#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
TNPO1	3842	genome.wustl.edu	37	5	72112474	72112474	+	5'UTR	SNP	C	C	A			TCGA-VT-AB3D-01A-12D-A417-09	TCGA-VT-AB3D-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51932322-cd96-4c1b-a8ba-660637fff36b	c94fc63b-bf20-4585-9319-5f35435795df	g.chr5:72112474C>A	ENST00000337273.5	+	0	336				TNPO1_ENST00000454282.1_5'UTR|TNPO1_ENST00000447967.2_5'Flank|CTD-2631K10.1_ENST00000507957.1_RNA|TNPO1_ENST00000523768.1_5'Flank	NM_002270.3	NP_002261.3	Q92973	TNPO1_HUMAN	transportin 1						gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|protein import into nucleus, translocation (GO:0000060)|RNA metabolic process (GO:0016070)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	nuclear localization sequence binding (GO:0008139)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(10)|lung(6)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	36		Lung NSC(167;0.0053)|Ovarian(174;0.0175)		OV - Ovarian serous cystadenocarcinoma(47;6.14e-54)		CTCGGTGAAGCCCAGATTCTC	0.701																																																	0								ENSG00000083312						7.0	14.0	12.0					5																	72112474		683	1581	2264	TNPO1	SO:0001623	5_prime_UTR_variant	0			-	HGNC	U70322	CCDS4016.1, CCDS43329.1	5q13.1	2009-01-12	2004-01-29	2004-01-30	ENSG00000083312	ENSG00000083312		"""Importins"""	6401	protein-coding gene	gene with protein product	"""importin 2"""	602901	"""karyopherin (importin) beta 2"""	KPNB2		8808633, 9144189	Standard	NM_153188		Approved	MIP, TRN, IPO2, MIP1	uc003kci.4	Q92973	OTTHUMG00000100967	ENST00000337273.5:c.-91C>A	5.37:g.72112474C>A		Somatic	0	56	0.00		0.5117654914895859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	25	13.79	B4DVC6|Q92957|Q92975	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000337273.5	37	NULL	CCDS43329.1	5																																																																																			-	-		0.701	TNPO1-001	KNOWN	basic|CCDS	protein_coding	TNPO1	protein_coding	OTTHUMT00000218577.3	C	NM_002270	-		72112474	+1	no_errors	ENST00000515483	ensembl	human	known	74_37	rna	SNP	0.991	A
CACNA1I	8911	genome.wustl.edu	37	22	40055726	40055726	+	Missense_Mutation	SNP	G	G	A	rs199827082		TCGA-VT-AB3D-01A-12D-A417-09	TCGA-VT-AB3D-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51932322-cd96-4c1b-a8ba-660637fff36b	c94fc63b-bf20-4585-9319-5f35435795df	g.chr22:40055726G>A	ENST00000402142.3	+	14	2473	c.2473G>A	c.(2473-2475)Gtc>Atc	p.V825I	CACNA1I_ENST00000400164.3_Missense_Mutation_p.V790I|CACNA1I_ENST00000404898.1_Missense_Mutation_p.V790I|CACNA1I_ENST00000336649.4_Missense_Mutation_p.V831I|CACNA1I_ENST00000401624.1_Missense_Mutation_p.V825I|CACNA1I_ENST00000407673.1_Missense_Mutation_p.V790I	NM_021096.3	NP_066919.2	Q9P0X4	CAC1I_HUMAN	calcium channel, voltage-dependent, T type, alpha 1I subunit	825					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|signal transduction (GO:0007165)|sleep (GO:0030431)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|liver(2)|lung(27)|ovary(1)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	60	Melanoma(58;0.0749)				Cinnarizine(DB00568)|Flunarizine(DB04841)|Paramethadione(DB00617)|Spironolactone(DB00421)|Verapamil(DB00661)|Zonisamide(DB00909)	GGACTGGAACGTCGTTCTCTA	0.572																																																	0								ENSG00000100346	G	ILE/VAL,ILE/VAL	0,4154		0,0,2077	139.0	142.0	141.0		2368,2473	2.4	1.0	22		141	2,8380		0,2,4189	yes	missense,missense	CACNA1I	NM_001003406.1,NM_021096.3	29,29	0,2,6266	AA,AG,GG		0.0239,0.0,0.016	benign,benign	790/2189,825/2224	40055726	2,12534	2077	4191	6268	CACNA1I	SO:0001583	missense	0			-	HGNC	AF129133	CCDS46710.1, CCDS46711.1	22q13.1	2012-03-07	2007-02-16		ENSG00000100346	ENSG00000100346		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1396	protein-coding gene	gene with protein product		608230				10454147, 16382099	Standard	NM_021096		Approved	Cav3.3	uc003ayd.3	Q9P0X4	OTTHUMG00000151096	ENST00000402142.3:c.2473G>A	22.37:g.40055726G>A	ENSP00000385019:p.Val825Ile	Somatic	0	40	0.00		0.5117654914895859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	35	35.19	B0QY12|B0QY13|B0QY14|O95504|Q5JZ88|Q7Z6S9|Q8NFX6|Q9NZC8|Q9UH15|Q9UH30|Q9ULU9|Q9UNE6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_PKD1_2_channel,prints_VDCC_T_a1su,prints_VDCCAlpha1	p.V831I	ENST00000402142.3	37	c.2491	CCDS46710.1	22	.	.	.	.	.	.	.	.	.	.	G	14.53	2.562026	0.45590	0.0	2.39E-4	ENSG00000100346	ENST00000402142;ENST00000404898;ENST00000401624;ENST00000407673;ENST00000336649;ENST00000400164	D;D;D;D;D;D	0.97378	-4.36;-4.36;-4.36;-4.36;-4.36;-4.36	4.67	2.43	0.29744	Ion transport (1);	0.266978	0.37623	N	0.002004	D	0.93318	0.7870	L	0.42686	1.345	0.33981	D	0.648016	P;P;P;P	0.48589	0.827;0.854;0.912;0.909	B;B;B;B	0.41135	0.169;0.239;0.239;0.348	D	0.93069	0.6481	10	0.26408	T	0.33	.	10.1303	0.42674	0.08:0.1405:0.7796:0.0	.	790;825;790;825	Q9P0X4-3;Q9P0X4-2;Q9P0X4-4;Q9P0X4	.;.;.;CAC1I_HUMAN	I	825;790;825;790;831;790	ENSP00000385019:V825I;ENSP00000384093:V790I;ENSP00000383887:V825I;ENSP00000385680:V790I;ENSP00000337829:V831I;ENSP00000383028:V790I	ENSP00000337829:V831I	V	+	1	0	CACNA1I	38385672	0.996000	0.38824	1.000000	0.80357	0.935000	0.57460	2.193000	0.42658	2.284000	0.76573	0.655000	0.94253	GTC	-	pfam_Ion_trans_dom,prints_VDCCAlpha1		0.572	CACNA1I-001	KNOWN	basic|CCDS	protein_coding	CACNA1I	protein_coding	OTTHUMT00000321290.1	G	NM_001003406	rs199827082		40055726	+1	no_errors	ENST00000336649	ensembl	human	known	74_37	missense	SNP	1.000	A
ZZZ3	26009	genome.wustl.edu	37	1	78098138	78098138	+	Missense_Mutation	SNP	G	G	T			TCGA-VT-AB3D-01A-12D-A417-09	TCGA-VT-AB3D-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51932322-cd96-4c1b-a8ba-660637fff36b	c94fc63b-bf20-4585-9319-5f35435795df	g.chr1:78098138G>T	ENST00000370801.3	-	5	1377	c.902C>A	c.(901-903)aCa>aAa	p.T301K	ZZZ3_ENST00000370798.1_Intron|ZZZ3_ENST00000476275.1_5'UTR	NM_015534.4	NP_056349.1	Q8IYH5	ZZZ3_HUMAN	zinc finger, ZZ-type containing 3	301					chromatin organization (GO:0006325)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|prostate(1)|stomach(1)|urinary_tract(2)	39						AAAGGGCCCTGTAGCTGGCTC	0.463																																																	0								ENSG00000036549						106.0	102.0	103.0					1																	78098138		2203	4300	6503	ZZZ3	SO:0001583	missense	0			-	HGNC	AL080063	CCDS677.1	1p31.1	2012-08-13			ENSG00000036549	ENSG00000036549		"""Zinc fingers, ZZ-type"""	24523	protein-coding gene	gene with protein product	"""ATAC component 1 homolog (Drosophila)"""					16428443, 21304275	Standard	NM_015534		Approved	DKFZP564I052, ATAC1	uc001dhq.3	Q8IYH5	OTTHUMG00000009652	ENST00000370801.3:c.902C>A	1.37:g.78098138G>T	ENSP00000359837:p.Thr301Lys	Somatic	0	39	0.00		0.5117654914895859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	41	8.89	B7WPC6|Q6N004|Q6N070|Q8IYP0|Q8IYR1|Q8TEK4|Q9Y4U0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SANT/Myb,pfam_Znf_ZZ,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Znf_ZZ,pfscan_Myb-like_dom	p.T301K	ENST00000370801.3	37	c.902	CCDS677.1	1	.	.	.	.	.	.	.	.	.	.	G	2.665	-0.278885	0.05642	.	.	ENSG00000036549	ENST00000370801	.	.	.	5.49	2.44	0.29823	.	1.115670	0.06530	N	0.741189	T	0.27419	0.0673	L	0.36672	1.1	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.001	T	0.18493	-1.0335	8	.	.	.	.	9.4823	0.38908	0.0669:0.0:0.6775:0.2556	.	301;301;301	Q8IYH5-4;Q8IYH5;Q8IYH5-2	.;ZZZ3_HUMAN;.	K	301	.	.	T	-	2	0	ZZZ3	77870726	0.961000	0.32948	0.220000	0.23810	0.037000	0.13140	2.593000	0.46180	0.312000	0.23038	-0.157000	0.13467	ACA	-	NULL		0.463	ZZZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZZZ3	protein_coding	OTTHUMT00000026615.1	G	NM_015534	-		78098138	-1	no_errors	ENST00000370801	ensembl	human	known	74_37	missense	SNP	0.740	T
ATRX	546	genome.wustl.edu	37	X	76939697	76939697	+	Nonsense_Mutation	SNP	C	C	A			TCGA-VT-AB3D-01A-12D-A417-09	TCGA-VT-AB3D-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51932322-cd96-4c1b-a8ba-660637fff36b	c94fc63b-bf20-4585-9319-5f35435795df	g.chrX:76939697C>A	ENST00000373344.5	-	9	1265	c.1051G>T	c.(1051-1053)Gag>Tag	p.E351*	ATRX_ENST00000480283.1_5'UTR|ATRX_ENST00000395603.3_Nonsense_Mutation_p.E313*	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked	351					ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.?(1)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						TTAATCATCTCTTTGGGCACA	0.353			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome																																	Rec	yes		X	Xq21.1	546	alpha thalassemia/mental retardation syndrome X-linked	yes	E	1	Unknown(1)	bone(1)						ENSG00000085224						81.0	78.0	79.0					X																	76939697		2203	4296	6499	ATRX	SO:0001587	stop_gained	0			-	HGNC	U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.1051G>T	X.37:g.76939697C>A	ENSP00000362441:p.Glu351*	Somatic	0	18	0.00		0.5117654914895859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	14	22.22	D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SNF2_N,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_Znf_FYVE_PHD,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.E351*	ENST00000373344.5	37	c.1051	CCDS14434.1	X	.	.	.	.	.	.	.	.	.	.	c	38	6.875248	0.97904	.	.	ENSG00000085224	ENST00000373344;ENST00000395603;ENST00000400862	.	.	.	5.3	4.44	0.53790	.	0.196705	0.43579	D	0.000553	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	-1.1203	13.1753	0.59624	0.0:0.9208:0.0:0.0792	.	.	.	.	X	351;313;307	.	ENSP00000362441:E351X	E	-	1	0	ATRX	76826353	1.000000	0.71417	0.997000	0.53966	0.972000	0.66771	7.481000	0.81124	1.014000	0.39417	0.502000	0.49764	GAG	-	NULL		0.353	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATRX	protein_coding	OTTHUMT00000058860.2	C	NM_000489	-		76939697	-1	no_errors	ENST00000373344	ensembl	human	known	74_37	nonsense	SNP	1.000	A
ZNF702P	79986	genome.wustl.edu	37	19	53513293	53513293	+	lincRNA	SNP	A	A	C			TCGA-VT-AB3D-01A-12D-A417-09	TCGA-VT-AB3D-10A-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51932322-cd96-4c1b-a8ba-660637fff36b	c94fc63b-bf20-4585-9319-5f35435795df	g.chr19:53513293A>C	ENST00000596769.1	+	0	920																											ggatgtcgccatcctcctagg	0.507																																																	0								ENSG00000267943																																			CTD-2620I22.3			0			-	Clone_based_vega_gene																													19.37:g.53513293A>C		Somatic	0	20	0.00		0.5117654914895859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	16	36.00		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000596769.1	37	NULL		19																																																																																			-	-		0.507	CTD-2620I22.3-001	KNOWN	basic	lincRNA	ENSG00000267943	lincRNA	OTTHUMT00000463993.1	A		-		53513293	+1	no_errors	ENST00000596769	ensembl	human	known	74_37	rna	SNP	0.124	C
A2M	2	genome.wustl.edu	37	12	9248236	9248236	+	Missense_Mutation	SNP	C	C	T			TCGA-VT-AB3D-01A-12D-A417-09	TCGA-VT-AB3D-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51932322-cd96-4c1b-a8ba-660637fff36b	c94fc63b-bf20-4585-9319-5f35435795df	g.chr12:9248236C>T	ENST00000318602.7	-	16	2219	c.1912G>A	c.(1912-1914)Gac>Aac	p.D638N		NM_000014.4	NP_000005	P01023	A2MG_HUMAN	alpha-2-macroglobulin	638					blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of complement activation, lectin pathway (GO:0001869)|negative regulation of endopeptidase activity (GO:0010951)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|stem cell differentiation (GO:0048863)	blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule lumen (GO:0031093)	calcium-dependent protein binding (GO:0048306)|enzyme binding (GO:0019899)|growth factor binding (GO:0019838)|interleukin-1 binding (GO:0019966)|interleukin-8 binding (GO:0019959)|protease binding (GO:0002020)|receptor binding (GO:0005102)|serine-type endopeptidase inhibitor activity (GO:0004867)|tumor necrosis factor binding (GO:0043120)			breast(1)|central_nervous_system(6)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(17)|lung(30)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	77					Bacitracin(DB00626)|Becaplermin(DB00102)|Ocriplasmin(DB08888)	TCTTCATTGTCCTGGTCATTC	0.388																																																	0								ENSG00000175899						107.0	104.0	105.0					12																	9248236		1864	4099	5963	A2M	SO:0001583	missense	0			-	HGNC	BX647329, X68728, M11313	CCDS44827.1	12p13.31	2010-02-24			ENSG00000175899	ENSG00000175899			7	protein-coding gene	gene with protein product		103950					Standard	XM_006719056		Approved	FWP007, S863-7, CPAMD5	uc001qvk.1	P01023	OTTHUMG00000150267	ENST00000318602.7:c.1912G>A	12.37:g.9248236C>T	ENSP00000323929:p.Asp638Asn	Somatic	0	84	0.00		0.5117654914895859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	72	10.00	Q13677|Q59F47|Q5QTS0|Q68DN2|Q6PIY3|Q6PN97	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_A2M_comp,pfam_A2M_N_2,pfam_Macroglobln_a2,pfam_A-macroglobulin_rcpt-bd,pfam_A2M_N,pfam_MacrogloblnA2_thiol-ester-bond,superfamily_Terpenoid_cyclase/PrenylTrfase,superfamily_A-macroglobulin_rcpt-bd,superfamily_Beta-lactam/transpept-like,superfamily_Cupredoxin	p.D638N	ENST00000318602.7	37	c.1912	CCDS44827.1	12	.	.	.	.	.	.	.	.	.	.	C	14.28	2.488561	0.44249	.	.	ENSG00000175899	ENST00000318602;ENST00000540099	T	0.31510	1.49	5.65	4.76	0.60689	.	1.132090	0.06462	N	0.729636	T	0.34164	0.0888	L	0.46741	1.465	0.09310	N	1	B	0.17268	0.021	B	0.20384	0.029	T	0.32508	-0.9904	10	0.41790	T	0.15	.	13.924	0.63950	0.0:0.9257:0.0:0.0743	.	638	P01023	A2MG_HUMAN	N	638;653	ENSP00000323929:D638N	ENSP00000323929:D638N	D	-	1	0	A2M	9139503	0.000000	0.05858	0.005000	0.12908	0.009000	0.06853	-0.248000	0.08854	1.527000	0.49086	0.650000	0.86243	GAC	-	NULL		0.388	A2M-001	KNOWN	basic|appris_principal|CCDS	protein_coding	A2M	protein_coding	OTTHUMT00000317233.2	C	NM_000014	-		9248236	-1	no_errors	ENST00000318602	ensembl	human	known	74_37	missense	SNP	0.020	T
SATB2	23314	genome.wustl.edu	37	2	200245158	200245158	+	Missense_Mutation	SNP	G	G	A			TCGA-VT-AB3D-01A-12D-A417-09	TCGA-VT-AB3D-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51932322-cd96-4c1b-a8ba-660637fff36b	c94fc63b-bf20-4585-9319-5f35435795df	g.chr2:200245158G>A	ENST00000417098.1	-	5	1342	c.526C>T	c.(526-528)Cgc>Tgc	p.R176C	SATB2_ENST00000484124.1_5'UTR|SATB2_ENST00000443023.1_Missense_Mutation_p.R117C|SATB2_ENST00000428695.1_Intron|SATB2_ENST00000260926.5_Missense_Mutation_p.R176C|SATB2_ENST00000457245.1_Missense_Mutation_p.R176C	NM_001172509.1	NP_001165980.1	Q9UPW6	SATB2_HUMAN	SATB homeobox 2	176					cartilage development (GO:0051216)|cellular response to organic substance (GO:0071310)|chromatin remodeling (GO:0006338)|embryonic pattern specification (GO:0009880)|embryonic skeletal system morphogenesis (GO:0048704)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|osteoblast development (GO:0002076)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(40)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						AAGGCATTGCGGACTGTGGCA	0.488																																					Colon(30;262 767 11040 24421 36230)												0								ENSG00000119042						137.0	116.0	123.0					2																	200245158		2203	4300	6503	SATB2	SO:0001583	missense	0			-	HGNC	AB028957	CCDS2327.1	2q33.1	2011-06-20	2007-02-15		ENSG00000119042	ENSG00000119042		"""Homeoboxes / CUT class"""	21637	protein-coding gene	gene with protein product		608148	"""SATB family member 2"""				Standard	NM_015265		Approved	KIAA1034, FLJ21474	uc002uva.2	Q9UPW6	OTTHUMG00000132767	ENST00000417098.1:c.526C>T	2.37:g.200245158G>A	ENSP00000401112:p.Arg176Cys	Somatic	0	58	0.00		0.5117654914895859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	65	13.33	A8K5Z8|Q3ZB87|Q4V763	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Hmoeo_CUT,pfam_Homeobox_dom,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Hmoeo_CUT	p.R176C	ENST00000417098.1	37	c.526	CCDS2327.1	2	.	.	.	.	.	.	.	.	.	.	G	23.4	4.408917	0.83340	.	.	ENSG00000119042	ENST00000417098;ENST00000443023;ENST00000260926;ENST00000457245	T;T;T;T	0.78364	-1.17;-1.17;-1.17;-1.17	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	D	0.86826	0.6026	L	0.58101	1.795	0.80722	D	1	D	0.89917	1.0	D	0.75020	0.985	D	0.87279	0.2291	10	0.87932	D	0	-15.7143	19.7691	0.96356	0.0:0.0:1.0:0.0	.	176	Q9UPW6	SATB2_HUMAN	C	176;117;176;176	ENSP00000401112:R176C;ENSP00000388764:R117C;ENSP00000260926:R176C;ENSP00000405420:R176C	ENSP00000260926:R176C	R	-	1	0	SATB2	199953403	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.152000	0.64882	2.689000	0.91719	0.462000	0.41574	CGC	-	superfamily_Lambda_DNA-bd_dom		0.488	SATB2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SATB2	protein_coding	OTTHUMT00000256140.1	G	NM_015265	-		200245158	-1	no_errors	ENST00000260926	ensembl	human	known	74_37	missense	SNP	1.000	A
RAD54L2	23132	genome.wustl.edu	37	3	51624506	51624508	+	In_Frame_Del	DEL	GAG	GAG	-			TCGA-VT-AB3D-01A-12D-A417-09	TCGA-VT-AB3D-10A-01D-A41A-09	GAG	GAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51932322-cd96-4c1b-a8ba-660637fff36b	c94fc63b-bf20-4585-9319-5f35435795df	g.chr3:51624506_51624508delGAG	ENST00000409535.2	+	2	195_197	c.70_72delGAG	c.(70-72)gagdel	p.E30del		NM_015106.2	NP_055921.2	Q9Y4B4	ARIP4_HUMAN	RAD54-like 2 (S. cerevisiae)	30						nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|transcription cofactor activity (GO:0003712)			NS(2)|breast(1)|cervix(2)|endometrium(4)|large_intestine(5)|liver(2)|lung(9)|ovary(4)|skin(2)	31				BRCA - Breast invasive adenocarcinoma(193;0.000102)|Kidney(197;0.000758)|KIRC - Kidney renal clear cell carcinoma(197;0.000896)		ggatgcggaagaggaggaggagg	0.586																																																	0								ENSG00000164080																																			RAD54L2	SO:0001651	inframe_deletion	0				HGNC	AB018352	CCDS33765.2	3p21.2	2006-01-17			ENSG00000164080	ENSG00000164080			29123	protein-coding gene	gene with protein product						9872452	Standard	NM_015106		Approved	KIAA0809, SRISNF2L	uc011bdt.2	Q9Y4B4	OTTHUMG00000152936	ENST00000409535.2:c.70_72delGAG	3.37:g.51624515_51624517delGAG	ENSP00000386520:p.Glu30del	Somatic	0	28	0.00		0.5117654914895859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	28	15.15	Q8TB57|Q9BV54	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_SNF2_N,pfam_Helicase_C,pfam_Helicase/UvrB_dom,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.E27in_frame_del	ENST00000409535.2	37	c.70_72	CCDS33765.2	3																																																																																			-	NULL		0.586	RAD54L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAD54L2	protein_coding	OTTHUMT00000328700.2	GAG	NM_015106			51624508	+1	no_errors	ENST00000409535	ensembl	human	known	74_37	in_frame_del	DEL	1.000:1.000:1.000	-
INPP4B	8821	genome.wustl.edu	37	4	143159017	143159017	+	Splice_Site	SNP	C	C	A			TCGA-VT-AB3D-01A-12D-A417-09	TCGA-VT-AB3D-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51932322-cd96-4c1b-a8ba-660637fff36b	c94fc63b-bf20-4585-9319-5f35435795df	g.chr4:143159017C>A	ENST00000513000.1	-	13	1269	c.836G>T	c.(835-837)aGa>aTa	p.R279I	INPP4B_ENST00000508116.1_Splice_Site_p.R279I|INPP4B_ENST00000509777.1_Splice_Site_p.R279I|INPP4B_ENST00000308502.4_Splice_Site_p.R279I|INPP4B_ENST00000262992.4_Splice_Site_p.R279I	NM_003866.2	NP_003857.2	O15327	INP4B_HUMAN	inositol polyphosphate-4-phosphatase, type II, 105kDa	279					cellular calcium ion homeostasis (GO:0006874)|inositol phosphate metabolic process (GO:0043647)|negative regulation of osteoclast differentiation (GO:0045671)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|regulation of bone remodeling (GO:0046850)|regulation of nucleocytoplasmic transport (GO:0046822)|regulation of protein kinase B signaling (GO:0051896)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)	lipid binding (GO:0008289)|phosphatidylinositol trisphosphate phosphatase activity (GO:0034594)|phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity (GO:0016316)|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity (GO:0034597)			breast(3)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(8)|lung(29)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	58	all_hematologic(180;0.158)					TTTCTCTTACCTGCACAAATC	0.274																																																	0								ENSG00000109452						33.0	33.0	33.0					4																	143159017		2202	4297	6499	INPP4B	SO:0001630	splice_region_variant	0			-	HGNC	U96922	CCDS3757.1	4q31.1	2008-02-05	2002-08-29			ENSG00000109452			6075	protein-coding gene	gene with protein product		607494	"""inositol polyphosphate-4-phosphatase, type II, 105kD"""			9295334	Standard	NM_003866		Approved		uc003iiw.4	O15327		ENST00000513000.1:c.836+1G>T	4.37:g.143159017C>A		Somatic	0	109	0.00		0.5117654914895859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	111	11.90	Q2TAI2|Q5XLE7|Q6IN59|Q6PJB4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_C2_dom	p.R279I	ENST00000513000.1	37	c.836	CCDS3757.1	4	.	.	.	.	.	.	.	.	.	.	C	32	5.177452	0.94846	.	.	ENSG00000109452	ENST00000513000;ENST00000262992;ENST00000308502;ENST00000543161;ENST00000508116;ENST00000509777;ENST00000511838;ENST00000542702;ENST00000510812;ENST00000514525	T;T;T;T;T;T;T;T	0.37058	1.22;1.22;1.22;1.22;1.22;1.22;1.22;1.22	5.39	5.39	0.77823	.	0.047083	0.85682	D	0.000000	T	0.61677	0.2366	M	0.72894	2.215	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.91635	0.996;0.999	T	0.59936	-0.7360	9	.	.	.	.	19.52	0.95182	0.0:1.0:0.0:0.0	.	150;279	B7Z6T2;O15327	.;INP4B_HUMAN	I	279;279;279;150;279;279;94;94;279;150	ENSP00000425487:R279I;ENSP00000262992:R279I;ENSP00000308441:R279I;ENSP00000423954:R279I;ENSP00000422793:R279I;ENSP00000426207:R94I;ENSP00000427250:R279I;ENSP00000421065:R150I	.	R	-	2	0	INPP4B	143378467	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	7.251000	0.78297	2.671000	0.90904	0.591000	0.81541	AGA	-	NULL		0.274	INPP4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INPP4B	protein_coding	OTTHUMT00000364587.1	C	NM_003866	-	Missense_Mutation	143159017	-1	no_errors	ENST00000509777	ensembl	human	known	74_37	missense	SNP	1.000	A
OR5P2	120065	genome.wustl.edu	37	11	7817740	7817740	+	Silent	SNP	G	G	T			TCGA-VT-AB3D-01A-12D-A417-09	TCGA-VT-AB3D-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51932322-cd96-4c1b-a8ba-660637fff36b	c94fc63b-bf20-4585-9319-5f35435795df	g.chr11:7817740G>T	ENST00000329434.2	-	1	780	c.750C>A	c.(748-750)acC>acA	p.T250T	RP11-35J10.5_ENST00000527565.1_lincRNA	NM_153444.1	NP_703145.1	Q8WZ92	OR5P2_HUMAN	olfactory receptor, family 5, subfamily P, member 2	250						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(4)	22				Epithelial(150;8.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		TGAAGGTAATGGTCCCATAGA	0.507																																																	0								ENSG00000183303						125.0	127.0	126.0					11																	7817740		2110	4292	6402	OR5P2	SO:0001819	synonymous_variant	0			-	HGNC	AF173006	CCDS7782.1	11p15.4	2012-08-09			ENSG00000183303	ENSG00000183303		"""GPCR / Class A : Olfactory receptors"""	14783	protein-coding gene	gene with protein product							Standard	NM_153444		Approved	JCG3	uc001mfp.1	Q8WZ92	OTTHUMG00000165668	ENST00000329434.2:c.750C>A	11.37:g.7817740G>T		Somatic	0	43	0.00		0.5117654914895859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	30	16.67	Q3MIS8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.T250	ENST00000329434.2	37	c.750	CCDS7782.1	11																																																																																			-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM		0.507	OR5P2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5P2	protein_coding	OTTHUMT00000385696.1	G	NM_153444	-		7817740	-1	no_errors	ENST00000329434	ensembl	human	known	74_37	silent	SNP	0.004	T
