#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
HNRNPCL1	343069	genome.wustl.edu	37	1	12907990	12907990	+	Silent	SNP	G	G	T			TCGA-QQ-A8VH-01A-11D-A37C-09	TCGA-QQ-A8VH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b5a400-a49b-41a3-bff0-f3b8c36e36dd	a65e8e60-03c3-468b-acb5-075ff9096122	g.chr1:12907990G>T	ENST00000317869.6	-	2	378	c.153C>A	c.(151-153)ggC>ggA	p.G51G		NM_001013631.1|NM_001136561.2|NM_001146181.1	NP_001013653.1|NP_001130033.2|NP_001139653.1	O60812	HNRC1_HUMAN	heterogeneous nuclear ribonucleoprotein C-like 1	51	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.					nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(15)|prostate(1)|skin(1)|stomach(2)	29						CGAAGGCAAAGCCCTTATGAA	0.458																																																	0								ENSG00000179172						90.0	89.0	90.0					1																	12907990		2203	4297	6500	HNRNPCL1	SO:0001819	synonymous_variant	0			-	HGNC	BC002696	CCDS30591.1	1p36.21	2013-02-12		2008-04-18	ENSG00000179172	ENSG00000179172		"""RNA binding motif (RRM) containing"""	29295	protein-coding gene	gene with protein product				HNRPCL1			Standard	NM_001013631		Approved			O60812	OTTHUMG00000001931	ENST00000317869.6:c.153C>A	1.37:g.12907990G>T		Somatic	0	283	0.00		0.7039346279484041	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	45	290	13.43	B2RP44	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_RRM_dom,smart_RRM_dom,pirsf_hnRNP_C_Raly,pfscan_RRM_dom	p.G51	ENST00000317869.6	37	c.153	CCDS30591.1	1																																																																																			-	pfam_RRM_dom,smart_RRM_dom,pirsf_hnRNP_C_Raly,pfscan_RRM_dom		0.458	HNRNPCL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HNRNPCL1	protein_coding	OTTHUMT00000005462.1	G	NM_001013631	-		12907990	-1	no_errors	ENST00000317869	ensembl	human	known	74_37	silent	SNP	1.000	T
ZBTB12	221527	genome.wustl.edu	37	6	31868321	31868321	+	Missense_Mutation	SNP	G	G	C			TCGA-QQ-A8VH-01A-11D-A37C-09	TCGA-QQ-A8VH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b5a400-a49b-41a3-bff0-f3b8c36e36dd	a65e8e60-03c3-468b-acb5-075ff9096122	g.chr6:31868321G>C	ENST00000375527.2	-	2	937	c.762C>G	c.(760-762)agC>agG	p.S254R	C2_ENST00000452323.2_5'Flank|EHMT2_ENST00000375530.4_5'Flank|C2_ENST00000469372.1_Intron|EHMT2_ENST00000375537.4_5'Flank	NM_181842.2	NP_862825.1	Q9Y330	ZBT12_HUMAN	zinc finger and BTB domain containing 12	254	Gly-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(1)|lung(5)|prostate(1)|skin(1)	10						GGGCTACAGTGCTGGGGGGAA	0.682																																																	0								ENSG00000204366						21.0	22.0	21.0					6																	31868321		1860	3682	5542	ZBTB12	SO:0001583	missense	0			-	HGNC	BC043609	CCDS4727.1	6p21.31	2013-01-08	2004-04-15	2004-04-16	ENSG00000204366	ENSG00000204366		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	19066	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 46"""	C6orf46		9545376	Standard	NM_181842		Approved	G10, NG35, D6S59E	uc003nyd.1	Q9Y330	OTTHUMG00000031169	ENST00000375527.2:c.762C>G	6.37:g.31868321G>C	ENSP00000364677:p.Ser254Arg	Somatic	0	80	0.00		0.7039346279484041	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	46	67	40.71	B0UY00|Q5JQ98	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_BTB_POZ,pfam_Znf_C2H2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.S254R	ENST00000375527.2	37	c.762	CCDS4727.1	6	.	.	.	.	.	.	.	.	.	.	G	6.273	0.418389	0.11870	.	.	ENSG00000204366	ENST00000375527	T	0.12984	2.63	3.7	2.73	0.32206	.	0.478737	0.21100	U	0.080172	T	0.02083	0.0065	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.46076	-0.9217	10	0.16896	T	0.51	.	8.4715	0.32988	0.0:0.0:0.534:0.466	.	254	Q9Y330	ZBT12_HUMAN	R	254	ENSP00000364677:S254R	ENSP00000364677:S254R	S	-	3	2	ZBTB12	31976300	0.010000	0.17322	0.998000	0.56505	0.853000	0.48598	1.158000	0.31737	1.611000	0.50210	0.313000	0.20887	AGC	-	NULL		0.682	ZBTB12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB12	protein_coding	OTTHUMT00000076315.2	G	NM_181842	-		31868321	-1	no_errors	ENST00000375527	ensembl	human	known	74_37	missense	SNP	0.004	C
LHCGR	3973	genome.wustl.edu	37	2	48936105	48936105	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VH-01A-11D-A37C-09	TCGA-QQ-A8VH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b5a400-a49b-41a3-bff0-f3b8c36e36dd	a65e8e60-03c3-468b-acb5-075ff9096122	g.chr2:48936105G>A	ENST00000294954.7	-	8	683	c.662C>T	c.(661-663)gCc>gTc	p.A221V	LHCGR_ENST00000344775.3_Missense_Mutation_p.A221V|LHCGR_ENST00000401907.1_Missense_Mutation_p.A221V|STON1-GTF2A1L_ENST00000402114.2_Intron|LHCGR_ENST00000405626.1_Missense_Mutation_p.A221V|LHCGR_ENST00000403273.1_Missense_Mutation_p.A221V	NM_000233.3	NP_000224.2	P22888	LSHR_HUMAN	luteinizing hormone/choriogonadotropin receptor	221					activation of adenylate cyclase activity (GO:0007190)|cellular response to gonadotropin stimulus (GO:0071371)|cognition (GO:0050890)|development of secondary male sexual characteristics (GO:0046544)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|male genitalia development (GO:0030539)|male gonad development (GO:0008584)|ovarian follicle development (GO:0001541)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of inositol trisphosphate biosynthetic process (GO:0032962)|regulation of steroid hormone biosynthetic process (GO:0090030)|seminiferous tubule development (GO:0072520)|spermatogenesis (GO:0007283)|uterus development (GO:0060065)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	choriogonadotropin hormone binding (GO:0038106)|choriogonadotropin hormone receptor activity (GO:0035472)|luteinizing hormone receptor activity (GO:0004964)			NS(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|liver(1)|lung(23)|ovary(3)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	56		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.176)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Buserelin(DB06719)|Cetrorelix(DB00050)|Choriogonadotropin alfa(DB00097)|Goserelin(DB00014)|Lutropin alfa(DB00044)|Menotropins(DB00032)	CGGCCCTGTGGCCCCACGGAA	0.547																																																	0								ENSG00000138039						234.0	201.0	212.0					2																	48936105		2203	4300	6503	LHCGR	SO:0001583	missense	0			-	HGNC		CCDS1842.1	2p21	2012-08-10			ENSG00000138039	ENSG00000138039		"""GPCR / Class A : Gonadotropin and TSH receptors"""	6585	protein-coding gene	gene with protein product		152790	"""hypergonadotropic hypogonadism"""	HHG			Standard	NM_000233		Approved	LHR, LCGR, LGR2, ULG5	uc002rwu.4	P22888	OTTHUMG00000129257	ENST00000294954.7:c.662C>T	2.37:g.48936105G>A	ENSP00000294954:p.Ala221Val	Somatic	0	110	0.00		0.7039346279484041	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	53	85	38.41	Q14751|Q15996|Q9UEW9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,prints_LSH_rcpt,prints_Gphrmn_rcpt_fam,prints_GPCR_Rhodpsn,prints_TSH_rcpt,pfscan_GPCR_Rhodpsn_7TM	p.A221V	ENST00000294954.7	37	c.662	CCDS1842.1	2	.	.	.	.	.	.	.	.	.	.	G	24.3	4.521523	0.85600	.	.	ENSG00000138039	ENST00000344775;ENST00000294954;ENST00000405626;ENST00000403273;ENST00000401907	D;D;D;D;D	0.91237	-2.81;-2.81;-1.72;-2.81;-2.81	5.04	5.04	0.67666	.	0.053409	0.85682	D	0.000000	D	0.90445	0.7008	L	0.56199	1.76	0.25284	N	0.989418	P	0.51653	0.947	P	0.48901	0.594	D	0.85095	0.0954	9	.	.	.	.	15.2364	0.73436	0.0:0.0:1.0:0.0	.	221	P22888	LSHR_HUMAN	V	221	ENSP00000344301:A221V;ENSP00000294954:A221V;ENSP00000386033:A221V;ENSP00000385847:A221V;ENSP00000385406:A221V	.	A	-	2	0	LHCGR	48789609	1.000000	0.71417	0.995000	0.50966	0.921000	0.55340	4.584000	0.60971	2.617000	0.88574	0.655000	0.94253	GCC	-	prints_TSH_rcpt		0.547	LHCGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LHCGR	protein_coding	OTTHUMT00000251364.4	G	NM_000233.3	-		48936105	-1	no_errors	ENST00000294954	ensembl	human	known	74_37	missense	SNP	1.000	A
MEG3	55384	genome.wustl.edu	37	14	101299003	101299003	+	RNA	SNP	G	G	A			TCGA-QQ-A8VH-01A-11D-A37C-09	TCGA-QQ-A8VH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b5a400-a49b-41a3-bff0-f3b8c36e36dd	a65e8e60-03c3-468b-acb5-075ff9096122	g.chr14:101299003G>A	ENST00000554041.1	-	0	578																											GCCGGGCCGGGGCGATGTGGC	0.488																																																	0								ENSG00000214548																																			MEG3			0			-	HGNC																													14.37:g.101299003G>A		Somatic	0	42	0.00		0.7039346279484041	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	45	26.56		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000554041.1	37	NULL		14																																																																																			-	-		0.488	RP11-123M6.2-001	KNOWN	basic	antisense	MEG3	antisense	OTTHUMT00000414687.1	G		-		101299003	+1	no_errors	ENST00000452120	ensembl	human	known	74_37	rna	SNP	0.046	A
ZNF568	374900	genome.wustl.edu	37	19	37440596	37440596	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VH-01A-11D-A37C-09	TCGA-QQ-A8VH-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b5a400-a49b-41a3-bff0-f3b8c36e36dd	a65e8e60-03c3-468b-acb5-075ff9096122	g.chr19:37440596C>T	ENST00000333987.7	+	7	1047	c.541C>T	c.(541-543)Ctt>Ttt	p.L181F	ZNF568_ENST00000455427.2_Intron|ZNF568_ENST00000415168.1_Missense_Mutation_p.L117F|ZNF568_ENST00000427117.1_Intron	NM_001204835.1|NM_198539.3	NP_001191764.1|NP_940941.2	Q3ZCX4	ZN568_HUMAN	zinc finger protein 568	181					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(9)|ovary(1)	29	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			CTGTGACTCACTTGATAAGGG	0.338																																																	0								ENSG00000198453						100.0	93.0	95.0					19																	37440596		1865	4105	5970	ZNF568	SO:0001583	missense	0			-	HGNC	BX640681	CCDS42558.1, CCDS56092.1, CCDS56093.1, CCDS74351.1	19q13.12	2013-09-20			ENSG00000198453	ENSG00000198453		"""Zinc fingers, C2H2-type"", ""-"""	25392	protein-coding gene	gene with protein product							Standard	NM_198539		Approved	DKFZp686B0797	uc002ofc.3	Q3ZCX4	OTTHUMG00000048160	ENST00000333987.7:c.541C>T	19.37:g.37440596C>T	ENSP00000334685:p.Leu181Phe	Somatic	0	47	0.00		0.7039346279484041	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	87	10.31	B4DS92|E7ER33|Q6N060|Q8NA64	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.L181F	ENST00000333987.7	37	c.541	CCDS42558.1	19	.	.	.	.	.	.	.	.	.	.	C	0.685	-0.796543	0.02862	.	.	ENSG00000198453	ENST00000333987;ENST00000415168	T;T	0.13778	2.56;2.56	4.01	-8.02	0.01118	.	0.764305	0.10763	N	0.636863	T	0.04952	0.0133	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.31336	-0.9947	10	0.34782	T	0.22	.	3.1904	0.06615	0.105:0.1657:0.4143:0.315	.	181	Q3ZCX4	ZN568_HUMAN	F	181;117	ENSP00000334685:L181F;ENSP00000394514:L117F	ENSP00000334685:L181F	L	+	1	0	ZNF568	42132436	0.000000	0.05858	0.000000	0.03702	0.068000	0.16541	-5.168000	0.00145	-1.325000	0.02269	-0.137000	0.14449	CTT	-	NULL		0.338	ZNF568-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF568	protein_coding	OTTHUMT00000109572.2	C	NM_198539	-		37440596	+1	no_errors	ENST00000333987	ensembl	human	known	74_37	missense	SNP	0.000	T
A2ML1	144568	genome.wustl.edu	37	12	8995729	8995729	+	Splice_Site	DEL	G	G	-			TCGA-QQ-A8VH-01A-11D-A37C-09	TCGA-QQ-A8VH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b5a400-a49b-41a3-bff0-f3b8c36e36dd	a65e8e60-03c3-468b-acb5-075ff9096122	g.chr12:8995729delG	ENST00000299698.7	+	12	1428		c.e12-1		A2ML1_ENST00000539547.1_5'Flank	NM_001282424.1|NM_144670.4	NP_001269353.1|NP_653271			alpha-2-macroglobulin-like 1									p.?(1)		NS(2)|breast(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(2)|lung(36)|ovary(2)|skin(4)|stomach(1)|urinary_tract(1)	80						TTTATTCTCAGGGAAAGTTTC	0.433																																																	1	Unknown(1)	lung(1)						ENSG00000166535						61.0	61.0	61.0					12																	8995729		1878	4112	5990	A2ML1	SO:0001630	splice_region_variant	0				HGNC	AK057908	CCDS8596.2, CCDS73439.1	12p13	2010-12-14	2005-09-01	2005-09-01	ENSG00000166535	ENSG00000166535			23336	protein-coding gene	gene with protein product		610627	"""C3 and PZP-like, alpha-2-macroglobulin domain containing 9"""	CPAMD9		16298998	Standard	NM_144670		Approved	FLJ25179	uc001quz.5	A8K2U0	OTTHUMG00000128499	ENST00000299698.7:c.1249-1G>-	12.37:g.8995729delG		Somatic	0	44	0.00		0.7039346279484041	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	12	14.29		Splice_Site	DEL	NA	NA	NA	NA	NA	NA	-	e12-1	ENST00000299698.7	37	c.1249-1	CCDS8596.2	12																																																																																			-	-		0.433	A2ML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	A2ML1	protein_coding	OTTHUMT00000250304.3	G	NM_144670		Intron	8995729	+1	no_errors	ENST00000299698	ensembl	human	known	74_37	splice_site_del	DEL	0.965	-
MYO9B	4650	genome.wustl.edu	37	19	17294679	17294680	+	Splice_Site	INS	-	-	A			TCGA-QQ-A8VH-01A-11D-A37C-09	TCGA-QQ-A8VH-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b5a400-a49b-41a3-bff0-f3b8c36e36dd	a65e8e60-03c3-468b-acb5-075ff9096122	g.chr19:17294679_17294680insA	ENST00000594824.1	+	16	2520		c.e16+2		MYO9B_ENST00000397274.2_Splice_Site|MYO9B_ENST00000595618.1_Splice_Site			Q13459	MYO9B_HUMAN	myosin IXB						actin filament-based movement (GO:0030048)|establishment of cell polarity (GO:0030010)|lamellipodium morphogenesis (GO:0072673)|macrophage chemotaxis (GO:0048246)|monocyte chemotaxis (GO:0002548)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|filamentous actin (GO:0031941)|filopodium tip (GO:0032433)|lamellipodium (GO:0030027)|membrane (GO:0016020)|myosin complex (GO:0016459)|perinuclear region of cytoplasm (GO:0048471)|ruffle (GO:0001726)	actin binding (GO:0003779)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)	p.?(2)		breast(3)|endometrium(9)|kidney(2)|large_intestine(1)|lung(19)|soft_tissue(1)|urinary_tract(4)	39						ATTCCAAAGGTAAAAAAAAAAA	0.411																																																	2	Unknown(2)	soft_tissue(2)						ENSG00000099331																																			MYO9B	SO:0001630	splice_region_variant	0				HGNC		CCDS46010.1	19p13.1	2011-09-27				ENSG00000099331		"""Myosins / Myosin superfamily : Class IX"""	7609	protein-coding gene	gene with protein product		602129		CELIAC4		9226381	Standard	NM_004145		Approved		uc010eak.3	Q13459		ENST00000594824.1:c.2373+2->A	19.37:g.17294690_17294690dupA		Somatic	0	42	0.00		0.7039346279484041	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	45	11.76	O75314|Q9NUJ2|Q9UHN0	Splice_Site	INS	NA	NA	NA	NA	NA	NA	-	e15+2	ENST00000594824.1	37	c.2373+2_2373+1		19																																																																																			-	-		0.411	MYO9B-002	KNOWN	basic|appris_principal	protein_coding	MYO9B	protein_coding	OTTHUMT00000463236.1	-			Intron	17294680	+1	no_errors	ENST00000594824	ensembl	human	known	74_37	splice_site_ins	INS	1.000:1.000	A
ST6GALNAC6	30815	genome.wustl.edu	37	9	130653162	130653162	+	Frame_Shift_Del	DEL	T	T	-			TCGA-QQ-A8VH-01A-11D-A37C-09	TCGA-QQ-A8VH-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b5a400-a49b-41a3-bff0-f3b8c36e36dd	a65e8e60-03c3-468b-acb5-075ff9096122	g.chr9:130653162delT	ENST00000373146.1	-	5	637	c.458delA	c.(457-459)tacfs	p.Y153fs	ST6GALNAC6_ENST00000291839.5_Frame_Shift_Del_p.Y153fs|ST6GALNAC6_ENST00000373144.3_Frame_Shift_Del_p.Y119fs|ST6GALNAC6_ENST00000542456.1_Intron|ST6GALNAC6_ENST00000373141.1_Frame_Shift_Del_p.Y119fs|ST6GALNAC6_ENST00000485320.1_5'UTR|ST6GALNAC6_ENST00000373142.1_Frame_Shift_Del_p.Y153fs			Q969X2	SIA7F_HUMAN	ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 6	153					cell-cell recognition (GO:0009988)|ganglioside biosynthetic process (GO:0001574)|glycoprotein metabolic process (GO:0009100)|glycosphingolipid metabolic process (GO:0006687)|glycosylceramide metabolic process (GO:0006677)|oligosaccharide biosynthetic process (GO:0009312)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-N-acetylgalactosaminide alpha-2,6-sialyltransferase activity (GO:0001665)|sialyltransferase activity (GO:0008373)			endometrium(3)|large_intestine(3)|lung(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	14						CACGACGCGGTAGGTGGTCTT	0.607																																																	0								ENSG00000160408						95.0	86.0	89.0					9																	130653162		2203	4300	6503	ST6GALNAC6	SO:0001589	frameshift_variant	0				HGNC	BC006564	CCDS6882.1, CCDS69668.1, CCDS69669.1, CCDS75908.1	9q34.13	2013-03-01		2005-02-07	ENSG00000160408	ENSG00000160408		"""Sialyltransferases"""	23364	protein-coding gene	gene with protein product		610135	"""sialytransferase 7 ((alpha-N-acetylneuraminyl 2,3-betagalactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialytransferase) F"""	SIAT7F		12668675	Standard	XM_005251952		Approved	ST6GALNACVI	uc004bso.1	Q969X2	OTTHUMG00000020718	ENST00000373146.1:c.458delA	9.37:g.130653162delT	ENSP00000362239:p.Tyr153fs	Somatic	0	48	0.00		0.7039346279484041	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	13	13.33	B3KQ01|Q5T9C4|Q5T9C5|Q9H8A2|Q9ULB8	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Glyco_trans_29	p.Y153fs	ENST00000373146.1	37	c.458	CCDS6882.1	9																																																																																			-	pfam_Glyco_trans_29		0.607	ST6GALNAC6-007	KNOWN	basic|CCDS	protein_coding	ST6GALNAC6	protein_coding	OTTHUMT00000054278.1	T	NM_013443			130653162	-1	no_errors	ENST00000291839	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
DNAH7	56171	genome.wustl.edu	37	2	196799353	196799353	+	Missense_Mutation	SNP	C	C	A			TCGA-QQ-A8VH-01A-11D-A37C-09	TCGA-QQ-A8VH-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b5a400-a49b-41a3-bff0-f3b8c36e36dd	a65e8e60-03c3-468b-acb5-075ff9096122	g.chr2:196799353C>A	ENST00000312428.6	-	21	3533	c.3433G>T	c.(3433-3435)Gtt>Ttt	p.V1145F		NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	1145	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)			NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						TCTAATTCAACCAACCACTTC	0.363																																																	0								ENSG00000118997						187.0	181.0	183.0					2																	196799353		1854	4106	5960	DNAH7	SO:0001583	missense	0			-	HGNC	AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.3433G>T	2.37:g.196799353C>A	ENSP00000311273:p.Val1145Phe	Somatic	0	59	0.00		0.7039346279484041	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	31	42.59	B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,superfamily_P-loop_NTPase,superfamily_Signal_recog_particle_SRP9/14,smart_AAA+_ATPase,pfscan_EF_hand_dom	p.V1145F	ENST00000312428.6	37	c.3433	CCDS42794.1	2	.	.	.	.	.	.	.	.	.	.	C	14.21	2.466661	0.43839	.	.	ENSG00000118997	ENST00000312428	T	0.57107	0.42	5.72	2.77	0.32553	Dynein heavy chain, domain-2 (1);	0.239703	0.34223	N	0.004149	T	0.48077	0.1480	L	0.51422	1.61	0.80722	D	1	B	0.10296	0.003	B	0.15870	0.014	T	0.35226	-0.9797	10	0.28530	T	0.3	.	17.1738	0.86836	0.0:0.5584:0.4416:0.0	.	1145	Q8WXX0	DYH7_HUMAN	F	1145	ENSP00000311273:V1145F	ENSP00000311273:V1145F	V	-	1	0	DNAH7	196507598	0.128000	0.22383	0.998000	0.56505	0.994000	0.84299	0.160000	0.16462	0.228000	0.21019	0.655000	0.94253	GTT	-	pfam_Dynein_heavy_dom-2		0.363	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH7	protein_coding	OTTHUMT00000335202.3	C	NM_018897	-		196799353	-1	no_errors	ENST00000312428	ensembl	human	known	74_37	missense	SNP	1.000	A
KRTAP10-9	386676	genome.wustl.edu	37	21	46048196	46048197	+	3'UTR	INS	-	-	CGCTGGT	rs181355860|rs587633163|rs61263042	byFrequency	TCGA-QQ-A8VH-01A-11D-A37C-09	TCGA-QQ-A8VH-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b5a400-a49b-41a3-bff0-f3b8c36e36dd	a65e8e60-03c3-468b-acb5-075ff9096122	g.chr21:46048196_46048197insCGCTGGT	ENST00000397911.3	+	0	1157_1158				KRTAP10-9_ENST00000484861.1_3'UTR|TSPEAR_ENST00000323084.4_Intron	NM_198690.2	NP_941963.2	P60411	KR109_HUMAN	keratin associated protein 10-9							keratin filament (GO:0045095)				endometrium(1)|kidney(1)|large_intestine(1)|lung(6)	9						CCACAACCCTCCGCTGGTCGCT	0.693														1171	0.233826	0.2458	0.2536	5008	,	,		10044	0.1855		0.2952	False		,,,				2504	0.1902																0								ENSG00000221837																																			KRTAP10-9	SO:0001624	3_prime_UTR_variant	0				HGNC	AJ566386	CCDS42961.1	21q22.3	2007-10-05			ENSG00000221837	ENSG00000221837		"""Keratin associated proteins"""	22971	protein-coding gene	gene with protein product				KRTAP18-9			Standard	NM_198690		Approved	KAP10.9, KAP18.9	uc002zfp.4	P60411	OTTHUMG00000057637	ENST00000397911.3:c.*230->CGCTGGT	21.37:g.46048197_46048203dupCGCTGGT		Somatic	NA	NA	NA		0.7039346279484041	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A2RRG1|A6NIR9|Q70LJ1	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000397911.3	37	NULL	CCDS42961.1	21																																																																																			-	-		0.693	KRTAP10-9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP10-9	protein_coding	OTTHUMT00000128040.1	-				46048197	+1	no_errors	ENST00000484861	ensembl	human	known	74_37	rna	INS	0.001:0.001	CGCTGGT
SDK1	221935	genome.wustl.edu	37	7	4169647	4169647	+	Nonsense_Mutation	SNP	C	C	G	rs371541591		TCGA-QQ-A8VH-01A-11D-A37C-09	TCGA-QQ-A8VH-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b5a400-a49b-41a3-bff0-f3b8c36e36dd	a65e8e60-03c3-468b-acb5-075ff9096122	g.chr7:4169647C>G	ENST00000404826.2	+	27	4186	c.4047C>G	c.(4045-4047)taC>taG	p.Y1349*	SDK1_ENST00000389531.3_Nonsense_Mutation_p.Y1349*	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	1349	Fibronectin type-III 7. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		TCGTGCTCTACGAGCTCCAGG	0.667																																																	0								ENSG00000146555						53.0	50.0	51.0					7																	4169647		2203	4300	6503	SDK1	SO:0001587	stop_gained	0			-	HGNC	AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.4047C>G	7.37:g.4169647C>G	ENSP00000385899:p.Tyr1349*	Somatic	0	78	0.00		0.7039346279484041	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	33	40	45.21	Q8TEN9|Q8TEP5|Q96N44	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.Y1349*	ENST00000404826.2	37	c.4047	CCDS34590.1	7	.	.	.	.	.	.	.	.	.	.	C	46	12.339733	0.99658	.	.	ENSG00000146555	ENST00000404826;ENST00000389531	.	.	.	5.67	-1.19	0.09585	.	0.000000	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.511	0.56005	0.0:0.3676:0.0:0.6324	.	.	.	.	X	1349	.	ENSP00000374182:Y1349X	Y	+	3	2	SDK1	4136173	0.069000	0.21087	0.996000	0.52242	0.983000	0.72400	-0.759000	0.04761	-0.096000	0.12329	0.655000	0.94253	TAC	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.667	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SDK1	protein_coding	OTTHUMT00000323702.1	C	NM_152744	-		4169647	+1	no_errors	ENST00000404826	ensembl	human	known	74_37	nonsense	SNP	0.933	G
