#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
TAF1	6872	genome.wustl.edu	37	X	70598812	70598812	+	Missense_Mutation	SNP	C	C	T			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chrX:70598812C>T	ENST00000373790.4	+	8	1339	c.1288C>T	c.(1288-1290)Cgt>Tgt	p.R430C	TAF1_ENST00000449580.1_Missense_Mutation_p.R430C|TAF1_ENST00000423759.1_Missense_Mutation_p.R451C|TAF1_ENST00000276072.3_Missense_Mutation_p.R451C	NM_004606.3|NM_138923.2	NP_004597.2|NP_620278.1	P21675	TAF1_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa	430					cellular response to DNA damage stimulus (GO:0006974)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone acetylation (GO:0016573)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|protein autophosphorylation (GO:0046777)|regulation of transcription involved in G2/M transition of mitotic cell cycle (GO:0000117)|RNA polymerase II transcriptional preinitiation complex assembly (GO:0051123)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	ATP binding (GO:0005524)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)|sequence-specific DNA binding (GO:0043565)|TBP-class protein binding (GO:0017025)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(13)|central_nervous_system(6)|cervix(1)|endometrium(25)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(16)|lung(34)|ovary(9)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	124	Renal(35;0.156)	all_lung(315;0.000321)				AAAACCTCAGCGTGCAAGCCT	0.507																																																	0								ENSG00000147133						224.0	166.0	186.0					X																	70598812		2203	4300	6503	TAF1	SO:0001583	missense	0			-	HGNC		CCDS14412.1, CCDS35325.1, CCDS69783.1	Xq13.1	2011-07-01	2002-08-29	2001-12-07	ENSG00000147133	ENSG00000147133		"""Chromatin-modifying enzymes / K-acetyltransferases"""	11535	protein-coding gene	gene with protein product		313650	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, A, 250kD"", ""dystonia 3 (with Parkinsonism)"""	TAF2A, BA2R, CCG1, CCGS, DYT3		3556424, 12928496, 17952504	Standard	XM_005262295		Approved	NSCL2, TAFII250, KAT4, DYT3/TAF1	uc004dzt.4	P21675	OTTHUMG00000022723	ENST00000373790.4:c.1288C>T	X.37:g.70598812C>T	ENSP00000362895:p.Arg430Cys	Somatic	0	60	0.00		0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	52	34.18	A5CVC8|A5CVC9|A5CVD0|A5CVD1|B1Q2X3|Q59FZ3|Q6IUZ1|Q70Q86|Q70Q87|Q70T00|Q70T01|Q70T02|Q70T03	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_TAF1_animal,pfam_TFIID_sub1_DUF3591,pfam_Bromodomain,pfam_TAF_II_230-bd,superfamily_Bromodomain,superfamily_TAF_II_230-bd,smart_Bromodomain,prints_Bromodomain,pfscan_Bromodomain	p.R430C	ENST00000373790.4	37	c.1288	CCDS35325.1	X	.	.	.	.	.	.	.	.	.	.	.	17.02	3.282588	0.59867	.	.	ENSG00000147133	ENST00000373790;ENST00000449580;ENST00000423759;ENST00000276072	T;T;T;T	0.10382	2.88;2.94;2.93;2.88	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	T	0.20129	0.0484	L	0.47716	1.5	0.80722	D	1	D;D	0.59357	0.975;0.985	P;P	0.54815	0.582;0.761	T	0.00124	-1.2024	10	0.72032	D	0.01	.	12.7536	0.57321	0.2863:0.7137:0.0:0.0	.	430;451	P21675;P21675-2	TAF1_HUMAN;.	C	430;430;451;451	ENSP00000362895:R430C;ENSP00000389000:R430C;ENSP00000406549:R451C;ENSP00000276072:R451C	ENSP00000276072:R451C	R	+	1	0	TAF1	70515537	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.603000	0.46266	2.498000	0.84270	0.513000	0.50165	CGT	-	pirsf_TAF1_animal		0.507	TAF1-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	TAF1	protein_coding	OTTHUMT00000058995.2	C	NM_004606	-		70598812	+1	no_errors	ENST00000449580	ensembl	human	known	74_37	missense	SNP	1.000	T
F8	2157	genome.wustl.edu	37	X	154124375	154124375	+	Missense_Mutation	SNP	C	C	T			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chrX:154124375C>T	ENST00000360256.4	-	22	6606	c.6406G>A	c.(6406-6408)Gga>Aga	p.G2136R		NM_000132.3	NP_000123.1	P00451	FA8_HUMAN	coagulation factor VIII, procoagulant component	2136	F5/8 type C 1. {ECO:0000255|PROSITE- ProRule:PRU00081}.				acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	copper ion binding (GO:0005507)|oxidoreductase activity (GO:0016491)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(27)|liver(1)|lung(47)|ovary(5)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(5)|urinary_tract(2)	120	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)	GTGGAATTTCCTCGATAAGTC	0.403																																																	0			GRCh37	CI064690	F8	I		ENSG00000185010						144.0	138.0	140.0					X																	154124375		2203	4300	6503	F8	SO:0001583	missense	0			-	HGNC	M90707	CCDS35457.1, CCDS44026.1	Xq28	2014-09-17	2008-07-29		ENSG00000185010	ENSG00000185010			3546	protein-coding gene	gene with protein product	"""Factor VIIIF8B"", ""hemophilia A"""	300841		F8C		6438528, 3935400	Standard	NM_000132		Approved	FVIII, DXS1253E, HEMA	uc004fmt.3	P00451	OTTHUMG00000022688	ENST00000360256.4:c.6406G>A	X.37:g.154124375C>T	ENSP00000353393:p.Gly2136Arg	Somatic	0	101	0.00		0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	104	16.13	Q14286|Q5HY69	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Coagulation_fac_5/8-C_type_dom,pfam_Cu-oxidase_3,pfam_Cu-oxidase_2,superfamily_Galactose-bd-like,superfamily_Cupredoxin,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom	p.G2136R	ENST00000360256.4	37	c.6406	CCDS35457.1	X	.	.	.	.	.	.	.	.	.	.	c	26.2	4.715536	0.89112	.	.	ENSG00000185010	ENST00000360256	D	0.98937	-5.25	5.65	5.65	0.86999	Coagulation factor 5/8 C-terminal type domain (3);Galactose-binding domain-like (1);	0.049433	0.85682	D	0.000000	D	0.99187	0.9718	M	0.84773	2.715	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99640	1.0988	10	0.87932	D	0	-17.2037	17.1744	0.86837	0.0:1.0:0.0:0.0	.	2136	P00451	FA8_HUMAN	R	2136	ENSP00000353393:G2136R	ENSP00000353393:G2136R	G	-	1	0	F8	153777569	1.000000	0.71417	0.995000	0.50966	0.992000	0.81027	6.782000	0.75073	2.370000	0.80446	0.600000	0.82982	GGA	-	pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom		0.403	F8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	F8	protein_coding	OTTHUMT00000058869.4	C		-		154124375	-1	no_errors	ENST00000360256	ensembl	human	known	74_37	missense	SNP	1.000	T
C15orf52	388115	genome.wustl.edu	37	15	40630782	40630782	+	Missense_Mutation	SNP	C	C	T			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr15:40630782C>T	ENST00000559313.1	-	5	614	c.599G>A	c.(598-600)cGa>cAa	p.R200Q	C15orf52_ENST00000557973.1_5'Flank|C15orf52_ENST00000397536.2_5'Flank	NM_207380.2	NP_997263.2	Q6ZUT6	CO052_HUMAN	chromosome 15 open reading frame 52	200							poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(9)|urinary_tract(1)	19		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;9.06e-06)|Colorectal(105;0.0107)|BRCA - Breast invasive adenocarcinoma(123;0.0505)|READ - Rectum adenocarcinoma(2;0.0649)|Lung(196;0.0781)|LUAD - Lung adenocarcinoma(183;0.0841)		GGGGGGGCTTCGGGTCACACG	0.582											OREG0023060	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000188549						104.0	114.0	111.0					15																	40630782		2022	4162	6184	C15orf52	SO:0001583	missense	0			-	HGNC	AK124643	CCDS10055.2	15q15.1	2007-06-14			ENSG00000188549	ENSG00000188549			33488	protein-coding gene	gene with protein product							Standard	NM_207380		Approved	FLJ43339	uc001zlh.4	Q6ZUT6	OTTHUMG00000129981	ENST00000559313.1:c.599G>A	15.37:g.40630782C>T	ENSP00000453969:p.Arg200Gln	Somatic	0	87	0.00	894	0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	42	94	30.88	B9EIQ8|Q68DG9|Q6ZTM3|Q6ZU22	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.R200Q	ENST00000559313.1	37	c.599	CCDS10055.2	15	.	.	.	.	.	.	.	.	.	.	C	10.99	1.507202	0.27036	.	.	ENSG00000188549	ENST00000382688;ENST00000397535	.	.	.	4.44	-5.33	0.02713	.	1.020600	0.07843	N	0.963337	T	0.17746	0.0426	L	0.27053	0.805	0.09310	N	1	B;B	0.28971	0.229;0.017	B;B	0.15870	0.014;0.009	T	0.17992	-1.0351	9	0.25751	T	0.34	-0.1407	5.7979	0.18397	0.1416:0.2809:0.0:0.5776	.	132;200	Q6ZUT6-3;Q6ZUT6	.;CO052_HUMAN	Q	200;132	.	ENSP00000372135:R200Q	R	-	2	0	C15orf52	38418074	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.355000	0.02612	-0.790000	0.04492	0.563000	0.77884	CGA	-	NULL		0.582	C15orf52-002	KNOWN	basic|appris_principal|CCDS	protein_coding	C15orf52	protein_coding	OTTHUMT00000319567.2	C	NM_207380	-		40630782	-1	no_errors	ENST00000559313	ensembl	human	known	74_37	missense	SNP	0.000	T
CDKL5	6792	genome.wustl.edu	37	X	18622326	18622326	+	Missense_Mutation	SNP	G	G	T			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chrX:18622326G>T	ENST00000379989.3	+	13	1567	c.1282G>T	c.(1282-1284)Ggc>Tgc	p.G428C	CDKL5_ENST00000379996.3_Missense_Mutation_p.G428C|CDKL5_ENST00000463994.1_3'UTR	NM_001037343.1	NP_001032420.1	O76039	CDKL5_HUMAN	cyclin-dependent kinase-like 5	428					neuron migration (GO:0001764)|positive regulation of axon extension (GO:0045773)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of Rac GTPase activity (GO:0032855)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of dendrite development (GO:0050773)	cytoplasm (GO:0005737)|dendrite cytoplasm (GO:0032839)|dendritic growth cone (GO:0044294)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|kinase activity (GO:0016301)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rac GTPase binding (GO:0048365)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(12)|ovary(4)|skin(5)|stomach(1)	44	Hepatocellular(33;0.183)					GCCTTCAGAAGGCCCAGGGAC	0.453																																																	0								ENSG00000008086						132.0	133.0	133.0					X																	18622326		2203	4300	6503	CDKL5	SO:0001583	missense	0			-	HGNC	Y15057	CCDS14186.1	Xp22	2011-11-04	2002-11-26	2002-11-29	ENSG00000008086	ENSG00000008086		"""Cyclin-dependent kinases"""	11411	protein-coding gene	gene with protein product		300203	"""serine/threonine kinase 9"""	STK9		9721213, 16935860	Standard	XM_005274584		Approved	EIEE2	uc004cym.3	O76039	OTTHUMG00000021214	ENST00000379989.3:c.1282G>T	X.37:g.18622326G>T	ENSP00000369325:p.Gly428Cys	Somatic	0	56	0.00		0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70	G9B9X4|Q14198|Q5H985|Q8IYC7|Q9UJL6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.G428C	ENST00000379989.3	37	c.1282	CCDS14186.1	X	.	.	.	.	.	.	.	.	.	.	G	16.76	3.212107	0.58452	.	.	ENSG00000008086	ENST00000379996;ENST00000379989	T;T	0.74632	-0.86;-0.86	6.06	6.06	0.98353	.	0.043072	0.85682	D	0.000000	T	0.80586	0.4651	L	0.29908	0.895	0.44302	D	0.997173	D	0.89917	1.0	D	0.69307	0.963	T	0.81364	-0.0966	10	0.56958	D	0.05	-19.3549	19.5011	0.95095	0.0:0.0:1.0:0.0	.	428	O76039	CDKL5_HUMAN	C	428	ENSP00000369332:G428C;ENSP00000369325:G428C	ENSP00000369325:G428C	G	+	1	0	CDKL5	18532247	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	6.399000	0.73248	2.560000	0.86352	0.600000	0.82982	GGC	-	NULL		0.453	CDKL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDKL5	protein_coding	OTTHUMT00000055945.2	G	NM_003159	-		18622326	+1	no_errors	ENST00000379989	ensembl	human	known	74_37	missense	SNP	1.000	T
BAP1	8314	genome.wustl.edu	37	3	52438591	52438591	+	Silent	SNP	G	G	A			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr3:52438591G>A	ENST00000460680.1	-	12	1599	c.1128C>T	c.(1126-1128)gaC>gaT	p.D376D	BAP1_ENST00000296288.5_Silent_p.D358D	NM_004656.2	NP_004647.1	Q99496	RING2_HUMAN	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)	0					anterior/posterior axis specification (GO:0009948)|gastrulation with mouth forming second (GO:0001702)|histone H2A monoubiquitination (GO:0035518)|histone H2A-K119 monoubiquitination (GO:0036353)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|MLL1 complex (GO:0071339)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|RING-like zinc finger domain binding (GO:0071535)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(3)|eye(42)|kidney(60)|large_intestine(3)|lung(9)|ovary(4)|pleura(39)|prostate(4)|skin(9)|urinary_tract(2)	180				BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)		CTGCCGCCAGGTCTTCTTCCT	0.587			"""N, Mis, F, S, O"""		"""uveal melanoma, breast, NSCLC, RCC"""	"""mesothelioma, uveal melanoma"""																															GBM(101;493 1458 7992 21037 25532)			Rec	yes		3	3p21.31-p21.2	8314	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)		E	0								ENSG00000163930						43.0	38.0	39.0					3																	52438591		2203	4300	6503	BAP1	SO:0001819	synonymous_variant	0			-	HGNC	AF045581	CCDS2853.1	3p21.31-p21.2	2014-09-17			ENSG00000163930	ENSG00000163930			950	protein-coding gene	gene with protein product		603089				9528852	Standard	NM_004656		Approved	hucep-6, KIAA0272, UCHL2	uc003ddx.4	Q92560	OTTHUMG00000158392	ENST00000460680.1:c.1128C>T	3.37:g.52438591G>A		Somatic	0	52	0.00		0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	51	23.88	B2RBS7|B3KRH1|Q5TEN1|Q5TEN2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_C12,prints_Peptidase_C12	p.D376	ENST00000460680.1	37	c.1128	CCDS2853.1	3																																																																																			-	NULL		0.587	BAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAP1	protein_coding	OTTHUMT00000350895.1	G		-		52438591	-1	no_errors	ENST00000460680	ensembl	human	known	74_37	silent	SNP	1.000	A
WHSC1	7468	genome.wustl.edu	37	4	1918632	1918632	+	Silent	SNP	G	G	A			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr4:1918632G>A	ENST00000382895.3	+	6	1226	c.795G>A	c.(793-795)caG>caA	p.Q265Q	WHSC1_ENST00000420906.2_Silent_p.Q265Q|WHSC1_ENST00000382891.5_Silent_p.Q265Q|WHSC1_ENST00000398261.1_Silent_p.Q265Q|WHSC1_ENST00000503128.1_Silent_p.Q265Q|WHSC1_ENST00000508803.1_Silent_p.Q265Q|WHSC1_ENST00000514045.1_Silent_p.Q265Q|WHSC1_ENST00000382892.2_Silent_p.Q265Q	NM_133330.2	NP_579877.1	O96028	NSD2_HUMAN	Wolf-Hirschhorn syndrome candidate 1	265	PWWP 1. {ECO:0000255|PROSITE- ProRule:PRU00162}.				anatomical structure morphogenesis (GO:0009653)|atrial septum primum morphogenesis (GO:0003289)|atrial septum secundum morphogenesis (GO:0003290)|bone development (GO:0060348)|membranous septum morphogenesis (GO:0003149)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(14)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|urinary_tract(3)	48		all_epithelial(65;1.34e-05)	OV - Ovarian serous cystadenocarcinoma(23;0.00606)	STAD - Stomach adenocarcinoma(129;0.232)		ATCACGTACAGTTCTTTGGTG	0.393			T	IGH@	MM																																			Dom	yes		4	4p16.3	7468	Wolf-Hirschhorn syndrome candidate 1(MMSET)		L	0								ENSG00000109685						86.0	91.0	89.0					4																	1918632		2203	4300	6503	WHSC1	SO:0001819	synonymous_variant	0			-	HGNC	AF083386	CCDS3356.1, CCDS33940.1, CCDS46999.1	4p16.3	2013-05-20			ENSG00000109685	ENSG00000109685		"""Zinc fingers, PHD-type"""	12766	protein-coding gene	gene with protein product		602952				9618163, 9787135	Standard	NM_133334		Approved	MMSET, NSD2	uc003gdz.4	O96028	OTTHUMG00000121147	ENST00000382895.3:c.795G>A	4.37:g.1918632G>A		Somatic	0	80	0.00		0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	62	50	55.36	A2A2T2|A2A2T3|A2A2T4|A7MCZ1|D3DVQ2|O96031|Q4VBY8|Q672J1|Q6IS00|Q86V01|Q9BZB4|Q9UI92|Q9UPR2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_PWWP_dom,pfam_SET_dom,pfam_Znf_PHD-finger,pfam_HMG_box_dom,superfamily_Znf_FYVE_PHD,superfamily_HMG_box_dom,smart_PWWP_dom,smart_HMG_box_dom,smart_Znf_PHD,smart_Znf_RING,smart_AWS,smart_SET_dom,smart_Post-SET_dom,pfscan_AWS,pfscan_PWWP_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_RING,pfscan_HMG_box_dom	p.Q265	ENST00000382895.3	37	c.795	CCDS33940.1	4																																																																																			-	pfam_PWWP_dom,smart_PWWP_dom,pfscan_PWWP_dom		0.393	WHSC1-008	KNOWN	basic|appris_principal|CCDS	protein_coding	WHSC1	protein_coding	OTTHUMT00000366269.2	G	NM_133330	-		1918632	+1	no_errors	ENST00000382891	ensembl	human	known	74_37	silent	SNP	1.000	A
TTC17	55761	genome.wustl.edu	37	11	43418289	43418289	+	Missense_Mutation	SNP	G	G	T			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr11:43418289G>T	ENST00000039989.4	+	6	708	c.694G>T	c.(694-696)Gct>Tct	p.A232S	RP11-484D2.4_ENST00000394183.2_RNA|TTC17_ENST00000299240.6_Missense_Mutation_p.A232S|TTC17_ENST00000526774.1_3'UTR	NM_018259.5	NP_060729.2	Q96AE7	TTC17_HUMAN	tetratricopeptide repeat domain 17	232					actin filament polymerization (GO:0030041)|cilium organization (GO:0044782)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(27)|ovary(5)|prostate(3)|skin(3)	53						GTATAACATGGCTTCATTTTA	0.388																																																	0								ENSG00000052841						131.0	125.0	127.0					11																	43418289		2202	4300	6502	TTC17	SO:0001583	missense	0			-	HGNC	AK001540	CCDS31466.1	11p11.2	2013-01-10			ENSG00000052841	ENSG00000052841		"""Tetratricopeptide (TTC) repeat domain containing"""	25596	protein-coding gene	gene with protein product						12477932	Standard	NM_018259		Approved	FLJ10890	uc001mxi.3	Q96AE7	OTTHUMG00000166398	ENST00000039989.4:c.694G>T	11.37:g.43418289G>T	ENSP00000039989:p.Ala232Ser	Somatic	0	41	0.00		0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	30	11.76	G3XAB3|Q8NEC0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TPR_1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.A232S	ENST00000039989.4	37	c.694	CCDS31466.1	11	.	.	.	.	.	.	.	.	.	.	G	35	5.512314	0.96402	.	.	ENSG00000052841	ENST00000299240;ENST00000039989	T;T	0.57273	0.41;0.41	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	T	0.72479	0.3465	M	0.68952	2.095	0.80722	D	1	D;P;D	0.89917	1.0;0.879;1.0	D;P;D	0.91635	0.998;0.76;0.999	T	0.69939	-0.5009	10	0.44086	T	0.13	-12.1418	19.9855	0.97347	0.0:0.0:1.0:0.0	.	232;232;232	Q8NEC0;Q96AE7;G3XAB3	.;TTC17_HUMAN;.	S	232	ENSP00000299240:A232S;ENSP00000039989:A232S	ENSP00000039989:A232S	A	+	1	0	TTC17	43374865	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	9.813000	0.99286	2.806000	0.96561	0.655000	0.94253	GCT	-	NULL		0.388	TTC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC17	protein_coding	OTTHUMT00000389577.2	G	NM_018259	-		43418289	+1	no_errors	ENST00000039989	ensembl	human	known	74_37	missense	SNP	1.000	T
RP11-435B5.5	0	genome.wustl.edu	37	1	143391795	143391795	+	lincRNA	SNP	G	G	A			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr1:143391795G>A	ENST00000428624.1	+	0	2011				RP11-435B5.4_ENST00000423249.1_lincRNA																							ATAAATCAGAGCTAGATGAAA	0.308																																																	0								ENSG00000238261																																			RP11-435B5.5			0			-	Clone_based_vega_gene																													1.37:g.143391795G>A		Somatic	0	392	0.00		0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	75	303	19.84		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000428624.1	37	NULL		1																																																																																			-	-		0.308	RP11-435B5.5-002	KNOWN	not_best_in_genome_evidence|basic	lincRNA	LOC101927345	lincRNA	OTTHUMT00000037971.1	G		-		143391795	+1	no_errors	ENST00000412492	ensembl	human	known	74_37	rna	SNP	0.855	A
EPS8	2059	genome.wustl.edu	37	12	15776223	15776224	+	Splice_Site	INS	-	-	A	rs147977740|rs35885542		TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr12:15776223_15776224insA	ENST00000281172.5	-	20	2662		c.e20-2		EPS8_ENST00000540613.1_Splice_Site|EPS8_ENST00000543612.1_Splice_Site|EPS8_ENST00000542903.1_Splice_Site|EPS8_ENST00000543523.1_Splice_Site	NM_004447.5	NP_004438.3	Q12929	EPS8_HUMAN	epidermal growth factor receptor pathway substrate 8						actin crosslink formation (GO:0051764)|actin cytoskeleton reorganization (GO:0031532)|actin filament bundle assembly (GO:0051017)|actin polymerization-dependent cell motility (GO:0070358)|adult locomotory behavior (GO:0008344)|barbed-end actin filament capping (GO:0051016)|behavioral response to ethanol (GO:0048149)|cell proliferation (GO:0008283)|dendritic cell migration (GO:0036336)|epidermal growth factor receptor signaling pathway (GO:0007173)|exit from mitosis (GO:0010458)|positive regulation of signal transduction (GO:0009967)|Rac protein signal transduction (GO:0016601)|regulation of actin filament length (GO:0030832)|regulation of cell shape (GO:0008360)|signal transduction (GO:0007165)	cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|postsynaptic density (GO:0014069)|ruffle membrane (GO:0032587)|stereocilium (GO:0032420)|vesicle (GO:0031982)	actin binding (GO:0003779)|Rac GTPase binding (GO:0048365)|SH3/SH2 adaptor activity (GO:0005070)	p.?(1)		NS(1)|breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	33		all_epithelial(100;1.87e-05)|Breast(259;0.000286)|Hepatocellular(102;0.244)		BRCA - Breast invasive adenocarcinoma(232;4.29e-05)|GBM - Glioblastoma multiforme(207;0.0264)		TTGACAGTCCTAAAAAAAAAAA	0.366																																																	1	Unknown(1)	lung(1)						ENSG00000151491																																			EPS8	SO:0001630	splice_region_variant	0				HGNC	U12535	CCDS31753.1	12p12.3	2008-05-02				ENSG00000151491			3420	protein-coding gene	gene with protein product		600206				8084614	Standard	NM_004447		Approved		uc001rdb.3	Q12929		ENST00000281172.5:c.2226-2->T	12.37:g.15776234_15776234dupA		Somatic	0	51	0.00		0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	58	9.38	A6NMC3|A8K6W2|A8KA66|B4DX66|Q8N6J0	Splice_Site	INS	NA	NA	NA	NA	NA	NA	-	e19-2	ENST00000281172.5	37	c.2226-3_2226-2	CCDS31753.1	12																																																																																			-	-		0.366	EPS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPS8	protein_coding	OTTHUMT00000401093.1	-			Intron	15776224	-1	no_errors	ENST00000281172	ensembl	human	known	74_37	splice_site_ins	INS	1.000:0.000	A
CDK5RAP3	80279	genome.wustl.edu	37	17	46053334	46053334	+	Silent	SNP	A	A	G	rs202125432	byFrequency	TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr17:46053334A>G	ENST00000338399.4	+	8	859	c.753A>G	c.(751-753)gaA>gaG	p.E251E	RP11-6N17.9_ENST00000582262.1_RNA|CDK5RAP3_ENST00000536708.2_Silent_p.E276E	NM_176096.1	NP_788276.1	Q96JB5	CK5P3_HUMAN	CDK5 regulatory subunit associated protein 3	251					brain development (GO:0007420)|protein ufmylation (GO:0071569)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of neuron differentiation (GO:0045664)	membrane (GO:0016020)	protein kinase binding (GO:0019901)	p.E251E(1)		NS(1)|central_nervous_system(2)|cervix(3)|endometrium(3)|large_intestine(2)|lung(5)|prostate(1)|skin(1)	18						CTGTGGTGGAACGACCCCACC	0.602																																																	1	Substitution - coding silent(1)	prostate(1)						ENSG00000108465																																			CDK5RAP3	SO:0001819	synonymous_variant	0			-	HGNC	AF110322	CCDS42356.1, CCDS62232.1	17q21.2	2008-07-18				ENSG00000108465			18673	protein-coding gene	gene with protein product	"""ischemic heart CDK5 activator-binding protein C53"", ""LXXLL/leucine-zipper-containing ARFbinding protein"""	608202				10721722	Standard	NM_176096		Approved	MST016, FLJ13660, C53, IC53, HSF-27, OK/SW-cl.114, LZAP	uc010wlc.3	Q96JB5		ENST00000338399.4:c.753A>G	17.37:g.46053334A>G		Somatic	0	58	0.00		0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	86	16.50	B7Z6N4|D3DTU1|D3DTU2|F5H3I5|Q53FA2|Q9H3F8|Q9H8G0|Q9HBR9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF773	p.E251	ENST00000338399.4	37	c.753	CCDS42356.1	17																																																																																			-	pfam_DUF773		0.602	CDK5RAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDK5RAP3	protein_coding	OTTHUMT00000442913.1	A	NM_176096	rs202125432		46053334	+1	no_errors	ENST00000338399	ensembl	human	known	74_37	silent	SNP	1.000	G
RAD21L1	642636	genome.wustl.edu	37	20	1221006	1221006	+	Nonsense_Mutation	SNP	G	G	T			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr20:1221006G>T	ENST00000409241.1	+	8	877	c.784G>T	c.(784-786)Gaa>Taa	p.E262*	RAD21L1_ENST00000402452.1_Nonsense_Mutation_p.E262*|RAD21L1_ENST00000381882.2_Nonsense_Mutation_p.E262*	NM_001136566.2	NP_001130038.2	Q9H4I0	RD21L_HUMAN	RAD21-like 1 (S. pombe)	262					attachment of telomeric heterochromatin to nuclear envelope (GO:0070197)|chromosome segregation (GO:0007059)|double-strand break repair via homologous recombination (GO:0000724)|fertilization (GO:0009566)|linear element assembly (GO:0030999)|seminiferous tubule development (GO:0072520)|spermatogenesis (GO:0007283)	chromosome (GO:0005694)|lateral element (GO:0000800)|meiotic cohesin complex (GO:0030893)|nuclear meiotic cohesin complex (GO:0034991)|nucleus (GO:0005634)				NS(1)|breast(1)|large_intestine(1)|lung(2)|skin(1)|stomach(1)	7						ACCTGAAAATGAAAAAATGAA	0.323																																																	0								ENSG00000244588						82.0	72.0	75.0					20																	1221006		692	1585	2277	RAD21L1	SO:0001587	stop_gained	0			-	HGNC	AL031665	CCDS46568.1	20p13	2011-08-12			ENSG00000244588	ENSG00000244588			16271	protein-coding gene	gene with protein product							Standard	NM_001136566		Approved	dJ545L17.2, RAD21L	uc010gab.1	Q9H4I0	OTTHUMG00000031664	ENST00000409241.1:c.784G>T	20.37:g.1221006G>T	ENSP00000386414:p.Glu262*	Somatic	0	82	0.00		0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00	B2RXL0|B7ZBB1|B7ZW76|Q5W0X5	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Rad21_Rec8_N,pfam_Rad21/Rec8_C_eu	p.E262*	ENST00000409241.1	37	c.784	CCDS46568.1	20	.	.	.	.	.	.	.	.	.	.	G	34	5.365830	0.95900	.	.	ENSG00000244588	ENST00000402452;ENST00000409241;ENST00000381882	.	.	.	4.27	3.26	0.37387	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06365	T	0.9	.	10.1307	0.42676	0.0:0.3286:0.6714:0.0	.	.	.	.	X	262	.	ENSP00000371306:E262X	E	+	1	0	RAD21L1	1169006	0.994000	0.37717	0.997000	0.53966	0.978000	0.69477	2.297000	0.43593	2.203000	0.70933	0.460000	0.39030	GAA	-	NULL		0.323	RAD21L1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	RAD21L1	protein_coding	OTTHUMT00000334022.1	G		-		1221006	+1	no_errors	ENST00000409241	ensembl	human	known	74_37	nonsense	SNP	0.340	T