KIAA1614	57710	genome.wustl.edu	37	1	180905484	180905484	+	Silent	SNP	G	G	A			TCGA-VT-AB3D-01A-12D-A417-09	TCGA-VT-AB3D-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51932322-cd96-4c1b-a8ba-660637fff36b	c94fc63b-bf20-4585-9319-5f35435795df	g.chr1:180905484G>A	ENST00000367588.4	+	5	2494	c.2439G>A	c.(2437-2439)tcG>tcA	p.S813S	KIAA1614_ENST00000367587.1_Silent_p.S434S	NM_020950.1	NP_066001.1	Q5VZ46	K1614_HUMAN	KIAA1614	813										NS(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(12)|ovary(5)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	33						CTCCCCCTTCGAGGAAAACCA	0.632																																																	0								ENSG00000135835						47.0	51.0	50.0					1																	180905484		1964	4137	6101	KIAA1614	SO:0001819	synonymous_variant	0			-	HGNC	AB046834	CCDS41442.1	1q25.3	2008-02-05			ENSG00000135835	ENSG00000135835			29327	protein-coding gene	gene with protein product							Standard	NM_020950		Approved		uc001gok.2	Q5VZ46	OTTHUMG00000035183	ENST00000367588.4:c.2439G>A	1.37:g.180905484G>A		Somatic	0	32	0.00		0.5117654914895859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.16	Q5VZ45|Q9HCF8	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.S813	ENST00000367588.4	37	c.2439	CCDS41442.1	1																																																																																			-	NULL		0.632	KIAA1614-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA1614	protein_coding	OTTHUMT00000085151.1	G	XM_046531	-		180905484	+1	no_errors	ENST00000367588	ensembl	human	known	74_37	silent	SNP	0.000	A
RAE1	8480	genome.wustl.edu	37	20	55949675	55949675	+	Missense_Mutation	SNP	G	G	A			TCGA-VT-AB3D-01A-12D-A417-09	TCGA-VT-AB3D-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51932322-cd96-4c1b-a8ba-660637fff36b	c94fc63b-bf20-4585-9319-5f35435795df	g.chr20:55949675G>A	ENST00000395841.2	+	11	1258	c.838G>A	c.(838-840)Gcg>Acg	p.A280T	RAE1_ENST00000371242.2_Missense_Mutation_p.A280T|RAE1_ENST00000527947.1_Missense_Mutation_p.A280T|RAE1_ENST00000395840.2_Missense_Mutation_p.A280T	NM_003610.3	NP_003601.1	P78406	RAE1L_HUMAN	ribonucleic acid export 1	280					carbohydrate metabolic process (GO:0005975)|cellular response to organic cyclic compound (GO:0071407)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nuclear envelope (GO:0005635)|nuclear outer membrane (GO:0005640)|nuclear pore (GO:0005643)|nucleolus (GO:0005730)|nucleus (GO:0005634)	microtubule binding (GO:0008017)|RNA binding (GO:0003723)	p.A280T(1)		breast(1)|endometrium(5)|large_intestine(4)|lung(6)|prostate(3)|skin(2)	21	Lung NSC(12;0.00263)|all_lung(29;0.00828)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(4;3.7e-14)|Epithelial(14;1.07e-09)|all cancers(14;1.11e-08)			AAATGGAATCGCGTTCCATCC	0.493																																																	1	Substitution - Missense(1)	endometrium(1)						ENSG00000101146						199.0	190.0	193.0					20																	55949675		2203	4300	6503	RAE1	SO:0001583	missense	0			-	HGNC	U84720	CCDS13458.1	20q13.31	2013-08-28	2013-08-28		ENSG00000101146	ENSG00000101146		"""WD repeat domain containing"""	9828	protein-coding gene	gene with protein product		603343	"""RAE1 (RNA export 1, S.pombe) homolog"", ""RAE1 RNA export 1 homolog (S. pombe)"""			9370289, 9256445	Standard	XM_005260582		Approved	Mnrp41	uc002xyi.3	P78406	OTTHUMG00000032819	ENST00000395841.2:c.838G>A	20.37:g.55949675G>A	ENSP00000379182:p.Ala280Thr	Somatic	0	47	0.00		0.5117654914895859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	41	14.58	A8K882|O15306|Q3SYL7|Q5TCH8|Q6V708|Q9H100|Q9NQM6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.A280T	ENST00000395841.2	37	c.838	CCDS13458.1	20	.	.	.	.	.	.	.	.	.	.	G	24.1	4.497606	0.85069	.	.	ENSG00000101146	ENST00000395841;ENST00000371242;ENST00000527947;ENST00000395840	T;T;T;T	0.63744	-0.06;-0.06;-0.06;-0.06	5.91	4.94	0.65067	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.147777	0.64402	D	0.000008	T	0.77177	0.4092	M	0.82517	2.595	0.80722	D	1	D;D;D	0.71674	0.998;0.997;0.997	P;P;P	0.57057	0.589;0.812;0.812	T	0.81169	-0.1055	10	0.56958	D	0.05	-13.9053	16.2734	0.82632	0.0:0.0:0.8664:0.1336	.	280;280;280	E9PQ57;A8K882;P78406	.;.;RAE1L_HUMAN	T	280	ENSP00000379182:A280T;ENSP00000360286:A280T;ENSP00000432609:A280T;ENSP00000379181:A280T	ENSP00000360286:A280T	A	+	1	0	RAE1	55383082	1.000000	0.71417	0.501000	0.27601	0.969000	0.65631	3.633000	0.54295	1.457000	0.47850	0.655000	0.94253	GCG	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat		0.493	RAE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAE1	protein_coding	OTTHUMT00000079842.2	G		-		55949675	+1	no_errors	ENST00000371242	ensembl	human	known	74_37	missense	SNP	0.973	A
KIF1C	10749	genome.wustl.edu	37	17	4903611	4903611	+	Missense_Mutation	SNP	G	G	A			TCGA-VT-AB3D-01A-12D-A417-09	TCGA-VT-AB3D-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51932322-cd96-4c1b-a8ba-660637fff36b	c94fc63b-bf20-4585-9319-5f35435795df	g.chr17:4903611G>A	ENST00000320785.5	+	3	427	c.70G>A	c.(70-72)Gcc>Acc	p.A24T	INCA1_ENST00000355025.3_5'Flank|INCA1_ENST00000575780.1_5'Flank|INCA1_ENST00000396829.2_5'Flank	NM_006612.5	NP_006603.2	O43896	KIF1C_HUMAN	kinesin family member 1C	24	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)|poly(A) RNA binding (GO:0044822)			NS(2)|breast(4)|endometrium(4)|kidney(2)|large_intestine(8)|lung(6)|skin(1)|urinary_tract(3)	30						CAGCCAGGATGCCAAGTGTGT	0.652																																					Melanoma(96;1023 1447 10250 19259 33730)												0								ENSG00000129250						65.0	50.0	55.0					17																	4903611		2201	4297	6498	KIF1C	SO:0001583	missense	0			-	HGNC	U91329	CCDS11065.1	17p13.2	2014-03-03			ENSG00000129250	ENSG00000129250		"""Kinesins"""	6317	protein-coding gene	gene with protein product		603060	"""spastic ataxia 2 (autosomal recessive)"""	SAX2		9685376, 24319291, 24482476	Standard	NM_006612		Approved	SPAX2, SPG58	uc002gan.2	O43896	OTTHUMG00000099451	ENST00000320785.5:c.70G>A	17.37:g.4903611G>A	ENSP00000320821:p.Ala24Thr	Somatic	0	62	0.00		0.5117654914895859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	D3DTL6|O75186|Q5U618	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Kinesin_motor_dom,pfam_FHA_dom,superfamily_P-loop_NTPase,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.A24T	ENST00000320785.5	37	c.70	CCDS11065.1	17	.	.	.	.	.	.	.	.	.	.	G	14.75	2.629168	0.46944	.	.	ENSG00000129250	ENST00000320785	T	0.75260	-0.92	4.01	4.01	0.46588	Kinesin, motor domain (4);	.	.	.	.	T	0.70430	0.3223	L	0.28649	0.875	0.41923	D	0.990523	D	0.53312	0.959	P	0.50590	0.645	T	0.70557	-0.4839	9	0.34782	T	0.22	.	14.4403	0.67311	0.0:0.0:1.0:0.0	.	24	O43896	KIF1C_HUMAN	T	24	ENSP00000320821:A24T	ENSP00000320821:A24T	A	+	1	0	KIF1C	4844335	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.652000	0.37313	2.154000	0.67381	0.467000	0.42956	GCC	-	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom		0.652	KIF1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF1C	protein_coding	OTTHUMT00000216916.1	G		-		4903611	+1	no_errors	ENST00000320785	ensembl	human	known	74_37	missense	SNP	1.000	A
TCF25	22980	genome.wustl.edu	37	16	89951019	89951020	+	Frame_Shift_Ins	INS	-	-	A			TCGA-VT-AB3D-01A-12D-A417-09	TCGA-VT-AB3D-10A-01D-A41A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51932322-cd96-4c1b-a8ba-660637fff36b	c94fc63b-bf20-4585-9319-5f35435795df	g.chr16:89951019_89951020insA	ENST00000263346.8	+	3	440_441	c.384_385insA	c.(385-387)aaafs	p.K129fs	TCF25_ENST00000263347.7_5'Flank|TCF25_ENST00000563406.1_3'UTR	NM_014972.2	NP_055787.1	Q9BQ70	TCF25_HUMAN	transcription factor 25 (basic helix-loop-helix)	129					heart development (GO:0007507)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|large_intestine(1)|lung(8)|ovary(3)|skin(1)|urinary_tract(2)	18		all_cancers(9;4.71e-08)|Lung NSC(15;0.000192)|all_lung(18;0.000319)|all_neural(9;0.0122)|all_hematologic(23;0.027)		BRCA - Breast invasive adenocarcinoma(80;0.0288)		TCCGGAAGAAGAAAAAAAAACA	0.446																																																	0								ENSG00000141002																																			TCF25	SO:0001589	frameshift_variant	0				HGNC	AF322111	CCDS10987.1	16q24.3	2008-02-05			ENSG00000141002	ENSG00000141002			29181	protein-coding gene	gene with protein product		612326				12107429, 16574069	Standard	NM_014972		Approved	Nulp1, KIAA1049	uc002fpb.2	Q9BQ70	OTTHUMG00000138986	ENST00000263346.8:c.393dupA	16.37:g.89951028_89951028dupA	ENSP00000263346:p.Lys129fs	Somatic	0	39	0.00		0.5117654914895859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	49	12.50	Q2MK75|Q9UPV3	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_TCF25	p.Q131fs	ENST00000263346.8	37	c.384_385	CCDS10987.1	16																																																																																			-	NULL		0.446	TCF25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCF25	protein_coding	OTTHUMT00000272875.2	-	NM_014972			89951020	+1	no_errors	ENST00000263346	ensembl	human	known	74_37	frame_shift_ins	INS	1.000:1.000	A
MAMDC4	158056	genome.wustl.edu	37	9	139752912	139752912	+	Missense_Mutation	SNP	G	G	T			TCGA-VT-AB3D-01A-12D-A417-09	TCGA-VT-AB3D-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51932322-cd96-4c1b-a8ba-660637fff36b	c94fc63b-bf20-4585-9319-5f35435795df	g.chr9:139752912G>T	ENST00000317446.2	+	22	2785	c.2735G>T	c.(2734-2736)gGc>gTc	p.G912V	MAMDC4_ENST00000485732.1_3'UTR|MAMDC4_ENST00000445819.1_Missense_Mutation_p.G991V	NM_206920.2	NP_996803.2			MAM domain containing 4											breast(4)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(4)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	19	all_cancers(76;0.0763)|all_epithelial(76;0.198)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.52e-05)|Epithelial(140;0.000171)		CCCGGCCTGGGCGGATACAGC	0.687																																																	0								ENSG00000177943						26.0	33.0	31.0					9																	139752912		2189	4295	6484	MAMDC4	SO:0001583	missense	0			-	HGNC	AL834531	CCDS7010.1	9q34.3	2013-10-21			ENSG00000177943	ENSG00000177943			24083	protein-coding gene	gene with protein product	"""apical early endosomal glycoprotein precursor"", ""endotubin"""					7829488	Standard	NM_206920		Approved	AEGP, DKFZp434M1411	uc004cjs.3	Q6UXC1	OTTHUMG00000020951	ENST00000317446.2:c.2735G>T	9.37:g.139752912G>T	ENSP00000319388:p.Gly912Val	Somatic	0	30	0.00		0.5117654914895859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	37	15.91		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MAM_dom,pfam_LDrepeatLR_classA_rpt,superfamily_ConA-like_lec_gl_sf,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_MAM_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_MAM_dom,prints_LDrepeatLR_classA_rpt	p.G991V	ENST00000317446.2	37	c.2972	CCDS7010.1	9	.	.	.	.	.	.	.	.	.	.	.	14.70	2.614136	0.46631	.	.	ENSG00000177943	ENST00000317446;ENST00000445819	T;T	0.02158	4.42;4.42	5.05	5.05	0.67936	Concanavalin A-like lectin/glucanase (1);MAM domain (3);	0.346611	0.24664	N	0.036604	T	0.08492	0.0211	M	0.64997	1.995	0.21967	N	0.999448	D;D	0.89917	0.974;1.0	D;D	0.78314	0.95;0.991	T	0.13282	-1.0515	10	0.52906	T	0.07	-27.8183	7.3718	0.26806	0.0905:0.1716:0.7379:0.0	.	991;912	Q6UXC1;Q6UXC1-2	AEGP_HUMAN;.	V	912;991	ENSP00000319388:G912V;ENSP00000411339:G991V	ENSP00000319388:G912V	G	+	2	0	MAMDC4	138872733	0.282000	0.24268	0.342000	0.25602	0.674000	0.39518	2.469000	0.45110	2.355000	0.79922	0.561000	0.74099	GGC	-	pfam_MAM_dom,superfamily_ConA-like_lec_gl_sf,smart_MAM_dom,pfscan_MAM_dom		0.687	MAMDC4-005	KNOWN	basic|CCDS	protein_coding	MAMDC4	protein_coding	OTTHUMT00000254642.3	G	NM_206920	-		139752912	+1	no_errors	ENST00000445819	ensembl	human	known	74_37	missense	SNP	0.053	T
PCDH15	65217	genome.wustl.edu	37	10	55626560	55626560	+	Missense_Mutation	SNP	G	G	T			TCGA-VT-AB3D-01A-12D-A417-09	TCGA-VT-AB3D-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51932322-cd96-4c1b-a8ba-660637fff36b	c94fc63b-bf20-4585-9319-5f35435795df	g.chr10:55626560G>T	ENST00000320301.6	-	27	3953	c.3559C>A	c.(3559-3561)Cca>Aca	p.P1187T	PCDH15_ENST00000395433.1_Missense_Mutation_p.P1165T|PCDH15_ENST00000463095.1_5'UTR|PCDH15_ENST00000409834.1_Missense_Mutation_p.P798T|PCDH15_ENST00000414778.1_Missense_Mutation_p.P1192T|PCDH15_ENST00000437009.1_Missense_Mutation_p.P1116T|PCDH15_ENST00000395440.1_Intron|PCDH15_ENST00000395432.2_Missense_Mutation_p.P1150T|PCDH15_ENST00000373957.3_Intron|PCDH15_ENST00000395445.1_Missense_Mutation_p.P1194T|PCDH15_ENST00000373965.2_Missense_Mutation_p.P1194T|PCDH15_ENST00000395430.1_Missense_Mutation_p.P1187T|PCDH15_ENST00000395446.1_Intron|PCDH15_ENST00000395438.1_Missense_Mutation_p.P1187T|PCDH15_ENST00000361849.3_Missense_Mutation_p.P1187T|PCDH15_ENST00000395442.1_Intron	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	1187	Cadherin 11. {ECO:0000255|PROSITE- ProRule:PRU00043}.				equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)			NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				TCTTTAATTGGTGGTATTATG	0.368										HNSCC(58;0.16)																																							0								ENSG00000150275						155.0	143.0	147.0					10																	55626560		2203	4300	6503	PCDH15	SO:0001583	missense	0			-	HGNC	AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.3559C>A	10.37:g.55626560G>T	ENSP00000322604:p.Pro1187Thr	Somatic	0	43	0.00		0.5117654914895859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	57	10.94	A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.P1187T	ENST00000320301.6	37	c.3559	CCDS7248.1	10	.	.	.	.	.	.	.	.	.	.	G	21.6	4.180102	0.78564	.	.	ENSG00000150275	ENST00000373965;ENST00000414778;ENST00000455746;ENST00000395438;ENST00000409834;ENST00000395445;ENST00000395432;ENST00000361849;ENST00000395433;ENST00000320301;ENST00000395430;ENST00000417177;ENST00000437009	T;T;T;T;T;T;T;T;T;T;T	0.51574	0.7;0.7;0.7;0.7;0.7;0.7;0.7;0.7;0.7;0.7;0.7	5.81	5.81	0.92471	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.67031	0.2850	L	0.54323	1.7	0.80722	D	1	D;D;D;P;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;0.935;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;0.986	D;D;D;P;D;D;D;D;D;D;D;D;D	0.97110	1.0;1.0;0.998;0.891;1.0;1.0;1.0;1.0;0.997;0.997;0.998;1.0;0.961	T	0.67039	-0.5771	9	0.72032	D	0.01	.	19.6571	0.95847	0.0:0.0:1.0:0.0	.	1165;1187;1187;1192;1116;1150;1187;1187;1194;1194;1187;1192;1187	A2A3E8;E7EMG4;A2A3E7;C9JIG1;E7EM53;E7EMG0;A2A3E6;A2A3E3;C6ZEF5;A2A3E2;C6ZEF7;C9J4F3;Q96QU1	.;.;.;.;.;.;.;.;.;.;.;.;PCD15_HUMAN	T	1194;1192;1187;1187;798;1194;1150;1187;1165;1187;1187;1192;1116	ENSP00000363076:P1194T;ENSP00000410304:P1192T;ENSP00000378826:P1187T;ENSP00000386693:P798T;ENSP00000378832:P1194T;ENSP00000378820:P1150T;ENSP00000354950:P1187T;ENSP00000378821:P1165T;ENSP00000322604:P1187T;ENSP00000378818:P1187T;ENSP00000412628:P1116T	ENSP00000322604:P1187T	P	-	1	0	PCDH15	55296566	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.062000	0.89475	2.750000	0.94351	0.655000	0.94253	CCA	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.368	PCDH15-001	KNOWN	basic|CCDS	protein_coding	PCDH15	protein_coding	OTTHUMT00000048121.2	G	NM_033056	-		55626560	-1	no_errors	ENST00000320301	ensembl	human	known	74_37	missense	SNP	1.000	T
CCDC59	29080	genome.wustl.edu	37	12	82736380	82736385	+	RNA	DEL	ATATAC	ATATAC	-	rs148601718	byFrequency	TCGA-VT-AB3D-01A-12D-A417-09	TCGA-VT-AB3D-10A-01D-A41A-09	ATATAC	ATATAC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51932322-cd96-4c1b-a8ba-660637fff36b	c94fc63b-bf20-4585-9319-5f35435795df	g.chr12:82736380_82736385delATATAC	ENST00000408194.1	-	0	104_109																											atgtatgtatatatacatatatatgt	0.204														262	0.0523163	0.0552	0.0605	5008	,	,		15716	0.002		0.0805	False		,,,				2504	0.0654																0								ENSG00000221121																																			AC083811.1			0				Clone_based_ensembl_gene																													12.37:g.82736380_82736385delATATAC		Somatic	NA	NA	NA		0.5117654914895859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000408194.1	37	NULL		12																																																																																			-	-		0.204	AC083811.1-201	NOVEL	basic	miRNA	ENSG00000221121	miRNA		ATATAC				82736385	-1	no_errors	ENST00000408194	ensembl	human	novel	74_37	rna	DEL	0.012:0.010:0.008:0.005:0.002:0.001	-
CNGA1	1259	genome.wustl.edu	37	4	47945298	47945298	+	Missense_Mutation	SNP	C	C	A			TCGA-VT-AB3D-01A-12D-A417-09	TCGA-VT-AB3D-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51932322-cd96-4c1b-a8ba-660637fff36b	c94fc63b-bf20-4585-9319-5f35435795df	g.chr4:47945298C>A	ENST00000514170.1	-	8	668	c.349G>T	c.(349-351)Gat>Tat	p.D117Y	CNGA1_ENST00000358519.4_Missense_Mutation_p.D117Y|CNGA1_ENST00000420489.2_Missense_Mutation_p.D117Y|CNGA1_ENST00000402813.3_Missense_Mutation_p.D186Y|CNGA1_ENST00000544810.1_Missense_Mutation_p.D117Y			P29973	CNGA1_HUMAN	cyclic nucleotide gated channel alpha 1	117					phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment membrane (GO:0042622)|plasma membrane (GO:0005886)	cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|urinary_tract(1)	28						TTTTTATCATCTGACTTGCTG	0.318																																																	0								ENSG00000198515						32.0	29.0	30.0					4																	47945298		1752	3962	5714	CNGA1	SO:0001583	missense	0			-	HGNC	M84741	CCDS43226.1, CCDS47050.1	4p12	2013-02-14				ENSG00000198515		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2148	protein-coding gene	gene with protein product		123825		CNCG1, CNCG		7683629, 16382102	Standard	NM_000087		Approved	RCNC1, RCNCa, CNG1, RP49	uc003gxu.3	P29973		ENST00000514170.1:c.349G>T	4.37:g.47945298C>A	ENSP00000426862:p.Asp117Tyr	Somatic	0	77	0.00		0.5117654914895859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	115	15.44	A8K7K6|J3KPZ2|Q16279|Q16485|Q4W5E3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom	p.D186Y	ENST00000514170.1	37	c.556	CCDS43226.1	4	.	.	.	.	.	.	.	.	.	.	C	12.99	2.102887	0.37145	.	.	ENSG00000198515	ENST00000402813;ENST00000514170;ENST00000544810;ENST00000358519;ENST00000420489;ENST00000504722	T;T;T;T;T;T	0.28895	2.95;2.95;2.95;2.95;2.95;1.59	4.82	3.05	0.35203	.	0.647251	0.15825	N	0.242811	T	0.23410	0.0566	L	0.44542	1.39	0.41057	D	0.985347	P;P	0.44090	0.826;0.651	B;B	0.37833	0.259;0.172	T	0.05886	-1.0858	10	0.62326	D	0.03	.	7.8829	0.29633	0.1622:0.7495:0.0:0.0883	.	117;117	Q4W5E3;P29973	.;CNGA1_HUMAN	Y	186;117;117;117;117;117	ENSP00000384264:D186Y;ENSP00000426862:D117Y;ENSP00000443401:D117Y;ENSP00000351320:D117Y;ENSP00000389881:D117Y;ENSP00000423721:D117Y	ENSP00000351320:D117Y	D	-	1	0	CNGA1	47640055	0.013000	0.17824	0.999000	0.59377	0.486000	0.33341	0.934000	0.28910	1.180000	0.42898	-0.122000	0.15005	GAT	-	NULL		0.318	CNGA1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	CNGA1	protein_coding	OTTHUMT00000372070.2	C	NM_000087	-		47945298	-1	no_errors	ENST00000402813	ensembl	human	known	74_37	missense	SNP	0.891	A
OR2T33	391195	genome.wustl.edu	37	1	248436456	248436456	+	Missense_Mutation	SNP	C	C	A	rs142107755	byFrequency	TCGA-VT-AB3D-01A-12D-A417-09	TCGA-VT-AB3D-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51932322-cd96-4c1b-a8ba-660637fff36b	c94fc63b-bf20-4585-9319-5f35435795df	g.chr1:248436456C>A	ENST00000318021.2	-	1	682	c.661G>T	c.(661-663)Gct>Tct	p.A221S		NM_001004695.1	NP_001004695.1	Q8NG76	O2T33_HUMAN	olfactory receptor, family 2, subfamily T, member 33	221						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(41)|ovary(1)|prostate(1)|skin(4)	67	all_cancers(71;0.000124)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			AGAACAGCAGCGAGGATGAGA	0.527																																																	0								ENSG00000177212						18.0	21.0	20.0					1																	248436456		2179	4273	6452	OR2T33	SO:0001583	missense	0			-	HGNC		CCDS31109.1	1q44	2012-08-09			ENSG00000177212	ENSG00000177212		"""GPCR / Class A : Olfactory receptors"""	31255	protein-coding gene	gene with protein product							Standard	NM_001004695		Approved		uc010pzi.2	Q8NG76	OTTHUMG00000040458	ENST00000318021.2:c.661G>T	1.37:g.248436456C>A	ENSP00000324687:p.Ala221Ser	Somatic	0	41	0.00		0.5117654914895859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	34	10.53	B2RNN0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.A221S	ENST00000318021.2	37	c.661	CCDS31109.1	1	.	.	.	.	.	.	.	.	.	.	-	1.125	-0.654212	0.03480	.	.	ENSG00000177212	ENST00000318021	T	0.36699	1.24	1.86	0.451	0.16629	GPCR, rhodopsin-like superfamily (1);	0.768304	0.10547	N	0.661922	T	0.15046	0.0363	N	0.05230	-0.09	0.09310	N	1	B	0.27498	0.18	B	0.28385	0.089	T	0.21314	-1.0249	10	0.41790	T	0.15	.	1.341	0.02154	0.4684:0.2296:0.1692:0.1327	.	221	Q8NG76	O2T33_HUMAN	S	221	ENSP00000324687:A221S	ENSP00000324687:A221S	A	-	1	0	OR2T33	246503079	0.000000	0.05858	0.044000	0.18714	0.453000	0.32348	-2.089000	0.01357	0.101000	0.17610	0.494000	0.49563	GCT	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.527	OR2T33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T33	protein_coding	OTTHUMT00000097354.1	C	NM_001004695	rs142107755		248436456	-1	no_errors	ENST00000318021	ensembl	human	known	74_37	missense	SNP	0.000	A
FAT1	2195	genome.wustl.edu	37	4	187554873	187554873	+	Nonsense_Mutation	SNP	C	C	A			TCGA-VT-AB3D-01A-12D-A417-09	TCGA-VT-AB3D-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51932322-cd96-4c1b-a8ba-660637fff36b	c94fc63b-bf20-4585-9319-5f35435795df	g.chr4:187554873C>A	ENST00000441802.2	-	7	4497	c.4288G>T	c.(4288-4290)Gag>Tag	p.E1430*		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	1430	Cadherin 12. {ECO:0000255|PROSITE- ProRule:PRU00043}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						TCTGTAGCCTCGACTGTGAGG	0.463										HNSCC(5;0.00058)																											Colon(197;1040 2055 4143 4984 49344)												0								ENSG00000083857						265.0	250.0	255.0					4																	187554873		1994	4173	6167	FAT1	SO:0001587	stop_gained	0			-	HGNC	X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.4288G>T	4.37:g.187554873C>A	ENSP00000406229:p.Glu1430*	Somatic	0	78	0.00		0.5117654914895859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	67	8.22		Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Laminin_G,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,smart_EG-like_dom,smart_Laminin_G,smart_EGF-like_Ca-bd_dom,prints_Cadherin,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin	p.E1430*	ENST00000441802.2	37	c.4288	CCDS47177.1	4	.	.	.	.	.	.	.	.	.	.	C	45	11.292727	0.99542	.	.	ENSG00000083857	ENST00000441802;ENST00000260147	.	.	.	5.02	5.02	0.67125	.	0.164580	0.52532	D	0.000065	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09338	T	0.73	.	18.9077	0.92469	0.0:1.0:0.0:0.0	.	.	.	.	X	1430	.	ENSP00000260147:E1430X	E	-	1	0	FAT1	187791867	1.000000	0.71417	0.951000	0.38953	0.767000	0.43475	4.418000	0.59828	2.774000	0.95407	0.650000	0.86243	GAG	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.463	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT1	protein_coding	OTTHUMT00000360209.3	C	NM_005245	-		187554873	-1	no_errors	ENST00000441802	ensembl	human	known	74_37	nonsense	SNP	0.995	A
