#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
MTRNR2L6	100463482	genome.wustl.edu	37	7	142375121	142375121	+	Missense_Mutation	SNP	T	T	C			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr7:142375121T>C	ENST00000604952.1	+	1	1018	c.59T>C	c.(58-60)gTg>gCg	p.V20A		NM_001190487.1	NP_001177416.1			MT-RNR2-like 6																		GACCTGCCTGTGAAGAGGCGA	0.413																																																	0								ENSG00000270672																																			MTRNR2L6	SO:0001583	missense	0			-	HGNC		CCDS64784.1	7q34	2014-02-18				ENSG00000270672			37163	protein-coding gene	gene with protein product	"""humanin-like 6"""					19477263	Standard	NM_001190487		Approved		uc003vzz.2	P0CJ73	OTTHUMG00000184977	ENST00000604952.1:c.59T>C	7.37:g.142375121T>C	ENSP00000473686:p.Val20Ala	Somatic	0	61	0.00		0.4120429396410797	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	53	23.19		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.V20A	ENST00000604952.1	37	c.59		7																																																																																			-	NULL		0.413	MTRNR2L6-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	MTRNR2L6	protein_coding	OTTHUMT00000469394.1	T	NM_001190487	-		142375121	+1	no_errors	ENST00000604952	ensembl	human	known	74_37	missense	SNP	1.000	C
DUSP1	1843	genome.wustl.edu	37	5	172195870	172195870	+	Silent	SNP	G	G	A			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr5:172195870G>A	ENST00000239223.3	-	4	1241	c.999C>T	c.(997-999)acC>acT	p.T333T	RP11-779O18.3_ENST00000523005.1_RNA	NM_004417.3	NP_004408.1	P28562	DUS1_HUMAN	dual specificity phosphatase 1	333	Tyrosine-protein phosphatase.				cellular response to hormone stimulus (GO:0032870)|endoderm formation (GO:0001706)|inactivation of MAPK activity (GO:0000188)|intracellular signal transduction (GO:0035556)|mitotic cell cycle arrest (GO:0071850)|negative regulation of apoptotic process (GO:0043066)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of meiotic cell cycle (GO:0051447)|peptidyl-threonine dephosphorylation (GO:0035970)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of apoptotic process (GO:0043065)|protein dephosphorylation (GO:0006470)|regulation of apoptotic process (GO:0042981)|regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090266)|response to calcium ion (GO:0051592)|response to cAMP (GO:0051591)|response to estradiol (GO:0032355)|response to glucocorticoid (GO:0051384)|response to hydrogen peroxide (GO:0042542)|response to light stimulus (GO:0009416)|response to oxidative stress (GO:0006979)|response to retinoic acid (GO:0032526)|response to testosterone (GO:0033574)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|protein tyrosine/threonine phosphatase activity (GO:0008330)			NS(1)|breast(2)|endometrium(1)|large_intestine(1)|liver(1)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	10	Renal(175;0.000159)|Lung NSC(126;0.00431)|all_lung(126;0.00729)	all_hematologic(541;4.11e-18)|Breast(839;0.00637)|Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|Ovarian(839;0.15)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)	GBM - Glioblastoma multiforme(465;0.0103)		TGGTGGTGGAGGTGCCTCGGT	0.632																																																	0								ENSG00000120129						98.0	93.0	95.0					5																	172195870		2203	4300	6503	DUSP1	SO:0001819	synonymous_variant	0			-	HGNC	X68277	CCDS4380.1	5q35.1	2011-06-09			ENSG00000120129	ENSG00000120129		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3064	protein-coding gene	gene with protein product		600714		PTPN10		1406996, 7806236	Standard	NM_004417		Approved	HVH1, CL100, MKP-1	uc003mbv.2	P28562	OTTHUMG00000130523	ENST00000239223.3:c.999C>T	5.37:g.172195870G>A		Somatic	0	78	0.00		0.4120429396410797	1069	6.21	71	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	33	15.38	D3DQL9|Q2V508	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Dual-sp_phosphatase_cat-dom,pfam_Rhodanese-like_dom,pfam_Tyr_Pase_rcpt/non-rcpt,superfamily_Rhodanese-like_dom,smart_Rhodanese-like_dom,smart_Dual-sp_phosphatase_subgr_cat,smart_Tyr_Pase_cat,pirsf_MKP,pfscan_Rhodanese-like_dom,pfscan_Tyr/Dual-sp_Pase,pfscan_Dual-sp_phosphatase_subgr_cat,prints_MKP,prints_Atypical_DUSP	p.T333	ENST00000239223.3	37	c.999	CCDS4380.1	5																																																																																			-	pirsf_MKP		0.632	DUSP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUSP1	protein_coding	OTTHUMT00000252943.3	G	NM_004417	-		172195870	-1	no_errors	ENST00000239223	ensembl	human	known	74_37	silent	SNP	0.773	A
ZBED9	114821	genome.wustl.edu	37	6	28540383	28540383	+	Missense_Mutation	SNP	C	C	A			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr6:28540383C>A	ENST00000452236.2	-	4	3900	c.3283G>T	c.(3283-3285)Gat>Tat	p.D1095Y		NM_052923.1	NP_443155.1														NS(3)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(14)|liver(1)|lung(29)|ovary(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(3)	71						caattcacatctttaaaaagt	0.358																																																	0								ENSG00000232040						58.0	60.0	59.0					6																	28540383		2203	4297	6500	SCAND3	SO:0001583	missense	0			-	HGNC																												ENST00000452236.2:c.3283G>T	6.37:g.28540383C>A	ENSP00000395259:p.Asp1095Tyr	Somatic	0	62	0.00		0.4120429396410797	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	44	13.73		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Tscrpt_reg_SCAN,pfam_Integrase_cat-core,pfam_HATC_dom_C,superfamily_Retrov_capsid_C,superfamily_RNaseH-like_dom,smart_Tscrpt_reg_SCAN,pfscan_Integrase_cat-core,pfscan_Tscrpt_reg_SCAN	p.D1095Y	ENST00000452236.2	37	c.3283	CCDS34355.1	6	.	.	.	.	.	.	.	.	.	.	C	13.27	2.188577	0.38609	.	.	ENSG00000232040	ENST00000452236	T	0.42513	0.97	2.27	2.27	0.28462	Ribonuclease H-like (1);	3.282620	0.01950	N	0.042540	T	0.56124	0.1964	M	0.82823	2.61	0.30275	N	0.791861	D	0.71674	0.998	D	0.79784	0.993	T	0.14062	-1.0486	10	0.72032	D	0.01	.	8.144	0.31100	0.0:1.0:0.0:0.0	.	1095	Q6R2W3	SCND3_HUMAN	Y	1095	ENSP00000395259:D1095Y	ENSP00000395259:D1095Y	D	-	1	0	SCAND3	28648362	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	0.730000	0.26043	1.581000	0.49865	0.655000	0.94253	GAT	-	superfamily_RNaseH-like_dom		0.358	SCAND3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	SCAND3	protein_coding	OTTHUMT00000043551.3	C		-		28540383	-1	no_errors	ENST00000452236	ensembl	human	known	74_37	missense	SNP	1.000	A
UGP2	7360	genome.wustl.edu	37	2	64109761	64109761	+	Silent	SNP	G	G	T			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr2:64109761G>T	ENST00000337130.5	+	4	893	c.417G>T	c.(415-417)ctG>ctT	p.L139L	ACA59_ENST00000515966.1_RNA|UGP2_ENST00000467648.2_Silent_p.L128L|UGP2_ENST00000487469.1_3'UTR|UGP2_ENST00000394417.2_Silent_p.L128L|UGP2_ENST00000445915.2_Silent_p.L148L	NM_006759.3	NP_006750.3	Q16851	UGPA_HUMAN	UDP-glucose pyrophosphorylase 2	139					carbohydrate metabolic process (GO:0005975)|cellular glucuronidation (GO:0052695)|glucose 1-phosphate metabolic process (GO:0019255)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|small molecule metabolic process (GO:0044281)|UDP-glucose metabolic process (GO:0006011)|UDP-glucuronate biosynthetic process (GO:0006065)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	glucose binding (GO:0005536)|metal ion binding (GO:0046872)|pyrimidine ribonucleotide binding (GO:0032557)|UTP:glucose-1-phosphate uridylyltransferase activity (GO:0003983)			endometrium(2)|kidney(1)|large_intestine(8)|lung(6)|prostate(1)	18						ATACCTTTCTGGATCTGACTG	0.363																																																	0								ENSG00000169764						136.0	138.0	137.0					2																	64109761		2203	4300	6503	UGP2	SO:0001819	synonymous_variant	0			-	HGNC		CCDS1875.1, CCDS42690.1	2p14-p13	2012-10-02			ENSG00000169764	ENSG00000169764	2.7.7.9		12527	protein-coding gene	gene with protein product		191760	"""UDP-glucose pyrophosphorylase 1"""	UGP1			Standard	NM_006759		Approved	UGPP1	uc002scm.3	Q16851	OTTHUMG00000129513	ENST00000337130.5:c.417G>T	2.37:g.64109761G>T		Somatic	0	59	0.00		0.4120429396410797	177	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.16	Q07131|Q0P6K2|Q86Y81|Q9BU15	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_UDPGP_trans,pirsf_UDPGP_trans_subgr	p.L139	ENST00000337130.5	37	c.417	CCDS1875.1	2																																																																																			-	pfam_UDPGP_trans,pirsf_UDPGP_trans_subgr		0.363	UGP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGP2	protein_coding	OTTHUMT00000251688.1	G	NM_006759	-		64109761	+1	no_errors	ENST00000337130	ensembl	human	known	74_37	silent	SNP	1.000	T
ANKRD11	29123	genome.wustl.edu	37	16	89348191	89348191	+	Silent	SNP	G	G	A			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr16:89348191G>A	ENST00000301030.4	-	9	5219	c.4759C>T	c.(4759-4761)Ctg>Ttg	p.L1587L	ANKRD11_ENST00000378330.2_Silent_p.L1587L	NM_001256183.1|NM_013275.5	NP_001243112.1|NP_037407.4	Q6UB99	ANR11_HUMAN	ankyrin repeat domain 11	1587	Lys-rich.				bone development (GO:0060348)|face morphogenesis (GO:0060325)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|odontogenesis of dentin-containing tooth (GO:0042475)|skeletal system morphogenesis (GO:0048705)|tissue homeostasis (GO:0001894)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|central_nervous_system(3)|endometrium(17)|kidney(2)|large_intestine(18)|lung(20)|ovary(6)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	83		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)		TTCTGGGACAGCATCCTCTCG	0.602																																																	0								ENSG00000167522						77.0	71.0	73.0					16																	89348191		2198	4300	6498	ANKRD11	SO:0001819	synonymous_variant	0			-	HGNC	AY373756	CCDS32513.1	16q24.3	2013-01-10				ENSG00000167522		"""Ankyrin repeat domain containing"""	21316	protein-coding gene	gene with protein product		611192				11483580	Standard	NM_001256182		Approved	LZ16, T13	uc002fnc.2	Q6UB99		ENST00000301030.4:c.4759C>T	16.37:g.89348191G>A		Somatic	0	43	0.00		0.4120429396410797	107	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	9	35.71	Q6NTG1|Q6QMF8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.L1587	ENST00000301030.4	37	c.4759	CCDS32513.1	16																																																																																			-	NULL		0.602	ANKRD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD11	protein_coding	OTTHUMT00000430462.3	G	NM_013275	-		89348191	-1	no_errors	ENST00000301030	ensembl	human	known	74_37	silent	SNP	1.000	A
FSCB	84075	genome.wustl.edu	37	14	44975802	44975802	+	Missense_Mutation	SNP	C	C	A			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr14:44975802C>A	ENST00000340446.4	-	1	680	c.389G>T	c.(388-390)aGa>aTa	p.R130I	RP11-163M18.1_ENST00000557465.1_RNA|RP11-163M18.1_ENST00000555433.1_RNA|RP11-163M18.1_ENST00000556228.1_RNA	NM_032135.3	NP_115511.3	Q5H9T9	FSCB_HUMAN	fibrous sheath CABYR binding protein	130						sperm fibrous sheath (GO:0035686)|sperm principal piece (GO:0097228)	calcium ion binding (GO:0005509)			breast(4)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(10)|lung(47)|ovary(2)|pancreas(1)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	89				GBM - Glioblastoma multiforme(112;0.128)		CTGCTGAGATCTGTCCATTTT	0.423																																																	0								ENSG00000189139						194.0	196.0	195.0					14																	44975802		2203	4300	6503	FSCB	SO:0001583	missense	0			-	HGNC	AK124110	CCDS9679.1	14q21.3	2007-11-22	2007-11-22	2007-11-22	ENSG00000189139	ENSG00000189139			20494	protein-coding gene	gene with protein product		611779	"""chromosome 14 open reading frame 155"""	C14orf155		17855365	Standard	NM_032135		Approved	DKFZP434F1017	uc001wvn.3	Q5H9T9	OTTHUMG00000140262	ENST00000340446.4:c.389G>T	14.37:g.44975802C>A	ENSP00000344579:p.Arg130Ile	Somatic	0	52	0.00		0.4120429396410797	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	30	11.76	Q5H9U7|Q86YI2|Q9H0J3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.R130I	ENST00000340446.4	37	c.389	CCDS9679.1	14	.	.	.	.	.	.	.	.	.	.	C	15.83	2.947788	0.53186	.	.	ENSG00000189139	ENST00000340446;ENST00000537803	T	0.27104	1.69	5.26	5.26	0.73747	.	.	.	.	.	T	0.44498	0.1296	L	0.59436	1.845	0.42819	D	0.993982	D	0.89917	1.0	D	0.80764	0.994	T	0.37596	-0.9699	9	0.87932	D	0	-15.1677	10.2356	0.43282	0.0:0.9098:0.0:0.0902	.	130	Q5H9T9	FSCB_HUMAN	I	130	ENSP00000344579:R130I	ENSP00000344579:R130I	R	-	2	0	FSCB	44045552	1.000000	0.71417	1.000000	0.80357	0.370000	0.29829	1.106000	0.31098	2.648000	0.89879	0.561000	0.74099	AGA	-	NULL		0.423	FSCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FSCB	protein_coding	OTTHUMT00000276788.1	C	NM_032135	-		44975802	-1	no_errors	ENST00000340446	ensembl	human	known	74_37	missense	SNP	1.000	A
APOBR	55911	genome.wustl.edu	37	16	28507458	28507458	+	Missense_Mutation	SNP	G	G	A			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr16:28507458G>A	ENST00000431282.1	+	3	1079	c.1069G>A	c.(1069-1071)Gcc>Acc	p.A357T	APOBR_ENST00000564831.1_Missense_Mutation_p.A366T|APOBR_ENST00000328423.5_Missense_Mutation_p.A357T|CLN3_ENST00000569430.1_5'Flank|CLN3_ENST00000567160.1_5'Flank			Q0VD83	APOBR_HUMAN	apolipoprotein B receptor	357	Glu-rich.				cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|triglyceride metabolic process (GO:0006641)	chylomicron (GO:0042627)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	very-low-density lipoprotein particle receptor activity (GO:0030229)			breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(11)|prostate(1)|skin(2)|stomach(1)	29						GGCCGGGACAGCCTCAGGAGG	0.667																																																	0								ENSG00000184730						16.0	19.0	18.0					16																	28507458		1959	4109	6068	APOBR	SO:0001583	missense	0			-	HGNC	AK025123	CCDS58442.1	16p11.2	2011-02-14			ENSG00000184730	ENSG00000184730			24087	protein-coding gene	gene with protein product	"""apolipoprotein B48 receptor"", ""apolipoprotein B100 receptor"""	605220				10852956	Standard	NM_018690		Approved	APOB48R, APOB100R	uc002dqb.2	Q0VD83		ENST00000431282.1:c.1069G>A	16.37:g.28507458G>A	ENSP00000416094:p.Ala357Thr	Somatic	0	46	0.00		0.4120429396410797	15	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	33	17.50	H3BU97|Q0VD81|Q8NC15|Q9NPJ9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.A366T	ENST00000431282.1	37	c.1096		16	.	.	.	.	.	.	.	.	.	.	G	13.61	2.288719	0.40494	.	.	ENSG00000184730	ENST00000328423;ENST00000431282	T;T	0.60299	0.2;0.2	3.92	-4.9	0.03094	.	.	.	.	.	T	0.34395	0.0896	N	0.19112	0.55	0.09310	N	1	B	0.30146	0.27	B	0.29524	0.103	T	0.20371	-1.0277	9	0.34782	T	0.22	6.3641	6.5262	0.22303	0.3857:0.1261:0.4882:0.0	.	357	Q9NS13	.	T	357	ENSP00000327669:A357T;ENSP00000416094:A357T	ENSP00000327669:A357T	A	+	1	0	APOBR	28414959	0.000000	0.05858	0.000000	0.03702	0.068000	0.16541	-2.026000	0.01434	-0.919000	0.03803	-0.382000	0.06688	GCC	-	NULL		0.667	APOBR-202	KNOWN	basic|appris_candidate	protein_coding	APOBR	protein_coding		G	NM_182804	-		28507458	+1	no_errors	ENST00000564831	ensembl	human	known	74_37	missense	SNP	0.002	A
LOC100131347	100131347	genome.wustl.edu	37	17	37213382	37213382	+	RNA	SNP	G	G	T			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr17:37213382G>T	ENST00000583447.1	+	0	111					NR_036551.1																						TGTGGGAGCTGAGCTCTGGAC	0.622																																																	0								ENSG00000263818																																			CTD-2206N4.4			0			-	Clone_based_vega_gene																													17.37:g.37213382G>T		Somatic	0	66	0.00		0.4120429396410797	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.16		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000583447.1	37	NULL		17																																																																																			-	-		0.622	CTD-2206N4.4-003	KNOWN	basic	processed_transcript	LOC100131347	pseudogene	OTTHUMT00000444106.1	G		-		37213382	+1	no_errors	ENST00000578423	ensembl	human	known	74_37	rna	SNP	0.986	T
HIF1A	3091	genome.wustl.edu	37	14	62199177	62199177	+	Missense_Mutation	SNP	G	G	T			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr14:62199177G>T	ENST00000337138.4	+	7	1080	c.815G>T	c.(814-816)gGc>gTc	p.G272V	HIF1A-AS2_ENST00000554254.1_lincRNA|HIF1A_ENST00000394997.1_Missense_Mutation_p.G273V|HIF1A_ENST00000323441.6_Missense_Mutation_p.G272V|HIF1A_ENST00000557538.1_Missense_Mutation_p.G213V|HIF1A_ENST00000539097.1_Missense_Mutation_p.G296V|RP11-618G20.1_ENST00000555937.1_RNA	NM_001530.3	NP_001521.1	Q16665	HIF1A_HUMAN	hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor)	272	Interaction with TSGA10. {ECO:0000250}.|PAS 2. {ECO:0000255|PROSITE- ProRule:PRU00140}.				angiogenesis (GO:0001525)|axon transport of mitochondrion (GO:0019896)|B-1 B cell homeostasis (GO:0001922)|cardiac ventricle morphogenesis (GO:0003208)|cartilage development (GO:0051216)|cellular iron ion homeostasis (GO:0006879)|cellular response to hypoxia (GO:0071456)|cellular response to interleukin-1 (GO:0071347)|cerebral cortex development (GO:0021987)|collagen metabolic process (GO:0032963)|connective tissue replacement involved in inflammatory response wound healing (GO:0002248)|digestive tract morphogenesis (GO:0048546)|dopaminergic neuron differentiation (GO:0071542)|elastin metabolic process (GO:0051541)|embryonic hemopoiesis (GO:0035162)|embryonic placenta development (GO:0001892)|epithelial cell differentiation involved in mammary gland alveolus development (GO:0061030)|epithelial to mesenchymal transition (GO:0001837)|glucose homeostasis (GO:0042593)|heart looping (GO:0001947)|hemoglobin biosynthetic process (GO:0042541)|intestinal epithelial cell maturation (GO:0060574)|lactate metabolic process (GO:0006089)|lactation (GO:0007595)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of bone mineralization (GO:0030502)|negative regulation of growth (GO:0045926)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903377)|negative regulation of thymocyte apoptotic process (GO:0070244)|negative regulation of TOR signaling (GO:0032007)|neural crest cell migration (GO:0001755)|neural fold elevation formation (GO:0021502)|Notch signaling pathway (GO:0007219)|outflow tract morphogenesis (GO:0003151)|oxygen homeostasis (GO:0032364)|positive regulation of angiogenesis (GO:0045766)|positive regulation of chemokine production (GO:0032722)|positive regulation of chemokine-mediated signaling pathway (GO:0070101)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of glycolytic process (GO:0045821)|positive regulation of hormone biosynthetic process (GO:0046886)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of gene expression (GO:0010468)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0043619)|regulation of transcription, DNA-templated (GO:0006355)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|response to muscle activity (GO:0014850)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction (GO:0007165)|vascular endothelial growth factor production (GO:0010573)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|motile cilium (GO:0031514)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|Hsp90 protein binding (GO:0051879)|nuclear hormone receptor binding (GO:0035257)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)|transcription factor binding transcription factor activity (GO:0000989)|ubiquitin protein ligase binding (GO:0031625)			breast(2)|endometrium(8)|kidney(6)|large_intestine(3)|lung(4)	23				OV - Ovarian serous cystadenocarcinoma(108;1.62e-09)|BRCA - Breast invasive adenocarcinoma(234;0.189)	Carvedilol(DB01136)	GAACTTTTAGGCCGCTCAATT	0.318																																																	0								ENSG00000100644						139.0	142.0	141.0					14																	62199177		2203	4300	6503	HIF1A	SO:0001583	missense	0			-	HGNC	U22431	CCDS9753.1, CCDS9754.1, CCDS58324.1	14q23.2	2013-05-21	2008-12-02		ENSG00000100644	ENSG00000100644		"""Basic helix-loop-helix proteins"""	4910	protein-coding gene	gene with protein product		603348				8786149, 9079689	Standard	NM_001530		Approved	MOP1, HIF-1alpha, PASD8, HIF1, bHLHe78	uc001xfq.2	Q16665	OTTHUMG00000140344	ENST00000337138.4:c.815G>T	14.37:g.62199177G>T	ENSP00000338018:p.Gly272Val	Somatic	0	31	0.00		0.4120429396410797	462	0.21	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52	C0LZJ3|Q53XP6|Q96PT9|Q9UPB1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PAS_fold_3,pfam_HIF-1_TAD_C,pfam_HIF_alpha_subunit,pfam_PAS_fold,superfamily_PAS,superfamily_bHLH_dom,smart_bHLH_dom,smart_PAS,smart_PAC,prints_HIF-1_alpha,pfscan_PAS,pfscan_bHLH_dom,tigrfam_PAS	p.G296V	ENST00000337138.4	37	c.887	CCDS9753.1	14	.	.	.	.	.	.	.	.	.	.	G	20.1	3.932551	0.73442	.	.	ENSG00000100644	ENST00000539494;ENST00000394988;ENST00000337138;ENST00000394997;ENST00000323441;ENST00000557538;ENST00000539097	T;T;T;T;T	0.35421	1.31;1.31;1.31;1.31;1.31	5.57	4.68	0.58851	PAS fold-3 (1);PAS (3);	0.143104	0.64402	D	0.000005	T	0.64918	0.2642	M	0.86805	2.84	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.996;0.997;0.997	T	0.72472	-0.4283	10	0.87932	D	0	.	14.4042	0.67071	0.0711:0.0:0.9289:0.0	.	273;272;272	A8MYV6;D0VY79;Q16665	.;.;HIF1A_HUMAN	V	23;213;272;273;272;213;296	ENSP00000338018:G272V;ENSP00000378446:G273V;ENSP00000323326:G272V;ENSP00000451696:G213V;ENSP00000437955:G296V	ENSP00000323326:G272V	G	+	2	0	HIF1A	61268930	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.262000	0.65501	1.348000	0.45733	0.650000	0.86243	GGC	-	pfam_PAS_fold_3,pfam_PAS_fold,superfamily_PAS,smart_PAS,pfscan_PAS,tigrfam_PAS		0.318	HIF1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	HIF1A	protein_coding	OTTHUMT00000276977.2	G	NM_001530	-		62199177	+1	no_errors	ENST00000539097	ensembl	human	known	74_37	missense	SNP	1.000	T
ODF3	113746	genome.wustl.edu	37	11	197587	197587	+	Missense_Mutation	SNP	C	C	A			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr11:197587C>A	ENST00000325113.4	+	3	453	c.136C>A	c.(136-138)Ctg>Atg	p.L46M	ODF3_ENST00000525282.1_Missense_Mutation_p.L46M|ODF3_ENST00000342593.5_Missense_Mutation_p.L46M|BET1L_ENST00000410108.1_Intron	NM_053280.3	NP_444510.2	Q96PU9	ODF3A_HUMAN	outer dense fiber of sperm tails 3	46					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	outer dense fiber (GO:0001520)				biliary_tract(1)|breast(1)|kidney(1)|large_intestine(2)|ovary(1)|prostate(2)|skin(1)	9		all_cancers(49;9.23e-07)|all_epithelial(84;0.000315)|Breast(177;0.00122)|Ovarian(85;0.0202)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;3.95e-27)|Epithelial(43;2.66e-26)|OV - Ovarian serous cystadenocarcinoma(40;5.55e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.105)|LUSC - Lung squamous cell carcinoma(625;0.122)		GCCCACCAAGCTGCGTGCACC	0.637																																																	0								ENSG00000177947						40.0	39.0	40.0					11																	197587		2203	4300	6503	ODF3	SO:0001583	missense	0			-	HGNC	AB067774	CCDS7688.1, CCDS65981.1	11p15.5	2010-04-23			ENSG00000177947	ENSG00000177947			19905	protein-coding gene	gene with protein product	"""cancer/testis antigen 135"""	608356				11870087	Standard	NM_001286136		Approved	SHIPPO1, hSHIPPO, CT135	uc001lob.3	Q96PU9	OTTHUMG00000119073	ENST00000325113.4:c.136C>A	11.37:g.197587C>A	ENSP00000325868:p.Leu46Met	Somatic	0	84	0.00		0.4120429396410797	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	39	9.30	B7ZLT0|Q69YX0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SHIPPO-rpt	p.L46M	ENST00000325113.4	37	c.136	CCDS7688.1	11	.	.	.	.	.	.	.	.	.	.	C	9.055	0.993045	0.19043	.	.	ENSG00000177947	ENST00000325113;ENST00000540150;ENST00000342593;ENST00000525282	T;T;T	0.31247	1.5;1.53;1.51	5.02	3.15	0.36227	.	0.979822	0.08319	N	0.964239	T	0.32224	0.0822	N	0.24115	0.695	0.23174	N	0.99817	P;P;P	0.52577	0.891;0.852;0.954	P;P;P	0.55222	0.694;0.653;0.771	T	0.18681	-1.0329	10	0.30078	T	0.28	-5.7958	7.8334	0.29355	0.0:0.8069:0.0:0.1931	.	46;46;46	B7ZLT0;F8W6Z3;Q96PU9	.;.;ODF3A_HUMAN	M	46	ENSP00000325868:L46M;ENSP00000339623:L46M;ENSP00000436588:L46M	ENSP00000325868:L46M	L	+	1	2	ODF3	187587	0.053000	0.20554	0.496000	0.27539	0.003000	0.03518	0.502000	0.22594	0.641000	0.30601	0.561000	0.74099	CTG	-	NULL		0.637	ODF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ODF3	protein_coding	OTTHUMT00000239287.1	C		-		197587	+1	no_errors	ENST00000325113	ensembl	human	known	74_37	missense	SNP	0.569	A
