#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
C19orf18	147685	genome.wustl.edu	37	19	58470001	58470001	+	Missense_Mutation	SNP	G	G	A	rs139357251	byFrequency	TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr19:58470001G>A	ENST00000314391.3	-	6	718	c.617C>T	c.(616-618)gCg>gTg	p.A206V		NM_152474.4	NP_689687.1	Q8NEA5	CS018_HUMAN	chromosome 19 open reading frame 18	206						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.A206V(1)		large_intestine(2)|lung(3)|ovary(1)|pancreas(1)|prostate(1)	8		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.017)		ATTATGTGACGCATTCTTTGT	0.403													G|||	6	0.00119808	0.0	0.0	5008	,	,		17255	0.0		0.0	False		,,,				2504	0.0061																1	Substitution - Missense(1)	lung(1)						ENSG00000177025	G	VAL/ALA	1,4405	2.1+/-5.4	0,1,2202	71.0	67.0	69.0		617	-2.2	0.0	19	dbSNP_134	69	1,8599	1.2+/-3.3	0,1,4299	no	missense	C19orf18	NM_152474.4	64	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	benign	206/216	58470001	2,13004	2203	4300	6503	C19orf18	SO:0001583	missense	0			-	HGNC	BC033933	CCDS12967.1	19q13.43	2013-03-11			ENSG00000177025	ENSG00000177025			28642	protein-coding gene	gene with protein product						12477932	Standard	NM_152474		Approved	MGC41906	uc002qqv.3	Q8NEA5	OTTHUMG00000183450	ENST00000314391.3:c.617C>T	19.37:g.58470001G>A	ENSP00000321519:p.Ala206Val	Somatic	0	67	0.00		0.5558904216091591	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	34	10.53		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.A206V	ENST00000314391.3	37	c.617	CCDS12967.1	19	.	.	.	.	.	.	.	.	.	.	G	13.71	2.319556	0.41096	2.27E-4	1.16E-4	ENSG00000177025	ENST00000314391	T	0.50277	0.75	2.96	-2.15	0.07102	.	.	.	.	.	T	0.20618	0.0496	N	0.14661	0.345	0.09310	N	1	B	0.27498	0.18	B	0.15484	0.013	T	0.12785	-1.0534	9	0.30078	T	0.28	-6.121	0.7039	0.00912	0.238:0.1861:0.3857:0.1901	.	206	Q8NEA5	CS018_HUMAN	V	206	ENSP00000321519:A206V	ENSP00000321519:A206V	A	-	2	0	C19orf18	63161813	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.105000	0.10907	-0.305000	0.08831	-0.458000	0.05436	GCG	-	NULL		0.403	C19orf18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C19orf18	protein_coding	OTTHUMT00000466704.1	G	NM_152474	rs139357251		58470001	-1	no_errors	ENST00000314391	ensembl	human	known	74_37	missense	SNP	0.000	A
PKD1L3	342372	genome.wustl.edu	37	16	72003878	72003878	+	RNA	SNP	C	C	T			TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr16:72003878C>T	ENST00000534738.1	-	0	2079							Q7Z443	PK1L3_HUMAN	polycystic kidney disease 1-like 3						cation transport (GO:0006812)|cellular response to acidic pH (GO:0071468)|detection of chemical stimulus involved in sensory perception of sour taste (GO:0001581)|neuropeptide signaling pathway (GO:0007218)|sensory perception of sour taste (GO:0050915)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)			autonomic_ganglia(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|lung(3)|skin(2)	22						TTGTTGGTCACGCGAAGGAAC	0.493																																																	0								ENSG00000187008						109.0	86.0	93.0					16																	72003878		692	1591	2283	PKD1L3			0			-	HGNC	AY164485	CCDS73912.1	16q22.2	2008-02-05				ENSG00000277481			21716	protein-coding gene	gene with protein product		607895				12782129	Standard	NM_181536		Approved		uc010vmm.2	Q7Z443			16.37:g.72003878C>T		Somatic	0	64	0.00		0.5558904216091591	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	60	32.58		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000534738.1	37	NULL		16																																																																																			-	-		0.493	PKD1L3-001	KNOWN	basic	processed_transcript	PKD1L3	processed_transcript	OTTHUMT00000387876.1	C	NM_181536	-		72003878	-1	no_errors	ENST00000335106	ensembl	human	known	74_37	rna	SNP	0.740	T
PCYOX1L	78991	genome.wustl.edu	37	5	148743621	148743627	+	Frame_Shift_Del	DEL	GGTGGGC	GGTGGGC	-			TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	GGTGGGC	GGTGGGC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr5:148743621_148743627delGGTGGGC	ENST00000274569.4	+	3	380_386	c.318_324delGGTGGGC	c.(316-324)gtggtgggcfs	p.VVG106fs	PCYOX1L_ENST00000514349.1_Frame_Shift_Del_p.VVG16fs	NM_024028.3	NP_076933.3	Q8NBM8	PCYXL_HUMAN	prenylcysteine oxidase 1 like	106					prenylcysteine catabolic process (GO:0030328)	extracellular region (GO:0005576)|membrane (GO:0016020)	prenylcysteine oxidase activity (GO:0001735)			breast(2)|kidney(1)|large_intestine(2)|lung(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	11			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGCGCGAGGTGGTGGGCAGGAGCGCCA	0.609																																					Ovarian(62;1136 1477 27277 27495)												0								ENSG00000145882																																			PCYOX1L	SO:0001589	frameshift_variant	0				HGNC		CCDS4296.1	5q33.1	2008-02-05			ENSG00000145882	ENSG00000145882			28477	protein-coding gene	gene with protein product						12477932	Standard	NM_024028		Approved	MGC3265	uc003lqk.2	Q8NBM8	OTTHUMG00000130052	ENST00000274569.4:c.318_324delGGTGGGC	5.37:g.148743621_148743627delGGTGGGC	ENSP00000274569:p.Val106fs	Somatic	NA	NA	NA		0.5558904216091591	20	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q7Z4S2|Q8NCY5|Q8NF69|Q9BTE8|Q9BWS3	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Prenylcys_lyase,pirsf_Prenylcysteine_Oxase	p.V107fs	ENST00000274569.4	37	c.318_324	CCDS4296.1	5																																																																																			-	pirsf_Prenylcysteine_Oxase		0.609	PCYOX1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCYOX1L	protein_coding	OTTHUMT00000252331.2	GGTGGGC	NM_024028			148743627	+1	no_errors	ENST00000274569	ensembl	human	known	74_37	frame_shift_del	DEL	1.000:1.000:1.000:0.931:1.000:1.000:0.995	-
BAZ2A	11176	genome.wustl.edu	37	12	57011279	57011279	+	Silent	SNP	A	A	G			TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr12:57011279A>G	ENST00000551812.1	-	2	235	c.42T>C	c.(40-42)ctT>ctC	p.L14L	BAZ2A_ENST00000379441.3_Silent_p.L14L|BAZ2A_ENST00000179765.5_Silent_p.L12L|BAZ2A_ENST00000549884.1_Silent_p.L12L	NM_013449.3	NP_038477.2	Q9UIF9	BAZ2A_HUMAN	bromodomain adjacent to zinc finger domain, 2A	14					chromatin remodeling (GO:0006338)|chromatin silencing at rDNA (GO:0000183)|DNA methylation (GO:0006306)|heterochromatin assembly involved in chromatin silencing (GO:0070869)|histone deacetylation (GO:0016575)|histone H3-K9 methylation (GO:0051567)|histone H4 deacetylation (GO:0070933)|histone H4-K20 methylation (GO:0034770)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromatin silencing complex (GO:0005677)|nucleolus (GO:0005730)|rDNA heterochromatin (GO:0033553)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|lysine-acetylated histone binding (GO:0070577)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(1)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(15)|urinary_tract(1)	31						GTGCAGGGGGAAGGCCAGTAA	0.522																																																	0								ENSG00000076108						42.0	46.0	44.0					12																	57011279		1943	4141	6084	BAZ2A	SO:0001819	synonymous_variant	0			-	HGNC	AB032254	CCDS44924.1, CCDS73483.1	12q13.3	2013-01-28				ENSG00000076108		"""Zinc fingers, PHD-type"""	962	protein-coding gene	gene with protein product	"""TTF-I interacting peptide 5"""	605682				10662543, 11532953	Standard	XM_005268596		Approved	KIAA0314, TIP5, WALp3	uc001slq.1	Q9UIF9	OTTHUMG00000170332	ENST00000551812.1:c.42T>C	12.37:g.57011279A>G		Somatic	0	57	0.00		0.5558904216091591	11	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	41	8.89	B3KN66|O00536|O15030|Q68DI8|Q96H26	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Bromodomain,pfam_Methyl_CpG_DNA-bd,pfam_DDT_dom,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_DNA-bd_dom,superfamily_Znf_FYVE_PHD,smart_Methyl_CpG_DNA-bd,smart_AT_hook_DNA-bd_motif,smart_DDT_dom_subgr,smart_Znf_PHD,smart_Bromodomain,pfscan_Methyl_CpG_DNA-bd,pfscan_Znf_PHD-finger,pfscan_DDT_dom_superfamily,pfscan_Bromodomain,prints_Bromodomain	p.L14	ENST00000551812.1	37	c.42	CCDS44924.1	12																																																																																			-	NULL		0.522	BAZ2A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BAZ2A	protein_coding	OTTHUMT00000408561.1	A	NM_013449	-		57011279	-1	no_errors	ENST00000551812	ensembl	human	known	74_37	silent	SNP	1.000	G
TTN	7273	genome.wustl.edu	37	2	179615352	179615352	+	Intron	SNP	T	T	A			TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr2:179615352T>A	ENST00000591111.1	-	45	10585				TTN-AS1_ENST00000578746.1_RNA|TTN-AS1_ENST00000590773.1_RNA|TTN_ENST00000360870.5_Missense_Mutation_p.E3925D|TTN_ENST00000342175.6_Intron|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN_ENST00000589042.1_Intron|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342992.6_Intron			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCATGTTTTCTTCCTTCTGTT	0.343																																																	0								ENSG00000155657						49.0	50.0	50.0					2																	179615352		2201	4296	6497	TTN	SO:0001627	intron_variant	0			-	HGNC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.10360+2498A>T	2.37:g.179615352T>A		Somatic	0	23	0.00		0.5558904216091591	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	34	20.93	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Titin_Z,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.E3925D	ENST00000591111.1	37	c.11775		2	.	.	.	.	.	.	.	.	.	.	T	12.90	2.076222	0.36662	.	.	ENSG00000155657	ENST00000360870	T	0.60672	0.17	5.55	-5.16	0.02857	.	.	.	.	.	T	0.31949	0.0813	N	0.14661	0.345	0.19775	N	0.999957	B	0.12630	0.006	B	0.10450	0.005	T	0.26360	-1.0105	9	0.15952	T	0.53	.	8.4886	0.33086	0.0:0.4189:0.2005:0.3806	.	3925	Q8WZ42-6	.	D	3925	ENSP00000354117:E3925D	ENSP00000354117:E3925D	E	-	3	2	TTN	179323597	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.191000	0.09601	-1.107000	0.03004	-2.997000	0.00077	GAA	-	NULL		0.343	TTN-019	PUTATIVE	basic	protein_coding	TTN	protein_coding	OTTHUMT00000460310.1	T	NM_133378	-		179615352	-1	no_errors	ENST00000360870	ensembl	human	known	74_37	missense	SNP	0.000	A
KCNJ9	3765	genome.wustl.edu	37	1	160057465	160057465	+	Missense_Mutation	SNP	C	C	T			TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr1:160057465C>T	ENST00000368088.3	+	3	1282	c.1040C>T	c.(1039-1041)gCc>gTc	p.A347V		NM_004983.2	NP_004974.2	Q92806	KCNJ9_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 9	347					synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein activated inward rectifier potassium channel activity (GO:0015467)			biliary_tract(1)|endometrium(3)|large_intestine(3)|liver(1)|lung(5)|ovary(1)|skin(2)	16	all_cancers(52;5.86e-16)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			CGCCTTGATGCCCATCTCTAC	0.637																																																	0								ENSG00000162728						35.0	35.0	35.0					1																	160057465		2197	4294	6491	KCNJ9	SO:0001583	missense	0			-	HGNC	U52152	CCDS1194.1	1q23.2	2011-07-05			ENSG00000162728	ENSG00000162728		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6270	protein-coding gene	gene with protein product		600932				8575783, 16382105	Standard	NM_004983		Approved	Kir3.3, GIRK3	uc001fuy.1	Q92806	OTTHUMG00000024072	ENST00000368088.3:c.1040C>T	1.37:g.160057465C>T	ENSP00000357067:p.Ala347Val	Somatic	0	25	0.00		0.5558904216091591	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	12	20.00	Q5JW75	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_K_chnl_inward-rec_Kir,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir3.3	p.A347V	ENST00000368088.3	37	c.1040	CCDS1194.1	1	.	.	.	.	.	.	.	.	.	.	c	15.85	2.954112	0.53293	.	.	ENSG00000162728	ENST00000368088	D	0.94000	-3.33	4.42	4.42	0.53409	Immunoglobulin E-set (1);Potassium channel, inwardly rectifying, Kir, conserved region 2 (1);	0.077539	0.50627	U	0.000118	T	0.76212	0.3956	N	0.04508	-0.205	0.50171	D	0.999858	B	0.13594	0.008	B	0.12156	0.007	T	0.72773	-0.4192	10	0.28530	T	0.3	.	13.9907	0.64364	0.0:1.0:0.0:0.0	.	347	Q92806	IRK9_HUMAN	V	347	ENSP00000357067:A347V	ENSP00000357067:A347V	A	+	2	0	KCNJ9	158324089	0.998000	0.40836	0.994000	0.49952	0.915000	0.54546	2.215000	0.42862	2.025000	0.59659	0.550000	0.68814	GCC	-	pfam_K_chnl_inward-rec_Kir,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir3.3		0.637	KCNJ9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNJ9	protein_coding	OTTHUMT00000060628.1	C	NM_004983	-		160057465	+1	no_errors	ENST00000368088	ensembl	human	known	74_37	missense	SNP	1.000	T
PLCL1	5334	genome.wustl.edu	37	2	199011618	199011618	+	Missense_Mutation	SNP	G	G	A			TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr2:199011618G>A	ENST00000428675.1	+	6	3618	c.3220G>A	c.(3220-3222)Gcc>Acc	p.A1074T	PLCL1_ENST00000437704.2_Missense_Mutation_p.A976T	NM_006226.3	NP_006217.3	Q15111	PLCL1_HUMAN	phospholipase C-like 1	1074					gamma-aminobutyric acid signaling pathway (GO:0007214)|intracellular signal transduction (GO:0035556)|lipid metabolic process (GO:0006629)|positive regulation of receptor binding (GO:1900122)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|inositol 1,4,5 trisphosphate binding (GO:0070679)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(14)|lung(44)|ovary(1)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	80					Quinacrine(DB01103)	CAGTGCTGAGGCCAAGAGCAA	0.512																																																	0								ENSG00000115896						88.0	71.0	77.0					2																	199011618		2203	4300	6503	PLCL1	SO:0001583	missense	0			-	HGNC	D42108	CCDS2326.1, CCDS2326.2	2q33	2014-06-13	2002-02-18	2002-02-22	ENSG00000115896	ENSG00000115896			9063	protein-coding gene	gene with protein product	"""phospholipase C related, but catalytically inactive protein"", ""protein phosphatase 1, regulatory subunit 127"""	600597	"""phospholipase C, epsilon"""	PLCE		7633416	Standard	NM_006226		Approved	PLC-L, PLCL, PRIP, PPP1R127	uc010fsp.3	Q15111	OTTHUMG00000132750	ENST00000428675.1:c.3220G>A	2.37:g.199011618G>A	ENSP00000402861:p.Ala1074Thr	Somatic	0	38	0.00		0.5558904216091591	4	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	35	10.26	Q3MJ90|Q53SD3|Q7Z3S3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_PLipase_C_EF-hand-like,pfam_C2_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_dom,smart_Pleckstrin_homology,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_dom,pfscan_C2_dom,pfscan_Pleckstrin_homology,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,prints_Pinositol_PLipase_C	p.A1074T	ENST00000428675.1	37	c.3220	CCDS2326.2	2	.	.	.	.	.	.	.	.	.	.	G	13.65	2.299815	0.40694	.	.	ENSG00000115896	ENST00000428675;ENST00000437704	T;T	0.17213	2.29;2.31	5.97	2.01	0.26516	.	0.110421	0.40302	N	0.001125	T	0.11367	0.0277	L	0.36672	1.1	0.37415	D	0.913411	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.21861	-1.0233	9	.	.	.	.	7.2005	0.25879	0.2115:0.1218:0.6668:0.0	.	1074;1000	Q15111;B4DYZ4	PLCL1_HUMAN;.	T	1074;976	ENSP00000402861:A1074T;ENSP00000414138:A976T	.	A	+	1	0	PLCL1	198719863	0.998000	0.40836	0.926000	0.36857	0.822000	0.46500	1.334000	0.33827	0.083000	0.17047	0.650000	0.86243	GCC	-	NULL		0.512	PLCL1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	PLCL1	protein_coding	OTTHUMT00000340210.1	G	NM_006226	-		199011618	+1	no_errors	ENST00000428675	ensembl	human	known	74_37	missense	SNP	0.986	A
PRKDC	5591	genome.wustl.edu	37	8	48801762	48801763	+	Frame_Shift_Ins	INS	-	-	A			TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr8:48801762_48801763insA	ENST00000314191.2	-	34	4145_4146	c.4089_4090insT	c.(4087-4092)tgtaatfs	p.N1364fs	PRKDC_ENST00000338368.3_Frame_Shift_Ins_p.N1364fs|PRKDC_ENST00000523565.1_5'UTR|AC103686.1_ENST00000390136.2_RNA	NM_006904.6	NP_008835.5	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic polypeptide	1365					B cell lineage commitment (GO:0002326)|brain development (GO:0007420)|cellular protein modification process (GO:0006464)|cellular response to insulin stimulus (GO:0032869)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|ectopic germ cell programmed cell death (GO:0035234)|heart development (GO:0007507)|immunoglobulin V(D)J recombination (GO:0033152)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of protein phosphorylation (GO:0001933)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|pro-B cell differentiation (GO:0002328)|protein destabilization (GO:0031648)|regulation of circadian rhythm (GO:0042752)|response to gamma radiation (GO:0010332)|rhythmic process (GO:0048511)|signal transduction involved in mitotic G1 DNA damage checkpoint (GO:0072431)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell receptor V(D)J recombination (GO:0033153)|telomere maintenance (GO:0000723)	cytosol (GO:0005829)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription factor binding (GO:0008134)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(9)|cervix(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(30)|lung(56)|ovary(6)|pancreas(1)|prostate(8)|skin(7)	147		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)			Caffeine(DB00201)	AGGTGTGTATTACACAAGTCCT	0.485								Non-homologous end-joining																													Esophageal Squamous(79;1091 1253 12329 31680 40677)												0								ENSG00000253729																																			PRKDC	SO:0001589	frameshift_variant	0				HGNC		CCDS75734.1, CCDS75735.1	8q11	2014-09-17				ENSG00000253729	2.7.11.1		9413	protein-coding gene	gene with protein product		600899		HYRC, HYRC1		7638222	Standard	NM_001081640		Approved	DNPK1, p350, DNAPK, XRCC7, DNA-PKcs	uc003xqi.3	P78527		ENST00000314191.2:c.4090dupT	8.37:g.48801763_48801763dupA	ENSP00000313420:p.Asn1364fs	Somatic	0	17	0.00		0.5558904216091591	37	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	23	34.29	P78528|Q13327|Q13337|Q14175|Q59H99|Q7Z611|Q96SE6|Q9UME3	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_NUC194,pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.N1363fs	ENST00000314191.2	37	c.4090_4089		8																																																																																			-	NULL		0.485	PRKDC-201	KNOWN	basic|appris_principal	protein_coding	PRKDC	protein_coding		-	NM_001081640			48801763	-1	no_errors	ENST00000314191	ensembl	human	known	74_37	frame_shift_ins	INS	0.070:0.066	A
SOX3	6658	genome.wustl.edu	37	X	139586860	139586860	+	Silent	SNP	G	G	T			TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chrX:139586860G>T	ENST00000370536.2	-	1	365	c.366C>A	c.(364-366)ggC>ggA	p.G122G		NM_005634.2	NP_005625.2	P41225	SOX3_HUMAN	SRY (sex determining region Y)-box 3	122					central nervous system development (GO:0007417)|face development (GO:0060324)|hypothalamus development (GO:0021854)|negative regulation of neuron differentiation (GO:0045665)|neuron development (GO:0048666)|organ morphogenesis (GO:0009887)|pituitary gland development (GO:0021983)|sensory organ development (GO:0007423)|Sertoli cell development (GO:0060009)|sex determination (GO:0007530)|spermatid differentiation (GO:0048515)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|pancreas(1)|skin(1)	10	Acute lymphoblastic leukemia(192;7.65e-05)					CACCGCTGCTGCCGCCGCCCG	0.731																																																	0								ENSG00000134595						13.0	15.0	14.0					X																	139586860		2197	4286	6483	SOX3	SO:0001819	synonymous_variant	0			-	HGNC		CCDS14669.1	Xq27.1	2013-10-17			ENSG00000134595	ENSG00000134595		"""SRY (sex determining region Y)-boxes"""	11199	protein-coding gene	gene with protein product		313430	"""panhypopituitarism"""	PHP		15800844	Standard	NM_005634		Approved		uc004fbd.1	P41225	OTTHUMG00000022544	ENST00000370536.2:c.366C>A	X.37:g.139586860G>T		Somatic	0	40	0.00		0.5558904216091591	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	22	15.38	P35714|Q5JWI3|Q9NP49	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_HMG_box_dom,pfam_TF_SOX,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	p.G122	ENST00000370536.2	37	c.366	CCDS14669.1	X																																																																																			-	superfamily_HMG_box_dom		0.731	SOX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOX3	protein_coding	OTTHUMT00000058577.1	G		-		139586860	-1	no_errors	ENST00000370536	ensembl	human	known	74_37	silent	SNP	1.000	T
BUB1	699	genome.wustl.edu	37	2	111430293	111430293	+	Missense_Mutation	SNP	G	G	T			TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr2:111430293G>T	ENST00000302759.6	-	4	485	c.367C>A	c.(367-369)Cag>Aag	p.Q123K	BUB1_ENST00000535254.1_Missense_Mutation_p.Q103K|BUB1_ENST00000409311.1_Missense_Mutation_p.Q123K	NM_004336.3	NP_004327.1	O43683	BUB1_HUMAN	BUB1 mitotic checkpoint serine/threonine kinase	123	BUB1 N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00822}.|Necessary for interaction with CASC5.|Necessary for kinetochore localization.				apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|regulation of chromosome segregation (GO:0051983)|regulation of sister chromatid cohesion (GO:0007063)|spindle assembly checkpoint (GO:0071173)|viral process (GO:0016032)	condensed chromosome kinetochore (GO:0000777)|condensed nuclear chromosome, centromeric region (GO:0000780)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|endometrium(8)|kidney(4)|large_intestine(9)|lung(18)|ovary(1)|prostate(1)|stomach(1)	45		Ovarian(717;0.0822)		BRCA - Breast invasive adenocarcinoma(221;0.0556)		ATTCCTCTCTGAAGGACAGCA	0.493																																																	0								ENSG00000169679						125.0	124.0	124.0					2																	111430293		2203	4300	6503	BUB1	SO:0001583	missense	0			-	HGNC	AF046078	CCDS33273.1, CCDS62984.1, CCDS62985.1	2q13	2013-01-17	2013-01-17		ENSG00000169679	ENSG00000169679			1148	protein-coding gene	gene with protein product		602452	"""budding uninhibited by benzimidazoles 1 (yeast homolog)"", ""budding uninhibited by benzimidazoles 1 homolog (yeast)"""	BUB1L			Standard	NM_004336		Approved	hBUB1, BUB1A	uc002tgc.3	O43683	OTTHUMG00000153638	ENST00000302759.6:c.367C>A	2.37:g.111430293G>T	ENSP00000302530:p.Gln123Lys	Somatic	0	45	0.00		0.5558904216091591	44	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	26	10.34	E9PC26|F5GXI5|O43430|O43643|O60626|Q53QE4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Mad3_BUB1_I,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Mad3_BUB1_I,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_dom	p.Q123K	ENST00000302759.6	37	c.367	CCDS33273.1	2	.	.	.	.	.	.	.	.	.	.	G	15.00	2.702288	0.48307	.	.	ENSG00000169679	ENST00000535254;ENST00000409311;ENST00000302759;ENST00000541432;ENST00000447014;ENST00000420328	T;T;T;T;T	0.63913	-0.07;-0.07;-0.07;-0.07;-0.07	5.55	5.55	0.83447	Mad3/BUB1 homology region 1 (3);	0.422461	0.25854	N	0.027876	T	0.48314	0.1493	L	0.37630	1.12	0.37208	D	0.904674	B;B;P	0.34562	0.007;0.283;0.457	B;B;B	0.25140	0.007;0.042;0.058	T	0.52533	-0.8563	10	0.11485	T	0.65	-7.1753	17.0095	0.86401	0.0:0.0:1.0:0.0	.	103;123;123	F5GXI5;E9PC26;O43683	.;.;BUB1_HUMAN	K	103;123;123;123;114;114	ENSP00000441013:Q103K;ENSP00000386701:Q123K;ENSP00000302530:Q123K;ENSP00000402883:Q114K;ENSP00000409713:Q114K	ENSP00000302530:Q123K	Q	-	1	0	BUB1	111146764	0.984000	0.35163	0.781000	0.31783	0.819000	0.46315	6.189000	0.72051	2.602000	0.87976	0.650000	0.86243	CAG	-	pfam_Mad3_BUB1_I,smart_Mad3_BUB1_I		0.493	BUB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BUB1	protein_coding	OTTHUMT00000331925.1	G	NM_004336	-		111430293	-1	no_errors	ENST00000302759	ensembl	human	known	74_37	missense	SNP	0.604	T
TMEM163	81615	genome.wustl.edu	37	2	135470881	135470881	+	Nonsense_Mutation	SNP	C	C	A			TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr2:135470881C>A	ENST00000281924.6	-	2	275	c.211G>T	c.(211-213)Gaa>Taa	p.E71*		NM_030923.4	NP_112185.1	Q8TC26	TM163_HUMAN	transmembrane protein 163	71						cell junction (GO:0030054)|early endosome membrane (GO:0031901)|integral component of synaptic vesicle membrane (GO:0030285)	zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(5)|lung(8)|stomach(1)|urinary_tract(1)	16				BRCA - Breast invasive adenocarcinoma(221;0.154)		GTGCTGCTTTCTAGTAAGCCT	0.483																																																	0								ENSG00000152128						169.0	149.0	156.0					2																	135470881		2203	4300	6503	TMEM163	SO:0001587	stop_gained	0			-	HGNC		CCDS2172.1	2q21.3	2008-02-05			ENSG00000152128	ENSG00000152128			25380	protein-coding gene	gene with protein product						17623043	Standard	NM_030923		Approved	DKFZP566N034, SV31	uc002ttx.3	Q8TC26	OTTHUMG00000131713	ENST00000281924.6:c.211G>T	2.37:g.135470881C>A	ENSP00000281924:p.Glu71*	Somatic	0	75	0.00		0.5558904216091591	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70	Q53QM3|Q53SV7|Q69YH3|Q9UFG3	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.E71*	ENST00000281924.6	37	c.211	CCDS2172.1	2	.	.	.	.	.	.	.	.	.	.	C	37	6.404437	0.97542	.	.	ENSG00000152128	ENST00000281924;ENST00000537539	.	.	.	5.11	5.11	0.69529	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.49607	T	0.09	.	18.7075	0.91644	0.0:1.0:0.0:0.0	.	.	.	.	X	71;10	.	ENSP00000281924:E71X	E	-	1	0	TMEM163	135187351	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	7.495000	0.81514	2.656000	0.90262	0.591000	0.81541	GAA	-	NULL		0.483	TMEM163-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM163	protein_coding	OTTHUMT00000254631.2	C	NM_030923	-		135470881	-1	no_errors	ENST00000281924	ensembl	human	known	74_37	nonsense	SNP	1.000	A
CCDC81	60494	genome.wustl.edu	37	11	86119267	86119267	+	Missense_Mutation	SNP	G	G	T			TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr11:86119267G>T	ENST00000445632.2	+	9	1340	c.1068G>T	c.(1066-1068)caG>caT	p.Q356H	CCDC81_ENST00000354755.1_Missense_Mutation_p.Q266H|CCDC81_ENST00000528728.1_Intron|CCDC81_ENST00000278487.3_Intron	NM_001156474.1	NP_001149946.1	Q6ZN84	CCD81_HUMAN	coiled-coil domain containing 81	356										kidney(3)|large_intestine(8)|lung(6)|skin(2)|upper_aerodigestive_tract(1)	20		Acute lymphoblastic leukemia(157;5.51e-06)|all_hematologic(158;0.00535)				GACTCATACAGCAGTATCAGA	0.413																																																	0								ENSG00000149201						116.0	107.0	110.0					11																	86119267		2202	4299	6501	CCDC81	SO:0001583	missense	0			-	HGNC	AK131331	CCDS8276.1, CCDS53691.1	11q14.2	2006-03-09			ENSG00000149201	ENSG00000149201			26281	protein-coding gene	gene with protein product							Standard	NM_001156474		Approved	FLJ16339, FLJ23514	uc001pbx.2	Q6ZN84	OTTHUMG00000167213	ENST00000445632.2:c.1068G>T	11.37:g.86119267G>T	ENSP00000415528:p.Gln356His	Somatic	0	34	0.00		0.5558904216091591	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	29	12.12	A0AVL7|Q53FW3|Q9H5E5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_IHF-like_DNA-bd_dom	p.Q356H	ENST00000445632.2	37	c.1068	CCDS53691.1	11	.	.	.	.	.	.	.	.	.	.	G	13.80	2.344969	0.41498	.	.	ENSG00000149201	ENST00000354755;ENST00000445632	T;T	0.44482	0.92;0.92	5.42	-1.54	0.08584	.	0.361069	0.25789	N	0.028286	T	0.54695	0.1874	M	0.78801	2.425	0.31618	N	0.650622	D;B	0.89917	1.0;0.002	D;B	0.78314	0.991;0.005	T	0.56396	-0.7986	9	.	.	.	-1.4803	4.3271	0.11045	0.2725:0.0:0.3972:0.3303	.	356;266	Q6ZN84;Q6ZN84-2	CCD81_HUMAN;.	H	266;356	ENSP00000346800:Q266H;ENSP00000415528:Q356H	.	Q	+	3	2	CCDC81	85796915	0.984000	0.35163	0.041000	0.18516	0.357000	0.29423	0.097000	0.15168	-0.613000	0.05694	0.563000	0.77884	CAG	-	NULL		0.413	CCDC81-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC81	protein_coding	OTTHUMT00000393756.1	G	NM_021827	-		86119267	+1	no_errors	ENST00000445632	ensembl	human	known	74_37	missense	SNP	0.196	T