ALDH1A3	220	genome.wustl.edu	37	15	101438364	101438364	+	Missense_Mutation	SNP	C	C	G			TCGA-QQ-A8VH-01A-11D-A37C-09	TCGA-QQ-A8VH-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b5a400-a49b-41a3-bff0-f3b8c36e36dd	a65e8e60-03c3-468b-acb5-075ff9096122	g.chr15:101438364C>G	ENST00000329841.5	+	8	1389	c.857C>G	c.(856-858)cCc>cGc	p.P286R	ALDH1A3_ENST00000346623.6_Missense_Mutation_p.P179R|RP11-66B24.4_ENST00000560351.1_RNA	NM_000693.2	NP_000684.2	P47895	AL1A3_HUMAN	aldehyde dehydrogenase 1 family, member A3	286					embryonic eye morphogenesis (GO:0048048)|face development (GO:0060324)|inner ear morphogenesis (GO:0042472)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|nucleus accumbens development (GO:0021768)|olfactory pit development (GO:0060166)|optic cup morphogenesis involved in camera-type eye development (GO:0002072)|positive regulation of apoptotic process (GO:0043065)|retinal metabolic process (GO:0042574)|retinoic acid biosynthetic process (GO:0002138)|retinoic acid metabolic process (GO:0042573)|retinol metabolic process (GO:0042572)|righting reflex (GO:0060013)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	aldehyde dehydrogenase (NAD) activity (GO:0004029)|aldehyde dehydrogenase [NAD(P)+] activity (GO:0004030)|NAD+ binding (GO:0070403)|protein homodimerization activity (GO:0042803)|thyroid hormone binding (GO:0070324)			NS(1)|central_nervous_system(2)|endometrium(3)|large_intestine(7)|lung(9)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	27	Lung NSC(78;0.00144)|all_lung(78;0.0018)|Melanoma(26;0.00852)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.0766)|Lung(145;0.103)		Vitamin A(DB00162)	GGGAAGAACCCCTGCATCGTG	0.587																																																	0								ENSG00000184254						69.0	66.0	67.0					15																	101438364		2203	4300	6503	ALDH1A3	SO:0001583	missense	0			-	HGNC	U07919	CCDS10389.1	15q26	2010-05-07			ENSG00000184254	ENSG00000184254	1.2.1.5	"""Aldehyde dehydrogenases"""	409	protein-coding gene	gene with protein product	"""retinaldehyde dehydrogenase 3"""	600463		ALDH6		7698756	Standard	XR_111558		Approved	RALDH3	uc002bwn.4	P47895	OTTHUMG00000149870	ENST00000329841.5:c.857C>G	15.37:g.101438364C>G	ENSP00000332256:p.Pro286Arg	Somatic	0	27	0.00		0.7039346279484041	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	36	31	53.73	Q6NT64	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Aldehyde_DH_dom,superfamily_Ald_DH/histidinol_DH	p.P286R	ENST00000329841.5	37	c.857	CCDS10389.1	15	.	.	.	.	.	.	.	.	.	.	C	20.1	3.932822	0.73442	.	.	ENSG00000184254	ENST00000329841;ENST00000346623	T	0.22134	1.97	5.76	5.76	0.90799	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, N-terminal (1);Aldehyde/histidinol dehydrogenase (1);Aldehyde dehydrogenase, conserved site (1);	0.000000	0.85682	D	0.000000	T	0.70211	0.3198	H	0.99682	4.7	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.84558	0.0648	10	0.87932	D	0	.	19.9788	0.97318	0.0:1.0:0.0:0.0	.	190;286	Q7Z3A2;P47895	.;AL1A3_HUMAN	R	286;190	ENSP00000332256:P286R	ENSP00000332256:P286R	P	+	2	0	ALDH1A3	99255887	1.000000	0.71417	0.968000	0.41197	0.228000	0.25075	7.380000	0.79704	2.719000	0.93026	0.555000	0.69702	CCC	-	pfam_Aldehyde_DH_dom,superfamily_Ald_DH/histidinol_DH		0.587	ALDH1A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALDH1A3	protein_coding	OTTHUMT00000313620.2	C		-		101438364	+1	no_errors	ENST00000329841	ensembl	human	known	74_37	missense	SNP	1.000	G
RSF1	51773	genome.wustl.edu	37	11	77378084	77378084	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VH-01A-11D-A37C-09	TCGA-QQ-A8VH-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b5a400-a49b-41a3-bff0-f3b8c36e36dd	a65e8e60-03c3-468b-acb5-075ff9096122	g.chr11:77378084C>T	ENST00000308488.6	-	16	4506	c.4204G>A	c.(4204-4206)Gca>Aca	p.A1402T	RSF1_ENST00000360355.2_Missense_Mutation_p.A1371T|RSF1_ENST00000480887.1_Missense_Mutation_p.A1150T			Q96T23	RSF1_HUMAN	remodeling and spacing factor 1	1402					CENP-A containing nucleosome assembly (GO:0034080)|chromatin remodeling (GO:0006338)|DNA-templated transcription, initiation (GO:0006352)|negative regulation of DNA binding (GO:0043392)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of viral transcription (GO:0050434)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|RSF complex (GO:0031213)	histone binding (GO:0042393)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(9)|lung(14)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	43	all_cancers(14;1.54e-17)|all_epithelial(13;4.06e-20)|Ovarian(111;0.152)		Epithelial(5;3e-50)|all cancers(3;6.37e-47)|BRCA - Breast invasive adenocarcinoma(5;9.82e-31)			GCTAGGCTTGCACTGGCTGTG	0.522																																																	0								ENSG00000048649						133.0	109.0	117.0					11																	77378084		2200	4292	6492	RSF1	SO:0001583	missense	0			-	HGNC	AF380176, AF227948	CCDS8253.1	11q14.1	2013-01-28	2006-05-25	2006-05-25	ENSG00000048649	ENSG00000048649		"""Zinc fingers, PHD-type"""	18118	protein-coding gene	gene with protein product		608522	"""hepatitis B virus x associated protein"""	HBXAP		11788598, 12972596	Standard	NM_016578		Approved	XAP8, RSF-1, p325	uc001oyn.3	Q96T23	OTTHUMG00000150433	ENST00000308488.6:c.4204G>A	11.37:g.77378084C>T	ENSP00000311513:p.Ala1402Thr	Somatic	0	55	0.00		0.7039346279484041	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	38	38.71	Q86X86|Q9H3L8|Q9NVZ8|Q9NYU0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.A1402T	ENST00000308488.6	37	c.4204	CCDS8253.1	11	.	.	.	.	.	.	.	.	.	.	C	12.68	2.011158	0.35511	.	.	ENSG00000048649	ENST00000308488;ENST00000480887;ENST00000360355	D;D;D	0.89617	-2.52;-2.54;-2.51	4.99	4.99	0.66335	.	0.141173	0.32753	N	0.005690	D	0.82926	0.5143	L	0.29908	0.895	0.38130	D	0.938118	B	0.29531	0.247	B	0.31016	0.123	D	0.83549	0.0100	10	0.66056	D	0.02	-7.3213	12.1931	0.54282	0.0:0.9218:0.0:0.0782	.	1402	Q96T23	RSF1_HUMAN	T	1402;1150;1371	ENSP00000311513:A1402T;ENSP00000434509:A1150T;ENSP00000353511:A1371T	ENSP00000311513:A1402T	A	-	1	0	RSF1	77055732	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	3.823000	0.55715	2.757000	0.94681	0.462000	0.41574	GCA	-	NULL		0.522	RSF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RSF1	protein_coding	OTTHUMT00000318075.2	C	NM_016578	-		77378084	-1	no_errors	ENST00000308488	ensembl	human	known	74_37	missense	SNP	1.000	T
LETM2	137994	genome.wustl.edu	37	8	38261910	38261910	+	Splice_Site	SNP	G	G	T	rs574669200	byFrequency	TCGA-QQ-A8VH-01A-11D-A37C-09	TCGA-QQ-A8VH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b5a400-a49b-41a3-bff0-f3b8c36e36dd	a65e8e60-03c3-468b-acb5-075ff9096122	g.chr8:38261910G>T	ENST00000379957.4	+	8	1231		c.e8-1		LETM2_ENST00000297720.5_Splice_Site|LETM2_ENST00000523983.2_Splice_Site|LETM2_ENST00000524874.1_Splice_Site|LETM2_ENST00000528827.1_Splice_Site|LETM2_ENST00000527710.1_Splice_Site|RP11-350N15.3_ENST00000533301.1_RNA	NM_001199659.1	NP_001186588.1	Q2VYF4	LETM2_HUMAN	leucine zipper-EF-hand containing transmembrane protein 2							integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				NS(1)|large_intestine(1)|lung(3)|prostate(2)	7	all_cancers(2;6.77e-47)|all_epithelial(2;1.01e-50)|all_lung(3;1.25e-23)|Lung NSC(2;2.76e-23)|Colorectal(12;0.000442)|Esophageal squamous(3;0.00202)	all_lung(54;0.0657)|Hepatocellular(245;0.152)|Lung NSC(58;0.175)	Epithelial(3;1.17e-42)|all cancers(3;5.44e-38)|BRCA - Breast invasive adenocarcinoma(5;5.44e-27)|LUSC - Lung squamous cell carcinoma(2;7.12e-25)|Lung(2;4.49e-22)|COAD - Colon adenocarcinoma(9;0.114)			CCGTTCTCCAGTGGCAGGACC	0.582																																																	0								ENSG00000165046						147.0	110.0	123.0					8																	38261910		2203	4300	6503	LETM2	SO:0001630	splice_region_variant	0			-	HGNC	AK058138	CCDS6106.1, CCDS56534.1, CCDS69466.1, CCDS75731.1	8p12	2013-01-11						"""EF-hand domain containing"""	14648	protein-coding gene	gene with protein product						11549311	Standard	NM_001286821		Approved	FLJ25409	uc003xlm.2	Q2VYF4		ENST00000379957.4:c.1105-1G>T	8.37:g.38261910G>T		Somatic	0	105	0.00		0.7039346279484041	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	A6NMG3|Q8NCR2|Q96LL1	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e7-1	ENST00000379957.4	37	c.1105-1		8	.	.	.	.	.	.	.	.	.	.	G	21.2	4.118144	0.77323	.	.	ENSG00000165046	ENST00000297720;ENST00000524874;ENST00000379957;ENST00000523983;ENST00000527710	.	.	.	5.78	5.78	0.91487	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.0831	0.97789	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	LETM2	38381067	1.000000	0.71417	1.000000	0.80357	0.847000	0.48162	9.291000	0.96070	2.755000	0.94549	0.644000	0.83932	.	-	-		0.582	LETM2-013	KNOWN	basic|appris_candidate_longest	protein_coding	LETM2	protein_coding	OTTHUMT00000381816.1	G	NM_144652	-	Intron	38261910	+1	no_errors	ENST00000379957	ensembl	human	known	74_37	splice_site	SNP	1.000	T
TP53	7157	genome.wustl.edu	37	17	7578443	7578443	+	Missense_Mutation	SNP	A	A	T			TCGA-QQ-A8VH-01A-11D-A37C-09	TCGA-QQ-A8VH-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b5a400-a49b-41a3-bff0-f3b8c36e36dd	a65e8e60-03c3-468b-acb5-075ff9096122	g.chr17:7578443A>T	ENST00000269305.4	-	5	676	c.487T>A	c.(487-489)Tac>Aac	p.Y163N	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Missense_Mutation_p.Y163N|TP53_ENST00000455263.2_Missense_Mutation_p.Y163N|TP53_ENST00000445888.2_Missense_Mutation_p.Y163N|TP53_ENST00000420246.2_Missense_Mutation_p.Y163N|TP53_ENST00000359597.4_Missense_Mutation_p.Y163N	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	163	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		Y -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:17224074}.|Y -> D (in sporadic cancers; somatic mutation).|Y -> F (in a sporadic cancer; somatic mutation).|Y -> H (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:17224074}.|Y -> N (in sporadic cancers; somatic mutation).|Y -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.Y163N(20)|p.Y163H(17)|p.0?(8)|p.Y163D(5)|p.I162_Y163>N(3)|p.Y163fs*7(2)|p.V157_C176del20(1)|p.Y163fs*1(1)|p.Y163_Q165delYKQ(1)|p.P151_V173del23(1)|p.S149fs*72(1)|p.I30_Y31>N(1)|p.I162_Y163delIY(1)|p.I69_Y70>N(1)|p.Y70N(1)|p.A161fs*7(1)|p.Y31N(1)|p.Y163fs*14(1)|p.A159_Q167delAMAIYKQSQ(1)|p.Y163fs*18(1)|p.Y70D(1)|p.Y31D(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GACTGCTTGTAGATGGCCATG	0.622		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	71	Substitution - Missense(46)|Whole gene deletion(8)|Deletion - Frameshift(6)|Deletion - In frame(5)|Complex - deletion inframe(5)|Insertion - Frameshift(1)	breast(14)|lung(12)|liver(8)|skin(6)|large_intestine(4)|haematopoietic_and_lymphoid_tissue(4)|oesophagus(4)|bone(4)|upper_aerodigestive_tract(3)|central_nervous_system(3)|ovary(3)|stomach(2)|adrenal_gland(1)|biliary_tract(1)|prostate(1)|pancreas(1)						ENSG00000141510						53.0	54.0	53.0					17																	7578443		2203	4300	6503	TP53	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	-	HGNC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.487T>A	17.37:g.7578443A>T	ENSP00000269305:p.Tyr163Asn	Somatic	0	32	0.00		0.7039346279484041	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	5	81.48	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.Y163N	ENST00000269305.4	37	c.487	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	A	15.86	2.958850	0.53400	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	D;D;D;D;D;D;D;D;D	0.99869	-7.33;-7.33;-7.33;-7.33;-7.33;-7.33;-7.33;-7.33;-7.33	5.59	4.52	0.55395	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.062225	0.64402	D	0.000003	D	0.99843	0.9928	M	0.89478	3.035	0.58432	D	0.999997	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	0.999;1.0;0.998;1.0;1.0;1.0;0.999	D	0.97202	0.9865	10	0.87932	D	0	-16.6607	9.9777	0.41795	0.9196:0.0:0.0804:0.0	.	124;163;163;70;163;163;163	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	N	163;163;163;163;163;163;152;70;31;70;31;163	ENSP00000410739:Y163N;ENSP00000352610:Y163N;ENSP00000269305:Y163N;ENSP00000398846:Y163N;ENSP00000391127:Y163N;ENSP00000391478:Y163N;ENSP00000425104:Y31N;ENSP00000423862:Y70N;ENSP00000424104:Y163N	ENSP00000269305:Y163N	Y	-	1	0	TP53	7519168	1.000000	0.71417	0.998000	0.56505	0.047000	0.14425	9.287000	0.95975	1.067000	0.40740	-0.256000	0.11100	TAC	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor		0.622	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	A	NM_000546	-		7578443	-1	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	SNP	1.000	T
LCNL1	401562	genome.wustl.edu	37	9	139879882	139879882	+	3'UTR	SNP	G	G	C			TCGA-QQ-A8VH-01A-11D-A37C-09	TCGA-QQ-A8VH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b5a400-a49b-41a3-bff0-f3b8c36e36dd	a65e8e60-03c3-468b-acb5-075ff9096122	g.chr9:139879882G>C	ENST00000408973.2	+	0	1508				LCNL1_ENST00000432827.1_3'UTR	NM_207510.3	NP_997393.3	Q6ZST4	LCNL1_HUMAN	lipocalin-like 1																		CGGGTGAGTAGACCATGGCCA	0.736																																																	0								ENSG00000214402																																			LCNL1	SO:0001624	3_prime_UTR_variant	0			-	HGNC		CCDS43908.1	9q34.3	2014-01-22			ENSG00000214402	ENSG00000214402		"""Lipocalins"""	34436	protein-coding gene	gene with protein product							Standard	NM_207510		Approved	FLJ45224	uc004ckh.1	Q6ZST4	OTTHUMG00000159546	ENST00000408973.2:c.*419G>C	9.37:g.139879882G>C		Somatic	0	53	0.00		0.7039346279484041	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000408973.2	37	NULL	CCDS43908.1	9																																																																																			-	-		0.736	LCNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCNL1	protein_coding	OTTHUMT00000356128.1	G	NM_207510	-		139879882	+1	no_errors	ENST00000432827	ensembl	human	known	74_37	rna	SNP	0.000	C
ACBD5	91452	genome.wustl.edu	37	10	27499800	27499800	+	Missense_Mutation	SNP	G	G	T			TCGA-QQ-A8VH-01A-11D-A37C-09	TCGA-QQ-A8VH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b5a400-a49b-41a3-bff0-f3b8c36e36dd	a65e8e60-03c3-468b-acb5-075ff9096122	g.chr10:27499800G>T	ENST00000375888.1	-	9	1238	c.1174C>A	c.(1174-1176)Cac>Aac	p.H392N	ACBD5_ENST00000375905.4_Missense_Mutation_p.H348N|ACBD5_ENST00000396271.3_Missense_Mutation_p.H383N|ACBD5_ENST00000476758.1_5'UTR|ACBD5_ENST00000375897.3_Missense_Mutation_p.H206N|ACBD5_ENST00000375901.1_Missense_Mutation_p.H274N			Q5T8D3	ACBD5_HUMAN	acyl-CoA binding domain containing 5	392					peroxisome degradation (GO:0030242)|transport (GO:0006810)	integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|peroxisome (GO:0005777)	fatty-acyl-CoA binding (GO:0000062)|lipid binding (GO:0008289)			breast(1)|endometrium(1)|large_intestine(3)|lung(7)|prostate(1)	13						TTCTCCCGGTGTGGTGCTCCG	0.458																																																	0								ENSG00000107897						196.0	184.0	188.0					10																	27499800		2203	4300	6503	ACBD5	SO:0001583	missense	0			-	HGNC	AF505653	CCDS7154.1, CCDS44368.1, CCDS73079.1	10p12.1	2010-04-30	2010-04-30		ENSG00000107897	ENSG00000107897			23338	protein-coding gene	gene with protein product			"""acyl-Coenzyme A binding domain containing 5"""			12056414	Standard	NR_024150		Approved	DKFZp434A2417, KIAA1996	uc010qdp.2	Q5T8D3	OTTHUMG00000017854	ENST00000375888.1:c.1174C>A	10.37:g.27499800G>T	ENSP00000365049:p.His392Asn	Somatic	0	93	0.00		0.7039346279484041	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	31	30	50.82	B3KQ56|D3DRW0|Q5T8D4|Q5T8E1|Q5T8E2|Q86UV1|Q8N6E3|Q9UFB5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Acyl-CoA-binding_protein,superfamily_Acyl-CoA-binding_protein,pirsf_M-assoc_diazepam-bd-inh,prints_Acyl-CoA-binding_protein	p.H392N	ENST00000375888.1	37	c.1174		10	.	.	.	.	.	.	.	.	.	.	G	12.01	1.810833	0.32053	.	.	ENSG00000107897	ENST00000375889;ENST00000396271;ENST00000375905;ENST00000375901;ENST00000375897;ENST00000375888	D;T;T;T;T	0.83250	-1.7;2.2;1.46;1.47;2.46	5.49	5.49	0.81192	.	0.660669	0.17226	N	0.182121	D	0.83663	0.5303	M	0.68317	2.08	0.36909	D	0.890818	P;P;B;B	0.49862	0.604;0.929;0.282;0.411	B;B;B;B	0.42827	0.302;0.399;0.159;0.159	D	0.87646	0.2525	10	0.54805	T	0.06	0.1782	17.5683	0.87927	0.0:0.0:1.0:0.0	.	383;206;381;392	Q5T8D3-3;B7Z2A7;B7Z2R7;Q5T8D3	.;.;.;ACBD5_HUMAN	N	389;383;348;274;206;392	ENSP00000379568:H383N;ENSP00000365070:H348N;ENSP00000365066:H274N;ENSP00000365062:H206N;ENSP00000365049:H392N	ENSP00000365049:H392N	H	-	1	0	ACBD5	27539806	1.000000	0.71417	0.854000	0.33618	0.289000	0.27227	3.326000	0.52037	2.569000	0.86673	0.555000	0.69702	CAC	-	pirsf_M-assoc_diazepam-bd-inh		0.458	ACBD5-005	KNOWN	basic	protein_coding	ACBD5	protein_coding	OTTHUMT00000047314.1	G	NM_145698	-		27499800	-1	no_errors	ENST00000375888	ensembl	human	known	74_37	missense	SNP	0.958	T
DGCR6	8214	genome.wustl.edu	37	22	18898464	18898464	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VH-01A-11D-A37C-09	TCGA-QQ-A8VH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b5a400-a49b-41a3-bff0-f3b8c36e36dd	a65e8e60-03c3-468b-acb5-075ff9096122	g.chr22:18898464G>A	ENST00000331444.6	+	4	588	c.436G>A	c.(436-438)Gac>Aac	p.D146N	DGCR6_ENST00000413981.1_Missense_Mutation_p.D10N|DGCR6_ENST00000436645.1_3'UTR	NM_005675.4	NP_005666.2	Q14129	DGCR6_HUMAN	DiGeorge syndrome critical region gene 6	146					cell adhesion (GO:0007155)|organ morphogenesis (GO:0009887)	nucleus (GO:0005634)|proteinaceous extracellular matrix (GO:0005578)				central_nervous_system(1)|cervix(1)|upper_aerodigestive_tract(1)	3						CCTGGAGCTGGACCGGAAGGT	0.692																																																	0								ENSG00000183628						97.0	80.0	86.0					22																	18898464		2203	4299	6502	DGCR6	SO:0001583	missense	0			-	HGNC	X96484	CCDS13753.1	22q11.21	2008-06-12			ENSG00000183628	ENSG00000183628			2846	protein-coding gene	gene with protein product		601279				8733130	Standard	NM_005675		Approved		uc002zoh.4	Q14129	OTTHUMG00000150162	ENST00000331444.6:c.436G>A	22.37:g.18898464G>A	ENSP00000331681:p.Asp146Asn	Somatic	0	99	0.00		0.7039346279484041	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	39	104	27.27	B2RCH5|D3DX15|G5E9J8|Q9BY28	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DGCR6	p.D146N	ENST00000331444.6	37	c.436	CCDS13753.1	22	.	.	.	.	.	.	.	.	.	.	g	34	5.380687	0.95945	.	.	ENSG00000183628	ENST00000331444;ENST00000436645	T	0.54675	0.56	4.31	4.31	0.51392	.	0.000000	0.85682	D	0.000000	T	0.74450	0.3718	M	0.85945	2.785	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.79591	-0.1740	10	0.87932	D	0	-39.6603	14.6638	0.68893	0.0:0.0:1.0:0.0	.	146	Q14129	DGCR6_HUMAN	N	146;66	ENSP00000331681:D146N	ENSP00000331681:D146N	D	+	1	0	DGCR6	17278464	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	6.478000	0.73596	2.421000	0.82119	0.430000	0.28490	GAC	-	pfam_DGCR6		0.692	DGCR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DGCR6	protein_coding	OTTHUMT00000316631.2	G	NM_005675	-		18898464	+1	no_errors	ENST00000331444	ensembl	human	known	74_37	missense	SNP	1.000	A
SLC4A4	8671	genome.wustl.edu	37	4	72412066	72412066	+	Splice_Site	SNP	G	G	A			TCGA-QQ-A8VH-01A-11D-A37C-09	TCGA-QQ-A8VH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b5a400-a49b-41a3-bff0-f3b8c36e36dd	a65e8e60-03c3-468b-acb5-075ff9096122	g.chr4:72412066G>A	ENST00000264485.5	+	19	2559		c.e19-1		SLC4A4_ENST00000425175.1_Splice_Site|SLC4A4_ENST00000351898.6_Intron|SLC4A4_ENST00000340595.3_Splice_Site	NM_001098484.2	NP_001091954.1	Q9Y6R1	S4A4_HUMAN	solute carrier family 4 (sodium bicarbonate cotransporter), member 4						bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|sodium:bicarbonate symporter activity (GO:0008510)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(1)|lung(21)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	58			Lung(101;0.0739)|LUSC - Lung squamous cell carcinoma(112;0.225)		Sodium bicarbonate(DB01390)	TCTTTCTACAGAAAGGAGCAG	0.433																																																	0								ENSG00000080493						214.0	182.0	193.0					4																	72412066		2203	4300	6503	SLC4A4	SO:0001630	splice_region_variant	0			-	HGNC	AF007216	CCDS3549.1, CCDS43236.1, CCDS47071.1	4q13.3	2013-07-19	2013-07-19		ENSG00000080493	ENSG00000080493		"""Solute carriers"""	11030	protein-coding gene	gene with protein product		603345	"""solute carrier family 4, sodium bicarbonate cotransporter, member 4"""	SLC4A5		9235899, 9651366	Standard	NM_001098484		Approved	NBC1, HNBC1, NBC2, pNBC, hhNMC	uc010iic.3	Q9Y6R1	OTTHUMG00000129907	ENST00000264485.5:c.2443-1G>A	4.37:g.72412066G>A		Somatic	0	103	0.00		0.7039346279484041	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	35	38	47.95	C4B714|O15153|Q8NEJ2|Q9H262|Q9NRZ1|Q9UIC0|Q9UIC1|Q9UP50	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e18-1	ENST00000264485.5	37	c.2443-1	CCDS43236.1	4	.	.	.	.	.	.	.	.	.	.	G	26.3	4.723939	0.89298	.	.	ENSG00000080493	ENST00000264485;ENST00000425175;ENST00000340595	.	.	.	5.55	5.55	0.83447	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.5157	0.95162	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SLC4A4	72630930	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	9.869000	0.99810	2.602000	0.87976	0.650000	0.86243	.	-	-		0.433	SLC4A4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC4A4	protein_coding	OTTHUMT00000362090.1	G	NM_003759	-	Intron	72412066	+1	no_errors	ENST00000425175	ensembl	human	known	74_37	splice_site	SNP	1.000	A
