#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
DHX38	9785	genome.wustl.edu	37	16	72135400	72135400	+	Splice_Site	SNP	C	C	A			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr16:72135400C>A	ENST00000268482.3	+	11	1897	c.1388C>A	c.(1387-1389)gCt>gAt	p.A463D	DHX38_ENST00000536867.1_Intron	NM_014003.3	NP_054722.2	Q92620	PRP16_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 38	463					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			endometrium(5)|kidney(1)|large_intestine(16)|lung(15)|pancreas(1)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	48		Ovarian(137;0.125)				CCTTTTCAGGCTCAGCACAAA	0.532																																					Melanoma(97;711 1442 7855 13832 28836)												0								ENSG00000140829						58.0	42.0	48.0					16																	72135400		2100	4096	6196	DHX38	SO:0001630	splice_region_variant	0			-	HGNC	AF038391	CCDS10907.1	16q22	2008-02-05	2003-06-13	2003-06-20	ENSG00000140829	ENSG00000140829		"""DEAH-boxes"""	17211	protein-coding gene	gene with protein product		605584	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 38"""	DDX38		9524131, 9039502	Standard	NM_014003		Approved	PRP16, KIAA0224, hPrp16, PRPF16	uc002fcb.3	Q92620	OTTHUMG00000137596	ENST00000268482.3:c.1387-1C>A	16.37:g.72135400C>A		Somatic	0	51	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.16	B4DVG8|D3DWS7|O75212|Q96HN7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Helicase-assoc_dom,pfam_DUF1605,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Helicase-assoc_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.A463D	ENST00000268482.3	37	c.1388	CCDS10907.1	16	.	.	.	.	.	.	.	.	.	.	C	16.91	3.253513	0.59212	.	.	ENSG00000140829	ENST00000268482	T	0.43294	0.95	5.06	4.1	0.47936	.	0.058236	0.64402	N	0.000002	T	0.44159	0.1280	M	0.78801	2.425	0.80722	D	1	B	0.25351	0.124	B	0.24269	0.052	T	0.37641	-0.9697	10	0.17832	T	0.49	.	14.8731	0.70474	0.1445:0.8555:0.0:0.0	.	463	Q92620	PRP16_HUMAN	D	463	ENSP00000268482:A463D	ENSP00000268482:A463D	A	+	2	0	DHX38	70692901	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.226000	0.78060	1.114000	0.41781	0.655000	0.94253	GCT	-	NULL		0.532	DHX38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHX38	protein_coding	OTTHUMT00000269004.3	C	NM_014003	-	Missense_Mutation	72135400	+1	no_errors	ENST00000268482	ensembl	human	known	74_37	missense	SNP	1.000	A
NOS2P1	645740	genome.wustl.edu	37	17	25988693	25988702	+	lincRNA	DEL	CACAGGTGGC	CACAGGTGGC	-	rs147959873|rs200074028|rs3217511	byFrequency	TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	CACAGGTGGC	CACAGGTGGC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr17:25988693_25988702delCACAGGTGGC	ENST00000583179.1	-	0	1982_1991																											GATGTAAAAGCACAGGTGGCCACAGGTTAC	0.5														1161	0.231829	0.1165	0.3098	5008	,	,		20228	0.2738		0.2435	False		,,,				2504	0.2771																0								ENSG00000265788																																			RP11-19P22.5			0				Clone_based_vega_gene																													17.37:g.25988693_25988702delCACAGGTGGC		Somatic	NA	NA	NA		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000583179.1	37	NULL		17																																																																																			-	-		0.500	RP11-19P22.5-001	KNOWN	basic	lincRNA	ENSG00000265788	lincRNA	OTTHUMT00000445273.1	CACAGGTGGC				25988702	-1	no_errors	ENST00000583179	ensembl	human	known	74_37	rna	DEL	0.001:0.006:0.055:0.065:0.094:0.091:0.069:0.077:0.073:0.052	-
DGCR5	26220	genome.wustl.edu	37	22	18981968	18981968	+	RNA	SNP	C	C	T			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr22:18981968C>T	ENST00000438934.1	+	0	5319				DGCR5_ENST00000440005.2_RNA|DGCR5_ENST00000537283.1_RNA					DiGeorge syndrome critical region gene 5 (non-protein coding)																		GCCAGTGCAGCCACACGGCCA	0.627																																																	0								ENSG00000237517																																			DGCR5			0			-	HGNC	X91348		22q11	2012-10-16	2008-08-13		ENSG00000237517	ENSG00000237517		"""Long non-coding RNAs"""	16757	non-coding RNA	RNA, long non-coding	"""non-protein coding RNA 37"", ""long intergenic non-protein coding RNA 37"""					8659529	Standard	NR_002733		Approved	NCRNA00037, LINC00037	uc021wku.1		OTTHUMG00000149977		22.37:g.18981968C>T		Somatic	0	39	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	30	11.76		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000438934.1	37	NULL		22																																																																																			-	-		0.627	DGCR5-002	KNOWN	basic	antisense	DGCR5	antisense	OTTHUMT00000314912.1	C	NR_002733	-		18981968	+1	no_errors	ENST00000438934	ensembl	human	known	74_37	rna	SNP	0.998	T
LINC01378	103689918	genome.wustl.edu	37	4	118496711	118496711	+	lincRNA	SNP	T	T	A			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr4:118496711T>A	ENST00000422145.3	+	0	159				NT5C3AP1_ENST00000441170.1_RNA																							AAATTCTTCATATCTTTCTTT	0.378																																																	0								ENSG00000213492																																			NT5C3AP1			0			-	HGNC																													4.37:g.118496711T>A		Somatic	0	57	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	31	34.04		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000422145.3	37	NULL		4																																																																																			-	-		0.378	AC092661.1-002	KNOWN	basic	lincRNA	NT5C3AP1	lincRNA	OTTHUMT00000291362.3	T		-		118496711	-1	no_errors	ENST00000441170	ensembl	human	known	74_37	rna	SNP	0.925	A
MXRA5	25878	genome.wustl.edu	37	X	3241893	3241893	+	Missense_Mutation	SNP	C	C	A			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chrX:3241893C>A	ENST00000217939.6	-	5	1987	c.1833G>T	c.(1831-1833)tgG>tgT	p.W611C		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	611	Ig-like C2-type 2.					extracellular vesicular exosome (GO:0070062)				NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				TTGGAAGAATCCAGCTAAGGT	0.458																																																	0								ENSG00000101825						83.0	72.0	76.0					X																	3241893		2203	4300	6503	MXRA5	SO:0001583	missense	0			-	HGNC	AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.1833G>T	X.37:g.3241893C>A	ENSP00000217939:p.Trp611Cys	Somatic	0	35	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	35	10.26	Q6P1M7|Q9Y3Y8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.W611C	ENST00000217939.6	37	c.1833	CCDS14124.1	X	.	.	.	.	.	.	.	.	.	.	C	14.51	2.557994	0.45590	.	.	ENSG00000101825	ENST00000381114;ENST00000217939	T	0.54675	0.56	3.95	3.95	0.45737	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.38058	U	0.001838	T	0.80894	0.4711	H	0.96301	3.8	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.88041	0.2781	10	0.87932	D	0	.	15.7074	0.77594	0.0:1.0:0.0:0.0	.	611	Q9NR99	MXRA5_HUMAN	C	611	ENSP00000217939:W611C	ENSP00000217939:W611C	W	-	3	0	MXRA5	3251893	1.000000	0.71417	0.181000	0.23098	0.328000	0.28507	6.358000	0.73055	1.597000	0.50072	0.525000	0.51046	TGG	-	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.458	MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MXRA5	protein_coding	OTTHUMT00000055655.2	C	NM_015419	-		3241893	-1	no_errors	ENST00000217939	ensembl	human	known	74_37	missense	SNP	1.000	A
SF3A3	10946	genome.wustl.edu	37	1	38442606	38442606	+	Missense_Mutation	SNP	C	C	T			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr1:38442606C>T	ENST00000373019.4	-	12	1910	c.955G>A	c.(955-957)Gac>Aac	p.D319N	SF3A3_ENST00000448721.2_Missense_Mutation_p.D266N|SF3A3_ENST00000489537.1_5'Flank	NM_006802.2	NP_006793.1	Q12874	SF3A3_HUMAN	splicing factor 3a, subunit 3, 60kDa	319					gene expression (GO:0010467)|mRNA 3'-splice site recognition (GO:0000389)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(3)|large_intestine(1)|liver(1)|lung(3)|prostate(2)	12	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				AAAGCAATGTCTTTGTTCCTT	0.388																																																	0								ENSG00000183431						142.0	144.0	143.0					1																	38442606		2202	4300	6502	SF3A3	SO:0001583	missense	0			-	HGNC	U08815	CCDS428.1	1p34.3	2012-06-07	2002-08-29		ENSG00000183431	ENSG00000183431			10767	protein-coding gene	gene with protein product		605596	"""splicing factor 3a, subunit 3, 60kD"""			7816610, 8022796	Standard	NM_006802		Approved	SF3a60, SAP61, PRP9, PRPF9	uc001cci.3	Q12874	OTTHUMG00000004438	ENST00000373019.4:c.955G>A	1.37:g.38442606C>T	ENSP00000362110:p.Asp319Asn	Somatic	0	65	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	31	41	43.06	D3DPT5|Q15460|Q5VT87	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF3449,pfam_SF3a60_bindingd,pfscan_Znf_C2H2_matrin	p.D319N	ENST00000373019.4	37	c.955	CCDS428.1	1	.	.	.	.	.	.	.	.	.	.	C	19.67	3.871834	0.72180	.	.	ENSG00000183431	ENST00000373019;ENST00000448721	.	.	.	5.69	4.78	0.61160	.	0.142736	0.64402	D	0.000007	T	0.51924	0.1703	L	0.39898	1.24	0.49130	D	0.999752	B;B	0.24258	0.014;0.1	B;B	0.15870	0.004;0.014	T	0.46512	-0.9186	9	0.28530	T	0.3	-21.6152	14.1002	0.65049	0.0:0.9273:0.0:0.0727	.	266;319	E7EUT8;Q12874	.;SF3A3_HUMAN	N	319;266	.	ENSP00000362110:D319N	D	-	1	0	SF3A3	38215193	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.403000	0.79983	1.426000	0.47256	0.585000	0.79938	GAC	-	NULL		0.388	SF3A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SF3A3	protein_coding	OTTHUMT00000012976.1	C	NM_006802	-		38442606	-1	no_errors	ENST00000373019	ensembl	human	known	74_37	missense	SNP	1.000	T
MTR	4548	genome.wustl.edu	37	1	236978947	236978947	+	Missense_Mutation	SNP	C	C	A			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr1:236978947C>A	ENST00000366577.5	+	7	1047	c.653C>A	c.(652-654)gCt>gAt	p.A218D	MTR_ENST00000418145.2_3'UTR|MTR_ENST00000535889.1_Missense_Mutation_p.A218D	NM_000254.2	NP_000245.2	Q99707	METH_HUMAN	5-methyltetrahydrofolate-homocysteine methyltransferase	218	Hcy-binding. {ECO:0000255|PROSITE- ProRule:PRU00333}.				cellular nitrogen compound metabolic process (GO:0034641)|cobalamin metabolic process (GO:0009235)|methylation (GO:0032259)|nervous system development (GO:0007399)|pteridine-containing compound metabolic process (GO:0042558)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	cobalamin binding (GO:0031419)|methionine synthase activity (GO:0008705)|S-adenosylmethionine-homocysteine S-methyltransferase activity (GO:0008898)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(8)|lung(30)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	67	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;2.79e-22)|all_epithelial(177;4.84e-14)|Breast(1374;0.00123)|Prostate(94;0.0181)|Lung SC(1967;0.0262)|Acute lymphoblastic leukemia(190;0.117)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)	KIRC - Kidney renal clear cell carcinoma(1967;0.248)	Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)|L-Methionine(DB00134)|Tetrahydrofolic acid(DB00116)	GAGAAATATGCTCCCCGGCCT	0.383																																																	0								ENSG00000116984						96.0	96.0	96.0					1																	236978947		2203	4300	6503	MTR	SO:0001583	missense	0			-	HGNC	U73338	CCDS1614.1, CCDS73054.1	1q43	2011-05-12			ENSG00000116984	ENSG00000116984	2.1.1.13		7468	protein-coding gene	gene with protein product		156570				8968735	Standard	NM_000254		Approved	cblG	uc001hyi.4	Q99707	OTTHUMG00000040060	ENST00000366577.5:c.653C>A	1.37:g.236978947C>A	ENSP00000355536:p.Ala218Asp	Somatic	0	45	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	39	9.30	A1L4N8|A9Z1W4|B9EGF7|Q99713|Q99723	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_S_MeTrfase,pfam_VitB12-dep_Met_synth_activ_dom,pfam_Pterin-binding,pfam_Cbl-bd_cap,pfam_Cobalamin-bd,superfamily_VitB12-dep_Met_synth_activ_dom,superfamily_S_MeTrfase,superfamily_Dihydropteroate_synth-like,superfamily_Cobalamin-bd,superfamily_Cbl-bd_cap,pirsf_MetH,pfscan_VitB12-dep_Met_synth_activ_dom,pfscan_S_MeTrfase,pfscan_Pterin-binding,tigrfam_MetH	p.A218D	ENST00000366577.5	37	c.653	CCDS1614.1	1	.	.	.	.	.	.	.	.	.	.	C	10.72	1.430475	0.25726	.	.	ENSG00000116984	ENST00000417743;ENST00000366577;ENST00000535889	T;T	0.11604	2.76;2.76	6.07	2.89	0.33648	Homocysteine S-methyltransferase (4);	0.649258	0.16392	N	0.216418	T	0.06096	0.0158	N	0.11131	0.1	0.18873	N	0.999988	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.08055	0.003;0.003;0.003	T	0.33394	-0.9870	10	0.42905	T	0.14	-3.4169	9.8668	0.41148	0.327:0.6022:0.0:0.0708	.	218;218;218	B7ZLW8;B7ZLW7;Q99707	.;.;METH_HUMAN	D	218	ENSP00000355536:A218D;ENSP00000441845:A218D	ENSP00000355536:A218D	A	+	2	0	MTR	235045570	0.901000	0.30685	0.828000	0.32881	0.687000	0.40016	0.787000	0.26858	0.888000	0.36160	-0.182000	0.12963	GCT	-	pfam_S_MeTrfase,superfamily_S_MeTrfase,pirsf_MetH,pfscan_S_MeTrfase,tigrfam_MetH		0.383	MTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTR	protein_coding	OTTHUMT00000096632.2	C	NM_000254	-		236978947	+1	no_errors	ENST00000366577	ensembl	human	known	74_37	missense	SNP	0.271	A
MMP26	56547	genome.wustl.edu	37	11	4825681	4825681	+	Intron	DEL	T	T	-			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr11:4825681delT	ENST00000380390.1	+	1	72				MMP26_ENST00000477339.1_Intron|OR52R1_ENST00000380382.1_Frame_Shift_Del_p.N56fs|OR52R1_ENST00000356069.2_5'Flank			Q9NRE1	MMP26_HUMAN	matrix metallopeptidase 26						collagen catabolic process (GO:0030574)|proteolysis (GO:0006508)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(11)|pancreas(1)|skin(3)|stomach(1)	22		Medulloblastoma(188;0.0025)|Breast(177;0.0204)|all_neural(188;0.0227)		Epithelial(150;1.33e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0287)|LUSC - Lung squamous cell carcinoma(625;0.191)	Marimastat(DB00786)	AAAACAAGTGTTATTATTATA	0.363																																																	0								ENSG00000176937						89.0	89.0	89.0					11																	4825681		2201	4298	6499	OR52R1	SO:0001627	intron_variant	0				HGNC	AF230354	CCDS7752.1	11p15	2008-07-18	2005-08-08		ENSG00000167346	ENSG00000167346	3.4.24.1		14249	protein-coding gene	gene with protein product	"""matrilysin 2"""	605470	"""matrix metalloproteinase 26"""			10801841, 10824119	Standard	NM_021801		Approved	endometase, MGC126590, MGC126592	uc001lzv.3	Q9NRE1	OTTHUMG00000066442	ENST00000380390.1:c.-145+37110T>-	11.37:g.4825681delT		Somatic	0	37	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	41	14.58	Q3MJ78|Q9GZS2|Q9NR87	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.N56fs	ENST00000380390.1	37	c.167	CCDS7752.1	11																																																																																			-	NULL		0.363	MMP26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52R1	protein_coding	OTTHUMT00000142058.3	T	NM_021801			4825681	-1	no_errors	ENST00000380382	ensembl	human	known	74_37	frame_shift_del	DEL	0.000	-
ZFYVE19	84936	genome.wustl.edu	37	15	41099899	41099900	+	Frame_Shift_Ins	INS	-	-	GGGGC	rs371684343|rs200042011|rs142730574|rs369585041	byFrequency	TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr15:41099899_41099900insGGGGC	ENST00000355341.4	+	1	613_614	c.112_113insGGGGC	c.(112-114)tggfs	p.-40fs	ZFYVE19_ENST00000336455.5_Intron|ZFYVE19_ENST00000564258.1_Intron|ZFYVE19_ENST00000563530.1_3'UTR|DNAJC17_ENST00000220496.4_5'Flank|ZFYVE19_ENST00000570108.1_Intron|ZFYVE19_ENST00000299173.10_Frame_Shift_Ins_p.-40fs	NM_001077268.1	NP_001070736.1	Q96K21	ANCHR_HUMAN	zinc finger, FYVE domain containing 19						abscission (GO:0009838)|cell division (GO:0051301)|cytokinesis checkpoint (GO:0031565)|negative regulation of cytokinesis (GO:0032466)	centrosome (GO:0005813)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|midbody (GO:0030496)	phosphatidylinositol-3-phosphate binding (GO:0032266)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	9		all_cancers(109;3.31e-18)|all_epithelial(112;2.33e-15)|Lung NSC(122;5.34e-11)|all_lung(180;1.33e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;2.76e-05)|COAD - Colon adenocarcinoma(120;0.151)|BRCA - Breast invasive adenocarcinoma(123;0.164)		AGTGGGCGTGTGgggcggggca	0.718														1685	0.336462	0.3411	0.3112	5008	,	,		13821	0.2252		0.3777	False		,,,				2504	0.4202																0								ENSG00000166140			1226,2460		247,732,864						2.0	0.3		dbSNP_130	17	2598,5206		494,1610,1798	no	frameshift	ZFYVE19	NM_001077268.1		741,2342,2662	A1A1,A1R,RR		33.2906,33.261,33.2811				3824,7666				ZFYVE19	SO:0001589	frameshift_variant	0				HGNC	AK027746	CCDS42025.1, CCDS58353.1, CCDS58354.1, CCDS58355.1	15q14	2008-05-02				ENSG00000166140		"""Zinc fingers, FYVE domain containing"""	20758	protein-coding gene	gene with protein product							Standard	NM_001077268		Approved	FLJ14840	uc031qrk.1	Q96K21		ENST00000355341.4:c.118_122dupGGGGC	15.37:g.41099905_41099909dupGGGGC	ENSP00000347498:p.Gly40fs	Somatic	NA	NA	NA		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B3KVB2|C9JNF4|H3BUF9|Q86WC2|Q8WU96	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,smart_Znf_FYVE,pfscan_Znf_FYVE-rel	p.A42fs	ENST00000355341.4	37	c.112_113	CCDS42025.1	15																																																																																			-	NULL		0.718	ZFYVE19-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZFYVE19	protein_coding	OTTHUMT00000418996.1	-	NM_032850			41099900	+1	no_errors	ENST00000355341	ensembl	human	known	74_37	frame_shift_ins	INS	0.028:0.002	GGGGC
KCNC4	3749	genome.wustl.edu	37	1	110768794	110768794	+	Missense_Mutation	SNP	C	C	T	rs200184574		TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr1:110768794C>T	ENST00000369787.3	+	3	1840	c.1813C>T	c.(1813-1815)Cgg>Tgg	p.R605W	KCNC4_ENST00000412512.2_Intron|KCNC4_ENST00000438661.2_Missense_Mutation_p.R605W|KCNC4_ENST00000413138.3_Missense_Mutation_p.R605W	NM_004978.4	NP_004969.2	Q03721	KCNC4_HUMAN	potassium voltage-gated channel, Shaw-related subfamily, member 4	605					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of neurotransmitter secretion (GO:0046928)|synaptic transmission (GO:0007268)	axon terminus (GO:0043679)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|liver(2)|lung(11)|ovary(1)|skin(2)	32		all_cancers(81;9.88e-06)|all_epithelial(167;3.23e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0238)|all cancers(265;0.0693)|Epithelial(280;0.0748)|Colorectal(144;0.112)|LUSC - Lung squamous cell carcinoma(189;0.135)		TGGTAGTGTCCGGAAAGGTAT	0.647																																																	0								ENSG00000116396						52.0	58.0	56.0					1																	110768794		2203	4300	6503	KCNC4	SO:0001583	missense	0			-	HGNC	BC101769	CCDS821.1, CCDS44193.1	1p21	2012-07-05			ENSG00000116396	ENSG00000116396		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6236	protein-coding gene	gene with protein product		176265	"""chromosome 1 open reading frame 30"""	C1orf30		1920536, 1740329, 16382104	Standard	NM_004978		Approved	Kv3.4, HKSHIIIC	uc001dzh.3	Q03721	OTTHUMG00000011037	ENST00000369787.3:c.1813C>T	1.37:g.110768794C>T	ENSP00000358802:p.Arg605Trp	Somatic	0	140	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	39	14	73.58	Q3MIM4|Q5TBI6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_K_chnl_volt-dep_Kv3_ID,pfam_2pore_dom_K_chnl_dom,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv3,prints_K_chnl_volt-dep_Kv3.4,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv9	p.R605W	ENST00000369787.3	37	c.1813	CCDS821.1	1	.	.	.	.	.	.	.	.	.	.	C	25.6	4.656015	0.88056	.	.	ENSG00000116396	ENST00000369787;ENST00000413138;ENST00000438661	D;D;D	0.98221	-4.8;-4.63;-4.69	5.19	5.19	0.71726	.	0.134642	0.30723	N	0.009019	D	0.97579	0.9207	L	0.59436	1.845	0.43073	D	0.99471	D;D	0.71674	0.997;0.998	P;P	0.50754	0.551;0.649	D	0.98158	1.0445	10	0.87932	D	0	.	18.7013	0.91621	0.0:1.0:0.0:0.0	.	605;605	Q03721;Q03721-3	KCNC4_HUMAN;.	W	605	ENSP00000358802:R605W;ENSP00000388029:R605W;ENSP00000393655:R605W	ENSP00000358802:R605W	R	+	1	2	KCNC4	110570317	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	4.651000	0.61447	2.430000	0.82344	0.462000	0.41574	CGG	-	NULL		0.647	KCNC4-004	KNOWN	basic|CCDS	protein_coding	KCNC4	protein_coding	OTTHUMT00000052146.2	C	NM_001039574	rs200184574		110768794	+1	no_errors	ENST00000369787	ensembl	human	known	74_37	missense	SNP	1.000	T
MAGEA11	4110	genome.wustl.edu	37	X	148798137	148798137	+	Nonsense_Mutation	SNP	G	G	T			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chrX:148798137G>T	ENST00000355220.5	+	5	1093	c.991G>T	c.(991-993)Gaa>Taa	p.E331*	MAGEA11_ENST00000333104.4_Nonsense_Mutation_p.E302*	NM_005366.4	NP_005357.2	P43364	MAGAB_HUMAN	melanoma antigen family A, 11	331	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.					cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(2)|skin(1)	9	Acute lymphoblastic leukemia(192;6.56e-05)|Colorectal(9;0.0662)					CTGCATCCCTGAAGAGGTTAT	0.507																																																	0								ENSG00000185247						133.0	131.0	132.0					X																	148798137		2203	4300	6503	MAGEA11	SO:0001587	stop_gained	0			-	HGNC		CCDS48180.1	Xq28	2009-03-13			ENSG00000185247	ENSG00000185247			6798	protein-coding gene	gene with protein product	"""MAGE-11 antigen"", ""melanoma-associated antigen 11"", ""cancer/testis antigen family 1, member 11"""	300344		MAGE11		8575766	Standard	NM_001011544		Approved	MAGE-11, MAGEA-11, MGC10511, CT1.11	uc004fdq.3	P43364	OTTHUMG00000022633	ENST00000355220.5:c.991G>T	X.37:g.148798137G>T	ENSP00000347358:p.Glu331*	Somatic	0	26	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	Q5ETU4|Q6ZRZ5	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MAGE,pfam_Melanoma_ass_antigen_N,pfscan_MAGE	p.E331*	ENST00000355220.5	37	c.991	CCDS48180.1	X	.	.	.	.	.	.	.	.	.	.	N	10.14	1.267162	0.23136	.	.	ENSG00000185247	ENST00000333104;ENST00000355220	.	.	.	0.909	0.909	0.19332	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	4.8361	0.13466	0.0:0.0:1.0:0.0	.	.	.	.	X	302;331	.	.	E	+	1	0	MAGEA11	148576268	0.138000	0.22547	0.004000	0.12327	0.007000	0.05969	2.052000	0.41316	0.721000	0.32231	0.377000	0.23210	GAA	-	pfam_MAGE,pfscan_MAGE		0.507	MAGEA11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAGEA11	protein_coding	OTTHUMT00000058725.4	G	NM_005366	-		148798137	+1	no_errors	ENST00000355220	ensembl	human	known	74_37	nonsense	SNP	0.004	T
LPCAT3	10162	genome.wustl.edu	37	12	7090930	7090930	+	Intron	SNP	G	G	T			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr12:7090930G>T	ENST00000261407.4	-	4	546				U47924.30_ENST00000606112.1_lincRNA|LPCAT3_ENST00000535021.1_5'Flank	NM_005768.5	NP_005759.4	Q6P1A2	MBOA5_HUMAN	lysophosphatidylcholine acyltransferase 3						glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|regulation of plasma lipoprotein particle levels (GO:0097006)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	1-acylglycerophosphocholine O-acyltransferase activity (GO:0047184)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(2)|lung(4)|ovary(1)|skin(2)	17						AGATGGGGGAGGGACCTACAT	0.542																																																	0								ENSG00000111684						118.0	100.0	106.0					12																	7090930		2203	4300	6503	LPCAT3	SO:0001627	intron_variant	0			-	HGNC	U72515	CCDS8572.1	12p13.31	2010-05-12	2008-06-24	2008-06-24	ENSG00000111684	ENSG00000111684			30244	protein-coding gene	gene with protein product		611950	"""O-acyltransferase (membrane bound) domain containing 5"", ""membrane bound O-acyltransferase domain containing 5"""	OACT5, MBOAT5		8723724, 9074930, 18195019	Standard	NM_005768		Approved	C3F, nessy	uc001qsi.3	Q6P1A2	OTTHUMG00000168970	ENST00000261407.4:c.460+41C>A	12.37:g.7090930G>T		Somatic	0	46	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	30	11.76	B2RDH0|B7Z3N3|Q7KZS1|Q92980|Q9BW40	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000261407.4	37	NULL	CCDS8572.1	12																																																																																			-	-		0.542	LPCAT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPCAT3	protein_coding	OTTHUMT00000401812.1	G	NM_005768	-		7090930	-1	no_errors	ENST00000536971	ensembl	human	putative	74_37	rna	SNP	0.000	T
LRP1B	53353	genome.wustl.edu	37	2	141533723	141533723	+	Missense_Mutation	SNP	C	C	A			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr2:141533723C>A	ENST00000389484.3	-	33	6415	c.5444G>T	c.(5443-5445)cGg>cTg	p.R1815L		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	1815					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		AGTCTTATTCCGTAGGATGGT	0.418										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)												0								ENSG00000168702						135.0	129.0	131.0					2																	141533723		2203	4300	6503	LRP1B	SO:0001583	missense	0			-	HGNC	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.5444G>T	2.37:g.141533723C>A	ENSP00000374135:p.Arg1815Leu	Somatic	0	87	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	58	9.23	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,pfam_EG-like_dom,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.R1815L	ENST00000389484.3	37	c.5444	CCDS2182.1	2	.	.	.	.	.	.	.	.	.	.	C	17.24	3.338822	0.60963	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.91068	-2.78	5.69	5.69	0.88448	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.64402	D	0.000003	D	0.94778	0.8314	M	0.79475	2.455	0.54753	D	0.999986	D	0.89917	1.0	D	0.81914	0.995	D	0.91743	0.5406	10	0.10377	T	0.69	.	19.8051	0.96529	0.0:1.0:0.0:0.0	.	1815	Q9NZR2	LRP1B_HUMAN	L	1815;1753	ENSP00000374135:R1815L	ENSP00000374135:R1815L	R	-	2	0	LRP1B	141250193	0.941000	0.31946	0.689000	0.30133	0.063000	0.16089	7.692000	0.84203	2.702000	0.92279	0.591000	0.81541	CGG	-	NULL		0.418	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1B	protein_coding	OTTHUMT00000254736.2	C	NM_018557	-		141533723	-1	no_errors	ENST00000389484	ensembl	human	known	74_37	missense	SNP	0.985	A
MUC5B	727897	genome.wustl.edu	37	11	1267347	1267347	+	Silent	SNP	C	C	A			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr11:1267347C>A	ENST00000529681.1	+	31	9295	c.9237C>A	c.(9235-9237)acC>acA	p.T3079T	RP11-532E4.2_ENST00000532061.2_RNA|MUC5B_ENST00000447027.1_Silent_p.T3082T	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	3079	17 X approximate tandem repeats, Ser/Thr- rich.|7 X Cys-rich subdomain repeats.|Thr-rich.			Missing (in Ref. 6; AAB61398). {ECO:0000305}.	cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CCACCGGGACCCTCCCAGAAC	0.607																																																	0								ENSG00000117983						154.0	174.0	167.0					11																	1267347		2100	4197	6297	MUC5B	SO:0001819	synonymous_variant	0			-	HGNC	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.9237C>A	11.37:g.1267347C>A		Somatic	0	75	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	18	21.74	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_VWF_C,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.T3082	ENST00000529681.1	37	c.9246	CCDS44515.2	11																																																																																			-	NULL		0.607	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	MUC5B	protein_coding	OTTHUMT00000390041.2	C	XM_001126093	-		1267347	+1	no_errors	ENST00000447027	ensembl	human	known	74_37	silent	SNP	0.031	A
MTMR12	54545	genome.wustl.edu	37	5	32268807	32268807	+	Splice_Site	SNP	C	C	G			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr5:32268807C>G	ENST00000382142.3	-	6	753	c.583G>C	c.(583-585)Gtc>Ctc	p.V195L	MTMR12_ENST00000264934.5_Splice_Site_p.V195L|MTMR12_ENST00000280285.5_Splice_Site_p.V195L	NM_001040446.1	NP_001035536.1	Q9C0I1	MTMRC_HUMAN	myotubularin related protein 12	195						cytoplasm (GO:0005737)	phosphatase activity (GO:0016791)			breast(3)|endometrium(3)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	34						AGATATTTACCTGTATTGTTT	0.403																																																	0								ENSG00000150712						91.0	85.0	87.0					5																	32268807		2203	4300	6503	MTMR12	SO:0001630	splice_region_variant	0			-	HGNC	AB051469	CCDS34138.1, CCDS75230.1	5p15.33	2011-06-09	2005-04-07	2005-04-07	ENSG00000150712	ENSG00000150712		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	18191	protein-coding gene	gene with protein product		606501	"""phosphatidylinositol-3-phosphate associated protein"""	PIP3AP		11504939, 12495846	Standard	XM_005248313		Approved	3-PAP, FLJ20476, KIAA1682, 3PAP	uc003jhq.3	Q9C0I1	OTTHUMG00000161978	ENST00000382142.3:c.583+1G>C	5.37:g.32268807C>G		Somatic	0	40	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	47	9.62	Q69YJ4|Q6PFW3|Q96QU2|Q9NX27	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Myotubularin_assoc	p.V195L	ENST00000382142.3	37	c.583	CCDS34138.1	5	.	.	.	.	.	.	.	.	.	.	C	14.49	2.552433	0.45487	.	.	ENSG00000150712	ENST00000280285;ENST00000382142;ENST00000264934	D;D;D	0.95518	-3.73;-3.39;-3.25	5.22	4.34	0.51931	.	0.921001	0.09249	N	0.828100	D	0.92789	0.7707	L	0.36672	1.1	0.34377	D	0.69265	B;B;B	0.21606	0.058;0.034;0.006	B;B;B	0.22601	0.04;0.033;0.014	D	0.87687	0.2551	9	.	.	.	.	15.7546	0.78013	0.0:0.8631:0.1369:0.0	.	195;195;195	Q9C0I1-3;Q9C0I1-2;Q9C0I1	.;.;MTMRC_HUMAN	L	195	ENSP00000280285:V195L;ENSP00000371577:V195L;ENSP00000264934:V195L	.	V	-	1	0	MTMR12	32304564	1.000000	0.71417	0.761000	0.31378	0.946000	0.59487	3.527000	0.53517	1.171000	0.42768	0.650000	0.86243	GTC	-	NULL		0.403	MTMR12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTMR12	protein_coding	OTTHUMT00000366579.1	C	NM_019061	-	Missense_Mutation	32268807	-1	no_errors	ENST00000382142	ensembl	human	known	74_37	missense	SNP	0.996	G
CASP2	835	genome.wustl.edu	37	7	142991867	142991867	+	Splice_Site	SNP	G	G	T			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr7:142991867G>T	ENST00000310447.5	+	6	988		c.e6+1		CASP2_ENST00000493642.1_Splice_Site	NM_032982.3|NM_032983.3	NP_116764.2|NP_116765.2	P42575	CASP2_HUMAN	caspase 2, apoptosis-related cysteine peptidase						aging (GO:0007568)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|brain development (GO:0007420)|cellular response to mechanical stimulus (GO:0071260)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|ectopic germ cell programmed cell death (GO:0035234)|execution phase of apoptosis (GO:0097194)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|luteolysis (GO:0001554)|neural retina development (GO:0003407)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of neuron apoptotic process (GO:0043525)|protein processing (GO:0016485)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|cysteine-type endopeptidase activity involved in apoptotic process (GO:0097153)|enzyme binding (GO:0019899)|protein domain specific binding (GO:0019904)			endometrium(2)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)	21	Melanoma(164;0.059)					GACTGCACAGGTACCTGAGGT	0.473																																																	0								ENSG00000106144						64.0	54.0	57.0					7																	142991867		2203	4300	6503	CASP2	SO:0001630	splice_region_variant	0			-	HGNC	AK096245, BC002427, BM998653, BX537669, CB988674, U13021	CCDS5879.1, CCDS47733.1	7q34-q35	2014-01-20	2008-08-01		ENSG00000106144	ENSG00000106144		"""Caspases"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1503	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 57"""	600639	"""neural precursor cell expressed, developmentally down-regulated 2"""	NEDD2		7789948, 8780721	Standard	NM_032982		Approved	ICH1, PPP1R57, MGC2181	uc003wco.3	P42575	OTTHUMG00000023641	ENST00000310447.5:c.747+1G>T	7.37:g.142991867G>T		Somatic	0	74	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	40	9.09	A8K5F9|D3DXD6|E9PDN0|P42576|Q59F21|Q7KZL6|Q86UJ3|Q9BUP7|Q9BZK9|Q9BZL0	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e6+1	ENST00000310447.5	37	c.747+1	CCDS5879.1	7	.	.	.	.	.	.	.	.	.	.	G	18.73	3.687330	0.68157	.	.	ENSG00000106144	ENST00000310447;ENST00000392923	.	.	.	5.62	5.62	0.85841	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.069	0.97712	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CASP2	142701989	1.000000	0.71417	1.000000	0.80357	0.731000	0.41821	8.755000	0.91646	2.820000	0.97059	0.650000	0.86243	.	-	-		0.473	CASP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CASP2	protein_coding	OTTHUMT00000059962.3	G	NM_032982	-	Intron	142991867	+1	no_errors	ENST00000310447	ensembl	human	known	74_37	splice_site	SNP	1.000	T
BRINP3	339479	genome.wustl.edu	37	1	190067251	190067251	+	Missense_Mutation	SNP	T	T	A			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr1:190067251T>A	ENST00000367462.3	-	8	2429	c.2198A>T	c.(2197-2199)aAg>aTg	p.K733M	BRINP3_ENST00000534846.1_Missense_Mutation_p.K631M	NM_199051.1	NP_950252.1	Q76B58	BRNP3_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 3	733					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)											AGTAGACAGCTTGAGTCTATG	0.443																																																	0								ENSG00000162670						122.0	117.0	119.0					1																	190067251		2203	4300	6503	BRINP3	SO:0001583	missense	0			-	HGNC	AB111893	CCDS1373.1	1q31.1	2013-09-18	2013-09-18	2013-09-18	ENSG00000162670	ENSG00000162670			22393	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member C"""	FAM5C		16018821, 15193423	Standard	NM_199051		Approved	DBCCR1L, DBCCR1L1	uc001gse.1	Q76B58	OTTHUMG00000035533	ENST00000367462.3:c.2198A>T	1.37:g.190067251T>A	ENSP00000356432:p.Lys733Met	Somatic	0	41	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	35	0	100.00	B3KVP1|B7Z260|O95726|Q2M330	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MACPF,smart_MACPF	p.K733M	ENST00000367462.3	37	c.2198	CCDS1373.1	1	.	.	.	.	.	.	.	.	.	.	T	16.62	3.173536	0.57584	.	.	ENSG00000162670	ENST00000367462;ENST00000534846	T;T	0.26373	1.99;1.74	5.54	5.54	0.83059	.	0.049414	0.85682	D	0.000000	T	0.50257	0.1605	M	0.73962	2.25	0.53005	D	0.999963	D;D	0.69078	0.997;0.995	D;D	0.71870	0.975;0.945	T	0.54437	-0.8294	10	0.87932	D	0	.	13.6231	0.62149	0.0:0.0:0.0:1.0	.	631;733	B7Z260;Q76B58	.;FAM5C_HUMAN	M	733;631	ENSP00000356432:K733M;ENSP00000438022:K631M	ENSP00000356432:K733M	K	-	2	0	FAM5C	188333874	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.208000	0.72165	2.096000	0.63516	0.528000	0.53228	AAG	-	NULL		0.443	BRINP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRINP3	protein_coding	OTTHUMT00000086278.1	T	NM_199051	-		190067251	-1	no_errors	ENST00000367462	ensembl	human	known	74_37	missense	SNP	1.000	A
CNTNAP3B	728577	genome.wustl.edu	37	9	43844210	43844210	+	Missense_Mutation	SNP	G	G	A			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr9:43844210G>A	ENST00000377564.3	+	10	1937	c.1544G>A	c.(1543-1545)aGg>aAg	p.R515K		NM_001201380.1	NP_001188309.1	Q96NU0	CNT3B_HUMAN	contactin associated protein-like 3B	515	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(2)|lung(3)|pancreas(1)|prostate(3)	10						GGCTGCCTAAGGCTCATCACC	0.542																																																	0								ENSG00000154529																																			CNTNAP3B	SO:0001583	missense	0			-	HGNC	BX538190	CCDS75836.1	9p12	2007-12-14			ENSG00000154529	ENSG00000154529			32035	protein-coding gene	gene with protein product						15820314	Standard	XM_006716853		Approved		uc004abr.1	Q96NU0	OTTHUMG00000013174	ENST00000377564.3:c.1544G>A	9.37:g.43844210G>A	ENSP00000366787:p.Arg515Lys	Somatic	0	79	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	39	38.10	B1B0V7|B1B0V8|B1B0V9|B1B0W0|B1B0X8|B1B162|Q4VXF0|Q9H7W3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Laminin_G,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,superfamily_ConA-like_lec_gl_sf,superfamily_Fibrinogen_a/b/g_C_dom,smart_Coagulation_fac_5/8-C_type_dom,smart_Laminin_G,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Laminin_G	p.R515K	ENST00000377564.3	37	c.1544	CCDS55312.1	9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	15.62|15.62	2.886917|2.886917	0.52014|0.52014	.|.	.|.	ENSG00000154529|ENSG00000154529	ENST00000377561|ENST00000377564;ENST00000341990	.|T	.|0.79653	.|-1.29	3.46|3.46	2.55|2.55	0.30701|0.30701	.|.	.|.	.|.	.|.	.|.	T|T	0.78317|0.78317	0.4264|0.4264	L|L	0.54908|0.54908	1.71|1.71	0.21386|0.21386	N|N	0.999705|0.999705	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.69250|0.69250	-0.5194|-0.5194	5|7	.|0.66056	.|D	.|0.02	.|.	5.4043|5.4043	0.16312|0.16312	0.3447:0.0:0.6553:0.0|0.3447:0.0:0.6553:0.0	.|.	.|.	.|.	.|.	S|K	564|515	.|ENSP00000366787:R515K	.|ENSP00000340890:R515K	G|R	+|+	1|2	0|0	CNTNAP3B|CNTNAP3B	43784206|43784206	0.965000|0.965000	0.33210|0.33210	0.998000|0.998000	0.56505|0.56505	0.657000|0.657000	0.38888|0.38888	1.597000|1.597000	0.36729|0.36729	0.803000|0.803000	0.34113|0.34113	0.491000|0.491000	0.48974|0.48974	GGC|AGG	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,pfscan_Laminin_G		0.542	CNTNAP3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP3B	protein_coding	OTTHUMT00000036930.3	G		-		43844210	+1	no_errors	ENST00000377564	ensembl	human	known	74_37	missense	SNP	0.863	A
CD3G	917	genome.wustl.edu	37	11	118222368	118222368	+	Silent	SNP	C	C	A			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr11:118222368C>A	ENST00000532917.1	+	5	533	c.465C>A	c.(463-465)ccC>ccA	p.P155P	CD3G_ENST00000392883.2_Silent_p.P51P|CD3G_ENST00000532903.1_3'UTR	NM_000073.2	NP_000064.1	P09693	CD3G_HUMAN	CD3g molecule, gamma (CD3-TCR complex)	155	ITAM. {ECO:0000255|PROSITE- ProRule:PRU00379}.				cell surface receptor signaling pathway (GO:0007166)|establishment or maintenance of cell polarity (GO:0007163)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|protein complex assembly (GO:0006461)|protein transport (GO:0015031)|regulation of immune response (GO:0050776)|regulation of lymphocyte apoptotic process (GO:0070228)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	alpha-beta T cell receptor complex (GO:0042105)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|T cell receptor complex (GO:0042101)	protein heterodimerization activity (GO:0046982)|receptor signaling complex scaffold activity (GO:0030159)|T cell receptor binding (GO:0042608)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|kidney(1)|large_intestine(2)|skin(1)	6	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.04e-05)	Muromonab(DB00075)	CTCTGTTGCCCAATGACCAGC	0.398																																																	0								ENSG00000160654						157.0	152.0	154.0					11																	118222368		2200	4296	6496	CD3G	SO:0001819	synonymous_variant	0			-	HGNC	X60491	CCDS8395.1	11q23	2014-09-17	2006-03-28		ENSG00000160654	ENSG00000160654		"""CD molecules"""	1675	protein-coding gene	gene with protein product		186740	"""CD3g antigen, gamma polypeptide (TiT3 complex)"""				Standard	NM_000073		Approved		uc001psu.2	P09693	OTTHUMG00000166971	ENST00000532917.1:c.465C>A	11.37:g.118222368C>A		Somatic	0	56	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51	Q2HIZ6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Phos_immunorcpt_sig_ITAM,smart_Ig_sub2,smart_Phos_immunorcpt_sig_ITAM,pfscan_Phos_immunorcpt_sig_ITAM	p.P155	ENST00000532917.1	37	c.465	CCDS8395.1	11																																																																																			-	pfscan_Phos_immunorcpt_sig_ITAM		0.398	CD3G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD3G	protein_coding	OTTHUMT00000392135.1	C	NM_000073	-		118222368	+1	no_errors	ENST00000532917	ensembl	human	known	74_37	silent	SNP	0.989	A
ADCY4	196883	genome.wustl.edu	37	14	24802126	24802126	+	Silent	SNP	C	C	T			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr14:24802126C>T	ENST00000310677.4	-	3	341	c.228G>A	c.(226-228)ctG>ctA	p.L76L	ADCY4_ENST00000554068.2_Silent_p.L76L|ADCY4_ENST00000558563.1_5'UTR|RP11-934B9.3_ENST00000555591.1_Missense_Mutation_p.G143R|ADCY4_ENST00000396747.3_5'UTR|ADCY4_ENST00000418030.2_Silent_p.L76L	NM_001198568.1|NM_001198592.1|NM_139247.3	NP_001185497.1|NP_001185521.1|NP_640340.2	Q8NFM4	ADCY4_HUMAN	adenylate cyclase 4	76					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	34				GBM - Glioblastoma multiforme(265;0.0192)		AAGCGAGGCCCAGCAGCAGCG	0.667											OREG0022624	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000258973						23.0	31.0	28.0					14																	24802126		2203	4300	6503	RP11-934B9.3	SO:0001819	synonymous_variant	0			-	Clone_based_vega_gene	AF497516	CCDS9627.1	14q11.2	2013-02-04			ENSG00000129467	ENSG00000129467	4.6.1.1	"""Adenylate cyclases"""	235	protein-coding gene	gene with protein product		600292				7766992	Standard	NM_001198592		Approved	AC4	uc001woy.3	Q8NFM4	OTTHUMG00000029347	ENST00000310677.4:c.228G>A	14.37:g.24802126C>T		Somatic	0	35	0.00	774	0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	29	12.12	B3KV74|D3DS75|Q17R40|Q6ZTM6|Q96ML7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.G143R	ENST00000310677.4	37	c.427	CCDS9627.1	14	.	.	.	.	.	.	.	.	.	.	C	18.77	3.695148	0.68386	.	.	ENSG00000258973	ENST00000555591	.	.	.	5.66	4.73	0.59995	.	.	.	.	.	T	0.69214	0.3086	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.67154	-0.5742	4	.	.	.	.	13.8862	0.63710	0.0:0.7665:0.2334:0.0	.	.	.	.	R	143	.	.	G	-	1	0	RP11-934B9.3	23871966	1.000000	0.71417	1.000000	0.80357	0.897000	0.52465	1.838000	0.39211	2.663000	0.90544	0.555000	0.69702	GGG	-	NULL		0.667	ADCY4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000258973	protein_coding	OTTHUMT00000073200.4	C		-		24802126	-1	no_errors	ENST00000555591	ensembl	human	putative	74_37	missense	SNP	0.999	T
