#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
SUZ12	23512	genome.wustl.edu	37	17	30322708	30322732	+	Frame_Shift_Del	DEL	TCCGTCCACAAGAAATGGAAGTAGA	TCCGTCCACAAGAAATGGAAGTAGA	-			TCGA-SI-AA8C-01A-11D-A387-09	TCGA-SI-AA8C-10A-01D-A38A-09	TCCGTCCACAAGAAATGGAAGTAGA	TCCGTCCACAAGAAATGGAAGTAGA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b939bdb6-694c-4411-b89b-ee9ac7dc62a9	7a75c68f-e44f-4634-92eb-e759d0c9075c	g.chr17:30322708_30322732delTCCGTCCACAAGAAATGGAAGTAGA	ENST00000322652.5	+	14	1950_1974	c.1721_1745delTCCGTCCACAAGAAATGGAAGTAGA	c.(1720-1746)ctccgtccacaagaaatggaagtagatfs	p.LRPQEMEVD574fs	SUZ12_ENST00000580398.1_Frame_Shift_Del_p.LRPQEMEVD551fs	NM_015355.2	NP_056170.2	Q15022	SUZ12_HUMAN	SUZ12 polycomb repressive complex 2 subunit	574	VEFS-box.				histone ubiquitination (GO:0016574)|negative regulation of cell differentiation (GO:0045596)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell proliferation (GO:0008284)|transcription, DNA-templated (GO:0006351)	ESC/E(Z) complex (GO:0035098)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|sex chromatin (GO:0001739)	chromatin binding (GO:0003682)|histone methyltransferase activity (GO:0042054)|metal ion binding (GO:0046872)|methylated histone binding (GO:0035064)|RNA binding (GO:0003723)|sequence-specific DNA binding (GO:0043565)		SSH2/SUZ12(2)|JAZF1/SUZ12(133)	breast(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(4)|lung(5)|skin(1)	21		Myeloproliferative disorder(56;0.0255)|all_hematologic(16;0.041)|Ovarian(249;0.182)|Breast(31;0.231)				TGCTTACCTCTCCGTCCACAAGAAATGGAAGTAGATAGTGAAGAT	0.342			T	JAZF1	endometrial stromal tumours																																			Dom	yes		17	17q11.2	23512	suppressor of zeste 12 homolog (Drosophila)		M	0								ENSG00000178691																																			SUZ12	SO:0001589	frameshift_variant	0				HGNC	D63881	CCDS11270.1	17q21	2013-06-05	2013-06-05		ENSG00000178691	ENSG00000178691		"""Zinc fingers, C2H2-type"""	17101	protein-coding gene	gene with protein product		606245	"""suppressor of zeste 12 homolog (Drosophila)"""			8590280, 11371647, 18784248	Standard	NM_015355		Approved	JJAZ1, KIAA0160, CHET9	uc002hgs.2	Q15022	OTTHUMG00000132813	ENST00000322652.5:c.1721_1745delTCCGTCCACAAGAAATGGAAGTAGA	17.37:g.30322708_30322732delTCCGTCCACAAGAAATGGAAGTAGA	ENSP00000316578:p.Leu574fs	Somatic	NA	NA	NA		0.6119782349188219	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q96BD9	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Polycomb_protein_VEFS-Box	p.R575fs	ENST00000322652.5	37	c.1721_1745	CCDS11270.1	17																																																																																			-	pfam_Polycomb_protein_VEFS-Box		0.342	SUZ12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUZ12	protein_coding	OTTHUMT00000256260.2	TCCGTCCACAAGAAATGGAAGTAGA	NM_015355			30322732	+1	no_errors	ENST00000322652	ensembl	human	known	74_37	frame_shift_del	DEL	1.000:0.999:1.000:1.000:0.967:1.000:1.000:0.973:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000	-
EVL	51466	genome.wustl.edu	37	14	100595978	100595978	+	Missense_Mutation	SNP	G	G	A			TCGA-SI-AA8C-01A-11D-A387-09	TCGA-SI-AA8C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b939bdb6-694c-4411-b89b-ee9ac7dc62a9	7a75c68f-e44f-4634-92eb-e759d0c9075c	g.chr14:100595978G>A	ENST00000402714.2	+	7	1394	c.790G>A	c.(790-792)Gga>Aga	p.G264R	EVL_ENST00000544450.2_Missense_Mutation_p.G270R|EVL_ENST00000392920.3_Missense_Mutation_p.G266R			Q9UI08	EVL_HUMAN	Enah/Vasp-like	264	EVH2.				actin filament organization (GO:0007015)|actin polymerization or depolymerization (GO:0008154)|axon guidance (GO:0007411)|cell surface receptor signaling pathway (GO:0007166)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of ruffle assembly (GO:1900028)|nervous system development (GO:0007399)|organ morphogenesis (GO:0009887)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of stress fiber assembly (GO:0051496)|protein homotetramerization (GO:0051289)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|membrane (GO:0016020)	profilin binding (GO:0005522)|SH3 domain binding (GO:0017124)			cervix(1)|large_intestine(5)|lung(3)|ovary(3)|urinary_tract(2)	14		Melanoma(154;0.152)				CGGGGGTGGCGGAGGAGGCCT	0.622																																																	0								ENSG00000196405						44.0	41.0	42.0					14																	100595978		2202	4299	6501	EVL	SO:0001583	missense	0			-	HGNC	AF112209	CCDS9955.1	14q32.2	2014-08-13			ENSG00000196405	ENSG00000196405			20234	protein-coding gene	gene with protein product						10945997, 10993894	Standard	NM_016337		Approved	RNB6	uc001ygu.3	Q9UI08	OTTHUMG00000171530	ENST00000402714.2:c.790G>A	14.37:g.100595978G>A	ENSP00000384720:p.Gly264Arg	Somatic	0	52	0.00		0.6119782349188219	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	40	20.00	A8K105|O95884|Q7Z522|Q8TBV1|Q9UF25|Q9UIC2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_WH1/EVH1,pfam_VASP_tetra,smart_WH1/EVH1,pirsf_Vasodilator_phosphoprotein,pfscan_WH1/EVH1	p.G266R	ENST00000402714.2	37	c.796		14	.	.	.	.	.	.	.	.	.	.	G	20.1	3.939494	0.73557	.	.	ENSG00000196405	ENST00000402714;ENST00000544450;ENST00000392920;ENST00000539470;ENST00000557384;ENST00000554695	T;T;T;T	0.76578	-1.0;-1.03;-1.0;0.34	5.24	4.35	0.52113	.	0.368082	0.27876	N	0.017491	D	0.85982	0.5824	M	0.87547	2.89	0.38658	D	0.952009	D;D;D	0.65815	0.995;0.995;0.992	P;P;P	0.57720	0.739;0.826;0.674	D	0.88718	0.3227	10	0.66056	D	0.02	-19.3173	10.8189	0.46593	0.1477:0.0:0.8523:0.0	.	270;266;264	B7Z3I5;Q9UI08-2;Q9UI08	.;.;EVL_HUMAN	R	264;270;266;229;160;81	ENSP00000384720:G264R;ENSP00000437904:G270R;ENSP00000376652:G266R;ENSP00000450979:G160R	ENSP00000376652:G266R	G	+	1	0	EVL	99665731	1.000000	0.71417	0.907000	0.35723	0.593000	0.36681	4.471000	0.60182	2.445000	0.82738	0.655000	0.94253	GGA	-	pirsf_Vasodilator_phosphoprotein		0.622	EVL-006	KNOWN	basic|appris_candidate	protein_coding	EVL	protein_coding	OTTHUMT00000413958.1	G		-		100595978	+1	no_errors	ENST00000392920	ensembl	human	known	74_37	missense	SNP	0.985	A
NDST2	8509	genome.wustl.edu	37	10	75563007	75563007	+	Silent	SNP	A	A	G			TCGA-SI-AA8C-01A-11D-A387-09	TCGA-SI-AA8C-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b939bdb6-694c-4411-b89b-ee9ac7dc62a9	7a75c68f-e44f-4634-92eb-e759d0c9075c	g.chr10:75563007A>G	ENST00000309979.6	-	12	2809	c.2253T>C	c.(2251-2253)ctT>ctC	p.L751L	NDST2_ENST00000299641.4_Silent_p.L628L|ZSWIM8-AS1_ENST00000456638.2_RNA|RP11-574K11.31_ENST00000603027.1_Silent_p.L751L			P52849	NDST2_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 2	751	Heparan sulfate N-sulfotransferase 2.				carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|hydrolase activity (GO:0016787)			cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(11)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	30	Prostate(51;0.0112)					AGCCAGGGACAAGACAGCGGT	0.552																																																	0								ENSG00000166507						147.0	150.0	149.0					10																	75563007		2203	4300	6503	NDST2	SO:0001819	synonymous_variant	0			-	HGNC	U36601	CCDS7335.1	10q22	2007-03-14			ENSG00000166507	ENSG00000166507		"""Sulfotransferases, membrane-bound"""	7681	protein-coding gene	gene with protein product		603268				9601056	Standard	NM_003635		Approved	NST2, HSST2	uc001jvk.2	P52849	OTTHUMG00000018489	ENST00000309979.6:c.2253T>C	10.37:g.75563007A>G		Somatic	0	67	0.00		0.6119782349188219	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70	Q2TB32|Q59H89	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Heparan_SO4_deacetylase,pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase	p.L751	ENST00000309979.6	37	c.2253	CCDS7335.1	10																																																																																			-	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase		0.552	NDST2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	NDST2	protein_coding	OTTHUMT00000048710.1	A	NM_003635	-		75563007	-1	no_errors	ENST00000309979	ensembl	human	known	74_37	silent	SNP	0.016	G
PLTP	5360	genome.wustl.edu	37	20	44540098	44540098	+	5'UTR	SNP	C	C	T			TCGA-SI-AA8C-01A-11D-A387-09	TCGA-SI-AA8C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b939bdb6-694c-4411-b89b-ee9ac7dc62a9	7a75c68f-e44f-4634-92eb-e759d0c9075c	g.chr20:44540098C>T	ENST00000477313.1	-	0	588				PLTP_ENST00000420868.2_5'UTR|PLTP_ENST00000372420.1_5'Flank|PLTP_ENST00000372431.3_5'UTR|PLTP_ENST00000542937.1_Silent_p.P18P|PLTP_ENST00000354050.4_5'UTR			P55058	PLTP_HUMAN	phospholipid transfer protein						lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|sperm motility (GO:0030317)|vitamin E biosynthetic process (GO:0010189)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	lipid binding (GO:0008289)			endometrium(2)|kidney(2)|large_intestine(8)|lung(8)|ovary(1)	21		Myeloproliferative disorder(115;0.0122)				CCATGGCGAGCGGGCCTGGGG	0.632																																																	0								ENSG00000100979						21.0	26.0	24.0					20																	44540098		2158	4248	6406	PLTP	SO:0001623	5_prime_UTR_variant	0			-	HGNC	L26232	CCDS13386.1, CCDS13387.1, CCDS56196.1, CCDS56197.1	20q13.12	2011-08-16			ENSG00000100979	ENSG00000100979		"""BPI fold containing"""	9093	protein-coding gene	gene with protein product	"""BPI fold containing family E"""	172425					Standard	NM_006227		Approved	BPIFE	uc002xqn.2	P55058	OTTHUMG00000033047	ENST00000477313.1:c.-7G>A	20.37:g.44540098C>T		Somatic	0	101	0.00		0.6119782349188219	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	36	12.20	A8K006|B4DDD5|B4DRB4|E1P5N8|E7EV16|Q8WTT1|Q9BR07|Q9BSH8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Lipid-bd_serum_glycop_C,pfam_Lipid-bd_serum_glycop_N,superfamily_Bactericidal_perm-incr_a/b_dom,smart_Lipid-bd_serum_glycop_N,smart_Lipid-bd_serum_glycop_C	p.P18	ENST00000477313.1	37	c.54	CCDS13386.1	20																																																																																			-	NULL		0.632	PLTP-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PLTP	protein_coding	OTTHUMT00000354633.1	C	NM_006227	-		44540098	-1	no_errors	ENST00000542937	ensembl	human	known	74_37	silent	SNP	0.983	T
DGKG	1608	genome.wustl.edu	37	3	186015929	186015929	+	Silent	SNP	G	G	T			TCGA-SI-AA8C-01A-11D-A387-09	TCGA-SI-AA8C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b939bdb6-694c-4411-b89b-ee9ac7dc62a9	7a75c68f-e44f-4634-92eb-e759d0c9075c	g.chr3:186015929G>T	ENST00000265022.3	-	4	773	c.234C>A	c.(232-234)gcC>gcA	p.A78A	DGKG_ENST00000382164.4_Silent_p.A78A|DGKG_ENST00000344484.4_Silent_p.A78A|DGKG_ENST00000544847.1_Silent_p.A78A	NM_001080744.1|NM_001080745.1|NM_001346.2	NP_001074213.1|NP_001074214.1|NP_001337.2	P49619	DGKG_HUMAN	diacylglycerol kinase, gamma 90kDa	78					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|neuron development (GO:0048666)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(17)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	42	all_cancers(143;3.26e-12)|Ovarian(172;0.0315)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)	GBM - Glioblastoma multiforme(93;0.0657)	Phosphatidylserine(DB00144)	TCTGGCTGAAGGCCAGGAAGA	0.587																																																	0								ENSG00000058866						109.0	107.0	107.0					3																	186015929		2203	4300	6503	DGKG	SO:0001819	synonymous_variant	0			-	HGNC	AF020945	CCDS3274.1, CCDS43181.1, CCDS43182.1	3q27-q28	2013-01-10	2002-08-29		ENSG00000058866	ENSG00000058866	2.7.1.107	"""EF-hand domain containing"""	2853	protein-coding gene	gene with protein product		601854	"""diacylglycerol kinase, gamma (90kD)"""	DAGK3		8034597	Standard	NM_001080744		Approved		uc003fqa.3	P49619	OTTHUMG00000156617	ENST00000265022.3:c.234C>A	3.37:g.186015929G>T		Somatic	0	90	0.00		0.6119782349188219	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	54	11.48	B2RAH4|Q2M1H4|Q5FWG1	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Diacylglycerol_kin_accessory,pfam_Diacylglycerol_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,smart_EF_hand_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kin_accessory,pfscan_EF_hand_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd	p.A78	ENST00000265022.3	37	c.234	CCDS3274.1	3																																																																																			-	NULL		0.587	DGKG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DGKG	protein_coding	OTTHUMT00000344800.3	G		-		186015929	-1	no_errors	ENST00000265022	ensembl	human	known	74_37	silent	SNP	1.000	T
TC2N	123036	genome.wustl.edu	37	14	92251630	92251630	+	Missense_Mutation	SNP	G	G	T			TCGA-SI-AA8C-01A-11D-A387-09	TCGA-SI-AA8C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b939bdb6-694c-4411-b89b-ee9ac7dc62a9	7a75c68f-e44f-4634-92eb-e759d0c9075c	g.chr14:92251630G>T	ENST00000435962.2	-	11	1561	c.1238C>A	c.(1237-1239)tCc>tAc	p.S413Y	TC2N_ENST00000360594.5_Missense_Mutation_p.S413Y|TC2N_ENST00000556018.1_Missense_Mutation_p.S349Y|TC2N_ENST00000340892.5_Missense_Mutation_p.S413Y	NM_001128596.1	NP_001122068	Q8N9U0	TAC2N_HUMAN	tandem C2 domains, nuclear	413	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)	nucleus (GO:0005634)				breast(1)|endometrium(2)|large_intestine(6)|liver(1)|lung(5)|skin(1)|upper_aerodigestive_tract(2)	18				COAD - Colon adenocarcinoma(157;0.218)		TCTTCCATTGGAGGCCTTCAG	0.358																																																	0								ENSG00000165929						186.0	204.0	198.0					14																	92251630		2203	4299	6502	TC2N	SO:0001583	missense	0			-	HGNC	AA243837	CCDS9897.1, CCDS73679.1	14q32.12	2007-10-17	2007-08-17	2007-08-17		ENSG00000165929			19859	protein-coding gene	gene with protein product	"""C2 calcium-dependent domain containing 1"""		"""chromosome 14 open reading frame 47"", ""membrane targeting (tandem) C2 domain containing 1"""	C14orf47, MTAC2D1		11526914	Standard	NM_001128596		Approved	FLJ36557, Tac2-N, C2CD1	uc001xzt.4	Q8N9U0		ENST00000435962.2:c.1238C>A	14.37:g.92251630G>T	ENSP00000387882:p.Ser413Tyr	Somatic	0	64	0.00		0.6119782349188219	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	39	9.30		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	p.S413Y	ENST00000435962.2	37	c.1238	CCDS9897.1	14	.	.	.	.	.	.	.	.	.	.	G	21.6	4.169855	0.78452	.	.	ENSG00000165929	ENST00000435962;ENST00000340892;ENST00000360594;ENST00000556018;ENST00000556590	T;T;T;T;T	0.71817	-0.6;-0.6;-0.6;-0.6;-0.6	5.5	5.5	0.81552	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.297002	0.37530	N	0.002057	T	0.73401	0.3582	N	0.14661	0.345	0.32490	N	0.540285	D;P	0.64830	0.994;0.773	D;P	0.65233	0.933;0.678	T	0.79727	-0.1682	10	0.87932	D	0	-7.0666	19.3998	0.94623	0.0:0.0:1.0:0.0	.	349;413	Q8N9U0-2;Q8N9U0	.;TAC2N_HUMAN	Y	413;413;413;349;165	ENSP00000387882:S413Y;ENSP00000343199:S413Y;ENSP00000353802:S413Y;ENSP00000451317:S349Y;ENSP00000450922:S165Y	ENSP00000343199:S413Y	S	-	2	0	TC2N	91321383	1.000000	0.71417	0.999000	0.59377	0.950000	0.60333	4.165000	0.58196	2.586000	0.87340	0.655000	0.94253	TCC	-	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom		0.358	TC2N-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TC2N	protein_coding	OTTHUMT00000411778.1	G	NM_152332	-		92251630	-1	no_errors	ENST00000340892	ensembl	human	known	74_37	missense	SNP	1.000	T