IGFBP5	3488	genome.wustl.edu	37	2	217559222	217559222	+	Silent	SNP	G	G	A			TCGA-QQ-A8VH-01A-11D-A37C-09	TCGA-QQ-A8VH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b5a400-a49b-41a3-bff0-f3b8c36e36dd	a65e8e60-03c3-468b-acb5-075ff9096122	g.chr2:217559222G>A	ENST00000233813.4	-	1	1026	c.277C>T	c.(277-279)Ctg>Ttg	p.L93L	AC007563.5_ENST00000447289.1_RNA	NM_000599.3	NP_000590.1	P24593	IBP5_HUMAN	insulin-like growth factor binding protein 5	93	IGFBP N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00653}.				cellular protein metabolic process (GO:0044267)|cellular response to cAMP (GO:0071320)|cellular response to organic cyclic compound (GO:0071407)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|hair follicle morphogenesis (GO:0031069)|intracellular signal transduction (GO:0035556)|mammary gland involution (GO:0060056)|negative regulation of cell migration (GO:0030336)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of translation (GO:0017148)|osteoblast differentiation (GO:0001649)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of cell growth (GO:0001558)|regulation of glucose metabolic process (GO:0010906)|signal transduction (GO:0007165)|skeletal muscle tissue growth (GO:0048630)|striated muscle cell differentiation (GO:0051146)|type B pancreatic cell proliferation (GO:0044342)	extracellular region (GO:0005576)|insulin-like growth factor binding protein complex (GO:0016942)	insulin-like growth factor I binding (GO:0031994)			endometrium(1)|large_intestine(3)|lung(1)	5		Renal(323;0.0822)		Epithelial(149;2.1e-06)|all cancers(144;0.000165)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CCGTGCAGCAGGGCGTGCAGC	0.701																																																	0								ENSG00000115461						7.0	7.0	7.0					2																	217559222		1863	3711	5574	IGFBP5	SO:0001819	synonymous_variant	0			-	HGNC		CCDS2405.1	2q35	2014-09-16			ENSG00000115461	ENSG00000115461			5474	protein-coding gene	gene with protein product		146734				7511611	Standard	NM_000599		Approved		uc002vgj.4	P24593	OTTHUMG00000133058	ENST00000233813.4:c.277C>T	2.37:g.217559222G>A		Somatic	0	65	0.00		0.7039346279484041	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	30	40.00	Q5U0A3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Thyroglobulin_1,pfam_IGFBP-like,superfamily_Thyroglobulin_1,superfamily_Growth_fac_rcpt_N_dom,smart_IGFBP-like,smart_Thyroglobulin_1,pfscan_Thyroglobulin_1,prints_IGFBP_1-6_chordata,prints_IGFBP-5	p.L93	ENST00000233813.4	37	c.277	CCDS2405.1	2																																																																																			-	superfamily_Growth_fac_rcpt_N_dom,smart_IGFBP-like,prints_IGFBP_1-6_chordata		0.701	IGFBP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGFBP5	protein_coding	OTTHUMT00000256674.2	G	NM_000599	-		217559222	-1	no_errors	ENST00000233813	ensembl	human	known	74_37	silent	SNP	1.000	A
SLC28A3	64078	genome.wustl.edu	37	9	86907608	86907608	+	Missense_Mutation	SNP	G	G	T			TCGA-QQ-A8VH-01A-11D-A37C-09	TCGA-QQ-A8VH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b5a400-a49b-41a3-bff0-f3b8c36e36dd	a65e8e60-03c3-468b-acb5-075ff9096122	g.chr9:86907608G>T	ENST00000376238.4	-	10	1047	c.998C>A	c.(997-999)gCt>gAt	p.A333D	SLC28A3_ENST00000537648.1_Missense_Mutation_p.A264D|RP11-380F14.2_ENST00000419815.1_RNA	NM_001199633.1|NM_022127.2	NP_001186562.1|NP_071410.1	Q9HAS3	S28A3_HUMAN	solute carrier family 28 (concentrative nucleoside transporter), member 3	333					pyrimidine nucleoside transport (GO:0015864)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	nucleoside binding (GO:0001882)|purine-specific nucleoside:sodium symporter activity (GO:0015390)|pyrimidine- and adenine-specific:sodium symporter activity (GO:0015389)			endometrium(2)|large_intestine(6)|lung(17)|ovary(1)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	31					Adenosine(DB00640)|Cladribine(DB00242)|Fludarabine(DB01073)|Gemcitabine(DB00441)|Mercaptopurine(DB01033)|Ribavirin(DB00811)	ATTGCCAGAAGCAACTACAGA	0.348																																					Ovarian(106;425 1539 34835 42413 43572)												0								ENSG00000197506						93.0	84.0	87.0					9																	86907608		2203	4300	6503	SLC28A3	SO:0001583	missense	0			-	HGNC	AF305210	CCDS6670.1	9q21.33	2013-07-17	2013-07-17		ENSG00000197506	ENSG00000197506		"""Solute carriers"""	16484	protein-coding gene	gene with protein product		608269	"""solute carrier family 28 (sodium-coupled nucleoside transporter), member 3"""			11032837	Standard	NM_001199633		Approved	CNT3	uc010mpz.3	Q9HAS3	OTTHUMG00000020117	ENST00000376238.4:c.998C>A	9.37:g.86907608G>T	ENSP00000365413:p.Ala333Asp	Somatic	0	60	0.00		0.7039346279484041	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	22	12.00	A8K9Y4|B1AML0|B2RA51|B4E2S8|F5GYE3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Nucleos_tra2_C,pfam_Nuclsd_transpt2,pfam_Nucleoside_recog_Gate,tigrfam_C_nuclsd_transpt_met_bac	p.A333D	ENST00000376238.4	37	c.998	CCDS6670.1	9	.	.	.	.	.	.	.	.	.	.	G	26.3	4.725722	0.89298	.	.	ENSG00000197506	ENST00000376238;ENST00000537648	T;T	0.32988	1.43;1.43	6.08	6.08	0.98989	Nucleoside recognition (1);	0.000000	0.85682	D	0.000000	T	0.71995	0.3406	H	0.96748	3.875	0.58432	D	0.999998	D;D	0.76494	0.997;0.999	D;D	0.79784	0.987;0.993	T	0.80656	-0.1285	10	0.87932	D	0	-20.5706	20.6721	0.99693	0.0:0.0:1.0:0.0	.	264;333	B4E2S8;Q9HAS3	.;S28A3_HUMAN	D	333;264	ENSP00000365413:A333D;ENSP00000446438:A264D	ENSP00000365413:A333D	A	-	2	0	SLC28A3	86097428	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.088000	0.64486	2.894000	0.99253	0.591000	0.81541	GCT	-	pfam_Nucleoside_recog_Gate,tigrfam_C_nuclsd_transpt_met_bac		0.348	SLC28A3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC28A3	protein_coding	OTTHUMT00000052874.1	G	NM_022127	-		86907608	-1	no_errors	ENST00000376238	ensembl	human	known	74_37	missense	SNP	1.000	T
AGBL2	79841	genome.wustl.edu	37	11	47711627	47711627	+	Splice_Site	DEL	C	C	-			TCGA-QQ-A8VH-01A-11D-A37C-09	TCGA-QQ-A8VH-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b5a400-a49b-41a3-bff0-f3b8c36e36dd	a65e8e60-03c3-468b-acb5-075ff9096122	g.chr11:47711627delC	ENST00000525123.1	-	10	1917		c.e10+1		AGBL2_ENST00000528244.1_Splice_Site|AGBL2_ENST00000357610.3_Splice_Site|AGBL2_ENST00000529712.1_Splice_Site|AGBL2_ENST00000298861.4_Splice_Site	NM_024783.3	NP_079059.2	Q5U5Z8	CBPC2_HUMAN	ATP/GTP binding protein-like 2							cytosol (GO:0005829)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			NS(1)|endometrium(5)|kidney(1)|large_intestine(8)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(1)	34						AAAAGTCTCACCTTTTGATCA	0.428																																																	0								ENSG00000165923						54.0	47.0	49.0					11																	47711627		2201	4298	6499	AGBL2	SO:0001630	splice_region_variant	0				HGNC		CCDS7944.1	11p11.2	2014-06-23			ENSG00000165923	ENSG00000165923			26296	protein-coding gene	gene with protein product	"""cytoplasmic carboxypeptidase 2"""					12738998, 21303978	Standard	NM_024783		Approved	FLJ23598, CCP2	uc001ngg.3	Q5U5Z8	OTTHUMG00000165368	ENST00000525123.1:c.1631+1G>-	11.37:g.47711627delC		Somatic	0	32	0.00		0.7039346279484041	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	45	25.00	A8MPX2|Q53FV5|Q8IV57|Q9H5C0	Splice_Site	DEL	NA	NA	NA	NA	NA	NA	-	e9+1	ENST00000525123.1	37	c.1631+1	CCDS7944.1	11																																																																																			-	-		0.428	AGBL2-001	KNOWN	non_canonical_conserved|basic|appris_candidate|CCDS	protein_coding	AGBL2	protein_coding	OTTHUMT00000383726.2	C	NM_024783		Intron	47711627	-1	no_errors	ENST00000357610	ensembl	human	known	74_37	splice_site_del	DEL	1.000	-
CERS3	204219	genome.wustl.edu	37	15	101088125	101088126	+	5'Flank	INS	-	-	T	rs532048470|rs574236631|rs111634080	byFrequency	TCGA-QQ-A8VH-01A-11D-A37C-09	TCGA-QQ-A8VH-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b5a400-a49b-41a3-bff0-f3b8c36e36dd	a65e8e60-03c3-468b-acb5-075ff9096122	g.chr15:101088125_101088126insT	ENST00000560944.1	-	0	0				RP11-526I2.5_ENST00000602585.1_lincRNA			Q8IU89	CERS3_HUMAN	ceramide synthase 3						ceramide biosynthetic process (GO:0046513)|keratinocyte differentiation (GO:0030216)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sphingosine N-acyltransferase activity (GO:0050291)										ACATGCTACAGTTTTTTTTTTC	0.347													|||unknown(HR)	294	0.0587061	0.0204	0.1902	5008	,	,		16134	0.0437		0.0487	False		,,,				2504	0.0429																0								ENSG00000270127																																			RP11-526I2.5	SO:0001631	upstream_gene_variant	0				Clone_based_vega_gene		CCDS10384.1	15q26.3	2012-11-19	2011-07-08	2011-07-08	ENSG00000154227	ENSG00000154227		"""Homeoboxes / CERS class"""	23752	protein-coding gene	gene with protein product		615276	"""LAG1 longevity assurance homolog 3 (S. cerevisiae)"", ""LAG1 homolog, ceramide synthase 3"""	LASS3			Standard	NM_178842		Approved	MGC27091	uc002bwb.3	Q8IU89	OTTHUMG00000172568		15.37:g.101088135_101088135dupT	Exception_encountered	Somatic	0	16	0.00		0.7039346279484041	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	29	19.44	Q8NE64|Q8NEN6	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000560944.1	37	NULL		15																																																																																			-	-		0.347	CERS3-009	KNOWN	basic	processed_transcript	PRKXP1	protein_coding	OTTHUMT00000417720.1	-	NM_178842			101088126	-1	no_errors	ENST00000602585	ensembl	human	known	74_37	rna	INS	0.000:0.000	T
KCNH1	3756	genome.wustl.edu	37	1	210977435	210977435	+	Nonsense_Mutation	SNP	G	G	T			TCGA-QQ-A8VH-01A-11D-A37C-09	TCGA-QQ-A8VH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b5a400-a49b-41a3-bff0-f3b8c36e36dd	a65e8e60-03c3-468b-acb5-075ff9096122	g.chr1:210977435G>T	ENST00000271751.4	-	8	1563	c.1536C>A	c.(1534-1536)taC>taA	p.Y512*	KCNH1_ENST00000367007.4_Nonsense_Mutation_p.Y485*			O95259	KCNH1_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 1	512					myoblast fusion (GO:0007520)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|phosphorelay sensor kinase activity (GO:0000155)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(13)|lung(35)|ovary(4)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	68				OV - Ovarian serous cystadenocarcinoma(81;0.0109)|all cancers(67;0.141)|Epithelial(68;0.185)		GCATCTCATGGTATCTGTTGG	0.468																																																	0								ENSG00000143473						168.0	152.0	158.0					1																	210977435		2203	4300	6503	KCNH1	SO:0001587	stop_gained	0			-	HGNC	AJ001366	CCDS1496.1, CCDS31015.1	1q32.2	2012-07-05			ENSG00000143473	ENSG00000143473		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6250	protein-coding gene	gene with protein product		603305				9738473, 16382104	Standard	NM_172362		Approved	Kv10.1, eag, h-eag, eag1	uc001hib.2	O95259	OTTHUMG00000036309	ENST00000271751.4:c.1536C>A	1.37:g.210977435G>T	ENSP00000271751:p.Tyr512*	Somatic	0	102	0.00		0.7039346279484041	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	49	37.18	B1AQ26|O76035|Q14CL3	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_cNMP-bd_dom,pfam_2pore_dom_K_chnl_dom,pfam_PAS_fold,superfamily_cNMP-bd-like,superfamily_PAS,smart_PAC,smart_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG,prints_K_chnl_volt-dep_EAG/ELK/ERG,prints_K_chnl_volt-dep_ERG,pfscan_cNMP-bd_dom,pfscan_PAS,pfscan_PAS-assoc_C,tigrfam_PAS	p.Y512*	ENST00000271751.4	37	c.1536	CCDS1496.1	1	.	.	.	.	.	.	.	.	.	.	G	39	7.516838	0.98332	.	.	ENSG00000143473	ENST00000271751;ENST00000367007	.	.	.	5.6	3.71	0.42584	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.8208	0.40880	0.2742:0.0:0.7258:0.0	.	.	.	.	X	512;485	.	ENSP00000271751:Y512X	Y	-	3	2	KCNH1	209044058	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	1.126000	0.31344	0.714000	0.32081	0.511000	0.50034	TAC	-	superfamily_cNMP-bd-like		0.468	KCNH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNH1	protein_coding	OTTHUMT00000088332.1	G	NM_002238	-		210977435	-1	no_errors	ENST00000271751	ensembl	human	known	74_37	nonsense	SNP	1.000	T
KIT	3815	genome.wustl.edu	37	4	55603360	55603360	+	Missense_Mutation	SNP	T	T	C			TCGA-QQ-A8VH-01A-11D-A37C-09	TCGA-QQ-A8VH-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b5a400-a49b-41a3-bff0-f3b8c36e36dd	a65e8e60-03c3-468b-acb5-075ff9096122	g.chr4:55603360T>C	ENST00000288135.5	+	20	2813	c.2716T>C	c.(2716-2718)Tgc>Cgc	p.C906R		NM_000222.2|NM_001093772.1	NP_000213.1|NP_001087241.1	P10721	KIT_HUMAN	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	906	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cellular response to thyroid hormone stimulus (GO:0097067)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell cytokine production (GO:0002371)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|digestive tract development (GO:0048565)|ectopic germ cell programmed cell death (GO:0035234)|embryonic hemopoiesis (GO:0035162)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation (GO:0050673)|erythrocyte differentiation (GO:0030218)|erythropoietin-mediated signaling pathway (GO:0038162)|Fc receptor signaling pathway (GO:0038093)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell migration (GO:0008354)|glycosphingolipid metabolic process (GO:0006687)|hemopoiesis (GO:0030097)|immature B cell differentiation (GO:0002327)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|Kit signaling pathway (GO:0038109)|lamellipodium assembly (GO:0030032)|lymphoid progenitor cell differentiation (GO:0002320)|male gonad development (GO:0008584)|mast cell chemotaxis (GO:0002551)|mast cell cytokine production (GO:0032762)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|mast cell proliferation (GO:0070662)|megakaryocyte development (GO:0035855)|melanocyte adhesion (GO:0097326)|melanocyte differentiation (GO:0030318)|melanocyte migration (GO:0097324)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of programmed cell death (GO:0043069)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|pigmentation (GO:0043473)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of developmental pigmentation (GO:0048070)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)|T cell differentiation (GO:0030217)|visual learning (GO:0008542)	acrosomal vesicle (GO:0001669)|cell-cell junction (GO:0005911)|cytoplasmic side of plasma membrane (GO:0009898)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|stem cell factor receptor activity (GO:0005020)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(8)|autonomic_ganglia(1)|bone(21)|breast(2)|central_nervous_system(4)|endometrium(10)|eye(12)|genital_tract(18)|haematopoietic_and_lymphoid_tissue(1820)|kidney(17)|large_intestine(17)|lung(27)|ovary(23)|pancreas(4)|prostate(1)|salivary_gland(15)|skin(228)|soft_tissue(4117)|stomach(3)|testis(55)|thymus(7)|upper_aerodigestive_tract(1)	6411	all_cancers(7;0.00453)|all_lung(4;0.000565)|Lung NSC(11;0.00129)|all_epithelial(27;0.0104)|Glioma(25;0.08)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(32;0.000276)|Epithelial(7;0.209)	Colorectal(1;0.0276)|COAD - Colon adenocarcinoma(1;0.171)	Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	AATGAAGACTTGCTGGGATGC	0.433		1	"""Mis, O"""		"""GIST, AML, TGCT, mastocytosis, mucosal melanoma"""	"""GIST, epithelioma"""	Piebald trait		Piebaldism;Mast Cell disease, Familial Clustering of;Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Gastrointestinal Stromal Tumors																														yes	Dom	yes	Familial gastrointestinal stromal tumour	4	4q12	3815	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	yes	"""L, M, O, E"""	0								ENSG00000157404						126.0	110.0	116.0					4																	55603360		2203	4300	6503	KIT	SO:0001583	missense	0	Familial Cancer Database	Piebald trait;incl.: Familial Cutaneous Mastocytosis (Urticaria Pigmentosum);Sporadic Multiple GIST;Familial GIST, incl. Multiple Familial Gastrointestinal Autonomic Nerve Tumors (GANT)	-	HGNC	S67773	CCDS3496.1, CCDS47058.1	4q12	2014-09-17			ENSG00000157404	ENSG00000157404		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6342	protein-coding gene	gene with protein product		164920	"""piebald trait"""	PBT		9027509	Standard	NM_001093772		Approved	CD117, SCFR, C-Kit	uc010igr.3	P10721	OTTHUMG00000128713	ENST00000288135.5:c.2716T>C	4.37:g.55603360T>C	ENSP00000288135:p.Cys906Arg	Somatic	0	28	0.00		0.7039346279484041	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	33	17.50	B5A956|D5LXN2|D5M931|F5H8F8|Q6IQ28|Q99662|Q9UM99	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_Tyr_kinase_CSF1/PDGF_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.C906R	ENST00000288135.5	37	c.2716	CCDS3496.1	4	.	.	.	.	.	.	.	.	.	.	T	20.4	3.976496	0.74360	.	.	ENSG00000157404	ENST00000288135;ENST00000412167	D;D	0.90004	-2.6;-2.6	5.44	5.44	0.79542	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.092585	0.47852	D	0.000209	D	0.96291	0.8790	H	0.96430	3.82	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.79108	0.992;0.981	D	0.97620	1.0135	10	0.87932	D	0	.	15.7887	0.78332	0.0:0.0:0.0:1.0	.	902;906	P10721-2;P10721	.;KIT_HUMAN	R	906;902	ENSP00000288135:C906R;ENSP00000390987:C902R	ENSP00000288135:C906R	C	+	1	0	KIT	55298117	1.000000	0.71417	1.000000	0.80357	0.793000	0.44817	8.040000	0.89188	2.193000	0.70182	0.528000	0.53228	TGC	-	pirsf_Tyr_kinase_CSF1/PDGF_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.433	KIT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIT	protein_coding	OTTHUMT00000250618.1	T		-		55603360	+1	no_errors	ENST00000288135	ensembl	human	known	74_37	missense	SNP	1.000	C
RNASE8	122665	genome.wustl.edu	37	14	21526082	21526084	+	In_Frame_Del	DEL	CTG	CTG	-			TCGA-QQ-A8VH-01A-11D-A37C-09	TCGA-QQ-A8VH-10A-01D-A37F-09	CTG	CTG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b5a400-a49b-41a3-bff0-f3b8c36e36dd	a65e8e60-03c3-468b-acb5-075ff9096122	g.chr14:21526082_21526084delCTG	ENST00000308227.2	+	1	102_104	c.31_33delCTG	c.(31-33)ctgdel	p.L16del	NDRG2_ENST00000403829.3_Intron	NM_138331.1	NP_612204.1	Q8TDE3	RNAS8_HUMAN	ribonuclease, RNase A family, 8	16					RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)	extracellular region (GO:0005576)	nucleic acid binding (GO:0003676)|pancreatic ribonuclease activity (GO:0004522)			endometrium(1)|kidney(1)|large_intestine(1)|lung(1)	4	all_cancers(95;0.000759)		OV - Ovarian serous cystadenocarcinoma(11;3.42e-11)|Epithelial(56;5.57e-09)|all cancers(55;2.36e-08)	GBM - Glioblastoma multiforme(265;0.0188)		ATGCTGCCCCCTGCTGCTGCTGC	0.557																																																	0								ENSG00000173431																																			RNASE8	SO:0001651	inframe_deletion	0				HGNC	AF473854	CCDS9567.1	14q11.1	2003-03-13			ENSG00000173431	ENSG00000173431		"""Ribonucleases, RNase A"""	19277	protein-coding gene	gene with protein product		612485				11861908	Standard	NM_138331		Approved		uc010tlm.2	Q8TDE3	OTTHUMG00000029645	ENST00000308227.2:c.31_33delCTG	14.37:g.21526091_21526093delCTG	ENSP00000311398:p.Leu16del	Somatic	0	49	0.00		0.7039346279484041	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	19	17.39	B2RPP6|B2RPP7	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_RNaseA_domain,superfamily_RNaseA_domain,smart_RNaseA_domain,prints_RNaseA	p.L14in_frame_del	ENST00000308227.2	37	c.31_33	CCDS9567.1	14																																																																																			-	NULL		0.557	RNASE8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNASE8	protein_coding	OTTHUMT00000073925.3	CTG	NM_138331			21526084	+1	no_errors	ENST00000308227	ensembl	human	known	74_37	in_frame_del	DEL	0.001:0.002:0.001	-
TECTA	7007	genome.wustl.edu	37	11	121037373	121037373	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VH-01A-11D-A37C-09	TCGA-QQ-A8VH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b5a400-a49b-41a3-bff0-f3b8c36e36dd	a65e8e60-03c3-468b-acb5-075ff9096122	g.chr11:121037373G>A	ENST00000392793.1	+	18	5741	c.5470G>A	c.(5470-5472)Ggt>Agt	p.G1824S	TECTA_ENST00000264037.2_Missense_Mutation_p.G1824S			O75443	TECTA_HUMAN	tectorin alpha	1824	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.		G -> D (in DFNA12; prelingual and stable deafness). {ECO:0000269|PubMed:9590290}.		cell-matrix adhesion (GO:0007160)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)		p.G1824C(1)	TECTA/TBCEL(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|liver(1)|lung(46)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	135	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		CTTCCAGCTCGGTTTTGAGAG	0.488																																																	1	Substitution - Missense(1)	lung(1)						ENSG00000109927						135.0	116.0	122.0					11																	121037373		2203	4299	6502	TECTA	SO:0001583	missense	0			-	HGNC	AF055136	CCDS8434.1	11q22-q24	2008-02-05			ENSG00000109927	ENSG00000109927			11720	protein-coding gene	gene with protein product		602574		DFNA12, DFNA8, DFNB21		9503015, 9590290	Standard	NM_005422		Approved		uc010rzo.2	O75443	OTTHUMG00000149908	ENST00000392793.1:c.5470G>A	11.37:g.121037373G>A	ENSP00000376543:p.Gly1824Ser	Somatic	0	72	0.00		0.7039346279484041	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	41	30.51		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_ZP_dom,pfam_Nidogen_extracell_dom,pfam_TIL_dom,superfamily_TIL_dom,smart_Nidogen_extracell_dom,smart_VWC_out,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EG-like_dom,smart_ZP_dom,pfscan_ZP_dom	p.G1824S	ENST00000392793.1	37	c.5470	CCDS8434.1	11	.	.	.	.	.	.	.	.	.	.	G	36	5.672229	0.96754	.	.	ENSG00000109927	ENST00000392793;ENST00000264037	D;D	0.83250	-1.7;-1.7	6.05	6.05	0.98169	Zona pellucida sperm-binding protein (3);	0.000000	0.85682	D	0.000000	D	0.91553	0.7332	M	0.76574	2.34	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.90947	0.4802	10	0.62326	D	0.03	.	20.6087	0.99469	0.0:0.0:1.0:0.0	.	1824	O75443	TECTA_HUMAN	S	1824	ENSP00000376543:G1824S;ENSP00000264037:G1824S	ENSP00000264037:G1824S	G	+	1	0	TECTA	120542583	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.429000	0.97481	2.866000	0.98385	0.650000	0.86243	GGT	-	pfam_ZP_dom,smart_ZP_dom,pfscan_ZP_dom		0.488	TECTA-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	TECTA	protein_coding	OTTHUMT00000313850.1	G	NM_005422	-		121037373	+1	no_errors	ENST00000264037	ensembl	human	known	74_37	missense	SNP	1.000	A