OR52M1	119772	genome.wustl.edu	37	11	4566606	4566606	+	Nonsense_Mutation	SNP	C	C	G			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr11:4566606C>G	ENST00000360213.1	+	1	186	c.186C>G	c.(184-186)taC>taG	p.Y62*		NM_001004137.1	NP_001004137.1	Q8NGK5	O52M1_HUMAN	olfactory receptor, family 52, subfamily M, member 1	62						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(2)|lung(9)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	18		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;8.45e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0285)|LUSC - Lung squamous cell carcinoma(625;0.19)		AGCCCATGTACTTTTTCTTGT	0.517																																																	0								ENSG00000197790						147.0	137.0	140.0					11																	4566606		2201	4298	6499	OR52M1	SO:0001587	stop_gained	0			-	HGNC	AB065789	CCDS31353.1	11p15.4	2012-08-09	2002-11-13	2002-11-15	ENSG00000197790	ENSG00000197790		"""GPCR / Class A : Olfactory receptors"""	15225	protein-coding gene	gene with protein product			"""olfactory receptor, family 52, subfamily M, member 1 pseudogene"""	OR52M1P			Standard	NM_001004137		Approved		uc010qyf.2	Q8NGK5	OTTHUMG00000165706	ENST00000360213.1:c.186C>G	11.37:g.4566606C>G	ENSP00000353343:p.Tyr62*	Somatic	0	66	0.00		0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	91	18.02		Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.Y62*	ENST00000360213.1	37	c.186	CCDS31353.1	11	.	.	.	.	.	.	.	.	.	.	C	21.6	4.170650	0.78452	.	.	ENSG00000197790	ENST00000360213	.	.	.	4.71	1.83	0.25207	.	0.000000	0.42964	D	0.000635	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.6777	0.40050	0.0:0.7504:0.0:0.2496	.	.	.	.	X	62	.	ENSP00000353343:Y62X	Y	+	3	2	OR52M1	4523182	0.079000	0.21365	1.000000	0.80357	0.956000	0.61745	0.583000	0.23849	0.706000	0.31912	-0.136000	0.14681	TAC	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.517	OR52M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52M1	protein_coding	OTTHUMT00000385847.1	C	NM_001004137	-		4566606	+1	no_errors	ENST00000360213	ensembl	human	known	74_37	nonsense	SNP	0.685	G
OLFM3	118427	genome.wustl.edu	37	1	102269549	102269549	+	3'UTR	DEL	T	T	-			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr1:102269549delT	ENST00000338858.5	-	0	1681				OLFM3_ENST00000462354.1_5'UTR|OLFM3_ENST00000370103.4_3'UTR|OLFM3_ENST00000536598.1_3'UTR			Q96PB7	NOE3_HUMAN	olfactomedin 3						eye photoreceptor cell development (GO:0042462)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|synapse (GO:0045202)				breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(24)|ovary(3)|prostate(1)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(2)	43		all_epithelial(167;1.87e-06)|all_lung(203;8.12e-05)|Lung NSC(277;0.000189)		all cancers(265;0.0843)|Epithelial(280;0.0921)|COAD - Colon adenocarcinoma(174;0.145)		ACTTAAACTCTTTTTTTTTTT	0.338																																																	0								ENSG00000118733																																			OLFM3	SO:0001624	3_prime_UTR_variant	0				HGNC	AF397392	CCDS30781.1, CCDS72832.1	1p22	2008-05-23			ENSG00000118733	ENSG00000118733			17990	protein-coding gene	gene with protein product	"""optimedin"""	607567				12019210, 16115881	Standard	NM_001288821		Approved	NOE3	uc001dug.2	Q96PB7	OTTHUMG00000010941	ENST00000338858.5:c.*245A>-	1.37:g.102269549delT		Somatic	0	24	0.00		0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	30	11.76	Q5T3V6|Q6IMI7|Q6IMI8|Q6IMI9|Q6IMJ1|Q8TBG1|Q96PB2|Q96PB3|Q96PB4|Q96PB5|Q96PB6	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000338858.5	37	NULL		1																																																																																			-	-		0.338	OLFM3-001	KNOWN	basic|appris_principal	protein_coding	OLFM3	protein_coding	OTTHUMT00000030142.1	T				102269549	-1	no_errors	ENST00000462354	ensembl	human	known	74_37	rna	DEL	0.475	-
TRIM9	114088	genome.wustl.edu	37	14	51452697	51452697	+	Intron	SNP	G	G	C			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr14:51452697G>C	ENST00000298355.3	-	8	2725				TRIM9_ENST00000338969.5_Missense_Mutation_p.S586C|TRIM9_ENST00000557456.1_5'UTR	NM_015163.5	NP_055978.4	Q9C026	TRIM9_HUMAN	tripartite motif containing 9						negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of SNARE complex assembly (GO:0035544)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dendrite (GO:0030425)|synaptic vesicle (GO:0008021)	ligase activity (GO:0016874)|protein homodimerization activity (GO:0042803)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(4)|kidney(2)|large_intestine(7)|liver(1)|lung(11)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	all_epithelial(31;0.00418)|Breast(41;0.148)					AGACTGTAAAGAGGAATGCAA	0.517																																																	0								ENSG00000100505																																			TRIM9	SO:0001627	intron_variant	0			-	HGNC	AF220036	CCDS9703.1, CCDS45105.1	14q21.3	2013-02-11	2011-01-25		ENSG00000100505	ENSG00000100505		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Fibronectin type III domain containing"""	16288	protein-coding gene	gene with protein product		606555	"""tripartite motif-containing 9"""			11331580, 11524423	Standard	NM_015163		Approved	SPRING, RNF91	uc001wyx.4	Q9C026	OTTHUMG00000140291	ENST00000298355.3:c.1604-3876C>G	14.37:g.51452697G>C		Somatic	0	69	0.00		0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	51	25.00	D3DSB7|D3DSB8|Q92557|Q96D24|Q96NI4|Q9C025|Q9C027	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SPRY_rcpt,pfam_Fibronectin_type3,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,superfamily_Znf_FYVE_PHD,smart_Znf_RING,smart_Znf_B-box,smart_Bbox_C,smart_Fibronectin_type3,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Fibronectin_type3,pfscan_Znf_B-box,pfscan_Znf_RING	p.S586C	ENST00000298355.3	37	c.1757	CCDS9703.1	14	.	.	.	.	.	.	.	.	.	.	G	17.61	3.431788	0.62844	.	.	ENSG00000100505	ENST00000338969	T	0.71222	-0.55	6.08	6.08	0.98989	.	0.198684	0.44902	D	0.000406	D	0.85243	0.5652	.	.	.	0.80722	D	1	D	0.76494	0.999	D	0.79108	0.992	D	0.85936	0.1455	9	0.72032	D	0.01	.	17.828	0.88672	0.0:0.0:1.0:0.0	.	586	Q9C026-4	.	C	586	ENSP00000342970:S586C	ENSP00000342970:S586C	S	-	2	0	TRIM9	50522447	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.069000	0.71209	2.894000	0.99253	0.591000	0.81541	TCT	-	superfamily_ConA-like_lec_gl_sf		0.517	TRIM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM9	protein_coding	OTTHUMT00000276874.1	G	NM_015163	-		51452697	-1	no_errors	ENST00000338969	ensembl	human	known	74_37	missense	SNP	1.000	C
CACNA1A	773	genome.wustl.edu	37	19	13410062	13410062	+	Silent	SNP	G	G	A			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr19:13410062G>A	ENST00000360228.5	-	19	2384	c.2385C>T	c.(2383-2385)aaC>aaT	p.N795N	CACNA1A_ENST00000573710.2_Silent_p.N796N	NM_000068.3|NM_001127222.1|NM_001174080.1|NM_023035.2	NP_000059.3|NP_001120694.1|NP_001167551.1|NP_075461.2	O00555	CAC1A_HUMAN	calcium channel, voltage-dependent, P/Q type, alpha 1A subunit	796					adult walking behavior (GO:0007628)|behavioral response to pain (GO:0048266)|calcium ion import (GO:0070509)|calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cell death (GO:0008219)|cell growth (GO:0016049)|cellular chloride ion homeostasis (GO:0030644)|cerebellar molecular layer development (GO:0021679)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellum maturation (GO:0021590)|dendrite morphogenesis (GO:0048813)|energy reserve metabolic process (GO:0006112)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glucose metabolic process (GO:0006006)|hormone metabolic process (GO:0042445)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of hormone biosynthetic process (GO:0032353)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular process controlling balance (GO:0050885)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter metabolic process (GO:0042133)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|receptor clustering (GO:0043113)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion-dependent exocytosis (GO:0017158)|regulation of insulin secretion (GO:0050796)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|spinal cord motor neuron differentiation (GO:0021522)|sulfur amino acid metabolic process (GO:0000096)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmission of nerve impulse (GO:0019226)|vestibular nucleus development (GO:0021750)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|syntaxin binding (GO:0019905)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(25)|prostate(2)|urinary_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Loperamide(DB00836)|Pregabalin(DB00230)|Spironolactone(DB00421)|Verapamil(DB00661)	GGTCCATTTCGTTATACAGGG	0.622																																																	0								ENSG00000141837						63.0	69.0	67.0					19																	13410062		2058	4182	6240	CACNA1A	SO:0001819	synonymous_variant	0			-	HGNC	U79666	CCDS45998.1, CCDS45999.1	19p13	2014-09-17			ENSG00000141837	ENSG00000141837		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1388	protein-coding gene	gene with protein product		601011		CACNL1A4, SCA6, MHP1, MHP		8825650, 16382099, 23827678	Standard	NM_000068		Approved	Cav2.1, EA2, APCA, HPCA, FHM	uc010xne.2	O00555	OTTHUMG00000044590	ENST00000360228.5:c.2385C>T	19.37:g.13410062G>A		Somatic	0	117	0.00		0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	70	92	43.21	J3KP41|P78510|P78511|Q16290|Q92690|Q99790|Q99791|Q99792|Q99793|Q9NS88|Q9UDC4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCCAlpha1,prints_VDCC_P/Q_a1su	p.N795	ENST00000360228.5	37	c.2385	CCDS45998.1	19																																																																																			-	NULL		0.622	CACNA1A-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	CACNA1A	protein_coding	OTTHUMT00000104062.2	G	NM_000068	-		13410062	-1	no_errors	ENST00000360228	ensembl	human	known	74_37	silent	SNP	0.916	A
PSMF1	9491	genome.wustl.edu	37	20	1115769	1115769	+	Missense_Mutation	SNP	A	A	G	rs371369250		TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr20:1115769A>G	ENST00000335877.6	+	4	547	c.371A>G	c.(370-372)tAc>tGc	p.Y124C	PSMF1_ENST00000438768.2_Intron|PSMF1_ENST00000333082.3_Missense_Mutation_p.Y124C|PSMF1_ENST00000381898.4_Missense_Mutation_p.Y36C|PSMF1_ENST00000484891.1_3'UTR|PSMF1_ENST00000246015.4_Missense_Mutation_p.Y124C	NM_006814.3	NP_006805.2	Q92530	PSMF1_HUMAN	proteasome (prosome, macropain) inhibitor subunit 1 (PI31)	124	Important for homodimerization and interaction with FBXO7.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of proteasomal protein catabolic process (GO:1901799)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|proteasome core complex (GO:0005839)	endopeptidase inhibitor activity (GO:0004866)|proteasome binding (GO:0070628)			endometrium(1)|kidney(1)|large_intestine(3)|lung(8)	13						TGCAGGACCTACAAGAACAGT	0.557																																																	0								ENSG00000125818	A	CYS/TYR,CYS/TYR	0,4406		0,0,2203	106.0	92.0	97.0		371,371	5.0	1.0	20		97	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	PSMF1	NM_006814.3,NM_178578.2	194,194	0,1,6502	GG,GA,AA		0.0116,0.0,0.0077	probably-damaging,probably-damaging	124/272,124/272	1115769	1,13005	2203	4300	6503	PSMF1	SO:0001583	missense	0			-	HGNC	D88378	CCDS13010.1	20p13	2008-07-02			ENSG00000125818	ENSG00000125818		"""Proteasome (prosome, macropain) subunits"""	9571	protein-coding gene	gene with protein product	"""proteasome inhibitor hP131 subunit"""					10363639	Standard	NM_006814		Approved	PI31	uc002wen.4	Q92530	OTTHUMG00000031656	ENST00000335877.6:c.371A>G	20.37:g.1115769A>G	ENSP00000338039:p.Tyr124Cys	Somatic	0	68	0.00		0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	17	58.54	A0AVQ9|D3DVW3|Q9H4I1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_FP_dom,pfam_PI31_Prot_Reg	p.Y124C	ENST00000335877.6	37	c.371	CCDS13010.1	20	.	.	.	.	.	.	.	.	.	.	A	16.89	3.248454	0.59103	0.0	1.16E-4	ENSG00000125818	ENST00000333082;ENST00000381898;ENST00000381899;ENST00000454500;ENST00000246015;ENST00000335877	T;T;T;T;T	0.45668	0.89;0.89;0.89;0.89;0.89	4.98	4.98	0.66077	.	0.068468	0.64402	D	0.000012	T	0.60104	0.2243	M	0.61703	1.905	0.44789	D	0.997793	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.998;0.999;0.997;0.997	T	0.62426	-0.6857	10	0.59425	D	0.04	-15.9569	12.2968	0.54852	1.0:0.0:0.0:0.0	.	36;36;124;124	F5H4Z3;B4DUJ0;Q5QPM7;Q92530	.;.;.;PSMF1_HUMAN	C	124;36;124;36;124;124	ENSP00000327704:Y124C;ENSP00000371323:Y36C;ENSP00000371324:Y124C;ENSP00000246015:Y124C;ENSP00000338039:Y124C	ENSP00000246015:Y124C	Y	+	2	0	PSMF1	1063769	1.000000	0.71417	1.000000	0.80357	0.820000	0.46376	3.629000	0.54266	2.099000	0.63709	0.528000	0.53228	TAC	-	pfam_FP_dom		0.557	PSMF1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMF1	protein_coding	OTTHUMT00000077504.2	A	NM_178578	-		1115769	+1	no_errors	ENST00000333082	ensembl	human	known	74_37	missense	SNP	1.000	G
PIWIL2	55124	genome.wustl.edu	37	8	22138936	22138936	+	Silent	SNP	G	G	A			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr8:22138936G>A	ENST00000454009.2	+	4	842	c.333G>A	c.(331-333)aaG>aaA	p.K111K	PIWIL2_ENST00000521356.1_Silent_p.K111K|PIWIL2_ENST00000356766.6_Silent_p.K111K	NM_001135721.1	NP_001129193.1	Q8TC59	PIWL2_HUMAN	piwi-like RNA-mediated gene silencing 2	111					DNA methylation involved in gamete generation (GO:0043046)|gene silencing by RNA (GO:0031047)|germ-line stem cell maintenance (GO:0030718)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|oogenesis (GO:0048477)|piRNA metabolic process (GO:0034587)|positive regulation of meiosis I (GO:0060903)|positive regulation of translation (GO:0045727)|RNA 5'-end processing (GO:0000966)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|P granule (GO:0043186)|pi-body (GO:0071546)|polysome (GO:0005844)	mRNA binding (GO:0003729)|piRNA binding (GO:0034584)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(14)|lung(14)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)	46				Colorectal(74;0.018)|COAD - Colon adenocarcinoma(73;0.0707)		TGGTACGCAAGGACAGGGAGG	0.493																																																	0								ENSG00000197181						154.0	153.0	154.0					8																	22138936		2203	4300	6503	PIWIL2	SO:0001819	synonymous_variant	0			-	HGNC	AK001213	CCDS6029.1	8p24	2013-02-15	2013-02-15		ENSG00000197181	ENSG00000197181		"""Argonaute/PIWI family"""	17644	protein-coding gene	gene with protein product	"""Hiwi-like"", ""cancer/testis antigen 80"""	610312	"""piwi-like 2 (Drosophila)"""			11279525, 12906857	Standard	NM_018068		Approved	HILI, FLJ10351, Mili, CT80	uc003xbn.2	Q8TC59	OTTHUMG00000097767	ENST00000454009.2:c.333G>A	8.37:g.22138936G>A		Somatic	0	65	0.00		0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	78	18.75	A8K4S3|A8K8S5|B0AZN9|B0AZP2|B4DR22|E7ECA4|Q96SW6|Q9NW28	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Piwi,pfam_PAZ_dom,superfamily_RNaseH-like_dom,superfamily_PAZ_dom,smart_PAZ_dom,smart_Piwi,pfscan_PAZ_dom,pfscan_Piwi	p.K111	ENST00000454009.2	37	c.333	CCDS6029.1	8																																																																																			-	NULL		0.493	PIWIL2-003	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	PIWIL2	protein_coding	OTTHUMT00000375438.1	G		-		22138936	+1	no_errors	ENST00000356766	ensembl	human	known	74_37	silent	SNP	0.984	A
F7	2155	genome.wustl.edu	37	13	113765058	113765058	+	Missense_Mutation	SNP	A	A	G			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr13:113765058A>G	ENST00000375581.3	+	3	220	c.185A>G	c.(184-186)aAc>aGc	p.N62S	F7_ENST00000541084.1_Intron|F7_ENST00000473085.1_3'UTR|F7_ENST00000346342.3_Missense_Mutation_p.N40S	NM_000131.4	NP_000122.1	P08709	FA7_HUMAN	coagulation factor VII (serum prothrombin conversion accelerator)	62	Gla. {ECO:0000255|PROSITE- ProRule:PRU00463}.				blood coagulation (GO:0007596)|blood coagulation, extrinsic pathway (GO:0007598)|cellular protein metabolic process (GO:0044267)|circadian rhythm (GO:0007623)|organ regeneration (GO:0031100)|peptidyl-glutamic acid carboxylation (GO:0017187)|positive regulation of blood coagulation (GO:0030194)|positive regulation of cell migration (GO:0030335)|positive regulation of leukocyte chemotaxis (GO:0002690)|positive regulation of platelet-derived growth factor receptor signaling pathway (GO:0010641)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of protein kinase B signaling (GO:0051897)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)|response to estrogen (GO:0043627)|response to growth hormone (GO:0060416)|response to vitamin K (GO:0032571)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|glycoprotein binding (GO:0001948)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			large_intestine(4)|lung(9)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	16	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_cancers(25;0.118)|all_lung(25;0.0364)|all_epithelial(44;0.0393)|Lung NSC(25;0.128)|Breast(118;0.188)	all cancers(43;0.0737)|Epithelial(84;0.213)|BRCA - Breast invasive adenocarcinoma(86;0.218)		Coagulation Factor IX(DB00100)|Coagulation factor VIIa(DB00036)|Menadione(DB00170)	CGGCGCGCCAACGCGTTCCTG	0.692																																																	0								ENSG00000057593						13.0	11.0	12.0					13																	113765058		2037	3998	6035	F7	SO:0001583	missense	0			-	HGNC		CCDS9528.1, CCDS9529.1, CCDS73602.1	13q34	2014-02-03			ENSG00000057593	ENSG00000057593	3.4.21.21		3544	protein-coding gene	gene with protein product	"""eptacog alfa"", ""FVII coagulation protein"", ""factor VII"""	613878				3264725, 2511201	Standard	NM_000131		Approved		uc001vsv.4	P08709	OTTHUMG00000017373	ENST00000375581.3:c.185A>G	13.37:g.113765058A>G	ENSP00000364731:p.Asn62Ser	Somatic	0	142	0.00		0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	277	9.48	B0YJC8|Q14339|Q5JVF1|Q5JVF2|Q9UD52|Q9UD53|Q9UD54	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_Pept_S1A_FX,pfam_Peptidase_S1,pfam_GLA_domain,pfam_Peptidase_S1A_nudel,pfam_EG-like_dom,superfamily_Trypsin-like_Pept_dom,superfamily_GLA_domain,smart_GLA_domain,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_Peptidase_S1,prints_Peptidase_S1A,prints_GLA_domain,pfscan_EG-like_dom,pfscan_GLA_domain,pfscan_Peptidase_S1	p.N62S	ENST00000375581.3	37	c.185	CCDS9528.1	13	.	.	.	.	.	.	.	.	.	.	a	16.43	3.119783	0.56613	.	.	ENSG00000057593	ENST00000346342;ENST00000375581	D;D	0.99784	-6.74;-6.74	4.47	4.47	0.54385	Gamma-carboxyglutamic acid-rich (GLA) domain (3);Coagulation factor, subgroup, Gla domain (1);	0.121288	0.52532	N	0.000064	D	0.99591	0.9852	M	0.88310	2.945	0.80722	D	1	P;P	0.52316	0.948;0.952	P;P	0.50490	0.642;0.536	D	0.97684	1.0174	10	0.87932	D	0	.	13.8175	0.63301	1.0:0.0:0.0:0.0	.	40;62	P08709-2;P08709	.;FA7_HUMAN	S	40;62	ENSP00000329546:N40S;ENSP00000364731:N62S	ENSP00000329546:N40S	N	+	2	0	F7	112813059	0.998000	0.40836	0.515000	0.27774	0.002000	0.02628	3.906000	0.56340	1.661000	0.50771	0.412000	0.27726	AAC	-	pirsf_Pept_S1A_FX,superfamily_GLA_domain,smart_GLA_domain,pfscan_GLA_domain		0.692	F7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	F7	protein_coding	OTTHUMT00000045838.4	A	NM_000131	-		113765058	+1	no_errors	ENST00000375581	ensembl	human	known	74_37	missense	SNP	1.000	G
TEKT4P2	100132288	genome.wustl.edu	37	21	9908223	9908223	+	RNA	SNP	G	G	A	rs374471127	byFrequency	TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr21:9908223G>A	ENST00000416067.1	-	0	569					NR_037872.1|NR_038327.1				tektin 4 pseudogene 2																		GGAGAGGGTCGCAGCGAGGAG	0.627													.|||	279	0.0557109	0.0129	0.049	5008	,	,		23956	0.0942		0.0616	False		,,,				2504	0.0726																0								ENSG00000188681																																			TEKT4P2			0			-	HGNC			21p11.2	2012-10-03	2011-06-14	2011-06-14	ENSG00000188681	ENSG00000188681			40046	pseudogene	pseudogene			"""MAFF interacting protein-like"""	MAFIPL			Standard	NR_038327		Approved		uc021wgx.1		OTTHUMG00000172149		21.37:g.9908223G>A		Somatic	0	62	0.00		0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	8	20.00		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000416067.1	37	NULL		21																																																																																			-	-		0.627	TEKT4P2-002	KNOWN	basic	processed_transcript	TEKT4P2	pseudogene	OTTHUMT00000417115.1	G	NM_001033515	-		9908223	-1	no_errors	ENST00000416067	ensembl	human	known	74_37	rna	SNP	0.000	A
OR2T1	26696	genome.wustl.edu	37	1	248569970	248569970	+	Missense_Mutation	SNP	C	C	A			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr1:248569970C>A	ENST00000366474.1	+	1	675	c.675C>A	c.(673-675)aaC>aaA	p.N225K		NM_030904.1	NP_112166.1	O43869	OR2T1_HUMAN	olfactory receptor, family 2, subfamily T, member 1	225						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.N225K(1)		NS(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(24)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	39	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GGGAGATTAACCACTTCTTCT	0.512																																																	1	Substitution - Missense(1)	lung(1)						ENSG00000175143						144.0	131.0	135.0					1																	248569970		2203	4300	6503	OR2T1	SO:0001583	missense	0			-	HGNC	U86215	CCDS31115.1	1q44	2012-08-09			ENSG00000175143	ENSG00000175143		"""GPCR / Class A : Olfactory receptors"""	8277	protein-coding gene	gene with protein product						9500546	Standard	NM_030904		Approved	OR1-25	uc010pzm.2	O43869	OTTHUMG00000040450	ENST00000366474.1:c.675C>A	1.37:g.248569970C>A	ENSP00000355430:p.Asn225Lys	Somatic	0	44	0.00		0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	37	5	88.10	Q6IEZ9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.N225K	ENST00000366474.1	37	c.675	CCDS31115.1	1	.	.	.	.	.	.	.	.	.	.	c	15.68	2.905883	0.52333	.	.	ENSG00000175143	ENST00000366474	T	0.00115	8.71	4.75	0.61	0.17580	GPCR, rhodopsin-like superfamily (1);	0.000000	0.39834	U	0.001253	T	0.00271	0.0008	L	0.58428	1.81	0.09310	N	1	D	0.56746	0.977	P	0.62560	0.904	T	0.48725	-0.9010	10	0.72032	D	0.01	.	5.4531	0.16576	0.0:0.5441:0.1374:0.3185	.	225	O43869	OR2T1_HUMAN	K	225	ENSP00000355430:N225K	ENSP00000355430:N225K	N	+	3	2	OR2T1	246636593	0.004000	0.15560	0.213000	0.23690	0.856000	0.48823	-0.657000	0.05335	0.218000	0.20820	0.650000	0.86243	AAC	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.512	OR2T1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T1	protein_coding	OTTHUMT00000097346.2	C		-		248569970	+1	no_errors	ENST00000366474	ensembl	human	known	74_37	missense	SNP	0.054	A
TEFM	79736	genome.wustl.edu	37	17	29233372	29233372	+	5'UTR	SNP	G	G	T			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr17:29233372G>T	ENST00000581216.1	-	0	466				TEFM_ENST00000580840.1_5'Flank|ADAP2_ENST00000583688.1_3'UTR	NM_024683.3	NP_078959.3	Q96QE5	TEFM_HUMAN	transcription elongation factor, mitochondrial						DNA metabolic process (GO:0006259)|oxidative phosphorylation (GO:0006119)|regulation of transcription, DNA-templated (GO:0006355)|transcription from mitochondrial promoter (GO:0006390)	mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|ribonucleoprotein complex (GO:0030529)	DNA polymerase processivity factor activity (GO:0030337)|poly(A) RNA binding (GO:0044822)										GCAGTGGGTCGTCCGCGTCTG	0.711																																																	0								ENSG00000184060																																			ADAP2	SO:0001623	5_prime_UTR_variant	0			-	HGNC		CCDS42291.1	17q11.2	2011-12-12	2011-12-12	2011-12-12	ENSG00000172171	ENSG00000172171			26223	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 42"""	C17orf42		11468690, 10843809, 21278163	Standard	NM_024683		Approved	FLJ22729	uc002hfu.2	Q96QE5		ENST00000581216.1:c.-156C>A	17.37:g.29233372G>T		Somatic	0	14	0.00		0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	4	66.67	E1P655|Q6GPG5|Q6PJ19|Q96H04|Q9H5Z9	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000581216.1	37	NULL	CCDS42291.1	17																																																																																			-	-		0.711	TEFM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAP2	protein_coding	OTTHUMT00000444498.1	G	NM_024683	-		29233372	+1	no_errors	ENST00000583688	ensembl	human	putative	74_37	rna	SNP	0.000	T
UHRF1	29128	genome.wustl.edu	37	19	4962077	4962078	+	RNA	INS	-	-	A			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr19:4962077_4962078insA	ENST00000592666.1	+	0	4220_4221							Q96T88	UHRF1_HUMAN	ubiquitin-like with PHD and ring finger domains 1						cell cycle (GO:0007049)|cell proliferation (GO:0008283)|DNA repair (GO:0006281)|histone monoubiquitination (GO:0010390)|histone ubiquitination (GO:0016574)|maintenance of DNA methylation (GO:0010216)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of DNA topoisomerase (ATP-hydrolyzing) activity (GO:2000373)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein autoubiquitination (GO:0051865)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|heterochromatin (GO:0000792)|nuclear chromatin (GO:0000790)|nuclear heterochromatin (GO:0005720)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|replication fork (GO:0005657)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|hemi-methylated DNA-binding (GO:0044729)|histone binding (GO:0042393)|identical protein binding (GO:0042802)|ligase activity (GO:0016874)|methyl-CpG binding (GO:0008327)|methylated histone binding (GO:0035064)|nucleosomal histone binding (GO:0031493)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(7)|prostate(1)|upper_aerodigestive_tract(2)	16				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0276)		TATTAGGGAAGAATGAGACAAT	0.312																																																	0								ENSG00000034063																																			UHRF1			0				HGNC	AF129507	CCDS74262.1, CCDS74263.1	19p13.3	2012-04-20	2008-08-14		ENSG00000034063	ENSG00000276043		"""RING-type (C3HC4) zinc fingers"""	12556	protein-coding gene	gene with protein product		607990				10646863	Standard	NM_001048201		Approved	ICBP90, Np95, FLJ21925, RNF106	uc002mbo.3	Q96T88			19.37:g.4962079_4962079dupA		Somatic	0	8	0.00		0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	5	44.44	A0JBR2|A8K024|B2RBA9|Q2HIX7|Q8J022|Q9H6S6|Q9P115|Q9P1U7	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000592666.1	37	NULL		19																																																																																			-	-		0.312	UHRF1-006	KNOWN	sequence_error|basic	processed_transcript	UHRF1	processed_transcript	OTTHUMT00000450444.1	-	NM_001048201			4962078	+1	no_errors	ENST00000262952	ensembl	human	known	74_37	rna	INS	0.066:0.089	A