AC002485.1	0	genome.wustl.edu	37	6	67069361	67069362	+	RNA	DEL	AC	AC	-			TCGA-VT-AB3D-01A-12D-A417-09	TCGA-VT-AB3D-10A-01D-A41A-09	AC	AC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51932322-cd96-4c1b-a8ba-660637fff36b	c94fc63b-bf20-4585-9319-5f35435795df	g.chr6:67069361_67069362delAC	ENST00000408354.1	+	0	44_45																											GTATGCAAATacacacacacac	0.411																																																	0								ENSG00000221281																																			AC002485.1			0				Clone_based_ensembl_gene																													6.37:g.67069371_67069372delAC		Somatic	0	18	0.00		0.5117654914895859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	17	22.73		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000408354.1	37	NULL		6																																																																																			-	-		0.411	AC002485.1-201	NOVEL	basic	miRNA	ENSG00000221281	miRNA		AC				67069362	+1	no_errors	ENST00000408354	ensembl	human	novel	74_37	rna	DEL	0.000:0.000	-
LINC00842	643650	genome.wustl.edu	37	10	47151672	47151672	+	lincRNA	SNP	G	G	T	rs202065397	byFrequency	TCGA-VT-AB3D-01A-12D-A417-09	TCGA-VT-AB3D-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51932322-cd96-4c1b-a8ba-660637fff36b	c94fc63b-bf20-4585-9319-5f35435795df	g.chr10:47151672G>T	ENST00000422732.2	-	0	0					NR_033957.2				long intergenic non-protein coding RNA 842																		GAAAGGGGCCGTCCGGGGAGC	0.637											OREG0020158	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000223477																																			LINC00842			0			-	HGNC			10q11.22	2013-01-04			ENSG00000223477	ENSG00000274909		"""Long non-coding RNAs"""	44989	non-coding RNA	RNA, long non-coding							Standard	NR_033957		Approved		uc001jef.3		OTTHUMG00000018109		10.37:g.47151672G>T		Somatic	0	13	0.00	944	0.5117654914895859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	7	36.36		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000422732.2	37	NULL		10	.	.	.	.	.	.	.	.	.	.	G	4.265	0.048241	0.08243	.	.	ENSG00000179251	ENST00000319426	.	.	.	1.26	-0.955	0.10356	.	.	.	.	.	T	0.36963	0.0986	.	.	.	.	.	.	.	.	.	.	.	.	T	0.46652	-0.9176	4	0.87932	D	0	.	3.6945	0.08358	0.5684:0.0:0.4316:0.0	.	.	.	.	E	59	.	ENSP00000385877:D59E	D	-	3	2	AL391137.1	46571678	0.001000	0.12720	0.001000	0.08648	0.046000	0.14306	0.259000	0.18405	-0.289000	0.09038	0.205000	0.17691	GAC	-	-		0.637	LINC00842-002	KNOWN	basic	lincRNA	LINC00842	lincRNA	OTTHUMT00000047838.2	G	NR_033957	rs202065397		47151672	-1	no_errors	ENST00000319426	ensembl	human	known	74_37	rna	SNP	0.001	T
TFAP2C	7022	genome.wustl.edu	37	20	55206468	55206468	+	Missense_Mutation	SNP	G	G	T			TCGA-VT-AB3D-01A-12D-A417-09	TCGA-VT-AB3D-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51932322-cd96-4c1b-a8ba-660637fff36b	c94fc63b-bf20-4585-9319-5f35435795df	g.chr20:55206468G>T	ENST00000201031.2	+	2	499	c.256G>T	c.(256-258)Gcc>Tcc	p.A86S	TFAP2C_ENST00000544508.1_5'UTR	NM_003222.3	NP_003213.1	Q92754	AP2C_HUMAN	transcription factor AP-2 gamma (activating enhancer binding protein 2 gamma)	86	Gln/Pro-rich (transactivation domain).				cell-cell signaling (GO:0007267)|cerebral cortex development (GO:0021987)|dichotomous subdivision of terminal units involved in mammary gland duct morphogenesis (GO:0060598)|epithelial cell proliferation involved in mammary gland duct elongation (GO:0060750)|forebrain neuron fate commitment (GO:0021877)|germ-line stem cell maintenance (GO:0030718)|hair follicle development (GO:0001942)|keratinocyte development (GO:0003334)|male gonad development (GO:0008584)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of epidermis development (GO:0045682)|regulation of gene expression, epigenetic (GO:0040029)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|sebaceous gland development (GO:0048733)|somatic stem cell maintenance (GO:0035019)|trophectodermal cell differentiation (GO:0001829)	nucleus (GO:0005634)	core promoter binding (GO:0001047)|DNA binding (GO:0003677)|protein dimerization activity (GO:0046983)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	13			Colorectal(105;0.229)			GTACGCCGCCGCCATCAACCC	0.716																																																	0								ENSG00000087510						11.0	12.0	12.0					20																	55206468		2187	4280	6467	TFAP2C	SO:0001583	missense	0			-	HGNC		CCDS13454.1	20q13.2	2008-07-17	2001-11-28		ENSG00000087510	ENSG00000087510			11744	protein-coding gene	gene with protein product	"""estrogen receptor factor 1"""	601602	"""transcription factor AP-2 gamma (activating enhancer-binding protein 2 gamma)"""			8661133	Standard	NM_003222		Approved	AP2-GAMMA, ERF1, TFAP2G, hAP-2g	uc002xya.3	Q92754	OTTHUMG00000032805	ENST00000201031.2:c.256G>T	20.37:g.55206468G>T	ENSP00000201031:p.Ala86Ser	Somatic	0	62	0.00		0.5117654914895859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	41	8.70	B4DWK3|O00685|O00730|Q86V30|Q8IVB6|Q9P1X2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TF_AP2_C,prints_TF_AP2_C,prints_TF_AP2_gamma	p.A86S	ENST00000201031.2	37	c.256	CCDS13454.1	20	.	.	.	.	.	.	.	.	.	.	G	0.027	-1.363524	0.01235	.	.	ENSG00000087510	ENST00000201031;ENST00000416606	D;T	0.96802	-4.13;-1.0	5.58	0.814	0.18756	.	0.000000	0.43579	D	0.000553	D	0.88062	0.6336	N	0.24115	0.695	0.45227	D	0.998232	B	0.11235	0.004	B	0.10450	0.005	T	0.77008	-0.2747	10	0.05620	T	0.96	-24.8709	4.7734	0.13167	0.0758:0.1016:0.3546:0.468	.	86	Q92754	AP2C_HUMAN	S	86;74	ENSP00000201031:A86S;ENSP00000390857:A74S	ENSP00000201031:A86S	A	+	1	0	TFAP2C	54639875	0.003000	0.15002	0.392000	0.26245	0.050000	0.14768	0.044000	0.13992	0.662000	0.31006	0.491000	0.48974	GCC	-	prints_TF_AP2_gamma		0.716	TFAP2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TFAP2C	protein_coding	OTTHUMT00000079823.2	G	NM_003222	-		55206468	+1	no_errors	ENST00000201031	ensembl	human	known	74_37	missense	SNP	0.072	T
PGR	5241	genome.wustl.edu	37	11	100996760	100996760	+	Silent	SNP	G	G	C			TCGA-VT-AB3D-01A-12D-A417-09	TCGA-VT-AB3D-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51932322-cd96-4c1b-a8ba-660637fff36b	c94fc63b-bf20-4585-9319-5f35435795df	g.chr11:100996760G>C	ENST00000325455.5	-	2	3220	c.1767C>G	c.(1765-1767)gtC>gtG	p.V589V	PGR_ENST00000263463.5_Silent_p.V589V|PGR_ENST00000534013.1_5'UTR	NM_000926.4|NM_001202474.1|NM_001271162.1	NP_000917.3|NP_001189403.1|NP_001258091.1	P06401	PRGR_HUMAN	progesterone receptor	589					cell-cell signaling (GO:0007267)|epithelial cell maturation (GO:0002070)|gene expression (GO:0010467)|negative regulation of gene expression (GO:0010629)|ovulation from ovarian follicle (GO:0001542)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|progesterone receptor signaling pathway (GO:0050847)|regulation of epithelial cell proliferation (GO:0050678)|signal transduction (GO:0007165)|tertiary branching involved in mammary gland duct morphogenesis (GO:0060748)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mitochondrial outer membrane (GO:0005741)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(4)|liver(1)|lung(18)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	36		Acute lymphoblastic leukemia(157;0.000885)|all_hematologic(158;0.014)		LUSC - Lung squamous cell carcinoma(1;0.0387)|BRCA - Breast invasive adenocarcinoma(274;0.124)|OV - Ovarian serous cystadenocarcinoma(223;0.148)|Lung(307;0.164)	Allylestrenol(DB01431)|Danazol(DB01406)|Desogestrel(DB00304)|Drospirenone(DB01395)|Dydrogesterone(DB00378)|Ethynodiol(DB00823)|Etonogestrel(DB00294)|Fluticasone Propionate(DB00588)|Levonorgestrel(DB00367)|Medroxyprogesterone Acetate(DB00603)|Megestrol acetate(DB00351)|Mifepristone(DB00834)|Norelgestromin(DB06713)|Norethindrone(DB00717)|Norgestimate(DB00957)|Progesterone(DB00396)|Spironolactone(DB00421)	TCTTAAAGAAGACCTTACAGC	0.393																																					Pancreas(124;2271 2354 21954 22882)												0								ENSG00000082175						101.0	88.0	93.0					11																	100996760		2203	4300	6503	PGR	SO:0001819	synonymous_variant	0			-	HGNC	M15716	CCDS8310.1, CCDS59229.1	11q22-q23	2013-01-16			ENSG00000082175	ENSG00000082175		"""Nuclear hormone receptors"""	8910	protein-coding gene	gene with protein product		607311					Standard	NM_000926		Approved	PR, NR3C3	uc001pgh.2	P06401	OTTHUMG00000167531	ENST00000325455.5:c.1767C>G	11.37:g.100996760G>C		Somatic	0	88	0.00		0.5117654914895859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	92	9.71	A7LQ08|A7X8B0|B4E3T0|Q8TDS3|Q9UPF7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Progest_rcpt,pfam_Znf_hrmn_rcpt,pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Progest_rcpt,prints_Znf_hrmn_rcpt,prints_Str_hrmn_rcpt	p.V589	ENST00000325455.5	37	c.1767	CCDS8310.1	11																																																																																			-	pfam_Znf_hrmn_rcpt,smart_Znf_hrmn_rcpt,pfscan_Znf_hrmn_rcpt,prints_Znf_hrmn_rcpt		0.393	PGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PGR	protein_coding	OTTHUMT00000394934.1	G		-		100996760	-1	no_errors	ENST00000325455	ensembl	human	known	74_37	silent	SNP	1.000	C
KLK13	26085	genome.wustl.edu	37	19	51567062	51567062	+	Intron	SNP	G	G	T			TCGA-VT-AB3D-01A-12D-A417-09	TCGA-VT-AB3D-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51932322-cd96-4c1b-a8ba-660637fff36b	c94fc63b-bf20-4585-9319-5f35435795df	g.chr19:51567062G>T	ENST00000595793.1	-	1	95				KLK13_ENST00000595547.1_Intron|KLK13_ENST00000596955.1_Intron|KLK13_ENST00000335422.3_Intron	NM_015596.1	NP_056411.1	Q9UKR3	KLK13_HUMAN	kallikrein-related peptidase 13						protein processing (GO:0016485)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|secretory granule (GO:0030141)	hydrolase activity (GO:0016787)|serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(6)|prostate(1)|skin(1)	16		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00224)|GBM - Glioblastoma multiforme(134;0.00432)		aaggcctctggtcgggaagcc	0.507																																																	0								ENSG00000167759						5.0	5.0	5.0					19																	51567062		860	1966	2826	KLK13	SO:0001627	intron_variant	0			-	HGNC		CCDS12822.1	19q13.33	2008-02-05	2006-10-27			ENSG00000167759		"""Kallikreins"""	6361	protein-coding gene	gene with protein product		605505	"""kallikrein 13"""			16800724, 16800723	Standard	NM_015596		Approved	KLK-L4	uc002pvn.3	Q9UKR3		ENST00000595793.1:c.52+1210C>A	19.37:g.51567062G>T		Somatic	0	45	0.00		0.5117654914895859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	44	13.73	A7UNK6|Q86VI8|Q9Y433	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.P37T	ENST00000595793.1	37	c.109	CCDS12822.1	19	.	.	.	.	.	.	.	.	.	.	g	2.954	-0.216112	0.06101	.	.	ENSG00000167759	ENST00000441527	.	.	.	2.49	-1.3	0.09259	.	.	.	.	.	T	0.34658	0.0905	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.39623	-0.9605	5	0.87932	D	0	.	3.3318	0.07087	0.28:0.219:0.501:0.0	.	.	.	.	T	37	.	ENSP00000392640:P37T	P	-	1	0	KLK13	56258874	0.001000	0.12720	0.000000	0.03702	0.004000	0.04260	0.535000	0.23114	-0.143000	0.11334	0.460000	0.39030	CCA	-	NULL		0.507	KLK13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLK13	protein_coding	OTTHUMT00000464298.2	G	NM_015596	-		51567062	-1	no_errors	ENST00000441527	ensembl	human	known	74_37	missense	SNP	0.000	T
PLEKHH1	57475	genome.wustl.edu	37	14	68038854	68038854	+	Missense_Mutation	SNP	G	G	T			TCGA-VT-AB3D-01A-12D-A417-09	TCGA-VT-AB3D-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51932322-cd96-4c1b-a8ba-660637fff36b	c94fc63b-bf20-4585-9319-5f35435795df	g.chr14:68038854G>T	ENST00000329153.5	+	11	1720	c.1588G>T	c.(1588-1590)Gtc>Ttc	p.V530F		NM_020715.2	NP_065766.1	Q9ULM0	PKHH1_HUMAN	pleckstrin homology domain containing, family H (with MyTH4 domain) member 1	530						cytoskeleton (GO:0005856)				endometrium(2)|kidney(4)|lung(12)|urinary_tract(1)	19				all cancers(60;0.000771)|OV - Ovarian serous cystadenocarcinoma(108;0.00502)|BRCA - Breast invasive adenocarcinoma(234;0.011)		TCGGCAAGGCGTCTCCATGTC	0.657																																																	0								ENSG00000054690						27.0	29.0	28.0					14																	68038854		2075	4199	6274	PLEKHH1	SO:0001583	missense	0			-	HGNC	AB033026	CCDS45128.1	14q24.1	2013-01-10				ENSG00000054690		"""Pleckstrin homology (PH) domain containing"""	17733	protein-coding gene	gene with protein product						10574462	Standard	NM_020715		Approved	KIAA1200	uc001xjl.1	Q9ULM0		ENST00000329153.5:c.1588G>T	14.37:g.68038854G>T	ENSP00000330278:p.Val530Phe	Somatic	0	66	0.00		0.5117654914895859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51	A6H8X6|Q6PJL4|Q6ZWC7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Pleckstrin_homology,pfam_MyTH4_dom,pfam_FERM_central,superfamily_FERM_central,smart_Pleckstrin_homology,smart_MyTH4_dom,smart_Band_41_domain,pfscan_FERM_domain,pfscan_MyTH4_dom,pfscan_Pleckstrin_homology	p.V530F	ENST00000329153.5	37	c.1588	CCDS45128.1	14	.	.	.	.	.	.	.	.	.	.	G	28.2	4.903660	0.92035	.	.	ENSG00000054690	ENST00000329153	T	0.14022	2.54	4.78	4.78	0.61160	.	0.128905	0.52532	D	0.000072	T	0.36082	0.0954	M	0.69823	2.125	0.80722	D	1	D;P	0.69078	0.997;0.932	D;P	0.67900	0.954;0.699	T	0.13282	-1.0515	10	0.87932	D	0	.	16.24	0.82402	0.0:0.0:1.0:0.0	.	45;530	Q9ULM0-2;Q9ULM0	.;PKHH1_HUMAN	F	530	ENSP00000330278:V530F	ENSP00000330278:V530F	V	+	1	0	PLEKHH1	67108607	1.000000	0.71417	0.991000	0.47740	0.824000	0.46624	9.284000	0.95882	2.481000	0.83766	0.555000	0.69702	GTC	-	NULL		0.657	PLEKHH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHH1	protein_coding	OTTHUMT00000412730.3	G	XM_031054	-		68038854	+1	no_errors	ENST00000329153	ensembl	human	known	74_37	missense	SNP	1.000	T
SLC25A19	60386	genome.wustl.edu	37	17	73269841	73269842	+	Intron	INS	-	-	TTATT	rs3082641|rs35986946|rs55758835	byFrequency	TCGA-VT-AB3D-01A-12D-A417-09	TCGA-VT-AB3D-10A-01D-A41A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51932322-cd96-4c1b-a8ba-660637fff36b	c94fc63b-bf20-4585-9319-5f35435795df	g.chr17:73269841_73269842insTTATT	ENST00000402418.3	-	6	1684				SLC25A19_ENST00000375261.4_Intron|MIF4GD_ENST00000325102.8_5'Flank|MIF4GD_ENST00000578305.1_5'Flank|MIF4GD_ENST00000579297.1_5'Flank|MIF4GD_ENST00000577542.1_5'Flank|SLC25A19_ENST00000442286.2_Intron|MIF4GD_ENST00000580571.1_5'Flank|MIF4GD_ENST00000245551.5_5'Flank|SLC25A19_ENST00000416858.2_Intron|SLC25A19_ENST00000320362.3_Intron|SLC25A19_ENST00000580994.1_Intron|RP11-649A18.12_ENST00000585075.1_RNA|RP11-649A18.12_ENST00000582668.1_RNA			Q9HC21	TPC_HUMAN	solute carrier family 25 (mitochondrial thiamine pyrophosphate carrier), member 19						deoxynucleotide transport (GO:0030302)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|nucleus (GO:0005634)	deoxynucleotide transmembrane transporter activity (GO:0030233)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)|skin(1)	9	all_cancers(13;5.98e-08)|all_epithelial(9;1.16e-08)|Breast(9;3.1e-08)		all cancers(21;6.82e-07)|Epithelial(20;6.86e-06)			AAAATAGCAAAttattttattt	0.465														4192	0.837061	0.7103	0.879	5008	,	,		24978	0.9256		0.7992	False		,,,				2504	0.9264																0								ENSG00000263843																																			RP11-649A18.12	SO:0001627	intron_variant	0				Clone_based_vega_gene		CCDS11720.1	17q25.1	2013-05-22	2007-03-08		ENSG00000125454	ENSG00000125454		"""Solute carriers"""	14409	protein-coding gene	gene with protein product		606521	"""solute carrier family 25 (mitochondrial deoxynucleotide carrier), member 19"", ""microcephaly, Amish"""	MCPHA		11474176, 11226231, 19798730	Standard	NM_021734		Approved	DNC, MUP1, TPC	uc002jnw.4	Q9HC21		ENST00000402418.3:c.775-121->AATAA	17.37:g.73269847_73269851dupTTATT		Somatic	NA	NA	NA		0.5117654914895859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	E9PF74|Q6V9R7	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000402418.3	37	NULL	CCDS11720.1	17																																																																																			-	-		0.465	SLC25A19-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LOC100287042	protein_coding	OTTHUMT00000447282.1	-	NM_021734			73269842	+1	no_errors	ENST00000585075	ensembl	human	known	74_37	rna	INS	0.003:0.004	TTATT
CALN1	83698	genome.wustl.edu	37	7	71275389	71275389	+	Missense_Mutation	SNP	T	T	C			TCGA-VT-AB3D-01A-12D-A417-09	TCGA-VT-AB3D-10A-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51932322-cd96-4c1b-a8ba-660637fff36b	c94fc63b-bf20-4585-9319-5f35435795df	g.chr7:71275389T>C	ENST00000329008.5	-	5	762	c.464A>G	c.(463-465)aAc>aGc	p.N155S	CALN1_ENST00000412588.1_Missense_Mutation_p.N197S|CALN1_ENST00000405452.2_Missense_Mutation_p.N155S|CALN1_ENST00000395276.2_Missense_Mutation_p.N155S|CALN1_ENST00000431984.1_Missense_Mutation_p.N155S|CALN1_ENST00000395275.2_Missense_Mutation_p.N197S	NM_001017440.2	NP_001017440.1	Q9BXU9	CABP8_HUMAN	calneuron 1	155						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(1)|endometrium(3)|large_intestine(6)|lung(19)|skin(2)	32		all_cancers(73;0.069)|Lung NSC(55;0.0658)|all_lung(88;0.0912)|all_epithelial(88;0.161)				GATAATGATGTTCTCAATGTC	0.488																																																	0								ENSG00000183166						212.0	171.0	185.0					7																	71275389		2203	4300	6503	CALN1	SO:0001583	missense	0			-	HGNC	AF282250	CCDS5541.1, CCDS47603.1	7q11	2013-01-10			ENSG00000183166	ENSG00000183166		"""EF-hand domain containing"""	13248	protein-coding gene	gene with protein product	"""calcium-binding protein CABP8"""	607176				11286509	Standard	NM_031468		Approved		uc003twb.4	Q9BXU9	OTTHUMG00000023787	ENST00000329008.5:c.464A>G	7.37:g.71275389T>C	ENSP00000332498:p.Asn155Ser	Somatic	0	67	0.00		0.5117654914895859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51	J3KQA7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_EF_hand_dom,smart_EF_hand_dom,pfscan_EF_hand_dom	p.N197S	ENST00000329008.5	37	c.590	CCDS5541.1	7	.	.	.	.	.	.	.	.	.	.	T	19.63	3.863169	0.71949	.	.	ENSG00000183166	ENST00000329008;ENST00000395275;ENST00000395276;ENST00000431984;ENST00000412588;ENST00000405452	T;T;T;T;T;T	0.62498	0.02;0.02;0.02;0.02;0.02;0.02	5.1	3.96	0.45880	.	0.043916	0.85682	N	0.000000	T	0.67335	0.2882	L	0.32530	0.975	0.41919	D	0.990508	D;D	0.71674	0.998;0.998	D;D	0.77557	0.99;0.99	T	0.69007	-0.5259	10	0.72032	D	0.01	-19.9429	10.0744	0.42351	0.0:0.0784:0.0:0.9216	.	155;155	A4D1Z1;Q9BXU9	.;CABP8_HUMAN	S	155;197;155;155;197;155	ENSP00000332498:N155S;ENSP00000378690:N197S;ENSP00000378691:N155S;ENSP00000410704:N155S;ENSP00000391882:N197S;ENSP00000384354:N155S	ENSP00000332498:N155S	N	-	2	0	CALN1	70913325	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.852000	0.62904	0.985000	0.38656	0.533000	0.62120	AAC	-	NULL		0.488	CALN1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	CALN1	protein_coding	OTTHUMT00000320044.2	T	NM_031468	-		71275389	-1	no_errors	ENST00000395275	ensembl	human	known	74_37	missense	SNP	1.000	C
TTC22	55001	genome.wustl.edu	37	1	55251777	55251777	+	Missense_Mutation	SNP	C	C	T	rs145786276		TCGA-VT-AB3D-01A-12D-A417-09	TCGA-VT-AB3D-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51932322-cd96-4c1b-a8ba-660637fff36b	c94fc63b-bf20-4585-9319-5f35435795df	g.chr1:55251777C>T	ENST00000371276.4	-	5	1002	c.899G>A	c.(898-900)cGc>cAc	p.R300H	TTC22_ENST00000371274.4_Missense_Mutation_p.R300H	NM_001114108.1	NP_001107580.1	Q5TAA0	TTC22_HUMAN	tetratricopeptide repeat domain 22	300										kidney(1)|large_intestine(1)|lung(7)|skin(1)	10						TTTTGCCAGGCGATTCAGGAT	0.502																																																	0								ENSG00000006555	C	HIS/ARG,HIS/ARG	0,4406		0,0,2203	115.0	98.0	104.0		899,899	3.6	1.0	1	dbSNP_134	104	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	TTC22	NM_001114108.1,NM_017904.3	29,29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging	300/570,300/373	55251777	1,13005	2203	4300	6503	TTC22	SO:0001583	missense	0			-	HGNC	AK000626	CCDS598.1, CCDS44152.1	1p32.3	2013-01-11			ENSG00000006555	ENSG00000006555		"""Tetratricopeptide (TTC) repeat domain containing"""	26067	protein-coding gene	gene with protein product							Standard	NM_017904		Approved	FLJ20619	uc009vzt.1	Q5TAA0	OTTHUMG00000009916	ENST00000371276.4:c.899G>A	1.37:g.55251777C>T	ENSP00000360323:p.Arg300His	Somatic	0	58	0.00		0.5117654914895859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	40	9.09	Q9NWT4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_TPR_repeat	p.R300H	ENST00000371276.4	37	c.899	CCDS44152.1	1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.956289	0.73902	0.0	1.16E-4	ENSG00000006555	ENST00000371276;ENST00000371274;ENST00000448308	T;T;T	0.73789	-0.78;1.54;0.18	4.53	3.62	0.41486	Tetratricopeptide-like helical (1);	0.067118	0.64402	D	0.000009	T	0.62841	0.2461	L	0.32530	0.975	0.49051	D	0.999745	B;B	0.25007	0.022;0.116	B;B	0.17098	0.005;0.017	T	0.62996	-0.6735	10	0.72032	D	0.01	-25.7824	11.816	0.52211	0.0:0.9131:0.0:0.0869	.	300;300	Q5TAA0;Q5TAA0-2	TTC22_HUMAN;.	H	300;300;81	ENSP00000360323:R300H;ENSP00000360321:R300H;ENSP00000390300:R81H	ENSP00000360321:R300H	R	-	2	0	TTC22	55024365	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	2.959000	0.49153	1.126000	0.42016	0.561000	0.74099	CGC	-	smart_TPR_repeat		0.502	TTC22-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	TTC22	protein_coding	OTTHUMT00000027438.1	C	NM_017904	rs145786276		55251777	-1	no_errors	ENST00000371276	ensembl	human	known	74_37	missense	SNP	1.000	T