TBC1D20	128637	genome.wustl.edu	37	20	422183	422183	+	Intron	SNP	G	G	T	rs577622376		TCGA-SI-AA8C-01A-11D-A387-09	TCGA-SI-AA8C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b939bdb6-694c-4411-b89b-ee9ac7dc62a9	7a75c68f-e44f-4634-92eb-e759d0c9075c	g.chr20:422183G>T	ENST00000354200.4	-	5	774				TBC1D20_ENST00000461188.1_5'UTR	NM_144628.2	NP_653229.1	Q96BZ9	TBC20_HUMAN	TBC1 domain family, member 20						acrosome assembly (GO:0001675)|cargo loading into COPII-coated vesicle (GO:0090110)|ER to Golgi vesicle-mediated transport (GO:0006888)|Golgi organization (GO:0007030)|lens fiber cell morphogenesis (GO:0070309)|lipid particle organization (GO:0034389)|positive regulation of ER to Golgi vesicle-mediated transport (GO:1902953)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)|seminiferous tubule development (GO:0072520)|virion assembly (GO:0019068)	endoplasmic reticulum membrane (GO:0005789)|integral component of Golgi membrane (GO:0030173)|nuclear membrane (GO:0031965)	Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	12		all_epithelial(17;0.228)|Breast(17;0.231)				GGTGTGGGGGGGTGTGGGCGT	0.507													G|||	1	0.000199681	0.0	0.0014	5008	,	,		19204	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000125875						84.0	72.0	76.0					20																	422183		2203	4300	6503	TBC1D20	SO:0001627	intron_variant	0			-	HGNC	AK055573	CCDS13002.1	20p13	2013-07-10	2005-01-05	2005-01-05	ENSG00000125875	ENSG00000125875			16133	protein-coding gene	gene with protein product		611663	"""chromosome 20 open reading frame 140"""	C20orf140		17901050	Standard	XM_005260661		Approved	dJ852M4.2	uc002wds.3	Q96BZ9	OTTHUMG00000031637	ENST00000354200.4:c.626+48C>A	20.37:g.422183G>T		Somatic	0	48	0.00		0.6119782349188219	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	51	12.07	A8K6I3|B9A6M1|Q5JWQ7|Q6ZSY8|Q96NE1|Q9BYM7|Q9H140	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000354200.4	37	NULL	CCDS13002.1	20																																																																																			-	-		0.507	TBC1D20-004	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D20	protein_coding	OTTHUMT00000251397.2	G	NM_144628	-		422183	-1	no_errors	ENST00000461188	ensembl	human	known	74_37	rna	SNP	0.000	T
TTN	7273	genome.wustl.edu	37	2	179416365	179416365	+	Missense_Mutation	SNP	G	G	T			TCGA-SI-AA8C-01A-11D-A387-09	TCGA-SI-AA8C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b939bdb6-694c-4411-b89b-ee9ac7dc62a9	7a75c68f-e44f-4634-92eb-e759d0c9075c	g.chr2:179416365G>T	ENST00000591111.1	-	285	86563	c.86339C>A	c.(86338-86340)tCt>tAt	p.S28780Y	TTN_ENST00000460472.2_Missense_Mutation_p.S21356Y|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.S21548Y|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.S21481Y|TTN_ENST00000589042.1_Missense_Mutation_p.S30421Y|TTN_ENST00000342992.6_Missense_Mutation_p.S27853Y|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000592600.1_RNA|RP11-65L3.2_ENST00000603415.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000585451.1_RNA			Q8WZ42	TITIN_HUMAN	titin	28780	Fibronectin type-III 109. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ACCTACTGGAGAAACAGCTAA	0.368																																																	0								ENSG00000155657						61.0	56.0	58.0					2																	179416365		1841	4085	5926	TTN	SO:0001583	missense	0			-	HGNC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.86339C>A	2.37:g.179416365G>T	ENSP00000465570:p.Ser28780Tyr	Somatic	0	78	0.00		0.6119782349188219	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.16	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.S27853Y	ENST00000591111.1	37	c.83558		2	.	.	.	.	.	.	.	.	.	.	G	16.06	3.015888	0.54468	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.55588	0.51;0.51;0.51;0.51	5.75	5.75	0.90469	Fibronectin, type III (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.66752	0.2821	L	0.38649	1.16	0.80722	D	1	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.83275	0.996;0.996;0.996;0.996	T	0.68127	-0.5491	9	0.87932	D	0	.	19.94	0.97155	0.0:0.0:1.0:0.0	.	21356;21481;21548;28780	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	Y	27853;21356;21548;21481;21353	ENSP00000343764:S27853Y;ENSP00000434586:S21356Y;ENSP00000340554:S21548Y;ENSP00000352154:S21481Y	ENSP00000340554:S21548Y	S	-	2	0	TTN	179124611	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.922000	0.87538	2.721000	0.93114	0.650000	0.86243	TCT	-	superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom		0.368	TTN-019	PUTATIVE	basic	protein_coding	TTN	protein_coding	OTTHUMT00000460310.1	G	NM_133378	-		179416365	-1	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	SNP	1.000	T
COL11A2	1302	genome.wustl.edu	37	6	33147260	33147260	+	Missense_Mutation	SNP	G	G	A	rs143965711		TCGA-SI-AA8C-01A-11D-A387-09	TCGA-SI-AA8C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b939bdb6-694c-4411-b89b-ee9ac7dc62a9	7a75c68f-e44f-4634-92eb-e759d0c9075c	g.chr6:33147260G>A	ENST00000374708.4	-	12	1451	c.1193C>T	c.(1192-1194)gCg>gTg	p.A398V	COL11A2_ENST00000374712.1_Missense_Mutation_p.A403V|COL11A2_ENST00000357486.1_Missense_Mutation_p.A463V|COL11A2_ENST00000341947.2_Missense_Mutation_p.A484V|COL11A2_ENST00000374713.1_Missense_Mutation_p.A437V|COL11A2_ENST00000477772.1_5'Flank|COL11A2_ENST00000395197.1_Missense_Mutation_p.A424V|COL11A2_ENST00000374714.1_Missense_Mutation_p.A458V|COL11A2_ENST00000361917.1_Missense_Mutation_p.A377V	NM_080681.2	NP_542412.2	P13942	COBA2_HUMAN	collagen, type XI, alpha 2	484	Nonhelical region.				cartilage development (GO:0051216)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|palate development (GO:0060021)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|soft palate development (GO:0060023)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			biliary_tract(1)|breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|liver(1)|lung(27)|ovary(5)|prostate(5)|skin(6)	68						TCCACGGAGCGCCAGCTAGGG	0.632																																					Melanoma(1;90 116 3946 5341 17093)												0								ENSG00000204248		VAL/ALA,VAL/ALA,VAL/ALA	1,2969		0,1,1484	24.0	11.0	16.0		1130,1451,1193	4.8	1.0	6	dbSNP_134	16	0,5362		0,0,2681	no	missense,missense,missense	COL11A2	NM_080679.2,NM_080680.2,NM_080681.2	64,64,64	0,1,4165	AA,AG,GG		0.0,0.0337,0.012	probably-damaging,probably-damaging,probably-damaging	377/1630,484/1737,398/1651	33147260	1,8331	1485	2681	4166	COL11A2	SO:0001583	missense	0			-	HGNC	U32169	CCDS43452.1, CCDS54992.1	6p21.3	2013-01-16			ENSG00000204248	ENSG00000204248		"""Collagens"""	2187	protein-coding gene	gene with protein product		120290		DFNA13, DFNB53		7559422, 10581026	Standard	NM_080679		Approved	HKE5	uc003ocx.1	P13942	OTTHUMG00000031036	ENST00000374708.4:c.1193C>T	6.37:g.33147260G>A	ENSP00000363840:p.Ala398Val	Somatic	0	77	0.00		0.6119782349188219	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00	A6NLX2|E7ER90|Q07751|Q13271|Q13272|Q13273|Q5JP94|Q5SUI8|Q7Z6C3|Q99866|Q9UIP9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Collagen,pfam_Fib_collagen_C,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,superfamily_Fibrinogen_a/b/g_C_dom,smart_Laminin_G,smart_Fib_collagen_C	p.A484V	ENST00000374708.4	37	c.1451	CCDS43452.1	6	.	.	.	.	.	.	.	.	.	.	G	19.85	3.902925	0.72754	3.37E-4	0.0	ENSG00000204248	ENST00000374708;ENST00000341947;ENST00000357486;ENST00000374714;ENST00000374713;ENST00000395197;ENST00000374712;ENST00000361917;ENST00000457788	D;D;D;D;D;D;D;D;D	0.90788	-2.48;-2.41;-2.44;-2.45;-2.45;-2.44;-2.55;-2.44;-2.73	4.77	4.77	0.60923	.	0.000000	0.85682	D	0.000000	D	0.94532	0.8239	M	0.80616	2.505	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.81914	0.962;0.957;0.995	D	0.95062	0.8196	10	0.87932	D	0	.	15.3205	0.74117	0.0:0.0:1.0:0.0	.	377;398;484	P13942-8;P13942-6;P13942	.;.;COBA2_HUMAN	V	398;484;463;458;437;424;403;377;484	ENSP00000363840:A398V;ENSP00000339915:A484V;ENSP00000350079:A463V;ENSP00000363846:A458V;ENSP00000363845:A437V;ENSP00000378623:A424V;ENSP00000363844:A403V;ENSP00000355123:A377V;ENSP00000405520:A484V	ENSP00000339915:A484V	A	-	2	0	COL11A2	33255238	1.000000	0.71417	0.954000	0.39281	0.213000	0.24496	5.939000	0.70179	2.477000	0.83638	0.549000	0.68633	GCG	-	NULL		0.632	COL11A2-001	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	COL11A2	protein_coding	OTTHUMT00000076032.2	G		rs143965711		33147260	-1	no_errors	ENST00000341947	ensembl	human	known	74_37	missense	SNP	0.998	A
UBR4	23352	genome.wustl.edu	37	1	19493694	19493694	+	Frame_Shift_Del	DEL	T	T	-			TCGA-SI-AA8C-01A-11D-A387-09	TCGA-SI-AA8C-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b939bdb6-694c-4411-b89b-ee9ac7dc62a9	7a75c68f-e44f-4634-92eb-e759d0c9075c	g.chr1:19493694delT	ENST00000375254.3	-	29	3958	c.3931delA	c.(3931-3933)attfs	p.I1311fs	UBR4_ENST00000375226.2_Frame_Shift_Del_p.I1311fs|UBR4_ENST00000375267.2_Frame_Shift_Del_p.I1311fs|UBR4_ENST00000375217.2_Frame_Shift_Del_p.I1311fs	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	1311					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		AGTGTCCGAATTACCTGTGGT	0.478																																																	0								ENSG00000127481						109.0	106.0	107.0					1																	19493694		2203	4300	6503	UBR4	SO:0001589	frameshift_variant	0				HGNC	AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.3931delA	1.37:g.19493694delT	ENSP00000364403:p.Ile1311fs	Somatic	0	50	0.00		0.6119782349188219	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	14	12.50	A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_Znf_N-recognin_met,pfscan_Znf_N-recognin	p.I1311fs	ENST00000375254.3	37	c.3931	CCDS189.1	1																																																																																			-	superfamily_ARM-type_fold		0.478	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBR4	protein_coding	OTTHUMT00000007085.1	T	NM_020765			19493694	-1	no_errors	ENST00000375267	ensembl	human	known	74_37	frame_shift_del	DEL	0.967	-
HS6ST3	266722	genome.wustl.edu	37	13	97485014	97485014	+	Silent	SNP	T	T	A			TCGA-SI-AA8C-01A-11D-A387-09	TCGA-SI-AA8C-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b939bdb6-694c-4411-b89b-ee9ac7dc62a9	7a75c68f-e44f-4634-92eb-e759d0c9075c	g.chr13:97485014T>A	ENST00000376705.2	+	2	1002	c.978T>A	c.(976-978)acT>acA	p.T326T		NM_153456.3	NP_703157.2	Q8IZP7	H6ST3_HUMAN	heparan sulfate 6-O-sulfotransferase 3	326					heparan sulfate proteoglycan biosynthetic process, enzymatic modification (GO:0015015)	integral component of membrane (GO:0016021)	heparan sulfate 6-O-sulfotransferase activity (GO:0017095)			NS(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|pancreas(1)|skin(1)	20	all_neural(89;0.0878)|Medulloblastoma(90;0.163)					ATAACTTGACTTTCATGAACG	0.502																																																	0								ENSG00000185352						90.0	90.0	90.0					13																	97485014		2203	4300	6503	HS6ST3	SO:0001819	synonymous_variant	0			-	HGNC	AF539426	CCDS9481.1	13q32.2	2007-12-04			ENSG00000185352	ENSG00000185352		"""Sulfotransferases, membrane-bound"""	19134	protein-coding gene	gene with protein product		609401					Standard	NM_153456		Approved		uc001vmw.4	Q8IZP7	OTTHUMG00000017232	ENST00000376705.2:c.978T>A	13.37:g.97485014T>A		Somatic	0	64	0.00		0.6119782349188219	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	38	11.63	Q5W0L0|Q68CW6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Sulfotransferase,superfamily_P-loop_NTPase	p.T326	ENST00000376705.2	37	c.978	CCDS9481.1	13																																																																																			-	pfam_Sulfotransferase		0.502	HS6ST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HS6ST3	protein_coding	OTTHUMT00000045517.2	T	NM_153456	-		97485014	+1	no_errors	ENST00000376705	ensembl	human	known	74_37	silent	SNP	0.934	A
MN1	4330	genome.wustl.edu	37	22	28195625	28195627	+	In_Frame_Del	DEL	GCT	GCT	-			TCGA-SI-AA8C-01A-11D-A387-09	TCGA-SI-AA8C-10A-01D-A38A-09	GCT	GCT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b939bdb6-694c-4411-b89b-ee9ac7dc62a9	7a75c68f-e44f-4634-92eb-e759d0c9075c	g.chr22:28195625_28195627delGCT	ENST00000302326.4	-	1	1859_1861	c.905_907delAGC	c.(904-909)cagccc>ccc	p.Q302del		NM_002430.2	NP_002421.3	Q10571	MN1_HUMAN	meningioma (disrupted in balanced translocation) 1	302	Poly-Gln.				intramembranous ossification (GO:0001957)					NS(1)|breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(6)|lung(15)|ovary(3)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	45						tgctgctggggctgctgctgctg	0.66			T	ETV6	"""AML, meningioma"""																																			Dom	yes		22	22q13	4330	meningioma (disrupted in balanced translocation) 1		"""L, O"""	0								ENSG00000169184			39,2663		9,21,1321						-0.8	0.0		dbSNP_131	3	111,5619		17,77,2771	no	coding	MN1	NM_002430.2		26,98,4092	A1A1,A1R,RR		1.9372,1.4434,1.7789				150,8282				MN1	SO:0001651	inframe_deletion	0				HGNC	X82209	CCDS42998.1	22q12.1	2010-09-29			ENSG00000169184	ENSG00000169184			7180	protein-coding gene	gene with protein product	"""probable tumor suppressor protein MN1"""	156100	"""meningioma chromosome region"""	MGCR		7731706, 12569362	Standard	NM_002430		Approved	MGCR1-PEN, MGCR1	uc003adj.3	Q10571	OTTHUMG00000150975	ENST00000302326.4:c.905_907delAGC	22.37:g.28195634_28195636delGCT	ENSP00000304956:p.Gln302del	Somatic	0	35	0.00		0.6119782349188219	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	12	20.00	A9Z1V9	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	NULL	p.Q302in_frame_del	ENST00000302326.4	37	c.907_905	CCDS42998.1	22																																																																																			-	NULL		0.660	MN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MN1	protein_coding	OTTHUMT00000320737.1	GCT	NM_002430			28195627	-1	no_errors	ENST00000302326	ensembl	human	known	74_37	in_frame_del	DEL	0.962:0.987:0.994	-
FRMPD2	143162	genome.wustl.edu	37	10	49414887	49414887	+	Silent	SNP	G	G	T			TCGA-SI-AA8C-01A-11D-A387-09	TCGA-SI-AA8C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b939bdb6-694c-4411-b89b-ee9ac7dc62a9	7a75c68f-e44f-4634-92eb-e759d0c9075c	g.chr10:49414887G>T	ENST00000374201.3	-	14	2003	c.1701C>A	c.(1699-1701)atC>atA	p.I567I	FRMPD2_ENST00000407470.4_Silent_p.I535I|FRMPD2_ENST00000305531.3_Silent_p.I542I	NM_001018071.3|NM_001042512.2	NP_001018081|NP_001035977.2	Q68DX3	FRPD2_HUMAN	FERM and PDZ domain containing 2	567	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				tight junction assembly (GO:0070830)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|tight junction (GO:0005923)	1-phosphatidylinositol binding (GO:0005545)			NS(2)|autonomic_ganglia(2)|breast(5)|cervix(1)|endometrium(3)|kidney(7)|large_intestine(15)|lung(24)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	66				Kidney(211;0.201)		CCTTGGCACAGATCCCCAGGG	0.483																																																	0								ENSG00000170324						127.0	115.0	119.0					10																	49414887		2203	4300	6503	FRMPD2	SO:0001819	synonymous_variant	0			-	HGNC	AK123038	CCDS31195.1	10q11	2010-10-13			ENSG00000170324	ENSG00000170324			28572	protein-coding gene	gene with protein product		613323	"""PDZ domain containing 5C"""	PDZD5C, PDZK5C			Standard	NM_001018071		Approved	MGC35285	uc001jdv.3	Q68DX3	OTTHUMG00000018171	ENST00000374201.3:c.1701C>A	10.37:g.49414887G>T		Somatic	0	106	0.00		0.6119782349188219	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	33	23.26	B7WNW0|B7ZML5|Q2VY07|Q6GMQ9|Q6ZN38|Q6ZWI2|Q8N5T9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_PDZ,pfam_FERM_central,pfam_FERM_PH-like_C,pfam_FERM_N,superfamily_PDZ,superfamily_FERM_central,superfamily_Kinase-like_dom,smart_KIND,smart_Band_41_domain,smart_PDZ,pfscan_FERM_domain,pfscan_PDZ,prints_Band_41_fam	p.I567	ENST00000374201.3	37	c.1701	CCDS31195.1	10																																																																																			-	pfam_FERM_PH-like_C,pfscan_FERM_domain		0.483	FRMPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRMPD2	protein_coding	OTTHUMT00000047923.3	G	NM_152428	-		49414887	-1	no_errors	ENST00000374201	ensembl	human	known	74_37	silent	SNP	0.998	T
FAM178A	55719	genome.wustl.edu	37	10	102685930	102685930	+	Intron	SNP	G	G	A			TCGA-SI-AA8C-01A-11D-A387-09	TCGA-SI-AA8C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b939bdb6-694c-4411-b89b-ee9ac7dc62a9	7a75c68f-e44f-4634-92eb-e759d0c9075c	g.chr10:102685930G>A	ENST00000238961.4	+	6	2584				FAM178A_ENST00000370269.3_Intron|FAM178A_ENST00000370271.3_Silent_p.T732T	NM_018121.3	NP_060591.3	Q8IX21	F178A_HUMAN	family with sequence similarity 178, member A							chromatin (GO:0000785)|extracellular space (GO:0005615)|nucleus (GO:0005634)											TTGgccggacgcagtggctca	0.448																																																	0								ENSG00000119906																																			FAM178A	SO:0001627	intron_variant	0			-	HGNC	AF460991	CCDS7500.1, CCDS44470.1, CCDS65918.1	10q24.31	2008-07-18	2008-07-18	2008-07-18	ENSG00000119906	ENSG00000119906			17814	protein-coding gene	gene with protein product		610348	"""chromosome 10 open reading frame 6"""	C10orf6		12459258	Standard	NM_018121		Approved	FLJ10512, FLJ25012	uc001krs.3	Q8IX21	OTTHUMG00000018919	ENST00000238961.4:c.2042+154G>A	10.37:g.102685930G>A		Somatic	0	28	0.00		0.6119782349188219	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	13	18.75	A8K950|B1AL17|Q5W0L8|Q6GMU6|Q9NPE8	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.T732	ENST00000238961.4	37	c.2196	CCDS7500.1	10																																																																																			-	NULL		0.448	FAM178A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM178A	protein_coding	OTTHUMT00000049897.3	G		-		102685930	+1	no_errors	ENST00000370271	ensembl	human	known	74_37	silent	SNP	0.005	A