TMEM8C	389827	genome.wustl.edu	37	9	136384035	136384035	+	Silent	SNP	G	G	A			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr9:136384035G>A	ENST00000339996.3	-	3	461	c.360C>T	c.(358-360)ggC>ggT	p.G120G	TMEM8C_ENST00000413714.1_5'UTR	NM_001080483.2	NP_001073952.1	A6NI61	TMM8C_HUMAN	transmembrane protein 8C	120					muscle organ development (GO:0007517)|myoblast fusion (GO:0007520)|plasma membrane fusion (GO:0045026)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|large_intestine(2)|lung(4)	8						TGCCGATGGGGCCCGAGTACA	0.612																																																	0								ENSG00000187616						97.0	84.0	89.0					9																	136384035		2203	4300	6503	TMEM8C	SO:0001819	synonymous_variant	0			-	HGNC	BX324209	CCDS35170.1	9q34.2	2009-06-19		2009-06-19	ENSG00000187616	ENSG00000187616			33778	protein-coding gene	gene with protein product	"""transmembrane protein 226"""	615345					Standard	NM_001080483		Approved	TMEM226	uc011mdk.2	A6NI61	OTTHUMG00000131685	ENST00000339996.3:c.360C>T	9.37:g.136384035G>A		Somatic	0	60	0.00		0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	44	32.31		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF3522	p.G120	ENST00000339996.3	37	c.360	CCDS35170.1	9																																																																																			-	pfam_DUF3522		0.612	TMEM8C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM8C	protein_coding	OTTHUMT00000356200.2	G	NM_001080483	-		136384035	-1	no_errors	ENST00000339996	ensembl	human	known	74_37	silent	SNP	0.983	A
RNFT2	84900	genome.wustl.edu	37	12	117289548	117289549	+	3'UTR	INS	-	-	A	rs373885060		TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr12:117289548_117289549insA	ENST00000257575.4	+	0	3863_3864				RNFT2_ENST00000551251.1_Intron|RNFT2_ENST00000407967.3_Intron|RNFT2_ENST00000392549.2_Intron|RNFT2_ENST00000319176.7_Frame_Shift_Ins_p.K256fs			Q96EX2	RNFT2_HUMAN	ring finger protein, transmembrane 2							integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(3)|lung(1)|urinary_tract(1)	6	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.034)		agactctgtctaaaaaaaaaaa	0.505																																																	0								ENSG00000135119																																			RNFT2	SO:0001624	3_prime_UTR_variant	0				HGNC	AK027533	CCDS9180.2, CCDS44987.1	12q24.22	2013-01-09	2008-02-26	2008-02-26	ENSG00000135119	ENSG00000135119		"""RING-type (C3HC4) zinc fingers"""	25905	protein-coding gene	gene with protein product			"""transmembrane protein 118"""	TMEM118		12477932	Standard	NM_032814		Approved	FLJ14627	uc009zwn.3	Q96EX2	OTTHUMG00000150882	ENST00000257575.4:c.*2296->A	12.37:g.117289559_117289559dupA		Somatic	0	30	0.00		0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	25	16.67	E9PAM7|Q96SU5	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	NULL	p.K259fs	ENST00000257575.4	37	c.765_766	CCDS44987.1	12																																																																																			-	NULL		0.505	RNFT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNFT2	protein_coding	OTTHUMT00000320417.1	-	NM_032814			117289549	+1	no_errors	ENST00000319176	ensembl	human	putative	74_37	frame_shift_ins	INS	0.004:0.003	A
ZP4	57829	genome.wustl.edu	37	1	238053862	238053862	+	Missense_Mutation	SNP	G	G	T			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr1:238053862G>T	ENST00000366570.4	-	1	232	c.74C>A	c.(73-75)gCa>gAa	p.A25E	RP11-193H5.1_ENST00000450451.1_RNA	NM_021186.3	NP_067009.1	Q12836	ZP4_HUMAN	zona pellucida glycoprotein 4	25					acrosomal vesicle exocytosis (GO:0060478)|binding of sperm to zona pellucida (GO:0007339)|intracellular signal transduction (GO:0035556)|multicellular organism reproduction (GO:0032504)|negative regulation of binding of sperm to zona pellucida (GO:2000360)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of humoral immune response (GO:0002922)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of T cell proliferation (GO:0042102)|protein kinase A signaling (GO:0010737)|protein kinase C signaling (GO:0070528)|single fertilization (GO:0007338)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	acrosin binding (GO:0032190)|signal transducer activity (GO:0004871)			breast(6)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(8)|lung(42)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	73	Ovarian(103;0.103)	all_cancers(173;0.00175)|all_epithelial(177;0.162)|all_neural(198;0.164)|Melanoma(53;0.211)|Prostate(94;0.214)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)			ATAATCTGGTGCCTCAGGCTT	0.532																																					NSCLC(166;160 2029 11600 18754 19936)												0								ENSG00000116996						58.0	55.0	56.0					1																	238053862		2203	4300	6503	ZP4	SO:0001583	missense	0			-	HGNC	U05781	CCDS1615.1	1q43	2013-01-17			ENSG00000116996	ENSG00000116996		"""Zona pellucida glycoproteins"""	15770	protein-coding gene	gene with protein product		613514				7841460	Standard	NM_021186		Approved	ZPB	uc001hym.3	Q12836	OTTHUMG00000039586	ENST00000366570.4:c.74C>A	1.37:g.238053862G>T	ENSP00000355529:p.Ala25Glu	Somatic	0	34	0.00		0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	28	12.50	B2RAE1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ZP_dom,pfam_P_trefoil,superfamily_P_trefoil,smart_P_trefoil,smart_ZP_dom,pfscan_ZP_dom,prints_ZP_dom	p.A25E	ENST00000366570.4	37	c.74	CCDS1615.1	1	.	.	.	.	.	.	.	.	.	.	G	0.144	-1.099175	0.01843	.	.	ENSG00000116996	ENST00000366570	T	0.74737	-0.87	4.09	-1.55	0.08558	.	0.813731	0.10112	N	0.714619	T	0.54791	0.1880	L	0.36672	1.1	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.33266	-0.9875	10	0.11485	T	0.65	-2.0E-4	3.4304	0.07426	0.4246:0.0:0.3961:0.1793	.	25	Q12836	ZP4_HUMAN	E	25	ENSP00000355529:A25E	ENSP00000355529:A25E	A	-	2	0	ZP4	236120485	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.594000	0.05733	-0.073000	0.12842	0.563000	0.77884	GCA	-	NULL		0.532	ZP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZP4	protein_coding	OTTHUMT00000095476.1	G		-		238053862	-1	no_errors	ENST00000366570	ensembl	human	known	74_37	missense	SNP	0.000	T
SATB1	6304	genome.wustl.edu	37	3	18391133	18391135	+	In_Frame_Del	DEL	CTG	CTG	-			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	CTG	CTG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr3:18391133_18391135delCTG	ENST00000338745.6	-	11	3553_3555	c.1819_1821delCAG	c.(1819-1821)cagdel	p.Q607del	TBC1D5_ENST00000414318.2_Intron|SATB1_ENST00000417717.2_In_Frame_Del_p.Q639del|SATB1_ENST00000454909.2_In_Frame_Del_p.Q607del	NM_002971.4	NP_002962.1	Q01826	SATB1_HUMAN	SATB homeobox 1	607	Poly-Gln.				activated T cell proliferation (GO:0050798)|apoptotic process (GO:0006915)|CD4-positive, alpha-beta T cell differentiation (GO:0043367)|CD8-positive, alpha-beta T cell differentiation (GO:0043374)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|epidermis development (GO:0008544)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|reflex (GO:0060004)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nuclear heterochromatin (GO:0005720)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|breast(2)|endometrium(6)|large_intestine(4)|lung(10)|ovary(1)|skin(5)|upper_aerodigestive_tract(2)	32						GCGGCGGTGCctgctgctgctgc	0.606																																																	0								ENSG00000182568		,,	7,190,3727		2,0,3,5,180,1772					,,	-1.4	0.0			13	18,388,7346		2,0,14,7,374,3479	no	codingComplex,codingComplex,codingComplex	SATB1	NM_002971.4,NM_001195470.1,NM_001131010.2	,,	4,0,17,12,554,5251	A1A1,A1A2,A1R,A2A2,A2R,RR		5.2374,5.0204,5.1644	,,	,,		25,578,11073				SATB1	SO:0001651	inframe_deletion	0				HGNC		CCDS2631.1, CCDS56242.1	3p24.3	2011-07-19	2007-02-15		ENSG00000182568	ENSG00000182568		"""Homeoboxes / CUT class"""	10541	protein-coding gene	gene with protein product		602075	"""special AT-rich sequence binding protein 1 (binds to nuclear matrix/scaffold-associating DNA)"""			1505028	Standard	NM_002971		Approved		uc003cbj.3	Q01826	OTTHUMG00000129890	ENST00000338745.6:c.1819_1821delCAG	3.37:g.18391142_18391144delCTG	ENSP00000341024:p.Gln607del	Somatic	0	42	0.00		0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	44	10.20	B3KXF1|C9JTR6|Q59EQ0	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Hmoeo_CUT,pfam_Homeobox_dom,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Hmoeo_CUT	p.Q639in_frame_del	ENST00000338745.6	37	c.1917_1915	CCDS2631.1	3																																																																																			-	NULL		0.606	SATB1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SATB1	protein_coding	OTTHUMT00000252138.4	CTG	NM_001131010			18391135	-1	no_errors	ENST00000417717	ensembl	human	known	74_37	in_frame_del	DEL	0.002:0.133:0.926	-
OPRK1	4986	genome.wustl.edu	37	8	54163589	54163589	+	Silent	SNP	G	G	A			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr8:54163589G>A	ENST00000265572.3	-	2	306	c.9C>T	c.(7-9)tcC>tcT	p.S3S	OPRK1_ENST00000520287.1_Silent_p.S3S	NM_000912.3	NP_000903.2	P41145	OPRK_HUMAN	opioid receptor, kappa 1	3					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-inhibiting opioid receptor signaling pathway (GO:0031635)|behavior (GO:0007610)|defense response to virus (GO:0051607)|immune response (GO:0006955)|locomotory behavior (GO:0007626)|opioid receptor signaling pathway (GO:0038003)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|regulation of saliva secretion (GO:0046877)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	dynorphin receptor activity (GO:0038048)|opioid receptor activity (GO:0004985)			NS(2)|breast(3)|endometrium(3)|kidney(12)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(5)|urinary_tract(1)	43		all_epithelial(80;0.066)|Lung NSC(129;0.0804)|all_lung(136;0.136)			Alvimopan(DB06274)|Amitriptyline(DB00321)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Dezocine(DB01209)|Fentanyl(DB00813)|Heroin(DB01452)|Hydromorphone(DB00327)|Ketamine(DB01221)|Ketobemidone(DB06738)|Levorphanol(DB00854)|Loperamide(DB00836)|Menthol(DB00825)|Methylnaltrexone(DB06800)|Mianserin(DB06148)|Mirtazapine(DB00370)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Oxycodone(DB00497)|Pentazocine(DB00652)|Pethidine(DB00454)|Progesterone(DB00396)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tapentadol(DB06204)|Tramadol(DB00193)	TCTGGATCGGGGAGTCCATGG	0.711																																																	0								ENSG00000082556						6.0	9.0	8.0					8																	54163589		1954	4010	5964	OPRK1	SO:0001819	synonymous_variant	0			-	HGNC		CCDS6152.1, CCDS64895.1	8q11.2	2014-05-21			ENSG00000082556	ENSG00000082556		"""GPCR / Class A : Opioid receptors"""	8154	protein-coding gene	gene with protein product		165196				8188308	Standard	XM_005251252		Approved	KOR, OPRK	uc003xri.1	P41145	OTTHUMG00000164276	ENST00000265572.3:c.9C>T	8.37:g.54163589G>A		Somatic	0	29	0.00		0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	25	48.08	E5RHC9|Q499G4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfam_7TM_GPCR_serpentine_rcpt_Srx,prints_Kappa_opi_rcpt,prints_GPCR_Rhodpsn,prints_Opioid_rcpt,prints_Neuropept_B/W_rcpt,prints_Somatstn_rcpt,prints_NPY_rcpt,pfscan_GPCR_Rhodpsn_7TM	p.S3	ENST00000265572.3	37	c.9	CCDS6152.1	8																																																																																			-	NULL		0.711	OPRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OPRK1	protein_coding	OTTHUMT00000378048.1	G		-		54163589	-1	no_errors	ENST00000265572	ensembl	human	known	74_37	silent	SNP	0.999	A
SNX14	57231	genome.wustl.edu	37	6	86215589	86215589	+	3'UTR	SNP	A	A	G			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr6:86215589A>G	ENST00000314673.3	-	0	3113				SNX14_ENST00000346348.3_3'UTR|SNX14_ENST00000513865.1_3'UTR|SNX14_ENST00000369627.2_3'UTR|SNX14_ENST00000505648.1_3'UTR|SNX14_ENST00000508980.1_5'UTR	NM_153816.3	NP_722523.1	Q9Y5W7	SNX14_HUMAN	sorting nexin 14						protein transport (GO:0015031)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	integral component of membrane (GO:0016021)	phosphatidylinositol binding (GO:0035091)			NS(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(11)|skin(1)	22		all_cancers(76;4.83e-07)|Acute lymphoblastic leukemia(125;3.3e-08)|Prostate(29;2.55e-07)|all_hematologic(105;3.66e-05)|all_epithelial(107;0.000695)|Lung NSC(302;0.197)|all_lung(197;0.24)		BRCA - Breast invasive adenocarcinoma(108;0.0423)		ACAGCGATGTACATAATATAT	0.284																																																	0								ENSG00000135317																																			SNX14	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AF121863	CCDS5003.1, CCDS5004.1, CCDS75490.1	6q15	2008-10-22			ENSG00000135317	ENSG00000135317		"""Sorting nexins"""	14977	protein-coding gene	gene with protein product						11485546, 11736640	Standard	XM_005248738		Approved	RGS-PX2	uc003pkr.3	Q9Y5W7	OTTHUMG00000015140	ENST00000314673.3:c.*96T>C	6.37:g.86215589A>G		Somatic	0	24	0.00		0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	14	22.22	B4DI55|Q4VBR3|Q5TCF9|Q5TCG0|Q6NUI7|Q6PI37|Q9BSD1	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000314673.3	37	NULL	CCDS5004.1	6																																																																																			-	-		0.284	SNX14-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SNX14	protein_coding	OTTHUMT00000041393.2	A	NM_153816	-		86215589	-1	no_errors	ENST00000508980	ensembl	human	known	74_37	rna	SNP	1.000	G
CAPN7	23473	genome.wustl.edu	37	3	15253704	15253704	+	Missense_Mutation	SNP	G	G	A			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr3:15253704G>A	ENST00000253693.2	+	2	449	c.196G>A	c.(196-198)Gct>Act	p.A66T		NM_014296.2	NP_055111.1	Q9Y6W3	CAN7_HUMAN	calpain 7	66					positive regulation of epithelial cell migration (GO:0010634)|self proteolysis (GO:0097264)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|endopeptidase activity (GO:0004175)|MIT domain binding (GO:0090541)			breast(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(5)|ovary(1)|skin(2)	22						AAGAGTTCAAGCTCTACATTC	0.363																																																	0								ENSG00000131375						76.0	77.0	76.0					3																	15253704		2203	4300	6503	CAPN7	SO:0001583	missense	0			-	HGNC	AB028639	CCDS2624.1	3p24	2008-07-18			ENSG00000131375	ENSG00000131375			1484	protein-coding gene	gene with protein product	"""calpain like protease"", ""homolog of Aspergillus Nidulans PALB"""	606400				8163008, 10051333	Standard	NM_014296		Approved	PalBH	uc003bzn.3	Q9Y6W3	OTTHUMG00000129863	ENST00000253693.2:c.196G>A	3.37:g.15253704G>A	ENSP00000253693:p.Ala66Thr	Somatic	0	65	0.00		0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	42	40.85		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_C2_calpain_cat,pfam_MIT,pfam_Calpain_domain_III,superfamily_Calpain_domain_III,smart_MIT,smart_Peptidase_C2_calpain_cat,smart_Calpain_III,prints_Calpain_cysteine_protease,pfscan_Peptidase_C2_calpain_cat	p.A66T	ENST00000253693.2	37	c.196	CCDS2624.1	3	.	.	.	.	.	.	.	.	.	.	G	10.12	1.262019	0.23051	.	.	ENSG00000131375	ENST00000253693	T	0.69306	-0.39	5.49	5.49	0.81192	MIT (2);	0.115965	0.64402	D	0.000019	T	0.51398	0.1672	N	0.20986	0.625	0.51767	D	0.999934	B	0.14012	0.009	B	0.15052	0.012	T	0.51068	-0.8752	10	0.05351	T	0.99	-14.1306	18.9685	0.92706	0.0:0.0:1.0:0.0	.	66	Q9Y6W3	CAN7_HUMAN	T	66	ENSP00000253693:A66T	ENSP00000253693:A66T	A	+	1	0	CAPN7	15228708	1.000000	0.71417	0.996000	0.52242	0.805000	0.45488	6.713000	0.74686	2.591000	0.87537	0.555000	0.69702	GCT	-	pfam_MIT,smart_MIT		0.363	CAPN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAPN7	protein_coding	OTTHUMT00000252105.2	G	NM_014296	-		15253704	+1	no_errors	ENST00000253693	ensembl	human	known	74_37	missense	SNP	1.000	A
PABPC3	5042	genome.wustl.edu	37	13	25671027	25671027	+	Missense_Mutation	SNP	A	A	G	rs78826513	byFrequency	TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr13:25671027A>G	ENST00000281589.3	+	1	728	c.691A>G	c.(691-693)Aaa>Gaa	p.K231E		NM_030979.2	NP_112241.2	Q9H361	PABP3_HUMAN	poly(A) binding protein, cytoplasmic 3	231	RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA metabolic process (GO:0016071)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(21)|ovary(4)|pancreas(1)|skin(3)	47		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.0071)|Epithelial(112;0.0398)|OV - Ovarian serous cystadenocarcinoma(117;0.151)|GBM - Glioblastoma multiforme(144;0.222)|Lung(94;0.241)		TGGAAAATCCAAAGGATTTGG	0.418																																																	0								ENSG00000151846						81.0	76.0	78.0					13																	25671027		2203	4300	6503	PABPC3	SO:0001583	missense	0			-	HGNC	AF132026	CCDS9311.1	13q12-q13	2013-02-12	2001-11-28		ENSG00000151846	ENSG00000151846		"""RNA binding motif (RRM) containing"""	8556	protein-coding gene	gene with protein product	"""testis PABP"""	604680	"""poly(A)-binding protein, cytoplasmic 3"""	PABPL3		8432538, 10543404	Standard	NM_030979		Approved	PABP3, tPABP	uc001upy.3	Q9H361	OTTHUMG00000016601	ENST00000281589.3:c.691A>G	13.37:g.25671027A>G	ENSP00000281589:p.Lys231Glu	Somatic	0	73	0.00		0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	73	8.75	Q8NHV0|Q9H086	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RRM_dom,pfam_PABP_HYD,superfamily_PABP_HYD,smart_RRM_dom,smart_RRM_dom_euk,smart_PABP_HYD,pfscan_RRM_dom,tigrfam_PABP_1234	p.K231E	ENST00000281589.3	37	c.691	CCDS9311.1	13	.	.	.	.	.	.	.	.	.	.	A	14.76	2.631048	0.46944	.	.	ENSG00000151846	ENST00000281589	T	0.08807	3.05	0.993	0.993	0.19825	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.49916	U	0.000136	T	0.27063	0.0663	M	0.90198	3.095	0.34162	D	0.668825	D	0.65815	0.995	D	0.67725	0.953	T	0.36553	-0.9743	10	0.87932	D	0	.	6.1165	0.20130	1.0:0.0:0.0:0.0	.	231	Q9H361	PABP3_HUMAN	E	231	ENSP00000281589:K231E	ENSP00000281589:K231E	K	+	1	0	PABPC3	24569027	0.998000	0.40836	0.994000	0.49952	0.967000	0.64934	2.374000	0.44274	0.692000	0.31613	0.374000	0.22700	AAA	-	pfam_RRM_dom,smart_RRM_dom_euk,smart_RRM_dom,pfscan_RRM_dom,tigrfam_PABP_1234		0.418	PABPC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PABPC3	protein_coding	OTTHUMT00000044220.2	A	NM_030979	rs78826513		25671027	+1	no_errors	ENST00000281589	ensembl	human	known	74_37	missense	SNP	0.999	G
SLAIN2	57606	genome.wustl.edu	37	4	48380035	48380035	+	Nonsense_Mutation	SNP	C	C	T			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr4:48380035C>T	ENST00000264313.6	+	3	1079	c.661C>T	c.(661-663)Cga>Tga	p.R221*	SLAIN2_ENST00000512093.1_Nonsense_Mutation_p.R28*|SLAIN2_ENST00000506375.1_3'UTR	NM_020846.1	NP_065897.1	Q9P270	SLAI2_HUMAN	SLAIN motif family, member 2	221					cytoplasmic microtubule organization (GO:0031122)|microtubule nucleation (GO:0007020)|positive regulation of microtubule polymerization (GO:0031116)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(7)|prostate(1)	13						AACCCCAGTGCGACCTCCTAT	0.408																																																	0								ENSG00000109171						121.0	120.0	120.0					4																	48380035		1884	4110	5994	SLAIN2	SO:0001587	stop_gained	0			-	HGNC	BC006139	CCDS47051.1	4p12	2008-02-05	2006-09-12	2006-09-12	ENSG00000109171	ENSG00000109171			29282	protein-coding gene	gene with protein product		610492	"""KIAA1458"""	KIAA1458		16546155	Standard	NM_020846		Approved	FLJ21611	uc003gya.4	Q9P270	OTTHUMG00000161701	ENST00000264313.6:c.661C>T	4.37:g.48380035C>T	ENSP00000264313:p.Arg221*	Somatic	0	68	0.00		0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	61	10.29	A8K4P1|Q8N5R3	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.R221*	ENST00000264313.6	37	c.661	CCDS47051.1	4	.	.	.	.	.	.	.	.	.	.	C	20.9	4.062404	0.76187	.	.	ENSG00000109171	ENST00000264313;ENST00000512093	.	.	.	5.96	4.01	0.46588	.	0.123592	0.52532	D	0.000065	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.16420	T	0.52	-6.4436	12.3262	0.55011	0.5695:0.4305:0.0:0.0	.	.	.	.	X	221;28	.	ENSP00000264313:R221X	R	+	1	2	SLAIN2	48074792	1.000000	0.71417	0.997000	0.53966	0.385000	0.30292	2.594000	0.46189	1.462000	0.47948	0.655000	0.94253	CGA	-	NULL		0.408	SLAIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLAIN2	protein_coding	OTTHUMT00000365807.4	C	NM_020846	-		48380035	+1	no_errors	ENST00000264313	ensembl	human	known	74_37	nonsense	SNP	1.000	T
ZBED9	114821	genome.wustl.edu	37	6	28540109	28540109	+	Nonsense_Mutation	SNP	A	A	T			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr6:28540109A>T	ENST00000452236.2	-	4	4174	c.3557T>A	c.(3556-3558)tTa>tAa	p.L1186*		NM_052923.1	NP_443155.1														NS(3)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(14)|liver(1)|lung(29)|ovary(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(3)	71						aaaacattctaacaaatttgt	0.279																																																	0								ENSG00000232040						28.0	27.0	27.0					6																	28540109		2196	4283	6479	SCAND3	SO:0001587	stop_gained	0			-	HGNC																												ENST00000452236.2:c.3557T>A	6.37:g.28540109A>T	ENSP00000395259:p.Leu1186*	Somatic	0	91	0.00		0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	53	30.26		Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Tscrpt_reg_SCAN,pfam_Integrase_cat-core,pfam_HATC_dom_C,superfamily_Retrov_capsid_C,superfamily_RNaseH-like_dom,smart_Tscrpt_reg_SCAN,pfscan_Integrase_cat-core,pfscan_Tscrpt_reg_SCAN	p.L1186*	ENST00000452236.2	37	c.3557	CCDS34355.1	6	.	.	.	.	.	.	.	.	.	.	A	44	11.073195	0.99511	.	.	ENSG00000232040	ENST00000452236	.	.	.	2.53	1.35	0.21983	.	0.418923	0.16610	U	0.206938	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.16420	T	0.52	.	4.3809	0.11293	0.8374:0.0:0.1626:0.0	.	.	.	.	X	1186	.	ENSP00000395259:L1186X	L	-	2	0	SCAND3	28648088	1.000000	0.71417	0.986000	0.45419	0.995000	0.86356	1.021000	0.30040	0.391000	0.25143	0.533000	0.62120	TTA	-	superfamily_RNaseH-like_dom		0.279	SCAND3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	SCAND3	protein_coding	OTTHUMT00000043551.3	A		-		28540109	-1	no_errors	ENST00000452236	ensembl	human	known	74_37	nonsense	SNP	0.992	T
CTPS2	56474	genome.wustl.edu	37	X	16609019	16609020	+	Intron	INS	-	-	A			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chrX:16609019_16609020insA	ENST00000443824.1	-	18	2435				CTPS2_ENST00000380241.3_Intron|CTPS2_ENST00000483053.1_5'UTR|CTPS2_ENST00000359276.4_Intron	NM_001144002.1	NP_001137474.1	Q9NRF8	PYRG2_HUMAN	CTP synthase 2						'de novo' CTP biosynthetic process (GO:0044210)|glutamine metabolic process (GO:0006541)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|pyrimidine nucleotide metabolic process (GO:0006220)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|CTP synthase activity (GO:0003883)			breast(1)|endometrium(3)|large_intestine(4)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19	Hepatocellular(33;0.0997)					TAGCAAGGTATAAAAAAAAAAC	0.327																																																	0								ENSG00000047230																																			CTPS2	SO:0001627	intron_variant	0				HGNC	AF086422	CCDS14175.1	Xp22	2012-05-02	2012-05-02		ENSG00000047230	ENSG00000047230	6.3.4.2		2520	protein-coding gene	gene with protein product		300380	"""CTP synthase II"""			10899599	Standard	NM_001144002		Approved		uc004cxm.3	Q9NRF8	OTTHUMG00000021193	ENST00000443824.1:c.1692-34->T	X.37:g.16609029_16609029dupA		Somatic	0	41	0.00		0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	28	17.65	B3KWM2|Q9BRI0|Q9H809|Q9H8K9	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000443824.1	37	NULL	CCDS14175.1	X																																																																																			-	-		0.327	CTPS2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CTPS2	protein_coding	OTTHUMT00000055906.1	-	NM_019857			16609020	-1	no_errors	ENST00000483053	ensembl	human	known	74_37	rna	INS	0.000:0.000	A
POF1B	79983	genome.wustl.edu	37	X	84614563	84614563	+	Missense_Mutation	SNP	G	G	C			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chrX:84614563G>C	ENST00000262753.4	-	4	575	c.430C>G	c.(430-432)Cct>Gct	p.P144A	POF1B_ENST00000373145.3_Missense_Mutation_p.P144A	NM_024921.3	NP_079197.3	Q8WVV4	POF1B_HUMAN	premature ovarian failure, 1B	144						tight junction (GO:0005923)				central_nervous_system(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|liver(2)|lung(17)|ovary(1)|prostate(1)	35						ACCTGTTCAGGATTTTGTACT	0.333																																																	0								ENSG00000124429						166.0	145.0	152.0					X																	84614563		2203	4298	6501	POF1B	SO:0001583	missense	0			-	HGNC	BC017500	CCDS14452.1	Xq21.2	2008-02-05			ENSG00000124429	ENSG00000124429			13711	protein-coding gene	gene with protein product		300603				11299520	Standard	NM_024921		Approved	POF, FLJ22792	uc004eer.2	Q8WVV4	OTTHUMG00000021934	ENST00000262753.4:c.430C>G	X.37:g.84614563G>C	ENSP00000262753:p.Pro144Ala	Somatic	0	84	0.00		0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	52	51	50.49	A8K2U5|Q5H9E9|Q5H9F0|Q8NG12|Q9H5Y2|Q9H738|Q9H744	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.P144A	ENST00000262753.4	37	c.430	CCDS14452.1	X	.	.	.	.	.	.	.	.	.	.	G	11.72	1.724026	0.30593	.	.	ENSG00000124429	ENST00000262753;ENST00000373145;ENST00000276124	T;T	0.33438	1.42;1.41	4.77	3.88	0.44766	.	0.121898	0.37304	N	0.002144	T	0.27027	0.0662	L	0.50333	1.59	0.38207	D	0.94036	B;B	0.13594	0.008;0.002	B;B	0.14578	0.011;0.005	T	0.09952	-1.0651	10	0.40728	T	0.16	.	9.6613	0.39956	0.0:0.2064:0.7936:0.0	.	144;144	Q8WVV4-1;Q8WVV4	.;POF1B_HUMAN	A	144	ENSP00000262753:P144A;ENSP00000362238:P144A	ENSP00000262753:P144A	P	-	1	0	POF1B	84501219	1.000000	0.71417	1.000000	0.80357	0.909000	0.53808	2.522000	0.45572	0.978000	0.38470	0.506000	0.49869	CCT	-	NULL		0.333	POF1B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	POF1B	protein_coding	OTTHUMT00000057391.2	G	NM_024921	-		84614563	-1	no_errors	ENST00000373145	ensembl	human	known	74_37	missense	SNP	1.000	C
