#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
C6	729	genome.wustl.edu	37	5	41160304	41160304	+	Missense_Mutation	SNP	C	C	T			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr5:41160304C>T	ENST00000263413.3	-	11	1888	c.1624G>A	c.(1624-1626)Gtg>Atg	p.V542M	C6_ENST00000475349.1_5'Flank|C6_ENST00000337836.5_Missense_Mutation_p.V542M	NM_001115131.1	NP_001108603.2	P13671	CO6_HUMAN	complement component 6	542	EGF-like.				complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)				central_nervous_system(2)|cervix(2)|endometrium(2)|kidney(7)|large_intestine(16)|liver(1)|lung(51)|ovary(3)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)	96		Breast(839;1.07e-05)|Ovarian(839;0.0228)|Lung SC(612;0.0548)|Lung NSC(810;0.128)|all_neural(839;0.157)				CTCTGACACACACACAGACAT	0.463																																																	0								ENSG00000039537						172.0	162.0	165.0					5																	41160304		2203	4300	6503	C6	SO:0001583	missense	0			-	HGNC	J05024	CCDS3936.1	5p13.1	2014-09-17			ENSG00000039537	ENSG00000039537		"""Complement system"""	1339	protein-coding gene	gene with protein product		217050					Standard	NM_001115131		Approved		uc003jmk.3	P13671	OTTHUMG00000094781	ENST00000263413.3:c.1624G>A	5.37:g.41160304C>T	ENSP00000263413:p.Val542Met	Somatic	0	55	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	33	10.81		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MACPF,pfam_Sushi_SCR_CCP,pfam_Thrombospondin_1_rpt,pfam_LDrepeatLR_classA_rpt,pfam_Kazal_dom,superfamily_Sushi_SCR_CCP,superfamily_Thrombospondin_1_rpt,superfamily_LDrepeatLR_classA_rpt,smart_Thrombospondin_1_rpt,smart_LDrepeatLR_classA_rpt,smart_MACPF,smart_Sushi_SCR_CCP,smart_FacI_MAC,prints_MAC_perforin,pfscan_LDrepeatLR_classA_rpt,pfscan_Sushi_SCR_CCP,pfscan_Thrombospondin_1_rpt	p.V542M	ENST00000263413.3	37	c.1624	CCDS3936.1	5	.	.	.	.	.	.	.	.	.	.	C	15.50	2.851033	0.51270	.	.	ENSG00000039537	ENST00000337836;ENST00000263413	T;T	0.62105	0.05;0.05	6.06	4.27	0.50696	.	0.347453	0.30979	N	0.008493	T	0.62392	0.2424	L	0.34521	1.04	0.45867	D	0.998725	D	0.62365	0.991	D	0.64410	0.925	T	0.62599	-0.6820	10	0.52906	T	0.07	-8.948	3.9597	0.09405	0.1234:0.5067:0.2388:0.1311	.	542	P13671	CO6_HUMAN	M	542	ENSP00000338861:V542M;ENSP00000263413:V542M	ENSP00000263413:V542M	V	-	1	0	C6	41196061	0.789000	0.28775	0.993000	0.49108	0.415000	0.31203	0.201000	0.17276	0.881000	0.35993	0.655000	0.94253	GTG	-	prints_MAC_perforin		0.463	C6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C6	protein_coding	OTTHUMT00000211592.1	C		-		41160304	-1	no_errors	ENST00000263413	ensembl	human	known	74_37	missense	SNP	0.977	T
OPHN1	4983	genome.wustl.edu	37	X	67283813	67283813	+	Missense_Mutation	SNP	C	C	A			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chrX:67283813C>A	ENST00000355520.5	-	21	2682	c.2041G>T	c.(2041-2043)Ggg>Tgg	p.G681W	OPHN1_ENST00000484842.1_5'UTR|OPHN1_ENST00000540071.1_Intron	NM_002547.2	NP_002538.1	O60890	OPHN1_HUMAN	oligophrenin 1	681	Pro-rich.				actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|negative regulation of proteasomal protein catabolic process (GO:1901799)|nervous system development (GO:0007399)|regulation of endocytosis (GO:0030100)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of synaptic transmission, glutamatergic (GO:0051966)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|substrate-dependent cell migration, cell extension (GO:0006930)|synaptic vesicle endocytosis (GO:0048488)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|terminal bouton (GO:0043195)	phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(13)|ovary(3)|skin(2)	31						ATCTTGGTCCCTCCATCCTGC	0.607																																																	0								ENSG00000079482						79.0	61.0	67.0					X																	67283813		2203	4300	6503	OPHN1	SO:0001583	missense	0			-	HGNC	AJ001189	CCDS14388.1	Xq12	2011-07-04			ENSG00000079482	ENSG00000079482		"""Rho GTPase activating proteins"""	8148	protein-coding gene	gene with protein product		300127	"""mental retardation, X-linked 60"""	MRX60		9195162, 9582072	Standard	NM_002547		Approved	OPN1, ARHGAP41	uc004dww.4	O60890	OTTHUMG00000021744	ENST00000355520.5:c.2041G>T	X.37:g.67283813C>A	ENSP00000347710:p.Gly681Trp	Somatic	0	110	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	44	21.43	B9EIP8|Q5JQ81|Q6PCC1|Q8WX47	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_Pleckstrin_homology,smart_RhoGAP_dom,pfscan_Pleckstrin_homology,pfscan_RhoGAP_dom	p.G681W	ENST00000355520.5	37	c.2041	CCDS14388.1	X	.	.	.	.	.	.	.	.	.	.	C	15.42	2.828782	0.50845	.	.	ENSG00000079482	ENST00000355520	T	0.50001	0.76	4.9	4.02	0.46733	.	0.185819	0.37437	N	0.002083	T	0.34687	0.0906	N	0.14661	0.345	0.80722	D	1	D	0.54047	0.964	P	0.46685	0.524	T	0.24048	-1.0171	10	0.72032	D	0.01	.	9.9236	0.41478	0.0:0.7987:0.2013:0.0	.	681	O60890	OPHN1_HUMAN	W	681	ENSP00000347710:G681W	ENSP00000347710:G681W	G	-	1	0	OPHN1	67200538	1.000000	0.71417	0.979000	0.43373	0.631000	0.37964	2.576000	0.46033	1.037000	0.40024	0.506000	0.49869	GGG	-	NULL		0.607	OPHN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OPHN1	protein_coding	OTTHUMT00000057011.1	C	NM_002547	-		67283813	-1	no_errors	ENST00000355520	ensembl	human	known	74_37	missense	SNP	0.990	A
ERBB2IP	55914	genome.wustl.edu	37	5	65349674	65349674	+	Missense_Mutation	SNP	G	G	T	rs538916835		TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr5:65349674G>T	ENST00000284037.5	+	21	2917	c.2528G>T	c.(2527-2529)tGt>tTt	p.C843F	ERBB2IP_ENST00000508515.1_Missense_Mutation_p.C843F|ERBB2IP_ENST00000380939.2_Missense_Mutation_p.C843F|ERBB2IP_ENST00000380936.1_Missense_Mutation_p.C843F|ERBB2IP_ENST00000380943.2_Missense_Mutation_p.C843F|ERBB2IP_ENST00000380935.1_Missense_Mutation_p.C843F|ERBB2IP_ENST00000506030.1_Missense_Mutation_p.C843F|ERBB2IP_ENST00000511297.1_Missense_Mutation_p.C839F|ERBB2IP_ENST00000380938.2_Missense_Mutation_p.C843F|ERBB2IP_ENST00000416865.2_Intron	NM_001253697.1	NP_001240626.1	Q96RT1	LAP2_HUMAN	erbb2 interacting protein	843					basal protein localization (GO:0045175)|cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell growth (GO:0016049)|epidermal growth factor receptor signaling pathway (GO:0007173)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|signal transduction (GO:0007165)	basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|hemidesmosome (GO:0030056)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ErbB-2 class receptor binding (GO:0005176)|integrin binding (GO:0005178)|structural constituent of cytoskeleton (GO:0005200)			breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(8)|lung(11)|ovary(3)|skin(2)	36		Lung NSC(167;9.45e-06)|Prostate(74;0.0139)|Ovarian(174;0.0547)|Breast(144;0.093)|Colorectal(97;0.234)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0767)|Lung(70;0.00191)		GACAGTGATTGTTCTGTTGAC	0.393																																																	0								ENSG00000112851						95.0	97.0	96.0					5																	65349674		2203	4300	6503	ERBB2IP	SO:0001583	missense	0			-	HGNC		CCDS3990.1, CCDS34172.1, CCDS58951.1, CCDS58952.1, CCDS58953.1, CCDS58954.1	5p14.3-q12.3	2008-07-18	2001-11-29		ENSG00000112851	ENSG00000112851			15842	protein-coding gene	gene with protein product	"""densin-180-like protein"", ""ERBB2-interacting protein"""	606944	"""erbb2-interacting protein"""			10574462, 10878805	Standard	NM_001253697		Approved	ERBIN, LAP2	uc011cqx.2	Q96RT1	OTTHUMG00000097808	ENST00000284037.5:c.2528G>T	5.37:g.65349674G>T	ENSP00000284037:p.Cys843Phe	Somatic	0	42	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	16	15.79	A0AVR1|B4E3F1|B7ZLV9|E7EQW9|E9PCR8|Q1RMD0|Q86W38|Q9NR18|Q9NW48|Q9ULJ5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Leu-rich_rpt,pfam_PDZ,superfamily_PDZ,smart_Leu-rich_rpt_typical-subtyp,smart_PDZ,pfscan_PDZ	p.C843F	ENST00000284037.5	37	c.2528	CCDS58953.1	5	.	.	.	.	.	.	.	.	.	.	G	0.421	-0.908305	0.02434	.	.	ENSG00000112851	ENST00000284037;ENST00000380943;ENST00000380939;ENST00000380936;ENST00000380935;ENST00000380938;ENST00000511297;ENST00000506030;ENST00000508515	T;T;T;T;T;T;T;T;T	0.36878	1.43;1.42;1.42;1.62;1.23;1.49;1.42;1.46;1.23	5.69	2.92	0.33932	.	0.468250	0.26133	N	0.026156	T	0.21387	0.0515	N	0.08118	0	0.09310	N	1	B;B;B;B;B;B;B	0.22211	0.039;0.023;0.023;0.04;0.007;0.039;0.066	B;B;B;B;B;B;B	0.29862	0.108;0.05;0.05;0.05;0.012;0.074;0.079	T	0.24048	-1.0171	10	0.59425	D	0.04	.	10.7011	0.45928	0.0:0.6717:0.2593:0.069	.	843;843;843;839;843;843;843	Q96RT1-4;E9PCR8;B7ZLV9;E7EQW9;Q96RT1;Q96RT1-7;Q96RT1-2	.;.;.;.;LAP2_HUMAN;.;.	F	843;843;843;843;843;843;839;843;843	ENSP00000284037:C843F;ENSP00000370330:C843F;ENSP00000370326:C843F;ENSP00000370323:C843F;ENSP00000370322:C843F;ENSP00000370325:C843F;ENSP00000422766:C839F;ENSP00000426632:C843F;ENSP00000422015:C843F	ENSP00000284037:C843F	C	+	2	0	ERBB2IP	65385430	0.950000	0.32346	0.002000	0.10522	0.035000	0.12851	1.860000	0.39428	0.321000	0.23259	-0.344000	0.07964	TGT	-	NULL		0.393	ERBB2IP-002	KNOWN	basic|CCDS	protein_coding	ERBB2IP	protein_coding	OTTHUMT00000215070.1	G	NM_018695	-		65349674	+1	no_errors	ENST00000284037	ensembl	human	known	74_37	missense	SNP	0.006	T
NRIP3	56675	genome.wustl.edu	37	11	9007284	9007284	+	Missense_Mutation	SNP	C	C	T			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr11:9007284C>T	ENST00000309166.3	-	4	649	c.536G>A	c.(535-537)cGc>cAc	p.R179H	NRIP3_ENST00000531090.1_Intron	NM_020645.2	NP_065696.1	Q9NQ35	NRIP3_HUMAN	nuclear receptor interacting protein 3	179							aspartic-type endopeptidase activity (GO:0004190)			large_intestine(1)|lung(4)|skin(1)|stomach(1)	7				Epithelial(150;4.77e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0241)		GCAGTCCAGGCGGAGGGAGCC	0.542																																																	0								ENSG00000175352						131.0	127.0	129.0					11																	9007284		2201	4296	6497	NRIP3	SO:0001583	missense	0			-	HGNC	AJ400877	CCDS31422.1	11p15.3	2008-02-05	2003-09-03	2003-09-05	ENSG00000175352	ENSG00000175352			1167	protein-coding gene	gene with protein product		613125	"""chromosome 11 open reading frame 14"""	C11orf14		11528127	Standard	NM_020645		Approved		uc001mhg.2	Q9NQ35	OTTHUMG00000165680	ENST00000309166.3:c.536G>A	11.37:g.9007284C>T	ENSP00000310205:p.Arg179His	Somatic	0	67	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	47	9.62	Q86WD9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_aspartic_DDI1-type,superfamily_Peptidase_aspartic_dom	p.R179H	ENST00000309166.3	37	c.536	CCDS31422.1	11	.	.	.	.	.	.	.	.	.	.	C	17.07	3.295976	0.60086	.	.	ENSG00000175352	ENST00000309166;ENST00000531142	T	0.39592	1.07	6.02	4.17	0.49024	Peptidase aspartic (1);Peptidase aspartic, eukaryotic predicted (1);	0.399819	0.28214	N	0.016167	T	0.49541	0.1563	M	0.62723	1.935	0.80722	D	1	D	0.71674	0.998	P	0.60609	0.877	T	0.49418	-0.8942	10	0.14656	T	0.56	.	6.3337	0.21285	0.1464:0.701:0.0:0.1526	.	179	Q9NQ35	NRIP3_HUMAN	H	179;7	ENSP00000310205:R179H	ENSP00000310205:R179H	R	-	2	0	NRIP3	8963860	0.465000	0.25815	0.992000	0.48379	0.835000	0.47333	0.090000	0.15025	0.893000	0.36288	-0.150000	0.13652	CGC	-	pfam_Peptidase_aspartic_DDI1-type,superfamily_Peptidase_aspartic_dom		0.542	NRIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NRIP3	protein_coding	OTTHUMT00000385774.1	C	NM_020645	-		9007284	-1	no_errors	ENST00000309166	ensembl	human	known	74_37	missense	SNP	0.998	T
ANK2	287	genome.wustl.edu	37	4	114177028	114177028	+	Frame_Shift_Del	DEL	C	C	-			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr4:114177028delC	ENST00000357077.4	+	11	1181	c.1128delC	c.(1126-1128)ggcfs	p.G376fs	ANK2_ENST00000506722.1_Frame_Shift_Del_p.G355fs|ANK2_ENST00000264366.6_Frame_Shift_Del_p.G376fs|ANK2_ENST00000394537.3_Frame_Shift_Del_p.G376fs	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	376					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		CGCACTGTGGCCACTACCGTG	0.512																																																	0								ENSG00000145362						167.0	147.0	154.0					4																	114177028		2203	4300	6503	ANK2	SO:0001589	frameshift_variant	0				HGNC	M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.1128delC	4.37:g.114177028delC	ENSP00000349588:p.Gly376fs	Somatic	0	47	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	12	14.29	Q01485|Q08AC7|Q08AC8|Q7Z3L5	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Ankyrin_rpt,pfam_ZU5,pfam_Death_domain,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like_dom,smart_Ankyrin_rpt,smart_ZU5,smart_Death_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death_domain,pfscan_ZU5,prints_Ankyrin_rpt	p.H377fs	ENST00000357077.4	37	c.1128	CCDS3702.1	4																																																																																			-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom		0.512	ANK2-001	KNOWN	basic|CCDS	protein_coding	ANK2	protein_coding	OTTHUMT00000256422.2	C	NM_001148			114177028	+1	no_errors	ENST00000357077	ensembl	human	known	74_37	frame_shift_del	DEL	0.549	-
CA5BP1	340591	genome.wustl.edu	37	X	15721071	15721071	+	RNA	SNP	G	G	A			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chrX:15721071G>A	ENST00000380334.2	+	0	488							Q8WTZ4	CA5BL_HUMAN	carbonic anhydrase VB pseudogene 1							mitochondrion (GO:0005739)	carbonate dehydratase activity (GO:0004089)|zinc ion binding (GO:0008270)										CACTGGGTCCGCATCCGGCCC	0.637																																																	0								ENSG00000186312																																			CA5BP1			0			-	HGNC	BC021816		Xp22.2	2012-11-02	2011-02-07	2011-02-07	ENSG00000186312	ENSG00000186312			29544	pseudogene	pseudogene	"""similar to carbonic anhydrase VB, mitochondrial precursor"", ""carbonic dehydratase"""		"""carbonic anhydrase VB-like"", ""carbonic anhydrase VB pseudogene"""	CA5BL, CA5BP		12477932	Standard	NR_026551		Approved	PRO2325	uc011mir.1	Q8WTZ4	OTTHUMG00000021182		X.37:g.15721071G>A		Somatic	0	100	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.30	A6NEZ4	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000380334.2	37	NULL		X																																																																																			-	-		0.637	CA5BP1-005	KNOWN	basic	processed_transcript	CA5BP1	pseudogene	OTTHUMT00000055884.3	G	NR_026551	-		15721071	+1	no_errors	ENST00000380333	ensembl	human	known	74_37	rna	SNP	0.000	A
ITGB6	3694	genome.wustl.edu	37	2	161052858	161052858	+	Frame_Shift_Del	DEL	A	A	-			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr2:161052858delA	ENST00000283249.2	-	3	452	c.215delT	c.(214-216)ttafs	p.L72fs	ITGB6_ENST00000485635.1_5'UTR|ITGB6_ENST00000409872.1_Frame_Shift_Del_p.L72fs|ITGB6_ENST00000428609.2_Frame_Shift_Del_p.L30fs|ITGB6_ENST00000409967.2_Frame_Shift_Del_p.L72fs	NM_001282353.1|NM_001282354.1|NM_001282388.1	NP_001269282.1|NP_001269283.1|NP_001269317.1	P18564	ITB6_HUMAN	integrin, beta 6	72					cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|inflammatory response (GO:0006954)|integrin-mediated signaling pathway (GO:0007229)|multicellular organismal development (GO:0007275)|viral process (GO:0016032)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	virus receptor activity (GO:0001618)			breast(1)|endometrium(1)|kidney(2)|large_intestine(8)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	23						GATGAAGTTTAATTGACATCC	0.363																																																	0								ENSG00000115221						165.0	177.0	173.0					2																	161052858		2203	4300	6503	ITGB6	SO:0001589	frameshift_variant	0				HGNC		CCDS2212.1, CCDS63040.1, CCDS74596.1, CCDS74597.1	2q24.2	2010-03-23			ENSG00000115221	ENSG00000115221		"""Integrins"""	6161	protein-coding gene	gene with protein product		147558				1729173, 8120056	Standard	NM_001282353		Approved		uc002ubh.2	P18564	OTTHUMG00000132026	ENST00000283249.2:c.215delT	2.37:g.161052858delA	ENSP00000283249:p.Leu72fs	Somatic	0	63	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	15	11.76	B2R9W5|C9JA97|Q0VA95|Q16500|Q53RG5|Q53RR6	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pirsf_Integrin_bsu,pfam_Integrin_bsu_N,pfam_Integrin_bsu_cyt_dom,pfam_Integrin_bsu_tail,pfam_EGF_extracell,superfamily_Integrin_bsu_tail,superfamily_Plexin-like_fold,smart_Plexin-like_fold,smart_Integrin_bsu_N,prints_Integrin_bsu	p.L72fs	ENST00000283249.2	37	c.215	CCDS2212.1	2																																																																																			-	pirsf_Integrin_bsu,pfam_Integrin_bsu_N,superfamily_Plexin-like_fold,smart_Integrin_bsu_N,prints_Integrin_bsu		0.363	ITGB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGB6	protein_coding	OTTHUMT00000255036.1	A	NM_000888			161052858	-1	no_errors	ENST00000283249	ensembl	human	known	74_37	frame_shift_del	DEL	0.000	-
