#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
OR7D4	125958	genome.wustl.edu	37	19	9325401	9325401	+	Missense_Mutation	SNP	G	G	A	rs148654687	byFrequency	TCGA-RN-A68Q-01A-11D-A307-09	TCGA-RN-A68Q-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3c3787ae-7994-4448-a01f-347bcb22368c	61a568f9-beb4-45a9-92b9-30cf2001d4fe	g.chr19:9325401G>A	ENST00000308682.2	-	1	141	c.113C>T	c.(112-114)aCg>aTg	p.T38M		NM_001005191.2	NP_001005191.1	Q8NG98	OR7D4_HUMAN	olfactory receptor, family 7, subfamily D, member 4	38						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(10)|ovary(2)|skin(3)|stomach(1)	26						CCCCAGCACCGTGACCAGGTA	0.522													G|||	2	0.000399361	0.0008	0.0	5008	,	,		18844	0.001		0.0	False		,,,				2504	0.0																0								ENSG00000174667	G	MET/THR	5,4401	9.9+/-24.2	0,5,2198	76.0	73.0	74.0		113	2.8	0.6	19	dbSNP_134	74	0,8600		0,0,4300	no	missense	OR7D4	NM_001005191.2	81	0,5,6498	AA,AG,GG		0.0,0.1135,0.0384	probably-damaging	38/313	9325401	5,13001	2203	4300	6503	OR7D4	SO:0001583	missense	0			-	HGNC		CCDS32901.1	19p13.2	2013-12-17		2004-03-10	ENSG00000174667	ENSG00000174667		"""GPCR / Class A : Olfactory receptors"""	8380	protein-coding gene	gene with protein product		611538		OR7D4P			Standard	NM_001005191		Approved	hg105, OR19-B	uc002mla.2	Q8NG98	OTTHUMG00000179936	ENST00000308682.2:c.113C>T	19.37:g.9325401G>A	ENSP00000310488:p.Thr38Met	Somatic	0	80	0.00		0.4355817787290055	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	122	16.44	A8CAH8|A8CAH9|A8CAI0|A8CAI1|B9EH79	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.T38M	ENST00000308682.2	37	c.113	CCDS32901.1	19	.	.	.	.	.	.	.	.	.	.	G	8.540	0.873143	0.17322	0.001135	0.0	ENSG00000174667	ENST00000308682	T	0.00504	6.94	3.92	2.84	0.33178	.	0.330554	0.26355	N	0.024852	T	0.00998	0.0033	H	0.96604	3.85	0.25703	N	0.985567	P	0.51653	0.947	B	0.39531	0.302	T	0.42361	-0.9456	10	0.87932	D	0	.	6.7623	0.23548	0.1002:0.1818:0.718:0.0	.	38	Q8NG98	OR7D4_HUMAN	M	38	ENSP00000310488:T38M	ENSP00000310488:T38M	T	-	2	0	OR7D4	9186401	0.004000	0.15560	0.577000	0.28562	0.010000	0.07245	1.564000	0.36375	0.979000	0.38497	0.436000	0.28706	ACG	-	pfam_7TM_GPCR_olfarory/Srsx,prints_GPCR_Rhodpsn		0.522	OR7D4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR7D4	protein_coding	OTTHUMT00000449004.1	G		rs148654687		9325401	-1	no_errors	ENST00000308682	ensembl	human	known	74_37	missense	SNP	0.586	A
VWF	7450	genome.wustl.edu	37	12	6143932	6143932	+	Silent	SNP	C	C	T			TCGA-RN-A68Q-01A-11D-A307-09	TCGA-RN-A68Q-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3c3787ae-7994-4448-a01f-347bcb22368c	61a568f9-beb4-45a9-92b9-30cf2001d4fe	g.chr12:6143932C>T	ENST00000261405.5	-	20	2861	c.2607G>A	c.(2605-2607)acG>acA	p.T869T		NM_000552.3	NP_000543	P04275	VWF_HUMAN	von Willebrand factor	869	VWFD 3. {ECO:0000255|PROSITE- ProRule:PRU00580}.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|extracellular matrix organization (GO:0030198)|hemostasis (GO:0007599)|liver development (GO:0001889)|placenta development (GO:0001890)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein homooligomerization (GO:0051260)|response to wounding (GO:0009611)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)|Weibel-Palade body (GO:0033093)	chaperone binding (GO:0051087)|collagen binding (GO:0005518)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|immunoglobulin binding (GO:0019865)|integrin binding (GO:0005178)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(41)|ovary(7)|pancreas(2)|prostate(6)|skin(15)|stomach(1)|upper_aerodigestive_tract(5)	129					Antihemophilic Factor(DB00025)	CCATGCCGATCGTGGAGCACG	0.582																																																	0								ENSG00000110799						186.0	147.0	160.0					12																	6143932		2203	4300	6503	VWF	SO:0001819	synonymous_variant	0			-	HGNC		CCDS8539.1	12p13.3	2014-09-17			ENSG00000110799	ENSG00000110799		"""Endogenous ligands"""	12726	protein-coding gene	gene with protein product		613160		F8VWF		2251280	Standard	NM_000552		Approved		uc001qnn.1	P04275	OTTHUMG00000168265	ENST00000261405.5:c.2607G>A	12.37:g.6143932C>T		Somatic	0	115	0.00		0.4355817787290055	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	45	171	20.83	Q8TCE8|Q99806	Silent	SNP	NA	NA	NA	NA	NA	NA	pirsf_VWF,pfam_VWF_type-D,pfam_VWF_A,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_VWF_C,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_VWF_A,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_A,pfscan_VWF_C	p.T869	ENST00000261405.5	37	c.2607	CCDS8539.1	12																																																																																			-	pirsf_VWF,pfam_VWF_type-D,smart_VWC_out,smart_VWF_C,smart_VWF_type-D		0.582	VWF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	VWF	protein_coding	OTTHUMT00000399020.1	C	NM_000552	-		6143932	-1	no_errors	ENST00000261405	ensembl	human	known	74_37	silent	SNP	0.000	T
HAUS3	79441	genome.wustl.edu	37	4	2241964	2241964	+	Missense_Mutation	SNP	T	T	C	rs368361238	byFrequency	TCGA-RN-A68Q-01A-11D-A307-09	TCGA-RN-A68Q-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3c3787ae-7994-4448-a01f-347bcb22368c	61a568f9-beb4-45a9-92b9-30cf2001d4fe	g.chr4:2241964T>C	ENST00000243706.4	-	2	939	c.710A>G	c.(709-711)aAt>aGt	p.N237S	POLN_ENST00000515357.1_Intron|POLN_ENST00000511885.2_Intron|HAUS3_ENST00000443786.2_Missense_Mutation_p.N237S|HAUS3_ENST00000506763.1_Missense_Mutation_p.N237S	NM_024511.5	NP_078787.2	Q68CZ6	HAUS3_HUMAN	HAUS augmin-like complex, subunit 3	237					centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|HAUS complex (GO:0070652)|microtubule (GO:0005874)				breast(3)|endometrium(1)|large_intestine(7)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	22						AAGTTGAAAATTGTCTTCATT	0.368													T|||	2	0.000399361	0.0015	0.0	5008	,	,		21564	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000214367	T	SER/ASN	1,4405	2.1+/-5.4	0,1,2202	61.0	60.0	60.0		710	5.3	1.0	4		60	0,8596		0,0,4298	no	missense	HAUS3	NM_024511.5	46	0,1,6500	CC,CT,TT		0.0,0.0227,0.0077	benign	237/604	2241964	1,13001	2203	4298	6501	HAUS3	SO:0001583	missense	0			-	HGNC	AF040964	CCDS33941.1	4p16.3	2013-10-11	2009-04-20	2009-04-20	ENSG00000214367	ENSG00000214367		"""HAUS augmin-like complex subunits"""	28719	protein-coding gene	gene with protein product		613430	"""chromosome 4 open reading frame 15"""	C4orf15		19427217, 19812674	Standard	NM_024511		Approved	MGC4701, IT1, dgt3	uc003ges.1	Q68CZ6		ENST00000243706.4:c.710A>G	4.37:g.2241964T>C	ENSP00000243706:p.Asn237Ser	Somatic	0	84	0.00		0.4355817787290055	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	123	16.33	B4DF64|O43606|Q8TAZ5|Q9BTJ9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.N237S	ENST00000243706.4	37	c.710	CCDS33941.1	4	.	.	.	.	.	.	.	.	.	.	T	12.54	1.969210	0.34754	2.27E-4	0.0	ENSG00000214367	ENST00000506763;ENST00000243706;ENST00000443786	T;T	0.39406	1.08;1.08	5.29	5.29	0.74685	.	0.203710	0.42964	U	0.000632	T	0.35970	0.0950	M	0.72118	2.19	0.29586	N	0.848777	P;P	0.35011	0.48;0.48	B;B	0.31495	0.131;0.131	T	0.36163	-0.9759	10	0.07175	T	0.84	-42.4448	10.7332	0.46109	0.0:0.0774:0.0:0.9226	.	237;237	B4DF64;Q68CZ6	.;HAUS3_HUMAN	S	237	ENSP00000243706:N237S;ENSP00000392903:N237S	ENSP00000243706:N237S	N	-	2	0	HAUS3	2211762	1.000000	0.71417	0.998000	0.56505	0.969000	0.65631	1.611000	0.36879	2.111000	0.64477	0.533000	0.62120	AAT	-	NULL		0.368	HAUS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HAUS3	protein_coding	OTTHUMT00000357446.1	T	NM_024511	-		2241964	-1	no_errors	ENST00000243706	ensembl	human	known	74_37	missense	SNP	1.000	C