GBF1	8729	genome.wustl.edu	37	10	104117849	104117849	+	Missense_Mutation	SNP	G	G	T			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr10:104117849G>T	ENST00000369983.3	+	9	953	c.693G>T	c.(691-693)aaG>aaT	p.K231N		NM_001199378.1|NM_001199379.1|NM_004193.2	NP_001186307.1|NP_001186308.1|NP_004184.1	Q92538	GBF1_HUMAN	golgi brefeldin A resistant guanine nucleotide exchange factor 1	231					COPI coating of Golgi vesicle (GO:0048205)|membrane organization (GO:0061024)|positive regulation of GTPase activity (GO:0043547)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of ARF protein signal transduction (GO:0032012)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|vesicle-mediated transport (GO:0016192)|viral process (GO:0016032)	cis-Golgi network (GO:0005801)|endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisome (GO:0005777)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(14)|kidney(8)|large_intestine(15)|lung(19)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	71		Colorectal(252;0.0236)		Epithelial(162;5.16e-08)|all cancers(201;1.19e-06)		AGAAACAGAAGAGATCCCCTC	0.478																																																	0								ENSG00000107862						166.0	166.0	166.0					10																	104117849		2203	4300	6503	GBF1	SO:0001583	missense	0			-	HGNC	D87435	CCDS7533.1	10q24	2010-02-12	2010-02-12		ENSG00000107862	ENSG00000107862			4181	protein-coding gene	gene with protein product		603698	"""golgi-specific brefeldin A resistance factor 1"""			9828135	Standard	NM_004193		Approved	KIAA0248, ARF1GEF	uc001kux.2	Q92538	OTTHUMG00000018955	ENST00000369983.3:c.693G>T	10.37:g.104117849G>T	ENSP00000359000:p.Lys231Asn	Somatic	0	72	0.00		0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	28	12.50	Q5VXX3|Q96CK6|Q96HZ3|Q9H473	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Sec7_dom,superfamily_Sec7_dom,superfamily_ARM-type_fold,smart_Sec7_dom,pfscan_Sec7_dom	p.K231N	ENST00000369983.3	37	c.693	CCDS7533.1	10	.	.	.	.	.	.	.	.	.	.	G	15.03	2.711323	0.48517	.	.	ENSG00000107862	ENST00000369983	T	0.10573	2.86	5.92	4.05	0.47172	.	0.000000	0.85682	D	0.000000	T	0.19087	0.0458	M	0.66939	2.045	0.58432	D	0.999998	P;B;P;D	0.56035	0.509;0.322;0.956;0.974	B;B;B;P	0.51415	0.064;0.029;0.366;0.669	T	0.05599	-1.0875	10	0.16420	T	0.52	-20.9727	12.9667	0.58488	0.1328:0.0:0.8672:0.0	.	231;231;231;231	Q149P1;Q149P0;Q92538;Q504U7	.;.;GBF1_HUMAN;.	N	231	ENSP00000359000:K231N	ENSP00000359000:K231N	K	+	3	2	GBF1	104107839	1.000000	0.71417	0.995000	0.50966	0.981000	0.71138	1.427000	0.34881	0.816000	0.34421	0.555000	0.69702	AAG	-	superfamily_ARM-type_fold		0.478	GBF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GBF1	protein_coding	OTTHUMT00000050051.1	G		-		104117849	+1	no_errors	ENST00000369983	ensembl	human	known	74_37	missense	SNP	1.000	T
TXNDC16	57544	genome.wustl.edu	37	14	52907417	52907417	+	Missense_Mutation	SNP	G	G	T			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr14:52907417G>T	ENST00000281741.4	-	19	2239	c.1868C>A	c.(1867-1869)cCc>cAc	p.P623H	TXNDC16_ENST00000554399.1_5'UTR	NM_001160047.1|NM_020784.2	NP_001153519.1|NP_065835.2	Q9P2K2	TXD16_HUMAN	thioredoxin domain containing 16	623					cell redox homeostasis (GO:0045454)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)				breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(10)|prostate(3)|skin(1)	21	Breast(41;0.0716)					GAAATAACTGGGAAGATTTTC	0.343																																																	0								ENSG00000087301						57.0	55.0	56.0					14																	52907417		2203	4299	6502	TXNDC16	SO:0001583	missense	0			-	HGNC	AB037765	CCDS32083.1	14q22.1	2007-08-16	2007-08-16	2007-08-16		ENSG00000087301			19965	protein-coding gene	gene with protein product			"""KIAA1344"""	KIAA1344			Standard	NM_020784		Approved		uc001wzs.3	Q9P2K2		ENST00000281741.4:c.1868C>A	14.37:g.52907417G>T	ENSP00000281741:p.Pro623His	Somatic	0	47	0.00		0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52	A5PKW9|A7E260|A7MD07|B9EH67|Q9H9W7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Thioredoxin_domain,superfamily_Thioredoxin-like_fold	p.P623H	ENST00000281741.4	37	c.1868	CCDS32083.1	14	.	.	.	.	.	.	.	.	.	.	G	20.2	3.954325	0.73902	.	.	ENSG00000087301	ENST00000281741	T	0.31247	1.5	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	T	0.57095	0.2030	M	0.71581	2.175	0.58432	D	0.999992	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.59284	-0.7483	10	0.72032	D	0.01	-52.4122	17.9642	0.89094	0.0:0.0:1.0:0.0	.	618;623	B7ZME4;Q9P2K2	.;TXD16_HUMAN	H	623	ENSP00000281741:P623H	ENSP00000281741:P623H	P	-	2	0	TXNDC16	51977167	1.000000	0.71417	0.965000	0.40720	0.789000	0.44602	6.260000	0.72502	2.577000	0.86979	0.655000	0.94253	CCC	-	NULL		0.343	TXNDC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TXNDC16	protein_coding	OTTHUMT00000411681.1	G	XM_051699	-		52907417	-1	no_errors	ENST00000281741	ensembl	human	known	74_37	missense	SNP	0.996	T
ZDHHC13	54503	genome.wustl.edu	37	11	19138776	19138776	+	5'UTR	SNP	C	C	T			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr11:19138776C>T	ENST00000446113.2	+	0	101				ZDHHC13_ENST00000399351.3_5'UTR	NM_019028.2	NP_061901.2	Q8IUH4	ZDH13_HUMAN	zinc finger, DHHC-type containing 13						metabolic process (GO:0008152)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi-associated vesicle membrane (GO:0030660)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)	magnesium ion transmembrane transporter activity (GO:0015095)|palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|signal transducer activity (GO:0004871)|zinc ion binding (GO:0008270)			NS(1)|kidney(1)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	6						GTAGCCTCAGCCGCTGTGGGC	0.736																																																	0								ENSG00000177054						3.0	5.0	4.0					11																	19138776		1489	3316	4805	ZDHHC13	SO:0001623	5_prime_UTR_variant	0			-	HGNC	AB024495	CCDS44550.1, CCDS44551.1	11p15.1	2013-01-10			ENSG00000177054	ENSG00000177054		"""Zinc fingers, DHHC-type"", ""Ankyrin repeat domain containing"""	18413	protein-coding gene	gene with protein product		612815				18794299	Standard	NM_001001483		Approved	FLJ10852, FLJ10941, HIP14L	uc001mpi.3	Q8IUH4	OTTHUMG00000166099	ENST00000446113.2:c.-21C>T	11.37:g.19138776C>T		Somatic	0	41	0.00		0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	33	10.81	Q7Z2D3|Q86VK2|Q9NV30|Q9NV99	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000446113.2	37	NULL	CCDS44550.1	11																																																																																			-	-		0.736	ZDHHC13-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	ZDHHC13	protein_coding	OTTHUMT00000387821.1	C	NM_019028	-		19138776	+1	no_errors	ENST00000524744	ensembl	human	putative	74_37	rna	SNP	0.003	T
TAOK1	57551	genome.wustl.edu	37	17	27822611	27822611	+	Missense_Mutation	SNP	G	G	A			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr17:27822611G>A	ENST00000261716.3	+	11	1384	c.865G>A	c.(865-867)Gtg>Atg	p.V289M	TAOK1_ENST00000536202.1_Missense_Mutation_p.V289M	NM_020791.2	NP_065842.1	Q7L7X3	TAOK1_HUMAN	TAO kinase 1	289					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|execution phase of apoptosis (GO:0097194)|G2 DNA damage checkpoint (GO:0031572)|mitotic cell cycle (GO:0000278)|positive regulation of JNK cascade (GO:0046330)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein phosphorylation (GO:0006468)|regulation of cytoskeleton organization (GO:0051493)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transferase activity (GO:0016740)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(4)|lung(14)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	28			Colorectal(6;0.198)			CCCTGAAACCGTGTTAATAGA	0.413																																																	0								ENSG00000160551						112.0	108.0	109.0					17																	27822611		2203	4300	6503	TAOK1	SO:0001583	missense	0			-	HGNC	AB037782	CCDS32601.1, CCDS56024.1	17q11.2	2014-01-28				ENSG00000160551			29259	protein-coding gene	gene with protein product		610266				10718198, 14517247	Standard	NM_020791		Approved	KIAA1361, MARKK, PSK2, MAP3K16, FLJ14314, TAO1	uc002hdz.2	Q7L7X3		ENST00000261716.3:c.865G>A	17.37:g.27822611G>A	ENSP00000261716:p.Val289Met	Somatic	0	81	0.00		0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	59	24.36	A2RUT8|B7ZLV6|Q96L75|Q9H2K7|Q9H7S5|Q9P2I6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Homeodomain-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.V289M	ENST00000261716.3	37	c.865	CCDS32601.1	17	.	.	.	.	.	.	.	.	.	.	G	34	5.307465	0.95629	.	.	ENSG00000160551	ENST00000261716;ENST00000536202	D;D	0.86366	-2.11;-2.11	5.22	5.22	0.72569	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	D	0.93275	0.7857	M	0.77103	2.36	0.80722	D	1	D;D;D	0.76494	0.998;0.999;0.991	P;D;P	0.65773	0.893;0.938;0.673	D	0.93873	0.7164	10	0.87932	D	0	.	19.1509	0.93488	0.0:0.0:1.0:0.0	.	289;115;289	B7ZLV6;Q7L7X3-2;Q7L7X3	.;.;TAOK1_HUMAN	M	289	ENSP00000261716:V289M;ENSP00000438819:V289M	ENSP00000261716:V289M	V	+	1	0	TAOK1	24846737	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.660000	0.98599	2.599000	0.87857	0.563000	0.77884	GTG	-	superfamily_Kinase-like_dom		0.413	TAOK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAOK1	protein_coding	OTTHUMT00000447790.1	G	NM_020791	-		27822611	+1	no_errors	ENST00000261716	ensembl	human	known	74_37	missense	SNP	1.000	A
ETV1	2115	genome.wustl.edu	37	7	13971306	13971306	+	Missense_Mutation	SNP	C	C	A			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr7:13971306C>A	ENST00000430479.1	-	9	1290	c.623G>T	c.(622-624)cGt>cTt	p.R208L	ETV1_ENST00000242066.5_Missense_Mutation_p.R190L|ETV1_ENST00000476720.2_5'UTR|ETV1_ENST00000405192.2_Missense_Mutation_p.R208L|ETV1_ENST00000403685.1_Missense_Mutation_p.R190L|ETV1_ENST00000403527.1_Missense_Mutation_p.R168L|ETV1_ENST00000420159.2_Missense_Mutation_p.R150L|ETV1_ENST00000405358.4_Missense_Mutation_p.R222L|ETV1_ENST00000343495.5_Missense_Mutation_p.R190L|ETV1_ENST00000405218.2_Missense_Mutation_p.R208L|ETV1_ENST00000399357.3_Missense_Mutation_p.R105L	NM_004956.4	NP_004947.2	P50549	ETV1_HUMAN	ets variant 1	208					axon guidance (GO:0007411)|cell differentiation (GO:0030154)|mechanosensory behavior (GO:0007638)|muscle organ development (GO:0007517)|peripheral nervous system neuron development (GO:0048935)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)		TMPRSS2/ETV1(34)|ACSL3_ENST00000357430/ETV1(2)|EWSR1/ETV1(7)|KLK2/ETV1(3)|SLC45A3/ETV1(3)|HNRNPA2B1/ETV1(8)	breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(9)|lung(15)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	31						GTACATAGGACGTCCTTCCCT	0.502			T	"""EWSR1, TMPRSS2, SLC45A3, C15orf21, HNRNPA2B1. ACSL3"""	"""Ewing sarcoma, prostate"""																																			Dom	yes		7	7p22	2115	ets variant gene 1		"""M, E"""	0								ENSG00000006468						137.0	134.0	135.0					7																	13971306		2044	4191	6235	ETV1	SO:0001583	missense	0			-	HGNC		CCDS55083.1, CCDS55084.1, CCDS55085.1, CCDS55086.1, CCDS55087.1, CCDS55088.1	7p22	2008-09-12	2008-09-12		ENSG00000006468	ENSG00000006468			3490	protein-coding gene	gene with protein product		600541	"""ets variant gene 1"""			1340465	Standard	NM_004956		Approved	ER81	uc003ssw.4	P50549	OTTHUMG00000152403	ENST00000430479.1:c.623G>T	7.37:g.13971306C>A	ENSP00000405327:p.Arg208Leu	Somatic	0	90	0.00		0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	42	183	18.58	A4D118|B2R768|B7Z2I4|B7Z618|B7Z9P2|C9JT37|E9PHB1|F5GXR2|O75849|Q4KMQ6|Q59GA7|Q6AI30|Q9UQ71|Q9Y636	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ETS_PEA3_N,pfam_Ets_dom,smart_Ets_dom,pfscan_Ets_dom,prints_Ets_dom	p.R208L	ENST00000430479.1	37	c.623	CCDS55088.1	7	.	.	.	.	.	.	.	.	.	.	C	32	5.168572	0.94768	.	.	ENSG00000006468	ENST00000430479;ENST00000242066;ENST00000343495;ENST00000420159;ENST00000399357;ENST00000405192;ENST00000405358;ENST00000403527;ENST00000405218;ENST00000403685;ENST00000438956;ENST00000443608	T;T;T;T;T;T;T;T;T;T;T;T	0.26373	1.74;1.74;1.74;1.74;1.74;1.74;1.74;1.74;1.74;1.74;1.74;1.74	6.13	6.13	0.99165	PEA3-type ETS-domain transcription factor, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.47002	0.1422	L	0.47716	1.5	0.53688	D	0.999973	D;D;P;P;D;D;D;P	0.89917	0.982;1.0;0.82;0.891;0.997;0.998;0.966;0.898	P;D;B;P;D;D;P;P	0.85130	0.81;0.985;0.385;0.457;0.997;0.992;0.737;0.796	T	0.02983	-1.1086	10	0.27082	T	0.32	.	20.8401	0.99726	0.0:1.0:0.0:0.0	.	219;190;222;150;105;168;150;208	Q59GA7;P50549-2;B5MCT2;F5GXR2;B7Z9P2;E9PHB1;B7Z618;P50549	.;.;.;.;.;.;.;ETV1_HUMAN	L	208;190;190;150;105;208;222;168;208;190;150;105	ENSP00000405327:R208L;ENSP00000242066:R190L;ENSP00000340853:R190L;ENSP00000411626:R150L;ENSP00000382293:R105L;ENSP00000385381:R208L;ENSP00000384085:R222L;ENSP00000384138:R168L;ENSP00000385551:R208L;ENSP00000385686:R190L;ENSP00000393078:R150L;ENSP00000394710:R105L	ENSP00000242066:R190L	R	-	2	0	ETV1	13937831	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.291000	0.78721	2.932000	0.99384	0.644000	0.83932	CGT	-	pfam_ETS_PEA3_N		0.502	ETV1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	ETV1	protein_coding	OTTHUMT00000326111.1	C	NM_004956	-		13971306	-1	no_errors	ENST00000405218	ensembl	human	known	74_37	missense	SNP	1.000	A
KRT1	3848	genome.wustl.edu	37	12	53069223	53069243	+	In_Frame_Del	DEL	ACCTCCGGAGCCGTAGCTGCT	ACCTCCGGAGCCGTAGCTGCT	-	rs77846840|rs540699806|rs11170232|rs370799361|rs267607656	byFrequency	TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	ACCTCCGGAGCCGTAGCTGCT	ACCTCCGGAGCCGTAGCTGCT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr12:53069223_53069243delACCTCCGGAGCCGTAGCTGCT	ENST00000252244.3	-	9	1727_1747	c.1669_1689delAGCAGCTACGGCTCCGGAGGT	c.(1669-1689)agcagctacggctccggaggtdel	p.SSYGSGG557del		NM_006121.3	NP_006112.3	P04264	K2C1_HUMAN	keratin 1	557	Gly/Ser-rich.|Tail.				complement activation, lectin pathway (GO:0001867)|establishment of skin barrier (GO:0061436)|fibrinolysis (GO:0042730)|negative regulation of inflammatory response (GO:0050728)|regulation of angiogenesis (GO:0045765)|response to oxidative stress (GO:0006979)|retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|cytoskeleton (GO:0005856)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)|structural molecule activity (GO:0005198)	p.S557_G563delSSYGSGG(3)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(11)|ovary(1)|prostate(7)|skin(3)	39						catagctgccacctccggagccgtagctgctacctccggag	0.697														1779	0.355232	0.4372	0.3905	5008	,	,		11351	0.1349		0.3459	False		,,,				2504	0.456																3	Deletion - In frame(3)	prostate(2)|central_nervous_system(1)						ENSG00000167768			1255,1949		405,445,752						0.8	0.1		dbSNP_130	5	2781,3759		866,1049,1355	no	coding	KRT1	NM_006121.3		1271,1494,2107	A1A1,A1R,RR		42.5229,39.1698,41.4204				4036,5708				KRT1	SO:0001651	inframe_deletion	0				HGNC	X69725	CCDS8836.1	12q13.13	2014-06-05	2008-08-01		ENSG00000167768	ENSG00000167768		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6412	protein-coding gene	gene with protein product		139350	"""epidermolytic hyperkeratosis 1"""	EHK1		2461420, 2470667, 16831889	Standard	NM_006121		Approved	KRT1A	uc001sau.1	P04264	OTTHUMG00000169749	ENST00000252244.3:c.1669_1689delAGCAGCTACGGCTCCGGAGGT	12.37:g.53069223_53069243delACCTCCGGAGCCGTAGCTGCT	ENSP00000252244:p.Ser557_Gly563del	Somatic	NA	NA	NA		0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B2RA01|P85925|P86104|Q14720|Q6GSJ0|Q9H298	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_IF,superfamily_Prefoldin,prints_Keratin_II	p.SSYGSGG557in_frame_del	ENST00000252244.3	37	c.1689_1669	CCDS8836.1	12																																																																																			-	NULL		0.697	KRT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT1	protein_coding	OTTHUMT00000405706.1	ACCTCCGGAGCCGTAGCTGCT	NM_006121			53069243	-1	no_errors	ENST00000252244	ensembl	human	known	74_37	in_frame_del	DEL	0.630:0.649:0.647:0.620:0.134:0.123:0.092:0.297:0.354:0.356:0.356:0.216:0.007:0.001:0.003:0.006:0.057:0.050:0.289:0.318:0.300	-
ATRX	546	genome.wustl.edu	37	X	76938686	76938686	+	Nonsense_Mutation	SNP	T	T	A			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chrX:76938686T>A	ENST00000373344.5	-	9	2276	c.2062A>T	c.(2062-2064)Aaa>Taa	p.K688*	ATRX_ENST00000395603.3_Nonsense_Mutation_p.K650*|ATRX_ENST00000480283.1_5'UTR	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked	688					ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.?(1)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						AGTTTTTGTTTCTCCTTAACT	0.373			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome																																	Rec	yes		X	Xq21.1	546	alpha thalassemia/mental retardation syndrome X-linked	yes	E	1	Unknown(1)	bone(1)						ENSG00000085224						137.0	135.0	136.0					X																	76938686		2203	4295	6498	ATRX	SO:0001587	stop_gained	0			-	HGNC	U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.2062A>T	X.37:g.76938686T>A	ENSP00000362441:p.Lys688*	Somatic	0	28	0.00		0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	24	47.83	D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SNF2_N,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_Znf_FYVE_PHD,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.K688*	ENST00000373344.5	37	c.2062	CCDS14434.1	X	.	.	.	.	.	.	.	.	.	.	T	36	5.923794	0.97110	.	.	ENSG00000085224	ENST00000373344;ENST00000395603;ENST00000400862	.	.	.	5.12	2.67	0.31697	.	0.066111	0.64402	D	0.000020	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.7636	7.3742	0.26818	0.0:0.0764:0.1418:0.7818	.	.	.	.	X	688;650;615	.	ENSP00000362441:K688X	K	-	1	0	ATRX	76825342	1.000000	0.71417	0.873000	0.34254	0.246000	0.25737	3.918000	0.56432	0.147000	0.19030	-0.466000	0.05196	AAA	-	NULL		0.373	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATRX	protein_coding	OTTHUMT00000058860.2	T	NM_000489	-		76938686	-1	no_errors	ENST00000373344	ensembl	human	known	74_37	nonsense	SNP	0.984	A
SKAP1	8631	genome.wustl.edu	37	17	46507467	46507467	+	Missense_Mutation	SNP	G	G	A			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr17:46507467G>A	ENST00000336915.6	-	1	85	c.16C>T	c.(16-18)Ctc>Ttc	p.L6F	SKAP1_ENST00000584924.1_Missense_Mutation_p.L6F	NM_001075099.1|NM_003726.3	NP_001068567.1|NP_003717.3	Q86WV1	SKAP1_HUMAN	src kinase associated phosphoprotein 1	6					positive regulation of signal transduction (GO:0009967)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|SH2 domain binding (GO:0042169)|SH3 domain binding (GO:0017124)|SH3/SH2 adaptor activity (GO:0005070)			large_intestine(1)|lung(10)|prostate(2)|skin(4)|urinary_tract(1)	18						TCCTCAGGGAGGGCGGCGGCC	0.736																																																	0								ENSG00000141293						12.0	12.0	12.0					17																	46507467		2097	4159	6256	SKAP1	SO:0001583	missense	0			-	HGNC	Y11215	CCDS32674.1	17q21.32	2013-01-10	2006-09-28	2006-09-28		ENSG00000141293		"""Pleckstrin homology (PH) domain containing"""	15605	protein-coding gene	gene with protein product		604969	"""src family associated phosphoprotein 1"""	SCAP1		9195899	Standard	NM_003726		Approved	SKAP55	uc002ini.1	Q86WV1		ENST00000336915.6:c.16C>T	17.37:g.46507467G>A	ENSP00000338171:p.Leu6Phe	Somatic	0	109	0.00		0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	28	135	17.18	D3DTV1|O15268	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Pleckstrin_homology,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_SH3_domain,pfscan_Pleckstrin_homology,pfscan_SH3_domain,prints_SH3_domain	p.L6F	ENST00000336915.6	37	c.16	CCDS32674.1	17	.	.	.	.	.	.	.	.	.	.	G	11.32	1.603829	0.28534	.	.	ENSG00000141293	ENST00000336915	T	0.37752	1.18	2.8	2.8	0.32819	.	0.482934	0.17798	U	0.161664	T	0.40670	0.1126	L	0.56769	1.78	0.28100	N	0.931466	P;D	0.54772	0.806;0.968	B;P	0.50970	0.312;0.655	T	0.29671	-1.0004	10	0.72032	D	0.01	.	6.8364	0.23939	0.0:0.0:0.7232:0.2768	.	6;6	Q86WV1-2;Q86WV1	.;SKAP1_HUMAN	F	6	ENSP00000338171:L6F	ENSP00000338171:L6F	L	-	1	0	SKAP1	43862466	0.999000	0.42202	1.000000	0.80357	0.520000	0.34377	3.515000	0.53429	1.408000	0.46895	0.185000	0.17295	CTC	-	NULL		0.736	SKAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SKAP1	protein_coding	OTTHUMT00000443432.1	G	NM_003726	-		46507467	-1	no_errors	ENST00000336915	ensembl	human	known	74_37	missense	SNP	0.998	A
KATNAL1	84056	genome.wustl.edu	37	13	30829681	30829681	+	Missense_Mutation	SNP	G	G	A			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr13:30829681G>A	ENST00000380615.3	-	4	562	c.395C>T	c.(394-396)gCc>gTc	p.A132V	KATNAL1_ENST00000380617.3_Missense_Mutation_p.A132V	NM_032116.4	NP_115492.1			katanin p60 subunit A-like 1											autonomic_ganglia(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(5)|skin(1)|urinary_tract(3)	19		Lung SC(185;0.0257)		all cancers(112;0.114)|OV - Ovarian serous cystadenocarcinoma(117;0.213)		AGGTCCCCGGGCTCCTACTCC	0.453																																																	0								ENSG00000102781						222.0	234.0	230.0					13																	30829681		2203	4300	6503	KATNAL1	SO:0001583	missense	0			-	HGNC	AK097423	CCDS31956.1	13q12.3	2010-04-21			ENSG00000102781	ENSG00000102781		"""ATPases / AAA-type"""	28361	protein-coding gene	gene with protein product		614764				12477932	Standard	NM_001014380		Approved	MGC2599	uc001uss.4	Q9BW62	OTTHUMG00000016665	ENST00000380615.3:c.395C>T	13.37:g.30829681G>A	ENSP00000369989:p.Ala132Val	Somatic	0	140	0.00		0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	61	53	52.59		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ATPase_AAA_core,pfam_Vps4_C,pfam_DNA_helicase_Holl-junc_RuvB_N,pfam_ATPase_AAA-2,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.A132V	ENST00000380615.3	37	c.395	CCDS31956.1	13	.	.	.	.	.	.	.	.	.	.	G	14.68	2.606766	0.46527	.	.	ENSG00000102781	ENST00000380615;ENST00000380617;ENST00000414289;ENST00000441394	D;D	0.94376	-3.41;-3.41	5.8	4.95	0.65309	.	0.486664	0.24443	N	0.038482	D	0.87593	0.6216	N	0.19112	0.55	0.40314	D	0.978758	B	0.02656	0.0	B	0.04013	0.001	T	0.82766	-0.0295	10	0.24483	T	0.36	0.0104	15.7122	0.77641	0.0:0.1372:0.8628:0.0	.	132	Q9BW62	KATL1_HUMAN	V	132	ENSP00000369989:A132V;ENSP00000369991:A132V	ENSP00000369989:A132V	A	-	2	0	KATNAL1	29727681	0.997000	0.39634	1.000000	0.80357	0.881000	0.50899	1.612000	0.36889	1.439000	0.47511	0.650000	0.86243	GCC	-	NULL		0.453	KATNAL1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	KATNAL1	protein_coding	OTTHUMT00000044346.2	G	NM_032116	-		30829681	-1	no_errors	ENST00000380615	ensembl	human	known	74_37	missense	SNP	1.000	A
PRKCQ	5588	genome.wustl.edu	37	10	6553127	6553127	+	Missense_Mutation	SNP	G	G	T			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr10:6553127G>T	ENST00000263125.5	-	3	247	c.148C>A	c.(148-150)Cct>Act	p.P50T	PRKCQ_ENST00000539722.1_5'UTR|PRKCQ_ENST00000397176.2_Missense_Mutation_p.P50T	NM_001282644.1|NM_006257.3	NP_001269573.1|NP_006248.1	Q04759	KPCT_HUMAN	protein kinase C, theta	50	C2.				apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|Fc-epsilon receptor signaling pathway (GO:0038095)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|membrane protein ectodomain proteolysis (GO:0006509)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of T cell apoptotic process (GO:0070233)|phototransduction, visible light (GO:0007603)|platelet activation (GO:0030168)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of T-helper 17 type immune response (GO:2000318)|positive regulation of T-helper 2 cell activation (GO:2000570)|protein ubiquitination (GO:0016567)|regulation of cell growth (GO:0001558)|regulation of platelet aggregation (GO:0090330)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|regulation of transcription, DNA-templated (GO:0006355)|rhodopsin mediated signaling pathway (GO:0016056)|T cell receptor signaling pathway (GO:0050852)	cytosol (GO:0005829)|immunological synapse (GO:0001772)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|liver(1)|lung(13)|ovary(4)|prostate(1)|skin(4)|stomach(2)	45					Tamoxifen(DB00675)	TACATGGTAGGCTTTTTCTGG	0.448																																					Ovarian(50;572 1126 10530 25349 30594)												0								ENSG00000065675						159.0	140.0	146.0					10																	6553127		2203	4300	6503	PRKCQ	SO:0001583	missense	0			-	HGNC	L07032	CCDS7079.1, CCDS55701.1, CCDS60482.1	10p15	2009-07-10			ENSG00000065675	ENSG00000065675	2.7.11.1		9410	protein-coding gene	gene with protein product		600448				8444877	Standard	NM_001282645		Approved		uc001ijj.2	Q04759	OTTHUMG00000017623	ENST00000263125.5:c.148C>A	10.37:g.6553127G>T	ENSP00000263125:p.Pro50Thr	Somatic	0	44	0.00		0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	51	8.93	B4DF52|Q14DH6|Q3MJF1|Q64FY5|Q9H508|Q9H549	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_C2_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pirsf_Prot_kin_PKC_delta,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_dom,prints_DAG/PE-bd,prints_Ser-Thr/Tyr_kinase_cat_dom	p.P50T	ENST00000263125.5	37	c.148	CCDS7079.1	10	.	.	.	.	.	.	.	.	.	.	G	26.4	4.734439	0.89482	.	.	ENSG00000065675	ENST00000263125;ENST00000397176	T;T	0.68025	-0.3;-0.26	5.33	5.33	0.75918	C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	D	0.82300	0.5007	M	0.75777	2.31	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.85130	0.993;0.997	T	0.82309	-0.0521	10	0.49607	T	0.09	.	19.4129	0.94683	0.0:0.0:1.0:0.0	.	50;50	Q04759-2;Q04759	.;KPCT_HUMAN	T	50	ENSP00000263125:P50T;ENSP00000380361:P50T	ENSP00000263125:P50T	P	-	1	0	PRKCQ	6593133	1.000000	0.71417	0.997000	0.53966	0.985000	0.73830	9.562000	0.98145	2.652000	0.90054	0.655000	0.94253	CCT	-	superfamily_C2_dom,pirsf_Prot_kin_PKC_delta		0.448	PRKCQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKCQ	protein_coding	OTTHUMT00000046665.1	G	NM_006257	-		6553127	-1	no_errors	ENST00000263125	ensembl	human	known	74_37	missense	SNP	1.000	T