ZC3HAV1	56829	genome.wustl.edu	37	7	138764595	138764595	+	Silent	SNP	G	G	T			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr7:138764595G>T	ENST00000242351.5	-	4	1408	c.1092C>A	c.(1090-1092)tcC>tcA	p.S364S	ZC3HAV1_ENST00000464606.1_Silent_p.S364S|ZC3HAV1_ENST00000471652.1_Silent_p.S364S	NM_020119.3	NP_064504.2	Q7Z2W4	ZCCHV_HUMAN	zinc finger CCCH-type, antiviral 1	364					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of viral genome replication (GO:0045071)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of mRNA catabolic process (GO:0061014)|positive regulation of RIG-I signaling pathway (GO:1900246)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(4)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|prostate(4)|skin(1)	37						CATTCGTCCAGGATGTGAGGC	0.537																																																	0								ENSG00000105939						124.0	130.0	128.0					7																	138764595		2203	4300	6503	ZC3HAV1	SO:0001819	synonymous_variant	0			-	HGNC	BX571742	CCDS5851.1, CCDS55171.1	7q34	2012-07-05			ENSG00000105939	ENSG00000105939		"""Zinc fingers, CCCH-type domain containing"", ""Poly (ADP-ribose) polymerases"""	23721	protein-coding gene	gene with protein product	"""zinc finger antiviral protein"", "" CCCH-type zinc finger antiviral protein"""	607312				12215647, 12851707	Standard	NM_024625		Approved	ZAP, FLB6421, FLJ13288, MGC48898, ZC3HDC2, ZC3H2, PARP13	uc003vun.3	Q7Z2W4	OTTHUMG00000157471	ENST00000242351.5:c.1092C>A	7.37:g.138764595G>T		Somatic	0	53	0.00		0.4120429396410797	42	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	A4D1R2|A4D1S4|Q8IW57|Q8TAJ3|Q96N79|Q9H8R9|Q9P0Y7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Poly(ADP-ribose)pol_cat_dom,pfscan_WWE-dom,pfscan_Poly(ADP-ribose)pol_cat_dom	p.S364	ENST00000242351.5	37	c.1092	CCDS5851.1	7																																																																																			-	NULL		0.537	ZC3HAV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZC3HAV1	protein_coding	OTTHUMT00000348915.1	G	NM_020119	-		138764595	-1	no_errors	ENST00000242351	ensembl	human	known	74_37	silent	SNP	0.001	T
MYH9	4627	genome.wustl.edu	37	22	36688042	36688042	+	Missense_Mutation	SNP	T	T	G			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr22:36688042T>G	ENST00000216181.5	-	31	4564	c.4334A>C	c.(4333-4335)aAg>aCg	p.K1445T		NM_002473.4	NP_002464.1	P35579	MYH9_HUMAN	myosin, heavy chain 9, non-muscle	1445					actin cytoskeleton reorganization (GO:0031532)|actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|angiogenesis (GO:0001525)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood vessel endothelial cell migration (GO:0043534)|cytokinesis (GO:0000910)|establishment of meiotic spindle localization (GO:0051295)|establishment of T cell polarity (GO:0001768)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|meiotic spindle organization (GO:0000212)|membrane protein ectodomain proteolysis (GO:0006509)|monocyte differentiation (GO:0030224)|myoblast fusion (GO:0007520)|platelet aggregation (GO:0070527)|platelet formation (GO:0030220)|protein transport (GO:0015031)|regulation of cell shape (GO:0008360)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|uropod organization (GO:0032796)	actin cytoskeleton (GO:0015629)|actomyosin (GO:0042641)|actomyosin contractile ring (GO:0005826)|cell leading edge (GO:0031252)|cell-cell adherens junction (GO:0005913)|cleavage furrow (GO:0032154)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle (GO:0001726)|spindle (GO:0005819)|stress fiber (GO:0001725)|uropod (GO:0001931)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)|protein anchor (GO:0043495)|protein homodimerization activity (GO:0042803)			NS(1)|breast(8)|central_nervous_system(3)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(16)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(3)	86						CTGGTCAAACTTCTTCTGCTT	0.592			T	ALK	ALCL		"""Deafness, autosomal dominant 17, Epstein syndrome, Fechtner syndrome, May-Hegglin anomaly, Sebastian syndrome"""		Hereditary Macrothrombocytopenia, MYH9-associated																															Dom	yes		22	22q13.1	4627	"""myosin, heavy polypeptide 9, non-muscle"""	yes	L	0								ENSG00000100345						75.0	67.0	70.0					22																	36688042		2203	4300	6503	MYH9	SO:0001583	missense	0	Familial Cancer Database	MYHIIA syndrome, incl. Fechtner Syndrome, FTNS, and May-Hegglin Anomaly, MHA	-	HGNC		CCDS13927.1	22q13.1	2014-09-17	2006-09-29		ENSG00000100345	ENSG00000100345		"""Myosins / Myosin superfamily : Class II"""	7579	protein-coding gene	gene with protein product	"""nonmuscle myosin heavy chain II-A"""	160775	"""myosin, heavy polypeptide 9, non-muscle"""	DFNA17		1860190, 11023810	Standard	NM_002473		Approved	NMMHCA, NMHC-II-A, MHA, FTNS, EPSTS	uc003apg.3	P35579	OTTHUMG00000030429	ENST00000216181.5:c.4334A>C	22.37:g.36688042T>G	ENSP00000216181:p.Lys1445Thr	Somatic	0	67	0.00		0.4120429396410797	499	19.26	119	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	28	31.71	A8K6E4|O60805|Q60FE2|Q86T83	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,superfamily_Regulat_G_prot_signal_superfam,superfamily_Prefoldin,superfamily_Myosin_S1_N,superfamily_STAT_TF_coiled-coil,superfamily_tRNA-bd_arm,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.K1445T	ENST00000216181.5	37	c.4334	CCDS13927.1	22	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	24.2|24.2	4.505516|4.505516	0.85282|0.85282	.|.	.|.	ENSG00000100345|ENSG00000100345	ENST00000337818;ENST00000216181|ENST00000397231	D|.	0.85629|.	-2.01|.	4.8|4.8	4.8|4.8	0.61643|0.61643	Myosin tail (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.74604|0.74604	0.3738|0.3738	M|M	0.74546|0.74546	2.27|2.27	0.80722|0.80722	D|D	1|1	D|.	0.56035|.	0.974|.	D|.	0.64144|.	0.922|.	T|T	0.77672|0.77672	-0.2500|-0.2500	10|6	0.72032|0.56958	D|D	0.01|0.05	.|.	14.631|14.631	0.68655|0.68655	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	1445|.	P35579|.	MYH9_HUMAN|.	T|R	867;1445|48	ENSP00000216181:K1445T|.	ENSP00000216181:K1445T|ENSP00000380408:S48R	K|S	-|-	2|1	0|0	MYH9|MYH9	35017988|35017988	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.982000|0.982000	0.71751|0.71751	7.919000|7.919000	0.87513|0.87513	1.906000|1.906000	0.55180|0.55180	0.379000|0.379000	0.24179|0.24179	AAG|AGT	-	pfam_Myosin_tail		0.592	MYH9-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	MYH9	protein_coding	OTTHUMT00000259110.3	T	NM_002473	-		36688042	-1	no_errors	ENST00000216181	ensembl	human	known	74_37	missense	SNP	1.000	G
PTTG1IP	754	genome.wustl.edu	37	21	46276197	46276197	+	Silent	SNP	G	G	A			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr21:46276197G>A	ENST00000330938.3	-	4	580	c.360C>T	c.(358-360)tgC>tgT	p.C120C	PTTG1IP_ENST00000494690.1_5'UTR|PTTG1IP_ENST00000445724.2_Intron|PTTG1IP_ENST00000397887.3_Intron|PTTG1IP_ENST00000397886.3_Silent_p.C99C	NM_004339.3	NP_004330.1	P53801	PTTG_HUMAN	pituitary tumor-transforming 1 interacting protein	120	Poly-Cys.				multicellular organismal development (GO:0007275)|protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	receptor activity (GO:0004872)			ovary(1)|prostate(1)	2				Colorectal(79;0.0659)		TCCTCCTGCAGCAGCAGCAGC	0.612																																																	0								ENSG00000183255						112.0	90.0	97.0					21																	46276197		2203	4300	6503	PTTG1IP	SO:0001819	synonymous_variant	0			-	HGNC	AF149785	CCDS13715.1, CCDS68221.1	21q22.3	2008-07-04			ENSG00000183255	ENSG00000183255			13524	protein-coding gene	gene with protein product		603784		C21orf3, C21orf1		9570958, 10830953	Standard	NM_004339		Approved	PBF	uc002zgb.2	P53801	OTTHUMG00000090254	ENST00000330938.3:c.360C>T	21.37:g.46276197G>A		Somatic	0	107	0.00		0.4120429396410797	589	23.38	180	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	77	10.34	B2RDP7|D3DSL9|Q9NS09	Silent	SNP	NA	NA	NA	NA	NA	NA	smart_Plexin-like_fold	p.C120	ENST00000330938.3	37	c.360	CCDS13715.1	21																																																																																			-	NULL		0.612	PTTG1IP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTTG1IP	protein_coding	OTTHUMT00000206553.1	G		-		46276197	-1	no_errors	ENST00000330938	ensembl	human	known	74_37	silent	SNP	1.000	A
FAM208B	54906	genome.wustl.edu	37	10	5788196	5788196	+	Missense_Mutation	SNP	T	T	C			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr10:5788196T>C	ENST00000328090.5	+	15	3437	c.2812T>C	c.(2812-2814)Tcg>Ccg	p.S938P	RP11-336A10.2_ENST00000411512.2_RNA	NM_017782.4	NP_060252	Q5VWN6	F208B_HUMAN	family with sequence similarity 208, member B	938																	TCTTGTGCTTTCGGGTATTGG	0.383																																																	0								ENSG00000108021						129.0	130.0	130.0					10																	5788196		1853	4102	5955	FAM208B	SO:0001583	missense	0			-	HGNC	BX649177	CCDS41485.1	10p15.1	2011-09-14	2011-09-14	2011-09-14	ENSG00000108021	ENSG00000108021			23484	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 18"""	C10orf18		12477932	Standard	NM_017782		Approved	FLJ20360, bA318E3.2, KIAA2006	uc001iij.3	Q5VWN6	OTTHUMG00000017605	ENST00000328090.5:c.2812T>C	10.37:g.5788196T>C	ENSP00000328426:p.Ser938Pro	Somatic	0	174	0.00		0.4120429396410797	3	72.73	8	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	101	14.29	Q2YD91|Q5VWN5|Q6ZRQ8|Q8IVG4|Q9BUZ7|Q9H5J9|Q9H7A4|Q9H996|Q9NXA1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF3715,pfam_DUF3699	p.S938P	ENST00000328090.5	37	c.2812	CCDS41485.1	10	.	.	.	.	.	.	.	.	.	.	T	9.777	1.174323	0.21704	.	.	ENSG00000108021	ENST00000328090	D	0.98455	-4.94	5.6	4.46	0.54185	.	0.128560	0.36134	N	0.002779	D	0.95959	0.8684	L	0.43701	1.375	0.29636	N	0.845077	B	0.34161	0.439	B	0.37422	0.249	D	0.93239	0.6624	10	0.51188	T	0.08	.	8.3516	0.32305	0.0:0.0892:0.0:0.9108	.	938	Q5VWN6	F208B_HUMAN	P	938	ENSP00000328426:S938P	ENSP00000328426:S938P	S	+	1	0	C10orf18	5828202	0.110000	0.22057	0.478000	0.27316	0.222000	0.24845	0.517000	0.22832	0.934000	0.37316	0.533000	0.62120	TCG	-	pfam_DUF3715		0.383	FAM208B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM208B	protein_coding	OTTHUMT00000046571.2	T	NM_017782	-		5788196	+1	no_errors	ENST00000328090	ensembl	human	known	74_37	missense	SNP	0.962	C
PSD2	84249	genome.wustl.edu	37	5	139201548	139201548	+	Missense_Mutation	SNP	C	C	A			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr5:139201548C>A	ENST00000274710.3	+	6	1373	c.1168C>A	c.(1168-1170)Cgc>Agc	p.R390S		NM_032289.2	NP_115665.1	Q9BQI7	PSD2_HUMAN	pleckstrin and Sec7 domain containing 2	390	SEC7. {ECO:0000255|PROSITE- ProRule:PRU00189}.				neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phospholipid binding (GO:0005543)			breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(10)|liver(2)|lung(15)|ovary(1)|prostate(2)	38			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACACTTCTCCCGCCGGTACTG	0.607																																																	0								ENSG00000146005						161.0	124.0	137.0					5																	139201548		2203	4300	6503	PSD2	SO:0001583	missense	0			-	HGNC	AL136559	CCDS4216.1	5q31.3	2013-01-10			ENSG00000146005	ENSG00000146005		"""Pleckstrin homology (PH) domain containing"""	19092	protein-coding gene	gene with protein product							Standard	NM_032289		Approved	DKFZp761B0514	uc003leu.1	Q9BQI7	OTTHUMG00000129240	ENST00000274710.3:c.1168C>A	5.37:g.139201548C>A	ENSP00000274710:p.Arg390Ser	Somatic	0	38	0.00		0.4120429396410797	13	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	33	10.81	D3DQD3|Q8N3J8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Sec7_dom,pfam_Pleckstrin_homology,superfamily_Sec7_dom,smart_Sec7_dom,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Sec7_dom,prints_PH_dom-spectrin-type	p.R390S	ENST00000274710.3	37	c.1168	CCDS4216.1	5	.	.	.	.	.	.	.	.	.	.	c	15.28	2.787102	0.49997	.	.	ENSG00000146005	ENST00000274710	T	0.54071	0.59	5.1	4.09	0.47781	SEC7-like, alpha orthogonal bundle (1);SEC7-like (4);	0.165537	0.50627	D	0.000111	T	0.36826	0.0981	N	0.16066	0.365	0.40954	D	0.984567	B	0.09022	0.002	B	0.20577	0.03	T	0.20840	-1.0263	10	0.35671	T	0.21	.	14.9782	0.71293	0.1863:0.8137:0.0:0.0	.	390	Q9BQI7	PSD2_HUMAN	S	390	ENSP00000274710:R390S	ENSP00000274710:R390S	R	+	1	0	PSD2	139181732	0.977000	0.34250	1.000000	0.80357	0.983000	0.72400	2.393000	0.44442	2.539000	0.85634	0.509000	0.49947	CGC	-	pfam_Sec7_dom,superfamily_Sec7_dom,smart_Sec7_dom,pfscan_Sec7_dom		0.607	PSD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSD2	protein_coding	OTTHUMT00000251339.1	C	NM_032289	-		139201548	+1	no_errors	ENST00000274710	ensembl	human	known	74_37	missense	SNP	0.999	A
BACE2	25825	genome.wustl.edu	37	21	42647759	42647760	+	3'UTR	INS	-	-	A	rs11448311|rs112413372	byFrequency	TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr21:42647759_42647760insA	ENST00000330333.6	+	0	2228_2229				BACE2_ENST00000328735.6_3'UTR|BACE2_ENST00000347667.5_3'UTR|BACE2_ENST00000466122.1_3'UTR	NM_012105.3	NP_036237.2	Q9Y5Z0	BACE2_HUMAN	beta-site APP-cleaving enzyme 2						membrane protein ectodomain proteolysis (GO:0006509)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|peptide hormone processing (GO:0016486)|proteolysis (GO:0006508)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	aspartic-type endopeptidase activity (GO:0004190)			endometrium(2)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14		Prostate(19;1.57e-07)|all_epithelial(19;0.0251)				GAAAAATAATTAAAAAAAAAAC	0.386																																																	0								ENSG00000182240																																			BACE2	SO:0001624	3_prime_UTR_variant	0				HGNC	AF117892	CCDS13668.1, CCDS13669.1, CCDS13670.1	21q22.3	2011-08-11			ENSG00000182240	ENSG00000182240			934	protein-coding gene	gene with protein product		605668		AEPLC		10965118, 10830953	Standard	NM_138991		Approved	CEAP1, DRAP, ALP56	uc002yyw.3	Q9Y5Z0	OTTHUMG00000086742	ENST00000330333.6:c.*209->A	21.37:g.42647769_42647769dupA		Somatic	0	37	0.00		0.4120429396410797	215	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	38	11.63	A8K7P1|Q5DIH8|Q8N2D4|Q9H2V8|Q9NZL1|Q9NZL2|Q9UJT6	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000330333.6	37	NULL	CCDS13668.1	21																																																																																			-	-		0.386	BACE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BACE2	protein_coding	OTTHUMT00000195056.1	-				42647760	+1	no_errors	ENST00000466122	ensembl	human	known	74_37	rna	INS	0.000:0.000	A
DRC1	92749	genome.wustl.edu	37	2	26624902	26624902	+	Missense_Mutation	SNP	C	C	G			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr2:26624902C>G	ENST00000288710.2	+	1	119	c.45C>G	c.(43-45)gaC>gaG	p.D15E		NM_145038.2	NP_659475.2	Q96MC2	DRC1_HUMAN	dynein regulatory complex subunit 1	15					axonemal dynein complex assembly (GO:0070286)|bacterial-type flagellum-dependent cell motility (GO:0071973)|cilium-dependent cell motility (GO:0060285)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)											CGAACGTGGACGAGCACTTGT	0.677																																																	0								ENSG00000157856						34.0	30.0	31.0					2																	26624902		2203	4300	6503	DRC1	SO:0001583	missense	0			-	HGNC	AL833892	CCDS1723.1	2p23.3	2014-07-18	2014-07-18	2013-03-14	ENSG00000157856	ENSG00000157856			24245	protein-coding gene	gene with protein product		615288	"""chromosome 2 open reading frame 39"", ""coiled-coil domain containing 164"", ""dynein regulatory complex subunit 1 homolog (Chlamydomonas)"""	C2orf39, CCDC164		23354437	Standard	NM_145038		Approved	MGC16372, FLJ32660, CILD21	uc002rhg.2	Q96MC2	OTTHUMG00000125531	ENST00000288710.2:c.45C>G	2.37:g.26624902C>G	ENSP00000288710:p.Asp15Glu	Somatic	0	249	0.00		0.4120429396410797	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	178	8.21	A8K1N8|Q53R91|Q53TA3|Q8NDI5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.D15E	ENST00000288710.2	37	c.45	CCDS1723.1	2	.	.	.	.	.	.	.	.	.	.	C	0.024	-1.391562	0.01185	.	.	ENSG00000157856	ENST00000288710	T	0.11930	2.73	4.97	-0.914	0.10497	.	0.295281	0.27455	N	0.019294	T	0.03095	0.0091	N	0.01668	-0.77	0.09310	N	0.999992	B	0.06786	0.001	B	0.08055	0.003	T	0.43015	-0.9417	10	0.02654	T	1	-3.8821	7.8279	0.29326	0.1349:0.4747:0.3904:0.0	.	15	Q96MC2	CC164_HUMAN	E	15	ENSP00000288710:D15E	ENSP00000288710:D15E	D	+	3	2	CCDC164	26478406	0.268000	0.24133	0.052000	0.19188	0.011000	0.07611	-0.966000	0.03825	-0.390000	0.07774	0.655000	0.94253	GAC	-	NULL		0.677	DRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DRC1	protein_coding	OTTHUMT00000246862.1	C	NM_145038	-		26624902	+1	no_errors	ENST00000288710	ensembl	human	known	74_37	missense	SNP	0.356	G
PRKCSH	5589	genome.wustl.edu	37	19	11558341	11558346	+	In_Frame_Del	DEL	GAGGAG	GAGGAG	-	rs543211095|rs397840350|rs71166603|rs3217229	byFrequency	TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	GAGGAG	GAGGAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr19:11558341_11558346delGAGGAG	ENST00000589838.1	+	10	937_942	c.937_942delGAGGAG	c.(937-942)gaggagdel	p.EE323del	PRKCSH_ENST00000587327.1_In_Frame_Del_p.EE323del|PRKCSH_ENST00000412601.1_In_Frame_Del_p.EE323del|PRKCSH_ENST00000592741.1_In_Frame_Del_p.EE323del|PRKCSH_ENST00000591462.1_In_Frame_Del_p.EE323del|PRKCSH_ENST00000252455.2_In_Frame_Del_p.EE323del			P14314	GLU2B_HUMAN	protein kinase C substrate 80K-H	323	Glu-rich (acidic).				cellular protein metabolic process (GO:0044267)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|liver development (GO:0001889)|N-glycan processing (GO:0006491)|negative regulation of neuron projection development (GO:0010977)|nitrogen compound metabolic process (GO:0006807)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein heterooligomerization (GO:0051291)|protein N-linked glycosylation via asparagine (GO:0018279)|renal system development (GO:0072001)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|intracellular (GO:0005622)	calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)|phosphoprotein binding (GO:0051219)|protein kinase C binding (GO:0005080)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|pancreas(1)|prostate(3)	19						GTCGCCCACAgaggaggaggaggagg	0.655																																																	0								ENSG00000130175																																			PRKCSH	SO:0001651	inframe_deletion	0				HGNC		CCDS32911.1, CCDS45977.1, CCDS74286.1	19p13.2	2014-01-30			ENSG00000130175	ENSG00000130175	2.7.11.1	"""EF-hand domain containing"""	9411	protein-coding gene	gene with protein product		177060	"""polycystic liver disease"""	G19P1, PCLD, PLD1		12529853	Standard	NM_002743		Approved		uc002mrt.3	P14314	OTTHUMG00000182029	ENST00000589838.1:c.937_942delGAGGAG	19.37:g.11558347_11558352delGAGGAG	ENSP00000465461:p.Glu323_Glu324del	Somatic	NA	NA	NA		0.4120429396410797	249	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A8K318|Q96BU9|Q96D06|Q9P0W9	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_PRKCSH,superfamily_Man6P_isomerase_rcpt-bd_dom,superfamily_LDrepeatLR_classA_rpt,pfscan_EF_hand_dom	p.EE316in_frame_del	ENST00000589838.1	37	c.937_942	CCDS32911.1	19																																																																																			-	NULL		0.655	PRKCSH-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PRKCSH	protein_coding	OTTHUMT00000458817.1	GAGGAG				11558346	+1	no_errors	ENST00000252455	ensembl	human	known	74_37	in_frame_del	DEL	0.997:0.999:0.994:1.000:1.000:0.720	-
THTPA	79178	genome.wustl.edu	37	14	24026503	24026503	+	Missense_Mutation	SNP	C	C	A			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr14:24026503C>A	ENST00000288014.6	+	1	1273	c.537C>A	c.(535-537)agC>agA	p.S179R	RP11-66N24.4_ENST00000555446.1_RNA|THTPA_ENST00000554970.1_Intron|THTPA_ENST00000556015.1_Intron|THTPA_ENST00000404535.3_Missense_Mutation_p.S179R|RP11-66N24.4_ENST00000553985.1_RNA|THTPA_ENST00000554789.1_Intron|RP11-66N24.4_ENST00000556354.1_RNA			Q9BU02	THTPA_HUMAN	thiamine triphosphatase	179	CYTH. {ECO:0000255|PROSITE- ProRule:PRU01044}.				dephosphorylation (GO:0016311)|generation of precursor metabolites and energy (GO:0006091)|small molecule metabolic process (GO:0044281)|thiamine diphosphate metabolic process (GO:0042357)|thiamine metabolic process (GO:0006772)|thiamine-containing compound metabolic process (GO:0042723)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)	hydrolase activity (GO:0016787)|magnesium ion binding (GO:0000287)|thiamin-triphosphatase activity (GO:0050333)			large_intestine(1)|prostate(2)	3	all_cancers(95;0.000251)			GBM - Glioblastoma multiforme(265;0.00643)		ACAGGCTCAGCAGCATGCTTG	0.577																																																	0								ENSG00000259431						31.0	25.0	27.0					14																	24026503		2203	4300	6503	THTPA	SO:0001583	missense	0			-	HGNC	AF432862	CCDS32053.1, CCDS58306.1, CCDS58307.1	14q11.2	2011-04-28					3.6.1.28		18987	protein-coding gene	gene with protein product		611612				11827967	Standard	NR_046051		Approved	THTPASE	uc001wkh.5	Q9BU02		ENST00000288014.6:c.537C>A	14.37:g.24026503C>A	ENSP00000288014:p.Ser179Arg	Somatic	0	30	0.00		0.4120429396410797	47	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	12	25.00	D3DS50|G3V4J3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_CYTH-like_domain,superfamily_CYTH-like_domain,pirsf_ThTPase	p.S179R	ENST00000288014.6	37	c.537	CCDS32053.1	14	.	.	.	.	.	.	.	.	.	.	C	17.24	3.338974	0.60963	.	.	ENSG00000157306	ENST00000404535;ENST00000288014	T;T	0.41758	0.99;0.99	5.04	4.14	0.48551	CYTH domain (2);CYTH-like domain (1);	0.189795	0.56097	D	0.000025	T	0.58104	0.2099	M	0.68317	2.08	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.58358	-0.7650	10	0.51188	T	0.08	-5.898	8.4213	0.32703	0.0:0.8929:0.0:0.1071	.	179	Q9BU02	THTPA_HUMAN	R	179	ENSP00000384580:S179R;ENSP00000288014:S179R	ENSP00000288014:S179R	S	+	3	2	THTPA	23096343	0.899000	0.30636	1.000000	0.80357	0.963000	0.63663	1.267000	0.33050	1.312000	0.45043	0.561000	0.74099	AGC	-	pfam_CYTH-like_domain,superfamily_CYTH-like_domain,pirsf_ThTPase		0.577	THTPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THTPA	protein_coding	OTTHUMT00000413800.2	C		-		24026503	+1	no_errors	ENST00000288014	ensembl	human	known	74_37	missense	SNP	0.994	A
CACTIN	58509	genome.wustl.edu	37	19	3624126	3624126	+	Missense_Mutation	SNP	C	C	T			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr19:3624126C>T	ENST00000429344.2	-	2	254	c.202G>A	c.(202-204)Ggg>Agg	p.G68R	CACTIN_ENST00000221899.3_5'UTR|CACTIN_ENST00000248420.5_Missense_Mutation_p.G68R	NM_001080543.1	NP_001074012.1	Q8WUQ7	CATIN_HUMAN	cactin, spliceosome C complex subunit	68					cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to tumor necrosis factor (GO:0071356)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|multicellular organismal development (GO:0007275)|negative regulation of interferon-beta production (GO:0032688)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of lipopolysaccharide-mediated signaling pathway (GO:0031665)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of type I interferon-mediated signaling pathway (GO:0060339)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)										CTTCGCATCCCTGAGCGCTGC	0.632																																																	0								ENSG00000105298						55.0	65.0	62.0					19																	3624126		1999	4104	6103	CACTIN	SO:0001583	missense	0			-	HGNC	BC019848	CCDS45920.1	19p13.3	2012-06-08	2012-06-08	2012-06-08	ENSG00000105298	ENSG00000105298			29938	protein-coding gene	gene with protein product	"""NY REN 24 antigen"", ""functional spliceosome-associated protein c"", ""cactin homolog (Drosophila)"""		"""chromosome 19 open reading frame 29"""	C19orf29		8619474, 9110174, 21429463, 20829348	Standard	NM_001080543		Approved	NY-REN-24, fSAPc, cactin	uc002lyh.3	Q8WUQ7		ENST00000429344.2:c.202G>A	19.37:g.3624126C>T	ENSP00000415078:p.Gly68Arg	Somatic	0	58	0.00		0.4120429396410797	24	22.58	7	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	47	9.62	A6NNA9|A9UL12|O75229|Q7LE08|Q9BTA6|Q9Y5A4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cactin_dom,pfam_Cactin_C	p.G68R	ENST00000429344.2	37	c.202	CCDS45920.1	19	.	.	.	.	.	.	.	.	.	.	C	10.20	1.283977	0.23392	.	.	ENSG00000105298	ENST00000429344;ENST00000248420	.	.	.	4.71	-4.18	0.03846	.	.	.	.	.	T	0.07279	0.0184	N	0.01705	-0.755	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.35992	-0.9766	8	0.08837	T	0.75	.	1.2739	0.02027	0.1361:0.346:0.2668:0.2511	.	68	Q8WUQ7	CS029_HUMAN	R	68	.	ENSP00000248420:G68R	G	-	1	0	C19orf29	3575126	0.000000	0.05858	0.012000	0.15200	0.342000	0.28953	-0.526000	0.06207	-0.173000	0.10761	0.561000	0.74099	GGG	-	NULL		0.632	CACTIN-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	CACTIN	protein_coding	OTTHUMT00000457370.2	C		-		3624126	-1	no_errors	ENST00000248420	ensembl	human	known	74_37	missense	SNP	0.001	T
