#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
CCDC13	152206	genome.wustl.edu	37	3	42799753	42799753	+	Missense_Mutation	SNP	G	G	T			TCGA-VT-A80J-02A-11D-A417-09	TCGA-VT-A80J-11A-22D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9f5f2b4-7057-4dbc-aa22-577a341c4045	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr3:42799753G>T	ENST00000310232.6	-	2	168	c.85C>A	c.(85-87)Cag>Aag	p.Q29K	CCDC13_ENST00000435327.2_5'UTR	NM_144719.3	NP_653320.3	Q8IYE1	CCD13_HUMAN	coiled-coil domain containing 13	29										endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(11)|ovary(1)|prostate(3)|skin(1)|urinary_tract(1)	25						TTCTCCATCTGCTTCTGTAAC	0.522																																																	0								ENSG00000244607						228.0	181.0	197.0					3																	42799753		2203	4300	6503	CCDC13	SO:0001583	missense	0			-	HGNC	AK058196	CCDS2705.1	3p22.1	2005-01-25			ENSG00000244607	ENSG00000244607			26358	protein-coding gene	gene with protein product						12477932	Standard	NM_144719		Approved	FLJ25467	uc003cly.4	Q8IYE1	OTTHUMG00000133046	ENST00000310232.6:c.85C>A	3.37:g.42799753G>T	ENSP00000309836:p.Gln29Lys	Somatic	0	60	0.00		0.6324490966295101	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	41	8.89		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_Prefoldin	p.Q29K	ENST00000310232.6	37	c.85	CCDS2705.1	3	.	.	.	.	.	.	.	.	.	.	G	10.51	1.369894	0.24771	.	.	ENSG00000244607	ENST00000310232	T	0.21932	1.98	4.61	4.61	0.57282	.	0.155750	0.47852	D	0.000220	T	0.23965	0.0580	L	0.50919	1.6	0.80722	D	1	B;B;B	0.32573	0.376;0.376;0.361	B;B;B	0.37387	0.248;0.163;0.138	T	0.03139	-1.1068	10	0.29301	T	0.29	.	14.9812	0.71313	0.0:0.0:1.0:0.0	.	29;29;29	B4DZD2;Q96LI1;Q8IYE1	.;.;CCD13_HUMAN	K	29	ENSP00000309836:Q29K	ENSP00000309836:Q29K	Q	-	1	0	CCDC13	42774757	1.000000	0.71417	1.000000	0.80357	0.344000	0.29017	2.411000	0.44600	2.379000	0.81126	0.563000	0.77884	CAG	-	NULL		0.522	CCDC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC13	protein_coding	OTTHUMT00000256652.1	G	NM_144719	-		42799753	-1	no_errors	ENST00000310232	ensembl	human	known	74_37	missense	SNP	1.000	T
CDH26	60437	genome.wustl.edu	37	20	58577889	58577889	+	Intron	SNP	C	C	G			TCGA-VT-A80J-02A-11D-A417-09	TCGA-VT-A80J-11A-22D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9f5f2b4-7057-4dbc-aa22-577a341c4045	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr20:58577889C>G	ENST00000244047.5	+	14	2408				CDH26_ENST00000348616.4_Missense_Mutation_p.P730A|CDH26_ENST00000350849.6_Missense_Mutation_p.P63A|CDH26_ENST00000497614.1_3'UTR|CDH26_ENST00000244049.3_Intron			Q8IXH8	CAD26_HUMAN	cadherin 26						homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(11)|lung(14)|ovary(4)|pancreas(2)|prostate(2)|skin(2)|urinary_tract(1)	44	all_lung(29;0.00963)		BRCA - Breast invasive adenocarcinoma(7;5.58e-09)			GCCCTTTGAGCCAAGAAGTGT	0.338																																																	0								ENSG00000124215						89.0	84.0	86.0					20																	58577889		2203	4300	6503	CDH26	SO:0001627	intron_variant	0			-	HGNC	AF169690, AK055202	CCDS13485.1, CCDS13486.1	20q13.33	2010-01-26	2009-11-20		ENSG00000124215	ENSG00000124215		"""Cadherins / Major cadherins"""	15902	protein-coding gene	gene with protein product			"""cadherin-like 26"""				Standard	NM_177980		Approved	VR20	uc002ybe.3	Q8IXH8	OTTHUMG00000032874	ENST00000244047.5:c.2097+3171C>G	20.37:g.58577889C>G		Somatic	0	78	0.00		0.6324490966295101	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	66	19.28	A2A2M5|B3KNX3|Q6P5Y6|Q8TCH3|Q9BQN4|Q9NRU1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.P730A	ENST00000244047.5	37	c.2188		20	.	.	.	.	.	.	.	.	.	.	C	5.589	0.293462	0.10567	.	.	ENSG00000124215	ENST00000348616;ENST00000350849;ENST00000456106	T;T	0.51325	0.71;0.71	3.31	-1.21	0.09524	.	0.765590	0.10841	N	0.628244	T	0.18800	0.0451	N	0.08118	0	0.09310	N	1	P;B	0.39282	0.666;0.221	B;B	0.35039	0.194;0.083	T	0.17349	-1.0372	10	0.02654	T	1	.	8.3482	0.32286	0.0:0.553:0.0:0.447	.	63;730	Q8IXH8-2;Q8IXH8-4	.;.	A	730;63;40	ENSP00000339390:P730A;ENSP00000310845:P63A	ENSP00000339390:P730A	P	+	1	0	CDH26	58011284	0.957000	0.32711	0.004000	0.12327	0.001000	0.01503	0.135000	0.15952	-0.516000	0.06470	-1.731000	0.00696	CCA	-	NULL		0.338	CDH26-201	KNOWN	basic	protein_coding	CDH26	protein_coding		C	NM_177980	-		58577889	+1	no_errors	ENST00000348616	ensembl	human	known	74_37	missense	SNP	0.008	G
MADD	8567	genome.wustl.edu	37	11	47330211	47330211	+	Missense_Mutation	SNP	G	G	T			TCGA-VT-A80J-02A-11D-A417-09	TCGA-VT-A80J-11A-22D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9f5f2b4-7057-4dbc-aa22-577a341c4045	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr11:47330211G>T	ENST00000311027.5	+	25	3994	c.3829G>T	c.(3829-3831)Gat>Tat	p.D1277Y	MADD_ENST00000402799.1_Missense_Mutation_p.D1196Y|MADD_ENST00000406482.1_Missense_Mutation_p.D1196Y|MADD_ENST00000395336.3_Missense_Mutation_p.D1277Y|MADD_ENST00000395344.3_Missense_Mutation_p.D1192Y|MADD_ENST00000405573.2_Missense_Mutation_p.D87Y|MADD_ENST00000402192.2_Missense_Mutation_p.D1238Y|MADD_ENST00000349238.3_Missense_Mutation_p.D1259Y|MADD_ENST00000342922.4_Missense_Mutation_p.D1239Y|MADD_ENST00000407859.3_Missense_Mutation_p.D1216Y	NM_003682.3	NP_003673.3			MAP-kinase activating death domain											breast(7)|central_nervous_system(2)|endometrium(9)|kidney(3)|large_intestine(19)|lung(26)|ovary(6)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	84				Lung(87;0.182)		TACTTCTGAAGATGTGAGCCA	0.537																																																	0								ENSG00000110514						71.0	69.0	70.0					11																	47330211		2201	4298	6499	MADD	SO:0001583	missense	0			-	HGNC	AB002356	CCDS7930.1, CCDS7931.1, CCDS7932.1, CCDS41642.1, CCDS44586.1, CCDS44587.1, CCDS44588.1, CCDS44589.1, CCDS44590.1	11p11.2	2012-10-04			ENSG00000110514	ENSG00000110514		"""DENN/MADD domain containing"""	6766	protein-coding gene	gene with protein product		603584				9115275, 9796103	Standard	NM_130476		Approved	DENN, KIAA0358, RAB3GEP	uc001ner.1	Q8WXG6	OTTHUMG00000150350	ENST00000311027.5:c.3829G>T	11.37:g.47330211G>T	ENSP00000310933:p.Asp1277Tyr	Somatic	0	41	0.00		0.6324490966295101	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	23	11.54		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DENN_dom,pfam_uDENN_dom,pfam_dDENN_dom,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom	p.D1277Y	ENST00000311027.5	37	c.3829	CCDS7930.1	11	.	.	.	.	.	.	.	.	.	.	G	23.0	4.363001	0.82353	.	.	ENSG00000110514	ENST00000342922;ENST00000395342;ENST00000402799;ENST00000406482;ENST00000349238;ENST00000311027;ENST00000407859;ENST00000395344;ENST00000395336;ENST00000402192;ENST00000405573	T;T;T;T;T;T;T;T;T;T	0.58210	3.34;3.19;3.19;3.35;3.05;3.19;3.18;3.05;3.34;0.35	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	T	0.64450	0.2599	L	0.29908	0.895	0.80722	D	1	D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D;D;D	0.97110	1.0;0.979;0.979;1.0;0.991;0.991;0.991;0.999;0.999;0.999;0.999	T	0.67201	-0.5730	10	0.66056	D	0.02	-15.9452	19.3113	0.94188	0.0:0.0:1.0:0.0	.	87;1192;1192;1277;1196;1196;1196;1259;1216;1277;1239	F8W8U2;B5MEE5;A8K8S7;Q8WXG6-7;F8W9P9;Q8WXG6-6;Q8WXG6-5;Q8WXG6-2;Q8WXG6-4;Q8WXG6;Q8WXG6-3	.;.;.;.;.;.;.;.;.;MADD_HUMAN;.	Y	1239;1196;1196;1196;1259;1277;1216;1192;1277;1238;87	ENSP00000343902:D1239Y;ENSP00000385585:D1196Y;ENSP00000384435:D1196Y;ENSP00000304505:D1259Y;ENSP00000310933:D1277Y;ENSP00000384204:D1216Y;ENSP00000378753:D1192Y;ENSP00000378745:D1277Y;ENSP00000384287:D1238Y;ENSP00000384483:D87Y	ENSP00000310933:D1277Y	D	+	1	0	MADD	47286787	1.000000	0.71417	0.997000	0.53966	0.846000	0.48090	8.186000	0.89706	2.548000	0.85928	0.563000	0.77884	GAT	-	NULL		0.537	MADD-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MADD	protein_coding	OTTHUMT00000317746.1	G		-		47330211	+1	no_errors	ENST00000311027	ensembl	human	known	74_37	missense	SNP	1.000	T
ESRP1	54845	genome.wustl.edu	37	8	95677276	95677276	+	Missense_Mutation	SNP	C	C	T			TCGA-VT-A80J-02A-11D-A417-09	TCGA-VT-A80J-11A-22D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9f5f2b4-7057-4dbc-aa22-577a341c4045	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr8:95677276C>T	ENST00000433389.2	+	8	1067	c.877C>T	c.(877-879)Cgg>Tgg	p.R293W	ESRP1_ENST00000358397.5_Missense_Mutation_p.R293W|ESRP1_ENST00000454170.2_Missense_Mutation_p.R293W|ESRP1_ENST00000423620.2_Missense_Mutation_p.R293W	NM_001034915.2|NM_017697.3	NP_001030087.2|NP_060167.2	Q6NXG1	ESRP1_HUMAN	epithelial splicing regulatory protein 1	293	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)		ESRP1/RAF1(4)	NS(1)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(2)|lung(6)|prostate(1)|urinary_tract(2)	20						CATGGGGACCCGGTATATTGA	0.478																																																	0								ENSG00000104413						101.0	99.0	100.0					8																	95677276		1928	4139	6067	ESRP1	SO:0001583	missense	0			-	HGNC	AK000178	CCDS47895.1, CCDS47896.1, CCDS47897.1, CCDS47898.1	8q22.1	2013-02-12	2009-03-10	2009-03-10	ENSG00000104413	ENSG00000104413		"""RNA binding motif (RRM) containing"""	25966	protein-coding gene	gene with protein product		612959	"""RNA binding motif protein 35A"""	RBM35A		12477932	Standard	NM_017697		Approved	FLJ20171	uc003ygq.4	Q6NXG1	OTTHUMG00000164587	ENST00000433389.2:c.877C>T	8.37:g.95677276C>T	ENSP00000405738:p.Arg293Trp	Somatic	0	68	0.00		0.6324490966295101	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	37	21.28	A6NHA8|A8MPX1|E9PB47|Q2M2B0|Q499G3|Q6PJ86|Q9NXL8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_RNaseH-like_dom,smart_RRM_dom,pfscan_RRM_dom	p.R293W	ENST00000433389.2	37	c.877	CCDS47897.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	21.1|21.1	4.090705|4.090705	0.76756|0.76756	.|.	.|.	ENSG00000104413|ENSG00000104413	ENST00000519505|ENST00000423620;ENST00000433389;ENST00000358397;ENST00000454170;ENST00000522756;ENST00000517610	.|T;T;T;T;T;T	.|0.13420	.|2.59;2.59;2.59;2.59;2.59;2.59	5.53|5.53	4.62|4.62	0.57501|0.57501	.|Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (2);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.53142|0.53142	0.1778|0.1778	H|H	0.97564|0.97564	4.03|4.03	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0;1.0;1.0	.|D;D;D;D;D;D	.|0.97110	.|1.0;1.0;1.0;1.0;1.0;1.0	T|T	0.70908|0.70908	-0.4744|-0.4744	5|10	.|0.87932	.|D	.|0	-15.3355|-15.3355	15.7289|15.7289	0.77788|0.77788	0.1372:0.8628:0.0:0.0|0.1372:0.8628:0.0:0.0	.|.	.|293;293;293;293;293;293	.|D7PBN3;Q6NXG1-4;Q6NXG1-2;E9PB47;Q6NXG1-3;Q6NXG1	.|.;.;.;.;.;ESRP1_HUMAN	L|W	158|293;293;293;293;76;152	.|ENSP00000407349:R293W;ENSP00000405738:R293W;ENSP00000351168:R293W;ENSP00000402766:R293W;ENSP00000428490:R76W;ENSP00000429125:R152W	.|ENSP00000351168:R293W	P|R	+|+	2|1	0|2	ESRP1|ESRP1	95746452|95746452	0.064000|0.064000	0.20934|0.20934	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	0.512000|0.512000	0.22755|0.22755	2.601000|2.601000	0.87937|0.87937	0.563000|0.563000	0.77884|0.77884	CCG|CGG	-	smart_RRM_dom,pfscan_RRM_dom		0.478	ESRP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ESRP1	protein_coding	OTTHUMT00000379326.1	C	NM_017697	-		95677276	+1	no_errors	ENST00000433389	ensembl	human	known	74_37	missense	SNP	1.000	T
ROR2	4920	genome.wustl.edu	37	9	94484841	94484841	+	IGR	SNP	C	C	T	rs537571926		TCGA-VT-A80J-02A-11D-A417-09	TCGA-VT-A80J-11A-22D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9f5f2b4-7057-4dbc-aa22-577a341c4045	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr9:94484841C>T	ENST00000375708.3	-	0	4096				ROR2_ENST00000550066.1_5'Flank|ROR2_ENST00000375715.1_Missense_Mutation_p.G648R	NM_004560.3	NP_004551.2	Q01974	ROR2_HUMAN	receptor tyrosine kinase-like orphan receptor 2						cartilage condensation (GO:0001502)|cell differentiation (GO:0030154)|embryonic genitalia morphogenesis (GO:0030538)|inner ear morphogenesis (GO:0042472)|JNK cascade (GO:0007254)|multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)|somitogenesis (GO:0001756)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	clathrin-coated endocytic vesicle membrane (GO:0030669)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|Wnt-protein binding (GO:0017147)			autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(31)|ovary(3)|prostate(6)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	71						CACTGCCTCCCGCTGCCTCGC	0.522													C|||	1	0.000199681	0.0	0.0	5008	,	,		19093	0.001		0.0	False		,,,				2504	0.0																0								ENSG00000169071						164.0	148.0	153.0					9																	94484841		876	1991	2867	ROR2	SO:0001628	intergenic_variant	0			-	HGNC	M97639	CCDS6691.1	9q22	2013-01-11			ENSG00000169071	ENSG00000169071		"""Immunoglobulin superfamily / I-set domain containing"""	10257	protein-coding gene	gene with protein product		602337		NTRKR2, BDB, BDB1		1334494, 10700182	Standard	NM_004560		Approved		uc004arj.2	Q01974	OTTHUMG00000020211		9.37:g.94484841C>T		Somatic	0	21	0.00		0.6324490966295101	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	21	22.22	Q59GF5|Q5SPI5|Q9HAY7|Q9HB61	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Kringle,pfam_Frizzled_dom,superfamily_Kinase-like_dom,superfamily_Kringle-like,superfamily_Frizzled_dom,smart_Kringle,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Frizzled_dom,pfscan_Kringle,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.G648R	ENST00000375708.3	37	c.1942	CCDS6691.1	9	.	.	.	.	.	.	.	.	.	.	C	13.84	2.356590	0.41801	.	.	ENSG00000169071	ENST00000375715	T	0.77620	-1.11	3.35	-2.75	0.05914	.	.	.	.	.	T	0.61502	0.2352	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.48222	-0.9054	8	0.52906	T	0.07	.	4.1206	0.10104	0.0:0.2857:0.338:0.3763	.	648	B1APY4	.	R	648	ENSP00000364867:G648R	ENSP00000364867:G648R	G	-	1	0	ROR2	93524662	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-1.260000	0.02858	-0.602000	0.05775	-0.379000	0.06801	GGG	-	NULL		0.522	ROR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ROR2	protein_coding	OTTHUMT00000053040.1	C		-		94484841	-1	no_errors	ENST00000375715	ensembl	human	putative	74_37	missense	SNP	0.000	T
MYL1	4632	genome.wustl.edu	37	2	211179643	211179643	+	Missense_Mutation	SNP	C	C	T			TCGA-VT-A80J-02A-11D-A417-09	TCGA-VT-A80J-11A-22D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9f5f2b4-7057-4dbc-aa22-577a341c4045	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr2:211179643C>T	ENST00000352451.3	-	1	271	c.124G>A	c.(124-126)Gcc>Acc	p.A42T		NM_079420.2	NP_524144.1	P05976	MYL1_HUMAN	myosin, light chain 1, alkali; skeletal, fast	42					cardiac muscle contraction (GO:0060048)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)	cytosol (GO:0005829)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|sarcomere (GO:0030017)	calcium ion binding (GO:0005509)|structural constituent of muscle (GO:0008307)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(2)|skin(1)	16				Epithelial(149;0.00573)|Lung(261;0.0422)|LUSC - Lung squamous cell carcinoma(261;0.0444)|all cancers(144;0.057)		ACCTTAATGGCAGAGAGGTCA	0.502																																																	0								ENSG00000168530						137.0	152.0	147.0					2																	211179643		2203	4300	6503	MYL1	SO:0001583	missense	0			-	HGNC		CCDS2390.1, CCDS2391.1	2q33-q34	2013-01-10	2006-09-29		ENSG00000168530	ENSG00000168530		"""Myosins / Light chain"", ""EF-hand domain containing"""	7582	protein-coding gene	gene with protein product		160780	"""myosin, light polypeptide 1, alkali; skeletal, fast"""			2304459, 3422212	Standard	NM_079422		Approved		uc002vec.3	P05976	OTTHUMG00000132992	ENST00000352451.3:c.124G>A	2.37:g.211179643C>T	ENSP00000307280:p.Ala42Thr	Somatic	0	61	0.00		0.6324490966295101	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	59	10.61	B2R4N6|B2R4T6|P06741|Q6IBD5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_EF_hand_dom,pfscan_EF_hand_dom	p.A42T	ENST00000352451.3	37	c.124	CCDS2390.1	2	.	.	.	.	.	.	.	.	.	.	C	11.76	1.735650	0.30774	.	.	ENSG00000168530	ENST00000352451	D	0.84146	-1.81	5.39	-0.136	0.13473	.	0.368381	0.27604	N	0.018632	T	0.66616	0.2807	N	0.12182	0.205	0.36351	D	0.860091	B	0.16396	0.017	B	0.15052	0.012	T	0.52396	-0.8581	10	0.22706	T	0.39	.	7.3309	0.26582	0.6434:0.2362:0.0:0.1204	.	42	P05976	MYL1_HUMAN	T	42	ENSP00000307280:A42T	ENSP00000307280:A42T	A	-	1	0	MYL1	210887888	1.000000	0.71417	0.998000	0.56505	0.989000	0.77384	1.003000	0.29809	-0.046000	0.13446	-0.262000	0.10625	GCC	-	NULL		0.502	MYL1-001	KNOWN	basic|CCDS	protein_coding	MYL1	protein_coding	OTTHUMT00000256566.2	C	NM_079420	-		211179643	-1	no_errors	ENST00000352451	ensembl	human	known	74_37	missense	SNP	0.993	T
EPB41L1	2036	genome.wustl.edu	37	20	34761735	34761735	+	Silent	SNP	G	G	A			TCGA-VT-A80J-02A-11D-A417-09	TCGA-VT-A80J-11A-22D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9f5f2b4-7057-4dbc-aa22-577a341c4045	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr20:34761735G>A	ENST00000338074.2	+	2	197	c.36G>A	c.(34-36)aaG>aaA	p.K12K	EPB41L1_ENST00000373946.3_Intron|EPB41L1_ENST00000373950.2_Intron|EPB41L1_ENST00000441639.1_Intron|EPB41L1_ENST00000373941.1_Silent_p.K12K|EPB41L1_ENST00000202028.5_Intron	NM_001258329.1|NM_012156.2	NP_001245258.1|NP_036288.2	Q9H4G0	E41L1_HUMAN	erythrocyte membrane protein band 4.1-like 1	12					cortical actin cytoskeleton organization (GO:0030866)|synaptic transmission (GO:0007268)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|plasma membrane (GO:0005886)	structural molecule activity (GO:0005198)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(10)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	37	Breast(12;0.0239)					CTGAGGTGAAGAAAGCTCAGG	0.622																																																	0								ENSG00000088367						37.0	41.0	39.0					20																	34761735		2203	4300	6503	EPB41L1	SO:0001819	synonymous_variant	0			-	HGNC	AB002336	CCDS13271.1, CCDS13272.1, CCDS58771.1	20q11.2-q12	2003-03-17			ENSG00000088367	ENSG00000088367			3378	protein-coding gene	gene with protein product		602879				9570967, 9828140	Standard	NM_012156		Approved	KIAA0338	uc002xfb.3	Q9H4G0	OTTHUMG00000032378	ENST00000338074.2:c.36G>A	20.37:g.34761735G>A		Somatic	0	44	0.00		0.6324490966295101	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	31	31.11	O15046|Q4VXM6|Q4VXM7|Q4VXM8|Q4VXN4|Q6ZT61|Q8IUU7|Q96CV5|Q96L65	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Band_4.1_C,pfam_FERM_PH-like_C,pfam_FERM_N,pfam_FERM_central,pfam_SAB_dom,pfam_FERM-adjacent,superfamily_FERM_central,smart_Band_41_domain,pirsf_Band_41_protein,pfscan_FERM_domain,prints_Band_41_fam,prints_Ez/rad/moesin_like	p.K12	ENST00000338074.2	37	c.36	CCDS13271.1	20																																																																																			-	pirsf_Band_41_protein		0.622	EPB41L1-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EPB41L1	protein_coding	OTTHUMT00000078978.3	G	NM_012156	-		34761735	+1	no_errors	ENST00000338074	ensembl	human	known	74_37	silent	SNP	1.000	A
PRIM2	5558	genome.wustl.edu	37	6	57512787	57512788	+	3'UTR	INS	-	-	CACCAAGGC	rs373452397|rs376103961|rs386701662|rs79832250		TCGA-VT-A80J-02A-11D-A417-09	TCGA-VT-A80J-11A-22D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9f5f2b4-7057-4dbc-aa22-577a341c4045	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr6:57512787_57512788insCACCAAGGC	ENST00000389488.2	+	0	1702_1703				PRIM2_ENST00000607273.1_3'UTR			P49643	PRI2_HUMAN	primase, DNA, polypeptide 2 (58kDa)						DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	nucleoplasm (GO:0005654)|primosome complex (GO:1990077)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA primase activity (GO:0003896)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(34)|prostate(6)|stomach(4)|upper_aerodigestive_tract(1)	59				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		ttgcactctgttgtgtaattgt	0.431																																																	0								ENSG00000146143																																			PRIM2	SO:0001624	3_prime_UTR_variant	0				HGNC		CCDS75476.1, CCDS75477.1	6p12-p11.1	2013-01-31	2007-06-19	2007-06-19	ENSG00000146143	ENSG00000146143			9370	protein-coding gene	gene with protein product		176636	"""primase, polypeptide 2A (58kD)"", ""primase, polypeptide 2A, 58kDa"""	PRIM2A		8530050, 20675616	Standard	NM_001282487		Approved		uc003pdx.3	P49643	OTTHUMG00000016190	ENST00000389488.2:c.*1700->CACCAAGGC	6.37:g.57512787_57512788insCACCAAGGC		Somatic	NA	NA	NA		0.6324490966295101	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q53FJ8|Q6P1Q7|Q8WVL2|Q9H413	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000389488.2	37	NULL		6																																																																																			-	-		0.431	PRIM2-001	KNOWN	sequence_error|basic	processed_transcript	PRIM2	protein_coding	OTTHUMT00000043468.3	-	NM_000947			57512788	+1	no_errors	ENST00000389488	ensembl	human	known	74_37	rna	INS	0.057:0.034	CACCAAGGC
ODF3L1	161753	genome.wustl.edu	37	15	76018406	76018406	+	Silent	SNP	G	G	T			TCGA-VT-A80J-02A-11D-A417-09	TCGA-VT-A80J-11A-22D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9f5f2b4-7057-4dbc-aa22-577a341c4045	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr15:76018406G>T	ENST00000332145.2	+	3	460	c.237G>T	c.(235-237)gtG>gtT	p.V79V	DNM1P35_ENST00000501931.1_RNA	NM_175881.3	NP_787077.1	Q8IXM7	OD3L1_HUMAN	outer dense fiber of sperm tails 3-like 1	79										kidney(1)|lung(1)	2						CAGGGATGGTGTGCCACAGCA	0.617																																																	0								ENSG00000182950						53.0	44.0	47.0					15																	76018406		2197	4294	6491	ODF3L1	SO:0001819	synonymous_variant	0			-	HGNC	BC039862	CCDS10285.1	15q23	2008-02-05			ENSG00000182950	ENSG00000182950			28735	protein-coding gene	gene with protein product							Standard	NM_175881		Approved	MGC48986	uc002bax.1	Q8IXM7	OTTHUMG00000142837	ENST00000332145.2:c.237G>T	15.37:g.76018406G>T		Somatic	0	36	0.00		0.6324490966295101	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	23	14.81		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_SHIPPO-rpt	p.V79	ENST00000332145.2	37	c.237	CCDS10285.1	15																																																																																			-	NULL		0.617	ODF3L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ODF3L1	protein_coding	OTTHUMT00000286473.1	G	NM_175881	-		76018406	+1	no_errors	ENST00000332145	ensembl	human	known	74_37	silent	SNP	0.000	T