CACNA2D3	55799	genome.wustl.edu	37	3	55107538	55107538	+	Silent	SNP	C	C	G			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr3:55107538C>G	ENST00000474759.1	+	36	3102	c.3054C>G	c.(3052-3054)ctC>ctG	p.L1018L	CACNA2D3_ENST00000490478.1_Silent_p.L924L|CACNA2D3_ENST00000478261.1_Intron|CACNA2D3_ENST00000288197.5_Silent_p.L1018L|CACNA2D3_ENST00000415676.2_Silent_p.L1018L	NM_018398.2	NP_060868.2	Q8IZS8	CA2D3_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 3	1018						integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(17)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(3)	59				KIRC - Kidney renal clear cell carcinoma(284;0.00287)|Kidney(284;0.00327)	Amlodipine(DB00381)|Nilvadipine(DB06712)|Spironolactone(DB00421)	GCAGCTGCCTCTGTGAATCTG	0.512																																																	0								ENSG00000157445						87.0	89.0	88.0					3																	55107538		2035	4185	6220	CACNA2D3	SO:0001819	synonymous_variant	0			-	HGNC	AJ272268	CCDS54598.1	3p21.1	2010-10-05	2008-02-26		ENSG00000157445	ENSG00000157445		"""Calcium channel subunits"""	15460	protein-coding gene	gene with protein product		606399				11245980	Standard	XM_005265318		Approved	HSA272268	uc003dhf.3	Q8IZS8	OTTHUMG00000158580	ENST00000474759.1:c.3054C>G	3.37:g.55107538C>G		Somatic	0	89	0.00		0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	59	71	45.38	B2RPL6|Q9NY16|Q9NY18	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_VWA_N,pfam_Cache_domain,pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	p.L1018	ENST00000474759.1	37	c.3054	CCDS54598.1	3																																																																																			-	NULL		0.512	CACNA2D3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNA2D3	protein_coding	OTTHUMT00000351402.1	C		-		55107538	+1	no_errors	ENST00000288197	ensembl	human	known	74_37	silent	SNP	1.000	G
RPL9	6133	genome.wustl.edu	37	4	39462463	39462464	+	5'Flank	INS	-	-	A			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr4:39462463_39462464insA	ENST00000449470.2	-	0	0				LIAS_ENST00000381846.1_Frame_Shift_Ins_p.K34fs|LIAS_ENST00000515061.1_3'UTR|LIAS_ENST00000261434.3_Frame_Shift_Ins_p.K34fs|LIAS_ENST00000513731.1_Frame_Shift_Ins_p.K34fs|LIAS_ENST00000340169.2_Frame_Shift_Ins_p.K34fs|RPL9_ENST00000295955.9_5'Flank	NM_001024921.2	NP_001020092.1	P32969	RL9_HUMAN	ribosomal protein L9						cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribosome (GO:0005840)	RNA binding (GO:0003723)|rRNA binding (GO:0019843)|structural constituent of ribosome (GO:0003735)	p.K36fs*31(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(1)|skin(1)	8						CCTTGCCAGATAAAAAAAAGGA	0.391																																																	1	Deletion - Frameshift(1)	large_intestine(1)						ENSG00000121897																																			LIAS	SO:0001631	upstream_gene_variant	0				HGNC	D14531	CCDS3452.1	4p13	2011-04-06			ENSG00000163682	ENSG00000163682		"""L ribosomal proteins"""	10369	protein-coding gene	gene with protein product		603686				8597601, 8415001	Standard	XM_005262661		Approved	L9	uc021sso.1	P32969	OTTHUMG00000099367		4.37:g.39462471_39462471dupA	Exception_encountered	Somatic	0	34	0.00		0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	46	9.80		Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_rSAM,smart_Elp3/MiaB/NifB,pirsf_Lipoyl_synth,tigrfam_Lipoyl_synth	p.E36fs	ENST00000449470.2	37	c.99_100	CCDS3452.1	4																																																																																			-	pirsf_Lipoyl_synth		0.391	RPL9-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LIAS	protein_coding	OTTHUMT00000361018.1	-				39462464	+1	no_errors	ENST00000261434	ensembl	human	known	74_37	frame_shift_ins	INS	0.695:0.641	A
SBNO1	55206	genome.wustl.edu	37	12	123812034	123812034	+	Missense_Mutation	SNP	T	T	C			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr12:123812034T>C	ENST00000602398.1	-	13	1758	c.1631A>G	c.(1630-1632)aAa>aGa	p.K544R	SBNO1_ENST00000420886.2_Missense_Mutation_p.K544R|SBNO1_ENST00000267176.4_Missense_Mutation_p.K543R|SBNO1_ENST00000602750.1_Missense_Mutation_p.K543R			A3KN83	SBNO1_HUMAN	strawberry notch homolog 1 (Drosophila)	544					regulation of transcription, DNA-templated (GO:0006355)					NS(2)|breast(6)|cervix(2)|endometrium(8)|kidney(3)|large_intestine(11)|lung(18)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(2)	62	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000701)|Epithelial(86;0.00197)		TTCCTCAATTTTGAAGGTCAC	0.368																																																	0								ENSG00000139697						64.0	64.0	64.0					12																	123812034		2203	4300	6503	SBNO1	SO:0001583	missense	0			-	HGNC	AK001563	CCDS9246.1, CCDS53844.1	12q24.31	2006-10-06	2006-10-06			ENSG00000139697			22973	protein-coding gene	gene with protein product		614274	"""sno, strawberry notch homolog 1 (Drosophila)"""				Standard	NM_018183		Approved	MOP3, FLJ10701, FLJ10833, Sno	uc010tap.2	A3KN83		ENST00000602398.1:c.1631A>G	12.37:g.123812034T>C	ENSP00000473665:p.Lys544Arg	Somatic	0	34	0.00		0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	29	23.68	Q05C06|Q3ZTS3|Q9H3T8|Q9NVB2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Helicase/UvrB_dom,superfamily_P-loop_NTPase,superfamily_Prismane-like	p.K544R	ENST00000602398.1	37	c.1631	CCDS53844.1	12	.	.	.	.	.	.	.	.	.	.	T	11.97	1.799009	0.31777	.	.	ENSG00000139697	ENST00000420886;ENST00000267176;ENST00000442601	T;T	0.30981	1.51;1.51	6.04	6.04	0.98038	.	0.000000	0.85682	D	0.000000	T	0.30916	0.0780	N	0.04203	-0.255	0.80722	D	1	B;B;D	0.71674	0.083;0.02;0.998	B;B;D	0.78314	0.127;0.078;0.991	T	0.24584	-1.0156	10	0.08599	T	0.76	-33.8024	16.5763	0.84648	0.0:0.0:0.0:1.0	.	544;543;542	A3KN83;A3KN83-2;A3KN83-3	SBNO1_HUMAN;.;.	R	544;543;543	ENSP00000387361:K544R;ENSP00000267176:K543R	ENSP00000267176:K543R	K	-	2	0	SBNO1	122377987	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.266000	0.72540	2.317000	0.78254	0.459000	0.35465	AAA	-	NULL		0.368	SBNO1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SBNO1	protein_coding	OTTHUMT00000467684.1	T	NM_018183	-		123812034	-1	no_errors	ENST00000420886	ensembl	human	known	74_37	missense	SNP	1.000	C
MEFV	4210	genome.wustl.edu	37	16	3299631	3299631	+	Missense_Mutation	SNP	G	G	A	rs104895116		TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr16:3299631G>A	ENST00000219596.1	-	3	1099	c.1060C>T	c.(1060-1062)Cgg>Tgg	p.R354W	MEFV_ENST00000536379.1_Missense_Mutation_p.R143W|MEFV_ENST00000339854.4_Missense_Mutation_p.R174W|MEFV_ENST00000541159.1_Missense_Mutation_p.R143W	NM_000243.2	NP_000234.1	O15553	MEFV_HUMAN	Mediterranean fever	354					inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of macrophage inflammatory protein 1 alpha production (GO:0071641)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity (GO:2001056)	cell projection (GO:0042995)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)	actin binding (GO:0003779)|zinc ion binding (GO:0008270)			NS(2)|biliary_tract(1)|breast(5)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(6)|lung(19)|ovary(3)|prostate(1)|skin(6)	50						TCCTGGCACCGGGGGCAGCCA	0.647																																																	0			GRCh37	CM035568	MEFV	M	rs104895116	ENSG00000103313						25.0	28.0	27.0					16																	3299631		2197	4300	6497	MEFV	SO:0001583	missense	0			-	HGNC	AF018080	CCDS10498.1, CCDS55981.1	16p13.3	2014-09-17			ENSG00000103313	ENSG00000103313		"""Tripartite motif containing / Tripartite motif containing"""	6998	protein-coding gene	gene with protein product	"""pyrin"""	608107		MEF		9288094	Standard	NM_000243		Approved	FMF, TRIM20	uc002cun.1	O15553	OTTHUMG00000129324	ENST00000219596.1:c.1060C>T	16.37:g.3299631G>A	ENSP00000219596:p.Arg354Trp	Somatic	0	87	0.00		0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	50	125	28.57	D3DUC0|F5H0Q3|Q3MJ84|Q96PN4|Q96PN5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DAPIN,pfam_SPRY_rcpt,pfam_Znf_B-box,superfamily_ConA-like_lec_gl_sf,superfamily_DEATH-like_dom,smart_Znf_B-box,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_DAPIN,pfscan_Znf_B-box,prints_Butyrophylin	p.R354W	ENST00000219596.1	37	c.1060	CCDS10498.1	16	.	.	.	.	.	.	.	.	.	.	G	15.93	2.979377	0.53827	.	.	ENSG00000103313	ENST00000545159;ENST00000219596;ENST00000339854;ENST00000541159;ENST00000536379;ENST00000534868	T;T;T;T	0.64991	-0.13;0.3;0.18;0.3	4.67	-1.56	0.08532	.	1.750020	0.03072	N	0.157340	T	0.62109	0.2401	L	0.40543	1.245	0.09310	N	1	D	0.69078	0.997	P	0.53313	0.723	T	0.54735	-0.8249	10	0.38643	T	0.18	-22.9296	7.1558	0.25637	0.0895:0.0:0.2769:0.6336	.	354	O15553	MEFV_HUMAN	W	354;354;174;143;143;143	ENSP00000219596:R354W;ENSP00000339639:R174W;ENSP00000438711:R143W;ENSP00000445079:R143W	ENSP00000219596:R354W	R	-	1	2	MEFV	3239632	0.000000	0.05858	0.000000	0.03702	0.111000	0.19643	0.551000	0.23361	-0.027000	0.13873	0.563000	0.77884	CGG	-	NULL		0.647	MEFV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MEFV	protein_coding	OTTHUMT00000251464.1	G	NM_000243	rs104895116		3299631	-1	no_errors	ENST00000219596	ensembl	human	known	74_37	missense	SNP	0.000	A
SGPL1	8879	genome.wustl.edu	37	10	72619225	72619225	+	Missense_Mutation	SNP	T	T	C			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr10:72619225T>C	ENST00000373202.3	+	7	784	c.584T>C	c.(583-585)cTg>cCg	p.L195P		NM_003901.3	NP_003892.2	O95470	SGPL1_HUMAN	sphingosine-1-phosphate lyase 1	195					androgen metabolic process (GO:0008209)|apoptotic signaling pathway (GO:0097190)|ceramide metabolic process (GO:0006672)|estrogen metabolic process (GO:0008210)|face morphogenesis (GO:0060325)|fatty acid metabolic process (GO:0006631)|fibroblast migration (GO:0010761)|hemopoiesis (GO:0030097)|kidney development (GO:0001822)|Leydig cell differentiation (GO:0033327)|luteinization (GO:0001553)|palate development (GO:0060021)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|post-embryonic development (GO:0009791)|regulation of multicellular organism growth (GO:0040014)|skeletal system morphogenesis (GO:0048705)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid catabolic process (GO:0030149)|sphingolipid metabolic process (GO:0006665)|vasculogenesis (GO:0001570)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)	carboxy-lyase activity (GO:0016831)|pyridoxal phosphate binding (GO:0030170)|sphinganine-1-phosphate aldolase activity (GO:0008117)			large_intestine(4)	4						GCTTGTTCCCTGTTCAATGGG	0.418																																					Colon(151;1054 2458 6676 40971)												0								ENSG00000166224						114.0	100.0	105.0					10																	72619225		2203	4300	6503	SGPL1	SO:0001583	missense	0			-	HGNC	AI128825	CCDS31216.1	10q21	2008-08-01			ENSG00000166224	ENSG00000166224			10817	protein-coding gene	gene with protein product		603729				9464245, 17090686	Standard	NM_003901		Approved	SPL	uc001jrm.3	O95470	OTTHUMG00000018421	ENST00000373202.3:c.584T>C	10.37:g.72619225T>C	ENSP00000362298:p.Leu195Pro	Somatic	0	153	0.00		0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	44	62	41.51	B2RBD4|Q7Z732|Q9ULG8|Q9UN89	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PyrdxlP-dep_de-COase,pfam_Aminotrans_V/Cys_dSase,pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase	p.L195P	ENST00000373202.3	37	c.584	CCDS31216.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	24.6|24.6	4.545706|4.545706	0.86022|0.86022	.|.	.|.	ENSG00000166224|ENSG00000166224	ENST00000409118|ENST00000373202;ENST00000299297	.|T;T	.|0.63580	.|0.22;-0.05	5.58|5.58	5.58|5.58	0.84498|0.84498	.|Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.85613|0.85613	0.5737|0.5737	H|H	0.96142|0.96142	3.775|3.775	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.87578	.|0.998	D|D	0.90257|0.90257	0.4298|0.4298	5|10	.|0.87932	.|D	.|0	-8.3496|-8.3496	15.3946|15.3946	0.74781|0.74781	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|195	.|O95470	.|SGPL1_HUMAN	R|P	109|195;178	.|ENSP00000362298:L195P;ENSP00000299297:L178P	.|ENSP00000299297:L178P	C|L	+|+	1|2	0|0	SGPL1|SGPL1	72289231|72289231	1.000000|1.000000	0.71417|0.71417	0.992000|0.992000	0.48379|0.48379	0.975000|0.975000	0.68041|0.68041	7.305000|7.305000	0.78891|0.78891	2.113000|2.113000	0.64589|0.64589	0.533000|0.533000	0.62120|0.62120	TGT|CTG	-	superfamily_PyrdxlP-dep_Trfase		0.418	SGPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SGPL1	protein_coding	OTTHUMT00000048533.1	T	NM_003901	-		72619225	+1	no_errors	ENST00000373202	ensembl	human	known	74_37	missense	SNP	1.000	C
MCC	4163	genome.wustl.edu	37	5	112824048	112824049	+	In_Frame_Ins	INS	-	-	GCC	rs35336557|rs531679771|rs370593160	byFrequency	TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr5:112824048_112824049insGCC	ENST00000408903.3	-	1	478_479	c.63_64insGGC	c.(61-66)ggcagc>ggcGGCagc	p.21_22insG		NM_001085377.1	NP_001078846	P23508	CRCM_HUMAN	mutated in colorectal cancers	0					negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of epithelial cell proliferation (GO:0050680)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			endometrium(4)|kidney(3)|large_intestine(15)|liver(2)|lung(8)|ovary(2)|pancreas(1)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42		all_cancers(142;5.89e-08)|all_epithelial(76;3.57e-11)|all_lung(232;0.000605)|Lung NSC(810;0.000697)|Colorectal(10;0.00146)|Prostate(80;0.00174)|Ovarian(225;0.0175)|Breast(839;0.198)		OV - Ovarian serous cystadenocarcinoma(64;2.04e-54)|Epithelial(69;9.69e-49)|all cancers(49;6.25e-44)|COAD - Colon adenocarcinoma(37;0.0432)|Colorectal(14;0.0766)		ctgctgccgctgccgccgccgc	0.738														1663	0.332069	0.0227	0.3487	5008	,	,		8489	0.5208		0.3668	False		,,,				2504	0.5082																0								ENSG00000171444																																			MCC	SO:0001652	inframe_insertion	0				HGNC		CCDS4111.1, CCDS43351.1	5q21-q22	2013-01-10			ENSG00000171444	ENSG00000171444		"""EF-hand domain containing"""	6935	protein-coding gene	gene with protein product		159350				1848370	Standard	NM_002387		Approved		uc003kql.4	P23508	OTTHUMG00000128804	ENST00000408903.3:c.61_63dupGGC	5.37:g.112824055_112824057dupGCC	ENSP00000386227:p.Gly22_Gly23dup	Somatic	0	26	0.00		0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	23	25.81	D3DT05|Q6ZR04	In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_USH1C-bd_PDZ_domain,superfamily_tRNA-bd_arm,smart_EF_hand_dom,pfscan_EF_hand_dom	p.21in_frame_insG	ENST00000408903.3	37	c.64_63	CCDS43351.1	5																																																																																			-	NULL		0.738	MCC-003	PUTATIVE	basic|appris_principal|CCDS	protein_coding	MCC	protein_coding	OTTHUMT00000370839.1	-	NM_001085377			112824049	-1	no_errors	ENST00000408903	ensembl	human	putative	74_37	in_frame_ins	INS	0.854:0.894	GCC
GPR112	139378	genome.wustl.edu	37	X	135426697	135426697	+	Missense_Mutation	SNP	G	G	T			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chrX:135426697G>T	ENST00000394143.1	+	6	1123	c.832G>T	c.(832-834)Gca>Tca	p.A278S	GPR112_ENST00000370652.1_Missense_Mutation_p.A278S|GPR112_ENST00000394141.1_Missense_Mutation_p.A73S|GPR112_ENST00000287534.4_Missense_Mutation_p.A215S|GPR112_ENST00000412101.1_Missense_Mutation_p.A73S	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	278					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					ACCTATATTTGCAACTGATTA	0.373																																																	0								ENSG00000156920						204.0	159.0	174.0					X																	135426697		2203	4300	6503	GPR112	SO:0001583	missense	0			-	HGNC	AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.832G>T	X.37:g.135426697G>T	ENSP00000377699:p.Ala278Ser	Somatic	0	59	0.00		0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70	A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_Pentaxin,superfamily_ConA-like_lec_gl_sf,smart_Pentaxin,smart_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	p.A278S	ENST00000394143.1	37	c.832	CCDS35409.1	X	.	.	.	.	.	.	.	.	.	.	g	4.994	0.184572	0.09495	.	.	ENSG00000156920	ENST00000394143;ENST00000370652;ENST00000412101;ENST00000287534;ENST00000394141	T;T;T;T;T	0.33865	1.42;1.42;1.39;1.52;1.39	4.27	-0.887	0.10587	.	.	.	.	.	T	0.18923	0.0454	N	0.19112	0.55	0.09310	N	1	B;B;B	0.28713	0.22;0.123;0.075	B;B;B	0.27076	0.076;0.042;0.019	T	0.19976	-1.0289	9	0.46703	T	0.11	.	3.0548	0.06181	0.4591:0.0:0.3411:0.1998	.	215;73;278	Q8IZF6-2;Q8IZF6-3;Q8IZF6	.;.;GP112_HUMAN	S	278;278;73;215;73	ENSP00000377699:A278S;ENSP00000359686:A278S;ENSP00000416526:A73S;ENSP00000287534:A215S;ENSP00000377697:A73S	ENSP00000287534:A215S	A	+	1	0	GPR112	135254363	0.205000	0.23458	0.003000	0.11579	0.044000	0.14063	0.339000	0.19875	-0.082000	0.12640	0.502000	0.49764	GCA	-	NULL		0.373	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GPR112	protein_coding	OTTHUMT00000286639.1	G		-		135426697	+1	no_errors	ENST00000370652	ensembl	human	known	74_37	missense	SNP	0.002	T
ZNF276	92822	genome.wustl.edu	37	16	89799797	89799797	+	Missense_Mutation	SNP	G	G	T	rs531487697		TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr16:89799797G>T	ENST00000443381.2	+	7	1354	c.1257G>T	c.(1255-1257)tgG>tgT	p.W419C	ZNF276_ENST00000568064.1_Missense_Mutation_p.W327C|ZNF276_ENST00000289816.5_Missense_Mutation_p.W344C|ZNF276_ENST00000446326.2_Missense_Mutation_p.W205C	NM_001113525.1	NP_001106997.1	Q8N554	ZN276_HUMAN	zinc finger protein 276	419					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(6)|prostate(1)	14		Lung NSC(15;2.19e-05)|all_lung(18;3.07e-05)|all_hematologic(23;0.0256)		BRCA - Breast invasive adenocarcinoma(80;0.0278)		AGCCCGGATGGAAGAAGAAGC	0.547																																																	0								ENSG00000158805						122.0	138.0	133.0					16																	89799797		2198	4300	6498	ZNF276	SO:0001583	missense	0			-	HGNC	AK026482	CCDS10986.1, CCDS45554.1	16q24.3	2014-02-17	2006-02-10	2006-02-10	ENSG00000158805	ENSG00000158805		"""Zinc fingers, C2H2-type"""	23330	protein-coding gene	gene with protein product	"""centromere protein Z"", ""zinc finger, AD-type"""	608460	"""zinc finger protein 276 homolog (mouse)"""	ZFP276		10936049, 20813266	Standard	NM_152287		Approved	MGC45417, ZNF477, CENPZ, CENP-Z, ZADT	uc002fos.4	Q8N554	OTTHUMG00000138050	ENST00000443381.2:c.1257G>T	16.37:g.89799797G>T	ENSP00000415836:p.Trp419Cys	Somatic	0	46	0.00		0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	30	11.76	Q0VGA1|Q2TBE8|Q3B7H7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_AD,pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.W419C	ENST00000443381.2	37	c.1257	CCDS45554.1	16	.	.	.	.	.	.	.	.	.	.	G	17.09	3.300071	0.60195	.	.	ENSG00000158805	ENST00000446326;ENST00000289816;ENST00000443381	T;T;T	0.06528	3.41;3.29;3.33	5.88	5.88	0.94601	.	0.000000	0.85682	D	0.000000	T	0.18299	0.0439	L	0.32530	0.975	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.998;0.998;0.998;0.999	T	0.00313	-1.1825	10	0.51188	T	0.08	-28.3367	19.2304	0.93836	0.0:0.0:1.0:0.0	.	257;419;205;344	B4DIT3;Q8N554;A8K186;Q8N554-2	.;ZN276_HUMAN;.;.	C	205;344;419	ENSP00000415999:W205C;ENSP00000289816:W344C;ENSP00000415836:W419C	ENSP00000289816:W344C	W	+	3	0	ZNF276	88327298	1.000000	0.71417	0.998000	0.56505	0.120000	0.20174	8.536000	0.90627	2.782000	0.95742	0.655000	0.94253	TGG	-	NULL		0.547	ZNF276-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF276	protein_coding	OTTHUMT00000422517.1	G	NM_152287	-		89799797	+1	no_errors	ENST00000443381	ensembl	human	known	74_37	missense	SNP	1.000	T
MLIP	90523	genome.wustl.edu	37	6	53986311	53986311	+	Missense_Mutation	SNP	C	C	A			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr6:53986311C>A	ENST00000274897.5	+	2	243	c.130C>A	c.(130-132)Cca>Aca	p.P44T	MLIP_ENST00000370877.2_Intron|MLIP_ENST00000358276.5_Missense_Mutation_p.P38T|MLIP_ENST00000511744.1_3'UTR|MLIP_ENST00000509997.1_Intron|MLIP_ENST00000370876.2_Intron|MLIP_ENST00000514921.1_Missense_Mutation_p.P44T|MLIP_ENST00000502396.1_Missense_Mutation_p.P55T	NM_138569.2	NP_612636.2	Q5VWP3	MLIP_HUMAN	muscular LMNA-interacting protein	44						nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|PML body (GO:0016605)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(16)|ovary(8)|skin(4)|stomach(1)|urinary_tract(1)	34						CAGAAGACTACCAACCCATAC	0.408																																																	0								ENSG00000146147						128.0	124.0	126.0					6																	53986311		2203	4300	6503	MLIP	SO:0001583	missense	0			-	HGNC	AK055530	CCDS4954.1, CCDS64448.1, CCDS64449.1	6p12.2-p12.1	2011-04-29	2011-04-29	2011-04-29	ENSG00000146147	ENSG00000146147			21355	protein-coding gene	gene with protein product	"""muscle-enriched A-type lamin interacting protein"""	614106	"""chromosome 6 open reading frame 142"""	C6orf142		21498514	Standard	NM_138569		Approved	MGC18257	uc011dxa.2	Q5VWP3	OTTHUMG00000014891	ENST00000274897.5:c.130C>A	6.37:g.53986311C>A	ENSP00000274897:p.Pro44Thr	Somatic	0	53	0.00		0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	68	16.05	B7Z2N0|D6RE05|Q96H08|Q96NF7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.P44T	ENST00000274897.5	37	c.130	CCDS4954.1	6	.	.	.	.	.	.	.	.	.	.	C	19.98	3.927572	0.73327	.	.	ENSG00000146147	ENST00000274897;ENST00000514921;ENST00000502396;ENST00000358276;ENST00000514433	T;T;T;T;T	0.61859	0.88;0.17;0.23;0.07;0.51	5.22	5.22	0.72569	.	0.000000	0.56097	D	0.000026	T	0.66406	0.2786	M	0.64997	1.995	0.31866	N	0.620329	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.91635	0.998;0.976;0.999	T	0.68205	-0.5470	10	0.87932	D	0	-6.1984	14.626	0.68621	0.0:1.0:0.0:0.0	.	55;44;44	Q5VWP3-3;Q5VWP3;D6RE05	.;MLIP_HUMAN;.	T	44;44;55;38;45	ENSP00000274897:P44T;ENSP00000425142:P44T;ENSP00000426290:P55T;ENSP00000351019:P38T;ENSP00000421444:P45T	ENSP00000274897:P44T	P	+	1	0	MLIP	54094270	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	4.199000	0.58426	2.599000	0.87857	0.655000	0.94253	CCA	-	NULL		0.408	MLIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MLIP	protein_coding	OTTHUMT00000040979.3	C	NM_138569	-		53986311	+1	no_errors	ENST00000274897	ensembl	human	known	74_37	missense	SNP	1.000	A
SEMA3C	10512	genome.wustl.edu	37	7	80535212	80535212	+	Intron	SNP	C	C	A			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr7:80535212C>A	ENST00000265361.3	-	2	665				SEMA3C_ENST00000419255.2_Intron|SEMA3C_ENST00000544525.1_Intron|SEMA3C_ENST00000536800.1_Intron|SEMA3C_ENST00000487621.1_Intron	NM_006379.3	NP_006370.1	Q99985	SEM3C_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C						axon guidance (GO:0007411)|blood vessel remodeling (GO:0001974)|cardiac right ventricle morphogenesis (GO:0003215)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|immune response (GO:0006955)|limb bud formation (GO:0060174)|neural crest cell migration (GO:0001755)|neural tube development (GO:0021915)|outflow tract morphogenesis (GO:0003151)|post-embryonic development (GO:0009791)|pulmonary myocardium development (GO:0003350)|response to drug (GO:0042493)|somitogenesis (GO:0001756)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	receptor activity (GO:0004872)			NS(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	34						ATGTAGCACACAGCATTGTAC	0.368																																																	0								ENSG00000075223																																			SEMA3C	SO:0001627	intron_variant	0			-	HGNC	AB000220	CCDS5596.1	7q21-q31	2013-01-11			ENSG00000075223	ENSG00000075223		"""Semaphorins"", ""Immunoglobulin superfamily / I-set domain containing"""	10725	protein-coding gene	gene with protein product		602645		SEMAE		7748561, 9168980	Standard	NM_006379		Approved	SemE	uc003uhj.3	Q99985	OTTHUMG00000023447	ENST00000265361.3:c.103+10782G>T	7.37:g.80535212C>A		Somatic	0	49	0.00		0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00	B4DRL8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.V42L	ENST00000265361.3	37	c.124	CCDS5596.1	7																																																																																			-	NULL		0.368	SEMA3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA3C	protein_coding	OTTHUMT00000253279.1	C	NM_006379	-		80535212	-1	no_errors	ENST00000411788	ensembl	human	known	74_37	missense	SNP	0.000	A
MRGPRX4	117196	genome.wustl.edu	37	11	18195645	18195645	+	Missense_Mutation	SNP	G	G	A			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr11:18195645G>A	ENST00000314254.3	+	1	1262	c.842G>A	c.(841-843)cGt>cAt	p.R281H	RP11-113D6.6_ENST00000527671.1_Intron	NM_054032.3	NP_473373.2	Q96LA9	MRGX4_HUMAN	MAS-related GPR, member X4	281						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(18)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	32						TTTAGGCAGCGTCAAAATAGG	0.498																																																	0								ENSG00000179817						88.0	89.0	89.0					11																	18195645		2199	4290	6489	MRGPRX4	SO:0001583	missense	0			-	HGNC	AY042216	CCDS7831.1	11p15.1	2013-10-10			ENSG00000179817	ENSG00000179817		"""GPCR / Class A : Orphans"""	17617	protein-coding gene	gene with protein product		607230				11551509	Standard	NM_054032		Approved	MRGX4	uc001mnv.1	Q96LA9	OTTHUMG00000166442	ENST00000314254.3:c.842G>A	11.37:g.18195645G>A	ENSP00000314042:p.Arg281His	Somatic	0	67	0.00		0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	52	33	61.18	Q3KNU3|Q3KNU4|Q502W0|Q8TDD6|Q8TDD7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.R281H	ENST00000314254.3	37	c.842	CCDS7831.1	11	.	.	.	.	.	.	.	.	.	.	G	7.726	0.698303	0.15106	.	.	ENSG00000179817	ENST00000314254	T	0.39592	1.07	2.85	-5.7	0.02421	.	0.934257	0.08943	N	0.871317	T	0.35158	0.0922	M	0.79011	2.435	0.09310	N	1	B	0.18461	0.028	B	0.13407	0.009	T	0.21724	-1.0237	10	0.21540	T	0.41	.	5.1213	0.14862	0.3667:0.0:0.4739:0.1594	.	281	Q96LA9	MRGX4_HUMAN	H	281	ENSP00000314042:R281H	ENSP00000314042:R281H	R	+	2	0	MRGPRX4	18152221	0.000000	0.05858	0.000000	0.03702	0.032000	0.12392	-1.029000	0.03585	-2.234000	0.00715	-1.179000	0.01719	CGT	-	NULL		0.498	MRGPRX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRGPRX4	protein_coding	OTTHUMT00000389788.1	G	NM_054032	-		18195645	+1	no_errors	ENST00000314254	ensembl	human	known	74_37	missense	SNP	0.000	A
