#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
SLC9B1P2	389000	genome.wustl.edu	37	2	92102188	92102188	+	RNA	SNP	T	T	A			TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr2:92102188T>A	ENST00000606405.1	-	0	50									solute carrier family 9, subfamily B (NHA1, cation proton antiporter 1), member 1 pseudogene 2																		ATATCCATTTTCTTGCAACAC	0.383																																																	0								ENSG00000214329																																			SLC9B1P2			0			-	HGNC			2p11.1	2013-05-22	2012-03-22	2011-07-26	ENSG00000214329	ENSG00000214329		"""Solute carriers"""	37493	pseudogene	pseudogene			"""Na+/H+ exchanger domain containing 1 pseudogene 2"", ""solute carrier family 9, subfamily B (cation proton antiporter 2), member 1 pseudogene 2"""	NHEDC1P2			Standard	NG_009550		Approved				OTTHUMG00000155082		2.37:g.92102188T>A		Somatic	1	315	0.32		0.6820090568639808	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	101	390	20.53		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000606405.1	37	NULL		2																																																																																			-	-		0.383	SLC9B1P2-002	KNOWN	basic	processed_transcript	SLC9B1P2	pseudogene	OTTHUMT00000470174.1	T		-		92102188	-1	no_errors	ENST00000606405	ensembl	human	known	74_37	rna	SNP	0.854	A
TRDN	10345	genome.wustl.edu	37	6	123824870	123824870	+	Missense_Mutation	SNP	G	G	C			TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr6:123824870G>C	ENST00000398178.3	-	8	808	c.787C>G	c.(787-789)Cag>Gag	p.Q263E	TRDN_ENST00000334268.4_Missense_Mutation_p.Q263E|TRDN_ENST00000546248.1_Missense_Mutation_p.Q263E	NM_006073.3	NP_006064.2	Q13061	TRDN_HUMAN	triadin	263					cellular calcium ion homeostasis (GO:0006874)|cytoplasmic microtubule organization (GO:0031122)|endoplasmic reticulum membrane organization (GO:0090158)|heart contraction (GO:0060047)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|myotube differentiation (GO:0014902)|negative regulation of ryanodine-sensitive calcium-release channel activity (GO:0060315)|positive regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901846)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cell communication by electrical coupling (GO:0010649)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to organic cyclic compound (GO:0014070)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)	ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(1)|kidney(1)|large_intestine(8)|liver(1)|lung(22)|ovary(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	41				GBM - Glioblastoma multiforme(226;0.184)		TTACCTTTCTGTTCATGCTTT	0.398																																																	0								ENSG00000186439						161.0	147.0	152.0					6																	123824870		1914	4135	6049	TRDN	SO:0001583	missense	0			-	HGNC	U18985	CCDS59035.1, CCDS75511.1	6q22.31	2008-05-15			ENSG00000186439	ENSG00000186439			12261	protein-coding gene	gene with protein product		603283				7588753	Standard	NM_001251987		Approved		uc003pzj.2	Q13061	OTTHUMG00000015497	ENST00000398178.3:c.787C>G	6.37:g.123824870G>C	ENSP00000381240:p.Gln263Glu	Somatic	0	47	0.00		0.6820090568639808	0	100.00	5	WXS	Illumina HiSeq 2500	Phase_IV	tier1	57	31	64.77	A5D6W5|F5H2W7|Q6NSB8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Asp-B-hydro/Triadin_dom	p.Q263E	ENST00000398178.3	37	c.787	CCDS55053.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.81|10.81	1.456804|1.456804	0.26161|0.26161	.|.	.|.	ENSG00000186439|ENSG00000186439	ENST00000361029|ENST00000398178;ENST00000398161;ENST00000334268;ENST00000542014;ENST00000543022;ENST00000546248;ENST00000333613	.|T;T;T	.|0.78126	.|0.08;0.08;-1.15	5.81|5.81	4.89|4.89	0.63831|0.63831	.|Aspartyl beta-hydroxylase/Triadin domain (1);	.|0.235206	.|0.35067	.|N	.|0.003473	T|T	0.69726|0.69726	0.3143|0.3143	M|M	0.68317|0.68317	2.08|2.08	0.80722|0.80722	D|D	1|1	.|P;P;P;P	.|0.44090	.|0.571;0.826;0.826;0.826	.|B;P;B;P	.|0.45195	.|0.173;0.473;0.388;0.473	T|T	0.69359|0.69359	-0.5166|-0.5166	5|10	.|0.32370	.|T	.|0.25	-5.9821|-5.9821	11.3322|11.3322	0.49484|0.49484	0.0:0.0:0.7462:0.2538|0.0:0.0:0.7462:0.2538	.|.	.|263;263;263;263	.|F5H2W7;Q5SWK9;Q8IVK2;Q13061	.|.;.;.;TRDN_HUMAN	K|E	101|263;263;263;263;263;263;168	.|ENSP00000381240:Q263E;ENSP00000333984:Q263E;ENSP00000439281:Q263E	.|ENSP00000329278:Q168E	N|Q	-|-	3|1	2|0	TRDN|TRDN	123866569|123866569	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.755000|0.755000	0.42902|0.42902	1.952000|1.952000	0.40343|0.40343	2.746000|2.746000	0.94184|0.94184	0.655000|0.655000	0.94253|0.94253	AAC|CAG	-	pfam_Asp-B-hydro/Triadin_dom		0.398	TRDN-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRDN	protein_coding		G		-		123824870	-1	no_errors	ENST00000398178	ensembl	human	known	74_37	missense	SNP	1.000	C
LILRP2	79166	genome.wustl.edu	37	19	55220578	55220578	+	RNA	SNP	T	T	A			TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr19:55220578T>A	ENST00000413439.1	+	0	716				AC098784.2_ENST00000583865.1_RNA					leukocyte immunoglobulin-like receptor pseudogene 2																		ATCCCATCCATGAGAGAGCAC	0.567																																					Ovarian(107;788 1543 20399 31552 46707)												0								ENSG00000170858																																			LILRP2			0			-	HGNC	AF072100		19q13.4	2010-02-17			ENSG00000240258	ENSG00000170858		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"""	15497	pseudogene	pseudogene						10941842	Standard	NR_003061		Approved	ILT10, CD85m	uc002qgs.1		OTTHUMG00000065886		19.37:g.55220578T>A		Somatic	0	61	0.00		0.6820090568639808	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	42	21	66.67		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000413439.1	37	NULL		19																																																																																			-	-		0.567	LILRP2-002	KNOWN	basic	processed_transcript	LILRP2	pseudogene	OTTHUMT00000141240.2	T	NM_024317	-		55220578	+1	no_errors	ENST00000413439	ensembl	human	known	74_37	rna	SNP	0.002	A
IL12RB2	3595	genome.wustl.edu	37	1	67787498	67787498	+	Missense_Mutation	SNP	C	C	T			TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr1:67787498C>T	ENST00000262345.1	+	3	930	c.290C>T	c.(289-291)aCc>aTc	p.T97I	IL12RB2_ENST00000544434.1_Missense_Mutation_p.T97I|IL12RB2_ENST00000541374.1_Missense_Mutation_p.T97I|IL12RB2_ENST00000371000.1_Missense_Mutation_p.T97I	NM_001559.2	NP_001550.1	Q99665	I12R2_HUMAN	interleukin 12 receptor, beta 2	97					cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma production (GO:0032609)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of interferon-gamma production (GO:0032729)|response to lipopolysaccharide (GO:0032496)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	cytokine receptor activity (GO:0004896)			breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(8)|lung(21)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	45						CTTGGTACAACCTTGTTTGTC	0.398																																																	0								ENSG00000081985						174.0	165.0	168.0					1																	67787498		2203	4300	6503	IL12RB2	SO:0001583	missense	0			-	HGNC	U64198	CCDS638.1, CCDS58006.1, CCDS58007.1, CCDS72805.1	1p31.3-p31.2	2014-07-15			ENSG00000081985	ENSG00000081985		"""Interleukins and interleukin receptors"", ""Fibronectin type III domain containing"""	5972	protein-coding gene	gene with protein product		601642				9284929, 8943050	Standard	NM_001559		Approved		uc001ddu.3	Q99665	OTTHUMG00000009094	ENST00000262345.1:c.290C>T	1.37:g.67787498C>T	ENSP00000262345:p.Thr97Ile	Somatic	0	54	0.00		0.6820090568639808	3	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	63	21.25	B1AN98|B7ZKL9|F5H7L6|Q2M3V3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Fibronectin_type3,pfam_IgC2-like_lig-bd,pfam_IL-6_rcpt_alpha-bd,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.T97I	ENST00000262345.1	37	c.290	CCDS638.1	1	.	.	.	.	.	.	.	.	.	.	C	17.82	3.483132	0.63962	.	.	ENSG00000081985	ENST00000262345;ENST00000371000;ENST00000541374;ENST00000544434	T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19	5.95	5.95	0.96441	Immunoglobulin C2-set-like, ligand-binding (1);	0.185546	0.56097	D	0.000021	T	0.76688	0.4022	L	0.36672	1.1	0.29554	N	0.851157	D;D;D;D	0.76494	0.966;0.996;0.997;0.999	P;D;D;D	0.77557	0.779;0.918;0.954;0.99	T	0.70981	-0.4724	10	0.29301	T	0.29	-28.3281	15.8928	0.79312	0.0:1.0:0.0:0.0	.	97;97;97;97	B4DGA4;F5H7L6;Q99665-2;Q99665	.;.;.;I12R2_HUMAN	I	97	ENSP00000262345:T97I;ENSP00000360039:T97I;ENSP00000445276:T97I;ENSP00000442443:T97I	ENSP00000262345:T97I	T	+	2	0	IL12RB2	67560086	0.106000	0.21978	0.100000	0.21137	0.003000	0.03518	2.328000	0.43867	2.819000	0.97034	0.650000	0.86243	ACC	-	pfam_IgC2-like_lig-bd		0.398	IL12RB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL12RB2	protein_coding	OTTHUMT00000025202.2	C	NM_001559	-		67787498	+1	no_errors	ENST00000262345	ensembl	human	known	74_37	missense	SNP	0.385	T
AL589986.2	0	genome.wustl.edu	37	1	152097427	152097427	+	RNA	SNP	C	C	T			TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr1:152097427C>T	ENST00000429230.1	+	0	675																											ATAATCTGTGCTGCCTCTAAT	0.418																																																	0								ENSG00000226716																																			AL589986.2			0			-	Clone_based_vega_gene																													1.37:g.152097427C>T		Somatic	0	22	0.00		0.6820090568639808	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	26	40.91		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000429230.1	37	NULL		1																																																																																			-	-		0.418	AL589986.2-001	KNOWN	basic	antisense	ENSG00000226716	antisense	OTTHUMT00000036670.1	C		-		152097427	+1	no_errors	ENST00000429230	ensembl	human	known	74_37	rna	SNP	0.250	T
MFHAS1	9258	genome.wustl.edu	37	8	8748843	8748843	+	Missense_Mutation	SNP	C	C	T			TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr8:8748843C>T	ENST00000276282.6	-	1	2312	c.1726G>A	c.(1726-1728)Gtg>Atg	p.V576M		NM_004225.2	NP_004216.2	Q9Y4C4	MFHA1_HUMAN	malignant fibrous histiocytoma amplified sequence 1	576	Roc. {ECO:0000255|PROSITE- ProRule:PRU00758}.									endometrium(1)|kidney(3)|large_intestine(7)|lung(6)|ovary(1)|prostate(2)|stomach(1)	21		Hepatocellular(245;0.217)		COAD - Colon adenocarcinoma(149;0.124)		GCCTCGTCCACCACCTTGGCC	0.647																																					Melanoma(103;1201 2045 17515 28966)												0								ENSG00000147324						49.0	43.0	45.0					8																	8748843		2203	4300	6503	MFHAS1	SO:0001583	missense	0			-	HGNC	AB016816	CCDS34844.1	8p23.1	2014-03-07			ENSG00000147324	ENSG00000147324			16982	protein-coding gene	gene with protein product	"""leucine rich repeat containing 65"", ""malignant fibrous histiocytoma-amplified sequences with leucine-rich tandem repeats 1"""	605352				9973190	Standard	NM_004225		Approved	MASL1, LRRC65	uc003wsj.1	Q9Y4C4	OTTHUMG00000163676	ENST00000276282.6:c.1726G>A	8.37:g.8748843C>T	ENSP00000276282:p.Val576Met	Somatic	0	43	0.00		0.6820090568639808	23	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	35	10.26	Q96CI0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Leu-rich_rpt,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_typical-subtyp	p.V576M	ENST00000276282.6	37	c.1726	CCDS34844.1	8	.	.	.	.	.	.	.	.	.	.	C	18.83	3.707556	0.68615	.	.	ENSG00000147324	ENST00000276282	T	0.37058	1.22	5.15	5.15	0.70609	ROC GTPase (1);	0.000000	0.64402	D	0.000002	T	0.39517	0.1081	L	0.43152	1.355	0.58432	D	0.999998	D	0.57257	0.979	P	0.47044	0.535	T	0.11966	-1.0566	10	0.39692	T	0.17	.	17.8055	0.88600	0.0:1.0:0.0:0.0	.	576	Q9Y4C4	MFHA1_HUMAN	M	576	ENSP00000276282:V576M	ENSP00000276282:V576M	V	-	1	0	MFHAS1	8786253	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.294000	0.78760	2.668000	0.90789	0.563000	0.77884	GTG	-	superfamily_P-loop_NTPase		0.647	MFHAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MFHAS1	protein_coding	OTTHUMT00000374724.2	C	NM_004225	-		8748843	-1	no_errors	ENST00000276282	ensembl	human	known	74_37	missense	SNP	1.000	T
LRP8	7804	genome.wustl.edu	37	1	53728180	53728180	+	Missense_Mutation	SNP	T	T	C	rs201950519		TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr1:53728180T>C	ENST00000306052.6	-	11	1813	c.1712A>G	c.(1711-1713)aAc>aGc	p.N571S	LRP8_ENST00000465675.1_Missense_Mutation_p.N124S|LRP8_ENST00000371454.2_Missense_Mutation_p.N571S|LRP8_ENST00000460214.1_5'Flank|LRP8_ENST00000347547.2_Missense_Mutation_p.N401S|LRP8_ENST00000354412.3_Missense_Mutation_p.N442S	NM_004631.4	NP_004622.2	Q14114	LRP8_HUMAN	low density lipoprotein receptor-related protein 8, apolipoprotein e receptor	571					ammon gyrus development (GO:0021541)|blood coagulation (GO:0007596)|cellular response to cholesterol (GO:0071397)|cellular response to growth factor stimulus (GO:0071363)|cytokine-mediated signaling pathway (GO:0019221)|endocytosis (GO:0006897)|layer formation in cerebral cortex (GO:0021819)|lipid metabolic process (GO:0006629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|phototransduction, visible light (GO:0007603)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendrite development (GO:1900006)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein tyrosine kinase activity (GO:0061098)|proteolysis (GO:0006508)|receptor-mediated endocytosis (GO:0006898)|reelin-mediated signaling pathway (GO:0038026)|regulation of synaptic transmission (GO:0050804)|response to drug (GO:0042493)|retinoid metabolic process (GO:0001523)|signal transduction (GO:0007165)	caveola (GO:0005901)|dendrite (GO:0030425)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|high-density lipoprotein particle binding (GO:0008035)|reelin receptor activity (GO:0038025)|transmembrane signaling receptor activity (GO:0004888)|very-low-density lipoprotein particle receptor activity (GO:0030229)			endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|prostate(2)|skin(1)	21						GTCCACACCGTTGAGCCCAGA	0.517													T|||	1	0.000199681	0.0	0.0	5008	,	,		20210	0.0		0.001	False		,,,				2504	0.0																0								ENSG00000157193	T	SER/ASN,SER/ASN,SER/ASN,SER/ASN	0,4406		0,0,2203	226.0	223.0	224.0		1712,1712,1325,1202	5.6	1.0	1		224	3,8597	3.0+/-9.4	0,3,4297	yes	missense,missense,missense,missense	LRP8	NM_001018054.2,NM_004631.4,NM_017522.4,NM_033300.3	46,46,46,46	0,3,6500	CC,CT,TT		0.0349,0.0,0.0231	probably-damaging,probably-damaging,probably-damaging,probably-damaging	571/905,571/964,442/701,401/794	53728180	3,13003	2203	4300	6503	LRP8	SO:0001583	missense	0			-	HGNC	D50678	CCDS578.1, CCDS579.1, CCDS580.1, CCDS30720.1	1p32.3	2013-05-29			ENSG00000157193	ENSG00000157193		"""Low density lipoprotein receptors"""	6700	protein-coding gene	gene with protein product		602600				8626535, 9079678	Standard	NM_004631		Approved	APOER2, MCI1, LRP-8, HSZ75190	uc001cvi.2	Q14114	OTTHUMG00000008924	ENST00000306052.6:c.1712A>G	1.37:g.53728180T>C	ENSP00000303634:p.Asn571Ser	Somatic	0	85	0.00		0.6820090568639808	3	78.57	11	WXS	Illumina HiSeq 2500	Phase_IV	tier1	49	60	44.95	B1AMT6|B1AMT7|B1AMT8|O14968|Q86V27|Q99876|Q9BR78	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,pfam_EGF-like_Ca-bd_dom,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.N571S	ENST00000306052.6	37	c.1712	CCDS578.1	1	.	.	.	.	.	.	.	.	.	.	T	29.6	5.020248	0.93462	0.0	3.49E-4	ENSG00000157193	ENST00000306052;ENST00000371454;ENST00000465675;ENST00000354412;ENST00000347547	D;D;D;D;D	0.94376	-3.41;-3.41;-3.41;-3.41;-3.41	5.64	5.64	0.86602	Six-bladed beta-propeller, TolB-like (1);Growth factor, receptor (1);	.	.	.	.	D	0.95837	0.8645	L	0.58510	1.815	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;0.996;0.988;0.998;1.0;1.0	D;D;D;P;D;D	0.83275	0.996;0.986;0.933;0.899;0.993;0.996	D	0.96244	0.9178	9	0.87932	D	0	.	16.0238	0.80522	0.0:0.0:0.0:1.0	.	124;442;401;571;571;124	B3KU40;Q14114-2;Q14114-4;Q14114-3;Q14114;E9PP15	.;.;.;.;LRP8_HUMAN;.	S	571;571;124;442;401	ENSP00000303634:N571S;ENSP00000360509:N571S;ENSP00000437009:N124S;ENSP00000346391:N442S;ENSP00000334522:N401S	ENSP00000303634:N571S	N	-	2	0	LRP8	53500768	1.000000	0.71417	0.996000	0.52242	0.998000	0.95712	7.795000	0.85887	2.367000	0.80283	0.528000	0.53228	AAC	-	pfam_LDLR_classB_rpt,superfamily_Growth_fac_rcpt_N_dom,smart_LDLR_classB_rpt,pfscan_LDLR_classB_rpt		0.517	LRP8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LRP8	protein_coding	OTTHUMT00000024699.1	T	NM_004631	rs201950519		53728180	-1	no_errors	ENST00000306052	ensembl	human	known	74_37	missense	SNP	1.000	C
F8	2157	genome.wustl.edu	37	X	154159234	154159234	+	Missense_Mutation	SNP	T	T	G			TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chrX:154159234T>G	ENST00000360256.4	-	14	3031	c.2831A>C	c.(2830-2832)aAg>aCg	p.K944T		NM_000132.3	NP_000123.1	P00451	FA8_HUMAN	coagulation factor VIII, procoagulant component	944	B.				acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	copper ion binding (GO:0005507)|oxidoreductase activity (GO:0016491)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(27)|liver(1)|lung(47)|ovary(5)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(5)|urinary_tract(2)	120	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)	GGGAGATGACTTTTTGCCAAA	0.388																																																	0			GRCh37	CD083298	F8	D		ENSG00000185010						76.0	75.0	76.0					X																	154159234		2202	4298	6500	F8	SO:0001583	missense	0			-	HGNC	M90707	CCDS35457.1, CCDS44026.1	Xq28	2014-09-17	2008-07-29		ENSG00000185010	ENSG00000185010			3546	protein-coding gene	gene with protein product	"""Factor VIIIF8B"", ""hemophilia A"""	300841		F8C		6438528, 3935400	Standard	NM_000132		Approved	FVIII, DXS1253E, HEMA	uc004fmt.3	P00451	OTTHUMG00000022688	ENST00000360256.4:c.2831A>C	X.37:g.154159234T>G	ENSP00000353393:p.Lys944Thr	Somatic	0	28	0.00		0.6820090568639808	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	35	10.26	Q14286|Q5HY69	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Coagulation_fac_5/8-C_type_dom,pfam_Cu-oxidase_3,pfam_Cu-oxidase_2,superfamily_Galactose-bd-like,superfamily_Cupredoxin,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom	p.K944T	ENST00000360256.4	37	c.2831	CCDS35457.1	X	.	.	.	.	.	.	.	.	.	.	T	4.071	0.011027	0.07912	.	.	ENSG00000185010	ENST00000360256	D	0.99264	-5.65	5.19	1.06	0.20224	.	0.357105	0.28784	N	0.014153	D	0.96510	0.8861	L	0.50333	1.59	0.09310	N	1	P	0.39665	0.682	B	0.32864	0.154	D	0.93167	0.6563	10	0.44086	T	0.13	-2.2376	3.3649	0.07199	0.36:0.1013:0.0:0.5387	.	944	P00451	FA8_HUMAN	T	944	ENSP00000353393:K944T	ENSP00000353393:K944T	K	-	2	0	F8	153812428	0.121000	0.22262	0.013000	0.15412	0.020000	0.10135	0.904000	0.28491	0.230000	0.21059	-0.544000	0.04233	AAG	-	NULL		0.388	F8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	F8	protein_coding	OTTHUMT00000058869.4	T		-		154159234	-1	no_errors	ENST00000360256	ensembl	human	known	74_37	missense	SNP	0.028	G
DSE	29940	genome.wustl.edu	37	6	116757666	116757666	+	Missense_Mutation	SNP	G	G	A			TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr6:116757666G>A	ENST00000331677.3	+	7	2479	c.2035G>A	c.(2035-2037)Gac>Aac	p.D679N	DSE_ENST00000452085.3_Missense_Mutation_p.D679N|DSE_ENST00000359564.2_Missense_Mutation_p.D679N|DSE_ENST00000537543.1_Missense_Mutation_p.D698N			Q9UL01	DSE_HUMAN	dermatan sulfate epimerase	679					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	chondroitin-glucuronate 5-epimerase activity (GO:0047757)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(2)|lung(12)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35		all_cancers(87;0.00019)|all_epithelial(87;0.000416)|Ovarian(999;0.133)|Colorectal(196;0.234)		Epithelial(106;0.00915)|OV - Ovarian serous cystadenocarcinoma(136;0.0149)|GBM - Glioblastoma multiforme(226;0.0189)|all cancers(137;0.0262)		TGTCCACGGAGACTCTCAGCA	0.527																																																	0								ENSG00000111817						102.0	97.0	98.0					6																	116757666		2203	4300	6503	DSE	SO:0001583	missense	0			-	HGNC	AF098066	CCDS5107.1	6q22	2008-02-05	2007-01-29	2007-01-29	ENSG00000111817	ENSG00000111817	5.1.3.19		21144	protein-coding gene	gene with protein product		605942	"""squamous cell carcinoma antigen recognized by T cells 2"""	SART2		11920522, 16505484	Standard	NM_001080976		Approved	DSEPI	uc003pws.3	Q9UL01	OTTHUMG00000015434	ENST00000331677.3:c.2035G>A	6.37:g.116757666G>A	ENSP00000332151:p.Asp679Asn	Somatic	0	33	0.00		0.6820090568639808	242	3.20	8	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	73	8.75	Q5R3K6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_Chondroitin_lyas	p.D698N	ENST00000331677.3	37	c.2092	CCDS5107.1	6	.	.	.	.	.	.	.	.	.	.	G	12.87	2.066582	0.36470	.	.	ENSG00000111817	ENST00000452085;ENST00000537543;ENST00000331677;ENST00000359564	T;T;T;T	0.63580	-0.05;-0.05;-0.05;-0.05	6.01	5.14	0.70334	.	0.086719	0.85682	D	0.000000	T	0.48314	0.1493	L	0.43152	1.355	0.80722	D	1	B;B	0.34181	0.44;0.44	B;B	0.40864	0.342;0.256	T	0.53982	-0.8361	10	0.45353	T	0.12	-16.6199	15.1954	0.73084	0.0673:0.0:0.9327:0.0	.	698;679	B7Z765;Q9UL01	.;DSE_HUMAN	N	679;698;679;679	ENSP00000404049:D679N;ENSP00000441152:D698N;ENSP00000332151:D679N;ENSP00000352567:D679N	ENSP00000332151:D679N	D	+	1	0	DSE	116864359	1.000000	0.71417	0.099000	0.21106	0.062000	0.15995	8.012000	0.88631	1.552000	0.49463	0.650000	0.86243	GAC	-	NULL		0.527	DSE-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DSE	protein_coding	OTTHUMT00000041940.2	G	NM_013352	-		116757666	+1	no_errors	ENST00000537543	ensembl	human	known	74_37	missense	SNP	0.998	A
PTHLH	5744	genome.wustl.edu	37	12	28114898	28114898	+	Intron	DEL	T	T	-	rs377014358		TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr12:28114898delT	ENST00000545234.1	-	5	1065				RP11-993B23.3_ENST00000538113.1_RNA|PTHLH_ENST00000395872.1_Intron|PTHLH_ENST00000354417.3_Frame_Shift_Del_p.K186fs|PTHLH_ENST00000538310.1_Frame_Shift_Del_p.K186fs|PTHLH_ENST00000539239.1_Intron			P12272	PTHR_HUMAN	parathyroid hormone-like hormone						adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|cAMP metabolic process (GO:0046058)|cell-cell signaling (GO:0007267)|endochondral ossification (GO:0001958)|endoderm development (GO:0007492)|epidermis development (GO:0008544)|epithelial cell differentiation (GO:0030855)|female pregnancy (GO:0007565)|lung alveolus development (GO:0048286)|mammary gland bud elongation (GO:0060649)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|nipple sheath formation (GO:0060659)|osteoblast development (GO:0002076)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cell proliferation (GO:0008284)|protein processing (GO:0016485)|regulation of gene expression (GO:0010468)|skeletal system development (GO:0001501)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	hormone activity (GO:0005179)|peptide hormone receptor binding (GO:0051428)			breast(1)|endometrium(1)|large_intestine(2)|lung(4)|skin(1)|stomach(1)	10	Lung SC(9;0.184)					GTTGTTTTCCTTTTTTTTTTT	0.333																																																	0								ENSG00000087494						16.0	16.0	16.0					12																	28114898		875	1991	2866	PTHLH	SO:0001627	intron_variant	0				HGNC		CCDS8715.1, CCDS44853.1	12p12.1-p11.2	2014-01-07			ENSG00000087494	ENSG00000087494		"""Endogenous ligands"""	9607	protein-coding gene	gene with protein product	"""osteostatin"", ""parathyroid hormone-like hormone preproprotein"", ""parathyroid hormone-related protein preproprotein"""	168470				2708388	Standard	NM_002820		Approved	PTHRP, HHM, PLP, PTHR	uc001ril.3	P12272	OTTHUMG00000169221	ENST00000545234.1:c.524+1382A>-	12.37:g.28114898delT		Somatic	0	31	0.00		0.6820090568639808	3	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	30	9.09	Q15251|Q6FH74	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_PTH/PTH-rel,smart_PTH/PTH-rel	p.K186fs	ENST00000545234.1	37	c.557	CCDS44853.1	12																																																																																			-	NULL		0.333	PTHLH-001	KNOWN	basic|CCDS	protein_coding	PTHLH	protein_coding	OTTHUMT00000402913.1	T	NM_198965			28114898	-1	no_errors	ENST00000354417	ensembl	human	known	74_37	frame_shift_del	DEL	0.135	-
SERHL2	253190	genome.wustl.edu	37	22	42952282	42952282	+	Intron	SNP	G	G	A	rs376066225		TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr22:42952282G>A	ENST00000327678.5	+	5	450				RRP7B_ENST00000357802.2_RNA|SERHL2_ENST00000335879.5_Intron|SERHL2_ENST00000340239.4_Intron|SERHL2_ENST00000407614.4_Intron	NM_014509.3	NP_055324.2	Q9NQF3	SERHL_HUMAN	serine hydrolase-like 2								hydrolase activity (GO:0016787)			breast(1)|endometrium(2)|lung(3)|skin(1)|stomach(1)	8						CCCCATACCCGGTCCCACCGC	0.562																																																	0								ENSG00000182841																																			RRP7B	SO:0001627	intron_variant	0			-	HGNC		CCDS14037.1, CCDS63498.1	22q13	2005-08-09			ENSG00000183569	ENSG00000183569			29446	protein-coding gene	gene with protein product							Standard	NM_014509		Approved		uc003bcr.3	Q9H4I8	OTTHUMG00000150892	ENST00000327678.5:c.348+193G>A	22.37:g.42952282G>A		Somatic	0	16	0.00		0.6820090568639808	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	4	50.00	Q5JZ95|Q9UH21	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000327678.5	37	NULL	CCDS14037.1	22																																																																																			-	-		0.562	SERHL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RRP7B	protein_coding	OTTHUMT00000320454.1	G	NM_014509	-		42952282	-1	no_errors	ENST00000357802	ensembl	human	known	74_37	rna	SNP	0.000	A