PGM3	5238	genome.wustl.edu	37	6	83885740	83885740	+	Missense_Mutation	SNP	G	G	T			TCGA-VT-A80J-02A-11D-A417-09	TCGA-VT-A80J-11A-22D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9f5f2b4-7057-4dbc-aa22-577a341c4045	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr6:83885740G>T	ENST00000283977.4	-	8	952	c.826C>A	c.(826-828)Cac>Aac	p.H276N	PGM3_ENST00000512866.1_Missense_Mutation_p.H357N|PGM3_ENST00000513973.1_Missense_Mutation_p.H357N|PGM3_ENST00000506587.1_Missense_Mutation_p.H385N					phosphoglucomutase 3											NS(1)|breast(1)|endometrium(2)|large_intestine(4)|lung(6)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	18		all_cancers(76;0.000504)|Acute lymphoblastic leukemia(125;3.85e-06)|all_hematologic(105;0.0017)|all_epithelial(107;0.068)		BRCA - Breast invasive adenocarcinoma(397;0.0478)		GCCTTGTGGTGCAAATGTTTT	0.368																																																	0								ENSG00000013375						130.0	119.0	123.0					6																	83885740		2203	4300	6503	PGM3	SO:0001583	missense	0			-	HGNC	BC001258	CCDS4997.1, CCDS56435.1, CCDS56436.1, CCDS75487.1	6q14.1-q15	2012-10-02			ENSG00000013375	ENSG00000013375	5.4.2.3		8907	protein-coding gene	gene with protein product	"""acetylglucosamine phosphomutase"""	172100				12174217, 10721701	Standard	NM_001199917		Approved	AGM1, DKFZP434B187, PAGM	uc011dyz.2	O95394	OTTHUMG00000015110	ENST00000283977.4:c.826C>A	6.37:g.83885740G>T	ENSP00000283977:p.His276Asn	Somatic	0	59	0.00		0.6324490966295101	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	37	11.90		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_A-D-PHexomutase_a/b/a-I,pfam_A-D-PHexomutase_a/b/a-II,pfam_A-D-PHexomutase_C,superfamily_A-D-PHexomutase_a/b/a-I/II/III,pirsf_PAGM	p.H357N	ENST00000283977.4	37	c.1069		6	.	.	.	.	.	.	.	.	.	.	G	28.9	4.958779	0.92726	.	.	ENSG00000013375	ENST00000513973;ENST00000512866;ENST00000283977;ENST00000506587	T;T;T;T	0.62788	-0.0;-0.0;-0.0;-0.0	6.02	6.02	0.97574	Alpha-D-phosphohexomutase, alpha/beta/alpha I/II/III (2);	0.042575	0.85682	D	0.000000	D	0.83658	0.5302	H	0.95611	3.695	0.80722	D	1	D;D;D	0.67145	0.996;0.965;0.996	P;P;D	0.63957	0.877;0.834;0.92	D	0.86633	0.1887	10	0.59425	D	0.04	-46.5601	20.5407	0.99260	0.0:0.0:1.0:0.0	.	385;385;357	E9PF86;B4DX94;O95394	.;.;AGM1_HUMAN	N	357;357;276;385	ENSP00000424874:H357N;ENSP00000421565:H357N;ENSP00000283977:H276N;ENSP00000425809:H385N	ENSP00000283977:H276N	H	-	1	0	PGM3	83942459	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	9.209000	0.95087	2.865000	0.98341	0.655000	0.94253	CAC	-	superfamily_A-D-PHexomutase_a/b/a-I/II/III,pirsf_PAGM		0.368	PGM3-003	PUTATIVE	basic|exp_conf	protein_coding	PGM3	protein_coding	OTTHUMT00000366385.2	G	NM_015599	-		83885740	-1	no_errors	ENST00000513973	ensembl	human	known	74_37	missense	SNP	1.000	T
MAGED1	9500	genome.wustl.edu	37	X	51638173	51638173	+	Missense_Mutation	SNP	G	G	A			TCGA-VT-A80J-02A-11D-A417-09	TCGA-VT-A80J-11A-22D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9f5f2b4-7057-4dbc-aa22-577a341c4045	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chrX:51638173G>A	ENST00000375722.1	+	3	322	c.70G>A	c.(70-72)Gcc>Acc	p.A24T	MAGED1_ENST00000375772.3_Missense_Mutation_p.A24T|MAGED1_ENST00000494718.1_3'UTR|MAGED1_ENST00000326587.7_Missense_Mutation_p.A24T|MAGED1_ENST00000375695.2_Missense_Mutation_p.A80T			Q9Y5V3	MAGD1_HUMAN	melanoma antigen family D, 1	24					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|circadian regulation of gene expression (GO:0032922)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of circadian rhythm (GO:0042752)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	transcription coactivator activity (GO:0003713)			breast(1)|endometrium(4)|large_intestine(10)|lung(13)|ovary(3)|upper_aerodigestive_tract(1)	32	Ovarian(276;0.236)					AGAAGACAGCGCCTTGCTTAT	0.592										Multiple Myeloma(10;0.10)																																							0								ENSG00000179222						34.0	33.0	34.0					X																	51638173		2203	4299	6502	MAGED1	SO:0001583	missense	0			-	HGNC	AF124440	CCDS14337.1, CCDS35279.1	Xp11.23	2008-08-01			ENSG00000179222	ENSG00000179222			6813	protein-coding gene	gene with protein product		300224				10409427	Standard	NM_006986		Approved	NRAGE, DLXIN-1	uc004dpn.3	Q9Y5V3	OTTHUMG00000021540	ENST00000375722.1:c.70G>A	X.37:g.51638173G>A	ENSP00000364874:p.Ala24Thr	Somatic	0	61	0.00		0.6324490966295101	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	30	23	56.60	Q5VSH6|Q8IZ84|Q8WY92|Q9H352|Q9HBT4|Q9UF36	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MAGE,pfscan_MAGE	p.A80T	ENST00000375722.1	37	c.238	CCDS14337.1	X	.	.	.	.	.	.	.	.	.	.	G	8.300	0.819649	0.16607	.	.	ENSG00000179222	ENST00000375772;ENST00000375722;ENST00000326587;ENST00000375695;ENST00000430189	T;T;T;T	0.46063	0.88;0.88;0.88;0.88	3.85	-4.12	0.03916	.	1.317030	0.05432	N	0.546076	T	0.18341	0.0440	N	0.19112	0.55	0.23962	N	0.996331	B;B;B	0.34399	0.033;0.363;0.452	B;B;B	0.20577	0.005;0.03;0.019	T	0.11941	-1.0567	10	0.14656	T	0.56	.	4.3385	0.11097	0.4391:0.3276:0.2333:0.0	.	24;80;24	B4DQ04;Q9Y5V3-2;Q9Y5V3	.;.;MAGD1_HUMAN	T	24;24;24;80;24	ENSP00000364927:A24T;ENSP00000364874:A24T;ENSP00000325333:A24T;ENSP00000364847:A80T	ENSP00000325333:A24T	A	+	1	0	MAGED1	51654913	0.962000	0.33011	0.976000	0.42696	0.963000	0.63663	-0.387000	0.07361	-0.615000	0.05679	0.420000	0.28162	GCC	-	NULL		0.592	MAGED1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MAGED1	protein_coding	OTTHUMT00000056593.1	G	NM_001005332	-		51638173	+1	no_errors	ENST00000375695	ensembl	human	known	74_37	missense	SNP	0.950	A
CELSR3	1951	genome.wustl.edu	37	3	48701489	48701489	+	5'Flank	SNP	G	G	T			TCGA-VT-A80J-02A-11D-A417-09	TCGA-VT-A80J-11A-22D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9f5f2b4-7057-4dbc-aa22-577a341c4045	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr3:48701489G>T	ENST00000164024.4	-	0	0				CELSR3_ENST00000544264.1_5'Flank|NCKIPSD_ENST00000341520.4_Missense_Mutation_p.P682T|RP11-148G20.1_ENST00000421275.1_RNA	NM_001407.2	NP_001398.2	Q9NYQ7	CELR3_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 3						axonal fasciculation (GO:0007413)|cilium assembly (GO:0042384)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of protein localization (GO:0032880)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(9)|prostate(6)|skin(7)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	83				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		ACAGGGTGCGGCTCCCGCGAT	0.652											OREG0015562	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000213672						12.0	12.0	12.0					3																	48701489		873	1989	2862	NCKIPSD	SO:0001631	upstream_gene_variant	0			-	HGNC	AF231023	CCDS2775.1	3p21.31	2014-08-08	2013-02-18		ENSG00000008300	ENSG00000008300		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3230	protein-coding gene	gene with protein product	"""flamingo homolog 1 (Drosophila)"""	604264	"""cadherin EGF LAG seven-pass G-type receptor 3, flamingo (Drosophila) homolog"""	EGFL1		9693030	Standard	NM_001407		Approved	MEGF2, HFMI1, FMI1, CDHF11	uc003cuf.1	Q9NYQ7	OTTHUMG00000133544		3.37:g.48701489G>T	Exception_encountered	Somatic	0	179	0.00	956	0.6324490966295101	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	119	17.93	O75092	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF2013,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain	p.P682T	ENST00000164024.4	37	c.2044	CCDS2775.1	3	.	.	.	.	.	.	.	.	.	.	G	13.45	2.240235	0.39598	.	.	ENSG00000213672	ENST00000341520	T	0.48522	0.81	3.62	1.82	0.25136	.	0.376809	0.24189	U	0.040730	T	0.41811	0.1175	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.28073	-1.0055	7	0.49607	T	0.09	.	5.7411	0.18094	0.2459:0.0:0.7541:0.0	.	.	.	.	T	682	ENSP00000342621:P682T	ENSP00000342621:P682T	P	-	1	0	NCKIPSD	48676493	0.309000	0.24518	0.040000	0.18447	0.154000	0.21943	1.282000	0.33226	0.503000	0.28060	0.655000	0.94253	CCG	-	NULL		0.652	CELSR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCKIPSD	protein_coding	OTTHUMT00000257523.1	G	NM_001407	-		48701489	-1	no_errors	ENST00000341520	ensembl	human	known	74_37	missense	SNP	0.098	T
ORC3	23595	genome.wustl.edu	37	6	88375493	88375493	+	Missense_Mutation	SNP	G	G	T			TCGA-VT-A80J-02A-11D-A417-09	TCGA-VT-A80J-11A-22D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9f5f2b4-7057-4dbc-aa22-577a341c4045	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr6:88375493G>T	ENST00000392844.3	+	19	2020	c.1972G>T	c.(1972-1974)Gct>Tct	p.A658S	ORC3_ENST00000546266.1_Missense_Mutation_p.A515S|ORC3_ENST00000257789.4_Missense_Mutation_p.A659S	NM_012381.3|NM_181837.2	NP_036513.2|NP_862820.1	Q9UBD5	ORC3_HUMAN	origin recognition complex, subunit 3	658					DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|neural precursor cell proliferation (GO:0061351)	nuclear origin of replication recognition complex (GO:0005664)|nucleoplasm (GO:0005654)|origin recognition complex (GO:0000808)	DNA replication origin binding (GO:0003688)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|liver(1)|lung(9)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	28						AGTTGTGACAGCTGCTGAAAA	0.328																																																	0								ENSG00000135336						53.0	53.0	53.0					6																	88375493		2203	4299	6502	ORC3	SO:0001583	missense	0			-	HGNC	AF093535	CCDS5012.1, CCDS43486.1, CCDS56440.1	6q	2010-10-12	2010-10-12	2010-10-12	ENSG00000135336	ENSG00000135336			8489	protein-coding gene	gene with protein product		604972	"""origin recognition complex, subunit 3 (yeast homolog)-like"", ""origin recognition complex, subunit 3-like (yeast)"", ""origin recognition complex, subunit 3 honolog (yeast)"""	ORC3L		9829972, 10402192	Standard	NM_181837		Approved	IMAGE50150, LATHEO	uc003pmg.3	Q9UBD5	OTTHUMG00000015179	ENST00000392844.3:c.1972G>T	6.37:g.88375493G>T	ENSP00000376586:p.Ala658Ser	Somatic	0	50	0.00		0.6324490966295101	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	30	9.09	A2A2T5|B4E025|Q13565|Q53GY6|Q5T159|Q6IUY7|Q86TN5|Q9UG44|Q9UNT6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ORC3	p.A659S	ENST00000392844.3	37	c.1975	CCDS43486.1	6	.	.	.	.	.	.	.	.	.	.	G	16.18	3.051568	0.55218	.	.	ENSG00000135336	ENST00000392844;ENST00000257789;ENST00000546266	T;T;T	0.11063	3.17;3.17;2.81	5.85	5.85	0.93711	.	0.050164	0.85682	D	0.000000	T	0.03305	0.0096	N	0.20986	0.625	0.58432	D	0.999991	B;P;P	0.41929	0.138;0.765;0.708	B;B;B	0.37198	0.082;0.243;0.227	T	0.23547	-1.0185	10	0.06494	T	0.89	-12.3244	20.1653	0.98150	0.0:0.0:1.0:0.0	.	596;658;659	B4E014;Q9UBD5;Q9UBD5-2	.;ORC3_HUMAN;.	S	658;659;515	ENSP00000376586:A658S;ENSP00000257789:A659S;ENSP00000444695:A515S	ENSP00000257789:A659S	A	+	1	0	ORC3	88432212	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.759000	0.74934	2.768000	0.95171	0.655000	0.94253	GCT	-	NULL		0.328	ORC3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ORC3	protein_coding	OTTHUMT00000041452.2	G		-		88375493	+1	no_errors	ENST00000257789	ensembl	human	known	74_37	missense	SNP	1.000	T
LINC01317	104355287	genome.wustl.edu	37	2	33952141	33952141	+	lincRNA	SNP	C	C	T			TCGA-VT-A80J-02A-11D-A417-09	TCGA-VT-A80J-11A-22D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9f5f2b4-7057-4dbc-aa22-577a341c4045	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr2:33952141C>T	ENST00000366209.2	+	0	68				MYADML_ENST00000474610.1_RNA																							CAGAGTACACCAGGTCGCCCA	0.572																																																	0								ENSG00000239649																																			MYADML			0			-	HGNC																													2.37:g.33952141C>T		Somatic	0	61	0.00		0.6324490966295101	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	49	28.99		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000366209.2	37	NULL		2																																																																																			-	-		0.572	AC009499.1-002	KNOWN	non_canonical_polymorphism|basic	lincRNA	MYADML	lincRNA	OTTHUMT00000325406.1	C		-		33952141	-1	no_errors	ENST00000474610	ensembl	human	known	74_37	rna	SNP	1.000	T
MORN1	79906	genome.wustl.edu	37	1	2282770	2282770	+	Intron	DEL	G	G	-			TCGA-VT-A80J-02A-11D-A417-09	TCGA-VT-A80J-11A-22D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9f5f2b4-7057-4dbc-aa22-577a341c4045	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr1:2282770delG	ENST00000378531.3	-	10	1210				RP4-740C4.6_ENST00000602865.1_RNA|MORN1_ENST00000606372.1_Intron	NM_024848.1	NP_079124.1	Q5T089	MORN1_HUMAN	MORN repeat containing 1											breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(1)|liver(1)|lung(1)|ovary(2)	9	all_cancers(77;0.000194)|all_epithelial(69;9.96e-05)|all_lung(157;0.016)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;3.3e-15)|all_lung(118;1.15e-06)|Lung NSC(185;6.26e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)		Epithelial(90;2.21e-37)|OV - Ovarian serous cystadenocarcinoma(86;5.01e-23)|GBM - Glioblastoma multiforme(42;2.8e-08)|Colorectal(212;5.97e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.00137)|BRCA - Breast invasive adenocarcinoma(365;0.00488)|STAD - Stomach adenocarcinoma(132;0.00665)|KIRC - Kidney renal clear cell carcinoma(229;0.0203)|Lung(427;0.212)		GGTCACAGCAGGGCACGCCAC	0.627																																																	0								ENSG00000269896																																			RP4-740C4.6	SO:0001627	intron_variant	0				Clone_based_vega_gene	AK024003	CCDS40.1, CCDS72688.1	1p36.33-p36.32	2008-02-05			ENSG00000116151	ENSG00000116151			25852	protein-coding gene	gene with protein product						12477932	Standard	XM_005244798		Approved	FLJ13941	uc001ajb.1	Q5T089	OTTHUMG00000001402	ENST00000378531.3:c.1036+6100C>-	1.37:g.2282770delG		Somatic	0	42	0.00		0.6324490966295101	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	9	18.18	A6NKZ6|Q8WW30|Q9H852	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000378531.3	37	NULL	CCDS40.1	1																																																																																			-	-		0.627	MORN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LOC100129534	protein_coding	OTTHUMT00000004055.1	G	NM_024848			2282770	-1	no_errors	ENST00000602865	ensembl	human	known	74_37	rna	DEL	0.009	-
ATAD3C	219293	genome.wustl.edu	37	1	1387815	1387815	+	Splice_Site	SNP	G	G	A			TCGA-VT-A80J-02A-11D-A417-09	TCGA-VT-A80J-11A-22D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9f5f2b4-7057-4dbc-aa22-577a341c4045	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr1:1387815G>A	ENST00000378785.2	+	3	1217		c.e3+1			NM_001039211.2	NP_001034300.2	Q5T2N8	ATD3C_HUMAN	ATPase family, AAA domain containing 3C								ATP binding (GO:0005524)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|lung(4)	7	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;1.79e-36)|OV - Ovarian serous cystadenocarcinoma(86;3.94e-22)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.145)		GACAGCCACGGTAAACATACT	0.602																																																	0								ENSG00000215915						138.0	118.0	124.0					1																	1387815		692	1591	2283	ATAD3C	SO:0001630	splice_region_variant	0			-	HGNC	AK091918	CCDS44039.1	1p36.33	2010-04-21		2007-02-08	ENSG00000215915	ENSG00000215915		"""ATPases / AAA-type"""	32151	protein-coding gene	gene with protein product							Standard	NM_001039211		Approved	FLJ34599	uc001aft.2	Q5T2N8	OTTHUMG00000000531	ENST00000378785.2:c.222+1G>A	1.37:g.1387815G>A		Somatic	0	112	0.00		0.6324490966295101	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	36	25	59.02	Q8N1Z5	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e3+1	ENST00000378785.2	37	c.222+1	CCDS44039.1	1	.	.	.	.	.	.	.	.	.	.	G	8.235	0.805515	0.16467	.	.	ENSG00000215915	ENST00000378785	.	.	.	2.48	2.48	0.30137	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.9955	0.53201	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ATAD3C	1377678	1.000000	0.71417	0.959000	0.39883	0.164000	0.22412	7.420000	0.80191	1.224000	0.43551	0.194000	0.17425	.	-	-		0.602	ATAD3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATAD3C	protein_coding	OTTHUMT00000001279.3	G	NM_001039211	-	Intron	1387815	+1	no_errors	ENST00000378785	ensembl	human	known	74_37	splice_site	SNP	1.000	A
DMD	1756	genome.wustl.edu	37	X	33229530	33229530	+	5'UTR	SNP	C	C	G			TCGA-VT-A80J-02A-11D-A417-09	TCGA-VT-A80J-11A-22D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9f5f2b4-7057-4dbc-aa22-577a341c4045	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chrX:33229530C>G	ENST00000357033.4	-	0	106				DMD_ENST00000288447.4_Intron	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin						cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				AACCAACAAACTTCAGCAGCT	0.368																																																	0								ENSG00000198947																																			DMD	SO:0001623	5_prime_UTR_variant	0			-	HGNC	AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.-101G>C	X.37:g.33229530C>G		Somatic	0	71	0.00		0.6324490966295101	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	53	57	48.18	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000357033.4	37	NULL	CCDS14233.1	X																																																																																			-	-		0.368	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMD	protein_coding	OTTHUMT00000056182.2	C	NM_004006	-		33229530	-1	no_errors	ENST00000463609	ensembl	human	known	74_37	rna	SNP	0.902	G
RAI1	10743	genome.wustl.edu	37	17	17697974	17697974	+	Missense_Mutation	SNP	C	C	G			TCGA-VT-A80J-02A-11D-A417-09	TCGA-VT-A80J-11A-22D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9f5f2b4-7057-4dbc-aa22-577a341c4045	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr17:17697974C>G	ENST00000353383.1	+	3	2181	c.1712C>G	c.(1711-1713)tCc>tGc	p.S571C	RAI1_ENST00000261641.6_Missense_Mutation_p.S571C	NM_030665.3	NP_109590.3	Q7Z5J4	RAI1_HUMAN	retinoic acid induced 1	571					circadian regulation of gene expression (GO:0032922)|negative regulation of multicellular organism growth (GO:0040015)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	enhancer binding (GO:0035326)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(14)|ovary(1)|prostate(1)|skin(5)|urinary_tract(7)	48				READ - Rectum adenocarcinoma(1115;0.0276)		TCTGACGACTCCTTCCAGAGC	0.627																																																	0								ENSG00000108557						96.0	89.0	91.0					17																	17697974		2202	4300	6502	RAI1	SO:0001583	missense	0			-	HGNC	AJ230819	CCDS11188.1	17p11.2	2011-02-08			ENSG00000108557	ENSG00000108557			9834	protein-coding gene	gene with protein product		607642	"""Smith-Magenis syndrome chromosome region"""	SMCR		10036180	Standard	NM_030665		Approved	DKFZP434A139, SMS, KIAA1820, MGC12824	uc002grm.3	Q7Z5J4	OTTHUMG00000059314	ENST00000353383.1:c.1712C>G	17.37:g.17697974C>G	ENSP00000323074:p.Ser571Cys	Somatic	0	80	0.00		0.6324490966295101	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	14	53.33	Q8N3B4|Q8ND08|Q8WU64|Q96JK5|Q9H1C1|Q9H1C2|Q9UF69	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_Znf_PHD	p.S571C	ENST00000353383.1	37	c.1712	CCDS11188.1	17	.	.	.	.	.	.	.	.	.	.	C	20.0	3.931198	0.73327	.	.	ENSG00000108557	ENST00000353383;ENST00000395774;ENST00000395776;ENST00000355970;ENST00000261641;ENST00000315321	T;T;T	0.80480	-1.38;1.49;-0.81	5.18	5.18	0.71444	.	0.000000	0.64402	D	0.000001	D	0.88782	0.6530	M	0.64997	1.995	0.58432	D	0.999997	D	0.89917	1.0	D	0.83275	0.996	D	0.89816	0.3985	10	0.87932	D	0	.	18.6855	0.91562	0.0:1.0:0.0:0.0	.	571	Q7Z5J4	RAI1_HUMAN	C	571;571;571;571;571;523	ENSP00000323074:S571C;ENSP00000379120:S571C;ENSP00000261641:S571C	ENSP00000261641:S571C	S	+	2	0	RAI1	17638699	1.000000	0.71417	1.000000	0.80357	0.856000	0.48823	7.388000	0.79795	2.423000	0.82170	0.561000	0.74099	TCC	-	NULL		0.627	RAI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAI1	protein_coding	OTTHUMT00000131775.1	C	NM_030665	-		17697974	+1	no_errors	ENST00000353383	ensembl	human	known	74_37	missense	SNP	1.000	G
UBXN4	23190	genome.wustl.edu	37	2	136530072	136530072	+	Missense_Mutation	SNP	A	A	G			TCGA-VT-A80J-02A-11D-A417-09	TCGA-VT-A80J-11A-22D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9f5f2b4-7057-4dbc-aa22-577a341c4045	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr2:136530072A>G	ENST00000272638.9	+	9	1216	c.905A>G	c.(904-906)cAg>cGg	p.Q302R	UBXN4_ENST00000490163.1_3'UTR	NM_014607.3	NP_055422.1	Q92575	UBXN4_HUMAN	UBX domain protein 4	302					response to unfolded protein (GO:0006986)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)				NS(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	24						CTAGCAAAACAGGCAGAAATG	0.433																																																	0								ENSG00000144224						74.0	71.0	72.0					2																	136530072		1870	4113	5983	UBXN4	SO:0001583	missense	0			-	HGNC	D87684	CCDS42761.1	2q21.3-q22.1	2008-07-25	2008-07-25	2008-07-25	ENSG00000144224	ENSG00000144224		"""UBX domain containing"""	14860	protein-coding gene	gene with protein product	"""erasin"""	611216	"""UBX domain-containing 2"", ""UBX domain containing 2"""	UBXDC1, UBXD2		16968747	Standard	NM_014607		Approved	KIAA0242	uc002tur.3	Q92575	OTTHUMG00000153577	ENST00000272638.9:c.905A>G	2.37:g.136530072A>G	ENSP00000272638:p.Gln302Arg	Somatic	0	61	0.00		0.6324490966295101	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	41	57	41.84	A8K9W4|Q4ZG56|Q8IYM5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_UBX,superfamily_Thioredoxin-like_fold,smart_UBX,pfscan_UBX	p.Q302R	ENST00000272638.9	37	c.905	CCDS42761.1	2	.	.	.	.	.	.	.	.	.	.	A	18.23	3.578236	0.65878	.	.	ENSG00000144224	ENST00000272638;ENST00000430594	T	0.13420	2.59	5.8	5.8	0.92144	.	0.117723	0.64402	D	0.000015	T	0.20861	0.0502	M	0.77616	2.38	0.58432	D	0.999995	B	0.14012	0.009	B	0.12837	0.008	T	0.03112	-1.1071	10	0.24483	T	0.36	.	16.1611	0.81712	1.0:0.0:0.0:0.0	.	302	Q92575	UBXN4_HUMAN	R	302;284	ENSP00000272638:Q302R	ENSP00000272638:Q302R	Q	+	2	0	UBXN4	136246542	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	6.112000	0.71547	2.213000	0.71641	0.477000	0.44152	CAG	-	NULL		0.433	UBXN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBXN4	protein_coding	OTTHUMT00000331696.1	A	NM_014607	-		136530072	+1	no_errors	ENST00000272638	ensembl	human	known	74_37	missense	SNP	1.000	G