DDX10	1662	genome.wustl.edu	37	11	108788635	108788637	+	In_Frame_Del	DEL	TGA	TGA	-			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	TGA	TGA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr11:108788635_108788637delTGA	ENST00000322536.3	+	17	2469_2471	c.2340_2342delTGA	c.(2338-2343)agtgat>agt	p.D788del	DDX10_ENST00000526794.1_In_Frame_Del_p.D788del	NM_004398.2	NP_004389.2	Q13206	DDX10_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 10	788					metabolic process (GO:0008152)		ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)			breast(2)|endometrium(5)|kidney(2)|large_intestine(4)|lung(11)|pancreas(1)|prostate(2)	27		all_cancers(61;1.29e-11)|all_epithelial(67;2.96e-07)|Melanoma(852;1.54e-05)|Acute lymphoblastic leukemia(157;4.24e-05)|all_hematologic(158;0.000141)|Breast(348;0.026)|all_neural(223;0.0729)		BRCA - Breast invasive adenocarcinoma(274;2.48e-05)|Epithelial(105;4.35e-05)|all cancers(92;0.000609)|OV - Ovarian serous cystadenocarcinoma(223;0.133)		TGGATTGGAGtgatgatgatgat	0.355			T	NUP98	AML*																																			Dom	yes		11	11q22-q23	1662	DEAD (Asp-Glu-Ala-Asp) box polypeptide 10		L	0								ENSG00000178105			25,260,77,3902		0,2,0,23,4,0,250,5,67,1781						4.9	1.0			85	14,28,155,8057		0,0,0,14,0,0,28,12,131,3942	no	codingComplex	DDX10	NM_004398.2		0,2,0,37,4,0,278,17,198,5723	A1A1,A1A2,A1A3,A1R,A2A2,A2A3,A2R,A3A3,A3R,RR		2.3867,8.4897,4.4656				39,288,232,11959				DDX10	SO:0001651	inframe_deletion	0				HGNC	U28042	CCDS8342.1	11q22-q23	2005-10-11	2003-06-13		ENSG00000178105	ENSG00000178105		"""DEAD-boxes"""	2735	protein-coding gene	gene with protein product		601235	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 10 (RNA helicase)"""			8660968	Standard	NM_004398		Approved	HRH-J8	uc001pkm.3	Q13206	OTTHUMG00000166540	ENST00000322536.3:c.2340_2342delTGA	11.37:g.108788644_108788646delTGA	ENSP00000314348:p.Asp788del	Somatic	0	33	0.00		0.4120429396410797	44	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00	B2RCQ3|Q5BJD8	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.D784in_frame_del	ENST00000322536.3	37	c.2340_2342	CCDS8342.1	11																																																																																			-	NULL		0.355	DDX10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX10	protein_coding	OTTHUMT00000390343.1	TGA	NM_004398			108788637	+1	no_errors	ENST00000322536	ensembl	human	known	74_37	in_frame_del	DEL	0.998:0.997:0.996	-
DCTN1	1639	genome.wustl.edu	37	2	74597633	74597633	+	Missense_Mutation	SNP	G	G	T			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr2:74597633G>T	ENST00000361874.3	-	11	1404	c.1087C>A	c.(1087-1089)Ctt>Att	p.L363I	DCTN1_ENST00000409567.3_Missense_Mutation_p.L343I|DCTN1_ENST00000495643.1_5'Flank|DCTN1_ENST00000409438.1_Missense_Mutation_p.L229I|DCTN1_ENST00000394003.3_Missense_Mutation_p.L356I|DCTN1_ENST00000409868.1_Missense_Mutation_p.L346I|DCTN1_ENST00000407639.2_Missense_Mutation_p.L229I|DCTN1_ENST00000409240.1_Missense_Mutation_p.L326I	NM_004082.4	NP_004073.2	Q14203	DCTN1_HUMAN	dynactin 1	363					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|G2/M transition of mitotic cell cycle (GO:0000086)|melanosome transport (GO:0032402)|microtubule-based transport (GO:0010970)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|nervous system development (GO:0007399)	cell leading edge (GO:0031252)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dynactin complex (GO:0005869)|dynein complex (GO:0030286)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|spindle pole (GO:0000922)	motor activity (GO:0003774)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(20)|ovary(4)|prostate(1)|skin(3)	45						TGCTCCTCAAGCTGCTTGAGC	0.532																																																	0								ENSG00000204843						96.0	85.0	89.0					2																	74597633		2203	4300	6503	DCTN1	SO:0001583	missense	0			-	HGNC		CCDS1939.1, CCDS46341.1, CCDS46342.1, CCDS54368.1, CCDS54369.1	2p13	2014-09-17	2010-06-24		ENSG00000204843	ENSG00000204843			2711	protein-coding gene	gene with protein product	"""p150 glued homolog (Drosophila)"""	601143	"""dynactin 1 (p150, Glued (Drosophila) homolog)"""			1828535	Standard	NM_001190836		Approved		uc002skx.3	Q14203	OTTHUMG00000129963	ENST00000361874.3:c.1087C>A	2.37:g.74597633G>T	ENSP00000354791:p.Leu363Ile	Somatic	0	57	0.00		0.4120429396410797	265	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	41	8.89	A8MY36|B4DM45|E9PFS5|E9PGE1|G5E9H4|O95296|Q6IQ37|Q9BRM9|Q9UIU1|Q9UIU2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Dynactin,pfam_CAP-Gly_domain,superfamily_CAP-Gly_domain,superfamily_Polyketide_synth_docking,superfamily_P-loop_NTPase,pfscan_CAP-Gly_domain	p.L363I	ENST00000361874.3	37	c.1087	CCDS1939.1	2	.	.	.	.	.	.	.	.	.	.	G	28.7	4.943958	0.92593	.	.	ENSG00000204843	ENST00000361874;ENST00000394003;ENST00000393999;ENST00000407639;ENST00000409438;ENST00000409240;ENST00000409868;ENST00000409567	T;T;T;T;T;T;T	0.76578	-1.02;-1.02;-1.02;-1.02;-1.02;-1.03;-1.02	4.98	4.98	0.66077	.	0.000000	0.37906	N	0.001883	D	0.88213	0.6376	M	0.80028	2.48	0.80722	D	1	D;P;D;D;D;D	0.69078	0.994;0.756;0.993;0.989;0.997;0.974	D;B;D;P;D;D	0.71870	0.931;0.293;0.952;0.893;0.975;0.953	D	0.89602	0.3835	10	0.72032	D	0.01	-5.7611	17.1844	0.86863	0.0:0.0:1.0:0.0	.	343;326;363;356;229;229	E9PGE1;E9PFS5;Q14203;A8MY36;Q14203-2;G5E9H4	.;.;DCTN1_HUMAN;.;.;.	I	363;356;346;229;229;326;346;343	ENSP00000354791:L363I;ENSP00000377571:L356I;ENSP00000384844:L229I;ENSP00000387270:L229I;ENSP00000386406:L326I;ENSP00000387327:L346I;ENSP00000386843:L343I	ENSP00000354791:L363I	L	-	1	0	DCTN1	74451141	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	6.431000	0.73395	2.591000	0.87537	0.655000	0.94253	CTT	-	NULL		0.532	DCTN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DCTN1	protein_coding	OTTHUMT00000252227.3	G	NM_004082	-		74597633	-1	no_errors	ENST00000361874	ensembl	human	known	74_37	missense	SNP	1.000	T
RNF40	9810	genome.wustl.edu	37	16	30785330	30785330	+	Silent	SNP	C	C	T			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr16:30785330C>T	ENST00000324685.6	+	20	3336	c.2901C>T	c.(2899-2901)ttC>ttT	p.F967F	RNF40_ENST00000357890.5_Silent_p.F867F|RNF40_ENST00000402121.3_Silent_p.F659F|RNF40_ENST00000563683.1_Silent_p.F927F	NM_001207033.1|NM_014771.3	NP_001193962.1|NP_055586	O75150	BRE1B_HUMAN	ring finger protein 40, E3 ubiquitin protein ligase	967					histone H2B ubiquitination (GO:0033523)|histone monoubiquitination (GO:0010390)|ubiquitin-dependent protein catabolic process (GO:0006511)	HULC complex (GO:0033503)|membrane (GO:0016020)|neuron projection (GO:0043005)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(10)|prostate(2)	30			Colorectal(24;0.198)			TCCACGTTTTCTGCTTCGAGT	0.602																																																	0								ENSG00000103549						171.0	126.0	141.0					16																	30785330		2197	4300	6497	RNF40	SO:0001819	synonymous_variant	0			-	HGNC	AB014561	CCDS10691.1, CCDS55994.1	16p11.2-p11.1	2012-02-23	2012-02-23		ENSG00000103549	ENSG00000103549		"""RING-type (C3HC4) zinc fingers"""	16867	protein-coding gene	gene with protein product	"""BRE1 E3 ubiquitin ligase homolog B (S. cerevisiae)"""	607700	"""ring finger protein 40"""			9734811, 10944455, 12121982	Standard	NM_014771		Approved	KIAA0661, RBP95, BRE1B, STARING	uc002dzq.3	O75150	OTTHUMG00000132394	ENST00000324685.6:c.2901C>T	16.37:g.30785330C>T		Somatic	0	88	0.00		0.4120429396410797	166	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	Q6AHZ6|Q6N005|Q7L3T6|Q8N615|Q96T18|Q9BSV9|Q9HC82	Silent	SNP	NA	NA	NA	NA	NA	NA	smart_Znf_RING,pfscan_Znf_RING	p.F967	ENST00000324685.6	37	c.2901	CCDS10691.1	16																																																																																			-	smart_Znf_RING,pfscan_Znf_RING		0.602	RNF40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF40	protein_coding	OTTHUMT00000255524.2	C	NM_014771	-		30785330	+1	no_errors	ENST00000324685	ensembl	human	known	74_37	silent	SNP	1.000	T
KMT2A	4297	genome.wustl.edu	37	11	118376704	118376704	+	Missense_Mutation	SNP	C	C	A			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr11:118376704C>A	ENST00000389506.5	+	27	10088	c.10088C>A	c.(10087-10089)aCc>aAc	p.T3363N	KMT2A_ENST00000354520.4_Missense_Mutation_p.T3325N|KMT2A_ENST00000534358.1_Missense_Mutation_p.T3366N			Q03164	KMT2A_HUMAN	lysine (K)-specific methyltransferase 2A	3363					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|DNA methylation (GO:0006306)|embryonic hemopoiesis (GO:0035162)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cellular response to drug (GO:2001040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transporter activity (GO:0032411)|protein complex assembly (GO:0006461)|regulation of histone H3-K4 methylation (GO:0051569)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|identical protein binding (GO:0042802)|lysine-acetylated histone binding (GO:0070577)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)										GGACACGTCACCTTAACCAAC	0.488																																																	0								ENSG00000118058						193.0	194.0	193.0					11																	118376704		2200	4295	6495	KMT2A	SO:0001583	missense	0			-	HGNC	L04284	CCDS31686.1, CCDS55791.1	11q23	2014-09-17	2013-05-09	2013-05-09	ENSG00000118058	ENSG00000118058		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7132	protein-coding gene	gene with protein product		159555	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog)"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)"""	MLL		1720549	Standard	NM_001197104		Approved	TRX1, HRX, ALL-1, HTRX1, CXXC7, MLL1A		Q03164	OTTHUMG00000166337	ENST00000389506.5:c.10088C>A	11.37:g.118376704C>A	ENSP00000374157:p.Thr3363Asn	Somatic	0	59	0.00		0.4120429396410797	22	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.00	E9PQG7|Q13743|Q13744|Q14845|Q16364|Q59FF2|Q6UBD1|Q9HBJ3|Q9UD94|Q9UMA3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SET_dom,pfam_FYrich_C,pfam_Znf_PHD-finger,pfam_FYrich_N,pfam_Znf_CXXC,superfamily_Znf_FYVE_PHD,superfamily_Bromodomain,smart_Znf_PHD,smart_Bromodomain,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pirsf_MeTrfase_trithorax,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_CXXC,pfscan_Bromodomain	p.T3363N	ENST00000389506.5	37	c.10088	CCDS31686.1	11	.	.	.	.	.	.	.	.	.	.	C	11.21	1.572438	0.28092	.	.	ENSG00000118058	ENST00000534358;ENST00000389506;ENST00000354520;ENST00000359313	D;D;D	0.82619	-1.63;-1.63;-1.59	5.92	5.92	0.95590	.	0.232366	0.45606	D	0.000343	T	0.76630	0.4014	L	0.40543	1.245	0.33613	D	0.603804	B;B	0.27559	0.181;0.181	B;B	0.20577	0.03;0.03	T	0.79690	-0.1698	10	0.45353	T	0.12	.	14.4639	0.67470	0.0:0.9302:0.0:0.0698	.	3366;3363	E9PQG7;Q03164	.;MLL1_HUMAN	N	3366;3363;3325;2273	ENSP00000436786:T3366N;ENSP00000374157:T3363N;ENSP00000346516:T3325N	ENSP00000346516:T3325N	T	+	2	0	MLL	117881914	0.993000	0.37304	0.547000	0.28179	0.745000	0.42441	5.774000	0.68906	2.809000	0.96659	0.467000	0.42956	ACC	-	pirsf_MeTrfase_trithorax		0.488	KMT2A-015	KNOWN	basic|appris_candidate|CCDS	protein_coding	KMT2A	protein_coding	OTTHUMT00000399085.2	C	NM_005933	-		118376704	+1	no_errors	ENST00000389506	ensembl	human	known	74_37	missense	SNP	0.540	A
PLXNB1	5364	genome.wustl.edu	37	3	48452412	48452412	+	Frame_Shift_Del	DEL	C	C	-			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr3:48452412delC	ENST00000358536.4	-	29	5550	c.5281delG	c.(5281-5283)gcafs	p.A1761fs	PLXNB1_ENST00000465117.1_5'Flank|PLXNB1_ENST00000358459.4_Frame_Shift_Del_p.A1578fs|PLXNB1_ENST00000456774.1_Frame_Shift_Del_p.A1578fs|PLXNB1_ENST00000448774.2_Frame_Shift_Del_p.A372fs|PLXNB1_ENST00000296440.6_Frame_Shift_Del_p.A1761fs	NM_002673.4	NP_002664.2	O43157	PLXB1_HUMAN	plexin B1	1761					axon guidance (GO:0007411)|cell migration (GO:0016477)|intracellular signal transduction (GO:0035556)|negative regulation of cell adhesion (GO:0007162)|negative regulation of osteoblast proliferation (GO:0033689)|neuron projection morphogenesis (GO:0048812)|ossification involved in bone maturation (GO:0043931)|positive regulation of axonogenesis (GO:0050772)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell shape (GO:0008360)|regulation of cytoskeleton organization (GO:0051493)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in bone trabecula morphogenesis (GO:1900220)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	GTPase activating protein binding (GO:0032794)|receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)|semaphorin receptor binding (GO:0030215)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(10)|ovary(3)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	47				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		GCCTCTCCTGCCCCAGGCCCC	0.572																																																	0								ENSG00000164050						47.0	43.0	45.0					3																	48452412		2203	4300	6503	PLXNB1	SO:0001589	frameshift_variant	0				HGNC	X87904	CCDS2765.1	3p21.31	2008-07-18			ENSG00000164050	ENSG00000164050		"""Plexins"""	9103	protein-coding gene	gene with protein product		601053		PLXN5		8570614, 11035813	Standard	XM_005265234		Approved	SEP, KIAA0407	uc003csw.2	O43157	OTTHUMG00000133527	ENST00000358536.4:c.5281delG	3.37:g.48452412delC	ENSP00000351338:p.Ala1761fs	Somatic	0	49	0.00		0.4120429396410797	53	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	16	11.11	A6H8Y2|Q6NY20|Q9UIV7|Q9UJ92|Q9UJ93	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_IPT,pfam_Semap_dom,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_IPT,pfscan_Semap_dom	p.A1761fs	ENST00000358536.4	37	c.5281	CCDS2765.1	3																																																																																			-	pfam_Plexin_cytoplasmic_RasGAP_dom,superfamily_Rho_GTPase_activation_prot		0.572	PLXNB1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PLXNB1	protein_coding	OTTHUMT00000344454.1	C	NM_002673			48452412	-1	no_errors	ENST00000296440	ensembl	human	known	74_37	frame_shift_del	DEL	0.002	-
NCOR1	9611	genome.wustl.edu	37	17	16049780	16049780	+	Missense_Mutation	SNP	C	C	T			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr17:16049780C>T	ENST00000268712.3	-	10	1249	c.992G>A	c.(991-993)aGg>aAg	p.R331K	NCOR1_ENST00000395851.1_Missense_Mutation_p.R331K|NCOR1_ENST00000395848.1_Missense_Mutation_p.R222K	NM_006311.3	NP_006302.2	O75376	NCOR1_HUMAN	nuclear receptor corepressor 1	331	Interaction with ZBTB33 and HEXIM1.				CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation (GO:0002361)|cellular lipid metabolic process (GO:0044255)|cholesterol homeostasis (GO:0042632)|chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|definitive erythrocyte differentiation (GO:0060318)|gene expression (GO:0010467)|negative regulation of JNK cascade (GO:0046329)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of histone deacetylation (GO:0031065)|regulation of fatty acid transport (GO:2000191)|regulation of glycolytic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072362)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|spindle assembly (GO:0051225)|thalamus development (GO:0021794)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|histone deacetylase binding (GO:0042826)|histone deacetylase regulator activity (GO:0035033)|nuclear hormone receptor binding (GO:0035257)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(26)|ovary(1)|prostate(7)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(10)	107				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		TTTAGCTTTCCTCCGAGGATT	0.383																																																	0								ENSG00000141027						158.0	147.0	151.0					17																	16049780		2203	4300	6503	NCOR1	SO:0001583	missense	0			-	HGNC	AF044209	CCDS11175.1, CCDS54094.1, CCDS54095.1	17p11.2	2014-06-12	2010-06-10		ENSG00000141027	ENSG00000141027			7672	protein-coding gene	gene with protein product	"""thyroid hormone- and retinoic acid receptor-associated corepressor 1"", ""protein phosphatase 1, regulatory subunit 109"""	600849	"""nuclear receptor co-repressor 1"""			7566114, 9724795	Standard	NM_006311		Approved	N-CoR, hCIT529I10, TRAC1, hN-CoR, KIAA1047, MGC104216, PPP1R109	uc002gpo.3	O75376	OTTHUMG00000059309	ENST00000268712.3:c.992G>A	17.37:g.16049780C>T	ENSP00000268712:p.Arg331Lys	Somatic	0	86	0.00		0.4120429396410797	17	30.77	8	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	51	13.56	B3DLF8|E9PGV6|Q86YY0|Q9UPV5|Q9UQ18	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SANT/Myb,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.R331K	ENST00000268712.3	37	c.992	CCDS11175.1	17	.	.	.	.	.	.	.	.	.	.	C	17.43	3.387515	0.61956	.	.	ENSG00000141027	ENST00000268712;ENST00000395851;ENST00000395849;ENST00000458113;ENST00000395848;ENST00000411510;ENST00000436828	T;T;T;T;T	0.49720	0.77;0.77;0.77;0.77;0.77	5.4	5.4	0.78164	.	0.000000	0.85682	D	0.000000	T	0.59824	0.2222	L	0.34521	1.04	0.80722	D	1	P;P;P;B;P;D	0.67145	0.719;0.719;0.719;0.402;0.534;0.996	B;B;B;B;P;D	0.76071	0.348;0.348;0.348;0.235;0.518;0.987	T	0.58434	-0.7637	10	0.46703	T	0.11	-9.6499	18.5255	0.90971	0.0:1.0:0.0:0.0	.	340;331;331;222;331;331	E7EU93;E7EV02;E7EW50;E9PGV6;O75376;O75376-2	.;.;.;.;NCOR1_HUMAN;.	K	331;331;222;340;222;331;340	ENSP00000268712:R331K;ENSP00000379192:R331K;ENSP00000379189:R222K;ENSP00000407998:R331K;ENSP00000387727:R340K	ENSP00000268712:R331K	R	-	2	0	NCOR1	15990505	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.776000	0.85560	2.696000	0.92011	0.561000	0.74099	AGG	-	NULL		0.383	NCOR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCOR1	protein_coding	OTTHUMT00000131751.5	C	NM_006311	-		16049780	-1	no_errors	ENST00000268712	ensembl	human	known	74_37	missense	SNP	1.000	T
DNM1P47	100216544	genome.wustl.edu	37	15	102300044	102300044	+	RNA	SNP	C	C	G			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr15:102300044C>G	ENST00000561463.1	+	0	8090									DNM1 pseudogene 47																		TTCATCTTCTCAGAGCTGCTG	0.587																																																	0								ENSG00000259660																																			DNM1P47			0			-	HGNC	AJ576276		15q26.3	2013-04-25			ENSG00000259660	ENSG00000259660			35200	pseudogene	pseudogene				DNM1DN14@			Standard	NG_009149		Approved	DNM1DN14-3			OTTHUMG00000172265		15.37:g.102300044C>G		Somatic	0	49	0.00		0.4120429396410797	10	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	27	10.00		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000561463.1	37	NULL		15																																																																																			-	-		0.587	DNM1P47-001	KNOWN	basic	processed_transcript	DNM1P47	pseudogene	OTTHUMT00000417589.1	C	NG_009149	-		102300044	+1	no_errors	ENST00000561463	ensembl	human	known	74_37	rna	SNP	1.000	G
LRRN2	10446	genome.wustl.edu	37	1	204588925	204588925	+	Missense_Mutation	SNP	C	C	T			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr1:204588925C>T	ENST00000367175.1	-	1	2408	c.196G>A	c.(196-198)Gca>Aca	p.A66T	LRRN2_ENST00000367177.3_Missense_Mutation_p.A66T|LRRN2_ENST00000496057.1_5'Flank|LRRN2_ENST00000367176.3_Missense_Mutation_p.A66T			O75325	LRRN2_HUMAN	leucine rich repeat neuronal 2	66	LRRNT.				cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|liver(1)|lung(22)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	38	all_cancers(21;0.0519)|Breast(84;0.112)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)			GCGGGGAGTGCCGGGGGGACT	0.632																																																	0								ENSG00000170382						53.0	52.0	52.0					1																	204588925		2203	4300	6503	LRRN2	SO:0001583	missense	0			-	HGNC	AF030435	CCDS1448.1	1q32.1	2013-01-11	2007-01-31	2007-01-31	ENSG00000170382	ENSG00000170382		"""Immunoglobulin superfamily / I-set domain containing"""	16914	protein-coding gene	gene with protein product	"""leucine rich and ankyrin repeats 1"", ""fibronectin type III, immunoglobulin and leucine rich repeat domain 7"""	605492	"""leucine rich repeat neuronal 5"""	LRRN5		9662332	Standard	NM_006338		Approved	GAC1, LRANK1, FIGLER7	uc001hbf.1	O75325	OTTHUMG00000035989	ENST00000367175.1:c.196G>A	1.37:g.204588925C>T	ENSP00000356143:p.Ala66Thr	Somatic	0	51	0.00		0.4120429396410797	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	25	13.79	B2R624|Q5T0Y0|Q6UXM0|Q8N182	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Leu-rich_rpt,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.A66T	ENST00000367175.1	37	c.196	CCDS1448.1	1	.	.	.	.	.	.	.	.	.	.	C	0.020	-1.446599	0.01089	.	.	ENSG00000170382	ENST00000367176;ENST00000367177;ENST00000367175	T;T;T	0.21932	1.98;1.98;1.98	5.67	3.73	0.42828	Leucine-rich repeat-containing N-terminal (1);	1.155900	0.06676	N	0.767169	T	0.10594	0.0259	N	0.08118	0	0.09310	N	1	B	0.16802	0.019	B	0.15484	0.013	T	0.39057	-0.9632	10	0.14656	T	0.56	.	5.5513	0.17091	0.1421:0.6417:0.0:0.2162	.	66	O75325	LRRN2_HUMAN	T	66	ENSP00000356144:A66T;ENSP00000356145:A66T;ENSP00000356143:A66T	ENSP00000356143:A66T	A	-	1	0	LRRN2	202855548	0.000000	0.05858	0.036000	0.18154	0.032000	0.12392	0.346000	0.19997	0.701000	0.31803	0.650000	0.86243	GCA	-	NULL		0.632	LRRN2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LRRN2	protein_coding	OTTHUMT00000089894.1	C	NM_006338	-		204588925	-1	no_errors	ENST00000367175	ensembl	human	known	74_37	missense	SNP	0.003	T
ZNF407	55628	genome.wustl.edu	37	18	72346148	72346148	+	Missense_Mutation	SNP	G	G	A	rs368385934		TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr18:72346148G>A	ENST00000299687.5	+	1	3173	c.3173G>A	c.(3172-3174)cGt>cAt	p.R1058H	ZNF407_ENST00000309902.6_Missense_Mutation_p.R1058H|ZNF407_ENST00000582337.1_Missense_Mutation_p.R1058H|ZNF407_ENST00000577538.1_Missense_Mutation_p.R1058H	NM_017757.2	NP_060227.2	Q9C0G0	ZN407_HUMAN	zinc finger protein 407	1058					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.R1058H(2)		central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(21)|lung(23)|ovary(4)|prostate(3)|upper_aerodigestive_tract(2)	67		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.184)		GCGGTGACTCGTCGCGAGATG	0.458													G|||	1	0.000199681	0.0	0.0	5008	,	,		20502	0.0		0.001	False		,,,				2504	0.0																2	Substitution - Missense(2)	endometrium(2)						ENSG00000215421	G	HIS/ARG,HIS/ARG,HIS/ARG	0,4064		0,0,2032	104.0	101.0	102.0		3173,3173,3173	4.3	0.8	18		102	1,8415		0,1,4207	no	missense,missense,missense	ZNF407	NM_001146189.1,NM_001146190.1,NM_017757.2	29,29,29	0,1,6239	AA,AG,GG		0.0119,0.0,0.0080	probably-damaging,probably-damaging,probably-damaging	1058/1816,1058/1661,1058/2249	72346148	1,12479	2032	4208	6240	ZNF407	SO:0001583	missense	0			-	HGNC	AB051490	CCDS45885.1, CCDS54191.1, CCDS58634.1	18q23	2013-01-08			ENSG00000215421	ENSG00000215421		"""Zinc fingers, C2H2-type"""	19904	protein-coding gene	gene with protein product		615894				11214970	Standard	NM_017757		Approved	FLJ20307, FLJ13839, KIAA1703	uc002llw.2	Q9C0G0		ENST00000299687.5:c.3173G>A	18.37:g.72346148G>A	ENSP00000299687:p.Arg1058His	Somatic	0	22	0.00		0.4120429396410797	7	12.50	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	21	36.36	B5MD54|Q96MY0|Q9H8A1|Q9NXD4|Q9NXD7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,smart_Znf_C2H2-like,smart_Znf_U1,pfscan_Znf_C2H2	p.R1058H	ENST00000299687.5	37	c.3173	CCDS45885.1	18	.	.	.	.	.	.	.	.	.	.	G	14.25	2.478642	0.44044	0.0	1.19E-4	ENSG00000215421	ENST00000299687;ENST00000309902	T;T	0.12569	2.67;3.17	6.16	4.28	0.50868	Zinc finger, C2H2-like (1);Zinc finger, U1-type (1);	0.355700	0.25875	N	0.027723	T	0.10294	0.0252	L	0.32530	0.975	0.28231	N	0.926098	B;B;B	0.32939	0.391;0.219;0.14	B;B;B	0.26202	0.067;0.034;0.015	T	0.13442	-1.0509	10	0.51188	T	0.08	.	9.6873	0.40107	0.2224:0.0:0.7776:0.0	.	1058;1058;1058	Q9C0G0-3;Q9C0G0-2;Q9C0G0	.;.;ZN407_HUMAN	H	1058	ENSP00000299687:R1058H;ENSP00000310359:R1058H	ENSP00000299687:R1058H	R	+	2	0	ZNF407	70475136	1.000000	0.71417	0.821000	0.32701	0.996000	0.88848	3.181000	0.50903	-0.812000	0.04363	0.528000	0.53228	CGT	-	smart_Znf_C2H2-like,smart_Znf_U1		0.458	ZNF407-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF407	protein_coding	OTTHUMT00000444903.1	G	NM_017757	-		72346148	+1	no_errors	ENST00000299687	ensembl	human	known	74_37	missense	SNP	0.994	A
C2orf71	388939	genome.wustl.edu	37	2	29295870	29295870	+	Missense_Mutation	SNP	C	C	A			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr2:29295870C>A	ENST00000331664.5	-	1	1257	c.1258G>T	c.(1258-1260)Gca>Tca	p.A420S		NM_001029883.2	NP_001025054.1	A6NGG8	CB071_HUMAN	chromosome 2 open reading frame 71	420					response to stimulus (GO:0050896)|visual perception (GO:0007601)	primary cilium (GO:0072372)				NS(2)|breast(5)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(11)|lung(20)|ovary(2)|prostate(6)|skin(3)|stomach(1)	60						TGAACCTTTGCCATAGGAGCC	0.582																																																	0								ENSG00000179270						85.0	88.0	87.0					2																	29295870		2003	4168	6171	C2orf71	SO:0001583	missense	0			-	HGNC		CCDS42669.1	2p23.2	2014-01-28			ENSG00000179270	ENSG00000179270			34383	protein-coding gene	gene with protein product		613425				20398886	Standard	NM_001029883		Approved	FLJ34931, RP54	uc002rmt.2	A6NGG8	OTTHUMG00000152024	ENST00000331664.5:c.1258G>T	2.37:g.29295870C>A	ENSP00000332809:p.Ala420Ser	Somatic	0	81	0.00		0.4120429396410797	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	44	23.73		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.A420S	ENST00000331664.5	37	c.1258	CCDS42669.1	2	.	.	.	.	.	.	.	.	.	.	C	15.40	2.822160	0.50739	.	.	ENSG00000179270	ENST00000331664	T	0.20463	2.07	4.98	2.13	0.27403	.	0.508000	0.20508	N	0.090941	T	0.19327	0.0464	M	0.62723	1.935	0.09310	N	1	P	0.34462	0.454	B	0.34452	0.183	T	0.14755	-1.0461	10	0.17369	T	0.5	-4.2415	9.4086	0.38477	0.0:0.7612:0.0:0.2388	.	420	A6NGG8	CB071_HUMAN	S	420	ENSP00000332809:A420S	ENSP00000332809:A420S	A	-	1	0	C2orf71	29149374	0.005000	0.15991	0.011000	0.14972	0.640000	0.38277	1.608000	0.36847	0.620000	0.30215	0.561000	0.74099	GCA	-	NULL		0.582	C2orf71-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	C2orf71	protein_coding	OTTHUMT00000324924.3	C	NM_001029883	-		29295870	-1	no_errors	ENST00000331664	ensembl	human	known	74_37	missense	SNP	0.004	A