ZNF512B	57473	genome.wustl.edu	37	20	62632451	62632451	+	Intron	SNP	G	G	T			TCGA-SI-AA8C-01A-11D-A387-09	TCGA-SI-AA8C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b939bdb6-694c-4411-b89b-ee9ac7dc62a9	7a75c68f-e44f-4634-92eb-e759d0c9075c	g.chr20:62632451G>T	ENST00000450537.1	-	2	56				ZNF512B_ENST00000217130.3_Intron|PRPF6_ENST00000535781.1_Missense_Mutation_p.A349S			Q96KM6	Z512B_HUMAN	zinc finger protein 512B						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(16)|ovary(1)|prostate(4)|skin(1)	33	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					CTGGCTGGAAGCAGCCAGGTT	0.572																																																	0								ENSG00000101161						65.0	58.0	61.0					20																	62632451		2203	4300	6503	PRPF6	SO:0001627	intron_variant	0			-	HGNC	AB033022	CCDS13548.1	20q13.33	2011-02-09			ENSG00000196700	ENSG00000196700			29212	protein-coding gene	gene with protein product						10574462	Standard	NM_020713		Approved	GM632, MGC149845, MGC149846	uc002yhl.2	Q96KM6	OTTHUMG00000033008	ENST00000450537.1:c.5-33143C>A	20.37:g.62632451G>T		Somatic	0	34	0.00		0.6119782349188219	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	29	9.38	Q08AK9|Q9ULM4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PRP1_N,smart_HAT,smart_TPR_repeat,pfscan_TPR-contain_dom	p.A349S	ENST00000450537.1	37	c.1045	CCDS13548.1	20	.	.	.	.	.	.	.	.	.	.	G	18.12	3.553775	0.65425	.	.	ENSG00000101161	ENST00000266079;ENST00000535781	T;T	0.34072	1.38;1.38	5.52	4.56	0.56223	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	T	0.48003	0.1476	M	0.64260	1.97	0.80722	D	1	P;B	0.36125	0.538;0.136	P;B	0.48425	0.577;0.267	T	0.35599	-0.9782	10	0.20519	T	0.43	-12.4147	15.6763	0.77326	0.0:0.0:0.8617:0.1383	.	349;349	O94906-2;O94906	.;PRP6_HUMAN	S	349	ENSP00000266079:A349S;ENSP00000446216:A349S	ENSP00000266079:A349S	A	+	1	0	PRPF6	62102895	1.000000	0.71417	1.000000	0.80357	0.367000	0.29736	9.383000	0.97214	1.314000	0.45095	-0.181000	0.13052	GCA	-	smart_HAT		0.572	ZNF512B-202	KNOWN	basic|appris_principal|CCDS	protein_coding	PRPF6	protein_coding	OTTHUMT00000080246.1	G	NM_020713	-		62632451	+1	no_errors	ENST00000266079	ensembl	human	known	74_37	missense	SNP	1.000	T
PLCZ1	89869	genome.wustl.edu	37	12	18854541	18854549	+	In_Frame_Del	DEL	TCCTCCTCC	TCCTCCTCC	-	rs71064021|rs11279217|rs531863439|rs76947474		TCGA-SI-AA8C-01A-11D-A387-09	TCGA-SI-AA8C-10A-01D-A38A-09	TCCTCCTCC	TCCTCCTCC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b939bdb6-694c-4411-b89b-ee9ac7dc62a9	7a75c68f-e44f-4634-92eb-e759d0c9075c	g.chr12:18854541_18854549delTCCTCCTCC	ENST00000538330.1	-	5	630_638	c.249_257delGGAGGAGGA	c.(247-258)gaggaggaggat>gat	p.EEE83del	PLCZ1_ENST00000447925.2_Intron|PLCZ1_ENST00000266505.7_Intron|PLCZ1_ENST00000435379.1_Intron|PLCZ1_ENST00000539875.1_Intron|PLCZ1_ENST00000541695.1_Intron|PLCZ1_ENST00000542762.1_Intron					phospholipase C, zeta 1											NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	31	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.0241)					TTTGAATTTAtcctcctcctcctcctcct	0.44																																																	0								ENSG00000139151																																			PLCZ1	SO:0001651	inframe_deletion	0				HGNC	AY035866	CCDS8680.1	12p13.31	2013-01-10			ENSG00000139151	ENSG00000139151	3.1.4.11	"""EF-hand domain containing"""	19218	protein-coding gene	gene with protein product		608075				12117804	Standard	NM_033123		Approved	NYD-SP27, PLCzeta	uc021qvx.2	Q86YW0	OTTHUMG00000168937	ENST00000538330.1:c.249_257delGGAGGAGGA	12.37:g.18854550_18854558delTCCTCCTCC	ENSP00000445880:p.Glu83_Glu85del	Somatic	NA	NA	NA		0.6119782349188219	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_PLipase_C_Pinositol-sp_Y,pfam_C2_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_dom,pfscan_C2_dom,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,prints_Pinositol_PLipase_C	p.EEE83in_frame_del	ENST00000538330.1	37	c.257_249		12																																																																																			-	superfamily_PLC-like_Pdiesterase_TIM-brl		0.440	PLCZ1-002	PUTATIVE	basic|exp_conf	protein_coding	PLCZ1	protein_coding	OTTHUMT00000401666.3	TCCTCCTCC	NM_033123			18854549	-1	no_errors	ENST00000538330	ensembl	human	putative	74_37	in_frame_del	DEL	0.019:0.025:0.029:0.032:0.034:0.034:0.032:0.029:0.024	-
KRTAP10-9	386676	genome.wustl.edu	37	21	46048196	46048197	+	3'UTR	INS	-	-	CGCTGGT	rs181355860|rs587633163|rs61263042	byFrequency	TCGA-SI-AA8C-01A-11D-A387-09	TCGA-SI-AA8C-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b939bdb6-694c-4411-b89b-ee9ac7dc62a9	7a75c68f-e44f-4634-92eb-e759d0c9075c	g.chr21:46048196_46048197insCGCTGGT	ENST00000397911.3	+	0	1157_1158				TSPEAR_ENST00000323084.4_Intron|KRTAP10-9_ENST00000484861.1_3'UTR	NM_198690.2	NP_941963.2	P60411	KR109_HUMAN	keratin associated protein 10-9							keratin filament (GO:0045095)				endometrium(1)|kidney(1)|large_intestine(1)|lung(6)	9						CCACAACCCTCCGCTGGTCGCT	0.693														1171	0.233826	0.2458	0.2536	5008	,	,		10044	0.1855		0.2952	False		,,,				2504	0.1902																0								ENSG00000221837																																			KRTAP10-9	SO:0001624	3_prime_UTR_variant	0				HGNC	AJ566386	CCDS42961.1	21q22.3	2007-10-05			ENSG00000221837	ENSG00000221837		"""Keratin associated proteins"""	22971	protein-coding gene	gene with protein product				KRTAP18-9			Standard	NM_198690		Approved	KAP10.9, KAP18.9	uc002zfp.4	P60411	OTTHUMG00000057637	ENST00000397911.3:c.*230->CGCTGGT	21.37:g.46048197_46048203dupCGCTGGT		Somatic	NA	NA	NA		0.6119782349188219	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A2RRG1|A6NIR9|Q70LJ1	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000397911.3	37	NULL	CCDS42961.1	21																																																																																			-	-		0.693	KRTAP10-9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP10-9	protein_coding	OTTHUMT00000128040.1	-				46048197	+1	no_errors	ENST00000484861	ensembl	human	known	74_37	rna	INS	0.001:0.001	CGCTGGT
LARP7	51574	genome.wustl.edu	37	4	113569407	113569407	+	Intron	SNP	G	G	T			TCGA-SI-AA8C-01A-11D-A387-09	TCGA-SI-AA8C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b939bdb6-694c-4411-b89b-ee9ac7dc62a9	7a75c68f-e44f-4634-92eb-e759d0c9075c	g.chr4:113569407G>T	ENST00000344442.5	+	8	1420				MIR302B_ENST00000509938.1_RNA|MIR302C_ENST00000362232.1_RNA|MIR302A_ENST00000385192.1_RNA|LARP7_ENST00000509061.1_Intron|MIR367_ENST00000362299.1_RNA|LARP7_ENST00000324052.6_Intron|MIR302B_ENST00000505215.1_RNA|MIR302B_ENST00000510655.1_RNA|MIR302B_ENST00000362188.1_RNA|MIR302D_ENST00000362275.1_RNA	NM_016648.3	NP_057732.2	Q4G0J3	LARP7_HUMAN	La ribonucleoprotein domain family, member 7						RNA processing (GO:0006396)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(2)|large_intestine(2)|lung(8)|ovary(4)|skin(1)	17		Ovarian(17;0.0443)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000603)		TTAAGTGGTGGGGAGCCCAGT	0.333																																																	0								ENSG00000207927						72.0	69.0	70.0					4																	113569407		1568	3582	5150	MIR302A	SO:0001627	intron_variant	0			-	HGNC	AF068284	CCDS3701.2, CCDS58924.1	4q25	2013-02-12			ENSG00000174720	ENSG00000174720		"""La ribonucleoprotein domain containing"", ""RNA binding motif (RRM) containing"""	24912	protein-coding gene	gene with protein product	"""P-TEFb-interaction protein for 7SK stability"""	612026				18191186, 18249148, 18281698, 22865833, 22488152	Standard	NM_016648		Approved	HDCMA18P, PIP7S, DKFZP564K112	uc003ibb.4	Q4G0J3	OTTHUMG00000132909	ENST00000344442.5:c.1142+417G>T	4.37:g.113569407G>T		Somatic	0	106	0.00		0.6119782349188219	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	35	10.26	B2ZHN6|Q3B7A9|Q9P1S7|Q9Y3Z8	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000344442.5	37	NULL	CCDS3701.2	4																																																																																			-	-		0.333	LARP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIR302A	protein_coding	OTTHUMT00000256417.2	G	NM_016648	-		113569407	-1	no_errors	ENST00000385192	ensembl	human	known	74_37	rna	SNP	1.000	T
TSC2	7249	genome.wustl.edu	37	16	2096132	2096133	+	5'Flank	INS	-	-	G			TCGA-SI-AA8C-01A-11D-A387-09	TCGA-SI-AA8C-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b939bdb6-694c-4411-b89b-ee9ac7dc62a9	7a75c68f-e44f-4634-92eb-e759d0c9075c	g.chr16:2096132_2096133insG	ENST00000219476.3	+	0	0				TSC2_ENST00000439673.2_5'Flank|TSC2_ENST00000382538.6_5'Flank|NTHL1_ENST00000219066.1_Frame_Shift_Ins_p.P125fs|TSC2_ENST00000353929.4_5'Flank|NTHL1_ENST00000562951.1_5'Flank|TSC2_ENST00000568454.1_5'Flank|TSC2_ENST00000401874.2_5'Flank|TSC2_ENST00000350773.4_5'Flank	NM_000548.3	NP_000539.2	P49815	TSC2_HUMAN	tuberous sclerosis 2						acute-phase response (GO:0006953)|cell cycle arrest (GO:0007050)|cell projection organization (GO:0030030)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of TOR signaling (GO:0032007)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive chemotaxis (GO:0050918)|positive regulation of Ras GTPase activity (GO:0032320)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|protein import into nucleus (GO:0006606)|protein kinase B signaling (GO:0043491)|protein localization (GO:0008104)|regulation of cell cycle (GO:0051726)|regulation of endocytosis (GO:0030100)|regulation of insulin receptor signaling pathway (GO:0046626)|response to hypoxia (GO:0001666)|vesicle-mediated transport (GO:0016192)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|TSC1-TSC2 complex (GO:0033596)	GTPase activator activity (GO:0005096)|phosphatase binding (GO:0019902)|protein homodimerization activity (GO:0042803)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(3)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(7)|soft_tissue(1)	56		Hepatocellular(780;0.0202)				TGCCTACCTTTGGGGGGGCACT	0.579			"""D, Mis, N, F, S"""			"""hamartoma, renal cell"""			Tuberous Sclerosis																														yes	Rec		Tuberous sclerosis 2	16	16p13.3	7249	tuberous sclerosis 2 gene		"""E, O"""	0								ENSG00000065057																																			NTHL1	SO:0001631	upstream_gene_variant	0	Familial Cancer Database	TS, Tuberous Sclerosis Complex, TSC, Bourneville-Pringle disease		HGNC	AB014460	CCDS10458.1, CCDS45384.1, CCDS58408.1	16p13.3	2014-09-17			ENSG00000103197	ENSG00000103197			12363	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 160"""	191092		TSC4		1303246, 7558029	Standard	NM_001077183		Approved	tuberin, LAM, PPP1R160	uc002con.3	P49815	OTTHUMG00000128745		16.37:g.2096139_2096139dupG	Exception_encountered	Somatic	0	65	0.00		0.6119782349188219	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	30	9.09	A7E2E2|B4DIL8|B4DIQ7|B4DRN2|B7Z2B8|C9J378|O75275|Q4LE71|Q8TAZ1	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_HhH-GPD_domain,pfam_HhH_motif,superfamily_DNA_glycosylase,smart_HhH-GPD_domain,smart_Endouclease3_FeS-loop_motif	p.V127fs	ENST00000219476.3	37	c.375_374	CCDS10458.1	16																																																																																			-	superfamily_DNA_glycosylase		0.579	TSC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NTHL1	protein_coding	OTTHUMT00000250657.2	-	NM_000548			2096133	-1	no_errors	ENST00000219066	ensembl	human	known	74_37	frame_shift_ins	INS	0.794:1.000	G
PASD1	139135	genome.wustl.edu	37	X	150789982	150789982	+	Silent	SNP	A	A	G			TCGA-SI-AA8C-01A-11D-A387-09	TCGA-SI-AA8C-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b939bdb6-694c-4411-b89b-ee9ac7dc62a9	7a75c68f-e44f-4634-92eb-e759d0c9075c	g.chrX:150789982A>G	ENST00000370357.4	+	6	581	c.336A>G	c.(334-336)ttA>ttG	p.L112L		NM_173493.2	NP_775764.2	Q8IV76	PASD1_HUMAN	PAS domain containing 1	112						nucleus (GO:0005634)	signal transducer activity (GO:0004871)			breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(3)|liver(1)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	48	Acute lymphoblastic leukemia(192;6.56e-05)					GCTGTCATTTAAAAAGAGGAA	0.289																																																	0								ENSG00000166049						131.0	107.0	115.0					X																	150789982		2202	4297	6499	PASD1	SO:0001819	synonymous_variant	0			-	HGNC	AY270020	CCDS35431.1	Xq28	2009-08-06			ENSG00000166049	ENSG00000166049			20686	protein-coding gene	gene with protein product	"""cancer/testis antigen 63"""					15122589, 15162151	Standard	NM_173493		Approved	CT63	uc004fev.4	Q8IV76	OTTHUMG00000024169	ENST00000370357.4:c.336A>G	X.37:g.150789982A>G		Somatic	0	133	0.00		0.6119782349188219	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	32	51	38.55	Q3MNE0|Q69HD7|Q8N7X9	Silent	SNP	NA	NA	NA	NA	NA	NA	superfamily_PAS,smart_PAS,pfscan_PAS	p.L112	ENST00000370357.4	37	c.336	CCDS35431.1	X																																																																																			-	superfamily_PAS		0.289	PASD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PASD1	protein_coding	OTTHUMT00000060879.2	A	NM_173493	-		150789982	+1	no_errors	ENST00000370357	ensembl	human	known	74_37	silent	SNP	0.001	G
KAZN	23254	genome.wustl.edu	37	1	15430617	15430617	+	Silent	SNP	C	C	T			TCGA-SI-AA8C-01A-11D-A387-09	TCGA-SI-AA8C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b939bdb6-694c-4411-b89b-ee9ac7dc62a9	7a75c68f-e44f-4634-92eb-e759d0c9075c	g.chr1:15430617C>T	ENST00000376030.2	+	13	2274	c.1980C>T	c.(1978-1980)atC>atT	p.I660I		NM_201628.2	NP_963922.2	Q674X7	KAZRN_HUMAN	kazrin, periplakin interacting protein	660	SAM 3. {ECO:0000255|PROSITE- ProRule:PRU00184}.				keratinization (GO:0031424)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|desmosome (GO:0030057)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(9)|liver(1)|lung(6)|ovary(1)|prostate(2)	25						CCCTGGGCATCCCCAGTGGGA	0.632																																																	0								ENSG00000189337						57.0	43.0	48.0					1																	15430617		2203	4300	6503	KAZN	SO:0001819	synonymous_variant	0			-	HGNC	AY505119	CCDS30604.1, CCDS41267.1, CCDS152.2, CCDS41268.1	1p36.21	2014-02-12	2011-01-31		ENSG00000189337	ENSG00000189337		"""Sterile alpha motif (SAM) domain containing"""	29173	protein-coding gene	gene with protein product						15337775, 18840647	Standard	NM_015209		Approved	KIAA1026, KAZRIN, FLJ43806	uc001avm.4	Q674X7	OTTHUMG00000002042	ENST00000376030.2:c.1980C>T	1.37:g.15430617C>T		Somatic	0	60	0.00		0.6119782349188219	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	4	77.78	B0QYQ0|B1AK78|Q5TGF1|Q674X4|Q674X6|Q6ZUD1|Q8IYN7|Q8N409|Q9UIL2|Q9UPX4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_SAM_2,pfam_SAM_type1,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	p.I660	ENST00000376030.2	37	c.1980	CCDS152.2	1																																																																																			-	pfam_SAM_2,superfamily_SAM/pointed,smart_SAM,pfscan_SAM		0.632	KAZN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KAZN	protein_coding	OTTHUMT00000005690.2	C	NM_001017999	-		15430617	+1	no_errors	ENST00000376030	ensembl	human	known	74_37	silent	SNP	1.000	T