NOS1AP	9722	genome.wustl.edu	37	1	162335173	162335173	+	Intron	DEL	G	G	-			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr1:162335173delG	ENST00000361897.5	+	9	1341				RP11-565P22.6_ENST00000431696.1_5'Flank|NOS1AP_ENST00000530878.1_Intron|NOS1AP_ENST00000493151.1_Frame_Shift_Del_p.A14fs	NM_001164757.1|NM_014697.2	NP_001158229.1|NP_055512.1	O75052	CAPON_HUMAN	nitric oxide synthase 1 (neuronal) adaptor protein						regulation of apoptotic process (GO:0042981)|regulation of nitric oxide biosynthetic process (GO:0045428)|regulation of nitric-oxide synthase activity (GO:0050999)		nitric-oxide synthase binding (GO:0050998)			NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(12)|skin(1)|upper_aerodigestive_tract(2)	32	all_hematologic(112;0.203)		BRCA - Breast invasive adenocarcinoma(70;0.0537)			TGTCTTCTCTGCCGCTGCCTC	0.582																																																	0								ENSG00000198929						56.0	56.0	56.0					1																	162335173		2203	4300	6503	NOS1AP	SO:0001627	intron_variant	0				HGNC	AB007933	CCDS1237.1, CCDS44267.1, CCDS53421.1	1q23.3	2010-08-20			ENSG00000198929	ENSG00000198929			16859	protein-coding gene	gene with protein product	"""C-terminal PDZ domain ligand of neuronal nitric oxide synthase"""	605551				9455484, 9459447	Standard	NM_001126060		Approved	KIAA0464, CAPON	uc001gbv.2	O75052	OTTHUMG00000024049	ENST00000361897.5:c.940-21G>-	1.37:g.162335173delG		Somatic	0	48	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	14	12.50	B7ZLF5|O43564|Q3T551|Q5VU95	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	NULL	p.A12fs	ENST00000361897.5	37	c.34	CCDS1237.1	1																																																																																			-	NULL		0.582	NOS1AP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NOS1AP	protein_coding	OTTHUMT00000060555.2	G	NM_014697			162335173	+1	no_errors	ENST00000493151	ensembl	human	known	74_37	frame_shift_del	DEL	0.001	-
RNF212	285498	genome.wustl.edu	37	4	1087327	1087328	+	Intron	INS	-	-	CTGCCCAGGCTGGAGCCAGCC	rs376912904|rs386670461|rs142232513|rs539986150|rs138488801	byFrequency	TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr4:1087327_1087328insCTGCCCAGGCTGGAGCCAGCC	ENST00000433731.2	-	4	308				RNF212_ENST00000333673.5_In_Frame_Ins_p.241_241S>WLAPAWAA|RNF212_ENST00000382968.5_Intron			Q495C1	RN212_HUMAN	ring finger protein 212						chiasma assembly (GO:0051026)|meiotic gene conversion (GO:0006311)|protein sumoylation (GO:0016925)|reciprocal meiotic recombination (GO:0007131)	synaptonemal complex (GO:0000795)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)|skin(1)	10			OV - Ovarian serous cystadenocarcinoma(23;0.0179)	UCEC - Uterine corpus endometrioid carcinoma (64;0.151)		CAGAGCCTGTGACCTCCACGGC	0.619																																																	0								ENSG00000178222																																			RNF212	SO:0001627	intron_variant	0				HGNC	AK096160	CCDS3345.1, CCDS46996.1, CCDS54704.1	4p16.3	2013-02-27	2007-01-19	2007-01-19	ENSG00000178222	ENSG00000178222		"""RING-type (C3HC4) zinc fingers"""	27729	protein-coding gene	gene with protein product		612041	"""hypothetical protein LOC285498"""	LOC285498		23396135	Standard	NM_001131034		Approved	FLJ38841	uc003gcj.3	Q495C1	OTTHUMG00000118997	ENST00000433731.2:c.247-2701->GGCTGGCTCCAGCCTGGGCAG	4.37:g.1087327_1087328insCTGCCCAGGCTGGAGCCAGCC		Somatic	NA	NA	NA		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	C9J8N0|Q495C0|Q86W82|Q8IY99|Q8N8U7	In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	pfscan_Znf_RING	p.S241in_frame_insWLAPAWAA	ENST00000433731.2	37	c.722_721	CCDS46996.1	4																																																																																			-	NULL		0.619	RNF212-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RNF212	protein_coding	OTTHUMT00000359124.2	-	NM_194439			1087328	-1	no_errors	ENST00000333673	ensembl	human	known	74_37	in_frame_ins	INS	0.085:0.000	CTGCCCAGGCTGGAGCCAGCC
PAK4	10298	genome.wustl.edu	37	19	39663769	39663769	+	Missense_Mutation	SNP	C	C	T			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr19:39663769C>T	ENST00000593690.1	+	5	843	c.416C>T	c.(415-417)gCc>gTc	p.A139V	PAK4_ENST00000599386.1_Intron|PAK4_ENST00000599470.1_Intron|PAK4_ENST00000435673.2_Missense_Mutation_p.A139V|PAK4_ENST00000358301.3_Missense_Mutation_p.A139V|PAK4_ENST00000360442.3_Missense_Mutation_p.A139V|PAK4_ENST00000321944.4_Intron	NM_001014831.2	NP_001014831.1	O96013	PAK4_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 4	139	Linker.		A -> T (in dbSNP:rs35655056). {ECO:0000269|PubMed:17344846}.		apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cellular component movement (GO:0006928)|cytoskeleton organization (GO:0007010)|signal transduction (GO:0007165)	focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(1)|kidney(2)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)	13	all_cancers(60;1.03e-07)|all_epithelial(25;9.66e-08)|all_lung(34;1.58e-07)|Lung NSC(34;1.88e-07)|Ovarian(47;0.0454)		Epithelial(26;4.82e-25)|all cancers(26;2.94e-22)|Lung(45;0.000797)|LUSC - Lung squamous cell carcinoma(53;0.00113)			GGCCGGTTCGCCGGTCACAGC	0.741																																																	0								ENSG00000130669						3.0	4.0	4.0					19																	39663769		1826	3605	5431	PAK4	SO:0001583	missense	0			-	HGNC	AJ011855	CCDS12528.1, CCDS33019.1	19p11-q11	2008-06-17	2008-06-17						16059	protein-coding gene	gene with protein product		605451	"""p21(CDKN1A)-activated kinase 4"""			9822598, 10461188	Standard	NM_001014831		Approved		uc002okn.1	O96013		ENST00000593690.1:c.416C>T	19.37:g.39663769C>T	ENSP00000469413:p.Ala139Val	Somatic	0	42	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	10	23.08	B4DGG6|Q8N4E1|Q8NCH5|Q8NDE3|Q9BU33|Q9ULS8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_CRIB_dom,superfamily_Kinase-like_dom,smart_CRIB_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_CRIB_dom,pfscan_Prot_kinase_dom	p.A139V	ENST00000593690.1	37	c.416	CCDS12528.1	19	.	.	.	.	.	.	.	.	.	.	C	3.352	-0.132268	0.06753	.	.	ENSG00000130669	ENST00000358301;ENST00000435673;ENST00000360442	T;T;T	0.71934	-0.61;-0.61;-0.61	4.08	4.08	0.47627	.	0.933553	0.08904	N	0.876808	T	0.63721	0.2535	L	0.44542	1.39	0.09310	N	1	B	0.09022	0.002	B	0.12156	0.007	T	0.49597	-0.8923	10	0.27082	T	0.32	.	11.6615	0.51349	0.0:1.0:0.0:0.0	.	139	O96013	PAK4_HUMAN	V	139	ENSP00000351049:A139V;ENSP00000392753:A139V;ENSP00000353625:A139V	ENSP00000351049:A139V	A	+	2	0	PAK4	44355609	0.972000	0.33761	0.003000	0.11579	0.008000	0.06430	1.703000	0.37846	2.101000	0.63845	0.556000	0.70494	GCC	-	NULL		0.741	PAK4-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PAK4	protein_coding	OTTHUMT00000463823.1	C		-		39663769	+1	no_errors	ENST00000358301	ensembl	human	known	74_37	missense	SNP	0.004	T
IFT140	9742	genome.wustl.edu	37	16	1612085	1612085	+	Silent	SNP	G	G	T			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr16:1612085G>T	ENST00000426508.2	-	18	2463	c.2100C>A	c.(2098-2100)tcC>tcA	p.S700S	IFT140_ENST00000439987.2_5'UTR	NM_014714.3	NP_055529.2	Q96RY7	IF140_HUMAN	intraflagellar transport 140	700					cilium assembly (GO:0042384)|intraciliary retrograde transport (GO:0035721)|protein localization to cilium (GO:0061512)|regulation of cilium assembly (GO:1902017)|renal system development (GO:0072001)|retina development in camera-type eye (GO:0060041)|skeletal system morphogenesis (GO:0048705)	axoneme (GO:0005930)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|intraciliary transport particle A (GO:0030991)|photoreceptor connecting cilium (GO:0032391)				breast(1)|central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(12)|lung(10)|ovary(5)|pancreas(1)|prostate(4)|skin(4)|stomach(2)|urinary_tract(1)	53		Hepatocellular(780;0.219)				CGTGCTCTTCGGAAATGAAGA	0.458																																																	0								ENSG00000187535						66.0	67.0	67.0					16																	1612085		2199	4300	6499	IFT140	SO:0001819	synonymous_variant	0			-	HGNC	AB011162	CCDS10439.1	16p13.3	2014-07-03	2014-07-03	2005-11-02	ENSG00000187535	ENSG00000187535		"""Intraflagellar transport homologs"", ""WD repeat domain containing"""	29077	protein-coding gene	gene with protein product		614620	"""WD and tetratricopeptide repeats 2"", ""intraflagellar transport 140 homolog (Chlamydomonas)"""	WDTC2		9628581	Standard	NM_014714		Approved	gs114, KIAA0590	uc002cmb.3	Q96RY7	OTTHUMG00000128585	ENST00000426508.2:c.2100C>A	16.37:g.1612085G>T		Somatic	0	34	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	12	20.00	A2A2A8|D3DU75|O60332|Q9UG52	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.S700	ENST00000426508.2	37	c.2100	CCDS10439.1	16																																																																																			-	NULL		0.458	IFT140-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFT140	protein_coding	OTTHUMT00000250438.2	G	NM_014714	-		1612085	-1	no_errors	ENST00000426508	ensembl	human	known	74_37	silent	SNP	0.090	T
ASPH	444	genome.wustl.edu	37	8	62538749	62538749	+	Intron	SNP	T	T	C			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr8:62538749T>C	ENST00000379454.4	-	14	1122				ASPH_ENST00000517847.2_3'UTR|ASPH_ENST00000541428.1_Intron|ASPH_ENST00000518068.1_3'UTR|ASPH_ENST00000517903.1_3'UTR|ASPH_ENST00000522919.1_Intron|ASPH_ENST00000445642.3_3'UTR|ASPH_ENST00000522835.1_3'UTR|ASPH_ENST00000523897.1_Intron|ASPH_ENST00000356457.5_3'UTR	NM_004318.3	NP_004309.2	Q12797	ASPH_HUMAN	aspartate beta-hydroxylase						activation of cysteine-type endopeptidase activity (GO:0097202)|activation of store-operated calcium channel activity (GO:0032237)|calcium ion transmembrane transport (GO:0070588)|cellular response to calcium ion (GO:0071277)|detection of calcium ion (GO:0005513)|face morphogenesis (GO:0060325)|limb morphogenesis (GO:0035108)|muscle contraction (GO:0006936)|negative regulation of cell proliferation (GO:0008285)|palate development (GO:0060021)|pattern specification process (GO:0007389)|peptidyl-aspartic acid hydroxylation (GO:0042264)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of proteolysis (GO:0045862)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling (GO:0010649)|regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031585)|regulation of protein depolymerization (GO:1901879)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|response to ATP (GO:0033198)	calcium channel complex (GO:0034704)|cortical endoplasmic reticulum (GO:0032541)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|electron carrier activity (GO:0009055)|ion channel binding (GO:0044325)|peptide-aspartate beta-dioxygenase activity (GO:0004597)|structural constituent of muscle (GO:0008307)|structural molecule activity (GO:0005198)			breast(1)|cervix(1)|endometrium(5)|large_intestine(5)|lung(16)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35	Lung SC(2;0.153)	Lung NSC(129;0.0358)|all_lung(136;0.0654)|all_epithelial(80;0.101)			L-Aspartic Acid(DB00128)|Succinic acid(DB00139)	AGTAATTGCTTCACAAGATCT	0.378																																																	0								ENSG00000198363						124.0	101.0	108.0					8																	62538749		692	1591	2283	ASPH	SO:0001627	intron_variant	0			-	HGNC	AF224468	CCDS34898.1, CCDS34899.1, CCDS34900.1, CCDS43742.1, CCDS47866.1, CCDS55234.1, CCDS55235.1, CCDS55236.1, CCDS55237.1, CCDS55238.1, CCDS75746.1	8q12.1	2008-02-05			ENSG00000198363	ENSG00000198363	1.14.11.16		757	protein-coding gene	gene with protein product	"""junctin"", ""humbug"", ""junctate"""	600582				7821814, 10974562	Standard	NM_004318		Approved	CASQ2BP1, BAH, JCTN, HAAH	uc003xuj.3	Q12797	OTTHUMG00000164375	ENST00000379454.4:c.935-7171A>G	8.37:g.62538749T>C		Somatic	0	88	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	26	13.33	A6NDF4|A6NHI2|B4DIC9|B4E2K4|B7ZM95|E5RGP5|F5H667|Q6NXR7|Q8TB28|Q9H291|Q9H2C4|Q9NRI0|Q9NRI1|Q9Y4J0	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000379454.4	37	NULL	CCDS34898.1	8																																																																																			-	-		0.378	ASPH-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ASPH	protein_coding	OTTHUMT00000378510.3	T	NM_004318	-		62538749	-1	no_errors	ENST00000519678	ensembl	human	known	74_37	rna	SNP	1.000	C
CHRND	1144	genome.wustl.edu	37	2	233393680	233393680	+	Splice_Site	SNP	A	A	G			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr2:233393680A>G	ENST00000258385.3	+	6	650	c.618A>G	c.(616-618)acA>acG	p.T206T	CHRND_ENST00000457943.2_Intron|CHRND_ENST00000536614.1_Intron|CHRND_ENST00000543200.1_Splice_Site_p.T191T	NM_000751.2	NP_000742.1	Q07001	ACHD_HUMAN	cholinergic receptor, nicotinic, delta (muscle)	206					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|muscle contraction (GO:0006936)|musculoskeletal movement (GO:0050881)|neuromuscular process (GO:0050905)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|skeletal muscle tissue growth (GO:0048630)|synaptic transmission (GO:0007268)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine-activated cation-selective channel activity (GO:0004889)			breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|liver(1)|lung(17)|ovary(3)|prostate(1)|skin(1)|stomach(1)	34		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;1.89e-16)|BRCA - Breast invasive adenocarcinoma(100;0.00078)|Lung(119;0.00579)|LUSC - Lung squamous cell carcinoma(224;0.00754)	Galantamine(DB00674)	AAGGCTTCACAGGTGCTGGGA	0.577																																																	0								ENSG00000135902						70.0	64.0	66.0					2																	233393680		2203	4300	6503	CHRND	SO:0001630	splice_region_variant	0			-	HGNC	X55019	CCDS2494.1, CCDS58754.1	2q37.1	2012-02-11	2012-02-07		ENSG00000135902	ENSG00000135902		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1965	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, delta (muscle)"""	100720	"""cholinergic receptor, nicotinic, delta"""	ACHRD			Standard	NM_000751		Approved		uc002vsw.4	Q07001	OTTHUMG00000133261	ENST00000258385.3:c.619+1A>G	2.37:g.233393680A>G		Somatic	0	39	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	11	21.43	A8K661|B4DT92|Q52LH4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,prints_Nicotinic_acetylcholine_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.T206	ENST00000258385.3	37	c.618	CCDS2494.1	2																																																																																			-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,tigrfam_Neur_channel		0.577	CHRND-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRND	protein_coding	OTTHUMT00000257038.2	A		-	Silent	233393680	+1	no_errors	ENST00000258385	ensembl	human	known	74_37	silent	SNP	1.000	G
CCDC7	79741	genome.wustl.edu	37	10	33136791	33136791	+	Missense_Mutation	SNP	T	T	A			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr10:33136791T>A	ENST00000375030.2	+	19	1943	c.1325T>A	c.(1324-1326)aTt>aAt	p.I442N	C10orf68_ENST00000375028.3_Missense_Mutation_p.I487N|C10orf68_ENST00000375025.4_Missense_Mutation_p.I547N			Q9H943	CJ068_HUMAN		483										breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|skin(4)	29						ACAAATGCCATTGGTTCAAGT	0.299																																																	0								ENSG00000150076						106.0	110.0	109.0					10																	33136791		2203	4299	6502	C10orf68	SO:0001583	missense	0			-	HGNC																												ENST00000375030.2:c.1325T>A	10.37:g.33136791T>A	ENSP00000364170:p.Ile442Asn	Somatic	0	131	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	28	9.68	B0QZ71|Q08AN7|Q8N7T7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.I547N	ENST00000375030.2	37	c.1640		10	.	.	.	.	.	.	.	.	.	.	.	7.213	0.595725	0.13875	.	.	ENSG00000150076	ENST00000302316;ENST00000375030;ENST00000375028;ENST00000375025;ENST00000375037	T;T;T;T	0.32023	1.49;1.62;1.47;1.47	1.95	-1.82	0.07857	.	.	.	.	.	T	0.28499	0.0705	L	0.50333	1.59	0.09310	N	1	P;P;P;P	0.46912	0.815;0.599;0.815;0.886	B;B;B;P	0.47744	0.157;0.112;0.157;0.556	T	0.17961	-1.0352	9	0.72032	D	0.01	.	2.6361	0.04958	0.0:0.2499:0.262:0.4881	.	464;483;487;442	B4DX58;Q9H943;A2A3B4;A2A3D6	.;CJ068_HUMAN;.;.	N	483;442;487;547;459	ENSP00000303710:I483N;ENSP00000364170:I442N;ENSP00000364168:I487N;ENSP00000364165:I547N	ENSP00000303710:I483N	I	+	2	0	C10orf68	33176797	0.000000	0.05858	0.000000	0.03702	0.023000	0.10783	-1.803000	0.01740	-0.436000	0.07254	0.477000	0.44152	ATT	-	NULL		0.299	C10orf68-001	PUTATIVE	basic|appris_candidate|exp_conf	protein_coding	C10orf68	protein_coding	OTTHUMT00000313999.2	T		-		33136791	+1	no_errors	ENST00000375025	ensembl	human	known	74_37	missense	SNP	0.000	A