SARM1	23098	genome.wustl.edu	37	17	26708340	26708340	+	Nonsense_Mutation	SNP	G	G	T			TCGA-VT-AB3D-01A-12D-A417-09	TCGA-VT-AB3D-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51932322-cd96-4c1b-a8ba-660637fff36b	c94fc63b-bf20-4585-9319-5f35435795df	g.chr17:26708340G>T	ENST00000457710.3	+	2	958	c.487G>T	c.(487-489)Gag>Tag	p.E163*	SARM1_ENST00000379061.4_3'UTR|CTB-96E2.3_ENST00000591482.1_RNA|TMEM199_ENST00000509083.1_Missense_Mutation_p.G217V	NM_015077.2	NP_055892.2	Q6SZW1	SARM1_HUMAN	sterile alpha and TIR motif containing 1	197					innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|regulation of apoptotic process (GO:0042981)|regulation of dendrite morphogenesis (GO:0048814)|regulation of neuron death (GO:1901214)|response to glucose (GO:0009749)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|extrinsic component of mitochondrial outer membrane (GO:0031315)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|synapse (GO:0045202)				cervix(1)|endometrium(1)|large_intestine(3)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	12	all_lung(13;0.000533)|Lung NSC(42;0.00171)			UCEC - Uterine corpus endometrioid carcinoma (53;0.154)		GCATTCGGAGGAGACATGCCA	0.682																																																	0								ENSG00000004139						38.0	33.0	35.0					17																	26708340		2199	4287	6486	SARM1	SO:0001587	stop_gained	0			-	HGNC	AB011096		17q11	2013-01-10			ENSG00000004139	ENSG00000004139		"""Sterile alpha motif (SAM) domain containing"""	17074	protein-coding gene	gene with protein product		607732				9628581	Standard	NM_015077		Approved	SARM, SAMD2, KIAA0524	uc010crl.1	Q6SZW1	OTTHUMG00000132499	ENST00000457710.3:c.487G>T	17.37:g.26708340G>T	ENSP00000406738:p.Glu163*	Somatic	0	54	0.00		0.5117654914895859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	26	21.21	O60277|Q7LGG3|Q9NXY5	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SAM_2,pfam_SAM_type1,superfamily_ARM-type_fold,superfamily_TIR_dom,superfamily_SAM/pointed,smart_SAM,smart_TIR_dom,pfscan_SAM	p.E163*	ENST00000457710.3	37	c.487		17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	40|40	8.147246|8.147246	0.98678|0.98678	.|.	.|.	ENSG00000004139|ENSG00000244045	ENST00000457710;ENST00000003834|ENST00000509083	.|T	.|0.47869	.|0.83	5.01|5.01	5.01|5.01	0.66863|0.66863	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	.|T	.|0.66752	.|0.2821	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|D	.|0.65815	.|0.995	.|P	.|0.59643	.|0.861	.|T	.|0.72191	.|-0.4365	.|7	0.22109|0.87932	T|D	0.4|0	-17.3493|-17.3493	18.3363|18.3363	0.90288|0.90288	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|217	.|E9PBQ3	.|.	X|V	195;163|217	.|ENSP00000427614:G217V	ENSP00000003834:E163X|ENSP00000427614:G217V	E|G	+|+	1|2	0|0	SARM1|TMEM199	23732467|23732467	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.953000|0.953000	0.61014|0.61014	9.807000|9.807000	0.99171|0.99171	2.323000|2.323000	0.78572|0.78572	0.563000|0.563000	0.77884|0.77884	GAG|GGA	-	superfamily_ARM-type_fold		0.682	SARM1-001	NOVEL	basic|appris_principal|exp_conf	protein_coding	SARM1	protein_coding	OTTHUMT00000255679.3	G	NM_015077	-		26708340	+1	no_errors	ENST00000457710	ensembl	human	novel	74_37	nonsense	SNP	1.000	T
FAM111B	374393	genome.wustl.edu	37	11	58892214	58892214	+	Missense_Mutation	SNP	C	C	T			TCGA-VT-AB3D-01A-12D-A417-09	TCGA-VT-AB3D-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51932322-cd96-4c1b-a8ba-660637fff36b	c94fc63b-bf20-4585-9319-5f35435795df	g.chr11:58892214C>T	ENST00000343597.3	+	4	835	c.644C>T	c.(643-645)gCc>gTc	p.A215V	FAM111B_ENST00000529618.1_Missense_Mutation_p.A185V|FAM111B_ENST00000411426.1_Missense_Mutation_p.A185V	NM_198947.3	NP_945185.1	Q6SJ93	F111B_HUMAN	family with sequence similarity 111, member B	215							catalytic activity (GO:0003824)	p.A215G(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(12)|ovary(3)|pancreas(1)|skin(1)	40						TGTATTTATGCCTTGAAGGGT	0.368																																																	1	Substitution - Missense(1)	lung(1)						ENSG00000189057						93.0	91.0	92.0					11																	58892214		2201	4294	6495	FAM111B	SO:0001583	missense	0			-	HGNC	BC062456	CCDS7972.1, CCDS44611.1	11q12.1	2014-03-13			ENSG00000189057	ENSG00000189057			24200	protein-coding gene	gene with protein product		615584				24268661	Standard	NM_198947		Approved	CANP	uc001nnl.3	Q6SJ93	OTTHUMG00000167279	ENST00000343597.3:c.644C>T	11.37:g.58892214C>T	ENSP00000341565:p.Ala215Val	Somatic	0	41	0.00		0.5117654914895859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	40	9.09	B4E2G2|Q6P661	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_Trypsin-like_Pept_dom	p.A215V	ENST00000343597.3	37	c.644	CCDS7972.1	11	.	.	.	.	.	.	.	.	.	.	C	16.68	3.190555	0.58017	.	.	ENSG00000189057	ENST00000411426;ENST00000529618;ENST00000343597	T;T;T	0.49720	0.77;0.77;0.78	4.37	-1.22	0.09494	.	0.388394	0.20408	N	0.092904	T	0.59528	0.2200	M	0.74881	2.28	0.09310	N	1	D	0.69078	0.997	P	0.61397	0.888	T	0.55270	-0.8167	10	0.72032	D	0.01	.	10.3848	0.44134	0.1295:0.3578:0.5127:0.0	.	215	Q6SJ93	F111B_HUMAN	V	185;185;215	ENSP00000393855:A185V;ENSP00000432875:A185V;ENSP00000341565:A215V	ENSP00000341565:A215V	A	+	2	0	FAM111B	58648790	0.559000	0.26562	0.013000	0.15412	0.092000	0.18411	0.777000	0.26718	0.027000	0.15297	-0.181000	0.13052	GCC	-	NULL		0.368	FAM111B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM111B	protein_coding	OTTHUMT00000393974.1	C	NM_198947	-		58892214	+1	no_errors	ENST00000343597	ensembl	human	known	74_37	missense	SNP	0.049	T
QRICH1	54870	genome.wustl.edu	37	3	49066224	49066224	+	IGR	SNP	G	G	T			TCGA-VT-AB3D-01A-12D-A417-09	TCGA-VT-AB3D-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51932322-cd96-4c1b-a8ba-660637fff36b	c94fc63b-bf20-4585-9319-5f35435795df	g.chr3:49066224G>T	ENST00000395443.2	-	0	3549				RP13-131K19.6_ENST00000607245.1_RNA|IMPDH2_ENST00000326739.4_Silent_p.L38L	NM_198880.1	NP_942581.1	Q2TAL8	QRIC1_HUMAN	glutamine-rich 1							nucleus (GO:0005634)				breast(2)|endometrium(5)|large_intestine(8)|lung(8)|ovary(1)|skin(1)	25				BRCA - Breast invasive adenocarcinoma(193;8.88e-05)|Kidney(197;0.00239)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)		TGTACCCAGGGAGAATGAGAA	0.507																																																	0								ENSG00000178035						137.0	108.0	118.0					3																	49066224		2203	4300	6503	IMPDH2	SO:0001628	intergenic_variant	0			-	HGNC		CCDS2787.1	3p21.31	2011-06-03			ENSG00000198218	ENSG00000198218			24713	protein-coding gene	gene with protein product						12477932	Standard	NM_017730		Approved	FLJ20259	uc003cvv.3	Q2TAL8	OTTHUMG00000156772		3.37:g.49066224G>T		Somatic	0	31	0.00		0.5117654914895859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	10	23.08	Q4G0F7|Q7L621|Q8TEA5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_IMP_DH_GMPRt,pfam_CBS_dom,pfam_2Npropane_dOase,pfam_FMN-dep_DH,pfam_NanE,smart_CBS_dom,pirsf_IMP_DH,tigrfam_IMP_DH	p.L38	ENST00000395443.2	37	c.114	CCDS2787.1	3																																																																																			-	pfam_IMP_DH_GMPRt,pirsf_IMP_DH,tigrfam_IMP_DH		0.507	QRICH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IMPDH2	protein_coding	OTTHUMT00000345669.1	G	NM_017730	-		49066224	-1	no_errors	ENST00000326739	ensembl	human	known	74_37	silent	SNP	0.919	T
SYT4	6860	genome.wustl.edu	37	18	40853554	40853554	+	Silent	SNP	T	T	C			TCGA-VT-AB3D-01A-12D-A417-09	TCGA-VT-AB3D-10A-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51932322-cd96-4c1b-a8ba-660637fff36b	c94fc63b-bf20-4585-9319-5f35435795df	g.chr18:40853554T>C	ENST00000255224.3	-	2	1208	c.840A>G	c.(838-840)agA>agG	p.R280R	SYT4_ENST00000586678.1_Intron|SYT4_ENST00000590752.1_Silent_p.R262R	NM_020783.3	NP_065834.1	Q9H2B2	SYT4_HUMAN	synaptotagmin IV	280	Phospholipid binding. {ECO:0000305}.				exocytosis (GO:0006887)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of vesicle fusion (GO:0031339)|neurotransmitter secretion (GO:0007269)	cell junction (GO:0030054)|dense core granule (GO:0031045)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(25)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	44						CCCTAACATTTCTCTTGATGA	0.294																																					NSCLC(85;81 1419 2855 22820 35912)												0								ENSG00000132872						28.0	29.0	29.0					18																	40853554		2115	4253	6368	SYT4	SO:0001819	synonymous_variant	0			-	HGNC	BC036538	CCDS11922.1	18q12.3	2013-01-21			ENSG00000132872	ENSG00000132872		"""Synaptotagmins"""	11512	protein-coding gene	gene with protein product		600103				8058779	Standard	NM_020783		Approved	KIAA1342, HsT1192	uc002law.3	Q9H2B2	OTTHUMG00000132610	ENST00000255224.3:c.840A>G	18.37:g.40853554T>C		Somatic	0	77	0.00		0.5117654914895859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	71	17.44	B4DEU3|Q9P2K4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom,prints_Synaptotagmin	p.R280	ENST00000255224.3	37	c.840	CCDS11922.1	18																																																																																			-	NULL		0.294	SYT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYT4	protein_coding	OTTHUMT00000255851.2	T	NM_020783	-		40853554	-1	no_errors	ENST00000255224	ensembl	human	known	74_37	silent	SNP	1.000	C
SMYD5	10322	genome.wustl.edu	37	2	73452008	73452008	+	Missense_Mutation	SNP	G	G	T			TCGA-VT-AB3D-01A-12D-A417-09	TCGA-VT-AB3D-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51932322-cd96-4c1b-a8ba-660637fff36b	c94fc63b-bf20-4585-9319-5f35435795df	g.chr2:73452008G>T	ENST00000389501.4	+	11	1000	c.955G>T	c.(955-957)Gtg>Ttg	p.V319L		NM_006062.2	NP_006053.2	Q6GMV2	SMYD5_HUMAN	SMYD family member 5	319	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.						metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			NS(1)|breast(1)|endometrium(1)|large_intestine(3)|lung(5)|pancreas(1)|upper_aerodigestive_tract(1)	13						CCACAGTTGTGTGCCCAATGC	0.468																																																	0								ENSG00000135632						126.0	109.0	115.0					2																	73452008		2203	4300	6503	SMYD5	SO:0001583	missense	0			-	HGNC	U50383	CCDS33221.2	2p12	2007-02-09	2003-05-14	2003-05-16	ENSG00000135632	ENSG00000135632		"""Zinc fingers, MYND-type"""	16258	protein-coding gene	gene with protein product			"""retinoic acid induced 15"""	RAI15		8754834	Standard	NM_006062		Approved	RRG1, NN8-4AG, ZMYND23	uc002siw.2	Q6GMV2	OTTHUMG00000150482	ENST00000389501.4:c.955G>T	2.37:g.73452008G>T	ENSP00000374152:p.Val319Leu	Somatic	0	31	0.00		0.5117654914895859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	34	10.53	D6W5H3|Q13558	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SET_dom,smart_SET_dom,pfscan_SET_dom	p.V319L	ENST00000389501.4	37	c.955	CCDS33221.2	2	.	.	.	.	.	.	.	.	.	.	G	14.64	2.596176	0.46318	.	.	ENSG00000135632	ENST00000389501	D	0.81499	-1.5	5.06	5.06	0.68205	SET domain (3);	0.207416	0.43260	D	0.000593	T	0.68760	0.3036	L	0.31578	0.945	0.46701	D	0.99916	P	0.34462	0.454	B	0.34138	0.176	T	0.64508	-0.6391	10	0.20046	T	0.44	-19.7046	11.83	0.52290	0.0845:0.0:0.9155:0.0	.	319	Q6GMV2	SMYD5_HUMAN	L	319	ENSP00000374152:V319L	ENSP00000374152:V319L	V	+	1	0	SMYD5	73305516	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	3.682000	0.54656	2.813000	0.96785	0.655000	0.94253	GTG	-	pfam_SET_dom,smart_SET_dom,pfscan_SET_dom		0.468	SMYD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMYD5	protein_coding	OTTHUMT00000318301.1	G	NM_006062	-		73452008	+1	no_errors	ENST00000389501	ensembl	human	known	74_37	missense	SNP	1.000	T
LIPE	3991	genome.wustl.edu	37	19	42930831	42930831	+	Silent	SNP	A	A	G			TCGA-VT-AB3D-01A-12D-A417-09	TCGA-VT-AB3D-10A-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51932322-cd96-4c1b-a8ba-660637fff36b	c94fc63b-bf20-4585-9319-5f35435795df	g.chr19:42930831A>G	ENST00000244289.4	-	1	747	c.471T>C	c.(469-471)ccT>ccC	p.P157P	LIPE-AS1_ENST00000593740.2_RNA|LIPE-AS1_ENST00000594624.2_RNA|CTB-50E14.4_ENST00000596781.1_RNA|LIPE-AS1_ENST00000597203.1_RNA|LIPE-AS1_ENST00000457234.2_RNA|LIPE-AS1_ENST00000594688.1_RNA	NM_005357.2	NP_005348.2	Q05469	LIPS_HUMAN	lipase, hormone-sensitive	157					cholesterol metabolic process (GO:0008203)|diacylglycerol catabolic process (GO:0046340)|lipid catabolic process (GO:0016042)|long-chain fatty acid catabolic process (GO:0042758)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)	cytosol (GO:0005829)|lipid particle (GO:0005811)|plasma membrane (GO:0005886)	hormone-sensitive lipase activity (GO:0033878)|triglyceride lipase activity (GO:0004806)			breast(2)|endometrium(4)|kidney(7)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	32		Prostate(69;0.00682)				CCTGGGCCGCAGGTGTTGATT	0.557																																																	0								ENSG00000079435						93.0	91.0	92.0					19																	42930831		2203	4300	6503	LIPE	SO:0001819	synonymous_variant	0			-	HGNC	L11706	CCDS12607.1	19q13.1-q13.2	2014-03-14			ENSG00000079435	ENSG00000079435	3.1.1.3		6621	protein-coding gene	gene with protein product		151750				8506334	Standard	NM_005357		Approved	HSL	uc002otr.3	Q05469	OTTHUMG00000182814	ENST00000244289.4:c.471T>C	19.37:g.42930831A>G		Somatic	0	27	0.00		0.5117654914895859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	11	21.43	Q3LRT2|Q6NSL7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_HSL_N,pfam_AB_hydrolase_3,pfam_Steryl_acetyl_hydrolase	p.P157	ENST00000244289.4	37	c.471	CCDS12607.1	19																																																																																			-	NULL		0.557	LIPE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIPE	protein_coding	OTTHUMT00000463861.1	A	NM_005357	-		42930831	-1	no_errors	ENST00000244289	ensembl	human	known	74_37	silent	SNP	0.044	G
SHARPIN	81858	genome.wustl.edu	37	8	145154476	145154476	+	Silent	SNP	C	C	T			TCGA-VT-AB3D-01A-12D-A417-09	TCGA-VT-AB3D-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51932322-cd96-4c1b-a8ba-660637fff36b	c94fc63b-bf20-4585-9319-5f35435795df	g.chr8:145154476C>T	ENST00000398712.2	-	5	1141	c.705G>A	c.(703-705)gcG>gcA	p.A235A	SHARPIN_ENST00000533948.1_5'UTR	NM_030974.3	NP_112236.3	Q9H0F6	SHRPN_HUMAN	SHANK-associated RH domain interactor	235	Interaction with SHANK1. {ECO:0000250}.|Ubiquitin-like.				apoptotic nuclear changes (GO:0030262)|brain development (GO:0007420)|keratinization (GO:0031424)|mitochondrion organization (GO:0007005)|negative regulation of inflammatory response (GO:0050728)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein homooligomerization (GO:0051260)|protein linear polyubiquitination (GO:0097039)|regulation of CD40 signaling pathway (GO:2000348)|regulation of tumor necrosis factor-mediated signaling pathway (GO:0010803)	cell junction (GO:0030054)|cytosol (GO:0005829)|dendrite (GO:0030425)|LUBAC complex (GO:0071797)|postsynaptic density (GO:0014069)	polyubiquitin binding (GO:0031593)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(1)|lung(2)|ovary(2)	7	all_cancers(97;2.87e-11)|all_epithelial(106;2.16e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;4.1e-42)|Epithelial(56;1.58e-40)|all cancers(56;6.12e-36)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			GTGCAGAGGACGCGGCGGATG	0.652																																																	0								ENSG00000179526						44.0	54.0	51.0					8																	145154476		2155	4267	6422	SHARPIN	SO:0001819	synonymous_variant	0			-	HGNC	AL136816	CCDS43777.1	8q24.3	2005-08-09				ENSG00000179526			25321	protein-coding gene	gene with protein product		611885				11178875, 12753155	Standard	NM_030974		Approved	DKFZP434N1923, SIPL1	uc003zba.3	Q9H0F6		ENST00000398712.2:c.705G>A	8.37:g.145154476C>T		Somatic	0	32	0.00		0.5117654914895859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	34	12.50	A6NEG3|C0L3L2|D3DWL3|Q8IXF5|Q8IXF6|Q8N2E7|Q8TB25|Q9BUE4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_RanBP2,smart_Znf_RanBP2,pfscan_Znf_RanBP2	p.A235	ENST00000398712.2	37	c.705	CCDS43777.1	8																																																																																			-	NULL		0.652	SHARPIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHARPIN	protein_coding	OTTHUMT00000382901.1	C	NM_030974	-		145154476	-1	no_errors	ENST00000398712	ensembl	human	known	74_37	silent	SNP	0.001	T
MFSD2A	84879	genome.wustl.edu	37	1	40432576	40432576	+	Missense_Mutation	SNP	G	G	A			TCGA-VT-AB3D-01A-12D-A417-09	TCGA-VT-AB3D-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51932322-cd96-4c1b-a8ba-660637fff36b	c94fc63b-bf20-4585-9319-5f35435795df	g.chr1:40432576G>A	ENST00000372809.5	+	8	1081	c.938G>A	c.(937-939)gGc>gAc	p.G313D	MFSD2A_ENST00000372811.5_Missense_Mutation_p.G300D|MFSD2A_ENST00000480630.1_Intron|MFSD2A_ENST00000420632.2_Missense_Mutation_p.G144D	NM_001136493.1	NP_001129965.1	Q8NA29	NLS1_HUMAN	major facilitator superfamily domain containing 2A	313					establishment of blood-brain barrier (GO:0060856)|fatty acid transport (GO:0015908)|lipid transport across blood brain barrier (GO:1990379)|transcytosis (GO:0045056)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phospholipid transporter activity (GO:0005548)|symporter activity (GO:0015293)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	24						CTTATTACTGGCTTCCTCTTC	0.572																																																	0								ENSG00000168389						127.0	117.0	120.0					1																	40432576		2203	4300	6503	MFSD2A	SO:0001583	missense	0			-	HGNC	AK093223	CCDS446.1, CCDS44118.1, CCDS72762.1	1p34.2	2009-09-08	2009-09-08	2009-09-08	ENSG00000168389	ENSG00000168389			25897	protein-coding gene	gene with protein product		614397	"""major facilitator superfamily domain containing 2"""	MFSD2		18694395	Standard	XM_005271285		Approved	FLJ14490	uc001cev.3	Q8NA29	OTTHUMG00000009293	ENST00000372809.5:c.938G>A	1.37:g.40432576G>A	ENSP00000361895:p.Gly313Asp	Somatic	0	20	0.00		0.5117654914895859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	21	16.00	A8K675|Q6UWU5|Q96F59|Q9BRC8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	p.G313D	ENST00000372809.5	37	c.938	CCDS44118.1	1	.	.	.	.	.	.	.	.	.	.	G	16.82	3.228136	0.58777	.	.	ENSG00000168389	ENST00000372811;ENST00000420632;ENST00000372809	D;D;D	0.87809	-2.3;-2.3;-2.3	5.64	1.38	0.22167	Major facilitator superfamily domain, general substrate transporter (1);	0.192901	0.56097	D	0.000033	D	0.91791	0.7403	M	0.66939	2.045	0.80722	D	1	D;D;D	0.59767	0.986;0.986;0.968	D;D;D	0.72075	0.969;0.976;0.947	D	0.89837	0.4000	10	0.36615	T	0.2	-4.4204	17.3882	0.87422	0.0:0.4819:0.5181:0.0	.	261;313;300	B4DNN7;Q8NA29;Q8NA29-2	.;MFS2A_HUMAN;.	D	300;144;313	ENSP00000361898:G300D;ENSP00000391261:G144D;ENSP00000361895:G313D	ENSP00000361895:G313D	G	+	2	0	MFSD2A	40205163	1.000000	0.71417	0.861000	0.33841	0.602000	0.36980	2.838000	0.48199	0.068000	0.16574	0.563000	0.77884	GGC	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt		0.572	MFSD2A-002	KNOWN	basic|CCDS	protein_coding	MFSD2A	protein_coding	OTTHUMT00000025756.1	G	NM_032793	-		40432576	+1	no_errors	ENST00000372809	ensembl	human	known	74_37	missense	SNP	1.000	A
ZAK	51776	genome.wustl.edu	37	2	174086202	174086204	+	Intron	DEL	GAT	GAT	-	rs150632797|rs376385531		TCGA-VT-AB3D-01A-12D-A417-09	TCGA-VT-AB3D-10A-01D-A41A-09	GAT	GAT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51932322-cd96-4c1b-a8ba-660637fff36b	c94fc63b-bf20-4585-9319-5f35435795df	g.chr2:174086202_174086204delGAT	ENST00000375213.3	+	11	1065				MLTK_ENST00000539448.1_In_Frame_Del_p.D443del|MLTK_ENST00000409176.2_Intron|MLTK_ENST00000431503.2_In_Frame_Del_p.D342del|MLK7-AS1_ENST00000423106.2_RNA|MLK7-AS1_ENST00000422703.1_RNA|MLTK_ENST00000338983.3_In_Frame_Del_p.D443del	NM_016653.2	NP_057737.2	Q9NYL2	MLTK_HUMAN							activation of JUN kinase activity (GO:0007257)|activation of MAPKK activity (GO:0000186)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell death (GO:0008219)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|DNA damage checkpoint (GO:0000077)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|protein phosphorylation (GO:0006468)|response to radiation (GO:0009314)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase kinase kinase activity (GO:0004709)|poly(A) RNA binding (GO:0044822)|protein serine/threonine kinase activity (GO:0004674)										AGAAGGtgacgatgatgatgatg	0.404																																																	0								ENSG00000091436		,	2,8,25,4231		0,0,0,2,0,0,8,0,25,2098					,	-0.8	1.0			55	15,0,45,8194		0,0,0,15,0,0,0,0,45,4067	no	codingComplex,intron	ZAK	NM_133646.2,NM_016653.2	,	0,0,0,17,0,0,8,0,70,6165	A1A1,A1A2,A1A3,A1R,A2A2,A2A3,A2R,A3A3,A3R,RR		0.7269,0.8204,0.7588	,	,		17,8,70,12425				MLTK	SO:0001627	intron_variant	0				Uniprot_gn																												ENST00000375213.3:c.987+4224GAT>-	2.37:g.174086211_174086213delGAT		Somatic	0	55	0.00		0.5117654914895859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	40	11.11	B3KPG2|Q53SX1|Q580W8|Q59GY5|Q86YW8|Q9HCC4|Q9HCC5|Q9HDD2|Q9NYE9	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.D441in_frame_del	ENST00000375213.3	37	c.1312_1314	CCDS42777.1	2																																																																																			-	NULL		0.404	MLTK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZAK	protein_coding	OTTHUMT00000255401.1	GAT				174086204	+1	no_errors	ENST00000338983	ensembl	human	known	74_37	in_frame_del	DEL	0.975:0.977:0.983	-
RP11-435B5.5	0	genome.wustl.edu	37	1	143394413	143394413	+	lincRNA	SNP	C	C	T	rs6696542	byFrequency	TCGA-VT-AB3D-01A-12D-A417-09	TCGA-VT-AB3D-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51932322-cd96-4c1b-a8ba-660637fff36b	c94fc63b-bf20-4585-9319-5f35435795df	g.chr1:143394413C>T	ENST00000428624.1	+	0	2441				RP11-435B5.4_ENST00000423249.1_lincRNA																							TATCCATTTGCTAACTTTATT	0.303													.|||	656	0.13099	0.1354	0.134	5008	,	,		39194	0.1071		0.17	False		,,,				2504	0.1074																0								ENSG00000238261																																			RP11-435B5.5			0			-	Clone_based_vega_gene																													1.37:g.143394413C>T		Somatic	0	12	0.00		0.5117654914895859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	16	38.46		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000428624.1	37	NULL		1																																																																																			-	-		0.303	RP11-435B5.5-002	KNOWN	not_best_in_genome_evidence|basic	lincRNA	LOC101927345	lincRNA	OTTHUMT00000037971.1	C		rs6696542		143394413	+1	no_errors	ENST00000415543	ensembl	human	known	74_37	rna	SNP	0.031	T
BEND4	389206	genome.wustl.edu	37	4	42119561	42119561	+	Missense_Mutation	SNP	T	T	G			TCGA-VT-AB3D-01A-12D-A417-09	TCGA-VT-AB3D-10A-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51932322-cd96-4c1b-a8ba-660637fff36b	c94fc63b-bf20-4585-9319-5f35435795df	g.chr4:42119561T>G	ENST00000502486.1	-	6	2158	c.1579A>C	c.(1579-1581)Agt>Cgt	p.S527R	BEND4_ENST00000504360.1_3'UTR	NM_207406.3	NP_997289.2	Q6ZU67	BEND4_HUMAN	BEN domain containing 4	527										NS(2)|breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(15)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	26						TCCTGGGAACTTTTATTGAAG	0.517																																																	0								ENSG00000188848						49.0	49.0	49.0					4																	42119561		1856	4102	5958	BEND4	SO:0001583	missense	0			-	HGNC	AK092951	CCDS47048.1	4p13	2012-11-22	2008-10-03	2008-10-03	ENSG00000188848	ENSG00000188848		"""BEN domain containing"""	23815	protein-coding gene	gene with protein product			"""coiled-coil domain containing 4"""	CCDC4			Standard	NM_207406		Approved	FLJ35632, FLJ43965	uc003gwn.3	Q6ZU67	OTTHUMG00000160531	ENST00000502486.1:c.1579A>C	4.37:g.42119561T>G	ENSP00000421169:p.Ser527Arg	Somatic	0	45	0.00		0.5117654914895859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	18	25.00	A1A5D6|A1A5D7|C9JQZ5|Q58A26|Q58A27	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_BEN_domain	p.S527R	ENST00000502486.1	37	c.1579	CCDS47048.1	4	.	.	.	.	.	.	.	.	.	.	T	10.65	1.408660	0.25378	.	.	ENSG00000188848	ENST00000411720;ENST00000502486	.	.	.	5.29	2.52	0.30459	.	0.262525	0.37530	N	0.002058	T	0.30916	0.0780	N	0.14661	0.345	0.80722	D	1	B	0.18166	0.026	B	0.20577	0.03	T	0.08554	-1.0716	9	0.46703	T	0.11	-20.1197	5.8851	0.18876	0.0:0.3638:0.0:0.6362	.	527	Q6ZU67	BEND4_HUMAN	R	398;527	.	ENSP00000412495:S398R	S	-	1	0	BEND4	41814318	1.000000	0.71417	0.904000	0.35570	0.164000	0.22412	1.753000	0.38359	0.907000	0.36646	-0.366000	0.07423	AGT	-	NULL		0.517	BEND4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BEND4	protein_coding	OTTHUMT00000360975.2	T	NM_207406	-		42119561	-1	no_errors	ENST00000502486	ensembl	human	known	74_37	missense	SNP	1.000	G