BCLAF1	9774	genome.wustl.edu	37	6	136582417	136582417	+	Missense_Mutation	SNP	G	G	A	rs62431283		TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr6:136582417G>A	ENST00000531224.1	-	12	2995	c.2743C>T	c.(2743-2745)Cgc>Tgc	p.R915C	BCLAF1_ENST00000530767.1_Missense_Mutation_p.R742C|BCLAF1_ENST00000529917.1_5'UTR|BCLAF1_ENST00000353331.4_Missense_Mutation_p.R864C|BCLAF1_ENST00000527536.1_Missense_Mutation_p.R866C|BCLAF1_ENST00000527759.1_Missense_Mutation_p.R913C|BCLAF1_ENST00000031135.9_Missense_Mutation_p.R133C|BCLAF1_ENST00000392348.2_Missense_Mutation_p.R864C	NM_001077441.1|NM_014739.2	NP_001070909.1|NP_055554.1	Q9NYF8	BCLF1_HUMAN	BCL2-associated transcription factor 1	915					apoptotic process (GO:0006915)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA-templated transcription, initiation (GO:2000144)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of response to DNA damage stimulus (GO:2001022)|regulation of DNA-templated transcription in response to stress (GO:0043620)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|ovary(1)|skin(1)	9	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)		TCTTCCTTGCGTCTGTCCTTC	0.343																																					Colon(142;1534 1789 5427 7063 28491)												0								ENSG00000029363						159.0	156.0	157.0					6																	136582417		2203	4300	6503	BCLAF1	SO:0001583	missense	0			-	HGNC	AF249273	CCDS5177.1, CCDS47485.1, CCDS47486.1, CCDS75525.1	6q22-q23	2007-03-02			ENSG00000029363	ENSG00000029363			16863	protein-coding gene	gene with protein product		612588				8724849, 10330179	Standard	NM_001077440		Approved	KIAA0164, BTF	uc003qgx.1	Q9NYF8	OTTHUMG00000033323	ENST00000531224.1:c.2743C>T	6.37:g.136582417G>A	ENSP00000435210:p.Arg915Cys	Somatic	0	45	0.00		0.5558904216091591	166	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	68	19.05	A2RU75|B7ZM58|E1P586|Q14673|Q86WU6|Q86WY0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.R915C	ENST00000531224.1	37	c.2743	CCDS5177.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.01|15.01	2.704940|2.704940	0.48412|0.48412	.|.	.|.	ENSG00000029363|ENSG00000029363	ENST00000531224;ENST00000353331;ENST00000527536;ENST00000530767;ENST00000527759;ENST00000031135;ENST00000392348|ENST00000534762	T;T;T;T;T;T;T|.	0.50001|.	4.26;4.26;4.26;2.36;4.26;0.76;4.26|.	5.71|5.71	5.71|5.71	0.89125|0.89125	.|.	0.000000|.	0.64402|.	D|.	0.000009|.	T|T	0.32823|0.32823	0.0842|0.0842	N|N	0.08118|0.08118	0|0	0.58432|0.58432	D|D	0.999997|0.999997	D;D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0;1.0|.	D;D;D;D;D|.	0.85130|.	0.988;0.997;0.988;0.988;0.988|.	T|T	0.30822|0.30822	-0.9965|-0.9965	10|5	0.59425|.	D|.	0.04|.	-2.0E-4|-2.0E-4	18.034|18.034	0.89293|0.89293	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	rs62431283|rs62431283	913;194;864;915;742|.	Q9NYF8-2;B7Z8J9;Q9NYF8-3;Q9NYF8;Q9NYF8-4|.	.;.;.;BCLF1_HUMAN;.|.	C|M	915;864;866;742;913;133;864|181	ENSP00000435210:R915C;ENSP00000229446:R864C;ENSP00000435441:R866C;ENSP00000436501:R742C;ENSP00000434826:R913C;ENSP00000031135:R133C;ENSP00000376159:R864C|.	ENSP00000031135:R133C|.	R|T	-|-	1|2	0|0	BCLAF1|BCLAF1	136624110|136624110	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	5.363000|5.363000	0.66104|0.66104	2.691000|2.691000	0.91804|0.91804	0.655000|0.655000	0.94253|0.94253	CGC|ACG	-	NULL		0.343	BCLAF1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BCLAF1	protein_coding	OTTHUMT00000042375.2	G	NM_014739	rs62431283		136582417	-1	no_errors	ENST00000531224	ensembl	human	known	74_37	missense	SNP	1.000	A
PARP14	54625	genome.wustl.edu	37	3	122433232	122433232	+	Frame_Shift_Del	DEL	A	A	-			TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr3:122433232delA	ENST00000474629.2	+	12	4222	c.3956delA	c.(3955-3957)gaafs	p.E1319fs		NM_017554.2	NP_060024.2	Q460N5	PAR14_HUMAN	poly (ADP-ribose) polymerase family, member 14	1319	Macro 3. {ECO:0000255|PROSITE- ProRule:PRU00490}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	NAD+ ADP-ribosyltransferase activity (GO:0003950)			NS(2)|breast(5)|cervix(2)|endometrium(7)|kidney(5)|large_intestine(8)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	50				GBM - Glioblastoma multiforme(114;0.0531)		CAGGAGTGTGAAAAAAAAAAT	0.423																																																	0								ENSG00000173193			3,21,3610		1,0,1,3,15,1797	57.0	55.0	56.0			5.5	1.0	3		57	12,36,7812		3,1,5,1,33,3887	no	codingComplex	PARP14	NM_017554.2		4,1,6,4,48,5684	A1A1,A1A2,A1R,A2A2,A2R,RR		0.6107,0.6604,0.6264			122433232	15,57,11422	1884	4109	5993	PARP14	SO:0001589	frameshift_variant	0				HGNC	AB033094	CCDS46894.1	3q21	2010-02-16			ENSG00000173193	ENSG00000173193		"""Poly (ADP-ribose) polymerases"""	29232	protein-coding gene	gene with protein product		610028				15273990	Standard	NM_017554		Approved	KIAA1268, pART8	uc003efq.4	Q460N5	OTTHUMG00000159552	ENST00000474629.2:c.3956delA	3.37:g.122433232delA	ENSP00000418194:p.Glu1319fs	Somatic	0	50	0.00		0.5558904216091591	11	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	30	11.76	B4E2H0|Q460N4|Q8J027|Q9H9X9|Q9NV60|Q9ULF2	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Macro_dom,pfam_Poly(ADP-ribose)pol_cat_dom,pfam_WWE-dom,smart_Macro_dom,pfscan_Macro_dom,pfscan_WWE-dom,pfscan_Poly(ADP-ribose)pol_cat_dom	p.N1322fs	ENST00000474629.2	37	c.3956	CCDS46894.1	3																																																																																			-	pfam_Macro_dom,smart_Macro_dom,pfscan_Macro_dom		0.423	PARP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARP14	protein_coding	OTTHUMT00000356173.2	A	NM_017554			122433232	+1	no_errors	ENST00000474629	ensembl	human	known	74_37	frame_shift_del	DEL	0.974	-
PCP4L1	654790	genome.wustl.edu	37	1	161254154	161254156	+	In_Frame_Del	DEL	GGA	GGA	-	rs549268381		TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	GGA	GGA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr1:161254154_161254156delGGA	ENST00000504449.1	+	3	338_340	c.90_92delGGA	c.(88-93)gcggag>gcg	p.E35del		NM_001102566.1	NP_001096036.1	A6NKN8	PC4L1_HUMAN	Purkinje cell protein 4 like 1	35								p.A30A(1)|p.E35delE(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(1)	4	all_cancers(52;4.16e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00376)			TCAAGAAGGCGGAGGAGGAGGAG	0.488																																																	2	Substitution - coding silent(1)|Deletion - In frame(1)	large_intestine(1)|lung(1)						ENSG00000248485																																			PCP4L1	SO:0001651	inframe_deletion	0				HGNC	BC028905	CCDS53412.1	1q23.3	2006-02-27	2006-02-27		ENSG00000248485	ENSG00000248485			20448	protein-coding gene	gene with protein product			"""purkinje cell protein 4 like 1"""				Standard	NM_001102566		Approved	IQM1	uc001gad.3	A6NKN8	OTTHUMG00000034340	ENST00000504449.1:c.90_92delGGA	1.37:g.161254163_161254165delGGA	ENSP00000426296:p.Glu35del	Somatic	0	45	0.00		0.5558904216091591	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	27	10.00	B2RV24|B9EJG4	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	NULL	p.E34in_frame_del	ENST00000504449.1	37	c.90_92	CCDS53412.1	1																																																																																			-	NULL		0.488	PCP4L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCP4L1	protein_coding	OTTHUMT00000082986.2	GGA				161254156	+1	no_errors	ENST00000504449	ensembl	human	known	74_37	in_frame_del	DEL	0.232:0.995:1.000	-
ARAP1	116985	genome.wustl.edu	37	11	72396527	72396527	+	3'UTR	SNP	C	C	T			TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr11:72396527C>T	ENST00000393609.3	-	0	4737				ARAP1-AS1_ENST00000542022.1_RNA|ARAP1_ENST00000455638.2_3'UTR|ARAP1_ENST00000393605.3_3'UTR|ARAP1_ENST00000359373.5_3'UTR|ARAP1_ENST00000334211.8_3'UTR|ARAP1_ENST00000495878.1_5'UTR	NM_001040118.2	NP_001035207.1	Q96P48	ARAP1_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1						actin filament reorganization involved in cell cycle (GO:0030037)|negative regulation of stress fiber assembly (GO:0051497)|positive regulation of Cdc42 GTPase activity (GO:0043089)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of receptor recycling (GO:0001921)|regulation of ARF GTPase activity (GO:0032312)|regulation of cell shape (GO:0008360)|regulation of cellular component movement (GO:0051270)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			cervix(2)|endometrium(2)|large_intestine(10)|lung(8)|ovary(1)|skin(3)|urinary_tract(1)	27						CCAGGCTGACCCCTGCTGCCT	0.647																																					Ovarian(102;1198 1520 13195 17913 37529)												0								ENSG00000186635																																			ARAP1	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AF411983	CCDS8217.2, CCDS41687.1, CCDS44671.1	11q13.3	2013-01-11	2008-09-22	2008-09-22	ENSG00000186635	ENSG00000186635		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16925	protein-coding gene	gene with protein product		606646	"""centaurin, delta 2"""	CENTD2			Standard	NM_001040118		Approved		uc001osu.3	Q96P48	OTTHUMG00000157102	ENST00000393609.3:c.*182G>A	11.37:g.72396527C>T		Somatic	0	24	0.00		0.5558904216091591	39	75.16	118	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	0	100.00	A3KLL7|B2RTS2|O94879|Q4LDD5|Q59FI7|Q6PHS3|Q8WU51|Q96HP6|Q96L71	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000393609.3	37	NULL	CCDS41687.1	11																																																																																			-	-		0.647	ARAP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARAP1	protein_coding	OTTHUMT00000347428.1	C	NM_001040118	-		72396527	-1	no_errors	ENST00000495878	ensembl	human	known	74_37	rna	SNP	0.000	T
NEFL	4747	genome.wustl.edu	37	8	24810224	24810224	+	RNA	SNP	A	A	T			TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr8:24810224A>T	ENST00000221169.5	-	0	2326							P07196	NFL_HUMAN	neurofilament, light polypeptide						anterograde axon cargo transport (GO:0008089)|axon transport of mitochondrion (GO:0019896)|cell death (GO:0008219)|intermediate filament organization (GO:0045109)|locomotion (GO:0040011)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of neuron apoptotic process (GO:0043524)|neurofilament bundle assembly (GO:0033693)|neuromuscular process controlling balance (GO:0050885)|neuron projection morphogenesis (GO:0048812)|peripheral nervous system axon regeneration (GO:0014012)|positive regulation of axonogenesis (GO:0050772)|protein polymerization (GO:0051258)|regulation of axon diameter (GO:0031133)|response to corticosterone (GO:0051412)|response to peptide hormone (GO:0043434)|response to toxic substance (GO:0009636)|retrograde axon cargo transport (GO:0008090)|synaptic transmission (GO:0007268)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|neurofilament (GO:0005883)	identical protein binding (GO:0042802)|protein binding, bridging (GO:0030674)|protein C-terminus binding (GO:0008022)|structural constituent of cytoskeleton (GO:0005200)			central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(2)	21		Ovarian(32;0.00965)|Prostate(55;0.157)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0197)|Epithelial(17;2.44e-10)|Colorectal(74;0.0108)|COAD - Colon adenocarcinoma(73;0.0375)		TGACTTTTTAATTCACATAGA	0.373																																																	0								ENSG00000104725																																			NEFL			0			-	HGNC		CCDS75712.1	8p21.2	2014-09-17	2008-09-19		ENSG00000104725	ENSG00000277586		"""Intermediate filaments type IV"""	7739	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 110"""	162280	"""neurofilament, light polypeptide 68kDa"""			17620486, 3145240	Standard	NM_006158		Approved	NFL, CMT1F, CMT2E, NF68, PPP1R110	uc003xee.4	P07196	OTTHUMG00000134284		8.37:g.24810224A>T		Somatic	0	62	0.00		0.5558904216091591	0	100.00	114	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	4	83.33	B9ZVN2|Q16154|Q8IU72	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000221169.5	37	NULL		8																																																																																			-	-		0.373	NEFL-001	KNOWN	sequence_error|basic	processed_transcript	NEFL	processed_transcript	OTTHUMT00000258943.4	A	NM_006158	-		24810224	-1	no_errors	ENST00000221169	ensembl	human	known	74_37	rna	SNP	1.000	T
SPHKAP	80309	genome.wustl.edu	37	2	228856032	228856032	+	Missense_Mutation	SNP	C	C	T			TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr2:228856032C>T	ENST00000392056.3	-	10	4778	c.4732G>A	c.(4732-4734)Gaa>Aaa	p.E1578K	SPHKAP_ENST00000344657.5_Missense_Mutation_p.E1549K	NM_001142644.1	NP_001136116.1	Q2M3C7	SPKAP_HUMAN	SPHK1 interactor, AKAP domain containing	1578						extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|Z disc (GO:0030018)	protein kinase A binding (GO:0051018)			NS(5)|breast(5)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(25)|lung(86)|ovary(6)|pancreas(1)|prostate(6)|skin(17)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	185		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		TTCTTTTCTTCTACTAATTCA	0.393																																																	0								ENSG00000153820						148.0	146.0	147.0					2																	228856032		2203	4300	6503	SPHKAP	SO:0001583	missense	0			-	HGNC		CCDS33389.1, CCDS46537.1	2q36.3	2010-08-20			ENSG00000153820	ENSG00000153820		"""A-kinase anchor proteins"""	30619	protein-coding gene	gene with protein product	"""sphingosine kinase type 1-interacting protein"""	611646				12080051, 11214970	Standard	NM_030623		Approved	SKIP	uc002vpq.2	Q2M3C7	OTTHUMG00000153584	ENST00000392056.3:c.4732G>A	2.37:g.228856032C>T	ENSP00000375909:p.Glu1578Lys	Somatic	0	33	0.00		0.5558904216091591	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	14	61.11	Q68DA3|Q68DR8|Q9C0I5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_AKAP_110_C	p.E1578K	ENST00000392056.3	37	c.4732	CCDS46537.1	2	.	.	.	.	.	.	.	.	.	.	C	23.4	4.417579	0.83449	.	.	ENSG00000153820	ENST00000392056;ENST00000344657	T;T	0.16457	2.34;2.57	6.04	6.04	0.98038	.	0.257949	0.42964	D	0.000637	T	0.41604	0.1166	M	0.65975	2.015	0.51482	D	0.999925	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.01532	-1.1331	10	0.33141	T	0.24	.	17.7508	0.88432	0.0:1.0:0.0:0.0	.	1578;1549	Q2M3C7;Q2M3C7-2	SPKAP_HUMAN;.	K	1578;1549	ENSP00000375909:E1578K;ENSP00000339886:E1549K	ENSP00000339886:E1549K	E	-	1	0	SPHKAP	228564276	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	3.502000	0.53332	2.873000	0.98535	0.563000	0.77884	GAA	-	NULL		0.393	SPHKAP-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPHKAP	protein_coding	OTTHUMT00000331750.1	C	NM_030623	-		228856032	-1	no_errors	ENST00000392056	ensembl	human	known	74_37	missense	SNP	1.000	T
KCNH6	81033	genome.wustl.edu	37	17	61619796	61619796	+	Splice_Site	SNP	G	G	A			TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr17:61619796G>A	ENST00000583023.1	+	9	2159		c.e9+1		KCNH6_ENST00000581784.1_Splice_Site|KCNH6_ENST00000314672.5_Splice_Site|KCNH6_ENST00000456941.2_Splice_Site	NM_030779.2	NP_110406.1	Q9H252	KCNH6_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 6						potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	signal transducer activity (GO:0004871)|voltage-gated potassium channel activity (GO:0005249)			breast(2)|central_nervous_system(2)|endometrium(9)|kidney(4)|large_intestine(6)|lung(20)|ovary(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	54					Doxazosin(DB00590)|Ibutilide(DB00308)|Miconazole(DB01110)|Prazosin(DB00457)|Terazosin(DB01162)	CCTGCGGGACGTGAGTCAGGG	0.622																																																	0								ENSG00000173826						70.0	61.0	64.0					17																	61619796		2203	4300	6503	KCNH6	SO:0001630	splice_region_variant	0			-	HGNC	AF311913	CCDS11638.1, CCDS11639.1, CCDS62290.1	17q23.3	2012-07-05				ENSG00000173826		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18862	protein-coding gene	gene with protein product		608168				16382104	Standard	NM_030779		Approved	Kv11.2, erg2, HERG2	uc002jay.3	Q9H252		ENST00000583023.1:c.2148+1G>A	17.37:g.61619796G>A		Somatic	0	45	0.00		0.5558904216091591	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	24	27.27	Q9BRD7	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e9+1	ENST00000583023.1	37	c.2148+1	CCDS11638.1	17	.	.	.	.	.	.	.	.	.	.	G	21.7	4.194766	0.78902	.	.	ENSG00000173826	ENST00000314672;ENST00000456941	.	.	.	4.85	4.85	0.62838	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.9667	0.89101	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	KCNH6	58973528	1.000000	0.71417	0.997000	0.53966	0.960000	0.62799	8.062000	0.89475	2.213000	0.71641	0.563000	0.77884	.	-	-		0.622	KCNH6-005	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNH6	protein_coding	OTTHUMT00000443853.1	G	NM_030779	-	Intron	61619796	+1	no_errors	ENST00000583023	ensembl	human	known	74_37	splice_site	SNP	1.000	A
SCN1B	6324	genome.wustl.edu	37	19	35524582	35524582	+	Silent	SNP	C	C	T			TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr19:35524582C>T	ENST00000262631.5	+	3	524	c.387C>T	c.(385-387)ttC>ttT	p.F129F	SCN1B_ENST00000596348.1_3'UTR|SCN1B_ENST00000415950.3_Silent_p.F129F|SCN1B_ENST00000595652.1_Intron|CTD-2527I21.9_ENST00000601692.1_RNA	NM_001037.4	NP_001028.1	Q07699	SCN1B_HUMAN	sodium channel, voltage-gated, type I, beta subunit	129	Ig-like C2-type.				axon guidance (GO:0007411)|cardiac conduction (GO:0061337)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|cell adhesion (GO:0007155)|corticospinal neuron axon guidance (GO:0021966)|locomotion (GO:0040011)|membrane depolarization (GO:0051899)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane depolarization during Purkinje myocyte cell action potential (GO:0086047)|neuronal action potential propagation (GO:0019227)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transport (GO:0010765)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transporter activity (GO:2000649)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to pyrethroid (GO:0046684)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	extracellular region (GO:0005576)|intercalated disc (GO:0014704)|node of Ranvier (GO:0033268)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	sodium channel inhibitor activity (GO:0019871)|sodium channel regulator activity (GO:0017080)|voltage-gated sodium channel activity (GO:0005248)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)|voltage-gated sodium channel activity involved in Purkinje myocyte action potential (GO:0086062)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)|skin(3)	11	all_lung(56;2.66e-08)|Lung NSC(56;4.13e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)		Valproic Acid(DB00313)|Zonisamide(DB00909)	TGCTCTTCTTCGAAAACTACG	0.552																																																	0								ENSG00000105711						162.0	125.0	137.0					19																	35524582		2203	4300	6503	SCN1B	SO:0001819	synonymous_variant	0			-	HGNC		CCDS12441.1, CCDS46047.1	19q13.12	2014-09-17	2012-02-28		ENSG00000105711	ENSG00000105711		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10586	protein-coding gene	gene with protein product		600235	"""sodium channel, voltage-gated, type I, beta polypeptide"", ""sodium channel, voltage-gated, type I, beta"""			8394762	Standard	NM_001037		Approved		uc002nxo.2	Q07699	OTTHUMG00000182472	ENST00000262631.5:c.387C>T	19.37:g.35524582C>T		Somatic	0	72	0.00		0.5558904216091591	89	1.11	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	40	9.09	Q5TZZ4|Q6TN97	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Immunoglobulin,pfam_Ig_V-set	p.F129	ENST00000262631.5	37	c.387	CCDS12441.1	19																																																																																			-	pfam_Ig_V-set		0.552	SCN1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN1B	protein_coding	OTTHUMT00000461567.1	C		-		35524582	+1	no_errors	ENST00000262631	ensembl	human	known	74_37	silent	SNP	0.277	T
RCBTB1	55213	genome.wustl.edu	37	13	50123666	50123666	+	Missense_Mutation	SNP	G	G	T	rs200826424		TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr13:50123666G>T	ENST00000378302.2	-	9	1233	c.973C>A	c.(973-975)Cac>Aac	p.H325N	RCBTB1_ENST00000546015.1_Missense_Mutation_p.H325N|RCBTB1_ENST00000258646.3_Missense_Mutation_p.H325N	NM_018191.3	NP_060661.3	Q8NDN9	RCBT1_HUMAN	regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 1	325					cell cycle (GO:0007049)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|urinary_tract(1)	16		Lung NSC(96;2.1e-05)|Breast(56;0.00015)|Prostate(109;0.00314)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;4.7e-09)		CAGGAGAAGTGGGTGAGGTGC	0.647																																																	0								ENSG00000136144						94.0	69.0	78.0					13																	50123666		2203	4300	6503	RCBTB1	SO:0001583	missense	0			-	HGNC	AF334406	CCDS9418.1	13q14	2013-01-08			ENSG00000136144	ENSG00000136144		"""BTB/POZ domain containing"""	18243	protein-coding gene	gene with protein product		607867				11306461	Standard	XM_005266441		Approved	FLJ10716, CLLD7, CLLL7	uc001vde.1	Q8NDN9	OTTHUMG00000016915	ENST00000378302.2:c.973C>A	13.37:g.50123666G>T	ENSP00000367552:p.His325Asn	Somatic	0	68	0.00		0.5558904216091591	15	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	23	14.81	Q8IY29|Q969U9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Reg_chr_condens,pfam_BTB_POZ,superfamily_RCC1/BLIP-II,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pfscan_BTB/POZ-like,pfscan_Reg_chr_condens,prints_Reg_chr_condens	p.H325N	ENST00000378302.2	37	c.973	CCDS9418.1	13	.	.	.	.	.	.	.	.	.	.	G	19.31	3.802263	0.70682	.	.	ENSG00000136144	ENST00000258646;ENST00000378302;ENST00000546015	T;T;T	0.39229	1.31;1.31;1.09	5.15	4.29	0.51040	.	0.000000	0.85682	D	0.000000	T	0.38825	0.1055	M	0.61703	1.905	0.53688	D	0.999974	B	0.17268	0.021	B	0.18561	0.022	T	0.27262	-1.0079	10	0.08381	T	0.77	-5.4607	15.0288	0.71691	0.0:0.0:0.8566:0.1434	.	325	Q8NDN9	RCBT1_HUMAN	N	325	ENSP00000258646:H325N;ENSP00000367552:H325N;ENSP00000443293:H325N	ENSP00000258646:H325N	H	-	1	0	RCBTB1	49021667	1.000000	0.71417	0.995000	0.50966	0.865000	0.49528	7.630000	0.83225	1.138000	0.42230	0.462000	0.41574	CAC	-	NULL		0.647	RCBTB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RCBTB1	protein_coding	OTTHUMT00000044912.2	G	NM_018191	-		50123666	-1	no_errors	ENST00000258646	ensembl	human	known	74_37	missense	SNP	1.000	T
SPHKAP	80309	genome.wustl.edu	37	2	228855785	228855785	+	Missense_Mutation	SNP	C	C	G			TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr2:228855785C>G	ENST00000392056.3	-	11	4936	c.4890G>C	c.(4888-4890)tgG>tgC	p.W1630C	SPHKAP_ENST00000344657.5_Missense_Mutation_p.W1601C	NM_001142644.1	NP_001136116.1	Q2M3C7	SPKAP_HUMAN	SPHK1 interactor, AKAP domain containing	1630						extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|Z disc (GO:0030018)	protein kinase A binding (GO:0051018)			NS(5)|breast(5)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(25)|lung(86)|ovary(6)|pancreas(1)|prostate(6)|skin(17)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	185		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		AGGCAGCTATCCACTGCAGAG	0.512																																																	0								ENSG00000153820						65.0	67.0	66.0					2																	228855785		2203	4300	6503	SPHKAP	SO:0001583	missense	0			-	HGNC		CCDS33389.1, CCDS46537.1	2q36.3	2010-08-20			ENSG00000153820	ENSG00000153820		"""A-kinase anchor proteins"""	30619	protein-coding gene	gene with protein product	"""sphingosine kinase type 1-interacting protein"""	611646				12080051, 11214970	Standard	NM_030623		Approved	SKIP	uc002vpq.2	Q2M3C7	OTTHUMG00000153584	ENST00000392056.3:c.4890G>C	2.37:g.228855785C>G	ENSP00000375909:p.Trp1630Cys	Somatic	0	17	0.00		0.5558904216091591	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	10	62.96	Q68DA3|Q68DR8|Q9C0I5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_AKAP_110_C	p.W1630C	ENST00000392056.3	37	c.4890	CCDS46537.1	2	.	.	.	.	.	.	.	.	.	.	C	22.9	4.344393	0.82022	.	.	ENSG00000153820	ENST00000392056;ENST00000344657	T;T	0.17691	2.26;2.26	6.17	6.17	0.99709	A-kinase anchor 110kDa, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.49338	0.1551	M	0.83774	2.66	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.47169	-0.9138	10	0.87932	D	0	.	19.8676	0.96824	0.0:1.0:0.0:0.0	.	1630;1601	Q2M3C7;Q2M3C7-2	SPKAP_HUMAN;.	C	1630;1601	ENSP00000375909:W1630C;ENSP00000339886:W1601C	ENSP00000339886:W1601C	W	-	3	0	SPHKAP	228564029	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	7.194000	0.77789	2.941000	0.99782	0.655000	0.94253	TGG	-	pfam_AKAP_110_C		0.512	SPHKAP-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPHKAP	protein_coding	OTTHUMT00000331750.1	C	NM_030623	-		228855785	-1	no_errors	ENST00000392056	ensembl	human	known	74_37	missense	SNP	1.000	G
RP11-423O2.5	0	genome.wustl.edu	37	1	142803333	142803333	+	lincRNA	SNP	G	G	A	rs79184194	byFrequency	TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr1:142803333G>A	ENST00000423385.1	-	0	1632																											ACACAAGTGTGCACAAttttt	0.388																																																	0								ENSG00000234978																																			RP11-423O2.5			0			-	Clone_based_vega_gene																													1.37:g.142803333G>A		Somatic	0	50	0.00		0.5558904216091591	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	79	13.19		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000423385.1	37	NULL		1																																																																																			-	-		0.388	RP11-423O2.5-001	KNOWN	basic	lincRNA	ENSG00000234978	lincRNA	OTTHUMT00000193203.1	G		rs79184194		142803333	-1	no_errors	ENST00000423385	ensembl	human	known	74_37	rna	SNP	0.005	A
RGMA	56963	genome.wustl.edu	37	15	93595268	93595268	+	Silent	SNP	G	G	T			TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr15:93595268G>T	ENST00000329082.7	-	3	871	c.600C>A	c.(598-600)acC>acA	p.T200T	RGMA_ENST00000425933.2_Silent_p.T184T|RGMA_ENST00000538818.1_Silent_p.T91T|RGMA_ENST00000556087.1_Silent_p.T184T|RGMA_ENST00000557420.1_Intron|RGMA_ENST00000543599.1_Silent_p.T184T|RGMA_ENST00000557301.1_Silent_p.T208T|RGMA_ENST00000555584.1_5'Flank|RGMA_ENST00000542321.2_Silent_p.T184T|RGMA_ENST00000556658.1_Silent_p.T91T	NM_020211.2	NP_064596	Q96B86	RGMA_HUMAN	repulsive guidance molecule family member a	200					axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|neural tube closure (GO:0001843)|regulation of BMP signaling pathway (GO:0030510)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	coreceptor activity (GO:0015026)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(2)|prostate(1)	9	Lung NSC(78;0.0542)|all_lung(78;0.0786)		BRCA - Breast invasive adenocarcinoma(143;0.0312)|OV - Ovarian serous cystadenocarcinoma(32;0.108)			CAGGCGTGTTGGTGACCTGCA	0.647																																																	0								ENSG00000182175						33.0	38.0	36.0					15																	93595268		2083	4220	6303	RGMA	SO:0001819	synonymous_variant	0			-	HGNC	AL390083	CCDS45357.1, CCDS53973.1, CCDS53974.1	15q26.1	2013-11-06	2013-11-06			ENSG00000182175			30308	protein-coding gene	gene with protein product		607362	"""RGM domain family, member A"""			15975920	Standard	NM_020211		Approved	RGM, RGMa	uc010urc.2	Q96B86		ENST00000329082.7:c.600C>A	15.37:g.93595268G>T		Somatic	0	63	0.00		0.5558904216091591	14	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	35	10.26	B2RTW1|B7Z5S8|F5GXQ7|F5GZU6|G3V518|Q0JV97|Q8NC80|Q9H0E6|Q9NPM3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_RGM_N,pfam_RGM_C	p.T200	ENST00000329082.7	37	c.600	CCDS45357.1	15																																																																																			-	pfam_RGM_N		0.647	RGMA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	RGMA	protein_coding	OTTHUMT00000415091.1	G	NM_020211	-		93595268	-1	no_errors	ENST00000329082	ensembl	human	known	74_37	silent	SNP	1.000	T