MTMR2	8898	genome.wustl.edu	37	11	95595500	95595500	+	Missense_Mutation	SNP	G	G	T			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr11:95595500G>T	ENST00000346299.5	-	4	633	c.293C>A	c.(292-294)aCt>aAt	p.T98N	MTMR2_ENST00000484818.1_5'UTR|MTMR2_ENST00000409459.1_Missense_Mutation_p.T26N|MTMR2_ENST00000352297.7_Missense_Mutation_p.T26N|MTMR2_ENST00000393223.3_Missense_Mutation_p.T26N	NM_016156.5	NP_057240.3	Q13614	MTMR2_HUMAN	myotubularin related protein 2	98	GRAM.				cell death (GO:0008219)|dendritic spine maintenance (GO:0097062)|inositol phosphate dephosphorylation (GO:0046855)|myelin assembly (GO:0032288)|negative regulation of endocytosis (GO:0045806)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of myelination (GO:0031642)|negative regulation of receptor catabolic process (GO:2000645)|negative regulation of receptor internalization (GO:0002091)|neuron development (GO:0048666)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of early endosome to late endosome transport (GO:2000643)|protein dephosphorylation (GO:0006470)|protein tetramerization (GO:0051262)|small molecule metabolic process (GO:0044281)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endosome (GO:0005768)|neuronal postsynaptic density (GO:0097481)|nucleus (GO:0005634)|synaptic membrane (GO:0097060)|synaptic vesicle (GO:0008021)|vacuolar membrane (GO:0005774)	phosphatidylinositol-3,5-bisphosphate 3-phosphatase activity (GO:0052629)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	19		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				TACAGCGCCAGTGAATGGACA	0.353																																																	0								ENSG00000087053						71.0	70.0	70.0					11																	95595500		2201	4298	6499	MTMR2	SO:0001583	missense	0			-	HGNC	U58033	CCDS8305.1, CCDS8306.1	11q22	2014-09-17			ENSG00000087053	ENSG00000087053		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7450	protein-coding gene	gene with protein product		603557		CMT4B		8640223, 9736772	Standard	NM_016156		Approved	KIAA1073	uc001pfu.3	Q13614	OTTHUMG00000153837	ENST00000346299.5:c.293C>A	11.37:g.95595500G>T	ENSP00000345752:p.Thr98Asn	Somatic	0	46	0.00		0.4120429396410797	32	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	31	11.43	A6NN98|Q9UPS9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Myotubularin-like_Pase_dom,pfam_GRAM,smart_GRAM,smart_Tyr_Pase_cat,pfscan_Tyr/Dual-sp_Pase	p.T98N	ENST00000346299.5	37	c.293	CCDS8305.1	11	.	.	.	.	.	.	.	.	.	.	G	10.08	1.251277	0.22880	.	.	ENSG00000087053	ENST00000346299;ENST00000393223;ENST00000409459;ENST00000352297;ENST00000444541;ENST00000546018	T;T;T;T;T	0.80824	-1.42;-1.42;-1.42;-1.42;-1.42	5.8	5.8	0.92144	GRAM (2);	0.232813	0.51477	D	0.000090	T	0.60130	0.2245	N	0.04203	-0.255	0.39793	D	0.972461	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.59495	-0.7444	10	0.07325	T	0.83	.	15.534	0.75986	0.0:0.1375:0.8625:0.0	.	98;98	A8K5G2;Q13614	.;MTMR2_HUMAN	N	98;26;26;26;26;81	ENSP00000345752:T98N;ENSP00000376915:T26N;ENSP00000386882:T26N;ENSP00000343737:T26N;ENSP00000396020:T26N	ENSP00000345752:T98N	T	-	2	0	MTMR2	95235148	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	3.259000	0.51515	2.730000	0.93505	0.563000	0.77884	ACT	-	pfam_GRAM,smart_GRAM		0.353	MTMR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTMR2	protein_coding	OTTHUMT00000332620.1	G	NM_016156	-		95595500	-1	no_errors	ENST00000346299	ensembl	human	known	74_37	missense	SNP	1.000	T
ARHGAP29	9411	genome.wustl.edu	37	1	94643144	94643144	+	Intron	DEL	T	T	-	rs563927860	byFrequency	TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr1:94643144delT	ENST00000260526.6	-	22	3088				ARHGAP29_ENST00000482481.1_5'UTR	NM_004815.3	NP_004806.3	Q52LW3	RHG29_HUMAN	Rho GTPase activating protein 29						positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|Rho GTPase activator activity (GO:0005100)			NS(1)|breast(5)|endometrium(6)|kidney(2)|large_intestine(9)|lung(19)|ovary(1)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	54		all_lung(203;0.000732)|Lung NSC(277;0.00328)		all cancers(265;0.0187)|Epithelial(280;0.159)		AGCAAACATATTTTTTTTTTA	0.378													|||unknown(HR)	41	0.0081869	0.0166	0.0014	5008	,	,		16588	0.0069		0.0	False		,,,				2504	0.0112																0								ENSG00000137962			80,4186		3,74,2056	74.0	70.0	71.0			-1.3	0.0	1		73	148,8102		6,136,3983	no	intron	ARHGAP29	NM_004815.3		9,210,6039	A1A1,A1R,RR		1.7939,1.8753,1.8217			94643144	228,12288	2203	4298	6501	ARHGAP29	SO:0001627	intron_variant	0				HGNC		CCDS748.1	1p22.1	2011-06-29			ENSG00000137962	ENSG00000137962		"""Rho GTPase activating proteins"""	30207	protein-coding gene	gene with protein product		610496				9305890	Standard	NM_004815		Approved	PARG1	uc001dqj.4	Q52LW3	OTTHUMG00000010643	ENST00000260526.6:c.2905+23A>-	1.37:g.94643144delT		Somatic	0	38	0.00		0.4120429396410797	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	30	11.76	O15463|Q59H86|Q5VYZ0|Q6NVX2|Q8TBI6	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000260526.6	37	NULL	CCDS748.1	1																																																																																			-	-		0.378	ARHGAP29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP29	protein_coding	OTTHUMT00000029376.2	T	NM_004815			94643144	-1	no_errors	ENST00000482481	ensembl	human	known	74_37	rna	DEL	0.000	-
BX119917.1	0	genome.wustl.edu	37	X	71372202	71372209	+	RNA	DEL	CGCGCGCA	CGCGCGCA	-	rs6625958|rs72357649|rs72197346|rs59980083|rs6625957|rs200056633|rs10856127		TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	CGCGCGCA	CGCGCGCA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chrX:71372202_71372209delCGCGCGCA	ENST00000401114.1	-	0	55_62																											TGTGCATGCGCGCGCGcacacacacaca	0.495																																																	0								ENSG00000215933																																			BX119917.1			0				Clone_based_ensembl_gene																													X.37:g.71372202_71372209delCGCGCGCA		Somatic	NA	NA	NA		0.4120429396410797	4	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000401114.1	37	NULL		X																																																																																			-	-		0.495	BX119917.1-201	NOVEL	basic	miRNA	ENSG00000215933	miRNA		CGCGCGCA				71372209	-1	no_errors	ENST00000401114	ensembl	human	novel	74_37	rna	DEL	0.000:0.000:0.000:0.000:0.000:0.001:0.015:0.009	-
OR2T8	343172	genome.wustl.edu	37	1	248084909	248084909	+	Missense_Mutation	SNP	T	T	G	rs34508376	byFrequency	TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr1:248084909T>G	ENST00000319968.4	+	1	590	c.590T>G	c.(589-591)aTg>aGg	p.M197R		NM_001005522.1	NP_001005522.1	A6NH00	OR2T8_HUMAN	olfactory receptor, family 2, subfamily T, member 8	197			M -> R (in dbSNP:rs4474294).			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(20)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	34	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0211)	OV - Ovarian serous cystadenocarcinoma(106;0.0319)			GAAAACGCCATGTACATCTGC	0.527													T|||	1511	0.301717	0.1029	0.4337	5008	,	,		14434	0.2778		0.4652	False		,,,				2504	0.3333																0								ENSG00000177462						4.0	3.0	4.0					1																	248084909		1815	3480	5295	OR2T8	SO:0001583	missense	0			-	HGNC		CCDS31100.1	1q44	2012-08-09		2004-03-10	ENSG00000177462	ENSG00000177462		"""GPCR / Class A : Olfactory receptors"""	15020	protein-coding gene	gene with protein product				OR2T8P			Standard	XM_005273117		Approved		uc010pzc.2	A6NH00	OTTHUMG00000040205	ENST00000319968.4:c.590T>G	1.37:g.248084909T>G	ENSP00000326225:p.Met197Arg	Somatic	0	32	0.00		0.4120429396410797	0	100.00	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	13	18.75		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.M197R	ENST00000319968.4	37	c.590	CCDS31100.1	1	1010	0.4624542124542125	65	0.13211382113821138	233	0.643646408839779	209	0.36538461538461536	503	0.6635883905013192	T	14.19	2.460615	0.43736	.	.	ENSG00000177462	ENST00000319968	T	0.00130	8.69	3.56	1.06	0.20224	GPCR, rhodopsin-like superfamily (1);	0.000000	0.42682	U	0.000672	T	0.00012	0.0000	L	0.54323	1.7	0.80722	P	0.0	D	0.57899	0.981	D	0.65987	0.94	T	0.13255	-1.0516	9	0.72032	D	0.01	.	4.6079	0.12387	0.1689:0.1007:0.0:0.7304	rs34508376	197	A6NH00	OR2T8_HUMAN	R	197	ENSP00000326225:M197R	ENSP00000326225:M197R	M	+	2	0	OR2T8	246151532	0.000000	0.05858	0.009000	0.14445	0.396000	0.30629	-0.130000	0.10498	0.012000	0.14892	0.332000	0.21555	ATG	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.527	OR2T8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T8	protein_coding	OTTHUMT00000096862.1	T	NM_001005522	rs34508376		248084909	+1	no_errors	ENST00000319968	ensembl	human	known	74_37	missense	SNP	0.000	G
ATXN1	6310	genome.wustl.edu	37	6	16753377	16753378	+	Intron	INS	-	-	G	rs56374431|rs386697510|rs56192497	byFrequency	TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr6:16753377_16753378insG	ENST00000244769.4	-	3	323				ATXN1_ENST00000436367.1_Intron|ATXN1_ENST00000467008.1_Intron	NM_000332.3	NP_000323.2	P54253	ATX1_HUMAN	ataxin 1						adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|nuclear export (GO:0051168)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear inclusion body (GO:0042405)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|poly(G) binding (GO:0034046)|poly(U) RNA binding (GO:0008266)|protein C-terminus binding (GO:0008022)|protein self-association (GO:0043621)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(11)|lung(12)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)	44	Breast(50;0.063)|Ovarian(93;0.0733)	all_hematologic(90;0.000682)|Ovarian(999;0.00973)				AACAGCCAACAAAGTAAGGGAG	0.401																																																	0								ENSG00000124788																																			ATXN1	SO:0001627	intron_variant	0				HGNC	X79204	CCDS34342.1	6p23	2014-09-17	2004-08-12	2004-08-13	ENSG00000124788	ENSG00000124788		"""Ataxins"""	10548	protein-coding gene	gene with protein product		601556	"""spinocerebellar ataxia 1 (olivopontocerebellar ataxia 1, autosomal dominant, ataxin 1)"""	SCA1		1582256	Standard	NM_000332		Approved	D6S504E, ATX1	uc010jpi.3	P54253	OTTHUMG00000014303	ENST00000244769.4:c.613+85->C	6.37:g.16753377_16753378insG		Somatic	0	38	0.00		0.4120429396410797	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	35	10.26	Q17S02|Q9UJG2|Q9Y4J1	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000244769.4	37	NULL	CCDS34342.1	6																																																																																			-	-		0.401	ATXN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATXN1	protein_coding	OTTHUMT00000039943.3	-	NM_000332			16753378	-1	no_errors	ENST00000479680	ensembl	human	known	74_37	rna	INS	0.000:0.000	G
SLC22A8	9376	genome.wustl.edu	37	11	62782355	62782355	+	Missense_Mutation	SNP	G	G	A			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr11:62782355G>A	ENST00000336232.2	-	2	211	c.76C>T	c.(76-78)Ctc>Ttc	p.L26F	SLC22A8_ENST00000535878.1_Intron|SLC22A8_ENST00000311438.8_Missense_Mutation_p.L26F|SLC22A8_ENST00000430500.2_Missense_Mutation_p.L26F|SLC22A8_ENST00000545207.1_Intron	NM_001184732.1|NM_001184736.1|NM_004254.3	NP_001171661.1|NP_001171665.1|NP_004245.2	Q8TCC7	S22A8_HUMAN	solute carrier family 22 (organic anion transporter), member 8	26					glutathione transport (GO:0034635)|response to methotrexate (GO:0031427)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|organic anion transmembrane transporter activity (GO:0008514)|quaternary ammonium group transmembrane transporter activity (GO:0015651)			endometrium(2)|kidney(2)|large_intestine(6)|lung(10)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	28					Aciclovir(DB00787)|Adefovir Dipivoxil(DB00718)|Allopurinol(DB00437)|Aminohippurate(DB00345)|Aspartame(DB00168)|Baclofen(DB00181)|Benzylpenicillin(DB01053)|Bumetanide(DB00887)|Cefacetrile(DB01414)|Cefadroxil(DB01140)|Cefalotin(DB00456)|Cefamandole(DB01326)|Cefazolin(DB01327)|Cefoperazone(DB01329)|Cefotaxime(DB00493)|Ceftriaxone(DB01212)|Cephalexin(DB00567)|Cilastatin(DB01597)|Cimetidine(DB00501)|Conjugated Estrogens(DB00286)|Dabrafenib(DB08912)|Diclofenac(DB00586)|Digoxin(DB00390)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Doxycycline(DB00254)|Enalapril(DB00584)|Estradiol(DB00783)|Famotidine(DB00927)|Furosemide(DB00695)|Ganciclovir(DB01004)|Guanidine(DB00536)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Ketoprofen(DB01009)|L-Carnitine(DB00583)|Liothyronine(DB00279)|Liotrix(DB01583)|Melatonin(DB01065)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|Methyltestosterone(DB06710)|Minocycline(DB01017)|Novobiocin(DB01051)|Oseltamivir(DB00198)|Ouabain(DB01092)|Oxytetracycline(DB00595)|Phenylbutazone(DB00812)|Piroxicam(DB00554)|Pravastatin(DB00175)|Probenecid(DB01032)|Quinidine(DB00908)|Ranitidine(DB00863)|Salicylic acid(DB00936)|Saxagliptin(DB06335)|Succinic acid(DB00139)|Tenofovir(DB00300)|Tenoxicam(DB00469)|Testosterone(DB00624)|Tetracycline(DB00759)|Valaciclovir(DB00577)|Valproic Acid(DB00313)|Zidovudine(DB00495)	AGGATCGGGAGGCCCAGTATG	0.617																																																	0								ENSG00000149452						177.0	169.0	172.0					11																	62782355		2201	4298	6499	SLC22A8	SO:0001583	missense	0			-	HGNC	AF097491, BC022387	CCDS8042.1, CCDS53643.1, CCDS53644.1	11q12.3	2013-05-22			ENSG00000149452	ENSG00000149452		"""Solute carriers"""	10972	protein-coding gene	gene with protein product		607581				10049739	Standard	NM_004254		Approved	OAT3	uc001nwo.3	Q8TCC7	OTTHUMG00000167768	ENST00000336232.2:c.76C>T	11.37:g.62782355G>A	ENSP00000337335:p.Leu26Phe	Somatic	0	80	0.00		0.4120429396410797	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	54	15.38	B4DPH7|F5GWA8|F5H5J1|O95820|Q59EW9|Q96TC1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Orgcat_transp	p.L26F	ENST00000336232.2	37	c.76	CCDS8042.1	11	.	.	.	.	.	.	.	.	.	.	G	2.999	-0.206460	0.06180	.	.	ENSG00000149452	ENST00000336232;ENST00000540631;ENST00000311438;ENST00000430500	T;T;T	0.56611	0.45;0.45;0.45	4.76	-5.73	0.02398	.	0.694331	0.13875	N	0.356743	T	0.32556	0.0833	L	0.42744	1.35	0.26524	N	0.974376	B;B	0.12013	0.005;0.003	B;B	0.19148	0.024;0.011	T	0.21008	-1.0258	10	0.48119	T	0.1	.	1.3625	0.02194	0.3246:0.1017:0.1386:0.4352	.	26;26	Q8TCC7-2;Q8TCC7	.;S22A8_HUMAN	F	26	ENSP00000337335:L26F;ENSP00000311463:L26F;ENSP00000398548:L26F	ENSP00000311463:L26F	L	-	1	0	SLC22A8	62538931	0.017000	0.18338	0.040000	0.18447	0.080000	0.17528	-0.278000	0.08490	-0.702000	0.05056	-1.047000	0.02352	CTC	-	tigrfam_Orgcat_transp		0.617	SLC22A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC22A8	protein_coding	OTTHUMT00000396191.1	G	NM_004254	-		62782355	-1	no_errors	ENST00000336232	ensembl	human	known	74_37	missense	SNP	0.008	A
ST18	9705	genome.wustl.edu	37	8	53084453	53084453	+	Missense_Mutation	SNP	G	G	A			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr8:53084453G>A	ENST00000276480.7	-	10	1651	c.968C>T	c.(967-969)aCc>aTc	p.T323I		NM_014682.2	NP_055497.1	O60284	ST18_HUMAN	suppression of tumorigenicity 18, zinc finger	323					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(14)|lung(38)|ovary(4)|prostate(2)|skin(11)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	85		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)				CTCTTTGTAGGTGTTATGGAA	0.478																																																	0								ENSG00000147488						116.0	108.0	111.0					8																	53084453		2203	4300	6503	ST18	SO:0001583	missense	0			-	HGNC	AB011107	CCDS6149.1	8q11.23	2014-03-24	2014-03-24	2002-12-13	ENSG00000147488	ENSG00000147488		"""Zinc fingers, C2HC-type containing"""	18695	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 3"""		"""zinc finger protein 387"", ""suppression of tumorigenicity 18 (breast carcinoma) (zinc finger protein)"""	ZNF387		15489893	Standard	NM_014682		Approved	KIAA0535, ZC2HC10, NZF3	uc003xra.2	O60284	OTTHUMG00000164233	ENST00000276480.7:c.968C>T	8.37:g.53084453G>A	ENSP00000276480:p.Thr323Ile	Somatic	0	95	0.00		0.4120429396410797	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	47	9.62	Q17RY1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Myelin_TF,pfam_Znf_C2HC	p.T323I	ENST00000276480.7	37	c.968	CCDS6149.1	8	.	.	.	.	.	.	.	.	.	.	G	22.3	4.265224	0.80358	.	.	ENSG00000147488	ENST00000276480;ENST00000517580	T;T	0.46063	0.9;0.88	5.72	4.84	0.62591	.	0.097482	0.64402	D	0.000001	T	0.60663	0.2286	M	0.65975	2.015	0.47949	D	0.999551	D	0.69078	0.997	D	0.63033	0.91	T	0.63651	-0.6589	10	0.51188	T	0.08	-9.6033	16.1358	0.81487	0.0:0.0:0.8653:0.1347	.	323	O60284	ST18_HUMAN	I	323	ENSP00000276480:T323I;ENSP00000428521:T323I	ENSP00000276480:T323I	T	-	2	0	ST18	53247006	1.000000	0.71417	0.977000	0.42913	0.966000	0.64601	6.194000	0.72082	1.397000	0.46682	0.655000	0.94253	ACC	-	NULL		0.478	ST18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ST18	protein_coding	OTTHUMT00000377867.1	G		-		53084453	-1	no_errors	ENST00000276480	ensembl	human	known	74_37	missense	SNP	1.000	A
BPTF	2186	genome.wustl.edu	37	17	65955782	65955783	+	In_Frame_Ins	INS	-	-	GCC	rs60308484		TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr17:65955782_65955783insGCC	ENST00000321892.4	+	26	8491_8492	c.8430_8431insGCC	c.(8431-8433)cct>GCCcct	p.2810_2811insA	BPTF_ENST00000424123.3_In_Frame_Ins_p.2528_2529insA|BPTF_ENST00000306378.6_In_Frame_Ins_p.2684_2685insA|BPTF_ENST00000335221.5_In_Frame_Ins_p.2667_2668insA			Q12830	BPTF_HUMAN	bromodomain PHD finger transcription factor	2810	Pro-rich.				anterior/posterior pattern specification (GO:0009952)|ATP catabolic process (GO:0006200)|brain development (GO:0007420)|chromatin remodeling (GO:0006338)|embryonic placenta development (GO:0001892)|endoderm development (GO:0007492)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NURF complex (GO:0016589)	sequence-specific DNA binding (GO:0043565)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(16)|lung(23)|ovary(3)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	78	all_cancers(12;6e-11)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0984)|LUSC - Lung squamous cell carcinoma(166;0.24)			cagcccctccaCCTTCACCTCC	0.589																																																	0								ENSG00000171634																																			BPTF	SO:0001652	inframe_insertion	0				HGNC	AY282495	CCDS11673.1	17q24	2013-01-28	2006-12-01	2006-12-01	ENSG00000171634	ENSG00000171634		"""Zinc fingers, PHD-type"""	3581	protein-coding gene	gene with protein product		601819	"""fetal Alzheimer antigen"""	FALZ		8975731, 10662542, 16728976	Standard	NM_182641		Approved	FAC1, NURF301	uc002jgf.3	Q12830	OTTHUMG00000132254	Exception_encountered	17.37:g.65955782_65955783insGCC	ENSP00000315454:p.Pro2810_Pro2811insAla	Somatic	0	42	0.00		0.4120429396410797	41	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	51	8.93	Q6NX67|Q7Z7D6|Q9UIG2	In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_Bromodomain,pfam_DDT_dom,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_DDT_dom_subgr,smart_Znf_PHD,smart_Bromodomain,pfscan_Znf_PHD-finger,pfscan_DDT_dom_superfamily,pfscan_Bromodomain,prints_Bromodomain	p.2810in_frame_insA	ENST00000321892.4	37	c.8430_8431		17																																																																																			-	superfamily_Bromodomain		0.589	BPTF-201	KNOWN	basic	protein_coding	BPTF	protein_coding		-	NM_182641, NM_004459			65955783	+1	no_errors	ENST00000321892	ensembl	human	known	74_37	in_frame_ins	INS	0.069:0.577	GCC
TIGD6	81789	genome.wustl.edu	37	5	149375002	149375002	+	Missense_Mutation	SNP	G	G	A			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr5:149375002G>A	ENST00000296736.3	-	2	1684	c.910C>T	c.(910-912)Ccc>Tcc	p.P304S	TIGD6_ENST00000515406.2_Missense_Mutation_p.P304S	NM_030953.3	NP_112215.1	Q17RP2	TIGD6_HUMAN	tigger transposable element derived 6	304	DDE.					nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)|stomach(1)	10			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)			CAGTTGGAGGGCAGATACCCA	0.493																																																	0								ENSG00000164296						93.0	83.0	86.0					5																	149375002		2203	4300	6503	TIGD6	SO:0001583	missense	0			-	HGNC	AK056604	CCDS4301.1	5q33.1	2008-02-05			ENSG00000164296	ENSG00000164296			18332	protein-coding gene	gene with protein product						11230166	Standard	NM_030953		Approved	DKFZp761E2110	uc003lrj.3	Q17RP2	OTTHUMG00000130045	ENST00000296736.3:c.910C>T	5.37:g.149375002G>A	ENSP00000296736:p.Pro304Ser	Somatic	0	59	0.00		0.4120429396410797	23	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	B3KTZ8|Q96MQ4|Q9H0X7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DDE_SF_endonuclease_CENPB-like,pfam_HTH_CenpB_DNA-bd_dom,pfam_HTH_Psq,superfamily_Homeodomain-like,smart_HTH_CenpB_DNA-bd_dom,pfscan_HTH_Psq	p.P304S	ENST00000296736.3	37	c.910	CCDS4301.1	5	.	.	.	.	.	.	.	.	.	.	G	15.27	2.784602	0.49997	.	.	ENSG00000164296	ENST00000296736;ENST00000515406	D;D	0.87966	-2.32;-2.32	5.14	2.32	0.28847	.	0.000000	0.33610	U	0.004731	D	0.83358	0.5237	M	0.68728	2.09	0.24354	N	0.994907	B	0.23806	0.091	B	0.27262	0.078	T	0.74659	-0.3591	10	0.51188	T	0.08	.	6.4459	0.21875	0.1725:0.1538:0.6737:0.0	.	304	Q17RP2	TIGD6_HUMAN	S	304	ENSP00000296736:P304S;ENSP00000425318:P304S	ENSP00000296736:P304S	P	-	1	0	TIGD6	149355195	0.982000	0.34865	0.999000	0.59377	0.980000	0.70556	1.096000	0.30976	0.655000	0.30866	0.563000	0.77884	CCC	-	pfam_DDE_SF_endonuclease_CENPB-like		0.493	TIGD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIGD6	protein_coding	OTTHUMT00000252324.1	G	NM_030953	-		149375002	-1	no_errors	ENST00000296736	ensembl	human	known	74_37	missense	SNP	0.998	A
SYMPK	8189	genome.wustl.edu	37	19	46328479	46328479	+	Nonsense_Mutation	SNP	C	C	A			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr19:46328479C>A	ENST00000245934.7	-	18	2684	c.2440G>T	c.(2440-2442)Gaa>Taa	p.E814*	SYMPK_ENST00000598155.1_5'Flank	NM_004819.2	NP_004810.2	Q92797	SYMPK_HUMAN	symplekin	814					cell adhesion (GO:0007155)|mRNA polyadenylation (GO:0006378)|positive regulation of protein dephosphorylation (GO:0035307)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|liver(1)|lung(25)|ovary(1)|urinary_tract(1)	45		all_neural(266;0.0299)|Ovarian(192;0.0308)		OV - Ovarian serous cystadenocarcinoma(262;0.00509)|GBM - Glioblastoma multiforme(486;0.0593)		GCGATGGCTTCAGTGTACACG	0.637																																																	0								ENSG00000125755						166.0	112.0	130.0					19																	46328479		2203	4300	6503	SYMPK	SO:0001587	stop_gained	0			-	HGNC	U49240	CCDS12676.2	19q13.3	2008-02-05			ENSG00000125755	ENSG00000125755			22935	protein-coding gene	gene with protein product		602388				9330635	Standard	NM_004819		Approved	SYM, SPK	uc002pdn.3	Q92797	OTTHUMG00000150151	ENST00000245934.7:c.2440G>T	19.37:g.46328479C>A	ENSP00000245934:p.Glu814*	Somatic	0	69	0.00		0.4120429396410797	187	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	32	11.11	O00521|O00689|O00733|Q59GT5|Q8N2U5	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF3453,pfam_Symplekin_C,superfamily_ARM-type_fold	p.E814*	ENST00000245934.7	37	c.2440	CCDS12676.2	19	.	.	.	.	.	.	.	.	.	.	C	42	9.357693	0.99147	.	.	ENSG00000125755	ENST00000245934	.	.	.	4.72	4.72	0.59763	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.14252	T	0.57	.	15.5945	0.76569	0.0:1.0:0.0:0.0	.	.	.	.	X	814	.	ENSP00000245934:E814X	E	-	1	0	SYMPK	51020319	1.000000	0.71417	0.986000	0.45419	0.879000	0.50718	7.178000	0.77657	2.358000	0.79984	0.555000	0.69702	GAA	-	superfamily_ARM-type_fold		0.637	SYMPK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYMPK	protein_coding	OTTHUMT00000316581.1	C	NM_004819	-		46328479	-1	no_errors	ENST00000245934	ensembl	human	known	74_37	nonsense	SNP	1.000	A