SLIT2	9353	genome.wustl.edu	37	4	20611715	20611715	+	Missense_Mutation	SNP	G	G	A			TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr4:20611715G>A	ENST00000504154.1	+	34	4024	c.3772G>A	c.(3772-3774)Ggt>Agt	p.G1258S	SLIT2_ENST00000273739.5_Missense_Mutation_p.G1271S|SLIT2_ENST00000503837.1_Missense_Mutation_p.G1254S|SLIT2_ENST00000503823.1_Missense_Mutation_p.G1250S	NM_004787.1	NP_004778.1	O94813	SLIT2_HUMAN	slit homolog 2 (Drosophila)	1258	Laminin G-like. {ECO:0000255|PROSITE- ProRule:PRU00122}.				apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|branching morphogenesis of an epithelial tube (GO:0048754)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to heparin (GO:0071504)|cellular response to hormone stimulus (GO:0032870)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|corticospinal neuron axon guidance through spinal cord (GO:0021972)|dorsal/ventral axon guidance (GO:0033563)|in utero embryonic development (GO:0001701)|induction of negative chemotaxis (GO:0050929)|mammary duct terminal end bud growth (GO:0060763)|metanephros development (GO:0001656)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of axon extension (GO:0030517)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cellular response to growth factor stimulus (GO:0090288)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of gene expression (GO:0010629)|negative regulation of lamellipodium assembly (GO:0010593)|negative regulation of leukocyte chemotaxis (GO:0002689)|negative regulation of monocyte chemotaxis (GO:0090027)|negative regulation of mononuclear cell migration (GO:0071676)|negative regulation of neutrophil chemotaxis (GO:0090024)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|negative regulation of small GTPase mediated signal transduction (GO:0051058)|negative regulation of smooth muscle cell chemotaxis (GO:0071672)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of vascular permeability (GO:0043116)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|response to cortisol (GO:0051414)|retinal ganglion cell axon guidance (GO:0031290)|Roundabout signaling pathway (GO:0035385)|single organismal cell-cell adhesion (GO:0016337)|ureteric bud development (GO:0001657)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chemorepellent activity (GO:0045499)|GTPase inhibitor activity (GO:0005095)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|laminin-1 binding (GO:0043237)|protein homodimerization activity (GO:0042803)|proteoglycan binding (GO:0043394)|Roundabout binding (GO:0048495)			NS(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(17)|lung(60)|ovary(3)|pancreas(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	116						GTCCGTGGATGGTGGGAACCC	0.433																																																	0								ENSG00000145147						180.0	163.0	169.0					4																	20611715		2203	4300	6503	SLIT2	SO:0001583	missense	0			-	HGNC	AF055585	CCDS3426.1, CCDS75110.1, CCDS75111.1	4p15.2	2008-08-01	2001-11-28		ENSG00000145147	ENSG00000145147			11086	protein-coding gene	gene with protein product		603746	"""slit (Drosophila) homolog 2"""	SLIL3		9813312, 18269211	Standard	XM_005248211		Approved	Slit-2	uc003gpr.1	O94813	OTTHUMG00000128551	ENST00000504154.1:c.3772G>A	4.37:g.20611715G>A	ENSP00000422591:p.Gly1258Ser	Somatic	0	71	0.00		0.6820090568639808	66	53.19	75	WXS	Illumina HiSeq 2500	Phase_IV	tier1	30	38	44.12	B7ZLR5|O95710|Q17RU3|Q9Y5Q7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_EG-like_dom,pfam_Laminin_G,pfam_Leu-rich_rpt,pfam_LRR-contain_N,pfam_Cys-rich_flank_reg_C,superfamily_ConA-like_lec_gl_sf,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_Fol_N,smart_Laminin_G,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_EG-like_dom,pfscan_Laminin_G	p.G1258S	ENST00000504154.1	37	c.3772	CCDS3426.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	34|34	5.296264|5.296264	0.95574|0.95574	.|.	.|.	ENSG00000145147|ENSG00000145147	ENST00000503823;ENST00000504154;ENST00000273739;ENST00000382173;ENST00000503837|ENST00000512993	T;T;T;T|.	0.73047|.	-0.71;-0.71;-0.71;-0.71|.	6.07|6.07	6.07|6.07	0.98685|0.98685	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);|.	0.052988|.	0.85682|.	D|.	0.000000|.	T|T	0.70868|0.70868	0.3273|0.3273	L|L	0.48218|0.48218	1.51|1.51	0.80722|0.80722	D|D	1|1	P;D|.	0.56746|.	0.694;0.977|.	B;P|.	0.61722|.	0.379;0.893|.	T|T	0.64106|0.64106	-0.6485|-0.6485	10|5	0.21014|.	T|.	0.42|.	.|.	20.6593|20.6593	0.99626|0.99626	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1250;1258|.	O94813-3;O94813|.	.;SLIT2_HUMAN|.	S|I	1250;1258;1271;1254;1254|41	ENSP00000427548:G1250S;ENSP00000422591:G1258S;ENSP00000273739:G1271S;ENSP00000422261:G1254S|.	ENSP00000273739:G1271S|.	G|M	+|+	1|3	0|0	SLIT2|SLIT2	20220813|20220813	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.869000|0.869000	0.49853|0.49853	9.810000|9.810000	0.99221|0.99221	2.885000|2.885000	0.99019|0.99019	0.655000|0.655000	0.94253|0.94253	GGT|ATG	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,pfscan_Laminin_G		0.433	SLIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLIT2	protein_coding	OTTHUMT00000250396.2	G		-		20611715	+1	no_errors	ENST00000504154	ensembl	human	known	74_37	missense	SNP	1.000	A
CCAR1	55749	genome.wustl.edu	37	10	70509285	70509286	+	Frame_Shift_Del	DEL	GA	GA	-	rs147413396		TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	GA	GA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr10:70509285_70509286delGA	ENST00000265872.6	+	10	1080_1081	c.961_962delGA	c.(961-963)gagfs	p.E321fs	CCAR1_ENST00000535016.1_Frame_Shift_Del_p.E306fs|CCAR1_ENST00000543719.1_Frame_Shift_Del_p.E306fs	NM_001282959.1|NM_001282960.1|NM_018237.2	NP_001269888.1|NP_001269889.1|NP_060707.2	Q8IX12	CCAR1_HUMAN	cell division cycle and apoptosis regulator 1	321	Arg-rich.				apoptotic process (GO:0006915)|cell cycle (GO:0007049)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|lung(13)|ovary(7)|skin(3)	56						TTTCAGTCGTGAGAGAGAGAGA	0.391																																																	0								ENSG00000060339																																			CCAR1	SO:0001589	frameshift_variant	0				HGNC	AY249140	CCDS7282.1, CCDS60547.1	10q22.1	2004-02-19			ENSG00000060339	ENSG00000060339			24236	protein-coding gene	gene with protein product		612569				12816952	Standard	NM_018237		Approved	FLJ10590, CARP-1, CARP1	uc001joo.3	Q8IX12	OTTHUMG00000018361	ENST00000265872.6:c.961_962delGA	10.37:g.70509295_70509296delGA	ENSP00000265872:p.Glu321fs	Somatic	0	36	0.00		0.6820090568639808	83	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	33	10.81	A0JLT7|A1L4P7|A8K9D4|B4DNP8|B4DRK8|Q32NE3|Q5EBM3|Q5VUP6|Q6PIZ0|Q6X935|Q9H8N4|Q9NVA7|Q9NVQ0|Q9NWM6	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_SAP_dom,superfamily_NA-bd_OB-fold,smart_SAP_dom,pfscan_SAP_dom	p.R324fs	ENST00000265872.6	37	c.961_962	CCDS7282.1	10																																																																																			-	NULL		0.391	CCAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCAR1	protein_coding	OTTHUMT00000048356.2	GA	NM_018237			70509286	+1	no_errors	ENST00000265872	ensembl	human	known	74_37	frame_shift_del	DEL	1.000:1.000	-
STK17B	9262	genome.wustl.edu	37	2	197028100	197028100	+	Missense_Mutation	SNP	C	C	T			TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr2:197028100C>T	ENST00000263955.4	-	2	294	c.8G>A	c.(7-9)aGg>aAg	p.R3K	STK17B_ENST00000409228.1_Missense_Mutation_p.R3K	NM_004226.3	NP_004217.1	O94768	ST17B_HUMAN	serine/threonine kinase 17b	3					apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|positive regulation of fibroblast apoptotic process (GO:2000271)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	actin cytoskeleton (GO:0015629)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|cervix(1)|kidney(2)|large_intestine(1)|lung(10)	15			OV - Ovarian serous cystadenocarcinoma(117;0.141)			AAATCTCCTCCTCGACATGTT	0.343																																																	0								ENSG00000081320						74.0	77.0	76.0					2																	197028100		2203	4300	6503	STK17B	SO:0001583	missense	0			-	HGNC	AB011421	CCDS2315.1	2q33.1	2008-02-05	2007-02-12		ENSG00000081320	ENSG00000081320			11396	protein-coding gene	gene with protein product	"""death-associated protein kinase-related 2"""	604727	"""serine/threonine kinase 17b (apoptosis-inducing)"""			9786912	Standard	NM_004226		Approved	DRAK2	uc002utk.3	O94768	OTTHUMG00000132735	ENST00000263955.4:c.8G>A	2.37:g.197028100C>T	ENSP00000263955:p.Arg3Lys	Somatic	0	125	0.00		0.6820090568639808	70	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	44	129	25.43		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.R3K	ENST00000263955.4	37	c.8	CCDS2315.1	2	.	.	.	.	.	.	.	.	.	.	C	14.43	2.532232	0.45073	.	.	ENSG00000081320	ENST00000263955;ENST00000409228;ENST00000420683;ENST00000449152	T;T;T	0.67171	-0.25;-0.25;0.92	5.38	5.38	0.77491	.	0.000000	0.50627	D	0.000112	T	0.71091	0.3299	N	0.24115	0.695	0.46901	D	0.999249	P	0.52842	0.956	D	0.65010	0.931	T	0.72040	-0.4410	10	0.49607	T	0.09	.	17.5001	0.87728	0.0:1.0:0.0:0.0	.	3	O94768	ST17B_HUMAN	K	3	ENSP00000263955:R3K;ENSP00000386853:R3K;ENSP00000399755:R3K	ENSP00000263955:R3K	R	-	2	0	STK17B	196736345	0.950000	0.32346	0.948000	0.38648	0.344000	0.29017	3.029000	0.49712	2.813000	0.96785	0.655000	0.94253	AGG	-	NULL		0.343	STK17B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STK17B	protein_coding	OTTHUMT00000256092.2	C		-		197028100	-1	no_errors	ENST00000263955	ensembl	human	known	74_37	missense	SNP	0.982	T
OR2F1	26211	genome.wustl.edu	37	7	143658017	143658017	+	Nonstop_Mutation	SNP	A	A	G			TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr7:143658017A>G	ENST00000392899.1	+	1	991	c.954A>G	c.(952-954)tgA>tgG	p.*318W	RP4-669B10.3_ENST00000466281.1_lincRNA	NM_012369.2	NP_036501.2	Q13607	OR2F1_HUMAN	olfactory receptor, family 2, subfamily F, member 1 (gene/pseudogene)	0					signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(18)|ovary(1)|skin(4)	34	Melanoma(164;0.0903)					TGGCAACTTGACTCATGAGTA	0.458																																																	0								ENSG00000213215						39.0	40.0	40.0					7																	143658017		2201	4298	6499	OR2F1	SO:0001578	stop_lost	0			-	HGNC	U56421	CCDS5887.1	7q35	2013-06-03	2013-06-03		ENSG00000213215	ENSG00000213215		"""GPCR / Class A : Olfactory receptors"""	8246	protein-coding gene	gene with protein product		608497	"""olfactory receptor, family 2, subfamily F, member 1"""	OR2F4, OR2F5, OR2F3, OR2F3P		9500546	Standard	NM_012369		Approved	OLF3, OR7-140, OR7-139, OR14-60	uc003wds.1	Q13607	OTTHUMG00000157771	ENST00000392899.1:c.954A>G	7.37:g.143658017A>G	ENSP00000376633:p.*318Trpext*6	Somatic	0	51	0.00		0.6820090568639808	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	36	35.71	A4D2G1|Q6IFP7|Q96R49|Q9UDX1	Nonstop_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.*318W	ENST00000392899.1	37	c.954	CCDS5887.1	7	.	.	.	.	.	.	.	.	.	.	A	9.243	1.038684	0.19669	.	.	ENSG00000213215	ENST00000392899	.	.	.	5.11	3.96	0.45880	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.3629	0.26756	0.9024:0.0:0.0976:0.0	.	.	.	.	W	318	.	.	X	+	3	0	OR2F1	143288950	0.604000	0.26932	0.162000	0.22713	0.002000	0.02628	0.540000	0.23191	0.969000	0.38237	0.533000	0.62120	TGA	-	NULL		0.458	OR2F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2F1	protein_coding	OTTHUMT00000349581.1	A		-		143658017	+1	no_errors	ENST00000392899	ensembl	human	known	74_37	nonstop	SNP	0.360	G
BMP1	649	genome.wustl.edu	37	8	22020159	22020161	+	5'Flank	DEL	GTG	GTG	-	rs183533911	byFrequency	TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	GTG	GTG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr8:22020159_22020161delGTG	ENST00000306385.5	+	0	0				SFTPC_ENST00000522109.1_In_Frame_Del_p.V44del|SFTPC_ENST00000521315.1_In_Frame_Del_p.V44del|SFTPC_ENST00000520605.1_Intron|SFTPC_ENST00000524255.1_Intron|BMP1_ENST00000306349.8_5'Flank|BMP1_ENST00000397814.3_5'Flank|BMP1_ENST00000354870.5_5'Flank|SFTPC_ENST00000437090.2_In_Frame_Del_p.V44del|SFTPC_ENST00000318561.3_In_Frame_Del_p.V44del|BMP1_ENST00000397816.3_5'Flank	NM_006129.4	NP_006120.1	P13497	BMP1_HUMAN	bone morphogenetic protein 1						cartilage condensation (GO:0001502)|cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|lipoprotein metabolic process (GO:0042157)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|positive regulation of cartilage development (GO:0061036)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane-bounded vesicle (GO:0031988)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)|zinc ion binding (GO:0008270)			breast(1)|endometrium(7)|kidney(2)|large_intestine(7)|lung(7)|ovary(2)|prostate(1)|skin(3)	30				Colorectal(74;0.00229)|COAD - Colon adenocarcinoma(73;0.0661)|READ - Rectum adenocarcinoma(644;0.11)		CCTTCTTATCGTGGTGGTGGTGG	0.601																																																	0								ENSG00000168484																																			SFTPC	SO:0001631	upstream_gene_variant	0				HGNC		CCDS6026.1, CCDS34856.1	8p21	2013-02-06	2004-08-09		ENSG00000168487	ENSG00000168487	3.4.24.19	"""Bone morphogenetic proteins"""	1067	protein-coding gene	gene with protein product	"""procollagen C-endopeptidase"""	112264	"""procollagen C-endopeptidase"""	PCOLC		2004778	Standard	NM_006129		Approved		uc003xbg.3	P13497	OTTHUMG00000097761		8.37:g.22020168_22020170delGTG	Exception_encountered	Somatic	0	49	0.00		0.6820090568639808	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	29	12.12	A8K6F5|B2RN46|D3DSR0|Q13292|Q13872|Q14874|Q99421|Q99422|Q99423|Q9UL38	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Surfactant_protein_propep,pfam_BRICHOS_dom,smart_Pulm_surfact_AP,pfscan_BRICHOS_dom	p.V42in_frame_del	ENST00000306385.5	37	c.115_117	CCDS6026.1	8																																																																																			-	pfam_Surfactant_protein_propep,smart_Pulm_surfact_AP		0.601	BMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SFTPC	protein_coding	OTTHUMT00000214995.2	GTG	NM_006132			22020161	+1	no_errors	ENST00000318561	ensembl	human	known	74_37	in_frame_del	DEL	1.000:1.000:1.000	-
SMIM9	100132963	genome.wustl.edu	37	X	154058932	154058932	+	Intron	SNP	G	G	T			TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chrX:154058932G>T	ENST00000369529.1	-	2	339				SMIM9_ENST00000478043.1_5'UTR	NM_001162936.1	NP_001156408.1	A6NGZ8	SMIM9_HUMAN	small integral membrane protein 9							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)											GACCTGAACTGAAACATGAAT	0.353																																																	0								ENSG00000203870																																			SMIM9	SO:0001627	intron_variant	0			-	HGNC		CCDS55546.1	Xq28	2012-11-29	2012-11-29	2012-11-29	ENSG00000203870	ENSG00000203870			41915	protein-coding gene	gene with protein product			"""chromosome X open reading frame 68"""	CXorf68			Standard	NM_001162936		Approved		uc022cik.1	A6NGZ8	OTTHUMG00000024243	ENST00000369529.1:c.142+57C>A	X.37:g.154058932G>T		Somatic	0	30	0.00		0.6820090568639808	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000369529.1	37	NULL	CCDS55546.1	X																																																																																			-	-		0.353	SMIM9-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	SMIM9	protein_coding	OTTHUMT00000061185.2	G	NM_001162936	-		154058932	-1	no_errors	ENST00000478043	ensembl	human	known	74_37	rna	SNP	0.013	T
RWDD1	51389	genome.wustl.edu	37	6	116910071	116910071	+	Nonsense_Mutation	SNP	G	G	T			TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr6:116910071G>T	ENST00000466444.2	+	4	553	c.337G>T	c.(337-339)Gaa>Taa	p.E113*	RWDD1_ENST00000487832.2_Nonsense_Mutation_p.E17*|RWDD1_ENST00000392526.1_Nonsense_Mutation_p.E17*	NM_015952.2	NP_057036.2	Q9H446	RWDD1_HUMAN	RWD domain containing 1	113	RWD. {ECO:0000255|PROSITE- ProRule:PRU00179}.									NS(1)|breast(2)|central_nervous_system(1)|large_intestine(3)|lung(1)|ovary(2)|prostate(1)|skin(1)	12		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.026)|all cancers(137;0.0312)|OV - Ovarian serous cystadenocarcinoma(136;0.0689)|Epithelial(106;0.161)		AAAATTAAATGAAATAGTAGA	0.318																																																	0								ENSG00000111832						48.0	51.0	50.0					6																	116910071		2203	4293	6496	RWDD1	SO:0001587	stop_gained	0			-	HGNC	AF092134	CCDS34520.1, CCDS43496.1	6q13-q22.33	2012-12-07			ENSG00000111832	ENSG00000111832			20993	protein-coding gene	gene with protein product						10810093	Standard	NM_016104		Approved	PTD013	uc003pxd.3	Q9H446	OTTHUMG00000015441	ENST00000466444.2:c.337G>T	6.37:g.116910071G>T	ENSP00000420357:p.Glu113*	Somatic	0	17	0.00		0.6820090568639808	315	0.32	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	40	28.81	A8K3W2|A8MT24|Q9Y313|Q9Y6B3	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RWD-domain,superfamily_UBQ-conjugating_enzyme/RWD,smart_RWD-domain,pfscan_RWD-domain	p.E113*	ENST00000466444.2	37	c.337	CCDS34520.1	6	.	.	.	.	.	.	.	.	.	.	G	39	7.791473	0.98492	.	.	ENSG00000111832	ENST00000466444;ENST00000368590;ENST00000392526;ENST00000487832;ENST00000518117;ENST00000468204	.	.	.	5.22	5.22	0.72569	.	0.045996	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	-8.6256	18.738	0.91763	0.0:0.0:1.0:0.0	.	.	.	.	X	113;17;17;17;17;17	.	ENSP00000429070:E17X	E	+	1	0	RWDD1	117016764	1.000000	0.71417	1.000000	0.80357	0.893000	0.52053	7.878000	0.87231	2.413000	0.81919	0.585000	0.79938	GAA	-	superfamily_UBQ-conjugating_enzyme/RWD,smart_RWD-domain,pfscan_RWD-domain		0.318	RWDD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RWDD1	protein_coding	OTTHUMT00000041952.2	G	NM_015952	-		116910071	+1	no_errors	ENST00000466444	ensembl	human	known	74_37	nonsense	SNP	1.000	T
INSL4	3641	genome.wustl.edu	37	9	5233767	5233767	+	Missense_Mutation	SNP	T	T	A			TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr9:5233767T>A	ENST00000239316.4	+	2	415	c.310T>A	c.(310-312)Ttg>Atg	p.L104M		NM_002195.1	NP_002186.1	Q14641	INSL4_HUMAN	insulin-like 4 (placenta)	104					cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|female pregnancy (GO:0007565)|multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)	extracellular space (GO:0005615)	insulin-like growth factor receptor binding (GO:0005159)|receptor binding (GO:0005102)			endometrium(2)|lung(2)|skin(1)|urinary_tract(1)	6	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.0201)|Lung(218;0.14)		GCAGCCATCATTGAAGAAAAT	0.398																																																	0								ENSG00000120211						83.0	77.0	79.0					9																	5233767		2203	4300	6503	INSL4	SO:0001583	missense	0			-	HGNC		CCDS6459.1	9p24	2008-02-05			ENSG00000120211	ENSG00000120211			6087	protein-coding gene	gene with protein product		600910				8666396, 9730618	Standard	NM_002195		Approved	EPIL	uc003ziy.3	Q14641	OTTHUMG00000019494	ENST00000239316.4:c.310T>A	9.37:g.5233767T>A	ENSP00000239316:p.Leu104Met	Somatic	0	63	0.00		0.6820090568639808	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	35	34	50.72	A8K678|Q5W127	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_Insulin-like,prints_Placentin,prints_Relaxin	p.L104M	ENST00000239316.4	37	c.310	CCDS6459.1	9	.	.	.	.	.	.	.	.	.	.	T	8.969	0.972434	0.18736	.	.	ENSG00000120211	ENST00000239316	T	0.30981	1.51	2.03	0.735	0.18300	.	3.212140	0.02905	U	0.135906	T	0.31827	0.0809	N	0.19112	0.55	0.09310	N	1	D	0.65815	0.995	P	0.55011	0.766	T	0.15838	-1.0423	10	0.66056	D	0.02	.	4.1382	0.10181	0.0:0.1909:0.0:0.8091	.	104	Q14641	INSL4_HUMAN	M	104	ENSP00000239316:L104M	ENSP00000239316:L104M	L	+	1	2	INSL4	5223767	0.000000	0.05858	0.001000	0.08648	0.028000	0.11728	-0.456000	0.06754	0.181000	0.19994	0.358000	0.22013	TTG	-	superfamily_Insulin-like		0.398	INSL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INSL4	protein_coding	OTTHUMT00000051616.2	T	NM_002195	-		5233767	+1	no_errors	ENST00000239316	ensembl	human	known	74_37	missense	SNP	0.001	A
NRDE2	55051	genome.wustl.edu	37	14	90798307	90798307	+	5'UTR	SNP	G	G	T			TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr14:90798307G>T	ENST00000354366.3	-	0	174				NRDE2_ENST00000557106.1_5'UTR|NRDE2_ENST00000357904.3_5'Flank	NM_017970.3	NP_060440.2	Q9H7Z3	NRDE2_HUMAN	NRDE-2, necessary for RNA interference, domain containing																		GCGAGCGCCGGTCTGAGGACC	0.677																																																	0								ENSG00000119720						13.0	16.0	15.0					14																	90798307		691	1589	2280	NRDE2	SO:0001623	5_prime_UTR_variant	0			-	HGNC	AK000870	CCDS9890.1	14q32.11	2012-12-14	2012-09-25	2012-09-25	ENSG00000119720	ENSG00000119720			20186	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 102"""	C14orf102			Standard	NM_017970		Approved	FLJ14051	uc001xyi.2	Q9H7Z3	OTTHUMG00000171020	ENST00000354366.3:c.-59C>A	14.37:g.90798307G>T		Somatic	0	26	0.00		0.6820090568639808	4	50.00	4	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	28	28.21	B4DH71|Q4G0A7|Q9NWH6	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000354366.3	37	NULL	CCDS9890.1	14																																																																																			-	-		0.677	NRDE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NRDE2	protein_coding	OTTHUMT00000411264.1	G	NM_017970	-		90798307	-1	no_errors	ENST00000557106	ensembl	human	known	74_37	rna	SNP	0.000	T
KRTAP9-9	81870	genome.wustl.edu	37	17	39411670	39411671	+	In_Frame_Ins	INS	-	-	ACCTGCTGCAGGACC	rs67700678|rs540633489	byFrequency	TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr17:39411670_39411671insACCTGCTGCAGGACC	ENST00000394008.1	+	1	35_36	c.33_34insACCTGCTGCAGGACC	c.(34-36)acc>ACCTGCTGCAGGACCacc	p.12_12T>TCCRTT		NM_030975.2	NP_112237.2	Q9BYP9	KRA99_HUMAN	keratin associated protein 9-9	12	14 X 5 AA repeats of C-C-[RQVGE]- [SPSTNQ]-[TASL].					keratin filament (GO:0045095)				endometrium(3)|skin(2)|upper_aerodigestive_tract(1)	6		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000397)			GCTGTCAGCCTACCTGCTGCAG	0.604														2488	0.496805	0.298	0.647	5008	,	,		16406	0.4196		0.5805	False		,,,				2504	0.6524																0								ENSG00000198083																																			KRTAP9-9	SO:0001652	inframe_insertion	0				HGNC	AJ406951	CCDS54127.1	17q21.2	2010-06-03			ENSG00000198083	ENSG00000198083		"""Keratin associated proteins"""	16773	protein-coding gene	gene with protein product			"""keratin associated protein 9-5"""	KRTAP9-5		11279113	Standard	NM_030975		Approved	KAP9.9, KAP9.5	uc021txh.1	Q9BYP9	OTTHUMG00000133602	ENST00000394008.1:c.34_48dupACCTGCTGCAGGACC	17.37:g.39411670_39411671insACCTGCTGCAGGACC	Exception_encountered	Somatic	NA	NA	NA		0.6820090568639808	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B5MDD6|Q9BYQ1	In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	NULL	p.15in_frame_insTTCCR	ENST00000394008.1	37	c.33_34	CCDS54127.1	17																																																																																			-	NULL		0.604	KRTAP9-9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP9-9	protein_coding	OTTHUMT00000257710.1	-	NM_030975			39411671	+1	no_errors	ENST00000394008	ensembl	human	known	74_37	in_frame_ins	INS	0.053:0.940	ACCTGCTGCAGGACC
MUC5B	727897	genome.wustl.edu	37	11	1263664	1263664	+	Nonsense_Mutation	SNP	G	G	T			TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr11:1263664G>T	ENST00000529681.1	+	31	5612	c.5554G>T	c.(5554-5556)Gag>Tag	p.E1852*	MUC5B_ENST00000447027.1_Nonsense_Mutation_p.E1855*|RP11-532E4.2_ENST00000532061.2_RNA	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	1852	7 X Cys-rich subdomain repeats.|Thr-rich.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CTGCAGCCTGGAGACGGGGCT	0.587																																																	0								ENSG00000117983						55.0	71.0	65.0					11																	1263664		2175	4267	6442	MUC5B	SO:0001587	stop_gained	0			-	HGNC	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.5554G>T	11.37:g.1263664G>T	ENSP00000436812:p.Glu1852*	Somatic	0	47	0.00		0.6820090568639808	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	28	12.50	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_VWF_C,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.E1855*	ENST00000529681.1	37	c.5563	CCDS44515.2	11	.	.	.	.	.	.	.	.	.	.	G	42	9.584036	0.99211	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	.	.	.	4.64	-9.29	0.00653	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	9.4634	0.38798	0.2075:0.6086:0.111:0.0729	.	.	.	.	X	1852;1855;1853;1922	.	ENSP00000343037:E1853X	E	+	1	0	MUC5B	1220240	0.000000	0.05858	0.000000	0.03702	0.054000	0.15201	-3.861000	0.00348	-2.071000	0.00880	0.306000	0.20318	GAG	-	NULL		0.587	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	MUC5B	protein_coding	OTTHUMT00000390041.2	G	XM_001126093	-		1263664	+1	no_errors	ENST00000447027	ensembl	human	known	74_37	nonsense	SNP	0.000	T
CALCB	797	genome.wustl.edu	37	11	15098923	15098923	+	Missense_Mutation	SNP	A	A	T			TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr11:15098923A>T	ENST00000533448.1	+	4	427	c.316A>T	c.(316-318)Agc>Tgc	p.S106C	CALCB_ENST00000523376.1_Missense_Mutation_p.S117C|CALCB_ENST00000324229.6_Missense_Mutation_p.S106C			P10092	CALCB_HUMAN	calcitonin-related polypeptide beta	106					cellular calcium ion homeostasis (GO:0006874)|signal transduction (GO:0007165)	extracellular region (GO:0005576)	neuropeptide hormone activity (GO:0005184)			endometrium(1)|large_intestine(1)|lung(1)|skin(2)	5						CATGGTGAAGAGCAACTTCGT	0.572																																																	0								ENSG00000175868						62.0	58.0	59.0					11																	15098923		2200	4294	6494	CALCB	SO:0001583	missense	0			-	HGNC		CCDS7820.1	11p14.2-p12	2013-02-25	2008-02-20			ENSG00000175868		"""Endogenous ligands"""	1438	protein-coding gene	gene with protein product		114160	"""calcitonin 2"""	CALC2			Standard	NM_000728		Approved	FLJ30166, CGRP-II	uc001mlx.1	P10092		ENST00000533448.1:c.316A>T	11.37:g.15098923A>T	ENSP00000433490:p.Ser106Cys	Somatic	0	27	0.00		0.6820090568639808	3	72.73	8	WXS	Illumina HiSeq 2500	Phase_IV	tier1	33	7	82.50	A8K573|D3DQX4|Q569I0|Q9UCN9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Procalcitonin/adrenomedullin,smart_Calcitonin_peptide-like,prints_Calcitonin_gene-rel_peptide,prints_Pro-islet_amyloid_polypep	p.S106C	ENST00000533448.1	37	c.316	CCDS7820.1	11	.	.	.	.	.	.	.	.	.	.	A	17.97	3.518912	0.64634	.	.	ENSG00000175868	ENST00000523376;ENST00000324229;ENST00000533448	T;T;T	0.24350	1.86;1.86;1.86	4.87	2.56	0.30785	Calcitonin peptide-like (1);	0.905584	0.09411	N	0.805874	T	0.41604	0.1166	M	0.65975	2.015	0.27334	N	0.956703	D	0.61697	0.99	P	0.57371	0.819	T	0.19353	-1.0308	10	0.59425	D	0.04	-0.0815	7.9838	0.30198	0.8442:0.0:0.1558:0.0	.	106	P10092	CALCB_HUMAN	C	117;106;106	ENSP00000428882:S117C;ENSP00000346017:S106C;ENSP00000433490:S106C	ENSP00000346017:S106C	S	+	1	0	CALCB	15055499	1.000000	0.71417	0.995000	0.50966	0.756000	0.42949	3.463000	0.53050	0.315000	0.23110	0.379000	0.24179	AGC	-	pfam_Procalcitonin/adrenomedullin,smart_Calcitonin_peptide-like,prints_Calcitonin_gene-rel_peptide,prints_Pro-islet_amyloid_polypep		0.572	CALCB-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	CALCB	protein_coding	OTTHUMT00000387433.1	A	NM_000728	-		15098923	+1	no_errors	ENST00000324229	ensembl	human	known	74_37	missense	SNP	1.000	T
WBP2NL	164684	genome.wustl.edu	37	22	42398850	42398854	+	Intron	DEL	TACTT	TACTT	-	rs133310|rs201279320|rs71751842|rs199509113	byFrequency	TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	TACTT	TACTT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr22:42398850_42398854delTACTT	ENST00000328823.9	+	1	93				WBP2NL_ENST00000461730.1_3'UTR	NM_152613.2	NP_689826.2	Q6ICG8	WBP2L_HUMAN	WBP2 N-terminal like						egg activation (GO:0007343)|male pronucleus assembly (GO:0035039)|meiotic nuclear division (GO:0007126)	perinuclear theca (GO:0033011)	WW domain binding (GO:0050699)			breast(2)|large_intestine(3)|lung(5)|ovary(3)|prostate(1)	14						GGATAGAAACTACTTTAAAGAACCA	0.468														2430	0.485224	0.2519	0.3473	5008	,	,		17791	0.8641		0.4742	False		,,,				2504	0.5194																0								ENSG00000183066																																			WBP2NL	SO:0001627	intron_variant	0				HGNC	BC022546	CCDS14029.1	22q13.2	2007-07-18			ENSG00000183066	ENSG00000183066			28389	protein-coding gene	gene with protein product	"""postacrosomal sheath WW domain-binding protein"""	610981				17289678	Standard	NM_152613		Approved	FLJ26145, MGC26816, PAWP	uc003bbt.3	Q6ICG8	OTTHUMG00000151270	ENST00000328823.9:c.62+3966TACTT>-	22.37:g.42398850_42398854delTACTT		Somatic	NA	NA	NA		0.6820090568639808	3	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A3KFF7|A8MSG5|B3KXX4|Q8TBF0|Q8TBF3	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000328823.9	37	NULL	CCDS14029.1	22																																																																																			-	-		0.468	WBP2NL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WBP2NL	protein_coding	OTTHUMT00000322037.1	TACTT	NM_152613			42398854	+1	no_errors	ENST00000461730	ensembl	human	known	74_37	rna	DEL	0.001:0.003:0.012:0.016:0.015	-