FSIP2	401024	genome.wustl.edu	37	2	186656883	186656883	+	Missense_Mutation	SNP	C	C	A			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr2:186656883C>A	ENST00000424728.1	+	16	5020	c.5020C>A	c.(5020-5022)Cct>Act	p.P1674T	AC008174.3_ENST00000429929.1_RNA|AC008174.3_ENST00000436557.1_RNA|FSIP2_ENST00000343098.5_Missense_Mutation_p.P1763T			Q5CZC0	FSIP2_HUMAN	fibrous sheath interacting protein 2	1674										NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(11)|lung(46)|pancreas(1)|urinary_tract(2)	69						AAACCCACCACCTGAGACTCA	0.353																																																	0								ENSG00000188738																																			FSIP2	SO:0001583	missense	0			-	HGNC	AK092099	CCDS54426.1	2q32.1	2010-06-18			ENSG00000188738	ENSG00000188738			21675	protein-coding gene	gene with protein product		615796				14702039	Standard	NM_173651		Approved	FLJ34780	uc002upl.3	Q5CZC0	OTTHUMG00000153874	ENST00000424728.1:c.5020C>A	2.37:g.186656883C>A	ENSP00000401306:p.Pro1674Thr	Somatic	0	34	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	11	21.43	Q53TL3|Q53TN5|Q5HYH2|Q6ZTZ5|Q6ZU14|Q6ZU21	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.P1763T	ENST00000424728.1	37	c.5287		2	.	.	.	.	.	.	.	.	.	.	C	3.616	-0.078482	0.07184	.	.	ENSG00000188738	ENST00000343098;ENST00000424728;ENST00000326147	T;T	0.42513	0.97;0.97	4.86	0.641	0.17759	.	0.289542	0.25854	N	0.027867	T	0.28267	0.0698	L	0.29908	0.895	0.09310	N	1	.	.	.	.	.	.	T	0.15037	-1.0451	8	0.59425	D	0.04	.	2.7641	0.05315	0.3116:0.4328:0.1628:0.0927	.	.	.	.	T	1763;1674;1674	ENSP00000344403:P1763T;ENSP00000401306:P1674T	ENSP00000321903:P1674T	P	+	1	0	FSIP2	186365128	0.014000	0.17966	0.098000	0.21074	0.004000	0.04260	0.742000	0.26216	0.221000	0.20879	-0.321000	0.08615	CCT	-	NULL		0.353	FSIP2-001	KNOWN	basic	protein_coding	FSIP2	protein_coding	OTTHUMT00000332778.3	C	NM_173651	-		186656883	+1	no_errors	ENST00000343098	ensembl	human	known	74_37	missense	SNP	0.007	A
GBP4	115361	genome.wustl.edu	37	1	89661049	89661049	+	Silent	SNP	C	C	A			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr1:89661049C>A	ENST00000355754.6	-	3	391	c.294G>T	c.(292-294)gtG>gtT	p.V98V		NM_052941.4	NP_443173.2	Q96PP9	GBP4_HUMAN	guanylate binding protein 4	98	GB1/RHD3-type G.|GTPase domain (Globular). {ECO:0000250}.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(19)|skin(1)|stomach(2)|urinary_tract(1)	33				all cancers(265;0.00723)|Epithelial(280;0.0291)		AGAGGTGGGGCACACACCACA	0.532																																																	0								ENSG00000162654						130.0	118.0	122.0					1																	89661049		2203	4300	6503	GBP4	SO:0001819	synonymous_variant	0			-	HGNC	AF288814	CCDS721.1	1p22.2	2008-02-05			ENSG00000162654	ENSG00000162654			20480	protein-coding gene	gene with protein product		612466				16689661	Standard	NM_052941		Approved	Mpa2	uc001dnb.3	Q96PP9	OTTHUMG00000010663	ENST00000355754.6:c.294G>T	1.37:g.89661049C>A		Somatic	0	103	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	34	10.53	B2R630|Q05D63|Q6NSL0|Q86T99	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Guanylate-bd_C,pfam_Guanylate-bd_N,superfamily_Guanylate-bd_C,superfamily_P-loop_NTPase	p.V98	ENST00000355754.6	37	c.294	CCDS721.1	1																																																																																			-	pfam_Guanylate-bd_N,superfamily_P-loop_NTPase		0.532	GBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GBP4	protein_coding	OTTHUMT00000029409.1	C	NM_052941	-		89661049	-1	no_errors	ENST00000355754	ensembl	human	known	74_37	silent	SNP	0.890	A
FRG1B	284802	genome.wustl.edu	37	20	29624046	29624046	+	Missense_Mutation	SNP	C	C	T	rs10153995		TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr20:29624046C>T	ENST00000278882.3	+	4	450	c.70C>T	c.(70-72)Cct>Tct	p.P24S	FRG1B_ENST00000439954.2_Missense_Mutation_p.P29S|FRG1B_ENST00000358464.4_Missense_Mutation_p.P24S			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	24										endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						TGATGAGGGCCCTAGTCCTCC	0.279																																																	0								ENSG00000149531																																			FRG1B	SO:0001583	missense	0			-	HGNC			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.70C>T	20.37:g.29624046C>T	ENSP00000278882:p.Pro24Ser	Somatic	1	114	0.87		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	35	14.63	C4AME5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_FRG1,superfamily_Actin_cross-linking	p.P24S	ENST00000278882.3	37	c.70		20	.	.	.	.	.	.	.	.	.	.	c	13.70	2.316522	0.40996	.	.	ENSG00000149531	ENST00000278882;ENST00000439954;ENST00000358464	T	0.72394	-0.65	1.91	1.91	0.25777	.	0.000000	0.85682	D	0.000000	T	0.74861	0.3772	.	.	.	0.54753	D	0.999982	.	.	.	.	.	.	T	0.76260	-0.3024	7	0.56958	D	0.05	.	9.8627	0.41125	0.0:1.0:0.0:0.0	rs10153995	.	.	.	S	24;29;24	ENSP00000408863:P29S	ENSP00000278882:P24S	P	+	1	0	FRG1B	28237707	1.000000	0.71417	0.999000	0.59377	0.522000	0.34438	6.186000	0.72026	1.383000	0.46405	0.184000	0.17185	CCT	-	pfam_FRG1,superfamily_Actin_cross-linking		0.279	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	FRG1B	protein_coding	OTTHUMT00000078494.2	C	NR_003579	rs10153995		29624046	+1	no_errors	ENST00000278882	ensembl	human	known	74_37	missense	SNP	1.000	T
SMG1	23049	genome.wustl.edu	37	16	18859323	18859323	+	Frame_Shift_Del	DEL	G	G	-			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr16:18859323delG	ENST00000446231.2	-	37	6068	c.5656delC	c.(5656-5658)cttfs	p.L1886fs	SMG1_ENST00000389467.3_Frame_Shift_Del_p.L1886fs			Q96Q15	SMG1_HUMAN	SMG1 phosphatidylinositol 3-kinase-related kinase	1886	Interaction with SMG8 and SMG9.				DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol phosphorylation (GO:0046854)|protein autophosphorylation (GO:0046777)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(8)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(37)|ovary(1)|skin(1)|stomach(4)|urinary_tract(1)	92						ATATTGCCAAGTAAAGTTGGA	0.383																																																	0								ENSG00000157106						85.0	79.0	81.0					16																	18859323		1824	4085	5909	SMG1	SO:0001589	frameshift_variant	0				HGNC	AB061371	CCDS45430.1	16p12.3	2013-07-02	2013-07-02		ENSG00000157106	ENSG00000157106			30045	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase-related kinase"""	607032	"""smg-1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)"""			9455477, 11331269, 17229728	Standard	NM_015092		Approved	LIP, KIAA0421, ATX	uc002dfm.3	Q96Q15	OTTHUMG00000166900	ENST00000446231.2:c.5656delC	16.37:g.18859323delG	ENSP00000402515:p.Leu1886fs	Somatic	0	58	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	18	10.00	O43305|Q13284|Q8NFX2|Q96QV0|Q96RW3	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_PI3/4_kinase_cat_dom,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.G1887fs	ENST00000446231.2	37	c.5656	CCDS45430.1	16																																																																																			-	superfamily_ARM-type_fold		0.383	SMG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SMG1	protein_coding	OTTHUMT00000391817.1	G	NM_015092			18859323	-1	no_errors	ENST00000389467	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
DCUN1D2	55208	genome.wustl.edu	37	13	114115427	114115428	+	Frame_Shift_Ins	INS	-	-	A			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr13:114115427_114115428insA	ENST00000478244.1	-	5	826_827	c.544_545insT	c.(544-546)tggfs	p.W182fs	DCUN1D2_ENST00000332592.3_Frame_Shift_Ins_p.W49fs	NM_001014283.1	NP_001014305.1	Q6PH85	DCNL2_HUMAN	DCN1, defective in cullin neddylation 1, domain containing 2	182	DCUN1. {ECO:0000255|PROSITE- ProRule:PRU00574}.									breast(1)|endometrium(1)|large_intestine(1)|lung(3)|stomach(1)	7	Lung NSC(43;0.0161)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0395)|all_epithelial(44;0.011)|all_lung(25;0.0271)|Lung NSC(25;0.0977)|Breast(118;0.188)	all cancers(43;0.029)|GBM - Glioblastoma multiforme(44;0.234)			CACTAATTTCCAATACGCAACA	0.396																																																	0								ENSG00000150401																																			DCUN1D2	SO:0001589	frameshift_variant	0				HGNC	AK001566	CCDS32013.1	13q34	2013-06-10	2013-06-10	2005-10-04	ENSG00000150401	ENSG00000150401			20328	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 17"", ""DCN1, defective in cullin neddylation 1, domain containing 2 (S. cerevisiae)"""	C13orf17		15988528	Standard	XM_005268320		Approved	FLJ10704, FLJ20092	uc001vtr.1	Q6PH85	OTTHUMG00000017390	ENST00000478244.1:c.545dupT	13.37:g.114115429_114115429dupA	ENSP00000417706:p.Trp182fs	Somatic	0	27	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	8	20.00	Q5JSA5|Q5JSA6|Q5JSA7|Q9NVJ1|Q9NXR6	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_PONY_dom,superfamily_UBA-like	p.W182fs	ENST00000478244.1	37	c.545_544	CCDS32013.1	13																																																																																			-	pfam_PONY_dom		0.396	DCUN1D2-006	KNOWN	basic|appris_principal|CCDS	protein_coding	DCUN1D2	protein_coding	OTTHUMT00000045938.4	-	NM_018185			114115428	-1	no_errors	ENST00000478244	ensembl	human	known	74_37	frame_shift_ins	INS	1.000:1.000	A
DSC3	1825	genome.wustl.edu	37	18	28588458	28588458	+	Missense_Mutation	SNP	G	G	T			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr18:28588458G>T	ENST00000360428.4	-	10	1377	c.1297C>A	c.(1297-1299)Ctg>Atg	p.L433M	DSC3_ENST00000434452.1_Missense_Mutation_p.L433M	NM_001941.3	NP_001932.2	Q14574	DSC3_HUMAN	desmocollin 3	433	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|protein stabilization (GO:0050821)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|desmosome (GO:0030057)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|gamma-catenin binding (GO:0045295)			endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(6)|lung(29)|ovary(2)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	56			OV - Ovarian serous cystadenocarcinoma(10;0.125)			CCAATTTCCAGGTTCACTTGA	0.403																																																	0								ENSG00000134762						117.0	112.0	114.0					18																	28588458		2203	4300	6503	DSC3	SO:0001583	missense	0			-	HGNC	X83929	CCDS32810.1	18q12.1	2014-07-30			ENSG00000134762	ENSG00000134762		"""Cadherins / Major cadherins"""	3037	protein-coding gene	gene with protein product		600271		DSC4		7774948, 8486729	Standard	NM_001941		Approved	CDHF3, DSC, DSC1, DSC2	uc002kwj.4	Q14574	OTTHUMG00000179622	ENST00000360428.4:c.1297C>A	18.37:g.28588458G>T	ENSP00000353608:p.Leu433Met	Somatic	0	46	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	18	14.29	A6NN35|Q14200|Q9HAZ9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,pfam_Cadherin_pro_dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin,prints_Cadherin/Desmocollin,prints_Desmosomal_cadherin	p.L433M	ENST00000360428.4	37	c.1297	CCDS32810.1	18	.	.	.	.	.	.	.	.	.	.	G	17.08	3.296606	0.60086	.	.	ENSG00000134762	ENST00000360428;ENST00000434452	T;T	0.58652	0.32;0.32	5.35	2.63	0.31362	Cadherin (5);Cadherin-like (1);	0.000000	0.27139	N	0.020745	T	0.81842	0.4908	H	0.97635	4.045	0.45704	D	0.998615	D;D	0.89917	1.0;1.0	D;D	0.81914	0.995;0.995	D	0.83586	0.0120	10	0.87932	D	0	.	9.652	0.39904	0.2789:0.0:0.7211:0.0	.	433;433	Q14574;Q14574-2	DSC3_HUMAN;.	M	433	ENSP00000353608:L433M;ENSP00000392068:L433M	ENSP00000353608:L433M	L	-	1	2	DSC3	26842456	0.633000	0.27181	0.925000	0.36789	0.998000	0.95712	0.732000	0.26072	0.504000	0.28082	0.655000	0.94253	CTG	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin		0.403	DSC3-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_candidate_longest|CCDS	protein_coding	DSC3	protein_coding	OTTHUMT00000447384.1	G	NM_001941, NM_024423	-		28588458	-1	no_errors	ENST00000360428	ensembl	human	known	74_37	missense	SNP	0.751	T
PANK4	55229	genome.wustl.edu	37	1	2445492	2445492	+	Missense_Mutation	SNP	G	G	T			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr1:2445492G>T	ENST00000378466.3	-	12	1536	c.1524C>A	c.(1522-1524)gaC>gaA	p.D508E	PANK4_ENST00000435556.3_Missense_Mutation_p.D469E	NM_018216.1	NP_060686.1	Q9NVE7	PANK4_HUMAN	pantothenate kinase 4	508					coenzyme A biosynthetic process (GO:0015937)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|pantothenate kinase activity (GO:0004594)			breast(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(4)	23	all_cancers(77;0.000158)|all_epithelial(69;8.01e-05)|all_lung(157;0.0212)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;3.18e-20)|all_lung(118;1.67e-08)|Lung NSC(185;2.69e-06)|Breast(487;0.00147)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.123)		Epithelial(90;1.54e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.95e-23)|GBM - Glioblastoma multiforme(42;2.81e-08)|Colorectal(212;4.25e-05)|COAD - Colon adenocarcinoma(227;0.000196)|Kidney(185;0.000342)|BRCA - Breast invasive adenocarcinoma(365;0.00445)|KIRC - Kidney renal clear cell carcinoma(229;0.00549)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.201)		GCTCCCTGGTGTCCAGCAGGC	0.657																																																	0								ENSG00000157881						151.0	139.0	143.0					1																	2445492		2203	4300	6503	PANK4	SO:0001583	missense	0			-	HGNC	AK001644	CCDS42.1	1p36.32	2008-02-05			ENSG00000157881	ENSG00000157881			19366	protein-coding gene	gene with protein product		606162				11479594	Standard	XR_241034		Approved	FLJ10782	uc001ajm.1	Q9NVE7	OTTHUMG00000000791	ENST00000378466.3:c.1524C>A	1.37:g.2445492G>T	ENSP00000367727:p.Asp508Glu	Somatic	0	101	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	B9DI84|Q53EU3|Q5TA84|Q7RTX3|Q9H3X5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Type_II_PanK,pfam_DUF89,superfamily_DUF89,pirsf_PanK_long,tigrfam_Type_II_PanK	p.D508E	ENST00000378466.3	37	c.1524	CCDS42.1	1	.	.	.	.	.	.	.	.	.	.	G	15.98	2.992704	0.54041	.	.	ENSG00000157881	ENST00000378466;ENST00000435556	T;T	0.05925	3.37;3.37	4.92	-0.521	0.11931	Domain of unknown function DUF89 (2);	0.044980	0.85682	D	0.000000	T	0.02727	0.0082	N	0.16233	0.39	0.44908	D	0.997926	B;B	0.20164	0.042;0.012	B;B	0.23574	0.047;0.047	T	0.44742	-0.9308	10	0.10377	T	0.69	-39.0718	2.935	0.05811	0.2928:0.1165:0.4722:0.1185	.	469;508	E9PHT6;Q9NVE7	.;PANK4_HUMAN	E	508;469	ENSP00000367727:D508E;ENSP00000421433:D469E	ENSP00000367727:D508E	D	-	3	2	PANK4	2435352	1.000000	0.71417	0.997000	0.53966	0.990000	0.78478	1.966000	0.40481	0.499000	0.27970	0.462000	0.41574	GAC	-	pfam_DUF89,superfamily_DUF89,pirsf_PanK_long		0.657	PANK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PANK4	protein_coding	OTTHUMT00000002082.1	G		-		2445492	-1	no_errors	ENST00000378466	ensembl	human	known	74_37	missense	SNP	0.999	T
RP11-782C8.1	0	genome.wustl.edu	37	1	143230391	143230391	+	lincRNA	SNP	A	A	T			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr1:143230391A>T	ENST00000438000.1	+	0	147				RP11-782C8.5_ENST00000427309.1_lincRNA																							CAATGAATCCACACACAGTTC	0.343																																																	0								ENSG00000225278																																			RP11-782C8.5			0			-	Clone_based_vega_gene																													1.37:g.143230391A>T		Somatic	0	35	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	10	16.67		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000438000.1	37	NULL		1																																																																																			-	-		0.343	RP11-782C8.1-002	KNOWN	basic	lincRNA	LOC101930284	lincRNA	OTTHUMT00000037560.1	A		-		143230391	-1	no_errors	ENST00000422716	ensembl	human	known	74_37	rna	SNP	0.080	T
