK1_ENST00000391814.1_Missense_Mutation_p.E1473V|SYT3_ENST00000544769.1_Intron|SHANK1_ENST00000391813.1_Missense_Mutation_p.E852V	NM_016148.2	NP_057232.2	Q9Y566	SHAN1_HUMAN	SH3 and multiple ankyrin repeat domains 1	1465					adult behavior (GO:0030534)|associative learning (GO:0008306)|cytoskeletal anchoring at plasma membrane (GO:0007016)|dendritic spine morphogenesis (GO:0060997)|determination of affect (GO:0050894)|habituation (GO:0046959)|long-term memory (GO:0007616)|negative regulation of actin filament bundle assembly (GO:0032232)|neuromuscular process controlling balance (GO:0050885)|olfactory behavior (GO:0042048)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|protein complex assembly (GO:0006461)|protein localization to synapse (GO:0035418)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|righting reflex (GO:0060013)|social behavior (GO:0035176)|synapse maturation (GO:0060074)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|excitatory synapse (GO:0060076)|intracellular (GO:0005622)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ankyrin repeat binding (GO:0071532)|GKAP/Homer scaffold activity (GO:0030160)|identical protein binding (GO:0042802)|ionotropic glutamate receptor binding (GO:0035255)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|scaffold protein binding (GO:0097110)|SH3 domain binding (GO:0017124)|somatostatin receptor binding (GO:0031877)			breast(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(15)|liver(1)|lung(21)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	64		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00493)|GBM - Glioblastoma multiforme(134;0.0199)		GGCCGGGGGCTCCGTCCCCAG	0.751																																																	0								ENSG00000161681						3.0	5.0	4.0					19																	51170823		1184	2684	3868	SHANK1	SO:0001583	missense	0			-	HGNC	AF163302	CCDS12799.1	19q13.3	2013-01-10			ENSG00000161681	ENSG00000161681		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	15474	protein-coding gene	gene with protein product	"""somatostatin receptor-interacting protein"""	604999				10551867	Standard	NM_016148		Approved	SSTRIP, SPANK-1, synamon	uc002psx.1	Q9Y566	OTTHUMG00000137380	ENST00000293441.1:c.4394A>T	19.37:g.51170823T>A	ENSP00000293441:p.Glu1465Val	Somatic	0	10	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	7	46.15	A8MXP5|B7WNY6|Q9NYW9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ankyrin_rpt,pfam_SAM_type1,pfam_SH3_2,pfam_SAM_2,pfam_PDZ,pfam_SH3_domain,superfamily_Ankyrin_rpt-contain_dom,superfamily_PDZ,superfamily_SH3_domain,superfamily_SAM/pointed,smart_Ankyrin_rpt,smart_SH3_domain,smart_PDZ,smart_SAM,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_PDZ,pfscan_SAM,pfscan_SH3_domain	p.E1473V	ENST00000293441.1	37	c.4418	CCDS12799.1	19	.	.	.	.	.	.	.	.	.	.	T	1.435	-0.569232	0.03910	.	.	ENSG00000161681	ENST00000293441;ENST00000391813;ENST00000359082;ENST00000391814	T;T;T;T	0.39997	1.18;1.67;1.15;1.05	1.78	1.78	0.24846	.	0.653207	0.12883	U	0.431300	T	0.23210	0.0561	N	0.12746	0.255	0.30661	N	0.754409	P;D	0.55172	0.949;0.97	B;B	0.43225	0.234;0.412	T	0.10894	-1.0610	10	0.30078	T	0.28	.	7.1988	0.25868	0.0:0.0:0.0:1.0	.	1465;852	Q9Y566;Q9Y566-2	SHAN1_HUMAN;.	V	1465;852;1456;1473	ENSP00000293441:E1465V;ENSP00000375689:E852V;ENSP00000351984:E1456V;ENSP00000375690:E1473V	ENSP00000293441:E1465V	E	-	2	0	SHANK1	55862635	0.320000	0.24616	0.453000	0.27007	0.125000	0.20455	0.957000	0.29215	0.833000	0.34828	0.164000	0.16699	GAG	-	NULL		0.751	SHANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHANK1	protein_coding	OTTHUMT00000268071.1	T	NM_016148	-		51170823	-1	no_errors	ENST00000391814	ensembl	human	known	74_37	missense	SNP	1.000	A
DPPA3P2	400206	genome.wustl.edu	37	14	36840694	36840694	+	RNA	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr14:36840694G>A	ENST00000557188.1	+	0	325									developmental pluripotency associated 3 pseudogene 2																		TTCCCGGGACGATTCAGGGGC	0.478																																																	0								ENSG00000188831																																			DPPA3P2			0			-	HGNC			14q13.3	2012-07-04			ENSG00000188831	ENSG00000188831			20417	pseudogene	pseudogene							Standard	NG_023379		Approved	STELLAR			OTTHUMG00000170728		14.37:g.36840694G>A		Somatic	0	61	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	93	17.54		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000557188.1	37	NULL		14																																																																																			-	-		0.478	DPPA3P2-002	KNOWN	basic	processed_transcript	DPPA3P2	pseudogene	OTTHUMT00000410122.1	G		-		36840694	+1	no_errors	ENST00000557188	ensembl	human	known	74_37	rna	SNP	0.014	A
TRANK1	9881	genome.wustl.edu	37	3	36940674	36940674	+	Missense_Mutation	SNP	A	A	G			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr3:36940674A>G	ENST00000429976.2	-	3	474	c.227T>C	c.(226-228)cTg>cCg	p.L76P	TRANK1_ENST00000301807.6_5'UTR	NM_014831.2	NP_055646.2	O15050	TRNK1_HUMAN	tetratricopeptide repeat and ankyrin repeat containing 1	76							ATP binding (GO:0005524)|hydrolase activity (GO:0016787)			NS(2)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(20)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	73						CACAAGTCGCAGACCCTCAAA	0.493																																																	0								ENSG00000168016						59.0	62.0	61.0					3																	36940674		692	1591	2283	TRANK1	SO:0001583	missense	0			-	HGNC	AK096678	CCDS46789.1, CCDS46789.2	3p22.2	2013-01-11			ENSG00000168016	ENSG00000168016		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29011	protein-coding gene	gene with protein product	"""lupus brain antigen 1"", ""KIAA0342"""					9205841	Standard	NM_014831		Approved	LBA1, KIAA0342	uc003cgj.3	O15050	OTTHUMG00000155848	ENST00000429976.2:c.227T>C	3.37:g.36940674A>G	ENSP00000416168:p.Leu76Pro	Somatic	0	60	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	78	22.00	Q8N8K0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_UvrD-like_ATP-bd,superfamily_P-loop_NTPase,superfamily_Ankyrin_rpt-contain_dom,smart_TPR_repeat,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_TPR-contain_dom	p.L76P	ENST00000429976.2	37	c.227	CCDS46789.2	3	.	.	.	.	.	.	.	.	.	.	A	21.5	4.154352	0.78114	.	.	ENSG00000168016	ENST00000429976	T	0.25250	1.81	5.61	5.61	0.85477	.	.	.	.	.	T	0.50137	0.1598	M	0.83118	2.625	0.80722	D	1	.	.	.	.	.	.	T	0.55964	-0.8057	7	0.72032	D	0.01	.	13.6407	0.62249	1.0:0.0:0.0:0.0	.	.	.	.	P	76	ENSP00000416168:L76P	ENSP00000416168:L76P	L	-	2	0	TRANK1	36915678	0.998000	0.40836	0.986000	0.45419	0.829000	0.46940	5.040000	0.64191	2.272000	0.75746	0.460000	0.39030	CTG	-	smart_TPR_repeat,pfscan_TPR-contain_dom		0.493	TRANK1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	TRANK1	protein_coding		A	NM_014831	-		36940674	-1	no_errors	ENST00000429976	ensembl	human	known	74_37	missense	SNP	0.990	G
PCDHB13	56123	genome.wustl.edu	37	5	140595022	140595022	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr5:140595022G>A	ENST00000341948.4	+	1	1514	c.1327G>A	c.(1327-1329)Gat>Aat	p.D443N		NM_018933.2	NP_061756.1	Q9Y5F0	PCDBD_HUMAN	protocadherin beta 13	443	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|liver(4)|lung(24)|ovary(5)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	66			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCTGATCGCCGATGTCAATGA	0.552																																																	0								ENSG00000187372						154.0	137.0	143.0					5																	140595022		2203	4300	6503	PCDHB13	SO:0001583	missense	0			-	HGNC	AF152492	CCDS4255.1	5q31	2010-01-26			ENSG00000187372	ENSG00000187372		"""Cadherins / Protocadherins : Clustered"""	8684	other	protocadherin		606339				10380929	Standard	NM_018933		Approved	PCDH-BETA13	uc003lja.1	Q9Y5F0	OTTHUMG00000129615	ENST00000341948.4:c.1327G>A	5.37:g.140595022G>A	ENSP00000345491:p.Asp443Asn	Somatic	0	141	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	32	147	17.88	A8K9V6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.D443N	ENST00000341948.4	37	c.1327	CCDS4255.1	5	.	.	.	.	.	.	.	.	.	.	N	28.6	4.936319	0.92458	.	.	ENSG00000187372	ENST00000341948;ENST00000430318;ENST00000419217	T	0.67698	-0.28	3.5	3.5	0.40072	Cadherin (3);Cadherin conserved site (1);Cadherin-like (1);	.	.	.	.	D	0.85522	0.5716	M	0.93283	3.4	0.48511	D	0.999664	D	0.89917	1.0	D	0.97110	1.0	D	0.90040	0.4141	9	0.87932	D	0	.	15.0196	0.71621	0.0:0.0:1.0:0.0	.	443	Q9Y5F0	PCDBD_HUMAN	N	443	ENSP00000345491:D443N	ENSP00000345491:D443N	D	+	1	0	PCDHB13	140575206	1.000000	0.71417	0.772000	0.31596	0.132000	0.20833	7.889000	0.87307	1.671000	0.50874	0.298000	0.19748	GAT	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.552	PCDHB13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB13	protein_coding	OTTHUMT00000251810.1	G	NM_018933	-		140595022	+1	no_errors	ENST00000341948	ensembl	human	known	74_37	missense	SNP	1.000	A
UNC5A	90249	genome.wustl.edu	37	5	176301366	176301366	+	Nonsense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr5:176301366C>T	ENST00000329542.4	+	8	1451	c.1177C>T	c.(1177-1179)Cag>Tag	p.Q393*	UNC5A_ENST00000261961.3_Nonsense_Mutation_p.Q353*	NM_133369.2	NP_588610.2	Q6ZN44	UNC5A_HUMAN	unc-5 homolog A (C. elegans)	393					anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|positive regulation of apoptotic process (GO:0043065)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(4)|kidney(3)|large_intestine(2)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	34	all_cancers(89;0.000119)|Renal(175;0.000269)|Lung NSC(126;0.00696)|all_lung(126;0.0115)	Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CCCCAAGTTCCAGCTCACCAA	0.672																																																	0								ENSG00000113763						85.0	97.0	93.0					5																	176301366		2203	4300	6503	UNC5A	SO:0001587	stop_gained	0			-	HGNC	AB075856	CCDS34299.1	5q35.3	2013-01-11	2001-11-28		ENSG00000113763	ENSG00000113763		"""Immunoglobulin superfamily / I-set domain containing"""	12567	protein-coding gene	gene with protein product		607869	"""unc5 (C.elegans homolog) a"""				Standard	XM_006714927		Approved	KIAA1976, UNC5H1	uc003mey.3	Q6ZN44	OTTHUMG00000163225	ENST00000329542.4:c.1177C>T	5.37:g.176301366C>T	ENSP00000332737:p.Gln393*	Somatic	0	86	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	110	16.03	B2RXE6|Q8TF26|Q96GP4	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ZU5,pfam_Death_domain,pfam_Ig_I-set,superfamily_DEATH-like_dom,superfamily_Thrombospondin_1_rpt,smart_Ig_sub,smart_Thrombospondin_1_rpt,smart_ZU5,smart_Death_domain,pfscan_Thrombospondin_1_rpt,pfscan_ZU5,pfscan_Ig-like_dom	p.Q393*	ENST00000329542.4	37	c.1177	CCDS34299.1	5	.	.	.	.	.	.	.	.	.	.	C	37	6.524282	0.97637	.	.	ENSG00000113763	ENST00000329542;ENST00000261961	.	.	.	5.34	4.41	0.53225	.	0.359267	0.30483	N	0.009527	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.33141	T	0.24	-14.7331	15.4457	0.75228	0.0:0.8608:0.1392:0.0	.	.	.	.	X	393;353	.	ENSP00000261961:Q353X	Q	+	1	0	UNC5A	176233972	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	2.485000	0.45250	2.512000	0.84698	0.484000	0.47621	CAG	-	NULL		0.672	UNC5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UNC5A	protein_coding	OTTHUMT00000372166.1	C	XM_030300	-		176301366	+1	no_errors	ENST00000329542	ensembl	human	known	74_37	nonsense	SNP	1.000	T
ZNF804A	91752	genome.wustl.edu	37	2	185800578	185800578	+	Missense_Mutation	SNP	C	C	T	rs147922206		TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr2:185800578C>T	ENST00000302277.6	+	4	1049	c.455C>T	c.(454-456)tCc>tTc	p.S152F		NM_194250.1	NP_919226.1	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	152							metal ion binding (GO:0046872)	p.S152F(1)|p.S152Y(1)		NS(5)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(22)|liver(2)|lung(79)|ovary(7)|pancreas(1)|prostate(2)|skin(12)|urinary_tract(1)	146						AATGAAATTTCCCAACGAGTT	0.368																																																	2	Substitution - Missense(2)	lung(1)|skin(1)						ENSG00000170396						57.0	56.0	56.0					2																	185800578		2203	4300	6503	ZNF804A	SO:0001583	missense	0			-	HGNC	AF052145	CCDS2291.1	2q32.1	2012-10-05	2006-10-27	2006-10-27	ENSG00000170396	ENSG00000170396			21711	protein-coding gene	gene with protein product		612282		C2orf10		12970790	Standard	NM_194250		Approved		uc002uph.3	Q7Z570	OTTHUMG00000132625	ENST00000302277.6:c.455C>T	2.37:g.185800578C>T	ENSP00000303252:p.Ser152Phe	Somatic	0	35	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	33	25.00	A7E253|Q6ZN26	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2_jaz	p.S152F	ENST00000302277.6	37	c.455	CCDS2291.1	2	.	.	.	.	.	.	.	.	.	.	C	14.70	2.614733	0.46631	.	.	ENSG00000170396	ENST00000302277	T	0.06608	3.28	5.18	4.24	0.50183	.	0.415884	0.20585	N	0.089452	T	0.08492	0.0211	L	0.50333	1.59	0.09310	N	1	P	0.44578	0.838	P	0.44990	0.466	T	0.18116	-1.0347	10	0.42905	T	0.14	-1.7788	7.3606	0.26744	0.1685:0.7468:0.0:0.0847	.	152	Q7Z570	Z804A_HUMAN	F	152	ENSP00000303252:S152F	ENSP00000303252:S152F	S	+	2	0	ZNF804A	185508823	0.011000	0.17503	0.548000	0.28192	0.931000	0.56810	1.420000	0.34804	2.418000	0.82041	0.467000	0.42956	TCC	-	NULL		0.368	ZNF804A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF804A	protein_coding	OTTHUMT00000255871.1	C	NM_194250	rs147922206		185800578	+1	no_errors	ENST00000302277	ensembl	human	known	74_37	missense	SNP	0.005	T
MKLN1	4289	genome.wustl.edu	37	7	130794804	130794805	+	5'Flank	INS	-	-	GGCGGC	rs370827120|rs60530281|rs139750586	byFrequency	TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr7:130794804_130794805insGGCGGC	ENST00000421797.2	+	0	0				MKLN1-AS1_ENST00000451786.1_RNA|MKLN1-AS1_ENST00000423414.1_RNA|MKLN1-AS1_ENST00000431189.1_RNA|MKLN1-AS1_ENST00000429901.1_RNA	NM_001145354.1	NP_001138826.1	Q9UL63	MKLN1_HUMAN	muskelin 1, intracellular mediator containing kelch motifs						signal transduction (GO:0007165)	cytoplasm (GO:0005737)				breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(10)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	28	Melanoma(18;0.162)					TGCAAGAAGGAggcggcggcgg	0.688														4903	0.979034	0.944	0.9899	5008	,	,		11919	0.995		0.9901	False		,,,				2504	0.9908																0								ENSG00000231721																																			MKLN1-AS1	SO:0001631	upstream_gene_variant	0				HGNC	AF047489	CCDS34754.1	7q32	2008-07-18			ENSG00000128585	ENSG00000128585			7109	protein-coding gene	gene with protein product		605623				10640805	Standard	NM_001145354		Approved	TWA2	uc011kpm.2	Q9UL63	OTTHUMG00000154880		7.37:g.130794805_130794810dupGGCGGC	Exception_encountered	Somatic	NA	NA	NA		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A4D1M8|A6NG43|Q9NSK4|Q9NUS8	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000421797.2	37	NULL		7																																																																																			-	-		0.688	MKLN1-012	NOVEL	basic|exp_conf	protein_coding	MKLN1-AS1	protein_coding	OTTHUMT00000338094.2	-	NM_013255			130794805	-1	no_errors	ENST00000451786	ensembl	human	known	74_37	rna	INS	0.275:0.977	GGCGGC
COL6A5	256076	genome.wustl.edu	37	3	130107651	130107651	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr3:130107651G>A	ENST00000432398.2	+	6	2584	c.2090G>A	c.(2089-2091)aGa>aAa	p.R697K	COL6A5_ENST00000265379.6_Missense_Mutation_p.R697K	NM_153264.5	NP_694996.5	A8TX70	CO6A5_HUMAN	collagen, type VI, alpha 5	697	Nonhelical region.|VWFA 4. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				endometrium(6)|kidney(4)|large_intestine(8)|lung(19)|pancreas(2)|prostate(3)|stomach(1)|urinary_tract(1)	44						GCAATAGATAGAATGTCTCTC	0.393																																																	0								ENSG00000172752						48.0	42.0	44.0					3																	130107651		692	1591	2283	COL6A5	SO:0001583	missense	0			-	HGNC	AK093199		3q21.3	2013-01-16	2010-05-24	2010-05-24	ENSG00000172752	ENSG00000172752		"""Collagens"""	26674	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 4"""	611916	"""collagen, type XXIX, alpha 1"""	COL29A1		17850181	Standard	NM_153264		Approved	FLJ35880, VWA4	uc010htk.2	A8TX70	OTTHUMG00000159712	ENST00000432398.2:c.2090G>A	3.37:g.130107651G>A	ENSP00000390895:p.Arg697Lys	Somatic	0	36	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	50	24.24	A9J6L2|A9J6L4|A9J6L6|A9J6L7|A9J6M0|A9J6M1|A9J6M2|B5MEA7|Q6ZW26|Q8NA36	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_VWF_A,pfam_Collagen,smart_VWF_A,pfscan_VWF_A	p.R697K	ENST00000432398.2	37	c.2090		3	.	.	.	.	.	.	.	.	.	.	G	11.56	1.673705	0.29693	.	.	ENSG00000172752	ENST00000432398;ENST00000265379	T;T	0.77229	-1.08;-1.08	5.59	3.72	0.42706	.	.	.	.	.	T	0.73194	0.3556	L	0.42008	1.315	0.09310	N	0.999993	B	0.31705	0.336	B	0.38755	0.281	T	0.57075	-0.7873	9	0.13108	T	0.6	.	14.8133	0.70010	0.0:0.2747:0.7253:0.0	.	697	A8TX70-2	.	K	697	ENSP00000390895:R697K;ENSP00000265379:R697K	ENSP00000265379:R697K	R	+	2	0	COL6A5	131590341	0.000000	0.05858	0.081000	0.20488	0.875000	0.50365	-0.402000	0.07223	0.661000	0.30985	0.650000	0.86243	AGA	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A		0.393	COL6A5-202	KNOWN	basic|appris_principal	protein_coding	COL6A5	protein_coding		G	NM_153264	-		130107651	+1	no_errors	ENST00000265379	ensembl	human	known	74_37	missense	SNP	0.679	A
SIGLEC7	27036	genome.wustl.edu	37	19	51645996	51645996	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr19:51645996C>T	ENST00000317643.6	+	1	439	c.370C>T	c.(370-372)Cgt>Tgt	p.R124C	SIGLEC7_ENST00000600577.1_Missense_Mutation_p.R124C|SIGLEC7_ENST00000305628.7_Missense_Mutation_p.R124C	NM_014385.2	NP_055200.1	Q9Y286	SIGL7_HUMAN	sialic acid binding Ig-like lectin 7	124					cell adhesion (GO:0007155)	integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)	p.R124C(1)		autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(11)|skin(2)|stomach(1)	29		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000836)|OV - Ovarian serous cystadenocarcinoma(262;0.00297)		ATACTTCTTTCGTATGGAGAA	0.478																																																	1	Substitution - Missense(1)	skin(1)						ENSG00000168995						88.0	90.0	89.0					19																	51645996		2203	4300	6503	SIGLEC7	SO:0001583	missense	0			-	HGNC	AF170485	CCDS12826.1, CCDS42601.1, CCDS62771.1	19q13.41	2014-03-20			ENSG00000168995	ENSG00000168995		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10876	protein-coding gene	gene with protein product		604410	"""sialic acid binding Ig-like lectin 19, pseudogene"", ""sialic acid binding Ig-like lectin, pseudogene 2"""	SIGLEC19P, SIGLECP2		10567377	Standard	NM_001277201		Approved	SIGLEC-7, p75/AIRM1, QA79, CD328	uc002pvv.1	Q9Y286	OTTHUMG00000182895	ENST00000317643.6:c.370C>T	19.37:g.51645996C>T	ENSP00000323328:p.Arg124Cys	Somatic	0	50	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	53	17.19	Q9NZQ1|Q9UJ86|Q9UJ87|Q9Y502	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_V-set,pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.R124C	ENST00000317643.6	37	c.370	CCDS12826.1	19	.	.	.	.	.	.	.	.	.	.	.	13.14	2.149449	0.37923	.	.	ENSG00000168995	ENST00000317643;ENST00000305628;ENST00000536156	T;T;T	0.66638	-0.22;-0.22;-0.22	2.89	-1.1	0.09872	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	1.072930	0.07459	N	0.900226	T	0.79736	0.4497	M	0.90977	3.165	0.09310	N	0.999998	D;D;D	0.89917	0.997;1.0;0.999	P;P;P	0.61533	0.72;0.753;0.89	T	0.64097	-0.6487	10	0.49607	T	0.09	.	3.6718	0.08277	0.0:0.541:0.2071:0.2519	.	124;124;124	Q9Y286-4;Q9Y286-2;Q9Y286	.;.;SIGL7_HUMAN	C	124	ENSP00000323328:R124C;ENSP00000306757:R124C;ENSP00000437609:R124C	ENSP00000306757:R124C	R	+	1	0	SIGLEC7	56337808	0.000000	0.05858	0.000000	0.03702	0.057000	0.15508	-1.092000	0.03366	-0.177000	0.10690	-0.487000	0.04747	CGT	-	pfam_Ig_V-set,smart_Ig_sub		0.478	SIGLEC7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SIGLEC7	protein_coding	OTTHUMT00000464226.2	C	NM_016543	-		51645996	+1	no_errors	ENST00000317643	ensembl	human	known	74_37	missense	SNP	0.000	T
COL22A1	169044	genome.wustl.edu	37	8	139833396	139833396	+	Missense_Mutation	SNP	C	C	T	rs150603745		TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr8:139833396C>T	ENST00000303045.6	-	7	1674	c.1228G>A	c.(1228-1230)Gac>Aac	p.D410N	COL22A1_ENST00000435777.1_Missense_Mutation_p.D410N	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	410	Laminin G-like.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			GGCACACTGTCGTAGAGGCGC	0.592										HNSCC(7;0.00092)																																							0								ENSG00000169436	C	ASN/ASP	1,4405	2.1+/-5.4	0,1,2202	161.0	114.0	130.0		1228	5.2	1.0	8	dbSNP_134	130	0,8600		0,0,4300	no	missense	COL22A1	NM_152888.1	23	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	possibly-damaging	410/1627	139833396	1,13005	2203	4300	6503	COL22A1	SO:0001583	missense	0			-	HGNC	AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.1228G>A	8.37:g.139833396C>T	ENSP00000303153:p.Asp410Asn	Somatic	0	35	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	28	12.50	B7ZMH0|C9K0G4|Q8IVT9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Collagen,pfam_VWF_A,superfamily_ConA-like_lec_gl_sf,smart_VWF_A,smart_Laminin_G,pfscan_VWF_A	p.D410N	ENST00000303045.6	37	c.1228	CCDS6376.1	8	.	.	.	.	.	.	.	.	.	.	C	24.3	4.514002	0.85389	2.27E-4	0.0	ENSG00000169436	ENST00000303045;ENST00000435777	T;T	0.02177	4.41;4.41	5.21	5.21	0.72293	Concanavalin A-like lectin/glucanase (1);Laminin G, thrombospondin-type, N-terminal (1);	0.000000	0.52532	D	0.000075	T	0.09862	0.0242	L	0.50333	1.59	0.54753	D	0.999987	D	0.89917	1.0	D	0.83275	0.996	T	0.12293	-1.0553	9	.	.	.	.	18.1827	0.89783	0.0:1.0:0.0:0.0	.	410	Q8NFW1	COMA1_HUMAN	N	410	ENSP00000303153:D410N;ENSP00000387655:D410N	.	D	-	1	0	COL22A1	139902578	1.000000	0.71417	0.960000	0.40013	0.843000	0.47879	5.788000	0.69020	2.616000	0.88540	0.558000	0.71614	GAC	-	superfamily_ConA-like_lec_gl_sf,smart_Laminin_G		0.592	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	COL22A1	protein_coding	OTTHUMT00000315905.2	C	XM_291257	rs150603745		139833396	-1	no_errors	ENST00000303045	ensembl	human	known	74_37	missense	SNP	0.999	T
FPR3	2359	genome.wustl.edu	37	19	52327005	52327005	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr19:52327005G>A	ENST00000339223.4	+	2	183	c.4G>A	c.(4-6)Gaa>Aaa	p.E2K	FPR3_ENST00000595991.1_Missense_Mutation_p.E2K	NM_002030.3	NP_002021.3	P25089	FPR3_HUMAN	formyl peptide receptor 3	2					cellular component movement (GO:0006928)|chemotaxis (GO:0006935)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	N-formyl peptide receptor activity (GO:0004982)			NS(1)|breast(3)|endometrium(3)|kidney(1)|large_intestine(5)|lung(17)|ovary(1)|prostate(1)|skin(3)	35						TGGGAAGATGGAAACCAACTT	0.478																																																	0								ENSG00000187474						84.0	68.0	74.0					19																	52327005		2203	4300	6503	FPR3	SO:0001583	missense	0			-	HGNC		CCDS12841.1	19q13.3-q13.4	2012-08-08	2008-04-17	2008-04-17		ENSG00000187474		"""GPCR / Class A : Formyl peptide receptors"""	3828	protein-coding gene	gene with protein product		136539	"""formyl peptide receptor-like 2"""	FPRL2		1612600, 8198572	Standard	NM_002030		Approved	FPRH1, FMLPY, RMLP-R-I	uc002pxt.1	P25089		ENST00000339223.4:c.4G>A	19.37:g.52327005G>A	ENSP00000341821:p.Glu2Lys	Somatic	0	56	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	70	22.22		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Formyl_pep_rcpt,prints_GPCR_Rhodpsn,prints_Anphylx_rcpt	p.E2K	ENST00000339223.4	37	c.4	CCDS12841.1	19	.	.	.	.	.	.	.	.	.	.	.	14.52	2.559623	0.45590	.	.	ENSG00000187474	ENST00000339223	T	0.70869	-0.52	2.32	2.32	0.28847	.	0.566557	0.16051	N	0.231951	T	0.60274	0.2256	N	0.08118	0	0.23581	N	0.997362	D	0.59767	0.986	P	0.55455	0.776	T	0.52208	-0.8606	10	0.66056	D	0.02	.	8.6337	0.33935	0.0:0.0:1.0:0.0	.	2	P25089	FPR3_HUMAN	K	2	ENSP00000341821:E2K	ENSP00000341821:E2K	E	+	1	0	FPR3	57018817	0.998000	0.40836	0.927000	0.36925	0.408000	0.30992	1.948000	0.40303	1.223000	0.43536	0.467000	0.42956	GAA	-	NULL		0.478	FPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FPR3	protein_coding	OTTHUMT00000466914.1	G	NM_002030	-		52327005	+1	no_errors	ENST00000339223	ensembl	human	known	74_37	missense	SNP	0.958	A
USP30	84749	genome.wustl.edu	37	12	109490426	109490427	+	5'UTR	INS	-	-	CGGCGG	rs71079516|rs3217401|rs140371213	byFrequency	TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr12:109490426_109490427insCGGCGG	ENST00000257548.5	+	0	36_37				USP30-AS1_ENST00000478808.2_RNA|USP30_ENST00000392784.2_Intron	NM_032663.3	NP_116052.2	Q70CQ3	UBP30_HUMAN	ubiquitin specific peptidase 30						mitochondrial fusion (GO:0008053)|mitochondrion degradation (GO:0000422)|protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			endometrium(7)|kidney(1)|large_intestine(1)|liver(2)|lung(11)|prostate(1)|skin(3)|stomach(2)	28						ATCCCTCGGTCcggcggcggcg	0.728														2378	0.47484	0.177	0.6398	5008	,	,		14910	0.6944		0.5199	False		,,,				2504	0.4877																0								ENSG00000256262																																			USP30-AS1	SO:0001623	5_prime_UTR_variant	0				HGNC	BC022094	CCDS9123.2	12q23.3	2006-01-20	2005-08-08		ENSG00000135093	ENSG00000135093		"""Ubiquitin-specific peptidases"""	20065	protein-coding gene	gene with protein product		612492	"""ubiquitin specific protease 30"""			12838346	Standard	XM_005253962		Approved	MGC10702, FLJ40511	uc010sxi.2	Q70CQ3	OTTHUMG00000133613	ENST00000257548.5:c.-57->CGGCGG	12.37:g.109490427_109490432dupCGGCGG		Somatic	NA	NA	NA		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q8WTU7|Q96JX4|Q9BSS3	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000257548.5	37	NULL	CCDS9123.2	12																																																																																			-	-		0.728	USP30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP30-AS1	protein_coding	OTTHUMT00000257733.2	-	NM_032663			109490427	-1	no_errors	ENST00000478808	ensembl	human	known	74_37	rna	INS	0.000:0.000	CGGCGG