FAM47C	442444	genome.wustl.edu	37	X	37026659	37026659	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VH-01A-11D-A37C-09	TCGA-QQ-A8VH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b5a400-a49b-41a3-bff0-f3b8c36e36dd	a65e8e60-03c3-468b-acb5-075ff9096122	g.chrX:37026659G>A	ENST00000358047.3	+	1	228	c.176G>A	c.(175-177)cGc>cAc	p.R59H		NM_001013736.2	NP_001013758.1	Q5HY64	FA47C_HUMAN	family with sequence similarity 47, member C	59								p.R59L(2)		breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	120						GACGACTTCCGCTACGGCTGT	0.557																																																	2	Substitution - Missense(2)	lung(2)						ENSG00000198173						81.0	71.0	74.0					X																	37026659		2202	4300	6502	FAM47C	SO:0001583	missense	0			-	HGNC	AK125992	CCDS35227.1	Xp21.1	2006-07-04			ENSG00000198173	ENSG00000198173			25301	protein-coding gene	gene with protein product							Standard	NM_001013736		Approved		uc004ddl.2	Q5HY64	OTTHUMG00000024025	ENST00000358047.3:c.176G>A	X.37:g.37026659G>A	ENSP00000367913:p.Arg59His	Somatic	0	106	0.00		0.7039346279484041	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	33	54	37.93	Q6ZU46	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.R59H	ENST00000358047.3	37	c.176	CCDS35227.1	X	.	.	.	.	.	.	.	.	.	.	G	6.630	0.484669	0.12641	.	.	ENSG00000198173	ENST00000358047	T	0.21191	2.02	0.502	-1.0	0.10196	.	.	.	.	.	T	0.15435	0.0372	L	0.52823	1.66	0.09310	N	1	B	0.31949	0.348	B	0.29716	0.106	T	0.23655	-1.0182	8	0.62326	D	0.03	.	.	.	.	.	59	Q5HY64	FA47C_HUMAN	H	59	ENSP00000367913:R59H	ENSP00000367913:R59H	R	+	2	0	FAM47C	36936580	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.279000	0.08479	-1.720000	0.01380	-2.143000	0.00337	CGC	-	NULL		0.557	FAM47C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM47C	protein_coding	OTTHUMT00000060508.1	G	NM_001013736	-		37026659	+1	no_errors	ENST00000358047	ensembl	human	known	74_37	missense	SNP	0.000	A
RASSF9	9182	genome.wustl.edu	37	12	86198968	86198968	+	Nonsense_Mutation	SNP	T	T	A			TCGA-QQ-A8VH-01A-11D-A37C-09	TCGA-QQ-A8VH-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b5a400-a49b-41a3-bff0-f3b8c36e36dd	a65e8e60-03c3-468b-acb5-075ff9096122	g.chr12:86198968T>A	ENST00000361228.3	-	2	1188	c.820A>T	c.(820-822)Aaa>Taa	p.K274*		NM_005447.3	NP_005438.2	O75901	RASF9_HUMAN	Ras association (RalGDS/AF-6) domain family (N-terminal) member 9	274					endosomal transport (GO:0016197)|protein targeting (GO:0006605)|signal transduction (GO:0007165)	cytosol (GO:0005829)|endosome (GO:0005768)|trans-Golgi network transport vesicle membrane (GO:0012510)	transporter activity (GO:0005215)			endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(11)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						CGGTAATATTTCAGTCGTTCT	0.408																																																	0								ENSG00000198774						112.0	107.0	109.0					12																	86198968		1876	4106	5982	RASSF9	SO:0001587	stop_gained	0			-	HGNC		CCDS44950.1	12q21.31	2008-02-22	2008-02-22	2008-02-22		ENSG00000198774			15739	protein-coding gene	gene with protein product		610383	"""peptidylglycine alpha-amidating monooxygenase COOH-terminal interactor"""	PAMCI		9837933, 18272789	Standard	NM_005447		Approved	P-CIP1	uc001taf.1	O75901	OTTHUMG00000169831	ENST00000361228.3:c.820A>T	12.37:g.86198968T>A	ENSP00000354884:p.Lys274*	Somatic	0	42	0.00		0.7039346279484041	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	20	42.86	B3KMQ4|Q8N5U8	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_Ras-assoc,pfscan_Ras-assoc	p.K274*	ENST00000361228.3	37	c.820	CCDS44950.1	12	.	.	.	.	.	.	.	.	.	.	T	22.5	4.293561	0.80914	.	.	ENSG00000198774	ENST00000361228	.	.	.	4.9	-0.962	0.10333	.	0.874620	0.10040	U	0.723517	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05525	T	0.97	-4.9129	6.007	0.19551	0.0:0.1503:0.2603:0.5894	.	.	.	.	X	274	.	ENSP00000354884:K274X	K	-	1	0	RASSF9	84723099	0.001000	0.12720	0.025000	0.17156	0.441000	0.31987	0.500000	0.22562	-0.008000	0.14320	0.528000	0.53228	AAA	-	NULL		0.408	RASSF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RASSF9	protein_coding	OTTHUMT00000406109.1	T		-		86198968	-1	no_errors	ENST00000361228	ensembl	human	known	74_37	nonsense	SNP	0.017	A
GCC1	79571	genome.wustl.edu	37	7	127225067	127225067	+	Frame_Shift_Del	DEL	T	T	-			TCGA-QQ-A8VH-01A-11D-A37C-09	TCGA-QQ-A8VH-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b5a400-a49b-41a3-bff0-f3b8c36e36dd	a65e8e60-03c3-468b-acb5-075ff9096122	g.chr7:127225067delT	ENST00000321407.2	-	1	594	c.170delA	c.(169-171)aagfs	p.K57fs	GCC1_ENST00000497650.1_Intron	NM_024523.5	NP_078799.2	Q96CN9	GCC1_HUMAN	GRIP and coiled-coil domain containing 1	57					protein targeting to Golgi (GO:0000042)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)				breast(2)|endometrium(6)|kidney(4)|large_intestine(6)|lung(13)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	38						CGACAGCACCTTGATGCTGGC	0.572																																																	0								ENSG00000179562						107.0	102.0	104.0					7																	127225067		2203	4300	6503	GCC1	SO:0001589	frameshift_variant	0				HGNC	AF525417	CCDS5796.1	7q22.3	2004-03-05	2003-10-17		ENSG00000179562	ENSG00000179562			19095	protein-coding gene	gene with protein product		607418	"""golgi coiled-coil 1"""			10209125	Standard	NM_024523		Approved	FLJ22035, GCC88, GCC1P, MGC20706	uc003vma.3	Q96CN9	OTTHUMG00000023590	ENST00000321407.2:c.170delA	7.37:g.127225067delT	ENSP00000318821:p.Lys57fs	Somatic	0	65	0.00		0.7039346279484041	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	19	9.52	Q9H6N7	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_GRIP,superfamily_ARM-type_fold,smart_GRIP,pfscan_GRIP	p.K57fs	ENST00000321407.2	37	c.170	CCDS5796.1	7																																																																																			-	NULL		0.572	GCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCC1	protein_coding	OTTHUMT00000059911.3	T	NM_024523			127225067	-1	no_errors	ENST00000321407	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
SCAND2P	54581	genome.wustl.edu	37	15	85178522	85178523	+	RNA	INS	-	-	T	rs59254720		TCGA-QQ-A8VH-01A-11D-A37C-09	TCGA-QQ-A8VH-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b5a400-a49b-41a3-bff0-f3b8c36e36dd	a65e8e60-03c3-468b-acb5-075ff9096122	g.chr15:85178522_85178523insT	ENST00000527801.1	-	0	0				SCAND2P_ENST00000348993.5_RNA																							AAGATTGCTGCTTTTTTTTGAT	0.287																																																	0								ENSG00000176700																																			SCAND2P			0				HGNC																													15.37:g.85178530_85178530dupT		Somatic	0	22	0.00		0.7039346279484041	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	19	13.64		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000527801.1	37	NULL		15																																																																																			-	-		0.287	RP11-182J1.1-001	KNOWN	basic|exp_conf	antisense	SCAND2P	antisense	OTTHUMT00000390220.1	-				85178523	+1	no_errors	ENST00000427525	ensembl	human	known	74_37	rna	INS	0.260:0.227	T
LOC285556	285556	genome.wustl.edu	37	4	100571171	100571171	+	Silent	SNP	G	G	A			TCGA-QQ-A8VH-01A-11D-A37C-09	TCGA-QQ-A8VH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b5a400-a49b-41a3-bff0-f3b8c36e36dd	a65e8e60-03c3-468b-acb5-075ff9096122	g.chr4:100571171G>A	ENST00000511828.1	-	1	4634	c.4635C>T	c.(4633-4635)gcC>gcT	p.A1545A																								GCCCTGGGGGGGCAGCTACTG	0.657																																																	0								ENSG00000248713																																			RP11-766F14.2	SO:0001819	synonymous_variant	0			-	Clone_based_vega_gene																												ENST00000511828.1:c.4635C>T	4.37:g.100571171G>A		Somatic	0	22	0.00		0.7039346279484041	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	14	51.72		Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.A1545	ENST00000511828.1	37	c.4635		4																																																																																			-	NULL		0.657	RP11-766F14.2-001	PUTATIVE	basic|appris_principal|exp_conf	protein_coding	LOC285556	protein_coding	OTTHUMT00000365456.1	G		-		100571171	-1	no_errors	ENST00000511828	ensembl	human	putative	74_37	silent	SNP	0.007	A
KRTAP10-9	386676	genome.wustl.edu	37	21	46048138	46048138	+	3'UTR	SNP	C	C	G	rs112351109		TCGA-QQ-A8VH-01A-11D-A37C-09	TCGA-QQ-A8VH-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b5a400-a49b-41a3-bff0-f3b8c36e36dd	a65e8e60-03c3-468b-acb5-075ff9096122	g.chr21:46048138C>G	ENST00000397911.3	+	0	1099				KRTAP10-9_ENST00000484861.1_3'UTR|TSPEAR_ENST00000323084.4_Intron	NM_198690.2	NP_941963.2	P60411	KR109_HUMAN	keratin associated protein 10-9							keratin filament (GO:0045095)				endometrium(1)|kidney(1)|large_intestine(1)|lung(6)	9						ACCTCCCCCCCGGGCAGGCGA	0.697																																																	0								ENSG00000221837																																			KRTAP10-9	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AJ566386	CCDS42961.1	21q22.3	2007-10-05			ENSG00000221837	ENSG00000221837		"""Keratin associated proteins"""	22971	protein-coding gene	gene with protein product				KRTAP18-9			Standard	NM_198690		Approved	KAP10.9, KAP18.9	uc002zfp.4	P60411	OTTHUMG00000057637	ENST00000397911.3:c.*171C>G	21.37:g.46048138C>G		Somatic	1	109	0.91		0.7039346279484041	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	57	14.93	A2RRG1|A6NIR9|Q70LJ1	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000397911.3	37	NULL	CCDS42961.1	21																																																																																			-	-		0.697	KRTAP10-9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP10-9	protein_coding	OTTHUMT00000128040.1	C		rs112351109		46048138	+1	no_errors	ENST00000484861	ensembl	human	known	74_37	rna	SNP	0.000	G
NF1	4763	genome.wustl.edu	37	17	29553702	29553702	+	Splice_Site	SNP	G	G	C			TCGA-QQ-A8VH-01A-11D-A37C-09	TCGA-QQ-A8VH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b5a400-a49b-41a3-bff0-f3b8c36e36dd	a65e8e60-03c3-468b-acb5-075ff9096122	g.chr17:29553702G>C	ENST00000358273.4	+	18	2634	c.2251G>C	c.(2251-2253)Gga>Cga	p.G751R	NF1_ENST00000356175.3_Splice_Site_p.G751R	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	751					actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(4)|p.G751*(2)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		GATGTCAACAGGTAAATGTGA	0.403			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																													yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	14	Whole gene deletion(8)|Unknown(4)|Substitution - Nonsense(2)	soft_tissue(7)|lung(3)|autonomic_ganglia(2)|central_nervous_system(2)	GRCh37	CS076636	NF1	S		ENSG00000196712						118.0	105.0	110.0					17																	29553702		2203	4300	6503	NF1	SO:0001630	splice_region_variant	0	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome	-	HGNC		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.2251+1G>C	17.37:g.29553702G>C		Somatic	0	48	0.00		0.7039346279484041	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	16	48.39	O00662|Q14284|Q14930|Q14931|Q9UMK3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RasGAP,superfamily_Rho_GTPase_activation_prot,superfamily_ARM-type_fold,superfamily_CRAL-TRIO_dom,smart_RasGAP,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom,pfscan_RasGAP	p.G751R	ENST00000358273.4	37	c.2251	CCDS42292.1	17	.	.	.	.	.	.	.	.	.	.	G	28.3	4.905136	0.92035	.	.	ENSG00000196712	ENST00000358273;ENST00000356175;ENST00000456735	T;T;T	0.63913	-0.07;-0.07;0.74	5.78	5.78	0.91487	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.77572	0.4150	L	0.52905	1.665	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.87578	0.98;0.998;0.986	T	0.78122	-0.2327	10	0.87932	D	0	.	20.0278	0.97529	0.0:0.0:1.0:0.0	.	751;751;751	E1P657;P21359-2;P21359	.;.;NF1_HUMAN	R	751;751;417	ENSP00000351015:G751R;ENSP00000348498:G751R;ENSP00000389907:G417R	ENSP00000348498:G751R	G	+	1	0	NF1	26577828	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.288000	0.96055	2.717000	0.92951	0.650000	0.86243	GGA	-	superfamily_ARM-type_fold		0.403	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NF1	protein_coding	OTTHUMT00000256351.2	G	NM_000267	-	Missense_Mutation	29553702	+1	no_errors	ENST00000358273	ensembl	human	known	74_37	missense	SNP	1.000	C
GRIA3	2892	genome.wustl.edu	37	X	122616781	122616781	+	Missense_Mutation	SNP	G	G	T			TCGA-QQ-A8VH-01A-11D-A37C-09	TCGA-QQ-A8VH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b5a400-a49b-41a3-bff0-f3b8c36e36dd	a65e8e60-03c3-468b-acb5-075ff9096122	g.chrX:122616781G>T	ENST00000371251.1	+	15	2623	c.2571G>T	c.(2569-2571)atG>atT	p.M857I	GRIA3_ENST00000264357.5_Missense_Mutation_p.M857I|GRIA3_ENST00000371256.5_Missense_Mutation_p.M857I|GRIA3_ENST00000542149.1_3'UTR			P42263	GRIA3_HUMAN	glutamate receptor, ionotropic, AMPA 3	857					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)			breast(2)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(8)|lung(25)|ovary(3)|pancreas(2)|skin(2)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)	57					Lithium(DB01356)	CCAAACGCATGAAACTCACAA	0.463																																																	0								ENSG00000125675						126.0	103.0	111.0					X																	122616781		2203	4300	6503	GRIA3	SO:0001583	missense	0			-	HGNC	U10301	CCDS14604.1, CCDS14605.1, CCDS76017.1	Xq25	2012-08-29	2012-02-03		ENSG00000125675	ENSG00000125675		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4573	protein-coding gene	gene with protein product		305915	"""glutamate receptor, ionotrophic, AMPA 3"""	GLUR3		1319477, 10644433	Standard	NM_007325		Approved	GluA3, GLURC, MRX94	uc004etr.4	P42263	OTTHUMG00000022685	ENST00000371251.1:c.2571G>T	X.37:g.122616781G>T	ENSP00000360297:p.Met857Ile	Somatic	0	97	0.00		0.7039346279484041	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52	D3DTF1|Q4VXD5|Q4VXD6|Q9HDA0|Q9HDA1|Q9HDA2|Q9P0H1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Iontro_glu_rcpt,pfam_ANF_lig-bd_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.M857I	ENST00000371251.1	37	c.2571	CCDS14604.1	X	.	.	.	.	.	.	.	.	.	.	G	13.96	2.393577	0.42410	.	.	ENSG00000125675	ENST00000264357;ENST00000371256;ENST00000371251	T;T;T	0.12465	2.68;2.7;2.68	5.81	5.81	0.92471	.	0.039534	0.85682	D	0.000000	T	0.20861	0.0502	M	0.76574	2.34	0.80722	D	1	B;B	0.11235	0.002;0.004	B;B	0.06405	0.001;0.002	T	0.02728	-1.1118	10	0.27082	T	0.32	.	17.8613	0.88781	0.0:0.0:1.0:0.0	.	857;857	P42263;P42263-2	GRIA3_HUMAN;.	I	857	ENSP00000264357:M857I;ENSP00000360302:M857I;ENSP00000360297:M857I	ENSP00000264357:M857I	M	+	3	0	GRIA3	122444462	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.440000	0.73435	2.436000	0.82500	0.600000	0.82982	ATG	-	NULL		0.463	GRIA3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRIA3	protein_coding	OTTHUMT00000058854.1	G	NM_000828	-		122616781	+1	no_errors	ENST00000264357	ensembl	human	known	74_37	missense	SNP	1.000	T
SYNGAP1	8831	genome.wustl.edu	37	6	33411019	33411019	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VH-01A-11D-A37C-09	TCGA-QQ-A8VH-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b5a400-a49b-41a3-bff0-f3b8c36e36dd	a65e8e60-03c3-468b-acb5-075ff9096122	g.chr6:33411019C>T	ENST00000418600.2	+	15	2791	c.2690C>T	c.(2689-2691)tCa>tTa	p.S897L	SYNGAP1_ENST00000428982.2_Missense_Mutation_p.S838L|SYNGAP1_ENST00000293748.5_Missense_Mutation_p.S897L|SYNGAP1_ENST00000496374.1_3'UTR	NM_006772.2	NP_006763.2	Q96PV0	SYGP1_HUMAN	synaptic Ras GTPase activating protein 1	897					dendrite development (GO:0016358)|negative regulation of axonogenesis (GO:0050771)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of Ras protein signal transduction (GO:0046580)|pattern specification process (GO:0007389)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|receptor clustering (GO:0043113)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of MAPK cascade (GO:0043408)|regulation of synapse structure and activity (GO:0050803)|regulation of synaptic plasticity (GO:0048167)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	Rab GTPase activator activity (GO:0005097)|Ras GTPase activator activity (GO:0005099)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(15)|ovary(7)|pancreas(1)|stomach(1)|urinary_tract(1)	43						GGGAGTGGCTCATCCATCACG	0.677																																																	0								ENSG00000197283						65.0	65.0	65.0					6																	33411019		2201	4298	6499	SYNGAP1	SO:0001583	missense	0			-	HGNC	AB067525	CCDS34434.2	6p21.3	2010-06-25	2010-06-25		ENSG00000197283	ENSG00000197283			11497	protein-coding gene	gene with protein product		603384	"""synaptic Ras GTPase activating protein 1 homolog (rat)"""			9581761, 18323856	Standard	NM_006772		Approved	SYNGAP, RASA5, KIAA1938	uc011dri.2	Q96PV0	OTTHUMG00000031096	ENST00000418600.2:c.2690C>T	6.37:g.33411019C>T	ENSP00000403636:p.Ser897Leu	Somatic	0	72	0.00		0.7039346279484041	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	24	46.67	A2AB17|A2BEL6|A2BEL7|A8MQC4|Q8TCS2|Q9UGE2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF3498,pfam_RasGAP,pfam_C2_dom,superfamily_Rho_GTPase_activation_prot,superfamily_C2_dom,smart_Pleckstrin_homology,smart_C2_dom,smart_RasGAP,pfscan_Pleckstrin_homology,pfscan_RasGAP	p.S897L	ENST00000418600.2	37	c.2690	CCDS34434.2	6	.	.	.	.	.	.	.	.	.	.	C	14.16	2.452566	0.43531	.	.	ENSG00000197283	ENST00000293748;ENST00000418600;ENST00000449372;ENST00000428982	T;T;T	0.12672	2.66;2.66;2.66	4.45	3.56	0.40772	.	0.523732	0.18978	N	0.125952	T	0.07052	0.0179	L	0.34521	1.04	0.32522	N	0.536111	P;P;P	0.47841	0.901;0.879;0.879	P;P;P	0.50270	0.636;0.503;0.503	T	0.23476	-1.0187	10	0.27785	T	0.31	.	10.1441	0.42753	0.0:0.7973:0.2027:0.0	.	897;897;897	Q96PV0;Q96PV0-2;Q96PV0-4	SYGP1_HUMAN;.;.	L	897;897;883;838	ENSP00000293748:S897L;ENSP00000403636:S897L;ENSP00000412475:S838L	ENSP00000293748:S897L	S	+	2	0	SYNGAP1	33518997	0.995000	0.38212	0.806000	0.32338	0.993000	0.82548	2.702000	0.47102	1.044000	0.40200	0.591000	0.81541	TCA	-	pfam_DUF3498		0.677	SYNGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNGAP1	protein_coding	OTTHUMT00000076151.4	C	XM_166407	-		33411019	+1	no_errors	ENST00000418600	ensembl	human	known	74_37	missense	SNP	0.909	T
CD3EAP	10849	genome.wustl.edu	37	19	45912057	45912057	+	Silent	SNP	G	G	A	rs370766397		TCGA-QQ-A8VH-01A-11D-A37C-09	TCGA-QQ-A8VH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b5a400-a49b-41a3-bff0-f3b8c36e36dd	a65e8e60-03c3-468b-acb5-075ff9096122	g.chr19:45912057G>A	ENST00000309424.3	+	3	1319	c.831G>A	c.(829-831)gaG>gaA	p.E277E	PPP1R13L_ENST00000418234.2_5'Flank|ERCC1_ENST00000588738.1_5'Flank|ERCC1_ENST00000300853.3_3'UTR|CD3EAP_ENST00000589804.1_Silent_p.E279E|ERCC1_ENST00000423698.2_3'UTR	NM_012099.1	NP_036231.1	O15446	RPA34_HUMAN	CD3e molecule, epsilon associated protein	277					rRNA transcription (GO:0009303)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|DNA-directed RNA polymerase I complex (GO:0005736)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|RNA polymerase I transcription factor complex (GO:0000120)	DNA-directed RNA polymerase activity (GO:0003899)|poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(1)|large_intestine(3)|lung(2)|ovary(2)|prostate(1)	11		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0251)		TTAACACTGAGCCTCTAGAAG	0.527																																																	0								ENSG00000117877	G	,,	0,4406		0,0,2203	76.0	75.0	76.0		,,831	-1.8	0.0	19		76	1,8599	2.2+/-6.3	0,1,4299	no	utr-3,utr-3,coding-synonymous	ERCC1,CD3EAP	NM_001166049.1,NM_001983.3,NM_012099.1	,,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,,	,,277/511	45912057	1,13005	2203	4300	6503	CD3EAP	SO:0001819	synonymous_variant	0			-	HGNC	U86751	CCDS12661.1, CCDS74397.1	19q13.3	2008-02-05	2006-03-28			ENSG00000117877			24219	protein-coding gene	gene with protein product	"""CD3 epsilon associated protein"", ""antisense to ERCC 1"""	107325	"""CD3e antigen, epsilon polypeptide associated protein"""			10373416, 9426281, 15226435	Standard	XM_005258425		Approved	ASE-1, CAST, PAF49	uc002pbq.1	O15446		ENST00000309424.3:c.831G>A	19.37:g.45912057G>A		Somatic	0	44	0.00		0.7039346279484041	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	26	36.59	Q32N11|Q7Z5U2|Q9UPF6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_DNA-dir_RNA_pol1_su_RPA34	p.E279	ENST00000309424.3	37	c.837	CCDS12661.1	19																																																																																			-	NULL		0.527	CD3EAP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CD3EAP	protein_coding	OTTHUMT00000459538.1	G	NM_012099	-		45912057	+1	no_errors	ENST00000589804	ensembl	human	known	74_37	silent	SNP	0.006	A
ZCCHC12	170261	genome.wustl.edu	37	X	117959328	117959328	+	Missense_Mutation	SNP	G	G	T			TCGA-QQ-A8VH-01A-11D-A37C-09	TCGA-QQ-A8VH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b5a400-a49b-41a3-bff0-f3b8c36e36dd	a65e8e60-03c3-468b-acb5-075ff9096122	g.chrX:117959328G>T	ENST00000310164.2	+	4	628	c.121G>T	c.(121-123)Gca>Tca	p.A41S		NM_173798.2	NP_776159.1	Q6PEW1	ZCH12_HUMAN	zinc finger, CCHC domain containing 12	41					BMP signaling pathway (GO:0030509)|transcription, DNA-templated (GO:0006351)	nuclear speck (GO:0016607)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|prostate(2)	22						GGCCAGCATGGCAGACAgaaa	0.577																																																	0								ENSG00000174460						76.0	68.0	71.0					X																	117959328		2203	4300	6503	ZCCHC12	SO:0001583	missense	0			-	HGNC	AK122676	CCDS14574.1	Xq24	2013-10-11			ENSG00000174460	ENSG00000174460		"""Zinc fingers, CCHC domain containing"", ""Paraneoplastic Ma antigens"""	27273	protein-coding gene	gene with protein product	"""paraneoplastic Ma antigen family member 7A"""	300701				21739307, 19578717	Standard	NM_173798		Approved	FLJ16123, SIZN, SIZN1, PNMA7A	uc004equ.3	Q6PEW1	OTTHUMG00000022261	ENST00000310164.2:c.121G>T	X.37:g.117959328G>T	ENSP00000308921:p.Ala41Ser	Somatic	0	54	0.00		0.7039346279484041	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	22	12.00	B3KV48|Q6PID5|Q8N1C1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_Znf_CCHC	p.A41S	ENST00000310164.2	37	c.121	CCDS14574.1	X	.	.	.	.	.	.	.	.	.	.	G	13.77	2.334970	0.41398	.	.	ENSG00000174460	ENST00000310164	T	0.10288	2.89	3.09	3.09	0.35607	.	0.000000	0.32753	N	0.005687	T	0.18173	0.0436	M	0.80616	2.505	0.27285	N	0.957982	P	0.50443	0.935	P	0.49829	0.623	T	0.07046	-1.0793	10	0.14656	T	0.56	-0.9852	8.7855	0.34818	0.0:0.0:1.0:0.0	.	41	Q6PEW1	ZCH12_HUMAN	S	41	ENSP00000308921:A41S	ENSP00000308921:A41S	A	+	1	0	ZCCHC12	117843356	1.000000	0.71417	0.997000	0.53966	0.943000	0.58893	2.359000	0.44142	1.801000	0.52704	0.594000	0.82650	GCA	-	NULL		0.577	ZCCHC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZCCHC12	protein_coding	OTTHUMT00000058014.1	G	NM_173798	-		117959328	+1	no_errors	ENST00000310164	ensembl	human	known	74_37	missense	SNP	0.996	T