GALC	2581	genome.wustl.edu	37	14	88454857	88454857	+	Frame_Shift_Del	DEL	C	C	-	rs371523347		TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr14:88454857delC	ENST00000261304.2	-	2	312	c.206delG	c.(205-207)cgafs	p.R69fs	GALC_ENST00000554916.1_5'UTR|GALC_ENST00000393569.2_Frame_Shift_Del_p.R43fs|GALC_ENST00000544807.2_Frame_Shift_Del_p.R13fs|GALC_ENST00000393568.4_Intron	NM_000153.3|NM_001201401.1	NP_000144.2|NP_001188330.1	P54803	GALC_HUMAN	galactosylceramidase	69					carbohydrate metabolic process (GO:0005975)|galactosylceramide catabolic process (GO:0006683)|glycosphingolipid metabolic process (GO:0006687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)	galactosylceramidase activity (GO:0004336)			endometrium(2)|kidney(2)|large_intestine(1)|lung(10)|ovary(1)|prostate(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						TACTAGAAGTCGGGAGGTTGC	0.343																																																	0								ENSG00000054983						88.0	87.0	88.0					14																	88454857		1804	4067	5871	GALC	SO:0001589	frameshift_variant	0				HGNC	L23116	CCDS9878.2, CCDS55936.1, CCDS55937.1	14q31	2009-01-06	2005-11-29		ENSG00000054983	ENSG00000054983	3.2.1.46		4115	protein-coding gene	gene with protein product	"""Krabbe disease"""	606890	"""galactosylceramidase (Krabbe disease)"""				Standard	NM_000153		Approved		uc001xvt.3	P54803	OTTHUMG00000028646	ENST00000261304.2:c.206delG	14.37:g.88454857delC	ENSP00000261304:p.Arg69fs	Somatic	0	39	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	8	20.00	B4DKE8|B4DYN1|B4DZJ8|B7Z7Z2|J3KN25|J3KPP8|Q8J030	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Glyco_hydro_59,superfamily_Glycoside_hydrolase_SF,prints_Glyco_hydro_59	p.R69fs	ENST00000261304.2	37	c.206	CCDS9878.2	14																																																																																			-	pfam_Glyco_hydro_59,superfamily_Glycoside_hydrolase_SF		0.343	GALC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALC	protein_coding	OTTHUMT00000071559.2	C				88454857	-1	no_errors	ENST00000261304	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
AQP12A	375318	genome.wustl.edu	37	2	241631786	241631786	+	Frame_Shift_Del	DEL	G	G	-	rs369196482		TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr2:241631786delG	ENST00000337801.4	+	2	488	c.419delG	c.(418-420)agcfs	p.S141fs	AC011298.2_ENST00000407635.2_lincRNA|AQP12A_ENST00000429564.1_Frame_Shift_Del_p.S153fs	NM_198998.2	NP_945349.1	Q8IXF9	AQ12A_HUMAN	aquaporin 12A	141						integral component of membrane (GO:0016021)	transporter activity (GO:0005215)			endometrium(2)|kidney(3)|large_intestine(2)|lung(7)	14		all_epithelial(40;7.49e-12)|Breast(86;0.000148)|Renal(207;0.00571)|Ovarian(221;0.104)|all_neural(83;0.107)|all_hematologic(139;0.182)|all_lung(227;0.186)|Melanoma(123;0.238)		Epithelial(32;2.2e-31)|all cancers(36;1.08e-28)|OV - Ovarian serous cystadenocarcinoma(60;2.13e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;7.52e-06)|Lung(119;0.00163)|LUSC - Lung squamous cell carcinoma(224;0.008)|Colorectal(34;0.0124)|COAD - Colon adenocarcinoma(134;0.0757)		CAGAGCTGCAGCTCGGCCCTG	0.692																																																	0								ENSG00000184945			36,3516		5,26,1745	5.0	8.0	7.0			2.5	1.0	2		7	36,7602		2,32,3785	no	frameshift	AQP12A	NM_198998.1		7,58,5530	A1A1,A1R,RR		0.4713,1.0135,0.6434			241631786	72,11118	1936	4133	6069	AQP12A	SO:0001589	frameshift_variant	0				HGNC	AB040748		2q37.3	2013-06-03	2005-05-26	2005-05-26	ENSG00000184945	ENSG00000184945		"""Ion channels / Aquaporins"""	19941	protein-coding gene	gene with protein product		609789	"""aquaporin 12"""	AQP12			Standard	NM_198998		Approved		uc002vzu.3	Q8IXF9	OTTHUMG00000183906	ENST00000337801.4:c.419delG	2.37:g.241631786delG	ENSP00000337144:p.Ser141fs	Somatic	0	63	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	26	10.34		Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_MIP,superfamily_Aquaporin-like,pirsf_Aquaporin_11/12,prints_Aquaporin_12,prints_MIP	p.S152fs	ENST00000337801.4	37	c.455		2																																																																																			-	pfam_MIP,superfamily_Aquaporin-like,pirsf_Aquaporin_11/12,prints_Aquaporin_12		0.692	AQP12A-001	KNOWN	basic|appris_principal	protein_coding	AQP12A	protein_coding	OTTHUMT00000257185.2	G	NM_198998			241631786	+1	no_errors	ENST00000429564	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
MAPK8	5599	genome.wustl.edu	37	10	49643210	49643211	+	3'UTR	INS	-	-	T			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr10:49643210_49643211insT	ENST00000374189.1	+	0	1603_1604				MAPK8_ENST00000459755.1_3'UTR|MAPK8_ENST00000374182.3_3'UTR			P45983	MK08_HUMAN	mitogen-activated protein kinase 8						apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to mechanical stimulus (GO:0071260)|cellular response to nitric oxide (GO:0071732)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|JNK cascade (GO:0007254)|JUN phosphorylation (GO:0007258)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein binding (GO:0032091)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification (GO:0001503)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of deacetylase activity (GO:0090045)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of gene expression (GO:0010628)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|programmed necrotic cell death (GO:0097300)|regulation of histone deacetylation (GO:0031063)|regulation of protein localization (GO:0032880)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|response to cadmium ion (GO:0046686)|response to stress (GO:0006950)|response to UV (GO:0009411)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|histone deacetylase binding (GO:0042826)|histone deacetylase regulator activity (GO:0035033)|JUN kinase activity (GO:0004705)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(3)|endometrium(4)|kidney(1)|large_intestine(6)|liver(3)|lung(11)|ovary(1)|skin(1)|stomach(1)|urinary_tract(2)	34		Ovarian(717;0.0221)|Lung SC(717;0.113)|all_neural(218;0.116)		Epithelial(53;3.46e-65)|Lung(62;0.125)		AAAGTAGTTTATTTTTTTTAAT	0.252																																																	0								ENSG00000107643																																			MAPK8	SO:0001624	3_prime_UTR_variant	0				HGNC	L26318	CCDS7223.1, CCDS7224.1, CCDS7225.1, CCDS7226.1, CCDS60527.1	10q11	2011-06-09			ENSG00000107643	ENSG00000107643	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinases"""	6881	protein-coding gene	gene with protein product	"""JUN N-terminal kinase"""	601158		PRKM8		8137421, 8654373	Standard	NM_002750		Approved	JNK, JNK1, SAPK1	uc001jgp.3	P45983	OTTHUMG00000018172	ENST00000374189.1:c.*139->T	10.37:g.49643218_49643218dupT		Somatic	0	42	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	12	20.00	B5BTZ5|B7ZLV4|D3DX88|D3DX92|Q15709|Q15712|Q15713|Q308M2	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000374189.1	37	NULL	CCDS7224.1	10																																																																																			-	-		0.252	MAPK8-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAPK8	protein_coding	OTTHUMT00000047931.1	-				49643211	+1	no_errors	ENST00000459755	ensembl	human	known	74_37	rna	INS	0.961:1.000	T
VDAC1	7416	genome.wustl.edu	37	5	133316708	133316709	+	Intron	DEL	TT	TT	-	rs76032174|rs76341281		TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	TT	TT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr5:133316708_133316709delTT	ENST00000265333.3	-	6	568				VDAC1_ENST00000395047.2_Intron|VDAC1_ENST00000395044.3_Intron	NM_003374.2	NP_003365.1	P21796	VDAC1_HUMAN	voltage-dependent anion channel 1						anion transport (GO:0006820)|apoptotic process (GO:0006915)|behavioral fear response (GO:0001662)|epithelial cell differentiation (GO:0030855)|learning (GO:0007612)|neuron-neuron synaptic transmission (GO:0007270)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|pore complex (GO:0046930)	porin activity (GO:0015288)|protein kinase binding (GO:0019901)|voltage-gated anion channel activity (GO:0008308)			endometrium(1)|large_intestine(1)|lung(1)|skin(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00806)|Kidney(363;0.02)		Dihydroxyaluminium(DB01375)	GCAAGTTGTCTTTTTTTTTTTT	0.416																																					NSCLC(127;1776 1806 35523 41489 48154)												0								ENSG00000213585																																			VDAC1	SO:0001627	intron_variant	0				HGNC		CCDS4168.1	5q31	2011-11-15			ENSG00000213585	ENSG00000213585		"""Voltage-dependent anion channels"""	12669	protein-coding gene	gene with protein product		604492				7517385	Standard	NM_003374		Approved	MGC111064, PORIN	uc003kyr.2	P21796	OTTHUMG00000129118	ENST00000265333.3:c.324-61AA>-	5.37:g.133316718_133316719delTT		Somatic	0	30	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	6	33.33	B3KVK4|D3DQ93|Q5FVE7|Q9UIQ5|Q9UPL0	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000265333.3	37	NULL	CCDS4168.1	5																																																																																			-	-		0.416	VDAC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	VDAC1	protein_coding	OTTHUMT00000259208.1	TT				133316709	-1	no_errors	ENST00000492324	ensembl	human	known	74_37	rna	DEL	0.001:0.000	-
RP11-440D17.3	0	genome.wustl.edu	37	2	96191752	96191752	+	lincRNA	SNP	G	G	A			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr2:96191752G>A	ENST00000609975.1	-	0	698				AC009237.8_ENST00000608013.1_RNA																							ggctgatgccgctggcccagg	0.562																																																	0								ENSG00000272913																																			RP11-440D17.3			0			-	Clone_based_vega_gene																													2.37:g.96191752G>A		Somatic	0	52	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	15	16.67		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000609975.1	37	NULL		2																																																																																			-	-		0.562	RP11-440D17.3-001	KNOWN	basic	lincRNA	ENSG00000272913	lincRNA	OTTHUMT00000472064.1	G		-		96191752	-1	no_errors	ENST00000609975	ensembl	human	known	74_37	rna	SNP	0.769	A
UTP3	57050	genome.wustl.edu	37	4	71554620	71554622	+	In_Frame_Del	DEL	GAG	GAG	-	rs369776055		TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	GAG	GAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr4:71554620_71554622delGAG	ENST00000254803.2	+	1	425_427	c.226_228delGAG	c.(226-228)gagdel	p.E81del		NM_020368.2	NP_065101.1	Q9NQZ2	SAS10_HUMAN	UTP3, small subunit (SSU) processome component, homolog (S. cerevisiae)	81	Glu-rich.				brain development (GO:0007420)|chromatin modification (GO:0016568)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(2)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(4)	18			Lung(101;0.235)			ggaggatggcgaggaggaggagg	0.567																																																	0								ENSG00000132467																																			UTP3	SO:0001651	inframe_deletion	0				HGNC	AL136590	CCDS3546.1	4q13.3	2008-02-05			ENSG00000132467	ENSG00000132467			24477	protein-coding gene	gene with protein product	"""disrupter of silencing 10"""	611614				12477932	Standard	NM_020368		Approved	FLJ23256, DKFZp761F222, SAS10, CRLZ1	uc003hfo.3	Q9NQZ2	OTTHUMG00000129911	ENST00000254803.2:c.226_228delGAG	4.37:g.71554629_71554631delGAG	ENSP00000254803:p.Glu81del	Somatic	0	53	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	15	16.67	Q6FI82	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Sas10_C_dom,pfam_Sas10/Utp3/C1D	p.E79in_frame_del	ENST00000254803.2	37	c.226_228	CCDS3546.1	4																																																																																			-	NULL		0.567	UTP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UTP3	protein_coding	OTTHUMT00000252163.2	GAG	NM_020368			71554622	+1	no_errors	ENST00000254803	ensembl	human	known	74_37	in_frame_del	DEL	0.044:0.001:0.001	-
GMPPB	29925	genome.wustl.edu	37	3	49756266	49756266	+	3'UTR	SNP	C	C	A			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr3:49756266C>A	ENST00000480687.1	-	0	4118				RNF123_ENST00000433785.1_Intron|AMIGO3_ENST00000320431.7_Missense_Mutation_p.K211N|RNF123_ENST00000497099.1_Intron|RNF123_ENST00000327697.6_Intron|AMIGO3_ENST00000535833.1_Missense_Mutation_p.K211N			Q9Y5P6	GMPPB_HUMAN	GDP-mannose pyrophosphorylase B						cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|GDP-mannose biosynthetic process (GO:0009298)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|mannose-1-phosphate guanylyltransferase activity (GO:0004475)			endometrium(1)|kidney(2)|large_intestine(1)|lung(1)|skin(1)	6				BRCA - Breast invasive adenocarcinoma(193;4.53e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		AGAGGCCGTTCTTGAGGAAGG	0.652																																																	0								ENSG00000176020						44.0	46.0	46.0					3																	49756266		2203	4299	6502	AMIGO3	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AF135421	CCDS2802.1, CCDS2803.1	3p21.31	2008-02-05			ENSG00000173540	ENSG00000173540	2.7.7.22		22932	protein-coding gene	gene with protein product		615320					Standard	NM_013334		Approved	KIAA1851	uc003cxl.1	Q9Y5P6	OTTHUMG00000158151	ENST00000480687.1:c.*2919G>T	3.37:g.49756266C>A		Somatic	0	94	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51	A8K6N5|Q9H7U3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.K211N	ENST00000480687.1	37	c.633	CCDS2803.1	3	.	.	.	.	.	.	.	.	.	.	C	18.98	3.737126	0.69304	.	.	ENSG00000176020	ENST00000320431;ENST00000535833	T;T	0.02472	4.28;4.28	5.21	4.34	0.51931	.	0.055862	0.64402	D	0.000001	T	0.08537	0.0212	M	0.70275	2.135	0.80722	D	1	D	0.64830	0.994	P	0.57911	0.829	T	0.40136	-0.9579	10	0.18276	T	0.48	-27.101	8.9845	0.35986	0.0:0.767:0.1497:0.0833	.	211	Q86WK7	AMGO3_HUMAN	N	211	ENSP00000323096:K211N;ENSP00000439268:K211N	ENSP00000323096:K211N	K	-	3	2	AMIGO3	49731270	0.861000	0.29849	0.999000	0.59377	0.960000	0.62799	0.799000	0.27028	1.195000	0.43115	0.462000	0.41574	AAG	-	NULL		0.652	GMPPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMIGO3	protein_coding	OTTHUMT00000350291.1	C	NM_013334	-		49756266	-1	no_errors	ENST00000320431	ensembl	human	known	74_37	missense	SNP	0.998	A
C4BPB	725	genome.wustl.edu	37	1	207268652	207268652	+	Intron	DEL	T	T	-			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr1:207268652delT	ENST00000243611.5	+	4	703				C4BPB_ENST00000367076.3_Intron|C4BPB_ENST00000391923.1_Intron|C4BPB_ENST00000367078.3_Intron|C4BPB_ENST00000451804.2_Frame_Shift_Del_p.P132fs	NM_000716.3	NP_000707.1	P20851	C4BPB_HUMAN	complement component 4 binding protein, beta						blood coagulation (GO:0007596)|complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)|negative regulation of complement activation, classical pathway (GO:0045959)|positive regulation of protein catabolic process (GO:0045732)|regulation of complement activation (GO:0030449)|regulation of opsonization (GO:1903027)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|other organism cell (GO:0044216)|plasma membrane (GO:0005886)				breast(2)|lung(1)|ovary(1)	4						AGACTCGTCCTCTTCCCTTCC	0.478																																																	0								ENSG00000123843																																			C4BPB	SO:0001627	intron_variant	0				HGNC	L11245	CCDS1476.1, CCDS31005.1	1q32	2008-07-18	2001-11-28		ENSG00000123843	ENSG00000123843			1328	protein-coding gene	gene with protein product	"""complement component 4 binding protein, beta chain"", ""C4b binding protein, beta chain"""	120831	"""complement component 4-binding protein, beta"""	C4BP		2300577, 8325877	Standard	XM_005273255		Approved		uc001hfj.3	P20851	OTTHUMG00000036035	ENST00000243611.5:c.410-1215T>-	1.37:g.207268652delT		Somatic	0	47	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	14	12.50	A5JYP8|D3DT81|Q5VVR0|Q9BS25	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.L133fs	ENST00000243611.5	37	c.396	CCDS1476.1	1																																																																																			-	NULL		0.478	C4BPB-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C4BPB	protein_coding	OTTHUMT00000087847.2	T	NM_000716			207268652	+1	no_errors	ENST00000451804	ensembl	human	known	74_37	frame_shift_del	DEL	0.001	-