FILIP1	27145	genome.wustl.edu	37	6	76023331	76023331	+	Silent	SNP	A	A	G			TCGA-VT-A80J-02A-11D-A417-09	TCGA-VT-A80J-11A-22D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9f5f2b4-7057-4dbc-aa22-577a341c4045	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr6:76023331A>G	ENST00000237172.7	-	5	2547	c.2217T>C	c.(2215-2217)gaT>gaC	p.D739D	FILIP1_ENST00000393004.2_Silent_p.D739D|FILIP1_ENST00000498523.1_5'UTR|FILIP1_ENST00000370020.1_Silent_p.D640D	NM_015687.2	NP_056502.1	Q7Z7B0	FLIP1_HUMAN	filamin A interacting protein 1	739										breast(3)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)	80						GAGAAAGCTGATCTTCTTTGT	0.373																																																	0								ENSG00000118407						113.0	118.0	116.0					6																	76023331		2203	4300	6503	FILIP1	SO:0001819	synonymous_variant	0			-	HGNC	AB033101	CCDS4984.1, CCDS75480.1	6q14.1	2008-02-05			ENSG00000118407	ENSG00000118407			21015	protein-coding gene	gene with protein product		607307				10574462	Standard	XM_005248713		Approved	FILIP, KIAA1275	uc003pia.3	Q7Z7B0	OTTHUMG00000015056	ENST00000237172.7:c.2217T>C	6.37:g.76023331A>G		Somatic	0	24	0.00		0.6324490966295101	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	9	52.63	B2RMU6|Q5VUL6|Q86TC3|Q8N8B9|Q96SK6|Q9NVI8|Q9ULE5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Cortactin-binding_p2_N,prints_Tropomyosin	p.D739	ENST00000237172.7	37	c.2217	CCDS4984.1	6																																																																																			-	NULL		0.373	FILIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FILIP1	protein_coding	OTTHUMT00000041263.1	A	XM_029179	-		76023331	-1	no_errors	ENST00000237172	ensembl	human	known	74_37	silent	SNP	0.956	G
MYO5C	55930	genome.wustl.edu	37	15	52515824	52515824	+	Missense_Mutation	SNP	G	G	A			TCGA-VT-A80J-02A-11D-A417-09	TCGA-VT-A80J-11A-22D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9f5f2b4-7057-4dbc-aa22-577a341c4045	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr15:52515824G>A	ENST00000261839.7	-	29	3705	c.3544C>T	c.(3544-3546)Cac>Tac	p.H1182Y		NM_018728.3	NP_061198.2	Q9NQX4	MYO5C_HUMAN	myosin VC	1182						extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(7)|large_intestine(15)|lung(12)|ovary(7)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	66				all cancers(107;0.0137)		TTCTGCAGGTGGTTGATTTCT	0.418																																																	0								ENSG00000128833						133.0	127.0	129.0					15																	52515824		1859	4099	5958	MYO5C	SO:0001583	missense	0			-	HGNC	AF272390	CCDS42036.1	15q21	2011-09-27				ENSG00000128833		"""Myosins / Myosin superfamily : Class V"""	7604	protein-coding gene	gene with protein product	"""myosin 5C"""	610022				11870218	Standard	NM_018728		Approved	MGC74969	uc010bff.3	Q9NQX4		ENST00000261839.7:c.3544C>T	15.37:g.52515824G>A	ENSP00000261839:p.His1182Tyr	Somatic	0	47	0.00		0.6324490966295101	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	29	44.23	Q6P1W8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Myosin_head_motor_dom,pfam_Dil_domain,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_Dilute,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.H1182Y	ENST00000261839.7	37	c.3544	CCDS42036.1	15	.	.	.	.	.	.	.	.	.	.	G	15.82	2.946214	0.53079	.	.	ENSG00000128833	ENST00000261839	T	0.17054	2.3	6.07	5.15	0.70609	.	0.172530	0.52532	D	0.000077	T	0.13756	0.0333	N	0.22421	0.69	0.80722	D	1	P	0.40553	0.721	B	0.36335	0.222	T	0.02661	-1.1127	10	0.72032	D	0.01	.	16.7479	0.85477	0.0:0.0:0.8697:0.1303	.	1182	Q9NQX4	MYO5C_HUMAN	Y	1182	ENSP00000261839:H1182Y	ENSP00000261839:H1182Y	H	-	1	0	MYO5C	50303116	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.624000	0.61254	1.554000	0.49487	0.655000	0.94253	CAC	-	NULL		0.418	MYO5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO5C	protein_coding	OTTHUMT00000419562.1	G	NM_018728	-		52515824	-1	no_errors	ENST00000261839	ensembl	human	known	74_37	missense	SNP	1.000	A
HSPB6	126393	genome.wustl.edu	37	19	36244131	36244131	+	IGR	SNP	C	C	G			TCGA-VT-A80J-02A-11D-A417-09	TCGA-VT-A80J-11A-22D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9f5f2b4-7057-4dbc-aa22-577a341c4045	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr19:36244131C>G	ENST00000592984.1	-	0	1634				AC002398.11_ENST00000591091.1_RNA|AC002398.12_ENST00000587767.1_RNA|AC002398.9_ENST00000591613.2_3'UTR|LIN37_ENST00000301159.9_Missense_Mutation_p.P141A			O14558	HSPB6_HUMAN	heat shock protein, alpha-crystallin-related, B6						regulation of muscle contraction (GO:0006937)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)|structural constituent of eye lens (GO:0005212)			lung(1)	1	all_lung(56;3.33e-07)|Lung NSC(56;5.02e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			CTCACCCCTGCCCCCGCTGCC	0.657																																																	0								ENSG00000267796						18.0	20.0	19.0					19																	36244131		2036	4145	6181	LIN37	SO:0001628	intergenic_variant	0			-	HGNC	AJ278121	CCDS12475.1	19q13.13	2014-06-12			ENSG00000004776	ENSG00000004776		"""Heat shock proteins / HSPB"""	26511	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 91"""	610695				12820654, 14717697	Standard	NM_144617		Approved	FLJ32389, Hsp20, PPP1R91	uc002obn.2	O14558	OTTHUMG00000048122		19.37:g.36244131C>G		Somatic	0	58	0.00		0.6324490966295101	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	68	24.44	O14551|Q6NVI3|Q96MG9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.P141A	ENST00000592984.1	37	c.421	CCDS12475.1	19	.	.	.	.	.	.	.	.	.	.	C	13.03	2.114324	0.37339	.	.	ENSG00000188223	ENST00000301159	T	0.40225	1.04	4.92	2.71	0.32032	.	0.053971	0.85682	D	0.000000	T	0.31979	0.0814	L	0.42686	1.345	0.80722	D	1	B	0.06786	0.001	B	0.06405	0.002	T	0.09509	-1.0671	10	0.42905	T	0.14	-17.5835	8.3309	0.32187	0.1677:0.5072:0.3251:0.0	.	141	Q96GY3	LIN37_HUMAN	A	141	ENSP00000301159:P141A	ENSP00000301159:P141A	P	+	1	0	LIN37	40935971	0.996000	0.38824	0.857000	0.33713	0.989000	0.77384	2.626000	0.46460	0.627000	0.30340	0.561000	0.74099	CCC	-	NULL		0.657	HSPB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIN37	protein_coding	OTTHUMT00000109498.3	C	NM_144617	-		36244131	+1	no_errors	ENST00000301159	ensembl	human	known	74_37	missense	SNP	0.901	G
SPANXD	64648	genome.wustl.edu	37	X	140786506	140786506	+	Missense_Mutation	SNP	G	G	T			TCGA-VT-A80J-02A-11D-A417-09	TCGA-VT-A80J-11A-22D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9f5f2b4-7057-4dbc-aa22-577a341c4045	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chrX:140786506G>T	ENST00000370515.3	-	1	390	c.57C>A	c.(55-57)aaC>aaA	p.N19K		NM_032417.2|NM_145665.1	NP_115793.1|NP_663698.1	Q9BXN6	SPNXD_HUMAN	SPANX family, member D	19						cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	9	Acute lymphoblastic leukemia(192;7.65e-05)					CGTTGGCCTCGTTGGAATCAC	0.507																																																	0								ENSG00000196406						3.0	3.0	3.0					X																	140786506		1544	3070	4614	SPANXD	SO:0001583	missense	0			-	HGNC	AJ457791	CCDS14675.1	Xq27.2	2014-06-19			ENSG00000196406	ENSG00000196406			14332	protein-coding gene	gene with protein product	"""cancer/testis antigen family 11, member 4"""	300670, 300671	"""SPANX family, member E"""	SPANXE			Standard	NM_032417		Approved	CT11.4		Q9BXN6	OTTHUMG00000022563	ENST00000370515.3:c.57C>A	X.37:g.140786506G>T	ENSP00000359546:p.Asn19Lys	Somatic	1	196	0.51		0.6324490966295101	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	74	45	62.18	Q5JWI1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SPANX_prot	p.N19K	ENST00000370515.3	37	c.57	CCDS14675.1	X	.	.	.	.	.	.	.	.	.	.	G	8.848	0.943818	0.18281	.	.	ENSG00000196406	ENST00000370515	T	0.14516	2.5	.	.	.	.	.	.	.	.	T	0.29976	0.0750	.	.	.	0.09310	N	1	D	0.76494	0.999	D	0.85130	0.997	T	0.07809	-1.0753	6	0.87932	D	0	.	.	.	.	.	19	Q9BXN6	SPNXD_HUMAN	K	19	ENSP00000359546:N19K	ENSP00000359546:N19K	N	-	3	2	SPANXD	140614172	0.220000	0.23631	0.016000	0.15963	0.032000	0.12392	0.740000	0.26188	0.080000	0.16959	0.081000	0.15443	AAC	-	pfam_SPANX_prot		0.507	SPANXD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPANXD	protein_coding	OTTHUMT00000058598.1	G		-		140786506	-1	no_errors	ENST00000370515	ensembl	human	known	74_37	missense	SNP	0.016	T
CHD5	26038	genome.wustl.edu	37	1	6206323	6206323	+	Missense_Mutation	SNP	C	C	T	rs141210110		TCGA-VT-A80J-02A-11D-A417-09	TCGA-VT-A80J-11A-22D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9f5f2b4-7057-4dbc-aa22-577a341c4045	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr1:6206323C>T	ENST00000262450.3	-	11	1850	c.1751G>A	c.(1750-1752)cGc>cAc	p.R584H	CHD5_ENST00000378021.1_5'UTR	NM_015557.2	NP_056372.1	O00258	WRB_HUMAN	chromodomain helicase DNA binding protein 5	0					tail-anchored membrane protein insertion into ER membrane (GO:0071816)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(3)|central_nervous_system(3)|liver(1)|lung(1)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	16	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)		GATGCCATAGCGGTAGAAGCG	0.607																																																	0								ENSG00000116254	C	HIS/ARG	0,4406		0,0,2203	146.0	145.0	145.0		1751	3.8	1.0	1	dbSNP_134	145	2,8598	2.2+/-6.3	0,2,4298	yes	missense	CHD5	NM_015557.2	29	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	probably-damaging	584/1955	6206323	2,13004	2203	4300	6503	CHD5	SO:0001583	missense	0			-	HGNC	AF425231	CCDS57.1	1p36.3	2013-01-28			ENSG00000116254	ENSG00000116254		"""Zinc fingers, PHD-type"""	16816	protein-coding gene	gene with protein product		610771				11889561, 12592387	Standard	NM_015557		Approved		uc001amb.2	Q8TDI0	OTTHUMG00000000952	ENST00000262450.3:c.1751G>A	1.37:g.6206323C>T	ENSP00000262450:p.Arg584His	Somatic	0	35	0.00		0.6324490966295101	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	17	34.62	A8KAP8|A8MQ44|D3DSH9|O60740	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_CHD_C2,pfam_SNF2_N,pfam_DUF1086,pfam_CHD_N,pfam_DUF1087,pfam_Znf_PHD-finger,pfam_Chromo_domain,pfam_Helicase_C,pfam_Helicase/UvrB_dom,superfamily_P-loop_NTPase,superfamily_Chromodomain-like,superfamily_Znf_FYVE_PHD,superfamily_HMG_box_dom,smart_Znf_PHD,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Znf_PHD-finger,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.R584H	ENST00000262450.3	37	c.1751	CCDS57.1	1	.	.	.	.	.	.	.	.	.	.	C	25.9	4.686569	0.88639	0.0	2.33E-4	ENSG00000116254	ENST00000262450;ENST00000378006	T	0.72725	-0.68	3.85	3.85	0.44370	Chromo domain-like (1);	0.000000	0.85682	D	0.000000	D	0.85414	0.5691	M	0.86953	2.85	0.80722	D	1	D	0.76494	0.999	D	0.73380	0.98	D	0.88972	0.3401	10	0.87932	D	0	-21.9232	16.3262	0.82983	0.0:1.0:0.0:0.0	.	584	Q8TDI0	CHD5_HUMAN	H	584;100	ENSP00000262450:R584H	ENSP00000262450:R584H	R	-	2	0	CHD5	6128910	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	7.558000	0.82253	2.138000	0.66242	0.462000	0.41574	CGC	-	superfamily_Chromodomain-like		0.607	CHD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD5	protein_coding	OTTHUMT00000002823.2	C	NM_015557	rs141210110		6206323	-1	no_errors	ENST00000262450	ensembl	human	known	74_37	missense	SNP	1.000	T
FOXN3	1112	genome.wustl.edu	37	14	89629149	89629151	+	In_Frame_Del	DEL	GAG	GAG	-	rs139532153		TCGA-VT-A80J-02A-11D-A417-09	TCGA-VT-A80J-11A-22D-A36M-09	GAG	GAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9f5f2b4-7057-4dbc-aa22-577a341c4045	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr14:89629149_89629151delGAG	ENST00000345097.4	-	7	1196_1198	c.1080_1082delCTC	c.(1078-1083)tcctca>tca	p.360_361SS>S	FOXN3_ENST00000261302.5_In_Frame_Del_p.360_361SS>S|FOXN3_ENST00000557258.1_In_Frame_Del_p.338_339SS>S|FOXN3_ENST00000555353.1_In_Frame_Del_p.338_339SS>S	NM_001085471.1	NP_001078940.1	O00409	FOXN3_HUMAN	forkhead box N3	360					mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	protein C-terminus binding (GO:0008022)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|large_intestine(4)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						GTCGTCGGCTGAGGAGGAGGAGG	0.65																																																	0								ENSG00000053254		,	89,4171		9,71,2050					,	-2.3	1.0			26	192,8028		26,140,3944	no	coding,coding	FOXN3	NM_005197.3,NM_001085471.1	,	35,211,5994	A1A1,A1R,RR		2.3358,2.0892,2.2516	,	,		281,12199				FOXN3	SO:0001651	inframe_deletion	0				HGNC		CCDS32138.1, CCDS41977.1	14q32.11	2012-04-17	2007-05-02	2007-05-02	ENSG00000053254	ENSG00000053254		"""Forkhead boxes"""	1928	protein-coding gene	gene with protein product		602628	"""chromosome 14 open reading frame 116"", ""checkpoint suppressor 1"""	C14orf116, CHES1		9154802	Standard	NM_005197		Approved		uc001xxo.4	O00409	OTTHUMG00000170898	ENST00000345097.4:c.1080_1082delCTC	14.37:g.89629158_89629160delGAG	ENSP00000343288:p.Ser361del	Somatic	0	17	0.00		0.6324490966295101	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	31	8.82	Q96II7|Q9UIE7	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.S361in_frame_del	ENST00000345097.4	37	c.1082_1080	CCDS41977.1	14																																																																																			-	NULL		0.650	FOXN3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXN3	protein_coding	OTTHUMT00000410902.2	GAG	NM_005197			89629151	-1	no_errors	ENST00000261302	ensembl	human	known	74_37	in_frame_del	DEL	1.000:1.000:1.000	-
KHDRBS1	10657	genome.wustl.edu	37	1	32503558	32503558	+	Missense_Mutation	SNP	C	C	T			TCGA-VT-A80J-02A-11D-A417-09	TCGA-VT-A80J-11A-22D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9f5f2b4-7057-4dbc-aa22-577a341c4045	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr1:32503558C>T	ENST00000327300.7	+	6	1195	c.1028C>T	c.(1027-1029)cCa>cTa	p.P343L	KHDRBS1_ENST00000307714.8_3'UTR|KHDRBS1_ENST00000492989.1_Missense_Mutation_p.P304L	NM_006559.1	NP_006550.1			KH domain containing, RNA binding, signal transduction associated 1											endometrium(4)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)	14		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				AGGGGTGCTCCAGCACCAAGA	0.557																																					Ovarian(173;401 1982 12359 31110 42403)												0								ENSG00000121774						87.0	85.0	85.0					1																	32503558		2203	4300	6503	KHDRBS1	SO:0001583	missense	0			-	HGNC	U78971	CCDS350.1, CCDS60067.1	1p32	2008-07-18			ENSG00000121774	ENSG00000121774			18116	protein-coding gene	gene with protein product	"""GAP-associated tyrosine phosphoprotein p62 (Sam68)"""	602489				1374686, 10564820	Standard	NM_006559		Approved	Sam68, p62, FLJ34027	uc001bub.4	Q07666	OTTHUMG00000003921	ENST00000327300.7:c.1028C>T	1.37:g.32503558C>T	ENSP00000313829:p.Pro343Leu	Somatic	0	52	0.00		0.6324490966295101	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	75	27.88		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_KH_dom_type_1,smart_KH_dom,pfscan_KH_dom_type_1	p.P343L	ENST00000327300.7	37	c.1028	CCDS350.1	1	.	.	.	.	.	.	.	.	.	.	C	18.56	3.649893	0.67358	.	.	ENSG00000121774	ENST00000327300;ENST00000492989;ENST00000355201	T;T	0.47869	0.83;0.89	5.84	5.84	0.93424	.	0.364627	0.34652	N	0.003782	T	0.40909	0.1136	L	0.31420	0.93	0.80722	D	1	P;P	0.46912	0.818;0.886	B;P	0.45829	0.22;0.494	T	0.17107	-1.0380	10	0.02654	T	1	.	20.1225	0.97967	0.0:1.0:0.0:0.0	.	343;304	Q07666;Q07666-3	KHDR1_HUMAN;.	L	343;304;319	ENSP00000313829:P343L;ENSP00000417731:P304L	ENSP00000313829:P343L	P	+	2	0	KHDRBS1	32276145	1.000000	0.71417	0.994000	0.49952	0.810000	0.45777	5.063000	0.64332	2.937000	0.99478	0.650000	0.86243	CCA	-	NULL		0.557	KHDRBS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KHDRBS1	protein_coding	OTTHUMT00000011199.4	C	NM_006559	-		32503558	+1	no_errors	ENST00000327300	ensembl	human	known	74_37	missense	SNP	0.997	T
CCRN4L	25819	genome.wustl.edu	37	4	139966602	139966602	+	Frame_Shift_Del	DEL	A	A	-			TCGA-VT-A80J-02A-11D-A417-09	TCGA-VT-A80J-11A-22D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9f5f2b4-7057-4dbc-aa22-577a341c4045	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr4:139966602delA	ENST00000280614.2	+	3	1463	c.1270delA	c.(1270-1272)actfs	p.T424fs	ELF2_ENST00000515489.1_Intron	NM_012118.2	NP_036250.2	Q9UK39	NOCT_HUMAN	CCR4 carbon catabolite repression 4-like (S. cerevisiae)	424					circadian regulation of gene expression (GO:0032922)|cytoplasmic mRNA processing body assembly (GO:0033962)|deadenylation-dependent decapping of nuclear-transcribed mRNA (GO:0000290)|mRNA processing (GO:0006397)|mRNA stabilization (GO:0048255)|negative regulation of gene expression (GO:0010629)|negative regulation of osteoblast differentiation (GO:0045668)|positive regulation of fat cell differentiation (GO:0045600)|regulation of circadian rhythm (GO:0042752)|regulation of embryonic development (GO:0045995)|regulation of transcription, DNA-templated (GO:0006355)|response to extracellular stimulus (GO:0009991)|response to lipopolysaccharide (GO:0032496)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	metal ion binding (GO:0046872)|mRNA binding (GO:0003729)|poly(A)-specific ribonuclease activity (GO:0004535)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(2)|large_intestine(3)|lung(3)|ovary(1)	9	all_hematologic(180;0.162)					CTTCAGCTTTACTGAGGAATC	0.373																																					Ovarian(144;566 1842 19130 21379 22209)												0								ENSG00000151014						69.0	68.0	69.0					4																	139966602		2203	4300	6503	CCRN4L	SO:0001589	frameshift_variant	0				HGNC	AF183961	CCDS3743.1	4q31.1	2014-06-18	2001-11-28		ENSG00000151014	ENSG00000151014			14254	protein-coding gene	gene with protein product		608468	"""CCR4-like (carbon catabolite repression 4, S.cerevisiae)"""			10521507	Standard	NM_012118		Approved	CCR4L, Ccr4c	uc003ihl.3	Q9UK39	OTTHUMG00000161271	ENST00000280614.2:c.1270delA	4.37:g.139966602delA	ENSP00000280614:p.Thr424fs	Somatic	0	51	0.00		0.6324490966295101	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	16	11.11	D3DNY5|Q14D51|Q9HD93|Q9HD94|Q9HD95	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase	p.T424fs	ENST00000280614.2	37	c.1270	CCDS3743.1	4																																																																																			-	NULL		0.373	CCRN4L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCRN4L	protein_coding	OTTHUMT00000257231.3	A	NM_012118			139966602	+1	no_errors	ENST00000280614	ensembl	human	known	74_37	frame_shift_del	DEL	0.958	-
LOC440700	440700	genome.wustl.edu	37	1	165677941	165677941	+	lincRNA	SNP	C	C	T			TCGA-VT-A80J-02A-11D-A417-09	TCGA-VT-A80J-11A-22D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9f5f2b4-7057-4dbc-aa22-577a341c4045	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr1:165677941C>T	ENST00000608512.1	-	0	0				RP11-466F5.6_ENST00000400982.2_RNA																							TACGTTATGGCTGTGATTCCT	0.537																																																	0								ENSG00000215838																																			RP11-466F5.6			0			-	Clone_based_vega_gene																													1.37:g.165677941C>T		Somatic	0	38	0.00		0.6324490966295101	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	2	83.33		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000608512.1	37	NULL		1																																																																																			-	-		0.537	RP11-466F5.10-001	KNOWN	basic	lincRNA	LOC440700	lincRNA	OTTHUMT00000473144.1	C		-		165677941	+1	no_errors	ENST00000400982	ensembl	human	known	74_37	rna	SNP	0.013	T
FASN	2194	genome.wustl.edu	37	17	80041751	80041751	+	Silent	SNP	C	C	T			TCGA-VT-A80J-02A-11D-A417-09	TCGA-VT-A80J-11A-22D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9f5f2b4-7057-4dbc-aa22-577a341c4045	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr17:80041751C>T	ENST00000306749.2	-	30	5333	c.5115G>A	c.(5113-5115)cgG>cgA	p.R1705R	FASN_ENST00000579758.1_5'Flank	NM_004104.4	NP_004095.4	P49327	FAS_HUMAN	fatty acid synthase	1705	Enoyl reductase. {ECO:0000250}.				acetyl-CoA metabolic process (GO:0006084)|cellular lipid metabolic process (GO:0044255)|cellular response to interleukin-4 (GO:0071353)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|osteoblast differentiation (GO:0001649)|pantothenate metabolic process (GO:0015939)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycogen granule (GO:0042587)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	3-hydroxyoctanoyl-[acyl-carrier-protein] dehydratase activity (GO:0047451)|3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity (GO:0004317)|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity (GO:0004316)|3-oxoacyl-[acyl-carrier-protein] synthase activity (GO:0004315)|[acyl-carrier-protein] S-acetyltransferase activity (GO:0004313)|[acyl-carrier-protein] S-malonyltransferase activity (GO:0004314)|drug binding (GO:0008144)|enoyl-[acyl-carrier-protein] reductase (NADPH, A-specific) activity (GO:0047117)|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity (GO:0004319)|fatty acid synthase activity (GO:0004312)|myristoyl-[acyl-carrier-protein] hydrolase activity (GO:0016295)|NADPH binding (GO:0070402)|oleoyl-[acyl-carrier-protein] hydrolase activity (GO:0004320)|palmitoyl-[acyl-carrier-protein] hydrolase activity (GO:0016296)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(12)|prostate(3)|skin(2)|urinary_tract(1)	34	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		OV - Ovarian serous cystadenocarcinoma(97;0.0211)|BRCA - Breast invasive adenocarcinoma(99;0.0237)		Cerulenin(DB01034)|Orlistat(DB01083)	GGAGGTACGCCCGCTTCTCAG	0.706																																					Colon(59;314 1043 11189 28578 32273)												0								ENSG00000169710						36.0	30.0	32.0					17																	80041751		2183	4288	6471	FASN	SO:0001819	synonymous_variant	0			-	HGNC	U26644	CCDS11801.1	17q25	2012-01-31			ENSG00000169710	ENSG00000169710	2.3.1.85	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	3594	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 27X, member 1"""	600212				7835891, 7567999, 19027726	Standard	NM_004104		Approved	FAS, SDR27X1	uc002kdu.3	P49327		ENST00000306749.2:c.5115G>A	17.37:g.80041751C>T		Somatic	0	69	0.00		0.6324490966295101	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	41	8.89	Q13479|Q16702|Q4LE83|Q6P4U5|Q6SS02|Q969R1|Q96C68|Q96IT0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Acyl_transferase,pfam_Ketoacyl_synth_N,pfam_Thioesterase,pfam_PKS_KR,pfam_DH_sc/Rdtase_SDR,pfam_Ketoacyl_synth_C,pfam_ADH_C,pfam_Acyl_carrier_prot-like,pfam_Methyltransf_12,pfam_Methyltransf_11,superfamily_Thiolase-like,superfamily_Acyl_Trfase/lysoPLipase,superfamily_GroES-like,superfamily_Acyl_carrier_prot-like,superfamily_Malonyl_transacylase_ACP-bd,smart_PKS_Beta-ketoAc_synthase_dom,smart_PKS_acyl_transferase,smart_PKS_dehydratase,smart_PKS_ER,smart_PKS/FAS_KR,smart_PKS_PP-bd,pfscan_Acyl_carrier_prot-like	p.R1705	ENST00000306749.2	37	c.5115	CCDS11801.1	17																																																																																			-	pfam_ADH_C,smart_PKS_ER		0.706	FASN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FASN	protein_coding	OTTHUMT00000442369.1	C	NM_004104	-		80041751	-1	no_errors	ENST00000306749	ensembl	human	known	74_37	silent	SNP	0.931	T