MYOCD	93649	genome.wustl.edu	37	17	12647692	12647694	+	In_Frame_Del	DEL	CAG	CAG	-	rs536181176	byFrequency	TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	CAG	CAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr17:12647692_12647694delCAG	ENST00000343344.4	+	8	910_912	c.910_912delCAG	c.(910-912)cagdel	p.Q310del	AC005358.1_ENST00000609971.1_In_Frame_Del_p.Q214del|MYOCD_ENST00000425538.1_In_Frame_Del_p.Q310del|MYOCD_ENST00000395988.1_3'UTR			Q8IZQ8	MYCD_HUMAN	myocardin	310	Gln-rich.				cardiac muscle cell differentiation (GO:0055007)|cardiac ventricle development (GO:0003231)|cardiocyte differentiation (GO:0035051)|cell growth involved in cardiac muscle cell development (GO:0061049)|cellular component maintenance (GO:0043954)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hypoxia (GO:0071456)|digestive tract development (GO:0048565)|ductus arteriosus closure (GO:0097070)|hepatic stellate cell activation (GO:0035733)|lung alveolus development (GO:0048286)|negative regulation of beta-amyloid clearance (GO:1900222)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of skeletal muscle cell differentiation (GO:2001015)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|positive regulation of cardiac vascular smooth muscle cell differentiation (GO:2000724)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell differentiation (GO:0051152)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003257)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of cell growth by extracellular stimulus (GO:0001560)|regulation of histone acetylation (GO:0035065)|regulation of myoblast differentiation (GO:0045661)|regulation of smooth muscle cell differentiation (GO:0051150)|response to hypoxia (GO:0001666)|smooth muscle cell differentiation (GO:0051145)|urinary bladder development (GO:0060157)|uterus development (GO:0060065)|vasculogenesis (GO:0001570)|ventricular cardiac muscle cell differentiation (GO:0055012)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|protein domain specific binding (GO:0019904)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|liver(2)|lung(33)|ovary(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	70				UCEC - Uterine corpus endometrioid carcinoma (92;0.0969)		AATCCTCAGCcagcagcagcagc	0.596														27	0.00539137	0.0098	0.0029	5008	,	,		19180	0.001		0.001	False		,,,				2504	0.0102																0								ENSG00000141052		,,	189,4075		0,189,1943					,,	3.1	1.0			38	472,7780		2,468,3656	no	coding,coding,coding	MYOCD	NM_153604.2,NM_001146313.1,NM_001146312.1	,,	2,657,5599	A1A1,A1R,RR		5.7198,4.4325,5.2812	,,	,,		661,11855				MYOCD	SO:0001651	inframe_deletion	0				HGNC	AF532596	CCDS11163.1, CCDS54091.1	17p11.2	2004-03-01			ENSG00000141052	ENSG00000141052			16067	protein-coding gene	gene with protein product		606127				11439182, 12397177	Standard	XM_005256863		Approved	MYCD	uc002gno.2	Q8IZQ8	OTTHUMG00000058767	ENST00000343344.4:c.910_912delCAG	17.37:g.12647701_12647703delCAG	ENSP00000341835:p.Gln310del	Somatic	0	35	0.00		0.6820090568639808	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	19	13.64	Q5UBU5|Q8N7Q1	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_RPEL_repeat,pfam_SAP_dom,smart_RPEL_repeat,smart_SAP_dom,pfscan_RPEL_repeat,pfscan_SAP_dom	p.Q307in_frame_del	ENST00000343344.4	37	c.910_912	CCDS11163.1	17																																																																																			-	NULL		0.596	MYOCD-004	KNOWN	basic|appris_principal|CCDS	protein_coding	MYOCD	protein_coding	OTTHUMT00000129950.1	CAG	NM_153604			12647694	+1	no_errors	ENST00000425538	ensembl	human	known	74_37	in_frame_del	DEL	1.000:1.000:1.000	-
ELL2	22936	genome.wustl.edu	37	5	95249513	95249513	+	Missense_Mutation	SNP	C	C	G			TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr5:95249513C>G	ENST00000237853.4	-	4	792	c.443G>C	c.(442-444)cGa>cCa	p.R148P	ELL2_ENST00000431061.2_Intron|ELL2_ENST00000506628.1_Intron	NM_012081.5	NP_036213.2	O00472	ELL2_HUMAN	elongation factor, RNA polymerase II, 2	148					regulation of transcription, DNA-templated (GO:0006355)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|transcription elongation from RNA polymerase II promoter (GO:0006368)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(10)|pancreas(1)|prostate(2)	24		all_cancers(142;2.04e-06)|all_epithelial(76;3.1e-09)|all_lung(232;0.00309)|Lung NSC(167;0.00454)|Ovarian(225;0.0165)|Colorectal(57;0.0343)|Breast(839;0.198)		all cancers(79;2.16e-15)		TTTTGTGCTTCGGTTGCGGGA	0.418																																																	0								ENSG00000118985						191.0	191.0	191.0					5																	95249513		2203	4300	6503	ELL2	SO:0001583	missense	0			-	HGNC	U88629	CCDS4080.1	5q15	2010-11-29			ENSG00000118985	ENSG00000118985			17064	protein-coding gene	gene with protein product		601874				9108030	Standard	NM_012081		Approved		uc003klr.4	O00472	OTTHUMG00000122085	ENST00000237853.4:c.443G>C	5.37:g.95249513C>G	ENSP00000237853:p.Arg148Pro	Somatic	0	52	0.00		0.6820090568639808	107	42.47	79	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	31	46.55	B4DNK7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RNA_pol_II_elong_fac_ELL,pfam_Occludin_RNApol2_elong_fac_ELL	p.R148P	ENST00000237853.4	37	c.443	CCDS4080.1	5	.	.	.	.	.	.	.	.	.	.	C	27.9	4.870765	0.91587	.	.	ENSG00000118985	ENST00000237853	T	0.32753	1.44	5.49	5.49	0.81192	.	0.182978	0.49916	D	0.000137	T	0.60612	0.2282	M	0.81942	2.565	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	T	0.64245	-0.6453	10	0.87932	D	0	-2.0343	19.3344	0.94309	0.0:1.0:0.0:0.0	.	148	O00472	ELL2_HUMAN	P	148	ENSP00000237853:R148P	ENSP00000237853:R148P	R	-	2	0	ELL2	95275269	0.999000	0.42202	1.000000	0.80357	0.998000	0.95712	4.030000	0.57260	2.740000	0.93945	0.563000	0.77884	CGA	-	pfam_RNA_pol_II_elong_fac_ELL		0.418	ELL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELL2	protein_coding	OTTHUMT00000242846.1	C	NM_012081	-		95249513	-1	no_errors	ENST00000237853	ensembl	human	known	74_37	missense	SNP	1.000	G
GTF2H5	404672	genome.wustl.edu	37	6	158596076	158596077	+	Intron	INS	-	-	TGTGTATATATGTGTGTGTGTGTGTGTGTGTGTA	rs112780535	byFrequency	TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr6:158596076_158596077insTGTGTATATATGTGTGTGTGTGTGTGTGTGTGTA	ENST00000607778.1	+	2	113				AL590703.1_ENST00000580588.1_RNA	NM_207118.2	NP_997001.1	Q6ZYL4	TF2H5_HUMAN	general transcription factor IIH, polypeptide 5						cellular response to gamma radiation (GO:0071480)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, preincision complex assembly (GO:0006294)|regulation of transcription, DNA-templated (GO:0006355)|rRNA processing (GO:0006364)|transcription elongation from RNA polymerase I promoter (GO:0006362)	core TFIIH complex (GO:0000439)|nucleolus (GO:0005730)	rDNA binding (GO:0000182)						Breast(66;0.00519)|Ovarian(120;0.123)|Prostate(117;0.178)		OV - Ovarian serous cystadenocarcinoma(65;5.98e-18)|BRCA - Breast invasive adenocarcinoma(81;2.83e-05)		gtgtgtgtgtgtATACACACAC	0.411								Nucleotide excision repair (NER)																																									0								ENSG00000265803																																			AL590703.1	SO:0001627	intron_variant	0				Clone_based_ensembl_gene	AK055106	CCDS5256.1	6q25.3	2014-09-17	2004-07-15	2004-07-16		ENSG00000272047		"""General transcription factors"", ""General transcription factor IIH complex subunits"""	21157	protein-coding gene	gene with protein product	"""DNA repair syndrome trichothiodystrophy group A"""	608780	"""chromosome 6 open reading frame 175"", ""trichothiodystrophy"""	C6orf175, TTD		15220921	Standard	NM_207118		Approved	FLJ30544, bA120J8.2, TTD-A, TFB5, TFIIH, TTDA	uc003qrd.3	Q6ZYL4		ENST00000607778.1:c.35+4506->TGTGTATATATGTGTGTGTGTGTGTGTGTGTGTA	6.37:g.158596076_158596077insTGTGTATATATGTGTGTGTGTGTGTGTGTGTGTA		Somatic	NA	NA	NA		0.6820090568639808	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q0P5V8	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000607778.1	37	NULL	CCDS5256.1	6																																																																																			-	-		0.411	GTF2H5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000265803	protein_coding	OTTHUMT00000042865.2	-	NM_207118			158596077	+1	no_errors	ENST00000580588	ensembl	human	novel	74_37	rna	INS	0.000:0.000	TGTGTATATATGTGTGTGTGTGTGTGTGTGTGTA
AQP4	361	genome.wustl.edu	37	18	24442473	24442473	+	Silent	SNP	C	C	A			TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr18:24442473C>A	ENST00000383168.4	-	2	248	c.120G>T	c.(118-120)gcG>gcT	p.A40A	AQP4_ENST00000583022.1_5'Flank|AQP4_ENST00000581374.1_Silent_p.A18A|AQP4-AS1_ENST00000568797.1_RNA|AQP4_ENST00000440832.3_Silent_p.A18A|AQP4-AS1_ENST00000582605.1_RNA|AQP4-AS1_ENST00000579964.1_RNA|AQP4-AS1_ENST00000578701.1_RNA	NM_001650.4|NM_004028.3	NP_001641.1|NP_004019.1	P55087	AQP4_HUMAN	aquaporin 4	40					carbon dioxide transport (GO:0015670)|cellular response to estradiol stimulus (GO:0071392)|cellular response to interferon-gamma (GO:0071346)|female pregnancy (GO:0007565)|hyperosmotic salinity response (GO:0042538)|multicellular organismal water homeostasis (GO:0050891)|protein homooligomerization (GO:0051260)|renal water absorption (GO:0070295)|response to glucocorticoid (GO:0051384)|response to radiation (GO:0009314)|sensory perception of sound (GO:0007605)|transmembrane transport (GO:0055085)|transport (GO:0006810)|water transport (GO:0006833)	basolateral plasma membrane (GO:0016323)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|T-tubule (GO:0030315)	porin activity (GO:0015288)|water channel activity (GO:0015250)|water transmembrane transporter activity (GO:0005372)			kidney(2)|large_intestine(3)|lung(5)|skin(1)	11	all_cancers(21;0.0172)|Lung NSC(5;0.00299)|all_lung(6;0.00747)|Ovarian(20;0.124)					CCAGAAATTCCGCTGTGACTG	0.473																																																	0								ENSG00000171885						142.0	145.0	144.0					18																	24442473		2203	4300	6503	AQP4	SO:0001819	synonymous_variant	0			-	HGNC	U63622	CCDS11889.1, CCDS58617.1	18q11.2-q12.1	2005-09-20			ENSG00000171885	ENSG00000171885		"""Ion channels / Aquaporins"""	637	protein-coding gene	gene with protein product		600308				7528931	Standard	NM_001650		Approved	MIWC	uc002kwa.3	P55087	OTTHUMG00000131955	ENST00000383168.4:c.120G>T	18.37:g.24442473C>A		Somatic	0	35	0.00		0.6820090568639808	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	39	9.30	P78564	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.R39L	ENST00000383168.4	37	c.116	CCDS11889.1	18																																																																																			-	NULL		0.473	AQP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AQP4	protein_coding	OTTHUMT00000254914.2	C	NM_001650, NM_004028	-		24442473	-1	no_errors	ENST00000383170	ensembl	human	known	74_37	missense	SNP	0.855	A
FAT4	79633	genome.wustl.edu	37	4	126371057	126371057	+	Silent	SNP	C	C	A			TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr4:126371057C>A	ENST00000394329.3	+	9	8899	c.8886C>A	c.(8884-8886)tcC>tcA	p.S2962S	FAT4_ENST00000335110.5_Silent_p.S1260S	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	2962	Cadherin 28. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						GTAAACCTTCCTTAATTAGTG	0.333																																																	0								ENSG00000196159						66.0	68.0	68.0					4																	126371057		2203	4299	6502	FAT4	SO:0001819	synonymous_variant	0			-	HGNC	AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.8886C>A	4.37:g.126371057C>A		Somatic	0	53	0.00		0.6820090568639808	19	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	42	10.64	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Laminin_G,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,superfamily_Cadherin-like,superfamily_ConA-like_lec_gl_sf,smart_Cadherin,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.S2962	ENST00000394329.3	37	c.8886	CCDS3732.3	4																																																																																			-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.333	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT4	protein_coding	OTTHUMT00000256765.2	C	NM_024582	-		126371057	+1	no_errors	ENST00000394329	ensembl	human	known	74_37	silent	SNP	0.000	A
MKLN1	4289	genome.wustl.edu	37	7	130794804	130794805	+	5'Flank	INS	-	-	GGCGGC	rs370827120|rs60530281|rs139750586	byFrequency	TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr7:130794804_130794805insGGCGGC	ENST00000421797.2	+	0	0				MKLN1-AS1_ENST00000431189.1_RNA|MKLN1-AS1_ENST00000429901.1_RNA|MKLN1-AS1_ENST00000423414.1_RNA|MKLN1-AS1_ENST00000451786.1_RNA	NM_001145354.1	NP_001138826.1	Q9UL63	MKLN1_HUMAN	muskelin 1, intracellular mediator containing kelch motifs						signal transduction (GO:0007165)	cytoplasm (GO:0005737)				breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(10)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	28	Melanoma(18;0.162)					TGCAAGAAGGAggcggcggcgg	0.688														4903	0.979034	0.944	0.9899	5008	,	,		11919	0.995		0.9901	False		,,,				2504	0.9908																0								ENSG00000231721																																			MKLN1-AS1	SO:0001631	upstream_gene_variant	0				HGNC	AF047489	CCDS34754.1	7q32	2008-07-18			ENSG00000128585	ENSG00000128585			7109	protein-coding gene	gene with protein product		605623				10640805	Standard	NM_001145354		Approved	TWA2	uc011kpm.2	Q9UL63	OTTHUMG00000154880		7.37:g.130794805_130794810dupGGCGGC	Exception_encountered	Somatic	NA	NA	NA		0.6820090568639808	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A4D1M8|A6NG43|Q9NSK4|Q9NUS8	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000421797.2	37	NULL		7																																																																																			-	-		0.688	MKLN1-012	NOVEL	basic|exp_conf	protein_coding	MKLN1-AS1	protein_coding	OTTHUMT00000338094.2	-	NM_013255			130794805	-1	no_errors	ENST00000451786	ensembl	human	known	74_37	rna	INS	0.275:0.977	GGCGGC
EMC3	55831	genome.wustl.edu	37	3	10049212	10049212	+	lincRNA	SNP	G	G	A			TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr3:10049212G>A	ENST00000383808.2	-	0	786				AC034193.5_ENST00000326237.3_RNA																							GTGGCATGAAGCGCTCCCCCT	0.577																																																	0								ENSG00000206567						116.0	116.0	116.0					3																	10049212		1990	4162	6152	AC022007.5			0			-	Clone_based_vega_gene																													3.37:g.10049212G>A		Somatic	0	44	0.00		0.6820090568639808	2	33.33	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	30	41.18		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000383808.2	37	NULL		3																																																																																			-	-		0.577	AC022007.5-001	KNOWN	basic	lincRNA	ENSG00000206567	lincRNA	OTTHUMT00000339469.1	G		-		10049212	-1	no_errors	ENST00000383808	ensembl	human	known	74_37	rna	SNP	0.002	A
PDE4DIP	9659	genome.wustl.edu	37	1	144853254	144853254	+	Intron	SNP	A	A	G			TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr1:144853254A>G	ENST00000369354.3	-	44	7189				PDE4DIP_ENST00000369356.4_Intron|PDE4DIP_ENST00000524974.1_Intron|PDE4DIP_ENST00000313382.9_Intron|PDE4DIP_ENST00000369359.4_Intron|PDE4DIP_ENST00000530740.1_Intron			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein						cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		TACAGAGGCAATCCTGTAAGT	0.363			T	PDGFRB	MPD																																			Dom	yes		1	1q12	9659	phosphodiesterase 4D interacting protein (myomegalin)		L	0								ENSG00000178104																																			PDE4DIP	SO:0001627	intron_variant	0			-	HGNC	AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000369354.3:c.7000-755T>C	1.37:g.144853254A>G		Somatic	1	122	0.81		0.6820090568639808	7	12.50	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	43	126	25.44	A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000369354.3	37	NULL	CCDS30824.1	1																																																																																			-	-		0.363	PDE4DIP-003	KNOWN	basic|CCDS	protein_coding	PDE4DIP	protein_coding	OTTHUMT00000038858.2	A	NM_022359	-		144853254	-1	no_errors	ENST00000526182	ensembl	human	known	74_37	rna	SNP	1.000	G
LCE1A	353131	genome.wustl.edu	37	1	152800190	152800190	+	Missense_Mutation	SNP	G	G	A			TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr1:152800190G>A	ENST00000335123.2	+	1	242	c.242G>A	c.(241-243)aGa>aAa	p.R81K		NM_178348.2	NP_848125.1	Q5T7P2	LCE1A_HUMAN	late cornified envelope 1A	81	Cys-rich.				keratinization (GO:0031424)					endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|prostate(1)|skin(1)	8	Lung NSC(65;9.06e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			CACCGTCACAGACTCCAGAGC	0.697																																																	0								ENSG00000186844						20.0	25.0	23.0					1																	152800190		2187	4290	6477	LCE1A	SO:0001583	missense	0			-	HGNC		CCDS1028.1	1q21.3	2011-01-28			ENSG00000186844	ENSG00000186844		"""Late cornified envelopes"""	29459	protein-coding gene	gene with protein product		612603				11698679	Standard	NM_178348		Approved	LEP1	uc010pdw.2	Q5T7P2	OTTHUMG00000012447	ENST00000335123.2:c.242G>A	1.37:g.152800190G>A	ENSP00000334869:p.Arg81Lys	Somatic	0	29	0.00		0.6820090568639808	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	72	11.11		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.R81K	ENST00000335123.2	37	c.242	CCDS1028.1	1	.	.	.	.	.	.	.	.	.	.	G	2.564	-0.301115	0.05495	.	.	ENSG00000186844	ENST00000368766;ENST00000335123	T;T	0.03860	3.78;3.78	4.13	-0.0229	0.13945	.	0.195264	0.25380	N	0.031086	T	0.02418	0.0074	M	0.81112	2.525	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.33548	-0.9864	10	0.87932	D	0	.	6.334	0.21287	0.4733:0.0:0.5267:0.0	.	81	Q5T7P2	LCE1A_HUMAN	K	81	ENSP00000357755:R81K;ENSP00000334869:R81K	ENSP00000334869:R81K	R	+	2	0	LCE1A	151066814	0.000000	0.05858	0.001000	0.08648	0.018000	0.09664	0.254000	0.18314	-0.091000	0.12440	-0.253000	0.11424	AGA	-	NULL		0.697	LCE1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCE1A	protein_coding	OTTHUMT00000034660.2	G	NM_178348	-		152800190	+1	no_errors	ENST00000335123	ensembl	human	known	74_37	missense	SNP	0.002	A
ZFC3H1	196441	genome.wustl.edu	37	12	72038834	72038834	+	Missense_Mutation	SNP	C	C	G			TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr12:72038834C>G	ENST00000378743.3	-	4	1460	c.1102G>C	c.(1102-1104)Gaa>Caa	p.E368Q		NM_144982.4	NP_659419.3	O60293	ZC3H1_HUMAN	zinc finger, C3H1-type containing	368					RNA processing (GO:0006396)	extracellular space (GO:0005615)|intracellular (GO:0005622)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(31)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	69						TCAGATAGTTCCTCTTCATCT	0.323																																																	0								ENSG00000133858						73.0	62.0	65.0					12																	72038834		1807	4072	5879	ZFC3H1	SO:0001583	missense	0			-	HGNC	AB011118	CCDS41813.1	12q21.1	2013-01-25	2008-10-01	2008-10-01		ENSG00000133858		"""Zinc finger, C3H1-type containing"""	28328	protein-coding gene	gene with protein product			"""proline/serine-rich coiled-coil 2"", ""coiled-coil domain containing 131"""	PSRC2, CCDC131		9628581	Standard	NM_144982		Approved	MGC23401, KIAA0546	uc001swo.2	O60293	OTTHUMG00000169545	ENST00000378743.3:c.1102G>C	12.37:g.72038834C>G	ENSP00000368017:p.Glu368Gln	Somatic	0	64	0.00		0.6820090568639808	23	30.30	10	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	73	21.51	Q6GMU1|Q6P2S9|Q6ZV36|Q96BE7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Putative_zinc-finger_domain,smart_HAT,pfscan_TPR-contain_dom	p.E368Q	ENST00000378743.3	37	c.1102	CCDS41813.1	12	.	.	.	.	.	.	.	.	.	.	C	27.8	4.866294	0.91511	.	.	ENSG00000133858	ENST00000378743	T	0.40225	1.04	5.45	5.45	0.79879	.	0.000000	0.64402	D	0.000001	T	0.55065	0.1897	L	0.29908	0.895	0.80722	D	1	D	0.71674	0.998	D	0.78314	0.991	T	0.55477	-0.8135	10	0.51188	T	0.08	.	19.2963	0.94124	0.0:1.0:0.0:0.0	.	368	O60293	ZC3H1_HUMAN	Q	368	ENSP00000368017:E368Q	ENSP00000368017:E368Q	E	-	1	0	ZFC3H1	70325101	1.000000	0.71417	0.998000	0.56505	0.972000	0.66771	6.742000	0.74843	2.560000	0.86352	0.557000	0.71058	GAA	-	NULL		0.323	ZFC3H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFC3H1	protein_coding	OTTHUMT00000404751.1	C	NM_144982	-		72038834	-1	no_errors	ENST00000378743	ensembl	human	known	74_37	missense	SNP	1.000	G
PIDD1	55367	genome.wustl.edu	37	11	803282	803282	+	Missense_Mutation	SNP	G	G	C			TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr11:803282G>C	ENST00000347755.5	-	3	742	c.601C>G	c.(601-603)Ctc>Gtc	p.L201V	PIDD_ENST00000534649.1_5'Flank|PIDD_ENST00000411829.2_Missense_Mutation_p.L201V	NM_145886.3|NM_145887.3	NP_665893.2|NP_665894.2																					TTCTGAGAGAGATCGAGGCGC	0.667																																																	0								ENSG00000177595						50.0	58.0	55.0					11																	803282		2203	4299	6502	PIDD	SO:0001583	missense	0			-	HGNC																												ENST00000347755.5:c.601C>G	11.37:g.803282G>C	ENSP00000337797:p.Leu201Val	Somatic	0	59	0.00		0.6820090568639808	27	3.57	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	37	30.19		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_S68_pidd,pfam_Death_domain,pfam_Leu-rich_rpt,pfam_ZU5,superfamily_DEATH-like_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Death_domain,pfscan_Death_domain,pfscan_ZU5	p.L201V	ENST00000347755.5	37	c.601	CCDS7716.1	11	.	.	.	.	.	.	.	.	.	.	G	14.41	2.527791	0.44969	.	.	ENSG00000177595	ENST00000411829;ENST00000347755	T;T	0.74421	-0.84;-0.84	4.42	4.42	0.53409	.	0.092812	0.45867	D	0.000332	T	0.73552	0.3601	M	0.62016	1.91	0.42222	D	0.991851	P;P;P	0.44478	0.836;0.803;0.803	B;B;B	0.40982	0.345;0.234;0.234	T	0.80067	-0.1537	10	0.72032	D	0.01	.	17.1972	0.86895	0.0:0.0:1.0:0.0	.	201;55;201	Q9HB75;Q9HB75-3;Q9HB75-2	PIDD_HUMAN;.;.	V	201	ENSP00000416801:L201V;ENSP00000337797:L201V	ENSP00000337797:L201V	L	-	1	0	PIDD	793282	1.000000	0.71417	0.966000	0.40874	0.686000	0.39977	5.146000	0.64845	2.299000	0.77371	0.455000	0.32223	CTC	-	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp		0.667	PIDD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIDD	protein_coding	OTTHUMT00000257103.1	G		-		803282	-1	no_errors	ENST00000347755	ensembl	human	known	74_37	missense	SNP	1.000	C
PPARGC1A	10891	genome.wustl.edu	37	4	23833358	23833358	+	Missense_Mutation	SNP	T	T	A			TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr4:23833358T>A	ENST00000264867.2	-	3	370	c.251A>T	c.(250-252)aAt>aTt	p.N84I	PPARGC1A_ENST00000509702.1_5'UTR	NM_013261.3	NP_037393.1	Q9UBK2	PRGC1_HUMAN	peroxisome proliferator-activated receptor gamma, coactivator 1 alpha	84					androgen metabolic process (GO:0008209)|androgen receptor signaling pathway (GO:0030521)|brown fat cell differentiation (GO:0050873)|cellular glucose homeostasis (GO:0001678)|cellular respiration (GO:0045333)|cellular response to fatty acid (GO:0071398)|cellular response to hypoxia (GO:0071456)|cellular response to nitrite (GO:0071250)|cellular response to oxidative stress (GO:0034599)|cellular response to thyroid hormone stimulus (GO:0097067)|cellular response to tumor necrosis factor (GO:0071356)|circadian regulation of gene expression (GO:0032922)|digestion (GO:0007586)|fatty acid oxidation (GO:0019395)|flavone metabolic process (GO:0051552)|galactose metabolic process (GO:0006012)|gluconeogenesis (GO:0006094)|mitochondrion organization (GO:0007005)|mRNA processing (GO:0006397)|negative regulation of glycolytic process (GO:0045820)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron death (GO:1901215)|negative regulation of receptor activity (GO:2000272)|positive regulation of ATP biosynthetic process (GO:2001171)|positive regulation of cellular respiration (GO:1901857)|positive regulation of energy homeostasis (GO:2000507)|positive regulation of fatty acid oxidation (GO:0046321)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of histone acetylation (GO:0035066)|positive regulation of mitochondrial DNA metabolic process (GO:1901860)|positive regulation of mitochondrion organization (GO:0010822)|positive regulation of muscle tissue development (GO:1901863)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein stabilization (GO:0050821)|regulation of circadian rhythm (GO:0042752)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of transcription, DNA-templated (GO:0006355)|respiratory electron transport chain (GO:0022904)|response to cold (GO:0009409)|response to epinephrine (GO:0071871)|response to leucine (GO:0043201)|response to muscle activity (GO:0014850)|response to norepinephrine (GO:0071873)|response to starvation (GO:0042594)|response to statin (GO:0036273)|RNA splicing (GO:0008380)|temperature homeostasis (GO:0001659)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytosol (GO:0005829)|DNA-directed RNA polymerase II, core complex (GO:0005665)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|RNA polymerase II transcription cofactor activity (GO:0001104)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(7)|liver(1)|lung(24)|ovary(3)|skin(5)	51		Breast(46;0.0503)				GTTTGCCTCATTCTCTTCATC	0.463																																					Esophageal Squamous(29;694 744 13796 34866 44181)												0								ENSG00000109819						256.0	216.0	230.0					4																	23833358		2203	4300	6503	PPARGC1A	SO:0001583	missense	0			-	HGNC	AF106698	CCDS3429.1	4p15.1	2013-02-12	2006-10-17	2004-02-04	ENSG00000109819	ENSG00000109819		"""RNA binding motif (RRM) containing"""	9237	protein-coding gene	gene with protein product		604517	"""peroxisome proliferative activated receptor, gamma, coactivator 1"", ""peroxisome proliferative activated receptor, gamma, coactivator 1, alpha"""	PPARGC1		10585775	Standard	NM_013261		Approved	PGC1, PGC1A	uc003gqs.3	Q9UBK2	OTTHUMG00000097747	ENST00000264867.2:c.251A>T	4.37:g.23833358T>A	ENSP00000264867:p.Asn84Ile	Somatic	0	39	0.00		0.6820090568639808	1	50.00	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	33	32.65	B7Z406|G8DM16|I3RTT5|I3RTT6|I3RTT7|I3RTT8|I3RTT9|Q3LIG1|Q4W5M7|Q9UN32	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.N84I	ENST00000264867.2	37	c.251	CCDS3429.1	4	.	.	.	.	.	.	.	.	.	.	T	17.48	3.401158	0.62288	.	.	ENSG00000109819	ENST00000264867	T	0.39592	1.07	6.03	4.84	0.62591	.	0.040398	0.85682	D	0.000000	T	0.62196	0.2408	M	0.84948	2.725	0.80722	D	1	D	0.63880	0.993	P	0.59288	0.855	T	0.67473	-0.5662	10	0.87932	D	0	-7.6645	10.869	0.46872	0.0:0.1303:0.0:0.8697	.	84	Q9UBK2	PRGC1_HUMAN	I	84	ENSP00000264867:N84I	ENSP00000264867:N84I	N	-	2	0	PPARGC1A	23442456	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.244000	0.51399	1.090000	0.41315	0.533000	0.62120	AAT	-	NULL		0.463	PPARGC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPARGC1A	protein_coding	OTTHUMT00000214976.1	T	NM_013261	-		23833358	-1	no_errors	ENST00000264867	ensembl	human	known	74_37	missense	SNP	1.000	A
SNORD3C	780853	genome.wustl.edu	37	17	19091345	19091345	+	lincRNA	SNP	G	G	A			TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr17:19091345G>A	ENST00000362428.1	-	0	432				SNORD3A_ENST00000365494.1_lincRNA					small nucleolar RNA, C/D box 3C																		atactttcagggatcatttct	0.468																																																	0								ENSG00000263934						2.0	1.0	1.0					17																	19091345		218	143	361	SNORD3A			0			-	HGNC			17p11.2	2013-09-05			ENSG00000199298	ENSG00000264940			33191	non-coding RNA	RNA, small nucleolar						9365252	Standard	NR_006881		Approved	U3-3					17.37:g.19091345G>A		Somatic	0	176	0.00		0.6820090568639808	3	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	54	65	45.38		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000362428.1	37	NULL		17																																																																																			-	-		0.468	SNORD3C-201	KNOWN	basic	snoRNA	SNORD3A	lincRNA		G	NR_006881	-		19091345	+1	no_errors	ENST00000365494	ensembl	human	known	74_37	rna	SNP	1.000	A