FGB	2244	genome.wustl.edu	37	4	155487708	155487708	+	Missense_Mutation	SNP	A	A	G			TCGA-VT-AB3D-01A-12D-A417-09	TCGA-VT-AB3D-10A-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51932322-cd96-4c1b-a8ba-660637fff36b	c94fc63b-bf20-4585-9319-5f35435795df	g.chr4:155487708A>G	ENST00000302068.4	+	3	437	c.374A>G	c.(373-375)aAt>aGt	p.N125S	FGB_ENST00000509493.1_Intron|FGB_ENST00000502545.1_3'UTR	NM_005141.4	NP_005132.2	P02675	FIBB_HUMAN	fibrinogen beta chain	125					blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cellular protein complex assembly (GO:0043623)|cellular response to interleukin-1 (GO:0071347)|cellular response to leptin stimulus (GO:0044320)|extracellular matrix organization (GO:0030198)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of exocytosis (GO:0045921)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of peptide hormone secretion (GO:0090277)|positive regulation of protein secretion (GO:0050714)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of vasoconstriction (GO:0045907)|protein polymerization (GO:0051258)|response to calcium ion (GO:0051592)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|cell cortex (GO:0005938)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	chaperone binding (GO:0051087)|structural molecule activity (GO:0005198)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|liver(2)|lung(22)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34	all_hematologic(180;0.215)	Renal(120;0.0458)			Sucralfate(DB00364)	CCAATCAGAAATAGTGTTGAT	0.418																																					NSCLC(106;1133 1613 21870 46110 52656)												0								ENSG00000171564						159.0	149.0	152.0					4																	155487708		2203	4300	6503	FGB	SO:0001583	missense	0			-	HGNC		CCDS3786.1	4q28	2014-09-17			ENSG00000171564	ENSG00000171564		"""Fibrinogen C domain containing"", ""Endogenous ligands"""	3662	protein-coding gene	gene with protein product		134830	"""fibrinogen, B beta polypeptide"""				Standard	NM_005141		Approved		uc003ioa.4	P02675	OTTHUMG00000150331	ENST00000302068.4:c.374A>G	4.37:g.155487708A>G	ENSP00000306099:p.Asn125Ser	Somatic	0	58	0.00		0.5117654914895859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	37	11.90	A0JLR9|B2R7G3|Q32Q65|Q3KPF2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Fibrinogen_a/b/g_C_dom,pfam_Fibrinogen_a/b/g_coil_dom,superfamily_Fibrinogen_a/b/g_C_dom,smart_Fibrinogen_a/b/g_C_dom	p.N125S	ENST00000302068.4	37	c.374	CCDS3786.1	4	.	.	.	.	.	.	.	.	.	.	A	0.052	-1.246284	0.01481	.	.	ENSG00000171564	ENST00000302068;ENST00000537843	D	0.81659	-1.52	5.27	0.923	0.19413	Fibrinogen, alpha/beta/gamma chain, coiled coil domain (2);	0.674999	0.15593	N	0.254288	T	0.56108	0.1963	N	0.08118	0	0.09310	N	0.999992	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.37865	-0.9687	10	0.13853	T	0.58	.	6.3655	0.21453	0.6481:0.181:0.1709:0.0	.	108;125	B4E1D3;P02675	.;FIBB_HUMAN	S	125;108	ENSP00000306099:N125S	ENSP00000306099:N125S	N	+	2	0	FGB	155707158	0.000000	0.05858	0.002000	0.10522	0.001000	0.01503	0.382000	0.20635	0.055000	0.16094	-1.162000	0.01777	AAT	-	pfam_Fibrinogen_a/b/g_coil_dom		0.418	FGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGB	protein_coding	OTTHUMT00000317595.1	A	NM_005141	-		155487708	+1	no_errors	ENST00000302068	ensembl	human	known	74_37	missense	SNP	0.009	G
BTN2A2	10385	genome.wustl.edu	37	6	26390257	26390257	+	Missense_Mutation	SNP	C	C	A			TCGA-VT-AB3D-01A-12D-A417-09	TCGA-VT-AB3D-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51932322-cd96-4c1b-a8ba-660637fff36b	c94fc63b-bf20-4585-9319-5f35435795df	g.chr6:26390257C>A	ENST00000356709.4	+	5	860	c.749C>A	c.(748-750)cCc>cAc	p.P250H	BTN2A2_ENST00000482536.1_Missense_Mutation_p.P40H|BTN2A2_ENST00000469230.1_Missense_Mutation_p.P250H|BTN2A2_ENST00000416795.2_Missense_Mutation_p.P250H|BTN2A2_ENST00000432533.2_Missense_Mutation_p.P156H|BTN2A2_ENST00000352867.2_Missense_Mutation_p.P134H	NM_001197240.1|NM_006995.4	NP_001184169.1|NP_008926.2	Q8WVV5	BT2A2_HUMAN	butyrophilin, subfamily 2, member A2	250					negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of cellular metabolic process (GO:0031324)|negative regulation of cytokine secretion (GO:0050710)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(2)|endometrium(3)|large_intestine(5)|lung(13)	23						AGCGCATCTCCCTGGATGGTG	0.498																																																	0								ENSG00000124508						153.0	148.0	150.0					6																	26390257		2203	4300	6503	BTN2A2	SO:0001583	missense	0			-	HGNC	U90550	CCDS4606.1, CCDS4607.1, CCDS56401.1, CCDS56402.1, CCDS56403.1	6p22.1	2014-01-14			ENSG00000124508	ENSG00000124508		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Butyrophilins"""	1137	protein-coding gene	gene with protein product		613591				10354554, 9149941	Standard	NM_006995		Approved	BTF2, BT2.2, BTN2.2	uc003nhq.3	Q8WVV5	OTTHUMG00000014452	ENST00000356709.4:c.749C>A	6.37:g.26390257C>A	ENSP00000349143:p.Pro250His	Somatic	0	41	0.00		0.5117654914895859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	51	8.93	A6NM84|B4DE97|B4DQ01|E9PH07|O00480	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SPRY_rcpt,pfam_Ig_V-set,pfam_CD80_C2-set,superfamily_ConA-like_lec_gl_sf,smart_Ig_sub,smart_Ig_V-set_subgr,smart_PRY,smart_SPla/RYanodine_receptor_subgr,prints_Butyrophylin,pfscan_B30.2/SPRY,pfscan_Ig-like_dom	p.P250H	ENST00000356709.4	37	c.749	CCDS4606.1	6	.	.	.	.	.	.	.	.	.	.	.	10.72	1.429529	0.25726	.	.	ENSG00000124508	ENST00000469230;ENST00000490025;ENST00000356709;ENST00000352867;ENST00000482536;ENST00000432533;ENST00000482842;ENST00000416795;ENST00000483410	T;T;T;T;T;T;T;T;T	0.30448	1.53;1.53;1.53;1.53;1.53;1.53;1.53;1.53;1.53	3.04	1.08	0.20341	.	0.431469	0.17054	N	0.188814	T	0.15132	0.0365	M	0.86953	2.85	0.09310	N	1	B;B;P;B;B;B	0.42357	0.021;0.015;0.777;0.298;0.198;0.048	B;B;B;B;B;B	0.35278	0.009;0.003;0.199;0.087;0.023;0.062	T	0.16158	-1.0412	10	0.87932	D	0	.	3.7375	0.08517	0.2413:0.614:0.0:0.1447	.	40;156;134;250;134;250	E9PH07;B4DQ01;B4E3J1;Q8WVV5-2;A6NM84;Q8WVV5	.;.;.;.;.;BT2A2_HUMAN	H	250;45;250;134;40;156;45;250;134	ENSP00000417472:P250H;ENSP00000418965:P45H;ENSP00000349143:P250H;ENSP00000337117:P134H;ENSP00000419451:P40H;ENSP00000394241:P156H;ENSP00000417676:P45H;ENSP00000399308:P250H;ENSP00000418176:P134H	ENSP00000337117:P134H	P	+	2	0	BTN2A2	26498236	0.756000	0.28383	0.003000	0.11579	0.253000	0.25986	1.052000	0.30429	0.084000	0.17077	0.467000	0.42956	CCC	-	NULL		0.498	BTN2A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BTN2A2	protein_coding	OTTHUMT00000040117.1	C		-		26390257	+1	no_errors	ENST00000356709	ensembl	human	known	74_37	missense	SNP	0.023	A
BUB1B	701	genome.wustl.edu	37	15	40505677	40505677	+	Splice_Site	SNP	T	T	C			TCGA-VT-AB3D-01A-12D-A417-09	TCGA-VT-AB3D-10A-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51932322-cd96-4c1b-a8ba-660637fff36b	c94fc63b-bf20-4585-9319-5f35435795df	g.chr15:40505677T>C	ENST00000287598.6	+	20	2873		c.e20+2		BUB1B_ENST00000412359.3_Splice_Site	NM_001211.5	NP_001202	O60566	BUB1B_HUMAN	BUB1 mitotic checkpoint serine/threonine kinase B						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|protein localization to chromosome, centromeric region (GO:0071459)|protein localization to kinetochore (GO:0034501)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|condensed chromosome kinetochore (GO:0000777)|condensed chromosome outer kinetochore (GO:0000940)|condensed nuclear chromosome kinetochore (GO:0000778)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|perinuclear region of cytoplasm (GO:0048471)|spindle midzone (GO:0051233)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|endometrium(1)|kidney(2)|large_intestine(7)|liver(2)|lung(17)|ovary(1)|stomach(2)|urinary_tract(2)	36		all_cancers(109;1.12e-18)|all_epithelial(112;1.61e-15)|Lung NSC(122;5.63e-11)|all_lung(180;1.4e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;1.83e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0556)		CAGAAACAGGTTGGTCCTTTT	0.388			"""Mis, N, F, S"""			rhabdomyosarcoma			Mosaic Variegated Aneuploidy Syndrome																														yes	Rec		Mosaic variegated aneuploidy	15	15q15	701	BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast)		M	0								ENSG00000156970						129.0	136.0	134.0					15																	40505677		2203	4300	6503	BUB1B	SO:0001630	splice_region_variant	0	Familial Cancer Database	MVA, MVA syndrome, VMA syndrome, variegated mosaic aneuploidy syndrome, premature centromere division	-	HGNC	AF107297	CCDS10053.1	15q15	2014-09-17	2013-01-17		ENSG00000156970	ENSG00000156970			1149	protein-coding gene	gene with protein product		602860	"""budding uninhibited by benzimidazoles 1 (yeast homolog), beta"", ""budding uninhibited by benzimidazoles 1 homolog beta (yeast)"""			9889005	Standard	NM_001211		Approved	BUBR1, MAD3L, Bub1A, SSK1	uc001zkx.4	O60566	OTTHUMG00000129877	ENST00000287598.6:c.2678+2T>C	15.37:g.40505677T>C		Somatic	0	41	0.00		0.5117654914895859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	30	18.92	B2R6U0|B4DL09|B4DLG3|O60501|O60627|O60758|O75389|Q59HH6|Q8WV50|Q96KM4	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e20+2	ENST00000287598.6	37	c.2720+2	CCDS10053.1	15	.	.	.	.	.	.	.	.	.	.	T	19.27	3.794831	0.70452	.	.	ENSG00000156970	ENST00000287598;ENST00000412359;ENST00000442874	.	.	.	5.0	5.0	0.66597	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.7037	0.69174	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	BUB1B	38292969	1.000000	0.71417	1.000000	0.80357	0.883000	0.51084	3.805000	0.55575	1.872000	0.54250	0.402000	0.26972	.	-	-		0.388	BUB1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BUB1B	protein_coding	OTTHUMT00000252122.4	T		-	Intron	40505677	+1	no_errors	ENST00000412359	ensembl	human	known	74_37	splice_site	SNP	1.000	C
VPS13A	23230	genome.wustl.edu	37	9	79933265	79933265	+	Missense_Mutation	SNP	G	G	A			TCGA-VT-AB3D-01A-12D-A417-09	TCGA-VT-AB3D-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51932322-cd96-4c1b-a8ba-660637fff36b	c94fc63b-bf20-4585-9319-5f35435795df	g.chr9:79933265G>A	ENST00000360280.3	+	41	5331	c.5071G>A	c.(5071-5073)Gat>Aat	p.D1691N	VPS13A_ENST00000357409.5_Missense_Mutation_p.D1691N|VPS13A_ENST00000376634.4_Missense_Mutation_p.D1691N|VPS13A_ENST00000423463.2_3'UTR|VPS13A_ENST00000376636.3_Missense_Mutation_p.D1652N	NM_033305.2	NP_150648.2	Q96RL7	VP13A_HUMAN	vacuolar protein sorting 13 homolog A (S. cerevisiae)	1691					cell death (GO:0008219)|Golgi to endosome transport (GO:0006895)|locomotory behavior (GO:0007626)|nervous system development (GO:0007399)|protein localization (GO:0008104)|protein transport (GO:0015031)|social behavior (GO:0035176)	dense core granule (GO:0031045)|intracellular (GO:0005622)				breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(28)|liver(1)|lung(42)|ovary(3)|pancreas(3)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						GGAAAAGAAGGATACAAAGAC	0.343																																																	0								ENSG00000197969						87.0	92.0	91.0					9																	79933265		2203	4300	6503	VPS13A	SO:0001583	missense	0			-	HGNC	AB023203	CCDS6655.1, CCDS6656.1, CCDS47983.1, CCDS55321.1	9q21	2014-01-30	2006-04-04	2004-02-11	ENSG00000197969	ENSG00000197969			1908	protein-coding gene	gene with protein product	"""chorein"""	605978	"""chorea acanthocytosis"", ""vacuolar protein sorting 13A (yeast)"""	CHAC		9382101, 11381253	Standard	NM_001018038		Approved	KIAA0986	uc004akr.3	Q96RL7	OTTHUMG00000020055	ENST00000360280.3:c.5071G>A	9.37:g.79933265G>A	ENSP00000353422:p.Asp1691Asn	Somatic	0	103	0.00		0.5117654914895859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	96	21.77	Q5JSX9|Q5JSY0|Q5VYR5|Q702P4|Q709D0|Q86YF8|Q96S61|Q9H995|Q9Y2J1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_VPSAP_dom,pfam_Autophagy-rel_C	p.D1691N	ENST00000360280.3	37	c.5071	CCDS6655.1	9	.	.	.	.	.	.	.	.	.	.	G	9.000	0.979947	0.18812	.	.	ENSG00000197969	ENST00000376634;ENST00000376636;ENST00000360280;ENST00000357409	T;T;T;T	0.13089	2.62;2.62;2.62;2.62	5.16	5.16	0.70880	.	0.126264	0.56097	D	0.000023	T	0.13756	0.0333	L	0.39633	1.23	0.80722	D	1	B;B;B;B	0.23735	0.005;0.09;0.074;0.074	B;B;B;B	0.31245	0.021;0.059;0.126;0.126	T	0.08310	-1.0728	10	0.25751	T	0.34	.	12.3984	0.55399	0.0779:0.0:0.9221:0.0	.	1652;1691;1691;1691	Q96RL7-3;Q96RL7;Q96RL7-2;Q96RL7-4	.;VP13A_HUMAN;.;.	N	1691;1652;1691;1691	ENSP00000365821:D1691N;ENSP00000365823:D1652N;ENSP00000353422:D1691N;ENSP00000349985:D1691N	ENSP00000349985:D1691N	D	+	1	0	VPS13A	79123085	1.000000	0.71417	1.000000	0.80357	0.896000	0.52359	4.254000	0.58798	2.574000	0.86865	0.305000	0.20034	GAT	-	NULL		0.343	VPS13A-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13A	protein_coding	OTTHUMT00000052753.2	G	NM_015186	-		79933265	+1	no_errors	ENST00000360280	ensembl	human	known	74_37	missense	SNP	1.000	A
ZAN	7455	genome.wustl.edu	37	7	100365463	100365463	+	RNA	SNP	C	C	T			TCGA-VT-AB3D-01A-12D-A417-09	TCGA-VT-AB3D-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51932322-cd96-4c1b-a8ba-660637fff36b	c94fc63b-bf20-4585-9319-5f35435795df	g.chr7:100365463C>T	ENST00000348028.3	+	0	5035				ZAN_ENST00000421100.1_RNA|ZAN_ENST00000427578.1_RNA|ZAN_ENST00000449052.1_RNA|ZAN_ENST00000546292.1_RNA|ZAN_ENST00000349350.6_RNA|ZAN_ENST00000538115.1_RNA|ZAN_ENST00000542585.1_RNA|ZAN_ENST00000546213.1_RNA|ZAN_ENST00000443370.1_RNA			Q9Y493	ZAN_HUMAN	zonadhesin (gene/pseudogene)						binding of sperm to zona pellucida (GO:0007339)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(2)|breast(3)|central_nervous_system(3)|endometrium(21)|kidney(6)|large_intestine(18)|lung(60)|ovary(4)|pancreas(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)	139	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			GCTGAATGGCCATCGGGTGGC	0.582																																																	0								ENSG00000146839						41.0	43.0	42.0					7																	100365463		2028	4180	6208	ZAN			0			-	HGNC	U83191		7q22.1	2013-10-10	2013-10-10		ENSG00000146839	ENSG00000146839			12857	protein-coding gene	gene with protein product		602372	"""zonadhesin"""			9799793, 17033959	Standard	NM_003386		Approved		uc003uwk.3	Q9Y493	OTTHUMG00000157037		7.37:g.100365463C>T		Somatic	0	42	0.00		0.5117654914895859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	26	33.33	A0FKC8|D6W5W4|O00218|Q96L85|Q96L86|Q96L87|Q96L88|Q96L89|Q96L90|Q9BXN9|Q9BZ83|Q9BZ84|Q9BZ85|Q9BZ86|Q9BZ87|Q9BZ88	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_VWF_type-D,pfam_MAM_dom,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_ConA-like_lec_gl_sf,superfamily_TIL_dom,smart_MAM_dom,smart_VWC_out,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_MAM_dom	p.H1624Y	ENST00000348028.3	37	c.4870		7	.	.	.	.	.	.	.	.	.	.	C	15.63	2.891816	0.52014	.	.	ENSG00000146839	ENST00000546292;ENST00000538115;ENST00000542585;ENST00000546213	T;T;T;T	0.58797	0.31;0.31;0.31;0.31	4.57	3.69	0.42338	von Willebrand factor, type D domain (3);	0.853623	0.09842	N	0.748799	T	0.36991	0.0987	N	0.25094	0.71	0.09310	N	1	P;P	0.41450	0.706;0.75	B;B	0.32465	0.09;0.146	T	0.04976	-1.0914	10	0.17832	T	0.49	.	9.1899	0.37193	0.0:0.895:0.0:0.105	.	1624;1624	F5H0T8;Q9Y493	.;ZAN_HUMAN	Y	1624;1624;1624;201	ENSP00000445943:H1624Y;ENSP00000445091:H1624Y;ENSP00000444427:H1624Y;ENSP00000441117:H201Y	ENSP00000423579:H1624Y	H	+	1	0	ZAN	100203399	0.000000	0.05858	0.002000	0.10522	0.011000	0.07611	0.164000	0.16542	1.241000	0.43820	0.655000	0.94253	CAT	-	pfam_VWF_type-D,smart_VWF_type-D		0.582	ZAN-006	KNOWN	basic	polymorphic_pseudogene	ZAN	polymorphic_pseudogene	OTTHUMT00000347214.1	C	NM_003386	-		100365463	+1	no_errors	ENST00000546292	ensembl	human	known	74_37	missense	SNP	0.007	T
TSTD3	100130890	genome.wustl.edu	37	6	99968898	99968899	+	RNA	INS	-	-	GCGCC			TCGA-VT-AB3D-01A-12D-A417-09	TCGA-VT-AB3D-10A-01D-A41A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51932322-cd96-4c1b-a8ba-660637fff36b	c94fc63b-bf20-4585-9319-5f35435795df	g.chr6:99968898_99968899insGCGCC	ENST00000452647.2	+	0	330_331							H0UI37	TSTD3_HUMAN	thiosulfate sulfurtransferase (rhodanese)-like domain containing 3																		GCCGGAGCAGGAGGAGAAGGAG	0.683											OREG0017579	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000228439																																			TSTD3			0				HGNC			6q16.2	2012-07-04			ENSG00000228439	ENSG00000228439			40910	protein-coding gene	gene with protein product							Standard	NM_001195131		Approved		uc021zde.1	H0UI37	OTTHUMG00000015265		6.37:g.99968898_99968899insGCGCC		Somatic	NA	NA	NA	1347	0.5117654914895859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000452647.2	37	NULL		6																																																																																			-	-		0.683	TSTD3-001	KNOWN	basic	antisense	TSTD3	antisense	OTTHUMT00000041605.2	-	NM_001195131			99968899	+1	no_errors	ENST00000452647	ensembl	human	known	74_37	rna	INS	0.000:0.000	GCGCC
MS4A12	54860	genome.wustl.edu	37	11	60264870	60264870	+	Missense_Mutation	SNP	G	G	T			TCGA-VT-AB3D-01A-12D-A417-09	TCGA-VT-AB3D-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51932322-cd96-4c1b-a8ba-660637fff36b	c94fc63b-bf20-4585-9319-5f35435795df	g.chr11:60264870G>T	ENST00000016913.4	+	2	136	c.79G>T	c.(79-81)Gct>Tct	p.A27S	MS4A12_ENST00000537076.1_Missense_Mutation_p.A27S|MS4A12_ENST00000525951.1_3'UTR	NM_017716.2	NP_060186.2	Q9NXJ0	M4A12_HUMAN	membrane-spanning 4-domains, subfamily A, member 12	27						integral component of membrane (GO:0016021)				breast(1)|kidney(3)|large_intestine(2)|lung(9)|prostate(2)	17						CAGCTTTATGGCTCCTGGATT	0.473																																																	0								ENSG00000071203						104.0	104.0	104.0					11																	60264870		2203	4300	6503	MS4A12	SO:0001583	missense	0			-	HGNC	AK000224	CCDS7988.1, CCDS53638.1	11q12	2008-03-25				ENSG00000071203			13370	protein-coding gene	gene with protein product		606550				11401424, 11486273	Standard	NM_017716		Approved	Ms4a10, FLJ20217	uc001npr.3	Q9NXJ0		ENST00000016913.4:c.79G>T	11.37:g.60264870G>T	ENSP00000016913:p.Ala27Ser	Somatic	0	60	0.00		0.5117654914895859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	64	23.81	F5GX98|Q8N6L4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_CD20-like	p.A27S	ENST00000016913.4	37	c.79	CCDS7988.1	11	.	.	.	.	.	.	.	.	.	.	G	11.76	1.734082	0.30684	.	.	ENSG00000071203	ENST00000537076;ENST00000526784;ENST00000016913;ENST00000530007	T;T;T;T	0.52295	1.64;0.67;3.45;0.82	4.59	-1.09	0.09904	.	836.430000	0.00166	N	0.000000	T	0.28532	0.0706	N	0.24115	0.695	0.09310	N	1	P;B	0.37101	0.582;0.121	B;B	0.34722	0.188;0.035	T	0.07712	-1.0758	10	0.22109	T	0.4	.	0.9704	0.01414	0.1736:0.1546:0.3555:0.3162	.	27;27	E9PNI3;Q9NXJ0	.;M4A12_HUMAN	S	27	ENSP00000440424:A27S;ENSP00000431959:A27S;ENSP00000016913:A27S;ENSP00000434783:A27S	ENSP00000016913:A27S	A	+	1	0	MS4A12	60021446	0.000000	0.05858	0.001000	0.08648	0.022000	0.10575	-0.013000	0.12678	-0.005000	0.14395	-0.311000	0.09066	GCT	-	NULL		0.473	MS4A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MS4A12	protein_coding	OTTHUMT00000383627.1	G		-		60264870	+1	no_errors	ENST00000016913	ensembl	human	known	74_37	missense	SNP	0.000	T
EPHA4	2043	genome.wustl.edu	37	2	222283642	222283642	+	3'UTR	SNP	C	C	G			TCGA-VT-AB3D-01A-12D-A417-09	TCGA-VT-AB3D-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51932322-cd96-4c1b-a8ba-660637fff36b	c94fc63b-bf20-4585-9319-5f35435795df	g.chr2:222283642C>G	ENST00000281821.2	-	0	5452				EPHA4_ENST00000469354.1_5'UTR	NM_004438.3	NP_004429.1	P54764	EPHA4_HUMAN	EPH receptor A4						adult walking behavior (GO:0007628)|cell adhesion (GO:0007155)|corticospinal tract morphogenesis (GO:0021957)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|glial cell migration (GO:0008347)|motor neuron axon guidance (GO:0008045)|negative regulation of axon regeneration (GO:0048681)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of Rho guanyl-nucleotide exchange factor activity (GO:2001108)|protein autophosphorylation (GO:0046777)|regulation of astrocyte differentiation (GO:0048710)|regulation of axonogenesis (GO:0050770)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of Rac GTPase activity (GO:0032314)|regulation of Rap GTPase activity (GO:0032317)	axon (GO:0030424)|axon terminus (GO:0043679)|axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|mitochondrial outer membrane (GO:0005741)|neuromuscular junction (GO:0031594)|perikaryon (GO:0043204)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|DH domain binding (GO:0097161)|GPI-linked ephrin receptor activity (GO:0005004)|PH domain binding (GO:0042731)|protein kinase activity (GO:0004672)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|liver(1)|lung(21)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Renal(207;0.0183)		Epithelial(121;5.38e-09)|all cancers(144;2.47e-06)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(261;0.0154)		ATATTAAGGTCCCCAAAAAGG	0.358																																																	0								ENSG00000116106																																			EPHA4	SO:0001624	3_prime_UTR_variant	0			-	HGNC	L36645	CCDS2447.1	2q36.3	2013-02-11	2004-10-28		ENSG00000116106	ENSG00000116106	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3388	protein-coding gene	gene with protein product		602188	"""EphA4"""	TYRO1		9267020	Standard	NM_004438		Approved	Hek8	uc002vmq.3	P54764	OTTHUMG00000133142	ENST00000281821.2:c.*2450G>C	2.37:g.222283642C>G		Somatic	0	55	0.00		0.5117654914895859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	51	12.07	A8K2P1|B2R601|B7Z6Q8|Q2M380	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000281821.2	37	NULL	CCDS2447.1	2																																																																																			-	-		0.358	EPHA4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHA4	protein_coding	OTTHUMT00000256836.3	C		-		222283642	-1	no_errors	ENST00000469354	ensembl	human	putative	74_37	rna	SNP	0.986	G