KIAA1217	56243	genome.wustl.edu	37	10	24813274	24813274	+	Frame_Shift_Del	DEL	A	A	-			TCGA-SI-AA8C-01A-11D-A387-09	TCGA-SI-AA8C-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b939bdb6-694c-4411-b89b-ee9ac7dc62a9	7a75c68f-e44f-4634-92eb-e759d0c9075c	g.chr10:24813274delA	ENST00000376454.3	+	13	2509	c.2479delA	c.(2479-2481)aaafs	p.K827fs	KIAA1217_ENST00000307544.6_Frame_Shift_Del_p.K510fs|KIAA1217_ENST00000376451.2_Frame_Shift_Del_p.K510fs|KIAA1217_ENST00000396445.1_Frame_Shift_Del_p.K510fs|KIAA1217_ENST00000458595.1_Frame_Shift_Del_p.K792fs|KIAA1217_ENST00000430453.2_Intron|KIAA1217_ENST00000396446.1_Frame_Shift_Del_p.K510fs|KIAA1217_ENST00000376452.3_Frame_Shift_Del_p.K792fs|KIAA1217_ENST00000376462.1_Frame_Shift_Del_p.K747fs	NM_019590.3	NP_062536.2	Q5T5P2	SKT_HUMAN	KIAA1217	827					embryonic skeletal system development (GO:0048706)	cytoplasm (GO:0005737)				breast(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(19)|lung(19)|ovary(5)|prostate(3)|skin(3)|urinary_tract(1)	70						TGGGCTCCTGAAAGGCACGGA	0.557																																																	0								ENSG00000120549						76.0	77.0	77.0					10																	24813274		2203	4300	6503	KIAA1217	SO:0001589	frameshift_variant	0				HGNC	BX640796	CCDS31165.1, CCDS41496.1, CCDS60501.1, CCDS60502.1, CCDS60504.1, CCDS60505.1	10p12.31	2009-09-16			ENSG00000120549	ENSG00000120549			25428	protein-coding gene	gene with protein product	"""sickle tail"""					10574462	Standard	XM_005252500		Approved	DKFZP761L0424, SKT	uc001iru.4	Q5T5P2	OTTHUMG00000017824	ENST00000376454.3:c.2479delA	10.37:g.24813274delA	ENSP00000365637:p.Lys827fs	Somatic	0	65	0.00		0.6119782349188219	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	17	10.53	A5LHW9|A6NLF3|A6PVQ5|A6PVQ6|A6PVQ7|B9EGK4|Q4KMG4|Q5T5P3|Q5T7H3|Q6MZZ6|Q6ZUI4|Q8WV45|Q9NSR2|Q9ULK3	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_AIP3_C	p.G828fs	ENST00000376454.3	37	c.2479	CCDS31165.1	10																																																																																			-	NULL		0.557	KIAA1217-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA1217	protein_coding	OTTHUMT00000047223.2	A	NM_019590			24813274	+1	no_errors	ENST00000376454	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
MYC	4609	genome.wustl.edu	37	8	128750604	128750605	+	In_Frame_Ins	INS	-	-	CAG			TCGA-SI-AA8C-01A-11D-A387-09	TCGA-SI-AA8C-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b939bdb6-694c-4411-b89b-ee9ac7dc62a9	7a75c68f-e44f-4634-92eb-e759d0c9075c	g.chr8:128750604_128750605insCAG	ENST00000259523.6	+	2	1301_1302	c.96_97insCAG	c.(97-99)cag>CAGcag	p.33_33Q>QQ	MYC_ENST00000377970.2_In_Frame_Ins_p.48_48Q>QQ|MYC_ENST00000524013.1_In_Frame_Ins_p.47_47Q>QQ			P01106	MYC_HUMAN	v-myc avian myelocytomatosis viral oncogene homolog	33	Poly-Gln.				branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|cell cycle arrest (GO:0007050)|cellular iron ion homeostasis (GO:0006879)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to UV (GO:0034644)|chromatin remodeling (GO:0006338)|chromosome organization (GO:0051276)|energy reserve metabolic process (GO:0006112)|fibroblast apoptotic process (GO:0044346)|gene expression (GO:0010467)|MAPK cascade (GO:0000165)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell division (GO:0051782)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of monocyte differentiation (GO:0045656)|negative regulation of stress-activated MAPK cascade (GO:0032873)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|oxygen transport (GO:0015671)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of metanephric cap mesenchymal cell proliferation (GO:0090096)|positive regulation of response to DNA damage stimulus (GO:2001022)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gene expression (GO:0010468)|regulation of telomere maintenance (GO:0032204)|response to drug (GO:0042493)|response to gamma radiation (GO:0010332)|response to growth factor (GO:0070848)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|protein complex binding (GO:0032403)|repressing transcription factor binding (GO:0070491)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|lung(7)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	16	all_cancers(1;6.19e-134)|all_epithelial(1;1.75e-119)|all_lung(1;5.66e-51)|Breast(1;1.08e-22)|all_neural(1;4.45e-21)|Medulloblastoma(1;1.88e-20)|Colorectal(1;1.92e-09)|Lung SC(1;4.52e-07)|Ovarian(5;0.000122)|Esophageal squamous(12;0.000995)|Renal(1;0.0921)|Hepatocellular(40;0.108)|Myeloproliferative disorder(2;0.135)|Melanoma(291;0.185)	Myeloproliferative disorder(644;0.0255)|Ovarian(118;0.0654)|Breast(495;0.212)|Acute lymphoblastic leukemia(644;0.22)	Epithelial(1;1.63e-94)|all cancers(1;5.82e-87)|OV - Ovarian serous cystadenocarcinoma(1;2.12e-71)|BRCA - Breast invasive adenocarcinoma(1;4.3e-14)|Lung(2;0.000381)|Colorectal(2;0.0102)|LUAD - Lung adenocarcinoma(14;0.0172)|READ - Rectum adenocarcinoma(2;0.0723)|LUSC - Lung squamous cell carcinoma(258;0.151)	KIRC - Kidney renal clear cell carcinoma(542;0.248)	Nadroparin(DB08813)	AGAACTTCTACCAGCAGCAGCA	0.614		3	"""A, T"""	"""IGK@, BCL5, BCL7A , BTG1, TRA@, IGH@"""	"""Burkitt lymphoma,  amplified in other cancers, B-CLL"""						OREG0018982	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																												Dom	yes		8	8q24.12-q24.13	4609	v-myc myelocytomatosis viral oncogene homolog (avian)		"""L, E"""	0								ENSG00000136997			1,4263		0,1,2131						4.2	1.0			46	2,8252		0,2,4125	no	coding	MYC	NM_002467.4		0,3,6256	A1A1,A1R,RR		0.0242,0.0235,0.024				3,12515				MYC	SO:0001652	inframe_insertion	0				HGNC		CCDS6359.2	8q24	2013-07-09	2013-07-09		ENSG00000136997	ENSG00000136997		"""Basic helix-loop-helix proteins"""	7553	protein-coding gene	gene with protein product		190080					Standard	NM_002467		Approved	c-Myc, bHLHe39, MYCC	uc003ysi.3	P01106	OTTHUMG00000128475	ENST00000259523.6:c.109_111dupCAG	8.37:g.128750611_128750613dupCAG	ENSP00000259523:p.Gln37dup	Somatic	0	102	0.00	1567	0.6119782349188219	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	60	20.00	A8WFE7|P01107|Q14026	In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_Tscrpt_reg_Myc_N,pfam_Myc-LZ,pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom,prints_Tscrpt_reg_Myc	p.51in_frame_insQ	ENST00000259523.6	37	c.141_142		8																																																																																			-	pfam_Tscrpt_reg_Myc_N		0.614	MYC-002	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	MYC	protein_coding	OTTHUMT00000250278.1	-				128750605	+1	no_errors	ENST00000377970	ensembl	human	known	74_37	in_frame_ins	INS	1.000:1.000	CAG
COL21A1	81578	genome.wustl.edu	37	6	55956427	55956427	+	Intron	SNP	G	G	T			TCGA-SI-AA8C-01A-11D-A387-09	TCGA-SI-AA8C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b939bdb6-694c-4411-b89b-ee9ac7dc62a9	7a75c68f-e44f-4634-92eb-e759d0c9075c	g.chr6:55956427G>T	ENST00000244728.5	-	17	2210				COL21A1_ENST00000370819.1_Intron|COL21A1_ENST00000535941.1_Intron|COL21A1_ENST00000467045.1_5'UTR	NM_030820.3	NP_110447.2	Q96P44	COLA1_HUMAN	collagen, type XXI, alpha 1						extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(1)|kidney(3)|large_intestine(11)|lung(21)|ovary(2)|prostate(2)	41	Lung NSC(77;0.0483)		LUSC - Lung squamous cell carcinoma(124;0.181)			TACACAATGGGGCTAGCTGGT	0.463																																																	0								ENSG00000124749																																			COL21A1	SO:0001627	intron_variant	0			-	HGNC	AF330693	CCDS55025.1	6p12.3-p11.2	2013-01-16			ENSG00000124749	ENSG00000124749		"""Collagens"""	17025	protein-coding gene	gene with protein product		610002				11566190	Standard	XR_241922		Approved		uc003pcs.3	Q96P44	OTTHUMG00000014907	ENST00000244728.5:c.1812+9842C>A	6.37:g.55956427G>T		Somatic	0	39	0.00		0.6119782349188219	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	25	13.79	A6NIX5|B2R8J9|Q49A51|Q71RF4|Q8WXV8|Q9H0V3	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000244728.5	37	NULL	CCDS55025.1	6																																																																																			-	-		0.463	COL21A1-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	COL21A1	protein_coding	OTTHUMT00000041004.2	G		-		55956427	-1	no_errors	ENST00000467045	ensembl	human	known	74_37	rna	SNP	0.000	T
PKHD1L1	93035	genome.wustl.edu	37	8	110457290	110457290	+	Missense_Mutation	SNP	T	T	A			TCGA-SI-AA8C-01A-11D-A387-09	TCGA-SI-AA8C-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b939bdb6-694c-4411-b89b-ee9ac7dc62a9	7a75c68f-e44f-4634-92eb-e759d0c9075c	g.chr8:110457290T>A	ENST00000378402.5	+	38	5296	c.5192T>A	c.(5191-5193)gTg>gAg	p.V1731E		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	1731	IPT/TIG 9.				immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			ATACATGGAGTGCCTGCCCAG	0.433										HNSCC(38;0.096)																																							0								ENSG00000205038						170.0	164.0	166.0					8																	110457290		1924	4142	6066	PKHD1L1	SO:0001583	missense	0			-	HGNC	AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.5192T>A	8.37:g.110457290T>A	ENSP00000367655:p.Val1731Glu	Somatic	0	66	0.00		0.6119782349188219	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	49	9.26	Q567P2|Q9UF27	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_IPT,pfam_G8_domain,pfam_PA14,superfamily_Ig_E-set,superfamily_Pectin_lyase_fold/virulence,superfamily_Cupredoxin,smart_IPT,smart_PA14,smart_PbH1	p.V1731E	ENST00000378402.5	37	c.5192	CCDS47911.1	8	.	.	.	.	.	.	.	.	.	.	T	19.06	3.753855	0.69648	.	.	ENSG00000205038	ENST00000378402	T	0.74106	-0.81	6.17	5.0	0.66597	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.078312	0.52532	D	0.000061	T	0.78604	0.4309	L	0.60455	1.87	0.27804	N	0.942394	P	0.48016	0.904	P	0.53549	0.729	T	0.73626	-0.3923	10	0.66056	D	0.02	.	10.9899	0.47543	0.1398:0.0:0.0:0.8602	.	1731	Q86WI1	PKHL1_HUMAN	E	1731	ENSP00000367655:V1731E	ENSP00000367655:V1731E	V	+	2	0	PKHD1L1	110526466	0.945000	0.32115	1.000000	0.80357	0.998000	0.95712	1.955000	0.40372	1.113000	0.41760	0.533000	0.62120	GTG	-	pfam_IPT,superfamily_Ig_E-set,smart_IPT		0.433	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKHD1L1	protein_coding	OTTHUMT00000381017.1	T	NM_177531	-		110457290	+1	no_errors	ENST00000378402	ensembl	human	known	74_37	missense	SNP	1.000	A
IZUMO3	100129669	genome.wustl.edu	37	9	24543733	24543733	+	Silent	SNP	A	A	T	rs7859006	byFrequency	TCGA-SI-AA8C-01A-11D-A387-09	TCGA-SI-AA8C-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b939bdb6-694c-4411-b89b-ee9ac7dc62a9	7a75c68f-e44f-4634-92eb-e759d0c9075c	g.chr9:24543733A>T	ENST00000543880.2	-	6	741	c.510T>A	c.(508-510)gcT>gcA	p.A170A	IZUMO3_ENST00000604921.1_Silent_p.A164A|RP11-20A20.2_ENST00000602851.1_lincRNA			Q5VZ72	IZUM3_HUMAN	IZUMO family member 3	170						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)										CTCGATTCTCAGCCTTTCTTG	0.388																																																	0								ENSG00000205442																																			IZUMO3	SO:0001819	synonymous_variant	0			-	HGNC		CCDS65020.1	9p21.3	2014-02-17	2010-07-29	2010-07-29	ENSG00000205442	ENSG00000205442		"""-"""	31421	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 134"""	C9orf134		19658160, 22957301	Standard	NM_001271706		Approved	bA20A20.1	uc031tdg.1	Q5VZ72	OTTHUMG00000019704	ENST00000543880.2:c.510T>A	9.37:g.24543733A>T		Somatic	0	68	0.00		0.6119782349188219	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	23	42.50		Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.A170	ENST00000543880.2	37	c.510		9	.	.	.	.	.	.	.	.	.	.	A	1.469	-0.560331	0.03939	.	.	ENSG00000205442	ENST00000412335	.	.	.	4.69	4.69	0.59074	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	-3.918	10.7137	0.46000	1.0:0.0:0.0:0.0	.	.	.	.	R	103	.	.	X	-	1	0	IZUMO3	24533733	0.939000	0.31865	0.864000	0.33941	0.069000	0.16628	1.721000	0.38032	2.091000	0.63221	0.528000	0.53228	TGA	-	NULL		0.388	IZUMO3-001	NOVEL	not_organism_supported|basic	protein_coding	IZUMO3	protein_coding	OTTHUMT00000467652.1	A	NM_001271706	-		24543733	-1	no_errors	ENST00000543880	ensembl	human	novel	74_37	silent	SNP	0.882	T
MKRN1	23608	genome.wustl.edu	37	7	140158957	140158957	+	Silent	SNP	C	C	A			TCGA-SI-AA8C-01A-11D-A387-09	TCGA-SI-AA8C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b939bdb6-694c-4411-b89b-ee9ac7dc62a9	7a75c68f-e44f-4634-92eb-e759d0c9075c	g.chr7:140158957C>A	ENST00000255977.2	-	4	845	c.621G>T	c.(619-621)gtG>gtT	p.V207V	MKRN1_ENST00000480552.1_Intron|MKRN1_ENST00000474576.1_Silent_p.V143V|MKRN1_ENST00000437223.2_Intron|MKRN1_ENST00000481705.1_5'Flank|MKRN1_ENST00000443720.2_Silent_p.V207V	NM_013446.3	NP_038474.2	Q9UHC7	MKRN1_HUMAN	makorin ring finger protein 1	207					protein polyubiquitination (GO:0000209)		chromatin binding (GO:0003682)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)|skin(1)	16	Melanoma(164;0.00956)					TCTTTGTCTCCACGGCGGTTT	0.547																																																	0								ENSG00000133606						139.0	135.0	137.0					7																	140158957		2203	4300	6503	MKRN1	SO:0001819	synonymous_variant	0			-	HGNC	AF192784	CCDS5860.1, CCDS47725.1	7q34	2013-01-09	2008-08-13		ENSG00000133606	ENSG00000133606		"""RING-type (C3HC4) zinc fingers"""	7112	protein-coding gene	gene with protein product		607754				10843807	Standard	NM_013446		Approved	RNF61	uc003vvt.2	Q9UHC7	OTTHUMG00000157412	ENST00000255977.2:c.621G>T	7.37:g.140158957C>A		Somatic	0	57	0.00		0.6119782349188219	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	24	14.29	A4D1T7|B3KXB4|Q256Y7|Q59G11|Q6GSF1|Q9H0G0|Q9UEZ7|Q9UHW2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_CCCH,pfam_Znf_C3HC4_RING-type,smart_Znf_CCCH,smart_Znf_RING,pfscan_Znf_RING	p.V207	ENST00000255977.2	37	c.621	CCDS5860.1	7																																																																																			-	NULL		0.547	MKRN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MKRN1	protein_coding	OTTHUMT00000348752.1	C	NM_013446	-		140158957	-1	no_errors	ENST00000255977	ensembl	human	known	74_37	silent	SNP	0.935	A
KIAA1244	57221	genome.wustl.edu	37	6	138644891	138644891	+	Missense_Mutation	SNP	C	C	T			TCGA-SI-AA8C-01A-11D-A387-09	TCGA-SI-AA8C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b939bdb6-694c-4411-b89b-ee9ac7dc62a9	7a75c68f-e44f-4634-92eb-e759d0c9075c	g.chr6:138644891C>T	ENST00000251691.4	+	30	5016	c.4850C>T	c.(4849-4851)gCc>gTc	p.A1617V		NM_020340.4	NP_065073.3			KIAA1244											NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(11)|lung(17)|ovary(2)|skin(2)	44	Breast(32;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00102)|GBM - Glioblastoma multiforme(68;0.00259)		GCGTTCTCTGCCACACTCAAG	0.542																																																	0								ENSG00000112379						110.0	90.0	97.0					6																	138644891		2203	4300	6503	KIAA1244	SO:0001583	missense	0			-	HGNC	AB033070	CCDS5189.2	6q23.3	2012-04-17			ENSG00000112379	ENSG00000112379		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	21213	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 33"""		"""chromosome 6 open reading frame 92"""	C6orf92			Standard	NM_020340		Approved	dJ171N11.1, BIG3, PPP1R33	uc003qhu.3	Q5TH69	OTTHUMG00000015670	ENST00000251691.4:c.4850C>T	6.37:g.138644891C>T	ENSP00000251691:p.Ala1617Val	Somatic	0	64	0.00		0.6119782349188219	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	34	10.53		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF1981_Sec7_assoc,superfamily_ARM-type_fold,superfamily_Sec7_dom,smart_Sec7_dom	p.A1617V	ENST00000251691.4	37	c.4850	CCDS5189.2	6	.	.	.	.	.	.	.	.	.	.	C	15.19	2.758645	0.49468	.	.	ENSG00000112379	ENST00000251691	T	0.44482	0.92	5.58	4.72	0.59763	.	0.058985	0.64402	N	0.000002	T	0.16428	0.0395	L	0.32530	0.975	0.58432	D	0.999998	B	0.25390	0.125	B	0.23716	0.048	T	0.05209	-1.0899	10	0.16420	T	0.52	-26.4594	14.5639	0.68162	0.0:0.9298:0.0:0.0702	.	1617	Q5TH69	BIG3_HUMAN	V	1617	ENSP00000251691:A1617V	ENSP00000251691:A1617V	A	+	2	0	KIAA1244	138686584	1.000000	0.71417	0.991000	0.47740	0.970000	0.65996	4.067000	0.57527	1.354000	0.45846	0.557000	0.71058	GCC	-	NULL		0.542	KIAA1244-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	KIAA1244	protein_coding	OTTHUMT00000042425.4	C	NM_020340	-		138644891	+1	no_errors	ENST00000251691	ensembl	human	known	74_37	missense	SNP	1.000	T
FCGBP	8857	genome.wustl.edu	37	19	40377034	40377034	+	Silent	SNP	G	G	A	rs201304305	byFrequency	TCGA-SI-AA8C-01A-11D-A387-09	TCGA-SI-AA8C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b939bdb6-694c-4411-b89b-ee9ac7dc62a9	7a75c68f-e44f-4634-92eb-e759d0c9075c	g.chr19:40377034G>A	ENST00000221347.6	-	24	11395	c.11388C>T	c.(11386-11388)aaC>aaT	p.N3796N	FCGBP_ENST00000595713.1_5'UTR	NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	3796	VWFD 9. {ECO:0000255|PROSITE- ProRule:PRU00580}.					extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			TGGGGTCGCCGTTGTAGTTCC	0.597																																																	0								ENSG00000090920						4.0	4.0	4.0					19																	40377034		1716	3539	5255	FCGBP	SO:0001819	synonymous_variant	0			-	HGNC	D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.11388C>T	19.37:g.40377034G>A		Somatic	0	51	0.00		0.6119782349188219	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	44	10.20	O95784	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,smart_Fol_N,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EG-like_dom,smart_VWF_C,smart_VWC_out	p.N3796	ENST00000221347.6	37	c.11388	CCDS12546.1	19																																																																																			-	pfam_VWF_type-D,smart_VWF_type-D		0.597	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCGBP	protein_coding	OTTHUMT00000462507.1	G	NM_003890	rs201304305		40377034	-1	no_errors	ENST00000221347	ensembl	human	known	74_37	silent	SNP	0.470	A
