#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
NIFKP6	100132796	genome.wustl.edu	37	19	51906659	51906659	+	lincRNA	SNP	G	G	A	rs370693440		TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr19:51906659G>A	ENST00000600765.1	+	0	314																											CGTTAAGTAGGGTTGTTCTTG	0.448																																																	0								ENSG00000268889																																			CTD-2616J11.14			0			-	Clone_based_vega_gene																													19.37:g.51906659G>A		Somatic	0	23	0.00		0.5912292923157907	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	32	15.79		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000600765.1	37	NULL		19																																																																																			-	-		0.448	CTD-2616J11.14-001	KNOWN	basic	lincRNA	ENSG00000268889	lincRNA	OTTHUMT00000465204.1	G		-		51906659	+1	no_errors	ENST00000600765	ensembl	human	known	74_37	rna	SNP	0.001	A
CBWD1	55871	genome.wustl.edu	37	9	122049	122049	+	Silent	SNP	G	G	A			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr9:122049G>A	ENST00000356521.4	-	14	1081	c.993C>T	c.(991-993)gtC>gtT	p.V331V	CBWD1_ENST00000475411.1_5'UTR|CBWD1_ENST00000314367.10_Silent_p.V295V|CBWD1_ENST00000382447.4_Silent_p.V312V|CBWD1_ENST00000377400.4_Silent_p.V283V	NM_018491.3	NP_060961.3	Q9BRT8	CBWD1_HUMAN	COBW domain containing 1	331	CobW C-terminal.						ATP binding (GO:0005524)			kidney(1)|lung(2)|ovary(1)|skin(1)	5	all_lung(41;0.218)	all_cancers(5;3.04e-16)|all_epithelial(5;4.68e-12)|all_lung(10;1.94e-10)|Lung NSC(10;3.61e-10)|Acute lymphoblastic leukemia(5;0.00439)|Breast(48;0.0148)|all_hematologic(5;0.024)|Prostate(43;0.122)	Kidney(42;0.112)|KIRC - Kidney renal clear cell carcinoma(5;0.157)	all cancers(5;0.000704)|Lung(218;0.00755)|GBM - Glioblastoma multiforme(5;0.0149)|Epithelial(6;0.0154)		GGACACCCTGGACAATCACTT	0.433																																																	0								ENSG00000172785						1.0	1.0	1.0					9																	122049		584	1229	1813	CBWD1	SO:0001819	synonymous_variant	0			-	HGNC	AY343911	CCDS6438.1, CCDS47947.1, CCDS47948.1	9p24.3	2008-02-05			ENSG00000172785	ENSG00000172785			17134	protein-coding gene	gene with protein product		611078				15233989, 12421752	Standard	NM_018491		Approved		uc003zga.4	Q9BRT8	OTTHUMG00000019425	ENST00000356521.4:c.993C>T	9.37:g.122049G>A		Somatic	0	181	0.00		0.5912292923157907	42	31.15	19	WXS	Illumina HiSeq 2500	Phase_IV	tier1	108	5	95.58	A2RU55|A8K3N3|B0AZR4|Q49AJ1|Q5VVK2|Q6VBU6|Q7Z5Z0|Q7Z652|Q9BY38|Q9NYD0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_CobW/HypB/UreG_dom,pfam_Cbl_biosynth_CobW-like_C,superfamily_P-loop_NTPase,superfamily_Cbl_biosynth_CobW-like_C	p.V331	ENST00000356521.4	37	c.993	CCDS6438.1	9																																																																																			-	pfam_Cbl_biosynth_CobW-like_C,superfamily_Cbl_biosynth_CobW-like_C		0.433	CBWD1-008	KNOWN	basic|appris_principal|CCDS	protein_coding	CBWD1	protein_coding	OTTHUMT00000051463.1	G	NM_018491	-		122049	-1	no_errors	ENST00000356521	ensembl	human	known	74_37	silent	SNP	1.000	A
ARHGAP35	2909	genome.wustl.edu	37	19	47424830	47424830	+	Missense_Mutation	SNP	G	G	T			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr19:47424830G>T	ENST00000404338.3	+	1	2898	c.2898G>T	c.(2896-2898)gaG>gaT	p.E966D		NM_004491.4	NP_004482.4	Q9NRY4	RHG35_HUMAN	Rho GTPase activating protein 35	966					axon guidance (GO:0007411)|camera-type eye development (GO:0043010)|forebrain development (GO:0030900)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of vascular permeability (GO:0043116)|neural tube closure (GO:0001843)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|GTP binding (GO:0005525)|Rho GTPase activator activity (GO:0005100)|transcription corepressor activity (GO:0003714)										CCACCGAAGAGGTGTTTAACT	0.468																																																	0								ENSG00000160007						57.0	57.0	57.0					19																	47424830		1923	4129	6052	ARHGAP35	SO:0001583	missense	0			-	HGNC	M73077	CCDS46127.1	19q13.32	2011-06-29	2011-06-07	2011-06-07	ENSG00000160007	ENSG00000160007		"""Rho GTPase activating proteins"""	4591	protein-coding gene	gene with protein product		605277	"""glucocorticoid receptor DNA binding factor 1"""	GRLF1		1894621, 20675588	Standard	NM_004491		Approved	GRF-1, p190ARhoGAP, P190A, KIAA1722, p190RhoGAP	uc010ekv.3	Q9NRY4		ENST00000404338.3:c.2898G>T	19.37:g.47424830G>T	ENSP00000385720:p.Glu966Asp	Somatic	0	39	0.00		0.5912292923157907	91	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	A7E2A4|Q14452|Q9C0E1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RhoGAP_dom,pfam_Small_GTPase,pfam_FF_domain,superfamily_Rho_GTPase_activation_prot,superfamily_P-loop_NTPase,superfamily_FF_domain,smart_FF_domain,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.E966D	ENST00000404338.3	37	c.2898	CCDS46127.1	19	.	.	.	.	.	.	.	.	.	.	G	1.170	-0.641287	0.03557	.	.	ENSG00000160007	ENST00000317082;ENST00000404338	T	0.06687	3.27	5.86	-0.628	0.11537	.	0.157011	0.64402	D	0.000018	T	0.03348	0.0097	N	0.08118	0	0.41139	D	0.985946	B	0.02656	0.0	B	0.11329	0.006	T	0.47114	-0.9142	10	0.10377	T	0.69	-38.1694	9.5372	0.39229	0.5345:0.0:0.4655:0.0	.	966	Q9NRY4-2	.	D	966	ENSP00000385720:E966D	ENSP00000324820:E966D	E	+	3	2	ARHGAP35	52116670	0.877000	0.30153	0.994000	0.49952	0.981000	0.71138	0.101000	0.15251	0.099000	0.17552	0.655000	0.94253	GAG	-	NULL		0.468	ARHGAP35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP35	protein_coding	OTTHUMT00000466652.1	G	NM_004491	-		47424830	+1	no_errors	ENST00000404338	ensembl	human	known	74_37	missense	SNP	0.984	T
MALAT1	378938	genome.wustl.edu	37	11	65271779	65271780	+	lincRNA	INS	-	-	T	rs113635851|rs36002528		TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr11:65271779_65271780insT	ENST00000534336.1	+	0	6547_6548					NR_002819.2		Q9UHZ2	MALAT_HUMAN	metastasis associated lung adenocarcinoma transcript 1 (non-protein coding)																		CTTGTTGTAGCTTTTTTTTTTT	0.431																																																	0								ENSG00000251562																																			MALAT1			0				HGNC	AF001540		11q13.1	2013-12-11	2007-11-20		ENSG00000251562	ENSG00000251562		"""Long non-coding RNAs"", ""-"""	29665	non-coding RNA	RNA, long non-coding	"""metastasis associated in lung adenocarcinoma transcript 1"", ""non-protein coding RNA 47"", ""hepcarcin"", ""nuclear enriched abundant transcript 2"", ""nuclear paraspeckle assembly transcript 2 (non-protein coding)"", ""long intergenic non-protein coding RNA 47"""	607924				12970751, 22560368	Standard	NR_002819		Approved	PRO1073, MALAT-1, NCRNA00047, HCN, NEAT2, LINC00047, mascRNA	uc010roh.3	Q9UHZ2	OTTHUMG00000166322		11.37:g.65271790_65271790dupT		Somatic	0	24	0.00		0.5912292923157907	4	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	42	16.00		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000534336.1	37	NULL		11																																																																																			-	-		0.431	MALAT1-001	KNOWN	basic	lincRNA	MALAT1	lincRNA	OTTHUMT00000389143.1	-	NR_002819			65271780	+1	no_errors	ENST00000534336	ensembl	human	known	74_37	rna	INS	0.994:0.994	T
EIF4G3	8672	genome.wustl.edu	37	1	21307715	21307715	+	Missense_Mutation	SNP	G	G	T			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr1:21307715G>T	ENST00000264211.8	-	3	230	c.36C>A	c.(34-36)ttC>ttA	p.F12L	EIF4G3_ENST00000374927.4_Missense_Mutation_p.F12L|EIF4G3_ENST00000356916.3_Missense_Mutation_p.F23L|EIF4G3_ENST00000602326.1_Missense_Mutation_p.F19L|EIF4G3_ENST00000374937.3_Missense_Mutation_p.F19L|EIF4G3_ENST00000400422.1_Missense_Mutation_p.F12L|EIF4G3_ENST00000374935.3_Missense_Mutation_p.F12L	NM_003760.4	NP_003751.2	O43432	IF4G3_HUMAN	eukaryotic translation initiation factor 4 gamma, 3	12					cytokine-mediated signaling pathway (GO:0019221)|positive regulation of meiosis I (GO:0060903)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of translation (GO:0045727)|regulation of translational initiation (GO:0006446)|spermatogenesis (GO:0007283)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)	poly(A) RNA binding (GO:0044822)|RNA cap binding (GO:0000339)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(18)|lung(20)|ovary(1)|prostate(4)|skin(3)|stomach(1)|urinary_tract(3)	70		all_lung(284;2.61e-06)|Lung NSC(340;2.81e-06)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00149)|Ovarian(437;0.00338)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.023)|COAD - Colon adenocarcinoma(152;5.42e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000327)|GBM - Glioblastoma multiforme(114;0.000696)|Kidney(64;0.0018)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(64;0.0185)|READ - Rectum adenocarcinoma(331;0.124)|Lung(427;0.191)		GAGGCCTCTGGAAAAACTGGG	0.408																																																	0								ENSG00000075151						63.0	61.0	62.0					1																	21307715		2203	4300	6503	EIF4G3	SO:0001583	missense	0			-	HGNC	AF012072	CCDS214.1, CCDS55580.1, CCDS59192.1, CCDS72723.1	1p36.12	2008-02-05			ENSG00000075151	ENSG00000075151			3298	protein-coding gene	gene with protein product		603929				9418880	Standard	NM_001198801		Approved	eIF4GII	uc001bef.3	O43432	OTTHUMG00000002624	ENST00000264211.8:c.36C>A	1.37:g.21307715G>T	ENSP00000264211:p.Phe12Leu	Somatic	0	32	0.00		0.5912292923157907	32	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	32	10.81	B9EGQ7|Q15597|Q504Z1|Q5SWC3|Q8NEN1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MIF4G-like_typ-3,pfam_Initiation_fac_eIF4g_MI,pfam_W2_domain,superfamily_ARM-type_fold,smart_MIF4G-like_typ-3,smart_Initiation_fac_eIF4g_MI,smart_W2_domain	p.F19L	ENST00000264211.8	37	c.57	CCDS214.1	1	.	.	.	.	.	.	.	.	.	.	G	17.13	3.311323	0.60414	.	.	ENSG00000075151	ENST00000264211;ENST00000400415;ENST00000400422;ENST00000374935;ENST00000374937;ENST00000356916;ENST00000374927;ENST00000537059;ENST00000438975;ENST00000411888	T;T;T;T;T;T;T	0.20738	2.05;2.05;2.05;2.05;2.05;2.05;2.05	5.97	3.79	0.43588	.	0.106752	0.64402	D	0.000004	T	0.38108	0.1028	L	0.50333	1.59	0.58432	D	0.999996	D;D;D;D;D;D	0.71674	0.998;0.997;0.982;0.99;0.997;0.997	D;D;D;D;D;D	0.80764	0.994;0.97;0.952;0.979;0.97;0.97	T	0.14839	-1.0458	10	0.56958	D	0.05	-9.7188	12.2398	0.54536	0.2026:0.0:0.7974:0.0	.	12;208;12;138;19;12	B4DXR2;Q59GJ0;Q504Z1;B1AN89;B9EGQ7;O43432	.;.;.;.;.;IF4G3_HUMAN	L	12;209;12;12;19;138;12;23;12;50	ENSP00000264211:F12L;ENSP00000383274:F12L;ENSP00000364071:F12L;ENSP00000364073:F19L;ENSP00000364062:F12L;ENSP00000395381:F12L;ENSP00000396083:F50L	ENSP00000264211:F12L	F	-	3	2	EIF4G3	21180302	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.948000	0.40303	1.541000	0.49316	0.650000	0.86243	TTC	-	NULL		0.408	EIF4G3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	EIF4G3	protein_coding	OTTHUMT00000007467.3	G	NM_003760	-		21307715	-1	no_errors	ENST00000374937	ensembl	human	known	74_37	missense	SNP	1.000	T
FUBP1	8880	genome.wustl.edu	37	1	78429257	78429257	+	Splice_Site	SNP	G	G	T			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr1:78429257G>T	ENST00000370768.2	-	13	1265		c.e13+1		FUBP1_ENST00000370767.1_Splice_Site|FUBP1_ENST00000436586.2_Splice_Site	NM_003902.3	NP_003893.2	Q96AE4	FUBP1_HUMAN	far upstream element (FUSE) binding protein 1						positive regulation of gene expression (GO:0010628)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)			central_nervous_system(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(1)|upper_aerodigestive_tract(3)	17						AAAATACATTGCCTTTTCCTA	0.373			"""F, N"""		oligodendroglioma																																			Rec	yes		1	1p13.1	8880	far upstream element (FUSE) binding protein 1		O	0								ENSG00000162613						65.0	69.0	67.0					1																	78429257		2203	4300	6503	FUBP1	SO:0001630	splice_region_variant	0			-	HGNC	U05040	CCDS683.1	1p31.1	2008-02-05			ENSG00000162613	ENSG00000162613			4004	protein-coding gene	gene with protein product		603444		FUBP		8125259	Standard	XM_005271309		Approved	FBP	uc001dii.3	Q96AE4	OTTHUMG00000040799	ENST00000370768.2:c.1183+1C>A	1.37:g.78429257G>T		Somatic	0	27	0.00		0.5912292923157907	0	100.00	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	32	11.11	Q12828	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e14+2	ENST00000370768.2	37	c.1246+2	CCDS683.1	1	.	.	.	.	.	.	.	.	.	.	G	14.80	2.644439	0.47258	.	.	ENSG00000162613	ENST00000370773;ENST00000370767;ENST00000370768;ENST00000394922;ENST00000436586	.	.	.	5.64	1.74	0.24563	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.1991	0.31413	0.3798:0.0:0.6202:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	FUBP1	78201845	0.998000	0.40836	1.000000	0.80357	0.959000	0.62525	0.580000	0.23803	0.348000	0.23949	-0.136000	0.14681	.	-	-		0.373	FUBP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FUBP1	protein_coding	OTTHUMT00000098030.3	G	NM_003902	-	Intron	78429257	-1	no_errors	ENST00000436586	ensembl	human	known	74_37	splice_site	SNP	0.999	T
AL449083.1	0	genome.wustl.edu	37	9	75906130	75906130	+	RNA	SNP	G	G	T			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr9:75906130G>T	ENST00000408183.1	-	0	13																											gattacttttgtgccaaccta	0.353																																																	0								ENSG00000221110																																			AL449083.1			0			-	Clone_based_ensembl_gene																													9.37:g.75906130G>T		Somatic	0	40	0.00		0.5912292923157907	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000408183.1	37	NULL		9																																																																																			-	-		0.353	AL449083.1-201	KNOWN	basic	miRNA	ENSG00000221110	miRNA		G		-		75906130	-1	no_errors	ENST00000408183	ensembl	human	known	74_37	rna	SNP	0.001	T
ADAMTS16	170690	genome.wustl.edu	37	5	5303702	5303702	+	Silent	SNP	G	G	T			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr5:5303702G>T	ENST00000274181.7	+	20	3147	c.3009G>T	c.(3007-3009)ggG>ggT	p.G1003G		NM_139056.2	NP_620687.2	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 16	1003	TSP type-1 4. {ECO:0000255|PROSITE- ProRule:PRU00210}.				branching involved in ureteric bud morphogenesis (GO:0001658)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(72)|ovary(4)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	107						ACACCTGTGGGAAGGGGTGGA	0.637																																																	0								ENSG00000145536						53.0	62.0	59.0					5																	5303702		2161	4262	6423	ADAMTS16	SO:0001819	synonymous_variant	0			-	HGNC	AJ315734	CCDS43299.1	5p15	2008-07-18	2005-08-19		ENSG00000145536	ENSG00000145536		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17108	protein-coding gene	gene with protein product		607510	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 16"""			11867212	Standard	NM_139056		Approved	ADAMTS16s	uc003jdl.3	Q8TE57	OTTHUMG00000161663	ENST00000274181.7:c.3009G>T	5.37:g.5303702G>T		Somatic	0	43	0.00		0.5912292923157907	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52	C6G490|Q8IVE2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_ADAM_spacer1,pfam_Peptidase_M12B_N,pfam_Peptidase_M12B,pfam_Thrombospondin_1_rpt,pfam_PLAC,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.G1003	ENST00000274181.7	37	c.3009	CCDS43299.1	5																																																																																			-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt		0.637	ADAMTS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS16	protein_coding	OTTHUMT00000365657.1	G	NM_139056	-		5303702	+1	no_errors	ENST00000274181	ensembl	human	known	74_37	silent	SNP	0.998	T
RP11-774O3.3	0	genome.wustl.edu	37	4	8358174	8358174	+	lincRNA	SNP	C	C	A			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr4:8358174C>A	ENST00000505448.3	-	0	1891																											CTCCATCTCTCAGGAGGAAGT	0.493																																																	0								ENSG00000251615																																			RP11-774O3.3			0			-	Clone_based_vega_gene																													4.37:g.8358174C>A		Somatic	0	22	0.00		0.5912292923157907	29	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	16	15.79		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000505448.3	37	NULL		4																																																																																			-	-		0.493	RP11-774O3.3-001	KNOWN	basic	lincRNA	ENSG00000251615	lincRNA	OTTHUMT00000359029.5	C		-		8358174	-1	no_errors	ENST00000505448	ensembl	human	known	74_37	rna	SNP	0.006	A
DCHS1	8642	genome.wustl.edu	37	11	6661596	6661596	+	Missense_Mutation	SNP	G	G	T			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr11:6661596G>T	ENST00000299441.3	-	2	1660	c.1249C>A	c.(1249-1251)Caa>Aaa	p.Q417K		NM_003737.2	NP_003728.1	Q96JQ0	PCD16_HUMAN	dachsous cadherin-related 1	417	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.Q417fs*24(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(16)|liver(1)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	103		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		ACGCTGTCTTGGGTGCTTAGG	0.562																																																	1	Deletion - Frameshift(1)	ovary(1)						ENSG00000166341						53.0	48.0	50.0					11																	6661596		2201	4296	6497	DCHS1	SO:0001583	missense	0			-	HGNC	AB000895	CCDS7771.1	11p15.4	2013-10-04	2013-10-04	2004-09-03	ENSG00000166341	ENSG00000166341		"""Cadherins / Cadherin-related"""	13681	protein-coding gene	gene with protein product	"""cadherin-related family member 6"""	603057	"""protocadherin 16"", ""dachsous 1 (Drosophila)"""	CDH25, PCDH16		9199196	Standard	XM_005253207		Approved	FIB1, KIAA1773, FLJ11790, CDHR6	uc001mem.1	Q96JQ0	OTTHUMG00000133398	ENST00000299441.3:c.1249C>A	11.37:g.6661596G>T	ENSP00000299441:p.Gln417Lys	Somatic	0	70	0.00		0.5912292923157907	48	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	45	10.00	O15098	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.Q417K	ENST00000299441.3	37	c.1249	CCDS7771.1	11	.	.	.	.	.	.	.	.	.	.	G	3.812	-0.039532	0.07497	.	.	ENSG00000166341	ENST00000299441	T	0.50001	0.76	5.67	4.7	0.59300	Cadherin (4);Cadherin-like (1);	0.000000	0.43110	D	0.000602	T	0.30696	0.0773	N	0.03281	-0.365	0.41973	D	0.990761	B	0.27416	0.178	B	0.43783	0.431	T	0.20107	-1.0285	10	0.06365	T	0.9	.	11.6327	0.51185	0.0:0.0:0.6851:0.3149	.	417	Q96JQ0	PCD16_HUMAN	K	417	ENSP00000299441:Q417K	ENSP00000299441:Q417K	Q	-	1	0	DCHS1	6618172	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	5.667000	0.68067	2.661000	0.90470	0.637000	0.83480	CAA	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.562	DCHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCHS1	protein_coding	OTTHUMT00000257258.1	G	NM_003737	-		6661596	-1	no_errors	ENST00000299441	ensembl	human	known	74_37	missense	SNP	1.000	T
EXOC1	55763	genome.wustl.edu	37	4	56736871	56736871	+	Nonsense_Mutation	SNP	G	G	T			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr4:56736871G>T	ENST00000381295.2	+	6	979	c.631G>T	c.(631-633)Gaa>Taa	p.E211*	EXOC1_ENST00000349598.6_Nonsense_Mutation_p.E211*|EXOC1_ENST00000346134.7_Nonsense_Mutation_p.E211*	NM_001024924.1	NP_001020095.1	Q9NV70	EXOC1_HUMAN	exocyst complex component 1	211					cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|membrane organization (GO:0061024)|protein transport (GO:0015031)	exocyst (GO:0000145)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	35	Glioma(25;0.08)|all_neural(26;0.101)					CATGGCATCTGAAAAACAAGT	0.348																																																	0								ENSG00000090989						82.0	81.0	81.0					4																	56736871		2203	4300	6503	EXOC1	SO:0001587	stop_gained	0			-	HGNC	AK027047	CCDS3502.1, CCDS3503.1	4q12	2013-01-22	2005-11-01	2005-11-01	ENSG00000090989	ENSG00000090989			30380	protein-coding gene	gene with protein product		607879	"""SEC3-like 1 (S. cerevisiae)"""	SEC3L1		11042152, 11406615	Standard	XM_005265747		Approved	SEC3, FLJ10893, BM-102, Sec3p	uc003hbf.1	Q9NV70	OTTHUMG00000102165	ENST00000381295.2:c.631G>T	4.37:g.56736871G>T	ENSP00000370695:p.Glu211*	Somatic	0	40	0.00		0.5912292923157907	70	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	25	10.71	Q504V4|Q8WUE7|Q96T15|Q9NZE4	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Exocyst_Exoc1/SEC3	p.E211*	ENST00000381295.2	37	c.631	CCDS3502.1	4	.	.	.	.	.	.	.	.	.	.	G	41	8.762517	0.98943	.	.	ENSG00000090989	ENST00000381295;ENST00000346134;ENST00000349598	.	.	.	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	.	20.4008	0.98991	0.0:0.0:1.0:0.0	.	.	.	.	X	211	.	ENSP00000326514:E211X	E	+	1	0	EXOC1	56431628	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.476000	0.97823	2.826000	0.97356	0.655000	0.94253	GAA	-	pfam_Exocyst_Exoc1/SEC3		0.348	EXOC1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	EXOC1	protein_coding	OTTHUMT00000361799.1	G	NM_018261	-		56736871	+1	no_errors	ENST00000346134	ensembl	human	known	74_37	nonsense	SNP	1.000	T
MURC	347273	genome.wustl.edu	37	9	103340465	103340465	+	Missense_Mutation	SNP	C	C	A			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr9:103340465C>A	ENST00000307584.5	+	1	105	c.40C>A	c.(40-42)Cac>Aac	p.H14N	RN7SKP87_ENST00000364096.1_RNA	NM_001018116.1	NP_001018126.1	Q5BKX8	MURC_HUMAN	muscle-related coiled-coil protein	14					cell differentiation (GO:0030154)|muscle organ development (GO:0007517)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	Z disc (GO:0030018)				endometrium(1)|kidney(1)|large_intestine(6)|lung(7)|ovary(1)	16		Acute lymphoblastic leukemia(62;0.0461)				TGATAAAATCCACCAGAATCG	0.433																																																	0								ENSG00000170681						106.0	98.0	101.0					9																	103340465		2203	4300	6503	MURC	SO:0001583	missense	0			-	HGNC	BC090888	CCDS35083.1	9q31.1	2014-09-17			ENSG00000170681	ENSG00000170681			33742	protein-coding gene	gene with protein product	"""muscle-restricted coiled-coil protein"""					18508909, 18332105	Standard	NM_001018116		Approved	cavin-4, CAVIN4	uc004bba.3	Q5BKX8	OTTHUMG00000020368	ENST00000307584.5:c.40C>A	9.37:g.103340465C>A	ENSP00000418668:p.His14Asn	Somatic	0	29	0.00		0.5912292923157907	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	35	10.26	B1PRL3|B4DT88	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.H14N	ENST00000307584.5	37	c.40	CCDS35083.1	9	.	.	.	.	.	.	.	.	.	.	C	8.984	0.975984	0.18736	.	.	ENSG00000170681	ENST00000307584	T	0.64438	-0.1	5.39	4.5	0.54988	.	0.496290	0.20888	N	0.083871	T	0.38161	0.1030	N	0.19112	0.55	0.29341	N	0.865995	B	0.16396	0.017	B	0.12156	0.007	T	0.32798	-0.9893	10	0.02654	T	1	-6.9808	6.791	0.23699	0.1752:0.7359:0.0:0.0889	.	14	Q5BKX8	MURC_HUMAN	N	14	ENSP00000418668:H14N	ENSP00000418668:H14N	H	+	1	0	MURC	102380286	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	3.229000	0.51278	1.282000	0.44496	0.655000	0.94253	CAC	-	NULL		0.433	MURC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MURC	protein_coding	OTTHUMT00000053419.2	C	NM_001018116	-		103340465	+1	no_errors	ENST00000307584	ensembl	human	known	74_37	missense	SNP	1.000	A
TRIP12	9320	genome.wustl.edu	37	2	230679988	230679988	+	Splice_Site	SNP	C	C	A			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr2:230679988C>A	ENST00000283943.5	-	9	1670		c.e9+1		TRIP12_ENST00000543084.1_Intron|TRIP12_ENST00000389044.4_Splice_Site|TRIP12_ENST00000389045.3_Splice_Site	NM_001284214.1|NM_004238.1	NP_001271143.1|NP_004229.1	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12						cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|embryo development (GO:0009790)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligase activity (GO:0016874)|thyroid hormone receptor binding (GO:0046966)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(19)|lung(32)|ovary(5)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)		TATATACTTACAATATCAAAA	0.279																																																	0								ENSG00000153827						30.0	31.0	31.0					2																	230679988		2176	4290	6466	TRIP12	SO:0001630	splice_region_variant	0			-	HGNC	L40383	CCDS33391.1, CCDS63145.1, CCDS63146.1	2q36.3	2008-05-27			ENSG00000153827	ENSG00000153827			12306	protein-coding gene	gene with protein product		604506				7776974	Standard	XM_005246961		Approved	KIAA0045	uc002vpw.1	Q14669	OTTHUMG00000153623	ENST00000283943.5:c.1491+1G>T	2.37:g.230679988C>A		Somatic	0	35	0.00		0.5912292923157907	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	57	8.06	D4HL82|Q14CA3|Q14CF1|Q15644|Q53R87|Q53TE7	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e8+1	ENST00000283943.5	37	c.1491+1	CCDS33391.1	2	.	.	.	.	.	.	.	.	.	.	C	23.9	4.470200	0.84533	.	.	ENSG00000153827	ENST00000283943;ENST00000389045;ENST00000389044	.	.	.	5.66	5.66	0.87406	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.8049	0.96527	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TRIP12	230388232	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	7.364000	0.79526	2.672000	0.90937	0.558000	0.71614	.	-	-		0.279	TRIP12-001	KNOWN	basic|CCDS	protein_coding	TRIP12	protein_coding	OTTHUMT00000331861.3	C	NM_004238	-	Intron	230679988	-1	no_errors	ENST00000283943	ensembl	human	known	74_37	splice_site	SNP	1.000	A
ZNF890P	645700	genome.wustl.edu	37	7	5161321	5161321	+	RNA	SNP	G	G	C			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr7:5161321G>C	ENST00000422060.2	-	0	1233					NR_034163.1				zinc finger protein 890, pseudogene																		CTGTTTGTCAGGGCAAAGCTT	0.572																																																	0								ENSG00000159904																																			ZNF890P			0			-	HGNC			7p22.1	2011-05-24			ENSG00000159904	ENSG00000159904			38691	pseudogene	pseudogene							Standard	NR_034163		Approved		uc003snu.1		OTTHUMG00000166790		7.37:g.5161321G>C		Somatic	0	92	0.00		0.5912292923157907	16	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	44	152	22.45		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000422060.2	37	NULL		7																																																																																			-	-		0.572	ZNF890P-002	KNOWN	basic	processed_transcript	ZNF890P	pseudogene	OTTHUMT00000391474.1	G	NR_034163	-		5161321	-1	no_errors	ENST00000422060	ensembl	human	known	74_37	rna	SNP	0.001	C
RP11-1396O13.13	0	genome.wustl.edu	37	4	9385981	9385981	+	Silent	SNP	A	A	T			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr4:9385981A>T	ENST00000508324.1	-	5	662	c.663T>A	c.(661-663)acT>acA	p.T221T																	breast(2)|lung(7)	9						GTCCCGTGTGAGTTTTCTCAT	0.428																																																	0								ENSG00000219492																																			RP11-1396O13.13	SO:0001819	synonymous_variant	0			-	Clone_based_vega_gene																												ENST00000508324.1:c.663T>A	4.37:g.9385981A>T		Somatic	0	283	0.00		0.5912292923157907	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	54	207	20.69		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.T221	ENST00000508324.1	37	c.663		4																																																																																			-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.428	RP11-1396O13.13-001	NOVEL	not_best_in_genome_evidence|basic|appris_principal	protein_coding	ENSG00000219492	protein_coding	OTTHUMT00000359605.2	A		-		9385981	-1	no_errors	ENST00000508324	ensembl	human	novel	74_37	silent	SNP	0.656	T
KRT6C	286887	genome.wustl.edu	37	12	52865298	52865298	+	Silent	SNP	A	A	G	rs201562541	byFrequency	TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr12:52865298A>G	ENST00000252250.6	-	4	866	c.819T>C	c.(817-819)gaT>gaC	p.D273D		NM_173086.4	NP_775109.2	P48668	K2C6C_HUMAN	keratin 6C	273	Coil 1B.|Rod.				intermediate filament cytoskeleton organization (GO:0045104)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(6)|ovary(3)|prostate(2)|skin(2)	23				BRCA - Breast invasive adenocarcinoma(357;0.0828)		CAGCATCCACATCCTGGGGAA	0.507																																																	0								ENSG00000170465						48.0	48.0	48.0					12																	52865298		2203	4297	6500	KRT6C	SO:0001819	synonymous_variant	0			-	HGNC	L42611	CCDS8829.1	12q13.13	2013-01-16	2006-07-17	2006-07-17	ENSG00000170465	ENSG00000170465		"""-"", ""Intermediate filaments type II, keratins (basic)"""	20406	protein-coding gene	gene with protein product		612315	"""keratin 6E"""	KRT6E		7543104, 16831889	Standard	NM_173086		Approved		uc001sal.4	P48668	OTTHUMG00000169596	ENST00000252250.6:c.819T>C	12.37:g.52865298A>G		Somatic	0	50	0.00		0.5912292923157907	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	111	9.02	A1L4L5|P48666|Q2TAZ9|Q7RTN9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_IF,superfamily_Prefoldin,prints_Keratin_II	p.D273	ENST00000252250.6	37	c.819	CCDS8829.1	12																																																																																			-	pfam_IF		0.507	KRT6C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT6C	protein_coding	OTTHUMT00000404976.1	A	NM_173086	rs201562541		52865298	-1	no_errors	ENST00000252250	ensembl	human	known	74_37	silent	SNP	0.998	G