GSN	2934	genome.wustl.edu	37	9	124074856	124074857	+	Intron	INS	-	-	A			TCGA-RN-A68Q-01A-11D-A307-09	TCGA-RN-A68Q-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3c3787ae-7994-4448-a01f-347bcb22368c	61a568f9-beb4-45a9-92b9-30cf2001d4fe	g.chr9:124074856_124074857insA	ENST00000373818.4	+	5	885				GSN_ENST00000545652.1_Intron|GSN_ENST00000449733.1_Intron|GSN_ENST00000373808.2_Intron|GSN_ENST00000373807.1_Intron|GSN_ENST00000436847.1_Intron|GSN_ENST00000412819.1_Intron|GSN_ENST00000394353.2_Intron|GSN_ENST00000341272.2_Intron|GSN_ENST00000485767.1_3'UTR|GSN_ENST00000373823.3_Intron	NM_000177.4|NM_001258029.1	NP_000168.1|NP_001244958.1	P06396	GELS_HUMAN	gelsolin						actin filament polymerization (GO:0030041)|actin filament severing (GO:0051014)|aging (GO:0007568)|apoptotic process (GO:0006915)|barbed-end actin filament capping (GO:0051016)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to cadmium ion (GO:0071276)|cilium morphogenesis (GO:0060271)|oligodendrocyte development (GO:0014003)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of cell adhesion (GO:0030155)|response to ethanol (GO:0045471)|response to folic acid (GO:0051593)|tissue regeneration (GO:0042246)|vesicle-mediated transport (GO:0016192)	actin cytoskeleton (GO:0015629)|blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)|ruffle (GO:0001726)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(1)|lung(8)|ovary(1)	21						TGAATTTGAGGAAAAAAAAAAA	0.426																																																	0								ENSG00000148180																																			GSN	SO:0001627	intron_variant	0				HGNC	X04412	CCDS6828.1, CCDS6829.1, CCDS48011.1, CCDS65118.1, CCDS75890.1, CCDS75891.1	9q33	2010-04-27	2010-04-27		ENSG00000148180	ENSG00000148180			4620	protein-coding gene	gene with protein product	"""amyloidosis, Finnish type"""	137350	"""gelsolin (amyloidosis, Finnish type)"""			1652889	Standard	NM_001127662		Approved	DKFZp313L0718	uc004blf.1	P06396	OTTHUMG00000020584	ENST00000373818.4:c.816+90->A	9.37:g.124074867_124074867dupA		Somatic	0	25	0.00		0.4355817787290055	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	32	11.11	A2A418|A8MUD1|A8MYN7|B7Z373|B7Z5V1|F5H1A8|Q5T0I2|Q8WVV7	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000373818.4	37	NULL	CCDS6828.1	9																																																																																			-	-		0.426	GSN-001	KNOWN	basic|CCDS	protein_coding	GSN	protein_coding	OTTHUMT00000053861.1	-	NM_000177			124074857	+1	no_errors	ENST00000485767	ensembl	human	known	74_37	rna	INS	0.003:0.000	A
IL1A	3552	genome.wustl.edu	37	2	113535602	113535602	+	Missense_Mutation	SNP	C	C	A	rs547288438	byFrequency	TCGA-RN-A68Q-01A-11D-A307-09	TCGA-RN-A68Q-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3c3787ae-7994-4448-a01f-347bcb22368c	61a568f9-beb4-45a9-92b9-30cf2001d4fe	g.chr2:113535602C>A	ENST00000263339.3	-	6	732	c.577G>T	c.(577-579)Gtg>Ttg	p.V193L		NM_000575.3	NP_000566.3	P01583	IL1A_HUMAN	interleukin 1, alpha	193					apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|cellular response to heat (GO:0034605)|cytokine-mediated signaling pathway (GO:0019221)|ectopic germ cell programmed cell death (GO:0035234)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|fever generation (GO:0001660)|immune response (GO:0006955)|inflammatory response (GO:0006954)|negative regulation of cell proliferation (GO:0008285)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell division (GO:0051781)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of mitosis (GO:0045840)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation vascular endothelial growth factor production (GO:0010575)|response to copper ion (GO:0046688)	cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	copper ion binding (GO:0005507)|cytokine activity (GO:0005125)			breast(2)|large_intestine(1)|lung(9)	12					Rilonacept(DB06372)	TGGGCAGTCACATACAATTGA	0.388																																																	0								ENSG00000115008						192.0	174.0	180.0					2																	113535602		2203	4300	6503	IL1A	SO:0001583	missense	0			-	HGNC	M28983	CCDS2101.1	2q14	2014-01-30			ENSG00000115008	ENSG00000115008		"""Interleukins and interleukin receptors"", ""Endogenous ligands"""	5991	protein-coding gene	gene with protein product	"""preinterleukin 1 alpha"", ""hematopoietin-1"", ""pro-interleukin-1-alpha"""	147760		IL1		8188271, 2989698	Standard	NM_000575		Approved	IL1F1, IL-1A, IL1-ALPHA	uc002tig.3	P01583	OTTHUMG00000131315	ENST00000263339.3:c.577G>T	2.37:g.113535602C>A	ENSP00000263339:p.Val193Leu	Somatic	0	52	0.00		0.4355817787290055	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	96	11.11	Q53QF9|Q7RU02	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_IL-1_propep,pfam_IL-1,superfamily_Cytokine_IL1-like,smart_IL-1,prints_IL-1_alpha,prints_IL-1_alpha/beta,prints_IL-1	p.V193L	ENST00000263339.3	37	c.577	CCDS2101.1	2	.	.	.	.	.	.	.	.	.	.	C	15.04	2.715957	0.48622	.	.	ENSG00000115008	ENST00000263339	T	0.09073	3.02	5.48	2.52	0.30459	.	0.132879	0.34460	N	0.003945	T	0.06142	0.0159	L	0.41079	1.255	0.09310	N	1	B	0.23058	0.079	B	0.28991	0.097	T	0.42783	-0.9431	10	0.02654	T	1	-17.9785	7.9375	0.29939	0.3259:0.5164:0.1577:0.0	.	193	P01583	IL1A_HUMAN	L	193	ENSP00000263339:V193L	ENSP00000263339:V193L	V	-	1	0	IL1A	113252073	0.731000	0.28111	0.220000	0.23810	0.514000	0.34195	0.352000	0.20113	0.781000	0.33589	0.655000	0.94253	GTG	-	pfam_IL-1,superfamily_Cytokine_IL1-like,smart_IL-1,prints_IL-1_alpha,prints_IL-1_alpha/beta,prints_IL-1		0.388	IL1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL1A	protein_coding	OTTHUMT00000254084.1	C	NM_000575	-		113535602	-1	no_errors	ENST00000263339	ensembl	human	known	74_37	missense	SNP	0.048	A
FAM157A	728262	genome.wustl.edu	37	3	197894586	197894586	+	lincRNA	SNP	G	G	A			TCGA-RN-A68Q-01A-11D-A307-09	TCGA-RN-A68Q-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3c3787ae-7994-4448-a01f-347bcb22368c	61a568f9-beb4-45a9-92b9-30cf2001d4fe	g.chr3:197894586G>A	ENST00000437428.2	+	0	747							C9JC47	F157A_HUMAN	family with sequence similarity 157, member A											NS(1)|skin(1)	2						CATCCGCCGAGAAACTGTGAG	0.517											OREG0016022	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000236438						10.0	10.0	10.0					3																	197894586		686	1549	2235	FAM157A			0			-	HGNC			3q29	2013-01-30			ENSG00000236438	ENSG00000236438			34079	other	unknown							Standard	NM_001145248		Approved		uc011bup.1	C9JC47			3.37:g.197894586G>A		Somatic	0	127	0.00	2094	0.4355817787290055	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	47	183	20.43		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000437428.2	37	NULL		3	.	.	.	.	.	.	.	.	.	.	.	3.487	-0.104627	0.06967	.	.	ENSG00000236438	ENST00000431569	.	.	.	0.467	-0.934	0.10428	.	.	.	.	.	T	0.16428	0.0395	N	0.08118	0	0.09310	N	1	P	0.37398	0.593	P	0.45577	0.486	T	0.16070	-1.0415	6	.	.	.	.	.	.	.	.	310	C9JC47	F157A_HUMAN	K	310	.	.	E	+	1	0	FAM157A	199378983	0.035000	0.19736	0.000000	0.03702	0.023000	0.10783	0.293000	0.19029	-1.392000	0.02082	-0.926000	0.02714	GAA	-	-		0.517	FAM157A-001	KNOWN	not_best_in_genome_evidence|mRNA_end_NF|basic	lincRNA	FAM157A	lincRNA	OTTHUMT00000340078.2	G	NM_001145248	-		197894586	+1	no_errors	ENST00000431569	ensembl	human	known	74_37	rna	SNP	0.000	A
LPPR3	79948	genome.wustl.edu	37	19	814640	814640	+	Intron	SNP	C	C	G			TCGA-RN-A68Q-01A-11D-A307-09	TCGA-RN-A68Q-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3c3787ae-7994-4448-a01f-347bcb22368c	61a568f9-beb4-45a9-92b9-30cf2001d4fe	g.chr19:814640C>G	ENST00000520876.3	-	7	736				LPPR3_ENST00000359894.2_Missense_Mutation_p.E237Q|MIR3187_ENST00000583431.1_RNA	NM_001270366.1	NP_001257295.1	Q6T4P5	LPPR3_HUMAN								integral component of membrane (GO:0016021)	phosphatidate phosphatase activity (GO:0008195)										AGGGAGGGCTCCCCACGGGTC	0.652																																																	0								ENSG00000129951						52.0	54.0	53.0					19																	814640		2196	4299	6495	LPPR3	SO:0001627	intron_variant	0			-	Uniprot_gn																												ENST00000520876.3:c.658-33G>C	19.37:g.814640C>G		Somatic	0	77	0.00		0.4355817787290055	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	138	15.76	Q86XQ4|Q96EH1|Q9BQF9|Q9HAJ4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_P_Acid_Pase_2/haloperoxidase,superfamily_P_Acid_Pase_2/haloperoxidase,smart_P_Acid_Pase_2/haloperoxidase	p.E237Q	ENST00000520876.3	37	c.709	CCDS58636.1	19	.	.	.	.	.	.	.	.	.	.	C	7.593	0.671074	0.14776	.	.	ENSG00000129951	ENST00000359894	T	0.22539	1.95	2.58	0.142	0.14816	.	15.374300	0.00424	U	0.000075	T	0.12050	0.0293	.	.	.	0.09310	N	0.999998	B	0.11235	0.004	B	0.06405	0.002	T	0.16778	-1.0391	8	.	.	.	.	3.5333	0.07785	0.0:0.5025:0.2083:0.2891	.	237	Q6T4P5-3	.	Q	237	ENSP00000352962:E237Q	.	E	-	1	0	AC006273.1	765640	0.000000	0.05858	0.001000	0.08648	0.021000	0.10359	-3.086000	0.00611	0.057000	0.16193	0.305000	0.20034	GAG	-	pfam_P_Acid_Pase_2/haloperoxidase,superfamily_P_Acid_Pase_2/haloperoxidase,smart_P_Acid_Pase_2/haloperoxidase		0.652	LPPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPPR3	protein_coding	OTTHUMT00000379096.3	C		-		814640	-1	no_errors	ENST00000359894	ensembl	human	known	74_37	missense	SNP	0.000	G