MYH1	4619	genome.wustl.edu	37	17	10398388	10398388	+	Missense_Mutation	SNP	C	C	T	rs141339850		TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr17:10398388C>T	ENST00000226207.5	-	37	5420	c.5326G>A	c.(5326-5328)Gaa>Aaa	p.E1776K	CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|RP11-799N11.1_ENST00000399342.2_RNA	NM_005963.3	NP_005954.3	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	1776					muscle contraction (GO:0006936)	A band (GO:0031672)|cytoplasmic ribonucleoprotein granule (GO:0036464)|intercalated disc (GO:0014704)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.E1776K(1)		NS(7)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(22)|lung(78)|ovary(11)|pancreas(1)|prostate(3)|skin(13)|upper_aerodigestive_tract(4)|urinary_tract(5)	176						GTGTCCTGTTCCTTCTTCAGC	0.507																																																	1	Substitution - Missense(1)	skin(1)						ENSG00000109061						165.0	159.0	161.0					17																	10398388		2203	4300	6503	MYH1	SO:0001583	missense	0			-	HGNC		CCDS11155.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109061	ENSG00000109061		"""Myosins / Myosin superfamily : Class II"""	7567	protein-coding gene	gene with protein product	"""myosin heavy chain IIx/d"""	160730	"""myosin, heavy polypeptide 1, skeletal muscle, adult"""			6304733	Standard	NM_005963		Approved	MYHSA1, MYHa, MyHC-2X/D, MGC133384	uc002gmo.3	P12882	OTTHUMG00000130362	ENST00000226207.5:c.5326G>A	17.37:g.10398388C>T	ENSP00000226207:p.Glu1776Lys	Somatic	0	132	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	42	133	23.86	Q14CA4|Q9Y622	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,superfamily_tRNA-bd_arm,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.E1776K	ENST00000226207.5	37	c.5326	CCDS11155.1	17	.	.	.	.	.	.	.	.	.	.	C	36	5.709374	0.96821	.	.	ENSG00000109061	ENST00000226207	D	0.90504	-2.68	5.26	5.26	0.73747	Myosin tail (1);	0.000000	0.43579	U	0.000557	D	0.96778	0.8948	H	0.94503	3.545	0.80722	D	1	D	0.71674	0.998	D	0.73708	0.981	D	0.97294	0.9926	10	0.59425	D	0.04	.	19.2282	0.93825	0.0:1.0:0.0:0.0	.	1776	P12882	MYH1_HUMAN	K	1776	ENSP00000226207:E1776K	ENSP00000226207:E1776K	E	-	1	0	MYH1	10339113	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.748000	0.85085	2.616000	0.88540	0.561000	0.74099	GAA	-	pfam_Myosin_tail		0.507	MYH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH1	protein_coding	OTTHUMT00000252725.1	C	NM_005963	rs141339850		10398388	-1	no_errors	ENST00000226207	ensembl	human	known	74_37	missense	SNP	1.000	T
ASS1	445	genome.wustl.edu	37	9	133370324	133370324	+	Silent	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr9:133370324G>A	ENST00000372394.1	+	14	1522	c.1041G>A	c.(1039-1041)ggG>ggA	p.G347G	ASS1_ENST00000372393.3_Silent_p.G347G|ASS1_ENST00000352480.5_Silent_p.G347G			P00966	ASSY_HUMAN	argininosuccinate synthase 1	347			G -> R (in CTLN1; severe clinical course).		acute-phase response (GO:0006953)|aging (GO:0007568)|arginine biosynthetic process (GO:0006526)|argininosuccinate metabolic process (GO:0000053)|aspartate metabolic process (GO:0006531)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to amine stimulus (GO:0071418)|cellular response to amino acid stimulus (GO:0071230)|cellular response to ammonium ion (GO:0071242)|cellular response to cAMP (GO:0071320)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to glucagon stimulus (GO:0071377)|cellular response to interferon-gamma (GO:0071346)|cellular response to laminar fluid shear stress (GO:0071499)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to oleic acid (GO:0071400)|cellular response to tumor necrosis factor (GO:0071356)|citrulline metabolic process (GO:0000052)|diaphragm development (GO:0060539)|kidney development (GO:0001822)|liver development (GO:0001889)|midgut development (GO:0007494)|negative regulation of leukocyte cell-cell adhesion (GO:1903038)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to growth hormone (GO:0060416)|response to mycotoxin (GO:0010046)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)|urea cycle (GO:0000050)	cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)|perikaryon (GO:0043204)	amino acid binding (GO:0016597)|argininosuccinate synthase activity (GO:0004055)|ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|toxic substance binding (GO:0015643)			breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(4)|ovary(1)|skin(1)|urinary_tract(1)	17				OV - Ovarian serous cystadenocarcinoma(145;0.000514)	Adenosine triphosphate(DB00171)|L-Arginine(DB00125)|L-Aspartic Acid(DB00128)|L-Citrulline(DB00155)	GAGTGGAAGGGAAAGTGCAGG	0.582																																																	0								ENSG00000130707						131.0	120.0	124.0					9																	133370324		2203	4300	6503	ASS1	SO:0001819	synonymous_variant	0			-	HGNC	X01630	CCDS6933.1	9q34.1	2012-10-02	2010-04-20	2006-08-24	ENSG00000130707	ENSG00000130707	6.3.4.5		758	protein-coding gene	gene with protein product		603470	"""argininosuccinate synthetase"""	ASS		3513483, 852520	Standard	NM_054012		Approved	CTLN1	uc004bzm.3	P00966	OTTHUMG00000020806	ENST00000372394.1:c.1041G>A	9.37:g.133370324G>A		Somatic	0	40	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	28	36.36	Q6LDL2|Q86UZ0|Q96GT4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Arginosuc_synth,pfam_QueC,tigrfam_Arginosuc_synth	p.G347	ENST00000372394.1	37	c.1041	CCDS6933.1	9																																																																																			-	pfam_Arginosuc_synth,tigrfam_Arginosuc_synth		0.582	ASS1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ASS1	protein_coding	OTTHUMT00000054652.1	G	NM_000050	-		133370324	+1	no_errors	ENST00000352480	ensembl	human	known	74_37	silent	SNP	0.998	A
RPL5	6125	genome.wustl.edu	37	1	93306153	93306153	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr1:93306153C>T	ENST00000370321.3	+	7	841	c.751C>T	c.(751-753)Cca>Tca	p.P251S	SNORA66_ENST00000515986.1_RNA|SNORA66_ENST00000384792.1_RNA	NM_000969.3	NP_000960.2	P46777	RL5_HUMAN	ribosomal protein L5	251					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|ribosomal large subunit biogenesis (GO:0042273)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	5S rRNA binding (GO:0008097)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			endometrium(1)|kidney(2)|large_intestine(1)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	9		all_lung(203;0.00265)|Lung NSC(277;0.0056)|all_neural(321;0.185)|Melanoma(281;0.192)|Glioma(108;0.203)		GBM - Glioblastoma multiforme(16;0.000305)|all cancers(265;0.000343)|Epithelial(280;0.0927)		ACGAGAGAATCCAGTCTATGA	0.378																																																	0								ENSG00000122406						110.0	115.0	113.0					1																	93306153		2203	4298	6501	RPL5	SO:0001583	missense	0			-	HGNC	U14966	CCDS741.1	1p22.1	2014-06-13			ENSG00000122406	ENSG00000122406		"""L ribosomal proteins"""	10360	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 135"""	603634				7937132, 7772601	Standard	NM_000969		Approved	L5, PPP1R135	uc001doz.3	P46777	OTTHUMG00000010899	ENST00000370321.3:c.751C>T	1.37:g.93306153C>T	ENSP00000359345:p.Pro251Ser	Somatic	0	69	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	62	17.33	Q32LZ3|Q53HH6|Q9H3F4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ribosomal_L18/L5,prints_Rbsml_L5_euk/L18_arc	p.P251S	ENST00000370321.3	37	c.751	CCDS741.1	1	.	.	.	.	.	.	.	.	.	.	C	29.3	4.993760	0.93167	.	.	ENSG00000122406	ENST00000432788;ENST00000370321	T	0.65549	-0.16	5.26	5.26	0.73747	.	0.053407	0.85682	D	0.000000	T	0.77032	0.4071	M	0.93150	3.385	0.80722	D	1	D;D	0.58268	0.982;0.982	P;P	0.52309	0.695;0.695	D	0.83708	0.0186	10	0.66056	D	0.02	.	19.2432	0.93891	0.0:1.0:0.0:0.0	.	251;251	A2RUM7;P46777	.;RL5_HUMAN	S	201;251	ENSP00000359345:P251S	ENSP00000359345:P251S	P	+	1	0	RPL5	93078741	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	7.763000	0.85283	2.609000	0.88269	0.655000	0.94253	CCA	-	NULL		0.378	RPL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPL5	protein_coding	OTTHUMT00000030058.2	C	NM_000969	-		93306153	+1	no_errors	ENST00000370321	ensembl	human	known	74_37	missense	SNP	1.000	T
ERBB4	2066	genome.wustl.edu	37	2	212483964	212483964	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr2:212483964G>A	ENST00000342788.4	-	19	2549	c.2239C>T	c.(2239-2241)Cct>Tct	p.P747S	ERBB4_ENST00000436443.1_Missense_Mutation_p.P747S|ERBB4_ENST00000402597.1_Missense_Mutation_p.P737S	NM_005235.2	NP_005226.1	Q15303	ERBB4_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 4	747	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cardiac muscle tissue regeneration (GO:0061026)|cell fate commitment (GO:0045165)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system morphogenesis (GO:0021551)|embryonic pattern specification (GO:0009880)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell differentiation (GO:0060644)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory bulb interneuron differentiation (GO:0021889)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of STAT protein import into nucleus (GO:2000366)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell migration (GO:0030334)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transcription regulatory region DNA binding (GO:0044212)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|breast(7)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(31)|lung(71)|pancreas(1)|prostate(3)|skin(39)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	179		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)	Afatinib(DB08916)	ATAGCCACAGGAATCTTCACA	0.373										TSP Lung(8;0.080)																																							0								ENSG00000178568						118.0	116.0	117.0					2																	212483964		2203	4300	6503	ERBB4	SO:0001583	missense	0			-	HGNC	L07868	CCDS2394.1, CCDS42811.1	2q33.3-q34	2013-10-11	2013-07-09		ENSG00000178568	ENSG00000178568			3432	protein-coding gene	gene with protein product		600543	"""v-erb-a avian erythroblastic leukemia viral oncogene homolog-like 4"""			7700649, 17018285	Standard	NM_001042599		Approved	ALS19	uc002veg.1	Q15303	OTTHUMG00000133012	ENST00000342788.4:c.2239C>T	2.37:g.212483964G>A	ENSP00000342235:p.Pro747Ser	Somatic	0	34	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	56	13.85	B7ZLD7|B7ZLE2|B7ZLE3|Q2M1W1|Q59EW4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_EGF_rcpt_L,pfam_Prot_kinase_dom,pfam_Furin-like_Cys-rich_dom,superfamily_Kinase-like_dom,superfamily_Growth_fac_rcpt_N_dom,smart_Furin_repeat,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.P747S	ENST00000342788.4	37	c.2239	CCDS2394.1	2	.	.	.	.	.	.	.	.	.	.	G	29.9	5.042367	0.93685	.	.	ENSG00000178568	ENST00000342788;ENST00000436443;ENST00000402597	D;D;D	0.81996	-1.56;-1.56;-1.56	4.91	4.91	0.64330	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.86506	0.5949	L	0.38692	1.165	0.80722	D	1	D;D;D;D	0.67145	0.978;0.996;0.961;0.982	P;D;B;P	0.63192	0.492;0.912;0.27;0.626	D	0.88285	0.2939	10	0.87932	D	0	.	18.0478	0.89338	0.0:0.0:1.0:0.0	.	737;737;747;747	Q15303-4;Q15303-2;Q15303-3;Q15303	.;.;.;ERBB4_HUMAN	S	747;747;737	ENSP00000342235:P747S;ENSP00000403204:P747S;ENSP00000385565:P737S	ENSP00000342235:P747S	P	-	1	0	ERBB4	212192209	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.349000	0.97066	2.436000	0.82500	0.655000	0.94253	CCT	-	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.373	ERBB4-001	KNOWN	basic|CCDS	protein_coding	ERBB4	protein_coding	OTTHUMT00000256597.1	G	NM_001042599	-		212483964	-1	no_errors	ENST00000342788	ensembl	human	known	74_37	missense	SNP	1.000	A
ZFX	7543	genome.wustl.edu	37	X	24229432	24229432	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chrX:24229432G>A	ENST00000379177.1	+	11	2784	c.2357G>A	c.(2356-2358)cGa>cAa	p.R786Q	ZFX_ENST00000338565.3_Missense_Mutation_p.R736Q|ZFX_ENST00000379188.3_Missense_Mutation_p.R786Q|ZFX_ENST00000539115.1_Missense_Mutation_p.R557Q|ZFX_ENST00000304543.5_Missense_Mutation_p.R786Q|ZFX_ENST00000540034.1_Missense_Mutation_p.R825Q	NM_001178085.1|NM_003410.3	NP_001171556.1|NP_003401.2	P17010	ZFX_HUMAN	zinc finger protein, X-linked	786					death (GO:0016265)|fertilization (GO:0009566)|homeostasis of number of cells (GO:0048872)|multicellular organism growth (GO:0035264)|oocyte development (GO:0048599)|ovarian follicle development (GO:0001541)|parental behavior (GO:0060746)|post-embryonic development (GO:0009791)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transcription coactivator activity (GO:0003713)	p.R786Q(1)		cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|liver(2)|lung(4)|ovary(2)|prostate(1)	24						AAAGGCTTCCGAAGACCTTCA	0.443																																					Esophageal Squamous(20;306 562 7346 32868 37983)												1	Substitution - Missense(1)	endometrium(1)						ENSG00000005889						81.0	68.0	72.0					X																	24229432		2203	4300	6503	ZFX	SO:0001583	missense	0			-	HGNC		CCDS14211.1, CCDS55390.1	Xp22.1-p21.3	2013-01-08			ENSG00000005889	ENSG00000005889		"""Zinc fingers, C2H2-type"""	12869	protein-coding gene	gene with protein product		314980					Standard	NM_003410		Approved	ZNF926	uc022bua.1	P17010	OTTHUMG00000021264	ENST00000379177.1:c.2357G>A	X.37:g.24229432G>A	ENSP00000368475:p.Arg786Gln	Somatic	0	20	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	22	38.89	B9EG97|O43668|Q8WYJ8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Transcrp_activ_Zfx/Zfy-dom,pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R825Q	ENST00000379177.1	37	c.2474	CCDS14211.1	X	.	.	.	.	.	.	.	.	.	.	G	21.2	4.112457	0.77210	.	.	ENSG00000005889	ENST00000539115;ENST00000379188;ENST00000535562;ENST00000379177;ENST00000304543;ENST00000540034;ENST00000338565	T;T;T;T;T;T	0.53640	0.61;3.09;3.09;3.09;3.1;3.12	5.41	5.41	0.78517	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.56097	D	0.000040	T	0.52996	0.1769	L	0.59436	1.845	0.54753	D	0.999983	P;P;P	0.51449	0.945;0.904;0.836	B;P;B	0.45681	0.351;0.49;0.153	T	0.59413	-0.7459	10	0.72032	D	0.01	-6.7409	18.539	0.91020	0.0:0.0:1.0:0.0	.	825;508;786	B9EG97;F5GYV7;P17010	.;.;ZFX_HUMAN	Q	557;786;508;786;786;825;736	ENSP00000438233:R557Q;ENSP00000368486:R786Q;ENSP00000368475:R786Q;ENSP00000304985:R786Q;ENSP00000441382:R825Q;ENSP00000343384:R736Q	ENSP00000304985:R786Q	R	+	2	0	ZFX	24139353	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.813000	0.99286	2.407000	0.81776	0.594000	0.82650	CGA	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.443	ZFX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFX	protein_coding	OTTHUMT00000056084.1	G	NM_003410	-		24229432	+1	no_errors	ENST00000540034	ensembl	human	known	74_37	missense	SNP	1.000	A
RAD21L1	642636	genome.wustl.edu	37	20	1223278	1223278	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr20:1223278G>A	ENST00000409241.1	+	9	965	c.872G>A	c.(871-873)aGg>aAg	p.R291K	RAD21L1_ENST00000402452.1_Missense_Mutation_p.R291K|RAD21L1_ENST00000381882.2_Missense_Mutation_p.R291K	NM_001136566.2	NP_001130038.2	Q9H4I0	RD21L_HUMAN	RAD21-like 1 (S. pombe)	291					attachment of telomeric heterochromatin to nuclear envelope (GO:0070197)|chromosome segregation (GO:0007059)|double-strand break repair via homologous recombination (GO:0000724)|fertilization (GO:0009566)|linear element assembly (GO:0030999)|seminiferous tubule development (GO:0072520)|spermatogenesis (GO:0007283)	chromosome (GO:0005694)|lateral element (GO:0000800)|meiotic cohesin complex (GO:0030893)|nuclear meiotic cohesin complex (GO:0034991)|nucleus (GO:0005634)				NS(1)|breast(1)|large_intestine(1)|lung(2)|skin(1)|stomach(1)	7						GCTGAGAAAAGGAAAGGCAAA	0.343																																																	0								ENSG00000244588						60.0	48.0	52.0					20																	1223278		692	1591	2283	RAD21L1	SO:0001583	missense	0			-	HGNC	AL031665	CCDS46568.1	20p13	2011-08-12			ENSG00000244588	ENSG00000244588			16271	protein-coding gene	gene with protein product							Standard	NM_001136566		Approved	dJ545L17.2, RAD21L	uc010gab.1	Q9H4I0	OTTHUMG00000031664	ENST00000409241.1:c.872G>A	20.37:g.1223278G>A	ENSP00000386414:p.Arg291Lys	Somatic	0	23	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	27	28.95	B2RXL0|B7ZBB1|B7ZW76|Q5W0X5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Rad21_Rec8_N,pfam_Rad21/Rec8_C_eu	p.R291K	ENST00000409241.1	37	c.872	CCDS46568.1	20	.	.	.	.	.	.	.	.	.	.	G	1.460	-0.562583	0.03939	.	.	ENSG00000244588	ENST00000402452;ENST00000409241;ENST00000381882	T;T;T	0.62498	0.02;0.02;0.02	4.77	2.82	0.32997	.	.	.	.	.	T	0.43299	0.1241	L	0.35542	1.07	0.28619	N	0.908256	B	0.09022	0.002	B	0.08055	0.003	T	0.31806	-0.9930	9	0.08179	T	0.78	.	6.048	0.19770	0.3558:0.0:0.6442:0.0	.	291	Q9H4I0	RD21L_HUMAN	K	291	ENSP00000385925:R291K;ENSP00000386414:R291K;ENSP00000371306:R291K	ENSP00000371306:R291K	R	+	2	0	RAD21L1	1171278	1.000000	0.71417	0.993000	0.49108	0.896000	0.52359	2.117000	0.41939	0.616000	0.30141	0.557000	0.71058	AGG	-	NULL		0.343	RAD21L1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	RAD21L1	protein_coding	OTTHUMT00000334022.1	G		-		1223278	+1	no_errors	ENST00000409241	ensembl	human	known	74_37	missense	SNP	0.999	A
GPATCH4	54865	genome.wustl.edu	37	1	156567689	156567689	+	Nonsense_Mutation	SNP	A	A	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr1:156567689A>T	ENST00000334588.7	-	4	518	c.333T>A	c.(331-333)tgT>tgA	p.C111*	GPATCH4_ENST00000497287.1_Intron|GPATCH4_ENST00000438976.2_Intron|GPATCH4_ENST00000368232.4_Intron			Q5T3I0	GPTC4_HUMAN	G patch domain containing 4	0							poly(A) RNA binding (GO:0044822)			autonomic_ganglia(1)|breast(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(2)|skin(3)|stomach(1)	17	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					TAAGTAAGCAACAGCAAGGCT	0.512																																																	0								ENSG00000160818																																			GPATCH4	SO:0001587	stop_gained	0			-	HGNC	BC056904	CCDS1146.1, CCDS44245.1	1q22	2013-01-28		2006-12-13	ENSG00000160818	ENSG00000160818		"""G patch domain containing"""	25982	protein-coding gene	gene with protein product				GPATC4		12477932	Standard	NM_015590		Approved	FLJ20249, DKFZP434F1735	uc001fpl.3	Q5T3I0	OTTHUMG00000033203	ENST00000334588.7:c.333T>A	1.37:g.156567689A>T	ENSP00000334793:p.Cys111*	Somatic	0	44	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	40	23.08	Q5T3I1|Q6ZUE7|Q8IWG8|Q9NXH4	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.C111*	ENST00000334588.7	37	c.333		1	.	.	.	.	.	.	.	.	.	.	A	16.72	3.201460	0.58234	.	.	ENSG00000160818	ENST00000334588	.	.	.	3.57	2.42	0.29668	.	.	.	.	.	.	.	.	.	.	.	0.43007	D	0.994539	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.0172	0.24895	0.7667:0.2333:0.0:0.0	.	.	.	.	X	111	.	ENSP00000334793:C111X	C	-	3	2	GPATCH4	154834313	0.001000	0.12720	0.025000	0.17156	0.097000	0.18754	0.508000	0.22692	0.717000	0.32145	0.460000	0.39030	TGT	-	NULL		0.512	GPATCH4-201	KNOWN	basic	protein_coding	GPATCH4	protein_coding		A	NM_017725	-		156567689	-1	no_errors	ENST00000334588	ensembl	human	known	74_37	nonsense	SNP	0.030	T
LAMA2	3908	genome.wustl.edu	37	6	129674347	129674347	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr6:129674347G>A	ENST00000421865.2	+	32	4611	c.4562G>A	c.(4561-4563)gGa>gAa	p.G1521E		NM_000426.3|NM_001079823.1	NP_000417|NP_001073291.1	P24043	LAMA2_HUMAN	laminin, alpha 2	1521	Laminin EGF-like 16. {ECO:0000255|PROSITE-ProRule:PRU00460}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|myelination in peripheral nervous system (GO:0022011)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|sarcolemma (GO:0042383)	structural molecule activity (GO:0005198)			NS(2)|biliary_tract(2)|breast(10)|central_nervous_system(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(35)|lung(84)|ovary(10)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(2)	194				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		GGCAACCCTGGAGGCTCCTGC	0.537																																																	0								ENSG00000196569						63.0	56.0	58.0					6																	129674347		2203	4300	6503	LAMA2	SO:0001583	missense	0			-	HGNC	Z26653	CCDS5138.1	6q22-q23	2014-09-17	2008-08-01		ENSG00000196569	ENSG00000196569		"""Laminins"""	6482	protein-coding gene	gene with protein product	"""merosin"", ""congenital muscular dystrophy"""	156225		LAMM		2185464, 8294519	Standard	NM_000426		Approved		uc003qbn.3	P24043	OTTHUMG00000015545	ENST00000421865.2:c.4562G>A	6.37:g.129674347G>A	ENSP00000400365:p.Gly1521Glu	Somatic	0	44	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	57	9.52	Q14736|Q5VUM2|Q93022	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Laminin_G,pfam_EGF_laminin,pfam_Laminin_N,pfam_Laminin_I,pfam_Laminin_B_type_IV,pfam_Laminin_II,superfamily_ConA-like_lec_gl_sf,superfamily_Galactose-bd-like,superfamily_t-SNARE,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N	p.G1521E	ENST00000421865.2	37	c.4562	CCDS5138.1	6	.	.	.	.	.	.	.	.	.	.	G	25.5	4.642590	0.87859	.	.	ENSG00000196569	ENST00000358023;ENST00000354729;ENST00000421865	T	0.61510	0.1	5.75	5.75	0.90469	EGF-like, laminin (4);	0.000000	0.85682	D	0.000000	D	0.82449	0.5039	H	0.95187	3.635	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.86384	0.1731	10	0.62326	D	0.03	.	19.9569	0.97222	0.0:0.0:1.0:0.0	.	1521;1521	A6NF00;P24043	.;LAMA2_HUMAN	E	1521	ENSP00000400365:G1521E	ENSP00000346769:G1521E	G	+	2	0	LAMA2	129716040	1.000000	0.71417	0.999000	0.59377	0.904000	0.53231	8.510000	0.90532	2.729000	0.93468	0.460000	0.39030	GGA	-	pfam_EGF_laminin,smart_EGF_laminin		0.537	LAMA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA2	protein_coding	OTTHUMT00000042180.1	G		-		129674347	+1	no_errors	ENST00000421865	ensembl	human	known	74_37	missense	SNP	1.000	A
OR4X2	119764	genome.wustl.edu	37	11	48266853	48266853	+	Silent	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr11:48266853C>T	ENST00000302329.3	+	1	246	c.198C>T	c.(196-198)tcC>tcT	p.S66S		NM_001004727.1	NP_001004727.1	Q8NGF9	OR4X2_HUMAN	olfactory receptor, family 4, subfamily X, member 2	66						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|large_intestine(4)|lung(12)|pancreas(1)|stomach(1)|upper_aerodigestive_tract(1)	20						TCTGCTACTCCTCCGCTACAG	0.502																																																	0								ENSG00000172208						149.0	142.0	145.0					11																	48266853		2201	4298	6499	OR4X2	SO:0001819	synonymous_variant	0			-	HGNC	AB065847	CCDS31486.1	11p11.2	2012-08-09			ENSG00000172208	ENSG00000172208		"""GPCR / Class A : Olfactory receptors"""	15184	protein-coding gene	gene with protein product							Standard	NM_001004727		Approved		uc001ngs.1	Q8NGF9	OTTHUMG00000165302	ENST00000302329.3:c.198C>T	11.37:g.48266853C>T		Somatic	0	67	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	78	14.29	B2RNK3|Q6IF73|Q96R63	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S66	ENST00000302329.3	37	c.198	CCDS31486.1	11																																																																																			-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.502	OR4X2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4X2	protein_coding	OTTHUMT00000383376.2	C	NM_001004727	-		48266853	+1	no_errors	ENST00000302329	ensembl	human	known	74_37	silent	SNP	0.741	T
CPAMD8	27151	genome.wustl.edu	37	19	17025498	17025498	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr19:17025498G>A	ENST00000443236.1	-	28	3927	c.3896C>T	c.(3895-3897)gCc>gTc	p.A1299V		NM_015692.2	NP_056507.2	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain containing 8	1252						extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(11)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(14)|ovary(7)|pancreas(2)|prostate(4)|skin(5)	82						CCTGCCCACGGCCAGGAAGGA	0.662																																																	0								ENSG00000160111						30.0	35.0	33.0					19																	17025498		1975	4171	6146	CPAMD8	SO:0001583	missense	0			-	HGNC	AY101765	CCDS42519.1	19p13.12	2008-02-05			ENSG00000160111	ENSG00000160111			23228	protein-coding gene	gene with protein product		608841				10574462	Standard	NM_015692		Approved	KIAA1283, VIP, K-CAP	uc002nfb.3	Q8IZJ3	OTTHUMG00000133549	ENST00000443236.1:c.3896C>T	19.37:g.17025498G>A	ENSP00000402505:p.Ala1299Val	Somatic	0	35	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	58	20.55	Q8NC09|Q9ULD7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_A2M_comp,pfam_A2M_N_2,pfam_Methyltransf_FA,pfam_Macroglobln_a2,pfam_A-macroglobulin_rcpt-bd,pfam_A2M_N,pfam_MacrogloblnA2_thiol-ester-bond,pfam_Kazal_dom,superfamily_Terpenoid_cyclase/PrenylTrfase,superfamily_A-macroglobulin_rcpt-bd,smart_Kazal_dom	p.A1299V	ENST00000443236.1	37	c.3896	CCDS42519.1	19	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.64|15.64	2.892564|2.892564	0.52121|0.52121	.|.	.|.	ENSG00000160111|ENSG00000160111	ENST00000291440|ENST00000443236	.|.	.|.	.|.	2.93|2.93	2.93|2.93	0.34026|0.34026	Terpenoid cylases/protein prenyltransferase alpha-alpha toroid (1);A-macroglobulin complement component (1);|.	0.000000|.	0.64402|.	U|.	0.000001|.	T|T	0.59729|0.59729	0.2215|0.2215	L|L	0.46614|0.46614	1.455|1.455	0.80722|0.80722	D|D	1|1	P|.	0.49090|.	0.919|.	P|.	0.50537|.	0.643|.	T|T	0.57785|0.57785	-0.7751|-0.7751	9|5	0.35671|.	T|.	0.21|.	.|.	13.7993|13.7993	0.63190|0.63190	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1252|.	Q8IZJ3|.	CPMD8_HUMAN|.	V|S	1299|1310	.|.	ENSP00000291440:A1299V|.	A|P	-|-	2|1	0|0	CPAMD8|CPAMD8	16886498|16886498	1.000000|1.000000	0.71417|0.71417	0.269000|0.269000	0.24586|0.24586	0.218000|0.218000	0.24690|0.24690	4.869000|4.869000	0.63028|0.63028	1.202000|1.202000	0.43218|0.43218	0.555000|0.555000	0.69702|0.69702	GCC|CCG	-	pfam_A2M_comp,superfamily_Terpenoid_cyclase/PrenylTrfase		0.662	CPAMD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPAMD8	protein_coding	OTTHUMT00000257531.2	G	NM_015692	-		17025498	-1	no_errors	ENST00000443236	ensembl	human	known	74_37	missense	SNP	0.995	A
ASPH	444	genome.wustl.edu	37	8	62415936	62415936	+	Silent	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr8:62415936G>A	ENST00000379454.4	-	25	2446	c.2259C>T	c.(2257-2259)cgC>cgT	p.R753R	ASPH_ENST00000541428.1_Silent_p.R724R	NM_004318.3	NP_004309.2	Q12797	ASPH_HUMAN	aspartate beta-hydroxylase	753					activation of cysteine-type endopeptidase activity (GO:0097202)|activation of store-operated calcium channel activity (GO:0032237)|calcium ion transmembrane transport (GO:0070588)|cellular response to calcium ion (GO:0071277)|detection of calcium ion (GO:0005513)|face morphogenesis (GO:0060325)|limb morphogenesis (GO:0035108)|muscle contraction (GO:0006936)|negative regulation of cell proliferation (GO:0008285)|palate development (GO:0060021)|pattern specification process (GO:0007389)|peptidyl-aspartic acid hydroxylation (GO:0042264)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of proteolysis (GO:0045862)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling (GO:0010649)|regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031585)|regulation of protein depolymerization (GO:1901879)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|response to ATP (GO:0033198)	calcium channel complex (GO:0034704)|cortical endoplasmic reticulum (GO:0032541)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|electron carrier activity (GO:0009055)|ion channel binding (GO:0044325)|peptide-aspartate beta-dioxygenase activity (GO:0004597)|structural constituent of muscle (GO:0008307)|structural molecule activity (GO:0005198)			breast(1)|cervix(1)|endometrium(5)|large_intestine(5)|lung(16)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35	Lung SC(2;0.153)	Lung NSC(129;0.0358)|all_lung(136;0.0654)|all_epithelial(80;0.101)			L-Aspartic Acid(DB00128)|Succinic acid(DB00139)	CTGGAAGGCTGCGTCTCTGCT	0.502																																																	0								ENSG00000198363						86.0	72.0	77.0					8																	62415936		2203	4300	6503	ASPH	SO:0001819	synonymous_variant	0			-	HGNC	AF224468	CCDS34898.1, CCDS34899.1, CCDS34900.1, CCDS43742.1, CCDS47866.1, CCDS55234.1, CCDS55235.1, CCDS55236.1, CCDS55237.1, CCDS55238.1, CCDS75746.1	8q12.1	2008-02-05			ENSG00000198363	ENSG00000198363	1.14.11.16		757	protein-coding gene	gene with protein product	"""junctin"", ""humbug"", ""junctate"""	600582				7821814, 10974562	Standard	NM_004318		Approved	CASQ2BP1, BAH, JCTN, HAAH	uc003xuj.3	Q12797	OTTHUMG00000164375	ENST00000379454.4:c.2259C>T	8.37:g.62415936G>A		Somatic	0	49	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	45	15.09	A6NDF4|A6NHI2|B4DIC9|B4E2K4|B7ZM95|E5RGP5|F5H667|Q6NXR7|Q8TB28|Q9H291|Q9H2C4|Q9NRI0|Q9NRI1|Q9Y4J0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Asp-B-hydro/Triadin_dom,pfam_Asp_Arg_b-Hydrxlase,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.R753	ENST00000379454.4	37	c.2259	CCDS34898.1	8																																																																																			-	NULL		0.502	ASPH-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ASPH	protein_coding	OTTHUMT00000378510.3	G	NM_004318	-		62415936	-1	no_errors	ENST00000379454	ensembl	human	known	74_37	silent	SNP	0.984	A