GALNT14	79623	genome.wustl.edu	37	2	31168687	31168687	+	Missense_Mutation	SNP	G	G	A	rs370991103		TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr2:31168687G>A	ENST00000349752.5	-	7	1343	c.704C>T	c.(703-705)aCc>aTc	p.T235I	GALNT14_ENST00000356174.3_Missense_Mutation_p.T202I|GALNT14_ENST00000324589.5_Missense_Mutation_p.T240I|GALNT14_ENST00000406653.1_Missense_Mutation_p.T215I|GALNT14_ENST00000420311.2_Missense_Mutation_p.T200I|GALNT14_ENST00000486564.1_5'UTR	NM_024572.3	NP_078848.2	Q96FL9	GLT14_HUMAN	polypeptide N-acetylgalactosaminyltransferase 14	235					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			cervix(1)|endometrium(3)|large_intestine(10)|liver(1)|lung(21)|ovary(1)|skin(3)|upper_aerodigestive_tract(3)	43	Acute lymphoblastic leukemia(172;0.155)					GTAGGTGAAGGTGTCCAGGTT	0.532																																																	0								ENSG00000158089	G	ILE/THR	0,4406		0,0,2203	106.0	84.0	91.0		704	1.7	1.0	2		91	2,8598	2.2+/-6.3	0,2,4298	no	missense	GALNT14	NM_024572.2	89	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	possibly-damaging	235/553	31168687	2,13004	2203	4300	6503	GALNT14	SO:0001583	missense	0			-	HGNC	AB078144	CCDS1773.2, CCDS58705.1, CCDS58706.1	2p23.2	2014-03-13	2014-03-13		ENSG00000158089	ENSG00000158089	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	22946	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 14"""	608225	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 14 (GalNAc-T14)"""			12507512	Standard	NM_024572		Approved	GalNac-T10, FLJ12691, GalNac-T14	uc002rns.3	Q96FL9	OTTHUMG00000074077	ENST00000349752.5:c.704C>T	2.37:g.31168687G>A	ENSP00000288988:p.Thr235Ile	Somatic	0	42	0.00		0.5912292923157907	51	35.44	28	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	56	34.12	B3KV89|Q4ZG75|Q53SU1|Q53TJ0|Q8IVI4|Q9BRH1|Q9H827|Q9H9J8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.T235I	ENST00000349752.5	37	c.704	CCDS1773.2	2	.	.	.	.	.	.	.	.	.	.	G	21.9	4.215495	0.79352	0.0	2.33E-4	ENSG00000158089	ENST00000349752;ENST00000324589;ENST00000406653;ENST00000356174;ENST00000420311;ENST00000430167	T;T;T;T;T;T	0.60171	0.21;0.21;0.21;0.21;0.21;0.21	4.85	1.73	0.24493	Glycosyl transferase, family 2 (1);	0.105465	0.64402	D	0.000005	T	0.80644	0.4662	H	0.95712	3.71	0.53688	D	0.999976	P;D;D;P;D	0.64830	0.917;0.966;0.994;0.921;0.991	P;P;D;D;D	0.67725	0.697;0.836;0.928;0.912;0.953	D	0.84536	0.0636	10	0.87932	D	0	.	13.4737	0.61295	0.0:0.0:0.5342:0.4658	.	200;202;240;235;215	F5H263;Q96FL9-2;Q96FL9-3;Q96FL9;B3KV89	.;.;.;GLT14_HUMAN;.	I	235;240;215;202;200;202	ENSP00000288988:T235I;ENSP00000314500:T240I;ENSP00000385435:T215I;ENSP00000348497:T202I;ENSP00000415514:T200I;ENSP00000406399:T202I	ENSP00000314500:T240I	T	-	2	0	GALNT14	31022191	0.960000	0.32886	0.994000	0.49952	0.964000	0.63967	1.001000	0.29783	0.086000	0.17137	0.455000	0.32223	ACC	-	pfam_Glyco_trans_2		0.532	GALNT14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNT14	protein_coding	OTTHUMT00000157264.1	G	NM_024572	-		31168687	-1	no_errors	ENST00000349752	ensembl	human	known	74_37	missense	SNP	0.998	A
ZDBF2	57683	genome.wustl.edu	37	2	207173469	207173469	+	Missense_Mutation	SNP	G	G	T			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr2:207173469G>T	ENST00000374423.3	+	5	4603	c.4217G>T	c.(4216-4218)gGt>gTt	p.G1406V		NM_020923.1	NP_065974.1	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	1406							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(5)|large_intestine(28)|lung(50)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	95						TATAAATTAGGTGATTTTGAT	0.348																																																	0								ENSG00000204186						55.0	53.0	54.0					2																	207173469		1828	4083	5911	ZDBF2	SO:0001583	missense	0			-	HGNC	AB046791	CCDS46501.1, CCDS74637.1	2q33.3	2013-01-10			ENSG00000204186	ENSG00000204186		"""Zinc fingers, DBF-type"""	29313	protein-coding gene	gene with protein product						10997877	Standard	XM_005246711		Approved	FLJ45338, KIAA1571	uc002vbp.2	Q9HCK1	OTTHUMG00000154648	ENST00000374423.3:c.4217G>T	2.37:g.207173469G>T	ENSP00000363545:p.Gly1406Val	Somatic	0	39	0.00		0.5912292923157907	25	19.35	6	WXS	Illumina HiSeq 2500	Phase_IV	tier1	39	115	25.16	Q6ZNP7|Q6ZSN8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_DBF,smart_Znf_DBF	p.G1406V	ENST00000374423.3	37	c.4217	CCDS46501.1	2	.	.	.	.	.	.	.	.	.	.	G	12.47	1.947191	0.34377	.	.	ENSG00000204186	ENST00000374423	T	0.40225	1.04	3.76	1.78	0.24846	.	.	.	.	.	T	0.27278	0.0669	L	0.34521	1.04	0.39928	D	0.97425	B	0.21225	0.053	B	0.23574	0.047	T	0.06643	-1.0815	9	0.25751	T	0.34	.	5.3549	0.16055	0.0:0.1753:0.5218:0.3029	.	1406	Q9HCK1	ZDBF2_HUMAN	V	1406	ENSP00000363545:G1406V	ENSP00000363545:G1406V	G	+	2	0	ZDBF2	206881714	0.587000	0.26791	0.956000	0.39512	0.826000	0.46750	0.527000	0.22987	0.468000	0.27243	0.650000	0.86243	GGT	-	NULL		0.348	ZDBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZDBF2	protein_coding	OTTHUMT00000336458.1	G	NM_020923	-		207173469	+1	no_errors	ENST00000374423	ensembl	human	known	74_37	missense	SNP	0.975	T
BSND	7809	genome.wustl.edu	37	1	55464975	55464975	+	Missense_Mutation	SNP	C	C	T			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr1:55464975C>T	ENST00000371265.4	+	1	370	c.116C>T	c.(115-117)gCc>gTc	p.A39V		NM_057176.2	NP_476517.1	Q8WZ55	BSND_HUMAN	barttin CLCNK-type chloride channel accessory beta subunit	39					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	chloride channel activity (GO:0005254)|chloride channel regulator activity (GO:0017081)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	17						ACCTTCTATGCCATGGGCAGC	0.617																																					Ovarian(191;1657 2078 22894 42033 48899)												0								ENSG00000162399						92.0	80.0	84.0					1																	55464975		2203	4300	6503	BSND	SO:0001583	missense	0			-	HGNC	AY034632	CCDS602.1	1p32.3	2014-06-17	2014-06-17		ENSG00000162399	ENSG00000162399			16512	protein-coding gene	gene with protein product		606412	"""deafness, autosomal recessive 73"", ""Bartter syndrome, infantile, with sensorineural deafness (Barttin)"""	DFNB73		11687798, 11734858, 19646679	Standard	NM_057176		Approved	BART	uc001cye.3	Q8WZ55	OTTHUMG00000008112	ENST00000371265.4:c.116C>T	1.37:g.55464975C>T	ENSP00000360312:p.Ala39Val	Somatic	0	69	0.00		0.5912292923157907	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	40	9.09	Q6NT28	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.A39V	ENST00000371265.4	37	c.116	CCDS602.1	1	.	.	.	.	.	.	.	.	.	.	C	13.45	2.241629	0.39598	.	.	ENSG00000162399	ENST00000371265	T	0.66995	-0.24	4.44	3.51	0.40186	.	0.122641	0.35291	N	0.003307	T	0.63593	0.2524	M	0.70595	2.14	0.37606	D	0.920744	P	0.46142	0.873	B	0.40101	0.319	T	0.72004	-0.4421	10	0.40728	T	0.16	-20.737	12.9175	0.58214	0.0:0.9139:0.0:0.0861	.	39	Q8WZ55	BSND_HUMAN	V	39	ENSP00000360312:A39V	ENSP00000360312:A39V	A	+	2	0	BSND	55237563	0.997000	0.39634	1.000000	0.80357	0.611000	0.37282	1.948000	0.40303	2.194000	0.70268	0.478000	0.44815	GCC	-	NULL		0.617	BSND-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BSND	protein_coding	OTTHUMT00000022213.4	C	NM_057176	-		55464975	+1	no_errors	ENST00000371265	ensembl	human	known	74_37	missense	SNP	1.000	T
DGKI	9162	genome.wustl.edu	37	7	137080395	137080395	+	Silent	SNP	C	C	A			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr7:137080395C>A	ENST00000288490.5	-	33	3030	c.3030G>T	c.(3028-3030)gtG>gtT	p.V1010V	DGKI_ENST00000446122.1_Silent_p.V992V|DGKI_ENST00000424189.2_Silent_p.V1023V|DGKI_ENST00000494390.1_5'UTR|DGKI_ENST00000453654.2_Silent_p.V679V	NM_004717.2	NP_004708.1	O75912	DGKI_HUMAN	diacylglycerol kinase, iota	1010					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|positive regulation of Ras protein signal transduction (GO:0046579)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of Rap GTPase activity (GO:0032317)	cytoplasm (GO:0005737)|guanyl-nucleotide exchange factor complex (GO:0032045)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|GTPase inhibitor activity (GO:0005095)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(46)|ovary(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	84						GAAGCTGGCACACAGCCCGGT	0.562																																																	0								ENSG00000157680						79.0	68.0	72.0					7																	137080395		2203	4300	6503	DGKI	SO:0001819	synonymous_variant	0			-	HGNC	AF061936	CCDS5845.1	7q32.3-q33	2013-01-10			ENSG00000157680	ENSG00000157680		"""Ankyrin repeat domain containing"""	2855	protein-coding gene	gene with protein product		604072				9830018	Standard	NM_004717		Approved	DGK-IOTA	uc003vtt.3	O75912	OTTHUMG00000155697	ENST00000288490.5:c.3030G>T	7.37:g.137080395C>A		Somatic	0	60	0.00		0.5912292923157907	8	33.33	4	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	73	28.43	A4D1Q9|Q9NZ49	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Diacylglycerol_kin_accessory,pfam_Diacylglycerol_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kin_accessory,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.V1010	ENST00000288490.5	37	c.3030	CCDS5845.1	7																																																																																			-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom		0.562	DGKI-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DGKI	protein_coding	OTTHUMT00000341286.3	C	NM_004717	-		137080395	-1	no_errors	ENST00000288490	ensembl	human	known	74_37	silent	SNP	1.000	A
NRK	203447	genome.wustl.edu	37	X	105153297	105153297	+	Missense_Mutation	SNP	C	C	T			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chrX:105153297C>T	ENST00000243300.9	+	13	1967	c.1664C>T	c.(1663-1665)gCa>gTa	p.A555V	NRK_ENST00000428173.2_Missense_Mutation_p.A556V	NM_198465.2	NP_940867.2	Q7Z2Y5	NRK_HUMAN	Nik related kinase	555	Gln-rich.				activation of JNKK activity (GO:0007256)|negative regulation of cell proliferation (GO:0008285)|parturition (GO:0007567)|regulation of spongiotrophoblast cell proliferation (GO:0060721)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(8)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(14)|lung(36)|ovary(3)|prostate(1)|skin(2)	76						CAGAACCAGGCACCTGAACAG	0.562										HNSCC(51;0.14)																																							0								ENSG00000123572						38.0	39.0	39.0					X																	105153297		2019	4161	6180	NRK	SO:0001583	missense	0			-	HGNC	BX538345	CCDS65305.1	Xq22.3	2008-02-05			ENSG00000123572	ENSG00000123572			25391	protein-coding gene	gene with protein product		300791					Standard	NM_198465		Approved	DKFZp686A17109	uc004emd.3	Q7Z2Y5	OTTHUMG00000022143	ENST00000243300.9:c.1664C>T	X.37:g.105153297C>T	ENSP00000434830:p.Ala555Val	Somatic	0	19	0.00		0.5912292923157907	66	1.49	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	26	50.00	Q32ND6|Q5H9K2|Q6ZMP2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Citron,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Citron,pfscan_Prot_kinase_dom	p.A556V	ENST00000243300.9	37	c.1667		X	.	.	.	.	.	.	.	.	.	.	C	0.001	-3.286823	0.00020	.	.	ENSG00000123572	ENST00000243300;ENST00000428173	T;T	0.23552	1.9;1.9	4.38	-5.72	0.02406	.	0.966392	0.08488	N	0.938442	T	0.07863	0.0197	N	0.04090	-0.28	0.09310	N	0.999993	B;B	0.06786	0.001;0.0	B;B	0.09377	0.004;0.001	T	0.23119	-1.0197	10	0.30854	T	0.27	.	0.1017	0.00049	0.2971:0.2501:0.188:0.2648	.	223;555	Q7Z2Y5-2;Q7Z2Y5	.;NRK_HUMAN	V	555;556	ENSP00000434830:A555V;ENSP00000438378:A556V	ENSP00000434830:A555V	A	+	2	0	NRK	105039953	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.905000	0.00702	-2.086000	0.00863	-2.635000	0.00153	GCA	-	NULL		0.562	NRK-001	KNOWN	non_canonical_conserved|basic|appris_candidate	protein_coding	NRK	protein_coding	OTTHUMT00000106480.6	C	NM_198465	-		105153297	+1	no_errors	ENST00000428173	ensembl	human	known	74_37	missense	SNP	0.000	T
CASC3	22794	genome.wustl.edu	37	17	38324174	38324174	+	Nonsense_Mutation	SNP	C	C	T			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr17:38324174C>T	ENST00000264645.7	+	10	1949	c.1723C>T	c.(1723-1725)Cag>Tag	p.Q575*		NM_007359.4	NP_031385.2	O15234	CASC3_HUMAN	cancer susceptibility candidate 3	575	Necessary for localization in cytoplasmic stress granules.				gene expression (GO:0010467)|intracellular mRNA localization (GO:0008298)|mRNA metabolic process (GO:0016071)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of translation (GO:0006417)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)	cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|ribonucleoprotein complex (GO:0030529)	enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|ubiquitin protein ligase binding (GO:0031625)			endometrium(4)|kidney(2)|large_intestine(3)|lung(4)|ovary(1)|urinary_tract(2)	16						CATGCTTGTGCAGCCAGGAAT	0.517																																																	0								ENSG00000108349						145.0	125.0	132.0					17																	38324174		2203	4300	6503	CASC3	SO:0001587	stop_gained	0			-	HGNC	X80199	CCDS11362.1	17q21.1	2012-09-20			ENSG00000108349	ENSG00000108349			17040	protein-coding gene	gene with protein product		606504				7490069, 18332872	Standard	NM_007359		Approved	MLN51, BTZ	uc002hue.3	O15234	OTTHUMG00000133323	ENST00000264645.7:c.1723C>T	17.37:g.38324174C>T	ENSP00000264645:p.Gln575*	Somatic	0	79	0.00		0.5912292923157907	127	14.19	21	WXS	Illumina HiSeq 2500	Phase_IV	tier1	62	49	55.86	A8K8R0	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Btz_dom	p.Q575*	ENST00000264645.7	37	c.1723	CCDS11362.1	17	.	.	.	.	.	.	.	.	.	.	C	41	8.712659	0.98925	.	.	ENSG00000108349	ENST00000264645;ENST00000418132;ENST00000394114	.	.	.	5.09	5.09	0.68999	.	0.186120	0.48286	D	0.000190	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	-13.0313	18.2998	0.90160	0.0:1.0:0.0:0.0	.	.	.	.	X	575	.	ENSP00000264645:Q575X	Q	+	1	0	CASC3	35577700	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.059000	0.76684	2.651000	0.90000	0.563000	0.77884	CAG	-	NULL		0.517	CASC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CASC3	protein_coding	OTTHUMT00000257127.3	C	NM_007359	-		38324174	+1	no_errors	ENST00000264645	ensembl	human	known	74_37	nonsense	SNP	1.000	T
SIK3	23387	genome.wustl.edu	37	11	116729350	116729350	+	Missense_Mutation	SNP	G	G	A			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr11:116729350G>A	ENST00000292055.4	-	20	2548	c.2513C>T	c.(2512-2514)tCg>tTg	p.S838L	AP006216.12_ENST00000444200.1_RNA|SIK3_ENST00000488337.1_Intron|SIK3_ENST00000375288.1_Intron|SIK3_ENST00000542607.1_Intron|SIK3_ENST00000446921.2_Intron|SIK3_ENST00000434315.2_Intron|SIK3_ENST00000375300.1_Missense_Mutation_p.S896L	NM_025164.3	NP_079440.3	Q9Y2K2	SIK3_HUMAN	SIK family kinase 3	838	Gln-rich.				protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(18)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	57						GGACTGGTCCGAAAACAGATG	0.557																																																	0								ENSG00000160584						74.0	78.0	76.0					11																	116729350		2201	4296	6497	SIK3	SO:0001583	missense	0			-	HGNC	AB023216	CCDS8379.1, CCDS60974.1, CCDS8379.2	11q23.3	2010-02-17			ENSG00000160584	ENSG00000160584			29165	protein-coding gene	gene with protein product		614776				10231032, 8889548	Standard	NM_025164		Approved	FLJ12240, L19, KIAA0999, QSK	uc001ppy.3	Q9Y2K2	OTTHUMG00000066628	ENST00000292055.4:c.2513C>T	11.37:g.116729350G>A	ENSP00000292055:p.Ser838Leu	Somatic	0	54	0.00		0.5912292923157907	14	26.32	5	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	20	41.18	A1A5A8|Q59FY2|Q5M9N1|Q6P3R6|Q8IYM8|Q9HA50	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Prot_kinase_dom	p.S896L	ENST00000292055.4	37	c.2687	CCDS8379.1	11	.	.	.	.	.	.	.	.	.	.	G	17.37	3.373041	0.61624	.	.	ENSG00000160584	ENST00000375300;ENST00000292055	T;T	0.73789	-0.75;-0.78	5.67	4.72	0.59763	.	0.439086	0.16781	N	0.199764	T	0.57475	0.2056	N	0.24115	0.695	0.80722	D	1	P;P	0.49635	0.926;0.878	B;B	0.33960	0.173;0.084	T	0.61178	-0.7115	10	0.51188	T	0.08	.	13.6458	0.62281	0.0787:0.0:0.9213:0.0	.	838;838	Q9Y2K2-3;Q9Y2K2	.;SIK3_HUMAN	L	896;838	ENSP00000364449:S896L;ENSP00000292055:S838L	ENSP00000292055:S838L	S	-	2	0	SIK3	116234560	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.581000	0.74045	1.289000	0.44618	-0.345000	0.07892	TCG	-	NULL		0.557	SIK3-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	SIK3	protein_coding		G	NM_025164	-		116729350	-1	no_errors	ENST00000375300	ensembl	human	known	74_37	missense	SNP	1.000	A
DAXX	1616	genome.wustl.edu	37	6	33289082	33289082	+	Missense_Mutation	SNP	C	C	A			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr6:33289082C>A	ENST00000374542.5	-	3	674	c.470G>T	c.(469-471)gGg>gTg	p.G157V	DAXX_ENST00000477162.1_Intron|DAXX_ENST00000414083.2_Missense_Mutation_p.G82V|DAXX_ENST00000266000.6_Missense_Mutation_p.G157V	NM_001141969.1|NM_001141970.1|NM_001350.4	NP_001135441.1|NP_001135442.1|NP_001341.1	Q9UER7	DAXX_HUMAN	death-domain associated protein	157	Necessary for interaction with USP7 and ATRX.				activation of JUN kinase activity (GO:0007257)|androgen receptor signaling pathway (GO:0030521)|apoptotic process (GO:0006915)|chromatin remodeling (GO:0006338)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|mitotic cytokinesis (GO:0000281)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of neuron death (GO:1901216)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein phosphorylation (GO:0001934)|regulation of protein ubiquitination (GO:0031396)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|PML body (GO:0016605)|SWI/SNF superfamily-type complex (GO:0070603)	androgen receptor binding (GO:0050681)|enzyme binding (GO:0019899)|heat shock protein binding (GO:0031072)|histone binding (GO:0042393)|p53 binding (GO:0002039)|protein homodimerization activity (GO:0042803)|protein kinase activator activity (GO:0030295)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|receptor signaling protein activity (GO:0005057)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(2)|lung(7)|ovary(3)|pancreas(18)|prostate(3)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	55						AGGGTTATTCCCAGAGGGCTC	0.562			"""Mis, F, N"""		Pancreatic neuroendocrine tumors. Paediatric GBM																																			Rec	yes		6	6p21.3	1616	death-domain associated protein		E	0								ENSG00000204209						82.0	85.0	84.0					6																	33289082		2203	4300	6503	DAXX	SO:0001583	missense	0			-	HGNC	AF006041	CCDS4776.1, CCDS59008.1	6p21.3	2008-08-29	2008-08-29			ENSG00000204209			2681	protein-coding gene	gene with protein product		603186	"""death-associated protein 6"""			9407001, 9215629	Standard	NM_001141970		Approved	DAP6	uc011dre.2	Q9UER7		ENST00000374542.5:c.470G>T	6.37:g.33289082C>A	ENSP00000363668:p.Gly157Val	Somatic	0	52	0.00		0.5912292923157907	73	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	31	11.43	B4E1I3|F5H082|O14747|O15141|O15208|Q5STK9|Q9BWI3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Daxx	p.G157V	ENST00000374542.5	37	c.470	CCDS4776.1	6	.	.	.	.	.	.	.	.	.	.	C	12.80	2.046186	0.36085	.	.	ENSG00000204209	ENST00000266000;ENST00000374542;ENST00000414083;ENST00000446403	.	.	.	5.25	1.51	0.23008	.	0.530450	0.21001	N	0.081876	T	0.53481	0.1799	L	0.58669	1.825	0.46131	D	0.998887	P;D;D	0.64830	0.946;0.994;0.994	P;D;D	0.67900	0.745;0.954;0.954	T	0.52275	-0.8597	9	0.40728	T	0.16	-13.2289	7.1098	0.25384	0.0:0.6371:0.0:0.3629	.	169;157;157	B4E1C1;B2R7M0;Q9UER7	.;.;DAXX_HUMAN	V	157;157;82;157	.	ENSP00000266000:G157V	G	-	2	0	DAXX	33397060	0.086000	0.21541	0.187000	0.23214	0.977000	0.68977	0.516000	0.22817	0.091000	0.17302	-0.163000	0.13421	GGG	-	pfam_Daxx		0.562	DAXX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DAXX	protein_coding	OTTHUMT00000076403.1	C		-		33289082	-1	no_errors	ENST00000266000	ensembl	human	known	74_37	missense	SNP	0.135	A
ARID1A	8289	genome.wustl.edu	37	1	27106528	27106528	+	Missense_Mutation	SNP	G	G	A			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr1:27106528G>A	ENST00000324856.7	+	20	6510	c.6139G>A	c.(6139-6141)Gag>Aag	p.E2047K	ARID1A_ENST00000457599.2_Missense_Mutation_p.E1830K|ARID1A_ENST00000540690.1_Missense_Mutation_p.E375K|ARID1A_ENST00000374152.2_Missense_Mutation_p.E1664K	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	2047					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)	p.E2047*(3)	ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		CAACAAAGTGGAGTGGTGGTG	0.552			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																			Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	3	Substitution - Nonsense(3)	endometrium(2)|ovary(1)						ENSG00000117713						153.0	152.0	152.0					1																	27106528		2203	4300	6503	ARID1A	SO:0001583	missense	0			-	HGNC	AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.6139G>A	1.37:g.27106528G>A	ENSP00000320485:p.Glu2047Lys	Somatic	0	53	0.00		0.5912292923157907	126	45.92	107	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	31	39.22	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF3518,pfam_ARID/BRIGHT_DNA-bd,superfamily_ARID/BRIGHT_DNA-bd,superfamily_ARM-type_fold,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	p.E2047K	ENST00000324856.7	37	c.6139	CCDS285.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.4|21.4	4.147329|4.147329	0.77888|0.77888	.|.	.|.	ENSG00000117713|ENSG00000117713	ENST00000324856;ENST00000457599;ENST00000374152;ENST00000540690|ENST00000430799	T;T;T;T|.	0.37584|.	1.19;1.19;1.19;1.19|.	5.0|5.0	4.08|4.08	0.47627|0.47627	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.75140|0.75140	0.3809|0.3809	M|M	0.79475|0.79475	2.455|2.455	0.54753|0.54753	D|D	0.999986|0.999986	D;D;D|.	0.61697|.	0.986;0.99;0.972|.	P;P;P|.	0.60173|.	0.737;0.87;0.737|.	T|T	0.77466|0.77466	-0.2577|-0.2577	10|5	0.54805|.	T|.	0.06|.	-13.4302|-13.4302	15.2799|15.2799	0.73773|0.73773	0.0:0.0:0.8588:0.1412|0.0:0.0:0.8588:0.1412	.|.	1664;2047;1830|.	O14497-3;O14497;O14497-2|.	.;ARI1A_HUMAN;.|.	K|E	2047;1830;1664;375|943	ENSP00000320485:E2047K;ENSP00000387636:E1830K;ENSP00000363267:E1664K;ENSP00000442437:E375K|.	ENSP00000320485:E2047K|.	E|G	+|+	1|2	0|0	ARID1A|ARID1A	26979115|26979115	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	9.020000|9.020000	0.93667|0.93667	1.460000|1.460000	0.47911|0.47911	0.591000|0.591000	0.81541|0.81541	GAG|GGA	-	pfam_DUF3518		0.552	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARID1A	protein_coding	OTTHUMT00000011437.2	G	NM_139135	-		27106528	+1	no_errors	ENST00000324856	ensembl	human	known	74_37	missense	SNP	1.000	A
NIN	51199	genome.wustl.edu	37	14	51243731	51243731	+	Missense_Mutation	SNP	T	T	A			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr14:51243731T>A	ENST00000382041.3	-	7	792	c.602A>T	c.(601-603)cAc>cTc	p.H201L	NIN_ENST00000245441.5_Missense_Mutation_p.H201L|NIN_ENST00000530997.2_Missense_Mutation_p.H201L|NIN_ENST00000382043.4_Missense_Mutation_p.H201L|NIN_ENST00000453196.1_Missense_Mutation_p.H201L|NIN_ENST00000389868.3_Missense_Mutation_p.H201L|NIN_ENST00000324330.9_Missense_Mutation_p.H201L	NM_016350.4|NM_182946.1	NP_057434.4|NP_891991	Q8N4C6	NIN_HUMAN	ninein (GSK3B interacting protein)	201	EF-hand 3. {ECO:0000255|PROSITE- ProRule:PRU00448}.				centrosome localization (GO:0051642)|centrosome-templated microtubule nucleation (GO:0090222)|microtubule anchoring at centrosome (GO:0034454)	centriole (GO:0005814)|centrosome (GO:0005813)|microtubule (GO:0005874)|nucleolus (GO:0005730)|spindle pole (GO:0000922)	calcium ion binding (GO:0005509)|GTP binding (GO:0005525)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(10)|kidney(5)|large_intestine(13)|lung(16)|ovary(1)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	71	all_epithelial(31;0.00244)|Breast(41;0.127)					CCGGTTCAGGTGACCATCACG	0.463			T	PDGFRB	MPD																																			Dom	yes		14	14q24	51199	ninein (GSK3B interacting protein)		L	0								ENSG00000100503						120.0	109.0	113.0					14																	51243731		2203	4300	6503	NIN	SO:0001583	missense	0			-	HGNC	AF212162	CCDS32078.1, CCDS32079.1, CCDS32078.2	14q21-q22	2013-01-10			ENSG00000100503	ENSG00000100503		"""EF-hand domain containing"""	14906	protein-coding gene	gene with protein product		608684				11004522, 11162463	Standard	NM_020921		Approved		uc001wyi.3	Q8N4C6	OTTHUMG00000029569	ENST00000382041.3:c.602A>T	14.37:g.51243731T>A	ENSP00000371472:p.His201Leu	Somatic	0	25	0.00		0.5912292923157907	15	21.05	4	WXS	Illumina HiSeq 2500	Phase_IV	tier1	30	54	35.71	A6NDB8|B7WPA3|C9JSB6|C9JSG2|C9JXL2|Q5BKU3|Q6P0P6|Q9BWU6|Q9C012|Q9C013|Q9C014|Q9H5I6|Q9HAT7|Q9HBY5|Q9HCK7|Q9UH61	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_tRNA-bd_arm,pfscan_EF_hand_dom	p.H201L	ENST00000382041.3	37	c.602	CCDS32079.1	14	.	.	.	.	.	.	.	.	.	.	T	18.48	3.632136	0.67015	.	.	ENSG00000100503	ENST00000245441;ENST00000311149;ENST00000389868;ENST00000382043;ENST00000324292;ENST00000382041;ENST00000324330;ENST00000453196;ENST00000453401	T;T;T;T;T;T;T	0.23552	1.9;1.9;1.9;1.9;1.9;1.9;1.9	5.76	5.76	0.90799	EF-hand-like domain (1);	0.441675	0.29501	N	0.011969	T	0.36608	0.0973	N	0.24115	0.695	0.30734	N	0.746946	P;D;D;P;D	0.89917	0.923;0.999;1.0;0.915;0.999	P;D;D;B;D	0.85130	0.652;0.95;0.997;0.217;0.994	T	0.25433	-1.0132	10	0.28530	T	0.3	-17.4188	15.5501	0.76145	0.0:0.0:0.0:1.0	.	207;201;201;201;201	Q8N4C6-5;C9J066;Q8N4C6;Q5BKU3;Q8N4C6-7	.;.;NIN_HUMAN;.;.	L	201;201;201;201;207;201;201;201;163	ENSP00000245441:H201L;ENSP00000374518:H201L;ENSP00000371474:H201L;ENSP00000371472:H201L;ENSP00000324210:H201L;ENSP00000412391:H201L;ENSP00000398641:H163L	ENSP00000245441:H201L	H	-	2	0	NIN	50313481	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.275000	0.43399	2.315000	0.78130	0.533000	0.62120	CAC	-	NULL		0.463	NIN-016	KNOWN	basic|CCDS	protein_coding	NIN	protein_coding	OTTHUMT00000395207.2	T	NM_182946	-		51243731	-1	no_errors	ENST00000245441	ensembl	human	known	74_37	missense	SNP	1.000	A
KMT2A	4297	genome.wustl.edu	37	11	118344494	118344495	+	Frame_Shift_Del	DEL	AG	AG	-	rs369821804		TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	AG	AG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr11:118344494_118344495delAG	ENST00000389506.5	+	3	2620_2621	c.2620_2621delAG	c.(2620-2622)agafs	p.R874fs	KMT2A_ENST00000534358.1_Frame_Shift_Del_p.R874fs|KMT2A_ENST00000354520.4_Frame_Shift_Del_p.R874fs			Q03164	KMT2A_HUMAN	lysine (K)-specific methyltransferase 2A	874					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|DNA methylation (GO:0006306)|embryonic hemopoiesis (GO:0035162)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cellular response to drug (GO:2001040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transporter activity (GO:0032411)|protein complex assembly (GO:0006461)|regulation of histone H3-K4 methylation (GO:0051569)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|identical protein binding (GO:0042802)|lysine-acetylated histone binding (GO:0070577)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)										ggacaagagtagagagagagac	0.48																																																	0								ENSG00000118058																																			KMT2A	SO:0001589	frameshift_variant	0				HGNC	L04284	CCDS31686.1, CCDS55791.1	11q23	2014-09-17	2013-05-09	2013-05-09	ENSG00000118058	ENSG00000118058		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7132	protein-coding gene	gene with protein product		159555	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog)"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)"""	MLL		1720549	Standard	NM_001197104		Approved	TRX1, HRX, ALL-1, HTRX1, CXXC7, MLL1A		Q03164	OTTHUMG00000166337	ENST00000389506.5:c.2620_2621delAG	11.37:g.118344502_118344503delAG	ENSP00000374157:p.Arg874fs	Somatic	0	41	0.00		0.5912292923157907	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	19	13.64	E9PQG7|Q13743|Q13744|Q14845|Q16364|Q59FF2|Q6UBD1|Q9HBJ3|Q9UD94|Q9UMA3	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_SET_dom,pfam_FYrich_C,pfam_Znf_PHD-finger,pfam_FYrich_N,pfam_Znf_CXXC,superfamily_Znf_FYVE_PHD,superfamily_Bromodomain,smart_Znf_PHD,smart_Bromodomain,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pirsf_MeTrfase_trithorax,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_CXXC,pfscan_Bromodomain	p.D877fs	ENST00000389506.5	37	c.2620_2621	CCDS31686.1	11																																																																																			-	pirsf_MeTrfase_trithorax		0.480	KMT2A-015	KNOWN	basic|appris_candidate|CCDS	protein_coding	KMT2A	protein_coding	OTTHUMT00000399085.2	AG	NM_005933			118344495	+1	no_errors	ENST00000389506	ensembl	human	known	74_37	frame_shift_del	DEL	1.000:1.000	-
RHOBTB2	23221	genome.wustl.edu	37	8	22861951	22861951	+	Missense_Mutation	SNP	G	G	T			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr8:22861951G>T	ENST00000251822.6	+	2	541	c.4G>T	c.(4-6)Gat>Tat	p.D2Y	RP11-875O11.1_ENST00000523884.1_RNA|RHOBTB2_ENST00000519685.1_Missense_Mutation_p.D24Y|RHOBTB2_ENST00000523918.1_3'UTR|RHOBTB2_ENST00000522948.1_Missense_Mutation_p.D9Y|RP11-875O11.1_ENST00000502083.2_RNA	NM_015178.2	NP_055993.2	Q9BYZ6	RHBT2_HUMAN	Rho-related BTB domain containing 2	2	Rho-like.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(11)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	31		Prostate(55;0.0513)|Breast(100;0.214)		Colorectal(74;0.0157)|COAD - Colon adenocarcinoma(73;0.064)		CCGTTTAATGGATTCTGACAT	0.617											OREG0018628	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000008853						103.0	78.0	87.0					8																	22861951		2203	4300	6503	RHOBTB2	SO:0001583	missense	0			-	HGNC	AF315385	CCDS6034.1, CCDS55210.1, CCDS55211.1	8p21.2	2013-01-08			ENSG00000008853	ENSG00000008853		"""BTB/POZ domain containing"""	18756	protein-coding gene	gene with protein product		607352				11222756	Standard	NM_001160036		Approved	KIAA0717, DBC2	uc011kzp.1	Q9BYZ6	OTTHUMG00000097827	ENST00000251822.6:c.4G>T	8.37:g.22861951G>T	ENSP00000251822:p.Asp2Tyr	Somatic	0	70	0.00	759	0.5912292923157907	10	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	28	12.50	A8K9Z8|D3DSR8|E9PBU2|E9PEI7|O94825|Q8N4A8|Q9BZK6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_BTB_POZ,pfam_Small_GTPase,pfam_MIRO-like,superfamily_P-loop_NTPase,superfamily_BTB/POZ_fold,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_BTB/POZ-like,pfscan_BTB/POZ-like,prints_Small_GTPase	p.D2Y	ENST00000251822.6	37	c.4	CCDS6034.1	8	.	.	.	.	.	.	.	.	.	.	G	25.0	4.594623	0.86953	.	.	ENSG00000008853	ENST00000519685;ENST00000524077;ENST00000522948;ENST00000251822	T;T;T;T	0.30182	2.83;1.54;2.65;2.39	4.73	4.73	0.59995	.	0.000000	0.85682	D	0.000000	T	0.39036	0.1063	N	0.14661	0.345	0.58432	D	0.999998	D;D;D	0.89917	1.0;1.0;0.999	D;D;P	0.74023	0.982;0.982;0.894	T	0.46005	-0.9222	10	0.87932	D	0	.	16.4336	0.83861	0.0:0.0:1.0:0.0	.	9;2;24	E9PEI7;Q9BYZ6;E9PBU2	.;RHBT2_HUMAN;.	Y	24;24;9;2	ENSP00000427926:D24Y;ENSP00000430785:D24Y;ENSP00000429141:D9Y;ENSP00000251822:D2Y	ENSP00000251822:D2Y	D	+	1	0	RHOBTB2	22917896	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	9.644000	0.98468	2.456000	0.83038	0.561000	0.74099	GAT	-	NULL		0.617	RHOBTB2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	RHOBTB2	protein_coding	OTTHUMT00000215101.2	G		-		22861951	+1	no_errors	ENST00000251822	ensembl	human	known	74_37	missense	SNP	1.000	T