PRKAG2	51422	genome.wustl.edu	37	7	151504031	151504031	+	Intron	DEL	A	A	-			TCGA-RN-A68Q-01A-11D-A307-09	TCGA-RN-A68Q-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3c3787ae-7994-4448-a01f-347bcb22368c	61a568f9-beb4-45a9-92b9-30cf2001d4fe	g.chr7:151504031delA	ENST00000287878.4	-	2	619				PRKAG2_ENST00000392801.2_Intron|RP13-452N2.1_ENST00000462083.2_RNA	NM_016203.3	NP_057287.2	Q9UGJ0	AAKG2_HUMAN	protein kinase, AMP-activated, gamma 2 non-catalytic subunit						ATP biosynthetic process (GO:0006754)|carnitine shuttle (GO:0006853)|cell cycle arrest (GO:0007050)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|glycogen metabolic process (GO:0005977)|insulin receptor signaling pathway (GO:0008286)|intracellular signal transduction (GO:0035556)|membrane organization (GO:0061024)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein kinase activity (GO:0045860)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of fatty acid metabolic process (GO:0019217)|regulation of fatty acid oxidation (GO:0046320)|regulation of glucose import (GO:0046324)|regulation of glycolytic process (GO:0006110)|small molecule metabolic process (GO:0044281)|sterol biosynthetic process (GO:0016126)	AMP-activated protein kinase complex (GO:0031588)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleoplasm (GO:0005654)	ADP binding (GO:0043531)|AMP binding (GO:0016208)|ATP binding (GO:0005524)|cAMP-dependent protein kinase inhibitor activity (GO:0004862)|cAMP-dependent protein kinase regulator activity (GO:0008603)|phosphorylase kinase regulator activity (GO:0008607)|protein kinase activator activity (GO:0030295)|protein kinase binding (GO:0019901)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|upper_aerodigestive_tract(1)	26	all_neural(206;0.187)	all_hematologic(28;0.0605)	OV - Ovarian serous cystadenocarcinoma(82;0.00252)	UCEC - Uterine corpus endometrioid carcinoma (81;0.185)	Acetylsalicylic acid(DB00945)	cagcctgggGAAAAAAAAAAG	0.498																																																	0								ENSG00000242048																																			RP13-452N2.1	SO:0001627	intron_variant	0				Clone_based_vega_gene	AF087875	CCDS5928.1, CCDS43683.1, CCDS47752.1	7q35-q36	2014-09-17			ENSG00000106617	ENSG00000106617			9386	protein-coding gene	gene with protein product	"""AMPK gamma2"""	602743				8557660, 8621499	Standard	NM_024429		Approved	AAKG, AAKG2, H91620p, WPWS, CMH6	uc003wkk.3	Q9UGJ0	OTTHUMG00000157324	ENST00000287878.4:c.115-20404T>-	7.37:g.151504031delA		Somatic	0	24	0.00		0.4355817787290055	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	Q53Y07|Q6NUI0|Q75MP4|Q9NUZ9|Q9UDN8|Q9ULX8	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000287878.4	37	NULL	CCDS5928.1	7																																																																																			-	-		0.498	PRKAG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000242048	protein_coding	OTTHUMT00000348440.2	A	NM_016203			151504031	+1	no_errors	ENST00000462083	ensembl	human	known	74_37	rna	DEL	0.004	-
PTMA	5757	genome.wustl.edu	37	2	232577616	232577616	+	3'UTR	SNP	A	A	G			TCGA-RN-A68Q-01A-11D-A307-09	TCGA-RN-A68Q-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3c3787ae-7994-4448-a01f-347bcb22368c	61a568f9-beb4-45a9-92b9-30cf2001d4fe	g.chr2:232577616A>G	ENST00000341369.7	+	0	582				PTMA_ENST00000409321.1_3'UTR|PTMA_ENST00000466801.1_3'UTR|PTMA_ENST00000409115.3_3'UTR|PTMA_ENST00000409683.1_3'UTR	NM_001099285.1	NP_001092755.1	P06454	PTMA_HUMAN	prothymosin, alpha						transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)				lung(3)|ovary(1)|prostate(1)|skin(1)	6		Renal(207;0.0112)|all_hematologic(139;0.0315)|Acute lymphoblastic leukemia(138;0.0921)|all_lung(227;0.142)		Epithelial(121;1.75e-12)|BRCA - Breast invasive adenocarcinoma(100;0.00221)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.0139)		TGACCTATTCACCCTCCACTT	0.527																																																	0								ENSG00000187514						7.0	9.0	9.0					2																	232577616		687	1587	2274	PTMA	SO:0001624	3_prime_UTR_variant	0			-	HGNC		CCDS42833.1, CCDS46541.1	2q37.1	2008-07-04	2008-04-03		ENSG00000187514	ENSG00000187514			9623	protein-coding gene	gene with protein product	"""gene sequence 28"""	188390	"""prothymosin, alpha (gene sequence 28)"""	TMSA		1612591	Standard	NM_002823		Approved		uc002vsc.4	P06454	OTTHUMG00000153810	ENST00000341369.7:c.*55A>G	2.37:g.232577616A>G		Somatic	0	36	0.00		0.4355817787290055	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	61	9.86	Q15249|Q15592	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000341369.7	37	NULL	CCDS42833.1	2																																																																																			-	-		0.527	PTMA-002	KNOWN	basic|CCDS	protein_coding	PTMA	protein_coding	OTTHUMT00000332553.1	A		-		232577616	+1	no_errors	ENST00000466801	ensembl	human	known	74_37	rna	SNP	1.000	G
RPA3	6119	genome.wustl.edu	37	7	7712942	7712950	+	Intron	DEL	AGCAGCAGC	AGCAGCAGC	-	rs551829612|rs148595964|rs10527750|rs56962308	byFrequency	TCGA-RN-A68Q-01A-11D-A307-09	TCGA-RN-A68Q-10A-01D-A307-09	AGCAGCAGC	AGCAGCAGC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3c3787ae-7994-4448-a01f-347bcb22368c	61a568f9-beb4-45a9-92b9-30cf2001d4fe	g.chr7:7712942_7712950delAGCAGCAGC	ENST00000223129.4	-	4	415				RPA3-AS1_ENST00000469183.1_3'UTR	NM_002947.3	NP_002938.1	P35244	RFA3_HUMAN	replication protein A3, 14kDa						base-excision repair (GO:0006284)|DNA recombinase assembly (GO:0000730)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand elongation involved in DNA replication (GO:0006271)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|G1/S transition of mitotic cell cycle (GO:0000082)|mismatch repair (GO:0006298)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of cell proliferation (GO:0042127)|regulation of mitotic cell cycle (GO:0007346)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	DNA replication factor A complex (GO:0005662)|nucleoplasm (GO:0005654)	damaged DNA binding (GO:0003684)|single-stranded DNA binding (GO:0003697)			endometrium(1)|kidney(1)|large_intestine(1)|lung(3)	6		Ovarian(82;0.0607)		UCEC - Uterine corpus endometrioid carcinoma (126;0.202)		TATTTCAGGTagcagcagcagcagcagca	0.431								Direct reversal of damage;Nucleotide excision repair (NER)						3166	0.632188	0.5303	0.6527	5008	,	,		13954	0.7827		0.6272	False		,,,				2504	0.6053				Colon(148;376 1816 25359 26011 31717)												0								ENSG00000219545																																			RPA3-AS1	SO:0001627	intron_variant	0				HGNC		CCDS5356.1	7p21.3	2013-09-23	2002-08-29		ENSG00000106399	ENSG00000106399			10291	protein-coding gene	gene with protein product		179837	"""replication protein A3 (14kD)"""			8454588	Standard	NM_002947		Approved	REPA3	uc003sri.3	P35244	OTTHUMG00000023748	ENST00000223129.4:c.756+12510GCTGCTGCT>-	7.37:g.7712951_7712959delAGCAGCAGC		Somatic	NA	NA	NA		0.4355817787290055	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q549U6	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000223129.4	37	NULL	CCDS5356.1	7																																																																																			-	-		0.431	RPA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPA3-AS1	protein_coding	OTTHUMT00000324778.2	AGCAGCAGC	NM_002947			7712950	+1	no_errors	ENST00000463725	ensembl	human	known	74_37	rna	DEL	0.003:0.000:0.000:0.000:0.000:0.008:0.006:0.005:0.005	-