GPATCH4	54865	genome.wustl.edu	37	1	156567690	156567690	+	Missense_Mutation	SNP	C	C	T	rs148605371		TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr1:156567690C>T	ENST00000334588.7	-	4	517	c.332G>A	c.(331-333)tGt>tAt	p.C111Y	GPATCH4_ENST00000497287.1_Intron|GPATCH4_ENST00000438976.2_Intron|GPATCH4_ENST00000368232.4_Intron			Q5T3I0	GPTC4_HUMAN	G patch domain containing 4	0							poly(A) RNA binding (GO:0044822)			autonomic_ganglia(1)|breast(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(2)|skin(3)|stomach(1)	17	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					AAGTAAGCAACAGCAAGGCTG	0.512													C|||	1	0.000199681	0.0	0.0	5008	,	,		21197	0.001		0.0	False		,,,				2504	0.0																0								ENSG00000160818																																			GPATCH4	SO:0001583	missense	0			GMAF=0.0005	HGNC	BC056904	CCDS1146.1, CCDS44245.1	1q22	2013-01-28		2006-12-13	ENSG00000160818	ENSG00000160818		"""G patch domain containing"""	25982	protein-coding gene	gene with protein product				GPATC4		12477932	Standard	NM_015590		Approved	FLJ20249, DKFZP434F1735	uc001fpl.3	Q5T3I0	OTTHUMG00000033203	ENST00000334588.7:c.332G>A	1.37:g.156567690C>T	ENSP00000334793:p.Cys111Tyr	Somatic	0	44	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	40	23.08	Q5T3I1|Q6ZUE7|Q8IWG8|Q9NXH4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_G_patch_dom,smart_G_patch_dom,pfscan_G_patch_dom	p.V120I	ENST00000334588.7	37	c.358		1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	2.374	-0.343609	0.05243	.	.	ENSG00000160818	ENST00000334588	.	.	.	2.58	-2.97	0.05530	.	.	.	.	.	T	0.11110	0.0271	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.37596	-0.9699	5	0.87932	D	0	.	0.5423	0.00647	0.1791:0.2702:0.1765:0.3743	.	.	.	.	Y	111	.	ENSP00000334793:C111Y	C	-	2	0	GPATCH4	154834314	0.000000	0.05858	0.001000	0.08648	0.061000	0.15899	-1.866000	0.01647	-0.820000	0.04318	-0.444000	0.05651	TGT	-	NULL		0.512	GPATCH4-201	KNOWN	basic	protein_coding	GPATCH4	protein_coding		C	NM_017725	rs148605371		156567690	-1	no_errors	ENST00000474904	ensembl	human	known	74_37	missense	SNP	0.001	T
REG3A	5068	genome.wustl.edu	37	2	79385793	79385793	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr2:79385793G>A	ENST00000409839.3	-	3	215	c.179C>T	c.(178-180)tCc>tTc	p.S60F	AC011754.1_ENST00000415201.1_RNA|REG3A_ENST00000393878.1_Missense_Mutation_p.S60F|REG3A_ENST00000305165.2_Missense_Mutation_p.S60F	NM_002580.2|NM_138937.2	NP_002571.1|NP_620354.1	Q06141	REG3A_HUMAN	regenerating islet-derived 3 alpha	60	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				acute-phase response (GO:0006953)|cell proliferation (GO:0008283)|heterophilic cell-cell adhesion (GO:0007157)|multicellular organismal development (GO:0007275)|negative regulation of keratinocyte differentiation (GO:0045617)|positive regulation of keratinocyte proliferation (GO:0010838)|positive regulation of wound healing (GO:0090303)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	carbohydrate binding (GO:0030246)			breast(2)|large_intestine(4)|lung(41)|prostate(2)|skin(1)	50						ATCTGTCCAGGATTTTGGTGA	0.552																																																	0								ENSG00000172016						129.0	117.0	121.0					2																	79385793		2203	4300	6503	REG3A	SO:0001583	missense	0			-	HGNC	S51768	CCDS1965.1	2p12	2008-02-05	2005-02-11	2005-02-11	ENSG00000172016	ENSG00000172016			8601	protein-coding gene	gene with protein product		167805	"""pancreatitis-associated protein"""	PAP		8188210	Standard	NM_002580		Approved	HIP, REG-III, REG3, PBCGF, PAP1	uc002sof.2	Q06141	OTTHUMG00000130017	ENST00000409839.3:c.179C>T	2.37:g.79385793G>A	ENSP00000386630:p.Ser60Phe	Somatic	0	30	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	p.S60F	ENST00000409839.3	37	c.179	CCDS1965.1	2	.	.	.	.	.	.	.	.	.	.	G	13.05	2.120115	0.37436	.	.	ENSG00000172016	ENST00000409839;ENST00000393878;ENST00000305165	T;T;T	0.22539	1.95;1.95;1.95	4.02	1.15	0.20763	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.385935	0.22627	N	0.057623	T	0.46367	0.1389	M	0.93507	3.425	0.09310	N	1	D	0.60160	0.987	D	0.68192	0.956	T	0.37079	-0.9721	10	0.87932	D	0	.	2.624	0.04924	0.1046:0.1861:0.5173:0.192	.	60	Q06141	REG3A_HUMAN	F	60	ENSP00000386630:S60F;ENSP00000377456:S60F;ENSP00000304311:S60F	ENSP00000304311:S60F	S	-	2	0	REG3A	79239301	0.134000	0.22483	0.045000	0.18777	0.001000	0.01503	0.272000	0.18644	0.241000	0.21283	-0.249000	0.11873	TCC	-	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin		0.552	REG3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	REG3A	protein_coding	OTTHUMT00000252290.2	G	NM_002580	-		79385793	-1	no_errors	ENST00000305165	ensembl	human	known	74_37	missense	SNP	0.051	A
BAHD1	22893	genome.wustl.edu	37	15	40754377	40754377	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr15:40754377C>T	ENST00000416165.1	+	3	1770	c.1699C>T	c.(1699-1701)Cct>Tct	p.P567S	BAHD1_ENST00000560846.1_Missense_Mutation_p.P567S|RP11-64K12.8_ENST00000559730.1_RNA|BAHD1_ENST00000561234.1_Missense_Mutation_p.P566S	NM_014952.3	NP_055767.3	Q8TBE0	BAHD1_HUMAN	bromo adjacent homology domain containing 1	567	Arg-rich.				heterochromatin assembly (GO:0031507)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	chromatin silencing complex (GO:0005677)|chromosome (GO:0005694)	chromatin binding (GO:0003682)			NS(1)|endometrium(6)|kidney(3)|large_intestine(3)|lung(10)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	28		all_cancers(109;8.28e-19)|all_epithelial(112;2.64e-15)|Lung NSC(122;5.14e-11)|all_lung(180;1.27e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;3.46e-06)|BRCA - Breast invasive adenocarcinoma(123;0.08)		TGCCCGCAGGCCTAGCCACCC	0.677																																																	0								ENSG00000140320						46.0	49.0	48.0					15																	40754377		2200	4297	6497	BAHD1	SO:0001583	missense	0			-	HGNC	AL833923	CCDS10058.1, CCDS73705.1	15q14	2005-11-10			ENSG00000140320	ENSG00000140320			29153	protein-coding gene	gene with protein product		613880				10231032	Standard	XM_005254229		Approved	KIAA0945	uc001zlu.2	Q8TBE0	OTTHUMG00000129982	ENST00000416165.1:c.1699C>T	15.37:g.40754377C>T	ENSP00000396976:p.Pro567Ser	Somatic	0	47	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	58	9.38	Q8NDF7|Q9Y2F4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_BAH_dom,smart_BAH_dom,pfscan_BAH_dom	p.P567S	ENST00000416165.1	37	c.1699	CCDS10058.1	15	.	.	.	.	.	.	.	.	.	.	C	12.17	1.857696	0.32791	.	.	ENSG00000140320	ENST00000416165	T	0.17213	2.29	5.98	5.05	0.67936	.	0.204155	0.42821	D	0.000655	T	0.08802	0.0218	N	0.03608	-0.345	0.36819	D	0.886308	B;B;B	0.31548	0.328;0.22;0.328	B;B;B	0.34242	0.178;0.086;0.178	T	0.18085	-1.0348	10	0.07644	T	0.81	-9.2222	17.1988	0.86901	0.0:0.8738:0.1262:0.0	.	567;567;566	Q8TBE0-3;Q8TBE0;Q8TBE0-2	.;BAHD1_HUMAN;.	S	567	ENSP00000396976:P567S	ENSP00000396976:P567S	P	+	1	0	BAHD1	38541669	0.142000	0.22610	1.000000	0.80357	0.266000	0.26442	1.748000	0.38308	1.519000	0.48950	0.585000	0.79938	CCT	-	NULL		0.677	BAHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BAHD1	protein_coding	OTTHUMT00000252248.1	C	NM_014952	-		40754377	+1	no_errors	ENST00000416165	ensembl	human	known	74_37	missense	SNP	1.000	T
SLC13A1	6561	genome.wustl.edu	37	7	122774576	122774576	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr7:122774576G>A	ENST00000194130.2	-	8	859	c.820C>T	c.(820-822)Cct>Tct	p.P274S	SLC13A1_ENST00000539873.1_3'UTR	NM_022444.3	NP_071889.2	Q9BZW2	S13A1_HUMAN	solute carrier family 13 (sodium/sulfate symporter), member 1	274					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium:sulfate symporter activity (GO:0015382)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(20)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	45					Succinic acid(DB00139)	CGACAGTCAGGATAGCGTCTG	0.483																																																	0								ENSG00000081800						167.0	136.0	146.0					7																	122774576		2203	4300	6503	SLC13A1	SO:0001583	missense	0			-	HGNC		CCDS5786.1	7q31.32	2013-07-18	2013-07-18		ENSG00000081800	ENSG00000081800		"""Solute carriers"""	10916	protein-coding gene	gene with protein product		606193	"""solute carrier family 13 (sodium/sulphate symporters), member 1"""			11161786	Standard	NM_022444		Approved	NaSi-1, NAS1	uc003vkm.3	Q9BZW2	OTTHUMG00000157087	ENST00000194130.2:c.820C>T	7.37:g.122774576G>A	ENSP00000194130:p.Pro274Ser	Somatic	0	46	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	46	25.81	Q9H5Z0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Na/sul_symport,pfam_Cit_transptr-like_dom	p.P274S	ENST00000194130.2	37	c.820	CCDS5786.1	7	.	.	.	.	.	.	.	.	.	.	G	19.51	3.841172	0.71488	.	.	ENSG00000081800	ENST00000194130	T	0.02631	4.22	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	T	0.21387	0.0515	M	0.89785	3.06	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.00382	-1.1775	10	0.87932	D	0	-12.1307	17.7332	0.88384	0.0:0.0:1.0:0.0	.	274;274	A4D0X1;Q9BZW2	.;S13A1_HUMAN	S	274	ENSP00000194130:P274S	ENSP00000194130:P274S	P	-	1	0	SLC13A1	122561812	1.000000	0.71417	0.998000	0.56505	0.574000	0.36063	6.253000	0.72453	2.865000	0.98341	0.655000	0.94253	CCT	-	pfam_Na/sul_symport		0.483	SLC13A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC13A1	protein_coding	OTTHUMT00000347404.1	G	NM_022444	-		122774576	-1	no_errors	ENST00000194130	ensembl	human	known	74_37	missense	SNP	1.000	A
LINC01121	400952	genome.wustl.edu	37	2	45416340	45416340	+	RNA	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr2:45416340C>T	ENST00000378479.1	-	0	671					NR_033831.1																						TTTTGCTTGTCTCTCCATCAC	0.453																																																	0								ENSG00000205054																																			AC009236.1			0			-	Clone_based_vega_gene																													2.37:g.45416340C>T		Somatic	0	45	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	73	13.10		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000378479.1	37	NULL		2																																																																																			-	-		0.453	AC009236.1-001	KNOWN	mRNA_end_NF|basic|exp_conf	lincRNA	UNQ6975	processed_transcript	OTTHUMT00000326236.1	C		-		45416340	-1	no_errors	ENST00000378479	ensembl	human	known	74_37	rna	SNP	0.000	T
PGAP1	80055	genome.wustl.edu	37	2	197750179	197750179	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr2:197750179G>A	ENST00000354764.4	-	12	1355	c.1241C>T	c.(1240-1242)tCa>tTa	p.S414L	PGAP1_ENST00000409475.1_Missense_Mutation_p.S414L|PGAP1_ENST00000409188.1_3'UTR	NM_024989.3	NP_079265.2	Q75T13	PGAP1_HUMAN	post-GPI attachment to proteins 1	414					anterior/posterior axis specification (GO:0009948)|attachment of GPI anchor to protein (GO:0016255)|C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|embryonic pattern specification (GO:0009880)|forebrain regionalization (GO:0021871)|head development (GO:0060322)|intracellular protein transport (GO:0006886)|myo-inositol transport (GO:0015798)|post-translational protein modification (GO:0043687)|sensory perception of sound (GO:0007605)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	nuclease activity (GO:0004518)|phosphoric ester hydrolase activity (GO:0042578)			breast(4)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(9)|lung(11)|ovary(6)|stomach(1)|urinary_tract(1)	40						AGCTTTCCATGATAAATCAAC	0.264																																																	0								ENSG00000197121						57.0	65.0	63.0					2																	197750179		2197	4292	6489	PGAP1	SO:0001583	missense	0			-	HGNC		CCDS2318.1	2q33.1	2014-03-03			ENSG00000197121	ENSG00000197121			25712	protein-coding gene	gene with protein product	"""GPI inositol-deacylase"""	611655				14734546, 17711852, 24482476	Standard	XM_005246866		Approved	FLJ12377, Bst1, SPG67	uc002utw.3	Q75T13	OTTHUMG00000132743	ENST00000354764.4:c.1241C>T	2.37:g.197750179G>A	ENSP00000346809:p.Ser414Leu	Somatic	0	100	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	102	14.88	Q4G0R8|Q4ZG47|Q53SM0|Q6AW92|Q6UWV4|Q9HA24	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PGAP1-like	p.S414L	ENST00000354764.4	37	c.1241	CCDS2318.1	2	.	.	.	.	.	.	.	.	.	.	G	26.4	4.732167	0.89390	.	.	ENSG00000197121	ENST00000422382;ENST00000354764;ENST00000409475	.	.	.	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.63510	0.2517	L	0.27053	0.805	0.80722	D	1	D;D	0.63046	0.992;0.981	P;D	0.69824	0.755;0.966	T	0.64334	-0.6432	9	0.52906	T	0.07	-16.0594	14.225	0.65853	0.0:0.0:1.0:0.0	.	414;414	Q75T13-3;Q75T13	.;PGAP1_HUMAN	L	194;414;414	.	ENSP00000346809:S414L	S	-	2	0	PGAP1	197458424	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.318000	0.65829	2.732000	0.93576	0.591000	0.81541	TCA	-	NULL		0.264	PGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PGAP1	protein_coding	OTTHUMT00000256103.5	G	NM_024989	-		197750179	-1	no_errors	ENST00000354764	ensembl	human	known	74_37	missense	SNP	1.000	A
CREB3L1	90993	genome.wustl.edu	37	11	46333926	46333926	+	Silent	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr11:46333926G>A	ENST00000529193.1	+	6	1255	c.804G>A	c.(802-804)cgG>cgA	p.R268R	CREB3L1_ENST00000288400.3_Silent_p.R268R			Q96BA8	CR3L1_HUMAN	cAMP responsive element binding protein 3-like 1	268					regulation of bone mineralization (GO:0030500)|response to unfolded protein (GO:0006986)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)		FUS/CREB3L1(6)	NS(2)|breast(1)|large_intestine(4)|lung(2)|ovary(3)	12				GBM - Glioblastoma multiforme(35;0.0285)		AGGAGAAGCGGACCCTGATTG	0.547			T	FUS	myxofibrosarcoma																																Pancreas(3;159 194 19597 26278 47995)			Dom	yes		11	11p11.2	90993	cAMP responsive element binding protein 3-like 1		M	0								ENSG00000157613						34.0	38.0	37.0					11																	46333926		2154	4285	6439	CREB3L1	SO:0001819	synonymous_variant	0			-	HGNC		CCDS53620.1	11q11	2013-01-10				ENSG00000157613		"""basic leucine zipper proteins"""	18856	protein-coding gene	gene with protein product	"""BBF-2 homolog (drosophila)"""						Standard	NM_052854		Approved	OASIS	uc021qil.1	Q96BA8		ENST00000529193.1:c.804G>A	11.37:g.46333926G>A		Somatic	0	38	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	39	18.75	Q8N2D5|Q96CP0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_bZIP,superfamily_TF_DNA-bd,smart_bZIP,pfscan_bZIP,prints_Leuzip_CREB	p.R268	ENST00000529193.1	37	c.804	CCDS53620.1	11																																																																																			-	superfamily_TF_DNA-bd		0.547	CREB3L1-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_principal|CCDS	protein_coding	CREB3L1	protein_coding	OTTHUMT00000389702.1	G	NM_052854	-		46333926	+1	no_errors	ENST00000288400	ensembl	human	known	74_37	silent	SNP	0.030	A
NID1	4811	genome.wustl.edu	37	1	236201485	236201485	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr1:236201485C>T	ENST00000264187.6	-	5	1286	c.1204G>A	c.(1204-1206)Gag>Aag	p.E402K	NID1_ENST00000366595.3_Missense_Mutation_p.E402K	NM_002508.2	NP_002499.2	P14543	NID1_HUMAN	nidogen 1	402	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.				basement membrane organization (GO:0071711)|cell-matrix adhesion (GO:0007160)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)|positive regulation of cell-substrate adhesion (GO:0010811)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|cell periphery (GO:0071944)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|laminin binding (GO:0043236)|proteoglycan binding (GO:0043394)			breast(4)|endometrium(9)|kidney(1)|large_intestine(23)|lung(20)|pancreas(1)|prostate(4)|skin(3)|urinary_tract(1)	66	Ovarian(103;0.0544)|Breast(184;0.23)	all_cancers(173;0.00491)|Prostate(94;0.184)|Acute lymphoblastic leukemia(190;0.229)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)		Urokinase(DB00013)	TCCCTGCACTCTGCGTGCACC	0.517																																																	0								ENSG00000116962						124.0	115.0	118.0					1																	236201485		2203	4300	6503	NID1	SO:0001583	missense	0			-	HGNC	BC045606	CCDS1608.1	1q43	2011-05-08	2005-06-02	2005-06-02	ENSG00000116962	ENSG00000116962			7821	protein-coding gene	gene with protein product		131390	"""nidogen (enactin)"""	NID		2471408, 7557988	Standard	NM_002508		Approved	entactin	uc001hxo.3	P14543	OTTHUMG00000040071	ENST00000264187.6:c.1204G>A	1.37:g.236201485C>T	ENSP00000264187:p.Glu402Lys	Somatic	0	41	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	45	11.76	Q14942|Q59FL2|Q5TAF2|Q5TAF3|Q86XD7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_G2_nidogen/fibulin_G2F,pfam_LDLR_classB_rpt,pfam_Nidogen_extracell_dom,pfam_Thyroglobulin_1,pfam_EGF-like_Ca-bd_dom,superfamily_GFP,superfamily_Thyroglobulin_1,smart_Nidogen_extracell_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_G2_nidogen/fibulin_G2F,smart_Thyroglobulin_1,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDLR_classB_rpt,pfscan_G2_nidogen/fibulin_G2F,pfscan_Thyroglobulin_1	p.E402K	ENST00000264187.6	37	c.1204	CCDS1608.1	1	.	.	.	.	.	.	.	.	.	.	C	16.09	3.025600	0.54683	.	.	ENSG00000116962	ENST00000264187;ENST00000366595	D;D	0.87103	-2.21;-2.21	5.52	4.58	0.56647	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.316268	0.38837	N	0.001556	T	0.69214	0.3086	N	0.16833	0.445	0.28472	N	0.91539	B;P	0.42871	0.444;0.792	B;B	0.31614	0.044;0.133	T	0.64411	-0.6414	10	0.29301	T	0.29	.	5.5286	0.16972	0.1446:0.635:0.1402:0.0801	.	402;402	P14543-2;P14543	.;NID1_HUMAN	K	402	ENSP00000264187:E402K;ENSP00000355554:E402K	ENSP00000264187:E402K	E	-	1	0	NID1	234268108	0.911000	0.30947	0.951000	0.38953	0.963000	0.63663	1.835000	0.39181	2.602000	0.87976	0.650000	0.86243	GAG	-	smart_EGF-like_Ca-bd_dom,smart_EG-like_dom		0.517	NID1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NID1	protein_coding	OTTHUMT00000096647.2	C	NM_002508	-		236201485	-1	no_errors	ENST00000264187	ensembl	human	known	74_37	missense	SNP	0.951	T
CA2	760	genome.wustl.edu	37	8	86392944	86392944	+	Missense_Mutation	SNP	G	G	A	rs143666045		TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr8:86392944G>A	ENST00000285379.5	+	7	939	c.709G>A	c.(709-711)Gaa>Aaa	p.E237K		NM_000067.2	NP_000058.1	P00918	CAH2_HUMAN	carbonic anhydrase II	237					angiotensin-activated signaling pathway (GO:0038166)|bicarbonate transport (GO:0015701)|kidney development (GO:0001822)|morphogenesis of an epithelium (GO:0002009)|odontogenesis of dentin-containing tooth (GO:0042475)|one-carbon metabolic process (GO:0006730)|positive regulation of bone resorption (GO:0045780)|positive regulation of cellular pH reduction (GO:0032849)|positive regulation of dipeptide transmembrane transport (GO:2001150)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|regulation of anion transport (GO:0044070)|regulation of chloride transport (GO:2001225)|regulation of intracellular pH (GO:0051453)|response to estrogen (GO:0043627)|response to pH (GO:0009268)|response to zinc ion (GO:0010043)|secretion (GO:0046903)|small molecule metabolic process (GO:0044281)	apical part of cell (GO:0045177)|axon (GO:0030424)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|microvillus (GO:0005902)|myelin sheath (GO:0043209)|plasma membrane (GO:0005886)	carbonate dehydratase activity (GO:0004089)|zinc ion binding (GO:0008270)			central_nervous_system(2)|cervix(1)|large_intestine(2)|lung(5)|prostate(1)	11					Acetazolamide(DB00819)|Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Brinzolamide(DB01194)|Chlorothiazide(DB00880)|Cyclothiazide(DB00606)|Diazoxide(DB01119)|Diclofenamide(DB01144)|Dorzolamide(DB00869)|Ethinamate(DB01031)|Furosemide(DB00695)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Methazolamide(DB00703)|Methyclothiazide(DB00232)|Quinethazone(DB01325)|Topiramate(DB00273)|Trichlormethiazide(DB01021)|Zonisamide(DB00909)	GGGTGAACCCGAAGAACTGAT	0.398																																																	0								ENSG00000104267	G	LYS/GLU	0,4406		0,0,2203	101.0	94.0	96.0		709	3.8	0.1	8	dbSNP_134	96	1,8599	1.2+/-3.3	0,1,4299	yes	missense	CA2	NM_000067.2	56	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	237/261	86392944	1,13005	2203	4300	6503	CA2	SO:0001583	missense	0			-	HGNC	J03037	CCDS6239.1	8q21.2	2012-10-02			ENSG00000104267	ENSG00000104267	4.2.1.1	"""Carbonic anhydrases"""	1373	protein-coding gene	gene with protein product		611492				3107918	Standard	NM_000067		Approved	Car2, CA-II, CAII	uc003ydk.2	P00918	OTTHUMG00000164944	ENST00000285379.5:c.709G>A	8.37:g.86392944G>A	ENSP00000285379:p.Glu237Lys	Somatic	0	41	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	56	22.22	B2R7G8|Q6FI12|Q96ET9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Carbonic_anhydrase_a,superfamily_Carbonic_anhydrase_a,pfscan_Carbonic_anhydrase_a	p.E237K	ENST00000285379.5	37	c.709	CCDS6239.1	8	.	.	.	.	.	.	.	.	.	.	G	23.2	4.386703	0.82902	0.0	1.16E-4	ENSG00000104267	ENST00000285379	D	0.84070	-1.8	5.85	3.84	0.44239	Carbonic anhydrase, alpha-class, catalytic domain (4);	0.365842	0.26045	N	0.026667	T	0.69187	0.3083	L	0.38175	1.15	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.46345	-0.9198	10	0.13108	T	0.6	-0.0349	5.777	0.18285	0.0737:0.1377:0.646:0.1426	.	237	P00918	CAH2_HUMAN	K	237	ENSP00000285379:E237K	ENSP00000285379:E237K	E	+	1	0	CA2	86580196	0.000000	0.05858	0.121000	0.21740	0.881000	0.50899	0.711000	0.25764	2.753000	0.94483	0.655000	0.94253	GAA	-	pfam_Carbonic_anhydrase_a,superfamily_Carbonic_anhydrase_a,pfscan_Carbonic_anhydrase_a		0.398	CA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CA2	protein_coding	OTTHUMT00000381097.2	G	NM_000067	rs143666045		86392944	+1	no_errors	ENST00000285379	ensembl	human	known	74_37	missense	SNP	0.003	A
ELTD1	64123	genome.wustl.edu	37	1	79392644	79392644	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr1:79392644G>A	ENST00000370742.3	-	8	1073	c.1010C>T	c.(1009-1011)tCa>tTa	p.S337L		NM_022159.3	NP_071442.2	Q9HBW9	ELTD1_HUMAN	EGF, latrophilin and seven transmembrane domain containing 1	337					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(45)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	69				COAD - Colon adenocarcinoma(225;0.0905)|Colorectal(170;0.103)|all cancers(265;0.105)|Epithelial(280;0.148)		CATTGAGACTGAAATTACTGA	0.333																																																	0								ENSG00000162618						127.0	116.0	119.0					1																	79392644		1831	4086	5917	ELTD1	SO:0001583	missense	0			-	HGNC	AF192403	CCDS41352.1	1p33-p32	2014-08-08			ENSG00000162618	ENSG00000162618		"""-"", ""GPCR / Class B : Orphans"""	20822	protein-coding gene	gene with protein product						11050079	Standard	NM_022159		Approved	ETL	uc001diq.4	Q9HBW9	OTTHUMG00000009738	ENST00000370742.3:c.1010C>T	1.37:g.79392644G>A	ENSP00000359778:p.Ser337Leu	Somatic	0	42	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	44	20.00	B1AR71|Q5KU34	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_2_secretin-like,pfam_DUF3497,pfam_GPS_dom,pfam_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_GPS_dom,pfscan_EG-like_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	p.S337L	ENST00000370742.3	37	c.1010	CCDS41352.1	1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.194743	0.78902	.	.	ENSG00000162618	ENST00000370742	T	0.11604	2.76	6.02	6.02	0.97574	Domain of unknown function DUF3497 (1);	0.049908	0.85682	D	0.000000	T	0.16300	0.0392	L	0.47716	1.5	0.43531	D	0.995817	P	0.46578	0.88	P	0.56088	0.791	T	0.00465	-1.1723	9	.	.	.	.	20.5345	0.99232	0.0:0.0:1.0:0.0	.	337	Q9HBW9	ELTD1_HUMAN	L	337	ENSP00000359778:S337L	.	S	-	2	0	ELTD1	79165232	1.000000	0.71417	0.998000	0.56505	0.535000	0.34838	6.665000	0.74442	2.859000	0.98148	0.544000	0.68410	TCA	-	pfam_DUF3497		0.333	ELTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELTD1	protein_coding	OTTHUMT00000026859.1	G	NM_022159	-		79392644	-1	no_errors	ENST00000370742	ensembl	human	known	74_37	missense	SNP	1.000	A
COL6A3	1293	genome.wustl.edu	37	2	238280646	238280646	+	Silent	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr2:238280646C>T	ENST00000295550.4	-	9	4466	c.4014G>A	c.(4012-4014)caG>caA	p.Q1338Q	COL6A3_ENST00000392004.3_Silent_p.Q1132Q|COL6A3_ENST00000472056.1_Silent_p.Q731Q|COL6A3_ENST00000346358.4_Silent_p.Q1138Q|COL6A3_ENST00000347401.3_Silent_p.Q1137Q|COL6A3_ENST00000392003.2_Silent_p.Q931Q|COL6A3_ENST00000409809.1_Silent_p.Q1132Q|COL6A3_ENST00000353578.4_Silent_p.Q1132Q	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	1338	Nonhelical region.|VWFA 7. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		GGACCAGGAACTGCGGGACGC	0.617																																																	0								ENSG00000163359						36.0	33.0	34.0					2																	238280646		2203	4300	6503	COL6A3	SO:0001819	synonymous_variant	0			-	HGNC	X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.4014G>A	2.37:g.238280646C>T		Somatic	0	26	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	23	20.69	A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_VWF_A,pfam_Collagen,pfam_Prot_inh_Kunz-m,superfamily_Prot_inh_Kunz-m,superfamily_Fibronectin_type3,smart_VWF_A,smart_Prot_inh_Kunz-m,pfscan_Fibronectin_type3,pfscan_VWF_A,pfscan_Prot_inh_Kunz-m,prints_Prot_inh_Kunz-m	p.Q1338	ENST00000295550.4	37	c.4014	CCDS33412.1	2																																																																																			-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A		0.617	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL6A3	protein_coding	OTTHUMT00000315790.2	C	NM_004369	-		238280646	-1	no_errors	ENST00000295550	ensembl	human	known	74_37	silent	SNP	1.000	T