RNPC3	55599	genome.wustl.edu	37	1	104076466	104076467	+	Frame_Shift_Ins	INS	-	-	A			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr1:104076466_104076467insA	ENST00000533099.1	+	4	582_583	c.346_347insA	c.(346-348)gaafs	p.E116fs	RNPC3_ENST00000524631.1_Frame_Shift_Ins_p.E116fs|RNPC3_ENST00000423855.2_Frame_Shift_Ins_p.E116fs			Q96LT9	RBM40_HUMAN	RNA-binding region (RNP1, RRM) containing 3	116	Necessary for interaction with PDCD7.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|U12-type spliceosomal complex (GO:0005689)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Lung(183;0.111)|Epithelial(280;0.122)|all cancers(265;0.125)|Colorectal(144;0.163)		TTCAGGCTCTGAAAAAAAAAAA	0.322																																																	0								ENSG00000185946																																			RNPC3	SO:0001589	frameshift_variant	0				HGNC	AB058742, AY099329	CCDS781.1	1p21.1	2013-07-16			ENSG00000185946	ENSG00000185946		"""RNA binding motif (RRM) containing"""	18666	protein-coding gene	gene with protein product	"""U11/U12 snRNP 65K"""					14974681, 15146077	Standard	NM_017619		Approved	KIAA1839, FLJ20008, RBM40, SNRNP65	uc010oun.2	Q96LT9	OTTHUMG00000166613	ENST00000533099.1:c.358dupA	1.37:g.104076477_104076477dupA	ENSP00000432886:p.Glu116fs	Somatic	0	29	0.00		0.5912292923157907	10	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	28	20.00	A8K1C9|D3DT74|Q5TZ87|Q96FK7|Q96JI8|Q9NSU7|Q9NXX2	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.K120fs	ENST00000533099.1	37	c.346_347	CCDS781.1	1																																																																																			-	NULL		0.322	RNPC3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RNPC3	protein_coding	OTTHUMT00000390812.1	-	NM_017619			104076467	+1	no_errors	ENST00000423855	ensembl	human	known	74_37	frame_shift_ins	INS	0.748:0.784	A
KEAP1	9817	genome.wustl.edu	37	19	10610197	10610197	+	Silent	SNP	G	G	A			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr19:10610197G>A	ENST00000171111.5	-	2	1060	c.513C>T	c.(511-513)tgC>tgT	p.C171C	KEAP1_ENST00000588024.1_5'Flank|KEAP1_ENST00000393623.2_Silent_p.C171C	NM_203500.1	NP_987096.1	Q14145	KEAP1_HUMAN	kelch-like ECH-associated protein 1	171					cellular response to interleukin-4 (GO:0071353)|in utero embryonic development (GO:0001701)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein ubiquitination (GO:0016567)|regulation of epidermal cell differentiation (GO:0045604)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|nucleus (GO:0005634)				breast(3)|endometrium(2)|kidney(4)|large_intestine(4)|liver(2)|lung(69)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	92			OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)		Dimethyl fumarate(DB08908)	GGAAGTCACTGCAGGCACGGA	0.597																																																	0								ENSG00000079999						155.0	123.0	134.0					19																	10610197		2203	4300	6503	KEAP1	SO:0001819	synonymous_variant	0			-	HGNC	AF361886	CCDS12239.1	19p13.2	2013-01-30				ENSG00000079999		"""Kelch-like"", ""BTB/POZ domain containing"""	23177	protein-coding gene	gene with protein product	"""kelch-like family member 19"""	606016					Standard	NM_012289		Approved	KIAA0132, MGC10630, MGC1114, MGC20887, MGC4407, MGC9454, INrf2, KLHL19	uc002mor.1	Q14145		ENST00000171111.5:c.513C>T	19.37:g.10610197G>A		Somatic	0	23	0.00		0.5912292923157907	169	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	27	12.90	B3KPD5|Q6LEP0|Q8WTX1|Q9BPY9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Kelch_1,pfam_BACK,pfam_BTB_POZ,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.C171	ENST00000171111.5	37	c.513	CCDS12239.1	19																																																																																			-	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pirsf_Kelch-like_gigaxonin		0.597	KEAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KEAP1	protein_coding	OTTHUMT00000452000.1	G	NM_012289	-		10610197	-1	no_errors	ENST00000171111	ensembl	human	known	74_37	silent	SNP	1.000	A
SLC2A5	6518	genome.wustl.edu	37	1	9097956	9097956	+	Splice_Site	SNP	C	C	A			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr1:9097956C>A	ENST00000377424.4	-	11	1481	c.1302G>T	c.(1300-1302)caG>caT	p.Q434H	SLC2A5_ENST00000536305.1_Splice_Site_p.Q375H|SLC2A5_ENST00000535586.1_Splice_Site_p.Q319H	NM_003039.2	NP_003030.1	P22732	GTR5_HUMAN	solute carrier family 2 (facilitated glucose/fructose transporter), member 5	434					carbohydrate metabolic process (GO:0005975)|cellular response to fructose stimulus (GO:0071332)|fructose transport (GO:0015755)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	fructose transmembrane transporter activity (GO:0005353)|glucose transmembrane transporter activity (GO:0005355)			endometrium(6)|kidney(15)|large_intestine(6)|lung(4)|ovary(1)|pancreas(2)|prostate(1)|urinary_tract(1)	36	Ovarian(185;0.112)|all_lung(157;0.185)	all_epithelial(116;1.34e-15)|all_lung(118;9.46e-05)|Lung NSC(185;0.000172)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.00715)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;7.78e-07)|COAD - Colon adenocarcinoma(227;8.83e-05)|Kidney(185;0.000286)|KIRC - Kidney renal clear cell carcinoma(229;0.00103)|STAD - Stomach adenocarcinoma(132;0.0019)|BRCA - Breast invasive adenocarcinoma(304;0.00199)|READ - Rectum adenocarcinoma(331;0.0649)		CCCCACTCACCTGGATGAACG	0.627																																																	0								ENSG00000142583						58.0	55.0	56.0					1																	9097956		2203	4300	6503	SLC2A5	SO:0001630	splice_region_variant	0			-	HGNC	BC001820	CCDS99.1, CCDS44054.1	1p36.2	2013-05-22			ENSG00000142583	ENSG00000142583		"""Solute carriers"""	11010	protein-coding gene	gene with protein product		138230		GLUT5		9691177	Standard	NM_003039		Approved		uc001apo.3	P22732	OTTHUMG00000001771	ENST00000377424.4:c.1302+1G>T	1.37:g.9097956C>A		Somatic	0	67	0.00		0.5912292923157907	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70	Q14770|Q5T977|Q8IVB3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,prints_Sugar/inositol_transpt,prints_Fru_transpt_5,tigrfam_Sugar/inositol_transpt	p.Q434H	ENST00000377424.4	37	c.1302	CCDS99.1	1	.	.	.	.	.	.	.	.	.	.	C	14.83	2.653714	0.47362	.	.	ENSG00000142583	ENST00000377424;ENST00000456780;ENST00000536305;ENST00000535586	T;T;T	0.58652	0.32;0.32;0.32	5.65	-1.74	0.08056	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.179262	0.50627	D	0.000116	T	0.75384	0.3842	M	0.89353	3.025	0.43095	D	0.994772	D;D;D	0.63046	0.992;0.99;0.961	P;D;P	0.67103	0.878;0.949;0.878	T	0.77635	-0.2514	9	.	.	.	.	14.7243	0.69332	0.0:0.8758:0.0:0.1242	.	390;375;434	B4DG19;B4DU31;P22732	.;.;GTR5_HUMAN	H	434;417;375;319	ENSP00000366641:Q434H;ENSP00000440688:Q375H;ENSP00000442744:Q319H	.	Q	-	3	2	SLC2A5	9020543	0.998000	0.40836	0.436000	0.26797	0.089000	0.18198	1.102000	0.31050	-0.673000	0.05259	0.655000	0.94253	CAG	-	pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Sugar/inositol_transpt		0.627	SLC2A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC2A5	protein_coding	OTTHUMT00000004932.1	C	NM_003039	-	Missense_Mutation	9097956	-1	no_errors	ENST00000377424	ensembl	human	known	74_37	missense	SNP	1.000	A
FAM131C	348487	genome.wustl.edu	37	1	16384813	16384813	+	3'UTR	SNP	G	G	C			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr1:16384813G>C	ENST00000375662.4	-	0	1145				FAM131C_ENST00000494078.1_5'UTR	NM_182623.2	NP_872429.2	Q96AQ9	F131C_HUMAN	family with sequence similarity 131, member C											large_intestine(2)|lung(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	8		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.32e-08)|COAD - Colon adenocarcinoma(227;5.56e-06)|BRCA - Breast invasive adenocarcinoma(304;9.12e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00656)|READ - Rectum adenocarcinoma(331;0.0649)		CACCTACCCTGTGCCTACCCG	0.677																																																	0								ENSG00000185519																																			FAM131C	SO:0001624	3_prime_UTR_variant	0			-	HGNC		CCDS41270.1	1p36.13	2008-02-05	2007-03-20	2007-03-20	ENSG00000185519	ENSG00000185519			26717	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 117"""	C1orf117		12477932	Standard	NM_182623		Approved	FLJ36766	uc001axz.4	Q96AQ9	OTTHUMG00000009525	ENST00000375662.4:c.*119C>G	1.37:g.16384813G>C		Somatic	0	124	0.00		0.5912292923157907	4	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	31	51	37.80	Q5T5Q5|Q8N3X3|Q8N9P9	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000375662.4	37	NULL	CCDS41270.1	1																																																																																			-	-		0.677	FAM131C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM131C	protein_coding	OTTHUMT00000026319.1	G	NM_182623	-		16384813	-1	no_errors	ENST00000494078	ensembl	human	known	74_37	rna	SNP	0.002	C
OR11A1	26531	genome.wustl.edu	37	6	29395185	29395185	+	Silent	SNP	T	T	A			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr6:29395185T>A	ENST00000377149.1	-	5	706	c.234A>T	c.(232-234)gcA>gcT	p.A78A	OR11A1_ENST00000377148.1_Silent_p.A78A|OR5V1_ENST00000377154.1_Intron|OR11A1_ENST00000377147.2_Silent_p.A78A			Q9GZK7	O11A1_HUMAN	olfactory receptor, family 11, subfamily A, member 1	78						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|large_intestine(1)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	19						TTGGCATCACTGCGGAGGTGT	0.488																																																	0								ENSG00000204694						71.0	65.0	67.0					6																	29395185		1510	2709	4219	OR11A1	SO:0001819	synonymous_variant	0			-	HGNC		CCDS34363.1	6p22.2-p21.31	2014-02-19	2002-02-28		ENSG00000204694	ENSG00000204694		"""GPCR / Class A : Olfactory receptors"""	8176	protein-coding gene	gene with protein product			"""olfactory receptor, family 11, subfamily A, member 2"""	OR11A2			Standard	XM_005249001		Approved	hs6M1-18	uc003nmg.3	Q9GZK7	OTTHUMG00000031225	ENST00000377149.1:c.234A>T	6.37:g.29395185T>A		Somatic	0	31	0.00		0.5912292923157907	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	28	40.43	A2BF33|A6NFQ3|B0S7T2|Q5ST16|Q9GZK8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_GPCR_Rhodpsn,prints_Olfact_rcpt,pfscan_GPCR_Rhodpsn_7TM	p.A78	ENST00000377149.1	37	c.234	CCDS34363.1	6																																																																																			-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.488	OR11A1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	OR11A1	protein_coding	OTTHUMT00000193778.1	T		-		29395185	-1	no_errors	ENST00000377147	ensembl	human	known	74_37	silent	SNP	0.044	A
DPPA5	340168	genome.wustl.edu	37	6	74063926	74063926	+	Missense_Mutation	SNP	C	C	G			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr6:74063926C>G	ENST00000370370.3	-	1	92	c.23G>C	c.(22-24)aGa>aCa	p.R8T		NM_001025290.2	NP_001020461.1	A6NC42	DPPA5_HUMAN	developmental pluripotency associated 5	8					multicellular organismal development (GO:0007275)	cytoplasm (GO:0005737)	RNA binding (GO:0003723)			NS(1)|endometrium(1)|lung(5)	7						CGGGATATGTCTACGTGCCGG	0.577																																																	0								ENSG00000203909						64.0	57.0	59.0					6																	74063926		2203	4300	6503	DPPA5	SO:0001583	missense	0			-	HGNC		CCDS34483.1	6q13	2014-01-28			ENSG00000203909	ENSG00000203909			19201	protein-coding gene	gene with protein product		611111					Standard	NM_001025290		Approved	Esg1	uc003pgs.2	A6NC42	OTTHUMG00000015025	ENST00000370370.3:c.23G>C	6.37:g.74063926C>G	ENSP00000359396:p.Arg8Thr	Somatic	0	86	0.00		0.5912292923157907	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	43	59	42.16	B2RPQ7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.R8T	ENST00000370370.3	37	c.23	CCDS34483.1	6	.	.	.	.	.	.	.	.	.	.	C	6.202	0.405474	0.11754	.	.	ENSG00000203909	ENST00000370370	T	0.29397	1.57	3.6	-0.837	0.10766	.	0.540328	0.16982	N	0.191662	T	0.05547	0.0146	N	0.24115	0.695	0.09310	N	1	B	0.18310	0.027	B	0.16289	0.015	T	0.39396	-0.9616	10	0.26408	T	0.33	.	6.6106	0.22749	0.0:0.465:0.0:0.535	.	8	A6NC42	DPPA5_HUMAN	T	8	ENSP00000359396:R8T	ENSP00000359396:R8T	R	-	2	0	DPPA5	74120647	0.001000	0.12720	0.000000	0.03702	0.008000	0.06430	0.398000	0.20899	-0.117000	0.11872	-0.350000	0.07774	AGA	-	NULL		0.577	DPPA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPPA5	protein_coding	OTTHUMT00000041203.3	C	NM_001025290	-		74063926	-1	no_errors	ENST00000370370	ensembl	human	known	74_37	missense	SNP	0.000	G
GIF	2694	genome.wustl.edu	37	11	59612858	59612858	+	Missense_Mutation	SNP	C	C	A			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr11:59612858C>A	ENST00000257248.2	-	1	116	c.69G>T	c.(67-69)caG>caT	p.Q23H	GIF_ENST00000541311.1_5'UTR	NM_005142.2	NP_005133.2	P27352	IF_HUMAN	gastric intrinsic factor (vitamin B synthesis)	23			Q -> R (in dbSNP:rs35211634). {ECO:0000269|PubMed:14695536, ECO:0000269|PubMed:15738392}.		cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|cobalt ion transport (GO:0006824)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|lysosomal lumen (GO:0043202)|microvillus (GO:0005902)	cobalamin binding (GO:0031419)			large_intestine(4)|liver(1)|lung(6)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	17					Cyanocobalamin(DB00115)	AGCATGAACTCTGGGTCTGGG	0.532																																					NSCLC(53;1139 1245 16872 38474 42853)												0								ENSG00000134812						152.0	150.0	150.0					11																	59612858		2201	4295	6496	GIF	SO:0001583	missense	0			-	HGNC	X76562	CCDS7977.1	11q12.1	2013-09-20			ENSG00000134812	ENSG00000134812			4268	protein-coding gene	gene with protein product		609342				2071148	Standard	NM_005142		Approved	TCN3, IF, IFMH, INF	uc001noi.3	P27352	OTTHUMG00000167399	ENST00000257248.2:c.69G>T	11.37:g.59612858C>A	ENSP00000257248:p.Gln23His	Somatic	0	42	0.00		0.5912292923157907	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	B2RAN8|B4DVZ1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cbl-bd_transpt_euk	p.Q23H	ENST00000257248.2	37	c.69	CCDS7977.1	11	.	.	.	.	.	.	.	.	.	.	C	11.33	1.607595	0.28623	.	.	ENSG00000134812	ENST00000257248	T	0.35973	1.28	5.46	-1.87	0.07737	.	0.905508	0.09152	N	0.841440	T	0.29556	0.0737	N	0.22421	0.69	0.09310	N	0.999997	B;B	0.32425	0.371;0.371	B;B	0.41466	0.358;0.358	T	0.44907	-0.9297	10	0.35671	T	0.21	2.9968	11.1349	0.48368	0.0:0.6163:0.0:0.3837	.	23;23	B4DVY6;P27352	.;IF_HUMAN	H	23	ENSP00000257248:Q23H	ENSP00000257248:Q23H	Q	-	3	2	GIF	59369434	0.000000	0.05858	0.005000	0.12908	0.053000	0.15095	-0.337000	0.07852	-0.195000	0.10382	0.561000	0.74099	CAG	-	pfam_Cbl-bd_transpt_euk		0.532	GIF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GIF	protein_coding	OTTHUMT00000394497.1	C	NM_005142	-		59612858	-1	no_errors	ENST00000257248	ensembl	human	known	74_37	missense	SNP	0.000	A
OSCP1	127700	genome.wustl.edu	37	1	36888990	36888990	+	Missense_Mutation	SNP	C	C	A			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr1:36888990C>A	ENST00000356637.5	-	6	687	c.624G>T	c.(622-624)tgG>tgT	p.W208C	OSCP1_ENST00000315643.9_Missense_Mutation_p.W208C|OSCP1_ENST00000495222.1_5'UTR|OSCP1_ENST00000433045.2_Missense_Mutation_p.W153C|OSCP1_ENST00000235532.5_Missense_Mutation_p.W198C			Q8WVF1	OSCP1_HUMAN	organic solute carrier partner 1	208					transport (GO:0006810)	plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|stomach(2)|urinary_tract(1)	22						CTTCAGTTCCCCAAGGAACAG	0.463																																																	0								ENSG00000116885						88.0	90.0	89.0					1																	36888990		2203	4300	6503	OSCP1	SO:0001583	missense	0			-	HGNC		CCDS409.1, CCDS410.1, CCDS409.2	1p34.3	2009-07-06	2009-07-06	2009-07-06	ENSG00000116885	ENSG00000116885			29971	protein-coding gene	gene with protein product	"""oxidored nitro domain containing protein"""	608854	"""chromosome 1 open reading frame 102"""	C1orf102		12477932	Standard	NM_145047		Approved	NOR1	uc001caq.3	Q8WVF1	OTTHUMG00000008139	ENST00000356637.5:c.624G>T	1.37:g.36888990C>A	ENSP00000349052:p.Trp208Cys	Somatic	0	46	0.00		0.5912292923157907	12	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	46	11.54	A6NHM5|A6NHS9|A6NIN9|Q4AEJ0|Q8N7G2|Q8TDF1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_OSCP1	p.W198C	ENST00000356637.5	37	c.594		1	.	.	.	.	.	.	.	.	.	.	c	11.37	1.619973	0.28801	.	.	ENSG00000116885	ENST00000235532;ENST00000356637;ENST00000433045;ENST00000445843;ENST00000315643	T;T;T;T;T	0.30448	1.95;1.96;1.54;1.53;1.95	5.34	5.34	0.76211	.	0.264107	0.41194	D	0.000939	T	0.34019	0.0883	L	0.59912	1.85	0.58432	D	0.999999	B;B	0.16802	0.019;0.011	B;B	0.16722	0.016;0.007	T	0.06935	-1.0799	10	0.32370	T	0.25	.	18.0306	0.89282	0.0:1.0:0.0:0.0	.	198;208	Q8WVF1-3;Q8WVF1	.;OSCP1_HUMAN	C	198;208;153;168;208	ENSP00000235532:W198C;ENSP00000349052:W208C;ENSP00000390820:W153C;ENSP00000396417:W168C;ENSP00000314541:W208C	ENSP00000235532:W198C	W	-	3	0	OSCP1	36661577	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	4.471000	0.60182	2.511000	0.84671	0.650000	0.86243	TGG	-	NULL		0.463	OSCP1-010	NOVEL	not_organism_supported|basic	protein_coding	OSCP1	protein_coding	OTTHUMT00000389759.1	C	NM_145047	-		36888990	-1	no_errors	ENST00000235532	ensembl	human	known	74_37	missense	SNP	1.000	A
AKAP2	11217	genome.wustl.edu	37	9	112900341	112900342	+	In_Frame_Ins	INS	-	-	GAAGCT	rs373159646|rs34665027|rs150402481	byFrequency	TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr9:112900341_112900342insGAAGCT	ENST00000259318.7	+	2	2031_2032	c.1824_1825insGAAGCT	c.(1825-1827)gaa>GAAGCTgaa	p.609_609E>EAE	AKAP2_ENST00000510514.5_In_Frame_Ins_p.840_840E>EAE|AKAP2_ENST00000374525.1_In_Frame_Ins_p.698_698E>EAE|AKAP2_ENST00000434623.2_In_Frame_Ins_p.698_698E>EAE|PALM2-AKAP2_ENST00000374530.3_In_Frame_Ins_p.840_840E>EAE|AKAP2_ENST00000555236.1_In_Frame_Ins_p.840_840E>EAE|PALM2-AKAP2_ENST00000302798.7_In_Frame_Ins_p.840_840E>EAE	NM_001136562.2	NP_001130034.1	Q9Y2D5	AKAP2_HUMAN	A kinase (PRKA) anchor protein 2	609								p.E839_E840insEA(1)|p.E697_E698insEA(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(16)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	33						CGACTGTAGAGGAAGCTGAAGC	0.505														656	0.13099	0.1309	0.0821	5008	,	,		20174	0.2133		0.1362	False		,,,				2504	0.0757																2	Insertion - In frame(2)	lung(2)						ENSG00000157654		,,,,	550,3714		39,472,1621					,,,,	2.7	0.9		dbSNP_134	39	1146,7108		82,982,3063	no	coding,coding,coding,coding,coding	AKAP2,PALM2-AKAP2	NM_147150.2,NM_007203.4,NM_001198656.1,NM_001136562.2,NM_001004065.4	,,,,	121,1454,4684	A1A1,A1R,RR		13.8842,12.8987,13.5485	,,,,	,,,,		1696,10822				PALM2-AKAP2	SO:0001652	inframe_insertion	0				HGNC	AB023137	CCDS43861.1, CCDS48003.1, CCDS56581.1	9q31.3	2009-10-16			ENSG00000241978	ENSG00000241978		"""A-kinase anchor proteins"""	372	protein-coding gene	gene with protein product	"""protein kinase A2"""	604582		PRKA2		10231032	Standard	NM_001136562		Approved	AKAP-KL, KIAA0920, DKFZp564L0716		Q9Y2D5	OTTHUMG00000156811	ENST00000259318.7:c.1831_1836dupGAAGCT	9.37:g.112900342_112900347dupGAAGCT	Exception_encountered	Somatic	NA	NA	NA		0.5912292923157907	54	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B1ALX9|B2RTU4|B3KQ00|B4DTZ2|B7ZW07|B9EJB5|Q9UG26	In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_Paralemmin,pfam_RII_binding_1	p.843in_frame_insEA	ENST00000259318.7	37	c.2517_2518	CCDS48003.1	9																																																																																			-	NULL		0.505	AKAP2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	PALM2-AKAP2	protein_coding	OTTHUMT00000346067.3	-	NM_001004065			112900342	+1	no_errors	ENST00000374530	ensembl	human	known	74_37	in_frame_ins	INS	0.985:0.982	GAAGCT
MRC2	9902	genome.wustl.edu	37	17	60758429	60758429	+	Silent	SNP	C	C	A			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr17:60758429C>A	ENST00000303375.5	+	18	3043	c.2641C>A	c.(2641-2643)Cgg>Agg	p.R881R	MRC2_ENST00000446119.2_5'Flank|RNU6-446P_ENST00000362827.1_RNA	NM_006039.4	NP_006030.2	Q9UBG0	MRC2_HUMAN	mannose receptor, C type 2	881	C-type lectin 5. {ECO:0000255|PROSITE- ProRule:PRU00040}.				collagen catabolic process (GO:0030574)|endocytosis (GO:0006897)|osteoblast differentiation (GO:0001649)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|collagen binding (GO:0005518)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(11)|lung(28)|ovary(2)|prostate(1)|skin(3)	53						CCAGTTCTCCCGGGCCCAGGA	0.682																																																	0								ENSG00000011028						28.0	26.0	27.0					17																	60758429		2203	4300	6503	MRC2	SO:0001819	synonymous_variant	0			-	HGNC	AB014609	CCDS11634.1	17q23	2011-08-30				ENSG00000011028		"""CD molecules"", ""C-type lectin domain containing"""	16875	protein-coding gene	gene with protein product		612264				9734811, 8702911	Standard	NM_006039		Approved	KIAA0709, ENDO180, CLEC13E, CD280	uc002jad.4	Q9UBG0		ENST00000303375.5:c.2641C>A	17.37:g.60758429C>A		Somatic	0	57	0.00		0.5912292923157907	932	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	A6H8K4|D3DU08|Q7LGE7|Q9Y5P9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_C-type_lectin,pfam_FN_type2_col-bd,pfam_Herpes_UL45-like,superfamily_C-type_lectin_fold,superfamily_Ricin_B_lectin,superfamily_Kringle-like,smart_Ricin_B_lectin,smart_FN_type2_col-bd,smart_C-type_lectin,pfscan_FN_type2_col-bd,pfscan_C-type_lectin,pfscan_Ricin_B_lectin,prints_AntifreezeII	p.R881	ENST00000303375.5	37	c.2641	CCDS11634.1	17																																																																																			-	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin		0.682	MRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRC2	protein_coding	OTTHUMT00000445152.1	C		-		60758429	+1	no_errors	ENST00000303375	ensembl	human	known	74_37	silent	SNP	0.993	A
ADCY2	108	genome.wustl.edu	37	5	7396579	7396579	+	Frame_Shift_Del	DEL	C	C	-			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr5:7396579delC	ENST00000338316.4	+	1	259	c.170delC	c.(169-171)tccfs	p.S57fs		NM_020546.2	NP_065433.2	Q08462	ADCY2_HUMAN	adenylate cyclase 2 (brain)	57					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)			NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(56)|ovary(8)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	119						GTCATGGGCTCCTGCCTCGCC	0.706																																																	0								ENSG00000078295						51.0	43.0	46.0					5																	7396579		2203	4296	6499	ADCY2	SO:0001589	frameshift_variant	0				HGNC	AB028983	CCDS3872.2	5p15.3	2013-02-04			ENSG00000078295	ENSG00000078295	4.6.1.1	"""Adenylate cyclases"""	233	protein-coding gene	gene with protein product		103071				1427768	Standard	NM_020546		Approved	HBAC2, KIAA1060, AC2	uc003jdz.1	Q08462	OTTHUMG00000090476	ENST00000338316.4:c.170delC	5.37:g.7396579delC	ENSP00000342952:p.Ser57fs	Somatic	0	15	0.00		0.5912292923157907	22	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	21	8.70	B7Z2C1|Q2NKL8|Q9UDB2|Q9UPU2	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_A/G_cyclase,pfam_Adenylate_cyclase-like,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	p.C58fs	ENST00000338316.4	37	c.170	CCDS3872.2	5																																																																																			-	NULL		0.706	ADCY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY2	protein_coding	OTTHUMT00000206930.2	C	NM_020546			7396579	+1	no_errors	ENST00000338316	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
PCDHGA1	56114	genome.wustl.edu	37	5	140711128	140711128	+	Missense_Mutation	SNP	C	C	T			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr5:140711128C>T	ENST00000517417.1	+	1	877	c.877C>T	c.(877-879)Cgt>Tgt	p.R293C	AC005618.6_ENST00000606901.1_lincRNA|PCDHGA1_ENST00000378105.3_Missense_Mutation_p.R293C	NM_018912.2	NP_061735.1	Q9Y5H4	PCDG1_HUMAN	protocadherin gamma subfamily A, 1	293	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R293C(2)		breast(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|lung(32)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCAAATATTTCGTTTAGATTC	0.428																																																	2	Substitution - Missense(2)	skin(2)						ENSG00000204956						61.0	62.0	62.0					5																	140711128		2203	4300	6503	PCDHGA1	SO:0001583	missense	0			-	HGNC	AF152318	CCDS54922.1	5q31	2010-01-26				ENSG00000204956		"""Cadherins / Protocadherins : Clustered"""	8696	other	protocadherin		606288				10380929	Standard	NM_018912		Approved	PCDH-GAMMA-A1		Q9Y5H4		ENST00000517417.1:c.877C>T	5.37:g.140711128C>T	ENSP00000431083:p.Arg293Cys	Somatic	0	36	0.00		0.5912292923157907	4	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	27	12.50	Q2M273|Q9Y5D6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R293C	ENST00000517417.1	37	c.877	CCDS54922.1	5	.	.	.	.	.	.	.	.	.	.	C	8.755	0.922233	0.17982	.	.	ENSG00000204956	ENST00000517417;ENST00000378105	T;T	0.55930	0.49;0.49	4.19	4.19	0.49359	Cadherin (4);Cadherin-like (1);	0.151865	0.30419	N	0.009671	T	0.49081	0.1536	M	0.69523	2.12	0.25748	N	0.985084	B;B	0.13145	0.001;0.007	B;B	0.13407	0.002;0.009	T	0.44498	-0.9324	10	0.46703	T	0.11	.	8.8528	0.35210	0.1661:0.6725:0.1614:0.0	.	293;293	Q9Y5H4-2;Q9Y5H4	.;PCDG1_HUMAN	C	293	ENSP00000431083:R293C;ENSP00000367345:R293C	ENSP00000367345:R293C	R	+	1	0	PCDHGA1	140691312	0.000000	0.05858	0.996000	0.52242	0.912000	0.54170	-0.755000	0.04782	2.345000	0.79718	0.650000	0.86243	CGT	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.428	PCDHGA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDHGA1	protein_coding	OTTHUMT00000374737.1	C	NM_018912	rs145926133		140711128	+1	no_errors	ENST00000517417	ensembl	human	known	74_37	missense	SNP	0.609	T
VARS	7407	genome.wustl.edu	37	6	31750593	31750593	+	Missense_Mutation	SNP	G	G	T			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr6:31750593G>T	ENST00000375663.3	-	15	2232	c.1792C>A	c.(1792-1794)Caa>Aaa	p.Q598K	VARS_ENST00000482996.1_5'Flank|VARS_ENST00000444930.2_Intron	NM_006295.2	NP_006286.1	P26640	SYVC_HUMAN	valyl-tRNA synthetase	598					gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)|valyl-tRNA aminoacylation (GO:0006438)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|valine-tRNA ligase activity (GO:0004832)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(18)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	30					L-Valine(DB00161)	TAGTCATTTTGGTCATGTGCG	0.582																																																	0								ENSG00000204394						54.0	52.0	53.0					6																	31750593		1509	2708	4217	VARS	SO:0001583	missense	0			-	HGNC	BC012808	CCDS34412.1	6p21.3	2011-07-01		2005-07-05	ENSG00000204394	ENSG00000204394	6.1.1.9	"""Aminoacyl tRNA synthetases / Class I"""	12651	protein-coding gene	gene with protein product	"""valine tRNA ligase 1, cytoplasmic"""	192150	"""valyl-tRNA synthetase 2"""	VARS2		15779907	Standard	XM_005249362		Approved		uc003nxe.3	P26640	OTTHUMG00000031286	ENST00000375663.3:c.1792C>A	6.37:g.31750593G>T	ENSP00000364815:p.Gln598Lys	Somatic	0	36	0.00		0.5912292923157907	116	0.85	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	21	16.00	B0V1N1|B4DZ61|Q5JQ90|Q96E77|Q9UQM2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_aa-tRNA-synth_Ia,pfam_V/L/I-tRNA-synth_anticodon-bd,pfam_Glutathione_S-Trfase_N,pfam_Methionyl/Leucyl_tRNA_Synth,pfam_GST_C,superfamily_Val/Leu/Ile-tRNA-synth_edit,superfamily_tRNAsynth_1a_anticodon-bd,superfamily_Glutathione-S-Trfase_C-like,superfamily_tRNA-bd_arm,prints_Valyl-tRNA_ligase,tigrfam_Valyl-tRNA_ligase	p.Q598K	ENST00000375663.3	37	c.1792	CCDS34412.1	6	.	.	.	.	.	.	.	.	.	.	G	18.02	3.530471	0.64860	.	.	ENSG00000204394	ENST00000375663	T	0.34859	1.34	5.09	4.22	0.49857	Valyl/Leucyl/Isoleucyl-tRNA synthetase, class Ia, editing domain (2);Aminoacyl-tRNA synthetase, class Ia (1);	0.113134	0.64402	D	0.000009	T	0.09512	0.0234	N	0.20845	0.615	0.80722	D	1	P	0.38729	0.644	B	0.41135	0.348	T	0.05484	-1.0882	10	0.02654	T	1	-15.5249	11.0924	0.48123	0.0914:0.0:0.9085:0.0	.	598	P26640	SYVC_HUMAN	K	598	ENSP00000364815:Q598K	ENSP00000364815:Q598K	Q	-	1	0	VARS	31858572	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	6.966000	0.76073	1.135000	0.42183	0.563000	0.77884	CAA	-	pfam_aa-tRNA-synth_Ia,superfamily_Val/Leu/Ile-tRNA-synth_edit,tigrfam_Valyl-tRNA_ligase		0.582	VARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VARS	protein_coding	OTTHUMT00000076619.2	G	NM_006295	-		31750593	-1	no_errors	ENST00000375663	ensembl	human	known	74_37	missense	SNP	1.000	T
ANKRD20A2	441430	genome.wustl.edu	37	9	42375546	42375547	+	Intron	INS	-	-	ACACC	rs376182807		TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr9:42375546_42375547insACACC	ENST00000377601.2	+	4	604				ANKRD20A2_ENST00000477139.2_3'UTR	NM_001012421.1	NP_001012421.1	Q5SQ80	A20A2_HUMAN	ankyrin repeat domain 20 family, member A2											large_intestine(1)|lung(1)|ovary(1)|urinary_tract(1)	4						CTGGGATCCTGACACCATTCAT	0.431																																																	0								ENSG00000183148																																			ANKRD20A2	SO:0001627	intron_variant	0				HGNC		CCDS35028.1	9p12	2013-01-10			ENSG00000183148	ENSG00000183148		"""Ankyrin repeat domain containing"""	31979	protein-coding gene	gene with protein product							Standard	XM_005272519		Approved			Q5SQ80	OTTHUMG00000058641	ENST00000377601.2:c.493-714->ACACC	9.37:g.42375547_42375551dupACACC		Somatic	NA	NA	NA		0.5912292923157907	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000377601.2	37	NULL	CCDS35028.1	9																																																																																			-	-		0.431	ANKRD20A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD20A2	protein_coding	OTTHUMT00000129794.1	-	NM_001012421			42375547	+1	no_errors	ENST00000477139	ensembl	human	known	74_37	rna	INS	0.000:0.000	ACACC