SFRP1	6422	genome.wustl.edu	37	8	41166638	41166640	+	In_Frame_Del	DEL	GCT	GCT	-	rs3055861|rs3832595	byFrequency	TCGA-RN-A68Q-01A-11D-A307-09	TCGA-RN-A68Q-10A-01D-A307-09	GCT	GCT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3c3787ae-7994-4448-a01f-347bcb22368c	61a568f9-beb4-45a9-92b9-30cf2001d4fe	g.chr8:41166638_41166640delGCT	ENST00000220772.3	-	1	376_378	c.39_41delAGC	c.(37-42)gcagcc>gcc	p.13_14AA>A	SFRP1_ENST00000379845.3_5'Flank	NM_003012.4	NP_003003.3	Q8N474	SFRP1_HUMAN	secreted frizzled-related protein 1	13				Missing (in Ref. 1 and 3). {ECO:0000305}.	bone trabecula formation (GO:0060346)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|cellular response to BMP stimulus (GO:0071773)|cellular response to estradiol stimulus (GO:0071392)|cellular response to estrogen stimulus (GO:0071391)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to growth factor stimulus (GO:0071363)|cellular response to heparin (GO:0071504)|cellular response to hypoxia (GO:0071456)|cellular response to interleukin-1 (GO:0071347)|cellular response to prostaglandin E stimulus (GO:0071380)|cellular response to starvation (GO:0009267)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cellular response to tumor necrosis factor (GO:0071356)|cellular response to vitamin D (GO:0071305)|cellular response to X-ray (GO:0071481)|convergent extension involved in somitogenesis (GO:0090246)|digestive tract morphogenesis (GO:0048546)|dorsal/ventral axis specification (GO:0009950)|female gonad development (GO:0008585)|gonad development (GO:0008406)|hematopoietic progenitor cell differentiation (GO:0002244)|hematopoietic stem cell differentiation (GO:0060218)|male gonad development (GO:0008584)|menstrual cycle phase (GO:0022601)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of apoptotic process (GO:0043066)|negative regulation of B cell differentiation (GO:0045578)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of bone remodeling (GO:0046851)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of canonical Wnt signaling pathway involved in controlling type B pancreatic cell proliferation (GO:2000080)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of gene expression (GO:0010629)|negative regulation of insulin secretion (GO:0046676)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of ossification (GO:0030279)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of osteoblast proliferation (GO:0033689)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|negative regulation of planar cell polarity pathway involved in axis elongation (GO:2000041)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|negative regulation of Wnt signaling pathway involved in dorsal/ventral axis specification (GO:2000054)|neural crest cell fate commitment (GO:0014034)|neural tube closure (GO:0001843)|osteoblast differentiation (GO:0001649)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of apoptotic process (GO:0043065)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of fibroblast apoptotic process (GO:2000271)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of non-canonical Wnt signaling pathway (GO:2000052)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis (GO:0060527)|proteolysis (GO:0006508)|regulation of angiogenesis (GO:0045765)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|regulation of cell cycle process (GO:0010564)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|somatic stem cell maintenance (GO:0035019)|stromal-epithelial cell signaling involved in prostate gland development (GO:0044345)|ureteric bud development (GO:0001657)|vasculature development (GO:0001944)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	cell surface (GO:0009986)|cytosol (GO:0005829)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	cysteine-type endopeptidase activity (GO:0004197)|drug binding (GO:0008144)|frizzled binding (GO:0005109)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(1)|central_nervous_system(1)|large_intestine(2)|liver(1)|lung(1)|skin(1)	7	Breast(1;9.19e-13)|Ovarian(28;0.00769)|Colorectal(14;0.0305)|Lung SC(25;0.211)	all_lung(54;0.0034)|Lung NSC(58;0.0134)|Hepatocellular(245;0.023)|Esophageal squamous(32;0.0559)	BRCA - Breast invasive adenocarcinoma(1;1.11e-10)|LUSC - Lung squamous cell carcinoma(45;0.00894)|COAD - Colon adenocarcinoma(11;0.0174)			CACGCCCAGGGCTGCCCCGCGGC	0.764														1558	0.311102	0.0401	0.389	5008	,	,		9448	0.4038		0.3956	False		,,,				2504	0.4397																0								ENSG00000104332			337,0,3741		45,0,247,0,0,1747						1.6	0.3		dbSNP_107	8	2693,2,5163		669,0,1355,0,2,1903	no	codingComplex	SFRP1	NM_003012.4		714,0,1602,0,2,3650	A1A1,A1A2,A1R,A2A2,A2R,RR		34.2963,8.2639,25.4021				3030,2,8904				SFRP1	SO:0001651	inframe_deletion	0				HGNC	AF017987	CCDS34886.1	8p11.21	2006-12-15			ENSG00000104332	ENSG00000104332		"""Secreted frizzled-related proteins"""	10776	protein-coding gene	gene with protein product		604156				9391078, 9192640	Standard	NM_003012		Approved	SARP2, FRP, FRP-1	uc003xnt.3	Q8N474	OTTHUMG00000164074	ENST00000220772.3:c.39_41delAGC	8.37:g.41166638_41166640delGCT	ENSP00000220772:p.Ala14del	Somatic	0	11	0.00		0.4355817787290055	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	18	28.00	O00546|O14779	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Frizzled_dom,pfam_Netrin_module_non-TIMP,superfamily_Frizzled_dom,superfamily_TIMP-like_OB-fold,smart_Frizzled_dom,smart_Netrin_module_non-TIMP,pfscan_Frizzled_dom,pfscan_Netrin_domain	p.A14in_frame_del	ENST00000220772.3	37	c.41_39	CCDS34886.1	8																																																																																			-	NULL		0.764	SFRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SFRP1	protein_coding	OTTHUMT00000377132.1	GCT	NM_003012			41166640	-1	no_errors	ENST00000220772	ensembl	human	known	74_37	in_frame_del	DEL	0.862:0.867:0.876	-
ABAT	18	genome.wustl.edu	37	16	8862051	8862051	+	Splice_Site	SNP	C	C	G			TCGA-RN-A68Q-01A-11D-A307-09	TCGA-RN-A68Q-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3c3787ae-7994-4448-a01f-347bcb22368c	61a568f9-beb4-45a9-92b9-30cf2001d4fe	g.chr16:8862051C>G	ENST00000396600.2	+	10	1543	c.605C>G	c.(604-606)gCc>gGc	p.A202G	ABAT_ENST00000567812.1_Splice_Site_p.A217G|ABAT_ENST00000268251.8_Splice_Site_p.A202G|ABAT_ENST00000425191.2_Splice_Site_p.A202G|ABAT_ENST00000569156.1_Splice_Site_p.A202G	NM_000663.4	NP_000654.2	P80404	GABT_HUMAN	4-aminobutyrate aminotransferase	202					behavioral response to cocaine (GO:0048148)|copulation (GO:0007620)|gamma-aminobutyric acid catabolic process (GO:0009450)|locomotory behavior (GO:0007626)|negative regulation of blood pressure (GO:0045776)|neurotransmitter catabolic process (GO:0042135)|neurotransmitter secretion (GO:0007269)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|response to iron ion (GO:0010039)|response to nicotine (GO:0035094)|synaptic transmission (GO:0007268)	4-aminobutyrate transaminase complex (GO:0032144)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)	(S)-3-amino-2-methylpropionate transaminase activity (GO:0047298)|4-aminobutyrate transaminase activity (GO:0003867)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)|succinate-semialdehyde dehydrogenase binding (GO:0032145)			breast(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(10)|skin(3)|upper_aerodigestive_tract(2)	26					L-Alanine(DB00160)|Phenelzine(DB00780)|Pyruvic acid(DB00119)|Valproic Acid(DB00313)|Vigabatrin(DB01080)	TGGTTTTAGGCCCCTGGCTGC	0.522																																																	0								ENSG00000183044						100.0	93.0	95.0					16																	8862051		2197	4300	6497	ABAT	SO:0001630	splice_region_variant	0			-	HGNC	L32961	CCDS10534.1	16p13.2	2011-01-10			ENSG00000183044	ENSG00000183044	2.6.1.19		23	protein-coding gene	gene with protein product	"""4-aminobutyrate transaminase"""	137150				7721088	Standard	NM_020686		Approved	GABAT	uc002czc.4	P80404	OTTHUMG00000048201	ENST00000396600.2:c.604-1C>G	16.37:g.8862051C>G		Somatic	0	70	0.00		0.4355817787290055	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	30	121	19.87	A8K386|Q16260|Q8N5W2|Q96BG2|Q99800	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Aminotrans_3,superfamily_PyrdxlP-dep_Trfase,tigrfam_4NH2But_aminotransferase_euk	p.A202G	ENST00000396600.2	37	c.605	CCDS10534.1	16	.	.	.	.	.	.	.	.	.	.	C	12.14	1.848145	0.32699	.	.	ENSG00000183044	ENST00000268251;ENST00000396600;ENST00000425191	T;T;T	0.76839	-1.05;-1.05;-1.05	5.61	3.41	0.39046	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.647844	0.17199	N	0.183210	T	0.69842	0.3156	L	0.56124	1.755	0.26815	N	0.968928	B	0.14438	0.01	B	0.20767	0.031	T	0.60682	-0.7215	10	0.41790	T	0.15	-8.754	6.416	0.21717	0.1404:0.6545:0.1278:0.0773	.	202	P80404	GABT_HUMAN	G	202	ENSP00000268251:A202G;ENSP00000379845:A202G;ENSP00000411916:A202G	ENSP00000268251:A202G	A	+	2	0	ABAT	8769552	1.000000	0.71417	1.000000	0.80357	0.597000	0.36814	2.235000	0.43044	1.339000	0.45563	0.555000	0.69702	GCC	-	pfam_Aminotrans_3,superfamily_PyrdxlP-dep_Trfase,tigrfam_4NH2But_aminotransferase_euk		0.522	ABAT-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ABAT	protein_coding	OTTHUMT00000433620.2	C	NM_020686	-	Missense_Mutation	8862051	+1	no_errors	ENST00000268251	ensembl	human	known	74_37	missense	SNP	0.989	G