SAMSN1	64092	genome.wustl.edu	37	21	15870817	15870817	+	Missense_Mutation	SNP	G	G	A			TCGA-VT-AB3D-01A-12D-A417-09	TCGA-VT-AB3D-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51932322-cd96-4c1b-a8ba-660637fff36b	c94fc63b-bf20-4585-9319-5f35435795df	g.chr21:15870817G>A	ENST00000400566.1	-	7	946	c.865C>T	c.(865-867)Cca>Tca	p.P289S	SAMSN1_ENST00000463807.1_5'UTR|SAMSN1_ENST00000400564.1_Missense_Mutation_p.P121S|SAMSN1_ENST00000285670.2_Missense_Mutation_p.P357S	NM_022136.4	NP_071419.3	Q9NSI8	SAMN1_HUMAN	SAM domain, SH3 domain and nuclear localization signals 1	289	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.				negative regulation of adaptive immune response (GO:0002820)|negative regulation of B cell activation (GO:0050869)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)	cell projection (GO:0042995)|cytosol (GO:0005829)|nucleus (GO:0005634)	phosphotyrosine binding (GO:0001784)|poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(9)|ovary(3)|pancreas(1)|prostate(3)|urinary_tract(1)	24				Epithelial(23;0.000155)|COAD - Colon adenocarcinoma(22;0.00118)|Colorectal(24;0.00961)|Lung(58;0.164)		CTGTCATCTGGGTTTTCAATA	0.358																																																	0								ENSG00000155307						105.0	93.0	97.0					21																	15870817		1810	4066	5876	SAMSN1	SO:0001583	missense	0			-	HGNC	AF222927	CCDS42906.1, CCDS58786.1, CCDS74774.1	21q11	2013-01-10	2006-12-13		ENSG00000155307	ENSG00000155307		"""SAM and SH3 domain containing"", ""Sterile alpha motif (SAM) domain containing"""	10528	protein-coding gene	gene with protein product	"""nuclear localization signals, SAM and SH3 domain containing 1"", ""SAM and SH3 domain containing 2"", ""hematopoietic adapter-containing SH3 and sterile &#945;-motif (SAM) domains 1"", ""Src homology domain 3 (SH3)-containing adapter protein SH3 lymphocyte protein 2"""	607978				11536050, 11594764	Standard	NM_022136		Approved	NASH1, SASH2, SH3D6B, HACS1, SLy2	uc002yjv.1	Q9NSI8	OTTHUMG00000074317	ENST00000400566.1:c.865C>T	21.37:g.15870817G>A	ENSP00000383411:p.Pro289Ser	Somatic	0	85	0.00		0.5117654914895859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	78	9.30	B3KWJ3|F8WAA1|Q8NFF7|Q9C041	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_rSAM/SH3_domain-containing,pfam_SAM_2,pfam_SAM_type1,pfam_SH3_2,superfamily_SAM/pointed,superfamily_SH3_domain,smart_SH3_domain,smart_SAM,pfscan_SAM	p.P289S	ENST00000400566.1	37	c.865	CCDS42906.1	21	.	.	.	.	.	.	.	.	.	.	G	12.40	1.927057	0.34002	.	.	ENSG00000155307	ENST00000285670;ENST00000400566;ENST00000400564	D;D;D	0.84298	-1.83;-1.83;-1.83	6.04	2.09	0.27110	Sterile alpha motif domain (2);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 2 (1);	0.379664	0.32719	N	0.005735	T	0.78097	0.4230	L	0.49126	1.545	0.47374	D	0.999406	B;B;B	0.27264	0.173;0.003;0.004	B;B;B	0.29077	0.098;0.004;0.022	T	0.67356	-0.5691	10	0.40728	T	0.16	-1.658	5.6713	0.17723	0.287:0.1291:0.5839:0.0	.	121;357;289	Q9NSI8-2;F8WAA1;Q9NSI8	.;.;SAMN1_HUMAN	S	357;289;121	ENSP00000285670:P357S;ENSP00000383411:P289S;ENSP00000383409:P121S	ENSP00000285670:P357S	P	-	1	0	SAMSN1	14792688	1.000000	0.71417	0.996000	0.52242	0.833000	0.47200	3.095000	0.50235	0.104000	0.17725	-0.244000	0.11960	CCA	-	pfam_SAM_2,pfam_SAM_type1,superfamily_SAM/pointed,smart_SAM,pfscan_SAM		0.358	SAMSN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SAMSN1	protein_coding	OTTHUMT00000157914.1	G		-		15870817	-1	no_errors	ENST00000400566	ensembl	human	known	74_37	missense	SNP	1.000	A
TBC1D31	93594	genome.wustl.edu	37	8	124140520	124140521	+	Splice_Site	INS	-	-	T	rs570441854		TCGA-VT-AB3D-01A-12D-A417-09	TCGA-VT-AB3D-10A-01D-A41A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51932322-cd96-4c1b-a8ba-660637fff36b	c94fc63b-bf20-4585-9319-5f35435795df	g.chr8:124140520_124140521insT	ENST00000287380.1	+	14	1974_1975		c.e14-1		TBC1D31_ENST00000309336.3_Splice_Site|TBC1D31_ENST00000522420.1_Splice_Site|TBC1D31_ENST00000327098.5_Splice_Site|TBC1D31_ENST00000521676.1_Splice_Site|TBC1D31_ENST00000378080.2_Splice_Site|TBC1D31_ENST00000518805.1_Intron	NM_145647.3	NP_663622.2	Q96DN5	TBC31_HUMAN	TBC1 domain family, member 31							centrosome (GO:0005813)	Rab GTPase activator activity (GO:0005097)										TTTTCTTACAGTTTTTTTTTCA	0.322																																																	0								ENSG00000156787		,	6,4258		0,6,2126					,	5.7	1.0			76	8,8246		0,8,4119	no	frameshift-near-splice,frameshift-near-splice	WDR67	NM_145647.3,NM_001145088.1	,	0,14,6245	A1A1,A1R,RR		0.0969,0.1407,0.1118	,	,		14,12504				TBC1D31	SO:0001630	splice_region_variant	0				HGNC	AK094612	CCDS6338.1, CCDS47916.1	8q24.13	2013-07-10	2013-07-10	2013-07-10	ENSG00000156787	ENSG00000156787		"""WD repeat domain containing"""	30888	protein-coding gene	gene with protein product			"""WD repeat domain 67"""	WDR67		12477932	Standard	NM_001145088		Approved	MGC21654, Gm85	uc003ypp.2	Q96DN5	OTTHUMG00000165081	ENST00000287380.1:c.1885-1->T	8.37:g.124140529_124140529dupT		Somatic	0	15	0.00		0.5117654914895859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	30	9.09	B7ZL19|Q2M2J9|Q3MIR6|Q8TBP9	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_Rab-GTPase-TBC_dom,pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_Rab-GTPase-TBC_dom,smart_WD40_repeat,pfscan_Rab-GTPase-TBC_dom,pfscan_WD40_repeat_dom	p.H632fs	ENST00000287380.1	37	c.1886_1885	CCDS6338.1	8																																																																																			-	superfamily_Rab-GTPase-TBC_dom		0.322	TBC1D31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D31	protein_coding	OTTHUMT00000381721.1	-	NM_145647		Intron	124140521	+1	no_errors	ENST00000287380	ensembl	human	known	74_37	frame_shift_ins	INS	1.000:1.000	T
POP5	51367	genome.wustl.edu	37	12	121017374	121017374	+	Missense_Mutation	SNP	G	G	T			TCGA-VT-AB3D-01A-12D-A417-09	TCGA-VT-AB3D-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51932322-cd96-4c1b-a8ba-660637fff36b	c94fc63b-bf20-4585-9319-5f35435795df	g.chr12:121017374G>T	ENST00000357500.4	-	4	375	c.340C>A	c.(340-342)Cta>Ata	p.L114I	POP5_ENST00000341039.2_Missense_Mutation_p.L64I|POP5_ENST00000542776.1_5'UTR	NM_015918.3	NP_057002.2	Q969H6	POP5_HUMAN	processing of precursor 5, ribonuclease P/MRP subunit (S. cerevisiae)	114					tRNA processing (GO:0008033)	nucleolar ribonuclease P complex (GO:0005655)	ribonuclease P activity (GO:0004526)			breast(1)|endometrium(1)|large_intestine(2)|lung(2)|ovary(1)	7	all_neural(191;0.077)|Medulloblastoma(191;0.0922)					TACTGAATTAGGAACTTCTGA	0.463																																																	0								ENSG00000167272						212.0	185.0	194.0					12																	121017374		2203	4300	6503	POP5	SO:0001583	missense	0			-	HGNC	AJ306296	CCDS9202.1, CCDS9203.1	12q24.31	2012-05-21			ENSG00000167272	ENSG00000167272			17689	protein-coding gene	gene with protein product		609992				11413139	Standard	NM_198202		Approved		uc001tys.3	Q969H6	OTTHUMG00000169023	ENST00000357500.4:c.340C>A	12.37:g.121017374G>T	ENSP00000350098:p.Leu114Ile	Somatic	0	34	0.00		0.5117654914895859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	41	8.89	A6NL80|Q53FS5|Q9Y2Q6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RNase_P/MRP_subunit,pirsf_RNase_P/MRP_POP5	p.L114I	ENST00000357500.4	37	c.340	CCDS9202.1	12	.	.	.	.	.	.	.	.	.	.	G	23.4	4.414272	0.83449	.	.	ENSG00000167272	ENST00000341039;ENST00000357500	.	.	.	5.3	4.4	0.53042	.	0.000000	0.85682	D	0.000000	T	0.73992	0.3658	L	0.53617	1.68	0.53005	D	0.999961	D;D	0.76494	0.999;0.999	D;D	0.78314	0.991;0.961	T	0.76710	-0.2859	9	0.87932	D	0	-11.3893	14.1922	0.65646	0.0732:0.0:0.9268:0.0	.	64;114	A6NL80;Q969H6	.;POP5_HUMAN	I	64;114	.	ENSP00000341791:L64I	L	-	1	2	POP5	119501757	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.669000	0.54561	2.469000	0.83416	0.655000	0.94253	CTA	-	pfam_RNase_P/MRP_subunit,pirsf_RNase_P/MRP_POP5		0.463	POP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POP5	protein_coding	OTTHUMT00000401993.1	G	NM_015918	-		121017374	-1	no_errors	ENST00000357500	ensembl	human	known	74_37	missense	SNP	1.000	T
SON	6651	genome.wustl.edu	37	21	34944044	34944044	+	Intron	SNP	C	C	G			TCGA-VT-AB3D-01A-12D-A417-09	TCGA-VT-AB3D-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51932322-cd96-4c1b-a8ba-660637fff36b	c94fc63b-bf20-4585-9319-5f35435795df	g.chr21:34944044C>G	ENST00000356577.4	+	9	7360				SON_ENST00000290239.6_Intron|SON_ENST00000381692.2_Intron	NM_138927.1	NP_620305	P18583	SON_HUMAN	SON DNA binding protein						cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|regulation of cell cycle (GO:0051726)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleic acid binding (GO:0003676)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(3)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(25)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	72						TGCACAGTTGCCCTTTTTTTT	0.403																																																	0								ENSG00000159140																																			SON	SO:0001627	intron_variant	0			-	HGNC	AF380181	CCDS13629.1, CCDS13631.1, CCDS74784.1	21q22.1-q22.2	2013-01-28			ENSG00000159140	ENSG00000159140		"""G patch domain containing"""	11183	protein-coding gene	gene with protein product	"""NRE-binding protein"", ""negative regulatory element-binding protein"", ""Bax antagonist selected in Saccharomyces 1"""	182465		C21orf50		8318737, 21551269	Standard	NM_032195		Approved	DBP-5, NREBP, KIAA1019, BASS1, FLJ21099, FLJ33914	uc002yse.1	P18583	OTTHUMG00000065806	ENST00000356577.4:c.6886-1570C>G	21.37:g.34944044C>G		Somatic	0	104	0.00		0.5117654914895859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	81	19.00	D3DSF5|D3DSF6|E7ETE8|E7EU67|E7EVW3|E9PFQ2|O14487|O95981|Q14120|Q6PKE0|Q9H7B1|Q9P070|Q9P072|Q9UKP9|Q9UPY0	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000356577.4	37	NULL	CCDS13629.1	21																																																																																			-	-		0.403	SON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SON	protein_coding	OTTHUMT00000140978.2	C	NM_138927	-		34944044	+1	no_errors	ENST00000473102	ensembl	human	putative	74_37	rna	SNP	1.000	G
OBSCN	84033	genome.wustl.edu	37	1	228451851	228451851	+	Silent	SNP	G	G	A			TCGA-VT-AB3D-01A-12D-A417-09	TCGA-VT-AB3D-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51932322-cd96-4c1b-a8ba-660637fff36b	c94fc63b-bf20-4585-9319-5f35435795df	g.chr1:228451851G>A	ENST00000422127.1	+	16	4664	c.4620G>A	c.(4618-4620)gcG>gcA	p.A1540A	OBSCN_ENST00000284548.11_Silent_p.A1540A|OBSCN_ENST00000359599.6_Silent_p.A196A|OBSCN_ENST00000570156.2_Silent_p.A1724A|OBSCN_ENST00000366707.4_5'UTR|OBSCN_ENST00000366709.4_5'UTR	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	1540	Ig-like 16.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				AGCAGCCAGCGAGCAGGGAGG	0.642																																																	0								ENSG00000154358						51.0	54.0	53.0					1																	228451851		2116	4223	6339	OBSCN	SO:0001819	synonymous_variant	0			-	HGNC	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.4620G>A	1.37:g.228451851G>A		Somatic	0	40	0.00		0.5117654914895859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	42	17.65	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Fibronectin_type3,pfam_DH-domain,pfam_IQ_motif_EF-hand-BS,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_IQ_motif_EF-hand-BS,smart_DH-domain,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,pfscan_DH-domain	p.A1540	ENST00000422127.1	37	c.4620	CCDS58065.1	1																																																																																			-	pfscan_Ig-like_dom		0.642	OBSCN-204	KNOWN	basic|CCDS	protein_coding	OBSCN	protein_coding		G	NM_052843	-		228451851	+1	no_errors	ENST00000422127	ensembl	human	known	74_37	silent	SNP	0.000	A
CCDC150	284992	genome.wustl.edu	37	2	197584490	197584490	+	Intron	DEL	A	A	-	rs368182383	byFrequency	TCGA-VT-AB3D-01A-12D-A417-09	TCGA-VT-AB3D-10A-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51932322-cd96-4c1b-a8ba-660637fff36b	c94fc63b-bf20-4585-9319-5f35435795df	g.chr2:197584490delA	ENST00000389175.4	+	19	2300				CCDC150_ENST00000409270.1_Intron|CCDC150_ENST00000272831.7_Intron|CCDC150_ENST00000487663.1_Intron	NM_001080539.1	NP_001074008.1	Q8NCX0	CC150_HUMAN	coiled-coil domain containing 150											breast(3)|endometrium(6)|kidney(1)|large_intestine(6)|lung(14)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	33						CTTCCTTTACAAAAAAAAAAA	0.299														21	0.00419329	0.0121	0.0014	5008	,	,		19925	0.0		0.0	False		,,,				2504	0.0041																0								ENSG00000144395																																			CCDC150	SO:0001627	intron_variant	0				HGNC		CCDS46478.1	2q33.1	2008-04-10			ENSG00000144395	ENSG00000144395			26834	protein-coding gene	gene with protein product							Standard	NM_001080539		Approved	FLJ39660	uc002utp.1	Q8NCX0	OTTHUMG00000154475	ENST00000389175.4:c.2165+100A>-	2.37:g.197584490delA		Somatic	0	27	0.00		0.5117654914895859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	26	16.13	Q6P5U6|Q6P663|Q8N8V5	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000389175.4	37	NULL	CCDS46478.1	2																																																																																			-	-		0.299	CCDC150-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	CCDC150	protein_coding	OTTHUMT00000335377.2	A	NM_001080539			197584490	+1	no_errors	ENST00000461825	ensembl	human	putative	74_37	rna	DEL	0.000	-
MAST4	375449	genome.wustl.edu	37	5	66429429	66429429	+	Silent	SNP	C	C	T			TCGA-VT-AB3D-01A-12D-A417-09	TCGA-VT-AB3D-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51932322-cd96-4c1b-a8ba-660637fff36b	c94fc63b-bf20-4585-9319-5f35435795df	g.chr5:66429429C>T	ENST00000403625.2	+	17	2476	c.2181C>T	c.(2179-2181)taC>taT	p.Y727Y	MAST4_ENST00000403666.1_Silent_p.Y538Y|MAST4_ENST00000404260.3_Silent_p.Y730Y|MAST4_ENST00000405643.1_Silent_p.Y548Y|MAST4_ENST00000261569.7_Silent_p.Y533Y	NM_001164664.1	NP_001158136.1	O15021	MAST4_HUMAN	microtubule associated serine/threonine kinase family member 4	730	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					cytoplasm (GO:0005737)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|kidney(2)|lung(6)|ovary(2)	13		Lung NSC(167;8.56e-06)|Prostate(74;0.00637)|Ovarian(174;0.0563)|Breast(144;0.0586)|Colorectal(97;0.245)		Lung(70;0.011)		CCAACCTTTACGAGGGTCATA	0.423																																																	0								ENSG00000069020						164.0	160.0	161.0					5																	66429429		1898	4117	6015	MAST4	SO:0001819	synonymous_variant	0			-	HGNC	AY830839	CCDS47224.1, CCDS47225.1, CCDS54861.1, CCDS75254.1	5q12.3	2007-06-20			ENSG00000069020	ENSG00000069020			19037	protein-coding gene	gene with protein product						9205841	Standard	NM_198828		Approved	KIAA0303	uc021xzk.1	O15021	OTTHUMG00000152471	ENST00000403625.2:c.2181C>T	5.37:g.66429429C>T		Somatic	0	62	0.00		0.5117654914895859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	84	14.29	A6NL49|B5ME48|Q05EE6|Q6ZN07|Q8N4X4|Q96LY3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_MA_Ser/Thr_Kinase_dom,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_PDZ,superfamily_Kinase-like_dom,superfamily_MAST_pre-PK_dom,superfamily_PDZ,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_PDZ,pfscan_PDZ,pfscan_Prot_kinase_dom	p.Y730	ENST00000403625.2	37	c.2190	CCDS54861.1	5																																																																																			-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.423	MAST4-001	NOVEL	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	MAST4	protein_coding	OTTHUMT00000326324.2	C		-		66429429	+1	no_errors	ENST00000404260	ensembl	human	known	74_37	silent	SNP	0.995	T
FAM196B	100131897	genome.wustl.edu	37	5	169309739	169309739	+	Silent	SNP	G	G	T			TCGA-VT-AB3D-01A-12D-A417-09	TCGA-VT-AB3D-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51932322-cd96-4c1b-a8ba-660637fff36b	c94fc63b-bf20-4585-9319-5f35435795df	g.chr5:169309739G>T	ENST00000377365.3	-	2	2545	c.1164C>A	c.(1162-1164)acC>acA	p.T388T	DOCK2_ENST00000540750.1_Intron|FAM196B_ENST00000523970.1_5'Flank|DOCK2_ENST00000523351.1_Intron|DOCK2_ENST00000520908.1_Intron|DOCK2_ENST00000256935.8_Intron	NM_001129891.1	NP_001123363.1	A6NMK8	F196B_HUMAN	family with sequence similarity 196, member B	388										endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|prostate(1)|skin(1)	5						TCTGAAGTTTGGTCTCACTCC	0.498																																																	0								ENSG00000204767						92.0	81.0	85.0					5																	169309739		692	1591	2283	FAM196B	SO:0001819	synonymous_variant	0			-	HGNC		CCDS47336.1	5q35.1	2010-02-17	2009-09-11	2009-09-11	ENSG00000204767	ENSG00000204767			37271	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 57"""	C5orf57			Standard	NM_001129891		Approved		uc003mag.2	A6NMK8	OTTHUMG00000163083	ENST00000377365.3:c.1164C>A	5.37:g.169309739G>T		Somatic	0	36	0.00		0.5117654914895859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70		Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.T388	ENST00000377365.3	37	c.1164	CCDS47336.1	5																																																																																			-	NULL		0.498	FAM196B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM196B	protein_coding	OTTHUMT00000371629.1	G	NM_001129891	-		169309739	-1	no_errors	ENST00000377365	ensembl	human	known	74_37	silent	SNP	0.012	T
PROP1	5626	genome.wustl.edu	37	5	177419969	177419969	+	Missense_Mutation	SNP	G	G	A			TCGA-VT-AB3D-01A-12D-A417-09	TCGA-VT-AB3D-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51932322-cd96-4c1b-a8ba-660637fff36b	c94fc63b-bf20-4585-9319-5f35435795df	g.chr5:177419969G>A	ENST00000308304.2	-	3	730	c.422C>T	c.(421-423)gCc>gTc	p.A141V		NM_006261.4	NP_006252	O75360	PROP1_HUMAN	PROP paired-like homeobox 1	141					blood vessel development (GO:0001568)|canonical Wnt signaling pathway (GO:0060070)|cell migration (GO:0016477)|central nervous system development (GO:0007417)|dorsal/ventral pattern formation (GO:0009953)|hypophysis morphogenesis (GO:0048850)|hypothalamus cell differentiation (GO:0021979)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|somatotropin secreting cell differentiation (GO:0060126)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)			endometrium(1)|large_intestine(2)|lung(9)|stomach(1)	13	all_cancers(89;0.00176)|Renal(175;0.000269)|Lung NSC(126;0.00858)|all_lung(126;0.0139)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GGAAAAGGCGGCAGGAGACAG	0.587																																																	0								ENSG00000175325						154.0	140.0	145.0					5																	177419969		2203	4300	6503	PROP1	SO:0001583	missense	0			-	HGNC	AF076215	CCDS4430.1	5q35.3	2011-06-20	2007-07-12		ENSG00000175325	ENSG00000175325		"""Homeoboxes / PRD class"""	9455	protein-coding gene	gene with protein product		601538	"""prophet of Pit1, paired-like homeodomain transcription factor"""			9462743	Standard	NM_006261		Approved		uc003mif.1	O75360	OTTHUMG00000130887	ENST00000308304.2:c.422C>T	5.37:g.177419969G>A	ENSP00000311290:p.Ala141Val	Somatic	0	26	0.00		0.5117654914895859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	32	11.11		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_HTH_motif	p.A141V	ENST00000308304.2	37	c.422	CCDS4430.1	5	.	.	.	.	.	.	.	.	.	.	.	13.95	2.389319	0.42410	.	.	ENSG00000175325	ENST00000308304	D	0.90004	-2.6	3.75	3.75	0.43078	.	0.175756	0.27668	N	0.018360	T	0.81302	0.4794	L	0.32530	0.975	0.29265	N	0.871076	P	0.47762	0.9	B	0.40602	0.334	T	0.77107	-0.2710	10	0.37606	T	0.19	-21.6578	9.6561	0.39928	0.0:0.2145:0.7855:0.0	.	141	O75360	PROP1_HUMAN	V	141	ENSP00000311290:A141V	ENSP00000311290:A141V	A	-	2	0	PROP1	177352575	0.000000	0.05858	0.796000	0.32109	0.068000	0.16541	0.306000	0.19279	1.830000	0.53286	0.467000	0.42956	GCC	-	NULL		0.587	PROP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PROP1	protein_coding	OTTHUMT00000253472.1	G	NM_006261	-		177419969	-1	no_errors	ENST00000308304	ensembl	human	known	74_37	missense	SNP	0.846	A
CPSF3	51692	genome.wustl.edu	37	2	9597080	9597080	+	Missense_Mutation	SNP	A	A	G			TCGA-VT-AB3D-01A-12D-A417-09	TCGA-VT-AB3D-10A-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51932322-cd96-4c1b-a8ba-660637fff36b	c94fc63b-bf20-4585-9319-5f35435795df	g.chr2:9597080A>G	ENST00000238112.3	+	14	1828	c.1622A>G	c.(1621-1623)gAa>gGa	p.E541G	CPSF3_ENST00000460593.1_Missense_Mutation_p.E504G	NM_016207.3	NP_057291.1	Q9UKF6	CPSF3_HUMAN	cleavage and polyadenylation specific factor 3, 73kDa	541					gene expression (GO:0010467)|histone mRNA 3'-end processing (GO:0006398)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA export from nucleus (GO:0006406)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleoplasm (GO:0005654)|ribonucleoprotein complex (GO:0030529)	5'-3' exonuclease activity (GO:0008409)|endoribonuclease activity (GO:0004521)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)			NS(1)|breast(3)|endometrium(1)|kidney(2)|large_intestine(5)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	24	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)	all_cancers(51;2.39e-25)|all_epithelial(98;8.75e-19)|Lung NSC(108;2.38e-06)|Ovarian(717;0.0308)		all cancers(51;2.2e-40)|Epithelial(75;6.71e-35)|OV - Ovarian serous cystadenocarcinoma(76;4.35e-21)|STAD - Stomach adenocarcinoma(1183;0.00644)		GAAGAATTAGAAATTCAAGAA	0.318																																					Colon(194;1259 2048 3845 5218 19985)												0								ENSG00000119203						47.0	52.0	50.0					2																	9597080		2203	4291	6494	CPSF3	SO:0001583	missense	0			-	HGNC	AF171877	CCDS1664.1	2p25.1	2009-01-06	2002-08-29		ENSG00000119203	ENSG00000119203			2326	protein-coding gene	gene with protein product		606029	"""cleavage and polyadenylation specific factor 3, 73kD subunit"""			8929409	Standard	NM_016207		Approved	CPSF-73, CPSF73, YSH1	uc002qzo.2	Q9UKF6	OTTHUMG00000090415	ENST00000238112.3:c.1622A>G	2.37:g.9597080A>G	ENSP00000238112:p.Glu541Gly	Somatic	0	110	0.00		0.5117654914895859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	96	8.57	O14769|Q53RS2|Q96F36	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_CPSF73-100_C,pfam_Beta_Casp,pfam_Beta-lactamas-like,pfam_RMMBL,smart_Beta-lactamas-like	p.E541G	ENST00000238112.3	37	c.1622	CCDS1664.1	2	.	.	.	.	.	.	.	.	.	.	A	16.45	3.126985	0.56721	.	.	ENSG00000119203	ENST00000238112;ENST00000540142;ENST00000427001;ENST00000460593	T;T	0.45668	0.89;0.89	5.77	5.77	0.91146	-end-processing endonuclease polyadenylation factor C-term (1);Pre-mRNA 3&apos (1);	0.050539	0.85682	D	0.000000	T	0.42381	0.1200	L	0.57536	1.79	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.10450	0.003;0.005	T	0.21109	-1.0255	10	0.32370	T	0.25	-22.4759	16.086	0.81049	1.0:0.0:0.0:0.0	.	492;541	E7ER23;Q9UKF6	.;CPSF3_HUMAN	G	541;263;492;504	ENSP00000238112:E541G;ENSP00000418957:E504G	ENSP00000238112:E541G	E	+	2	0	CPSF3	9514531	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.413000	0.90235	2.207000	0.71202	0.528000	0.53228	GAA	-	pfam_CPSF73-100_C		0.318	CPSF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPSF3	protein_coding	OTTHUMT00000206843.1	A	NM_016207	-		9597080	+1	no_errors	ENST00000238112	ensembl	human	known	74_37	missense	SNP	1.000	G