SLC35G3	146861	genome.wustl.edu	37	17	33518303	33518303	+	IGR	SNP	G	G	T			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr17:33518303G>T	ENST00000297307.5	-	0	1874				RP11-799D4.2_ENST00000590144.1_RNA	NM_152462.2	NP_689675.1	Q8N808	S35G3_HUMAN	solute carrier family 35, member G3							integral component of membrane (GO:0016021)											GAAAAGGCAGGAAGAAGCTTA	0.423																																																	0								ENSG00000266981																																			RP11-799D4.2	SO:0001628	intergenic_variant	0			-	Clone_based_vega_gene	AK097473	CCDS11293.1	17q21.1	2013-05-22	2011-08-03	2011-08-03	ENSG00000164729	ENSG00000164729		"""Solute carriers"""	26848	protein-coding gene	gene with protein product			"""transmembrane protein 21A"", ""acyl-malonyl condensing enzyme 1"""	TMEM21A, AMAC1			Standard	NM_152462		Approved	FLJ40154	uc002hjd.2	Q8N808	OTTHUMG00000132929		17.37:g.33518303G>T		Somatic	0	26	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	13	18.75	B9EGE9	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000297307.5	37	NULL	CCDS11293.1	17																																																																																			-	-		0.423	SLC35G3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000266981	protein_coding	OTTHUMT00000256445.2	G	NM_152462	-		33518303	+1	no_errors	ENST00000590144	ensembl	human	putative	74_37	rna	SNP	0.998	T
SNX9	51429	genome.wustl.edu	37	6	158296072	158296072	+	Intron	SNP	C	C	A			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr6:158296072C>A	ENST00000392185.3	+	4	345				RP11-52J3.2_ENST00000457427.1_RNA|RP11-52J3.2_ENST00000422776.1_RNA	NM_016224.3	NP_057308.1	Q9Y5X1	SNX9_HUMAN	sorting nexin 9						cleavage furrow formation (GO:0036089)|endocytosis (GO:0006897)|endosomal transport (GO:0016197)|intracellular protein transport (GO:0006886)|lipid tube assembly (GO:0060988)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)|positive regulation of GTPase activity (GO:0043547)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of protein oligomerization (GO:0032461)|receptor-mediated endocytosis (GO:0006898)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic vesicle membrane (GO:0030659)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	1-phosphatidylinositol binding (GO:0005545)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(10)|skin(1)|upper_aerodigestive_tract(1)	20		Breast(66;0.000776)|Ovarian(120;0.0303)|Prostate(117;0.167)		OV - Ovarian serous cystadenocarcinoma(65;8.06e-18)|BRCA - Breast invasive adenocarcinoma(81;4.48e-05)		GCGGCTCTTTCTCCTATTCAG	0.408																																																	0								ENSG00000229502						95.0	98.0	97.0					6																	158296072		2203	4300	6503	RP11-52J3.2	SO:0001627	intron_variant	0			-	Clone_based_vega_gene	AF121859	CCDS5253.1	6q25.1-q26	2008-05-22			ENSG00000130340	ENSG00000130340		"""Sorting nexins"""	14973	protein-coding gene	gene with protein product		605952				10531379, 17609109	Standard	NM_016224		Approved	SH3PX1, SDP1, SH3PXD3A	uc003qqv.1	Q9Y5X1	OTTHUMG00000015903	ENST00000392185.3:c.175-11C>A	6.37:g.158296072C>A		Somatic	0	42	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	Q9BSI7|Q9BVM1|Q9UJH6|Q9UP20	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000392185.3	37	NULL	CCDS5253.1	6																																																																																			-	-		0.408	SNX9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000229502	protein_coding	OTTHUMT00000042856.1	C		-		158296072	-1	no_errors	ENST00000422776	ensembl	human	known	74_37	rna	SNP	0.000	A
UGT3A1	133688	genome.wustl.edu	37	5	35965701	35965701	+	Silent	SNP	G	G	A			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr5:35965701G>A	ENST00000274278.3	-	4	987	c.630C>T	c.(628-630)ttC>ttT	p.F210F	UGT3A1_ENST00000513233.1_Intron|UGT3A1_ENST00000333811.4_Silent_p.F156F|UGT3A1_ENST00000507113.1_Silent_p.F176F|UGT3A1_ENST00000503189.1_Silent_p.F210F	NM_152404.3	NP_689617.3	Q6NUS8	UD3A1_HUMAN	UDP glycosyltransferase 3 family, polypeptide A1	210						integral component of membrane (GO:0016021)|UDP-N-acetylglucosamine transferase complex (GO:0043541)	glucuronosyltransferase activity (GO:0015020)|UDP-glycosyltransferase activity (GO:0008194)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(28)|ovary(2)|skin(4)	46	all_lung(31;0.000197)		Epithelial(62;0.107)|Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			GGCTCCTGGAGAAACTAAAGA	0.458																																																	0								ENSG00000145626						96.0	100.0	99.0					5																	35965701		2203	4300	6503	UGT3A1	SO:0001819	synonymous_variant	0			-	HGNC		CCDS3913.1, CCDS54841.1	5p13.2	2014-05-20			ENSG00000145626	ENSG00000145626		"""UDP glucuronosyltransferases"""	26625	protein-coding gene	gene with protein product							Standard	NM_152404		Approved	FLJ34658	uc003jjv.2	Q6NUS8	OTTHUMG00000131107	ENST00000274278.3:c.630C>T	5.37:g.35965701G>A		Somatic	0	57	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	47	30	61.04	G5E961|Q8IYS9|Q8NAW4|Q96DM6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	p.F210	ENST00000274278.3	37	c.630	CCDS3913.1	5																																																																																			-	pfam_UDP_glucos_trans		0.458	UGT3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGT3A1	protein_coding	OTTHUMT00000253770.2	G	NM_152404	-		35965701	-1	no_errors	ENST00000274278	ensembl	human	known	74_37	silent	SNP	0.001	A
RP11-281O15.4	0	genome.wustl.edu	37	5	178396498	178396498	+	RNA	SNP	C	C	A			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr5:178396498C>A	ENST00000519491.1	+	0	108																											CCAGCTGTGACAAGATGAAGG	0.517																																																	0								ENSG00000254035																																			RP11-281O15.4			0			-	Clone_based_vega_gene																													5.37:g.178396498C>A		Somatic	0	59	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	41	8.89		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000519491.1	37	NULL		5	.	.	.	.	.	.	.	.	.	.	C	4.879	0.163288	0.09287	.	.	ENSG00000113262	ENST00000319065	.	.	.	2.5	0.518	0.17030	.	.	.	.	.	T	0.44540	0.1298	.	.	.	0.09310	N	1.0	.	.	.	.	.	.	T	0.53158	-0.8478	4	0.87932	D	0	.	4.6719	0.12692	0.2539:0.4982:0.2478:0.0	.	.	.	.	F	1000	.	ENSP00000325675:V1000F	V	-	1	0	GRM6	178329104	0.008000	0.16893	0.001000	0.08648	0.024000	0.10985	0.954000	0.29175	0.096000	0.17463	0.555000	0.69702	GTC	-	-		0.517	RP11-281O15.4-001	KNOWN	basic|exp_conf	antisense	ENSG00000254035	antisense	OTTHUMT00000374376.1	C		-		178396498	+1	no_errors	ENST00000519491	ensembl	human	known	74_37	rna	SNP	0.002	A
NOTCH3	4854	genome.wustl.edu	37	19	15300239	15300239	+	Splice_Site	SNP	C	C	A			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr19:15300239C>A	ENST00000263388.2	-	7	1112	c.1037G>T	c.(1036-1038)gGc>gTc	p.G346V		NM_000435.2	NP_000426.2	Q9UM47	NOTC3_HUMAN	notch 3	346	EGF-like 8; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				forebrain development (GO:0030900)|gene expression (GO:0010467)|glomerular capillary formation (GO:0072104)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of smooth muscle cell proliferation (GO:0048661)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			breast(4)|central_nervous_system(3)|endometrium(10)|kidney(3)|large_intestine(16)|liver(1)|lung(31)|ovary(8)|prostate(3)|skin(7)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	93			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)			ACACAGGAGGCCTGGGAAGTG	0.527																																																	0								ENSG00000074181						82.0	89.0	87.0					19																	15300239		2203	4300	6503	NOTCH3	SO:0001630	splice_region_variant	0			-	HGNC	U97669	CCDS12326.1	19p13.2-p13.1	2013-01-10	2010-06-24			ENSG00000074181		"""Ankyrin repeat domain containing"""	7883	protein-coding gene	gene with protein product		600276	"""Notch (Drosophila) homolog 3"", ""Notch homolog 3 (Drosophila)"""	CADASIL		7835890	Standard	NM_000435		Approved	CASIL	uc002nan.3	Q9UM47		ENST00000263388.2:c.1037-1G>T	19.37:g.15300239C>A		Somatic	0	31	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	20	16.67	Q9UEB3|Q9UPL3|Q9Y6L8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_Notch,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,pfam_Ankyrin_rpt,pfam_Notch_dom,pfam_Notch_NODP_dom,pfam_Notch_NOD_dom,pfam_EGF_extracell,pfam_DUF3454_notch,superfamily_Ankyrin_rpt-contain_dom,superfamily_Notch_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Notch_dom,smart_Ankyrin_rpt,prints_Notch_3,prints_Notch_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EG-like_dom,pfscan_Notch_dom	p.G346V	ENST00000263388.2	37	c.1037	CCDS12326.1	19	.	.	.	.	.	.	.	.	.	.	C	21.5	4.161838	0.78226	.	.	ENSG00000074181	ENST00000263388;ENST00000539383	D	0.98280	-4.84	4.68	4.68	0.58851	EGF-like region, conserved site (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	.	.	.	.	D	0.99411	0.9792	H	0.98594	4.275	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98175	1.0454	9	0.87932	D	0	.	16.4553	0.84011	0.0:1.0:0.0:0.0	.	349;346	Q59FL3;Q9UM47	.;NOTC3_HUMAN	V	346;348	ENSP00000263388:G346V	ENSP00000263388:G346V	G	-	2	0	NOTCH3	15161239	1.000000	0.71417	0.995000	0.50966	0.867000	0.49689	7.336000	0.79245	2.175000	0.68902	0.306000	0.20318	GGC	-	pirsf_Notch,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom		0.527	NOTCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH3	protein_coding	OTTHUMT00000465714.1	C	NM_000435	-	Missense_Mutation	15300239	-1	no_errors	ENST00000263388	ensembl	human	known	74_37	missense	SNP	1.000	A
KCTD13	253980	genome.wustl.edu	37	16	29934439	29934439	+	Intron	DEL	T	T	-			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr16:29934439delT	ENST00000568000.1	-	2	1416				KCTD13_ENST00000568721.1_5'Flank|CTD-2574D22.4_ENST00000567795.1_RNA|KCTD13_ENST00000561540.1_Frame_Shift_Del_p.K162fs	NM_178863.3	NP_849194.1	Q8WZ19	BACD1_HUMAN	potassium channel tetramerization domain containing 13						cell migration (GO:0016477)|DNA replication (GO:0006260)|negative regulation of Rho protein signal transduction (GO:0035024)|positive regulation of DNA replication (GO:0045740)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein homooligomerization (GO:0051260)|protein ubiquitination (GO:0016567)|stress fiber assembly (GO:0043149)	Cul3-RING ubiquitin ligase complex (GO:0031463)|nucleus (GO:0005634)	GTP-Rho binding (GO:0017049)			breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(2)	7						CCATATCTCCTTTTTTCTGCT	0.572																																																	0								ENSG00000174943																																			KCTD13	SO:0001627	intron_variant	0				HGNC	AF289573	CCDS10661.1	16p11.2	2013-06-20	2013-06-20		ENSG00000174943	ENSG00000174943			22234	protein-coding gene	gene with protein product	"""polymerase delta-interacting protein 1"", ""TNFAIP1-like"""	608947	"""potassium channel tetramerisation domain containing 13"""			11593007	Standard	NM_178863		Approved	PDIP1, FKSG86, POLDIP1	uc002duv.4	Q8WZ19	OTTHUMG00000132120	ENST00000568000.1:c.414+71A>-	16.37:g.29934439delT		Somatic	0	48	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	22	8.33	A8K0R5|Q96P93|Q96SA1	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_T1-type_BTB,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pfscan_BTB/POZ-like	p.G163fs	ENST00000568000.1	37	c.486	CCDS10661.1	16																																																																																			-	NULL		0.572	KCTD13-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	KCTD13	protein_coding	OTTHUMT00000255162.2	T	NM_178863			29934439	-1	no_errors	ENST00000561540	ensembl	human	putative	74_37	frame_shift_del	DEL	0.001	-
AMER3	205147	genome.wustl.edu	37	2	131521735	131521735	+	Missense_Mutation	SNP	C	C	A			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr2:131521735C>A	ENST00000423981.1	+	2	2200	c.2090C>A	c.(2089-2091)cCa>cAa	p.P697Q	AMER3_ENST00000321420.4_Missense_Mutation_p.P697Q	NM_001105193.1|NM_001105194.1|NM_001105195.1|NM_152698.2	NP_001098663.1|NP_001098664.1|NP_001098665.1|NP_689911.2	Q8N944	AMER3_HUMAN	APC membrane recruitment protein 3	697					Wnt signaling pathway (GO:0016055)	plasma membrane (GO:0005886)	lipid binding (GO:0008289)										GCATGGCCTCCAAGGCAAGAC	0.647																																																	0								ENSG00000178171						23.0	24.0	24.0					2																	131521735		2201	4299	6500	AMER3	SO:0001583	missense	0			-	HGNC	AK095696	CCDS2164.1	2q21.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000178171	ENSG00000178171		"""-"""	26771	protein-coding gene	gene with protein product			"""family with sequence similarity 123C"""	FAM123C		20843316	Standard	NM_001105195		Approved	FLJ38377	uc002trw.2	Q8N944	OTTHUMG00000131637	ENST00000423981.1:c.2090C>A	2.37:g.131521735C>A	ENSP00000392700:p.Pro697Gln	Somatic	0	47	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	26	13.33	B7ZLH6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Uncharacterised_FAM123	p.P697Q	ENST00000423981.1	37	c.2090	CCDS2164.1	2	.	.	.	.	.	.	.	.	.	.	C	7.344	0.621427	0.14193	.	.	ENSG00000178171	ENST00000321420;ENST00000423981	T;T	0.50277	0.75;0.75	4.61	-0.928	0.10448	.	0.816316	0.10278	N	0.693886	T	0.28466	0.0704	L	0.29908	0.895	0.09310	N	1	B	0.11235	0.004	B	0.11329	0.006	T	0.21211	-1.0252	10	0.22109	T	0.4	-7.6317	3.5173	0.07730	0.2075:0.3121:0.0:0.4804	.	697	Q8N944	F123C_HUMAN	Q	697	ENSP00000314914:P697Q;ENSP00000392700:P697Q	ENSP00000314914:P697Q	P	+	2	0	FAM123C	131238205	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.053000	0.11846	-0.121000	0.11787	-0.379000	0.06801	CCA	-	NULL		0.647	AMER3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	AMER3	protein_coding	OTTHUMT00000254531.3	C	NM_152698	-		131521735	+1	no_errors	ENST00000321420	ensembl	human	known	74_37	missense	SNP	0.000	A
MAP9	79884	genome.wustl.edu	37	4	156268989	156268989	+	Missense_Mutation	SNP	C	C	A			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr4:156268989C>A	ENST00000311277.4	-	14	2153	c.1890G>T	c.(1888-1890)gaG>gaT	p.E630D	AC097467.2_ENST00000599555.2_RNA|AC097467.2_ENST00000609716.1_RNA|AC097467.2_ENST00000609254.1_RNA|AC097467.2_ENST00000608463.1_RNA|AC097467.2_ENST00000608406.1_RNA|MAP9_ENST00000515654.1_Missense_Mutation_p.E606D|AC097467.2_ENST00000595760.1_RNA|AC097467.2_ENST00000593387.2_RNA|AC097467.2_ENST00000608762.1_RNA|AC097467.2_ENST00000597939.1_RNA|AC097467.2_ENST00000512269.1_RNA|AC097467.2_ENST00000601977.1_RNA|AC097467.2_ENST00000593486.1_RNA|AC097467.2_ENST00000610249.1_RNA|AC097467.2_ENST00000608544.1_RNA|AC097467.2_ENST00000609486.1_RNA|AC097467.2_ENST00000595229.1_RNA|AC097467.2_ENST00000598252.1_RNA|AC097467.2_ENST00000597955.1_RNA|AC097467.2_ENST00000608092.1_RNA	NM_001039580.1	NP_001034669.1	Q49MG5	MAP9_HUMAN	microtubule-associated protein 9	630					cytokinesis (GO:0000910)|regulation of mitosis (GO:0007088)|spindle assembly involved in mitosis (GO:0090307)	astral microtubule (GO:0000235)|mitotic spindle midzone (GO:1990023)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(8)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	26	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.143)		GAGGAAGTGCCTCACTTTCAA	0.343																																																	0								ENSG00000164114						105.0	102.0	103.0					4																	156268989		2202	4300	6502	MAP9	SO:0001583	missense	0			-	HGNC	AK024812	CCDS35493.1	4q32.1	2008-02-05			ENSG00000164114	ENSG00000164114			26118	protein-coding gene	gene with protein product	"""aster-associated protein"""	610070				16049101	Standard	XM_006714306		Approved	ASAP, FLJ21159	uc003ios.3	Q49MG5	OTTHUMG00000133628	ENST00000311277.4:c.1890G>T	4.37:g.156268989C>A	ENSP00000310593:p.Glu630Asp	Somatic	0	29	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	Q4W5I7|Q68DU1|Q9H781|Q9H7B6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.E630D	ENST00000311277.4	37	c.1890	CCDS35493.1	4	.	.	.	.	.	.	.	.	.	.	C	14.34	2.506728	0.44558	.	.	ENSG00000164114	ENST00000311277;ENST00000515654	T;T	0.27256	1.68;1.78	5.72	-0.192	0.13248	.	0.235520	0.42053	N	0.000777	T	0.17831	0.0428	L	0.52364	1.645	0.23585	N	0.997353	B;B	0.19583	0.021;0.037	B;B	0.19148	0.016;0.024	T	0.18587	-1.0332	10	0.25106	T	0.35	-2.9678	5.7028	0.17891	0.0:0.4113:0.2561:0.3325	.	605;630	B4DVG9;Q49MG5	.;MAP9_HUMAN	D	630;606	ENSP00000310593:E630D;ENSP00000427402:E606D	ENSP00000310593:E630D	E	-	3	2	MAP9	156488439	0.018000	0.18449	0.025000	0.17156	0.932000	0.56968	-0.232000	0.09055	-0.061000	0.13110	-1.202000	0.01658	GAG	-	NULL		0.343	MAP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP9	protein_coding	OTTHUMT00000257771.3	C	NM_001039580	-		156268989	-1	no_errors	ENST00000311277	ensembl	human	known	74_37	missense	SNP	0.015	A
CCDC33	80125	genome.wustl.edu	37	15	74564053	74564053	+	Missense_Mutation	SNP	C	C	T	rs201603982	byFrequency	TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr15:74564053C>T	ENST00000398814.3	+	6	987	c.556C>T	c.(556-558)Cgg>Tgg	p.R186W	CCDC33_ENST00000321288.5_Missense_Mutation_p.R389W	NM_025055.3	NP_079331.3	Q8N5R6	CCD33_HUMAN	coiled-coil domain containing 33	389										breast(2)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(17)|ovary(4)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	39						GATCTTTCTCCGGGGAGTCAA	0.582													c|||	2	0.000399361	0.0015	0.0	5008	,	,		17269	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000140481						35.0	38.0	37.0					15																	74564053		1999	4150	6149	CCDC33	SO:0001583	missense	0			-	HGNC	BC025689	CCDS42058.1, CCDS42059.1, CCDS73753.1	15q24.1	2009-08-06				ENSG00000140481			26552	protein-coding gene	gene with protein product	"""cancer/testis antigen 61"""					12477932	Standard	NM_025055		Approved	FLJ32855, CT61	uc002axo.4	Q8N5R6		ENST00000398814.3:c.556C>T	15.37:g.74564053C>T	ENSP00000381795:p.Arg186Trp	Somatic	0	71	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	51	25.00	A8K3U4|A8MPQ6|A8MV61|A8MVU9|B3KQ49|Q8TAX6|Q9H5Q6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_C2_dom,superfamily_C2_dom	p.R389W	ENST00000398814.3	37	c.1165	CCDS42058.1	15	.	.	.	.	.	.	.	.	.	.	c	13.24	2.179487	0.38511	.	.	ENSG00000140481	ENST00000321288;ENST00000398814	T;T	0.26373	1.74;2.1	4.48	2.42	0.29668	.	0.773622	0.11104	N	0.599308	T	0.20577	0.0495	L	0.40543	1.245	0.22648	N	0.998893	B;B	0.19935	0.04;0.022	B;B	0.12837	0.008;0.007	T	0.20438	-1.0275	10	0.72032	D	0.01	.	7.2644	0.26222	0.1924:0.6212:0.1864:0.0	.	389;186	C9JFX2;Q8N5R6-6	.;.	W	389;186	ENSP00000325012:R389W;ENSP00000381795:R186W	ENSP00000325012:R389W	R	+	1	2	CCDC33	72351106	0.000000	0.05858	0.964000	0.40570	0.932000	0.56968	-0.024000	0.12435	1.062000	0.40625	0.558000	0.71614	CGG	-	NULL		0.582	CCDC33-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CCDC33	protein_coding	OTTHUMT00000419491.2	C	NM_182791	rs201603982		74564053	+1	no_errors	ENST00000321288	ensembl	human	known	74_37	missense	SNP	0.812	T
LRTM1	57408	genome.wustl.edu	37	3	54952905	54952905	+	Missense_Mutation	SNP	C	C	A			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr3:54952905C>A	ENST00000273286.5	-	3	781	c.619G>T	c.(619-621)Ggc>Tgc	p.G207C	CACNA2D3_ENST00000415676.2_Intron|CACNA2D3_ENST00000288197.5_Intron|LRTM1_ENST00000493075.1_Missense_Mutation_p.G131C|CACNA2D3_ENST00000490478.1_Intron|CACNA2D3_ENST00000474759.1_Intron	NM_020678.2	NP_065729.1	Q9HBL6	LRTM1_HUMAN	leucine-rich repeats and transmembrane domains 1	207	LRRCT.					integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|large_intestine(7)|lung(6)|prostate(1)|skin(4)	21				KIRC - Kidney renal clear cell carcinoma(284;0.00975)|Kidney(284;0.0112)|OV - Ovarian serous cystadenocarcinoma(275;0.0502)		CAGATGATGCCGTCTGTTAGT	0.468																																																	0								ENSG00000144771						43.0	41.0	42.0					3																	54952905		2203	4300	6503	LRTM1	SO:0001583	missense	0			-	HGNC	AF225421	CCDS2876.1	3p14.3	2006-01-02			ENSG00000144771	ENSG00000144771			25023	protein-coding gene	gene with protein product						12477932	Standard	NM_020678		Approved	HT017	uc003dhl.3	Q9HBL6	OTTHUMG00000158578	ENST00000273286.5:c.619G>T	3.37:g.54952905C>A	ENSP00000273286:p.Gly207Cys	Somatic	0	35	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	12	20.00	Q8IUU2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.G207C	ENST00000273286.5	37	c.619	CCDS2876.1	3	.	.	.	.	.	.	.	.	.	.	C	10.26	1.302110	0.23736	.	.	ENSG00000144771	ENST00000273286;ENST00000493075	T;D	0.89681	4.26;-2.55	6.07	3.16	0.36331	Cysteine-rich flanking region, C-terminal (1);	0.418861	0.28706	N	0.014407	D	0.88444	0.6438	L	0.31664	0.95	0.09310	N	1	D	0.71674	0.998	P	0.58970	0.849	T	0.81462	-0.0922	10	0.59425	D	0.04	.	11.851	0.52412	0.0:0.8383:0.0:0.1617	.	207	Q9HBL6	LRTM1_HUMAN	C	207;131	ENSP00000273286:G207C;ENSP00000419772:G131C	ENSP00000273286:G207C	G	-	1	0	LRTM1	54927945	0.011000	0.17503	0.010000	0.14722	0.006000	0.05464	1.646000	0.37249	0.329000	0.23460	-0.150000	0.13652	GGC	-	smart_Cys-rich_flank_reg_C		0.468	LRTM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRTM1	protein_coding	OTTHUMT00000351399.1	C	NM_020678	-		54952905	-1	no_errors	ENST00000273286	ensembl	human	known	74_37	missense	SNP	0.049	A
ZBTB41	360023	genome.wustl.edu	37	1	197127605	197127605	+	3'UTR	SNP	T	T	C	rs115447450		TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr1:197127605T>C	ENST00000367405.4	-	0	3682				ZBTB41_ENST00000467322.1_5'UTR	NM_194314.2	NP_919290.2	Q5SVQ8	ZBT41_HUMAN	zinc finger and BTB domain containing 41						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(11)|lung(11)|ovary(1)|skin(3)|upper_aerodigestive_tract(2)	40						TTAAATTTCATTGAGTTACAA	0.299													T|||	1	0.000199681	0.0	0.0	5008	,	,		18086	0.0		0.001	False		,,,				2504	0.0																0								ENSG00000177888																																			ZBTB41	SO:0001624	3_prime_UTR_variant	0			GMAF=0.0005	HGNC		CCDS30960.1	1q31.3	2013-01-08			ENSG00000177888	ENSG00000177888		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	24819	protein-coding gene	gene with protein product							Standard	NM_194314		Approved	FRBZ1, FLJ36199, DKFZp686C06120, ZNF924	uc001gtx.1	Q5SVQ8	OTTHUMG00000036275	ENST00000367405.4:c.*884A>G	1.37:g.197127605T>C		Somatic	0	32	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	58	9	86.57	A2RUA8|Q6MZT8|Q6ZR25|Q7Z4T1|Q8IZ99	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000367405.4	37	NULL	CCDS30960.1	1																																																																																			-	-		0.299	ZBTB41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB41	protein_coding	OTTHUMT00000088249.2	T	NM_194314	rs115447450		197127605	-1	no_errors	ENST00000467322	ensembl	human	known	74_37	rna	SNP	0.003	C
BSN	8927	genome.wustl.edu	37	3	49695575	49695575	+	Missense_Mutation	SNP	G	G	T			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr3:49695575G>T	ENST00000296452.4	+	5	8700	c.8586G>T	c.(8584-8586)gaG>gaT	p.E2862D		NM_003458.3	NP_003449.2	Q9UPA5	BSN_HUMAN	bassoon presynaptic cytomatrix protein	2862					synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuron projection terminus (GO:0044306)|nucleus (GO:0005634)|presynaptic cytoskeletal matrix assembled at active zones (GO:0048788)	metal ion binding (GO:0046872)			breast(8)|central_nervous_system(2)|cervix(2)|endometrium(16)|kidney(3)|large_intestine(17)|lung(37)|ovary(7)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	106				BRCA - Breast invasive adenocarcinoma(193;6.66e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0032)|Kidney(197;0.00336)		CCGCCGAAGAGTCTGCCAAAG	0.652																																																	0								ENSG00000164061						32.0	36.0	35.0					3																	49695575		2202	4300	6502	BSN	SO:0001583	missense	0			-	HGNC	AF052224	CCDS2800.1	3p21	2013-01-07	2013-01-07		ENSG00000164061	ENSG00000164061			1117	protein-coding gene	gene with protein product	"""zinc finger protein 231"", ""neuronal double zinc finger protein"""	604020	"""bassoon (presynaptic cytomatrix protein)"""	ZNF231		9806829, 10329005	Standard	NM_003458		Approved		uc003cxe.4	Q9UPA5	OTTHUMG00000133750	ENST00000296452.4:c.8586G>T	3.37:g.49695575G>T	ENSP00000296452:p.Glu2862Asp	Somatic	0	113	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00	O43161|Q7LGH3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_piccolo,superfamily_Znf_FYVE_PHD	p.E2862D	ENST00000296452.4	37	c.8586	CCDS2800.1	3	.	.	.	.	.	.	.	.	.	.	G	7.487	0.649844	0.14516	.	.	ENSG00000164061	ENST00000296452	T	0.17370	2.28	5.56	1.59	0.23543	.	0.169729	0.52532	D	0.000062	T	0.06554	0.0168	N	0.11651	0.15	0.32857	D	0.507503	B	0.26445	0.149	B	0.20384	0.029	T	0.14062	-1.0486	10	0.40728	T	0.16	-22.8193	2.0138	0.03493	0.2081:0.2472:0.4175:0.1272	.	2862	Q9UPA5	BSN_HUMAN	D	2862	ENSP00000296452:E2862D	ENSP00000296452:E2862D	E	+	3	2	BSN	49670579	0.966000	0.33281	1.000000	0.80357	0.911000	0.54048	0.061000	0.14366	0.326000	0.23384	-0.361000	0.07541	GAG	-	NULL		0.652	BSN-001	KNOWN	NMD_exception|basic|appris_principal|exp_conf|CCDS	protein_coding	BSN	protein_coding	OTTHUMT00000258164.1	G	NM_003458	-		49695575	+1	no_errors	ENST00000296452	ensembl	human	known	74_37	missense	SNP	0.996	T
DCC	1630	genome.wustl.edu	37	18	50985606	50985606	+	Missense_Mutation	SNP	C	C	T			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr18:50985606C>T	ENST00000442544.2	+	24	4013	c.3397C>T	c.(3397-3399)Cgg>Tgg	p.R1133W	DCC_ENST00000581580.1_Missense_Mutation_p.R768W	NM_005215.3	NP_005206.2	P43146	DCC_HUMAN	DCC netrin 1 receptor	1133					anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|dorsal/ventral axon guidance (GO:0033563)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|neuron migration (GO:0001764)|positive regulation of apoptotic process (GO:0043065)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|regulation of apoptotic process (GO:0042981)|response to amphetamine (GO:0001975)|spinal cord ventral commissure morphogenesis (GO:0021965)	axon (GO:0030424)|cytosol (GO:0005829)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)|transcription coactivator activity (GO:0003713)|transmembrane signaling receptor activity (GO:0004888)			NS(3)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(23)|liver(1)|lung(56)|ovary(7)|pancreas(3)|prostate(2)|skin(16)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(6)	148		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		CCATAGGAAACGGGCCACCCA	0.443																																																	0								ENSG00000187323						49.0	49.0	49.0					18																	50985606		2203	4300	6503	DCC	SO:0001583	missense	0			-	HGNC	X76132	CCDS11952.1	18q21.1	2014-06-20	2014-06-20		ENSG00000187323	ENSG00000187323		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2701	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 1"""	120470	"""deleted in colorectal carcinoma"""			2294591, 24400119	Standard	NM_005215		Approved	IGDCC1, NTN1R1	uc002lfe.2	P43146	OTTHUMG00000132698	ENST00000442544.2:c.3397C>T	18.37:g.50985606C>T	ENSP00000389140:p.Arg1133Trp	Somatic	0	52	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	11	63.33		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Neogenin_C,pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.R1133W	ENST00000442544.2	37	c.3397	CCDS11952.1	18	.	.	.	.	.	.	.	.	.	.	C	10.35	1.326766	0.24080	.	.	ENSG00000187323	ENST00000442544	T	0.55588	0.51	5.93	5.01	0.66863	.	0.148193	0.43260	D	0.000595	T	0.68568	0.3015	L	0.58101	1.795	0.45634	D	0.998562	D	0.89917	1.0	D	0.87578	0.998	T	0.70208	-0.4935	10	0.87932	D	0	-8.3898	14.8726	0.70471	0.1442:0.8558:0.0:0.0	.	1133	P43146	DCC_HUMAN	W	1133	ENSP00000389140:R1133W	ENSP00000389140:R1133W	R	+	1	2	DCC	49239604	1.000000	0.71417	1.000000	0.80357	0.505000	0.33919	3.604000	0.54081	2.826000	0.97356	0.655000	0.94253	CGG	-	pfam_Neogenin_C		0.443	DCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCC	protein_coding	OTTHUMT00000255996.3	C	NM_005215	-		50985606	+1	no_errors	ENST00000442544	ensembl	human	known	74_37	missense	SNP	1.000	T
PUS3	83480	genome.wustl.edu	37	11	125765477	125765477	+	Missense_Mutation	SNP	G	G	T	rs370110541		TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr11:125765477G>T	ENST00000530811.1	-	2	631	c.586C>A	c.(586-588)Cgc>Agc	p.R196S	HYLS1_ENST00000425380.2_Intron|PUS3_ENST00000227474.3_Missense_Mutation_p.R196S|HYLS1_ENST00000356438.3_Intron|HYLS1_ENST00000526028.1_Intron			Q9BZE2	PUS3_HUMAN	pseudouridylate synthase 3	196					tRNA pseudouridine synthesis (GO:0031119)	nucleus (GO:0005634)	pseudouridine synthase activity (GO:0009982)|RNA binding (GO:0003723)			NS(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)	10	all_hematologic(175;0.177)	Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.131)|all_lung(97;0.139)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.043)		AAAAAATAGCGGTAAGTCCGC	0.468																																																	0								ENSG00000110060						63.0	66.0	65.0					11																	125765477		2201	4299	6500	PUS3	SO:0001583	missense	0			-	HGNC	BC004822	CCDS8466.1, CCDS73411.1	11q24.2	2008-02-05							25461	protein-coding gene	gene with protein product						12477932	Standard	NM_031307		Approved	FKSG32	uc001qcy.2	Q9BZE2		ENST00000530811.1:c.586C>A	11.37:g.125765477G>T	ENSP00000432386:p.Arg196Ser	Somatic	0	40	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	20	13.04	B2RAM0|Q96D17|Q96J23|Q96NB4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PsdUridine_synth_TruA_a/b_dom,superfamily_PsdUridine_synth_cat_dom,tigrfam_PsdUridine_synth_TruA	p.R196S	ENST00000530811.1	37	c.586	CCDS8466.1	11	.	.	.	.	.	.	.	.	.	.	G	22.1	4.245073	0.79912	.	.	ENSG00000110060	ENST00000227474;ENST00000530811	T;T	0.56776	0.44;0.44	5.97	5.97	0.96955	Pseudouridine synthase I, TruA, C-terminal (1);Pseudouridine synthase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.67011	0.2848	M	0.79805	2.47	0.80722	D	1	P	0.51449	0.945	P	0.48454	0.578	T	0.71279	-0.4640	10	0.72032	D	0.01	-3.6941	20.4135	0.99023	0.0:0.0:1.0:0.0	.	196	Q9BZE2	PUS3_HUMAN	S	196	ENSP00000227474:R196S;ENSP00000432386:R196S	ENSP00000227474:R196S	R	-	1	0	PUS3	125270687	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.368000	0.79567	2.835000	0.97688	0.591000	0.81541	CGC	-	superfamily_PsdUridine_synth_cat_dom,tigrfam_PsdUridine_synth_TruA		0.468	PUS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PUS3	protein_coding	OTTHUMT00000386783.1	G	NM_031307	-		125765477	-1	no_errors	ENST00000227474	ensembl	human	known	74_37	missense	SNP	1.000	T
ITGA6	3655	genome.wustl.edu	37	2	173349540	173349540	+	Missense_Mutation	SNP	A	A	G			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr2:173349540A>G	ENST00000264106.6	+	13	1900	c.1697A>G	c.(1696-1698)gAa>gGa	p.E566G	ITGA6_ENST00000409532.1_Missense_Mutation_p.E408G|AC093818.1_ENST00000442417.1_RNA|ITGA6_ENST00000375221.2_Missense_Mutation_p.E566G|ITGA6_ENST00000343713.4_Missense_Mutation_p.E522G|ITGA6_ENST00000409080.1_Missense_Mutation_p.E527G|ITGA6_ENST00000264107.7_Missense_Mutation_p.E527G			P23229	ITA6_HUMAN	integrin, alpha 6	566					amelogenesis (GO:0097186)|blood coagulation (GO:0007596)|brown fat cell differentiation (GO:0050873)|cell adhesion mediated by integrin (GO:0033627)|cell junction assembly (GO:0034329)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|cell-substrate junction assembly (GO:0007044)|cellular response to extracellular stimulus (GO:0031668)|cellular response to organic cyclic compound (GO:0071407)|digestive tract development (GO:0048565)|ectodermal cell differentiation (GO:0010668)|extracellular matrix organization (GO:0030198)|filopodium assembly (GO:0046847)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|nail development (GO:0035878)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|renal system development (GO:0072001)|single organismal cell-cell adhesion (GO:0016337)|skin development (GO:0043588)	basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell surface (GO:0009986)|cell-cell adherens junction (GO:0005913)|external side of plasma membrane (GO:0009897)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integrin alpha6-beta4 complex (GO:0034676)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	44			OV - Ovarian serous cystadenocarcinoma(117;0.0979)			GCTGAAAAAGAAAGAAGAAAA	0.383																																																	0								ENSG00000091409						58.0	59.0	58.0					2																	173349540		2203	4300	6503	ITGA6	SO:0001583	missense	0			-	HGNC		CCDS2249.1, CCDS46451.1	2q31.1	2010-09-20			ENSG00000091409	ENSG00000091409		"""CD molecules"", ""Integrins"""	6142	protein-coding gene	gene with protein product		147556					Standard	NM_001079818		Approved	CD49f	uc002uhp.1	P23229	OTTHUMG00000132277	ENST00000264106.6:c.1697A>G	2.37:g.173349540A>G	ENSP00000264106:p.Glu566Gly	Somatic	0	31	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	4	76.47	B2RMU9|B4DG69|B4DKB8|C4AM96|G5E9H1|Q08443|Q0MRC7|Q14646|Q16508|Q53RX7|Q59HB7|Q86VL6|Q9UCT1|Q9UN03	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Integrin_alpha-2,pfam_FG-GAP,smart_Int_alpha_beta-p,prints_Integrin_alpha	p.E566G	ENST00000264106.6	37	c.1697		2	.	.	.	.	.	.	.	.	.	.	A	16.51	3.143188	0.57044	.	.	ENSG00000091409	ENST00000409532;ENST00000264107;ENST00000264106;ENST00000375221;ENST00000343713;ENST00000409080;ENST00000442250;ENST00000458358	T;T;T;T;T;T;T;T	0.47869	0.83;0.83;0.83;0.83;0.83;0.83;0.83;0.83	5.77	5.77	0.91146	.	0.245405	0.47852	D	0.000220	T	0.50633	0.1627	M	0.63428	1.95	0.45762	D	0.998656	B;B;B;B	0.30193	0.026;0.272;0.156;0.141	B;B;B;B	0.35182	0.025;0.197;0.197;0.197	T	0.53521	-0.8427	10	0.66056	D	0.02	.	14.3323	0.66566	1.0:0.0:0.0:0.0	.	522;566;527;527	P23229-4;P23229-9;G5E9H1;P23229-2	.;.;.;.	G	408;527;566;566;522;527;566;522	ENSP00000386614:E408G;ENSP00000264107:E527G;ENSP00000264106:E566G;ENSP00000364369:E566G;ENSP00000341078:E522G;ENSP00000386896:E527G;ENSP00000406694:E566G;ENSP00000394169:E522G	ENSP00000264106:E566G	E	+	2	0	ITGA6	173057786	0.997000	0.39634	1.000000	0.80357	0.998000	0.95712	3.338000	0.52128	2.200000	0.70718	0.459000	0.35465	GAA	-	pfam_Integrin_alpha-2		0.383	ITGA6-201	KNOWN	basic	protein_coding	ITGA6	protein_coding		A		-		173349540	+1	no_errors	ENST00000264106	ensembl	human	known	74_37	missense	SNP	0.998	G
DNAH7	56171	genome.wustl.edu	37	2	196681510	196681510	+	Missense_Mutation	SNP	C	C	A			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr2:196681510C>A	ENST00000312428.6	-	51	9703	c.9603G>T	c.(9601-9603)atG>atT	p.M3201I		NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	3201					cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)			NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						GACGATAGCCCATGCGGGTGG	0.428																																																	0								ENSG00000118997						153.0	155.0	154.0					2																	196681510		1890	4116	6006	DNAH7	SO:0001583	missense	0			-	HGNC	AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.9603G>T	2.37:g.196681510C>A	ENSP00000311273:p.Met3201Ile	Somatic	0	41	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	42	10.64	B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,superfamily_P-loop_NTPase,superfamily_Signal_recog_particle_SRP9/14,smart_AAA+_ATPase,pfscan_EF_hand_dom	p.M3201I	ENST00000312428.6	37	c.9603	CCDS42794.1	2	.	.	.	.	.	.	.	.	.	.	C	13.27	2.187948	0.38609	.	.	ENSG00000118997	ENST00000312428	D	0.86366	-2.11	5.11	5.11	0.69529	.	0.277839	0.41938	D	0.000787	D	0.88514	0.6457	M	0.79926	2.475	0.80722	D	1	B	0.20164	0.042	B	0.19946	0.027	D	0.86040	0.1519	10	0.52906	T	0.07	.	18.3163	0.90223	0.0:1.0:0.0:0.0	.	3201	Q8WXX0	DYH7_HUMAN	I	3201	ENSP00000311273:M3201I	ENSP00000311273:M3201I	M	-	3	0	DNAH7	196389755	1.000000	0.71417	1.000000	0.80357	0.619000	0.37552	4.761000	0.62243	2.652000	0.90054	0.591000	0.81541	ATG	-	NULL		0.428	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH7	protein_coding	OTTHUMT00000335202.3	C	NM_018897	-		196681510	-1	no_errors	ENST00000312428	ensembl	human	known	74_37	missense	SNP	1.000	A
RSPH1	89765	genome.wustl.edu	37	21	43905899	43905899	+	Silent	SNP	G	G	A			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr21:43905899G>A	ENST00000291536.3	-	5	548	c.381C>T	c.(379-381)acC>acT	p.T127T	RSPH1_ENST00000398352.3_Silent_p.T89T	NM_080860.2	NP_543136.1	Q8WYR4	RSPH1_HUMAN	radial spoke head 1 homolog (Chlamydomonas)	127					axoneme assembly (GO:0035082)|meiotic nuclear division (GO:0007126)	cytosol (GO:0005829)|motile cilium (GO:0031514)|nucleus (GO:0005634)				large_intestine(7)|lung(2)|ovary(1)|prostate(1)|stomach(1)	12						CGTATAAATAGGTGCCTTGCC	0.517																																					Esophageal Squamous(23;63 706 6286 10288 12913)												0								ENSG00000160188						152.0	132.0	139.0					21																	43905899		2203	4300	6503	RSPH1	SO:0001819	synonymous_variant	0			-	HGNC	AB006536	CCDS13688.1, CCDS68210.1	21q22.3	2014-02-03	2007-06-25	2007-06-25	ENSG00000160188	ENSG00000160188			12371	protein-coding gene	gene with protein product	"""meichroacidin"""	609314	"""testis specific A2 homolog (mouse)"""	TSGA2		9403069, 9578619, 17451891	Standard	XM_005261208		Approved	FLJ32753, RSP44, RSPH10A, CILD24	uc002zbg.3	Q8WYR4	OTTHUMG00000086804	ENST00000291536.3:c.381C>T	21.37:g.43905899G>A		Somatic	0	53	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	33	13.16	A8MWV0|B2RBN9|Q3MJA1	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_MORN,smart_MORN	p.T127	ENST00000291536.3	37	c.381	CCDS13688.1	21																																																																																			-	pfam_MORN,smart_MORN		0.517	RSPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RSPH1	protein_coding	OTTHUMT00000195379.1	G		-		43905899	-1	no_errors	ENST00000291536	ensembl	human	known	74_37	silent	SNP	1.000	A
KRT77	374454	genome.wustl.edu	37	12	53086400	53086400	+	Missense_Mutation	SNP	G	G	A	rs201690097		TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr12:53086400G>A	ENST00000341809.3	-	7	1260	c.1232C>T	c.(1231-1233)tCg>tTg	p.S411L	KRT77_ENST00000537195.1_Missense_Mutation_p.S178L|RP11-641A6.3_ENST00000547533.1_RNA	NM_175078.2	NP_778253.2	Q7Z794	K2C1B_HUMAN	keratin 77	411	Coil 2.|Rod.					cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			NS(2)|endometrium(2)|large_intestine(3)|lung(11)|ovary(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	25						CTCAGCATCCGAAATGAGTGA	0.572													G|||	1	0.000199681	0.0	0.0014	5008	,	,		21686	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000189182	G	LEU/SER	0,4404		0,0,2202	50.0	45.0	46.0		1232	2.6	0.1	12		46	2,8534	2.2+/-6.3	1,0,4267	yes	missense	KRT77	NM_175078.2	145	1,0,6469	AA,AG,GG		0.0234,0.0,0.0155	benign	411/579	53086400	2,12938	2202	4268	6470	KRT77	SO:0001583	missense	0			GMAF=0.0005	HGNC	BK000975	CCDS8837.1	12q13.13	2013-06-25	2006-07-17	2006-07-17	ENSG00000189182	ENSG00000189182		"""-"", ""Intermediate filaments type II, keratins (basic)"""	20411	protein-coding gene	gene with protein product		611158	"""keratin 1B"""	KRT1B		11683385, 16831889	Standard	NM_175078		Approved		uc001saw.3	Q7Z794	OTTHUMG00000169450	ENST00000341809.3:c.1232C>T	12.37:g.53086400G>A	ENSP00000342710:p.Ser411Leu	Somatic	0	39	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	11	54.17	Q7RTS8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_IF,superfamily_Prefoldin,prints_Keratin_II	p.S411L	ENST00000341809.3	37	c.1232	CCDS8837.1	12	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	G	10.63	1.402766	0.25291	0.0	2.34E-4	ENSG00000189182	ENST00000341809;ENST00000537195	T;D	0.83837	-0.96;-1.77	4.47	2.57	0.30868	Filament (1);	.	.	.	.	T	0.78541	0.4299	L	0.45698	1.435	0.23043	N	0.998387	B	0.28584	0.216	B	0.32928	0.155	T	0.69465	-0.5138	9	0.87932	D	0	.	9.6207	0.39719	0.079:0.1424:0.7786:0.0	.	411	Q7Z794	K2C1B_HUMAN	L	411;178	ENSP00000342710:S411L;ENSP00000440803:S178L	ENSP00000342710:S411L	S	-	2	0	KRT77	51372667	0.875000	0.30112	0.149000	0.22428	0.095000	0.18619	4.604000	0.61112	0.432000	0.26286	0.400000	0.26472	TCG	-	pfam_IF		0.572	KRT77-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT77	protein_coding	OTTHUMT00000404111.1	G	NM_175078	rs201690097		53086400	-1	no_errors	ENST00000341809	ensembl	human	known	74_37	missense	SNP	0.560	A
RAB11FIP5	26056	genome.wustl.edu	37	2	73316336	73316336	+	Missense_Mutation	SNP	A	A	G			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr2:73316336A>G	ENST00000258098.6	-	2	779	c.539T>C	c.(538-540)cTg>cCg	p.L180P	RAB11FIP5_ENST00000493523.2_5'UTR	NM_015470.2	NP_056285.1	Q9BXF6	RFIP5_HUMAN	RAB11 family interacting protein 5 (class I)	180					cellular response to acidic pH (GO:0071468)|insulin secretion involved in cellular response to glucose stimulus (GO:0035773)|protein transport (GO:0015031)|regulated secretory pathway (GO:0045055)|regulation of protein localization to cell surface (GO:2000008)	early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|microtubule organizing center (GO:0005815)|mitochondrial outer membrane (GO:0005741)|recycling endosome (GO:0055037)|secretory granule (GO:0030141)	gamma-tubulin binding (GO:0043015)			biliary_tract(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(9)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	23						CTTCATGGACAGGTCAAACAT	0.527																																																	0								ENSG00000135631						275.0	273.0	274.0					2																	73316336		2203	4300	6503	RAB11FIP5	SO:0001583	missense	0			-	HGNC	AF334812	CCDS1923.1	2p13	2008-02-05			ENSG00000135631	ENSG00000135631			24845	protein-coding gene	gene with protein product		605536				10048485, 11163216	Standard	NM_015470		Approved	GAF1, KIAA0857, RIP11, pp75	uc002sis.4	Q9BXF6	OTTHUMG00000129779	ENST00000258098.6:c.539T>C	2.37:g.73316336A>G	ENSP00000258098:p.Leu180Pro	Somatic	0	51	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	24	14.29	O94939|Q9P0M1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Rab-bd_FIP-RBD,pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	p.L180P	ENST00000258098.6	37	c.539	CCDS1923.1	2	.	.	.	.	.	.	.	.	.	.	A	20.6	4.010130	0.75046	.	.	ENSG00000135631	ENST00000258098	T	0.48522	0.81	4.6	4.6	0.57074	C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.64402	D	0.000015	T	0.64681	0.2620	M	0.69358	2.11	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.64045	-0.6499	10	0.37606	T	0.19	-10.7927	13.2544	0.60070	1.0:0.0:0.0:0.0	.	180;180	Q9BXF6;Q2Z1P3	RFIP5_HUMAN;.	P	180	ENSP00000258098:L180P	ENSP00000258098:L180P	L	-	2	0	RAB11FIP5	73169844	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.139000	0.94554	2.077000	0.62373	0.459000	0.35465	CTG	-	superfamily_C2_dom		0.527	RAB11FIP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB11FIP5	protein_coding	OTTHUMT00000251995.1	A	NM_015470	-		73316336	-1	no_errors	ENST00000258098	ensembl	human	known	74_37	missense	SNP	1.000	G