C2orf27A	29798	genome.wustl.edu	37	2	132491337	132491337	+	Intron	SNP	A	A	G			TCGA-RN-A68Q-01A-11D-A307-09	TCGA-RN-A68Q-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3c3787ae-7994-4448-a01f-347bcb22368c	61a568f9-beb4-45a9-92b9-30cf2001d4fe	g.chr2:132491337A>G	ENST00000355171.4	+	1	274					NM_013310.3	NP_037442.3	Q580R0	CB027_HUMAN	chromosome 2 open reading frame 27A											kidney(1)	1						TTTTATGAATATTATAATTGC	0.308																																																	0								ENSG00000197927																																			C2orf27A	SO:0001627	intron_variant	0			-	HGNC	AF038169	CCDS2168.1	2q21.2	2010-05-11	2009-04-02	2009-04-02	ENSG00000197927	ENSG00000197927			25077	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 27"""	C2orf27		9110174, 8619474	Standard	NM_013310		Approved		uc002ttf.1	Q580R0	OTTHUMG00000131666	ENST00000355171.4:c.-248+11116A>G	2.37:g.132491337A>G		Somatic	0	42	0.00		0.4355817787290055	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	85	9.57	O43575|Q2M1X0|Q52M10|Q86XG2	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000355171.4	37	NULL	CCDS2168.1	2																																																																																			-	-		0.308	C2orf27A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C2orf27A	protein_coding	OTTHUMT00000254569.4	A	NM_013310	-		132491337	+1	no_errors	ENST00000463645	ensembl	human	putative	74_37	rna	SNP	0.101	G
GPT	2875	genome.wustl.edu	37	8	145730424	145730424	+	Silent	SNP	C	C	T			TCGA-RN-A68Q-01A-11D-A307-09	TCGA-RN-A68Q-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3c3787ae-7994-4448-a01f-347bcb22368c	61a568f9-beb4-45a9-92b9-30cf2001d4fe	g.chr8:145730424C>T	ENST00000528431.1	+	5	562	c.405C>T	c.(403-405)gaC>gaT	p.D135D	GPT_ENST00000394955.2_Silent_p.D135D			P24298	ALAT1_HUMAN	glutamic-pyruvate transaminase (alanine aminotransferase)	135					cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|L-alanine catabolic process (GO:0042853)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	L-alanine:2-oxoglutarate aminotransferase activity (GO:0004021)|pyridoxal phosphate binding (GO:0030170)			central_nervous_system(1)|endometrium(1)|lung(2)|ovary(1)	5	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)		L-Alanine(DB00160)|Phenelzine(DB00780)	TCCGGGAGGACGTGGCGCGGT	0.642																																																	0								ENSG00000167701						79.0	80.0	80.0					8																	145730424		2203	4300	6503	GPT	SO:0001819	synonymous_variant	0			-	HGNC		CCDS6430.1	8q24.3	2013-09-19			ENSG00000167701	ENSG00000167701	2.6.1.2		4552	protein-coding gene	gene with protein product		138200					Standard	NM_005309		Approved	ALT1, GPT1	uc003zdh.4	P24298	OTTHUMG00000165176	ENST00000528431.1:c.405C>T	8.37:g.145730424C>T		Somatic	0	63	0.00		0.4355817787290055	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	81	19.00	B0YJ18|D3DWM7|P78398|Q93076	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase	p.D135	ENST00000528431.1	37	c.405	CCDS6430.1	8																																																																																			-	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase		0.642	GPT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPT	protein_coding	OTTHUMT00000382471.1	C		-		145730424	+1	no_errors	ENST00000394955	ensembl	human	known	74_37	silent	SNP	0.985	T
LARP1	23367	genome.wustl.edu	37	5	154191148	154191148	+	Missense_Mutation	SNP	A	A	T			TCGA-RN-A68Q-01A-11D-A307-09	TCGA-RN-A68Q-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3c3787ae-7994-4448-a01f-347bcb22368c	61a568f9-beb4-45a9-92b9-30cf2001d4fe	g.chr5:154191148A>T	ENST00000336314.4	+	18	2822	c.2798A>T	c.(2797-2799)aAa>aTa	p.K933I		NM_015315.3	NP_056130.2	Q6PKG0	LARP1_HUMAN	La ribonucleoprotein domain family, member 1	1010					cell proliferation (GO:0008283)|positive regulation of macroautophagy (GO:0016239)|positive regulation of translation (GO:0045727)|TOR signaling (GO:0031929)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	eukaryotic initiation factor 4E binding (GO:0008190)|mRNA 3'-UTR binding (GO:0003730)|mRNA 5'-UTR binding (GO:0048027)|poly(A) RNA binding (GO:0044822)|RNA cap binding (GO:0000339)|translation activator activity (GO:0008494)|translation initiation factor binding (GO:0031369)			breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(9)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	33	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			ATTGACCCCAAACTGCAAGAA	0.443																																																	0								ENSG00000155506						97.0	99.0	99.0					5																	154191148		2203	4300	6503	LARP1	SO:0001583	missense	0			-	HGNC	AB018274	CCDS4328.1	5q33.2	2014-02-12			ENSG00000155506	ENSG00000155506		"""La ribonucleoprotein domain containing"""	29531	protein-coding gene	gene with protein product		612059				9872452, 10878606	Standard	NM_015315		Approved	LARP, KIAA0731, MGC19556	uc003lvo.4	Q6PKG0	OTTHUMG00000130191	ENST00000336314.4:c.2798A>T	5.37:g.154191148A>T	ENSP00000336721:p.Lys933Ile	Somatic	0	26	0.00		0.4355817787290055	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	29	23.68	O94836|Q8N4M2|Q8NB73|Q9UFD7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Lupus_La_RNA-bd,smart_Lupus_La_RNA-bd,smart_DM15,pfscan_Lupus_La_RNA-bd	p.K933I	ENST00000336314.4	37	c.2798	CCDS4328.1	5	.	.	.	.	.	.	.	.	.	.	A	18.64	3.667303	0.67814	.	.	ENSG00000155506	ENST00000336314	T	0.27890	1.64	5.89	5.89	0.94794	.	0.046337	0.85682	D	0.000000	T	0.40498	0.1119	M	0.85041	2.73	0.58432	D	0.999996	B;B	0.26041	0.086;0.14	B;B	0.27170	0.035;0.077	T	0.41070	-0.9529	10	0.66056	D	0.02	-13.2127	11.4016	0.49873	0.8652:0.0:0.0:0.1348	.	1010;933	Q6PKG0;Q6PKG0-3	LARP1_HUMAN;.	I	933	ENSP00000336721:K933I	ENSP00000336721:K933I	K	+	2	0	LARP1	154171341	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.264000	0.78432	2.254000	0.74563	0.459000	0.35465	AAA	-	NULL		0.443	LARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LARP1	protein_coding	OTTHUMT00000252509.1	A	NM_033551	-		154191148	+1	no_errors	ENST00000336314	ensembl	human	known	74_37	missense	SNP	1.000	T
NINL	22981	genome.wustl.edu	37	20	25443278	25443279	+	Intron	INS	-	-	TTTGTTTTGT	rs200513281|rs377227803|rs113237945		TCGA-RN-A68Q-01A-11D-A307-09	TCGA-RN-A68Q-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3c3787ae-7994-4448-a01f-347bcb22368c	61a568f9-beb4-45a9-92b9-30cf2001d4fe	g.chr20:25443278_25443279insTTTGTTTTGT	ENST00000278886.6	-	20	3497				NINL_ENST00000422516.1_Intron	NM_025176.4	NP_079452.3	Q9Y2I6	NINL_HUMAN	ninein-like						G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	cytosol (GO:0005829)|microtubule (GO:0005874)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(13)|lung(25)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	57						TTAAGTAGTCAtttgttttgtt	0.361																																																	0								ENSG00000101004																																			NINL	SO:0001627	intron_variant	0				HGNC		CCDS33452.1	20p11.22-p11.1	2013-01-10			ENSG00000101004	ENSG00000101004		"""EF-hand domain containing"""	29163	protein-coding gene	gene with protein product	"""ninein-like protein"""	609580				10231032	Standard	XM_005260678		Approved	KIAA0980, NLP	uc002wux.1	Q9Y2I6	OTTHUMG00000032127	ENST00000278886.6:c.3424-101->ACAAAACAAA	20.37:g.25443279_25443288dupTTTGTTTTGT		Somatic	NA	NA	NA		0.4355817787290055	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A6NJN0|B3V9H6|B7Z1V8|Q5JYP0|Q8NE38|Q9NQE3	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000278886.6	37	NULL	CCDS33452.1	20																																																																																			-	-		0.361	NINL-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NINL	protein_coding	OTTHUMT00000078445.3	-	NM_025176			25443279	-1	no_errors	ENST00000496509	ensembl	human	known	74_37	rna	INS	0.010:0.013	TTTGTTTTGT