GRB14	2888	genome.wustl.edu	37	2	165365287	165365288	+	Frame_Shift_Ins	INS	-	-	T			TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr2:165365287_165365288insT	ENST00000263915.3	-	7	1429_1430	c.891_892insA	c.(889-894)aaacatfs	p.H298fs	GRB14_ENST00000543549.1_Frame_Shift_Ins_p.H211fs	NM_004490.2	NP_004481.2	Q14449	GRB14_HUMAN	growth factor receptor-bound protein 14	298	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				blood coagulation (GO:0007596)|leukocyte migration (GO:0050900)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)	p.K297fs*23(2)		breast(3)|endometrium(2)|large_intestine(6)|lung(10)|ovary(7)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	32						GGTGCTCCATGTTTTTTTTTGC	0.371																																																	2	Deletion - Frameshift(2)	ovary(1)|breast(1)						ENSG00000115290																																			GRB14	SO:0001589	frameshift_variant	0				HGNC		CCDS2222.1	2q22-q24	2013-02-14			ENSG00000115290	ENSG00000115290		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	4565	protein-coding gene	gene with protein product		601524				8812444	Standard	XM_005246477		Approved		uc002ucl.3	Q14449	OTTHUMG00000132135	ENST00000263915.3:c.892dupA	2.37:g.165365296_165365296dupT	ENSP00000263915:p.His298fs	Somatic	0	26	0.00		0.5558904216091591	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	28	9.68	B7Z7F9|Q7Z6I1	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_BPS-dom,pfam_SH2,pfam_Ras-assoc,pfam_Pleckstrin_homology,smart_Ras-assoc,smart_Pleckstrin_homology,smart_SH2,pfscan_Pleckstrin_homology,pfscan_Ras-assoc,pfscan_SH2,prints_SH2	p.H297fs	ENST00000263915.3	37	c.892_891	CCDS2222.1	2																																																																																			-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology		0.371	GRB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRB14	protein_coding	OTTHUMT00000255180.2	-				165365288	-1	no_errors	ENST00000263915	ensembl	human	known	74_37	frame_shift_ins	INS	0.105:0.015	T
SACS	26278	genome.wustl.edu	37	13	23911370	23911370	+	Missense_Mutation	SNP	G	G	C			TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr13:23911370G>C	ENST00000382292.3	-	9	6918	c.6645C>G	c.(6643-6645)ttC>ttG	p.F2215L	SACS_ENST00000382298.3_Missense_Mutation_p.F2215L|SACS_ENST00000402364.1_Missense_Mutation_p.F1465L			Q9NZJ4	SACS_HUMAN	sacsin molecular chaperone	2215					cell death (GO:0008219)|negative regulation of inclusion body assembly (GO:0090084)|protein folding (GO:0006457)	axon (GO:0030424)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|proteasome binding (GO:0070628)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		GAAATGGAAGGAAGCGGATTG	0.388																																																	0								ENSG00000151835						56.0	57.0	57.0					13																	23911370		2203	4299	6502	SACS	SO:0001583	missense	0			-	HGNC	AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835		"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""			10610707, 15057823, 21726565	Standard	NM_001278055		Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.6645C>G	13.37:g.23911370G>C	ENSP00000371729:p.Phe2215Leu	Somatic	0	40	0.00		0.5558904216091591	4	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	28	46.15	O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_HEPN,pfam_Ubiquitin_dom,superfamily_HATPase_ATP-bd,superfamily_DnaJ_domain,smart_HEPN,pfscan_HEPN,pfscan_DnaJ_domain,pfscan_Ubiquitin_supergroup	p.F2215L	ENST00000382292.3	37	c.6645	CCDS9300.2	13	.	.	.	.	.	.	.	.	.	.	G	12.70	2.016836	0.35606	.	.	ENSG00000151835	ENST00000382292;ENST00000402364;ENST00000382298	D;D;D	0.91124	-2.66;-2.79;-2.66	5.93	0.0973	0.14493	.	0.000000	0.85682	D	0.000000	D	0.87633	0.6226	M	0.61703	1.905	0.37045	D	0.897301	B	0.21381	0.055	B	0.23419	0.046	T	0.82402	-0.0475	10	0.59425	D	0.04	.	11.8631	0.52478	0.4879:0.0:0.5121:0.0	.	2215	Q9NZJ4	SACS_HUMAN	L	2215;1465;2215	ENSP00000371729:F2215L;ENSP00000385844:F1465L;ENSP00000371735:F2215L	ENSP00000371729:F2215L	F	-	3	2	SACS	22809370	0.997000	0.39634	0.995000	0.50966	0.982000	0.71751	0.330000	0.19715	-0.076000	0.12775	0.650000	0.86243	TTC	-	NULL		0.388	SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SACS	protein_coding	OTTHUMT00000044148.3	G	NM_014363	-		23911370	-1	no_errors	ENST00000382292	ensembl	human	known	74_37	missense	SNP	0.975	C
SLC25A39	51629	genome.wustl.edu	37	17	42397786	42397786	+	Missense_Mutation	SNP	G	G	T			TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr17:42397786G>T	ENST00000377095.5	-	10	939	c.820C>A	c.(820-822)Cta>Ata	p.L274I	SLC25A39_ENST00000225308.8_Missense_Mutation_p.L266I|SLC25A39_ENST00000586016.1_Missense_Mutation_p.L142I|SLC25A39_ENST00000537904.2_Missense_Mutation_p.L251I|SLC25A39_ENST00000590194.1_Missense_Mutation_p.L266I	NM_001143780.1	NP_001137252.1	Q9BZJ4	S2539_HUMAN	solute carrier family 25, member 39	274					heme biosynthetic process (GO:0006783)|transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				endometrium(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	7		Prostate(33;0.0233)		BRCA - Breast invasive adenocarcinoma(366;0.189)		TCAAAGGGTAGAGTCAGCACT	0.657																																																	0								ENSG00000013306						39.0	39.0	39.0					17																	42397786		2203	4300	6503	SLC25A39	SO:0001583	missense	0			-	HGNC	BC096819	CCDS11482.1, CCDS45700.1	17q12	2013-05-22			ENSG00000013306	ENSG00000013306		"""Solute carriers"""	24279	protein-coding gene	gene with protein product		610820				16949250	Standard	NM_001143780		Approved	FLJ22407, CGI-69	uc002ign.2	Q9BZJ4	OTTHUMG00000132628	ENST00000377095.5:c.820C>A	17.37:g.42397786G>T	ENSP00000366299:p.Leu274Ile	Somatic	0	70	0.00		0.5558904216091591	479	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	41	8.89	A8JZZ2|D3DX51|D3DX54|Q4V9M1|Q9P182|Q9UF66|Q9Y379	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier	p.L274I	ENST00000377095.5	37	c.820	CCDS45700.1	17	.	.	.	.	.	.	.	.	.	.	G	15.07	2.724212	0.48728	.	.	ENSG00000013306	ENST00000225308;ENST00000377095;ENST00000537904	T;T;T	0.78595	-1.19;-1.19;-1.19	5.14	3.05	0.35203	Mitochondrial carrier domain (2);	0.000000	0.64402	D	0.000003	T	0.80633	0.4660	L	0.46885	1.475	0.48236	D	0.999613	P;D;P	0.89917	0.77;1.0;0.728	P;D;B	0.80764	0.463;0.994;0.333	T	0.75221	-0.3394	10	0.24483	T	0.36	-17.544	8.5324	0.33342	0.2668:0.0:0.7332:0.0	.	251;274;266	B4DFG5;Q9BZJ4;Q9BZJ4-2	.;S2539_HUMAN;.	I	266;274;251	ENSP00000225308:L266I;ENSP00000366299:L274I;ENSP00000444540:L251I	ENSP00000225308:L266I	L	-	1	2	SLC25A39	39753312	0.884000	0.30299	0.680000	0.29994	0.617000	0.37484	1.294000	0.33365	0.673000	0.31224	-0.345000	0.07892	CTA	-	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier		0.657	SLC25A39-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC25A39	protein_coding	OTTHUMT00000457745.1	G	NM_016016	-		42397786	-1	no_errors	ENST00000377095	ensembl	human	known	74_37	missense	SNP	0.774	T
BZRAP1	9256	genome.wustl.edu	37	17	56393418	56393418	+	Silent	SNP	G	G	T			TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr17:56393418G>T	ENST00000343736.4	-	16	2227	c.2064C>A	c.(2062-2064)atC>atA	p.I688I	BZRAP1_ENST00000268893.6_Silent_p.I628I|BZRAP1_ENST00000355701.3_Silent_p.I688I			O95153	RIMB1_HUMAN	benzodiazepine receptor (peripheral) associated protein 1	688	SH3 1. {ECO:0000255|PROSITE- ProRule:PRU00192}.					cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	benzodiazepine receptor binding (GO:0030156)			cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|liver(2)|lung(16)|ovary(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	54	Medulloblastoma(34;0.127)|all_neural(34;0.237)					TGTTGCCATAGATGTAGATGT	0.522																																																	0								ENSG00000005379						211.0	178.0	189.0					17																	56393418		2203	4300	6503	BZRAP1	SO:0001819	synonymous_variant	0			-	HGNC	AB014512	CCDS11605.1, CCDS45742.1	17q22-q23	2014-01-09	2014-01-09						16831	protein-coding gene	gene with protein product		610764				9734811, 9915832	Standard	NM_004758		Approved	PRAX-1, KIAA0612, RIM-BP1, RIMBP1	uc002ivx.5	O95153		ENST00000343736.4:c.2064C>A	17.37:g.56393418G>T		Somatic	0	37	0.00		0.5558904216091591	4	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	23	14.81	O75111|Q8N5W3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_SH3_2,superfamily_SH3_domain,superfamily_Fibronectin_type3,smart_SH3_domain,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_SH3_domain	p.I688	ENST00000343736.4	37	c.2064	CCDS11605.1	17																																																																																			-	pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain		0.522	BZRAP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	BZRAP1	protein_coding	OTTHUMT00000443980.1	G	NM_004758	-		56393418	-1	no_errors	ENST00000355701	ensembl	human	known	74_37	silent	SNP	1.000	T
SFXN4	119559	genome.wustl.edu	37	10	120905850	120905850	+	Missense_Mutation	SNP	C	C	A			TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr10:120905850C>A	ENST00000355697.2	-	13	853	c.834G>T	c.(832-834)agG>agT	p.R278S	SFXN4_ENST00000330036.6_Missense_Mutation_p.R269S|SFXN4_ENST00000461438.1_5'UTR	NM_213649.1	NP_998814.1	Q6P4A7	SFXN4_HUMAN	sideroflexin 4	278					iron ion homeostasis (GO:0055072)	integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrial inner membrane (GO:0005743)	cation transmembrane transporter activity (GO:0008324)			central_nervous_system(1)|cervix(1)|kidney(3)|large_intestine(1)|lung(3)|ovary(1)|skin(1)	11		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.0261)		CTGGGTTTTTCCTGAAATACT	0.433																																																	0								ENSG00000183605						132.0	124.0	127.0					10																	120905850		2203	4300	6503	SFXN4	SO:0001583	missense	0			-	HGNC		CCDS7610.1	10q26.11	2006-03-13			ENSG00000183605	ENSG00000183605		"""Sideroflexins"""	16088	protein-coding gene	gene with protein product		615564				14756423	Standard	NM_213649		Approved		uc001leb.3	Q6P4A7	OTTHUMG00000019147	ENST00000355697.2:c.834G>T	10.37:g.120905850C>A	ENSP00000347924:p.Arg278Ser	Somatic	0	79	0.00		0.5558904216091591	34	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00	Q6WSU4|Q86TD9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Mtc	p.R278S	ENST00000355697.2	37	c.834	CCDS7610.1	10	.	.	.	.	.	.	.	.	.	.	C	7.535	0.659435	0.14645	.	.	ENSG00000183605	ENST00000355697;ENST00000330036;ENST00000392875;ENST00000369131	T;T;T	0.31510	1.49;1.49;1.49	4.99	1.9	0.25705	.	1.370110	0.05101	N	0.487143	T	0.19287	0.0463	N	0.22421	0.69	0.09310	N	1	B	0.18013	0.025	B	0.24006	0.05	T	0.29427	-1.0012	10	0.20519	T	0.43	0.1459	2.4215	0.04449	0.193:0.5103:0.1875:0.1092	.	278	Q6P4A7	SFXN4_HUMAN	S	278;269;161;162	ENSP00000347924:R278S;ENSP00000333200:R269S;ENSP00000358127:R162S	ENSP00000333200:R269S	R	-	3	2	SFXN4	120895840	0.009000	0.17119	0.008000	0.14137	0.003000	0.03518	0.476000	0.22180	1.215000	0.43411	0.650000	0.86243	AGG	-	pfam_Mtc		0.433	SFXN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SFXN4	protein_coding	OTTHUMT00000050642.3	C	XM_058406	-		120905850	-1	no_errors	ENST00000355697	ensembl	human	known	74_37	missense	SNP	0.001	A
CMC1	152100	genome.wustl.edu	37	3	28357732	28357733	+	Intron	INS	-	-	T			TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr3:28357732_28357733insT	ENST00000466830.1	+	3	308				CMC1_ENST00000469102.1_3'UTR|CMC1_ENST00000423894.1_Intron	NM_182523.1	NP_872329.1	Q7Z7K0	COXM1_HUMAN	C-x(9)-C motif containing 1							mitochondrion (GO:0005739)	metal ion binding (GO:0046872)			central_nervous_system(1)|kidney(1)|large_intestine(3)	5						gacagGCTTTCTTTTTTTTTTT	0.351																																																	0								ENSG00000187118																																			CMC1	SO:0001627	intron_variant	0				HGNC	BC052644	CCDS33722.1	3p24.1	2013-10-18	2013-10-18	2008-06-20	ENSG00000187118	ENSG00000187118			28783	protein-coding gene	gene with protein product		615166	"""chromosome 3 open reading frame 68"", ""COX assembly mitochondrial protein 1 homolog (S. cerevisiae)"""	C3orf68		18443040	Standard	NM_182523		Approved	MGC61571	uc003cea.3	Q7Z7K0	OTTHUMG00000155660	ENST00000466830.1:c.110-91->T	3.37:g.28357743_28357743dupT		Somatic	0	33	0.00		0.5558904216091591	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	55	12.70	Q68DJ7	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000466830.1	37	NULL	CCDS33722.1	3																																																																																			-	-		0.351	CMC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CMC1	protein_coding	OTTHUMT00000341087.1	-	NM_182523			28357733	+1	no_errors	ENST00000469102	ensembl	human	known	74_37	rna	INS	0.003:0.003	T
EML5	161436	genome.wustl.edu	37	14	89212617	89212617	+	Missense_Mutation	SNP	G	G	A			TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr14:89212617G>A	ENST00000380664.5	-	3	367	c.368C>T	c.(367-369)tCa>tTa	p.S123L	EML5_ENST00000554922.1_Missense_Mutation_p.S123L|EML5_ENST00000352093.5_Missense_Mutation_p.S123L			Q05BV3	EMAL5_HUMAN	echinoderm microtubule associated protein like 5	123						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	catalytic activity (GO:0003824)			breast(1)|endometrium(3)|kidney(4)|large_intestine(17)|lung(14)|ovary(3)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	50						AAGTCCAACTGAAACCAAGCG	0.368																																																	0								ENSG00000165521						124.0	113.0	116.0					14																	89212617		1840	4085	5925	EML5	SO:0001583	missense	0			-	HGNC	AY357725	CCDS45148.1	14q31.3	2013-01-10				ENSG00000165521		"""WD repeat domain containing"""	18197	protein-coding gene	gene with protein product							Standard	NM_183387		Approved	HuEMAP-2, EMAP-2	uc021ryf.1	Q05BV3		ENST00000380664.5:c.368C>T	14.37:g.89212617G>A	ENSP00000370039:p.Ser123Leu	Somatic	0	27	0.00		0.5558904216091591	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	39	37.10	B9EK59|Q5H9N6|Q6UYC9|Q6ZRP3|Q6ZT03	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,pfam_HELP,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.S123L	ENST00000380664.5	37	c.368	CCDS45148.1	14	.	.	.	.	.	.	.	.	.	.	G	32	5.179757	0.94846	.	.	ENSG00000165521	ENST00000554922;ENST00000352093;ENST00000380664	T;T;T	0.01584	4.75;4.75;4.75	5.6	5.6	0.85130	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.64402	D	0.000002	T	0.13841	0.0335	H	0.98111	4.15	0.80722	D	1	P	0.46142	0.873	P	0.47941	0.562	T	0.16276	-1.0408	10	0.72032	D	0.01	-10.3827	19.6102	0.95602	0.0:0.0:1.0:0.0	.	123	Q05BV3	EMAL5_HUMAN	L	123	ENSP00000451998:S123L;ENSP00000298315:S123L;ENSP00000370039:S123L	ENSP00000298315:S123L	S	-	2	0	EML5	88282370	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.624000	0.98398	2.630000	0.89119	0.563000	0.77884	TCA	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom		0.368	EML5-010	KNOWN	basic|CCDS	protein_coding	EML5	protein_coding	OTTHUMT00000410491.1	G		-		89212617	-1	no_errors	ENST00000554922	ensembl	human	known	74_37	missense	SNP	1.000	A
CERS3	204219	genome.wustl.edu	37	15	101088125	101088126	+	5'Flank	INS	-	-	T	rs532048470|rs574236631|rs111634080	byFrequency	TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr15:101088125_101088126insT	ENST00000560944.1	-	0	0				RP11-526I2.5_ENST00000602585.1_lincRNA			Q8IU89	CERS3_HUMAN	ceramide synthase 3						ceramide biosynthetic process (GO:0046513)|keratinocyte differentiation (GO:0030216)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sphingosine N-acyltransferase activity (GO:0050291)										ACATGCTACAGTTTTTTTTTTC	0.347													|||unknown(HR)	294	0.0587061	0.0204	0.1902	5008	,	,		16134	0.0437		0.0487	False		,,,				2504	0.0429																0								ENSG00000270127																																			RP11-526I2.5	SO:0001631	upstream_gene_variant	0				Clone_based_vega_gene		CCDS10384.1	15q26.3	2012-11-19	2011-07-08	2011-07-08	ENSG00000154227	ENSG00000154227		"""Homeoboxes / CERS class"""	23752	protein-coding gene	gene with protein product		615276	"""LAG1 longevity assurance homolog 3 (S. cerevisiae)"", ""LAG1 homolog, ceramide synthase 3"""	LASS3			Standard	NM_178842		Approved	MGC27091	uc002bwb.3	Q8IU89	OTTHUMG00000172568		15.37:g.101088135_101088135dupT	Exception_encountered	Somatic	0	21	0.00		0.5558904216091591	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	19	13.64	Q8NE64|Q8NEN6	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000560944.1	37	NULL		15																																																																																			-	-		0.347	CERS3-009	KNOWN	basic	processed_transcript	PRKXP1	protein_coding	OTTHUMT00000417720.1	-	NM_178842			101088126	-1	no_errors	ENST00000602585	ensembl	human	known	74_37	rna	INS	0.000:0.000	T
EHBP1	23301	genome.wustl.edu	37	2	63220684	63220684	+	Missense_Mutation	SNP	G	G	T			TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr2:63220684G>T	ENST00000263991.5	+	19	3448	c.2966G>T	c.(2965-2967)cGg>cTg	p.R989L	EHBP1_ENST00000405289.1_Missense_Mutation_p.R954L|EHBP1_ENST00000405015.3_Missense_Mutation_p.R918L|EHBP1_ENST00000431489.1_Missense_Mutation_p.R918L|EHBP1_ENST00000496857.1_3'UTR|EHBP1_ENST00000354487.3_Missense_Mutation_p.R954L	NM_015252.3	NP_056067.2	Q8NDI1	EHBP1_HUMAN	EH domain binding protein 1	989						cytoplasm (GO:0005737)|membrane (GO:0016020)				biliary_tract(1)|breast(3)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(8)|lung(22)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	47	Lung NSC(7;0.0951)|all_lung(7;0.169)		LUSC - Lung squamous cell carcinoma(7;7.74e-05)|Epithelial(17;0.189)			GAAGATCTCCGGACTGAACGA	0.358																																																	0								ENSG00000115504						80.0	77.0	78.0					2																	63220684		2203	4299	6502	EHBP1	SO:0001583	missense	0			-	HGNC	AL833968	CCDS1872.1, CCDS46299.1, CCDS46300.1	2p15	2008-02-05			ENSG00000115504	ENSG00000115504			29144	protein-coding gene	gene with protein product		609922				10048485	Standard	NM_015252		Approved	KIAA0903, NACSIN	uc002sby.3	Q8NDI1	OTTHUMG00000129453	ENST00000263991.5:c.2966G>T	2.37:g.63220684G>T	ENSP00000263991:p.Arg989Leu	Somatic	0	25	0.00		0.5558904216091591	130	1.49	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	33	10.81	O94977|Q53TG7|Q53TV6|Q580X2|Q6NX72|Q6PIT3|Q6QNV2|Q9NWI9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF3585,pfam_CH-domain,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	p.R989L	ENST00000263991.5	37	c.2966	CCDS1872.1	2	.	.	.	.	.	.	.	.	.	.	G	7.939	0.742426	0.15642	.	.	ENSG00000115504	ENST00000405015;ENST00000431489;ENST00000263991;ENST00000354487;ENST00000405289	T;T;T;T;T	0.76578	-0.91;-0.91;-1.03;-1.02;-1.02	5.92	1.13	0.20643	.	0.280447	0.33496	N	0.004844	T	0.65439	0.2691	L	0.47716	1.5	0.41354	D	0.987388	P;P;P	0.46142	0.873;0.712;0.61	B;B;B	0.37692	0.256;0.196;0.12	T	0.59700	-0.7405	10	0.29301	T	0.29	.	10.1778	0.42948	0.3223:0.0:0.6777:0.0	.	954;918;989	Q8NDI1-2;Q8NDI1-3;Q8NDI1	.;.;EHBP1_HUMAN	L	918;918;989;954;954	ENSP00000384143:R918L;ENSP00000403783:R918L;ENSP00000263991:R989L;ENSP00000346482:R954L;ENSP00000385524:R954L	ENSP00000263991:R989L	R	+	2	0	EHBP1	63074188	1.000000	0.71417	0.933000	0.37362	0.965000	0.64279	2.631000	0.46502	0.128000	0.18479	-0.143000	0.13931	CGG	-	NULL		0.358	EHBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EHBP1	protein_coding	OTTHUMT00000251616.1	G	NM_015252	-		63220684	+1	no_errors	ENST00000263991	ensembl	human	known	74_37	missense	SNP	0.744	T
SCRIB	23513	genome.wustl.edu	37	8	144895522	144895522	+	Missense_Mutation	SNP	G	G	T			TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr8:144895522G>T	ENST00000320476.3	-	6	532	c.526C>A	c.(526-528)Ctg>Atg	p.L176M	SCRIB_ENST00000377533.3_Missense_Mutation_p.L95M|SCRIB_ENST00000356994.2_Missense_Mutation_p.L176M|MIR937_ENST00000401271.1_RNA	NM_015356.4	NP_056171	Q14160	SCRIB_HUMAN	scribbled planar cell polarity protein	176	Sufficient for targeting to adherens junction and to inhibit cell proliferation.				activation of Rac GTPase activity (GO:0032863)|apoptotic process involved in morphogenesis (GO:0060561)|astrocyte cell migration (GO:0043615)|asymmetric protein localization (GO:0008105)|auditory receptor cell stereocilium organization (GO:0060088)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cochlear nucleus development (GO:0021747)|establishment of apical/basal cell polarity (GO:0035089)|mammary gland duct morphogenesis (GO:0060603)|negative regulation of mitotic cell cycle (GO:0045930)|neural tube closure (GO:0001843)|positive chemotaxis (GO:0050918)|positive regulation of apoptotic process (GO:0043065)|positive regulation of receptor recycling (GO:0001921)|protein localization to adherens junction (GO:0071896)|single organismal cell-cell adhesion (GO:0016337)|synaptic vesicle endocytosis (GO:0048488)|synaptic vesicle targeting (GO:0016080)|viral process (GO:0016032)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cell projection (GO:0042995)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|myelin sheath abaxonal region (GO:0035748)|plasma membrane (GO:0005886)|Scrib-APC-beta-catenin complex (GO:0034750)				NS(1)|autonomic_ganglia(1)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(3)|lung(20)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	42	all_cancers(97;2.31e-11)|all_epithelial(106;1.58e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;1.23e-39)|all cancers(56;1.12e-34)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.18)			AGCTGTTCCAGCTTGACCAGA	0.642																																					Pancreas(51;966 1133 10533 14576 29674)												0								ENSG00000180900						74.0	75.0	75.0					8																	144895522		2203	4300	6503	SCRIB	SO:0001583	missense	0			-	HGNC	AY062238	CCDS6411.1, CCDS6412.1	8q24.3	2013-03-05	2013-03-05		ENSG00000180900	ENSG00000180900			30377	protein-coding gene	gene with protein product		607733	"""scribbled homolog (Drosophila)"""			11027293, 14681682	Standard	NM_182706		Approved	KIAA0147, SCRB1, Vartul	uc003yzo.1	Q14160	OTTHUMG00000165154	ENST00000320476.3:c.526C>A	8.37:g.144895522G>T	ENSP00000322938:p.Leu176Met	Somatic	0	34	0.00		0.5558904216091591	157	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	24	13.33	Q6P496|Q7Z5D1|Q8WWV8|Q96C69|Q96GG1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PDZ,pfam_Leu-rich_rpt,superfamily_PDZ,smart_Leu-rich_rpt_typical-subtyp,smart_PDZ,pfscan_PDZ	p.L176M	ENST00000320476.3	37	c.526	CCDS6411.1	8	.	.	.	.	.	.	.	.	.	.	G	23.7	4.442011	0.83993	.	.	ENSG00000180900	ENST00000356994;ENST00000320476;ENST00000377533	T;T;T	0.61392	0.11;0.11;0.11	4.28	4.28	0.50868	.	.	.	.	.	T	0.78444	0.4284	M	0.91717	3.235	0.58432	D	0.999997	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.82220	-0.0565	9	0.87932	D	0	.	9.8765	0.41207	0.1095:0.0:0.8905:0.0	.	176;176	Q14160;Q14160-3	SCRIB_HUMAN;.	M	176;176;95	ENSP00000349486:L176M;ENSP00000322938:L176M;ENSP00000366756:L95M	ENSP00000322938:L176M	L	-	1	2	SCRIB	144967510	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.903000	0.56318	2.069000	0.61940	0.563000	0.77884	CTG	-	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp		0.642	SCRIB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SCRIB	protein_coding	OTTHUMT00000382215.1	G	NM_015356	-		144895522	-1	no_errors	ENST00000320476	ensembl	human	known	74_37	missense	SNP	1.000	T
MCOLN1	57192	genome.wustl.edu	37	19	7591462	7591462	+	Silent	SNP	G	G	A			TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr19:7591462G>A	ENST00000264079.6	+	3	500	c.375G>A	c.(373-375)ctG>ctA	p.L125L		NM_020533.2	NP_065394.1	Q9GZU1	MCLN1_HUMAN	mucolipin 1	125					calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|cellular iron ion homeostasis (GO:0006879)|ion transmembrane transport (GO:0034220)|release of sequestered calcium ion into cytosol (GO:0051209)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	cation channel activity (GO:0005261)|NAADP-sensitive calcium-release channel activity (GO:0072345)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						GGGAGCAGCTGTACCAGGCCA	0.662																																																	0								ENSG00000090674						113.0	93.0	100.0					19																	7591462		2203	4300	6503	MCOLN1	SO:0001819	synonymous_variant	0			-	HGNC	AF249319	CCDS12180.1	19p13.2	2011-12-16				ENSG00000090674		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	13356	protein-coding gene	gene with protein product		605248				16382100	Standard	NM_020533		Approved	TRPML1, ML4, MLIV, MST080, MSTP080, TRPM-L1	uc002mgo.3	Q9GZU1		ENST00000264079.6:c.375G>A	19.37:g.7591462G>A		Somatic	0	35	0.00		0.5558904216091591	185	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.16	D6W647|Q7Z4F7|Q9H292|Q9H4B3|Q9H4B5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_PKD1_2_channel,superfamily_Glycoside_hydrolase_SF	p.L125	ENST00000264079.6	37	c.375	CCDS12180.1	19	.	.	.	.	.	.	.	.	.	.	G	14.19	2.460919	0.43736	.	.	ENSG00000090674	ENST00000394321	.	.	.	5.48	-4.16	0.03869	.	.	.	.	.	T	0.27134	0.0665	.	.	.	0.22050	N	0.999392	B	0.06786	0.001	B	0.04013	0.001	T	0.34403	-0.9830	7	0.87932	D	0	.	6.3879	0.21572	0.2061:0.3031:0.426:0.0647	.	12	Q9GZU1-2	.	Y	12	.	ENSP00000377856:C12Y	C	+	2	0	MCOLN1	7497462	0.000000	0.05858	0.967000	0.41034	0.937000	0.57800	-2.331000	0.01110	-0.518000	0.06452	-1.291000	0.01355	TGT	-	NULL		0.662	MCOLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCOLN1	protein_coding	OTTHUMT00000458974.2	G	NM_020533	-		7591462	+1	no_errors	ENST00000264079	ensembl	human	known	74_37	silent	SNP	0.969	A
TAF1B	9014	genome.wustl.edu	37	2	9989570	9989571	+	Frame_Shift_Ins	INS	-	-	A	rs528368939		TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr2:9989570_9989571insA	ENST00000263663.5	+	3	374_375	c.186_187insA	c.(187-189)aaafs	p.K63fs	TAF1B_ENST00000396242.3_5'UTR|TAF1B_ENST00000402170.1_3'UTR	NM_005680.2	NP_005671	Q53T94	TAF1B_HUMAN	TATA box binding protein (TBP)-associated factor, RNA polymerase I, B, 63kDa	63	B-reader.				gene expression (GO:0010467)|RNA polymerase I transcriptional preinitiation complex assembly at the promoter for the nuclear large rRNA transcript (GO:0001189)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|RNA polymerase I core factor complex (GO:0070860)	metal ion binding (GO:0046872)|RNA polymerase I CORE element sequence-specific DNA binding (GO:0001164)|RNA polymerase I CORE element sequence-specific DNA binding transcription factor recruiting transcription factor activity (GO:0001187)|sequence-specific DNA binding transcription factor activity (GO:0003700)|TBP-class protein binding (GO:0017025)	p.K63fs*1(1)		breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|lung(4)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	14	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					ACCGGGGGCTTAAAAAAAAAAA	0.337																																																	1	Insertion - Frameshift(1)	upper_aerodigestive_tract(1)						ENSG00000115750																																			TAF1B	SO:0001589	frameshift_variant	0				HGNC	L39061	CCDS33143.1	2p25	2008-06-02	2002-08-29		ENSG00000115750	ENSG00000115750			11533	protein-coding gene	gene with protein product		604904	"""TATA box binding protein (TBP)-associated factor, RNA polymerase I, B, 63kD"""			7801123	Standard	NM_005680		Approved	TAFI63, SL1, RAF1B, RAFI63	uc002qzz.3	Q53T94	OTTHUMG00000151673	ENST00000263663.5:c.197dupA	2.37:g.9989581_9989581dupA	ENSP00000263663:p.Lys63fs	Somatic	0	30	0.00		0.5558904216091591	9	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	14	17.65	B4DI42|F8WD72|Q15574|Q8WVC3	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_TF_Rrn7	p.N65fs	ENST00000263663.5	37	c.186_187	CCDS33143.1	2																																																																																			-	NULL		0.337	TAF1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF1B	protein_coding	OTTHUMT00000323426.2	-	NM_005680			9989571	+1	no_errors	ENST00000263663	ensembl	human	known	74_37	frame_shift_ins	INS	0.992:0.991	A