ZDHHC23	254887	genome.wustl.edu	37	3	113675255	113675255	+	Silent	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr3:113675255C>T	ENST00000330212.3	+	4	1241	c.942C>T	c.(940-942)acC>acT	p.T314T	ZDHHC23_ENST00000498275.1_Silent_p.T308T	NM_173570.3	NP_775841.2	Q8IYP9	ZDH23_HUMAN	zinc finger, DHHC-type containing 23	314					protein localization to plasma membrane (GO:0072659)|protein palmitoylation (GO:0018345)	integral component of membrane (GO:0016021)	protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(2)|urinary_tract(2)	16						TCTTGCTCACCTCGGTGTATG	0.393																																																	0								ENSG00000184307						219.0	207.0	211.0					3																	113675255		2203	4300	6503	ZDHHC23	SO:0001819	synonymous_variant	0			-	HGNC	AK127025	CCDS33827.1	3q13.31	2008-05-02			ENSG00000184307	ENSG00000184307		"""Zinc fingers, DHHC-type"""	28654	protein-coding gene	gene with protein product						12477932	Standard	NM_173570		Approved	MGC42530	uc003eau.3	Q8IYP9	OTTHUMG00000159335	ENST00000330212.3:c.942C>T	3.37:g.113675255C>T		Somatic	0	46	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	51	22.73	D3DN76	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_DHHC_palmitoyltrfase,pfscan_Znf_DHHC_palmitoyltrfase	p.T314	ENST00000330212.3	37	c.942	CCDS33827.1	3																																																																																			-	NULL		0.393	ZDHHC23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZDHHC23	protein_coding	OTTHUMT00000354702.1	C	NM_173570	-		113675255	+1	no_errors	ENST00000478793	ensembl	human	known	74_37	silent	SNP	1.000	T
ZNF536	9745	genome.wustl.edu	37	19	31039417	31039417	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr19:31039417C>T	ENST00000355537.3	+	4	3038	c.2891C>T	c.(2890-2892)tCc>tTc	p.S964F		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	964					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)			NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					GGCAAGTCCTCCCAGAGGAAG	0.582																																																	0								ENSG00000198597						97.0	106.0	103.0					19																	31039417		2203	4300	6503	ZNF536	SO:0001583	missense	0			-	HGNC		CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.2891C>T	19.37:g.31039417C>T	ENSP00000347730:p.Ser964Phe	Somatic	0	37	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	35	22.22	A2RU18	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S964F	ENST00000355537.3	37	c.2891	CCDS32984.1	19	.	.	.	.	.	.	.	.	.	.	C	1.987	-0.432635	0.04669	.	.	ENSG00000198597	ENST00000355537	T	0.09255	3.0	5.78	2.52	0.30459	.	0.700532	0.15160	N	0.277184	T	0.07954	0.0199	L	0.27053	0.805	0.09310	N	0.999998	B;B	0.21225	0.053;0.053	B;B	0.18263	0.021;0.021	T	0.29882	-0.9997	10	0.49607	T	0.09	-5.8649	8.3396	0.32235	0.0:0.7312:0.1289:0.1399	.	964;964	A7E228;O15090	.;ZN536_HUMAN	F	964	ENSP00000347730:S964F	ENSP00000347730:S964F	S	+	2	0	ZNF536	35731257	0.870000	0.30015	0.056000	0.19401	0.688000	0.40055	1.383000	0.34385	0.374000	0.24650	0.561000	0.74099	TCC	-	NULL		0.582	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF536	protein_coding	OTTHUMT00000459667.2	C	NM_014717	-		31039417	+1	no_errors	ENST00000355537	ensembl	human	known	74_37	missense	SNP	0.234	T
PTBP3	9991	genome.wustl.edu	37	9	115038213	115038213	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr9:115038213G>A	ENST00000374255.2	-	4	346	c.199C>T	c.(199-201)Cca>Tca	p.P67S	PTBP3_ENST00000374257.1_Missense_Mutation_p.P39S|PTBP3_ENST00000487997.1_Intron|PTBP3_ENST00000334318.6_Missense_Mutation_p.P70S|PTBP3_ENST00000458258.1_Missense_Mutation_p.P73S|PTBP3_ENST00000343327.2_Intron			O95758	PTBP3_HUMAN	polypyrimidine tract binding protein 3	67	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				anatomical structure morphogenesis (GO:0009653)|erythrocyte maturation (GO:0043249)|mRNA processing (GO:0006397)|negative regulation of RNA splicing (GO:0033119)|regulation of cell differentiation (GO:0045595)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)										ACATCACATGGAATTTTTCGA	0.373																																																	0								ENSG00000119314						122.0	115.0	117.0					9																	115038213		2203	4300	6503	PTBP3	SO:0001583	missense	0			-	HGNC	AB023967	CCDS6784.1, CCDS55332.1, CCDS55333.1, CCDS59140.1, CCDS59141.1	9q32	2013-07-16	2011-11-16	2011-11-16	ENSG00000119314	ENSG00000119314		"""RNA binding motif (RRM) containing"""	10253	protein-coding gene	gene with protein product		607527	"""regulator of differentiation (in S. pombe) 1"", ""ROD1 regulator of differentiation 1 (S. pombe)"""	ROD1		10207106	Standard	NM_005156		Approved	DKFZp781I1117	uc004bfx.3	O95758	OTTHUMG00000020503	ENST00000374255.2:c.199C>T	9.37:g.115038213G>A	ENSP00000363373:p.Pro67Ser	Somatic	0	64	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	30	69	30.30	B1ALY2|B1ALY3|B1ALY5|B1ALY6|B3KME7|Q68DB9|Q86YB3|Q86YH9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,tigrfam_HnRNP-L_PTB	p.P73S	ENST00000374255.2	37	c.217	CCDS6784.1	9	.	.	.	.	.	.	.	.	.	.	G	34	5.353051	0.95830	.	.	ENSG00000119314	ENST00000374257;ENST00000334318;ENST00000458258;ENST00000374255;ENST00000210227;ENST00000450374	T;T;T;T;T	0.79554	-1.28;-1.28;-1.28;-1.28;-1.28	5.51	5.51	0.81932	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (2);	0.000000	0.85682	D	0.000000	D	0.91952	0.7451	M	0.90759	3.145	0.80722	D	1	P;D;D;D;D	0.89917	0.947;0.997;1.0;0.999;0.999	P;D;D;D;D	0.87578	0.656;0.985;0.998;0.993;0.977	D	0.92882	0.6324	10	0.62326	D	0.03	-4.0889	19.3944	0.94601	0.0:0.0:1.0:0.0	.	39;39;70;67;73	B1ALY5;O95758-2;O95758-5;O95758;O95758-4	.;.;.;ROD1_HUMAN;.	S	39;70;73;67;73;70	ENSP00000363375:P39S;ENSP00000334499:P70S;ENSP00000414921:P73S;ENSP00000363373:P67S;ENSP00000210227:P73S	ENSP00000210227:P73S	P	-	1	0	ROD1	114078034	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.444000	0.97578	2.574000	0.86865	0.591000	0.81541	CCA	-	smart_RRM_dom,pfscan_RRM_dom,tigrfam_HnRNP-L_PTB		0.373	PTBP3-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTBP3	protein_coding	OTTHUMT00000053679.1	G		-		115038213	-1	no_errors	ENST00000458258	ensembl	human	known	74_37	missense	SNP	1.000	A
PTPRU	10076	genome.wustl.edu	37	1	29611337	29611337	+	Silent	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr1:29611337C>T	ENST00000345512.3	+	14	2403	c.2274C>T	c.(2272-2274)gtC>gtT	p.V758V	PTPRU_ENST00000373779.3_Silent_p.V758V|PTPRU_ENST00000415600.2_3'UTR|PTPRU_ENST00000323874.8_Silent_p.V758V|PTPRU_ENST00000428026.2_Silent_p.V758V|PTPRU_ENST00000356870.3_Silent_p.V758V|PTPRU_ENST00000460170.2_Silent_p.V758V	NM_005704.4	NP_005695.3	Q92729	PTPRU_HUMAN	protein tyrosine phosphatase, receptor type, U	758					canonical Wnt signaling pathway (GO:0060070)|cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|homotypic cell-cell adhesion (GO:0034109)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|organ regeneration (GO:0031100)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|protein localization to cell surface (GO:0034394)|response to glucocorticoid (GO:0051384)|single organismal cell-cell adhesion (GO:0016337)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cell-cell junction (GO:0005911)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(4)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(26)|ovary(1)|prostate(3)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	79		Colorectal(325;0.000399)|Lung NSC(340;0.00953)|all_lung(284;0.0112)|Breast(348;0.0126)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;6.99e-07)|COAD - Colon adenocarcinoma(152;3.18e-05)|STAD - Stomach adenocarcinoma(196;0.0234)|READ - Rectum adenocarcinoma(331;0.0686)|BRCA - Breast invasive adenocarcinoma(304;0.0871)		GGCTTGCTGTCCTCATCCTTC	0.617																																																	0								ENSG00000060656						97.0	85.0	89.0					1																	29611337		2203	4300	6503	PTPRU	SO:0001819	synonymous_variant	0			-	HGNC	U71075	CCDS334.1, CCDS335.1, CCDS44098.1, CCDS44098.2, CCDS53290.1	1p35.3	2013-02-11			ENSG00000060656	ENSG00000060656		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9683	protein-coding gene	gene with protein product	"""pi R-PTP-Psi"""	602454				8700514, 9434160	Standard	NM_133178		Approved	PTPRO, hPTP-J, PCP-2, FMI, PTP	uc001bru.3	Q92729	OTTHUMG00000003699	ENST00000345512.3:c.2274C>T	1.37:g.29611337C>T		Somatic	0	66	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	64	13.51	A6H8L1|O00197|P78399|Q59HA4|Q5SYU4|Q5SYU5|Q92735|Q92850	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_MAM_dom,pfam_Fibronectin_type3,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_MAM_dom,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_MAM_dom,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt,prints_MAM_dom	p.V758	ENST00000345512.3	37	c.2274	CCDS334.1	1																																																																																			-	NULL		0.617	PTPRU-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRU	protein_coding	OTTHUMT00000010447.1	C		-		29611337	+1	no_errors	ENST00000345512	ensembl	human	known	74_37	silent	SNP	0.997	T
ATM	472	genome.wustl.edu	37	11	108159767	108159767	+	Silent	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr11:108159767C>T	ENST00000452508.2	+	29	4362	c.4173C>T	c.(4171-4173)gcC>gcT	p.A1391A	ATM_ENST00000278616.4_Silent_p.A1391A			Q13315	ATM_HUMAN	ATM serine/threonine kinase	1391					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)	p.Y1392fs*7(1)		NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	CAACATTTGCCTATATCAGCA	0.338			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																													yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	1	Insertion - Frameshift(1)	haematopoietic_and_lymphoid_tissue(1)						ENSG00000149311						88.0	85.0	86.0					11																	108159767		2201	4297	6498	ATM	SO:0001819	synonymous_variant	0	Familial Cancer Database	AT, Louis-Bar syndrome	-	HGNC	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.4173C>T	11.37:g.108159767C>T		Somatic	0	62	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	88	21.43	B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,pfam_TAN,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.A1391	ENST00000452508.2	37	c.4173	CCDS31669.1	11	.	.	.	.	.	.	.	.	.	.	C	10.06	1.248095	0.22880	.	.	ENSG00000149311	ENST00000531525	.	.	.	5.36	0.638	0.17742	.	.	.	.	.	T	0.53384	0.1793	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.42965	-0.9420	4	.	.	.	.	6.7175	0.23312	0.0:0.5471:0.1308:0.3222	.	.	.	.	L	61	.	.	P	+	2	0	ATM	107664977	0.748000	0.28294	1.000000	0.80357	0.998000	0.95712	-0.109000	0.10840	0.213000	0.20722	0.650000	0.86243	CCT	-	superfamily_ARM-type_fold		0.338	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ATM	protein_coding	OTTHUMT00000389938.1	C	NM_000051	-		108159767	+1	no_errors	ENST00000278616	ensembl	human	known	74_37	silent	SNP	0.994	T
CST1	1469	genome.wustl.edu	37	20	23728456	23728456	+	Silent	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr20:23728456G>A	ENST00000304749.2	-	3	493	c.423C>T	c.(421-423)tcC>tcT	p.S141S	CST1_ENST00000398402.1_Silent_p.S141S	NM_001898.2	NP_001889.2	P01037	CYTN_HUMAN	cystatin SN	141					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|negative regulation of endopeptidase activity (GO:0010951)	extracellular space (GO:0005615)	cysteine-type endopeptidase inhibitor activity (GO:0004869)	p.S141*(1)|p.S141S(1)		kidney(1)|large_intestine(1)|lung(8)|ovary(1)|stomach(1)|urinary_tract(1)	13	Lung NSC(19;0.0676)|all_lung(19;0.148)					CAGATCCCTAGGATTCTTGAC	0.587																																																	2	Substitution - Nonsense(1)|Substitution - coding silent(1)	lung(2)						ENSG00000170373						103.0	88.0	93.0					20																	23728456		2203	4300	6503	CST1	SO:0001819	synonymous_variant	0			-	HGNC	M19169	CCDS13160.1	20p11.2	2008-04-15			ENSG00000170373	ENSG00000170373			2473	protein-coding gene	gene with protein product		123855					Standard	NM_001898		Approved		uc002wtp.3	P01037	OTTHUMG00000032085	ENST00000304749.2:c.423C>T	20.37:g.23728456G>A		Somatic	0	62	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	69	13.75	Q96LE6|Q9UCQ6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_inh_cystat,smart_Prot_inh_cystat	p.S141	ENST00000304749.2	37	c.423	CCDS13160.1	20																																																																																			-	NULL		0.587	CST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CST1	protein_coding	OTTHUMT00000078351.2	G	NM_001898	-		23728456	-1	no_errors	ENST00000304749	ensembl	human	known	74_37	silent	SNP	0.000	A
TBC1D3P2	440452	genome.wustl.edu	37	17	60352924	60352924	+	Intron	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr17:60352924C>T	ENST00000602932.1	-	2	214				TBC1D3P2_ENST00000581291.1_RNA																							GATGAATCAGCTGGCCTGGGT	0.592																																																	0								ENSG00000188755																																			TBC1D3P2	SO:0001627	intron_variant	0			-	HGNC																												ENST00000602932.1:c.184-1447G>A	17.37:g.60352924C>T		Somatic	0	90	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	111	15.27		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000602932.1	37	NULL		17																																																																																			-	-		0.592	RP11-51L5.7-001	KNOWN	basic|appris_principal|readthrough_transcript	nonsense_mediated_decay	TBC1D3P2	protein_coding	OTTHUMT00000467667.1	C		-		60352924	-1	no_errors	ENST00000339120	ensembl	human	known	74_37	rna	SNP	0.162	T
TMEM132C	92293	genome.wustl.edu	37	12	128899972	128899972	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr12:128899972G>A	ENST00000435159.2	+	2	781	c.781G>A	c.(781-783)Gaa>Aaa	p.E261K		NM_001136103.2	NP_001129575.2	Q8N3T6	T132C_HUMAN	transmembrane protein 132C	261						integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|lung(2)|prostate(2)|skin(1)	13						TGGGCTGGAGGAAACCACGTC	0.632																																																	0								ENSG00000181234						81.0	91.0	88.0					12																	128899972		692	1591	2283	TMEM132C	SO:0001583	missense	0			-	HGNC	AK126715		12q24.32	2014-06-13				ENSG00000181234			25436	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 152"""						Standard	NM_001136103		Approved	DKFZp761O2018, PPP1R152	uc021rgn.1	Q8N3T6		ENST00000435159.2:c.781G>A	12.37:g.128899972G>A	ENSP00000410852:p.Glu261Lys	Somatic	0	70	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	67	11.84	Q69YX8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.E261K	ENST00000435159.2	37	c.781		12	.	.	.	.	.	.	.	.	.	.	G	6.106	0.387774	0.11581	.	.	ENSG00000181234	ENST00000435159	T	0.13089	2.62	5.09	5.09	0.68999	.	.	.	.	.	T	0.12902	0.0313	L	0.50333	1.59	0.19300	N	0.999974	P	0.38110	0.618	B	0.29862	0.108	T	0.35773	-0.9775	9	0.07644	T	0.81	.	18.8683	0.92301	0.0:0.0:1.0:0.0	.	261	Q8N3T6	T132C_HUMAN	K	261	ENSP00000410852:E261K	ENSP00000410852:E261K	E	+	1	0	TMEM132C	127465925	0.997000	0.39634	0.005000	0.12908	0.134000	0.20937	5.152000	0.64882	2.519000	0.84933	0.655000	0.94253	GAA	-	NULL		0.632	TMEM132C-201	KNOWN	basic|appris_principal	protein_coding	TMEM132C	protein_coding		G	XM_044062	-		128899972	+1	no_errors	ENST00000435159	ensembl	human	known	74_37	missense	SNP	0.334	A
SLC12A7	10723	genome.wustl.edu	37	5	1081838	1081838	+	Frame_Shift_Del	DEL	G	G	-	rs376127373		TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr5:1081838delG	ENST00000264930.5	-	9	1194	c.1151delC	c.(1150-1152)gcgfs	p.A384fs		NM_006598.2	NP_006589.2	Q9Y666	S12A7_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 7	384					cell volume homeostasis (GO:0006884)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|potassium ion transport (GO:0006813)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)			breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	32	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;5.44e-09)		Epithelial(17;0.000497)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00241)|Lung(60;0.165)		Potassium Chloride(DB00761)	CCCCGCGTGCGCGTACGTACT	0.672																																																	0								ENSG00000113504						66.0	65.0	65.0					5																	1081838		2201	4300	6501	SLC12A7	SO:0001589	frameshift_variant	0				HGNC	AF105365	CCDS34129.1	5p15	2013-07-18	2013-07-18		ENSG00000113504	ENSG00000113504		"""Solute carriers"""	10915	protein-coding gene	gene with protein product		604879				10347194	Standard	NM_006598		Approved	KCC4, DKFZP434F076	uc003jbu.3	Q9Y666	OTTHUMG00000161931	ENST00000264930.5:c.1151delC	5.37:g.1081838delG	ENSP00000264930:p.Ala384fs	Somatic	0	81	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	71	16.47	A6NDS8|Q4G0F3|Q96I81|Q9H7I3|Q9H7I7|Q9UFW2	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_AA-permease/SLC12A_dom,prints_KCL_cotranspt,tigrfam_Na/K/Cl_cotransptS	p.A384fs	ENST00000264930.5	37	c.1151	CCDS34129.1	5																																																																																			-	tigrfam_Na/K/Cl_cotransptS		0.672	SLC12A7-001	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	SLC12A7	protein_coding	OTTHUMT00000366446.2	G	NM_006598			1081838	-1	no_errors	ENST00000264930	ensembl	human	known	74_37	frame_shift_del	DEL	0.000	-
PDGFB	5155	genome.wustl.edu	37	22	39626130	39626130	+	Missense_Mutation	SNP	C	C	T	rs146204796	byFrequency	TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr22:39626130C>T	ENST00000331163.6	-	5	1347	c.560G>A	c.(559-561)cGg>cAg	p.R187Q	PDGFB_ENST00000381551.4_Missense_Mutation_p.R172Q	NM_002608.2	NP_002599.1	P01127	PDGFB_HUMAN	platelet-derived growth factor beta polypeptide	187					actin cytoskeleton organization (GO:0030036)|activation of protein kinase activity (GO:0032147)|activation of protein kinase B activity (GO:0032148)|blood coagulation (GO:0007596)|blood vessel morphogenesis (GO:0048514)|branching involved in salivary gland morphogenesis (GO:0060445)|cell chemotaxis (GO:0060326)|cell growth (GO:0016049)|cell projection assembly (GO:0030031)|cellular response to growth factor stimulus (GO:0071363)|cellular response to mycophenolic acid (GO:0071506)|DNA replication (GO:0006260)|embryonic placenta development (GO:0001892)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation involved in salivary gland morphogenesis (GO:0060664)|extracellular matrix organization (GO:0030198)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|metanephric glomerular endothelium development (GO:0072264)|metanephric glomerular mesangial cell development (GO:0072255)|metanephric glomerular mesangial cell proliferation involved in metanephros development (GO:0072262)|monocyte chemotaxis (GO:0002548)|negative regulation of cell migration (GO:0030336)|negative regulation of phosphatidylinositol biosynthetic process (GO:0010512)|negative regulation of platelet activation (GO:0010544)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|paracrine signaling (GO:0038001)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive chemotaxis (GO:0050918)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of calcium ion import (GO:0090280)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chemotaxis (GO:0050921)|positive regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045737)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of DNA replication (GO:0045740)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of glomerular filtration (GO:0003104)|positive regulation of glomerular mesangial cell proliferation (GO:0072126)|positive regulation of hyaluronan biosynthetic process (GO:1900127)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of metanephric mesenchymal cell migration (GO:2000591)|positive regulation of metanephric mesenchymal cell migration by platelet-derived growth factor receptor-beta signaling pathway (GO:0035793)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein autophosphorylation (GO:0031954)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to hypoxia (GO:0001666)|response to insulin (GO:0032868)|response to wounding (GO:0009611)|substrate-dependent cell migration (GO:0006929)|transforming growth factor beta receptor signaling pathway (GO:0007179)	basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi membrane (GO:0000139)|platelet alpha granule lumen (GO:0031093)	chemoattractant activity (GO:0042056)|collagen binding (GO:0005518)|growth factor activity (GO:0008083)|identical protein binding (GO:0042802)|platelet-derived growth factor binding (GO:0048407)|platelet-derived growth factor receptor binding (GO:0005161)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|superoxide-generating NADPH oxidase activator activity (GO:0016176)		COL1A1/PDGFB(429)	central_nervous_system(1)|endometrium(3)|large_intestine(1)|lung(2)	7	Melanoma(58;0.04)					GGTCACAGGCCGTGCAGCTGC	0.617			T	COL1A1	DFSP								C|||	2	0.000399361	0.0015	0.0	5008	,	,		14595	0.0		0.0	False		,,,				2504	0.0							Dom	yes		22	22q12.3-q13.1	5155	platelet-derived growth factor beta polypeptide (simian sarcoma viral (v-sis) oncogene homolog)		M	0								ENSG00000100311	C	GLN/ARG,GLN/ARG	2,4404	4.2+/-10.8	0,2,2201	59.0	59.0	59.0		560,515	3.6	0.1	22	dbSNP_134	59	0,8600		0,0,4300	no	missense,missense	PDGFB	NM_002608.2,NM_033016.2	43,43	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	probably-damaging,probably-damaging	187/242,172/227	39626130	2,13004	2203	4300	6503	PDGFB	SO:0001583	missense	0			GMAF=0.0005	HGNC		CCDS13987.1, CCDS33650.1	22q13.1	2012-10-02	2011-05-19		ENSG00000100311	ENSG00000100311			8800	protein-coding gene	gene with protein product	"""oncogene SIS"", ""becaplermin"""	190040	"""platelet-derived growth factor beta polypeptide (simian sarcoma viral (v-sis) oncogene homolog)"""	SIS		2991848, 1661670	Standard	NM_002608		Approved	SSV	uc003axf.3	P01127	OTTHUMG00000151029	ENST00000331163.6:c.560G>A	22.37:g.39626130C>T	ENSP00000330382:p.Arg187Gln	Somatic	0	84	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	90	21.05	G3XAG8|P78431|Q15354|Q6FHE7|Q9UF23	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PDGF/VEGF_dom,pfam_PDGF_N,smart_PDGF/VEGF_dom,pfscan_PDGF/VEGF_dom	p.R187Q	ENST00000331163.6	37	c.560	CCDS13987.1	22	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	18.17	3.565045	0.65651	4.54E-4	0.0	ENSG00000100311	ENST00000331163;ENST00000381551	T;T	0.44083	0.93;0.94	4.65	3.61	0.41365	.	3.738860	0.02873	U	0.131873	T	0.24470	0.0593	N	0.19112	0.55	0.09310	N	0.999994	P;P	0.39352	0.513;0.669	B;B	0.25291	0.033;0.059	T	0.15694	-1.0428	10	0.27785	T	0.31	-19.4671	6.2833	0.21019	0.0:0.6893:0.2081:0.1026	.	187;172	P01127;G3XAG8	PDGFB_HUMAN;.	Q	187;172	ENSP00000330382:R187Q;ENSP00000370963:R172Q	ENSP00000330382:R187Q	R	-	2	0	PDGFB	37956076	0.004000	0.15560	0.133000	0.22050	0.721000	0.41392	0.282000	0.18829	2.308000	0.77769	0.561000	0.74099	CGG	-	NULL		0.617	PDGFB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDGFB	protein_coding	OTTHUMT00000321043.1	C	NM_002608	rs146204796		39626130	-1	no_errors	ENST00000331163	ensembl	human	known	74_37	missense	SNP	0.101	T
FNDC7	163479	genome.wustl.edu	37	1	109261651	109261651	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr1:109261651C>T	ENST00000370017.3	+	4	855	c.578C>T	c.(577-579)tCc>tTc	p.S193F	FNDC7_ENST00000271311.2_Missense_Mutation_p.S194F	NM_001144937.1	NP_001138409.1	Q5VTL7	FNDC7_HUMAN	fibronectin type III domain containing 7	193	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.					extracellular region (GO:0005576)				breast(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(6)|ovary(1)|skin(4)|stomach(1)|urinary_tract(1)	20		all_lung(203;0.00439)|Lung NSC(277;0.00683)|all_epithelial(167;0.00728)		Colorectal(144;0.0314)|Lung(183;0.0924)|COAD - Colon adenocarcinoma(174;0.119)|Epithelial(280;0.173)|all cancers(265;0.244)		GGGGATGACTCCACCTGCAAT	0.473																																																	0								ENSG00000143107						72.0	61.0	65.0					1																	109261651		692	1591	2283	FNDC7	SO:0001583	missense	0			-	HGNC		CCDS44185.1	1p13.3	2013-02-11			ENSG00000143107	ENSG00000143107		"""Fibronectin type III domain containing"""	26668	protein-coding gene	gene with protein product						12477932	Standard	NM_001144937		Approved	FLJ35838	uc001dvx.3	Q5VTL7	OTTHUMG00000011120	ENST00000370017.3:c.578C>T	1.37:g.109261651C>T	ENSP00000359034:p.Ser193Phe	Somatic	0	49	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	50	13.79	A1L468|E9PAZ5|Q6PF16|Q8NA51	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.S194F	ENST00000370017.3	37	c.581	CCDS44185.1	1	.	.	.	.	.	.	.	.	.	.	C	8.314	0.822751	0.16678	.	.	ENSG00000143107	ENST00000370017;ENST00000271311	T;T	0.27720	1.93;1.65	5.78	5.78	0.91487	.	0.236518	0.42053	D	0.000772	T	0.07007	0.0178	N	0.15975	0.35	0.35584	D	0.806494	B	0.13145	0.007	B	0.12156	0.007	T	0.22417	-1.0217	10	0.11794	T	0.64	-23.3045	10.1086	0.42548	0.0:0.8471:0.0:0.1529	.	193	E9PAZ5	.	F	193;194	ENSP00000359034:S193F;ENSP00000271311:S194F	ENSP00000271311:S194F	S	+	2	0	FNDC7	109063174	1.000000	0.71417	1.000000	0.80357	0.857000	0.48899	1.047000	0.30367	2.736000	0.93811	0.650000	0.86243	TCC	-	superfamily_Fibronectin_type3,pfscan_Fibronectin_type3		0.473	FNDC7-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	FNDC7	protein_coding	OTTHUMT00000030589.4	C	NM_173532	-		109261651	+1	no_errors	ENST00000271311	ensembl	human	known	74_37	missense	SNP	1.000	T