WNK1	65125	genome.wustl.edu	37	12	970296	970297	+	Frame_Shift_Ins	INS	-	-	A			TCGA-RN-A68Q-01A-11D-A307-09	TCGA-RN-A68Q-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3c3787ae-7994-4448-a01f-347bcb22368c	61a568f9-beb4-45a9-92b9-30cf2001d4fe	g.chr12:970296_970297insA	ENST00000315939.6	+	7	2381_2382	c.1738_1739insA	c.(1738-1740)gaafs	p.E580fs	WNK1_ENST00000537687.1_Frame_Shift_Ins_p.E580fs|WNK1_ENST00000535572.1_Frame_Shift_Ins_p.E580fs|WNK1_ENST00000530271.2_Frame_Shift_Ins_p.E580fs|WNK1_ENST00000540360.1_3'UTR|WNK1_ENST00000340908.4_Frame_Shift_Ins_p.E173fs	NM_018979.3	NP_061852.3	Q9H4A3	WNK1_HUMAN	WNK lysine deficient protein kinase 1	580					intracellular signal transduction (GO:0035556)|ion transport (GO:0006811)|negative regulation of pancreatic juice secretion (GO:0090188)|negative regulation of phosphatase activity (GO:0010923)|neuron development (GO:0048666)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of systemic arterial blood pressure (GO:0003084)|protein phosphorylation (GO:0006468)|regulation of cellular process (GO:0050794)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|phosphatase binding (GO:0019902)|protein kinase inhibitor activity (GO:0004860)|protein serine/threonine kinase activity (GO:0004674)	p.?(1)		breast(7)|central_nervous_system(1)|endometrium(3)|kidney(6)|large_intestine(15)|lung(43)|ovary(6)|prostate(3)|skin(7)|stomach(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	104	all_cancers(10;0.00611)|all_epithelial(11;0.00825)|all_lung(10;0.0331)|Ovarian(42;0.0512)|Lung NSC(10;0.0632)		Epithelial(1;1.74e-08)|all cancers(1;7.04e-08)|OV - Ovarian serous cystadenocarcinoma(31;0.000423)|BRCA - Breast invasive adenocarcinoma(9;0.0149)|Colorectal(1;0.0197)			GGAGGAGCAAGAAAAAAAAAAG	0.47																																					Colon(19;451 567 6672 12618 28860)												1	Unknown(1)	skin(1)						ENSG00000060237																																			WNK1	SO:0001589	frameshift_variant	0				HGNC	AJ296290	CCDS8506.1, CCDS53731.1, CCDS73419.1	12p13.3	2014-09-17	2005-01-19	2005-01-21	ENSG00000060237	ENSG00000060237			14540	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 167"""	605232	"""protein kinase, lysine deficient 1"", ""hereditary sensory neuropathy, type II"""	PRKWNK1, HSN2			Standard	NM_001184985		Approved	HSAN2, PPP1R167	uc031qfk.1	Q9H4A3	OTTHUMG00000090321	ENST00000315939.6:c.1748dupA	12.37:g.970306_970306dupA	ENSP00000313059:p.Glu580fs	Somatic	0	45	0.00		0.4355817787290055	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	61	8.96	A1L4B0|C5HTZ5|C5HTZ6|C5HTZ7|H6WZW3|O15052|P54963|Q4VBX9|Q6IFS5|Q86WL5|Q8N673|Q96CZ6|Q9P1S9	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Kinase_OSR1/WNK_CCT,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.K584fs	ENST00000315939.6	37	c.1738_1739	CCDS8506.1	12																																																																																			-	NULL		0.470	WNK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WNK1	protein_coding	OTTHUMT00000206683.1	-	NM_018979			970297	+1	no_errors	ENST00000530271	ensembl	human	known	74_37	frame_shift_ins	INS	1.000:1.000	A
ZFR2	23217	genome.wustl.edu	37	19	3834851	3834851	+	Missense_Mutation	SNP	G	G	T			TCGA-RN-A68Q-01A-11D-A307-09	TCGA-RN-A68Q-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3c3787ae-7994-4448-a01f-347bcb22368c	61a568f9-beb4-45a9-92b9-30cf2001d4fe	g.chr19:3834851G>T	ENST00000262961.4	-	2	194	c.184C>A	c.(184-186)Ccc>Acc	p.P62T	ZFR2_ENST00000591965.1_5'UTR	NM_015174.1	NP_055989.1	Q9UPR6	ZFR2_HUMAN	zinc finger RNA binding protein 2	62							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(5)|pancreas(1)|prostate(1)|skin(1)	16				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00514)|STAD - Stomach adenocarcinoma(1328;0.19)		CCGGAGTGGGGCTGGTATCCA	0.657																																																	0								ENSG00000105278						20.0	25.0	23.0					19																	3834851		1962	4142	6104	ZFR2	SO:0001583	missense	0			-	HGNC	AB029009	CCDS45921.1, CCDS45922.1	19p13.3	2012-10-05	2008-03-25	2008-03-25	ENSG00000105278	ENSG00000105278			29189	protein-coding gene	gene with protein product			"""KIAA1086"""	KIAA1086		10470851	Standard	NM_015174		Approved		uc002lyw.2	Q9UPR6	OTTHUMG00000180918	ENST00000262961.4:c.184C>A	19.37:g.3834851G>T	ENSP00000262961:p.Pro62Thr	Somatic	0	89	0.00		0.4355817787290055	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	169	11.52		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DZF,smart_Znf_U1,smart_Znf_C2H2-like,smart_DZF	p.P62T	ENST00000262961.4	37	c.184	CCDS45921.1	19	.	.	.	.	.	.	.	.	.	.	G	7.981	0.751289	0.15778	.	.	ENSG00000105278	ENST00000262961;ENST00000438164	T;T	0.15139	3.24;2.45	3.39	2.25	0.28309	.	0.774714	0.11008	U	0.609817	T	0.08268	0.0206	L	0.34521	1.04	0.80722	D	1	P	0.39480	0.675	B	0.29176	0.099	T	0.20107	-1.0285	10	0.05351	T	0.99	-7.5765	7.6561	0.28375	0.0:0.2934:0.7066:0.0	.	62	Q9UPR6	ZFR2_HUMAN	T	62	ENSP00000262961:P62T;ENSP00000388974:P62T	ENSP00000262961:P62T	P	-	1	0	ZFR2	3785851	0.103000	0.21917	0.230000	0.23976	0.010000	0.07245	0.257000	0.18369	1.742000	0.51746	0.542000	0.68232	CCC	-	NULL		0.657	ZFR2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFR2	protein_coding	OTTHUMT00000453648.2	G	NM_015174	-		3834851	-1	no_errors	ENST00000262961	ensembl	human	known	74_37	missense	SNP	0.956	T
KRTAP12-1	353332	genome.wustl.edu	37	21	46101928	46101928	+	Silent	SNP	G	G	A			TCGA-RN-A68Q-01A-11D-A307-09	TCGA-RN-A68Q-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3c3787ae-7994-4448-a01f-347bcb22368c	61a568f9-beb4-45a9-92b9-30cf2001d4fe	g.chr21:46101928G>A	ENST00000391617.1	-	1	150	c.111C>T	c.(109-111)ccC>ccT	p.P37P	TSPEAR_ENST00000323084.4_Intron	NM_181686.1	NP_859014.1	P59990	KR121_HUMAN	keratin associated protein 12-1	37	14 X 5 AA approximate repeats.					keratin filament (GO:0045095)				kidney(1)|large_intestine(1)|lung(1)|skin(2)	5						TGAAGCTCACGGGCACGCACA	0.692																																																	0								ENSG00000187175						61.0	71.0	67.0					21																	46101928		2188	4274	6462	KRTAP12-1	SO:0001819	synonymous_variant	0			-	HGNC	AJ566388	CCDS42966.1	21q22.3	2006-03-13			ENSG00000187175	ENSG00000187175		"""Keratin associated proteins"""	20529	protein-coding gene	gene with protein product							Standard	NM_181686		Approved	KRTAP12.1, KAP12.1	uc002zfv.3	P59990	OTTHUMG00000057639	ENST00000391617.1:c.111C>T	21.37:g.46101928G>A		Somatic	0	115	0.00		0.4355817787290055	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	33	118	21.85	Q0VAS3	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.P37	ENST00000391617.1	37	c.111	CCDS42966.1	21																																																																																			-	NULL		0.692	KRTAP12-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP12-1	protein_coding	OTTHUMT00000128043.1	G	NM_181686	-		46101928	-1	no_errors	ENST00000391617	ensembl	human	known	74_37	silent	SNP	0.014	A