SP110	3431	genome.wustl.edu	37	2	231067394	231067394	+	Missense_Mutation	SNP	G	G	T			TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr2:231067394G>T	ENST00000358662.4	-	9	1027	c.949C>A	c.(949-951)Cag>Aag	p.Q317K	SP110_ENST00000258382.5_Missense_Mutation_p.Q317K|SP110_ENST00000338556.3_Intron|SP110_ENST00000258381.6_Missense_Mutation_p.Q317K|SP110_ENST00000392048.3_Missense_Mutation_p.Q315K|SP110_ENST00000540870.1_Missense_Mutation_p.Q323K|SP110_ENST00000486146.2_5'Flank	NM_004509.3	NP_004500	Q9HB58	SP110_HUMAN	SP110 nuclear body protein	317					regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)|zinc ion binding (GO:0008270)			breast(4)|endometrium(3)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29		Renal(207;0.0112)|all_lung(227;0.0223)|Lung NSC(271;0.0983)|all_hematologic(139;0.104)|Acute lymphoblastic leukemia(138;0.169)		Epithelial(121;2.61e-12)|all cancers(144;6.39e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.0097)		TGAGGAACCTGATCCACCCTT	0.458																																																	0								ENSG00000135899						213.0	196.0	202.0					2																	231067394		2203	4300	6503	SP110	SO:0001583	missense	0			-	HGNC	L22343	CCDS2474.1, CCDS2475.1, CCDS2476.1, CCDS54435.1	2q37.1	2014-09-17	2001-12-19	2001-12-20	ENSG00000135899	ENSG00000135899			5401	protein-coding gene	gene with protein product		604457	"""interferon-induced protein 41, 30kD"""	IFI41, IFI75		7693701, 10388521	Standard	NM_080424		Approved		uc002vqg.3	Q9HB58	OTTHUMG00000133204	ENST00000358662.4:c.949C>A	2.37:g.231067394G>T	ENSP00000351488:p.Gln317Lys	Somatic	0	42	0.00		0.5558904216091591	21	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	13	18.75	B4DVI4|F5H1M1|Q14976|Q14977|Q53TG2|Q8WUZ6|Q9HCT8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Sp100,pfam_SAND_dom,superfamily_SAND_dom-like,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_SAND_dom,smart_Znf_PHD,smart_Bromodomain,pfscan_Znf_PHD-finger,pfscan_SAND_dom	p.Q317K	ENST00000358662.4	37	c.949	CCDS2474.1	2	.	.	.	.	.	.	.	.	.	.	G	5.211	0.224406	0.09863	.	.	ENSG00000135899	ENST00000258381;ENST00000358662;ENST00000392048;ENST00000258382;ENST00000540870	T;T;T;T;T	0.68765	0.91;0.8;-0.25;-0.35;-0.33	3.72	1.87	0.25490	.	.	.	.	.	T	0.47432	0.1445	L	0.32530	0.975	0.09310	N	0.999998	B;B;B;B	0.33612	0.419;0.419;0.077;0.079	B;B;B;B	0.26864	0.074;0.074;0.012;0.018	T	0.32079	-0.9920	9	0.40728	T	0.16	.	4.4921	0.11819	0.1172:0.0:0.6639:0.2189	.	315;323;317;317	G5E9C0;F5H1M1;Q9HB58;Q9HB58-6	.;.;SP110_HUMAN;.	K	317;317;315;317;323	ENSP00000258381:Q317K;ENSP00000351488:Q317K;ENSP00000375902:Q315K;ENSP00000258382:Q317K;ENSP00000439558:Q323K	ENSP00000258381:Q317K	Q	-	1	0	SP110	230775638	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	0.431000	0.21444	0.535000	0.28714	0.563000	0.77884	CAG	-	NULL		0.458	SP110-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	SP110	protein_coding	OTTHUMT00000332414.1	G	NM_080424	-		231067394	-1	no_errors	ENST00000258381	ensembl	human	known	74_37	missense	SNP	0.000	T
ARHGEF37	389337	genome.wustl.edu	37	5	149001563	149001564	+	Frame_Shift_Del	DEL	GT	GT	-			TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	GT	GT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr5:149001563_149001564delGT	ENST00000333677.6	+	9	1436_1437	c.1273_1274delGT	c.(1273-1275)gtgfs	p.V425fs		NM_001001669.2	NP_001001669.2	A1IGU5	ARH37_HUMAN	Rho guanine nucleotide exchange factor (GEF) 37	425	BAR. {ECO:0000255|PROSITE- ProRule:PRU00361}.					cytoplasm (GO:0005737)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			large_intestine(5)|lung(6)|ovary(1)|prostate(2)|stomach(3)	17						GTGCACATTCGTGACCCTCCAG	0.589																																																	0								ENSG00000183111																																			ARHGEF37	SO:0001589	frameshift_variant	0				HGNC	BC041325	CCDS43385.1	5q33.1	2012-07-24			ENSG00000183111	ENSG00000183111		"""Rho guanine nucleotide exchange factors"""	34430	protein-coding gene	gene with protein product							Standard	XM_005268448		Approved	FLJ41603	uc003lra.1	A1IGU5	OTTHUMG00000163491	ENST00000333677.6:c.1273_1274delGT	5.37:g.149001563_149001564delGT	ENSP00000328083:p.Val425fs	Somatic	0	19	0.00		0.5558904216091591	3	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	23	8.00	Q6ZW51	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_DH-domain,pfam_BAR_dom,pfam_SH3_2,pfam_SH3_domain,superfamily_DH-domain,superfamily_SH3_domain,smart_DH-domain,smart_BAR_dom,smart_SH3_domain,pfscan_BAR_dom,pfscan_SH3_domain,pfscan_DH-domain	p.V425fs	ENST00000333677.6	37	c.1273_1274	CCDS43385.1	5																																																																																			-	pfam_BAR_dom,smart_BAR_dom,pfscan_BAR_dom		0.589	ARHGEF37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGEF37	protein_coding	OTTHUMT00000373763.1	GT	NM_001001669			149001564	+1	no_errors	ENST00000333677	ensembl	human	known	74_37	frame_shift_del	DEL	0.979:1.000	-
NCOR2	9612	genome.wustl.edu	37	12	124911219	124911219	+	Missense_Mutation	SNP	C	C	T			TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr12:124911219C>T	ENST00000405201.1	-	11	1277	c.1277G>A	c.(1276-1278)cGc>cAc	p.R426H	NCOR2_ENST00000356219.3_Missense_Mutation_p.R426H|NCOR2_ENST00000404121.2_5'UTR|NCOR2_ENST00000397355.1_Missense_Mutation_p.R426H|NCOR2_ENST00000404621.1_Missense_Mutation_p.R425H|NCOR2_ENST00000429285.2_Missense_Mutation_p.R425H			Q9Y618	NCOR2_HUMAN	nuclear receptor corepressor 2	426					cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|regulation of cellular ketone metabolic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072365)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|Notch binding (GO:0005112)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(7)|lung(28)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		CATGACCTGGCGGTCTTTGTA	0.607																																																	0								ENSG00000196498						89.0	96.0	94.0					12																	124911219		2088	4209	6297	NCOR2	SO:0001583	missense	0			-	HGNC	U37146	CCDS41857.1, CCDS41858.1, CCDS41857.2, CCDS41858.2, CCDS55892.1	12q24	2010-06-10	2010-06-10		ENSG00000196498	ENSG00000196498			7673	protein-coding gene	gene with protein product		600848	"""nuclear receptor co-repressor 2"""			7566127, 8813722	Standard	NM_001077261		Approved	SMRT, SMRTE, TRAC-1, CTG26, TNRC14	uc010tbb.2	Q9Y618	OTTHUMG00000150455	ENST00000405201.1:c.1277G>A	12.37:g.124911219C>T	ENSP00000384018:p.Arg426His	Somatic	0	26	0.00		0.5558904216091591	152	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	29	12.12	O00613|O15416|O15421|Q13354|Q56D06|Q59GM0|Q9Y5U0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SANT/Myb,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.R426H	ENST00000405201.1	37	c.1277	CCDS41858.2	12	.	.	.	.	.	.	.	.	.	.	c	17.64	3.439013	0.63067	.	.	ENSG00000196498	ENST00000405201;ENST00000404621;ENST00000356219;ENST00000397355;ENST00000447011;ENST00000429285;ENST00000458234;ENST00000420698	D;D;D;D;D;D;D	0.83163	-1.69;-1.69;-1.69;-1.69;-1.69;-1.69;-1.69	5.07	5.07	0.68467	.	0.129222	0.52532	D	0.000072	D	0.89901	0.6849	L	0.58925	1.835	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.996;0.996;0.998	D	0.90778	0.4677	10	0.87932	D	0	-36.8489	18.8326	0.92145	0.0:1.0:0.0:0.0	.	425;426;426	C9J0Q5;C9J239;C9JFD3	.;.;.	H	426;425;426;426;426;425;426;426	ENSP00000384018:R426H;ENSP00000384202:R425H;ENSP00000348551:R426H;ENSP00000380513:R426H;ENSP00000400281:R425H;ENSP00000402808:R426H;ENSP00000405367:R426H	ENSP00000348551:R426H	R	-	2	0	NCOR2	123477172	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	7.795000	0.85887	2.533000	0.85409	0.556000	0.70494	CGC	-	superfamily_Homeodomain-like		0.607	NCOR2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	NCOR2	protein_coding	OTTHUMT00000318173.2	C	NM_006312	-		124911219	-1	no_errors	ENST00000356219	ensembl	human	known	74_37	missense	SNP	1.000	T
SEC24D	9871	genome.wustl.edu	37	4	119666217	119666218	+	Splice_Site	INS	-	-	A	rs78494615|rs35951660		TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr4:119666217_119666218insA	ENST00000280551.6	-	14	1946		c.e14-2		SEC24D_ENST00000505134.1_Splice_Site|SEC24D_ENST00000419654.2_Splice_Site|SEC24D_ENST00000511481.1_Splice_Site|SEC24D_ENST00000429811.2_Splice_Site|SEC24D_ENST00000379735.5_Splice_Site			O94855	SC24D_HUMAN	SEC24 family member D						antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|in utero embryonic development (GO:0001701)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)	zinc ion binding (GO:0008270)			breast(3)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(13)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	37						GTCTGCTGCCTAAAAAAAAAAA	0.381																																																	0								ENSG00000150961																																			SEC24D	SO:0001630	splice_region_variant	0				HGNC	AB018298	CCDS3710.1	4q26	2013-10-21	2013-10-21		ENSG00000150961	ENSG00000150961			10706	protein-coding gene	gene with protein product		607186	"""SEC24 (S. cerevisiae) related gene family, member D"", ""SEC24 family, member D (S. cerevisiae)"""			9872452, 10075675	Standard	NM_014822		Approved	KIAA0755	uc003ici.4	O94855	OTTHUMG00000132957	ENST00000280551.6:c.1708-2->T	4.37:g.119666228_119666228dupA		Somatic	0	11	0.00		0.5558904216091591	4	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	10	16.67	Q8IYI7	Splice_Site	INS	NA	NA	NA	NA	NA	NA	-	e13-2	ENST00000280551.6	37	c.1711-3_1711-2	CCDS3710.1	4																																																																																			-	-		0.381	SEC24D-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SEC24D	protein_coding	OTTHUMT00000256514.4	-			Intron	119666218	-1	no_errors	ENST00000379735	ensembl	human	known	74_37	splice_site_ins	INS	1.000:0.975	A
OR10G9	219870	genome.wustl.edu	37	11	123893856	123893856	+	Missense_Mutation	SNP	T	T	C			TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr11:123893856T>C	ENST00000375024.1	+	1	137	c.137T>C	c.(136-138)gTg>gCg	p.V46A		NM_001001953.1	NP_001001953.1	Q8NGN4	O10G9_HUMAN	olfactory receptor, family 10, subfamily G, member 9	46						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(33)|prostate(2)|skin(4)|stomach(8)|urinary_tract(1)	61		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)		ATCCTGCTGGTGATCAGGGTG	0.567																																																	0								ENSG00000236981						87.0	80.0	82.0					11																	123893856		2201	4295	6496	OR10G9	SO:0001583	missense	0			-	HGNC	AB065756	CCDS31703.1	11q24.1	2012-08-09			ENSG00000236981	ENSG00000236981		"""GPCR / Class A : Olfactory receptors"""	15129	protein-coding gene	gene with protein product				OR10G10P			Standard	NM_001001953		Approved		uc010sad.2	Q8NGN4	OTTHUMG00000165967	ENST00000375024.1:c.137T>C	11.37:g.123893856T>C	ENSP00000364164:p.Val46Ala	Somatic	0	76	0.00		0.5558904216091591	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	41	27	60.29		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.V46A	ENST00000375024.1	37	c.137	CCDS31703.1	11	.	.	.	.	.	.	.	.	.	.	T	5.004	0.186447	0.09495	.	.	ENSG00000236981	ENST00000375024	T	0.01126	5.3	3.33	3.33	0.38152	GPCR, rhodopsin-like superfamily (1);	0.000000	0.44285	D	0.000479	T	0.00754	0.0025	N	0.05487	-0.04	0.09310	N	1	B	0.09022	0.002	B	0.18263	0.021	T	0.49428	-0.8941	10	0.33940	T	0.23	.	6.0061	0.19547	0.0:0.1762:0.0:0.8238	.	46	Q8NGN4	O10G9_HUMAN	A	46	ENSP00000364164:V46A	ENSP00000364164:V46A	V	+	2	0	OR10G9	123399066	0.001000	0.12720	0.995000	0.50966	0.988000	0.76386	0.932000	0.28884	1.512000	0.48834	0.533000	0.62120	GTG	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.567	OR10G9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10G9	protein_coding	OTTHUMT00000387269.1	T	NM_001001953	-		123893856	+1	no_errors	ENST00000375024	ensembl	human	known	74_37	missense	SNP	0.038	C
SLC22A31	146429	genome.wustl.edu	37	16	89265864	89265864	+	Silent	SNP	G	G	A			TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr16:89265864G>A	ENST00000562855.2	-	4	569	c.570C>T	c.(568-570)caC>caT	p.H190H				A6NKX4	S22AV_HUMAN	solute carrier family 22, member 31	190					ion transport (GO:0006811)	integral component of membrane (GO:0016021)	transmembrane transporter activity (GO:0022857)										ATGTGCCCCCGTGGAGTAGGC	0.697																																																	0								ENSG00000259803																																			SLC22A31	SO:0001819	synonymous_variant	0			-	HGNC		CCDS73927.1	16q24.3	2014-02-12	2011-07-12		ENSG00000259803	ENSG00000259803		"""Solute carriers"""	27091	protein-coding gene	gene with protein product							Standard	NM_001242757		Approved		uc021tmr.1	A6NKX4	OTTHUMG00000175615	ENST00000562855.2:c.570C>T	16.37:g.89265864G>A		Somatic	0	111	0.00		0.5558904216091591	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	57	18.57		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.H190	ENST00000562855.2	37	c.570		16																																																																																			-	pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom		0.697	SLC22A31-006	NOVEL	basic|appris_principal	protein_coding	SLC22A31	protein_coding	OTTHUMT00000469767.1	G	NM_001242757	-		89265864	-1	no_errors	ENST00000562855	ensembl	human	novel	74_37	silent	SNP	0.000	A
APBB2	323	genome.wustl.edu	37	4	40818138	40818138	+	Nonsense_Mutation	SNP	G	G	A			TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr4:40818138G>A	ENST00000295974.8	-	18	2877	c.2248C>T	c.(2248-2250)Cag>Tag	p.Q750*	APBB2_ENST00000508593.1_Nonsense_Mutation_p.Q751*|RP11-632F7.3_ENST00000513127.1_RNA|APBB2_ENST00000506352.1_Nonsense_Mutation_p.Q729*|APBB2_ENST00000543538.1_Nonsense_Mutation_p.Q202*|APBB2_ENST00000502841.1_Nonsense_Mutation_p.Q202*|APBB2_ENST00000504305.1_Nonsense_Mutation_p.Q202*|APBB2_ENST00000513140.1_Nonsense_Mutation_p.Q728*	NM_001166050.1|NM_004307.1	NP_001159522.1|NP_004298.1	Q92870	APBB2_HUMAN	amyloid beta (A4) precursor protein-binding, family B, member 2	750					axon guidance (GO:0007411)|cell cycle arrest (GO:0007050)|extracellular matrix organization (GO:0030198)|intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|neuron migration (GO:0001764)|positive regulation of apoptotic process (GO:0043065)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|membrane (GO:0016020)|nucleus (GO:0005634)|synapse (GO:0045202)	beta-amyloid binding (GO:0001540)|transcription factor binding (GO:0008134)			central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(5)|lung(16)|ovary(3)|skin(2)|urinary_tract(1)	34						GGGCGTTTCTGTTTCAAAGTG	0.463																																					Ovarian(3;20 75 16686 49997)												0								ENSG00000163697						264.0	258.0	260.0					4																	40818138		1970	4151	6121	APBB2	SO:0001587	stop_gained	0			-	HGNC	U62325	CCDS43224.1, CCDS54760.1, CCDS54761.1, CCDS54762.1	4p13	2011-10-10	2008-07-31		ENSG00000163697	ENSG00000163697			582	protein-coding gene	gene with protein product	"""Fe65-like"""	602710				8955346, 9585438	Standard	NM_173075		Approved	FE65L, FE65L1, MGC35575	uc003gvn.3	Q92870	OTTHUMG00000160416	ENST00000295974.8:c.2248C>T	4.37:g.40818138G>A	ENSP00000295974:p.Gln750*	Somatic	0	53	0.00		0.5558904216091591	57	38.71	36	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	35	42.62	B4DSL4|E9PG87|Q8IUI6	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PTB/PI_dom,pfam_WW_dom,superfamily_WW_dom,smart_WW_dom,smart_PTB/PI_dom,pfscan_PTB/PI_dom,pfscan_WW_dom	p.Q750*	ENST00000295974.8	37	c.2248	CCDS54761.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	43|43	9.931005|9.931005	0.99298|0.99298	.|.	.|.	ENSG00000163697|ENSG00000163697	ENST00000295974;ENST00000316212;ENST00000543538;ENST00000513140;ENST00000508593;ENST00000502841;ENST00000506352;ENST00000504305|ENST00000513611	.|.	.|.	.|.	5.53|5.53	5.53|5.53	0.82687|0.82687	.|.	0.054103|.	0.85682|.	D|.	0.000000|.	.|T	.|0.75459	.|0.3852	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.73500	.|-0.3963	.|4	0.02654|.	T|.	1|.	-17.704|-17.704	19.4755|19.4755	0.94985|0.94985	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	X|I	750;749;202;728;751;202;729;202|719	.|.	ENSP00000295974:Q750X|.	Q|T	-|-	1|2	0|0	APBB2|APBB2	40512895|40512895	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.984000|0.984000	0.73092|0.73092	7.787000|7.787000	0.85759|0.85759	2.605000|2.605000	0.88082|0.88082	0.650000|0.650000	0.86243|0.86243	CAG|ACA	-	NULL		0.463	APBB2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	APBB2	protein_coding	OTTHUMT00000360523.3	G	NM_173075	-		40818138	-1	no_errors	ENST00000295974	ensembl	human	known	74_37	nonsense	SNP	1.000	A
SURF1	6834	genome.wustl.edu	37	9	136221533	136221533	+	Missense_Mutation	SNP	G	G	T			TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr9:136221533G>T	ENST00000371974.3	-	4	335	c.304C>A	c.(304-306)Cct>Act	p.P102T	SURF2_ENST00000371964.4_5'Flank|SURF1_ENST00000495952.1_5'Flank	NM_001280787.1|NM_003172.2	NP_001267716.1|NP_003163.1	Q15526	SURF1_HUMAN	surfeit 1	102					aerobic respiration (GO:0009060)|ATP biosynthetic process (GO:0006754)|oxidation-reduction process (GO:0055114)|oxidative phosphorylation (GO:0006119)|respiratory chain complex IV assembly (GO:0008535)	integral component of membrane (GO:0016021)|mitochondrial respiratory chain (GO:0005746)	cytochrome-c oxidase activity (GO:0004129)			breast(2)|endometrium(1)|ovary(2)|stomach(1)	6				OV - Ovarian serous cystadenocarcinoma(145;5.06e-07)|Epithelial(140;4.25e-06)|all cancers(34;3.93e-05)		AGAGGGACAGGCTCAGCCAGA	0.587																																																	0								ENSG00000148290						131.0	134.0	133.0					9																	136221533		2203	4300	6503	SURF1	SO:0001583	missense	0			-	HGNC		CCDS6966.1, CCDS75928.1	9q33-q34	2012-10-12			ENSG00000148290	ENSG00000148290		"""Mitochondrial respiratory chain complex assembly factors"""	11474	protein-coding gene	gene with protein product	"""surfeit locus protein 1"""	185620				8499913, 9843204	Standard	NM_003172		Approved		uc004cdh.1	Q15526	OTTHUMG00000020866	ENST00000371974.3:c.304C>A	9.37:g.136221533G>T	ENSP00000361042:p.Pro102Thr	Somatic	0	36	0.00		0.5558904216091591	133	0.75	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	34	10.53	Q5T8T3|Q5T8T4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Surf1/Shy1,pfscan_Surf1/Shy1	p.P102T	ENST00000371974.3	37	c.304	CCDS6966.1	9	.	.	.	.	.	.	.	.	.	.	G	18.68	3.676828	0.67928	.	.	ENSG00000148290	ENST00000371974;ENST00000437995	D	0.95137	-3.62	5.01	5.01	0.66863	.	0.000000	0.85682	D	0.000000	D	0.98295	0.9435	H	0.96576	3.845	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.99818	1.1045	10	0.87932	D	0	-20.6655	17.3282	0.87255	0.0:0.0:1.0:0.0	.	102	Q15526	SURF1_HUMAN	T	102;84	ENSP00000361042:P102T	ENSP00000361042:P102T	P	-	1	0	SURF1	135211354	1.000000	0.71417	1.000000	0.80357	0.539000	0.34962	9.031000	0.93731	2.310000	0.77875	0.563000	0.77884	CCT	-	pfam_Surf1/Shy1,pfscan_Surf1/Shy1		0.587	SURF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SURF1	protein_coding	OTTHUMT00000054879.1	G	NM_003172	-		136221533	-1	no_errors	ENST00000371974	ensembl	human	known	74_37	missense	SNP	1.000	T
GPR83	10888	genome.wustl.edu	37	11	94113534	94113534	+	Missense_Mutation	SNP	G	G	C			TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr11:94113534G>C	ENST00000243673.2	-	4	1224	c.1053C>G	c.(1051-1053)aaC>aaG	p.N351K	GPR83_ENST00000539203.2_Missense_Mutation_p.N309K	NM_016540.3	NP_057624.3	Q9NYM4	GPR83_HUMAN	G protein-coupled receptor 83	351					response to glucocorticoid (GO:0051384)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide Y receptor activity (GO:0004983)			NS(1)|breast(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)	19		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				CAATCCTGAAGTTCTCGTTCA	0.532																																																	0								ENSG00000123901						163.0	142.0	149.0					11																	94113534		2201	4298	6499	GPR83	SO:0001583	missense	0			-	HGNC	AF236081	CCDS8297.1	11q21	2012-08-21	2003-07-30	2003-08-01	ENSG00000123901	ENSG00000123901		"""GPCR / Class A : Orphans"""	4523	protein-coding gene	gene with protein product		605569	"""G protein-coupled receptor 72"""	GPR72		10760605, 11060465	Standard	NM_016540		Approved		uc001pet.2	Q9NYM4	OTTHUMG00000167779	ENST00000243673.2:c.1053C>G	11.37:g.94113534G>C	ENSP00000243673:p.Asn351Lys	Somatic	0	15	0.00		0.5558904216091591	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	2	89.47	B0M0K5|Q6NWR4|Q9P1Y8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_NPY_rcpt	p.N351K	ENST00000243673.2	37	c.1053	CCDS8297.1	11	.	.	.	.	.	.	.	.	.	.	G	12.33	1.906494	0.33628	.	.	ENSG00000123901	ENST00000243673;ENST00000539203	T;T	0.54071	0.59;0.59	5.75	1.78	0.24846	.	0.277603	0.45361	D	0.000374	T	0.38532	0.1044	L	0.42245	1.32	0.44247	D	0.997097	P	0.38020	0.615	B	0.33454	0.164	T	0.08597	-1.0714	10	0.22706	T	0.39	.	11.1818	0.48633	0.3363:0.0:0.6637:0.0	.	351	Q9NYM4	GPR83_HUMAN	K	351;309	ENSP00000243673:N351K;ENSP00000441550:N309K	ENSP00000243673:N351K	N	-	3	2	GPR83	93753182	1.000000	0.71417	0.997000	0.53966	0.282000	0.26991	0.767000	0.26575	0.100000	0.17581	-0.797000	0.03246	AAC	-	pfam_7TM_GPCR_olfarory/Srsx,prints_GPCR_Rhodpsn,prints_NPY_rcpt		0.532	GPR83-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR83	protein_coding	OTTHUMT00000396232.1	G	NM_016540	-		94113534	-1	no_errors	ENST00000243673	ensembl	human	known	74_37	missense	SNP	0.999	C
SPRED3	399473	genome.wustl.edu	37	19	38886200	38886200	+	Silent	SNP	C	C	A			TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr19:38886200C>A	ENST00000338502.4	+	5	751	c.648C>A	c.(646-648)ggC>ggA	p.G216G	SPRED3_ENST00000587013.1_Silent_p.G260G|SPRED3_ENST00000586301.1_Silent_p.G216G|AC005789.11_ENST00000588453.1_lincRNA	NM_001042522.2	NP_001035987.1	Q2MJR0	SPRE3_HUMAN	sprouty-related, EVH1 domain containing 3	216	KBD. {ECO:0000255|PROSITE- ProRule:PRU00821}.				inactivation of MAPK activity (GO:0000188)|multicellular organismal development (GO:0007275)	plasma membrane (GO:0005886)				central_nervous_system(2)|large_intestine(1)|lung(5)|skin(1)	9	all_cancers(60;3.4e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			TGGGGTGGGGCGGCCGCGGCT	0.716																																																	0								ENSG00000188766						6.0	6.0	6.0					19																	38886200		1736	3911	5647	SPRED3	SO:0001819	synonymous_variant	0			-	HGNC		CCDS42560.1	19q13	2007-10-05				ENSG00000188766			31041	protein-coding gene	gene with protein product		609293				14618415	Standard	NM_001042522		Approved		uc002oim.4	Q2MJR0		ENST00000338502.4:c.648C>A	19.37:g.38886200C>A		Somatic	0	29	0.00		0.5558904216091591	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	5	58.33	Q2MJR1	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Sprouty,pfam_WH1/EVH1,smart_WH1/EVH1,pfscan_WH1/EVH1	p.G216	ENST00000338502.4	37	c.648	CCDS42560.1	19																																																																																			-	NULL		0.716	SPRED3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPRED3	protein_coding	OTTHUMT00000459216.1	C	XM_351191	-		38886200	+1	no_errors	ENST00000338502	ensembl	human	known	74_37	silent	SNP	0.992	A
BAG5	9529	genome.wustl.edu	37	14	104027121	104027121	+	Silent	SNP	G	G	T			TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr14:104027121G>T	ENST00000445922.2	-	2	627	c.381C>A	c.(379-381)atC>atA	p.I127I	RP11-894P9.2_ENST00000556332.1_RNA|APOPT1_ENST00000409074.2_5'Flank|BAG5_ENST00000299204.4_Silent_p.I127I|BAG5_ENST00000337322.4_Silent_p.I168I|RP11-73M18.2_ENST00000472726.2_5'Flank|APOPT1_ENST00000247618.4_5'Flank|APOPT1_ENST00000556253.2_5'Flank	NM_004873.3	NP_004864.1	Q9UL15	BAG5_HUMAN	BCL2-associated athanogene 5	127	BAG 2. {ECO:0000255|PROSITE- ProRule:PRU00369}.				negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|negative regulation of protein refolding (GO:0061084)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of ubiquitin-protein transferase activity (GO:0051444)|neuron death (GO:0070997)|protein folding (GO:0006457)|regulation of inclusion body assembly (GO:0090083)	inclusion body (GO:0016234)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	chaperone binding (GO:0051087)|protein kinase binding (GO:0019901)|ubiquitin protein ligase binding (GO:0031625)			endometrium(5)|large_intestine(4)|lung(7)|ovary(2)|prostate(2)|skin(2)|urinary_tract(2)	24		Melanoma(154;0.155)	Epithelial(46;0.144)			TGATATCTTGGATGCCTTCTT	0.423																																					NSCLC(171;1832 2055 18950 31566 41632)												0								ENSG00000166170						125.0	122.0	123.0					14																	104027121		2203	4300	6503	BAG5	SO:0001819	synonymous_variant	0			-	HGNC	AF095195	CCDS9982.1, CCDS41995.1	14q32	2008-08-01				ENSG00000166170			941	protein-coding gene	gene with protein product		603885				9873016, 15603737	Standard	NM_001015048		Approved		uc001ynh.2	Q9UL15		ENST00000445922.2:c.381C>A	14.37:g.104027121G>T		Somatic	0	51	0.00		0.5558904216091591	50	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	35	10.26	O94950|Q86W59	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_BAG_domain,smart_BAG_domain,pfscan_BAG_domain	p.I168	ENST00000445922.2	37	c.504	CCDS9982.1	14																																																																																			-	NULL		0.423	BAG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAG5	protein_coding	OTTHUMT00000414990.1	G		-		104027121	-1	no_errors	ENST00000337322	ensembl	human	known	74_37	silent	SNP	0.998	T
WRNIP1	56897	genome.wustl.edu	37	6	2770552	2770552	+	Missense_Mutation	SNP	C	C	T			TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr6:2770552C>T	ENST00000380773.4	+	3	1422	c.1213C>T	c.(1213-1215)Cgt>Tgt	p.R405C	WRNIP1_ENST00000380771.4_Missense_Mutation_p.R380C|WRNIP1_ENST00000380764.1_Missense_Mutation_p.R21C|WRNIP1_ENST00000380769.4_Missense_Mutation_p.R185C	NM_020135.2	NP_064520.2			Werner helicase interacting protein 1									p.R405S(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(2)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	14	Ovarian(93;0.0412)	all_hematologic(90;0.0895)				AGACTCTAGCCGTCCCACTGA	0.547																																																	1	Substitution - Missense(1)	lung(1)						ENSG00000124535						81.0	76.0	77.0					6																	2770552		2203	4300	6503	WRNIP1	SO:0001583	missense	0			-	HGNC	AB056152	CCDS4475.1, CCDS4476.1	6p25.2	2010-04-21			ENSG00000124535	ENSG00000124535		"""ATPases / AAA-type"""	20876	protein-coding gene	gene with protein product		608196				11301316	Standard	NM_020135		Approved	WHIP, FLJ22526, bA420G6.2	uc003mtz.3	Q96S55	OTTHUMG00000014126	ENST00000380773.4:c.1213C>T	6.37:g.2770552C>T	ENSP00000370150:p.Arg405Cys	Somatic	0	63	0.00		0.5558904216091591	135	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	35	10.26		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MgsA_C,pfam_ATPase_AAA_core,pfam_DNA_helicase_Holl-junc_RuvB_N,pfam_ATPase_dyneun-rel_AAA,pfam_DUF815,pfam_IstB_ATP-bd,pfam_ATPase_AAA-2,superfamily_P-loop_NTPase,smart_Znf_Rad18_put,smart_AAA+_ATPase	p.R405C	ENST00000380773.4	37	c.1213	CCDS4475.1	6	.	.	.	.	.	.	.	.	.	.	C	15.86	2.957836	0.53400	.	.	ENSG00000124535	ENST00000380773;ENST00000380771;ENST00000380769;ENST00000380764	T;T;T	0.50001	0.76;0.81;0.81	5.79	3.88	0.44766	.	0.622335	0.17681	N	0.165626	T	0.26593	0.0650	L	0.46157	1.445	0.40048	D	0.975733	B;B	0.23058	0.079;0.018	B;B	0.16289	0.015;0.007	T	0.24368	-1.0162	10	0.66056	D	0.02	-34.9001	10.8255	0.46629	0.15:0.7189:0.1311:0.0	.	380;405	Q96S55-2;Q96S55	.;WRIP1_HUMAN	C	405;380;185;21	ENSP00000370150:R405C;ENSP00000370148:R380C;ENSP00000370146:R185C	ENSP00000370141:R21C	R	+	1	0	WRNIP1	2715551	0.991000	0.36638	0.997000	0.53966	0.997000	0.91878	2.082000	0.41605	2.731000	0.93534	0.650000	0.86243	CGT	-	superfamily_P-loop_NTPase		0.547	WRNIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WRNIP1	protein_coding	OTTHUMT00000039641.1	C	NM_130395	-		2770552	+1	no_errors	ENST00000380773	ensembl	human	known	74_37	missense	SNP	0.912	T