AMOT	154796	genome.wustl.edu	37	X	112022791	112022791	+	Missense_Mutation	SNP	G	G	A			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chrX:112022791G>A	ENST00000524145.1	-	11	2665	c.2591C>T	c.(2590-2592)aCc>aTc	p.T864I	AMOT_ENST00000371959.3_Missense_Mutation_p.T864I|MIR4329_ENST00000582643.1_RNA|AMOT_ENST00000371962.1_Missense_Mutation_p.T632I|AMOT_ENST00000304758.1_Missense_Mutation_p.T455I			Q4VCS5	AMOT_HUMAN	angiomotin	864					actin cytoskeleton organization (GO:0030036)|blood vessel endothelial cell migration (GO:0043534)|cell migration involved in gastrulation (GO:0042074)|cell-cell junction assembly (GO:0007043)|cellular protein localization (GO:0034613)|chemotaxis (GO:0006935)|establishment of cell polarity involved in ameboidal cell migration (GO:0003365)|gastrulation with mouth forming second (GO:0001702)|hippo signaling (GO:0035329)|in utero embryonic development (GO:0001701)|negative regulation of angiogenesis (GO:0016525)|negative regulation of GTPase activity (GO:0034260)|negative regulation of vascular permeability (GO:0043116)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell size (GO:0045793)|positive regulation of embryonic development (GO:0040019)|positive regulation of stress fiber assembly (GO:0051496)|regulation of cell migration (GO:0030334)|regulation of small GTPase mediated signal transduction (GO:0051056)|vasculogenesis (GO:0001570)	actin filament (GO:0005884)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|ruffle (GO:0001726)|stress fiber (GO:0001725)|tight junction (GO:0005923)	angiostatin binding (GO:0043532)|receptor activity (GO:0004872)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	43						TTCAGTTTGGGTACTGCAGTC	0.592																																																	0								ENSG00000126016						116.0	77.0	91.0					X																	112022791		2203	4300	6503	AMOT	SO:0001583	missense	0			-	HGNC	AB028994	CCDS14563.1, CCDS48154.1	Xq23	2006-02-08			ENSG00000126016	ENSG00000126016			17810	protein-coding gene	gene with protein product		300410				11257124, 16043488, 12406577	Standard	NM_001113490		Approved	KIAA1071	uc004epr.3	Q4VCS5	OTTHUMG00000022216	ENST00000524145.1:c.2591C>T	X.37:g.112022791G>A	ENSP00000429013:p.Thr864Ile	Somatic	0	70	0.00		0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	92	9.80	Q504X5|Q9HD27|Q9UPT1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Angiomotin_C,superfamily_Prefoldin,prints_Angiomotin	p.T864I	ENST00000524145.1	37	c.2591	CCDS48154.1	X	.	.	.	.	.	.	.	.	.	.	G	22.5	4.292894	0.80914	.	.	ENSG00000126016	ENST00000304758;ENST00000371959;ENST00000371962;ENST00000524145;ENST00000432214	T;T;T;T	0.38722	1.49;1.12;1.34;1.12	5.5	5.5	0.81552	.	0.047914	0.85682	D	0.000000	T	0.63129	0.2485	M	0.68317	2.08	0.58432	D	0.999999	D	0.89917	1.0	D	0.69307	0.963	T	0.65047	-0.6263	10	0.56958	D	0.05	-15.4293	17.3331	0.87271	0.0:0.0:1.0:0.0	.	864	Q4VCS5	AMOT_HUMAN	I	455;864;632;864;104	ENSP00000305557:T455I;ENSP00000361027:T864I;ENSP00000361030:T632I;ENSP00000429013:T864I	ENSP00000305557:T455I	T	-	2	0	AMOT	111909447	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.676000	0.98643	2.305000	0.77605	0.529000	0.55759	ACC	-	NULL		0.592	AMOT-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AMOT	protein_coding	OTTHUMT00000378570.1	G	NM_133265	-		112022791	-1	no_errors	ENST00000371959	ensembl	human	known	74_37	missense	SNP	1.000	A
SOX3	6658	genome.wustl.edu	37	X	139586763	139586763	+	Missense_Mutation	SNP	G	G	A			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chrX:139586763G>A	ENST00000370536.2	-	1	462	c.463C>T	c.(463-465)Cgc>Tgc	p.R155C		NM_005634.2	NP_005625.2	P41225	SOX3_HUMAN	SRY (sex determining region Y)-box 3	155					central nervous system development (GO:0007417)|face development (GO:0060324)|hypothalamus development (GO:0021854)|negative regulation of neuron differentiation (GO:0045665)|neuron development (GO:0048666)|organ morphogenesis (GO:0009887)|pituitary gland development (GO:0021983)|sensory organ development (GO:0007423)|Sertoli cell development (GO:0060009)|sex determination (GO:0007530)|spermatid differentiation (GO:0048515)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R155C(1)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|pancreas(1)|skin(1)	10	Acute lymphoblastic leukemia(192;7.65e-05)					GCCATTTTGCGCCGCTGCCCG	0.632																																																	1	Substitution - Missense(1)	large_intestine(1)						ENSG00000134595						49.0	50.0	50.0					X																	139586763		2203	4300	6503	SOX3	SO:0001583	missense	0			-	HGNC		CCDS14669.1	Xq27.1	2013-10-17			ENSG00000134595	ENSG00000134595		"""SRY (sex determining region Y)-boxes"""	11199	protein-coding gene	gene with protein product		313430	"""panhypopituitarism"""	PHP		15800844	Standard	NM_005634		Approved		uc004fbd.1	P41225	OTTHUMG00000022544	ENST00000370536.2:c.463C>T	X.37:g.139586763G>A	ENSP00000359567:p.Arg155Cys	Somatic	0	142	0.00		0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	34	194	14.91	P35714|Q5JWI3|Q9NP49	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_HMG_box_dom,pfam_TF_SOX,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	p.R155C	ENST00000370536.2	37	c.463	CCDS14669.1	X	.	.	.	.	.	.	.	.	.	.	g	17.97	3.518465	0.64634	.	.	ENSG00000134595	ENST00000370536	D	0.99277	-5.67	4.12	4.12	0.48240	High mobility group, superfamily (1);High mobility group, HMG1/HMG2 (4);	0.000000	0.85682	U	0.000000	D	0.99465	0.9810	M	0.93197	3.39	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.98794	1.0737	9	.	.	.	.	10.1878	0.43009	0.0:0.0:0.8014:0.1986	.	155	P41225	SOX3_HUMAN	C	155	ENSP00000359567:R155C	.	R	-	1	0	SOX3	139414429	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.574000	0.53863	1.638000	0.50547	0.525000	0.51046	CGC	-	pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom		0.632	SOX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOX3	protein_coding	OTTHUMT00000058577.1	G		-		139586763	-1	no_errors	ENST00000370536	ensembl	human	known	74_37	missense	SNP	1.000	A
SH3BP5	9467	genome.wustl.edu	37	3	15300271	15300271	+	Intron	SNP	A	A	G			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr3:15300271A>G	ENST00000383791.3	-	7	1110				SH3BP5_ENST00000426925.1_Intron|SH3BP5_ENST00000408919.3_Intron|SH3BP5_ENST00000253688.5_Intron|SH3BP5-AS1_ENST00000413977.1_RNA|SH3BP5-AS1_ENST00000420195.1_RNA|SH3BP5-AS1_ENST00000436602.1_RNA	NM_004844.4	NP_004835.2	O60239	3BP5_HUMAN	SH3-domain binding protein 5 (BTK-associated)						intracellular signal transduction (GO:0035556)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	protein kinase inhibitor activity (GO:0004860)			NS(1)|endometrium(3)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)	12						AGAGAAAGTGAGGACCTTGGG	0.502																																																	0								ENSG00000224660																																			SH3BP5-AS1	SO:0001627	intron_variant	0			-	HGNC	AB005047	CCDS2625.2, CCDS43055.1	3p24.3	2008-07-10			ENSG00000131370	ENSG00000131370			10827	protein-coding gene	gene with protein product	"""SH3 binding protein"""	605612				9571151, 10339589	Standard	NM_004844		Approved	Sab	uc003bzp.2	O60239	OTTHUMG00000129859	ENST00000383791.3:c.889+66T>C	3.37:g.15300271A>G		Somatic	0	33	0.00		0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	35	10.26	B3KQW6|Q5JWV9	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000383791.3	37	NULL	CCDS2625.2	3																																																																																			-	-		0.502	SH3BP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SH3BP5-AS1	protein_coding	OTTHUMT00000340740.2	A	NM_004844	-		15300271	+1	no_errors	ENST00000413977	ensembl	human	known	74_37	rna	SNP	0.000	G
BAZ2B	29994	genome.wustl.edu	37	2	160317644	160317645	+	Intron	INS	-	-	T	rs532390970		TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr2:160317644_160317645insT	ENST00000392783.2	-	4	641				BAZ2B_ENST00000392782.1_Intron|BAZ2B_ENST00000483316.1_5'UTR|BAZ2B_ENST00000355831.2_Intron|BAZ2B_ENST00000343439.5_Intron	NM_013450.2	NP_038478.2	Q9UIF8	BAZ2B_HUMAN	bromodomain adjacent to zinc finger domain, 2B						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(7)|liver(2)|lung(41)|ovary(3)|prostate(1)|skin(2)|soft_tissue(1)|urinary_tract(1)	82						GCACAAACACGTTTTTTTTTTA	0.351																																																	0								ENSG00000123636																																			BAZ2B	SO:0001627	intron_variant	0				HGNC	AB032255	CCDS2209.2, CCDS74594.1	2q24.2	2013-01-28			ENSG00000123636	ENSG00000123636		"""Zinc fingers, PHD-type"""	963	protein-coding gene	gene with protein product		605683				10662543	Standard	XM_005246488		Approved	WALp4	uc002uao.3	Q9UIF8	OTTHUMG00000132027	ENST00000392783.2:c.146-7332->A	2.37:g.160317654_160317654dupT		Somatic	0	13	0.00		0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	14	17.65	D3DPA8|Q96EA1|Q96SQ8|Q9P252|Q9Y4N8	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000392783.2	37	NULL	CCDS2209.2	2																																																																																			-	-		0.351	BAZ2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAZ2B	protein_coding	OTTHUMT00000255037.2	-				160317645	-1	no_errors	ENST00000483316	ensembl	human	known	74_37	rna	INS	0.005:0.155	T
INPP5D	3635	genome.wustl.edu	37	2	234055015	234055015	+	Silent	SNP	C	C	G			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr2:234055015C>G	ENST00000359570.5	+	10	801	c.801C>G	c.(799-801)gtC>gtG	p.V267V	INPP5D_ENST00000538935.1_Silent_p.V266V|INPP5D_ENST00000455936.2_Silent_p.V31V|INPP5D_ENST00000450745.1_Silent_p.V31V			Q92835	SHIP1_HUMAN	inositol polyphosphate-5-phosphatase, 145kDa	279					apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|determination of adult lifespan (GO:0008340)|immunoglobulin mediated immune response (GO:0016064)|inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of bone resorption (GO:0045779)|negative regulation of immune response (GO:0050777)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of monocyte differentiation (GO:0045656)|negative regulation of neutrophil differentiation (GO:0045659)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of signal transduction (GO:0009968)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of apoptotic process (GO:0043065)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of erythrocyte differentiation (GO:0045648)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)	cytosol (GO:0005829)|membrane (GO:0016020)	inositol-polyphosphate 5-phosphatase activity (GO:0004445)|phosphatidylinositol trisphosphate phosphatase activity (GO:0034594)			central_nervous_system(1)|ovary(1)	2		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0273)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0843)		Epithelial(121;1.16e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000479)|LUSC - Lung squamous cell carcinoma(224;0.00655)|Lung(119;0.00802)|GBM - Glioblastoma multiforme(43;0.0185)		GCCCACAGGTCAAGGCCTTGC	0.612																																					NSCLC(82;1215 1426 16163 20348 41018)												0								ENSG00000168918						61.0	60.0	61.0					2																	234055015		692	1591	2283	INPP5D	SO:0001819	synonymous_variant	0			-	HGNC	U57650	CCDS74672.1	2q37.1	2013-02-14	2002-08-29		ENSG00000168918	ENSG00000168918		"""SH2 domain containing"""	6079	protein-coding gene	gene with protein product		601582	"""inositol polyphosphate-5-phosphatase, 145kD"""			8643691, 8874179	Standard	NM_001017915		Approved	SHIP, hp51CN	uc010zmp.2	Q92835	OTTHUMG00000133688	ENST00000359570.5:c.801C>G	2.37:g.234055015C>G		Somatic	0	66	0.00		0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	40	10	80.00	O00145|Q13544|Q13545|Q6P5A4|Q92656|Q9UE80	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Endo/exonuclease/phosphatase,pfam_SH2,superfamily_Endo/exonuclease/phosphatase,smart_SH2,smart_IPPc,pfscan_SH2,prints_SH2	p.V267	ENST00000359570.5	37	c.801		2																																																																																			-	NULL		0.612	INPP5D-201	KNOWN	basic|appris_principal	protein_coding	INPP5D	protein_coding		C	NM_001017915	-		234055015	+1	no_errors	ENST00000359570	ensembl	human	known	74_37	silent	SNP	1.000	G
SPIB	6689	genome.wustl.edu	37	19	50923209	50923209	+	Missense_Mutation	SNP	C	C	A			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr19:50923209C>A	ENST00000595883.1	+	2	55	c.30C>A	c.(28-30)gaC>gaA	p.D10E	SPIB_ENST00000597855.1_Missense_Mutation_p.D10E|SPIB_ENST00000596074.1_Missense_Mutation_p.D10E|SPIB_ENST00000270632.7_Missense_Mutation_p.D10E|CTD-2545M3.6_ENST00000599632.1_Silent_p.R145R|SPIB_ENST00000439922.2_5'UTR	NM_001243999.1|NM_001244000.1|NM_003121.4	NP_001230928.1|NP_001230929.1|NP_003112.2	Q01892	SPIB_HUMAN	Spi-B transcription factor (Spi-1/PU.1 related)	10	TAD1 (Acidic).				cell differentiation (GO:0030154)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(8)	14		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00757)|GBM - Glioblastoma multiforme(134;0.0186)		CCAGGCTCGACGGGCCACACT	0.647																																																	0								ENSG00000269404						35.0	30.0	32.0					19																	50923209		2201	4300	6501	SPIB	SO:0001583	missense	0			-	HGNC		CCDS33080.1, CCDS58674.1, CCDS59412.1	19q13.3-q13.4	2008-07-22				ENSG00000269404			11242	protein-coding gene	gene with protein product		606802				1406622	Standard	NM_003121		Approved	SPI-B	uc002psd.3	Q01892		ENST00000595883.1:c.30C>A	19.37:g.50923209C>A	ENSP00000471921:p.Asp10Glu	Somatic	0	240	0.00		0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	69	127	35.20	A8K9C9|B4DUG6|Q15359	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ets_dom,smart_Ets_dom,pfscan_Ets_dom,prints_Ets_dom	p.D10E	ENST00000595883.1	37	c.30	CCDS33080.1	19	.	.	.	.	.	.	.	.	.	.	C	11.78	1.740744	0.30865	.	.	ENSG00000142539	ENST00000270632	T	0.52754	0.65	2.29	-1.33	0.09172	.	.	.	.	.	T	0.44393	0.1291	L	0.40543	1.245	0.80722	D	1	D;D	0.63880	0.989;0.993	D;D	0.69479	0.943;0.964	T	0.57046	-0.7878	9	0.02654	T	1	0.1745	5.2332	0.15434	0.0:0.4095:0.0:0.5905	.	10;10	Q01892-2;Q01892	.;SPIB_HUMAN	E	10	ENSP00000270632:D10E	ENSP00000270632:D10E	D	+	3	2	SPIB	55615021	0.000000	0.05858	0.985000	0.45067	0.897000	0.52465	-4.360000	0.00246	-0.258000	0.09446	-0.476000	0.04901	GAC	-	NULL		0.647	SPIB-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPIB	protein_coding	OTTHUMT00000464744.1	C	NM_003121	-		50923209	+1	no_errors	ENST00000595883	ensembl	human	known	74_37	missense	SNP	0.990	A
CCR5	1234	genome.wustl.edu	37	3	46414944	46414975	+	Frame_Shift_Del	DEL	ACAGTCAGTATCAATTCTGGAAGAATTTCCAG	ACAGTCAGTATCAATTCTGGAAGAATTTCCAG	-	rs372782701|rs333|rs62625034|rs112590754|rs201797884|rs562091107|rs56345960|rs111718604|rs199827265|rs113869679	byFrequency	TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	ACAGTCAGTATCAATTCTGGAAGAATTTCCAG	ACAGTCAGTATCAATTCTGGAAGAATTTCCAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr3:46414944_46414975delACAGTCAGTATCAATTCTGGAAGAATTTCCAG	ENST00000292303.4	+	2	697_728	c.551_582delACAGTCAGTATCAATTCTGGAAGAATTTCCAG	c.(550-582)tacagtcagtatcaattctggaagaatttccagfs	p.YSQYQFWKNFQ184fs	CCR5_ENST00000343801.4_Frame_Shift_Del_p.YSQYQFWKNFQ184fs|RP11-24F11.2_ENST00000451485.1_RNA|CCR5_ENST00000445772.1_Frame_Shift_Del_p.YSQYQFWKNFQ184fs	NM_001100168.1	NP_001093638.1	P51681	CCR5_HUMAN	chemokine (C-C motif) receptor 5 (gene/pseudogene)	184					calcium ion transport (GO:0006816)|calcium-mediated signaling (GO:0019722)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular defense response (GO:0006968)|cellular response to lipopolysaccharide (GO:0071222)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|dendritic cell chemotaxis (GO:0002407)|entry into host cell (GO:0030260)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|MAPK cascade (GO:0000165)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to cholesterol (GO:0070723)|signaling (GO:0023052)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|C-C chemokine binding (GO:0019957)|C-C chemokine receptor activity (GO:0016493)|chemokine (C-C motif) ligand 5 binding (GO:0071791)|chemokine receptor activity (GO:0004950)|coreceptor activity (GO:0015026)|phosphatidylinositol phospholipase C activity (GO:0004435)	p.Y187*(1)|p.K191N(1)		central_nervous_system(1)|large_intestine(2)|lung(13)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	20				BRCA - Breast invasive adenocarcinoma(193;0.00112)|KIRC - Kidney renal clear cell carcinoma(197;0.017)|Kidney(197;0.02)	Maraviroc(DB04835)	CATTTTCCATACAGTCAGTATCAATTCTGGAAGAATTTCCAGACATTAAAGA	0.453														146	0.0291534	0.003	0.0317	5008	,	,		26634	0.0		0.1103	False		,,,				2504	0.0092																2	Substitution - Nonsense(1)|Substitution - Missense(1)	lung(2)						ENSG00000160791		,	58,4208		0,58,2075					,	-10.8	0.0		dbSNP_36	152	697,7531		36,625,3453	no	frameshift,frameshift	CCR5	NM_001100168.1,NM_000579.3	,	36,683,5528	A1A1,A1R,RR		8.4711,1.3596,6.0429	,	,		755,11739				CCR5	SO:0001589	frameshift_variant	0				HGNC		CCDS2739.1	3p21	2012-08-08	2012-01-23		ENSG00000160791	ENSG00000160791		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1606	protein-coding gene	gene with protein product		601373	"""chemokine (C-C motif) receptor 5"""	CMKBR5		8639485	Standard	NM_001100168		Approved	CKR-5, CC-CKR-5, CKR5, CD195, IDDM22	uc003cpo.4	P51681	OTTHUMG00000133481	ENST00000292303.4:c.551_582delACAGTCAGTATCAATTCTGGAAGAATTTCCAG	3.37:g.46414944_46414975delACAGTCAGTATCAATTCTGGAAGAATTTCCAG	ENSP00000292303:p.Tyr184fs	Somatic	NA	NA	NA		0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	O14692|O14693|O14695|O14696|O14697|O14698|O14699|O14700|O14701|O14702|O14703|O14704|O14705|O14706|O14707|O14708|O15538|Q9UPA4	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Chemokine_rcpt,prints_GPCR_Rhodpsn,prints_Chemokine_CCR5,prints_Chemokine_CCR1,prints_ATII_rcpt	p.S185fs	ENST00000292303.4	37	c.551_582	CCDS2739.1	3																																																																																			-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Chemokine_CCR5,prints_Chemokine_CCR1		0.453	CCR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCR5	protein_coding	OTTHUMT00000257377.2	ACAGTCAGTATCAATTCTGGAAGAATTTCCAG	NM_000579			46414975	+1	no_errors	ENST00000292303	ensembl	human	known	74_37	frame_shift_del	DEL	0.000:0.000:0.000:0.000:0.000:0.535:0.487:0.052:0.002:0.000:0.000:0.000:0.000:0.000:0.012:0.815:0.918:1.000:1.000:1.000:1.000:0.903:0.820:0.363:0.169:0.001:0.138:0.144:0.013:0.014:0.007:0.000	-
CFDP1	10428	genome.wustl.edu	37	16	75327731	75327732	+	3'UTR	INS	-	-	A	rs149574560		TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr16:75327731_75327732insA	ENST00000283882.3	-	0	1150_1151					NM_006324.2	NP_006315.1	Q9UEE9	CFDP1_HUMAN	craniofacial development protein 1						cell adhesion (GO:0007155)|multicellular organismal development (GO:0007275)|negative regulation of fibroblast apoptotic process (GO:2000270)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)					endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)	5						CTTCAATGTAGAAAAAAAAAAG	0.307																																																	0								ENSG00000153774																																			CFDP1	SO:0001624	3_prime_UTR_variant	0				HGNC	AB009285	CCDS10916.1	16q22.2-q22.3	2011-08-12			ENSG00000153774	ENSG00000153774			1873	protein-coding gene	gene with protein product	"""Bucentaur"", ""centromere protein 29"""	608108				9602175, 9006920, 11992732	Standard	NM_006324		Approved	BCNT, p97, CP27, SWC5, Yeti, CENP-29	uc002fdy.3	Q9UEE9	OTTHUMG00000137615	ENST00000283882.3:c.*119->T	16.37:g.75327741_75327741dupA		Somatic	0	24	0.00		0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	30	9.09	O00393|O00404|Q9UEF0|Q9UEF1|Q9UEF8	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000283882.3	37	NULL	CCDS10916.1	16																																																																																			-	-		0.307	CFDP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CFDP1	protein_coding	OTTHUMT00000269031.2	-	NM_006324			75327732	-1	no_errors	ENST00000570103	ensembl	human	known	74_37	rna	INS	0.904:0.940	A
CCDC171	203238	genome.wustl.edu	37	9	15744289	15744290	+	Frame_Shift_Ins	INS	-	-	A	rs35013909	byFrequency	TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr9:15744289_15744290insA	ENST00000380701.3	+	17	2396_2397	c.2068_2069insA	c.(2068-2070)gaafs	p.E690fs	CCDC171_ENST00000297641.3_Frame_Shift_Ins_p.E690fs	NM_173550.2	NP_775821.2	Q6TFL3	CC171_HUMAN	coiled-coil domain containing 171	690																	AGAAATTGCTGAAAAAAACATG	0.297																																																	0								ENSG00000164989																																			CCDC171	SO:0001589	frameshift_variant	0				HGNC	AY422473	CCDS6481.1	9p22.2	2012-03-26	2012-03-26	2012-03-26	ENSG00000164989	ENSG00000164989			29828	protein-coding gene	gene with protein product	"""myosin tail domain containing protein"""		"""chromosome 9 open reading frame 93"""	C9orf93		14702039	Standard	NM_173550		Approved	FLJ39267, FLJ46740, Em:AL513423.1, bA778P13.1, bA536D16.1	uc003zmd.3	Q6TFL3	OTTHUMG00000019584	ENST00000380701.3:c.2075dupA	9.37:g.15744296_15744296dupA	ENSP00000370077:p.Glu690fs	Somatic	0	64	0.00		0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	41	14.58	B7ZM22|Q5SU58|Q6P1W1|Q6ZR13|Q8N1Z4|Q8N8L3|Q8TBR2	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	superfamily_STAT_TF_coiled-coil	p.N692fs	ENST00000380701.3	37	c.2068_2069	CCDS6481.1	9																																																																																			-	superfamily_STAT_TF_coiled-coil		0.297	CCDC171-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC171	protein_coding	OTTHUMT00000051768.4	-	NM_173550			15744290	+1	no_errors	ENST00000380701	ensembl	human	known	74_37	frame_shift_ins	INS	1.000:1.000	A
ERG	2078	genome.wustl.edu	37	21	39947669	39947669	+	5'UTR	SNP	C	C	T	rs371363525		TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr21:39947669C>T	ENST00000417133.2	-	0	141				ERG_ENST00000442448.1_5'UTR|ERG_ENST00000398911.1_5'UTR|ERG_ENST00000398897.1_5'UTR|ERG_ENST00000485493.1_5'UTR|ERG_ENST00000398919.2_5'UTR|ERG_ENST00000398910.1_5'UTR	NM_001136154.1|NM_001243432.1	NP_001129626.1|NP_001230361.1	Q12809	KCNH2_HUMAN	v-ets avian erythroblastosis virus E26 oncogene homolog						cardiac muscle contraction (GO:0060048)|cellular response to drug (GO:0035690)|membrane depolarization during action potential (GO:0086010)|membrane repolarization during action potential (GO:0086011)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of potassium ion export (GO:1902303)|negative regulation of potassium ion transmembrane transport (GO:1901380)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transmembrane transport (GO:0071805)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of heart rate by hormone (GO:0003064)|regulation of membrane potential (GO:0042391)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|synaptic transmission (GO:0007268)|ventricular cardiac muscle cell action potential (GO:0086005)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|identical protein binding (GO:0042802)|inward rectifier potassium channel activity (GO:0005242)|phosphorelay sensor kinase activity (GO:0000155)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated potassium channel activity involved in ventricular cardiac muscle cell action potential repolarization (GO:1902282)		EWSR1/ERG(178)|NDRG1/ERG(5)|TMPRSS2/ERG(3582)|FUS/ERG(167)|SLC45A3/ERG(50)	lung(2)|ovary(1)|skin(1)	4		Prostate(19;3.6e-06)			Alfuzosin(DB00346)|Amiodarone(DB01118)|Amsacrine(DB00276)|Astemizole(DB00637)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Cisapride(DB00604)|Dofetilide(DB00204)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronedarone(DB04855)|Halofantrine(DB01218)|Ibutilide(DB00308)|Imipramine(DB00458)|Miconazole(DB01110)|Pimozide(DB01100)|Prazosin(DB00457)|Propafenone(DB01182)|Quinidine(DB00908)|Sertindole(DB06144)|Sotalol(DB00489)|Terazosin(DB01162)|Thioridazine(DB00679)|Verapamil(DB00661)	CAGAACCTGACGGCTAGAAGA	0.448			T	"""EWSR1, TMPRSS2, ELF4, FUS, HERPUD1, NDRG1"""	"""Ewing sarcoma, prostate, AML"""																																Esophageal Squamous(130;336 1700 3010 3083 40589)			Dom	yes		21	21q22.3	2078	v-ets erythroblastosis virus E26 oncogene like (avian)		"""M, E, L"""	0								ENSG00000157554	T	,	1,4405	2.1+/-5.4	0,1,2202	73.0	60.0	64.0		,	0.9	0.0	21		64	1,8599	1.2+/-3.3	0,1,4299	no	utr-5,utr-5	ERG	NM_001136154.1,NM_004449.4	,	0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154	,	,	39947669	2,13004	2203	4300	6503	ERG	SO:0001623	5_prime_UTR_variant	0			-	HGNC		CCDS13657.1, CCDS13658.1, CCDS46648.1, CCDS46649.1, CCDS58789.1	21q22.3	2013-07-09	2013-07-09		ENSG00000157554	ENSG00000157554			3446	protein-coding gene	gene with protein product	"""v-ets avian erythroblastosis virus E26 oncogene related"", ""transcriptional regulator ERG (transforming protein ERG)"", ""v-ets erythroblastosis virus E26 oncogene like"", ""TMPRSS2-ERG prostate cancer specific"""	165080	"""v-ets avian erythroblastosis virus E26 oncogene related"""			3274086	Standard	NM_001136154		Approved	erg-3, p55	uc002yxa.3	P11308	OTTHUMG00000090767	ENST00000417133.2:c.-45G>A	21.37:g.39947669C>T		Somatic	0	40	0.00		0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	3	89.66	A5H1P7|C4PFH9|D3DX04|O75418|O75680|Q708S9|Q9BT72|Q9BUT7|Q9H3P0	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000417133.2	37	NULL	CCDS46648.1	21																																																																																			-	-		0.448	ERG-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ERG	protein_coding	OTTHUMT00000207532.2	C	NM_182918	-		39947669	-1	no_errors	ENST00000485493	ensembl	human	known	74_37	rna	SNP	0.073	T
TMEM132C	92293	genome.wustl.edu	37	12	129190234	129190234	+	Silent	SNP	G	G	C	rs534721977		TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr12:129190234G>C	ENST00000435159.2	+	9	2721	c.2721G>C	c.(2719-2721)ggG>ggC	p.G907G	TMEM132C_ENST00000537538.1_Silent_p.G292G|TMEM132C_ENST00000315208.8_Silent_p.G523G	NM_001136103.2	NP_001129575.2	Q8N3T6	T132C_HUMAN	transmembrane protein 132C	907						integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|lung(2)|prostate(2)|skin(1)	13						CCGGGAGTGGGCTGGAGGAAA	0.642																																																	0								ENSG00000181234						18.0	26.0	23.0					12																	129190234		692	1591	2283	TMEM132C	SO:0001819	synonymous_variant	0			-	HGNC	AK126715		12q24.32	2014-06-13				ENSG00000181234			25436	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 152"""						Standard	NM_001136103		Approved	DKFZp761O2018, PPP1R152	uc021rgn.1	Q8N3T6		ENST00000435159.2:c.2721G>C	12.37:g.129190234G>C		Somatic	0	83	0.00		0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	78	22.00	Q69YX8	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.G907	ENST00000435159.2	37	c.2721		12																																																																																			-	NULL		0.642	TMEM132C-201	KNOWN	basic|appris_principal	protein_coding	TMEM132C	protein_coding		G	XM_044062	-		129190234	+1	no_errors	ENST00000435159	ensembl	human	known	74_37	silent	SNP	0.049	C