SOX10	6663	genome.wustl.edu	37	22	38374051	38374052	+	In_Frame_Ins	INS	-	-	GTACTT			TCGA-RN-A68Q-01A-11D-A307-09	TCGA-RN-A68Q-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3c3787ae-7994-4448-a01f-347bcb22368c	61a568f9-beb4-45a9-92b9-30cf2001d4fe	g.chr22:38374051_38374052insGTACTT	ENST00000396884.2	-	3	801_802	c.519_520insAAGTAC	c.(517-522)taccag>tacAAGTACcag	p.172_173insYK	SOX10_ENST00000470555.1_5'Flank|SOX10_ENST00000360880.2_In_Frame_Ins_p.172_173insYK|POLR2F_ENST00000405557.1_Intron|POLR2F_ENST00000407936.1_Intron	NM_006941.3	NP_008872.1	P56693	SOX10_HUMAN	SRY (sex determining region Y)-box 10	172					anatomical structure morphogenesis (GO:0009653)|cell maturation (GO:0048469)|developmental growth (GO:0048589)|digestive tract morphogenesis (GO:0048546)|enteric nervous system development (GO:0048484)|in utero embryonic development (GO:0001701)|melanocyte differentiation (GO:0030318)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of transcription, DNA-templated (GO:0045892)|neural crest cell migration (GO:0001755)|oligodendrocyte differentiation (GO:0048709)|peripheral nervous system development (GO:0007422)|positive regulation of gliogenesis (GO:0014015)|positive regulation of neuroblast proliferation (GO:0002052)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	extrinsic component of mitochondrial outer membrane (GO:0031315)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|identical protein binding (GO:0042802)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|transcription coactivator activity (GO:0003713)			NS(6)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(4)|skin(2)	20	Melanoma(58;0.045)					CGCCTGGGCTGGTACTTGTAGT	0.668																																					Melanoma(39;342 1098 6220 32775 40068)|GBM(21;140 497 5227 16059 19275)												0								ENSG00000100146																																			SOX10	SO:0001652	inframe_insertion	0				HGNC		CCDS13964.1	22q13.1	2014-09-17			ENSG00000100146	ENSG00000100146		"""SRY (sex determining region Y)-boxes"""	11190	protein-coding gene	gene with protein product	"""dominant megacolon, mouse, human homolog of"""	602229				9462749, 10441344, 12944398	Standard	NM_006941		Approved	DOM, WS4, WS2E	uc003aun.1	P56693	OTTHUMG00000149913	ENST00000396884.2:c.514_519dupAAGTAC	22.37:g.38374052_38374057dupGTACTT	ENSP00000380093:p.Tyr171_Lys172dup	Somatic	NA	NA	NA		0.4355817787290055	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B4DV62|Q6FHW7	In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_Sox_N,pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	p.173in_frame_insKY	ENST00000396884.2	37	c.520_519	CCDS13964.1	22																																																																																			-	superfamily_HMG_box_dom,smart_HMG_box_dom		0.668	SOX10-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SOX10	protein_coding	OTTHUMT00000313875.1	-	NM_006941			38374052	-1	no_errors	ENST00000360880	ensembl	human	known	74_37	in_frame_ins	INS	1.000:1.000	GTACTT
ATP8B3	148229	genome.wustl.edu	37	19	1799763	1799764	+	Intron	INS	-	-	A			TCGA-RN-A68Q-01A-11D-A307-09	TCGA-RN-A68Q-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3c3787ae-7994-4448-a01f-347bcb22368c	61a568f9-beb4-45a9-92b9-30cf2001d4fe	g.chr19:1799763_1799764insA	ENST00000310127.6	-	14	1791				ATP8B3_ENST00000526092.2_Frame_Shift_Ins_p.E526fs|ATP8B3_ENST00000539485.1_Intron|ATP8B3_ENST00000525591.1_Intron	NM_138813.3	NP_620168.1	O60423	AT8B3_HUMAN	ATPase, aminophospholipid transporter, class I, type 8B, member 3						binding of sperm to zona pellucida (GO:0007339)	acrosomal vesicle (GO:0001669)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(9)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	23		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		gactctgcctcaaaaaaaaaaa	0.545																																																	0								ENSG00000130270																																			ATP8B3	SO:0001627	intron_variant	0				HGNC	AA827939	CCDS45901.1, CCDS54196.1	19p13.3	2010-04-28	2010-04-28		ENSG00000130270	ENSG00000130270		"""ATPases / P-type"""	13535	protein-coding gene	gene with protein product	"""aminophospholipid translocase ATP8B3"", ""potential phospholipid-transporting ATPase IK"""	605866	"""ATPase, Class I, type 8B, member 3"", ""ATPase, class I, type 8B, member 3"""			11015572	Standard	NM_138813		Approved	ATPIK	uc002ltw.4	O60423	OTTHUMG00000166189	ENST00000310127.6:c.1552+181->T	19.37:g.1799774_1799774dupA		Somatic	0	13	0.00		0.4355817787290055	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	28	17.65	Q7Z485|Q8IVB8|Q8N4Y8|Q96M22	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_ATPase_P-typ_transduc_dom_A,superfamily_HAD-like_dom	p.E525fs	ENST00000310127.6	37	c.1576_1575	CCDS45901.1	19																																																																																			-	NULL		0.545	ATP8B3-002	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	ATP8B3	protein_coding	OTTHUMT00000388279.1	-	NM_138813			1799764	-1	no_errors	ENST00000526092	ensembl	human	putative	74_37	frame_shift_ins	INS	0.003:0.016	A
OLFM2	93145	genome.wustl.edu	37	19	9965243	9965243	+	Silent	SNP	G	G	A	rs200166801		TCGA-RN-A68Q-01A-11D-A307-09	TCGA-RN-A68Q-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3c3787ae-7994-4448-a01f-347bcb22368c	61a568f9-beb4-45a9-92b9-30cf2001d4fe	g.chr19:9965243G>A	ENST00000264833.4	-	6	1169	c.984C>T	c.(982-984)gaC>gaT	p.D328D	OLFM2_ENST00000590841.1_Silent_p.D250D	NM_058164.2	NP_477512.1	O95897	NOE2_HUMAN	olfactomedin 2	328	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				protein secretion (GO:0009306)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|extracellular region (GO:0005576)|synapse (GO:0045202)				breast(1)|cervix(1)|endometrium(3)|large_intestine(8)|lung(9)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)	31						GCCCGCTCTCGTCCACCATGA	0.657																																																	0								ENSG00000105088	G		0,4406		0,0,2203	61.0	59.0	60.0		984	2.4	1.0	19		60	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	OLFM2	NM_058164.2		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		328/455	9965243	1,13005	2203	4300	6503	OLFM2	SO:0001819	synonymous_variant	0			-	HGNC	AF131839	CCDS12221.1	19p13.2	2008-07-03				ENSG00000105088			17189	protein-coding gene	gene with protein product	"""noelin 2"""						Standard	NM_058164		Approved	OlfC, NOE2	uc002mmp.3	O95897		ENST00000264833.4:c.984C>T	19.37:g.9965243G>A		Somatic	0	64	0.00		0.4355817787290055	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	53	28.38	Q6IMJ3|Q96FC2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Olfac-like,pfam_Noelin-1,superfamily_Quinonprotein_ADH-like_supfam,smart_Olfac-like,pfscan_Olfac-like	p.D328	ENST00000264833.4	37	c.984	CCDS12221.1	19																																																																																			-	pfam_Olfac-like,superfamily_Quinonprotein_ADH-like_supfam,smart_Olfac-like,pfscan_Olfac-like		0.657	OLFM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OLFM2	protein_coding	OTTHUMT00000451119.1	G		rs200166801		9965243	-1	no_errors	ENST00000264833	ensembl	human	known	74_37	silent	SNP	1.000	A
RP11-284N8.3	0	genome.wustl.edu	37	1	111195567	111195580	+	lincRNA	DEL	TGTGTGTGTGTGTG	TGTGTGTGTGTGTG	-	rs35174060|rs146753647|rs546628713|rs9308236		TCGA-RN-A68Q-01A-11D-A307-09	TCGA-RN-A68Q-10A-01D-A307-09	TGTGTGTGTGTGTG	TGTGTGTGTGTGTG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3c3787ae-7994-4448-a01f-347bcb22368c	61a568f9-beb4-45a9-92b9-30cf2001d4fe	g.chr1:111195567_111195580delTGTGTGTGTGTGTG	ENST00000566942.1	-	0	6962				AL365361.1_ENST00000408611.1_RNA																							CTTGGGAATAtgtgtgtgtgtgtgtgtgtgtgtg	0.355																																																	0								ENSG00000221538																																			AL365361.1			0				Clone_based_ensembl_gene																													1.37:g.111195567_111195580delTGTGTGTGTGTGTG		Somatic	NA	NA	NA		0.4355817787290055	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000566942.1	37	NULL		1																																																																																			-	-		0.355	RP11-284N8.3-001	KNOWN	basic	lincRNA	ENSG00000221538	lincRNA	OTTHUMT00000431321.1	TGTGTGTGTGTGTG				111195580	-1	no_errors	ENST00000408611	ensembl	human	novel	74_37	rna	DEL	0.005:0.004:0.004:0.002:0.002:0.000:0.000:0.000:0.001:0.000:0.002:0.002:0.002:0.000	-