NUGGC	389643	genome.wustl.edu	37	8	27927170	27927170	+	Splice_Site	SNP	C	C	A			TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr8:27927170C>A	ENST00000413272.2	-	4	291		c.e4-1		NUGGC_ENST00000341513.6_Splice_Site	NM_001010906.1	NP_001010906.1	Q68CJ6	SLIP_HUMAN	nuclear GTPase, germinal center associated						cellular response to DNA damage stimulus (GO:0006974)|somatic hypermutation of immunoglobulin genes (GO:0016446)	nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)										AATTTTTCATCTGGAATTAAC	0.438																																																	0								ENSG00000189233						106.0	102.0	103.0					8																	27927170		1859	4111	5970	NUGGC	SO:0001630	splice_region_variant	0			-	HGNC	AB075870	CCDS47833.1	8p21.1	2012-06-07	2012-06-07	2012-06-07	ENSG00000189233	ENSG00000189233			33550	protein-coding gene	gene with protein product	"""speckled-like pattern in the germinal center"""		"""chromosome 8 open reading frame 80"""	C8orf80		19734146	Standard	NM_001010906		Approved	HMFN0672, SLIP-GC	uc003xgm.4	Q68CJ6	OTTHUMG00000155970	ENST00000413272.2:c.149-1G>T	8.37:g.27927170C>A		Somatic	0	32	0.00		0.5558904216091591	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	22	12.00	Q6ZP73	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e3-1	ENST00000413272.2	37	c.149-1	CCDS47833.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.72|11.72	1.721576|1.721576	0.30503|0.30503	.|.	.|.	ENSG00000189233|ENSG00000189233	ENST00000413272;ENST00000341513|ENST00000418860	.|T	.|0.55760	.|0.5	5.34|5.34	5.34|5.34	0.76211|0.76211	.|.	.|.	.|.	.|.	.|.	.|T	.|0.67702	.|0.2921	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.70777	.|-0.4780	.|6	.|0.87932	.|D	.|0	.|.	14.8985|14.8985	0.70661|0.70661	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	.|Y	-1|74	.|ENSP00000388515:D74Y	.|ENSP00000388515:D74Y	.|D	-|-	.|1	.|0	C8orf80|C8orf80	27983089|27983089	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.213000|0.213000	0.24496|0.24496	4.037000|4.037000	0.57311|0.57311	2.654000|2.654000	0.90174|0.90174	0.650000|0.650000	0.86243|0.86243	.|GAT	-	-		0.438	NUGGC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NUGGC	protein_coding	OTTHUMT00000342494.1	C	NM_001010906	-	Intron	27927170	-1	no_errors	ENST00000341513	ensembl	human	known	74_37	splice_site	SNP	1.000	A
LOR	4014	genome.wustl.edu	37	1	153234265	153234265	+	Silent	SNP	C	C	T			TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr1:153234265C>T	ENST00000368742.3	+	2	897	c.840C>T	c.(838-840)ggC>ggT	p.G280G		NM_000427.2	NP_000418.2	P23490	LORI_HUMAN	loricrin	280					keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein binding, bridging (GO:0030674)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			lung(2)	2	all_lung(78;3.35e-32)|Lung NSC(65;1.22e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			CTGGAGGCGGCGGCGGCGGCT	0.716																																																	0								ENSG00000203782						5.0	7.0	6.0					1																	153234265		1332	3138	4470	LOR	SO:0001819	synonymous_variant	0			-	HGNC	M61120	CCDS30870.1	1q21	2008-02-05			ENSG00000203782	ENSG00000203782			6663	protein-coding gene	gene with protein product		152445				2007607, 1355480	Standard	NM_000427		Approved		uc001fbm.3	P23490	OTTHUMG00000013938	ENST00000368742.3:c.840C>T	1.37:g.153234265C>T		Somatic	0	25	0.00		0.5558904216091591	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	16	45.16	Q5T869|Q5XKF8	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.G280	ENST00000368742.3	37	c.840	CCDS30870.1	1	.	.	.	.	.	.	.	.	.	.	C	0.499	-0.871780	0.02570	.	.	ENSG00000203782	ENST00000392652	.	.	.	3.68	1.69	0.24217	.	.	.	.	.	T	0.21227	0.0511	.	.	.	0.26840	N	0.96839	.	.	.	.	.	.	T	0.23868	-1.0176	5	0.87932	D	0	-3.1075	4.9757	0.14138	0.0:0.6614:0.215:0.1236	.	.	.	.	W	280	.	ENSP00000376422:R280W	R	+	1	2	LOR	151500889	1.000000	0.71417	0.036000	0.18154	0.179000	0.23085	1.734000	0.38166	0.199000	0.20427	0.563000	0.77884	CGG	-	NULL		0.716	LOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOR	protein_coding	OTTHUMT00000039107.1	C	NM_000427	-		153234265	+1	no_errors	ENST00000368742	ensembl	human	known	74_37	silent	SNP	0.088	T
NMUR2	56923	genome.wustl.edu	37	5	151784153	151784153	+	Silent	SNP	G	G	T			TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr5:151784153G>T	ENST00000255262.3	-	1	687	c.522C>A	c.(520-522)tcC>tcA	p.S174S	NMUR2_ENST00000518933.1_Intron	NM_020167.4	NP_064552.3	Q9GZQ4	NMUR2_HUMAN	neuromedin U receptor 2	174					activation of phospholipase A2 activity by calcium-mediated signaling (GO:0043006)|arachidonic acid secretion (GO:0050482)|calcium ion transport (GO:0006816)|calcium-mediated signaling (GO:0019722)|cell-cell signaling (GO:0007267)|central nervous system development (GO:0007417)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|feeding behavior (GO:0007631)|grooming behavior (GO:0007625)|inositol phosphate-mediated signaling (GO:0048016)|neuropeptide signaling pathway (GO:0007218)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|reduction of food intake in response to dietary excess (GO:0002023)|regulation of smooth muscle contraction (GO:0006940)|response to pain (GO:0048265)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|GTP binding (GO:0005525)|intracellular calcium activated chloride channel activity (GO:0005229)|neuromedin U binding (GO:0042924)|neuromedin U receptor activity (GO:0001607)	p.S174S(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(12)|liver(1)|lung(15)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	44		Medulloblastoma(196;0.091)|all_hematologic(541;0.103)	Kidney(363;0.000106)|KIRC - Kidney renal clear cell carcinoma(527;0.000672)			AGAAGAGCACGGAGAAGCCCC	0.637																																																	1	Substitution - coding silent(1)	lung(1)						ENSG00000132911						77.0	82.0	80.0					5																	151784153		2203	4300	6503	NMUR2	SO:0001819	synonymous_variant	0			-	HGNC	AF242874	CCDS4321.1	5q33.1	2012-08-08		2004-05-28	ENSG00000132911	ENSG00000132911		"""GPCR / Class A : Neuromedin U receptors"""	16454	protein-coding gene	gene with protein product		605108		NMU2R		8940772, 10894543	Standard	NM_020167		Approved		uc003luv.2	Q9GZQ4	OTTHUMG00000130131	ENST00000255262.3:c.522C>A	5.37:g.151784153G>T		Somatic	0	49	0.00		0.5558904216091591	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	33	10.81	Q7LC54|Q96AM5|Q9NRA6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_NeuromedU_rcpt_2,prints_NeuromedU_rcpt,prints_GPCR_Rhodpsn	p.S174	ENST00000255262.3	37	c.522	CCDS4321.1	5																																																																																			-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.637	NMUR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NMUR2	protein_coding	OTTHUMT00000252439.1	G	NM_020167	-		151784153	-1	no_errors	ENST00000255262	ensembl	human	known	74_37	silent	SNP	0.000	T
SALL3	27164	genome.wustl.edu	37	18	76753242	76753242	+	Missense_Mutation	SNP	C	C	A	rs200930481		TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr18:76753242C>A	ENST00000537592.2	+	2	1251	c.1251C>A	c.(1249-1251)ttC>ttA	p.F417L	SALL3_ENST00000575389.2_Missense_Mutation_p.F417L|SALL3_ENST00000536229.3_Missense_Mutation_p.F284L	NM_171999.3	NP_741996.2	Q9BXA9	SALL3_HUMAN	spalt-like transcription factor 3	417					forelimb morphogenesis (GO:0035136)|hindlimb morphogenesis (GO:0035137)|negative regulation of smoothened signaling pathway (GO:0045879)|olfactory bulb interneuron development (GO:0021891)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(40)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)|Melanoma(33;0.16)|Prostate(75;0.167)		OV - Ovarian serous cystadenocarcinoma(15;4.69e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0256)		AGGACCCGTTCTTCAAGCACA	0.647																																																	0								ENSG00000256463						27.0	20.0	22.0					18																	76753242		2202	4294	6496	SALL3	SO:0001583	missense	0			-	HGNC	AJ007421	CCDS12013.1	18q23	2013-10-17	2013-10-17		ENSG00000256463	ENSG00000256463		"""Zinc fingers, C2H2-type"""	10527	protein-coding gene	gene with protein product		605079	"""sal (Drosophila)-like 3"", ""sal-like 3 (Drosophila)"""			10610715	Standard	NM_171999		Approved	ZNF796	uc002lmt.3	Q9BXA9	OTTHUMG00000132896	ENST00000537592.2:c.1251C>A	18.37:g.76753242C>A	ENSP00000441823:p.Phe417Leu	Somatic	0	27	0.00		0.5558904216091591	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	8	27.27	Q9UGH1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.F417L	ENST00000537592.2	37	c.1251	CCDS12013.1	18	.	.	.	.	.	.	.	.	.	.	C	9.223	1.033978	0.19590	.	.	ENSG00000256463	ENST00000537592;ENST00000536229;ENST00000543056	T	0.09723	2.95	4.54	1.5	0.22942	.	0.000000	0.64402	D	0.000018	T	0.11153	0.0272	L	0.42245	1.32	0.54753	D	0.99998	P;B	0.40794	0.729;0.039	B;B	0.43225	0.412;0.082	T	0.07908	-1.0748	10	0.44086	T	0.13	-36.0439	9.2624	0.37621	0.0:0.6537:0.0:0.3463	.	149;417	F5GXY4;Q9BXA9	.;SALL3_HUMAN	L	417;417;149	ENSP00000441823:F417L	ENSP00000299466:F417L	F	+	3	2	SALL3	74854230	1.000000	0.71417	0.995000	0.50966	0.937000	0.57800	1.252000	0.32874	0.188000	0.20168	-1.628000	0.00784	TTC	-	NULL		0.647	SALL3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SALL3	protein_coding	OTTHUMT00000256397.1	C	NM_171999	-		76753242	+1	no_errors	ENST00000537592	ensembl	human	known	74_37	missense	SNP	1.000	A
FOXN3	1112	genome.wustl.edu	37	14	89628792	89628792	+	Missense_Mutation	SNP	C	C	T			TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr14:89628792C>T	ENST00000345097.4	-	7	1555	c.1439G>A	c.(1438-1440)gGg>gAg	p.G480E	FOXN3_ENST00000555353.1_Missense_Mutation_p.G458E|FOXN3_ENST00000557258.1_Missense_Mutation_p.G458E|FOXN3_ENST00000261302.5_Missense_Mutation_p.G480E	NM_001085471.1	NP_001078940.1	O00409	FOXN3_HUMAN	forkhead box N3	480					mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	protein C-terminus binding (GO:0008022)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|large_intestine(4)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						CTCTTTCTGCCCCTTTGCCGT	0.443																																																	0								ENSG00000053254						64.0	65.0	65.0					14																	89628792		2203	4300	6503	FOXN3	SO:0001583	missense	0			-	HGNC		CCDS32138.1, CCDS41977.1	14q32.11	2012-04-17	2007-05-02	2007-05-02	ENSG00000053254	ENSG00000053254		"""Forkhead boxes"""	1928	protein-coding gene	gene with protein product		602628	"""chromosome 14 open reading frame 116"", ""checkpoint suppressor 1"""	C14orf116, CHES1		9154802	Standard	NM_005197		Approved		uc001xxo.4	O00409	OTTHUMG00000170898	ENST00000345097.4:c.1439G>A	14.37:g.89628792C>T	ENSP00000343288:p.Gly480Glu	Somatic	0	43	0.00		0.5558904216091591	52	16.13	10	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	22	18.52	Q96II7|Q9UIE7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.G480E	ENST00000345097.4	37	c.1439	CCDS41977.1	14	.	.	.	.	.	.	.	.	.	.	C	22.4	4.284854	0.80803	.	.	ENSG00000053254	ENST00000345097;ENST00000261302;ENST00000557258;ENST00000555353	T;T;T;T	0.62941	-0.01;-0.01;-0.01;-0.01	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	T	0.77538	0.4145	L	0.54323	1.7	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.974	T	0.77086	-0.2718	10	0.66056	D	0.02	.	19.9882	0.97356	0.0:1.0:0.0:0.0	.	480;458	O00409;O00409-2	FOXN3_HUMAN;.	E	480;480;458;458	ENSP00000343288:G480E;ENSP00000261302:G480E;ENSP00000452005:G458E;ENSP00000452227:G458E	ENSP00000261302:G480E	G	-	2	0	FOXN3	88698545	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.907000	0.69908	2.824000	0.97209	0.655000	0.94253	GGG	-	NULL		0.443	FOXN3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXN3	protein_coding	OTTHUMT00000410902.2	C	NM_005197	-		89628792	-1	no_errors	ENST00000261302	ensembl	human	known	74_37	missense	SNP	1.000	T
PUM2	23369	genome.wustl.edu	37	2	20518400	20518400	+	Missense_Mutation	SNP	G	G	A			TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr2:20518400G>A	ENST00000361078.2	-	2	80	c.58C>T	c.(58-60)Cct>Tct	p.P20S	PUM2_ENST00000420234.1_5'UTR|PUM2_ENST00000338086.5_Missense_Mutation_p.P20S|PUM2_ENST00000403432.1_Missense_Mutation_p.P20S|PUM2_ENST00000319801.5_Missense_Mutation_p.P20S|PUM2_ENST00000536417.1_Intron			Q8TB72	PUM2_HUMAN	pumilio RNA-binding family member 2	20	Interaction with SNAPIN.				regulation of translation (GO:0006417)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|nuclear membrane (GO:0031965)|perinuclear region of cytoplasm (GO:0048471)	poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(7)|lung(13)|ovary(2)|prostate(4)|urinary_tract(3)	42	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TTTTTGGTAGGCAAAAGCTAT	0.328																																																	0								ENSG00000055917						89.0	83.0	85.0					2																	20518400		2203	4300	6503	PUM2	SO:0001583	missense	0			-	HGNC	AF315591	CCDS1698.1, CCDS74486.1, CCDS74487.1	2p22-p21	2013-09-02	2013-09-02		ENSG00000055917	ENSG00000055917			14958	protein-coding gene	gene with protein product		607205	"""pumilio (Drosphila) homolog 2"", ""pumilio homolog 2 (Drosophila)"""			9039502, 12459267, 12511597	Standard	XM_005262607		Approved	PUMH2, KIAA0235	uc002rds.1	Q8TB72	OTTHUMG00000122098	ENST00000361078.2:c.58C>T	2.37:g.20518400G>A	ENSP00000354370:p.Pro20Ser	Somatic	0	44	0.00		0.5558904216091591	41	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	13	18.75	B3KSL0|B4E2B6|D6W527|O00234|Q53TV7|Q8WY43|Q9HAN2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Pumilio_RNA-bd_rpt,superfamily_ARM-type_fold,smart_Pumilio_RNA-bd_rpt,pfscan_Pumilio_RNA-bd_rpt	p.P20S	ENST00000361078.2	37	c.58		2	.	.	.	.	.	.	.	.	.	.	G	20.6	4.013512	0.75161	.	.	ENSG00000055917	ENST00000338086;ENST00000361078;ENST00000319801;ENST00000403432;ENST00000442400;ENST00000424110	T;T;T;T	0.21361	2.01;2.27;2.18;2.01	5.74	4.87	0.63330	.	0.000000	0.85682	D	0.000000	T	0.26955	0.0660	L	0.31065	0.9	0.80722	D	1	B;P	0.48230	0.003;0.907	B;P	0.52554	0.009;0.702	T	0.02093	-1.1215	10	0.56958	D	0.05	-12.1649	14.4969	0.67694	0.0702:0.0:0.9298:0.0	.	20;20	B7ZL34;Q8TB72-3	.;.	S	20	ENSP00000338173:P20S;ENSP00000354370:P20S;ENSP00000326746:P20S;ENSP00000385992:P20S	ENSP00000326746:P20S	P	-	1	0	PUM2	20381881	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.591000	0.98241	1.425000	0.47237	0.591000	0.81541	CCT	-	NULL		0.328	PUM2-202	KNOWN	basic|appris_candidate_longest	protein_coding	PUM2	protein_coding		G	NM_015317	-		20518400	-1	no_errors	ENST00000361078	ensembl	human	known	74_37	missense	SNP	1.000	A
PRSS1	5644	genome.wustl.edu	37	7	142459667	142459667	+	Silent	SNP	G	G	A	rs142476093		TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr7:142459667G>A	ENST00000311737.7	+	3	249	c.243G>A	c.(241-243)ctG>ctA	p.L81L	PRSS1_ENST00000486171.1_Silent_p.L95L	NM_002769.4	NP_002760.1	P07477	TRY1_HUMAN	protease, serine, 1 (trypsin 1)	81	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cobalamin metabolic process (GO:0009235)|digestion (GO:0007586)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(24)|prostate(2)	38	Melanoma(164;0.047)	all_cancers(3;2.14e-49)|Acute lymphoblastic leukemia(3;7.3e-185)|all_hematologic(3;1.1e-165)	all cancers(2;0.000126)|Colorectal(2;0.000157)|Epithelial(2;0.000191)|COAD - Colon adenocarcinoma(2;0.00189)		Aprotinin(DB06692)	TCGAAGTCCTGGAGGGGAATG	0.542																																																	0								ENSG00000204983						213.0	200.0	204.0					7																	142459667		2203	4300	6503	PRSS1	SO:0001819	synonymous_variant	0			-	HGNC	M22612	CCDS5872.1	7q34	2012-10-02			ENSG00000204983	ENSG00000204983	3.4.21.4	"""Serine peptidases / Serine peptidases"""	9475	protein-coding gene	gene with protein product		276000		TRY1			Standard	NM_002769		Approved		uc003wak.2	P07477	OTTHUMG00000158923	ENST00000311737.7:c.243G>A	7.37:g.142459667G>A		Somatic	0	63	0.00		0.5558904216091591	3	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	94	8.74	A1A509|A6NJ71|B2R5I5|Q5NV57|Q7M4N3|Q7M4N4|Q92955|Q9HAN4|Q9HAN5|Q9HAN6|Q9HAN7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.L81	ENST00000311737.7	37	c.243	CCDS5872.1	7																																																																																			-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1		0.542	PRSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRSS1	protein_coding	OTTHUMT00000352538.2	G		-		142459667	+1	no_errors	ENST00000311737	ensembl	human	known	74_37	silent	SNP	0.003	A
DAB1	1600	genome.wustl.edu	37	1	57476849	57476849	+	Missense_Mutation	SNP	T	T	C			TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr1:57476849T>C	ENST00000371231.1	-	14	1674	c.1640A>G	c.(1639-1641)gAa>gGa	p.E547G	DAB1_ENST00000485760.1_5'UTR|DAB1_ENST00000420954.2_Missense_Mutation_p.E512G|DAB1_ENST00000371234.4_Missense_Mutation_p.E514G|DAB1_ENST00000371236.2_Missense_Mutation_p.E514G|DAB1_ENST00000439789.2_Missense_Mutation_p.E428G|DAB1_ENST00000414851.2_Missense_Mutation_p.E496G			O75553	DAB1_HUMAN	Dab, reelin signal transducer, homolog 1 (Drosophila)	547					adult walking behavior (GO:0007628)|cell-cell adhesion involved in neuronal-glial interactions involved in cerebral cortex radial glia guided migration (GO:0021813)|cerebellum structural organization (GO:0021589)|dendrite development (GO:0016358)|Golgi localization (GO:0051645)|lateral motor column neuron migration (GO:0097477)|midgut development (GO:0007494)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell adhesion (GO:0007162)|negative regulation of JAK-STAT cascade (GO:0046426)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of protein kinase activity (GO:0045860)|radial glia guided migration of Purkinje cell (GO:0021942)|response to drug (GO:0042493)|small GTPase mediated signal transduction (GO:0007264)|ventral spinal cord development (GO:0021517)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytosol (GO:0005829)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)				central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(28)|ovary(3)|skin(4)|upper_aerodigestive_tract(5)|urinary_tract(5)	64						GCTGGGACTTTCAAAGCCCTC	0.438																																																	0								ENSG00000173406						135.0	137.0	136.0					1																	57476849		2203	4300	6503	DAB1	SO:0001583	missense	0			-	HGNC	BC067445	CCDS607.1	1p32-p31	2013-10-03	2013-10-03		ENSG00000173406	ENSG00000173406			2661	protein-coding gene	gene with protein product		603448	"""disabled (Drosophila) homolog 1"", ""disabled homolog 1 (Drosophila)"", ""Dab, reelin signal transducer, homolog 1 (Drosophila)"", ""Dab reelin signal transducer 1"""			9790777	Standard	NM_021080		Approved		uc001cys.1	O75553	OTTHUMG00000008391	ENST00000371231.1:c.1640A>G	1.37:g.57476849T>C	ENSP00000360275:p.Glu547Gly	Somatic	0	45	0.00		0.5558904216091591	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	32	17.95	A4FU90|B3KTG3|Q4LE59|Q5T6M6|Q5T6M9|Q5T835|Q5T836|Q5T837|Q6NWS9|Q6NWT0|Q6NWT1|Q9NYA8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PTB/PI_dom,smart_PTB/PI_dom,pfscan_PTB/PI_dom	p.E547G	ENST00000371231.1	37	c.1640		1	.	.	.	.	.	.	.	.	.	.	T	10.87	1.473270	0.26423	.	.	ENSG00000173406	ENST00000371236;ENST00000371233;ENST00000371234;ENST00000420954;ENST00000414851;ENST00000439789;ENST00000371231	T;T;T;T;T;T	0.42131	0.99;0.99;0.98;0.98;2.0;0.98	4.96	4.96	0.65561	.	0.152990	0.64402	D	0.000015	T	0.22475	0.0542	N	0.05441	-0.05	0.47441	D	0.999421	B;B;B;B;B	0.14805	0.011;0.002;0.004;0.003;0.006	B;B;B;B;B	0.18263	0.006;0.009;0.009;0.004;0.021	T	0.08764	-1.0706	10	0.07325	T	0.83	-47.9219	15.0778	0.72090	0.0:0.0:0.0:1.0	.	496;547;514;428;512	O75553-4;O75553;O75553-6;O75553-3;O75553-5	.;DAB1_HUMAN;.;.;.	G	514;514;514;512;496;428;547	ENSP00000360280:E514G;ENSP00000360278:E514G;ENSP00000395296:E512G;ENSP00000387581:E496G;ENSP00000409328:E428G;ENSP00000360275:E547G	ENSP00000360275:E547G	E	-	2	0	DAB1	57249437	1.000000	0.71417	1.000000	0.80357	0.925000	0.55904	4.112000	0.57845	2.199000	0.70637	0.454000	0.30748	GAA	-	NULL		0.438	DAB1-010	KNOWN	basic	protein_coding	DAB1	protein_coding	OTTHUMT00000027962.1	T	NM_021080	-		57476849	-1	no_errors	ENST00000371231	ensembl	human	known	74_37	missense	SNP	1.000	C
CD9	928	genome.wustl.edu	37	12	6334750	6334750	+	Intron	SNP	T	T	A			TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr12:6334750T>A	ENST00000382518.1	+	3	611				CD9_ENST00000009180.4_Intron|CD9_ENST00000382515.2_Intron|CD9_ENST00000481267.1_Intron			P21926	CD9_HUMAN	CD9 molecule						blood coagulation (GO:0007596)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cellular component movement (GO:0006928)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organism reproduction (GO:0032504)|negative regulation of cell proliferation (GO:0008285)|oligodendrocyte development (GO:0014003)|paranodal junction assembly (GO:0030913)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|response to water deprivation (GO:0009414)|single fertilization (GO:0007338)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|platelet alpha granule membrane (GO:0031092)|vesicle (GO:0031982)				endometrium(2)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)|skin(1)|stomach(1)	8						TCCAACAAAGTTCCTGCAACT	0.507																																																	0								ENSG00000010278						24.0	23.0	23.0					12																	6334750		2203	4300	6503	CD9	SO:0001627	intron_variant	0			-	HGNC	M38690	CCDS8540.1	12p13	2013-02-14	2006-03-28		ENSG00000010278	ENSG00000010278		"""CD molecules"", ""Tetraspanins"""	1709	protein-coding gene	gene with protein product	"""motility related protein-1"""	143030	"""CD9 antigen (p24)"""	MIC3		6198179	Standard	NM_001769		Approved	BA2, P24, TSPAN29, MRP-1	uc001qnq.2	P21926	OTTHUMG00000044400	ENST00000382518.1:c.175+50T>A	12.37:g.6334750T>A		Somatic	0	11	0.00		0.5558904216091591	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	2	75.00	D3DUQ9|Q5J7W6|Q96ES4	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000382518.1	37	NULL	CCDS8540.1	12																																																																																			-	-		0.507	CD9-004	NOVEL	basic|appris_principal|CCDS	protein_coding	CD9	protein_coding	OTTHUMT00000103348.1	T		-		6334750	+1	no_errors	ENST00000538418	ensembl	human	putative	74_37	rna	SNP	0.000	A
ARHGAP6	395	genome.wustl.edu	37	X	11187750	11187750	+	Missense_Mutation	SNP	G	G	C			TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chrX:11187750G>C	ENST00000337414.4	-	9	2556	c.1684C>G	c.(1684-1686)Ctg>Gtg	p.L562V	ARHGAP6_ENST00000491514.1_5'UTR|ARHGAP6_ENST00000380736.1_Missense_Mutation_p.L359V|ARHGAP6_ENST00000380732.3_Missense_Mutation_p.L594V|ARHGAP6_ENST00000303025.6_Missense_Mutation_p.L359V|ARHGAP6_ENST00000380718.1_Missense_Mutation_p.L562V|ARHGAP6_ENST00000534860.1_Missense_Mutation_p.L387V|ARHGAP6_ENST00000413512.3_Missense_Mutation_p.L371V	NM_013427.2	NP_038286.2	O43182	RHG06_HUMAN	Rho GTPase activating protein 6	562	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				actin filament polymerization (GO:0030041)|activation of phospholipase C activity (GO:0007202)|focal adhesion assembly (GO:0048041)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of stress fiber assembly (GO:0051497)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of signal transduction (GO:0009967)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	phospholipase activator activity (GO:0016004)|phospholipase binding (GO:0043274)|Rho GTPase activator activity (GO:0005100)|SH3/SH2 adaptor activity (GO:0005070)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(19)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38						TTGTGCAGCAGGTTGGGTCCA	0.448																																																	0								ENSG00000047648						150.0	124.0	133.0					X																	11187750		2203	4300	6503	ARHGAP6	SO:0001583	missense	0			-	HGNC	AF012272	CCDS14140.1, CCDS14141.1, CCDS14142.1	Xp22.3	2008-02-05			ENSG00000047648	ENSG00000047648		"""Rho GTPase activating proteins"""	676	protein-coding gene	gene with protein product		300118				9417914	Standard	XM_005274507		Approved	rhoGAPX-1	uc004cup.1	O43182	OTTHUMG00000021134	ENST00000337414.4:c.1684C>G	X.37:g.11187750G>C	ENSP00000338967:p.Leu562Val	Somatic	0	13	0.00		0.5558904216091591	2	83.33	10	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	3	88.00	B2RWQ0|O43437|Q9P1B3|Q9UK81|Q9UK82	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.L562V	ENST00000337414.4	37	c.1684	CCDS14140.1	X	.	.	.	.	.	.	.	.	.	.	G	19.68	3.872023	0.72180	.	.	ENSG00000047648	ENST00000534860;ENST00000380736;ENST00000303025;ENST00000337414;ENST00000380717;ENST00000380718;ENST00000413512;ENST00000380732	T;T;T;T;T;T;T;T	0.61040	0.14;0.14;0.14;0.14;0.14;0.14;0.14;0.14	5.66	5.66	0.87406	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.000000	0.42172	D	0.000742	T	0.72463	0.3463	M	0.70108	2.13	0.58432	D	0.999999	D;D;D;D;D	0.69078	0.981;0.972;0.981;0.994;0.997	P;P;P;D;D	0.74348	0.871;0.891;0.855;0.954;0.983	T	0.75482	-0.3302	10	0.87932	D	0	.	10.5651	0.45167	0.1538:0.0:0.8462:0.0	.	371;359;562;562;562	B7Z8H7;O43182-5;O43182-2;O43182;A8KAL3	.;.;.;RHG06_HUMAN;.	V	387;359;359;562;398;562;371;594	ENSP00000438135:L387V;ENSP00000370112:L359V;ENSP00000302312:L359V;ENSP00000338967:L562V;ENSP00000370093:L398V;ENSP00000370094:L562V;ENSP00000389394:L371V;ENSP00000370108:L594V	ENSP00000302312:L359V	L	-	1	2	ARHGAP6	11097671	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.234000	0.65343	2.385000	0.81259	0.600000	0.82982	CTG	-	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom		0.448	ARHGAP6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARHGAP6	protein_coding	OTTHUMT00000055760.2	G	NM_013427	-		11187750	-1	no_errors	ENST00000337414	ensembl	human	known	74_37	missense	SNP	1.000	C