LRP8	7804	genome.wustl.edu	37	1	53792620	53792620	+	Nonsense_Mutation	SNP	C	C	A			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr1:53792620C>A	ENST00000306052.6	-	2	270	c.169G>T	c.(169-171)Gag>Tag	p.E57*	LRP8_ENST00000371454.2_Nonsense_Mutation_p.E57*|LRP8_ENST00000347547.2_Nonsense_Mutation_p.E57*|LRP8_ENST00000354412.3_Nonsense_Mutation_p.E57*|RP4-784A16.5_ENST00000445039.2_lincRNA|LRP8_ENST00000465675.1_5'UTR	NM_004631.4	NP_004622.2	Q14114	LRP8_HUMAN	low density lipoprotein receptor-related protein 8, apolipoprotein e receptor	57	LDL-receptor class A 1. {ECO:0000255|PROSITE-ProRule:PRU00124}.				ammon gyrus development (GO:0021541)|blood coagulation (GO:0007596)|cellular response to cholesterol (GO:0071397)|cellular response to growth factor stimulus (GO:0071363)|cytokine-mediated signaling pathway (GO:0019221)|endocytosis (GO:0006897)|layer formation in cerebral cortex (GO:0021819)|lipid metabolic process (GO:0006629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|phototransduction, visible light (GO:0007603)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendrite development (GO:1900006)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein tyrosine kinase activity (GO:0061098)|proteolysis (GO:0006508)|receptor-mediated endocytosis (GO:0006898)|reelin-mediated signaling pathway (GO:0038026)|regulation of synaptic transmission (GO:0050804)|response to drug (GO:0042493)|retinoid metabolic process (GO:0001523)|signal transduction (GO:0007165)	caveola (GO:0005901)|dendrite (GO:0030425)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|high-density lipoprotein particle binding (GO:0008035)|reelin receptor activity (GO:0038025)|transmembrane signaling receptor activity (GO:0004888)|very-low-density lipoprotein particle receptor activity (GO:0030229)			endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|prostate(2)|skin(1)	21						ATGCAGCGCTCGTTCCGGCAC	0.652																																																	0								ENSG00000157193						95.0	86.0	89.0					1																	53792620		2203	4300	6503	LRP8	SO:0001587	stop_gained	0			-	HGNC	D50678	CCDS578.1, CCDS579.1, CCDS580.1, CCDS30720.1	1p32.3	2013-05-29			ENSG00000157193	ENSG00000157193		"""Low density lipoprotein receptors"""	6700	protein-coding gene	gene with protein product		602600				8626535, 9079678	Standard	NM_004631		Approved	APOER2, MCI1, LRP-8, HSZ75190	uc001cvi.2	Q14114	OTTHUMG00000008924	ENST00000306052.6:c.169G>T	1.37:g.53792620C>A	ENSP00000303634:p.Glu57*	Somatic	0	79	0.00		0.4120429396410797	13	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	40	11.11	B1AMT6|B1AMT7|B1AMT8|O14968|Q86V27|Q99876|Q9BR78	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,pfam_EGF-like_Ca-bd_dom,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.E57*	ENST00000306052.6	37	c.169	CCDS578.1	1	.	.	.	.	.	.	.	.	.	.	C	38	7.101832	0.98063	.	.	ENSG00000157193	ENST00000306052;ENST00000371454;ENST00000354412;ENST00000347547	.	.	.	4.46	2.53	0.30540	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	.	6.6108	0.22751	0.0:0.6911:0.1458:0.1631	.	.	.	.	X	57	.	ENSP00000303634:E57X	E	-	1	0	LRP8	53565208	0.133000	0.22466	0.989000	0.46669	0.856000	0.48823	0.634000	0.24614	1.107000	0.41642	0.462000	0.41574	GAG	-	pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt,prints_LDrepeatLR_classA_rpt		0.652	LRP8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LRP8	protein_coding	OTTHUMT00000024699.1	C	NM_004631	-		53792620	-1	no_errors	ENST00000306052	ensembl	human	known	74_37	nonsense	SNP	0.996	A
DCAF5	8816	genome.wustl.edu	37	14	69521851	69521851	+	Missense_Mutation	SNP	G	G	C			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr14:69521851G>C	ENST00000341516.5	-	9	1699	c.1552C>G	c.(1552-1554)Cgc>Ggc	p.R518G	DCAF5_ENST00000553293.1_5'Flank|DCAF5_ENST00000557386.1_Missense_Mutation_p.R517G|DCAF5_ENST00000554215.1_Missense_Mutation_p.R436G|DCAF5_ENST00000556847.1_Missense_Mutation_p.R436G	NM_001284206.1|NM_001284207.1|NM_003861.2	NP_001271135.1|NP_001271136.1|NP_003852.1	Q96JK2	DCAF5_HUMAN	DDB1 and CUL4 associated factor 5	518					protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|mitochondrion (GO:0005739)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(15)|ovary(2)|upper_aerodigestive_tract(2)	29						TCTTGGTAGCGCCGCAGAGCA	0.587																																																	0								ENSG00000139990						52.0	51.0	52.0					14																	69521851		2203	4300	6503	DCAF5	SO:0001583	missense	0			-	HGNC	AB058727	CCDS32106.1, CCDS61480.1, CCDS61481.1, CCDS73646.1	14q23-q24.1	2013-01-09	2009-07-17	2009-07-17				"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	20224	protein-coding gene	gene with protein product		603812	"""WD repeat domain 22"""	WDR22		9740667, 9521877	Standard	NM_003861		Approved	BCRP2, D14S1461E, BCRG2, KIAA1824	uc001xkp.3	Q96JK2		ENST00000341516.5:c.1552C>G	14.37:g.69521851G>C	ENSP00000341351:p.Arg518Gly	Somatic	0	38	0.00		0.4120429396410797	40	28.57	16	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	31	11.43	B2RN31|G3V4J7|O60559|Q8N3V3|Q8N3V5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R518G	ENST00000341516.5	37	c.1552	CCDS32106.1	14	.	.	.	.	.	.	.	.	.	.	G	11.19	1.565126	0.27915	.	.	ENSG00000139990	ENST00000341516;ENST00000554215;ENST00000556847;ENST00000557386	T;T;T;T	0.74842	-0.88;-0.71;-0.71;-0.31	5.23	4.25	0.50352	.	0.212334	0.34555	N	0.003869	T	0.62962	0.2471	L	0.27053	0.805	0.80722	D	1	P;P	0.41748	0.761;0.649	B;B	0.38378	0.272;0.14	T	0.70963	-0.4729	10	0.87932	D	0	-15.0753	14.8422	0.70233	0.0:0.0:0.7814:0.2185	.	517;518	G3V4J7;Q96JK2	.;DCAF5_HUMAN	G	518;436;436;517	ENSP00000341351:R518G;ENSP00000451551:R436G;ENSP00000452052:R436G;ENSP00000451845:R517G	ENSP00000341351:R518G	R	-	1	0	DCAF5	68591604	0.998000	0.40836	1.000000	0.80357	0.996000	0.88848	1.491000	0.35583	2.431000	0.82371	0.561000	0.74099	CGC	-	NULL		0.587	DCAF5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DCAF5	protein_coding	OTTHUMT00000414806.2	G	NM_003861	-		69521851	-1	no_errors	ENST00000341516	ensembl	human	known	74_37	missense	SNP	0.999	C
LCN2	3934	genome.wustl.edu	37	9	130913979	130913979	+	Missense_Mutation	SNP	C	C	T	rs150975968	byFrequency	TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr9:130913979C>T	ENST00000373017.1	+	4	575	c.338C>T	c.(337-339)aCg>aTg	p.T113M	LCN2_ENST00000373013.2_Missense_Mutation_p.T115M|LCN2_ENST00000470902.1_3'UTR|LCN2_ENST00000372998.1_Missense_Mutation_p.T115M|LCN2_ENST00000540948.1_Missense_Mutation_p.T113M|LCN2_ENST00000277480.2_Missense_Mutation_p.T113M			P80188	NGAL_HUMAN	lipocalin 2	113					apoptotic process (GO:0006915)|innate immune response (GO:0045087)|ion transport (GO:0006811)|iron ion homeostasis (GO:0055072)|siderophore transport (GO:0015891)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	iron ion binding (GO:0005506)|small molecule binding (GO:0036094)|transporter activity (GO:0005215)			central_nervous_system(1)|lung(3)|prostate(2)|skin(1)|urinary_tract(1)	8						GGCGAGTTCACGCTGGGCAAC	0.582													C|||	2	0.000399361	0.0	0.0029	5008	,	,		20739	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000148346	C	MET/THR	1,4405	2.1+/-5.4	0,1,2202	58.0	51.0	54.0		338	-8.9	0.0	9	dbSNP_134	54	0,8600		0,0,4300	yes	missense	LCN2	NM_005564.3	81	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	113/199	130913979	1,13005	2203	4300	6503	LCN2	SO:0001583	missense	0			GMAF=0.0005	HGNC		CCDS6892.1	9q34	2011-10-24	2007-12-18		ENSG00000148346	ENSG00000148346		"""Lipocalins"""	6526	protein-coding gene	gene with protein product	"""oncogene 24p3"", ""neutrophil gelatinase-associated lipocalin"", ""siderocalin"""	600181	"""lipocalin 2 (oncogene 24p3)"""			7683678	Standard	NM_005564		Approved	NGAL, 24p3	uc004bto.1	P80188	OTTHUMG00000020734	ENST00000373017.1:c.338C>T	9.37:g.130913979C>T	ENSP00000362108:p.Thr113Met	Somatic	0	119	0.00		0.4120429396410797	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	41	18.00	A6NII8|B4DWV4|B7ZAA2|P30150|Q5SYV9|Q5SYW0|Q6FGL5|Q92683	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Lipocln_cytosolic_FA-bd_dom,superfamily_Calycin-like,prints_N_gelatinase,prints_PstgldnD_synth,prints_Lipocalin,prints_A1-microglobln	p.T115M	ENST00000373017.1	37	c.344	CCDS6892.1	9	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	6.048	0.377173	0.11466	2.27E-4	0.0	ENSG00000148346	ENST00000373017;ENST00000277480;ENST00000373013;ENST00000540948;ENST00000372998	T;T;T;T;T	0.09073	3.02;3.02;3.02;3.02;3.02	4.48	-8.95	0.00765	Calycin-like (1);Lipocalin/cytosolic fatty-acid binding protein domain (1);Calycin (1);	1.463730	0.04186	N	0.327364	T	0.22704	0.0548	M	0.72894	2.215	0.09310	N	0.999998	D;D	0.89917	1.0;1.0	D;D	0.75484	0.958;0.986	T	0.54377	-0.8303	10	0.72032	D	0.01	-14.1116	9.2736	0.37686	0.104:0.5852:0.2306:0.0802	.	113;113	P80188-2;P80188	.;NGAL_HUMAN	M	113;113;115;113;115	ENSP00000362108:T113M;ENSP00000277480:T113M;ENSP00000362104:T115M;ENSP00000441666:T113M;ENSP00000362089:T115M	ENSP00000277480:T113M	T	+	2	0	LCN2	129953800	0.000000	0.05858	0.001000	0.08648	0.000000	0.00434	-2.762000	0.00785	-3.051000	0.00260	-1.405000	0.01134	ACG	-	pfam_Lipocln_cytosolic_FA-bd_dom,superfamily_Calycin-like,prints_N_gelatinase		0.582	LCN2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LCN2	protein_coding	OTTHUMT00000054375.1	C	NM_005564	rs150975968		130913979	+1	no_errors	ENST00000372998	ensembl	human	known	74_37	missense	SNP	0.000	T
PCM1	5108	genome.wustl.edu	37	8	17810512	17810512	+	Nonsense_Mutation	SNP	G	G	T	rs375635025		TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr8:17810512G>T	ENST00000519253.1	+	9	1356	c.1105G>T	c.(1105-1107)Gaa>Taa	p.E369*	PCM1_ENST00000518537.1_Nonsense_Mutation_p.E408*|PCM1_ENST00000325083.8_Nonsense_Mutation_p.E369*|PCM1_ENST00000524226.1_Nonsense_Mutation_p.E369*			Q15154	PCM1_HUMAN	pericentriolar material 1	369					centrosome organization (GO:0051297)|cilium assembly (GO:0042384)|cytoplasmic microtubule organization (GO:0031122)|G2/M transition of mitotic cell cycle (GO:0000086)|interkinetic nuclear migration (GO:0022027)|intraciliary transport involved in cilium morphogenesis (GO:0035735)|microtubule anchoring (GO:0034453)|microtubule anchoring at centrosome (GO:0034454)|mitotic cell cycle (GO:0000278)|negative regulation of neurogenesis (GO:0050768)|neuronal stem cell maintenance (GO:0097150)|positive regulation of intracellular protein transport (GO:0090316)|protein localization to centrosome (GO:0071539)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|pericentriolar material (GO:0000242)|protein complex (GO:0043234)	identical protein binding (GO:0042802)		PCM1/JAK2(30)	breast(4)|endometrium(8)|kidney(5)|large_intestine(16)|lung(11)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	48				Colorectal(111;0.0789)		AAGACAGGCAGAAAGTCTTTC	0.358			T	"""RET, JAK2"""	"""papillary thyroid, CML, MPD"""																																			Dom	yes		8	8p22-p21.3	5108	pericentriolar material 1  (PTC4)		"""E, L"""	0								ENSG00000078674						41.0	37.0	39.0					8																	17810512		1817	4082	5899	PCM1	SO:0001587	stop_gained	0			-	HGNC		CCDS47812.1	8p22-p21.3	2008-08-08			ENSG00000078674	ENSG00000078674			8727	protein-coding gene	gene with protein product		600299				8120099, 15659651	Standard	NM_006197		Approved	PTC4	uc003wyi.4	Q15154	OTTHUMG00000163699	ENST00000519253.1:c.1105G>T	8.37:g.17810512G>T	ENSP00000431099:p.Glu369*	Somatic	0	55	0.00		0.4120429396410797	55	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	57	8.06	Q58F13|Q6P1K7|Q8NB85|Q9BWC1|Q9H4A2	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.E369*	ENST00000519253.1	37	c.1105		8	.	.	.	.	.	.	.	.	.	.	G	32	5.122270	0.94429	.	.	ENSG00000078674	ENST00000325083;ENST00000325126;ENST00000517730;ENST00000518537;ENST00000523055;ENST00000519253;ENST00000524226	.	.	.	5.28	5.28	0.74379	.	0.044247	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.40728	T	0.16	-19.9898	18.2963	0.90147	0.0:0.0:1.0:0.0	.	.	.	.	X	369;408;408;408;369;369;369	.	ENSP00000327077:E369X	E	+	1	0	PCM1	17854792	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.175000	0.77632	2.658000	0.90341	0.585000	0.79938	GAA	-	NULL		0.358	PCM1-003	NOVEL	basic|exp_conf	protein_coding	PCM1	protein_coding	OTTHUMT00000374800.1	G	NM_006197	-		17810512	+1	no_errors	ENST00000325083	ensembl	human	known	74_37	nonsense	SNP	1.000	T
CADM3	57863	genome.wustl.edu	37	1	159166613	159166613	+	Intron	DEL	T	T	-	rs533935187		TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr1:159166613delT	ENST00000368125.4	+	7	939				CADM3_ENST00000368124.4_Intron|CTA-134P22.2_ENST00000415675.2_RNA	NM_001127173.1	NP_001120645.1	Q8N126	CADM3_HUMAN	cell adhesion molecule 3						adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|protein localization (GO:0008104)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(20)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	55	all_hematologic(112;0.0429)					CTCCCAGTTATTTTTTTTTTT	0.527											OREG0013913	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000225670																																			CTA-134P22.2	SO:0001627	intron_variant	0				Clone_based_vega_gene	AY046418	CCDS1182.1, CCDS44251.1	1q21.2-q22	2013-01-29	2007-02-07	2007-02-07	ENSG00000162706	ENSG00000162706		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17601	protein-coding gene	gene with protein product	"""nectin-like 1"""	609743	"""immunoglobulin superfamily, member 4B"""	IGSF4B		11536053	Standard	NM_021189		Approved	BIgR, FLJ10698, TSLL1, NECL1, SynCAM3, Necl-1	uc001ftk.2	Q8N126	OTTHUMG00000037177	ENST00000368125.4:c.783-68T>-	1.37:g.159166613delT		Somatic	0	18	0.00	1799	0.4120429396410797	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	11	21.43	Q8IZQ9|Q9NVJ5|Q9UJP1	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000368125.4	37	NULL	CCDS44251.1	1																																																																																			-	-		0.527	CADM3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LOC100131825	protein_coding	OTTHUMT00000090330.1	T	NM_021189			159166613	-1	no_errors	ENST00000415675	ensembl	human	known	74_37	rna	DEL	0.000	-
NLRP12	91662	genome.wustl.edu	37	19	54313886	54313886	+	Missense_Mutation	SNP	G	G	A	rs112159191	byFrequency	TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr19:54313886G>A	ENST00000324134.6	-	3	1195	c.1027C>T	c.(1027-1029)Cgg>Tgg	p.R343W	NLRP12_ENST00000351894.4_Missense_Mutation_p.R343W|NLRP12_ENST00000391773.1_Missense_Mutation_p.R343W|NLRP12_ENST00000391772.1_Missense_Mutation_p.R343W|NLRP12_ENST00000345770.5_Missense_Mutation_p.R343W|NLRP12_ENST00000354278.3_Missense_Mutation_p.R343W|NLRP12_ENST00000535162.1_Missense_Mutation_p.R343W|NLRP12_ENST00000391775.3_Missense_Mutation_p.R343W	NM_001277126.1|NM_144687.2	NP_001264055.1|NP_653288.1	P59046	NAL12_HUMAN	NLR family, pyrin domain containing 12	343	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to cytokine stimulus (GO:0071345)|dendritic cell migration (GO:0036336)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 secretion (GO:0050711)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of NIK/NF-kappaB signaling (GO:1901223)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of signal transduction (GO:0009968)|negative regulation of Toll signaling pathway (GO:0045751)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of MHC class I biosynthetic process (GO:0045345)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of interleukin-18 biosynthetic process (GO:0045381)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)			NS(1)|breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(1)|lung(36)|ovary(5)|pancreas(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	80	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.026)		GCCGTGGGCCGTGTGGTGATG	0.557																																																	0								ENSG00000142405						79.0	84.0	82.0					19																	54313886		2203	4300	6503	NLRP12	SO:0001583	missense	0			-	HGNC	AY095146	CCDS12864.1, CCDS62784.1, CCDS62785.1	19q13.42	2014-09-17	2006-12-08	2006-12-08	ENSG00000142405	ENSG00000142405		"""Nucleotide-binding domain and leucine rich repeat containing"""	22938	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 12"""	609648	"""NACHT, leucine rich repeat and PYD containing 12"""	NALP12		12563287, 12019269	Standard	NM_001277129		Approved	RNO2, PYPAF7, Monarch1, PAN6, CLR19.3	uc002qcj.5	P59046	OTTHUMG00000060776	ENST00000324134.6:c.1027C>T	19.37:g.54313886G>A	ENSP00000319377:p.Arg343Trp	Somatic	0	46	0.00		0.4120429396410797	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	19	26.92	A8MTQ2|B3KTE7|Q8NEU4|Q9BY26	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DAPIN,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.R343W	ENST00000324134.6	37	c.1027	CCDS12864.1	19	.	.	.	.	.	.	.	.	.	.	G	13.35	2.212315	0.39102	.	.	ENSG00000142405	ENST00000324134;ENST00000535162;ENST00000351894;ENST00000354278;ENST00000391775;ENST00000391773;ENST00000345770;ENST00000391772	D;D;D;D;D;D;D	0.87029	-2.2;-2.2;-2.2;-2.2;-2.2;-2.2;-2.2	4.64	-2.5	0.06384	NACHT nucleoside triphosphatase (1);	0.000000	0.39759	N	0.001272	D	0.92616	0.7654	M	0.91818	3.245	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.90544	0.4504	10	0.87932	D	0	.	8.4404	0.32812	0.0794:0.0:0.3846:0.5361	.	343;343;343;343	F2Z321;A8K407;A8MTQ2;P59046	.;.;.;NAL12_HUMAN	W	343	ENSP00000319377:R343W;ENSP00000438030:R343W;ENSP00000340473:R343W;ENSP00000346231:R343W;ENSP00000375655:R343W;ENSP00000375653:R343W;ENSP00000375652:R343W	ENSP00000319377:R343W	R	-	1	2	NLRP12	59005698	0.000000	0.05858	0.646000	0.29493	0.315000	0.28087	-0.717000	0.04986	-0.148000	0.11234	-0.467000	0.05162	CGG	-	superfamily_P-loop_NTPase,pfscan_NACHT_NTPase		0.557	NLRP12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	NLRP12	protein_coding	OTTHUMT00000134340.1	G	NM_144687	rs112159191		54313886	-1	no_errors	ENST00000324134	ensembl	human	known	74_37	missense	SNP	0.375	A
LONRF2	164832	genome.wustl.edu	37	2	100915748	100915748	+	Missense_Mutation	SNP	G	G	A			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr2:100915748G>A	ENST00000393437.3	-	6	1940	c.1301C>T	c.(1300-1302)aCa>aTa	p.T434I	LONRF2_ENST00000409647.1_Missense_Mutation_p.T191I	NM_198461.3	NP_940863.3	Q1L5Z9	LONF2_HUMAN	LON peptidase N-terminal domain and ring finger 2	434							ATP-dependent peptidase activity (GO:0004176)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(11)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	34						ACTTTCTTCTGTCTCAGAGTT	0.433																																																	0								ENSG00000170500						82.0	83.0	82.0					2																	100915748		2203	4300	6503	LONRF2	SO:0001583	missense	0			-	HGNC	AK127206	CCDS2046.2	2q11.2	2013-01-09			ENSG00000170500	ENSG00000170500		"""RING-type (C3HC4) zinc fingers"""	24788	protein-coding gene	gene with protein product							Standard	NM_198461		Approved	FLJ45273, RNF192	uc002tal.4	Q1L5Z9	OTTHUMG00000130668	ENST00000393437.3:c.1301C>T	2.37:g.100915748G>A	ENSP00000377086:p.Thr434Ile	Somatic	0	71	0.00		0.4120429396410797	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	63	17.95	B9A006|Q6ZSR4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Pept_S16_N,pfam_Znf_C3HC4_RING-type,superfamily_PUA-like_domain,smart_Znf_RING,smart_TPR_repeat,smart_Pept_S16_N,pfscan_TPR-contain_dom,pfscan_Znf_RING	p.T434I	ENST00000393437.3	37	c.1301	CCDS2046.2	2	.	.	.	.	.	.	.	.	.	.	G	5.896	0.349399	0.11182	.	.	ENSG00000170500	ENST00000393437;ENST00000409647	D;D	0.86030	-1.9;-2.06	3.96	-7.93	0.01156	Zinc finger, RING/FYVE/PHD-type (1);	3.484580	0.00520	N	0.000191	T	0.71367	0.3331	N	0.22421	0.69	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.61700	-0.7009	10	0.18710	T	0.47	14.1699	7.1238	0.25461	0.1823:0.1025:0.5782:0.1371	.	434	Q1L5Z9	LONF2_HUMAN	I	434;191	ENSP00000377086:T434I;ENSP00000386823:T191I	ENSP00000377086:T434I	T	-	2	0	LONRF2	100282180	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.517000	0.06275	-2.638000	0.00430	-1.090000	0.02178	ACA	-	NULL		0.433	LONRF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LONRF2	protein_coding	OTTHUMT00000253161.2	G	NM_198461	-		100915748	-1	no_errors	ENST00000393437	ensembl	human	known	74_37	missense	SNP	0.000	A
ATIC	471	genome.wustl.edu	37	2	216197214	216197214	+	Silent	SNP	A	A	G			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr2:216197214A>G	ENST00000236959.9	+	8	1124	c.798A>G	c.(796-798)aaA>aaG	p.K266K	ATIC_ENST00000435675.1_Silent_p.K265K|ATIC_ENST00000540518.1_Silent_p.K207K	NM_004044.6	NP_004035.2	P31939	PUR9_HUMAN	5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase	266		Transition state stabilizer. {ECO:0000255}.			'de novo' IMP biosynthetic process (GO:0006189)|brainstem development (GO:0003360)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|dihydrofolate metabolic process (GO:0046452)|nucleobase-containing compound metabolic process (GO:0006139)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleoside metabolic process (GO:0009116)|organ regeneration (GO:0031100)|purine nucleobase metabolic process (GO:0006144)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|response to inorganic substance (GO:0010035)|small molecule metabolic process (GO:0044281)|tetrahydrofolate biosynthetic process (GO:0046654)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)	IMP cyclohydrolase activity (GO:0003937)|phosphoribosylaminoimidazolecarboxamide formyltransferase activity (GO:0004643)|protein homodimerization activity (GO:0042803)		ATIC/ALK(24)	large_intestine(2)|lung(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	8		Renal(323;0.229)		Epithelial(149;2.02e-06)|all cancers(144;0.000316)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.0097)	Methotrexate(DB00563)|Pemetrexed(DB00642)|Tetrahydrofolic acid(DB00116)	CCTCTTTCAAACATGTCAGCC	0.438			T	ALK	ALCL																																			Dom	yes		2	2q35	471	5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase		L	0								ENSG00000138363						41.0	45.0	44.0					2																	216197214		2203	4300	6503	ATIC	SO:0001819	synonymous_variant	0			-	HGNC		CCDS2398.1	2q35	2010-04-27			ENSG00000138363	ENSG00000138363	2.1.2.3, 3.5.4.10		794	protein-coding gene	gene with protein product	"""phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase"""	601731				8567683, 9378707	Standard	NM_004044		Approved	PURH, AICARFT, IMPCHASE	uc002vex.4	P31939	OTTHUMG00000133023	ENST00000236959.9:c.798A>G	2.37:g.216197214A>G		Somatic	0	56	0.00		0.4120429396410797	108	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	60	10.45	A8K202|E9PBU3|Q13856|Q53S28	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_AICARFT_IMPCHas,pfam_MGS-like_dom,superfamily_Cytidine_deaminase-like,superfamily_MGS-like_dom,smart_MGS-like_dom,smart_AICARFT_IMPCHas,pirsf_AICARFT_IMPCHas,tigrfam_AICARFT_IMPCHas	p.K266	ENST00000236959.9	37	c.798	CCDS2398.1	2																																																																																			-	pfam_AICARFT_IMPCHas,superfamily_Cytidine_deaminase-like,smart_AICARFT_IMPCHas,pirsf_AICARFT_IMPCHas,tigrfam_AICARFT_IMPCHas		0.438	ATIC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATIC	protein_coding	OTTHUMT00000256610.1	A	NM_004044	-		216197214	+1	no_errors	ENST00000236959	ensembl	human	known	74_37	silent	SNP	0.985	G
KRTAP2-2	728279	genome.wustl.edu	37	17	39211139	39211140	+	In_Frame_Ins	INS	-	-	GCAGGGGGGCCGGCA	rs9674636		TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr17:39211139_39211140insGCAGGGGGGCCGGCA	ENST00000398477.1	-	1	342_343	c.324_325insTGCCGGCCCCCCTGC	c.(322-327)tgcggc>tgcTGCCGGCCCCCCTGCggc	p.107_108insCCRPP	KRTAP2-2_ENST00000542910.1_In_Frame_Ins_p.107_108insCCRPP	NM_033032.2	NP_149021.2	Q9BYT5	KRA22_HUMAN	keratin associated protein 2-2	107	11 X 5 AA repeats of C-C-[CDPQRWG]- [APRS]-[CIPSTVD].					keratin filament (GO:0045095)											GTCGGCTGGCCGCAGGGGGACT	0.703																																																	0								ENSG00000214518			369,641		167,35,303						3.3	1.0			2	525,2849		188,149,1350	no	coding	KRTAP2-2	NM_033032.2		355,184,1653	A1A1,A1R,RR		15.5602,36.5347,20.3923				894,3490				KRTAP2-2	SO:0001652	inframe_insertion	0				HGNC	AJ302536	CCDS32648.1, CCDS54122.1	17q21.2	2013-06-25			ENSG00000214518	ENSG00000214518		"""Keratin associated proteins"""	18905	protein-coding gene	gene with protein product							Standard	NM_033032		Approved	KAP2.2	uc010cxj.3	Q9BYT5	OTTHUMG00000133593	ENST00000398477.1:c.324_325insTGCCGGCCCCCCTGC	17.37:g.39211139_39211140insGCAGGGGGGCCGGCA	ENSP00000381494:p.Pro107_Cys108insCysCysArgProPro	Somatic	NA	NA	NA		0.4120429396410797	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A8MTN3|A8MXM4	In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_Keratin-assoc	p.108in_frame_insCRPPC	ENST00000398477.1	37	c.325_324	CCDS54122.1	17																																																																																			-	NULL		0.703	KRTAP2-2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KRTAP2-2	protein_coding	OTTHUMT00000257697.1	-				39211140	-1	no_errors	ENST00000542910	ensembl	human	known	74_37	in_frame_ins	INS	1.000:1.000	GCAGGGGGGCCGGCA
CXXC1	30827	genome.wustl.edu	37	18	47810148	47810148	+	Missense_Mutation	SNP	A	A	T	rs138609805		TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr18:47810148A>T	ENST00000285106.6	-	11	2165	c.1451T>A	c.(1450-1452)aTc>aAc	p.I484N	MBD1_ENST00000585672.1_5'Flank|MBD1_ENST00000382948.5_5'Flank|MBD1_ENST00000591416.1_5'Flank|CXXC1_ENST00000587396.1_5'Flank|MBD1_ENST00000398493.1_5'Flank|MBD1_ENST00000424334.2_5'Flank|MBD1_ENST00000349085.2_5'Flank|MBD1_ENST00000339998.6_5'Flank|MBD1_ENST00000353909.3_5'Flank|MBD1_ENST00000269468.5_5'Flank|MBD1_ENST00000347968.3_5'Flank|MBD1_ENST00000269471.5_5'Flank|CXXC1_ENST00000412036.2_Missense_Mutation_p.I488N|MBD1_ENST00000436910.1_5'Flank|MBD1_ENST00000457839.2_5'Flank|MBD1_ENST00000585595.1_5'Flank|MBD1_ENST00000587605.1_5'Flank|MBD1_ENST00000590208.1_5'Flank|CXXC1_ENST00000589940.1_Missense_Mutation_p.I484N	NM_001101654.1|NM_014593.3	NP_001095124.1|NP_055408.2	Q9P0U4	CXXC1_HUMAN	CXXC finger protein 1	484					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|histone H3-K4 methylation (GO:0051568)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	24						AACACAGAAGATCTGCAGGTC	0.577																																																	0								ENSG00000154832						145.0	123.0	130.0					18																	47810148		2203	4300	6503	CXXC1	SO:0001583	missense	0			-	HGNC	BC014940	CCDS11945.1, CCDS45866.1	18q12	2014-02-20	2014-02-20		ENSG00000154832	ENSG00000154832		"""Zinc fingers, PHD-type"""	24343	protein-coding gene	gene with protein product	"""CpG binding protein"", ""DNA-binding protein with PHD finger and CXXC domain"", ""zinc finger, CpG binding-type containing 1"""	609150	"""CXXC finger 1 (PHD domain)"""			10799292, 10688657	Standard	NM_014593		Approved	HsT2645, PCCX1, hCGBP, PHF18, CGBP, SPP1, CFP1, ZCGPC1	uc002ler.4	Q9P0U4	OTTHUMG00000132670	ENST00000285106.6:c.1451T>A	18.37:g.47810148A>T	ENSP00000285106:p.Ile484Asn	Somatic	0	60	0.00		0.4120429396410797	63	23.17	19	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	34	15.00	B2RC03|Q8N2W4|Q96BC8|Q9P2V7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_CpG-bd_C,pfam_Znf_CXXC,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger,pfscan_Znf_CXXC	p.I488N	ENST00000285106.6	37	c.1463	CCDS11945.1	18	.	.	.	.	.	.	.	.	.	.	A	21.0	4.085296	0.76642	.	.	ENSG00000154832	ENST00000285106;ENST00000412036	T;T	0.27256	1.68;1.68	4.65	4.65	0.58169	CpG binding protein, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.45617	0.1351	L	0.59436	1.845	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.76071	0.977;0.987;0.985	T	0.44832	-0.9302	10	0.87932	D	0	-12.8846	12.3149	0.54951	1.0:0.0:0.0:0.0	.	488;484;351	Q9P0U4-2;Q9P0U4;Q59EC8	.;CXXC1_HUMAN;.	N	484;488	ENSP00000285106:I484N;ENSP00000390475:I488N	ENSP00000285106:I484N	I	-	2	0	CXXC1	46064146	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.508000	0.90525	1.856000	0.53863	0.383000	0.25322	ATC	-	pfam_CpG-bd_C		0.577	CXXC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CXXC1	protein_coding	OTTHUMT00000255927.2	A	NM_014593	-		47810148	-1	no_errors	ENST00000412036	ensembl	human	known	74_37	missense	SNP	1.000	T