KCNJ12	3768	genome.wustl.edu	37	17	21318772	21318772	+	Missense_Mutation	SNP	C	C	T			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr17:21318772C>T	ENST00000583088.1	+	3	1013	c.118C>T	c.(118-120)Cgc>Tgc	p.R40C	KCNJ12_ENST00000331718.5_Missense_Mutation_p.R40C	NM_021012.4	NP_066292.2	Q14500	KCJ12_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 12	40					muscle contraction (GO:0006936)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|protein homotetramerization (GO:0051289)|regulation of heart contraction (GO:0008016)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|intrinsic component of membrane (GO:0031224)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)			NS(1)|breast(4)|endometrium(4)|kidney(1)|large_intestine(5)|lung(39)|ovary(5)|skin(8)|stomach(3)	70				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)|Yohimbine(DB01392)	GCACACGCGGCGCAGGTGCCG	0.612										Prostate(3;0.18)																																							0								ENSG00000184185						116.0	88.0	98.0					17																	21318772		2203	4300	6503	KCNJ12	SO:0001583	missense	0			-	HGNC	L36069	CCDS11219.1	17p11.1	2011-07-05	2004-01-13		ENSG00000184185	ENSG00000184185		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6258	protein-coding gene	gene with protein product		602323	"""potassium inwardly-rectifying channel, subfamily J, inhibitor 1"""	KCNJN1		7859381, 12417321, 16382105	Standard	NM_021012		Approved	Kir2.2, Kir2.2v, IRK2, hIRK1	uc021tss.1	Q14500	OTTHUMG00000132039	ENST00000583088.1:c.118C>T	17.37:g.21318772C>T	ENSP00000463778:p.Arg40Cys	Somatic	0	129	0.00		0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	168	13.85	O43401|Q15756|Q8NG63	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_K_chnl_inward-rec_Kir,pfam_K_chnl_inward-rec_Kir_N,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir2.2	p.R40C	ENST00000583088.1	37	c.118	CCDS11219.1	17	.	.	.	.	.	.	.	.	.	.	C	17.46	3.395066	0.62066	.	.	ENSG00000184185	ENST00000331718	T	0.38722	1.12	5.33	3.24	0.37175	Potassium channel, inwardly rectifying, Kir, N-terminal (1);	0.175986	0.42964	U	0.000638	T	0.54415	0.1857	L	0.59436	1.845	0.58432	D	0.999999	D	0.76494	0.999	D	0.64877	0.93	T	0.56980	-0.7889	10	0.87932	D	0	.	9.5137	0.39093	0.3622:0.5301:0.1077:0.0	.	40	Q14500	IRK12_HUMAN	C	40	ENSP00000328150:R40C	ENSP00000328150:R40C	R	+	1	0	KCNJ12	21259365	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	1.763000	0.38461	1.242000	0.43836	0.591000	0.81541	CGC	-	pfam_K_chnl_inward-rec_Kir_N,pirsf_K_chnl_inward-rec_Kir		0.612	KCNJ12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNJ12	protein_coding	OTTHUMT00000255060.2	C	NM_021012	-		21318772	+1	no_errors	ENST00000331718	ensembl	human	known	74_37	missense	SNP	1.000	T
FAM86B3P	286042	genome.wustl.edu	37	8	8095821	8095821	+	RNA	SNP	T	T	C			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr8:8095821T>C	ENST00000310542.3	+	0	0				ALG1L13P_ENST00000523017.1_RNA					family with sequence similarity 86, member B3, pseudogene																		AGAGGCCCTTTGCCTTCACAG	0.607																																																	0								ENSG00000253981																																			ALG1L13P			0			-	HGNC			8p23.1	2013-06-10			ENSG00000173295	ENSG00000173295			44371	pseudogene	pseudogene							Standard	NR_024361		Approved		uc011kwt.2		OTTHUMG00000163669		8.37:g.8095821T>C		Somatic	0	274	0.00		0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	44	386	10.23		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000310542.3	37	NULL		8																																																																																			-	-		0.607	FAM86B3P-005	KNOWN	basic	processed_transcript	ALG1L13P	pseudogene	OTTHUMT00000448496.1	T		-		8095821	-1	no_errors	ENST00000518201	ensembl	human	known	74_37	rna	SNP	1.000	C
SLIT2	9353	genome.wustl.edu	37	4	20530661	20530661	+	Missense_Mutation	SNP	G	G	T			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr4:20530661G>T	ENST00000504154.1	+	16	1804	c.1552G>T	c.(1552-1554)Gat>Tat	p.D518Y	SLIT2_ENST00000503837.1_Missense_Mutation_p.D514Y|SLIT2_ENST00000273739.5_Missense_Mutation_p.D522Y|SLIT2_ENST00000503823.1_Missense_Mutation_p.D510Y|MIR218-1_ENST00000384999.1_RNA	NM_004787.1	NP_004778.1	O94813	SLIT2_HUMAN	slit homolog 2 (Drosophila)	518	LRRNT 3.				apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|branching morphogenesis of an epithelial tube (GO:0048754)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to heparin (GO:0071504)|cellular response to hormone stimulus (GO:0032870)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|corticospinal neuron axon guidance through spinal cord (GO:0021972)|dorsal/ventral axon guidance (GO:0033563)|in utero embryonic development (GO:0001701)|induction of negative chemotaxis (GO:0050929)|mammary duct terminal end bud growth (GO:0060763)|metanephros development (GO:0001656)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of axon extension (GO:0030517)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cellular response to growth factor stimulus (GO:0090288)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of gene expression (GO:0010629)|negative regulation of lamellipodium assembly (GO:0010593)|negative regulation of leukocyte chemotaxis (GO:0002689)|negative regulation of monocyte chemotaxis (GO:0090027)|negative regulation of mononuclear cell migration (GO:0071676)|negative regulation of neutrophil chemotaxis (GO:0090024)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|negative regulation of small GTPase mediated signal transduction (GO:0051058)|negative regulation of smooth muscle cell chemotaxis (GO:0071672)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of vascular permeability (GO:0043116)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|response to cortisol (GO:0051414)|retinal ganglion cell axon guidance (GO:0031290)|Roundabout signaling pathway (GO:0035385)|single organismal cell-cell adhesion (GO:0016337)|ureteric bud development (GO:0001657)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chemorepellent activity (GO:0045499)|GTPase inhibitor activity (GO:0005095)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|laminin-1 binding (GO:0043237)|protein homodimerization activity (GO:0042803)|proteoglycan binding (GO:0043394)|Roundabout binding (GO:0048495)			NS(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(17)|lung(60)|ovary(3)|pancreas(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	116						AACCACAGTAGATTGCTCTAA	0.443																																																	0								ENSG00000145147						125.0	124.0	124.0					4																	20530661		2203	4300	6503	SLIT2	SO:0001583	missense	0			-	HGNC	AF055585	CCDS3426.1, CCDS75110.1, CCDS75111.1	4p15.2	2008-08-01	2001-11-28		ENSG00000145147	ENSG00000145147			11086	protein-coding gene	gene with protein product		603746	"""slit (Drosophila) homolog 2"""	SLIL3		9813312, 18269211	Standard	XM_005248211		Approved	Slit-2	uc003gpr.1	O94813	OTTHUMG00000128551	ENST00000504154.1:c.1552G>T	4.37:g.20530661G>T	ENSP00000422591:p.Asp518Tyr	Somatic	0	50	0.00		0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	74	9.76	B7ZLR5|O95710|Q17RU3|Q9Y5Q7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_EG-like_dom,pfam_Laminin_G,pfam_Leu-rich_rpt,pfam_LRR-contain_N,pfam_Cys-rich_flank_reg_C,superfamily_ConA-like_lec_gl_sf,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_Fol_N,smart_Laminin_G,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_EG-like_dom,pfscan_Laminin_G	p.D518Y	ENST00000504154.1	37	c.1552	CCDS3426.1	4	.	.	.	.	.	.	.	.	.	.	G	21.0	4.083795	0.76642	.	.	ENSG00000145147	ENST00000503823;ENST00000504154;ENST00000273739;ENST00000382173;ENST00000503837	D;D;D;D	0.96427	-4.01;-4.01;-4.01;-4.01	5.93	5.93	0.95920	Leucine-rich repeat-containing N-terminal (2);	0.000000	0.85682	D	0.000000	D	0.98005	0.9343	M	0.71581	2.175	0.80722	D	1	D;D	0.89917	0.988;1.0	P;D	0.87578	0.716;0.998	D	0.98206	1.0470	10	0.66056	D	0.02	.	20.3465	0.98790	0.0:0.0:1.0:0.0	.	510;518	O94813-3;O94813	.;SLIT2_HUMAN	Y	510;518;522;514;514	ENSP00000427548:D510Y;ENSP00000422591:D518Y;ENSP00000273739:D522Y;ENSP00000422261:D514Y	ENSP00000273739:D522Y	D	+	1	0	SLIT2	20139759	1.000000	0.71417	0.928000	0.36995	0.873000	0.50193	9.467000	0.97671	2.798000	0.96311	0.655000	0.94253	GAT	-	pfam_LRR-contain_N,smart_LRR-contain_N		0.443	SLIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLIT2	protein_coding	OTTHUMT00000250396.2	G		-		20530661	+1	no_errors	ENST00000504154	ensembl	human	known	74_37	missense	SNP	1.000	T
TUBGCP2	10844	genome.wustl.edu	37	10	135094822	135094822	+	Missense_Mutation	SNP	T	T	C			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr10:135094822T>C	ENST00000252936.3	-	16	2567	c.2528A>G	c.(2527-2529)tAt>tGt	p.Y843C	TUBGCP2_ENST00000417178.2_Missense_Mutation_p.Y713C|TUBGCP2_ENST00000368563.2_Missense_Mutation_p.Y843C|TUBGCP2_ENST00000368562.1_Missense_Mutation_p.Y436C|TUBGCP2_ENST00000543663.1_Missense_Mutation_p.Y871C			Q9BSJ2	GCP2_HUMAN	tubulin, gamma complex associated protein 2	843					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)|protein complex assembly (GO:0006461)	centrosome (GO:0005813)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|spindle pole (GO:0000922)				breast(2)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(16)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	35		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.87e-06)|all cancers(32;8.98e-06)|Epithelial(32;1.15e-05)		ACTGGTGCTATAGATGCTCAG	0.632																																																	0								ENSG00000130640						98.0	84.0	88.0					10																	135094822		2203	4300	6503	TUBGCP2	SO:0001583	missense	0			-	HGNC	AF042379	CCDS7676.1, CCDS58104.1, CCDS58105.1	10q26.3	2008-07-28			ENSG00000130640	ENSG00000130640			18599	protein-coding gene	gene with protein product						9566967	Standard	NM_001256617		Approved	GCP2, Spc97p, SPBC97	uc010qvc.2	Q9BSJ2	OTTHUMG00000019319	ENST00000252936.3:c.2528A>G	10.37:g.135094822T>C	ENSP00000252936:p.Tyr843Cys	Somatic	0	76	0.00		0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	45	30.30	B4DM18|B7ZKL8|F5H4E0|F5H4L0|O43632|Q5VWX7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TUBGCP,superfamily_Ocr	p.Y871C	ENST00000252936.3	37	c.2612	CCDS7676.1	10	.	.	.	.	.	.	.	.	.	.	T	14.98	2.697961	0.48307	.	.	ENSG00000130640	ENST00000252936;ENST00000417178;ENST00000368563;ENST00000368562;ENST00000543663	T;T;T;T;T	0.33865	2.38;2.13;2.38;1.39;2.41	4.49	3.27	0.37495	.	0.000000	0.85682	D	0.000000	T	0.41259	0.1151	M	0.65975	2.015	0.58432	D	0.999995	B;B;P	0.47762	0.03;0.018;0.9	B;B;P	0.48227	0.072;0.033;0.571	T	0.29119	-1.0022	10	0.38643	T	0.18	-20.1466	9.9607	0.41695	0.1522:0.0:0.0:0.8478	.	871;871;843	F5H4L0;B7ZKL8;Q9BSJ2	.;.;GCP2_HUMAN	C	843;713;843;436;871	ENSP00000252936:Y843C;ENSP00000395666:Y713C;ENSP00000357551:Y843C;ENSP00000357550:Y436C;ENSP00000446093:Y871C	ENSP00000252936:Y843C	Y	-	2	0	TUBGCP2	134944812	1.000000	0.71417	0.993000	0.49108	0.840000	0.47671	4.655000	0.61476	2.036000	0.60181	0.459000	0.35465	TAT	-	NULL		0.632	TUBGCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBGCP2	protein_coding	OTTHUMT00000051148.1	T		-		135094822	-1	no_errors	ENST00000543663	ensembl	human	known	74_37	missense	SNP	1.000	C
RP11-364P22.2	0	genome.wustl.edu	37	4	158559249	158559249	+	lincRNA	SNP	A	A	C			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr4:158559249A>C	ENST00000507296.1	+	0	411																											aacaacaaaaagttaaaaagc	0.378																																																	0								ENSG00000249275																																			RP11-364P22.2			0			-	Clone_based_vega_gene																													4.37:g.158559249A>C		Somatic	0	8	0.00		0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	4	66.67		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000507296.1	37	NULL		4																																																																																			-	-		0.378	RP11-364P22.2-001	KNOWN	basic	lincRNA	ENSG00000249275	lincRNA	OTTHUMT00000365220.1	A		-		158559249	+1	no_errors	ENST00000507296	ensembl	human	known	74_37	rna	SNP	0.020	C
TTLL9	164395	genome.wustl.edu	37	20	30522516	30522516	+	Missense_Mutation	SNP	C	C	T	rs369485862		TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr20:30522516C>T	ENST00000375938.4	+	12	1082	c.829C>T	c.(829-831)Cgc>Tgc	p.R277C	TTLL9_ENST00000375934.4_Silent_p.S244S|TTLL9_ENST00000375921.2_Intron|TTLL9_ENST00000535842.1_Missense_Mutation_p.R277C|TTLL9_ENST00000310998.4_Missense_Mutation_p.R242C|TTLL9_ENST00000375922.4_Missense_Mutation_p.R219C			Q3SXZ7	TTLL9_HUMAN	tubulin tyrosine ligase-like family, member 9	277	TTL. {ECO:0000255|PROSITE- ProRule:PRU00568}.				cellular protein modification process (GO:0006464)	cilium (GO:0005929)|cytoplasm (GO:0005737)|microtubule (GO:0005874)	ligase activity (GO:0016874)	p.R277C(1)|p.R266C(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	26			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			GACGCTGCAGCGCTTCCGGCA	0.607																																																	2	Substitution - Missense(2)	lung(2)						ENSG00000131044	C	CYS/ARG	0,3982		0,0,1991	27.0	28.0	28.0		829	4.2	1.0	20		28	2,8324		0,2,4161	no	missense	TTLL9	NM_001008409.2	180	0,2,6152	TT,TC,CC		0.024,0.0,0.0162	benign	277/440	30522516	2,12306	1991	4163	6154	TTLL9	SO:0001583	missense	0			-	HGNC	AL031658	CCDS42863.1	20q11	2013-02-14	2005-07-28	2005-07-28		ENSG00000131044		"""Tubulin tyrosine ligase-like family"""	16118	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 125"""	C20orf125		15890843	Standard	NM_001008409		Approved	dJ310O13.1	uc010gdx.1	Q3SXZ7		ENST00000375938.4:c.829C>T	20.37:g.30522516C>T	ENSP00000365105:p.Arg277Cys	Somatic	0	34	0.00		0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	32	43	42.11	A6NH06|A6NIS5|B3KSG8|Q3SXZ8|Q5JYS3|Q5JYS4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TTL/TTLL_fam	p.R277C	ENST00000375938.4	37	c.829	CCDS42863.1	20	.	.	.	.	.	.	.	.	.	.	C	25.8	4.672569	0.88348	0.0	2.4E-4	ENSG00000131044	ENST00000375938;ENST00000535842;ENST00000310998;ENST00000375935;ENST00000375922	T;T;T;T	0.05855	3.38;3.38;3.38;3.38	5.09	4.15	0.48705	.	0.197212	0.46145	D	0.000316	T	0.16727	0.0402	L	0.46157	1.445	0.80722	D	1	D;D	0.67145	0.992;0.996	P;D	0.65443	0.809;0.935	T	0.00501	-1.1702	10	0.72032	D	0.01	.	12.8253	0.57716	0.0:0.9199:0.0:0.0801	.	277;179	Q3SXZ7;B1ANK8	TTLL9_HUMAN;.	C	277;277;242;266;219	ENSP00000365105:R277C;ENSP00000442515:R277C;ENSP00000308980:R242C;ENSP00000365088:R219C	ENSP00000308980:R242C	R	+	1	0	TTLL9	29986177	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	4.034000	0.57289	1.279000	0.44446	-0.254000	0.11334	CGC	-	pfam_TTL/TTLL_fam		0.607	TTLL9-205	KNOWN	basic|appris_principal|CCDS	protein_coding	TTLL9	protein_coding		C	NM_001008409	-		30522516	+1	no_errors	ENST00000375938	ensembl	human	known	74_37	missense	SNP	1.000	T
HCN2	610	genome.wustl.edu	37	19	590536	590536	+	Missense_Mutation	SNP	G	G	T			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr19:590536G>T	ENST00000251287.2	+	1	644	c.591G>T	c.(589-591)aaG>aaT	p.K197N		NM_001194.3	NP_001185.3	Q9UL51	HCN2_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 2	197	Involved in subunit assembly. {ECO:0000250}.				cell-cell signaling (GO:0007267)|cellular response to cAMP (GO:0071320)|cellular response to cGMP (GO:0071321)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	cAMP binding (GO:0030552)|identical protein binding (GO:0042802)|intracellular cAMP activated cation channel activity (GO:0005222)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)			endometrium(5)|lung(4)	9		all_epithelial(18;2.78e-22)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AGCGCGTCAAGTCGGCGGGGG	0.736																																					Melanoma(145;1175 2427 8056 36306)												0								ENSG00000099822						12.0	14.0	13.0					19																	590536		2111	4155	6266	HCN2	SO:0001583	missense	0			-	HGNC	AF064877	CCDS12035.1	19p13	2011-07-05				ENSG00000099822		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	4846	protein-coding gene	gene with protein product		602781		BCNG2		9405696, 9630217, 16382102	Standard	NM_001194		Approved	BCNG-2, HAC-1	uc002lpe.3	Q9UL51		ENST00000251287.2:c.591G>T	19.37:g.590536G>T	ENSP00000251287:p.Lys197Asn	Somatic	0	47	0.00		0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	33	10.81	O60742|O60743|O75267|Q9UBS2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_N,pfam_cNMP-bd_dom,pfam_Ion_trans_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG/ELK/ERG	p.K197N	ENST00000251287.2	37	c.591	CCDS12035.1	19	.	.	.	.	.	.	.	.	.	.	.	20.3	3.970376	0.74246	.	.	ENSG00000099822	ENST00000251287	T	0.79554	-1.28	2.44	1.38	0.22167	Ion transport N-terminal (1);	.	.	.	.	D	0.85570	0.5727	M	0.82517	2.595	0.47407	D	0.999414	D	0.55385	0.971	P	0.59424	0.857	D	0.84761	0.0762	9	0.87932	D	0	.	5.3103	0.15828	0.2967:0.0:0.7033:0.0	.	197	Q9UL51	HCN2_HUMAN	N	197	ENSP00000251287:K197N	ENSP00000251287:K197N	K	+	3	2	HCN2	541536	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	1.386000	0.34419	1.306000	0.44926	0.282000	0.19409	AAG	-	pfam_Ion_trans_N		0.736	HCN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCN2	protein_coding	OTTHUMT00000452100.1	G	NM_001194	-		590536	+1	no_errors	ENST00000251287	ensembl	human	known	74_37	missense	SNP	1.000	T
FRY	10129	genome.wustl.edu	37	13	32811825	32811825	+	Silent	SNP	G	G	T			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr13:32811825G>T	ENST00000380250.3	+	44	6616	c.6120G>T	c.(6118-6120)ctG>ctT	p.L2040L		NM_023037.2	NP_075463.2	Q5TBA9	FRY_HUMAN	furry homolog (Drosophila)	2040						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				NS(3)|breast(4)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(31)|lung(50)|ovary(5)|pancreas(1)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	132		Lung SC(185;0.0271)		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)		CCACCAACCTGCTGGCCACCA	0.493																																																	0								ENSG00000073910						46.0	46.0	46.0					13																	32811825		1987	4163	6150	FRY	SO:0001819	synonymous_variant	0			-	HGNC	AL049784	CCDS41875.1	13q13.1	2008-02-05	2005-11-24	2005-11-24	ENSG00000073910	ENSG00000073910			20367	protein-coding gene	gene with protein product		614818	"""chromosome 13 open reading frame 14"""	C13orf14		14702039, 8812419	Standard	NM_023037		Approved	bA37E23.1, 13CDNA73, CG003	uc001utx.3	Q5TBA9	OTTHUMG00000016696	ENST00000380250.3:c.6120G>T	13.37:g.32811825G>T		Somatic	0	45	0.00		0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51	Q9Y3N6	Silent	SNP	NA	NA	NA	NA	NA	NA	superfamily_ARM-type_fold	p.L2040	ENST00000380250.3	37	c.6120	CCDS41875.1	13																																																																																			-	superfamily_ARM-type_fold		0.493	FRY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRY	protein_coding	OTTHUMT00000044405.1	G	NM_023037	-		32811825	+1	no_errors	ENST00000380250	ensembl	human	known	74_37	silent	SNP	0.620	T
PNPLA6	10908	genome.wustl.edu	37	19	7619936	7619936	+	Missense_Mutation	SNP	T	T	A			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr19:7619936T>A	ENST00000221249.6	+	25	3109	c.2678T>A	c.(2677-2679)tTt>tAt	p.F893Y	PNPLA6_ENST00000414982.3_Missense_Mutation_p.F941Y|PNPLA6_ENST00000600737.1_Missense_Mutation_p.F931Y|PNPLA6_ENST00000545201.2_Missense_Mutation_p.F866Y|PNPLA6_ENST00000450331.3_Missense_Mutation_p.F893Y	NM_006702.4	NP_006693.3	Q8IY17	PLPL6_HUMAN	patatin-like phospholipase domain containing 6	932					angiogenesis (GO:0001525)|cell death (GO:0008219)|lipid catabolic process (GO:0016042)|organ morphogenesis (GO:0009887)|phosphatidylcholine metabolic process (GO:0046470)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	lysophospholipase activity (GO:0004622)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(14)|ovary(3)|stomach(1)|upper_aerodigestive_tract(1)	35						CGCCGCCTCTTTTCGCGCCGC	0.731																																																	0								ENSG00000032444						7.0	9.0	8.0					19																	7619936		2152	4233	6385	PNPLA6	SO:0001583	missense	0			-	HGNC	AJ004832	CCDS32891.1, CCDS54206.1, CCDS54207.1, CCDS59343.1	19p13.2	2013-09-11						"""Patatin-like phospholipase domain containing"""	16268	protein-coding gene	gene with protein product	"""neuropathy target esterase"""	603197				9576844, 16799181, 19029121	Standard	NM_006702		Approved	NTE, sws, iPLA2delta, SPG39	uc010xjq.2	Q8IY17		ENST00000221249.6:c.2678T>A	19.37:g.7619936T>A	ENSP00000221249:p.Phe893Tyr	Somatic	0	49	0.00		0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	39	20.41	A6NGQ0|B4DFB9|B7Z7T2|F5H5K9|J3KQS3|O60859|Q86W58|Q9UG58	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_cNMP-bd_dom,pfam_Patatin/PLipase_A2-rel,superfamily_Acyl_Trfase/lysoPLipase,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom	p.F941Y	ENST00000221249.6	37	c.2822	CCDS32891.1	19	.	.	.	.	.	.	.	.	.	.	t	21.9	4.222094	0.79464	.	.	ENSG00000032444	ENST00000221249;ENST00000545201;ENST00000414982;ENST00000450331	T;T;T;T	0.26223	1.75;1.75;1.75;1.75	5.35	5.35	0.76521	.	0.110115	0.64402	D	0.000006	T	0.51975	0.1706	M	0.83012	2.62	0.58432	D	0.999997	D;D;P;D	0.69078	0.997;0.996;0.685;0.974	D;D;B;D	0.65573	0.911;0.936;0.382;0.915	T	0.58836	-0.7566	10	0.72032	D	0.01	.	13.3305	0.60483	0.0:0.0:0.0:1.0	.	932;866;931;893	Q8IY17;F5H5K9;Q8IY17-3;Q8IY17-2	PLPL6_HUMAN;.;.;.	Y	893;866;941;893	ENSP00000221249:F893Y;ENSP00000443323:F866Y;ENSP00000407509:F941Y;ENSP00000394348:F893Y	ENSP00000221249:F893Y	F	+	2	0	PNPLA6	7525936	1.000000	0.71417	1.000000	0.80357	0.109000	0.19521	7.975000	0.88055	2.040000	0.60383	0.454000	0.30748	TTT	-	NULL		0.731	PNPLA6-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	PNPLA6	protein_coding	OTTHUMT00000459275.1	T	NM_006702	-		7619936	+1	no_errors	ENST00000414982	ensembl	human	known	74_37	missense	SNP	1.000	A
TPH2	121278	genome.wustl.edu	37	12	72425429	72425429	+	Missense_Mutation	SNP	C	C	T			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr12:72425429C>T	ENST00000333850.3	+	11	1568	c.1427C>T	c.(1426-1428)aCa>aTa	p.T476I		NM_173353.3	NP_775489.2	Q8IWU9	TPH2_HUMAN	tryptophan hydroxylase 2	476					aromatic amino acid family metabolic process (GO:0009072)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to lithium ion (GO:0071285)|circadian rhythm (GO:0007623)|indolalkylamine biosynthetic process (GO:0046219)|response to activity (GO:0014823)|response to calcium ion (GO:0051592)|response to estrogen (GO:0043627)|response to glucocorticoid (GO:0051384)|response to nutrient levels (GO:0031667)|serotonin biosynthetic process (GO:0042427)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|neuron projection (GO:0043005)	amino acid binding (GO:0016597)|iron ion binding (GO:0005506)|tryptophan 5-monooxygenase activity (GO:0004510)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(9)|lung(20)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	41					L-Tryptophan(DB00150)	GACTTGAATACAGTGTGTGAT	0.413																																																	0								ENSG00000139287						176.0	172.0	174.0					12																	72425429		2203	4300	6503	TPH2	SO:0001583	missense	0			-	HGNC	AY098914	CCDS31859.1	12q15	2008-02-07				ENSG00000139287	1.14.16.4		20692	protein-coding gene	gene with protein product		607478				12511643	Standard	NM_173353		Approved	NTPH, FLJ37295	uc009zrw.1	Q8IWU9		ENST00000333850.3:c.1427C>T	12.37:g.72425429C>T	ENSP00000329093:p.Thr476Ile	Somatic	0	47	0.00		0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	48	15.79	A6NGA4|Q14CB0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Aromatic-AA_hydroxylase_C,pfam_ACT_dom,superfamily_Aromatic-AA_hydroxylase_C,pirsf_Tyrosine_3-monooxygenase-like,prints_Aromatic-AA_hydroxylase_C,tigrfam_Trp_5_mOase	p.T476I	ENST00000333850.3	37	c.1427	CCDS31859.1	12	.	.	.	.	.	.	.	.	.	.	C	5.981	0.364911	0.11296	.	.	ENSG00000139287	ENST00000333850	D	0.99488	-6.0	5.86	5.86	0.93980	Aromatic amino acid hydroxylase, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.96364	0.8814	N	0.03903	-0.33	0.80722	D	1	B	0.13145	0.007	B	0.15052	0.012	D	0.94018	0.7290	10	0.02654	T	1	-19.5798	20.1859	0.98214	0.0:1.0:0.0:0.0	.	476	Q8IWU9	TPH2_HUMAN	I	476	ENSP00000329093:T476I	ENSP00000329093:T476I	T	+	2	0	TPH2	70711696	1.000000	0.71417	0.996000	0.52242	0.989000	0.77384	4.952000	0.63618	2.777000	0.95525	0.591000	0.81541	ACA	-	pfam_Aromatic-AA_hydroxylase_C,superfamily_Aromatic-AA_hydroxylase_C,pirsf_Tyrosine_3-monooxygenase-like,tigrfam_Trp_5_mOase		0.413	TPH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPH2	protein_coding	OTTHUMT00000405234.1	C	NM_173353	-		72425429	+1	no_errors	ENST00000333850	ensembl	human	known	74_37	missense	SNP	1.000	T
FRY	10129	genome.wustl.edu	37	13	32711073	32711073	+	Missense_Mutation	SNP	G	G	T			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr13:32711073G>T	ENST00000380250.3	+	11	1639	c.1143G>T	c.(1141-1143)tgG>tgT	p.W381C		NM_023037.2	NP_075463.2	Q5TBA9	FRY_HUMAN	furry homolog (Drosophila)	381						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				NS(3)|breast(4)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(31)|lung(50)|ovary(5)|pancreas(1)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	132		Lung SC(185;0.0271)		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)		TGAACAGGTGGCACATTTTCC	0.443																																																	0								ENSG00000073910						136.0	136.0	136.0					13																	32711073		1932	4130	6062	FRY	SO:0001583	missense	0			-	HGNC	AL049784	CCDS41875.1	13q13.1	2008-02-05	2005-11-24	2005-11-24	ENSG00000073910	ENSG00000073910			20367	protein-coding gene	gene with protein product		614818	"""chromosome 13 open reading frame 14"""	C13orf14		14702039, 8812419	Standard	NM_023037		Approved	bA37E23.1, 13CDNA73, CG003	uc001utx.3	Q5TBA9	OTTHUMG00000016696	ENST00000380250.3:c.1143G>T	13.37:g.32711073G>T	ENSP00000369600:p.Trp381Cys	Somatic	0	42	0.00		0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	34	10.53	Q9Y3N6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_ARM-type_fold	p.W381C	ENST00000380250.3	37	c.1143	CCDS41875.1	13	.	.	.	.	.	.	.	.	.	.	G	26.1	4.709017	0.89018	.	.	ENSG00000073910	ENST00000380250;ENST00000267067	T	0.56103	0.48	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.78246	0.4253	M	0.87547	2.89	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.80694	-0.1268	10	0.87932	D	0	.	20.3011	0.98612	0.0:0.0:1.0:0.0	.	381	Q5TBA9	FRY_HUMAN	C	381;309	ENSP00000369600:W381C	ENSP00000267067:W309C	W	+	3	0	FRY	31609073	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.830000	0.99415	2.804000	0.96469	0.650000	0.86243	TGG	-	NULL		0.443	FRY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRY	protein_coding	OTTHUMT00000044405.1	G	NM_023037	-		32711073	+1	no_errors	ENST00000380250	ensembl	human	known	74_37	missense	SNP	1.000	T