LGR4	55366	genome.wustl.edu	37	11	27390228	27390228	+	Missense_Mutation	SNP	A	A	G			TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr11:27390228A>G	ENST00000379214.4	-	18	2485	c.2042T>C	c.(2041-2043)cTt>cCt	p.L681P	LGR4_ENST00000389858.4_Missense_Mutation_p.L657P	NM_018490.2	NP_060960.2	Q9BXB1	LGR4_HUMAN	leucine-rich repeat containing G protein-coupled receptor 4	681				L -> I (in Ref. 4; AAH33039). {ECO:0000305}.	bone mineralization (GO:0030282)|bone remodeling (GO:0046849)|canonical Wnt signaling pathway involved in metanephric kidney development (GO:0061290)|cell differentiation involved in metanephros development (GO:0072202)|epithelial cell proliferation (GO:0050673)|innate immune response (GO:0045087)|male genitalia development (GO:0030539)|metanephric glomerulus development (GO:0072224)|metanephric nephron tubule morphogenesis (GO:0072282)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoblast differentiation (GO:0001649)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)			NS(3)|breast(2)|endometrium(3)|kidney(2)|large_intestine(11)|lung(10)|ovary(1)	32						TCTATGGAAAAGGGGAAAACA	0.428																																																	0								ENSG00000205213						90.0	82.0	85.0					11																	27390228		2202	4299	6501	LGR4	SO:0001583	missense	0			-	HGNC	AF257182	CCDS31449.1	11p14-p13	2012-08-21	2011-01-25	2004-11-12	ENSG00000205213	ENSG00000205213		"""GPCR / Class A : Orphans"""	13299	protein-coding gene	gene with protein product		606666	"""G protein-coupled receptor 48"", ""leucine-rich repeat-containing G protein-coupled receptor 4"""	GPR48		10894923	Standard	NM_018490		Approved		uc001mrj.4	Q9BXB1	OTTHUMG00000133508	ENST00000379214.4:c.2042T>C	11.37:g.27390228A>G	ENSP00000368516:p.Leu681Pro	Somatic	0	56	0.00		0.5558904216091591	20	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	36	12.20	A6NCH3|G5E9B3|Q8N537|Q9NYD1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Leu-rich_rpt,pfam_GPCR_Rhodpsn,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,pfscan_GPCR_Rhodpsn_7TM,prints_Gphrmn_rcpt_fam,prints_GPCR_Rhodpsn	p.L681P	ENST00000379214.4	37	c.2042	CCDS31449.1	11	.	.	.	.	.	.	.	.	.	.	A	17.70	3.454559	0.63290	.	.	ENSG00000205213	ENST00000379214;ENST00000389858	T;T	0.75260	-0.92;0.94	5.72	5.72	0.89469	GPCR, rhodopsin-like superfamily (1);	0.185608	0.48767	D	0.000173	D	0.85991	0.5826	M	0.74467	2.265	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.996;1.0	D	0.87651	0.2528	10	0.87932	D	0	.	15.9971	0.80260	1.0:0.0:0.0:0.0	.	657;681	G5E9B3;Q9BXB1	.;LGR4_HUMAN	P	681;657	ENSP00000368516:L681P;ENSP00000374508:L657P	ENSP00000368516:L681P	L	-	2	0	LGR4	27346804	1.000000	0.71417	0.838000	0.33150	0.743000	0.42351	8.756000	0.91651	2.175000	0.68902	0.528000	0.53228	CTT	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.428	LGR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LGR4	protein_coding	OTTHUMT00000257467.1	A	NM_018490	-		27390228	-1	no_errors	ENST00000379214	ensembl	human	known	74_37	missense	SNP	1.000	G
SNX29P2	440352	genome.wustl.edu	37	16	29337795	29337795	+	lincRNA	SNP	G	G	T			TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr16:29337795G>T	ENST00000398878.3	+	0	852							Q8IUI4	S29P2_HUMAN	sorting nexin 29 pseudogene 2																		AAGACGGACAGGTGCAAGTAG	0.652																																																	0								ENSG00000198106																																			SNX29P2			0			-	HGNC	BX648280		16p11.2	2014-03-21	2011-08-16	2011-08-16	ENSG00000198106	ENSG00000198106			31914	pseudogene	pseudogene			"""RUN domain containing 2C"""	RUNDC2C			Standard	NR_002939		Approved		uc021tfw.1	Q8IUI4			16.37:g.29337795G>T		Somatic	0	99	0.00		0.5558904216091591	0	100.00	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	24	47.83		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000398878.3	37	NULL		16																																																																																			-	-		0.652	SNX29P2-202	KNOWN	basic	lincRNA	SNX29P2	lincRNA		G	NR_002939	-		29337795	+1	no_errors	ENST00000398878	ensembl	human	known	74_37	rna	SNP	1.000	T
ZNF101	94039	genome.wustl.edu	37	19	19790091	19790091	+	Missense_Mutation	SNP	G	G	T			TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr19:19790091G>T	ENST00000592502.1	+	4	403	c.293G>T	c.(292-294)gGa>gTa	p.G98V	ZNF101_ENST00000444249.2_3'UTR|ZNF101_ENST00000415784.2_5'UTR			Q8IZC7	ZN101_HUMAN	zinc finger protein 101	98					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(4)|ovary(2)|prostate(1)	17						AGTCAAACTGGAGTGAAACCA	0.473																																																	0								ENSG00000181896						101.0	85.0	91.0					19																	19790091		2203	4300	6503	ZNF101	SO:0001583	missense	0			-	HGNC	AK097169	CCDS32971.1	19p13.11	2013-01-08	2004-02-10		ENSG00000181896	ENSG00000181896		"""Zinc fingers, C2H2-type"", ""-"""	12881	protein-coding gene	gene with protein product		603983	"""zinc finger protein 101 (Y2)"""			11441184	Standard	XM_005260165		Approved	HZF12, DKFZp570I0164	uc002nni.2	Q8IZC7	OTTHUMG00000167736	ENST00000592502.1:c.293G>T	19.37:g.19790091G>T	ENSP00000468049:p.Gly98Val	Somatic	0	28	0.00		0.5558904216091591	32	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	37	11.90	C9JU83|Q0VDG9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G98V	ENST00000592502.1	37	c.293	CCDS32971.1	19	.	.	.	.	.	.	.	.	.	.	G	15.52	2.858619	0.51376	.	.	ENSG00000181896	ENST00000318110;ENST00000415440	T	0.21734	1.99	0.235	0.235	0.15431	Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.32346	0.0826	L	0.49126	1.545	0.80722	D	1	D	0.76494	0.999	D	0.71656	0.974	T	0.09975	-1.0650	9	0.62326	D	0.03	.	6.2532	0.20859	3.0E-4:0.0:0.9997:0.0	.	98	Q8IZC7	ZN101_HUMAN	V	98	ENSP00000319716:G98V	ENSP00000319716:G98V	G	+	2	0	ZNF101	19651091	0.978000	0.34361	0.454000	0.27019	0.460000	0.32559	2.309000	0.43699	0.308000	0.22923	0.313000	0.20887	GGA	-	NULL		0.473	ZNF101-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF101	protein_coding	OTTHUMT00000460559.1	G	NM_033204	-		19790091	+1	no_errors	ENST00000318110	ensembl	human	known	74_37	missense	SNP	1.000	T
PLEKHH1	57475	genome.wustl.edu	37	14	68029200	68029200	+	Missense_Mutation	SNP	G	G	T			TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr14:68029200G>T	ENST00000329153.5	+	7	984	c.852G>T	c.(850-852)gaG>gaT	p.E284D		NM_020715.2	NP_065766.1	Q9ULM0	PKHH1_HUMAN	pleckstrin homology domain containing, family H (with MyTH4 domain) member 1	284						cytoskeleton (GO:0005856)				endometrium(2)|kidney(4)|lung(12)|urinary_tract(1)	19				all cancers(60;0.000771)|OV - Ovarian serous cystadenocarcinoma(108;0.00502)|BRCA - Breast invasive adenocarcinoma(234;0.011)		CCTGGGGTGAGGGTCTGGTTA	0.582																																																	0								ENSG00000054690						59.0	69.0	66.0					14																	68029200		1954	4153	6107	PLEKHH1	SO:0001583	missense	0			-	HGNC	AB033026	CCDS45128.1	14q24.1	2013-01-10				ENSG00000054690		"""Pleckstrin homology (PH) domain containing"""	17733	protein-coding gene	gene with protein product						10574462	Standard	NM_020715		Approved	KIAA1200	uc001xjl.1	Q9ULM0		ENST00000329153.5:c.852G>T	14.37:g.68029200G>T	ENSP00000330278:p.Glu284Asp	Somatic	0	35	0.00		0.5558904216091591	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	27	12.90	A6H8X6|Q6PJL4|Q6ZWC7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Pleckstrin_homology,pfam_MyTH4_dom,pfam_FERM_central,superfamily_FERM_central,smart_Pleckstrin_homology,smart_MyTH4_dom,smart_Band_41_domain,pfscan_FERM_domain,pfscan_MyTH4_dom,pfscan_Pleckstrin_homology	p.E284D	ENST00000329153.5	37	c.852	CCDS45128.1	14	.	.	.	.	.	.	.	.	.	.	G	7.354	0.623445	0.14193	.	.	ENSG00000054690	ENST00000329153	T	0.72835	-0.69	5.08	-1.78	0.07957	.	0.651971	0.16492	N	0.212056	T	0.56978	0.2022	L	0.57536	1.79	0.25080	N	0.990933	B	0.09022	0.002	B	0.06405	0.002	T	0.40572	-0.9556	10	0.23891	T	0.37	.	5.0247	0.14379	0.4771:0.1551:0.3678:0.0	.	284	Q9ULM0	PKHH1_HUMAN	D	284	ENSP00000330278:E284D	ENSP00000330278:E284D	E	+	3	2	PLEKHH1	67098953	0.001000	0.12720	0.535000	0.28026	0.129000	0.20672	-0.480000	0.06559	-0.190000	0.10465	0.491000	0.48974	GAG	-	NULL		0.582	PLEKHH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHH1	protein_coding	OTTHUMT00000412730.3	G	XM_031054	-		68029200	+1	no_errors	ENST00000329153	ensembl	human	known	74_37	missense	SNP	0.071	T
INPP4A	3631	genome.wustl.edu	37	2	99182628	99182628	+	Missense_Mutation	SNP	G	G	A			TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr2:99182628G>A	ENST00000523221.1	+	20	2431	c.2431G>A	c.(2431-2433)Gag>Aag	p.E811K	INPP4A_ENST00000409540.3_Missense_Mutation_p.E772K|INPP4A_ENST00000409463.1_Missense_Mutation_p.E140K|INPP4A_ENST00000409016.4_Missense_Mutation_p.E772K|INPP4A_ENST00000545415.1_Missense_Mutation_p.E772K|INPP4A_ENST00000467042.1_3'UTR|INPP4A_ENST00000074304.5_Missense_Mutation_p.E811K|INPP4A_ENST00000409851.3_Missense_Mutation_p.E806K			Q96PE3	INP4A_HUMAN	inositol polyphosphate-4-phosphatase, type I, 107kDa	811					inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity (GO:0016316)|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity (GO:0034597)			breast(1)|endometrium(9)|kidney(2)|large_intestine(5)|lung(16)|ovary(2)|prostate(4)|upper_aerodigestive_tract(4)	43						GACACTGGCCGAGAGGTGCGT	0.622																																																	0								ENSG00000040933						13.0	16.0	15.0					2																	99182628		2060	4202	6262	INPP4A	SO:0001583	missense	0			-	HGNC	U26398	CCDS46369.1, CCDS46370.1, CCDS46371.1, CCDS46372.1	2q11.2	2008-05-27	2002-08-29		ENSG00000040933	ENSG00000040933			6074	protein-coding gene	gene with protein product		600916	"""inositol polyphosphate-4-phosphatase, type I, 107kD"""	INPP4		7608176, 9295334	Standard	NM_004027		Approved		uc002syy.3	Q96PE3	OTTHUMG00000153106	ENST00000523221.1:c.2431G>A	2.37:g.99182628G>A	ENSP00000427722:p.Glu811Lys	Somatic	0	69	0.00		0.5558904216091591	19	13.64	3	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	22	33.33	O15326|Q13187|Q53TD8|Q8TC02	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_C2_dom	p.E811K	ENST00000523221.1	37	c.2431	CCDS46369.1	2	.	.	.	.	.	.	.	.	.	.	G	28.8	4.950173	0.92660	.	.	ENSG00000040933	ENST00000409016;ENST00000409851;ENST00000409463;ENST00000074304;ENST00000545415;ENST00000409540;ENST00000523221	T;T;T;T;T;T;T	0.46451	1.79;2.15;0.87;2.15;1.79;1.77;2.15	5.22	4.34	0.51931	.	0.000000	0.85682	D	0.000000	T	0.65637	0.2710	M	0.80183	2.485	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;0.994;1.0;1.0	D;D;P;D;D	0.85130	0.994;0.994;0.859;0.997;0.997	T	0.70281	-0.4915	10	0.54805	T	0.06	-26.9683	14.4079	0.67096	0.0:0.0:0.8514:0.1486	.	772;772;140;811;806	Q96PE3-2;Q96PE3-4;B8ZZB2;Q96PE3;Q96PE3-3	.;.;.;INP4A_HUMAN;.	K	772;806;140;811;772;772;811	ENSP00000386704:E772K;ENSP00000386777:E806K;ENSP00000386329:E140K;ENSP00000074304:E811K;ENSP00000442149:E772K;ENSP00000387294:E772K;ENSP00000427722:E811K	ENSP00000074304:E811K	E	+	1	0	INPP4A	98549060	1.000000	0.71417	0.993000	0.49108	0.700000	0.40528	9.657000	0.98554	1.433000	0.47394	0.650000	0.86243	GAG	-	NULL		0.622	INPP4A-009	KNOWN	basic|CCDS	protein_coding	INPP4A	protein_coding	OTTHUMT00000376095.1	G	NM_001566	-		99182628	+1	no_errors	ENST00000074304	ensembl	human	known	74_37	missense	SNP	1.000	A
CDCP1	64866	genome.wustl.edu	37	3	45127316	45127316	+	Silent	SNP	G	G	T			TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr3:45127316G>T	ENST00000296129.1	-	9	2459	c.2325C>A	c.(2323-2325)tcC>tcA	p.S775S		NM_022842.3	NP_073753.3	Q9H5V8	CDCP1_HUMAN	CUB domain containing protein 1	775						extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(12)|ovary(1)|skin(4)|urinary_tract(1)	29				BRCA - Breast invasive adenocarcinoma(193;0.00928)|KIRC - Kidney renal clear cell carcinoma(197;0.0519)|Kidney(197;0.0651)		TGGTGGGTGGGGAGGGAGGAC	0.612																																																	0								ENSG00000163814						86.0	83.0	84.0					3																	45127316		2203	4300	6503	CDCP1	SO:0001819	synonymous_variant	0			-	HGNC	AF468010	CCDS2727.1, CCDS46812.1	3p21.3	2006-03-28			ENSG00000163814	ENSG00000163814		"""CD molecules"""	24357	protein-coding gene	gene with protein product		611735				11466621	Standard	NM_022842		Approved	CD318, SIMA135	uc003com.3	Q9H5V8	OTTHUMG00000133090	ENST00000296129.1:c.2325C>A	3.37:g.45127316G>T		Somatic	0	35	0.00		0.5558904216091591	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	25	13.79	Q49UB4|Q6NT71|Q6U9Y2|Q8WU91|Q96QU7|Q9H676|Q9H8C2	Silent	SNP	NA	NA	NA	NA	NA	NA	superfamily_CUB_dom	p.S775	ENST00000296129.1	37	c.2325	CCDS2727.1	3																																																																																			-	NULL		0.612	CDCP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDCP1	protein_coding	OTTHUMT00000256748.3	G	NM_022842	-		45127316	-1	no_errors	ENST00000296129	ensembl	human	known	74_37	silent	SNP	0.996	T
KIF21A	55605	genome.wustl.edu	37	12	39740286	39740286	+	Missense_Mutation	SNP	C	C	A			TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr12:39740286C>A	ENST00000361418.5	-	12	1709	c.1694G>T	c.(1693-1695)aGc>aTc	p.S565I	KIF21A_ENST00000395670.3_Missense_Mutation_p.S565I|KIF21A_ENST00000361961.3_Intron|KIF21A_ENST00000544797.2_Intron|KIF21A_ENST00000541463.2_Intron			Q7Z4S6	KI21A_HUMAN	kinesin family member 21A	565					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(41)|ovary(5)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	86		Lung NSC(34;0.179)|all_lung(34;0.213)				TTCTCGATTGCTTTCCTCAAG	0.363																																																	0								ENSG00000139116																																			KIF21A	SO:0001583	missense	0			-	HGNC	AK000059	CCDS31773.1, CCDS53774.1, CCDS53775.1, CCDS53776.1	12q12	2013-01-10						"""Kinesins"", ""WD repeat domain containing"""	19349	protein-coding gene	gene with protein product		608283	"""fibrosis of the extraocular muscles, congenital, 1"""	FEOM1		10225949	Standard	NM_017641		Approved	FLJ20052	uc001rly.3	Q7Z4S6	OTTHUMG00000169335	ENST00000361418.5:c.1694G>T	12.37:g.39740286C>A	ENSP00000354878:p.Ser565Ile	Somatic	0	70	0.00		0.5558904216091591	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	35	130	21.08	A8MX28|B0I1R9|B9EGE4|F5H0C3|F5H219|Q2UVF1|Q6UKL9|Q7Z668|Q86WZ5|Q8IVZ8|Q9C0F5|Q9NXU4|Q9Y590	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Kinesin_motor_dom,pfam_WD40_repeat,superfamily_P-loop_NTPase,superfamily_WD40_repeat_dom,superfamily_Prefoldin,superfamily_ARM-type_fold,smart_Kinesin_motor_dom,smart_WD40_repeat,pfscan_Kinesin_motor_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Kinesin_motor_dom	p.S565I	ENST00000361418.5	37	c.1694	CCDS53776.1	12	.	.	.	.	.	.	.	.	.	.	C	13.46	2.244361	0.39697	.	.	ENSG00000139116	ENST00000395670;ENST00000341813;ENST00000361418	T;T	0.70045	-0.45;-0.41	5.42	5.42	0.78866	.	.	.	.	.	T	0.51770	0.1694	N	0.22421	0.69	0.38924	D	0.957795	P	0.44578	0.838	B	0.35413	0.202	T	0.59590	-0.7426	9	0.42905	T	0.14	.	17.4003	0.87458	0.0:1.0:0.0:0.0	.	565	Q7Z4S6	KI21A_HUMAN	I	565	ENSP00000379029:S565I;ENSP00000354878:S565I	ENSP00000344501:S565I	S	-	2	0	KIF21A	38026553	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.975000	0.49281	2.542000	0.85734	0.655000	0.94253	AGC	-	superfamily_ARM-type_fold		0.363	KIF21A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF21A	protein_coding	OTTHUMT00000403581.1	C	NM_017641	-		39740286	-1	no_errors	ENST00000395670	ensembl	human	known	74_37	missense	SNP	1.000	A
ATP2A2	488	genome.wustl.edu	37	12	110719652	110719652	+	Nonsense_Mutation	SNP	G	G	T			TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr12:110719652G>T	ENST00000539276.2	+	1	167	c.58G>T	c.(58-60)Gag>Tag	p.E20*	ATP2A2_ENST00000395494.2_Nonsense_Mutation_p.E20*|ATP2A2_ENST00000308664.6_Nonsense_Mutation_p.E20*|ATP2A2_ENST00000552636.1_Intron			P16615	AT2A2_HUMAN	ATPase, Ca++ transporting, cardiac muscle, slow twitch 2	20					blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cell adhesion (GO:0007155)|cellular calcium ion homeostasis (GO:0006874)|epidermis development (GO:0008544)|ER-nucleus signaling pathway (GO:0006984)|ion transmembrane transport (GO:0034220)|negative regulation of heart contraction (GO:0045822)|positive regulation of heart rate (GO:0010460)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|transport (GO:0006810)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|calcium-transporting ATPase activity involved in regulation of cardiac muscle cell membrane potential (GO:0086039)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|S100 protein binding (GO:0044548)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(10)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|urinary_tract(1)	38						CGGCGTCAACGAGAGTACGGG	0.706																																																	0								ENSG00000174437						69.0	56.0	60.0					12																	110719652		2191	4296	6487	ATP2A2	SO:0001587	stop_gained	0			-	HGNC		CCDS9143.1, CCDS9144.1	12q24.11	2012-10-22			ENSG00000174437	ENSG00000174437	3.6.3.8	"""ATPases / P-type"""	812	protein-coding gene	gene with protein product	"""sarcoplasmic/endoplasmic reticulum calcium ATPase 2"", ""calcium pump 2"""	108740		ATP2B, DAR		10080178	Standard	NM_170665		Approved	SERCA2	uc001tqk.4	P16615	OTTHUMG00000169327	ENST00000539276.2:c.58G>T	12.37:g.110719652G>T	ENSP00000440045:p.Glu20*	Somatic	0	43	0.00		0.5558904216091591	109	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	13	23.53	A6NDN7|B4DF05|P16614|Q86VJ2	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_cation-transptr_C,pfam_HAD-like_dom,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_P-typ_cyto_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Ca-transp_IIA,tigrfam_Cation_transp_P_typ_ATPase	p.E20*	ENST00000539276.2	37	c.58	CCDS9144.1	12	.	.	.	.	.	.	.	.	.	.	G	44	10.701271	0.99453	.	.	ENSG00000174437	ENST00000308664;ENST00000395494;ENST00000539276	.	.	.	5.14	3.28	0.37604	.	0.121675	0.64402	D	0.000018	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07644	T	0.81	.	10.1806	0.42965	0.0747:0.1379:0.7874:0.0	.	.	.	.	X	20	.	ENSP00000311186:E20X	E	+	1	0	ATP2A2	109204035	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.380000	0.79704	1.151000	0.42436	0.561000	0.74099	GAG	-	pfam_ATPase_P-typ_cation-transptr_N,smart_ATPase_P-typ_cation-transptr_N		0.706	ATP2A2-003	KNOWN	basic|CCDS	protein_coding	ATP2A2	protein_coding	OTTHUMT00000403539.1	G	NM_001681	-		110719652	+1	no_errors	ENST00000539276	ensembl	human	known	74_37	nonsense	SNP	1.000	T
CAMKK2	10645	genome.wustl.edu	37	12	121698198	121698198	+	Intron	SNP	G	G	T	rs200694005	byFrequency	TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr12:121698198G>T	ENST00000324774.5	-	7	1588				CAMKK2_ENST00000392473.2_Intron|CAMKK2_ENST00000446440.2_Intron|CAMKK2_ENST00000538733.1_Intron|CAMKK2_ENST00000337174.3_Intron|CAMKK2_ENST00000347034.2_Intron|CAMKK2_ENST00000545538.1_Silent_p.P27P|CAMKK2_ENST00000404169.3_Intron|CAMKK2_ENST00000412367.2_Intron|CAMKK2_ENST00000392474.2_Intron|CAMKK2_ENST00000402834.4_Intron|CAMKK2_ENST00000535524.1_Intron	NM_006549.3	NP_006540.3	Q96RR4	KKCC2_HUMAN	calcium/calmodulin-dependent protein kinase kinase 2, beta						calcium-mediated signaling (GO:0019722)|MAPK cascade (GO:0000165)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of protein kinase activity (GO:0045859)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|protein tyrosine kinase activity (GO:0004713)			endometrium(2)|kidney(1)|large_intestine(2)|liver(2)|lung(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	17	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					GACGGATGGCGGGGGAGAAAA	0.552																																																	0								ENSG00000110931																																			CAMKK2	SO:0001627	intron_variant	0			-	HGNC	AF101264	CCDS9216.1, CCDS9217.1, CCDS9218.1, CCDS9219.1, CCDS44999.1, CCDS53837.1, CCDS58283.1	12q24.2	2002-08-13				ENSG00000110931			1470	protein-coding gene	gene with protein product		615002				9662074	Standard	NM_172226		Approved	CAMKK, KIAA0787, CAMKKB, MGC15254	uc001tzu.3	Q96RR4		ENST00000324774.5:c.760-40C>A	12.37:g.121698198G>T		Somatic	0	52	0.00		0.5558904216091591	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	61	15.28	A8K7Q7|O94883|Q8IUG2|Q8IUG3|Q8N3I4|Q8WY03|Q8WY04|Q8WY05|Q8WY06|Q96RP1|Q96RP2|Q96RR3|Q9BWE9|Q9UER3|Q9UES2|Q9Y5N2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.P27	ENST00000324774.5	37	c.81	CCDS9216.1	12																																																																																			-	smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_dom		0.552	CAMKK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CAMKK2	protein_coding	OTTHUMT00000402563.1	G	NM_172226	-		121698198	-1	no_errors	ENST00000545538	ensembl	human	putative	74_37	silent	SNP	0.006	T
FAM159A	348378	genome.wustl.edu	37	1	53099179	53099179	+	Missense_Mutation	SNP	G	G	C			TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr1:53099179G>C	ENST00000517870.1	+	1	164	c.14G>C	c.(13-15)tGc>tCc	p.C5S	FAM159A_ENST00000401050.3_3'UTR	NM_001042693.1	NP_001036158.1	Q6UWV7	F159A_HUMAN	family with sequence similarity 159, member A	5						integral component of membrane (GO:0016021)				endometrium(3)|lung(6)|upper_aerodigestive_tract(1)	10						AGCGGCGCCTGCACGAGCTAC	0.771																																																	0								ENSG00000182183						6.0	7.0	6.0					1																	53099179		1811	3938	5749	FAM159A	SO:0001583	missense	0			-	HGNC		CCDS41336.1	1p32.3	2008-08-08			ENSG00000182183	ENSG00000182183			28757	protein-coding gene	gene with protein product						12477932	Standard	NM_001042693		Approved	MGC52498	uc001cuf.3	Q6UWV7	OTTHUMG00000008330	ENST00000517870.1:c.14G>C	1.37:g.53099179G>C	ENSP00000429726:p.Cys5Ser	Somatic	0	13	0.00		0.5558904216091591	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	3	70.00	Q6ZRG4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.C5S	ENST00000517870.1	37	c.14	CCDS41336.1	1	.	.	.	.	.	.	.	.	.	.	G	26.6	4.756636	0.89843	.	.	ENSG00000182183	ENST00000517870	.	.	.	3.44	3.44	0.39384	.	0.000000	0.64402	U	0.000003	T	0.75317	0.3833	L	0.59436	1.845	0.46203	D	0.998924	D	0.76494	0.999	D	0.83275	0.996	T	0.79736	-0.1678	9	0.87932	D	0	.	15.773	0.78187	0.0:0.0:1.0:0.0	.	5	Q6UWV7	F159A_HUMAN	S	5	.	ENSP00000429726:C5S	C	+	2	0	FAM159A	52871767	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.602000	0.90868	1.860000	0.53959	0.455000	0.32223	TGC	-	NULL		0.771	FAM159A-004	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM159A	protein_coding	OTTHUMT00000022934.2	G	NM_001042693	-		53099179	+1	no_errors	ENST00000517870	ensembl	human	known	74_37	missense	SNP	1.000	C
UXT	8409	genome.wustl.edu	37	X	47516703	47516703	+	Intron	SNP	G	G	T			TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chrX:47516703G>T	ENST00000333119.3	-	5	304				UXT_ENST00000335890.2_Intron|RP1-212G6.7_ENST00000590504.1_RNA|RP1-212G6.7_ENST00000591832.1_RNA|UXT_ENST00000460840.1_5'UTR	NM_004182.3	NP_004173.1	Q9UBK9	UXT_HUMAN	ubiquitously-expressed, prefoldin-like chaperone						centrosome organization (GO:0051297)|microtubule cytoskeleton organization (GO:0000226)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein folding (GO:0006457)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)|prefoldin complex (GO:0016272)	beta-tubulin binding (GO:0048487)|chromatin binding (GO:0003682)|microtubule binding (GO:0008017)|RNA polymerase II transcription corepressor activity (GO:0001106)			central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(1)	6						AGGAAAGAGAGGTTAGAGGAA	0.478																																																	0								ENSG00000126756						47.0	36.0	40.0					X																	47516703		2203	4298	6501	UXT	SO:0001627	intron_variant	0			-	HGNC	AF092737	CCDS14284.1, CCDS14285.1	Xp11.23-p11.22	2011-11-21	2011-11-21		ENSG00000126756	ENSG00000126756			12641	protein-coding gene	gene with protein product	"""androgen receptor trapped clone 27"", ""SKP2-associated alpha PFD 1"""	300234	"""ubiquitously-expressed transcript"""			10087202, 16221885	Standard	NM_004182		Approved	ART-27, STAP1	uc004dim.3	Q9UBK9	OTTHUMG00000021453	ENST00000333119.3:c.249-14C>A	X.37:g.47516703G>T		Somatic	0	22	0.00		0.5558904216091591	10	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	8	27.27	B2R561|Q5JZG3|Q9Y6E5	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000333119.3	37	NULL	CCDS14285.1	X																																																																																			-	-		0.478	UXT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UXT	protein_coding	OTTHUMT00000056440.1	G	NM_153477	-		47516703	-1	no_errors	ENST00000460840	ensembl	human	known	74_37	rna	SNP	0.001	T
DIP2A	23181	genome.wustl.edu	37	21	47966879	47966879	+	Missense_Mutation	SNP	G	G	T			TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr21:47966879G>T	ENST00000417564.2	+	21	2467	c.2446G>T	c.(2446-2448)Gtt>Ttt	p.V816F	DIP2A_ENST00000427143.2_Missense_Mutation_p.V752F|DIP2A_ENST00000435722.3_Missense_Mutation_p.V816F|DIP2A_ENST00000466639.1_Missense_Mutation_p.V773F|DIP2A_ENST00000400274.1_Missense_Mutation_p.V812F|DIP2A_ENST00000318711.7_Missense_Mutation_p.V817F|DIP2A_ENST00000457905.3_Missense_Mutation_p.V816F			Q14689	DIP2A_HUMAN	DIP2 disco-interacting protein 2 homolog A (Drosophila)	816					multicellular organismal development (GO:0007275)|negative regulation of gene expression (GO:0010629)|regulation of apoptotic process (GO:0042981)	cell surface (GO:0009986)|nucleus (GO:0005634)	catalytic activity (GO:0003824)			cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(22)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Breast(49;0.0933)			Epithelial(3;3.12e-06)|OV - Ovarian serous cystadenocarcinoma(3;5.68e-06)|all cancers(3;4.08e-05)|Colorectal(79;0.0129)|COAD - Colon adenocarcinoma(84;0.0824)		GGTCACTGGAGTTCGCAGACA	0.602																																																	0								ENSG00000160305						80.0	88.0	86.0					21																	47966879		2155	4272	6427	DIP2A	SO:0001583	missense	0			-	HGNC	AF490768	CCDS46655.1, CCDS46656.1, CCDS46657.1, CCDS54490.1, CCDS54491.1	21q22.3	2010-08-20	2006-01-13	2006-01-13	ENSG00000160305	ENSG00000160305			17217	protein-coding gene	gene with protein product		607711	"""chromosome 21 open reading frame 106"""	C21orf106			Standard	NM_015151		Approved	Dip2, KIAA0184	uc002zjo.2	Q14689	OTTHUMG00000090717	ENST00000417564.2:c.2446G>T	21.37:g.47966879G>T	ENSP00000392066:p.Val816Phe	Somatic	0	79	0.00		0.5558904216091591	38	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	A6P4T3|B4E0F0|E7EMA5|Q8IVA3|Q8N4S2|Q8TD89|Q96ML9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_AMP-dep_Synth/Lig,pfam_DMAP1-bd	p.V817F	ENST00000417564.2	37	c.2449	CCDS46655.1	21	.	.	.	.	.	.	.	.	.	.	G	8.883	0.952212	0.18431	.	.	ENSG00000160305	ENST00000400274;ENST00000427143;ENST00000318711;ENST00000358985;ENST00000457905;ENST00000466639;ENST00000435722;ENST00000417564	T;T;T;T;T;T;T	0.10477	2.87;2.87;2.87;2.87;2.87;2.87;2.87	4.58	-2.33	0.06724	.	0.549672	0.17026	N	0.189907	T	0.04497	0.0123	N	0.14661	0.345	0.09310	N	1	B;B;B;B;B;B	0.06786	0.0;0.0;0.001;0.0;0.0;0.0	B;B;B;B;B;B	0.10450	0.003;0.001;0.004;0.005;0.003;0.003	T	0.29912	-0.9996	10	0.59425	D	0.04	-0.2178	1.547	0.02567	0.2228:0.1173:0.4203:0.2397	.	817;752;773;752;816;816	E9PER1;E7EMA5;Q14689-3;B4E0F0;Q14689;Q14689-4	.;.;.;.;DIP2A_HUMAN;.	F	812;752;817;773;816;773;816;816	ENSP00000383133:V812F;ENSP00000400528:V752F;ENSP00000323633:V817F;ENSP00000393434:V816F;ENSP00000430249:V773F;ENSP00000415089:V816F;ENSP00000392066:V816F	ENSP00000323633:V817F	V	+	1	0	DIP2A	46791307	0.873000	0.30073	0.000000	0.03702	0.349000	0.29174	2.592000	0.46171	-0.115000	0.11915	-0.229000	0.12294	GTT	-	NULL		0.602	DIP2A-012	KNOWN	basic|CCDS	protein_coding	DIP2A	protein_coding	OTTHUMT00000376736.1	G	NM_015151	-		47966879	+1	no_errors	ENST00000318711	ensembl	human	known	74_37	missense	SNP	0.025	T