SIN3A	25942	genome.wustl.edu	37	15	75684814	75684814	+	Missense_Mutation	SNP	G	G	C			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr15:75684814G>C	ENST00000394947.3	-	15	2934	c.2620C>G	c.(2620-2622)Caa>Gaa	p.Q874E	SIN3A_ENST00000360439.4_Missense_Mutation_p.Q874E|SIN3A_ENST00000394949.4_Missense_Mutation_p.Q874E	NM_001145358.1	NP_001138830.1			SIN3 transcription regulator family member A											breast(2)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(15)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	63						CTTAATTTTTGAGCTGCTGTG	0.443																																																	0								ENSG00000169375						146.0	145.0	146.0					15																	75684814		2197	4294	6491	SIN3A	SO:0001583	missense	0			-	HGNC	AK027559	CCDS10279.1	15q22.33	2013-08-21	2013-08-21		ENSG00000169375	ENSG00000169375			19353	protein-coding gene	gene with protein product		607776	"""SIN3 homolog A, transcription regulator (yeast)"", ""SIN3 transcription regulator homolog A (yeast)"""			10773092, 7601471	Standard	NM_001145357		Approved	KIAA0700, DKFZP434K2235	uc002bai.3	Q96ST3	OTTHUMG00000142834	ENST00000394947.3:c.2620C>G	15.37:g.75684814G>C	ENSP00000378402:p.Gln874Glu	Somatic	0	56	0.00		0.4120429396410797	48	40.74	33	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	57	26.92		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PAH,pfam_HDAC_interact,superfamily_PAH,smart_HDAC_interact	p.Q874E	ENST00000394947.3	37	c.2620	CCDS10279.1	15	.	.	.	.	.	.	.	.	.	.	G	8.662	0.900738	0.17686	.	.	ENSG00000169375	ENST00000394947;ENST00000394949;ENST00000360439	T;T;T	0.39592	1.07;1.07;1.07	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	T	0.39306	0.1073	L	0.60455	1.87	0.80722	D	1	B	0.13594	0.008	B	0.15870	0.014	T	0.40496	-0.9560	10	0.02654	T	1	-19.4734	19.0195	0.92908	0.0:0.0:1.0:0.0	.	874	Q96ST3	SIN3A_HUMAN	E	874	ENSP00000378402:Q874E;ENSP00000378403:Q874E;ENSP00000353622:Q874E	ENSP00000353622:Q874E	Q	-	1	0	SIN3A	73471867	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.829000	0.99411	2.746000	0.94184	0.655000	0.94253	CAA	-	NULL		0.443	SIN3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIN3A	protein_coding	OTTHUMT00000286469.1	G	NM_015477	-		75684814	-1	no_errors	ENST00000360439	ensembl	human	known	74_37	missense	SNP	1.000	C
ARL6	84100	genome.wustl.edu	37	3	97487021	97487021	+	Missense_Mutation	SNP	G	G	A			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr3:97487021G>A	ENST00000463745.1	+	2	547	c.70G>A	c.(70-72)Ggg>Agg	p.G24R	ARL6_ENST00000335979.2_Missense_Mutation_p.G24R|ARL6_ENST00000496713.1_3'UTR|ARL6_ENST00000394206.1_Missense_Mutation_p.G24R	NM_001278293.1	NP_001265222.1	Q9H0F7	ARL6_HUMAN	ADP-ribosylation factor-like 6	24					cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|fat cell differentiation (GO:0045444)|melanosome transport (GO:0032402)|protein polymerization (GO:0051258)|protein targeting to membrane (GO:0006612)|small GTPase mediated signal transduction (GO:0007264)|visual perception (GO:0007601)|Wnt signaling pathway (GO:0016055)	axonemal microtubule (GO:0005879)|axoneme (GO:0005930)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|membrane coat (GO:0030117)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|metal ion binding (GO:0046872)|phospholipid binding (GO:0005543)			large_intestine(1)|lung(4)	5		Lung NSC(201;0.0193)|Prostate(884;0.174)		LUSC - Lung squamous cell carcinoma(29;0.0118)|Lung(72;0.0189)		TTTGTGCCTTGGGCTAGATAA	0.363																																																	0								ENSG00000113966						127.0	123.0	124.0					3																	97487021		2203	4300	6503	ARL6	SO:0001583	missense	0			-	HGNC	BC024239	CCDS2928.1	3q11.2	2014-05-09			ENSG00000113966	ENSG00000113966		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	13210	protein-coding gene	gene with protein product		608845		BBS3		15258860, 15314642, 21282186	Standard	NM_032146		Approved	RP55	uc003drv.3	Q9H0F7	OTTHUMG00000159189	ENST00000463745.1:c.70G>A	3.37:g.97487021G>A	ENSP00000419619:p.Gly24Arg	Somatic	0	89	0.00		0.4120429396410797	9	30.77	4	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	51	12.07	A8KA93|D3DN31	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Small_GTPase_ARF/SAR,pfam_Small_GTPase,pfam_SRP_receptor_beta_su,pfam_Gprotein_alpha_su,pfam_Gtr1_RagA,pfam_MIRO-like,superfamily_P-loop_NTPase,smart_Small_GTPase_SAR1,smart_Small_GTPase_ARF,prints_Small_GTPase_ARF/SAR,tigrfam_Small_GTP-bd_dom	p.G24R	ENST00000463745.1	37	c.70	CCDS2928.1	3	.	.	.	.	.	.	.	.	.	.	G	26.0	4.691272	0.88735	.	.	ENSG00000113966	ENST00000463745;ENST00000462412;ENST00000335979;ENST00000394206	D;D;D;D	0.99292	-5.7;-5.7;-5.7;-5.7	5.76	4.87	0.63330	Small GTP-binding protein domain (1);	0.046877	0.85682	N	0.000000	D	0.99739	0.9897	H	0.99582	4.64	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96729	0.9538	10	0.87932	D	0	.	16.6081	0.84836	0.0:0.1302:0.8698:0.0	.	24	Q9H0F7	ARL6_HUMAN	R	24	ENSP00000419619:G24R;ENSP00000418740:G24R;ENSP00000337722:G24R;ENSP00000377756:G24R	ENSP00000337722:G24R	G	+	1	0	ARL6	98969711	1.000000	0.71417	0.988000	0.46212	0.993000	0.82548	9.229000	0.95273	1.391000	0.46566	0.655000	0.94253	GGG	-	pfam_Small_GTPase_ARF/SAR,pfam_Small_GTPase,pfam_SRP_receptor_beta_su,pfam_Gtr1_RagA,pfam_MIRO-like,superfamily_P-loop_NTPase,smart_Small_GTPase_SAR1,smart_Small_GTPase_ARF,prints_Small_GTPase_ARF/SAR,tigrfam_Small_GTP-bd_dom		0.363	ARL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARL6	protein_coding	OTTHUMT00000353756.1	G	NM_032146	-		97487021	+1	no_errors	ENST00000335979	ensembl	human	known	74_37	missense	SNP	1.000	A
GOLGA3	2802	genome.wustl.edu	37	12	133349865	133349865	+	Missense_Mutation	SNP	G	G	T			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr12:133349865G>T	ENST00000450791.2	-	23	4506	c.4323C>A	c.(4321-4323)agC>agA	p.S1441R	GOLGA3_ENST00000204726.3_Missense_Mutation_p.S1441R			Q08378	GOGA3_HUMAN	golgin A3	1441					intra-Golgi vesicle-mediated transport (GO:0006891)	cytosol (GO:0005829)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extrinsic component of Golgi membrane (GO:0090498)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	transporter activity (GO:0005215)			breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.27e-08)|Epithelial(86;3.34e-07)|all cancers(50;9.4e-06)		GGCGCTGCAGGCTGTCCATCT	0.662																																																	0								ENSG00000090615						23.0	20.0	21.0					12																	133349865		2199	4288	6487	GOLGA3	SO:0001583	missense	0			-	HGNC	AF485338	CCDS9281.1, CCDS53846.1	12q24.33	2010-02-12	2010-02-12		ENSG00000090615	ENSG00000090615			4426	protein-coding gene	gene with protein product	"""SY2/SY10 protein"", ""Golgi complex-associated protein of 170 kD"""	602581	"""golgi autoantigen, golgin subfamily a, 3"""			8315394, 15829563	Standard	NM_001172557		Approved	golgin-160, GCP170, MEA-2	uc001ukz.1	Q08378	OTTHUMG00000168023	ENST00000450791.2:c.4323C>A	12.37:g.133349865G>T	ENSP00000410378:p.Ser1441Arg	Somatic	0	50	0.00		0.4120429396410797	109	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	35	10.26	A5PKX6|O43241|Q6P9C7|Q86XW3|Q8TDA9|Q8WZA3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_Prefoldin	p.S1441R	ENST00000450791.2	37	c.4323	CCDS9281.1	12	.	.	.	.	.	.	.	.	.	.	G	21.2	4.119575	0.77323	.	.	ENSG00000090615	ENST00000204726;ENST00000450791	T;T	0.27402	1.67;1.67	5.81	2.0	0.26442	.	0.000000	0.85682	D	0.000000	T	0.39886	0.1095	L	0.34521	1.04	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.17379	-1.0371	10	0.72032	D	0.01	.	9.3616	0.38199	0.4023:0.0:0.5977:0.0	.	1441	Q08378	GOGA3_HUMAN	R	1441	ENSP00000204726:S1441R;ENSP00000410378:S1441R	ENSP00000204726:S1441R	S	-	3	2	GOLGA3	131859938	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.289000	0.51747	0.549000	0.28973	-0.143000	0.13931	AGC	-	NULL		0.662	GOLGA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GOLGA3	protein_coding	OTTHUMT00000397569.2	G	NM_005895	-		133349865	-1	no_errors	ENST00000204726	ensembl	human	known	74_37	missense	SNP	1.000	T
CHIT1	1118	genome.wustl.edu	37	1	203186975	203186975	+	Nonsense_Mutation	SNP	T	T	A			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr1:203186975T>A	ENST00000367229.1	-	10	1082	c.1048A>T	c.(1048-1050)Aag>Tag	p.K350*	CHIT1_ENST00000484834.1_5'UTR|CHIT1_ENST00000255427.3_Nonsense_Mutation_p.K331*|CHIT1_ENST00000535569.1_Nonsense_Mutation_p.K341*	NM_001270509.1|NM_003465.2	NP_001257438.1|NP_003456.1	Q13231	CHIT1_HUMAN	chitinase 1 (chitotriosidase)	350					chitin catabolic process (GO:0006032)|immune response (GO:0006955)|polysaccharide catabolic process (GO:0000272)|response to bacterium (GO:0009617)	extracellular space (GO:0005615)|lysosome (GO:0005764)	chitin binding (GO:0008061)|chitinase activity (GO:0004568)|endochitinase activity (GO:0008843)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(13)|ovary(1)|stomach(2)	27						CCCAGTCCCTTCTGCTTCAGA	0.637																																																	0								ENSG00000133063						43.0	35.0	38.0					1																	203186975		2203	4300	6503	CHIT1	SO:0001587	stop_gained	0			-	HGNC	U29615	CCDS1436.1, CCDS58057.1	1q32.1	2013-06-06			ENSG00000133063	ENSG00000133063			1936	protein-coding gene	gene with protein product		600031				9748235, 9492324	Standard	NM_003465		Approved	CHIT, CHI3	uc001gzn.2	Q13231	OTTHUMG00000042126	ENST00000367229.1:c.1048A>T	1.37:g.203186975T>A	ENSP00000356198:p.Lys350*	Somatic	0	75	0.00		0.4120429396410797	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	48	9.43	B3KNW6|J3KN09|Q0VGG5|Q0VGG6|Q3ZAR1|Q6ISC2|Q9H3V8|Q9UDJ8	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Glyco_hydro18cat,pfam_Chitin-bd_dom,superfamily_Glycoside_hydrolase_SF,superfamily_Chitin-bd_dom,smart_Chitinase_II,smart_Chitin-bd_dom,pfscan_Chitin-bd_dom	p.K350*	ENST00000367229.1	37	c.1048	CCDS1436.1	1	.	.	.	.	.	.	.	.	.	.	T	23.5	4.429057	0.83667	.	.	ENSG00000133063	ENST00000367229;ENST00000255427;ENST00000535569	.	.	.	4.71	2.1	0.27182	.	0.819792	0.10465	N	0.671455	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06494	T	0.89	-6.7144	6.0807	0.19940	0.1611:0.0:0.167:0.6718	.	.	.	.	X	350;331;341	.	ENSP00000255427:K331X	K	-	1	0	CHIT1	201453598	0.987000	0.35691	0.883000	0.34634	0.428000	0.31595	1.045000	0.30341	0.720000	0.32209	0.460000	0.39030	AAG	-	pfam_Glyco_hydro18cat,superfamily_Glycoside_hydrolase_SF,smart_Chitinase_II		0.637	CHIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHIT1	protein_coding	OTTHUMT00000100275.2	T	NM_003465	-		203186975	-1	no_errors	ENST00000367229	ensembl	human	known	74_37	nonsense	SNP	0.332	A
UBL4A	8266	genome.wustl.edu	37	X	153713811	153713811	+	3'UTR	SNP	G	G	T			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chrX:153713811G>T	ENST00000369660.4	-	0	626				UBL4A_ENST00000477777.1_5'UTR|UBL4A_ENST00000369653.4_Intron	NM_014235.3	NP_055050.1	P11441	UBL4A_HUMAN	ubiquitin-like 4A						cellular protein modification process (GO:0006464)|tail-anchored membrane protein insertion into ER membrane (GO:0071816)|transport (GO:0006810)	BAT3 complex (GO:0071818)|cytosol (GO:0005829)	small conjugating protein ligase activity (GO:0019787)			endometrium(5)|lung(1)|urinary_tract(1)	7	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					ACTGCAACAGGAGAACACACT	0.557																																					Esophageal Squamous(74;88 1215 11149 34177 46777)												0								ENSG00000102178																																			UBL4A	SO:0001624	3_prime_UTR_variant	0			-	HGNC	J03589	CCDS14754.1	Xq28	2010-08-05	2005-09-27	2005-09-27	ENSG00000102178	ENSG00000102178			12505	protein-coding gene	gene with protein product		312070	"""ubiquitin-like 4"""	UBL4		2829204, 16872915	Standard	NM_014235		Approved	GDX, DXS254E, GET5, MDY2, TMA24	uc004flo.3	P11441	OTTHUMG00000013370	ENST00000369660.4:c.*67C>A	X.37:g.153713811G>T		Somatic	0	51	0.00		0.4120429396410797	174	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00	Q5HY80	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000369660.4	37	NULL	CCDS14754.1	X																																																																																			-	-		0.557	UBL4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBL4A	protein_coding	OTTHUMT00000037238.2	G	NM_014235	-		153713811	-1	no_errors	ENST00000477777	ensembl	human	putative	74_37	rna	SNP	0.274	T
MT-ND1	4535	genome.wustl.edu	37	M	965	965	+	5'Flank	SNP	C	C	A			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chrM:965C>A	ENST00000361390.2	+	0	0				MT-TL1_ENST00000386347.1_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-RNR1_ENST00000389680.2_RNA|MT-TF_ENST00000387314.1_RNA|MT-TV_ENST00000387342.1_RNA			P03886	NU1M_HUMAN	mitochondrially encoded NADH dehydrogenase 1						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(13)|kidney(17)|lung(2)|prostate(1)	34					Desflurane(DB01189)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	TCACCCCCTCCCCAATAAAGC	0.443																																																	0								ENSG00000211459																																			MT-RNR1	SO:0001631	upstream_gene_variant	0			-	HGNC			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198888	ENSG00000198888	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7455	protein-coding gene	gene with protein product	"""complex I ND1 subunit"", ""NADH-ubiquinone oxidoreductase chain 1"""	516000	"""NADH dehydrogenase 1"""	MTND1			Standard			Approved	ND1, NAD1		P03886			M.37:g.965C>A	Exception_encountered	Somatic	0	59	0.00		0.4120429396410797	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	18	10.00	C0JKH6|Q37523	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000361390.2	37	NULL		MT																																																																																			-	-		0.443	MT-ND1-201	KNOWN	basic|appris_principal	protein_coding	MT-RNR1	protein_coding		C	YP_003024026	-		965	+1	no_errors	ENST00000389680	ensembl	human	known	74_37	rna	SNP	NULL	A
TFEC	22797	genome.wustl.edu	37	7	115750938	115750938	+	Missense_Mutation	SNP	G	G	A			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr7:115750938G>A	ENST00000484212.1	-	3	196	c.22C>T	c.(22-24)Ctt>Ttt	p.L8F	TFEC_ENST00000474337.1_5'UTR			O14948	TFEC_HUMAN	transcription factor EC	0	Necessary for transcriptional transactivation.				cellular response to heat (GO:0034605)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			NS(1)|kidney(1)|large_intestine(5)|lung(13)|prostate(2)|skin(1)|urinary_tract(2)	25			STAD - Stomach adenocarcinoma(10;0.00878)			TGAAATTGAAGTCCAGTTAAA	0.343																																																	0								ENSG00000105967																																			TFEC	SO:0001583	missense	0			-	HGNC	D43945	CCDS5762.1, CCDS34738.1, CCDS59076.1	7q31.2	2013-05-21			ENSG00000105967	ENSG00000105967		"""Basic helix-loop-helix proteins"""	11754	protein-coding gene	gene with protein product		604732				9256061	Standard	NM_012252		Approved	TCFEC, TFECL, bHLHe34	uc003vhj.2	O14948	OTTHUMG00000023518	ENST00000484212.1:c.22C>T	7.37:g.115750938G>A	ENSP00000417432:p.Leu8Phe	Somatic	0	50	0.00		0.4120429396410797	7	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	59	9.23	B2R8X5|Q5H9U8|Q709A4|Q8N6J9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.L8F	ENST00000484212.1	37	c.22		7	.	.	.	.	.	.	.	.	.	.	g	17.40	3.381050	0.61845	.	.	ENSG00000105967	ENST00000484212	T	0.23754	1.89	5.48	2.7	0.31948	.	.	.	.	.	T	0.19927	0.0479	.	.	.	0.24031	N	0.996119	B	0.17852	0.024	B	0.17979	0.02	T	0.24225	-1.0166	8	0.87932	D	0	.	6.7359	0.23409	0.1584:0.1541:0.6875:0.0	.	8	B7Z757	.	F	8	ENSP00000417432:L8F	ENSP00000390171:L8F	L	-	1	0	TFEC	115538174	0.930000	0.31532	0.411000	0.26484	0.975000	0.68041	1.769000	0.38522	0.289000	0.22422	0.650000	0.86243	CTT	-	NULL		0.343	TFEC-008	NOVEL	basic	protein_coding	TFEC	protein_coding	OTTHUMT00000351050.2	G	NM_012252	-		115750938	-1	no_errors	ENST00000484212	ensembl	human	novel	74_37	missense	SNP	0.373	A
SASS6	163786	genome.wustl.edu	37	1	100550855	100550855	+	3'UTR	SNP	C	C	A			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr1:100550855C>A	ENST00000287482.5	-	0	2143				SASS6_ENST00000535161.1_3'UTR|RP4-714D9.2_ENST00000432294.1_RNA|SASS6_ENST00000462159.1_5'UTR	NM_194292.1	NP_919268.1	Q6UVJ0	SAS6_HUMAN	spindle assembly 6 homolog (C. elegans)						centriole replication (GO:0007099)|centrosome duplication (GO:0051298)	centriole (GO:0005814)|centrosome (GO:0005813)|deuterosome (GO:0098536)				breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(2)|lung(6)|ovary(1)|upper_aerodigestive_tract(2)	19		all_epithelial(167;4.58e-06)|all_lung(203;0.00125)|Lung NSC(277;0.00131)		Epithelial(280;0.085)|all cancers(265;0.139)|COAD - Colon adenocarcinoma(174;0.15)|Lung(183;0.197)		TTCTAAAATACCAATAAAAAG	0.378																																																	0								ENSG00000156876						85.0	94.0	91.0					1																	100550855		2203	4300	6503	SASS6	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AL834265	CCDS764.1	1p21.3	2008-02-05			ENSG00000156876	ENSG00000156876			25403	protein-coding gene	gene with protein product		609321				15665853, 14654843	Standard	NM_194292		Approved	DKFZp761A078, SAS-6, FLJ22097, SAS6	uc001dsu.3	Q6UVJ0	OTTHUMG00000010754	ENST00000287482.5:c.*29G>T	1.37:g.100550855C>A		Somatic	0	41	0.00		0.4120429396410797	4	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	D3DT55|Q8N3K0	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000287482.5	37	NULL	CCDS764.1	1																																																																																			-	-		0.378	SASS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SASS6	protein_coding	OTTHUMT00000029656.2	C	NM_194292	-		100550855	-1	no_errors	ENST00000462159	ensembl	human	known	74_37	rna	SNP	0.002	A
TKT	7086	genome.wustl.edu	37	3	53274298	53274298	+	Missense_Mutation	SNP	C	C	G			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr3:53274298C>G	ENST00000462138.1	-	4	494	c.406G>C	c.(406-408)Gcc>Ccc	p.A136P	TKT_ENST00000423516.1_Missense_Mutation_p.A136P|TKT_ENST00000296289.6_Missense_Mutation_p.A89P|TKT_ENST00000423525.2_Missense_Mutation_p.A136P			P29401	TKT_HUMAN	transketolase	136					carbohydrate metabolic process (GO:0005975)|energy reserve metabolic process (GO:0006112)|glyceraldehyde-3-phosphate biosynthetic process (GO:0046166)|pentose-phosphate shunt (GO:0006098)|pentose-phosphate shunt, non-oxidative branch (GO:0009052)|regulation of growth (GO:0040008)|small molecule metabolic process (GO:0044281)|xylulose biosynthetic process (GO:0005999)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|peroxisome (GO:0005777)|vesicle (GO:0031982)	cofactor binding (GO:0048037)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|transketolase activity (GO:0004802)			endometrium(5)|large_intestine(4)|lung(4)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	17		Prostate(884;0.0959)		BRCA - Breast invasive adenocarcinoma(193;0.000159)|OV - Ovarian serous cystadenocarcinoma(275;0.000314)|Kidney(197;0.00178)|KIRC - Kidney renal clear cell carcinoma(197;0.00201)		CCGGTGTAGGCCATCCCACAA	0.592																																					Colon(133;1506 2347 35238 42177)												0								ENSG00000163931						90.0	84.0	86.0					3																	53274298		2203	4300	6503	TKT	SO:0001583	missense	0			-	HGNC		CCDS2871.1, CCDS58834.1	3p14.3	2008-07-31	2008-07-31		ENSG00000163931	ENSG00000163931	2.2.1.1		11834	protein-coding gene	gene with protein product	"""Wernicke-Korsakoff syndrome"""	606781				1567394	Standard	NM_001064		Approved		uc011beq.2	P29401	OTTHUMG00000158192	ENST00000462138.1:c.406G>C	3.37:g.53274298C>G	ENSP00000417773:p.Ala136Pro	Somatic	0	119	0.00		0.4120429396410797	333	22.56	97	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	66	19.51	A8K089|B4DE31|E7EPA7|Q8TBA3|Q96HH3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Transketolase_N,pfam_Transketolase-like_Pyr-bd,pfam_Transketolase_C,pfam_DH_E1,superfamily_Transketo_C/Pyr-ferredox_oxred,smart_Transketolase-like_Pyr-bd	p.A136P	ENST00000462138.1	37	c.406	CCDS2871.1	3	.	.	.	.	.	.	.	.	.	.	C	22.9	4.344778	0.82022	.	.	ENSG00000163931	ENST00000462138;ENST00000423525;ENST00000423516;ENST00000296289	T;T;T;T	0.57107	0.42;0.42;0.42;0.42	6.07	5.17	0.71159	Transketolase, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.82467	0.5043	H	0.97635	4.045	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.88117	0.2829	10	0.87932	D	0	-3.5466	16.8452	0.85978	0.1289:0.8711:0.0:0.0	.	136;136	E7EPA7;P29401	.;TKT_HUMAN	P	136;136;136;89	ENSP00000417773:A136P;ENSP00000405455:A136P;ENSP00000391481:A136P;ENSP00000296289:A89P	ENSP00000296289:A89P	A	-	1	0	TKT	53249338	1.000000	0.71417	1.000000	0.80357	0.320000	0.28249	6.067000	0.71193	2.884000	0.98904	0.655000	0.94253	GCC	-	pfam_Transketolase_N,pfam_DH_E1		0.592	TKT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TKT	protein_coding	OTTHUMT00000350356.1	C		-		53274298	-1	no_errors	ENST00000423525	ensembl	human	known	74_37	missense	SNP	1.000	G
RYR3	6263	genome.wustl.edu	37	15	33954925	33954925	+	Silent	SNP	C	C	T			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr15:33954925C>T	ENST00000389232.4	+	35	5264	c.5194C>T	c.(5194-5196)Ctg>Ttg	p.L1732L	RYR3_ENST00000415757.3_Silent_p.L1732L	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	1732	4 X approximate repeats.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		CATTGGAACCCTGCTGGTCAT	0.577																																																	0								ENSG00000198838						101.0	109.0	107.0					15																	33954925		2145	4267	6412	RYR3	SO:0001819	synonymous_variant	0			-	HGNC		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.5194C>T	15.37:g.33954925C>T		Somatic	0	98	0.00		0.4120429396410797	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	52	28.77	O15175|Q15412	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ryanodine_rcpt,pfam_Ca-rel_channel,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,superfamily_4_helix_cytokine-like_core,superfamily_ARM-type_fold,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_hand_dom,pfscan_MIR_motif	p.L1732	ENST00000389232.4	37	c.5194	CCDS45210.1	15																																																																																			-	NULL		0.577	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR3	protein_coding	OTTHUMT00000417514.1	C		-		33954925	+1	no_errors	ENST00000389232	ensembl	human	known	74_37	silent	SNP	0.543	T
KRTAP10-2	386679	genome.wustl.edu	37	21	45971380	45971381	+	5'UTR	INS	-	-	GTGAGTGAGTGT	rs6147532|rs61660473|rs375322622|rs587605229|rs375670763|rs62220863	byFrequency	TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr21:45971380_45971381insGTGAGTGAGTGT	ENST00000391621.1	-	0	7_8				TSPEAR_ENST00000323084.4_Intron|KRTAP10-2_ENST00000498210.1_5'UTR|TSPEAR_ENST00000397916.1_Intron	NM_198693.2	NP_941966.1	P60368	KR102_HUMAN	keratin associated protein 10-2							keratin filament (GO:0045095)				large_intestine(1)|lung(4)|skin(1)	6						GAGgtgtgtgagtgagtgagtg	0.599														3966	0.791933	0.8343	0.7262	5008	,	,		18766	0.7609		0.7773	False		,,,				2504	0.8282																0								ENSG00000205445																																			KRTAP10-2	SO:0001623	5_prime_UTR_variant	0				HGNC	AJ566381	CCDS42955.1	21q22.3	2007-10-05			ENSG00000205445	ENSG00000205445		"""Keratin associated proteins"""	22967	protein-coding gene	gene with protein product				KRTAP18-2			Standard	NM_198693		Approved	KAP10.2, KAP18.2	uc002zfi.1	P60368	OTTHUMG00000057625	ENST00000391621.1:c.-40->ACACTCACTCAC	21.37:g.45971380_45971381insGTGAGTGAGTGT		Somatic	NA	NA	NA		0.4120429396410797	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q70LJ5	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000391621.1	37	NULL	CCDS42955.1	21																																																																																			-	-		0.599	KRTAP10-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP10-2	protein_coding	OTTHUMT00000128027.1	-				45971381	-1	no_errors	ENST00000498210	ensembl	human	known	74_37	rna	INS	0.018:0.138	GTGAGTGAGTGT