GMPS	8833	genome.wustl.edu	37	3	155649568	155649568	+	Silent	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr3:155649568C>T	ENST00000496455.2	+	13	1910	c.1575C>T	c.(1573-1575)tcC>tcT	p.S525S	GMPS_ENST00000295920.7_Silent_p.S426S	NM_003875.2	NP_003866.1	P49915	GUAA_HUMAN	guanine monphosphate synthase	525					glutamine metabolic process (GO:0006541)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase biosynthetic process (GO:0009113)|purine nucleobase metabolic process (GO:0006144)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|GMP synthase (glutamine-hydrolyzing) activity (GO:0003922)|GMP synthase activity (GO:0003921)|pyrophosphatase activity (GO:0016462)			breast(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(5)|lung(12)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)		L-Glutamine(DB00130)	ACTGTCGTTCCTACAGTTACG	0.333			T	MLL	AML																																Ovarian(153;896 1876 4149 15499 28134)			Dom	yes		3	3q24	8833	guanine monphosphate synthetase		L	0								ENSG00000163655						156.0	142.0	146.0					3																	155649568		1835	4081	5916	GMPS	SO:0001819	synonymous_variant	0			-	HGNC	U10860	CCDS46941.1	3q25.31	2013-06-18	2013-06-18		ENSG00000163655	ENSG00000163655	6.3.5.2		4378	protein-coding gene	gene with protein product	"""GMP synthase"""	600358	"""guanine monphosphate synthetase"""			8089153, 9195163	Standard	NM_003875		Approved		uc003faq.3	P49915	OTTHUMG00000158551	ENST00000496455.2:c.1575C>T	3.37:g.155649568C>T		Somatic	0	54	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	56	9.68	A8K639|B4DXV7|F8W720	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GATASE,pfam_GMP_synth_C,pfam_Peptidase_C26,pfam_NAD/GMP_synthase,pfam_QueC,pfam_Asn_synthase,pfam_tRNA-specific_2-thiouridylase,tigrfam_GMP_synth_N	p.S525	ENST00000496455.2	37	c.1575	CCDS46941.1	3																																																																																			-	pfam_GMP_synth_C		0.333	GMPS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GMPS	protein_coding	OTTHUMT00000351260.2	C		-		155649568	+1	no_errors	ENST00000496455	ensembl	human	known	74_37	silent	SNP	0.999	T
FADS2	9415	genome.wustl.edu	37	11	61584070	61584070	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr11:61584070C>T	ENST00000522056.1	+	1	195	c.16C>T	c.(16-18)Cct>Tct	p.P6S	FADS2_ENST00000257261.6_Intron|FADS1_ENST00000350997.7_Missense_Mutation_p.G111E|FADS1_ENST00000542506.1_5'Flank|FADS1_ENST00000541683.1_5'UTR|FADS2_ENST00000522639.1_Intron|MIR1908_ENST00000410394.1_RNA|FADS2_ENST00000574708.1_Intron|FADS1_ENST00000433932.1_5'Flank|FADS2_ENST00000517839.1_Missense_Mutation_p.P6S			O95864	FADS2_HUMAN	fatty acid desaturase 2	0					alpha-linolenic acid metabolic process (GO:0036109)|linoleic acid metabolic process (GO:0043651)|small molecule metabolic process (GO:0044281)|unsaturated fatty acid biosynthetic process (GO:0006636)|unsaturated fatty acid metabolic process (GO:0033559)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|stearoyl-CoA 9-desaturase activity (GO:0004768)			breast(2)|kidney(2)|large_intestine(4)|liver(1)|lung(2)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	20					Alpha-Linolenic Acid(DB00132)	CCGGGAGCCCCCTGGATGCCG	0.692																																																	0								ENSG00000149485						12.0	15.0	14.0					11																	61584070		1946	4117	6063	FADS1	SO:0001583	missense	0			-	HGNC	AF084559	CCDS8012.1, CCDS60807.1, CCDS60808.1	11q12.2	2013-01-25			ENSG00000134824	ENSG00000134824	1.14.19.3	"""Fatty acid desaturases"""	3575	protein-coding gene	gene with protein product	"""delta-6-desaturase"""	606149		LLCDL2			Standard	NM_004265		Approved	FADSD6, D6D, TU13, DES6, SLL0262	uc001nsl.1	O95864	OTTHUMG00000163794	ENST00000522056.1:c.16C>T	11.37:g.61584070C>T	ENSP00000429500:p.Pro6Ser	Somatic	0	51	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	83	15.31	A8K2M6|B7Z634|Q6MZQ7|Q96H07|Q96SV8|Q9H3G3|Q9Y3X4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Fatty_acid_desaturase-1,pfam_Cyt_B5-like_heme/steroid-bd,superfamily_Cyt_B5-like_heme/steroid-bd,pirsf_Fatty_acid/sphinglp_desaturase,pfscan_Cyt_B5-like_heme/steroid-bd,prints_Cyt_B5-like_heme/steroid-bd	p.G111E	ENST00000522056.1	37	c.332		11	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	26.8|26.8|26.8	4.771385|4.771385|4.771385	0.90108|0.90108|0.90108	.|.|.	.|.|.	ENSG00000149485|ENSG00000149485|ENSG00000134824	ENST00000350997|ENST00000491310|ENST00000522056;ENST00000517839	D|D|T	0.93488|0.93547|0.19669	-3.23|-3.24|2.13	4.5|4.5|4.5	2.62|2.62|2.62	0.31277|0.31277|0.31277	Cytochrome b5 (5);|.|.	.|.|.	.|.|.	.|.|.	.|.|.	T|T|T	0.39572|0.39572|0.39572	0.1083|0.1083|0.1083	H|H|H	0.98155|0.98155|0.98155	4.16|4.16|4.16	0.80722|0.80722|0.80722	D|D|D	1|1|1	D|.|B	0.69078|.|0.27882	0.997|.|0.192	D|.|B	0.74348|.|0.23716	0.983|.|0.048	T|T|T	0.45234|0.45234|0.45234	-0.9275|-0.9275|-0.9275	9|6|8	0.87932|.|.	D|.|.	0|.|.	1.4335|1.4335|1.4335	10.8036|10.8036|10.8036	0.46504|0.46504|0.46504	0.0:0.8389:0.0:0.1611|0.0:0.8389:0.0:0.1611|0.0:0.8389:0.0:0.1611	.|.|.	54|.|6	O60427|.|B7Z634	FADS1_HUMAN|.|.	E|R|S	111|61|6	ENSP00000322229:G111E|ENSP00000429016:G61R|ENSP00000429500:P6S	ENSP00000322229:G111E|.|.	G|G|P	-|-|+	2|1|1	0|0|0	FADS1|FADS1|FADS2	61340646|61340646|61340646	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	0.667000|0.667000|0.667000	0.29798|0.29798|0.29798	0.982000|0.982000|0.982000	0.71751|0.71751|0.71751	5.372000|5.372000|5.372000	0.66156|0.66156|0.66156	0.598000|0.598000|0.598000	0.29829|0.29829|0.29829	0.561000|0.561000|0.561000	0.74099|0.74099|0.74099	GGG|GGG|CCT	-	pfam_Cyt_B5-like_heme/steroid-bd,superfamily_Cyt_B5-like_heme/steroid-bd,pirsf_Fatty_acid/sphinglp_desaturase,pfscan_Cyt_B5-like_heme/steroid-bd,prints_Cyt_B5-like_heme/steroid-bd		0.692	FADS2-002	PUTATIVE	basic|exp_conf	protein_coding	FADS1	protein_coding	OTTHUMT00000375583.1	C	NM_004265	-		61584070	-1	no_errors	ENST00000350997	ensembl	human	known	74_37	missense	SNP	1.000	T
DOCK2	1794	genome.wustl.edu	37	5	169508872	169508872	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr5:169508872C>T	ENST00000256935.8	+	51	5394	c.5314C>T	c.(5314-5316)Cct>Tct	p.P1772S	DOCK2_ENST00000520908.1_Missense_Mutation_p.P1264S|DOCK2_ENST00000523351.1_3'UTR|DOCK2_ENST00000540750.1_Missense_Mutation_p.P833S	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	1772					actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)			NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GGCAGGCATCCCTGGGTTGGA	0.597																																																	0								ENSG00000134516						73.0	64.0	67.0					5																	169508872		2203	4300	6503	DOCK2	SO:0001583	missense	0			-	HGNC	BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.5314C>T	5.37:g.169508872C>T	ENSP00000256935:p.Pro1772Ser	Somatic	0	81	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	64	16.88	Q2M3I0|Q96AK7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DOCK_C,pfam_SH3_2,superfamily_SH3_domain,superfamily_Cyt_c-like_dom,superfamily_ARM-type_fold,superfamily_Ferritin-like_SF,smart_SH3_domain,pfscan_SH3_domain	p.P1772S	ENST00000256935.8	37	c.5314	CCDS4371.1	5	.	.	.	.	.	.	.	.	.	.	C	10.76	1.442033	0.25900	.	.	ENSG00000134516	ENST00000256935;ENST00000520908;ENST00000540750	T;T;T	0.08008	3.8;3.42;3.14	4.84	0.668	0.17912	.	0.458070	0.21983	N	0.066270	T	0.04227	0.0117	N	0.19112	0.55	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.0;0.002;0.001	T	0.42899	-0.9424	10	0.19590	T	0.45	.	5.1018	0.14764	0.1365:0.515:0.2666:0.0818	.	1264;328;1772	E7ERW7;B3KY14;Q92608	.;.;DOCK2_HUMAN	S	1772;1264;833	ENSP00000256935:P1772S;ENSP00000429283:P1264S;ENSP00000438827:P833S	ENSP00000256935:P1772S	P	+	1	0	DOCK2	169441450	0.002000	0.14202	0.000000	0.03702	0.011000	0.07611	1.306000	0.33505	0.124000	0.18369	0.655000	0.94253	CCT	-	NULL		0.597	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK2	protein_coding	OTTHUMT00000252828.2	C	NM_004946	-		169508872	+1	no_errors	ENST00000256935	ensembl	human	known	74_37	missense	SNP	0.000	T
MEFV	4210	genome.wustl.edu	37	16	3293917	3293917	+	Intron	SNP	A	A	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr16:3293917A>T	ENST00000219596.1	-	9	1799				MEFV_ENST00000541159.1_Missense_Mutation_p.F426Y|MEFV_ENST00000536379.1_Intron|MEFV_ENST00000339854.4_Intron	NM_000243.2	NP_000234.1	O15553	MEFV_HUMAN	Mediterranean fever						inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of macrophage inflammatory protein 1 alpha production (GO:0071641)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity (GO:2001056)	cell projection (GO:0042995)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)	actin binding (GO:0003779)|zinc ion binding (GO:0008270)			NS(2)|biliary_tract(1)|breast(5)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(6)|lung(19)|ovary(3)|prostate(1)|skin(6)	50						CAGATAGGGAAAAAAATCCTG	0.507																																																	0								ENSG00000103313						36.0	38.0	37.0					16																	3293917		2197	4300	6497	MEFV	SO:0001627	intron_variant	0			-	HGNC	AF018080	CCDS10498.1, CCDS55981.1	16p13.3	2014-09-17			ENSG00000103313	ENSG00000103313		"""Tripartite motif containing / Tripartite motif containing"""	6998	protein-coding gene	gene with protein product	"""pyrin"""	608107		MEF		9288094	Standard	NM_000243		Approved	FMF, TRIM20	uc002cun.1	O15553	OTTHUMG00000129324	ENST00000219596.1:c.1760-25T>A	16.37:g.3293917A>T		Somatic	0	31	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	37	15.91	D3DUC0|F5H0Q3|Q3MJ84|Q96PN4|Q96PN5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DAPIN,pfam_Znf_B-box,superfamily_DEATH-like_dom,smart_Znf_B-box,pfscan_DAPIN,pfscan_Znf_B-box	p.F426Y	ENST00000219596.1	37	c.1277	CCDS10498.1	16	.	.	.	.	.	.	.	.	.	.	A	10.27	1.302958	0.23736	.	.	ENSG00000103313	ENST00000541159	T	0.61742	0.08	4.28	-8.56	0.00904	.	.	.	.	.	T	0.28566	0.0707	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.27365	-1.0076	6	.	.	.	.	9.0598	0.36427	0.1369:0.1101:0.6387:0.1143	.	.	.	.	Y	426	ENSP00000438711:F426Y	.	F	-	2	0	MEFV	3233918	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.724000	0.04947	-2.169000	0.00777	-0.912000	0.02778	TTT	-	NULL		0.507	MEFV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MEFV	protein_coding	OTTHUMT00000251464.1	A	NM_000243	-		3293917	-1	no_errors	ENST00000541159	ensembl	human	putative	74_37	missense	SNP	0.000	T
COL11A1	1301	genome.wustl.edu	37	1	103355091	103355091	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr1:103355091C>T	ENST00000370096.3	-	59	4696	c.4384G>A	c.(4384-4386)Ggt>Agt	p.G1462S	COL11A1_ENST00000512756.1_Missense_Mutation_p.G1346S|COL11A1_ENST00000353414.4_Missense_Mutation_p.G1423S|COL11A1_ENST00000358392.2_Missense_Mutation_p.G1474S	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	1462	Collagen-like 7.|Triple-helical region.				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		CCTGGAGGACCAATCAGGCCA	0.388																																																	0								ENSG00000060718						66.0	62.0	64.0					1																	103355091		2203	4300	6503	COL11A1	SO:0001583	missense	0			-	HGNC	J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.4384G>A	1.37:g.103355091C>T	ENSP00000359114:p.Gly1462Ser	Somatic	0	107	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	102	19.69	B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Collagen,pfam_Fib_collagen_C,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,superfamily_Fibrinogen_a/b/g_C_dom,smart_Laminin_G,smart_Fib_collagen_C	p.G1474S	ENST00000370096.3	37	c.4420	CCDS778.1	1	.	.	.	.	.	.	.	.	.	.	C	26.0	4.690420	0.88735	.	.	ENSG00000060718	ENST00000370096;ENST00000358392;ENST00000353414;ENST00000370090;ENST00000512756	D;D;D;D	0.99607	-6.27;-6.27;-6.27;-6.27	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	D	0.99792	0.9912	H	0.94542	3.55	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.998;0.999;0.999;1.0;0.999	D	0.97219	0.9876	10	0.87932	D	0	.	19.3074	0.94169	0.0:1.0:0.0:0.0	.	1346;1423;1474;1462;682	E9PCU0;P12107-3;P12107-2;P12107;F5H5Z5	.;.;.;COBA1_HUMAN;.	S	1462;1474;1423;682;1346	ENSP00000359114:G1462S;ENSP00000351163:G1474S;ENSP00000302551:G1423S;ENSP00000426533:G1346S	ENSP00000302551:G1423S	G	-	1	0	COL11A1	103127679	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.560000	0.86352	0.563000	0.77884	GGT	-	pfam_Collagen		0.388	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	COL11A1	protein_coding	OTTHUMT00000029997.1	C	NM_080630	-		103355091	-1	no_errors	ENST00000358392	ensembl	human	known	74_37	missense	SNP	1.000	T
MORC1	27136	genome.wustl.edu	37	3	108836856	108836856	+	Silent	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr3:108836856G>A	ENST00000483760.1	-	1	94	c.51C>T	c.(49-51)ttC>ttT	p.F17F	MORC1_ENST00000232603.5_Silent_p.F17F					MORC family CW-type zinc finger 1											breast(7)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(47)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	105						TGGCGTGGATGAAATCCAGAC	0.637																																																	0								ENSG00000114487						29.0	23.0	25.0					3																	108836856		2202	4297	6499	MORC1	SO:0001819	synonymous_variant	0			-	HGNC	AF084946	CCDS2955.1	3q13	2011-10-26	2005-06-15	2005-06-15	ENSG00000114487	ENSG00000114487			7198	protein-coding gene	gene with protein product	"""cancer/testis antigen 33"""	603205	"""microrchidia (mouse) homolog"", ""microrchidia homolog (mouse)"""	MORC		10369865	Standard	NM_014429		Approved	ZCW6, CT33	uc003dxl.3	Q86VD1	OTTHUMG00000159209	ENST00000483760.1:c.51C>T	3.37:g.108836856G>A		Somatic	0	153	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	33	167	16.50		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_CW,superfamily_HATPase_ATP-bd,pfscan_Znf_CW	p.F17	ENST00000483760.1	37	c.51		3																																																																																			-	NULL		0.637	MORC1-002	NOVEL	basic|appris_candidate|exp_conf	protein_coding	MORC1	protein_coding	OTTHUMT00000353844.1	G		-		108836856	-1	no_errors	ENST00000232603	ensembl	human	known	74_37	silent	SNP	1.000	A
SLC37A1	54020	genome.wustl.edu	37	21	43981883	43981883	+	Intron	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr21:43981883C>T	ENST00000352133.2	+	12	1963				SLC37A1_ENST00000398341.3_Intron|AP001625.6_ENST00000442605.1_RNA			P57057	GLPT_HUMAN	solute carrier family 37 (glucose-6-phosphate transporter), member 1						carbohydrate transport (GO:0008643)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	transporter activity (GO:0005215)			breast(1)|endometrium(6)|kidney(1)|large_intestine(2)|liver(2)|lung(3)	15						agtagaaaatctggccacgct	0.562																																																	0								ENSG00000235772						17.0	13.0	14.0					21																	43981883		692	1589	2281	AP001625.6	SO:0001627	intron_variant	0			-	Clone_based_vega_gene	AJ269529	CCDS13689.1	21q22.3	2013-07-17	2013-07-17		ENSG00000160190	ENSG00000160190		"""Solute carriers"""	11024	protein-coding gene	gene with protein product		608094	"""solute carrier family 37 (glycerol-3-phosphate transporter), member 1"""			11112347	Standard	NM_018964		Approved		uc002zbi.3	P57057	OTTHUMG00000086803	ENST00000352133.2:c.982-305C>T	21.37:g.43981883C>T		Somatic	0	29	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	23	14.81	D3DSJ7|Q9HAQ1	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000352133.2	37	NULL	CCDS13689.1	21																																																																																			-	-		0.562	SLC37A1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ENSG00000235772	protein_coding	OTTHUMT00000195377.1	C		-		43981883	-1	no_errors	ENST00000442605	ensembl	human	known	74_37	rna	SNP	0.300	T
Unknown	0	genome.wustl.edu	37	X	3824062	3824062	+	IGR	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chrX:3824062G>A								RP11-706O15.5 (4021 upstream) : RP11-706O15.7 (23847 downstream)																							GCTGATGTAGGAAACATGACT	0.622																																																	0								ENSG00000205663																																			RP11-706O15.5	SO:0001628	intergenic_variant	0			-	Clone_based_vega_gene																													X.37:g.3824062G>A		Somatic	0	123	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	33	133	19.88		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL		37	NULL		X																																																																																			-	-	0	0.622					ENSG00000205663			G		-		3824062	-1	no_errors	ENST00000381106	ensembl	human	known	74_37	rna	SNP	0.028	A
LEPREL1	55214	genome.wustl.edu	37	3	189690672	189690672	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr3:189690672C>T	ENST00000319332.5	-	11	1887	c.1690G>A	c.(1690-1692)Gcc>Acc	p.A564T	LEPREL1_ENST00000427335.2_Missense_Mutation_p.A383T	NM_018192.3	NP_060662.2	Q8IVL5	P3H2_HUMAN	leprecan-like 1	564	Fe2OG dioxygenase. {ECO:0000255|PROSITE- ProRule:PRU00805}.				collagen metabolic process (GO:0032963)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|peptidyl-proline hydroxylation (GO:0019511)	basement membrane (GO:0005604)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen-proline 3-dioxygenase activity (GO:0019797)			NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(10)|liver(1)|lung(8)|ovary(2)|prostate(2)|skin(5)	41	all_cancers(143;4.01e-10)|Ovarian(172;0.0925)		Lung(62;4.35e-05)	GBM - Glioblastoma multiforme(93;0.02)	L-Proline(DB00172)|Succinic acid(DB00139)|Vitamin C(DB00126)	CCAGACAGGGCTGTTCGGCAG	0.403																																																	0								ENSG00000090530						107.0	103.0	104.0					3																	189690672		2203	4300	6503	LEPREL1	SO:0001583	missense	0			-	HGNC		CCDS3294.1, CCDS46981.1	3q29	2014-01-28			ENSG00000090530	ENSG00000090530	1.14.11.7		19317	protein-coding gene	gene with protein product	"""prolyl 3-hydroxylase 2"""	610341				15063763, 21885030	Standard	NM_018192		Approved	FLJ10718, MLAT4, P3H2	uc011bsk.2	Q8IVL5	OTTHUMG00000156312	ENST00000319332.5:c.1690G>A	3.37:g.189690672C>T	ENSP00000316881:p.Ala564Thr	Somatic	0	48	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	66	17.50	B3KPK0|B3KWI9|D3DNV8|Q9NVI2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Oxoglu/Fe-dep_dioxygenase,smart_Pro_4_hyd_alph	p.A564T	ENST00000319332.5	37	c.1690	CCDS3294.1	3	.	.	.	.	.	.	.	.	.	.	C	25.4	4.638749	0.87760	.	.	ENSG00000090530	ENST00000319332;ENST00000427335	T;T	0.65732	-0.17;-0.17	5.71	4.8	0.61643	Oxoglutarate/iron-dependent oxygenase (1);Prolyl 4-hydroxylase, alpha subunit (1);	0.047535	0.85682	D	0.000000	T	0.68595	0.3018	M	0.81802	2.56	0.80722	D	1	P	0.37525	0.598	B	0.40864	0.342	T	0.70967	-0.4728	9	.	.	.	-13.7952	17.5051	0.87742	0.0:0.8659:0.1341:0.0	.	564	Q8IVL5	P3H2_HUMAN	T	564;383	ENSP00000316881:A564T;ENSP00000408947:A383T	.	A	-	1	0	LEPREL1	191173366	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.775000	0.68915	2.686000	0.91538	0.650000	0.86243	GCC	-	smart_Pro_4_hyd_alph		0.403	LEPREL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LEPREL1	protein_coding	OTTHUMT00000343855.1	C	NM_018192	-		189690672	-1	no_errors	ENST00000319332	ensembl	human	known	74_37	missense	SNP	1.000	T
PDGFA	5154	genome.wustl.edu	37	7	550608	550608	+	Silent	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr7:550608C>T	ENST00000354513.5	-	4	683	c.291G>A	c.(289-291)aaG>aaA	p.K97K	PDGFA_ENST00000426681.2_5'Flank|PDGFA_ENST00000402802.3_Silent_p.K97K	NM_002607.5	NP_002598.4	P04085	PDGFA_HUMAN	platelet-derived growth factor alpha polypeptide	97					actin cytoskeleton organization (GO:0030036)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cell activation (GO:0001775)|cell projection assembly (GO:0030031)|cell-cell signaling (GO:0007267)|embryo development (GO:0009790)|epidermal growth factor receptor signaling pathway (GO:0007173)|extracellular matrix organization (GO:0030198)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hair follicle development (GO:0001942)|innate immune response (GO:0045087)|inner ear development (GO:0048839)|lung alveolus development (GO:0048286)|negative chemotaxis (GO:0050919)|negative regulation of phosphatidylinositol biosynthetic process (GO:0010512)|negative regulation of platelet activation (GO:0010544)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA replication (GO:0045740)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of metanephric mesenchymal cell migration by platelet-derived growth factor receptor-beta signaling pathway (GO:0035793)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein autophosphorylation (GO:0031954)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of branching involved in salivary gland morphogenesis by epithelial-mesenchymal signaling (GO:0060683)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|regulation of smooth muscle cell migration (GO:0014910)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to hypoxia (GO:0001666)|response to inorganic substance (GO:0010035)|response to retinoic acid (GO:0032526)|response to wounding (GO:0009611)|skin development (GO:0043588)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	cell surface (GO:0009986)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi membrane (GO:0000139)|microvillus (GO:0005902)|platelet alpha granule lumen (GO:0031093)	collagen binding (GO:0005518)|growth factor activity (GO:0008083)|platelet-derived growth factor binding (GO:0048407)|platelet-derived growth factor receptor binding (GO:0005161)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	16		Ovarian(82;0.0112)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|Epithelial(4;1.1e-17)|OV - Ovarian serous cystadenocarcinoma(56;1.7e-17)|all cancers(6;4.89e-15)		CCGTCCTGGTCTTGCAGACAG	0.677																																																	0								ENSG00000197461						55.0	46.0	49.0					7																	550608		2203	4298	6501	PDGFA	SO:0001819	synonymous_variant	0			-	HGNC		CCDS34578.1, CCDS47524.1	7p22	2008-07-18			ENSG00000197461	ENSG00000197461			8799	protein-coding gene	gene with protein product	"""PDGF A-chain"", ""platelet-derived growth factor alpha chain"""	173430				1505216, 2536956	Standard	NM_002607		Approved	PDGF1, PDGF-A	uc003sir.3	P04085	OTTHUMG00000151412	ENST00000354513.5:c.291G>A	7.37:g.550608C>T		Somatic	0	70	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	74	26.73	B5BU73	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_PDGF/VEGF_dom,pfam_PDGF_N,smart_PDGF/VEGF_dom,pfscan_PDGF/VEGF_dom	p.K97	ENST00000354513.5	37	c.291	CCDS34578.1	7	.	.	.	.	.	.	.	.	.	.	c	3.821	-0.037842	0.07497	.	.	ENSG00000197461	ENST00000400761	.	.	.	4.69	3.67	0.42095	.	.	.	.	.	T	0.53690	0.1812	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51164	-0.8740	4	.	.	.	-31.0506	5.5239	0.16947	0.0:0.6388:0.0:0.3612	.	.	.	.	N	104	.	.	D	-	1	0	PDGFA	517134	1.000000	0.71417	1.000000	0.80357	0.217000	0.24651	2.611000	0.46334	2.153000	0.67306	0.558000	0.71614	GAC	-	pfam_PDGF/VEGF_dom,smart_PDGF/VEGF_dom,pfscan_PDGF/VEGF_dom		0.677	PDGFA-002	KNOWN	basic|CCDS	protein_coding	PDGFA	protein_coding	OTTHUMT00000322534.1	C		-		550608	-1	no_errors	ENST00000354513	ensembl	human	known	74_37	silent	SNP	1.000	T
COL5A2	1290	genome.wustl.edu	37	2	189906326	189906326	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr2:189906326C>T	ENST00000374866.3	-	50	3893	c.3619G>A	c.(3619-3621)Gaa>Aaa	p.E1207K		NM_000393.3	NP_000384.2	P05997	CO5A2_HUMAN	collagen, type V, alpha 2	1207					axon guidance (GO:0007411)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|negative regulation of endodermal cell differentiation (GO:1903225)|skeletal system development (GO:0001501)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)			NS(3)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(16)|lung(53)|ovary(3)|prostate(2)|skin(6)|urinary_tract(3)	95			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)			GGTCCTGCTTCTCCTACACTG	0.502																																																	0								ENSG00000204262						158.0	154.0	155.0					2																	189906326		2203	4300	6503	COL5A2	SO:0001583	missense	0			-	HGNC	Y14690	CCDS33350.1	2q14-q32	2014-09-17			ENSG00000204262	ENSG00000204262		"""Collagens"""	2210	protein-coding gene	gene with protein product	"""AB collagen"""	120190				1572660	Standard	NM_000393		Approved		uc002uqk.3	P05997	OTTHUMG00000149842	ENST00000374866.3:c.3619G>A	2.37:g.189906326C>T	ENSP00000364000:p.Glu1207Lys	Somatic	0	49	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	44	25.42	P78440|Q13908|Q53WR4|Q59GR4|Q6LDJ5|Q7KZ55|Q86XF6|Q96QB0|Q96QB3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Collagen,pfam_Fib_collagen_C,pfam_VWF_C,superfamily_Fibrinogen_a/b/g_C_dom,smart_VWF_C,smart_Fib_collagen_C,pfscan_VWF_C	p.E1207K	ENST00000374866.3	37	c.3619	CCDS33350.1	2	.	.	.	.	.	.	.	.	.	.	C	26.4	4.737661	0.89573	.	.	ENSG00000204262	ENST00000374866;ENST00000452536	D	0.92752	-3.1	5.56	5.56	0.83823	.	0.000000	0.51477	D	0.000085	D	0.93051	0.7788	L	0.50919	1.6	0.80722	D	1	P;P	0.51449	0.856;0.945	P;P	0.55055	0.578;0.767	D	0.89656	0.3873	10	0.13470	T	0.59	.	19.9019	0.96988	0.0:1.0:0.0:0.0	.	847;1207	Q5PR22;P05997	.;CO5A2_HUMAN	K	1207;847	ENSP00000364000:E1207K	ENSP00000364000:E1207K	E	-	1	0	COL5A2	189614571	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	7.635000	0.83286	2.781000	0.95711	0.650000	0.86243	GAA	-	pfam_Collagen		0.502	COL5A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL5A2	protein_coding	OTTHUMT00000313523.1	C	NM_000393	-		189906326	-1	no_errors	ENST00000374866	ensembl	human	known	74_37	missense	SNP	1.000	T
PPWD1	23398	genome.wustl.edu	37	5	64867822	64867823	+	Frame_Shift_Ins	INS	-	-	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr5:64867822_64867823insA	ENST00000261308.5	+	5	750_751	c.678_679insA	c.(679-681)actfs	p.T227fs	PPWD1_ENST00000538977.1_Frame_Shift_Ins_p.T71fs|PPWD1_ENST00000535264.1_Frame_Shift_Ins_p.T197fs	NM_015342.3	NP_056157.1	Q96BP3	PPWD1_HUMAN	peptidylprolyl isomerase domain and WD repeat containing 1	227					mRNA splicing, via spliceosome (GO:0000398)|protein folding (GO:0006457)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)	peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)	19		Lung NSC(167;7.21e-05)|Prostate(74;0.0174)|Ovarian(174;0.186)		Lung(70;0.00451)		CATCACCTCTTACTCAGATACG	0.406																																																	0								ENSG00000113593																																			PPWD1	SO:0001589	frameshift_variant	0				HGNC	AK025679	CCDS3985.1, CCDS64161.1, CCDS64162.1	5q12.3	2013-01-09			ENSG00000113593	ENSG00000113593		"""WD repeat domain containing"""	28954	protein-coding gene	gene with protein product						7584044	Standard	NM_015342		Approved	KIAA0073	uc003jtv.5	Q96BP3	OTTHUMG00000131226	ENST00000261308.5:c.679dupA	5.37:g.64867823_64867823dupA	ENSP00000261308:p.Thr227fs	Somatic	0	59	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	50	12.28	B4DWR9|Q15002|Q7KZ89	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_Cyclophilin-like_PPIase_dom,pfam_WD40_repeat,superfamily_Cyclophilin-like_PPIase_dom,superfamily_WD40_repeat_dom,smart_WD40_repeat,prints_Cyclophilin-like_PPIase_dom,pfscan_Cyclophilin-like_PPIase_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.T226fs	ENST00000261308.5	37	c.678_679	CCDS3985.1	5																																																																																			-	superfamily_WD40_repeat_dom,smart_WD40_repeat		0.406	PPWD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPWD1	protein_coding	OTTHUMT00000253970.2	-	NM_015342			64867823	+1	no_errors	ENST00000261308	ensembl	human	known	74_37	frame_shift_ins	INS	1.000:1.000	A