PASK	23178	genome.wustl.edu	37	2	242062177	242062177	+	Nonsense_Mutation	SNP	C	C	T			TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr2:242062177C>T	ENST00000405260.1	-	12	3740	c.3042G>A	c.(3040-3042)tgG>tgA	p.W1014*	PASK_ENST00000539818.1_Nonsense_Mutation_p.W798*|PASK_ENST00000358649.4_Nonsense_Mutation_p.W1014*|PASK_ENST00000403638.3_Nonsense_Mutation_p.W1014*|PASK_ENST00000234040.4_Nonsense_Mutation_p.W1014*|PASK_ENST00000544142.1_Nonsense_Mutation_p.W828*	NM_001252120.1	NP_001239049.1	Q96RG2	PASK_HUMAN	PAS domain containing serine/threonine kinase	1014	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				negative regulation of glycogen biosynthetic process (GO:0045719)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of energy homeostasis (GO:2000505)|regulation of glucagon secretion (GO:0070092)|regulation of respiratory gaseous exchange (GO:0043576)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatidylinositol binding (GO:0035091)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|lung(20)|ovary(4)|prostate(4)|skin(1)|stomach(1)|urinary_tract(2)	53		all_cancers(19;4.46e-39)|all_epithelial(40;1.34e-17)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00481)|Lung NSC(271;0.017)|Ovarian(221;0.0228)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;1.34e-31)|all cancers(36;1e-28)|OV - Ovarian serous cystadenocarcinoma(60;3.53e-14)|Kidney(56;4.31e-09)|KIRC - Kidney renal clear cell carcinoma(57;4.35e-08)|BRCA - Breast invasive adenocarcinoma(100;5.64e-06)|Lung(119;0.000596)|LUSC - Lung squamous cell carcinoma(224;0.00481)|Colorectal(34;0.014)|COAD - Colon adenocarcinoma(134;0.0968)		CCACAGCAGTCCACACGAAGC	0.602																																																	0								ENSG00000115687						90.0	96.0	94.0					2																	242062177		2203	4300	6503	PASK	SO:0001587	stop_gained	0			-	HGNC	U79240	CCDS2545.1, CCDS58758.1, CCDS58759.1	2q37.3	2008-05-23			ENSG00000115687	ENSG00000115687			17270	protein-coding gene	gene with protein product		607505				11688972, 11459942, 15148392	Standard	NM_001252119		Approved	PASKIN, KIAA0135, STK37	uc010fzl.2	Q96RG2	OTTHUMG00000133392	ENST00000405260.1:c.3042G>A	2.37:g.242062177C>T	ENSP00000384016:p.Trp1014*	Somatic	0	36	0.00		0.6820090568639808	15	48.28	14	WXS	Illumina HiSeq 2500	Phase_IV	tier1	54	42	56.25	G5E9F1|Q05BE4|Q68DY3|Q6GSJ5|Q86XH6|Q99763|Q9UFR7	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_PAS_fold,superfamily_Kinase-like_dom,superfamily_PAS,smart_PAS,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_PAS,pfscan_Prot_kinase_dom,tigrfam_PAS	p.W1014*	ENST00000405260.1	37	c.3042	CCDS2545.1	2	.	.	.	.	.	.	.	.	.	.	C	47	13.549198	0.99749	.	.	ENSG00000115687	ENST00000234040;ENST00000544142;ENST00000405260;ENST00000358649;ENST00000539818;ENST00000403638	.	.	.	4.57	4.57	0.56435	.	0.000000	0.51477	D	0.000092	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.4983	0.75673	0.0:1.0:0.0:0.0	.	.	.	.	X	1014;828;1014;1014;798;1014	.	ENSP00000234040:W1014X	W	-	3	0	PASK	241710850	1.000000	0.71417	0.998000	0.56505	0.843000	0.47879	6.073000	0.71245	2.240000	0.73641	0.555000	0.69702	TGG	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.602	PASK-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	PASK	protein_coding	OTTHUMT00000323753.1	C	NM_015148	-		242062177	-1	no_errors	ENST00000358649	ensembl	human	known	74_37	nonsense	SNP	1.000	T
SLFN5	162394	genome.wustl.edu	37	17	33585788	33585788	+	Nonsense_Mutation	SNP	C	C	T			TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr17:33585788C>T	ENST00000299977.4	+	2	227	c.79C>T	c.(79-81)Cag>Tag	p.Q27*	SLFN5_ENST00000542451.1_Nonsense_Mutation_p.Q27*|SLFN5_ENST00000592325.1_Nonsense_Mutation_p.Q27*	NM_144975.3	NP_659412.3	Q08AF3	SLFN5_HUMAN	schlafen family member 5	27					cell differentiation (GO:0030154)	nucleus (GO:0005634)	ATP binding (GO:0005524)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(8)|liver(2)|lung(6)|ovary(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(2)	34		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0191)		TGGGACTCAGCAGAGGCAGGA	0.498																																																	0								ENSG00000166750						77.0	74.0	75.0					17																	33585788		2203	4300	6503	SLFN5	SO:0001587	stop_gained	0			-	HGNC	BX647942	CCDS32619.1	17q12	2006-04-05				ENSG00000166750			28286	protein-coding gene	gene with protein product		614952				9846487	Standard	NM_144975		Approved	MGC19764	uc002hjf.4	Q08AF3		ENST00000299977.4:c.79C>T	17.37:g.33585788C>T	ENSP00000299977:p.Gln27*	Somatic	0	77	0.00		0.6820090568639808	14	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00	Q08AF2|Q8WU54|Q96A82	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ATPase_AAA-4,pfam_DUF2075,superfamily_P-loop_NTPase	p.Q27*	ENST00000299977.4	37	c.79	CCDS32619.1	17	.	.	.	.	.	.	.	.	.	.	C	14.60	2.582888	0.46006	.	.	ENSG00000166750	ENST00000299977;ENST00000542451	.	.	.	3.7	-0.953	0.10362	.	0.258391	0.20622	N	0.088771	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	.	9.8704	0.41170	0.6913:0.3087:0.0:0.0	.	.	.	.	X	27	.	ENSP00000299977:Q27X	Q	+	1	0	SLFN5	30609901	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.295000	0.02764	-0.003000	0.14444	0.655000	0.94253	CAG	-	NULL		0.498	SLFN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLFN5	protein_coding	OTTHUMT00000448649.2	C	NM_144975	-		33585788	+1	no_errors	ENST00000299977	ensembl	human	known	74_37	nonsense	SNP	0.000	T
CTR9	9646	genome.wustl.edu	37	11	10772978	10772978	+	Missense_Mutation	SNP	G	G	C			TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr11:10772978G>C	ENST00000361367.2	+	1	445	c.19G>C	c.(19-21)Gag>Cag	p.E7Q		NM_014633.3	NP_055448.1	Q6PD62	CTR9_HUMAN	CTR9, Paf1/RNA polymerase II complex component	7					cellular response to lipopolysaccharide (GO:0071222)|endodermal cell fate commitment (GO:0001711)|histone H2B ubiquitination (GO:0033523)|histone H3-K4 trimethylation (GO:0080182)|histone monoubiquitination (GO:0010390)|interleukin-6-mediated signaling pathway (GO:0070102)|JAK-STAT cascade (GO:0007259)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K79 methylation (GO:2001162)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	Cdc73/Paf1 complex (GO:0016593)|transcriptionally active chromatin (GO:0035327)				breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(3)|large_intestine(7)|lung(12)|ovary(2)|pancreas(1)|stomach(1)	40				all cancers(16;1.64e-07)|Epithelial(150;2.47e-07)|BRCA - Breast invasive adenocarcinoma(625;0.111)		GGGCTCCATCGAGATTCCCCT	0.627																																																	0								ENSG00000198730						45.0	45.0	45.0					11																	10772978		2201	4294	6495	CTR9	SO:0001583	missense	0			-	HGNC	D63875	CCDS7805.1	11p15.3	2013-07-03	2013-07-03	2006-05-22	ENSG00000198730	ENSG00000198730		"""Tetratricopeptide (TTC) repeat domain containing"""	16850	protein-coding gene	gene with protein product		609366	"""SH2 domain binding protein 1 (tetratricopeptide repeat containing)"", ""Ctr9, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)"""	SH2BP1		8590280, 8636124	Standard	NM_014633		Approved	KIAA0155, TSBP, p150TSP	uc001mja.3	Q6PD62	OTTHUMG00000165789	ENST00000361367.2:c.19G>C	11.37:g.10772978G>C	ENSP00000355013:p.Glu7Gln	Somatic	0	45	0.00		0.6820090568639808	36	14.29	6	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	38	17.39	D3DQV8|Q15015	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TPR_1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.E7Q	ENST00000361367.2	37	c.19	CCDS7805.1	11	.	.	.	.	.	.	.	.	.	.	G	36	5.819469	0.96982	.	.	ENSG00000198730	ENST00000361367	T	0.50548	0.74	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	T	0.63943	0.2554	M	0.84219	2.685	0.80722	D	1	D	0.63880	0.993	P	0.51550	0.673	T	0.67313	-0.5702	10	0.48119	T	0.1	-27.3762	18.1653	0.89723	0.0:0.0:1.0:0.0	.	7	Q6PD62	CTR9_HUMAN	Q	7	ENSP00000355013:E7Q	ENSP00000355013:E7Q	E	+	1	0	CTR9	10729554	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.006000	0.93592	2.805000	0.96524	0.650000	0.86243	GAG	-	NULL		0.627	CTR9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTR9	protein_coding	OTTHUMT00000386215.1	G	NM_014633	-		10772978	+1	no_errors	ENST00000361367	ensembl	human	known	74_37	missense	SNP	1.000	C
IRX4	50805	genome.wustl.edu	37	5	1881171	1881183	+	Intron	DEL	CGGTGGGGGGGGG	CGGTGGGGGGGGG	-	rs71871413|rs111961905|rs111619755	byFrequency	TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	CGGTGGGGGGGGG	CGGTGGGGGGGGG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr5:1881171_1881183delCGGTGGGGGGGGG	ENST00000505790.1	-	4	754				IRX4_ENST00000505938.1_5'UTR|CTD-2194D22.3_ENST00000506335.1_RNA|IRX4_ENST00000513692.1_Intron|IRX4_ENST00000231357.2_Intron	NM_001278634.1	NP_001265563.1	P78413	IRX4_HUMAN	iroquois homeobox 4						establishment of organ orientation (GO:0048561)|heart development (GO:0007507)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(1)|lung(7)|ovary(1)|prostate(1)	10				GBM - Glioblastoma multiforme(108;0.242)		GAgcgcgggccggtgggggggggcgggggggAG	0.624														3675	0.733826	0.7171	0.6931	5008	,	,		5605	0.6845		0.8072	False		,,,				2504	0.7607																0								ENSG00000113430																																			IRX4	SO:0001627	intron_variant	0				HGNC	AF124733	CCDS3867.1, CCDS75225.1	5p15.33	2011-06-20	2007-07-13		ENSG00000113430	ENSG00000113430		"""Homeoboxes / TALE class"""	6129	protein-coding gene	gene with protein product		606199	"""iroquois homeobox protein 4"""			10625552	Standard	NM_016358		Approved		uc003jcz.2	P78413	OTTHUMG00000090411	ENST00000505790.1:c.298-223CCCCCCCCCACCG>-	5.37:g.1881171_1881183delCGGTGGGGGGGGG		Somatic	NA	NA	NA		0.6820090568639808	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B2RMW5|D3DTC5|H1AFL0|H1AFL1|Q2NL64|Q9UHR2	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000505790.1	37	NULL	CCDS3867.1	5																																																																																			-	-		0.624	IRX4-004	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	IRX4	protein_coding	OTTHUMT00000365500.1	CGGTGGGGGGGGG	NM_016358			1881183	-1	no_errors	ENST00000505938	ensembl	human	known	74_37	rna	DEL	0.002:0.002:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.003:0.003:0.001	-
SYNE1	23345	genome.wustl.edu	37	6	152647594	152647594	+	Missense_Mutation	SNP	G	G	T			TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr6:152647594G>T	ENST00000367255.5	-	79	15731	c.15130C>A	c.(15130-15132)Cag>Aag	p.Q5044K	SYNE1_ENST00000265368.4_Missense_Mutation_p.Q5044K|SYNE1_ENST00000423061.1_Missense_Mutation_p.Q4973K|SYNE1_ENST00000448038.1_Missense_Mutation_p.Q4973K|SYNE1_ENST00000341594.5_Missense_Mutation_p.Q4791K	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	5044					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CTATGGAACTGATCCTCTGTA	0.512										HNSCC(10;0.0054)																																							0								ENSG00000131018						98.0	101.0	100.0					6																	152647594		2203	4300	6503	SYNE1	SO:0001583	missense	0			-	HGNC	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.15130C>A	6.37:g.152647594G>T	ENSP00000356224:p.Gln5044Lys	Somatic	0	41	0.00		0.6820090568639808	4	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	20	13.04	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.Q5044K	ENST00000367255.5	37	c.15130	CCDS5236.2	6	.	.	.	.	.	.	.	.	.	.	G	12.61	1.990517	0.35131	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594	T;T;T;T;T	0.34472	1.36;1.36;1.36;1.36;1.36	5.75	3.83	0.44106	.	0.111999	0.39909	N	0.001222	T	0.15349	0.0370	L	0.42245	1.32	0.80722	D	1	B;B;B;B	0.17465	0.022;0.003;0.003;0.006	B;B;B;B	0.14023	0.01;0.003;0.003;0.007	T	0.04495	-1.0947	10	0.25106	T	0.35	.	12.7034	0.57046	0.0:0.244:0.6433:0.1127	.	5044;5044;5044;4973	Q8NF91-7;Q8NF91;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.	K	5044;4973;5044;4973;4791	ENSP00000356224:Q5044K;ENSP00000396024:Q4973K;ENSP00000265368:Q5044K;ENSP00000390975:Q4973K;ENSP00000341887:Q4791K	ENSP00000265368:Q5044K	Q	-	1	0	SYNE1	152689287	1.000000	0.71417	0.996000	0.52242	0.990000	0.78478	3.733000	0.55029	1.402000	0.46780	0.655000	0.94253	CAG	-	superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom,smart_Spectrin/alpha-actinin		0.512	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	protein_coding	OTTHUMT00000334755.2	G	NM_182961	-		152647594	-1	no_errors	ENST00000265368	ensembl	human	known	74_37	missense	SNP	0.992	T
BLMH	642	genome.wustl.edu	37	17	28616399	28616399	+	Frame_Shift_Del	DEL	A	A	-			TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr17:28616399delA	ENST00000261714.6	-	3	487	c.313delT	c.(313-315)tggfs	p.W105fs	BLMH_ENST00000394819.3_Intron|RNU6-1267P_ENST00000410747.1_RNA	NM_000386.3	NP_000377.1	Q13867	BLMH_HUMAN	bleomycin hydrolase	105					antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)|response to drug (GO:0042493)|response to toxic substance (GO:0009636)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|carboxypeptidase activity (GO:0004180)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)			breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(2)|ovary(1)|prostate(1)|stomach(1)	13					Bleomycin(DB00290)	ACCTTGTCCCAAAAAAACAGG	0.383																																					Pancreas(127;628 1772 12912 33293 36203)												0								ENSG00000108578						83.0	81.0	82.0					17																	28616399		2203	4300	6503	BLMH	SO:0001589	frameshift_variant	0				HGNC	X92106	CCDS32604.1	17q11.2	2004-02-16				ENSG00000108578			1059	protein-coding gene	gene with protein product		602403				9407121, 9331073	Standard	NM_000386		Approved	BH	uc002hez.2	Q13867		ENST00000261714.6:c.313delT	17.37:g.28616399delA	ENSP00000261714:p.Trp105fs	Somatic	0	41	0.00		0.6820090568639808	29	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	19	13.64	B2R796|Q53F86|Q9UER9	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Peptidase_C1B,pirsf_Peptidase_C1B	p.W105fs	ENST00000261714.6	37	c.313	CCDS32604.1	17																																																																																			-	pfam_Peptidase_C1B,pirsf_Peptidase_C1B		0.383	BLMH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BLMH	protein_coding	OTTHUMT00000447940.1	A	NM_000386			28616399	-1	no_errors	ENST00000261714	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
SYT8	90019	genome.wustl.edu	37	11	1852913	1852913	+	5'Flank	SNP	G	G	C			TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr11:1852913G>C	ENST00000381968.3	+	0	0				SYT8_ENST00000535046.1_Missense_Mutation_p.E77D|SYT8_ENST00000436964.2_Intron	NM_138567.3	NP_612634	Q8NBV8	SYT8_HUMAN	synaptotagmin VIII						acrosome reaction (GO:0007340)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	transporter activity (GO:0005215)			breast(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	6		all_epithelial(84;0.000138)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00136)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		GTCTTGGGGAGACCTTCCTCC	0.662																																																	0								ENSG00000149043																																			SYT8	SO:0001631	upstream_gene_variant	0			-	HGNC	AL137708	CCDS7726.2	11p15.5	2013-01-21			ENSG00000149043	ENSG00000149043		"""Synaptotagmins"""	19264	protein-coding gene	gene with protein product		607719				7791877	Standard	XM_005253216		Approved	DKFZp434K0322	uc001lue.1	Q8NBV8	OTTHUMG00000009026		11.37:g.1852913G>C	Exception_encountered	Somatic	0	83	0.00		0.6820090568639808	0	100.00	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	76	26.21	A6NFJ4|Q9NSV9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.E77D	ENST00000381968.3	37	c.231	CCDS7726.2	11	.	.	.	.	.	.	.	.	.	.	g	13.62	2.292894	0.40594	.	.	ENSG00000149043	ENST00000535046	T	0.22945	1.93	2.65	2.65	0.31530	.	.	.	.	.	T	0.36826	0.0981	.	.	.	0.40531	D	0.980931	.	.	.	.	.	.	T	0.31998	-0.9923	6	0.87932	D	0	.	8.9495	0.35781	0.0:0.0:1.0:0.0	.	.	.	.	D	77	ENSP00000443325:E77D	ENSP00000443325:E77D	E	+	3	2	SYT8	1809489	0.000000	0.05858	0.002000	0.10522	0.008000	0.06430	0.086000	0.14935	1.810000	0.52873	0.313000	0.20887	GAG	-	NULL		0.662	SYT8-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYT8	protein_coding	OTTHUMT00000025013.4	G		-		1852913	+1	no_errors	ENST00000535046	ensembl	human	known	74_37	missense	SNP	0.004	C
LCE6A	448835	genome.wustl.edu	37	1	152816161	152816161	+	Missense_Mutation	SNP	G	G	C	rs368198993		TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr1:152816161G>C	ENST00000431011.2	+	2	330	c.165G>C	c.(163-165)agG>agC	p.R55S		NM_001128600.1	NP_001122072.1	A0A183	LCE6A_HUMAN	late cornified envelope 6A	55					keratinization (GO:0031424)												AGAAGCCTAGGAGGGCTCGTC	0.552																																																	0								ENSG00000235942						106.0	100.0	102.0					1																	152816161		692	1591	2283	LCE6A	SO:0001583	missense	0			-	HGNC	DQ991251	CCDS44227.1	1q21.3	2011-05-24	2006-09-18	2006-09-18	ENSG00000235942	ENSG00000235942		"""Late cornified envelopes"""	31824	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 44"""	C1orf44			Standard	NM_001128600		Approved		uc001fas.4	A0A183	OTTHUMG00000012448	ENST00000431011.2:c.165G>C	1.37:g.152816161G>C	ENSP00000411070:p.Arg55Ser	Somatic	0	51	0.00		0.6820090568639808	0	100.00	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	98	9.26		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.R55S	ENST00000431011.2	37	c.165	CCDS44227.1	1	.	.	.	.	.	.	.	.	.	.	G	5.568	0.289659	0.10567	.	.	ENSG00000235942	ENST00000431011	.	.	.	4.12	-0.391	0.12446	.	.	.	.	.	T	0.05090	0.0136	.	.	.	0.09310	N	1	P	0.42518	0.782	B	0.37888	0.26	T	0.30475	-0.9977	7	0.14656	T	0.56	.	6.7422	0.23443	0.4983:0.0:0.5017:0.0	.	55	A0A183	LCE6A_HUMAN	S	55	.	ENSP00000411070:R55S	R	+	3	2	LCE6A	151082785	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	0.066000	0.14489	-0.054000	0.13266	-0.157000	0.13467	AGG	-	NULL		0.552	LCE6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCE6A	protein_coding	OTTHUMT00000034661.2	G		-		152816161	+1	no_errors	ENST00000431011	ensembl	human	known	74_37	missense	SNP	0.000	C
TAOK3	51347	genome.wustl.edu	37	12	118604652	118604653	+	Intron	INS	-	-	ACACAC	rs376430378|rs373259313|rs200569755|rs7487392		TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr12:118604652_118604653insACACAC	ENST00000392533.3	-	18	2390				TAOK3_ENST00000537952.1_Intron|AC026366.1_ENST00000408353.1_RNA|TAOK3_ENST00000419821.2_Intron	NM_016281.3	NP_057365.3	Q9H2K8	TAOK3_HUMAN	TAO kinase 3						cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|MAPK cascade (GO:0000165)|mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of JNK cascade (GO:0046329)|negative regulation of protein kinase activity (GO:0006469)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase inhibitor activity (GO:0004860)|protein serine/threonine kinase activity (GO:0004674)|transferase activity (GO:0016740)			central_nervous_system(1)|lung(5)|skin(1)	7	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					cacacacacatacacacacaca	0.421																																																	0								ENSG00000221280																																			AC026366.1	SO:0001627	intron_variant	0				Clone_based_ensembl_gene	AF135158	CCDS9188.1	12q	2007-08-03				ENSG00000135090			18133	protein-coding gene	gene with protein product						10559204, 10924369	Standard	NM_016281		Approved	JIK, DPK, MAP3K18	uc001twy.4	Q9H2K8		ENST00000392533.3:c.1900-4820->GTGTGT	12.37:g.118604653_118604658dupACACAC		Somatic	NA	NA	NA		0.6820090568639808	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q658N1|Q8IUM4|Q9HC79|Q9NZM9|Q9UHG7	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000392533.3	37	NULL	CCDS9188.1	12																																																																																			-	-		0.421	TAOK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000221280	protein_coding	OTTHUMT00000401456.2	-	NM_016281			118604653	+1	no_errors	ENST00000408353	ensembl	human	novel	74_37	rna	INS	0.002:0.000	ACACAC
ENPEP	2028	genome.wustl.edu	37	4	111397679	111397679	+	Missense_Mutation	SNP	G	G	A			TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr4:111397679G>A	ENST00000265162.5	+	1	451	c.109G>A	c.(109-111)Gtg>Atg	p.V37M		NM_001977.3	NP_001968.3	Q07075	AMPE_HUMAN	glutamyl aminopeptidase (aminopeptidase A)	37					angiogenesis (GO:0001525)|angiotensin catabolic process in blood (GO:0002005)|angiotensin maturation (GO:0002003)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|cellular protein metabolic process (GO:0044267)|glomerulus development (GO:0032835)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|brush border (GO:0005903)|cytoplasmic vesicle (GO:0031410)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metalloaminopeptidase activity (GO:0070006)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(1)|large_intestine(12)|lung(22)|ovary(1)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(1)	54		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.0031)		GGGACTTGCCGTGGGCTTGAC	0.607																																																	0								ENSG00000138792						196.0	181.0	186.0					4																	111397679		2203	4300	6503	ENPEP	SO:0001583	missense	0			-	HGNC	L12468	CCDS3691.1	4q25	2008-02-05			ENSG00000138792	ENSG00000138792	3.4.11.7	"""CD molecules"""	3355	protein-coding gene	gene with protein product		138297				9268642	Standard	NM_001977		Approved	gp160, CD249	uc003iab.4	Q07075	OTTHUMG00000132546	ENST00000265162.5:c.109G>A	4.37:g.111397679G>A	ENSP00000265162:p.Val37Met	Somatic	0	40	0.00		0.6820090568639808	28	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	41	8.89	Q504U2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_M1_N,prints_Peptidase_M1_N	p.V37M	ENST00000265162.5	37	c.109	CCDS3691.1	4	.	.	.	.	.	.	.	.	.	.	G	19.79	3.893019	0.72524	.	.	ENSG00000138792	ENST00000265162	T	0.01430	4.9	5.57	4.73	0.59995	.	0.000000	0.85682	D	0.000000	T	0.06600	0.0169	M	0.66939	2.045	0.58432	D	0.99999	D	0.89917	1.0	D	0.87578	0.998	T	0.05146	-1.0903	10	0.72032	D	0.01	.	10.3745	0.44075	0.0699:0.0:0.7964:0.1337	.	37	Q07075	AMPE_HUMAN	M	37	ENSP00000265162:V37M	ENSP00000265162:V37M	V	+	1	0	ENPEP	111617128	1.000000	0.71417	0.869000	0.34112	0.891000	0.51852	4.321000	0.59209	1.372000	0.46190	-0.698000	0.03680	GTG	-	NULL		0.607	ENPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENPEP	protein_coding	OTTHUMT00000255747.2	G		-		111397679	+1	no_errors	ENST00000265162	ensembl	human	known	74_37	missense	SNP	0.975	A
DAPK1	1612	genome.wustl.edu	37	9	90321149	90321149	+	Missense_Mutation	SNP	C	C	T	rs370890284		TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr9:90321149C>T	ENST00000408954.3	+	26	3498	c.3163C>T	c.(3163-3165)Cgg>Tgg	p.R1055W	DAPK1_ENST00000469640.2_Missense_Mutation_p.R1080W|DAPK1_ENST00000472284.1_Missense_Mutation_p.R1055W|DAPK1_ENST00000358077.5_Missense_Mutation_p.R1055W|DAPK1_ENST00000491893.1_Missense_Mutation_p.R989W	NM_004938.2	NP_004929.2	P53355	DAPK1_HUMAN	death-associated protein kinase 1	1055					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular response to interferon-gamma (GO:0071346)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of autophagy (GO:0010506)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|identical protein binding (GO:0042802)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(27)|liver(2)|lung(17)|ovary(1)|prostate(2)|skin(3)|stomach(1)	72						GGAGACCCCACGGGCGCTGCA	0.632									Chronic Lymphocytic Leukemia, Familial Clustering of				C|||	1	0.000199681	0.0008	0.0	5008	,	,		16965	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000196730	C	TRP/ARG	1,4111		0,1,2055	31.0	36.0	34.0		3163	3.7	0.9	9		34	0,8402		0,0,4201	no	missense	DAPK1	NM_004938.2	101	0,1,6256	TT,TC,CC		0.0,0.0243,0.0080	possibly-damaging	1055/1431	90321149	1,12513	2056	4201	6257	DAPK1	SO:0001583	missense	0	Familial Cancer Database	Familial CLL	-	HGNC	X76104	CCDS43842.1	9q34.1	2013-01-10			ENSG00000196730	ENSG00000196730		"""Ankyrin repeat domain containing"""	2674	protein-coding gene	gene with protein product		600831				8530096	Standard	XM_005251757		Approved	DAPK	uc004apd.3	P53355	OTTHUMG00000020150	ENST00000408954.3:c.3163C>T	9.37:g.90321149C>T	ENSP00000386135:p.Arg1055Trp	Somatic	0	61	0.00		0.6820090568639808	19	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	41	8.89	B7ZLD2|B7ZLE7|Q14CQ7|Q1W5W0|Q68CP8|Q6ZRZ3|Q9BTL8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ankyrin_rpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Death_domain,pfam_LipoPS_kinase,pfam_RIO-like_kinase,superfamily_Kinase-like_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Ankyrin_rpt,smart_Death_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death_domain,pfscan_Prot_kinase_dom,prints_Ankyrin_rpt	p.R1080W	ENST00000408954.3	37	c.3238	CCDS43842.1	9	.	.	.	.	.	.	.	.	.	.	C	14.87	2.663192	0.47572	2.43E-4	0.0	ENSG00000196730	ENST00000358077;ENST00000472284;ENST00000469640;ENST00000408954;ENST00000491893	T;T;T;T;T	0.67698	-0.26;-0.26;-0.28;-0.26;-0.26	5.72	3.68	0.42216	.	0.180292	0.25631	N	0.029343	T	0.62514	0.2434	N	0.22421	0.69	0.31790	N	0.629839	P;D;P	0.59767	0.916;0.986;0.916	B;P;B	0.52343	0.312;0.696;0.19	T	0.70956	-0.4731	10	0.66056	D	0.02	.	13.571	0.61847	0.43:0.57:0.0:0.0	.	989;1055;1055	B7ZLE7;P53355-3;P53355	.;.;DAPK1_HUMAN	W	1055;1055;1080;1055;989	ENSP00000350785:R1055W;ENSP00000417076:R1055W;ENSP00000418885:R1080W;ENSP00000386135:R1055W;ENSP00000419026:R989W	ENSP00000350785:R1055W	R	+	1	2	DAPK1	89510969	0.997000	0.39634	0.872000	0.34217	0.950000	0.60333	3.537000	0.53590	1.410000	0.46936	0.655000	0.94253	CGG	-	NULL		0.632	DAPK1-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	DAPK1	protein_coding	OTTHUMT00000356843.1	C	NM_004938	-		90321149	+1	no_errors	ENST00000469640	ensembl	human	known	74_37	missense	SNP	0.762	T
POTEM	641455	genome.wustl.edu	37	14	20010458	20010458	+	Intron	SNP	T	T	C			TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr14:20010458T>C	ENST00000551509.1	-	5	969				RP11-244H18.1_ENST00000547584.1_lincRNA|RNU6-1268P_ENST00000391214.1_RNA	NM_001145442.1	NP_001138914.1	A6NI47	POTEM_HUMAN	POTE ankyrin domain family, member M											endometrium(4)|kidney(1)|lung(4)	9						CTCAGTGGGGTATTGCATAGC	0.348																																																	0								ENSG00000258276																																			RP11-244H18.1	SO:0001627	intron_variant	0			-	Clone_based_vega_gene		CCDS73609.1	14q11.2	2013-01-10			ENSG00000187537	ENSG00000187537		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	37096	protein-coding gene	gene with protein product	"""prostate-specific P704P"""					16364570	Standard	NM_001145442		Approved	POTE14beta, P704P, ACT	uc001vwc.3	A6NI47		ENST00000551509.1:c.918-218A>G	14.37:g.20010458T>C		Somatic	0	25	0.00		0.6820090568639808	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	37	13.64		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000551509.1	37	NULL	CCDS45076.1	14																																																																																			-	-		0.348	POTEM-001	NOVEL	basic|appris_principal|CCDS	protein_coding	LOC100508046	protein_coding	OTTHUMT00000409490.3	T	NM_001145442	-		20010458	+1	no_errors	ENST00000547584	ensembl	human	known	74_37	rna	SNP	0.000	C
HSD17B11	51170	genome.wustl.edu	37	4	88303510	88303510	+	Missense_Mutation	SNP	C	C	T			TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr4:88303510C>T	ENST00000358290.4	-	2	530	c.215G>A	c.(214-216)gGa>gAa	p.G72E	HSD17B11_ENST00000507286.1_Missense_Mutation_p.G72E	NM_016245.3	NP_057329.2	Q8NBQ5	DHB11_HUMAN	hydroxysteroid (17-beta) dehydrogenase 11	72					androgen catabolic process (GO:0006710)|steroid biosynthetic process (GO:0006694)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|lipid particle (GO:0005811)	estradiol 17-beta-dehydrogenase activity (GO:0004303)|steroid dehydrogenase activity (GO:0016229)			cervix(1)|endometrium(4)|kidney(2)|lung(2)|ovary(2)	11		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.000339)		TTCCTCCAGTCCATGCTAGAA	0.373																																																	0								ENSG00000198189						129.0	134.0	132.0					4																	88303510		2203	4300	6503	HSD17B11	SO:0001583	missense	0			-	HGNC	AF126780	CCDS3619.1	4q22.1	2011-09-20	2006-11-22	2006-11-22	ENSG00000198189	ENSG00000198189	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	22960	protein-coding gene	gene with protein product	"""retinal short-chain dehydrogenase/reductase 2"", ""short chain dehydrogenase/reductase family 16C, member 2"""	612831	"""dehydrogenase/reductase (SDR family) member 8"""	DHRS8		11165019, 12697717, 19027726	Standard	XM_006714232		Approved	RetSDR2, 17-BETA-HSD11, 17-BETA-HSDXI, PAN1B, SDR16C2	uc003hqp.2	Q8NBQ5	OTTHUMG00000130594	ENST00000358290.4:c.215G>A	4.37:g.88303510C>T	ENSP00000351035:p.Gly72Glu	Somatic	0	85	0.00		0.6820090568639808	234	11.70	31	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	75	8.54	Q96HF6|Q9UKU4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,prints_Glc/ribitol_DH,prints_DH_sc/Rdtase_SDR	p.G72E	ENST00000358290.4	37	c.215	CCDS3619.1	4	.	.	.	.	.	.	.	.	.	.	C	23.4	4.415141	0.83449	.	.	ENSG00000198189	ENST00000358290;ENST00000507286	D;T	0.89746	-2.56;0.73	5.47	5.47	0.80525	NAD(P)-binding domain (1);	0.074260	0.56097	D	0.000032	D	0.92306	0.7559	L	0.40543	1.245	0.58432	D	0.99999	D	0.76494	0.999	D	0.80764	0.994	D	0.92960	0.6388	10	0.72032	D	0.01	.	18.9346	0.92580	0.0:1.0:0.0:0.0	.	72	Q8NBQ5	DHB11_HUMAN	E	72	ENSP00000351035:G72E;ENSP00000423775:G72E	ENSP00000351035:G72E	G	-	2	0	HSD17B11	88522534	0.995000	0.38212	1.000000	0.80357	0.946000	0.59487	4.997000	0.63921	2.552000	0.86080	0.591000	0.81541	GGA	-	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR		0.373	HSD17B11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSD17B11	protein_coding	OTTHUMT00000253041.1	C	NM_016245	-		88303510	-1	no_errors	ENST00000358290	ensembl	human	known	74_37	missense	SNP	1.000	T