MT-ND2	4536	genome.wustl.edu	37	M	2814	2814	+	5'Flank	SNP	G	G	A			TCGA-SI-AA8C-01A-11D-A387-09	TCGA-SI-AA8C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b939bdb6-694c-4411-b89b-ee9ac7dc62a9	7a75c68f-e44f-4634-92eb-e759d0c9075c	g.chrM:2814G>A	ENST00000361453.3	+	0	0				MT-TV_ENST00000387342.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-TQ_ENST00000387372.1_RNA|MT-ND1_ENST00000361390.2_5'Flank|MT-TL1_ENST00000386347.1_RNA|MT-TM_ENST00000387377.1_RNA|MT-RNR1_ENST00000389680.2_RNA|MT-TI_ENST00000387365.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-TW_ENST00000387382.1_RNA|MT-TC_ENST00000387405.1_RNA|MT-TF_ENST00000387314.1_RNA			P03891	NU2M_HUMAN	mitochondrially encoded NADH dehydrogenase 2						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|reactive oxygen species metabolic process (GO:0072593)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|lung(1)	3						AAAATTTCGGTTGGGGCGACC	0.438																																																	0								ENSG00000210082																																			MT-RNR2	SO:0001631	upstream_gene_variant	0			-	HGNC			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198763	ENSG00000198763	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7456	protein-coding gene	gene with protein product	"""complex I ND2 subunit"", ""NADH-ubiquinone oxidoreductase chain 2"""	516001	"""NADH dehydrogenase 2"""	MTND2			Standard			Approved	ND2, NAD2		P03891			M.37:g.2814G>A	Exception_encountered	Somatic	1	344	0.29		0.6119782349188219	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	210	32	86.42	Q34769|Q9TGI0|Q9TGI1|Q9TGI2|Q9TGI3|Q9TGI4	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000361453.3	37	NULL		MT																																																																																			-	-		0.438	MT-ND2-201	KNOWN	basic|appris_principal	protein_coding	MT-RNR2	protein_coding		G	YP_003024027	-		2814	+1	no_errors	ENST00000387347	ensembl	human	known	74_37	rna	SNP	NULL	A
FOXA1	3169	genome.wustl.edu	37	14	38064348	38064350	+	5'Flank	DEL	GCG	GCG	-	rs546145599	byFrequency	TCGA-SI-AA8C-01A-11D-A387-09	TCGA-SI-AA8C-10A-01D-A38A-09	GCG	GCG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b939bdb6-694c-4411-b89b-ee9ac7dc62a9	7a75c68f-e44f-4634-92eb-e759d0c9075c	g.chr14:38064348_38064350delGCG	ENST00000250448.2	-	0	0				FOXA1_ENST00000545425.2_5'Flank|FOXA1_ENST00000540786.1_Intron	NM_004496.3	NP_004487.2	P55317	FOXA1_HUMAN	forkhead box A1						anatomical structure formation involved in morphogenesis (GO:0048646)|chromatin remodeling (GO:0006338)|dorsal/ventral neural tube patterning (GO:0021904)|epithelial cell maturation involved in prostate gland development (GO:0060743)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|epithelial-mesenchymal signaling involved in prostate gland development (GO:0060738)|glucose homeostasis (GO:0042593)|hormone metabolic process (GO:0042445)|lung epithelial cell differentiation (GO:0060487)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron fate specification (GO:0048665)|positive regulation of cell-cell adhesion mediated by cadherin (GO:2000049)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostate gland epithelium morphogenesis (GO:0060740)|prostate gland stromal morphogenesis (GO:0060741)|response to estradiol (GO:0032355)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)	microvillus (GO:0005902)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|endometrium(1)|large_intestine(2)|lung(3)|prostate(12)	19	Breast(36;0.0954)|Esophageal squamous(585;0.164)|Hepatocellular(127;0.213)		Lung(238;5.41e-07)|LUAD - Lung adenocarcinoma(48;2.48e-05)|Epithelial(34;0.0454)|LUSC - Lung squamous cell carcinoma(13;0.0917)|all cancers(34;0.0925)|BRCA - Breast invasive adenocarcinoma(188;0.239)	GBM - Glioblastoma multiforme(112;0.0222)		cgcggcgtgcgcggcggcggcgg	0.837														3732	0.745208	0.8707	0.7032	5008	,	,		2587	0.8056		0.6392	False		,,,				2504	0.6524																0								ENSG00000129514																																			FOXA1	SO:0001631	upstream_gene_variant	0				HGNC	U39840	CCDS9665.1	14q12-q13	2008-04-10		2002-09-20	ENSG00000129514	ENSG00000129514		"""Forkhead boxes"""	5021	protein-coding gene	gene with protein product		602294	"""hepatocyte nuclear factor 3, alpha"""	HNF3A		9119385, 8652662	Standard	NM_004496		Approved		uc001wuf.4	P55317	OTTHUMG00000140253		14.37:g.38064357_38064359delGCG	Exception_encountered	Somatic	0	8	0.00		0.6119782349188219	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	6	40.00	B2R9H6|B7ZAP5|Q9H2A0	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000250448.2	37	NULL	CCDS9665.1	14																																																																																			-	-		0.837	FOXA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXA1	protein_coding	OTTHUMT00000276735.1	GCG				38064350	-1	no_errors	ENST00000557418	ensembl	human	known	74_37	rna	DEL	0.998:0.994:0.997	-
GBP5	115362	genome.wustl.edu	37	1	89734500	89734500	+	Frame_Shift_Del	DEL	C	C	-			TCGA-SI-AA8C-01A-11D-A387-09	TCGA-SI-AA8C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b939bdb6-694c-4411-b89b-ee9ac7dc62a9	7a75c68f-e44f-4634-92eb-e759d0c9075c	g.chr1:89734500delC	ENST00000370459.3	-	3	357	c.230delG	c.(229-231)ggafs	p.G77fs	RP4-620F22.2_ENST00000437128.1_RNA|GBP5_ENST00000343435.5_Frame_Shift_Del_p.G77fs			Q96PP8	GBP5_HUMAN	guanylate binding protein 5	77	GB1/RHD3-type G.|GTPase domain (Globular). {ECO:0000250}.					cytoplasm (GO:0005737)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)			breast(1)|endometrium(1)|large_intestine(6)|lung(14)|ovary(1)|prostate(1)	24				all cancers(265;0.00784)|Epithelial(280;0.0286)		TATCCAAATTCCCTTGGTGTG	0.488																																																	0								ENSG00000154451						109.0	97.0	101.0					1																	89734500		2203	4300	6503	GBP5	SO:0001589	frameshift_variant	0				HGNC	AF430642	CCDS722.1	1p22.2	2008-02-05			ENSG00000154451	ENSG00000154451			19895	protein-coding gene	gene with protein product		611467					Standard	NM_052942		Approved		uc001dnd.3	Q96PP8	OTTHUMG00000010006	ENST00000370459.3:c.230delG	1.37:g.89734500delC	ENSP00000359488:p.Gly77fs	Somatic	0	53	0.00		0.6119782349188219	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	18	10.00	B2RCE1|Q86TM5	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Guanylate-bd_N,pfam_Guanylate-bd_C,superfamily_Guanylate-bd_C,superfamily_P-loop_NTPase	p.G77fs	ENST00000370459.3	37	c.230	CCDS722.1	1																																																																																			-	pfam_Guanylate-bd_N,superfamily_P-loop_NTPase		0.488	GBP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GBP5	protein_coding	OTTHUMT00000027700.1	C	NM_052942			89734500	-1	no_errors	ENST00000343435	ensembl	human	known	74_37	frame_shift_del	DEL	0.992	-
MT-CO1	4512	genome.wustl.edu	37	M	2978	2978	+	5'Flank	SNP	T	T	C			TCGA-SI-AA8C-01A-11D-A387-09	TCGA-SI-AA8C-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b939bdb6-694c-4411-b89b-ee9ac7dc62a9	7a75c68f-e44f-4634-92eb-e759d0c9075c	g.chrM:2978T>C	ENST00000361624.2	+	0	0				MT-TV_ENST00000387342.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TQ_ENST00000387372.1_RNA|MT-ND1_ENST00000361390.2_5'Flank|MT-TL1_ENST00000386347.1_RNA|MT-TM_ENST00000387377.1_RNA|MT-ND2_ENST00000361453.3_5'Flank|MT-RNR1_ENST00000389680.2_RNA|MT-TI_ENST00000387365.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-TW_ENST00000387382.1_RNA|MT-TC_ENST00000387405.1_RNA|MT-TF_ENST00000387314.1_RNA			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I						aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						TCAACAATAGGGTTTACGACC	0.433																																																	0								ENSG00000210082																																			MT-RNR2	SO:0001631	upstream_gene_variant	0			-	HGNC			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395			M.37:g.2978T>C	Exception_encountered	Somatic	0	40	0.00		0.6119782349188219	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	29	12.12	Q34770	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000361624.2	37	NULL		MT																																																																																			-	-		0.433	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	MT-RNR2	protein_coding		T	YP_003024028	-		2978	+1	no_errors	ENST00000387347	ensembl	human	known	74_37	rna	SNP	NULL	C
PCDHB6	56130	genome.wustl.edu	37	5	140530097	140530097	+	Nonsense_Mutation	SNP	G	G	T			TCGA-SI-AA8C-01A-11D-A387-09	TCGA-SI-AA8C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b939bdb6-694c-4411-b89b-ee9ac7dc62a9	7a75c68f-e44f-4634-92eb-e759d0c9075c	g.chr5:140530097G>T	ENST00000231136.1	+	1	259	c.259G>T	c.(259-261)Gaa>Taa	p.E87*	PCDHB6_ENST00000543635.1_5'UTR	NM_018939.2	NP_061762.1	Q9Y5E3	PCDB6_HUMAN	protocadherin beta 6	87	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			cervix(1)|endometrium(14)|kidney(6)|large_intestine(16)|liver(1)|lung(33)|ovary(1)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	84			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ACTGCTAAATGAAAAACTGGA	0.517																																																	0								ENSG00000113211						75.0	82.0	79.0					5																	140530097		2203	4300	6503	PCDHB6	SO:0001587	stop_gained	0			-	HGNC	AF152499	CCDS4248.1	5q31	2010-01-26			ENSG00000113211	ENSG00000113211		"""Cadherins / Protocadherins : Clustered"""	8691	other	protocadherin		606332				10380929	Standard	NM_018939		Approved	PCDH-BETA6	uc003lir.3	Q9Y5E3	OTTHUMG00000129623	ENST00000231136.1:c.259G>T	5.37:g.140530097G>T	ENSP00000231136:p.Glu87*	Somatic	0	64	0.00		0.6119782349188219	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	B2R8R9	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.E87*	ENST00000231136.1	37	c.259	CCDS4248.1	5	.	.	.	.	.	.	.	.	.	.	G	14.14	2.445948	0.43429	.	.	ENSG00000113211	ENST00000231136	.	.	.	4.97	4.97	0.65823	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	18.587	0.91194	0.0:0.0:1.0:0.0	.	.	.	.	X	87	.	ENSP00000231136:E87X	E	+	1	0	PCDHB6	140510281	0.992000	0.36948	0.858000	0.33744	0.190000	0.23558	4.848000	0.62874	2.454000	0.82982	0.561000	0.74099	GAA	-	pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin		0.517	PCDHB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB6	protein_coding	OTTHUMT00000251818.2	G	NM_018939	-		140530097	+1	no_errors	ENST00000231136	ensembl	human	known	74_37	nonsense	SNP	0.982	T
HMGCS2	3158	genome.wustl.edu	37	1	120306940	120306940	+	Frame_Shift_Del	DEL	G	G	-			TCGA-SI-AA8C-01A-11D-A387-09	TCGA-SI-AA8C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b939bdb6-694c-4411-b89b-ee9ac7dc62a9	7a75c68f-e44f-4634-92eb-e759d0c9075c	g.chr1:120306940delG	ENST00000369406.3	-	2	463	c.414delC	c.(412-414)tccfs	p.S138fs	HMGCS2_ENST00000476640.1_5'UTR|HMGCS2_ENST00000544913.2_Frame_Shift_Del_p.S138fs	NM_005518.3	NP_005509.1	P54868	HMCS2_HUMAN	3-hydroxy-3-methylglutaryl-CoA synthase 2 (mitochondrial)	138					cellular ketone body metabolic process (GO:0046950)|cellular lipid metabolic process (GO:0044255)|cholesterol biosynthetic process (GO:0006695)|isoprenoid biosynthetic process (GO:0008299)|ketone body biosynthetic process (GO:0046951)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	hydroxymethylglutaryl-CoA synthase activity (GO:0004421)			NS(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(1)|lung(13)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	28	all_cancers(5;6.38e-10)|all_epithelial(5;1.1e-10)|Melanoma(3;1.93e-05)|Breast(55;0.218)|all_neural(166;0.219)	all_lung(203;1.29e-06)|Lung NSC(69;9.35e-06)|all_epithelial(167;0.00124)		Lung(183;0.0112)|LUSC - Lung squamous cell carcinoma(189;0.0595)		TGACAGCTTTGGACTTGTCAA	0.527																																																	0								ENSG00000134240						105.0	100.0	101.0					1																	120306940		2203	4300	6503	HMGCS2	SO:0001589	frameshift_variant	0				HGNC	BC044217	CCDS905.1, CCDS53353.1	1p13-p12	2014-09-17	2010-04-30		ENSG00000134240	ENSG00000134240			5008	protein-coding gene	gene with protein product		600234	"""3-hydroxy-3-methylglutaryl-Coenzyme A synthase 2 (mitochondrial)"""			7851882, 7893153	Standard	NM_005518		Approved		uc001eid.3	P54868	OTTHUMG00000012101	ENST00000369406.3:c.414delC	1.37:g.120306940delG	ENSP00000358414:p.Ser138fs	Somatic	0	61	0.00		0.6119782349188219	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	16	11.11	B7Z8R3|D3Y5K6|Q5SZU2|Q6IBF4	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_HMG_CoA_synt_C,pfam_HMG_CoA_synth_N,superfamily_Thiolase-like,tigrfam_HMG_CoA_synthase_euk	p.A140fs	ENST00000369406.3	37	c.414	CCDS905.1	1																																																																																			-	pfam_HMG_CoA_synth_N,superfamily_Thiolase-like,tigrfam_HMG_CoA_synthase_euk		0.527	HMGCS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMGCS2	protein_coding	OTTHUMT00000033469.2	G	NM_005518			120306940	-1	no_errors	ENST00000369406	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
RABGAP1L	9910	genome.wustl.edu	37	1	174652688	174652688	+	Missense_Mutation	SNP	G	G	C			TCGA-SI-AA8C-01A-11D-A387-09	TCGA-SI-AA8C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b939bdb6-694c-4411-b89b-ee9ac7dc62a9	7a75c68f-e44f-4634-92eb-e759d0c9075c	g.chr1:174652688G>C	ENST00000251507.4	+	15	2027	c.1853G>C	c.(1852-1854)gGg>gCg	p.G618A		NM_014857.4	NP_055672.3	B7ZAP0	RBG10_HUMAN	RAB GTPase activating protein 1-like	0										NS(1)|breast(2)|endometrium(4)|kidney(5)|large_intestine(7)|lung(21)|ovary(2)|prostate(1)|skin(2)	45						GAAGACATTGGGTACTGTCAA	0.368																																																	0								ENSG00000152061						231.0	205.0	214.0					1																	174652688		2203	4300	6503	RABGAP1L	SO:0001583	missense	0			-	HGNC	AF279778	CCDS1314.1, CCDS41437.1, CCDS55662.1, CCDS58046.1	1q24	2011-11-21			ENSG00000152061	ENSG00000152061			24663	protein-coding gene	gene with protein product		609238				10585558	Standard	NM_014857		Approved	HHL, TBC1D18, KIAA0471, FLJ38519	uc001gjx.3	B7ZAP0	OTTHUMG00000034899	ENST00000251507.4:c.1853G>C	1.37:g.174652688G>C	ENSP00000251507:p.Gly618Ala	Somatic	0	145	0.00		0.6119782349188219	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	80	8.05	B7ZAA4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Rab-GTPase-TBC_dom,pfam_Kinesin-like,pfam_PTB/PI_dom,superfamily_Rab-GTPase-TBC_dom,smart_PTB/PI_dom,smart_Rab-GTPase-TBC_dom,pfscan_PTB/PI_dom,pfscan_Rab-GTPase-TBC_dom	p.G618A	ENST00000251507.4	37	c.1853	CCDS1314.1	1	.	.	.	.	.	.	.	.	.	.	G	25.4	4.638387	0.87760	.	.	ENSG00000152061	ENST00000251507;ENST00000367692	T	0.10860	2.83	5.42	5.42	0.78866	Rab-GAP/TBC domain (4);	0.000000	0.85682	D	0.000000	T	0.48995	0.1531	H	0.96015	3.755	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.65409	-0.6175	10	0.87932	D	0	.	18.3433	0.90313	0.0:0.0:1.0:0.0	.	618	Q5R372	RBG1L_HUMAN	A	618;630	ENSP00000251507:G618A	ENSP00000251507:G618A	G	+	2	0	RABGAP1L	172919311	1.000000	0.71417	0.994000	0.49952	0.973000	0.67179	8.805000	0.91925	2.687000	0.91594	0.655000	0.94253	GGG	-	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom		0.368	RABGAP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RABGAP1L	protein_coding	OTTHUMT00000084497.1	G	NM_001243765	-		174652688	+1	no_errors	ENST00000251507	ensembl	human	known	74_37	missense	SNP	1.000	C