DNAH8	1769	genome.wustl.edu	37	6	38816506	38816506	+	Missense_Mutation	SNP	G	G	A			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr6:38816506G>A	ENST00000359357.3	+	35	4731	c.4477G>A	c.(4477-4479)Gta>Ata	p.V1493I	DNAH8_ENST00000441566.1_Missense_Mutation_p.V1493I|DNAH8_ENST00000449981.2_Missense_Mutation_p.V1710I			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	1493					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						AGAGTGGCTCGTAGTACAGAA	0.368																																																	0								ENSG00000124721						80.0	87.0	85.0					6																	38816506		2203	4300	6503	DNAH8	SO:0001583	missense	0			-	HGNC	Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.4477G>A	6.37:g.38816506G>A	ENSP00000352312:p.Val1493Ile	Somatic	0	29	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	43	46	44.33	O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.V1493I	ENST00000359357.3	37	c.4477		6	.	.	.	.	.	.	.	.	.	.	G	6.451	0.451347	0.12223	.	.	ENSG00000124721	ENST00000449981;ENST00000327475;ENST00000359357;ENST00000441566	T;T;T	0.60920	0.15;0.15;0.15	5.78	-3.56	0.04626	Dynein heavy chain, domain-2 (1);	0.798663	0.11567	N	0.551143	T	0.19167	0.0460	N	0.16368	0.405	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.17992	-1.0351	10	0.36615	T	0.2	.	14.7748	0.69724	0.6568:0.0:0.3432:0.0	.	1493	Q96JB1	DYH8_HUMAN	I	1698;1698;1493;1493	ENSP00000333363:V1698I;ENSP00000352312:V1493I;ENSP00000402294:V1493I	ENSP00000333363:V1698I	V	+	1	0	DNAH8	38924484	0.000000	0.05858	0.000000	0.03702	0.738000	0.42128	-0.162000	0.10012	-0.791000	0.04486	-1.105000	0.02106	GTA	-	pfam_Dynein_heavy_dom-2		0.368	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	DNAH8	protein_coding	OTTHUMT00000043574.1	G	NM_001206927	-		38816506	+1	no_errors	ENST00000359357	ensembl	human	known	74_37	missense	SNP	0.001	A
LRRTM4	80059	genome.wustl.edu	37	2	77746658	77746658	+	Missense_Mutation	SNP	C	C	T			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr2:77746658C>T	ENST00000409093.1	-	3	673	c.337G>A	c.(337-339)Gaa>Aaa	p.E113K	LRRTM4_ENST00000409884.1_Missense_Mutation_p.E113K|LRRTM4_ENST00000409088.3_Missense_Mutation_p.E113K|LRRTM4_ENST00000409911.1_Missense_Mutation_p.E114K|LRRTM4_ENST00000409282.1_Missense_Mutation_p.E114K			Q86VH4	LRRT4_HUMAN	leucine rich repeat transmembrane neuronal 4	113					alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|regulation of presynaptic membrane organization (GO:1901629)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)				autonomic_ganglia(1)|endometrium(1)|large_intestine(6)|lung(49)|ovary(2)|pancreas(3)|prostate(1)|upper_aerodigestive_tract(1)	64				Colorectal(11;0.059)		AGAATTAATTCTTTCAGTCTA	0.393																																																	0								ENSG00000176204						149.0	135.0	140.0					2																	77746658		1843	4088	5931	LRRTM4	SO:0001583	missense	0			-	HGNC	AK122612	CCDS46346.1, CCDS46347.1, CCDS74530.1	2p12	2008-02-05			ENSG00000176204	ENSG00000176204			19411	protein-coding gene	gene with protein product		610870				12676565	Standard	NM_024993		Approved	FLJ12568	uc002snr.3	Q86VH4	OTTHUMG00000152842	ENST00000409093.1:c.337G>A	2.37:g.77746658C>T	ENSP00000386357:p.Glu113Lys	Somatic	0	33	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	41	9	82.00	Q4FZ98|Q6UXJ7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.E114K	ENST00000409093.1	37	c.340	CCDS46346.1	2	.	.	.	.	.	.	.	.	.	.	C	22.9	4.350664	0.82132	.	.	ENSG00000176204	ENST00000409911;ENST00000409884;ENST00000409093;ENST00000409088;ENST00000409282	T;T;T;T;T	0.57907	0.37;0.37;0.37;0.37;0.37	5.96	5.96	0.96718	.	0.048793	0.85682	D	0.000000	T	0.65729	0.2719	L	0.37697	1.125	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	T	0.62709	-0.6797	10	0.45353	T	0.12	.	18.9646	0.92691	0.0:1.0:0.0:0.0	.	114;113;113	Q4KMX1;Q86VH4-2;Q86VH4	.;.;LRRT4_HUMAN	K	114;113;113;113;114	ENSP00000387228:E114K;ENSP00000387297:E113K;ENSP00000386357:E113K;ENSP00000386236:E113K;ENSP00000386286:E114K	ENSP00000386236:E113K	E	-	1	0	LRRTM4	77600166	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.826000	0.97356	0.655000	0.94253	GAA	-	smart_Leu-rich_rpt_typical-subtyp		0.393	LRRTM4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LRRTM4	protein_coding	OTTHUMT00000328225.1	C	NM_024993	-		77746658	-1	no_errors	ENST00000409911	ensembl	human	known	74_37	missense	SNP	1.000	T
VANGL1	81839	genome.wustl.edu	37	1	116206718	116206718	+	Missense_Mutation	SNP	G	G	T			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr1:116206718G>T	ENST00000355485.2	+	4	912	c.641G>T	c.(640-642)cGg>cTg	p.R214L	VANGL1_ENST00000310260.3_Missense_Mutation_p.R214L|VANGL1_ENST00000369510.4_Missense_Mutation_p.R212L|VANGL1_ENST00000369509.1_Missense_Mutation_p.R214L	NM_001172411.1|NM_138959.2	NP_001165882.1|NP_620409.1	Q8TAA9	VANG1_HUMAN	VANGL planar cell polarity protein 1	214					multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(2)|liver(2)|lung(13)|urinary_tract(1)	27	Lung SC(450;0.211)	all_cancers(81;1.24e-06)|all_epithelial(167;1.02e-06)|all_lung(203;7.95e-06)|Lung NSC(69;4.97e-05)		Lung(183;0.0171)|Colorectal(144;0.0686)|LUSC - Lung squamous cell carcinoma(189;0.0903)|all cancers(265;0.108)|COAD - Colon adenocarcinoma(174;0.111)|Epithelial(280;0.12)		TCTCGGGACCGGAATTACCAG	0.522																																																	0								ENSG00000173218						190.0	192.0	191.0					1																	116206718		2203	4300	6503	VANGL1	SO:0001583	missense	0			-	HGNC	AB075805	CCDS883.1, CCDS53350.1	1p13.1	2013-03-05	2013-03-05		ENSG00000173218	ENSG00000173218			15512	protein-coding gene	gene with protein product		610132	"""vang (van gogh, Drosophila)-like 1, vang, van gogh-like 1 (Drosophila)"", ""vang-like 1 (van gogh, Drosophila)"""			11956595, 12011995	Standard	NM_001172411		Approved	STB2	uc001efv.1	Q8TAA9	OTTHUMG00000011971	ENST00000355485.2:c.641G>T	1.37:g.116206718G>T	ENSP00000347672:p.Arg214Leu	Somatic	0	69	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52	Q5T1D3|Q5T1D4|Q86WG8|Q8N559	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Strabismus,pirsf_Strabismus	p.R214L	ENST00000355485.2	37	c.641	CCDS883.1	1	.	.	.	.	.	.	.	.	.	.	G	10.73	1.431398	0.25813	.	.	ENSG00000173218	ENST00000355485;ENST00000369510;ENST00000310260;ENST00000369509	T;T;T;T	0.80393	-1.37;-1.37;-1.37;-1.37	5.73	3.86	0.44501	.	0.446972	0.24771	N	0.035732	T	0.48607	0.1509	L	0.42245	1.32	0.25900	N	0.983362	B;B	0.09022	0.001;0.002	B;B	0.10450	0.003;0.005	T	0.33599	-0.9862	10	0.27785	T	0.31	-13.1007	2.0005	0.03466	0.2309:0.1441:0.4929:0.1321	.	212;214	Q8TAA9-2;Q8TAA9	.;VANG1_HUMAN	L	214;212;214;214	ENSP00000347672:R214L;ENSP00000358523:R212L;ENSP00000310800:R214L;ENSP00000358522:R214L	ENSP00000310800:R214L	R	+	2	0	VANGL1	116008241	0.992000	0.36948	0.739000	0.30968	0.943000	0.58893	2.611000	0.46334	0.883000	0.36040	-0.142000	0.14014	CGG	-	pfam_Strabismus,pirsf_Strabismus		0.522	VANGL1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VANGL1	protein_coding	OTTHUMT00000033096.1	G		-		116206718	+1	no_errors	ENST00000310260	ensembl	human	known	74_37	missense	SNP	0.633	T
HS3ST6	64711	genome.wustl.edu	37	16	1961876	1961876	+	Silent	SNP	G	G	A			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr16:1961876G>A	ENST00000293937.3	-	2	743	c.744C>T	c.(742-744)agC>agT	p.S248S	HS3ST6_ENST00000443547.1_Silent_p.S217S|HS3ST6_ENST00000454677.2_Silent_p.S265S			Q96QI5	HS3S6_HUMAN	heparan sulfate (glucosamine) 3-O-sulfotransferase 6	248					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity (GO:0008467)			endometrium(2)|lung(2)	4						GACGCTCCCCGCTGACGAACA	0.667																																																	0								ENSG00000162040						44.0	54.0	50.0					16																	1961876		2190	4295	6485	HS3ST6	SO:0001819	synonymous_variant	0			-	HGNC			16p13.3	2008-10-30	2003-06-11	2003-06-13	ENSG00000162040	ENSG00000162040		"""Sulfotransferases, membrane-bound"""	14178	protein-coding gene	gene with protein product			"""heparan sulfate (glucosamine) 3-O-sulfotransferase 5"""	HS3ST5		11157797	Standard	NM_001009606		Approved		uc002cnf.3	Q96QI5	OTTHUMG00000047860	ENST00000293937.3:c.744C>T	16.37:g.1961876G>A		Somatic	1	131	0.76		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	45	59	43.27	Q96RX7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase	p.S248	ENST00000293937.3	37	c.744		16																																																																																			-	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase		0.667	HS3ST6-201	KNOWN	basic|appris_principal	protein_coding	HS3ST6	protein_coding		G	NM_001009606	-		1961876	-1	no_errors	ENST00000293937	ensembl	human	known	74_37	silent	SNP	0.988	A
OR10Q1	219960	genome.wustl.edu	37	11	57996225	57996225	+	Missense_Mutation	SNP	C	C	T			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr11:57996225C>T	ENST00000316770.2	-	1	165	c.123G>A	c.(121-123)atG>atA	p.M41I		NM_001004471.2	NP_001004471.1	Q8NGQ4	O10Q1_HUMAN	olfactory receptor, family 10, subfamily Q, member 1	41						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(26)|ovary(2)	35		Breast(21;0.0589)				CACAGAGGATCATCAAGTAGA	0.527																																																	0								ENSG00000180475						114.0	122.0	119.0					11																	57996225		2200	4294	6494	OR10Q1	SO:0001583	missense	0			-	HGNC	AB065735	CCDS31547.1	11q12.1	2012-08-09			ENSG00000180475	ENSG00000180475		"""GPCR / Class A : Olfactory receptors"""	15134	protein-coding gene	gene with protein product							Standard	NM_001004471		Approved		uc010rkd.2	Q8NGQ4	OTTHUMG00000167542	ENST00000316770.2:c.123G>A	11.37:g.57996225C>T	ENSP00000314324:p.Met41Ile	Somatic	0	41	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	5	80.77	Q6IFG4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.M41I	ENST00000316770.2	37	c.123	CCDS31547.1	11	.	.	.	.	.	.	.	.	.	.	C	8.116	0.779975	0.16120	.	.	ENSG00000180475	ENST00000316770	T	0.00392	7.58	5.28	2.25	0.28309	.	0.123417	0.36555	N	0.002525	T	0.00178	0.0005	N	0.13168	0.305	0.09310	N	1	B	0.34181	0.44	B	0.30646	0.118	T	0.31558	-0.9939	10	0.10377	T	0.69	.	11.4267	0.50015	0.136:0.3334:0.5306:0.0	.	41	Q8NGQ4	O10Q1_HUMAN	I	41	ENSP00000314324:M41I	ENSP00000314324:M41I	M	-	3	0	OR10Q1	57752801	0.000000	0.05858	0.013000	0.15412	0.626000	0.37791	-0.168000	0.09925	0.305000	0.22832	0.650000	0.86243	ATG	-	prints_GPCR_Rhodpsn		0.527	OR10Q1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10Q1	protein_coding	OTTHUMT00000394706.1	C	NM_001004471	-		57996225	-1	no_errors	ENST00000316770	ensembl	human	known	74_37	missense	SNP	0.003	T
PKHD1	5314	genome.wustl.edu	37	6	51619707	51619707	+	Missense_Mutation	SNP	C	C	T			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr6:51619707C>T	ENST00000371117.3	-	56	8947	c.8672G>A	c.(8671-8673)cGc>cAc	p.R2891H	PKHD1_ENST00000340994.4_Missense_Mutation_p.R2891H	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	2891					cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					GTCATGGGGGCGCCAATCCAC	0.433																																																	0								ENSG00000170927						155.0	146.0	149.0					6																	51619707		2203	4300	6503	PKHD1	SO:0001583	missense	0			-	HGNC	AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.8672G>A	6.37:g.51619707C>T	ENSP00000360158:p.Arg2891His	Somatic	0	8	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	9	70.00	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_IPT,pfam_G8_domain,superfamily_Ig_E-set,superfamily_Pectin_lyase_fold/virulence,smart_IPT,smart_PbH1	p.R2891H	ENST00000371117.3	37	c.8672	CCDS4935.1	6	.	.	.	.	.	.	.	.	.	.	C	14.66	2.603129	0.46423	.	.	ENSG00000170927	ENST00000371117;ENST00000340994;ENST00000393616	D;D	0.83755	-1.76;-1.76	5.63	-4.53	0.03462	.	0.940169	0.08899	N	0.877580	T	0.66896	0.2836	L	0.45051	1.395	0.09310	N	1	D;D;P	0.56521	0.976;0.975;0.947	B;P;B	0.45474	0.306;0.482;0.306	T	0.67601	-0.5629	10	0.62326	D	0.03	.	14.2904	0.66273	0.0:0.3183:0.0:0.6817	.	2891;2891;2891	A8MVM9;P08F94-2;P08F94	.;.;PKHD1_HUMAN	H	2891	ENSP00000360158:R2891H;ENSP00000341097:R2891H	ENSP00000341097:R2891H	R	-	2	0	PKHD1	51727666	0.007000	0.16637	0.389000	0.26208	0.414000	0.31173	-0.412000	0.07132	-0.887000	0.03961	-0.123000	0.14984	CGC	-	NULL		0.433	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PKHD1	protein_coding	OTTHUMT00000040893.1	C	NM_138694	-		51619707	-1	no_errors	ENST00000371117	ensembl	human	known	74_37	missense	SNP	0.009	T
ASAP1	50807	genome.wustl.edu	37	8	131414143	131414143	+	Nonsense_Mutation	SNP	G	G	T			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr8:131414143G>T	ENST00000518721.1	-	2	274	c.47C>A	c.(46-48)tCa>tAa	p.S16*	ASAP1_ENST00000357668.1_Nonsense_Mutation_p.S16*|ASAP1_ENST00000520625.1_5'UTR	NM_001247996.1|NM_018482.3	NP_001234925.1|NP_060952.2	Q9ULH1	ASAP1_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH domain 1	16					cilium morphogenesis (GO:0060271)|regulation of ARF GTPase activity (GO:0032312)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|zinc ion binding (GO:0008270)			breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(22)|ovary(6)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	68						ATTCCATAGTGAATCTCTCGA	0.493																																																	0								ENSG00000153317						79.0	77.0	78.0					8																	131414143		2203	4300	6503	ASAP1	SO:0001587	stop_gained	0			-	HGNC	AB033075	CCDS6362.1, CCDS75788.1	8q24.1-q24.2	2013-01-11	2008-09-22	2008-09-22	ENSG00000153317	ENSG00000153317		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	2720	protein-coding gene	gene with protein product	"""centaurin, beta 4"""	605953	"""development and differentiation enhancing factor 1"""	DDEF1		9819391	Standard	NM_018482		Approved	PAP, KIAA1249, ZG14P, CENTB4	uc003yta.2	Q9ULH1	OTTHUMG00000164772	ENST00000518721.1:c.47C>A	8.37:g.131414143G>T	ENSP00000429900:p.Ser16*	Somatic	0	35	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51	B2RNV3	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ArfGAP,pfam_SH3_domain,pfam_Pleckstrin_homology,pfam_SH3_2,superfamily_Ankyrin_rpt-contain_dom,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_ArfGAP,smart_Ankyrin_rpt,smart_SH3_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_ArfGAP,prints_ArfGAP,prints_p67phox	p.S16*	ENST00000518721.1	37	c.47	CCDS6362.1	8	.	.	.	.	.	.	.	.	.	.	G	41	9.059190	0.99051	.	.	ENSG00000153317	ENST00000343135;ENST00000357668;ENST00000518721	.	.	.	6.03	6.03	0.97812	.	0.221918	0.29493	N	0.011995	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.19590	T	0.45	.	18.0535	0.89357	0.0:0.0:1.0:0.0	.	.	.	.	X	16	.	ENSP00000344591:S16X	S	-	2	0	ASAP1	131483325	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.003000	0.70701	2.868000	0.98415	0.555000	0.69702	TCA	-	NULL		0.493	ASAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASAP1	protein_coding	OTTHUMT00000380170.1	G	NM_018482	-		131414143	-1	no_errors	ENST00000357668	ensembl	human	known	74_37	nonsense	SNP	1.000	T
GPR50	9248	genome.wustl.edu	37	X	150349083	150349083	+	Missense_Mutation	SNP	G	G	A			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chrX:150349083G>A	ENST00000218316.3	+	2	1097	c.1028G>A	c.(1027-1029)cGc>cAc	p.R343H	AF003625.3_ENST00000602313.1_lincRNA|GPR50-AS1_ENST00000454196.1_RNA	NM_004224.3	NP_004215.2	Q13585	MTR1L_HUMAN	G protein-coupled receptor 50	343	Pro-rich.				cell-cell signaling (GO:0007267)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)|identical protein binding (GO:0042802)|melatonin receptor activity (GO:0008502)			breast(4)|central_nervous_system(1)|endometrium(8)|kidney(1)|large_intestine(6)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|stomach(1)	38	Acute lymphoblastic leukemia(192;6.56e-05)					GCCCATGCTCGCGACCAAGCT	0.577																																																	0								ENSG00000102195						98.0	102.0	101.0					X																	150349083		2130	4211	6341	GPR50	SO:0001583	missense	0			-	HGNC	U52219	CCDS44012.1	Xq28	2012-08-21			ENSG00000102195	ENSG00000102195		"""GPCR / Class A : Orphans"""	4506	protein-coding gene	gene with protein product		300207				9933574, 18400093	Standard	NM_004224		Approved	H9, Mel1c	uc010ntg.2	Q13585	OTTHUMG00000024166	ENST00000218316.3:c.1028G>A	X.37:g.150349083G>A	ENSP00000218316:p.Arg343His	Somatic	0	20	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	33	0	100.00	Q0VGG3|Q3ZAR0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_Mel_rcpt_1X,prints_GPCR_Rhodpsn,prints_Melatonin_rcpt,prints_NPY_rcpt	p.R343H	ENST00000218316.3	37	c.1028	CCDS44012.1	X	.	.	.	.	.	.	.	.	.	.	G	14.65	2.597722	0.46318	.	.	ENSG00000102195	ENST00000218316	T	0.59638	0.25	3.9	2.07	0.26955	.	0.962914	0.08481	N	0.939498	T	0.41442	0.1159	N	0.24115	0.695	0.09310	N	1	B	0.25486	0.127	B	0.17722	0.019	T	0.30995	-0.9959	10	0.54805	T	0.06	-1.4039	6.943	0.24502	0.1079:0.1733:0.7187:0.0	.	343	Q13585	MTR1L_HUMAN	H	343	ENSP00000218316:R343H	ENSP00000218316:R343H	R	+	2	0	GPR50	150099741	0.217000	0.23597	0.010000	0.14722	0.005000	0.04900	0.199000	0.17237	0.255000	0.21593	-0.344000	0.07964	CGC	-	prints_Mel_rcpt_1X		0.577	GPR50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR50	protein_coding	OTTHUMT00000060874.1	G	NM_004224	-		150349083	+1	no_errors	ENST00000218316	ensembl	human	known	74_37	missense	SNP	0.041	A
GPR19	2842	genome.wustl.edu	37	12	12815222	12815222	+	Missense_Mutation	SNP	G	G	T			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr12:12815222G>T	ENST00000540510.1	-	2	353	c.161C>A	c.(160-162)aCa>aAa	p.T54K	GPR19_ENST00000332427.2_Missense_Mutation_p.T54K			P46093	GPR4_HUMAN	G protein-coupled receptor 19	0					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	17		Prostate(47;0.0802)		BRCA - Breast invasive adenocarcinoma(232;0.048)		GTGAAGGTCTGTTTGGTTGCT	0.507																																																	0								ENSG00000183150						163.0	150.0	155.0					12																	12815222		2203	4300	6503	GPR19	SO:0001583	missense	0			-	HGNC		CCDS8652.1	12p12.3	2014-01-30				ENSG00000183150		"""GPCR / Class A : Orphans"""	4473	protein-coding gene	gene with protein product		602927					Standard	NM_006143		Approved		uc001raq.2	Q15760		ENST00000540510.1:c.161C>A	12.37:g.12815222G>T	ENSP00000441832:p.Thr54Lys	Somatic	0	76	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	34	10.53	A8K3T3|B0M0K1|Q6NWM4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.T54K	ENST00000540510.1	37	c.161	CCDS8652.1	12	.	.	.	.	.	.	.	.	.	.	G	9.743	1.165345	0.21538	.	.	ENSG00000183150	ENST00000540510;ENST00000332427;ENST00000540796	T;T	0.54071	0.59;0.59	5.28	5.28	0.74379	.	0.072136	0.51477	D	0.000096	T	0.38348	0.1037	N	0.19112	0.55	0.19300	N	0.999971	B	0.12630	0.006	B	0.15052	0.012	T	0.22312	-1.0220	10	0.39692	T	0.17	-17.1782	13.6594	0.62357	0.0:0.0:0.8454:0.1546	.	54	Q15760	GPR19_HUMAN	K	54	ENSP00000441832:T54K;ENSP00000333744:T54K	ENSP00000333744:T54K	T	-	2	0	GPR19	12706489	0.998000	0.40836	0.035000	0.18076	0.003000	0.03518	5.789000	0.69029	2.744000	0.94065	0.655000	0.94253	ACA	-	NULL		0.507	GPR19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR19	protein_coding	OTTHUMT00000400662.1	G	NM_006143	-		12815222	-1	no_errors	ENST00000332427	ensembl	human	known	74_37	missense	SNP	0.140	T
FZD10	11211	genome.wustl.edu	37	12	130649050	130649050	+	Missense_Mutation	SNP	G	G	T			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr12:130649050G>T	ENST00000229030.4	+	1	2047	c.1563G>T	c.(1561-1563)tgG>tgT	p.W521C	FZD10_ENST00000539839.1_3'UTR|FZD10-AS1_ENST00000505807.2_RNA			Q9ULW2	FZD10_HUMAN	frizzled class receptor 10	521					brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|cellular response to retinoic acid (GO:0071300)|gonad development (GO:0008406)|negative regulation of Rho GTPase activity (GO:0034259)|neuron differentiation (GO:0030182)|non-canonical Wnt signaling pathway via JNK cascade (GO:0038031)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of actin cytoskeleton organization (GO:0032956)|vasculature development (GO:0001944)	cell projection (GO:0042995)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(7)|lung(14)|pancreas(1)|prostate(3)|urinary_tract(1)	35	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.3e-06)|Epithelial(86;1.66e-05)|all cancers(50;5.18e-05)		GCGGGATGTGGATTTGGACCT	0.582																																																	0								ENSG00000111432						41.0	43.0	42.0					12																	130649050		2203	4300	6503	FZD10	SO:0001583	missense	0			-	HGNC	AB027464	CCDS9267.1	12q24.33	2014-01-29	2014-01-29			ENSG00000111432		"""GPCR / Class F : Frizzled receptors"", ""CD molecules"""	4039	protein-coding gene	gene with protein product		606147	"""frizzled (Drosophila) homolog 10"", ""frizzled homolog 10 (Drosophila)"", ""frizzled 10, seven transmembrane spanning receptor"", ""frizzled family receptor 10"""			10448064	Standard	NM_007197		Approved	CD350	uc001uii.3	Q9ULW2		ENST00000229030.4:c.1563G>T	12.37:g.130649050G>T	ENSP00000229030:p.Trp521Cys	Somatic	0	78	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Frizzled,pfam_Frizzled_dom,superfamily_Frizzled_dom,smart_Frizzled_dom,pfscan_Frizzled_dom,pfscan_GPCR_2-like,prints_Frizzled	p.W521C	ENST00000229030.4	37	c.1563	CCDS9267.1	12	.	.	.	.	.	.	.	.	.	.	G	16.22	3.060296	0.55432	.	.	ENSG00000111432	ENST00000229030	D	0.91464	-2.85	4.87	4.87	0.63330	GPCR, family 2-like (1);	0.000000	0.85682	U	0.000000	D	0.97009	0.9023	H	0.96460	3.825	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98539	1.0631	10	0.87932	D	0	.	18.0183	0.89248	0.0:0.0:1.0:0.0	.	521	Q9ULW2	FZD10_HUMAN	C	521	ENSP00000229030:W521C	ENSP00000229030:W521C	W	+	3	0	FZD10	129215003	1.000000	0.71417	0.998000	0.56505	0.860000	0.49131	9.638000	0.98445	2.236000	0.73375	0.561000	0.74099	TGG	-	pfam_Frizzled,pfscan_GPCR_2-like,prints_Frizzled		0.582	FZD10-201	KNOWN	basic|appris_principal|CCDS	protein_coding	FZD10	protein_coding		G		-		130649050	+1	no_errors	ENST00000229030	ensembl	human	known	74_37	missense	SNP	1.000	T
LOC100996291	100996291	genome.wustl.edu	37	17	76267801	76267801	+	lincRNA	SNP	C	C	T			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr17:76267801C>T	ENST00000374945.1	-	0	296					NR_073178.1																						TGTGGACCTGCGGAATGGGGG	0.572																																																	0								ENSG00000204277																																			RP11-219G17.4			0			-	Clone_based_vega_gene																													17.37:g.76267801C>T		Somatic	0	32	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	19	26.92		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000374945.1	37	NULL		17	.	.	.	.	.	.	.	.	.	.	C	5.216	0.225366	0.09916	.	.	ENSG00000204277	ENST00000374945	.	.	.	1.96	-1.39	0.08997	.	.	.	.	.	T	0.35595	0.0937	.	.	.	.	.	.	.	.	.	.	.	.	T	0.45190	-0.9278	4	0.87932	D	0	.	2.7511	0.05281	0.3491:0.2592:0.3917:0.0	.	.	.	.	T	72	.	ENSP00000364083:A72T	A	-	1	0	AC087645.1	73779396	0.001000	0.12720	0.001000	0.08648	0.015000	0.08874	-0.111000	0.10807	-0.340000	0.08388	-0.702000	0.03669	GCA	-	-		0.572	RP11-219G17.4-001	KNOWN	basic	lincRNA	LOC100996291	lincRNA	OTTHUMT00000437286.1	C		-		76267801	-1	no_errors	ENST00000374945	ensembl	human	known	74_37	rna	SNP	0.001	T
SHROOM4	57477	genome.wustl.edu	37	X	50377783	50377784	+	Frame_Shift_Ins	INS	-	-	C			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chrX:50377783_50377784insC	ENST00000289292.7	-	4	1572_1573	c.1289_1290insG	c.(1288-1290)ggcfs	p.G430fs	SHROOM4_ENST00000376020.2_Frame_Shift_Ins_p.G430fs|SHROOM4_ENST00000460112.3_Frame_Shift_Ins_p.G314fs			Q9ULL8	SHRM4_HUMAN	shroom family member 4	430					actin cytoskeleton organization (GO:0030036)|actin filament organization (GO:0007015)|brain development (GO:0007420)|cognition (GO:0050890)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|myosin II complex (GO:0016460)|stress fiber (GO:0001725)	actin filament binding (GO:0051015)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(5)|large_intestine(6)|liver(1)|lung(20)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	52	Ovarian(276;0.236)					TCCCTTTGCTGCCCCTGGTATC	0.594																																																	0								ENSG00000158352																																			SHROOM4	SO:0001589	frameshift_variant	0				HGNC	AB033028	CCDS35277.1	Xp11.22	2008-02-05			ENSG00000158352	ENSG00000158352			29215	protein-coding gene	gene with protein product		300579				10574462, 16615870	Standard	NR_027121		Approved	KIAA1202	uc004dpe.2	Q9ULL8	OTTHUMG00000021521	ENST00000289292.7:c.1290dupG	X.37:g.50377787_50377787dupC	ENSP00000289292:p.Gly430fs	Somatic	0	15	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	14	12.50	A7E2X9|D6RFW0|Q96LA0	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_ASD2,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.S431fs	ENST00000289292.7	37	c.1290_1289	CCDS35277.1	X																																																																																			-	NULL		0.594	SHROOM4-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	SHROOM4	protein_coding	OTTHUMT00000056564.4	-	NM_020717			50377784	-1	no_errors	ENST00000289292	ensembl	human	known	74_37	frame_shift_ins	INS	0.000:0.005	C
RP11-65D24.2	0	genome.wustl.edu	37	13	112240744	112240744	+	3'UTR	SNP	C	C	T			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr13:112240744C>T	ENST00000607406.1	+	0	197				RP11-65D24.2_ENST00000375713.1_Intron																							ACCTCACAGCCGGGAGGAGAC	0.532																																																	0								ENSG00000204398																																			RP11-65D24.2	SO:0001624	3_prime_UTR_variant	0			-	Clone_based_vega_gene																												ENST00000607406.1:c.*194C>T	13.37:g.112240744C>T		Somatic	0	44	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	35	25.53		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000607406.1	37	NULL		13																																																																																			-	-		0.532	RP11-65D24.2-002	KNOWN	basic	processed_transcript	ENSG00000204398	protein_coding	OTTHUMT00000471073.1	C		-		112240744	+1	no_errors	ENST00000607406	ensembl	human	known	74_37	rna	SNP	0.000	T
OSR1	130497	genome.wustl.edu	37	2	19553480	19553480	+	Silent	SNP	G	G	A			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr2:19553480G>A	ENST00000272223.2	-	2	431	c.87C>T	c.(85-87)ggC>ggT	p.G29G	OSR1_ENST00000536433.1_Silent_p.G29G	NM_145260.2	NP_660303.1	Q8TAX0	OSR1_HUMAN	odd-skipped related transciption factor 1	29					cell differentiation (GO:0030154)|cell proliferation involved in kidney development (GO:0072111)|cellular response to retinoic acid (GO:0071300)|chondrocyte differentiation (GO:0002062)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic skeletal joint development (GO:0072498)|embryonic skeletal joint morphogenesis (GO:0060272)|embryonic skeletal limb joint morphogenesis (GO:0036023)|gonad development (GO:0008406)|heart development (GO:0007507)|intermediate mesoderm development (GO:0048389)|mesangial cell development (GO:0072143)|mesonephric duct morphogenesis (GO:0072180)|mesonephros development (GO:0001823)|metanephric cap mesenchymal cell proliferation involved in metanephros development (GO:0090094)|metanephric epithelium development (GO:0072207)|metanephric glomerulus vasculature development (GO:0072239)|metanephric interstitial fibroblast development (GO:0072259)|metanephric mesenchymal cell differentiation (GO:0072162)|metanephric mesenchyme development (GO:0072075)|metanephric mesenchyme morphogenesis (GO:0072133)|metanephric nephron tubule development (GO:0072234)|metanephric smooth muscle tissue development (GO:0072208)|middle ear morphogenesis (GO:0042474)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of nephron tubule epithelial cell differentiation (GO:0072183)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|odontogenesis (GO:0042476)|palate development (GO:0060021)|pattern specification involved in metanephros development (GO:0072268)|positive regulation of bone mineralization (GO:0030501)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of gastrulation (GO:2000543)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|posterior mesonephric tubule development (GO:0072166)|pronephros development (GO:0048793)|renal vesicle progenitor cell differentiation (GO:0072184)|specification of anterior mesonephric tubule identity (GO:0072168)|specification of posterior mesonephric tubule identity (GO:0072169)|stem cell differentiation (GO:0048863)|transcription, DNA-templated (GO:0006351)|ureter urothelium development (GO:0072190)|ureteric bud development (GO:0001657)|urogenital system development (GO:0001655)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			breast(1)|large_intestine(2)|lung(4)|ovary(1)	8	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.197)	Acute lymphoblastic leukemia(84;0.221)				CTGTGGGCAGGCCGTTCACTG	0.612																																																	0								ENSG00000143867						51.0	49.0	50.0					2																	19553480		2203	4300	6503	OSR1	SO:0001819	synonymous_variant	0			-	HGNC	BC025712	CCDS1694.1	2p24.1	2013-10-17	2013-10-17	2004-11-26	ENSG00000143867	ENSG00000143867		"""Zinc fingers, C2H2-type"""	8111	protein-coding gene	gene with protein product		608891	"""odd-skipped (Drosophila) homolog"", ""odd-skipped related 1 (Drosophila)"""	ODD		2120051, 12119563	Standard	XM_006711942		Approved		uc002rdc.3	Q8TAX0	OTTHUMG00000088793	ENST00000272223.2:c.87C>T	2.37:g.19553480G>A		Somatic	0	67	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	31	11.43	B3KV97|D6W521	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.G29	ENST00000272223.2	37	c.87	CCDS1694.1	2																																																																																			-	NULL		0.612	OSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OSR1	protein_coding	OTTHUMT00000201432.2	G	NM_145260	-		19553480	-1	no_errors	ENST00000272223	ensembl	human	known	74_37	silent	SNP	0.969	A
LYL1	4066	genome.wustl.edu	37	19	13211670	13211670	+	Missense_Mutation	SNP	G	G	T			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr19:13211670G>T	ENST00000264824.4	-	2	676	c.316C>A	c.(316-318)Cct>Act	p.P106T		NM_005583.4	NP_005574.2	P12980	LYL1_HUMAN	lymphoblastic leukemia associated hematopoiesis regulator 1	106					B cell differentiation (GO:0030183)|blood vessel maturation (GO:0001955)|definitive hemopoiesis (GO:0060216)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			cervix(1)|endometrium(2)|kidney(1)|lung(2)|prostate(1)	7			OV - Ovarian serous cystadenocarcinoma(19;6.08e-22)			AAGGGGTGAGGGTGGTAGTGC	0.667			T	TRB@	T-ALL																																			Dom	yes		19	19p13.2-p13.1	4066	lymphoblastic leukemia derived sequence 1		L	0								ENSG00000104903						16.0	19.0	18.0					19																	13211670		2131	4147	6278	LYL1	SO:0001583	missense	0			-	HGNC		CCDS12292.1	19p13.2	2014-01-20	2014-01-20			ENSG00000104903		"""Basic helix-loop-helix proteins"""	6734	protein-coding gene	gene with protein product		151440	"""lymphoblastic leukemia derived sequence 1"""			2752424	Standard	NM_005583		Approved	bHLHa18	uc002mwi.3	P12980		ENST00000264824.4:c.316C>A	19.37:g.13211670G>T	ENSP00000264824:p.Pro106Thr	Somatic	0	51	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	29	12.12	O76102	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.P106T	ENST00000264824.4	37	c.316	CCDS12292.1	19	.	.	.	.	.	.	.	.	.	.	G	17.65	3.442071	0.63067	.	.	ENSG00000104903	ENST00000264824	D	0.97870	-4.58	4.67	4.67	0.58626	.	0.000000	0.56097	D	0.000034	D	0.97614	0.9218	L	0.44542	1.39	0.34504	D	0.706342	D	0.64830	0.994	P	0.61328	0.887	D	0.99972	1.2043	10	0.72032	D	0.01	-6.2263	16.352	0.83215	0.0:0.0:1.0:0.0	.	106	P12980	LYL1_HUMAN	T	106	ENSP00000264824:P106T	ENSP00000264824:P106T	P	-	1	0	LYL1	13072670	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	2.931000	0.48932	2.139000	0.66308	0.555000	0.69702	CCT	-	NULL		0.667	LYL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LYL1	protein_coding	OTTHUMT00000452827.1	G	NM_005583	-		13211670	-1	no_errors	ENST00000264824	ensembl	human	known	74_37	missense	SNP	1.000	T
SCN10A	6336	genome.wustl.edu	37	3	38798178	38798178	+	Missense_Mutation	SNP	C	C	T	rs143033805	byFrequency	TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr3:38798178C>T	ENST00000449082.2	-	9	1276	c.1277G>A	c.(1276-1278)cGg>cAg	p.R426Q		NM_006514.2	NP_006505.2	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha subunit	426					AV node cell to bundle of His cell communication (GO:0086067)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of cardiac muscle contraction (GO:0055117)|regulation of heart rate (GO:0002027)|regulation of ion transmembrane transport (GO:0034765)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(5)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(14)|kidney(5)|large_intestine(33)|lung(54)|ovary(5)|pancreas(1)|prostate(5)|skin(13)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	150				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cinchocaine(DB00527)|Cocaine(DB00907)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Lacosamide(DB06218)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Orphenadrine(DB01173)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)|Valproic Acid(DB00313)	CTGCTCCTTCCGGAGCATCTC	0.502													C|||	2	0.000399361	0.0	0.0	5008	,	,		19817	0.002		0.0	False		,,,				2504	0.0																0								ENSG00000185313	C	GLN/ARG	0,4406		0,0,2203	126.0	124.0	124.0		1277	-1.6	0.9	3	dbSNP_134	124	2,8598	2.2+/-6.3	0,2,4298	yes	missense	SCN10A	NM_006514.2	43	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	benign	426/1957	38798178	2,13004	2203	4300	6503	SCN10A	SO:0001583	missense	0			GMAF=0.0005	HGNC	AF117907	CCDS33736.1	3p22.2	2012-02-26	2007-01-23		ENSG00000185313	ENSG00000185313		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10582	protein-coding gene	gene with protein product		604427	"""sodium channel, voltage-gated, type X, alpha polypeptide"""			9839820, 10198179, 16382098	Standard	NM_006514		Approved	Nav1.8, hPN3, SNS, PN3	uc003ciq.3	Q9Y5Y9	OTTHUMG00000048245	ENST00000449082.2:c.1277G>A	3.37:g.38798178C>T	ENSP00000390600:p.Arg426Gln	Somatic	0	34	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	31	32.61	A6NDQ1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_PKD1_2_channel,prints_Na_channel_asu,prints_PKD_2	p.R426Q	ENST00000449082.2	37	c.1277	CCDS33736.1	3	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	10.40	1.339362	0.24339	0.0	2.33E-4	ENSG00000185313	ENST00000449082	D	0.95588	-3.75	5.21	-1.65	0.08291	.	0.468395	0.19915	N	0.103210	D	0.89026	0.6598	N	0.17631	0.505	0.22034	N	0.999407	B	0.14012	0.009	B	0.04013	0.001	T	0.77446	-0.2585	10	0.44086	T	0.13	.	12.469	0.55775	0.0:0.2858:0.0:0.7142	.	426	Q9Y5Y9	SCNAA_HUMAN	Q	426	ENSP00000390600:R426Q	ENSP00000390600:R426Q	R	-	2	0	SCN10A	38773182	0.044000	0.20184	0.850000	0.33497	0.401000	0.30781	0.288000	0.18939	-0.431000	0.07307	-0.224000	0.12420	CGG	-	NULL		0.502	SCN10A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	SCN10A	protein_coding	OTTHUMT00000109745.3	C	NM_006514	rs143033805		38798178	-1	no_errors	ENST00000449082	ensembl	human	known	74_37	missense	SNP	0.950	T
MUC2	4583	genome.wustl.edu	37	11	1096490	1096490	+	Missense_Mutation	SNP	C	C	A			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr11:1096490C>A	ENST00000441003.2	+	34	6542	c.6515C>A	c.(6514-6516)tCc>tAc	p.S2172Y	MUC2_ENST00000361558.6_Missense_Mutation_p.S310Y	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	4534					cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	GACAAGGTGTCCTGTCCCCGC	0.597																																																	0								ENSG00000198788						105.0	117.0	113.0					11																	1096490		2184	4266	6450	MUC2	SO:0001583	missense	0			-	HGNC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.6515C>A	11.37:g.1096490C>A	ENSP00000415183:p.Ser2172Tyr	Somatic	0	49	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	25	13.79	Q14878	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,superfamily_Prot_inh_PMP,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.S2172Y	ENST00000441003.2	37	c.6515		11	.	.	.	.	.	.	.	.	.	.	c	18.59	3.656964	0.67586	.	.	ENSG00000198788	ENST00000441003;ENST00000361558	T;T	0.61040	0.14;0.14	3.95	3.02	0.34903	.	.	.	.	.	T	0.75110	0.3805	M	0.79805	2.47	0.31441	N	0.671975	D	0.76494	0.999	D	0.77557	0.99	T	0.77349	-0.2621	9	0.87932	D	0	.	11.9496	0.52948	0.0:0.9128:0.0:0.0872	.	2172	E7EUV1	.	Y	2172;310	ENSP00000415183:S2172Y;ENSP00000354885:S310Y	ENSP00000354885:S310Y	S	+	2	0	MUC2	1086490	1.000000	0.71417	0.972000	0.41901	0.877000	0.50540	7.361000	0.79497	0.830000	0.34757	0.479000	0.44913	TCC	-	pfam_VWF_type-D,smart_VWF_type-D		0.597	MUC2-001	KNOWN	basic|appris_principal	protein_coding	MUC2	protein_coding	OTTHUMT00000345894.2	C	NM_002457	-		1096490	+1	no_errors	ENST00000441003	ensembl	human	known	74_37	missense	SNP	1.000	A
CLSTN1	22883	genome.wustl.edu	37	1	9810040	9810040	+	Intron	SNP	G	G	T	rs566527994		TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr1:9810040G>T	ENST00000377298.4	-	6	1442				CLSTN1_ENST00000361311.4_Intron|CLSTN1_ENST00000377288.3_Intron	NM_001009566.1	NP_001009566.1	O94985	CSTN1_HUMAN	calsyntenin 1						cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)	cell junction (GO:0030054)|cell projection (GO:0042995)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	beta-amyloid binding (GO:0001540)|calcium ion binding (GO:0005509)|kinesin binding (GO:0019894)|X11-like protein binding (GO:0042988)			breast(1)|endometrium(5)|kidney(2)|large_intestine(7)|liver(1)|lung(9)|prostate(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	36	all_lung(157;0.222)	all_lung(284;4.03e-05)|Lung NSC(185;6.93e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00314)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|Colorectal(212;8.36e-08)|COAD - Colon adenocarcinoma(227;1.93e-05)|Kidney(185;0.000342)|BRCA - Breast invasive adenocarcinoma(304;0.000949)|KIRC - Kidney renal clear cell carcinoma(229;0.00122)|STAD - Stomach adenocarcinoma(132;0.00644)|READ - Rectum adenocarcinoma(331;0.0419)		GTCCTAGGCGGAAAGACAAAA	0.408																																																	0								ENSG00000171603																																			CLSTN1	SO:0001627	intron_variant	0			-	HGNC	AB020718	CCDS105.1, CCDS30580.1	1p36.22	2011-07-01			ENSG00000171603	ENSG00000171603		"""Cadherins / Cadherin-related"""	17447	protein-coding gene	gene with protein product	"""cadherin-related family member 12"""	611321				10048485	Standard	XM_005263432		Approved	CSTN1, KIAA0911, CDHR12	uc001aqh.3	O94985	OTTHUMG00000001451	ENST00000377298.4:c.650-69C>A	1.37:g.9810040G>T		Somatic	0	29	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	25	13.79	A8K183|Q5SR52|Q5UE58|Q71MN0|Q8N4K9	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000377298.4	37	NULL	CCDS30580.1	1																																																																																			-	-		0.408	CLSTN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CLSTN1	protein_coding	OTTHUMT00000004239.1	G		-		9810040	-1	no_errors	ENST00000464286	ensembl	human	known	74_37	rna	SNP	0.000	T
KDM2A	22992	genome.wustl.edu	37	11	66987031	66987031	+	Intron	DEL	T	T	-	rs111981707		TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr11:66987031delT	ENST00000529006.2	+	10	1403				KDM2A_ENST00000526258.1_Intron|snoU13_ENST00000459034.1_RNA|KDM2A_ENST00000398645.2_Intron	NM_012308.2	NP_036440.1	Q9Y2K7	KDM2A_HUMAN	lysine (K)-specific demethylase 2A						histone H3-K36 demethylation (GO:0070544)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleus (GO:0005634)	histone demethylase activity (H3-K36 specific) (GO:0051864)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(15)|ovary(5)|skin(1)|urinary_tract(2)	36						ttaaatttaattttttttttt	0.363																																																	0								ENSG00000173120																																			KDM2A	SO:0001627	intron_variant	0				HGNC	BC047486	CCDS44657.1, CCDS58148.1	11q13.1	2014-02-18	2009-04-06	2009-04-06	ENSG00000173120	ENSG00000173120		"""F-boxes / Leucine-rich repeats"", ""Chromatin-modifying enzymes / K-demethylases"""	13606	protein-coding gene	gene with protein product	"""F-box protein FBL11"", ""jumonji C domain-containing histone demethylase 1A"""	605657	"""F-box and leucine-rich repeat protein 11"""	FBXL11		10231032, 10531037	Standard	NM_012308		Approved	KIAA1004, FBL11, LILINA, DKFZP434M1735, FBL7, FLJ00115, CXXC8, JHDM1A	uc001ojw.3	Q9Y2K7	OTTHUMG00000167103	ENST00000529006.2:c.957+157T>-	11.37:g.66987031delT		Somatic	0	19	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	6	33.33	D4QA03|E9PIL6|I3VM55|Q49A21|Q4G0M3|Q69YY8|Q9BVH5|Q9H7H5|Q9UK66	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000529006.2	37	NULL	CCDS44657.1	11																																																																																			-	-		0.363	KDM2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM2A	protein_coding	OTTHUMT00000393140.2	T	NM_012308			66987031	+1	no_errors	ENST00000525379	ensembl	human	putative	74_37	rna	DEL	0.003	-