OPN4	94233	genome.wustl.edu	37	10	88418324	88418324	+	Silent	SNP	C	C	T			TCGA-QQ-A8VH-01A-11D-A37C-09	TCGA-QQ-A8VH-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b5a400-a49b-41a3-bff0-f3b8c36e36dd	a65e8e60-03c3-468b-acb5-075ff9096122	g.chr10:88418324C>T	ENST00000241891.5	+	4	675	c.508C>T	c.(508-510)Ctg>Ttg	p.L170L	OPN4_ENST00000372071.2_Silent_p.L181L	NM_033282.3	NP_150598.1	Q9UHM6	OPN4_HUMAN	opsin 4	170					phototransduction (GO:0007602)|protein-chromophore linkage (GO:0018298)|regulation of circadian rhythm (GO:0042752)|rhodopsin mediated signaling pathway (GO:0016056)|rhythmic process (GO:0048511)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	11-cis retinal binding (GO:0005502)|G-protein coupled photoreceptor activity (GO:0008020)			breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|liver(2)|lung(5)|ovary(3)	18						GGACCGCTACCTGGTAATCAC	0.612																																																	0								ENSG00000122375						92.0	82.0	85.0					10																	88418324		2203	4300	6503	OPN4	SO:0001819	synonymous_variant	0			-	HGNC	AF147788	CCDS7376.1, CCDS31237.1	10q22	2012-08-08	2008-04-16		ENSG00000122375	ENSG00000122375		"""GPCR / Class A : Opsin receptors"""	14449	protein-coding gene	gene with protein product	"""melanopsin"""	606665	"""opsin 4 (melanopsin)"""			10632589	Standard	NM_001030015		Approved	MOP, melanopsin	uc001kdp.3	Q9UHM6	OTTHUMG00000018654	ENST00000241891.5:c.508C>T	10.37:g.88418324C>T		Somatic	0	76	0.00		0.7039346279484041	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	12	67.57	B7ZLB3|Q14D01|Q2PP22|Q8NGQ9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_Opsin	p.L181	ENST00000241891.5	37	c.541	CCDS7376.1	10																																																																																			-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.612	OPN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OPN4	protein_coding	OTTHUMT00000049158.2	C	NM_033282	-		88418324	+1	no_errors	ENST00000372071	ensembl	human	known	74_37	silent	SNP	1.000	T
DICER1	23405	genome.wustl.edu	37	14	95560464	95560464	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VH-01A-11D-A37C-09	TCGA-QQ-A8VH-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b5a400-a49b-41a3-bff0-f3b8c36e36dd	a65e8e60-03c3-468b-acb5-075ff9096122	g.chr14:95560464C>T	ENST00000526495.1	-	26	5416	c.5125G>A	c.(5125-5127)Gat>Aat	p.D1709N	DICER1_ENST00000527416.2_5'Flank|DICER1_ENST00000393063.1_Missense_Mutation_p.D1709N|DICER1_ENST00000541352.1_Missense_Mutation_p.D1709N|DICER1_ENST00000556045.1_Missense_Mutation_p.D607N|DICER1_ENST00000343455.3_Missense_Mutation_p.D1709N|DICER1_ENST00000527414.1_Missense_Mutation_p.D1709N			Q9UPY3	DICER_HUMAN	dicer 1, ribonuclease type III	1709	RNase III 2. {ECO:0000255|PROSITE- ProRule:PRU00177}.		D -> E (in non-epithelial ovarian tumor; somatic mutation; results in reduced RNase IIIb activity but retention of RNase IIIa activity). {ECO:0000269|PubMed:22187960}.|D -> G (in non-epithelial ovarian tumor; somatic mutation). {ECO:0000269|PubMed:22187960}.|D -> N (in non-epithelial ovarian tumor; somatic mutation; results in reduced RNase IIIb activity but retention of RNase IIIa activity). {ECO:0000269|PubMed:22187960}.		angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac muscle cell development (GO:0055013)|cerebral cortex development (GO:0021987)|defense response to virus (GO:0051607)|embryonic hindlimb morphogenesis (GO:0035116)|gene expression (GO:0010467)|hair follicle cell proliferation (GO:0071335)|hair follicle morphogenesis (GO:0031069)|inner ear receptor cell development (GO:0060119)|intestinal epithelial cell development (GO:0060576)|lung development (GO:0030324)|mRNA stabilization (GO:0048255)|multicellular organism growth (GO:0035264)|negative regulation of Schwann cell proliferation (GO:0010626)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nerve development (GO:0021675)|neuron projection morphogenesis (GO:0048812)|olfactory bulb interneuron differentiation (GO:0021889)|peripheral nervous system myelin formation (GO:0032290)|positive regulation of gene expression (GO:0010628)|positive regulation of miRNA metabolic process (GO:2000630)|positive regulation of myelination (GO:0031643)|positive regulation of Schwann cell differentiation (GO:0014040)|post-embryonic development (GO:0009791)|pre-miRNA processing (GO:0031054)|production of miRNAs involved in gene silencing by miRNA (GO:0035196)|production of siRNA involved in RNA interference (GO:0030422)|regulation of cell cycle (GO:0051726)|regulation of enamel mineralization (GO:0070173)|regulation of neuron differentiation (GO:0045664)|regulation of oligodendrocyte differentiation (GO:0048713)|regulation of viral genome replication (GO:0045069)|reproductive structure development (GO:0048608)|RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|spinal cord motor neuron differentiation (GO:0021522)|spindle assembly (GO:0051225)|spleen development (GO:0048536)|stem cell maintenance (GO:0019827)|targeting of mRNA for destruction involved in RNA interference (GO:0030423)|zygote asymmetric cell division (GO:0010070)	axon (GO:0030424)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|growth cone (GO:0030426)|RISC complex (GO:0016442)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|miRNA binding (GO:0035198)|ribonuclease III activity (GO:0004525)	p.D1709N(1)		NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(13)|kidney(3)|large_intestine(10)|lung(33)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)	75		all_cancers(154;0.0621)|all_epithelial(191;0.223)		Epithelial(152;0.211)|COAD - Colon adenocarcinoma(157;0.215)		AAAATCGCATCTCCCAGGAAT	0.527			"""Mis F, N"""		"""sex cord-stromal tumour, TGCT, embryonal rhadomyosarcoma"""	pleuropulmonary blastoma			Familial Multinodular Goiter ;DICER 1 syndrome																														yes	Rec	yes	Familial Pleuropulmonary Blastoma	14	14q32.13	23405	"""dicer 1, ribonuclease type III """		"""E, M, O"""	1	Substitution - Missense(1)	endometrium(1)						ENSG00000100697						69.0	73.0	72.0					14																	95560464		2203	4300	6503	DICER1	SO:0001583	missense	0	Familial Cancer Database	Adolescent Multinodular Goiter, incl. Multinodular Euthyroid Goiter & Non-Medullary Thyroid Cancer;incl. Pleuropulmonary Blastoma, Familial ; Cystic Nephroma, Familial	-	HGNC	AB028449	CCDS9931.1, CCDS55941.1	14q32.13	2014-09-17	2008-02-20		ENSG00000100697	ENSG00000100697			17098	protein-coding gene	gene with protein product	"""dicer 1, double-stranded RNA-specific endoribonuclease"""	606241	"""Dicer1, Dcr-1 homolog (Drosophila)"", ""multinodular goitre 1"""	MNG1		10051563, 10786632, 21205968	Standard	NM_177438		Approved	Dicer, KIAA0928, K12H4.8-LIKE, HERNA	uc001ydw.2	Q9UPY3	OTTHUMG00000166134	ENST00000526495.1:c.5125G>A	14.37:g.95560464C>T	ENSP00000437256:p.Asp1709Asn	Somatic	0	49	0.00		0.7039346279484041	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	40	7	85.11	A7E2D3|B3KRG4|E0AD28|O95943|Q9UQ02	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RNase_III_dom,pfam_PAZ_dom,pfam_Dicer_dimerisation_dom,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase/UvrB_dom,superfamily_RNase_III_dom,superfamily_P-loop_NTPase,superfamily_PAZ_dom,smart_Helicase_ATP-bd,smart_Helicase_C,smart_PAZ_dom,smart_RNase_III_dom,smart_dsRNA-bd_dom,pfscan_PAZ_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_dsRNA-bd_dom,pfscan_RNase_III_dom	p.D1709N	ENST00000526495.1	37	c.5125	CCDS9931.1	14	.	.	.	.	.	.	.	.	.	.	C	36	5.678665	0.96764	.	.	ENSG00000100697	ENST00000343455;ENST00000526495;ENST00000393063;ENST00000527414;ENST00000556045;ENST00000541352	D;D;D;D;D;D	0.92699	-3.09;-3.09;-3.09;-3.09;-3.09;-3.09	5.43	5.43	0.79202	Ribonuclease III (6);	0.000000	0.85682	D	0.000000	D	0.98261	0.9424	H	0.99668	4.69	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.97110	1.0;0.995	D	0.99785	1.1029	10	0.87932	D	0	-27.7505	19.2735	0.94021	0.0:1.0:0.0:0.0	.	607;1709	B3KRG4;Q9UPY3	.;DICER_HUMAN	N	1709;1709;1709;1709;607;1709	ENSP00000343745:D1709N;ENSP00000437256:D1709N;ENSP00000376783:D1709N;ENSP00000435681:D1709N;ENSP00000451041:D607N;ENSP00000444719:D1709N	ENSP00000343745:D1709N	D	-	1	0	DICER1	94630217	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.421000	0.80204	2.549000	0.85964	0.655000	0.94253	GAT	-	pfam_RNase_III_dom,superfamily_RNase_III_dom,smart_RNase_III_dom,pfscan_RNase_III_dom		0.527	DICER1-004	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	DICER1	protein_coding	OTTHUMT00000387997.1	C		-		95560464	-1	no_errors	ENST00000343455	ensembl	human	known	74_37	missense	SNP	1.000	T
ROCK1P1	727758	genome.wustl.edu	37	18	122175	122175	+	RNA	SNP	T	T	C	rs201110035		TCGA-QQ-A8VH-01A-11D-A37C-09	TCGA-QQ-A8VH-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b5a400-a49b-41a3-bff0-f3b8c36e36dd	a65e8e60-03c3-468b-acb5-075ff9096122	g.chr18:122175T>C	ENST00000608049.1	+	0	2413					NR_033770.1				Rho-associated, coiled-coil containing protein kinase 1 pseudogene 1																		ATGACTGTGCTCATTTAATGA	0.299																																																	0								ENSG00000263006																																			ROCK1P1			0			-	HGNC			18p11.32	2012-10-04			ENSG00000263006	ENSG00000263006			37832	pseudogene	pseudogene							Standard	NR_033770		Approved		uc002kke.3		OTTHUMG00000177913		18.37:g.122175T>C		Somatic	0	26	0.00		0.7039346279484041	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	8	27.27		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000608049.1	37	NULL		18																																																																																			-	-		0.299	ROCK1P1-003	KNOWN	basic	processed_transcript	ROCK1P1	pseudogene	OTTHUMT00000472417.1	T		rs201110035		122175	+1	no_errors	ENST00000608049	ensembl	human	known	74_37	rna	SNP	1.000	C
FAM47C	442444	genome.wustl.edu	37	X	37026574	37026574	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VH-01A-11D-A37C-09	TCGA-QQ-A8VH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b5a400-a49b-41a3-bff0-f3b8c36e36dd	a65e8e60-03c3-468b-acb5-075ff9096122	g.chrX:37026574G>A	ENST00000358047.3	+	1	143	c.91G>A	c.(91-93)Gcg>Acg	p.A31T		NM_001013736.2	NP_001013758.1	Q5HY64	FA47C_HUMAN	family with sequence similarity 47, member C	31										breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	120						CAAGTACTTCGCGAAGCGCAA	0.642																																																	0								ENSG00000198173						27.0	25.0	26.0					X																	37026574		2202	4299	6501	FAM47C	SO:0001583	missense	0			-	HGNC	AK125992	CCDS35227.1	Xp21.1	2006-07-04			ENSG00000198173	ENSG00000198173			25301	protein-coding gene	gene with protein product							Standard	NM_001013736		Approved		uc004ddl.2	Q5HY64	OTTHUMG00000024025	ENST00000358047.3:c.91G>A	X.37:g.37026574G>A	ENSP00000367913:p.Ala31Thr	Somatic	0	104	0.00		0.7039346279484041	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	40	42.03	Q6ZU46	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.A31T	ENST00000358047.3	37	c.91	CCDS35227.1	X	.	.	.	.	.	.	.	.	.	.	G	10.49	1.364786	0.24684	.	.	ENSG00000198173	ENST00000358047	T	0.20069	2.1	0.462	-0.871	0.10642	.	.	.	.	.	T	0.13372	0.0324	L	0.39898	1.24	0.09310	N	1	P	0.44241	0.829	B	0.39706	0.307	T	0.19745	-1.0296	8	0.23302	T	0.38	.	.	.	.	.	31	Q5HY64	FA47C_HUMAN	T	31	ENSP00000367913:A31T	ENSP00000367913:A31T	A	+	1	0	FAM47C	36936495	0.001000	0.12720	0.002000	0.10522	0.005000	0.04900	-0.328000	0.07945	-0.487000	0.06735	-0.888000	0.02935	GCG	-	NULL		0.642	FAM47C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM47C	protein_coding	OTTHUMT00000060508.1	G	NM_001013736	-		37026574	+1	no_errors	ENST00000358047	ensembl	human	known	74_37	missense	SNP	0.002	A
ZC4H2	55906	genome.wustl.edu	37	X	64140081	64140081	+	Missense_Mutation	SNP	G	G	T			TCGA-QQ-A8VH-01A-11D-A37C-09	TCGA-QQ-A8VH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b5a400-a49b-41a3-bff0-f3b8c36e36dd	a65e8e60-03c3-468b-acb5-075ff9096122	g.chrX:64140081G>T	ENST00000374839.3	-	3	384	c.278C>A	c.(277-279)tCt>tAt	p.S93Y	ZC4H2_ENST00000488608.1_5'UTR|ZC4H2_ENST00000337990.2_Missense_Mutation_p.S70Y|ZC4H2_ENST00000545618.1_Missense_Mutation_p.S88Y|ZC4H2_ENST00000447788.2_Missense_Mutation_p.S93Y	NM_018684.3	NP_061154.1	Q9NQZ6	ZC4H2_HUMAN	zinc finger, C4H2 domain containing	93					nervous system development (GO:0007399)|neuromuscular junction development (GO:0007528)|spinal cord motor neuron differentiation (GO:0021522)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	metal ion binding (GO:0046872)			endometrium(2)|large_intestine(4)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	24						CCTCCTTGTAGACTCTAGCAG	0.468																																																	0								ENSG00000126970						181.0	152.0	162.0					X																	64140081		2203	4300	6503	ZC4H2	SO:0001583	missense	0			-	HGNC	AF270491	CCDS14380.1, CCDS55431.1, CCDS55432.1	Xq11.1	2013-07-23	2008-10-01	2008-10-01	ENSG00000126970	ENSG00000126970		"""Zinc fingers"""	24931	protein-coding gene	gene with protein product		300897	"""KIAA1166"", ""Wieacker-Wolff syndrome"""	KIAA1166, WWS		10574461, 12097419, 23623388	Standard	NM_018684		Approved	HCA127	uc004dvu.3	Q9NQZ6	OTTHUMG00000021712	ENST00000374839.3:c.278C>A	X.37:g.64140081G>T	ENSP00000363972:p.Ser93Tyr	Somatic	0	83	0.00		0.7039346279484041	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	35	16.67	B2RDC2|B3KVZ5|B4DED0|E7EM74|G3V1L3|Q53H73|Q5JTF9|Q9H9C3|Q9H9H7|Q9ULQ4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf-C4H2	p.S93Y	ENST00000374839.3	37	c.278	CCDS14380.1	X	.	.	.	.	.	.	.	.	.	.	G	11.94	1.787393	0.31593	.	.	ENSG00000126970	ENST00000447788;ENST00000545618;ENST00000374839;ENST00000337990	.	.	.	5.15	5.15	0.70609	.	0.101633	0.64402	D	0.000002	T	0.48077	0.1480	N	0.08118	0	0.58432	D	0.999999	D;P	0.55385	0.971;0.728	P;B	0.57679	0.825;0.217	T	0.53387	-0.8446	9	0.38643	T	0.18	.	15.3201	0.74115	0.0:0.0:1.0:0.0	.	93;93	B4DED0;Q9NQZ6	.;ZC4H2_HUMAN	Y	93;88;93;70	.	ENSP00000338650:S70Y	S	-	2	0	ZC4H2	64056806	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	9.264000	0.95635	2.297000	0.77311	0.529000	0.55759	TCT	-	pfam_Znf-C4H2		0.468	ZC4H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZC4H2	protein_coding	OTTHUMT00000056958.1	G	NM_018684	-		64140081	-1	no_errors	ENST00000374839	ensembl	human	known	74_37	missense	SNP	1.000	T
SGIP1	84251	genome.wustl.edu	37	1	67160987	67160987	+	Intron	SNP	C	C	G			TCGA-QQ-A8VH-01A-11D-A37C-09	TCGA-QQ-A8VH-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b5a400-a49b-41a3-bff0-f3b8c36e36dd	a65e8e60-03c3-468b-acb5-075ff9096122	g.chr1:67160987C>G	ENST00000371037.4	+	18	1647				SGIP1_ENST00000371035.3_Intron|SGIP1_ENST00000371036.3_Intron|SGIP1_ENST00000435165.2_5'UTR|SGIP1_ENST00000371039.1_Intron|SGIP1_ENST00000237247.6_Intron	NM_032291.2	NP_115667.2	Q9BQI5	SGIP1_HUMAN	SH3-domain GRB2-like (endophilin) interacting protein 1						endocytosis (GO:0006897)|membrane tubulation (GO:0097320)|positive regulation of energy homeostasis (GO:2000507)|positive regulation of feeding behavior (GO:2000253)|positive regulation of receptor-mediated endocytosis (GO:0048260)|response to dietary excess (GO:0002021)	AP-2 adaptor complex (GO:0030122)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	microtubule binding (GO:0008017)|phospholipid binding (GO:0005543)|SH3 domain binding (GO:0017124)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(43)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	71						TTTTCCTGCACGCTAATGGCA	0.433																																																	0								ENSG00000118473																																			SGIP1	SO:0001627	intron_variant	0			-	HGNC	AL136561	CCDS30744.1	1p31.3	2008-02-05			ENSG00000118473	ENSG00000118473			25412	protein-coding gene	gene with protein product		611540				11230166	Standard	NM_032291		Approved	DKFZp761D221	uc001dcr.3	Q9BQI5	OTTHUMG00000009161	ENST00000371037.4:c.1571-130C>G	1.37:g.67160987C>G		Somatic	0	60	0.00		0.7039346279484041	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	18	43.75	A6NL81|A6NLD1|Q4LE32|Q5VYE2|Q5VYE3|Q5VYE4|Q68D76|Q6MZY6|Q8IWC2	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000371037.4	37	NULL	CCDS30744.1	1																																																																																			-	-		0.433	SGIP1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SGIP1	protein_coding	OTTHUMT00000025395.4	C	NM_032291	-		67160987	+1	no_errors	ENST00000320161	ensembl	human	putative	74_37	rna	SNP	1.000	G
APC	324	genome.wustl.edu	37	5	112128170	112128170	+	Missense_Mutation	SNP	G	G	A			TCGA-QQ-A8VH-01A-11D-A37C-09	TCGA-QQ-A8VH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b5a400-a49b-41a3-bff0-f3b8c36e36dd	a65e8e60-03c3-468b-acb5-075ff9096122	g.chr5:112128170G>A	ENST00000457016.1	+	7	1053	c.673G>A	c.(673-675)Gaa>Aaa	p.E225K	APC_ENST00000508376.2_Missense_Mutation_p.E225K|APC_ENST00000257430.4_Missense_Mutation_p.E225K			P25054	APC_HUMAN	adenomatous polyposis coli	225	Leu-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)			NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		TCAGCAAATCGAAAAGGACAT	0.313		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)		yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	0			GRCh37	CM023006	APC	M		ENSG00000134982						74.0	72.0	73.0					5																	112128170		2202	4300	6502	APC	SO:0001583	missense	0	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	-	HGNC	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.673G>A	5.37:g.112128170G>A	ENSP00000413133:p.Glu225Lys	Somatic	0	83	0.00		0.7039346279484041	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	36	36	49.32	D3DT03|Q15162|Q15163|Q93042	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_APC_basic_dom,pfam_EB1-bd,pfam_APC_Cys-rich_rpt,pfam_Armadillo,pfam_APC_dom,pfam_SAMP,pfam_APC_15aa_rpt,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.E225K	ENST00000457016.1	37	c.673	CCDS4107.1	5	.	.	.	.	.	.	.	.	.	.	G	24.5	4.535380	0.85812	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376;ENST00000512211	D;D;D;D	0.91011	-2.77;-2.77;-2.77;-2.77	5.19	5.19	0.71726	.	0.103447	0.64402	D	0.000005	D	0.94866	0.8341	M	0.73598	2.24	0.50813	D	0.999898	D	0.89917	1.0	D	0.64687	0.928	D	0.95164	0.8284	10	0.72032	D	0.01	-6.6066	19.0649	0.93106	0.0:0.0:1.0:0.0	.	225	P25054	APC_HUMAN	K	225	ENSP00000413133:E225K;ENSP00000257430:E225K;ENSP00000427089:E225K;ENSP00000423828:E225K	ENSP00000257430:E225K	E	+	1	0	APC	112156069	1.000000	0.71417	0.997000	0.53966	0.663000	0.39108	6.841000	0.75374	2.568000	0.86640	0.650000	0.86243	GAA	-	NULL		0.313	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	APC	protein_coding	OTTHUMT00000250738.2	G	NM_000038	-		112128170	+1	no_errors	ENST00000257430	ensembl	human	known	74_37	missense	SNP	1.000	A
FLNA	2316	genome.wustl.edu	37	X	153583396	153583396	+	Missense_Mutation	SNP	T	T	C			TCGA-QQ-A8VH-01A-11D-A37C-09	TCGA-QQ-A8VH-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b5a400-a49b-41a3-bff0-f3b8c36e36dd	a65e8e60-03c3-468b-acb5-075ff9096122	g.chrX:153583396T>C	ENST00000369850.3	-	31	5250	c.5014A>G	c.(5014-5016)Atc>Gtc	p.I1672V	FLNA_ENST00000369856.3_5'UTR|FLNA_ENST00000422373.1_Missense_Mutation_p.I1664V|FLNA_ENST00000344736.4_Missense_Mutation_p.I1664V|FLNA_ENST00000360319.4_Missense_Mutation_p.I1664V	NM_001110556.1	NP_001104026.1	P21333	FLNA_HUMAN	filamin A, alpha	1672					actin crosslink formation (GO:0051764)|actin cytoskeleton reorganization (GO:0031532)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|blood coagulation (GO:0007596)|cell junction assembly (GO:0034329)|cilium assembly (GO:0042384)|cytoplasmic sequestering of protein (GO:0051220)|early endosome to late endosome transport (GO:0045022)|epithelial to mesenchymal transition (GO:0001837)|establishment of protein localization (GO:0045184)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription factor import into nucleus (GO:0042993)|protein localization to cell surface (GO:0034394)|protein stabilization (GO:0050821)|receptor clustering (GO:0043113)|spindle assembly involved in mitosis (GO:0090307)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|apical dendrite (GO:0097440)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|Myb complex (GO:0031523)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|Fc-gamma receptor I complex binding (GO:0034988)|glycoprotein binding (GO:0001948)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|Rac GTPase binding (GO:0048365)|Ral GTPase binding (GO:0017160)|Rho GTPase binding (GO:0017048)|signal transducer activity (GO:0004871)|small GTPase binding (GO:0031267)|transcription factor binding (GO:0008134)			breast(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					TCCACAGTGATCACCGTCTCC	0.627											OREG0003595	type=REGULATORY REGION|Gene=FLNA|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																																					0								ENSG00000196924						62.0	62.0	62.0					X																	153583396		2154	4215	6369	FLNA	SO:0001583	missense	0			-	HGNC	X70082	CCDS44021.1, CCDS48194.1	Xq28	2009-07-23	2009-07-23		ENSG00000196924	ENSG00000196924			3754	protein-coding gene	gene with protein product	"""actin binding protein 280"""	300017	"""filamin A, alpha (actin binding protein 280)"""	FLN1, FLN, OPD2, OPD1		8406501, 12612583	Standard	NM_001456		Approved	ABP-280	uc004fkk.2	P21333	OTTHUMG00000022712	ENST00000369850.3:c.5014A>G	X.37:g.153583396T>C	ENSP00000358866:p.Ile1672Val	Somatic	0	45	0.00	1756	0.7039346279484041	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	22	46.34	E9KL45|Q5HY53|Q5HY55|Q8NF52	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Filamin/ABP280_repeat-like,pfam_CH-domain,superfamily_CH-domain,superfamily_Ig_E-set,smart_CH-domain,smart_Filamin,pfscan_CH-domain,pfscan_Filamin/ABP280_repeat-like	p.I1672V	ENST00000369850.3	37	c.5014	CCDS48194.1	X	.	.	.	.	.	.	.	.	.	.	T	14.86	2.661937	0.47572	.	.	ENSG00000196924	ENST00000360319;ENST00000369852;ENST00000422373;ENST00000369850;ENST00000344736	D;D;D;D	0.84442	-1.85;-1.85;-1.85;-1.85	5.53	4.36	0.52297	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.86033	0.5836	L	0.39633	1.23	0.80722	D	1	B;D	0.55172	0.164;0.97	B;D	0.64877	0.087;0.93	D	0.83794	0.0232	10	0.49607	T	0.09	.	6.4462	0.21877	0.1494:0.0796:0.0:0.771	.	1664;1672	P21333-2;P21333	.;FLNA_HUMAN	V	1664;1645;1664;1672;1664	ENSP00000353467:I1664V;ENSP00000416926:I1664V;ENSP00000358866:I1672V;ENSP00000358863:I1664V	ENSP00000358863:I1664V	I	-	1	0	FLNA	153236590	0.914000	0.31030	0.935000	0.37517	0.709000	0.40893	1.131000	0.31406	0.729000	0.32403	0.417000	0.27973	ATC	-	pfam_Filamin/ABP280_repeat-like,superfamily_Ig_E-set,smart_Filamin,pfscan_Filamin/ABP280_repeat-like		0.627	FLNA-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FLNA	protein_coding	OTTHUMT00000058942.3	T		-		153583396	-1	no_errors	ENST00000369850	ensembl	human	known	74_37	missense	SNP	1.000	C