WDR18	57418	genome.wustl.edu	37	19	985925	985925	+	Frame_Shift_Del	DEL	A	A	-			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr19:985925delA	ENST00000251289.5	+	2	294	c.271delA	c.(271-273)aatfs	p.N91fs	WDR18_ENST00000591997.1_3'UTR|WDR18_ENST00000587001.2_Frame_Shift_Del_p.N91fs	NM_024100.3	NP_077005.2	Q9BV38	WDR18_HUMAN	WD repeat domain 18	91					multicellular organismal development (GO:0007275)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(1)|kidney(2)|lung(2)|skin(2)	7		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGCATCACCCAATGGTCTCTA	0.577																																																	0								ENSG00000065268						138.0	110.0	119.0					19																	985925		2203	4300	6503	WDR18	SO:0001589	frameshift_variant	0				HGNC		CCDS12051.1	19p13.3	2013-01-09				ENSG00000065268		"""WD repeat domain containing"""	17956	protein-coding gene	gene with protein product	"""Involved in Processing ITS2 3 homolog (S. cerevisiae)"""					22190735	Standard	NM_024100		Approved	Ipi3	uc002lqm.1	Q9BV38		ENST00000251289.5:c.271delA	19.37:g.985925delA	ENSP00000251289:p.Asn91fs	Somatic	0	57	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	14	12.50	O60390|Q9BWR2	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.N91fs	ENST00000251289.5	37	c.271	CCDS12051.1	19																																																																																			-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom		0.577	WDR18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR18	protein_coding	OTTHUMT00000458225.2	A				985925	+1	no_errors	ENST00000251289	ensembl	human	known	74_37	frame_shift_del	DEL	0.989	-
C7orf25	79020	genome.wustl.edu	37	7	42950004	42950004	+	Missense_Mutation	SNP	T	T	A			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr7:42950004T>A	ENST00000350427.4	-	2	771	c.496A>T	c.(496-498)Atc>Ttc	p.I166F	PSMA2_ENST00000442788.1_3'UTR|C7orf25_ENST00000438029.1_Missense_Mutation_p.I166F|C7orf25_ENST00000431882.2_Missense_Mutation_p.I224F|C7orf25_ENST00000447342.1_Missense_Mutation_p.I166F			Q9BPX7	CG025_HUMAN	chromosome 7 open reading frame 25	166										endometrium(6)|kidney(1)|large_intestine(7)|lung(2)|skin(1)	17						AATGCAAAGATGATGTGAGGG	0.502																																																	0								ENSG00000136197						96.0	86.0	89.0					7																	42950004		2203	4300	6503	C7orf25	SO:0001583	missense	0			-	HGNC	BC001845	CCDS5466.1, CCDS47576.1	7p14.1	2011-11-24			ENSG00000136197	ENSG00000136197			21703	protein-coding gene	gene with protein product							Standard	NM_024054		Approved	MGC2821	uc003thx.4	Q9BPX7	OTTHUMG00000128869	ENST00000350427.4:c.496A>T	7.37:g.42950004T>A	ENSP00000343364:p.Ile166Phe	Somatic	0	44	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	18	33.33	A4D1V2|J3KR36|Q9H779	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF1308	p.I224F	ENST00000350427.4	37	c.670	CCDS5466.1	7	.	.	.	.	.	.	.	.	.	.	T	14.00	2.405216	0.42613	.	.	ENSG00000136197	ENST00000350427;ENST00000447342;ENST00000431882;ENST00000438029;ENST00000425683	T;T;T;T;T	0.46451	0.87;0.87;0.87;0.87;0.87	5.8	-2.11	0.07187	.	0.296244	0.34484	N	0.003935	T	0.34337	0.0894	M	0.71581	2.175	0.54753	D	0.999984	B;B;B	0.31503	0.188;0.326;0.036	B;B;B	0.36989	0.238;0.139;0.102	T	0.16100	-1.0414	10	0.10111	T	0.7	-6.0784	6.3873	0.21568	0.1081:0.314:0.0:0.5779	.	166;224;166	C9K0L6;B4DQM3;Q9BPX7	.;.;CG025_HUMAN	F	166;166;224;166;166	ENSP00000343364:I166F;ENSP00000413029:I166F;ENSP00000416290:I224F;ENSP00000396597:I166F;ENSP00000413106:I166F	ENSP00000343364:I166F	I	-	1	0	C7orf25	42916529	1.000000	0.71417	0.955000	0.39395	0.990000	0.78478	0.842000	0.27627	-0.104000	0.12154	0.454000	0.30748	ATC	-	pfam_DUF1308		0.502	C7orf25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C7orf25	protein_coding	OTTHUMT00000250814.2	T	NM_024054	-		42950004	-1	no_errors	ENST00000431882	ensembl	human	known	74_37	missense	SNP	0.947	A
F2	2147	genome.wustl.edu	37	11	46760630	46760630	+	Missense_Mutation	SNP	G	G	T			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr11:46760630G>T	ENST00000311907.5	+	13	1743	c.1687G>T	c.(1687-1689)Gcc>Tcc	p.A563S	F2_ENST00000530231.1_Missense_Mutation_p.A524S	NM_000506.3	NP_000497.1	P00734	THRB_HUMAN	coagulation factor II (thrombin)	563	High affinity receptor-binding region which is also known as the TP508 peptide.|Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell surface receptor signaling pathway (GO:0007166)|cellular protein metabolic process (GO:0044267)|cytosolic calcium ion homeostasis (GO:0051480)|fibrinolysis (GO:0042730)|leukocyte migration (GO:0050900)|multicellular organismal development (GO:0007275)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of platelet activation (GO:0010544)|negative regulation of proteolysis (GO:0045861)|peptidyl-glutamic acid carboxylation (GO:0017187)|platelet activation (GO:0030168)|positive regulation of blood coagulation (GO:0030194)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C-activating G-protein coupled receptor signaling pathway (GO:1900738)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)|regulation of blood coagulation (GO:0030193)|regulation of cell shape (GO:0008360)|response to wounding (GO:0009611)	blood microparticle (GO:0072562)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|growth factor activity (GO:0008083)|receptor binding (GO:0005102)|serine-type endopeptidase activity (GO:0004252)|thrombospondin receptor activity (GO:0070053)			endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|ovary(3)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)	27		all_lung(304;0.000414)|Lung NSC(402;0.0011)		BRCA - Breast invasive adenocarcinoma(625;0.146)	Antihemophilic Factor(DB00025)|Argatroban(DB00278)|ART-123(DB05777)|Bivalirudin(DB00006)|Coagulation Factor IX(DB00100)|Dabigatran etexilate(DB06695)|Drotrecogin alfa(DB00055)|Lepirudin(DB00001)|Menadione(DB00170)|Proflavine(DB01123)|Suramin(DB04786)|Ximelagatran(DB04898)	ACGAGGGGATGCCTGTGAAGG	0.547																																					Esophageal Squamous(147;1147 1808 2148 38609 51144)												0								ENSG00000180210						126.0	119.0	121.0					11																	46760630		2201	4299	6500	F2	SO:0001583	missense	0			-	HGNC	M33031	CCDS31476.1	11p11.2	2013-02-28			ENSG00000180210	ENSG00000180210	3.4.21.5	"""Endogenous ligands"""	3535	protein-coding gene	gene with protein product	"""prepro-coagulation factor II"""	176930					Standard	NM_000506		Approved		uc001ndf.4	P00734	OTTHUMG00000150344	ENST00000311907.5:c.1687G>T	11.37:g.46760630G>T	ENSP00000308541:p.Ala563Ser	Somatic	0	59	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	24	11.11	B2R7F7|B4E1A7|Q4QZ40|Q53H04|Q53H06|Q69EZ7|Q7Z7P3|Q9UCA1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_S1,pfam_Kringle,pfam_Thrombin_light_chain,pfam_GLA_domain,superfamily_Trypsin-like_Pept_dom,superfamily_Kringle-like,superfamily_GLA_domain,smart_GLA_domain,smart_Kringle,smart_Peptidase_S1,pirsf_Prothrombin/thrombin,pfscan_GLA_domain,pfscan_Kringle,pfscan_Peptidase_S1,prints_Prothrombin/thrombin,prints_Peptidase_S1A,prints_GLA_domain	p.A563S	ENST00000311907.5	37	c.1687	CCDS31476.1	11	.	.	.	.	.	.	.	.	.	.	G	17.31	3.357519	0.61293	.	.	ENSG00000180210	ENST00000311907;ENST00000530231	D;D	0.93133	-3.17;-3.17	5.32	3.07	0.35406	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.104014	0.64402	N	0.000004	D	0.93468	0.7916	N	0.21545	0.675	0.58432	D	0.999999	P	0.46912	0.886	D	0.67548	0.952	D	0.94235	0.7480	10	0.87932	D	0	.	15.1236	0.72465	0.0:0.0:0.6898:0.3102	.	563	P00734	THRB_HUMAN	S	563;524	ENSP00000308541:A563S;ENSP00000433907:A524S	ENSP00000308541:A563S	A	+	1	0	F2	46717206	1.000000	0.71417	1.000000	0.80357	0.894000	0.52154	4.760000	0.62235	1.087000	0.41251	0.460000	0.39030	GCC	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pirsf_Prothrombin/thrombin,pfscan_Peptidase_S1,prints_Peptidase_S1A		0.547	F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	F2	protein_coding	OTTHUMT00000317706.1	G		-		46760630	+1	no_errors	ENST00000311907	ensembl	human	known	74_37	missense	SNP	1.000	T
USP15	9958	genome.wustl.edu	37	12	62783616	62783616	+	Silent	SNP	C	C	T	rs144407646		TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr12:62783616C>T	ENST00000280377.5	+	14	1750	c.1692C>T	c.(1690-1692)caC>caT	p.H564H	USP15_ENST00000353364.3_Silent_p.H535H|USP15_ENST00000393654.3_Silent_p.H539H	NM_001252078.1	NP_001239007.1	Q9Y4E8	UBP15_HUMAN	ubiquitin specific peptidase 15	564	USP.				BMP signaling pathway (GO:0030509)|monoubiquitinated protein deubiquitination (GO:0035520)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|protein deubiquitination (GO:0016579)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|identical protein binding (GO:0042802)|SMAD binding (GO:0046332)|transforming growth factor beta receptor binding (GO:0005160)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(8)|lung(15)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	37			GBM - Glioblastoma multiforme(1;0.000276)	GBM - Glioblastoma multiforme(28;0.0622)		ATACAGAGCACGTGATTATTC	0.348													C|||	1	0.000199681	0.0	0.0	5008	,	,		15982	0.0		0.0	False		,,,				2504	0.001				Melanoma(181;615 2041 39364 49691 50001)												0								ENSG00000135655	C		0,4406		0,0,2203	91.0	86.0	88.0		1605	0.4	1.0	12	dbSNP_134	88	3,8597	3.0+/-9.4	0,3,4297	no	coding-synonymous	USP15	NM_006313.1		0,3,6500	TT,TC,CC		0.0349,0.0,0.0231		535/953	62783616	3,13003	2203	4300	6503	USP15	SO:0001819	synonymous_variant	0			-	HGNC	AB011101	CCDS8963.1, CCDS58250.1, CCDS58251.1	12q14	2006-07-18	2005-08-08					"""Ubiquitin-specific peptidases"""	12613	protein-coding gene	gene with protein product		604731	"""ubiquitin specific protease 15"""			12838346	Standard	NM_001252078		Approved	KIAA0529, UNPH4	uc001src.2	Q9Y4E8	OTTHUMG00000170186	ENST00000280377.5:c.1692C>T	12.37:g.62783616C>T		Somatic	0	64	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	13	18.75	Q08AL5|Q9H8G9|Q9HCA6|Q9UNP0|Q9Y5B5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_C19/C67,pfam_Pept_C19_DUSP,superfamily_RNA3'P_cycl/enolpyr_Trfase_a/b,smart_Pept_C19_DUSP,pfscan_Peptidase_C19/C67	p.H564	ENST00000280377.5	37	c.1692	CCDS58251.1	12																																																																																			-	pfam_Peptidase_C19/C67,superfamily_RNA3'P_cycl/enolpyr_Trfase_a/b,pfscan_Peptidase_C19/C67		0.348	USP15-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	USP15	protein_coding	OTTHUMT00000407831.2	C	NM_006313	rs144407646		62783616	+1	no_errors	ENST00000280377	ensembl	human	known	74_37	silent	SNP	0.999	T
TTN	7273	genome.wustl.edu	37	2	179429661	179429661	+	Silent	SNP	T	T	A			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr2:179429661T>A	ENST00000591111.1	-	276	76499	c.76275A>T	c.(76273-76275)gtA>gtT	p.V25425V	TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000359218.5_Silent_p.V18126V|TTN_ENST00000460472.2_Silent_p.V18001V|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_Silent_p.V18193V|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000342992.6_Silent_p.V24498V|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000589042.1_Silent_p.V27066V			Q8WZ42	TITIN_HUMAN	titin	25425	Fibronectin type-III 84. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ATGGATATTGTACAATAACTG	0.403																																																	0								ENSG00000155657						114.0	110.0	111.0					2																	179429661		1856	4102	5958	TTN	SO:0001819	synonymous_variant	0			-	HGNC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.76275A>T	2.37:g.179429661T>A		Somatic	0	57	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	24	11.11	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.V24498	ENST00000591111.1	37	c.73494		2																																																																																			-	superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom		0.403	TTN-019	PUTATIVE	basic	protein_coding	TTN	protein_coding	OTTHUMT00000460310.1	T	NM_133378	-		179429661	-1	no_errors	ENST00000342992	ensembl	human	known	74_37	silent	SNP	1.000	A
LRRC14B	389257	genome.wustl.edu	37	5	192413	192413	+	Frame_Shift_Del	DEL	C	C	-			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr5:192413delC	ENST00000328278.3	+	1	788	c.760delC	c.(760-762)cccfs	p.P255fs		NM_001080478.1	NP_001073947.1	A6NHZ5	LR14B_HUMAN	leucine rich repeat containing 14B	255										endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|skin(1)|upper_aerodigestive_tract(2)	10						CTTTGATGCACCCCCCACCTA	0.697																																																	0								ENSG00000185028			57,3913		26,5,1954	15.0	19.0	17.0			-10.5	0.0	5		17	79,7889		35,9,3940	no	frameshift	LRRC14B	NM_001080478.1		61,14,5894	A1A1,A1R,RR		0.9915,1.4358,1.1392			192413	136,11802	2091	4183	6274	LRRC14B	SO:0001589	frameshift_variant	0				HGNC		CCDS47184.1	5p15.33	2010-02-17			ENSG00000185028	ENSG00000185028			37268	protein-coding gene	gene with protein product							Standard	NM_001080478		Approved		uc003jal.1	A6NHZ5	OTTHUMG00000161578	ENST00000328278.3:c.760delC	5.37:g.192413delC	ENSP00000327675:p.Pro255fs	Somatic	0	33	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	11	21.43		Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	NULL	p.T256fs	ENST00000328278.3	37	c.760	CCDS47184.1	5																																																																																			-	NULL		0.697	LRRC14B-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	LRRC14B	protein_coding	OTTHUMT00000365393.2	C	NM_001080478			192413	+1	no_errors	ENST00000328278	ensembl	human	novel	74_37	frame_shift_del	DEL	0.004	-
HSPA6	3310	genome.wustl.edu	37	1	161495396	161495396	+	Silent	SNP	G	G	T			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr1:161495396G>T	ENST00000309758.4	+	1	1361	c.948G>T	c.(946-948)ctG>ctT	p.L316L	RP11-25K21.6_ENST00000537821.2_RNA	NM_002155.3	NP_002146.2	P17066	HSP76_HUMAN	heat shock 70kDa protein 6 (HSP70B')	316					ATP catabolic process (GO:0006200)|cellular response to heat (GO:0034605)|protein refolding (GO:0042026)|response to unfolded protein (GO:0006986)	blood microparticle (GO:0072562)|centriole (GO:0005814)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|enzyme binding (GO:0019899)|heat shock protein binding (GO:0031072)|unfolded protein binding (GO:0051082)			endometrium(3)|large_intestine(5)|lung(9)|prostate(2)|skin(2)	21	all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		BRCA - Breast invasive adenocarcinoma(70;0.00376)			GCAGCACCCTGGAGCCGGTGG	0.622																																																	0								ENSG00000173110						20.0	23.0	22.0					1																	161495396		2201	4293	6494	HSPA6	SO:0001819	synonymous_variant	0			-	HGNC		CCDS1231.1	1q23.3	2011-09-02	2002-08-29		ENSG00000173110	ENSG00000173110		"""Heat shock proteins / HSP70"""	5239	protein-coding gene	gene with protein product		140555	"""heat shock 70kD protein 6 (HSP70B')"""			1346391	Standard	NM_002155		Approved		uc001gaq.3	P17066	OTTHUMG00000034461	ENST00000309758.4:c.948G>T	1.37:g.161495396G>T		Somatic	0	94	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	30	11.76	Q1HBA8|Q8IYK7|Q9BT95	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Hsp_70_fam,pfam_MreB_Mrl,prints_Hsp_70_fam	p.L316	ENST00000309758.4	37	c.948	CCDS1231.1	1																																																																																			-	pfam_Hsp_70_fam,pfam_MreB_Mrl		0.622	HSPA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPA6	protein_coding	OTTHUMT00000083308.1	G	NM_002155	-		161495396	+1	no_errors	ENST00000309758	ensembl	human	known	74_37	silent	SNP	1.000	T