LOC100130331	100130331	genome.wustl.edu	37	1	238090583	238090583	+	RNA	SNP	G	G	T			TCGA-SI-AA8C-01A-11D-A387-09	TCGA-SI-AA8C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b939bdb6-694c-4411-b89b-ee9ac7dc62a9	7a75c68f-e44f-4634-92eb-e759d0c9075c	g.chr1:238090583G>T	ENST00000450451.1	+	0	2089					NR_027247.2																						CAGTGGCATTGTCAGGGACTC	0.602																																																	0								ENSG00000237250																																			RP11-193H5.1			0			-	Clone_based_vega_gene																													1.37:g.238090583G>T		Somatic	0	37	0.00		0.6119782349188219	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	16	20.00		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000450451.1	37	NULL		1																																																																																			-	-		0.602	RP11-193H5.1-001	KNOWN	basic	antisense	LOC100130331	antisense	OTTHUMT00000095477.1	G		-		238090583	+1	no_errors	ENST00000450451	ensembl	human	known	74_37	rna	SNP	1.000	T
FZD2	2535	genome.wustl.edu	37	17	42636593	42636593	+	Missense_Mutation	SNP	C	C	T			TCGA-SI-AA8C-01A-11D-A387-09	TCGA-SI-AA8C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b939bdb6-694c-4411-b89b-ee9ac7dc62a9	7a75c68f-e44f-4634-92eb-e759d0c9075c	g.chr17:42636593C>T	ENST00000315323.3	+	1	1669	c.1537C>T	c.(1537-1539)Cgc>Tgc	p.R513C		NM_001466.3	NP_001457.1	Q14332	FZD2_HUMAN	frizzled class receptor 2	513					axonogenesis (GO:0007409)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|cell-cell signaling (GO:0007267)|cochlea morphogenesis (GO:0090103)|epithelial cell differentiation (GO:0030855)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|gonad development (GO:0008406)|hard palate development (GO:0060022)|inner ear receptor cell development (GO:0060119)|membranous septum morphogenesis (GO:0003149)|muscular septum morphogenesis (GO:0003150)|neuron differentiation (GO:0030182)|outflow tract morphogenesis (GO:0003151)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of cGMP metabolic process (GO:0030825)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|sensory perception of smell (GO:0007608)|vasculature development (GO:0001944)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)	apical part of cell (GO:0045177)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|neuron projection membrane (GO:0032589)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(9)|ovary(3)|prostate(8)	33		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.189)		CTACACGCCGCGCATGTCGCC	0.627																																																	0								ENSG00000180340						42.0	39.0	40.0					17																	42636593		2203	4300	6503	FZD2	SO:0001583	missense	0			-	HGNC	L37882	CCDS11484.1	17q21.1	2014-01-29	2014-01-29			ENSG00000180340		"""GPCR / Class F : Frizzled receptors"""	4040	protein-coding gene	gene with protein product		600667	"""frizzled (Drosophila) homolog 2"", ""frizzled homolog 2 (Drosophila)"", ""frizzled 2, seven transmembrane spanning receptor"", ""frizzled family receptor 2"""			7558010, 9813155	Standard	NM_001466		Approved		uc002igx.2	Q14332		ENST00000315323.3:c.1537C>T	17.37:g.42636593C>T	ENSP00000323901:p.Arg513Cys	Somatic	0	103	0.00		0.6119782349188219	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	55	8.33	Q0VG82	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Frizzled,pfam_Frizzled_dom,superfamily_Frizzled_dom,smart_Frizzled_dom,pfscan_Frizzled_dom,pfscan_GPCR_2-like,prints_Frizzled	p.R513C	ENST00000315323.3	37	c.1537	CCDS11484.1	17	.	.	.	.	.	.	.	.	.	.	c	18.76	3.692883	0.68271	.	.	ENSG00000180340	ENST00000541149;ENST00000315323	D	0.82255	-1.59	5.0	3.97	0.46021	GPCR, family 2-like (1);	0.172114	0.52532	D	0.000067	T	0.78691	0.4323	M	0.66297	2.02	0.51482	D	0.99992	P	0.34629	0.46	B	0.26202	0.067	T	0.79557	-0.1754	10	0.39692	T	0.17	.	13.8394	0.63430	0.1537:0.8463:0.0:0.0	.	513	Q14332	FZD2_HUMAN	C	589;513	ENSP00000323901:R513C	ENSP00000323901:R513C	R	+	1	0	FZD2	39992119	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.431000	0.44775	2.325000	0.78763	0.555000	0.69702	CGC	-	pfam_Frizzled,pfscan_GPCR_2-like		0.627	FZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FZD2	protein_coding	OTTHUMT00000457806.1	C	NM_001466	-		42636593	+1	no_errors	ENST00000315323	ensembl	human	known	74_37	missense	SNP	1.000	T
CDH23	64072	genome.wustl.edu	37	10	73157033	73157034	+	Frame_Shift_Ins	INS	-	-	CGAGG	rs147915565|rs560521778|rs377387074|rs71012280	byFrequency	TCGA-SI-AA8C-01A-11D-A387-09	TCGA-SI-AA8C-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b939bdb6-694c-4411-b89b-ee9ac7dc62a9	7a75c68f-e44f-4634-92eb-e759d0c9075c	g.chr10:73157033_73157034insCGAGG	ENST00000299366.7	+	1	340_341	c.88_89insCGAGG	c.(88-90)ccgfs	p.-32fs	CDH23_ENST00000398809.4_5'UTR|CDH23_ENST00000461841.3_Frame_Shift_Ins_p.-32fs|CDH23_ENST00000398842.3_5'UTR	NM_001171931.1	NP_001165402.1	Q9H251	CAD23_HUMAN	cadherin-related 23						calcium ion transport (GO:0006816)|calcium-dependent cell-cell adhesion (GO:0016339)|cytosolic calcium ion homeostasis (GO:0051480)|equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(6)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(27)|lung(49)|ovary(3)|pancreas(1)|prostate(7)|stomach(7)|upper_aerodigestive_tract(3)	133						AGAGCAGAGCCCGAGGCGAGGC	0.767																																																	0								ENSG00000107736																																			CDH23	SO:0001589	frameshift_variant	0				HGNC	AY010111	CCDS53540.1, CCDS73146.1	10q22.1	2014-08-08	2010-01-25		ENSG00000107736	ENSG00000107736		"""Cadherins / Cadherin-related"""	13733	protein-coding gene	gene with protein product	"""cadherin-related family member 23"""	605516	"""cadherin related 23"", ""cadherin-like 23"""	DFNB12, USH1D		11090341	Standard	NM_022124		Approved	CDHR23	uc001jrx.4	Q9H251	OTTHUMG00000019347	ENST00000299366.7:c.99_103dupCGAGG	10.37:g.73157039_73157043dupCGAGG	ENSP00000299366:p.Arg32fs	Somatic	NA	NA	NA		0.6119782349188219	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	C4IXS9|F6U049|Q5QGS1|Q5QGS2|Q5QGS5|Q5QGS6|Q5XKN2|Q6UWW1|Q96JL3|Q9H4K9	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.G34fs	ENST00000299366.7	37	c.88_89		10																																																																																			-	NULL		0.767	CDH23-003	PUTATIVE	basic	protein_coding	CDH23	protein_coding	OTTHUMT00000051229.7	-	NM_052836			73157034	+1	no_errors	ENST00000461841	ensembl	human	known	74_37	frame_shift_ins	INS	0.008:0.011	CGAGG
SEC31B	25956	genome.wustl.edu	37	10	102250030	102250030	+	Missense_Mutation	SNP	G	G	T			TCGA-SI-AA8C-01A-11D-A387-09	TCGA-SI-AA8C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b939bdb6-694c-4411-b89b-ee9ac7dc62a9	7a75c68f-e44f-4634-92eb-e759d0c9075c	g.chr10:102250030G>T	ENST00000370345.3	-	21	2797	c.2700C>A	c.(2698-2700)aaC>aaA	p.N900K		NM_015490.3	NP_056305.1	Q9NQW1	SC31B_HUMAN	SEC31 homolog B (S. cerevisiae)	900	Pro-rich.				protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|vesicle coat (GO:0030120)				NS(1)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(3)|lung(17)|ovary(1)|urinary_tract(1)	36		Colorectal(252;0.117)		Epithelial(162;2.36e-10)|all cancers(201;2.09e-08)		ATCCCACCGGGTTAGGAACTT	0.537																																																	0								ENSG00000075826						78.0	68.0	71.0					10																	102250030		2203	4300	6503	SEC31B	SO:0001583	missense	0			-	HGNC	AF274863	CCDS7495.1	10q24.32	2013-01-10	2006-10-05	2006-09-07	ENSG00000075826	ENSG00000075826		"""WD repeat domain containing"""	23197	protein-coding gene	gene with protein product		610258	"""SEC31-like 2 (S. cerevisiae)"""	SEC31L2		16495487	Standard	NM_015490		Approved	SEC31B-1, DKFZP434M183	uc001krc.1	Q9NQW1	OTTHUMG00000019342	ENST00000370345.3:c.2700C>A	10.37:g.102250030G>T	ENSP00000359370:p.Asn900Lys	Somatic	0	50	0.00		0.6119782349188219	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	31	11.43	B7ZM75|Q6MZS3|Q86UF0|Q9Y4Q8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.N900K	ENST00000370345.3	37	c.2700	CCDS7495.1	10	.	.	.	.	.	.	.	.	.	.	G	9.078	0.998535	0.19121	.	.	ENSG00000075826	ENST00000370345	T	0.50001	0.76	5.51	2.19	0.27852	.	0.851650	0.11013	N	0.609197	T	0.35740	0.0942	M	0.66939	2.045	0.09310	N	0.999995	P;P	0.43094	0.799;0.698	B;B	0.33454	0.164;0.142	T	0.36040	-0.9764	10	0.38643	T	0.18	-6.2545	2.5422	0.04729	0.1052:0.191:0.5057:0.1981	.	899;900	Q9NQW1-5;Q9NQW1	.;SC31B_HUMAN	K	900	ENSP00000359370:N900K	ENSP00000359370:N900K	N	-	3	2	SEC31B	102240020	0.980000	0.34600	0.085000	0.20634	0.971000	0.66376	0.242000	0.18087	1.295000	0.44724	0.561000	0.74099	AAC	-	NULL		0.537	SEC31B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC31B	protein_coding	OTTHUMT00000051198.1	G	NM_015490	-		102250030	-1	no_errors	ENST00000370345	ensembl	human	known	74_37	missense	SNP	0.054	T
GCNT6	644378	genome.wustl.edu	37	6	10634149	10634149	+	Missense_Mutation	SNP	G	G	A			TCGA-SI-AA8C-01A-11D-A387-09	TCGA-SI-AA8C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b939bdb6-694c-4411-b89b-ee9ac7dc62a9	7a75c68f-e44f-4634-92eb-e759d0c9075c	g.chr6:10634149G>A	ENST00000417671.1	+	1	157	c.157G>A	c.(157-159)Gca>Aca	p.A53T				Q5T4J0	GCNT6_HUMAN	glucosaminyl (N-acetyl) transferase 6	53					protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)			breast(1)	1						CATCTGTGACGCAGCCCTAAA	0.438																																																	0								ENSG00000205318																																			GCNT6	SO:0001583	missense	0			-	HGNC			6p24.2	2013-02-25			ENSG00000205318	ENSG00000205318		"""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	21623	protein-coding gene	gene with protein product							Standard			Approved	bA421M1.3		Q5T4J0	OTTHUMG00000014243	ENST00000417671.1:c.157G>A	6.37:g.10634149G>A	ENSP00000398277:p.Ala53Thr	Somatic	0	59	0.00		0.6119782349188219	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	25	39.02		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Glyco_trans_14	p.A53T	ENST00000417671.1	37	c.157		6	.	.	.	.	.	.	.	.	.	.	g	12.08	1.831626	0.32329	.	.	ENSG00000205318	ENST00000417671	T	0.10382	2.88	3.36	-3.52	0.04682	.	.	.	.	.	T	0.01592	0.0051	L	0.29908	0.895	0.09310	N	1	.	.	.	.	.	.	T	0.46133	-0.9213	7	0.15499	T	0.54	.	3.964	0.09423	0.4279:0.0:0.3118:0.2603	.	.	.	.	T	53	ENSP00000398277:A53T	ENSP00000398277:A53T	A	+	1	0	GCNT6	10742135	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.881000	0.01626	-1.154000	0.02825	-2.244000	0.00286	GCA	-	NULL		0.438	GCNT6-201	KNOWN	basic|appris_principal	protein_coding	GCNT6	protein_coding		G		-		10634149	+1	no_errors	ENST00000417671	ensembl	human	known	74_37	missense	SNP	0.000	A
CPA2	1358	genome.wustl.edu	37	7	129919465	129919465	+	Missense_Mutation	SNP	G	G	T	rs150060449		TCGA-SI-AA8C-01A-11D-A387-09	TCGA-SI-AA8C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b939bdb6-694c-4411-b89b-ee9ac7dc62a9	7a75c68f-e44f-4634-92eb-e759d0c9075c	g.chr7:129919465G>T	ENST00000222481.4	+	9	1005	c.950G>T	c.(949-951)gGg>gTg	p.G317V		NM_001869.2	NP_001860.2	P48052	CBPA2_HUMAN	carboxypeptidase A2 (pancreatic)	317					protein catabolic process in the vacuole (GO:0007039)	extracellular region (GO:0005576)	carboxypeptidase activity (GO:0004180)|metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14	Melanoma(18;0.0435)					TTCCCCTATGGGTACAAATGT	0.418																																																	0								ENSG00000158516	G	VAL/GLY	1,4405	2.1+/-5.4	0,1,2202	99.0	87.0	91.0		950	4.4	0.1	7	dbSNP_134	91	0,8600		0,0,4300	no	missense	CPA2	NM_001869.2	109	0,1,6502	TT,TG,GG		0.0,0.0227,0.0077	probably-damaging	317/420	129919465	1,13005	2203	4300	6503	CPA2	SO:0001583	missense	0			-	HGNC	U19977	CCDS5817.2	7q32	2012-02-10			ENSG00000158516	ENSG00000158516	3.4.17.15		2297	protein-coding gene	gene with protein product		600688				7896805, 10860668	Standard	NM_001869		Approved		uc003vpq.3	P48052	OTTHUMG00000157019	ENST00000222481.4:c.950G>T	7.37:g.129919465G>T	ENSP00000222481:p.Gly317Val	Somatic	0	47	0.00		0.6119782349188219	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70	A4D1M4|C9JIK1|Q53XS1|Q96A12|Q96QN3|Q9UCF1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_M14,pfam_Prot_inh_M14A,superfamily_Prot_inh_propept,smart_Peptidase_M14,prints_Peptidase_M14	p.G317V	ENST00000222481.4	37	c.950	CCDS5817.2	7	.	.	.	.	.	.	.	.	.	.	G	16.07	3.019001	0.54576	2.27E-4	0.0	ENSG00000158516	ENST00000222481	T	0.04194	3.68	6.17	4.37	0.52481	Peptidase M14, carboxypeptidase A (2);	0.000000	0.85682	D	0.000000	T	0.31796	0.0808	H	0.96889	3.9	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.40646	-0.9552	10	0.87932	D	0	.	10.976	0.47467	0.0664:0.0:0.8036:0.13	.	317	P48052	CBPA2_HUMAN	V	317	ENSP00000222481:G317V	ENSP00000222481:G317V	G	+	2	0	CPA2	129706701	1.000000	0.71417	0.125000	0.21846	0.418000	0.31294	6.427000	0.73378	0.934000	0.37316	0.655000	0.94253	GGG	-	pfam_Peptidase_M14,smart_Peptidase_M14		0.418	CPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPA2	protein_coding	OTTHUMT00000347124.2	G	NM_001869	rs150060449		129919465	+1	no_errors	ENST00000222481	ensembl	human	known	74_37	missense	SNP	1.000	T
KHDRBS2	202559	genome.wustl.edu	37	6	62757794	62757794	+	Missense_Mutation	SNP	C	C	G			TCGA-SI-AA8C-01A-11D-A387-09	TCGA-SI-AA8C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b939bdb6-694c-4411-b89b-ee9ac7dc62a9	7a75c68f-e44f-4634-92eb-e759d0c9075c	g.chr6:62757794C>G	ENST00000281156.4	-	3	603	c.325G>C	c.(325-327)Gat>Cat	p.D109H		NM_152688.2	NP_689901.2	Q5VWX1	KHDR2_HUMAN	KH domain containing, RNA binding, signal transduction associated 2	109	KH. {ECO:0000255|PROSITE- ProRule:PRU00117}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	poly(A) binding (GO:0008143)|poly(U) RNA binding (GO:0008266)	p.D109Y(1)		NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(5)|liver(1)|lung(13)|ovary(3)|prostate(3)|skin(12)|upper_aerodigestive_tract(2)|urinary_tract(1)	49				BRCA - Breast invasive adenocarcinoma(397;0.149)		TTAGCTTTATCTCTCATTGAT	0.408																																																	1	Substitution - Missense(1)	endometrium(1)						ENSG00000112232						197.0	188.0	191.0					6																	62757794		2203	4300	6503	KHDRBS2	SO:0001583	missense	0			-	HGNC	BC034043	CCDS4963.1	6q11.1	2013-09-20			ENSG00000112232	ENSG00000112232			18114	protein-coding gene	gene with protein product	"""Sam68-like mammalian protein 1"""	610487					Standard	NM_152688		Approved	SLM1, SLM-1, MGC26664	uc003peg.2	Q5VWX1	OTTHUMG00000014936	ENST00000281156.4:c.325G>C	6.37:g.62757794C>G	ENSP00000281156:p.Asp109His	Somatic	0	99	0.00		0.6119782349188219	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	32	28.89	A8K7M8|Q8N4I4|Q8TCZ4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_KH_dom_type_1,smart_KH_dom,pfscan_KH_dom_type_1	p.D109H	ENST00000281156.4	37	c.325	CCDS4963.1	6	.	.	.	.	.	.	.	.	.	.	C	19.56	3.850198	0.71719	.	.	ENSG00000112232	ENST00000281156;ENST00000539571	T	0.19394	2.15	5.12	4.26	0.50523	K Homology (1);K Homology, type 1 (1);	0.098954	0.64402	D	0.000002	T	0.39708	0.1088	M	0.82193	2.58	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.49153	-0.8969	10	0.87932	D	0	-5.9294	13.7525	0.62917	0.0:0.9255:0.0:0.0745	.	109	Q5VWX1	KHDR2_HUMAN	H	109	ENSP00000281156:D109H	ENSP00000281156:D109H	D	-	1	0	KHDRBS2	62815753	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.776000	0.85560	1.301000	0.44836	0.460000	0.39030	GAT	-	smart_KH_dom,pfscan_KH_dom_type_1		0.408	KHDRBS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KHDRBS2	protein_coding	OTTHUMT00000041066.2	C	NM_152688	-		62757794	-1	no_errors	ENST00000281156	ensembl	human	known	74_37	missense	SNP	1.000	G