PGAP1	80055	genome.wustl.edu	37	2	197707533	197707533	+	Missense_Mutation	SNP	T	T	G			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr2:197707533T>G	ENST00000354764.4	-	26	2656	c.2542A>C	c.(2542-2544)Aat>Cat	p.N848H		NM_024989.3	NP_079265.2	Q75T13	PGAP1_HUMAN	post-GPI attachment to proteins 1	848					anterior/posterior axis specification (GO:0009948)|attachment of GPI anchor to protein (GO:0016255)|C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|embryonic pattern specification (GO:0009880)|forebrain regionalization (GO:0021871)|head development (GO:0060322)|intracellular protein transport (GO:0006886)|myo-inositol transport (GO:0015798)|post-translational protein modification (GO:0043687)|sensory perception of sound (GO:0007605)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	nuclease activity (GO:0004518)|phosphoric ester hydrolase activity (GO:0042578)			breast(4)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(9)|lung(11)|ovary(6)|stomach(1)|urinary_tract(1)	40						GGATCAGGATTAAGTTTAAAA	0.279																																																	0								ENSG00000197121						59.0	68.0	65.0					2																	197707533		2200	4289	6489	PGAP1	SO:0001583	missense	0			-	HGNC		CCDS2318.1	2q33.1	2014-03-03			ENSG00000197121	ENSG00000197121			25712	protein-coding gene	gene with protein product	"""GPI inositol-deacylase"""	611655				14734546, 17711852, 24482476	Standard	XM_005246866		Approved	FLJ12377, Bst1, SPG67	uc002utw.3	Q75T13	OTTHUMG00000132743	ENST00000354764.4:c.2542A>C	2.37:g.197707533T>G	ENSP00000346809:p.Asn848His	Somatic	0	41	0.00		0.5912292923157907	35	23.91	11	WXS	Illumina HiSeq 2500	Phase_IV	tier1	39	105	27.08	Q4G0R8|Q4ZG47|Q53SM0|Q6AW92|Q6UWV4|Q9HA24	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PGAP1-like	p.N848H	ENST00000354764.4	37	c.2542	CCDS2318.1	2	.	.	.	.	.	.	.	.	.	.	T	11.77	1.737798	0.30774	.	.	ENSG00000197121	ENST00000354764	.	.	.	5.35	4.17	0.49024	.	0.447709	0.25361	N	0.031228	T	0.25791	0.0628	N	0.08118	0	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.14364	-1.0475	9	0.45353	T	0.12	-5.5324	0.6207	0.00777	0.1797:0.1662:0.1878:0.4663	.	848	Q75T13	PGAP1_HUMAN	H	848	.	ENSP00000346809:N848H	N	-	1	0	PGAP1	197415778	0.995000	0.38212	0.996000	0.52242	0.951000	0.60555	0.279000	0.18771	1.014000	0.39417	0.533000	0.62120	AAT	-	NULL		0.279	PGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PGAP1	protein_coding	OTTHUMT00000256103.5	T	NM_024989	-		197707533	-1	no_errors	ENST00000354764	ensembl	human	known	74_37	missense	SNP	0.968	G
PLXNB3	5365	genome.wustl.edu	37	X	153043144	153043144	+	Splice_Site	SNP	G	G	T			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chrX:153043144G>T	ENST00000361971.5	+	31	5375		c.e31+1		SRPK3_ENST00000489426.1_Splice_Site|PLXNB3_ENST00000485980.1_3'UTR|PLXNB3_ENST00000538776.1_Splice_Site|PLXNB3_ENST00000538966.1_Splice_Site	NM_005393.2	NP_005384.2	Q9ULL4	PLXB3_HUMAN	plexin B3						axon guidance (GO:0007411)|cell chemotaxis (GO:0060326)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell migration (GO:0030336)|negative regulation of GTPase activity (GO:0034260)|negative regulation of lamellipodium assembly (GO:0010593)|positive chemotaxis (GO:0050918)|positive regulation of endothelial cell proliferation (GO:0001938)|semaphorin-plexin signaling pathway (GO:0071526)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	protein domain specific binding (GO:0019904)|semaphorin receptor activity (GO:0017154)			central_nervous_system(1)|endometrium(7)|large_intestine(2)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	32	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)					AGACCAACAGGTGCCTTTCCT	0.597																																																	0								ENSG00000198753						162.0	125.0	138.0					X																	153043144		2203	4300	6503	PLXNB3	SO:0001630	splice_region_variant	0			-	HGNC	AF149019	CCDS14729.1, CCDS55536.1	Xq28	2008-02-05			ENSG00000198753	ENSG00000198753		"""Plexins"""	9105	protein-coding gene	gene with protein product		300214		PLXN6		10520995	Standard	NM_005393		Approved	PLEXR, PLEXB3	uc010nuk.2	Q9ULL4	OTTHUMG00000024217	ENST00000361971.5:c.5261+1G>T	X.37:g.153043144G>T		Somatic	0	76	0.00		0.5912292923157907	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	57	8.06	B7Z3E6|F5H773|Q9HDA4	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e30+1	ENST00000361971.5	37	c.5330+1	CCDS14729.1	X	.	.	.	.	.	.	.	.	.	.	G	11.86	1.764672	0.31228	.	.	ENSG00000198753	ENST00000538966;ENST00000361971;ENST00000538776;ENST00000448847	.	.	.	4.7	4.7	0.59300	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.8103	0.78557	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PLXNB3	152696338	1.000000	0.71417	0.989000	0.46669	0.235000	0.25334	9.731000	0.98807	2.065000	0.61736	0.529000	0.55759	.	-	-		0.597	PLXNB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLXNB3	protein_coding	OTTHUMT00000061063.1	G		-	Intron	153043144	+1	no_errors	ENST00000538966	ensembl	human	known	74_37	splice_site	SNP	1.000	T
ADAMTS19	171019	genome.wustl.edu	37	5	129072798	129072798	+	Missense_Mutation	SNP	G	G	T			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr5:129072798G>T	ENST00000274487.4	+	23	3656	c.3511G>T	c.(3511-3513)Gtg>Ttg	p.V1171L	CTC-575N7.1_ENST00000503616.1_RNA	NM_133638.3	NP_598377.3	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 19	1171	PLAC. {ECO:0000255|PROSITE- ProRule:PRU00233}.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(10)|kidney(9)|large_intestine(14)|lung(34)|ovary(6)|pancreas(1)|prostate(6)|skin(6)	91		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		TCAGTGGCCAGTGTACTGCCG	0.463																																																	0								ENSG00000145808						133.0	123.0	127.0					5																	129072798		2203	4300	6503	ADAMTS19	SO:0001583	missense	0			-	HGNC	AJ311904	CCDS4146.1	5q23.3	2009-04-27	2005-08-19		ENSG00000145808	ENSG00000145808		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17111	protein-coding gene	gene with protein product		607513	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 19"""			11867212	Standard	NM_133638		Approved		uc003kvb.1	Q8TE59	OTTHUMG00000128990	ENST00000274487.4:c.3511G>T	5.37:g.129072798G>T	ENSP00000274487:p.Val1171Leu	Somatic	0	21	0.00		0.5912292923157907	1	50.00	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	6	78.57		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_PLAC,pfam_Pept_M10_metallopeptidase,superfamily_Thrombospondin_1_rpt,smart_ADAM_Cys-rich,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.V1171L	ENST00000274487.4	37	c.3511	CCDS4146.1	5	.	.	.	.	.	.	.	.	.	.	G	18.44	3.623779	0.66901	.	.	ENSG00000145808	ENST00000274487	T	0.64085	-0.08	4.12	4.12	0.48240	PLAC (2);	0.000000	0.45126	D	0.000394	T	0.66436	0.2789	N	0.19112	0.55	0.53688	D	0.99997	D	0.76494	0.999	D	0.85130	0.997	T	0.65228	-0.6219	9	.	.	.	.	17.6813	0.88243	0.0:0.0:1.0:0.0	.	1171	Q8TE59	ATS19_HUMAN	L	1171	ENSP00000274487:V1171L	.	V	+	1	0	ADAMTS19	129100697	1.000000	0.71417	0.913000	0.36048	0.603000	0.37013	8.517000	0.90555	2.599000	0.87857	0.650000	0.86243	GTG	-	pfam_PLAC,pfscan_PLAC		0.463	ADAMTS19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS19	protein_coding	OTTHUMT00000250979.2	G	NM_133638	-		129072798	+1	no_errors	ENST00000274487	ensembl	human	known	74_37	missense	SNP	0.999	T
GPR112	139378	genome.wustl.edu	37	X	135487944	135487944	+	Silent	SNP	T	T	C			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chrX:135487944T>C	ENST00000394143.1	+	23	9039	c.8748T>C	c.(8746-8748)gtT>gtC	p.V2916V	GPR112_ENST00000412101.1_Silent_p.V2711V|GPR112_ENST00000394141.1_Silent_p.V2711V|GPR112_ENST00000370652.1_Silent_p.V2916V|GPR112_ENST00000287534.4_Silent_p.V2669V	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	2916					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.V2916V(1)		NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					TCTGCACTGTTCTTGTTCAAC	0.403																																																	1	Substitution - coding silent(1)	large_intestine(1)						ENSG00000156920						166.0	142.0	150.0					X																	135487944		2203	4300	6503	GPR112	SO:0001819	synonymous_variant	0			-	HGNC	AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.8748T>C	X.37:g.135487944T>C		Somatic	0	49	0.00		0.5912292923157907	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	65	27.78	A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_Pentaxin,superfamily_ConA-like_lec_gl_sf,smart_Pentaxin,smart_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	p.V2916	ENST00000394143.1	37	c.8748	CCDS35409.1	X																																																																																			-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like		0.403	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GPR112	protein_coding	OTTHUMT00000286639.1	T		-		135487944	+1	no_errors	ENST00000370652	ensembl	human	known	74_37	silent	SNP	0.998	C
SHANK1	50944	genome.wustl.edu	37	19	51191180	51191180	+	Splice_Site	SNP	C	C	A			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr19:51191180C>A	ENST00000293441.1	-	17	2326	c.2308G>T	c.(2308-2310)Gca>Tca	p.A770S	SHANK1_ENST00000391813.1_Splice_Site_p.A157S|SHANK1_ENST00000359082.3_Splice_Site_p.A761S|SHANK1_ENST00000391814.1_Splice_Site_p.A770S	NM_016148.2	NP_057232.2	Q9Y566	SHAN1_HUMAN	SH3 and multiple ankyrin repeat domains 1	770					adult behavior (GO:0030534)|associative learning (GO:0008306)|cytoskeletal anchoring at plasma membrane (GO:0007016)|dendritic spine morphogenesis (GO:0060997)|determination of affect (GO:0050894)|habituation (GO:0046959)|long-term memory (GO:0007616)|negative regulation of actin filament bundle assembly (GO:0032232)|neuromuscular process controlling balance (GO:0050885)|olfactory behavior (GO:0042048)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|protein complex assembly (GO:0006461)|protein localization to synapse (GO:0035418)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|righting reflex (GO:0060013)|social behavior (GO:0035176)|synapse maturation (GO:0060074)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|excitatory synapse (GO:0060076)|intracellular (GO:0005622)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ankyrin repeat binding (GO:0071532)|GKAP/Homer scaffold activity (GO:0030160)|identical protein binding (GO:0042802)|ionotropic glutamate receptor binding (GO:0035255)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|scaffold protein binding (GO:0097110)|SH3 domain binding (GO:0017124)|somatostatin receptor binding (GO:0031877)			breast(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(15)|liver(1)|lung(21)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	64		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00493)|GBM - Glioblastoma multiforme(134;0.0199)		GCAGGAGCACCTTTCTTGTGC	0.642																																																	0								ENSG00000161681						139.0	93.0	109.0					19																	51191180		2203	4300	6503	SHANK1	SO:0001630	splice_region_variant	0			-	HGNC	AF163302	CCDS12799.1	19q13.3	2013-01-10			ENSG00000161681	ENSG00000161681		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	15474	protein-coding gene	gene with protein product	"""somatostatin receptor-interacting protein"""	604999				10551867	Standard	NM_016148		Approved	SSTRIP, SPANK-1, synamon	uc002psx.1	Q9Y566	OTTHUMG00000137380	ENST00000293441.1:c.2308+1G>T	19.37:g.51191180C>A		Somatic	0	42	0.00		0.5912292923157907	8	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	30	11.76	A8MXP5|B7WNY6|Q9NYW9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ankyrin_rpt,pfam_SAM_type1,pfam_SH3_2,pfam_SAM_2,pfam_PDZ,pfam_SH3_domain,superfamily_Ankyrin_rpt-contain_dom,superfamily_PDZ,superfamily_SH3_domain,superfamily_SAM/pointed,smart_Ankyrin_rpt,smart_SH3_domain,smart_PDZ,smart_SAM,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_PDZ,pfscan_SAM,pfscan_SH3_domain	p.A770S	ENST00000293441.1	37	c.2308	CCDS12799.1	19	.	.	.	.	.	.	.	.	.	.	C	13.72	2.321610	0.41096	.	.	ENSG00000161681	ENST00000293441;ENST00000391813;ENST00000359082;ENST00000391814	T;T;T;T	0.43688	1.04;1.43;0.96;0.94	3.66	3.66	0.41972	.	0.527728	0.16218	U	0.224146	T	0.57607	0.2065	M	0.68952	2.095	0.33597	D	0.601849	B;P	0.52692	0.192;0.955	B;P	0.58520	0.09;0.84	T	0.68788	-0.5316	9	.	.	.	-2.2426	14.6423	0.68734	0.0:1.0:0.0:0.0	.	770;157	Q9Y566;Q9Y566-2	SHAN1_HUMAN;.	S	770;157;761;770	ENSP00000293441:A770S;ENSP00000375689:A157S;ENSP00000351984:A761S;ENSP00000375690:A770S	.	A	-	1	0	SHANK1	55882992	1.000000	0.71417	1.000000	0.80357	0.689000	0.40095	5.510000	0.67018	2.074000	0.62210	0.289000	0.19496	GCA	-	NULL		0.642	SHANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHANK1	protein_coding	OTTHUMT00000268071.1	C	NM_016148	-	Missense_Mutation	51191180	-1	no_errors	ENST00000391814	ensembl	human	known	74_37	missense	SNP	1.000	A
CDKN2A	1029	genome.wustl.edu	37	9	21968231	21968288	+	Splice_Site	DEL	ATCGGGGATGTCTGCAGAGGGCAGAAAGAAAACAGGCGTTAGAAACCTGAGGTCAAAG	ATCGGGGATGTCTGCAGAGGGCAGAAAGAAAACAGGCGTTAGAAACCTGAGGTCAAAG	-			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	ATCGGGGATGTCTGCAGAGGGCAGAAAGAAAACAGGCGTTAGAAACCTGAGGTCAAAG	ATCGGGGATGTCTGCAGAGGGCAGAAAGAAAACAGGCGTTAGAAACCTGAGGTCAAAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr9:21968231_21968288delATCGGGGATGTCTGCAGAGGGCAGAAAGAAAACAGGCGTTAGAAACCTGAGGTCAAAG	ENST00000304494.5	-	3	728_738	c.458_468delCTTTGACCTCAGGTTTCTAACGCCTGTTTTCTTTCTGCCCTCTGCAGACATCCCCGAT	c.(457-468)gctttgacctca>g	p.ALTS153fs	CDKN2A_ENST00000498628.2_Splice_Site_p.ALTS102fs|CDKN2A_ENST00000579122.1_Splice_Site_p.RFDLR128fs|CDKN2A_ENST00000498124.1_3'UTR|RP11-145E5.5_ENST00000404796.2_Intron|CDKN2A_ENST00000530628.2_3'UTR|CDKN2A_ENST00000579755.1_3'UTR|CDKN2A_ENST00000578845.2_Splice_Site_p.ALTS102fs|CDKN2A_ENST00000494262.1_Splice_Site_p.ALTS102fs|CDKN2A_ENST00000361570.3_3'UTR	NM_000077.4	NP_000068.1	P42771	CD2A1_HUMAN	cyclin-dependent kinase inhibitor 2A	153					cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cellular senescence (GO:2000774)|positive regulation of macrophage apoptotic process (GO:2000111)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|Ras protein signal transduction (GO:0007265)|replicative senescence (GO:0090399)|senescence-associated heterochromatin focus assembly (GO:0035986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|senescence-associated heterochromatin focus (GO:0035985)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|NF-kappaB binding (GO:0051059)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)	p.0?(1315)|p.?(13)|p.0(1)		NS(28)|adrenal_gland(6)|autonomic_ganglia(11)|biliary_tract(74)|bone(84)|breast(46)|central_nervous_system(522)|cervix(23)|endometrium(14)|eye(4)|genital_tract(15)|haematopoietic_and_lymphoid_tissue(698)|kidney(39)|large_intestine(11)|liver(92)|lung(365)|meninges(18)|oesophagus(239)|ovary(98)|pancreas(263)|pleura(94)|prostate(13)|salivary_gland(10)|skin(541)|small_intestine(1)|soft_tissue(93)|stomach(48)|thymus(4)|thyroid(24)|upper_aerodigestive_tract(436)|urinary_tract(283)|vulva(2)	4199		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;2.37e-290)|Lung NSC(2;1.26e-139)|all_lung(2;4.48e-131)|Glioma(2;3.26e-60)|all_neural(2;2.1e-52)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;2.74e-34)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00162)|Colorectal(97;0.172)		all cancers(2;0)|GBM - Glioblastoma multiforme(3;0)|Lung(2;4.07e-74)|Epithelial(2;1.08e-61)|LUSC - Lung squamous cell carcinoma(2;3.82e-48)|LUAD - Lung adenocarcinoma(2;4.56e-26)|OV - Ovarian serous cystadenocarcinoma(39;7.64e-10)|BRCA - Breast invasive adenocarcinoma(2;5.01e-09)|STAD - Stomach adenocarcinoma(4;4.63e-07)|Kidney(2;5.79e-07)|KIRC - Kidney renal clear cell carcinoma(2;7.27e-07)|COAD - Colon adenocarcinoma(8;5.15e-05)		GGTTCTTTCAATCGGGGATGTCTGCAGAGGGCAGAAAGAAAACAGGCGTTAGAAACCTGAGGTCAAAGATGTGTGGCA	0.543		17								HNSCC(2;<9.43e_08)|TSP Lung(5;3.83e-07)																																							1329	Whole gene deletion(1316)|Unknown(13)	haematopoietic_and_lymphoid_tissue(277)|skin(167)|central_nervous_system(163)|lung(141)|urinary_tract(90)|bone(73)|soft_tissue(57)|pleura(51)|upper_aerodigestive_tract(51)|oesophagus(48)|ovary(33)|breast(30)|kidney(29)|pancreas(29)|thyroid(13)|biliary_tract(13)|NS(12)|stomach(12)|autonomic_ganglia(7)|meninges(7)|large_intestine(6)|liver(6)|salivary_gland(4)|thymus(4)|vulva(2)|endometrium(2)|prostate(2)						ENSG00000147889																																			CDKN2A	SO:0001630	splice_region_variant	0				HGNC	L27211	CCDS6510.1, CCDS6511.1, CCDS6511.2, CCDS56565.1	9p21	2014-09-17	2012-03-08		ENSG00000147889	ENSG00000147889			1787	protein-coding gene	gene with protein product		600160	"""cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4)"""	CDKN2, MLM		8152487, 7606716	Standard	NM_058195		Approved	CDK4I, p16, INK4a, MTS1, CMM2, ARF, p19, p14, INK4, p16INK4a, p19Arf	uc003zpk.3	P42771	OTTHUMG00000019686	ENST00000304494.5:c.458-1CTTTGACCTCAGGTTTCTAACGCCTGTTTTCTTTCTGCCCTCTGCAGACATCCCCGAT>-	9.37:g.21968231_21968288delATCGGGGATGTCTGCAGAGGGCAGAAAGAAAACAGGCGTTAGAAACCTGAGGTCAAAG		Somatic	NA	NA	NA		0.5912292923157907	3	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A5X2G7|D3DRK1|O95440|Q15191|Q5VVJ5|Q96B52|Q9NP05	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom	p.D153fs	ENST00000304494.5	37	c.468_458	CCDS6510.1	9																																																																																			-	NULL		0.543	CDKN2A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CDKN2A	protein_coding	OTTHUMT00000051915.1	ATCGGGGATGTCTGCAGAGGGCAGAAAGAAAACAGGCGTTAGAAACCTGAGGTCAAAG	NM_000077		Frame_Shift_Del	21968288	-1	no_errors	ENST00000304494	ensembl	human	known	74_37	frame_shift_del	DEL	0.000:0.000:0.000:0.000:0.001:0.000:0.000:0.000:0.000:0.000:0.014	-
DPAGT1	1798	genome.wustl.edu	37	11	118981867	118981867	+	5'Flank	SNP	C	C	A			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr11:118981867C>A	ENST00000409993.2	-	0	0				C2CD2L_ENST00000336702.3_Missense_Mutation_p.P263T|C2CD2L_ENST00000528586.1_Missense_Mutation_p.P11T			Q9H3H5	GPT_HUMAN	dolichyl-phosphate (UDP-N-acetylglucosamine) N-acetylglucosaminephosphotransferase 1 (GlcNAc-1-P transferase)						cellular protein metabolic process (GO:0044267)|dolichol biosynthetic process (GO:0019408)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)|protein oligomerization (GO:0051259)|UDP-N-acetylglucosamine metabolic process (GO:0006047)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)	phospho-N-acetylmuramoyl-pentapeptide-transferase activity (GO:0008963)|transferase activity, transferring glycosyl groups (GO:0016757)|UDP-N-acetylglucosamine-dolichyl-phosphate N-acetylglucosaminephosphotransferase activity (GO:0003975)			breast(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(2)	17	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.55e-05)		TTGCTCTGCCCCAGGAGGCCT	0.517																																																	0								ENSG00000172375						144.0	144.0	144.0					11																	118981867		2200	4295	6495	C2CD2L	SO:0001631	upstream_gene_variant	0			-	HGNC	Z82022	CCDS8411.1	11q23.3	2007-12-14			ENSG00000172269	ENSG00000172269	2.7.8.15		2995	protein-coding gene	gene with protein product		191350		DPAGT2, DPAGT		8244387	Standard	NM_001382		Approved	GPT, D11S366, DGPT, ALG7, CDG-Ij	uc001pvi.3	Q9H3H5	OTTHUMG00000153533		11.37:g.118981867C>A	Exception_encountered	Somatic	0	74	0.00		0.5912292923157907	17	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	15	21.05	O15216|Q86WV9|Q9BWE6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_C2_dom	p.P263T	ENST00000409993.2	37	c.787	CCDS8411.1	11	.	.	.	.	.	.	.	.	.	.	C	9.831	1.188499	0.21954	.	.	ENSG00000172375	ENST00000336702;ENST00000528586	T;T	0.80393	-1.37;-1.37	4.7	2.73	0.32206	.	0.388845	0.28166	N	0.016352	T	0.65207	0.2669	N	0.24115	0.695	0.43857	D	0.996454	B;B	0.16802	0.019;0.019	B;B	0.18561	0.022;0.022	T	0.53308	-0.8457	10	0.23891	T	0.37	-30.9038	8.6886	0.34254	0.2734:0.4602:0.2664:0.0	.	263;263	O14523;O14523-2	C2C2L_HUMAN;.	T	263;11	ENSP00000338885:P263T;ENSP00000433600:P11T	ENSP00000338885:P263T	P	+	1	0	C2CD2L	118487077	.	.	1.000000	0.80357	0.911000	0.54048	.	.	0.531000	0.28639	0.563000	0.77884	CCA	-	NULL		0.517	DPAGT1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	C2CD2L	protein_coding	OTTHUMT00000331527.2	C	NM_001382	-		118981867	+1	no_errors	ENST00000336702	ensembl	human	known	74_37	missense	SNP	0.996	A
ARRDC5	645432	genome.wustl.edu	37	19	4891142	4891142	+	Silent	SNP	G	G	T			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr19:4891142G>T	ENST00000381781.2	-	3	944	c.945C>A	c.(943-945)atC>atA	p.I315I	AC027319.1_ENST00000408608.1_RNA	NM_001080523.1	NP_001073992.1	A6NEK1	ARRD5_HUMAN	arrestin domain containing 5	315										endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)	12				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0257)		CGCTGGTGATGATGATGGGAA	0.572																																																	0								ENSG00000205784						116.0	121.0	119.0					19																	4891142		2154	4248	6402	ARRDC5	SO:0001819	synonymous_variant	0			-	HGNC		CCDS45929.1	19p13.3	2007-10-05				ENSG00000205784			31407	protein-coding gene	gene with protein product						12886014	Standard	NM_001080523		Approved		uc002mbm.3	A6NEK1		ENST00000381781.2:c.945C>A	19.37:g.4891142G>T		Somatic	0	47	0.00		0.5912292923157907	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	72	27.27		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Arrestin-like_N,pfam_Arrestin_C-like,superfamily_Ig_E-set	p.I315	ENST00000381781.2	37	c.945	CCDS45929.1	19																																																																																			-	pfam_Arrestin_C-like,superfamily_Ig_E-set		0.572	ARRDC5-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	ARRDC5	protein_coding	OTTHUMT00000450443.1	G	XM_292803	-		4891142	-1	no_errors	ENST00000381781	ensembl	human	known	74_37	silent	SNP	0.019	T
KLF8	11279	genome.wustl.edu	37	X	56292123	56292123	+	Missense_Mutation	SNP	C	C	A			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chrX:56292123C>A	ENST00000468660.1	+	3	880	c.592C>A	c.(592-594)Cct>Act	p.P198T	KLF8_ENST00000374928.3_Missense_Mutation_p.P198T	NM_007250.4	NP_009181.2	O95600	KLF8_HUMAN	Kruppel-like factor 8	198					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			kidney(4)|large_intestine(6)|lung(5)|ovary(1)	16						AGATGGGGGCCCTGCAGCCAT	0.498																																																	0								ENSG00000102349						55.0	49.0	51.0					X																	56292123		2203	4300	6503	KLF8	SO:0001583	missense	0			-	HGNC	U28282	CCDS14373.1, CCDS55428.1	Xp11.21	2013-01-08			ENSG00000102349	ENSG00000102349		"""Zinc fingers, C2H2-type"", ""Kruppel-like transcription factors"""	6351	protein-coding gene	gene with protein product		300286					Standard	NM_007250		Approved	BKLF3, ZNF741, DXS741	uc004dur.3	O95600	OTTHUMG00000021666	ENST00000468660.1:c.592C>A	X.37:g.56292123C>A	ENSP00000417303:p.Pro198Thr	Somatic	0	17	0.00		0.5912292923157907	16	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	47	29.85	B4DJN3|E7EQQ8|L0R3U8|L0R4U2|Q2M246|Q59GV5|Q5HYQ5|Q5JXP7|Q6MZJ7|Q9UGC4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P198T	ENST00000468660.1	37	c.592	CCDS14373.1	X	.	.	.	.	.	.	.	.	.	.	C	3.294	-0.144236	0.06627	.	.	ENSG00000102349	ENST00000374928;ENST00000468660	T;T	0.25579	1.79;1.79	4.35	3.38	0.38709	.	0.246250	0.34338	N	0.004054	T	0.15955	0.0384	L	0.41079	1.255	0.31757	N	0.633807	P;B;B	0.37466	0.596;0.216;0.027	B;B;B	0.37989	0.262;0.085;0.006	T	0.08330	-1.0727	10	0.02654	T	1	.	7.9918	0.30246	0.3775:0.6225:0.0:0.0	.	198;198;198	E7EQQ8;B4DJN3;O95600	.;.;KLF8_HUMAN	T	198	ENSP00000364063:P198T;ENSP00000417303:P198T	ENSP00000431911:P198T	P	+	1	0	KLF8	56308848	0.978000	0.34361	0.997000	0.53966	0.984000	0.73092	2.250000	0.43178	2.088000	0.63022	0.600000	0.82982	CCT	-	NULL		0.498	KLF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLF8	protein_coding	OTTHUMT00000056887.2	C	NM_007250	-		56292123	+1	no_errors	ENST00000468660	ensembl	human	known	74_37	missense	SNP	0.992	A
TSKU	25987	genome.wustl.edu	37	11	76507195	76507195	+	Missense_Mutation	SNP	G	G	T			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr11:76507195G>T	ENST00000527881.1	+	2	1561	c.535G>T	c.(535-537)Gcc>Tcc	p.A179S	TSKU_ENST00000333090.4_Missense_Mutation_p.A179S			Q8WUA8	TSK_HUMAN	tsukushi, small leucine rich proteoglycan	179					anterior commissure morphogenesis (GO:0021960)|ciliary body morphogenesis (GO:0061073)|corpus callosum morphogenesis (GO:0021540)|lateral ventricle development (GO:0021670)|negative regulation of Wnt signaling pathway (GO:0030178)|regulation of gene expression (GO:0010468)	extracellular space (GO:0005615)				NS(1)|large_intestine(4)|lung(6)|urinary_tract(1)	12	Ovarian(111;0.112)					CCCCACGAGGGCCGGCCTGCC	0.667																																																	0								ENSG00000182704						60.0	68.0	65.0					11																	76507195		2200	4292	6492	TSKU	SO:0001583	missense	0			-	HGNC	AK075476	CCDS8246.1	11q13.5	2012-12-05	2012-12-05	2006-11-21	ENSG00000182704	ENSG00000182704			28850	protein-coding gene	gene with protein product		608015	"""leucine rich repeat containing 54"", ""tsukushin"", ""tsukushi small leucine rich proteoglycan homolog (Xenopus laevis)"""	LRRC54		11085516, 19710929, 22880013	Standard	NM_001258210		Approved	E2IG4, TSK	uc031qcw.1	Q8WUA8		ENST00000527881.1:c.535G>T	11.37:g.76507195G>T	ENSP00000434847:p.Ala179Ser	Somatic	0	34	0.00		0.5912292923157907	331	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	28	12.50	B3KQT7|Q6UXK1|Q9UG10|Q9UJX9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.A179S	ENST00000527881.1	37	c.535	CCDS8246.1	11	.	.	.	.	.	.	.	.	.	.	G	0.996	-0.692351	0.03303	.	.	ENSG00000182704	ENST00000333090;ENST00000439807;ENST00000527881	T;T	0.33654	1.4;1.4	5.01	2.81	0.32909	.	0.409578	0.18086	N	0.152153	T	0.28167	0.0695	L	0.50333	1.59	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.22068	-1.0227	10	0.54805	T	0.06	-23.3784	4.3034	0.10935	0.1674:0.0:0.5662:0.2664	.	179	Q8WUA8	TSK_HUMAN	S	179;147;179	ENSP00000332668:A179S;ENSP00000434847:A179S	ENSP00000332668:A179S	A	+	1	0	TSKU	76184843	0.000000	0.05858	0.010000	0.14722	0.002000	0.02628	0.294000	0.19047	1.043000	0.40175	0.655000	0.94253	GCC	-	NULL		0.667	TSKU-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TSKU	protein_coding	OTTHUMT00000382871.1	G	NM_015516	-		76507195	+1	no_errors	ENST00000333090	ensembl	human	known	74_37	missense	SNP	0.009	T
CHRM2	1129	genome.wustl.edu	37	7	136699910	136699910	+	Missense_Mutation	SNP	C	C	A			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr7:136699910C>A	ENST00000445907.2	+	3	826	c.298C>A	c.(298-300)Cta>Ata	p.L100I	hsa-mir-490_ENST00000597642.1_RNA|hsa-mir-490_ENST00000592183.1_RNA|CHRM2_ENST00000320658.5_Missense_Mutation_p.L100I|hsa-mir-490_ENST00000425981.2_RNA|hsa-mir-490_ENST00000586239.1_RNA|CHRM2_ENST00000397608.3_Missense_Mutation_p.L100I|hsa-mir-490_ENST00000593789.1_RNA|CHRM2_ENST00000402486.3_Missense_Mutation_p.L100I|CHRM2_ENST00000401861.1_Missense_Mutation_p.L100I|CHRM2_ENST00000453373.1_Missense_Mutation_p.L100I|hsa-mir-490_ENST00000598184.1_RNA|hsa-mir-490_ENST00000439694.1_RNA	NM_001006627.1|NM_001006629.1	NP_001006628.1|NP_001006630.1	P08172	ACM2_HUMAN	cholinergic receptor, muscarinic 2	100					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|nervous system development (GO:0007399)|phospholipase C-activating G-protein coupled acetylcholine receptor signaling pathway (GO:0007207)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|regulation of heart contraction (GO:0008016)|response to virus (GO:0009615)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	G-protein coupled acetylcholine receptor activity (GO:0016907)			central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(13)|liver(1)|lung(29)|ovary(4)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	68					Aclidinium(DB08897)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Anisotropine Methylbromide(DB00517)|Aripiprazole(DB01238)|Atropine(DB00572)|Bethanechol(DB01019)|Brompheniramine(DB00835)|Carbachol(DB00411)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Cocaine(DB00907)|Cryptenamine(DB00785)|Cyproheptadine(DB00434)|Darifenacin(DB00496)|Desipramine(DB01151)|Dicyclomine(DB00804)|Dimetindene(DB08801)|Diphenidol(DB01231)|Disopyramide(DB00280)|Doxacurium chloride(DB01135)|Doxepin(DB01142)|Ethopropazine(DB00392)|Fesoterodine(DB06702)|Flavoxate(DB01148)|Gallamine Triethiodide(DB00483)|Glycopyrrolate(DB00986)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|Ketamine(DB01221)|Loxapine(DB00408)|Maprotiline(DB00934)|Methotrimeprazine(DB01403)|Methylscopolamine bromide(DB00462)|Metixene(DB00340)|Metocurine(DB01336)|Mivacurium(DB01226)|Nicardipine(DB00622)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Pancuronium(DB01337)|Paroxetine(DB00715)|Pethidine(DB00454)|Pilocarpine(DB01085)|Pipecuronium(DB01338)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Rocuronium(DB00728)|Scopolamine(DB00747)|Solifenacin(DB01591)|Succinylcholine(DB00202)|Tiotropium(DB01409)|Tolterodine(DB01036)|Triflupromazine(DB00508)|Trihexyphenidyl(DB00376)|Trimipramine(DB00726)|Tropicamide(DB00809)|Ziprasidone(DB00246)	TGACCTTTGGCTAGCCCTGGA	0.478																																																	0								ENSG00000181072						186.0	176.0	179.0					7																	136699910		2203	4300	6503	CHRM2	SO:0001583	missense	0			-	HGNC		CCDS5843.1	7q35-q36	2014-09-17			ENSG00000181072	ENSG00000181072		"""Cholinergic receptors"", ""GPCR / Class A : Cholinergic receptors, muscarinic"""	1951	protein-coding gene	gene with protein product	"""acetylcholine receptor, muscarinic 2"""	118493					Standard	NM_000739		Approved		uc003vtl.1	P08172	OTTHUMG00000155658	ENST00000445907.2:c.298C>A	7.37:g.136699910C>A	ENSP00000399745:p.Leu100Ile	Somatic	0	27	0.00		0.5912292923157907	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	15	16.67	Q4VBK6|Q9P1X9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Musac_Ach_M2_rcpt,prints_Musac_Ach_rcpt,prints_GPCR_Rhodpsn	p.L100I	ENST00000445907.2	37	c.298	CCDS5843.1	7	.	.	.	.	.	.	.	.	.	.	C	15.35	2.807076	0.50421	.	.	ENSG00000181072	ENST00000445907;ENST00000453373;ENST00000320658;ENST00000397608;ENST00000402486;ENST00000401861	T;T;T;T;T;T	0.29917	1.55;1.55;1.55;1.55;1.55;1.55	5.61	0.728	0.18260	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000001	T	0.42040	0.1185	L	0.46947	1.48	0.54753	D	0.999986	D	0.76494	0.999	D	0.85130	0.997	T	0.10989	-1.0606	10	0.37606	T	0.19	-12.6405	9.5222	0.39143	0.0:0.5962:0.0:0.4038	.	100	P08172	ACM2_HUMAN	I	100	ENSP00000399745:L100I;ENSP00000415386:L100I;ENSP00000319984:L100I;ENSP00000380733:L100I;ENSP00000384937:L100I;ENSP00000384401:L100I	ENSP00000319984:L100I	L	+	1	2	CHRM2	136350450	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.115000	0.31209	0.335000	0.23614	0.650000	0.86243	CTA	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.478	CHRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRM2	protein_coding	OTTHUMT00000341010.1	C		-		136699910	+1	no_errors	ENST00000320658	ensembl	human	known	74_37	missense	SNP	0.997	A