MEGF10	84466	genome.wustl.edu	37	5	126732295	126732295	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr5:126732295C>T	ENST00000274473.6	+	7	751	c.484C>T	c.(484-486)Ccc>Tcc	p.P162S	MEGF10_ENST00000508365.1_Missense_Mutation_p.P162S|MEGF10_ENST00000503335.2_Missense_Mutation_p.P162S|MEGF10_ENST00000418761.2_Missense_Mutation_p.P162S	NM_032446.2	NP_115822.1	Q96KG7	MEG10_HUMAN	multiple EGF-like-domains 10	162	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.|Necessary for interaction with AP2M1, self-assembly and formation of the irregular, mosaic-like adhesion pattern.				homotypic cell-cell adhesion (GO:0034109)|muscle cell development (GO:0055001)|recognition of apoptotic cell (GO:0043654)|regulation of muscle cell differentiation (GO:0051147)|regulation of skeletal muscle tissue development (GO:0048641)|skeletal muscle satellite cell activation (GO:0014719)|skeletal muscle satellite cell differentiation (GO:0014816)|skeletal muscle satellite cell proliferation (GO:0014841)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)				breast(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(28)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	68		Prostate(80;0.165)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0657)|Epithelial(69;0.123)		TCTGTGCAACCCCATCACCGG	0.607																																																	0								ENSG00000145794						59.0	66.0	63.0					5																	126732295		2201	4298	6499	MEGF10	SO:0001583	missense	0			-	HGNC	AK021631	CCDS4142.1	5q33	2008-02-05			ENSG00000145794	ENSG00000145794			29634	protein-coding gene	gene with protein product		612453				11347906	Standard	NM_032446		Approved	KIAA1780	uc003kui.4	Q96KG7	OTTHUMG00000128984	ENST00000274473.6:c.484C>T	5.37:g.126732295C>T	ENSP00000274473:p.Pro162Ser	Somatic	0	106	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	33	103	24.26	Q68DE5|Q8WUL3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_EGF_laminin,pfam_EGF_extracell,superfamily_Proteinase_amylase_inhib_dom,smart_EG-like_dom,smart_EGF_laminin,pfscan_EG-like_dom,pfscan_EMI_domain	p.P162S	ENST00000274473.6	37	c.484	CCDS4142.1	5	.	.	.	.	.	.	.	.	.	.	C	35	5.458377	0.96240	.	.	ENSG00000145794	ENST00000503335;ENST00000508365;ENST00000418761;ENST00000274473	T;T;T;T	0.53857	0.6;0.6;0.6;0.6	5.56	5.56	0.83823	EGF-like, laminin (2);Epidermal growth factor-like, type 3 (1);	0.000000	0.64402	D	0.000001	T	0.73806	0.3634	M	0.73962	2.25	0.80722	D	1	P;D	0.89917	0.863;1.0	P;D	0.97110	0.8;1.0	T	0.72944	-0.4138	10	0.44086	T	0.13	-16.8581	19.532	0.95232	0.0:1.0:0.0:0.0	.	162;162	Q96KG7-2;Q96KG7	.;MEG10_HUMAN	S	162	ENSP00000423354:P162S;ENSP00000423195:P162S;ENSP00000416284:P162S;ENSP00000274473:P162S	ENSP00000274473:P162S	P	+	1	0	MEGF10	126760194	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	2.621000	0.88768	0.655000	0.94253	CCC	-	pfam_EGF_laminin,smart_EG-like_dom,smart_EGF_laminin,pfscan_EG-like_dom		0.607	MEGF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MEGF10	protein_coding	OTTHUMT00000250973.2	C	NM_032446	-		126732295	+1	no_errors	ENST00000274473	ensembl	human	known	74_37	missense	SNP	1.000	T
LGR6	59352	genome.wustl.edu	37	1	202283984	202283984	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr1:202283984C>T	ENST00000367278.3	+	17	1711	c.1622C>T	c.(1621-1623)cCc>cTc	p.P541L	LGR6_ENST00000439764.2_Missense_Mutation_p.P402L|LGR6_ENST00000255432.7_Missense_Mutation_p.P489L	NM_001017403.1	NP_001017403.1	Q9HBX8	LGR6_HUMAN	leucine-rich repeat containing G protein-coupled receptor 6	541					G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of Wnt signaling pathway (GO:0030177)|Wnt signaling pathway (GO:0016055)	integral component of plasma membrane (GO:0005887)|trans-Golgi network membrane (GO:0032588)|vesicle (GO:0031982)	transmembrane signaling receptor activity (GO:0004888)			breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(16)|ovary(3)|pancreas(1)|prostate(3)|skin(3)	36						AAGCCACACCCCAGTGTCCAG	0.562																																																	0								ENSG00000133067						102.0	90.0	94.0					1																	202283984		2203	4300	6503	LGR6	SO:0001583	missense	0			-	HGNC	AF190501	CCDS1424.1, CCDS30971.1, CCDS30972.1	1q32.1	2012-08-21	2011-01-25		ENSG00000133067	ENSG00000133067		"""GPCR / Class A : Orphans"""	19719	protein-coding gene	gene with protein product		606653	"""leucine-rich repeat-containing G protein-coupled receptor 6"""			10935549	Standard	XM_005245404		Approved	FLJ14471	uc001gxu.3	Q9HBX8	OTTHUMG00000041383	ENST00000367278.3:c.1622C>T	1.37:g.202283984C>T	ENSP00000356247:p.Pro541Leu	Somatic	0	43	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	54	23.94	Q5T509|Q5T512|Q6UY15|Q86VU0|Q96K69|Q9BYD7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Leu-rich_rpt,pfam_GPCR_Rhodpsn,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,prints_Gphrmn_rcpt_fam,prints_GPCR_Rhodpsn	p.P541L	ENST00000367278.3	37	c.1622	CCDS30971.1	1	.	.	.	.	.	.	.	.	.	.	C	6.378	0.437769	0.12104	.	.	ENSG00000133067	ENST00000367278;ENST00000255432;ENST00000439764	D;D;D	0.85556	-2.0;-2.0;-2.0	5.56	3.68	0.42216	.	0.345254	0.31404	N	0.007709	T	0.77896	0.4199	L	0.53249	1.67	0.42288	D	0.992125	B;B;B	0.12630	0.006;0.001;0.001	B;B;B	0.13407	0.009;0.005;0.003	T	0.65957	-0.6042	10	0.10636	T	0.68	.	8.4279	0.32739	0.2756:0.6542:0.0:0.0701	.	402;489;541	Q9HBX8-1;Q9HBX8-2;Q9HBX8	.;.;LGR6_HUMAN	L	541;489;402	ENSP00000356247:P541L;ENSP00000255432:P489L;ENSP00000387869:P402L	ENSP00000255432:P489L	P	+	2	0	LGR6	200550607	0.990000	0.36364	0.944000	0.38274	0.341000	0.28922	1.203000	0.32284	0.706000	0.31912	-0.147000	0.13772	CCC	-	NULL		0.562	LGR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LGR6	protein_coding	OTTHUMT00000099143.1	C	NM_021636	-		202283984	+1	no_errors	ENST00000367278	ensembl	human	known	74_37	missense	SNP	0.992	T
CCDC144B	284047	genome.wustl.edu	37	17	18511275	18511275	+	RNA	SNP	C	C	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr17:18511275C>A	ENST00000442583.1	-	0	0				RN7SL639P_ENST00000578843.1_RNA			Q3MJ40	C144B_HUMAN	coiled-coil domain containing 144B (pseudogene)											NS(3)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(6)|ovary(1)|prostate(2)|skin(2)|urinary_tract(2)	36						AGCTCCAAGTCTTGTTCTGCT	0.323																																																	0								ENSG00000154874						31.0	28.0	29.0					17																	18511275		1786	4031	5817	CCDC144B			0			-	HGNC	AK093811		17p11.2	2012-11-19	2011-09-02		ENSG00000154874	ENSG00000154874			26704	pseudogene	pseudogene			"""coiled-coil domain containing 144B"""			11997339	Standard	NR_036647		Approved	FLJ36492	uc002guc.2	Q3MJ40	OTTHUMG00000059531		17.37:g.18511275C>A		Somatic	0	173	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	35	208	14.40	Q6P5Q3|Q8N200	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000442583.1	37	NULL		17																																																																																			-	-		0.323	CCDC144B-006	KNOWN	basic	processed_transcript	CCDC144B	pseudogene	OTTHUMT00000132102.1	C	NM_182568	-		18511275	-1	no_errors	ENST00000455629	ensembl	human	known	74_37	rna	SNP	0.012	A
DOCK2	1794	genome.wustl.edu	37	5	169506118	169506118	+	Missense_Mutation	SNP	G	G	C			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr5:169506118G>C	ENST00000256935.8	+	49	5214	c.5134G>C	c.(5134-5136)Gag>Cag	p.E1712Q	DOCK2_ENST00000520908.1_Missense_Mutation_p.E1204Q|DOCK2_ENST00000523351.1_3'UTR|DOCK2_ENST00000540750.1_Missense_Mutation_p.E773Q	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	1712					actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)			NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TTTTGCGGATGAGAAAGCAGC	0.572																																																	0								ENSG00000134516						67.0	64.0	65.0					5																	169506118		2203	4300	6503	DOCK2	SO:0001583	missense	0			-	HGNC	BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.5134G>C	5.37:g.169506118G>C	ENSP00000256935:p.Glu1712Gln	Somatic	0	30	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	52	10.34	Q2M3I0|Q96AK7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DOCK_C,pfam_SH3_2,superfamily_SH3_domain,superfamily_Cyt_c-like_dom,superfamily_ARM-type_fold,superfamily_Ferritin-like_SF,smart_SH3_domain,pfscan_SH3_domain	p.E1712Q	ENST00000256935.8	37	c.5134	CCDS4371.1	5	.	.	.	.	.	.	.	.	.	.	G	12.02	1.811958	0.32053	.	.	ENSG00000134516	ENST00000256935;ENST00000520908;ENST00000540750	T;T;T	0.10860	3.54;3.14;2.83	4.81	4.81	0.61882	.	0.000000	0.85682	D	0.000000	T	0.12347	0.0300	L	0.32530	0.975	0.39940	D	0.974401	P;P;P	0.52577	0.954;0.938;0.457	P;B;B	0.46452	0.517;0.368;0.287	T	0.20571	-1.0271	10	0.19147	T	0.46	.	17.0938	0.86628	0.0:0.0:1.0:0.0	.	1204;268;1712	E7ERW7;B3KY14;Q92608	.;.;DOCK2_HUMAN	Q	1712;1204;773	ENSP00000256935:E1712Q;ENSP00000429283:E1204Q;ENSP00000438827:E773Q	ENSP00000256935:E1712Q	E	+	1	0	DOCK2	169438696	1.000000	0.71417	0.952000	0.39060	0.013000	0.08279	6.631000	0.74277	2.389000	0.81357	0.650000	0.86243	GAG	-	NULL		0.572	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK2	protein_coding	OTTHUMT00000252828.2	G	NM_004946	-		169506118	+1	no_errors	ENST00000256935	ensembl	human	known	74_37	missense	SNP	1.000	C
PDHB	5162	genome.wustl.edu	37	3	58413849	58413849	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr3:58413849G>A	ENST00000302746.6	-	10	1034	c.992C>T	c.(991-993)cCt>cTt	p.P331L	RP11-802O23.3_ENST00000607214.1_RNA|PDHB_ENST00000485460.1_Missense_Mutation_p.P313L|PDHB_ENST00000474765.1_3'UTR	NM_000925.3|NM_001173468.1	NP_000916.2|NP_001166939.1	P11177	ODPB_HUMAN	pyruvate dehydrogenase (lipoamide) beta	331					acetyl-CoA biosynthetic process from pyruvate (GO:0006086)|cellular metabolic process (GO:0044237)|glucose metabolic process (GO:0006006)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|nucleus (GO:0005634)|pyruvate dehydrogenase complex (GO:0045254)	pyruvate dehydrogenase (acetyl-transferring) activity (GO:0004739)|pyruvate dehydrogenase activity (GO:0004738)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(1)|ovary(1)	9				BRCA - Breast invasive adenocarcinoma(55;0.000179)|Kidney(10;0.00231)|KIRC - Kidney renal clear cell carcinoma(10;0.00258)|OV - Ovarian serous cystadenocarcinoma(275;0.187)	Pyruvic acid(DB00119)	ATAAGGCATAGGGACATCAGC	0.423																																																	0								ENSG00000168291						76.0	71.0	73.0					3																	58413849		2203	4300	6503	PDHB	SO:0001583	missense	0			-	HGNC		CCDS2890.1, CCDS54602.1	3p21.1-p14.2	1995-12-20			ENSG00000168291	ENSG00000168291	1.2.4.1		8808	protein-coding gene	gene with protein product		179060					Standard	NR_033384		Approved		uc003dkf.4	P11177	OTTHUMG00000159157	ENST00000302746.6:c.992C>T	3.37:g.58413849G>A	ENSP00000307241:p.Pro331Leu	Somatic	0	38	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	39	20.41	B2R7L0|B4DDD7|Q6FH45|Q9BQ27|Q9UFK3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Transketolase-like_Pyr-bd,pfam_Transketolase_C,superfamily_Transketo_C/Pyr-ferredox_oxred,smart_Transketolase-like_Pyr-bd	p.P331L	ENST00000302746.6	37	c.992	CCDS2890.1	3	.	.	.	.	.	.	.	.	.	.	G	34	5.400289	0.96030	.	.	ENSG00000168291	ENST00000302746;ENST00000383714;ENST00000485460	D;D;D	0.92911	-3.13;-3.13;-3.13	6.16	6.16	0.99307	Transketolase, C-terminal (1);Transketolase, C-terminal/Pyruvate-ferredoxin oxidoreductase, domain II (1);Transketolase-like, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.98194	0.9403	H	0.99074	4.42	0.80722	D	1	D;D;D	0.71674	0.992;0.984;0.998	D;D;P	0.76071	0.987;0.936;0.897	D	0.98619	1.0666	10	0.87932	D	0	-5.9473	20.8598	0.99761	0.0:0.0:1.0:0.0	.	313;313;331	B4DDD7;P11177-2;P11177	.;.;ODPB_HUMAN	L	331;313;313	ENSP00000307241:P331L;ENSP00000373220:P313L;ENSP00000417267:P313L	ENSP00000307241:P331L	P	-	2	0	PDHB	58388889	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.434000	0.97515	2.937000	0.99478	0.650000	0.86243	CCT	-	pfam_Transketolase_C,superfamily_Transketo_C/Pyr-ferredox_oxred		0.423	PDHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDHB	protein_coding	OTTHUMT00000353558.1	G		-		58413849	-1	no_errors	ENST00000302746	ensembl	human	known	74_37	missense	SNP	1.000	A
OR6C3	254786	genome.wustl.edu	37	12	55726200	55726200	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr12:55726200C>T	ENST00000379667.1	+	1	716	c.716C>T	c.(715-717)tCt>tTt	p.S239F		NM_054104.1	NP_473445.1	Q9NZP0	OR6C3_HUMAN	olfactory receptor, family 6, subfamily C, member 3	239					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|kidney(2)|large_intestine(2)|lung(1)|prostate(1)|skin(2)	11						TCCACTTGTTCTTCTCACATG	0.358																																																	0								ENSG00000205329						132.0	129.0	130.0					12																	55726200		2203	4300	6503	OR6C3	SO:0001583	missense	0			-	HGNC	AF179770	CCDS31819.1	12q13.2	2013-09-23			ENSG00000205329	ENSG00000205329		"""GPCR / Class A : Olfactory receptors"""	15437	protein-coding gene	gene with protein product							Standard	NM_054104		Approved	OST709	uc010spj.2	Q9NZP0	OTTHUMG00000169861	ENST00000379667.1:c.716C>T	12.37:g.55726200C>T	ENSP00000368989:p.Ser239Phe	Somatic	0	41	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	47	18.97		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S239F	ENST00000379667.1	37	c.716	CCDS31819.1	12	.	.	.	.	.	.	.	.	.	.	C	10.66	1.413128	0.25465	.	.	ENSG00000205329	ENST00000379667	T	0.37058	1.22	5.13	4.23	0.50019	GPCR, rhodopsin-like superfamily (1);	0.000000	0.48286	D	0.000194	T	0.61438	0.2347	M	0.86864	2.845	0.09310	N	1	D	0.89917	1.0	D	0.97110	1.0	T	0.56366	-0.7991	10	0.72032	D	0.01	.	9.2948	0.37808	0.0:0.6445:0.2793:0.0762	.	239	Q9NZP0	OR6C3_HUMAN	F	239	ENSP00000368989:S239F	ENSP00000368989:S239F	S	+	2	0	OR6C3	54012467	0.000000	0.05858	0.998000	0.56505	0.145000	0.21501	-1.107000	0.03316	1.495000	0.48549	0.650000	0.86243	TCT	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt		0.358	OR6C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6C3	protein_coding	OTTHUMT00000406309.1	C		-		55726200	+1	no_errors	ENST00000379667	ensembl	human	known	74_37	missense	SNP	0.098	T
IQCF2	389123	genome.wustl.edu	37	3	51897111	51897111	+	Nonsense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr3:51897111C>T	ENST00000333127.3	+	3	249	c.220C>T	c.(220-222)Cag>Tag	p.Q74*	IQCF2_ENST00000429548.1_3'UTR	NM_203424.1	NP_982248.1	Q8IXL9	IQCF2_HUMAN	IQ motif containing F2	74										endometrium(1)|kidney(2)|large_intestine(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	10				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000537)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		CTGGATAATTCAGTGCTGGTG	0.582																																																	0								ENSG00000184345						79.0	79.0	79.0					3																	51897111		2203	4300	6503	IQCF2	SO:0001587	stop_gained	0			-	HGNC	AK128883	CCDS2835.1	3p21.31	2008-02-05			ENSG00000184345	ENSG00000184345			31815	protein-coding gene	gene with protein product							Standard	NM_203424		Approved		uc003dbt.1	Q8IXL9	OTTHUMG00000156914	ENST00000333127.3:c.220C>T	3.37:g.51897111C>T	ENSP00000329904:p.Gln74*	Somatic	0	36	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	44	12.00		Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS	p.Q74*	ENST00000333127.3	37	c.220	CCDS2835.1	3	.	.	.	.	.	.	.	.	.	.	C	18.11	3.550416	0.65311	.	.	ENSG00000184345	ENST00000333127	.	.	.	5.23	5.23	0.72850	.	0.000000	0.48767	D	0.000174	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	-33.3138	14.4995	0.67711	0.0:1.0:0.0:0.0	.	.	.	.	X	74	.	ENSP00000329904:Q74X	Q	+	1	0	IQCF2	51872151	0.992000	0.36948	0.981000	0.43875	0.701000	0.40568	2.148000	0.42235	2.871000	0.98454	0.655000	0.94253	CAG	-	pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,smart_IQ_motif_EF-hand-BS		0.582	IQCF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IQCF2	protein_coding	OTTHUMT00000346594.1	C	NM_203424	-		51897111	+1	no_errors	ENST00000333127	ensembl	human	known	74_37	nonsense	SNP	0.996	T
NCF1	653361	genome.wustl.edu	37	7	74197917	74197917	+	Silent	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr7:74197917C>T	ENST00000289473.4	+	7	694	c.624C>T	c.(622-624)tcC>tcT	p.S208S	NCF1_ENST00000443956.3_3'UTR	NM_000265.4	NP_000256.4	P14598	NCF1_HUMAN	neutrophil cytosolic factor 1	208	SH3 1. {ECO:0000255|PROSITE- ProRule:PRU00192}.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|cellular defense response (GO:0006968)|hydrogen peroxide biosynthetic process (GO:0050665)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interaction with host (GO:0051701)|leukotriene metabolic process (GO:0006691)|negative regulation of smooth muscle contraction (GO:0045986)|neutrophil mediated killing of fungus (GO:0070947)|neutrophil mediated killing of gram-positive bacterium (GO:0070946)|oxidation-reduction process (GO:0055114)|phagosome maturation (GO:0090382)|protein targeting to membrane (GO:0006612)|respiratory burst (GO:0045730)|respiratory burst involved in defense response (GO:0002679)|response to yeast (GO:0001878)|superoxide anion generation (GO:0042554)|superoxide metabolic process (GO:0006801)	cytosol (GO:0005829)|dendrite (GO:0030425)|extrinsic component of membrane (GO:0019898)|Golgi apparatus (GO:0005794)|NADPH oxidase complex (GO:0043020)|neuronal cell body (GO:0043025)|phagolysosome (GO:0032010)|rough endoplasmic reticulum (GO:0005791)	electron carrier activity (GO:0009055)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|SH3 domain binding (GO:0017124)|superoxide-generating NADPH oxidase activity (GO:0016175)			breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|skin(3)	10					Dextromethorphan(DB00514)	TCCCAGCGTCCTTCCTCGAGC	0.637																																																	0								ENSG00000158517						69.0	61.0	64.0					7																	74197917		2202	4298	6500	NCF1	SO:0001819	synonymous_variant	0			-	HGNC	M25665	CCDS34657.1	7q11.23	2014-09-17	2008-07-31		ENSG00000158517	ENSG00000158517			7660	protein-coding gene	gene with protein product	"""NADPH oxidase organizer 2"", ""chronic granulomatous disease, autosomal 1"""	608512	"""neutrophil cytosolic factor 1 (47kD, chronic granulomatous disease, autosomal 1)"""				Standard	NM_000265		Approved	p47phox, NOXO2, NCF1A, SH3PXD1A	uc022aft.1	P14598	OTTHUMG00000149965	ENST00000289473.4:c.624C>T	7.37:g.74197917C>T		Somatic	0	86	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	80	13.98	A6NEH2|A8K7S9|O43842|Q2PP07|Q53FR5|Q9BU90|Q9BXI7|Q9BXI8|Q9UDV9|Q9UMU2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_SH3_domain,pfam_NADPH_oxidase_p47Phox_C,pfam_SH3_2,pfam_Phox,superfamily_Phox,superfamily_SH3_domain,smart_Phox,smart_SH3_domain,pfscan_Phox,pfscan_SH3_domain,prints_P47PHOX	p.S208	ENST00000289473.4	37	c.624	CCDS34657.1	7																																																																																			-	pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain		0.637	NCF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCF1	protein_coding	OTTHUMT00000314560.1	C	NM_000265	-		74197917	+1	no_errors	ENST00000289473	ensembl	human	known	74_37	silent	SNP	0.998	T
PI4KB	5298	genome.wustl.edu	37	1	151263000	151263000	+	IGR	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr1:151263000C>T	ENST00000368873.1	-	0	3340				ZNF687_ENST00000368879.2_Silent_p.V1077V			Q9UBF8	PI4KB_HUMAN	phosphatidylinositol 4-kinase, catalytic, beta						phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi membrane (GO:0000139)|mitochondrial outer membrane (GO:0005741)|plasma membrane (GO:0005886)	1-phosphatidylinositol 4-kinase activity (GO:0004430)|ATP binding (GO:0005524)			breast(3)|endometrium(5)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	27	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			GGGGCCCAGTCCCCTGGCCGG	0.622																																					Colon(154;765 1838 9854 28443 37492)												0								ENSG00000143373						59.0	67.0	64.0					1																	151263000		2203	4300	6503	ZNF687	SO:0001628	intergenic_variant	0			-	HGNC	AB005910	CCDS993.1, CCDS55637.1, CCDS55638.1	1q21	2008-02-05	2007-08-14	2007-08-02	ENSG00000143393	ENSG00000143393			8984	protein-coding gene	gene with protein product		602758		PIK4CB		9020160, 9405938	Standard	NM_002651		Approved	PI4K-BETA, pi4K92	uc001exu.3	Q9UBF8	OTTHUMG00000012348		1.37:g.151263000C>T		Somatic	0	43	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	48	26.15	B4DGI2|O15096|P78405|Q5VWB9|Q5VWC0|Q5VWC1|Q9BWR6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S1057F	ENST00000368873.1	37	c.3170		1	.	.	.	.	.	.	.	.	.	.	C	17.93	3.509963	0.64522	.	.	ENSG00000143373	ENST00000336715;ENST00000324048;ENST00000426871;ENST00000436614	T;T	0.00966	5.49;5.49	5.09	5.09	0.68999	.	0.000000	0.33854	U	0.004495	T	0.01592	0.0051	L	0.54323	1.7	0.80722	D	1	D	0.62365	0.991	P	0.55161	0.77	T	0.67499	-0.5655	10	0.59425	D	0.04	.	16.0337	0.80603	0.0:1.0:0.0:0.0	.	1057	Q8N1G0	ZN687_HUMAN	F	1057;1057;680;25	ENSP00000336620:S1057F;ENSP00000319829:S1057F	ENSP00000319829:S1057F	S	+	2	0	ZNF687	149529624	0.929000	0.31497	1.000000	0.80357	0.749000	0.42624	3.239000	0.51360	2.635000	0.89317	0.563000	0.77884	TCC	-	NULL		0.622	PI4KB-002	KNOWN	basic	protein_coding	ZNF687	protein_coding	OTTHUMT00000034400.3	C	NM_002651	-		151263000	+1	no_errors	ENST00000324048	ensembl	human	known	74_37	missense	SNP	0.994	T
MYOG	4656	genome.wustl.edu	37	1	203054910	203054910	+	Silent	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr1:203054910G>A	ENST00000241651.4	-	1	254	c.180C>T	c.(178-180)caC>caT	p.H60H		NM_002479.5	NP_002470.2	P15173	MYOG_HUMAN	myogenin (myogenic factor 4)	60					cell cycle (GO:0007049)|cellular response to estradiol stimulus (GO:0071392)|cellular response to growth factor stimulus (GO:0071363)|cellular response to lithium ion (GO:0071285)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|muscle cell differentiation (GO:0042692)|muscle cell fate commitment (GO:0042693)|negative regulation of cell proliferation (GO:0008285)|ossification (GO:0001503)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of muscle atrophy (GO:0014737)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of skeletal muscle fiber development (GO:0048743)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of myoblast fusion (GO:1901739)|regulation of satellite cell proliferation (GO:0014842)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|response to electrical stimulus involved in regulation of muscle adaptation (GO:0014878)|response to muscle activity involved in regulation of muscle adaptation (GO:0014873)|skeletal muscle fiber development (GO:0048741)|skeletal muscle tissue development (GO:0007519)|striated muscle atrophy (GO:0014891)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein-DNA complex (GO:0032993)|transcription factor complex (GO:0005667)	chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|E-box binding (GO:0070888)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(6)|skin(2)|urinary_tract(1)	12						GGCCTGGACAGTGCTCGGGGG	0.697																																																	0								ENSG00000122180						47.0	54.0	52.0					1																	203054910		2203	4299	6502	MYOG	SO:0001819	synonymous_variant	0			-	HGNC	BC053899	CCDS1433.1	1q31-q41	2013-05-21			ENSG00000122180	ENSG00000122180		"""Basic helix-loop-helix proteins"""	7612	protein-coding gene	gene with protein product		159980		MYF4		10329008	Standard	NM_002479		Approved	bHLHc3	uc001gzd.4	P15173	OTTHUMG00000042127	ENST00000241651.4:c.180C>T	1.37:g.203054910G>A		Somatic	0	33	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	40	18.37	Q53XW6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Basic,pfam_bHLH_dom,superfamily_bHLH_dom,smart_Basic,smart_bHLH_dom,pfscan_bHLH_dom	p.H60	ENST00000241651.4	37	c.180	CCDS1433.1	1																																																																																			-	pfam_Basic,smart_Basic		0.697	MYOG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYOG	protein_coding	OTTHUMT00000100279.1	G	NM_002479	-		203054910	-1	no_errors	ENST00000241651	ensembl	human	known	74_37	silent	SNP	1.000	A
TMEM232	642987	genome.wustl.edu	37	5	110003051	110003051	+	Start_Codon_SNP	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr5:110003051C>T	ENST00000455884.2	-	2	53	c.3G>A	c.(1-3)atG>atA	p.M1I	TMEM232_ENST00000429839.2_Start_Codon_SNP_p.M1I|TMEM232_ENST00000515518.2_Intron			C9JQI7	TM232_HUMAN	transmembrane protein 232	1						integral component of membrane (GO:0016021)				breast(1)|kidney(2)	3						CAGGCATATTCATAAATCATA	0.284																																																	0								ENSG00000186952						41.0	34.0	36.0					5																	110003051		692	1576	2268	TMEM232	SO:0001582	initiator_codon_variant	0			-	HGNC	AK125070	CCDS47253.1, CCDS47253.2	5q22.1	2014-02-12	2009-10-02		ENSG00000186952	ENSG00000186952			37270	protein-coding gene	gene with protein product							Standard	NM_001039763		Approved	FLJ43080	uc011cvh.2	C9JQI7	OTTHUMG00000163297	ENST00000455884.2:c.3G>A	5.37:g.110003051C>T	ENSP00000401477:p.Met1Ile	Somatic	0	41	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	65	15.58	B4DKF4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.M1I	ENST00000455884.2	37	c.3	CCDS47253.2	5	.	.	.	.	.	.	.	.	.	.	C	0.007	-1.960485	0.00465	.	.	ENSG00000186952	ENST00000429839;ENST00000455884;ENST00000511883;ENST00000515278;ENST00000512886	.	.	.	4.24	2.29	0.28610	.	.	.	.	.	T	0.23410	0.0566	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.21518	-1.0243	6	.	.	.	0.5066	4.8511	0.13537	0.0:0.6502:0.0:0.3498	.	1	C9JQI7-2	.	I	1	.	.	M	-	3	0	TMEM232	110030950	0.896000	0.30565	0.002000	0.10522	0.076000	0.17211	0.876000	0.28092	0.443000	0.26582	0.591000	0.81541	ATG	-	NULL		0.284	TMEM232-001	NOVEL	basic|appris_principal|CCDS	protein_coding	TMEM232	protein_coding	OTTHUMT00000372488.2	C	NM_001039763	-	Missense_Mutation	110003051	-1	no_errors	ENST00000429839	ensembl	human	known	74_37	missense	SNP	0.007	T