MUC4	4585	genome.wustl.edu	37	3	195512366	195512366	+	Missense_Mutation	SNP	C	C	G			TCGA-VT-A80J-02A-11D-A417-09	TCGA-VT-A80J-11A-22D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9f5f2b4-7057-4dbc-aa22-577a341c4045	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr3:195512366C>G	ENST00000463781.3	-	2	6544	c.6085G>C	c.(6085-6087)Gac>Cac	p.D2029H	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.D2029H	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GGCGTGGTGTCACCAGTGGAT	0.577																																																	0								ENSG00000145113						26.0	24.0	25.0					3																	195512366		684	1577	2261	MUC4	SO:0001583	missense	0			-	HGNC	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.6085G>C	3.37:g.195512366C>G	ENSP00000417498:p.Asp2029His	Somatic	1	106	0.93		0.6324490966295101	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	83	23.15	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EG-like_dom,pfscan_AMOP,pfscan_EG-like_dom	p.D2029H	ENST00000463781.3	37	c.6085	CCDS54700.1	3	.	.	.	.	.	.	.	.	.	.	C	5.854	0.341728	0.11069	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.39229	1.09;1.09	.	.	.	.	.	.	.	.	T	0.21841	0.0526	N	0.19112	0.55	0.09310	N	1	B	0.26876	0.162	B	0.17433	0.018	T	0.18366	-1.0339	6	.	.	.	.	.	.	.	.	2029	E7ESK3	.	H	2029	ENSP00000417498:D2029H;ENSP00000420243:D2029H	.	D	-	1	0	MUC4	196996761	0.002000	0.14202	0.016000	0.15963	0.014000	0.08584	0.383000	0.20651	0.064000	0.16427	0.064000	0.15345	GAC	-	NULL		0.577	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	protein_coding	OTTHUMT00000324081.6	C	NM_018406	-		195512366	-1	no_errors	ENST00000463781	ensembl	human	known	74_37	missense	SNP	0.003	G
FLG2	388698	genome.wustl.edu	37	1	152328366	152328366	+	Silent	SNP	G	G	C			TCGA-VT-A80J-02A-11D-A417-09	TCGA-VT-A80J-11A-22D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9f5f2b4-7057-4dbc-aa22-577a341c4045	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr1:152328366G>C	ENST00000388718.5	-	3	1968	c.1896C>G	c.(1894-1896)ggC>ggG	p.G632G	FLG-AS1_ENST00000445097.1_RNA|FLG-AS1_ENST00000392688.2_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	632	Ser-rich.				establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			ACCCATGTTGGCCATAGCCAG	0.502																																																	0								ENSG00000143520						152.0	203.0	186.0					1																	152328366		2203	4297	6500	FLG2	SO:0001819	synonymous_variant	0			-	HGNC	AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.1896C>G	1.37:g.152328366G>C		Somatic	1	107	0.92		0.6324490966295101	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	40	61	39.22	Q9H4U1	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_S100_Ca-bd_sub,pfscan_EF_hand_dom,prints_Filaggrin	p.G632	ENST00000388718.5	37	c.1896	CCDS30861.1	1																																																																																			-	NULL		0.502	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG2	protein_coding	OTTHUMT00000034018.5	G	NM_001014342	-		152328366	-1	no_errors	ENST00000388718	ensembl	human	known	74_37	silent	SNP	0.000	C
R3HDM1	23518	genome.wustl.edu	37	2	136396651	136396651	+	Missense_Mutation	SNP	G	G	A			TCGA-VT-A80J-02A-11D-A417-09	TCGA-VT-A80J-11A-22D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9f5f2b4-7057-4dbc-aa22-577a341c4045	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr2:136396651G>A	ENST00000264160.4	+	14	1548	c.1178G>A	c.(1177-1179)aGt>aAt	p.S393N	R3HDM1_ENST00000409478.1_Missense_Mutation_p.S349N|R3HDM1_ENST00000329971.3_Missense_Mutation_p.S349N|R3HDM1_ENST00000409606.1_Missense_Mutation_p.S393N|R3HDM1_ENST00000410054.1_Missense_Mutation_p.S337N|R3HDM1_ENST00000443537.2_3'UTR	NM_001282798.1|NM_015361.2	NP_001269727.1|NP_056176.2	Q15032	R3HD1_HUMAN	R3H domain containing 1	393							poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(6)|kidney(5)|large_intestine(3)|lung(14)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(3)	38				BRCA - Breast invasive adenocarcinoma(221;0.127)		AGAGGTGATAGTTCTGGAAGC	0.433																																																	0								ENSG00000048991						88.0	96.0	93.0					2																	136396651		2203	4300	6503	R3HDM1	SO:0001583	missense	0			-	HGNC	D21852	CCDS2177.1, CCDS63024.1, CCDS63025.1, CCDS63026.1	2q21.3	2012-09-20	2005-09-02	2005-09-02	ENSG00000048991	ENSG00000048991			9757	protein-coding gene	gene with protein product			"""R3H domain (binds single-stranded nucleic acids) containing"""	R3HDM		7584026	Standard	NM_001282798		Approved	KIAA0029	uc002tuo.3	Q15032	OTTHUMG00000131740	ENST00000264160.4:c.1178G>A	2.37:g.136396651G>A	ENSP00000264160:p.Ser393Asn	Somatic	0	31	0.00		0.6324490966295101	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	53	25.35	A8K1V0|B3KXQ9|E9PBB4|E9PG42|G5E9G8|Q8IW32	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_R3H_ss-bd,smart_R3H_ss-bd,pfscan_R3H_ss-bd	p.S393N	ENST00000264160.4	37	c.1178	CCDS2177.1	2	.	.	.	.	.	.	.	.	.	.	G	25.5	4.642167	0.87859	.	.	ENSG00000048991	ENST00000422577;ENST00000409478;ENST00000264160;ENST00000329971;ENST00000410054;ENST00000409606	T;T;T;T;T	0.57595	0.74;0.39;0.89;0.44;0.41	5.31	4.43	0.53597	.	0.000000	0.85682	D	0.000000	T	0.73860	0.3641	M	0.82517	2.595	0.40815	D	0.983456	P;D;D;D	0.69078	0.787;0.997;0.993;0.993	P;D;D;D	0.70227	0.526;0.931;0.968;0.968	T	0.79184	-0.1908	10	0.56958	D	0.05	-11.4009	16.0489	0.80740	0.0:0.1344:0.8656:0.0	.	349;393;337;393	G5E9G8;E9PBB4;E9PG42;Q15032	.;.;.;R3HD1_HUMAN	N	349;349;393;349;337;393	ENSP00000386457:S349N;ENSP00000264160:S393N;ENSP00000331396:S349N;ENSP00000386877:S337N;ENSP00000387010:S393N	ENSP00000264160:S393N	S	+	2	0	R3HDM1	136113121	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	1.218000	0.43458	0.655000	0.94253	AGT	-	NULL		0.433	R3HDM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	R3HDM1	protein_coding	OTTHUMT00000254659.1	G	NM_015361	-		136396651	+1	no_errors	ENST00000264160	ensembl	human	known	74_37	missense	SNP	1.000	A
CPS1	1373	genome.wustl.edu	37	2	211540493	211540493	+	Missense_Mutation	SNP	C	C	A			TCGA-VT-A80J-02A-11D-A417-09	TCGA-VT-A80J-11A-22D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9f5f2b4-7057-4dbc-aa22-577a341c4045	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr2:211540493C>A	ENST00000233072.5	+	36	4399	c.4203C>A	c.(4201-4203)aaC>aaA	p.N1401K	CPS1_ENST00000430249.2_Missense_Mutation_p.N1407K|CPS1_ENST00000451903.2_Missense_Mutation_p.N950K	NM_001875.4	NP_001866.2	P31327	CPSM_HUMAN	carbamoyl-phosphate synthase 1, mitochondrial	1401					anion homeostasis (GO:0055081)|carbamoyl phosphate biosynthetic process (GO:0070409)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to glucagon stimulus (GO:0071377)|cellular response to oleic acid (GO:0071400)|citrulline biosynthetic process (GO:0019240)|glutamine catabolic process (GO:0006543)|glycogen catabolic process (GO:0005980)|hepatocyte differentiation (GO:0070365)|homocysteine metabolic process (GO:0050667)|midgut development (GO:0007494)|nitric oxide metabolic process (GO:0046209)|positive regulation of vasodilation (GO:0045909)|response to amine (GO:0014075)|response to amino acid (GO:0043200)|response to dexamethasone (GO:0071548)|response to drug (GO:0042493)|response to food (GO:0032094)|response to growth hormone (GO:0060416)|response to lipopolysaccharide (GO:0032496)|response to starvation (GO:0042594)|response to toxic substance (GO:0009636)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)|urea cycle (GO:0000050)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|carbamoyl-phosphate synthase (ammonia) activity (GO:0004087)|endopeptidase activity (GO:0004175)|glutamate binding (GO:0016595)|modified amino acid binding (GO:0072341)|phospholipid binding (GO:0005543)			breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(85)|ovary(8)|pancreas(1)|prostate(6)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	142				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)	Carglumic Acid(DB06775)	TCAACGCCAACAATGTCCCTG	0.438																																																	0								ENSG00000021826						69.0	68.0	68.0					2																	211540493		2203	4300	6503	CPS1	SO:0001583	missense	0			-	HGNC	AF154830	CCDS2393.1, CCDS46505.1, CCDS46506.1	2p	2014-09-17	2010-05-11		ENSG00000021826	ENSG00000021826	6.3.4.16		2323	protein-coding gene	gene with protein product		608307	"""carbamoyl-phosphate synthetase 1, mitochondrial"""				Standard	NM_001122633		Approved		uc002vee.4	P31327	OTTHUMG00000132994	ENST00000233072.5:c.4203C>A	2.37:g.211540493C>A	ENSP00000233072:p.Asn1401Lys	Somatic	0	43	0.00		0.6324490966295101	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	39	18.75	B7Z818|J3KQL0|O43774|Q53TL5|Q59HF8|Q7Z5I5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_CbamoylP_synth_lsu-like_ATP-bd,pfam_CarbamoylP_synth_ssu_N,pfam_CarbamoylP_synth_lsu_oligo,pfam_GATASE,pfam_CarbamoylP_synth_lsu_N,pfam_MGS-like_dom,pfam_ATP-grasp_carboxylate-amine,pfam_Dala_Dala_lig_C,superfamily_CarbamoylP_synth_lsu_oligo,superfamily_CarbamoylP_synth_ssu_N,superfamily_PreATP-grasp_dom,superfamily_MGS-like_dom,smart_MGS-like_dom,pfscan_ATP-grasp,prints_CbamoylP_synth_lsu_CPSase_dom,tigrfam_CarbamoylP_synth_lsu,tigrfam_CarbamoylP_synth_ssu	p.N1407K	ENST00000233072.5	37	c.4221	CCDS2393.1	2	.	.	.	.	.	.	.	.	.	.	C	16.13	3.035743	0.54896	.	.	ENSG00000021826	ENST00000430249;ENST00000539150;ENST00000233072;ENST00000451903	D;D;D	0.81739	-1.53;-1.53;-1.53	6.08	6.08	0.98989	Methylglyoxal synthase-like domain (4);	0.093021	0.64402	D	0.000001	T	0.78162	0.4240	M	0.61387	1.9	0.43152	D	0.994927	B;B	0.25904	0.137;0.137	B;B	0.25614	0.062;0.062	T	0.75382	-0.3337	10	0.56958	D	0.05	-12.7482	12.4627	0.55741	0.0:0.918:0.0:0.082	.	1411;1401	Q59HF8;P31327	.;CPSM_HUMAN	K	1407;1409;1401;950	ENSP00000402608:N1407K;ENSP00000233072:N1401K;ENSP00000406136:N950K	ENSP00000233072:N1401K	N	+	3	2	CPS1	211248738	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	1.531000	0.36018	2.894000	0.99253	0.591000	0.81541	AAC	-	pfam_MGS-like_dom,superfamily_MGS-like_dom,smart_MGS-like_dom,tigrfam_CarbamoylP_synth_lsu		0.438	CPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPS1	protein_coding	OTTHUMT00000256569.5	C		-		211540493	+1	no_errors	ENST00000430249	ensembl	human	known	74_37	missense	SNP	1.000	A
SH2D4A	63898	genome.wustl.edu	37	8	19190593	19190593	+	Silent	SNP	G	G	A			TCGA-VT-A80J-02A-11D-A417-09	TCGA-VT-A80J-11A-22D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9f5f2b4-7057-4dbc-aa22-577a341c4045	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr8:19190593G>A	ENST00000265807.3	+	3	720	c.309G>A	c.(307-309)cgG>cgA	p.R103R	SH2D4A_ENST00000519207.1_Silent_p.R103R|SH2D4A_ENST00000518040.1_Silent_p.R58R	NM_001174160.1|NM_022071.3	NP_001167631.1|NP_071354.2	Q9H788	SH24A_HUMAN	SH2 domain containing 4A	103					negative regulation of phosphatase activity (GO:0010923)	cytoplasm (GO:0005737)	phosphatase binding (GO:0019902)			endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|stomach(1)	16				Colorectal(111;0.0732)		AGAGGGCCCGGCTGAAAGCAG	0.463																																																	0								ENSG00000104611						77.0	80.0	79.0					8																	19190593		2203	4300	6503	SH2D4A	SO:0001819	synonymous_variant	0			-	HGNC	AY190323	CCDS6009.1, CCDS55206.1	8p21	2013-02-14			ENSG00000104611	ENSG00000104611		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""SH2 domain containing"""	26102	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 38"""	614968					Standard	NM_022071		Approved	FLJ20967, SH2A, PPP1R38	uc003wzc.3	Q9H788	OTTHUMG00000097005	ENST00000265807.3:c.309G>A	8.37:g.19190593G>A		Somatic	0	48	0.00		0.6324490966295101	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	B4DDR1|Q5XKC1|Q6NXE9|Q86YM2|Q96C88|Q9H7F7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_SH2,smart_SH2,pfscan_SH2	p.R103	ENST00000265807.3	37	c.309	CCDS6009.1	8																																																																																			-	NULL		0.463	SH2D4A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SH2D4A	protein_coding	OTTHUMT00000214094.1	G	NM_022071	-		19190593	+1	no_errors	ENST00000265807	ensembl	human	known	74_37	silent	SNP	0.003	A
GINS1	9837	genome.wustl.edu	37	20	25422336	25422336	+	Splice_Site	SNP	A	A	G			TCGA-VT-A80J-02A-11D-A417-09	TCGA-VT-A80J-11A-22D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9f5f2b4-7057-4dbc-aa22-577a341c4045	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr20:25422336A>G	ENST00000262460.4	+	6	541		c.e6-1		GINS1_ENST00000429262.2_Splice_Site	NM_021067.3	NP_066545.3	Q14691	PSF1_HUMAN	GINS complex subunit 1 (Psf1 homolog)						DNA strand elongation involved in DNA replication (GO:0006271)|inner cell mass cell proliferation (GO:0001833)|mitotic cell cycle (GO:0000278)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|urinary_tract(1)	7						TTTTTCTTTCAGGTCCGGTGT	0.299																																																	0								ENSG00000101003						75.0	81.0	79.0					20																	25422336		2203	4300	6503	GINS1	SO:0001630	splice_region_variant	0			-	HGNC	BC012542	CCDS33451.1	20p11.21	2006-05-04			ENSG00000101003	ENSG00000101003			28980	protein-coding gene	gene with protein product		610608				8724849, 8786132	Standard	NM_021067		Approved	KIAA0186, PSF1	uc002wuv.1	Q14691	OTTHUMG00000032124	ENST00000262460.4:c.448-1A>G	20.37:g.25422336A>G		Somatic	0	49	0.00		0.6324490966295101	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	45	22.41	Q9NQE2|Q9NQI7	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e6-2	ENST00000262460.4	37	c.448-2	CCDS33451.1	20	.	.	.	.	.	.	.	.	.	.	A	17.83	3.485580	0.63962	.	.	ENSG00000101003	ENST00000262460	.	.	.	5.62	5.62	0.85841	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.7931	0.69857	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	GINS1	25370336	1.000000	0.71417	1.000000	0.80357	0.746000	0.42486	6.472000	0.73567	2.130000	0.65690	0.533000	0.62120	.	-	-		0.299	GINS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GINS1	protein_coding	OTTHUMT00000078433.1	A	NM_021067	-	Intron	25422336	+1	no_errors	ENST00000262460	ensembl	human	known	74_37	splice_site	SNP	1.000	G
SHANK1	50944	genome.wustl.edu	37	19	51215298	51215298	+	Missense_Mutation	SNP	A	A	G			TCGA-VT-A80J-02A-11D-A417-09	TCGA-VT-A80J-11A-22D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9f5f2b4-7057-4dbc-aa22-577a341c4045	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr19:51215298A>G	ENST00000293441.1	-	6	884	c.866T>C	c.(865-867)aTg>aCg	p.M289T	SHANK1_ENST00000359082.3_Missense_Mutation_p.M289T|SHANK1_ENST00000391814.1_Missense_Mutation_p.M289T	NM_016148.2	NP_057232.2	Q9Y566	SHAN1_HUMAN	SH3 and multiple ankyrin repeat domains 1	289					adult behavior (GO:0030534)|associative learning (GO:0008306)|cytoskeletal anchoring at plasma membrane (GO:0007016)|dendritic spine morphogenesis (GO:0060997)|determination of affect (GO:0050894)|habituation (GO:0046959)|long-term memory (GO:0007616)|negative regulation of actin filament bundle assembly (GO:0032232)|neuromuscular process controlling balance (GO:0050885)|olfactory behavior (GO:0042048)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|protein complex assembly (GO:0006461)|protein localization to synapse (GO:0035418)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|righting reflex (GO:0060013)|social behavior (GO:0035176)|synapse maturation (GO:0060074)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|excitatory synapse (GO:0060076)|intracellular (GO:0005622)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ankyrin repeat binding (GO:0071532)|GKAP/Homer scaffold activity (GO:0030160)|identical protein binding (GO:0042802)|ionotropic glutamate receptor binding (GO:0035255)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|scaffold protein binding (GO:0097110)|SH3 domain binding (GO:0017124)|somatostatin receptor binding (GO:0031877)			breast(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(15)|liver(1)|lung(21)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	64		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00493)|GBM - Glioblastoma multiforme(134;0.0199)		ACCACCCACCATGGCCGTGTG	0.627																																																	0								ENSG00000161681						63.0	65.0	65.0					19																	51215298		2203	4300	6503	SHANK1	SO:0001583	missense	0			-	HGNC	AF163302	CCDS12799.1	19q13.3	2013-01-10			ENSG00000161681	ENSG00000161681		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	15474	protein-coding gene	gene with protein product	"""somatostatin receptor-interacting protein"""	604999				10551867	Standard	NM_016148		Approved	SSTRIP, SPANK-1, synamon	uc002psx.1	Q9Y566	OTTHUMG00000137380	ENST00000293441.1:c.866T>C	19.37:g.51215298A>G	ENSP00000293441:p.Met289Thr	Somatic	0	71	0.00		0.6324490966295101	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	30	44	40.54	A8MXP5|B7WNY6|Q9NYW9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ankyrin_rpt,pfam_SAM_type1,pfam_SH3_2,pfam_SAM_2,pfam_PDZ,pfam_SH3_domain,superfamily_Ankyrin_rpt-contain_dom,superfamily_PDZ,superfamily_SH3_domain,superfamily_SAM/pointed,smart_Ankyrin_rpt,smart_SH3_domain,smart_PDZ,smart_SAM,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_PDZ,pfscan_SAM,pfscan_SH3_domain	p.M289T	ENST00000293441.1	37	c.866	CCDS12799.1	19	.	.	.	.	.	.	.	.	.	.	A	12.63	1.996682	0.35226	.	.	ENSG00000161681	ENST00000293441;ENST00000359082;ENST00000391814	T;T;T	0.17054	2.3;2.3;2.3	4.68	4.68	0.58851	Ankyrin repeat-containing domain (3);	0.090598	0.40728	U	0.001039	T	0.16727	0.0402	N	0.16567	0.415	0.80722	D	1	D	0.63880	0.993	P	0.51615	0.675	T	0.05386	-1.0888	10	0.29301	T	0.29	-19.8957	13.4359	0.61084	1.0:0.0:0.0:0.0	.	289	Q9Y566	SHAN1_HUMAN	T	289	ENSP00000293441:M289T;ENSP00000351984:M289T;ENSP00000375690:M289T	ENSP00000293441:M289T	M	-	2	0	SHANK1	55907110	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.249000	0.95470	1.887000	0.54652	0.454000	0.30748	ATG	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom		0.627	SHANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHANK1	protein_coding	OTTHUMT00000268071.1	A	NM_016148	-		51215298	-1	no_errors	ENST00000391814	ensembl	human	known	74_37	missense	SNP	1.000	G
ARRDC1	92714	genome.wustl.edu	37	9	140507315	140507315	+	Intron	SNP	T	T	A			TCGA-VT-A80J-02A-11D-A417-09	TCGA-VT-A80J-11A-22D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9f5f2b4-7057-4dbc-aa22-577a341c4045	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr9:140507315T>A	ENST00000371421.4	+	2	182				C9orf37_ENST00000496793.1_5'Flank|ARRDC1_ENST00000491911.1_3'UTR	NM_152285.2	NP_689498.1	Q8N5I2	ARRD1_HUMAN	arrestin domain containing 1							cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|liver(2)|lung(4)|prostate(1)|urinary_tract(1)	13	all_cancers(76;0.106)			OV - Ovarian serous cystadenocarcinoma(145;0.000273)|Epithelial(140;0.000464)		GGCCGTCGGCTGGCTGGGGCT	0.642																																																	0								ENSG00000197070						35.0	32.0	33.0					9																	140507315		2203	4298	6501	ARRDC1	SO:0001627	intron_variant	0			-	HGNC	AJ420420	CCDS7049.1	9q34.3	2013-10-11			ENSG00000197070	ENSG00000197070			28633	protein-coding gene	gene with protein product	"""alpha-arrestin 1"""					23886940	Standard	XM_005266119		Approved	MGC40555	uc004cns.3	Q8N5I2	OTTHUMG00000020993	ENST00000371421.4:c.119-33T>A	9.37:g.140507315T>A		Somatic	0	47	0.00		0.6324490966295101	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	16	27.27		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000371421.4	37	NULL	CCDS7049.1	9																																																																																			-	-		0.642	ARRDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARRDC1	protein_coding	OTTHUMT00000055358.1	T	NM_152285	-		140507315	+1	no_errors	ENST00000491911	ensembl	human	known	74_37	rna	SNP	0.300	A