CPNE9	151835	genome.wustl.edu	37	3	9771323	9771323	+	Missense_Mutation	SNP	C	C	T			TCGA-SI-AA8C-01A-11D-A387-09	TCGA-SI-AA8C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b939bdb6-694c-4411-b89b-ee9ac7dc62a9	7a75c68f-e44f-4634-92eb-e759d0c9075c	g.chr3:9771323C>T	ENST00000383832.3	+	21	1799	c.1609C>T	c.(1609-1611)Cgg>Tgg	p.R537W	BRPF1_ENST00000302054.3_5'Flank|BRPF1_ENST00000424362.1_5'Flank|BRPF1_ENST00000383829.2_5'Flank|BRPF1_ENST00000433861.2_5'Flank	NM_153635.2	NP_705899.2	Q8IYJ1	CPNE9_HUMAN	copine family member IX	537	Poly-Pro.					extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(2)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	16	Medulloblastoma(99;0.227)					CATCCAGCCTCGGCCCCCACC	0.632																																																	0								ENSG00000144550						42.0	51.0	48.0					3																	9771323		2082	4211	6293	CPNE9	SO:0001583	missense	0			-	HGNC		CCDS2574.2	3p25.3	2008-10-30			ENSG00000144550	ENSG00000144550			24336	protein-coding gene	gene with protein product						9430674	Standard	XM_006712990		Approved	KIAA4217	uc003bsd.3	Q8IYJ1	OTTHUMG00000128418	ENST00000383832.3:c.1609C>T	3.37:g.9771323C>T	ENSP00000373343:p.Arg537Trp	Somatic	0	89	0.00		0.6119782349188219	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	37	33	52.86	A1L430|A6NDX6|A8MSP8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Copine,pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,smart_VWF_A,pfscan_C2_dom,pfscan_VWF_A	p.R537W	ENST00000383832.3	37	c.1609	CCDS2574.2	3	.	.	.	.	.	.	.	.	.	.	C	15.67	2.901013	0.52227	.	.	ENSG00000144550	ENST00000383832	T	0.06768	3.26	5.22	4.29	0.51040	.	0.157190	0.40728	U	0.001040	T	0.23133	0.0559	M	0.78637	2.42	0.80722	D	1	D	0.69078	0.997	P	0.56648	0.803	T	0.01133	-1.1441	10	0.72032	D	0.01	-0.1584	13.3114	0.60382	0.1588:0.8412:0.0:0.0	.	537	Q8IYJ1	CPNE9_HUMAN	W	537	ENSP00000373343:R537W	ENSP00000373343:R537W	R	+	1	2	CPNE9	9746323	0.465000	0.25815	0.998000	0.56505	0.834000	0.47266	1.176000	0.31957	2.395000	0.81488	0.655000	0.94253	CGG	-	NULL		0.632	CPNE9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPNE9	protein_coding	OTTHUMT00000250205.4	C	NM_001033755	-		9771323	+1	no_errors	ENST00000383832	ensembl	human	known	74_37	missense	SNP	0.998	T
PAXIP1	22976	genome.wustl.edu	37	7	154752762	154752762	+	Missense_Mutation	SNP	C	C	T			TCGA-SI-AA8C-01A-11D-A387-09	TCGA-SI-AA8C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b939bdb6-694c-4411-b89b-ee9ac7dc62a9	7a75c68f-e44f-4634-92eb-e759d0c9075c	g.chr7:154752762C>T	ENST00000404141.1	-	12	2429	c.2275G>A	c.(2275-2277)Gcc>Acc	p.A759T	PAXIP1_ENST00000397192.1_Missense_Mutation_p.A759T|PAXIP1_ENST00000473219.1_5'UTR			Q6ZW49	PAXI1_HUMAN	PAX interacting (with transcription-activation domain) protein 1	759	BRCT 4. {ECO:0000255|PROSITE- ProRule:PRU00033}.|Interaction with TP53BP1.				adipose tissue development (GO:0060612)|chorion development (GO:0060717)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|endothelial cell migration (GO:0043542)|histone H3-K4 methylation (GO:0051568)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K36 methylation (GO:0000416)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of isotype switching (GO:0045830)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|response to ionizing radiation (GO:0010212)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)				NS(1)|breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	33	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.0296)	UCEC - Uterine corpus endometrioid carcinoma (81;0.178)		CACTCTTTGGCTTTTTCATAC	0.393																																																	0								ENSG00000157212						80.0	77.0	78.0					7																	154752762		1864	4091	5955	PAXIP1	SO:0001583	missense	0			-	HGNC	U80735	CCDS47753.1	7q36	2007-07-06	2005-04-05	2005-04-05	ENSG00000157212	ENSG00000157212			8624	protein-coding gene	gene with protein product		608254	"""PAX transcription activation domain interacting protein 1 like"""	PAXIP1L		9225980	Standard	XM_005249539		Approved	CAGF29, CAGF28, TNRC2, PTIP	uc022aqf.1	Q6ZW49	OTTHUMG00000151322	ENST00000404141.1:c.2275G>A	7.37:g.154752762C>T	ENSP00000384048:p.Ala759Thr	Somatic	0	111	0.00		0.6119782349188219	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	43	30.65	O15404|Q6N099|Q6ZWH9|Q7Z315|Q86UN0|Q8N4P9|Q96HP2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_BRCT_dom,superfamily_BRCT_dom,smart_BRCT_dom,pfscan_BRCT_dom	p.A759T	ENST00000404141.1	37	c.2275	CCDS47753.1	7	.	.	.	.	.	.	.	.	.	.	C	27.5	4.841079	0.91197	.	.	ENSG00000157212	ENST00000404141;ENST00000397192;ENST00000357094;ENST00000323199	D;D	0.97455	-4.39;-4.39	5.51	5.51	0.81932	BRCT (3);	0.000000	0.56097	U	0.000040	D	0.98495	0.9498	M	0.81802	2.56	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.998;0.999	D	0.99521	1.0958	10	0.87932	D	0	-23.208	19.4545	0.94882	0.0:1.0:0.0:0.0	.	712;725;759	B4DEQ6;Q6ZW49-1;Q6ZW49	.;.;PAXI1_HUMAN	T	759;759;583;712	ENSP00000384048:A759T;ENSP00000380376:A759T	ENSP00000319149:A712T	A	-	1	0	PAXIP1	154383695	1.000000	0.71417	0.986000	0.45419	0.925000	0.55904	7.525000	0.81892	2.590000	0.87494	0.650000	0.86243	GCC	-	pfam_BRCT_dom,superfamily_BRCT_dom,smart_BRCT_dom,pfscan_BRCT_dom		0.393	PAXIP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	PAXIP1	protein_coding	OTTHUMT00000322223.1	C	NM_007349	-		154752762	-1	no_errors	ENST00000397192	ensembl	human	known	74_37	missense	SNP	1.000	T
MN1	4330	genome.wustl.edu	37	22	28194881	28194883	+	In_Frame_Del	DEL	GCT	GCT	-			TCGA-SI-AA8C-01A-11D-A387-09	TCGA-SI-AA8C-10A-01D-A38A-09	GCT	GCT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b939bdb6-694c-4411-b89b-ee9ac7dc62a9	7a75c68f-e44f-4634-92eb-e759d0c9075c	g.chr22:28194881_28194883delGCT	ENST00000302326.4	-	1	2603_2605	c.1649_1651delAGC	c.(1648-1653)cagcgc>cgc	p.Q550del		NM_002430.2	NP_002421.3	Q10571	MN1_HUMAN	meningioma (disrupted in balanced translocation) 1	550	Poly-Gln.				intramembranous ossification (GO:0001957)					NS(1)|breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(6)|lung(15)|ovary(3)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	45						GCGTTTTGGCgctgctgctgctg	0.645			T	ETV6	"""AML, meningioma"""																																			Dom	yes		22	22q13	4330	meningioma (disrupted in balanced translocation) 1		"""L, O"""	0								ENSG00000169184			88,3382		14,60,1661						3.4	1.0			5	216,6858		15,186,3336	no	coding	MN1	NM_002430.2		29,246,4997	A1A1,A1R,RR		3.0534,2.536,2.8832				304,10240				MN1	SO:0001651	inframe_deletion	0				HGNC	X82209	CCDS42998.1	22q12.1	2010-09-29			ENSG00000169184	ENSG00000169184			7180	protein-coding gene	gene with protein product	"""probable tumor suppressor protein MN1"""	156100	"""meningioma chromosome region"""	MGCR		7731706, 12569362	Standard	NM_002430		Approved	MGCR1-PEN, MGCR1	uc003adj.3	Q10571	OTTHUMG00000150975	ENST00000302326.4:c.1649_1651delAGC	22.37:g.28194890_28194892delGCT	ENSP00000304956:p.Gln550del	Somatic	0	43	0.00		0.6119782349188219	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	11	15.38	A9Z1V9	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	NULL	p.Q550in_frame_del	ENST00000302326.4	37	c.1651_1649	CCDS42998.1	22																																																																																			-	NULL		0.645	MN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MN1	protein_coding	OTTHUMT00000320737.1	GCT	NM_002430			28194883	-1	no_errors	ENST00000302326	ensembl	human	known	74_37	in_frame_del	DEL	1.000:1.000:1.000	-
ZC3H7B	23264	genome.wustl.edu	37	22	41751983	41751983	+	Missense_Mutation	SNP	G	G	A			TCGA-SI-AA8C-01A-11D-A387-09	TCGA-SI-AA8C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b939bdb6-694c-4411-b89b-ee9ac7dc62a9	7a75c68f-e44f-4634-92eb-e759d0c9075c	g.chr22:41751983G>A	ENST00000352645.4	+	20	2557	c.2300G>A	c.(2299-2301)cGc>cAc	p.R767H	ZC3H7B_ENST00000351589.4_Missense_Mutation_p.R767H	NM_017590.4	NP_060060.3	Q9UGR2	Z3H7B_HUMAN	zinc finger CCCH-type containing 7B	783					viral process (GO:0016032)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(11)|ovary(3)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	38						CAGAACGGCCGCAAGTGCCAA	0.627																																																	0								ENSG00000100403						55.0	46.0	49.0					22																	41751983		2203	4300	6503	ZC3H7B	SO:0001583	missense	0			-	HGNC		CCDS14013.1	22q13.2	2013-01-10		2005-08-09	ENSG00000100403	ENSG00000100403		"""Zinc fingers, CCCH-type domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	30869	protein-coding gene	gene with protein product						10470851, 11230166	Standard	NM_017590		Approved	RoXaN, FLJ13787, DKFZp434K0920, KIAA1031	uc003azw.4	Q9UGR2	OTTHUMG00000150969	ENST00000352645.4:c.2300G>A	22.37:g.41751983G>A	ENSP00000345793:p.Arg767His	Somatic	0	48	0.00		0.6119782349188219	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	20	16.67	A7YY88|B2RCA4|Q5TFX9|Q8TBT9|Q9H8B6|Q9UGQ9|Q9UGR0|Q9UGR1|Q9UK03|Q9UPW9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_CCCH,pfam_TPR_1,smart_TPR_repeat,smart_Znf_CCCH,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.R767H	ENST00000352645.4	37	c.2300	CCDS14013.1	22	.	.	.	.	.	.	.	.	.	.	G	25.5	4.648553	0.87958	.	.	ENSG00000100403	ENST00000352645;ENST00000351589	T;T	0.13196	2.61;2.61	5.18	5.18	0.71444	.	0.052389	0.85682	D	0.000000	T	0.20941	0.0504	L	0.29908	0.895	0.39079	D	0.960869	D	0.67145	0.996	P	0.59115	0.852	T	0.01484	-1.1343	10	0.87932	D	0	-15.3002	12.0975	0.53763	0.0792:0.0:0.9208:0.0	.	767	Q9UGR2-2	.	H	767	ENSP00000345793:R767H;ENSP00000263243:R767H	ENSP00000263243:R767H	R	+	2	0	ZC3H7B	40081929	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.729000	0.74775	2.410000	0.81850	0.561000	0.74099	CGC	-	smart_Znf_CCCH		0.627	ZC3H7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZC3H7B	protein_coding	OTTHUMT00000320696.1	G	NM_017590	-		41751983	+1	no_errors	ENST00000351589	ensembl	human	known	74_37	missense	SNP	1.000	A
YIPF2	78992	genome.wustl.edu	37	19	11038362	11038364	+	In_Frame_Del	DEL	GCT	GCT	-			TCGA-SI-AA8C-01A-11D-A387-09	TCGA-SI-AA8C-10A-01D-A38A-09	GCT	GCT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b939bdb6-694c-4411-b89b-ee9ac7dc62a9	7a75c68f-e44f-4634-92eb-e759d0c9075c	g.chr19:11038362_11038364delGCT	ENST00000586748.1	-	4	393_395	c.221_223delAGC	c.(220-225)cagccg>ccg	p.Q74del	YIPF2_ENST00000253031.2_In_Frame_Del_p.Q74del|YIPF2_ENST00000590329.1_In_Frame_Del_p.Q74del|C19orf52_ENST00000270502.6_5'Flank			Q9BWQ6	YIPF2_HUMAN	Yip1 domain family, member 2	74						integral component of membrane (GO:0016021)|transport vesicle (GO:0030133)				cervix(1)|endometrium(1)|lung(3)|ovary(2)	7						CAGAATCCCGgctgctgctgctg	0.621																																																	0								ENSG00000130733																																			YIPF2	SO:0001651	inframe_deletion	0				HGNC	BC013014	CCDS12251.1	19p13.2	2008-02-05				ENSG00000130733		"""Yip1 domain family"""	28476	protein-coding gene	gene with protein product						12477932	Standard	NM_024029		Approved	MGC3262, FinGER2	uc002mqc.3	Q9BWQ6		ENST00000586748.1:c.221_223delAGC	19.37:g.11038371_11038373delGCT	ENSP00000466055:p.Gln74del	Somatic	0	44	0.00		0.6119782349188219	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	26	13.33		In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Yip1	p.Q74in_frame_del	ENST00000586748.1	37	c.223_221	CCDS12251.1	19																																																																																			-	NULL		0.621	YIPF2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	YIPF2	protein_coding	OTTHUMT00000453045.1	GCT	NM_024029			11038364	-1	no_errors	ENST00000253031	ensembl	human	known	74_37	in_frame_del	DEL	0.404:0.366:0.337	-
YTHDF3	253943	genome.wustl.edu	37	8	64124995	64124995	+	3'UTR	DEL	A	A	-	rs71671324	byFrequency	TCGA-SI-AA8C-01A-11D-A387-09	TCGA-SI-AA8C-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b939bdb6-694c-4411-b89b-ee9ac7dc62a9	7a75c68f-e44f-4634-92eb-e759d0c9075c	g.chr8:64124995delA	ENST00000517371.1	+	0	3114				YTHDF3_ENST00000521674.1_3'UTR|YTHDF3_ENST00000542911.2_3'UTR|YTHDF3_ENST00000539294.1_3'UTR			Q7Z739	YTHD3_HUMAN	YTH domain family, member 3								N6-methyladenosine-containing RNA binding (GO:1990247)|poly(A) RNA binding (GO:0044822)					Breast(64;0.0716)	all_cancers(86;0.169)|Lung NSC(129;0.0324)|all_lung(136;0.0593)|all_epithelial(80;0.146)	BRCA - Breast invasive adenocarcinoma(89;0.161)			AGTTTGCAATAAAAAAAAATG	0.274													AAAAAAAA|AAAAAAAAA|AAAAAAAA|insertion	1279	0.255391	0.3404	0.1801	5008	,	,		16951	0.4117		0.1183	False		,,,				2504	0.1738																0								ENSG00000185728																																			YTHDF3	SO:0001624	3_prime_UTR_variant	0				HGNC	BC052970	CCDS75747.1, CCDS75748.1, CCDS75749.1	8q12.3	2013-06-07	2004-11-16		ENSG00000185728	ENSG00000185728			26465	protein-coding gene	gene with protein product			"""YTH domain family 3"""			12477932	Standard	NM_152758		Approved	FLJ31657	uc003xuz.4	Q7Z739	OTTHUMG00000164369	ENST00000517371.1:c.*2731A>-	8.37:g.64124995delA		Somatic	0	58	0.00		0.6119782349188219	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	17	15.00	B3KXL4|Q63Z37|Q659A3	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000517371.1	37	NULL		8																																																																																			-	-		0.274	YTHDF3-010	PUTATIVE	basic	protein_coding	YTHDF3	protein_coding	OTTHUMT00000378466.4	A	NM_152758			64124995	+1	no_errors	ENST00000521674	ensembl	human	known	74_37	rna	DEL	0.997	-
DLGAP2	9228	genome.wustl.edu	37	8	1497797	1497797	+	Missense_Mutation	SNP	C	C	T			TCGA-SI-AA8C-01A-11D-A387-09	TCGA-SI-AA8C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b939bdb6-694c-4411-b89b-ee9ac7dc62a9	7a75c68f-e44f-4634-92eb-e759d0c9075c	g.chr8:1497797C>T	ENST00000421627.2	+	2	1072	c.938C>T	c.(937-939)cCg>cTg	p.P313L		NM_004745.3	NP_004736.2	Q9P1A6	DLGP2_HUMAN	discs, large (Drosophila) homolog-associated protein 2	392					neuron-neuron synaptic transmission (GO:0007270)	cell junction (GO:0030054)|neurofilament (GO:0005883)|postsynaptic membrane (GO:0045211)				breast(1)|endometrium(6)|lung(31)|prostate(3)	41		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)		BRCA - Breast invasive adenocarcinoma(11;0.000169)|READ - Rectum adenocarcinoma(644;0.171)		CTGGACAAGCCGCTGCTGCAC	0.672																																																	0								ENSG00000198010						6.0	7.0	7.0					8																	1497797		2027	4092	6119	DLGAP2	SO:0001583	missense	0			-	HGNC	AB000275	CCDS47760.1, CCDS75689.1	8p23	2007-12-06	2001-11-28		ENSG00000198010	ENSG00000198010			2906	protein-coding gene	gene with protein product		605438	"""discs, large (Drosophila) homolog-associated protein 2"""			9286858, 10854099	Standard	NM_004745		Approved	DAP-2	uc003wpl.4	Q9P1A6	OTTHUMG00000163599	ENST00000421627.2:c.938C>T	8.37:g.1497797C>T	ENSP00000400258:p.Pro313Leu	Somatic	0	73	0.00		0.6119782349188219	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	54	11.48	A1QCF8|A1QCF9|A5D8Y2|O14488|O14664|Q9P1A7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GKAP	p.P313L	ENST00000421627.2	37	c.938	CCDS47760.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.4|20.4	3.977761|3.977761	0.74360|0.74360	.|.	.|.	ENSG00000198010|ENSG00000198010	ENST00000356067;ENST00000421627|ENST00000520901	T|.	0.13307|.	2.6|.	5.3|5.3	5.3|5.3	0.74995|0.74995	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.78792|0.78792	0.4339|0.4339	M|M	0.80028|0.80028	2.48|2.48	0.58432|0.58432	D|D	0.999999|0.999999	D;D|.	0.71674|.	0.998;0.997|.	P;P|.	0.57776|.	0.827;0.676|.	T|T	0.79654|0.79654	-0.1713|-0.1713	10|5	0.72032|.	D|.	0.01|.	-14.1979|-14.1979	18.9482|18.9482	0.92630|0.92630	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	392;392|.	Q9P1A6-2;Q9P1A6|.	.;DLGP2_HUMAN|.	L|C	358;313|330	ENSP00000400258:P313L|.	ENSP00000348366:P358L|.	P|R	+|+	2|1	0|0	DLGAP2|DLGAP2	1485204|1485204	1.000000|1.000000	0.71417|0.71417	0.948000|0.948000	0.38648|0.38648	0.538000|0.538000	0.34931|0.34931	7.052000|7.052000	0.76634|0.76634	2.463000|2.463000	0.83235|0.83235	0.655000|0.655000	0.94253|0.94253	CCG|CGC	-	NULL		0.672	DLGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DLGAP2	protein_coding	OTTHUMT00000374478.1	C	NM_004745	-		1497797	+1	no_errors	ENST00000421627	ensembl	human	known	74_37	missense	SNP	0.999	T