DUSP13	51207	genome.wustl.edu	37	10	76854531	76854531	+	Missense_Mutation	SNP	G	G	A	rs150329504		TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr10:76854531G>A	ENST00000472493.2	-	4	578	c.500C>T	c.(499-501)aCg>aTg	p.T167M	DUSP13_ENST00000605915.1_Missense_Mutation_p.T189M|DUSP13_ENST00000478873.2_Missense_Mutation_p.T303M|DUSP13_ENST00000372700.3_Missense_Mutation_p.T217M|DUSP13_ENST00000607131.1_Missense_Mutation_p.T260M|DUSP13_ENST00000607009.1_5'Flank|DUSP13_ENST00000464872.1_Missense_Mutation_p.T116M|DUSP13_ENST00000372702.3_3'UTR|DUSP13_ENST00000491677.2_Missense_Mutation_p.T296M	NM_016364.3	NP_057448.3	Q9UII6	DS13B_HUMAN	dual specificity phosphatase 13	167	Tyrosine-protein phosphatase.				meiotic nuclear division (GO:0007126)|protein dephosphorylation (GO:0006470)|spermatogenesis (GO:0007283)		protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			large_intestine(3)|lung(3)|prostate(1)|urinary_tract(1)	8	all_cancers(46;0.0207)|all_epithelial(25;0.00126)|Prostate(51;0.0112)|Ovarian(15;0.0348)					GGCCTGCACCGTCTGGATGGC	0.607																																					NSCLC(174;1655 2059 12324 40663 42963)												0								ENSG00000079393	G	,MET/THR,MET/THR,MET/THR	2,4404	4.2+/-10.8	0,2,2201	101.0	73.0	82.0		,650,779,500	1.6	1.0	10	dbSNP_134	82	0,8600		0,0,4300	no	utr-3,missense,missense,missense	DUSP13	NM_001007271.1,NM_001007272.1,NM_001007273.1,NM_016364.3	,81,81,81	0,2,6501	AA,AG,GG		0.0,0.0454,0.0154	,probably-damaging,probably-damaging,probably-damaging	,217/249,260/292,167/199	76854531	2,13004	2203	4300	6503	DUSP13	SO:0001583	missense	0			-	HGNC	AB027004	CCDS7346.1, CCDS31224.1, CCDS53542.1	10q23.1	2013-10-25			ENSG00000079393	ENSG00000079393		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	19681	protein-coding gene	gene with protein product		613191				10585869	Standard	XM_005269883		Approved	BEDP, TMDP, FLJ32450, DUSP13A, DUSP13B	uc001jwu.3	Q6B8I1	OTTHUMG00000018516	ENST00000472493.2:c.500C>T	10.37:g.76854531G>A	ENSP00000444580:p.Thr167Met	Somatic	0	49	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	11	56.00	A8K776|A8K782|B3KPY1|B3KXT0|B4DUK0|Q5JSC6|Q6IAR0|Q96GC2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Dual-sp_phosphatase_cat-dom,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Dual-sp_phosphatase_subgr_cat,pfscan_Tyr/Dual-sp_Pase,pfscan_Dual-sp_phosphatase_subgr_cat,prints_Atypical_DUSP,prints_Atypical_DUSP_famA	p.T296M	ENST00000472493.2	37	c.887	CCDS7346.1	10	.	.	.	.	.	.	.	.	.	.	G	17.12	3.308733	0.60305	4.54E-4	0.0	ENSG00000079393	ENST00000308475;ENST00000472493;ENST00000491677;ENST00000372698;ENST00000464872;ENST00000372700	D;D;D;D;D	0.85013	-1.93;-1.93;-1.93;-1.93;-1.93	5.52	1.56	0.23342	Dual specificity phosphatase, catalytic domain (1);Protein-tyrosine/Dual-specificity phosphatase (1);Dual specificity phosphatase, subgroup, catalytic domain (2);	0.452569	0.27876	N	0.017486	D	0.82751	0.5105	N	0.26042	0.785	0.26901	N	0.967107	D;D;D	0.76494	0.998;0.999;0.987	P;D;P	0.67103	0.874;0.949;0.688	T	0.72228	-0.4354	10	0.34782	T	0.22	-5.5811	5.5206	0.16931	0.1743:0.0:0.576:0.2497	.	217;296;167	Q9UII6-4;F2Z2C4;Q9UII6	.;.;DUS13_HUMAN	M	167;167;296;260;116;217	ENSP00000311051:T167M;ENSP00000444580:T167M;ENSP00000436312:T296M;ENSP00000434041:T116M;ENSP00000361785:T217M	ENSP00000311051:T167M	T	-	2	0	DUSP13	76524537	0.944000	0.32072	0.994000	0.49952	0.995000	0.86356	2.308000	0.43690	0.025000	0.15241	-0.136000	0.14681	ACG	-	pfam_Dual-sp_phosphatase_cat-dom,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Dual-sp_phosphatase_subgr_cat,pfscan_Tyr/Dual-sp_Pase,pfscan_Dual-sp_phosphatase_subgr_cat		0.607	DUSP13-004	KNOWN	basic|CCDS	protein_coding	DUSP13	protein_coding	OTTHUMT00000048786.3	G		rs150329504		76854531	-1	no_errors	ENST00000491677	ensembl	human	known	74_37	missense	SNP	0.897	A
AKAP6	9472	genome.wustl.edu	37	14	33014696	33014696	+	Silent	SNP	T	T	C			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr14:33014696T>C	ENST00000280979.4	+	4	1007	c.837T>C	c.(835-837)gcT>gcC	p.A279A	AKAP6_ENST00000557354.1_Silent_p.A279A|AKAP6_ENST00000557272.1_Silent_p.A279A	NM_004274.4	NP_004265.3	Q13023	AKAP6_HUMAN	A kinase (PRKA) anchor protein 6	279					action potential (GO:0001508)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cytokine stimulus (GO:0071345)|negative regulation of cAMP biosynthetic process (GO:0030818)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|positive regulation of cell growth (GO:0030307)|positive regulation of cell growth involved in cardiac muscle cell development (GO:0061051)|positive regulation of delayed rectifier potassium channel activity (GO:1902261)|positive regulation of NFAT protein import into nucleus (GO:0051533)|positive regulation of potassium ion transmembrane transport (GO:1901381)|positive regulation of protein phosphatase type 2B activity (GO:0032514)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|protein targeting (GO:0006605)|regulation of membrane repolarization (GO:0060306)|regulation of protein kinase A signaling (GO:0010738)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)	calcium channel complex (GO:0034704)|caveola (GO:0005901)|cytoplasm (GO:0005737)|intercalated disc (GO:0014704)|junctional sarcoplasmic reticulum membrane (GO:0014701)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)	adenylate cyclase binding (GO:0008179)|ion channel binding (GO:0044325)|protein anchor (GO:0043495)|protein complex scaffold (GO:0032947)|protein kinase A binding (GO:0051018)|protein kinase A regulatory subunit binding (GO:0034237)			NS(2)|breast(10)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(25)|lung(42)|ovary(5)|pancreas(2)|prostate(3)|skin(9)|urinary_tract(2)	122	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)		CGGTAGCTGCTGACTCTATCT	0.453																																					Melanoma(49;821 1200 7288 13647 42351)												0								ENSG00000151320						134.0	120.0	124.0					14																	33014696		2203	4300	6503	AKAP6	SO:0001819	synonymous_variant	0			-	HGNC	AB002309	CCDS9644.1	14q12	2008-08-11			ENSG00000151320	ENSG00000151320		"""A-kinase anchor proteins"""	376	protein-coding gene	gene with protein product	"""protein kinase A anchoring protein 6"""	604691				7721854, 9205841	Standard	NM_004274		Approved	KIAA0311, mAKAP, AKAP100, PRKA6, ADAP6	uc001wrq.3	Q13023	OTTHUMG00000140207	ENST00000280979.4:c.837T>C	14.37:g.33014696T>C		Somatic	0	18	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	17	34.62	A7E242|A7E2D4|O15028	Silent	SNP	NA	NA	NA	NA	NA	NA	smart_Spectrin/alpha-actinin	p.A279	ENST00000280979.4	37	c.837	CCDS9644.1	14																																																																																			-	NULL		0.453	AKAP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP6	protein_coding	OTTHUMT00000276617.2	T	NM_004274	-		33014696	+1	no_errors	ENST00000280979	ensembl	human	known	74_37	silent	SNP	0.977	C
MYH9	4627	genome.wustl.edu	37	22	36680174	36680174	+	Missense_Mutation	SNP	C	C	A			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr22:36680174C>A	ENST00000216181.5	-	40	5960	c.5730G>T	c.(5728-5730)atG>atT	p.M1910I	MYH9_ENST00000475726.1_5'Flank	NM_002473.4	NP_002464.1	P35579	MYH9_HUMAN	myosin, heavy chain 9, non-muscle	1910					actin cytoskeleton reorganization (GO:0031532)|actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|angiogenesis (GO:0001525)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood vessel endothelial cell migration (GO:0043534)|cytokinesis (GO:0000910)|establishment of meiotic spindle localization (GO:0051295)|establishment of T cell polarity (GO:0001768)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|meiotic spindle organization (GO:0000212)|membrane protein ectodomain proteolysis (GO:0006509)|monocyte differentiation (GO:0030224)|myoblast fusion (GO:0007520)|platelet aggregation (GO:0070527)|platelet formation (GO:0030220)|protein transport (GO:0015031)|regulation of cell shape (GO:0008360)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|uropod organization (GO:0032796)	actin cytoskeleton (GO:0015629)|actomyosin (GO:0042641)|actomyosin contractile ring (GO:0005826)|cell leading edge (GO:0031252)|cell-cell adherens junction (GO:0005913)|cleavage furrow (GO:0032154)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle (GO:0001726)|spindle (GO:0005819)|stress fiber (GO:0001725)|uropod (GO:0001931)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)|protein anchor (GO:0043495)|protein homodimerization activity (GO:0042803)			NS(1)|breast(8)|central_nervous_system(3)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(16)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(3)	86						CTTCGCGGTTCATGGCATCGG	0.647			T	ALK	ALCL		"""Deafness, autosomal dominant 17, Epstein syndrome, Fechtner syndrome, May-Hegglin anomaly, Sebastian syndrome"""		Hereditary Macrothrombocytopenia, MYH9-associated																															Dom	yes		22	22q13.1	4627	"""myosin, heavy polypeptide 9, non-muscle"""	yes	L	0								ENSG00000100345						69.0	78.0	75.0					22																	36680174		2203	4300	6503	MYH9	SO:0001583	missense	0	Familial Cancer Database	MYHIIA syndrome, incl. Fechtner Syndrome, FTNS, and May-Hegglin Anomaly, MHA	-	HGNC		CCDS13927.1	22q13.1	2014-09-17	2006-09-29		ENSG00000100345	ENSG00000100345		"""Myosins / Myosin superfamily : Class II"""	7579	protein-coding gene	gene with protein product	"""nonmuscle myosin heavy chain II-A"""	160775	"""myosin, heavy polypeptide 9, non-muscle"""	DFNA17		1860190, 11023810	Standard	NM_002473		Approved	NMMHCA, NMHC-II-A, MHA, FTNS, EPSTS	uc003apg.3	P35579	OTTHUMG00000030429	ENST00000216181.5:c.5730G>T	22.37:g.36680174C>A	ENSP00000216181:p.Met1910Ile	Somatic	0	43	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	33	13.16	A8K6E4|O60805|Q60FE2|Q86T83	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,superfamily_Regulat_G_prot_signal_superfam,superfamily_Prefoldin,superfamily_Myosin_S1_N,superfamily_STAT_TF_coiled-coil,superfamily_tRNA-bd_arm,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.M1910I	ENST00000216181.5	37	c.5730	CCDS13927.1	22	.	.	.	.	.	.	.	.	.	.	C	24.2	4.502166	0.85176	.	.	ENSG00000100345	ENST00000337818;ENST00000397231;ENST00000216181	T	0.77489	-1.1	4.57	4.57	0.56435	Myosin tail (1);	0.000000	0.85682	D	0.000000	T	0.79335	0.4428	L	0.58428	1.81	0.80722	D	1	B	0.32365	0.367	B	0.39771	0.309	T	0.80848	-0.1199	10	0.56958	D	0.05	.	17.702	0.88298	0.0:1.0:0.0:0.0	.	1910	P35579	MYH9_HUMAN	I	1332;512;1910	ENSP00000216181:M1910I	ENSP00000216181:M1910I	M	-	3	0	MYH9	35010120	1.000000	0.71417	1.000000	0.80357	0.829000	0.46940	7.682000	0.84083	2.240000	0.73641	0.305000	0.20034	ATG	-	pfam_Myosin_tail		0.647	MYH9-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	MYH9	protein_coding	OTTHUMT00000259110.3	C	NM_002473	-		36680174	-1	no_errors	ENST00000216181	ensembl	human	known	74_37	missense	SNP	1.000	A
PAPD5	64282	genome.wustl.edu	37	16	50263692	50263693	+	3'UTR	INS	-	-	T			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr16:50263692_50263693insT	ENST00000561678.1	+	0	2294_2295				PAPD5_ENST00000436909.3_3'UTR|PAPD5_ENST00000573002.1_3'UTR|PAPD5_ENST00000357464.3_3'UTR			Q8NDF8	PAPD5_HUMAN	PAP associated domain containing 5						histone mRNA catabolic process (GO:0071044)|mitotic nuclear division (GO:0007067)|mRNA processing (GO:0006397)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|polynucleotide adenylyltransferase activity (GO:0004652)			endometrium(1)|kidney(1)|lung(2)	4		all_cancers(37;0.0452)		BRCA - Breast invasive adenocarcinoma(181;0.0843)|GBM - Glioblastoma multiforme(240;0.231)		ATCTGTGCATGTTTTTTTTTTA	0.307																																																	0								ENSG00000121274																																			PAPD5	SO:0001624	3_prime_UTR_variant	0				HGNC	AF089897	CCDS54006.1	16q12.1	2010-11-18				ENSG00000121274			30758	protein-coding gene	gene with protein product	"""TUTase3"""	605540				10066793	Standard	NM_001040284		Approved	TRF4-2	uc010vgo.2	Q8NDF8		ENST00000561678.1:c.*454->T	16.37:g.50263702_50263702dupT		Somatic	0	49	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	24	20.00	B4DV38|Q9NW67|Q9Y6C0	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000561678.1	37	NULL		16																																																																																			-	-		0.307	PAPD5-002	PUTATIVE	not_organism_supported|basic|exp_conf	protein_coding	PAPD5	protein_coding	OTTHUMT00000423150.1	-	NM_022447			50263693	+1	no_errors	ENST00000573002	ensembl	human	known	74_37	rna	INS	1.000:0.737	T
CCDC103	388389	genome.wustl.edu	37	17	42978433	42978433	+	Missense_Mutation	SNP	G	G	T			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr17:42978433G>T	ENST00000417826.2	+	2	162	c.67G>T	c.(67-69)Gat>Tat	p.D23Y	CCDC103_ENST00000410006.2_Missense_Mutation_p.D23Y|EFTUD2_ENST00000591382.1_5'Flank|CCDC103_ENST00000410027.1_Missense_Mutation_p.D23Y|EFTUD2_ENST00000592576.1_5'Flank|EFTUD2_ENST00000426333.2_5'Flank|AC015936.3_ENST00000441312.1_RNA|FAM187A_ENST00000331733.4_5'UTR|EFTUD2_ENST00000402521.3_5'Flank|FAM187A_ENST00000412523.2_5'UTR	NM_001258399.1|NM_213607.2	NP_001245328.1|NP_998772.1	Q8IW40	CC103_HUMAN	coiled-coil domain containing 103	23					axonemal dynein complex assembly (GO:0070286)|cell projection organization (GO:0030030)|cilium movement (GO:0003341)|determination of digestive tract left/right asymmetry (GO:0071907)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|inner dynein arm assembly (GO:0036159)|outer dynein arm assembly (GO:0036158)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|motile cilium (GO:0031514)	protein homodimerization activity (GO:0042803)			endometrium(1)|kidney(1)|large_intestine(3)|prostate(1)|skin(1)	7		Prostate(33;0.109)				ACTCACTGCTGATGAGAAGTA	0.502																																																	0								ENSG00000167131						122.0	103.0	110.0					17																	42978433		2203	4300	6503	CCDC103	SO:0001583	missense	0			-	HGNC	AK023156	CCDS11490.1, CCDS58554.1	17q21.31	2013-02-22			ENSG00000167131	ENSG00000167131			32700	protein-coding gene	gene with protein product		614677				22581229	Standard	NM_213607		Approved	FLJ13094, FLJ34211, PR46b, CILD17	uc031ray.1	Q8IW40	OTTHUMG00000154264	ENST00000417826.2:c.67G>T	17.37:g.42978433G>T	ENSP00000391692:p.Asp23Tyr	Somatic	0	52	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	33	10.81	A8K145|B8ZZU0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.D23Y	ENST00000417826.2	37	c.67	CCDS11490.1	17	.	.	.	.	.	.	.	.	.	.	G	26.9	4.778981	0.90195	.	.	ENSG00000167131	ENST00000357776;ENST00000410027;ENST00000417826;ENST00000410006	D;D;D	0.87334	-2.23;-2.24;-2.24	5.76	5.76	0.90799	.	0.000000	0.64402	U	0.000014	D	0.94255	0.8155	M	0.83774	2.66	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.94424	0.7643	10	0.87932	D	0	-18.3531	19.551	0.95319	0.0:0.0:1.0:0.0	.	23	Q8IW40	CC103_HUMAN	Y	23	ENSP00000350420:D23Y;ENSP00000391692:D23Y;ENSP00000387252:D23Y	ENSP00000350420:D23Y	D	+	1	0	CCDC103	40333959	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.228000	0.89789	2.728000	0.93425	0.462000	0.41574	GAT	-	NULL		0.502	CCDC103-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC103	protein_coding	OTTHUMT00000334578.1	G	NM_213607	-		42978433	+1	no_errors	ENST00000410006	ensembl	human	known	74_37	missense	SNP	1.000	T
ZNF823	55552	genome.wustl.edu	37	19	11832715	11832715	+	Missense_Mutation	SNP	T	T	C			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr19:11832715T>C	ENST00000341191.6	-	4	1787	c.1634A>G	c.(1633-1635)cAt>cGt	p.H545R	ZNF823_ENST00000545749.1_Missense_Mutation_p.H363R	NM_001080493.2	NP_001073962.1	P16415	ZN823_HUMAN	zinc finger protein 823	545					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(10)|ovary(2)|prostate(1)|upper_aerodigestive_tract(4)	26						AATTCTTTCATGTCGTAGAAG	0.413										HNSCC(68;0.2)																																							0								ENSG00000197933						74.0	75.0	75.0					19																	11832715		2203	4299	6502	ZNF823	SO:0001583	missense	0			-	HGNC	X51760	CCDS45981.1	19p13.2	2013-01-08			ENSG00000197933	ENSG00000197933		"""Zinc fingers, C2H2-type"", ""-"""	30936	protein-coding gene	gene with protein product	"""ZFP 36 for a zinc finger protein"""						Standard	XM_006722789		Approved	HSZFP36	uc002msm.2	P16415	OTTHUMG00000156528	ENST00000341191.6:c.1634A>G	19.37:g.11832715T>C	ENSP00000340683:p.His545Arg	Somatic	0	82	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	41	27	60.29	A0PJL4|B7Z8D4|Q6P4A9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.H545R	ENST00000341191.6	37	c.1634	CCDS45981.1	19	.	.	.	.	.	.	.	.	.	.	-	17.92	3.507361	0.64410	.	.	ENSG00000197933	ENST00000545749;ENST00000341191	D;D	0.86865	-2.18;-2.18	0.856	-0.266	0.12942	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.91778	0.7399	H	0.95043	3.615	0.27262	N	0.958603	D	0.53312	0.959	P	0.52554	0.702	D	0.84236	0.0469	9	0.87932	D	0	.	5.0443	0.14475	0.0:0.1987:0.0:0.8013	.	545	P16415	ZN823_HUMAN	R	363;545	ENSP00000440162:H363R;ENSP00000340683:H545R	ENSP00000340683:H545R	H	-	2	0	ZNF823	11693715	0.998000	0.40836	0.004000	0.12327	0.752000	0.42762	3.387000	0.52501	-0.159000	0.11021	0.254000	0.18369	CAT	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.413	ZNF823-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF823	protein_coding	OTTHUMT00000344516.2	T	NM_001080493	-		11832715	-1	no_errors	ENST00000341191	ensembl	human	known	74_37	missense	SNP	0.952	C
LOC285556	285556	genome.wustl.edu	37	4	100574097	100574097	+	Missense_Mutation	SNP	T	T	A			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr4:100574097T>A	ENST00000511828.1	-	1	1708	c.1709A>T	c.(1708-1710)aAc>aTc	p.N570I																								TGCAGCCGGGTTTTGCTTCAG	0.542																																																	0								ENSG00000248713																																			RP11-766F14.2	SO:0001583	missense	0			-	Clone_based_vega_gene																												ENST00000511828.1:c.1709A>T	4.37:g.100574097T>A	ENSP00000427555:p.Asn570Ile	Somatic	0	60	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	27	49.06		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.N570I	ENST00000511828.1	37	c.1709		4	.	.	.	.	.	.	.	.	.	.	T	9.527	1.109940	0.20714	.	.	ENSG00000248713	ENST00000511828	T	0.17528	2.27	5.0	-3.27	0.05048	.	.	.	.	.	T	0.06554	0.0168	N	0.08118	0	.	.	.	.	.	.	.	.	.	T	0.33497	-0.9866	6	0.36615	T	0.2	.	2.2891	0.04134	0.3407:0.0677:0.3099:0.2816	.	.	.	.	I	570	ENSP00000427555:N570I	ENSP00000427555:N570I	N	-	2	0	RP11-766F14.2	100793120	0.916000	0.31088	0.131000	0.22000	0.996000	0.88848	0.807000	0.27140	-0.665000	0.05317	0.533000	0.62120	AAC	-	NULL		0.542	RP11-766F14.2-001	PUTATIVE	basic|appris_principal|exp_conf	protein_coding	LOC285556	protein_coding	OTTHUMT00000365456.1	T		-		100574097	-1	no_errors	ENST00000511828	ensembl	human	putative	74_37	missense	SNP	0.002	A
SLC45A3	85414	genome.wustl.edu	37	1	205632049	205632049	+	Silent	SNP	C	C	A			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr1:205632049C>A	ENST00000367145.3	-	3	1165	c.870G>T	c.(868-870)ctG>ctT	p.L290L	SLC45A3_ENST00000460934.1_5'Flank	NM_033102.2	NP_149093.1	Q96JT2	S45A3_HUMAN	solute carrier family 45, member 3	290					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)			SLC45A3/BRAF(2)|SLC45A3/ELK4(18)|SLC45A3/ETV1(3)|SLC45A3/ETV5_ENST00000306376(2)|SLC45A3/ERG(50)	cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|liver(1)|lung(7)|ovary(3)|prostate(5)	21	Breast(84;0.07)		BRCA - Breast invasive adenocarcinoma(75;0.0194)			CCGTGTAAAACAGCGTGAAGG	0.647			T	"""ETV1, ETV5, ELK4, ERG"""	prostate																																			Dom	yes		1	1q32	85414	"""solute carrier family 45, member 3"""		E	0								ENSG00000158715						40.0	44.0	43.0					1																	205632049		2203	4300	6503	SLC45A3	SO:0001819	synonymous_variant	0			-	HGNC	AF109301	CCDS1458.1	1q32.1	2013-05-22	2005-10-04	2005-10-04	ENSG00000158715	ENSG00000158715		"""Solute carriers"""	8642	protein-coding gene	gene with protein product		605097	"""prostate cancer associated protein 6"", ""prostate cancer associated protein 2"", ""prostate cancer associated protein 8"""	PCANAP6, PCANAP2, PCANAP8		10613842, 11245466	Standard	XM_005245556		Approved	IPCA-6, prostein, IPCA-2, IPCA-8	uc001hda.1	Q96JT2	OTTHUMG00000037223	ENST00000367145.3:c.870G>T	1.37:g.205632049C>A		Somatic	0	100	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70	A8K2U9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	p.L290	ENST00000367145.3	37	c.870	CCDS1458.1	1																																																																																			-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt		0.647	SLC45A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC45A3	protein_coding	OTTHUMT00000090619.1	C	NM_033102	-		205632049	-1	no_errors	ENST00000367145	ensembl	human	known	74_37	silent	SNP	0.998	A
NRXN1	9378	genome.wustl.edu	37	2	50147836	50147847	+	3'UTR	DEL	GTGTGTGTGTGT	GTGTGTGTGTGT	-	rs200264093|rs201814381|rs199597709|rs199689866|rs368179294|rs200666696|rs200969250|rs66612444		TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	GTGTGTGTGTGT	GTGTGTGTGTGT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr2:50147836_50147847delGTGTGTGTGTGT	ENST00000406316.2	-	0	7145_7156				NRXN1_ENST00000401710.1_3'UTR|NRXN1_ENST00000404971.1_3'UTR|NRXN1_ENST00000342183.5_3'UTR	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1						adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			CTGTGGATTCgtgtgtgtgtgtgtgtgtgtgt	0.392																																																	0								ENSG00000179915																																			NRXN1	SO:0001624	3_prime_UTR_variant	0				HGNC	AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.*1246ACACACACACAC>-	2.37:g.50147836_50147847delGTGTGTGTGTGT		Somatic	NA	NA	NA		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000406316.2	37	NULL	CCDS54360.1	2																																																																																			-	-		0.392	NRXN1-001	KNOWN	basic|CCDS	protein_coding	NRXN1	protein_coding	OTTHUMT00000325291.2	GTGTGTGTGTGT				50147847	-1	no_errors	ENST00000484192	ensembl	human	known	74_37	rna	DEL	0.000:0.001:0.005:0.106:0.113:0.127:0.107:0.109:0.093:0.096:0.025:0.055	-
POTEF	728378	genome.wustl.edu	37	2	130832537	130832537	+	Silent	SNP	G	G	A			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr2:130832537G>A	ENST00000409914.2	-	17	2907	c.2508C>T	c.(2506-2508)atC>atT	p.I836I	POTEF_ENST00000357462.5_Silent_p.I836I	NM_001099771.2	NP_001093241.1	A5A3E0	POTEF_HUMAN	POTE ankyrin domain family, member F	836	Actin-like.				retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)		p.I836M(1)		breast(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(4)|lung(28)|ovary(3)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	53						GCACAGCCTGGATGGCCACGT	0.582																																																	1	Substitution - Missense(1)	lung(1)						ENSG00000196604						107.0	129.0	122.0					2																	130832537		2197	4288	6485	POTEF	SO:0001819	synonymous_variant	0			-	HGNC	EF523384	CCDS46409.1	2q21.1	2013-01-10	2008-11-26	2008-11-26	ENSG00000196604	ENSG00000196604		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33905	protein-coding gene	gene with protein product			"""ANKRD26-like family C, member 1B"""	A26C1B		17101985	Standard	NM_001099771		Approved	POTEACTIN, POTE2alpha	uc010fmh.2	A5A3E0	OTTHUMG00000153628	ENST00000409914.2:c.2508C>T	2.37:g.130832537G>A		Somatic	0	63	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	30	11.76	A6NC34	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Actin-related,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Actin-related,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Actin-related	p.I836	ENST00000409914.2	37	c.2508	CCDS46409.1	2																																																																																			-	pfam_Actin-related,smart_Actin-related		0.582	POTEF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POTEF	protein_coding	OTTHUMT00000331889.2	G	NM_001099771	-		130832537	-1	no_errors	ENST00000357462	ensembl	human	known	74_37	silent	SNP	1.000	A
DPP3	10072	genome.wustl.edu	37	11	66272210	66272210	+	Missense_Mutation	SNP	G	G	T	rs200822369		TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr11:66272210G>T	ENST00000360510.2	+	17	2071	c.2006G>T	c.(2005-2007)cGg>cTg	p.R669L	DPP3_ENST00000531863.1_Missense_Mutation_p.R689L|DPP3_ENST00000532677.1_Missense_Mutation_p.R688L|DPP3_ENST00000541961.1_Missense_Mutation_p.R669L|DPP3_ENST00000530165.1_Missense_Mutation_p.R639L|DPP3_ENST00000453114.1_Missense_Mutation_p.R669L			Q9NY33	DPP3_HUMAN	dipeptidyl-peptidase 3	669					proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	dipeptidyl-peptidase activity (GO:0008239)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(2)|stomach(1)	23						AAGGAATCTCGGAAGCTCATT	0.592																																																	0								ENSG00000254986						124.0	108.0	113.0					11																	66272210		2200	4295	6495	DPP3	SO:0001583	missense	0			-	HGNC	AB017970	CCDS8141.1, CCDS58147.1	11q12-q13.1	2008-02-05	2006-01-12		ENSG00000254986	ENSG00000254986	3.4.14.4		3008	protein-coding gene	gene with protein product		606818	"""dipeptidylpeptidase III"", ""dipeptidylpeptidase 3"""			10773679	Standard	NM_005700		Approved		uc001oif.2	Q9NY33	OTTHUMG00000167143	ENST00000360510.2:c.2006G>T	11.37:g.66272210G>T	ENSP00000353701:p.Arg669Leu	Somatic	0	58	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	B2RDB5|B4DLX4|F5H8L6|O95748|Q969H2|Q9BV67|Q9HAL6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_Dipeptidyl-peptase3	p.R669L	ENST00000360510.2	37	c.2006	CCDS8141.1	11	.	.	.	.	.	.	.	.	.	.	G	33	5.277569	0.95459	.	.	ENSG00000254986	ENST00000531863;ENST00000532677;ENST00000360510;ENST00000453114;ENST00000541961;ENST00000530165;ENST00000543807;ENST00000347422	T;T;T;T;T;T	0.31510	1.49;1.49;1.49;1.49;1.49;1.49	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	T	0.65554	0.2702	M	0.93375	3.41	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.70296	-0.4911	10	0.33141	T	0.24	.	16.8871	0.86078	0.0:0.0:1.0:0.0	.	688;669	G3V1D3;Q9NY33	.;DPP3_HUMAN	L	689;688;669;669;669;639;567;249	ENSP00000432782:R689L;ENSP00000435284:R688L;ENSP00000353701:R669L;ENSP00000389943:R669L;ENSP00000440502:R669L;ENSP00000436941:R639L	ENSP00000309957:R249L	R	+	2	0	DPP3	66028786	1.000000	0.71417	0.997000	0.53966	0.990000	0.78478	8.402000	0.90205	2.608000	0.88229	0.543000	0.68304	CGG	-	pirsf_Dipeptidyl-peptase3		0.592	DPP3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	DPP3	protein_coding	OTTHUMT00000393424.2	G		-		66272210	+1	no_errors	ENST00000360510	ensembl	human	known	74_37	missense	SNP	1.000	T
ARHGAP23	57636	genome.wustl.edu	37	17	36638789	36638789	+	Missense_Mutation	SNP	G	G	T			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr17:36638789G>T	ENST00000431231.2	+	16	2845	c.2777G>T	c.(2776-2778)tGc>tTc	p.C926F	ARHGAP23_ENST00000443378.1_Missense_Mutation_p.C832F|ARHGAP23_ENST00000437668.3_Missense_Mutation_p.C926F	NM_001199417.1	NP_001186346.1	Q9P227	RHG23_HUMAN	Rho GTPase activating protein 23	926	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	GTPase activator activity (GO:0005096)			breast(2)|endometrium(8)|kidney(6)|lung(1)|skin(1)|stomach(2)	20						GTGGCTGCATGCTGTCGCATT	0.627																																																	0								ENSG00000225485						19.0	16.0	17.0					17																	36638789		692	1589	2281	ARHGAP23	SO:0001583	missense	0			-	HGNC	AB040934	CCDS56027.1	17q12	2014-05-06			ENSG00000225485	ENSG00000275832		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	29293	protein-coding gene	gene with protein product		610590				10819331, 15254754	Standard	NM_001199417		Approved	KIAA1501	uc021twd.1	Q9P227	OTTHUMG00000188547	ENST00000431231.2:c.2777G>T	17.37:g.36638789G>T	ENSP00000393539:p.Cys926Phe	Somatic	0	101	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	39	9.30		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RhoGAP_dom,pfam_PDZ,pfam_Pleckstrin_homology,superfamily_Rho_GTPase_activation_prot,superfamily_PDZ,smart_PDZ,smart_Pleckstrin_homology,smart_RhoGAP_dom,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_RhoGAP_dom	p.C926F	ENST00000431231.2	37	c.2777	CCDS56027.1	17	.	.	.	.	.	.	.	.	.	.	G	13.48	2.249639	0.39797	.	.	ENSG00000225485	ENST00000437668;ENST00000431231;ENST00000443378	T;T;T	0.25749	1.78;1.78;1.78	4.85	4.85	0.62838	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.000000	0.85682	D	0.000000	T	0.63367	0.2505	H	0.94964	3.605	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.997	T	0.75263	-0.3379	10	0.87932	D	0	.	16.8914	0.86088	0.0:0.0:1.0:0.0	.	926;926	Q9P227;Q9P227-2	RHG23_HUMAN;.	F	926;926;832	ENSP00000394153:C926F;ENSP00000393539:C926F;ENSP00000407333:C832F	ENSP00000393539:C926F	C	+	2	0	ARHGAP23	33892315	1.000000	0.71417	0.996000	0.52242	0.048000	0.14542	9.657000	0.98554	2.517000	0.84864	0.650000	0.86243	TGC	-	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom		0.627	ARHGAP23-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARHGAP23	protein_coding	OTTHUMT00000441789.1	G	XM_290799	-		36638789	+1	no_errors	ENST00000431231	ensembl	human	known	74_37	missense	SNP	1.000	T
TSGA13	114960	genome.wustl.edu	37	7	130370043	130370043	+	Missense_Mutation	SNP	G	G	T			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr7:130370043G>T	ENST00000456951.1	-	3	857	c.6C>A	c.(4-6)agC>agA	p.S2R	TSGA13_ENST00000356588.3_Missense_Mutation_p.S2R			Q96PP4	TSG13_HUMAN	testis specific, 13	2										endometrium(1)|kidney(3)|large_intestine(3)|lung(6)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	18	Melanoma(18;0.0435)					GTCTCTTTTGGCTCATTGCTG	0.433																																																	0								ENSG00000213265						211.0	190.0	197.0					7																	130370043		2203	4300	6503	TSGA13	SO:0001583	missense	0			-	HGNC	AK093329	CCDS5824.1	7q32	2008-02-04			ENSG00000213265	ENSG00000213265			12369	protein-coding gene	gene with protein product							Standard	NM_052933		Approved		uc003vqi.3	Q96PP4	OTTHUMG00000154999	ENST00000456951.1:c.6C>A	7.37:g.130370043G>T	ENSP00000406047:p.Ser2Arg	Somatic	0	51	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	40	9.09	B3KSC9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.S2R	ENST00000456951.1	37	c.6	CCDS5824.1	7	.	.	.	.	.	.	.	.	.	.	G	8.220	0.802282	0.16397	.	.	ENSG00000213265	ENST00000456951;ENST00000418126;ENST00000356588;ENST00000443954;ENST00000438346	.	.	.	4.47	3.59	0.41128	.	1.298600	0.05525	N	0.562811	T	0.23492	0.0568	N	0.14661	0.345	0.09310	N	0.999998	P	0.35982	0.531	B	0.31686	0.134	T	0.19353	-1.0308	9	0.62326	D	0.03	0.0287	8.3212	0.32130	0.1045:0.0:0.8955:0.0	.	2	Q96PP4	TSG13_HUMAN	R	2	.	ENSP00000348996:S2R	S	-	3	2	TSGA13	130020583	0.965000	0.33210	0.558000	0.28319	0.016000	0.09150	1.046000	0.30354	1.481000	0.48307	0.557000	0.71058	AGC	-	NULL		0.433	TSGA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSGA13	protein_coding	OTTHUMT00000337997.1	G	NM_052933	-		130370043	-1	no_errors	ENST00000356588	ensembl	human	known	74_37	missense	SNP	0.566	T
LINC01330	646168	genome.wustl.edu	37	3	167621200	167621200	+	lincRNA	SNP	A	A	G			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr3:167621200A>G	ENST00000481578.1	+	0	244																											AAGGAGAAGAACATTCCACCC	0.348																																																	0								ENSG00000244227																																			RP11-298O21.5			0			-	Clone_based_vega_gene																													3.37:g.167621200A>G		Somatic	0	40	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	39	7	84.78		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000481578.1	37	NULL		3																																																																																			-	-		0.348	RP11-298O21.5-002	KNOWN	basic	lincRNA	ENSG00000244227	lincRNA	OTTHUMT00000351188.1	A		-		167621200	+1	no_errors	ENST00000459923	ensembl	human	known	74_37	rna	SNP	0.053	G
KLK12	43849	genome.wustl.edu	37	19	51534120	51534120	+	Missense_Mutation	SNP	C	C	A			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr19:51534120C>A	ENST00000525263.1	-	4	634	c.515G>T	c.(514-516)tGc>tTc	p.C172F	CTC-518B2.9_ENST00000594910.1_RNA|KLK12_ENST00000529888.1_Silent_p.L85L|KLK11_ENST00000319720.7_5'Flank|KLK12_ENST00000319590.4_Missense_Mutation_p.C172F|KLK12_ENST00000250351.4_Missense_Mutation_p.C172F|KLK12_ENST00000250352.11_Missense_Mutation_p.C62F|KLK11_ENST00000391804.3_5'Flank			Q9UKR0	KLK12_HUMAN	kallikrein-related peptidase 12	172	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				proteolysis (GO:0006508)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			endometrium(1)|large_intestine(4)|lung(3)|ovary(1)|skin(1)|stomach(1)|urinary_tract(1)	12		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00328)|GBM - Glioblastoma multiforme(134;0.00399)		CACACCATGGCAGGTGGCATG	0.627																																																	0								ENSG00000186474						166.0	151.0	156.0					19																	51534120		2203	4300	6503	KLK12	SO:0001583	missense	0			-	HGNC		CCDS12820.1, CCDS12821.1, CCDS54298.1	19q13.33	2008-02-05	2006-10-27		ENSG00000186474	ENSG00000186474		"""Kallikreins"""	6360	protein-coding gene	gene with protein product		605539	"""kallikrein 12"""			16800724, 16800723	Standard	NM_019598		Approved	KLK-L5	uc002pvh.1	Q9UKR0	OTTHUMG00000165806	ENST00000525263.1:c.515G>T	19.37:g.51534120C>A	ENSP00000436458:p.Cys172Phe	Somatic	0	56	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	24	14.29	Q9UKR1|Q9UKR2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.C172F	ENST00000525263.1	37	c.515	CCDS12821.1	19	.	.	.	.	.	.	.	.	.	.	c	14.27	2.485393	0.44147	.	.	ENSG00000186474	ENST00000525263;ENST00000319590;ENST00000250352;ENST00000250351	D;D;T;D	0.96992	-4.2;-4.2;0.5;-4.2	4.62	4.62	0.57501	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.39020	N	0.001489	D	0.98789	0.9592	H	0.97732	4.065	0.52501	D	0.999953	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;0.998;1.0	D	0.99327	1.0908	10	0.87932	D	0	.	14.9862	0.71351	0.0:1.0:0.0:0.0	.	62;62;172;172	B9EGA9;Q49AM7;Q9UKR0-2;Q9UKR0	.;.;.;KLK12_HUMAN	F	172;172;62;172	ENSP00000436458:C172F;ENSP00000324181:C172F;ENSP00000250352:C62F;ENSP00000250351:C172F	ENSP00000250351:C172F	C	-	2	0	KLK12	56225932	0.986000	0.35501	0.680000	0.29994	0.024000	0.10985	4.692000	0.61746	2.395000	0.81488	0.555000	0.69702	TGC	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1		0.627	KLK12-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	KLK12	protein_coding	OTTHUMT00000386288.1	C	NM_019598	-		51534120	-1	no_errors	ENST00000250351	ensembl	human	known	74_37	missense	SNP	0.930	A
PGAM4	441531	genome.wustl.edu	37	X	77224422	77224422	+	Silent	SNP	C	C	A			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chrX:77224422C>A	ENST00000458128.1	-	1	713	c.714G>T	c.(712-714)acG>acT	p.T238T	ATP7A_ENST00000343533.5_Intron|ATP7A_ENST00000341514.6_Intron|ATP7A_ENST00000350425.4_Intron	NM_001029891.2	NP_001025062.1	Q8N0Y7	PGAM4_HUMAN	phosphoglycerate mutase family member 4	238					glycolytic process (GO:0006096)|positive regulation of sperm motility (GO:1902093)	extracellular vesicular exosome (GO:0070062)|sperm principal piece (GO:0097228)	bisphosphoglycerate 2-phosphatase activity (GO:0004083)|bisphosphoglycerate mutase activity (GO:0004082)|phosphoglycerate mutase activity (GO:0004619)			endometrium(2)|lung(4)	6						CTTTGCACACCGTCTCTTCAT	0.557																																																	0								ENSG00000226784						64.0	59.0	61.0					X																	77224422		2203	4296	6499	PGAM4	SO:0001819	synonymous_variant	0			-	HGNC	AF465731	CCDS35338.1	Xq21.1	2011-02-09	2006-02-09		ENSG00000226784	ENSG00000226784			21731	protein-coding gene	gene with protein product		300567	"""phosphoglycerate mutase family 4"""			11961099, 9370262	Standard	NM_001029891		Approved	dJ1000K24.1, PGAM3, PGAM-B, PGAM1	uc004ecy.1	Q8N0Y7	OTTHUMG00000057865	ENST00000458128.1:c.714G>T	X.37:g.77224422C>A		Somatic	0	72	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	54	8.47	Q5JPN2|Q8NI24|Q8NI25|Q8NI26	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_His_Pase_superF_clade-1,smart_His_Pase_superF_clade-1,tigrfam_Phosphogly_mut1	p.T238	ENST00000458128.1	37	c.714	CCDS35338.1	X																																																																																			-	tigrfam_Phosphogly_mut1		0.557	PGAM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PGAM4	protein_coding	OTTHUMT00000128371.2	C	NM_001029891	-		77224422	-1	no_errors	ENST00000458128	ensembl	human	known	74_37	silent	SNP	0.991	A
POLG2	11232	genome.wustl.edu	37	17	62479040	62479040	+	Missense_Mutation	SNP	C	C	A			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr17:62479040C>A	ENST00000539111.2	-	6	1254	c.1187G>T	c.(1186-1188)aGa>aTa	p.R396I	POLG2_ENST00000582501.1_5'UTR	NM_007215.3	NP_009146.2	Q9UHN1	DPOG2_HUMAN	polymerase (DNA directed), gamma 2, accessory subunit	396					DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-dependent DNA replication (GO:0006261)	extracellular vesicular exosome (GO:0070062)|mitochondrial chromosome (GO:0000262)|mitochondrial nucleoid (GO:0042645)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)			central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(1)|lung(4)|skin(2)|stomach(1)|urinary_tract(1)	15	Breast(5;2.15e-14)		BRCA - Breast invasive adenocarcinoma(8;4.97e-11)			ACTCACCTGTCTTAGTTCCAA	0.393																																					Colon(3;18 21 435 17652 48887)												0								ENSG00000256525						67.0	67.0	67.0					17																	62479040		2203	4300	6503	POLG2	SO:0001583	missense	0			-	HGNC	U94703	CCDS32706.1	17q23.3	2012-05-18			ENSG00000256525	ENSG00000256525		"""DNA polymerases"""	9180	protein-coding gene	gene with protein product		604983				9153213	Standard	NM_007215		Approved	MTPOLB, HP55	uc002jei.3	Q9UHN1		ENST00000539111.2:c.1187G>T	17.37:g.62479040C>A	ENSP00000442563:p.Arg396Ile	Somatic	0	70	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	51	8.93	O00419|Q0IJ81|Q96GW2|Q9UK35|Q9UK94	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Anticodon-bd,superfamily_Anticodon-bd	p.R396I	ENST00000539111.2	37	c.1187	CCDS32706.1	17	.	.	.	.	.	.	.	.	.	.	C	17.91	3.503841	0.64410	.	.	ENSG00000256525	ENST00000539111	D	0.82526	-1.62	5.91	5.91	0.95273	Anticodon-binding (3);	0.000000	0.85682	D	0.000000	D	0.90604	0.7054	M	0.65975	2.015	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.90651	0.4582	10	0.72032	D	0.01	-19.4102	18.5344	0.91004	0.0:1.0:0.0:0.0	.	396	Q9UHN1	DPOG2_HUMAN	I	396	ENSP00000442563:R396I	ENSP00000442563:R396I	R	-	2	0	POLG2	59909502	1.000000	0.71417	0.996000	0.52242	0.146000	0.21551	6.265000	0.72534	2.816000	0.96949	0.644000	0.83932	AGA	-	pfam_Anticodon-bd,superfamily_Anticodon-bd		0.393	POLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLG2	protein_coding	OTTHUMT00000443820.1	C	NM_007215	-		62479040	-1	no_errors	ENST00000539111	ensembl	human	known	74_37	missense	SNP	1.000	A
MARCH11	441061	genome.wustl.edu	37	5	16067845	16067845	+	Missense_Mutation	SNP	A	A	G			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr5:16067845A>G	ENST00000332432.8	-	4	1143	c.944T>C	c.(943-945)gTg>gCg	p.V315A		NM_001102562.1	NP_001096032.1	A6NNE9	MARHB_HUMAN	membrane-associated ring finger (C3HC4) 11	315					protein ubiquitination (GO:0016567)	cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(14)|urinary_tract(1)	20						GTGCAAATTCACAGCTCGCCA	0.418																																																	0								ENSG00000183654						60.0	59.0	59.0					5																	16067845		1897	4134	6031	MARCH11	SO:0001583	missense	0			-	HGNC	BC150513	CCDS47192.1	5p15.1	2013-01-09			ENSG00000183654	ENSG00000183654		"""RING-type (C3HC4) zinc fingers"", ""MARCH membrane-associated ring fingers"""	33609	protein-coding gene	gene with protein product		613338				17604280	Standard	NM_001102562		Approved	MARCH-XI	uc003jfo.2	A6NNE9	OTTHUMG00000161789	ENST00000332432.8:c.944T>C	5.37:g.16067845A>G	ENSP00000333181:p.Val315Ala	Somatic	0	29	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	32	31.91	A7E2S6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C3HC4_RING-type,smart_Znf_RING-CH	p.V315A	ENST00000332432.8	37	c.944	CCDS47192.1	5	.	.	.	.	.	.	.	.	.	.	A	18.29	3.590370	0.66105	.	.	ENSG00000183654	ENST00000332432	T	0.23754	1.89	5.54	5.54	0.83059	.	0.000000	0.48767	D	0.000180	T	0.48466	0.1501	M	0.62723	1.935	0.80722	D	1	D	0.69078	0.997	D	0.68192	0.956	T	0.49523	-0.8931	10	0.87932	D	0	-15.3288	15.971	0.80019	1.0:0.0:0.0:0.0	.	315	A6NNE9	MARHB_HUMAN	A	315	ENSP00000333181:V315A	ENSP00000333181:V315A	V	-	2	0	MARCH11	16120845	1.000000	0.71417	0.949000	0.38748	0.980000	0.70556	8.673000	0.91186	2.223000	0.72356	0.533000	0.62120	GTG	-	NULL		0.418	MARCH11-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	MARCH11	protein_coding	OTTHUMT00000366096.2	A	NM_001102562	-		16067845	-1	no_errors	ENST00000332432	ensembl	human	known	74_37	missense	SNP	0.999	G