MYO16	23026	genome.wustl.edu	37	13	109772771	109772771	+	Missense_Mutation	SNP	T	T	A			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr13:109772771T>A	ENST00000357550.2	+	28	3467	c.3426T>A	c.(3424-3426)gaT>gaA	p.D1142E	MYO16_ENST00000356711.2_Missense_Mutation_p.D1142E|MYO16_ENST00000457511.2_Missense_Mutation_p.D654E	NM_001198950.1	NP_001185879.1			myosin XVI											NS(3)|breast(4)|central_nervous_system(2)|endometrium(10)|kidney(8)|large_intestine(27)|lung(51)|ovary(9)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	121	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)			AACTCAATGATTTGTGCCTAC	0.348																																																	0								ENSG00000041515						122.0	116.0	118.0					13																	109772771		2203	4300	6503	MYO16	SO:0001583	missense	0			-	HGNC		CCDS32008.1, CCDS73598.1	13q33.3	2014-06-12			ENSG00000041515	ENSG00000041515		"""Myosins / Myosin superfamily : Class XVI"", ""Ankyrin repeat domain containing"""	29822	protein-coding gene	gene with protein product	"""neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 3"", ""protein phosphatase 1, regulatory subunit 107"""	615479				11588169, 17029291, 21946561	Standard	NM_001198950		Approved	MYR8, KIAA0865, Myo16b, NYAP3, PPP1R107	uc001vqt.1	Q9Y6X6	OTTHUMG00000017333	ENST00000357550.2:c.3426T>A	13.37:g.109772771T>A	ENSP00000350160:p.Asp1142Glu	Somatic	0	48	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	9	25.00		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Myosin_head_motor_dom,pfam_Ankyrin_rpt,superfamily_P-loop_NTPase,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Myosin_head_motor_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.D1142E	ENST00000357550.2	37	c.3426	CCDS32008.1	13	.	.	.	.	.	.	.	.	.	.	T	15.79	2.937266	0.52972	.	.	ENSG00000041515	ENST00000356711;ENST00000357550;ENST00000457511	D;D;D	0.94758	-3.51;-3.51;-3.51	5.38	-2.77	0.05877	Myosin head, motor domain (1);	0.000000	0.41938	U	0.000796	D	0.94696	0.8289	M	0.62723	1.935	0.37086	D	0.899209	D;D	0.76494	0.991;0.999	P;D	0.72338	0.895;0.977	D	0.91839	0.5482	9	.	.	.	.	7.6607	0.28402	0.1275:0.5414:0.0:0.3311	.	654;1142	F8W883;Q9Y6X6	.;MYO16_HUMAN	E	1142;1142;654	ENSP00000349145:D1142E;ENSP00000350160:D1142E;ENSP00000401633:D654E	.	D	+	3	2	MYO16	108570772	0.384000	0.25164	0.013000	0.15412	0.836000	0.47400	-0.128000	0.10531	-0.518000	0.06452	-1.413000	0.01118	GAT	-	superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom		0.348	MYO16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO16	protein_coding	OTTHUMT00000045746.1	T	NM_015011	-		109772771	+1	no_errors	ENST00000356711	ensembl	human	known	74_37	missense	SNP	0.880	A
SULT1B1	27284	genome.wustl.edu	37	4	70596224	70596224	+	Missense_Mutation	SNP	C	C	T	rs142990488	byFrequency	TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr4:70596224C>T	ENST00000310613.3	-	7	1070	c.773G>A	c.(772-774)cGt>cAt	p.R258H		NM_014465.3	NP_055280.2	O43704	ST1B1_HUMAN	sulfotransferase family, cytosolic, 1B, member 1	258					3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|cellular biogenic amine metabolic process (GO:0006576)|epithelial cell differentiation (GO:0030855)|flavonoid metabolic process (GO:0009812)|phenol-containing compound metabolic process (GO:0018958)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sulfation (GO:0051923)|thyroid hormone metabolic process (GO:0042403)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	aryl sulfotransferase activity (GO:0004062)|sulfotransferase activity (GO:0008146)			breast(1)|cervix(1)|endometrium(2)|large_intestine(4)|lung(14)|prostate(1)|upper_aerodigestive_tract(1)	24						TTTACCTTTACGCATAAAAGG	0.353													C|||	5	0.000998403	0.0	0.0	5008	,	,		16912	0.002		0.0	False		,,,				2504	0.0031																0								ENSG00000173597	C	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	129.0	123.0	125.0		773	3.4	1.0	4	dbSNP_134	125	0,8600		0,0,4300	yes	missense	SULT1B1	NM_014465.3	29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	258/297	70596224	1,13005	2203	4300	6503	SULT1B1	SO:0001583	missense	0			GMAF=0.0005	HGNC	D89479	CCDS3530.1	4q13.3	2008-02-05			ENSG00000173597	ENSG00000173597		"""Sulfotransferases, cytosolic"""	17845	protein-coding gene	gene with protein product		608436				11688987, 9443824	Standard	NM_014465		Approved	ST1B2	uc003hen.3	O43704	OTTHUMG00000129407	ENST00000310613.3:c.773G>A	4.37:g.70596224C>T	ENSP00000308770:p.Arg258His	Somatic	0	47	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	6	40.00	O15497|Q96FI1|Q9UK34	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase	p.R258H	ENST00000310613.3	37	c.773	CCDS3530.1	4	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	14.16	2.452004	0.43531	2.27E-4	0.0	ENSG00000173597	ENST00000310613	T	0.03181	4.02	4.27	3.43	0.39272	Sulfotransferase domain (1);	0.397593	0.18360	N	0.143598	T	0.28797	0.0714	H	0.98111	4.15	0.41988	D	0.99083	D	0.89917	1.0	D	0.97110	1.0	T	0.32134	-0.9918	10	0.87932	D	0	.	10.1702	0.42904	0.0:0.8991:0.0:0.1009	.	258	O43704	ST1B1_HUMAN	H	258	ENSP00000308770:R258H	ENSP00000308770:R258H	R	-	2	0	SULT1B1	70630813	1.000000	0.71417	0.997000	0.53966	0.171000	0.22731	5.795000	0.69074	0.937000	0.37394	-0.373000	0.07131	CGT	-	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase		0.353	SULT1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SULT1B1	protein_coding	OTTHUMT00000251563.2	C	NM_014465	rs142990488		70596224	-1	no_errors	ENST00000310613	ensembl	human	known	74_37	missense	SNP	1.000	T
COL4A6	1288	genome.wustl.edu	37	X	107417804	107417804	+	Missense_Mutation	SNP	C	C	A			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chrX:107417804C>A	ENST00000372216.4	-	31	3107	c.3007G>T	c.(3007-3009)Gct>Tct	p.A1003S	COL4A6_ENST00000545689.1_Missense_Mutation_p.A1002S|COL4A6_ENST00000334504.7_Missense_Mutation_p.A1002S|COL4A6_ENST00000538570.1_Missense_Mutation_p.A1002S|COL4A6_ENST00000394872.2_Missense_Mutation_p.A1003S	NM_001847.2	NP_001838.2	Q14031	CO4A6_HUMAN	collagen, type IV, alpha 6	1003	Triple-helical region.				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(41)|ovary(7)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	92						AGGCCAGGAGCTCCAGGTAGG	0.547									Alport syndrome with Diffuse Leiomyomatosis																												Melanoma(87;1895 1945 2589 7165)												0								ENSG00000197565						30.0	32.0	31.0					X																	107417804		2203	4300	6503	COL4A6	SO:0001583	missense	0	Familial Cancer Database		-	HGNC	U04845	CCDS14541.1, CCDS14542.1, CCDS76008.1, CCDS76009.1, CCDS76010.1	Xq22	2014-09-17			ENSG00000197565	ENSG00000197565		"""Collagens"""	2208	protein-coding gene	gene with protein product		303631				8356449	Standard	NM_033641		Approved		uc004env.4	Q14031	OTTHUMG00000022179	ENST00000372216.4:c.3007G>T	X.37:g.107417804C>A	ENSP00000361290:p.Ala1003Ser	Somatic	0	148	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	30	28.57	Q12823|Q14053|Q5JYH6|Q5JYH8|Q9NQM5|Q9NTX3|Q9UJ76|Q9UMG6|Q9Y4L4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Collagen,pfam_Collagen_VI_NC,superfamily_C-type_lectin_fold,smart_Collagen_VI_NC	p.A1003S	ENST00000372216.4	37	c.3007	CCDS14541.1	X	.	.	.	.	.	.	.	.	.	.	C	4.227	0.041020	0.08196	.	.	ENSG00000197565	ENST00000372216;ENST00000334504;ENST00000394872;ENST00000541389;ENST00000545689;ENST00000538570	D;D;D;D;D	0.92647	-3.08;-3.08;-3.08;-3.08;-3.08	5.03	-0.63	0.11530	.	0.945621	0.08713	N	0.904678	D	0.84866	0.5567	N	0.16201	0.385	0.09310	N	1	P;D;P;P	0.58970	0.842;0.984;0.883;0.594	B;P;P;P	0.51487	0.39;0.671;0.625;0.458	T	0.74922	-0.3499	10	0.07990	T	0.79	.	6.264	0.20915	0.0:0.1697:0.2685:0.5618	.	1002;1002;1003;1002	F5H851;F5H3Q5;Q14031;Q14031-2	.;.;CO4A6_HUMAN;.	S	1003;1002;1003;1002;1002;1002	ENSP00000361290:A1003S;ENSP00000334733:A1002S;ENSP00000378340:A1003S;ENSP00000443707:A1002S;ENSP00000445236:A1002S	ENSP00000334733:A1002S	A	-	1	0	COL4A6	107304460	0.003000	0.15002	0.115000	0.21578	0.175000	0.22909	-0.325000	0.07976	-0.156000	0.11079	-0.199000	0.12753	GCT	-	pfam_Collagen		0.547	COL4A6-001	KNOWN	basic|CCDS	protein_coding	COL4A6	protein_coding	OTTHUMT00000057875.2	C		-		107417804	-1	no_errors	ENST00000372216	ensembl	human	known	74_37	missense	SNP	0.010	A
ZFHX3	463	genome.wustl.edu	37	16	72830503	72830503	+	Nonsense_Mutation	SNP	G	G	T			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr16:72830503G>T	ENST00000268489.5	-	9	6750	c.6078C>A	c.(6076-6078)taC>taA	p.Y2026*	ZFHX3_ENST00000397992.5_Nonsense_Mutation_p.Y1112*	NM_006885.3	NP_008816.3	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3	2026					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|regulation of neuron differentiation (GO:0045664)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(3)|breast(7)|cervix(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(22)|liver(1)|lung(46)|ovary(5)|pancreas(1)|prostate(15)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(11)	153		Ovarian(137;0.13)				ACAGTTTATCGTAGTGGTCTC	0.552																																																	0								ENSG00000140836						77.0	82.0	80.0					16																	72830503		2198	4300	6498	ZFHX3	SO:0001587	stop_gained	0			-	HGNC	D10250	CCDS10908.1, CCDS54035.1	16q22.3	2012-03-09	2007-08-09	2007-08-09	ENSG00000140836	ENSG00000140836		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	777	protein-coding gene	gene with protein product		104155	"""AT-binding transcription factor 1"""	ATBF1		1719379, 7592926	Standard	NM_006885		Approved	ZNF927	uc002fck.3	Q15911	OTTHUMG00000137599	ENST00000268489.5:c.6078C>A	16.37:g.72830503G>T	ENSP00000268489:p.Tyr2026*	Somatic	0	109	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70	D3DWS8|O15101|Q13719	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Homeobox_dom,superfamily_Homeodomain-like,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Znf_C2H2-like,smart_Znf_U1,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Znf_C2H2	p.Y2026*	ENST00000268489.5	37	c.6078	CCDS10908.1	16	.	.	.	.	.	.	.	.	.	.	G	45	11.883379	0.99613	.	.	ENSG00000140836	ENST00000268489;ENST00000397992	.	.	.	5.38	-8.63	0.00878	.	0.000000	0.42548	D	0.000691	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.6985	0.96043	0.3817:0.0:0.6183:0.0	.	.	.	.	X	2026;1112	.	ENSP00000268489:Y2026X	Y	-	3	2	ZFHX3	71388004	0.783000	0.28701	0.760000	0.31359	0.090000	0.18270	0.032000	0.13732	-1.750000	0.01328	-1.731000	0.00696	TAC	-	superfamily_Adenylate_cyclase-assoc_CAP_N		0.552	ZFHX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFHX3	protein_coding	OTTHUMT00000269008.1	G	NM_006885	-		72830503	-1	no_errors	ENST00000268489	ensembl	human	known	74_37	nonsense	SNP	0.745	T
GSDMC	56169	genome.wustl.edu	37	8	130777930	130777930	+	Missense_Mutation	SNP	C	C	T	rs375510820		TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr8:130777930C>T	ENST00000276708.4	-	4	1395	c.514G>A	c.(514-516)Gat>Aat	p.D172N		NM_031415.2	NP_113603.1	Q9BYG8	GSDMC_HUMAN	gasdermin C	172						cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|mitochondrion (GO:0005739)		p.D172N(1)		autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(2)|pancreas(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	26						CTACTGCTATCGTACAGCACA	0.428																																																	1	Substitution - Missense(1)	skin(1)						ENSG00000147697	C	ASN/ASP	3,4403	6.2+/-15.9	0,3,2200	124.0	116.0	119.0		514	-2.6	0.0	8		119	0,8600		0,0,4300	no	missense	GSDMC	NM_031415.2	23	0,3,6500	TT,TC,CC		0.0,0.0681,0.0231	benign	172/509	130777930	3,13003	2203	4300	6503	GSDMC	SO:0001583	missense	0			-	HGNC	AB042405	CCDS6360.1	8q24.21	2014-05-14	2008-07-31	2008-07-31	ENSG00000147697	ENSG00000147697			7151	protein-coding gene	gene with protein product		608384	"""melanoma-derived leucine zipper, extra-nuclear factor"""	MLZE		17350798	Standard	NM_031415		Approved		uc003ysr.3	Q9BYG8	OTTHUMG00000164851	ENST00000276708.4:c.514G>A	8.37:g.130777930C>T	ENSP00000276708:p.Asp172Asn	Somatic	0	83	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	18	45.45	Q5XKF3|Q6P494	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Gasdermin	p.D172N	ENST00000276708.4	37	c.514	CCDS6360.1	8	.	.	.	.	.	.	.	.	.	.	C	8.527	0.870003	0.17322	6.81E-4	0.0	ENSG00000147697	ENST00000276708	T	0.23348	1.91	4.51	-2.59	0.06209	.	1.724680	0.02841	N	0.128013	T	0.17492	0.0420	L	0.31926	0.97	0.09310	N	1	B	0.26258	0.145	B	0.23018	0.043	T	0.12760	-1.0535	10	0.22109	T	0.4	.	5.341	0.15984	0.1422:0.3789:0.0:0.4789	.	172	Q9BYG8	GSDMC_HUMAN	N	172	ENSP00000276708:D172N	ENSP00000276708:D172N	D	-	1	0	GSDMC	130847112	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.739000	0.04866	-0.582000	0.05929	-1.936000	0.00505	GAT	-	pfam_Gasdermin		0.428	GSDMC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GSDMC	protein_coding	OTTHUMT00000380586.1	C		-		130777930	-1	no_errors	ENST00000276708	ensembl	human	known	74_37	missense	SNP	0.000	T
GALNT6	11226	genome.wustl.edu	37	12	51785401	51785402	+	5'Flank	INS	-	-	AGCCGC	rs143011477	byFrequency	TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr12:51785401_51785402insAGCCGC	ENST00000356317.3	-	0	0				SLC4A8_ENST00000535225.2_Intron|GALNT6_ENST00000603203.1_5'UTR	NM_007210.3	NP_009141.2	Q8NCL4	GALT6_HUMAN	polypeptide N-acetylgalactosaminyltransferase 6						cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			endometrium(2)|large_intestine(6)|lung(7)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	27						CGCCGAGGCAAAGCCGCAGCCG	0.757														1258	0.251198	0.0234	0.245	5008	,	,		9662	0.2897		0.4155	False		,,,				2504	0.3548																0								ENSG00000139629																																			GALNT6	SO:0001631	upstream_gene_variant	0				HGNC	Y08565	CCDS8813.1	12q13	2014-03-13	2014-03-13		ENSG00000139629	ENSG00000139629		"""Glycosyltransferase family 2 domain containing"""	4128	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 6"""	605148	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 6 (GalNAc-T6)"""			10464263	Standard	NM_007210		Approved	GalNAc-T6	uc001ryl.1	Q8NCL4			12.37:g.51785402_51785407dupAGCCGC	Exception_encountered	Somatic	NA	NA	NA		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q8IYH4|Q9H6G2|Q9UIV5	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000356317.3	37	NULL	CCDS8813.1	12																																																																																			-	-		0.757	GALNT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNT6	protein_coding	OTTHUMT00000469736.1	-	NM_007210			51785402	-1	no_errors	ENST00000603203	ensembl	human	known	74_37	rna	INS	0.021:0.127	AGCCGC
ART1	417	genome.wustl.edu	37	11	3681130	3681130	+	Silent	SNP	G	G	A			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr11:3681130G>A	ENST00000250693.1	+	3	482	c.381G>A	c.(379-381)ctG>ctA	p.L127L		NM_004314.2	NP_004305.2	P52961	NAR1_HUMAN	ADP-ribosyltransferase 1	127					innate immune response (GO:0045087)|protein ADP-ribosylation (GO:0006471)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)	NAD(P)+-protein-arginine ADP-ribosyltransferase activity (GO:0003956)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			endometrium(1)|large_intestine(2)|liver(1)|lung(3)|skin(1)	8		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0351)|LUSC - Lung squamous cell carcinoma(625;0.195)		ACAGCCCCCTGCACAAGGAGT	0.652																																																	0								ENSG00000129744						32.0	34.0	33.0					11																	3681130		2201	4297	6498	ART1	SO:0001819	synonymous_variant	0			-	HGNC	S74683	CCDS7744.1	11p15	2006-02-23			ENSG00000129744	ENSG00000129744		"""CD molecules"""	723	protein-coding gene	gene with protein product		601625				8812442	Standard	NM_004314		Approved	ART2, CD296	uc001lye.1	P52961	OTTHUMG00000011845	ENST00000250693.1:c.381G>A	11.37:g.3681130G>A		Somatic	0	76	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	35	10.26	Q6NTD2|Q96KT9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_ART,prints_ART	p.L127	ENST00000250693.1	37	c.381	CCDS7744.1	11																																																																																			-	pfam_ART		0.652	ART1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ART1	protein_coding	OTTHUMT00000032765.1	G	NM_004314	-		3681130	+1	no_errors	ENST00000250693	ensembl	human	known	74_37	silent	SNP	1.000	A
CLP1	10978	genome.wustl.edu	37	11	57428885	57428910	+	Stop_Codon_Del	DEL	ATCCGGTTCATGGATCTGAAGTAGAG	ATCCGGTTCATGGATCTGAAGTAGAG	-			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	ATCCGGTTCATGGATCTGAAGTAGAG	ATCCGGTTCATGGATCTGAAGTAGAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr11:57428885_57428910delATCCGGTTCATGGATCTGAAGTAGAG	ENST00000302731.4	+	0	1183_1208				CLP1_ENST00000529430.1_Stop_Codon_Del|CLP1_ENST00000525602.1_Stop_Codon_Del|CLP1_ENST00000533682.1_Stop_Codon_Del	NM_001142597.1|NM_006831.2	NP_001136069.1|NP_006822.1	Q5KU26	COL12_HUMAN	cleavage and polyadenylation factor I subunit 1						carbohydrate mediated signaling (GO:0009756)|defense response (GO:0006952)|innate immune response (GO:0045087)|pattern recognition receptor signaling pathway (GO:0002221)|phagocytosis, recognition (GO:0006910)|protein homooligomerization (GO:0051260)|receptor-mediated endocytosis (GO:0006898)	collagen trimer (GO:0005581)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	galactose binding (GO:0005534)|low-density lipoprotein particle binding (GO:0030169)|metal ion binding (GO:0046872)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)|stomach(1)	15						CATCATGGATATCCGGTTCATGGATCTGAAGTAGAGATCAGCAGGA	0.527																																																	0								ENSG00000172409																																			CLP1	SO:0001567	stop_retained_variant	0				HGNC	BC000446	CCDS7964.1, CCDS44600.1	11q12.1	2012-10-02	2012-10-02		ENSG00000172409	ENSG00000172409	2.7.1.78		16999	protein-coding gene	gene with protein product	"""ATP/GTPbinding protein"", ""polyribonucleotide 5'-hydroxyl-kinase"""	608757	"""CLP1, cleavage and polyadenylation factor I subunit, homolog (S. cerevisiae)"""			8896421, 11060040	Standard	NM_006831		Approved	HEAB, hClp1	uc001nkw.3	Q92989	OTTHUMG00000167146	Exception_encountered	11.37:g.57428885_57428910delATCCGGTTCATGGATCTGAAGTAGAG		Somatic	NA	NA	NA		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q6P9F2|Q8TCR2|Q8WZA4|Q9BY85|Q9BYH7	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Pre-mRNA_cleavage_cplxII_Clp1,superfamily_P-loop_NTPase	p.IRFMDLK*419in_frame_del	ENST00000302731.4	37	c.1255_1278	CCDS44600.1	11																																																																																			-	pfam_Pre-mRNA_cleavage_cplxII_Clp1		0.527	CLP1-003	NOVEL	basic|exp_conf|CCDS	protein_coding	CLP1	protein_coding	OTTHUMT00000393465.1	ATCCGGTTCATGGATCTGAAGTAGAG	NM_006831			57428910	+1	no_errors	ENST00000525602	ensembl	human	known	74_37	in_frame_del	DEL	1.000:1.000:1.000:1.000:1.000:0.994:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:0.858:1.000:1.000:0.993:1.000:1.000:0.925	-