BAIAP2	10458	genome.wustl.edu	37	17	79080670	79080670	+	Missense_Mutation	SNP	A	A	G			TCGA-VT-AB3D-01A-12D-A417-09	TCGA-VT-AB3D-10A-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51932322-cd96-4c1b-a8ba-660637fff36b	c94fc63b-bf20-4585-9319-5f35435795df	g.chr17:79080670A>G	ENST00000321300.6	+	12	1556	c.1463A>G	c.(1462-1464)cAg>cGg	p.Q488R	BAIAP2_ENST00000435091.3_Missense_Mutation_p.Q488R|BAIAP2_ENST00000428708.2_Missense_Mutation_p.Q488R|BAIAP2_ENST00000416299.2_Missense_Mutation_p.Q351R|BAIAP2_ENST00000575712.1_Missense_Mutation_p.Q488R|BAIAP2_ENST00000392411.3_Missense_Mutation_p.Q410R|BAIAP2_ENST00000321280.7_Missense_Mutation_p.Q488R|BAIAP2_ENST00000575245.1_Missense_Mutation_p.Q521R	NM_001144888.1|NM_017451.2	NP_001138360.1|NP_059345.1	Q9UQB8	BAIP2_HUMAN	BAI1-associated protein 2	488					actin crosslink formation (GO:0051764)|actin filament bundle assembly (GO:0051017)|axonogenesis (GO:0007409)|dendrite development (GO:0016358)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|filopodium assembly (GO:0046847)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell shape (GO:0008360)|regulation of synaptic plasticity (GO:0048167)|response to bacterium (GO:0009617)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	cytoskeletal adaptor activity (GO:0008093)|identical protein binding (GO:0042802)|proline-rich region binding (GO:0070064)|protein C-terminus binding (GO:0008022)	p.Q488L(2)		breast(1)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(6)|skin(1)	18	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0228)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)			GGCTTCAAGCAGAGGCCCTAC	0.721																																																	2	Substitution - Missense(2)	lung(2)						ENSG00000175866						21.0	22.0	22.0					17																	79080670		2184	4296	6480	BAIAP2	SO:0001583	missense	0			-	HGNC	AB015019	CCDS11775.1, CCDS11776.1, CCDS11777.1, CCDS45806.1	17q25.3	2014-09-11			ENSG00000175866				947	protein-coding gene	gene with protein product		605475				10343108	Standard	NM_017451		Approved	BAP2	uc002jzg.2	Q9UQB8	OTTHUMG00000177698	ENST00000321300.6:c.1463A>G	17.37:g.79080670A>G	ENSP00000316338:p.Gln488Arg	Somatic	0	20	0.00		0.5117654914895859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	12	29.41	O43858|Q53HB1|Q86WC1|Q8N5C0|Q96CR7|Q9UBR3|Q9UQ43	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_IRSp53/MIM_homology_IMD,pfam_SH3_2,pfam_SH3_domain,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain	p.Q488R	ENST00000321300.6	37	c.1463	CCDS11775.1	17	.	.	.	.	.	.	.	.	.	.	A	3.257	-0.152111	0.06585	.	.	ENSG00000175866	ENST00000321300;ENST00000428708;ENST00000435091;ENST00000321280;ENST00000392411;ENST00000416299	T;T;T;T;T;T	0.33654	1.91;1.92;1.42;1.42;1.89;1.4	4.78	4.78	0.61160	.	0.292453	0.34002	N	0.004346	T	0.31888	0.0811	L	0.47190	1.495	0.34126	D	0.664671	P;P;P;B;P;B;B;B;P	0.44627	0.736;0.73;0.839;0.258;0.515;0.328;0.374;0.374;0.515	B;B;B;B;B;B;B;B;B	0.41988	0.221;0.283;0.372;0.101;0.206;0.116;0.206;0.206;0.206	T	0.49744	-0.8907	10	0.40728	T	0.16	-27.4715	9.6702	0.40008	0.8249:0.1751:0.0:0.0	.	351;410;489;488;488;488;488;489;488	B4DWA1;F8W878;B3KPV9;Q9UQB8;Q9UQB8-2;Q9UQB8-3;Q9UQB8-5;Q9UQB8-6;Q9UQB8-4	.;.;.;BAIP2_HUMAN;.;.;.;.;.	R	488;488;488;488;410;351	ENSP00000316338:Q488R;ENSP00000401022:Q488R;ENSP00000413069:Q488R;ENSP00000315685:Q488R;ENSP00000376211:Q410R;ENSP00000391837:Q351R	ENSP00000315685:Q488R	Q	+	2	0	BAIAP2	76695265	1.000000	0.71417	1.000000	0.80357	0.434000	0.31775	1.867000	0.39499	1.811000	0.52892	0.248000	0.18094	CAG	-	NULL		0.721	BAIAP2-003	KNOWN	basic|CCDS	protein_coding	BAIAP2	protein_coding	OTTHUMT00000438553.1	A		-		79080670	+1	no_errors	ENST00000321300	ensembl	human	known	74_37	missense	SNP	1.000	G
TMEM44	93109	genome.wustl.edu	37	3	194353772	194353773	+	Intron	INS	-	-	CCGCCCGACAG	rs11273892|rs78196807	byFrequency	TCGA-VT-AB3D-01A-12D-A417-09	TCGA-VT-AB3D-10A-01D-A41A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51932322-cd96-4c1b-a8ba-660637fff36b	c94fc63b-bf20-4585-9319-5f35435795df	g.chr3:194353772_194353773insCCGCCCGACAG	ENST00000392432.2	-	1	343				TMEM44_ENST00000347147.4_Intron|TMEM44_ENST00000273580.7_Intron|TMEM44_ENST00000330115.3_Intron|TMEM44_ENST00000473092.1_Intron|TMEM44_ENST00000381975.3_Intron|AC046143.3_ENST00000447139.1_RNA	NM_001166305.1	NP_001159777.1	Q2T9K0	TMM44_HUMAN	transmembrane protein 44							integral component of membrane (GO:0016021)				breast(1)|kidney(1)|large_intestine(1)|liver(1)|lung(3)|urinary_tract(1)	8	all_cancers(143;1.41e-08)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;4.34e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;9.06e-06)		CGCCCGTTTCCCCGCCCGACAG	0.653														3578	0.714457	0.7632	0.621	5008	,	,		10280	0.6905		0.7674	False		,,,				2504	0.6851																0								ENSG00000229334		,,,	2118,906		906,306,300					,,,	2.1	0.0		dbSNP_120	6	4108,1674		1774,560,557	no	intron,intron,intron,intron	TMEM44	NM_138399.4,NM_001166306.1,NM_001166305.1,NM_001011655.2	,,,	2680,866,857	A1A1,A1R,RR		28.9519,29.9603,29.2982	,,,	,,,		6226,2580				AC046143.3	SO:0001627	intron_variant	0				Clone_based_vega_gene	AL833026	CCDS3308.1, CCDS33921.1, CCDS3308.2, CCDS54698.1, CCDS54699.1	3q29	2005-08-16			ENSG00000145014	ENSG00000145014			25120	protein-coding gene	gene with protein product							Standard	NM_138399		Approved	DKFZp686O18124	uc010hzn.3	Q2T9K0	OTTHUMG00000156023	ENST00000392432.2:c.137+34->CTGTCGGGCGG	3.37:g.194353773_194353783dupCCGCCCGACAG		Somatic	NA	NA	NA		0.5117654914895859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A1L3V7|B7ZLZ5|B7ZLZ6|C9JJ62|E9PGA9|Q0P6F7|Q6ZT47|Q8IXR1|Q8N4G3	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000392432.2	37	NULL	CCDS54699.1	3																																																																																			-	-		0.653	TMEM44-002	KNOWN	basic|CCDS	protein_coding	ENSG00000229334	protein_coding	OTTHUMT00000342750.1	-	NM_138399			194353773	+1	no_errors	ENST00000447139	ensembl	human	known	74_37	rna	INS	0.030:0.049	CCGCCCGACAG
TESPA1	9840	genome.wustl.edu	37	12	55354969	55354969	+	Missense_Mutation	SNP	G	G	A			TCGA-VT-AB3D-01A-12D-A417-09	TCGA-VT-AB3D-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51932322-cd96-4c1b-a8ba-660637fff36b	c94fc63b-bf20-4585-9319-5f35435795df	g.chr12:55354969G>A	ENST00000449076.1	-	10	1682	c.1550C>T	c.(1549-1551)gCt>gTt	p.A517V	TESPA1_ENST00000524622.1_Missense_Mutation_p.A379V|TESPA1_ENST00000531122.1_Missense_Mutation_p.A379V|TESPA1_ENST00000532804.1_Missense_Mutation_p.A379V|TESPA1_ENST00000524959.1_5'Flank|TESPA1_ENST00000316577.8_Missense_Mutation_p.A517V	NM_001136030.2	NP_001129502.1	A2RU30	TESP1_HUMAN	thymocyte expressed, positive selection associated 1	517					COP9 signalosome assembly (GO:0010387)|positive regulation of T cell differentiation in thymus (GO:0033089)|positive regulation of T cell receptor signaling pathway (GO:0050862)	COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)											GTCTTTGCCAGCAAAAGTCTG	0.507																																																	0								ENSG00000135426						140.0	166.0	157.0					12																	55354969		2184	4294	6478	TESPA1	SO:0001583	missense	0			-	HGNC	AB018291	CCDS44913.1, CCDS58240.1	12q13.2	2012-03-21	2012-03-21	2012-03-21	ENSG00000135426	ENSG00000135426			29109	protein-coding gene	gene with protein product		615664	"""KIAA0748"""	KIAA0748		9872452	Standard	NM_001136030		Approved		uc001sgn.4	A2RU30	OTTHUMG00000165407	ENST00000449076.1:c.1550C>T	12.37:g.55354969G>A	ENSP00000400892:p.Ala517Val	Somatic	0	46	0.00		0.5117654914895859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	32	11.11	B4DPM3|B4E048|B7Z9K7|O94849|Q4G0P2|Q9P0C4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.A517V	ENST00000449076.1	37	c.1550	CCDS44913.1	12	.	.	.	.	.	.	.	.	.	.	G	13.16	2.153851	0.38021	.	.	ENSG00000135426	ENST00000524622;ENST00000532804;ENST00000449076;ENST00000316577;ENST00000531122	T;T;T;T;T	0.46819	0.86;0.86;0.87;0.87;0.86	4.15	2.33	0.28932	.	0.658638	0.13332	N	0.395823	T	0.32436	0.0829	L	0.27053	0.805	0.09310	N	1	B	0.06786	0.001	B	0.12156	0.007	T	0.27226	-1.0080	10	0.72032	D	0.01	4.3059	6.4127	0.21700	0.2178:0.0:0.7822:0.0	.	517	A2RU30	K0748_HUMAN	V	379;379;517;517;379	ENSP00000435622:A379V;ENSP00000432030:A379V;ENSP00000400892:A517V;ENSP00000312679:A517V;ENSP00000433098:A379V	ENSP00000312679:A517V	A	-	2	0	KIAA0748	53641236	0.003000	0.15002	0.001000	0.08648	0.015000	0.08874	0.700000	0.25601	0.724000	0.32296	0.650000	0.86243	GCT	-	NULL		0.507	TESPA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TESPA1	protein_coding	OTTHUMT00000383822.1	G	NM_001098815	-		55354969	-1	no_errors	ENST00000316577	ensembl	human	known	74_37	missense	SNP	0.001	A
LRIF1	55791	genome.wustl.edu	37	1	111494597	111494597	+	Silent	SNP	A	A	T			TCGA-VT-AB3D-01A-12D-A417-09	TCGA-VT-AB3D-10A-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51932322-cd96-4c1b-a8ba-660637fff36b	c94fc63b-bf20-4585-9319-5f35435795df	g.chr1:111494597A>T	ENST00000369763.4	-	2	1299	c.909T>A	c.(907-909)tcT>tcA	p.S303S	LRIF1_ENST00000485275.2_Intron|LRIF1_ENST00000494675.1_Intron|RP11-96K19.2_ENST00000440689.1_RNA	NM_018372.3	NP_060842.3	Q5T3J3	LRIF1_HUMAN	ligand dependent nuclear receptor interacting factor 1	303					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|nucleus (GO:0005634)				endometrium(2)|kidney(2)|large_intestine(7)|lung(12)|ovary(2)|skin(1)|urinary_tract(2)	28						CAGGAACAAGAGATGGCGTAA	0.353																																																	0								ENSG00000121931						90.0	86.0	87.0					1																	111494597		2203	4300	6503	LRIF1	SO:0001819	synonymous_variant	0			-	HGNC	AY190122	CCDS30800.1, CCDS41366.1	1p13.3	2011-04-15	2011-04-15	2011-04-15	ENSG00000121931	ENSG00000121931			30299	protein-coding gene	gene with protein product	"""receptor interacting factor 1"""	615354	"""chromosome 1 open reading frame 103"""	C1orf103		17455211	Standard	NM_018372		Approved	RIF1, FLJ11269	uc001eaa.3	Q5T3J3	OTTHUMG00000011913	ENST00000369763.4:c.909T>A	1.37:g.111494597A>T		Somatic	0	52	0.00		0.5117654914895859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	49	9.26	Q86XS4|Q8N3B6|Q96HT4|Q9NUM5|Q9NV32	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.S303	ENST00000369763.4	37	c.909	CCDS30800.1	1																																																																																			-	NULL		0.353	LRIF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LRIF1	protein_coding	OTTHUMT00000032932.2	A	NM_018372	-		111494597	-1	no_errors	ENST00000369763	ensembl	human	known	74_37	silent	SNP	1.000	T
RP11-782C8.2	0	genome.wustl.edu	37	1	143189135	143189135	+	lincRNA	SNP	C	C	T	rs202151544		TCGA-VT-AB3D-01A-12D-A417-09	TCGA-VT-AB3D-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51932322-cd96-4c1b-a8ba-660637fff36b	c94fc63b-bf20-4585-9319-5f35435795df	g.chr1:143189135C>T	ENST00000412204.2	-	0	2503				RP11-782C8.1_ENST00000438000.1_lincRNA|RP11-782C8.3_ENST00000425124.1_lincRNA																							GTTGTTTAAACAGCTGACATT	0.318																																																	0								ENSG00000232274																																			RP11-782C8.2			0			-	Clone_based_vega_gene																													1.37:g.143189135C>T		Somatic	0	11	0.00		0.5117654914895859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	11	35.29		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000412204.2	37	NULL		1																																																																																			-	-		0.318	RP11-782C8.2-004	KNOWN	basic	lincRNA	ENSG00000232274	lincRNA	OTTHUMT00000037567.2	C		rs202151544		143189135	-1	no_errors	ENST00000447389	ensembl	human	known	74_37	rna	SNP	0.003	T
SMYD3	64754	genome.wustl.edu	37	1	246490624	246490624	+	Missense_Mutation	SNP	G	G	T			TCGA-VT-AB3D-01A-12D-A417-09	TCGA-VT-AB3D-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51932322-cd96-4c1b-a8ba-660637fff36b	c94fc63b-bf20-4585-9319-5f35435795df	g.chr1:246490624G>T	ENST00000388985.4	-	5	409	c.410C>A	c.(409-411)aCt>aAt	p.T137N	SMYD3_ENST00000403792.3_Missense_Mutation_p.T137N|SMYD3_ENST00000541742.1_Missense_Mutation_p.T78N|SMYD3_ENST00000490107.1_Missense_Mutation_p.T78N			Q9H7B4	SMYD3_HUMAN	SET and MYND domain containing 3	137	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				cellular response to dexamethasone stimulus (GO:0071549)|establishment of protein localization (GO:0045184)|myotube cell development (GO:0014904)|negative regulation of protein kinase activity (GO:0006469)|nucleosome assembly (GO:0006334)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)|metal ion binding (GO:0046872)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II intronic transcription regulatory region sequence-specific DNA binding (GO:0001162)			breast(3)|large_intestine(5)|lung(8)|skin(1)	17	all_cancers(71;0.000291)|all_epithelial(71;0.000174)|Ovarian(71;0.0377)|all_lung(81;0.0568)|Lung NSC(105;0.0804)|Breast(184;0.173)|Melanoma(84;0.242)	all_cancers(173;0.0496)|Acute lymphoblastic leukemia(190;0.164)	OV - Ovarian serous cystadenocarcinoma(106;0.0129)	all cancers(4;0.028)|GBM - Glioblastoma multiforme(49;0.0537)		CTTATCTTCAGTCAGTTTGTT	0.368																																																	0								ENSG00000185420						104.0	98.0	100.0					1																	246490624		2203	4300	6503	SMYD3	SO:0001583	missense	0			-	HGNC	AK023594	CCDS31083.1	1q44	2011-07-01	2003-05-14	2003-05-16	ENSG00000185420	ENSG00000185420		"""Zinc fingers, MYND-type"", ""Chromatin-modifying enzymes / K-methyltransferases"""	15513	protein-coding gene	gene with protein product		608783	"""zinc finger, MYND domain containing 1"""	ZNFN3A1, ZMYND1			Standard	NM_022743		Approved	KMT3E	uc001ibl.3	Q9H7B4	OTTHUMG00000040508	ENST00000388985.4:c.410C>A	1.37:g.246490624G>T	ENSP00000373637:p.Thr137Asn	Somatic	0	59	0.00		0.5117654914895859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70	A8K0P0|B1AN38|Q86TL8|Q8N5Z6|Q96AI5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SET_dom,pfam_Znf_MYND,smart_SET_dom,pfscan_SET_dom,pfscan_Znf_MYND	p.T137N	ENST00000388985.4	37	c.410	CCDS53486.1	1	.	.	.	.	.	.	.	.	.	.	G	12.61	1.990278	0.35131	.	.	ENSG00000185420	ENST00000541742;ENST00000490107;ENST00000388985;ENST00000453676;ENST00000403792	T;T;T;T;T	0.81247	2.5;2.5;-1.47;2.5;2.5	5.88	4.95	0.65309	SET domain (2);	0.307905	0.29300	N	0.012548	T	0.66297	0.2775	N	0.25485	0.75	0.36930	D	0.891839	B	0.10296	0.003	B	0.12156	0.007	T	0.62096	-0.6926	10	0.17832	T	0.49	-25.133	9.0621	0.36440	0.0:0.3505:0.5252:0.1243	.	137	Q9H7B4	SMYD3_HUMAN	N	78;78;137;78;137	ENSP00000444184:T78N;ENSP00000419184:T78N;ENSP00000373637:T137N;ENSP00000408122:T78N;ENSP00000385380:T137N	ENSP00000373637:T137N	T	-	2	0	SMYD3	244557247	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.441000	0.52893	2.780000	0.95670	0.655000	0.94253	ACT	-	pfam_SET_dom,smart_SET_dom		0.368	SMYD3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SMYD3	protein_coding		G	NM_022743	-		246490624	-1	no_errors	ENST00000388985	ensembl	human	known	74_37	missense	SNP	1.000	T
NTRK3	4916	genome.wustl.edu	37	15	88522367	88522367	+	Intron	SNP	G	G	A			TCGA-VT-AB3D-01A-12D-A417-09	TCGA-VT-AB3D-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51932322-cd96-4c1b-a8ba-660637fff36b	c94fc63b-bf20-4585-9319-5f35435795df	g.chr15:88522367G>A	ENST00000360948.2	-	14	1747				NTRK3_ENST00000558306.1_5'UTR|NTRK3_ENST00000542733.2_Intron|NTRK3_ENST00000355254.2_Intron|NTRK3_ENST00000357724.2_Intron|NTRK3_ENST00000540489.2_3'UTR|NTRK3_ENST00000394480.2_Intron|NTRK3_ENST00000557856.1_Intron|NTRK3_ENST00000317501.3_3'UTR|NTRK3_ENST00000558676.1_Intron	NM_001012338.2	NP_001012338.1	Q16288	NTRK3_HUMAN	neurotrophic tyrosine kinase, receptor, type 3						activation of MAPK activity (GO:0000187)|activation of protein kinase B activity (GO:0032148)|activation of Ras GTPase activity (GO:0032856)|cellular response to retinoic acid (GO:0071300)|circadian rhythm (GO:0007623)|cochlea development (GO:0090102)|lens fiber cell differentiation (GO:0070306)|mechanoreceptor differentiation (GO:0042490)|modulation by virus of host transcription (GO:0019056)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell death (GO:0060548)|negative regulation of protein phosphorylation (GO:0001933)|neuron fate specification (GO:0048665)|neuron migration (GO:0001764)|neurotrophin signaling pathway (GO:0038179)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of axon extension involved in regeneration (GO:0048691)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of positive chemotaxis (GO:0050927)|protein autophosphorylation (GO:0046777)|response to axon injury (GO:0048678)|response to corticosterone (GO:0051412)|response to ethanol (GO:0045471)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|neurotrophin binding (GO:0043121)|neurotrophin receptor activity (GO:0005030)|p53 binding (GO:0002039)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		ETV6/NTRK3(238)	breast(3)|central_nervous_system(3)|endometrium(6)|kidney(1)|large_intestine(22)|lung(63)|ovary(6)|pancreas(3)|prostate(1)|skin(4)|stomach(5)|upper_aerodigestive_tract(2)	119			BRCA - Breast invasive adenocarcinoma(143;0.211)			GGAGCACAGTGATGATTGGAG	0.517			T	ETV6	"""congenital fibrosarcoma, Secretory breast """					TSP Lung(13;0.10)																														Dom	yes		15	15q25	4916	"""neurotrophic tyrosine kinase, receptor, type 3"""		"""E, M"""	0								ENSG00000140538																																			NTRK3	SO:0001627	intron_variant	0			-	HGNC	U05012	CCDS10340.1, CCDS32322.1, CCDS32323.1, CCDS58399.1	15q24-q25	2013-01-11			ENSG00000140538	ENSG00000140538	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"""	8033	protein-coding gene	gene with protein product		191316				7806211	Standard	NM_001012338		Approved	TRKC	uc002bme.2	Q16288	OTTHUMG00000148677	ENST00000360948.2:c.1586-38383C>T	15.37:g.88522367G>A		Somatic	0	68	0.00		0.5117654914895859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	54	19.40	B7Z4C5|E9PG56|H0YND1|O75682|Q12827|Q16289	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000360948.2	37	NULL	CCDS32322.1	15																																																																																			-	-		0.517	NTRK3-204	KNOWN	basic|CCDS	protein_coding	NTRK3	protein_coding		G		-		88522367	-1	no_errors	ENST00000558306	ensembl	human	putative	74_37	rna	SNP	1.000	A
RP11-146E13.4	0	genome.wustl.edu	37	14	19856633	19856633	+	lincRNA	SNP	T	T	C	rs61971873	byFrequency	TCGA-VT-AB3D-01A-12D-A417-09	TCGA-VT-AB3D-10A-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51932322-cd96-4c1b-a8ba-660637fff36b	c94fc63b-bf20-4585-9319-5f35435795df	g.chr14:19856633T>C	ENST00000548109.1	+	0	72																											ACATTAGTAATTATATTTGTC	0.234																																																	0								ENSG00000244306																																			CTD-2314B22.3			0			-	Clone_based_vega_gene																													14.37:g.19856633T>C		Somatic	0	13	0.00		0.5117654914895859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	11	26.67		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000548109.1	37	NULL		14																																																																																			-	-		0.234	RP11-146E13.4-001	KNOWN	basic	lincRNA	ENSG00000244306	lincRNA	OTTHUMT00000409408.1	T		-		19856633	-1	no_errors	ENST00000551334	ensembl	human	known	74_37	rna	SNP	0.030	C
FRMPD3	84443	genome.wustl.edu	37	X	106846480	106846480	+	Silent	SNP	G	G	A			TCGA-VT-AB3D-01A-12D-A417-09	TCGA-VT-AB3D-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51932322-cd96-4c1b-a8ba-660637fff36b	c94fc63b-bf20-4585-9319-5f35435795df	g.chrX:106846480G>A	ENST00000276185.4	+	16	5310	c.5310G>A	c.(5308-5310)caG>caA	p.Q1770Q				Q5JV73	FRPD3_HUMAN	FERM and PDZ domain containing 3	1770	Gln-rich.					cytoskeleton (GO:0005856)				breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(16)|ovary(2)|urinary_tract(1)	28						aacaacaacagcagcagcagc	0.582																																																	0								ENSG00000147234						3.0	2.0	2.0					X																	106846480		690	1560	2250	FRMPD3	SO:0001819	synonymous_variant	0			-	HGNC	AB058720	CCDS76006.1	Xq22	2008-02-05			ENSG00000147234	ENSG00000147234			29382	protein-coding gene	gene with protein product						11347906	Standard	NM_032428		Approved	RP5-1070B1.1, KIAA1817		Q5JV73	OTTHUMG00000022165	ENST00000276185.4:c.5310G>A	X.37:g.106846480G>A		Somatic	0	26	0.00		0.5117654914895859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	33	13.16	Q96JK8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_FERM_central,pfam_PDZ,superfamily_FERM_central,superfamily_PDZ,smart_PDZ,smart_Band_41_domain,pfscan_FERM_domain,pfscan_PDZ	p.Q1770	ENST00000276185.4	37	c.5310		X																																																																																			-	NULL		0.582	FRMPD3-201	KNOWN	basic|appris_principal	protein_coding	FRMPD3	protein_coding		G	XM_042978	-		106846480	+1	no_errors	ENST00000276185	ensembl	human	known	74_37	silent	SNP	0.516	A
SMYD1	150572	genome.wustl.edu	37	2	88387480	88387480	+	Silent	SNP	C	C	T			TCGA-VT-AB3D-01A-12D-A417-09	TCGA-VT-AB3D-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51932322-cd96-4c1b-a8ba-660637fff36b	c94fc63b-bf20-4585-9319-5f35435795df	g.chr2:88387480C>T	ENST00000419482.2	+	3	499	c.414C>T	c.(412-414)caC>caT	p.H138H	SMYD1_ENST00000468008.1_3'UTR|SMYD1_ENST00000438570.1_Intron|SMYD1_ENST00000444564.2_Silent_p.H138H	NM_198274.3	NP_938015.1	Q8NB12	SMYD1_HUMAN	SET and MYND domain containing 1	138	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				chromatin remodeling (GO:0006338)|heart development (GO:0007507)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of myotube differentiation (GO:0010831)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|metal ion binding (GO:0046872)|transcription corepressor activity (GO:0003714)			NS(1)|breast(4)|central_nervous_system(1)|large_intestine(6)|lung(19)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	41						ACGTGGAGCACTTTGGGGAGG	0.642																																																	0								ENSG00000115593						113.0	90.0	98.0					2																	88387480		2203	4300	6503	SMYD1	SO:0001819	synonymous_variant	0			-	HGNC	AF086123	CCDS33240.1	2p11.1	2011-07-01			ENSG00000115593	ENSG00000115593		"""Zinc fingers, MYND-type"", ""Chromatin-modifying enzymes / K-methyltransferases"""	20986	protein-coding gene	gene with protein product		606846				11923873	Standard	NM_198274		Approved	BOP, ZMYND22, KMT3D	uc002ssr.3	Q8NB12	OTTHUMG00000155045	ENST00000419482.2:c.414C>T	2.37:g.88387480C>T		Somatic	0	30	0.00		0.5117654914895859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	28	14.71	A0AV30|A6NE13	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_SET_dom,pfam_Znf_MYND,smart_SET_dom,pfscan_SET_dom,pfscan_Znf_MYND	p.H138	ENST00000419482.2	37	c.414	CCDS33240.1	2																																																																																			-	pfam_SET_dom,smart_SET_dom		0.642	SMYD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMYD1	protein_coding	OTTHUMT00000338229.2	C	XM_097915	-		88387480	+1	no_errors	ENST00000419482	ensembl	human	known	74_37	silent	SNP	1.000	T
RBMY1J	378951	genome.wustl.edu	37	Y	24551698	24551698	+	Missense_Mutation	SNP	C	C	T			TCGA-VT-AB3D-01A-12D-A417-09	TCGA-VT-AB3D-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51932322-cd96-4c1b-a8ba-660637fff36b	c94fc63b-bf20-4585-9319-5f35435795df	g.chrY:24551698C>T	ENST00000414629.2	+	2	256	c.104C>T	c.(103-105)tCa>tTa	p.S35L	RBMY1J_ENST00000445779.2_Missense_Mutation_p.S35L|RBMY1J_ENST00000470460.1_3'UTR|RBMY1J_ENST00000250831.5_Missense_Mutation_p.S35L			Q15415	RBY1F_HUMAN	RNA binding motif protein, Y-linked, family 1, member J	35	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)										GGTCCCATATCAGAAGGTAAC	0.388																																																	0								ENSG00000226941						4.0	4.0	4.0					Y																	24551698		310	814	1124	RBMY1J	SO:0001583	missense	0			-	HGNC		CCDS35484.1	Yq11.223	2013-02-12			ENSG00000226941	ENSG00000226941		"""RNA binding motif (RRM) containing"""	23917	protein-coding gene	gene with protein product						12815422	Standard	NM_001006117		Approved			Q15415	OTTHUMG00000043594	ENST00000414629.2:c.104C>T	Y.37:g.24551698C>T	ENSP00000405745:p.Ser35Leu	Somatic	0	24	0.00		0.5117654914895859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	10	16.67	B2R916	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RBM1CTR,pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.S35L	ENST00000414629.2	37	c.104	CCDS35484.1	Y																																																																																			-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom		0.388	RBMY1J-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RBMY1J	protein_coding	OTTHUMT00000101937.2	C	NM_001006117	-		24551698	+1	no_errors	ENST00000250831	ensembl	human	known	74_37	missense	SNP	0.970	T