USP28	57646	genome.wustl.edu	37	11	113711444	113711444	+	Nonsense_Mutation	SNP	G	G	T			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr11:113711444G>T	ENST00000003302.4	-	5	478	c.410C>A	c.(409-411)tCa>tAa	p.S137*	USP28_ENST00000542033.1_5'UTR|USP28_ENST00000537706.1_Nonsense_Mutation_p.S137*|USP28_ENST00000260188.5_Nonsense_Mutation_p.S137*|USP28_ENST00000545540.1_Nonsense_Mutation_p.S12*	NM_020886.2	NP_065937.1	Q96RU2	UBP28_HUMAN	ubiquitin specific peptidase 28	137					cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|protein deubiquitination (GO:0016579)|response to ionizing radiation (GO:0010212)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(4)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(12)|lung(24)|ovary(1)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	59		all_cancers(61;3.74e-18)|all_epithelial(67;3.75e-11)|Melanoma(852;1.46e-05)|all_hematologic(158;4.65e-05)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|Prostate(24;0.0153)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;3.93e-06)|Epithelial(105;0.000122)|all cancers(92;0.00104)		TTTTCTCTTTGAGCGTTTAGT	0.428																																					Melanoma(4;162 555 7664)|GBM(79;500 2010 17506)|Esophageal Squamous(9;463 924 15765)												0								ENSG00000048028						114.0	98.0	103.0					11																	113711444		2201	4296	6497	USP28	SO:0001587	stop_gained	0			-	HGNC	AB040948	CCDS31680.1, CCDS73394.1	11q23	2008-04-11	2005-08-08		ENSG00000048028	ENSG00000048028		"""Ubiquitin-specific peptidases"""	12625	protein-coding gene	gene with protein product		610748	"""ubiquitin specific protease 28"""			12838346, 11597335	Standard	XM_005271630		Approved	KIAA1515	uc001poh.3	Q96RU2	OTTHUMG00000168205	ENST00000003302.4:c.410C>A	11.37:g.113711444G>T	ENSP00000003302:p.Ser137*	Somatic	0	65	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	B0YJC0|B0YJC1|Q9P213	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_C19/C67,superfamily_UBA-like,pfscan_Peptidase_C19/C67	p.S137*	ENST00000003302.4	37	c.410	CCDS31680.1	11	.	.	.	.	.	.	.	.	.	.	G	36	5.750612	0.96890	.	.	ENSG00000048028	ENST00000003302;ENST00000260188;ENST00000545540;ENST00000537706;ENST00000537642	.	.	.	5.75	5.75	0.90469	.	0.118599	0.56097	D	0.000039	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.12430	T	0.62	-11.9303	19.5331	0.95237	0.0:0.0:1.0:0.0	.	.	.	.	X	137;137;12;137;65	.	ENSP00000003302:S137X	S	-	2	0	USP28	113216654	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.526000	0.53509	2.701000	0.92244	0.585000	0.79938	TCA	-	NULL		0.428	USP28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP28	protein_coding	OTTHUMT00000398789.1	G		-		113711444	-1	no_errors	ENST00000003302	ensembl	human	known	74_37	nonsense	SNP	0.998	T
NBPF11	200030	genome.wustl.edu	37	1	146055349	146055349	+	Missense_Mutation	SNP	G	G	A	rs200002878	byFrequency	TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr1:146055349G>A	ENST00000604938.1	-	7	1572	c.274C>T	c.(274-276)Ctc>Ttc	p.L92F	NBPF11_ENST00000604894.1_Intron|NBPF11_ENST00000605317.1_Missense_Mutation_p.L146F|NBPF11_ENST00000401009.2_5'Flank|NBPF11_ENST00000479926.2_Intron|NBPF11_ENST00000339388.5_Missense_Mutation_p.L92F|NBPF11_ENST00000369323.3_Intron			Q86T75	NBPFB_HUMAN	neuroblastoma breakpoint family, member 11	92						cytoplasm (GO:0005737)						all_hematologic(923;0.0276)					CCTCACCTGAGCTCCTCAGCT	0.527																																																	0								ENSG00000152042																																			NBPF11	SO:0001583	missense	0			-	HGNC			1q21.1	2014-01-16			ENSG00000152042	ENSG00000263956		"""neuroblastoma breakpoint family"""	31993	protein-coding gene	gene with protein product		614001	"""neuroblastoma breakpoint family, member 24"""	NBPF24		16079250	Standard	XM_006711197		Approved			Q86T75	OTTHUMG00000013880	ENST00000604938.1:c.274C>T	1.37:g.146055349G>A	ENSP00000474107:p.Leu92Phe	Somatic	0	10	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	13	45.83	B1AKG1|B7Z7R4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_NBPF_dom,superfamily_Secretoglobin	p.L92F	ENST00000604938.1	37	c.274		1	.	.	.	.	.	.	.	.	.	.	g	8.397	0.841041	0.16891	.	.	ENSG00000152042	ENST00000339388;ENST00000479926	T	0.03553	3.89	0.804	0.804	0.18697	.	.	.	.	.	T	0.04952	0.0133	M	0.66378	2.025	0.09310	N	0.999998	D;B	0.76494	0.999;0.137	D;B	0.71656	0.974;0.01	T	0.35748	-0.9776	9	0.39692	T	0.17	.	5.0805	0.14653	0.0:0.0:1.0:0.0	.	92;92	B7WNR1;Q86T75	.;NBPFB_HUMAN	F	92	ENSP00000345181:L92F	ENSP00000345181:L92F	L	-	1	0	NBPF11	144766706	0.001000	0.12720	0.053000	0.19242	0.075000	0.17131	-0.341000	0.07811	0.772000	0.33382	0.398000	0.26397	CTC	-	NULL		0.527	NBPF11-001	KNOWN	basic|appris_candidate	protein_coding	NBPF11	protein_coding	OTTHUMT00000351193.2	G	NM_183372	rs200002878		146055349	-1	no_errors	ENST00000604938	ensembl	human	known	74_37	missense	SNP	0.060	A
ZNF404	342908	genome.wustl.edu	37	19	44377052	44377052	+	Silent	SNP	G	G	T	rs545094704		TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr19:44377052G>T	ENST00000587539.1	-	3	1313	c.1314C>A	c.(1312-1314)ccC>ccA	p.P438P	ZNF404_ENST00000324394.6_Silent_p.P436P	NM_001033719.2	NP_001028891.2	Q494X3	ZN404_HUMAN	zinc finger protein 404	438					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(3)|skin(1)|stomach(2)|urinary_tract(1)	17		Prostate(69;0.0352)				TACATTCATAGGGTTTCTCCC	0.358																																																	0								ENSG00000176222						41.0	44.0	43.0					19																	44377052		2194	4297	6491	ZNF404	SO:0001819	synonymous_variant	0			-	HGNC	XM_092027	CCDS59394.1	19q13.31	2013-01-08				ENSG00000176222		"""Zinc fingers, C2H2-type"", ""-"""	19417	protein-coding gene	gene with protein product							Standard	NM_001033719		Approved		uc002oxs.5	Q494X3		ENST00000587539.1:c.1314C>A	19.37:g.44377052G>T		Somatic	0	43	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	39	9.30	A4FU30|K7ELF2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.P438	ENST00000587539.1	37	c.1314	CCDS59394.1	19																																																																																			-	pfscan_Znf_C2H2		0.358	ZNF404-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF404	protein_coding	OTTHUMT00000460019.1	G	NM_001033719	-		44377052	-1	no_errors	ENST00000587539	ensembl	human	known	74_37	silent	SNP	0.747	T
LOC401286	401286	genome.wustl.edu	37	6	168069993	168069993	+	lincRNA	SNP	G	G	A			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr6:168069993G>A	ENST00000609107.1	-	0	2095																											TGCTCCCCATGAAGTGCATCT	0.637																																																	0								ENSG00000272549																																			RP11-351J23.2			0			-	Clone_based_vega_gene																													6.37:g.168069993G>A		Somatic	0	82	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	43	21.82		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000609107.1	37	NULL		6																																																																																			-	-		0.637	RP11-351J23.2-001	KNOWN	basic	lincRNA	LOC401286	lincRNA	OTTHUMT00000471574.1	G		-		168069993	-1	no_errors	ENST00000609107	ensembl	human	known	74_37	rna	SNP	0.000	A
OTP	23440	genome.wustl.edu	37	5	76932753	76932753	+	Missense_Mutation	SNP	C	C	T			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr5:76932753C>T	ENST00000306422.3	-	2	1478	c.340G>A	c.(340-342)Gca>Aca	p.A114T	OTP_ENST00000515716.1_5'UTR	NM_032109.2	NP_115485.1	Q5XKR4	OTP_HUMAN	orthopedia homeobox	114					forebrain neuron differentiation (GO:0021879)|hypothalamus cell differentiation (GO:0021979)|neurohypophysis development (GO:0021985)|positive regulation of neuroblast proliferation (GO:0002052)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(1)|kidney(1)|large_intestine(5)|lung(5)|pancreas(1)	13		all_lung(232;0.00051)|Lung NSC(167;0.000601)|Ovarian(174;0.0105)|Prostate(461;0.214)		OV - Ovarian serous cystadenocarcinoma(54;9.04e-51)|Epithelial(54;1.62e-45)|all cancers(79;4.4e-41)		TTGAGCTGTGCGGGGGTGAAG	0.667																																																	0								ENSG00000171540						108.0	110.0	110.0					5																	76932753		2203	4300	6503	OTP	SO:0001583	missense	0			-	HGNC		CCDS4039.1	5q14.1	2011-06-20	2007-02-15		ENSG00000171540	ENSG00000171540		"""Homeoboxes / PRD class"""	8518	protein-coding gene	gene with protein product		604529	"""orthopedia homolog (Drosophila)"""			10458915	Standard	NM_032109		Approved		uc003kfg.3	Q5XKR4	OTTHUMG00000102171	ENST00000306422.3:c.340G>A	5.37:g.76932753C>T	ENSP00000302814:p.Ala114Thr	Somatic	0	82	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	26	40.91		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Homeobox_dom,pfam_OAR_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,prints_HTH_motif,pfscan_OAR_dom,pfscan_Homeobox_dom	p.A114T	ENST00000306422.3	37	c.340	CCDS4039.1	5	.	.	.	.	.	.	.	.	.	.	C	33	5.282106	0.95489	.	.	ENSG00000171540	ENST00000306422	D	0.96104	-3.91	5.18	5.18	0.71444	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.95752	0.8618	L	0.27975	0.815	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	D	0.95434	0.8519	10	0.39692	T	0.17	.	17.6239	0.88089	0.0:1.0:0.0:0.0	.	114	Q5XKR4	OTP_HUMAN	T	114	ENSP00000302814:A114T	ENSP00000302814:A114T	A	-	1	0	OTP	76968509	1.000000	0.71417	0.850000	0.33497	0.935000	0.57460	4.699000	0.61796	2.589000	0.87451	0.655000	0.94253	GCA	-	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom		0.667	OTP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OTP	protein_coding	OTTHUMT00000220016.2	C		-		76932753	-1	no_errors	ENST00000306422	ensembl	human	known	74_37	missense	SNP	1.000	T
C1orf116	79098	genome.wustl.edu	37	1	207198249	207198249	+	Missense_Mutation	SNP	G	G	T			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr1:207198249G>T	ENST00000359470.5	-	3	515	c.266C>A	c.(265-267)aCc>aAc	p.T89N	C1orf116_ENST00000461135.2_5'UTR	NM_023938.5	NP_076427.2	Q9BW04	SARG_HUMAN	chromosome 1 open reading frame 116	89						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(2)|skin(4)|stomach(1)	29	Prostate(682;0.19)					AGTGGGTTGGGTTATGGGCAG	0.597																																																	0								ENSG00000182795						95.0	101.0	99.0					1																	207198249		2203	4300	6503	C1orf116	SO:0001583	missense	0			-	HGNC		CCDS1475.1, CCDS44306.1	1q32.1	2012-06-26			ENSG00000182795	ENSG00000182795			28667	protein-coding gene	gene with protein product	"""specifically androgen-regulated gene"""	611680				15525603, 9389513	Standard	NM_023938		Approved	SARG, FLJ36507, MGC2742, MGC4309	uc001hfd.2	Q9BW04	OTTHUMG00000036580	ENST00000359470.5:c.266C>A	1.37:g.207198249G>T	ENSP00000352447:p.Thr89Asn	Somatic	0	61	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	31	11.43	C9JV41|Q658X3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.T89N	ENST00000359470.5	37	c.266	CCDS1475.1	1	.	.	.	.	.	.	.	.	.	.	G	14.08	2.428811	0.43122	.	.	ENSG00000182795	ENST00000359470	T	0.09350	2.99	4.39	-0.122	0.13531	.	1.309000	0.04622	N	0.402222	T	0.10078	0.0247	L	0.51422	1.61	0.20196	N	0.999924	P	0.43701	0.815	B	0.36989	0.238	T	0.30851	-0.9964	10	0.62326	D	0.03	-1.6746	3.2343	0.06758	0.164:0.3226:0.3958:0.1176	.	89	Q9BW04	SARG_HUMAN	N	89	ENSP00000352447:T89N	ENSP00000352447:T89N	T	-	2	0	C1orf116	205264872	0.001000	0.12720	0.001000	0.08648	0.004000	0.04260	-0.096000	0.11059	0.168000	0.19655	0.655000	0.94253	ACC	-	NULL		0.597	C1orf116-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf116	protein_coding	OTTHUMT00000088973.1	G	NM_024115	-		207198249	-1	no_errors	ENST00000359470	ensembl	human	known	74_37	missense	SNP	0.000	T
CTBP2	1488	genome.wustl.edu	37	10	126799600	126799600	+	5'UTR	SNP	G	G	T			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr10:126799600G>T	ENST00000337195.5	-	0	257				CTBP2_ENST00000411419.2_5'UTR|CTBP2_ENST00000531469.1_5'UTR|CTBP2_ENST00000476817.1_Intron|CTBP2_ENST00000494626.2_Intron	NM_001329.2	NP_001320.1	P56545	CTBP2_HUMAN	C-terminal binding protein 2						negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)|viral genome replication (GO:0019079)|white fat cell differentiation (GO:0050872)	cell junction (GO:0030054)|nucleus (GO:0005634)|synapse (GO:0045202)|transcriptional repressor complex (GO:0017053)	NAD binding (GO:0051287)|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor (GO:0016616)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25		all_lung(145;0.0132)|Lung NSC(174;0.0193)|all_neural(114;0.116)|Colorectal(57;0.173)		Colorectal(40;0.00572)|COAD - Colon adenocarcinoma(40;0.0127)|GBM - Glioblastoma multiforme(135;0.147)		CACACGATGGGCTGTCCGTCT	0.373																																																	0								ENSG00000175029																																			CTBP2	SO:0001623	5_prime_UTR_variant	0			-	HGNC	AF016507	CCDS7643.1, CCDS7644.1	10q26.13	2008-08-01			ENSG00000175029	ENSG00000175029			2495	protein-coding gene	gene with protein product		602619				9479502, 11864595	Standard	NM_022802		Approved	ribeye	uc001lie.4	P56545	OTTHUMG00000019224	ENST00000337195.5:c.-143C>A	10.37:g.126799600G>T		Somatic	0	61	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	33	10.81	A8K2X5|D3DRF5|O43449|Q5SQP7|Q69YI3|Q86SV0|Q9H2T8	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000337195.5	37	NULL	CCDS7643.1	10																																																																																			-	-		0.373	CTBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTBP2	protein_coding	OTTHUMT00000050900.3	G	NM_001083914	-		126799600	-1	no_errors	ENST00000467395	ensembl	human	known	74_37	rna	SNP	0.214	T
SH3RF3	344558	genome.wustl.edu	37	2	110107247	110107247	+	Nonsense_Mutation	SNP	G	G	T			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr2:110107247G>T	ENST00000309415.6	+	9	2335	c.2335G>T	c.(2335-2337)Gag>Tag	p.E779*		NM_001099289.1	NP_001092759.1	Q8TEJ3	SH3R3_HUMAN	SH3 domain containing ring finger 3	779							zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(6)|liver(2)|lung(5)|ovary(2)	18						CTGCCCCATAGAGAGCGAGAT	0.642																																																	0								ENSG00000172985						31.0	30.0	30.0					2																	110107247		692	1591	2283	SH3RF3	SO:0001587	stop_gained	0			-	HGNC	AK074131	CCDS74557.1	2q13	2013-01-11	2008-05-14	2008-05-14	ENSG00000172985	ENSG00000172985		"""RING-type (C3HC4) zinc fingers"""	24699	protein-coding gene	gene with protein product			"""SH3 multiple domains 4"""	SH3MD4		16374509	Standard	XM_006712493		Approved	FLJ00204, POSH2	uc010ywt.1	Q8TEJ3	OTTHUMG00000153439	ENST00000309415.6:c.2335G>T	2.37:g.110107247G>T	ENSP00000309186:p.Glu779*	Somatic	0	75	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	14	17.65	A0SDZ7|A8MPR1|Q8NDU1	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_Znf_RING,smart_SH3_domain,prints_p67phox,pfscan_SH3_domain,pfscan_Znf_RING	p.E779*	ENST00000309415.6	37	c.2335		2	.	.	.	.	.	.	.	.	.	.	G	39	7.793566	0.98492	.	.	ENSG00000172985	ENST00000309415	.	.	.	5.49	5.49	0.81192	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.21014	T	0.42	.	19.3708	0.94484	0.0:0.0:1.0:0.0	.	.	.	.	X	779	.	ENSP00000309186:E779X	E	+	1	0	SH3RF3	.	1.000000	0.71417	0.998000	0.56505	0.917000	0.54804	9.091000	0.94151	2.576000	0.86940	0.555000	0.69702	GAG	-	NULL		0.642	SH3RF3-201	KNOWN	basic|appris_principal	protein_coding	SH3RF3	protein_coding		G	NM_001099289	-		110107247	+1	no_errors	ENST00000309415	ensembl	human	known	74_37	nonsense	SNP	1.000	T
PRRC2B	84726	genome.wustl.edu	37	9	134350137	134350137	+	Missense_Mutation	SNP	G	G	T			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr9:134350137G>T	ENST00000357304.4	+	15	2676	c.2621G>T	c.(2620-2622)aGc>aTc	p.S874I	PRRC2B_ENST00000372249.1_5'UTR|PRRC2B_ENST00000405995.1_Intron|PRRC2B_ENST00000458550.1_Intron	NM_013318.3	NP_037450.2	Q5JSZ5	PRC2B_HUMAN	proline-rich coiled-coil 2B	874							poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(20)|ovary(2)	44						TGGGATGTTAGCCACCAGCCA	0.592																																																	0								ENSG00000130723						18.0	20.0	19.0					9																	134350137		2030	4194	6224	PRRC2B	SO:0001583	missense	0			-	HGNC	AB011087	CCDS48044.1	9q34.13	2010-12-09	2010-12-09	2010-12-09	ENSG00000130723	ENSG00000130723			28121	protein-coding gene	gene with protein product			"""KIAA0515"", ""HLA-B associated transcript 2-like"", ""HLA-B associated transcript 2-like 1"""	KIAA0515, BAT2L, BAT2L1		9628581	Standard	NM_013318		Approved	MGC10526, LQFBS-1	uc004can.4	Q5JSZ5	OTTHUMG00000020827	ENST00000357304.4:c.2621G>T	9.37:g.134350137G>T	ENSP00000349856:p.Ser874Ile	Somatic	0	35	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	32	11.11	O60270|Q5JSZ7|Q66VZ2|Q68CR0|Q96EI9|Q9H683	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_BAT2_N	p.S874I	ENST00000357304.4	37	c.2621	CCDS48044.1	9	.	.	.	.	.	.	.	.	.	.	G	9.750	1.167241	0.21621	.	.	ENSG00000130723	ENST00000357304;ENST00000418650;ENST00000456307	T;T	0.09630	2.96;2.96	5.7	3.87	0.44632	.	.	.	.	.	T	0.09069	0.0224	N	0.14661	0.345	0.19300	N	0.99998	P;P	0.46220	0.874;0.8	P;B	0.48141	0.568;0.143	T	0.23976	-1.0173	9	0.32370	T	0.25	.	7.5054	0.27542	0.1452:0.1352:0.7196:0.0	.	170;874	Q5H9R5;Q5JSZ5	.;PRC2B_HUMAN	I	874;170;143	ENSP00000349856:S874I;ENSP00000400608:S143I	ENSP00000349856:S874I	S	+	2	0	PRRC2B	133339958	0.132000	0.22450	0.027000	0.17364	0.868000	0.49771	0.872000	0.28037	0.768000	0.33290	0.655000	0.94253	AGC	-	NULL		0.592	PRRC2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PRRC2B	protein_coding		G		-		134350137	+1	no_errors	ENST00000357304	ensembl	human	known	74_37	missense	SNP	0.010	T
SLC4A3	6508	genome.wustl.edu	37	2	220494110	220494111	+	Frame_Shift_Ins	INS	-	-	C			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr2:220494110_220494111insC	ENST00000358055.3	+	4	974_975	c.462_463insC	c.(463-465)cccfs	p.P155fs	SLC4A3_ENST00000317151.3_Frame_Shift_Ins_p.P155fs|SLC4A3_ENST00000373760.2_Frame_Shift_Ins_p.P155fs|AC009955.8_ENST00000455896.1_RNA|SLC4A3_ENST00000273063.6_Frame_Shift_Ins_p.P155fs|SLC4A3_ENST00000497589.1_3'UTR|SLC4A3_ENST00000373762.3_Frame_Shift_Ins_p.P155fs			P48751	B3A3_HUMAN	solute carrier family 4 (anion exchanger), member 3	155	Pro-rich.				bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|regulation of intracellular pH (GO:0051453)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)	51		Renal(207;0.0183)		Epithelial(149;2.53e-07)|all cancers(144;5.57e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		AACCTGTGGAGCCCCCCCACTC	0.629																																																	0								ENSG00000114923																																			SLC4A3	SO:0001589	frameshift_variant	0				HGNC		CCDS2445.1, CCDS2446.1	2q35	2013-07-19	2013-07-19		ENSG00000114923	ENSG00000114923		"""Solute carriers"""	11029	protein-coding gene	gene with protein product	"""Anion exchanger 3, neuronal"""	106195	"""solute carrier family 4, anion exchanger, member 3"""			8001971	Standard	NM_005070		Approved	AE3, SLC2C	uc002vmo.4	P48751	OTTHUMG00000059238	ENST00000358055.3:c.469dupC	2.37:g.220494117_220494117dupC	ENSP00000350756:p.Pro155fs	Somatic	0	47	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	17	10.53	A6H8L2|A8K1Q9|B7ZVX6|B9EGD1|Q6YIQ9	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_HCO3_transpt_C,pfam_Band3_cytoplasmic_dom,superfamily_PTrfase/Anion_transptr,prints_HCO3_transpt_euk,prints_Anion_exchange_3,prints_Anion_exchange,tigrfam_HCO3_transpt_euk	p.H156fs	ENST00000358055.3	37	c.462_463	CCDS2445.1	2																																																																																			-	prints_Anion_exchange_3		0.629	SLC4A3-009	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SLC4A3	protein_coding	OTTHUMT00000316472.1	-	NM_005070			220494111	+1	no_errors	ENST00000273063	ensembl	human	known	74_37	frame_shift_ins	INS	0.015:0.049	C
GLOD4	51031	genome.wustl.edu	37	17	681981	681981	+	Intron	SNP	G	G	T			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr17:681981G>T	ENST00000301328.5	-	3	169				GLOD4_ENST00000536578.1_De_novo_Start_OutOfFrame|GLOD4_ENST00000301329.6_Missense_Mutation_p.L32M			Q9HC38	GLOD4_HUMAN	glyoxalase domain containing 4							extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)				endometrium(1)|large_intestine(1)|prostate(1)	3				UCEC - Uterine corpus endometrioid carcinoma (25;0.022)		TCATGCCGCAGAACCTGGTGT	0.398																																																	0								ENSG00000167699						76.0	71.0	73.0					17																	681981		2203	4300	6503	GLOD4	SO:0001627	intron_variant	0			-	HGNC	AF177342	CCDS32520.1	17p13.3	2008-02-05	2007-03-14	2007-03-14		ENSG00000167699			14111	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 25"""	C17orf25		11642406, 12528892	Standard	NM_016080		Approved	CGI-150, HC71	uc002fru.3	Q9HC38		ENST00000301328.5:c.146-80C>A	17.37:g.681981G>T		Somatic	0	60	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	50	9.09	D3DTG9|D3DTH1|Q96B89|Q9H3J8|Q9HC37|Q9NVN1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.L32M	ENST00000301328.5	37	c.94		17	.	.	.	.	.	.	.	.	.	.	G	13.65	2.301596	0.40694	.	.	ENSG00000167699	ENST00000301329;ENST00000397393	T	0.65732	-0.17	5.14	4.17	0.49024	.	0.649796	0.13933	N	0.352726	T	0.72439	0.3460	M	0.92923	3.36	0.80722	D	1	B	0.29253	0.239	B	0.32393	0.145	T	0.74816	-0.3536	10	0.87932	D	0	-1.1096	12.9956	0.58644	0.0787:0.0:0.9213:0.0	.	32	Q9HC38-2	.	M	32;235	ENSP00000301329:L32M	ENSP00000301329:L32M	L	-	1	2	GLOD4	628731	1.000000	0.71417	1.000000	0.80357	0.719000	0.41307	2.863000	0.48396	1.172000	0.42781	-0.122000	0.15005	CTG	-	NULL		0.398	GLOD4-005	KNOWN	basic	protein_coding	GLOD4	protein_coding	OTTHUMT00000437190.1	G	NM_016080	-		681981	-1	no_errors	ENST00000301329	ensembl	human	known	74_37	missense	SNP	1.000	T
SLCO1B3	28234	genome.wustl.edu	37	12	21028281	21028281	+	Silent	SNP	G	G	A	rs555631927		TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr12:21028281G>A	ENST00000381545.3	+	9	1059	c.840G>A	c.(838-840)ccG>ccA	p.P280P	SLCO1B3_ENST00000553473.1_Silent_p.P280P|SLCO1B3_ENST00000261196.2_Silent_p.P280P|LST3_ENST00000540229.1_Silent_p.P280P|SLCO1B7_ENST00000554957.1_Intron|LST3_ENST00000381541.3_Intron	NM_019844.3	NP_062818.1	Q9NPD5	SO1B3_HUMAN	solute carrier organic anion transporter family, member 1B3	280					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	organic anion transmembrane transporter activity (GO:0008514)	p.P280P(1)		breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(23)|ovary(2)|prostate(2)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(2)	63	Esophageal squamous(101;0.149)				Atorvastatin(DB01076)|Cabazitaxel(DB06772)|Caspofungin(DB00520)|Conjugated Estrogens(DB00286)|Dabrafenib(DB08912)|Digoxin(DB00390)|Docetaxel(DB01248)|Estradiol(DB00783)|Fexofenadine(DB00950)|Fluvastatin(DB01095)|Gadoxetate(DB08884)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Methotrexate(DB00563)|Mycophenolate mofetil(DB00688)|Olmesartan(DB00275)|Ouabain(DB01092)|Paclitaxel(DB01229)|Pioglitazone(DB01132)|Pitavastatin(DB08860)|Pravastatin(DB00175)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Rosuvastatin(DB01098)|Valsartan(DB00177)	TTTTCTTGCCGAAAAATCCAA	0.358													.|||	1	0.000199681	0.0	0.0	5008	,	,		16452	0.0		0.001	False		,,,				2504	0.0																1	Substitution - coding silent(1)	lung(1)						ENSG00000111700						115.0	112.0	113.0					12																	21028281		2203	4300	6503	SLCO1B3	SO:0001819	synonymous_variant	0			-	HGNC		CCDS8684.1	12p12	2013-05-22	2003-11-25	2003-11-26		ENSG00000111700		"""Solute carriers"""	10961	protein-coding gene	gene with protein product		605495	"""solute carrier family 21 (organic anion transporter), member 8"""	SLC21A8			Standard	NM_019844		Approved	OATP8, OATP1B3	uc001rel.4	Q9NPD5	OTTHUMG00000169011	ENST00000381545.3:c.840G>A	12.37:g.21028281G>A		Somatic	0	74	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	51	25.00	E7EMT8|Q5JAR4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_OA_transporter,pfam_MFS,pfam_Kazal_dom,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	p.P280	ENST00000381545.3	37	c.840	CCDS8684.1	12																																																																																			-	pfam_OA_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter		0.358	SLCO1B3-001	KNOWN	upstream_ATG|basic|appris_candidate|CCDS	protein_coding	SLCO1B3	protein_coding	OTTHUMT00000401936.1	G	NM_019844	-		21028281	+1	no_errors	ENST00000553473	ensembl	human	known	74_37	silent	SNP	0.016	A
EPAS1	2034	genome.wustl.edu	37	2	46605046	46605046	+	Silent	SNP	C	C	T	rs142534349		TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr2:46605046C>T	ENST00000263734.3	+	10	1773	c.1263C>T	c.(1261-1263)ttC>ttT	p.F421F		NM_001430.4	NP_001421.2	Q99814	EPAS1_HUMAN	endothelial PAS domain protein 1	421					angiogenesis (GO:0001525)|blood vessel remodeling (GO:0001974)|cell maturation (GO:0048469)|cellular response to hypoxia (GO:0071456)|embryonic placenta development (GO:0001892)|erythrocyte differentiation (GO:0030218)|lung development (GO:0030324)|mitochondrion organization (GO:0007005)|myoblast fate commitment (GO:0048625)|norepinephrine metabolic process (GO:0042415)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of heart rate (GO:0002027)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0043619)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|surfactant homeostasis (GO:0043129)|transcription from RNA polymerase II promoter (GO:0006366)|visual perception (GO:0007601)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|histone acetyltransferase binding (GO:0035035)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(11)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	39		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.18)	LUSC - Lung squamous cell carcinoma(58;0.151)			ATCAGAACTTCGAGGAGTCCT	0.637																																																	0								ENSG00000116016						29.0	28.0	28.0					2																	46605046		2146	4196	6342	EPAS1	SO:0001819	synonymous_variant	0			-	HGNC	U81984	CCDS1825.1	2p21-p16	2013-05-21			ENSG00000116016	ENSG00000116016		"""Basic helix-loop-helix proteins"""	3374	protein-coding gene	gene with protein product	"""HIF-1 alpha-like factor"""	603349				9000051, 9079689, 18378852	Standard	NM_001430		Approved	MOP2, PASD2, HIF2A, HLF, bHLHe73	uc002ruv.3	Q99814	OTTHUMG00000128818	ENST00000263734.3:c.1263C>T	2.37:g.46605046C>T		Somatic	0	66	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	14	36.36	Q86VA2|Q99630	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_PAS_fold_3,pfam_HIF-1_TAD_C,pfam_HIF_alpha_subunit,pfam_PAS_fold,superfamily_PAS,superfamily_bHLH_dom,smart_bHLH_dom,smart_PAS,smart_PAC,prints_Nuc_translocat,pfscan_PAS,pfscan_bHLH_dom,tigrfam_PAS	p.F421	ENST00000263734.3	37	c.1263	CCDS1825.1	2																																																																																			-	NULL		0.637	EPAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPAS1	protein_coding	OTTHUMT00000250752.2	C	NM_001430	-		46605046	+1	no_errors	ENST00000263734	ensembl	human	known	74_37	silent	SNP	0.731	T
DDX18	8886	genome.wustl.edu	37	2	118582579	118582579	+	Nonsense_Mutation	SNP	C	C	T			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr2:118582579C>T	ENST00000263239.2	+	9	1398	c.1270C>T	c.(1270-1272)Cga>Tga	p.R424*		NM_006773.3	NP_006764.3	Q9NVP1	DDX18_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 18	424	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)	membrane (GO:0016020)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(2)|kidney(4)|large_intestine(3)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						TAAGAAGAACCGAAAGAAGAA	0.383																																																	0								ENSG00000088205						119.0	116.0	117.0					2																	118582579		2203	4300	6503	DDX18	SO:0001587	stop_gained	0			-	HGNC	X98743	CCDS2120.1	2q21.2	2008-02-05	2003-06-13		ENSG00000088205	ENSG00000088205		"""DEAD-boxes"""	2741	protein-coding gene	gene with protein product		606355	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 18 (Myc-regulated)"""			8861962	Standard	NM_006773		Approved	MrDb	uc002tlh.1	Q9NVP1	OTTHUMG00000058521	ENST00000263239.2:c.1270C>T	2.37:g.118582579C>T	ENSP00000263239:p.Arg424*	Somatic	0	30	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	23	14.81	Q6GTZ9|Q6IAU4|Q92732|Q9BQB7	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.R424*	ENST00000263239.2	37	c.1270	CCDS2120.1	2	.	.	.	.	.	.	.	.	.	.	C	37	6.174587	0.97348	.	.	ENSG00000088205	ENST00000263239;ENST00000539346;ENST00000415038	.	.	.	5.17	4.28	0.50868	.	0.290919	0.38605	N	0.001635	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05959	T	0.93	.	15.3142	0.74059	0.1412:0.8588:0.0:0.0	.	.	.	.	X	424;163;88	.	ENSP00000263239:R424X	R	+	1	2	DDX18	118299049	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.502000	0.66956	1.303000	0.44873	-0.188000	0.12872	CGA	-	superfamily_P-loop_NTPase,pfscan_Helicase_C		0.383	DDX18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX18	protein_coding	OTTHUMT00000129632.3	C	NM_006773	-		118582579	+1	no_errors	ENST00000263239	ensembl	human	known	74_37	nonsense	SNP	1.000	T
PCDH15	65217	genome.wustl.edu	37	10	55569141	55569141	+	Missense_Mutation	SNP	C	C	A			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr10:55569141C>A	ENST00000395445.1	-	36	5063	c.4669G>T	c.(4669-4671)Gct>Tct	p.A1557S	PCDH15_ENST00000395438.1_3'UTR|PCDH15_ENST00000373965.2_Intron|PCDH15_ENST00000395442.1_Missense_Mutation_p.A422S|PCDH15_ENST00000395446.1_Missense_Mutation_p.A753S|PCDH15_ENST00000395440.1_Missense_Mutation_p.A491S|PCDH15_ENST00000414778.1_Intron|PCDH15_ENST00000409834.1_3'UTR	NM_001142769.1	NP_001136241.1	Q96QU1	PCD15_HUMAN	protocadherin-related 15	0					equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)			NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				CTTTTATCAGCTAATCCTCTA	0.418										HNSCC(58;0.16)																																							0								ENSG00000150275						163.0	146.0	151.0					10																	55569141		1568	3582	5150	PCDH15	SO:0001583	missense	0			-	HGNC	AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000395445.1:c.4669G>T	10.37:g.55569141C>A	ENSP00000378832:p.Ala1557Ser	Somatic	0	45	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.A1557S	ENST00000395445.1	37	c.4669		10	.	.	.	.	.	.	.	.	.	.	C	14.36	2.512741	0.44660	.	.	ENSG00000150275	ENST00000395445;ENST00000395446;ENST00000395442;ENST00000395440	T;T;T;T	0.66815	-0.13;-0.23;0.09;-0.04	5.88	5.88	0.94601	.	.	.	.	.	T	0.54046	0.1834	N	0.14661	0.345	0.80722	D	1	B;B	0.31318	0.319;0.319	B;B	0.31751	0.135;0.135	T	0.56220	-0.8015	9	0.54805	T	0.06	.	18.001	0.89197	0.0:1.0:0.0:0.0	.	1555;1557	C6ZEF5;A2A3E2	.;.	S	1557;753;422;491	ENSP00000378832:A1557S;ENSP00000378833:A753S;ENSP00000378829:A422S;ENSP00000378827:A491S	ENSP00000378827:A491S	A	-	1	0	PCDH15	55239147	0.743000	0.28239	0.639000	0.29394	0.052000	0.14988	2.076000	0.41548	2.778000	0.95560	0.655000	0.94253	GCT	-	NULL		0.418	PCDH15-007	NOVEL	not_organism_supported|basic	protein_coding	PCDH15	protein_coding	OTTHUMT00000291335.1	C	NM_033056	-		55569141	-1	no_errors	ENST00000395445	ensembl	human	novel	74_37	missense	SNP	0.978	A
SLC2A10	81031	genome.wustl.edu	37	20	45354435	45354435	+	Missense_Mutation	SNP	G	G	T			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr20:45354435G>T	ENST00000359271.2	+	2	1010	c.760G>T	c.(760-762)Gcc>Tcc	p.A254S		NM_030777.3	NP_110404.1	O95528	GTR10_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 10	254					glucose transport (GO:0015758)|proton transport (GO:0015992)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sugar:proton symporter activity (GO:0005351)			central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(9)|liver(2)|lung(13)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	34		Myeloproliferative disorder(115;0.0122)				GCTGTGCTATGCCTCCACCAT	0.632																																																	0								ENSG00000197496						120.0	108.0	112.0					20																	45354435		2203	4300	6503	SLC2A10	SO:0001583	missense	0			-	HGNC	AL137188	CCDS13402.1	20q13.12	2013-05-22			ENSG00000197496	ENSG00000197496		"""Solute carriers"""	13444	protein-coding gene	gene with protein product		606145				11247674	Standard	NM_030777		Approved	GLUT10	uc002xsl.3	O95528	OTTHUMG00000032657	ENST00000359271.2:c.760G>T	20.37:g.45354435G>T	ENSP00000352216:p.Ala254Ser	Somatic	0	27	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	8	27.27	A8K4J6|Q3MIX5|Q9H4I6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,prints_Sugar/inositol_transpt	p.A254S	ENST00000359271.2	37	c.760	CCDS13402.1	20	.	.	.	.	.	.	.	.	.	.	G	32	5.176295	0.94846	.	.	ENSG00000197496	ENST00000359271	T	0.73789	-0.78	5.86	5.86	0.93980	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.049209	0.85682	N	0.000000	T	0.81039	0.4740	L	0.33624	1.015	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.76745	-0.2846	10	0.27785	T	0.31	.	20.1865	0.98220	0.0:0.0:1.0:0.0	.	254	O95528	GTR10_HUMAN	S	254	ENSP00000352216:A254S	ENSP00000352216:A254S	A	+	1	0	SLC2A10	44787842	1.000000	0.71417	0.946000	0.38457	0.896000	0.52359	9.729000	0.98795	2.775000	0.95449	0.655000	0.94253	GCC	-	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom		0.632	SLC2A10-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	SLC2A10	protein_coding	OTTHUMT00000079578.2	G		-		45354435	+1	no_errors	ENST00000359271	ensembl	human	known	74_37	missense	SNP	1.000	T
KLHL1	57626	genome.wustl.edu	37	13	70681572	70681572	+	Missense_Mutation	SNP	G	G	T			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr13:70681572G>T	ENST00000377844.4	-	1	1019	c.260C>A	c.(259-261)tCt>tAt	p.S87Y	ATXN8OS_ENST00000414504.2_RNA|KLHL1_ENST00000545028.1_5'UTR|ATXN8OS_ENST00000424524.1_RNA	NM_020866.2	NP_065917.1	Q9NR64	KLHL1_HUMAN	kelch-like family member 1	87	Ser-rich.				actin cytoskeleton organization (GO:0030036)|adult walking behavior (GO:0007628)|cerebellar Purkinje cell layer development (GO:0021680)|dendrite development (GO:0016358)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	actin binding (GO:0003779)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(56)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	84		Breast(118;0.000162)		COAD - Colon adenocarcinoma(199;0.000193)|GBM - Glioblastoma multiforme(99;0.000211)		ATTGAaggaagaggaggaaga	0.587																																																	0								ENSG00000150361						67.0	70.0	69.0					13																	70681572		2203	4300	6503	KLHL1	SO:0001583	missense	0			-	HGNC	AB040923	CCDS9445.1, CCDS73582.1	13q21	2013-01-30	2013-01-30		ENSG00000150361	ENSG00000150361		"""Kelch-like"", ""BTB/POZ domain containing"""	6352	protein-coding gene	gene with protein product	"""Kelch-like protein 1"", ""Mayven-related protein 2"""	605332	"""kelch (Drosophila)-like 1"", ""kelch-like 1 (Drosophila)"""			10888605	Standard	NM_020866		Approved	KIAA1490, MRP2, FLJ30047	uc001vip.3	Q9NR64	OTTHUMG00000017056	ENST00000377844.4:c.260C>A	13.37:g.70681572G>T	ENSP00000367075:p.Ser87Tyr	Somatic	0	68	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	46	19.30	A8K5X0|Q5VZ64|Q9H4X4|Q9NR65|Q9P238	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Kelch_1,pfam_Kelch_2,pfam_BACK,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pfscan_BTB/POZ-like	p.S87Y	ENST00000377844.4	37	c.260	CCDS9445.1	13	.	.	.	.	.	.	.	.	.	.	G	13.41	2.227491	0.39399	.	.	ENSG00000150361	ENST00000377844	T	0.73897	-0.79	5.3	5.3	0.74995	.	2.007420	0.02094	N	0.053415	T	0.69548	0.3123	L	0.36672	1.1	0.80722	D	1	P;P	0.38642	0.641;0.641	B;B	0.31614	0.087;0.133	T	0.58929	-0.7549	10	0.72032	D	0.01	.	13.7654	0.62992	0.0:0.1534:0.8466:0.0	.	87;87	Q8TBJ7;Q9NR64	.;KLHL1_HUMAN	Y	87	ENSP00000367075:S87Y	ENSP00000367075:S87Y	S	-	2	0	KLHL1	69579573	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	3.895000	0.56258	2.477000	0.83638	0.650000	0.86243	TCT	-	NULL		0.587	KLHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL1	protein_coding	OTTHUMT00000045231.3	G	NM_020866	-		70681572	-1	no_errors	ENST00000377844	ensembl	human	known	74_37	missense	SNP	1.000	T
CACNA1F	778	genome.wustl.edu	37	X	49075837	49075837	+	Silent	SNP	G	G	T			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chrX:49075837G>T	ENST00000376265.2	-	21	2710	c.2649C>A	c.(2647-2649)ctC>ctA	p.L883L	CACNA1F_ENST00000480889.1_5'Flank|CACNA1F_ENST00000376251.1_Silent_p.L818L|CACNA1F_ENST00000323022.5_Silent_p.L872L	NM_005183.2	NP_005174.2	O60840	CAC1F_HUMAN	calcium channel, voltage-dependent, L type, alpha 1F subunit	883					axonogenesis (GO:0007409)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|dendrite morphogenesis (GO:0048813)|detection of light stimulus involved in visual perception (GO:0050908)|membrane depolarization during action potential (GO:0086010)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|perikaryon (GO:0043204)|photoreceptor outer segment (GO:0001750)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			autonomic_ganglia(1)|breast(8)|central_nervous_system(3)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(24)|ovary(5)|prostate(3)|skin(4)|urinary_tract(1)	85					Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Nimodipine(DB00393)|Spironolactone(DB00421)|Verapamil(DB00661)	ACACACTGCTGAGGATGATGA	0.597																																																	0								ENSG00000102001						103.0	81.0	88.0					X																	49075837		2203	4300	6503	CACNA1F	SO:0001819	synonymous_variant	0			-	HGNC	AA019975	CCDS35253.1, CCDS59166.1, CCDS59167.1	Xp11.23	2013-01-23	2007-02-16		ENSG00000102001	ENSG00000102001		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1393	protein-coding gene	gene with protein product		300110	"""Aland island eye disease (Forsius-Eriksson ocular albinism, ocular albinism type 2)"""	CSNB2, AIED		9344658, 9662400, 16382099, 12111638, 17525176	Standard	NM_005183		Approved	Cav1.4, JM8, JMC8, CSNBX2, CORDX3, CSNB2A, OA2	uc010nip.3	O60840	OTTHUMG00000022703	ENST00000376265.2:c.2649C>A	X.37:g.49075837G>T		Somatic	0	42	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	35	10.26	A6NI29|F5CIQ9|O43901|O95226|Q9UHB1	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCCAlpha1,prints_VDCC_L_a1su	p.L883	ENST00000376265.2	37	c.2649	CCDS35253.1	X																																																																																			-	NULL		0.597	CACNA1F-007	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNA1F	protein_coding	OTTHUMT00000358157.1	G	NM_005183	-		49075837	-1	no_errors	ENST00000376265	ensembl	human	known	74_37	silent	SNP	1.000	T
DUSP9	1852	genome.wustl.edu	37	X	152915639	152915639	+	Missense_Mutation	SNP	G	G	T			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chrX:152915639G>T	ENST00000342782.3	+	4	1299	c.1034G>T	c.(1033-1035)cGg>cTg	p.R345L	DUSP9_ENST00000370167.4_Missense_Mutation_p.R345L			Q99956	DUS9_HUMAN	dual specificity phosphatase 9	345	Tyrosine-protein phosphatase.				inactivation of MAPK activity (GO:0000188)|JNK cascade (GO:0007254)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(2)|prostate(1)	16	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CGCAGCTTGCGGCTGGAGGAG	0.612																																																	0								ENSG00000130829						135.0	120.0	125.0					X																	152915639		2203	4300	6503	DUSP9	SO:0001583	missense	0			-	HGNC	Y08302	CCDS14724.1	Xq28	2011-06-09			ENSG00000130829	ENSG00000130829		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3076	protein-coding gene	gene with protein product	"""map kinase phosphatase 4"""	300134				9030581, 9286695	Standard	NM_001395		Approved	MKP-4, MKP4	uc004fhx.4	Q99956	OTTHUMG00000024211	ENST00000342782.3:c.1034G>T	X.37:g.152915639G>T	ENSP00000345853:p.Arg345Leu	Somatic	0	38	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	40	11.11	D3DWU5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Dual-sp_phosphatase_cat-dom,pfam_Rhodanese-like_dom,superfamily_Rhodanese-like_dom,smart_Rhodanese-like_dom,smart_Dual-sp_phosphatase_subgr_cat,pirsf_MKP,pfscan_Rhodanese-like_dom,pfscan_Tyr/Dual-sp_Pase,pfscan_Dual-sp_phosphatase_subgr_cat,prints_MKP	p.R345L	ENST00000342782.3	37	c.1034	CCDS14724.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	11.73|11.73	1.726264|1.726264	0.30593|0.30593	.|.	.|.	ENSG00000130829|ENSG00000130829	ENST00000433144|ENST00000370167;ENST00000342782	.|T;T	.|0.58940	.|0.3;0.3	4.53|4.53	0.781|0.781	0.18561|0.18561	.|Dual specificity phosphatase, subgroup, catalytic domain (1);	.|1.080270	.|0.07212	.|N	.|0.859447	T|T	0.44138|0.44138	0.1279|0.1279	L|L	0.31371|0.31371	0.925|0.925	0.39684|0.39684	D|D	0.970946|0.970946	.|B	.|0.06786	.|0.001	.|B	.|0.08055	.|0.003	T|T	0.17319|0.17319	-1.0373|-1.0373	5|10	.|0.28530	.|T	.|0.3	.|.	9.0401|9.0401	0.36311|0.36311	0.3625:0.0:0.6375:0.0|0.3625:0.0:0.6375:0.0	.|.	.|345	.|Q99956	.|DUS9_HUMAN	C|L	316|345	.|ENSP00000359186:R345L;ENSP00000345853:R345L	.|ENSP00000345853:R345L	G|R	+|+	1|2	0|0	DUSP9|DUSP9	152568833|152568833	1.000000|1.000000	0.71417|0.71417	0.075000|0.075000	0.20258|0.20258	0.389000|0.389000	0.30415|0.30415	4.836000|4.836000	0.62789|0.62789	0.137000|0.137000	0.18759|0.18759	0.529000|0.529000	0.55759|0.55759	GGC|CGG	-	pirsf_MKP,pfscan_Dual-sp_phosphatase_subgr_cat		0.612	DUSP9-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	DUSP9	protein_coding	OTTHUMT00000061022.3	G	NM_001395	-		152915639	+1	no_errors	ENST00000342782	ensembl	human	known	74_37	missense	SNP	0.993	T
