#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
ROCK1P1	727758	genome.wustl.edu	37	18	117295	117295	+	RNA	SNP	C	C	A			TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr18:117295C>A	ENST00000608049.1	+	0	721					NR_033770.1				Rho-associated, coiled-coil containing protein kinase 1 pseudogene 1																		CTTAATTTGTCCATGTAAAGG	0.363																																																	0								ENSG00000263006																																			ROCK1P1			0			-	HGNC			18p11.32	2012-10-04			ENSG00000263006	ENSG00000263006			37832	pseudogene	pseudogene							Standard	NR_033770		Approved		uc002kke.3		OTTHUMG00000177913		18.37:g.117295C>A		Somatic	0	59	0.00		0.5093136486593635	3	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	57	25.00		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000608049.1	37	NULL		18																																																																																			-	-		0.363	ROCK1P1-003	KNOWN	basic	processed_transcript	ROCK1P1	pseudogene	OTTHUMT00000472417.1	C		-		117295	+1	no_errors	ENST00000576266	ensembl	human	known	74_37	rna	SNP	1.000	A
SMAD5	4090	genome.wustl.edu	37	5	135469745	135469746	+	Intron	DEL	TT	TT	-			TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	TT	TT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr5:135469745_135469746delTT	ENST00000514641.2	+	1	118				SMAD5_ENST00000545620.1_Intron|SMAD5_ENST00000545279.1_Intron|SMAD5-AS1_ENST00000297163.3_RNA			Q99717	SMAD5_HUMAN	SMAD family member 5						BMP signaling pathway (GO:0030509)|bone development (GO:0060348)|cardiac muscle contraction (GO:0060048)|cartilage development (GO:0051216)|cellular response to BMP stimulus (GO:0071773)|cellular response to organic cyclic compound (GO:0071407)|embryonic pattern specification (GO:0009880)|erythrocyte differentiation (GO:0030218)|germ cell development (GO:0007281)|intracellular signal transduction (GO:0035556)|Mullerian duct regression (GO:0001880)|osteoblast fate commitment (GO:0002051)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter involved in cellular response to chemical stimulus (GO:1901522)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ureteric bud development (GO:0001657)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|transcription factor complex (GO:0005667)	metal ion binding (GO:0046872)|receptor signaling protein activity (GO:0005057)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity (GO:0030618)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|large_intestine(4)|lung(3)	8			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			GGGGGGGGTGTTGCGGGGGGAG	0.48																																																	0								ENSG00000164621																																			SMAD5-AS1	SO:0001627	intron_variant	0				HGNC	U59913	CCDS75308.1	5q31	2008-02-05	2006-11-06	2004-05-26		ENSG00000113658		"""SMADs"""	6771	protein-coding gene	gene with protein product		603110	"""MAD, mothers against decapentaplegic homolog 5 (Drosophila)"", ""SMAD, mothers against DPP homolog 5 (Drosophila)"""	MADH5		8673135	Standard	NM_005903		Approved	Dwfc, JV5-1	uc003lbl.1	Q99717		ENST00000514641.2:c.118+1094TT>-	5.37:g.135469745_135469746delTT		Somatic	0	58	0.00		0.5093136486593635	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	32	8.57	O14688|Q15798|Q9UQA1	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000514641.2	37	NULL		5																																																																																			-	-		0.480	SMAD5-001	KNOWN	basic	processed_transcript	SMAD5-AS1	protein_coding	OTTHUMT00000372096.2	TT	NM_005903			135469746	-1	no_errors	ENST00000297163	ensembl	human	known	74_37	rna	DEL	0.001:0.001	-
ASTN2	23245	genome.wustl.edu	37	9	119770532	119770532	+	Missense_Mutation	SNP	C	C	A			TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr9:119770532C>A	ENST00000313400.4	-	7	1530	c.1430G>T	c.(1429-1431)aGc>aTc	p.S477I	ASTN2_ENST00000361477.3_5'UTR|ASTN2_ENST00000361209.2_Missense_Mutation_p.S426I|ASTN2_ENST00000373996.3_Missense_Mutation_p.S477I			O75129	ASTN2_HUMAN	astrotactin 2	477					negative regulation of protein localization to cell surface (GO:2000009)	cell pole (GO:0060187)|endosome (GO:0005768)|integral component of membrane (GO:0016021)				breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(21)|lung(45)|ovary(4)|pancreas(2)|prostate(2)|skin(9)|stomach(1)|urinary_tract(1)	102						CACCACGAAGCTGCTTCCTAT	0.498																																																	0								ENSG00000148219						93.0	78.0	83.0					9																	119770532		2203	4300	6503	ASTN2	SO:0001583	missense	0			-	HGNC	AF116574	CCDS6814.1, CCDS6815.1, CCDS48009.1, CCDS48009.2, CCDS55334.1	9q33	2008-02-05			ENSG00000148219	ENSG00000148219			17021	protein-coding gene	gene with protein product		612856				9734811	Standard	NM_014010		Approved	KIAA0634	uc004bjt.2	O75129	OTTHUMG00000021013	ENST00000313400.4:c.1430G>T	9.37:g.119770532C>A	ENSP00000314038:p.Ser477Ile	Somatic	0	74	0.00		0.5093136486593635	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	50	15.00	A2A2T7|A2A2T9|Q52LQ2|Q5JVX8|Q5JVX9|Q5JVY1|Q5VXG8|Q5VZX6|Q8N6P8|Q8WV47|Q96FL4|Q9UHW6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MACPF,superfamily_Fibronectin_type3,smart_MACPF	p.S477I	ENST00000313400.4	37	c.1430		9	.	.	.	.	.	.	.	.	.	.	C	17.68	3.449732	0.63290	.	.	ENSG00000148219	ENST00000313400;ENST00000373996;ENST00000373986;ENST00000361209	T;T;T;T	0.13420	2.77;2.76;2.59;2.8	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	T	0.19765	0.0475	N	0.19112	0.55	0.51482	D	0.999926	D;P;D	0.59357	0.985;0.92;0.978	P;P;P	0.56216	0.79;0.483;0.794	T	0.02813	-1.1107	9	.	.	.	-22.6992	19.5337	0.95240	0.0:1.0:0.0:0.0	.	426;477;477	O75129-2;O75129;O75129-3	.;ASTN2_HUMAN;.	I	477;477;204;426	ENSP00000314038:S477I;ENSP00000363108:S477I;ENSP00000363098:S204I;ENSP00000354504:S426I	.	S	-	2	0	ASTN2	118810353	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	5.833000	0.69349	2.602000	0.87976	0.655000	0.94253	AGC	-	NULL		0.498	ASTN2-201	KNOWN	basic	protein_coding	ASTN2	protein_coding		C	NM_014010	-		119770532	-1	no_errors	ENST00000313400	ensembl	human	known	74_37	missense	SNP	1.000	A
YBX2	51087	genome.wustl.edu	37	17	7193637	7193637	+	Frame_Shift_Del	DEL	G	G	-			TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr17:7193637delG	ENST00000007699.5	-	5	740	c.677delC	c.(676-678)ccafs	p.P227fs	YBX2_ENST00000570627.1_5'Flank	NM_015982.3	NP_057066.2	Q9Y2T7	YBOX2_HUMAN	Y box binding protein 2	227	Pro-rich.|Required for mRNA-binding.				mRNA stabilization (GO:0048255)|negative regulation of binding (GO:0051100)|negative regulation of translation (GO:0017148)|oocyte development (GO:0048599)|regulation of transcription, DNA-templated (GO:0006355)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|transcription from RNA polymerase II promoter (GO:0006366)|translational attenuation (GO:0009386)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|polysome (GO:0005844)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|lipid binding (GO:0008289)|mRNA 3'-UTR binding (GO:0003730)|ribonucleoprotein complex binding (GO:0043021)|translation regulator activity (GO:0045182)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(2)|skin(3)	12						GAAGAAGGGTGGGGGGCACCA	0.657																																																	0								ENSG00000006047						78.0	94.0	89.0					17																	7193637		2200	4286	6486	YBX2	SO:0001589	frameshift_variant	0				HGNC	AF096834	CCDS11098.1	17p13.1	2013-12-20			ENSG00000006047	ENSG00000006047			17948	protein-coding gene	gene with protein product		611447				10100484, 9780336	Standard	NM_015982		Approved	MSY2, CSDA3	uc002gfq.2	Q9Y2T7	OTTHUMG00000177992	ENST00000007699.5:c.677delC	17.37:g.7193637delG	ENSP00000007699:p.Pro227fs	Somatic	0	148	0.00		0.5093136486593635	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	144	12.73	D3DTP1|Q8N4P0	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_CSP_DNA-bd,superfamily_NA-bd_OB-fold,smart_Cold_shock_prot,prints_CSP_DNA-bd	p.P226fs	ENST00000007699.5	37	c.677	CCDS11098.1	17																																																																																			-	NULL		0.657	YBX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YBX2	protein_coding	OTTHUMT00000440172.2	G	NM_015982			7193637	-1	no_errors	ENST00000007699	ensembl	human	known	74_37	frame_shift_del	DEL	0.892	-
GP1BA	2811	genome.wustl.edu	37	17	4837184	4837184	+	Frame_Shift_Del	DEL	G	G	-			TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr17:4837184delG	ENST00000329125.5	+	2	1360	c.1285delG	c.(1285-1287)gagfs	p.E429fs		NM_000173.5	NP_000164.5	P07359	GP1BA_HUMAN	glycoprotein Ib (platelet), alpha polypeptide	429	Pro/Thr-rich.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell morphogenesis (GO:0000902)|cell surface receptor signaling pathway (GO:0007166)|fibrinolysis (GO:0042730)|platelet activation (GO:0030168)|regulation of blood coagulation (GO:0030193)|thrombin receptor signaling pathway (GO:0070493)	anchored component of external side of plasma membrane (GO:0031362)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	thrombin receptor activity (GO:0015057)			central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(5)|stomach(1)|urinary_tract(1)	20						gcccacctcagagcccgcccc	0.741																																																	0								ENSG00000185245			12,2990		2,8,1491	6.0	6.0	6.0			-5.9	0.0	17	dbSNP_129	6	51,6799		8,35,3382	no	frameshift	GP1BA	NM_000173.5		10,43,4873	A1A1,A1R,RR		0.7445,0.3997,0.6395			4837184	63,9789	1567	3584	5151	GP1BA	SO:0001589	frameshift_variant	0				HGNC		CCDS54068.1	17p13.2	2014-09-17			ENSG00000185245	ENSG00000185245		"""CD molecules"""	4439	protein-coding gene	gene with protein product		606672		GP1B		3353370	Standard	NM_000173		Approved	CD42b	uc021tnz.1	P07359	OTTHUMG00000177946	ENST00000329125.5:c.1285delG	17.37:g.4837184delG	ENSP00000329380:p.Glu429fs	Somatic	0	14	0.00		0.5093136486593635	3	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	9	25.00	E7ES66|Q14441|Q16469|Q8N1F3|Q8NG39|Q9HDC7|Q9UEK1|Q9UQS4	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Leu-rich_rpt,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.E429fs	ENST00000329125.5	37	c.1285	CCDS54068.1	17																																																																																			-	NULL		0.741	GP1BA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GP1BA	protein_coding	OTTHUMT00000439889.1	G				4837184	+1	no_errors	ENST00000329125	ensembl	human	known	74_37	frame_shift_del	DEL	0.000	-
ANP32E	81611	genome.wustl.edu	37	1	150199040	150199045	+	In_Frame_Del	DEL	TCCTCT	TCCTCT	-	rs56692627|rs28594165|rs68136184|rs28460085	byFrequency	TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	TCCTCT	TCCTCT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr1:150199040_150199045delTCCTCT	ENST00000314136.8	-	5	945_950	c.576_581delAGAGGA	c.(574-582)gaagaggag>gag	p.192_194EEE>E	ANP32E_ENST00000533654.1_In_Frame_Del_p.KR137del|ANP32E_ENST00000369114.5_Intron|ANP32E_ENST00000369115.2_In_Frame_Del_p.60_62EEE>E|ANP32E_ENST00000436748.2_In_Frame_Del_p.151_153EEE>E|ANP32E_ENST00000369119.3_In_Frame_Del_p.144_146EEE>E|ANP32E_ENST00000369116.4_In_Frame_Del_p.60_62EEE>E	NM_001136478.2|NM_001280559.1|NM_030920.3	NP_001129950.1|NP_001267488.1|NP_112182.1	Q9BTT0	AN32E_HUMAN	acidic (leucine-rich) nuclear phosphoprotein 32 family, member E	192	Asp/Glu-rich (highly acidic).				histone exchange (GO:0043486)|negative regulation of catalytic activity (GO:0043086)	cytoplasmic membrane-bounded vesicle (GO:0016023)|nucleus (GO:0005634)|Swr1 complex (GO:0000812)	histone binding (GO:0042393)|phosphatase inhibitor activity (GO:0019212)			breast(3)|endometrium(3)|lung(7)|skin(1)|urinary_tract(1)	15	Lung NSC(24;7.29e-29)|Breast(34;0.00211)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			atcctcatcctcctcttcctcttcct	0.437														1756	0.350639	0.1596	0.3559	5008	,	,		19419	0.5446		0.2753	False		,,,				2504	0.4826																0								ENSG00000143401		,,	627,3639		79,469,1585					,,	-6.5	0.0		dbSNP_130	261	1908,6340		294,1320,2510	no	coding,coding,coding	ANP32E	NM_030920.3,NM_001136479.1,NM_001136478.2	,,	373,1789,4095	A1A1,A1R,RR		23.1329,14.6976,20.2573	,,	,,		2535,9979				ANP32E	SO:0001651	inframe_deletion	0				HGNC	AK092672	CCDS946.1, CCDS44214.1, CCDS44215.1, CCDS60245.1	1q22	2008-02-05			ENSG00000143401	ENSG00000143401		"""ANP32 acidic nuclear phosphoproteins"""	16673	protein-coding gene	gene with protein product		609611				12438741	Standard	NM_030920		Approved	LANPL, MGC5350, LANP-L	uc001etw.3	Q9BTT0	OTTHUMG00000012547	ENST00000314136.8:c.576_581delAGAGGA	1.37:g.150199046_150199051delTCCTCT	ENSP00000324074:p.Glu192_Glu193del	Somatic	NA	NA	NA		0.5093136486593635	248	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B4E0I6|E9PEA6|Q5TB18|Q5TB20|Q8N1S4|Q8WWW9	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Leu-rich_rpt	p.EE193in_frame_del	ENST00000314136.8	37	c.581_576	CCDS946.1	1																																																																																			-	NULL		0.437	ANP32E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANP32E	protein_coding	OTTHUMT00000035056.1	TCCTCT	NM_030920			150199045	-1	no_errors	ENST00000314136	ensembl	human	known	74_37	in_frame_del	DEL	0.001:0.006:0.000:0.058:0.106:0.091	-
TRIM7	81786	genome.wustl.edu	37	5	180622664	180622664	+	Silent	SNP	C	C	T			TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr5:180622664C>T	ENST00000274773.7	-	7	1099	c.1038G>A	c.(1036-1038)ttG>ttA	p.L346L	TRIM7_ENST00000393319.3_Silent_p.L164L|CTC-338M12.5_ENST00000514487.1_RNA|CTC-338M12.6_ENST00000512508.1_RNA|TRIM7_ENST00000504241.1_5'UTR|CTC-338M12.6_ENST00000509080.1_RNA|CTC-338M12.5_ENST00000508877.1_RNA|CTC-338M12.6_ENST00000502812.2_RNA|TRIM7_ENST00000393315.1_Silent_p.L138L|TRIM7_ENST00000361809.3_Silent_p.L138L|TRIM7_ENST00000422067.2_Silent_p.L138L	NM_203293.1	NP_976038.1	Q9C029	TRIM7_HUMAN	tripartite motif containing 7	346	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			NS(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(6)|ovary(2)|skin(1)|stomach(1)	17	all_cancers(89;6.03e-06)|all_epithelial(37;7.1e-07)|Renal(175;0.000159)|Lung NSC(126;0.00354)|all_lung(126;0.00609)|Breast(19;0.0684)	all_cancers(40;0.000172)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_lung(500;0.0221)|all_hematologic(541;0.0433)|Lung NSC(249;0.132)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;2e-06)|Epithelial(171;1.35e-05)|OV - Ovarian serous cystadenocarcinoma(192;0.000128)|Kidney(146;0.0674)|GBM - Glioblastoma multiforme(465;0.0802)		TGTCGGGATCCAAGGTGAGCT	0.662																																					Esophageal Squamous(128;2258 2308 35507 48647)												0								ENSG00000146054						42.0	49.0	47.0					5																	180622664		2159	4170	6329	TRIM7	SO:0001819	synonymous_variant	0			-	HGNC	AF220032	CCDS4462.1, CCDS4463.1, CCDS4464.1, CCDS43414.1	5q35.3	2013-01-09	2011-01-25		ENSG00000146054	ENSG00000146054		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16278	protein-coding gene	gene with protein product	"""glycogenin-interacting protein"", ""tripartite motif protein TRIM7"""	609315	"""tripartite motif-containing 7"""			11331580	Standard	NM_203294		Approved	RNF90, GNIP	uc003mmz.1	Q9C029	OTTHUMG00000130963	ENST00000274773.7:c.1038G>A	5.37:g.180622664C>T		Somatic	0	101	0.00		0.5093136486593635	13	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	28	215	11.52	A2RUE4|D3DWR7|Q969F5|Q96F67|Q96J89|Q96J90	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl_sf,smart_Znf_RING,smart_Znf_B-box,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin,prints_Znf_B-box_chordata	p.L346	ENST00000274773.7	37	c.1038	CCDS4462.1	5																																																																																			-	superfamily_ConA-like_lec_gl_sf,smart_PRY,pfscan_B30.2/SPRY,prints_Butyrophylin		0.662	TRIM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM7	protein_coding	OTTHUMT00000253569.3	C	NM_203296	-		180622664	-1	no_errors	ENST00000274773	ensembl	human	known	74_37	silent	SNP	1.000	T
SEPHS1	22929	genome.wustl.edu	37	10	13365015	13365015	+	Missense_Mutation	SNP	C	C	T			TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr10:13365015C>T	ENST00000327347.5	-	8	1159	c.784G>A	c.(784-786)Gcc>Acc	p.A262T	SEPHS1_ENST00000537130.1_Missense_Mutation_p.A195T|SEPHS1_ENST00000545675.1_Missense_Mutation_p.A262T|SEPHS1_ENST00000378614.4_Intron	NM_001195602.1|NM_012247.4	NP_001182531.1|NP_036379.2	P49903	SPS1_HUMAN	selenophosphate synthetase 1	262					cellular protein modification process (GO:0006464)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|selenide, water dikinase activity (GO:0004756)			cervix(1)|endometrium(3)|large_intestine(3)|lung(6)|prostate(1)|skin(1)|stomach(1)	16						TCAGTGGCGGCGTGGGCATTG	0.547																																																	0								ENSG00000086475						41.0	39.0	40.0					10																	13365015		2203	4300	6503	SEPHS1	SO:0001583	missense	0			-	HGNC	BC000941	CCDS7098.1, CCDS55702.1, CCDS55703.1	10p14	2006-10-06			ENSG00000086475	ENSG00000086475			19685	protein-coding gene	gene with protein product		600902				7665581	Standard	NM_012247		Approved	SPS, SPS1	uc001imk.3	P49903	OTTHUMG00000017696	ENST00000327347.5:c.784G>A	10.37:g.13365015C>T	ENSP00000367893:p.Ala262Thr	Somatic	0	45	0.00		0.5093136486593635	81	25.23	28	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	39	13.33	B4DWK0|D3DRS9|D6PSQ9|Q5T5U8|Q5T5U9|Q9BVT4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_AIR_synth_C_dom,pfam_AIR_synth_N_dom,superfamily_AIR_synth_C_dom,superfamily_PurM_N-like,pirsf_SelD,tigrfam_SelD	p.A262T	ENST00000327347.5	37	c.784	CCDS7098.1	10	.	.	.	.	.	.	.	.	.	.	C	24.7	4.555408	0.86231	.	.	ENSG00000086475	ENST00000327347;ENST00000545675;ENST00000537130	T;T;T	0.65364	-0.15;-0.15;-0.15	5.09	5.09	0.68999	AIR synthase-related protein, C-terminal (2);	0.000000	0.85682	D	0.000000	D	0.84606	0.5509	H	0.94808	3.585	0.80722	D	1	D;D;D;D;D	0.76494	0.999;0.999;0.999;0.999;0.999	D;D;D;D;D	0.65773	0.938;0.938;0.938;0.938;0.938	D	0.89217	0.3568	10	0.87932	D	0	-9.5749	18.8485	0.92217	0.0:1.0:0.0:0.0	.	214;262;262;262;195	B4DLS1;P49903;D6PSQ9;D3DRS9;B4DWK0	.;SPS1_HUMAN;.;.;.	T	262;262;195	ENSP00000367893:A262T;ENSP00000441119:A262T;ENSP00000442768:A195T	ENSP00000367893:A262T	A	-	1	0	SEPHS1	13405021	1.000000	0.71417	0.708000	0.30435	0.324000	0.28378	7.731000	0.84895	2.517000	0.84864	0.561000	0.74099	GCC	-	pfam_AIR_synth_C_dom,superfamily_AIR_synth_C_dom,pirsf_SelD,tigrfam_SelD		0.547	SEPHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEPHS1	protein_coding	OTTHUMT00000046856.1	C	NM_012247	-		13365015	-1	no_errors	ENST00000327347	ensembl	human	known	74_37	missense	SNP	1.000	T
CATIP-AS2	103689911	genome.wustl.edu	37	2	219215889	219215890	+	RNA	INS	-	-	T			TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr2:219215889_219215890insT	ENST00000411433.1	-	0	112_113																											ttacccatcgcttttttttttc	0.361																																																	0								ENSG00000237281																																			AC021016.8			0				Clone_based_vega_gene																													2.37:g.219215899_219215899dupT		Somatic	0	65	0.00		0.5093136486593635	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	48	11.11		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000411433.1	37	NULL		2																																																																																			-	-		0.361	AC021016.8-001	KNOWN	basic	antisense	ENSG00000237281	antisense	OTTHUMT00000338557.1	-				219215890	-1	no_errors	ENST00000411433	ensembl	human	known	74_37	rna	INS	0.210:0.199	T
STK38	11329	genome.wustl.edu	37	6	36492187	36492187	+	Silent	SNP	C	C	T			TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr6:36492187C>T	ENST00000229812.7	-	4	522	c.237G>A	c.(235-237)ttG>ttA	p.L79L	RN7SL748P_ENST00000483066.2_RNA	NM_007271.2	NP_009202.1			serine/threonine kinase 38											NS(1)|endometrium(4)|large_intestine(2)|lung(9)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						TTGTTCTCTTCAAACGAAGAA	0.393																																					Colon(180;997 3561 16158)												0								ENSG00000112079						135.0	132.0	133.0					6																	36492187		2203	4300	6503	STK38	SO:0001819	synonymous_variant	0			-	HGNC		CCDS4822.1	6p21	2006-10-06			ENSG00000112079	ENSG00000112079			17847	protein-coding gene	gene with protein product		606964				7761441	Standard	NM_007271		Approved	NDR	uc003omh.3	Q15208	OTTHUMG00000014598	ENST00000229812.7:c.237G>A	6.37:g.36492187C>T		Somatic	0	76	0.00		0.5093136486593635	88	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	48	29.41		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pkinase_C,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_Prot_kinase_dom	p.L79	ENST00000229812.7	37	c.237	CCDS4822.1	6																																																																																			-	superfamily_Kinase-like_dom		0.393	STK38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STK38	protein_coding	OTTHUMT00000040346.1	C	NM_007271	-		36492187	-1	no_errors	ENST00000229812	ensembl	human	known	74_37	silent	SNP	0.997	T
TRIM7	81786	genome.wustl.edu	37	5	180622493	180622493	+	Silent	SNP	C	C	T			TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr5:180622493C>T	ENST00000274773.7	-	7	1270	c.1209G>A	c.(1207-1209)gtG>gtA	p.V403V	TRIM7_ENST00000393319.3_Silent_p.V221V|CTC-338M12.5_ENST00000514487.1_RNA|CTC-338M12.6_ENST00000512508.1_RNA|TRIM7_ENST00000504241.1_5'UTR|CTC-338M12.6_ENST00000509080.1_RNA|CTC-338M12.5_ENST00000508877.1_RNA|CTC-338M12.6_ENST00000502812.2_RNA|TRIM7_ENST00000393315.1_Silent_p.V195V|TRIM7_ENST00000361809.3_Silent_p.V195V|TRIM7_ENST00000422067.2_Silent_p.V195V	NM_203293.1	NP_976038.1	Q9C029	TRIM7_HUMAN	tripartite motif containing 7	403	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			NS(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(6)|ovary(2)|skin(1)|stomach(1)	17	all_cancers(89;6.03e-06)|all_epithelial(37;7.1e-07)|Renal(175;0.000159)|Lung NSC(126;0.00354)|all_lung(126;0.00609)|Breast(19;0.0684)	all_cancers(40;0.000172)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_lung(500;0.0221)|all_hematologic(541;0.0433)|Lung NSC(249;0.132)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;2e-06)|Epithelial(171;1.35e-05)|OV - Ovarian serous cystadenocarcinoma(192;0.000128)|Kidney(146;0.0674)|GBM - Glioblastoma multiforme(465;0.0802)		CCTTAGAGCCCACCTCCACCT	0.711																																					Esophageal Squamous(128;2258 2308 35507 48647)												0								ENSG00000146054						19.0	21.0	20.0					5																	180622493		2186	4266	6452	TRIM7	SO:0001819	synonymous_variant	0			-	HGNC	AF220032	CCDS4462.1, CCDS4463.1, CCDS4464.1, CCDS43414.1	5q35.3	2013-01-09	2011-01-25		ENSG00000146054	ENSG00000146054		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16278	protein-coding gene	gene with protein product	"""glycogenin-interacting protein"", ""tripartite motif protein TRIM7"""	609315	"""tripartite motif-containing 7"""			11331580	Standard	NM_203294		Approved	RNF90, GNIP	uc003mmz.1	Q9C029	OTTHUMG00000130963	ENST00000274773.7:c.1209G>A	5.37:g.180622493C>T		Somatic	0	37	0.00		0.5093136486593635	10	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	77	17.20	A2RUE4|D3DWR7|Q969F5|Q96F67|Q96J89|Q96J90	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl_sf,smart_Znf_RING,smart_Znf_B-box,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin,prints_Znf_B-box_chordata	p.V403	ENST00000274773.7	37	c.1209	CCDS4462.1	5																																																																																			-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,prints_Butyrophylin		0.711	TRIM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM7	protein_coding	OTTHUMT00000253569.3	C	NM_203296	-		180622493	-1	no_errors	ENST00000274773	ensembl	human	known	74_37	silent	SNP	0.998	T
SLC5A5	6528	genome.wustl.edu	37	19	17988575	17988575	+	Missense_Mutation	SNP	G	G	C			TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr19:17988575G>C	ENST00000222248.3	+	6	1089	c.742G>C	c.(742-744)Gtg>Ctg	p.V248L		NM_000453.2	NP_000444.1	Q92911	SC5A5_HUMAN	solute carrier family 5 (sodium/iodide cotransporter), member 5	248					cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|iodide transport (GO:0015705)|ion transport (GO:0006811)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	iodide transmembrane transporter activity (GO:0015111)|sodium:iodide symporter activity (GO:0008507)			NS(2)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(6)|lung(13)|ovary(1)|prostate(1)|skin(3)	31						CTGGACTTTTGTGGTGGGTGG	0.597																																					Melanoma(65;1008 1708 7910 46650)												0								ENSG00000105641						171.0	137.0	149.0					19																	17988575		2203	4300	6503	SLC5A5	SO:0001583	missense	0			-	HGNC		CCDS12368.1	19p13.11	2013-07-19	2013-07-19		ENSG00000105641	ENSG00000105641		"""Solute carriers"""	11040	protein-coding gene	gene with protein product		601843	"""solute carrier family 5 (sodium iodide symporter), member 5"""			9231811	Standard	NM_000453		Approved	NIS	uc002nhr.4	Q92911		ENST00000222248.3:c.742G>C	19.37:g.17988575G>C	ENSP00000222248:p.Val248Leu	Somatic	0	59	0.00		0.5093136486593635	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	40	20.00	O43702|Q2M335|Q9NYB6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	p.V248L	ENST00000222248.3	37	c.742	CCDS12368.1	19	.	.	.	.	.	.	.	.	.	.	G	4.523	0.097121	0.08681	.	.	ENSG00000105641	ENST00000222248	D	0.87650	-2.28	5.3	-2.61	0.06171	.	1.424930	0.04308	N	0.348503	T	0.74891	0.3776	N	0.17764	0.52	0.09310	N	0.999999	B	0.11235	0.004	B	0.17979	0.02	T	0.59059	-0.7525	10	0.15066	T	0.55	.	5.735	0.18061	0.2962:0.2387:0.4651:0.0	.	248	Q92911	SC5A5_HUMAN	L	248	ENSP00000222248:V248L	ENSP00000222248:V248L	V	+	1	0	SLC5A5	17849575	0.000000	0.05858	0.018000	0.16275	0.134000	0.20937	-0.874000	0.04210	-0.229000	0.09854	-0.355000	0.07637	GTG	-	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr		0.597	SLC5A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC5A5	protein_coding	OTTHUMT00000466690.1	G		-		17988575	+1	no_errors	ENST00000222248	ensembl	human	known	74_37	missense	SNP	0.001	C