NPIPA1	9284	genome.wustl.edu	37	16	15045631	15045631	+	Missense_Mutation	SNP	G	G	A	rs201805072	byFrequency	TCGA-VT-A80J-02A-11D-A417-09	TCGA-VT-A80J-11A-22D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9f5f2b4-7057-4dbc-aa22-577a341c4045	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr16:15045631G>A	ENST00000328085.6	+	8	802	c.802G>A	c.(802-804)Gag>Aag	p.E268K	NPIPA1_ENST00000472413.1_3'UTR	NM_006985.2	NP_008916.2	Q9UND3	NPIA1_HUMAN	nuclear pore complex interacting protein family, member A1	268	Pro-rich.				mRNA transport (GO:0051028)|protein transport (GO:0015031)	nuclear pore (GO:0005643)											GACACCTTCCGAGTGTCTGCT	0.517																																																	0								ENSG00000183426						83.0	70.0	75.0					16																	15045631		1386	2350	3736	NPIPA1	SO:0001583	missense	0			-	HGNC	AC002045	CCDS10557.1	16p13.11	2013-06-11	2013-06-11	2013-06-11	ENSG00000183426	ENSG00000183426			7909	protein-coding gene	gene with protein product		606406	"""nuclear pore complex interacting protein"""	NPIP		11586358, 18055785	Standard	NM_006985		Approved	morpheus	uc002dcy.4	Q9UND3	OTTHUMG00000090663	ENST00000328085.6:c.802G>A	16.37:g.15045631G>A	ENSP00000331843:p.Glu268Lys	Somatic	0	41	0.00		0.6324490966295101	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	7	41.67	O15102	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.E268K	ENST00000328085.6	37	c.802	CCDS10557.1	16	.	.	.	.	.	.	.	.	.	.	.	7.020	0.558597	0.13436	.	.	ENSG00000183426	ENST00000432470;ENST00000328085	T	0.51817	0.69	.	.	.	.	.	.	.	.	T	0.42720	0.1215	M	0.64997	1.995	0.09310	N	1	P	0.41265	0.744	B	0.40410	0.328	T	0.34030	-0.9845	7	0.66056	D	0.02	.	.	.	.	.	268	Q9UND3	NPIP_HUMAN	K	268	ENSP00000331843:E268K	ENSP00000331843:E268K	E	+	1	0	NPIP	14953132	0.018000	0.18449	0.031000	0.17742	0.031000	0.12232	0.112000	0.15479	0.121000	0.18284	0.123000	0.15791	GAG	-	NULL		0.517	NPIPA1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	NPIPA1	protein_coding	OTTHUMT00000207326.2	G	NM_006985	rs201805072		15045631	+1	no_errors	ENST00000328085	ensembl	human	novel	74_37	missense	SNP	0.032	A
ACCS	84680	genome.wustl.edu	37	11	44104733	44104733	+	Missense_Mutation	SNP	G	G	T	rs368035781		TCGA-VT-A80J-02A-11D-A417-09	TCGA-VT-A80J-11A-22D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9f5f2b4-7057-4dbc-aa22-577a341c4045	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr11:44104733G>T	ENST00000263776.8	+	13	1560	c.1126G>T	c.(1126-1128)Gtg>Ttg	p.V376L		NM_001127219.1|NM_032592.3	NP_001120691.1|NP_115981.1	Q96QU6	1A1L1_HUMAN	1-aminocyclopropane-1-carboxylate synthase homolog (Arabidopsis)(non-functional)	376					biosynthetic process (GO:0009058)		catalytic activity (GO:0003824)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)			breast(4)|endometrium(3)|large_intestine(11)|lung(15)|ovary(1)|skin(1)	35						GATCAACCAGGTGTACCTGCC	0.522																																					Esophageal Squamous(158;148 1889 8077 23160 41213)												0								ENSG00000110455						132.0	135.0	134.0					11																	44104733		2203	4300	6503	ACCS	SO:0001583	missense	0			-	HGNC	AY026508	CCDS7907.1	11p11	2008-03-12	2008-01-28		ENSG00000110455	ENSG00000110455			23989	protein-coding gene	gene with protein product		608405				11470512	Standard	NM_032592		Approved	PHACS, ACS	uc009yks.1	Q96QU6	OTTHUMG00000166427	ENST00000263776.8:c.1126G>T	11.37:g.44104733G>T	ENSP00000263776:p.Val376Leu	Somatic	0	54	0.00		0.6324490966295101	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	31	9	77.50	B4E219|Q8WUL4|Q96LX5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase	p.V376L	ENST00000263776.8	37	c.1126	CCDS7907.1	11	.	.	.	.	.	.	.	.	.	.	G	32	5.105651	0.94292	.	.	ENSG00000110455	ENST00000263776	T	0.21361	2.01	5.77	5.77	0.91146	Aminotransferase, class I/classII (1);Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.123947	0.53938	D	0.000049	T	0.48978	0.1530	M	0.83953	2.67	0.80722	D	1	P	0.52692	0.955	P	0.58520	0.84	T	0.50136	-0.8863	10	0.62326	D	0.03	-21.2101	19.5934	0.95525	0.0:0.0:1.0:0.0	.	376	Q96QU6	1A1L1_HUMAN	L	376	ENSP00000263776:V376L	ENSP00000263776:V376L	V	+	1	0	ACCS	44061309	1.000000	0.71417	0.994000	0.49952	0.996000	0.88848	5.099000	0.64554	2.724000	0.93272	0.561000	0.74099	GTG	-	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase		0.522	ACCS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACCS	protein_coding	OTTHUMT00000389721.1	G	NM_032592	-		44104733	+1	no_errors	ENST00000263776	ensembl	human	known	74_37	missense	SNP	0.999	T
TRPM6	140803	genome.wustl.edu	37	9	77502760	77502760	+	Missense_Mutation	SNP	G	G	T			TCGA-VT-A80J-02A-11D-A417-09	TCGA-VT-A80J-11A-22D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9f5f2b4-7057-4dbc-aa22-577a341c4045	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr9:77502760G>T	ENST00000360774.1	-	1	250	c.13C>A	c.(13-15)Cct>Act	p.P5T	TRPM6_ENST00000359047.2_Missense_Mutation_p.P5T|TRPM6_ENST00000376864.4_Missense_Mutation_p.P5T|TRPM6_ENST00000376872.3_Missense_Mutation_p.P5T|TRPM6_ENST00000451710.3_Missense_Mutation_p.P5T|TRPM6_ENST00000361255.3_5'Flank|TRPM6_ENST00000376871.3_Missense_Mutation_p.P5T|TRPM6_ENST00000449912.2_5'Flank	NM_017662.4	NP_060132.3	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel, subfamily M, member 6	5					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|liver(1)|lung(53)|ovary(1)|prostate(7)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	126						TCCAAGACAGGTTGTTCTTTC	0.562																																																	0								ENSG00000119121						155.0	140.0	145.0					9																	77502760		2203	4300	6503	TRPM6	SO:0001583	missense	0			-	HGNC	AK026281	CCDS6647.1, CCDS55318.1, CCDS55319.1	9q21.13	2011-12-14	2003-12-02		ENSG00000119121	ENSG00000119121		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17995	protein-coding gene	gene with protein product		607009	"""hypomagnesemia, secondary hypocalcemia"""	HOMG, HSH		10021370, 12032570, 16382100	Standard	NM_017662		Approved	CHAK2, FLJ22628	uc004ajk.1	Q9BX84	OTTHUMG00000020027	ENST00000360774.1:c.13C>A	9.37:g.77502760G>T	ENSP00000354006:p.Pro5Thr	Somatic	0	34	0.00		0.6324490966295101	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	22	38.89	Q6VPR8|Q6VPR9|Q6VPS0|Q6VPS1|Q6VPS2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MHCK_EF2_kinase,pfam_Ion_trans_dom,superfamily_Kinase-like_dom,smart_MHCK_EF2_kinase,pfscan_MHCK_EF2_kinase	p.P5T	ENST00000360774.1	37	c.13	CCDS6647.1	9	.	.	.	.	.	.	.	.	.	.	G	9.640	1.138658	0.21123	.	.	ENSG00000119121	ENST00000360774;ENST00000451710;ENST00000376872;ENST00000376871;ENST00000376864;ENST00000359047	T;T;T;T;T;T	0.61627	0.77;0.76;0.68;0.91;0.66;0.09	3.19	-2.78	0.05859	.	2.543950	0.02094	N	0.053379	T	0.38214	0.1032	N	0.24115	0.695	0.09310	N	1	B;B;B;B;B	0.26318	0.0;0.0;0.0;0.146;0.001	B;B;B;B;B	0.21546	0.001;0.001;0.001;0.035;0.001	T	0.13442	-1.0509	10	0.54805	T	0.06	.	0.6123	0.00763	0.3717:0.171:0.2836:0.1737	.	5;5;5;5;5	Q9BX84-7;Q9BX84-6;Q9BX84-5;Q96LV9;Q9BX84	.;.;.;.;TRPM6_HUMAN	T	5	ENSP00000354006:P5T;ENSP00000407341:P5T;ENSP00000366068:P5T;ENSP00000366067:P5T;ENSP00000366060:P5T;ENSP00000351942:P5T	ENSP00000351942:P5T	P	-	1	0	TRPM6	76692580	0.000000	0.05858	0.000000	0.03702	0.027000	0.11550	0.296000	0.19083	-0.641000	0.05487	-0.258000	0.10820	CCT	-	NULL		0.562	TRPM6-001	KNOWN	basic|CCDS	protein_coding	TRPM6	protein_coding	OTTHUMT00000052693.1	G	NM_017662	-		77502760	-1	no_errors	ENST00000451710	ensembl	human	known	74_37	missense	SNP	0.000	T
YAF2	10138	genome.wustl.edu	37	12	42629563	42629563	+	Intron	DEL	A	A	-	rs565109622		TCGA-VT-A80J-02A-11D-A417-09	TCGA-VT-A80J-11A-22D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9f5f2b4-7057-4dbc-aa22-577a341c4045	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr12:42629563delA	ENST00000534854.2	-	2	220				PPHLN1_ENST00000549190.1_5'Flank|YAF2_ENST00000541702.2_5'UTR|YAF2_ENST00000442791.3_Intron|YAF2_ENST00000327791.4_Intron|YAF2_ENST00000380788.3_Intron|YAF2_ENST00000380790.4_Intron|YAF2_ENST00000555248.2_3'UTR	NM_005748.4	NP_005739.2	Q8IY57	YAF2_HUMAN	YY1 associated factor 2						negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			cervix(2)|endometrium(1)|large_intestine(1)|lung(3)|skin(1)	8	all_cancers(12;0.000425)	Lung NSC(34;0.0402)|all_lung(34;0.057)		GBM - Glioblastoma multiforme(48;0.0514)		ATGTACTGGTAAAAAAAAAAA	0.438																																																	0								ENSG00000015153																																			YAF2	SO:0001627	intron_variant	0				HGNC	U72209	CCDS31775.1, CCDS53778.1, CCDS53779.1, CCDS53780.1	12q12	2014-09-04			ENSG00000015153	ENSG00000015153			17363	protein-coding gene	gene with protein product		607534				9016636	Standard	NM_001190977		Approved		uc001rmw.3	Q8IY57	OTTHUMG00000169380	ENST00000534854.2:c.152+1837T>-	12.37:g.42629563delA		Somatic	0	27	0.00		0.6324490966295101	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	22	8.33	A8K5P0|B4DFU3|G3V465|Q99710	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000534854.2	37	NULL	CCDS31775.1	12																																																																																			-	-		0.438	YAF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YAF2	protein_coding	OTTHUMT00000403781.1	A				42629563	-1	no_errors	ENST00000541702	ensembl	human	known	74_37	rna	DEL	0.986	-
PLEKHO1	51177	genome.wustl.edu	37	1	150128083	150128083	+	Intron	SNP	C	C	T			TCGA-VT-A80J-02A-11D-A417-09	TCGA-VT-A80J-11A-22D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9f5f2b4-7057-4dbc-aa22-577a341c4045	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr1:150128083C>T	ENST00000369124.4	+	3	455				PLEKHO1_ENST00000479194.1_Intron|PLEKHO1_ENST00000369126.1_Intron|PLEKHO1_ENST00000025469.6_Intron	NM_016274.4	NP_057358.2	Q53GL0	PKHO1_HUMAN	pleckstrin homology domain containing, family O member 1							cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|skin(2)	22	Lung NSC(24;7.78e-28)|Breast(34;0.00211)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			TTGGAGCTGCCCTAGCGTCCT	0.552																																																	0								ENSG00000023902																																			PLEKHO1	SO:0001627	intron_variant	0			-	HGNC	AF073836	CCDS945.1	1q21.2	2013-01-10			ENSG00000023902	ENSG00000023902		"""Pleckstrin homology (PH) domain containing"""	24310	protein-coding gene	gene with protein product		608335				10799509	Standard	NM_016274		Approved	CKIP-1, OC120	uc001ett.3	Q53GL0	OTTHUMG00000012510	ENST00000369124.4:c.178-177C>T	1.37:g.150128083C>T		Somatic	0	59	0.00		0.6324490966295101	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	27	48.08	Q336K5|Q8IZ51|Q9NRV3|Q9UL48	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000369124.4	37	NULL	CCDS945.1	1																																																																																			-	-		0.552	PLEKHO1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	PLEKHO1	protein_coding	OTTHUMT00000034962.1	C	NM_016274	-		150128083	+1	no_errors	ENST00000477309	ensembl	human	known	74_37	rna	SNP	0.002	T
PRKD1	5587	genome.wustl.edu	37	14	30396622	30396623	+	In_Frame_Ins	INS	-	-	CCCGGA	rs200987283|rs139860047|rs45471692	byFrequency	TCGA-VT-A80J-02A-11D-A417-09	TCGA-VT-A80J-11A-22D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9f5f2b4-7057-4dbc-aa22-577a341c4045	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr14:30396622_30396623insCCCGGA	ENST00000331968.5	-	1	325_326	c.96_97insTCCGGG	c.(94-99)gggccc>gggTCCGGGccc	p.31_32insGS	PRKD1_ENST00000415220.2_In_Frame_Ins_p.31_32insGS	NM_002742.2	NP_002733.2	Q15139	KPCD1_HUMAN	protein kinase D1	31					angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|cellular response to oxidative stress (GO:0034599)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|Golgi organization (GO:0007030)|Golgi vesicle transport (GO:0048193)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|negative regulation of cell death (GO:0060548)|negative regulation of endocytosis (GO:0045806)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein autophosphorylation (GO:0046777)|regulation of integrin-mediated signaling pathway (GO:2001044)|regulation of keratinocyte proliferation (GO:0010837)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cell cortex (GO:0005938)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|lung(32)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	78	Hepatocellular(127;0.0604)		LUAD - Lung adenocarcinoma(48;0.00527)|Lung(238;0.0252)	GBM - Glioblastoma multiforme(265;0.00888)		GCGGGCCCGGGCCCGGACCCTG	0.762														343	0.0684904	0.003	0.0548	5008	,	,		4659	0.1567		0.0507	False		,,,				2504	0.0941																0								ENSG00000184304			31,2319		11,9,1155						3.1	1.0		dbSNP_127	3	234,5084		58,118,2483	no	coding	PRKD1	NM_002742.2		69,127,3638	A1A1,A1R,RR		4.4002,1.3191,3.4559				265,7403				PRKD1	SO:0001652	inframe_insertion	0				HGNC		CCDS9637.1	14q11	2013-01-10	2004-10-28	2004-10-30	ENSG00000184304	ENSG00000184304	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	9407	protein-coding gene	gene with protein product		605435	"""protein kinase C, mu"""	PRKCM		8119958, 10965134	Standard	NM_002742		Approved	PKCM, PKD, PKC-mu	uc001wqh.3	Q15139	OTTHUMG00000140203	ENST00000331968.5:c.91_96dupTCCGGG	14.37:g.30396623_30396628dupCCCGGA	ENSP00000333568:p.Gly30_Ser31dup	Somatic	NA	NA	NA		0.6324490966295101	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A6NL64|B2RAF6	In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pleckstrin_homology,superfamily_Kinase-like_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_dom,prints_DAG/PE-bd	p.32in_frame_insSG	ENST00000331968.5	37	c.97_96	CCDS9637.1	14																																																																																			-	NULL		0.762	PRKD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PRKD1	protein_coding	OTTHUMT00000276611.2	-	NM_002742			30396623	-1	no_errors	ENST00000331968	ensembl	human	known	74_37	in_frame_ins	INS	1.000:1.000	CCCGGA
NPFFR2	10886	genome.wustl.edu	37	4	73013005	73013005	+	Missense_Mutation	SNP	T	T	C			TCGA-VT-A80J-02A-11D-A417-09	TCGA-VT-A80J-11A-22D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9f5f2b4-7057-4dbc-aa22-577a341c4045	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr4:73013005T>C	ENST00000308744.6	+	4	1143	c.1045T>C	c.(1045-1047)Ttc>Ctc	p.F349L	NPFFR2_ENST00000344413.5_3'UTR|NPFFR2_ENST00000395999.1_Missense_Mutation_p.F250L|NPFFR2_ENST00000358749.3_Missense_Mutation_p.F247L|NPFFR2_ENST00000506359.1_3'UTR	NM_004885.2	NP_004876.2	Q9Y5X5	NPFF2_HUMAN	neuropeptide FF receptor 2	349					detection of abiotic stimulus (GO:0009582)|G-protein coupled receptor signaling pathway (GO:0007186)|regulation of adenylate cyclase activity (GO:0045761)|regulation of cAMP-dependent protein kinase activity (GO:2000479)|regulation of MAPK cascade (GO:0043408)	actin cytoskeleton (GO:0015629)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide receptor activity (GO:0008188)			NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(24)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	43			Lung(101;0.0935)|LUSC - Lung squamous cell carcinoma(112;0.138)			AATTTCACTCTTCAGGGCTGC	0.502																																																	0								ENSG00000056291						80.0	74.0	76.0					4																	73013005		2203	4300	6503	NPFFR2	SO:0001583	missense	0			-	HGNC	AF236083	CCDS3551.1, CCDS3552.1, CCDS47072.1	4q21	2012-08-10	2006-02-15	2006-02-15	ENSG00000056291	ENSG00000056291		"""GPCR / Class A :  Neuropeptide receptors : FF/AF"", ""GPCR / Class A : RF amide peptide receptors"""	4525	protein-coding gene	gene with protein product	"""neuropeptide FF 2"""	607449	"""G protein-coupled receptor 74"""	GPR74		10079187, 10851242	Standard	NM_001144756		Approved	NPFF2, NPGPR	uc003hgg.2	Q9Y5X5	OTTHUMG00000129918	ENST00000308744.6:c.1045T>C	4.37:g.73013005T>C	ENSP00000307822:p.Phe349Leu	Somatic	0	54	0.00		0.6324490966295101	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	42	28.81	Q96RV1|Q9NR49	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_NPFF_rcpt_2,prints_NPFF_rcpt,prints_GPCR_Rhodpsn,prints_NPY_rcpt	p.F349L	ENST00000308744.6	37	c.1045	CCDS3551.1	4	.	.	.	.	.	.	.	.	.	.	T	12.50	1.957788	0.34565	.	.	ENSG00000056291	ENST00000308744;ENST00000395999;ENST00000358749	T;T;T	0.33438	1.41;1.41;1.41	5.82	3.34	0.38264	GPCR, rhodopsin-like superfamily (1);	0.431858	0.22318	N	0.061660	T	0.29491	0.0735	L	0.48174	1.505	0.50632	D	0.99988	B;B	0.30236	0.05;0.274	B;B	0.38296	0.061;0.27	T	0.05022	-1.0911	10	0.42905	T	0.14	.	7.4187	0.27059	0.1281:0.0698:0.0:0.802	.	250;349	Q9Y5X5-3;Q9Y5X5	.;NPFF2_HUMAN	L	349;250;247	ENSP00000307822:F349L;ENSP00000379321:F250L;ENSP00000351599:F247L	ENSP00000307822:F349L	F	+	1	0	NPFFR2	73231869	0.998000	0.40836	0.622000	0.29159	0.021000	0.10359	4.141000	0.58038	0.437000	0.26423	0.482000	0.46254	TTC	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM		0.502	NPFFR2-001	KNOWN	basic|CCDS	protein_coding	NPFFR2	protein_coding	OTTHUMT00000252170.2	T	NM_004885	-		73013005	+1	no_errors	ENST00000308744	ensembl	human	known	74_37	missense	SNP	0.998	C
LOC645752	645752	genome.wustl.edu	37	15	78207077	78207077	+	lincRNA	SNP	G	G	T			TCGA-VT-A80J-02A-11D-A417-09	TCGA-VT-A80J-11A-22D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9f5f2b4-7057-4dbc-aa22-577a341c4045	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr15:78207077G>T	ENST00000565869.1	+	0	0				RN7SL214P_ENST00000487317.2_RNA																							ATTCTGTAATGAATATATGTG	0.368																																																	0								ENSG00000260776																																			RP11-114H24.2			0			-	Clone_based_vega_gene																													15.37:g.78207077G>T		Somatic	1	121	0.82		0.6324490966295101	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	57	140	28.93		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000565869.1	37	NULL		15																																																																																			-	-		0.368	RP11-114H24.7-001	KNOWN	basic	lincRNA	LOC645752	lincRNA	OTTHUMT00000421587.1	G		-		78207077	-1	no_errors	ENST00000563349	ensembl	human	known	74_37	rna	SNP	0.019	T
SCAF1	58506	genome.wustl.edu	37	19	50155567	50155569	+	In_Frame_Del	DEL	AAG	AAG	-			TCGA-VT-A80J-02A-11D-A417-09	TCGA-VT-A80J-11A-22D-A36M-09	AAG	AAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9f5f2b4-7057-4dbc-aa22-577a341c4045	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr19:50155567_50155569delAAG	ENST00000360565.3	+	7	2045_2047	c.1921_1923delAAG	c.(1921-1923)aagdel	p.K645del		NM_021228.2	NP_067051.2	Q9H7N4	SFR19_HUMAN	SR-related CTD-associated factor 1	645	Arg-rich.|Ser-rich.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(2)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	20		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.196)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00113)|GBM - Glioblastoma multiforme(134;0.0204)		TGGCGGCAGCAAGAAGAAGAAGA	0.744																																																	0								ENSG00000126461			45,2899		7,31,1434						4.0	1.0			2	109,6037		13,83,2977	no	coding	SCAF1	NM_021228.2		20,114,4411	A1A1,A1R,RR		1.7735,1.5285,1.6942				154,8936				SCAF1	SO:0001651	inframe_deletion	0				HGNC	AK024444	CCDS33074.1	19q13.3-q13.4	2011-01-10			ENSG00000126461	ENSG00000126461			30403	protein-coding gene	gene with protein product						11461075	Standard	NM_021228		Approved	SR-A1, FLJ00034	uc002poq.3	Q9H7N4		ENST00000360565.3:c.1921_1923delAAG	19.37:g.50155576_50155578delAAG	ENSP00000353769:p.Lys645del	Somatic	0	14	0.00		0.6324490966295101	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	18	25.00	Q7Z5V7|Q8WVA1|Q9NR59	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	NULL	p.K644in_frame_del	ENST00000360565.3	37	c.1921_1923	CCDS33074.1	19																																																																																			-	NULL		0.744	SCAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCAF1	protein_coding	OTTHUMT00000465764.1	AAG	NM_021228			50155569	+1	no_errors	ENST00000360565	ensembl	human	known	74_37	in_frame_del	DEL	1.000:1.000:1.000	-
ZFHX3	463	genome.wustl.edu	37	16	72991713	72991715	+	In_Frame_Del	DEL	CCA	CCA	-	rs4788682	byFrequency	TCGA-VT-A80J-02A-11D-A417-09	TCGA-VT-A80J-11A-22D-A36M-09	CCA	CCA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9f5f2b4-7057-4dbc-aa22-577a341c4045	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr16:72991713_72991715delCCA	ENST00000268489.5	-	2	3002_3004	c.2330_2332delTGG	c.(2329-2334)gtggct>gct	p.V777del	ZFHX3_ENST00000397992.5_Intron	NM_006885.3	NP_008816.3	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3	777	Poly-Ala.		V -> A (in dbSNP:rs4788682). {ECO:0000269|PubMed:7592926}.		brain development (GO:0007420)|cell cycle arrest (GO:0007050)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|regulation of neuron differentiation (GO:0045664)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.V777V(1)		NS(3)|breast(7)|cervix(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(22)|liver(1)|lung(46)|ovary(5)|pancreas(1)|prostate(15)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(11)	153		Ovarian(137;0.13)				gccgccgcagccaccgccgccgc	0.635																																																	1	Substitution - coding silent(1)	lung(1)						ENSG00000140836		,	1706,1886		582,542,672					,	5.5	0.1			17	4240,2792		1606,1028,882	no	coding,intron	ZFHX3	NM_006885.3,NM_001164766.1	,	2188,1570,1554	A1A1,A1R,RR		39.7042,47.4944,44.0324	,	,		5946,4678				ZFHX3	SO:0001651	inframe_deletion	0				HGNC	D10250	CCDS10908.1, CCDS54035.1	16q22.3	2012-03-09	2007-08-09	2007-08-09	ENSG00000140836	ENSG00000140836		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	777	protein-coding gene	gene with protein product		104155	"""AT-binding transcription factor 1"""	ATBF1		1719379, 7592926	Standard	NM_006885		Approved	ZNF927	uc002fck.3	Q15911	OTTHUMG00000137599	ENST00000268489.5:c.2330_2332delTGG	16.37:g.72991713_72991715delCCA	ENSP00000268489:p.Val777del	Somatic	0	43	0.00		0.6324490966295101	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	8	20.00	D3DWS8|O15101|Q13719	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Homeobox_dom,superfamily_Homeodomain-like,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Znf_C2H2-like,smart_Znf_U1,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Znf_C2H2	p.V777in_frame_del	ENST00000268489.5	37	c.2332_2330	CCDS10908.1	16																																																																																			-	NULL		0.635	ZFHX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFHX3	protein_coding	OTTHUMT00000269008.1	CCA	NM_006885			72991715	-1	no_errors	ENST00000268489	ensembl	human	known	74_37	in_frame_del	DEL	0.943:0.039:0.779	-