AP2A2	161	genome.wustl.edu	37	11	970176	970176	+	Missense_Mutation	SNP	G	G	T			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr11:970176G>T	ENST00000448903.2	+	3	285	c.144G>T	c.(142-144)aaG>aaT	p.K48N	AP2A2_ENST00000534328.1_Missense_Mutation_p.K48N|AP2A2_ENST00000332231.5_Missense_Mutation_p.K48N	NM_001242837.1|NM_012305.3	NP_001229766.1|NP_036437.1	O94973	AP2A2_HUMAN	adaptor-related protein complex 2, alpha 2 subunit	48	Lipid-binding.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular protein transport (GO:0006886)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of defense response to virus by virus (GO:0050690)|synaptic transmission (GO:0007268)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|clathrin-coated endocytic vesicle membrane (GO:0030669)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|protein kinase binding (GO:0019901)|protein transporter activity (GO:0008565)			breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(6)|ovary(2)	21		all_cancers(49;9.46e-06)|Breast(177;0.00257)|all_epithelial(84;0.0027)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;1.75e-24)|BRCA - Breast invasive adenocarcinoma(625;5.73e-05)|Lung(200;0.0696)|LUSC - Lung squamous cell carcinoma(625;0.082)		TAGGTGACAAGGCTCTTGATG	0.512																																																	0								ENSG00000183020						129.0	132.0	131.0					11																	970176		1966	4151	6117	AP2A2	SO:0001583	missense	0			-	HGNC	AB020706	CCDS44512.1, CCDS73234.1	11p15.5	2008-07-18			ENSG00000183020	ENSG00000183020			562	protein-coding gene	gene with protein product	"""alpha-adaptin C; Huntingtin interacting protein J"", ""adaptin, alpha B"", ""clathrin-associated/assembly/adaptor protein, large, alpha 2"""	607242		CLAPA2, ADTAB		9700202, 2564002	Standard	NM_012305		Approved	DKFZP564D1864, HYPJ, KIAA0899, HIP9	uc001lst.2	O94973	OTTHUMG00000165627	ENST00000448903.2:c.144G>T	11.37:g.970176G>T	ENSP00000413234:p.Lys48Asn	Somatic	0	69	0.00		0.5912292923157907	71	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	56	8.20	O75403|Q53ET1|Q96SI8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Clathrin/coatomer_adapt-like_N,pfam_Clathrin_a-adaptin_app_sub_C,pfam_Clathrin_a/b/g-adaptin_app_Ig,superfamily_ARM-type_fold,superfamily_Coatomer/calthrin_app_sub_C,superfamily_Coatomer/clathrin_app_Ig-like,smart_Clathrin_a/b/g-adaptin_app_Ig,pirsf_AP2_complex_asu	p.K48N	ENST00000448903.2	37	c.144	CCDS44512.1	11	.	.	.	.	.	.	.	.	.	.	G	13.22	2.171484	0.38315	.	.	ENSG00000183020	ENST00000534328;ENST00000417081;ENST00000448903;ENST00000332231;ENST00000448757;ENST00000529125;ENST00000452310;ENST00000531548;ENST00000534485;ENST00000527024	T;T;T;T;T;T	0.39406	1.08;1.08;1.08;1.08;1.08;1.08	3.26	1.37	0.22104	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.40522	0.1120	M	0.77820	2.39	0.58432	D	0.999997	B;B	0.30281	0.233;0.275	B;B	0.31751	0.083;0.135	T	0.25117	-1.0141	10	0.46703	T	0.11	-18.9098	6.9552	0.24568	0.388:0.0:0.612:0.0	.	48;48	O94973-2;O94973	.;AP2A2_HUMAN	N	48;48;48;48;48;48;48;54;38;42	ENSP00000436059:K48N;ENSP00000413234:K48N;ENSP00000327694:K48N;ENSP00000433498:K54N;ENSP00000435756:K38N;ENSP00000434563:K42N	ENSP00000327694:K48N	K	+	3	2	AP2A2	960176	1.000000	0.71417	1.000000	0.80357	0.565000	0.35776	4.006000	0.57083	0.404000	0.25506	0.563000	0.77884	AAG	-	pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,pirsf_AP2_complex_asu		0.512	AP2A2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	AP2A2	protein_coding	OTTHUMT00000385431.2	G	NM_012305	-		970176	+1	no_errors	ENST00000332231	ensembl	human	known	74_37	missense	SNP	1.000	T
FGFR1	2260	genome.wustl.edu	37	8	38274849	38274849	+	Missense_Mutation	SNP	G	G	T			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr8:38274849G>T	ENST00000447712.2	-	12	2579	c.1638C>A	c.(1636-1638)aaC>aaA	p.N546K	FGFR1_ENST00000341462.5_Missense_Mutation_p.N546K|FGFR1_ENST00000425967.3_Missense_Mutation_p.N577K|FGFR1_ENST00000326324.6_Missense_Mutation_p.N455K|FGFR1_ENST00000335922.5_Missense_Mutation_p.N536K|FGFR1_ENST00000397113.2_Missense_Mutation_p.N544K|FGFR1_ENST00000397091.5_Missense_Mutation_p.N544K|FGFR1_ENST00000397103.1_Missense_Mutation_p.N457K|FGFR1_ENST00000532791.1_Missense_Mutation_p.N544K|FGFR1_ENST00000356207.5_Missense_Mutation_p.N457K|FGFR1_ENST00000397108.4_Missense_Mutation_p.N544K	NM_001174063.1|NM_015850.3|NM_023110.2	NP_001167534.1|NP_056934.2|NP_075598.2	P11362	FGFR1_HUMAN	fibroblast growth factor receptor 1	546	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|auditory receptor cell development (GO:0060117)|axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell maturation (GO:0048469)|cell migration (GO:0016477)|chondrocyte differentiation (GO:0002062)|chordate embryonic development (GO:0043009)|embryonic limb morphogenesis (GO:0030326)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|fibroblast growth factor receptor signaling pathway involved in orbitofrontal cortex development (GO:0035607)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|insulin receptor signaling pathway (GO:0008286)|lung-associated mesenchyme development (GO:0060484)|MAPK cascade (GO:0000165)|mesenchymal cell differentiation (GO:0048762)|midbrain development (GO:0030901)|middle ear morphogenesis (GO:0042474)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ induction (GO:0001759)|outer ear morphogenesis (GO:0042473)|paraxial mesoderm development (GO:0048339)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of phospholipase C activity (GO:0010863)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of branching involved in salivary gland morphogenesis by mesenchymal-epithelial signaling (GO:0060665)|regulation of cell differentiation (GO:0045595)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|regulation of lateral mesodermal cell fate specification (GO:0048378)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|skeletal system morphogenesis (GO:0048705)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ventricular zone neuroblast division (GO:0021847)	cytoplasmic vesicle (GO:0031410)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)	p.N546K(4)	FGFR1/ZNF703(2)	breast(2)|central_nervous_system(7)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(18)|ovary(1)|prostate(1)|stomach(2)|urinary_tract(2)	50	all_cancers(2;9.05e-47)|all_epithelial(2;2.64e-50)|all_lung(3;1.71e-23)|Lung NSC(2;3.61e-23)|Colorectal(12;0.000442)	Breast(189;1.48e-05)|all_lung(54;0.00354)|Lung NSC(58;0.0138)|Hepatocellular(245;0.065)	Epithelial(3;3.96e-34)|all cancers(3;3.06e-30)|BRCA - Breast invasive adenocarcinoma(5;2.28e-21)|COAD - Colon adenocarcinoma(9;0.24)		Palifermin(DB00039)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)	CCCCCAGCAGGTTGATGATAT	0.542		1	T	"""BCR, FOP, ZNF198, CEP1"""	"""MPD, NHL"""		"""Pfeiffer syndrome, Kallman syndrome"""																														Melanoma(146;1153 1840 21453 21841 43625)			Dom	yes		8	8p11.2-p11.1	2260	fibroblast growth factor receptor 1	yes	L	4	Substitution - Missense(4)	central_nervous_system(4)						ENSG00000077782						87.0	95.0	92.0					8																	38274849		2154	4289	6443	FGFR1	SO:0001583	missense	0			-	HGNC	M34185	CCDS6107.2, CCDS43730.1, CCDS43731.1, CCDS43732.1, CCDS55221.1, CCDS55222.1, CCDS55223.1	8p11.23-p11.22	2014-04-03	2008-08-01		ENSG00000077782	ENSG00000077782	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3688	protein-coding gene	gene with protein product	"""Pfeiffer syndrome"""	136350	"""fms-related tyrosine kinase 2"""	FLT2, KAL2		2162671	Standard	NM_015850		Approved	H2, H3, H4, H5, CEK, FLG, BFGFR, N-SAM, CD331	uc011lbu.2	P11362	OTTHUMG00000147366	ENST00000447712.2:c.1638C>A	8.37:g.38274849G>T	ENSP00000400162:p.Asn546Lys	Somatic	0	26	0.00		0.5912292923157907	1288	26.22	458	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	38	22.45	A8K6T9|A8K8V5|C1KBH8|P17049|Q02063|Q02065|Q14306|Q14307|Q53H63|Q59H40|Q5BJG2|Q8N685|Q9UD50|Q9UDF0|Q9UDF1|Q9UDF2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_FGF_rcpt_fam,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.N577K	ENST00000447712.2	37	c.1731	CCDS6107.2	8	.	.	.	.	.	.	.	.	.	.	G	23.4	4.406498	0.83230	.	.	ENSG00000077782	ENST00000397091;ENST00000425967;ENST00000447712;ENST00000341462;ENST00000310729;ENST00000532791;ENST00000397113;ENST00000356207;ENST00000335922;ENST00000326324;ENST00000397103;ENST00000397108	D;D;D;D;D;D;D;D;D;D;D	0.90620	-2.7;-2.7;-2.7;-2.7;-2.7;-2.7;-2.7;-2.7;-2.7;-2.7;-2.7	5.57	3.76	0.43208	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.87577	0.6212	N	0.04387	-0.21	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	D	0.88572	0.3130	10	0.87932	D	0	.	9.3132	0.37919	0.2169:0.0:0.7831:0.0	.	455;455;546;536;544	P11362-14;P11362-4;P11362;P11362-20;P11362-2	.;.;FGFR1_HUMAN;.;.	K	544;577;546;546;546;544;544;457;536;455;457;544	ENSP00000380280:N544K;ENSP00000393312:N577K;ENSP00000400162:N546K;ENSP00000340636:N546K;ENSP00000432972:N544K;ENSP00000380302:N544K;ENSP00000348537:N457K;ENSP00000337247:N536K;ENSP00000327229:N455K;ENSP00000380292:N457K;ENSP00000380297:N544K	ENSP00000311337:N546K	N	-	3	2	FGFR1	38394006	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.001000	0.40825	1.491000	0.48482	0.655000	0.94253	AAC	-	pirsf_FGF_rcpt_fam,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.542	FGFR1-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FGFR1	protein_coding		G		-		38274849	-1	no_errors	ENST00000425967	ensembl	human	known	74_37	missense	SNP	1.000	T
CCDC155	147872	genome.wustl.edu	37	19	49910870	49910870	+	Splice_Site	SNP	G	G	A	rs535323954		TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr19:49910870G>A	ENST00000447857.3	+	12	1140	c.935G>A	c.(934-936)cGc>cAc	p.R312H		NM_144688.4	NP_653289.3	Q8N6L0	KASH5_HUMAN	coiled-coil domain containing 155	312						chromosome, telomeric region (GO:0000781)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(2)|lung(10)|ovary(1)|stomach(1)	22						CTTTCCTAGCGCACTCGCGAT	0.642													g|||	1	0.000199681	0.0	0.0	5008	,	,		13852	0.0		0.0	False		,,,				2504	0.001																0								ENSG00000161609						38.0	42.0	41.0					19																	49910870		1948	4139	6087	CCDC155	SO:0001630	splice_region_variant	0			-	HGNC		CCDS46140.1	19q13.33	2014-01-21			ENSG00000161609	ENSG00000161609			26520	protein-coding gene	gene with protein product							Standard	NM_144688		Approved	FLJ32658, KASH5	uc002pnm.2	Q8N6L0	OTTHUMG00000183170	ENST00000447857.3:c.934-1G>A	19.37:g.49910870G>A		Somatic	0	112	0.00		0.5912292923157907	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	56	118	32.18	Q96MC3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.R312H	ENST00000447857.3	37	c.935	CCDS46140.1	19	.	.	.	.	.	.	.	.	.	.	g	18.09	3.545249	0.65198	.	.	ENSG00000161609	ENST00000447857	T	0.35789	1.29	4.83	4.83	0.62350	.	0.274240	0.30101	N	0.010402	T	0.59500	0.2198	M	0.75447	2.3	0.35404	D	0.791875	D;D	0.89917	1.0;1.0	D;D	0.87578	0.997;0.998	T	0.69606	-0.5100	10	0.56958	D	0.05	-18.8095	14.1996	0.65693	0.0:0.0:1.0:0.0	.	312;312	C9JGW3;Q8N6L0	.;CC155_HUMAN	H	312	ENSP00000404220:R312H	ENSP00000404220:R312H	R	+	2	0	CCDC155	54602682	0.991000	0.36638	0.996000	0.52242	0.351000	0.29236	2.029000	0.41098	2.636000	0.89361	0.645000	0.84053	CGC	-	NULL		0.642	CCDC155-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC155	protein_coding	OTTHUMT00000465436.2	G	NM_144688	-	Missense_Mutation	49910870	+1	no_errors	ENST00000447857	ensembl	human	known	74_37	missense	SNP	0.998	A
CTPS1	1503	genome.wustl.edu	37	1	41461588	41461588	+	Splice_Site	SNP	G	G	T			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr1:41461588G>T	ENST00000372621.4	+	8	1228		c.e8-1		CTPS1_ENST00000543104.1_Splice_Site|CTPS1_ENST00000372616.1_Splice_Site|CTPS1_ENST00000541520.1_Splice_Site	NM_001905.2	NP_001896.2			CTP synthase 1											endometrium(3)|lung(10)	13						TTTCTAAACAGGTGATCTGTG	0.388																																																	0								ENSG00000171793						88.0	93.0	91.0					1																	41461588		2203	4300	6503	CTPS1	SO:0001630	splice_region_variant	0			-	HGNC	BC009408	CCDS459.1	1p34.1	2012-05-02	2012-05-02	2012-05-02	ENSG00000171793	ENSG00000171793	6.3.4.2		2519	protein-coding gene	gene with protein product		123860	"""CTP synthase"""	CTPS		1783378	Standard	XM_005270536		Approved		uc001cgk.4	P17812	OTTHUMG00000005712	ENST00000372621.4:c.721-1G>T	1.37:g.41461588G>T		Somatic	0	46	0.00		0.5912292923157907	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70		Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e7-1	ENST00000372621.4	37	c.721-1	CCDS459.1	1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.982345	0.74474	.	.	ENSG00000171793	ENST00000372621;ENST00000541520;ENST00000543104;ENST00000372616	.	.	.	5.39	5.39	0.77823	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.718	0.88343	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CTPS	41234175	1.000000	0.71417	0.999000	0.59377	0.947000	0.59692	9.450000	0.97607	2.521000	0.84997	0.563000	0.77884	.	-	-		0.388	CTPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTPS1	protein_coding	OTTHUMT00000015629.1	G	NM_001905	-	Intron	41461588	+1	no_errors	ENST00000372616	ensembl	human	known	74_37	splice_site	SNP	1.000	T
IFITM3	10410	genome.wustl.edu	37	11	320723	320723	+	Missense_Mutation	SNP	C	C	T	rs199582787	byFrequency	TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr11:320723C>T	ENST00000399808.4	-	1	327	c.91G>A	c.(91-93)Gtg>Atg	p.V31M	IFITM3_ENST00000526811.1_Missense_Mutation_p.V10M|RP11-326C3.11_ENST00000602429.1_RNA|RP11-326C3.10_ENST00000534271.1_RNA|RP11-326C3.11_ENST00000508004.2_RNA|RP11-326C3.14_ENST00000602809.1_lincRNA|RP11-326C3.11_ENST00000602756.1_RNA|IFITM3_ENST00000602735.1_Missense_Mutation_p.V10M	NM_021034.2	NP_066362.2	Q01628	IFM3_HUMAN	interferon induced transmembrane protein 3	31					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|immune response (GO:0006955)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral genome replication (GO:0045071)|negative regulation of viral transcription (GO:0032897)|response to interferon-alpha (GO:0035455)|response to interferon-beta (GO:0035456)|response to interferon-gamma (GO:0034341)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)				central_nervous_system(7)|endometrium(7)|kidney(2)|large_intestine(1)|lung(1)	18		all_cancers(49;2e-09)|all_epithelial(84;3.36e-06)|Breast(177;0.000162)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;8.85e-28)|Epithelial(43;5.52e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0327)|LUSC - Lung squamous cell carcinoma(625;0.122)		GCCCCCAGCACAGCCACCTCG	0.612																																																	0								ENSG00000142089						87.0	98.0	95.0					11																	320723		1967	4140	6107	IFITM3	SO:0001583	missense	0			-	HGNC	X57352	CCDS41585.1	11p15.5	2011-05-24	2011-05-24		ENSG00000142089	ENSG00000142089			5414	protein-coding gene	gene with protein product		605579	"""interferon induced transmembrane protein 3 (1-8U)"""			1906403, 16326387	Standard	NM_021034		Approved	1-8U	uc001lpa.2	Q01628		ENST00000399808.4:c.91G>A	11.37:g.320723C>T	ENSP00000382707:p.Val31Met	Somatic	0	63	0.00		0.5912292923157907	1270	4.57	61	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	42	17.65	Q53Y76|Q96HK8|Q96J15	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_CD225/Dispanin_fam	p.V31M	ENST00000399808.4	37	c.91	CCDS41585.1	11	.	.	.	.	.	.	.	.	.	.	C	11.06	1.526447	0.27299	.	.	ENSG00000142089	ENST00000399808;ENST00000270031;ENST00000526811	T;T	0.79454	-1.03;-1.27	4.61	-4.91	0.03085	.	11.488500	0.02440	N	0.084490	T	0.64516	0.2605	L	0.39147	1.195	0.09310	N	1	B	0.16802	0.019	B	0.15484	0.013	T	0.46400	-0.9194	10	0.13108	T	0.6	0.9022	6.4601	0.21952	0.1231:0.361:0.0:0.5159	.	31	Q01628	IFM3_HUMAN	M	31;15;10	ENSP00000382707:V31M;ENSP00000432108:V10M	ENSP00000372047:V15M	V	-	1	0	IFITM3	310723	0.000000	0.05858	0.000000	0.03702	0.034000	0.12701	-1.638000	0.02013	-0.562000	0.06086	-1.790000	0.00627	GTG	-	NULL		0.612	IFITM3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	IFITM3	protein_coding	OTTHUMT00000384765.1	C	NM_021034	rs199582787		320723	-1	no_errors	ENST00000399808	ensembl	human	known	74_37	missense	SNP	0.000	T
DENND4C	55667	genome.wustl.edu	37	9	19371794	19371794	+	Missense_Mutation	SNP	C	C	A			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr9:19371794C>A	ENST00000380432.2	+	27	4894	c.4861C>A	c.(4861-4863)Cta>Ata	p.L1621I	RP11-513M16.7_ENST00000609609.1_RNA|DENND4C_ENST00000602925.1_Missense_Mutation_p.L1857I|DENND4C_ENST00000434457.2_Missense_Mutation_p.L1906I			Q5VZ89	DEN4C_HUMAN	DENN/MADD domain containing 4C	1621					cellular response to insulin stimulus (GO:0032869)|positive regulation of Rab GTPase activity (GO:0032851)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)	cytosol (GO:0005829)|insulin-responsive compartment (GO:0032593)|plasma membrane (GO:0005886)|retromer complex (GO:0030904)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|endometrium(8)|kidney(1)|large_intestine(7)|liver(2)|lung(13)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40						ATTAGTGTCTCTAGGAAGAGA	0.264																																																	0								ENSG00000137145						56.0	63.0	61.0					9																	19371794		2193	4273	6466	DENND4C	SO:0001583	missense	0			-	HGNC	AK000693	CCDS6491.2, CCDS6491.3	9p22.1	2012-10-03	2006-01-27	2006-01-27	ENSG00000137145	ENSG00000137145		"""DENN/MADD domain containing"""	26079	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 55B"", ""chromosome 9 open reading frame 55"""	C9orf55B, C9orf55		12906859	Standard	NM_017925		Approved	FLJ20686, bA513M16.3	uc031tcw.1	Q5VZ89	OTTHUMG00000019627	ENST00000380432.2:c.4861C>A	9.37:g.19371794C>A	ENSP00000369797:p.Leu1621Ile	Somatic	0	52	0.00		0.5912292923157907	24	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	A2A3R1|A2A3R2|A2A3R3|A2A3R9|Q6AI48|Q6ZUB3|Q8NCY7|Q9H6N4|Q9NUT1|Q9NWA5|Q9NWT3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DENN_dom,pfam_dDENN_dom,pfam_uDENN_dom,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom	p.L1857I	ENST00000380432.2	37	c.5569		9	.	.	.	.	.	.	.	.	.	.	C	22.3	4.276081	0.80580	.	.	ENSG00000137145	ENST00000380437;ENST00000307015;ENST00000540671;ENST00000380432;ENST00000361024	T;T	0.34275	1.38;1.37	5.37	5.37	0.77165	.	0.144445	0.45126	D	0.000395	T	0.57242	0.2040	L	0.53561	1.675	0.47153	D	0.999332	D;D	0.89917	1.0;0.999	D;D	0.85130	0.997;0.991	T	0.52873	-0.8517	9	.	.	.	-16.902	19.0971	0.93257	0.0:1.0:0.0:0.0	.	951;1621	B7Z660;Q5VZ89	.;DEN4C_HUMAN	I	1621;1094;951;1094;618	ENSP00000305795:L1094I;ENSP00000443804:L951I	.	L	+	1	2	DENND4C	19361794	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.012000	0.57131	2.494000	0.84150	0.655000	0.94253	CTA	-	NULL		0.264	DENND4C-201	KNOWN	basic	protein_coding	DENND4C	protein_coding		C	NM_017925	-		19371794	+1	no_errors	ENST00000602925	ensembl	human	known	74_37	missense	SNP	1.000	A
METTL12	751071	genome.wustl.edu	37	11	62434093	62434093	+	Missense_Mutation	SNP	C	C	A			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr11:62434093C>A	ENST00000532971.1	+	3	550	c.293C>A	c.(292-294)cCa>cAa	p.P98Q	C11orf48_ENST00000532208.1_Intron|SNORA57_ENST00000383870.1_RNA|C11orf48_ENST00000354588.3_Intron|RP11-831H9.11_ENST00000528405.1_5'Flank|C11orf48_ENST00000524958.1_5'Flank|C11orf48_ENST00000525675.1_5'Flank|C11orf48_ENST00000431002.2_Intron|METTL12_ENST00000398922.2_3'UTR	NM_001043229.1	NP_001036694.1	A8MUP2	MET12_HUMAN	methyltransferase like 12	98						mitochondrion (GO:0005739)	methyltransferase activity (GO:0008168)			endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|urinary_tract(1)	6						ACCAAATCTCCACACCCAGTG	0.597																																																	0								ENSG00000214756						57.0	63.0	61.0					11																	62434093		1954	4139	6093	METTL12	SO:0001583	missense	0			-	HGNC	BC041359	CCDS41657.1	11q12.3	2013-09-30			ENSG00000214756	ENSG00000214756			33113	protein-coding gene	gene with protein product							Standard	NM_001043229		Approved	U99HG	uc001nuh.3	A8MUP2	OTTHUMG00000167545	ENST00000532971.1:c.293C>A	11.37:g.62434093C>A	ENSP00000431287:p.Pro98Gln	Somatic	0	36	0.00		0.5912292923157907	4	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70	B7Z4C1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Methyltransf_11	p.P98Q	ENST00000532971.1	37	c.293	CCDS41657.1	11	.	.	.	.	.	.	.	.	.	.	C	18.85	3.712328	0.68730	.	.	ENSG00000214756	ENST00000532971	T	0.52983	0.64	4.5	4.5	0.54988	Methyltransferase type 11 (1);	0.103466	0.37530	U	0.002048	T	0.67618	0.2912	M	0.79475	2.455	0.34396	D	0.694715	D	0.76494	0.999	D	0.75484	0.986	T	0.75221	-0.3394	10	0.35671	T	0.21	-11.3642	15.1079	0.72334	0.0:1.0:0.0:0.0	.	98	A8MUP2	MTL12_HUMAN	Q	98	ENSP00000431287:P98Q	ENSP00000431287:P98Q	P	+	2	0	METTL12	62190669	0.083000	0.21467	0.974000	0.42286	0.994000	0.84299	2.696000	0.47052	2.503000	0.84419	0.655000	0.94253	CCA	-	pfam_Methyltransf_11		0.597	METTL12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	METTL12	protein_coding	OTTHUMT00000394990.1	C	NM_001043229	-		62434093	+1	no_errors	ENST00000532971	ensembl	human	known	74_37	missense	SNP	0.977	A
DLGAP3	58512	genome.wustl.edu	37	1	35351792	35351792	+	Missense_Mutation	SNP	C	C	T			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr1:35351792C>T	ENST00000373347.1	-	6	1749	c.1481G>A	c.(1480-1482)gGc>gAc	p.G494D	DLGAP3_ENST00000235180.4_Missense_Mutation_p.G494D			O95886	DLGP3_HUMAN	discs, large (Drosophila) homolog-associated protein 3	494					cell-cell signaling (GO:0007267)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)	beta-amyloid binding (GO:0001540)			central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(23)|ovary(4)|prostate(3)|skin(3)|urinary_tract(1)	46		Myeloproliferative disorder(586;0.0393)				GCGGAAACAGCCGGGCAGGTC	0.687																																																	0								ENSG00000116544						17.0	21.0	19.0					1																	35351792		2199	4296	6495	DLGAP3	SO:0001583	missense	0			-	HGNC	AF131778	CCDS30670.1	1p35.3-p34.1	2008-02-05			ENSG00000116544	ENSG00000116544			30368	protein-coding gene	gene with protein product		611413				8619474, 9110174	Standard	NM_001080418		Approved	SAPAP3, DAP3	uc001byc.3	O95886	OTTHUMG00000004049	ENST00000373347.1:c.1481G>A	1.37:g.35351792C>T	ENSP00000362444:p.Gly494Asp	Somatic	0	42	0.00		0.5912292923157907	7	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	14	17.65	Q5TDD5|Q9H3X7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GKAP	p.G494D	ENST00000373347.1	37	c.1481	CCDS30670.1	1	.	.	.	.	.	.	.	.	.	.	C	35	5.440685	0.96168	.	.	ENSG00000116544	ENST00000373347;ENST00000235180	D;D	0.88586	-2.4;-2.4	5.05	5.05	0.67936	.	0.000000	0.85682	D	0.000000	D	0.93897	0.8047	M	0.78456	2.415	0.80722	D	1	D	0.71674	0.998	P	0.61874	0.895	D	0.94503	0.7711	10	0.87932	D	0	-19.7087	18.6083	0.91275	0.0:1.0:0.0:0.0	.	494	O95886	DLGP3_HUMAN	D	494	ENSP00000362444:G494D;ENSP00000235180:G494D	ENSP00000235180:G494D	G	-	2	0	DLGAP3	35124379	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.872000	0.69636	2.625000	0.88918	0.555000	0.69702	GGC	-	NULL		0.687	DLGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DLGAP3	protein_coding	OTTHUMT00000011554.1	C	NM_021234	-		35351792	-1	no_errors	ENST00000235180	ensembl	human	known	74_37	missense	SNP	1.000	T
SLC1A6	6511	genome.wustl.edu	37	19	15082594	15082594	+	Missense_Mutation	SNP	G	G	T			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr19:15082594G>T	ENST00000221742.3	-	2	305	c.298C>A	c.(298-300)Ctg>Atg	p.L100M	SLC1A6_ENST00000598504.1_Missense_Mutation_p.L100M|SLC1A6_ENST00000544886.2_Missense_Mutation_p.L100M|SLC1A6_ENST00000600144.1_Missense_Mutation_p.L100M|SLC1A6_ENST00000430939.2_Missense_Mutation_p.A104D	NM_005071.1	NP_005062.1	P48664	EAA4_HUMAN	solute carrier family 1 (high affinity aspartate/glutamate transporter), member 6	100					aspartate transport (GO:0015810)|ion transport (GO:0006811)|L-glutamate transport (GO:0015813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	L-aspartate transmembrane transporter activity (GO:0015183)|L-glutamate transmembrane transporter activity (GO:0005313)|sodium:dicarboxylate symporter activity (GO:0017153)			breast(1)|central_nervous_system(2)|endometrium(6)|large_intestine(8)|liver(1)|lung(12)|ovary(3)|pancreas(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	42						AGCATCTGCAGCATCCTCATC	0.577																																																	0								ENSG00000105143						147.0	125.0	133.0					19																	15082594		2203	4300	6503	SLC1A6	SO:0001583	missense	0			-	HGNC		CCDS12321.1, CCDS62578.1	19p13.12	2013-07-15			ENSG00000105143	ENSG00000105143		"""Solute carriers"""	10944	protein-coding gene	gene with protein product		600637				7791878	Standard	NM_005071		Approved	EAAT4	uc002naa.2	P48664	OTTHUMG00000183351	ENST00000221742.3:c.298C>A	19.37:g.15082594G>T	ENSP00000221742:p.Leu100Met	Somatic	0	71	0.00		0.5912292923157907	10	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	Q8N753	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Na-dicarboxylate_symporter,prints_Na-dicarboxylate_symporter	p.L100M	ENST00000221742.3	37	c.298	CCDS12321.1	19	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.84|17.84	3.488119|3.488119	0.64074|0.64074	.|.	.|.	ENSG00000105143|ENSG00000105143	ENST00000430939|ENST00000221742;ENST00000544886;ENST00000542610	T|T;T	0.73047|0.70399	-0.71|-0.48;-0.48	4.02|4.02	1.81|1.81	0.25067|0.25067	.|Sodium:dicarboxylate symporter, conserved site (1);	.|0.000000	.|0.64402	.|D	.|0.000003	T|T	0.81814|0.81814	0.4902|0.4902	M|M	0.82433|0.82433	2.59|2.59	0.48511|0.48511	D|D	0.99966|0.99966	P|D;D;D	0.44429|0.89917	0.835|1.0;1.0;1.0	B|D;D;D	0.42245|0.87578	0.381|0.994;0.998;0.997	T|T	0.81788|0.81788	-0.0772|-0.0772	9|10	0.31617|0.87932	T|D	0.26|0	-10.7462|-10.7462	8.2377|8.2377	0.31636|0.31636	0.2087:0.0:0.7913:0.0|0.2087:0.0:0.7913:0.0	.|.	104|100;101;100	E7EV13|Q8N753;Q59GB0;P48664	.|.;.;EAA4_HUMAN	D|M	104|100;100;101	ENSP00000409386:A104D|ENSP00000221742:L100M;ENSP00000446175:L100M	ENSP00000409386:A104D|ENSP00000221742:L100M	A|L	-|-	2|1	0|2	SLC1A6|SLC1A6	14943594|14943594	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	2.981000|2.981000	0.49329|0.49329	0.904000|0.904000	0.36572|0.36572	0.561000|0.561000	0.74099|0.74099	GCT|CTG	-	pfam_Na-dicarboxylate_symporter,prints_Na-dicarboxylate_symporter		0.577	SLC1A6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLC1A6	protein_coding	OTTHUMT00000466283.1	G	NM_005071	-		15082594	-1	no_errors	ENST00000221742	ensembl	human	known	74_37	missense	SNP	1.000	T
KCNH7	90134	genome.wustl.edu	37	2	163256864	163256864	+	Missense_Mutation	SNP	C	C	A			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr2:163256864C>A	ENST00000332142.5	-	10	2341	c.2242G>T	c.(2242-2244)Ggg>Tgg	p.G748W		NM_033272.3	NP_150375.2	Q9NS40	KCNH7_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 7	748					circadian rhythm (GO:0007623)|potassium ion transmembrane transport (GO:0071805)|protein heterooligomerization (GO:0051291)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)|signal transducer activity (GO:0004871)|voltage-gated potassium channel activity (GO:0005249)	p.G748W(1)		NS(1)|biliary_tract(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(22)|lung(53)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	108					Doxazosin(DB00590)|Ibutilide(DB00308)|Miconazole(DB01110)|Prazosin(DB00457)|Terazosin(DB01162)	TTACTTGCCCCCCGAAAGGCT	0.483																																					GBM(196;1492 2208 17507 24132 45496)												1	Substitution - Missense(1)	lung(1)						ENSG00000184611						131.0	134.0	133.0					2																	163256864		2203	4300	6503	KCNH7	SO:0001583	missense	0			-	HGNC	AF032897	CCDS2219.1, CCDS2220.1	2q24.3	2012-07-05			ENSG00000184611	ENSG00000184611		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18863	protein-coding gene	gene with protein product		608169				16382104	Standard	NM_173162		Approved	Kv11.3, HERG3, erg3	uc002uch.2	Q9NS40	OTTHUMG00000132069	ENST00000332142.5:c.2242G>T	2.37:g.163256864C>A	ENSP00000331727:p.Gly748Trp	Somatic	0	45	0.00		0.5912292923157907	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	66	8.33	Q53QU4|Q53TB7|Q53TP9|Q8IV15	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_cNMP-bd_dom,pfam_2pore_dom_K_chnl_dom,pfam_PAS_fold_3,superfamily_cNMP-bd-like,superfamily_PAS,smart_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG/ELK/ERG,prints_K_chnl_volt-dep_ERG,pfscan_cNMP-bd_dom,tigrfam_PAS	p.G748W	ENST00000332142.5	37	c.2242	CCDS2219.1	2	.	.	.	.	.	.	.	.	.	.	C	24.1	4.498798	0.85069	.	.	ENSG00000184611	ENST00000332142	D	0.97066	-4.23	5.47	5.47	0.80525	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (2);	0.000000	0.85682	D	0.000000	D	0.98216	0.9410	M	0.72479	2.2	0.80722	D	1	D	0.71674	0.998	D	0.71184	0.972	D	0.99087	1.0839	10	0.72032	D	0.01	.	19.333	0.94299	0.0:1.0:0.0:0.0	.	748	Q9NS40	KCNH7_HUMAN	W	748	ENSP00000331727:G748W	ENSP00000331727:G748W	G	-	1	0	KCNH7	162965110	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.807000	0.86032	2.571000	0.86741	0.591000	0.81541	GGG	-	superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom		0.483	KCNH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNH7	protein_coding	OTTHUMT00000255093.1	C	NM_033272	-		163256864	-1	no_errors	ENST00000332142	ensembl	human	known	74_37	missense	SNP	1.000	A