OTOP3	347741	genome.wustl.edu	37	17	72937678	72937678	+	Silent	SNP	A	A	G			TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr17:72937678A>G	ENST00000328801.4	+	2	264	c.264A>G	c.(262-264)caA>caG	p.Q88Q		NM_178233.1	NP_839947.1	Q7RTS5	OTOP3_HUMAN	otopetrin 3	88						integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23	all_lung(278;0.151)|Lung NSC(278;0.185)					AGGCTGGACAACTCTTCTCGG	0.642																																																	0								ENSG00000182938						34.0	37.0	36.0					17																	72937678		2203	4295	6498	OTOP3	SO:0001819	synonymous_variant	0			-	HGNC	BK000568	CCDS11709.1	17q25	2004-01-19				ENSG00000182938			19658	protein-coding gene	gene with protein product		607828				12651873	Standard	NM_178233		Approved		uc010wrr.3	Q7RTS5		ENST00000328801.4:c.264A>G	17.37:g.72937678A>G		Somatic	0	33	0.00		0.5093136486593635	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	31	20.51		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Otopetrin	p.Q88	ENST00000328801.4	37	c.264	CCDS11709.1	17																																																																																			-	NULL		0.642	OTOP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OTOP3	protein_coding	OTTHUMT00000445308.1	A	NM_178233	-		72937678	+1	no_errors	ENST00000328801	ensembl	human	known	74_37	silent	SNP	1.000	G
MAGEE2	139599	genome.wustl.edu	37	X	75003967	75003967	+	Missense_Mutation	SNP	G	G	A			TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chrX:75003967G>A	ENST00000373359.2	-	1	1112	c.920C>T	c.(919-921)tCg>tTg	p.S307L		NM_138703.4	NP_619648.1	Q8TD90	MAGE2_HUMAN	melanoma antigen family E, 2	307										autonomic_ganglia(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(17)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						AGTGTCCTCCGACCAGAACTC	0.463																																																	0								ENSG00000186675						82.0	72.0	75.0					X																	75003967		2203	4300	6503	MAGEE2	SO:0001583	missense	0			-	HGNC	AF490509	CCDS14431.1	Xq13	2008-02-05			ENSG00000186675	ENSG00000186675			24935	protein-coding gene	gene with protein product		300760				11454705	Standard	NM_138703		Approved	HCA3	uc004ecj.2	Q8TD90	OTTHUMG00000021870	ENST00000373359.2:c.920C>T	X.37:g.75003967G>A	ENSP00000362457:p.Ser307Leu	Somatic	0	56	0.00		0.5093136486593635	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	29	25.64	Q5JSI5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MAGE,pfscan_MAGE	p.S307L	ENST00000373359.2	37	c.920	CCDS14431.1	X	.	.	.	.	.	.	.	.	.	.	G	14.46	2.543477	0.45280	.	.	ENSG00000186675	ENST00000373359	T	0.03982	3.74	2.76	2.76	0.32466	.	.	.	.	.	T	0.06050	0.0157	N	0.08118	0	0.33365	D	0.572874	D	0.69078	0.997	D	0.67725	0.953	T	0.43893	-0.9363	9	0.20046	T	0.44	.	8.1526	0.31150	0.0:0.0:1.0:0.0	.	307	Q8TD90	MAGE2_HUMAN	L	307	ENSP00000362457:S307L	ENSP00000362457:S307L	S	-	2	0	MAGEE2	74920692	1.000000	0.71417	0.999000	0.59377	0.661000	0.39034	1.318000	0.33643	1.638000	0.50547	0.422000	0.28245	TCG	-	NULL		0.463	MAGEE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEE2	protein_coding	OTTHUMT00000057288.1	G	NM_138703	-		75003967	-1	no_errors	ENST00000373359	ensembl	human	known	74_37	missense	SNP	0.999	A
ROCK1P1	727758	genome.wustl.edu	37	18	117194	117194	+	RNA	SNP	C	C	G			TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr18:117194C>G	ENST00000608049.1	+	0	620					NR_033770.1				Rho-associated, coiled-coil containing protein kinase 1 pseudogene 1																		TGTGCCAAACCTCTCTGGCAT	0.423																																																	0								ENSG00000263006																																			ROCK1P1			0			-	HGNC			18p11.32	2012-10-04			ENSG00000263006	ENSG00000263006			37832	pseudogene	pseudogene							Standard	NR_033770		Approved		uc002kke.3		OTTHUMG00000177913		18.37:g.117194C>G		Somatic	0	88	0.00		0.5093136486593635	12	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	71	21.98		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000608049.1	37	NULL		18																																																																																			-	-		0.423	ROCK1P1-003	KNOWN	basic	processed_transcript	ROCK1P1	pseudogene	OTTHUMT00000472417.1	C		-		117194	+1	no_errors	ENST00000576266	ensembl	human	known	74_37	rna	SNP	1.000	G
TRNAU1AP	54952	genome.wustl.edu	37	1	28906964	28906964	+	IGR	SNP	C	C	G			TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr1:28906964C>G	ENST00000373830.3	+	0	1793				SNORD99_ENST00000408612.1_RNA|SNHG12_ENST00000384584.1_RNA|SNHG12_ENST00000488745.1_RNA|SNHG12_ENST00000384342.1_RNA|SNHG12_ENST00000384581.1_RNA|SNHG12_ENST00000475441.1_RNA|SNHG12_ENST00000531126.1_RNA|SNHG12_ENST00000483436.1_RNA	NM_017846.4	NP_060316.1	Q9NX07	TSAP1_HUMAN	tRNA selenocysteine 1 associated protein 1						selenocysteine incorporation (GO:0001514)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|large_intestine(2)|ovary(1)|pancreas(1)|skin(1)	8						TTCCAGGTTGCTCTTGCATGC	0.522																																																	0								ENSG00000197989						60.0	57.0	58.0					1																	28906964		876	1991	2867	SNHG12	SO:0001628	intergenic_variant	0			-	HGNC		CCDS324.1	1p35.3	2013-02-12	2008-09-05	2008-09-05	ENSG00000180098	ENSG00000180098		"""RNA binding motif (RRM) containing"""	30813	protein-coding gene	gene with protein product			"""tRNA selenocysteine associated protein 1"""	TRSPAP1		10606267, 16230358	Standard	NM_017846		Approved	SECP43, FLJ20503	uc001bqi.3	Q9NX07	OTTHUMG00000003653		1.37:g.28906964C>G		Somatic	0	56	0.00		0.5093136486593635	3	25.00	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	47	16.07	Q86SU7	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000373830.3	37	NULL	CCDS324.1	1																																																																																			-	-		0.522	TRNAU1AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNHG12	protein_coding	OTTHUMT00000010346.1	C	NM_017846	-		28906964	-1	no_errors	ENST00000384584	ensembl	human	known	74_37	rna	SNP	0.812	G
ZNF692	55657	genome.wustl.edu	37	1	249150493	249150493	+	Missense_Mutation	SNP	G	G	T			TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr1:249150493G>T	ENST00000306601.4	-	6	819	c.653C>A	c.(652-654)cCa>cAa	p.P218Q	ZNF692_ENST00000451251.1_Missense_Mutation_p.P223Q|ZNF692_ENST00000427146.1_Intron|ZNF692_ENST00000468455.1_5'UTR|AL672294.1_ENST00000417047.1_RNA|ZNF692_ENST00000366471.3_Intron|ZNF692_ENST00000366469.5_Missense_Mutation_p.P218Q	NM_017865.3	NP_060335.2	Q9BU19	ZN692_HUMAN	zinc finger protein 692	218					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|large_intestine(6)|lung(7)|stomach(1)	17	all_cancers(71;3.33e-06)|all_epithelial(71;2.41e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.0458)|Lung NSC(105;0.0494)|Melanoma(84;0.199)	all_cancers(173;0.19)	OV - Ovarian serous cystadenocarcinoma(106;0.00805)			TTGCTCATCTGGGGAGGAGCT	0.547																																																	0								ENSG00000171163						167.0	140.0	149.0					1																	249150493		2203	4300	6503	ZNF692	SO:0001583	missense	0			-	HGNC	BC002948	CCDS31127.1, CCDS44348.1, CCDS53487.1	1q44	2013-01-08			ENSG00000171163	ENSG00000171163		"""Zinc fingers, C2H2-type"""	26049	protein-coding gene	gene with protein product						12477932	Standard	NM_001136036		Approved	FLJ20531, Zfp692	uc001ifc.2	Q9BU19	OTTHUMG00000040423	ENST00000306601.4:c.653C>A	1.37:g.249150493G>T	ENSP00000305483:p.Pro218Gln	Somatic	0	44	0.00		0.5093136486593635	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	22	15.38	B4DXZ0|Q5SRA5|Q5SRA6|Q9HBC9|Q9NW93|Q9NWY6|Q9UF97	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P223Q	ENST00000306601.4	37	c.668	CCDS31127.1	1	.	.	.	.	.	.	.	.	.	.	G	17.77	3.472059	0.63737	.	.	ENSG00000171163	ENST00000306601;ENST00000366469;ENST00000451251	T;T;T	0.08008	3.15;3.17;3.14	4.72	4.72	0.59763	.	0.368123	0.23943	N	0.043026	T	0.13372	0.0324	M	0.63428	1.95	0.80722	D	1	P;P	0.48911	0.917;0.917	P;P	0.47470	0.548;0.548	T	0.08229	-1.0732	10	0.14656	T	0.56	-3.5913	13.3852	0.60791	0.0:0.0:1.0:0.0	.	223;218	B4DXZ0;Q9BU19	.;ZN692_HUMAN	Q	218;218;223	ENSP00000305483:P218Q;ENSP00000355425:P218Q;ENSP00000391200:P223Q	ENSP00000305483:P218Q	P	-	2	0	ZNF692	247117116	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	2.815000	0.48018	2.626000	0.88956	0.462000	0.41574	CCA	-	NULL		0.547	ZNF692-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF692	protein_coding	OTTHUMT00000097298.1	G	NM_017865	-		249150493	-1	no_errors	ENST00000451251	ensembl	human	known	74_37	missense	SNP	1.000	T
LINC00910	100130581	genome.wustl.edu	37	17	41466210	41466210	+	lincRNA	SNP	T	T	G	rs4792984	byFrequency	TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr17:41466210T>G	ENST00000606190.1	-	0	0									long intergenic non-protein coding RNA 910																		CCGTGTCCTGTGCTGTGTAGG	0.647																																																	0								ENSG00000188825																																			LINC00910			0			-	HGNC	BC035366		17q21.31	2013-05-21			ENSG00000188825	ENSG00000188825		"""Long non-coding RNAs"""	44361	non-coding RNA	RNA, long non-coding							Standard	NR_027412		Approved				OTTHUMG00000180880		17.37:g.41466210T>G		Somatic	0	15	0.00		0.5093136486593635	42	28.81	17	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	31	20.51		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000606190.1	37	NULL		17																																																																																			-	-		0.647	LINC00910-201	KNOWN	basic	snRNA	LINC00910	lincRNA		T	NR_027412	rs4792984		41466210	-1	no_errors	ENST00000586231	ensembl	human	known	74_37	rna	SNP	0.004	G
GPA33	10223	genome.wustl.edu	37	1	167025040	167025040	+	Silent	SNP	C	C	T	rs149640714	byFrequency	TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr1:167025040C>T	ENST00000367868.3	-	5	961	c.618G>A	c.(616-618)tcG>tcA	p.S206S	RP11-102C16.3_ENST00000417644.1_RNA|GPA33_ENST00000527955.1_5'UTR	NM_005814.1	NP_005805.1	Q99795	GPA33_HUMAN	glycoprotein A33 (transmembrane)	206	Ig-like C2-type.					extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)			endometrium(4)|large_intestine(1)|lung(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	15						TGTAGTAACCCGATGTGTCTG	0.567																																																	0								ENSG00000143167	C		0,4406		0,0,2203	152.0	124.0	133.0		618	-9.8	0.0	1	dbSNP_134	133	6,8594	5.0+/-18.6	0,6,4294	no	coding-synonymous	GPA33	NM_005814.1		0,6,6497	TT,TC,CC		0.0698,0.0,0.0461		206/320	167025040	6,13000	2203	4300	6503	GPA33	SO:0001819	synonymous_variant	0			-	HGNC	U79725	CCDS1258.1	1q24.1	2013-01-29			ENSG00000143167	ENSG00000143167		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	4445	protein-coding gene	gene with protein product		602171				9012807, 9245713	Standard	NM_005814		Approved	A33	uc001gea.1	Q99795	OTTHUMG00000034435	ENST00000367868.3:c.618G>A	1.37:g.167025040C>T		Somatic	0	57	0.00		0.5093136486593635	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	60	20.00	Q5VZP6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	p.S206	ENST00000367868.3	37	c.618	CCDS1258.1	1																																																																																			-	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.567	GPA33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPA33	protein_coding	OTTHUMT00000083245.1	C	NM_005814	rs149640714		167025040	-1	no_errors	ENST00000367868	ensembl	human	known	74_37	silent	SNP	0.003	T
FAM47A	158724	genome.wustl.edu	37	X	34148570	34148570	+	Missense_Mutation	SNP	C	C	T			TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chrX:34148570C>T	ENST00000346193.3	-	1	1877	c.1826G>A	c.(1825-1827)cGt>cAt	p.R609H		NM_203408.3	NP_981953.2	Q5JRC9	FA47A_HUMAN	family with sequence similarity 47, member A	609										NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(5)|large_intestine(17)|lung(44)|ovary(5)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	97						GAAGAATTCACGGAGTTTTTC	0.448																																																	0								ENSG00000185448						80.0	74.0	76.0					X																	34148570		2123	4251	6374	FAM47A	SO:0001583	missense	0			-	HGNC	BC026171	CCDS43926.1	Xp21.1	2004-08-09			ENSG00000185448	ENSG00000185448			29962	protein-coding gene	gene with protein product	"""similar to hypothetical protein FLJ35782"""					12477932	Standard	NM_203408		Approved	MGC27003	uc004ddg.3	Q5JRC9	OTTHUMG00000021339	ENST00000346193.3:c.1826G>A	X.37:g.34148570C>T	ENSP00000345029:p.Arg609His	Somatic	0	59	0.00		0.5093136486593635	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	63	10.00	A8K8I9|Q8TAA0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.R609H	ENST00000346193.3	37	c.1826	CCDS43926.1	X	.	.	.	.	.	.	.	.	.	.	c	4.779	0.144838	0.09134	.	.	ENSG00000185448	ENST00000346193	T	0.42900	0.96	1.8	-3.61	0.04556	.	.	.	.	.	T	0.38295	0.1035	L	0.45137	1.4	0.09310	N	1	D	0.69078	0.997	P	0.57283	0.817	T	0.17319	-1.0373	9	0.34782	T	0.22	.	0.214	0.00159	0.207:0.2581:0.2045:0.3304	.	609	Q5JRC9	FA47A_HUMAN	H	609	ENSP00000345029:R609H	ENSP00000345029:R609H	R	-	2	0	FAM47A	34058491	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	-0.460000	0.06720	-1.312000	0.02306	-1.168000	0.01747	CGT	-	NULL		0.448	FAM47A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM47A	protein_coding	OTTHUMT00000056205.1	C	NM_203408	-		34148570	-1	no_errors	ENST00000346193	ensembl	human	known	74_37	missense	SNP	0.000	T
UNC5D	137970	genome.wustl.edu	37	8	35608292	35608292	+	Missense_Mutation	SNP	G	G	T			TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr8:35608292G>T	ENST00000404895.2	+	13	2456	c.2128G>T	c.(2128-2130)Gtt>Ttt	p.V710F	UNC5D_ENST00000287272.2_Missense_Mutation_p.V641F|UNC5D_ENST00000449677.1_Missense_Mutation_p.V286F|UNC5D_ENST00000420357.1_Missense_Mutation_p.V643F|UNC5D_ENST00000416672.1_Missense_Mutation_p.V715F|UNC5D_ENST00000453357.2_Missense_Mutation_p.V705F	NM_080872.2	NP_543148.2	Q6UXZ4	UNC5D_HUMAN	unc-5 homolog D (C. elegans)	710	Interaction with DCC. {ECO:0000250}.				apoptotic process (GO:0006915)|axon guidance (GO:0007411)|pyramidal neuron differentiation (GO:0021859)|regulation of neuron migration (GO:2001222)|signal transduction (GO:0007165)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)				NS(2)|breast(7)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(56)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(6)|urinary_tract(2)	112				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)		CAACTTGAGAGTTTACTGTGT	0.438																																																	0								ENSG00000156687						204.0	177.0	186.0					8																	35608292		2203	4300	6503	UNC5D	SO:0001583	missense	0			-	HGNC	AB055056	CCDS6093.2	8p12	2013-01-11			ENSG00000156687	ENSG00000156687		"""Immunoglobulin superfamily / I-set domain containing"""	18634	protein-coding gene	gene with protein product						18402767	Standard	NM_080872		Approved	KIAA1777, Unc5h4	uc003xjr.2	Q6UXZ4	OTTHUMG00000157145	ENST00000404895.2:c.2128G>T	8.37:g.35608292G>T	ENSP00000385143:p.Val710Phe	Somatic	0	54	0.00		0.5093136486593635	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.16	Q8WYP7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ZU5,pfam_Ig_I-set,pfam_Thrombospondin_1_rpt,pfam_Death_domain,pfam_Immunoglobulin,superfamily_DEATH-like_dom,superfamily_Thrombospondin_1_rpt,smart_Ig_sub,smart_Ig_sub2,smart_Thrombospondin_1_rpt,smart_ZU5,smart_Death_domain,pfscan_Thrombospondin_1_rpt,pfscan_ZU5,pfscan_Ig-like_dom	p.V710F	ENST00000404895.2	37	c.2128	CCDS6093.2	8	.	.	.	.	.	.	.	.	.	.	G	29.8	5.034003	0.93575	.	.	ENSG00000156687	ENST00000404895;ENST00000420357;ENST00000287272;ENST00000416672;ENST00000453357;ENST00000449677	T;T;T;T;T;T	0.68624	-0.31;0.1;0.07;-0.3;-0.34;1.54	5.9	5.9	0.94986	.	0.000000	0.85682	D	0.000000	D	0.84456	0.5476	M	0.82193	2.58	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.87578	0.997;0.998;0.996	D	0.85467	0.1170	10	0.87932	D	0	-20.2235	20.2822	0.98520	0.0:0.0:1.0:0.0	.	286;705;710	E9PDS8;Q6UXZ4-2;Q6UXZ4	.;.;UNC5D_HUMAN	F	710;643;641;715;705;286	ENSP00000385143:V710F;ENSP00000392739:V643F;ENSP00000287272:V641F;ENSP00000412652:V715F;ENSP00000394303:V705F;ENSP00000397211:V286F	ENSP00000287272:V641F	V	+	1	0	UNC5D	35727834	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.476000	0.97823	2.806000	0.96561	0.655000	0.94253	GTT	-	NULL		0.438	UNC5D-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	UNC5D	protein_coding	OTTHUMT00000347586.2	G		-		35608292	+1	no_errors	ENST00000404895	ensembl	human	known	74_37	missense	SNP	1.000	T
THRA	7067	genome.wustl.edu	37	17	38240109	38240109	+	Nonsense_Mutation	SNP	C	C	T			TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr17:38240109C>T	ENST00000264637.4	+	5	824	c.244C>T	c.(244-246)Cag>Tag	p.Q82*	THRA_ENST00000394121.4_Nonsense_Mutation_p.Q82*|THRA_ENST00000584985.1_Nonsense_Mutation_p.Q82*|THRA_ENST00000546243.1_Nonsense_Mutation_p.Q82*|THRA_ENST00000450525.2_Nonsense_Mutation_p.Q82*	NM_003250.5	NP_003241.2	P10827	THA_HUMAN	thyroid hormone receptor, alpha	82					cartilage condensation (GO:0001502)|cytoplasmic sequestering of transcription factor (GO:0042994)|erythrocyte differentiation (GO:0030218)|female courtship behavior (GO:0008050)|gene expression (GO:0010467)|hormone-mediated signaling pathway (GO:0009755)|learning or memory (GO:0007611)|negative regulation of DNA-templated transcription, initiation (GO:2000143)|negative regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0017055)|negative regulation of transcription, DNA-templated (GO:0045892)|ossification (GO:0001503)|positive regulation of female receptivity (GO:0045925)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of heart contraction (GO:0008016)|regulation of lipid catabolic process (GO:0050994)|regulation of myeloid cell apoptotic process (GO:0033032)|regulation of thyroid hormone mediated signaling pathway (GO:0002155)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cold (GO:0009409)|thyroid gland development (GO:0030878)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|Type I pneumocyte differentiation (GO:0060509)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|protein domain specific binding (GO:0019904)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|steroid receptor RNA activator RNA binding (GO:0002153)|TBP-class protein binding (GO:0017025)|thyroid hormone binding (GO:0070324)|thyroid hormone receptor activity (GO:0004887)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(3)|large_intestine(2)|lung(4)|prostate(1)	11	Colorectal(19;0.000442)	Myeloproliferative disorder(1115;0.0255)			Dextrothyroxine(DB00509)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)	CCGCACAATCCAGAAGAACCT	0.537																																																	0								ENSG00000126351						150.0	132.0	138.0					17																	38240109		2203	4300	6503	THRA	SO:0001587	stop_gained	0			-	HGNC	J03239	CCDS11360.1, CCDS42316.1, CCDS58546.1	17q21.1	2013-01-16	2011-05-19		ENSG00000126351	ENSG00000126351		"""Nuclear hormone receptors"""	11796	protein-coding gene	gene with protein product		190120	"""thyroid hormone receptor, alpha (avian erythroblastic leukemia viral (v-erb-a) oncogene homolog)"", ""thyroid hormone receptor, alpha (erythroblastic leukemia viral (v-erb-a) oncogene homolog, avian)"""	THRA1, THRA2, ERBA1		6323162, 6589608	Standard	NM_003250		Approved	EAR-7.1/EAR-7.2, THRA3, AR7, ERBA, NR1A1	uc002htw.3	P10827	OTTHUMG00000133332	ENST00000264637.4:c.244C>T	17.37:g.38240109C>T	ENSP00000264637:p.Gln82*	Somatic	0	40	0.00		0.5093136486593635	33	46.77	29	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	29	38.30	A8K3B5|P21205|Q8N6A1|Q96H73	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_hrmn_rcpt,pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_ThyrH_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt	p.Q82*	ENST00000264637.4	37	c.244	CCDS11360.1	17	.	.	.	.	.	.	.	.	.	.	C	40	8.514649	0.98843	.	.	ENSG00000126351	ENST00000394121;ENST00000264637;ENST00000450525;ENST00000546243	.	.	.	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	18.5805	0.91168	0.0:1.0:0.0:0.0	.	.	.	.	X	82	.	ENSP00000264637:Q82X	Q	+	1	0	THRA	35493635	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.754000	0.85163	2.477000	0.83638	0.430000	0.28490	CAG	-	pfam_Znf_hrmn_rcpt,smart_Znf_hrmn_rcpt,pfscan_Znf_hrmn_rcpt,prints_ThyrH_rcpt,prints_Znf_hrmn_rcpt		0.537	THRA-001	KNOWN	basic|CCDS	protein_coding	THRA	protein_coding	OTTHUMT00000257160.2	C		-		38240109	+1	no_errors	ENST00000264637	ensembl	human	known	74_37	nonsense	SNP	1.000	T
RP11-439I14.2	0	genome.wustl.edu	37	16	64770704	64770705	+	lincRNA	INS	-	-	CCAGTGATGGTCACCT	rs200421189|rs71143515|rs377231404|rs145408521|rs140029302	byFrequency	TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr16:64770704_64770705insCCAGTGATGGTCACCT	ENST00000564293.1	+	0	453_454																											TGTCACCACTGCCACCTTGTTC	0.371														3288	0.65655	0.8434	0.5144	5008	,	,		21531	0.6052		0.5537	False		,,,				2504	0.6636																0								ENSG00000259859																																			RP11-439I14.2			0				Clone_based_vega_gene																													16.37:g.64770704_64770705insCCAGTGATGGTCACCT		Somatic	NA	NA	NA		0.5093136486593635	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000564293.1	37	NULL		16																																																																																			-	-		0.371	RP11-439I14.2-001	KNOWN	basic	lincRNA	ENSG00000259859	lincRNA	OTTHUMT00000422725.1	-				64770705	+1	no_errors	ENST00000564293	ensembl	human	known	74_37	rna	INS	0.009:0.006	CCAGTGATGGTCACCT
RIN2	54453	genome.wustl.edu	37	20	19915798	19915798	+	Missense_Mutation	SNP	C	C	G			TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr20:19915798C>G	ENST00000255006.6	+	3	409	c.260C>G	c.(259-261)aCa>aGa	p.T87R	RIN2_ENST00000440354.2_Missense_Mutation_p.T38R|RIN2_ENST00000484638.1_3'UTR	NM_001242581.1|NM_018993.3	NP_001229510.1|NP_061866.1	Q8WYP3	RIN2_HUMAN	Ras and Rab interactor 2	38					endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of catalytic activity (GO:0050790)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	GTPase activator activity (GO:0005096)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|small GTPase regulator activity (GO:0005083)			autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|urinary_tract(2)	27						ATGGTGCGGACAGATGTCAAC	0.512																																																	0								ENSG00000132669						74.0	74.0	74.0					20																	19915798		2013	4171	6184	RIN2	SO:0001583	missense	0			-	HGNC	AB060339	CCDS56182.1	20p11.22	2008-07-30			ENSG00000132669	ENSG00000132669			18750	protein-coding gene	gene with protein product		610222				11733506, 1849280, 16423831	Standard	NM_018993		Approved	RASSF4	uc002wro.2	Q8WYP3	OTTHUMG00000031996	ENST00000255006.6:c.260C>G	20.37:g.19915798C>G	ENSP00000255006:p.Thr87Arg	Somatic	0	82	0.00		0.5093136486593635	14	30.00	6	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	64	8.57	Q00425|Q5TFT8|Q9BQL3|Q9H071	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_VPS9,pfam_Ras-assoc,smart_VPS9_subgr,smart_Ras-assoc,pfscan_Ras-assoc,pfscan_SH2,pfscan_VPS9	p.T87R	ENST00000255006.6	37	c.260	CCDS56182.1	20	.	.	.	.	.	.	.	.	.	.	C	23.8	4.454044	0.84209	.	.	ENSG00000132669	ENST00000255006;ENST00000440354	T;T	0.06933	3.24;3.24	5.71	5.71	0.89125	.	0.187274	0.42053	D	0.000774	T	0.20333	0.0489	L	0.40543	1.245	0.40079	D	0.976113	D;P	0.69078	0.997;0.856	D;P	0.64144	0.922;0.483	T	0.00444	-1.1735	9	.	.	.	-6.7861	18.6285	0.91350	0.0:1.0:0.0:0.0	.	38;38	E7EPJ1;Q8WYP3	.;RIN2_HUMAN	R	87;38	ENSP00000255006:T87R;ENSP00000391239:T38R	.	T	+	2	0	RIN2	19863798	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.842000	0.48230	2.703000	0.92315	0.655000	0.94253	ACA	-	NULL		0.512	RIN2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	RIN2	protein_coding	OTTHUMT00000078212.1	C		-		19915798	+1	no_errors	ENST00000255006	ensembl	human	known	74_37	missense	SNP	1.000	G
C1orf87	127795	genome.wustl.edu	37	1	60491105	60491105	+	Silent	SNP	G	G	A	rs147855127		TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr1:60491105G>A	ENST00000371201.3	-	8	1202	c.1095C>T	c.(1093-1095)aaC>aaT	p.N365N	C1orf87_ENST00000450089.2_Silent_p.N136N	NM_152377.2	NP_689590.1	Q8N0U7	CA087_HUMAN	chromosome 1 open reading frame 87	365							calcium ion binding (GO:0005509)			breast(2)|endometrium(2)|large_intestine(6)|lung(19)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	33						AATCTTGATGGTTAAGCAATG	0.363													G|||	1	0.000199681	0.0	0.0	5008	,	,		18341	0.0		0.001	False		,,,				2504	0.0				NSCLC(75;811 1386 4923 13371 51772)												0								ENSG00000162598	G		1,4405	2.1+/-5.4	0,1,2202	119.0	122.0	121.0		1095	0.7	0.9	1	dbSNP_134	121	29,8571	20.4+/-63.3	0,29,4271	no	coding-synonymous	C1orf87	NM_152377.2		0,30,6473	AA,AG,GG		0.3372,0.0227,0.2307		365/547	60491105	30,12976	2203	4300	6503	C1orf87	SO:0001819	synonymous_variant	0			GMAF=0.0005	HGNC	AK124828	CCDS614.1	1p32.1	2014-04-03			ENSG00000162598	ENSG00000162598			28547	protein-coding gene	gene with protein product	"""carcinoma-related EF-hand protein"""					12477932	Standard	NM_152377		Approved	MGC34837, CREF	uc001czs.2	Q8N0U7	OTTHUMG00000008992	ENST00000371201.3:c.1095C>T	1.37:g.60491105G>A		Somatic	0	52	0.00		0.5093136486593635	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	29	47.27	Q6ZU07|Q8IVS0	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.N365	ENST00000371201.3	37	c.1095	CCDS614.1	1																																																																																			-	NULL		0.363	C1orf87-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf87	protein_coding	OTTHUMT00000024943.1	G	NM_152377	rs147855127		60491105	-1	no_errors	ENST00000371201	ensembl	human	known	74_37	silent	SNP	0.928	A