QRICH2	84074	genome.wustl.edu	37	17	74288739	74288739	+	Nonsense_Mutation	SNP	A	A	T			TCGA-QQ-A8VH-01A-11D-A37C-09	TCGA-QQ-A8VH-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b5a400-a49b-41a3-bff0-f3b8c36e36dd	a65e8e60-03c3-468b-acb5-075ff9096122	g.chr17:74288739A>T	ENST00000262765.5	-	4	1750	c.1571T>A	c.(1570-1572)tTg>tAg	p.L524*		NM_032134.1	NP_115510.1	Q9H0J4	QRIC2_HUMAN	glutamine rich 2	524	Gln-rich.									breast(3)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(17)|ovary(4)|pancreas(2)|prostate(3)|skin(2)|stomach(4)	62						AGGTTGGACCAAGCCAGGCTG	0.532																																																	0								ENSG00000129646						159.0	130.0	139.0					17																	74288739		2203	4300	6503	QRICH2	SO:0001587	stop_gained	0			-	HGNC	AK058102	CCDS32741.1	17q25.1	2009-03-19			ENSG00000129646	ENSG00000129646			25326	protein-coding gene	gene with protein product							Standard	NM_032134		Approved	DKFZP434P0316	uc002jrd.1	Q9H0J4	OTTHUMG00000167578	ENST00000262765.5:c.1571T>A	17.37:g.74288739A>T	ENSP00000262765:p.Leu524*	Somatic	0	89	0.00		0.7039346279484041	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	44	51	46.32	A2RRE1|Q96LM3	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.L524*	ENST00000262765.5	37	c.1571	CCDS32741.1	17	.	.	.	.	.	.	.	.	.	.	a	37	6.314379	0.97467	.	.	ENSG00000129646	ENST00000262765;ENST00000301613	.	.	.	5.38	5.38	0.77491	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-1.4829	13.3237	0.60447	1.0:0.0:0.0:0.0	.	.	.	.	X	524	.	ENSP00000262765:L524X	L	-	2	0	QRICH2	71800334	0.000000	0.05858	0.015000	0.15790	0.001000	0.01503	-0.108000	0.10857	2.031000	0.59945	0.459000	0.35465	TTG	-	NULL		0.532	QRICH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	QRICH2	protein_coding	OTTHUMT00000395140.1	A	NM_032134	-		74288739	-1	no_errors	ENST00000262765	ensembl	human	known	74_37	nonsense	SNP	0.010	T
DCAF11	80344	genome.wustl.edu	37	14	24590047	24590047	+	Splice_Site	SNP	G	G	T			TCGA-QQ-A8VH-01A-11D-A37C-09	TCGA-QQ-A8VH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b5a400-a49b-41a3-bff0-f3b8c36e36dd	a65e8e60-03c3-468b-acb5-075ff9096122	g.chr14:24590047G>T	ENST00000446197.3	+	12	1820	c.1093G>T	c.(1093-1095)Ggt>Tgt	p.G365C	DCAF11_ENST00000396941.4_Splice_Site_p.G339C|DCAF11_ENST00000396936.1_Splice_Site_p.G265C|DCAF11_ENST00000559115.1_Splice_Site_p.G365C|RP11-468E2.6_ENST00000558325.1_5'Flank	NM_025230.4	NP_079506.3	Q8TEB1	DCA11_HUMAN	DDB1 and CUL4 associated factor 11	365					protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)											GGATTCATAGGGTGATGCCCG	0.512																																																	0								ENSG00000100897						117.0	118.0	117.0					14																	24590047		2203	4300	6503	DCAF11	SO:0001630	splice_region_variant	0			-	HGNC	AF130070	CCDS9610.1, CCDS41929.1	14q11.2	2013-01-09	2009-07-17	2009-07-17	ENSG00000100897	ENSG00000100897		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	20258	protein-coding gene	gene with protein product		613317	"""WD repeat domain 23"""	WDR23			Standard	NM_025230		Approved	PRO2389, GL014	uc001wlv.3	Q8TEB1	OTTHUMG00000028793	ENST00000446197.3:c.1093-1G>T	14.37:g.24590047G>T		Somatic	0	33	0.00		0.7039346279484041	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	24	52.00	B3KQ83|D3DS56|Q5D039|Q86U00|Q86U39|Q8NDN2|Q9H2J0|Q9H3A3|Q9H5C9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pirsf_WD_repeat_p23,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.G365C	ENST00000446197.3	37	c.1093	CCDS9610.1	14	.	.	.	.	.	.	.	.	.	.	g	24.0	4.477993	0.84747	.	.	ENSG00000100897	ENST00000326009;ENST00000446197;ENST00000396936;ENST00000396941	T;T	0.60548	0.18;0.18	6.07	6.07	0.98685	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.69415	0.3108	L	0.41124	1.26	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;0.993;1.0	D;D;D;D;D	0.85130	0.997;0.988;0.986;0.959;0.993	T	0.64419	-0.6412	9	.	.	.	3.3686	18.1378	0.89627	0.0:0.0:1.0:0.0	.	288;339;265;365;365	Q59GN6;Q8TEB1-2;Q8TEB1-3;A8K9T2;Q8TEB1	.;.;.;.;DCA11_HUMAN	C	365;339;265;339	ENSP00000380142:G265C;ENSP00000380146:G339C	.	G	+	1	0	DCAF11	23659887	1.000000	0.71417	1.000000	0.80357	0.609000	0.37215	8.630000	0.90987	2.884000	0.98904	0.655000	0.94253	GGT	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pirsf_WD_repeat_p23,pfscan_WD40_repeat,pfscan_WD40_repeat_dom		0.512	DCAF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF11	protein_coding	OTTHUMT00000071907.4	G		-	Missense_Mutation	24590047	+1	no_errors	ENST00000446197	ensembl	human	known	74_37	missense	SNP	1.000	T
ARHGAP30	257106	genome.wustl.edu	37	1	161022582	161022582	+	Missense_Mutation	SNP	C	C	T	rs202221316		TCGA-QQ-A8VH-01A-11D-A37C-09	TCGA-QQ-A8VH-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b5a400-a49b-41a3-bff0-f3b8c36e36dd	a65e8e60-03c3-468b-acb5-075ff9096122	g.chr1:161022582C>T	ENST00000368013.3	-	7	990	c.670G>A	c.(670-672)Gag>Aag	p.E224K	ARHGAP30_ENST00000368016.3_Missense_Mutation_p.E224K|ARHGAP30_ENST00000368015.1_Missense_Mutation_p.E47K	NM_001025598.1|NM_181720.2	NP_001020769.1|NP_859071.2	Q7Z6I6	RHG30_HUMAN	Rho GTPase activating protein 30	224					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)	GTPase activator activity (GO:0005096)	p.E224K(2)		breast(2)|cervix(3)|endometrium(4)|kidney(2)|large_intestine(4)|lung(6)|ovary(4)|pancreas(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	37	all_cancers(52;8.05e-20)|Breast(13;0.00188)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00122)			CTCTCCACCTCACCACCTGGG	0.592													C|||	1	0.000199681	0.0	0.0014	5008	,	,		17359	0.0		0.0	False		,,,				2504	0.0																2	Substitution - Missense(2)	ovary(2)						ENSG00000186517						37.0	40.0	39.0					1																	161022582		2203	4300	6503	ARHGAP30	SO:0001583	missense	0			GMAF=0.0005	HGNC	AL832852	CCDS1215.1, CCDS30918.1, CCDS72958.1	1q23.3	2011-06-29			ENSG00000186517	ENSG00000186517		"""Rho GTPase activating proteins"""	27414	protein-coding gene	gene with protein product		614264					Standard	NM_001287602		Approved	FLJ00267	uc001fxl.3	Q7Z6I6	OTTHUMG00000031477	ENST00000368013.3:c.670G>A	1.37:g.161022582C>T	ENSP00000356992:p.Glu224Lys	Somatic	0	23	0.00		0.7039346279484041	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	18	37.93	Q5SY52|Q5SY53|Q5SY54|Q6ZML6|Q7Z3J8|Q86XI7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.E224K	ENST00000368013.3	37	c.670	CCDS30918.1	1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	12.56	1.974546	0.34848	.	.	ENSG00000186517	ENST00000368016;ENST00000368013;ENST00000368017;ENST00000368015	T;T;T	0.32753	3.02;2.99;1.44	4.2	3.28	0.37604	.	0.687394	0.13762	N	0.364560	T	0.13841	0.0335	L	0.47016	1.485	0.30095	N	0.807953	B;B	0.25206	0.027;0.12	B;B	0.29176	0.04;0.099	T	0.15521	-1.0434	10	0.56958	D	0.05	.	9.9491	0.41628	0.0:0.7937:0.2063:0.0	.	224;224	Q7Z6I6;Q7Z6I6-2	RHG30_HUMAN;.	K	224;224;76;47	ENSP00000356995:E224K;ENSP00000356992:E224K;ENSP00000356994:E47K	ENSP00000356992:E224K	E	-	1	0	ARHGAP30	159289206	0.990000	0.36364	0.066000	0.19879	0.454000	0.32378	4.780000	0.62382	0.973000	0.38340	-0.324000	0.08512	GAG	-	NULL		0.592	ARHGAP30-007	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP30	protein_coding	OTTHUMT00000077090.2	C	NM_181720	rs202221316		161022582	-1	no_errors	ENST00000368013	ensembl	human	known	74_37	missense	SNP	0.926	T
MAPK15	225689	genome.wustl.edu	37	8	144801595	144801595	+	Missense_Mutation	SNP	T	T	A	rs139010308		TCGA-QQ-A8VH-01A-11D-A37C-09	TCGA-QQ-A8VH-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b5a400-a49b-41a3-bff0-f3b8c36e36dd	a65e8e60-03c3-468b-acb5-075ff9096122	g.chr8:144801595T>A	ENST00000338033.4	+	7	783	c.664T>A	c.(664-666)Tcc>Acc	p.S222T	MAPK15_ENST00000395107.4_Missense_Mutation_p.S239T|RP11-429J17.5_ENST00000527908.1_RNA|MAPK15_ENST00000395108.2_Missense_Mutation_p.S222T	NM_139021.2	NP_620590.2	Q8TD08	MK15_HUMAN	mitogen-activated protein kinase 15	222	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				MAPK cascade (GO:0000165)|negative regulation of DNA replication (GO:0008156)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|response to estradiol (GO:0032355)	extracellular region (GO:0005576)|intracellular (GO:0005622)|nucleus (GO:0005634)	ATP binding (GO:0005524)|MAP kinase activity (GO:0004707)|SH3 domain binding (GO:0017124)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)|skin(1)|stomach(1)	12	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;6.8e-40)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			CCCCGGCACGTCCACCCTCCA	0.662																																																	0								ENSG00000181085	T	THR/SER	2,4404	4.2+/-10.8	0,2,2201	43.0	43.0	43.0		664	4.1	0.3	8	dbSNP_134	43	0,8600		0,0,4300	no	missense	MAPK15	NM_139021.2	58	0,2,6501	AA,AT,TT		0.0,0.0454,0.0154	possibly-damaging	222/545	144801595	2,13004	2203	4300	6503	MAPK15	SO:0001583	missense	0			-	HGNC	AY065978	CCDS6409.2	8q24.3	2011-06-09			ENSG00000181085	ENSG00000181085		"""Mitogen-activated protein kinase cascade / Kinases"""	24667	protein-coding gene	gene with protein product	"""extracellular signal regulated kinase 8"""					11875070	Standard	XM_006716528		Approved	ERK8, ERK7	uc003yzj.3	Q8TD08	OTTHUMG00000146450	ENST00000338033.4:c.664T>A	8.37:g.144801595T>A	ENSP00000337691:p.Ser222Thr	Somatic	0	166	0.00		0.7039346279484041	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	103	14	87.29	Q2TCF9|Q8N362	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.S222T	ENST00000338033.4	37	c.664	CCDS6409.2	8	.	.	.	.	.	.	.	.	.	.	t	17.67	3.446212	0.63178	4.54E-4	0.0	ENSG00000181085	ENST00000338033;ENST00000395107;ENST00000395108	T;T;T	0.47528	0.84;0.84;0.84	4.14	4.14	0.48551	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.55257	0.1909	L	0.31120	0.905	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.59112	-0.7515	10	0.66056	D	0.02	-19.5563	12.4546	0.55697	0.0:0.0:0.0:1.0	.	222	Q8TD08	MK15_HUMAN	T	222;239;222	ENSP00000337691:S222T;ENSP00000378539:S239T;ENSP00000378540:S222T	ENSP00000337691:S222T	S	+	1	0	MAPK15	144873583	1.000000	0.71417	0.252000	0.24328	0.353000	0.29299	5.762000	0.68809	1.711000	0.51337	0.402000	0.26972	TCC	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.662	MAPK15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAPK15	protein_coding	OTTHUMT00000300348.1	T	NM_139021	rs139010308		144801595	+1	no_errors	ENST00000338033	ensembl	human	known	74_37	missense	SNP	0.997	A
GSTCD	79807	genome.wustl.edu	37	4	106629991	106629991	+	5'UTR	SNP	G	G	T			TCGA-QQ-A8VH-01A-11D-A37C-09	TCGA-QQ-A8VH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b5a400-a49b-41a3-bff0-f3b8c36e36dd	a65e8e60-03c3-468b-acb5-075ff9096122	g.chr4:106629991G>T	ENST00000515279.1	+	0	17				GSTCD_ENST00000360505.5_5'Flank|GSTCD_ENST00000394730.3_5'UTR|GSTCD_ENST00000515255.1_3'UTR|INTS12_ENST00000451321.2_5'UTR|GSTCD_ENST00000507281.1_5'UTR|INTS12_ENST00000340139.5_5'Flank|INTS12_ENST00000394735.1_5'Flank			Q8NEC7	GSTCD_HUMAN	glutathione S-transferase, C-terminal domain containing							extracellular vesicular exosome (GO:0070062)				breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(2)|ovary(1)|skin(1)	14		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;3.15e-07)|READ - Rectum adenocarcinoma(30;0.139)		GCCGGCGCGAGTATTTTCCAC	0.582																																																	0								ENSG00000138780																																			GSTCD	SO:0001623	5_prime_UTR_variant	0			-	HGNC	BC032942	CCDS3672.2, CCDS43257.1	4q24	2008-02-05	2006-05-09		ENSG00000138780	ENSG00000138780			25806	protein-coding gene	gene with protein product		615912	"""Glutathione S-transferase, C-terminal domain containing"""			12477932	Standard	NM_001031720		Approved	FLJ13273	uc003hxz.4	Q8NEC7	OTTHUMG00000131211	ENST00000515279.1:c.-204G>T	4.37:g.106629991G>T		Somatic	0	50	0.00		0.7039346279484041	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	29	48.21	A8K8J0|A8MVD3|H9KV97|Q9H8S3	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000515279.1	37	NULL	CCDS43257.1	4																																																																																			-	-		0.582	GSTCD-006	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	GSTCD	protein_coding	OTTHUMT00000363981.1	G	NM_024751	-		106629991	+1	no_errors	ENST00000515255	ensembl	human	known	74_37	rna	SNP	0.002	T
CLEC16A	23274	genome.wustl.edu	37	16	11066825	11066825	+	Missense_Mutation	SNP	G	G	T			TCGA-QQ-A8VH-01A-11D-A37C-09	TCGA-QQ-A8VH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b5a400-a49b-41a3-bff0-f3b8c36e36dd	a65e8e60-03c3-468b-acb5-075ff9096122	g.chr16:11066825G>T	ENST00000409790.1	+	7	865	c.635G>T	c.(634-636)cGa>cTa	p.R212L	CLEC16A_ENST00000409552.3_Missense_Mutation_p.R210L	NM_015226.2	NP_056041.1			C-type lectin domain family 16, member A											breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|ovary(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	37						CACTACATCCGAGATAAAACT	0.408																																																	0								ENSG00000038532						100.0	92.0	94.0					16																	11066825		1936	4144	6080	CLEC16A	SO:0001583	missense	0			-	HGNC	AB002348	CCDS45409.1, CCDS58423.1	16p13.13	2010-04-27	2007-07-17	2007-07-17	ENSG00000038532	ENSG00000038532		"""C-type lectin domain containing"""	29013	protein-coding gene	gene with protein product		611303	"""KIAA0350"""	KIAA0350		9205841, 17632545	Standard	NM_015226		Approved	Gop-1	uc002dao.3	Q2KHT3	OTTHUMG00000152915	ENST00000409790.1:c.635G>T	16.37:g.11066825G>T	ENSP00000387122:p.Arg212Leu	Somatic	0	55	0.00		0.7039346279484041	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	34	10.53		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Uncharacterised_FPL	p.R212L	ENST00000409790.1	37	c.635	CCDS45409.1	16	.	.	.	.	.	.	.	.	.	.	G	32	5.135436	0.94517	.	.	ENSG00000038532	ENST00000409790;ENST00000542102;ENST00000409552	T	0.50001	0.76	5.9	5.9	0.94986	.	0.000000	0.85682	D	0.000000	T	0.59018	0.2163	L	0.35542	1.07	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.80764	0.992;0.994	T	0.49133	-0.8971	10	0.23302	T	0.38	-14.3544	19.2671	0.93993	0.0:0.0:1.0:0.0	.	212;210	Q2KHT3;Q2KHT3-2	CL16A_HUMAN;.	L	212;212;210	ENSP00000387122:R212L	ENSP00000386495:R210L	R	+	2	0	CLEC16A	10974326	1.000000	0.71417	0.998000	0.56505	0.970000	0.65996	9.751000	0.98889	2.788000	0.95919	0.650000	0.86243	CGA	-	NULL		0.408	CLEC16A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLEC16A	protein_coding	OTTHUMT00000328540.2	G	NM_015226	-		11066825	+1	no_errors	ENST00000409790	ensembl	human	known	74_37	missense	SNP	1.000	T
LAT	27040	genome.wustl.edu	37	16	28997518	28997518	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VH-01A-11D-A37C-09	TCGA-QQ-A8VH-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b5a400-a49b-41a3-bff0-f3b8c36e36dd	a65e8e60-03c3-468b-acb5-075ff9096122	g.chr16:28997518C>T	ENST00000360872.5	+	4	304	c.226C>T	c.(226-228)Cca>Tca	p.P76S	LAT_ENST00000454369.2_Missense_Mutation_p.P76S|RP11-264B17.3_ENST00000569969.1_RNA|RP11-264B17.5_ENST00000561471.1_RNA|LAT_ENST00000566177.1_Missense_Mutation_p.P76S|LAT_ENST00000354453.4_Missense_Mutation_p.P76S|LAT_ENST00000563964.1_Intron|LAT_ENST00000395456.2_Missense_Mutation_p.P76S|LAT_ENST00000564277.1_Missense_Mutation_p.P76S|LAT_ENST00000395461.3_Missense_Mutation_p.P112S			O43561	LAT_HUMAN	linker for activation of T cells	76					blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|Fc-epsilon receptor signaling pathway (GO:0038095)|gene expression (GO:0010467)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|lymphocyte homeostasis (GO:0002260)|mast cell degranulation (GO:0043303)|platelet activation (GO:0030168)|positive regulation of signal transduction (GO:0009967)|Ras protein signal transduction (GO:0007265)|regulation of T cell activation (GO:0050863)|T cell activation (GO:0042110)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|COP9 signalosome (GO:0008180)|immunological synapse (GO:0001772)|integral component of membrane (GO:0016021)|mast cell granule (GO:0042629)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|SH3/SH2 adaptor activity (GO:0005070)			large_intestine(2)|lung(3)|urinary_tract(1)	6		Hepatocellular(780;0.244)				CCTGAGCCAGCCAGACCTGCT	0.607																																																	0								ENSG00000213658						81.0	78.0	79.0					16																	28997518		2197	4300	6497	LAT	SO:0001583	missense	0			-	HGNC	AF036905	CCDS10647.1, CCDS32425.1, CCDS45455.1, CCDS53999.1	16q13	2011-11-01			ENSG00000213658	ENSG00000213658			18874	protein-coding gene	gene with protein product	"""linker for activation of T cells, transmembrane adaptor"""	602354				9489702	Standard	NM_014387		Approved	LAT1	uc010vdj.2	O43561	OTTHUMG00000131761	ENST00000360872.5:c.226C>T	16.37:g.28997518C>T	ENSP00000354119:p.Pro76Ser	Somatic	0	42	0.00		0.7039346279484041	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	26	13.33	B7WPI0|C7C5T6|G5E9K3|O43919	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	prints_Linker_for_activat_Tcells_prot	p.P112S	ENST00000360872.5	37	c.334	CCDS10647.1	16	.	.	.	.	.	.	.	.	.	.	C	14.62	2.589032	0.46110	.	.	ENSG00000213658	ENST00000395461;ENST00000395456;ENST00000454369;ENST00000360872;ENST00000354453	.	.	.	4.33	3.37	0.38596	.	.	.	.	.	T	0.45397	0.1340	N	0.20986	0.625	0.31238	N	0.69548	D;P;P;D;P	0.89917	1.0;0.873;0.873;1.0;0.873	D;B;B;D;B	0.71870	0.975;0.441;0.441;0.975;0.441	T	0.45175	-0.9279	8	0.87932	D	0	-3.9714	7.4242	0.27090	0.0:0.884:0.0:0.116	.	76;76;112;76;76	C7C5T6;O43561-2;B7WPI0;O43561;G5E9K3	.;.;.;LAT_HUMAN;.	S	112;76;76;76;76	.	ENSP00000346441:P76S	P	+	1	0	LAT	28905019	0.991000	0.36638	0.999000	0.59377	0.474000	0.32979	1.010000	0.29898	2.421000	0.82119	0.462000	0.41574	CCA	-	prints_Linker_for_activat_Tcells_prot		0.607	LAT-001	KNOWN	basic|CCDS	protein_coding	LAT	protein_coding	OTTHUMT00000254688.2	C		-		28997518	+1	no_errors	ENST00000395461	ensembl	human	known	74_37	missense	SNP	1.000	T
KRTAP5-5	439915	genome.wustl.edu	37	11	1651159	1651169	+	Frame_Shift_Del	DEL	GCTGTGGCTCT	GCTGTGGCTCT	-	rs71454095|rs71454094	byFrequency	TCGA-QQ-A8VH-01A-11D-A37C-09	TCGA-QQ-A8VH-10A-01D-A37F-09	GCTGTGGCTCT	GCTGTGGCTCT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b5a400-a49b-41a3-bff0-f3b8c36e36dd	a65e8e60-03c3-468b-acb5-075ff9096122	g.chr11:1651159_1651169delGCTGTGGCTCT	ENST00000399676.2	+	1	127_137	c.89_99delGCTGTGGCTCT	c.(88-99)ggctgtggctctfs	p.GCGS30fs		NM_001001480.2	NP_001001480.2	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	30						keratin filament (GO:0045095)				endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|urinary_tract(1)	33		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		ggctgtggaggctgtggctctggctgtgggg	0.711																																																	0								ENSG00000185940			98,3952		6,86,1933						0.1	0.0			32	211,7787		8,195,3796	no	frameshift	KRTAP5-5	NM_001001480.2		14,281,5729	A1A1,A1R,RR		2.6382,2.4198,2.5647				309,11739				KRTAP5-5	SO:0001589	frameshift_variant	0				HGNC	AB125074	CCDS41592.1	11p15.5	2008-10-30			ENSG00000185940	ENSG00000185940		"""Keratin associated proteins"""	23601	protein-coding gene	gene with protein product						15144888	Standard	NM_001001480		Approved	KRTAP5.5, KRTAP5-11	uc001lty.3	Q701N2	OTTHUMG00000057554	ENST00000399676.2:c.89_99delGCTGTGGCTCT	11.37:g.1651159_1651169delGCTGTGGCTCT	ENSP00000382584:p.Gly30fs	Somatic	NA	NA	NA		0.7039346279484041	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A8MWN2	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	NULL	p.C31fs	ENST00000399676.2	37	c.89_99	CCDS41592.1	11																																																																																			-	NULL		0.711	KRTAP5-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP5-5	protein_coding	OTTHUMT00000127919.1	GCTGTGGCTCT				1651169	+1	no_errors	ENST00000399676	ensembl	human	known	74_37	frame_shift_del	DEL	0.384:0.317:0.302:0.301:0.281:0.273:0.283:0.273:0.229:0.033:0.002	-