MYO18A	399687	genome.wustl.edu	37	17	27423801	27423801	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr17:27423801C>T	ENST00000527372.1	-	28	4543	c.4363G>A	c.(4363-4365)Gaa>Aaa	p.E1455K	MYO18A_ENST00000533112.1_Missense_Mutation_p.E1455K|MYO18A_ENST00000531253.1_Missense_Mutation_p.E1455K|MYO18A_ENST00000354329.4_Missense_Mutation_p.E1455K	NM_078471.3	NP_510880.2	Q92614	MY18A_HUMAN	myosin XVIIIA	1455					actomyosin structure organization (GO:0031032)|cell migration (GO:0016477)|DNA metabolic process (GO:0006259)|Golgi organization (GO:0007030)|Golgi vesicle budding (GO:0048194)|negative regulation of apoptotic process (GO:0043066)|positive regulation of protein secretion (GO:0050714)	actomyosin (GO:0042641)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|myosin complex (GO:0016459)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)			NS(1)|cervix(1)|endometrium(6)|kidney(6)|lung(20)|urinary_tract(2)	36			Epithelial(11;4.97e-05)|BRCA - Breast invasive adenocarcinoma(11;0.000221)|all cancers(11;0.000234)|Colorectal(6;0.0102)|COAD - Colon adenocarcinoma(6;0.031)			TTCTCCAGTTCGTGGTTGCGG	0.647																																					Esophageal Squamous(182;472 2015 7001 15270 22562)												0								ENSG00000196535						31.0	35.0	34.0					17																	27423801		2051	4212	6263	MYO18A	SO:0001583	missense	0			-	HGNC	D86970	CCDS45641.1, CCDS45642.1	17q11.2	2011-09-27			ENSG00000196535	ENSG00000196535		"""Myosins / Myosin superfamily : Class XVIII"""	31104	protein-coding gene	gene with protein product		610067				12761286	Standard	NM_078471		Approved	KIAA0216, MysPDZ	uc002hdt.1	Q92614	OTTHUMG00000166360	ENST00000527372.1:c.4363G>A	17.37:g.27423801C>T	ENSP00000437073:p.Glu1455Lys	Somatic	0	50	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	46	28.12	Q5H9U3|Q5W9F9|Q5W9G1|Q8IXP8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_PDZ,superfamily_P-loop_NTPase,superfamily_PDZ,superfamily_Regulat_G_prot_signal_superfam,smart_PDZ,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,pfscan_PDZ,pfscan_RecA_monomer-monomer_interface,prints_Myosin_head_motor_dom	p.E1455K	ENST00000527372.1	37	c.4363	CCDS45642.1	17	.	.	.	.	.	.	.	.	.	.	C	27.4	4.830253	0.91036	.	.	ENSG00000196535	ENST00000354329;ENST00000359450;ENST00000533112;ENST00000531253;ENST00000527372;ENST00000529799;ENST00000540575;ENST00000458428	T;T;T;T	0.30714	1.52;1.52;1.52;1.52	5.53	5.53	0.82687	Myosin tail (1);	0.043406	0.85682	D	0.000000	T	0.47358	0.1441	L	0.58810	1.83	0.53688	D	0.999975	D;P;P;P;D	0.63046	0.992;0.948;0.948;0.948;0.967	P;B;B;B;B	0.54270	0.747;0.176;0.24;0.176;0.353	T	0.40515	-0.9559	10	0.54805	T	0.06	.	19.4519	0.94871	0.0:1.0:0.0:0.0	.	1124;1067;1455;1455;1455	Q92614-2;F8W6Y3;Q92614-3;Q92614-4;Q92614	.;.;.;.;MY18A_HUMAN	K	1455;1455;1455;1455;1455;351;351;1067	ENSP00000346291:E1455K;ENSP00000435932:E1455K;ENSP00000434228:E1455K;ENSP00000437073:E1455K	ENSP00000346291:E1455K	E	-	1	0	MYO18A	24447927	1.000000	0.71417	0.995000	0.50966	0.988000	0.76386	7.453000	0.80700	2.606000	0.88127	0.591000	0.81541	GAA	-	pfam_Myosin_tail		0.647	MYO18A-001	KNOWN	basic|CCDS	protein_coding	MYO18A	protein_coding	OTTHUMT00000389396.1	C	NM_078471	-		27423801	-1	no_errors	ENST00000354329	ensembl	human	known	74_37	missense	SNP	1.000	T
CNTNAP3B	728577	genome.wustl.edu	37	9	43884963	43884963	+	Silent	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr9:43884963C>T	ENST00000377564.3	+	15	2649	c.2256C>T	c.(2254-2256)gtC>gtT	p.V752V		NM_001201380.1	NP_001188309.1	Q96NU0	CNT3B_HUMAN	contactin associated protein-like 3B	752	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(2)|lung(3)|pancreas(1)|prostate(3)	10						ACACAATAGTCCTTTCCCAAA	0.428																																																	0								ENSG00000154529																																			CNTNAP3B	SO:0001819	synonymous_variant	0			-	HGNC	BX538190	CCDS75836.1	9p12	2007-12-14			ENSG00000154529	ENSG00000154529			32035	protein-coding gene	gene with protein product						15820314	Standard	XM_006716853		Approved		uc004abr.1	Q96NU0	OTTHUMG00000013174	ENST00000377564.3:c.2256C>T	9.37:g.43884963C>T		Somatic	0	72	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	128	12.33	B1B0V7|B1B0V8|B1B0V9|B1B0W0|B1B0X8|B1B162|Q4VXF0|Q9H7W3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Laminin_G,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,superfamily_ConA-like_lec_gl_sf,superfamily_Fibrinogen_a/b/g_C_dom,smart_Coagulation_fac_5/8-C_type_dom,smart_Laminin_G,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Laminin_G	p.V752	ENST00000377564.3	37	c.2256	CCDS55312.1	9	.	.	.	.	.	.	.	.	.	.	C	1.349	-0.591882	0.03799	.	.	ENSG00000154529	ENST00000377561	.	.	.	2.5	1.57	0.23409	.	.	.	.	.	T	0.56381	0.1981	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.53521	-0.8427	4	.	.	.	.	8.6295	0.33911	0.0:0.8647:0.0:0.1353	.	.	.	.	F	801	.	.	S	+	2	0	CNTNAP3B	43824959	0.956000	0.32656	0.615000	0.29064	0.322000	0.28314	0.023000	0.13533	1.433000	0.47394	0.121000	0.15741	TCC	-	NULL		0.428	CNTNAP3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP3B	protein_coding	OTTHUMT00000036930.3	C		-		43884963	+1	no_errors	ENST00000377564	ensembl	human	known	74_37	silent	SNP	0.999	T
ARID3A	1820	genome.wustl.edu	37	19	972055	972055	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr19:972055C>T	ENST00000263620.3	+	9	2099	c.1772C>T	c.(1771-1773)tCg>tTg	p.S591L		NM_005224.2	NP_005215.1	Q99856	ARI3A_HUMAN	AT rich interactive domain 3A (BRIGHT-like)	591						cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|nucleolus (GO:0005730)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|ovary(1)	10		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TCAAATAACTCGTTGCCTTAA	0.692																																					Pancreas(29;54 1022 32760 50921)												0								ENSG00000116017						44.0	41.0	42.0					19																	972055		2158	4224	6382	ARID3A	SO:0001583	missense	0			-	HGNC	U88047	CCDS12050.1	19p13.3	2013-02-07	2006-11-08	2004-01-30		ENSG00000116017		"""-"""	3031	protein-coding gene	gene with protein product		603265	"""dead ringer-like 1 (Drosophila)"", ""AT rich interactive domain 3A (BRIGHT- like)"""	DRIL1		9722953	Standard	NM_005224		Approved	BRIGHT	uc002lql.3	Q99856		ENST00000263620.3:c.1772C>T	19.37:g.972055C>T	ENSP00000263620:p.Ser591Leu	Somatic	0	105	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	28	118	19.18	Q5I858|Q6P9C6|Q8IZA7|Q8N4Z3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ARID/BRIGHT_DNA-bd,superfamily_ARID/BRIGHT_DNA-bd,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	p.S591L	ENST00000263620.3	37	c.1772	CCDS12050.1	19	.	.	.	.	.	.	.	.	.	.	C	17.46	3.394405	0.62066	.	.	ENSG00000116017	ENST00000263620	T	0.49139	0.79	5.03	5.03	0.67393	.	12.725600	0.00166	N	0.000010	T	0.43831	0.1265	L	0.44542	1.39	0.30744	N	0.745881	P	0.43662	0.814	B	0.30943	0.122	T	0.52881	-0.8516	10	0.62326	D	0.03	-10.0608	13.8475	0.63477	0.0:1.0:0.0:0.0	.	591	Q99856	ARI3A_HUMAN	L	591	ENSP00000263620:S591L	ENSP00000263620:S591L	S	+	2	0	ARID3A	923055	0.989000	0.36119	0.992000	0.48379	0.970000	0.65996	3.106000	0.50322	2.328000	0.79073	0.561000	0.74099	TCG	-	NULL		0.692	ARID3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARID3A	protein_coding	OTTHUMT00000458219.1	C	NM_005224	-		972055	+1	no_errors	ENST00000263620	ensembl	human	known	74_37	missense	SNP	0.983	T
SALL1	6299	genome.wustl.edu	37	16	51175382	51175382	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr16:51175382G>A	ENST00000251020.4	-	2	784	c.751C>T	c.(751-753)Cgt>Tgt	p.R251C	SALL1_ENST00000562674.1_5'Flank|SALL1_ENST00000566102.1_Intron|SALL1_ENST00000541611.1_Intron|SALL1_ENST00000440970.1_Missense_Mutation_p.R154C	NM_002968.2	NP_002959.2	Q9NSC2	SALL1_HUMAN	spalt-like transcription factor 1	251					adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic digestive tract development (GO:0048566)|embryonic digit morphogenesis (GO:0042733)|forelimb morphogenesis (GO:0035136)|gonad development (GO:0008406)|heart development (GO:0007507)|hindlimb morphogenesis (GO:0035137)|histone deacetylation (GO:0016575)|inductive cell-cell signaling (GO:0031129)|kidney development (GO:0001822)|kidney epithelium development (GO:0072073)|limb development (GO:0060173)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|olfactory bulb interneuron differentiation (GO:0021889)|olfactory bulb mitral cell layer development (GO:0061034)|olfactory nerve development (GO:0021553)|outer ear morphogenesis (GO:0042473)|pituitary gland development (GO:0021983)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ureteric bud invasion (GO:0072092)|ventricular septum development (GO:0003281)	chromocenter (GO:0010369)|cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R251C(1)		NS(4)|breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(25)|lung(61)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	126		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			ATTTGGTGACGAATCTGTTCG	0.532																																					GBM(103;1352 1446 1855 4775 8890)												1	Substitution - Missense(1)	lung(1)						ENSG00000103449						85.0	88.0	87.0					16																	51175382		2198	4300	6498	SALL1	SO:0001583	missense	0			-	HGNC	X98833	CCDS10747.1, CCDS45483.1	16q12.1	2014-09-17	2013-10-17		ENSG00000103449	ENSG00000103449		"""Zinc fingers, C2H2-type"""	10524	protein-coding gene	gene with protein product		602218	"""sal (Drosophila)-like 1"", ""sal-like 1 (Drosophila)"""	TBS		9425907	Standard	NM_002968		Approved	Hsal1, ZNF794	uc021tie.1	Q9NSC2	OTTHUMG00000133176	ENST00000251020.4:c.751C>T	16.37:g.51175382G>A	ENSP00000251020:p.Arg251Cys	Somatic	0	44	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	47	14.55	Q99881|Q9NSC3|Q9P1R0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R251C	ENST00000251020.4	37	c.751	CCDS10747.1	16	.	.	.	.	.	.	.	.	.	.	G	19.67	3.871584	0.72065	.	.	ENSG00000103449	ENST00000251020;ENST00000440970;ENST00000457559	T;T	0.09350	3.02;2.99	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	T	0.29190	0.0726	L	0.48362	1.52	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.00611	-1.1645	10	0.54805	T	0.06	.	19.11	0.93313	0.0:0.0:1.0:0.0	.	251	Q9NSC2	SALL1_HUMAN	C	251;154;215	ENSP00000251020:R251C;ENSP00000407914:R154C	ENSP00000251020:R251C	R	-	1	0	SALL1	49732883	1.000000	0.71417	0.475000	0.27278	0.971000	0.66376	9.850000	0.99511	2.493000	0.84123	0.561000	0.74099	CGT	-	NULL		0.532	SALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SALL1	protein_coding	OTTHUMT00000256883.2	G	NM_002968	-		51175382	-1	no_errors	ENST00000251020	ensembl	human	known	74_37	missense	SNP	1.000	A
RNF150	57484	genome.wustl.edu	37	4	141847187	141847187	+	Missense_Mutation	SNP	C	C	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr4:141847187C>A	ENST00000515673.2	-	5	964	c.931G>T	c.(931-933)Gac>Tac	p.D311Y	RNF150_ENST00000379512.2_Missense_Mutation_p.D170Y|RNF150_ENST00000507500.1_Missense_Mutation_p.D311Y|RNF150_ENST00000306799.3_Missense_Mutation_p.D269Y|RNF150_ENST00000420921.2_Missense_Mutation_p.D170Y			Q9ULK6	RN150_HUMAN	ring finger protein 150	311						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			breast(1)|large_intestine(10)|lung(7)|ovary(1)	19	all_hematologic(180;0.162)					GTACGATGGTCTAGAAGCCAG	0.488																																																	0								ENSG00000170153						135.0	131.0	133.0					4																	141847187		2203	4300	6503	RNF150	SO:0001583	missense	0			-	HGNC	AB033040	CCDS34065.1	4q31.1	2013-01-09			ENSG00000170153	ENSG00000170153		"""RING-type (C3HC4) zinc fingers"""	23138	protein-coding gene	gene with protein product						10574462	Standard	XM_005263150		Approved	KIAA1214	uc003iio.1	Q9ULK6	OTTHUMG00000161380	ENST00000515673.2:c.931G>T	4.37:g.141847187C>A	ENSP00000425840:p.Asp311Tyr	Somatic	0	27	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	28	12.50	Q3T1D0|Q6ZNW6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Protease-assoc_domain,pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.D311Y	ENST00000515673.2	37	c.931	CCDS34065.1	4	.	.	.	.	.	.	.	.	.	.	C	28.9	4.958210	0.92726	.	.	ENSG00000170153	ENST00000379512;ENST00000420921;ENST00000306799;ENST00000515673;ENST00000507500;ENST00000506101	T;T;T;T;T;T	0.41758	0.99;0.99;0.99;0.99;0.99;0.99	5.95	5.95	0.96441	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, RING-H2-type (1);	0.051761	0.85682	D	0.000000	T	0.45054	0.1323	L	0.27944	0.81	0.80722	D	1	P;P;B	0.45768	0.866;0.516;0.389	P;B;B	0.48815	0.591;0.187;0.403	T	0.40496	-0.9560	10	0.87932	D	0	.	20.3932	0.98965	0.0:1.0:0.0:0.0	.	269;311;311	Q9ULK6-2;Q9ULK6-3;Q9ULK6	.;.;RN150_HUMAN	Y	170;170;269;311;311;142	ENSP00000368827:D170Y;ENSP00000394581:D170Y;ENSP00000304321:D269Y;ENSP00000425840:D311Y;ENSP00000425568:D311Y;ENSP00000425947:D142Y	ENSP00000304321:D269Y	D	-	1	0	RNF150	142066637	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.566000	0.82347	2.824000	0.97209	0.655000	0.94253	GAC	-	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING		0.488	RNF150-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF150	protein_coding	OTTHUMT00000364739.2	C	XM_291090	-		141847187	-1	no_errors	ENST00000515673	ensembl	human	known	74_37	missense	SNP	1.000	A
FAM230A	653203	genome.wustl.edu	37	22	20708719	20708719	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr22:20708719G>A	ENST00000434783.3	+	8	635	c.451G>A	c.(451-453)Gag>Aag	p.E151K	USP41_ENST00000454608.2_Intron|USP41_ENST00000486536.2_Intron					family with sequence similarity 230, member A																		CATCGCTAACGAGGACGCCGT	0.552																																																	0								ENSG00000188280																																			FAM230A	SO:0001583	missense	0			-	HGNC	JX456222		22q11.21	2014-08-13			ENSG00000188280	ENSG00000188280			45045	other	unknown							Standard	XM_006724099		Approved	DGCR15			OTTHUMG00000150686	ENST00000434783.3:c.451G>A	22.37:g.20708719G>A	ENSP00000463576:p.Glu151Lys	Somatic	0	62	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	49	26.87		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ret-finger_pr-like_3_antisense,superfamily_Kinase-like_dom	p.E151K	ENST00000434783.3	37	c.451		22																																																																																			-	superfamily_Kinase-like_dom		0.552	FAM230A-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	FAM230A	protein_coding	OTTHUMT00000319609.4	G		-		20708719	+1	no_errors	ENST00000434783	ensembl	human	known	74_37	missense	SNP	0.445	A
EML5	161436	genome.wustl.edu	37	14	89202819	89202819	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr14:89202819C>T	ENST00000380664.5	-	7	937	c.938G>A	c.(937-939)aGa>aAa	p.R313K	EML5_ENST00000352093.5_Missense_Mutation_p.R313K|EML5_ENST00000554922.1_Missense_Mutation_p.R313K			Q05BV3	EMAL5_HUMAN	echinoderm microtubule associated protein like 5	313						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	catalytic activity (GO:0003824)			breast(1)|endometrium(3)|kidney(4)|large_intestine(17)|lung(14)|ovary(3)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	50						AGGTTTATTTCTTTCTTGCAC	0.408																																																	0								ENSG00000165521						171.0	169.0	169.0					14																	89202819		1901	4108	6009	EML5	SO:0001583	missense	0			-	HGNC	AY357725	CCDS45148.1	14q31.3	2013-01-10				ENSG00000165521		"""WD repeat domain containing"""	18197	protein-coding gene	gene with protein product							Standard	NM_183387		Approved	HuEMAP-2, EMAP-2	uc021ryf.1	Q05BV3		ENST00000380664.5:c.938G>A	14.37:g.89202819C>T	ENSP00000370039:p.Arg313Lys	Somatic	0	47	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	59	14.49	B9EK59|Q5H9N6|Q6UYC9|Q6ZRP3|Q6ZT03	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,pfam_HELP,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R313K	ENST00000380664.5	37	c.938	CCDS45148.1	14	.	.	.	.	.	.	.	.	.	.	C	15.37	2.814590	0.50527	.	.	ENSG00000165521	ENST00000554922;ENST00000352093;ENST00000380664	T;T;T	0.01246	5.12;5.12;5.11	5.15	5.15	0.70609	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (2);WD40-repeat-containing domain (1);	0.120532	0.56097	D	0.000025	T	0.02156	0.0067	L	0.50333	1.59	0.54753	D	0.999986	B	0.19200	0.034	B	0.24006	0.05	T	0.46261	-0.9204	10	0.05620	T	0.96	-27.4633	18.8169	0.92079	0.0:1.0:0.0:0.0	.	313	Q05BV3	EMAL5_HUMAN	K	313	ENSP00000451998:R313K;ENSP00000298315:R313K;ENSP00000370039:R313K	ENSP00000298315:R313K	R	-	2	0	EML5	88272572	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.320000	0.79064	2.682000	0.91365	0.655000	0.94253	AGA	-	superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom		0.408	EML5-010	KNOWN	basic|CCDS	protein_coding	EML5	protein_coding	OTTHUMT00000410491.1	C		-		89202819	-1	no_errors	ENST00000554922	ensembl	human	known	74_37	missense	SNP	1.000	T
RFX6	222546	genome.wustl.edu	37	6	117237188	117237188	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr6:117237188G>A	ENST00000332958.2	+	8	814	c.798G>A	c.(796-798)atG>atA	p.M266I	RFX6_ENST00000471966.1_3'UTR	NM_173560.3	NP_775831.2	Q8HWS3	RFX6_HUMAN	regulatory factor X, 6	266					endocrine pancreas development (GO:0031018)|glucose homeostasis (GO:0042593)|pancreatic A cell differentiation (GO:0003310)|pancreatic D cell differentiation (GO:0003311)|pancreatic epsilon cell differentiation (GO:0090104)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of insulin secretion (GO:0050796)|transcription, DNA-templated (GO:0006351)|type B pancreatic cell differentiation (GO:0003309)	nucleus (GO:0005634)	transcription regulatory region DNA binding (GO:0044212)			cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(29)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	59						CGCTCATAATGATGTACAAAA	0.328																																																	0								ENSG00000185002						134.0	133.0	133.0					6																	117237188		2203	4300	6503	RFX6	SO:0001583	missense	0			-	HGNC	BC039248	CCDS5113.1	6q22.31	2008-08-04	2008-08-04	2008-08-04	ENSG00000185002	ENSG00000185002			21478	protein-coding gene	gene with protein product		612659	"""regulatory factor X domain containing 1"""	RFXDC1			Standard	NM_173560		Approved	MGC33442, dJ955L16.1	uc003pxm.3	Q8HWS3	OTTHUMG00000015449	ENST00000332958.2:c.798G>A	6.37:g.117237188G>A	ENSP00000332208:p.Met266Ile	Somatic	0	26	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	30	18.42	Q5T6B3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DNA-bd_RFX	p.M266I	ENST00000332958.2	37	c.798	CCDS5113.1	6	.	.	.	.	.	.	.	.	.	.	G	18.99	3.739609	0.69304	.	.	ENSG00000185002	ENST00000332958	T	0.56444	0.46	5.97	5.97	0.96955	.	0.075813	0.85682	D	0.000000	T	0.24774	0.0601	N	0.10972	0.075	0.80722	D	1	B	0.26041	0.14	B	0.23150	0.044	T	0.06826	-1.0805	10	0.37606	T	0.19	-19.7342	20.4324	0.99085	0.0:0.0:1.0:0.0	.	266	Q8HWS3	RFX6_HUMAN	I	266	ENSP00000332208:M266I	ENSP00000332208:M266I	M	+	3	0	RFX6	117343881	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.476000	0.97823	2.833000	0.97629	0.585000	0.79938	ATG	-	NULL		0.328	RFX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RFX6	protein_coding	OTTHUMT00000041970.2	G	NM_173560	-		117237188	+1	no_errors	ENST00000332958	ensembl	human	known	74_37	missense	SNP	1.000	A
ZBTB32	27033	genome.wustl.edu	37	19	36207192	36207192	+	Silent	SNP	C	C	G			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr19:36207192C>G	ENST00000392197.2	+	6	1500	c.1182C>G	c.(1180-1182)gtC>gtG	p.V394V	ZBTB32_ENST00000262630.3_Silent_p.V394V|KMT2B_ENST00000420124.1_5'Flank|KMT2B_ENST00000607650.1_RNA|KMT2B_ENST00000341701.1_5'Flank|KMT2B_ENST00000222270.7_5'Flank			Q9Y2Y4	ZBT32_HUMAN	zinc finger and BTB domain containing 32	394					DNA repair (GO:0006281)|hemopoiesis (GO:0030097)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of cytokine production (GO:0001817)|T cell proliferation (GO:0042098)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			large_intestine(5)|lung(1)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	14	all_lung(56;2.22e-07)|Lung NSC(56;3.47e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			ACTACCGAGTCCACACAGGTA	0.617																																																	0								ENSG00000011590						32.0	30.0	31.0					19																	36207192		2203	4300	6503	ZBTB32	SO:0001819	synonymous_variant	0			-	HGNC	AF130255	CCDS12471.1	19q13.1	2013-01-08			ENSG00000011590	ENSG00000011590		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	16763	protein-coding gene	gene with protein product	"""repressor of GATA"""	605859				10572087	Standard	XM_005258739		Approved	TZFP, FAZF, FAXF, Rog, ZNF538	uc002oay.3	Q9Y2Y4	OTTHUMG00000048118	ENST00000392197.2:c.1182C>G	19.37:g.36207192C>G		Somatic	0	40	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	30	14.29	Q8WVP2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.V394	ENST00000392197.2	37	c.1182	CCDS12471.1	19																																																																																			-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.617	ZBTB32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB32	protein_coding	OTTHUMT00000109491.3	C	NM_014383	-		36207192	+1	no_errors	ENST00000262630	ensembl	human	known	74_37	silent	SNP	0.996	G
ANKRD30A	91074	genome.wustl.edu	37	10	37430649	37430649	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr10:37430649G>A	ENST00000602533.1	+	7	755	c.656G>A	c.(655-657)gGa>gAa	p.G219E	ANKRD30A_ENST00000361713.1_Missense_Mutation_p.G219E|ANKRD30A_ENST00000374660.1_Missense_Mutation_p.G219E			Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	275					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(8)|endometrium(14)|kidney(21)|large_intestine(13)|lung(70)|ovary(8)|pancreas(1)|prostate(3)|skin(15)|stomach(1)|urinary_tract(3)	158						TTGGCAGAAGGAACATCTGCA	0.463																																																	0								ENSG00000148513						24.0	25.0	25.0					10																	37430649		1867	4096	5963	ANKRD30A	SO:0001583	missense	0			-	HGNC	AF269087	CCDS7193.1	10p11.21	2013-01-10			ENSG00000148513	ENSG00000148513		"""Ankyrin repeat domain containing"""	17234	protein-coding gene	gene with protein product	"""breast cancer antigen NY-BR-1"""	610856				11280766	Standard	NM_052997		Approved	NY-BR-1	uc001iza.1	Q9BXX3	OTTHUMG00000017968	ENST00000602533.1:c.656G>A	10.37:g.37430649G>A	ENSP00000473551:p.Gly219Glu	Somatic	0	72	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	84	18.45	Q5W025	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.G219E	ENST00000602533.1	37	c.656		10	.	.	.	.	.	.	.	.	.	.	.	2.913	-0.224929	0.06022	.	.	ENSG00000148513	ENST00000361713;ENST00000374660	T;T	0.30981	1.56;1.51	0.128	-0.256	0.12984	Ankyrin repeat-containing domain (1);	.	.	.	.	T	0.29620	0.0739	N	0.14661	0.345	0.09310	N	1	D	0.89917	1.0	D	0.80764	0.994	T	0.16719	-1.0393	8	0.34782	T	0.22	.	.	.	.	.	275	Q9BXX3	AN30A_HUMAN	E	219	ENSP00000354432:G219E;ENSP00000363792:G219E	ENSP00000354432:G219E	G	+	2	0	ANKRD30A	37470655	0.773000	0.28580	0.129000	0.21949	0.208000	0.24298	-0.037000	0.12164	-0.779000	0.04560	-0.763000	0.03452	GGA	-	NULL		0.463	ANKRD30A-001	KNOWN	NMD_exception|basic|appris_principal	protein_coding	ANKRD30A	protein_coding	OTTHUMT00000047588.2	G	NM_052997	-		37430649	+1	no_errors	ENST00000361713	ensembl	human	known	74_37	missense	SNP	0.177	A
GPAM	57678	genome.wustl.edu	37	10	113915640	113915640	+	Missense_Mutation	SNP	T	T	C			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr10:113915640T>C	ENST00000348367.4	-	20	2490	c.2293A>G	c.(2293-2295)Aga>Gga	p.R765G	GPAM_ENST00000369425.1_3'UTR|GPAM_ENST00000423155.1_Missense_Mutation_p.R765G			Q9HCL2	GPAT1_HUMAN	glycerol-3-phosphate acyltransferase, mitochondrial	765					acyl-CoA metabolic process (GO:0006637)|CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|defense response to virus (GO:0051607)|fatty acid homeostasis (GO:0055089)|fatty acid metabolic process (GO:0006631)|glycerophospholipid biosynthetic process (GO:0046474)|interleukin-2 secretion (GO:0070970)|negative regulation of activation-induced cell death of T cells (GO:0070236)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of multicellular organism growth (GO:0040018)|regulation of cytokine secretion (GO:0050707)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|plasma membrane (GO:0005886)	glycerol-3-phosphate O-acyltransferase activity (GO:0004366)			breast(2)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31				Epithelial(162;0.0306)|all cancers(201;0.123)		GCAACATTTCTTTCTGTTCTG	0.328																																					Ovarian(161;1017 2606 18293 52943)												0								ENSG00000119927						110.0	103.0	106.0					10																	113915640		2203	4300	6503	GPAM	SO:0001583	missense	0			-	HGNC	AL832464	CCDS7570.1	10q25.3	2009-07-15			ENSG00000119927	ENSG00000119927			24865	protein-coding gene	gene with protein product	"""glycerol-3-phosphate acyltransferase 1, mitochondrial"""	602395				10997877, 8369314	Standard	NM_020918		Approved	KIAA1560, MGC26846, GPAT1	uc001kzp.3	Q9HCL2	OTTHUMG00000019055	ENST00000348367.4:c.2293A>G	10.37:g.113915640T>C	ENSP00000265276:p.Arg765Gly	Somatic	0	55	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	68	19.77	Q5VW51|Q86TA3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Plipid/glycerol_acylTrfase,smart_Plipid/glycerol_acylTrfase	p.R765G	ENST00000348367.4	37	c.2293	CCDS7570.1	10	.	.	.	.	.	.	.	.	.	.	T	11.61	1.688804	0.29962	.	.	ENSG00000119927	ENST00000348367;ENST00000423155	T;T	0.68765	-0.35;-0.35	5.08	3.91	0.45181	.	0.109566	0.64402	D	0.000010	T	0.50650	0.1628	L	0.27053	0.805	0.42793	D	0.993902	P	0.34522	0.455	B	0.34346	0.18	T	0.41980	-0.9478	10	0.25106	T	0.35	-18.9467	10.895	0.47017	0.0:0.0:0.1575:0.8425	.	765	Q9HCL2	GPAT1_HUMAN	G	765	ENSP00000265276:R765G;ENSP00000409242:R765G	ENSP00000265276:R765G	R	-	1	2	GPAM	113905630	0.965000	0.33210	0.669000	0.29828	0.967000	0.64934	3.547000	0.53663	0.838000	0.34948	0.533000	0.62120	AGA	-	NULL		0.328	GPAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPAM	protein_coding	OTTHUMT00000050377.1	T	NM_020918	-		113915640	-1	no_errors	ENST00000348367	ensembl	human	known	74_37	missense	SNP	1.000	C
BRINP1	1620	genome.wustl.edu	37	9	121929585	121929585	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr9:121929585G>A	ENST00000265922.3	-	8	2524	c.2063C>T	c.(2062-2064)tCc>tTc	p.S688F	BRINP1_ENST00000482797.1_Intron	NM_014618.2	NP_055433.2	O60477	BRNP1_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 1	688					cell cycle arrest (GO:0007050)|cell death (GO:0008219)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell cycle (GO:0045786)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	cytoplasm (GO:0005737)											TGACGAAGAGGAATAGAACTG	0.582																																																	0								ENSG00000078725						138.0	133.0	135.0					9																	121929585		2203	4300	6503	BRINP1	SO:0001583	missense	0			-	HGNC	AF027734	CCDS6822.1	9q32-q33	2013-08-06	2013-08-06	2013-07-31	ENSG00000078725	ENSG00000078725			2687	protein-coding gene	gene with protein product		602865	"""deleted in bladder cancer chromosome region candidate 1"", ""deleted in bladder cancer 1"""	DBCCR1, DBC1		9175739, 10444335, 15193422	Standard	NM_014618		Approved	FAM5A	uc004bkc.2	O60477	OTTHUMG00000021020	ENST00000265922.3:c.2063C>T	9.37:g.121929585G>A	ENSP00000265922:p.Ser688Phe	Somatic	0	24	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	24	22.58	Q6IPV6|Q6P1A0|Q8WU22	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MACPF,smart_MACPF	p.S688F	ENST00000265922.3	37	c.2063	CCDS6822.1	9	.	.	.	.	.	.	.	.	.	.	G	15.83	2.948209	0.53186	.	.	ENSG00000078725	ENST00000373969;ENST00000265922	T	0.16073	2.37	5.73	4.83	0.62350	.	0.119025	0.64402	D	0.000012	T	0.18923	0.0454	L	0.36672	1.1	0.80722	D	1	B	0.26258	0.145	B	0.31191	0.125	T	0.03641	-1.1017	10	0.87932	D	0	-20.1001	17.0691	0.86568	0.0:0.1271:0.8729:0.0	.	688	O60477	DBC1_HUMAN	F	688	ENSP00000265922:S688F	ENSP00000265922:S688F	S	-	2	0	DBC1	120969406	1.000000	0.71417	0.619000	0.29118	0.500000	0.33767	9.734000	0.98822	1.550000	0.49438	0.650000	0.86243	TCC	-	NULL		0.582	BRINP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRINP1	protein_coding	OTTHUMT00000055440.2	G	NM_014618	-		121929585	-1	no_errors	ENST00000265922	ensembl	human	known	74_37	missense	SNP	1.000	A