FAM174B	400451	genome.wustl.edu	37	15	93198679	93198684	+	In_Frame_Del	DEL	TGGAGC	TGGAGC	-	rs66488707|rs111725167|rs68056278	byFrequency	TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	TGGAGC	TGGAGC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr15:93198679_93198684delTGGAGC	ENST00000327355.5	-	1	504_509	c.206_211delGCTCCA	c.(205-213)agctccaac>aac	p.SS69del	FAM174B_ENST00000555696.1_5'Flank|FAM174B_ENST00000555748.1_5'Flank	NM_207446.2	NP_997329.2	Q3ZCQ3	F174B_HUMAN	family with sequence similarity 174, member B	69						integral component of membrane (GO:0016021)				endometrium(2)|lung(1)	3						CCACTGCTGTTGGAGCTGGAGCTGCC	0.714														4884	0.97524	0.9092	0.9942	5008	,	,		6551	1.0		1.0	False		,,,				2504	1.0																0								ENSG00000185442			1931,417		927,77,170						2.2	1.0		dbSNP_130	8	5234,70		2614,6,32	no	coding	FAM174B	NM_207446.2		3541,83,202	A1A1,A1R,RR		1.3198,17.7598,6.3643				7165,487				FAM174B	SO:0001651	inframe_deletion	0				HGNC		CCDS45355.1	15q26.1	2012-10-03			ENSG00000185442	ENSG00000185442			34339	protein-coding gene	gene with protein product							Standard	NM_207446		Approved	LOC400451, MGC102891	uc010boe.3	Q3ZCQ3	OTTHUMG00000171744	ENST00000327355.5:c.206_211delGCTCCA	15.37:g.93198685_93198690delTGGAGC	ENSP00000329040:p.Ser69_Ser70del	Somatic	NA	NA	NA		0.5093136486593635	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q3ZCR9|Q8NBH7	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_DUF1180	p.SS69in_frame_del	ENST00000327355.5	37	c.211_206	CCDS45355.1	15																																																																																			-	pfam_DUF1180		0.714	FAM174B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM174B	protein_coding	OTTHUMT00000414931.1	TGGAGC	NM_207446			93198684	-1	no_errors	ENST00000327355	ensembl	human	known	74_37	in_frame_del	DEL	0.997:0.996:0.995:0.994:0.994:0.995	-
FMN2	56776	genome.wustl.edu	37	1	240255905	240255905	+	Missense_Mutation	SNP	G	G	T			TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr1:240255905G>T	ENST00000319653.9	+	1	726	c.496G>T	c.(496-498)Gca>Tca	p.A166S		NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	166					cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			TGTGGAAACTGCAGCAGGGGC	0.622																																																	0								ENSG00000155816						51.0	54.0	53.0					1																	240255905		2203	4300	6503	FMN2	SO:0001583	missense	0			-	HGNC	AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.496G>T	1.37:g.240255905G>T	ENSP00000318884:p.Ala166Ser	Somatic	0	104	0.00		0.5093136486593635	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	130	12.75	B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_FH2_Formin,pfam_Formin_homology_1,smart_FH2_Formin,pfscan_DEP_dom	p.A166S	ENST00000319653.9	37	c.496	CCDS31069.2	1	.	.	.	.	.	.	.	.	.	.	G	10.25	1.299647	0.23650	.	.	ENSG00000155816	ENST00000319653	T	0.31247	1.5	4.35	3.35	0.38373	.	0.611150	0.15147	N	0.277944	T	0.26484	0.0647	L	0.47716	1.5	0.39453	D	0.967444	B	0.25312	0.123	B	0.21360	0.034	T	0.10222	-1.0639	10	0.34782	T	0.22	.	11.5928	0.50955	0.0:0.0:0.8222:0.1778	.	166	Q9NZ56	FMN2_HUMAN	S	166	ENSP00000318884:A166S	ENSP00000318884:A166S	A	+	1	0	FMN2	238322528	.	.	0.118000	0.21660	0.584000	0.36387	.	.	2.125000	0.65367	0.313000	0.20887	GCA	-	NULL		0.622	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMN2	protein_coding	OTTHUMT00000096217.2	G	XM_371352	-		240255905	+1	no_errors	ENST00000319653	ensembl	human	known	74_37	missense	SNP	0.029	T
TRPM6	140803	genome.wustl.edu	37	9	77343190	77343190	+	Missense_Mutation	SNP	T	T	C			TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr9:77343190T>C	ENST00000360774.1	-	38	6137	c.5900A>G	c.(5899-5901)cAt>cGt	p.H1967R	TRPM6_ENST00000451710.3_Missense_Mutation_p.H1971R|TRPM6_ENST00000361255.3_Missense_Mutation_p.H1962R|TRPM6_ENST00000449912.2_Missense_Mutation_p.H1962R|TRPM6_ENST00000376871.3_Missense_Mutation_p.H804R|TRPM6_ENST00000376872.3_Missense_Mutation_p.H922R	NM_017662.4	NP_060132.3	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel, subfamily M, member 6	1967	Alpha-type protein kinase. {ECO:0000255|PROSITE-ProRule:PRU00501}.				calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|liver(1)|lung(53)|ovary(1)|prostate(7)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	126						GGAGTTACAATGATGTTTTGC	0.398																																																	0								ENSG00000119121						119.0	105.0	110.0					9																	77343190		2203	4300	6503	TRPM6	SO:0001583	missense	0			-	HGNC	AK026281	CCDS6647.1, CCDS55318.1, CCDS55319.1	9q21.13	2011-12-14	2003-12-02		ENSG00000119121	ENSG00000119121		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17995	protein-coding gene	gene with protein product		607009	"""hypomagnesemia, secondary hypocalcemia"""	HOMG, HSH		10021370, 12032570, 16382100	Standard	NM_017662		Approved	CHAK2, FLJ22628	uc004ajk.1	Q9BX84	OTTHUMG00000020027	ENST00000360774.1:c.5900A>G	9.37:g.77343190T>C	ENSP00000354006:p.His1967Arg	Somatic	0	90	0.00		0.5093136486593635	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	54	28.95	Q6VPR8|Q6VPR9|Q6VPS0|Q6VPS1|Q6VPS2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MHCK_EF2_kinase,pfam_Ion_trans_dom,superfamily_Kinase-like_dom,smart_MHCK_EF2_kinase,pfscan_MHCK_EF2_kinase	p.H1971R	ENST00000360774.1	37	c.5912	CCDS6647.1	9	.	.	.	.	.	.	.	.	.	.	t	0.015	-1.568619	0.00895	.	.	ENSG00000119121	ENST00000360774;ENST00000451710;ENST00000376872;ENST00000376871;ENST00000449912;ENST00000361255;ENST00000376870	T;T;T;T;T;T	0.12569	2.67;2.67;2.67;2.67;2.67;2.67	5.95	4.12	0.48240	MHCK/EF2 kinase (3);Protein kinase-like domain (1);	0.522986	0.23782	N	0.044602	T	0.05135	0.0137	N	0.01640	-0.785	0.80722	D	1	B;B;B;B;B;B	0.18013	0.004;0.009;0.025;0.0;0.0;0.0	B;B;B;B;B;B	0.17098	0.001;0.017;0.017;0.001;0.0;0.0	T	0.31081	-0.9956	10	0.11485	T	0.65	.	14.0254	0.64582	0.0:0.852:0.0:0.148	.	514;800;918;1967;1962;1962	Q9BX84-7;Q9BX84-6;Q9BX84-5;Q9BX84;Q9BX84-3;Q9BX84-2	.;.;.;TRPM6_HUMAN;.;.	R	1967;1971;922;804;1962;1962;513	ENSP00000354006:H1967R;ENSP00000407341:H1971R;ENSP00000366068:H922R;ENSP00000366067:H804R;ENSP00000396672:H1962R;ENSP00000354962:H1962R	ENSP00000354006:H1967R	H	-	2	0	TRPM6	76533010	1.000000	0.71417	1.000000	0.80357	0.851000	0.48451	1.156000	0.31712	0.853000	0.35312	-0.976000	0.02587	CAT	-	pfam_MHCK_EF2_kinase,superfamily_Kinase-like_dom,smart_MHCK_EF2_kinase,pfscan_MHCK_EF2_kinase		0.398	TRPM6-001	KNOWN	basic|CCDS	protein_coding	TRPM6	protein_coding	OTTHUMT00000052693.1	T	NM_017662	-		77343190	-1	no_errors	ENST00000451710	ensembl	human	known	74_37	missense	SNP	1.000	C
EFCAB2	84288	genome.wustl.edu	37	1	245133623	245133624	+	Frame_Shift_Ins	INS	-	-	CCTCC	rs145835471|rs78699431|rs373891984	byFrequency	TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr1:245133623_245133624insCCTCC	ENST00000366522.2	+	1	340_341	c.199_200insCCTCC	c.(199-201)tccfs	p.S67fs	EFCAB2_ENST00000447569.2_5'Flank|RP11-156E8.1_ENST00000607453.1_Frame_Shift_Ins_p.R252fs|EFCAB2_ENST00000366523.1_Intron			Q5VUJ9	EFCB2_HUMAN	EF-hand calcium binding domain 2	67							calcium ion binding (GO:0005509)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)|stomach(2)	13	all_cancers(71;2.93e-06)|all_epithelial(71;2.13e-05)|all_lung(81;0.0337)|Lung NSC(105;0.0472)|Ovarian(71;0.0584)|Breast(184;0.0716)|all_neural(11;0.0982)		OV - Ovarian serous cystadenocarcinoma(106;0.015)			GAGCGGCCCCTCCTCCAGGCCA	0.743														2490	0.497204	0.2315	0.415	5008	,	,		8334	0.7272		0.5517	False		,,,				2504	0.6217																0								ENSG00000203666																																			EFCAB2	SO:0001589	frameshift_variant	0				HGNC	AB209286	CCDS31082.1, CCDS44341.1	1q44	2014-07-18			ENSG00000203666	ENSG00000203666		"""EF-hand domain containing"""	28166	protein-coding gene	gene with protein product	"""dynein regulatory complex subunit 8"""					23427265	Standard	NM_032328		Approved	MGC12458, DRC8, CFAP200	uc001ibc.2	Q5VUJ9	OTTHUMG00000040474	ENST00000366522.2:c.200_204dupCCTCC	1.37:g.245133624_245133628dupCCTCC	ENSP00000355479:p.Ser67fs	Somatic	NA	NA	NA		0.5093136486593635	8	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B4DZE9|Q59G23|Q9BS36	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	smart_EF_hand_dom,pfscan_EF_hand_dom	p.R69fs	ENST00000366522.2	37	c.199_200		1																																																																																			-	NULL		0.743	EFCAB2-001	KNOWN	basic	protein_coding	EFCAB2	protein_coding	OTTHUMT00000097407.2	-				245133624	+1	no_errors	ENST00000366522	ensembl	human	known	74_37	frame_shift_ins	INS	0.000:0.000	CCTCC
RARB	5915	genome.wustl.edu	37	3	25622051	25622051	+	Silent	SNP	C	C	T			TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr3:25622051C>T	ENST00000404969.1	+	5	645	c.645C>T	c.(643-645)gaC>gaT	p.D215D	RARB_ENST00000437042.2_Silent_p.D96D|RARB_ENST00000462272.1_3'UTR|RARB_ENST00000458646.1_Silent_p.D96D|RARB_ENST00000330688.4_Silent_p.D208D			P10826	RARB_HUMAN	retinoic acid receptor, beta	215	Ligand-binding.				embryonic digestive tract development (GO:0048566)|embryonic eye morphogenesis (GO:0048048)|embryonic hindlimb morphogenesis (GO:0035116)|gene expression (GO:0010467)|glandular epithelial cell development (GO:0002068)|growth plate cartilage development (GO:0003417)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cartilage development (GO:0061037)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract septum morphogenesis (GO:0003148)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell proliferation (GO:0008284)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of myelination (GO:0031641)|retinal pigment epithelium development (GO:0003406)|signal transduction (GO:0007165)|striatum development (GO:0021756)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ureteric bud development (GO:0001657)|ventricular cardiac muscle cell differentiation (GO:0055012)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|drug binding (GO:0008144)|retinoic acid receptor activity (GO:0003708)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			breast(3)|kidney(1)|large_intestine(10)|lung(11)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	28					Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Tamibarotene(DB04942)|Tazarotene(DB00799)	CCAGTGCTGACCATCGAGTCC	0.473																																																	0								ENSG00000077092						93.0	86.0	88.0					3																	25622051		2203	4300	6503	RARB	SO:0001819	synonymous_variant	0			-	HGNC	Y00291	CCDS2642.1, CCDS46775.1	3p24	2013-01-16			ENSG00000077092	ENSG00000077092		"""Nuclear hormone receptors"""	9865	protein-coding gene	gene with protein product		180220					Standard	NM_016152		Approved	HAP, NR1B2, RRB2	uc003cdh.3	P10826	OTTHUMG00000130480	ENST00000404969.1:c.645C>T	3.37:g.25622051C>T		Somatic	0	71	0.00		0.5093136486593635	3	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	73	13.10	P12891|Q00989|Q15298|Q9UN48	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_hrmn_rcpt,pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Retinoic_acid_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt,prints_Nuc_orph_rcpt,prints_Retinoid-X_rcpt/HNF4	p.D215	ENST00000404969.1	37	c.645		3																																																																																			-	superfamily_Nucl_hormone_rcpt_ligand-bd,prints_Retinoic_acid_rcpt		0.473	RARB-201	KNOWN	basic	protein_coding	RARB	protein_coding		C	NM_000965, NM_016152	-		25622051	+1	no_errors	ENST00000404969	ensembl	human	known	74_37	silent	SNP	0.997	T
HEATR2	54919	genome.wustl.edu	37	7	796579	796579	+	Missense_Mutation	SNP	C	C	A			TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr7:796579C>A	ENST00000297440.6	+	6	1438	c.1418C>A	c.(1417-1419)gCa>gAa	p.A473E	HEATR2_ENST00000313147.5_Missense_Mutation_p.A473E	NM_017802.3	NP_060272.3	Q86Y56	HEAT2_HUMAN	HEAT repeat containing 2	473						cytoplasm (GO:0005737)				breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(3)|ovary(2)|prostate(4)|skin(1)	22		Ovarian(82;0.0112)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0182)|Epithelial(4;5.48e-17)|OV - Ovarian serous cystadenocarcinoma(56;1.95e-16)|all cancers(6;2.98e-14)		CCGCACCTGGCAGCCATCGCC	0.647																																																	0								ENSG00000164818						32.0	36.0	35.0					7																	796579		2202	4300	6502	HEATR2	SO:0001583	missense	0			-	HGNC	AL832914, AK000404, NM_017802, AK056233	CCDS34580.1	7p22.3	2014-05-06	2006-05-19		ENSG00000164818	ENSG00000164818			26013	protein-coding gene	gene with protein product		614864				23040496	Standard	NM_017802		Approved	FLJ20397, FLJ31671, FLJ39381, FLJ25564, CILD18	uc010krz.1	Q86Y56	OTTHUMG00000151416	ENST00000297440.6:c.1418C>A	7.37:g.796579C>A	ENSP00000297440:p.Ala473Glu	Somatic	0	17	0.00		0.5093136486593635	25	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	13	27.78	Q69YL1|Q96FI9|Q9NX75	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_HEAT,superfamily_ARM-type_fold,pfscan_HEAT_type_2	p.A473E	ENST00000297440.6	37	c.1418	CCDS34580.1	7	.	.	.	.	.	.	.	.	.	.	C	0.005	-2.164113	0.00318	.	.	ENSG00000164818	ENST00000297440;ENST00000313147;ENST00000537862	T;T	0.64085	-0.08;-0.08	5.49	-2.01	0.07410	Armadillo-like helical (1);Armadillo-type fold (1);	1.126930	0.06449	N	0.727322	T	0.37019	0.0988	N	0.14661	0.345	0.09310	N	1	B;B	0.14438	0.01;0.006	B;B	0.12837	0.003;0.008	T	0.29610	-1.0006	10	0.02654	T	1	-14.4175	7.5438	0.27755	0.1898:0.5691:0.0602:0.1809	.	473;219	Q86Y56;F5H8D4	HEAT2_HUMAN;.	E	473;473;219	ENSP00000297440:A473E;ENSP00000321451:A473E	ENSP00000297440:A473E	A	+	2	0	HEATR2	763105	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.074000	0.14662	-0.578000	0.05959	-1.114000	0.02060	GCA	-	superfamily_ARM-type_fold		0.647	HEATR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEATR2	protein_coding	OTTHUMT00000322542.1	C	NM_017802	-		796579	+1	no_errors	ENST00000297440	ensembl	human	known	74_37	missense	SNP	0.000	A
MALAT1	378938	genome.wustl.edu	37	11	65271779	65271780	+	lincRNA	INS	-	-	T	rs113635851|rs36002528		TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr11:65271779_65271780insT	ENST00000534336.1	+	0	6547_6548					NR_002819.2		Q9UHZ2	MALAT_HUMAN	metastasis associated lung adenocarcinoma transcript 1 (non-protein coding)																		CTTGTTGTAGCTTTTTTTTTTT	0.431																																																	0								ENSG00000251562																																			MALAT1			0				HGNC	AF001540		11q13.1	2013-12-11	2007-11-20		ENSG00000251562	ENSG00000251562		"""Long non-coding RNAs"", ""-"""	29665	non-coding RNA	RNA, long non-coding	"""metastasis associated in lung adenocarcinoma transcript 1"", ""non-protein coding RNA 47"", ""hepcarcin"", ""nuclear enriched abundant transcript 2"", ""nuclear paraspeckle assembly transcript 2 (non-protein coding)"", ""long intergenic non-protein coding RNA 47"""	607924				12970751, 22560368	Standard	NR_002819		Approved	PRO1073, MALAT-1, NCRNA00047, HCN, NEAT2, LINC00047, mascRNA	uc010roh.3	Q9UHZ2	OTTHUMG00000166322		11.37:g.65271790_65271790dupT		Somatic	0	22	0.00		0.5093136486593635	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	29	12.12		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000534336.1	37	NULL		11																																																																																			-	-		0.431	MALAT1-001	KNOWN	basic	lincRNA	MALAT1	lincRNA	OTTHUMT00000389143.1	-	NR_002819			65271780	+1	no_errors	ENST00000534336	ensembl	human	known	74_37	rna	INS	0.994:0.994	T
C1QBP	708	genome.wustl.edu	37	17	5336015	5336016	+	IGR	INS	-	-	A	rs553032511		TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr17:5336015_5336016insA	ENST00000225698.4	-	0	1169				RPAIN_ENST00000536255.2_3'UTR|RPAIN_ENST00000381209.3_3'UTR|RPAIN_ENST00000381208.5_3'UTR|CTC-524C5.2_ENST00000575890.1_RNA	NM_001212.3	NP_001203.1	Q07021	C1QBP_HUMAN	complement component 1, q subcomponent binding protein						apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|complement activation, classical pathway (GO:0006958)|immune response (GO:0006955)|innate immune response (GO:0045087)|mature ribosome assembly (GO:0042256)|mRNA processing (GO:0006397)|negative regulation of defense response to virus (GO:0050687)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of MDA-5 signaling pathway (GO:0039534)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|negative regulation of RIG-I signaling pathway (GO:0039536)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of dendritic cell chemotaxis (GO:2000510)|positive regulation of mitochondrial translation (GO:0070131)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of trophoblast cell migration (GO:1901165)|regulation of complement activation (GO:0030449)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|membrane (GO:0016020)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	adrenergic receptor binding (GO:0031690)|complement component C1q binding (GO:0001849)|hyaluronic acid binding (GO:0005540)|kininogen binding (GO:0030984)|mitochondrial ribosome binding (GO:0097177)|mRNA binding (GO:0003729)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			lung(2)|ovary(1)	3					Hyaluronan(DB08818)	CAATACTGAAGAAAAAAAAACT	0.366																																																	0								ENSG00000263272																																			CTC-524C5.2	SO:0001628	intergenic_variant	0				Clone_based_vega_gene	X75913	CCDS11071.1	17p13.3	2009-05-07				ENSG00000108561			1243	protein-coding gene	gene with protein product	"""C1q globular domain-binding protein"", ""hyaluronan-binding protein 1"", ""splicing factor SF2-associated protein"""	601269		HABP1		8567680, 8195709	Standard	NM_001212		Approved	gC1Q-R, gC1qR, p32, SF2p32	uc002gby.1	Q07021			17.37:g.5336024_5336024dupA		Somatic	0	20	0.00		0.5093136486593635	38	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	23	11.54	Q2HXR8|Q9NNY8	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000225698.4	37	NULL	CCDS11071.1	17																																																																																			-	-		0.366	C1QBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000263272	protein_coding	OTTHUMT00000439388.1	-	NM_001212			5336016	-1	no_errors	ENST00000575890	ensembl	human	known	74_37	rna	INS	0.046:0.076	A
FBN3	84467	genome.wustl.edu	37	19	8146270	8146270	+	Silent	SNP	C	C	T			TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr19:8146270C>T	ENST00000600128.1	-	58	7722	c.7308G>A	c.(7306-7308)ctG>ctA	p.L2436L	FBN3_ENST00000601739.1_Silent_p.L2436L|FBN3_ENST00000270509.2_Silent_p.L2436L			Q75N90	FBN3_HUMAN	fibrillin 3	2436	EGF-like 39; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.					proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(9)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(15)|lung(53)|ovary(7)|pancreas(2)|prostate(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	132						CCTCCTCCAGCAGGTAGCCTC	0.582																																																	0								ENSG00000142449						84.0	76.0	78.0					19																	8146270		2203	4300	6503	FBN3	SO:0001819	synonymous_variant	0			-	HGNC		CCDS12196.1	19p13	2008-02-05							18794	protein-coding gene	gene with protein product		608529					Standard	NM_032447		Approved		uc002mjf.3	Q75N90		ENST00000600128.1:c.7308G>A	19.37:g.8146270C>T		Somatic	0	58	0.00		0.5093136486593635	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	55	14.06	Q75N91|Q75N92|Q75N93|Q86SJ5|Q96JP8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_EGF-like_Ca-bd_dom,pfam_TB_dom,pfam_EG-like_dom,superfamily_TB_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pirsf_FBN,pfscan_EG-like_dom	p.L2436	ENST00000600128.1	37	c.7308	CCDS12196.1	19																																																																																			-	pfam_EGF-like_Ca-bd_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pirsf_FBN		0.582	FBN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN3	protein_coding	OTTHUMT00000461428.2	C	NM_032447	-		8146270	-1	no_errors	ENST00000270509	ensembl	human	known	74_37	silent	SNP	0.997	T
NTSR1	4923	genome.wustl.edu	37	20	61340977	61340977	+	Missense_Mutation	SNP	G	G	T			TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr20:61340977G>T	ENST00000370501.3	+	1	789	c.418G>T	c.(418-420)Ggc>Tgc	p.G140C		NM_002531.2	NP_002522.2	P30989	NTR1_HUMAN	neurotensin receptor 1 (high affinity)	140					adult locomotory behavior (GO:0008344)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of apoptotic process (GO:0043066)|neuropeptide signaling pathway (GO:0007218)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	G-protein coupled neurotensin receptor activity (GO:0016492)|G-protein coupled receptor activity (GO:0004930)	p.G140S(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(16)|prostate(1)|skin(3)	27	Breast(26;3.65e-08)		BRCA - Breast invasive adenocarcinoma(19;3.63e-06)			CGGCGACGCCGGCTGCCGCGG	0.687																																					GBM(37;400 780 6403 19663 35669)												1	Substitution - Missense(1)	prostate(1)						ENSG00000101188						39.0	45.0	43.0					20																	61340977		2201	4292	6493	NTSR1	SO:0001583	missense	0			-	HGNC		CCDS13502.1	20q13	2012-08-08			ENSG00000101188	ENSG00000101188		"""GPCR / Class A : Neurotensin receptors"""	8039	protein-coding gene	gene with protein product		162651				8075503	Standard	NM_002531		Approved	NTR	uc002ydf.3	P30989	OTTHUMG00000032932	ENST00000370501.3:c.418G>T	20.37:g.61340977G>T	ENSP00000359532:p.Gly140Cys	Somatic	0	29	0.00		0.5093136486593635	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	32	27.27	Q9H4H1|Q9H4T5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfscan_GPCR_Rhodpsn_7TM,prints_NT1_rcpt,prints_GPCR_Rhodpsn,prints_NT_rcpt	p.G140C	ENST00000370501.3	37	c.418	CCDS13502.1	20	.	.	.	.	.	.	.	.	.	.	G	18.27	3.586717	0.66105	.	.	ENSG00000101188	ENST00000370501	T	0.41065	1.01	5.15	3.18	0.36537	GPCR, rhodopsin-like superfamily (1);	0.819987	0.11088	N	0.601122	T	0.56171	0.1967	M	0.83603	2.65	0.31071	N	0.713045	P	0.48230	0.907	P	0.52343	0.696	T	0.56733	-0.7930	10	0.45353	T	0.12	-14.5784	7.7106	0.28675	0.1525:0.1363:0.7112:0.0	.	140	P30989	NTR1_HUMAN	C	140	ENSP00000359532:G140C	ENSP00000359532:G140C	G	+	1	0	NTSR1	60811422	0.859000	0.29813	0.247000	0.24249	0.802000	0.45316	4.009000	0.57110	0.554000	0.29061	0.561000	0.74099	GGC	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfscan_GPCR_Rhodpsn_7TM,prints_NT_rcpt		0.687	NTSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NTSR1	protein_coding	OTTHUMT00000080061.1	G		-		61340977	+1	no_errors	ENST00000370501	ensembl	human	known	74_37	missense	SNP	0.820	T
SLC8A3	6547	genome.wustl.edu	37	14	70512750	70512750	+	Missense_Mutation	SNP	C	C	T			TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr14:70512750C>T	ENST00000381269.2	-	8	3451	c.2698G>A	c.(2698-2700)Gcc>Acc	p.A900T	SLC8A3_ENST00000394330.2_Missense_Mutation_p.A257T|SLC8A3_ENST00000528359.1_Missense_Mutation_p.A898T|SLC8A3_ENST00000356921.2_Missense_Mutation_p.A894T|SLC8A3_ENST00000216568.7_Missense_Mutation_p.A271T|SLC8A3_ENST00000534137.1_Missense_Mutation_p.A897T|SLC8A3_ENST00000357887.3_Missense_Mutation_p.A898T	NM_058240.2|NM_183002.1	NP_489479.1|NP_892114.1	P57103	NAC3_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 3	900					blood coagulation (GO:0007596)|calcium ion export from cell (GO:1990034)|calcium ion import into cell (GO:1990035)|calcium ion transport into cytosol (GO:0060402)|cell communication (GO:0007154)|cellular response to cAMP (GO:0071320)|hematopoietic progenitor cell differentiation (GO:0002244)|ion transport (GO:0006811)|telencephalon development (GO:0021537)|transmembrane transport (GO:0055085)	dendritic spine (GO:0043197)|integral component of membrane (GO:0016021)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	calcium:sodium antiporter activity (GO:0005432)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(12)|lung(18)|ovary(2)|pancreas(2)|prostate(3)|skin(6)	54				BRCA - Breast invasive adenocarcinoma(234;0.0079)|all cancers(60;0.0102)|OV - Ovarian serous cystadenocarcinoma(108;0.0555)		CATGTTGTGGCGAGCTTGCAG	0.562											OREG0022773	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000100678						22.0	24.0	23.0					14																	70512750		2203	4299	6502	SLC8A3	SO:0001583	missense	0			-	HGNC	AJ304852	CCDS9799.1, CCDS9800.1, CCDS35498.1, CCDS41967.1, CCDS45131.1, CCDS53904.1	14q24.1	2013-05-22	2008-09-02		ENSG00000100678	ENSG00000100678		"""Solute carriers"""	11070	protein-coding gene	gene with protein product		607991				8798769	Standard	XM_005268017		Approved	NCX3	uc001xly.3	P57103	OTTHUMG00000152342	ENST00000381269.2:c.2698G>A	14.37:g.70512750C>T	ENSP00000370669:p.Ala900Thr	Somatic	0	32	0.00	1122	0.5093136486593635	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	32	27.27	Q5K3P6|Q5K3P7|Q8IUE9|Q8IUF0|Q8NFI7|Q96QG1|Q96QG2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_NaCa_Exmemb,pfam_Calx_beta,smart_Calx_beta,prints_Na_Ca_Ex,tigrfam_Na_Ca_Ex	p.A900T	ENST00000381269.2	37	c.2698	CCDS35498.1	14	.	.	.	.	.	.	.	.	.	.	C	24.4	4.528729	0.85706	.	.	ENSG00000100678	ENST00000356921;ENST00000381269;ENST00000357887;ENST00000216568;ENST00000394330;ENST00000534137;ENST00000528359	T;T;T;T;T;T;T	0.63744	-0.06;-0.06;-0.06;-0.06;-0.06;-0.06;-0.06	5.68	5.68	0.88126	Sodium/calcium exchanger membrane region (1);	0.317042	0.33631	N	0.004714	T	0.78509	0.4294	M	0.68593	2.085	0.53005	D	0.999965	D;D;D;D;P	0.89917	0.99;0.996;0.999;1.0;0.806	P;P;D;D;B	0.81914	0.635;0.809;0.993;0.995;0.41	T	0.75731	-0.3215	10	0.38643	T	0.18	.	19.7943	0.96472	0.0:1.0:0.0:0.0	.	894;900;898;897;271	P57103-2;P57103;Q96QG2;Q96QG1;Q5K3P6	.;NAC3_HUMAN;.;.;.	T	894;900;898;271;257;897;898	ENSP00000349392:A894T;ENSP00000370669:A900T;ENSP00000350560:A898T;ENSP00000216568:A271T;ENSP00000377863:A257T;ENSP00000436688:A897T;ENSP00000433531:A898T	ENSP00000216568:A271T	A	-	1	0	SLC8A3	69582503	0.935000	0.31712	0.958000	0.39756	0.825000	0.46686	2.005000	0.40864	2.678000	0.91216	0.555000	0.69702	GCC	-	pfam_NaCa_Exmemb,tigrfam_Na_Ca_Ex		0.562	SLC8A3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC8A3	protein_coding	OTTHUMT00000390736.1	C		-		70512750	-1	no_errors	ENST00000381269	ensembl	human	known	74_37	missense	SNP	0.994	T