PPP2R2C	5522	genome.wustl.edu	37	4	6374262	6374262	+	Missense_Mutation	SNP	C	C	T			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr4:6374262C>T	ENST00000382599.4	-	5	829	c.613G>A	c.(613-615)Gac>Aac	p.D205N	PPP2R2C_ENST00000314348.8_5'UTR|PPP2R2C_ENST00000515571.1_Missense_Mutation_p.D188N|PPP2R2C_ENST00000507294.1_Missense_Mutation_p.D198N|PPP2R2C_ENST00000506140.1_Missense_Mutation_p.D198N|PPP2R2C_ENST00000335585.5_Missense_Mutation_p.D205N			Q9Y2T4	2ABG_HUMAN	protein phosphatase 2, regulatory subunit B, gamma	205					regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)	protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)			central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	28						AAGCTCCTGTCGGTGATGGCC	0.582																																																	0								ENSG00000074211						144.0	116.0	126.0					4																	6374262		2203	4300	6503	PPP2R2C	SO:0001583	missense	0			-	HGNC	AF086924	CCDS3388.1, CCDS56304.1, CCDS56305.1, CCDS3387.1	4p16.1	2013-01-10	2010-04-14		ENSG00000074211	ENSG00000074211	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"", ""WD repeat domain containing"""	9306	protein-coding gene	gene with protein product	"""PP2A subunit B isoform gamma"""	605997	"""protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), gamma isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B, gamma isoform"""			10574460, 10945473	Standard	NM_020416		Approved	PR52, IMYPNO, MGC33570, PR55G	uc003gja.3	Q9Y2T4	OTTHUMG00000090445	ENST00000382599.4:c.613G>A	4.37:g.6374262C>T	ENSP00000372042:p.Asp205Asn	Somatic	0	66	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	19	38.71	A8MSY7|B7Z3Y1|Q7Z4V7|Q8NEC4|Q9H3G7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pirsf_PP2A_PR55,prints_PP2A_PR55	p.D205N	ENST00000382599.4	37	c.613		4	.	.	.	.	.	.	.	.	.	.	C	14.86	2.661985	0.47572	.	.	ENSG00000074211	ENST00000335585;ENST00000506140;ENST00000515571;ENST00000382599;ENST00000507294	T;T;T;T;T	0.34472	1.36;1.37;1.37;1.37;1.37	4.18	4.18	0.49190	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.32315	0.0825	L	0.50993	1.605	0.80722	D	1	B;B;B;B;B	0.26318	0.009;0.146;0.016;0.009;0.007	B;B;B;B;B	0.20577	0.007;0.03;0.007;0.007;0.007	T	0.10520	-1.0626	10	0.21540	T	0.41	-54.1694	16.0314	0.80579	0.0:1.0:0.0:0.0	.	198;301;205;188;205	B7Z3Y1;Q59GC6;Q9Y2T4;Q9Y2T4-3;Q9Y2T4-2	.;.;2ABG_HUMAN;.;.	N	205;198;188;205;198	ENSP00000335083:D205N;ENSP00000423649:D198N;ENSP00000422374:D188N;ENSP00000372042:D205N;ENSP00000425247:D198N	ENSP00000335083:D205N	D	-	1	0	PPP2R2C	6425163	1.000000	0.71417	0.998000	0.56505	0.988000	0.76386	5.333000	0.65917	2.327000	0.79052	0.462000	0.41574	GAC	-	superfamily_WD40_repeat_dom,pirsf_PP2A_PR55,prints_PP2A_PR55		0.582	PPP2R2C-001	NOVEL	overlapping_uORF|basic|appris_principal	protein_coding	PPP2R2C	protein_coding	OTTHUMT00000206889.2	C	NM_181876	-		6374262	-1	no_errors	ENST00000335585	ensembl	human	known	74_37	missense	SNP	1.000	T
FLYWCH2	114984	genome.wustl.edu	37	16	2949270	2949270	+	3'UTR	DEL	T	T	-	rs76446842		TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr16:2949270delT	ENST00000396958.3	+	0	923				FLYWCH2_ENST00000293981.6_3'UTR|FLYWCH2_ENST00000572786.1_3'UTR	NM_001142500.1|NM_138439.2	NP_001135972.1|NP_612448.1	Q96CP2	FWCH2_HUMAN	FLYWCH family member 2								poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|lung(3)|ovary(1)|skin(1)	6						Atttcttttcttttttttttt	0.393																																																	0								ENSG00000162076																																			FLYWCH2	SO:0001624	3_prime_UTR_variant	0				HGNC	BC014089	CCDS10482.1	16p13.3	2014-02-12	2007-06-21		ENSG00000162076	ENSG00000162076			25178	protein-coding gene	gene with protein product						12477932	Standard	NM_138439		Approved		uc010uwk.2	Q96CP2	OTTHUMG00000128962	ENST00000396958.3:c.*120T>-	16.37:g.2949270delT		Somatic	0	34	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	21	12.50		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000396958.3	37	NULL	CCDS10482.1	16																																																																																			-	-		0.393	FLYWCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLYWCH2	protein_coding	OTTHUMT00000250944.1	T	NM_138439			2949270	+1	no_errors	ENST00000572786	ensembl	human	putative	74_37	rna	DEL	0.000	-
CCSAP	126731	genome.wustl.edu	37	1	229460177	229460178	+	3'UTR	DEL	AA	AA	-			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	AA	AA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr1:229460177_229460178delAA	ENST00000366687.1	-	0	1668_1669				CCSAP_ENST00000284617.2_3'UTR|RP4-803J11.2_ENST00000418348.1_RNA|CCSAP_ENST00000483092.1_5'UTR|CCSAP_ENST00000366686.1_3'UTR			Q6IQ19	CCSAP_HUMAN	centriole, cilia and spindle-associated protein						multicellular organismal development (GO:0007275)|regulation of cilium beat frequency involved in ciliary motility (GO:0060296)|regulation of embryonic development (GO:0045995)	axon (GO:0030424)|axoneme (GO:0005930)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|ciliary transition zone (GO:0035869)|cilium (GO:0005929)|spindle (GO:0005819)											TGTATTCTTTAAAAAAAAAAAA	0.366																																																	0								ENSG00000154429																																			CCSAP	SO:0001624	3_prime_UTR_variant	0				HGNC	BC071609	CCDS1577.1	1q42.13	2012-06-19	2012-06-19	2012-06-19	ENSG00000154429	ENSG00000154429			29578	protein-coding gene	gene with protein product	"""centriole and spindle-associated protein"""		"""chromosome 1 open reading frame 96"""	C1orf96		22493317	Standard	NM_145257		Approved	FLJ41471, CSAP	uc001htl.4	Q6IQ19	OTTHUMG00000037663	ENST00000366687.1:c.*805TT>-	1.37:g.229460187_229460188delAA		Somatic	0	49	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	14	12.50	A8K5X2|Q6P9G2|Q6ZW85|Q8IXU1|Q96BM2	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000366687.1	37	NULL	CCDS1577.1	1																																																																																			-	-		0.366	CCSAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCSAP	protein_coding	OTTHUMT00000091839.1	AA	NM_145257			229460178	-1	no_errors	ENST00000483092	ensembl	human	known	74_37	rna	DEL	0.004:0.005	-
SEMG1	6406	genome.wustl.edu	37	20	43836290	43836290	+	Frame_Shift_Del	DEL	A	A	-			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr20:43836290delA	ENST00000372781.3	+	2	409	c.352delA	c.(352-354)aaafs	p.K118fs	SEMG1_ENST00000244069.6_Frame_Shift_Del_p.K118fs	NM_003007.3	NP_002998.1	P04279	SEMG1_HUMAN	semenogelin I	118	Repeat-rich region. {ECO:0000250}.				insemination (GO:0007320)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|secretory granule (GO:0030141)	structural molecule activity (GO:0005198)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(3)|liver(1)|lung(12)|prostate(1)|skin(6)|stomach(2)|urinary_tract(1)	32		Myeloproliferative disorder(115;0.0122)				AGACCATGATAAATCAAAAGG	0.408																																																	0								ENSG00000124233						109.0	96.0	101.0					20																	43836290		2203	4300	6503	SEMG1	SO:0001589	frameshift_variant	0				HGNC		CCDS13345.1	20q12-q13.2	2009-08-06			ENSG00000124233	ENSG00000124233			10742	protein-coding gene	gene with protein product	"""semen coagulating protein"", ""cancer/testis antigen 103"""	182140		SEMG		2912989, 15563730	Standard	NM_003007		Approved	CT103		P04279	OTTHUMG00000032565	ENST00000372781.3:c.352delA	20.37:g.43836290delA	ENSP00000361867:p.Lys118fs	Somatic	0	56	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	18	10.00	Q53ZV0|Q53ZV1|Q53ZV2|Q6X4I9|Q6Y809|Q6Y822|Q6Y823|Q86U64|Q96QM3	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Semenogelin	p.K118fs	ENST00000372781.3	37	c.352	CCDS13345.1	20																																																																																			-	pfam_Semenogelin		0.408	SEMG1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SEMG1	protein_coding	OTTHUMT00000079416.3	A	NM_003007			43836290	+1	no_errors	ENST00000372781	ensembl	human	known	74_37	frame_shift_del	DEL	0.000	-
ZIC2	7546	genome.wustl.edu	37	13	100635008	100635010	+	In_Frame_Del	DEL	CCA	CCA	-	rs375069774		TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	CCA	CCA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr13:100635008_100635010delCCA	ENST00000376335.3	+	1	983_985	c.690_692delCCA	c.(688-693)gcccac>gcc	p.H239del		NM_007129.3	NP_009060.2	O95409	ZIC2_HUMAN	Zic family member 2	239	Necessary for interaction with MDFIC and transcriptional activation or repression. {ECO:0000250}.|Poly-His.		H -> HH. {ECO:0000269|PubMed:15221788}.|Missing. {ECO:0000269|PubMed:15221788}.		brain development (GO:0007420)|developmental pigmentation (GO:0048066)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|retinal ganglion cell axon guidance (GO:0031290)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(2)|liver(2)|lung(5)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					CAGCCGCGGCccaccaccaccac	0.621																																					Pancreas(97;119 1522 31925 44771 48764)												0								ENSG00000043355																																			ZIC2	SO:0001651	inframe_deletion	0				HGNC	AF104902	CCDS9495.1	13q32	2013-01-08	2011-05-19		ENSG00000043355	ENSG00000043355		"""Zinc fingers, C2H2-type"""	12873	protein-coding gene	gene with protein product	"""Zinc finger protein of the cerebellum 2"""	603073	"""Zic family member 2 (odd-paired Drosophila homolog)"", ""Zic family member 2 (odd-paired homolog, Drosophila)"""			9771712	Standard	NM_007129		Approved	HPE5	uc001von.3	O95409	OTTHUMG00000017279	ENST00000376335.3:c.690_692delCCA	13.37:g.100635017_100635019delCCA	ENSP00000365514:p.His239del	Somatic	0	53	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	14	17.65	Q5VYA9|Q9H309	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.H234in_frame_del	ENST00000376335.3	37	c.690_692	CCDS9495.1	13																																																																																			-	NULL		0.621	ZIC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZIC2	protein_coding	OTTHUMT00000045618.2	CCA	NM_007129			100635010	+1	no_errors	ENST00000376335	ensembl	human	known	74_37	in_frame_del	DEL	0.990:0.999:1.000	-
FAM98C	147965	genome.wustl.edu	37	19	38899502	38899504	+	In_Frame_Del	DEL	AAG	AAG	-	rs372349446		TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	AAG	AAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr19:38899502_38899504delAAG	ENST00000252530.5	+	8	1049_1051	c.1030_1032delAAG	c.(1030-1032)aagdel	p.K349del	FAM98C_ENST00000588262.1_3'UTR|FAM98C_ENST00000343358.7_In_Frame_Del_p.K267del	NM_174905.3	NP_777565.3	Q17RN3	FA98C_HUMAN	family with sequence similarity 98, member C	349										endometrium(2)|large_intestine(3)|lung(6)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	15	all_cancers(60;3.95e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			TTGGGGTCGCAAGAAGAAGAAGA	0.606																																																	0								ENSG00000130244			414,186,2888		21,2,370,1,182,1168						-2.6	0.1		dbSNP_134	37	186,506,7042		7,0,172,3,500,3185	no	codingComplex	FAM98C	NM_174905.3		28,2,542,4,682,4353	A1A1,A1A2,A1R,A2A2,A2R,RR		8.9475,17.2018,11.5131				600,692,9930				FAM98C	SO:0001651	inframe_deletion	0				HGNC		CCDS42562.1	19q13.2	2008-02-05				ENSG00000130244			27119	protein-coding gene	gene with protein product						12477932	Standard	NM_174905		Approved	FLJ44669	uc002oin.1	Q17RN3		ENST00000252530.5:c.1030_1032delAAG	19.37:g.38899511_38899513delAAG	ENSP00000252530:p.Lys349del	Somatic	0	71	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	35	14.63	A6NMW3|Q66K45	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Uncharacterised_FAM98	p.K347in_frame_del	ENST00000252530.5	37	c.1030_1032	CCDS42562.1	19																																																																																			-	NULL		0.606	FAM98C-001	KNOWN	basic|CCDS	protein_coding	FAM98C	protein_coding	OTTHUMT00000459222.1	AAG	NM_174905			38899504	+1	no_errors	ENST00000252530	ensembl	human	known	74_37	in_frame_del	DEL	0.830:0.873:0.987	-
TRIO	7204	genome.wustl.edu	37	5	14465697	14465697	+	Missense_Mutation	SNP	C	C	T			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr5:14465697C>T	ENST00000344204.4	+	37	5735	c.5711C>T	c.(5710-5712)cCg>cTg	p.P1904L	TRIO_ENST00000537187.1_Missense_Mutation_p.P1904L|TRIO_ENST00000515710.1_3'UTR	NM_007118.2	NP_009049.2	O75962	TRIO_HUMAN	trio Rho guanine nucleotide exchange factor	1904					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cytosol (GO:0005829)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(2)|breast(6)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(21)|lung(34)|ovary(4)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	118	Lung NSC(4;0.000742)					TCCGAAACACCGAGTGCAGCC	0.522																																																	0								ENSG00000038382						80.0	77.0	78.0					5																	14465697		2203	4300	6503	TRIO	SO:0001583	missense	0			-	HGNC	AF091395	CCDS3883.1	5p14-p15.1	2013-01-11	2012-07-12		ENSG00000038382	ENSG00000038382		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"""	12303	protein-coding gene	gene with protein product		601893	"""triple functional domain (PTPRF interacting)"""			8643598	Standard	NM_007118		Approved	ARHGEF23	uc003jff.3	O75962	OTTHUMG00000131057	ENST00000344204.4:c.5711C>T	5.37:g.14465697C>T	ENSP00000339299:p.Pro1904Leu	Somatic	0	67	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	31	11.43	D3DTD1|Q13458|Q59EQ7|Q6PJC9|Q6ZN05|Q8IWK8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DH-domain,pfam_Prot_kinase_dom,pfam_Spectrin_repeat,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ig_I-set,pfam_SH3_domain,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_SH3_domain,superfamily_CRAL-TRIO_dom,superfamily_Capsid/spike_ssDNA_virus,smart_CRAL-TRIO_dom,smart_Spectrin/alpha-actinin,smart_DH-domain,smart_Pleckstrin_homology,smart_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_CRAL-TRIO_dom,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,pfscan_DH-domain	p.P1904L	ENST00000344204.4	37	c.5711	CCDS3883.1	5	.	.	.	.	.	.	.	.	.	.	C	20.3	3.962390	0.74016	.	.	ENSG00000038382	ENST00000344204;ENST00000537187;ENST00000513206	T;T	0.65916	-0.18;-0.14	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.78323	0.4265	L	0.59436	1.845	0.80722	D	1	D;D;D	0.89917	1.0;0.991;1.0	D;P;D	0.87578	0.998;0.688;0.998	T	0.77960	-0.2391	10	0.66056	D	0.02	.	20.2985	0.98592	0.0:1.0:0.0:0.0	.	1904;1904;1904	D3DTD2;O75962-5;O75962	.;.;TRIO_HUMAN	L	1904;1904;1591	ENSP00000339299:P1904L;ENSP00000446348:P1904L	ENSP00000339299:P1904L	P	+	2	0	TRIO	14518697	1.000000	0.71417	0.598000	0.28837	0.861000	0.49209	7.487000	0.81328	2.793000	0.96121	0.655000	0.94253	CCG	-	NULL		0.522	TRIO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIO	protein_coding	OTTHUMT00000253711.2	C	NM_007118	-		14465697	+1	no_errors	ENST00000344204	ensembl	human	known	74_37	missense	SNP	1.000	T