CCDC71	64925	genome.wustl.edu	37	3	49201437	49201437	+	Frame_Shift_Del	DEL	C	C	-			TCGA-VT-A80J-02A-11D-A417-09	TCGA-VT-A80J-11A-22D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9f5f2b4-7057-4dbc-aa22-577a341c4045	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr3:49201437delC	ENST00000321895.6	-	2	311	c.205delG	c.(205-207)gatfs	p.D69fs		NM_022903.3	NP_075054.3	Q8IV32	CCD71_HUMAN	coiled-coil domain containing 71	69										endometrium(1)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)	10				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00217)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		CCATAGACATCACCACTGCGC	0.577																																																	0								ENSG00000177352						108.0	87.0	94.0					3																	49201437		2203	4300	6503	CCDC71	SO:0001589	frameshift_variant	0				HGNC	AK022862	CCDS2790.1	3p21.31	2014-02-12			ENSG00000177352	ENSG00000177352			25760	protein-coding gene	gene with protein product						12477932	Standard	NM_022903		Approved	FLJ12800	uc003cwg.4	Q8IV32	OTTHUMG00000156815	ENST00000321895.6:c.205delG	3.37:g.49201437delC	ENSP00000319006:p.Asp69fs	Somatic	0	45	0.00		0.6324490966295101	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	14	12.50	Q6IPE2|Q9H8H4|Q9H9F1	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	NULL	p.D69fs	ENST00000321895.6	37	c.205	CCDS2790.1	3																																																																																			-	NULL		0.577	CCDC71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC71	protein_coding	OTTHUMT00000345980.1	C	NM_022903			49201437	-1	no_errors	ENST00000321895	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
PIEZO1	9780	genome.wustl.edu	37	16	88798917	88798919	+	In_Frame_Del	DEL	CAG	CAG	-	rs201226914		TCGA-VT-A80J-02A-11D-A417-09	TCGA-VT-A80J-11A-22D-A36M-09	CAG	CAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9f5f2b4-7057-4dbc-aa22-577a341c4045	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr16:88798917_88798919delCAG	ENST00000301015.9	-	21	3061_3063	c.2815_2817delCTG	c.(2815-2817)ctgdel	p.L939del	RP5-1142A6.2_ENST00000440406.2_RNA	NM_001142864.2	NP_001136336.2	Q92508	PIEZ1_HUMAN	piezo-type mechanosensitive ion channel component 1	939					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|detection of mechanical stimulus (GO:0050982)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|positive regulation of integrin activation (GO:0033625)|regulation of membrane potential (GO:0042391)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation channel activity (GO:0005261)|mechanically-gated ion channel activity (GO:0008381)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(2)|prostate(2)|skin(1)	10						CCTCGAATACCAGCAGCAGCAGC	0.704																																																	0								ENSG00000103335																																			PIEZO1	SO:0001651	inframe_deletion	0				HGNC	D87071	CCDS54058.1	16q24.3	2011-08-31	2011-08-31	2011-08-31	ENSG00000103335	ENSG00000103335			28993	protein-coding gene	gene with protein product		611184	"""family with sequence similarity 38, member A"""	FAM38A		20813920, 21056836, 21299953, 21696149	Standard	NM_001142864		Approved	KIAA0233	uc010vpb.2	Q92508	OTTHUMG00000156776	ENST00000301015.9:c.2815_2817delCTG	16.37:g.88798926_88798928delCAG	ENSP00000301015:p.Leu939del	Somatic	0	76	0.00		0.6324490966295101	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	33	10.81	A6NHT9|A7E2B7|Q0KKZ9	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Piezo	p.L939in_frame_del	ENST00000301015.9	37	c.2817_2815	CCDS54058.1	16																																																																																			-	NULL		0.704	PIEZO1-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	PIEZO1	protein_coding	OTTHUMT00000345699.4	CAG	NM_014745			88798919	-1	no_errors	ENST00000301015	ensembl	human	novel	74_37	in_frame_del	DEL	1.000:1.000:1.000	-
RP11-159F24.2	0	genome.wustl.edu	37	5	43348816	43348817	+	RNA	INS	-	-	A	rs553054916|rs574591852|rs140799200	byFrequency	TCGA-VT-A80J-02A-11D-A417-09	TCGA-VT-A80J-11A-22D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9f5f2b4-7057-4dbc-aa22-577a341c4045	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr5:43348816_43348817insA	ENST00000511991.1	+	0	430_431																											ACCAAACTCTTAAAAAAAAAAA	0.337																																																	0								ENSG00000188850																																			RP11-159F24.2			0				Clone_based_vega_gene																													5.37:g.43348827_43348827dupA		Somatic	0	14	0.00		0.6324490966295101	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	9	30.77		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000511991.1	37	NULL		5																																																																																			-	-		0.337	RP11-159F24.2-001	KNOWN	basic	processed_transcript	ENSG00000188850	pseudogene	OTTHUMT00000367972.1	-				43348817	+1	no_errors	ENST00000511991	ensembl	human	known	74_37	rna	INS	0.001:0.000	A
SP140	11262	genome.wustl.edu	37	2	231112646	231112646	+	Missense_Mutation	SNP	G	G	A			TCGA-VT-A80J-02A-11D-A417-09	TCGA-VT-A80J-11A-22D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9f5f2b4-7057-4dbc-aa22-577a341c4045	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr2:231112646G>A	ENST00000392045.3	+	8	872	c.758G>A	c.(757-759)gGg>gAg	p.G253E	SP140_ENST00000420434.3_Missense_Mutation_p.G253E|SP140_ENST00000343805.6_Missense_Mutation_p.G227E|SP140_ENST00000417495.3_Intron|SP140_ENST00000350136.5_Intron|SP140_ENST00000486687.2_Intron	NM_007237.4	NP_009168.4	Q13342	SP140_HUMAN	SP140 nuclear body protein	253					defense response (GO:0006952)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(1)	12		Renal(207;0.0112)|all_lung(227;0.0221)|Lung NSC(271;0.0977)|all_hematologic(139;0.103)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)		GAAAGCAACGGGATGATAGAT	0.443																																																	0								ENSG00000079263						162.0	158.0	159.0					2																	231112646		1954	4153	6107	SP140	SO:0001583	missense	0			-	HGNC	U63420	CCDS33392.1, CCDS42831.1, CCDS63149.1, CCDS63150.1, CCDS63151.1	2q37.1	2013-01-28			ENSG00000079263	ENSG00000079263		"""Zinc fingers, PHD-type"""	17133	protein-coding gene	gene with protein product		608602				8695863, 8910577, 12368356	Standard	NM_001005176		Approved	LYSP100-B, LYSP100-A	uc002vql.3	Q13342	OTTHUMG00000153670	ENST00000392045.3:c.758G>A	2.37:g.231112646G>A	ENSP00000375899:p.Gly253Glu	Somatic	0	45	0.00		0.6324490966295101	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	31	13.89	E7ESH9|E7EUR5|E9PFJ6|Q0VGE5|Q13341|Q3KR17|Q4ZG66|Q53TG1|Q6NSG4|Q92881|Q96TG3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Sp100,pfam_SAND_dom,pfam_Bromodomain,pfam_Znf_PHD-finger,superfamily_SAND_dom-like,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_SAND_dom,smart_Znf_PHD,smart_Bromodomain,pfscan_Znf_PHD-finger,pfscan_SAND_dom,pfscan_Bromodomain	p.G253E	ENST00000392045.3	37	c.758	CCDS42831.1	2	.	.	.	.	.	.	.	.	.	.	G	0.003	-2.425595	0.00186	.	.	ENSG00000079263	ENST00000392044;ENST00000392045;ENST00000343805;ENST00000420434	T;T;T	0.59364	0.77;0.27;0.67	1.82	-1.38	0.09027	.	.	.	.	.	T	0.26557	0.0649	N	0.08118	0	0.09310	N	1	B;B;B;B	0.09022	0.001;0.001;0.002;0.001	B;B;B;B	0.11329	0.003;0.006;0.001;0.002	T	0.26643	-1.0097	9	0.02654	T	1	.	5.2205	0.15366	0.602:0.0:0.398:0.0	.	253;227;253;253	E7EUR5;E9PFJ6;Q13342;E7EX75	.;.;LY10_HUMAN;.	E	253;253;227;253	ENSP00000375899:G253E;ENSP00000342096:G227E;ENSP00000398210:G253E	ENSP00000342096:G227E	G	+	2	0	SP140	230820890	.	.	0.000000	0.03702	0.005000	0.04900	.	.	-0.431000	0.07307	0.305000	0.20034	GGG	-	NULL		0.443	SP140-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SP140	protein_coding	OTTHUMT00000332015.1	G	NM_007237	-		231112646	+1	no_errors	ENST00000392045	ensembl	human	known	74_37	missense	SNP	0.000	A
SMC5	23137	genome.wustl.edu	37	9	72959324	72959325	+	Intron	DEL	AT	AT	-	rs113697041|rs148835452|rs58118106	byFrequency	TCGA-VT-A80J-02A-11D-A417-09	TCGA-VT-A80J-11A-22D-A36M-09	AT	AT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9f5f2b4-7057-4dbc-aa22-577a341c4045	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr9:72959324_72959325delAT	ENST00000361138.5	+	18	2581					NM_015110.3	NP_055925.2	Q8IY18	SMC5_HUMAN	structural maintenance of chromosomes 5						cellular senescence (GO:0090398)|double-strand break repair via homologous recombination (GO:0000724)|mitotic nuclear division (GO:0007067)|positive regulation of maintenance of mitotic sister chromatid cohesion (GO:0034184)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|telomere maintenance via recombination (GO:0000722)	cell junction (GO:0030054)|chromosome, telomeric region (GO:0000781)|nucleus (GO:0005634)|PML body (GO:0016605)|Smc5-Smc6 complex (GO:0030915)	ATP binding (GO:0005524)			breast(1)|central_nervous_system(3)|endometrium(3)|kidney(4)|large_intestine(8)|lung(9)|ovary(2)|prostate(1)|skin(4)	35						TTTAAACTGaatatatatatat	0.282														1324	0.264377	0.2882	0.1787	5008	,	,		11632	0.2808		0.2107	False		,,,				2504	0.3313																0								ENSG00000198887																																			SMC5	SO:0001627	intron_variant	0				HGNC	AB011166	CCDS6632.1	9q21.11	2008-02-05	2006-07-06	2006-07-06	ENSG00000198887	ENSG00000198887		"""Structural maintenance of chromosomes proteins"""	20465	protein-coding gene	gene with protein product		609386	"""SMC5 structural maintenance of chromosomes 5-like 1 (yeast)"""	SMC5L1		9628581	Standard	NM_015110		Approved	KIAA0594	uc004ahr.2	Q8IY18	OTTHUMG00000019992	ENST00000361138.5:c.2523+139AT>-	9.37:g.72959334_72959335delAT		Somatic	0	10	0.00		0.6324490966295101	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	7	50.00	A6NM81|O60335|Q05D92|Q5VZ60|Q96SB9	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000361138.5	37	NULL	CCDS6632.1	9																																																																																			-	-		0.282	SMC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMC5	protein_coding	OTTHUMT00000052603.1	AT	NM_015110			72959325	+1	no_errors	ENST00000475540	ensembl	human	known	74_37	rna	DEL	0.121:0.027	-
BX119917.1	0	genome.wustl.edu	37	X	71372202	71372209	+	RNA	DEL	CGCGCGCA	CGCGCGCA	-	rs6625958|rs72357649|rs72197346|rs59980083|rs6625957|rs200056633|rs10856127		TCGA-VT-A80J-02A-11D-A417-09	TCGA-VT-A80J-11A-22D-A36M-09	CGCGCGCA	CGCGCGCA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9f5f2b4-7057-4dbc-aa22-577a341c4045	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chrX:71372202_71372209delCGCGCGCA	ENST00000401114.1	-	0	55_62																											TGTGCATGCGCGCGCGcacacacacaca	0.495																																																	0								ENSG00000215933																																			BX119917.1			0				Clone_based_ensembl_gene																													X.37:g.71372202_71372209delCGCGCGCA		Somatic	NA	NA	NA		0.6324490966295101	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000401114.1	37	NULL		X																																																																																			-	-		0.495	BX119917.1-201	NOVEL	basic	miRNA	ENSG00000215933	miRNA		CGCGCGCA				71372209	-1	no_errors	ENST00000401114	ensembl	human	novel	74_37	rna	DEL	0.000:0.000:0.000:0.000:0.000:0.001:0.015:0.009	-
APITD1	378708	genome.wustl.edu	37	1	10493968	10493968	+	Nonsense_Mutation	SNP	C	C	T			TCGA-VT-A80J-02A-11D-A417-09	TCGA-VT-A80J-11A-22D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9f5f2b4-7057-4dbc-aa22-577a341c4045	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr1:10493968C>T	ENST00000309048.3	+	2	196	c.121C>T	c.(121-123)Cag>Tag	p.Q41*	APITD1-CORT_ENST00000400900.2_Nonsense_Mutation_p.Q41*|APITD1_ENST00000602296.1_Nonsense_Mutation_p.Q41*|APITD1-CORT_ENST00000470413.2_Nonsense_Mutation_p.Q41*|APITD1_ENST00000602787.1_Nonsense_Mutation_p.Q41*|APITD1_ENST00000462462.1_Intron|APITD1-CORT_ENST00000465026.1_Intron	NM_001270517.1|NM_199294.2	NP_001257446.1|NP_954988.1	Q8N2Z9	CENPS_HUMAN	apoptosis-inducing, TAF9-like domain 1	41					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|positive regulation of protein ubiquitination (GO:0031398)|replication fork processing (GO:0031297)|resolution of meiotic recombination intermediates (GO:0000712)	cytosol (GO:0005829)|FANCM-MHF complex (GO:0071821)|Fanconi anaemia nuclear complex (GO:0043240)|kinetochore (GO:0000776)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			kidney(1)|lung(1)|ovary(1)|stomach(1)	4	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.19e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.31e-07)|COAD - Colon adenocarcinoma(227;7.32e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000297)|Kidney(185;0.000747)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(132;0.0167)|READ - Rectum adenocarcinoma(331;0.0487)		CAAAGAGATGCAGTTCAGCAA	0.488																																																	0								ENSG00000251503						148.0	140.0	143.0					1																	10493968		2203	4300	6503	APITD1-CORT	SO:0001587	stop_gained	0			-	HGNC	BC029430	CCDS114.1, CCDS115.1	1p36.22	2013-11-05			ENSG00000175279	ENSG00000175279			23163	protein-coding gene	gene with protein product	"""centromere protein S"""	609130				15328517, 16622420, 16622419	Standard	NR_036462		Approved	CENPS, CENP-S, MHF1, FAAP16		Q8N2Z9	OTTHUMG00000059085	ENST00000309048.3:c.121C>T	1.37:g.10493968C>T	ENSP00000308583:p.Gln41*	Somatic	0	53	0.00		0.6324490966295101	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	27	12.50	Q8NFE5|Q8NFG5	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Somatostatin/Cortistatin_C,superfamily_Histone-fold	p.Q41*	ENST00000309048.3	37	c.121	CCDS115.1	1	.	.	.	.	.	.	.	.	.	.	C	39	7.639312	0.98406	.	.	ENSG00000175279;ENSG00000175279;ENSG00000175279;ENSG00000251503;ENSG00000251503	ENST00000556104;ENST00000556817;ENST00000309048;ENST00000400900;ENST00000470413	.	.	.	6.07	1.91	0.25777	.	0.713327	0.14103	N	0.341265	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08599	T	0.76	-0.2681	7.8516	0.29457	0.2337:0.6328:0.0:0.1335	.	.	.	.	X	41	.	ENSP00000383692:Q41X	Q	+	1	0	APITD1-CORT;APITD1	10416555	0.985000	0.35326	0.977000	0.42913	0.999000	0.98932	1.486000	0.35530	0.874000	0.35823	0.655000	0.94253	CAG	-	superfamily_Histone-fold		0.488	APITD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APITD1-CORT	protein_coding	OTTHUMT00000130797.2	C	NM_199294	-		10493968	+1	no_errors	ENST00000400900	ensembl	human	known	74_37	nonsense	SNP	0.824	T
RGS21	431704	genome.wustl.edu	37	1	192316509	192316522	+	Splice_Site	DEL	AGCCAACCAAGGTA	AGCCAACCAAGGTA	-	rs142678159	byFrequency	TCGA-VT-A80J-02A-11D-A417-09	TCGA-VT-A80J-11A-22D-A36M-09	AGCCAACCAAGGTA	AGCCAACCAAGGTA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9f5f2b4-7057-4dbc-aa22-577a341c4045	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr1:192316509_192316522delAGCCAACCAAGGTA	ENST00000417209.2	+	3	252_262	c.78_88delAGCCAACCAAGGTA	c.(76-90)ttagccaaccaaggt>ttgt	p.ANQG27fs		NM_001039152.3	NP_001034241.1	Q2M5E4	RGS21_HUMAN	regulator of G-protein signaling 21	27	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)	p.N28K(1)		NS(1)|endometrium(3)|large_intestine(4)|lung(5)|ovary(1)|skin(1)	15						ACACGCTTTTAGCCAACCAAGGTAAGATTTAACT	0.299																																																	1	Substitution - Missense(1)	ovary(1)						ENSG00000253148																																			RGS21	SO:0001630	splice_region_variant	0				HGNC	AY643711	CCDS41448.1	1q31.2	2013-09-24	2007-08-14		ENSG00000253148	ENSG00000253148		"""Regulators of G-protein signaling"""	26839	protein-coding gene	gene with protein product		612407	"""regulator of G-protein signalling 21"""			15066150	Standard	NM_001039152		Approved		uc001gsh.3	Q2M5E4	OTTHUMG00000035594	ENST00000417209.2:c.88+1AGCCAACCAAGGTA>-	1.37:g.192316509_192316522delAGCCAACCAAGGTA		Somatic	NA	NA	NA		0.6324490966295101	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_RGS_dom,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal_superfam,pfscan_Regulat_G_prot_signal_superfam,prints_RGS_dom	p.L26fs	ENST00000417209.2	37	c.78_88	CCDS41448.1	1																																																																																			-	pfam_RGS_dom,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal_superfam,pfscan_Regulat_G_prot_signal_superfam,prints_RGS_dom		0.299	RGS21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGS21	protein_coding	OTTHUMT00000086387.2	AGCCAACCAAGGTA			Frame_Shift_Del	192316522	+1	no_errors	ENST00000417209	ensembl	human	known	74_37	frame_shift_del	DEL	1.000:1.000:1.000:0.991:0.990:0.968:0.645:0.950:1.000:1.000:1.000	-
WBP2NL	164684	genome.wustl.edu	37	22	42398850	42398854	+	Intron	DEL	TACTT	TACTT	-	rs133310|rs201279320|rs71751842|rs199509113	byFrequency	TCGA-VT-A80J-02A-11D-A417-09	TCGA-VT-A80J-11A-22D-A36M-09	TACTT	TACTT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9f5f2b4-7057-4dbc-aa22-577a341c4045	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr22:42398850_42398854delTACTT	ENST00000328823.9	+	1	93				WBP2NL_ENST00000461730.1_3'UTR	NM_152613.2	NP_689826.2	Q6ICG8	WBP2L_HUMAN	WBP2 N-terminal like						egg activation (GO:0007343)|male pronucleus assembly (GO:0035039)|meiotic nuclear division (GO:0007126)	perinuclear theca (GO:0033011)	WW domain binding (GO:0050699)			breast(2)|large_intestine(3)|lung(5)|ovary(3)|prostate(1)	14						GGATAGAAACTACTTTAAAGAACCA	0.468														2430	0.485224	0.2519	0.3473	5008	,	,		17791	0.8641		0.4742	False		,,,				2504	0.5194																0								ENSG00000183066																																			WBP2NL	SO:0001627	intron_variant	0				HGNC	BC022546	CCDS14029.1	22q13.2	2007-07-18			ENSG00000183066	ENSG00000183066			28389	protein-coding gene	gene with protein product	"""postacrosomal sheath WW domain-binding protein"""	610981				17289678	Standard	NM_152613		Approved	FLJ26145, MGC26816, PAWP	uc003bbt.3	Q6ICG8	OTTHUMG00000151270	ENST00000328823.9:c.62+3966TACTT>-	22.37:g.42398850_42398854delTACTT		Somatic	NA	NA	NA		0.6324490966295101	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A3KFF7|A8MSG5|B3KXX4|Q8TBF0|Q8TBF3	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000328823.9	37	NULL	CCDS14029.1	22																																																																																			-	-		0.468	WBP2NL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WBP2NL	protein_coding	OTTHUMT00000322037.1	TACTT	NM_152613			42398854	+1	no_errors	ENST00000461730	ensembl	human	known	74_37	rna	DEL	0.001:0.003:0.012:0.016:0.015	-
RP11-284N8.3	0	genome.wustl.edu	37	1	111195567	111195572	+	lincRNA	DEL	TGTGTG	TGTGTG	-	rs35174060|rs146753647|rs546628713|rs9308236		TCGA-VT-A80J-02A-11D-A417-09	TCGA-VT-A80J-11A-22D-A36M-09	TGTGTG	TGTGTG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9f5f2b4-7057-4dbc-aa22-577a341c4045	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr1:111195567_111195572delTGTGTG	ENST00000566942.1	-	0	6962				AL365361.1_ENST00000408611.1_RNA																							CTTGGGAATAtgtgtgtgtgtgtgtg	0.354																																																	0								ENSG00000221538																																			AL365361.1			0				Clone_based_ensembl_gene																													1.37:g.111195573_111195578delTGTGTG		Somatic	NA	NA	NA		0.6324490966295101	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000566942.1	37	NULL		1																																																																																			-	-		0.354	RP11-284N8.3-001	KNOWN	basic	lincRNA	ENSG00000221538	lincRNA	OTTHUMT00000431321.1	TGTGTG				111195572	-1	no_errors	ENST00000408611	ensembl	human	novel	74_37	rna	DEL	0.005:0.004:0.004:0.002:0.002:0.000	-
SYNE4	163183	genome.wustl.edu	37	19	36497392	36497392	+	Missense_Mutation	SNP	C	C	T	rs200616477		TCGA-VT-A80J-02A-11D-A417-09	TCGA-VT-A80J-11A-22D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9f5f2b4-7057-4dbc-aa22-577a341c4045	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr19:36497392C>T	ENST00000324444.3	-	5	911	c.800G>A	c.(799-801)cGg>cAg	p.R267Q	ALKBH6_ENST00000495116.2_5'Flank|SYNE4_ENST00000340477.5_Missense_Mutation_p.R154Q|AC002116.8_ENST00000473572.2_RNA	NM_001039876.1	NP_001034965.1	Q8N205	SYNE4_HUMAN	spectrin repeat containing, nuclear envelope family member 4	267					establishment of epithelial cell apical/basal polarity (GO:0045198)	integral component of nuclear outer membrane (GO:0031309)											TCCTAGTGTCCGGGCTGTCTT	0.667																																																	0								ENSG00000181392																																			SYNE4	SO:0001583	missense	0			-	HGNC	BC038360	CCDS42553.1	19q13.12	2014-01-28	2012-05-31	2012-05-31	ENSG00000181392	ENSG00000181392			26703	protein-coding gene	gene with protein product		615535	"""chromosome 19 open reading frame 46"", ""deafness, autosomal recessive 76"""	C19orf46, DFNB76		23348741	Standard	XM_005258597		Approved	FLJ36445, Nesprin-4, Nesp4	uc002ocq.1	Q8N205	OTTHUMG00000048135	ENST00000324444.3:c.800G>A	19.37:g.36497392C>T	ENSP00000316130:p.Arg267Gln	Somatic	0	56	0.00		0.6324490966295101	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	63	17.11	A8MRS0|A8MYE3|Q7Z7L3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_KASH,pfscan_KASH	p.R267Q	ENST00000324444.3	37	c.800	CCDS42553.1	19	.	.	.	.	.	.	.	.	.	.	C	3.833	-0.035435	0.07497	.	.	ENSG00000181392	ENST00000340477;ENST00000324444	T;T	0.34472	1.36;1.36	5.15	0.562	0.17290	.	1.528510	0.03379	N	0.200115	T	0.22589	0.0545	N	0.24115	0.695	0.09310	N	1	B;B	0.12013	0.005;0.001	B;B	0.04013	0.001;0.001	T	0.11941	-1.0567	10	0.27785	T	0.31	-29.6686	1.8582	0.03183	0.1659:0.497:0.1605:0.1766	.	154;267	Q8N205-2;Q8N205	.;SYNE4_HUMAN	Q	154;267	ENSP00000343152:R154Q;ENSP00000316130:R267Q	ENSP00000316130:R267Q	R	-	2	0	C19orf46	41189232	0.000000	0.05858	0.014000	0.15608	0.057000	0.15508	0.142000	0.16096	0.059000	0.16252	-0.136000	0.14681	CGG	-	NULL		0.667	SYNE4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNE4	protein_coding	OTTHUMT00000109525.3	C	NM_001039876	rs200616477		36497392	-1	no_errors	ENST00000324444	ensembl	human	known	74_37	missense	SNP	0.030	T