TOLLIP	54472	genome.wustl.edu	37	11	1311571	1311571	+	Silent	SNP	C	C	T			TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr11:1311571C>T	ENST00000317204.6	-	3	375	c.252G>A	c.(250-252)gcG>gcA	p.A84A	TOLLIP_ENST00000528719.1_5'UTR|TOLLIP_ENST00000263646.7_Silent_p.A56A|TOLLIP_ENST00000525159.1_Intron|TOLLIP_ENST00000527886.1_Silent_p.A15A|TOLLIP_ENST00000542915.1_Silent_p.A34A|TOLLIP_ENST00000527938.1_Intron	NM_019009.3	NP_061882.2	Q9H0E2	TOLIP_HUMAN	toll interacting protein	84	C2.				autophagy (GO:0006914)|cell-cell signaling (GO:0007267)|epithelial cell differentiation (GO:0030855)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|leukocyte activation (GO:0045321)|phosphorylation (GO:0016310)|positive regulation of protein sumoylation (GO:0033235)|protein localization to endosome (GO:0036010)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|interleukin-1 receptor complex (GO:0045323)|interleukin-18 receptor complex (GO:0045092)|nuclear body (GO:0016604)|perinuclear region of cytoplasm (GO:0048471)	kinase binding (GO:0019900)|signal transducer activity (GO:0004871)|Toll-like receptor binding (GO:0035325)			large_intestine(1)|lung(4)|upper_aerodigestive_tract(1)	6		all_cancers(49;7.62e-05)|Breast(177;0.00257)|all_epithelial(84;0.0027)|Ovarian(85;0.0256)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		BRCA - Breast invasive adenocarcinoma(625;0.00152)|Lung(200;0.09)|LUSC - Lung squamous cell carcinoma(625;0.107)		TCTCGTACACCGCGTAGCCCA	0.587																																																	0								ENSG00000078902						107.0	92.0	97.0					11																	1311571		2198	4298	6496	TOLLIP	SO:0001819	synonymous_variant	0			-	HGNC	AJ242972	CCDS7723.1	11p	2008-02-05			ENSG00000078902	ENSG00000078902			16476	protein-coding gene	gene with protein product		606277				9426216, 10854325	Standard	NM_019009		Approved	IL-1RAcPIP	uc001lte.3	Q9H0E2	OTTHUMG00000133333	ENST00000317204.6:c.252G>A	11.37:g.1311571C>T		Somatic	0	68	0.00		0.5093136486593635	53	46.46	46	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	33	13.16	B3KXC6|Q9H9E6|Q9UJ69	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_CUE,pfam_C2_dom,superfamily_C2_dom,superfamily_UBA-like,smart_C2_dom,smart_CUE,pfscan_CUE	p.A84	ENST00000317204.6	37	c.252	CCDS7723.1	11																																																																																			-	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom		0.587	TOLLIP-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	TOLLIP	protein_coding	OTTHUMT00000257162.2	C	NM_019009	-		1311571	-1	no_errors	ENST00000317204	ensembl	human	known	74_37	silent	SNP	0.001	T
RTN4	57142	genome.wustl.edu	37	2	55254362	55254363	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	CT	CT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr2:55254362_55254363delCT	ENST00000337526.6	-	3	1115_1116	c.872_873delAG	c.(871-873)gagfs	p.E291fs	RTN4_ENST00000394611.2_Frame_Shift_Del_p.E85fs|RTN4_ENST00000402434.2_Intron|RTN4_ENST00000405240.1_Frame_Shift_Del_p.E85fs|RTN4_ENST00000357732.4_Intron|RTN4_ENST00000317610.7_Intron|RTN4_ENST00000357376.3_Frame_Shift_Del_p.E85fs|RTN4_ENST00000404909.1_Frame_Shift_Del_p.E85fs|RTN4_ENST00000354474.6_Splice_Site_p.Q59fs	NM_020532.4	NP_065393.1	Q9NQC3	RTN4_HUMAN	reticulon 4	291					angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|axonal fasciculation (GO:0007413)|cardiac epithelial to mesenchymal transition (GO:0060317)|cerebral cortex radial glia guided migration (GO:0021801)|endoplasmic reticulum tubular network organization (GO:0071786)|negative regulation of axon extension (GO:0030517)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell growth (GO:0030308)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of apoptotic process (GO:0042981)|regulation of axonogenesis (GO:0050770)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of cell migration (GO:0030334)	cell projection (GO:0042995)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of endoplasmic reticulum membrane (GO:0030176)|intracellular (GO:0005622)|neuronal cell body (GO:0043025)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(11)|lung(9)|ovary(2)|prostate(1)|skin(1)|stomach(1)	36						ATTCTGAAAACTCTGTTAAATC	0.381																																																	0								ENSG00000115310																																			RTN4	SO:0001589	frameshift_variant	0				HGNC	AF087901	CCDS1851.1, CCDS1852.1, CCDS42683.1, CCDS42684.1, CCDS42685.1	2p14-p13	2008-05-23			ENSG00000115310	ENSG00000115310			14085	protein-coding gene	gene with protein product		604475				10667797, 10773680	Standard	NM_020532		Approved	NSP-CL, KIAA0886, NOGO, ASY	uc002rye.3	Q9NQC3	OTTHUMG00000129337	ENST00000337526.6:c.872_873delAG	2.37:g.55254364_55254365delCT	ENSP00000337838:p.Glu291fs	Somatic	0	61	0.00		0.5093136486593635	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	56	18.84	O94962|Q7L7Q5|Q7L7Q6|Q7L7Q8|Q8IUA4|Q96B16|Q9BXG5|Q9H212|Q9H3I3|Q9UQ42|Q9Y293|Q9Y2Y7|Q9Y5U6	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Reticulon,pfscan_Reticulon	p.E291fs	ENST00000337526.6	37	c.873_872	CCDS42684.1	2																																																																																			-	NULL		0.381	RTN4-001	KNOWN	basic|CCDS	protein_coding	RTN4	protein_coding	OTTHUMT00000251484.1	CT				55254363	-1	no_errors	ENST00000337526	ensembl	human	known	74_37	frame_shift_del	DEL	0.082:0.235	-
UNC5B	219699	genome.wustl.edu	37	10	73048357	73048357	+	Missense_Mutation	SNP	T	T	A			TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr10:73048357T>A	ENST00000335350.6	+	7	1350	c.934T>A	c.(934-936)Tca>Aca	p.S312T	UNC5B_ENST00000373192.4_Missense_Mutation_p.S312T	NM_170744.4	NP_734465.2	Q8IZJ1	UNC5B_HUMAN	unc-5 homolog B (C. elegans)	312	TSP type-1 2. {ECO:0000255|PROSITE- ProRule:PRU00210}.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of apoptotic process (GO:0043065)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|prostate(4)|skin(4)	49						GAGCAAGTGGTCAGCCTGCAG	0.617																																																	0								ENSG00000107731						109.0	98.0	102.0					10																	73048357		2203	4300	6503	UNC5B	SO:0001583	missense	0			-	HGNC	AB096256	CCDS7309.1, CCDS58083.1	10q22.2	2013-01-11	2001-11-28		ENSG00000107731	ENSG00000107731		"""Immunoglobulin superfamily / I-set domain containing"""	12568	protein-coding gene	gene with protein product		607870	"""unc5 (C.elegans homolog) b"""				Standard	NM_170744		Approved	UNC5H2, p53RDL1	uc001jro.3	Q8IZJ1	OTTHUMG00000018422	ENST00000335350.6:c.934T>A	10.37:g.73048357T>A	ENSP00000334329:p.Ser312Thr	Somatic	0	22	0.00		0.5093136486593635	13	50.00	13	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	3	76.92	Q5T3R9|Q5T3S0|Q86SN3|Q8N1Y2|Q9H9F3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ZU5,pfam_Ig_I-set,pfam_Death_domain,pfam_Thrombospondin_1_rpt,superfamily_DEATH-like_dom,superfamily_Thrombospondin_1_rpt,smart_Ig_sub,smart_Ig_sub2,smart_Thrombospondin_1_rpt,smart_ZU5,smart_Death_domain,pfscan_Thrombospondin_1_rpt,pfscan_ZU5,pfscan_Ig-like_dom	p.S312T	ENST00000335350.6	37	c.934	CCDS7309.1	10	.	.	.	.	.	.	.	.	.	.	t	31	5.081854	0.94050	.	.	ENSG00000107731	ENST00000335350;ENST00000373192	T;T	0.66638	-0.22;-0.22	4.84	4.84	0.62591	.	0.000000	0.85682	D	0.000000	T	0.78381	0.4274	L	0.58969	1.84	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.87578	0.996;0.998	T	0.79645	-0.1717	10	0.52906	T	0.07	-10.6367	14.4772	0.67554	0.0:0.0:0.0:1.0	.	312;312	Q8IZJ1-2;Q8IZJ1	.;UNC5B_HUMAN	T	312	ENSP00000334329:S312T;ENSP00000362288:S312T	ENSP00000334329:S312T	S	+	1	0	UNC5B	72718363	1.000000	0.71417	0.992000	0.48379	0.993000	0.82548	8.037000	0.88933	1.833000	0.53350	0.524000	0.50904	TCA	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt		0.617	UNC5B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	UNC5B	protein_coding	OTTHUMT00000048541.1	T	NM_170744	-		73048357	+1	no_errors	ENST00000335350	ensembl	human	known	74_37	missense	SNP	1.000	A
NOV	4856	genome.wustl.edu	37	8	120431473	120431473	+	Missense_Mutation	SNP	T	T	C			TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr8:120431473T>C	ENST00000259526.3	+	4	892	c.665T>C	c.(664-666)aTg>aCg	p.M222T	RP11-775B15.2_ENST00000519786.1_RNA	NM_002514.3	NP_002505.1	Q9UIW2	PLXA1_HUMAN	nephroblastoma overexpressed	1543	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|multicellular organismal development (GO:0007275)|regulation of smooth muscle cell migration (GO:0014910)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)			NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(7)|ovary(2)|pancreas(1)|skin(3)	21	all_cancers(13;3.84e-26)|Lung NSC(37;1.19e-08)|Ovarian(258;0.0249)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.000507)			AGCTGTGGTATGGGGTTCTCC	0.542																																																	0								ENSG00000136999						127.0	122.0	124.0					8																	120431473		2203	4300	6503	NOV	SO:0001583	missense	0			-	HGNC	X96584	CCDS6328.1	8q24.12	2012-02-27	2012-02-27		ENSG00000136999	ENSG00000136999			7885	protein-coding gene	gene with protein product		164958	"""nephroblastoma overexpressed gene"""			1334251	Standard	NM_002514		Approved	IGFBP9, CCN3	uc003yoq.2	P48745	OTTHUMG00000164984	ENST00000259526.3:c.665T>C	8.37:g.120431473T>C	ENSP00000259526:p.Met222Thr	Somatic	0	56	0.00		0.5093136486593635	106	54.70	128	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	41	14.58		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_IGFBP-like,pfam_Cys_knot,pfam_VWF_C,pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_IGFBP-like,smart_VWF_C,smart_Thrombospondin_1_rpt,smart_Cys_knot_C,pirsf_IGFBP_CNN,pfscan_Cys_knot_C,pfscan_Thrombospondin_1_rpt,pfscan_VWF_C	p.M222T	ENST00000259526.3	37	c.665	CCDS6328.1	8	.	.	.	.	.	.	.	.	.	.	T	10.06	1.246482	0.22796	.	.	ENSG00000136999	ENST00000259526	T	0.53423	0.62	5.96	5.96	0.96718	.	0.157826	0.64402	D	0.000002	T	0.36248	0.0960	N	0.22421	0.69	0.51482	D	0.999922	B	0.27823	0.19	B	0.27076	0.076	T	0.13495	-1.0507	10	0.24483	T	0.36	-23.0561	16.4484	0.83959	0.0:0.0:0.0:1.0	.	222	P48745	NOV_HUMAN	T	222	ENSP00000259526:M222T	ENSP00000259526:M222T	M	+	2	0	NOV	120500654	1.000000	0.71417	1.000000	0.80357	0.650000	0.38633	6.262000	0.72514	2.285000	0.76669	0.533000	0.62120	ATG	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pirsf_IGFBP_CNN,pfscan_Thrombospondin_1_rpt		0.542	NOV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOV	protein_coding	OTTHUMT00000381301.1	T	NM_002514	-		120431473	+1	no_errors	ENST00000259526	ensembl	human	known	74_37	missense	SNP	1.000	C
BTN1A1	696	genome.wustl.edu	37	6	26509300	26509300	+	Missense_Mutation	SNP	G	G	T			TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr6:26509300G>T	ENST00000244513.6	+	7	1545	c.1479G>T	c.(1477-1479)aaG>aaT	p.K493N		NM_001732.2	NP_001723.2	Q13410	BT1A1_HUMAN	butyrophilin, subfamily 1, member A1	493						extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)			endometrium(1)|kidney(1)|large_intestine(5)|lung(15)|ovary(1)|skin(1)|soft_tissue(1)|urinary_tract(1)	26						ACCTTTCTAAGGAGATCCCAT	0.547																																																	0								ENSG00000124557						93.0	94.0	94.0					6																	26509300		2203	4300	6503	BTN1A1	SO:0001583	missense	0			-	HGNC	U39576	CCDS4614.1	6p22.1	2014-01-14			ENSG00000124557	ENSG00000124557		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Butyrophilins"""	1135	protein-coding gene	gene with protein product		601610		BTN		8114113, 9382921	Standard	NM_001732		Approved	BT, BTN1	uc003nif.4	Q13410	OTTHUMG00000016358	ENST00000244513.6:c.1479G>T	6.37:g.26509300G>T	ENSP00000244513:p.Lys493Asn	Somatic	0	49	0.00		0.5093136486593635	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52	Q4VAN3|Q4VAN4|Q9H458	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SPRY_rcpt,pfam_Ig_V-set,pfam_CD80_C2-set,superfamily_ConA-like_lec_gl_sf,smart_Ig_sub,smart_Ig_V-set_subgr,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Ig-like_dom,prints_Butyrophylin	p.K493N	ENST00000244513.6	37	c.1479	CCDS4614.1	6	.	.	.	.	.	.	.	.	.	.	G	14.81	2.647444	0.47258	.	.	ENSG00000124557	ENST00000244513;ENST00000377586	T	0.38077	1.16	5.13	4.24	0.50183	.	0.603673	0.16787	N	0.199534	T	0.21718	0.0523	L	0.32530	0.975	0.27431	N	0.954013	D	0.57257	0.979	P	0.54270	0.747	T	0.04386	-1.0955	10	0.33940	T	0.23	.	6.815	0.23824	0.0902:0.0:0.7354:0.1744	.	493	Q13410	BT1A1_HUMAN	N	493;461	ENSP00000244513:K493N	ENSP00000244513:K493N	K	+	3	2	BTN1A1	26617279	0.983000	0.35010	0.937000	0.37676	0.587000	0.36485	4.291000	0.59025	2.658000	0.90341	0.655000	0.94253	AAG	-	NULL		0.547	BTN1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BTN1A1	protein_coding	OTTHUMT00000043776.1	G	NM_001732	-		26509300	+1	no_errors	ENST00000244513	ensembl	human	known	74_37	missense	SNP	0.851	T
MRPL4	51073	genome.wustl.edu	37	19	10370387	10370387	+	Silent	SNP	A	A	T			TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr19:10370387A>T	ENST00000253099.6	+	9	1121	c.834A>T	c.(832-834)tcA>tcT	p.S278S	MRPL4_ENST00000307422.5_Silent_p.S278S|CTD-2369P2.5_ENST00000592893.1_RNA|CTD-2369P2.4_ENST00000587088.1_RNA|MRPL4_ENST00000393733.2_3'UTR	NM_015956.2|NM_146388.1	NP_057040.2|NP_666500.1	Q9BYD3	RM04_HUMAN	mitochondrial ribosomal protein L4	278					translation (GO:0006412)	mitochondrion (GO:0005739)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			breast(2)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	11		Renal(1328;0.0112)	OV - Ovarian serous cystadenocarcinoma(20;1.39e-09)|Epithelial(33;1.99e-06)|all cancers(31;4.81e-06)	Lung(535;0.00705)		GGCAGGACTCACGTTACAGAC	0.647																																																	0								ENSG00000105364						79.0	61.0	68.0					19																	10370387		2203	4300	6503	MRPL4	SO:0001819	synonymous_variant	0			-	HGNC	AB049635	CCDS12230.1, CCDS42499.1	19p13.2	2012-11-14			ENSG00000105364	ENSG00000105364		"""Mitochondrial ribosomal proteins / large subunits"""	14276	protein-coding gene	gene with protein product		611823					Standard	NM_015956		Approved	CGI-28	uc002mnn.3	Q9BYD3	OTTHUMG00000180400	ENST00000253099.6:c.834A>T	19.37:g.10370387A>T		Somatic	0	93	0.00		0.5093136486593635	263	25.92	92	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	90	9.00	A6NNV7|Q9BW07|Q9H4N2|Q9Y317	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ribosomal_L4/L1e,superfamily_Ribosomal_L4_dom,tigrfam_Ribosomal_L4/L1e_bac-type	p.S278	ENST00000253099.6	37	c.834	CCDS12230.1	19																																																																																			-	NULL		0.647	MRPL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPL4	protein_coding	OTTHUMT00000451197.1	A		-		10370387	+1	no_errors	ENST00000253099	ensembl	human	known	74_37	silent	SNP	0.000	T
ZNF418	147686	genome.wustl.edu	37	19	58438975	58438975	+	Missense_Mutation	SNP	A	A	G			TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr19:58438975A>G	ENST00000396147.1	-	4	865	c.574T>C	c.(574-576)Tgt>Cgt	p.C192R	ZNF418_ENST00000595830.1_Missense_Mutation_p.C192R|ZNF418_ENST00000425570.3_Missense_Mutation_p.C213R|ZNF418_ENST00000600989.1_Intron|ZNF418_ENST00000599086.1_5'Flank|ZNF418_ENST00000599852.1_Missense_Mutation_p.C107R	NM_133460.1	NP_597717.1	Q8TF45	ZN418_HUMAN	zinc finger protein 418	192					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(9)|prostate(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	31		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0158)		GGAGACTCACACTCAGGTTTG	0.468																																																	0								ENSG00000196724						70.0	68.0	69.0					19																	58438975		2186	4292	6478	ZNF418	SO:0001583	missense	0			-	HGNC	AB075836, AY695825	CCDS42642.1	19q13.43	2013-01-08				ENSG00000196724		"""Zinc fingers, C2H2-type"", ""-"""	20647	protein-coding gene	gene with protein product						11853319	Standard	NM_133460		Approved	KIAA1956, FLJ31551	uc002qqs.1	Q8TF45		ENST00000396147.1:c.574T>C	19.37:g.58438975A>G	ENSP00000379451:p.Cys192Arg	Somatic	0	63	0.00		0.5093136486593635	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	35	32.69	Q2M1S2|Q670L5|Q96N18	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.C192R	ENST00000396147.1	37	c.574	CCDS42642.1	19	.	.	.	.	.	.	.	.	.	.	.	3.452	-0.111740	0.06881	.	.	ENSG00000196724	ENST00000396147;ENST00000425570;ENST00000545403	T;T	0.08193	3.12;3.14	2.01	0.881	0.19166	.	.	.	.	.	T	0.24122	0.0584	M	0.87827	2.91	0.33742	D	0.619561	D	0.57571	0.98	D	0.69142	0.962	T	0.30001	-0.9993	9	0.87932	D	0	.	1.7268	0.02923	0.5367:0.0:0.1766:0.2867	.	192	Q8TF45	ZN418_HUMAN	R	192;213;158	ENSP00000379451:C192R;ENSP00000407039:C213R	ENSP00000379451:C192R	C	-	1	0	ZNF418	63130787	0.000000	0.05858	0.003000	0.11579	0.009000	0.06853	0.166000	0.16583	0.173000	0.19788	0.254000	0.18369	TGT	-	NULL		0.468	ZNF418-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	ZNF418	protein_coding	OTTHUMT00000466693.1	A	NM_133460	-		58438975	-1	no_errors	ENST00000396147	ensembl	human	known	74_37	missense	SNP	0.582	G
TRAK1	22906	genome.wustl.edu	37	3	42251577	42251578	+	Intron	INS	-	-	GGAGGA	rs10634555|rs35624871		TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr3:42251577_42251578insGGAGGA	ENST00000327628.5	+	14	2363				TRAK1_ENST00000487159.1_Intron|TRAK1_ENST00000396175.1_Intron|TRAK1_ENST00000341421.3_In_Frame_Ins_p.639_640insEE	NM_001042646.2	NP_001036111.1	Q9UPV9	TRAK1_HUMAN	trafficking protein, kinesin binding 1						endosome to lysosome transport (GO:0008333)|protein O-linked glycosylation (GO:0006493)|protein targeting (GO:0006605)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|mitochondrion (GO:0005739)|nucleus (GO:0005634)		p.E640delE(1)		central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(8)|lung(6)|ovary(1)|upper_aerodigestive_tract(2)	22						CCAGCGGCCACggaggaggagg	0.629																																					GBM(44;195 884 22595 31865 41850)												1	Deletion - In frame(1)	kidney(1)						ENSG00000182606																																			TRAK1	SO:0001627	intron_variant	0				HGNC		CCDS2695.1, CCDS43072.1, CCDS58826.1, CCDS74922.1	3p22.1	2012-03-05			ENSG00000182606	ENSG00000182606			29947	protein-coding gene	gene with protein product	"""OGT(O Glc NAc transferase) interacting protein 106 KDa"", ""O-linked N-acetylglucosamine transferase interacting protein 106"", ""milton homolog 1 (Drosophila)"""	608112				10470851, 12435728, 16380713, 20230862	Standard	NM_014965		Approved	OIP106, KIAA1042, MILT1	uc003cky.4	Q9UPV9	OTTHUMG00000131795	ENST00000327628.5:c.1963+100->GGAGGA	3.37:g.42251578_42251583dupGGAGGA		Somatic	NA	NA	NA		0.5093136486593635	7	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	E9PDS2|J3KNT7|Q63HR0|Q659B5|Q96B69	In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_HAP1_N,pfam_Traffickng_kinesin-bd_prot_dom	p.634in_frame_insEE	ENST00000327628.5	37	c.1889_1890	CCDS43072.1	3																																																																																			-	NULL		0.629	TRAK1-004	PUTATIVE	basic|appris_principal|CCDS	protein_coding	TRAK1	protein_coding	OTTHUMT00000343413.1	-	NM_014965			42251578	+1	no_errors	ENST00000341421	ensembl	human	known	74_37	in_frame_ins	INS	0.010:0.044	GGAGGA
WDR24	84219	genome.wustl.edu	37	16	737641	737641	+	Missense_Mutation	SNP	G	G	A			TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr16:737641G>A	ENST00000248142.6	-	6	969	c.970C>T	c.(970-972)Cgg>Tgg	p.R324W	LA16c-313D11.12_ENST00000566927.1_RNA|WDR24_ENST00000293883.4_Missense_Mutation_p.R194W			Q96S15	WDR24_HUMAN	WD repeat domain 24	324										breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|urinary_tract(3)	19		Hepatocellular(780;0.0218)				TCGGGACGCCGGATGTCCCAG	0.637																																																	0								ENSG00000127580						104.0	87.0	93.0					16																	737641		2199	4300	6499	WDR24	SO:0001583	missense	0			-	HGNC	AL136863	CCDS10420.1	16p13.3	2013-01-09			ENSG00000127580	ENSG00000127580		"""WD repeat domain containing"""	20852	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 21"""	C16orf21		11230166	Standard	NM_032259		Approved	DKFZp434F054, JFP7	uc002ciz.1	Q96S15	OTTHUMG00000090421	ENST00000248142.6:c.970C>T	16.37:g.737641G>A	ENSP00000248142:p.Arg324Trp	Somatic	0	40	0.00		0.5093136486593635	29	29.27	12	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	30	14.29	A2IDB8|D3DU59|Q96GC7|Q9H0B7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R324W	ENST00000248142.6	37	c.970		16	.	.	.	.	.	.	.	.	.	.	G	21.8	4.199142	0.79015	.	.	ENSG00000127580	ENST00000248142;ENST00000293883	T;T	0.36520	1.25;1.25	5.03	5.03	0.67393	.	0.000000	0.85682	D	0.000000	T	0.63780	0.2540	M	0.82056	2.57	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.68674	-0.5346	10	0.87932	D	0	-20.3797	17.532	0.87817	0.0:0.0:1.0:0.0	.	194	Q96S15-2	.	W	324;194	ENSP00000248142:R324W;ENSP00000293883:R194W	ENSP00000248142:R324W	R	-	1	2	WDR24	677642	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.786000	0.75094	2.609000	0.88269	0.637000	0.83480	CGG	-	superfamily_WD40_repeat_dom,pfscan_WD40_repeat_dom		0.637	WDR24-201	KNOWN	basic	protein_coding	WDR24	protein_coding		G	NM_032259	-		737641	-1	no_errors	ENST00000248142	ensembl	human	known	74_37	missense	SNP	1.000	A
MYO15A	51168	genome.wustl.edu	37	17	18042602	18042602	+	Intron	SNP	G	G	A			TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr17:18042602G>A	ENST00000205890.5	+	19	5471				MYO15A_ENST00000412324.1_3'UTR	NM_016239.3	NP_057323.3	Q9UKN7	MYO15_HUMAN	myosin XVA						inner ear morphogenesis (GO:0042472)|locomotory behavior (GO:0007626)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|stereocilium (GO:0032420)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(5)|central_nervous_system(2)|endometrium(17)|kidney(3)|large_intestine(16)|lung(27)|ovary(3)|pancreas(1)|prostate(6)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	99	all_neural(463;0.228)					Ccatgcctctgtccccatccg	0.512																																																	0								ENSG00000091536																																			MYO15A	SO:0001627	intron_variant	0			-	HGNC	AF144094	CCDS42271.1	17p11.2	2011-09-27			ENSG00000091536	ENSG00000091536		"""Myosins / Myosin superfamily : Class XV"""	7594	protein-coding gene	gene with protein product		602666		DFNB3, MYO15		9603736	Standard	NM_016239		Approved		uc021trl.1	Q9UKN7	OTTHUMG00000059390	ENST00000205890.5:c.5134-246G>A	17.37:g.18042602G>A		Somatic	0	25	0.00		0.5093136486593635	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	23	52.08	B4DFC7	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000205890.5	37	NULL	CCDS42271.1	17																																																																																			-	-		0.512	MYO15A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO15A	protein_coding	OTTHUMT00000132048.1	G	NM_016239	-		18042602	+1	no_errors	ENST00000412324	ensembl	human	known	74_37	rna	SNP	0.010	A
LGR6	59352	genome.wustl.edu	37	1	202183341	202183341	+	Intron	SNP	G	G	A			TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr1:202183341G>A	ENST00000367278.3	+	2	301				LGR6_ENST00000439764.2_Missense_Mutation_p.G20E|LGR6_ENST00000255432.7_Intron	NM_001017403.1	NP_001017403.1	Q9HBX8	LGR6_HUMAN	leucine-rich repeat containing G protein-coupled receptor 6						G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of Wnt signaling pathway (GO:0030177)|Wnt signaling pathway (GO:0016055)	integral component of plasma membrane (GO:0005887)|trans-Golgi network membrane (GO:0032588)|vesicle (GO:0031982)	transmembrane signaling receptor activity (GO:0004888)			breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(16)|ovary(3)|pancreas(1)|prostate(3)|skin(3)	36						TCCCGGGCTGGGAGTGCACGG	0.697																																																	0								ENSG00000133067						13.0	15.0	14.0					1																	202183341		2181	4291	6472	LGR6	SO:0001627	intron_variant	0			-	HGNC	AF190501	CCDS1424.1, CCDS30971.1, CCDS30972.1	1q32.1	2012-08-21	2011-01-25		ENSG00000133067	ENSG00000133067		"""GPCR / Class A : Orphans"""	19719	protein-coding gene	gene with protein product		606653	"""leucine-rich repeat-containing G protein-coupled receptor 6"""			10935549	Standard	XM_005245404		Approved	FLJ14471	uc001gxu.3	Q9HBX8	OTTHUMG00000041383	ENST00000367278.3:c.213-11210G>A	1.37:g.202183341G>A		Somatic	0	77	0.00		0.5093136486593635	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	44	37.14	Q5T509|Q5T512|Q6UY15|Q86VU0|Q96K69|Q9BYD7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Leu-rich_rpt,pfam_GPCR_Rhodpsn,smart_Leu-rich_rpt_typical-subtyp,prints_Gphrmn_rcpt_fam,prints_GPCR_Rhodpsn	p.G20E	ENST00000367278.3	37	c.59	CCDS30971.1	1	.	.	.	.	.	.	.	.	.	.	G	10.74	1.435490	0.25813	.	.	ENSG00000133067	ENST00000439764	T	0.51071	0.72	2.43	1.07	0.20283	.	.	.	.	.	T	0.27559	0.0677	.	.	.	0.09310	N	1	B	0.29037	0.231	B	0.26969	0.075	T	0.16867	-1.0388	8	0.24483	T	0.36	.	4.8638	0.13598	0.2389:0.0:0.7611:0.0	.	20	Q9HBX8-1	.	E	20	ENSP00000387869:G20E	ENSP00000387869:G20E	G	+	2	0	LGR6	200449964	0.000000	0.05858	0.001000	0.08648	0.013000	0.08279	0.009000	0.13219	0.305000	0.22832	0.313000	0.20887	GGG	-	NULL		0.697	LGR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LGR6	protein_coding	OTTHUMT00000099143.1	G	NM_021636	-		202183341	+1	no_errors	ENST00000439764	ensembl	human	known	74_37	missense	SNP	0.001	A
EP400NL	347918	genome.wustl.edu	37	12	132603415	132603416	+	Intron	INS	-	-	GGCAGA	rs141780032	byFrequency	TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr12:132603415_132603416insGGCAGA	ENST00000376625.4	+	4	1509				EP400NL_ENST00000361109.5_Intron|EP400NL_ENST00000475841.1_3'UTR			Q6ZTU2	E400N_HUMAN	EP400 N-terminal like											endometrium(1)|lung(1)|prostate(2)|urinary_tract(1)	5						GCAGCTCGCTGGGCAGAGGCAG	0.673														277	0.0553115	0.1604	0.0216	5008	,	,		17210	0.0208		0.0209	False		,,,				2504	0.0082																0								ENSG00000185684																																			EP400NL	SO:0001627	intron_variant	0				HGNC	AK091234		12q24.33	2013-02-15			ENSG00000185684	ENSG00000185684			26602	protein-coding gene	gene with protein product						12477932	Standard	NR_003290		Approved	FLJ33915	uc009zyq.3	Q6ZTU2	OTTHUMG00000168251	ENST00000376625.4:c.1465-1549->GGCAGA	12.37:g.132603416_132603421dupGGCAGA		Somatic	NA	NA	NA		0.5093136486593635	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A6NLB7|A8K0Z5|B3KQY2|Q6NXP1|Q8N253|Q8N7S7|Q9UFJ3	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000376625.4	37	NULL		12																																																																																			-	-		0.673	EP400NL-202	KNOWN	basic|appris_candidate_longest	protein_coding	EP400NL	protein_coding		-	NM_182613			132603416	+1	no_errors	ENST00000475841	ensembl	human	known	74_37	rna	INS	0.945:0.951	GGCAGA