GPR22	2845	genome.wustl.edu	37	7	107115000	107115000	+	Missense_Mutation	SNP	G	G	T			TCGA-VT-AB3D-01A-12D-A417-09	TCGA-VT-AB3D-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51932322-cd96-4c1b-a8ba-660637fff36b	c94fc63b-bf20-4585-9319-5f35435795df	g.chr7:107115000G>T	ENST00000304402.4	+	3	1838	c.495G>T	c.(493-495)tgG>tgT	p.W165C	COG5_ENST00000393603.2_Intron|COG5_ENST00000347053.3_Intron|COG5_ENST00000475638.2_Intron|COG5_ENST00000297135.3_Intron	NM_005295.2	NP_005286.2	Q99680	GPR22_HUMAN	G protein-coupled receptor 22	165					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			large_intestine(3)|lung(6)|ovary(2)|stomach(1)	12						TATCCATTTGGATTTTTTCTT	0.343																																																	0								ENSG00000172209						44.0	47.0	46.0					7																	107115000		2203	4299	6502	GPR22	SO:0001583	missense	0			-	HGNC	U66581	CCDS5744.1	7q22-q31.1	2012-08-21			ENSG00000172209	ENSG00000172209		"""GPCR / Class A : Orphans"""	4477	protein-coding gene	gene with protein product		601910				9073069	Standard	NM_005295		Approved		uc003vef.3	Q99680	OTTHUMG00000154902	ENST00000304402.4:c.495G>T	7.37:g.107115000G>T	ENSP00000302676:p.Trp165Cys	Somatic	0	32	0.00		0.5117654914895859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	20	20.00	O14554	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.W165C	ENST00000304402.4	37	c.495	CCDS5744.1	7	.	.	.	.	.	.	.	.	.	.	G	16.59	3.164480	0.57476	.	.	ENSG00000172209	ENST00000304402	D	0.88818	-2.43	5.5	5.5	0.81552	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.94725	0.8298	M	0.77486	2.375	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.94716	0.7896	10	0.72032	D	0.01	-3.0647	19.762	0.96323	0.0:0.0:1.0:0.0	.	165	Q99680	GPR22_HUMAN	C	165	ENSP00000302676:W165C	ENSP00000302676:W165C	W	+	3	0	GPR22	106902236	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.813000	0.99286	2.741000	0.93983	0.650000	0.86243	TGG	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.343	GPR22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR22	protein_coding	OTTHUMT00000337598.1	G		-		107115000	+1	no_errors	ENST00000304402	ensembl	human	known	74_37	missense	SNP	1.000	T
AGAP1	116987	genome.wustl.edu	37	2	236817475	236817475	+	Missense_Mutation	SNP	T	T	A			TCGA-VT-AB3D-01A-12D-A417-09	TCGA-VT-AB3D-10A-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51932322-cd96-4c1b-a8ba-660637fff36b	c94fc63b-bf20-4585-9319-5f35435795df	g.chr2:236817475T>A	ENST00000304032.8	+	11	1829	c.1249T>A	c.(1249-1251)Tgc>Agc	p.C417S	AGAP1_ENST00000336665.5_Missense_Mutation_p.C417S|AGAP1_ENST00000409538.1_Missense_Mutation_p.C682S|AGAP1_ENST00000428334.2_Missense_Mutation_p.C256S	NM_001037131.2	NP_001032208.1	Q9UPQ3	AGAP1_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 1	417	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	ARF GTPase activator activity (GO:0008060)|GTP binding (GO:0005525)|phospholipid binding (GO:0005543)|zinc ion binding (GO:0008270)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|lung(11)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	41						CACGTCAGCCTGCGCACCCAT	0.498																																																	0								ENSG00000157985						95.0	84.0	88.0					2																	236817475		2203	4300	6503	AGAP1	SO:0001583	missense	0			-	HGNC	AF413078	CCDS2514.1, CCDS33408.1, CCDS58756.1	2q37	2013-01-10	2008-09-22	2008-09-22	ENSG00000157985	ENSG00000157985		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16922	protein-coding gene	gene with protein product		608651	"""centaurin, gamma 2"""	CENTG2			Standard	NM_001037131		Approved	KIAA1099, GGAP1	uc002vvs.3	Q9UPQ3	OTTHUMG00000133293	ENST00000304032.8:c.1249T>A	2.37:g.236817475T>A	ENSP00000307634:p.Cys417Ser	Somatic	0	71	0.00		0.5117654914895859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	60	21.05	B2RTX7|Q541S5|Q6P9D7|Q9NV93	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ArfGAP,pfam_MIRO-like,pfam_Small_GTPase,pfam_Ankyrin_rpt,pfam_Pleckstrin_homology,superfamily_P-loop_NTPase,superfamily_Ankyrin_rpt-contain_dom,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Pleckstrin_homology,smart_ArfGAP,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Pleckstrin_homology,pfscan_ArfGAP,prints_ArfGAP,prints_Small_GTPase	p.C417S	ENST00000304032.8	37	c.1249	CCDS33408.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	3.089|3.089	-0.187369|-0.187369	0.06299|0.06299	.|.	.|.	ENSG00000157985|ENSG00000157985	ENST00000304032;ENST00000336665;ENST00000409538;ENST00000428334|ENST00000448025	T;T;T;T|.	0.73789|.	-0.78;-0.78;-0.78;-0.78|.	4.66|4.66	4.66|4.66	0.58398|0.58398	Pleckstrin homology domain (3);|.	0.058733|.	0.64402|.	D|.	0.000002|.	T|T	0.58850|0.58850	0.2151|0.2151	L|L	0.41824|0.41824	1.3|1.3	0.52501|0.52501	D|D	0.999951|0.999951	B;D|.	0.63046|.	0.001;0.992|.	B;D|.	0.77004|.	0.003;0.989|.	T|T	0.56517|0.56517	-0.7966|-0.7966	10|5	0.21014|.	T|.	0.42|.	.|.	14.8075|14.8075	0.69968|0.69968	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	417;417|.	Q9UPQ3-2;Q9UPQ3|.	.;AGAP1_HUMAN|.	S|Q	417;417;682;256|50	ENSP00000307634:C417S;ENSP00000338378:C417S;ENSP00000386897:C682S;ENSP00000411824:C256S|.	ENSP00000307634:C417S|.	C|L	+|+	1|2	0|0	AGAP1|AGAP1	236482214|236482214	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.611000|0.611000	0.37282|0.37282	4.939000|4.939000	0.63526|0.63526	2.044000|2.044000	0.60594|0.60594	0.533000|0.533000	0.62120|0.62120	TGC|CTG	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology		0.498	AGAP1-001	KNOWN	basic|CCDS	protein_coding	AGAP1	protein_coding	OTTHUMT00000257076.2	T	NM_014914	-		236817475	+1	no_errors	ENST00000304032	ensembl	human	known	74_37	missense	SNP	1.000	A
LOC101927209	101927209	genome.wustl.edu	37	1	142620676	142620678	+	lincRNA	DEL	ATA	ATA	-	rs375376320		TCGA-VT-AB3D-01A-12D-A417-09	TCGA-VT-AB3D-10A-01D-A41A-09	ATA	ATA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51932322-cd96-4c1b-a8ba-660637fff36b	c94fc63b-bf20-4585-9319-5f35435795df	g.chr1:142620676_142620678delATA	ENST00000610091.1	-	0	6805_6807				RP11-417J8.3_ENST00000426408.1_lincRNA																							TAGTGAACTTATAATGTTTCTTT	0.217																																																	0								ENSG00000203849																																			RP11-417J8.6			0				Clone_based_vega_gene																													1.37:g.142620676_142620678delATA		Somatic	0	9	0.00		0.5117654914895859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	12	25.00		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000610091.1	37	NULL		1																																																																																			-	-		0.217	RP11-417J8.6-001	KNOWN	basic	lincRNA	ENSG00000203849	lincRNA	OTTHUMT00000037265.2	ATA				142620678	-1	no_errors	ENST00000369381	ensembl	human	known	74_37	rna	DEL	0.222:0.217:0.212	-
CWH43	80157	genome.wustl.edu	37	4	48993490	48993490	+	Missense_Mutation	SNP	G	G	T			TCGA-VT-AB3D-01A-12D-A417-09	TCGA-VT-AB3D-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51932322-cd96-4c1b-a8ba-660637fff36b	c94fc63b-bf20-4585-9319-5f35435795df	g.chr4:48993490G>T	ENST00000226432.4	+	3	438	c.255G>T	c.(253-255)caG>caT	p.Q85H	CWH43_ENST00000513409.1_Missense_Mutation_p.Q58H	NM_025087.2	NP_079363.2	Q9H720	PG2IP_HUMAN	cell wall biogenesis 43 C-terminal homolog (S. cerevisiae)	85					GPI anchor biosynthetic process (GO:0006506)	integral component of membrane (GO:0016021)				cervix(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(26)|ovary(1)|prostate(1)|skin(4)|urinary_tract(1)	43						CCTCCTTCCAGGCTCCAAATG	0.468																																																	0								ENSG00000109182						257.0	232.0	240.0					4																	48993490		2203	4300	6503	CWH43	SO:0001583	missense	0			-	HGNC		CCDS3486.1, CCDS68697.1	4p12-p11	2010-09-21			ENSG00000109182	ENSG00000109182			26133	protein-coding gene	gene with protein product						17714445, 17761529	Standard	NM_025087		Approved	FLJ21511, CWH43-C	uc003gyv.3	Q9H720	OTTHUMG00000128627	ENST00000226432.4:c.255G>T	4.37:g.48993490G>T	ENSP00000226432:p.Gln85His	Somatic	0	53	0.00		0.5117654914895859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	53	11.67	B2RPD7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_Endo/exonuclease/phosphatase	p.Q85H	ENST00000226432.4	37	c.255	CCDS3486.1	4	.	.	.	.	.	.	.	.	.	.	G	7.979	0.750763	0.15778	.	.	ENSG00000109182	ENST00000226432;ENST00000513409	T;T	0.44482	1.51;0.92	4.51	3.65	0.41850	.	0.505620	0.18101	N	0.151690	T	0.34106	0.0886	L	0.48362	1.52	0.34702	D	0.726844	B	0.12013	0.005	B	0.11329	0.006	T	0.38650	-0.9651	9	.	.	.	.	10.3914	0.44171	0.0:0.1452:0.7043:0.1505	.	85	Q9H720	PG2IP_HUMAN	H	85;58	ENSP00000226432:Q85H;ENSP00000422802:Q58H	.	Q	+	3	2	CWH43	48688247	1.000000	0.71417	1.000000	0.80357	0.500000	0.33767	0.962000	0.29280	1.466000	0.48025	0.563000	0.77884	CAG	-	NULL		0.468	CWH43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CWH43	protein_coding	OTTHUMT00000250496.2	G	NM_025087	-		48993490	+1	no_errors	ENST00000226432	ensembl	human	known	74_37	missense	SNP	1.000	T
SNCB	6620	genome.wustl.edu	37	5	176048292	176048292	+	Missense_Mutation	SNP	C	C	T			TCGA-VT-AB3D-01A-12D-A417-09	TCGA-VT-AB3D-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51932322-cd96-4c1b-a8ba-660637fff36b	c94fc63b-bf20-4585-9319-5f35435795df	g.chr5:176048292C>T	ENST00000310112.3	-	6	545	c.295G>A	c.(295-297)Gcc>Acc	p.A99T	SNCB_ENST00000510387.1_Missense_Mutation_p.A99T|SNCB_ENST00000506696.1_Missense_Mutation_p.A99T|SNCB_ENST00000393693.2_Missense_Mutation_p.A99T	NM_001001502.1	NP_001001502.1	Q16143	SYUB_HUMAN	synuclein, beta	99					dopamine metabolic process (GO:0042417)|negative regulation of catalytic activity (GO:0043086)|negative regulation of neuron apoptotic process (GO:0043524)|synapse organization (GO:0050808)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|inclusion body (GO:0016234)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|terminal bouton (GO:0043195)	calcium ion binding (GO:0005509)|phospholipase inhibitor activity (GO:0004859)			breast(1)|large_intestine(1)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	10	all_cancers(89;0.00222)|Renal(175;0.000269)|Lung NSC(126;0.00902)|all_lung(126;0.0142)	Medulloblastoma(196;0.00498)|all_neural(177;0.0212)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GCTTCCTGGGCCACTTCCTCT	0.607																																																	0								ENSG00000074317						54.0	52.0	52.0					5																	176048292		2203	4300	6503	SNCB	SO:0001583	missense	0			-	HGNC	AF053134	CCDS4406.1	5q35	2008-07-18			ENSG00000074317	ENSG00000074317			11140	protein-coding gene	gene with protein product		602569				7558013, 9806846	Standard	NM_003085		Approved		uc003meq.3	Q16143	OTTHUMG00000130661	ENST00000310112.3:c.295G>A	5.37:g.176048292C>T	ENSP00000308057:p.Ala99Thr	Somatic	0	53	0.00		0.5117654914895859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	34	10.53	Q6IAX7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Synuclein,prints_Synuclein,prints_Synuclein_beta	p.A99T	ENST00000310112.3	37	c.295	CCDS4406.1	5	.	.	.	.	.	.	.	.	.	.	C	16.59	3.164349	0.57476	.	.	ENSG00000074317	ENST00000310112;ENST00000393693;ENST00000510387;ENST00000506696	D;D;D;D	0.83673	-1.75;-1.75;-1.75;-1.75	5.3	4.42	0.53409	.	0.204155	0.41500	D	0.000867	T	0.75679	0.3882	L	0.43152	1.355	0.42447	D	0.99273	P	0.41748	0.761	B	0.37267	0.245	T	0.72766	-0.4194	10	0.16420	T	0.52	-4.6425	15.9379	0.79729	0.0:0.8645:0.1355:0.0	.	99	Q16143	SYUB_HUMAN	T	99	ENSP00000308057:A99T;ENSP00000377296:A99T;ENSP00000424073:A99T;ENSP00000422223:A99T	ENSP00000308057:A99T	A	-	1	0	SNCB	175980898	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.003000	0.70701	1.227000	0.43598	0.655000	0.94253	GCC	-	pfam_Synuclein,prints_Synuclein_beta		0.607	SNCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNCB	protein_coding	OTTHUMT00000253152.2	C	NM_001001502	-		176048292	-1	no_errors	ENST00000310112	ensembl	human	known	74_37	missense	SNP	1.000	T
EPB41	2035	genome.wustl.edu	37	1	29444350	29444352	+	3'UTR	DEL	TTC	TTC	-			TCGA-VT-AB3D-01A-12D-A417-09	TCGA-VT-AB3D-10A-01D-A41A-09	TTC	TTC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51932322-cd96-4c1b-a8ba-660637fff36b	c94fc63b-bf20-4585-9319-5f35435795df	g.chr1:29444350_29444352delTTC	ENST00000343067.4	+	0	3748_3750				EPB41_ENST00000460378.1_3'UTR|EPB41_ENST00000356093.2_3'UTR|EPB41_ENST00000398863.2_3'UTR|EPB41_ENST00000373798.1_3'UTR	NM_001166005.1	NP_001159477.1	P11171	41_HUMAN	erythrocyte membrane protein band 4.1						actin cytoskeleton organization (GO:0030036)|blood circulation (GO:0008015)|cortical actin cytoskeleton organization (GO:0030866)|positive regulation of protein binding (GO:0032092)	cortical cytoskeleton (GO:0030863)|extrinsic component of membrane (GO:0019898)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	1-phosphatidylinositol binding (GO:0005545)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(2)|urinary_tract(1)	14		Colorectal(325;3.46e-05)|Prostate(1639;0.000244)|Lung NSC(340;0.00328)|all_lung(284;0.00412)|Breast(348;0.00765)|all_neural(195;0.0199)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)|Medulloblastoma(700;0.123)		Colorectal(126;3.12e-07)|COAD - Colon adenocarcinoma(152;1.21e-05)|STAD - Stomach adenocarcinoma(196;0.00395)|KIRC - Kidney renal clear cell carcinoma(1967;0.0249)|BRCA - Breast invasive adenocarcinoma(304;0.0289)|READ - Rectum adenocarcinoma(331;0.0757)		AGAAGGGTTTTTCTTTTTTGACC	0.478																																																	0								ENSG00000159023																																			EPB41	SO:0001624	3_prime_UTR_variant	0				HGNC	BC039079	CCDS330.1, CCDS331.1, CCDS332.1, CCDS53288.1, CCDS53289.1	1p33-p32	2014-05-09	2014-05-09		ENSG00000159023	ENSG00000159023			3377	protein-coding gene	gene with protein product		130500	"""elliptocytosis 1, RH-linked"""	EL1			Standard	NM_001166005		Approved	4.1R	uc001brm.2	P11171	OTTHUMG00000003644	ENST00000343067.4:c.*1028TTC>-	1.37:g.29444350_29444352delTTC		Somatic	0	45	0.00		0.5117654914895859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	55	20.29	B1ALH8|B1ALH9|D3DPM9|D3DPN0|P11176|Q14245|Q5TB35|Q5VXN8|Q8IXV9|Q9Y578|Q9Y579	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000343067.4	37	NULL	CCDS53288.1	1																																																																																			-	-		0.478	EPB41-201	KNOWN	basic|appris_principal|CCDS	protein_coding	EPB41	protein_coding	OTTHUMT00000010312.1	TTC	NM_203342			29444352	+1	no_errors	ENST00000460378	ensembl	human	known	74_37	rna	DEL	0.000:0.000:0.000	-
ADAMTS2	9509	genome.wustl.edu	37	5	178559313	178559313	+	Splice_Site	DEL	T	T	-			TCGA-VT-AB3D-01A-12D-A417-09	TCGA-VT-AB3D-10A-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51932322-cd96-4c1b-a8ba-660637fff36b	c94fc63b-bf20-4585-9319-5f35435795df	g.chr5:178559313delT	ENST00000251582.7	-	15	2311		c.e15-2			NM_014244.4	NP_055059.2	O95450	ATS2_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 2						collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|lung development (GO:0030324)|protein processing (GO:0016485)|skin development (GO:0043588)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(31)|ovary(1)|pancreas(3)|prostate(2)|skin(7)	72	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)		TGATGTAACCTTTTTTTGATG	0.547																																																	0								ENSG00000087116						87.0	83.0	84.0					5																	178559313		2203	4300	6503	ADAMTS2	SO:0001630	splice_region_variant	0				HGNC	AJ003125	CCDS4444.1, CCDS34311.1	5q23-q24	2008-07-18	2005-08-19		ENSG00000087116	ENSG00000087116		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	218	protein-coding gene	gene with protein product	"""procollagen I N-proteinase"", ""procollagen N-endopeptidase"""	604539	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 2"""			10094461, 15373769	Standard	NM_014244		Approved	ADAMTS-3, hPCPNI, PCINP, ADAM-TS2, NPI	uc003mjw.3	O95450	OTTHUMG00000130915	ENST00000251582.7:c.2210-2A>-	5.37:g.178559313delT		Somatic	0	33	0.00		0.5117654914895859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	31	8.82		Splice_Site	DEL	NA	NA	NA	NA	NA	NA	-	e15-2	ENST00000251582.7	37	c.2210-2	CCDS4444.1	5																																																																																			-	-		0.547	ADAMTS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS2	protein_coding	OTTHUMT00000253507.1	T	NM_014244		Intron	178559313	-1	no_errors	ENST00000251582	ensembl	human	known	74_37	splice_site_del	DEL	0.999	-
MUC20	200958	genome.wustl.edu	37	3	195453048	195453053	+	In_Frame_Del	DEL	TTAGCA	TTAGCA	-	rs368952817		TCGA-VT-AB3D-01A-12D-A417-09	TCGA-VT-AB3D-10A-01D-A41A-09	TTAGCA	TTAGCA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51932322-cd96-4c1b-a8ba-660637fff36b	c94fc63b-bf20-4585-9319-5f35435795df	g.chr3:195453048_195453053delTTAGCA	ENST00000447234.2	+	2	1700_1705	c.1574_1579delTTAGCA	c.(1573-1581)gttagcagg>ggg	p.525_527VSR>G	MUC20_ENST00000445522.2_In_Frame_Del_p.490_492VSR>G|MUC20_ENST00000320736.6_In_Frame_Del_p.354_356VSR>G|MUC20_ENST00000436408.1_In_Frame_Del_p.525_527VSR>G	NM_001282506.1	NP_001269435.1	Q8N307	MUC20_HUMAN	mucin 20, cell surface associated	525	Involved in oligomerization.		Missing. {ECO:0000269|PubMed:14702039}.	VTVSR -> ATG (in Ref. 5; AAH29267). {ECO:0000305}.	activation of MAPK activity (GO:0000187)|cellular protein metabolic process (GO:0044267)|hepatocyte growth factor receptor signaling pathway (GO:0048012)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein homooligomerization (GO:0051260)	basal plasma membrane (GO:0009925)|cell projection (GO:0042995)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)				NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(4)|skin(4)|stomach(3)|upper_aerodigestive_tract(1)	23	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)	Lung NSC(153;0.191)	Epithelial(36;1e-21)|all cancers(36;9.02e-20)|OV - Ovarian serous cystadenocarcinoma(49;1.6e-18)|Lung(62;0.000104)|LUSC - Lung squamous cell carcinoma(58;0.000128)	GBM - Glioblastoma multiforme(46;1.66e-05)		CTGGTCACAGTTAGCAGGAATCCCCT	0.578																																																	0								ENSG00000176945																																			MUC20	SO:0001651	inframe_deletion	0				HGNC	AB037780	CCDS63877.1	3q29	2008-08-07	2006-03-14		ENSG00000176945	ENSG00000176945		"""Mucins"""	23282	protein-coding gene	gene with protein product		610360				14565953	Standard	NM_001282506		Approved	FLJ14408, KIAA1359	uc010hzo.3	Q8N307	OTTHUMG00000155823	ENST00000447234.2:c.1574_1579delTTAGCA	3.37:g.195453048_195453053delTTAGCA	ENSP00000414350:p.Val525_Arg527delinsGly	Somatic	NA	NA	NA		0.5117654914895859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q6UX97|Q76I83|Q76I85|Q86ST8|Q8NBY6|Q96KA1|Q9P2I8	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	NULL	p.VSR525in_frame_delG	ENST00000447234.2	37	c.1574_1579		3																																																																																			-	NULL		0.578	MUC20-001	KNOWN	basic|appris_candidate	protein_coding	MUC20	protein_coding	OTTHUMT00000341835.1	TTAGCA	NM_152673			195453053	+1	no_errors	ENST00000447234	ensembl	human	known	74_37	in_frame_del	DEL	0.000:0.000:0.000:0.000:0.000:0.000	-
OGG1	4968	genome.wustl.edu	37	3	9798456	9798456	+	Frame_Shift_Del	DEL	T	T	-			TCGA-VT-AB3D-01A-12D-A417-09	TCGA-VT-AB3D-10A-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51932322-cd96-4c1b-a8ba-660637fff36b	c94fc63b-bf20-4585-9319-5f35435795df	g.chr3:9798456delT	ENST00000344629.7	+	6	1247	c.904delT	c.(904-906)tttfs	p.F303fs	OGG1_ENST00000349503.5_Intron|OGG1_ENST00000449570.2_Frame_Shift_Del_p.F303fs|OGG1_ENST00000339511.5_Frame_Shift_Del_p.F303fs|OGG1_ENST00000383826.5_Intron|OGG1_ENST00000302008.8_Frame_Shift_Del_p.F303fs|OGG1_ENST00000302036.7_Frame_Shift_Del_p.F303fs|OGG1_ENST00000302003.7_Frame_Shift_Del_p.F303fs			O15527	OGG1_HUMAN	8-oxoguanine DNA glycosylase	303					acute inflammatory response (GO:0002526)|base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|cellular response to cadmium ion (GO:0071276)|depurination (GO:0045007)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair (GO:0006289)|regulation of protein import into nucleus, translocation (GO:0033158)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to folic acid (GO:0051593)|response to oxidative stress (GO:0006979)|response to radiation (GO:0009314)	mitochondrion (GO:0005739)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	8-oxo-7,8-dihydroguanine DNA N-glycosylase activity (GO:0034039)|damaged DNA binding (GO:0003684)|endonuclease activity (GO:0004519)|oxidized purine nucleobase lesion DNA N-glycosylase activity (GO:0008534)			kidney(2)|large_intestine(2)|lung(2)|skin(1)|urinary_tract(1)	8	Medulloblastoma(99;0.227)					TTTAGGAAACTTTTTCCGGAG	0.527								Base excision repair (BER), DNA glycosylases																																									0								ENSG00000114026						92.0	91.0	91.0					3																	9798456		2203	4300	6503	OGG1	SO:0001589	frameshift_variant	0				HGNC	U96710	CCDS2576.1, CCDS2577.1, CCDS2578.1, CCDS2579.1, CCDS2580.1, CCDS2581.1, CCDS43046.1, CCDS46742.1	3p26	2010-11-23			ENSG00000114026	ENSG00000114026	3.2.2.-, 4.2.99.18		8125	protein-coding gene	gene with protein product	"""8-hydroxyguanine DNA glycosylase"", ""OGG1 type 1e"", ""OGG1 type 1d"", ""OGG1 type 1g"", ""OGG1 type 1h"""	601982				9207108, 10449904	Standard	NM_002542		Approved	HMMH, HOGG1, OGH1, MUTM	uc003bsj.3	O15527	OTTHUMG00000097091	ENST00000344629.7:c.904delT	3.37:g.9798456delT	ENSP00000342851:p.Phe303fs	Somatic	0	44	0.00		0.5117654914895859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	30	9.09	A8K1E3|O00390|O00670|O00705|O14876|O95488|P78554|Q9BW42|Q9UIK0|Q9UIK1|Q9UIK2|Q9UL34|Q9Y2C0|Q9Y2C1|Q9Y6C3|Q9Y6C4	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_OGG_N,pfam_HhH-GPD_domain,superfamily_DNA_glycosylase,smart_HhH-GPD_domain,tigrfam_Ogg	p.F303fs	ENST00000344629.7	37	c.904	CCDS2581.1	3																																																																																			-	superfamily_DNA_glycosylase,smart_HhH-GPD_domain,tigrfam_Ogg		0.527	OGG1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	OGG1	protein_coding	OTTHUMT00000214223.2	T	NM_016821			9798456	+1	no_errors	ENST00000302036	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