PRKDC	5591	genome.wustl.edu	37	8	48765289	48765289	+	Missense_Mutation	SNP	G	G	C			TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr8:48765289G>C	ENST00000314191.2	-	53	7003	c.6947C>G	c.(6946-6948)gCc>gGc	p.A2316G	PRKDC_ENST00000338368.3_Missense_Mutation_p.A2316G|PRKDC_ENST00000523565.1_5'UTR	NM_006904.6	NP_008835.5	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic polypeptide	2317					B cell lineage commitment (GO:0002326)|brain development (GO:0007420)|cellular protein modification process (GO:0006464)|cellular response to insulin stimulus (GO:0032869)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|ectopic germ cell programmed cell death (GO:0035234)|heart development (GO:0007507)|immunoglobulin V(D)J recombination (GO:0033152)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of protein phosphorylation (GO:0001933)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|pro-B cell differentiation (GO:0002328)|protein destabilization (GO:0031648)|regulation of circadian rhythm (GO:0042752)|response to gamma radiation (GO:0010332)|rhythmic process (GO:0048511)|signal transduction involved in mitotic G1 DNA damage checkpoint (GO:0072431)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell receptor V(D)J recombination (GO:0033153)|telomere maintenance (GO:0000723)	cytosol (GO:0005829)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription factor binding (GO:0008134)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(9)|cervix(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(30)|lung(56)|ovary(6)|pancreas(1)|prostate(8)|skin(7)	147		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)			Caffeine(DB00201)	TGCTGCAGCGGCATACACTTC	0.343								Non-homologous end-joining																													Esophageal Squamous(79;1091 1253 12329 31680 40677)												0								ENSG00000253729						90.0	81.0	84.0					8																	48765289		1850	4099	5949	PRKDC	SO:0001583	missense	0			-	HGNC		CCDS75734.1, CCDS75735.1	8q11	2014-09-17				ENSG00000253729	2.7.11.1		9413	protein-coding gene	gene with protein product		600899		HYRC, HYRC1		7638222	Standard	NM_001081640		Approved	DNPK1, p350, DNAPK, XRCC7, DNA-PKcs	uc003xqi.3	P78527		ENST00000314191.2:c.6947C>G	8.37:g.48765289G>C	ENSP00000313420:p.Ala2316Gly	Somatic	0	48	0.00		0.6820090568639808	88	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	58	24.68	P78528|Q13327|Q13337|Q14175|Q59H99|Q7Z611|Q96SE6|Q9UME3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_NUC194,pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.A2316G	ENST00000314191.2	37	c.6947		8	.	.	.	.	.	.	.	.	.	.	G	11.47	1.649349	0.29336	.	.	ENSG00000253729	ENST00000314191;ENST00000338368	T;T	0.66099	-0.19;-0.19	4.63	4.63	0.57726	Armadillo-type fold (1);	0.074348	0.52532	D	0.000071	T	0.59555	0.2202	M	0.73598	2.24	0.41370	D	0.987484	B;B	0.18013	0.025;0.025	B;B	0.16289	0.015;0.015	T	0.59445	-0.7453	10	0.37606	T	0.19	.	10.1487	0.42780	0.0944:0.0:0.9056:0.0	.	2316;2317	E7EUY0;P78527	.;PRKDC_HUMAN	G	2316	ENSP00000313420:A2316G;ENSP00000345182:A2316G	ENSP00000313420:A2316G	A	-	2	0	PRKDC	48927842	1.000000	0.71417	0.998000	0.56505	0.561000	0.35649	4.088000	0.57678	2.260000	0.74910	0.655000	0.94253	GCC	-	superfamily_ARM-type_fold		0.343	PRKDC-201	KNOWN	basic|appris_principal	protein_coding	PRKDC	protein_coding		G	NM_001081640	-		48765289	-1	no_errors	ENST00000314191	ensembl	human	known	74_37	missense	SNP	1.000	C
TIPARP	25976	genome.wustl.edu	37	3	156396350	156396350	+	Silent	SNP	C	C	T			TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr3:156396350C>T	ENST00000461166.1	+	2	1452	c.864C>T	c.(862-864)caC>caT	p.H288H	TIPARP_ENST00000542783.1_Silent_p.H288H|TIPARP_ENST00000295924.7_Silent_p.H288H|TIPARP_ENST00000486483.1_Silent_p.H288H	NM_001184717.1	NP_001171646.1	Q7Z3E1	PARPT_HUMAN	TCDD-inducible poly(ADP-ribose) polymerase	288					androgen metabolic process (GO:0008209)|cellular response to organic cyclic compound (GO:0071407)|estrogen metabolic process (GO:0008210)|face morphogenesis (GO:0060325)|female gonad development (GO:0008585)|hemopoiesis (GO:0030097)|kidney development (GO:0001822)|multicellular organismal metabolic process (GO:0044236)|negative regulation of gene expression (GO:0010629)|nitrogen compound metabolic process (GO:0006807)|palate development (GO:0060021)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of protein catabolic process (GO:0045732)|post-embryonic development (GO:0009791)|protein ADP-ribosylation (GO:0006471)|skeletal system morphogenesis (GO:0048705)|smooth muscle tissue development (GO:0048745)|vasculogenesis (GO:0001570)	nucleus (GO:0005634)	enhancer binding (GO:0035326)|metal ion binding (GO:0046872)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			NS(1)|breast(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(4)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)	23			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)			CTCAGGAGCACTTGGAAAGAT	0.368																																					Ovarian(171;276 1987 3319 6837 11197)												0								ENSG00000163659						75.0	76.0	76.0					3																	156396350		2203	4300	6503	TIPARP	SO:0001819	synonymous_variant	0			-	HGNC	BX537965	CCDS3177.1	3q25.31	2011-06-22			ENSG00000163659	ENSG00000163659		"""Poly (ADP-ribose) polymerases"""	23696	protein-coding gene	gene with protein product		612480				12851707	Standard	NM_001184717		Approved	DKFZP434J214, DKFZp686N0351, DDF1, PARP7, PARP-7, PARP-1, pART14, RM1	uc021xgg.1	Q7Z3E1	OTTHUMG00000158646	ENST00000461166.1:c.864C>T	3.37:g.156396350C>T		Somatic	0	51	0.00		0.6820090568639808	38	48.65	36	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	15	50.00	D3DNK6|Q68CY9|Q86VP4|Q9Y4P7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Poly(ADP-ribose)pol_cat_dom,pfscan_WWE-dom,pfscan_Poly(ADP-ribose)pol_cat_dom	p.H288	ENST00000461166.1	37	c.864	CCDS3177.1	3																																																																																			-	NULL		0.368	TIPARP-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TIPARP	protein_coding	OTTHUMT00000351618.1	C	NM_015508	-		156396350	+1	no_errors	ENST00000295924	ensembl	human	known	74_37	silent	SNP	1.000	T
PI4KB	5298	genome.wustl.edu	37	1	151288732	151288732	+	Nonsense_Mutation	SNP	C	C	A			TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr1:151288732C>A	ENST00000368873.1	-	2	394	c.226G>T	c.(226-228)Gag>Tag	p.E76*	PI4KB_ENST00000368875.2_Nonsense_Mutation_p.E88*|PI4KB_ENST00000271657.5_Nonsense_Mutation_p.E88*|PI4KB_ENST00000529142.1_Intron|PI4KB_ENST00000368872.1_Nonsense_Mutation_p.E76*|PI4KB_ENST00000368874.4_Nonsense_Mutation_p.E76*			Q9UBF8	PI4KB_HUMAN	phosphatidylinositol 4-kinase, catalytic, beta	76	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.				phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi membrane (GO:0000139)|mitochondrial outer membrane (GO:0005741)|plasma membrane (GO:0005886)	1-phosphatidylinositol 4-kinase activity (GO:0004430)|ATP binding (GO:0005524)			breast(3)|endometrium(5)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	27	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			TTGACCAACTCCAGTGGGGTG	0.587																																					Colon(154;765 1838 9854 28443 37492)												0								ENSG00000143393						109.0	90.0	96.0					1																	151288732		2203	4300	6503	PI4KB	SO:0001587	stop_gained	0			-	HGNC	AB005910	CCDS993.1, CCDS55637.1, CCDS55638.1	1q21	2008-02-05	2007-08-14	2007-08-02	ENSG00000143393	ENSG00000143393			8984	protein-coding gene	gene with protein product		602758		PIK4CB		9020160, 9405938	Standard	NM_002651		Approved	PI4K-BETA, pi4K92	uc001exu.3	Q9UBF8	OTTHUMG00000012348	ENST00000368873.1:c.226G>T	1.37:g.151288732C>A	ENSP00000357867:p.Glu76*	Somatic	0	27	0.00		0.6820090568639808	269	15.94	51	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	27	18.18	B4DGI2|O15096|P78405|Q5VWB9|Q5VWC0|Q5VWC1|Q9BWR6	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PI3/4_kinase_cat_dom,superfamily_Kinase-like_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.E88*	ENST00000368873.1	37	c.262		1	.	.	.	.	.	.	.	.	.	.	C	37	5.997883	0.97184	.	.	ENSG00000143393	ENST00000368874;ENST00000368875;ENST00000271657;ENST00000368873;ENST00000368872;ENST00000438243	.	.	.	5.53	3.64	0.41730	.	0.461817	0.23356	N	0.049062	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09084	T	0.74	-7.6825	10.0429	0.42169	0.0:0.7862:0.1387:0.0751	.	.	.	.	X	76;88;88;76;76;76	.	ENSP00000271657:E88X	E	-	1	0	PI4KB	149555356	0.131000	0.22433	0.997000	0.53966	0.859000	0.49053	1.375000	0.34295	0.872000	0.35775	0.655000	0.94253	GAG	-	NULL		0.587	PI4KB-002	KNOWN	basic	protein_coding	PI4KB	protein_coding	OTTHUMT00000034400.3	C	NM_002651	-		151288732	-1	no_errors	ENST00000271657	ensembl	human	known	74_37	nonsense	SNP	0.991	A
PIDD1	55367	genome.wustl.edu	37	11	803545	803545	+	Missense_Mutation	SNP	G	G	T	rs138805631		TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr11:803545G>T	ENST00000347755.5	-	3	479	c.338C>A	c.(337-339)gCc>gAc	p.A113D	PIDD_ENST00000534649.1_5'UTR|PIDD_ENST00000411829.2_Missense_Mutation_p.A113D	NM_145886.3|NM_145887.3	NP_665893.2|NP_665894.2																					GTTGGTCAGGGCACCCCGGAG	0.682																																																	0								ENSG00000177595						36.0	41.0	40.0					11																	803545		2203	4297	6500	PIDD	SO:0001583	missense	0			-	HGNC																												ENST00000347755.5:c.338C>A	11.37:g.803545G>T	ENSP00000337797:p.Ala113Asp	Somatic	0	35	0.00		0.6820090568639808	35	10.26	4	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	19	17.39		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_S68_pidd,pfam_Death_domain,pfam_Leu-rich_rpt,pfam_ZU5,superfamily_DEATH-like_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Death_domain,pfscan_Death_domain,pfscan_ZU5	p.A113D	ENST00000347755.5	37	c.338	CCDS7716.1	11	.	.	.	.	.	.	.	.	.	.	G	4.704	0.130863	0.08981	.	.	ENSG00000177595	ENST00000411829;ENST00000347755	T;T	0.41758	1.08;0.99	4.34	2.43	0.29744	.	0.931884	0.09093	N	0.849673	T	0.15652	0.0377	N	0.08118	0	0.20764	N	0.999859	B;B	0.34015	0.309;0.435	B;B	0.21917	0.016;0.037	T	0.14811	-1.0459	10	0.12430	T	0.62	.	2.2896	0.04135	0.1672:0.1668:0.5116:0.1544	.	113;113	Q9HB75;Q9HB75-2	PIDD_HUMAN;.	D	113	ENSP00000416801:A113D;ENSP00000337797:A113D	ENSP00000337797:A113D	A	-	2	0	PIDD	793545	1.000000	0.71417	0.052000	0.19188	0.560000	0.35617	2.398000	0.44486	0.448000	0.26722	0.462000	0.41574	GCC	-	NULL		0.682	PIDD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIDD	protein_coding	OTTHUMT00000257103.1	G		-		803545	-1	no_errors	ENST00000347755	ensembl	human	known	74_37	missense	SNP	0.888	T
CCDC27	148870	genome.wustl.edu	37	1	3683994	3683994	+	Missense_Mutation	SNP	G	G	C	rs145881374		TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr1:3683994G>C	ENST00000294600.2	+	10	1812	c.1728G>C	c.(1726-1728)gaG>gaC	p.E576D		NM_152492.2	NP_689705.2	Q2M243	CCD27_HUMAN	coiled-coil domain containing 27	576										breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|liver(2)|lung(17)|prostate(1)|skin(2)|urinary_tract(2)	36	all_cancers(77;0.0385)|Ovarian(185;0.0634)|Lung NSC(156;0.21)|all_lung(157;0.218)	all_epithelial(116;5.52e-17)|all_lung(118;1.04e-06)|Lung NSC(185;0.000214)|Renal(390;0.00357)|Breast(487;0.00446)|Hepatocellular(190;0.0218)|Lung SC(97;0.0367)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.127)		Epithelial(90;1.11e-38)|OV - Ovarian serous cystadenocarcinoma(86;1.35e-22)|GBM - Glioblastoma multiforme(42;3.46e-16)|Colorectal(212;1.17e-05)|COAD - Colon adenocarcinoma(227;5.76e-05)|Kidney(185;0.00036)|BRCA - Breast invasive adenocarcinoma(365;0.000696)|KIRC - Kidney renal clear cell carcinoma(229;0.00558)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.203)		TGGCCCTGGAGAGCTCCCAGT	0.647																																																	0								ENSG00000162592						39.0	33.0	35.0					1																	3683994		2203	4300	6503	CCDC27	SO:0001583	missense	0			-	HGNC		CCDS50.1	1p36.32	2008-02-05			ENSG00000162592	ENSG00000162592			26546	protein-coding gene	gene with protein product							Standard	NM_152492		Approved	FLJ32825	uc001akv.2	Q2M243	OTTHUMG00000003504	ENST00000294600.2:c.1728G>C	1.37:g.3683994G>C	ENSP00000294600:p.Glu576Asp	Somatic	0	28	0.00		0.6820090568639808	3	40.00	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	16	50.00	Q5TBV3|Q96M50	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_Prefoldin	p.E576D	ENST00000294600.2	37	c.1728	CCDS50.1	1	.	.	.	.	.	.	.	.	.	.	G	10.66	1.411804	0.25465	.	.	ENSG00000162592	ENST00000294600	T	0.34072	1.38	5.3	2.4	0.29515	.	0.000000	0.56097	D	0.000027	T	0.53384	0.1793	M	0.65498	2.005	0.22620	N	0.998928	D	0.71674	0.998	D	0.77557	0.99	T	0.45775	-0.9238	10	0.54805	T	0.06	-35.3497	9.921	0.41464	0.2497:0.0:0.7503:0.0	.	576	Q2M243	CCD27_HUMAN	D	576	ENSP00000294600:E576D	ENSP00000294600:E576D	E	+	3	2	CCDC27	3673854	0.985000	0.35326	0.139000	0.22197	0.430000	0.31655	1.813000	0.38962	-0.002000	0.14469	-0.797000	0.03246	GAG	-	NULL		0.647	CCDC27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC27	protein_coding	OTTHUMT00000009740.1	G	NM_152492	-		3683994	+1	no_errors	ENST00000294600	ensembl	human	known	74_37	missense	SNP	0.288	C
WWC1	23286	genome.wustl.edu	37	5	167881030	167881032	+	In_Frame_Del	DEL	GGA	GGA	-	rs111457550|rs28429769|rs28421695|rs376909223	byFrequency	TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	GGA	GGA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr5:167881030_167881032delGGA	ENST00000265293.4	+	18	3085_3087	c.2583_2585delGGA	c.(2581-2586)gtggag>gtg	p.E865del	WWC1_ENST00000522140.1_3'UTR|WWC1_ENST00000521089.1_In_Frame_Del_p.E865del	NM_001161661.1|NM_001161662.1|NM_015238.2	NP_001155133.1|NP_001155134.1|NP_056053.1	Q8IX03	KIBRA_HUMAN	WW and C2 domain containing 1	865	Glu-rich.|Interaction with histone H3.			Missing (in Ref. 6; AAO73817). {ECO:0000305}.	cell migration (GO:0016477)|establishment of cell polarity (GO:0030010)|hippo signaling (GO:0035329)|negative regulation of hippo signaling (GO:0035331)|negative regulation of organ growth (GO:0046621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of MAPK cascade (GO:0043410)|regulation of hippo signaling (GO:0035330)|regulation of intracellular transport (GO:0032386)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)	kinase binding (GO:0019900)|protein complex scaffold (GO:0032947)|transcription coactivator activity (GO:0003713)			breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(16)|ovary(2)|prostate(1)|skin(4)	43	Renal(175;0.000212)|Lung NSC(126;0.0875)|all_lung(126;0.166)	Medulloblastoma(196;0.0399)|all_neural(177;0.0577)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0364)|Epithelial(171;0.0765)|OV - Ovarian serous cystadenocarcinoma(192;0.0918)		aggaggaggtggaggaggaggag	0.547																																																	0								ENSG00000113645		,,	2323,1941		637,1049,446					,,	-0.6	0.1		dbSNP_132	92	1828,6426		217,1394,2516	no	coding,coding,coding	WWC1	NM_015238.2,NM_001161662.1,NM_001161661.1	,,	854,2443,2962	A1A1,A1R,RR		22.1468,45.5206,33.1602	,,	,,		4151,8367				WWC1	SO:0001651	inframe_deletion	0				HGNC	AF506799	CCDS4366.1, CCDS54945.1	5q34	2014-06-13	2006-11-09		ENSG00000113645	ENSG00000113645		"""WW, C2 and coiled-coil domain containing"""	29435	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 168"""	610533	"""WW, C2 and coiled-coil domain containing 1"""			10048485, 12559952	Standard	NM_001161661		Approved	KIBRA, KIAA0869, PPP1R168	uc011den.2	Q8IX03	OTTHUMG00000130408	ENST00000265293.4:c.2583_2585delGGA	5.37:g.167881039_167881041delGGA	ENSP00000265293:p.Glu865del	Somatic	0	35	0.00		0.6820090568639808	8	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	39	36.07	B4DK05|O94946|Q6MZX4|Q6Y2F8|Q7Z4G8|Q8WVM4|Q9BT29	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_WW_dom,superfamily_C2_dom,superfamily_WW_dom,smart_WW_dom,pfscan_WW_dom	p.E865in_frame_del	ENST00000265293.4	37	c.2583_2585	CCDS4366.1	5																																																																																			-	NULL		0.547	WWC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	WWC1	protein_coding	OTTHUMT00000252791.2	GGA	NM_015238			167881032	+1	no_errors	ENST00000265293	ensembl	human	known	74_37	in_frame_del	DEL	0.823:0.847:0.815	-
GOLGA2P9	440518	genome.wustl.edu	37	19	22786189	22786189	+	RNA	SNP	C	C	T			TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr19:22786189C>T	ENST00000599738.1	+	0	119				RN7SL860P_ENST00000473738.2_RNA|CTC-457E21.3_ENST00000600260.1_RNA|AC011467.1_ENST00000408863.1_RNA																							ATTCTGTTTTCCCACCAGGCT	0.587																																																	0								ENSG00000268823																																			CTC-457E21.6			0			-	Clone_based_vega_gene																													19.37:g.22786189C>T		Somatic	0	38	0.00		0.6820090568639808	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	50	30.56		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000599738.1	37	NULL		19																																																																																			-	-		0.587	CTC-457E21.6-001	KNOWN	basic|readthrough_transcript	processed_transcript	ENSG00000268823	processed_transcript	OTTHUMT00000464575.1	C		-		22786189	+1	no_errors	ENST00000599738	ensembl	human	known	74_37	rna	SNP	1.000	T
CNGB1	1258	genome.wustl.edu	37	16	57954314	57954314	+	Missense_Mutation	SNP	G	G	T			TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr16:57954314G>T	ENST00000251102.8	-	19	1838	c.1778C>A	c.(1777-1779)tCt>tAt	p.S593Y	CNGB1_ENST00000564448.1_Missense_Mutation_p.S587Y	NM_001297.4	NP_001288.3	Q14028	CNGB1_HUMAN	cyclic nucleotide gated channel beta 1	593					cation transport (GO:0006812)|cytosolic calcium ion homeostasis (GO:0051480)|detection of light stimulus involved in visual perception (GO:0050908)|phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|protein heterotetramerization (GO:0051290)|regulation of membrane potential (GO:0042391)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina homeostasis (GO:0001895)|rhodopsin mediated signaling pathway (GO:0016056)|sensory perception of smell (GO:0007608)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|intracellular cyclic nucleotide activated cation channel complex (GO:0017071)|plasma membrane (GO:0005886)|terminal bouton (GO:0043195)|transmembrane transporter complex (GO:1902495)	cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|ligand-gated ion channel activity (GO:0015276)|voltage-gated potassium channel activity (GO:0005249)			breast(7)|cervix(2)|endometrium(4)|kidney(2)|large_intestine(11)|liver(1)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	54						CTCCTCATCAGAGGTGACGTC	0.572																																					Colon(156;1293 1853 16336 28962 38659)												0								ENSG00000070729						80.0	83.0	82.0					16																	57954314		1945	4137	6082	CNGB1	SO:0001583	missense	0			-	HGNC	AF042498	CCDS42169.1, CCDS45495.1, CCDS67042.1	16q13	2013-02-14			ENSG00000070729	ENSG00000070729		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2151	protein-coding gene	gene with protein product	"""glutamic acid-rich protein"""	600724		CNCG2, CNCG3L		8766832, 7590744, 16382102	Standard	NM_001297		Approved	RCNC2, RCNCb, GARP, GAR1, CNGB1B, RP45	uc002emt.2	Q14028	OTTHUMG00000154810	ENST00000251102.8:c.1778C>A	16.37:g.57954314G>T	ENSP00000251102:p.Ser593Tyr	Somatic	0	57	0.00		0.6820090568639808	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	40	42.03	H3BN09|O43636|Q13059|Q14029|Q9UMG2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom	p.S593Y	ENST00000251102.8	37	c.1778	CCDS42169.1	16	.	.	.	.	.	.	.	.	.	.	G	25.5	4.643316	0.87859	.	.	ENSG00000070729	ENST00000251102	D	0.98280	-4.84	5.42	5.42	0.78866	.	0.000000	0.64402	D	0.000008	D	0.98874	0.9619	M	0.78801	2.425	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.99873	1.1100	10	0.87932	D	0	.	18.2255	0.89916	0.0:0.0:1.0:0.0	.	593	Q14028	CNGB1_HUMAN	Y	593	ENSP00000251102:S593Y	ENSP00000251102:S593Y	S	-	2	0	CNGB1	56511815	1.000000	0.71417	0.952000	0.39060	0.914000	0.54420	7.647000	0.83462	2.557000	0.86248	0.555000	0.69702	TCT	-	NULL		0.572	CNGB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CNGB1	protein_coding	OTTHUMT00000337167.2	G	NM_001297	-		57954314	-1	no_errors	ENST00000251102	ensembl	human	known	74_37	missense	SNP	1.000	T
C9orf139	401563	genome.wustl.edu	37	9	139927527	139927527	+	Silent	SNP	G	G	T			TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr9:139927527G>T	ENST00000314330.2	+	2	1526	c.12G>T	c.(10-12)cgG>cgT	p.R4R	FUT7_ENST00000314412.6_5'Flank	NM_207511.1	NP_997394.1	Q6ZV77	CI139_HUMAN	chromosome 9 open reading frame 139	4										cervix(1)|lung(2)	3	all_cancers(76;0.0893)	Myeloproliferative disorder(178;0.0821)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.99e-05)|Epithelial(140;0.000493)		TGGCCCTGCGGGGTCACCCTG	0.667																																																	0								ENSG00000180539						109.0	99.0	102.0					9																	139927527		2202	4292	6494	C9orf139	SO:0001819	synonymous_variant	0			-	HGNC		CCDS7023.1	9q34.3	2008-02-05			ENSG00000180539	ENSG00000180539			31426	protein-coding gene	gene with protein product							Standard	NM_207511		Approved	FLJ36268, FLJ42909	uc004ckp.1	Q6ZV77	OTTHUMG00000020959	ENST00000314330.2:c.12G>T	9.37:g.139927527G>T		Somatic	0	36	0.00		0.6820090568639808	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	38	15.56	A2RUA3|B9EGW2|Q5SPY0|Q8N224	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.R4	ENST00000314330.2	37	c.12	CCDS7023.1	9																																																																																			-	NULL		0.667	C9orf139-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf139	protein_coding	OTTHUMT00000055213.2	G	NM_207511	-		139927527	+1	no_errors	ENST00000314330	ensembl	human	known	74_37	silent	SNP	0.006	T
ZSWIM4	65249	genome.wustl.edu	37	19	13915823	13915823	+	Frame_Shift_Del	DEL	G	G	-			TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr19:13915823delG	ENST00000254323.2	+	3	762	c.573delG	c.(571-573)acgfs	p.T191fs	ZSWIM4_ENST00000440752.2_5'Flank	NM_023072.2	NP_075560.2	Q9H7M6	ZSWM4_HUMAN	zinc finger, SWIM-type containing 4	191							zinc ion binding (GO:0008270)			central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(11)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	27			OV - Ovarian serous cystadenocarcinoma(19;2.94e-23)|Epithelial(5;4.58e-19)			TCTCCGAGACGCTCTCCCAGA	0.632											OREG0025298	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000132003						55.0	49.0	51.0					19																	13915823		2203	4300	6503	ZSWIM4	SO:0001589	frameshift_variant	0				HGNC	AK022283	CCDS32924.1	19p13.13	2012-02-23			ENSG00000132003	ENSG00000132003		"""Zinc fingers, SWIM-type"""	25704	protein-coding gene	gene with protein product							Standard	NM_023072		Approved	FLJ12221	uc002mxh.1	Q9H7M6		ENST00000254323.2:c.573delG	19.37:g.13915823delG	ENSP00000254323:p.Thr191fs	Somatic	0	26	0.00	691	0.6820090568639808	12	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	13	23.53		Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfscan_Znf_SWIM	p.L192fs	ENST00000254323.2	37	c.573	CCDS32924.1	19																																																																																			-	NULL		0.632	ZSWIM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZSWIM4	protein_coding	OTTHUMT00000457457.1	G	XM_031342			13915823	+1	no_errors	ENST00000254323	ensembl	human	known	74_37	frame_shift_del	DEL	0.091	-
LCE2B	26239	genome.wustl.edu	37	1	152659592	152659592	+	Silent	SNP	C	C	T			TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr1:152659592C>T	ENST00000368780.3	+	2	327	c.273C>T	c.(271-273)tgC>tgT	p.C91C	LCE2B_ENST00000417924.2_Silent_p.C91C	NM_014357.4	NP_055172.1	O14633	LCE2B_HUMAN	late cornified envelope 2B	91	Cys-rich.				epidermis development (GO:0008544)|keratinization (GO:0031424)					endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	11	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			GCCCCGACTGCTGTGAGAGTG	0.632																																																	0								ENSG00000159455						36.0	48.0	44.0					1																	152659592		2198	4287	6485	LCE2B	SO:0001819	synonymous_variant	0			-	HGNC	BI670514	CCDS1020.1	1q21	2008-02-05	2004-10-11	2004-10-15	ENSG00000159455	ENSG00000159455		"""Late cornified envelopes"""	16610	protein-coding gene	gene with protein product		612610	"""small proline rich-like (epidermal differentiation complex) 1B"""	SPRL1B		11698679, 9344646	Standard	NM_014357		Approved	LEP10, XP5	uc001fai.3	O14633	OTTHUMG00000012404	ENST00000368780.3:c.273C>T	1.37:g.152659592C>T		Somatic	0	87	0.00		0.6820090568639808	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	187	12.62	Q5TA80	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.C91	ENST00000368780.3	37	c.273	CCDS1020.1	1																																																																																			-	NULL		0.632	LCE2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCE2B	protein_coding	OTTHUMT00000034524.1	C	NM_014357	-		152659592	+1	no_errors	ENST00000368780	ensembl	human	known	74_37	silent	SNP	0.532	T
ABT1	29777	genome.wustl.edu	37	6	26597314	26597314	+	Missense_Mutation	SNP	C	C	T			TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr6:26597314C>T	ENST00000274849.1	+	1	135	c.104C>T	c.(103-105)gCg>gTg	p.A35V		NM_013375.3	NP_037507.1	Q9ULW3	ABT1_HUMAN	activator of basal transcription 1	35					regulation of transcription from RNA polymerase II promoter (GO:0006357)|spinal cord motor neuron differentiation (GO:0021522)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|urinary_tract(1)	11						TCCGAAGAAGCGGCCTGTGGC	0.622																																																	0								ENSG00000146109						70.0	80.0	77.0					6																	26597314		2203	4300	6503	ABT1	SO:0001583	missense	0			-	HGNC	AB027258	CCDS4616.1	6p21.31	2008-07-07			ENSG00000146109	ENSG00000146109			17369	protein-coding gene	gene with protein product						10648625	Standard	NM_013375		Approved		uc003nii.3	Q9ULW3	OTTHUMG00000016319	ENST00000274849.1:c.104C>T	6.37:g.26597314C>T	ENSP00000274849:p.Ala35Val	Somatic	0	33	0.00		0.6820090568639808	239	31.53	111	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	46	36.99		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.A35V	ENST00000274849.1	37	c.104	CCDS4616.1	6	.	.	.	.	.	.	.	.	.	.	C	10.75	1.437563	0.25900	.	.	ENSG00000146109	ENST00000274849	.	.	.	4.27	2.44	0.29823	.	0.932943	0.09022	N	0.860004	T	0.10294	0.0252	L	0.47716	1.5	0.09310	N	1	B	0.30824	0.296	B	0.25140	0.058	T	0.28744	-1.0034	9	0.29301	T	0.29	-5.2338	2.6808	0.05093	0.208:0.5321:0.1561:0.1038	.	35	Q9ULW3	ABT1_HUMAN	V	35	.	ENSP00000274849:A35V	A	+	2	0	ABT1	26705293	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	-0.179000	0.09768	0.709000	0.31976	-0.137000	0.14449	GCG	-	NULL		0.622	ABT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABT1	protein_coding	OTTHUMT00000043698.1	C		-		26597314	+1	no_errors	ENST00000274849	ensembl	human	known	74_37	missense	SNP	0.001	T