C2orf72	257407	genome.wustl.edu	37	2	231911630	231911630	+	Missense_Mutation	SNP	T	T	A			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr2:231911630T>A	ENST00000373640.4	+	3	858	c.782T>A	c.(781-783)cTa>cAa	p.L261Q	C2orf72_ENST00000477463.1_3'UTR	NM_001144994.1	NP_001138466.1	A6NCS6	CB072_HUMAN	chromosome 2 open reading frame 72	261																	GAGCTGCCACTAACAGCCATA	0.498																																																	0								ENSG00000204128						60.0	62.0	61.0					2																	231911630		692	1591	2283	C2orf72	SO:0001583	missense	0			-	HGNC		CCDS46539.1	2q37.1	2012-08-06			ENSG00000204128	ENSG00000204128			27418	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_001144994		Approved	LOC257407	uc002vrl.4	A6NCS6	OTTHUMG00000153996	ENST00000373640.4:c.782T>A	2.37:g.231911630T>A	ENSP00000362743:p.Leu261Gln	Somatic	0	86	0.00		0.5912292923157907	11	35.29	6	WXS	Illumina HiSeq 2500	Phase_IV	tier1	34	103	24.82		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.L261Q	ENST00000373640.4	37	c.782	CCDS46539.1	2	.	.	.	.	.	.	.	.	.	.	T	13.67	2.306099	0.40795	.	.	ENSG00000204128	ENST00000373640	.	.	.	5.27	5.27	0.74061	.	0.000000	0.29783	N	0.011201	T	0.68888	0.3050	M	0.65498	2.005	0.33475	D	0.586642	D	0.89917	1.0	D	0.91635	0.999	T	0.78909	-0.2018	9	0.87932	D	0	-13.9458	11.5054	0.50463	0.0:0.0:0.0:1.0	.	261	A6NCS6	CB072_HUMAN	Q	261	.	ENSP00000362743:L261Q	L	+	2	0	C2orf72	231619874	1.000000	0.71417	0.337000	0.25536	0.009000	0.06853	3.785000	0.55424	2.203000	0.70933	0.460000	0.39030	CTA	-	NULL		0.498	C2orf72-003	PUTATIVE	basic|appris_principal|CCDS	protein_coding	C2orf72	protein_coding	OTTHUMT00000333376.2	T	NM_001144994	-		231911630	+1	no_errors	ENST00000373640	ensembl	human	putative	74_37	missense	SNP	0.873	A
SCGB1C1	147199	genome.wustl.edu	37	11	194424	194424	+	Missense_Mutation	SNP	G	G	A			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr11:194424G>A	ENST00000342878.2	+	3	282	c.262G>A	c.(262-264)Gtg>Atg	p.V88M	ODF3_ENST00000525282.1_5'Flank|ODF3_ENST00000342593.5_5'Flank|ODF3_ENST00000325113.4_5'Flank|BET1L_ENST00000410108.1_Intron	NM_145651.2	NP_663626.2	Q8TD33	SG1C1_HUMAN	secretoglobin, family 1C, member 1	88						extracellular region (GO:0005576)				endometrium(1)|liver(2)|lung(1)|skin(1)	5		all_cancers(49;1.58e-09)|all_epithelial(84;2.71e-06)|Breast(177;0.000162)|Ovarian(85;0.000626)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;3.95e-27)|Epithelial(43;2.66e-26)|OV - Ovarian serous cystadenocarcinoma(40;5.55e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.105)|LUSC - Lung squamous cell carcinoma(625;0.122)		CCAGGTGCAAGTGCTGGGCAG	0.602																																																	0								ENSG00000188076						157.0	163.0	161.0					11																	194424		2158	4256	6414	SCGB1C1	SO:0001583	missense	0			-	HGNC	AY026938	CCDS41581.1	11p15.5	2011-12-14			ENSG00000188076	ENSG00000188076		"""Secretoglobins"""	18394	protein-coding gene	gene with protein product		610176				22155607	Standard	NM_145651		Approved	RYD5	uc001loa.1	Q8TD33	OTTHUMG00000165539	ENST00000342878.2:c.262G>A	11.37:g.194424G>A	ENSP00000344545:p.Val88Met	Somatic	0	101	0.00		0.5912292923157907	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	75	12.79	A8MSI9|Q14DW0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Secretoglobin,superfamily_Secretoglobin	p.V88M	ENST00000342878.2	37	c.262	CCDS41581.1	11	.	.	.	.	.	.	.	.	.	.	.	13.63	2.294603	0.40594	.	.	ENSG00000188076	ENST00000342878	T	0.19394	2.15	4.14	4.14	0.48551	.	0.105822	0.41712	D	0.000833	T	0.43590	0.1254	.	.	.	0.32908	D	0.51415	D	0.76494	0.999	D	0.91635	0.999	T	0.55945	-0.8060	9	0.72032	D	0.01	-48.5404	12.2031	0.54337	0.0:0.0:1.0:0.0	.	88	Q8TD33	SG1C1_HUMAN	M	88	ENSP00000344545:V88M	ENSP00000344545:V88M	V	+	1	0	SCGB1C1	184424	1.000000	0.71417	1.000000	0.80357	0.071000	0.16799	3.182000	0.50910	2.604000	0.88044	0.491000	0.48974	GTG	-	pfam_Secretoglobin,superfamily_Secretoglobin		0.602	SCGB1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCGB1C1	protein_coding	OTTHUMT00000384759.1	G	NM_145651	-		194424	+1	no_errors	ENST00000342878	ensembl	human	known	74_37	missense	SNP	1.000	A
CLDN24	100132463	genome.wustl.edu	37	4	184243010	184243010	+	Silent	SNP	G	G	A			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr4:184243010G>A	ENST00000541814.1	-	1	569	c.570C>T	c.(568-570)agC>agT	p.S190S	CLDN22_ENST00000323319.5_5'Flank	NM_001185149.1	NP_001172078.1	A6NM45	CLD24_HUMAN	claudin 24	190						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	structural molecule activity (GO:0005198)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(1)	4						GGGGAGCGTGGCTGGAGCAGG	0.577																																																	0								ENSG00000185758																																			CLDN24	SO:0001819	synonymous_variant	0			-	HGNC		CCDS54824.1	4q35.1	2012-07-05			ENSG00000185758	ENSG00000185758			37200	protein-coding gene	gene with protein product			"""claudin 21"""	CLDN21		12736707	Standard	NM_001185149		Approved		uc021xva.1	A6NM45	OTTHUMG00000160628	ENST00000541814.1:c.570C>T	4.37:g.184243010G>A		Somatic	0	27	0.00		0.5912292923157907	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	30	11.76	F5H040	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_PMP22/EMP/MP20/Claudin,prints_Claudin	p.S190	ENST00000541814.1	37	c.570	CCDS54824.1	4																																																																																			-	NULL		0.577	CLDN24-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CLDN24	protein_coding		G	XM_001714660	-		184243010	-1	no_errors	ENST00000541814	ensembl	human	known	74_37	silent	SNP	0.000	A
MT-ATP6	4508	genome.wustl.edu	37	M	8714	8714	+	Missense_Mutation	SNP	C	C	A			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chrM:8714C>A	ENST00000361899.2	+	1	188	c.188C>A	c.(187-189)aCt>aAt	p.T63N	MT-TK_ENST00000387421.1_RNA|MT-TG_ENST00000387429.1_RNA|MT-TC_ENST00000387405.1_RNA|MT-ND4L_ENST00000361335.1_5'Flank|MT-ND3_ENST00000361227.2_5'Flank|MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TR_ENST00000387439.1_RNA|MT-ND4_ENST00000361381.2_5'Flank|MT-TS1_ENST00000387416.2_RNA|MT-CO3_ENST00000362079.2_5'Flank|MT-TD_ENST00000387419.1_RNA			P00846	ATP6_HUMAN	mitochondrially encoded ATP synthase 6	63					ATP catabolic process (GO:0006200)|cellular metabolic process (GO:0044237)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|proton-transporting ATP synthase complex, coupling factor F(o) (GO:0045263)	hydrogen ion transmembrane transporter activity (GO:0015078)|transmembrane transporter activity (GO:0022857)			breast(2)|endometrium(7)|kidney(8)|prostate(1)	18						CATACACAACACTAAAGGACG	0.403																																																	0								ENSG00000198899																																			MT-ATP6	SO:0001583	missense	0			-	HGNC			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198899	ENSG00000198899		"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	7414	protein-coding gene	gene with protein product		516060	"""ATP synthase 6"", ""spicular retinitis pigmentosa with dementia, seizures, ataxia, proximal muscle weakness and sensory deficit"""	MTATP6, RP		7219534	Standard			Approved	ATP6, ATPase-6, Su6m		P00846		ENST00000361899.2:c.188C>A	M.37:g.8714C>A	ENSP00000354632:p.Thr63Asn	Somatic	0	46	0.00		0.5912292923157907	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	9	18.18	Q34772|Q5S8W5|Q5S9E7|Q5S9I6|Q5SA31|Q6RPB7|Q6VHC0|Q6VHE0|Q6WQF4|Q7YCC1|Q7YCF8|Q7YCG1|Q85KU8|Q85KX1|Q85L05|Q8HNQ4|Q8HNQ8|Q8WCX6|Q9B2U5|Q9B2Z2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ATPase_F0-cplx_asu,superfamily_ATPase_F0-cplx_asu,prints_ATPase_F0-cplx_asu,tigrfam_ATPase_F0-cplx_asu	p.T63N	ENST00000361899.2	37	c.188		MT																																																																																			-	pfam_ATPase_F0-cplx_asu,superfamily_ATPase_F0-cplx_asu,tigrfam_ATPase_F0-cplx_asu		0.403	MT-ATP6-201	KNOWN	basic|appris_principal	protein_coding	MT-ATP6	protein_coding		C	YP_003024031	-		8714	+1	no_errors	ENST00000361899	ensembl	human	known	74_37	missense	SNP	NULL	A
LCP1	3936	genome.wustl.edu	37	13	46717443	46717443	+	Silent	SNP	C	C	T			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr13:46717443C>T	ENST00000398576.2	-	15	1738	c.1350G>A	c.(1348-1350)ctG>ctA	p.L450L	LCP1_ENST00000323076.2_Silent_p.L450L|LCP1_ENST00000435666.2_5'Flank			P13796	PLSL_HUMAN	lymphocyte cytosolic protein 1 (L-plastin)	450	Actin-binding 2.|CH 3. {ECO:0000255|PROSITE- ProRule:PRU00044}.				actin filament bundle assembly (GO:0051017)|cell migration (GO:0016477)|organ regeneration (GO:0031100)|protein kinase A signaling (GO:0010737)|regulation of intracellular protein transport (GO:0033157)|T cell activation involved in immune response (GO:0002286)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|actin filament bundle (GO:0032432)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)			breast(2)|kidney(1)|large_intestine(6)|lung(18)|ovary(4)|prostate(2)|skin(1)	34		Lung NSC(96;1.27e-05)|Breast(56;8.04e-05)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;5.39e-05)		TATTGCCTCCCAGTTTGGGGT	0.438			T	BCL6	NHL																																			Dom	yes		13	13q14.1-q14.3	3936	lymphocyte cytosolic protein 1 (L-plastin)		L	0								ENSG00000136167						179.0	146.0	157.0					13																	46717443		2203	4300	6503	LCP1	SO:0001819	synonymous_variant	0			-	HGNC	M22300	CCDS9403.1	13q14.3	2013-01-10			ENSG00000136167	ENSG00000136167		"""EF-hand domain containing"""	6528	protein-coding gene	gene with protein product	"""plastin 2"""	153430				2111166	Standard	NM_002298		Approved	PLS2, CP64, L-PLASTIN, LC64P	uc001vba.4	P13796	OTTHUMG00000016864	ENST00000398576.2:c.1350G>A	13.37:g.46717443C>T		Somatic	0	89	0.00		0.5912292923157907	17	15.00	3	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	94	23.58	B2R613|B4DUA0|Q5TBN4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_CH-domain,pfam_EF_hand_dom,pfam_CAMSAP_CH,superfamily_CH-domain,smart_EF_hand_dom,smart_CH-domain,pfscan_CH-domain,pfscan_EF_hand_dom	p.L450	ENST00000398576.2	37	c.1350	CCDS9403.1	13																																																																																			-	pfam_CH-domain,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain		0.438	LCP1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	LCP1	protein_coding	OTTHUMT00000044800.3	C	NM_002298	-		46717443	-1	no_errors	ENST00000323076	ensembl	human	known	74_37	silent	SNP	1.000	T
DCHS1	8642	genome.wustl.edu	37	11	6662445	6662445	+	Missense_Mutation	SNP	C	C	A			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr11:6662445C>A	ENST00000299441.3	-	2	811	c.400G>T	c.(400-402)Gct>Tct	p.A134S		NM_003737.2	NP_003728.1	Q96JQ0	PCD16_HUMAN	dachsous cadherin-related 1	134	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(16)|liver(1)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	103		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TTGATGTCAGCCACTCGCACT	0.617																																																	0								ENSG00000166341						88.0	60.0	69.0					11																	6662445		2201	4296	6497	DCHS1	SO:0001583	missense	0			-	HGNC	AB000895	CCDS7771.1	11p15.4	2013-10-04	2013-10-04	2004-09-03	ENSG00000166341	ENSG00000166341		"""Cadherins / Cadherin-related"""	13681	protein-coding gene	gene with protein product	"""cadherin-related family member 6"""	603057	"""protocadherin 16"", ""dachsous 1 (Drosophila)"""	CDH25, PCDH16		9199196	Standard	XM_005253207		Approved	FIB1, KIAA1773, FLJ11790, CDHR6	uc001mem.1	Q96JQ0	OTTHUMG00000133398	ENST00000299441.3:c.400G>T	11.37:g.6662445C>A	ENSP00000299441:p.Ala134Ser	Somatic	0	43	0.00		0.5912292923157907	28	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	O15098	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.A134S	ENST00000299441.3	37	c.400	CCDS7771.1	11	.	.	.	.	.	.	.	.	.	.	C	9.888	1.203407	0.22121	.	.	ENSG00000166341	ENST00000299441	T	0.37752	1.18	5.41	3.54	0.40534	Cadherin (3);Cadherin conserved site (1);Cadherin-like (1);	0.146701	0.31438	N	0.007655	T	0.25269	0.0614	N	0.03948	-0.315	0.25003	N	0.99145	D	0.53312	0.959	P	0.61070	0.883	T	0.14615	-1.0466	10	0.09338	T	0.73	.	8.1618	0.31202	0.0:0.7511:0.0:0.2489	.	134	Q96JQ0	PCD16_HUMAN	S	134	ENSP00000299441:A134S	ENSP00000299441:A134S	A	-	1	0	DCHS1	6619021	0.976000	0.34144	1.000000	0.80357	0.986000	0.74619	2.064000	0.41432	1.290000	0.44636	-0.148000	0.13756	GCT	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.617	DCHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCHS1	protein_coding	OTTHUMT00000257258.1	C	NM_003737	-		6662445	-1	no_errors	ENST00000299441	ensembl	human	known	74_37	missense	SNP	0.990	A
NTM	50863	genome.wustl.edu	37	11	132205623	132205624	+	3'UTR	INS	-	-	T	rs111313978		TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr11:132205623_132205624insT	ENST00000374786.1	+	0	2097_2098				NTM_ENST00000474900.1_3'UTR|NTM_ENST00000374791.3_3'UTR	NM_001144058.1|NM_016522.2	NP_001137530.1|NP_057606.1	Q9P121	NTRI_HUMAN	neurotrimin						cell adhesion (GO:0007155)|neuron recognition (GO:0008038)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(4)|large_intestine(9)|lung(30)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	56						TACCGTTAAACTTTTTTTTTTT	0.292																																																	0								ENSG00000182667																																			NTM	SO:0001624	3_prime_UTR_variant	0				HGNC	AF126426	CCDS8491.1, CCDS41733.1, CCDS44777.1, CCDS44778.1	11q25	2013-01-11			ENSG00000182667	ENSG00000182667		"""Immunoglobulin superfamily / I-set domain containing"""	17941	protein-coding gene	gene with protein product	"""neurotrimin"", ""IgLON family member 2"""	607938				7891157	Standard	NM_001048209		Approved	HNT, NTRI, IGLON2	uc001qgq.3	Q9P121	OTTHUMG00000066364	ENST00000374786.1:c.*584->T	11.37:g.132205634_132205634dupT		Somatic	0	13	0.00		0.5912292923157907	16	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	10	33.33	A0MTT2|Q6UXJ3|Q86VJ9	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000374786.1	37	NULL	CCDS8491.1	11																																																																																			-	-		0.292	NTM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NTM	protein_coding	OTTHUMT00000141937.1	-	NM_016522			132205624	+1	no_errors	ENST00000474900	ensembl	human	known	74_37	rna	INS	0.000:0.000	T
AK5	26289	genome.wustl.edu	37	1	77857120	77857125	+	Intron	DEL	ATATAC	ATATAC	-	rs59295145|rs150964634	byFrequency	TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	ATATAC	ATATAC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr1:77857120_77857125delATATAC	ENST00000354567.2	+	7	1154				AK5_ENST00000344720.5_Intron|AC095030.1_ENST00000408737.1_RNA	NM_174858.2	NP_777283.1	Q9Y6K8	KAD5_HUMAN	adenylate kinase 5						ADP biosynthetic process (GO:0006172)|ATP metabolic process (GO:0046034)|dADP biosynthetic process (GO:0006173)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleoside diphosphate phosphorylation (GO:0006165)|nucleoside triphosphate biosynthetic process (GO:0009142)|pyrimidine ribonucleotide biosynthetic process (GO:0009220)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule organizing center (GO:0005815)	adenylate kinase activity (GO:0004017)|ATP binding (GO:0005524)|nucleoside diphosphate kinase activity (GO:0004550)|nucleoside kinase activity (GO:0019206)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(27)|prostate(1)|skin(2)|stomach(1)	40						atatatacatatatacatatatgtgt	0.238																																																	0								ENSG00000221664																																			AC095030.1	SO:0001627	intron_variant	0				Clone_based_ensembl_gene	AF062595	CCDS675.1, CCDS676.1	1p31	2008-02-05			ENSG00000154027	ENSG00000154027		"""Adenylate kinases"""	365	protein-coding gene	gene with protein product		608009				10215863	Standard	NM_012093		Approved		uc001dhn.3	Q9Y6K8	OTTHUMG00000009796	ENST00000354567.2:c.892-19541ATATAC>-	1.37:g.77857120_77857125delATATAC		Somatic	NA	NA	NA		0.5912292923157907	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q5U622|Q6FH66|Q7Z4T5|Q86YS0|Q8N464|Q96EC9	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000354567.2	37	NULL	CCDS675.1	1																																																																																			-	-		0.238	AK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000221664	protein_coding	OTTHUMT00000026993.4	ATATAC	NM_174858			77857125	-1	no_errors	ENST00000408737	ensembl	human	novel	74_37	rna	DEL	0.993:0.996:0.997:0.998:0.999:0.999	-
FMOD	2331	genome.wustl.edu	37	1	203316940	203316940	+	Missense_Mutation	SNP	C	C	A	rs183197075		TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr1:203316940C>A	ENST00000354955.4	-	2	922	c.459G>T	c.(457-459)aaG>aaT	p.K153N	FMOD_ENST00000493296.1_Intron	NM_002023.4	NP_002014.2	Q06828	FMOD_HUMAN	fibromodulin	153					carbohydrate metabolic process (GO:0005975)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|small molecule metabolic process (GO:0044281)|transforming growth factor beta receptor complex assembly (GO:0007181)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(4)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	17			BRCA - Breast invasive adenocarcinoma(75;0.171)			GGTGCCTCAGCTTGGAGAAGA	0.592																																																	0								ENSG00000122176						91.0	90.0	90.0					1																	203316940		2203	4300	6503	FMOD	SO:0001583	missense	0			-	HGNC	U05291	CCDS30976.1	1q32	2008-02-05			ENSG00000122176	ENSG00000122176		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	3774	protein-coding gene	gene with protein product	"""fibromodulin proteoglycan"""	600245				7851907	Standard	NM_002023		Approved	SLRR2E	uc001gzr.3	Q06828	OTTHUMG00000035910	ENST00000354955.4:c.459G>T	1.37:g.203316940C>A	ENSP00000347041:p.Lys153Asn	Somatic	0	35	0.00		0.5912292923157907	2532	0.20	5	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.16	Q15331|Q8IV47	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Leu-rich_rpt,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp	p.K153N	ENST00000354955.4	37	c.459	CCDS30976.1	1	.	.	.	.	.	.	.	.	.	.	C	18.28	3.590169	0.66105	.	.	ENSG00000122176	ENST00000435105;ENST00000354955;ENST00000539467	T	0.55588	0.51	5.39	5.39	0.77823	.	0.000000	0.85682	D	0.000000	T	0.57095	0.2030	N	0.21324	0.655	0.58432	D	0.999996	D	0.76494	0.999	D	0.72625	0.978	T	0.60672	-0.7217	10	0.72032	D	0.01	-19.1085	11.2396	0.48962	0.0:0.9162:0.0:0.0838	.	153	Q06828	FMOD_HUMAN	N	140;153;133	ENSP00000347041:K153N	ENSP00000347041:K153N	K	-	3	2	FMOD	201583563	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	1.115000	0.31209	2.525000	0.85131	0.655000	0.94253	AAG	-	NULL		0.592	FMOD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMOD	protein_coding	OTTHUMT00000087472.1	C	NM_002023	-		203316940	-1	no_errors	ENST00000354955	ensembl	human	known	74_37	missense	SNP	1.000	A
SURF6	6838	genome.wustl.edu	37	9	136198685	136198685	+	3'UTR	SNP	C	C	A			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr9:136198685C>A	ENST00000372022.4	-	0	1371				SURF6_ENST00000468290.1_5'UTR	NM_006753.4	NP_006744.2	O75683	SURF6_HUMAN	surfeit 6						ribosome biogenesis (GO:0042254)	granular component (GO:0001652)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(1)|large_intestine(5)|lung(5)|ovary(1)	12				OV - Ovarian serous cystadenocarcinoma(145;1.16e-06)|Epithelial(140;8.34e-06)|all cancers(34;7.08e-05)		CGGAAGACGGCGGCCCCAGGT	0.677																																																	0								ENSG00000148296						14.0	16.0	15.0					9																	136198685		2117	4092	6209	SURF6	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AF186772	CCDS6962.1	9q33-q34	2010-07-06			ENSG00000148296	ENSG00000148296			11478	protein-coding gene	gene with protein product	"""surfeit locus protein 6"""	185642				9740673, 15629442	Standard	NM_006753		Approved	FLJ30322, RRP14	uc004cdb.4	O75683	OTTHUMG00000020871	ENST00000372022.4:c.*20G>T	9.37:g.136198685C>A		Somatic	0	42	0.00		0.5912292923157907	64	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52	Q5T8U1|Q9BRK9|Q9BTZ5|Q9UK24	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000372022.4	37	NULL	CCDS6962.1	9																																																																																			-	-		0.677	SURF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SURF6	protein_coding	OTTHUMT00000054905.1	C	NM_006753	-		136198685	-1	no_errors	ENST00000468290	ensembl	human	known	74_37	rna	SNP	0.000	A
KCNE1L	23630	genome.wustl.edu	37	X	108868055	108868055	+	Silent	SNP	G	G	T			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chrX:108868055G>T	ENST00000372101.2	-	1	338	c.195C>A	c.(193-195)ctC>ctA	p.L65L		NM_012282.2	NP_036414.1	Q9UJ90	KCE1L_HUMAN	KCNE1-like	65					atrial cardiac muscle cell action potential (GO:0086014)|cardiac muscle contraction (GO:0060048)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of potassium ion transmembrane transport (GO:1901380)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion export (GO:0071435)|potassium ion transmembrane transport (GO:0071805)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of cation channel activity (GO:2001257)|regulation of heart contraction (GO:0008016)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|ventricular cardiac muscle cell action potential (GO:0086005)	voltage-gated potassium channel complex (GO:0008076)	ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)			endometrium(1)|kidney(1)|large_intestine(2)|lung(2)	6						AGATCATGATGAGCAGGATGT	0.657																																																	0								ENSG00000176076						45.0	40.0	42.0					X																	108868055		2202	4300	6502	KCNE1L	SO:0001819	synonymous_variant	0			-	HGNC	AJ012743	CCDS14547.1	Xq22.3	2008-02-05	2004-06-09		ENSG00000176076	ENSG00000176076		"""Potassium channels"""	6241	protein-coding gene	gene with protein product		300328	"""potassium voltage-gated channel, Isk-related family, member 1-like"""			10493825	Standard	NM_012282		Approved		uc004eoh.3	Q9UJ90	OTTHUMG00000022189	ENST00000372101.2:c.195C>A	X.37:g.108868055G>T		Somatic	0	64	0.00		0.5912292923157907	15	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	51	8.77		Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.L65	ENST00000372101.2	37	c.195	CCDS14547.1	X																																																																																			-	NULL		0.657	KCNE1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNE1L	protein_coding	OTTHUMT00000057892.1	G	NM_012282	-		108868055	-1	no_errors	ENST00000372101	ensembl	human	known	74_37	silent	SNP	1.000	T
CD2AP	23607	genome.wustl.edu	37	6	47573998	47573998	+	Silent	SNP	C	C	T			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr6:47573998C>T	ENST00000359314.5	+	14	1971	c.1515C>T	c.(1513-1515)ttC>ttT	p.F505F		NM_012120.2	NP_036252.1	Q9Y5K6	CD2AP_HUMAN	CD2-associated protein	505					mitotic nuclear division (GO:0007067)|negative regulation of transforming growth factor beta1 production (GO:0032911)|positive regulation of protein localization to nucleus (GO:1900182)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein complex assembly (GO:0006461)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of receptor-mediated endocytosis (GO:0048259)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|substrate-dependent cell migration, cell extension (GO:0006930)|vesicle organization (GO:0016050)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	SH3 domain binding (GO:0017124)|structural constituent of cytoskeleton (GO:0005200)			kidney(1)|large_intestine(9)|lung(5)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	20			Lung(136;0.105)|LUSC - Lung squamous cell carcinoma(51;0.138)			CGGGCCGTTTCAATGGTGGAC	0.398																																																	0								ENSG00000198087						116.0	107.0	110.0					6																	47573998		2203	4300	6503	CD2AP	SO:0001819	synonymous_variant	0			-	HGNC	AF146277	CCDS34472.1	6p12	2008-02-05			ENSG00000198087	ENSG00000198087			14258	protein-coding gene	gene with protein product		604241				10339567	Standard	NM_012120		Approved	CMS	uc003oyw.3	Q9Y5K6	OTTHUMG00000014799	ENST00000359314.5:c.1515C>T	6.37:g.47573998C>T		Somatic	0	48	0.00		0.5912292923157907	24	4.00	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	92	22.03	A6NL34|Q5VYA3|Q9UG97	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain,prints_SH3_domain	p.F505	ENST00000359314.5	37	c.1515	CCDS34472.1	6																																																																																			-	NULL		0.398	CD2AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD2AP	protein_coding	OTTHUMT00000040817.2	C		-		47573998	+1	no_errors	ENST00000359314	ensembl	human	known	74_37	silent	SNP	1.000	T
TYK2	7297	genome.wustl.edu	37	19	10463610	10463610	+	Silent	SNP	G	G	A			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr19:10463610G>A	ENST00000525621.1	-	22	3673	c.3192C>T	c.(3190-3192)ccC>ccT	p.P1064P	TYK2_ENST00000524462.1_Silent_p.P879P|TYK2_ENST00000264818.6_Silent_p.P1064P|TYK2_ENST00000529422.1_Intron	NM_003331.4	NP_003322.3	P29597	TYK2_HUMAN	tyrosine kinase 2	1064	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cytokine-mediated signaling pathway (GO:0019221)|intracellular signal transduction (GO:0035556)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|growth hormone receptor binding (GO:0005131)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			breast(1)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(11)|kidney(6)|large_intestine(3)|lung(19)|ovary(4)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	64			OV - Ovarian serous cystadenocarcinoma(20;1.77e-09)|Epithelial(33;3.92e-06)|all cancers(31;8.95e-06)			ACCAGAACACGGGGCTGTCCC	0.627																																																	0								ENSG00000105397						74.0	66.0	69.0					19																	10463610		2203	4300	6503	TYK2	SO:0001819	synonymous_variant	0			-	HGNC		CCDS12236.1	19p13.2	2014-09-17			ENSG00000105397	ENSG00000105397	2.7.10.1		12440	protein-coding gene	gene with protein product		176941				2156206	Standard	NM_003331		Approved	JTK1	uc002moc.4	P29597	OTTHUMG00000166373	ENST00000525621.1:c.3192C>T	19.37:g.10463610G>A		Somatic	0	54	0.00		0.5912292923157907	54	42.71	41	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	12	55.56	Q6QB10|Q96CH0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,superfamily_FERM_central,smart_Band_41_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Tyr_kinase_non-rcpt_Jak/Tyk2,pfscan_FERM_domain,pfscan_Prot_kinase_dom,prints_Tyr_kinase_non-rcpt_Jak/Tyk2,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_Tyr_kinase_non-rcpt_TYK2_N	p.P1064	ENST00000525621.1	37	c.3192	CCDS12236.1	19																																																																																			-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Tyr_kinase_non-rcpt_Jak/Tyk2,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom		0.627	TYK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TYK2	protein_coding	OTTHUMT00000389443.1	G		-		10463610	-1	no_errors	ENST00000264818	ensembl	human	known	74_37	silent	SNP	0.036	A
SFXN5	94097	genome.wustl.edu	37	2	73172112	73172112	+	3'UTR	SNP	C	C	A	rs566194162		TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr2:73172112C>A	ENST00000272433.2	-	0	1192				SFXN5_ENST00000474528.1_5'UTR	NM_144579.2	NP_653180.1	Q8TD22	SFXN5_HUMAN	sideroflexin 5						iron ion homeostasis (GO:0055072)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	cation transmembrane transporter activity (GO:0008324)|citrate transmembrane transporter activity (GO:0015137)			breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(1)|ovary(2)|prostate(1)	9						CTCAGCTCCCCGGCTGCACAG	0.667																																																	0								ENSG00000144040						38.0	25.0	29.0					2																	73172112		2203	4300	6503	SFXN5	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AY044437	CCDS1922.1	2p13	2008-05-21			ENSG00000144040	ENSG00000144040		"""Sideroflexins"""	16073	protein-coding gene	gene with protein product		615572				12039050, 12150972	Standard	XM_005264648		Approved	BBG-TCC	uc002siq.3	Q8TD22	OTTHUMG00000129775	ENST00000272433.2:c.*39G>T	2.37:g.73172112C>A		Somatic	0	59	0.00		0.5912292923157907	26	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	41	8.89	A8K116|Q494Y3|Q53T29	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000272433.2	37	NULL	CCDS1922.1	2																																																																																			-	-		0.667	SFXN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SFXN5	protein_coding	OTTHUMT00000251991.1	C	NM_144579	-		73172112	-1	no_errors	ENST00000461352	ensembl	human	known	74_37	rna	SNP	0.002	A