FLT4	2324	genome.wustl.edu	37	5	180048109	180048109	+	Missense_Mutation	SNP	A	A	T			TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr5:180048109A>T	ENST00000261937.6	-	14	2242	c.2164T>A	c.(2164-2166)Tct>Act	p.S722T	FLT4_ENST00000393347.3_Missense_Mutation_p.S722T|FLT4_ENST00000502649.1_Missense_Mutation_p.S722T|FLT4_ENST00000424276.2_5'UTR	NM_182925.4	NP_891555.2	P35916	VGFR3_HUMAN	fms-related tyrosine kinase 4	722	Ig-like C2-type 7.				blood vessel morphogenesis (GO:0048514)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|lymph vessel development (GO:0001945)|lymphangiogenesis (GO:0001946)|negative regulation of apoptotic process (GO:0043066)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of JNK cascade (GO:0046330)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation vascular endothelial growth factor production (GO:0010575)|protein autophosphorylation (GO:0046777)|regulation of blood vessel remodeling (GO:0060312)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein phosphatase binding (GO:0019903)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|kidney(6)|large_intestine(5)|liver(2)|lung(37)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(89;2.21e-05)|all_epithelial(37;5.29e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00245)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.134)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	TCCCTACCAGACTTTTCCTCC	0.672																																					Colon(97;1075 1466 27033 27547 35871)												0								ENSG00000037280						24.0	25.0	25.0					5																	180048109		2201	4292	6493	FLT4	SO:0001583	missense	0			-	HGNC	X68203	CCDS4457.1, CCDS43412.1	5q34-q35	2013-01-29			ENSG00000037280	ENSG00000037280	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3767	protein-coding gene	gene with protein product		136352				1319394	Standard	NM_002020		Approved	VEGFR3, PCL	uc003mlz.4	P35916	OTTHUMG00000130931	ENST00000261937.6:c.2164T>A	5.37:g.180048109A>T	ENSP00000261937:p.Ser722Thr	Somatic	0	47	0.00		0.5093136486593635	5	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	101	9.01	A8K6L4|B5A926|Q16067|Q86W07|Q86W08	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Ig_I-set,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,prints_VEGFR3_rcpt	p.S722T	ENST00000261937.6	37	c.2164	CCDS4457.1	5	.	.	.	.	.	.	.	.	.	.	A	22.6	4.304916	0.81247	.	.	ENSG00000037280	ENST00000261937;ENST00000393347;ENST00000502649;ENST00000376868	D;D;D	0.82619	-1.63;-1.63;-1.63	4.4	4.4	0.53042	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.90215	0.6941	M	0.78344	2.41	0.80722	D	1	D;D;D;D	0.71674	0.998;0.972;0.972;0.972	D;D;P;P	0.73380	0.98;0.911;0.861;0.895	D	0.91406	0.5147	9	0.66056	D	0.02	.	13.963	0.64193	1.0:0.0:0.0:0.0	.	722;532;722;722	P35916-3;E9PFB0;E9PD35;P35916	.;.;.;VGFR3_HUMAN	T	722;722;722;532	ENSP00000261937:S722T;ENSP00000377016:S722T;ENSP00000426057:S722T	ENSP00000261937:S722T	S	-	1	0	FLT4	179980715	1.000000	0.71417	0.972000	0.41901	0.761000	0.43186	8.187000	0.89708	1.770000	0.52166	0.379000	0.24179	TCT	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.672	FLT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLT4	protein_coding	OTTHUMT00000253527.4	A		-		180048109	-1	no_errors	ENST00000261937	ensembl	human	known	74_37	missense	SNP	1.000	T
PHLPP1	23239	genome.wustl.edu	37	18	60630681	60630681	+	Missense_Mutation	SNP	C	C	G			TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr18:60630681C>G	ENST00000262719.5	+	14	3770	c.3536C>G	c.(3535-3537)aCt>aGt	p.T1179S	PHLPP1_ENST00000400316.4_Missense_Mutation_p.T667S			O60346	PHLP1_HUMAN	PH domain and leucine rich repeat protein phosphatase 1	1179	PP2C-like.				apoptotic process (GO:0006915)|entrainment of circadian clock (GO:0009649)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)			endometrium(2)|kidney(2)|lung(13)	17						CATGGTTACACTGAAGCTTCG	0.458																																																	0								ENSG00000081913						55.0	49.0	51.0					18																	60630681		1892	4109	6001	PHLPP1	SO:0001583	missense	0			-	HGNC	AB011178	CCDS45881.1, CCDS45881.2	18q21.32	2013-01-11	2009-05-26	2009-05-26	ENSG00000081913	ENSG00000081913		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"", ""Pleckstrin homology (PH) domain containing"""	20610	protein-coding gene	gene with protein product		609396	"""pleckstrin homology domain containing, family E (with leucine rich repeats) member 1"", ""PH domain and leucine rich repeat protein phosphatase"""	PLEKHE1, PHLPP		10570941, 15808505	Standard	NM_194449		Approved	KIAA0606, SCOP	uc021ule.1	O60346	OTTHUMG00000150629	ENST00000262719.5:c.3536C>G	18.37:g.60630681C>G	ENSP00000262719:p.Thr1179Ser	Somatic	0	93	0.00		0.5093136486593635	36	28.00	14	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	81	14.74	A1A4F5|Q641Q7|Q6P4C4|Q6PJI6|Q86TN6|Q96FK2|Q9NUY1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PP2C-like_dom,pfam_Leu-rich_rpt,superfamily_PP2C-like_dom,smart_Leu-rich_rpt_typical-subtyp,smart_PP2C-like_dom,pfscan_Pleckstrin_homology	p.T1179S	ENST00000262719.5	37	c.3536	CCDS45881.2	18	.	.	.	.	.	.	.	.	.	.	C	18.67	3.673331	0.67928	.	.	ENSG00000081913	ENST00000400316;ENST00000262719	T;T	0.08634	3.07;3.07	5.65	5.65	0.86999	Protein phosphatase 2C-like (4);	.	.	.	.	T	0.12987	0.0315	N	0.13235	0.315	0.80722	D	1	D	0.58970	0.984	P	0.56612	0.802	T	0.22277	-1.0221	9	0.33141	T	0.24	-17.1262	19.7432	0.96238	0.0:1.0:0.0:0.0	.	1179	O60346	PHLP1_HUMAN	S	667;1179	ENSP00000383170:T667S;ENSP00000262719:T1179S	ENSP00000262719:T1179S	T	+	2	0	PHLPP1	58781661	1.000000	0.71417	0.976000	0.42696	0.883000	0.51084	7.277000	0.78572	2.663000	0.90544	0.563000	0.77884	ACT	-	pfam_PP2C-like_dom,superfamily_PP2C-like_dom,smart_PP2C-like_dom		0.458	PHLPP1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PHLPP1	protein_coding	OTTHUMT00000319249.2	C	NM_194449	-		60630681	+1	no_errors	ENST00000262719	ensembl	human	known	74_37	missense	SNP	1.000	G
DNAH9	1770	genome.wustl.edu	37	17	11603120	11603120	+	Missense_Mutation	SNP	C	C	A			TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr17:11603120C>A	ENST00000262442.4	+	23	5013	c.4945C>A	c.(4945-4947)Cca>Aca	p.P1649T	DNAH9_ENST00000454412.2_Missense_Mutation_p.P1649T	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	1649	Stem. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		CAGTGGGGAACCAACCAAGAC	0.517																																																	0								ENSG00000007174						140.0	109.0	120.0					17																	11603120		2203	4300	6503	DNAH9	SO:0001583	missense	0			-	HGNC	U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.4945C>A	17.37:g.11603120C>A	ENSP00000262442:p.Pro1649Thr	Somatic	0	58	0.00		0.5093136486593635	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	49	63	43.75	A2VCQ8|O15064|O95494|Q9NQ28	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.P1649T	ENST00000262442.4	37	c.4945	CCDS11160.1	17	.	.	.	.	.	.	.	.	.	.	C	11.17	1.558840	0.27827	.	.	ENSG00000007174	ENST00000262442;ENST00000454412;ENST00000413703	T;T	0.26660	1.76;1.72	5.45	4.48	0.54585	Dynein heavy chain, domain-2 (1);	0.142018	0.47852	D	0.000207	T	0.23806	0.0576	L	0.52206	1.635	0.80722	D	1	B	0.12013	0.005	B	0.22152	0.038	T	0.04400	-1.0954	10	0.16420	T	0.52	.	12.5862	0.56419	0.1315:0.742:0.1265:0.0	.	1649	Q9NYC9	DYH9_HUMAN	T	1649;1649;231	ENSP00000262442:P1649T;ENSP00000414874:P1649T	ENSP00000262442:P1649T	P	+	1	0	DNAH9	11543845	0.958000	0.32768	0.746000	0.31095	0.235000	0.25334	1.464000	0.35288	1.303000	0.44873	0.655000	0.94253	CCA	-	pfam_Dynein_heavy_dom-2		0.517	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH9	protein_coding	OTTHUMT00000252756.2	C	NM_001372	-		11603120	+1	no_errors	ENST00000262442	ensembl	human	known	74_37	missense	SNP	0.975	A
LRCH2	57631	genome.wustl.edu	37	X	114357669	114357669	+	Nonsense_Mutation	SNP	G	G	A			TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chrX:114357669G>A	ENST00000317135.8	-	18	1966	c.1936C>T	c.(1936-1938)Cga>Tga	p.R646*	LRCH2_ENST00000538422.1_Nonsense_Mutation_p.R629*	NM_020871.3	NP_065922.3	Q5VUJ6	LRCH2_HUMAN	leucine-rich repeats and calponin homology (CH) domain containing 2	646	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.									breast(1)|endometrium(4)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	19						ATTTGCTCTCGCTCTTCCCGT	0.408																																																	0								ENSG00000130224						162.0	136.0	144.0					X																	114357669		1906	4113	6019	LRCH2	SO:0001587	stop_gained	0			-	HGNC	AB040928	CCDS48155.1, CCDS59175.1	Xq24	2008-02-05			ENSG00000130224	ENSG00000130224			29292	protein-coding gene	gene with protein product						10819331	Standard	NM_020871		Approved	KIAA1495	uc010nqe.3	Q5VUJ6	OTTHUMG00000022233	ENST00000317135.8:c.1936C>T	X.37:g.114357669G>A	ENSP00000325091:p.Arg646*	Somatic	0	57	0.00		0.5093136486593635	10	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	F5H2T1|Q08AD5|Q9HA88|Q9P233	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Leu-rich_rpt,pfam_CH-domain,superfamily_CH-domain,superfamily_NA-bd_OB-fold,smart_Leu-rich_rpt_typical-subtyp,smart_CH-domain,pfscan_CH-domain	p.R646*	ENST00000317135.8	37	c.1936	CCDS48155.1	X	.	.	.	.	.	.	.	.	.	.	G	37	6.032886	0.97221	.	.	ENSG00000130224	ENST00000317135;ENST00000536655;ENST00000538422	.	.	.	5.31	3.38	0.38709	.	0.186759	0.43919	D	0.000517	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07030	T	0.85	-9.0887	10.3811	0.44113	0.0:0.0:0.449:0.551	.	.	.	.	X	646;125;629	.	ENSP00000325091:R646X	R	-	1	2	LRCH2	114263925	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.384000	0.52478	1.195000	0.43115	0.544000	0.68410	CGA	-	superfamily_CH-domain,pfscan_CH-domain		0.408	LRCH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LRCH2	protein_coding	OTTHUMT00000057971.2	G	NM_020871	-		114357669	-1	no_errors	ENST00000317135	ensembl	human	known	74_37	nonsense	SNP	1.000	A
CAMKK1	84254	genome.wustl.edu	37	17	3769248	3769248	+	Missense_Mutation	SNP	C	C	A			TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr17:3769248C>A	ENST00000348335.2	-	15	1547	c.1399G>T	c.(1399-1401)Gca>Tca	p.A467S	CAMKK1_ENST00000381769.2_Missense_Mutation_p.A494S|CAMKK1_ENST00000158166.5_Missense_Mutation_p.A505S|CAMKK1_ENST00000381771.2_Missense_Mutation_p.A505S	NM_032294.2	NP_115670.1	Q8N5S9	KKCC1_HUMAN	calcium/calmodulin-dependent protein kinase kinase 1, alpha	467					synaptic transmission (GO:0007268)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)			NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)	11				LUAD - Lung adenocarcinoma(2;2.11e-05)|Lung(3;0.0176)		TCCCTCCGTGCTTGGGGCTCA	0.607																																																	0								ENSG00000004660						125.0	99.0	108.0					17																	3769248		2203	4300	6503	CAMKK1	SO:0001583	missense	0			-	HGNC	AL136576	CCDS11038.1, CCDS11039.1	17p13.3	2004-02-18			ENSG00000004660	ENSG00000004660			1469	protein-coding gene	gene with protein product		611411				11230166	Standard	NM_172207		Approved	DKFZp761M0423, CAMKKA, MGC34095	uc002fwt.3	Q8N5S9	OTTHUMG00000090725	ENST00000348335.2:c.1399G>T	17.37:g.3769248C>A	ENSP00000323118:p.Ala467Ser	Somatic	0	39	0.00		0.5093136486593635	10	28.57	4	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	43	28.33	Q9BQH3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.A505S	ENST00000348335.2	37	c.1513	CCDS11038.1	17	.	.	.	.	.	.	.	.	.	.	C	5.675	0.309055	0.10733	.	.	ENSG00000004660	ENST00000381769;ENST00000348335;ENST00000381771;ENST00000158166	T;T;T;T	0.46063	0.88;0.88;0.88;0.88	4.87	1.67	0.24075	Protein kinase-like domain (1);	0.310318	0.33057	N	0.005334	T	0.12390	0.0301	N	0.02315	-0.6	0.09310	N	1	B;B	0.11235	0.004;0.001	B;B	0.16722	0.016;0.002	T	0.35351	-0.9792	10	0.02654	T	1	-6.7134	4.8309	0.13439	0.1663:0.6006:0.0:0.2332	.	505;467	F8W9H1;Q8N5S9	.;KKCC1_HUMAN	S	494;467;505;505	ENSP00000371188:A494S;ENSP00000323118:A467S;ENSP00000371190:A505S;ENSP00000158166:A505S	ENSP00000158166:A505S	A	-	1	0	CAMKK1	3715997	0.002000	0.14202	0.953000	0.39169	0.921000	0.55340	0.829000	0.27449	1.255000	0.44051	0.462000	0.41574	GCA	-	superfamily_Kinase-like_dom		0.607	CAMKK1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CAMKK1	protein_coding	OTTHUMT00000207456.1	C	NM_032294, NM_172206, NM_172207	-		3769248	-1	no_errors	ENST00000381771	ensembl	human	known	74_37	missense	SNP	0.014	A
LOC730102	730102	genome.wustl.edu	37	1	177977233	177977233	+	RNA	SNP	G	G	T			TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr1:177977233G>T	ENST00000354921.3	-	0	105				RP11-568K15.1_ENST00000476232.2_RNA																							AGAGCGAGAAGCACCTTGCCC	0.408																																																	0								ENSG00000242193																																			RP11-568K15.1			0			-	Clone_based_vega_gene																													1.37:g.177977233G>T		Somatic	0	107	0.00		0.5093136486593635	3	40.00	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	36	82	30.51		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000354921.3	37	NULL		1																																																																																			-	-		0.408	RP4-798P15.3-003	KNOWN	basic|readthrough_transcript	processed_transcript	LOC730102	processed_transcript	OTTHUMT00000084770.16	G		-		177977233	-1	no_errors	ENST00000476232	ensembl	human	known	74_37	rna	SNP	0.962	T
RP11-866E20.3	0	genome.wustl.edu	37	18	57678376	57678376	+	lincRNA	SNP	C	C	T			TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr18:57678376C>T	ENST00000585691.1	+	0	594																											AGCTCGACATCGCCGTGGGCC	0.721																																																	0								ENSG00000267462																																			RP11-866E20.3			0			-	Clone_based_vega_gene																													18.37:g.57678376C>T		Somatic	0	34	0.00		0.5093136486593635	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	38	19.15		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000585691.1	37	NULL		18																																																																																			-	-		0.721	RP11-866E20.3-001	KNOWN	basic	lincRNA	ENSG00000267462	lincRNA	OTTHUMT00000449078.1	C		-		57678376	+1	no_errors	ENST00000585691	ensembl	human	known	74_37	rna	SNP	0.014	T
RASGRF2	5924	genome.wustl.edu	37	5	80503117	80503117	+	Missense_Mutation	SNP	C	C	A			TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr5:80503117C>A	ENST00000265080.4	+	21	3087	c.3020C>A	c.(3019-3021)gCa>gAa	p.A1007E	CKMT2-AS1_ENST00000503483.2_RNA|CKMT2-AS1_ENST00000511495.1_RNA	NM_006909.2	NP_008840.1	O14827	RGRF2_HUMAN	Ras protein-specific guanine nucleotide-releasing factor 2	1007	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			biliary_tract(1)|breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(28)|ovary(5)|prostate(3)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	75		Lung NSC(167;0.00498)|all_lung(232;0.00531)|Ovarian(174;0.0357)		OV - Ovarian serous cystadenocarcinoma(54;4.22e-42)|Epithelial(54;4.04e-35)|all cancers(79;2.52e-29)		ATGGAGCTGGCAGAACAGATC	0.567																																																	0								ENSG00000113319						112.0	97.0	102.0					5																	80503117		2203	4300	6503	RASGRF2	SO:0001583	missense	0			-	HGNC	AF023130	CCDS4052.1	5q13	2013-01-10			ENSG00000113319	ENSG00000113319		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	9876	protein-coding gene	gene with protein product		606614					Standard	NM_006909		Approved	GRF2, Ras-GRF2	uc003kha.2	O14827	OTTHUMG00000119015	ENST00000265080.4:c.3020C>A	5.37:g.80503117C>A	ENSP00000265080:p.Ala1007Glu	Somatic	0	47	0.00		0.5093136486593635	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51	B9EG89|Q9UK56	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RasGRF_CDC25,pfam_Ras-like_Gua-exchang_fac_N,pfam_DH-domain,pfam_Pleckstrin_homology,superfamily_Ras_GEF_dom,superfamily_DH-domain,smart_Pleckstrin_homology,smart_DH-domain,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_DH-domain,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.A1007E	ENST00000265080.4	37	c.3020	CCDS4052.1	5	.	.	.	.	.	.	.	.	.	.	C	27.5	4.839700	0.91117	.	.	ENSG00000113319	ENST00000265080	T	0.71934	-0.61	5.26	5.26	0.73747	Guanine-nucleotide dissociation stimulator CDC25 (4);Ras guanine nucleotide exchange factor, domain (1);	0.000000	0.85682	D	0.000000	D	0.90239	0.6948	H	0.97564	4.03	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.93685	0.7002	10	0.87932	D	0	.	18.4707	0.90773	0.0:1.0:0.0:0.0	.	1007	O14827	RGRF2_HUMAN	E	1007	ENSP00000265080:A1007E	ENSP00000265080:A1007E	A	+	2	0	RASGRF2	80538873	1.000000	0.71417	0.955000	0.39395	0.818000	0.46254	7.818000	0.86416	2.462000	0.83206	0.555000	0.69702	GCA	-	pfam_RasGRF_CDC25,superfamily_Ras_GEF_dom,smart_RasGRF_CDC25,pfscan_RasGRF_CDC25		0.567	RASGRF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RASGRF2	protein_coding	OTTHUMT00000239215.2	C	NM_006909	-		80503117	+1	no_errors	ENST00000265080	ensembl	human	known	74_37	missense	SNP	1.000	A
FGFR4	2264	genome.wustl.edu	37	5	176520502	176520502	+	Silent	SNP	C	C	A	rs542115984		TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr5:176520502C>A	ENST00000292408.4	+	10	1592	c.1347C>A	c.(1345-1347)ctC>ctA	p.L449L	FGFR4_ENST00000292410.3_Silent_p.L409L|FGFR4_ENST00000502906.1_Silent_p.L449L|FGFR4_ENST00000393648.2_Splice_Site_p.S398*|FGFR4_ENST00000393637.1_Silent_p.L409L	NM_002011.3|NM_213647.1	NP_002002.3|NP_998812.1	P22455	FGFR4_HUMAN	fibroblast growth factor receptor 4	449					alveolar secondary septum development (GO:0061144)|cell migration (GO:0016477)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose homeostasis (GO:0042593)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ induction (GO:0001759)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphate ion homeostasis (GO:0055062)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of metalloenzyme activity (GO:0048554)|positive regulation of proteolysis (GO:0045862)|protein autophosphorylation (GO:0046777)|regulation of bile acid biosynthetic process (GO:0070857)|regulation of cholesterol homeostasis (GO:2000188)|regulation of extracellular matrix disassembly (GO:0010715)|regulation of lipid metabolic process (GO:0019216)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|heparin binding (GO:0008201)|protein tyrosine kinase activity (GO:0004713)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(16)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	34	all_cancers(89;5.93e-05)|Renal(175;0.000269)|Lung NSC(126;0.0088)|all_lung(126;0.0142)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Palifermin(DB00039)|Ponatinib(DB08901)	TCGCCGGCCTCGTGAGTCTAG	0.672										TSP Lung(9;0.080)																																							0								ENSG00000160867						66.0	72.0	70.0					5																	176520502		2203	4300	6503	FGFR4	SO:0001819	synonymous_variant	0			-	HGNC	AF202063	CCDS4410.1, CCDS4411.1	5q35.2	2013-09-19			ENSG00000160867	ENSG00000160867		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3691	protein-coding gene	gene with protein product		134935					Standard	XM_005265837		Approved	JTK2, CD334	uc003mfm.3	P22455	OTTHUMG00000151523	ENST00000292408.4:c.1347C>A	5.37:g.176520502C>A		Somatic	0	37	0.00		0.5093136486593635	3	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	45	10.00	G3JVM2|G3JVM5|G3JVM7|G3JVM9|O43785|Q14309|Q71TW8|Q8TDA0|Q96KE5	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_FGF_rcpt_fam,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.S398*	ENST00000292408.4	37	c.1193	CCDS4410.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.39|17.39	3.378465|3.378465	0.61735|0.61735	.|.	.|.	ENSG00000160867|ENSG00000160867	ENST00000511076|ENST00000393648	.|.	.|.	.|.	4.44|4.44	-2.8|-2.8	0.05823|0.05823	.|.	.|.	.|.	.|.	.|.	T|.	0.57607|.	0.2065|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.57277|.	-0.7839|.	4|.	.|0.36615	.|T	.|0.2	.|.	11.1627|11.1627	0.48524|0.48524	0.0:0.4536:0.0:0.5464|0.0:0.4536:0.0:0.5464	.|.	.|.	.|.	.|.	S|X	81|398	.|.	.|ENSP00000377259:S398X	R|S	+|+	1|2	0|0	FGFR4|FGFR4	176453108|176453108	0.459000|0.459000	0.25768|0.25768	0.973000|0.973000	0.42090|0.42090	0.152000|0.152000	0.21847|0.21847	-0.099000|-0.099000	0.11007|0.11007	-0.422000|-0.422000	0.07405|0.07405	-0.266000|-0.266000	0.10368|0.10368	CGT|TCG	-	pirsf_FGF_rcpt_fam,superfamily_Kinase-like_dom		0.672	FGFR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGFR4	protein_coding	OTTHUMT00000253410.1	C		-		176520502	+1	no_errors	ENST00000393648	ensembl	human	novel	74_37	nonsense	SNP	0.997	A
SLK	9748	genome.wustl.edu	37	10	105762686	105762686	+	Missense_Mutation	SNP	T	T	G			TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr10:105762686T>G	ENST00000369755.3	+	9	2295	c.1750T>G	c.(1750-1752)Tta>Gta	p.L584V	SLK_ENST00000335753.4_Missense_Mutation_p.L584V	NM_014720.2	NP_055535.2	Q9H2G2	SLK_HUMAN	STE20-like kinase	584	Glu-rich.				apoptotic process (GO:0006915)|protein autophosphorylation (GO:0046777)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)			kidney(1)|lung(1)|ovary(2)|skin(2)|stomach(2)	8		Colorectal(252;0.178)		Epithelial(162;5.81e-10)|all cancers(201;2.35e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)		AGGCCAGAAATTAATTAATAA	0.408																																					NSCLC(111;540 1651 1927 4474 17706)												0								ENSG00000065613						44.0	47.0	46.0					10																	105762686		2203	4300	6503	SLK	SO:0001583	missense	0			-	HGNC		CCDS7553.1	10q25.1	2010-06-25	2010-06-25		ENSG00000065613	ENSG00000065613			11088	protein-coding gene	gene with protein product			"""SNF1 (sucrose nonfermenting, yeast, homolog)-like kinase, SNF1 sucrose nonfermenting like kinase (yeast)"", ""STE20-like kinase (yeast)"""			3526554	Standard	NM_014720		Approved	STK2, se20-9, KIAA0204	uc001kxo.1	Q9H2G2	OTTHUMG00000018999	ENST00000369755.3:c.1750T>G	10.37:g.105762686T>G	ENSP00000358770:p.Leu584Val	Somatic	0	35	0.00		0.5093136486593635	48	27.27	18	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	40	18.37	D3DRA0|D3DRA1|O00211|Q6P1Z4|Q86WU7|Q86WW1|Q92603|Q9NQL0|Q9NQL1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PKK,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_UVR_dom,pfscan_Prot_kinase_dom	p.L584V	ENST00000369755.3	37	c.1750	CCDS7553.1	10	.	.	.	.	.	.	.	.	.	.	T	1.807	-0.475570	0.04414	.	.	ENSG00000065613	ENST00000335753;ENST00000369755	T;T	0.69561	-0.41;-0.41	5.52	1.91	0.25777	Protein kinase-like domain (1);	0.442134	0.21862	N	0.068018	T	0.47135	0.1429	L	0.32530	0.975	0.09310	N	1	P;P	0.41848	0.763;0.651	B;B	0.36666	0.23;0.115	T	0.29882	-0.9997	10	0.26408	T	0.33	.	6.7331	0.23395	0.0:0.4726:0.0:0.5274	.	584;584	Q9H2G2-2;Q9H2G2	.;SLK_HUMAN	V	584	ENSP00000336824:L584V;ENSP00000358770:L584V	ENSP00000336824:L584V	L	+	1	2	SLK	105752676	0.183000	0.23186	0.008000	0.14137	0.160000	0.22226	0.961000	0.29267	0.410000	0.25675	0.454000	0.30748	TTA	-	superfamily_Kinase-like_dom		0.408	SLK-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SLK	protein_coding	OTTHUMT00000050188.1	T	NM_014720	-		105762686	+1	no_errors	ENST00000369755	ensembl	human	known	74_37	missense	SNP	0.001	G
GRHPR	9380	genome.wustl.edu	37	9	37424844	37424844	+	Missense_Mutation	SNP	G	G	T			TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr9:37424844G>T	ENST00000318158.6	+	2	171	c.86G>T	c.(85-87)tGt>tTt	p.C29F	GRHPR_ENST00000493368.1_3'UTR|GRHPR_ENST00000607784.1_Missense_Mutation_p.C29F	NM_012203.1	NP_036335.1	Q9UBQ7	GRHPR_HUMAN	glyoxylate reductase/hydroxypyruvate reductase	29					cellular nitrogen compound metabolic process (GO:0034641)|dicarboxylic acid metabolic process (GO:0043648)|excretion (GO:0007588)|glyoxylate metabolic process (GO:0046487)|metabolic process (GO:0008152)|oxidation-reduction process (GO:0055114)|protein oligomerization (GO:0051259)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|peroxisomal matrix (GO:0005782)	carboxylic acid binding (GO:0031406)|glycerate dehydrogenase activity (GO:0008465)|glyoxylate reductase (NADP) activity (GO:0030267)|hydroxypyruvate reductase activity (GO:0016618)|NAD binding (GO:0051287)|NADPH binding (GO:0070402)|protein homodimerization activity (GO:0042803)			endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	12				GBM - Glioblastoma multiforme(29;0.00687)		CCCCGCAGCTGTGAGGTGGAG	0.687																																																	0								ENSG00000137106						39.0	37.0	38.0					9																	37424844		2203	4300	6503	GRHPR	SO:0001583	missense	0			-	HGNC	AF134895	CCDS6609.1	9q12	2012-07-13			ENSG00000137106	ENSG00000137106	1.1.1.79, 1.1.1.81		4570	protein-coding gene	gene with protein product	"""primary hyperoxaluria type 2"""	604296		GLXR		10524214, 10484776	Standard	XM_005251631		Approved	PH2	uc003zzu.1	Q9UBQ7	OTTHUMG00000019914	ENST00000318158.6:c.86G>T	9.37:g.37424844G>T	ENSP00000313432:p.Cys29Phe	Somatic	0	66	0.00		0.5093136486593635	126	50.20	128	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	44	25.42	Q5T945|Q9H3E9|Q9H636|Q9UKX1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_D-isomer_2_OHA_DH_NAD-bd,pfam_D-isomer_2_OHA_DH_cat_dom,pfam_6PGDH_NADP-bd	p.C29F	ENST00000318158.6	37	c.86	CCDS6609.1	9	.	.	.	.	.	.	.	.	.	.	G	22.1	4.239798	0.79912	.	.	ENSG00000137106	ENST00000377824;ENST00000318158	D;D	0.83075	-1.68;-1.68	5.74	4.82	0.62117	D-isomer specific 2-hydroxyacid dehydrogenase, catalytic domain (1);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.70527	0.3234	N	0.03071	-0.42	0.80722	D	1	B	0.29037	0.231	B	0.37387	0.248	T	0.72899	-0.4152	10	0.54805	T	0.06	.	16.5644	0.84575	0.0:0.13:0.87:0.0	.	29	Q9UBQ7	GRHPR_HUMAN	F	29	ENSP00000367055:C29F;ENSP00000313432:C29F	ENSP00000313432:C29F	C	+	2	0	GRHPR	37414844	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	2.873000	0.48475	2.745000	0.94114	0.650000	0.86243	TGT	-	pfam_D-isomer_2_OHA_DH_cat_dom		0.687	GRHPR-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GRHPR	protein_coding	OTTHUMT00000052442.1	G	NM_012203	-		37424844	+1	no_errors	ENST00000318158	ensembl	human	known	74_37	missense	SNP	1.000	T