CCNYL1	151195	genome.wustl.edu	37	2	208619067	208619067	+	3'UTR	SNP	G	G	A	rs74909259		TCGA-QQ-A8VH-01A-11D-A37C-09	TCGA-QQ-A8VH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b5a400-a49b-41a3-bff0-f3b8c36e36dd	a65e8e60-03c3-468b-acb5-075ff9096122	g.chr2:208619067G>A	ENST00000295414.3	+	0	1936				RP11-801F7.1_ENST00000609146.1_RNA|CCNYL1_ENST00000339882.5_3'UTR|CCNYL1_ENST00000392209.3_3'UTR|MIR4775_ENST00000581168.1_RNA			Q8N7R7	CCYL1_HUMAN	cyclin Y-like 1						regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)					endometrium(1)|large_intestine(1)|lung(3)	5				LUSC - Lung squamous cell carcinoma(261;0.0731)|Epithelial(149;0.139)|Lung(261;0.14)		GTCATAAACAGAGGAAGTATC	0.328																																																	0								ENSG00000272851																																			RP11-801F7.1	SO:0001624	3_prime_UTR_variant	0			-	Clone_based_vega_gene	AK095479	CCDS2377.1, CCDS46503.1	2q33.3	2008-02-05			ENSG00000163249	ENSG00000163249			26868	protein-coding gene	gene with protein product							Standard	NM_152523		Approved	FLJ40432	uc002vci.3	Q8N7R7	OTTHUMG00000132946	ENST00000295414.3:c.*645G>A	2.37:g.208619067G>A		Somatic	0	54	0.00		0.7039346279484041	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	46	9.80	Q6NX60	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000295414.3	37	NULL		2																																																																																			-	-		0.328	CCNYL1-003	KNOWN	basic	protein_coding	ENSG00000272851	protein_coding	OTTHUMT00000337062.1	G	NM_152523	rs74909259		208619067	-1	no_errors	ENST00000609146	ensembl	human	known	74_37	rna	SNP	0.000	A
BEND3P1	644459	genome.wustl.edu	37	10	52419326	52419326	+	RNA	DEL	A	A	-			TCGA-QQ-A8VH-01A-11D-A37C-09	TCGA-QQ-A8VH-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b5a400-a49b-41a3-bff0-f3b8c36e36dd	a65e8e60-03c3-468b-acb5-075ff9096122	g.chr10:52419326delA	ENST00000449695.1	+	0	2060																											ACATCTCAGTAATCAGGGTGG	0.597																																																	0								ENSG00000231345																																			RP11-564C4.6			0				Clone_based_vega_gene																													10.37:g.52419326delA		Somatic	0	51	0.00		0.7039346279484041	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	13	13.33		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000449695.1	37	NULL		10																																																																																			-	-		0.597	RP11-564C4.6-002	KNOWN	basic	processed_transcript	ENSG00000231345	pseudogene	OTTHUMT00000048079.1	A				52419326	+1	no_errors	ENST00000449695	ensembl	human	known	74_37	rna	DEL	0.359	-
GIGYF1	64599	genome.wustl.edu	37	7	100281500	100281500	+	Frame_Shift_Del	DEL	A	A	-			TCGA-QQ-A8VH-01A-11D-A37C-09	TCGA-QQ-A8VH-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b5a400-a49b-41a3-bff0-f3b8c36e36dd	a65e8e60-03c3-468b-acb5-075ff9096122	g.chr7:100281500delA	ENST00000275732.5	-	16	3119	c.1910delT	c.(1909-1911)ttgfs	p.L637fs	GIGYF1_ENST00000471340.2_5'Flank	NM_022574.4	NP_072096.2	O75420	PERQ1_HUMAN	GRB10 interacting GYF protein 1	637					insulin-like growth factor receptor signaling pathway (GO:0048009)					central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	23	Lung NSC(181;0.035)|all_lung(186;0.0509)|Esophageal squamous(72;0.0817)					TGGCACCGACAAGGACCGGCT	0.612																																																	0								ENSG00000146830						25.0	30.0	28.0					7																	100281500		2177	4252	6429	GIGYF1	SO:0001589	frameshift_variant	0				HGNC	AF053356	CCDS34708.1	7q22	2008-02-11	2008-02-11	2008-02-11	ENSG00000146830	ENSG00000146830			9126	protein-coding gene	gene with protein product	"""GYF domain containing 1"""	612064	"""PERQ amino acid rich, with GYF domain 1"""	PERQ1		9799793, 12771153	Standard	NM_022574		Approved	GYF1	uc003uwg.1	O75420	OTTHUMG00000157036	ENST00000275732.5:c.1910delT	7.37:g.100281500delA	ENSP00000275732:p.Leu637fs	Somatic	0	55	0.00		0.7039346279484041	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	15	11.76	Q6Y7W7|Q8WZ38	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_GYF,superfamily_GYF,smart_GYF,pfscan_GYF	p.L637fs	ENST00000275732.5	37	c.1910	CCDS34708.1	7																																																																																			-	NULL		0.612	GIGYF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GIGYF1	protein_coding	OTTHUMT00000347205.2	A	NM_022574			100281500	-1	no_errors	ENST00000275732	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
STKLD1	169436	genome.wustl.edu	37	9	136270476	136270476	+	Missense_Mutation	SNP	C	C	G			TCGA-QQ-A8VH-01A-11D-A37C-09	TCGA-QQ-A8VH-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b5a400-a49b-41a3-bff0-f3b8c36e36dd	a65e8e60-03c3-468b-acb5-075ff9096122	g.chr9:136270476C>G	ENST00000371957.3	+	18	2081	c.1974C>G	c.(1972-1974)ttC>ttG	p.F658L	C9orf96_ENST00000371955.1_Missense_Mutation_p.F191L	NM_153710.3	NP_714921.4	Q8NE28	STKL1_HUMAN		658							ATP binding (GO:0005524)|protein kinase activity (GO:0004672)			autonomic_ganglia(1)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(5)|lung(10)|ovary(2)|stomach(2)	25				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|Epithelial(140;1.28e-06)|all cancers(34;1.46e-05)		GCAGCGCCTTCAGCAAACCAG	0.592																																																	0								ENSG00000198870						43.0	39.0	40.0					9																	136270476		2203	4300	6503	C9orf96	SO:0001583	missense	0			-	HGNC																												ENST00000371957.3:c.1974C>G	9.37:g.136270476C>G	ENSP00000361025:p.Phe658Leu	Somatic	0	13	0.00		0.7039346279484041	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	6	45.45	Q5T8U8|Q6ZMP6|Q6ZMQ5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.F658L	ENST00000371957.3	37	c.1974	CCDS35169.1	9	.	.	.	.	.	.	.	.	.	.	C	0.011	-1.715893	0.00706	.	.	ENSG00000198870	ENST00000371957;ENST00000371955	T;T	0.61392	0.11;1.24	2.09	-1.06	0.10002	.	5.213390	0.00508	N	0.000173	T	0.31295	0.0792	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.14200	-1.0481	10	0.08599	T	0.76	0.8648	2.8233	0.05478	0.0:0.4243:0.2468:0.3289	.	658	Q8NE28	SGK71_HUMAN	L	658;191	ENSP00000361025:F658L;ENSP00000361023:F191L	ENSP00000361023:F191L	F	+	3	2	C9orf96	135260297	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.068000	0.11561	-0.278000	0.09180	-0.254000	0.11334	TTC	-	NULL		0.592	C9orf96-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf96	protein_coding	OTTHUMT00000054855.1	C		-		136270476	+1	no_errors	ENST00000371957	ensembl	human	known	74_37	missense	SNP	0.000	G
AGPAT6	137964	genome.wustl.edu	37	8	41467400	41467400	+	Missense_Mutation	SNP	G	G	C			TCGA-QQ-A8VH-01A-11D-A37C-09	TCGA-QQ-A8VH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b5a400-a49b-41a3-bff0-f3b8c36e36dd	a65e8e60-03c3-468b-acb5-075ff9096122	g.chr8:41467400G>C	ENST00000396987.3	+	4	1389	c.462G>C	c.(460-462)caG>caC	p.Q154H	RP11-360L9.8_ENST00000581909.1_RNA	NM_178819.3	NP_848934.1	Q86UL3	GPAT4_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 6	154					acyl-CoA metabolic process (GO:0006637)|CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|diacylglycerol metabolic process (GO:0046339)|fatty acid metabolic process (GO:0006631)|glandular epithelial cell maturation (GO:0002071)|glycerophospholipid biosynthetic process (GO:0046474)|lactation (GO:0007595)|lipid biosynthetic process (GO:0008610)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glycerol-3-phosphate O-acyltransferase activity (GO:0004366)			endometrium(3)|kidney(2)|large_intestine(3)|lung(6)	14	Ovarian(28;0.00769)|Colorectal(14;0.0202)|Lung SC(25;0.211)	all_lung(54;0.0131)|Lung NSC(58;0.0363)|Hepatocellular(245;0.0462)|Esophageal squamous(32;0.0844)	OV - Ovarian serous cystadenocarcinoma(14;0.00126)|Colorectal(10;0.0014)|Lung(22;0.00177)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0147)			ATAACTTCCAGTACATCAGCC	0.537																																																	0								ENSG00000158669						98.0	97.0	97.0					8																	41467400		2203	4300	6503	AGPAT6	SO:0001583	missense	0			-	HGNC	AF406612	CCDS6117.1	8p11.21	2013-02-05	2013-02-05			ENSG00000158669	2.3.1.15	"""1-acylglycerol-3-phosphate O-acyltransferases"""	20880	protein-coding gene	gene with protein product	"""lysophosphatidic acid acyltransferase, zeta"""	608143	"""1-acylglycerol-3-phosphate O-acyltransferase 6 (lysophosphatidic acid acyltransferase, zeta)"""			12938015	Standard	NM_178819		Approved	DKFZp586M1819, LPAAT-zeta	uc003xnz.2	Q86UL3		ENST00000396987.3:c.462G>C	8.37:g.41467400G>C	ENSP00000380184:p.Gln154His	Somatic	0	47	0.00		0.7039346279484041	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	7	77.42	Q86V89	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Plipid/glycerol_acylTrfase,smart_Plipid/glycerol_acylTrfase	p.Q154H	ENST00000396987.3	37	c.462	CCDS6117.1	8	.	.	.	.	.	.	.	.	.	.	G	10.12	1.263084	0.23051	.	.	ENSG00000158669	ENST00000396987;ENST00000519853	T	0.43688	0.94	4.69	0.839	0.18907	.	0.200086	0.53938	D	0.000048	T	0.16811	0.0404	N	0.08118	0	0.48185	D	0.999601	B	0.02656	0.0	B	0.04013	0.001	T	0.11060	-1.0603	10	0.08837	T	0.75	.	7.2751	0.26279	0.2911:0.1162:0.5927:0.0	.	154	Q86UL3	GPAT4_HUMAN	H	154;108	ENSP00000380184:Q154H	ENSP00000380184:Q154H	Q	+	3	2	AGPAT6	41586557	0.846000	0.29590	1.000000	0.80357	0.953000	0.61014	-0.127000	0.10547	0.281000	0.22233	-0.350000	0.07774	CAG	-	NULL		0.537	AGPAT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGPAT6	protein_coding	OTTHUMT00000377158.1	G	NM_178819	-		41467400	+1	no_errors	ENST00000396987	ensembl	human	known	74_37	missense	SNP	0.983	C
IFIH1	64135	genome.wustl.edu	37	2	163136618	163136618	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VH-01A-11D-A37C-09	TCGA-QQ-A8VH-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b5a400-a49b-41a3-bff0-f3b8c36e36dd	a65e8e60-03c3-468b-acb5-075ff9096122	g.chr2:163136618C>T	ENST00000263642.2	-	8	1924	c.1529G>A	c.(1528-1530)tGt>tAt	p.C510Y		NM_022168.3	NP_071451.2	Q9BYX4	IFIH1_HUMAN	interferon induced with helicase C domain 1	510					cytoplasmic pattern recognition receptor signaling pathway in response to virus (GO:0039528)|detection of virus (GO:0009597)|innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|protein sumoylation (GO:0016925)|regulation of apoptotic process (GO:0042981)|regulation of type III interferon production (GO:0034344)|response to virus (GO:0009615)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|ribonucleoprotein complex binding (GO:0043021)|single-stranded RNA binding (GO:0003727)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(14)|ovary(1)|prostate(2)|skin(3)|urinary_tract(1)	39						AAGATTGGCACATAGCTGGAA	0.308																																																	0								ENSG00000115267						92.0	88.0	89.0					2																	163136618		2202	4300	6502	IFIH1	SO:0001583	missense	0			-	HGNC	AF095844	CCDS2217.1	2q24.2	2010-02-09			ENSG00000115267	ENSG00000115267			18873	protein-coding gene	gene with protein product	"""helicard"""	606951					Standard	NM_022168		Approved	MDA-5, Hlcd, MDA5, IDDM19	uc002uce.4	Q9BYX4	OTTHUMG00000132055	ENST00000263642.2:c.1529G>A	2.37:g.163136618C>T	ENSP00000263642:p.Cys510Tyr	Somatic	0	92	0.00		0.7039346279484041	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	38	42	47.50	Q2NKL6|Q6DC96|Q86X56|Q96MX8|Q9H3G6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RIG-I_C-RD,pfam_Helicase/UvrB_dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,pfam_CARD,superfamily_P-loop_NTPase,superfamily_DEATH-like_dom,superfamily_ARM-type_fold,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.C510Y	ENST00000263642.2	37	c.1529	CCDS2217.1	2	.	.	.	.	.	.	.	.	.	.	C	20.1	3.932007	0.73442	.	.	ENSG00000115267	ENST00000263642;ENST00000543192	T	0.08896	3.04	5.4	5.4	0.78164	DEAD-like helicase (1);	0.000000	0.85682	D	0.000000	T	0.39253	0.1071	M	0.90082	3.085	0.58432	D	0.999996	D	0.89917	1.0	D	0.91635	0.999	T	0.45071	-0.9286	10	0.87932	D	0	-15.0688	19.5284	0.95215	0.0:1.0:0.0:0.0	.	510	Q9BYX4	IFIH1_HUMAN	Y	510	ENSP00000263642:C510Y	ENSP00000263642:C510Y	C	-	2	0	IFIH1	162844864	1.000000	0.71417	1.000000	0.80357	0.818000	0.46254	5.955000	0.70306	2.685000	0.91497	0.655000	0.94253	TGT	-	superfamily_P-loop_NTPase,smart_Helicase_ATP-bd		0.308	IFIH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFIH1	protein_coding	OTTHUMT00000255078.2	C	NM_022168	-		163136618	-1	no_errors	ENST00000263642	ensembl	human	known	74_37	missense	SNP	1.000	T
FAM182B	728882	genome.wustl.edu	37	20	25840376	25840379	+	Intron	DEL	CCCA	CCCA	-			TCGA-QQ-A8VH-01A-11D-A37C-09	TCGA-QQ-A8VH-10A-01D-A37F-09	CCCA	CCCA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b5a400-a49b-41a3-bff0-f3b8c36e36dd	a65e8e60-03c3-468b-acb5-075ff9096122	g.chr20:25840376_25840379delCCCA	ENST00000376403.1	-	1	142				FAM182B_ENST00000376404.2_Intron|FAM182B_ENST00000478164.1_Intron			Q5T319	F182B_HUMAN	family with sequence similarity 182, member B											lung(1)	1						cgagactcaccccaaccaacaccg	0.632																																																	0								ENSG00000175170																																			FAM182B	SO:0001627	intron_variant	0				HGNC			20p11.1	2010-07-14			ENSG00000175170	ENSG00000175170			34503	pseudogene	pseudogene							Standard	NR_027061		Approved			Q5T319	OTTHUMG00000032136	ENST00000376403.1:c.236+3316TGGG>-	20.37:g.25840376_25840379delCCCA		Somatic	0	12	0.00		0.7039346279484041	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	3	70.00	Q4G0Q1	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000376403.1	37	NULL		20																																																																																			-	-		0.632	FAM182B-003	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	FAM182B	protein_coding	OTTHUMT00000078463.2	CCCA	NR_026714			25840379	-1	no_errors	ENST00000584356	ensembl	human	known	74_37	rna	DEL	0.030:0.028:0.026:0.024	-
LOC730102	730102	genome.wustl.edu	37	1	178006883	178006883	+	RNA	SNP	A	A	C			TCGA-QQ-A8VH-01A-11D-A37C-09	TCGA-QQ-A8VH-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b5a400-a49b-41a3-bff0-f3b8c36e36dd	a65e8e60-03c3-468b-acb5-075ff9096122	g.chr1:178006883A>C	ENST00000476232.2	-	0	107					NR_037167.1																						GGGCTTCTTCAGCTCTGCGCA	0.672																																																	0								ENSG00000242193																																			RP11-568K15.1			0			-	Clone_based_vega_gene																													1.37:g.178006883A>C		Somatic	0	60	0.00		0.7039346279484041	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	48	20.00		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000476232.2	37	NULL		1																																																																																			-	-		0.672	RP11-568K15.1-002	KNOWN	basic	processed_transcript	LOC730102	pseudogene	OTTHUMT00000337461.2	A		-		178006883	-1	no_errors	ENST00000476232	ensembl	human	known	74_37	rna	SNP	0.905	C
SETD5	55209	genome.wustl.edu	37	3	9470539	9470539	+	5'UTR	SNP	C	C	T			TCGA-QQ-A8VH-01A-11D-A37C-09	TCGA-QQ-A8VH-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b5a400-a49b-41a3-bff0-f3b8c36e36dd	a65e8e60-03c3-468b-acb5-075ff9096122	g.chr3:9470539C>T	ENST00000406341.1	+	0	107				AC018506.1_ENST00000578447.1_RNA|SETD5_ENST00000302463.6_5'Flank|SETD5_ENST00000402466.1_5'UTR|SETD5_ENST00000402198.1_5'UTR|SETD5_ENST00000407969.1_5'Flank			Q9C0A6	SETD5_HUMAN	SET domain containing 5											NS(2)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(11)|ovary(3)|prostate(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	Medulloblastoma(99;0.227)			OV - Ovarian serous cystadenocarcinoma(96;0.112)		TTGGATGAGGCTCTGCAGCTC	0.423																																																	0								ENSG00000168137																																			SETD5	SO:0001623	5_prime_UTR_variant	0			-	HGNC	BC020956	CCDS46741.1, CCDS74892.1	3p25.3	2011-12-13			ENSG00000168137	ENSG00000168137			25566	protein-coding gene	gene with protein product		615743				11214970	Standard	XM_005265299		Approved	FLJ10707	uc003brt.3	Q9C0A6	OTTHUMG00000150491	ENST00000406341.1:c.-84C>T	3.37:g.9470539C>T		Somatic	0	32	0.00		0.7039346279484041	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	15	42.31	Q6AI17|Q8WUB6|Q9H3X4|Q9H6V7|Q9H7S3|Q9NVI9	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000406341.1	37	NULL	CCDS46741.1	3																																																																																			-	-		0.423	SETD5-001	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	SETD5	protein_coding	OTTHUMT00000318425.1	C	XM_371614	-		9470539	+1	no_errors	ENST00000468208	ensembl	human	known	74_37	rna	SNP	1.000	T
FKBP10	60681	genome.wustl.edu	37	17	39974436	39974436	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VH-01A-11D-A37C-09	TCGA-QQ-A8VH-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b5a400-a49b-41a3-bff0-f3b8c36e36dd	a65e8e60-03c3-468b-acb5-075ff9096122	g.chr17:39974436C>T	ENST00000321562.4	+	3	591	c.487C>T	c.(487-489)Cgc>Tgc	p.R163C	FKBP10_ENST00000544340.1_5'Flank	NM_021939.3	NP_068758.3	Q96AY3	FKB10_HUMAN	FK506 binding protein 10, 65 kDa	163					chaperone-mediated protein folding (GO:0061077)|protein peptidyl-prolyl isomerization (GO:0000413)	endoplasmic reticulum membrane (GO:0005789)	calcium ion binding (GO:0005509)|FK506 binding (GO:0005528)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			cervix(1)|endometrium(3)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	14		Breast(137;0.00122)		BRCA - Breast invasive adenocarcinoma(366;0.148)		CACATTGCTGCGCCCGCCCCA	0.622																																																	0								ENSG00000141756						64.0	59.0	61.0					17																	39974436		2203	4300	6503	FKBP10	SO:0001583	missense	0			-	HGNC	AB045981	CCDS11409.1	17q21.2	2014-09-17	2002-08-29		ENSG00000141756	ENSG00000141756		"""EF-hand domain containing"""	18169	protein-coding gene	gene with protein product		607063	"""FK506 binding protein 10 (65 kDa)"""			11071917, 18786928	Standard	NM_021939		Approved	hFKBP65, FLJ22041, FKBP6, FLJ20683, FLJ23833	uc002hxv.2	Q96AY3	OTTHUMG00000133497	ENST00000321562.4:c.487C>T	17.37:g.39974436C>T	ENSP00000317232:p.Arg163Cys	Somatic	0	49	0.00		0.7039346279484041	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	27	12.90	Q7Z3R4|Q9H3N3|Q9H6J3|Q9H6N5|Q9UF89	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PPIase_FKBP_dom,smart_EF_hand_dom,pfscan_EF_hand_dom,pfscan_PPIase_FKBP_dom	p.R163C	ENST00000321562.4	37	c.487	CCDS11409.1	17	.	.	.	.	.	.	.	.	.	.	C	18.38	3.612185	0.66672	.	.	ENSG00000141756	ENST00000269598;ENST00000321562;ENST00000414352	T	0.55588	0.51	5.53	5.53	0.82687	.	0.255230	0.30630	N	0.009204	T	0.56978	0.2022	M	0.78049	2.395	0.80722	D	1	D	0.56287	0.975	P	0.44561	0.453	T	0.64193	-0.6465	10	0.59425	D	0.04	-10.2049	12.3863	0.55335	0.2793:0.7207:0.0:0.0	.	163	Q96AY3	FKB10_HUMAN	C	163	ENSP00000317232:R163C	ENSP00000269598:R163C	R	+	1	0	FKBP10	37227962	0.997000	0.39634	1.000000	0.80357	0.926000	0.56050	3.832000	0.55783	2.628000	0.89032	0.561000	0.74099	CGC	-	NULL		0.622	FKBP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FKBP10	protein_coding	OTTHUMT00000257410.2	C	NM_021939	-		39974436	+1	no_errors	ENST00000321562	ensembl	human	known	74_37	missense	SNP	0.970	T
ZNF618	114991	genome.wustl.edu	37	9	116812463	116812464	+	3'UTR	INS	-	-	A	rs575961464		TCGA-QQ-A8VH-01A-11D-A37C-09	TCGA-QQ-A8VH-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b5a400-a49b-41a3-bff0-f3b8c36e36dd	a65e8e60-03c3-468b-acb5-075ff9096122	g.chr9:116812463_116812464insA	ENST00000374126.5	+	0	2980_2981				ZNF618_ENST00000288466.7_3'UTR|ZNF618_ENST00000470105.1_3'UTR			Q5T7W0	ZN618_HUMAN	zinc finger protein 618						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(4)|lung(10)|urinary_tract(1)	16						GACTTCGGGGGAAAAAAAAAGA	0.361																																																	0								ENSG00000157657																																			ZNF618	SO:0001624	3_prime_UTR_variant	0				HGNC	BC012922	CCDS48008.1	9q33.1	2010-04-21			ENSG00000157657	ENSG00000157657		"""Zinc fingers, C2H2-type"""	29416	protein-coding gene	gene with protein product	"""neural precursor cell expressed, developmentally down-regulated 10"""					11853319	Standard	NM_133374		Approved	KIAA1952, NEDD10	uc004bic.3	Q5T7W0	OTTHUMG00000020532	ENST00000374126.5:c.*17->A	9.37:g.116812472_116812472dupA		Somatic	0	44	0.00		0.7039346279484041	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	31	8.82	B9EG82|Q4G0X6|Q5T7W1|Q6ZT53|Q7Z6B9|Q8TF49|Q96E49	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000374126.5	37	NULL		9																																																																																			-	-		0.361	ZNF618-004	KNOWN	basic|appris_candidate_longest	protein_coding	ZNF618	protein_coding	OTTHUMT00000053749.1	-	XM_054983			116812464	+1	no_errors	ENST00000470105	ensembl	human	known	74_37	rna	INS	0.000:0.003	A
TNFRSF21	27242	genome.wustl.edu	37	6	47252150	47252150	+	Missense_Mutation	SNP	G	G	T			TCGA-QQ-A8VH-01A-11D-A37C-09	TCGA-QQ-A8VH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b5a400-a49b-41a3-bff0-f3b8c36e36dd	a65e8e60-03c3-468b-acb5-075ff9096122	g.chr6:47252150G>T	ENST00000296861.2	-	3	1160	c.767C>A	c.(766-768)tCc>tAc	p.S256Y		NM_014452.3	NP_055267.1	O75509	TNR21_HUMAN	tumor necrosis factor receptor superfamily, member 21	256					adaptive immune response (GO:0002250)|apoptotic process (GO:0006915)|B cell apoptotic process (GO:0001783)|cellular lipid metabolic process (GO:0044255)|cellular response to tumor necrosis factor (GO:0071356)|humoral immune response (GO:0006959)|myelination (GO:0042552)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of interleukin-10 secretion (GO:2001180)|negative regulation of interleukin-13 secretion (GO:2000666)|negative regulation of interleukin-5 secretion (GO:2000663)|negative regulation of myelination (GO:0031642)|negative regulation of T cell proliferation (GO:0042130)|neuron apoptotic process (GO:0051402)|oligodendrocyte apoptotic process (GO:0097252)|regulation of oligodendrocyte differentiation (GO:0048713)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|lung(7)|pancreas(1)|skin(2)	21			Lung(136;0.189)			AGAAGAGTTGGATTCTGTTGA	0.483																																																	0								ENSG00000146072						117.0	104.0	108.0					6																	47252150		2203	4300	6503	TNFRSF21	SO:0001583	missense	0			-	HGNC	AF068868	CCDS4921.1	6p21.1	2011-08-11			ENSG00000146072	ENSG00000146072		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	13469	protein-coding gene	gene with protein product	"""death receptor 6"""	605732				9714541	Standard	NM_014452		Approved	DR6, CD358	uc003oyv.3	O75509	OTTHUMG00000014796	ENST00000296861.2:c.767C>A	6.37:g.47252150G>T	ENSP00000296861:p.Ser256Tyr	Somatic	0	67	0.00		0.7039346279484041	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	31	38.00	B2RDI9|Q0D2P5|Q96D86	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Death_domain,superfamily_DEATH-like_dom,smart_TNFR/NGFR_Cys_rich_reg,smart_Death_domain,pfscan_Death_domain,pfscan_TNFR/NGFR_Cys_rich_reg,prints_TNFR_21	p.S256Y	ENST00000296861.2	37	c.767	CCDS4921.1	6	.	.	.	.	.	.	.	.	.	.	G	12.34	1.910117	0.33721	.	.	ENSG00000146072	ENST00000296861	T	0.65549	-0.16	5.38	2.68	0.31781	.	0.548033	0.21480	N	0.073842	T	0.32971	0.0847	L	0.47716	1.5	0.34643	D	0.720872	P	0.35383	0.498	B	0.27500	0.08	T	0.12811	-1.0533	10	0.59425	D	0.04	.	10.1032	0.42517	0.2751:0.0:0.7249:0.0	.	256	O75509	TNR21_HUMAN	Y	256	ENSP00000296861:S256Y	ENSP00000296861:S256Y	S	-	2	0	TNFRSF21	47360109	1.000000	0.71417	0.999000	0.59377	0.999000	0.98932	2.752000	0.47516	0.415000	0.25817	0.655000	0.94253	TCC	-	NULL		0.483	TNFRSF21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFRSF21	protein_coding	OTTHUMT00000040814.1	G	NM_014452	-		47252150	-1	no_errors	ENST00000296861	ensembl	human	known	74_37	missense	SNP	0.999	T