KCNK13	56659	genome.wustl.edu	37	14	90650876	90650876	+	Missense_Mutation	SNP	G	G	T			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr14:90650876G>T	ENST00000282146.4	+	2	1197	c.756G>T	c.(754-756)gaG>gaT	p.E252D		NM_022054.2	NP_071337.2	Q9HB14	KCNKD_HUMAN	potassium channel, subfamily K, member 13	252					synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(12)|prostate(1)|skin(4)	25		all_cancers(154;0.186)				CCCACTATGAGAGCCAAGGCC	0.493																																																	0								ENSG00000152315						118.0	105.0	109.0					14																	90650876		2203	4300	6503	KCNK13	SO:0001583	missense	0			-	HGNC	AF287303	CCDS9889.1	14q32.11	2012-03-07				ENSG00000152315		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6275	protein-coding gene	gene with protein product		607367				11060316, 16382106	Standard	NM_022054		Approved	K2p13.1, THIK-1, THIK1	uc001xye.1	Q9HB14		ENST00000282146.4:c.756G>T	14.37:g.90650876G>T	ENSP00000282146:p.Glu252Asp	Somatic	0	39	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	39	9.30	B5TJL8|Q96E79	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_2pore_dom_K_chnl_dom,prints_2pore_dom_K_chnl_THIK,prints_2pore_dom_K_chnl,prints_2pore_dom_K_chnl_TASK	p.E252D	ENST00000282146.4	37	c.756	CCDS9889.1	14	.	.	.	.	.	.	.	.	.	.	G	3.632	-0.075325	0.07184	.	.	ENSG00000152315	ENST00000282146	T	0.41400	1.0	5.42	-10.8	0.00216	Ion transport 2 (1);	0.955768	0.08571	N	0.926120	T	0.23289	0.0563	L	0.39020	1.185	0.26135	N	0.980355	B	0.02656	0.0	B	0.10450	0.005	T	0.09729	-1.0661	10	0.17832	T	0.49	.	8.8549	0.35223	0.0519:0.5188:0.2338:0.1956	.	252	Q9HB14	KCNKD_HUMAN	D	252	ENSP00000282146:E252D	ENSP00000282146:E252D	E	+	3	2	KCNK13	89720629	0.000000	0.05858	0.000000	0.03702	0.130000	0.20726	-3.167000	0.00575	-2.275000	0.00679	-0.175000	0.13238	GAG	-	pfam_2pore_dom_K_chnl_dom		0.493	KCNK13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNK13	protein_coding	OTTHUMT00000411251.1	G	NM_022054	-		90650876	+1	no_errors	ENST00000282146	ensembl	human	known	74_37	missense	SNP	0.035	T
HMCN2	256158	genome.wustl.edu	37	9	133294525	133294525	+	3'UTR	SNP	G	G	A			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr9:133294525G>A	ENST00000487727.2	+	0	4358				HMCN2_ENST00000428715.1_Intron			Q8NDA2	HMCN2_HUMAN	hemicentin 2						response to stimulus (GO:0050896)	proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)										CCCCTGCCTTGCCAGCTCCCC	0.552																																																	0								ENSG00000148357																																			HMCN2	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AK074396		9q34.11	2013-01-29			ENSG00000148357	ENSG00000148357		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	21293	protein-coding gene	gene with protein product							Standard	XM_006710218		Approved	DKFZp434P0216, FLJ23816		Q8NDA2	OTTHUMG00000140096	ENST00000487727.2:c.*4355G>A	9.37:g.133294525G>A		Somatic	0	55	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.16	Q8N225|Q8TCI8	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000487727.2	37	NULL		9																																																																																			-	-		0.552	HMCN2-006	KNOWN	mRNA_start_NF|basic	processed_transcript	HMCN2	protein_coding	OTTHUMT00000054659.3	G	XM_175125	-		133294525	+1	no_errors	ENST00000487727	ensembl	human	known	74_37	rna	SNP	0.000	A
DACH2	117154	genome.wustl.edu	37	X	85404005	85404005	+	Missense_Mutation	SNP	G	G	T			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chrX:85404005G>T	ENST00000373125.4	+	1	381	c.381G>T	c.(379-381)caG>caT	p.Q127H	DACH2_ENST00000373131.1_Missense_Mutation_p.Q127H	NM_053281.3	NP_444511.1	Q96NX9	DACH2_HUMAN	dachshund family transcription factor 2	127	DACHbox-N.				development of primary female sexual characteristics (GO:0046545)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(14)|lung(28)|ovary(5)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)	71						CTGTTGAGCAGGTCCGGATCC	0.542																																																	0								ENSG00000126733						73.0	69.0	70.0					X																	85404005		2202	4300	6502	DACH2	SO:0001583	missense	0			-	HGNC	AF428101	CCDS14455.1, CCDS48140.1, CCDS55457.1	Xq21.3	2014-02-03	2014-02-03		ENSG00000126733	ENSG00000126733			16814	protein-coding gene	gene with protein product		300608	"""dachshund homolog 2 (Drosophila)"""				Standard	NM_053281		Approved		uc004eew.2	Q96NX9	OTTHUMG00000021944	ENST00000373125.4:c.381G>T	X.37:g.85404005G>T	ENSP00000362217:p.Gln127His	Somatic	0	67	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	30	38.78	B1AJV3|B4DQG3|Q8NAY3|Q8ND17|Q96N55	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Transform_Ski,superfamily_DNA-bd_dom_put	p.Q127H	ENST00000373125.4	37	c.381	CCDS14455.1	X	.	.	.	.	.	.	.	.	.	.	G	16.75	3.208734	0.58343	.	.	ENSG00000126733	ENST00000344497;ENST00000373131;ENST00000373125	D;D	0.89746	-2.56;-2.56	4.5	3.41	0.39046	DNA binding domain, putative (1);Transforming protein Ski (2);	0.000000	0.48286	D	0.000194	D	0.93446	0.7909	M	0.81802	2.56	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.92697	0.6171	10	0.87932	D	0	.	9.6764	0.40043	0.1291:0.0:0.8709:0.0	.	127;127	Q96NX9-2;Q96NX9	.;DACH2_HUMAN	H	127	ENSP00000362223:Q127H;ENSP00000362217:Q127H	ENSP00000345134:Q127H	Q	+	3	2	DACH2	85290661	1.000000	0.71417	1.000000	0.80357	0.868000	0.49771	6.949000	0.75971	0.659000	0.30945	0.544000	0.68410	CAG	-	pfam_Transform_Ski,superfamily_DNA-bd_dom_put		0.542	DACH2-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DACH2	protein_coding	OTTHUMT00000359266.1	G	NM_053281	-		85404005	+1	no_errors	ENST00000373125	ensembl	human	known	74_37	missense	SNP	1.000	T
FCHSD1	89848	genome.wustl.edu	37	5	141030652	141030652	+	Missense_Mutation	SNP	G	G	T			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr5:141030652G>T	ENST00000435817.2	-	2	104	c.54C>A	c.(52-54)ttC>ttA	p.F18L	FCHSD1_ENST00000519800.1_Missense_Mutation_p.F18L|FCHSD1_ENST00000522126.1_5'UTR|ARAP3_ENST00000512390.1_5'Flank|FCHSD1_ENST00000522783.1_Missense_Mutation_p.F18L	NM_033449.2	NP_258260.1	Q86WN1	FCSD1_HUMAN	FCH and double SH3 domains 1	18	FCH. {ECO:0000255|PROSITE- ProRule:PRU00083}.								FCHSD1/BRAF(2)	central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(8)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	24			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCTGTTCCAGGAAGCGAAGCT	0.597																																																	0								ENSG00000197948						25.0	27.0	26.0					5																	141030652		1996	4168	6164	FCHSD1	SO:0001583	missense	0			-	HGNC	AK027281	CCDS47295.1	5q31.3	2008-02-05			ENSG00000197948	ENSG00000197948			25463	protein-coding gene	gene with protein product						11214971, 15067381	Standard	NM_033449		Approved	FLJ00007	uc003llk.3	Q86WN1	OTTHUMG00000163762	ENST00000435817.2:c.54C>A	5.37:g.141030652G>T	ENSP00000399259:p.Phe18Leu	Somatic	0	89	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	Q6UX75|Q86Y77|Q9NXX8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SH3_domain,pfam_SH3_2,pfam_FCH_dom,superfamily_SH3_domain,smart_FCH_dom,smart_SH3_domain,pfscan_FCH_dom,pfscan_SH3_domain	p.F18L	ENST00000435817.2	37	c.54	CCDS47295.1	5	.	.	.	.	.	.	.	.	.	.	G	13.43	2.233506	0.39498	.	.	ENSG00000197948	ENST00000435817;ENST00000522783;ENST00000519800	T;T;T	0.33216	2.26;2.05;1.42	4.34	2.49	0.30216	Fps/Fes/Fer/CIP4 homology (1);	0.000000	0.64402	D	0.000001	T	0.19406	0.0466	L	0.44542	1.39	0.32540	N	0.533787	B	0.24576	0.106	B	0.32533	0.147	T	0.30387	-0.9980	10	0.02654	T	1	-13.688	3.2704	0.06879	0.3087:0.0:0.5078:0.1836	.	18	Q86WN1	FCSD1_HUMAN	L	18	ENSP00000399259:F18L;ENSP00000428677:F18L;ENSP00000428776:F18L	ENSP00000399259:F18L	F	-	3	2	FCHSD1	141010836	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	0.732000	0.26072	0.422000	0.26005	0.561000	0.74099	TTC	-	smart_FCH_dom,pfscan_FCH_dom		0.597	FCHSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCHSD1	protein_coding	OTTHUMT00000375282.2	G	NM_033449	-		141030652	-1	no_errors	ENST00000435817	ensembl	human	known	74_37	missense	SNP	1.000	T
CACNA1H	8912	genome.wustl.edu	37	16	1250294	1250294	+	Missense_Mutation	SNP	C	C	T			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr16:1250294C>T	ENST00000348261.5	+	7	1090	c.842C>T	c.(841-843)aCg>aTg	p.T281M	CACNA1H_ENST00000358590.4_Missense_Mutation_p.T281M|CACNA1H_ENST00000565831.1_Missense_Mutation_p.T281M	NM_021098.2	NP_066921.2	O95180	CAC1H_HUMAN	calcium channel, voltage-dependent, T type, alpha 1H subunit	281					aldosterone biosynthetic process (GO:0032342)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|myoblast fusion (GO:0007520)|positive regulation of acrosome reaction (GO:2000344)|regulation of heart contraction (GO:0008016)|regulation of membrane potential (GO:0042391)|transport (GO:0006810)	caveola (GO:0005901)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|metal ion binding (GO:0046872)|scaffold protein binding (GO:0097110)			breast(4)|endometrium(5)|kidney(2)|lung(23)	34		Hepatocellular(780;0.00369)			Amiodarone(DB01118)|Bepridil(DB01244)|Cinnarizine(DB00568)|Felodipine(DB01023)|Flunarizine(DB04841)|Isradipine(DB00270)|Nifedipine(DB01115)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Zonisamide(DB00909)	TACTACCAGACGGAGGAGGGC	0.642																																																	0								ENSG00000196557						30.0	30.0	30.0					16																	1250294		2088	4201	6289	CACNA1H	SO:0001583	missense	0			-	HGNC	AL031703	CCDS45375.1, CCDS45376.1	16p13.3	2012-03-07	2007-02-16					"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1395	protein-coding gene	gene with protein product		607904				9670923, 16382099	Standard	NM_021098		Approved	Cav3.2	uc002cks.3	O95180		ENST00000348261.5:c.842C>T	16.37:g.1250294C>T	ENSP00000334198:p.Thr281Met	Somatic	0	122	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	65	26.14	B5ME00|F8WFD1|O95802|Q8WWI6|Q96QI6|Q96RZ9|Q9NYY4|Q9NYY5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_PKD1_2_channel,prints_VDCC_T_a1su,prints_PKD_2	p.T281M	ENST00000348261.5	37	c.842	CCDS45375.1	16	.	.	.	.	.	.	.	.	.	.	C	17.31	3.356868	0.61293	.	.	ENSG00000196557	ENST00000348261;ENST00000358590	D;D	0.96913	-4.17;-4.11	4.4	4.4	0.53042	Ion transport (1);	1.387780	0.04533	N	0.386779	D	0.97489	0.9178	M	0.85462	2.755	0.09310	N	1	D;P	0.56287	0.975;0.956	P;P	0.51895	0.653;0.683	D	0.89417	0.3707	10	0.62326	D	0.03	.	9.8648	0.41136	0.0:0.906:0.0:0.094	.	281;281	O95180-2;O95180	.;CAC1H_HUMAN	M	281	ENSP00000334198:T281M;ENSP00000351401:T281M	ENSP00000334198:T281M	T	+	2	0	CACNA1H	1190295	0.015000	0.18098	1.000000	0.80357	0.998000	0.95712	2.693000	0.47027	2.275000	0.75901	0.586000	0.80456	ACG	-	pfam_Ion_trans_dom		0.642	CACNA1H-001	KNOWN	basic|CCDS	protein_coding	CACNA1H	protein_coding	OTTHUMT00000421601.1	C	NM_001005407	-		1250294	+1	no_errors	ENST00000348261	ensembl	human	known	74_37	missense	SNP	0.341	T
ATG5	9474	genome.wustl.edu	37	6	106696116	106696116	+	Missense_Mutation	SNP	C	C	A			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr6:106696116C>A	ENST00000369076.3	-	6	805	c.482G>T	c.(481-483)aGa>aTa	p.R161I	ATG5_ENST00000343245.3_Missense_Mutation_p.R161I|ATG5_ENST00000360666.4_Missense_Mutation_p.D38Y|ATG5_ENST00000369070.1_Missense_Mutation_p.R83I	NM_004849.2	NP_004840.1	Q9H1Y0	ATG5_HUMAN	autophagy related 5	161					apoptotic process (GO:0006915)|autophagic vacuole assembly (GO:0000045)|autophagy (GO:0006914)|blood vessel remodeling (GO:0001974)|heart contraction (GO:0060047)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of type I interferon production (GO:0032480)|negative stranded viral RNA replication (GO:0039689)|otolith development (GO:0048840)|post-translational protein modification (GO:0043687)|regulation of cilium assembly (GO:1902017)|regulation of cytokine secretion involved in immune response (GO:0002739)|response to drug (GO:0042493)|response to fungus (GO:0009620)|vasodilation (GO:0042311)|ventricular cardiac muscle cell development (GO:0055015)	autophagic vacuole (GO:0005776)|axoneme (GO:0005930)|cytoplasm (GO:0005737)|membrane (GO:0016020)|pre-autophagosomal structure membrane (GO:0034045)				endometrium(1)|large_intestine(5)|lung(1)|prostate(1)	8	Breast(9;0.0296)	all_cancers(87;0.000301)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.0612)|Lung NSC(302;0.216)	BRCA - Breast invasive adenocarcinoma(8;0.00802)	OV - Ovarian serous cystadenocarcinoma(136;0.128)|Epithelial(106;0.159)|all cancers(137;0.18)		CTGGTCAAATCTGTCTGTAAT	0.313																																																	0								ENSG00000057663						58.0	60.0	59.0					6																	106696116		2203	4300	6503	ATG5	SO:0001583	missense	0			-	HGNC	Y11588	CCDS5055.1, CCDS69159.1, CCDS75498.1	6q21	2014-02-12	2012-06-06	2005-09-11	ENSG00000057663	ENSG00000057663			589	protein-coding gene	gene with protein product		604261	"""APG5 (autophagy 5, S. cerevisiae)-like"", ""APG5 autophagy 5-like (S. cerevisiae)"", ""ATG5 autophagy related 5 homolog (S. cerevisiae)"""	APG5L		9563500, 11349150, 15778222	Standard	NM_001286111		Approved	ASP, APG5, hAPG5	uc003prf.3	Q9H1Y0	OTTHUMG00000016193	ENST00000369076.3:c.482G>T	6.37:g.106696116C>A	ENSP00000358072:p.Arg161Ile	Somatic	0	93	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	71	110	39.23	O60875|Q5JVR2|Q68DI4|Q9H2B8|Q9HCZ7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Atg5	p.R161I	ENST00000369076.3	37	c.482	CCDS5055.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.75|16.75	3.208271|3.208271	0.58343|0.58343	.|.	.|.	ENSG00000057663|ENSG00000057663	ENST00000360666|ENST00000369076;ENST00000343245;ENST00000369070	.|.	.|.	.|.	5.88|5.88	3.87|3.87	0.44632|0.44632	.|.	.|0.042198	.|0.85682	.|D	.|0.000000	T|T	0.18718|0.18718	0.0449|0.0449	L|L	0.43152|0.43152	1.355|1.355	0.30630|0.30630	N|N	0.757555|0.757555	P|B;B	0.42649|0.15719	0.786|0.014;0.006	B|B;B	0.44044|0.16722	0.439|0.016;0.015	T|T	0.09640|0.09640	-1.0665|-1.0665	8|9	0.87932|0.56958	D|D	0|0.05	-4.8443|-4.8443	4.4552|4.4552	0.11640|0.11640	0.0:0.5706:0.0:0.4294|0.0:0.5706:0.0:0.4294	.|.	38|83;161	Q7Z3H3|Q9H1Y0-2;Q9H1Y0	.|.;ATG5_HUMAN	Y|I	38|161;161;83	.|.	ENSP00000353884:D38Y|ENSP00000343313:R161I	D|R	-|-	1|2	0|0	ATG5|ATG5	106802809|106802809	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.980000|0.980000	0.70556|0.70556	5.399000|5.399000	0.66314|0.66314	1.485000|1.485000	0.48380|0.48380	0.591000|0.591000	0.81541|0.81541	GAT|AGA	-	pfam_Atg5		0.313	ATG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATG5	protein_coding	OTTHUMT00000043476.1	C	NM_004849	-		106696116	-1	no_errors	ENST00000343245	ensembl	human	known	74_37	missense	SNP	1.000	A
ADARB2	105	genome.wustl.edu	37	10	1313200	1313200	+	Missense_Mutation	SNP	G	G	A			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr10:1313200G>A	ENST00000381312.1	-	4	1467	c.1142C>T	c.(1141-1143)aCg>aTg	p.T381M		NM_018702.3	NP_061172.1	Q9NS39	RED2_HUMAN	adenosine deaminase, RNA-specific, B2 (non-functional)	381					mRNA processing (GO:0006397)	nucleus (GO:0005634)	adenosine deaminase activity (GO:0004000)|double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|single-stranded RNA binding (GO:0003727)			breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(17)|prostate(2)|skin(1)|urinary_tract(1)	41		all_epithelial(10;0.059)|Colorectal(49;0.0815)		all cancers(11;0.0224)|GBM - Glioblastoma multiforme(2;0.0414)|Epithelial(11;0.165)		GTGCATGGGCGTGAGGTCCGT	0.552																																																	0								ENSG00000185736						102.0	80.0	87.0					10																	1313200		2203	4300	6503	ADARB2	SO:0001583	missense	0			-	HGNC	AF034837	CCDS7058.1	10p15.3	2013-05-20	2013-05-20		ENSG00000185736	ENSG00000185736	3.5.-.-		227	protein-coding gene	gene with protein product	"""RED2 homolog (rat)"""	602065	"""adenosine deaminase, RNA-specific, B2 (RED2 homolog rat)"", ""adenosine deaminase, RNA-specific, B2"""			9272162, 10836796	Standard	NM_018702		Approved	RED2, hRED2, ADAR3	uc009xhq.3	Q9NS39	OTTHUMG00000017543	ENST00000381312.1:c.1142C>T	10.37:g.1313200G>A	ENSP00000370713:p.Thr381Met	Somatic	0	45	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	16	56.76	B2RPJ5|Q5VUT6|Q5VW42	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_A_deamin,pfam_dsRNA-bd_dom,smart_dsRNA-bd_dom,smart_A_deamin,pfscan_dsRNA-bd_dom,pfscan_A_deamin	p.T381M	ENST00000381312.1	37	c.1142	CCDS7058.1	10	.	.	.	.	.	.	.	.	.	.	G	11.53	1.667346	0.29604	.	.	ENSG00000185736	ENST00000381312	T	0.24350	1.86	5.42	4.52	0.55395	Adenosine deaminase/editase (1);	0.487597	0.23724	N	0.045194	T	0.42426	0.1202	M	0.66939	2.045	0.26398	N	0.976477	D	0.60160	0.987	P	0.55260	0.772	T	0.37009	-0.9724	10	0.66056	D	0.02	-8.9961	14.4261	0.67218	0.0711:0.0:0.9289:0.0	.	381	Q9NS39	RED2_HUMAN	M	381	ENSP00000370713:T381M	ENSP00000370713:T381M	T	-	2	0	ADARB2	1303200	0.979000	0.34478	0.040000	0.18447	0.008000	0.06430	2.505000	0.45424	1.300000	0.44818	-0.333000	0.08304	ACG	-	smart_A_deamin		0.552	ADARB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADARB2	protein_coding	OTTHUMT00000046426.1	G	NM_018702	-		1313200	-1	no_errors	ENST00000381312	ensembl	human	known	74_37	missense	SNP	0.034	A
F2RL2	2151	genome.wustl.edu	37	5	75914149	75914149	+	Missense_Mutation	SNP	G	G	T	rs373076521		TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr5:75914149G>T	ENST00000296641.4	-	2	586	c.383C>A	c.(382-384)aCc>aAc	p.T128N	IQGAP2_ENST00000274364.6_Intron|F2RL2_ENST00000504899.1_Missense_Mutation_p.T106N|IQGAP2_ENST00000502745.1_Intron|IQGAP2_ENST00000396234.3_Intron|IQGAP2_ENST00000379730.3_Intron	NM_004101.3	NP_004092.1	O00254	PAR3_HUMAN	coagulation factor II (thrombin) receptor-like 2	128					blood coagulation (GO:0007596)|metabolic process (GO:0008152)|platelet activation (GO:0030168)|response to wounding (GO:0009611)	apical plasma membrane (GO:0016324)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phosphatidylinositol phospholipase C activity (GO:0004435)|thrombin receptor activity (GO:0015057)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)|skin(3)	32		all_lung(232;0.000462)|Lung NSC(167;0.00124)|Prostate(461;0.00955)|Ovarian(174;0.0129)		all cancers(79;4.43e-43)		GAATACAGTGGTACAGATGGA	0.443																																																	0								ENSG00000164220						83.0	84.0	84.0					5																	75914149		2203	4300	6503	F2RL2	SO:0001583	missense	0			-	HGNC	U92971	CCDS4031.1, CCDS58959.1	5q13	2012-08-08			ENSG00000164220	ENSG00000164220		"""GPCR / Class A : Protease activated receptors"""	3539	protein-coding gene	gene with protein product	"""proteinase-activated receptor-3"""	601919				9087410, 9722561	Standard	NM_004101		Approved	PAR3	uc003kem.4	O00254	OTTHUMG00000102119	ENST00000296641.4:c.383C>A	5.37:g.75914149G>T	ENSP00000296641:p.Thr128Asn	Somatic	0	48	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	35	10.26	B2R754|B4DQ13|Q52M68|Q7Z3W3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Prot_act_rcpt_3,prints_GPCR_Rhodpsn,prints_Protea_act_rcpt	p.T128N	ENST00000296641.4	37	c.383	CCDS4031.1	5	.	.	.	.	.	.	.	.	.	.	G	7.323	0.617412	0.14129	.	.	ENSG00000164220	ENST00000296641;ENST00000504899	T;T	0.41065	1.01;1.01	5.15	0.136	0.14780	GPCR, rhodopsin-like superfamily (1);	0.372482	0.29459	N	0.012094	T	0.35248	0.0925	L	0.46614	1.455	0.09310	N	1	P	0.40302	0.712	B	0.41440	0.357	T	0.20940	-1.0260	10	0.41790	T	0.15	-2.3704	10.4863	0.44724	0.434:0.0:0.566:0.0	.	128	O00254	PAR3_HUMAN	N	128;106	ENSP00000296641:T128N;ENSP00000426703:T106N	ENSP00000296641:T128N	T	-	2	0	F2RL2	75949905	0.618000	0.27051	0.000000	0.03702	0.116000	0.19942	1.719000	0.38011	-0.209000	0.10156	-0.259000	0.10710	ACC	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Prot_act_rcpt_3,prints_GPCR_Rhodpsn		0.443	F2RL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	F2RL2	protein_coding	OTTHUMT00000219958.3	G		-		75914149	-1	no_errors	ENST00000296641	ensembl	human	known	74_37	missense	SNP	0.000	T
LAMA3	3909	genome.wustl.edu	37	18	21407358	21407358	+	Missense_Mutation	SNP	G	G	T			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr18:21407358G>T	ENST00000313654.9	+	23	2991	c.2750G>T	c.(2749-2751)gGg>gTg	p.G917V	LAMA3_ENST00000399516.3_Missense_Mutation_p.G917V	NM_198129.1	NP_937762.1	Q16787	LAMA3_HUMAN	laminin, alpha 3	917	Domain IV 1 (domain IV B).				cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)			NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(24)|lung(54)|ovary(8)|prostate(6)|skin(7)|urinary_tract(4)	128	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)					CTGCTTGATGGGGAGCCAAGA	0.542																																																	0								ENSG00000053747						103.0	106.0	105.0					18																	21407358		2016	4175	6191	LAMA3	SO:0001583	missense	0			-	HGNC	L34155	CCDS11880.1, CCDS42419.1, CCDS45838.1, CCDS59307.1	18q11.2	2013-03-01	2002-08-29		ENSG00000053747	ENSG00000053747		"""Laminins"""	6483	protein-coding gene	gene with protein product		600805	"""laminin, alpha 3 (nicein (150kD), kalinin (165kD), BM600 (150kD), epilegrin)"""	LAMNA		8077230	Standard	NM_000227		Approved	nicein-150kDa, kalinin-165kDa, BM600-150kDa, epiligrin	uc002kuq.3	Q16787	OTTHUMG00000131874	ENST00000313654.9:c.2750G>T	18.37:g.21407358G>T	ENSP00000324532:p.Gly917Val	Somatic	0	21	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	17	15.00	B0YJ33|Q13679|Q13680|Q6VU67|Q6VU68|Q6VU69|Q76E14|Q96TG0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_EGF_laminin,pfam_Laminin_G,pfam_Laminin_I,pfam_Laminin_N,pfam_Laminin_II,pfam_Laminin_B_type_IV,superfamily_ConA-like_lec_gl_sf,superfamily_Growth_fac_rcpt_N_dom,superfamily_Galactose-bd-like,superfamily_STAT_TF_coiled-coil,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N	p.G917V	ENST00000313654.9	37	c.2750	CCDS42419.1	18	.	.	.	.	.	.	.	.	.	.	G	8.955	0.969080	0.18659	.	.	ENSG00000053747	ENST00000313654;ENST00000399516;ENST00000416669	T;T	0.19105	2.18;2.17	5.65	4.78	0.61160	.	.	.	.	.	T	0.24353	0.0590	M	0.73962	2.25	0.58432	D	0.999999	P;P	0.52316	0.836;0.952	B;B	0.40636	0.23;0.335	T	0.07046	-1.0793	9	0.72032	D	0.01	.	8.6421	0.33983	0.078:0.0:0.7722:0.1498	.	917;917	Q6VU67;Q16787	.;LAMA3_HUMAN	V	917;917;915	ENSP00000324532:G917V;ENSP00000382432:G917V	ENSP00000324532:G917V	G	+	2	0	LAMA3	19661356	1.000000	0.71417	0.114000	0.21550	0.071000	0.16799	3.500000	0.53318	1.376000	0.46267	0.655000	0.94253	GGG	-	NULL		0.542	LAMA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA3	protein_coding	OTTHUMT00000254824.3	G	NM_000227, NM_198129	-		21407358	+1	no_errors	ENST00000313654	ensembl	human	known	74_37	missense	SNP	0.015	T
AP3D1	8943	genome.wustl.edu	37	19	2129394	2129394	+	Silent	SNP	G	G	A	rs199695826		TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr19:2129394G>A	ENST00000345016.5	-	7	886	c.655C>T	c.(655-657)Ctg>Ttg	p.L219L	AP3D1_ENST00000356926.4_Intron|AP3D1_ENST00000350812.6_Intron|AP3D1_ENST00000355272.6_Silent_p.L219L|AP3D1_ENST00000590683.1_5'UTR	NM_003938.6	NP_003929.4	O14617	AP3D1_HUMAN	adaptor-related protein complex 3, delta 1 subunit	219					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|antigen processing and presentation, exogenous lipid antigen via MHC class Ib (GO:0048007)|endosome to melanosome transport (GO:0035646)|eye pigment biosynthetic process (GO:0006726)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|positive regulation of NK T cell differentiation (GO:0051138)|protein localization to membrane (GO:0072657)|protein localization to organelle (GO:0033365)|regulation of sequestering of zinc ion (GO:0061088)|synaptic vesicle membrane organization (GO:0048499)	endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|membrane coat (GO:0030117)|terminal bouton (GO:0043195)	protein transporter activity (GO:0008565)|transporter activity (GO:0005215)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(23)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCCAGGGACAGGTAGTTCTTA	0.562													G|||	1	0.000199681	0.0008	0.0	5008	,	,		16927	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000065000	G	,	4,3952		0,4,1974	137.0	141.0	140.0		,655	3.5	1.0	19		140	14,8306		0,14,4146	no	intron,coding-synonymous	AP3D1	NM_001077523.1,NM_003938.5	,	0,18,6120	AA,AG,GG		0.1683,0.1011,0.1466	,	,219/1154	2129394	18,12258	1978	4160	6138	AP3D1	SO:0001819	synonymous_variant	0			-	HGNC	U91930	CCDS42459.1, CCDS58638.1	19p13.3	2014-09-04			ENSG00000065000	ENSG00000065000			568	protein-coding gene	gene with protein product		607246				9151686, 9303295	Standard	NM_003938		Approved	ADTD	uc002lva.4	O14617	OTTHUMG00000180354	ENST00000345016.5:c.655C>T	19.37:g.2129394G>A		Somatic	0	78	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	22	46.34	O00202|O75262|Q59HF5|Q96G11|Q9H3C6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_BLV_receptor,pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,pirsf_AP3_complex_dsu	p.L219	ENST00000345016.5	37	c.655	CCDS42459.1	19																																																																																			-	pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,pirsf_AP3_complex_dsu		0.562	AP3D1-002	KNOWN	basic|CCDS	protein_coding	AP3D1	protein_coding	OTTHUMT00000450912.1	G		rs199695826		2129394	-1	no_errors	ENST00000355272	ensembl	human	known	74_37	silent	SNP	1.000	A
PRKCG	5582	genome.wustl.edu	37	19	54395787	54395787	+	Silent	SNP	G	G	A	rs116236420	byFrequency	TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr19:54395787G>A	ENST00000263431.3	+	7	993	c.711G>A	c.(709-711)gaG>gaA	p.E237E	PRKCG_ENST00000536044.1_Silent_p.E237E|PRKCG_ENST00000540413.1_Silent_p.E237E|PRKCG_ENST00000542049.1_Silent_p.E124E	NM_002739.3	NP_002730.1	P05129	KPCG_HUMAN	protein kinase C, gamma	237	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cell death (GO:0008219)|chemosensory behavior (GO:0007635)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of protein ubiquitination (GO:0031397)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphorylation (GO:0016310)|platelet activation (GO:0030168)|positive regulation of mismatch repair (GO:0032425)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|response to morphine (GO:0043278)|response to pain (GO:0048265)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|dendrite (GO:0030425)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|synaptic membrane (GO:0097060)	ATP binding (GO:0005524)|calcium-dependent protein kinase C activity (GO:0004698)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(4)|ovary(2)|pancreas(2)|skin(1)	10	all_cancers(19;0.0462)|all_epithelial(19;0.0258)|all_lung(19;0.185)|Ovarian(34;0.19)|Lung NSC(19;0.218)			GBM - Glioblastoma multiforme(134;0.0521)	Tamoxifen(DB00675)	GGGATGTGGAGCGCCGGCTCA	0.667																																																	0								ENSG00000126583						46.0	34.0	38.0					19																	54395787		2203	4300	6503	PRKCG	SO:0001819	synonymous_variant	0			-	HGNC	M13977	CCDS12867.1	19q13.4	2014-09-17			ENSG00000126583	ENSG00000126583	2.7.11.1		9402	protein-coding gene	gene with protein product	"""PKC-gamma"""	176980		PKCG, SCA14		8432525, 3755548	Standard	NM_002739		Approved	PKCC, MGC57564	uc002qcq.1	P05129	OTTHUMG00000064846	ENST00000263431.3:c.711G>A	19.37:g.54395787G>A		Somatic	0	204	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	35	79	30.70	B7Z8Q0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_C2_dom,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_C2_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_C2_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pirsf_Protein_kinase_C_a/b/g,prints_DAG/PE-bd,prints_C2_dom,pfscan_C2_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_dom	p.E237	ENST00000263431.3	37	c.711	CCDS12867.1	19																																																																																			-	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pirsf_Protein_kinase_C_a/b/g,pfscan_C2_dom		0.667	PRKCG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKCG	protein_coding	OTTHUMT00000139233.3	G	NM_002739	-		54395787	+1	no_errors	ENST00000540413	ensembl	human	known	74_37	silent	SNP	1.000	A
TRIM34	53840	genome.wustl.edu	37	11	5655947	5655947	+	Silent	SNP	G	G	A			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr11:5655947G>A	ENST00000514226.1	+	4	943	c.606G>A	c.(604-606)ctG>ctA	p.L202L	TRIM34_ENST00000429814.2_Silent_p.L202L|TRIM6-TRIM34_ENST00000354852.5_Silent_p.L556L|HBG2_ENST00000380259.2_Intron|TRIM6-TRIM34_ENST00000457787.2_Silent_p.L202L	NM_001003827.1	NP_001003827.1	Q9BYJ4	TRI34_HUMAN	tripartite motif containing 34	202					positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein trimerization (GO:0070206)	cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)			NS(1)|kidney(1)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	17		Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)		Epithelial(150;5.72e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AGAGAGAGCTGCAAAGATTGG	0.438																																																	0								ENSG00000258588						80.0	74.0	76.0					11																	5655947		2201	4297	6498	TRIM6-TRIM34	SO:0001819	synonymous_variant	0			-	HGNC	AB039902	CCDS31391.1	11p15	2013-01-09	2011-01-25	2001-11-23		ENSG00000258659		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	10063	protein-coding gene	gene with protein product		605684	"""tripartite motif-containing 34"""	RNF21			Standard	NM_130390		Approved			Q9BYJ4	OTTHUMG00000066892	ENST00000514226.1:c.606G>A	11.37:g.5655947G>A		Somatic	0	51	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	28	12.50	D3DQS7|Q9C016|Q9HCR0|Q9HCR1|Q9HCR2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl_sf,smart_Znf_RING,smart_Znf_B-box,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.L556	ENST00000514226.1	37	c.1668	CCDS31391.1	11																																																																																			-	NULL		0.438	TRIM34-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TRIM6-TRIM34	protein_coding	OTTHUMT00000143357.2	G	NM_001003827	-		5655947	+1	no_errors	ENST00000354852	ensembl	human	known	74_37	silent	SNP	0.017	A
TMEM205	374882	genome.wustl.edu	37	19	11453523	11453523	+	Missense_Mutation	SNP	C	C	T			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr19:11453523C>T	ENST00000354882.5	-	3	964	c.538G>A	c.(538-540)Gct>Act	p.A180T	TMEM205_ENST00000586218.1_Missense_Mutation_p.A119T|CCDC159_ENST00000588790.1_5'Flank|RAB3D_ENST00000589655.1_Intron|TMEM205_ENST00000589555.1_Missense_Mutation_p.A180T|TMEM205_ENST00000447337.1_Missense_Mutation_p.A180T|TMEM205_ENST00000593256.2_Missense_Mutation_p.A180T|TMEM205_ENST00000587948.1_Missense_Mutation_p.A180T|TMEM205_ENST00000586590.1_Missense_Mutation_p.A180T|TMEM205_ENST00000586956.1_Missense_Mutation_p.A180T|TMEM205_ENST00000588560.1_Missense_Mutation_p.A180T			Q6UW68	TM205_HUMAN	transmembrane protein 205	180						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				endometrium(1)|lung(1)	2						GCAAGGCCAGCGAGACAGAGC	0.527																																																	0								ENSG00000105518						113.0	117.0	115.0					19																	11453523		2203	4300	6503	TMEM205	SO:0001583	missense	0			-	HGNC	AK127147	CCDS32909.1	19p13.2	2008-01-09				ENSG00000105518			29631	protein-coding gene	gene with protein product		613771				12975309	Standard	NM_198536		Approved	UNQ501, MBC3205	uc002mrb.2	Q6UW68		ENST00000354882.5:c.538G>A	19.37:g.11453523C>T	ENSP00000346954:p.Ala180Thr	Somatic	0	105	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	56	8.20		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.A180T	ENST00000354882.5	37	c.538	CCDS32909.1	19	.	.	.	.	.	.	.	.	.	.	C	11.29	1.594299	0.28445	.	.	ENSG00000105518	ENST00000354882;ENST00000447337	.	.	.	4.75	3.72	0.42706	.	0.340681	0.27056	U	0.021151	T	0.31979	0.0814	L	0.54323	1.7	0.09310	N	1	P	0.35551	0.509	B	0.24541	0.054	T	0.12837	-1.0532	9	0.23302	T	0.38	-1.8862	11.9236	0.52806	0.0:0.9135:0.0:0.0865	.	180	Q6UW68	TM205_HUMAN	T	180	.	ENSP00000346954:A180T	A	-	1	0	TMEM205	11314523	0.000000	0.05858	0.003000	0.11579	0.017000	0.09413	1.007000	0.29860	1.133000	0.42147	0.655000	0.94253	GCT	-	NULL		0.527	TMEM205-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TMEM205	protein_coding	OTTHUMT00000458743.1	C	NM_198536	-		11453523	-1	no_errors	ENST00000354882	ensembl	human	known	74_37	missense	SNP	0.034	T
PRDX3	10935	genome.wustl.edu	37	10	120927997	120927997	+	Missense_Mutation	SNP	G	G	T			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr10:120927997G>T	ENST00000298510.2	-	7	808	c.766C>A	c.(766-768)Cag>Aag	p.Q256K	PRDX3_ENST00000356951.3_Missense_Mutation_p.Q238K|SFXN4_ENST00000330036.6_5'Flank|SFXN4_ENST00000461438.1_5'Flank|SFXN4_ENST00000355697.2_5'Flank|PRDX3_ENST00000494433.1_5'UTR	NM_006793.2	NP_006784.1	P30048	PRDX3_HUMAN	peroxiredoxin 3	256					cellular response to oxidative stress (GO:0034599)|cellular response to reactive oxygen species (GO:0034614)|hydrogen peroxide catabolic process (GO:0042744)|maternal placenta development (GO:0001893)|mitochondrion organization (GO:0007005)|myeloid cell differentiation (GO:0030099)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of kinase activity (GO:0033673)|peptidyl-cysteine oxidation (GO:0018171)|positive regulation of cell proliferation (GO:0008284)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|regulation of mitochondrial membrane potential (GO:0051881)|response to hydrogen peroxide (GO:0042542)|response to lipopolysaccharide (GO:0032496)|response to oxidative stress (GO:0006979)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	alkyl hydroperoxide reductase activity (GO:0008785)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|kinase binding (GO:0019900)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|thioredoxin peroxidase activity (GO:0008379)			endometrium(1)|lung(2)	3		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.0245)		GTGATCTACTGATTTACCTTC	0.368																																					Pancreas(36;562 1096 2447 42526)												0								ENSG00000165672						107.0	97.0	100.0					10																	120927997		2203	4300	6503	PRDX3	SO:0001583	missense	0			-	HGNC	D49396	CCDS7611.1	10q25-q26	2010-11-24			ENSG00000165672	ENSG00000165672			9354	protein-coding gene	gene with protein product		604769	"""antioxidant protein 1"""	AOP1		7733872, 9363753	Standard	NM_006793		Approved	MER5, AOP-1, SP-22	uc001lec.3	P30048	OTTHUMG00000019146	ENST00000298510.2:c.766C>A	10.37:g.120927997G>T	ENSP00000298510:p.Gln256Lys	Somatic	0	91	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.16	B2R7Z0|D3DRC9|E9PH29|P35690|Q0D2H1|Q13776|Q5T5V2|Q96HK4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_AhpC/TSA,pfam_Redoxin,pfam_Peroxiredoxin_C,superfamily_Thioredoxin-like_fold	p.Q256K	ENST00000298510.2	37	c.766	CCDS7611.1	10	.	.	.	.	.	.	.	.	.	.	G	4.250	0.045402	0.08196	.	.	ENSG00000165672	ENST00000356951;ENST00000298510	T;T	0.11169	2.8;2.8	5.19	2.17	0.27698	Thioredoxin-like fold (1);	0.478584	0.21221	N	0.078144	T	0.02848	0.0085	N	0.00801	-1.175	0.26142	N	0.980264	B	0.02656	0.0	B	0.04013	0.001	T	0.39643	-0.9604	10	0.33141	T	0.24	-12.7321	6.1141	0.20117	0.1714:0.0:0.6247:0.2039	.	256	P30048	PRDX3_HUMAN	K	238;256	ENSP00000349432:Q238K;ENSP00000298510:Q256K	ENSP00000298510:Q256K	Q	-	1	0	PRDX3	120917987	1.000000	0.71417	0.983000	0.44433	0.889000	0.51656	1.079000	0.30766	0.703000	0.31848	0.561000	0.74099	CAG	-	superfamily_Thioredoxin-like_fold		0.368	PRDX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRDX3	protein_coding	OTTHUMT00000050639.1	G	NM_006793	-		120927997	-1	no_errors	ENST00000298510	ensembl	human	known	74_37	missense	SNP	0.995	T
HECW1	23072	genome.wustl.edu	37	7	43351444	43351444	+	Missense_Mutation	SNP	A	A	G			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr7:43351444A>G	ENST00000395891.2	+	4	715	c.110A>G	c.(109-111)gAg>gGg	p.E37G	HECW1_ENST00000453890.1_Missense_Mutation_p.E37G	NM_015052.3	NP_055867.3	Q76N89	HECW1_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1	37					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(2)|breast(10)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(57)|ovary(8)|pancreas(2)|prostate(2)|skin(6)|urinary_tract(3)	125						CGGTGCAAGGAGCCGCTCCGA	0.607																																																	0								ENSG00000002746						53.0	61.0	59.0					7																	43351444		1985	4142	6127	HECW1	SO:0001583	missense	0			-	HGNC	AB048365	CCDS5469.2, CCDS69286.1	7p13	2004-12-13			ENSG00000002746	ENSG00000002746			22195	protein-coding gene	gene with protein product		610384				12690205, 14684739	Standard	XM_005249665		Approved	KIAA0322, NEDL1	uc003tid.1	Q76N89	OTTHUMG00000128917	ENST00000395891.2:c.110A>G	7.37:g.43351444A>G	ENSP00000379228:p.Glu37Gly	Somatic	0	27	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	17	45.16	A7E2X0|A8MYS3|B4DH42|O15036|Q9HCC7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_HECT,pfam_WW_dom,pfam_C2_dom,superfamily_HECT,superfamily_WW_dom,superfamily_C2_dom,smart_C2_dom,smart_WW_dom,smart_HECT,pfscan_HECT,pfscan_C2_dom,pfscan_WW_dom	p.E37G	ENST00000395891.2	37	c.110	CCDS5469.2	7	.	.	.	.	.	.	.	.	.	.	A	22.5	4.293083	0.80914	.	.	ENSG00000002746	ENST00000395891;ENST00000453890;ENST00000265522	T;T	0.37411	1.2;1.2	5.96	5.96	0.96718	.	0.099811	0.64402	D	0.000002	T	0.45915	0.1366	L	0.47716	1.5	0.47214	D	0.999357	P;P;D	0.59767	0.919;0.877;0.986	B;B;P	0.53266	0.375;0.339;0.722	T	0.29305	-1.0016	10	0.40728	T	0.16	.	16.422	0.83766	1.0:0.0:0.0:0.0	.	37;69;37	B4DH42;B3KR18;Q76N89	.;.;HECW1_HUMAN	G	37;37;36	ENSP00000379228:E37G;ENSP00000407774:E37G	ENSP00000265522:E36G	E	+	2	0	HECW1	43317969	1.000000	0.71417	1.000000	0.80357	0.864000	0.49448	5.843000	0.69424	2.270000	0.75569	0.533000	0.62120	GAG	-	NULL		0.607	HECW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HECW1	protein_coding	OTTHUMT00000250893.2	A	NM_015052	-		43351444	+1	no_errors	ENST00000395891	ensembl	human	known	74_37	missense	SNP	1.000	G
RMDN2	151393	genome.wustl.edu	37	2	38179419	38179419	+	Intron	SNP	G	G	T			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr2:38179419G>T	ENST00000406384.1	+	3	646				RMDN2_ENST00000402091.3_Missense_Mutation_p.R354I|RMDN2_ENST00000417700.2_Intron|RMDN2_ENST00000354545.2_Intron|RMDN2_ENST00000407257.1_Intron|RMDN2-AS1_ENST00000414365.2_RNA|RMDN2_ENST00000234195.3_Intron	NM_001170792.1	NP_001164263.1	Q96LZ7	RMD2_HUMAN	regulator of microtubule dynamics 2							cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|microtubule (GO:0005874)|mitochondrion (GO:0005739)											ATAGCCTGTAGAATTCATTTC	0.378																																																	0								ENSG00000115841																																			RMDN2	SO:0001627	intron_variant	0			-	HGNC	AK057516	CCDS1792.1, CCDS54351.1, CCDS54352.1	2p22.2	2013-01-11	2013-01-11	2013-01-11	ENSG00000115841	ENSG00000115841			26567	protein-coding gene	gene with protein product		611872	"""family with sequence similarity 82, member A1"""	FAM82A, FAM82A1		12477932	Standard	XM_005264161		Approved	FLJ32954, RMD2	uc002rqn.2	Q96LZ7	OTTHUMG00000128487	ENST00000406384.1:c.453-21764G>T	2.37:g.38179419G>T		Somatic	0	28	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	19	13.64	A9UMZ7|A9UN00|Q4ZG33|Q6UXN4|Q8N657|Q8N9A2|Q8NCV6|Q8NHM0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.R354I	ENST00000406384.1	37	c.1061	CCDS54351.1	2	.	.	.	.	.	.	.	.	.	.	G	15.94	2.980674	0.53827	.	.	ENSG00000115841	ENST00000402091	.	.	.	4.54	4.54	0.55810	.	.	.	.	.	T	0.64283	0.2584	.	.	.	0.49389	D	0.999787	.	.	.	.	.	.	T	0.62282	-0.6887	4	.	.	.	.	12.9675	0.58492	0.0:0.0:1.0:0.0	.	.	.	.	I	354	.	.	R	+	2	0	FAM82A1	38032923	0.475000	0.25894	0.013000	0.15412	0.069000	0.16628	2.469000	0.45110	2.515000	0.84797	0.467000	0.42956	AGA	-	NULL		0.378	RMDN2-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RMDN2	protein_coding	OTTHUMT00000325577.1	G	NM_144713	-		38179419	+1	no_errors	ENST00000402091	ensembl	human	putative	74_37	missense	SNP	0.023	T
POPDC3	64208	genome.wustl.edu	37	6	105614546	105614546	+	Intron	SNP	T	T	G			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr6:105614546T>G	ENST00000254765.3	-	2	28				POPDC3_ENST00000474760.1_Intron|BVES-AS1_ENST00000369122.3_RNA|BVES-AS1_ENST00000580511.1_RNA|BVES-AS1_ENST00000580854.1_RNA	NM_022361.4	NP_071756.2	Q9HBV1	POPD3_HUMAN	popeye domain containing 3						regulation of membrane potential (GO:0042391)	integral component of membrane (GO:0016021)				NS(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(10)|ovary(2)|skin(3)|urinary_tract(1)	26		all_cancers(87;4.87e-05)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0157)|Colorectal(196;0.202)|Lung NSC(302;0.238)				TGCAGCAGCCTTCCCTGACCA	0.448																																																	0								ENSG00000203808																																			BVES-AS1	SO:0001627	intron_variant	0			-	HGNC	BC022323	CCDS5052.1	6q21	2003-06-12			ENSG00000132429	ENSG00000132429			17649	protein-coding gene	gene with protein product		605824				10882522	Standard	NM_022361		Approved	POP3, MGC22671, bA355M14.1	uc003prb.3	Q9HBV1	OTTHUMG00000015293	ENST00000254765.3:c.251-4511A>C	6.37:g.105614546T>G		Somatic	0	66	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	79	12.22	B2RA98|Q5T3Y8|Q8TBW6	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000254765.3	37	NULL	CCDS5052.1	6																																																																																			-	-		0.448	POPDC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BVES-AS1	protein_coding	OTTHUMT00000041651.1	T	NM_022361	-		105614546	+1	no_errors	ENST00000369122	ensembl	human	known	74_37	rna	SNP	0.004	G