HIPK1	204851	genome.wustl.edu	37	1	114499908	114499908	+	Splice_Site	SNP	G	G	T			TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr1:114499908G>T	ENST00000369558.1	+	7	1987	c.1755G>T	c.(1753-1755)caG>caT	p.Q585H	HIPK1_ENST00000426820.2_Splice_Site_p.Q585H|HIPK1_ENST00000369553.1_Splice_Site_p.Q191H|HIPK1_ENST00000369555.2_Splice_Site_p.Q585H|HIPK1_ENST00000369559.4_Splice_Site_p.Q585H|HIPK1_ENST00000406344.1_Splice_Site_p.Q191H|HIPK1_ENST00000369561.4_Intron|HIPK1_ENST00000369554.2_Splice_Site_p.Q585H|HIPK1_ENST00000340480.4_Splice_Site_p.Q211H			Q86Z02	HIPK1_HUMAN	homeodomain interacting protein kinase 1	585					anterior/posterior pattern specification (GO:0009952)|definitive hemopoiesis (GO:0060216)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endothelial cell apoptotic process (GO:0072577)|extrinsic apoptotic signaling pathway (GO:0097191)|eye development (GO:0001654)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|iris morphogenesis (GO:0061072)|lens induction in camera-type eye (GO:0060235)|neuron differentiation (GO:0030182)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tumor necrosis factor-mediated signaling pathway (GO:0010803)|retina layer formation (GO:0010842)|smoothened signaling pathway (GO:0007224)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(15)|ovary(4)|prostate(2)	39	Lung SC(450;0.184)	all_cancers(81;4.5e-08)|all_epithelial(167;1.09e-07)|all_lung(203;1.53e-05)|Lung NSC(69;2.76e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TGCACAATCAGGTATTCAATA	0.383																																																	0								ENSG00000163349						88.0	77.0	80.0					1																	114499908		2203	4300	6503	HIPK1	SO:0001630	splice_region_variant	0			-	HGNC	AB089957	CCDS867.1, CCDS868.1, CCDS869.1, CCDS41370.1	1p13.1	2008-02-05			ENSG00000163349	ENSG00000163349			19006	protein-coding gene	gene with protein product		608003					Standard	NM_198268		Approved	KIAA0630, Myak, MGC26642, Nbak2, MGC33446, MGC33548	uc001eem.3	Q86Z02	OTTHUMG00000011983	ENST00000369558.1:c.1755+1G>T	1.37:g.114499908G>T		Somatic	0	37	0.00		0.5093136486593635	12	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	41	8.89	A6NJ34|O75125|Q5SQL2|Q5SQL4|Q5SQL5|Q8IYD7|Q8NDN5|Q8NEB6|Q8TBZ1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.Q585H	ENST00000369558.1	37	c.1755	CCDS867.1	1	.	.	.	.	.	.	.	.	.	.	G	18.83	3.706888	0.68615	.	.	ENSG00000163349	ENST00000426820;ENST00000369559;ENST00000443627;ENST00000369554;ENST00000369555;ENST00000369558;ENST00000340480;ENST00000369553;ENST00000406344	T;T;T;T;T;T;T;T;T	0.54479	0.57;0.58;0.62;0.57;0.57;0.62;3.68;1.85;1.85	5.09	5.09	0.68999	.	0.000000	0.64402	D	0.000005	T	0.69396	0.3106	M	0.78456	2.415	0.80722	D	1	P;D;P	0.61697	0.945;0.99;0.729	P;D;B	0.70487	0.878;0.969;0.371	T	0.70513	-0.4851	10	0.56958	D	0.05	.	19.04	0.92995	0.0:0.0:1.0:0.0	.	191;585;585	Q86Z02-4;Q86Z02;Q86Z02-2	.;HIPK1_HUMAN;.	H	656;585;585;585;585;585;211;191;191	ENSP00000407442:Q656H;ENSP00000358572:Q585H;ENSP00000409673:Q585H;ENSP00000358567:Q585H;ENSP00000358568:Q585H;ENSP00000358571:Q585H;ENSP00000340956:Q211H;ENSP00000358566:Q191H;ENSP00000384960:Q191H	ENSP00000340956:Q211H	Q	+	3	2	HIPK1	114301431	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.601000	0.98297	2.814000	0.96858	0.650000	0.86243	CAG	-	NULL		0.383	HIPK1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	HIPK1	protein_coding	OTTHUMT00000033127.1	G	NM_198268	-	Missense_Mutation	114499908	+1	no_errors	ENST00000369558	ensembl	human	known	74_37	missense	SNP	1.000	T
ZNF10	7556	genome.wustl.edu	37	12	133733335	133733335	+	Silent	SNP	G	G	A	rs207473570		TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr12:133733335G>A	ENST00000248211.6	+	5	1725	c.1503G>A	c.(1501-1503)aaG>aaA	p.K501K	ZNF10_ENST00000426665.2_Silent_p.K501K|CTD-2140B24.4_ENST00000540096.2_Intron|ZNF268_ENST00000416488.1_Intron|ZNF10_ENST00000402932.2_Silent_p.K367K	NM_015394.4	NP_056209.2	P21506	ZNF10_HUMAN	zinc finger protein 10	501					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(9)|prostate(1)|skin(5)|urinary_tract(1)	26	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;1.28e-06)|all_epithelial(31;0.0051)|Lung NSC(355;0.00948)		OV - Ovarian serous cystadenocarcinoma(86;3.58e-08)|Epithelial(86;6.6e-07)|all cancers(50;2.28e-05)		TCATCCGGAAGAATGACCTCA	0.418																																																	0								ENSG00000256223						95.0	88.0	90.0					12																	133733335		2203	4300	6503	ZNF10	SO:0001819	synonymous_variant	0			-	HGNC	X52332, BC024182	CCDS9283.1	12q24.33	2013-01-08	2005-05-22		ENSG00000256223	ENSG00000256223		"""Zinc fingers, C2H2-type"", ""-"""	12879	protein-coding gene	gene with protein product		194538	"""zinc finger protein 10 (KOX 1)"""			7865130, 8262519	Standard	NM_015394		Approved	KOX1	uc001ulq.3	P21506	OTTHUMG00000167944	ENST00000248211.6:c.1503G>A	12.37:g.133733335G>A		Somatic	0	46	0.00		0.5093136486593635	6	33.33	3	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	39	16.67	B2RBS1|Q8TC91	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K501	ENST00000248211.6	37	c.1503	CCDS9283.1	12																																																																																			-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.418	ZNF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF10	protein_coding	OTTHUMT00000397182.1	G	NM_015394	-		133733335	+1	no_errors	ENST00000248211	ensembl	human	known	74_37	silent	SNP	0.085	A
SH2D6	284948	genome.wustl.edu	37	2	85661740	85661741	+	5'Flank	INS	-	-	A	rs536360058|rs532727235	byFrequency	TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr2:85661740_85661741insA	ENST00000340326.2	+	0	0				SH2D6_ENST00000389938.2_Intron|Y_RNA_ENST00000384478.1_RNA|SH2D6_ENST00000481426.2_Intron	NM_198482.1	NP_940884.1	Q7Z4S9	SH2D6_HUMAN	SH2 domain containing 6											central_nervous_system(1)|lung(2)	3						tgactagacttAAAAAAAAAAA	0.475																																																	0								ENSG00000207207																																			Y_RNA	SO:0001631	upstream_gene_variant	0				RFAM	AF450483	CCDS1976.1	2p11.2	2013-02-14			ENSG00000152292	ENSG00000152292		"""SH2 domain containing"""	30439	protein-coding gene	gene with protein product						12477932	Standard	NM_198482		Approved	FLJ35993	uc002spq.3	Q7Z4S9	OTTHUMG00000130176		2.37:g.85661751_85661751dupA	Exception_encountered	Somatic	0	8	0.00		0.5093136486593635	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	21	12.50	A6ND14|Q6R306	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000340326.2	37	NULL	CCDS1976.1	2																																																																																			-	-		0.475	SH2D6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000207207	protein_coding	OTTHUMT00000252493.2	-	NM_198482			85661741	+1	no_errors	ENST00000384478	ensembl	human	novel	74_37	rna	INS	0.003:0.006	A
DST	667	genome.wustl.edu	37	6	56358840	56358840	+	Missense_Mutation	SNP	C	C	T			TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr6:56358840C>T	ENST00000361203.3	-	78	19409	c.19402G>A	c.(19402-19404)Gaa>Aaa	p.E6468K	DST_ENST00000244364.6_Missense_Mutation_p.E4165K|DST_ENST00000446842.2_Missense_Mutation_p.E6253K|DST_ENST00000312431.6_3'UTR|DST_ENST00000370769.4_Missense_Mutation_p.E6579K|DST_ENST00000421834.2_Missense_Mutation_p.E4491K|DST_ENST00000340834.4_5'Flank|DST_ENST00000370788.2_Missense_Mutation_p.E4382K|DST_ENST00000370754.5_Missense_Mutation_p.E6757K			Q03001	DYST_HUMAN	dystonin	6468					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			TCCACCGATTCCCATTTTTCT	0.363																																																	0								ENSG00000151914						173.0	149.0	156.0					6																	56358840		1822	4089	5911	DST	SO:0001583	missense	0			-	HGNC	M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.19402G>A	6.37:g.56358840C>T	ENSP00000354508:p.Glu6468Lys	Somatic	0	42	0.00		0.5093136486593635	100	49.49	98	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	31	38.00	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Spectrin_repeat,pfam_Plectin_repeat,pfam_CH-domain,pfam_GAS2_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_GAS2_dom,superfamily_ABC1_TM_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,smart_EF_hand_dom,smart_GAS2_dom,pfscan_CH-domain,pfscan_EF_hand_dom	p.E6757K	ENST00000361203.3	37	c.20269		6	.	.	.	.	.	.	.	.	.	.	C	26.1	4.701333	0.88924	.	.	ENSG00000151914	ENST00000244364;ENST00000370754;ENST00000370769;ENST00000421834;ENST00000446842;ENST00000370788;ENST00000361203	T;T;T;T;T;T;T	0.52754	0.65;0.65;0.65;0.65;0.65;0.65;0.65	5.87	5.87	0.94306	.	0.106317	0.41294	D	0.000905	T	0.58609	0.2134	M	0.63843	1.955	0.33074	D	0.535711	D;D;D;P;P	0.89917	0.999;1.0;1.0;0.928;0.584	D;D;D;P;B	0.91635	0.998;0.999;0.998;0.61;0.257	T	0.45542	-0.9254	9	0.16896	T	0.51	.	20.2182	0.98305	0.0:1.0:0.0:0.0	.	4491;6579;6757;6577;4165	Q5TBT1;E7ERU2;E9PEB9;Q03001;Q03001-8	.;.;.;DYST_HUMAN;.	K	4165;6757;6579;4491;6253;4382;6468	ENSP00000244364:E4165K;ENSP00000359790:E6757K;ENSP00000359805:E6579K;ENSP00000400883:E4491K;ENSP00000393645:E6253K;ENSP00000359824:E4382K;ENSP00000354508:E6468K	ENSP00000244364:E4165K	E	-	1	0	DST	56466799	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.028000	0.76470	2.785000	0.95823	0.655000	0.94253	GAA	-	pfam_Spectrin_repeat,superfamily_ABC1_TM_dom,smart_Spectrin/alpha-actinin		0.363	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	DST	protein_coding	OTTHUMT00000041021.3	C	NM_001723	-		56358840	-1	no_errors	ENST00000370754	ensembl	human	known	74_37	missense	SNP	1.000	T
PTPRN	5798	genome.wustl.edu	37	2	220167489	220167489	+	Missense_Mutation	SNP	C	C	T	rs201131601		TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr2:220167489C>T	ENST00000295718.2	-	5	688	c.448G>A	c.(448-450)Gcc>Acc	p.A150T	PTPRN_ENST00000409251.3_Missense_Mutation_p.A150T|PTPRN_ENST00000423636.2_Missense_Mutation_p.A60T|AC114803.3_ENST00000417355.1_RNA	NM_002846.3	NP_002837.1	Q16849	PTPRN_HUMAN	protein tyrosine phosphatase, receptor type, N	150					cytokine-mediated signaling pathway (GO:0019221)|peptidyl-tyrosine dephosphorylation (GO:0035335)|response to cAMP (GO:0051591)|response to estrogen (GO:0043627)|response to glucose (GO:0009749)|response to insulin (GO:0032868)|response to reactive oxygen species (GO:0000302)	integral component of plasma membrane (GO:0005887)	spectrin binding (GO:0030507)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(3)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(28)|ovary(3)|prostate(4)|skin(11)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		Renal(207;0.0474)		Epithelial(149;4.22e-07)|all cancers(144;8.82e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)|STAD - Stomach adenocarcinoma(1183;0.0875)		GCAGCAGGGGCGGAGCCAGTG	0.622													C|||	1	0.000199681	0.0008	0.0	5008	,	,		17241	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000054356						55.0	63.0	60.0					2																	220167489		2202	4300	6502	PTPRN	SO:0001583	missense	0			GMAF=0.0005	HGNC		CCDS2440.1, CCDS56167.1, CCDS56168.1	2q35-q36.1	2011-06-09			ENSG00000054356	ENSG00000054356		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9676	protein-coding gene	gene with protein product		601773				8024693	Standard	NM_001199763		Approved	IA-2	uc002vkz.3	Q16849	OTTHUMG00000133129	ENST00000295718.2:c.448G>A	2.37:g.220167489C>T	ENSP00000295718:p.Ala150Thr	Somatic	0	68	0.00		0.5093136486593635	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	47	11.32	B4DK12|F5GZS3|Q08319|Q53QD6|Q6NSL1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Receptor_IA-2,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.A150T	ENST00000295718.2	37	c.448	CCDS2440.1	2	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	4.578	0.107402	0.08780	.	.	ENSG00000054356	ENST00000409251;ENST00000295718;ENST00000539342;ENST00000537666;ENST00000536579;ENST00000412847;ENST00000446182;ENST00000440552;ENST00000442029;ENST00000451506	T;T;T	0.03607	3.87;3.91;3.88	4.79	-0.6	0.11642	.	0.613056	0.13780	N	0.363294	T	0.02688	0.0081	L	0.40543	1.245	0.09310	N	1	B;B	0.17268	0.021;0.01	B;B	0.06405	0.002;0.001	T	0.47983	-0.9074	10	0.13853	T	0.58	.	4.4008	0.11385	0.1616:0.3673:0.0:0.4711	.	150;150	Q6NSL1;Q16849	.;PTPRN_HUMAN	T	150;150;150;60;150;60;60;117;60;60	ENSP00000386638:A150T;ENSP00000295718:A150T;ENSP00000444244:A60T	ENSP00000295718:A150T	A	-	1	0	PTPRN	219875733	0.090000	0.21635	0.029000	0.17559	0.043000	0.13939	-0.052000	0.11865	-0.053000	0.13289	0.561000	0.74099	GCC	-	NULL		0.622	PTPRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRN	protein_coding	OTTHUMT00000256819.2	C		rs201131601		220167489	-1	no_errors	ENST00000295718	ensembl	human	known	74_37	missense	SNP	0.011	T
LETM2	137994	genome.wustl.edu	37	8	38264976	38264976	+	Missense_Mutation	SNP	G	G	A			TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr8:38264976G>A	ENST00000379957.4	+	10	1535	c.1408G>A	c.(1408-1410)Gaa>Aaa	p.E470K	LETM2_ENST00000524874.1_Missense_Mutation_p.E422K|LETM2_ENST00000527710.1_Missense_Mutation_p.E256K|RP11-350N15.6_ENST00000606593.1_RNA|LETM2_ENST00000523983.2_Missense_Mutation_p.E423K|LETM2_ENST00000297720.5_Missense_Mutation_p.E375K	NM_001199659.1	NP_001186588.1	Q2VYF4	LETM2_HUMAN	leucine zipper-EF-hand containing transmembrane protein 2	470						integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				NS(1)|large_intestine(1)|lung(3)|prostate(2)	7	all_cancers(2;6.77e-47)|all_epithelial(2;1.01e-50)|all_lung(3;1.25e-23)|Lung NSC(2;2.76e-23)|Colorectal(12;0.000442)|Esophageal squamous(3;0.00202)	all_lung(54;0.0657)|Hepatocellular(245;0.152)|Lung NSC(58;0.175)	Epithelial(3;1.17e-42)|all cancers(3;5.44e-38)|BRCA - Breast invasive adenocarcinoma(5;5.44e-27)|LUSC - Lung squamous cell carcinoma(2;7.12e-25)|Lung(2;4.49e-22)|COAD - Colon adenocarcinoma(9;0.114)			TTCTTCTGAAGAACCTGTAAG	0.378																																																	0								ENSG00000165046						135.0	127.0	129.0					8																	38264976		2203	4300	6503	LETM2	SO:0001583	missense	0			-	HGNC	AK058138	CCDS6106.1, CCDS56534.1, CCDS69466.1, CCDS75731.1	8p12	2013-01-11						"""EF-hand domain containing"""	14648	protein-coding gene	gene with protein product						11549311	Standard	NM_001286821		Approved	FLJ25409	uc003xlm.2	Q2VYF4		ENST00000379957.4:c.1408G>A	8.37:g.38264976G>A	ENSP00000369291:p.Glu470Lys	Somatic	0	64	0.00		0.5093136486593635	10	44.44	8	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	70	17.65	A6NMG3|Q8NCR2|Q96LL1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_LETM1	p.E470K	ENST00000379957.4	37	c.1408		8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.57|11.57	1.676847|1.676847	0.29783|0.29783	.|.	.|.	ENSG00000165046|ENSG00000165046	ENST00000297720;ENST00000524874;ENST00000379957;ENST00000523983;ENST00000527710|ENST00000527175	.|.	.|.	.|.	5.17|5.17	4.26|4.26	0.50523|0.50523	.|.	0.289624|.	0.29225|.	N|.	0.012765|.	T|T	0.66509|0.66509	0.2796|0.2796	M|M	0.69823|0.69823	2.125|2.125	0.39798|0.39798	D|D	0.972536|0.972536	P;P|.	0.42908|.	0.793;0.793|.	B;B|.	0.38842|.	0.283;0.283|.	T|T	0.67875|0.67875	-0.5557|-0.5557	9|5	0.24483|.	T|.	0.36|.	-3.9772|-3.9772	11.6482|11.6482	0.51273|0.51273	0.0:0.1796:0.8204:0.0|0.0:0.1796:0.8204:0.0	.|.	470;422|.	Q2VYF4;E9PMA4|.	LETM2_HUMAN;.|.	K|K	375;422;470;423;256|64	.|.	ENSP00000297720:E375K|.	E|R	+|+	1|2	0|0	LETM2|LETM2	38384133|38384133	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.116000|0.116000	0.19942|0.19942	2.922000|2.922000	0.48860|0.48860	1.233000|1.233000	0.43693|0.43693	0.561000|0.561000	0.74099|0.74099	GAA|AGA	-	NULL		0.378	LETM2-013	KNOWN	basic|appris_candidate_longest	protein_coding	LETM2	protein_coding	OTTHUMT00000381816.1	G	NM_144652	-		38264976	+1	no_errors	ENST00000379957	ensembl	human	known	74_37	missense	SNP	1.000	A
LOC730102	730102	genome.wustl.edu	37	1	177977224	177977224	+	RNA	SNP	G	G	C			TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr1:177977224G>C	ENST00000354921.3	-	0	105				RP11-568K15.1_ENST00000476232.2_RNA																							ATTTATTTAAGAGCGAGAAGC	0.418																																																	0								ENSG00000242193																																			RP11-568K15.1			0			-	Clone_based_vega_gene																													1.37:g.177977224G>C		Somatic	0	116	0.00		0.5093136486593635	3	50.00	3	WXS	Illumina HiSeq 2500	Phase_IV	tier1	36	85	29.75		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000354921.3	37	NULL		1																																																																																			-	-		0.418	RP4-798P15.3-003	KNOWN	basic|readthrough_transcript	processed_transcript	LOC730102	processed_transcript	OTTHUMT00000084770.16	G		-		177977224	-1	no_errors	ENST00000476232	ensembl	human	known	74_37	rna	SNP	0.000	C
MAP1B	4131	genome.wustl.edu	37	5	71495628	71495628	+	Nonsense_Mutation	SNP	C	C	A			TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr5:71495628C>A	ENST00000296755.7	+	5	6744	c.6446C>A	c.(6445-6447)tCa>tAa	p.S2149*		NM_005909.3	NP_005900.2	P46821	MAP1B_HUMAN	microtubule-associated protein 1B	2149					axon extension (GO:0048675)|cellular process (GO:0009987)|dendrite development (GO:0016358)|establishment of monopolar cell polarity (GO:0061162)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of intracellular transport (GO:0032387)|positive regulation of axon extension (GO:0045773)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|plasma membrane (GO:0005886)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(42)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	104		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)		CCTCCCACCTCAGTCAGCGAG	0.587																																					Melanoma(17;367 822 11631 31730 47712)												0								ENSG00000131711						90.0	81.0	84.0					5																	71495628		2203	4300	6503	MAP1B	SO:0001587	stop_gained	0			-	HGNC	L06237	CCDS4012.1	5q13	2014-06-12			ENSG00000131711	ENSG00000131711			6836	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 102"""	157129				1881920	Standard	NM_005909		Approved	MAP5, PPP1R102	uc003kbw.4	P46821	OTTHUMG00000100952	ENST00000296755.7:c.6446C>A	5.37:g.71495628C>A	ENSP00000296755:p.Ser2149*	Somatic	0	33	0.00		0.5093136486593635	191	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	23	14.81	A2BDK5	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MAP1B_neuraxin	p.S2149*	ENST00000296755.7	37	c.6446	CCDS4012.1	5	.	.	.	.	.	.	.	.	.	.	C	48	14.872371	0.99813	.	.	ENSG00000131711	ENST00000296755	.	.	.	5.82	5.82	0.92795	.	0.000000	0.52532	D	0.000072	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.7908	20.0953	0.97838	0.0:1.0:0.0:0.0	.	.	.	.	X	2149	.	ENSP00000296755:S2149X	S	+	2	0	MAP1B	71531384	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.818000	0.86416	2.767000	0.95098	0.655000	0.94253	TCA	-	NULL		0.587	MAP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP1B	protein_coding	OTTHUMT00000218561.6	C	NM_005909	-		71495628	+1	no_errors	ENST00000296755	ensembl	human	known	74_37	nonsense	SNP	1.000	A
LAYN	143903	genome.wustl.edu	37	11	111425989	111425989	+	Missense_Mutation	SNP	C	C	T			TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr11:111425989C>T	ENST00000375615.3	+	6	841	c.656C>T	c.(655-657)gCc>gTc	p.A219V	LAYN_ENST00000533265.1_Missense_Mutation_p.A211V|LAYN_ENST00000436913.2_Missense_Mutation_p.A66V|LAYN_ENST00000525126.1_Missense_Mutation_p.A219V|LAYN_ENST00000375614.2_Missense_Mutation_p.A211V|LAYN_ENST00000528924.1_3'UTR	NM_001258390.1	NP_001245319.1	Q6UX15	LAYN_HUMAN	layilin	219				A -> T (in Ref. 2; BAB70978). {ECO:0000305}.		cell surface (GO:0009986)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|ruffle (GO:0001726)	carbohydrate binding (GO:0030246)|hyaluronic acid binding (GO:0005540)			breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(3)|skin(1)	14		all_cancers(61;9.06e-10)|all_epithelial(67;1.34e-05)|Melanoma(852;1.74e-05)|all_hematologic(158;0.000885)|Acute lymphoblastic leukemia(157;0.000966)|Medulloblastoma(222;0.0523)|all_neural(223;0.0663)|Breast(348;0.086)		Epithelial(105;1.5e-06)|BRCA - Breast invasive adenocarcinoma(274;1.63e-06)|all cancers(92;2.45e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0476)	Hyaluronan(DB08818)	GAAGAAGATGCCAAAAAAACA	0.403																																					Ovarian(17;551 586 12136 22082 22900)												0								ENSG00000204381						75.0	72.0	73.0					11																	111425989		2201	4297	6498	LAYN	SO:0001583	missense	0			-	HGNC		CCDS31676.1, CCDS58178.1, CCDS58179.1	11q23.1	2006-02-09			ENSG00000204381	ENSG00000204381			29471	protein-coding gene	gene with protein product						15913605	Standard	NM_001258390		Approved	FLJ30977, FLJ31092	uc001plr.2	Q6UX15	OTTHUMG00000166721	ENST00000375615.3:c.656C>T	11.37:g.111425989C>T	ENSP00000364765:p.Ala219Val	Somatic	0	40	0.00		0.5093136486593635	34	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.16	A6NJB0|B4DJU0|Q8TAY8|Q96NC5|Q96NF3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	p.A219V	ENST00000375615.3	37	c.656	CCDS58178.1	11	.	.	.	.	.	.	.	.	.	.	C	15.00	2.702425	0.48307	.	.	ENSG00000204381	ENST00000375614;ENST00000375615;ENST00000525126;ENST00000436913;ENST00000533265;ENST00000541011;ENST00000530962	T;T;T;T	0.05649	3.93;3.51;3.41;4.12	4.99	3.06	0.35304	.	0.804545	0.11795	N	0.528770	T	0.06050	0.0157	L	0.41236	1.265	0.24301	N	0.995121	B;B;B;B;B	0.25351	0.124;0.002;0.002;0.003;0.006	B;B;B;B;B	0.24269	0.052;0.004;0.003;0.001;0.009	T	0.40059	-0.9583	9	.	.	.	-1.5862	7.2974	0.26401	0.1672:0.7457:0.0:0.0871	.	66;211;219;219;211	B4DJU0;E9PMI0;Q6UX15;E9PQU7;Q6UX15-2	.;.;LAYN_HUMAN;.;.	V	211;219;219;66;211;174;67	ENSP00000364764:A211V;ENSP00000364765:A219V;ENSP00000434328:A219V;ENSP00000434972:A211V	.	A	+	2	0	LAYN	110931199	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	1.284000	0.33249	0.762000	0.33152	0.655000	0.94253	GCC	-	NULL		0.403	LAYN-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LAYN	protein_coding	OTTHUMT00000391187.1	C	NM_178834	-		111425989	+1	no_errors	ENST00000375615	ensembl	human	known	74_37	missense	SNP	1.000	T
ADAM22	53616	genome.wustl.edu	37	7	87746112	87746112	+	Missense_Mutation	SNP	T	T	G			TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr7:87746112T>G	ENST00000265727.7	+	7	669	c.590T>G	c.(589-591)tTg>tGg	p.L197W	ADAM22_ENST00000398204.4_Missense_Mutation_p.L197W|ADAM22_ENST00000398201.4_Missense_Mutation_p.L197W|ADAM22_ENST00000439864.1_Missense_Mutation_p.L197W|ADAM22_ENST00000398209.3_Missense_Mutation_p.L197W|ADAM22_ENST00000315984.7_Missense_Mutation_p.L197W			Q9P0K1	ADA22_HUMAN	ADAM metallopeptidase domain 22	197					adult locomotory behavior (GO:0008344)|cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|myelination in peripheral nervous system (GO:0022011)|negative regulation of cell adhesion (GO:0007162)	integral component of membrane (GO:0016021)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(7)|kidney(4)|large_intestine(7)|liver(2)|lung(20)|ovary(6)|prostate(4)|skin(3)	53	Esophageal squamous(14;0.00202)		STAD - Stomach adenocarcinoma(171;0.215)			GAATTTTCCTTGGATGATCTT	0.318																																																	0								ENSG00000008277						189.0	170.0	176.0					7																	87746112		1855	4100	5955	ADAM22	SO:0001583	missense	0			-	HGNC	AB009671	CCDS43608.1, CCDS43609.1, CCDS43610.1, CCDS47637.1	7q21	2008-07-18	2005-08-18		ENSG00000008277	ENSG00000008277		"""ADAM metallopeptidase domain containing"""	201	protein-coding gene	gene with protein product	"""metalloproteinase-like, disintegrin-like, and cysteine-rich protein 2"""	603709	"""a disintegrin and metalloproteinase domain 22"""			9693107, 10524237	Standard	NM_021723		Approved	MDC2	uc003ujn.3	Q9P0K1	OTTHUMG00000137417	ENST00000265727.7:c.590T>G	7.37:g.87746112T>G	ENSP00000265727:p.Leu197Trp	Somatic	0	38	0.00		0.5093136486593635	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	32	13.51	O75075|O75076|Q9P0K2|Q9UIA1|Q9UKK2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_ADAM_Cys-rich,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_Peptidase_M12B,prints_Blood-coag_inhib_Disintegrin	p.L197W	ENST00000265727.7	37	c.590	CCDS47637.1	7	.	.	.	.	.	.	.	.	.	.	T	20.6	4.015053	0.75161	.	.	ENSG00000008277	ENST00000398204;ENST00000439864;ENST00000398201;ENST00000265727;ENST00000315984;ENST00000398209;ENST00000398203	T;T;T;T;T;T;T	0.04917	4.38;3.53;4.37;4.37;4.39;4.38;4.38	5.93	5.93	0.95920	.	0.538685	0.18438	N	0.141207	T	0.11707	0.0285	L	0.32530	0.975	0.44694	D	0.997682	P;P;P;P;D;P	0.54964	0.942;0.941;0.902;0.922;0.969;0.902	P;P;P;P;P;P	0.54460	0.571;0.753;0.447;0.729;0.682;0.571	T	0.12785	-1.0534	10	0.34782	T	0.22	.	13.903	0.63817	0.0:0.0:0.0:1.0	.	249;197;197;197;197;197	E9PBH5;Q9P0K1-5;Q9P0K1;Q9P0K1-2;E7EPF1;D6W5P7	.;.;ADA22_HUMAN;.;.;.	W	197;197;197;197;197;197;164	ENSP00000381262:L197W;ENSP00000391334:L197W;ENSP00000381260:L197W;ENSP00000265727:L197W;ENSP00000315900:L197W;ENSP00000381267:L197W;ENSP00000381261:L164W	ENSP00000265727:L197W	L	+	2	0	ADAM22	87584048	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.154000	0.42291	2.271000	0.75665	0.533000	0.62120	TTG	-	NULL		0.318	ADAM22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ADAM22	protein_coding	OTTHUMT00000268370.2	T	NM_021723	-		87746112	+1	no_errors	ENST00000265727	ensembl	human	known	74_37	missense	SNP	1.000	G
RYR3	6263	genome.wustl.edu	37	15	34015055	34015055	+	Missense_Mutation	SNP	C	C	G			TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr15:34015055C>G	ENST00000389232.4	+	44	6829	c.6759C>G	c.(6757-6759)aaC>aaG	p.N2253K	Y_RNA_ENST00000363138.1_RNA|RYR3_ENST00000415757.3_Missense_Mutation_p.N2253K	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	2253	4 X approximate repeats.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		TCTCTGAGAACCCAGCGCTCG	0.557																																																	0								ENSG00000198838						88.0	92.0	91.0					15																	34015055		1952	4123	6075	RYR3	SO:0001583	missense	0			-	HGNC		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.6759C>G	15.37:g.34015055C>G	ENSP00000373884:p.Asn2253Lys	Somatic	0	42	0.00		0.5093136486593635	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	50	13.79	O15175|Q15412	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ryanodine_rcpt,pfam_Ca-rel_channel,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,superfamily_4_helix_cytokine-like_core,superfamily_ARM-type_fold,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_hand_dom,pfscan_MIR_motif	p.N2253K	ENST00000389232.4	37	c.6759	CCDS45210.1	15	.	.	.	.	.	.	.	.	.	.	C	11.59	1.683567	0.29872	.	.	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	D;D	0.97186	-4.28;-4.28	4.93	2.07	0.26955	.	0.323932	0.32273	N	0.006336	D	0.90652	0.7068	N	0.11427	0.14	0.39545	D	0.968876	B;B	0.14012	0.006;0.009	B;B	0.19946	0.014;0.027	T	0.83223	-0.0067	10	0.41790	T	0.15	.	7.8767	0.29597	0.0:0.5728:0.0:0.4272	.	2253;2253	Q15413-2;Q15413	.;RYR3_HUMAN	K	2253	ENSP00000373884:N2253K;ENSP00000399610:N2253K	ENSP00000354735:N2253K	N	+	3	2	RYR3	31802347	0.999000	0.42202	0.959000	0.39883	0.734000	0.41952	0.611000	0.24268	0.290000	0.22444	0.555000	0.69702	AAC	-	NULL		0.557	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR3	protein_coding	OTTHUMT00000417514.1	C		-		34015055	+1	no_errors	ENST00000389232	ensembl	human	known	74_37	missense	SNP	0.994	G