ZDHHC13	54503	genome.wustl.edu	37	11	19184856	19184856	+	Missense_Mutation	SNP	C	C	A			TCGA-QQ-A8VH-01A-11D-A37C-09	TCGA-QQ-A8VH-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b5a400-a49b-41a3-bff0-f3b8c36e36dd	a65e8e60-03c3-468b-acb5-075ff9096122	g.chr11:19184856C>A	ENST00000446113.2	+	11	1236	c.1115C>A	c.(1114-1116)gCa>gAa	p.A372E	ZDHHC13_ENST00000399351.3_Missense_Mutation_p.A242E	NM_019028.2	NP_061901.2	Q8IUH4	ZDH13_HUMAN	zinc finger, DHHC-type containing 13	372	Phe-rich.				metabolic process (GO:0008152)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi-associated vesicle membrane (GO:0030660)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)	magnesium ion transmembrane transporter activity (GO:0015095)|palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|signal transducer activity (GO:0004871)|zinc ion binding (GO:0008270)			NS(1)|kidney(1)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	6						TAACATTTAGCAGGAGCCCCT	0.353																																																	0								ENSG00000177054						107.0	99.0	102.0					11																	19184856		1829	4068	5897	ZDHHC13	SO:0001583	missense	0			-	HGNC	AB024495	CCDS44550.1, CCDS44551.1	11p15.1	2013-01-10			ENSG00000177054	ENSG00000177054		"""Zinc fingers, DHHC-type"", ""Ankyrin repeat domain containing"""	18413	protein-coding gene	gene with protein product		612815				18794299	Standard	NM_001001483		Approved	FLJ10852, FLJ10941, HIP14L	uc001mpi.3	Q8IUH4	OTTHUMG00000166099	ENST00000446113.2:c.1115C>A	11.37:g.19184856C>A	ENSP00000400113:p.Ala372Glu	Somatic	0	95	0.00		0.7039346279484041	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	36	98	26.87	Q7Z2D3|Q86VK2|Q9NV30|Q9NV99	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ankyrin_rpt,pfam_Znf_DHHC_palmitoyltrfase,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Znf_DHHC_palmitoyltrfase	p.A372E	ENST00000446113.2	37	c.1115	CCDS44550.1	11	.	.	.	.	.	.	.	.	.	.	C	9.507	1.104768	0.20632	.	.	ENSG00000177054	ENST00000446113;ENST00000399351	T;T	0.35789	1.29;2.01	5.32	3.41	0.39046	.	.	.	.	.	T	0.29749	0.0743	L	0.36672	1.1	0.23795	N	0.996828	B	0.17038	0.02	B	0.09377	0.004	T	0.14615	-1.0466	9	0.28530	T	0.3	.	13.9811	0.64306	0.0:0.7101:0.2899:0.0	.	372	Q8IUH4	ZDH13_HUMAN	E	372;242	ENSP00000400113:A372E;ENSP00000382288:A242E	ENSP00000382288:A242E	A	+	2	0	ZDHHC13	19141432	0.782000	0.28689	0.948000	0.38648	0.654000	0.38779	1.084000	0.30828	0.705000	0.31890	0.655000	0.94253	GCA	-	NULL		0.353	ZDHHC13-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	ZDHHC13	protein_coding	OTTHUMT00000387821.1	C	NM_019028	-		19184856	+1	no_errors	ENST00000446113	ensembl	human	known	74_37	missense	SNP	0.999	A
NONO	4841	genome.wustl.edu	37	X	70520091	70520091	+	3'UTR	SNP	G	G	A			TCGA-QQ-A8VH-01A-11D-A37C-09	TCGA-QQ-A8VH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b5a400-a49b-41a3-bff0-f3b8c36e36dd	a65e8e60-03c3-468b-acb5-075ff9096122	g.chrX:70520091G>A	ENST00000276079.8	+	0	1786				NONO_ENST00000535149.1_3'UTR|NONO_ENST00000373841.1_3'UTR|NONO_ENST00000490044.1_3'UTR|ITGB1BP2_ENST00000538820.1_5'Flank|NONO_ENST00000373856.3_3'UTR|ITGB1BP2_ENST00000373829.3_5'Flank	NM_007363.4	NP_031389.3	Q15233	NONO_HUMAN	non-POU domain containing, octamer-binding						circadian rhythm (GO:0007623)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|mRNA processing (GO:0006397)|negative regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903377)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of circadian rhythm (GO:0042752)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|paraspeckles (GO:0042382)	core promoter binding (GO:0001047)|identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)		NONO/TFE3(2)	endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(2)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	19	Renal(35;0.156)					AGGGAGGGGTGGTATTAAACA	0.463			T	TFE3	papillary renal cancer																																			Dom	yes		X	Xq13.1	4841	"""non-POU domain containing, octamer-binding"""		E	0								ENSG00000147140																																			NONO	SO:0001624	3_prime_UTR_variant	0			-	HGNC	L14599	CCDS14410.1, CCDS55445.1	Xq13.1	2014-06-13	2002-01-14		ENSG00000147140	ENSG00000147140		"""RNA binding motif (RRM) containing"""	7871	protein-coding gene	gene with protein product	"""Nuclear RNA-binding protein, 54-kD"", ""non-Pou domain-containing octamer (ATGCAAAT) binding protein"", ""protein phosphatase 1, regulatory subunit 114"""	300084	"""non-POU-domain-containing, octamer-binding"""			8371983, 9360842	Standard	NM_007363		Approved	NRB54, NMT55, P54NRB, P54, PPP1R114	uc004dzp.3	Q15233	OTTHUMG00000021798	ENST00000276079.8:c.*165G>A	X.37:g.70520091G>A		Somatic	0	35	0.00		0.7039346279484041	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	12	55.56	B7Z4C2|D3DVV4|F5GYZ3|O00201|P30807|Q12786|Q9BQC5	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000276079.8	37	NULL	CCDS14410.1	X																																																																																			-	-		0.463	NONO-002	KNOWN	basic|appris_principal|CCDS	protein_coding	NONO	protein_coding	OTTHUMT00000057138.1	G	NM_007363	-		70520091	+1	no_errors	ENST00000473525	ensembl	human	known	74_37	rna	SNP	0.004	A
KCNH8	131096	genome.wustl.edu	37	3	19432128	19432128	+	Missense_Mutation	SNP	G	G	T			TCGA-QQ-A8VH-01A-11D-A37C-09	TCGA-QQ-A8VH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b5a400-a49b-41a3-bff0-f3b8c36e36dd	a65e8e60-03c3-468b-acb5-075ff9096122	g.chr3:19432128G>T	ENST00000328405.2	+	6	1233	c.967G>T	c.(967-969)Gtg>Ttg	p.V323L	KCNH8_ENST00000537696.1_5'UTR|KCNH8_ENST00000475063.1_3'UTR	NM_144633.2	NP_653234.2	Q96L42	KCNH8_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 8	323					potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(3)|lung(37)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	77						CAACGTCACAGTGGTGAGTAA	0.423																																					NSCLC(124;1625 1765 8018 24930 42026)												0								ENSG00000183960						105.0	110.0	108.0					3																	19432128		2203	4300	6503	KCNH8	SO:0001583	missense	0			-	HGNC	AY053503	CCDS2632.1	3p24.3	2012-07-05			ENSG00000183960	ENSG00000183960		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18864	protein-coding gene	gene with protein product		608260				16382104	Standard	NM_144633		Approved	Kv12.1, elk3	uc003cbk.1	Q96L42	OTTHUMG00000129891	ENST00000328405.2:c.967G>T	3.37:g.19432128G>T	ENSP00000328813:p.Val323Leu	Somatic	0	87	0.00		0.7039346279484041	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	47	31.88	B7Z2I7|Q59GQ6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_cNMP-bd_dom,pfam_2pore_dom_K_chnl_dom,pfam_PAS_fold_3,pfam_PAS_4,pfam_PAS_fold,superfamily_cNMP-bd-like,superfamily_PAS,superfamily_tRNA-bd_arm,smart_PAC,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom,pfscan_PAS-assoc_C,prints_K_chnl_volt-dep_EAG/ELK/ERG,prints_K_chnl_volt-dep_ELK,prints_K_chnl_volt-dep_ERG,prints_K_chnl_volt-dep_EAG,tigrfam_PAS	p.V323L	ENST00000328405.2	37	c.967	CCDS2632.1	3	.	.	.	.	.	.	.	.	.	.	G	35	5.555364	0.96514	.	.	ENSG00000183960	ENST00000328405	D	0.98135	-4.74	5.41	5.41	0.78517	Ion transport (1);	.	.	.	.	D	0.97508	0.9184	L	0.38692	1.165	0.80722	D	1	P;D	0.56287	0.902;0.975	B;P	0.60541	0.411;0.876	D	0.97205	0.9867	8	.	.	.	.	19.2076	0.93739	0.0:0.0:1.0:0.0	.	323;323	B7Z398;Q96L42	.;KCNH8_HUMAN	L	323	ENSP00000328813:V323L	.	V	+	1	0	KCNH8	19407132	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	9.869000	0.99810	2.517000	0.84864	0.650000	0.86243	GTG	-	pfam_Ion_trans_dom		0.423	KCNH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNH8	protein_coding	OTTHUMT00000252139.2	G	NM_144633	-		19432128	+1	no_errors	ENST00000328405	ensembl	human	known	74_37	missense	SNP	1.000	T
PTPRU	10076	genome.wustl.edu	37	1	29630418	29630418	+	Missense_Mutation	SNP	C	C	T			TCGA-QQ-A8VH-01A-11D-A37C-09	TCGA-QQ-A8VH-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b5a400-a49b-41a3-bff0-f3b8c36e36dd	a65e8e60-03c3-468b-acb5-075ff9096122	g.chr1:29630418C>T	ENST00000345512.3	+	17	2687	c.2558C>T	c.(2557-2559)tCc>tTc	p.S853F	PTPRU_ENST00000428026.2_Missense_Mutation_p.S843F|PTPRU_ENST00000356870.3_Missense_Mutation_p.S843F|PTPRU_ENST00000460170.2_Missense_Mutation_p.S843F|PTPRU_ENST00000415600.2_3'UTR|PTPRU_ENST00000373779.3_Missense_Mutation_p.S843F|PTPRU_ENST00000323874.8_Missense_Mutation_p.S843F	NM_005704.4	NP_005695.3	Q92729	PTPRU_HUMAN	protein tyrosine phosphatase, receptor type, U	853	Mediates interaction with CTNNB1. {ECO:0000250}.				canonical Wnt signaling pathway (GO:0060070)|cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|homotypic cell-cell adhesion (GO:0034109)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|organ regeneration (GO:0031100)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|protein localization to cell surface (GO:0034394)|response to glucocorticoid (GO:0051384)|single organismal cell-cell adhesion (GO:0016337)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cell-cell junction (GO:0005911)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(4)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(26)|ovary(1)|prostate(3)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	79		Colorectal(325;0.000399)|Lung NSC(340;0.00953)|all_lung(284;0.0112)|Breast(348;0.0126)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;6.99e-07)|COAD - Colon adenocarcinoma(152;3.18e-05)|STAD - Stomach adenocarcinoma(196;0.0234)|READ - Rectum adenocarcinoma(331;0.0686)|BRCA - Breast invasive adenocarcinoma(304;0.0871)		CTGGGGGGCTCCCCGAGGCGT	0.647																																																	0								ENSG00000060656						35.0	41.0	39.0					1																	29630418		2203	4297	6500	PTPRU	SO:0001583	missense	0			-	HGNC	U71075	CCDS334.1, CCDS335.1, CCDS44098.1, CCDS44098.2, CCDS53290.1	1p35.3	2013-02-11			ENSG00000060656	ENSG00000060656		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9683	protein-coding gene	gene with protein product	"""pi R-PTP-Psi"""	602454				8700514, 9434160	Standard	NM_133178		Approved	PTPRO, hPTP-J, PCP-2, FMI, PTP	uc001bru.3	Q92729	OTTHUMG00000003699	ENST00000345512.3:c.2558C>T	1.37:g.29630418C>T	ENSP00000334941:p.Ser853Phe	Somatic	0	65	0.00		0.7039346279484041	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	31	33	48.44	A6H8L1|O00197|P78399|Q59HA4|Q5SYU4|Q5SYU5|Q92735|Q92850	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_MAM_dom,pfam_Fibronectin_type3,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_MAM_dom,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_MAM_dom,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt,prints_MAM_dom	p.S853F	ENST00000345512.3	37	c.2558	CCDS334.1	1	.	.	.	.	.	.	.	.	.	.	C	15.58	2.875156	0.51695	.	.	ENSG00000060656	ENST00000345512;ENST00000373779;ENST00000356870;ENST00000323874;ENST00000428026;ENST00000460170	T;T;T;T;T;T	0.32988	1.45;1.49;1.49;1.49;1.43;1.49	4.13	4.13	0.48395	.	0.000000	0.85682	D	0.000000	T	0.47875	0.1469	L	0.54323	1.7	0.80722	D	1	D;D;D;D;D	0.69078	0.995;0.995;0.995;0.991;0.997	D;D;D;P;P	0.63957	0.92;0.92;0.92;0.835;0.822	T	0.38329	-0.9666	9	.	.	.	.	16.6429	0.85134	0.0:1.0:0.0:0.0	.	843;843;843;843;853	Q92729-3;Q92729-4;Q92729-2;E9PH42;Q92729	.;.;.;.;PTPRU_HUMAN	F	853;843;843;843;843;843	ENSP00000334941:S853F;ENSP00000362884:S843F;ENSP00000349333:S843F;ENSP00000314987:S843F;ENSP00000392332:S843F;ENSP00000432906:S843F	.	S	+	2	0	PTPRU	29503005	1.000000	0.71417	0.955000	0.39395	0.834000	0.47266	7.535000	0.82014	2.592000	0.87571	0.561000	0.74099	TCC	-	NULL		0.647	PTPRU-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRU	protein_coding	OTTHUMT00000010447.1	C		-		29630418	+1	no_errors	ENST00000345512	ensembl	human	known	74_37	missense	SNP	0.999	T
C12orf54	121273	genome.wustl.edu	37	12	48882278	48882279	+	Intron	INS	-	-	AAC	rs67325885|rs200977170|rs77875864	byFrequency	TCGA-QQ-A8VH-01A-11D-A37C-09	TCGA-QQ-A8VH-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b5a400-a49b-41a3-bff0-f3b8c36e36dd	a65e8e60-03c3-468b-acb5-075ff9096122	g.chr12:48882278_48882279insAAC	ENST00000548364.1	+	4	192				C12orf54_ENST00000314014.2_Intron|C12orf54_ENST00000548913.1_3'UTR|RP11-722P11.4_ENST00000551847.1_RNA			Q6X4T0	CL054_HUMAN	chromosome 12 open reading frame 54											endometrium(1)|large_intestine(4)	5						AAAAAAAAAAAGAAAGAAAGAA	0.332																																																	0								ENSG00000177627																																			C12orf54	SO:0001627	intron_variant	0				HGNC	BC031670	CCDS8764.1	12q13.11	2011-01-31			ENSG00000177627	ENSG00000177627			28553	protein-coding gene	gene with protein product						12477932	Standard	NM_152319		Approved	MGC35033	uc001rrr.3	Q6X4T0	OTTHUMG00000170019	ENST00000548364.1:c.136-428->AAC	12.37:g.48882278_48882279insAAC		Somatic	0	23	0.00		0.7039346279484041	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	31	8.82	Q6X4S9|Q8N5S2	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000548364.1	37	NULL	CCDS8764.1	12																																																																																			-	-		0.332	C12orf54-001	KNOWN	non_canonical_polymorphism|basic|appris_principal|CCDS	protein_coding	C12orf54	protein_coding	OTTHUMT00000406875.1	-	NM_152319			48882279	+1	no_errors	ENST00000548913	ensembl	human	known	74_37	rna	INS	0.033:0.007	AAC
NBPF1	55672	genome.wustl.edu	37	1	16907298	16907298	+	Silent	SNP	C	C	T			TCGA-QQ-A8VH-01A-11D-A37C-09	TCGA-QQ-A8VH-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b5a400-a49b-41a3-bff0-f3b8c36e36dd	a65e8e60-03c3-468b-acb5-075ff9096122	g.chr1:16907298C>T	ENST00000430580.2	-	16	2420	c.1533G>A	c.(1531-1533)ctG>ctA	p.L511L	NBPF1_ENST00000432949.1_5'Flank	NM_017940.3	NP_060410.2	Q3BBV0	NBPF1_HUMAN	neuroblastoma breakpoint family, member 1	511	NBPF 2. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)									UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		TGTCTACAACCAGAGCTGAGT	0.463																																																	0								ENSG00000219481						1126.0	1132.0	1130.0					1																	16907298		2203	4300	6503	NBPF1	SO:0001819	synonymous_variant	0			-	HGNC	AB051480		1p36.13	2013-01-30			ENSG00000219481	ENSG00000219481		"""neuroblastoma breakpoint family"""	26088	protein-coding gene	gene with protein product		610501				11214970, 16079250	Standard	NM_017940		Approved	FLJ20719, KIAA1693	uc001ayw.4	Q3BBV0	OTTHUMG00000002487	ENST00000430580.2:c.1533G>A	1.37:g.16907298C>T		Somatic	0	1438	0.00		0.7039346279484041	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	131	1492	8.07	Q8N4E8|Q9C0H0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_NBPF_dom	p.L511	ENST00000430580.2	37	c.1533		1																																																																																			-	pfam_NBPF_dom		0.463	NBPF1-005	NOVEL	upstream_uORF|basic|appris_principal	protein_coding	NBPF1	protein_coding	OTTHUMT00000106436.3	C	NM_017940	-		16907298	-1	no_errors	ENST00000430580	ensembl	human	novel	74_37	silent	SNP	0.005	T
BCAT1	586	genome.wustl.edu	37	12	24995082	24995082	+	Nonsense_Mutation	SNP	C	C	A			TCGA-QQ-A8VH-01A-11D-A37C-09	TCGA-QQ-A8VH-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b5a400-a49b-41a3-bff0-f3b8c36e36dd	a65e8e60-03c3-468b-acb5-075ff9096122	g.chr12:24995082C>A	ENST00000261192.7	-	7	1277	c.751G>T	c.(751-753)Gag>Tag	p.E251*	BCAT1_ENST00000539780.1_Nonsense_Mutation_p.E214*|BCAT1_ENST00000538118.1_Nonsense_Mutation_p.E250*|BCAT1_ENST00000544418.1_5'UTR|BCAT1_ENST00000342945.5_Nonsense_Mutation_p.E190*|BCAT1_ENST00000539282.1_Nonsense_Mutation_p.E263*	NM_001178091.1|NM_005504.6	NP_001171562.1|NP_005495.2	P54687	BCAT1_HUMAN	branched chain amino-acid transaminase 1, cytosolic	251				E -> R (in Ref. 1; AAB08528). {ECO:0000305}.	branched-chain amino acid biosynthetic process (GO:0009082)|branched-chain amino acid catabolic process (GO:0009083)|cell proliferation (GO:0008283)|cellular nitrogen compound metabolic process (GO:0034641)|G1/S transition of mitotic cell cycle (GO:0000082)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	branched-chain-amino-acid transaminase activity (GO:0004084)|L-isoleucine transaminase activity (GO:0052656)|L-leucine transaminase activity (GO:0052654)|L-valine transaminase activity (GO:0052655)			breast(1)|large_intestine(1)|lung(3)|prostate(2)	7	Acute lymphoblastic leukemia(6;0.00112)|all_hematologic(7;0.00152)|Ovarian(17;0.107)|Colorectal(261;0.196)				Gabapentin(DB00996)|L-Isoleucine(DB00167)|L-Leucine(DB00149)|L-Valine(DB00161)	TGATGGTCCTCTCCATAGAGC	0.413																																																	0								ENSG00000060982						94.0	90.0	91.0					12																	24995082		1916	4150	6066	BCAT1	SO:0001587	stop_gained	0			-	HGNC		CCDS44845.1, CCDS53760.1, CCDS53761.1, CCDS53762.1, CCDS53763.1	12p12.1	2012-10-02	2010-05-07		ENSG00000060982	ENSG00000060982	2.6.1.42		976	protein-coding gene	gene with protein product		113520	"""branched chain aminotransferase 1, cytosolic"""	BCT1		9165094	Standard	NM_005504		Approved		uc010six.2	P54687	OTTHUMG00000169053	ENST00000261192.7:c.751G>T	12.37:g.24995082C>A	ENSP00000261192:p.Glu251*	Somatic	0	41	0.00		0.7039346279484041	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	21	11.54	B3KY27|B7Z2M5|B7Z5L0|F5H5E4|Q68DQ7|Q96MY9	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Aminotrans_IV,superfamily_Aminotrans_IV,pirsf_B_amino_transII,tigrfam_B_amino_transII	p.E251*	ENST00000261192.7	37	c.751	CCDS44845.1	12	.	.	.	.	.	.	.	.	.	.	C	28.1	4.892674	0.91889	.	.	ENSG00000060982	ENST00000261192;ENST00000538118;ENST00000342945;ENST00000539282;ENST00000539780	.	.	.	5.35	1.89	0.25635	.	0.641603	0.15986	N	0.235046	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.38643	T	0.18	-15.788	8.6948	0.34289	0.1175:0.7113:0.0:0.1712	.	.	.	.	X	251;250;190;263;214	.	ENSP00000261192:E251X	E	-	1	0	BCAT1	24886349	1.000000	0.71417	0.007000	0.13788	0.128000	0.20619	1.904000	0.39868	-0.144000	0.11314	-1.119000	0.02030	GAG	-	pfam_Aminotrans_IV,superfamily_Aminotrans_IV,pirsf_B_amino_transII,tigrfam_B_amino_transII		0.413	BCAT1-001	KNOWN	upstream_uORF|basic|appris_candidate_longest|CCDS	protein_coding	BCAT1	protein_coding	OTTHUMT00000402080.1	C	NM_005504	-		24995082	-1	no_errors	ENST00000261192	ensembl	human	known	74_37	nonsense	SNP	0.957	A
SHPRH	257218	genome.wustl.edu	37	6	146256227	146256227	+	Missense_Mutation	SNP	G	G	C			TCGA-QQ-A8VH-01A-11D-A37C-09	TCGA-QQ-A8VH-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e4b5a400-a49b-41a3-bff0-f3b8c36e36dd	a65e8e60-03c3-468b-acb5-075ff9096122	g.chr6:146256227G>C	ENST00000367505.2	-	13	3070	c.2806C>G	c.(2806-2808)Cgt>Ggt	p.R936G	SHPRH_ENST00000367503.3_Missense_Mutation_p.R936G|SHPRH_ENST00000438092.2_Missense_Mutation_p.R936G|SHPRH_ENST00000275233.7_Missense_Mutation_p.R936G			Q149N8	SHPRH_HUMAN	SNF2 histone linker PHD RING helicase, E3 ubiquitin protein ligase	936					DNA repair (GO:0006281)|nucleosome assembly (GO:0006334)|protein polyubiquitination (GO:0000209)	nucleosome (GO:0000786)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(15)|lung(33)|ovary(3)|pancreas(2)|prostate(7)|skin(1)|urinary_tract(1)	79		Ovarian(120;0.0365)		OV - Ovarian serous cystadenocarcinoma(155;1.47e-07)|GBM - Glioblastoma multiforme(68;0.0124)		TCATGCTGACGGTGATAGAAA	0.463																																																	0								ENSG00000146414						80.0	79.0	79.0					6																	146256227		1927	4151	6078	SHPRH	SO:0001583	missense	0			-	HGNC	AB095943	CCDS43513.1, CCDS47496.1, CCDS43513.2	6q24.2	2012-02-23	2012-02-23		ENSG00000146414	ENSG00000146414		"""RING-type (C3HC4) zinc fingers"""	19336	protein-coding gene	gene with protein product		608048	"""SNF2 histone linker PHD RING helicase"""			12837266	Standard	NM_001042683		Approved	FLJ90837, KIAA2023, bA545I5.2	uc003qlf.3	Q149N8	OTTHUMG00000015750	ENST00000367505.2:c.2806C>G	6.37:g.146256227G>C	ENSP00000356475:p.Arg936Gly	Somatic	0	69	0.00		0.7039346279484041	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	43	18.52	Q149N9|Q5VV79|Q68DS5|Q7Z5J5|Q8IVE8|Q8IWQ9|Q8N1S8|Q8NBR7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SNF2_N,pfam_Histone_H1/H5_H15,superfamily_P-loop_NTPase,superfamily_Znf_FYVE_PHD,superfamily_WW_dom,smart_Helicase_ATP-bd,smart_Histone_H1/H5_H15,smart_Znf_PHD,smart_Znf_RING,smart_Helicase_C,pfscan_Znf_RING,pfscan_Helicase_C	p.R936G	ENST00000367505.2	37	c.2806	CCDS43513.2	6	.	.	.	.	.	.	.	.	.	.	G	31	5.067870	0.93950	.	.	ENSG00000146414	ENST00000367505;ENST00000367503;ENST00000438092;ENST00000275233	T;T;T;T	0.75938	-0.98;-0.98;-0.98;-0.98	5.91	5.91	0.95273	SNF2-related (1);	0.000000	0.85682	D	0.000000	D	0.84202	0.5420	M	0.68593	2.085	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.999;0.999	D	0.84022	0.0354	10	0.66056	D	0.02	-19.5051	20.2983	0.98569	0.0:0.0:1.0:0.0	.	825;936;936	Q149N8-2;Q149N8;Q149N8-4	.;SHPRH_HUMAN;.	G	936	ENSP00000356475:R936G;ENSP00000356473:R936G;ENSP00000412797:R936G;ENSP00000275233:R936G	ENSP00000275233:R936G	R	-	1	0	SHPRH	146297920	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	9.869000	0.99810	2.802000	0.96397	0.655000	0.94253	CGT	-	pfam_SNF2_N,superfamily_P-loop_NTPase		0.463	SHPRH-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SHPRH	protein_coding	OTTHUMT00000042571.2	G	NM_173082	-		146256227	-1	no_errors	ENST00000367503	ensembl	human	known	74_37	missense	SNP	1.000	C