MACF1	23499	genome.wustl.edu	37	1	39752957	39752957	+	Splice_Site	SNP	G	G	T			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr1:39752957G>T	ENST00000372915.3	+	14	1610		c.e14-1		MACF1_ENST00000361689.2_Splice_Site|MACF1_ENST00000317713.7_Splice_Site|MACF1_ENST00000567887.1_Splice_Site|MACF1_ENST00000564288.1_Splice_Site|MACF1_ENST00000539005.1_Splice_Site|MACF1_ENST00000545844.1_Splice_Site			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1						ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			TTCCATTTCAGGGTCATGCGT	0.363																																																	0								ENSG00000127603						112.0	106.0	108.0					1																	39752957		2203	4300	6503	MACF1	SO:0001630	splice_region_variant	0			-	HGNC	AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.1524-1G>T	1.37:g.39752957G>T		Somatic	0	44	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	30	30	50.00	B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e14-1	ENST00000372915.3	37	c.1524-1		1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.467528	0.84533	.	.	ENSG00000127603	ENST00000545844;ENST00000372915;ENST00000361689;ENST00000317713;ENST00000539005;ENST00000524432;ENST00000530262;ENST00000372900	.	.	.	5.85	5.85	0.93711	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.1634	0.98142	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MACF1	39525544	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	9.312000	0.96287	2.773000	0.95371	0.655000	0.94253	.	-	-		0.363	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	MACF1	protein_coding	OTTHUMT00000392096.1	G	NM_033044	-	Intron	39752957	+1	no_errors	ENST00000317713	ensembl	human	known	74_37	splice_site	SNP	1.000	T
SUPV3L1	6832	genome.wustl.edu	37	10	70968644	70968644	+	Silent	SNP	G	G	T	rs141290422		TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr10:70968644G>T	ENST00000359655.4	+	15	2274	c.2214G>T	c.(2212-2214)gtG>gtT	p.V738V		NM_003171.3	NP_003162.2	Q8IYB8	SUV3_HUMAN	suppressor of var1, 3-like 1 (S. cerevisiae)	738	Interaction with LAMTOR5, important for protein stability.				ATP catabolic process (GO:0006200)|chromatin maintenance (GO:0070827)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|mitochondrial mRNA catabolic process (GO:0000958)|mitochondrial mRNA surveillance (GO:0035946)|mitochondrial ncRNA surveillance (GO:0035945)|mitochondrial RNA 3'-end processing (GO:0000965)|mitochondrial RNA surveillance (GO:2000827)|mitochondrion morphogenesis (GO:0070584)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell growth (GO:0030307)|positive regulation of mitochondrial RNA catabolic process (GO:0000962)|RNA catabolic process (GO:0006401)	mitochondrial degradosome (GO:0045025)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	3'-5' RNA helicase activity (GO:0034458)|ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|RNA binding (GO:0003723)			NS(1)|breast(2)|endometrium(5)|kidney(5)|large_intestine(3)|lung(6)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						CCAGATTGGTGCAGCAAGGAC	0.512																																																	0								ENSG00000156502						72.0	64.0	66.0					10																	70968644		2203	4300	6503	SUPV3L1	SO:0001819	synonymous_variant	0			-	HGNC	AF042169	CCDS7287.1	10q22.1	2008-08-01	2001-11-28		ENSG00000156502	ENSG00000156502			11471	protein-coding gene	gene with protein product		605122	"""suppressor of var1 (S.cerevisiae) 3-like 1"""			9925937, 16176273	Standard	XM_005270068		Approved	SUV3	uc001jpe.1	Q8IYB8	OTTHUMG00000018375	ENST00000359655.4:c.2214G>T	10.37:g.70968644G>T		Somatic	0	29	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.16	A8K301|O43630	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_SUV3_C,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_C,pfscan_Helicase_C	p.V738	ENST00000359655.4	37	c.2214	CCDS7287.1	10																																																																																			-	NULL		0.512	SUPV3L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUPV3L1	protein_coding	OTTHUMT00000048396.2	G	NM_003171	-		70968644	+1	no_errors	ENST00000359655	ensembl	human	known	74_37	silent	SNP	1.000	T
PLEKHA7	144100	genome.wustl.edu	37	11	16838747	16838747	+	Missense_Mutation	SNP	C	C	T			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr11:16838747C>T	ENST00000355661.3	-	11	1476	c.1466G>A	c.(1465-1467)cGa>cAa	p.R489Q	PLEKHA7_ENST00000448080.2_Missense_Mutation_p.R489Q|PLEKHA7_ENST00000531066.1_Missense_Mutation_p.R489Q|PLEKHA7_ENST00000532079.1_Intron			Q6IQ23	PKHA7_HUMAN	pleckstrin homology domain containing, family A member 7	489					epithelial cell-cell adhesion (GO:0090136)|zonula adherens maintenance (GO:0045218)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|zonula adherens (GO:0005915)	delta-catenin binding (GO:0070097)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(13)|ovary(1)|prostate(2)|skin(7)|urinary_tract(1)	37						TGGCAGGTTTCGGGGAGGTGG	0.642																																																	0								ENSG00000166689						62.0	70.0	68.0					11																	16838747		2200	4294	6494	PLEKHA7	SO:0001583	missense	0			-	HGNC	BC033239	CCDS31434.1	11p15	2013-01-10			ENSG00000166689	ENSG00000166689		"""Pleckstrin homology (PH) domain containing"""	27049	protein-coding gene	gene with protein product		612686				12477932	Standard	NM_175058		Approved	DKFZp686M22243	uc001mmo.3	Q6IQ23	OTTHUMG00000165954	ENST00000355661.3:c.1466G>A	11.37:g.16838747C>T	ENSP00000347883:p.Arg489Gln	Somatic	0	75	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	42	16.00	B4DK33|B4DWC3|Q86VZ7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Pleckstrin_homology,pfam_WW_dom,superfamily_WW_dom,smart_WW_dom,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_WW_dom	p.R489Q	ENST00000355661.3	37	c.1466	CCDS31434.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.57|16.57	3.159224|3.159224	0.57368|0.57368	.|.	.|.	ENSG00000166689|ENSG00000166689	ENST00000530489|ENST00000531066;ENST00000355661;ENST00000448080	.|T;T;T	.|0.06768	.|3.26;3.26;3.26	4.97|4.97	4.05|4.05	0.47172|0.47172	.|.	.|0.495687	.|0.22213	.|N	.|0.063064	T|T	0.06826|0.06826	0.0174|0.0174	L|L	0.43923|0.43923	1.385|1.385	0.47308|0.47308	D|D	0.999382|0.999382	.|B;P;P;P	.|0.49862	.|0.418;0.883;0.911;0.929	.|B;B;B;B	.|0.33750	.|0.028;0.117;0.097;0.169	T|T	0.36335|0.36335	-0.9752|-0.9752	5|10	.|0.38643	.|T	.|0.18	-19.3802|-19.3802	12.7035|12.7035	0.57046|0.57046	0.0:0.9204:0.0:0.0796|0.0:0.9204:0.0:0.0796	.|.	.|63;489;489;489	.|Q6IQ23-3;E9PKC0;Q6IQ23;Q6IQ23-2	.|.;.;PKHA7_HUMAN;.	K|Q	120|489	.|ENSP00000435389:R489Q;ENSP00000347883:R489Q;ENSP00000416895:R489Q	.|ENSP00000347883:R489Q	E|R	-|-	1|2	0|0	PLEKHA7|PLEKHA7	16795323|16795323	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.905000|0.905000	0.53344|0.53344	3.614000|3.614000	0.54160|0.54160	2.311000|2.311000	0.77944|0.77944	0.462000|0.462000	0.41574|0.41574	GAA|CGA	-	NULL		0.642	PLEKHA7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLEKHA7	protein_coding	OTTHUMT00000387242.2	C	NM_175058	-		16838747	-1	no_errors	ENST00000448080	ensembl	human	known	74_37	missense	SNP	1.000	T
ZNF502	91392	genome.wustl.edu	37	3	44762851	44762851	+	Missense_Mutation	SNP	G	G	T			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr3:44762851G>T	ENST00000296091.4	+	4	798	c.542G>T	c.(541-543)aGa>aTa	p.R181I	ZNF502_ENST00000436624.2_Missense_Mutation_p.R181I|ZNF502_ENST00000449836.1_Missense_Mutation_p.R181I	NM_001134440.1|NM_001282880.1|NM_033210.4	NP_001127912.1|NP_001269809.1|NP_149987.2	Q8TBZ5	ZN502_HUMAN	zinc finger protein 502	181					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(4)|large_intestine(8)|lung(4)|prostate(1)|urinary_tract(1)	19				BRCA - Breast invasive adenocarcinoma(193;0.00855)|KIRC - Kidney renal clear cell carcinoma(197;0.0471)|Kidney(197;0.0589)		ACTGGAGAGAGACCCTACACA	0.413																																																	0								ENSG00000196653						139.0	150.0	147.0					3																	44762851		2203	4300	6503	ZNF502	SO:0001583	missense	0			-	HGNC	AK022577	CCDS2719.1	3p21.32	2013-01-08			ENSG00000196653	ENSG00000196653		"""Zinc fingers, C2H2-type"""	23718	protein-coding gene	gene with protein product							Standard	NM_033210		Approved	FLJ14855, FLJ12515	uc003cnt.3	Q8TBZ5	OTTHUMG00000133086	ENST00000296091.4:c.542G>T	3.37:g.44762851G>T	ENSP00000296091:p.Arg181Ile	Somatic	0	51	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	35	10.26		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R181I	ENST00000296091.4	37	c.542	CCDS2719.1	3	.	.	.	.	.	.	.	.	.	.	G	16.69	3.192676	0.58017	.	.	ENSG00000196653	ENST00000449836;ENST00000296091;ENST00000436624;ENST00000427783	T;T;T	0.20332	2.08;2.08;2.08	4.79	2.83	0.33086	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.45915	0.1366	M	0.90595	3.13	0.39010	D	0.95953	D	0.76494	0.999	D	0.72338	0.977	T	0.50725	-0.8794	9	0.87932	D	0	-15.907	4.1256	0.10126	0.2657:0.1759:0.5585:0.0	.	181	Q8TBZ5	ZN502_HUMAN	I	181	ENSP00000397390:R181I;ENSP00000296091:R181I;ENSP00000406469:R181I	ENSP00000296091:R181I	R	+	2	0	ZNF502	44737855	0.026000	0.19158	0.042000	0.18584	0.980000	0.70556	0.155000	0.16362	1.360000	0.45960	0.655000	0.94253	AGA	-	pfscan_Znf_C2H2		0.413	ZNF502-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF502	protein_coding	OTTHUMT00000256744.4	G	NM_033210	-		44762851	+1	no_errors	ENST00000296091	ensembl	human	known	74_37	missense	SNP	0.747	T
TENM3	55714	genome.wustl.edu	37	4	183713453	183713453	+	Missense_Mutation	SNP	G	G	T			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr4:183713453G>T	ENST00000511685.1	+	26	5751	c.5628G>T	c.(5626-5628)caG>caT	p.Q1876H	TENM3_ENST00000406950.2_Missense_Mutation_p.Q1876H			Q9P273	TEN3_HUMAN	teneurin transmembrane protein 3	1876					camera-type eye morphogenesis (GO:0048593)|homophilic cell adhesion (GO:0007156)|positive regulation of neuron projection development (GO:0010976)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										TTCATAGCCAGCGGCAGTACA	0.498																																																	0								ENSG00000218336						100.0	101.0	101.0					4																	183713453		2034	4193	6227	TENM3	SO:0001583	missense	0			-	HGNC	AF195420	CCDS47165.1	4q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000218336	ENSG00000218336			29944	protein-coding gene	gene with protein product		610083	"""odz, odd Oz/ten-m homolog 3 (Drosophila)"""	ODZ3		10331952, 10625539	Standard	NM_001080477		Approved	Ten-M3, KIAA1455	uc003ivd.1	Q9P273	OTTHUMG00000160682	ENST00000511685.1:c.5628G>T	4.37:g.183713453G>T	ENSP00000424226:p.Gln1876His	Somatic	0	55	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	20	16.67	Q5XUL9|Q96SY2|Q9NV77|Q9NVW1|Q9NZJ2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ten_N,pfam_EGF_extracell,superfamily_CarboxyPept-like_regulatory,superfamily_Cyt_c-like_dom,smart_EG-like_dom,pfscan_EG-like_dom,tigrfam_YD,tigrfam_Rhs_assc_core	p.Q1876H	ENST00000511685.1	37	c.5628	CCDS47165.1	4	.	.	.	.	.	.	.	.	.	.	G	14.48	2.547896	0.45383	.	.	ENSG00000218336	ENST00000511685;ENST00000406950	D;D	0.87412	-2.25;-2.25	5.18	4.34	0.51931	.	.	.	.	.	D	0.92221	0.7533	M	0.83603	2.65	0.58432	D	0.999993	D	0.61697	0.99	D	0.70487	0.969	D	0.91193	0.4985	9	0.39692	T	0.17	.	9.3319	0.38027	0.2227:0.0:0.7773:0.0	.	1876	Q9P273	TEN3_HUMAN	H	1876	ENSP00000424226:Q1876H;ENSP00000385276:Q1876H	ENSP00000385276:Q1876H	Q	+	3	2	ODZ3	183950447	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	1.407000	0.34657	1.418000	0.47098	0.591000	0.81541	CAG	-	NULL		0.498	TENM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TENM3	protein_coding	OTTHUMT00000361734.1	G		-		183713453	+1	no_errors	ENST00000406950	ensembl	human	known	74_37	missense	SNP	1.000	T
LPIN3	64900	genome.wustl.edu	37	20	39977780	39977780	+	Silent	SNP	C	C	A			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr20:39977780C>A	ENST00000373257.3	+	5	697	c.606C>A	c.(604-606)ccC>ccA	p.P202P		NM_022896.1	NP_075047.1	Q9BQK8	LPIN3_HUMAN	lipin 3	202					fatty acid metabolic process (GO:0006631)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|nucleus (GO:0005634)	phosphatidate phosphatase activity (GO:0008195)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(7)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31		Myeloproliferative disorder(115;0.000739)				ACATCTACCCCTACTCGGATG	0.567																																																	0								ENSG00000132793						97.0	97.0	97.0					20																	39977780		2203	4300	6503	LPIN3	SO:0001819	synonymous_variant	0			-	HGNC	AL132654	CCDS33469.1	20q11.2-q12	2006-04-04	2002-05-23		ENSG00000132793	ENSG00000132793			14451	protein-coding gene	gene with protein product		605520	"""lipin 3-like"""	LIPN3L		11138012	Standard	XM_005260515		Approved	SMP2	uc002xjx.3	Q9BQK8	OTTHUMG00000033056	ENST00000373257.3:c.606C>A	20.37:g.39977780C>A		Somatic	0	48	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	34	10.53	B2RTT5|Q5TDB9|Q9NPY8|Q9UJE5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_LNS2,pfam_Lipin_N,superfamily_HAD-like_dom,smart_LNS2	p.P202	ENST00000373257.3	37	c.606	CCDS33469.1	20																																																																																			-	NULL		0.567	LPIN3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	LPIN3	protein_coding	OTTHUMT00000080393.1	C	NM_022896	-		39977780	+1	no_errors	ENST00000373257	ensembl	human	known	74_37	silent	SNP	1.000	A
OCRL	4952	genome.wustl.edu	37	X	128703302	128703302	+	Missense_Mutation	SNP	C	C	A			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chrX:128703302C>A	ENST00000371113.4	+	15	1693	c.1528C>A	c.(1528-1530)Cag>Aag	p.Q510K	OCRL_ENST00000357121.5_Missense_Mutation_p.Q510K	NM_000276.3	NP_000267.2	Q01968	OCRL_HUMAN	oculocerebrorenal syndrome of Lowe	510	5-phosphatase.				cilium assembly (GO:0042384)|in utero embryonic development (GO:0001701)|inositol phosphate metabolic process (GO:0043647)|lipid metabolic process (GO:0006629)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|Golgi stack (GO:0005795)|Golgi-associated vesicle (GO:0005798)|nucleus (GO:0005634)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	inositol phosphate phosphatase activity (GO:0052745)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)			breast(1)|endometrium(3)|kidney(4)|large_intestine(11)|lung(24)|ovary(2)|upper_aerodigestive_tract(3)	48						AAATGTTAATCAGCTTAATTA	0.423																																																	0								ENSG00000122126						173.0	160.0	164.0					X																	128703302		2203	4300	6503	OCRL	SO:0001583	missense	0			-	HGNC	U57627	CCDS35393.1, CCDS35394.1	Xq25	2014-06-18			ENSG00000122126	ENSG00000122126			8108	protein-coding gene	gene with protein product		300535					Standard	NM_001587		Approved	OCRL1	uc004euq.3	Q01968	OTTHUMG00000022706	ENST00000371113.4:c.1528C>A	X.37:g.128703302C>A	ENSP00000360154:p.Gln510Lys	Somatic	0	38	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52	A6NKI1|A8KAP2|B7ZLX2|O60800|Q15684|Q15774|Q4VY09|Q4VY10|Q5JQF1|Q5JQF2|Q9UJG5|Q9UMA5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Endo/exonuclease/phosphatase,pfam_RhoGAP_dom,superfamily_Endo/exonuclease/phosphatase,superfamily_Rho_GTPase_activation_prot,smart_IPPc,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.Q510K	ENST00000371113.4	37	c.1528	CCDS35393.1	X	.	.	.	.	.	.	.	.	.	.	C	24.7	4.565694	0.86439	.	.	ENSG00000122126	ENST00000371113;ENST00000357121	D;D	0.95238	-3.65;-3.65	5.82	4.96	0.65561	Endonuclease/exonuclease/phosphatase (2);Inositol polyphosphate-related phosphatase (1);	0.170703	0.53938	D	0.000054	D	0.97692	0.9243	H	0.94264	3.515	0.80722	D	1	D;D	0.76494	0.999;0.998	D;D	0.73708	0.981;0.963	D	0.97423	1.0010	10	0.34782	T	0.22	.	12.714	0.57105	0.0:0.9183:0.0:0.0817	.	510;510	Q01968-2;Q01968	.;OCRL_HUMAN	K	510	ENSP00000360154:Q510K;ENSP00000349635:Q510K	ENSP00000349635:Q510K	Q	+	1	0	OCRL	128530983	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	7.476000	0.81055	1.206000	0.43276	0.500000	0.49745	CAG	-	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase,smart_IPPc		0.423	OCRL-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	OCRL	protein_coding	OTTHUMT00000058917.1	C	NM_000276	-		128703302	+1	no_errors	ENST00000371113	ensembl	human	known	74_37	missense	SNP	1.000	A
MOGS	7841	genome.wustl.edu	37	2	74688578	74688578	+	Missense_Mutation	SNP	C	C	T			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr2:74688578C>T	ENST00000233616.4	-	4	2500	c.2338G>A	c.(2338-2340)Gct>Act	p.A780T	MOGS_ENST00000462443.1_5'Flank|MOGS_ENST00000409065.1_3'UTR|MOGS_ENST00000452063.2_Missense_Mutation_p.A674T	NM_006302.2	NP_006293.2	Q13724	MOGS_HUMAN	mannosyl-oligosaccharide glucosidase	780					cellular protein metabolic process (GO:0044267)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glucosidase activity (GO:0015926)|mannosyl-oligosaccharide glucosidase activity (GO:0004573)			cervix(1)|endometrium(6)|large_intestine(3)|lung(10)|prostate(1)|urinary_tract(2)	23						AGTTTGGCAGCCCGAGCCTGG	0.602																																																	0								ENSG00000115275						77.0	84.0	82.0					2																	74688578		2082	4210	6292	MOGS	SO:0001583	missense	0			-	HGNC	X87237	CCDS42700.1, CCDS54370.1	2p13.1	2012-01-31			ENSG00000115275	ENSG00000115275	3.2.1.106		24862	protein-coding gene	gene with protein product	"""glucosidase I"", ""processing A-glucosidase I"""	601336				7635146, 8786151	Standard	NM_006302		Approved	GCS1, CWH41, DER7	uc010ffj.3	Q13724	OTTHUMG00000152886	ENST00000233616.4:c.2338G>A	2.37:g.74688578C>T	ENSP00000233616:p.Ala780Thr	Somatic	0	63	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	22	14.81	A8K938|F5H6D0|Q17RN9|Q8TCT5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Glycoside_hydrolase_63,superfamily_6-hairpin_glycosidase-like	p.A780T	ENST00000233616.4	37	c.2338	CCDS42700.1	2	.	.	.	.	.	.	.	.	.	.	C	18.64	3.667383	0.67814	.	.	ENSG00000115275	ENST00000233616;ENST00000452063	T;T	0.41400	1.0;1.0	4.48	4.48	0.54585	Six-hairpin glycosidase-like (1);	0.122568	0.53938	D	0.000043	T	0.64023	0.2561	M	0.84846	2.72	0.80722	D	1	D	0.89917	1.0	D	0.72982	0.979	T	0.66352	-0.5945	10	0.48119	T	0.1	-7.6399	10.1336	0.42693	0.1996:0.8004:0.0:0.0	.	780	Q13724	MOGS_HUMAN	T	780;674	ENSP00000233616:A780T;ENSP00000388201:A674T	ENSP00000233616:A780T	A	-	1	0	MOGS	74542086	1.000000	0.71417	0.994000	0.49952	0.931000	0.56810	5.077000	0.64419	2.488000	0.83962	0.563000	0.77884	GCT	-	pfam_Glycoside_hydrolase_63,superfamily_6-hairpin_glycosidase-like		0.602	MOGS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MOGS	protein_coding	OTTHUMT00000328382.1	C	NM_006302	-		74688578	-1	no_errors	ENST00000233616	ensembl	human	known	74_37	missense	SNP	0.998	T
CROCCP2	84809	genome.wustl.edu	37	1	16946471	16946471	+	lincRNA	SNP	G	G	C			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr1:16946471G>C	ENST00000412962.1	-	0	1048				RP5-1182A14.5_ENST00000607700.1_lincRNA			Q86T23	CROL1_HUMAN	ciliary rootlet coiled-coil, rootletin pseudogene 2						centrosome organization (GO:0051297)	ciliary rootlet (GO:0035253)											CGCTGCAGCTGACTCTGCAGC	0.677																																																	0								ENSG00000215908																																			CROCCP2			0			-	HGNC	AK090414		1p36.13	2010-07-08	2010-07-08	2010-07-08	ENSG00000215908	ENSG00000215908			28170	pseudogene	pseudogene			"""ciliary rootlet coiled-coil, rootletin-like 1"""	CROCCL1		12477932	Standard	NR_026752		Approved	MGC12760	uc001azf.3	Q86T23	OTTHUMG00000037884		1.37:g.16946471G>C		Somatic	1	131	0.76		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	108	8.47	Q8NF65|Q96FR5|Q9BRE8	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000412962.1	37	NULL		1																																																																																			-	-		0.677	CROCCP2-003	KNOWN	basic	lincRNA	CROCCP2	lincRNA	OTTHUMT00000092784.1	G	NR_026752.1	-		16946471	-1	no_errors	ENST00000412962	ensembl	human	known	74_37	rna	SNP	0.998	C
KEL	3792	genome.wustl.edu	37	7	142636688	142636688	+	IGR	SNP	G	G	T			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr7:142636688G>T	ENST00000355265.2	-	0	2812				C7orf34_ENST00000409607.3_Silent_p.G15G	NM_000420.2	NP_000411.1	P23276	KELL_HUMAN	Kell blood group, metallo-endopeptidase						vasoconstriction (GO:0042310)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(11)|lung(34)|ovary(3)|prostate(2)|skin(1)	60	Melanoma(164;0.059)					TGGGAGCAGGGGGCGGCCAAA	0.637																																																	0								ENSG00000165131						39.0	42.0	41.0					7																	142636688		2203	4300	6503	C7orf34	SO:0001628	intergenic_variant	0			-	HGNC	BC003135	CCDS34766.1	7q33	2014-07-19	2006-10-10		ENSG00000197993	ENSG00000197993		"""CD molecules"", ""Blood group antigens"""	6308	protein-coding gene	gene with protein product		613883	"""Kell blood group"", ""Kell blood group, metalloendopeptidase"""			1712490, 7683930	Standard	NM_000420		Approved	ECE3, CD238	uc003wcb.3	P23276	OTTHUMG00000157159		7.37:g.142636688G>T		Somatic	0	23	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	7	30.00	B2RBV4|Q96RS8|Q99885	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.G15	ENST00000355265.2	37	c.45	CCDS34766.1	7																																																																																			-	NULL		0.637	KEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C7orf34	protein_coding	OTTHUMT00000347671.2	G	NM_000420	-		142636688	+1	no_errors	ENST00000409607	ensembl	human	known	74_37	silent	SNP	0.014	T
PA2G4	5036	genome.wustl.edu	37	12	56505265	56505265	+	Silent	SNP	C	C	A			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr12:56505265C>A	ENST00000303305.6	+	12	1490	c.1071C>A	c.(1069-1071)ctC>ctA	p.L357L	RP11-603J24.17_ENST00000548595.1_RNA|PA2G4_ENST00000552766.1_Intron	NM_006191.2	NP_006182.2	Q9UQ80	PA2G4_HUMAN	proliferation-associated 2G4, 38kDa	357	Necessary for nucleolar localization.				cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of translation (GO:0006417)|rRNA processing (GO:0006364)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin protein ligase binding (GO:0031625)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(4)|ovary(1)|urinary_tract(1)	12			OV - Ovarian serous cystadenocarcinoma(18;0.0739)			TCCAGGCCCTCCTCCAGAGTT	0.398																																																	0								ENSG00000170515						105.0	110.0	108.0					12																	56505265		2202	4299	6501	PA2G4	SO:0001819	synonymous_variant	0			-	HGNC	U59435, BC007561	CCDS8902.1	12q13.2	2008-09-05	2002-08-29		ENSG00000170515	ENSG00000170515			8550	protein-coding gene	gene with protein product		602145	"""proliferation-associated 2G4, 38kD"""			9345902	Standard	NM_006191		Approved		uc001sjm.3	Q9UQ80	OTTHUMG00000170173	ENST00000303305.6:c.1071C>A	12.37:g.56505265C>A		Somatic	0	45	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70	O43846|Q9UM59	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Pept_M24_structural-domain,superfamily_Pept_M24_structural-domain,tigrfam_Pap_1	p.L357	ENST00000303305.6	37	c.1071	CCDS8902.1	12																																																																																			-	tigrfam_Pap_1		0.398	PA2G4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PA2G4	protein_coding	OTTHUMT00000407767.1	C	NM_006191	-		56505265	+1	no_errors	ENST00000303305	ensembl	human	known	74_37	silent	SNP	1.000	A
PAPD5	64282	genome.wustl.edu	37	16	50264565	50264565	+	3'UTR	SNP	G	G	T			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr16:50264565G>T	ENST00000436909.3	+	0	3458				PAPD5_ENST00000573002.1_3'UTR|PAPD5_ENST00000357464.3_3'UTR	NM_001040284.2|NM_001040285.2	NP_001035374.2|NP_001035375.2	Q8NDF8	PAPD5_HUMAN	PAP associated domain containing 5						histone mRNA catabolic process (GO:0071044)|mitotic nuclear division (GO:0007067)|mRNA processing (GO:0006397)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|polynucleotide adenylyltransferase activity (GO:0004652)			endometrium(1)|kidney(1)|lung(2)	4		all_cancers(37;0.0452)		BRCA - Breast invasive adenocarcinoma(181;0.0843)|GBM - Glioblastoma multiforme(240;0.231)		TCATGGAATTGTTATCGTTAA	0.294																																																	0								ENSG00000121274																																			PAPD5	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AF089897	CCDS54006.1	16q12.1	2010-11-18				ENSG00000121274			30758	protein-coding gene	gene with protein product	"""TUTase3"""	605540				10066793	Standard	NM_001040284		Approved	TRF4-2	uc010vgo.2	Q8NDF8		ENST00000436909.3:c.*1326G>T	16.37:g.50264565G>T		Somatic	0	35	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	24	14.29	B4DV38|Q9NW67|Q9Y6C0	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000436909.3	37	NULL	CCDS54006.1	16																																																																																			-	-		0.294	PAPD5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PAPD5	protein_coding	OTTHUMT00000423149.2	G	NM_022447	-		50264565	+1	no_errors	ENST00000573002	ensembl	human	known	74_37	rna	SNP	1.000	T
SGOL1	151648	genome.wustl.edu	37	3	20212755	20212755	+	Intron	DEL	A	A	-	rs202135893|rs369158870	byFrequency	TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr3:20212755delA	ENST00000263753.4	-	7	1422				SGOL1_ENST00000437051.1_Intron|SGOL1_ENST00000452020.1_Intron|SGOL1_ENST00000306698.2_Intron|SGOL1_ENST00000443724.1_Intron|SGOL1_ENST00000419233.2_Intron|SGOL1_ENST00000442720.1_Intron|SGOL1-AS1_ENST00000448208.1_RNA|SGOL1_ENST00000429446.3_Intron|SGOL1_ENST00000417364.1_Intron|SGOL1_ENST00000460637.1_5'UTR|SGOL1_ENST00000412997.1_Intron|SGOL1_ENST00000383774.1_Intron|SGOL1_ENST00000425061.1_Intron|SGOL1_ENST00000412868.1_Intron|SGOL1_ENST00000421451.1_Intron	NM_001012410.3|NM_001199252.1	NP_001012410.1|NP_001186181.1	Q5FBB7	SGOL1_HUMAN	shugoshin-like 1 (S. pombe)						attachment of spindle microtubules to kinetochore (GO:0008608)|centriole-centriole cohesion (GO:0010457)|chromosome segregation (GO:0007059)|meiotic chromosome segregation (GO:0045132)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	centrosome (GO:0005813)|chromosome, centromeric region (GO:0000775)|condensed chromosome, centromeric region (GO:0000779)|condensed nuclear chromosome, centromeric region (GO:0000780)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|mitotic cohesin complex (GO:0030892)|nucleus (GO:0005634)|spindle pole (GO:0000922)	kinase binding (GO:0019900)			kidney(1)|large_intestine(4)|lung(6)|skin(1)|urinary_tract(2)	14						AATATGATTTAAAAAAAAAAA	0.308																																																	0								ENSG00000129810						26.0	28.0	27.0					3																	20212755		2201	4297	6498	SGOL1	SO:0001627	intron_variant	0				HGNC	BC001339	CCDS2635.1, CCDS33716.1, CCDS46771.1, CCDS46772.1, CCDS46773.1, CCDS46774.1, CCDS56243.1	3p24.3	2005-07-27			ENSG00000129810	ENSG00000129810			25088	protein-coding gene	gene with protein product		609168				12747765	Standard	NM_001199251		Approved	NY-BR-85	uc003cbu.3	Q5FBB7	OTTHUMG00000130479	ENST00000263753.4:c.1283-31T>-	3.37:g.20212755delA		Somatic	0	37	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	40	11.11	Q588H5|Q5FBB4|Q5FBB5|Q5FBB6|Q5FBB8|Q8N579|Q8WVL0|Q9BVA8|Q9H275	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000263753.4	37	NULL	CCDS33716.1	3																																																																																			-	-		0.308	SGOL1-009	KNOWN	basic|CCDS	protein_coding	SGOL1	protein_coding	OTTHUMT00000340498.1	A	NM_138484			20212755	-1	no_errors	ENST00000460637	ensembl	human	putative	74_37	rna	DEL	0.000	-
DUSP8	1850	genome.wustl.edu	37	11	1577819	1577820	+	Frame_Shift_Del	DEL	CG	CG	-			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	CG	CG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr11:1577819_1577820delCG	ENST00000397374.3	-	7	1933_1934	c.1806_1807delCG	c.(1804-1809)cgcggcfs	p.G603fs	DUSP8_ENST00000331588.4_Frame_Shift_Del_p.G603fs|DUSP8_ENST00000528778.1_5'Flank	NM_004420.2	NP_004411.2	Q13202	DUS8_HUMAN	dual specificity phosphatase 8	603					inactivation of MAPK activity (GO:0000188)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			endometrium(1)|lung(2)|prostate(1)|urinary_tract(1)	5		all_epithelial(84;0.000134)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000621)|Lung(200;0.0687)|LUSC - Lung squamous cell carcinoma(625;0.0825)		AGCTCCTCGCCGCGCGCGCGCC	0.752																																																	0								ENSG00000184545			31,2529		3,25,1252						2.2	0.4			2	79,5245		11,57,2594	no	frameshift	DUSP8	NM_004420.2		14,82,3846	A1A1,A1R,RR		1.4838,1.2109,1.3952				110,7774				DUSP8	SO:0001589	frameshift_variant	0				HGNC		CCDS7724.1	11p15.5	2011-06-09			ENSG00000184545	ENSG00000184545		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3074	protein-coding gene	gene with protein product	"""serine/threonine specific protein phosphatase"", ""H1 phosphatase, vaccinia virus homolog"""	602038	"""chromosome 11 open reading frame 81"""	C11orf81		7561881, 9192849	Standard	NM_004420		Approved	HVH-5, HB5, FLJ42958	uc001lts.2	Q13202	OTTHUMG00000133348	ENST00000397374.3:c.1806_1807delCG	11.37:g.1577827_1577828delCG	ENSP00000380530:p.Gly603fs	Somatic	0	38	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	7	22.22	Q86SS8	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Dual-sp_phosphatase_cat-dom,pfam_Rhodanese-like_dom,superfamily_Rhodanese-like_dom,smart_Rhodanese-like_dom,smart_Dual-sp_phosphatase_subgr_cat,pfscan_Rhodanese-like_dom,pfscan_Tyr/Dual-sp_Pase,pfscan_Dual-sp_phosphatase_subgr_cat,prints_MKP	p.G603fs	ENST00000397374.3	37	c.1807_1806	CCDS7724.1	11																																																																																			-	NULL		0.752	DUSP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUSP8	protein_coding	OTTHUMT00000257178.3	CG	NM_004420			1577820	-1	no_errors	ENST00000331588	ensembl	human	known	74_37	frame_shift_del	DEL	0.233:0.104	-
GSE1	23199	genome.wustl.edu	37	16	85694912	85694912	+	Nonsense_Mutation	SNP	G	G	T	rs528060260		TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr16:85694912G>T	ENST00000253458.7	+	9	1977	c.1801G>T	c.(1801-1803)Gaa>Taa	p.E601*	GSE1_ENST00000405402.2_Nonsense_Mutation_p.E497*|GSE1_ENST00000393243.1_Nonsense_Mutation_p.E528*|RN7SL381P_ENST00000577658.1_RNA	NM_014615.2	NP_055430.1	Q14687	GSE1_HUMAN	Gse1 coiled-coil protein	601	Pro-rich.																GCGGCGGGCCGAAAGCCACTC	0.662																																																	0								ENSG00000131149						30.0	34.0	33.0					16																	85694912		2180	4266	6446	GSE1	SO:0001587	stop_gained	0			-	HGNC	D80004	CCDS10952.1, CCDS45539.1, CCDS62007.1	16q24.1	2012-12-07	2012-12-07	2012-10-02	ENSG00000131149	ENSG00000131149			28979	protein-coding gene	gene with protein product	"""genetic suppressor element 1"""		"""KIAA0182"", ""Gse1 coiled-coil protein homolog (mouse)"""	KIAA0182		8724849, 8786132	Standard	NM_014615		Approved		uc002fix.4	Q14687	OTTHUMG00000137650	ENST00000253458.7:c.1801G>T	16.37:g.85694912G>T	ENSP00000253458:p.Glu601*	Somatic	0	58	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	32	30.43	D3DUM4|Q8IY61|Q96GA4|Q9BW09	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GSE-like	p.E601*	ENST00000253458.7	37	c.1801	CCDS10952.1	16	.	.	.	.	.	.	.	.	.	.	G	38	6.781875	0.97833	.	.	ENSG00000131149	ENST00000405402;ENST00000253458;ENST00000393243	.	.	.	5.17	5.17	0.71159	.	0.207319	0.49305	D	0.000152	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.33141	T	0.24	-15.9308	18.2613	0.90037	0.0:0.0:1.0:0.0	.	.	.	.	X	497;601;528	.	ENSP00000253458:E601X	E	+	1	0	KIAA0182	84252413	1.000000	0.71417	0.789000	0.31954	0.079000	0.17450	3.188000	0.50958	2.403000	0.81681	0.561000	0.74099	GAA	-	NULL		0.662	GSE1-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	GSE1	protein_coding	OTTHUMT00000325527.1	G	NM_014615	-		85694912	+1	no_errors	ENST00000253458	ensembl	human	known	74_37	nonsense	SNP	0.947	T
AC105242.1	0	genome.wustl.edu	37	8	78199114	78199133	+	RNA	DEL	CAGGGGGAACTGGGAGCATT	CAGGGGGAACTGGGAGCATT	-	rs72579714	byFrequency	TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	CAGGGGGAACTGGGAGCATT	CAGGGGGAACTGGGAGCATT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr8:78199114_78199133delCAGGGGGAACTGGGAGCATT	ENST00000410402.3	+	0	63_80																											tccatagagccagggggaactgggagcattcagggggaac	0.577														392	0.0782748	0.1278	0.0764	5008	,	,		22251	0.0		0.1262	False		,,,				2504	0.044																0								ENSG00000222334																																			AC105242.1			0				Clone_based_ensembl_gene																													8.37:g.78199114_78199133delCAGGGGGAACTGGGAGCATT		Somatic	NA	NA	NA		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000410402.3	37	NULL		8																																																																																			-	-		0.577	AC105242.1-201	NOVEL	basic	miRNA	ENSG00000222334	miRNA		CAGGGGGAACTGGGAGCATT				78199133	+1	no_errors	ENST00000410402	ensembl	human	novel	74_37	rna	DEL	0.006:0.006:0.004:0.003:0.002:0.001:0.002:0.005:0.008:0.016:0.022:0.026:0.030:0.032:0.032:0.032:0.031:0.028:0.024:0.018	-
TP53	7157	genome.wustl.edu	37	17	7574034	7574034	+	Splice_Site	SNP	C	C	G	rs587782272		TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr17:7574034C>G	ENST00000269305.4	-	10	1183		c.e10-1		TP53_ENST00000359597.4_Intron|TP53_ENST00000455263.2_Splice_Site|TP53_ENST00000413465.2_Intron|TP53_ENST00000420246.2_Splice_Site|TP53_ENST00000445888.2_Splice_Site	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53						apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.?(9)|p.0?(8)|p.I332fs*49(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCCCACGGATCTGCAGCAACA	0.512		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	18	Unknown(9)|Whole gene deletion(8)|Insertion - Frameshift(1)	lung(5)|bone(4)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|endometrium(2)|stomach(1)|breast(1)|ovary(1)	GRCh37	CS002470|CS033842	TP53	S		ENSG00000141510						44.0	36.0	39.0					17																	7574034		2203	4300	6503	TP53	SO:0001630	splice_region_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	-	HGNC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.994-1G>C	17.37:g.7574034C>G		Somatic	0	43	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	30	6	83.33	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e9-1	ENST00000269305.4	37	c.994-1	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	12.82	2.051594	0.36181	.	.	ENSG00000141510	ENST00000269305;ENST00000445888;ENST00000396473	.	.	.	5.13	5.13	0.70059	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.4323	0.83853	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TP53	7514759	1.000000	0.71417	0.997000	0.53966	0.143000	0.21401	6.410000	0.73294	2.549000	0.85964	0.561000	0.74099	.	-	-		0.512	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	C	NM_000546	-	Intron	7574034	-1	no_errors	ENST00000269305	ensembl	human	known	74_37	splice_site	SNP	1.000	G
TADA3	10474	genome.wustl.edu	37	3	9822210	9822210	+	Missense_Mutation	SNP	C	C	A			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr3:9822210C>A	ENST00000301964.2	-	9	1688	c.1130G>T	c.(1129-1131)cGg>cTg	p.R377L	TADA3_ENST00000440161.1_Missense_Mutation_p.R377L	NM_006354.2	NP_006345.1	O75528	TADA3_HUMAN	transcriptional adaptor 3	377					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|intracellular estrogen receptor signaling pathway (GO:0030520)|mitotic nuclear division (GO:0007067)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of histone deacetylation (GO:0031063)|regulation of protein phosphorylation (GO:0001932)|regulation of protein stability (GO:0031647)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of tubulin deacetylation (GO:0090043)|transcription, DNA-templated (GO:0006351)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|intracellular (GO:0005622)|mitotic spindle (GO:0072686)|nucleus (GO:0005634)|STAGA complex (GO:0030914)|transcription factor TFTC complex (GO:0033276)	ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein domain specific binding (GO:0019904)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(4)|skin(2)|upper_aerodigestive_tract(1)	16						CAGCTCCTGCCGGCTCACCTC	0.642																																																	0								ENSG00000171148						34.0	31.0	32.0					3																	9822210		2203	4300	6503	TADA3	SO:0001583	missense	0			-	HGNC	AF069733	CCDS2583.1, CCDS2584.1	3p25.3	2010-08-13	2009-10-02	2009-10-02	ENSG00000171148	ENSG00000171148			19422	protein-coding gene	gene with protein product		602945	"""transcriptional adaptor 3 (NGG1 homolog, yeast)-like"""	TADA3L		9674425, 11707411	Standard	NM_006354		Approved	FLJ20221, FLJ21329, ADA3, hADA3, NGG1	uc010hcn.2	O75528	OTTHUMG00000128440	ENST00000301964.2:c.1130G>T	3.37:g.9822210C>A	ENSP00000307684:p.Arg377Leu	Somatic	0	27	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	20	16.67	Q6FI83|Q9UFS2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Histone_AcTrfase_su3	p.R377L	ENST00000301964.2	37	c.1130	CCDS2583.1	3	.	.	.	.	.	.	.	.	.	.	C	18.61	3.661445	0.67700	.	.	ENSG00000171148	ENST00000301964;ENST00000440161	.	.	.	5.72	5.72	0.89469	.	0.058899	0.64402	D	0.000002	T	0.57257	0.2041	L	0.52011	1.625	0.80722	D	1	B;B	0.09022	0.002;0.002	B;B	0.10450	0.005;0.005	T	0.52426	-0.8577	9	0.14656	T	0.56	-16.931	18.0605	0.89375	0.0:1.0:0.0:0.0	.	377;377	O75528;A8K899	TADA3_HUMAN;.	L	377	.	ENSP00000307684:R377L	R	-	2	0	TADA3	9797210	1.000000	0.71417	0.983000	0.44433	0.989000	0.77384	4.657000	0.61490	2.708000	0.92522	0.561000	0.74099	CGG	-	pfam_Histone_AcTrfase_su3		0.642	TADA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TADA3	protein_coding	OTTHUMT00000250236.1	C		-		9822210	-1	no_errors	ENST00000301964	ensembl	human	known	74_37	missense	SNP	0.997	A
GPR12	2835	genome.wustl.edu	37	13	27333536	27333536	+	Nonsense_Mutation	SNP	G	G	T			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr13:27333536G>T	ENST00000381436.2	-	1	891	c.429C>A	c.(427-429)taC>taA	p.Y143*	GPR12_ENST00000405846.3_Nonsense_Mutation_p.Y143*			P47775	GPR12_HUMAN	G protein-coupled receptor 12	143					cellular calcium ion homeostasis (GO:0006874)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)|phosphatidylcholine binding (GO:0031210)			endometrium(7)|kidney(2)|large_intestine(6)|lung(14)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	33	Colorectal(5;5.77e-05)	Breast(139;0.198)		Epithelial(112;9.37e-07)|OV - Ovarian serous cystadenocarcinoma(117;1.16e-06)|all cancers(112;8.31e-06)|GBM - Glioblastoma multiforme(144;0.00121)|Lung(94;0.111)|LUSC - Lung squamous cell carcinoma(192;0.184)		TCAGAGCGTAGTACAGTGAGA	0.572																																																	0								ENSG00000132975						106.0	89.0	95.0					13																	27333536		2203	4300	6503	GPR12	SO:0001587	stop_gained	0			-	HGNC	U18548	CCDS9319.1	13q12	2014-06-12			ENSG00000132975	ENSG00000132975		"""GPCR / Class A : Orphans"""	4466	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 84"""	600752				8262253, 8530049	Standard	NM_005288		Approved	GPCR21, PPP1R84	uc010aal.3	P47775	OTTHUMG00000016620	ENST00000381436.2:c.429C>A	13.37:g.27333536G>T	ENSP00000370844:p.Tyr143*	Somatic	0	47	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	19	17.39	Q5T8P3	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPR_3/6/12_orphan,prints_GPR12,prints_GPCR_Rhodpsn	p.Y143*	ENST00000381436.2	37	c.429	CCDS9319.1	13	.	.	.	.	.	.	.	.	.	.	G	36	5.646163	0.96704	.	.	ENSG00000132975	ENST00000405846;ENST00000381436	.	.	.	5.36	-1.1	0.09872	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.2982	0.43637	0.5703:0.0:0.4297:0.0	.	.	.	.	X	143	.	ENSP00000370844:Y143X	Y	-	3	2	GPR12	26231536	1.000000	0.71417	0.997000	0.53966	0.915000	0.54546	1.764000	0.38471	-0.165000	0.10908	-0.258000	0.10820	TAC	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPR_3/6/12_orphan		0.572	GPR12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR12	protein_coding	OTTHUMT00000044257.2	G		-		27333536	-1	no_errors	ENST00000381436	ensembl	human	known	74_37	nonsense	SNP	0.998	T
SEPT6	23157	genome.wustl.edu	37	X	118797518	118797518	+	Nonsense_Mutation	SNP	C	C	A			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chrX:118797518C>A	ENST00000343984.5	-	3	532	c.268G>T	c.(268-270)Gag>Tag	p.E90*	SEPT6_ENST00000354416.3_Nonsense_Mutation_p.E90*|SEPT6_ENST00000360156.7_Nonsense_Mutation_p.E90*|SEPT6_ENST00000394610.1_Nonsense_Mutation_p.E90*|SEPT6_ENST00000489216.1_Nonsense_Mutation_p.E90*|SEPT6_ENST00000394617.2_Nonsense_Mutation_p.E120*|SEPT6_ENST00000394616.4_Nonsense_Mutation_p.E32*|SEPT6_ENST00000354228.4_Nonsense_Mutation_p.E90*	NM_015129.5	NP_055944.2	Q14141	SEPT6_HUMAN	septin 6	90	Septin-type G.				cytokinesis (GO:0000910)|viral process (GO:0016032)	axon terminus (GO:0043679)|kinetochore (GO:0000776)|septin complex (GO:0031105)|synaptic vesicle (GO:0008021)	GTP binding (GO:0005525)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(3)	17						ACGTTGCTCTCTTGGAGGTCA	0.552			T	MLL	AML																																			Dom	yes		X	Xq24	23157	septin 6		L	0								ENSG00000125354						251.0	239.0	243.0					X																	118797518		2203	4300	6503	SEPT6	SO:0001587	stop_gained	0			-	HGNC	D50918	CCDS14583.1, CCDS14584.1, CCDS14585.1	Xq24	2013-01-21			ENSG00000125354	ENSG00000125354		"""Septins"""	15848	protein-coding gene	gene with protein product		300683				8590280, 10744683	Standard	NM_015129		Approved	KIAA0128, SEP2, SEPT2, MGC16619, MGC20339	uc004erv.3	Q14141	OTTHUMG00000022280	ENST00000343984.5:c.268G>T	X.37:g.118797518C>A	ENSP00000341524:p.Glu90*	Somatic	0	40	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	52	8.77	Q5JTK0|Q969W5|Q96A13|Q96GR1|Q96P86|Q96P87	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cell_div_GTP-bd,superfamily_P-loop_NTPase,pirsf_Septin	p.E120*	ENST00000343984.5	37	c.358	CCDS14584.1	X	.	.	.	.	.	.	.	.	.	.	c	39	7.538332	0.98345	.	.	ENSG00000125354	ENST00000360156;ENST00000354228;ENST00000489216;ENST00000354416;ENST00000394610;ENST00000343984;ENST00000394616;ENST00000394617;ENST00000520510	.	.	.	4.58	4.58	0.56647	.	0.092177	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	16.1652	0.81750	0.0:1.0:0.0:0.0	.	.	.	.	X	90;90;90;90;90;90;32;120;90	.	ENSP00000341524:E90X	E	-	1	0	SEPT6	118681546	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	7.439000	0.80444	2.211000	0.71520	0.597000	0.82753	GAG	-	pfam_Cell_div_GTP-bd,superfamily_P-loop_NTPase,pirsf_Septin		0.552	SEPT6-001	KNOWN	basic|CCDS	protein_coding	SEPT6	protein_coding	OTTHUMT00000058059.1	C	NM_145802	-		118797518	-1	no_errors	ENST00000394617	ensembl	human	known	74_37	nonsense	SNP	1.000	A