ABCE1	6059	genome.wustl.edu	37	4	146048725	146048725	+	Nonstop_Mutation	SNP	G	G	T			TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr4:146048725G>T	ENST00000296577.4	+	18	2315	c.1800G>T	c.(1798-1800)taG>taT	p.*600Y	OTUD4_ENST00000455611.2_Intron	NM_001040876.1|NM_002940.2	NP_001035809.1|NP_002931.2	P61221	ABCE1_HUMAN	ATP-binding cassette, sub-family E (OABP), member 1	0					negative regulation of catalytic activity (GO:0043086)|response to virus (GO:0009615)|RNA catabolic process (GO:0006401)|viral process (GO:0016032)	cytoplasm (GO:0005737)|membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|iron-sulfur cluster binding (GO:0051536)|ribonuclease inhibitor activity (GO:0008428)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|lung(5)|prostate(2)|skin(3)	18	all_hematologic(180;0.151)					TGGATGATTAGACTGACTCTG	0.313																																																	0								ENSG00000164163						102.0	106.0	104.0					4																	146048725		2203	4300	6503	ABCE1	SO:0001578	stop_lost	0			-	HGNC	X74987	CCDS34071.1	4q31	2012-03-14			ENSG00000164163	ENSG00000164163		"""ATP binding cassette transporters / subfamily E"""	69	protein-coding gene	gene with protein product		601213		RNASEL1, RNASELI, RNS4I		7539425	Standard	NM_002940		Approved	RLI, OABP	uc003ijy.3	P61221	OTTHUMG00000161478	ENST00000296577.4:c.1800G>T	4.37:g.146048725G>T	ENSP00000296577:p.*600Tyrext*17	Somatic	0	69	0.00		0.5558904216091591	108	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	41	8.89	O88793|Q13181|Q13864|Q6NR76|Q96AL0|Q96B10|Q99K66	Nonstop_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ABC_transporter-like,pfam_RNaseL-inhib_metal-bd_dom,pfam_4Fe4S-bd_dom,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like,prints_ABC_E	p.*600Y	ENST00000296577.4	37	c.1800	CCDS34071.1	4	.	.	.	.	.	.	.	.	.	.	G	19.41	3.821536	0.71028	.	.	ENSG00000164163	ENST00000296577	.	.	.	5.24	2.07	0.26955	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	5.3715	0.16142	0.5599:0.0:0.4401:0.0	.	.	.	.	Y	600	.	.	X	+	3	2	ABCE1	146268175	0.983000	0.35010	0.997000	0.53966	0.794000	0.44872	1.399000	0.34566	0.721000	0.32231	0.650000	0.86243	TAG	-	NULL		0.313	ABCE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCE1	protein_coding	OTTHUMT00000365104.1	G	NM_002940	-		146048725	+1	no_errors	ENST00000296577	ensembl	human	known	74_37	nonstop	SNP	1.000	T
PCDHA1	56147	genome.wustl.edu	37	5	140167900	140167900	+	Silent	SNP	G	G	A	rs143057294	byFrequency	TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr5:140167900G>A	ENST00000504120.2	+	1	2025	c.2025G>A	c.(2023-2025)gcG>gcA	p.A675A	PCDHA1_ENST00000394633.3_Intron|PCDHA1_ENST00000378133.3_Silent_p.A675A	NM_018900.2	NP_061723.1	Q9Y5I3	PCDA1_HUMAN	protocadherin alpha 1	675	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(3)|kidney(2)|large_intestine(13)|lung(34)|prostate(3)|skin(4)|upper_aerodigestive_tract(5)|urinary_tract(3)	70			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCGGCCAGGCGCCAAAGGCGT	0.657																																																	0								ENSG00000204970	G	,,	2,4400	4.2+/-10.8	0,2,2199	40.0	46.0	44.0		2025,2025,	-6.1	0.0	5	dbSNP_134	44	0,8598		0,0,4299	no	coding-synonymous,coding-synonymous,intron	PCDHA1	NM_018900.2,NM_031410.1,NM_031411.1	,,	0,2,6498	AA,AG,GG		0.0,0.0454,0.0154	,,	675/951,675/808,	140167900	2,12998	2201	4299	6500	PCDHA1	SO:0001819	synonymous_variant	0			-	HGNC	AF152479	CCDS54912.1, CCDS54913.1	5q31	2010-11-26				ENSG00000204970		"""Cadherins / Protocadherins : Clustered"""	8663	other	complex locus constituent	"""KIAA0345-like 13"""	606307				10380929	Standard	NM_018900		Approved			Q9Y5I3		ENST00000504120.2:c.2025G>A	5.37:g.140167900G>A		Somatic	0	61	0.00		0.5558904216091591	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	23	43.90	O75288|Q9NRT7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.A675	ENST00000504120.2	37	c.2025	CCDS54913.1	5																																																																																			-	smart_Cadherin,pfscan_Cadherin		0.657	PCDHA1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDHA1	protein_coding	OTTHUMT00000389127.1	G	NM_018900	rs143057294		140167900	+1	no_errors	ENST00000504120	ensembl	human	known	74_37	silent	SNP	0.004	A
IDS	3423	genome.wustl.edu	37	X	148568507	148568507	+	Missense_Mutation	SNP	G	G	T			TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chrX:148568507G>T	ENST00000340855.6	-	8	1338	c.1129C>A	c.(1129-1131)Ctt>Att	p.L377I	IDS_ENST00000541269.1_Missense_Mutation_p.L166I|IDS_ENST00000422081.2_Missense_Mutation_p.L166I|IDS_ENST00000537071.1_Intron|IDS_ENST00000490775.1_5'Flank	NM_000202.5|NM_001166550.1	NP_000193.1|NP_001160022.1	P22304	IDS_HUMAN	iduronate 2-sulfatase	377					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	lysosomal lumen (GO:0043202)	iduronate-2-sulfatase activity (GO:0004423)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(5)|large_intestine(2)|lung(8)|prostate(1)	20	Acute lymphoblastic leukemia(192;6.56e-05)|Colorectal(9;0.0662)					TAAGGGAAAAGCTTCTCGCCT	0.453																																																	0								ENSG00000010404						86.0	79.0	81.0					X																	148568507		2203	4300	6503	IDS	SO:0001583	missense	0			-	HGNC	M58342	CCDS14685.1, CCDS14686.1	Xq27.3-q28	2012-10-02	2008-08-01		ENSG00000010404	ENSG00000010404	3.1.6.13		5389	protein-coding gene	gene with protein product	"""Hunter syndrome"""	300823		SIDS			Standard	NM_006123		Approved		uc011mxe.2	P22304	OTTHUMG00000022615	ENST00000340855.6:c.1129C>A	X.37:g.148568507G>T	ENSP00000339801:p.Leu377Ile	Somatic	0	33	0.00		0.5558904216091591	278	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	31	11.43	D3DWT4|Q14604|Q9BRM3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Sulfatase,pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core	p.L377I	ENST00000340855.6	37	c.1129	CCDS14685.1	X	.	.	.	.	.	.	.	.	.	.	g	7.359	0.624429	0.14193	.	.	ENSG00000010404	ENST00000340855;ENST00000541269	D;D	0.99462	-5.72;-5.94	5.27	2.57	0.30868	Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.485593	0.23083	N	0.052124	D	0.96430	0.8835	N	0.16478	0.41	0.80722	D	1	B;B	0.17038	0.007;0.02	B;B	0.20384	0.007;0.029	D	0.91708	0.5379	10	0.21540	T	0.41	.	5.3212	0.15881	0.27:0.1987:0.5313:0.0	.	287;377	B4DGD7;P22304	.;IDS_HUMAN	I	377;166	ENSP00000339801:L377I;ENSP00000441261:L166I	ENSP00000339801:L377I	L	-	1	0	IDS	148376412	0.032000	0.19561	0.886000	0.34754	0.151000	0.21798	0.288000	0.18939	0.194000	0.20326	0.525000	0.51046	CTT	-	pfam_Sulfatase,superfamily_Alkaline_phosphatase_core		0.453	IDS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IDS	protein_coding	OTTHUMT00000058677.3	G		-		148568507	-1	no_errors	ENST00000340855	ensembl	human	known	74_37	missense	SNP	0.990	T
ABCB1	5243	genome.wustl.edu	37	7	87175223	87175223	+	Missense_Mutation	SNP	G	G	T			TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr7:87175223G>T	ENST00000265724.3	-	16	2260	c.1843C>A	c.(1843-1845)Ctc>Atc	p.L615I	ABCB1_ENST00000543898.1_Missense_Mutation_p.L551I	NM_000927.4	NP_000918.2	P08183	MDR1_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 1	615	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				drug transmembrane transport (GO:0006855)|G2/M transition of mitotic cell cycle (GO:0000086)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|stem cell proliferation (GO:0072089)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)|xenobiotic-transporting ATPase activity (GO:0008559)			NS(1)|breast(6)|central_nervous_system(2)|endometrium(14)|kidney(9)|large_intestine(14)|lung(48)|ovary(4)|prostate(6)|skin(6)|upper_aerodigestive_tract(1)	111	Esophageal squamous(14;0.00164)				Acebutolol(DB01193)|Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Adenosine triphosphate(DB00171)|ado-trastuzumab emtansine(DB05773)|Afatinib(DB08916)|Albendazole(DB00518)|Alfentanil(DB00802)|Alitretinoin(DB00523)|Amantadine(DB00915)|Aminohippurate(DB00345)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amlodipine(DB00381)|Amprenavir(DB00701)|Amsacrine(DB00276)|Apixaban(DB06605)|Arsenic trioxide(DB01169)|Astemizole(DB00637)|Atazanavir(DB01072)|Atenolol(DB00335)|Atorvastatin(DB01076)|Axitinib(DB06626)|Azelastine(DB00972)|Azithromycin(DB00207)|Benzocaine(DB01086)|Bepridil(DB01244)|Betamethasone(DB00443)|Biperiden(DB00810)|Boceprevir(DB08873)|Bosutinib(DB06616)|Brentuximab vedotin(DB08870)|Bromocriptine(DB01200)|Buprenorphine(DB00921)|Buspirone(DB00490)|Cabazitaxel(DB06772)|Caffeine(DB00201)|Canagliflozin(DB08907)|Candesartan(DB00796)|Captopril(DB01197)|Carbamazepine(DB00564)|Carfilzomib(DB08889)|Carvedilol(DB01136)|Caspofungin(DB00520)|Chloroquine(DB00608)|Chlorpromazine(DB00477)|Chlorpropamide(DB00672)|Chlorprothixene(DB01239)|Cilazapril(DB01340)|Cimetidine(DB00501)|Ciprofloxacin(DB00537)|Cisplatin(DB00515)|Citalopram(DB00215)|Clarithromycin(DB01211)|Clobazam(DB00349)|Clofazimine(DB00845)|Clomifene(DB00882)|Clomipramine(DB01242)|Clonidine(DB00575)|Clopidogrel(DB00758)|Clotrimazole(DB00257)|Clozapine(DB00363)|Colchicine(DB01394)|Conjugated Estrogens(DB00286)|Crizotinib(DB08865)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dabigatran etexilate(DB06695)|Dabrafenib(DB08912)|Dactinomycin(DB00970)|Dapagliflozin(DB06292)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Debrisoquin(DB04840)|Desipramine(DB01151)|Desloratadine(DB00967)|Dexamethasone(DB01234)|Dextromethorphan(DB00514)|Diazepam(DB00829)|Diclofenac(DB00586)|Diethylstilbestrol(DB00255)|Digitoxin(DB01396)|Digoxin(DB00390)|Dihydroergotamine(DB00320)|Diltiazem(DB00343)|Dipyridamole(DB00975)|Docetaxel(DB01248)|Domperidone(DB01184)|Doxazosin(DB00590)|Doxepin(DB01142)|Doxorubicin(DB00997)|Dronabinol(DB00470)|Dronedarone(DB04855)|Eletriptan(DB00216)|Enalapril(DB00584)|Enzalutamide(DB08899)|Epinastine(DB00751)|Ergonovine(DB01253)|Ergotamine(DB00696)|Erlotinib(DB00530)|Erythromycin(DB00199)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estrone(DB00655)|Ethinyl Estradiol(DB00977)|Etoposide(DB00773)|Etravirine(DB06414)|Ezetimibe(DB00973)|Felodipine(DB01023)|Fentanyl(DB00813)|Fesoterodine(DB06702)|Fexofenadine(DB00950)|Fidaxomicin(DB08874)|Fluconazole(DB00196)|Fluoxetine(DB00472)|Flupentixol(DB00875)|Fluphenazine(DB00623)|Flurazepam(DB00690)|Fluticasone furoate(DB08906)|Fluvoxamine(DB00176)|Gefitinib(DB00317)|Gemcitabine(DB00441)|Glyburide(DB01016)|Gramicidin D(DB00027)|Haloperidol(DB00502)|Hydrocortisone(DB00741)|Ibuprofen(DB01050)|Imatinib(DB00619)|Imipramine(DB00458)|Indacaterol(DB05039)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Itraconazole(DB01167)|Ivacaftor(DB08820)|Ivermectin(DB00602)|Ketamine(DB01221)|Ketazolam(DB01587)|Ketoconazole(DB01026)|Lamivudine(DB00709)|Lamotrigine(DB00555)|Lansoprazole(DB00448)|Lapatinib(DB01259)|Lenalidomide(DB00480)|Levetiracetam(DB01202)|Levofloxacin(DB01137)|Levomilnacipran(DB08918)|Levothyroxine(DB00451)|Lidocaine(DB00281)|Linagliptin(DB08882)|Liothyronine(DB00279)|Liotrix(DB01583)|Lisinopril(DB00722)|Lomitapide(DB08827)|Loperamide(DB00836)|Lopinavir(DB01601)|Loratadine(DB00455)|Losartan(DB00678)|Lovastatin(DB00227)|Mannitol(DB00742)|Maprotiline(DB00934)|Mebendazole(DB00643)|Mefloquine(DB00358)|Megestrol acetate(DB00351)|Meprobamate(DB00371)|Methadone(DB00333)|Methotrexate(DB00563)|Methylprednisolone(DB00959)|Metoprolol(DB00264)|Miconazole(DB01110)|Midazolam(DB00683)|Mifepristone(DB00834)|Mirabegron(DB08893)|Mitomycin(DB00305)|Mitoxantrone(DB01204)|Morphine(DB00295)|Mycophenolate mofetil(DB00688)|Nadolol(DB01203)|Naloxone(DB01183)|Naltrexone(DB00704)|Nefazodone(DB01149)|Nelfinavir(DB00220)|Neostigmine(DB01400)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilotinib(DB04868)|Nisoldipine(DB00401)|Nitrazepam(DB01595)|Nitrendipine(DB01054)|Nizatidine(DB00585)|Norethindrone(DB00717)|Olanzapine(DB00334)|Omeprazole(DB00338)|Paclitaxel(DB01229)|Pantoprazole(DB00213)|Paroxetine(DB00715)|Pazopanib(DB06589)|Perindopril(DB00790)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pimozide(DB01100)|Pitavastatin(DB08860)|Pomalidomide(DB08910)|Ponatinib(DB08901)|Posaconazole(DB01263)|Pravastatin(DB00175)|Prazosin(DB00457)|Prednisolone(DB00860)|Prednisone(DB00635)|Probenecid(DB01032)|Progesterone(DB00396)|Promethazine(DB01069)|Propafenone(DB01182)|Propranolol(DB00571)|Protriptyline(DB00344)|Quetiapine(DB01224)|Quinacrine(DB01103)|Quinidine(DB00908)|Quinine(DB00468)|Ranitidine(DB00863)|Reboxetine(DB00234)|Regorafenib(DB08896)|Reserpine(DB00206)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Risperidone(DB00734)|Ritonavir(DB00503)|Rivaroxaban(DB06228)|Roxithromycin(DB00778)|Salicylic acid(DB00936)|Saquinavir(DB01232)|Scopolamine(DB00747)|Selegiline(DB01037)|Sertraline(DB01104)|Silodosin(DB06207)|SIMEPREVIR(DB06290)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sitagliptin(DB01261)|SOFOSBUVIR(DB08934)|Sorafenib(DB00398)|Sparfloxacin(DB01208)|Spironolactone(DB00421)|Streptozocin(DB00428)|Sulfinpyrazone(DB01138)|Sumatriptan(DB00669)|Sunitinib(DB01268)|Tacrolimus(DB00864)|Tamoxifen(DB00675)|Telaprevir(DB05521)|Telmisartan(DB00966)|Temsirolimus(DB06287)|Terazosin(DB01162)|Testosterone(DB00624)|Ticagrelor(DB08816)|Timolol(DB00373)|Tolvaptan(DB06212)|Topotecan(DB01030)|Toremifene(DB00539)|Trazodone(DB00656)|Trifluoperazine(DB00831)|Triflupromazine(DB00508)|Trimethoprim(DB00440)|Trimipramine(DB00726)|Troleandomycin(DB01361)|Vecuronium(DB01339)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)|Vinorelbine(DB00361)|Vismodegib(DB08828)|Voacamine(DB04877)|Zidovudine(DB00495)	TCTTTCATGAGTTCATCATGA	0.383																																																	0								ENSG00000085563						158.0	128.0	138.0					7																	87175223		2203	4300	6503	ABCB1	SO:0001583	missense	0			-	HGNC	M14758	CCDS5608.1	7q21.12	2012-03-14	2004-05-12		ENSG00000085563	ENSG00000085563		"""CD molecules"", ""ATP binding cassette transporters / subfamily B"""	40	protein-coding gene	gene with protein product	"""multidrug resistance protein 1"""	171050	"""colchicin sensitivity"""	PGY1, MDR1, CLCS		3027054	Standard	NM_000927		Approved	P-gp, CD243, GP170, ABC20	uc003uiz.2	P08183	OTTHUMG00000023393	ENST00000265724.3:c.1843C>A	7.37:g.87175223G>T	ENSP00000265724:p.Leu615Ile	Somatic	0	31	0.00		0.5558904216091591	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	A8K294|B5AK60|Q12755|Q14812	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,pfam_ABC_ATPase_put,superfamily_P-loop_NTPase,superfamily_ABC1_TM_dom,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom	p.L615I	ENST00000265724.3	37	c.1843	CCDS5608.1	7	.	.	.	.	.	.	.	.	.	.	G	24.5	4.541284	0.85917	.	.	ENSG00000085563	ENST00000543174;ENST00000265724;ENST00000543898	D;D	0.95035	-3.59;-3.59	5.86	4.97	0.65823	ABC transporter-like (1);	0.000000	0.85682	D	0.000000	D	0.96682	0.8917	M	0.75150	2.29	0.80722	D	1	D;D	0.76494	0.999;0.996	D;D	0.72625	0.978;0.971	D	0.96462	0.9342	10	0.87932	D	0	-15.6955	14.2928	0.66292	0.1196:0.0:0.8804:0.0	.	551;615	B5AK60;P08183	.;MDR1_HUMAN	I	396;615;551	ENSP00000265724:L615I;ENSP00000444095:L551I	ENSP00000265724:L615I	L	-	1	0	ABCB1	87013159	1.000000	0.71417	0.973000	0.42090	0.817000	0.46193	4.743000	0.62110	2.937000	0.99478	0.650000	0.86243	CTC	-	pfscan_ABC_transporter-like		0.383	ABCB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCB1	protein_coding	OTTHUMT00000335444.2	G	NM_000927	-		87175223	-1	no_errors	ENST00000265724	ensembl	human	known	74_37	missense	SNP	1.000	T
C2CD2L	9854	genome.wustl.edu	37	11	118984690	118984690	+	Missense_Mutation	SNP	G	G	T			TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr11:118984690G>T	ENST00000528586.1	+	8	929	c.859G>T	c.(859-861)Gtt>Ttt	p.V287F	C2CD2L_ENST00000336702.3_Missense_Mutation_p.V540F			O14523	C2C2L_HUMAN	C2CD2-like	539						integral component of membrane (GO:0016021)				NS(1)|endometrium(1)|large_intestine(2)|lung(8)|prostate(1)	13						CATCTCTGGTGTTTCCAAGGT	0.602																																																	0								ENSG00000172375						58.0	58.0	58.0					11																	118984690		2200	4295	6495	C2CD2L	SO:0001583	missense	0			-	HGNC	AK025223	CCDS8413.1	11q23.3	2008-04-22	2008-04-22	2008-04-22		ENSG00000172375			29000	protein-coding gene	gene with protein product			"""transmembrane protein 24"""	TMEM24		15289880	Standard	XM_005271738		Approved	KIAA0285	uc001pvn.3	O14523		ENST00000528586.1:c.859G>T	11.37:g.118984690G>T	ENSP00000433600:p.Val287Phe	Somatic	0	52	0.00		0.5558904216091591	16	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	18	14.29	Q86UT7|Q86V04|Q8N522|Q8TBN4|Q96G10	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_C2_dom	p.V540F	ENST00000528586.1	37	c.1618		11	.	.	.	.	.	.	.	.	.	.	G	22.4	4.283751	0.80803	.	.	ENSG00000172375	ENST00000336702;ENST00000528586	T;T	0.78246	-1.16;-1.16	5.25	4.33	0.51752	.	0.000000	0.85682	D	0.000000	D	0.85388	0.5685	L	0.60455	1.87	0.58432	D	0.999993	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.86968	0.2096	10	0.87932	D	0	-5.0121	14.3075	0.66393	0.0:0.0:0.8504:0.1496	.	539;540	O14523;O14523-2	C2C2L_HUMAN;.	F	540;287	ENSP00000338885:V540F;ENSP00000433600:V287F	ENSP00000338885:V540F	V	+	1	0	C2CD2L	118489900	1.000000	0.71417	0.925000	0.36789	0.994000	0.84299	5.993000	0.70616	1.402000	0.46780	0.655000	0.94253	GTT	-	NULL		0.602	C2CD2L-003	PUTATIVE	basic|exp_conf	protein_coding	C2CD2L	protein_coding	OTTHUMT00000388199.2	G	NM_014807	-		118984690	+1	no_errors	ENST00000336702	ensembl	human	known	74_37	missense	SNP	0.998	T
UBE2V1	7335	genome.wustl.edu	37	20	48698944	48698944	+	3'UTR	SNP	G	G	T			TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr20:48698944G>T	ENST00000371674.3	-	0	849				UBE2V1_ENST00000371657.5_3'UTR|UBE2V1_ENST00000371677.3_3'UTR|UBE2V1_ENST00000396059.3_5'UTR|UBE2V1_ENST00000340309.3_3'UTR|TMEM189-UBE2V1_ENST00000341698.2_3'UTR|UBE2V1_ENST00000415862.2_3'UTR|UBE2V1_ENST00000420027.2_3'UTR|TMEM189_ENST00000557021.1_3'UTR	NM_001032288.2|NM_001257395.1	NP_001027459.1|NP_001244324.1	Q13404	UB2V1_HUMAN	ubiquitin-conjugating enzyme E2 variant 1						cell differentiation (GO:0030154)|error-free postreplication DNA repair (GO:0042275)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription, DNA-templated (GO:0045893)|protein K63-linked ubiquitination (GO:0070534)|protein polyubiquitination (GO:0000209)|regulation of DNA repair (GO:0006282)|regulation of transcription, DNA-templated (GO:0006355)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|protein complex (GO:0043234)|UBC13-UEV1A complex (GO:0035370)|ubiquitin conjugating enzyme complex (GO:0031371)|ubiquitin ligase complex (GO:0000151)	acid-amino acid ligase activity (GO:0016881)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(2)|large_intestine(3)|lung(4)	9			BRCA - Breast invasive adenocarcinoma(9;4.74e-06)			AGAGACCCCAGGCCGTGTAAT	0.507																																																	0								ENSG00000244687																																			UBE2V1	SO:0001624	3_prime_UTR_variant	0			-	HGNC	U39360	CCDS13426.1, CCDS13427.1, CCDS33483.1, CCDS58775.1, CCDS74740.1	20q13.2	2007-07-18			ENSG00000244687	ENSG00000244687		"""Ubiquitin-conjugating enzymes E2"""	12494	protein-coding gene	gene with protein product		602995		UBE2V		9418904, 9305758	Standard	NM_001032288		Approved	UEV-1, CROC-1, UEV1A, CROC1		Q13404	OTTHUMG00000152626	ENST00000371674.3:c.*361C>A	20.37:g.48698944G>T		Somatic	0	50	0.00		0.5558904216091591	212	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	40	9.09	E1P629|Q13403|Q13532|Q5TGE0|Q5TGE3|Q96H34|Q9GZT0|Q9GZW1|Q9H4J3|Q9H4J4|Q9UKL1|Q9UM48|Q9UM49|Q9UM50	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000371674.3	37	NULL	CCDS33483.1	20																																																																																			-	-		0.507	UBE2V1-004	KNOWN	basic|CCDS	protein_coding	UBE2V1	protein_coding	OTTHUMT00000080530.1	G	NM_021988	-		48698944	-1	no_errors	ENST00000396059	ensembl	human	known	74_37	rna	SNP	1.000	T
TPP1	1200	genome.wustl.edu	37	11	6637860	6637860	+	Intron	SNP	C	C	A			TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr11:6637860C>A	ENST00000299427.6	-	7	947				TPP1_ENST00000534644.1_5'Flank|RP11-732A19.9_ENST00000545572.1_RNA|TPP1_ENST00000533371.1_Intron	NM_000391.3	NP_000382.3	P49638	TTPA_HUMAN	tripeptidyl peptidase I						embryonic placenta development (GO:0001892)|intermembrane transport (GO:0046909)|intracellular pH reduction (GO:0051452)|lipid metabolic process (GO:0006629)|negative regulation of cell death (GO:0060548)|negative regulation of establishment of blood-brain barrier (GO:0090212)|response to nutrient (GO:0007584)|response to pH (GO:0009268)|response to toxic substance (GO:0009636)|transport (GO:0006810)|vitamin E metabolic process (GO:0042360)|vitamin transport (GO:0051180)	cytosol (GO:0005829)|late endosome (GO:0005770)	phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|transporter activity (GO:0005215)|vitamin E binding (GO:0008431)			breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(9)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;3.45e-09)|BRCA - Breast invasive adenocarcinoma(625;0.131)	Vitamin E(DB00163)	TCTCCCACCCCCTTCCCCACT	0.552																																																	0								ENSG00000166340						59.0	58.0	58.0					11																	6637860		2201	4296	6497	TPP1	SO:0001627	intron_variant	0			-	HGNC	AF017456	CCDS7770.1	11p15.4	2014-09-17	2004-12-09	2004-12-10	ENSG00000166340	ENSG00000166340			2073	protein-coding gene	gene with protein product	"""TPP I"""	607998	"""ceroid-lipofuscinosis, neuronal 2, late infantile (Jansky-Bielschowsky disease)"", ""spinocerebellar ataxia, autosomal recessive 7"""	CLN2, SCAR7		9653647, 23418007	Standard	NM_000391		Approved		uc001mel.1	O14773	OTTHUMG00000133404	ENST00000299427.6:c.886+31G>T	11.37:g.6637860C>A		Somatic	0	45	0.00		0.5558904216091591	7	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	9	25.00	Q71V64	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000299427.6	37	NULL	CCDS7770.1	11																																																																																			-	-		0.552	TPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPP1	protein_coding	OTTHUMT00000257261.2	C		-		6637860	-1	no_errors	ENST00000528807	ensembl	human	putative	74_37	rna	SNP	0.000	A
DIP2B	57609	genome.wustl.edu	37	12	51121576	51121576	+	Missense_Mutation	SNP	G	G	A			TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr12:51121576G>A	ENST00000301180.5	+	29	3525	c.3491G>A	c.(3490-3492)gGc>gAc	p.G1164D		NM_173602.2	NP_775873.2	Q9P265	DIP2B_HUMAN	DIP2 disco-interacting protein 2 homolog B (Drosophila)	1164						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(15)|lung(18)|ovary(4)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	60						TCCACAACTGGCATGCTTACA	0.458																																																	0								ENSG00000066084						167.0	160.0	163.0					12																	51121576		2203	4300	6503	DIP2B	SO:0001583	missense	0			-	HGNC	AB040896	CCDS31799.1	12q13.12	2012-10-02	2006-01-13		ENSG00000066084	ENSG00000066084			29284	protein-coding gene	gene with protein product		611379					Standard	XM_005269044		Approved	KIAA1463, FLJ34278	uc001rwv.3	Q9P265	OTTHUMG00000169475	ENST00000301180.5:c.3491G>A	12.37:g.51121576G>A	ENSP00000301180:p.Gly1164Asp	Somatic	0	32	0.00		0.5558904216091591	32	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00	Q6B011|Q8N1L5|Q8NB38	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_AMP-dep_Synth/Lig,pfam_DMAP1-bd	p.G1164D	ENST00000301180.5	37	c.3491	CCDS31799.1	12	.	.	.	.	.	.	.	.	.	.	G	25.9	4.689969	0.88735	.	.	ENSG00000066084	ENST00000301180	T	0.67865	-0.29	4.27	4.27	0.50696	AMP-dependent synthetase/ligase (1);	0.000000	0.85682	D	0.000000	D	0.83166	0.5195	M	0.84082	2.675	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.85933	0.1453	10	0.72032	D	0.01	-13.2736	18.006	0.89209	0.0:0.0:1.0:0.0	.	1164	Q9P265	DIP2B_HUMAN	D	1164	ENSP00000301180:G1164D	ENSP00000301180:G1164D	G	+	2	0	DIP2B	49407843	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.601000	0.98297	2.668000	0.90789	0.655000	0.94253	GGC	-	pfam_AMP-dep_Synth/Lig		0.458	DIP2B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DIP2B	protein_coding	OTTHUMT00000404243.1	G	NM_173602	-		51121576	+1	no_errors	ENST00000301180	ensembl	human	known	74_37	missense	SNP	1.000	A
ZNF81	347344	genome.wustl.edu	37	X	47775688	47775688	+	Missense_Mutation	SNP	A	A	C			TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chrX:47775688A>C	ENST00000376954.1	+	6	2011	c.1643A>C	c.(1642-1644)cAc>cCc	p.H548P	ZNF81_ENST00000338637.7_Missense_Mutation_p.H548P			P51508	ZNF81_HUMAN	zinc finger protein 81	548					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|large_intestine(1)|lung(1)|skin(1)	4		all_lung(315;0.0973)				CAGACCATTCACACTGGAGAG	0.433																																																	0								ENSG00000197779						60.0	59.0	59.0					X																	47775688		2147	4268	6415	ZNF81	SO:0001583	missense	0			-	HGNC	AK126949	CCDS43933.1	Xp11.23	2013-01-08	2006-05-12		ENSG00000197779	ENSG00000197779		"""Zinc fingers, C2H2-type"", ""-"""	13156	protein-coding gene	gene with protein product		314998	"""zinc finger protein 81 (HFZ20)"", ""mental retardation, X-linked 45"""	MRX45		8507979, 15121780	Standard	NM_007137		Approved	HFZ20	uc022bvq.1	P51508	OTTHUMG00000021462	ENST00000376954.1:c.1643A>C	X.37:g.47775688A>C	ENSP00000366153:p.His548Pro	Somatic	0	13	0.00		0.5558904216091591	0	100.00	4	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	2	91.30	Q6RX22|Q96QH6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.H548P	ENST00000376954.1	37	c.1643	CCDS43933.1	X	.	.	.	.	.	.	.	.	.	.	A	16.52	3.146565	0.57044	.	.	ENSG00000197779	ENST00000376954;ENST00000338637	T;T	0.67698	-0.28;-0.28	4.14	4.14	0.48551	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.41823	D	0.000801	D	0.85805	0.5782	H	0.96398	3.815	0.36240	D	0.853239	D	0.89917	1.0	D	0.91635	0.999	D	0.91159	0.4959	10	0.87932	D	0	.	10.5689	0.45188	1.0:0.0:0.0:0.0	.	548	P51508	ZNF81_HUMAN	P	548	ENSP00000366153:H548P;ENSP00000341151:H548P	ENSP00000341151:H548P	H	+	2	0	ZNF81	47660632	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.608000	0.90895	1.858000	0.53909	0.441000	0.28932	CAC	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.433	ZNF81-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF81	protein_coding	OTTHUMT00000056455.2	A	NM_007137	-		47775688	+1	no_errors	ENST00000338637	ensembl	human	known	74_37	missense	SNP	1.000	C
SEMA5B	54437	genome.wustl.edu	37	3	122642544	122642544	+	Missense_Mutation	SNP	C	C	T			TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr3:122642544C>T	ENST00000357599.3	-	10	1578	c.1192G>A	c.(1192-1194)Gct>Act	p.A398T	SEMA5B_ENST00000195173.4_Missense_Mutation_p.A398T|SEMA5B_ENST00000451055.2_Missense_Mutation_p.A452T	NM_001031702.3|NM_001256348.1	NP_001026872.2|NP_001243277.1	Q9P283	SEM5B_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5B	398	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(13)|lung(26)|ovary(2)|pancreas(3)|skin(2)|upper_aerodigestive_tract(3)	55				GBM - Glioblastoma multiforme(114;0.0367)		CCATTGAAAGCCTGGGAGATA	0.567																																																	0								ENSG00000082684						110.0	109.0	109.0					3																	122642544		2203	4300	6503	SEMA5B	SO:0001583	missense	0			-	HGNC	AB040878	CCDS35491.1, CCDS58848.1, CCDS74995.1	3q21.1	2008-07-18			ENSG00000082684	ENSG00000082684		"""Semaphorins"""	10737	protein-coding gene	gene with protein product		609298		SEMAG		8817451	Standard	NM_001256346		Approved	SemG, KIAA1445, FLJ10372	uc031sbm.1	Q9P283	OTTHUMG00000140392	ENST00000357599.3:c.1192G>A	3.37:g.122642544C>T	ENSP00000350215:p.Ala398Thr	Somatic	0	91	0.00		0.5558904216091591	5	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	43	18.87	A8K5U2|B7Z393|F8W9U8|Q6DD89|Q6UY12|Q9NW17	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Semap_dom,pfam_Thrombospondin_1_rpt,superfamily_Semap_dom,superfamily_Thrombospondin_1_rpt,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_Thrombospondin_1_rpt,pfscan_Semap_dom,pfscan_Thrombospondin_1_rpt	p.A452T	ENST00000357599.3	37	c.1354	CCDS35491.1	3	.	.	.	.	.	.	.	.	.	.	C	17.60	3.430297	0.62844	.	.	ENSG00000082684	ENST00000357599;ENST00000195173;ENST00000418793;ENST00000451055;ENST00000393583	T;T;T;T	0.11821	2.74;2.74;2.74;2.74	5.22	5.22	0.72569	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.173358	0.49916	D	0.000126	T	0.17704	0.0425	L	0.56124	1.755	0.58432	D	0.999995	B;B;B	0.30889	0.093;0.299;0.187	B;B;B	0.30251	0.068;0.113;0.113	T	0.01613	-1.1312	10	0.48119	T	0.1	.	18.3337	0.90280	0.0:1.0:0.0:0.0	.	340;398;398	D3YTI7;B5ME80;Q9P283	.;.;SEM5B_HUMAN	T	398;398;340;452;398	ENSP00000350215:A398T;ENSP00000195173:A398T;ENSP00000389588:A452T;ENSP00000377208:A398T	ENSP00000195173:A398T	A	-	1	0	SEMA5B	124125234	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.717000	0.61923	2.885000	0.99019	0.655000	0.94253	GCT	-	pfam_Semap_dom,superfamily_Semap_dom,smart_Semap_dom,pfscan_Semap_dom		0.567	SEMA5B-001	KNOWN	basic|CCDS	protein_coding	SEMA5B	protein_coding	OTTHUMT00000277165.1	C	NM_001031702	-		122642544	-1	no_errors	ENST00000451055	ensembl	human	known	74_37	missense	SNP	1.000	T