FAM189A2	9413	genome.wustl.edu	37	9	72003271	72003271	+	Missense_Mutation	SNP	G	G	C			TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr9:72003271G>C	ENST00000257515.8	+	10	1474	c.1054G>C	c.(1054-1056)Gac>Cac	p.D352H	FAM189A2_ENST00000455972.1_Missense_Mutation_p.D352H|FAM189A2_ENST00000469179.1_3'UTR|FAM189A2_ENST00000303068.7_Missense_Mutation_p.D187H|FAM189A2_ENST00000377216.3_Missense_Mutation_p.D139H	NM_004816.3	NP_004807.3	Q15884	F1892_HUMAN	family with sequence similarity 189, member A2	352						integral component of membrane (GO:0016021)				endometrium(3)|large_intestine(5)|liver(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	12						CATGACCCCAGACATCCATGA	0.468																																																	0								ENSG00000135063						67.0	63.0	64.0					9																	72003271		2203	4300	6503	FAM189A2	SO:0001583	missense	0			-	HGNC	L27479	CCDS6629.1	9q21.11	2009-07-09	2009-07-09	2009-07-09	ENSG00000135063	ENSG00000135063			24820	protein-coding gene	gene with protein product		607710	"""chromosome 9 open reading frame 61"""	C9orf61		7951235	Standard	NM_004816		Approved	X123	uc010mon.1	Q15884	OTTHUMG00000019979	ENST00000257515.8:c.1054G>C	9.37:g.72003271G>C	ENSP00000257515:p.Asp352His	Somatic	0	40	0.00		0.5093136486593635	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	51	14.75	Q14CN5|Q5T6C8|Q5T6C9|Q6ZTX4|Q96N10	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_CD20-like	p.D352H	ENST00000257515.8	37	c.1054	CCDS6629.1	9	.	.	.	.	.	.	.	.	.	.	G	28.5	4.926923	0.92319	.	.	ENSG00000135063	ENST00000455972;ENST00000257515;ENST00000303068;ENST00000377225;ENST00000377216	T;T;T	0.37752	2.26;2.26;1.18	5.8	5.8	0.92144	.	0.105856	0.64402	D	0.000005	T	0.59770	0.2218	M	0.62723	1.935	0.80722	D	1	D	0.89917	1.0	D	0.68192	0.956	T	0.59231	-0.7493	10	0.66056	D	0.02	-30.1257	20.063	0.97692	0.0:0.0:1.0:0.0	.	352	Q15884	F1892_HUMAN	H	352;352;187;351;139	ENSP00000395675:D352H;ENSP00000257515:D352H;ENSP00000304435:D187H	ENSP00000257515:D352H	D	+	1	0	FAM189A2	71193091	1.000000	0.71417	0.991000	0.47740	0.990000	0.78478	9.731000	0.98807	2.735000	0.93741	0.655000	0.94253	GAC	-	NULL		0.468	FAM189A2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM189A2	protein_coding	OTTHUMT00000052576.2	G	NM_004816	-		72003271	+1	no_errors	ENST00000257515	ensembl	human	known	74_37	missense	SNP	1.000	C
MATN3	4148	genome.wustl.edu	37	2	20196958	20196958	+	Missense_Mutation	SNP	C	C	T	rs544319732		TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr2:20196958C>T	ENST00000407540.3	-	6	1293	c.1231G>A	c.(1231-1233)Gca>Aca	p.A411T	AC079145.4_ENST00000416575.1_RNA|MATN3_ENST00000421259.2_Missense_Mutation_p.A369T	NM_002381.4	NP_002372.1	O15232	MATN3_HUMAN	matrilin 3	411	EGF-like 4. {ECO:0000255|PROSITE- ProRule:PRU00076}.				extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)			central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(6)|skin(1)	13	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGGTAGGATGCGGCCCCATCA	0.488																																																	0								ENSG00000132031						70.0	67.0	68.0					2																	20196958		1998	4162	6160	MATN3	SO:0001583	missense	0			-	HGNC	AJ001047	CCDS46226.1	2p24-p23	2008-06-03			ENSG00000132031	ENSG00000132031			6909	protein-coding gene	gene with protein product		602109				9287130, 9350998	Standard	NM_002381		Approved	EDM5, HOA	uc002rdl.3	O15232	OTTHUMG00000151788	ENST00000407540.3:c.1231G>A	2.37:g.20196958C>T	ENSP00000383894:p.Ala411Thr	Somatic	0	22	0.00		0.5093136486593635	6	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	22	15.38	B2CPU0|Q4ZG02	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_VWF_A,pfam_Matrilin_coiled-coil_trimer,pfam_EGF-like_Ca-bd_dom,smart_VWF_A,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_VWF_A	p.A411T	ENST00000407540.3	37	c.1231	CCDS46226.1	2	.	.	.	.	.	.	.	.	.	.	C	2.261	-0.369336	0.05069	.	.	ENSG00000132031	ENST00000407540;ENST00000421259	D;D	0.96300	-3.97;-3.97	6.17	3.37	0.38596	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.731382	0.12411	N	0.471244	D	0.89770	0.6811	N	0.12663	0.25	0.09310	N	1	B;B	0.12630	0.006;0.006	B;B	0.06405	0.002;0.002	T	0.81093	-0.1089	10	0.46703	T	0.11	-8.1278	5.544	0.17053	0.0:0.6164:0.1415:0.2421	.	369;411	B2CPU0;O15232	.;MATN3_HUMAN	T	411;369	ENSP00000383894:A411T;ENSP00000398753:A369T	ENSP00000383894:A411T	A	-	1	0	MATN3	20060439	0.000000	0.05858	0.001000	0.08648	0.209000	0.24338	-0.341000	0.07811	0.446000	0.26666	-0.137000	0.14449	GCA	-	smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom		0.488	MATN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MATN3	protein_coding	OTTHUMT00000323925.1	C	NM_002381	-		20196958	-1	no_errors	ENST00000407540	ensembl	human	known	74_37	missense	SNP	0.000	T
CTNNA2	1496	genome.wustl.edu	37	2	80831148	80831148	+	Intron	SNP	T	T	A			TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr2:80831148T>A	ENST00000402739.4	+	15	2194				AC008067.2_ENST00000609950.1_RNA|AC008067.2_ENST00000596887.1_RNA|CTNNA2_ENST00000541047.1_Intron|AC008067.2_ENST00000599412.2_RNA|AC008067.2_ENST00000430876.1_RNA|CTNNA2_ENST00000361291.4_Intron|CTNNA2_ENST00000343114.3_Intron|AC008067.2_ENST00000595478.1_RNA|CTNNA2_ENST00000540488.1_Intron|AC008067.2_ENST00000596783.1_RNA|CTNNA2_ENST00000496558.1_Intron|CTNNA2_ENST00000466387.1_Intron	NM_001282597.1	NP_001269526.1	P26232	CTNA2_HUMAN	catenin (cadherin-associated protein), alpha 2						axonogenesis (GO:0007409)|brain morphogenesis (GO:0048854)|dendrite morphogenesis (GO:0048813)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|prepulse inhibition (GO:0060134)|radial glia guided migration of Purkinje cell (GO:0021942)|regulation of synapse structural plasticity (GO:0051823)|single organismal cell-cell adhesion (GO:0016337)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|axon (GO:0030424)|basolateral plasma membrane (GO:0016323)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	structural constituent of cytoskeleton (GO:0005200)			breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(49)|pancreas(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	78						TAGGTTGGTCTCTTTCCCGTC	0.378																																																	0								ENSG00000237031						32.0	31.0	31.0					2																	80831148		1884	4109	5993	AC008067.2	SO:0001627	intron_variant	0			-	Clone_based_vega_gene		CCDS42703.2, CCDS62944.1, CCDS62945.1, CCDS74531.1	2p12-p11.1	2010-05-04			ENSG00000066032	ENSG00000066032			2510	protein-coding gene	gene with protein product	"""cadherin-associated protein, related"", ""cancer/testis antigen 114"""	114025				8432524	Standard	NM_004389		Approved	CAP-R, CT114	uc010ysf.2	P26232	OTTHUMG00000152903	ENST00000402739.4:c.2190-51T>A	2.37:g.80831148T>A		Somatic	0	49	0.00		0.5093136486593635	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	43	15.69	B3KXE5|B7Z2W7|B7Z352|B7Z898|Q4ZFW1|Q53R26|Q53R33|Q53T67|Q53T71|Q53TM8|Q7Z3L1|Q7Z3Y0	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000402739.4	37	NULL		2																																																																																			-	-		0.378	CTNNA2-003	PUTATIVE	basic|exp_conf	protein_coding	ENSG00000237031	protein_coding	OTTHUMT00000328511.4	T	NM_004389	-		80831148	-1	no_errors	ENST00000595478	ensembl	human	known	74_37	rna	SNP	0.000	A
FUT2	2524	genome.wustl.edu	37	19	49207147	49207147	+	Missense_Mutation	SNP	C	C	T			TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr19:49207147C>T	ENST00000425340.2	+	2	1051	c.934C>T	c.(934-936)Ccc>Tcc	p.P312S	FUT2_ENST00000391876.4_Missense_Mutation_p.P312S	NM_000511.5|NM_001097638.2	NP_000502.4|NP_001091107.1	Q10981	FUT2_HUMAN	fucosyltransferase 2 (secretor status included)	312					carbohydrate metabolic process (GO:0005975)|fucosylation (GO:0036065)|L-fucose catabolic process (GO:0042355)|protein glycosylation (GO:0006486)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	fucosyltransferase activity (GO:0008417)|galactoside 2-alpha-L-fucosyltransferase activity (GO:0008107)			breast(1)|central_nervous_system(2)|endometrium(1)|large_intestine(1)|lung(2)	7		all_lung(116;4.89e-06)|all_epithelial(76;7.04e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.00011)|all cancers(93;0.000238)|GBM - Glioblastoma multiforme(486;0.0164)|Epithelial(262;0.017)		TTACACCCTCCCCGACTCCCC	0.567																																																	0								ENSG00000176920						130.0	114.0	119.0					19																	49207147		2203	4300	6503	FUT2	SO:0001583	missense	0			-	HGNC		CCDS33069.1	19q13.33	2014-07-19			ENSG00000176920	ENSG00000176920		"""Fucosyltransferases"""	4013	protein-coding gene	gene with protein product	"""alpha (1,2) fucosyltransferase"", ""galactoside 2-alpha-L-fucosyltransferase 2"", ""GDP-L-fucose:beta-D-galactoside 2-alpha-L-fucosyltransferase 2"", ""alpha(1,2)FT2"", ""secretor factor"", ""secretor blood group alpha-2-fucosyltransferase"""	182100		SE		1763885	Standard	NM_000511		Approved	sej, Se2, SEC2	uc010emc.3	Q10981	OTTHUMG00000164427	ENST00000425340.2:c.934C>T	19.37:g.49207147C>T	ENSP00000387498:p.Pro312Ser	Somatic	0	57	0.00		0.5093136486593635	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	44	13.73	Q0VAG5|Q14338|Q5D0G2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Glyco_trans_11	p.P312S	ENST00000425340.2	37	c.934	CCDS33069.1	19	.	.	.	.	.	.	.	.	.	.	C	17.83	3.484432	0.63962	.	.	ENSG00000176920	ENST00000425340;ENST00000391876	D;D	0.96334	-3.98;-3.98	4.99	4.99	0.66335	.	.	.	.	.	D	0.98365	0.9457	M	0.90650	3.135	0.50039	D	0.999846	D	0.89917	1.0	D	0.97110	1.0	D	0.99229	1.0881	8	.	.	.	.	16.1416	0.81528	0.0:1.0:0.0:0.0	.	312	Q10981	FUT2_HUMAN	S	312	ENSP00000387498:P312S;ENSP00000375748:P312S	.	P	+	1	0	FUT2	53898959	0.996000	0.38824	0.961000	0.40146	0.495000	0.33615	4.736000	0.62059	2.465000	0.83290	0.549000	0.68633	CCC	-	pfam_Glyco_trans_11		0.567	FUT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FUT2	protein_coding	OTTHUMT00000378731.2	C	NM_000511	-		49207147	+1	no_errors	ENST00000391876	ensembl	human	known	74_37	missense	SNP	0.993	T
NFASC	23114	genome.wustl.edu	37	1	204966566	204966566	+	Intron	SNP	T	T	A			TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr1:204966566T>A	ENST00000401399.1	+	24	3218				NFASC_ENST00000339876.6_Intron|NFASC_ENST00000404907.1_Intron|NFASC_ENST00000367170.4_Intron|NFASC_ENST00000539706.1_Intron|NFASC_ENST00000338586.6_Intron|NFASC_ENST00000513543.1_Intron|NFASC_ENST00000360049.4_Intron|NFASC_ENST00000367169.4_Intron|NFASC_ENST00000367171.4_Intron|NFASC_ENST00000367172.4_Intron|NFASC_ENST00000495396.1_Intron|NFASC_ENST00000404076.1_Intron|NFASC_ENST00000338515.6_Intron			O94856	NFASC_HUMAN	neurofascin						axon guidance (GO:0007411)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|myelination (GO:0042552)|paranodal junction assembly (GO:0030913)|peripheral nervous system development (GO:0007422)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|synapse organization (GO:0050808)|transmission of nerve impulse (GO:0019226)	axon initial segment (GO:0043194)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|node of Ranvier (GO:0033268)|paranodal junction (GO:0033010)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)				NS(1)|breast(4)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	81	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			CCCCATCCCCTCCTGGCCCGC	0.662																																																	0								ENSG00000163531						178.0	189.0	186.0					1																	204966566		1278	2899	4177	NFASC	SO:0001627	intron_variant	0			-	HGNC	AK027553	CCDS30982.1, CCDS53460.1, CCDS53461.1, CCDS53462.1	1q32.1	2013-02-11	2010-06-24		ENSG00000163531	ENSG00000163531		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	29866	protein-coding gene	gene with protein product		609145	"""neurofascin homolog (chicken)"""			1377696, 8672144	Standard	NM_015090		Approved	NRCAML, KIAA0756, FLJ46866, NF	uc001hbj.3	O94856	OTTHUMG00000151697	ENST00000401399.1:c.3019+32T>A	1.37:g.204966566T>A		Somatic	0	56	0.00		0.5093136486593635	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	41	15.69	B2RNN8|B3KQZ1|B5MDP6|B5MDR6|B7ZMD8|Q149P5|Q5T2F0|Q5T2F1|Q5T2F2|Q5T2F3|Q5T2F4|Q5T2F5|Q5T2F6|Q5T2F7|Q5T2F9|Q5T2G0|Q5W9F8|Q68DH3|Q6ZQV6|Q7Z3K1|Q96HT1|Q96K50	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000401399.1	37	NULL	CCDS53460.1	1																																																																																			-	-		0.662	NFASC-001	KNOWN	basic|CCDS	protein_coding	NFASC	protein_coding	OTTHUMT00000131237.1	T	NM_001005388	-		204966566	+1	no_errors	ENST00000492085	ensembl	human	known	74_37	rna	SNP	0.169	A
CYP2B7P	1556	genome.wustl.edu	37	19	41450278	41450278	+	RNA	SNP	G	G	A	rs567948411		TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr19:41450278G>A	ENST00000597260.1	+	0	0				CYP2B7P1_ENST00000599198.1_RNA																							GGCCCACATCGCCCTCCAGCG	0.507																																																	0								ENSG00000256612																																			CYP2B7P1			0			-	HGNC																													19.37:g.41450278G>A		Somatic	0	51	0.00		0.5093136486593635	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	42	23.64		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000597260.1	37	NULL		19	.	.	.	.	.	.	.	.	.	.	G	8.466	0.856506	0.17106	.	.	ENSG00000256612	ENST00000541697	.	.	.	3.55	2.5	0.30297	.	0.118515	0.56097	D	0.000033	T	0.57242	0.2040	.	.	.	.	.	.	.	.	.	.	.	.	T	0.69194	-0.5209	5	0.72032	D	0.01	.	8.9617	0.35851	0.1149:0.0:0.8851:0.0	.	.	.	.	H	336	.	ENSP00000441190:R336H	R	+	2	0	AC008537.4	46142118	0.962000	0.33011	0.004000	0.12327	0.155000	0.21991	4.235000	0.58666	0.848000	0.35191	0.400000	0.26472	CGC	-	-		0.507	AC092071.1-001	KNOWN	basic	sense_intronic	CYP2B7P1	sense_intronic	OTTHUMT00000463563.1	G		-		41450278	+1	no_errors	ENST00000599198	ensembl	human	known	74_37	rna	SNP	0.231	A
FAM13A	10144	genome.wustl.edu	37	4	89772181	89772181	+	Silent	SNP	A	A	G			TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr4:89772181A>G	ENST00000264344.5	-	7	1204	c.997T>C	c.(997-999)Ttg>Ctg	p.L333L	FAM13A_ENST00000511976.1_Intron|FAM13A_ENST00000502459.1_5'UTR	NM_014883.3	NP_055698.2	O94988	FA13A_HUMAN	family with sequence similarity 13, member A	333					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|liver(1)|lung(22)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	55						CTGGGTACCAACTTGGCACTA	0.428																																																	0								ENSG00000138640						168.0	166.0	166.0					4																	89772181		2203	4300	6503	FAM13A	SO:0001819	synonymous_variant	0			-	HGNC	AB020721	CCDS34029.1, CCDS43251.1, CCDS58911.1, CCDS58912.1, CCDS58913.1	4q22.1	2011-09-07	2009-01-20	2009-01-20	ENSG00000138640	ENSG00000138640		"""Rho GTPase activating proteins"""	19367	protein-coding gene	gene with protein product		613299	"""family with sequence similarity 13, member A1"""	FAM13A1			Standard	NM_014883		Approved	KIAA0914, ARHGAP48	uc003hse.2	O94988	OTTHUMG00000161006	ENST00000264344.5:c.997T>C	4.37:g.89772181A>G		Somatic	0	64	0.00		0.5093136486593635	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	37	28.85	B4DLC1|Q24JP0|Q5PR21|Q8NBA3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.L333	ENST00000264344.5	37	c.997	CCDS34029.1	4																																																																																			-	NULL		0.428	FAM13A-022	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM13A	protein_coding	OTTHUMT00000363371.1	A		-		89772181	-1	no_errors	ENST00000264344	ensembl	human	known	74_37	silent	SNP	0.000	G
OR1S1	219959	genome.wustl.edu	37	11	57982428	57982428	+	Missense_Mutation	SNP	C	C	A			TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr11:57982428C>A	ENST00000309433.6	+	1	212	c.212C>A	c.(211-213)cCc>cAc	p.P71H		NM_001004458.1	NP_001004458.1	Q8NH92	OR1S1_HUMAN	olfactory receptor, family 1, subfamily S, member 1	71						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(24)|kidney(1)|large_intestine(1)|liver(1)|lung(10)|prostate(1)|skin(2)|stomach(3)|urinary_tract(3)	48		Breast(21;0.0589)				CTTCATACCCCCATGTATCTC	0.448																																																	0								ENSG00000172774						313.0	291.0	298.0					11																	57982428		2201	4296	6497	OR1S1	SO:0001583	missense	0			-	HGNC	BK004299	CCDS31546.1	11q12.1	2012-08-09			ENSG00000172774	ENSG00000172774		"""GPCR / Class A : Olfactory receptors"""	8227	protein-coding gene	gene with protein product							Standard	NM_001004458		Approved	OST034	uc010rkc.2	Q8NH92	OTTHUMG00000167463	ENST00000309433.6:c.212C>A	11.37:g.57982428C>A	ENSP00000311688:p.Pro71His	Somatic	0	85	0.00		0.5093136486593635	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	107	13.01	Q6IFG3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.P71H	ENST00000309433.6	37	c.212	CCDS31546.1	11	.	.	.	.	.	.	.	.	.	.	C	18.23	3.578709	0.65878	.	.	ENSG00000172774	ENST00000309433	T	0.02050	4.48	3.45	3.45	0.39498	GPCR, rhodopsin-like superfamily (1);	0.000000	0.48767	D	0.000168	T	0.23014	0.0556	H	0.98664	4.295	0.46499	D	0.999071	D	0.89917	1.0	D	0.97110	1.0	T	0.50118	-0.8865	10	0.87932	D	0	.	14.1	0.65049	0.0:1.0:0.0:0.0	.	71	Q8NH92	OR1S1_HUMAN	H	71	ENSP00000311688:P71H	ENSP00000311688:P71H	P	+	2	0	OR1S1	57739004	1.000000	0.71417	0.905000	0.35620	0.788000	0.44548	7.141000	0.77330	1.770000	0.52166	0.479000	0.44913	CCC	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM		0.448	OR1S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR1S1	protein_coding	OTTHUMT00000394705.1	C	NM_001004458	-		57982428	+1	no_errors	ENST00000309433	ensembl	human	known	74_37	missense	SNP	1.000	A
CCDC180	100499483	genome.wustl.edu	37	9	100105638	100105638	+	Missense_Mutation	SNP	A	A	G	rs146215337		TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr9:100105638A>G	ENST00000357054.1	+	33	3775	c.2840A>G	c.(2839-2841)gAg>gGg	p.E947G	CCDC180_ENST00000529487.1_Missense_Mutation_p.E808G|RP11-23J9.4_ENST00000534123.1_RNA|CCDC180_ENST00000395220.1_3'UTR|CCDC180_ENST00000411667.2_Missense_Mutation_p.E805G|CCDC180_ENST00000375202.2_Missense_Mutation_p.E808G|CCDC180_ENST00000460482.2_3'UTR			Q9P1Z9	CC180_HUMAN	coiled-coil domain containing 180	947	Glu-rich.					extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)											GACAAGGAAGAGGGTCTAGAG	0.428																																																	0								ENSG00000197816	A	GLY/GLU	3,4403	2.1+/-5.4	0,3,2200	115.0	101.0	106.0		2423	3.2	0.6	9	dbSNP_134	106	0,8600		0,0,4300	yes	missense	C9orf174	NM_020893.2	98	0,3,6500	GG,GA,AA		0.0,0.0681,0.0231	benign	808/1702	100105638	3,13003	2203	4300	6503	CCDC180	SO:0001583	missense	0			-	HGNC	AK123391	CCDS35077.1, CCDS35077.2	9q22.33	2013-03-08	2013-03-08	2013-03-08		ENSG00000197816			29303	protein-coding gene	gene with protein product	"""Behcet's Disease Associated Gene 1"""		"""KIAA1529"", ""chromosome 9 open reading frame 174"""	KIAA1529, C9orf174		10819331	Standard	NM_020893		Approved	DKFZp434I2420, BDAG1	uc004axg.2	Q9P1Z9	OTTHUMG00000167001	ENST00000357054.1:c.2840A>G	9.37:g.100105638A>G	ENSP00000349562:p.Glu947Gly	Somatic	0	58	0.00		0.5093136486593635	6	14.29	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	39	22.00	Q2KHR6|Q5VV25|Q68DP5|Q69YV9|Q6AHY0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.E808G	ENST00000357054.1	37	c.2423		9	.	.	.	.	.	.	.	.	.	.	A	13.58	2.280411	0.40294	6.81E-4	0.0	ENSG00000197816	ENST00000357054;ENST00000375202;ENST00000411667;ENST00000541524;ENST00000529487	T;T;T;T	0.10288	3.1;2.89;3.1;2.89	5.5	3.15	0.36227	.	0.468956	0.20993	N	0.081998	T	0.07458	0.0188	L	0.29908	0.895	0.25569	N	0.986914	B;B;B	0.19073	0.033;0.008;0.008	B;B;B	0.22601	0.04;0.015;0.015	T	0.30031	-0.9992	10	0.30078	T	0.28	-14.9534	5.9518	0.19250	0.7823:0.0:0.2177:0.0	.	831;947;947	Q86Y65;B7ZMG3;Q9P1Z9	.;.;CI174_HUMAN	G	947;808;805;831;808	ENSP00000349562:E947G;ENSP00000364348:E808G;ENSP00000414000:E805G;ENSP00000434727:E808G	ENSP00000349562:E947G	E	+	2	0	C9orf174	99145459	0.934000	0.31675	0.644000	0.29465	0.014000	0.08584	1.874000	0.39568	1.016000	0.39470	0.533000	0.62120	GAG	-	NULL		0.428	CCDC180-201	KNOWN	basic	protein_coding	CCDC180	protein_coding		A	NM_020893	rs146215337		100105638	+1	no_errors	ENST00000375202	ensembl	human	known	74_37	missense	SNP	0.513	G
ACAD10	80724	genome.wustl.edu	37	12	112167713	112167713	+	Silent	SNP	C	C	G			TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr12:112167713C>G	ENST00000313698.4	+	10	1502	c.1347C>G	c.(1345-1347)ctC>ctG	p.L449L	ACAD10_ENST00000455480.2_Silent_p.L480L|ACAD10_ENST00000413681.3_3'UTR|ACAD10_ENST00000549590.1_Silent_p.L449L|ACAD10_ENST00000392636.2_Silent_p.L51L	NM_025247.5	NP_079523.3	Q6JQN1	ACD10_HUMAN	acyl-CoA dehydrogenase family, member 10	449						mitochondrion (GO:0005739)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)|hydrolase activity (GO:0016787)|transferase activity, transferring phosphorus-containing groups (GO:0016772)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(1)|lung(17)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(5)	47						GGCTGCCCCTCCATCTTCCCC	0.557																																																	0								ENSG00000111271						64.0	53.0	57.0					12																	112167713		2203	4300	6503	ACAD10	SO:0001819	synonymous_variant	0			-	HGNC	AY323912	CCDS31903.1, CCDS44973.1	12q24.12	2012-10-02	2010-04-30		ENSG00000111271	ENSG00000111271			21597	protein-coding gene	gene with protein product		611181	"""acyl-Coenzyme A dehydrogenase family, member 10"""			15560374	Standard	NM_025247		Approved	MGC5601	uc009zvx.3	Q6JQN1	OTTHUMG00000169602	ENST00000313698.4:c.1347C>G	12.37:g.112167713C>G		Somatic	0	47	0.00		0.5093136486593635	26	21.21	7	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	46	16.36	G3XAJ0|Q8N828|Q8NAP2|Q96BX5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Aminoglycoside_PTrfase,pfam_AcylCo_DH/oxidase_C,pfam_Acyl-CoA_DH_2_C,pfam_AcylCoA_DH/ox_N,pfam_Acyl-CoA_Oxase/DH_cen-dom,pfam_HAD-like_dom,superfamily_AcylCoA_DH/oxidase_NM_dom,superfamily_Kinase-like_dom,superfamily_AcylCo_DH/oxidase_C,superfamily_HAD-like_dom,prints_HAD-SF_hydro_IA,tigrfam_HAD-SF_ppase_IA/epoxid_hydro_N,tigrfam_HAD-SF_hydro_IA	p.L480	ENST00000313698.4	37	c.1440	CCDS31903.1	12																																																																																			-	pfam_Aminoglycoside_PTrfase,superfamily_Kinase-like_dom		0.557	ACAD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACAD10	protein_coding	OTTHUMT00000368307.1	C	NM_025247	-		112167713	+1	no_errors	ENST00000455480	ensembl	human	known	74_37	silent	SNP	0.000	G
FBLN2	2199	genome.wustl.edu	37	3	13613122	13613122	+	Missense_Mutation	SNP	C	C	T			TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr3:13613122C>T	ENST00000295760.7	+	2	1336	c.1267C>T	c.(1267-1269)Ccc>Tcc	p.P423S	FBLN2_ENST00000535798.1_Missense_Mutation_p.P449S|FBLN2_ENST00000492059.1_Missense_Mutation_p.P423S|FBLN2_ENST00000404922.3_Missense_Mutation_p.P423S	NM_001998.2	NP_001989.2	P98095	FBLN2_HUMAN	fibulin 2	423	N.|Subdomain NB (Cys-free).				extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)			haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(10)|ovary(3)|prostate(3)|urinary_tract(1)	24			UCEC - Uterine corpus endometrioid carcinoma (1;0.00416)			GGACACAGACCCCAACTCTGT	0.592																																																	0								ENSG00000163520						31.0	37.0	35.0					3																	13613122		2007	4153	6160	FBLN2	SO:0001583	missense	0			-	HGNC	X82494	CCDS46761.1, CCDS46762.1	3p25-p24	2010-06-15			ENSG00000163520	ENSG00000163520		"""Fibulins"""	3601	protein-coding gene	gene with protein product		135821				7806230	Standard	NM_001165035		Approved		uc011ava.2	P98095	OTTHUMG00000155437	ENST00000295760.7:c.1267C>T	3.37:g.13613122C>T	ENSP00000295760:p.Pro423Ser	Somatic	0	32	0.00		0.5093136486593635	977	53.55	1130	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	26	13.33	B7Z9C5|Q8IUI0|Q8IUI1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_EGF-like_Ca-bd_dom,pfam_Anaphylatoxin/fibulin,superfamily_Anaphylatoxin_comp_syst,smart_EG-like_dom,smart_Anaphylatoxin/fibulin,smart_EGF-like_Ca-bd_dom,pfscan_Anaphylatoxin/fibulin,pfscan_EG-like_dom	p.P423S	ENST00000295760.7	37	c.1267	CCDS46762.1	3	.	.	.	.	.	.	.	.	.	.	C	13.35	2.210151	0.39003	.	.	ENSG00000163520	ENST00000535798;ENST00000404922;ENST00000295760;ENST00000492059	T;T;T;T	0.79141	-1.24;-1.18;-1.15;-1.18	4.97	4.1	0.47936	.	0.386792	0.24725	N	0.036119	T	0.80686	0.4670	L	0.32530	0.975	0.28448	N	0.916498	P;D;D	0.76494	0.726;0.999;0.999	B;D;D	0.71656	0.191;0.974;0.951	T	0.74665	-0.3589	10	0.66056	D	0.02	.	11.6451	0.51257	0.0:0.9172:0.0:0.0828	.	423;423;449	P98095;P98095-2;F5H1F3	FBLN2_HUMAN;.;.	S	449;423;423;423	ENSP00000445705:P449S;ENSP00000384169:P423S;ENSP00000295760:P423S;ENSP00000420042:P423S	ENSP00000295760:P423S	P	+	1	0	FBLN2	13588123	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	4.647000	0.61418	1.110000	0.41699	-0.142000	0.14014	CCC	-	NULL		0.592	FBLN2-002	KNOWN	basic|CCDS	protein_coding	FBLN2	protein_coding	OTTHUMT00000340083.3	C	NM_001004019	-		13613122	+1	no_errors	ENST00000404922	ensembl	human	known	74_37	missense	SNP	1.000	T