GPHN	10243	genome.wustl.edu	37	14	67647600	67647600	+	Silent	SNP	C	C	T			TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr14:67647600C>T	ENST00000315266.5	+	22	3278	c.2157C>T	c.(2155-2157)taC>taT	p.Y719Y	GPHN_ENST00000305960.9_Silent_p.Y688Y|GPHN_ENST00000543237.1_Silent_p.Y765Y|GPHN_ENST00000478722.1_Silent_p.Y752Y|GPHN_ENST00000544752.2_3'UTR	NM_001024218.1	NP_001019389.1	Q9NQX3	GEPH_HUMAN	gephyrin	719	MPT adenylyltransferase.				establishment of synaptic specificity at neuromuscular junction (GO:0007529)|glycine receptor clustering (GO:0072579)|Mo-molybdopterin cofactor biosynthetic process (GO:0006777)|molybdopterin cofactor biosynthetic process (GO:0032324)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|inhibitory synapse (GO:0060077)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|molybdopterin adenylyltransferase activity (GO:0061598)|molybdopterin molybdotransferase activity (GO:0061599)|transferase activity (GO:0016740)			large_intestine(8)|liver(1)|ovary(2)|stomach(1)	12		all_cancers(7;0.0476)|all_hematologic(31;0.0116)		Epithelial(1;1.73e-08)|all cancers(60;3.15e-07)|OV - Ovarian serous cystadenocarcinoma(108;0.000275)|BRCA - Breast invasive adenocarcinoma(234;0.00323)|Colorectal(3;0.0938)|KIRC - Kidney renal clear cell carcinoma(182;0.184)		CAGAACAGTACGTGGAGCTCC	0.468			T	MLL	AL																																			Dom	yes		14	14q24	10243	gephyrin (GPH)		L	0								ENSG00000171723						179.0	137.0	151.0					14																	67647600		2203	4300	6503	GPHN	SO:0001819	synonymous_variant	0			-	HGNC	AB037806	CCDS9777.1, CCDS32103.1	14q23.3	2008-04-22			ENSG00000171723	ENSG00000171723			15465	protein-coding gene	gene with protein product		603930				1319186, 10325225, 18403029	Standard	XM_005267250		Approved	KIAA1385	uc001xix.3	Q9NQX3	OTTHUMG00000029785	ENST00000315266.5:c.2157C>T	14.37:g.67647600C>T		Somatic	0	50	0.00		0.6820090568639808	58	14.49	10	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	65	13.33	Q9H4E9|Q9P2G2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Mopterin-bd_dom,pfam_MoeA_linker/N,pfam_MoeA_C_domain_IV,superfamily_MoeA_linker/N,superfamily_Mopterin-bd_dom,superfamily_MoeA_C_domain_IV,smart_Mopterin-bd_dom,tigrfam_Mo_cofactor_synthesis	p.Y752	ENST00000315266.5	37	c.2256	CCDS32103.1	14																																																																																			-	pfam_MoeA_C_domain_IV,superfamily_MoeA_C_domain_IV		0.468	GPHN-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	GPHN	protein_coding	OTTHUMT00000074299.2	C	NM_020806	-		67647600	+1	no_errors	ENST00000478722	ensembl	human	known	74_37	silent	SNP	0.174	T
SLC4A1	6521	genome.wustl.edu	37	17	42327873	42327873	+	Nonsense_Mutation	SNP	C	C	A			TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr17:42327873C>A	ENST00000262418.6	-	20	2844	c.2689G>T	c.(2689-2691)Gag>Tag	p.E897*	AC003102.1_ENST00000399246.2_5'Flank	NM_000342.3	NP_000333.1	P02730	B3AT_HUMAN	solute carrier family 4 (anion exchanger), member 1 (Diego blood group)	897	Membrane (anion exchange).				anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|cellular ion homeostasis (GO:0006873)|chloride transport (GO:0006821)|ion transport (GO:0006811)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|blood microparticle (GO:0072562)|cortical cytoskeleton (GO:0030863)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	anion transmembrane transporter activity (GO:0008509)|anion:anion antiporter activity (GO:0015301)|ankyrin binding (GO:0030506)|bicarbonate transmembrane transporter activity (GO:0015106)|chloride transmembrane transporter activity (GO:0015108)|inorganic anion exchanger activity (GO:0005452)|protein anchor (GO:0043495)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(16)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	40		Breast(137;0.014)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.115)		CCTTCCTCCTCATCAAAGGTT	0.632																																																	0								ENSG00000004939						115.0	77.0	90.0					17																	42327873		2203	4300	6503	SLC4A1	SO:0001587	stop_gained	0			-	HGNC		CCDS11481.1	17q21.31	2014-07-19	2014-01-02		ENSG00000004939	ENSG00000004939		"""CD molecules"", ""Blood group antigens"", ""Solute carriers"""	11027	protein-coding gene	gene with protein product	"""Froese blood group"", ""Swann blood group"", ""Wright blood group"""	109270	"""Waldner blood group"", ""erythrocyte membrane protein band 3"", ""Diego blood group"", ""solute carrier family 4, anion exchanger, member 1 (erythrocyte membrane protein band 3, Diego blood group)"", ""solute carrier family 4 (anion exchanger), member 1"""	EPB3, AE1, DI, WD		8434259	Standard	NM_000342		Approved	RTA1A, CD233, FR, SW, WR	uc002igf.4	P02730	OTTHUMG00000156843	ENST00000262418.6:c.2689G>T	17.37:g.42327873C>A	ENSP00000262418:p.Glu897*	Somatic	0	53	0.00		0.6820090568639808	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	36	32.08	G4V2I6|P78487|Q1ZZ45|Q4KKW9|Q4VB84|Q9UCY7|Q9UDJ1	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_HCO3_transpt_C,pfam_Band3_cytoplasmic_dom,superfamily_PTrfase/Anion_transptr,prints_HCO3_transpt_euk,prints_Anion_exchange,prints_Anion_exchange_1,tigrfam_HCO3_transpt_euk	p.E897*	ENST00000262418.6	37	c.2689	CCDS11481.1	17	.	.	.	.	.	.	.	.	.	.	C	39	7.517791	0.98332	.	.	ENSG00000004939	ENST00000262418	.	.	.	4.66	3.68	0.42216	.	0.271361	0.35096	N	0.003454	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	13.9836	0.64319	0.0:0.8466:0.1534:0.0	.	.	.	.	X	897	.	ENSP00000262418:E897X	E	-	1	0	SLC4A1	39683399	1.000000	0.71417	0.265000	0.24526	0.394000	0.30568	4.695000	0.61767	1.312000	0.45043	0.561000	0.74099	GAG	-	tigrfam_HCO3_transpt_euk		0.632	SLC4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC4A1	protein_coding	OTTHUMT00000346194.1	C	NM_000342	-		42327873	-1	no_errors	ENST00000262418	ensembl	human	known	74_37	nonsense	SNP	1.000	A
CTCF	10664	genome.wustl.edu	37	16	67644737	67644737	+	Start_Codon_SNP	SNP	T	T	C			TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr16:67644737T>C	ENST00000264010.4	+	3	446	c.2T>C	c.(1-3)aTg>aCg	p.M1T	CTCF_ENST00000401394.1_Intron	NM_006565.3	NP_006556.1	P49711	CTCF_HUMAN	CCCTC-binding factor (zinc finger protein)	1					chromatin modification (GO:0016568)|chromosome segregation (GO:0007059)|DNA methylation (GO:0006306)|maintenance of DNA methylation (GO:0010216)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome positioning (GO:0016584)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of gene expression, epigenetic (GO:0040029)|regulation of histone acetylation (GO:0035065)|regulation of histone methylation (GO:0031060)|regulation of molecular function, epigenetic (GO:0040030)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin insulator sequence binding (GO:0043035)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			breast(6)|central_nervous_system(2)|cervix(1)|endometrium(34)|haematopoietic_and_lymphoid_tissue(7)|kidney(3)|large_intestine(9)|liver(1)|lung(11)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	79		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0166)|Epithelial(162;0.0577)		GCAGGGGAAATGGAAGGTGAT	0.403																																					Colon(175;1200 1966 6945 23069 27405)												0								ENSG00000102974						58.0	64.0	62.0					16																	67644737		2198	4300	6498	CTCF	SO:0001582	initiator_codon_variant	0			-	HGNC	U25435	CCDS10841.1, CCDS54029.1	16q21-q22.3	2013-01-08			ENSG00000102974	ENSG00000102974		"""Zinc fingers, C2H2-type"""	13723	protein-coding gene	gene with protein product	"""11 zinc finger transcriptional repressor"""	604167				8649389, 18550811	Standard	NM_006565		Approved		uc002etl.3	P49711	OTTHUMG00000137539	ENST00000264010.4:c.2T>C	16.37:g.67644737T>C	ENSP00000264010:p.Met1Thr	Somatic	0	99	0.00		0.6820090568639808	67	52.14	73	WXS	Illumina HiSeq 2500	Phase_IV	tier1	54	64	45.76	B5MC38|Q53XI7|Q59EL8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.M1T	ENST00000264010.4	37	c.2	CCDS10841.1	16	.	.	.	.	.	.	.	.	.	.	T	16.70	3.196186	0.58126	.	.	ENSG00000102974	ENST00000264010	T	0.10960	2.82	5.19	5.19	0.71726	.	0.000000	0.85682	D	0.000000	T	0.11965	0.0291	.	.	.	0.80722	D	1	B	0.28470	0.213	B	0.23419	0.046	T	0.03184	-1.1063	9	0.87932	D	0	-2.7778	15.2015	0.73142	0.0:0.0:0.0:1.0	.	1	P49711	CTCF_HUMAN	T	1	ENSP00000264010:M1T	ENSP00000264010:M1T	M	+	2	0	CTCF	66202238	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.682000	0.74528	2.178000	0.69098	0.533000	0.62120	ATG	-	NULL		0.403	CTCF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTCF	protein_coding	OTTHUMT00000268870.2	T	NM_006565	-	Missense_Mutation	67644737	+1	no_errors	ENST00000264010	ensembl	human	known	74_37	missense	SNP	1.000	C
LRRK2	120892	genome.wustl.edu	37	12	40688653	40688653	+	Missense_Mutation	SNP	A	A	G			TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr12:40688653A>G	ENST00000298910.7	+	22	2873	c.2815A>G	c.(2815-2817)Att>Gtt	p.I939V	LRRK2_ENST00000343742.2_Missense_Mutation_p.I939V	NM_198578.3	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	939					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|autophagy (GO:0006914)|cellular protein localization (GO:0034613)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|endocytosis (GO:0006897)|exploration behavior (GO:0035640)|GTP catabolic process (GO:0006184)|intracellular distribution of mitochondria (GO:0048312)|intracellular signal transduction (GO:0035556)|locomotory exploration behavior (GO:0035641)|MAPK cascade (GO:0000165)|negative regulation of GTPase activity (GO:0034260)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|negative regulation of late endosome to lysosome transport (GO:1902823)|negative regulation of peroxidase activity (GO:2000469)|negative regulation of protein binding (GO:0032091)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein processing (GO:0010955)|negative regulation of protein processing involved in protein targeting to mitochondrion (GO:1903217)|negative regulation of protein targeting to mitochondrion (GO:1903215)|negative regulation of thioredoxin peroxidase activity by peptidyl-threonine phosphorylation (GO:1903125)|neuromuscular junction development (GO:0007528)|neuron death (GO:0070997)|neuron projection morphogenesis (GO:0048812)|olfactory bulb development (GO:0021772)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of autophagy (GO:0010508)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of programmed cell death (GO:0043068)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein autoubiquitination (GO:1902499)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of kidney size (GO:0035564)|regulation of locomotion (GO:0040012)|regulation of membrane potential (GO:0042391)|regulation of mitochondrial depolarization (GO:0051900)|regulation of neuroblast proliferation (GO:1902692)|regulation of neuron death (GO:1901214)|regulation of neuron maturation (GO:0014041)|regulation of protein kinase A signaling (GO:0010738)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of synaptic vesicle exocytosis (GO:2000300)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic side of mitochondrial outer membrane (GO:0032473)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)|ATP binding (GO:0005524)|clathrin binding (GO:0030276)|glycoprotein binding (GO:0001948)|GTP binding (GO:0005525)|GTP-dependent protein kinase activity (GO:0034211)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|MAP kinase kinase activity (GO:0004708)|peroxidase inhibitor activity (GO:0036479)|protein homodimerization activity (GO:0042803)|protein kinase A binding (GO:0051018)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|tubulin binding (GO:0015631)			NS(3)|biliary_tract(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(23)|large_intestine(31)|lung(55)|ovary(15)|pancreas(2)|prostate(4)|skin(4)|stomach(9)|upper_aerodigestive_tract(7)|urinary_tract(2)	181	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				ataGGGGCCCATTTTTGATCA	0.264																																																	0								ENSG00000188906						26.0	29.0	28.0					12																	40688653		2200	4282	6482	LRRK2	SO:0001583	missense	0			-	HGNC	AK026776	CCDS31774.1	12q12	2011-07-21			ENSG00000188906	ENSG00000188906		"""Parkinson disease"""	18618	protein-coding gene	gene with protein product		609007	"""Parkinson disease (autosomal dominant) 8"""	PARK8		15541308	Standard	NM_198578		Approved	ROCO2, DKFZp434H2111, FLJ45829, RIPK7	uc001rmg.4	Q5S007	OTTHUMG00000059742	ENST00000298910.7:c.2815A>G	12.37:g.40688653A>G	ENSP00000298910:p.Ile939Val	Somatic	0	118	0.00		0.6820090568639808	0	100.00	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	48	40	54.55	A6NJU2|Q6ZS50|Q8NCX9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_MIRO-like,pfam_Small_GTPase,pfam_Leu-rich_rpt,pfam_Small_GTPase_ARF/SAR,superfamily_Kinase-like_dom,superfamily_P-loop_NTPase,superfamily_ARM-type_fold,superfamily_WD40_repeat_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Small_GTPase_Rab_type,smart_Tyr_kinase_cat_dom,smart_Ser/Thr_dual-sp_kinase_dom,prints_Small_GTPase,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,tigrfam_Small_GTP-bd_dom	p.I939V	ENST00000298910.7	37	c.2815	CCDS31774.1	12	.	.	.	.	.	.	.	.	.	.	A	0.019	-1.450939	0.01080	.	.	ENSG00000188906	ENST00000343742;ENST00000298910	T;T	0.70399	2.36;-0.48	5.52	-4.96	0.03038	.	0.909994	0.09601	N	0.780129	T	0.38957	0.1060	N	0.04508	-0.205	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.30621	-0.9972	10	0.12766	T	0.61	.	7.1657	0.25689	0.2514:0.0:0.5124:0.2362	.	939;939	E9PC85;Q5S007	.;LRRK2_HUMAN	V	939	ENSP00000341930:I939V;ENSP00000298910:I939V	ENSP00000298910:I939V	I	+	1	0	LRRK2	38974920	0.304000	0.24472	0.701000	0.30321	0.501000	0.33797	0.298000	0.19120	-1.208000	0.02634	-0.326000	0.08463	ATT	-	NULL		0.264	LRRK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRK2	protein_coding	OTTHUMT00000277179.1	A	XM_058513	-		40688653	+1	no_errors	ENST00000298910	ensembl	human	known	74_37	missense	SNP	0.303	G
VIPR1	7433	genome.wustl.edu	37	3	42569500	42569500	+	Missense_Mutation	SNP	G	G	T	rs201431086		TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr3:42569500G>T	ENST00000325123.4	+	6	634	c.521G>T	c.(520-522)cGg>cTg	p.R174L	VIPR1-AS1_ENST00000593621.1_RNA|VIPR1_ENST00000433647.1_Missense_Mutation_p.R133L|VIPR1-AS1_ENST00000452639.3_RNA|VIPR1-AS1_ENST00000602176.1_RNA|VIPR1_ENST00000438259.2_Intron|VIPR1-AS1_ENST00000596630.1_RNA|VIPR1-AS1_ENST00000601312.1_RNA|VIPR1-AS1_ENST00000598837.1_RNA|VIPR1_ENST00000543411.1_Missense_Mutation_p.R126L|VIPR1-AS1_ENST00000600342.1_RNA|VIPR1-AS1_ENST00000593611.1_RNA	NM_001251885.1|NM_004624.3	NP_001238814.1|NP_004615.2	P32241	VIPR1_HUMAN	vasoactive intestinal peptide receptor 1	174					digestion (GO:0007586)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|immune response (GO:0006955)|muscle contraction (GO:0006936)|positive regulation of cell proliferation (GO:0008284)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	vasoactive intestinal polypeptide receptor activity (GO:0004999)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|ovary(2)|skin(1)|urinary_tract(3)	18				KIRC - Kidney renal clear cell carcinoma(284;0.241)		CACTGCACGCGGAACTACATC	0.592																																																	0								ENSG00000114812						197.0	165.0	176.0					3																	42569500		2203	4300	6503	VIPR1	SO:0001583	missense	0			-	HGNC	AH005329	CCDS2698.1, CCDS58827.1, CCDS58828.1, CCDS58829.1	3p22	2012-08-10			ENSG00000114812	ENSG00000114812		"""GPCR / Class B : VIP and PACAP (ADCYAP1) receptors"""	12694	protein-coding gene	gene with protein product	"""VIP and PACAP receptor 1"""	192321				7708752	Standard	NM_004624		Approved	VPAC1, RDC1, HVR1, VPAC1R	uc003clf.2	P32241	OTTHUMG00000131792	ENST00000325123.4:c.521G>T	3.37:g.42569500G>T	ENSP00000327246:p.Arg174Leu	Somatic	0	47	0.00		0.6820090568639808	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	A5JUT9|B3KPV1|B4DEB5|B4DGI4|F5H1F5|G3V0I1|Q15871|Q6P2M6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_2_secretin-like,pfam_GPCR_2_extracellular_dom,smart_GPCR_2_extracellular_dom,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_VIP_rcpt_1,prints_GPCR_2_secretin-like,prints_GPCR_2_VIP_rcpt	p.R174L	ENST00000325123.4	37	c.521	CCDS2698.1	3	.	.	.	.	.	.	.	.	.	.	G	22.5	4.300624	0.81136	.	.	ENSG00000114812	ENST00000433647;ENST00000543411;ENST00000325123	T;T;T	0.35789	1.29;1.29;1.29	4.73	4.73	0.59995	GPCR, family 2-like (1);	0.000000	0.85682	U	0.000000	T	0.57184	0.2036	H	0.94886	3.595	0.80722	D	1	B;B;B	0.22683	0.073;0.006;0.073	B;B;B	0.32624	0.149;0.01;0.149	T	0.66567	-0.5891	10	0.87932	D	0	.	16.4438	0.83909	0.0:0.0:1.0:0.0	.	147;126;174	B4DNY6;F5H1F5;P32241	.;.;VIPR1_HUMAN	L	133;126;174	ENSP00000394950:R133L;ENSP00000445701:R126L;ENSP00000327246:R174L	ENSP00000327246:R174L	R	+	2	0	VIPR1	42544504	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.744000	0.98853	2.156000	0.67533	0.591000	0.81541	CGG	-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like		0.592	VIPR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VIPR1	protein_coding	OTTHUMT00000254728.4	G	NM_004624	-		42569500	+1	no_errors	ENST00000325123	ensembl	human	known	74_37	missense	SNP	1.000	T
CKLF	51192	genome.wustl.edu	37	16	66597032	66597032	+	Missense_Mutation	SNP	T	T	A			TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr16:66597032T>A	ENST00000264001.4	+	3	394	c.245T>A	c.(244-246)aTc>aAc	p.I82N	CKLF_ENST00000351137.4_Missense_Mutation_p.I29N|CKLF-CMTM1_ENST00000527729.1_Intron|CKLF_ENST00000563092.1_3'UTR|CKLF_ENST00000345436.4_Intron|CKLF_ENST00000362093.4_Intron|CKLF_ENST00000417030.2_Missense_Mutation_p.I82N|CKLF-CMTM1_ENST00000532838.1_Missense_Mutation_p.I29N	NM_016951.3	NP_058647.1	Q9UBR5	CKLF_HUMAN	chemokine-like factor	82	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.				cell proliferation (GO:0008283)|lymphocyte chemotaxis (GO:0048247)|macrophage chemotaxis (GO:0048246)|neutrophil chemotaxis (GO:0030593)|secretion by cell (GO:0032940)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	chemokine activity (GO:0008009)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(2)|upper_aerodigestive_tract(1)	5		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0689)|Epithelial(162;0.217)		TAGGATATTATCAACTCACTG	0.368																																																	0								ENSG00000217555						184.0	160.0	168.0					16																	66597032		2201	4300	6501	CKLF	SO:0001583	missense	0			-	HGNC	AF096895	CCDS10806.1, CCDS10807.1, CCDS10808.1, CCDS10809.1, CCDS45502.1	16q22.1-q22.3	2008-02-05	2003-02-28	2003-03-07	ENSG00000217555	ENSG00000217555			13253	protein-coding gene	gene with protein product			"""chemokine-like factor 1"""	CKLF1		11042152, 11415443	Standard	NM_016326		Approved	UCK-1, CKLF3, CKLF4, HSPC224, C32		Q9UBR5	OTTHUMG00000137504	ENST00000264001.4:c.245T>A	16.37:g.66597032T>A	ENSP00000264001:p.Ile82Asn	Somatic	0	71	0.00		0.6820090568639808	118	41.58	84	WXS	Illumina HiSeq 2500	Phase_IV	tier1	33	46	41.77	C9JE38|Q9UHM7|Q9UHN8|Q9UI41	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.I82N	ENST00000264001.4	37	c.245	CCDS10807.1	16	.	.	.	.	.	.	.	.	.	.	T	17.04	3.286687	0.59867	.	.	ENSG00000217555;ENSG00000217555;ENSG00000217555;ENSG00000217555;ENSG00000217555;ENSG00000254788	ENST00000264001;ENST00000351137;ENST00000361141;ENST00000417030;ENST00000532838;ENST00000529718	T;T	0.51817	0.69;0.71	4.9	3.81	0.43845	Marvel (1);	.	.	.	.	T	0.58032	0.2094	L	0.59436	1.845	0.80722	D	1	P;D;P	0.69078	0.815;0.997;0.904	P;D;P	0.65010	0.592;0.931;0.667	T	0.58747	-0.7582	9	0.87932	D	0	-11.5711	7.0049	0.24830	0.0:0.1016:0.0:0.8984	.	82;82;29	Q9UBR5-5;Q9UBR5;Q5BJH6	.;CKLF_HUMAN;.	N	82;29;82;82;29;1	ENSP00000264001:I82N;ENSP00000416678:I82N	ENSP00000433503:I1N	I	+	2	0	CKLF;CKLF-CMTM1	65154533	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	3.612000	0.54142	0.905000	0.36596	0.528000	0.53228	ATC	-	NULL		0.368	CKLF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CKLF	protein_coding	OTTHUMT00000268816.2	T	NM_016326	-		66597032	+1	no_errors	ENST00000264001	ensembl	human	known	74_37	missense	SNP	1.000	A
FAT1	2195	genome.wustl.edu	37	4	187629366	187629366	+	Missense_Mutation	SNP	C	C	T	rs368802187		TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr4:187629366C>T	ENST00000441802.2	-	2	1825	c.1616G>A	c.(1615-1617)cGt>cAt	p.R539H		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	539	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						GTCTGATGCACGAATCCTCAG	0.468										HNSCC(5;0.00058)																											Colon(197;1040 2055 4143 4984 49344)												0								ENSG00000083857	C	HIS/ARG	0,3880		0,0,1940	81.0	78.0	79.0		1616	5.6	0.1	4		79	1,8253		0,1,4126	no	missense	FAT1	NM_005245.3	29	0,1,6066	TT,TC,CC		0.0121,0.0,0.0082	probably-damaging	539/4589	187629366	1,12133	1940	4127	6067	FAT1	SO:0001583	missense	0			-	HGNC	X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.1616G>A	4.37:g.187629366C>T	ENSP00000406229:p.Arg539His	Somatic	0	39	0.00		0.6820090568639808	52	16.13	10	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	35	18.60		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Laminin_G,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,smart_EG-like_dom,smart_Laminin_G,smart_EGF-like_Ca-bd_dom,prints_Cadherin,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin	p.R539H	ENST00000441802.2	37	c.1616	CCDS47177.1	4	.	.	.	.	.	.	.	.	.	.	C	18.01	3.527316	0.64860	0.0	1.21E-4	ENSG00000083857	ENST00000441802;ENST00000260147	T	0.20738	2.05	5.58	5.58	0.84498	Cadherin (5);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.45955	0.1368	M	0.64404	1.975	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.04915	-1.0918	10	0.33141	T	0.24	.	19.769	0.96353	0.0:1.0:0.0:0.0	.	539	Q14517	FAT1_HUMAN	H	539	ENSP00000406229:R539H	ENSP00000260147:R539H	R	-	2	0	FAT1	187866360	1.000000	0.71417	0.087000	0.20705	0.180000	0.23129	7.651000	0.83577	2.906000	0.99361	0.655000	0.94253	CGT	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin		0.468	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT1	protein_coding	OTTHUMT00000360209.3	C	NM_005245	-		187629366	-1	no_errors	ENST00000441802	ensembl	human	known	74_37	missense	SNP	0.973	T
LCE2B	26239	genome.wustl.edu	37	1	152659563	152659563	+	Missense_Mutation	SNP	C	C	A			TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr1:152659563C>A	ENST00000368780.3	+	2	298	c.244C>A	c.(244-246)Cac>Aac	p.H82N	LCE2B_ENST00000417924.2_Missense_Mutation_p.H82N	NM_014357.4	NP_055172.1	O14633	LCE2B_HUMAN	late cornified envelope 2B	82	Cys-rich.				epidermis development (GO:0008544)|keratinization (GO:0031424)					endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	11	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCGTCTCTTCCACCGGCGCCG	0.682																																																	0								ENSG00000159455						47.0	62.0	57.0					1																	152659563		2201	4295	6496	LCE2B	SO:0001583	missense	0			-	HGNC	BI670514	CCDS1020.1	1q21	2008-02-05	2004-10-11	2004-10-15	ENSG00000159455	ENSG00000159455		"""Late cornified envelopes"""	16610	protein-coding gene	gene with protein product		612610	"""small proline rich-like (epidermal differentiation complex) 1B"""	SPRL1B		11698679, 9344646	Standard	NM_014357		Approved	LEP10, XP5	uc001fai.3	O14633	OTTHUMG00000012404	ENST00000368780.3:c.244C>A	1.37:g.152659563C>A	ENSP00000357769:p.His82Asn	Somatic	0	67	0.00		0.6820090568639808	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	160	10.11	Q5TA80	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.H82N	ENST00000368780.3	37	c.244	CCDS1020.1	1	.	.	.	.	.	.	.	.	.	.	C	7.352	0.623157	0.14193	.	.	ENSG00000159455	ENST00000417924;ENST00000368780	T;T	0.03951	3.75;3.75	2.24	2.24	0.28232	.	.	.	.	.	T	0.02610	0.0079	M	0.83012	2.62	0.09310	N	1	P	0.40619	0.724	B	0.29267	0.1	T	0.31081	-0.9956	9	0.87932	D	0	.	7.9165	0.29820	0.0:1.0:0.0:0.0	.	82	O14633	LCE2B_HUMAN	N	82	ENSP00000414043:H82N;ENSP00000357769:H82N	ENSP00000357769:H82N	H	+	1	0	LCE2B	150926187	0.001000	0.12720	0.002000	0.10522	0.323000	0.28346	0.992000	0.29667	1.235000	0.43724	0.313000	0.20887	CAC	-	NULL		0.682	LCE2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCE2B	protein_coding	OTTHUMT00000034524.1	C	NM_014357	-		152659563	+1	no_errors	ENST00000368780	ensembl	human	known	74_37	missense	SNP	0.004	A
SYNE2	23224	genome.wustl.edu	37	14	64465047	64465047	+	Splice_Site	SNP	G	G	A			TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr14:64465047G>A	ENST00000344113.4	+	26	3565		c.e26+1		SYNE2_ENST00000358025.3_Splice_Site|SYNE2_ENST00000357395.3_Splice_Site|SYNE2_ENST00000554584.1_Splice_Site	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2						centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)	p.?(1)		NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		TACTAGAGAGGTAAACTCTTT	0.338																																																	1	Unknown(1)	skin(1)						ENSG00000054654						62.0	56.0	57.0					14																	64465047		1805	4076	5881	SYNE2	SO:0001630	splice_region_variant	0			-	HGNC	AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.3353+1G>A	14.37:g.64465047G>A		Somatic	0	79	0.00		0.6820090568639808	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	92	8.00	Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e25+1	ENST00000344113.4	37	c.3353+1	CCDS41963.1	14	.	.	.	.	.	.	.	.	.	.	G	18.12	3.552885	0.65425	.	.	ENSG00000054654	ENST00000358025;ENST00000344113;ENST00000554584;ENST00000261678	.	.	.	5.44	5.44	0.79542	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.1134	0.72380	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SYNE2	63534800	1.000000	0.71417	1.000000	0.80357	0.758000	0.43043	4.808000	0.62583	2.708000	0.92522	0.650000	0.86243	.	-	-		0.338	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNE2	protein_coding	OTTHUMT00000276994.2	G	NM_182914	-	Intron	64465047	+1	no_errors	ENST00000358025	ensembl	human	known	74_37	splice_site	SNP	1.000	A
RNF219	79596	genome.wustl.edu	37	13	79190272	79190272	+	Missense_Mutation	SNP	C	C	G			TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr13:79190272C>G	ENST00000282003.6	-	6	1682	c.1624G>C	c.(1624-1626)Gat>Cat	p.D542H	RNF219-AS1_ENST00000560584.2_RNA|RNF219-AS1_ENST00000560209.2_RNA|RNF219-AS1_ENST00000606429.1_RNA	NM_024546.3	NP_078822.3	Q5W0B1	RN219_HUMAN	ring finger protein 219	542	Ser-rich.						zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(11)|liver(1)|lung(11)|prostate(1)|skin(1)	32		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.0848)		GBM - Glioblastoma multiforme(99;0.0414)		ATCATTGAATCCAACTCAGAG	0.413																																																	0								ENSG00000152193						141.0	142.0	142.0					13																	79190272		2203	4300	6503	RNF219	SO:0001583	missense	0			-	HGNC	BC028586	CCDS31997.1	13q31.1	2011-05-23	2008-03-26	2008-03-26	ENSG00000152193	ENSG00000152193		"""RING-type (C3HC4) zinc fingers"""	20308	protein-coding gene	gene with protein product		615906	"""chromosome 13 open reading frame 7"""	C13orf7			Standard	XM_006719865		Approved	FLJ13449	uc001vkw.1	Q5W0B1	OTTHUMG00000017122	ENST00000282003.6:c.1624G>C	13.37:g.79190272C>G	ENSP00000282003:p.Asp542His	Somatic	0	39	0.00		0.6820090568639808	9	18.18	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	21	32.26	B2RN99|Q8TBY2|Q9H0T2|Q9H8M0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfscan_Znf_RING	p.D542H	ENST00000282003.6	37	c.1624	CCDS31997.1	13	.	.	.	.	.	.	.	.	.	.	C	19.02	3.745050	0.69418	.	.	ENSG00000152193	ENST00000282003	T	0.14516	2.5	5.86	5.86	0.93980	.	0.000000	0.64402	D	0.000001	T	0.38878	0.1057	M	0.61703	1.905	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	T	0.03524	-1.1028	10	0.87932	D	0	-11.0944	20.2019	0.98263	0.0:1.0:0.0:0.0	.	542	Q5W0B1	RN219_HUMAN	H	542	ENSP00000282003:D542H	ENSP00000282003:D542H	D	-	1	0	RNF219	78088273	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	7.152000	0.77419	2.776000	0.95493	0.655000	0.94253	GAT	-	NULL		0.413	RNF219-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF219	protein_coding	OTTHUMT00000045363.1	C	NM_024546	-		79190272	-1	no_errors	ENST00000282003	ensembl	human	known	74_37	missense	SNP	1.000	G