ZNF181	339318	genome.wustl.edu	37	19	35232821	35232821	+	Missense_Mutation	SNP	C	C	A			TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr19:35232821C>A	ENST00000492450.1	+	4	1624	c.1535C>A	c.(1534-1536)aCt>aAt	p.T512N	ZNF181_ENST00000459757.2_Missense_Mutation_p.T511N|ZNF181_ENST00000392232.3_Missense_Mutation_p.T556N			Q2M3W8	ZN181_HUMAN	zinc finger protein 181	512					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(6)|kidney(2)|large_intestine(1)|lung(7)|ovary(2)|prostate(3)|skin(1)	22	all_lung(56;1.13e-07)|Lung NSC(56;1.81e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.138)			AGAATTCACACTGGAGAAAAG	0.383																																																	0								ENSG00000197841						58.0	64.0	62.0					19																	35232821		2203	4300	6503	ZNF181	SO:0001583	missense	0			-	HGNC	BC104759, H54888	CCDS32990.2, CCDS46043.1	19q13.13	2013-01-08	2006-04-27		ENSG00000197841	ENSG00000197841		"""Zinc fingers, C2H2-type"", ""-"""	12971	protein-coding gene	gene with protein product		606741	"""zinc finger protein 181 (HHZ181)"""				Standard	NM_001029997		Approved	HHZ181, MGC44316	uc002nvu.3	Q2M3W8	OTTHUMG00000157508	ENST00000492450.1:c.1535C>A	19.37:g.35232821C>A	ENSP00000420727:p.Thr512Asn	Somatic	0	116	0.00		0.5558904216091591	11	35.29	6	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	58	18.31	B7ZKX3|Q49A75	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,smart_Znf_BED_prd,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.T556N	ENST00000492450.1	37	c.1667	CCDS32990.2	19	.	.	.	.	.	.	.	.	.	.	C	17.30	3.354025	0.61293	.	.	ENSG00000197841	ENST00000392232;ENST00000492450;ENST00000459757	T;T;T	0.26067	1.76;1.76;1.76	2.72	2.72	0.32119	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.42268	0.1195	M	0.71920	2.185	0.34271	D	0.681017	P;P	0.49358	0.923;0.923	P;P	0.55965	0.788;0.788	T	0.60505	-0.7250	9	0.87932	D	0	.	11.6139	0.51078	0.0:1.0:0.0:0.0	.	511;512	B7ZKX3;Q2M3W8	.;ZN181_HUMAN	N	556;512;511	ENSP00000376065:T556N;ENSP00000420727:T512N;ENSP00000419435:T511N	ENSP00000376065:T556N	T	+	2	0	ZNF181	39924661	0.438000	0.25602	1.000000	0.80357	0.996000	0.88848	0.982000	0.29539	1.839000	0.53478	0.655000	0.94253	ACT	-	smart_Znf_BED_prd,pfscan_Znf_C2H2		0.383	ZNF181-002	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	ZNF181	protein_coding	OTTHUMT00000349005.3	C	NM_001029997	-		35232821	+1	no_errors	ENST00000392232	ensembl	human	known	74_37	missense	SNP	1.000	A
CST3	1471	genome.wustl.edu	37	20	23616002	23616002	+	Silent	SNP	G	G	T			TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr20:23616002G>T	ENST00000398411.1	-	2	328	c.246C>A	c.(244-246)atC>atA	p.I82I	CST3_ENST00000376925.3_Silent_p.I82I|CST3_ENST00000398409.1_Silent_p.I82I			P01034	CYTC_HUMAN	cystatin C	82					apoptotic process (GO:0006915)|brain development (GO:0007420)|cell activation (GO:0001775)|cellular response to hydrogen peroxide (GO:0070301)|circadian sleep/wake cycle, REM sleep (GO:0042747)|defense response (GO:0006952)|embryo implantation (GO:0007566)|extracellular fibril organization (GO:0043206)|eye development (GO:0001654)|negative regulation of blood vessel remodeling (GO:0060313)|negative regulation of cell death (GO:0060548)|negative regulation of collagen catabolic process (GO:0010711)|negative regulation of elastin catabolic process (GO:0060311)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extracellular matrix disassembly (GO:0010716)|negative regulation of peptidase activity (GO:0010466)|negative regulation of proteolysis (GO:0045861)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA replication (GO:0045740)|regulation of programmed cell death (GO:0043067)|regulation of tissue remodeling (GO:0034103)|response to axon injury (GO:0048678)|response to carbohydrate (GO:0009743)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to hypoxia (GO:0001666)|response to nutrient levels (GO:0031667)|response to toxic substance (GO:0009636)|salivary gland development (GO:0007431)|Sertoli cell development (GO:0060009)	basement membrane (GO:0005604)|cell projection (GO:0042995)|contractile fiber (GO:0043292)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|nuclear membrane (GO:0031965)|perinuclear region of cytoplasm (GO:0048471)	beta-amyloid binding (GO:0001540)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|endopeptidase inhibitor activity (GO:0004866)|protease binding (GO:0002020)	p.I82I(1)		large_intestine(2)|lung(1)|ovary(1)	4	Lung NSC(19;0.0789)|Colorectal(13;0.0993)|all_lung(19;0.169)					CCCCAGCTACGATCTACACAT	0.567																																																	1	Substitution - coding silent(1)	large_intestine(1)						ENSG00000101439						110.0	84.0	93.0					20																	23616002		2203	4300	6503	CST3	SO:0001819	synonymous_variant	0			-	HGNC		CCDS13158.1	20p11.2	2008-04-15	2008-04-15		ENSG00000101439	ENSG00000101439			2475	protein-coding gene	gene with protein product		604312	"""cystatin C (amyloid angiopathy and cerebral hemorrhage)"""			8486384	Standard	NM_000099		Approved		uc002wtn.1	P01034	OTTHUMG00000032080	ENST00000398411.1:c.246C>A	20.37:g.23616002G>T		Somatic	0	41	0.00		0.5558904216091591	1685	0.59	10	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	40	13.04	B2R5J9|D3DW42|Q6FGW9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_inh_cystat,smart_Prot_inh_cystat	p.I82	ENST00000398411.1	37	c.246	CCDS13158.1	20																																																																																			-	pfam_Prot_inh_cystat,smart_Prot_inh_cystat		0.567	CST3-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	CST3	protein_coding	OTTHUMT00000256831.1	G	NM_000099	-		23616002	-1	no_errors	ENST00000376925	ensembl	human	known	74_37	silent	SNP	0.008	T
DACT1	51339	genome.wustl.edu	37	14	59113290	59113290	+	Missense_Mutation	SNP	G	G	A			TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr14:59113290G>A	ENST00000335867.4	+	4	1973	c.1949G>A	c.(1948-1950)gGc>gAc	p.G650D	DACT1_ENST00000556859.1_Missense_Mutation_p.G369D|DACT1_ENST00000395153.3_Missense_Mutation_p.G613D|DACT1_ENST00000541264.2_Missense_Mutation_p.G369D			Q9NYF0	DACT1_HUMAN	dishevelled-binding antagonist of beta-catenin 1	650					dendrite morphogenesis (GO:0048813)|embryonic hindgut morphogenesis (GO:0048619)|gastrulation with mouth forming second (GO:0001702)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of catenin import into nucleus (GO:0035412)|regulation of protein stability (GO:0031647)|regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000095)|synapse organization (GO:0050808)|Wnt signaling pathway (GO:0016055)	beta-catenin destruction complex (GO:0030877)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|synapse (GO:0045202)	beta-catenin binding (GO:0008013)|delta-catenin binding (GO:0070097)|protein kinase A binding (GO:0051018)|protein kinase C binding (GO:0005080)			endometrium(7)|kidney(3)|large_intestine(11)|lung(27)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	53						GCGGGCGGGGGCCACAGGGCG	0.667																																																	0								ENSG00000165617						6.0	6.0	6.0					14																	59113290		2118	4117	6235	DACT1	SO:0001583	missense	0			-	HGNC	AF251079	CCDS9736.1, CCDS41961.1	14q22.3	2013-05-15	2013-05-15		ENSG00000165617	ENSG00000165617			17748	protein-coding gene	gene with protein product		607861	"""dapper homolog 1, antagonist of beta-catenin (xenopus)"", ""dapper, antagonist of beta-catenin, homolog 1 (Xenopus laevis)"""			11970895	Standard	NM_001079520		Approved	DAPPER1, THYEX3, HDPR1, DAPPER, FRODO	uc001xdw.3	Q9NYF0	OTTHUMG00000140324	ENST00000335867.4:c.1949G>A	14.37:g.59113290G>A	ENSP00000337439:p.Gly650Asp	Somatic	1	151	0.66		0.5558904216091591	6	25.00	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	107	12.20	A8MYJ2|Q86TY0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.G650D	ENST00000335867.4	37	c.1949	CCDS9736.1	14	.	.	.	.	.	.	.	.	.	.	G	8.555	0.876345	0.17395	.	.	ENSG00000165617	ENST00000556859;ENST00000395151;ENST00000395153;ENST00000335867;ENST00000541264	T;T;T;T;T	0.51325	0.71;0.71;0.71;0.71;0.71	4.8	1.63	0.23807	.	0.879811	0.09918	N	0.738827	T	0.44138	0.1279	L	0.56769	1.78	0.09310	N	1	P;P	0.49090	0.634;0.919	B;P	0.46275	0.165;0.51	T	0.38001	-0.9681	10	0.54805	T	0.06	-11.3579	2.2448	0.04029	0.1036:0.1706:0.4473:0.2785	.	613;650	A8MYJ2;Q9NYF0	.;DACT1_HUMAN	D	369;369;613;650;369	ENSP00000451598:G369D;ENSP00000378581:G369D;ENSP00000378582:G613D;ENSP00000337439:G650D;ENSP00000442850:G369D	ENSP00000337439:G650D	G	+	2	0	DACT1	58183043	0.002000	0.14202	0.013000	0.15412	0.152000	0.21847	0.826000	0.27407	0.587000	0.29643	0.563000	0.77884	GGC	-	NULL		0.667	DACT1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DACT1	protein_coding	OTTHUMT00000325515.1	G	NM_016651	-		59113290	+1	no_errors	ENST00000335867	ensembl	human	known	74_37	missense	SNP	0.002	A
KRT4	3851	genome.wustl.edu	37	12	53205597	53205597	+	Silent	SNP	C	C	T			TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr12:53205597C>T	ENST00000551956.1	-	2	1119	c.627G>A	c.(625-627)ctG>ctA	p.L209L	KRT4_ENST00000458244.2_Silent_p.L189L|KRT4_ENST00000293774.4_Silent_p.L283L			P19013	K2C4_HUMAN	keratin 4	223	Coil 1B.|Rod.				cytoskeleton organization (GO:0007010)|epithelial cell differentiation (GO:0030855)|negative regulation of epithelial cell proliferation (GO:0050680)	cell surface (GO:0009986)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			endometrium(3)|kidney(4)|large_intestine(6)|lung(8)|ovary(4)|prostate(2)|skin(2)	29						GCTCAGACTGCAGGCGCCCTT	0.562																																					Pancreas(190;284 2995 41444 45903)												0								ENSG00000170477						103.0	106.0	105.0					12																	53205597		2050	4211	6261	KRT4	SO:0001819	synonymous_variant	0			-	HGNC		CCDS41787.1, CCDS41787.2	12q13.13	2013-01-16			ENSG00000170477	ENSG00000170477		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6441	protein-coding gene	gene with protein product	"""cytokeratin 4"", ""keratin, type II cytoskeletal 4"""	123940		CYK4		16831889	Standard	NM_002272		Approved	CK4, K4	uc031qhk.1	P19013		ENST00000551956.1:c.627G>A	12.37:g.53205597C>T		Somatic	0	47	0.00		0.5558904216091591	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	F8VS64|Q6GTR8|Q96LA7|Q9BTL1	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_IF,superfamily_Prefoldin,prints_Keratin_II,prints_Keratin_I	p.L283	ENST00000551956.1	37	c.849	CCDS41787.2	12																																																																																			-	pfam_IF		0.562	KRT4-001	KNOWN	upstream_ATG|basic|appris_candidate|CCDS	protein_coding	KRT4	protein_coding	OTTHUMT00000405931.1	C	NM_002272	-		53205597	-1	no_errors	ENST00000293774	ensembl	human	known	74_37	silent	SNP	1.000	T
HDC	3067	genome.wustl.edu	37	15	50546363	50546363	+	Silent	SNP	G	G	T			TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr15:50546363G>T	ENST00000267845.3	-	6	1086	c.684C>A	c.(682-684)atC>atA	p.I228I	HDC_ENST00000543581.1_Silent_p.I228I	NM_002112.3	NP_002103.2	Q9UBI9	HDC_HUMAN	histidine decarboxylase	0					respiratory tube development (GO:0030323)	membrane (GO:0016020)		p.I228M(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(13)|lung(25)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		all_lung(180;0.0138)		all cancers(107;1.12e-06)|GBM - Glioblastoma multiforme(94;9.95e-05)		TGTCTTCCTCGATGGCCTTCT	0.478																																					GBM(95;1627 1936 6910 9570)												1	Substitution - Missense(1)	lung(1)						ENSG00000140287						70.0	66.0	68.0					15																	50546363		2196	4295	6491	HDC	SO:0001819	synonymous_variant	0			-	HGNC		CCDS10134.1	15q21.2	2013-09-20			ENSG00000140287	ENSG00000140287	4.1.1.22		4855	protein-coding gene	gene with protein product		142704				1487235	Standard	NM_002112		Approved		uc001zxz.3	P19113	OTTHUMG00000131644	ENST00000267845.3:c.684C>A	15.37:g.50546363G>T		Somatic	0	63	0.00		0.5558904216091591	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	32	11.11		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_PyrdxlP-dep_de-COase,superfamily_PyrdxlP-dep_Trfase,prints_Aromatic_deC	p.I228	ENST00000267845.3	37	c.684	CCDS10134.1	15																																																																																			-	pfam_PyrdxlP-dep_de-COase,superfamily_PyrdxlP-dep_Trfase		0.478	HDC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HDC	protein_coding	OTTHUMT00000254540.1	G		-		50546363	-1	no_errors	ENST00000267845	ensembl	human	known	74_37	silent	SNP	0.443	T
SMPD4	55627	genome.wustl.edu	37	2	130934161	130934161	+	Missense_Mutation	SNP	G	G	T			TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr2:130934161G>T	ENST00000409031.1	-	2	1270	c.122C>A	c.(121-123)gCg>gAg	p.A41E	SMPD4_ENST00000453750.1_Missense_Mutation_p.A41E|SMPD4_ENST00000443958.2_5'UTR|SMPD4_ENST00000426662.2_5'UTR|SMPD4_ENST00000473720.1_5'UTR|SMPD4_ENST00000452225.2_5'UTR|SMPD4_ENST00000431183.2_Missense_Mutation_p.A41E|SMPD4_ENST00000351288.6_Missense_Mutation_p.A41E|SMPD4_ENST00000339679.7_5'UTR	NM_017951.4	NP_060421.2	Q9NXE4	NSMA3_HUMAN	sphingomyelin phosphodiesterase 4, neutral membrane (neutral sphingomyelinase-3)	2					cellular response to tumor necrosis factor (GO:0071356)|ceramide biosynthetic process (GO:0046513)|glycerophospholipid catabolic process (GO:0046475)|glycosphingolipid metabolic process (GO:0006687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sphingomyelin catabolic process (GO:0006685)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|trans-Golgi network (GO:0005802)	metal ion binding (GO:0046872)|sphingomyelin phosphodiesterase activity (GO:0004767)|sphingomyelin phosphodiesterase D activity (GO:0050290)	p.A41V(1)		breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(17)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	29	Colorectal(110;0.1)				Phosphatidylserine(DB00144)	GTGAGGGAACGCCATAGCAGC	0.458																																																	1	Substitution - Missense(1)	urinary_tract(1)						ENSG00000136699						72.0	71.0	71.0					2																	130934161		2203	4300	6503	SMPD4	SO:0001583	missense	0			-	HGNC	AF052134	CCDS2156.2, CCDS42751.1, CCDS54398.1	2q21.1	2009-11-06			ENSG00000136699	ENSG00000136699			32949	protein-coding gene	gene with protein product		610457				16517606	Standard	NM_001171083		Approved	FLJ20297, FLJ20756, nSMase-3, KIAA1418, NSMASE3, NET13	uc002tqr.2	Q9NXE4	OTTHUMG00000131624	ENST00000409031.1:c.122C>A	2.37:g.130934161G>T	ENSP00000386531:p.Ala41Glu	Somatic	0	107	0.00		0.5558904216091591	62	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	56	8.20	B4DM23|B4DQ31|B4DRB8|B4DWK7|B4E0L6|E7ESA2|E9PCE6|Q6FI76|Q6P1P7|Q6ZT43|Q9H0M2|Q9NW20|Q9NWL2|Q9P2C9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.A41E	ENST00000409031.1	37	c.122	CCDS42751.1	2	.	.	.	.	.	.	.	.	.	.	g	15.52	2.858527	0.51376	.	.	ENSG00000136699	ENST00000351288;ENST00000409031;ENST00000431183;ENST00000453750;ENST00000441135	.	.	.	3.27	3.27	0.37495	.	0.067163	0.64402	D	0.000016	T	0.70684	0.3252	M	0.65975	2.015	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.998;0.998;1.0;0.999	T	0.73563	-0.3943	9	0.87932	D	0	.	10.195	0.43049	0.0:0.0:1.0:0.0	.	41;41;2;41	E7ESA2;B4DM23;Q9NXE4;B1PBA3	.;.;NSMA3_HUMAN;.	E	41;41;41;41;2	.	ENSP00000259217:A41E	A	-	2	0	SMPD4	130650631	1.000000	0.71417	0.966000	0.40874	0.808000	0.45660	6.726000	0.74758	1.801000	0.52704	0.455000	0.32223	GCG	-	NULL		0.458	SMPD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMPD4	protein_coding	OTTHUMT00000254516.3	G	NM_017751	-		130934161	-1	no_errors	ENST00000409031	ensembl	human	known	74_37	missense	SNP	1.000	T
EYA1	2138	genome.wustl.edu	37	8	72123391	72123392	+	Splice_Site	INS	-	-	T	rs397517919|rs143798228		TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr8:72123391_72123392insT	ENST00000340726.3	-	17	2336_2337	c.1697_1698insA	c.(1696-1698)aag>aaAg	p.K566fs	EYA1_ENST00000388741.2_Splice_Site_p.K532fs|EYA1_ENST00000388742.4_Splice_Site_p.K566fs|EYA1_ENST00000419131.1_Splice_Site_p.K531fs|EYA1_ENST00000388740.3_Splice_Site_p.K533fs|EYA1_ENST00000388743.2_Splice_Site_p.K565fs|EYA1_ENST00000303824.7_Splice_Site_p.K560fs	NM_000503.4	NP_000494.2	Q99502	EYA1_HUMAN	EYA transcriptional coactivator and phosphatase 1	566					anatomical structure morphogenesis (GO:0009653)|aorta morphogenesis (GO:0035909)|branching involved in ureteric bud morphogenesis (GO:0001658)|cellular protein localization (GO:0034613)|cochlea morphogenesis (GO:0090103)|double-strand break repair (GO:0006302)|embryonic skeletal system morphogenesis (GO:0048704)|establishment of mitotic spindle orientation (GO:0000132)|establishment or maintenance of apical/basal cell polarity (GO:0035088)|histone dephosphorylation (GO:0016576)|lung epithelial cell differentiation (GO:0060487)|metanephros development (GO:0001656)|middle ear morphogenesis (GO:0042474)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|neuron fate specification (GO:0048665)|otic vesicle morphogenesis (GO:0071600)|outer ear morphogenesis (GO:0042473)|outflow tract morphogenesis (GO:0003151)|pattern specification process (GO:0007389)|pharyngeal system development (GO:0060037)|positive regulation of DNA repair (GO:0045739)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of secondary heart field cardioblast proliferation (GO:0072513)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein sumoylation (GO:0016925)|regulation of neuron differentiation (GO:0045664)|response to ionizing radiation (GO:0010212)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|striated muscle tissue development (GO:0014706)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein tyrosine phosphatase activity (GO:0004725)|RNA binding (GO:0003723)			NS(2)|breast(3)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(15)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	44	Breast(64;0.046)		Epithelial(68;0.0837)|all cancers(69;0.247)			GAATGCTCACCTTTTTTGCTCC	0.361																																																	0			GRCh37	CI082242	EYA1	I		ENSG00000104313																																			EYA1	SO:0001630	splice_region_variant	0				HGNC	AJ000098	CCDS34906.1, CCDS34907.1, CCDS47873.1, CCDS75750.1	8q13.3	2014-06-19	2014-06-19		ENSG00000104313	ENSG00000104313		"""Protein tyrosine phosphatases / Asp-based PTPs"""	3519	protein-coding gene	gene with protein product		601653	"""eyes absent (Drosophila) homolog 1"", ""eyes absent homolog 1 (Drosophila)"""	BOR		9020840	Standard	XM_005251184		Approved		uc003xys.4	Q99502	OTTHUMG00000149894	ENST00000340726.3:c.1698+1->A	8.37:g.72123397_72123397dupT		Somatic	0	38	0.00		0.5558904216091591	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	52	27.78	A6NHQ0|G5E9R4|Q0P516|Q8WX80	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_HAD-like_dom,superfamily_HAD-like_dom,tigrfam_EYA	p.H567fs	ENST00000340726.3	37	c.1698_1697	CCDS34906.1	8																																																																																			-	superfamily_HAD-like_dom,tigrfam_EYA		0.361	EYA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EYA1	protein_coding	OTTHUMT00000313788.2	-	NM_000503, NM_172060		Frame_Shift_Ins	72123392	-1	no_errors	ENST00000340726	ensembl	human	known	74_37	frame_shift_ins	INS	1.000:1.000	T
HMGN2P46	283651	genome.wustl.edu	37	15	45848230	45848231	+	lincRNA	INS	-	-	T	rs372861121|rs368577527		TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr15:45848230_45848231insT	ENST00000557965.1	+	0	0				HMGN2P46_ENST00000409454.1_RNA																							TTTTGTTTAGCTTTTTTTTTTT	0.322																																																	0								ENSG00000179362																																			HMGN2P46			0				HGNC																													15.37:g.45848241_45848241dupT		Somatic	0	22	0.00		0.5558904216091591	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	35	14.63		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000557965.1	37	NULL		15																																																																																			-	-		0.322	RP11-96O20.2-001	KNOWN	basic	lincRNA	HMGN2P46	lincRNA	OTTHUMT00000416553.1	-				45848231	+1	no_errors	ENST00000313559	ensembl	human	known	74_37	rna	INS	0.997:0.997	T
PCDHB4	56131	genome.wustl.edu	37	5	140503450	140503450	+	Missense_Mutation	SNP	C	C	T	rs372114502		TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr5:140503450C>T	ENST00000194152.1	+	1	1870	c.1870C>T	c.(1870-1872)Cgc>Tgc	p.R624C		NM_018938.2	NP_061761.1	Q9Y5E5	PCDB4_HUMAN	protocadherin beta 4	624	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(12)|lung(35)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	67			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TGGCGAGGTGCGCACCGCCAG	0.697																																																	0								ENSG00000081818						27.0	27.0	27.0					5																	140503450		2031	4040	6071	PCDHB4	SO:0001583	missense	0			-	HGNC	AF152497	CCDS4246.1	5q31	2010-01-26			ENSG00000081818	ENSG00000081818		"""Cadherins / Protocadherins : Clustered"""	8689	other	protocadherin		606330				10380929	Standard	NM_018938		Approved	PCDH-BETA4	uc003lip.1	Q9Y5E5	OTTHUMG00000129617	ENST00000194152.1:c.1870C>T	5.37:g.140503450C>T	ENSP00000194152:p.Arg624Cys	Somatic	0	64	0.00		0.5558904216091591	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	Q4V761	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R624C	ENST00000194152.1	37	c.1870	CCDS4246.1	5	.	.	.	.	.	.	.	.	.	.	C	15.66	2.899529	0.52227	.	.	ENSG00000081818	ENST00000194152	T	0.52754	0.65	4.12	4.12	0.48240	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.78742	0.4331	H	0.98295	4.195	0.48341	D	0.999639	D	0.89917	1.0	D	0.87578	0.998	D	0.84923	0.0855	9	0.72032	D	0.01	.	10.939	0.47262	0.3132:0.6868:0.0:0.0	.	624	Q9Y5E5	PCDB4_HUMAN	C	624	ENSP00000194152:R624C	ENSP00000194152:R624C	R	+	1	0	PCDHB4	140483634	0.796000	0.28864	1.000000	0.80357	0.997000	0.91878	0.439000	0.21575	2.307000	0.77673	0.485000	0.47835	CGC	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.697	PCDHB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB4	protein_coding	OTTHUMT00000251812.2	C	NM_018938	-		140503450	+1	no_errors	ENST00000194152	ensembl	human	known	74_37	missense	SNP	1.000	T
CAPN2	824	genome.wustl.edu	37	1	223954074	223954074	+	Missense_Mutation	SNP	G	G	T			TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr1:223954074G>T	ENST00000295006.5	+	16	2005	c.1696G>T	c.(1696-1698)Gat>Tat	p.D566Y	CAPN2_ENST00000433674.2_Missense_Mutation_p.D488Y|CAPN2_ENST00000474026.1_3'UTR	NM_001748.4	NP_001739	P17655	CAN2_HUMAN	calpain 2, (m/II) large subunit	566	Domain IV.				blastocyst development (GO:0001824)|cellular response to amino acid stimulus (GO:0071230)|myoblast fusion (GO:0007520)|protein autoprocessing (GO:0016540)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of cytoskeleton organization (GO:0051493)|response to hypoxia (GO:0001666)	chromatin (GO:0000785)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)|pseudopodium (GO:0031143)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|cysteine-type peptidase activity (GO:0008234)|cytoskeletal protein binding (GO:0008092)			breast(3)|endometrium(1)|kidney(1)|large_intestine(9)|lung(10)|prostate(1)|skin(1)|stomach(3)	29				GBM - Glioblastoma multiforme(131;0.109)		TTTAGGCCAAGATATCAAGTC	0.423																																																	0								ENSG00000162909						139.0	123.0	128.0					1																	223954074		2203	4300	6503	CAPN2	SO:0001583	missense	0			-	HGNC	J04700	CCDS31035.1, CCDS53478.1	1q41-q42	2013-01-10			ENSG00000162909	ENSG00000162909	3.4.22.52	"""EF-hand domain containing"""	1479	protein-coding gene	gene with protein product		114230				2852952, 2539381	Standard	NM_001748		Approved	mCANP, CANPml, CANPL2	uc001hob.4	P17655	OTTHUMG00000037376	ENST00000295006.5:c.1696G>T	1.37:g.223954074G>T	ENSP00000295006:p.Asp566Tyr	Somatic	0	49	0.00		0.5558904216091591	372	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	24	10.34	A6NDG7|B7ZA96|E7ES58|Q16738|Q6PJT3|Q8WU26|Q9HBB1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_C2_calpain_cat,pfam_Calpain_domain_III,superfamily_Calpain_domain_III,smart_Peptidase_C2_calpain_cat,smart_Calpain_III,pfscan_EF_hand_dom,pfscan_Peptidase_C2_calpain_cat,prints_Calpain_cysteine_protease	p.D566Y	ENST00000295006.5	37	c.1696	CCDS31035.1	1	.	.	.	.	.	.	.	.	.	.	G	18.74	3.689514	0.68271	.	.	ENSG00000162909	ENST00000433674;ENST00000295006;ENST00000366869	T;T	0.32988	1.43;1.43	5.47	5.47	0.80525	EF-hand-like domain (1);	0.412660	0.29980	N	0.010711	T	0.50922	0.1644	M	0.79475	2.455	0.80722	D	1	B;P;B	0.35348	0.018;0.496;0.121	B;P;B	0.46144	0.134;0.505;0.105	T	0.54262	-0.8320	10	0.87932	D	0	.	19.3228	0.94248	0.0:0.0:1.0:0.0	.	488;149;566	B7ZA96;B3KUH9;P17655	.;.;CAN2_HUMAN	Y	488;566;595	ENSP00000413158:D488Y;ENSP00000295006:D566Y	ENSP00000295006:D566Y	D	+	1	0	CAPN2	222020697	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	9.473000	0.97714	2.559000	0.86315	0.561000	0.74099	GAT	-	NULL		0.423	CAPN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAPN2	protein_coding	OTTHUMT00000090973.1	G	NM_001748	-		223954074	+1	no_errors	ENST00000295006	ensembl	human	known	74_37	missense	SNP	1.000	T
BACH1	571	genome.wustl.edu	37	21	30723982	30723982	+	RNA	SNP	G	G	T			TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr21:30723982G>T	ENST00000504298.1	+	0	28					NR_027655.1				BACH1 intronic transcript 1 (non-protein coding)																		GATGTGCCAAGAAGTGTTCCA	0.433																																																	0								ENSG00000248476						106.0	95.0	98.0					21																	30723982		2203	4300	6503	BACH1-IT1			0			-	HGNC	AF317902		21q21.3	2012-10-12			ENSG00000248476	ENSG00000248476		"""Long non-coding RNAs"""	40006	non-coding RNA	RNA, long non-coding							Standard			Approved				OTTHUMG00000078881		21.37:g.30723982G>T		Somatic	0	49	0.00		0.5558904216091591	6	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	34	10.53		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000504298.1	37	NULL		21																																																																																			-	-		0.433	BACH1-IT1-001	KNOWN	basic	sense_intronic	BACH1-IT1	sense_intronic	OTTHUMT00000171988.1	G		-		30723982	+1	no_errors	ENST00000504298	ensembl	human	known	74_37	rna	SNP	0.000	T