USP46	64854	genome.wustl.edu	37	4	53492298	53492298	+	Missense_Mutation	SNP	T	T	C			TCGA-SI-AA8C-01A-11D-A387-09	TCGA-SI-AA8C-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b939bdb6-694c-4411-b89b-ee9ac7dc62a9	7a75c68f-e44f-4634-92eb-e759d0c9075c	g.chr4:53492298T>C	ENST00000441222.3	-	4	632	c.448A>G	c.(448-450)Aaa>Gaa	p.K150E	USP46_ENST00000451218.2_Missense_Mutation_p.K123E|USP46_ENST00000508499.1_Missense_Mutation_p.K143E	NM_022832.3	NP_073743.2	P62068	UBP46_HUMAN	ubiquitin specific peptidase 46	150	USP.				adult feeding behavior (GO:0008343)|behavioral fear response (GO:0001662)|behavioral response to ethanol (GO:0048149)|protein deubiquitination (GO:0016579)|regulation of synaptic transmission, GABAergic (GO:0032228)|righting reflex (GO:0060013)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|endometrium(2)|large_intestine(2)|lung(5)|ovary(2)	12			LUSC - Lung squamous cell carcinoma(32;0.0295)			TTGCCATTTTTTAATTTTCCA	0.383																																																	0								ENSG00000109189						137.0	124.0	128.0					4																	53492298		1821	4085	5906	USP46	SO:0001583	missense	0			-	HGNC	AK022614	CCDS47053.1, CCDS47054.1	4q12	2008-02-05	2005-08-08		ENSG00000109189	ENSG00000109189		"""Ubiquitin-specific peptidases"""	20075	protein-coding gene	gene with protein product		612849	"""ubiquitin specific protease 46"""			12838346	Standard	NM_022832		Approved	FLJ12552	uc003gzn.3	P62068	OTTHUMG00000160640	ENST00000441222.3:c.448A>G	4.37:g.53492298T>C	ENSP00000407818:p.Lys150Glu	Somatic	0	209	0.00		0.6119782349188219	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	56	79	41.48	B7Z3Y7|B7Z675|B7Z7S3|G8ACC7|Q80V95|Q9H7U4|Q9H9T8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	p.K150E	ENST00000441222.3	37	c.448	CCDS47053.1	4	.	.	.	.	.	.	.	.	.	.	T	1.078	-0.667891	0.03428	.	.	ENSG00000109189	ENST00000441222;ENST00000451218;ENST00000508499	T;T;T	0.23754	1.97;1.89;1.97	5.0	2.45	0.29901	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.317275	0.26963	N	0.021614	T	0.12305	0.0299	N	0.05199	-0.095	0.52501	D	0.999954	B;B;B;B	0.19445	0.014;0.0;0.036;0.002	B;B;B;B	0.32149	0.039;0.004;0.141;0.014	T	0.12344	-1.0551	10	0.06625	T	0.88	-21.2475	11.5578	0.50759	0.0:0.0:0.4443:0.5557	.	34;138;150;143	P62068-2;P62068-4;P62068;P62068-3	.;.;UBP46_HUMAN;.	E	150;123;143	ENSP00000407818:K150E;ENSP00000390102:K123E;ENSP00000423244:K143E	ENSP00000407818:K150E	K	-	1	0	USP46	53187055	1.000000	0.71417	0.987000	0.45799	0.017000	0.09413	2.537000	0.45702	0.303000	0.22785	-0.321000	0.08615	AAA	-	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67		0.383	USP46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP46	protein_coding	OTTHUMT00000361516.2	T	NM_022832	-		53492298	-1	no_errors	ENST00000441222	ensembl	human	known	74_37	missense	SNP	1.000	C
SLFNL1	200172	genome.wustl.edu	37	1	41483596	41483596	+	Frame_Shift_Del	DEL	C	C	-			TCGA-SI-AA8C-01A-11D-A387-09	TCGA-SI-AA8C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b939bdb6-694c-4411-b89b-ee9ac7dc62a9	7a75c68f-e44f-4634-92eb-e759d0c9075c	g.chr1:41483596delC	ENST00000359345.1	-	2	3244	c.668delG	c.(667-669)cgcfs	p.R223fs	SLFNL1_ENST00000302946.8_Frame_Shift_Del_p.R223fs|SLFNL1_ENST00000372613.2_Frame_Shift_Del_p.R223fs|SLFNL1_ENST00000439569.2_Frame_Shift_Del_p.R223fs|SLFNL1_ENST00000372611.1_Frame_Shift_Del_p.R164fs|SLFNL1_ENST00000397197.2_Frame_Shift_Del_p.R223fs	NM_144990.3	NP_659427.3	Q499Z3	SLNL1_HUMAN	schlafen-like 1	223							ATP binding (GO:0005524)			endometrium(3)|large_intestine(3)|lung(2)|prostate(1)|skin(1)	10	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Breast(333;0.1)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0393)				CTCCATATTGCGGGTCTCGCT	0.662																																																	0								ENSG00000171790						41.0	35.0	37.0					1																	41483596		2203	4300	6503	SLFNL1	SO:0001589	frameshift_variant	0				HGNC	BC022037	CCDS460.1, CCDS72766.1	1p34.2	2008-02-05			ENSG00000171790	ENSG00000171790			26313	protein-coding gene	gene with protein product							Standard	NM_144990		Approved	FLJ23878	uc001cgm.2	Q499Z3	OTTHUMG00000005719	ENST00000359345.1:c.668delG	1.37:g.41483596delC	ENSP00000352299:p.Arg223fs	Somatic	0	59	0.00		0.6119782349188219	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	17	10.53	A8K8D1|Q49AG8|Q5VW72|Q5VW74|Q8N7V7|Q8TCH6|Q8WVZ8	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_ATPase_AAA-4	p.R223fs	ENST00000359345.1	37	c.668	CCDS460.1	1																																																																																			-	pfam_ATPase_AAA-4		0.662	SLFNL1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLFNL1	protein_coding	OTTHUMT00000015650.1	C	NM_144990			41483596	-1	no_errors	ENST00000302946	ensembl	human	known	74_37	frame_shift_del	DEL	0.993	-
APOL3	80833	genome.wustl.edu	37	22	36545175	36545176	+	Intron	INS	-	-	T	rs577866985|rs199746432	byFrequency	TCGA-SI-AA8C-01A-11D-A387-09	TCGA-SI-AA8C-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b939bdb6-694c-4411-b89b-ee9ac7dc62a9	7a75c68f-e44f-4634-92eb-e759d0c9075c	g.chr22:36545175_36545176insT	ENST00000349314.2	-	2	261				APOL3_ENST00000397287.2_Intron|APOL3_ENST00000397293.2_5'UTR|APOL3_ENST00000424878.2_Intron|APOL3_ENST00000487423.1_Intron|APOL3_ENST00000361710.2_Intron	NM_145640.2	NP_663615.1	O95236	APOL3_HUMAN	apolipoprotein L, 3						inflammatory response (GO:0006954)|lipoprotein metabolic process (GO:0042157)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	lipid binding (GO:0008289)|lipid transporter activity (GO:0005319)|signal transducer activity (GO:0004871)			endometrium(2)|large_intestine(1)|lung(1)|stomach(1)	5						GGAAGGGTTCGTTTTTTTTCTT	0.53														9	0.00179712	0.0	0.0029	5008	,	,		18466	0.0		0.001	False		,,,				2504	0.0061																0								ENSG00000128284		,,	7,4257		0,7,2125					,,	-2.0	0.0			52	11,8243		0,11,4116	no	intron,intron,intron	APOL3	NM_145642.2,NM_145641.2,NM_145640.2	,,	0,18,6241	A1A1,A1R,RR		0.1333,0.1642,0.1438	,,	,,		18,12500				APOL3	SO:0001627	intron_variant	0				HGNC	AF305227	CCDS13922.1, CCDS13924.1	22q13.1	2013-01-24			ENSG00000128284	ENSG00000128284		"""Apolipoproteins"""	14868	protein-coding gene	gene with protein product		607253				11374903	Standard	NM_145640		Approved	CG12-1, APOLIII	uc003aot.3	O95236	OTTHUMG00000150632	ENST00000349314.2:c.224-3528->A	22.37:g.36545183_36545183dupT		Somatic	0	61	0.00		0.6119782349188219	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	16	15.79	B1AHI4|B1AHI5|Q5U5N4|Q9BQ82|Q9BQA3	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	NULL	p.T80fs	ENST00000349314.2	37	c.239_238	CCDS13922.1	22																																																																																			-	NULL		0.530	APOL3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	APOL3	protein_coding	OTTHUMT00000319268.1	-	NM_145641			36545176	-1	no_errors	ENST00000397289	ensembl	human	known	74_37	frame_shift_ins	INS	0.000:0.001	T
NME7	29922	genome.wustl.edu	37	1	169292501	169292501	+	Silent	SNP	G	G	T	rs201299047		TCGA-SI-AA8C-01A-11D-A387-09	TCGA-SI-AA8C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b939bdb6-694c-4411-b89b-ee9ac7dc62a9	7a75c68f-e44f-4634-92eb-e759d0c9075c	g.chr1:169292501G>T	ENST00000367811.3	-	3	388	c.132C>A	c.(130-132)cgC>cgA	p.R44R	NME7_ENST00000472647.1_Silent_p.R8R|NME7_ENST00000469474.1_5'UTR|RP4-800F24.1_ENST00000432081.1_RNA	NM_013330.3	NP_037462.1	Q9Y5B8	NDK7_HUMAN	NME/NM23 family member 7	44	DM10. {ECO:0000255|PROSITE- ProRule:PRU00665}.				brain development (GO:0007420)|ciliary receptor clustering involved in smoothened signaling pathway (GO:0060830)|CTP biosynthetic process (GO:0006241)|determination of left/right symmetry (GO:0007368)|epithelial cilium movement (GO:0003351)|GTP biosynthetic process (GO:0006183)|intraciliary transport (GO:0042073)|left/right pattern formation (GO:0060972)|UTP biosynthetic process (GO:0006228)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|nucleoside diphosphate kinase activity (GO:0004550)			central_nervous_system(1)|kidney(1)|large_intestine(5)|lung(8)|skin(1)	16	all_hematologic(923;0.208)					TTAAAAAGGTGCGATGATTCT	0.318																																																	0								ENSG00000143156						146.0	155.0	152.0					1																	169292501		2203	4300	6503	NME7	SO:0001819	synonymous_variant	0			-	HGNC	AF153191	CCDS1277.1, CCDS44274.1	1q24.2	2014-07-31	2012-05-18		ENSG00000143156	ENSG00000143156			20461	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 67"""	613465	"""non-metastatic cells 7, protein expressed in (nucleoside-diphosphate kinase)"""			19852809	Standard	NM_197972		Approved	FLJ37194, NM23-H7, CFAP67	uc001gfu.3	Q9Y5B8	OTTHUMG00000034586	ENST00000367811.3:c.132C>A	1.37:g.169292501G>T		Somatic	0	40	0.00		0.6119782349188219	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	29	12.12	A8K3T6|A8MY09|B3KSW9|Q5TGZ4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Nucleoside_diP_kinase,superfamily_Nucleoside_diP_kinase,smart_Uncharacterised_DM10,smart_Nucleoside_diP_kinase,pirsf_NDK7,prints_Nucleoside_diP_kinase	p.R44	ENST00000367811.3	37	c.132	CCDS1277.1	1																																																																																			-	smart_Uncharacterised_DM10,pirsf_NDK7		0.318	NME7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NME7	protein_coding	OTTHUMT00000083688.1	G	NM_013330	-		169292501	-1	no_errors	ENST00000367811	ensembl	human	known	74_37	silent	SNP	0.000	T
TAP1	6890	genome.wustl.edu	37	6	32813255	32813255	+	3'UTR	SNP	G	G	T			TCGA-SI-AA8C-01A-11D-A387-09	TCGA-SI-AA8C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b939bdb6-694c-4411-b89b-ee9ac7dc62a9	7a75c68f-e44f-4634-92eb-e759d0c9075c	g.chr6:32813255G>T	ENST00000354258.4	-	0	2689				TAPSAR1_ENST00000453426.1_lincRNA|PSMB8_ENST00000374881.2_5'Flank|PSMB8_ENST00000395339.3_5'Flank|PSMB9_ENST00000395330.1_Intron|TAP1_ENST00000425148.2_3'UTR|PSMB8_ENST00000374882.3_5'Flank	NM_000593.5	NP_000584.2	Q03518	TAP1_HUMAN	transporter 1, ATP-binding cassette, sub-family B (MDR/TAP)						antigen processing and presentation of endogenous peptide antigen via MHC class I (GO:0019885)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytosol to ER transport (GO:0046967)|defense response (GO:0006952)|intracellular transport of viral protein in host cell (GO:0019060)|peptide transport (GO:0015833)|transmembrane transport (GO:0055085)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrion (GO:0005739)|TAP complex (GO:0042825)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|MHC class Ib protein binding (GO:0023029)|peptide antigen binding (GO:0042605)|peptide transporter activity (GO:0015197)|protein homodimerization activity (GO:0042803)|TAP1 binding (GO:0046978)|TAP2 binding (GO:0046979)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(4)|prostate(1)|skin(1)	21					Lapatinib(DB01259)	CAAATTTCAAGTAACTCATCC	0.483																																																	0								ENSG00000204261																																			TAPSAR1	SO:0001624	3_prime_UTR_variant	0			-	HGNC		CCDS4758.1	6p21.3	2014-09-17			ENSG00000168394	ENSG00000168394		"""ATP binding cassette transporters / subfamily B"""	43	protein-coding gene	gene with protein product		170260		ABCB2		1529427, 1946428	Standard	NM_000593		Approved	PSF1, RING4, D6S114E	uc003ocg.3	Q03518	OTTHUMG00000031067	ENST00000354258.4:c.*101C>A	6.37:g.32813255G>T		Somatic	0	42	0.00		0.6119782349188219	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	22	11.54	Q16149|Q96CP4	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000354258.4	37	NULL	CCDS4758.1	6																																																																																			-	-		0.483	TAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAPSAR1	protein_coding	OTTHUMT00000076087.2	G	NM_000593	-		32813255	+1	no_errors	ENST00000412095	ensembl	human	known	74_37	rna	SNP	0.000	T
COL9A3	1299	genome.wustl.edu	37	20	61448936	61448936	+	Frame_Shift_Del	DEL	C	C	-	rs544133282	byFrequency	TCGA-SI-AA8C-01A-11D-A387-09	TCGA-SI-AA8C-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b939bdb6-694c-4411-b89b-ee9ac7dc62a9	7a75c68f-e44f-4634-92eb-e759d0c9075c	g.chr20:61448936delC	ENST00000343916.3	+	2	99	c.96delC	c.(94-96)ggcfs	p.G32fs		NM_001853.3	NP_001844.3	Q14050	CO9A3_HUMAN	collagen, type IX, alpha 3	32	Triple-helical region 3 (COL3).				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|female gonad development (GO:0008585)|male gonad development (GO:0008584)	collagen type IX trimer (GO:0005594)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(1)|endometrium(3)|large_intestine(1)|lung(18)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	28	Breast(26;5.68e-08)					GACTccccggcccccccggcc	0.726																																																	0								ENSG00000092758			20,3090		1,18,1536	5.0	6.0	6.0			1.7	0.5	20		6	56,6092		5,46,3023	no	frameshift	COL9A3	NM_001853.3		6,64,4559	A1A1,A1R,RR		0.9109,0.6431,0.8209			61448936	76,9182	1774	3538	5312	COL9A3	SO:0001589	frameshift_variant	0				HGNC	AK075240	CCDS13505.1	20q13.3	2013-01-16			ENSG00000092758	ENSG00000092758		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2219	protein-coding gene	gene with protein product	"""collagen type IX proteoglycan"""	120270				8586434, 1429648	Standard	NM_001853		Approved	IDD, MED, EDM3, FLJ90759, DJ885L7.4.1	uc002ydm.3	Q14050	OTTHUMG00000032938	ENST00000343916.3:c.96delC	20.37:g.61448936delC	ENSP00000341640:p.Gly32fs	Somatic	0	21	0.00		0.6119782349188219	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	14	12.50	Q13681|Q9H4G9|Q9UPE2	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Collagen	p.G35fs	ENST00000343916.3	37	c.96	CCDS13505.1	20																																																																																			-	pfam_Collagen		0.726	COL9A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL9A3	protein_coding	OTTHUMT00000080071.2	C	NM_001853			61448936	+1	no_errors	ENST00000343916	ensembl	human	known	74_37	frame_shift_del	DEL	0.499	-
TYK2	7297	genome.wustl.edu	37	19	10477123	10477123	+	Missense_Mutation	SNP	A	A	G			TCGA-SI-AA8C-01A-11D-A387-09	TCGA-SI-AA8C-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b939bdb6-694c-4411-b89b-ee9ac7dc62a9	7a75c68f-e44f-4634-92eb-e759d0c9075c	g.chr19:10477123A>G	ENST00000525621.1	-	6	1080	c.599T>C	c.(598-600)aTc>aCc	p.I200T	TYK2_ENST00000264818.6_Missense_Mutation_p.I200T|TYK2_ENST00000524462.1_Missense_Mutation_p.I15T|TYK2_ENST00000529370.1_Missense_Mutation_p.I200T	NM_003331.4	NP_003322.3	P29597	TYK2_HUMAN	tyrosine kinase 2	200	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				cytokine-mediated signaling pathway (GO:0019221)|intracellular signal transduction (GO:0035556)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|growth hormone receptor binding (GO:0005131)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			breast(1)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(11)|kidney(6)|large_intestine(3)|lung(19)|ovary(4)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	64			OV - Ovarian serous cystadenocarcinoma(20;1.77e-09)|Epithelial(33;3.92e-06)|all cancers(31;8.95e-06)			CTCCAGGGGGATGCCATGGCG	0.607																																																	0								ENSG00000105397						94.0	86.0	89.0					19																	10477123		2203	4300	6503	TYK2	SO:0001583	missense	0			-	HGNC		CCDS12236.1	19p13.2	2014-09-17			ENSG00000105397	ENSG00000105397	2.7.10.1		12440	protein-coding gene	gene with protein product		176941				2156206	Standard	NM_003331		Approved	JTK1	uc002moc.4	P29597	OTTHUMG00000166373	ENST00000525621.1:c.599T>C	19.37:g.10477123A>G	ENSP00000431885:p.Ile200Thr	Somatic	0	46	0.00		0.6119782349188219	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	23	14.81	Q6QB10|Q96CH0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,superfamily_FERM_central,smart_Band_41_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Tyr_kinase_non-rcpt_Jak/Tyk2,pfscan_FERM_domain,pfscan_Prot_kinase_dom,prints_Tyr_kinase_non-rcpt_Jak/Tyk2,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_Tyr_kinase_non-rcpt_TYK2_N	p.I200T	ENST00000525621.1	37	c.599	CCDS12236.1	19	.	.	.	.	.	.	.	.	.	.	A	8.411	0.844139	0.16963	.	.	ENSG00000105397	ENST00000524462;ENST00000525621;ENST00000264818;ENST00000529370	T;T;T;T	0.75154	-0.91;0.95;0.95;0.95	5.15	5.15	0.70609	FERM central domain (1);Band 4.1 domain (1);FERM domain (1);	0.510102	0.15582	N	0.254823	T	0.61664	0.2365	L	0.34521	1.04	0.23260	N	0.99802	B;B	0.31769	0.339;0.061	B;B	0.24701	0.055;0.044	T	0.50224	-0.8853	10	0.21540	T	0.41	-38.9989	12.9524	0.58409	1.0:0.0:0.0:0.0	.	200;200	E9PPF2;P29597	.;TYK2_HUMAN	T	15;200;200;200	ENSP00000433203:I15T;ENSP00000431885:I200T;ENSP00000264818:I200T;ENSP00000432728:I200T	ENSP00000264818:I200T	I	-	2	0	TYK2	10338123	0.002000	0.14202	0.933000	0.37362	0.262000	0.26303	1.690000	0.37711	1.943000	0.56356	0.460000	0.39030	ATC	-	superfamily_FERM_central,smart_Band_41_domain,pirsf_Tyr_kinase_non-rcpt_Jak/Tyk2,pfscan_FERM_domain		0.607	TYK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TYK2	protein_coding	OTTHUMT00000389443.1	A		-		10477123	-1	no_errors	ENST00000264818	ensembl	human	known	74_37	missense	SNP	0.888	G