RBM33	155435	genome.wustl.edu	37	7	155457900	155457900	+	Silent	SNP	C	C	T			TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr7:155457900C>T	ENST00000401878.3	+	2	273	c.75C>T	c.(73-75)ggC>ggT	p.G25G	RBM33_ENST00000287912.3_Silent_p.G25G|RBM33_ENST00000392759.3_Silent_p.G25G	NM_053043.2	NP_444271.2	Q96EV2	RBM33_HUMAN	RNA binding motif protein 33	25							nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(3)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(4)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	27	all_neural(206;0.101)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.011)	UCEC - Uterine corpus endometrioid carcinoma (81;0.2)		ATAAGCCTGGCGCGGAACGGT	0.458																																																	0								ENSG00000184863						118.0	124.0	122.0					7																	155457900		2019	4180	6199	RBM33	SO:0001819	synonymous_variant	0			-	HGNC	AL832196	CCDS5941.2	7q36.3	2013-02-12			ENSG00000184863	ENSG00000184863		"""RNA binding motif (RRM) containing"""	27223	protein-coding gene	gene with protein product			"""proline rich 8"""	PRR8			Standard	NM_053043		Approved	DKFZp686F102, MGC20460, DKFZp434D1319	uc010lqk.1	Q96EV2	OTTHUMG00000150260	ENST00000401878.3:c.75C>T	7.37:g.155457900C>T		Somatic	0	47	0.00		0.5093136486593635	13	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	25	10.71	A4D244|B5MC24|Q52LF5|Q75LN9|Q75ML5|Q9NSV0	Silent	SNP	NA	NA	NA	NA	NA	NA	smart_RRM_dom	p.G25	ENST00000401878.3	37	c.75	CCDS5941.2	7																																																																																			-	NULL		0.458	RBM33-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RBM33	protein_coding	OTTHUMT00000317225.3	C	NM_001008408	-		155457900	+1	no_errors	ENST00000401878	ensembl	human	known	74_37	silent	SNP	0.996	T
GRM4	2914	genome.wustl.edu	37	6	34003463	34003463	+	Silent	SNP	G	G	C			TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr6:34003463G>C	ENST00000538487.2	-	9	2867	c.2424C>G	c.(2422-2424)acC>acG	p.T808T	GRM4_ENST00000374181.4_Silent_p.T808T|GRM4_ENST00000545715.1_5'UTR|GRM4_ENST00000455714.2_Silent_p.T668T|GRM4_ENST00000374177.3_Silent_p.T692T|GRM4_ENST00000609222.1_Silent_p.T675T|GRM4_ENST00000544773.2_Silent_p.T639T|GRM4_ENST00000535756.1_Silent_p.T675T	NM_000841.2|NM_001256811.1	NP_000832.1|NP_001243740.1	Q14833	GRM4_HUMAN	glutamate receptor, metabotropic 4	808					activation of MAPK activity (GO:0000187)|adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|learning (GO:0007612)|neurotransmitter secretion (GO:0007269)|positive regulation of MAPK cascade (GO:0043410)|regulation of neuron apoptotic process (GO:0043523)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	cytoplasmic vesicle (GO:0031410)|dendritic shaft (GO:0043198)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|presynaptic active zone membrane (GO:0048787)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)			NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(9)|liver(1)|lung(19)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48						CCGACTGCGAGGTGCCAAAGA	0.647																																																	0								ENSG00000124493						61.0	48.0	52.0					6																	34003463		2203	4300	6503	GRM4	SO:0001819	synonymous_variant	0			-	HGNC	U92457	CCDS4787.1, CCDS59010.1, CCDS59011.1, CCDS59012.1, CCDS75432.1	6p21.3	2012-08-29			ENSG00000124493	ENSG00000124493		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4596	protein-coding gene	gene with protein product		604100				8738157, 9473604	Standard	NM_000841		Approved	GPRC1D, mGlu4, MGLUR4	uc010jvh.4	Q14833	OTTHUMG00000014538	ENST00000538487.2:c.2424C>G	6.37:g.34003463G>C		Somatic	0	50	0.00		0.5093136486593635	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	58	22.37	B3KVL9|B7Z1T9|B7Z1U6|F5GXM5|Q5SZ84|Q6ZMQ2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,superfamily_Peripla_BP_I,pfscan_GPCR_3_C,prints_GPCR_3,prints_GPCR_3_mtglu_rcpt_4,prints_GPCR_3_mtglu_rcpt,prints_GPCR_3_GABA_rcpt_B	p.T808	ENST00000538487.2	37	c.2424	CCDS4787.1	6																																																																																			-	pfam_GPCR_3_C,pfscan_GPCR_3_C		0.647	GRM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRM4	protein_coding	OTTHUMT00000040213.2	G		-		34003463	-1	no_errors	ENST00000374181	ensembl	human	known	74_37	silent	SNP	0.996	C
PTPRT	11122	genome.wustl.edu	37	20	41306780	41306780	+	Silent	SNP	A	A	T			TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr20:41306780A>T	ENST00000373187.1	-	7	878	c.879T>A	c.(877-879)gcT>gcA	p.A293A	PTPRT_ENST00000373193.3_Silent_p.A293A|PTPRT_ENST00000373198.4_Silent_p.A293A|PTPRT_ENST00000356100.2_Silent_p.A293A|PTPRT_ENST00000373190.1_Silent_p.A293A|PTPRT_ENST00000373201.1_Silent_p.A293A|PTPRT_ENST00000373184.1_Silent_p.A293A			O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	293	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|protein tyrosine phosphatase activity (GO:0004725)			NS(2)|breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(12)|large_intestine(26)|liver(1)|lung(63)|ovary(8)|pancreas(2)|prostate(5)|skin(35)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	176		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				GCTCTGGGGGAGCAATGGGCG	0.517																																																	0								ENSG00000196090						46.0	47.0	47.0					20																	41306780		1909	4125	6034	PTPRT	SO:0001819	synonymous_variant	0			-	HGNC	AF043644	CCDS42874.1, CCDS68127.1	20q12-q13	2013-02-11			ENSG00000196090	ENSG00000196090		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9682	protein-coding gene	gene with protein product		608712				9486824, 9602027	Standard	NM_133170		Approved	RPTPrho, KIAA0283	uc010ggj.3	O14522	OTTHUMG00000033040	ENST00000373187.1:c.879T>A	20.37:g.41306780A>T		Somatic	0	56	0.00		0.5093136486593635	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	85	10.53	A8E4R6|O43655|O75664|Q5W0X9|Q5W0Y1|Q9BR24|Q9BR28|Q9H0Y8|Q9NTL1|Q9NU72|Q9UBD2|Q9UJL7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_MAM_dom,pfam_Fibronectin_type3,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_MAM_dom,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_MAM_dom,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Ig-like_dom,prints_Tyr_Pase_rcpt/non-rcpt,prints_MAM_dom	p.A293	ENST00000373187.1	37	c.879	CCDS42874.1	20																																																																																			-	superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.517	PTPRT-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTPRT	protein_coding	OTTHUMT00000080315.1	A		-		41306780	-1	no_errors	ENST00000373198	ensembl	human	known	74_37	silent	SNP	0.881	T
SNCG	6623	genome.wustl.edu	37	10	88719349	88719349	+	Intron	SNP	C	C	G			TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr10:88719349C>G	ENST00000372017.3	+	2	163				MMRN2_ENST00000372027.5_5'Flank|SNCG_ENST00000483064.1_3'UTR|SNCG_ENST00000348795.4_Intron	NM_003087.2	NP_003078.2	O76070	SYUG_HUMAN	synuclein, gamma (breast cancer-specific protein 1)						adult locomotory behavior (GO:0008344)|aggressive behavior (GO:0002118)|cellular response to hydrostatic pressure (GO:0071464)|protein secretion (GO:0009306)|regulation of dopamine secretion (GO:0014059)|regulation of neurotransmitter secretion (GO:0046928)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|synapse organization (GO:0050808)|synaptic transmission (GO:0007268)	axon terminus (GO:0043679)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)				endometrium(1)|skin(1)	2						CCCCCAACACCTCGAGGGAGG	0.622																																																	0								ENSG00000173267						53.0	46.0	49.0					10																	88719349		2203	4300	6503	SNCG	SO:0001627	intron_variant	0			-	HGNC	AF044311	CCDS7380.1	10q23.2-q23.3	2006-06-28			ENSG00000173267	ENSG00000173267			11141	protein-coding gene	gene with protein product	"""synoretin"""	602998				9044857, 9700196	Standard	NM_003087		Approved	BCSG1, SR, persyn	uc001keb.2	O76070	OTTHUMG00000018656	ENST00000372017.3:c.122-41C>G	10.37:g.88719349C>G		Somatic	0	33	0.00		0.5093136486593635	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	41	19.61	O15104|Q96P61	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000372017.3	37	NULL	CCDS7380.1	10																																																																																			-	-		0.622	SNCG-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SNCG	protein_coding	OTTHUMT00000049167.1	C		-		88719349	+1	no_errors	ENST00000483064	ensembl	human	known	74_37	rna	SNP	0.003	G
TESK2	10420	genome.wustl.edu	37	1	45809610	45809610	+	3'UTR	DEL	A	A	-			TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr1:45809610delA	ENST00000372086.3	-	0	3018				TOE1_ENST00000495703.1_3'UTR|TESK2_ENST00000486676.1_5'UTR|TESK2_ENST00000372084.1_3'UTR|TESK2_ENST00000341771.6_3'UTR|TOE1_ENST00000372090.5_3'UTR	NM_007170.2	NP_009101.2	Q96S53	TESK2_HUMAN	testis-specific kinase 2						actin cytoskeleton organization (GO:0030036)|focal adhesion assembly (GO:0048041)|protein phosphorylation (GO:0006468)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|liver(1)|lung(9)|ovary(2)|pancreas(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	32	Acute lymphoblastic leukemia(166;0.155)					AAAGTTTTACAAAAAAAAAAA	0.363																																																	0								ENSG00000070759																																			TESK2	SO:0001624	3_prime_UTR_variant	0				HGNC	AJ132545	CCDS41323.1	1p32	2010-04-27			ENSG00000070759	ENSG00000070759	2.7.12.1		11732	protein-coding gene	gene with protein product		604746				10512679	Standard	NM_007170		Approved		uc001cns.1	Q96S53	OTTHUMG00000007680	ENST00000372086.3:c.*902T>-	1.37:g.45809610delA		Somatic	0	54	0.00		0.5093136486593635	7	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	41	18.00	Q5T422|Q5T423|Q8N520|Q9Y3Q6	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000372086.3	37	NULL	CCDS41323.1	1																																																																																			-	-		0.363	TESK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TESK2	protein_coding	OTTHUMT00000020523.1	A	NM_007170			45809610	-1	no_errors	ENST00000486676	ensembl	human	known	74_37	rna	DEL	0.794	-
NPM2	10361	genome.wustl.edu	37	8	21891682	21891682	+	Missense_Mutation	SNP	G	G	C			TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr8:21891682G>C	ENST00000397940.1	+	6	1442	c.427G>C	c.(427-429)Gag>Cag	p.E143Q	NPM2_ENST00000381530.5_Intron|snoU13_ENST00000459495.1_RNA|NPM2_ENST00000521157.1_Missense_Mutation_p.E143Q|NPM2_ENST00000518119.1_Missense_Mutation_p.E143Q|NPM2_ENST00000289820.6_Missense_Mutation_p.E143Q			Q86SE8	NPM2_HUMAN	nucleophosmin/nucleoplasmin 2	143	Acidic tract A2.|Poly-Glu.				chromatin remodeling (GO:0006338)|embryo development (GO:0009790)|oocyte differentiation (GO:0009994)|positive regulation of catalytic activity (GO:0043085)|positive regulation of DNA replication (GO:0045740)|positive regulation of meiosis (GO:0045836)|protein homooligomerization (GO:0051260)|regulation of exit from mitosis (GO:0007096)|single fertilization (GO:0007338)	cytoplasmic chromatin (GO:0000789)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|nucleic acid binding (GO:0003676)			large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	4				Colorectal(74;8.48e-05)|READ - Rectum adenocarcinoma(5;0.0276)|COAD - Colon adenocarcinoma(73;0.0618)		ggaagaggaagaggaagatga	0.537																																																	0								ENSG00000158806						80.0	77.0	78.0					8																	21891682		2203	4300	6503	NPM2	SO:0001583	missense	0			-	HGNC	AY262113	CCDS6018.1, CCDS75703.1	8p21.3	2009-08-27	2009-08-27		ENSG00000158806	ENSG00000158806			7930	protein-coding gene	gene with protein product		608073				12714744	Standard	NM_182795		Approved		uc003xae.3	Q86SE8	OTTHUMG00000131129	ENST00000397940.1:c.427G>C	8.37:g.21891682G>C	ENSP00000381032:p.Glu143Gln	Somatic	0	41	0.00		0.5093136486593635	10	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	39	25.00	B3KSU0|D3DSQ8|Q6NVH6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_Nucleoplasmin_core_dom	p.E143Q	ENST00000397940.1	37	c.427	CCDS6018.1	8	.	.	.	.	.	.	.	.	.	.	G	16.13	3.034827	0.54896	.	.	ENSG00000158806	ENST00000521157;ENST00000397940;ENST00000518119;ENST00000289820	T;T;T;T	0.35605	1.3;1.3;1.3;1.3	4.62	4.62	0.57501	.	0.270340	0.29376	N	0.012333	T	0.52869	0.1761	M	0.64404	1.975	0.80722	D	1	D	0.63046	0.992	P	0.62740	0.906	T	0.50381	-0.8835	10	0.42905	T	0.14	-1.3009	13.686	0.62517	0.0:0.0:1.0:0.0	.	143	Q86SE8	NPM2_HUMAN	Q	143	ENSP00000429413:E143Q;ENSP00000381032:E143Q;ENSP00000427741:E143Q;ENSP00000289820:E143Q	ENSP00000289820:E143Q	E	+	1	0	NPM2	21947628	0.008000	0.16893	0.065000	0.19835	0.043000	0.13939	1.134000	0.31442	2.482000	0.83794	0.655000	0.94253	GAG	-	NULL		0.537	NPM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPM2	protein_coding	OTTHUMT00000253810.2	G	NM_182795	-		21891682	+1	no_errors	ENST00000397940	ensembl	human	known	74_37	missense	SNP	0.458	C
GSN	2934	genome.wustl.edu	37	9	124074856	124074857	+	Intron	INS	-	-	A			TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr9:124074856_124074857insA	ENST00000373818.4	+	5	885				GSN_ENST00000341272.2_Intron|GSN_ENST00000373808.2_Intron|GSN_ENST00000412819.1_Intron|GSN_ENST00000373823.3_Intron|GSN_ENST00000545652.1_Intron|GSN_ENST00000449733.1_Intron|GSN_ENST00000394353.2_Intron|GSN_ENST00000373807.1_Intron|GSN_ENST00000485767.1_3'UTR|GSN_ENST00000436847.1_Intron	NM_000177.4|NM_001258029.1	NP_000168.1|NP_001244958.1	P06396	GELS_HUMAN	gelsolin						actin filament polymerization (GO:0030041)|actin filament severing (GO:0051014)|aging (GO:0007568)|apoptotic process (GO:0006915)|barbed-end actin filament capping (GO:0051016)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to cadmium ion (GO:0071276)|cilium morphogenesis (GO:0060271)|oligodendrocyte development (GO:0014003)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of cell adhesion (GO:0030155)|response to ethanol (GO:0045471)|response to folic acid (GO:0051593)|tissue regeneration (GO:0042246)|vesicle-mediated transport (GO:0016192)	actin cytoskeleton (GO:0015629)|blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)|ruffle (GO:0001726)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(1)|lung(8)|ovary(1)	21						TGAATTTGAGGAAAAAAAAAAA	0.426																																																	0								ENSG00000148180																																			GSN	SO:0001627	intron_variant	0				HGNC	X04412	CCDS6828.1, CCDS6829.1, CCDS48011.1, CCDS65118.1, CCDS75890.1, CCDS75891.1	9q33	2010-04-27	2010-04-27		ENSG00000148180	ENSG00000148180			4620	protein-coding gene	gene with protein product	"""amyloidosis, Finnish type"""	137350	"""gelsolin (amyloidosis, Finnish type)"""			1652889	Standard	NM_001127662		Approved	DKFZp313L0718	uc004blf.1	P06396	OTTHUMG00000020584	ENST00000373818.4:c.816+90->A	9.37:g.124074867_124074867dupA		Somatic	0	18	0.00		0.5093136486593635	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	15	21.05	A2A418|A8MUD1|A8MYN7|B7Z373|B7Z5V1|F5H1A8|Q5T0I2|Q8WVV7	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000373818.4	37	NULL	CCDS6828.1	9																																																																																			-	-		0.426	GSN-001	KNOWN	basic|CCDS	protein_coding	GSN	protein_coding	OTTHUMT00000053861.1	-	NM_000177			124074857	+1	no_errors	ENST00000485767	ensembl	human	known	74_37	rna	INS	0.003:0.000	A
NPM2	10361	genome.wustl.edu	37	8	21891645	21891645	+	Missense_Mutation	SNP	G	G	C			TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr8:21891645G>C	ENST00000397940.1	+	6	1405	c.390G>C	c.(388-390)gaG>gaC	p.E130D	NPM2_ENST00000381530.5_Intron|snoU13_ENST00000459495.1_RNA|NPM2_ENST00000521157.1_Missense_Mutation_p.E130D|NPM2_ENST00000520180.1_3'UTR|NPM2_ENST00000518119.1_Missense_Mutation_p.E130D|NPM2_ENST00000289820.6_Missense_Mutation_p.E130D			Q86SE8	NPM2_HUMAN	nucleophosmin/nucleoplasmin 2	130	Acidic tract A2.|Poly-Glu.				chromatin remodeling (GO:0006338)|embryo development (GO:0009790)|oocyte differentiation (GO:0009994)|positive regulation of catalytic activity (GO:0043085)|positive regulation of DNA replication (GO:0045740)|positive regulation of meiosis (GO:0045836)|protein homooligomerization (GO:0051260)|regulation of exit from mitosis (GO:0007096)|single fertilization (GO:0007338)	cytoplasmic chromatin (GO:0000789)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|nucleic acid binding (GO:0003676)			large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	4				Colorectal(74;8.48e-05)|READ - Rectum adenocarcinoma(5;0.0276)|COAD - Colon adenocarcinoma(73;0.0618)		CCTGggaggaggaggaggaag	0.507																																																	0								ENSG00000158806						72.0	73.0	73.0					8																	21891645		2203	4300	6503	NPM2	SO:0001583	missense	0			-	HGNC	AY262113	CCDS6018.1, CCDS75703.1	8p21.3	2009-08-27	2009-08-27		ENSG00000158806	ENSG00000158806			7930	protein-coding gene	gene with protein product		608073				12714744	Standard	NM_182795		Approved		uc003xae.3	Q86SE8	OTTHUMG00000131129	ENST00000397940.1:c.390G>C	8.37:g.21891645G>C	ENSP00000381032:p.Glu130Asp	Somatic	0	37	0.00		0.5093136486593635	4	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	37	17.39	B3KSU0|D3DSQ8|Q6NVH6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_Nucleoplasmin_core_dom	p.E130D	ENST00000397940.1	37	c.390	CCDS6018.1	8	.	.	.	.	.	.	.	.	.	.	G	10.33	1.320717	0.23994	.	.	ENSG00000158806	ENST00000521157;ENST00000397940;ENST00000522813;ENST00000518119;ENST00000289820	T;T;T;T;T	0.50001	0.76;0.76;0.76;0.76;0.76	4.76	-7.13	0.01532	.	0.069465	0.53938	N	0.000047	T	0.15955	0.0384	N	0.11756	0.17	0.09310	N	0.999999	B	0.21071	0.051	B	0.23716	0.048	T	0.34304	-0.9834	10	0.08837	T	0.75	-3.4837	2.2598	0.04064	0.5069:0.1078:0.1568:0.2284	.	130	Q86SE8	NPM2_HUMAN	D	130	ENSP00000429413:E130D;ENSP00000381032:E130D;ENSP00000428016:E130D;ENSP00000427741:E130D;ENSP00000289820:E130D	ENSP00000289820:E130D	E	+	3	2	NPM2	21947591	0.146000	0.22672	0.000000	0.03702	0.000000	0.00434	-1.060000	0.03475	-1.526000	0.01760	-0.136000	0.14681	GAG	-	NULL		0.507	NPM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPM2	protein_coding	OTTHUMT00000253810.2	G	NM_182795	-		21891645	+1	no_errors	ENST00000397940	ensembl	human	known	74_37	missense	SNP	0.000	C
FBXL22	283807	genome.wustl.edu	37	15	63893606	63893606	+	Silent	SNP	G	G	A			TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr15:63893606G>A	ENST00000360587.2	+	2	505	c.465G>A	c.(463-465)gaG>gaA	p.E155E	USP3-AS1_ENST00000560962.1_RNA|USP3-AS1_ENST00000561191.1_RNA|USP3-AS1_ENST00000558831.1_RNA|USP3-AS1_ENST00000560622.1_RNA|USP3-AS1_ENST00000561256.1_RNA|FBXL22_ENST00000539570.3_Silent_p.E149E|USP3-AS1_ENST00000559737.1_RNA	NM_203373.2	NP_976307.2	Q6P050	FXL22_HUMAN	F-box and leucine-rich repeat protein 22	155					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)				lung(4)	4						ACCACTCGGAGTTCGCCGACT	0.746																																																	0								ENSG00000197361						15.0	17.0	16.0					15																	63893606		2187	4270	6457	FBXL22	SO:0001819	synonymous_variant	0			-	HGNC	BC065833	CCDS10187.1, CCDS10187.2	15q22.1	2012-04-05			ENSG00000197361	ENSG00000197361		"""F-boxes / Leucine-rich repeats"""	27537	protein-coding gene	gene with protein product		609088				12477932	Standard	NM_203373		Approved	Fbl22, FLJ39626	uc002amn.4	Q6P050	OTTHUMG00000132905	ENST00000360587.2:c.465G>A	15.37:g.63893606G>A		Somatic	0	40	0.00		0.5093136486593635	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	37	17.78		Silent	SNP	NA	NA	NA	NA	NA	NA	superfamily_F-box_dom	p.E155	ENST00000360587.2	37	c.465	CCDS10187.2	15																																																																																			-	NULL		0.746	FBXL22-001	KNOWN	downstream_ATG|basic|appris_candidate_longest|CCDS	protein_coding	FBXL22	protein_coding	OTTHUMT00000256412.4	G	NM_203373	-		63893606	+1	no_errors	ENST00000360587	ensembl	human	known	74_37	silent	SNP	0.000	A
CELSR1	9620	genome.wustl.edu	37	22	46760514	46760514	+	Missense_Mutation	SNP	G	G	T			TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr22:46760514G>T	ENST00000262738.3	-	33	8673	c.8674C>A	c.(8674-8676)Ctg>Atg	p.L2892M		NM_014246.1	NP_055061.1	Q9NYQ6	CELR1_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 1	2892					anterior/posterior pattern specification (GO:0009952)|apical protein localization (GO:0045176)|central nervous system development (GO:0007417)|establishment of body hair planar orientation (GO:0048105)|establishment of planar polarity (GO:0001736)|establishment of planar polarity of embryonic epithelium (GO:0042249)|G-protein coupled receptor signaling pathway (GO:0007186)|hair follicle development (GO:0001942)|homophilic cell adhesion (GO:0007156)|inner ear morphogenesis (GO:0042472)|lateral sprouting involved in lung morphogenesis (GO:0060490)|locomotory behavior (GO:0007626)|neural tube closure (GO:0001843)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|orthogonal dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060488)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060489)|protein localization involved in establishment of planar polarity (GO:0090251)|regulation of actin cytoskeleton organization (GO:0032956)|Rho protein signal transduction (GO:0007266)|wound healing (GO:0042060)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|protein dimerization activity (GO:0046983)|transmembrane signaling receptor activity (GO:0004888)			breast(8)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(13)|lung(27)|ovary(2)|pancreas(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(3)	95		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		TCGCGGTGCAGCTCCACGCTG	0.701																																																	0								ENSG00000075275						34.0	37.0	36.0					22																	46760514		2199	4297	6496	CELSR1	SO:0001583	missense	0			-	HGNC	AF231024	CCDS14076.1	22q13.31	2014-08-08	2013-02-18		ENSG00000075275	ENSG00000075275		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	1850	protein-coding gene	gene with protein product	"""flamingo homolog 2 (Drosophila)"""	604523	"""cadherin, EGF LAG seven-pass G-type receptor 1, flamingo (Drosophila) homolog"""			9339365	Standard	XM_006724383		Approved	ME2, HFMI2, FMI2, CDHF9	uc003bhw.1	Q9NYQ6	OTTHUMG00000150423	ENST00000262738.3:c.8674C>A	22.37:g.46760514G>T	ENSP00000262738:p.Leu2892Met	Somatic	0	53	0.00		0.5093136486593635	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	O95722|Q5TH47|Q9BWQ5|Q9Y506|Q9Y526	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_DUF3497,pfam_Laminin_G,pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_EG-like_dom,pfam_EGF_laminin,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,smart_EGF_laminin,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_GPS_dom,pfscan_Laminin_G,pfscan_Cadherin,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_Cadherin,prints_GPCR_2_secretin-like	p.L2892M	ENST00000262738.3	37	c.8674	CCDS14076.1	22	.	.	.	.	.	.	.	.	.	.	G	19.32	3.804694	0.70682	.	.	ENSG00000075275	ENST00000262738	T	0.70986	-0.53	4.62	2.43	0.29744	.	0.000000	0.44688	U	0.000432	T	0.76814	0.4040	L	0.58101	1.795	0.80722	D	1	D	0.89917	1.0	D	0.72982	0.979	T	0.71925	-0.4445	10	0.37606	T	0.19	.	7.8335	0.29358	0.0884:0.0:0.7501:0.1615	.	2892	Q9NYQ6	CELR1_HUMAN	M	2892	ENSP00000262738:L2892M	ENSP00000262738:L2892M	L	-	1	2	CELSR1	45139178	1.000000	0.71417	0.997000	0.53966	0.874000	0.50279	5.932000	0.70121	0.320000	0.23234	0.563000	0.77884	CTG	-	NULL		0.701	CELSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CELSR1	protein_coding	OTTHUMT00000318037.1	G	NM_014246	-		46760514	-1	no_errors	ENST00000262738	ensembl	human	known	74_37	missense	SNP	1.000	T
ERCC8	1161	genome.wustl.edu	37	5	60199496	60199496	+	Missense_Mutation	SNP	A	A	T			TCGA-UE-A6QU-01A-12D-A32I-09	TCGA-UE-A6QU-10B-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8955375b-e2e4-42f6-a96f-0e14ffb8fd4b	a37b1846-7265-4f3a-bc22-c1dd8350e95a	g.chr5:60199496A>T	ENST00000265038.5	-	6	571	c.529T>A	c.(529-531)Tcc>Acc	p.S177T	ERCC8_ENST00000543101.1_Missense_Mutation_p.S24T|ERCC8_ENST00000462279.1_5'UTR|ERCC8_ENST00000426742.2_Missense_Mutation_p.S119T	NM_000082.3	NP_000073.1	Q13216	ERCC8_HUMAN	excision repair cross-complementation group 8	177					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|nucleotide-excision repair (GO:0006289)|positive regulation of DNA repair (GO:0045739)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein autoubiquitination (GO:0051865)|protein polyubiquitination (GO:0000209)|response to oxidative stress (GO:0006979)|response to UV (GO:0009411)|response to X-ray (GO:0010165)|transcription-coupled nucleotide-excision repair (GO:0006283)	Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleotide-excision repair complex (GO:0000109)|nucleus (GO:0005634)|protein complex (GO:0043234)	protein complex binding (GO:0032403)			breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)	14		Lung NSC(810;1.51e-06)|Prostate(74;0.0322)|Ovarian(174;0.0481)|Breast(144;0.077)				TGAGAACAGGATCCAGACTTC	0.328																																																	0								ENSG00000049167						75.0	79.0	78.0					5																	60199496		2203	4300	6503	ERCC8	SO:0001583	missense	0			-	HGNC	U28413	CCDS3978.1	5q12.1	2014-09-17	2014-03-07		ENSG00000049167	ENSG00000049167		"""WD repeat domain containing"""	3439	protein-coding gene	gene with protein product		609412	"""Cockayne syndrome 1 (classical)"", ""excision repair cross-complementing rodent repair deficiency, complementation group 8"""	CKN1		8596535	Standard	NM_000082		Approved	CSA	uc003jsm.3	Q13216	OTTHUMG00000097741	ENST00000265038.5:c.529T>A	5.37:g.60199496A>T	ENSP00000265038:p.Ser177Thr	Somatic	0	72	0.00		0.5093136486593635	0	100.00	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	49	16.95	B2RB64|Q6FHX5|Q96GB9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.S177T	ENST00000265038.5	37	c.529	CCDS3978.1	5	.	.	.	.	.	.	.	.	.	.	A	19.74	3.883478	0.72410	.	.	ENSG00000049167	ENST00000426742;ENST00000265038;ENST00000543101;ENST00000536596;ENST00000439176	T;T;T;T	0.63255	0.26;0.26;0.26;-0.03	6.03	4.86	0.63082	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.053369	0.85682	D	0.000000	T	0.47507	0.1449	N	0.25992	0.78	0.80722	D	1	P;B;B	0.44380	0.834;0.067;0.17	B;B;B	0.38500	0.275;0.023;0.089	T	0.45673	-0.9245	10	0.44086	T	0.13	-9.6012	11.6426	0.51242	0.7177:0.2823:0.0:0.0	.	24;177;177	B4DGZ9;Q13216-2;Q13216	.;.;ERCC8_HUMAN	T	119;177;24;176;119	ENSP00000400110:S119T;ENSP00000265038:S177T;ENSP00000441732:S24T;ENSP00000408344:S119T	ENSP00000265038:S177T	S	-	1	0	ERCC8	60235253	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.853000	0.62911	1.084000	0.41184	-0.478000	0.04885	TCC	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom		0.328	ERCC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERCC8	protein_coding	OTTHUMT00000214971.2	A	NM_000082	-		60199496	-1	no_errors	ENST00000265038	ensembl	human	known	74_37	missense	SNP	1.000	T