PLCH1	23007	genome.wustl.edu	37	3	155200815	155200815	+	Silent	SNP	T	T	C			TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr3:155200815T>C	ENST00000340059.7	-	23	3023	c.3024A>G	c.(3022-3024)aaA>aaG	p.K1008K	PLCH1_ENST00000494598.1_Intron|PLCH1_ENST00000460012.1_Silent_p.K970K|PLCH1_ENST00000414191.1_Silent_p.K970K|PLCH1_ENST00000447496.2_3'UTR|PLCH1_ENST00000334686.6_Silent_p.K970K|PLCH1-AS2_ENST00000472913.1_RNA	NM_001130960.1	NP_001124432.1	Q4KWH8	PLCH1_HUMAN	phospholipase C, eta 1	1008					inositol phosphate metabolic process (GO:0043647)|lipid catabolic process (GO:0016042)|phosphatidylinositol-mediated signaling (GO:0048015)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase C activity (GO:0050429)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)			NS(3)|breast(3)|endometrium(9)|kidney(4)|large_intestine(20)|lung(45)|ovary(2)|prostate(5)|skin(8)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	107			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			TTGCTTTCCCTTTTCTTCTGC	0.393																																																	0								ENSG00000114805						135.0	144.0	141.0					3																	155200815		2203	4300	6503	PLCH1	SO:0001819	synonymous_variant	0			-	HGNC	AB028992	CCDS33881.1, CCDS46939.1, CCDS46940.1	3q25	2013-01-10	2006-03-16	2006-03-16	ENSG00000114805	ENSG00000114805	3.1.4.11	"""EF-hand domain containing"""	29185	protein-coding gene	gene with protein product		612835	"""phospholipase C-like 3"""	PLCL3		15702972	Standard	NM_014996		Approved	KIAA1069, MGC117152, DKFZp434C1372, PLCeta1	uc021xge.1	Q4KWH8	OTTHUMG00000158477	ENST00000340059.7:c.3024A>G	3.37:g.155200815T>C		Somatic	0	31	0.00		0.6820090568639808	7	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	27	10.00	Q29RV9|Q4KWH9|Q68CN0|Q86XK4|Q9H9U2|Q9UPT3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_PLipase_C_EF-hand-like,pfam_C2_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_dom,smart_Pleckstrin_homology,smart_EF_hand_dom,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_dom,pfscan_EF_hand_dom,pfscan_C2_dom,pfscan_Pleckstrin_homology,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,prints_Pinositol_PLipase_C	p.K1008	ENST00000340059.7	37	c.3024	CCDS46939.1	3																																																																																			-	NULL		0.393	PLCH1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PLCH1	protein_coding	OTTHUMT00000351125.1	T	NM_014996	-		155200815	-1	no_errors	ENST00000340059	ensembl	human	known	74_37	silent	SNP	0.000	C
ALDH1A3	220	genome.wustl.edu	37	15	101432328	101432328	+	Intron	SNP	G	G	T			TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr15:101432328G>T	ENST00000329841.5	+	4	877				ALDH1A3_ENST00000560555.1_3'UTR|RP11-66B24.4_ENST00000560351.1_RNA|ALDH1A3_ENST00000346623.6_Intron	NM_000693.2	NP_000684.2	P47895	AL1A3_HUMAN	aldehyde dehydrogenase 1 family, member A3						embryonic eye morphogenesis (GO:0048048)|face development (GO:0060324)|inner ear morphogenesis (GO:0042472)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|nucleus accumbens development (GO:0021768)|olfactory pit development (GO:0060166)|optic cup morphogenesis involved in camera-type eye development (GO:0002072)|positive regulation of apoptotic process (GO:0043065)|retinal metabolic process (GO:0042574)|retinoic acid biosynthetic process (GO:0002138)|retinoic acid metabolic process (GO:0042573)|retinol metabolic process (GO:0042572)|righting reflex (GO:0060013)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	aldehyde dehydrogenase (NAD) activity (GO:0004029)|aldehyde dehydrogenase [NAD(P)+] activity (GO:0004030)|NAD+ binding (GO:0070403)|protein homodimerization activity (GO:0042803)|thyroid hormone binding (GO:0070324)			NS(1)|central_nervous_system(2)|endometrium(3)|large_intestine(7)|lung(9)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	27	Lung NSC(78;0.00144)|all_lung(78;0.0018)|Melanoma(26;0.00852)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.0766)|Lung(145;0.103)		Vitamin A(DB00162)	GAGCTTCCTGGGAACACACAA	0.542																																																	0								ENSG00000184254																																			ALDH1A3	SO:0001627	intron_variant	0			-	HGNC	U07919	CCDS10389.1	15q26	2010-05-07			ENSG00000184254	ENSG00000184254	1.2.1.5	"""Aldehyde dehydrogenases"""	409	protein-coding gene	gene with protein product	"""retinaldehyde dehydrogenase 3"""	600463		ALDH6		7698756	Standard	XR_111558		Approved	RALDH3	uc002bwn.4	P47895	OTTHUMG00000149870	ENST00000329841.5:c.346-387G>T	15.37:g.101432328G>T		Somatic	0	35	0.00		0.6820090568639808	21	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	35	10.26	Q6NT64	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000329841.5	37	NULL	CCDS10389.1	15																																																																																			-	-		0.542	ALDH1A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALDH1A3	protein_coding	OTTHUMT00000313620.2	G		-		101432328	+1	no_errors	ENST00000560555	ensembl	human	known	74_37	rna	SNP	0.000	T
ZXDA	7789	genome.wustl.edu	37	X	57936796	57936798	+	In_Frame_Del	DEL	CCG	CCG	-			TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	CCG	CCG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chrX:57936796_57936798delCCG	ENST00000358697.4	-	1	269_271	c.57_59delCGG	c.(55-60)ggcggt>ggt	p.19_20GG>G		NM_007156.4	NP_009087.1	P98168	ZXDA_HUMAN	zinc finger, X-linked, duplicated A	19	Poly-Gly.				positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(9)|kidney(1)|large_intestine(7)|lung(13)|ovary(2)|prostate(2)|skin(1)	37						CGCGGGGATACCGCCGCCGCCGC	0.744																																																	0								ENSG00000198205																																			ZXDA	SO:0001651	inframe_deletion	0				HGNC	L14787	CCDS14376.1	Xp11.21	2013-01-08			ENSG00000198205	ENSG00000198205		"""Zinc fingers, C2H2-type"""	13198	protein-coding gene	gene with protein product	"""zinc finger protein 896"""	300235				8268913	Standard	NM_007156		Approved	ZNF896	uc004dve.3	P98168	OTTHUMG00000021688	ENST00000358697.4:c.57_59delCGG	X.37:g.57936805_57936807delCCG	ENSP00000351530:p.Gly20del	Somatic	0	16	0.00		0.6820090568639808	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	10	16.67	Q9UJP7	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.G20in_frame_del	ENST00000358697.4	37	c.59_57	CCDS14376.1	X																																																																																			-	NULL		0.744	ZXDA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZXDA	protein_coding	OTTHUMT00000056925.1	CCG	NM_007156			57936798	-1	no_errors	ENST00000358697	ensembl	human	known	74_37	in_frame_del	DEL	0.010:0.009:0.008	-
KCNA3	3738	genome.wustl.edu	37	1	111215812	111215812	+	Silent	SNP	G	G	A			TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr1:111215812G>A	ENST00000369769.2	-	1	1843	c.1620C>T	c.(1618-1620)agC>agT	p.S540S		NM_002232.3	NP_002223.3	P22001	KCNA3_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 3	540				S -> T (in Ref. 5; AAA36425). {ECO:0000305}.	potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	membrane raft (GO:0045121)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)|voltage-gated ion channel activity (GO:0005244)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(7)|ovary(4)|pancreas(1)|prostate(3)|skin(1)	38		all_cancers(81;3.92e-06)|all_epithelial(167;1.28e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000398)		Lung(183;0.0235)|Colorectal(144;0.0306)|all cancers(265;0.0752)|Epithelial(280;0.0821)|COAD - Colon adenocarcinoma(174;0.132)|LUSC - Lung squamous cell carcinoma(189;0.133)	Dalfampridine(DB06637)	GGGGGAAAGCGCTATGGTTCA	0.498																																																	0								ENSG00000177272						135.0	124.0	128.0					1																	111215812		2203	4300	6503	KCNA3	SO:0001819	synonymous_variant	0			-	HGNC	L23499	CCDS828.2	1p13.3	2012-07-05			ENSG00000177272	ENSG00000177272		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6221	protein-coding gene	gene with protein product		176263				2251283, 16382104	Standard	NM_002232		Approved	Kv1.3, MK3, HLK3, HPCN3	uc001dzv.1	P22001	OTTHUMG00000034493	ENST00000369769.2:c.1620C>T	1.37:g.111215812G>A		Somatic	0	64	0.00		0.6820090568639808	3	76.92	10	WXS	Illumina HiSeq 2500	Phase_IV	tier1	35	41	45.45	Q5VWN2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_2pore_dom_K_chnl_dom,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv1.3,prints_K_chnl_volt-dep_Kv1,prints_K_chnl_volt-dep_Kv	p.S540	ENST00000369769.2	37	c.1620	CCDS828.2	1																																																																																			-	NULL		0.498	KCNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNA3	protein_coding	OTTHUMT00000083391.1	G	NM_002232	-		111215812	-1	no_errors	ENST00000369769	ensembl	human	known	74_37	silent	SNP	0.998	A
NOL10	79954	genome.wustl.edu	37	2	10811749	10811749	+	Missense_Mutation	SNP	C	C	G			TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr2:10811749C>G	ENST00000381685.5	-	6	500	c.395G>C	c.(394-396)aGa>aCa	p.R132T	NOL10_ENST00000345985.3_Missense_Mutation_p.R132T|NOL10_ENST00000542668.1_Missense_Mutation_p.R82T|NOL10_ENST00000538384.1_Missense_Mutation_p.R106T	NM_024894.3	NP_079170.2	Q9BSC4	NOL10_HUMAN	nucleolar protein 10	132						nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)					Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			Epithelial(75;0.172)|OV - Ovarian serous cystadenocarcinoma(76;0.207)		CTTTGGTATTCTGGTTTTGTA	0.338																																																	0								ENSG00000115761						90.0	88.0	89.0					2																	10811749		2203	4299	6502	NOL10	SO:0001583	missense	0			-	HGNC	AK024137	CCDS1673.2, CCDS58697.1, CCDS58698.1	2p25.1	2008-05-23			ENSG00000115761	ENSG00000115761			25862	protein-coding gene	gene with protein product			"""polyglutamine binding protein 5"""	PQBP5		12477932	Standard	NM_024894		Approved	FLJ14075	uc002raq.3	Q9BSC4	OTTHUMG00000119023	ENST00000381685.5:c.395G>C	2.37:g.10811749C>G	ENSP00000371101:p.Arg132Thr	Somatic	0	81	0.00		0.6820090568639808	22	33.33	11	WXS	Illumina HiSeq 2500	Phase_IV	tier1	44	63	41.12	A8K3R5|B4DLV0|Q53RC9|Q96TA5|Q9H7Y7|Q9H855	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_NUC153,superfamily_WD40_repeat_dom,smart_WD40_repeat	p.R132T	ENST00000381685.5	37	c.395	CCDS1673.2	2	.	.	.	.	.	.	.	.	.	.	C	27.2	4.805517	0.90623	.	.	ENSG00000115761	ENST00000345985;ENST00000381685;ENST00000542668;ENST00000538384;ENST00000431319	D;T;D;T;D	0.87029	-2.2;2.85;-2.2;2.77;-2.2	5.53	5.53	0.82687	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.95878	0.8658	H	0.95611	3.695	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.994;0.992;0.997	D	0.96610	0.9451	10	0.87932	D	0	-24.2709	19.8195	0.96586	0.0:1.0:0.0:0.0	.	106;132;132	B4DLV0;Q9BSC4;Q9BSC4-2	.;NOL10_HUMAN;.	T	132;132;82;106;23	ENSP00000263837:R132T;ENSP00000371101:R132T;ENSP00000437625:R82T;ENSP00000439663:R106T;ENSP00000403170:R23T	ENSP00000263837:R132T	R	-	2	0	NOL10	10729200	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.337000	0.79256	2.756000	0.94617	0.655000	0.94253	AGA	-	superfamily_WD40_repeat_dom		0.338	NOL10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOL10	protein_coding	OTTHUMT00000239227.1	C	NM_024894	-		10811749	-1	no_errors	ENST00000381685	ensembl	human	known	74_37	missense	SNP	1.000	G
LRRIQ3	127255	genome.wustl.edu	37	1	74549765	74549765	+	Intron	SNP	C	C	A			TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr1:74549765C>A	ENST00000395089.1	-	5	867				LRRIQ3_ENST00000354431.4_Intron|LRRIQ3_ENST00000468759.1_5'UTR			A6PVS8	LRIQ3_HUMAN	leucine-rich repeats and IQ motif containing 3											NS(2)|breast(1)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(13)|liver(1)|lung(27)|ovary(3)|prostate(1)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(5)	73						GCTGATATCCCTAGTGTCCAA	0.363																																																	0								ENSG00000162620																																			LRRIQ3	SO:0001627	intron_variant	0			-	HGNC	BX647210	CCDS41350.1	1p31.1	2008-06-12	2008-06-12	2008-06-12	ENSG00000162620	ENSG00000162620			28318	protein-coding gene	gene with protein product			"""leucine rich repeat containing 44"""	LRRC44		12477932	Standard	NM_001105659		Approved	MGC22773	uc001dfy.4	A6PVS8	OTTHUMG00000009508	ENST00000395089.1:c.868-9291G>T	1.37:g.74549765C>A		Somatic	0	37	0.00		0.6820090568639808	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	30	26.83	A6PVS9|Q6P5P7|Q6ZMV4|Q8WUE0	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000395089.1	37	NULL	CCDS41350.1	1																																																																																			-	-		0.363	LRRIQ3-008	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	LRRIQ3	protein_coding	OTTHUMT00000316539.1	C	NM_145258	-		74549765	-1	no_errors	ENST00000468759	ensembl	human	known	74_37	rna	SNP	1.000	A
PIDD1	55367	genome.wustl.edu	37	11	803302	803302	+	Missense_Mutation	SNP	G	G	T			TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr11:803302G>T	ENST00000347755.5	-	3	722	c.581C>A	c.(580-582)tCc>tAc	p.S194Y	PIDD_ENST00000534649.1_5'Flank|PIDD_ENST00000411829.2_Missense_Mutation_p.S194Y	NM_145886.3|NM_145887.3	NP_665893.2|NP_665894.2																					CTGCAGGGTGGATAGGGCCCC	0.652																																																	0								ENSG00000177595						55.0	66.0	62.0					11																	803302		2203	4299	6502	PIDD	SO:0001583	missense	0			-	HGNC																												ENST00000347755.5:c.581C>A	11.37:g.803302G>T	ENSP00000337797:p.Ser194Tyr	Somatic	0	65	0.00		0.6820090568639808	34	2.86	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	39	33.90		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_S68_pidd,pfam_Death_domain,pfam_Leu-rich_rpt,pfam_ZU5,superfamily_DEATH-like_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Death_domain,pfscan_Death_domain,pfscan_ZU5	p.S194Y	ENST00000347755.5	37	c.581	CCDS7716.1	11	.	.	.	.	.	.	.	.	.	.	G	15.45	2.837588	0.50951	.	.	ENSG00000177595	ENST00000411829;ENST00000347755	T;T	0.19806	2.12;2.12	4.42	1.18	0.20946	.	1.274370	0.05473	N	0.553386	T	0.37517	0.1006	M	0.78049	2.395	0.09310	N	1	P;P;P	0.49696	0.927;0.846;0.911	P;B;P	0.52267	0.694;0.367;0.66	T	0.21042	-1.0257	10	0.72032	D	0.01	.	6.8056	0.23777	0.1624:0.4191:0.4185:0.0	.	194;48;194	Q9HB75;Q9HB75-3;Q9HB75-2	PIDD_HUMAN;.;.	Y	194	ENSP00000416801:S194Y;ENSP00000337797:S194Y	ENSP00000337797:S194Y	S	-	2	0	PIDD	793302	0.001000	0.12720	0.014000	0.15608	0.928000	0.56348	1.002000	0.29796	0.454000	0.26884	0.455000	0.32223	TCC	-	smart_Leu-rich_rpt_typical-subtyp		0.652	PIDD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIDD	protein_coding	OTTHUMT00000257103.1	G		-		803302	-1	no_errors	ENST00000347755	ensembl	human	known	74_37	missense	SNP	0.000	T
MYH3	4621	genome.wustl.edu	37	17	10533415	10533415	+	Silent	SNP	C	C	T			TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr17:10533415C>T	ENST00000583535.1	-	38	5643	c.5556G>A	c.(5554-5556)acG>acA	p.T1852T	MYH3_ENST00000226209.7_Silent_p.T1852T	NM_002470.3	NP_002461.2	P11055	MYH3_HUMAN	myosin, heavy chain 3, skeletal muscle, embryonic	1852					actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|embryonic limb morphogenesis (GO:0030326)|face morphogenesis (GO:0060325)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|sarcomere organization (GO:0045214)|skeletal muscle contraction (GO:0003009)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(5)|large_intestine(18)|lung(30)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	83						TTACCTGGTACGTCAGCTCCT	0.517																																																	0								ENSG00000109063						274.0	262.0	266.0					17																	10533415		2203	4300	6503	MYH3	SO:0001819	synonymous_variant	0			-	HGNC		CCDS11157.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109063	ENSG00000109063		"""Myosins / Myosin superfamily : Class II"""	7573	protein-coding gene	gene with protein product	"""myosin, skeletal, heavy chain, embryonic 1"", ""muscle embryonic myosin heavy chain 3"""	160720	"""myosin, heavy polypeptide 3, skeletal muscle, embryonic"""			2726495	Standard	NM_002470		Approved	MYHC-EMB, MYHSE1, HEMHC, SMHCE	uc002gmq.2	P11055	OTTHUMG00000130367	ENST00000583535.1:c.5556G>A	17.37:g.10533415C>T		Somatic	0	63	0.00		0.6820090568639808	1	90.00	9	WXS	Illumina HiSeq 2500	Phase_IV	tier1	41	1	97.62	Q15492	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.T1852	ENST00000583535.1	37	c.5556	CCDS11157.1	17																																																																																			-	pfam_Myosin_tail		0.517	MYH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH3	protein_coding	OTTHUMT00000252734.2	C	NM_002470	-		10533415	-1	no_errors	ENST00000226209	ensembl	human	known	74_37	silent	SNP	0.172	T
MKL2	57496	genome.wustl.edu	37	16	14340547	14340547	+	Missense_Mutation	SNP	C	C	T			TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr16:14340547C>T	ENST00000341243.5	+	10	1397	c.1397C>T	c.(1396-1398)tCa>tTa	p.S466L	MKL2_ENST00000574045.1_Missense_Mutation_p.S477L|MKL2_ENST00000318282.5_Missense_Mutation_p.S477L|MKL2_ENST00000571589.1_Missense_Mutation_p.S477L			Q9ULH7	MKL2_HUMAN	MKL/myocardin-like 2	466					blood vessel morphogenesis (GO:0048514)|cardiac muscle tissue development (GO:0048738)|embryonic organ development (GO:0048568)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|liver development (GO:0001889)|muscle organ development (GO:0007517)|positive regulation of striated muscle tissue development (GO:0045844)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|smooth muscle cell differentiation (GO:0051145)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(3)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(6)|liver(2)|lung(7)|ovary(4)|pancreas(1)|prostate(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						GTGACTAGCTCAGTCTCTACT	0.527																																																	0								ENSG00000186260						205.0	180.0	189.0					16																	14340547		2197	4300	6497	MKL2	SO:0001583	missense	0			-	HGNC	AB033069	CCDS32391.1	16p13.12	2012-11-29			ENSG00000186260	ENSG00000186260			29819	protein-coding gene	gene with protein product		609463				10574462	Standard	NM_014048		Approved	MRTF-B, FLJ31823	uc002dcg.3	Q9ULH7	OTTHUMG00000177379	ENST00000341243.5:c.1397C>T	16.37:g.14340547C>T	ENSP00000345841:p.Ser466Leu	Somatic	0	58	0.00		0.6820090568639808	8	50.00	8	WXS	Illumina HiSeq 2500	Phase_IV	tier1	37	35	51.39	A6ND53|B4DGT8|Q68CT1|Q6UB16|Q86WW2|Q8N226	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RPEL_repeat,pfam_SAP_dom,smart_RPEL_repeat,smart_SAP_dom,pfscan_RPEL_repeat,pfscan_SAP_dom	p.S466L	ENST00000341243.5	37	c.1397		16	.	.	.	.	.	.	.	.	.	.	C	11.82	1.751548	0.31046	.	.	ENSG00000186260	ENST00000318282;ENST00000341243	.	.	.	5.75	5.75	0.90469	.	0.678240	0.14953	N	0.288814	T	0.54759	0.1878	M	0.66939	2.045	0.09310	N	1	B;B	0.18741	0.03;0.01	B;B	0.21151	0.014;0.033	T	0.44982	-0.9292	9	0.19590	T	0.45	-4.7302	18.9126	0.92491	0.0:1.0:0.0:0.0	.	477;477	B4DGT8;Q9ULH7-4	.;.	L	477;466	.	ENSP00000339086:S477L	S	+	2	0	MKL2	14248048	0.113000	0.22115	0.006000	0.13384	0.096000	0.18686	3.120000	0.50430	2.712000	0.92718	0.655000	0.94253	TCA	-	NULL		0.527	MKL2-202	KNOWN	basic	protein_coding	MKL2	protein_coding		C	NM_014048	-		14340547	+1	no_errors	ENST00000341243	ensembl	human	known	74_37	missense	SNP	0.090	T
HOXC8	3224	genome.wustl.edu	37	12	54403298	54403298	+	Missense_Mutation	SNP	G	G	T			TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr12:54403298G>T	ENST00000040584.4	+	1	467	c.230G>T	c.(229-231)tGc>tTc	p.C77F	RP11-834C11.12_ENST00000513209.1_Intron	NM_022658.3	NP_073149.1	P31273	HXC8_HUMAN	homeobox C8	77					anterior/posterior pattern specification (GO:0009952)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron differentiation (GO:0030182)|skeletal system morphogenesis (GO:0048705)|transcription, DNA-templated (GO:0006351)	microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)|skin(3)	8						CAGAACCCGTGCTCGCTTAGC	0.622																																					GBM(197;701 2226 7002 18822 41696)												0								ENSG00000037965						124.0	134.0	131.0					12																	54403298		2203	4300	6503	HOXC8	SO:0001583	missense	0			-	HGNC	X99680	CCDS8870.1	12q13.13	2011-06-20	2005-12-22			ENSG00000037965		"""Homeoboxes / ANTP class : HOXL subclass"""	5129	protein-coding gene	gene with protein product		142970	"""homeo box C8"""	HOX3, HOX3A		1973146, 1358459	Standard	NM_022658		Approved		uc001ser.3	P31273		ENST00000040584.4:c.230G>T	12.37:g.54403298G>T	ENSP00000040584:p.Cys77Phe	Somatic	0	67	0.00		0.6820090568639808	14	17.65	3	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	50	32.00	A8K4J4|O15221|O15362	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_Homeobox_metazoa,prints_HTH_motif	p.C77F	ENST00000040584.4	37	c.230	CCDS8870.1	12	.	.	.	.	.	.	.	.	.	.	G	19.03	3.748832	0.69533	.	.	ENSG00000037965	ENST00000040584	T	0.47869	0.83	3.95	3.95	0.45737	.	0.000000	0.85682	D	0.000000	T	0.71022	0.3291	M	0.87180	2.865	0.80722	D	1	D	0.71674	0.998	D	0.78314	0.991	T	0.75479	-0.3303	10	0.41790	T	0.15	.	15.1195	0.72432	0.0:0.0:1.0:0.0	.	77	P31273	HXC8_HUMAN	F	77	ENSP00000040584:C77F	ENSP00000040584:C77F	C	+	2	0	HOXC8	52689565	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.728000	0.98792	1.904000	0.55121	0.462000	0.41574	TGC	-	NULL		0.622	HOXC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOXC8	protein_coding	OTTHUMT00000358957.2	G		-		54403298	+1	no_errors	ENST00000040584	ensembl	human	known	74_37	missense	SNP	1.000	T
LINC00052	145978	genome.wustl.edu	37	15	88121390	88121390	+	lincRNA	DEL	T	T	-			TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr15:88121390delT	ENST00000560153.1	+	0	259				RP11-648K4.2_ENST00000560439.1_lincRNA	NR_026869.1		Q96N35	TMM83_HUMAN	long intergenic non-protein coding RNA 52							integral component of membrane (GO:0016021)											TTTTTGCATATTTTTTTGCTA	0.388																																																	0								ENSG00000259527																																			LINC00052			0				HGNC	AK056023		15q25.3	2012-10-12	2011-08-10	2011-08-10		ENSG00000259527		"""Long non-coding RNAs"""	26455	non-coding RNA	RNA, long non-coding			"""transmembrane protein 83"", ""non-protein coding RNA 52"""	TMEM83, NCRNA00052			Standard	NR_026869		Approved	FLJ31461	uc002bmc.1	Q96N35			15.37:g.88121390delT		Somatic	0	17	0.00		0.6820090568639808	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	19	17.39		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000560153.1	37	NULL		15																																																																																			-	-		0.388	LINC00052-002	KNOWN	basic	lincRNA	LINC00052	lincRNA	OTTHUMT00000416151.1	T	XR_017978			88121390	+1	no_errors	ENST00000560153	ensembl	human	known	74_37	rna	DEL	0.000	-
SLC1A6	6511	genome.wustl.edu	37	19	15072975	15072975	+	Silent	SNP	G	G	T	rs148368814		TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr19:15072975G>T	ENST00000221742.3	-	5	781	c.774C>A	c.(772-774)ccC>ccA	p.P258P	SLC1A6_ENST00000544886.2_Silent_p.P258P|SLC1A6_ENST00000430939.2_Silent_p.P194P|SLC1A6_ENST00000598504.1_Silent_p.P258P|SLC1A6_ENST00000600144.1_Silent_p.P258P	NM_005071.1	NP_005062.1	P48664	EAA4_HUMAN	solute carrier family 1 (high affinity aspartate/glutamate transporter), member 6	258					aspartate transport (GO:0015810)|ion transport (GO:0006811)|L-glutamate transport (GO:0015813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	L-aspartate transmembrane transporter activity (GO:0015183)|L-glutamate transmembrane transporter activity (GO:0005313)|sodium:dicarboxylate symporter activity (GO:0017153)			breast(1)|central_nervous_system(2)|endometrium(6)|large_intestine(8)|liver(1)|lung(12)|ovary(3)|pancreas(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	42						AGCCAGGCACGGGTACAGTCT	0.582																																																	0								ENSG00000105143						94.0	87.0	90.0					19																	15072975		2203	4300	6503	SLC1A6	SO:0001819	synonymous_variant	0			-	HGNC		CCDS12321.1, CCDS62578.1	19p13.12	2013-07-15			ENSG00000105143	ENSG00000105143		"""Solute carriers"""	10944	protein-coding gene	gene with protein product		600637				7791878	Standard	NM_005071		Approved	EAAT4	uc002naa.2	P48664	OTTHUMG00000183351	ENST00000221742.3:c.774C>A	19.37:g.15072975G>T		Somatic	0	55	0.00		0.6820090568639808	13	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51	Q8N753	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Na-dicarboxylate_symporter,prints_Na-dicarboxylate_symporter	p.P258	ENST00000221742.3	37	c.774	CCDS12321.1	19																																																																																			-	pfam_Na-dicarboxylate_symporter		0.582	SLC1A6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLC1A6	protein_coding	OTTHUMT00000466283.1	G	NM_005071	-		15072975	-1	no_errors	ENST00000221742	ensembl	human	known	74_37	silent	SNP	0.049	T
MTHFS	10588	genome.wustl.edu	37	15	80181626	80181626	+	Missense_Mutation	SNP	T	T	C			TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr15:80181626T>C	ENST00000258874.3	-	2	248	c.188A>G	c.(187-189)gAg>gGg	p.E63G	MTHFS_ENST00000559722.1_5'UTR|ST20-MTHFS_ENST00000479961.1_Missense_Mutation_p.E39G|ST20-MTHFS_ENST00000494999.1_5'UTR	NM_006441.3	NP_006432.1	P49914	MTHFS_HUMAN	5,10-methenyltetrahydrofolate synthetase (5-formyltetrahydrofolate cyclo-ligase)	63					formate metabolic process (GO:0015942)|tetrahydrofolate metabolic process (GO:0046653)	cytoplasm (GO:0005737)	5-formyltetrahydrofolate cyclo-ligase activity (GO:0030272)|ATP binding (GO:0005524)|folic acid binding (GO:0005542)|metal ion binding (GO:0046872)			endometrium(3)|large_intestine(1)|liver(1)	5				all cancers(203;0.00467)		CTCTTCTGTCTCAATTTCATC	0.393																																																	0								ENSG00000136371						171.0	149.0	156.0					15																	80181626		2203	4300	6503	MTHFS	SO:0001583	missense	0			-	HGNC	L38928	CCDS10311.1	15q24.3	2014-05-15			ENSG00000136371	ENSG00000136371	6.3.3.2		7437	protein-coding gene	gene with protein product		604197				8522195	Standard	NM_006441		Approved	HsT19268	uc002bex.4	P49914	OTTHUMG00000144174	ENST00000258874.3:c.188A>G	15.37:g.80181626T>C	ENSP00000258874:p.Glu63Gly	Somatic	0	89	0.00		0.6820090568639808	16	44.83	13	WXS	Illumina HiSeq 2500	Phase_IV	tier1	41	45	47.67	H3BQ75	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_FTHF_cligase,pirsf_FTHF_cligase,tigrfam_FTHF_cligase	p.E63G	ENST00000258874.3	37	c.188	CCDS10311.1	15	.	.	.	.	.	.	.	.	.	.	T	14.47	2.544089	0.45280	.	.	ENSG00000136371	ENST00000258874	T	0.41400	1.0	5.32	5.32	0.75619	5-formyltetrahydrofolate cyclo-ligase-like domain (1);	0.672064	0.15434	N	0.262566	T	0.32793	0.0841	L	0.33485	1.01	0.34670	D	0.723626	P	0.39601	0.68	B	0.32583	0.148	T	0.50432	-0.8829	10	0.51188	T	0.08	-28.1776	15.2906	0.73862	0.0:0.0:0.0:1.0	.	63	P49914	MTHFS_HUMAN	G	63	ENSP00000258874:E63G	ENSP00000258874:E63G	E	-	2	0	MTHFS	77968681	1.000000	0.71417	0.860000	0.33809	0.795000	0.44927	3.215000	0.51169	2.023000	0.59567	0.528000	0.53228	GAG	-	pfam_FTHF_cligase,pirsf_FTHF_cligase,tigrfam_FTHF_cligase		0.393	MTHFS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTHFS	protein_coding	OTTHUMT00000291374.2	T	NM_006441	-		80181626	-1	no_errors	ENST00000258874	ensembl	human	known	74_37	missense	SNP	0.994	C