KIF1C	10749	genome.wustl.edu	37	17	4910377	4910377	+	Nonsense_Mutation	SNP	C	C	T			TCGA-VT-A80J-02A-11D-A417-09	TCGA-VT-A80J-11A-22D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9f5f2b4-7057-4dbc-aa22-577a341c4045	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr17:4910377C>T	ENST00000320785.5	+	14	1690	c.1333C>T	c.(1333-1335)Cag>Tag	p.Q445*		NM_006612.5	NP_006603.2	O43896	KIF1C_HUMAN	kinesin family member 1C	445					ATP catabolic process (GO:0006200)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)|poly(A) RNA binding (GO:0044822)			NS(2)|breast(4)|endometrium(4)|kidney(2)|large_intestine(8)|lung(6)|skin(1)|urinary_tract(3)	30						GGAGAGGCTGCAGGTGGGAAG	0.562																																					Melanoma(96;1023 1447 10250 19259 33730)												0								ENSG00000129250						31.0	34.0	33.0					17																	4910377		2203	4299	6502	KIF1C	SO:0001587	stop_gained	0			-	HGNC	U91329	CCDS11065.1	17p13.2	2014-03-03			ENSG00000129250	ENSG00000129250		"""Kinesins"""	6317	protein-coding gene	gene with protein product		603060	"""spastic ataxia 2 (autosomal recessive)"""	SAX2		9685376, 24319291, 24482476	Standard	NM_006612		Approved	SPAX2, SPG58	uc002gan.2	O43896	OTTHUMG00000099451	ENST00000320785.5:c.1333C>T	17.37:g.4910377C>T	ENSP00000320821:p.Gln445*	Somatic	0	79	0.00		0.6324490966295101	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	42	10.64	D3DTL6|O75186|Q5U618	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Kinesin_motor_dom,pfam_FHA_dom,superfamily_P-loop_NTPase,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.Q445*	ENST00000320785.5	37	c.1333	CCDS11065.1	17	.	.	.	.	.	.	.	.	.	.	C	40	8.060158	0.98632	.	.	ENSG00000129250	ENST00000320785	.	.	.	4.92	4.92	0.64577	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07990	T	0.79	.	14.353	0.66716	0.0:1.0:0.0:0.0	.	.	.	.	X	445	.	ENSP00000320821:Q445X	Q	+	1	0	KIF1C	4851101	0.864000	0.29904	1.000000	0.80357	0.710000	0.40934	1.238000	0.32707	2.679000	0.91253	0.655000	0.94253	CAG	-	NULL		0.562	KIF1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF1C	protein_coding	OTTHUMT00000216916.1	C		-		4910377	+1	no_errors	ENST00000320785	ensembl	human	known	74_37	nonsense	SNP	1.000	T
MT1HL1	645745	genome.wustl.edu	37	1	237167633	237167633	+	Missense_Mutation	SNP	C	C	T			TCGA-VT-A80J-02A-11D-A417-09	TCGA-VT-A80J-11A-22D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9f5f2b4-7057-4dbc-aa22-577a341c4045	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr1:237167633C>T	ENST00000464121.2	-	1	85	c.40G>A	c.(40-42)Gcc>Acc	p.A14T		NM_001276687.1	NP_001263616.1	P0DM35	M1BL1_HUMAN	metallothionein 1H-like 1	14	Beta.|Cys-rich.						metal ion binding (GO:0046872)										CCGGCGCAGGCGTAGGAGCCT	0.627																																																	0								ENSG00000244020						31.0	34.0	34.0					1																	237167633		692	1591	2283	MT1HL1	SO:0001583	missense	0			-	HGNC	AF333388	CCDS31068.1	1q43	2013-03-07	2013-03-07	2013-03-07	ENSG00000244020	ENSG00000244020		"""Metallothioneins"""	31864	protein-coding gene	gene with protein product			"""metallothionein 1 pseudogene 2"""	MT1P2			Standard	NM_001276687		Approved		uc001hyk.2	P0DM35	OTTHUMG00000040065	ENST00000464121.2:c.40G>A	1.37:g.237167633C>T	ENSP00000476141:p.Ala14Thr	Somatic	0	47	0.00		0.6324490966295101	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	12	58.62		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Metalthion_sfam_euk,superfamily_Metalthion_dom,prints_Metalthion_vert	p.A14T	ENST00000464121.2	37	c.40		1																																																																																			-	pfam_Metalthion_sfam_euk,superfamily_Metalthion_dom,prints_Metalthion_vert		0.627	MT1HL1-001	KNOWN	basic|appris_principal	protein_coding	MT1HL1	protein_coding	OTTHUMT00000096642.4	C	NM_001039954	-		237167633	-1	no_errors	ENST00000464121	ensembl	human	known	74_37	missense	SNP	0.006	T
ARMC3	219681	genome.wustl.edu	37	10	23326384	23326384	+	Frame_Shift_Del	DEL	G	G	-			TCGA-VT-A80J-02A-11D-A417-09	TCGA-VT-A80J-11A-22D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9f5f2b4-7057-4dbc-aa22-577a341c4045	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr10:23326384delG	ENST00000298032.5	+	19	2679	c.2595delG	c.(2593-2595)gagfs	p.E865fs	ARMC3_ENST00000376528.4_Frame_Shift_Del_p.E602fs|ARMC3_ENST00000409983.3_Frame_Shift_Del_p.E858fs	NM_173081.3	NP_775104.2	Q5W041	ARMC3_HUMAN	armadillo repeat containing 3	865						extracellular vesicular exosome (GO:0070062)				breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(24)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						GAAGTCGAGAGGCTGATCTTT	0.463																																																	0								ENSG00000165309						79.0	73.0	75.0					10																	23326384		2203	4300	6503	ARMC3	SO:0001589	frameshift_variant	0				HGNC	AK057389	CCDS7142.1, CCDS60499.1, CCDS60500.1, CCDS73073.1	10p12.31	2013-02-14			ENSG00000165309	ENSG00000165309		"""Armadillo repeat containing"""	30964	protein-coding gene	gene with protein product	"""cancer/testis antigen 81"""	611226					Standard	XM_005252380		Approved	FLJ32827, CT81	uc001irm.4	Q5W041	OTTHUMG00000017811	ENST00000298032.5:c.2595delG	10.37:g.23326384delG	ENSP00000298032:p.Glu865fs	Somatic	0	42	0.00		0.6324490966295101	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	10	16.67	A0PG76|A6NH64|B4DZL3|B7ZBN6|B7ZBN7|Q8IXS5|Q8N7B0|Q96M49	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Armadillo,pfam_HEAT,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.A866fs	ENST00000298032.5	37	c.2595	CCDS7142.1	10																																																																																			-	NULL		0.463	ARMC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARMC3	protein_coding	OTTHUMT00000047197.2	G	NM_173081			23326384	+1	no_errors	ENST00000298032	ensembl	human	known	74_37	frame_shift_del	DEL	0.995	-
SASH1	23328	genome.wustl.edu	37	6	148846428	148846428	+	Splice_Site	SNP	G	G	T			TCGA-VT-A80J-02A-11D-A417-09	TCGA-VT-A80J-11A-22D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9f5f2b4-7057-4dbc-aa22-577a341c4045	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr6:148846428G>T	ENST00000367467.3	+	11	1686	c.1211G>T	c.(1210-1212)aGa>aTa	p.R404I	AL033378.1_ENST00000411390.2_RNA	NM_015278.3	NP_056093.3	O94885	SASH1_HUMAN	SAM and SH3 domain containing 1	404					positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)|positive regulation of NIK/NF-kappaB signaling (GO:1901224)|positive regulation of p38MAPK cascade (GO:1900745)|protein polyubiquitination (GO:0000209)|regulation of protein autoubiquitination (GO:1902498)|regulation of protein K63-linked ubiquitination (GO:1900044)	membrane (GO:0016020)|protein complex (GO:0043234)	mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein C-terminus binding (GO:0008022)|protein complex scaffold (GO:0032947)|protein kinase binding (GO:0019901)			breast(4)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(11)|lung(20)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	52		Ovarian(120;0.0169)		OV - Ovarian serous cystadenocarcinoma(155;5.63e-11)|GBM - Glioblastoma multiforme(68;0.0701)		TTTCCACAGAGAACCTGCAGT	0.478																																																	0								ENSG00000111961						222.0	202.0	209.0					6																	148846428		2203	4300	6503	SASH1	SO:0001630	splice_region_variant	0			-	HGNC	AB018333	CCDS5212.1	6q24.3	2013-01-10			ENSG00000111961	ENSG00000111961		"""SAM and SH3 domain containing"", ""Sterile alpha motif (SAM) domain containing"""	19182	protein-coding gene	gene with protein product		607955				9872452, 12771949	Standard	NM_015278		Approved	KIAA0790, dJ323M4.1, SH3D6A	uc003qme.1	O94885	OTTHUMG00000015773	ENST00000367467.3:c.1210-1G>T	6.37:g.148846428G>T		Somatic	0	50	0.00		0.6324490966295101	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	43	31	58.11	Q5TGN5|Q8TAI0|Q9H7R7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_rSAM/SH3_domain-containing,pfam_SAM_2,pfam_SAM_type1,pfam_SH3_2,superfamily_SAM/pointed,superfamily_SH3_domain,smart_SH3_domain,smart_SAM,pfscan_SAM	p.R404I	ENST00000367467.3	37	c.1211	CCDS5212.1	6	.	.	.	.	.	.	.	.	.	.	G	35	5.438132	0.96168	.	.	ENSG00000111961	ENST00000367467;ENST00000535767	T	0.62639	0.01	5.63	5.63	0.86233	.	0.134101	0.64402	D	0.000002	T	0.76856	0.4046	M	0.70275	2.135	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.77770	-0.2463	10	0.87932	D	0	-26.0197	20.0442	0.97604	0.0:0.0:1.0:0.0	.	385;404	Q6P4R9;O94885	.;SASH1_HUMAN	I	404;165	ENSP00000356437:R404I	ENSP00000356437:R404I	R	+	2	0	SASH1	148888121	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.420000	0.97426	2.814000	0.96858	0.655000	0.94253	AGA	-	pfam_rSAM/SH3_domain-containing		0.478	SASH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SASH1	protein_coding	OTTHUMT00000042619.1	G	NM_015278	-	Missense_Mutation	148846428	+1	no_errors	ENST00000367467	ensembl	human	known	74_37	missense	SNP	1.000	T
ANG	283	genome.wustl.edu	37	14	21162109	21162109	+	Missense_Mutation	SNP	T	T	A			TCGA-VT-A80J-02A-11D-A417-09	TCGA-VT-A80J-11A-22D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9f5f2b4-7057-4dbc-aa22-577a341c4045	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr14:21162109T>A	ENST00000336811.6	+	2	986	c.386T>A	c.(385-387)gTt>gAt	p.V129D	RNASE4_ENST00000555835.1_Intron|RNASE4_ENST00000397995.2_Intron|RNASE4_ENST00000304704.4_Intron|AL163636.6_ENST00000553909.1_Intron|ANG_ENST00000554073.1_Intron|RNASE4_ENST00000555597.1_Intron|RP11-903H12.3_ENST00000554286.1_RNA|ANG_ENST00000397990.4_Missense_Mutation_p.V129D	NM_001145.4	NP_001136.1	P03950	ANGI_HUMAN	angiogenin, ribonuclease, RNase A family, 5	129					actin filament polymerization (GO:0030041)|activation of phospholipase A2 activity (GO:0032431)|activation of phospholipase C activity (GO:0007202)|activation of protein kinase B activity (GO:0032148)|angiogenesis (GO:0001525)|cell communication (GO:0007154)|cell death (GO:0008219)|cell migration (GO:0016477)|diacylglycerol biosynthetic process (GO:0006651)|homeostatic process (GO:0042592)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of translation (GO:0017148)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|oocyte maturation (GO:0001556)|ovarian follicle development (GO:0001541)|placenta development (GO:0001890)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein secretion (GO:0050714)|response to hormone (GO:0009725)|response to hypoxia (GO:0001666)|RNA phosphodiester bond hydrolysis (GO:0090501)|rRNA transcription (GO:0009303)	angiogenin-PRI complex (GO:0032311)|basal lamina (GO:0005605)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|nucleus (GO:0005634)	actin binding (GO:0003779)|copper ion binding (GO:0005507)|DNA binding (GO:0003677)|endonuclease activity (GO:0004519)|heparin binding (GO:0008201)|peptide binding (GO:0042277)|receptor binding (GO:0005102)|ribonuclease activity (GO:0004540)|rRNA binding (GO:0019843)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|ovary(1)|prostate(1)	5	all_cancers(95;0.00387)	all_cancers(140;0.196)|all_epithelial(140;0.156)	Epithelial(56;5.13e-07)|all cancers(55;4.73e-06)	OV - Ovarian serous cystadenocarcinoma(311;3.25e-17)|GBM - Glioblastoma multiforme(265;5.56e-07)		AACGTTGTTGTTGCTTGTGAA	0.552																																																	0								ENSG00000214274						126.0	118.0	121.0					14																	21162109		2203	4300	6503	ANG	SO:0001583	missense	0			-	HGNC		CCDS9554.1	14q11.1-q11.2	2014-09-17			ENSG00000214274	ENSG00000214274	3.1.27.-	"""Ribonucleases, RNase A"""	483	protein-coding gene	gene with protein product		105850				1978563	Standard	NM_001145		Approved	RNASE5	uc001vxw.4	P03950	OTTHUMG00000029576	ENST00000336811.6:c.386T>A	14.37:g.21162109T>A	ENSP00000336762:p.Val129Asp	Somatic	0	87	0.00		0.6324490966295101	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	55	30.38	Q05CV1|Q53X86|Q6P5T2|Q8WXE7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RNaseA_domain,superfamily_RNaseA_domain,smart_RNaseA_domain,prints_RNaseA	p.V129D	ENST00000336811.6	37	c.386	CCDS9554.1	14	.	.	.	.	.	.	.	.	.	.	T	12.08	1.830681	0.32329	.	.	ENSG00000214274	ENST00000336811;ENST00000397990	T;T	0.80123	-1.34;-1.34	5.06	3.92	0.45320	Ribonuclease A, domain (4);	0.382752	0.17401	U	0.175528	D	0.90559	0.7041	M	0.93375	3.41	0.20764	N	0.999854	D	0.89917	1.0	D	0.75020	0.985	T	0.82157	-0.0596	10	0.87932	D	0	.	7.396	0.26936	0.0:0.0965:0.0:0.9035	.	129	P03950	ANGI_HUMAN	D	129	ENSP00000336762:V129D;ENSP00000381077:V129D	ENSP00000336762:V129D	V	+	2	0	ANG	20231949	0.436000	0.25586	0.031000	0.17742	0.007000	0.05969	3.699000	0.54778	0.953000	0.37825	0.533000	0.62120	GTT	-	pfam_RNaseA_domain,superfamily_RNaseA_domain,smart_RNaseA_domain,prints_RNaseA		0.552	ANG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANG	protein_coding	OTTHUMT00000073731.3	T	NM_001097577	-		21162109	+1	no_errors	ENST00000336811	ensembl	human	known	74_37	missense	SNP	0.157	A
GRM6	2916	genome.wustl.edu	37	5	178413641	178413641	+	Nonsense_Mutation	SNP	C	C	T			TCGA-VT-A80J-02A-11D-A417-09	TCGA-VT-A80J-11A-22D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9f5f2b4-7057-4dbc-aa22-577a341c4045	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr5:178413641C>T	ENST00000517717.1	-	9	1652	c.1614G>A	c.(1612-1614)tgG>tgA	p.W538*	RP11-281O15.4_ENST00000519491.1_RNA|GRM6_ENST00000231188.5_Nonsense_Mutation_p.W538*			O15303	GRM6_HUMAN	glutamate receptor, metabotropic 6	538					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|detection of light stimulus involved in visual perception (GO:0050908)|detection of visible light (GO:0009584)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|locomotory behavior (GO:0007626)|positive regulation of calcium ion import (GO:0090280)|regulation of synaptic transmission, glutamatergic (GO:0051966)|retina development in camera-type eye (GO:0060041)|synaptic transmission (GO:0007268)	cell projection (GO:0042995)|endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|new growing cell tip (GO:0035841)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)|protein homodimerization activity (GO:0042803)			NS(2)|breast(4)|endometrium(9)|large_intestine(12)|lung(21)|ovary(2)|pancreas(1)|prostate(3)|urinary_tract(1)	55	all_cancers(89;0.000828)|Renal(175;0.000159)|all_epithelial(37;0.000167)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	all_cancers(40;0.0156)|all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.245)		CCTCGCAGTGCCAACAGCAGG	0.682																																																	0								ENSG00000113262						45.0	39.0	41.0					5																	178413641		2203	4300	6503	GRM6	SO:0001587	stop_gained	0			-	HGNC	U82083	CCDS4442.1	5q35	2014-01-28						"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4598	protein-coding gene	gene with protein product		604096				9215706	Standard	NM_000843		Approved	GPRC1F, mGlu6, MGLUR6, CSNB1B	uc003mjr.3	O15303	OTTHUMG00000130889	ENST00000517717.1:c.1614G>A	5.37:g.178413641C>T	ENSP00000430767:p.Trp538*	Somatic	0	59	0.00		0.6324490966295101	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	24	14.29		Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,superfamily_Peripla_BP_I,pfscan_GPCR_3_C,prints_GPCR_3,prints_GPCR_3_mtglu_rcpt_6,prints_GPCR_3_mtglu_rcpt,prints_GPCR_3_mtglu_rcpt_4	p.W538*	ENST00000517717.1	37	c.1614	CCDS4442.1	5	.	.	.	.	.	.	.	.	.	.	C	40	7.925276	0.98565	.	.	ENSG00000113262	ENST00000319065;ENST00000231188;ENST00000517717	.	.	.	4.87	4.87	0.63330	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.8786	0.79185	0.0:1.0:0.0:0.0	.	.	.	.	X	694;538;538	.	ENSP00000231188:W538X	W	-	3	0	GRM6	178346247	1.000000	0.71417	1.000000	0.80357	0.868000	0.49771	5.936000	0.70153	2.414000	0.81942	0.462000	0.41574	TGG	-	pfam_GPCR_3_9-Cys_dom		0.682	GRM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRM6	protein_coding	OTTHUMT00000253474.2	C		-		178413641	-1	no_errors	ENST00000231188	ensembl	human	known	74_37	nonsense	SNP	1.000	T
C4orf50	389197	genome.wustl.edu	37	4	5990869	5990870	+	5'Flank	DEL	CT	CT	-	rs143859826		TCGA-VT-A80J-02A-11D-A417-09	TCGA-VT-A80J-11A-22D-A36M-09	CT	CT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9f5f2b4-7057-4dbc-aa22-577a341c4045	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr4:5990869_5990870delCT	ENST00000324058.5	-	0	0				C4orf50_ENST00000531445.1_Frame_Shift_Del_p.E210fs			Q6ZRC1	CD050_HUMAN	chromosome 4 open reading frame 50											breast(1)|large_intestine(2)|lung(5)|ovary(1)|pancreas(2)|skin(3)|urinary_tract(1)	15						TTTTTGTCACCTCTCTCTCTCT	0.455																																																	0								ENSG00000181215																																			C4orf50	SO:0001631	upstream_gene_variant	0				HGNC	BC140710		4p16.1	2009-04-14			ENSG00000181215	ENSG00000181215			33766	protein-coding gene	gene with protein product							Standard	XM_003119922		Approved	FLJ46481		Q6ZRC1	OTTHUMG00000149971		4.37:g.5990879_5990880delCT	Exception_encountered	Somatic	0	39	0.00		0.6324490966295101	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	22	12.00		Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	NULL	p.E210fs	ENST00000324058.5	37	c.630_629		4																																																																																			-	NULL		0.455	C4orf50-201	KNOWN	basic|appris_candidate	protein_coding	C4orf50	protein_coding		CT	NM_207405			5990870	-1	no_errors	ENST00000531445	ensembl	human	known	74_37	frame_shift_del	DEL	0.000:0.000	-
ZCCHC12	170261	genome.wustl.edu	37	X	117960020	117960020	+	Silent	SNP	C	C	T			TCGA-VT-A80J-02A-11D-A417-09	TCGA-VT-A80J-11A-22D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9f5f2b4-7057-4dbc-aa22-577a341c4045	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chrX:117960020C>T	ENST00000310164.2	+	4	1320	c.813C>T	c.(811-813)gaC>gaT	p.D271D		NM_173798.2	NP_776159.1	Q6PEW1	ZCH12_HUMAN	zinc finger, CCHC domain containing 12	271					BMP signaling pathway (GO:0030509)|transcription, DNA-templated (GO:0006351)	nuclear speck (GO:0016607)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|prostate(2)	22						ATACCCTCGACGACTCCGATG	0.582																																																	0								ENSG00000174460						91.0	77.0	82.0					X																	117960020		2203	4300	6503	ZCCHC12	SO:0001819	synonymous_variant	0			-	HGNC	AK122676	CCDS14574.1	Xq24	2013-10-11			ENSG00000174460	ENSG00000174460		"""Zinc fingers, CCHC domain containing"", ""Paraneoplastic Ma antigens"""	27273	protein-coding gene	gene with protein product	"""paraneoplastic Ma antigen family member 7A"""	300701				21739307, 19578717	Standard	NM_173798		Approved	FLJ16123, SIZN, SIZN1, PNMA7A	uc004equ.3	Q6PEW1	OTTHUMG00000022261	ENST00000310164.2:c.813C>T	X.37:g.117960020C>T		Somatic	0	35	0.00		0.6324490966295101	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	5	68.75	B3KV48|Q6PID5|Q8N1C1	Silent	SNP	NA	NA	NA	NA	NA	NA	superfamily_Znf_CCHC	p.D271	ENST00000310164.2	37	c.813	CCDS14574.1	X																																																																																			-	NULL		0.582	ZCCHC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZCCHC12	protein_coding	OTTHUMT00000058014.1	C	NM_173798	-		117960020	+1	no_errors	ENST00000310164	ensembl	human	known	74_37	silent	SNP	0.946	T
RTL1	388015	genome.wustl.edu	37	14	101347810	101347810	+	Missense_Mutation	SNP	A	A	G			TCGA-VT-A80J-02A-11D-A417-09	TCGA-VT-A80J-11A-22D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9f5f2b4-7057-4dbc-aa22-577a341c4045	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr14:101347810A>G	ENST00000534062.1	-	1	3374	c.3316T>C	c.(3316-3318)Tcg>Ccg	p.S1106P	MIR433_ENST00000384837.1_RNA|MIR127_ENST00000384876.1_RNA|MIR431_ENST00000385266.1_RNA	NM_001134888.2	NP_001128360.1	A6NKG5	RTL1_HUMAN	retrotransposon-like 1	1106					multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)				breast(1)|endometrium(5)|kidney(4)|large_intestine(1)|lung(5)|pancreas(1)|prostate(2)|skin(2)	21						GGCCGCAGCGAGAGGCATTGC	0.657																																																	0								ENSG00000254656						45.0	40.0	42.0					14																	101347810		692	1591	2283	RTL1	SO:0001583	missense	0			-	HGNC		CCDS53910.1	14q32.2	2012-04-18			ENSG00000254656	ENSG00000254656			14665	protein-coding gene	gene with protein product		611896				16155747, 15854907, 12796779	Standard	NM_001134888		Approved	PEG11, MART1, Mar1	uc010txj.1	A6NKG5	OTTHUMG00000167573	ENST00000534062.1:c.3316T>C	14.37:g.101347810A>G	ENSP00000435342:p.Ser1106Pro	Somatic	0	26	0.00		0.6324490966295101	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	16	33.33	E9PKS8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Retrotrans_gag_dom,superfamily_Peptidase_aspartic_dom	p.S1106P	ENST00000534062.1	37	c.3316	CCDS53910.1	14	.	.	.	.	.	.	.	.	.	.	A	5.569	0.289777	0.10567	.	.	ENSG00000254656	ENST00000534062	T	0.24350	1.86	3.11	-6.22	0.02058	.	.	.	.	.	T	0.12135	0.0295	N	0.24115	0.695	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.20940	-1.0260	9	0.48119	T	0.1	.	2.4661	0.04553	0.2213:0.2306:0.4247:0.1234	.	1106	E9PKS8	.	P	1106	ENSP00000435342:S1106P	ENSP00000435342:S1106P	S	-	1	0	RTL1	100417563	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-2.374000	0.01072	-2.327000	0.00636	-0.589000	0.04120	TCG	-	NULL		0.657	RTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RTL1	protein_coding	OTTHUMT00000395127.1	A	NM_001134888	-		101347810	-1	no_errors	ENST00000534062	ensembl	human	known	74_37	missense	SNP	0.000	G