CCAR2	57805	genome.wustl.edu	37	8	22463645	22463645	+	Missense_Mutation	SNP	C	C	A			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr8:22463645C>A	ENST00000308511.4	+	3	355	c.106C>A	c.(106-108)Cct>Act	p.P36T	CCAR2_ENST00000389279.3_Missense_Mutation_p.P36T|CCAR2_ENST00000520861.1_5'Flank|CCAR2_ENST00000521301.1_Missense_Mutation_p.P36T			Q8N163	CCAR2_HUMAN	cell cycle and apoptosis regulator 2	36					cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|mRNA processing (GO:0006397)|negative regulation of catalytic activity (GO:0043086)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage checkpoint (GO:2000003)|regulation of circadian rhythm (GO:0042752)|regulation of DNA-templated transcription, elongation (GO:0032784)|regulation of protein stability (GO:0031647)|response to UV (GO:0009411)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|DBIRD complex (GO:0044609)|mitochondrial matrix (GO:0005759)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|poly(A) RNA binding (GO:0044822)|RNA polymerase II core binding (GO:0000993)										TTTGCTCACTCCTCCTGTGGC	0.552																																																	0								ENSG00000158941						244.0	247.0	246.0					8																	22463645		2203	4300	6503	CCAR2	SO:0001583	missense	0			-	HGNC	AL834351	CCDS34863.1	8p22	2013-08-22	2013-08-22	2013-08-22		ENSG00000158941			23360	protein-coding gene	gene with protein product	"""deleted in breast cancer"""	607359	"""KIAA1967"""	KIAA1967		12370419	Standard	NM_021174		Approved	DBC-1, DBC1, NET35	uc003xci.3	Q8N163		ENST00000308511.4:c.106C>A	8.37:g.22463645C>A	ENSP00000310670:p.Pro36Thr	Somatic	0	105	0.00		0.5912292923157907	58	1.69	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	26	12.90	A6NL03|B2RB79|D3DSR6|Q6P0Q9|Q8N3G7|Q8N8M1|Q8TF34|Q9H9Q9|Q9HD12|Q9NT55	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_NA-bd_OB-fold	p.P36T	ENST00000308511.4	37	c.106	CCDS34863.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.66|17.66	3.444590|3.444590	0.63178|0.63178	.|.	.|.	ENSG00000158941|ENSG00000158941	ENST00000308511;ENST00000521301;ENST00000389279;ENST00000521837;ENST00000523349|ENST00000523801	T;T|.	0.35421|.	1.31;1.31|.	5.38|5.38	5.38|5.38	0.77491|0.77491	.|.	0.000000|.	0.56097|.	D|.	0.000024|.	T|T	0.40791|0.40791	0.1131|0.1131	N|N	0.08118|0.08118	0|0	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.80764|.	0.994|.	T|T	0.25293|0.25293	-1.0136|-1.0136	10|5	0.09338|.	T|.	0.73|.	-15.9416|-15.9416	16.9036|16.9036	0.86119|0.86119	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	36|.	Q8N163|.	K1967_HUMAN|.	T|Y	36|43	ENSP00000310670:P36T;ENSP00000373930:P36T|.	ENSP00000310670:P36T|.	P|S	+|+	1|2	0|0	KIAA1967|KIAA1967	22519590|22519590	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	2.602000|2.602000	0.46257|0.46257	2.906000|2.906000	0.99361|0.99361	0.655000|0.655000	0.94253|0.94253	CCT|TCC	-	NULL		0.552	CCAR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCAR2	protein_coding	OTTHUMT00000375865.1	C	NM_021174	-		22463645	+1	no_errors	ENST00000308511	ensembl	human	known	74_37	missense	SNP	1.000	A
SLC38A8	146167	genome.wustl.edu	37	16	84063139	84063139	+	Missense_Mutation	SNP	G	G	A	rs146442665	byFrequency	TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr16:84063139G>A	ENST00000299709.3	-	5	649	c.650C>T	c.(649-651)tCt>tTt	p.S217F		NM_001080442.1	NP_001073911.1	A6NNN8	S38A8_HUMAN	solute carrier family 38, member 8	217					amino acid transport (GO:0006865)|sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(12)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	26						ACTGAACACAGAGGTCCAGGA	0.502																																																	0								ENSG00000166558						92.0	90.0	90.0					16																	84063139		2200	4300	6500	SLC38A8	SO:0001583	missense	0			-	HGNC		CCDS32495.1	16q23.3	2013-05-22				ENSG00000166558		"""Solute carriers"""	32434	protein-coding gene	gene with protein product		615585					Standard	XM_006721135		Approved		uc002fhg.1	A6NNN8		ENST00000299709.3:c.650C>T	16.37:g.84063139G>A	ENSP00000299709:p.Ser217Phe	Somatic	0	105	0.00		0.5912292923157907	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	33	45	42.31		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_AA_transpt_TM,pfam_Tryptophan/tyrosine_permease	p.S217F	ENST00000299709.3	37	c.650	CCDS32495.1	16	.	.	.	.	.	.	.	.	.	.	G	16.12	3.033913	0.54896	.	.	ENSG00000166558	ENST00000299709	T	0.02498	4.27	5.25	4.28	0.50868	.	0.115957	0.64402	D	0.000010	T	0.04770	0.0129	L	0.47716	1.5	0.80722	D	1	B	0.33494	0.414	B	0.38378	0.272	T	0.43972	-0.9358	10	0.48119	T	0.1	.	13.2767	0.60191	0.0775:0.0:0.9225:0.0	.	217	A6NNN8	S38A8_HUMAN	F	217	ENSP00000299709:S217F	ENSP00000299709:S217F	S	-	2	0	SLC38A8	82620640	1.000000	0.71417	0.955000	0.39395	0.905000	0.53344	6.957000	0.76019	2.621000	0.88768	0.643000	0.83706	TCT	-	pfam_AA_transpt_TM,pfam_Tryptophan/tyrosine_permease		0.502	SLC38A8-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	SLC38A8	protein_coding	OTTHUMT00000432623.1	G	NM_001080442	-		84063139	-1	no_errors	ENST00000299709	ensembl	human	known	74_37	missense	SNP	0.998	A
BTBD10	84280	genome.wustl.edu	37	11	13441262	13441262	+	Frame_Shift_Del	DEL	G	G	-			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr11:13441262delG	ENST00000278174.5	-	4	574	c.329delC	c.(328-330)ccafs	p.P110fs	BTBD10_ENST00000528120.1_Frame_Shift_Del_p.P62fs|BTBD10_ENST00000532261.1_5'UTR|BTBD10_ENST00000530907.1_Frame_Shift_Del_p.P118fs	NM_032320.5	NP_115696.2	Q9BSF8	BTBDA_HUMAN	BTB (POZ) domain containing 10	110	Ser-rich.					nucleus (GO:0005634)				cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(7)|prostate(1)	20				Epithelial(150;0.0214)		CGGACTGCTTGGACGAGAGGA	0.388																																																	0								ENSG00000148925						148.0	143.0	145.0					11																	13441262		2200	4294	6494	BTBD10	SO:0001589	frameshift_variant	0				HGNC	AY221959	CCDS7811.1, CCDS73261.1	11p15.2	2013-01-24			ENSG00000148925	ENSG00000148925		"""BTB/POZ domain containing"""	21445	protein-coding gene	gene with protein product		615933				15556295	Standard	XM_005253164		Approved	GMRP1, GMRP-1, MGC13007	uc001mkz.3	Q9BSF8	OTTHUMG00000165787	ENST00000278174.5:c.329delC	11.37:g.13441262delG	ENSP00000278174:p.Pro110fs	Somatic	0	38	0.00		0.5912292923157907	19	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	66	14	82.50	B7Z228|Q86WG1	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	superfamily_BTB/POZ_fold,smart_BTB/POZ-like	p.P110fs	ENST00000278174.5	37	c.329	CCDS7811.1	11																																																																																			-	NULL		0.388	BTBD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BTBD10	protein_coding	OTTHUMT00000386200.1	G	NM_032320			13441262	-1	no_errors	ENST00000278174	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
LOC101927209	101927209	genome.wustl.edu	37	1	142653747	142653747	+	lincRNA	SNP	G	G	T			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr1:142653747G>T	ENST00000610091.1	-	0	3560				AL583842.2_ENST00000582446.1_RNA|AL583842.3_ENST00000580249.1_RNA|RP11-417J8.3_ENST00000426408.1_lincRNA|AL583842.1_ENST00000459390.1_RNA																							aatcccatctgcgggacaaac	0.463																																																	0								ENSG00000239012																																			AL583842.1			0			-	Clone_based_ensembl_gene																													1.37:g.142653747G>T		Somatic	1	235	0.42		0.5912292923157907	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	65	414	13.54		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000610091.1	37	NULL		1																																																																																			-	-		0.463	RP11-417J8.6-001	KNOWN	basic	lincRNA	ENSG00000239012	lincRNA	OTTHUMT00000037265.2	G		-		142653747	+1	no_errors	ENST00000459390	ensembl	human	novel	74_37	rna	SNP	0.000	T
LOXHD1	125336	genome.wustl.edu	37	18	44146368	44146368	+	Silent	SNP	G	G	T			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr18:44146368G>T	ENST00000398722.4	-	10	1454	c.1455C>A	c.(1453-1455)gcC>gcA	p.A485A	LOXHD1_ENST00000441551.2_Silent_p.A763A|LOXHD1_ENST00000536736.1_Silent_p.A763A			Q8IVV2	LOXH1_HUMAN	lipoxygenase homology domains 1	485	PLAT 4. {ECO:0000255|PROSITE- ProRule:PRU00152}.				calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)|sensory perception of sound (GO:0007605)	membrane (GO:0016020)|stereocilium (GO:0032420)	calcium channel activity (GO:0005262)			NS(3)|autonomic_ganglia(1)|breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|pancreas(1)|prostate(4)|skin(4)|stomach(1)	36						GGAACCAGCTGGCATGCATGC	0.592																																																	0								ENSG00000167210						57.0	54.0	55.0					18																	44146368		692	1591	2283	LOXHD1	SO:0001819	synonymous_variant	0			-	HGNC	AK057232	CCDS45861.1, CCDS45862.1, CCDS54184.1	18q21.1	2009-09-11			ENSG00000167210	ENSG00000167210			26521	protein-coding gene	gene with protein product		613072	"""deafness, autosomal recessive 77"""	DFNB77		19732867	Standard	NM_144612		Approved	FLJ32670, LH2D1	uc010xcw.1	Q8IVV2	OTTHUMG00000132644	ENST00000398722.4:c.1455C>A	18.37:g.44146368G>T		Somatic	0	40	0.00		0.5912292923157907	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	27	12.90	B7WNN3|B7WNT1|B7WPI9|Q6ZRY7|Q86WW9|Q96DL7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_PLAT/LH2_dom,superfamily_Lipase_LipOase,smart_PLAT/LH2_dom,pfscan_PLAT/LH2_dom	p.A763	ENST00000398722.4	37	c.2289		18	.	.	.	.	.	.	.	.	.	.	G	2.650	-0.282215	0.05642	.	.	ENSG00000167210	ENST00000441551	.	.	.	4.95	-5.58	0.02512	.	.	.	.	.	T	0.35038	0.0918	.	.	.	0.58432	D	0.999999	.	.	.	.	.	.	T	0.42599	-0.9442	4	.	.	.	.	0.6543	0.00832	0.2271:0.1545:0.259:0.3593	.	.	.	.	K	744	.	.	Q	-	1	0	LOXHD1	42400366	0.067000	0.21026	0.039000	0.18376	0.320000	0.28249	-0.475000	0.06599	-0.612000	0.05701	-0.479000	0.04858	CAG	-	pfam_PLAT/LH2_dom,superfamily_Lipase_LipOase,smart_PLAT/LH2_dom,pfscan_PLAT/LH2_dom		0.592	LOXHD1-201	KNOWN	basic	protein_coding	LOXHD1	protein_coding		G	NM_144612	-		44146368	-1	no_errors	ENST00000536736	ensembl	human	known	74_37	silent	SNP	0.277	T
SPTY2D1	144108	genome.wustl.edu	37	11	18636260	18636260	+	Missense_Mutation	SNP	C	C	A			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr11:18636260C>A	ENST00000336349.5	-	3	1796	c.1561G>T	c.(1561-1563)Ggg>Tgg	p.G521W	SPTY2D1_ENST00000543776.1_5'Flank	NM_194285.2	NP_919261.2	Q68D10	SPT2_HUMAN	SPT2, Suppressor of Ty, domain containing 1 (S. cerevisiae)	521	Ser-rich.									breast(4)|cervix(3)|endometrium(2)|kidney(3)|large_intestine(7)|lung(9)|skin(1)|stomach(1)	30						ACTGTTTGCCCAGGTCCCAAG	0.502																																																	0								ENSG00000179119						57.0	56.0	56.0					11																	18636260		2199	4293	6492	SPTY2D1	SO:0001583	missense	0			-	HGNC	BX647798	CCDS31441.1	11p15.1	2005-10-28			ENSG00000179119	ENSG00000179119			26818	protein-coding gene	gene with protein product							Standard	NM_194285		Approved	FLJ39441, DKFZp686I068	uc001moy.3	Q68D10	OTTHUMG00000167733	ENST00000336349.5:c.1561G>T	11.37:g.18636260C>A	ENSP00000337991:p.Gly521Trp	Somatic	0	52	0.00		0.5912292923157907	23	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51	Q6AWA5|Q6MZI5|Q7Z390|Q7Z470|Q86VG8|Q8N3E7|Q8N417|Q8N8I3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Chromatin_SPT2,smart_Chromatin_SPT2	p.G521W	ENST00000336349.5	37	c.1561	CCDS31441.1	11	.	.	.	.	.	.	.	.	.	.	C	18.40	3.614703	0.66672	.	.	ENSG00000179119	ENST00000336349	T	0.34859	1.34	6.08	6.08	0.98989	.	0.388801	0.29328	N	0.012478	T	0.64394	0.2594	M	0.75264	2.295	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.63829	-0.6548	10	0.72032	D	0.01	-15.0826	20.6647	0.99678	0.0:1.0:0.0:0.0	.	521	Q68D10	SPT2_HUMAN	W	521	ENSP00000337991:G521W	ENSP00000337991:G521W	G	-	1	0	SPTY2D1	18592836	1.000000	0.71417	1.000000	0.80357	0.674000	0.39518	1.228000	0.32588	2.890000	0.99128	0.655000	0.94253	GGG	-	NULL		0.502	SPTY2D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTY2D1	protein_coding	OTTHUMT00000395941.1	C	NM_194285	-		18636260	-1	no_errors	ENST00000336349	ensembl	human	known	74_37	missense	SNP	1.000	A
MTMR8	55613	genome.wustl.edu	37	X	63563503	63563503	+	Missense_Mutation	SNP	A	A	C			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chrX:63563503A>C	ENST00000374852.3	-	8	1030	c.963T>G	c.(961-963)atT>atG	p.I321M	MTMR8_ENST00000478487.1_5'UTR|MTMR8_ENST00000453546.1_Missense_Mutation_p.I321M	NM_017677.3	NP_060147.2	Q96EF0	MTMR8_HUMAN	myotubularin related protein 8	321	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.					nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)	p.0?(1)		breast(5)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(8)|lung(10)|ovary(2)|skin(3)	37						TTGTAATGAAAATTCCAGCAT	0.348																																																	1	Whole gene deletion(1)	ovary(1)						ENSG00000102043						61.0	51.0	54.0					X																	63563503		2203	4299	6502	MTMR8	SO:0001583	missense	0			-	HGNC	AK000133	CCDS14379.1	Xq11.2-q12	2013-01-11			ENSG00000102043	ENSG00000102043		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	16825	protein-coding gene	gene with protein product						11275328	Standard	NM_017677		Approved	FLJ20126	uc004dvs.3	Q96EF0	OTTHUMG00000021707	ENST00000374852.3:c.963T>G	X.37:g.63563503A>C	ENSP00000363985:p.Ile321Met	Somatic	0	98	0.00		0.5912292923157907	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	33	128	20.50	Q5JT99|Q9NXP6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Myotubularin-like_Pase_dom,smart_Tyr_Pase_cat	p.I321M	ENST00000374852.3	37	c.963	CCDS14379.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	15.34|15.34	2.803252|2.803252	0.50315|0.50315	.|.	.|.	ENSG00000102043|ENSG00000102043	ENST00000442913|ENST00000453546;ENST00000374852;ENST00000247400	.|D;D	.|0.90504	.|-2.68;-2.68	3.12|3.12	1.98|1.98	0.26296|0.26296	.|Myotubularin phosphatase domain (1);	.|0.149340	.|0.30630	.|U	.|0.009201	D|D	0.90314|0.90314	0.6970|0.6970	M|M	0.74647|0.74647	2.275|2.275	0.26616|0.26616	N|N	0.972746|0.972746	.|P;P	.|0.46706	.|0.879;0.883	.|B;P	.|0.50192	.|0.295;0.634	D|D	0.83673|0.83673	0.0167|0.0167	5|10	.|0.72032	.|D	.|0.01	.|.	4.991|4.991	0.14214|0.14214	0.7603:0.0:0.2397:0.0|0.7603:0.0:0.2397:0.0	.|.	.|321;321	.|B4DQL0;Q96EF0	.|.;MTMR8_HUMAN	V|M	125|321;321;207	.|ENSP00000394003:I321M;ENSP00000363985:I321M	.|ENSP00000247400:I207M	F|I	-|-	1|3	0|3	MTMR8|MTMR8	63480228|63480228	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	1.269000|1.269000	0.33074|0.33074	1.283000|1.283000	0.44513|0.44513	0.417000|0.417000	0.27973|0.27973	TTT|ATT	-	smart_Tyr_Pase_cat		0.348	MTMR8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTMR8	protein_coding	OTTHUMT00000056949.2	A	NM_017677	-		63563503	-1	no_errors	ENST00000374852	ensembl	human	known	74_37	missense	SNP	1.000	C
ARRDC5	645432	genome.wustl.edu	37	19	4891074	4891074	+	Missense_Mutation	SNP	G	G	C			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr19:4891074G>C	ENST00000381781.2	-	3	1012	c.1013C>G	c.(1012-1014)cCa>cGa	p.P338R	AC027319.1_ENST00000408608.1_RNA	NM_001080523.1	NP_001073992.1	A6NEK1	ARRD5_HUMAN	arrestin domain containing 5	338										endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)	12				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0257)		CTGGTGATCTGGGTTCACGGG	0.502																																																	0								ENSG00000205784						69.0	70.0	70.0					19																	4891074		1981	4173	6154	ARRDC5	SO:0001583	missense	0			-	HGNC		CCDS45929.1	19p13.3	2007-10-05				ENSG00000205784			31407	protein-coding gene	gene with protein product						12886014	Standard	NM_001080523		Approved		uc002mbm.3	A6NEK1		ENST00000381781.2:c.1013C>G	19.37:g.4891074G>C	ENSP00000371200:p.Pro338Arg	Somatic	0	73	0.00		0.5912292923157907	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	62	100	37.80		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Arrestin-like_N,pfam_Arrestin_C-like,superfamily_Ig_E-set	p.P338R	ENST00000381781.2	37	c.1013	CCDS45929.1	19	.	.	.	.	.	.	.	.	.	.	G	3.429	-0.116419	0.06881	.	.	ENSG00000205784	ENST00000381781	T	0.17213	2.29	3.68	-7.36	0.01417	Immunoglobulin E-set (1);	2.856690	0.02009	N	0.046854	T	0.11153	0.0272	N	0.24115	0.695	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.21381	-1.0247	10	0.66056	D	0.02	0.3088	6.3208	0.21217	0.0867:0.2957:0.4985:0.1191	.	338	A6NEK1	ARRD5_HUMAN	R	338	ENSP00000371200:P338R	ENSP00000371200:P338R	P	-	2	0	ARRDC5	4842074	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-3.387000	0.00488	-4.044000	0.00079	-1.075000	0.02238	CCA	-	superfamily_Ig_E-set		0.502	ARRDC5-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	ARRDC5	protein_coding	OTTHUMT00000450443.1	G	XM_292803	-		4891074	-1	no_errors	ENST00000381781	ensembl	human	known	74_37	missense	SNP	0.000	C
RP1L1	94137	genome.wustl.edu	37	8	10470651	10470651	+	Silent	SNP	G	G	T			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr8:10470651G>T	ENST00000382483.3	-	4	1180	c.957C>A	c.(955-957)ggC>ggA	p.G319G		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	319					cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)				breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		CGGACAGGCTGCCGTCCTCAT	0.662																																																	0								ENSG00000183638						87.0	96.0	93.0					8																	10470651		2136	4243	6379	RP1L1	SO:0001819	synonymous_variant	0			-	HGNC	AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.957C>A	8.37:g.10470651G>T		Somatic	0	94	0.00		0.5912292923157907	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	35	12.50	Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Doublecortin_dom,smart_Doublecortin_dom,pfscan_Doublecortin_dom	p.G319	ENST00000382483.3	37	c.957	CCDS43708.1	8																																																																																			-	NULL		0.662	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RP1L1	protein_coding	OTTHUMT00000375673.1	G		-		10470651	-1	no_errors	ENST00000382483	ensembl	human	known	74_37	silent	SNP	1.000	T
HNRNPA3	220988	genome.wustl.edu	37	2	178080861	178080861	+	Missense_Mutation	SNP	G	G	T	rs199989994		TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr2:178080861G>T	ENST00000392524.2	+	4	735	c.498G>T	c.(496-498)aaG>aaT	p.K166N	HNRNPA3_ENST00000411529.2_Missense_Mutation_p.K144N|HNRNPA3_ENST00000435711.1_Missense_Mutation_p.K166N			P51991	ROA3_HUMAN	heterogeneous nuclear ribonucleoprotein A3	166	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|urinary_tract(1)	16						GTGGAAAAAAGAGAGGATTTG	0.318																																																	0								ENSG00000170144						26.0	27.0	27.0					2																	178080861		2199	4256	6455	HNRNPA3	SO:0001583	missense	0			-	HGNC	AF517524	CCDS2273.1	2q31.2	2013-02-12		2008-04-18	ENSG00000170144	ENSG00000170144		"""RNA binding motif (RRM) containing"""	24941	protein-coding gene	gene with protein product		605372		HNRPA3		11886857, 15776420	Standard	XM_005246380		Approved		uc002ulc.1	P51991	OTTHUMG00000132529	ENST00000392524.2:c.498G>T	2.37:g.178080861G>T	ENSP00000376309:p.Lys166Asn	Somatic	0	31	0.00		0.5912292923157907	392	0.25	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	20	16.67	D3DPF4|Q53RW7|Q6URK5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.K166N	ENST00000392524.2	37	c.498	CCDS2273.1	2	.	.	.	.	.	.	.	.	.	.	G	15.33	2.801226	0.50315	.	.	ENSG00000170144	ENST00000392524;ENST00000411529;ENST00000416446;ENST00000420139;ENST00000435711	D;D;D	0.92495	-3.05;-3.05;-3.05	4.11	-0.176	0.13311	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.48286	U	0.000187	D	0.91798	0.7405	L	0.37630	1.12	0.53688	D	0.999977	D;D	0.89917	1.0;0.998	D;D	0.71414	0.973;0.943	D	0.89221	0.3571	10	0.72032	D	0.01	.	9.4697	0.38835	0.6151:0.0:0.3849:0.0	.	144;166	B4DDB6;P51991	.;ROA3_HUMAN	N	166;144;144;144;166	ENSP00000376309:K166N;ENSP00000408487:K144N;ENSP00000416340:K166N	ENSP00000376309:K166N	K	+	3	2	HNRNPA3	177789107	1.000000	0.71417	0.998000	0.56505	0.979000	0.70002	1.290000	0.33319	-0.025000	0.13918	-0.373000	0.07131	AAG	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom		0.318	HNRNPA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HNRNPA3	protein_coding	OTTHUMT00000255729.3	G	NM_194247	-		178080861	+1	no_errors	ENST00000392524	ensembl	human	known	74_37	missense	SNP	1.000	T
DCC	1630	genome.wustl.edu	37	18	49867196	49867196	+	Silent	SNP	G	G	T			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr18:49867196G>T	ENST00000442544.2	+	1	655	c.39G>T	c.(37-39)ctG>ctT	p.L13L	RP11-25O3.1_ENST00000582700.1_lincRNA	NM_005215.3	NP_005206.2	P43146	DCC_HUMAN	DCC netrin 1 receptor	13					anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|dorsal/ventral axon guidance (GO:0033563)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|neuron migration (GO:0001764)|positive regulation of apoptotic process (GO:0043065)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|regulation of apoptotic process (GO:0042981)|response to amphetamine (GO:0001975)|spinal cord ventral commissure morphogenesis (GO:0021965)	axon (GO:0030424)|cytosol (GO:0005829)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)|transcription coactivator activity (GO:0003713)|transmembrane signaling receptor activity (GO:0004888)			NS(3)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(23)|liver(1)|lung(56)|ovary(7)|pancreas(3)|prostate(2)|skin(16)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(6)	148		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		TACCCAAGCTGGCTTTTGTAC	0.547																																																	0								ENSG00000187323						250.0	211.0	224.0					18																	49867196		2203	4300	6503	DCC	SO:0001819	synonymous_variant	0			-	HGNC	X76132	CCDS11952.1	18q21.1	2014-06-20	2014-06-20		ENSG00000187323	ENSG00000187323		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2701	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 1"""	120470	"""deleted in colorectal carcinoma"""			2294591, 24400119	Standard	NM_005215		Approved	IGDCC1, NTN1R1	uc002lfe.2	P43146	OTTHUMG00000132698	ENST00000442544.2:c.39G>T	18.37:g.49867196G>T		Somatic	0	51	0.00		0.5912292923157907	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Neogenin_C,pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.L13	ENST00000442544.2	37	c.39	CCDS11952.1	18																																																																																			-	pfscan_Ig-like_dom		0.547	DCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCC	protein_coding	OTTHUMT00000255996.3	G	NM_005215	-		49867196	+1	no_errors	ENST00000442544	ensembl	human	known	74_37	silent	SNP	1.000	T
ATAD2	29028	genome.wustl.edu	37	8	124382158	124382159	+	In_Frame_Ins	INS	-	-	TCA	rs373904648|rs374184884|rs145137934|rs112640031|rs371096883|rs373069275|rs113064839	byFrequency	TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr8:124382158_124382159insTCA	ENST00000287394.5	-	7	940_941	c.833_834insTGA	c.(832-834)gaa>gaTGAa	p.277_278insD	ATAD2_ENST00000521903.1_De_novo_Start_InFrame|ATAD2_ENST00000534257.1_5'Flank	NM_014109.3	NP_054828.2	Q6PL18	ATAD2_HUMAN	ATPase family, AAA domain containing 2	277	Asp-rich.				ATP catabolic process (GO:0006200)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(12)|lung(16)|ovary(3)|prostate(3)|skin(1)|urinary_tract(2)	48	Lung NSC(37;1.25e-09)|Ovarian(258;0.00838)		STAD - Stomach adenocarcinoma(47;0.00288)			cttcatcatcttcatcatcatc	0.376																																																	0								ENSG00000156802																																			ATAD2	SO:0001652	inframe_insertion	0				HGNC	BC019909	CCDS6343.1	8q24.13	2014-01-21		2007-02-08	ENSG00000156802	ENSG00000156802		"""ATPases / AAA-type"""	30123	protein-coding gene	gene with protein product		611941				12477932	Standard	NM_014109		Approved	PRO2000, DKFZp667N1320, MGC5254, MGC29843, CT137	uc003yqh.4	Q6PL18	OTTHUMG00000165090	ENST00000287394.5:c.831_833dupTGA	8.37:g.124382165_124382167dupTCA	ENSP00000287394:p.Asp279_Asp280dup	Somatic	0	16	0.00		0.5912292923157907	118	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	49	26.87	Q14CR1|Q658P2|Q68CQ0|Q6PJV6|Q8N890|Q9UHS5	In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_ATPase_AAA_core,pfam_Bromodomain,superfamily_P-loop_NTPase,superfamily_Bromodomain,smart_AAA+_ATPase,smart_Bromodomain,pfscan_Bromodomain,prints_Bromodomain	p.278in_frame_insD	ENST00000287394.5	37	c.834_833	CCDS6343.1	8																																																																																			-	NULL		0.376	ATAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATAD2	protein_coding	OTTHUMT00000381766.2	-	NM_014109			124382159	-1	no_errors	ENST00000287394	ensembl	human	known	74_37	in_frame_ins	INS	0.866:0.899	TCA
PTPRF	5792	genome.wustl.edu	37	1	44088825	44088825	+	3'UTR	SNP	C	C	A			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr1:44088825C>A	ENST00000359947.4	+	0	7215				PTPRF_ENST00000372414.3_3'UTR|PTPRF_ENST00000372413.3_3'UTR|PTPRF_ENST00000496447.1_3'UTR	NM_002840.3	NP_002831.2	P10586	PTPRF_HUMAN	protein tyrosine phosphatase, receptor type, F						cell adhesion (GO:0007155)|cell migration (GO:0016477)|negative regulation of receptor binding (GO:1900121)|peptidyl-tyrosine dephosphorylation (GO:0035335)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	heparin binding (GO:0008201)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(2)|breast(4)|central_nervous_system(3)|endometrium(9)|kidney(4)|large_intestine(11)|liver(1)|lung(24)|ovary(4)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)	72	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				GCTGGCCTTTCAGGTCCAGGC	0.602																																																	0								ENSG00000142949																																			PTPRF	SO:0001624	3_prime_UTR_variant	0			-	HGNC	Y00815	CCDS489.2, CCDS490.2	1p34	2013-02-11			ENSG00000142949	ENSG00000142949		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9670	protein-coding gene	gene with protein product		179590		LAR		7558042	Standard	NM_130440		Approved		uc001cjr.3	P10586	OTTHUMG00000007501	ENST00000359947.4:c.*1151C>A	1.37:g.44088825C>A		Somatic	0	52	0.00		0.5912292923157907	67	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	D3DPX6|D3DPX7|Q5T021|Q5T022|Q5W9G2|Q86WS0	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000359947.4	37	NULL	CCDS489.2	1																																																																																			-	-		0.602	PTPRF-001	KNOWN	basic|CCDS	protein_coding	PTPRF	protein_coding	OTTHUMT00000019710.1	C		-		44088825	+1	no_errors	ENST00000496447	ensembl	human	known	74_37	rna	SNP	1.000	A
PTPN4	5775	genome.wustl.edu	37	2	120704097	120704097	+	Missense_Mutation	SNP	G	G	A			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr2:120704097G>A	ENST00000263708.2	+	18	2374	c.1603G>A	c.(1603-1605)Gga>Aga	p.G535R	PTPN4_ENST00000544261.1_Missense_Mutation_p.G168R	NM_002830.3	NP_002821.1	P29074	PTN4_HUMAN	protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte)	535	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)	non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)			endometrium(3)|kidney(2)|large_intestine(7)|lung(15)|ovary(2)|urinary_tract(1)	30					Alendronate(DB00630)	TTTTAAGGGAGGATATGATCA	0.299																																																	0								ENSG00000088179						101.0	101.0	101.0					2																	120704097		2203	4299	6502	PTPN4	SO:0001583	missense	0			-	HGNC		CCDS2129.1	2q14.2	2011-06-09			ENSG00000088179	ENSG00000088179		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9656	protein-coding gene	gene with protein product		176878				1648233	Standard	NM_002830		Approved	PTPMEG	uc002tmf.2	P29074	OTTHUMG00000131436	ENST00000263708.2:c.1603G>A	2.37:g.120704097G>A	ENSP00000263708:p.Gly535Arg	Somatic	0	53	0.00		0.5912292923157907	15	28.57	6	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	76	21.65	B2RBV8|Q9UDA7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_FERM_PH-like_C,pfam_FERM_central,pfam_FERM_N,pfam_PDZ,pfam_FERM-adjacent,superfamily_FERM_central,superfamily_PDZ,smart_Band_41_domain,smart_PDZ,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pirsf_Tyr_Pase_non-rcpt_typ-3/4,pfscan_FERM_domain,pfscan_PDZ,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt,prints_Band_41_fam,prints_Ez/rad/moesin_like	p.G535R	ENST00000263708.2	37	c.1603	CCDS2129.1	2	.	.	.	.	.	.	.	.	.	.	G	23.1	4.371536	0.82573	.	.	ENSG00000088179	ENST00000263708;ENST00000544261;ENST00000431283	T;T;T	0.31769	1.48;1.48;1.48	5.09	5.09	0.68999	PDZ/DHR/GLGF (4);	0.000000	0.85682	D	0.000000	T	0.70037	0.3178	H	0.96489	3.83	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.81195	-0.1043	10	0.87932	D	0	.	18.8463	0.92208	0.0:0.0:1.0:0.0	.	535	P29074	PTN4_HUMAN	R	535;168;161	ENSP00000263708:G535R;ENSP00000445841:G168R;ENSP00000387457:G161R	ENSP00000263708:G535R	G	+	1	0	PTPN4	120420567	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	6.522000	0.73783	2.513000	0.84729	0.591000	0.81541	GGA	-	pfam_PDZ,superfamily_PDZ,smart_PDZ,pirsf_Tyr_Pase_non-rcpt_typ-3/4,pfscan_PDZ		0.299	PTPN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPN4	protein_coding	OTTHUMT00000254233.2	G		-		120704097	+1	no_errors	ENST00000263708	ensembl	human	known	74_37	missense	SNP	1.000	A