CETP	1071	genome.wustl.edu	37	16	56996959	56996959	+	Missense_Mutation	SNP	C	C	A	rs201282006		TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr16:56996959C>A	ENST00000200676.3	+	2	286	c.156C>A	c.(154-156)ttC>ttA	p.F52L	CETP_ENST00000379780.2_Missense_Mutation_p.F52L|CETP_ENST00000566128.1_5'UTR|CETP_ENST00000569082.1_3'UTR	NM_000078.2	NP_000069.2			cholesteryl ester transfer protein, plasma											NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(8)|lung(4)|skin(3)	23						AGACCGCCTTCCAGCGAGCCA	0.627																																																	0								ENSG00000087237						98.0	72.0	81.0					16																	56996959		2198	4300	6498	CETP	SO:0001583	missense	0			-	HGNC	M30185	CCDS10772.1, CCDS67032.1	16q13	2012-10-02			ENSG00000087237	ENSG00000087237		"""BPI fold containing"""	1869	protein-coding gene	gene with protein product	"""BPI fold containing family F"""	118470				3600759, 2334701	Standard	NM_000078		Approved	BPIFF	uc002eki.2	P11597	OTTHUMG00000133279	ENST00000200676.3:c.156C>A	16.37:g.56996959C>A	ENSP00000200676:p.Phe52Leu	Somatic	0	68	0.00		0.4120429396410797	7	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Lipid-bd_serum_glycop_C,pfam_Lipid-bd_serum_glycop_N,superfamily_Bactericidal_perm-incr_a/b_dom,smart_Lipid-bd_serum_glycop_N,smart_Lipid-bd_serum_glycop_C,pirsf_Cholesteryl_ester_transfer	p.F52L	ENST00000200676.3	37	c.156	CCDS10772.1	16	.	.	.	.	.	.	.	.	.	.	C	9.414	1.081231	0.20309	.	.	ENSG00000087237	ENST00000200676;ENST00000379780	T;T	0.02446	4.29;4.29	4.68	3.72	0.42706	Lipid-binding serum glycoprotein, conserved site (1);Lipid-binding serum glycoprotein, N-terminal (2);Bactericidal permeability-increasing protein, alpha/beta domain (1);	0.000000	0.85682	U	0.000000	T	0.05777	0.0151	L	0.36672	1.1	0.80722	D	1	D;B	0.56035	0.974;0.15	D;B	0.67725	0.953;0.412	T	0.38542	-0.9656	10	0.02654	T	1	-7.1235	9.6839	0.40087	0.0:0.9008:0.0:0.0992	.	52;52	P11597-2;P11597	.;CETP_HUMAN	L	52	ENSP00000200676:F52L;ENSP00000369106:F52L	ENSP00000200676:F52L	F	+	3	2	CETP	55554460	1.000000	0.71417	0.119000	0.21687	0.031000	0.12232	2.475000	0.45162	0.938000	0.37419	0.591000	0.81541	TTC	-	pfam_Lipid-bd_serum_glycop_N,superfamily_Bactericidal_perm-incr_a/b_dom,smart_Lipid-bd_serum_glycop_N,pirsf_Cholesteryl_ester_transfer		0.627	CETP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CETP	protein_coding	OTTHUMT00000257059.1	C	NM_000078	-		56996959	+1	no_errors	ENST00000200676	ensembl	human	known	74_37	missense	SNP	0.997	A
QKI	9444	genome.wustl.edu	37	6	163984490	163984490	+	Missense_Mutation	SNP	G	G	C			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr6:163984490G>C	ENST00000361752.3	+	6	1224	c.673G>C	c.(673-675)Gct>Cct	p.A225P	QKI_ENST00000453779.2_Missense_Mutation_p.A225P|QKI_ENST00000424802.3_Missense_Mutation_p.A217P|QKI_ENST00000361195.2_Missense_Mutation_p.A217P|QKI_ENST00000275262.7_Missense_Mutation_p.A225P|QKI_ENST00000392127.2_Missense_Mutation_p.A225P	NM_006775.2|NM_206853.2|NM_206854.2|NM_206855.2	NP_006766.1|NP_996735.1|NP_996736.1|NP_996737.1	Q96PU8	QKI_HUMAN	QKI, KH domain containing, RNA binding	225					long-chain fatty acid biosynthetic process (GO:0042759)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|muscle cell differentiation (GO:0042692)|myelination (GO:0042552)|positive regulation of gene expression (GO:0010628)|regulation of translation (GO:0006417)|RNA splicing (GO:0008380)|spermatid development (GO:0007286)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(2)|large_intestine(13)|lung(5)|ovary(1)|prostate(3)|urinary_tract(2)	27		Breast(66;5e-05)|Prostate(117;0.0235)|all_neural(5;0.0416)|Ovarian(120;0.0448)|Glioma(2;0.203)		all cancers(1;4.4e-46)|OV - Ovarian serous cystadenocarcinoma(33;6.91e-23)|GBM - Glioblastoma multiforme(1;2.94e-19)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|Kidney(3;0.000199)|KIRC - Kidney renal clear cell carcinoma(3;0.000234)		AGCCCAGGCTGCTCCAAGGAT	0.488																																																	0								ENSG00000112531						42.0	42.0	42.0					6																	163984490		2203	4300	6503	QKI	SO:0001583	missense	0			-	HGNC	AB067798	CCDS5285.1, CCDS5286.1, CCDS5287.1, CCDS43525.1, CCDS75546.1	6q26	2011-09-12	2011-09-12		ENSG00000112531	ENSG00000112531			21100	protein-coding gene	gene with protein product		609590	"""quaking homolog, KH domain RNA binding (mouse)"""			10535969	Standard	NM_006775		Approved	QK3	uc003qui.3	Q96PU8	OTTHUMG00000015977	ENST00000361752.3:c.673G>C	6.37:g.163984490G>C	ENSP00000355094:p.Ala225Pro	Somatic	0	29	0.00		0.4120429396410797	319	40.93	221	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	34	22.73	Q2I375|Q5MJQ1|Q969L9|Q96EJ3|Q96KA3|Q96PU6|Q96PU7|Q9P0X6|Q9P0X7|Q9P0X8|Q9P0X9|Q9P0Y0|Q9P0Y1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_KH_dom_type_1,smart_KH_dom	p.A225P	ENST00000361752.3	37	c.673	CCDS5285.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.22|15.22	2.768390|2.768390	0.49680|0.49680	.|.	.|.	ENSG00000112531|ENSG00000112531	ENST00000453779;ENST00000275262;ENST00000392127;ENST00000361752;ENST00000361195;ENST00000424802;ENST00000544823|ENST00000537883;ENST00000544361	T;T|.	0.18338|.	2.22;2.22|.	4.63|4.63	4.63|4.63	0.57726|0.57726	.|.	0.225115|.	0.37669|.	N|.	0.001996|.	T|T	0.38692|0.38692	0.1050|0.1050	N|N	0.22421|0.22421	0.69|0.69	0.58432|0.58432	D|D	0.999998|0.999998	D;D;P;D;D;D|.	0.76494|.	0.979;0.984;0.919;0.999;0.986;0.986|.	P;P;P;D;P;P|.	0.80764|.	0.736;0.548;0.616;0.994;0.656;0.656|.	T|T	0.13872|0.13872	-1.0493|-1.0493	10|5	0.37606|.	T|.	0.19|.	-2.0224|-2.0224	13.3096|13.3096	0.60371|0.60371	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	217;225;217;225;225;225|.	Q96PU8-3;Q96PU8;Q96PU8-5;Q96PU8-9;Q96PU8-6;Q96PU8-8|.	.;QKI_HUMAN;.;.;.;.|.	P|S	225;225;225;225;217;217;170|121;58	ENSP00000354867:A217P;ENSP00000408382:A217P|.	ENSP00000275262:A225P|.	A|C	+|+	1|2	0|0	QKI|QKI	163904480|163904480	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	9.476000|9.476000	0.97823|0.97823	2.865000|2.865000	0.98341|0.98341	0.655000|0.655000	0.94253|0.94253	GCT|TGC	-	NULL		0.488	QKI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	QKI	protein_coding	OTTHUMT00000043016.2	G	NM_006775	-		163984490	+1	no_errors	ENST00000361752	ensembl	human	known	74_37	missense	SNP	1.000	C
NDFIP1	80762	genome.wustl.edu	37	5	141511526	141511526	+	Intron	DEL	A	A	-	rs556414620		TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr5:141511526delA	ENST00000253814.4	+	2	621				NDFIP1_ENST00000509436.1_3'UTR	NM_030571.3	NP_085048.1	Q9BT67	NFIP1_HUMAN	Nedd4 family interacting protein 1						cellular iron ion homeostasis (GO:0006879)|negative regulation of gene expression (GO:0010629)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-4 production (GO:0032713)|negative regulation of isotype switching to IgE isotypes (GO:0048294)|negative regulation of protein transport (GO:0051224)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of transporter activity (GO:0032410)|negative regulation of type 2 immune response (GO:0002829)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein ubiquitination (GO:0031398)|regulation of isotype switching to IgG isotypes (GO:0048302)|regulation of lymphocyte differentiation (GO:0045619)|regulation of myeloid leukocyte differentiation (GO:0002761)|signal transduction (GO:0007165)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	cell cortex (GO:0005938)|endosome (GO:0005768)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)	signal transducer activity (GO:0004871)			large_intestine(3)|lung(1)|ovary(1)	5		all_hematologic(541;0.0999)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATTACAGTTTAAAAAAAAAAA	0.393																																																	0								ENSG00000131507																																			NDFIP1	SO:0001627	intron_variant	0				HGNC	BC004317	CCDS4273.1	5q31.3	2008-02-05			ENSG00000131507	ENSG00000131507			17592	protein-coding gene	gene with protein product		612050				11042109, 11748237	Standard	NM_030571		Approved	N4WBP5, MGC10924	uc003lmi.4	Q9BT67	OTTHUMG00000129659	ENST00000253814.4:c.151+66A>-	5.37:g.141511526delA		Somatic	0	14	0.00		0.4120429396410797	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	14	22.22	B2RDB8|D3DQF0|Q658T8|Q8N2E3|Q8N2F9	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000253814.4	37	NULL	CCDS4273.1	5																																																																																			-	-		0.393	NDFIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDFIP1	protein_coding	OTTHUMT00000251859.2	A	NM_030571			141511526	+1	no_errors	ENST00000509436	ensembl	human	known	74_37	rna	DEL	0.000	-
PLG	5340	genome.wustl.edu	37	6	161134305	161134306	+	Intron	INS	-	-	T	rs113752311|rs140653624|rs528521448	byFrequency	TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr6:161134305_161134306insT	ENST00000308192.9	+	5	610				PLG_ENST00000462918.1_3'UTR	NM_000301.3	NP_000292.1	P00747	PLMN_HUMAN	plasminogen						blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|fibrinolysis (GO:0042730)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion mediated by cadherin (GO:2000048)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of fibrinolysis (GO:0051918)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of fibrinolysis (GO:0051919)|tissue remodeling (GO:0048771)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	apolipoprotein binding (GO:0034185)|protein domain specific binding (GO:0019904)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(19)|ovary(1)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)	59				OV - Ovarian serous cystadenocarcinoma(65;5.24e-17)|BRCA - Breast invasive adenocarcinoma(81;7.08e-06)	Alteplase(DB00009)|Aminocaproic Acid(DB00513)|Anistreplase(DB00029)|Aprotinin(DB06692)|Reteplase(DB00015)|Streptokinase(DB00086)|Tenecteplase(DB00031)|Tranexamic Acid(DB00302)|Urokinase(DB00013)	ATTAACCTGAAttttttttttt	0.436																																																	0								ENSG00000122194																																			PLG	SO:0001627	intron_variant	0				HGNC	M74220	CCDS5279.1, CCDS55074.1	6q26	2012-10-02			ENSG00000122194	ENSG00000122194			9071	protein-coding gene	gene with protein product		173350					Standard	NM_000301		Approved		uc003qtm.4	P00747	OTTHUMG00000015957	ENST00000308192.9:c.547+148->T	6.37:g.161134316_161134316dupT		Somatic	0	14	0.00		0.4120429396410797	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	10	37.50	Q15146|Q5TEH4|Q6PA00	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000308192.9	37	NULL	CCDS5279.1	6																																																																																			-	-		0.436	PLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLG	protein_coding	OTTHUMT00000042959.2	-	NM_000301			161134306	+1	no_errors	ENST00000462918	ensembl	human	known	74_37	rna	INS	0.002:0.003	T
LOC403323	403323	genome.wustl.edu	37	9	66513647	66513647	+	IGR	SNP	C	C	T			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr9:66513647C>T								RP11-262H14.1 (44337 upstream) : RP11-262H14.7 (3558 downstream)																							AAAATGACAGCATTCAGGGTC	0.507																																																	0								ENSG00000234665																																			RP11-262H14.3	SO:0001628	intergenic_variant	0			-	Clone_based_vega_gene																													9.37:g.66513647C>T		Somatic	0	33	0.00		0.4120429396410797	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	30	11.76		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL		37	NULL		9																																																																																			-	-	0	0.507					FLJ20444			C		-		66513647	-1	no_errors	ENST00000586625	ensembl	human	known	74_37	rna	SNP	1.000	T
NF1	4763	genome.wustl.edu	37	17	29541587	29541588	+	Frame_Shift_Ins	INS	-	-	A			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr17:29541587_29541588insA	ENST00000358273.4	+	13	1894_1895	c.1511_1512insA	c.(1510-1515)ccaaagfs	p.PK504fs	NF1_ENST00000356175.3_Frame_Shift_Ins_p.PK504fs|NF1_ENST00000431387.4_Frame_Shift_Ins_p.PK504fs	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	504					actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(5)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		CATGCAGATCCAAAGCTCTTGC	0.337			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																													yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	13	Whole gene deletion(8)|Unknown(5)	soft_tissue(7)|autonomic_ganglia(3)|central_nervous_system(2)|lung(1)						ENSG00000196712																																			NF1	SO:0001589	frameshift_variant	0	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome		HGNC		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.1514dupA	17.37:g.29541590_29541590dupA	ENSP00000351015:p.Pro504fs	Somatic	0	156	0.00		0.4120429396410797	18	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	40	175	18.60	O00662|Q14284|Q14930|Q14931|Q9UMK3	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_RasGAP,superfamily_Rho_GTPase_activation_prot,superfamily_ARM-type_fold,superfamily_CRAL-TRIO_dom,smart_RasGAP,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom,pfscan_RasGAP	p.L506fs	ENST00000358273.4	37	c.1511_1512	CCDS42292.1	17																																																																																			-	superfamily_ARM-type_fold		0.337	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NF1	protein_coding	OTTHUMT00000256351.2	-	NM_000267			29541588	+1	no_errors	ENST00000358273	ensembl	human	known	74_37	frame_shift_ins	INS	1.000:0.999	A
EFCAB11	90141	genome.wustl.edu	37	14	90420965	90420965	+	Missense_Mutation	SNP	C	C	T			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr14:90420965C>T	ENST00000316738.7	-	1	68	c.40G>A	c.(40-42)Gaa>Aaa	p.E14K	TDP1_ENST00000393454.2_5'Flank|TDP1_ENST00000393452.3_5'Flank|TDP1_ENST00000335725.4_5'Flank|TDP1_ENST00000357382.3_5'Flank|RP11-33N16.3_ENST00000555070.1_RNA|EFCAB11_ENST00000538485.2_Missense_Mutation_p.E14K|EFCAB11_ENST00000555872.1_5'Flank|EFCAB11_ENST00000556005.1_5'Flank|EFCAB11_ENST00000556609.1_Intron|EFCAB11_ENST00000267544.9_5'UTR	NM_001284267.1|NM_145231.3	NP_001271196.1|NP_660274.1	Q9BUY7	EFC11_HUMAN	EF-hand calcium binding domain 11	14							calcium ion binding (GO:0005509)			large_intestine(1)|lung(1)	2						GGACTGGCTTCCCACGTCCGC	0.632																																																	0								ENSG00000140025						56.0	47.0	50.0					14																	90420965		2203	4300	6503	EFCAB11	SO:0001583	missense	0			-	HGNC	AK094740	CCDS9887.1, CCDS61522.1, CCDS61523.1, CCDS61524.1, CCDS61525.1	14q32.11	2013-01-10	2011-01-31	2011-01-31	ENSG00000140025	ENSG00000140025		"""EF-hand domain containing"""	20357	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 143"""	C14orf143			Standard	NM_145231		Approved		uc001xxt.3	Q9BUY7	OTTHUMG00000148671	ENST00000316738.7:c.40G>A	14.37:g.90420965C>T	ENSP00000326267:p.Glu14Lys	Somatic	1	267	0.37		0.4120429396410797	18	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	32	150	17.49	B3KT10|B7Z5G9|G3V5G1|Q86T09|Q86TV7|Q8NDQ1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_EF_hand_dom,pfscan_EF_hand_dom	p.E14K	ENST00000316738.7	37	c.40	CCDS9887.1	14	.	.	.	.	.	.	.	.	.	.	C	18.92	3.726064	0.69074	.	.	ENSG00000140025	ENST00000316738;ENST00000538485	T;T	0.57436	0.4;2.93	5.51	5.51	0.81932	EF-hand-like domain (1);	0.074115	0.53938	D	0.000044	T	0.68384	0.2995	L	0.57536	1.79	0.80722	D	1	P;D	0.63880	0.518;0.993	B;D	0.72625	0.186;0.978	T	0.69161	-0.5218	10	0.72032	D	0.01	-30.2005	14.7928	0.69854	0.0:1.0:0.0:0.0	.	14;14	B7Z5G9;Q9BUY7	.;EFC11_HUMAN	K	14	ENSP00000326267:E14K;ENSP00000438072:E14K	ENSP00000326267:E14K	E	-	1	0	EFCAB11	89490718	0.077000	0.21312	0.776000	0.31678	0.484000	0.33280	1.773000	0.38563	2.873000	0.98535	0.561000	0.74099	GAA	-	NULL		0.632	EFCAB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EFCAB11	protein_coding	OTTHUMT00000309022.2	C	NM_145231	-		90420965	-1	no_errors	ENST00000316738	ensembl	human	known	74_37	missense	SNP	0.658	T
ZNF608	57507	genome.wustl.edu	37	5	124080775	124080776	+	5'UTR	INS	-	-	A	rs201912469		TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr5:124080775_124080776insA	ENST00000306315.5	-	0	342_343				ZNF608_ENST00000504926.1_5'Flank	NM_020747.2	NP_065798.2	Q9ULD9	ZN608_HUMAN	zinc finger protein 608								metal ion binding (GO:0046872)			breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(12)|ovary(3)|skin(6)|urinary_tract(1)	46		all_cancers(142;0.186)|Prostate(80;0.081)	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.00126)|Epithelial(69;0.00238)|all cancers(49;0.00783)		TTCTCTCAAAGAAAAAAAAAAT	0.436																																																	0								ENSG00000168916																																			ZNF608	SO:0001623	5_prime_UTR_variant	0				HGNC	AB033107	CCDS34219.1	5q23.2	2008-05-02			ENSG00000168916	ENSG00000168916		"""Zinc fingers, C2H2-type"""	29238	protein-coding gene	gene with protein product						10574462, 10508479	Standard	NM_020747		Approved	KIAA1281, DKFZp434M098, NY-REN-36	uc003ktq.1	Q9ULD9	OTTHUMG00000162999	ENST00000306315.5:c.-94->T	5.37:g.124080785_124080785dupA		Somatic	0	35	0.00		0.4120429396410797	4	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	14	17.65	A7E2W9|Q3SYM6|Q68D12|Q8IY05|Q9Y5A1	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000306315.5	37	NULL	CCDS34219.1	5																																																																																			-	-		0.436	ZNF608-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF608	protein_coding	OTTHUMT00000371300.1	-	XM_114432			124080776	-1	no_errors	ENST00000512940	ensembl	human	putative	74_37	rna	INS	0.885:0.996	A
RECQL5	9400	genome.wustl.edu	37	17	73620950	73620950	+	IGR	SNP	C	C	A			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr17:73620950C>A	ENST00000317905.5	-	0	3704				MYO15B_ENST00000578382.2_3'UTR|RECQL5_ENST00000443199.2_5'Flank	NM_004259.6	NP_004250.4	O94762	RECQ5_HUMAN	RecQ protein-like 5						chromosome separation (GO:0051304)|DNA duplex unwinding (GO:0032508)|DNA metabolic process (GO:0006259)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|mitotic nuclear division (GO:0007067)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|DNA helicase activity (GO:0003678)|nucleic acid binding (GO:0003676)|RNA polymerase II core binding (GO:0000993)			breast(1)|cervix(3)|endometrium(3)|kidney(7)|large_intestine(7)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	36	all_cancers(13;2.73e-08)|Breast(9;6.04e-09)|all_epithelial(9;6.79e-09)		all cancers(21;1.15e-06)|Epithelial(20;2.19e-06)|Lung(188;0.101)|LUSC - Lung squamous cell carcinoma(166;0.112)			TGGGAGACCCCACTGCACTTC	0.657								Other identified genes with known or suspected DNA repair function																																									0								ENSG00000266714																																			MYO15B	SO:0001628	intergenic_variant	0			-	HGNC	AB006533	CCDS32735.1, CCDS42380.1, CCDS45777.1	17q25	2014-03-07	2014-03-07	2014-03-07	ENSG00000108469	ENSG00000108469			9950	protein-coding gene	gene with protein product	"""RecQ protein 5"""	603781				9878247	Standard	NM_004259		Approved	RecQ5, FLJ90603	uc010dgl.3	O94762			17.37:g.73620950C>A		Somatic	0	37	0.00		0.4120429396410797	26	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	40	9.09	Q9H0B1|Q9P1W7|Q9UNC8	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000317905.5	37	NULL	CCDS42380.1	17	.	.	.	.	.	.	.	.	.	.	C	17.36	3.371238	0.61624	.	.	ENSG00000188126	ENST00000293201	T	0.73047	-0.71	5.24	-0.142	0.13448	.	.	.	.	.	T	0.63745	0.2537	.	.	.	0.09310	N	1	B;P	0.41475	0.379;0.751	B;B	0.40375	0.168;0.327	T	0.54234	-0.8324	8	0.44086	T	0.13	-2.3219	14.3039	0.66373	0.1485:0.7339:0.1176:0.0	.	272;246	Q9H614;Q8TCJ6	.;.	Q	272	ENSP00000293201:P272Q	ENSP00000293201:P272Q	P	+	2	0	MYO15B	71132545	0.000000	0.05858	0.251000	0.24312	0.511000	0.34104	-0.154000	0.10130	-0.248000	0.09583	0.561000	0.74099	CCA	-	-		0.657	RECQL5-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	MYO15B	protein_coding	OTTHUMT00000448207.1	C	NM_004259	-		73620950	+1	no_errors	ENST00000577948	ensembl	human	known	74_37	rna	SNP	0.025	A
ENKD1	84080	genome.wustl.edu	37	16	67697350	67697350	+	Missense_Mutation	SNP	G	G	T			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr16:67697350G>T	ENST00000243878.4	-	6	1174	c.853C>A	c.(853-855)Ctg>Atg	p.L285M	ACD_ENST00000219251.8_5'Flank|ENKD1_ENST00000602409.1_5'Flank|ACD_ENST00000393919.4_5'Flank|ENKD1_ENST00000602644.1_3'UTR	NM_032140.1	NP_115516.1	Q9H0I2	ENKD1_HUMAN	enkurin domain containing 1	285	Enkurin. {ECO:0000255|PROSITE- ProRule:PRU01000}.					cytoplasmic microtubule (GO:0005881)|microtubule cytoskeleton (GO:0015630)											AGTGTTTCCAGCCGCTGGTTC	0.701																																																	0								ENSG00000124074						38.0	44.0	42.0					16																	67697350		2198	4300	6498	ENKD1	SO:0001583	missense	0			-	HGNC	BC008284	CCDS10844.1	16q22.1	2012-10-09	2012-10-09	2012-10-09	ENSG00000124074	ENSG00000124074			25246	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 48"""	C16orf48		11230166	Standard	NM_032140		Approved	DKFZP434A1319	uc002etw.1	Q9H0I2	OTTHUMG00000137550	ENST00000243878.4:c.853C>A	16.37:g.67697350G>T	ENSP00000243878:p.Leu285Met	Somatic	0	38	0.00		0.4120429396410797	88	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	30	11.76	Q6UWD7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.L285M	ENST00000243878.4	37	c.853	CCDS10844.1	16	.	.	.	.	.	.	.	.	.	.	g	16.56	3.157911	0.57368	.	.	ENSG00000124074	ENST00000243878	.	.	.	4.72	4.72	0.59763	.	0.129202	0.53938	D	0.000057	T	0.78622	0.4312	M	0.78456	2.415	0.46478	D	0.999065	D;D	0.76494	0.963;0.999	P;D	0.70016	0.812;0.967	T	0.78265	-0.2271	9	0.36615	T	0.2	-1.1495	17.4698	0.87642	0.0:0.0:1.0:0.0	.	285;167	Q9H0I2;Q9H0I2-2	CP048_HUMAN;.	M	285	.	ENSP00000243878:L285M	L	-	1	2	C16orf48	66254851	1.000000	0.71417	0.994000	0.49952	0.053000	0.15095	4.424000	0.59868	2.452000	0.82932	0.556000	0.70494	CTG	-	NULL		0.701	ENKD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENKD1	protein_coding	OTTHUMT00000268884.1	G	NM_032140	-		67697350	-1	no_errors	ENST00000243878	ensembl	human	known	74_37	missense	SNP	1.000	T
JMJD1C	221037	genome.wustl.edu	37	10	64974302	64974302	+	Missense_Mutation	SNP	C	C	A			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr10:64974302C>A	ENST00000399262.2	-	8	1843	c.1625G>T	c.(1624-1626)aGt>aTt	p.S542I	JMJD1C_ENST00000402544.1_Missense_Mutation_p.S323I|JMJD1C_ENST00000399251.1_Missense_Mutation_p.S323I|JMJD1C_ENST00000489372.2_5'Flank|JMJD1C_ENST00000542921.1_Missense_Mutation_p.S360I	NM_032776.1	NP_116165.1	Q15652	JHD2C_HUMAN	jumonji domain containing 1C	542					blood coagulation (GO:0007596)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	intracellular (GO:0005622)|nucleoplasm (GO:0005654)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)|thyroid hormone receptor binding (GO:0046966)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(8)|large_intestine(9)|lung(27)|ovary(6)|prostate(4)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	77	Prostate(12;0.0119)|all_hematologic(501;0.191)					TTTTGAATCACTAACATTAGG	0.363																																																	0								ENSG00000171988						114.0	104.0	107.0					10																	64974302		1835	4089	5924	JMJD1C	SO:0001583	missense	0			-	HGNC	L40411	CCDS41532.1, CCDS60538.1	10q22.1	2011-05-25	2004-03-31	2004-04-01	ENSG00000171988	ENSG00000171988			12313	protein-coding gene	gene with protein product		604503	"""thyroid hormone receptor interactor 8"""	TRIP8		7776974	Standard	XM_005269624		Approved	DKFZp761F0118, KIAA1380, FLJ14374	uc001jmn.3	Q15652	OTTHUMG00000018311	ENST00000399262.2:c.1625G>T	10.37:g.64974302C>A	ENSP00000382204:p.Ser542Ile	Somatic	0	52	0.00		0.4120429396410797	17	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00	A0T124|Q5SQZ8|Q5SQZ9|Q5SR00|Q7Z3E7|Q8N3U0|Q96KB9|Q9P2G7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_JmjC_dom,smart_JmjC_dom,pfscan_JmjC_dom	p.S542I	ENST00000399262.2	37	c.1625	CCDS41532.1	10	.	.	.	.	.	.	.	.	.	.	C	15.85	2.955806	0.53293	.	.	ENSG00000171988	ENST00000399262;ENST00000402544;ENST00000399251;ENST00000542921	T;T;T;T	0.53640	0.61;0.61;0.61;0.61	5.81	2.97	0.34412	.	0.272597	0.43260	D	0.000588	T	0.55465	0.1922	L	0.54323	1.7	0.30940	N	0.725914	D;D	0.63880	0.993;0.991	P;P	0.57548	0.823;0.77	T	0.60850	-0.7181	10	0.56958	D	0.05	-4.0514	11.3913	0.49815	0.0:0.8021:0.0:0.1979	.	542;360	Q15652;A0T124	JHD2C_HUMAN;.	I	542;323;323;360	ENSP00000382204:S542I;ENSP00000384990:S323I;ENSP00000382195:S323I;ENSP00000444682:S360I	ENSP00000382195:S323I	S	-	2	0	JMJD1C	64644308	0.704000	0.27836	1.000000	0.80357	0.968000	0.65278	0.812000	0.27211	0.811000	0.34303	0.655000	0.94253	AGT	-	NULL		0.363	JMJD1C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	JMJD1C	protein_coding	OTTHUMT00000048249.2	C	NM_004241	-		64974302	-1	no_errors	ENST00000399262	ensembl	human	known	74_37	missense	SNP	1.000	A