BMP6	654	genome.wustl.edu	37	6	7727534	7727534	+	Missense_Mutation	SNP	C	C	A			TCGA-VT-A80J-02A-11D-A417-09	TCGA-VT-A80J-11A-22D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9f5f2b4-7057-4dbc-aa22-577a341c4045	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr6:7727534C>A	ENST00000283147.6	+	1	505	c.346C>A	c.(346-348)Cag>Aag	p.Q116K		NM_001718.4	NP_001709.1	P22004	BMP6_HUMAN	bone morphogenetic protein 6	116					BMP signaling pathway (GO:0030509)|cartilage development (GO:0051216)|cellular response to mechanical stimulus (GO:0071260)|endochondral ossification (GO:0001958)|eye development (GO:0001654)|growth (GO:0040007)|immune response (GO:0006955)|inflammatory response (GO:0006954)|kidney development (GO:0001822)|male genitalia development (GO:0030539)|osteoblast differentiation (GO:0001649)|positive regulation of aldosterone biosynthetic process (GO:0032349)|positive regulation of aldosterone secretion (GO:2000860)|positive regulation of bone mineralization (GO:0030501)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of DNA-dependent DNA replication (GO:2000105)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein secretion (GO:0050714)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to activity (GO:0014823)|response to glucocorticoid (GO:0051384)|response to iron ion (GO:0010039)|response to magnesium ion (GO:0032026)|response to retinoic acid (GO:0032526)|skeletal system development (GO:0001501)|SMAD protein signal transduction (GO:0060395)|type B pancreatic cell development (GO:0003323)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|membrane-bounded vesicle (GO:0031988)	BMP receptor binding (GO:0070700)|protein heterodimerization activity (GO:0046982)			breast(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(6)|ovary(1)|prostate(1)	23	Ovarian(93;0.0721)					gcagcagcagcagcagcagcT	0.716																																																	0								ENSG00000153162						6.0	9.0	8.0					6																	7727534		1989	3931	5920	BMP6	SO:0001583	missense	0			-	HGNC	AF083030	CCDS4503.1	6p24-p23	2014-01-30	2003-10-06		ENSG00000153162	ENSG00000153162		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	1073	protein-coding gene	gene with protein product		112266	"""vegetal related growth factor (TGFB-related)"""	VGR		1427904, 1453478	Standard	NM_001718		Approved	VGR1	uc003mxu.4	P22004	OTTHUMG00000014217	ENST00000283147.6:c.346C>A	6.37:g.7727534C>A	ENSP00000283147:p.Gln116Lys	Somatic	0	10	0.00		0.6324490966295101	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	7	36.36	Q5TCP3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TGF-b_N,pfam_TGF-b_C,smart_TGF-b_C	p.Q116K	ENST00000283147.6	37	c.346	CCDS4503.1	6	.	.	.	.	.	.	.	.	.	.	C	0.031	-1.336876	0.01287	.	.	ENSG00000153162	ENST00000537240;ENST00000283147;ENST00000540959	T	0.71817	-0.6	1.12	0.102	0.14522	Transforming growth factor-beta, N-terminal (1);	.	.	.	.	T	0.29288	0.0729	L	0.36672	1.1	0.09310	N	0.999999	B	0.23650	0.089	B	0.13407	0.009	T	0.12319	-1.0552	9	0.18710	T	0.47	.	3.7963	0.08740	0.0:0.723:0.0:0.277	.	116	P22004	BMP6_HUMAN	K	38;116;79	ENSP00000283147:Q116K	ENSP00000283147:Q116K	Q	+	1	0	BMP6	7672533	0.109000	0.22037	0.209000	0.23619	0.239000	0.25481	0.676000	0.25247	0.007000	0.14760	0.185000	0.17295	CAG	-	pfam_TGF-b_N		0.716	BMP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BMP6	protein_coding	OTTHUMT00000039794.1	C	NM_001718	-		7727534	+1	no_errors	ENST00000283147	ensembl	human	known	74_37	missense	SNP	0.341	A
LRIT2	340745	genome.wustl.edu	37	10	85982349	85982349	+	Missense_Mutation	SNP	C	C	T			TCGA-VT-A80J-02A-11D-A417-09	TCGA-VT-A80J-11A-22D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9f5f2b4-7057-4dbc-aa22-577a341c4045	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr10:85982349C>T	ENST00000372113.4	-	3	985	c.980G>A	c.(979-981)tGc>tAc	p.C327Y	LRIT2_ENST00000538192.1_Missense_Mutation_p.C337Y	NM_001017924.2	NP_001017924.1	A6NDA9	LRIT2_HUMAN	leucine-rich repeat, immunoglobulin-like and transmembrane domains 2	327	Ig-like.					integral component of membrane (GO:0016021)				central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(13)|ovary(3)|prostate(6)|urinary_tract(1)	32						GGAGGCCATGCAGGTGTAATT	0.532																																																	0								ENSG00000204033						84.0	72.0	76.0					10																	85982349		2203	4300	6503	LRIT2	SO:0001583	missense	0			-	HGNC		CCDS31234.1, CCDS60581.1	10q23.2	2013-01-11	2007-06-19	2007-06-19	ENSG00000204033	ENSG00000204033		"""Immunoglobulin superfamily / I-set domain containing"""	23443	protein-coding gene	gene with protein product			"""leucine rich repeat containing 22"""	LRRC22			Standard	NM_001017924		Approved	AC022389.4	uc001kcy.3	A6NDA9	OTTHUMG00000018633	ENST00000372113.4:c.980G>A	10.37:g.85982349C>T	ENSP00000361185:p.Cys327Tyr	Somatic	0	37	0.00		0.6324490966295101	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	10	60.00	B7ZME6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Leu-rich_rpt,superfamily_Fibronectin_type3,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.C337Y	ENST00000372113.4	37	c.1010	CCDS31234.1	10	.	.	.	.	.	.	.	.	.	.	C	18.43	3.621890	0.66787	.	.	ENSG00000204033	ENST00000372113;ENST00000538192	T;D	0.92647	-0.56;-3.08	5.41	4.51	0.55191	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.093122	0.85682	D	0.000000	D	0.97838	0.9290	H	0.99404	4.55	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98221	1.0478	10	0.87932	D	0	.	12.7105	0.57086	0.0:0.9189:0.0:0.0811	.	337;327	B7ZME6;A6NDA9	.;LRIT2_HUMAN	Y	327;337	ENSP00000361185:C327Y;ENSP00000438264:C337Y	ENSP00000361185:C327Y	C	-	2	0	LRIT2	85972329	1.000000	0.71417	0.782000	0.31804	0.651000	0.38670	5.801000	0.69115	1.277000	0.44412	0.557000	0.71058	TGC	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.532	LRIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRIT2	protein_coding	OTTHUMT00000049110.4	C	XM_291697	-		85982349	-1	no_errors	ENST00000538192	ensembl	human	known	74_37	missense	SNP	0.998	T
FAM87A	157693	genome.wustl.edu	37	8	328029	328029	+	lincRNA	SNP	A	A	G			TCGA-VT-A80J-02A-11D-A417-09	TCGA-VT-A80J-11A-22D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9f5f2b4-7057-4dbc-aa22-577a341c4045	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr8:328029A>G	ENST00000330148.2	-	0	2432					NR_103537.1		P0C7U9	FA87A_HUMAN	family with sequence similarity 87, member A							integral component of membrane (GO:0016021)											TTCTGGGAAAAAAAGACGGGG	0.463																																																	0								ENSG00000182366																																			FAM87A			0			-	HGNC	BC037297		8p23.3	2013-02-15				ENSG00000182366		"""Long non-coding RNAs"""	27233	non-coding RNA	RNA, long non-coding						12477932	Standard	NR_103537		Approved			P0C7U9			8.37:g.328029A>G		Somatic	0	46	0.00		0.6324490966295101	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	28	36.36		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000330148.2	37	NULL		8																																																																																			-	-		0.463	FAM87A-001	KNOWN	basic	lincRNA	FAM87A	lincRNA	OTTHUMT00000384563.2	A		-		328029	-1	no_errors	ENST00000330148	ensembl	human	known	74_37	rna	SNP	0.007	G
PIK3R4	30849	genome.wustl.edu	37	3	130425964	130425992	+	Splice_Site	DEL	TTTACATGTTTTCTGGCTATGAAAATATA	TTTACATGTTTTCTGGCTATGAAAATATA	-	rs185118493|rs2306686	byFrequency	TCGA-VT-A80J-02A-11D-A417-09	TCGA-VT-A80J-11A-22D-A36M-09	TTTACATGTTTTCTGGCTATGAAAATATA	TTTACATGTTTTCTGGCTATGAAAATATA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9f5f2b4-7057-4dbc-aa22-577a341c4045	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr3:130425964_130425992delTTTACATGTTTTCTGGCTATGAAAATATA	ENST00000356763.3	-	11	3091_3106	c.2534_2549delTATATTTTCATAGCCAGAAAACATGTAAA	c.(2533-2550)gtatattttcatagccag>gg	p.VYFHSQ845fs		NM_014602.2	NP_055417.1	Q99570	PI3R4_HUMAN	phosphoinositide-3-kinase, regulatory subunit 4	845					innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	axoneme (GO:0005930)|cytosol (GO:0005829)|late endosome (GO:0005770)|membrane (GO:0016020)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.R846R(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(6)|large_intestine(16)|lung(28)|ovary(6)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	77						TGAGTCTTGTTTTACATGTTTTCTGGCTATGAAAATATATTCAGAATAG	0.415																																																	1	Substitution - coding silent(1)	ovary(1)						ENSG00000196455																																			PIK3R4	SO:0001630	splice_region_variant	0				HGNC	Y08991	CCDS3067.1	3q22.1	2013-01-10	2008-02-04		ENSG00000196455	ENSG00000196455		"""WD repeat domain containing"""	8982	protein-coding gene	gene with protein product		602610				8999962	Standard	NM_014602		Approved	VPS15, p150	uc003enj.3	Q99570	OTTHUMG00000159645	ENST00000356763.3:c.2534-1TATATTTTCATAGCCAGAAAACATGTAAA>-	3.37:g.130425964_130425992delTTTACATGTTTTCTGGCTATGAAAATATA		Somatic	NA	NA	NA		0.6324490966295101	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q2TBF4	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_WD40_repeat,pfam_HEAT,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_WD40_repeat,pfscan_HEAT_type_2,pfscan_Prot_kinase_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.A845fs	ENST00000356763.3	37	c.2549_2534	CCDS3067.1	3																																																																																			-	NULL		0.415	PIK3R4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIK3R4	protein_coding	OTTHUMT00000356668.1	TTTACATGTTTTCTGGCTATGAAAATATA	NM_014602		Frame_Shift_Del	130425992	-1	no_errors	ENST00000356763	ensembl	human	known	74_37	frame_shift_del	DEL	1.000:0.999:0.900:0.998:0.998:0.993:1.000:1.000:1.000:1.000:1.000:0.997:1.000:0.993:0.958:0.997	-
AHNAK2	113146	genome.wustl.edu	37	14	105413459	105413459	+	Missense_Mutation	SNP	A	A	G	rs564635013	byFrequency	TCGA-VT-A80J-02A-11D-A417-09	TCGA-VT-A80J-11A-22D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9f5f2b4-7057-4dbc-aa22-577a341c4045	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr14:105413459A>G	ENST00000333244.5	-	7	8448	c.8329T>C	c.(8329-8331)Tcc>Ccc	p.S2777P	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	2777						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			TCCATGCTGGACAGAGACATC	0.622													.|||	4	0.000798722	0.0008	0.0014	5008	,	,		18641	0.002		0.0	False		,,,				2504	0.0																0								ENSG00000185567						130.0	144.0	140.0					14																	105413459		1865	4082	5947	AHNAK2	SO:0001583	missense	0			-	HGNC	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.8329T>C	14.37:g.105413459A>G	ENSP00000353114:p.Ser2777Pro	Somatic	0	97	0.00		0.6324490966295101	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	60	67	47.24	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.S2777P	ENST00000333244.5	37	c.8329	CCDS45177.1	14	.	.	.	.	.	.	.	.	.	.	a	7.528	0.658070	0.14645	.	.	ENSG00000185567	ENST00000333244	T	0.00569	6.52	3.54	2.58	0.30949	.	.	.	.	.	T	0.00109	0.0003	N	0.00007	-3.175	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.41645	-0.9497	9	0.15499	T	0.54	.	2.901	0.05706	0.1059:0.1771:0.5352:0.1818	.	2777	Q8IVF2	AHNK2_HUMAN	P	2777	ENSP00000353114:S2777P	ENSP00000353114:S2777P	S	-	1	0	AHNAK2	104484504	0.137000	0.22531	0.010000	0.14722	0.014000	0.08584	0.922000	0.28734	0.020000	0.15106	-0.665000	0.03846	TCC	-	NULL		0.622	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AHNAK2	protein_coding	OTTHUMT00000410300.1	A	NM_138420	-		105413459	-1	no_errors	ENST00000333244	ensembl	human	known	74_37	missense	SNP	0.466	G
ADCY8	114	genome.wustl.edu	37	8	132051899	132051899	+	Silent	SNP	G	G	A			TCGA-VT-A80J-02A-11D-A417-09	TCGA-VT-A80J-11A-22D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9f5f2b4-7057-4dbc-aa22-577a341c4045	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr8:132051899G>A	ENST00000286355.5	-	1	2773	c.681C>T	c.(679-681)tgC>tgT	p.C227C	ADCY8_ENST00000377928.3_Silent_p.C227C	NM_001115.2	NP_001106.1	P40145	ADCY8_HUMAN	adenylate cyclase 8 (brain)	227					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)	p.C227C(1)		NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(21)|lung(67)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(5)|urinary_tract(2)	134	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)			CCACCAGGGCGCAGATCACTA	0.627										HNSCC(32;0.087)																																							1	Substitution - coding silent(1)	large_intestine(1)						ENSG00000155897						61.0	58.0	59.0					8																	132051899		2203	4300	6503	ADCY8	SO:0001819	synonymous_variant	0			-	HGNC	Z35309	CCDS6363.1	8q24	2013-02-04			ENSG00000155897	ENSG00000155897	4.6.1.1	"""Adenylate cyclases"""	239	protein-coding gene	gene with protein product		103070		ADCY3		8076676	Standard	NM_001115		Approved	HBAC1, AC8	uc003ytd.4	P40145	OTTHUMG00000164756	ENST00000286355.5:c.681C>T	8.37:g.132051899G>A		Somatic	0	24	0.00		0.6324490966295101	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	10	54.55		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_A/G_cyclase,pfam_Adenylate_cyclase-like,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	p.C227	ENST00000286355.5	37	c.681	CCDS6363.1	8																																																																																			-	NULL		0.627	ADCY8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY8	protein_coding	OTTHUMT00000380080.1	G		-		132051899	-1	no_errors	ENST00000286355	ensembl	human	known	74_37	silent	SNP	0.998	A
TP53	7157	genome.wustl.edu	37	17	7578393	7578393	+	Missense_Mutation	SNP	A	A	C			TCGA-VT-A80J-02A-11D-A417-09	TCGA-VT-A80J-11A-22D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9f5f2b4-7057-4dbc-aa22-577a341c4045	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr17:7578393A>C	ENST00000269305.4	-	5	726	c.537T>G	c.(535-537)caT>caG	p.H179Q	TP53_ENST00000359597.4_Missense_Mutation_p.H179Q|TP53_ENST00000445888.2_Missense_Mutation_p.H179Q|TP53_ENST00000420246.2_Missense_Mutation_p.H179Q|TP53_ENST00000413465.2_Missense_Mutation_p.H179Q|TP53_ENST00000574684.1_5'UTR|TP53_ENST00000455263.2_Missense_Mutation_p.H179Q	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	179	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		H -> D (in sporadic cancers; somatic mutation).|H -> L (in sporadic cancers; somatic mutation).|H -> N (in sporadic cancers; somatic mutation).|H -> P (in sporadic cancers; somatic mutation).|H -> Q (in sporadic cancers; somatic mutation).|H -> R (in sporadic cancers; somatic mutation).|H -> Y (in LFS; germline mutation and in sporadic cancers; somatic mutation).|HH -> QS (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.H179Q(23)|p.P177_C182delPHHERC(8)|p.0?(8)|p.C176_R181delCPHHER(3)|p.R174fs*24(3)|p.H178_S183delHHERCS(3)|p.R175_E180delRCPHHE(3)|p.H179H(2)|p.P177fs*3(2)|p.V173fs*59(2)|p.H86Q(2)|p.H47Q(2)|p.C176fs*65(1)|p.P177_H179delPHH(1)|p.V173fs*23(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171_H179delEVVRRCPHH(1)|p.R81fs*24(1)|p.R174_E180>K(1)|p.H46_S51delHHERCS(1)|p.H178fs*6(1)|p.P177_E180delPHHE(1)|p.R42fs*24(1)|p.H85_S90delHHERCS(1)|p.R174fs*3(1)|p.E171fs*61(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AGCAGCGCTCATGGTGGGGGC	0.642		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	76	Substitution - Missense(27)|Deletion - In frame(24)|Deletion - Frameshift(14)|Whole gene deletion(8)|Substitution - coding silent(2)|Complex - deletion inframe(1)	large_intestine(18)|breast(10)|upper_aerodigestive_tract(8)|lung(7)|liver(7)|haematopoietic_and_lymphoid_tissue(5)|ovary(5)|bone(5)|central_nervous_system(4)|stomach(2)|oesophagus(2)|pancreas(2)|endometrium(1)						ENSG00000141510						47.0	47.0	47.0					17																	7578393		2203	4300	6503	TP53	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	-	HGNC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.537T>G	17.37:g.7578393A>C	ENSP00000269305:p.His179Gln	Somatic	0	39	0.00		0.6324490966295101	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	8	46.67	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.H179Q	ENST00000269305.4	37	c.537	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	A	22.2	4.252337	0.80135	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99909	-7.87;-7.87;-7.87;-7.87;-7.87;-7.87;-7.87;-7.87	5.47	-9.19	0.00685	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.048592	0.85682	N	0.000000	D	0.99878	0.9942	M	0.92507	3.315	0.58432	D	0.999998	D;D;D;D;D;D;D	0.89917	0.989;1.0;0.995;1.0;0.996;1.0;0.999	D;D;D;D;D;D;D	0.97110	0.952;0.997;0.939;1.0;0.985;0.995;0.971	D	0.99861	1.1083	10	0.87932	D	0	-15.4889	14.291	0.66278	0.2679:0.1015:0.6306:0.0	.	140;179;179;86;179;179;179	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	Q	179;179;179;179;179;179;168;86;47;86;47	ENSP00000410739:H179Q;ENSP00000352610:H179Q;ENSP00000269305:H179Q;ENSP00000398846:H179Q;ENSP00000391127:H179Q;ENSP00000391478:H179Q;ENSP00000425104:H47Q;ENSP00000423862:H86Q	ENSP00000269305:H179Q	H	-	3	2	TP53	7519118	0.081000	0.21417	0.351000	0.25721	0.844000	0.47949	-0.635000	0.05471	-2.028000	0.00931	-0.376000	0.06991	CAT	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor		0.642	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	A	NM_000546	-		7578393	-1	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	SNP	0.699	C
FAM210B	116151	genome.wustl.edu	37	20	54941148	54941148	+	Missense_Mutation	SNP	C	C	G			TCGA-VT-A80J-02A-11D-A417-09	TCGA-VT-A80J-11A-22D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9f5f2b4-7057-4dbc-aa22-577a341c4045	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr20:54941148C>G	ENST00000371384.3	+	3	475	c.384C>G	c.(382-384)atC>atG	p.I128M		NM_080821.2	NP_543011.2	Q96KR6	F210B_HUMAN	family with sequence similarity 210, member B	128	DUF1279.					integral component of membrane (GO:0016021)											TGCCTGCAATCCTGCTGAAAC	0.438																																																	0								ENSG00000124098						68.0	65.0	66.0					20																	54941148		2203	4300	6503	FAM210B	SO:0001583	missense	0			-	HGNC	AL121914	CCDS13450.1	20q13.2	2011-11-24	2011-11-24	2011-11-24	ENSG00000124098	ENSG00000124098			16102	protein-coding gene	gene with protein product	"""hypothetical protein LOC116151"""		"""chromosome 20 open reading frame 108"""	C20orf108		11780052	Standard	NM_080821		Approved	dJ1167H4.1, DKFZP434A1114	uc002xxc.3	Q96KR6	OTTHUMG00000032793	ENST00000371384.3:c.384C>G	20.37:g.54941148C>G	ENSP00000360437:p.Ile128Met	Somatic	0	21	0.00		0.6324490966295101	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	30	26.83	B2RBQ9|E1P5Y7|Q8WVN2|Q9BYL6|Q9H418	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF1279	p.I128M	ENST00000371384.3	37	c.384	CCDS13450.1	20	.	.	.	.	.	.	.	.	.	.	C	14.04	2.418104	0.42918	.	.	ENSG00000124098	ENST00000371384	T	0.30448	1.53	5.56	3.42	0.39159	Domain of unknown function DUF1279 (1);	1.110600	0.06535	N	0.742233	T	0.42517	0.1206	L	0.56769	1.78	0.25085	N	0.990897	B	0.30526	0.283	B	0.43445	0.42	T	0.47433	-0.9118	10	0.54805	T	0.06	-9.2788	8.7326	0.34507	0.0:0.7011:0.0:0.2989	.	128	Q96KR6	CT108_HUMAN	M	128	ENSP00000360437:I128M	ENSP00000360437:I128M	I	+	3	3	C20orf108	54374555	0.983000	0.35010	0.986000	0.45419	0.711000	0.40976	0.058000	0.14301	1.334000	0.45468	0.650000	0.86243	ATC	-	pfam_DUF1279		0.438	FAM210B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM210B	protein_coding	OTTHUMT00000079800.2	C	NM_080821	-		54941148	+1	no_errors	ENST00000371384	ensembl	human	known	74_37	missense	SNP	0.995	G
ESPN	83715	genome.wustl.edu	37	1	6500348	6500348	+	Missense_Mutation	SNP	C	C	T			TCGA-VT-A80J-02A-11D-A417-09	TCGA-VT-A80J-11A-22D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d9f5f2b4-7057-4dbc-aa22-577a341c4045	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr1:6500348C>T	ENST00000377828.1	+	3	691	c.523C>T	c.(523-525)Ccc>Tcc	p.P175S	RP1-202O8.2_ENST00000419034.1_RNA	NM_031475.2	NP_113663.2	B1AK53	ESPN_HUMAN	espin	175					locomotory behavior (GO:0007626)|negative regulation of cytoskeleton organization (GO:0051494)|parallel actin filament bundle assembly (GO:0030046)|positive regulation of filopodium assembly (GO:0051491)|sensory perception of sound (GO:0007605)	brush border (GO:0005903)|cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|microvillus (GO:0005902)|stereocilium bundle tip (GO:0032426)	actin filament binding (GO:0051015)|SH3 domain binding (GO:0017124)			NS(1)|breast(2)|cervix(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|skin(1)	17	Ovarian(185;0.0386)|all_lung(157;0.154)	all_cancers(23;3.6e-37)|all_epithelial(116;2.56e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|all_hematologic(16;6.92e-06)|Colorectal(325;4.47e-05)|Acute lymphoblastic leukemia(12;4.92e-05)|Breast(487;7.61e-05)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0392)		Epithelial(90;1.82e-35)|GBM - Glioblastoma multiforme(13;3e-28)|Kidney(185;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(229;5.63e-08)|Colorectal(212;7e-08)|COAD - Colon adenocarcinoma(227;1.41e-05)|BRCA - Breast invasive adenocarcinoma(365;0.000109)|STAD - Stomach adenocarcinoma(132;0.00167)|Lung(427;0.0108)|LUSC - Lung squamous cell carcinoma(448;0.0253)|READ - Rectum adenocarcinoma(331;0.0419)		CGGTGCCACGCCCCTGTACCT	0.687																																																	0								ENSG00000187017						9.0	9.0	9.0					1																	6500348		2139	4190	6329	ESPN	SO:0001583	missense	0			-	HGNC	AF134401	CCDS70.1	1p36.31	2013-01-10			ENSG00000187017	ENSG00000187017		"""Ankyrin repeat domain containing"""	13281	protein-coding gene	gene with protein product		606351	"""deafness, autosomal recessive 36"""	DFNB36		10975527, 15286153	Standard	NM_031475		Approved		uc001amy.3	B1AK53	OTTHUMG00000000753	ENST00000377828.1:c.523C>T	1.37:g.6500348C>T	ENSP00000367059:p.Pro175Ser	Somatic	0	60	0.00		0.6324490966295101	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.16	Q6XYB2|Q9H0A2|Q9Y329	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_WH2_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_WH2_dom	p.P175S	ENST00000377828.1	37	c.523	CCDS70.1	1	.	.	.	.	.	.	.	.	.	.	c	29.7	5.026360	0.93518	.	.	ENSG00000187017	ENST00000377828	T	0.70986	-0.53	3.85	3.85	0.44370	Ankyrin repeat-containing domain (4);	0.084183	0.48767	D	0.000177	T	0.79563	0.4467	M	0.67517	2.055	0.80722	D	1	D	0.54397	0.966	P	0.58820	0.846	T	0.82627	-0.0364	10	0.66056	D	0.02	-20.4124	14.7074	0.69200	0.0:1.0:0.0:0.0	.	175	B1AK53	ESPN_HUMAN	S	175	ENSP00000367059:P175S	ENSP00000367059:P175S	P	+	1	0	ESPN	6422935	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.795000	0.69074	2.031000	0.59945	0.466000	0.42574	CCC	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom		0.687	ESPN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ESPN	protein_coding	OTTHUMT00000001887.3	C	NM_031475	-		6500348	+1	no_errors	ENST00000377828	ensembl	human	known	74_37	missense	SNP	1.000	T