PRKDC	5591	genome.wustl.edu	37	8	48802690	48802691	+	Intron	INS	-	-	ATAATA	rs36103307|rs370814055|rs66656526	byFrequency	TCGA-RN-A68Q-01A-11D-A307-09	TCGA-RN-A68Q-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3c3787ae-7994-4448-a01f-347bcb22368c	61a568f9-beb4-45a9-92b9-30cf2001d4fe	g.chr8:48802690_48802691insATAATA	ENST00000523565.1	-	32	4127				AC103686.1_ENST00000390136.2_RNA|PRKDC_ENST00000314191.2_Intron|PRKDC_ENST00000338368.3_Intron			P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic polypeptide						B cell lineage commitment (GO:0002326)|brain development (GO:0007420)|cellular protein modification process (GO:0006464)|cellular response to insulin stimulus (GO:0032869)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|ectopic germ cell programmed cell death (GO:0035234)|heart development (GO:0007507)|immunoglobulin V(D)J recombination (GO:0033152)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of protein phosphorylation (GO:0001933)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|pro-B cell differentiation (GO:0002328)|protein destabilization (GO:0031648)|regulation of circadian rhythm (GO:0042752)|response to gamma radiation (GO:0010332)|rhythmic process (GO:0048511)|signal transduction involved in mitotic G1 DNA damage checkpoint (GO:0072431)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell receptor V(D)J recombination (GO:0033153)|telomere maintenance (GO:0000723)	cytosol (GO:0005829)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription factor binding (GO:0008134)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(9)|cervix(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(30)|lung(56)|ovary(6)|pancreas(1)|prostate(8)|skin(7)	147		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)			Caffeine(DB00201)	GAGGATGAAATataataataat	0.307								Non-homologous end-joining																													Esophageal Squamous(79;1091 1253 12329 31680 40677)												0								ENSG00000211562																																			AC103686.1	SO:0001627	intron_variant	0				Clone_based_ensembl_gene		CCDS75734.1, CCDS75735.1	8q11	2014-09-17				ENSG00000253729	2.7.11.1		9413	protein-coding gene	gene with protein product		600899		HYRC, HYRC1		7638222	Standard	NM_001081640		Approved	DNPK1, p350, DNAPK, XRCC7, DNA-PKcs	uc003xqi.3	P78527		ENST00000523565.1:c.9381+126->TATTAT	8.37:g.48802691_48802696dupATAATA		Somatic	NA	NA	NA		0.4355817787290055	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	P78528|Q13327|Q13337|Q14175|Q59H99|Q7Z611|Q96SE6|Q9UME3	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000523565.1	37	NULL		8																																																																																			-	-		0.307	PRKDC-002	KNOWN	basic	processed_transcript	ENSG00000211562	protein_coding	OTTHUMT00000377896.1	-	NM_001081640			48802691	+1	no_errors	ENST00000390136	ensembl	human	novel	74_37	rna	INS	0.000:0.002	ATAATA
MYO7A	4647	genome.wustl.edu	37	11	76895771	76895792	+	Intron	DEL	GGAGGCGGGGACACCAGGGCCT	GGAGGCGGGGACACCAGGGCCT	-	rs111906251|rs143953991|rs78509218|rs111033223|rs369969967|rs12291062	byFrequency	TCGA-RN-A68Q-01A-11D-A307-09	TCGA-RN-A68Q-10A-01D-A307-09	GGAGGCGGGGACACCAGGGCCT	GGAGGCGGGGACACCAGGGCCT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3c3787ae-7994-4448-a01f-347bcb22368c	61a568f9-beb4-45a9-92b9-30cf2001d4fe	g.chr11:76895771_76895792delGGAGGCGGGGACACCAGGGCCT	ENST00000409709.3	+	27	3775				MYO7A_ENST00000409619.2_Intron|MYO7A_ENST00000458637.2_Intron|MYO7A_ENST00000409893.1_Stop_Codon_Del	NM_000260.3	NP_000251.3	Q13402	MYO7A_HUMAN	myosin VIIA						actin filament-based movement (GO:0030048)|auditory receptor cell stereocilium organization (GO:0060088)|equilibrioception (GO:0050957)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|lysosome organization (GO:0007040)|metabolic process (GO:0008152)|phagolysosome assembly (GO:0001845)|pigment granule transport (GO:0051904)|post-embryonic organ morphogenesis (GO:0048563)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|melanosome (GO:0042470)|myosin VII complex (GO:0031477)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|stereocilium (GO:0032420)|synapse (GO:0045202)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|spectrin binding (GO:0030507)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						GTCAGTGCCGGGAGGCGGGGACACCAGGGCCTGAAAGTCTTT	0.599														2033	0.40595	0.466	0.4712	5008	,	,		20094	0.3194		0.4901	False		,,,				2504	0.2812																0								ENSG00000137474		,,	1379,2453		340,699,877					,,	-8.4	0.0		dbSNP_126	18	3099,4701		776,1547,1577	no	intron,frameshift,intron	MYO7A	NM_001127180.1,NM_001127179.2,NM_000260.3	,,	1116,2246,2454	A1A1,A1R,RR		39.7308,35.9864,38.4972	,,	,,		4478,7154				MYO7A	SO:0001627	intron_variant	0				HGNC	U39226	CCDS53683.1, CCDS53684.1, CCDS53685.1	11q13.5	2013-01-08	2005-09-12		ENSG00000137474	ENSG00000137474		"""A-kinase anchor proteins"", ""Myosins / Myosin superfamily : Class VII"""	7606	protein-coding gene	gene with protein product		276903	"""myosin VIIA (Usher syndrome 1B (autosomal recessive, severe))"""	USH1B, DFNB2, DFNA11		8884266	Standard	NM_000260		Approved	NSRD2	uc001oyb.2	Q13402	OTTHUMG00000152822	ENST00000409709.3:c.3503+11GGAGGCGGGGACACCAGGGCCT>-	11.37:g.76895771_76895792delGGAGGCGGGGACACCAGGGCCT		Somatic	NA	NA	NA		0.4355817787290055	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B9A011|F8VUN5|P78427|Q13321|Q14785|Q92821|Q92822	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Myosin_head_motor_dom,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,smart_MyTH4_dom,prints_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,pfscan_MyTH4_dom	p.G1172fs	ENST00000409709.3	37	c.3514_3535	CCDS53683.1	11																																																																																			-	smart_MyTH4_dom,pfscan_MyTH4_dom		0.599	MYO7A-001	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	MYO7A	protein_coding	OTTHUMT00000328133.1	GGAGGCGGGGACACCAGGGCCT	NM_000260			76895792	+1	no_errors	ENST00000409893	ensembl	human	putative	74_37	frame_shift_del	DEL	0.000:0.000:0.001:0.001:0.004:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.011:0.011:0.009:0.051:0.048:0.007	-
RBBP6	5930	genome.wustl.edu	37	16	24564880	24564881	+	Splice_Site	DEL	TA	TA	-	rs561766741|rs530815225|rs534393118|rs72133882	byFrequency	TCGA-RN-A68Q-01A-11D-A307-09	TCGA-RN-A68Q-10A-01D-A307-09	TA	TA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3c3787ae-7994-4448-a01f-347bcb22368c	61a568f9-beb4-45a9-92b9-30cf2001d4fe	g.chr16:24564880_24564881delTA	ENST00000319715.4	+	4	780		c.e4+2		RBBP6_ENST00000348022.2_Splice_Site|RBBP6_ENST00000381039.3_Splice_Site	NM_006910.4	NP_008841.2	Q7Z6E9	RBBP6_HUMAN	retinoblastoma binding protein 6						embryonic organ development (GO:0048568)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|somite development (GO:0061053)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.?(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(17)|ovary(4)|pancreas(1)|prostate(2)|urinary_tract(1)	46				GBM - Glioblastoma multiforme(48;0.0518)		CTTACAAAGGTATATATATATA	0.312																																																	1	Unknown(1)	central_nervous_system(1)						ENSG00000122257																																			RBBP6	SO:0001630	splice_region_variant	0				HGNC		CCDS10621.1, CCDS10622.1, CCDS45444.1	16p12.2	2008-08-04	2001-11-28		ENSG00000122257	ENSG00000122257			9889	protein-coding gene	gene with protein product	"""proliferation potential-related protein"""	600938	"""retinoblastoma-binding protein 6"""			8595913, 16396680	Standard	NM_006910		Approved	P2P-R, PACT, SNAMA	uc002dmh.3	Q7Z6E9	OTTHUMG00000096991	ENST00000319715.4:c.348+2TA>-	16.37:g.24564890_24564891delTA		Somatic	0	36	0.00		0.4355817787290055	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	64	13.51	Q147T5|Q15290|Q6DKH4|Q6P4C2|Q6YNC9|Q7Z6E8|Q8N0V2|Q96PH3|Q9H3I8|Q9H5M5|Q9NPX4	Splice_Site	DEL	NA	NA	NA	NA	NA	NA	-	e4+2	ENST00000319715.4	37	c.348+2_348+1	CCDS10621.1	16																																																																																			-	-		0.312	RBBP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBBP6	protein_coding	OTTHUMT00000214067.2	TA	NM_006910		Intron	24564881	+1	no_errors	ENST00000319715	ensembl	human	known	74_37	splice_site_del	DEL	1.000:1.000	-