CDON	50937	genome.wustl.edu	37	11	125831755	125831755	+	Silent	SNP	G	G	T			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr11:125831755G>T	ENST00000392693.3	-	19	3622	c.3495C>A	c.(3493-3495)gtC>gtA	p.V1165V	CDON_ENST00000263577.7_Silent_p.V1165V|CDON_ENST00000531738.1_Silent_p.V542V	NM_001243597.1|NM_016952.4	NP_001230526.1|NP_058648.4	Q4KMG0	CDON_HUMAN	cell adhesion associated, oncogene regulated	1165					anterior/posterior pattern specification (GO:0009952)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cerebral cortex development (GO:0021987)|embryonic body morphogenesis (GO:0010172)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|lens development in camera-type eye (GO:0002088)|muscle cell differentiation (GO:0042692)|myoblast fusion (GO:0007520)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of protein heterodimerization activity (GO:0043497)|skeletal muscle satellite cell differentiation (GO:0014816)|smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(9)|ovary(3)|prostate(2)|skin(4)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	61	all_hematologic(175;0.177)	Breast(109;0.00157)|Lung NSC(97;0.0127)|all_lung(97;0.0133)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.51e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0604)		CACAATCAGGGACTGCGGAAG	0.547																																																	0								ENSG00000064309						96.0	77.0	83.0					11																	125831755		2201	4299	6500	CDON	SO:0001819	synonymous_variant	0			-	HGNC	AF004841	CCDS8468.1, CCDS58192.1	11q24.2	2013-02-11	2012-12-07		ENSG00000064309	ENSG00000064309		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	17104	protein-coding gene	gene with protein product	"""cell adhesion molecule-related/down-regulated by oncogenes"""	608707	"""Cdon homolog (mouse)"""			9214393	Standard	NM_016952		Approved	ORCAM, CDO, CDON1	uc009zbw.3	Q4KMG0	OTTHUMG00000165862	ENST00000392693.3:c.3495C>A	11.37:g.125831755G>T		Somatic	0	28	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	20	16.67	O14631	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.V1165	ENST00000392693.3	37	c.3495	CCDS58192.1	11																																																																																			-	NULL		0.547	CDON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CDON	protein_coding	OTTHUMT00000386749.2	G	NM_016952	-		125831755	-1	no_errors	ENST00000392693	ensembl	human	known	74_37	silent	SNP	0.755	T
AC092364.4	0	genome.wustl.edu	37	19	21880281	21880281	+	RNA	SNP	G	G	A			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr19:21880281G>A	ENST00000579236.1	+	0	73																											gtagagaaacgccacactctg	0.522																																																	0								ENSG00000266008																																			AC092364.4			0			-	Clone_based_ensembl_gene																													19.37:g.21880281G>A		Somatic	0	22	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	6	45.45		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000579236.1	37	NULL		19																																																																																			-	-		0.522	AC092364.4-201	NOVEL	basic	miRNA	ENSG00000266008	miRNA		G		-		21880281	+1	no_errors	ENST00000579236	ensembl	human	novel	74_37	rna	SNP	0.163	A
TEX101	83639	genome.wustl.edu	37	19	43920058	43920058	+	5'UTR	SNP	C	C	A			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr19:43920058C>A	ENST00000598265.1	+	0	153				TEX101_ENST00000602198.1_Missense_Mutation_p.S14Y|TEX101_ENST00000601707.1_3'UTR|TEX101_ENST00000253435.7_Missense_Mutation_p.S14Y	NM_001130011.1	NP_001123483.1	Q9BY14	TX101_HUMAN	testis expressed 101							acrosomal membrane (GO:0002080)|anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				large_intestine(1)|lung(12)|ovary(1)|skin(1)	15		Prostate(69;0.0199)				TCCCAGACCTCTCCAGAAGAA	0.527																																																	0								ENSG00000131126						182.0	177.0	179.0					19																	43920058		2203	4300	6503	TEX101	SO:0001623	5_prime_UTR_variant	0			-	HGNC	AF241268	CCDS12619.1, CCDS59393.1	19q13.31	2013-06-06	2007-03-13			ENSG00000131126			30722	protein-coding gene	gene with protein product	"""cancer/testis antigen 131"", ""spermatogenesis associated 44"""	612665	"""testis expressed sequence 101"""			16388701, 16516155	Standard	NM_031451		Approved	MGC4766, SGRG, CT131, SPATA44	uc010xwo.2	Q9BY14		ENST00000598265.1:c.-14C>A	19.37:g.43920058C>A		Somatic	0	62	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	Q7L5R2|Q9BPY7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_LY6_UPAR	p.S14Y	ENST00000598265.1	37	c.41	CCDS59393.1	19	.	.	.	.	.	.	.	.	.	.	C	13.70	2.316224	0.40996	.	.	ENSG00000131126	ENST00000253435;ENST00000407156	T	0.11385	2.78	3.61	1.28	0.21552	.	1.064920	0.07418	N	0.893529	T	0.23965	0.0580	.	.	.	0.09310	N	1	D	0.89917	1.0	D	0.67382	0.951	T	0.13953	-1.0490	9	0.56958	D	0.05	-1.4809	4.615	0.12422	0.2136:0.6682:0.0:0.1182	.	14	Q9BY14-2	.	Y	14;9	ENSP00000253435:S14Y	ENSP00000253435:S14Y	S	+	2	0	TEX101	48611898	0.126000	0.22350	0.004000	0.12327	0.028000	0.11728	2.019000	0.41001	0.439000	0.26476	0.563000	0.77884	TCT	-	NULL		0.527	TEX101-004	KNOWN	non_canonical_other|basic|CCDS	protein_coding	TEX101	protein_coding	OTTHUMT00000463176.1	C	NM_031451	-		43920058	+1	no_errors	ENST00000253435	ensembl	human	known	74_37	missense	SNP	0.005	A
SLC30A8	169026	genome.wustl.edu	37	8	118147610	118147610	+	Missense_Mutation	SNP	C	C	A			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr8:118147610C>A	ENST00000456015.2	+	1	44	c.44C>A	c.(43-45)gCc>gAc	p.A15D	SLC30A8_ENST00000521035.1_3'UTR|SLC30A8_ENST00000427715.2_5'UTR|SLC30A8_ENST00000521243.1_Intron|SLC30A8_ENST00000519688.1_5'UTR	NM_173851.2	NP_776250.2	Q8IWU4	ZNT8_HUMAN	solute carrier family 30 (zinc transporter), member 8	15					cellular zinc ion homeostasis (GO:0006882)|insulin secretion (GO:0030073)|positive regulation of insulin secretion (GO:0032024)|regulation of sequestering of zinc ion (GO:0061088)|regulation of vesicle-mediated transport (GO:0060627)|response to glucose (GO:0009749)|response to interferon-gamma (GO:0034341)|response to interleukin-1 (GO:0070555)|sequestering of zinc ion (GO:0032119)|transmembrane transport (GO:0055085)|zinc ion transmembrane transport (GO:0071577)|zinc ion transport (GO:0006829)	cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|secretory granule membrane (GO:0030667)	protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)|zinc ion transmembrane transporter activity (GO:0005385)			breast(1)|endometrium(2)|large_intestine(9)|liver(2)|lung(18)|ovary(2)|pancreas(2)|skin(5)	41	all_cancers(13;2.11e-22)|Lung NSC(37;6.08e-05)|Ovarian(258;0.0173)		STAD - Stomach adenocarcinoma(47;0.203)			GATAAAGCTGCCAAGATGTAT	0.418																																					Ovarian(162;1202 1922 6011 16223 52092)												0								ENSG00000164756						210.0	199.0	203.0					8																	118147610		2203	4299	6502	SLC30A8	SO:0001583	missense	0			-	HGNC		CCDS6322.1, CCDS55272.1	8q24.11	2014-08-12			ENSG00000164756			"""Solute carriers"""	20303	protein-coding gene	gene with protein product		611145					Standard	NM_001172811		Approved		uc003yoh.3	Q8IWU4	OTTHUMG00000164962	ENST00000456015.2:c.44C>A	8.37:g.118147610C>A	ENSP00000415011:p.Ala15Asp	Somatic	0	26	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	72	15.29	A0AVP9|A5YM39|B4DPE0|Q8TCL3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cation_efflux,tigrfam_Cation_efflux	p.A15D	ENST00000456015.2	37	c.44	CCDS6322.1	8	.	.	.	.	.	.	.	.	.	.	C	11.09	1.535905	0.27475	.	.	ENSG00000164756	ENST00000456015	T	0.67865	-0.29	5.64	4.77	0.60923	.	0.390908	0.25114	N	0.033038	T	0.43634	0.1256	N	0.08118	0	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.28618	-1.0038	10	0.24483	T	0.36	-14.3176	9.9637	0.41712	0.0:0.8403:0.0:0.1597	.	15	Q8IWU4	ZNT8_HUMAN	D	15	ENSP00000415011:A15D	ENSP00000415011:A15D	A	+	2	0	SLC30A8	118216791	1.000000	0.71417	1.000000	0.80357	0.284000	0.27059	2.212000	0.42835	1.389000	0.46526	0.655000	0.94253	GCC	-	NULL		0.418	SLC30A8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC30A8	protein_coding	OTTHUMT00000381205.1	C	NM_173851	-		118147610	+1	no_errors	ENST00000456015	ensembl	human	known	74_37	missense	SNP	1.000	A
CTTN	2017	genome.wustl.edu	37	11	70281823	70281823	+	3'UTR	SNP	G	G	A			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr11:70281823G>A	ENST00000301843.8	+	0	2414				CTTN_ENST00000346329.3_3'UTR|CTTN_ENST00000538675.1_Missense_Mutation_p.C305Y|CTTN_ENST00000376561.3_Missense_Mutation_p.C584Y	NM_005231.3	NP_005222.2	Q14247	SRC8_HUMAN	cortactin						negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|mitotic spindle midzone (GO:1990023)|ruffle (GO:0001726)				breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(14)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(1)	31			BRCA - Breast invasive adenocarcinoma(2;4.34e-41)|LUSC - Lung squamous cell carcinoma(11;1.51e-13)|STAD - Stomach adenocarcinoma(18;0.0513)	Lung(977;0.0234)|LUSC - Lung squamous cell carcinoma(976;0.133)		ATCTGCCTATGTCATACCGTG	0.562																																																	0								ENSG00000085733						39.0	36.0	37.0					11																	70281823		873	1985	2858	CTTN	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AJ288897	CCDS8197.1, CCDS41680.1, CCDS53676.1	11q13	2008-02-05	2004-06-08	2004-06-09	ENSG00000085733	ENSG00000085733			3338	protein-coding gene	gene with protein product		164765	"""ems1 sequence (mammary tumor and squamous cell carcinoma-associated (p80/85 src substrate)"""	EMS1		7685625	Standard	NM_005231		Approved		uc001opu.3	Q14247	OTTHUMG00000134307	ENST00000301843.8:c.*555G>A	11.37:g.70281823G>A		Somatic	0	105	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	33	56	37.08	Q8N707|Q96H99	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SH3_domain,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain	p.C305Y	ENST00000301843.8	37	c.914	CCDS41680.1	11	.	.	.	.	.	.	.	.	.	.	G	4.729	0.135612	0.09032	.	.	ENSG00000085733	ENST00000376561;ENST00000538675	T;T	0.36157	1.27;1.49	3.73	-7.46	0.01369	.	.	.	.	.	T	0.13927	0.0337	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.28396	-1.0045	9	0.87932	D	0	.	2.4196	0.04445	0.1091:0.3516:0.274:0.2653	.	305;584	B4E358;Q8N707	.;.	Y	584;305	ENSP00000365745:C584Y;ENSP00000439762:C305Y	ENSP00000365745:C584Y	C	+	2	0	CTTN	69959471	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.776000	0.04674	-4.185000	0.00066	-0.181000	0.13052	TGT	-	NULL		0.562	CTTN-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CTTN	protein_coding	OTTHUMT00000259233.2	G	NM_138565	-		70281823	+1	no_errors	ENST00000538675	ensembl	human	known	74_37	missense	SNP	0.000	A
ARHGAP23P1	102577425	genome.wustl.edu	37	16	33739328	33739328	+	RNA	SNP	C	C	A			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr16:33739328C>A	ENST00000567025.1	-	0	215									Rho GTPase activating protein 23 pseudogene 1																		CAGGGACATGCTTGGCTTGGA	0.612																																																	0								ENSG00000260781																																			ARHGAP23P1			0			-	HGNC			16p11.2	2013-01-23			ENSG00000260781	ENSG00000260781			45039	pseudogene	pseudogene							Standard	NG_033847		Approved				OTTHUMG00000176364		16.37:g.33739328C>A		Somatic	0	108	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	62	15.07		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000567025.1	37	NULL		16																																																																																			-	-		0.612	ARHGAP23P1-002	KNOWN	basic	processed_transcript	ARHGAP23P1	pseudogene	OTTHUMT00000431823.1	C		-		33739328	-1	no_errors	ENST00000567025	ensembl	human	known	74_37	rna	SNP	0.998	A
COX10	1352	genome.wustl.edu	37	17	14080531	14080531	+	Intron	SNP	G	G	T			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr17:14080531G>T	ENST00000261643.3	+	6	772				COX10_ENST00000536205.1_Intron|COX10_ENST00000537334.1_Intron|SNORA74_ENST00000516496.1_RNA	NM_001303.3	NP_001294.2	Q12887	COX10_HUMAN	cytochrome c oxidase assembly homolog 10 (yeast)						aerobic respiration (GO:0009060)|cellular respiration (GO:0045333)|heme a biosynthetic process (GO:0006784)|heme biosynthetic process (GO:0006783)|heme O biosynthetic process (GO:0048034)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, cytochrome c to oxygen (GO:0006123)|mitochondrial fission (GO:0000266)|porphyrin-containing compound metabolic process (GO:0006778)|respiratory chain complex IV assembly (GO:0008535)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	farnesyltranstransferase activity (GO:0004311)|protoheme IX farnesyltransferase activity (GO:0008495)			cervix(1)|endometrium(3)|large_intestine(2)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	14		all_lung(20;0.06)|Lung SC(565;0.168)		UCEC - Uterine corpus endometrioid carcinoma (92;0.106)		CACTGTTCTAGGGGCTTCTGG	0.522																																																	0								ENSG00000252305																																			SNORA74	SO:0001627	intron_variant	0			-	RFAM	U09466	CCDS11166.1	17p12	2013-05-24	2012-10-15		ENSG00000006695	ENSG00000006695		"""Mitochondrial respiratory chain complex assembly factors"""	2260	protein-coding gene	gene with protein product	"""heme A: farnesyltransferase"", ""protoheme IX farnesyltransferase, mitochondrial"", ""heme O synthase"""	602125	"""COX10 (yeast) homolog, cytochrome c oxidase assembly protein (heme A: farnesyltransferase)"", ""COX10 homolog, cytochrome c oxidase assembly protein, heme A: farnesyltransferase (yeast)"""			9177788, 12928484	Standard	NM_001303		Approved		uc002gof.4	Q12887	OTTHUMG00000058814	ENST00000261643.3:c.696-14775G>T	17.37:g.14080531G>T		Somatic	0	10	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	14	22.22	B2R6U5|B4DJ50|O15334|Q969F7	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000261643.3	37	NULL	CCDS11166.1	17																																																																																			-	-		0.522	COX10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000252305	protein_coding	OTTHUMT00000130003.1	G	NM_001303	-		14080531	+1	no_errors	ENST00000516496	ensembl	human	novel	74_37	rna	SNP	0.074	T
KIAA0430	9665	genome.wustl.edu	37	16	15696480	15696481	+	Intron	INS	-	-	AGGAAAGAAGGAGGGAGGCAGAG	rs373385405|rs373082870|rs79821793|rs71293163	byFrequency	TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr16:15696480_15696481insAGGAAAGAAGGAGGGAGGCAGAG	ENST00000396368.3	-	23	4620				KIAA0430_ENST00000551742.1_Intron|KIAA0430_ENST00000547936.1_Intron|KIAA0430_ENST00000602337.1_Intron|KIAA0430_ENST00000548025.1_Intron|KIAA0430_ENST00000344181.3_Frame_Shift_Ins_p.-1113fs|KIAA0430_ENST00000540441.2_Intron	NM_001184998.1|NM_001184999.1|NM_014647.3	NP_001171927.1|NP_001171928.1|NP_055462.2	Q9Y4F3	MARF1_HUMAN	KIAA0430						double-strand break repair (GO:0006302)|female meiotic division (GO:0007143)|negative regulation of phosphatase activity (GO:0010923)|oogenesis (GO:0048477)|regulation of gene expression (GO:0010468)	membrane (GO:0016020)|peroxisome (GO:0005777)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(4)|endometrium(8)|kidney(4)|large_intestine(2)|lung(13)|ovary(3)|prostate(5)|skin(1)	40						gaggaggaggaaggaaagaagg	0.406														4802	0.958866	0.9955	0.9294	5008	,	,		23942	0.998		0.8777	False		,,,				2504	0.9734																0								ENSG00000166783																																			KIAA0430	SO:0001627	intron_variant	0				HGNC	AB007890	CCDS10562.2, CCDS53990.1, CCDS55991.1	16p13.11	2013-01-11			ENSG00000166783	ENSG00000166783		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	29562	protein-coding gene	gene with protein product	"""limkain b1"", ""protein phosphatase 1, regulatory subunit 34"", ""meiosis arrest female 1"""	614593				9455477, 10493829, 15932519, 22442484, 23090997	Standard	NM_014647		Approved	LKAP, PPP1R34, Marf1	uc010uzw.2	Q9Y4F3	OTTHUMG00000129884	ENST00000396368.3:c.4414-420->CTCTGCCTCCCTCCTTCTTTCCT	16.37:g.15696480_15696481insAGGAAAGAAGGAGGGAGGCAGAG		Somatic	NA	NA	NA		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A8MSK2|B2RNX2|B4DYY9|B7ZMG1|B7ZMG2|F8VV09|Q6P1R6|Q8WYR2|Q9Y4J9	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_Limkain_b1_cons_dom,pfam_NYN_limkain-b1,smart_RRM_dom,pfscan_RRM_dom	p.P1114fs	ENST00000396368.3	37	c.3339_3338	CCDS10562.2	16																																																																																			-	NULL		0.406	KIAA0430-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA0430	protein_coding	OTTHUMT00000252131.2	-	NM_014647			15696481	-1	no_errors	ENST00000344181	ensembl	human	known	74_37	frame_shift_ins	INS	0.000:0.000	AGGAAAGAAGGAGGGAGGCAGAG
NAPA	8775	genome.wustl.edu	37	19	47998796	47998796	+	Intron	SNP	G	G	T			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr19:47998796G>T	ENST00000263354.3	-	4	642				NAPA-AS1_ENST00000594367.1_RNA|NAPA_ENST00000593785.1_5'Flank|NAPA_ENST00000595227.1_Intron|NAPA-AS1_ENST00000593284.1_RNA	NM_003827.3	NP_003818.2	P54920	SNAA_HUMAN	N-ethylmaleimide-sensitive factor attachment protein, alpha						apical protein localization (GO:0045176)|brain development (GO:0007420)|intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|membrane organization (GO:0061024)|neuron differentiation (GO:0030182)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of synaptic vesicle priming (GO:0010807)|SNARE complex disassembly (GO:0035494)|synaptic transmission, glutamatergic (GO:0035249)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|synaptobrevin 2-SNAP-25-syntaxin-1a complex (GO:0070044)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(3)	11		all_cancers(25;1.55e-10)|all_epithelial(76;3.4e-08)|all_lung(116;1.73e-07)|Lung NSC(112;3.95e-07)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		OV - Ovarian serous cystadenocarcinoma(262;0.000466)|all cancers(93;0.000739)|Epithelial(262;0.0168)|GBM - Glioblastoma multiforme(486;0.049)		GGACAAGCAAGCAGCCCTTAC	0.547																																					Ovarian(185;1135 2042 27703 31345 42493)												0								ENSG00000268061						170.0	151.0	157.0					19																	47998796		2203	4300	6503	NAPA-AS1	SO:0001627	intron_variant	0			-	HGNC	U39412	CCDS12702.1	19q13.33	2012-08-16			ENSG00000105402	ENSG00000105402			7641	protein-coding gene	gene with protein product	"""alpha SNAP"""	603215				9269766	Standard	NM_003827		Approved		uc002pha.2	P54920		ENST00000263354.3:c.342+10C>A	19.37:g.47998796G>T		Somatic	0	91	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	33	10.81	A8K879|Q96IK3|Q9BVJ3	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000263354.3	37	NULL	CCDS12702.1	19																																																																																			-	-		0.547	NAPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAPA-AS1	protein_coding	OTTHUMT00000466048.2	G	NM_003827	-		47998796	+1	no_errors	ENST00000593284	ensembl	human	known	74_37	rna	SNP	0.000	T
ZFYVE19	84936	genome.wustl.edu	37	15	41101252	41101252	+	Intron	SNP	G	G	T			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr15:41101252G>T	ENST00000355341.4	+	2	780				ZFYVE19_ENST00000336455.5_Intron|ZFYVE19_ENST00000564258.1_Intron|ZFYVE19_ENST00000563530.1_3'UTR|DNAJC17_ENST00000220496.4_5'Flank|ZFYVE19_ENST00000570108.1_Intron|ZFYVE19_ENST00000299173.10_Intron	NM_001077268.1	NP_001070736.1	Q96K21	ANCHR_HUMAN	zinc finger, FYVE domain containing 19						abscission (GO:0009838)|cell division (GO:0051301)|cytokinesis checkpoint (GO:0031565)|negative regulation of cytokinesis (GO:0032466)	centrosome (GO:0005813)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|midbody (GO:0030496)	phosphatidylinositol-3-phosphate binding (GO:0032266)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	9		all_cancers(109;3.31e-18)|all_epithelial(112;2.33e-15)|Lung NSC(122;5.34e-11)|all_lung(180;1.33e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;2.76e-05)|COAD - Colon adenocarcinoma(120;0.151)|BRCA - Breast invasive adenocarcinoma(123;0.164)		TGTGCTTGGAGAGTCCCTGGG	0.557																																																	0								ENSG00000166140																																			ZFYVE19	SO:0001627	intron_variant	0			-	HGNC	AK027746	CCDS42025.1, CCDS58353.1, CCDS58354.1, CCDS58355.1	15q14	2008-05-02				ENSG00000166140		"""Zinc fingers, FYVE domain containing"""	20758	protein-coding gene	gene with protein product							Standard	NM_001077268		Approved	FLJ14840	uc031qrk.1	Q96K21		ENST00000355341.4:c.280-65G>T	15.37:g.41101252G>T		Somatic	0	66	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51	B3KVB2|C9JNF4|H3BUF9|Q86WC2|Q8WU96	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000355341.4	37	NULL	CCDS42025.1	15																																																																																			-	-		0.557	ZFYVE19-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZFYVE19	protein_coding	OTTHUMT00000418996.1	G	NM_032850	-		41101252	+1	no_errors	ENST00000563530	ensembl	human	known	74_37	rna	SNP	0.190	T
MTFMT	123263	genome.wustl.edu	37	15	65295423	65295423	+	Missense_Mutation	SNP	C	C	A			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr15:65295423C>A	ENST00000220058.4	-	9	1160	c.1147G>T	c.(1147-1149)Gct>Tct	p.A383S		NM_139242.3	NP_640335.2	Q96DP5	FMT_HUMAN	mitochondrial methionyl-tRNA formyltransferase	383						mitochondrion (GO:0005739)	methionyl-tRNA formyltransferase activity (GO:0004479)			endometrium(1)|large_intestine(3)|lung(3)|ovary(3)	10					Tetrahydrofolic acid(DB00116)	TGTTGCATAGCAACAGTTTTT	0.353																																																	0								ENSG00000103707						110.0	97.0	101.0					15																	65295423		1825	4083	5908	MTFMT	SO:0001583	missense	0			-	HGNC	AK055688	CCDS45280.1	15q22.31	2006-11-29		2005-08-09		ENSG00000103707			29666	protein-coding gene	gene with protein product		611766				9614118	Standard	NM_139242		Approved	FMT1	uc002aof.4	Q96DP5		ENST00000220058.4:c.1147G>T	15.37:g.65295423C>A	ENSP00000220058:p.Ala383Ser	Somatic	0	49	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	33	21.43	B7Z734	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Formyl_transf_N,pfam_Formyl_trans_C,superfamily_Formyl_transf_N,superfamily_Formyl_transferase_C-like,tigrfam_Fmt	p.A383S	ENST00000220058.4	37	c.1147	CCDS45280.1	15	.	.	.	.	.	.	.	.	.	.	C	0.761	-0.769382	0.02974	.	.	ENSG00000103707	ENST00000220058	T	0.63255	-0.03	5.65	4.73	0.59995	.	0.466252	0.21179	N	0.078856	T	0.45438	0.1342	N	0.12182	0.205	0.22050	N	0.999394	P	0.36144	0.539	B	0.33454	0.164	T	0.39901	-0.9591	10	0.72032	D	0.01	-5.667	15.2689	0.73683	0.0:0.9257:0.0:0.0743	.	383	Q96DP5	FMT_HUMAN	S	383	ENSP00000220058:A383S	ENSP00000220058:A383S	A	-	1	0	MTFMT	63082476	1.000000	0.71417	0.999000	0.59377	0.033000	0.12548	2.128000	0.42045	0.858000	0.35431	-0.813000	0.03139	GCT	-	NULL		0.353	MTFMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTFMT	protein_coding	OTTHUMT00000418155.1	C	NM_139242	-		65295423	-1	no_errors	ENST00000220058	ensembl	human	known	74_37	missense	SNP	1.000	A
SCN9A	6335	genome.wustl.edu	37	2	167138320	167138321	+	Splice_Site	INS	-	-	A	rs35888674|rs202239471	byFrequency	TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr2:167138320_167138321insA	ENST00000409435.1	-	12	1974		c.e12-2		SCN9A_ENST00000409672.1_Splice_Site|AC010127.3_ENST00000447809.2_RNA|SCN9A_ENST00000375387.4_Splice_Site|SCN9A_ENST00000303354.6_Splice_Site			Q15858	SCN9A_HUMAN	sodium channel, voltage-gated, type IX, alpha subunit						behavioral response to pain (GO:0048266)|inflammatory response (GO:0006954)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|post-embryonic development (GO:0009791)|response to toxic substance (GO:0009636)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	sodium ion binding (GO:0031402)|voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(5)|central_nervous_system(6)|endometrium(6)|kidney(3)|large_intestine(27)|lung(38)|ovary(6)|prostate(8)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	108					Lacosamide(DB06218)|Lidocaine(DB00281)|Ranolazine(DB00243)|Rufinamide(DB06201)|Valproic Acid(DB00313)|Zonisamide(DB00909)	GGTCGTGCCCTAAAAAAAAAAT	0.337													|||unknown(HR)	286	0.0571086	0.0772	0.0375	5008	,	,		20055	0.0308		0.0835	False		,,,				2504	0.044																0								ENSG00000169432																																			SCN9A	SO:0001630	splice_region_variant	0				HGNC	X82835	CCDS46441.1	2q24	2014-09-17	2007-01-23		ENSG00000169432	ENSG00000169432		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10597	protein-coding gene	gene with protein product		603415	"""sodium channel, voltage-gated, type IX, alpha polypeptide"""			7720699, 10198179, 16382098	Standard	NM_002977		Approved	Nav1.7, PN1, NE-NA, NENA, ETHA	uc010fpl.3	Q15858	OTTHUMG00000154044	ENST00000409435.1:c.1975-2->T	2.37:g.167138330_167138330dupA		Somatic	0	22	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	13	23.53	A1BUH5|Q6B4R9|Q6B4S0|Q6B4S1|Q70HX1|Q70HX2|Q8WTU1|Q8WWN4	Splice_Site	INS	NA	NA	NA	NA	NA	NA	-	e12-2	ENST00000409435.1	37	c.1978-3_1978-2	CCDS46441.1	2																																																																																			-	-		0.337	SCN9A-004	KNOWN	basic|CCDS	protein_coding	SCN9A	protein_coding	OTTHUMT00000333639.1	-	NM_002977		Intron	167138321	-1	no_errors	ENST00000303354	ensembl	human	known	74_37	splice_site_ins	INS	1.000:0.002	A
PAGR1	79447	genome.wustl.edu	37	16	29828598	29828598	+	Silent	SNP	C	C	A			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr16:29828598C>A	ENST00000320330.6	+	2	1112	c.550C>A	c.(550-552)Cgg>Agg	p.R184R	AC009133.20_ENST00000569039.1_RNA|AC009133.12_ENST00000569809.1_RNA|PAGR1_ENST00000609618.1_Silent_p.R184R|AC009133.12_ENST00000564980.1_RNA			Q9BTK6	PAGR1_HUMAN	PAXIP1 associated glutamate-rich protein 1	184						histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)											CCTGATTGACCGGAGACGCAC	0.547											OREG0023722	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000263136						111.0	89.0	97.0					16																	29828598		2197	4300	6497	PAGR1	SO:0001819	synonymous_variant	0			-	Uniprot_gn	BC003640	CCDS10655.1	16p11.2	2012-10-12	2012-10-12	2012-10-12	ENSG00000185928	ENSG00000185928			28707	protein-coding gene	gene with protein product	"""glutamate-rich coactivator interacting with SRC1/NCOA1"", ""PTIP-associated 1 protein"", ""glutamate-rich coactivator associated with SRC1"""	612033	"""chromosome 16 open reading frame 53"""	C16orf53		17500065, 19039327	Standard	NM_024516		Approved	MGC4606, GAS, PA1	uc002dug.4	Q9BTK6	OTTHUMG00000132117	ENST00000320330.6:c.550C>A	16.37:g.29828598C>A		Somatic	0	73	0.00	812	0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	41	8.89	A2ICR6	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.R184	ENST00000320330.6	37	c.550	CCDS10655.1	16																																																																																			-	NULL		0.547	PAGR1-002	PUTATIVE	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	PAGR1	protein_coding	OTTHUMT00000473165.1	C	NM_024516	-		29828598	+1	no_errors	ENST00000609618	ensembl	human	known	74_37	silent	SNP	1.000	A
GRIK2	2898	genome.wustl.edu	37	6	102250236	102250236	+	Missense_Mutation	SNP	A	A	G			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr6:102250236A>G	ENST00000421544.1	+	8	1616	c.1126A>G	c.(1126-1128)Act>Gct	p.T376A	GRIK2_ENST00000318991.6_Missense_Mutation_p.T376A|GRIK2_ENST00000369138.1_Missense_Mutation_p.T376A|GRIK2_ENST00000413795.1_Missense_Mutation_p.T376A|GRIK2_ENST00000369137.3_Missense_Mutation_p.T376A|GRIK2_ENST00000369134.4_Missense_Mutation_p.T327A	NM_021956.4	NP_068775.1	Q13002	GRIK2_HUMAN	glutamate receptor, ionotropic, kainate 2	376					behavioral fear response (GO:0001662)|cellular calcium ion homeostasis (GO:0006874)|glutamate receptor signaling pathway (GO:0007215)|intracellular protein transport (GO:0006886)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|neuronal action potential (GO:0019228)|positive regulation of synaptic transmission (GO:0050806)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission (GO:0050804)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(37)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83		all_cancers(76;1.19e-07)|Acute lymphoblastic leukemia(125;6.17e-11)|all_hematologic(75;6.01e-08)|all_epithelial(87;0.0121)|Colorectal(196;0.14)		all cancers(137;0.112)|BRCA - Breast invasive adenocarcinoma(108;0.124)|GBM - Glioblastoma multiforme(226;0.206)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)	AGGCAGAATAACTTTCAACAA	0.348																																																	0								ENSG00000164418						115.0	116.0	115.0					6																	102250236		2203	4299	6502	GRIK2	SO:0001583	missense	0			-	HGNC		CCDS5048.1, CCDS5049.1, CCDS55045.1	6q16.3	2012-08-29			ENSG00000164418	ENSG00000164418		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4580	protein-coding gene	gene with protein product		138244		GLUR6		8034316	Standard	NM_021956		Approved	GluK2, MRT6	uc003pqp.4	Q13002	OTTHUMG00000016328	ENST00000421544.1:c.1126A>G	6.37:g.102250236A>G	ENSP00000397026:p.Thr376Ala	Somatic	0	39	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	34	38	47.22	A6NMY9|B5MCV0|D7RWZ3|D7RWZ4|D7RWZ5|D7RWZ6|D7RWZ7|Q8WWS1|Q96KS6|Q96KS7|Q96KS8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.T376A	ENST00000421544.1	37	c.1126	CCDS5048.1	6	.	.	.	.	.	.	.	.	.	.	A	9.980	1.227841	0.22542	.	.	ENSG00000164418	ENST00000421544;ENST00000413795;ENST00000369138;ENST00000369137;ENST00000318991;ENST00000403289;ENST00000369134;ENST00000540076;ENST00000455610	D;D;D;D;D;D;D	0.82803	-1.65;-1.65;-1.65;-1.65;-1.65;-1.65;-1.65	5.61	5.61	0.85477	Extracellular ligand-binding receptor (1);	0.249412	0.39544	N	0.001329	T	0.54255	0.1847	N	0.14661	0.345	0.33887	D	0.636911	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.12156	0.007;0.007;0.004	T	0.47129	-0.9141	10	0.11794	T	0.64	.	15.8049	0.78491	1.0:0.0:0.0:0.0	.	376;376;376	Q13002-5;Q13002;Q13002-2	.;GRIK2_HUMAN;.	A	376;376;376;376;376;376;327;338;89	ENSP00000397026:T376A;ENSP00000405596:T376A;ENSP00000358134:T376A;ENSP00000358133:T376A;ENSP00000313276:T376A;ENSP00000358130:T327A;ENSP00000391988:T89A	ENSP00000313276:T376A	T	+	1	0	GRIK2	102356929	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.358000	0.59442	2.127000	0.65507	0.445000	0.29226	ACT	-	pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I		0.348	GRIK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIK2	protein_coding	OTTHUMT00000043718.1	A		-		102250236	+1	no_errors	ENST00000421544	ensembl	human	known	74_37	missense	SNP	1.000	G
HEXDC	284004	genome.wustl.edu	37	17	80400419	80400419	+	3'UTR	SNP	A	A	G			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr17:80400419A>G	ENST00000327949.9	+	0	1631				HEXDC_ENST00000337014.6_Missense_Mutation_p.E570G|HEXDC_ENST00000577944.1_Missense_Mutation_p.R543G			Q8WVB3	HEXDC_HUMAN	hexosaminidase (glycosyl hydrolase family 20, catalytic domain) containing						carbohydrate metabolic process (GO:0005975)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	beta-N-acetylhexosaminidase activity (GO:0004563)			breast(1)|endometrium(1)|kidney(3)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)|skin(1)	16	Breast(20;0.00106)|all_neural(118;0.0804)		OV - Ovarian serous cystadenocarcinoma(97;0.0143)|BRCA - Breast invasive adenocarcinoma(99;0.0369)			CCCCTGGGGGAGAGACTAGAA	0.582																																																	0								ENSG00000169660						72.0	82.0	79.0					17																	80400419		1960	4155	6115	HEXDC	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AK074405	CCDS42402.1	17q25.3	2011-12-19			ENSG00000169660	ENSG00000169660			26307	protein-coding gene	gene with protein product						12477932	Standard	NM_173620		Approved	FLJ23825	uc002kev.4	Q8WVB3		ENST00000327949.9:c.*159A>G	17.37:g.80400419A>G		Somatic	0	76	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	48	9.43	B7UUP6|Q8IYN4|Q8TE81	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Glyco_hydro_20_cat-core,superfamily_Glycoside_hydrolase_SF	p.E570G	ENST00000327949.9	37	c.1709		17	.	.	.	.	.	.	.	.	.	.	A	3.856	-0.030934	0.07543	.	.	ENSG00000169660	ENST00000337014	T	0.39229	1.09	3.14	-6.28	0.02020	.	2581.410000	0.00357	N	0.000023	T	0.26448	0.0646	.	.	.	0.09310	N	0.999999	B	0.02656	0.0	B	0.04013	0.001	T	0.10590	-1.0623	9	0.87932	D	0	.	1.0689	0.01617	0.467:0.119:0.1752:0.2388	.	570	Q8WVB3-2	.	G	570	ENSP00000337854:E570G	ENSP00000337854:E570G	E	+	2	0	HEXDC	77993708	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.906000	0.01590	-2.174000	0.00772	-1.288000	0.01363	GAG	-	NULL		0.582	HEXDC-003	KNOWN	basic|appris_principal	protein_coding	HEXDC	protein_coding	OTTHUMT00000443513.1	A	NM_173620	-		80400419	+1	no_errors	ENST00000337014	ensembl	human	known	74_37	missense	SNP	0.000	G
SPTB	6710	genome.wustl.edu	37	14	65260164	65260164	+	Silent	SNP	G	G	T			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr14:65260164G>T	ENST00000389721.5	-	13	2249	c.2217C>A	c.(2215-2217)ctC>ctA	p.L739L	SPTB_ENST00000556626.1_Silent_p.L739L|SPTB_ENST00000542895.1_Silent_p.L739L|SPTB_ENST00000389720.3_Silent_p.L739L|SPTB_ENST00000389722.3_Silent_p.L739L	NM_000347.5	NP_000338.3	P11277	SPTB1_HUMAN	spectrin, beta, erythrocytic	739					actin filament capping (GO:0051693)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)	actin cytoskeleton (GO:0015629)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ankyrin binding (GO:0030506)|structural constituent of cytoskeleton (GO:0005200)			breast(5)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(36)|ovary(8)|pancreas(1)|prostate(4)|skin(10)|urinary_tract(3)	106		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)		CAGCATCCTGGAGGTTCTTCT	0.597																																																	0								ENSG00000070182						48.0	47.0	47.0					14																	65260164		2203	4300	6503	SPTB	SO:0001819	synonymous_variant	0			-	HGNC		CCDS32099.1, CCDS32100.1	14q24.1-q24.2	2013-01-10	2008-07-29			ENSG00000070182		"""Pleckstrin homology (PH) domain containing"""	11274	protein-coding gene	gene with protein product	"""spherocytosis, clinical type I"""	182870				2209094	Standard	NM_001024858		Approved		uc001xhr.3	P11277		ENST00000389721.5:c.2217C>A	14.37:g.65260164G>T		Somatic	0	55	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	30	11.76	Q15510|Q15519	Silent	SNP	NA	NA	NA	NA	NA	NA	pirsf_Spectrin_bsu,pfam_Spectrin_repeat,pfam_CH-domain,pfam_CAMSAP_CH,pfam_Pleckstrin_homology,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Pleckstrin_homology,prints_PH_dom-spectrin-type,pfscan_CH-domain,pfscan_Pleckstrin_homology	p.L739	ENST00000389721.5	37	c.2217	CCDS32100.1	14																																																																																			-	pirsf_Spectrin_bsu,pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin		0.597	SPTB-004	KNOWN	basic|CCDS	protein_coding	SPTB	protein_coding	OTTHUMT00000414080.1	G		-		65260164	-1	no_errors	ENST00000389722	ensembl	human	known	74_37	silent	SNP	1.000	T
TNFRSF21	27242	genome.wustl.edu	37	6	47202418	47202418	+	Missense_Mutation	SNP	A	A	G			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr6:47202418A>G	ENST00000296861.2	-	5	2119	c.1726T>C	c.(1726-1728)Ttt>Ctt	p.F576L		NM_014452.3	NP_055267.1	O75509	TNR21_HUMAN	tumor necrosis factor receptor superfamily, member 21	576					adaptive immune response (GO:0002250)|apoptotic process (GO:0006915)|B cell apoptotic process (GO:0001783)|cellular lipid metabolic process (GO:0044255)|cellular response to tumor necrosis factor (GO:0071356)|humoral immune response (GO:0006959)|myelination (GO:0042552)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of interleukin-10 secretion (GO:2001180)|negative regulation of interleukin-13 secretion (GO:2000666)|negative regulation of interleukin-5 secretion (GO:2000663)|negative regulation of myelination (GO:0031642)|negative regulation of T cell proliferation (GO:0042130)|neuron apoptotic process (GO:0051402)|oligodendrocyte apoptotic process (GO:0097252)|regulation of oligodendrocyte differentiation (GO:0048713)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|lung(7)|pancreas(1)|skin(2)	21			Lung(136;0.189)			TTGGTAATAAAGGAACCGTTC	0.582																																																	0								ENSG00000146072						44.0	43.0	43.0					6																	47202418		2203	4300	6503	TNFRSF21	SO:0001583	missense	0			-	HGNC	AF068868	CCDS4921.1	6p21.1	2011-08-11			ENSG00000146072	ENSG00000146072		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	13469	protein-coding gene	gene with protein product	"""death receptor 6"""	605732				9714541	Standard	NM_014452		Approved	DR6, CD358	uc003oyv.3	O75509	OTTHUMG00000014796	ENST00000296861.2:c.1726T>C	6.37:g.47202418A>G	ENSP00000296861:p.Phe576Leu	Somatic	0	36	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	58	18.31	B2RDI9|Q0D2P5|Q96D86	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Death_domain,superfamily_DEATH-like_dom,smart_TNFR/NGFR_Cys_rich_reg,smart_Death_domain,pfscan_Death_domain,pfscan_TNFR/NGFR_Cys_rich_reg,prints_TNFR_21	p.F576L	ENST00000296861.2	37	c.1726	CCDS4921.1	6	.	.	.	.	.	.	.	.	.	.	A	34	5.332286	0.95733	.	.	ENSG00000146072	ENST00000296861;ENST00000419206	T	0.74421	-0.84	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.74801	0.3764	L	0.29908	0.895	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.80039	-0.1549	10	0.87932	D	0	.	15.5142	0.75809	1.0:0.0:0.0:0.0	.	576	O75509	TNR21_HUMAN	L	576;265	ENSP00000296861:F576L	ENSP00000296861:F576L	F	-	1	0	TNFRSF21	47310377	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	9.278000	0.95766	2.129000	0.65627	0.529000	0.55759	TTT	-	NULL		0.582	TNFRSF21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFRSF21	protein_coding	OTTHUMT00000040814.1	A	NM_014452	-		47202418	-1	no_errors	ENST00000296861	ensembl	human	known	74_37	missense	SNP	1.000	G
POLL	27343	genome.wustl.edu	37	10	103344559	103344559	+	Missense_Mutation	SNP	G	G	T			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr10:103344559G>T	ENST00000370162.3	-	5	1185	c.691C>A	c.(691-693)Cca>Aca	p.P231T	POLL_ENST00000463515.1_5'Flank|POLL_ENST00000436284.2_Silent_p.A88A|POLL_ENST00000456836.2_Intron|POLL_ENST00000339310.3_Intron|POLL_ENST00000370172.1_Missense_Mutation_p.P143T|POLL_ENST00000299206.4_Missense_Mutation_p.P231T|POLL_ENST00000370158.3_Intron|DPCD_ENST00000470165.1_Intron|DPCD_ENST00000416979.2_Intron|POLL_ENST00000370169.1_Missense_Mutation_p.P231T|POLL_ENST00000370168.3_5'Flank	NM_001174084.1|NM_001174085.1|NM_013274.3	NP_001167555.1|NP_001167556.1|NP_037406.1	Q9UGP5	DPOLL_HUMAN	polymerase (DNA directed), lambda	231					DNA replication (GO:0006260)|DNA-dependent DNA replication (GO:0006261)|nucleotide-excision repair (GO:0006289)|somatic hypermutation of immunoglobulin genes (GO:0016446)	nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|lyase activity (GO:0016829)|metal ion binding (GO:0046872)			biliary_tract(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(2)|lung(7)|upper_aerodigestive_tract(2)	19		Colorectal(252;0.234)		Epithelial(162;1.55e-08)|all cancers(201;6.64e-07)		GCAGGGGCTGGGCTAGGCTCA	0.567								DNA polymerases (catalytic subunits)																																									0								ENSG00000166169						57.0	54.0	55.0					10																	103344559		2203	4300	6503	POLL	SO:0001583	missense	0			-	HGNC	AF161019	CCDS7513.1	10q23	2012-05-18			ENSG00000166169	ENSG00000166169		"""DNA polymerases"""	9184	protein-coding gene	gene with protein product		606343				17686665	Standard	NM_001174084		Approved		uc001kti.2	Q9UGP5	OTTHUMG00000018933	ENST00000370162.3:c.691C>A	10.37:g.103344559G>T	ENSP00000359181:p.Pro231Thr	Somatic	0	32	0.00		0.5891460601327555	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	12	20.00	D3DR76|Q5JQP5|Q6NUM2|Q9BTN8|Q9HA10|Q9HB35	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DNA_pol_lambd_fingers_domain,superfamily_DNA_pol_b-like_N,superfamily_DNA_pol_lambd_fingers_domain,superfamily_BRCT_dom,smart_DNA-dir_DNA_pol_X,pfscan_BRCT_dom,prints_DNA_pol_X_beta-like,prints_DNA_pol_X	p.P231T	ENST00000370162.3	37	c.691	CCDS7513.1	10	.	.	.	.	.	.	.	.	.	.	G	6.700	0.497779	0.12762	.	.	ENSG00000166169	ENST00000299206;ENST00000370174;ENST00000370169;ENST00000370172;ENST00000370162;ENST00000370157;ENST00000426919;ENST00000413344	T;T;T;T;T;T	0.50277	2.63;2.63;2.61;2.63;1.41;0.75	5.92	5.01	0.66863	.	0.285867	0.39985	N	0.001219	T	0.39332	0.1074	L	0.60455	1.87	0.09310	N	0.999993	B	0.26195	0.144	B	0.15870	0.014	T	0.24119	-1.0169	10	0.17369	T	0.5	-36.5448	9.827	0.40919	0.0:0.3146:0.4554:0.23	.	231	Q9UGP5	DPOLL_HUMAN	T	231;231;231;143;231;231;242;231	ENSP00000299206:P231T;ENSP00000359188:P231T;ENSP00000359191:P143T;ENSP00000359181:P231T;ENSP00000411678:P242T;ENSP00000400517:P231T	ENSP00000299206:P231T	P	-	1	0	POLL	103334549	0.354000	0.24912	0.142000	0.22268	0.025000	0.11179	2.520000	0.45554	1.495000	0.48549	0.561000	0.74099	CCA	-	NULL		0.567	POLL-202	KNOWN	basic|appris_principal|CCDS	protein_coding	POLL	protein_coding	OTTHUMT00000049946.1	G	NM_013274	-		103344559	-1	no_errors	ENST00000299206	ensembl	human	known	74_37	missense	SNP	0.002	T