MT-CO2	4513	genome.wustl.edu	37	M	8264	8264	+	Silent	SNP	C	C	T			TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chrM:8264C>T	ENST00000361739.1	+	1	679	c.679C>T	c.(679-681)Cta>Tta	p.L227L	MT-CO3_ENST00000362079.2_5'Flank|MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-ATP6_ENST00000361899.2_5'Flank|MT-TG_ENST00000387429.1_RNA|MT-TC_ENST00000387405.1_RNA|MT-TW_ENST00000387382.1_RNA|MT-ND3_ENST00000361227.2_5'Flank|MT-ND4L_ENST00000361335.1_5'Flank|MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TR_ENST00000387439.1_RNA|MT-ND4_ENST00000361381.2_5'Flank|MT-ATP8_ENST00000361851.1_5'Flank|MT-TS1_ENST00000387416.2_RNA			P00403	COX2_HUMAN	mitochondrially encoded cytochrome c oxidase II	227					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, cytochrome c to oxygen (GO:0006123)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|respiratory chain complex IV (GO:0045277)	copper ion binding (GO:0005507)|cytochrome-c oxidase activity (GO:0004129)			endometrium(5)|kidney(8)|lung(2)|pancreas(3)|prostate(1)	19						CCGTATTTACCCTATAGCACC	0.423																																																	0								ENSG00000198712																																			MT-CO2	SO:0001819	synonymous_variant	0			-	HGNC			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198712	ENSG00000198712		"""Mitochondrial respiratory chain complex / Complex IV"""	7421	protein-coding gene	gene with protein product		516040	"""cytochrome c oxidase II"""	MTCO2		1712754, 1989603	Standard			Approved	COX2, CO2		P00403		ENST00000361739.1:c.679C>T	M.37:g.8264C>T		Somatic	0	89	0.00		0.6820090568639808	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	14	12.50	Q37526	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Cyt_c_oxidase_su2_C,pfam_Cyt_c_oxidase_su2_TM_dom,superfamily_Cupredoxin,superfamily_Cyt_c_oxidase_su2_TM_dom,pfscan_Cyt_c_oxidase_su2_TM_dom,pfscan_Cyt_c_oxidase_su2_C,tigrfam_Cyt_c_oxidase_su2	p.L227	ENST00000361739.1	37	c.679		MT																																																																																			-	NULL		0.423	MT-CO2-201	KNOWN	basic|appris_principal	protein_coding	MT-CO2	protein_coding		C	YP_003024029	-		8264	+1	no_errors	ENST00000361739	ensembl	human	known	74_37	silent	SNP	NULL	T
TARDBP	23435	genome.wustl.edu	37	1	11084333	11084334	+	IGR	INS	-	-	T	rs566657331|rs551513393	byFrequency	TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr1:11084333_11084334insT	ENST00000240185.3	+	0	2748				TARDBP_ENST00000480464.1_3'UTR	NM_007375.3	NP_031401.1	Q13148	TADBP_HUMAN	TAR DNA binding protein						3'-UTR-mediated mRNA stabilization (GO:0070935)|cell death (GO:0008219)|mRNA processing (GO:0006397)|negative regulation by host of viral transcription (GO:0043922)|RNA splicing (GO:0008380)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(3)|ovary(2)	11	Ovarian(185;0.249)	Lung NSC(185;1.04e-05)|all_lung(284;1.31e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00262)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.0578)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.37e-07)|COAD - Colon adenocarcinoma(227;7.38e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000299)|Kidney(185;0.000754)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|READ - Rectum adenocarcinoma(331;0.0487)		CAAAGTGAAAATTTTTTTTTTT	0.386																																																	0								ENSG00000120948																																			TARDBP	SO:0001628	intergenic_variant	0				HGNC	U23731	CCDS122.1	1p36.22	2014-09-17			ENSG00000120948	ENSG00000120948		"""RNA binding motif (RRM) containing"""	11571	protein-coding gene	gene with protein product		605078				7745706	Standard	NM_007375		Approved	TDP-43, ALS10	uc001art.3	Q13148	OTTHUMG00000002120		1.37:g.11084344_11084344dupT		Somatic	0	13	0.00		0.6820090568639808	10	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	20	13.04	A4GUK4|A4GUK5|A4GUK6|B2R629|B4DJ45|E2PU12|Q53H27|Q6FI92|Q96DJ0	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000240185.3	37	NULL	CCDS122.1	1																																																																																			-	-		0.386	TARDBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TARDBP	protein_coding	OTTHUMT00000006063.1	-	NM_007375			11084334	+1	no_errors	ENST00000480464	ensembl	human	known	74_37	rna	INS	0.002:0.289	T
BCL10	8915	genome.wustl.edu	37	1	85736511	85736511	+	Frame_Shift_Del	DEL	T	T	-			TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr1:85736511delT	ENST00000370580.1	-	2	873	c.136delA	c.(136-138)atafs	p.I46fs		NM_003921.4	NP_003912.1	O95999	BCL10_HUMAN	B-cell CLL/lymphoma 10	46	CARD. {ECO:0000255|PROSITE- ProRule:PRU00046}.				adaptive immune response (GO:0002250)|B cell apoptotic process (GO:0001783)|cell death (GO:0008219)|cellular defense response (GO:0006968)|cellular response to mechanical stimulus (GO:0071260)|Fc-epsilon receptor signaling pathway (GO:0038095)|immunoglobulin mediated immune response (GO:0016064)|innate immune response (GO:0045087)|interleukin-6 biosynthetic process (GO:0042226)|lymphotoxin A biosynthetic process (GO:0042109)|negative regulation of mature B cell apoptotic process (GO:0002906)|neural tube closure (GO:0001843)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of mast cell cytokine production (GO:0032765)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of T cell activation (GO:0050870)|positive regulation of transcription, DNA-templated (GO:0045893)|protein homooligomerization (GO:0051260)|protein oligomerization (GO:0051259)|regulation of T cell receptor signaling pathway (GO:0050856)|response to food (GO:0032094)|response to fungus (GO:0009620)|response to molecule of bacterial origin (GO:0002237)|T cell apoptotic process (GO:0070231)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor signaling pathway (GO:0002224)	CBM complex (GO:0032449)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|lysosome (GO:0005764)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	enzyme binding (GO:0019899)|kinase binding (GO:0019900)|NF-kappaB binding (GO:0051059)|protease binding (GO:0002020)|protein C-terminus binding (GO:0008022)|protein kinase B binding (GO:0043422)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)	p.I46fs*4(1)		haematopoietic_and_lymphoid_tissue(7)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|stomach(1)|urinary_tract(1)	19				all cancers(265;0.0114)|Epithelial(280;0.0311)		CTACTGAGTATTTTTTTTGCA	0.343			T	IGH@	MALT																																NSCLC(34;993 1034 12176 32621 50182)			Dom	yes		1	1p22	8915	B-cell CLL/lymphoma 10		L	1	Insertion - Frameshift(1)	ovary(1)						ENSG00000142867						83.0	90.0	87.0					1																	85736511		2203	4300	6503	BCL10	SO:0001589	frameshift_variant	0				HGNC	AJ006288	CCDS704.1	1p22	2008-07-18			ENSG00000142867	ENSG00000142867			989	protein-coding gene	gene with protein product	"""CARD-like apoptotic protein"", ""CARD-containing apoptotic signaling protein"", ""CARD containing molecule enhancing NF-kB"", ""caspase-recruiting domain-containing protein"", ""CARD-containing proapoptotic protein"""	603517				9989495	Standard	NM_003921		Approved	CARMEN, CIPER, mE10, c-E10, CLAP	uc021opd.1	O95999	OTTHUMG00000009965	ENST00000370580.1:c.136delA	1.37:g.85736511delT	ENSP00000359612:p.Ile46fs	Somatic	0	46	0.00		0.6820090568639808	53	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	47	9.62	Q5VUF1	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_CARD,superfamily_DEATH-like_dom,pfscan_CARD	p.I46fs	ENST00000370580.1	37	c.136	CCDS704.1	1																																																																																			-	pfam_CARD,superfamily_DEATH-like_dom,pfscan_CARD		0.343	BCL10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCL10	protein_coding	OTTHUMT00000027612.1	T	NM_003921			85736511	-1	no_errors	ENST00000370580	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
PASK	23178	genome.wustl.edu	37	2	242062301	242062301	+	Missense_Mutation	SNP	C	C	T			TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr2:242062301C>T	ENST00000405260.1	-	12	3616	c.2918G>A	c.(2917-2919)aGa>aAa	p.R973K	PASK_ENST00000539818.1_Missense_Mutation_p.R757K|PASK_ENST00000358649.4_Missense_Mutation_p.R973K|PASK_ENST00000403638.3_Missense_Mutation_p.R973K|PASK_ENST00000234040.4_Missense_Mutation_p.R973K|PASK_ENST00000544142.1_Missense_Mutation_p.R787K	NM_001252120.1	NP_001239049.1	Q96RG2	PASK_HUMAN	PAS domain containing serine/threonine kinase	973					negative regulation of glycogen biosynthetic process (GO:0045719)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of energy homeostasis (GO:2000505)|regulation of glucagon secretion (GO:0070092)|regulation of respiratory gaseous exchange (GO:0043576)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatidylinositol binding (GO:0035091)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|lung(20)|ovary(4)|prostate(4)|skin(1)|stomach(1)|urinary_tract(2)	53		all_cancers(19;4.46e-39)|all_epithelial(40;1.34e-17)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00481)|Lung NSC(271;0.017)|Ovarian(221;0.0228)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;1.34e-31)|all cancers(36;1e-28)|OV - Ovarian serous cystadenocarcinoma(60;3.53e-14)|Kidney(56;4.31e-09)|KIRC - Kidney renal clear cell carcinoma(57;4.35e-08)|BRCA - Breast invasive adenocarcinoma(100;5.64e-06)|Lung(119;0.000596)|LUSC - Lung squamous cell carcinoma(224;0.00481)|Colorectal(34;0.014)|COAD - Colon adenocarcinoma(134;0.0968)		AAACCAGGGTCTGGCTCTGAG	0.622																																																	0								ENSG00000115687						51.0	53.0	53.0					2																	242062301		2203	4300	6503	PASK	SO:0001583	missense	0			-	HGNC	U79240	CCDS2545.1, CCDS58758.1, CCDS58759.1	2q37.3	2008-05-23			ENSG00000115687	ENSG00000115687			17270	protein-coding gene	gene with protein product		607505				11688972, 11459942, 15148392	Standard	NM_001252119		Approved	PASKIN, KIAA0135, STK37	uc010fzl.2	Q96RG2	OTTHUMG00000133392	ENST00000405260.1:c.2918G>A	2.37:g.242062301C>T	ENSP00000384016:p.Arg973Lys	Somatic	0	32	0.00		0.6820090568639808	28	30.00	12	WXS	Illumina HiSeq 2500	Phase_IV	tier1	38	40	48.72	G5E9F1|Q05BE4|Q68DY3|Q6GSJ5|Q86XH6|Q99763|Q9UFR7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_PAS_fold,superfamily_Kinase-like_dom,superfamily_PAS,smart_PAS,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_PAS,pfscan_Prot_kinase_dom,tigrfam_PAS	p.R973K	ENST00000405260.1	37	c.2918	CCDS2545.1	2	.	.	.	.	.	.	.	.	.	.	C	0.007	-2.000945	0.00431	.	.	ENSG00000115687	ENST00000234040;ENST00000544142;ENST00000405260;ENST00000358649;ENST00000539818;ENST00000403638	T;T;T;T;T;T	0.64618	-0.11;-0.11;-0.11;-0.07;-0.11;0.93	4.57	1.8	0.24995	.	0.627629	0.13999	N	0.348234	T	0.16514	0.0397	N	0.00138	-2.015	0.09310	N	1	B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0	B;B;B;B;B	0.04013	0.0;0.0;0.0;0.001;0.0	T	0.36841	-0.9731	10	0.02654	T	1	.	4.419	0.11470	0.0:0.2195:0.2218:0.5587	.	938;787;973;973;973	B7Z7R6;F5GYW7;Q96RG2-2;G5E9F1;Q96RG2	.;.;.;.;PASK_HUMAN	K	973;787;973;973;757;973	ENSP00000234040:R973K;ENSP00000441374:R787K;ENSP00000384016:R973K;ENSP00000351475:R973K;ENSP00000443083:R757K;ENSP00000384438:R973K	ENSP00000234040:R973K	R	-	2	0	PASK	241710974	0.001000	0.12720	0.608000	0.28969	0.058000	0.15608	-0.530000	0.06179	0.175000	0.19841	-0.474000	0.04947	AGA	-	NULL		0.622	PASK-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	PASK	protein_coding	OTTHUMT00000323753.1	C	NM_015148	-		242062301	-1	no_errors	ENST00000358649	ensembl	human	known	74_37	missense	SNP	0.010	T
CASP8AP2	9994	genome.wustl.edu	37	6	90564622	90564622	+	RNA	SNP	G	G	A			TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr6:90564622G>A	ENST00000551025.1	+	0	1648									caspase 8 associated protein 2											NS(1)|endometrium(7)|kidney(6)|large_intestine(12)|lung(21)|ovary(2)|urinary_tract(2)	51		all_cancers(76;3.64e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;4.69e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0953)		TGCAAAGGAGGCAACATATAA	0.373																																					Colon(187;1656 2025 17045 31481 39901)												0								ENSG00000118412						67.0	61.0	63.0					6																	90564622		1850	4096	5946	CASP8AP2			0			-	HGNC	AB037736		6q15	2012-04-19	2008-10-30		ENSG00000118412	ENSG00000118412			1510	protein-coding gene	gene with protein product	"""FLICE-associated huge protein"""	606880	"""CASP8 associated protein 2"""			10235259, 17245429, 17003126	Standard	NM_001137668		Approved	FLASH, CED-4, RIP25, FLJ11208, KIAA1315	uc011dzz.2	Q9UKL3	OTTHUMG00000015212		6.37:g.90564622G>A		Somatic	0	36	0.00		0.6820090568639808	15	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	15	16.67		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000551025.1	37	NULL		6																																																																																			-	-		0.373	CASP8AP2-202	KNOWN	basic	processed_transcript	CASP8AP2	processed_transcript		G	NM_001137667	-		90564622	+1	no_errors	ENST00000237177	ensembl	human	known	74_37	rna	SNP	1.000	A
VCP	7415	genome.wustl.edu	37	9	35060455	35060455	+	Missense_Mutation	SNP	T	T	C			TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr9:35060455T>C	ENST00000358901.6	-	13	2445	c.1550A>G	c.(1549-1551)tAt>tGt	p.Y517C		NM_007126.3	NP_009057.1	P55072	TERA_HUMAN	valosin containing protein	517					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|aggresome assembly (GO:0070842)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER to Golgi vesicle-mediated transport (GO:0006888)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|establishment of protein localization (GO:0045184)|positive regulation of Lys63-specific deubiquitinase activity (GO:1903007)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of protein K63-linked deubiquitination (GO:1903006)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein homooligomerization (GO:0051260)|protein N-linked glycosylation via asparagine (GO:0018279)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|retrograde protein transport, ER to cytosol (GO:0030970)|translesion synthesis (GO:0019985)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|Hrd1p ubiquitin ligase complex (GO:0000836)|intracellular membrane-bounded organelle (GO:0043231)|lipid particle (GO:0005811)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|proteasome complex (GO:0000502)|site of double-strand break (GO:0035861)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|deubiquitinase activator activity (GO:0035800)|lipid binding (GO:0008289)|poly(A) RNA binding (GO:0044822)|polyubiquitin binding (GO:0031593)|protein domain specific binding (GO:0019904)|protein phosphatase binding (GO:0019903)|ubiquitin-specific protease binding (GO:1990381)			breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	24			LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)			AGGAGGTCCATAGAACAGAAC	0.498																																																	0								ENSG00000165280						102.0	87.0	92.0					9																	35060455		2203	4300	6503	VCP	SO:0001583	missense	0			-	HGNC	AC004472	CCDS6573.1	9p13.3	2014-09-17	2011-01-25		ENSG00000165280	ENSG00000165280		"""ATPases / AAA-type"""	12666	protein-coding gene	gene with protein product		601023	"""valosin-containing protein"""			8595912, 7553851	Standard	NM_007126		Approved	IBMPFD, p97	uc003zvy.2	P55072	OTTHUMG00000019855	ENST00000358901.6:c.1550A>G	9.37:g.35060455T>C	ENSP00000351777:p.Tyr517Cys	Somatic	0	48	0.00		0.6820090568639808	265	46.91	235	WXS	Illumina HiSeq 2500	Phase_IV	tier1	28	45	38.36	B2R5T8|Q0V924|Q2TAI5|Q969G7|Q9UCD5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ATPase_AAA_core,pfam_CDC4_N-term_subdom,pfam_DNA_helicase_Holl-junc_RuvB_N,pfam_Cdc48_dom2,pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA-2,pfam_Vps4_C,superfamily_P-loop_NTPase,superfamily_Asp_de-COase-like_dom,smart_AAA+_ATPase,tigrfam_AAA_ATPase_CDC48	p.Y517C	ENST00000358901.6	37	c.1550	CCDS6573.1	9	.	.	.	.	.	.	.	.	.	.	T	20.5	4.002817	0.74932	.	.	ENSG00000165280	ENST00000358901	D	0.94092	-3.35	5.85	5.85	0.93711	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	D	0.96463	0.8846	M	0.75085	2.285	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96930	0.9680	10	0.87932	D	0	-35.6377	16.2303	0.82332	0.0:0.0:0.0:1.0	.	517	P55072	TERA_HUMAN	C	517	ENSP00000351777:Y517C	ENSP00000351777:Y517C	Y	-	2	0	VCP	35050455	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.040000	0.89188	2.233000	0.73108	0.533000	0.62120	TAT	-	pfam_ATPase_AAA_core,pfam_DNA_helicase_Holl-junc_RuvB_N,superfamily_P-loop_NTPase,smart_AAA+_ATPase,tigrfam_AAA_ATPase_CDC48		0.498	VCP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VCP	protein_coding	OTTHUMT00000052290.1	T	NM_007126	-		35060455	-1	no_errors	ENST00000358901	ensembl	human	known	74_37	missense	SNP	1.000	C
STK17B	9262	genome.wustl.edu	37	2	197028089	197028089	+	Missense_Mutation	SNP	C	C	G			TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr2:197028089C>G	ENST00000263955.4	-	2	305	c.19G>C	c.(19-21)Gat>Cat	p.D7H	STK17B_ENST00000409228.1_Missense_Mutation_p.D7H	NM_004226.3	NP_004217.1	O94768	ST17B_HUMAN	serine/threonine kinase 17b	7					apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|positive regulation of fibroblast apoptotic process (GO:2000271)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	actin cytoskeleton (GO:0015629)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|cervix(1)|kidney(2)|large_intestine(1)|lung(10)	15			OV - Ovarian serous cystadenocarcinoma(117;0.141)			CTTCGGCAATCAAATCTCCTC	0.338																																																	0								ENSG00000081320						79.0	82.0	81.0					2																	197028089		2203	4300	6503	STK17B	SO:0001583	missense	0			-	HGNC	AB011421	CCDS2315.1	2q33.1	2008-02-05	2007-02-12		ENSG00000081320	ENSG00000081320			11396	protein-coding gene	gene with protein product	"""death-associated protein kinase-related 2"""	604727	"""serine/threonine kinase 17b (apoptosis-inducing)"""			9786912	Standard	NM_004226		Approved	DRAK2	uc002utk.3	O94768	OTTHUMG00000132735	ENST00000263955.4:c.19G>C	2.37:g.197028089C>G	ENSP00000263955:p.Asp7His	Somatic	0	118	0.00		0.6820090568639808	58	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	41	126	24.55		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.D7H	ENST00000263955.4	37	c.19	CCDS2315.1	2	.	.	.	.	.	.	.	.	.	.	C	20.5	4.003750	0.74932	.	.	ENSG00000081320	ENST00000263955;ENST00000409228;ENST00000420683	T;T;T	0.68624	-0.34;-0.34;1.37	5.38	5.38	0.77491	.	0.128787	0.34700	N	0.003745	T	0.58323	0.2114	N	0.19112	0.55	0.52501	D	0.999959	P	0.49961	0.93	P	0.44732	0.459	T	0.65005	-0.6273	10	0.72032	D	0.01	.	17.5001	0.87728	0.0:1.0:0.0:0.0	.	7	O94768	ST17B_HUMAN	H	7	ENSP00000263955:D7H;ENSP00000386853:D7H;ENSP00000399755:D7H	ENSP00000263955:D7H	D	-	1	0	STK17B	196736334	1.000000	0.71417	1.000000	0.80357	0.807000	0.45602	3.009000	0.49552	2.813000	0.96785	0.655000	0.94253	GAT	-	NULL		0.338	STK17B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STK17B	protein_coding	OTTHUMT00000256092.2	C		-		197028089	-1	no_errors	ENST00000263955	ensembl	human	known	74_37	missense	SNP	1.000	G
PSPH	5723	genome.wustl.edu	37	7	56079283	56079284	+	3'UTR	DEL	AA	AA	-	rs71015155		TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	AA	AA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr7:56079283_56079284delAA	ENST00000395471.3	-	0	1654_1655				PSPH_ENST00000459834.1_5'UTR|PSPH_ENST00000275605.3_3'UTR			P78330	SERB_HUMAN	phosphoserine phosphatase						cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|dephosphorylation (GO:0016311)|L-serine biosynthetic process (GO:0006564)|L-serine metabolic process (GO:0006563)|response to mechanical stimulus (GO:0009612)|response to nutrient levels (GO:0031667)|response to testosterone (GO:0033574)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|neuron projection (GO:0043005)	calcium ion binding (GO:0005509)|magnesium ion binding (GO:0000287)|phosphoserine phosphatase activity (GO:0004647)|protein homodimerization activity (GO:0042803)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(6)|ovary(1)|skin(1)	11	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			AACTACAGTTAAAAAAAAAAAA	0.342																																																	0								ENSG00000146733																																			PSPH	SO:0001624	3_prime_UTR_variant	0				HGNC	Y10275	CCDS5522.1	7p11.2	2012-10-02			ENSG00000146733	ENSG00000146733	3.1.3.3		9577	protein-coding gene	gene with protein product		172480		PSP		6297854, 9188776	Standard	NM_004577		Approved		uc003trh.3	P78330	OTTHUMG00000023441	ENST00000395471.3:c.*172TT>-	7.37:g.56079293_56079294delAA		Somatic	0	19	0.00		0.6820090568639808	32	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	16	20.00	B2RCR5|Q7Z3S5	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000395471.3	37	NULL	CCDS5522.1	7																																																																																			-	-		0.342	PSPH-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PSPH	protein_coding	OTTHUMT00000343304.1	AA	NM_004577			56079284	-1	no_errors	ENST00000459834	ensembl	human	known	74_37	rna	DEL	0.001:0.001	-
EGFR	1956	genome.wustl.edu	37	7	55231506	55231506	+	Missense_Mutation	SNP	G	G	A			TCGA-SG-A6Z7-01A-12D-A32I-09	TCGA-SG-A6Z7-11A-21D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	1a9b5304-f9e7-4b7f-9c10-bb5e0b659ce7	150e85f0-08f1-445f-86af-41a5bb0f3590	g.chr7:55231506G>A	ENST00000275493.2	+	14	1889	c.1712G>A	c.(1711-1713)tGc>tAc	p.C571Y	EGFR_ENST00000455089.1_Missense_Mutation_p.C526Y|EGFR_ENST00000342916.3_Missense_Mutation_p.C571Y|EGFR_ENST00000344576.2_Missense_Mutation_p.C571Y|EGFR_ENST00000442591.1_Missense_Mutation_p.C571Y|EGFR_ENST00000454757.2_Missense_Mutation_p.C518Y	NM_005228.3	NP_005219.2	P00533	EGFR_HUMAN	epidermal growth factor receptor	571					activation of phospholipase A2 activity by calcium-mediated signaling (GO:0043006)|activation of phospholipase C activity (GO:0007202)|alkanesulfonate metabolic process (GO:0019694)|astrocyte activation (GO:0048143)|axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cellular response to amino acid stimulus (GO:0071230)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to drug (GO:0035690)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to estradiol stimulus (GO:0071392)|cellular response to mechanical stimulus (GO:0071260)|cerebral cortex cell migration (GO:0021795)|circadian rhythm (GO:0007623)|digestive tract morphogenesis (GO:0048546)|diterpenoid metabolic process (GO:0016101)|embryonic placenta development (GO:0001892)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hair follicle development (GO:0001942)|hydrogen peroxide metabolic process (GO:0042743)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|liver development (GO:0001889)|lung development (GO:0030324)|magnesium ion homeostasis (GO:0010960)|MAPK cascade (GO:0000165)|morphogenesis of an epithelial fold (GO:0060571)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein catabolic process (GO:0042177)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification (GO:0001503)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|polysaccharide metabolic process (GO:0005976)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of DNA repair (GO:0045739)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of inflammatory response (GO:0050729)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of superoxide anion generation (GO:0032930)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vasoconstriction (GO:0045907)|positive regulation of vasodilation (GO:0045909)|protein autophosphorylation (GO:0046777)|protein insertion into membrane (GO:0051205)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to calcium ion (GO:0051592)|response to cobalamin (GO:0033590)|response to hydroxyisoflavone (GO:0033594)|response to osmotic stress (GO:0006970)|response to oxidative stress (GO:0006979)|response to stress (GO:0006950)|response to UV-A (GO:0070141)|salivary gland morphogenesis (GO:0007435)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|tongue development (GO:0043586)|translation (GO:0006412)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|Shc-EGFR complex (GO:0070435)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|epidermal growth factor-activated receptor activity (GO:0005006)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)|ubiquitin protein ligase binding (GO:0031625)			NS(2)|adrenal_gland(5)|biliary_tract(8)|bone(3)|breast(18)|central_nervous_system(106)|endometrium(26)|eye(3)|haematopoietic_and_lymphoid_tissue(9)|kidney(11)|large_intestine(85)|liver(2)|lung(13575)|oesophagus(21)|ovary(38)|pancreas(3)|peritoneum(11)|pleura(2)|prostate(35)|salivary_gland(11)|skin(9)|small_intestine(1)|soft_tissue(4)|stomach(41)|thymus(2)|thyroid(14)|upper_aerodigestive_tract(59)|urinary_tract(6)	14110	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Afatinib(DB08916)|Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)|Vandetanib(DB05294)	AACATCACCTGCACAGGACGG	0.557		8	"""A, O, Mis"""		"""glioma, NSCLC"""	NSCLC			Lung Cancer, Familial Clustering of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)																													yes	Dom	yes	Familial lung cancer	7	7p12.3-p12.1	1956	"""epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)"""		"""E, O"""	0								ENSG00000146648						133.0	124.0	127.0					7																	55231506		2203	4300	6503	EGFR	SO:0001583	missense	0	Familial Cancer Database	incl. Hereditary Lung cancer, Hereditary Non-Small Cell Lung cancer	-	HGNC		CCDS5514.1, CCDS5515.1, CCDS5516.1, CCDS47587.1	7p12	2014-09-17	2010-06-25		ENSG00000146648	ENSG00000146648			3236	protein-coding gene	gene with protein product	"""erythroblastic leukemia viral (v-erb-b) oncogene homolog (avian)"""	131550	"""epidermal growth factor receptor (avian erythroblastic leukemia viral (v-erb-b) oncogene homolog)"""	ERBB		1505215	Standard	NM_201282		Approved	ERBB1	uc003tqk.3	P00533	OTTHUMG00000023661	ENST00000275493.2:c.1712G>A	7.37:g.55231506G>A	ENSP00000275493:p.Cys571Tyr	Somatic	0	23	0.00		0.6820090568639808	64	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	15	16.67	O00688|O00732|P06268|Q14225|Q68GS5|Q92795|Q9BZS2|Q9GZX1|Q9H2C9|Q9H3C9|Q9UMD7|Q9UMD8|Q9UMG5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_EGF_rcpt_L,pfam_Prot_kinase_dom,pfam_Furin-like_Cys-rich_dom,superfamily_Kinase-like_dom,superfamily_Growth_fac_rcpt_N_dom,smart_Furin_repeat,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.C571Y	ENST00000275493.2	37	c.1712	CCDS5514.1	7	.	.	.	.	.	.	.	.	.	.	G	18.26	3.584131	0.65992	.	.	ENSG00000146648	ENST00000455089;ENST00000342916;ENST00000395504;ENST00000344576;ENST00000275493;ENST00000442591;ENST00000454757;ENST00000533450	T;T;T;T;T;T	0.66638	-0.22;-0.22;-0.22;-0.22;-0.22;-0.22	5.65	5.65	0.86999	Growth factor, receptor (1);	0.000000	0.85682	D	0.000000	D	0.88123	0.6352	H	0.96142	3.775	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;0.998;1.0;1.0	D	0.91443	0.5175	10	0.87932	D	0	.	18.3001	0.90160	0.0:0.0:1.0:0.0	.	526;571;571;571	Q504U8;P00533;P00533-3;P00533-4	.;EGFR_HUMAN;.;.	Y	526;571;441;571;571;571;518;365	ENSP00000415559:C526Y;ENSP00000342376:C571Y;ENSP00000345973:C571Y;ENSP00000275493:C571Y;ENSP00000410031:C571Y;ENSP00000395243:C518Y	ENSP00000275493:C571Y	C	+	2	0	EGFR	55199000	1.000000	0.71417	1.000000	0.80357	0.228000	0.25075	9.098000	0.94202	2.678000	0.91216	0.655000	0.94253	TGC	-	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,superfamily_Growth_fac_rcpt_N_dom,smart_Furin_repeat		0.557	EGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EGFR	protein_coding	OTTHUMT00000251456.2	G	NM_005228	-		55231506	+1	no_errors	ENST00000275493	ensembl	human	known	74_37	missense	SNP	1.000	A