DSE	29940	genome.wustl.edu	37	6	116758475	116758475	+	Nonsense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr6:116758475G>A	ENST00000331677.3	+	7	3288	c.2844G>A	c.(2842-2844)tgG>tgA	p.W948*	DSE_ENST00000359564.2_Nonsense_Mutation_p.W948*|DSE_ENST00000452085.3_Nonsense_Mutation_p.W948*|DSE_ENST00000537543.1_Nonsense_Mutation_p.W967*			Q9UL01	DSE_HUMAN	dermatan sulfate epimerase	948					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	chondroitin-glucuronate 5-epimerase activity (GO:0047757)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(2)|lung(12)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35		all_cancers(87;0.00019)|all_epithelial(87;0.000416)|Ovarian(999;0.133)|Colorectal(196;0.234)		Epithelial(106;0.00915)|OV - Ovarian serous cystadenocarcinoma(136;0.0149)|GBM - Glioblastoma multiforme(226;0.0189)|all cancers(137;0.0262)		TTTTATTATGGTTGTACTCTT	0.373																																																	0								ENSG00000111817						57.0	60.0	59.0					6																	116758475		2203	4300	6503	DSE	SO:0001587	stop_gained	0			-	HGNC	AF098066	CCDS5107.1	6q22	2008-02-05	2007-01-29	2007-01-29	ENSG00000111817	ENSG00000111817	5.1.3.19		21144	protein-coding gene	gene with protein product		605942	"""squamous cell carcinoma antigen recognized by T cells 2"""	SART2		11920522, 16505484	Standard	NM_001080976		Approved	DSEPI	uc003pws.3	Q9UL01	OTTHUMG00000015434	ENST00000331677.3:c.2844G>A	6.37:g.116758475G>A	ENSP00000332151:p.Trp948*	Somatic	0	50	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	51	16.39	Q5R3K6	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_Chondroitin_lyas	p.W967*	ENST00000331677.3	37	c.2901	CCDS5107.1	6	.	.	.	.	.	.	.	.	.	.	G	38	6.932228	0.97944	.	.	ENSG00000111817	ENST00000452085;ENST00000537543;ENST00000331677;ENST00000359564	.	.	.	6.02	6.02	0.97574	.	0.112086	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.5895	20.5373	0.99239	0.0:0.0:1.0:0.0	.	.	.	.	X	948;967;948;948	.	ENSP00000332151:W948X	W	+	3	0	DSE	116865168	1.000000	0.71417	1.000000	0.80357	0.812000	0.45895	5.127000	0.64727	2.857000	0.98124	0.650000	0.86243	TGG	-	NULL		0.373	DSE-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DSE	protein_coding	OTTHUMT00000041940.2	G	NM_013352	-		116758475	+1	no_errors	ENST00000537543	ensembl	human	known	74_37	nonsense	SNP	1.000	A
MYO15A	51168	genome.wustl.edu	37	17	18059639	18059639	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr17:18059639G>A	ENST00000205890.5	+	48	8928	c.8590G>A	c.(8590-8592)Gag>Aag	p.E2864K	MYO15A_ENST00000418233.3_Missense_Mutation_p.E128K	NM_016239.3	NP_057323.3	Q9UKN7	MYO15_HUMAN	myosin XVA	2864	Tail.				inner ear morphogenesis (GO:0042472)|locomotory behavior (GO:0007626)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|stereocilium (GO:0032420)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(5)|central_nervous_system(2)|endometrium(17)|kidney(3)|large_intestine(16)|lung(27)|ovary(3)|pancreas(1)|prostate(6)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	99	all_neural(463;0.228)					CTTCATCTTGGAGCTGAAGAA	0.547																																																	0								ENSG00000091536						72.0	70.0	71.0					17																	18059639		1972	4159	6131	MYO15A	SO:0001583	missense	0			-	HGNC	AF144094	CCDS42271.1	17p11.2	2011-09-27			ENSG00000091536	ENSG00000091536		"""Myosins / Myosin superfamily : Class XV"""	7594	protein-coding gene	gene with protein product		602666		DFNB3, MYO15		9603736	Standard	NM_016239		Approved		uc021trl.1	Q9UKN7	OTTHUMG00000059390	ENST00000205890.5:c.8590G>A	17.37:g.18059639G>A	ENSP00000205890:p.Glu2864Lys	Somatic	0	30	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	41	12.77	B4DFC7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Myosin_head_motor_dom,pfam_MyTH4_dom,pfam_SH3_2,pfam_FERM_central,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,superfamily_FERM_central,superfamily_SH3_domain,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,smart_MyTH4_dom,smart_SH3_domain,smart_Band_41_domain,pfscan_FERM_domain,pfscan_IQ_motif_EF-hand-BS,pfscan_MyTH4_dom,prints_Myosin_head_motor_dom	p.E2864K	ENST00000205890.5	37	c.8590	CCDS42271.1	17	.	.	.	.	.	.	.	.	.	.	G	15.19	2.758906	0.49468	.	.	ENSG00000091536	ENST00000205890;ENST00000536811	D	0.89939	-2.59	4.41	4.41	0.53225	.	.	.	.	.	D	0.93003	0.7773	M	0.61703	1.905	0.80722	D	1	D;D;D	0.76494	0.994;0.987;0.999	P;P;D	0.80764	0.856;0.904;0.994	D	0.92874	0.6317	9	0.44086	T	0.13	.	15.9789	0.80091	0.0:0.0:1.0:0.0	.	63;128;2864	B7Z6L1;B4DFC7;Q9UKN7	.;.;MYO15_HUMAN	K	2864;63	ENSP00000205890:E2864K	ENSP00000205890:E2864K	E	+	1	0	MYO15A	18000364	1.000000	0.71417	0.998000	0.56505	0.627000	0.37826	9.402000	0.97298	2.005000	0.58758	0.462000	0.41574	GAG	-	NULL		0.547	MYO15A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO15A	protein_coding	OTTHUMT00000132048.1	G	NM_016239	-		18059639	+1	no_errors	ENST00000205890	ensembl	human	known	74_37	missense	SNP	1.000	A
SLC26A9	115019	genome.wustl.edu	37	1	205897105	205897105	+	Silent	SNP	G	G	A	rs530666216		TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr1:205897105G>A	ENST00000367135.3	-	9	1139	c.1026C>T	c.(1024-1026)atC>atT	p.I342I	SLC26A9_ENST00000367134.2_Silent_p.I342I|SLC26A9_ENST00000340781.4_Silent_p.I342I	NM_052934.3	NP_443166.1	Q7LBE3	S26A9_HUMAN	solute carrier family 26 (anion exchanger), member 9	342					anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|positive regulation of gene expression (GO:0010628)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	anion:anion antiporter activity (GO:0015301)|ATPase binding (GO:0051117)|bicarbonate transmembrane transporter activity (GO:0015106)|chloride channel activity (GO:0005254)|secondary active sulfate transmembrane transporter activity (GO:0008271)			NS(1)|breast(3)|endometrium(11)|kidney(1)|large_intestine(6)|lung(17)|ovary(1)|skin(7)|urinary_tract(5)	52	Breast(84;0.201)		BRCA - Breast invasive adenocarcinoma(75;0.0458)			CGTAGCTCACGATGGCTAGGG	0.622													G|||	1	0.000199681	0.0	0.0	5008	,	,		20760	0.001		0.0	False		,,,				2504	0.0																0								ENSG00000174502						91.0	77.0	82.0					1																	205897105		2203	4300	6503	SLC26A9	SO:0001819	synonymous_variant	0			-	HGNC	AF331525	CCDS30989.1, CCDS30990.1	1q32.1	2013-07-18	2013-07-18		ENSG00000174502	ENSG00000174502		"""Solute carriers"""	14469	protein-coding gene	gene with protein product	"""anion transporter/exchanger-9"""	608481	"""solute carrier family 26, member 9"""			11834742	Standard	NM_134325		Approved		uc001hdp.3	Q7LBE3	OTTHUMG00000036001	ENST00000367135.3:c.1026C>T	1.37:g.205897105G>A		Somatic	0	37	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	34	19.05	A7E2V6|B1AVM8|B1AVM9|B7ZKK2|Q96PK9|Q96RN0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Sulph_transpt,pfam_STAS_dom,superfamily_STAS_dom,pfscan_STAS_dom,tigrfam_SulP_transpt	p.I342	ENST00000367135.3	37	c.1026	CCDS30990.1	1																																																																																			-	pfam_Sulph_transpt,tigrfam_SulP_transpt		0.622	SLC26A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC26A9	protein_coding	OTTHUMT00000087742.1	G	NM_052934	-		205897105	-1	no_errors	ENST00000340781	ensembl	human	known	74_37	silent	SNP	0.873	A
ATG2B	55102	genome.wustl.edu	37	14	96768417	96768417	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr14:96768417G>A	ENST00000359933.4	-	34	5959	c.5066C>T	c.(5065-5067)cCa>cTa	p.P1689L	ATG2B_ENST00000261834.5_5'UTR	NM_018036.5	NP_060506	Q96BY7	ATG2B_HUMAN	autophagy related 2B	1689					autophagic vacuole assembly (GO:0000045)|cellular response to nitrogen starvation (GO:0006995)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)	extrinsic component of membrane (GO:0019898)|lipid particle (GO:0005811)|pre-autophagosomal structure (GO:0000407)				breast(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(11)|liver(1)|lung(26)|ovary(1)|prostate(1)|skin(1)|urinary_tract(7)	64		all_cancers(154;0.0462)|all_epithelial(191;0.123)|Melanoma(154;0.155)		Epithelial(152;0.21)|COAD - Colon adenocarcinoma(157;0.244)		GCCAGATTCTGGACACACGTG	0.453																																																	0								ENSG00000066739						81.0	71.0	75.0					14																	96768417		2203	4300	6503	ATG2B	SO:0001583	missense	0			-	HGNC	AK001104	CCDS9944.2	14q32.31	2014-02-12	2012-06-06	2007-07-31	ENSG00000066739	ENSG00000066739			20187	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 103"", ""ATG2 autophagy related 2 homolog B (S. cerevisiae)"""	C14orf103		22350415	Standard	NM_018036		Approved	FLJ10242	uc001yfi.3	Q96BY7	OTTHUMG00000149933	ENST00000359933.4:c.5066C>T	14.37:g.96768417G>A	ENSP00000353010:p.Pro1689Leu	Somatic	0	67	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	68	18.07	Q6ZRE7|Q96DQ3|Q9NW80	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Autophagy-rel_C	p.P1689L	ENST00000359933.4	37	c.5066	CCDS9944.2	14	.	.	.	.	.	.	.	.	.	.	G	35	5.439457	0.96168	.	.	ENSG00000066739	ENST00000359933	T	0.18810	2.19	5.75	5.75	0.90469	.	0.205916	0.52532	D	0.000073	T	0.55386	0.1917	M	0.87097	2.86	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.57619	-0.7780	10	0.54805	T	0.06	.	20.312	0.98644	0.0:0.0:1.0:0.0	.	1689	Q96BY7	ATG2B_HUMAN	L	1689	ENSP00000353010:P1689L	ENSP00000261834:P333L	P	-	2	0	ATG2B	95838170	1.000000	0.71417	0.944000	0.38274	0.983000	0.72400	9.118000	0.94355	2.880000	0.98712	0.655000	0.94253	CCA	-	NULL		0.453	ATG2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATG2B	protein_coding	OTTHUMT00000314037.1	G	NM_018036	-		96768417	-1	no_errors	ENST00000359933	ensembl	human	known	74_37	missense	SNP	1.000	A
ME1	4199	genome.wustl.edu	37	6	84025054	84025054	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr6:84025054C>T	ENST00000369705.3	-	6	795	c.679G>A	c.(679-681)Gaa>Aaa	p.E227K	ME1_ENST00000543031.1_Missense_Mutation_p.E152K|ME1_ENST00000541327.1_Missense_Mutation_p.E61K	NM_002395.4	NP_002386.1	P48163	MAOX_HUMAN	malic enzyme 1, NADP(+)-dependent, cytosolic	227					carbohydrate metabolic process (GO:0005975)|cellular lipid metabolic process (GO:0044255)|malate metabolic process (GO:0006108)|NADP biosynthetic process (GO:0006741)|protein tetramerization (GO:0051262)|response to carbohydrate (GO:0009743)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	ADP binding (GO:0043531)|electron carrier activity (GO:0009055)|malate dehydrogenase (decarboxylating) (NAD+) activity (GO:0004471)|malate dehydrogenase (decarboxylating) (NADP+) activity (GO:0004473)|malic enzyme activity (GO:0004470)|manganese ion binding (GO:0030145)|NAD binding (GO:0051287)|NADP binding (GO:0050661)|oxaloacetate decarboxylase activity (GO:0008948)			NS(2)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(7)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	36		all_cancers(76;1.28e-06)|Acute lymphoblastic leukemia(125;5.03e-07)|all_hematologic(105;0.000238)|all_epithelial(107;0.00218)		BRCA - Breast invasive adenocarcinoma(397;0.0641)		TCCATGAATTCGTCCAAAAAA	0.303																																																	0								ENSG00000065833						107.0	109.0	109.0					6																	84025054		2203	4299	6502	ME1	SO:0001583	missense	0			-	HGNC	X77244	CCDS34492.1	6q12	2012-10-02			ENSG00000065833	ENSG00000065833	1.1.1.40		6983	protein-coding gene	gene with protein product		154250				8187880	Standard	NM_002395		Approved		uc003pjy.3	P48163	OTTHUMG00000015111	ENST00000369705.3:c.679G>A	6.37:g.84025054C>T	ENSP00000358719:p.Glu227Lys	Somatic	0	95	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	97	18.33	B4DZ70|Q16797|Q16855|Q53F72|Q5VWA2|Q9BWX8|Q9H1W3|Q9UIY4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Malic_NAD-bd,pfam_Malic_N,smart_Malic_NAD-bd,prints_Malic_OxRdtase	p.E227K	ENST00000369705.3	37	c.679	CCDS34492.1	6	.	.	.	.	.	.	.	.	.	.	C	19.23	3.786789	0.70337	.	.	ENSG00000065833	ENST00000369705;ENST00000541327;ENST00000543031	T;T;T	0.34072	1.38;1.38;1.38	5.76	4.88	0.63580	Malic enzyme, N-terminal (2);	0.095142	0.64402	D	0.000001	T	0.37892	0.1020	M	0.62723	1.935	0.53005	D	0.999961	D	0.55605	0.972	P	0.53450	0.726	T	0.39761	-0.9598	10	0.87932	D	0	-11.155	13.4751	0.61303	0.157:0.843:0.0:0.0	.	227	P48163	MAOX_HUMAN	K	227;61;152	ENSP00000358719:E227K;ENSP00000439912:E61K;ENSP00000446114:E152K	ENSP00000358719:E227K	E	-	1	0	ME1	84081773	1.000000	0.71417	1.000000	0.80357	0.492000	0.33523	5.588000	0.67517	1.430000	0.47334	-0.195000	0.12781	GAA	-	pfam_Malic_N		0.303	ME1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ME1	protein_coding	OTTHUMT00000041350.1	C		-		84025054	-1	no_errors	ENST00000369705	ensembl	human	known	74_37	missense	SNP	1.000	T
COLQ	8292	genome.wustl.edu	37	3	15515533	15515533	+	Missense_Mutation	SNP	C	C	T	rs374783562		TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr3:15515533C>T	ENST00000383788.5	-	10	735	c.610G>A	c.(610-612)Gga>Aga	p.G204R	COLQ_ENST00000383781.4_Missense_Mutation_p.G194R|COLQ_ENST00000383787.2_Missense_Mutation_p.G195R|COLQ_ENST00000383785.2_Missense_Mutation_p.G204R|COLQ_ENST00000435459.2_Intron|COLQ_ENST00000603808.1_Missense_Mutation_p.G204R|COLQ_ENST00000383786.5_Missense_Mutation_p.G170R	NM_005677.3	NP_005668.2	Q9Y215	COLQ_HUMAN	collagen-like tail subunit (single strand of homotrimer) of asymmetric acetylcholinesterase	204	Collagen-like 1.				acetylcholine catabolic process in synaptic cleft (GO:0001507)|asymmetric protein localization (GO:0008105)	basal lamina (GO:0005605)|cell junction (GO:0030054)|collagen trimer (GO:0005581)|extracellular space (GO:0005615)|synapse (GO:0045202)				endometrium(2)|large_intestine(4)|lung(10)|skin(3)	19						CCAGGAAATCCTGGGAAACCC	0.408																																																	0								ENSG00000206561	C	ARG/GLY,ARG/GLY,ARG/GLY	0,4406		0,0,2203	100.0	91.0	94.0		610,580,508	5.8	1.0	3		94	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	COLQ	NM_005677.3,NM_080538.2,NM_080539.3	125,125,125	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging	204/456,194/446,170/422	15515533	1,13005	2203	4300	6503	COLQ	SO:0001583	missense	0			-	HGNC	AF057036	CCDS33709.1, CCDS43057.1, CCDS46768.1	3p	2008-07-18			ENSG00000206561	ENSG00000206561			2226	protein-coding gene	gene with protein product	"""single strand of homotrimeric collagen-like tail subunit of asymmetric acetylcholinesterase"", ""collagenic tail of endplate acetylcholinesterase"", ""AChE Q subunit"", ""acetylcholinesterase-associated collagen"""	603033				9689136	Standard	NM_005677		Approved	EAD	uc003bzx.3	Q9Y215	OTTHUMG00000156233	ENST00000383788.5:c.610G>A	3.37:g.15515533C>T	ENSP00000373298:p.Gly204Arg	Somatic	0	47	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	58	20.55	B3KY09|Q6DK18|Q6YH18|Q6YH19|Q6YH20|Q6YH21|Q9NP18|Q9NP19|Q9NP20|Q9NP21|Q9NP22|Q9NP23|Q9NP24|Q9UP88	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Collagen,tigrfam_Myxo_disulph_rpt	p.G204R	ENST00000383788.5	37	c.610	CCDS33709.1	3	.	.	.	.	.	.	.	.	.	.	C	18.51	3.639006	0.67130	0.0	1.16E-4	ENSG00000206561	ENST00000383787;ENST00000383781;ENST00000383785;ENST00000383788;ENST00000420589;ENST00000454772;ENST00000383786;ENST00000430319	D;D;D;D;D	0.99488	-6.0;-6.0;-6.0;-6.0;-6.0	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	D	0.99792	0.9912	H	0.99347	4.525	0.80722	D	1	D;D;D;D	0.89917	1.0;0.988;1.0;1.0	D;D;D;D	0.97110	1.0;0.938;0.999;1.0	D	0.96939	0.9686	10	0.87932	D	0	-8.6204	16.9129	0.86144	0.0:1.0:0.0:0.0	.	170;195;204;194	Q9Y215-3;Q9Y215-5;Q9Y215;Q9Y215-2	.;.;COLQ_HUMAN;.	R	195;194;204;204;194;204;170;147	ENSP00000373297:G195R;ENSP00000373291:G194R;ENSP00000373295:G204R;ENSP00000373298:G204R;ENSP00000373296:G170R	ENSP00000373291:G194R	G	-	1	0	COLQ	15490537	1.000000	0.71417	0.981000	0.43875	0.951000	0.60555	5.772000	0.68889	2.744000	0.94065	0.561000	0.74099	GGA	-	NULL		0.408	COLQ-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	COLQ	protein_coding	OTTHUMT00000343575.1	C	NM_005677	-		15515533	-1	no_errors	ENST00000383788	ensembl	human	known	74_37	missense	SNP	1.000	T
SEMA3G	56920	genome.wustl.edu	37	3	52473941	52473941	+	Silent	SNP	G	G	A	rs149338010		TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr3:52473941G>A	ENST00000231721.2	-	11	1316	c.1317C>T	c.(1315-1317)atC>atT	p.I439I		NM_020163.1	NP_064548.1	Q9NS98	SEM3G_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3G	439	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				multicellular organismal development (GO:0007275)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	receptor activity (GO:0004872)			kidney(1)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)	18				BRCA - Breast invasive adenocarcinoma(193;1.69e-05)|Kidney(197;0.00173)|KIRC - Kidney renal clear cell carcinoma(197;0.00196)|OV - Ovarian serous cystadenocarcinoma(275;0.0333)		GGTCCACCACGATCTGGTGTA	0.637																																																	0								ENSG00000010319						75.0	76.0	76.0					3																	52473941		2203	4300	6503	SEMA3G	SO:0001819	synonymous_variant	0			-	HGNC		CCDS2856.1	3p21.1	2013-01-11			ENSG00000010319	ENSG00000010319		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	30400	protein-coding gene	gene with protein product						11214971	Standard	XM_005265327		Approved	FLJ00014, sem2	uc003dea.1	Q9NS98	OTTHUMG00000158570	ENST00000231721.2:c.1317C>T	3.37:g.52473941G>A		Somatic	0	57	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	62	16.22	Q7L9D9|Q9H7Q3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Semap_dom,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,pfscan_Semap_dom,pfscan_Ig-like_dom	p.I439	ENST00000231721.2	37	c.1317	CCDS2856.1	3																																																																																			-	pfam_Semap_dom,superfamily_Semap_dom,smart_Semap_dom,pfscan_Semap_dom		0.637	SEMA3G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA3G	protein_coding	OTTHUMT00000351354.1	G	NM_020163	-		52473941	-1	no_errors	ENST00000231721	ensembl	human	known	74_37	silent	SNP	0.030	A
TACC2	10579	genome.wustl.edu	37	10	123845786	123845786	+	Silent	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr10:123845786C>T	ENST00000369005.1	+	4	4111	c.3771C>T	c.(3769-3771)tcC>tcT	p.S1257S	TACC2_ENST00000513429.1_Intron|TACC2_ENST00000334433.3_Silent_p.S1257S|TACC2_ENST00000515273.1_Silent_p.S1257S|TACC2_ENST00000358010.1_Intron|TACC2_ENST00000453444.2_Silent_p.S1257S|TACC2_ENST00000515603.1_Silent_p.S1257S	NM_206862.2	NP_996744.2	O95359	TACC2_HUMAN	transforming, acidic coiled-coil containing protein 2	1257					astral microtubule organization (GO:0030953)|cerebral cortex development (GO:0021987)|interkinetic nuclear migration (GO:0022027)|neurogenesis (GO:0022008)|regulation of microtubule-based process (GO:0032886)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	nuclear hormone receptor binding (GO:0035257)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(15)|lung(27)|ovary(6)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	83		all_neural(114;0.0656)|Lung NSC(174;0.136)|all_lung(145;0.17)|Breast(234;0.197)				AAGCTGTTTCCTCTGCAGACC	0.592																																																	0								ENSG00000138162						74.0	82.0	79.0					10																	123845786		2203	4300	6503	TACC2	SO:0001819	synonymous_variant	0			-	HGNC	AF095791	CCDS7625.1, CCDS7626.1, CCDS7627.1, CCDS7628.1	10q26	2008-07-29			ENSG00000138162	ENSG00000138162			11523	protein-coding gene	gene with protein product		605302				14767476	Standard	XM_005269388		Approved	AZU-1	uc001lfv.3	O95359	OTTHUMG00000019181	ENST00000369005.1:c.3771C>T	10.37:g.123845786C>T		Somatic	0	29	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	40	16.67	Q4VXL0|Q4VXL3|Q4VXL6|Q4VXL7|Q5U5T7|Q86WG6|Q86WG7|Q8TCK9|Q9BVQ1|Q9NZ41|Q9NZR5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_TACC	p.S1257	ENST00000369005.1	37	c.3771	CCDS7626.1	10																																																																																			-	NULL		0.592	TACC2-001	KNOWN	basic|CCDS	protein_coding	TACC2	protein_coding	OTTHUMT00000090004.1	C		-		123845786	+1	no_errors	ENST00000334433	ensembl	human	known	74_37	silent	SNP	0.000	T
TBC1D3F	84218	genome.wustl.edu	37	17	36287676	36287676	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr17:36287676C>T	ENST00000327454.6	+	5	351	c.205C>T	c.(205-207)Cgg>Tgg	p.R69W	TBC1D3F_ENST00000378174.5_Missense_Mutation_p.R69W|TBC1D3F_ENST00000539424.1_5'UTR|TBC1D3F_ENST00000505415.1_Missense_Mutation_p.R69W	NM_032258.2	NP_115634.2	A6NER0	TBC3F_HUMAN	TBC1 domain family, member 3F	69						plasma membrane (GO:0005886)	Rab GTPase activator activity (GO:0005097)			liver(1)|pancreas(1)	2						ACAGCAAATTCGGCGGGAGAT	0.577																																																	0								ENSG00000185128						1.0	1.0	1.0					17																	36287676		88	300	388	TBC1D3F	SO:0001583	missense	0			-	HGNC			17q12	2014-09-16				ENSG00000275954			18257	protein-coding gene	gene with protein product		610809				16863688	Standard	NM_032258		Approved			A6NER0	OTTHUMG00000188428	ENST00000327454.6:c.205C>T	17.37:g.36287676C>T	ENSP00000329256:p.Arg69Trp	Somatic	0	36	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	34	20.93		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.R69W	ENST00000327454.6	37	c.205	CCDS45657.1	17	.	.	.	.	.	.	.	.	.	.	c	7.856	0.724954	0.15439	.	.	ENSG00000185128	ENST00000327454;ENST00000378174;ENST00000505415	T;T;T	0.34275	1.37;1.37;1.37	.	.	.	.	1.221300	0.06049	U	0.656316	T	0.31544	0.0800	M	0.64997	1.995	0.80722	D	1	B;B;B;B	0.32604	0.034;0.377;0.004;0.021	B;B;B;B	0.22601	0.009;0.04;0.003;0.007	T	0.22452	-1.0216	9	0.51188	T	0.08	.	5.9051	0.18992	0.0:0.9992:0.0:8.0E-4	.	69;69;69;69	B9A6J9;A6NFD7;P0C7X1;A6NER0	.;.;TBC3H_HUMAN;TBC3F_HUMAN	W	69	ENSP00000329256:R69W;ENSP00000367416:R69W;ENSP00000421962:R69W	ENSP00000329256:R69W	R	+	1	2	TBC1D3F	33362058	0.878000	0.30173	0.019000	0.16419	0.019000	0.09904	1.756000	0.38390	0.119000	0.18210	0.121000	0.15741	CGG	-	NULL		0.577	TBC1D3F-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TBC1D3F	protein_coding	OTTHUMT00000256100.3	C	NM_032258.2	-		36287676	+1	no_errors	ENST00000327454	ensembl	human	known	74_37	missense	SNP	0.884	T
TMEM119	338773	genome.wustl.edu	37	12	108985691	108985691	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr12:108985691C>T	ENST00000392806.3	-	2	637	c.469G>A	c.(469-471)Gcc>Acc	p.A157T		NM_181724.2	NP_859075.2	Q4V9L6	TM119_HUMAN	transmembrane protein 119	157					osteoblast differentiation (GO:0001649)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				large_intestine(2)|lung(3)|ovary(1)|skin(1)	7						CTGTCGGGGGCTCTGTCGGGG	0.682																																																	0								ENSG00000183160						14.0	19.0	17.0					12																	108985691		2182	4274	6456	TMEM119	SO:0001583	missense	0			-	HGNC	AK075501	CCDS9119.1	12q23.3	2014-02-12				ENSG00000183160			27884	protein-coding gene	gene with protein product						12975309	Standard	NM_181724		Approved		uc001tng.3	Q4V9L6		ENST00000392806.3:c.469G>A	12.37:g.108985691C>T	ENSP00000376553:p.Ala157Thr	Somatic	0	71	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	93	15.45	Q6UXE5|Q8N2F5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.A157T	ENST00000392806.3	37	c.469	CCDS9119.1	12	.	.	.	.	.	.	.	.	.	.	C	12.36	1.914320	0.33815	.	.	ENSG00000183160	ENST00000392806;ENST00000433191	T	0.50813	0.73	4.53	3.56	0.40772	.	0.248895	0.40469	N	0.001086	T	0.45236	0.1332	L	0.53249	1.67	0.31606	N	0.65212	P	0.40431	0.717	B	0.41271	0.352	T	0.57556	-0.7791	10	0.40728	T	0.16	-8.9073	13.8515	0.63499	0.0:0.728:0.272:0.0	.	157	Q4V9L6	TM119_HUMAN	T	157;91	ENSP00000376553:A157T	ENSP00000376553:A157T	A	-	1	0	TMEM119	107509820	0.489000	0.26004	0.443000	0.26883	0.621000	0.37620	1.126000	0.31344	2.257000	0.74773	0.407000	0.27541	GCC	-	NULL		0.682	TMEM119-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM119	protein_coding	OTTHUMT00000403900.1	C	NM_181724	-		108985691	-1	no_errors	ENST00000392806	ensembl	human	known	74_37	missense	SNP	0.911	T
OR4K13	390433	genome.wustl.edu	37	14	20502851	20502851	+	Missense_Mutation	SNP	G	G	A	rs372530966		TCGA-QQ-A8VG-01A-11D-A37C-09	TCGA-QQ-A8VG-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7b5b6759-0ab9-4272-b4b4-22cd138ed5a8	3f6bb728-6cc8-483f-85a4-4841d1d31718	g.chr14:20502851G>A	ENST00000315693.2	-	1	68	c.67C>T	c.(67-69)Ctt>Ttt	p.L23F	AL359218.1_ENST00000580563.1_RNA	NM_001004714.1	NP_001004714.1	Q8NH42	OR4KD_HUMAN	olfactory receptor, family 4, subfamily K, member 13	23						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|kidney(1)|large_intestine(2)|lung(11)|ovary(3)|skin(4)	24	all_cancers(95;0.00108)		Epithelial(56;4.65e-07)|all cancers(55;2.9e-06)	GBM - Glioblastoma multiforme(265;0.0064)		AAAATCTGAAGATTTTGAGAT	0.388																																																	0								ENSG00000176253						55.0	57.0	56.0					14																	20502851		2202	4299	6501	OR4K13	SO:0001583	missense	0			-	HGNC		CCDS32028.1	14q11.2	2013-09-23			ENSG00000176253	ENSG00000176253		"""GPCR / Class A : Olfactory receptors"""	15351	protein-coding gene	gene with protein product							Standard	NM_001004714		Approved		uc010tkz.2	Q8NH42	OTTHUMG00000170781	ENST00000315693.2:c.67C>T	14.37:g.20502851G>A	ENSP00000319322:p.Leu23Phe	Somatic	0	24	0.00		0.37408025132873873	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	34	15.00	Q6IF13	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L23F	ENST00000315693.2	37	c.67	CCDS32028.1	14	.	.	.	.	.	.	.	.	.	.	.	9.369	1.070109	0.20147	.	.	ENSG00000176253	ENST00000315693	T	0.03330	3.97	3.51	1.49	0.22878	.	0.568981	0.13357	U	0.393943	T	0.05868	0.0153	L	0.60067	1.865	0.09310	N	1	B	0.26672	0.156	B	0.30105	0.111	T	0.26467	-1.0102	10	0.66056	D	0.02	.	9.804	0.40781	0.0:0.0:0.4642:0.5358	.	23	Q8NH42	OR4KD_HUMAN	F	23	ENSP00000319322:L23F	ENSP00000319322:L23F	L	-	1	0	OR4K13	19572691	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	-0.268000	0.08607	0.132000	0.18615	0.536000	0.68110	CTT	-	NULL		0.388	OR4K13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4K13	protein_coding	OTTHUMT00000410344.1	G		-		20502851	-1	no_errors	ENST00000315693	ensembl	human	known	74_37	missense	SNP	0.001	A