HACE1	57531	genome.wustl.edu	37	6	105219148	105219148	+	Missense_Mutation	SNP	C	C	G			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr6:105219148C>G	ENST00000262903.4	-	19	2407	c.2131G>C	c.(2131-2133)Gag>Cag	p.E711Q	HACE1_ENST00000517995.1_5'UTR|HACE1_ENST00000369125.2_Intron	NM_020771.3	NP_065822.2	Q8IYU2	HACE1_HUMAN	HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1	711	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				cell cycle (GO:0007049)|Golgi organization (GO:0007030)|membrane fusion (GO:0061025)|protein K48-linked ubiquitination (GO:0070936)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|Rac protein signal transduction (GO:0016601)|regulation of cell migration (GO:0030334)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	ligase activity (GO:0016874)|Rab GTPase binding (GO:0017137)|Rac GTPase binding (GO:0048365)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|lung(17)|ovary(5)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	44		all_cancers(87;6.89e-05)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0216)|Colorectal(196;0.202)		BRCA - Breast invasive adenocarcinoma(108;0.122)|Epithelial(106;0.204)		ACATCAGTCTCAACAGAAAAA	0.373																																																	0								ENSG00000085382						107.0	110.0	109.0					6																	105219148		2203	4300	6503	HACE1	SO:0001583	missense	0			-	HGNC	BC034982	CCDS5050.1	6q21	2013-01-10	2012-02-23		ENSG00000085382	ENSG00000085382		"""Ankyrin repeat domain containing"""	21033	protein-coding gene	gene with protein product		610876				10718198	Standard	NM_020771		Approved	KIAA1320	uc003pqu.1	Q8IYU2	OTTHUMG00000015287	ENST00000262903.4:c.2131G>C	6.37:g.105219148C>G	ENSP00000262903:p.Glu711Gln	Somatic	0	56	0.00		0.5912292923157907	42	10.64	5	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	100	20.47	A8K6U5|B3KY89|B4DFM6|B4DTQ4|B7Z9X6|E9PGP0|Q5VU99|Q5VUA0|Q8ND12|Q9P2M6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_HECT,pfam_Ankyrin_rpt,superfamily_HECT,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_HECT,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_HECT,prints_Ankyrin_rpt	p.E711Q	ENST00000262903.4	37	c.2131	CCDS5050.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	25.4|25.4	4.632366|4.632366	0.87660|0.87660	.|.	.|.	ENSG00000085382|ENSG00000085382	ENST00000262903|ENST00000518503;ENST00000518402	T|.	0.58358|.	0.34|.	5.62|5.62	5.62|5.62	0.85841|0.85841	HECT (4);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.65554|.	0.2702|.	L|L	0.56340|0.56340	1.77|1.77	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	0.999;0.999;1.0|.	D;D;D|.	0.87578|.	0.977;0.998;0.998|.	T|.	0.61676|.	-0.7014|.	10|.	0.87932|.	D|.	0|.	.|.	19.6632|19.6632	0.95882|0.95882	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	200;711;364|.	B4DFM6;Q8IYU2;Q8IYU2-3|.	.;HACE1_HUMAN;.|.	Q|S	711|193;145	ENSP00000262903:E711Q|.	ENSP00000262903:E711Q|.	E|X	-|-	1|2	0|2	HACE1|HACE1	105325841|105325841	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	7.466000|7.466000	0.80914|0.80914	2.625000|2.625000	0.88918|0.88918	0.655000|0.655000	0.94253|0.94253	GAG|TGA	-	pfam_HECT,superfamily_HECT,smart_HECT,pfscan_HECT		0.373	HACE1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HACE1	protein_coding	OTTHUMT00000041643.2	C	XM_045095	-		105219148	-1	no_errors	ENST00000262903	ensembl	human	known	74_37	missense	SNP	1.000	G
TGFBRAP1	9392	genome.wustl.edu	37	2	105896857	105896857	+	Missense_Mutation	SNP	C	C	A			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr2:105896857C>A	ENST00000393359.2	-	6	1871	c.1445G>T	c.(1444-1446)tGg>tTg	p.W482L	TGFBRAP1_ENST00000258449.1_Missense_Mutation_p.W482L			Q8WUH2	TGFA1_HUMAN	transforming growth factor, beta receptor associated protein 1	482					intracellular protein transport (GO:0006886)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|membrane (GO:0016020)	SMAD binding (GO:0046332)|small GTPase regulator activity (GO:0005083)|transforming growth factor beta receptor binding (GO:0005160)			central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(5)|lung(11)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	31						CTTCTCTAGCCAGGCAGCACT	0.547																																					Esophageal Squamous(183;794 2019 9730 21801 48859)												0								ENSG00000135966						69.0	53.0	59.0					2																	105896857		2203	4300	6503	TGFBRAP1	SO:0001583	missense	0			-	HGNC	AF022795	CCDS2067.1	2q12.1	2008-02-05			ENSG00000135966	ENSG00000135966			16836	protein-coding gene	gene with protein product		606237				9545258, 11278302	Standard	NM_001142621		Approved	TRAP-1, TRAP1	uc002tcr.4	Q8WUH2	OTTHUMG00000130809	ENST00000393359.2:c.1445G>T	2.37:g.105896857C>A	ENSP00000377027:p.Trp482Leu	Somatic	0	31	0.00		0.5912292923157907	42	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.33	A8K5R7|D3DVJ8|O60466	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_VPS39/TGF_beta_rcpt-assoc_2,pfam_VPS39/TGF_beta_rcpt-assoc_1,pfam_Clathrin_H-chain/VPS_repeat,pfam_Citron	p.W482L	ENST00000393359.2	37	c.1445	CCDS2067.1	2	.	.	.	.	.	.	.	.	.	.	C	18.43	3.622296	0.66787	.	.	ENSG00000135966	ENST00000393359;ENST00000258449	T;T	0.38240	1.15;1.15	5.41	5.41	0.78517	Vacuolar sorting protein 39/Transforming growth factor beta receptor-associated domain 1 (1);	0.059022	0.64402	D	0.000001	T	0.40886	0.1135	L	0.55103	1.725	0.80722	D	1	P	0.39624	0.681	P	0.45232	0.474	T	0.15896	-1.0421	10	0.06891	T	0.86	-15.6839	19.2011	0.93712	0.0:1.0:0.0:0.0	.	482	Q8WUH2	TGFA1_HUMAN	L	482	ENSP00000377027:W482L;ENSP00000258449:W482L	ENSP00000258449:W482L	W	-	2	0	TGFBRAP1	105263289	1.000000	0.71417	1.000000	0.80357	0.896000	0.52359	6.022000	0.70839	2.523000	0.85059	0.650000	0.86243	TGG	-	pfam_VPS39/TGF_beta_rcpt-assoc_1		0.547	TGFBRAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGFBRAP1	protein_coding	OTTHUMT00000253354.2	C	NM_004257	-		105896857	-1	no_errors	ENST00000258449	ensembl	human	known	74_37	missense	SNP	1.000	A
CD72	971	genome.wustl.edu	37	9	35616663	35616663	+	Missense_Mutation	SNP	G	G	T			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr9:35616663G>T	ENST00000396757.1	-	5	450	c.286C>A	c.(286-288)Ctc>Atc	p.L96I	CD72_ENST00000490239.1_5'UTR|CD72_ENST00000378431.1_Missense_Mutation_p.L96I|CD72_ENST00000259633.4_Missense_Mutation_p.L96I			P21854	CD72_HUMAN	CD72 molecule	96					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor binding (GO:0005102)|transmembrane signaling receptor activity (GO:0004888)			large_intestine(5)|liver(1)|lung(6)	12			Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			CCGAGCAGGAGGTATCGCAGG	0.612																																																	0								ENSG00000137101						104.0	78.0	87.0					9																	35616663		2203	4300	6503	CD72	SO:0001583	missense	0			-	HGNC		CCDS6581.1	9p	2008-07-21	2006-03-28		ENSG00000137101	ENSG00000137101		"""CD molecules"""	1696	protein-coding gene	gene with protein product		107272	"""CD72 antigen"""			2044654, 1711157	Standard	NM_001782		Approved	LYB2, CD72b	uc003zxb.2	P21854	OTTHUMG00000019870	ENST00000396757.1:c.286C>A	9.37:g.35616663G>T	ENSP00000379980:p.Leu96Ile	Somatic	0	69	0.00		0.5912292923157907	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	p.L96I	ENST00000396757.1	37	c.286	CCDS6581.1	9	.	.	.	.	.	.	.	.	.	.	G	6.729	0.503250	0.12822	.	.	ENSG00000137101	ENST00000396757;ENST00000396759;ENST00000259633;ENST00000378431	T;T;T	0.62639	1.16;1.16;0.01	4.58	-2.76	0.05896	.	0.892392	0.09461	N	0.798965	T	0.38612	0.1047	L	0.35414	1.06	0.09310	N	1	B;B;B	0.17465	0.006;0.022;0.022	B;B;B	0.13407	0.008;0.009;0.009	T	0.26503	-1.0101	10	0.08599	T	0.76	-0.3628	2.2078	0.03940	0.181:0.3259:0.34:0.1531	.	96;96;96	Q5T4Q8;Q5TLG3;P21854	.;.;CD72_HUMAN	I	96	ENSP00000379980:L96I;ENSP00000259633:L96I;ENSP00000367688:L96I	ENSP00000259633:L96I	L	-	1	0	CD72	35606663	0.000000	0.05858	0.001000	0.08648	0.013000	0.08279	-0.570000	0.05895	-0.469000	0.06911	-1.134000	0.01955	CTC	-	NULL		0.612	CD72-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD72	protein_coding	OTTHUMT00000052336.1	G	NM_001782	-		35616663	-1	no_errors	ENST00000259633	ensembl	human	known	74_37	missense	SNP	0.000	T
RNF212	285498	genome.wustl.edu	37	4	1087327	1087328	+	Intron	INS	-	-	CTGCCCAGGCTGGAGCCAGCC	rs376912904|rs386670461|rs142232513|rs539986150|rs138488801	byFrequency	TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr4:1087327_1087328insCTGCCCAGGCTGGAGCCAGCC	ENST00000433731.2	-	4	308				RNF212_ENST00000333673.5_In_Frame_Ins_p.241_241S>WLAPAWAA|RNF212_ENST00000382968.5_Intron			Q495C1	RN212_HUMAN	ring finger protein 212						chiasma assembly (GO:0051026)|meiotic gene conversion (GO:0006311)|protein sumoylation (GO:0016925)|reciprocal meiotic recombination (GO:0007131)	synaptonemal complex (GO:0000795)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)|skin(1)	10			OV - Ovarian serous cystadenocarcinoma(23;0.0179)	UCEC - Uterine corpus endometrioid carcinoma (64;0.151)		CAGAGCCTGTGACCTCCACGGC	0.619																																																	0								ENSG00000178222																																			RNF212	SO:0001627	intron_variant	0				HGNC	AK096160	CCDS3345.1, CCDS46996.1, CCDS54704.1	4p16.3	2013-02-27	2007-01-19	2007-01-19	ENSG00000178222	ENSG00000178222		"""RING-type (C3HC4) zinc fingers"""	27729	protein-coding gene	gene with protein product		612041	"""hypothetical protein LOC285498"""	LOC285498		23396135	Standard	NM_001131034		Approved	FLJ38841	uc003gcj.3	Q495C1	OTTHUMG00000118997	ENST00000433731.2:c.247-2701->GGCTGGCTCCAGCCTGGGCAG	4.37:g.1087327_1087328insCTGCCCAGGCTGGAGCCAGCC		Somatic	NA	NA	NA		0.5912292923157907	4	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	C9J8N0|Q495C0|Q86W82|Q8IY99|Q8N8U7	In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	pfscan_Znf_RING	p.S241in_frame_insWLAPAWAA	ENST00000433731.2	37	c.722_721	CCDS46996.1	4																																																																																			-	NULL		0.619	RNF212-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RNF212	protein_coding	OTTHUMT00000359124.2	-	NM_194439			1087328	-1	no_errors	ENST00000333673	ensembl	human	known	74_37	in_frame_ins	INS	0.085:0.000	CTGCCCAGGCTGGAGCCAGCC
PAQR4	124222	genome.wustl.edu	37	16	3021235	3021235	+	Nonsense_Mutation	SNP	G	G	T	rs377141489		TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr16:3021235G>T	ENST00000318782.8	+	2	674	c.244G>T	c.(244-246)Gga>Tga	p.G82*	PAQR4_ENST00000576565.1_Nonsense_Mutation_p.G15*|PAQR4_ENST00000574988.1_Nonsense_Mutation_p.G15*|PAQR4_ENST00000293978.8_Intron|PKMYT1_ENST00000431515.2_Intron|PKMYT1_ENST00000571102.1_5'Flank|PAQR4_ENST00000572687.1_Intron	NM_001284513.1|NM_152341.3	NP_001271442.1|NP_689554.2	Q8N4S7	PAQR4_HUMAN	progestin and adipoQ receptor family member IV	82						integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|urinary_tract(1)	8						TGGCTGGCTGGGAGGCACACA	0.642																																																	0								ENSG00000162073						54.0	53.0	53.0					16																	3021235		2197	4300	6497	PAQR4	SO:0001587	stop_gained	0			-	HGNC		CCDS10485.1, CCDS66911.1, CCDS66912.1, CCDS73814.1	16p13	2008-05-02			ENSG00000162073	ENSG00000162073			26386	protein-coding gene	gene with protein product		614578				12477932	Standard	XM_005255112		Approved	FLJ30002	uc002csj.4	Q8N4S7	OTTHUMG00000128977	ENST00000318782.8:c.244G>T	16.37:g.3021235G>T	ENSP00000321804:p.Gly82*	Somatic	0	65	0.00		0.5912292923157907	72	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	31	11.43	A8K5Q8|D3DUA2|D3DUA3|Q8NAS6|Q96NW1	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_HlyIII-related	p.G82*	ENST00000318782.8	37	c.244	CCDS10485.1	16	.	.	.	.	.	.	.	.	.	.	G	31	5.078786	0.94050	.	.	ENSG00000162073	ENST00000318782	.	.	.	4.73	3.76	0.43208	.	0.114835	0.64402	D	0.000020	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.32370	T	0.25	-3.6598	11.7466	0.51823	0.0:0.0:0.8128:0.1871	.	.	.	.	X	82	.	ENSP00000321804:G82X	G	+	1	0	PAQR4	2961236	1.000000	0.71417	0.999000	0.59377	0.883000	0.51084	2.626000	0.46460	0.949000	0.37715	0.462000	0.41574	GGA	-	pfam_HlyIII-related		0.642	PAQR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAQR4	protein_coding	OTTHUMT00000250966.1	G	NM_152341	-		3021235	+1	no_errors	ENST00000318782	ensembl	human	known	74_37	nonsense	SNP	1.000	T
LOC388572	388572	genome.wustl.edu	37	11	134722	134722	+	RNA	SNP	G	G	T			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr11:134722G>T	ENST00000527297.1	+	0	235																											ATAGGCCATTGTGAGTCATGA	0.552																																																	0								ENSG00000230724																																			LINC01001			0			-	HGNC																													11.37:g.134722G>T		Somatic	0	15	0.00		0.5912292923157907	38	5.00	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	21	22.22		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000527297.1	37	NULL		11																																																																																			-	-		0.552	RP11-304M2.3-001	KNOWN	basic	antisense	LINC01001	antisense	OTTHUMT00000384758.1	G		-		134722	-1	no_errors	ENST00000527683	ensembl	human	known	74_37	rna	SNP	0.193	T
TNFRSF10B	8795	genome.wustl.edu	37	8	22880256	22880256	+	Missense_Mutation	SNP	C	C	A			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr8:22880256C>A	ENST00000276431.4	-	9	1535	c.1251G>T	c.(1249-1251)aaG>aaT	p.K417N	TNFRSF10B_ENST00000542226.1_Missense_Mutation_p.K237N|TNFRSF10B_ENST00000347739.3_Missense_Mutation_p.K388N	NM_003842.4|NM_147187.2	NP_003833.4|NP_671716.2	O14763	TR10B_HUMAN	tumor necrosis factor receptor superfamily, member 10b	417	Death. {ECO:0000255|PROSITE- ProRule:PRU00064}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of NF-kappaB-inducing kinase activity (GO:0007250)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell surface receptor signaling pathway (GO:0007166)|cellular response to mechanical stimulus (GO:0071260)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of apoptotic process (GO:0042981)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|response to endoplasmic reticulum stress (GO:0034976)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|TRAIL binding (GO:0045569)			NS(1)|endometrium(2)|large_intestine(7)|liver(1)|lung(3)|skin(1)	15		Prostate(55;0.0421)|Breast(100;0.067)		Colorectal(74;0.0179)|COAD - Colon adenocarcinoma(73;0.0703)		GGTCCTCAATCTTCTGCTTGG	0.502																																					GBM(94;1064 1342 1839 21060 42553)												0								ENSG00000120889						122.0	111.0	115.0					8																	22880256		2203	4300	6503	TNFRSF10B	SO:0001583	missense	0			-	HGNC	AF012628	CCDS6035.1, CCDS6036.1	8p22-p21	2006-02-22			ENSG00000120889	ENSG00000120889		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11905	protein-coding gene	gene with protein product		603612				9285725, 9311998	Standard	NM_003842		Approved	DR5, KILLER, TRICK2A, TRAIL-R2, TRICKB, CD262	uc003xcu.2	O14763	OTTHUMG00000097826	ENST00000276431.4:c.1251G>T	8.37:g.22880256C>A	ENSP00000276431:p.Lys417Asn	Somatic	0	42	0.00		0.5912292923157907	59	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	13	18.75	O14720|O15508|O15517|O15531|Q6UXM8|Q7Z360|Q9BVE0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_TNFR_10,pfam_Death_domain,pfam_TNFR/NGFR_Cys_rich_reg,superfamily_DEATH-like_dom,smart_TNFR/NGFR_Cys_rich_reg,smart_Death_domain,prints_TNFR_10,pfscan_Death_domain,pfscan_TNFR/NGFR_Cys_rich_reg	p.K417N	ENST00000276431.4	37	c.1251	CCDS6035.1	8	.	.	.	.	.	.	.	.	.	.	c	17.41	3.382281	0.61845	.	.	ENSG00000120889	ENST00000276431;ENST00000347739;ENST00000542226	D;D;D	0.86164	-2.08;-2.08;-2.08	4.96	-5.42	0.02640	Death (3);DEATH-like (2);	4.401270	0.01173	U	0.006902	D	0.85470	0.5704	L	0.38175	1.15	0.09310	N	1	P;B;B;D;P	0.56035	0.901;0.411;0.411;0.974;0.543	P;B;B;P;B	0.56343	0.71;0.321;0.321;0.796;0.42	T	0.75637	-0.3249	10	0.22109	T	0.4	.	7.2517	0.26152	0.0:0.2847:0.5028:0.2126	.	237;417;417;388;182	B7Z588;B5BU36;O14763;O14763-2;Q7Z2I8	.;.;TR10B_HUMAN;.;.	N	417;388;237	ENSP00000276431:K417N;ENSP00000317859:K388N;ENSP00000443386:K237N	ENSP00000276431:K417N	K	-	3	2	TNFRSF10B	22936201	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.863000	0.01651	-0.545000	0.06224	-0.910000	0.02820	AAG	-	pirsf_TNFR_10,pfam_Death_domain,superfamily_DEATH-like_dom,smart_Death_domain,pfscan_Death_domain		0.502	TNFRSF10B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TNFRSF10B	protein_coding	OTTHUMT00000215099.2	C	NM_147187	-		22880256	-1	no_errors	ENST00000276431	ensembl	human	known	74_37	missense	SNP	0.000	A
MGA	23269	genome.wustl.edu	37	15	41961309	41961309	+	Missense_Mutation	SNP	G	G	C			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr15:41961309G>C	ENST00000570161.1	+	1	217	c.217G>C	c.(217-219)Ggt>Cgt	p.G73R	MGA_ENST00000389936.4_Missense_Mutation_p.G73R|MGA_ENST00000219905.7_Missense_Mutation_p.G73R|MGA_ENST00000568630.1_Intron|MGA_ENST00000545763.1_Missense_Mutation_p.G73R|MGA_ENST00000566586.1_Missense_Mutation_p.G73R			O43451	MGA_HUMAN	MGA, MAX dimerization protein	0	Ser/Thr-rich.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			NS(1)|breast(4)|central_nervous_system(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(33)|ovary(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	TTGTACTGTGGGTGGAATCAC	0.423																																																	0								ENSG00000174197						132.0	130.0	130.0					15																	41961309		1905	4127	6032	MGA	SO:0001583	missense	0			-	HGNC	AB011090	CCDS55959.1, CCDS55960.1	15q15	2012-11-15	2012-11-15		ENSG00000174197	ENSG00000174197		"""MAX dimerization proteins"", ""T-boxes"""	14010	protein-coding gene	gene with protein product			"""MAX gene associated"""				Standard	NM_001080541		Approved	KIAA0518, MAD5, MXD5, FLJ12634	uc010ucy.2	Q8IWI9		ENST00000570161.1:c.217G>C	15.37:g.41961309G>C	ENSP00000457035:p.Gly73Arg	Somatic	0	50	0.00		0.5912292923157907	4	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	30	78	27.78	Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TF_T-box,pfam_bHLH_dom,superfamily_p53-like_TF_DNA-bd,superfamily_bHLH_dom,smart_TF_T-box,smart_bHLH_dom,pfscan_bHLH_dom,pfscan_TF_T-box,prints_TF_T-box	p.G73R	ENST00000570161.1	37	c.217	CCDS55959.1	15	.	.	.	.	.	.	.	.	.	.	G	17.26	3.345102	0.61073	.	.	ENSG00000174197	ENST00000219905;ENST00000389936;ENST00000545763	D;D;D	0.84298	-1.82;-1.83;-1.8	5.51	5.51	0.81932	.	0.107905	0.64402	D	0.000005	D	0.87669	0.6235	L	0.29908	0.895	0.41525	D	0.988428	P;D	0.59767	0.891;0.986	P;P	0.61477	0.74;0.889	D	0.87769	0.2604	10	0.49607	T	0.09	.	19.7791	0.96410	0.0:0.0:1.0:0.0	.	73;73	F5H7K2;E7ENI0	.;.	R	73	ENSP00000219905:G73R;ENSP00000374586:G73R;ENSP00000442467:G73R	ENSP00000219905:G73R	G	+	1	0	MGA	39748601	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	5.245000	0.65405	2.763000	0.94921	0.650000	0.86243	GGT	-	NULL		0.423	MGA-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MGA	protein_coding	OTTHUMT00000420229.1	G	NM_001164273.1	-		41961309	+1	no_errors	ENST00000219905	ensembl	human	known	74_37	missense	SNP	1.000	C
WASH3P	374666	genome.wustl.edu	37	15	102515340	102515340	+	RNA	SNP	G	G	A			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr15:102515340G>A	ENST00000557932.1	+	0	1186				DDX11L9_ENST00000562189.1_RNA			C4AMC7	WASH3_HUMAN	WAS protein family homolog 3 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)			central_nervous_system(1)|endometrium(6)|kidney(11)|prostate(5)|stomach(1)|urinary_tract(1)	25						GAAAGCTGGAGAAGAAGCAGC	0.652																																																	0								ENSG00000185596																																			WASH3P			0			-	HGNC			15q26.3	2014-03-20	2008-01-16	2008-01-16	ENSG00000185596	ENSG00000185596		"""WAS protein homologs"""	24362	pseudogene	pseudogene			"""family with sequence similarity 39, member D pseudogene"""	FAM39DP		11701968, 18159949	Standard	NR_003659		Approved	FLJ25222	uc002cdi.3	C4AMC7	OTTHUMG00000172275		15.37:g.102515340G>A		Somatic	0	305	0.00		0.5912292923157907	55	20.29	14	WXS	Illumina HiSeq 2500	Phase_IV	tier1	68	89	43.31		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000557932.1	37	NULL		15																																																																																			-	-		0.652	WASH3P-001	KNOWN	basic	processed_transcript	WASH3P	pseudogene	OTTHUMT00000417608.1	G	NM_199163	-		102515340	+1	no_errors	ENST00000557932	ensembl	human	known	74_37	rna	SNP	1.000	A
PIK3R3	8503	genome.wustl.edu	37	1	46598560	46598560	+	5'UTR	SNP	C	C	A			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr1:46598560C>A	ENST00000420542.1	-	0	148				PIK3R3_ENST00000540385.1_Intron|PIK3R3_ENST00000262741.5_5'Flank|PIK3R3_ENST00000354242.4_5'UTR|PIK3R3_ENST00000423209.1_5'Flank|RP4-533D7.5_ENST00000452785.2_RNA|PIK3R3_ENST00000372006.1_5'Flank|PIK3R3_ENST00000340332.6_5'UTR	NM_001114172.1	NP_001107644.1	Q92569	P55G_HUMAN	phosphoinositide-3-kinase, regulatory subunit 3 (gamma)						insulin receptor signaling pathway (GO:0008286)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphatidylinositol 3-kinase complex (GO:0005942)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|phosphatidylinositol 3-kinase regulator activity (GO:0035014)			endometrium(1)|large_intestine(5)|lung(6)|prostate(2)	14	Acute lymphoblastic leukemia(166;0.155)				Isoprenaline(DB01064)	AATCAGCCATCCGCGCTCTCC	0.607																																																	0								ENSG00000117461																																			PIK3R3	SO:0001623	5_prime_UTR_variant	0			-	HGNC	BC021622	CCDS529.1	1p34.1	2013-02-14	2008-02-04		ENSG00000117461	ENSG00000117461		"""SH2 domain containing"""	8981	protein-coding gene	gene with protein product		606076				9524259	Standard	NM_003629		Approved	p55	uc001cpb.4	Q92569	OTTHUMG00000008096	ENST00000420542.1:c.-109G>T	1.37:g.46598560C>A		Somatic	0	42	0.00		0.5912292923157907	3	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	24	14.29	B2R9C1|D3DQ12|O60482|Q5T4P1|Q5T4P2	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000420542.1	37	NULL	CCDS529.1	1																																																																																			-	-		0.607	PIK3R3-203	KNOWN	basic|appris_principal|CCDS	protein_coding	PIK3R3	protein_coding	OTTHUMT00000022166.1	C	NM_003629	-		46598560	-1	no_errors	ENST00000493202	ensembl	human	known	74_37	rna	SNP	0.009	A
CEACAM5	1048	genome.wustl.edu	37	19	42224076	42224076	+	Nonsense_Mutation	SNP	C	C	T			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr19:42224076C>T	ENST00000221992.6	+	7	1834	c.1720C>T	c.(1720-1722)Cag>Tag	p.Q574*	CEACAM5_ENST00000405816.1_Nonsense_Mutation_p.Q574*|CEACAM5_ENST00000398599.4_Nonsense_Mutation_p.Q573*|CEA_ENST00000598976.1_Intron	NM_004363.2	NP_004354.2	P06731	CEAM5_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 5	574	Ig-like 6.				homotypic cell-cell adhesion (GO:0034109)|negative regulation of anoikis (GO:2000811)|negative regulation of apoptotic process (GO:0043066)|negative regulation of myotube differentiation (GO:0010832)	anchored component of membrane (GO:0031225)|basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of external side of plasma membrane (GO:0071575)|integral component of plasma membrane (GO:0005887)	GPI anchor binding (GO:0034235)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)			breast(1)|endometrium(3)|kidney(5)|large_intestine(4)|lung(10)|ovary(2)|skin(7)|stomach(1)|urinary_tract(1)	34				OV - Ovarian serous cystadenocarcinoma(3;0.00278)|all cancers(3;0.00625)|Epithelial(262;0.0379)|GBM - Glioblastoma multiforme(1328;0.142)		ATGTGGAATCCAGAACTCAGT	0.522																																																	0								ENSG00000105388						206.0	188.0	194.0					19																	42224076		2203	4300	6503	CEACAM5	SO:0001587	stop_gained	0			-	HGNC	M17303	CCDS12584.1	19q13.1-q13.2	2013-01-29			ENSG00000105388	ENSG00000105388		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1817	protein-coding gene	gene with protein product		114890		CEA			Standard	XM_005258413		Approved	CD66e	uc002orl.3	P06731	OTTHUMG00000151061	ENST00000221992.6:c.1720C>T	19.37:g.42224076C>T	ENSP00000221992:p.Gln574*	Somatic	0	107	0.00		0.5912292923157907	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	66	136	32.67	H9KVA7	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.Q574*	ENST00000221992.6	37	c.1720	CCDS12584.1	19	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.58|14.58	2.578622|2.578622	0.46006|0.46006	.|.	.|.	ENSG00000105388|ENSG00000105388	ENST00000398599|ENST00000221992;ENST00000405816;ENST00000378181	.|.	.|.	.|.	2.51|2.51	-4.18|-4.18	0.03846|0.03846	.|.	.|.	.|.	.|.	.|.	T|.	0.17195|.	0.0413|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.30297|.	-0.9983|.	3|.	.|0.18710	.|T	.|0.47	.|.	3.6785|3.6785	0.08301|0.08301	0.2046:0.4366:0.0:0.3588|0.2046:0.4366:0.0:0.3588	.|.	.|.	.|.	.|.	L|X	569|574;574;292	.|.	.|ENSP00000221992:Q574X	P|Q	+|+	2|1	0|0	CEACAM5|CEACAM5	46915916|46915916	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.021000|0.021000	0.10359|0.10359	-3.663000|-3.663000	0.00400|0.00400	-1.160000|-1.160000	0.02804|0.02804	0.460000|0.460000	0.39030|0.39030	CCA|CAG	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.522	CEACAM5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CEACAM5	protein_coding	OTTHUMT00000321132.2	C	NM_004363	-		42224076	+1	no_errors	ENST00000221992	ensembl	human	known	74_37	nonsense	SNP	0.000	T
DDRGK1	65992	genome.wustl.edu	37	20	3172212	3172213	+	Intron	INS	-	-	T	rs560128508	byFrequency	TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr20:3172212_3172213insT	ENST00000354488.3	-	7	787				DDRGK1_ENST00000380201.2_3'UTR|DDRGK1_ENST00000496781.1_5'UTR	NM_023935.1	NP_076424.1	Q96HY6	DDRGK_HUMAN	DDRGK domain containing 1							endoplasmic reticulum (GO:0005783)				endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|skin(2)|urinary_tract(1)	7						TGGGGTTTGGGTTTTTTTTTTC	0.495																																																	0								ENSG00000198171																																			DDRGK1	SO:0001627	intron_variant	0				HGNC	AL121891	CCDS13050.1	20p13	2011-08-18	2008-10-03	2008-10-03	ENSG00000198171	ENSG00000198171			16110	protein-coding gene	gene with protein product	"""Dashurin"""		"""chromosome 20 open reading frame 116"""	C20orf116		20036718, 20228063, 21494687	Standard	NM_023935		Approved	dJ1187M17.3	uc002wic.3	Q96HY6	OTTHUMG00000031732	ENST00000354488.3:c.729+197->A	20.37:g.3172222_3172222dupT		Somatic	0	24	0.00		0.5912292923157907	4	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	20	16.67	A6NIU5|C9JSZ5|Q9BW47	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000354488.3	37	NULL	CCDS13050.1	20																																																																																			-	-		0.495	DDRGK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDRGK1	protein_coding	OTTHUMT00000077709.2	-	NM_023935			3172213	-1	no_errors	ENST00000496781	ensembl	human	known	74_37	rna	INS	0.000:0.009	T
ABCC2	1244	genome.wustl.edu	37	10	101595898	101595898	+	Silent	SNP	C	C	T			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr10:101595898C>T	ENST00000370449.4	+	25	3578	c.3465C>T	c.(3463-3465)acC>acT	p.T1155T		NM_000392.3	NP_000383	Q92887	MRP2_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 2	1155	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				cellular chloride ion homeostasis (GO:0030644)|drug transmembrane transport (GO:0006855)|prostaglandin transport (GO:0015732)|response to arsenic-containing substance (GO:0046685)|response to estrogen (GO:0043627)|response to heat (GO:0009408)|response to methotrexate (GO:0031427)|response to oxidative stress (GO:0006979)|thyroid hormone transport (GO:0070327)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)			NS(1)|breast(5)|endometrium(9)|kidney(2)|large_intestine(20)|liver(1)|lung(20)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	67		Colorectal(252;0.234)		Epithelial(162;2.77e-10)|all cancers(201;2.47e-08)	Adenosine triphosphate(DB00171)|Aminohippurate(DB00345)|Arsenic trioxide(DB01169)|Atorvastatin(DB01076)|Canagliflozin(DB08907)|Carbamazepine(DB00564)|Carboplatin(DB00958)|Cisplatin(DB00515)|Clotrimazole(DB00257)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dexamethasone(DB01234)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Eprosartan(DB00876)|Ethinyl Estradiol(DB00977)|Etoposide(DB00773)|Ezetimibe(DB00973)|Furosemide(DB00695)|Fusidic Acid(DB02703)|Gadoxetate(DB08884)|Glutathione(DB00143)|Glyburide(DB01016)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Ivermectin(DB00602)|Lamivudine(DB00709)|Leucovorin(DB00650)|Levetiracetam(DB01202)|Lomefloxacin(DB00978)|Lovastatin(DB00227)|Methotrexate(DB00563)|Mycophenolate mofetil(DB00688)|Nifedipine(DB01115)|Norgestimate(DB00957)|Ofloxacin(DB01165)|Olmesartan(DB00275)|Oxaliplatin(DB00526)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pitavastatin(DB08860)|Pranlukast(DB01411)|Pravastatin(DB00175)|Probenecid(DB01032)|Quinidine(DB00908)|Reserpine(DB00206)|Rifampicin(DB01045)|Ritonavir(DB00503)|Saquinavir(DB01232)|Simvastatin(DB00641)|Sorafenib(DB00398)|Sparfloxacin(DB01208)|Spironolactone(DB00421)|Sulfasalazine(DB00795)|Sulfinpyrazone(DB01138)|Sunitinib(DB01268)|Tamoxifen(DB00675)|Telmisartan(DB00966)|Tenofovir(DB00300)|Tetrahydrofolic acid(DB00116)|Ursodeoxycholic acid(DB01586)|Vasopressin(DB00067)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)	ACTCTGTCACCAGGTCCCCAA	0.512																																																	0								ENSG00000023839						137.0	126.0	130.0					10																	101595898		2203	4300	6503	ABCC2	SO:0001819	synonymous_variant	0			-	HGNC	U63970	CCDS7484.1	10q24	2012-03-14			ENSG00000023839	ENSG00000023839		"""ATP binding cassette transporters / subfamily C"""	53	protein-coding gene	gene with protein product		601107	"""canalicular multispecific organic anion transporter 1"""	CMOAT		8797578, 9284939	Standard	XM_006717630		Approved	DJS, MRP2, cMRP	uc001kqf.2	Q92887	OTTHUMG00000018895	ENST00000370449.4:c.3465C>T	10.37:g.101595898C>T		Somatic	0	55	0.00		0.5912292923157907	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	44	32	57.89	B2RMT8|Q14022|Q5T2B1|Q92500|Q92798|Q99663|Q9UMS2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC1_TM_dom,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom,tigrfam_Multidrug-R_assoc	p.T1155	ENST00000370449.4	37	c.3465	CCDS7484.1	10																																																																																			-	pfam_ABC_transptr_TM_dom,superfamily_ABC1_TM_dom,pfscan_ABC1_TM_dom,tigrfam_Multidrug-R_assoc		0.512	ABCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCC2	protein_coding	OTTHUMT00000049825.1	C	NM_000392	-		101595898	+1	no_errors	ENST00000370449	ensembl	human	known	74_37	silent	SNP	0.997	T