GLS	2744	genome.wustl.edu	37	2	191745599	191745622	+	5'UTR	DEL	GCAGCAGCAGCAGCAGCAGCAGCA	GCAGCAGCAGCAGCAGCAGCAGCA	-	rs369228284|rs57674096|rs554999438	byFrequency	TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	GCAGCAGCAGCAGCAGCAGCAGCA	GCAGCAGCAGCAGCAGCAGCAGCA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr2:191745599_191745622delGCAGCAGCAGCAGCAGCAGCAGCA	ENST00000320717.3	+	0	47_70				GLS_ENST00000338435.4_5'UTR|AC005540.3_ENST00000413911.1_RNA	NM_014905.4	NP_055720.3	O94925	GLSK_HUMAN	glutaminase						cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|glutamate biosynthetic process (GO:0006537)|glutamate secretion (GO:0014047)|glutamine catabolic process (GO:0006543)|neurotransmitter secretion (GO:0007269)|protein homotetramerization (GO:0051289)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|small molecule metabolic process (GO:0044281)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	glutaminase activity (GO:0004359)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|lung(9)|ovary(1)|skin(1)|urinary_tract(1)	16			OV - Ovarian serous cystadenocarcinoma(117;0.00625)|Epithelial(96;0.0744)|all cancers(119;0.181)		L-Glutamine(DB00130)	ATCCTAGCGCgcagcagcagcagcagcagcagcagcagcagcag	0.656																																																	0								ENSG00000235852																																			AC005540.3	SO:0001623	5_prime_UTR_variant	0				Clone_based_vega_gene	AB020645	CCDS2308.1, CCDS58744.1	2q32-q34	2013-01-10			ENSG00000115419	ENSG00000115419	3.5.1.2	"""Ankyrin repeat domain containing"""	4331	protein-coding gene	gene with protein product		138280				10048485	Standard	NM_014905		Approved	KIAA0838, GLS1	uc002usf.3	O94925	OTTHUMG00000132701	ENST00000320717.3:c.-189GCAGCAGCAGCAGCAGCAGCAGCA>-	2.37:g.191745599_191745622delGCAGCAGCAGCAGCAGCAGCAGCA		Somatic	NA	NA	NA		0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q9UL05|Q9UL06|Q9UL07|Q9UN40	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000320717.3	37	NULL	CCDS2308.1	2																																																																																			-	-		0.656	GLS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000235852	protein_coding	OTTHUMT00000255999.2	GCAGCAGCAGCAGCAGCAGCAGCA				191745622	-1	no_errors	ENST00000413911	ensembl	human	known	74_37	rna	DEL	0.000:0.000:0.000:0.002:0.001:0.000:0.000:0.000:0.001:0.001:0.001:0.001:0.002:0.001:0.001:0.002:0.002:0.001:0.000:0.000:0.000:0.000:0.000:0.001	-
C1orf106	55765	genome.wustl.edu	37	1	200880698	200880698	+	Silent	SNP	G	G	A			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr1:200880698G>A	ENST00000367342.4	+	9	1532	c.1332G>A	c.(1330-1332)ccG>ccA	p.P444P	C1orf106_ENST00000413687.2_Silent_p.P359P	NM_018265.3	NP_060735.3	Q3KP66	CA106_HUMAN	chromosome 1 open reading frame 106	444										endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(2)	21						CCAAGCCCCCGCTGCCCCACG	0.687																																																	0								ENSG00000163362						74.0	87.0	83.0					1																	200880698		2203	4300	6503	C1orf106	SO:0001819	synonymous_variant	0			-	HGNC	AK001763	CCDS44292.1	1q32.1	2011-02-15			ENSG00000163362	ENSG00000163362			25599	protein-coding gene	gene with protein product						14702039	Standard	NM_018265		Approved	FLJ10901	uc001gvo.4	Q3KP66	OTTHUMG00000035789	ENST00000367342.4:c.1332G>A	1.37:g.200880698G>A		Somatic	0	98	0.00		0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	50	32.89	B4E1K9|E9PFY0|Q9NV65|Q9NVI0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF3338	p.P444	ENST00000367342.4	37	c.1332		1																																																																																			-	NULL		0.687	C1orf106-001	KNOWN	basic	protein_coding	C1orf106	protein_coding	OTTHUMT00000087057.2	G	NM_018265	-		200880698	+1	no_errors	ENST00000367342	ensembl	human	known	74_37	silent	SNP	0.687	A
IFIT5	24138	genome.wustl.edu	37	10	91177561	91177561	+	Missense_Mutation	SNP	G	G	T			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr10:91177561G>T	ENST00000371795.4	+	2	818	c.605G>T	c.(604-606)gGg>gTg	p.G202V	IFIT5_ENST00000416601.1_Intron	NM_012420.2	NP_036552.1	Q13325	IFIT5_HUMAN	interferon-induced protein with tetratricopeptide repeats 5	202					defense response to virus (GO:0051607)|innate immune response (GO:0045087)	actin cytoskeleton (GO:0015629)|apical part of cell (GO:0045177)|ruffle membrane (GO:0032587)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded RNA binding (GO:0003727)|tRNA binding (GO:0000049)			endometrium(1)|large_intestine(4)|lung(4)	9						TTTTCTCTGGGGCCTTTGAGA	0.448																																																	0								ENSG00000152778						72.0	77.0	75.0					10																	91177561		2203	4300	6503	IFIT5	SO:0001583	missense	0			-	HGNC	U34605	CCDS7403.1	10q23.31	2013-01-10			ENSG00000152778	ENSG00000152778		"""Tetratricopeptide (TTC) repeat domain containing"""	13328	protein-coding gene	gene with protein product	"""retinoic acid- and interferon-inducible protein (58kD)"""					9398535	Standard	NM_012420		Approved	RI58	uc010qnh.2	Q13325	OTTHUMG00000018713	ENST00000371795.4:c.605G>T	10.37:g.91177561G>T	ENSP00000360860:p.Gly202Val	Somatic	0	52	0.00		0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52	B2R5X9|B4DDV1|Q5T7I9|Q6IAX3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TPR_2,pfam_TPR_1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.G202V	ENST00000371795.4	37	c.605	CCDS7403.1	10	.	.	.	.	.	.	.	.	.	.	G	11.37	1.618329	0.28801	.	.	ENSG00000152778	ENST00000371795	T	0.47869	0.83	6.03	3.14	0.36123	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.295210	0.36665	N	0.002465	T	0.20170	0.0485	N	0.08118	0	0.49389	D	0.999781	P	0.38335	0.627	B	0.29663	0.105	T	0.04607	-1.0939	10	0.40728	T	0.16	-7.7837	6.3862	0.21561	0.3802:0.0:0.6198:0.0	.	202	Q13325	IFIT5_HUMAN	V	202	ENSP00000360860:G202V	ENSP00000360860:G202V	G	+	2	0	IFIT5	91167541	0.348000	0.24861	0.998000	0.56505	0.996000	0.88848	2.309000	0.43699	1.529000	0.49120	0.655000	0.94253	GGG	-	pfscan_TPR-contain_dom		0.448	IFIT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFIT5	protein_coding	OTTHUMT00000049303.1	G	NM_012420	-		91177561	+1	no_errors	ENST00000371795	ensembl	human	known	74_37	missense	SNP	0.657	T
ZNF536	9745	genome.wustl.edu	37	19	30935562	30935562	+	Missense_Mutation	SNP	C	C	A			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr19:30935562C>A	ENST00000355537.3	+	2	1240	c.1093C>A	c.(1093-1095)Cgc>Agc	p.R365S		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	365					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)			NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					GGGTCACATGCGCAAGCACAA	0.617																																																	0								ENSG00000198597						99.0	105.0	103.0					19																	30935562		2203	4300	6503	ZNF536	SO:0001583	missense	0			-	HGNC		CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.1093C>A	19.37:g.30935562C>A	ENSP00000347730:p.Arg365Ser	Somatic	0	77	0.00		0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	56	20.00	A2RU18	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R365S	ENST00000355537.3	37	c.1093	CCDS32984.1	19	.	.	.	.	.	.	.	.	.	.	C	13.65	2.301359	0.40694	.	.	ENSG00000198597	ENST00000355537	T	0.56776	0.44	5.41	4.35	0.52113	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.65302	0.2678	L	0.56124	1.755	0.49130	D	0.999759	D;D	0.89917	0.973;1.0	D;D	0.91635	0.93;0.999	T	0.66925	-0.5800	10	0.72032	D	0.01	-25.9075	10.8773	0.46919	0.421:0.579:0.0:0.0	.	365;365	A7E228;O15090	.;ZN536_HUMAN	S	365	ENSP00000347730:R365S	ENSP00000347730:R365S	R	+	1	0	ZNF536	35627402	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	2.834000	0.48167	2.523000	0.85059	0.491000	0.48974	CGC	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.617	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF536	protein_coding	OTTHUMT00000459667.2	C	NM_014717	-		30935562	+1	no_errors	ENST00000355537	ensembl	human	known	74_37	missense	SNP	1.000	A
RASSF8	11228	genome.wustl.edu	37	12	26218075	26218075	+	Nonsense_Mutation	SNP	A	A	T			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr12:26218075A>T	ENST00000405154.2	+	3	947	c.748A>T	c.(748-750)Aaa>Taa	p.K250*	RASSF8_ENST00000282884.9_Nonsense_Mutation_p.K250*|RASSF8_ENST00000381352.3_Nonsense_Mutation_p.K250*|RASSF8_ENST00000542865.1_Nonsense_Mutation_p.K250*|RASSF8_ENST00000541490.1_Nonsense_Mutation_p.K250*	NM_001164748.1	NP_001158220.1	Q8NHQ8	RASF8_HUMAN	Ras association (RalGDS/AF-6) domain family (N-terminal) member 8	250	Glu-rich.				signal transduction (GO:0007165)					cervix(2)|endometrium(1)|large_intestine(6)|lung(15)|urinary_tract(1)	25	Colorectal(261;0.0847)					AATAAGACAGAAAATAACAGA	0.358																																																	0								ENSG00000123094						100.0	107.0	105.0					12																	26218075		2203	4300	6503	RASSF8	SO:0001587	stop_gained	0			-	HGNC	U82396	CCDS8705.1, CCDS53765.1	12p12.3	2013-05-30	2008-02-22	2005-09-14	ENSG00000123094	ENSG00000123094			13232	protein-coding gene	gene with protein product		608231	"""chromosome 12 open reading frame 2"""	C12orf2			Standard	NM_007211		Approved	HoJ-1	uc001rgx.3	Q8NHQ8	OTTHUMG00000169087	ENST00000405154.2:c.748A>T	12.37:g.26218075A>T	ENSP00000384491:p.Lys250*	Somatic	0	40	0.00		0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	27	27.03	A8K1Z0|O95647|Q5SCI2|Q76KB6	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ras-assoc,smart_Ras-assoc,pfscan_Ras-assoc	p.K250*	ENST00000405154.2	37	c.748	CCDS53765.1	12	.	.	.	.	.	.	.	.	.	.	A	21.0	4.077193	0.76415	.	.	ENSG00000123094	ENST00000381352;ENST00000405154;ENST00000542865;ENST00000541490;ENST00000282884	.	.	.	5.21	4.03	0.46877	.	0.152790	0.53938	D	0.000042	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-15.3533	11.5375	0.50645	0.7179:0.2821:0.0:0.0	.	.	.	.	X	250	.	ENSP00000282884:K250X	K	+	1	0	RASSF8	26109342	1.000000	0.71417	0.958000	0.39756	0.947000	0.59692	4.359000	0.59449	0.898000	0.36418	0.460000	0.39030	AAA	-	NULL		0.358	RASSF8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RASSF8	protein_coding	OTTHUMT00000402209.2	A	NM_007211	-		26218075	+1	no_errors	ENST00000282884	ensembl	human	known	74_37	nonsense	SNP	0.998	T
FAM182B	728882	genome.wustl.edu	37	20	25755837	25755837	+	Missense_Mutation	SNP	G	G	A			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr20:25755837G>A	ENST00000376403.1	-	3	497	c.119C>T	c.(118-120)cCa>cTa	p.P40L	FAM182B_ENST00000478164.1_5'UTR|FAM182B_ENST00000376404.2_Missense_Mutation_p.P37L			Q5T319	F182B_HUMAN	family with sequence similarity 182, member B	40										lung(1)	1						TCCGGGATGTGGACCAGGCAG	0.572																																																	0								ENSG00000175170																																			FAM182B	SO:0001583	missense	0			-	HGNC			20p11.1	2010-07-14			ENSG00000175170	ENSG00000175170			34503	pseudogene	pseudogene							Standard	NR_027061		Approved			Q5T319	OTTHUMG00000032136	ENST00000376403.1:c.119C>T	20.37:g.25755837G>A	ENSP00000365585:p.Pro40Leu	Somatic	0	121	0.00		0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	60	16.67	Q4G0Q1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.P37L	ENST00000376403.1	37	c.110		20	.	.	.	.	.	.	.	.	.	.	.	0.715	-0.785686	0.02907	.	.	ENSG00000175170	ENST00000376404;ENST00000376403	.	.	.	.	.	.	.	.	.	.	.	T	0.39064	0.1064	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.39187	-0.9626	3	0.87932	D	0	.	.	.	.	.	.	.	.	L	37;40	.	ENSP00000365585:P40L	P	-	2	0	FAM182B	25703837	0.187000	0.23238	0.208000	0.23602	0.210000	0.24377	-0.339000	0.07832	0.064000	0.16427	0.064000	0.15345	CCA	-	NULL		0.572	FAM182B-003	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	FAM182B	protein_coding	OTTHUMT00000078463.2	G	NR_026714	-		25755837	-1	no_errors	ENST00000376404	ensembl	human	known	74_37	missense	SNP	0.210	A
CLPTM1	1209	genome.wustl.edu	37	19	45489826	45489826	+	Silent	SNP	G	G	T			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr19:45489826G>T	ENST00000337392.5	+	7	936	c.786G>T	c.(784-786)ctG>ctT	p.L262L	CLPTM1_ENST00000541297.2_Silent_p.L248L|CLPTM1_ENST00000546079.1_Silent_p.L160L|CLPTM1_ENST00000589158.1_3'UTR	NM_001282175.1|NM_001282176.1|NM_001294.2	NP_001269104.1|NP_001269105.1|NP_001285.1	O96005	CLPT1_HUMAN	cleft lip and palate associated transmembrane protein 1	262					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of T cell differentiation in thymus (GO:0033081)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)				endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00354)|Epithelial(262;0.187)		CCCCTCCCCTGGATCAATGTA	0.622																																																	0								ENSG00000104853						104.0	85.0	91.0					19																	45489826		2203	4300	6503	CLPTM1	SO:0001819	synonymous_variant	0			-	HGNC	AF037339	CCDS12651.1, CCDS74394.1, CCDS74395.1	19q13.3	2008-02-05				ENSG00000104853			2087	protein-coding gene	gene with protein product		604783				9828125	Standard	NM_001294		Approved		uc002pai.3	O96005		ENST00000337392.5:c.786G>T	19.37:g.45489826G>T		Somatic	0	28	0.00		0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	22	15.38	B3KQH2|B4DDS3|B4E2X9|B7Z9X9|F5H8J3|Q53ET6|Q9BSS5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_CLPTM1	p.L262	ENST00000337392.5	37	c.786	CCDS12651.1	19																																																																																			-	pfam_CLPTM1		0.622	CLPTM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLPTM1	protein_coding	OTTHUMT00000453267.1	G	NM_001294	-		45489826	+1	no_errors	ENST00000337392	ensembl	human	known	74_37	silent	SNP	1.000	T
GRM6	2916	genome.wustl.edu	37	5	178413971	178413971	+	Silent	SNP	G	G	T			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr5:178413971G>T	ENST00000517717.1	-	8	1406	c.1368C>A	c.(1366-1368)acC>acA	p.T456T	GRM6_ENST00000231188.5_Silent_p.T456T|RP11-281O15.4_ENST00000519491.1_RNA			O15303	GRM6_HUMAN	glutamate receptor, metabotropic 6	456					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|detection of light stimulus involved in visual perception (GO:0050908)|detection of visible light (GO:0009584)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|locomotory behavior (GO:0007626)|positive regulation of calcium ion import (GO:0090280)|regulation of synaptic transmission, glutamatergic (GO:0051966)|retina development in camera-type eye (GO:0060041)|synaptic transmission (GO:0007268)	cell projection (GO:0042995)|endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|new growing cell tip (GO:0035841)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)|protein homodimerization activity (GO:0042803)			NS(2)|breast(4)|endometrium(9)|large_intestine(12)|lung(21)|ovary(2)|pancreas(1)|prostate(3)|urinary_tract(1)	55	all_cancers(89;0.000828)|Renal(175;0.000159)|all_epithelial(37;0.000167)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	all_cancers(40;0.0156)|all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.245)		ACATCACAGGGGTTCCTGCGC	0.647																																																	0								ENSG00000113262						63.0	55.0	57.0					5																	178413971		2203	4300	6503	GRM6	SO:0001819	synonymous_variant	0			-	HGNC	U82083	CCDS4442.1	5q35	2014-01-28						"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4598	protein-coding gene	gene with protein product		604096				9215706	Standard	NM_000843		Approved	GPRC1F, mGlu6, MGLUR6, CSNB1B	uc003mjr.3	O15303	OTTHUMG00000130889	ENST00000517717.1:c.1368C>A	5.37:g.178413971G>T		Somatic	0	42	0.00		0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	31	11.43		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,superfamily_Peripla_BP_I,pfscan_GPCR_3_C,prints_GPCR_3,prints_GPCR_3_mtglu_rcpt_6,prints_GPCR_3_mtglu_rcpt,prints_GPCR_3_mtglu_rcpt_4	p.T456	ENST00000517717.1	37	c.1368	CCDS4442.1	5																																																																																			-	pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I		0.647	GRM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRM6	protein_coding	OTTHUMT00000253474.2	G		-		178413971	-1	no_errors	ENST00000231188	ensembl	human	known	74_37	silent	SNP	1.000	T
ALDH1L1	10840	genome.wustl.edu	37	3	125877353	125877353	+	Missense_Mutation	SNP	C	C	A			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr3:125877353C>A	ENST00000393434.2	-	3	606	c.257G>T	c.(256-258)tGc>tTc	p.C86F	ALDH1L1_ENST00000413612.1_5'Flank|U1_ENST00000606575.1_RNA|ALDH1L1_ENST00000455064.2_Intron|ALDH1L1_ENST00000452905.2_Missense_Mutation_p.C86F|ALDH1L1_ENST00000472186.1_Missense_Mutation_p.C86F|ALDH1L1_ENST00000273450.3_Missense_Mutation_p.C96F|ALDH1L1_ENST00000393431.2_Missense_Mutation_p.C86F	NM_012190.3	NP_036322.2	O75891	AL1L1_HUMAN	aldehyde dehydrogenase 1 family, member L1	86	GART.				10-formyltetrahydrofolate catabolic process (GO:0009258)|biosynthetic process (GO:0009058)|one-carbon metabolic process (GO:0006730)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	catalytic activity (GO:0003824)|formyltetrahydrofolate dehydrogenase activity (GO:0016155)|hydroxymethyl-, formyl- and related transferase activity (GO:0016742)|methyltransferase activity (GO:0008168)|oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor (GO:0016620)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|kidney(5)|large_intestine(10)|lung(22)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	52				GBM - Glioblastoma multiforme(114;0.0462)	Tetrahydrofolic acid(DB00116)	GAATTGGCTGCAGAAGGGCAG	0.587																																																	0								ENSG00000144908						85.0	76.0	79.0					3																	125877353		2203	4300	6503	ALDH1L1	SO:0001583	missense	0			-	HGNC	AF052732	CCDS3034.1, CCDS58850.1, CCDS58851.1	3q21.2	2010-07-19		2005-01-27	ENSG00000144908	ENSG00000144908	1.5.1.6	"""Aldehyde dehydrogenases"""	3978	protein-coding gene	gene with protein product	"""cytosolic 10-formyltetrahydrofolate dehydrogenase"""	600249	"""formyltetrahydrofolate dehydrogenase"""	FTHFD			Standard	NM_012190		Approved	10-fTHF	uc031sbp.1	O75891	OTTHUMG00000125551	ENST00000393434.2:c.257G>T	3.37:g.125877353C>A	ENSP00000377083:p.Cys86Phe	Somatic	0	64	0.00		0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	60	10.29	B4DG36|E9PBX3|Q68CS1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Aldehyde_DH_dom,pfam_Formyl_transf_N,pfam_Formyl_trans_C,pfam_Acyl_carrier_prot-like,superfamily_Ald_DH/histidinol_DH,superfamily_Formyl_transf_N,superfamily_Formyl_transferase_C-like,superfamily_Acyl_carrier_prot-like,pirsf_10_FTHF_DH,pfscan_Acyl_carrier_prot-like	p.C86F	ENST00000393434.2	37	c.257	CCDS3034.1	3	.	.	.	.	.	.	.	.	.	.	C	18.67	3.673835	0.67928	.	.	ENSG00000144908	ENST00000273450;ENST00000472186;ENST00000452905;ENST00000393434;ENST00000393431;ENST00000490367;ENST00000460368;ENST00000488356;ENST00000509952	T;T;T;T;T;T;T;T;T	0.72167	-0.63;-0.63;-0.63;-0.63;-0.63;-0.63;-0.63;-0.63;-0.63	4.84	4.84	0.62591	Formyl transferase, N-terminal (3);	0.000000	0.85682	D	0.000000	T	0.75729	0.3889	N	0.25426	0.745	0.80722	D	1	D;D;D	0.89917	0.997;1.0;1.0	D;D;D	0.97110	0.996;1.0;1.0	T	0.79004	-0.1980	10	0.87932	D	0	.	15.4491	0.75259	0.0:1.0:0.0:0.0	.	86;138;86	E9PBX3;Q59G10;O75891	.;.;AL1L1_HUMAN	F	96;86;86;86;86;86;86;86;86	ENSP00000273450:C96F;ENSP00000420293:C86F;ENSP00000395881:C86F;ENSP00000377083:C86F;ENSP00000377081:C86F;ENSP00000418711:C86F;ENSP00000419826:C86F;ENSP00000419955:C86F;ENSP00000426594:C86F	ENSP00000273450:C96F	C	-	2	0	ALDH1L1	127360043	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.441000	0.80485	2.525000	0.85131	0.491000	0.48974	TGC	-	pfam_Formyl_transf_N,superfamily_Formyl_transf_N,pirsf_10_FTHF_DH		0.587	ALDH1L1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ALDH1L1	protein_coding	OTTHUMT00000354391.1	C	NM_012190	-		125877353	-1	no_errors	ENST00000393434	ensembl	human	known	74_37	missense	SNP	1.000	A
NRXN3	9369	genome.wustl.edu	37	14	80327832	80327832	+	Missense_Mutation	SNP	C	C	A			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr14:80327832C>A	ENST00000557594.1	+	6	2392	c.1439C>A	c.(1438-1440)gCt>gAt	p.A480D	NRXN3_ENST00000428277.2_Intron|NRXN3_ENST00000335750.5_Intron|NRXN3_ENST00000554719.1_Intron|NRXN3_ENST00000556003.1_Intron|NRXN3_ENST00000281127.7_Intron	NM_001272020.1	NP_001258949.1	Q9HDB5	NRX3B_HUMAN	neurexin 3	480					adult behavior (GO:0030534)|angiogenesis (GO:0001525)|learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(23)|lung(40)|ovary(3)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(9)|urinary_tract(1)	104		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		CGCTTCACAGCTTCCTCCTCG	0.502																																																	0								ENSG00000021645																																			NRXN3	SO:0001583	missense	0			-	HGNC	AB018286	CCDS9870.1, CCDS9871.1, CCDS45145.1, CCDS61515.1	14q31	2010-01-19				ENSG00000021645			8010	protein-coding gene	gene with protein product		600567	"""chromosome 14 open reading frame 60"""	C14orf60		11944992, 12379233	Standard	NM_004796		Approved	KIAA0743	uc001xun.4	Q9HDB5		ENST00000557594.1:c.1439C>A	14.37:g.80327832C>A	ENSP00000451672:p.Ala480Asp	Somatic	0	74	0.00		0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	34	34	50.00	A5PKW8|A8MPU5|B3KPM7|Q6NUR0|Q8IUD8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,smart_Neurexin-like,pfscan_Laminin_G	p.A480D	ENST00000557594.1	37	c.1439		14	.	.	.	.	.	.	.	.	.	.	C	16.63	3.177250	0.57692	.	.	ENSG00000021645	ENST00000330071;ENST00000557594	T	0.36157	1.27	6.05	6.05	0.98169	.	.	.	.	.	T	0.28034	0.0691	.	.	.	0.80722	D	1	P	0.38922	0.651	B	0.30401	0.115	T	0.02789	-1.1110	7	.	.	.	.	18.7818	0.91937	0.0:1.0:0.0:0.0	.	480	Q9HDB5	NRX3B_HUMAN	D	1486;480	ENSP00000451672:A480D	.	A	+	2	0	NRXN3	79397585	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.709000	0.84645	2.878000	0.98634	0.650000	0.86243	GCT	-	NULL		0.502	NRXN3-004	NOVEL	basic	protein_coding	NRXN3	protein_coding	OTTHUMT00000413790.1	C	NM_001105250	-		80327832	+1	no_errors	ENST00000557594	ensembl	human	novel	74_37	missense	SNP	1.000	A
PMEL	6490	genome.wustl.edu	37	12	56349572	56349572	+	Missense_Mutation	SNP	C	C	T			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr12:56349572C>T	ENST00000548747.1	-	8	2209	c.1547G>A	c.(1546-1548)tGc>tAc	p.C516Y	PMEL_ENST00000550464.1_Missense_Mutation_p.C430Y|PMEL_ENST00000449260.2_Missense_Mutation_p.C516Y|PMEL_ENST00000552882.1_Missense_Mutation_p.C516Y|PMEL_ENST00000550447.1_Missense_Mutation_p.C145Y|PMEL_ENST00000548493.1_Missense_Mutation_p.C516Y|PMEL_ENST00000548689.1_5'Flank|PMEL_ENST00000360714.4_Missense_Mutation_p.C516Y|PMEL_ENST00000539511.1_Missense_Mutation_p.C430Y|PMEL_ENST00000536427.1_Missense_Mutation_p.C474Y			P40967	PMEL_HUMAN	premelanosome protein	516					melanin biosynthetic process (GO:0042438)|melanosome organization (GO:0032438)	endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|melanosome (GO:0042470)|multivesicular body membrane (GO:0032585)|plasma membrane (GO:0005886)				NS(1)|breast(2)|endometrium(2)|large_intestine(4)|lung(4)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						CCCGCCTTGGCAGGACACAGT	0.517											OREG0021914	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000185664						142.0	127.0	132.0					12																	56349572		2203	4300	6503	PMEL	SO:0001583	missense	0			-	HGNC	AK092881	CCDS8897.1, CCDS55833.1, CCDS55834.1	12q13-q14	2010-12-17	2010-12-17	2010-12-17	ENSG00000185664	ENSG00000185664			10880	protein-coding gene	gene with protein product		155550	"""silver (mouse homolog) like"", ""silver homolog (mouse)"""	SIL, SILV		8739560	Standard	NM_001200053		Approved	D12S53E, SI, Pmel17, gp100	uc001siq.3	P40967		ENST00000548747.1:c.1547G>A	12.37:g.56349572C>T	ENSP00000448828:p.Cys516Tyr	Somatic	0	31	0.00	1014	0.5896962938082563	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	18	18.18	B3KS57|B7Z6D7|Q12763|Q14448|Q14817|Q16565	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PKD_dom,superfamily_PKD_dom,smart_PKD/Chitinase_dom,pfscan_PKD_dom	p.C516Y	ENST00000548747.1	37	c.1547	CCDS8897.1	12	.	.	.	.	.	.	.	.	.	.	C	29.5	5.012145	0.93346	.	.	ENSG00000185664	ENST00000449260;ENST00000552882;ENST00000550464;ENST00000548747;ENST00000548493;ENST00000360714;ENST00000536427;ENST00000539511;ENST00000550447	T;T;T;T;T;T;T;T	0.60548	0.38;2.32;2.27;2.32;2.32;0.38;0.18;2.27	5.7	5.7	0.88788	.	0.000000	0.64402	D	0.000003	T	0.77418	0.4127	M	0.75615	2.305	0.54753	D	0.999987	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.97110	1.0;0.999;0.997	T	0.78560	-0.2157	10	0.87932	D	0	-11.4405	18.995	0.92809	0.0:1.0:0.0:0.0	.	430;516;516	P40967-3;P40967-2;P40967	.;.;PMEL_HUMAN	Y	516;516;430;516;516;516;474;430;145	ENSP00000402758:C516Y;ENSP00000449690:C516Y;ENSP00000450036:C430Y;ENSP00000448828:C516Y;ENSP00000447374:C516Y;ENSP00000353940:C516Y;ENSP00000438695:C474Y;ENSP00000445005:C430Y	ENSP00000353940:C516Y	C	-	2	0	PMEL	54635839	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.619000	0.74219	2.861000	0.98227	0.655000	0.94253	TGC	-	NULL		0.517	PMEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PMEL	protein_coding	OTTHUMT00000409626.1	C	NM_006928	-		56349572	-1	no_errors	ENST00000360714	ensembl	human	known	74_37	missense	SNP	1.000	T