CERS2	29956	genome.wustl.edu	37	1	150940932	150940932	+	Missense_Mutation	SNP	C	C	T	rs587616340	byFrequency	TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr1:150940932C>T	ENST00000271688.6	-	3	616	c.230G>A	c.(229-231)cGg>cAg	p.R77Q	RP11-316M1.12_ENST00000560481.1_RNA|CERS2_ENST00000561294.1_Missense_Mutation_p.R77Q|RP11-316M1.12_ENST00000561111.1_RNA|CERS2_ENST00000368954.5_Missense_Mutation_p.R77Q|CERS2_ENST00000345896.4_5'UTR	NM_181746.3	NP_859530.1	Q96G23	CERS2_HUMAN	ceramide synthase 2	77					ceramide biosynthetic process (GO:0046513)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear membrane (GO:0031965)	DNA binding (GO:0003677)|sphingosine N-acyltransferase activity (GO:0050291)										GGGAGGTGCCCGCAGCCGAGT	0.557													C|||	2	0.000399361	0.0	0.0	5008	,	,		17379	0.0		0.0	False		,,,				2504	0.002																0								ENSG00000143418						82.0	78.0	79.0					1																	150940932		2203	4300	6503	CERS2	SO:0001583	missense	0			-	HGNC	AF189062	CCDS973.1	1q21.3	2012-09-20	2011-07-08	2011-07-08	ENSG00000143418	ENSG00000143418		"""Homeoboxes / CERS class"""	14076	protein-coding gene	gene with protein product		606920	"""longevity assurance (LAG1, S. cerevisiae) homolog 2"", ""LAG1 longevity assurance homolog 2 (S. cerevisiae)"", ""LAG1 homolog, ceramide synthase 2"""	LASS2		11543633	Standard	NM_181746		Approved	SP260, FLJ10243	uc001evz.3	Q96G23	OTTHUMG00000035064	ENST00000271688.6:c.230G>A	1.37:g.150940932C>T	ENSP00000271688:p.Arg77Gln	Somatic	0	133	0.00		0.4120429396410797	617	23.01	185	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	94	13.76	D3DV06|Q5SZE5|Q9HD96|Q9NW79	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TLC-dom,pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_TLC-dom,pirsf_Longevity_assurance_LAG1_LAC1,pfscan_TLC-dom,pfscan_Homeobox_dom	p.R77Q	ENST00000271688.6	37	c.230	CCDS973.1	1	.	.	.	.	.	.	.	.	.	.	C	13.44	2.237511	0.39498	.	.	ENSG00000143418	ENST00000368954;ENST00000271688;ENST00000368949;ENST00000361419;ENST00000421609;ENST00000457392	T;T;T;T;T;T	0.29397	1.57;1.57;1.57;1.57;1.57;1.57	5.08	5.08	0.68730	Homeobox (2);Homeodomain-like (1);	0.134129	0.49305	D	0.000157	T	0.12774	0.0310	L	0.41710	1.295	0.54753	D	0.999985	B	0.20368	0.044	B	0.20184	0.028	T	0.04347	-1.0958	10	0.31617	T	0.26	-21.7859	9.9949	0.41893	0.0:0.8747:0.0:0.1253	.	77	Q96G23	CERS2_HUMAN	Q	77;77;97;77;77;77	ENSP00000357950:R77Q;ENSP00000271688:R77Q;ENSP00000357945:R97Q;ENSP00000355020:R77Q;ENSP00000393239:R77Q;ENSP00000394012:R77Q	ENSP00000271688:R77Q	R	-	2	0	CERS2	149207556	0.989000	0.36119	1.000000	0.80357	0.924000	0.55760	1.429000	0.34903	2.646000	0.89796	0.655000	0.94253	CGG	-	superfamily_Homeodomain-like,pirsf_Longevity_assurance_LAG1_LAC1,pfscan_Homeobox_dom		0.557	CERS2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CERS2	protein_coding	OTTHUMT00000084897.2	C	NM_022075	-		150940932	-1	no_errors	ENST00000271688	ensembl	human	known	74_37	missense	SNP	1.000	T
ZMYM3	9203	genome.wustl.edu	37	X	70465194	70465194	+	Frame_Shift_Del	DEL	G	G	-			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chrX:70465194delG	ENST00000353904.2	-	18	3189	c.3002delC	c.(3001-3003)cctfs	p.P1001fs	ZMYM3_ENST00000373988.1_Frame_Shift_Del_p.P1003fs|ZMYM3_ENST00000373984.3_Frame_Shift_Del_p.P1003fs|ZMYM3_ENST00000373998.1_Frame_Shift_Del_p.P989fs|ZMYM3_ENST00000489332.1_5'UTR|ZMYM3_ENST00000314425.5_Frame_Shift_Del_p.P1001fs	NM_005096.3	NP_005087.1	Q14202	ZMYM3_HUMAN	zinc finger, MYM-type 3	1001					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(7)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(12)|lung(17)|ovary(1)|prostate(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	Renal(35;0.156)					CTCACTCTTAGGGAAGTCTGC	0.532																																																	0								ENSG00000147130						108.0	77.0	87.0					X																	70465194		2203	4300	6503	ZMYM3	SO:0001589	frameshift_variant	0				HGNC	AB002383	CCDS14409.1, CCDS55443.1, CCDS55444.1	Xq13.1	2013-01-08	2005-12-19	2005-12-19	ENSG00000147130	ENSG00000147130		"""Zinc fingers, MYM type"""	13054	protein-coding gene	gene with protein product		300061	"""zinc finger protein 261"""	ZNF261		10486218	Standard	NM_201599		Approved	ZNF198L2, DXS6673E, KIAA0385, MYM	uc004dzh.2	Q14202	OTTHUMG00000021799	ENST00000353904.2:c.3002delC	X.37:g.70465194delG	ENSP00000343909:p.Pro1001fs	Somatic	0	33	0.00		0.4120429396410797	49	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	10	16.67	D3DVV3|O15089|Q96E26	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Znf_MYM,pfam_DUF3504,smart_TRASH_dom	p.P1003fs	ENST00000353904.2	37	c.3008	CCDS14409.1	X																																																																																			-	NULL		0.532	ZMYM3-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZMYM3	protein_coding	OTTHUMT00000057154.1	G	NM_201599			70465194	-1	no_errors	ENST00000373988	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
KIF1C	10749	genome.wustl.edu	37	17	4925906	4925906	+	Missense_Mutation	SNP	C	C	A			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr17:4925906C>A	ENST00000320785.5	+	22	2887	c.2530C>A	c.(2530-2532)Ctg>Atg	p.L844M	AC109333.10_ENST00000438266.1_RNA	NM_006612.5	NP_006603.2	O43896	KIF1C_HUMAN	kinesin family member 1C	844					ATP catabolic process (GO:0006200)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)|poly(A) RNA binding (GO:0044822)			NS(2)|breast(4)|endometrium(4)|kidney(2)|large_intestine(8)|lung(6)|skin(1)|urinary_tract(3)	30						GACGGGGATTCTGCAGGAGGT	0.677																																					Melanoma(96;1023 1447 10250 19259 33730)												0								ENSG00000129250						30.0	31.0	31.0					17																	4925906		2201	4299	6500	KIF1C	SO:0001583	missense	0			-	HGNC	U91329	CCDS11065.1	17p13.2	2014-03-03			ENSG00000129250	ENSG00000129250		"""Kinesins"""	6317	protein-coding gene	gene with protein product		603060	"""spastic ataxia 2 (autosomal recessive)"""	SAX2		9685376, 24319291, 24482476	Standard	NM_006612		Approved	SPAX2, SPG58	uc002gan.2	O43896	OTTHUMG00000099451	ENST00000320785.5:c.2530C>A	17.37:g.4925906C>A	ENSP00000320821:p.Leu844Met	Somatic	0	45	0.00		0.4120429396410797	183	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	24	14.29	D3DTL6|O75186|Q5U618	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Kinesin_motor_dom,pfam_FHA_dom,superfamily_P-loop_NTPase,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.L844M	ENST00000320785.5	37	c.2530	CCDS11065.1	17	.	.	.	.	.	.	.	.	.	.	C	18.98	3.738621	0.69304	.	.	ENSG00000129250	ENST00000320785	T	0.74632	-0.86	4.67	4.67	0.58626	.	.	.	.	.	T	0.82084	0.4960	L	0.47190	1.495	0.33128	D	0.542648	D	0.71674	0.998	D	0.77557	0.99	D	0.86117	0.1566	9	0.87932	D	0	.	15.1018	0.72284	0.0:1.0:0.0:0.0	.	844	O43896	KIF1C_HUMAN	M	844	ENSP00000320821:L844M	ENSP00000320821:L844M	L	+	1	2	KIF1C	4866630	0.281000	0.24258	1.000000	0.80357	0.999000	0.98932	0.926000	0.28804	2.436000	0.82500	0.655000	0.94253	CTG	-	NULL		0.677	KIF1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF1C	protein_coding	OTTHUMT00000216916.1	C		-		4925906	+1	no_errors	ENST00000320785	ensembl	human	known	74_37	missense	SNP	1.000	A
WWC2	80014	genome.wustl.edu	37	4	184202086	184202086	+	Intron	SNP	A	A	G			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr4:184202086A>G	ENST00000403733.3	+	17	2883				WWC2_ENST00000504005.1_Intron|WWC2_ENST00000448232.2_Missense_Mutation_p.K907R|WWC2_ENST00000513834.1_Intron|WWC2_ENST00000508747.1_5'Flank	NM_024949.5	NP_079225.5	Q6AWC2	WWC2_HUMAN	WW and C2 domain containing 2						negative regulation of hippo signaling (GO:0035331)|negative regulation of organ growth (GO:0046621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	cytosol (GO:0005829)	kinase binding (GO:0019900)|protein complex scaffold (GO:0032947)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(15)|ovary(2)|prostate(1)|stomach(1)|urinary_tract(3)	32		all_lung(41;5.28e-14)|Lung NSC(41;1.35e-13)|Colorectal(36;0.00681)|Hepatocellular(41;0.00886)|Renal(120;0.00992)|Prostate(90;0.0237)|all_hematologic(60;0.0592)|Esophageal squamous(56;0.179)|all_neural(102;0.202)		all cancers(43;3.38e-24)|Epithelial(43;1.4e-20)|OV - Ovarian serous cystadenocarcinoma(60;1.09e-09)|GBM - Glioblastoma multiforme(59;3.33e-05)|Colorectal(24;3.58e-05)|STAD - Stomach adenocarcinoma(60;4.21e-05)|COAD - Colon adenocarcinoma(29;0.000171)|LUSC - Lung squamous cell carcinoma(40;0.0145)|READ - Rectum adenocarcinoma(43;0.242)		TGGGAGCTCAAAGATGATGTG	0.443																																																	0								ENSG00000151718						33.0	24.0	27.0					4																	184202086		2161	4212	6373	WWC2	SO:0001627	intron_variant	0			-	HGNC	BC017957	CCDS34109.2	4q35.1	2010-08-05	2006-11-09		ENSG00000151718	ENSG00000151718		"""WW, C2 and coiled-coil domain containing"""	24148	protein-coding gene	gene with protein product			"""WW, C2 and coiled-coil domain containing 2"""			12477932	Standard	NM_024949		Approved	BOMB, FLJ22029	uc010irx.3	Q6AWC2	OTTHUMG00000150685	ENST00000403733.3:c.2684+36A>G	4.37:g.184202086A>G		Somatic	0	42	0.00		0.4120429396410797	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	34	32.00	Q32Q84|Q69YQ1|Q6AWB8|Q6ZSY9|Q6ZU09|Q7Z620|Q8TEB8|Q9H6P0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_WW_dom,superfamily_C2_dom,superfamily_WW_dom,smart_WW_dom,pfscan_WW_dom	p.K907R	ENST00000403733.3	37	c.2720	CCDS34109.2	4	.	.	.	.	.	.	.	.	.	.	A	10.26	1.300048	0.23650	.	.	ENSG00000151718	ENST00000448232	T	0.06068	3.35	3.54	-2.09	0.07232	.	.	.	.	.	T	0.03178	0.0093	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.46898	-0.9158	7	.	.	.	.	4.4031	0.11397	0.4911:0.3019:0.207:0.0	.	907	Q6AWC2-6	.	R	907	ENSP00000398577:K907R	.	K	+	2	0	WWC2	184439080	0.000000	0.05858	0.000000	0.03702	0.169000	0.22640	-0.272000	0.08560	-0.208000	0.10171	0.455000	0.32223	AAA	-	NULL		0.443	WWC2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	WWC2	protein_coding	OTTHUMT00000319608.1	A	NM_024949	-		184202086	+1	no_errors	ENST00000448232	ensembl	human	known	74_37	missense	SNP	0.000	G
ZNF133	7692	genome.wustl.edu	37	20	18296306	18296306	+	Missense_Mutation	SNP	G	G	A			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr20:18296306G>A	ENST00000316358.4	+	4	908	c.811G>A	c.(811-813)Gtg>Atg	p.V271M	RP4-568F9.3_ENST00000436848.1_RNA|ZNF133_ENST00000396026.3_Missense_Mutation_p.V274M|ZNF133_ENST00000402618.2_Missense_Mutation_p.V208M|ZNF133_ENST00000377671.3_Missense_Mutation_p.V270M|ZNF133_ENST00000535822.1_Missense_Mutation_p.V176M|ZNF133_ENST00000538547.1_Missense_Mutation_p.V176M|ZNF133_ENST00000401790.1_Missense_Mutation_p.V271M|ZNF133_ENST00000462170.1_3'UTR	NM_001282998.1|NM_001282999.1|NM_001283000.1|NM_001283001.1|NM_001283008.1	NP_001269927.1|NP_001269928.1|NP_001269929.1|NP_001269930.1|NP_001269937.1	P52736	ZN133_HUMAN	zinc finger protein 133	271					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	26						GAAGCCAATTGTGTGCAGGGA	0.547																																																	0								ENSG00000125846						74.0	63.0	67.0					20																	18296306		2203	4300	6503	ZNF133	SO:0001583	missense	0			-	HGNC	AK123005	CCDS13134.1, CCDS63234.1, CCDS63235.1, CCDS74703.1, CCDS74704.1	20p11.23	2013-01-08	2006-06-13		ENSG00000125846	ENSG00000125846		"""Zinc fingers, C2H2-type"", ""-"""	12917	protein-coding gene	gene with protein product		604075	"""zinc finger protein 150 (pHZ-66)"", ""zinc finger protein 133 (clone pHZ-13)"""	ZNF150		7557990, 7649249	Standard	XM_005260819		Approved	pHZ-13, pHZ-66	uc010gcs.3	P52736	OTTHUMG00000031965	ENST00000316358.4:c.811G>A	20.37:g.18296306G>A	ENSP00000346090:p.Val271Met	Somatic	0	58	0.00		0.4120429396410797	31	41.82	23	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	50	25.37	A8K5S4|B4DHU7|B4DIB8|B7ZAS1|F5H289|J3KQ11|J3KQJ0|Q53XU1|Q5JXV8|Q9BUV2|Q9H443	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.V274M	ENST00000316358.4	37	c.820		20	.	.	.	.	.	.	.	.	.	.	G	14.62	2.588688	0.46110	.	.	ENSG00000125846	ENST00000377671;ENST00000396026;ENST00000402618;ENST00000401790;ENST00000538547;ENST00000535822;ENST00000316358	T;T;T;T;T;T;T	0.34472	2.2;2.2;1.36;2.2;1.36;1.36;2.2	4.27	4.27	0.50696	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.41605	D	0.000842	T	0.39733	0.1089	N	0.16266	0.395	0.24271	N	0.995244	D;P;D;D	0.71674	0.998;0.941;0.975;0.995	D;P;P;D	0.75020	0.985;0.854;0.823;0.964	T	0.12811	-1.0533	10	0.48119	T	0.1	-19.9332	10.5004	0.44802	0.0:0.1966:0.8034:0.0	.	208;274;271;270	B4DIB8;B4DHU7;P52736;P52736-2	.;.;ZN133_HUMAN;.	M	270;274;208;271;176;176;271	ENSP00000366899:V270M;ENSP00000400897:V274M;ENSP00000385279:V208M;ENSP00000383945:V271M;ENSP00000442978:V176M;ENSP00000439427:V176M;ENSP00000346090:V271M	ENSP00000346090:V271M	V	+	1	0	ZNF133	18244306	0.000000	0.05858	0.977000	0.42913	0.895000	0.52256	-0.601000	0.05687	2.667000	0.90743	0.561000	0.74099	GTG	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.547	ZNF133-002	KNOWN	basic|appris_candidate	protein_coding	ZNF133	protein_coding	OTTHUMT00000127616.1	G	NM_003434	-		18296306	+1	no_errors	ENST00000396026	ensembl	human	known	74_37	missense	SNP	0.891	A
FBXO41	150726	genome.wustl.edu	37	2	73486154	73486154	+	Missense_Mutation	SNP	C	C	T			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr2:73486154C>T	ENST00000521871.1	-	13	2999	c.2584G>A	c.(2584-2586)Ggc>Agc	p.G862S	FBXO41_ENST00000295133.5_Missense_Mutation_p.G923S|FBXO41_ENST00000520530.2_Missense_Mutation_p.G862S			Q8TF61	FBX41_HUMAN	F-box protein 41	862										breast(2)|central_nervous_system(1)|endometrium(1)|lung(6)|pancreas(1)|prostate(1)|skin(1)	13						TTAGAGAAGCCGGGCCTCCGT	0.672																																																	0								ENSG00000163013						23.0	28.0	26.0					2																	73486154		1912	4091	6003	FBXO41	SO:0001583	missense	0			-	HGNC	AB075820	CCDS46337.1, CCDS46337.2	2p13.2	2004-08-24				ENSG00000163013		"""F-boxes /  ""other"""""	29409	protein-coding gene	gene with protein product		609108				11853319	Standard	NM_001080410		Approved	KIAA1940, Fbx41	uc021vjh.1	Q8TF61		ENST00000521871.1:c.2584G>A	2.37:g.73486154C>T	ENSP00000428646:p.Gly862Ser	Somatic	0	92	0.00		0.4120429396410797	9	18.18	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	57	10.94	G3V0Z7|Q2M1V8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_F-box_dom	p.G923S	ENST00000521871.1	37	c.2767	CCDS46337.2	2	.	.	.	.	.	.	.	.	.	.	C	31	5.103791	0.94245	.	.	ENSG00000163013	ENST00000295133;ENST00000521871	.	.	.	5.0	5.0	0.66597	.	0.000000	0.85682	D	0.000000	T	0.64450	0.2599	L	0.29908	0.895	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.56456	-0.7976	9	0.17832	T	0.49	-9.3665	17.386	0.87416	0.0:1.0:0.0:0.0	.	862	Q8TF61	FBX41_HUMAN	S	923;862	.	ENSP00000295133:G923S	G	-	1	0	FBXO41	73339662	0.996000	0.38824	1.000000	0.80357	0.860000	0.49131	3.398000	0.52579	2.774000	0.95407	0.561000	0.74099	GGC	-	NULL		0.672	FBXO41-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	FBXO41	protein_coding	OTTHUMT00000377381.1	C		-		73486154	-1	no_errors	ENST00000295133	ensembl	human	known	74_37	missense	SNP	1.000	T
GAB3	139716	genome.wustl.edu	37	X	153924353	153924353	+	Intron	SNP	G	G	T			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chrX:153924353G>T	ENST00000369575.3	-	8	1456				GAB3_ENST00000424127.2_Intron|GAB3_ENST00000496390.1_Intron	NM_001081573.1|NM_080612.2	NP_001075042.1|NP_542179.1	Q8WWW8	GAB3_HUMAN	GRB2-associated binding protein 3						macrophage differentiation (GO:0030225)					NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(7)|lung(6)|ovary(2)|prostate(1)|skin(1)	25	all_cancers(53;8.15e-17)|all_epithelial(53;1.1e-10)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					CTGAAAGCTGGCCAGGAACTA	0.458																																																	0								ENSG00000160219																																			GAB3	SO:0001627	intron_variant	0			-	HGNC	AY057989	CCDS14760.1, CCDS48198.1, CCDS65357.1	Xq28	2013-01-10			ENSG00000160219	ENSG00000160219		"""Pleckstrin homology (PH) domain containing"""	17515	protein-coding gene	gene with protein product	"""DOS/Gab family member 3"", ""Gab3 scaffolding protein"""	300482				11739737	Standard	XM_005274648		Approved		uc004fmk.1	Q8WWW8	OTTHUMG00000024245	ENST00000369575.3:c.1425-59C>A	X.37:g.153924353G>T		Somatic	0	34	0.00		0.4120429396410797	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	29	12.12	A6NHF8|E9PB44	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000369575.3	37	NULL	CCDS14760.1	X																																																																																			-	-		0.458	GAB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GAB3	protein_coding	OTTHUMT00000061192.2	G	NM_001081573	-		153924353	-1	no_errors	ENST00000475685	ensembl	human	putative	74_37	rna	SNP	0.996	T
SLC5A10	125206	genome.wustl.edu	37	17	18857121	18857121	+	Intron	SNP	G	G	C			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr17:18857121G>C	ENST00000395645.3	+	1	129				AC090286.4_ENST00000354432.3_RNA|SLC5A10_ENST00000417251.2_Intron|SLC5A10_ENST00000395643.2_Intron|SLC5A10_ENST00000395642.1_Intron|SLC5A10_ENST00000395647.2_Intron|SLC5A10_ENST00000317977.6_Intron	NM_001042450.2	NP_001035915.1	A0PJK1	SC5AA_HUMAN	solute carrier family 5 (sodium/sugar cotransporter), member 10						sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(3)|ovary(3)|prostate(3)|skin(3)	24						tcagattttagagttttgggt	0.383																																																	0								ENSG00000196893																																			AC090286.4	SO:0001627	intron_variant	0			-	Clone_based_vega_gene		CCDS11201.2, CCDS42275.1, CCDS59277.1, CCDS59278.1, CCDS74008.1	17p11.2	2013-07-19	2013-07-19		ENSG00000154025	ENSG00000154025		"""Solute carriers"""	23155	protein-coding gene	gene with protein product			"""solute carrier family 5 (sodium/glucose cotransporter), member 10"""				Standard	NM_152351		Approved	SGLT5	uc002gut.2	A0PJK1	OTTHUMG00000178143	ENST00000395645.3:c.111+1492G>C	17.37:g.18857121G>C		Somatic	0	78	0.00		0.4120429396410797	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	52	17.46	A8MUC9|B4DPI0|B7WPR4|Q6P5X0|Q8IXM4|Q96LQ1	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000395645.3	37	NULL	CCDS42275.1	17																																																																																			-	-		0.383	SLC5A10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC101928787	protein_coding	OTTHUMT00000132129.2	G	NM_152351	-		18857121	-1	no_errors	ENST00000354432	ensembl	human	known	74_37	rna	SNP	0.003	C
ARID1A	8289	genome.wustl.edu	37	1	27100182	27100184	+	In_Frame_Del	DEL	GCA	GCA	-	rs370696498|rs374564889		TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	GCA	GCA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr1:27100182_27100184delGCA	ENST00000324856.7	+	16	4349_4351	c.3978_3980delGCA	c.(3976-3981)ccgcag>ccg	p.Q1334del	ARID1A_ENST00000457599.2_In_Frame_Del_p.Q1334del|ARID1A_ENST00000540690.1_5'UTR|ARID1A_ENST00000374152.2_In_Frame_Del_p.Q951del	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	1334	Gln-rich.				androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)	p.Q1327*(1)|p.Q1334delQ(1)	ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		GCTACCCCCCgcagcagcagcag	0.591			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																			Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	2	Substitution - Nonsense(1)|Deletion - In frame(1)	large_intestine(1)|endometrium(1)						ENSG00000117713																																			ARID1A	SO:0001651	inframe_deletion	0				HGNC	AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.3978_3980delGCA	1.37:g.27100191_27100193delGCA	ENSP00000320485:p.Gln1334del	Somatic	0	50	0.00		0.4120429396410797	70	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	39	11.36	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_DUF3518,pfam_ARID/BRIGHT_DNA-bd,superfamily_ARID/BRIGHT_DNA-bd,superfamily_ARM-type_fold,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	p.Q1330in_frame_del	ENST00000324856.7	37	c.3978_3980	CCDS285.1	1																																																																																			-	NULL		0.591	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARID1A	protein_coding	OTTHUMT00000011437.2	GCA	NM_139135			27100184	+1	no_errors	ENST00000324856	ensembl	human	known	74_37	in_frame_del	DEL	0.986:0.981:0.931	-
PLXNB1	5364	genome.wustl.edu	37	3	48451087	48451087	+	Missense_Mutation	SNP	C	C	A			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr3:48451087C>A	ENST00000358536.4	-	33	6100	c.5831G>T	c.(5830-5832)aGc>aTc	p.S1944I	PLXNB1_ENST00000358459.4_Missense_Mutation_p.S1761I|PLXNB1_ENST00000456774.1_Missense_Mutation_p.S1761I|PLXNB1_ENST00000448774.2_Missense_Mutation_p.S555I|PLXNB1_ENST00000296440.6_Missense_Mutation_p.S1944I	NM_002673.4	NP_002664.2	O43157	PLXB1_HUMAN	plexin B1	1944					axon guidance (GO:0007411)|cell migration (GO:0016477)|intracellular signal transduction (GO:0035556)|negative regulation of cell adhesion (GO:0007162)|negative regulation of osteoblast proliferation (GO:0033689)|neuron projection morphogenesis (GO:0048812)|ossification involved in bone maturation (GO:0043931)|positive regulation of axonogenesis (GO:0050772)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell shape (GO:0008360)|regulation of cytoskeleton organization (GO:0051493)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in bone trabecula morphogenesis (GO:1900220)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	GTPase activating protein binding (GO:0032794)|receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)|semaphorin receptor binding (GO:0030215)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(10)|ovary(3)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	47				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		CACGGGGCGGCTGGTGCTGAG	0.592																																																	0								ENSG00000164050						60.0	59.0	59.0					3																	48451087		2203	4300	6503	PLXNB1	SO:0001583	missense	0			-	HGNC	X87904	CCDS2765.1	3p21.31	2008-07-18			ENSG00000164050	ENSG00000164050		"""Plexins"""	9103	protein-coding gene	gene with protein product		601053		PLXN5		8570614, 11035813	Standard	XM_005265234		Approved	SEP, KIAA0407	uc003csw.2	O43157	OTTHUMG00000133527	ENST00000358536.4:c.5831G>T	3.37:g.48451087C>A	ENSP00000351338:p.Ser1944Ile	Somatic	0	60	0.00		0.4120429396410797	56	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	A6H8Y2|Q6NY20|Q9UIV7|Q9UJ92|Q9UJ93	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_IPT,pfam_Semap_dom,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_IPT,pfscan_Semap_dom	p.S1944I	ENST00000358536.4	37	c.5831	CCDS2765.1	3	.	.	.	.	.	.	.	.	.	.	c	15.77	2.932114	0.52866	.	.	ENSG00000164050	ENST00000296440;ENST00000358459;ENST00000358536;ENST00000448774;ENST00000456774	T;T;T;T;T	0.12147	2.71;2.71;2.71;2.71;2.71	4.16	4.16	0.48862	Plexin, cytoplasmic RasGAP domain (1);Rho GTPase activation protein (1);Ras GTPase-activating protein (1);	0.043298	0.85682	D	0.000000	T	0.32526	0.0832	M	0.69823	2.125	0.48571	D	0.999674	D;D	0.71674	0.998;0.979	D;P	0.73380	0.98;0.755	T	0.02743	-1.1116	10	0.38643	T	0.18	.	11.1918	0.48690	0.0:0.905:0.0:0.095	.	1944;1761	O43157;O43157-2	PLXB1_HUMAN;.	I	1944;1761;1944;555;1761	ENSP00000296440:S1944I;ENSP00000351242:S1761I;ENSP00000351338:S1944I;ENSP00000389320:S555I;ENSP00000414199:S1761I	ENSP00000296440:S1944I	S	-	2	0	PLXNB1	48426091	1.000000	0.71417	1.000000	0.80357	0.105000	0.19272	4.858000	0.62947	1.868000	0.54150	0.306000	0.20318	AGC	-	pfam_Plexin_cytoplasmic_RasGAP_dom,superfamily_Rho_GTPase_activation_prot		0.592	PLXNB1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PLXNB1	protein_coding	OTTHUMT00000344454.1	C	NM_002673	-		48451087	-1	no_errors	ENST00000296440	ensembl	human	known	74_37	missense	SNP	1.000	A
FAT1	2195	genome.wustl.edu	37	4	187540522	187540522	+	Silent	SNP	C	C	T			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr4:187540522C>T	ENST00000441802.2	-	10	7427	c.7218G>A	c.(7216-7218)ggG>ggA	p.G2406G		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	2406	Cadherin 22. {ECO:0000255|PROSITE- ProRule:PRU00043}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						TCACGAAATGCCCATGAGGGG	0.433										HNSCC(5;0.00058)																											Colon(197;1040 2055 4143 4984 49344)												0								ENSG00000083857						49.0	51.0	50.0					4																	187540522		1983	4157	6140	FAT1	SO:0001819	synonymous_variant	0			-	HGNC	X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.7218G>A	4.37:g.187540522C>T		Somatic	0	47	0.00		0.4120429396410797	112	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	34	10.53		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Laminin_G,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,smart_EG-like_dom,smart_Laminin_G,smart_EGF-like_Ca-bd_dom,prints_Cadherin,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin	p.G2406	ENST00000441802.2	37	c.7218	CCDS47177.1	4																																																																																			-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin		0.433	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT1	protein_coding	OTTHUMT00000360209.3	C	NM_005245	-		187540522	-1	no_errors	ENST00000441802	ensembl	human	known	74_37	silent	SNP	0.998	T