VCAN	1462	genome.wustl.edu	37	5	82837721	82837721	+	Nonsense_Mutation	SNP	G	G	T			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr5:82837721G>T	ENST00000265077.3	+	8	9464	c.8899G>T	c.(8899-8901)Gaa>Taa	p.E2967*	VCAN-AS1_ENST00000513899.1_RNA|VCAN_ENST00000513016.1_3'UTR|VCAN-AS1_ENST00000512090.1_RNA|VCAN_ENST00000502527.2_Intron|VCAN_ENST00000342785.4_Intron|VCAN_ENST00000512590.2_Intron|VCAN_ENST00000343200.5_Nonsense_Mutation_p.E1980*	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	2967	GAG-beta.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)	p.E2967*(1)		NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	CGATGAAATTGAATTAGAAGG	0.468																																																	1	Substitution - Nonsense(1)	lung(1)						ENSG00000038427						72.0	75.0	74.0					5																	82837721		2203	4300	6503	VCAN	SO:0001587	stop_gained	0			-	HGNC	X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.8899G>T	5.37:g.82837721G>T	ENSP00000265077:p.Glu2967*	Somatic	0	63	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	14	17.65	P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Link,pfam_C-type_lectin,pfam_Ig_V-set,pfam_EG-like_dom,pfam_Sushi_SCR_CCP,superfamily_C-type_lectin_fold,superfamily_Sushi_SCR_CCP,smart_Ig_sub,smart_Link,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_C-type_lectin,smart_Sushi_SCR_CCP,pfscan_EG-like_dom,pfscan_C-type_lectin,pfscan_Link,pfscan_Sushi_SCR_CCP,pfscan_Ig-like_dom,prints_Link	p.E2967*	ENST00000265077.3	37	c.8899	CCDS4060.1	5	.	.	.	.	.	.	.	.	.	.	G	51	18.565711	0.99907	.	.	ENSG00000038427	ENST00000265077;ENST00000343200	.	.	.	5.87	-4.05	0.03998	.	0.989663	0.08234	N	0.977035	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.06236	T	0.91	.	6.8903	0.24226	0.3435:0.335:0.3215:0.0	.	.	.	.	X	2967;1980	.	ENSP00000265077:E2967X	E	+	1	0	VCAN	82873477	0.000000	0.05858	0.000000	0.03702	0.022000	0.10575	-0.702000	0.05069	-0.701000	0.05063	-0.301000	0.09380	GAA	-	NULL		0.468	VCAN-001	KNOWN	basic|CCDS	protein_coding	VCAN	protein_coding	OTTHUMT00000254092.3	G	NM_004385	-		82837721	+1	no_errors	ENST00000265077	ensembl	human	known	74_37	nonsense	SNP	0.000	T
DIABLO	56616	genome.wustl.edu	37	12	122692318	122692318	+	3'UTR	SNP	G	G	A	rs546362213		TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr12:122692318G>A	ENST00000443649.3	-	0	2147				DIABLO_ENST00000464942.2_3'UTR|DIABLO_ENST00000413918.1_3'UTR|DIABLO_ENST00000353548.6_3'UTR|B3GNT4_ENST00000545141.1_3'UTR|B3GNT4_ENST00000546192.1_3'UTR	NM_019887.4	NP_063940.1	Q9NR28	DBLOH_HUMAN	diablo, IAP-binding mitochondrial protein						activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of cysteine-type endopeptidase activity involved in apoptotic process by cytochrome c (GO:0008635)|apoptotic process (GO:0006915)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|neuron apoptotic process (GO:0051402)|positive regulation of apoptotic process (GO:0043065)	CD40 receptor complex (GO:0035631)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)				breast(1)|endometrium(3)|large_intestine(1)|lung(1)|ovary(1)	7	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000302)|Epithelial(86;0.00051)|BRCA - Breast invasive adenocarcinoma(302;0.223)		CAAGAGGCCTGTGTTAAGTCC	0.428																																																	0								ENSG00000176383																																			B3GNT4	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AF262240	CCDS9228.1, CCDS9229.1, CCDS73541.1	12q24.31	2011-08-02	2011-03-11		ENSG00000184047	ENSG00000184047			21528	protein-coding gene	gene with protein product	"""second mitochondria-derived activator of caspase"""	605219				12749848, 17237824, 21722859	Standard	NM_019887		Approved	SMAC, DIABLO-S, FLJ25049, FLJ10537, DFNA64	uc010tab.2	Q9NR28	OTTHUMG00000157014	ENST00000443649.3:c.*610C>T	12.37:g.122692318G>A		Somatic	0	48	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52	B2RDQ0|Q6W3F3|Q96LV0|Q9BT11|Q9HAV6	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000443649.3	37	NULL	CCDS9228.1	12																																																																																			-	-		0.428	DIABLO-003	KNOWN	basic|appris_principal|CCDS	protein_coding	B3GNT4	protein_coding	OTTHUMT00000347102.2	G	NM_019887	-		122692318	+1	no_errors	ENST00000545141	ensembl	human	known	74_37	rna	SNP	0.002	A
MATN1	4146	genome.wustl.edu	37	1	31189153	31189155	+	In_Frame_Del	DEL	GCC	GCC	-			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	GCC	GCC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr1:31189153_31189155delGCC	ENST00000373765.4	-	5	843_845	c.808_810delGGC	c.(808-810)ggcdel	p.G270del	MATN1-AS1_ENST00000414532.2_RNA|MATN1-AS1_ENST00000454613.1_RNA|MATN1_ENST00000477320.1_5'UTR|MATN1-AS1_ENST00000414763.1_RNA	NM_002379.3	NP_002370.1	P21941	MATN1_HUMAN	matrilin 1, cartilage matrix protein	270	VWFA 2. {ECO:0000255|PROSITE- ProRule:PRU00219}.				extracellular matrix organization (GO:0030198)|growth plate cartilage chondrocyte morphogenesis (GO:0003429)|protein complex assembly (GO:0006461)|regulation of bone mineralization (GO:0030500)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)	12		Colorectal(325;0.00792)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)|Ovarian(437;0.0563)|Breast(348;0.0848)|Medulloblastoma(700;0.123)		Colorectal(126;1.29e-05)|COAD - Colon adenocarcinoma(152;0.000726)|STAD - Stomach adenocarcinoma(196;0.0183)|READ - Rectum adenocarcinoma(331;0.0649)		TGGCCGAGCTGCCACCACCACCA	0.562																																																	0								ENSG00000162510																																			MATN1	SO:0001651	inframe_deletion	0				HGNC	M55675	CCDS336.1	1p35	2008-02-05			ENSG00000162510	ENSG00000162510			6907	protein-coding gene	gene with protein product		115437		CRTM, CMP		2246248, 9083061	Standard	NM_002379		Approved		uc001brz.3	P21941	OTTHUMG00000003705	ENST00000373765.4:c.808_810delGGC	1.37:g.31189153_31189155delGCC	ENSP00000362870:p.Gly270del	Somatic	0	50	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	16	11.11	B2R7E3|Q5TBB9	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_VWF_A,pfam_Matrilin_coiled-coil_trimer,pfam_EGF-like_Ca-bd_dom,smart_VWF_A,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_VWF_A	p.G270in_frame_del	ENST00000373765.4	37	c.810_808	CCDS336.1	1																																																																																			-	NULL		0.562	MATN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MATN1	protein_coding	OTTHUMT00000010458.1	GCC	NM_002379			31189155	-1	no_errors	ENST00000373765	ensembl	human	known	74_37	in_frame_del	DEL	0.054:0.022:0.004	-
KCND3	3752	genome.wustl.edu	37	1	112533797	112533797	+	5'Flank	SNP	T	T	A			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr1:112533797T>A	ENST00000315987.2	-	0	0				KCND3_ENST00000302127.4_5'Flank|RP11-88H9.2_ENST00000438293.1_lincRNA	NM_004980.4	NP_004971.2	Q9UK17	KCND3_HUMAN	potassium voltage-gated channel, Shal-related subfamily, member 3						cell death (GO:0008219)|membrane repolarization (GO:0086009)|potassium ion export (GO:0071435)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	A-type (transient outward) potassium channel activity (GO:0005250)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(16)|lung(9)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	49		all_cancers(81;8.52e-06)|all_epithelial(167;5.65e-06)|all_lung(203;2.72e-05)|Lung NSC(69;4.56e-05)		all cancers(265;0.056)|Lung(183;0.0576)|Colorectal(144;0.1)|Epithelial(280;0.104)|COAD - Colon adenocarcinoma(174;0.222)|LUSC - Lung squamous cell carcinoma(189;0.231)	Amitriptyline(DB00321)|Dalfampridine(DB06637)|Disopyramide(DB00280)|Imipramine(DB00458)	ATCACATTTCTGGGTGTGGAG	0.607																																																	0								ENSG00000231437																																			RP11-88H9.2	SO:0001631	upstream_gene_variant	0			-	Clone_based_vega_gene	AF048713	CCDS843.1, CCDS844.1	1p13.2	2014-09-17			ENSG00000171385	ENSG00000171385		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6239	protein-coding gene	gene with protein product		605411	"""spinocerebellar ataxia 22"", ""spinocerebellar ataxia 19"""	SCA22, SCA19		10942109, 16382104, 23280837	Standard	NM_172198		Approved	Kv4.3, KSHIVB	uc001ebu.1	Q9UK17	OTTHUMG00000011989		1.37:g.112533797T>A	Exception_encountered	Somatic	0	51	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	26	13.33	O60576|O60577|Q14D71|Q5T0M0|Q9UH85|Q9UH86|Q9UK16	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000315987.2	37	NULL	CCDS843.1	1																																																																																			-	-		0.607	KCND3-001	KNOWN	basic|CCDS	protein_coding	ENSG00000231437	protein_coding	OTTHUMT00000033144.1	T	NM_172198	-		112533797	+1	no_errors	ENST00000438293	ensembl	human	known	74_37	rna	SNP	0.002	A
ZNF486	90649	genome.wustl.edu	37	19	20296806	20296806	+	Silent	SNP	C	C	G			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr19:20296806C>G	ENST00000335117.8	+	3	225	c.168C>G	c.(166-168)gtC>gtG	p.V56V	CTC-260E6.6_ENST00000593655.1_RNA|ZNF486_ENST00000597083.1_Silent_p.V56V|CTC-260E6.6_ENST00000586657.1_RNA|CTC-260E6.6_ENST00000585498.1_RNA	NM_052852.3	NP_443084.2	Q96H40	ZN486_HUMAN	zinc finger protein 486	56	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|large_intestine(3)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	11						GTATTATTGTCTCTAAGCCAG	0.363																																																	0								ENSG00000256229						68.0	71.0	70.0					19																	20296806		2166	4289	6455	ZNF486	SO:0001819	synonymous_variant	0			-	HGNC	BC008936	CCDS46029.1	19p12	2014-02-13	2003-12-16	2003-12-17	ENSG00000256229	ENSG00000256229		"""Zinc fingers, C2H2-type"", ""-"""	20807	protein-coding gene	gene with protein product			"""KRAB domain only 2"""	KRBO2			Standard	NM_052852		Approved	MGC2396	uc002nou.3	Q96H40	OTTHUMG00000179731	ENST00000335117.8:c.168C>G	19.37:g.20296806C>G		Somatic	0	93	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	36	16.28	Q0VG00	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.V56	ENST00000335117.8	37	c.168	CCDS46029.1	19																																																																																			-	superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box		0.363	ZNF486-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF486	protein_coding	OTTHUMT00000447843.2	C	NM_052852	-		20296806	+1	no_errors	ENST00000335117	ensembl	human	known	74_37	silent	SNP	0.087	G
VWA8	23078	genome.wustl.edu	37	13	42393355	42393355	+	Splice_Site	DEL	T	T	-			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr13:42393355delT	ENST00000379310.3	-	15	1936	c.1868delA	c.(1867-1869)aag>ag	p.K623fs	VWA8_ENST00000281496.6_Splice_Site_p.K623fs	NM_015058.1	NP_055873.1	A3KMH1	VWA8_HUMAN	von Willebrand factor A domain containing 8	623						extracellular region (GO:0005576)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)										TCTTCTTACCTTTTCCTTAAT	0.353																																																	0								ENSG00000102763						65.0	73.0	70.0					13																	42393355		2203	4300	6503	VWA8	SO:0001630	splice_region_variant	0				HGNC	AB011136	CCDS31963.1, CCDS41881.1	13q14.11	2013-11-18	2012-08-02	2012-08-02	ENSG00000102763	ENSG00000102763			29071	protein-coding gene	gene with protein product			"""KIAA0564"""	KIAA0564		9628581	Standard	NM_015058		Approved		uc001uyj.3	A3KMH1	OTTHUMG00000016799	ENST00000379310.3:c.1869+1A>-	13.37:g.42393355delT		Somatic	0	84	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	22	8.33	O60310|Q5JTP6|Q5VW08|Q7Z6I9|Q86YC9|Q8N3E4	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_ATPase_dyneun-rel_AAA,pfam_VWF_A,superfamily_P-loop_NTPase,smart_AAA+_ATPase,smart_VWF_A,pfscan_VWF_A	p.K623fs	ENST00000379310.3	37	c.1868	CCDS41881.1	13																																																																																			-	superfamily_P-loop_NTPase		0.353	VWA8-005	KNOWN	basic|appris_principal|CCDS	protein_coding	VWA8	protein_coding	OTTHUMT00000354828.2	T	NM_015058		Frame_Shift_Del	42393355	-1	no_errors	ENST00000379310	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
BANP	54971	genome.wustl.edu	37	16	88066823	88066823	+	Missense_Mutation	SNP	A	A	G			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr16:88066823A>G	ENST00000393207.1	+	9	1369	c.1148A>G	c.(1147-1149)cAg>cGg	p.Q383R	BANP_ENST00000538234.1_Missense_Mutation_p.Q391R|BANP_ENST00000355022.4_Missense_Mutation_p.Q352R|BANP_ENST00000286122.7_Missense_Mutation_p.Q383R|BANP_ENST00000393208.2_Missense_Mutation_p.Q352R|BANP_ENST00000355163.5_Missense_Mutation_p.Q358R|BANP_ENST00000479780.2_Missense_Mutation_p.Q352R	NM_001173543.1	NP_001167014.1	Q8N9N5	BANP_HUMAN	BTG3 associated nuclear protein	383	DNA-binding. {ECO:0000250}.|Gln-rich.				cell cycle (GO:0007049)|chromatin modification (GO:0016568)|multicellular organismal development (GO:0007275)|negative regulation of protein catabolic process (GO:0042177)|protein localization to nucleus (GO:0034504)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|endometrium(2)|large_intestine(3)|lung(5)|prostate(1)	12				BRCA - Breast invasive adenocarcinoma(80;0.00551)		CAGATCCACCAGATCGGAGAA	0.672																																																	0								ENSG00000172530						36.0	29.0	32.0					16																	88066823		2197	4300	6497	BANP	SO:0001583	missense	0			-	HGNC	AK094158	CCDS10966.2, CCDS42215.1, CCDS54052.1, CCDS54053.1, CCDS54054.1	16q24	2012-11-22			ENSG00000172530	ENSG00000172530		"""BEN domain containing"""	13450	protein-coding gene	gene with protein product	"""BEN domain containing 1"""	611564				10940556, 10950932	Standard	NM_017869		Approved	SMARBP1, SMAR1, FLJ20538, DKFZp761H172, FLJ10177, BEND1	uc010vow.2	Q8N9N5	OTTHUMG00000137678	ENST00000393207.1:c.1148A>G	16.37:g.88066823A>G	ENSP00000376902:p.Gln383Arg	Somatic	0	96	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	32	11.11	A8MU25|A8MX25|B2RCF7|B4DNJ9|F5GZM0|Q96GJ7|Q9NWY1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_BEN_domain	p.Q383R	ENST00000393207.1	37	c.1148	CCDS54054.1	16	.	.	.	.	.	.	.	.	.	.	A	9.254	1.041429	0.19669	.	.	ENSG00000172530	ENST00000286122;ENST00000355163;ENST00000289484;ENST00000479780;ENST00000393208;ENST00000540932;ENST00000355022;ENST00000538234;ENST00000393207	.	.	.	4.43	4.43	0.53597	.	0.061467	0.64402	D	0.000002	T	0.65428	0.2690	L	0.36672	1.1	0.40798	D	0.983316	D;D;B;D;B;B	0.60160	0.987;0.985;0.003;0.976;0.002;0.007	D;D;B;D;B;B	0.72625	0.953;0.978;0.002;0.943;0.005;0.013	T	0.67197	-0.5731	9	0.46703	T	0.11	.	13.1652	0.59567	1.0:0.0:0.0:0.0	.	391;358;352;383;352;352	B4DE54;B4DNJ9;B2RCF7;Q8N9N5;Q8N9N5-2;Q8N9N5-4	.;.;.;BANP_HUMAN;.;.	R	383;358;348;352;352;352;352;391;383	.	ENSP00000286122:Q383R	Q	+	2	0	BANP	86624324	1.000000	0.71417	1.000000	0.80357	0.797000	0.45037	5.851000	0.69481	1.770000	0.52166	0.254000	0.18369	CAG	-	NULL		0.672	BANP-002	KNOWN	basic|CCDS	protein_coding	BANP	protein_coding	OTTHUMT00000269166.1	A	NM_017869	-		88066823	+1	no_errors	ENST00000286122	ensembl	human	known	74_37	missense	SNP	1.000	G
LMNB2	84823	genome.wustl.edu	37	19	2435112	2435112	+	Silent	SNP	G	G	T			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr19:2435112G>T	ENST00000582871.1	-	5	768	c.682C>A	c.(682-684)Cgg>Agg	p.R228R	LMNB2_ENST00000325327.3_Silent_p.R248R	NM_032737.3	NP_116126.3	Q03252	LMNB2_HUMAN	lamin B2	228	Linker 2.|Rod.					lamin filament (GO:0005638)|nuclear inner membrane (GO:0005637)	structural molecule activity (GO:0005198)			NS(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	18		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TCCTGCTGCCGGCTGCTGTCC	0.692																																																	0								ENSG00000176619						37.0	40.0	39.0					19																	2435112		2202	4299	6501	LMNB2	SO:0001819	synonymous_variant	0			-	HGNC	M94362	CCDS12090.1, CCDS12090.2	19p13.3	2013-01-16			ENSG00000176619	ENSG00000176619		"""Intermediate filaments type V, lamins"""	6638	protein-coding gene	gene with protein product		150341		LMN2		1630457	Standard	NM_032737		Approved		uc002lvy.4	Q03252	OTTHUMG00000150626	ENST00000582871.1:c.682C>A	19.37:g.2435112G>T		Somatic	0	20	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	12	20.00	O75292|Q14734|Q96DF6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_IF,pfam_Lamin_tail_dom,superfamily_Prefoldin	p.R248	ENST00000582871.1	37	c.742		19																																																																																			-	pfam_IF		0.692	LMNB2-201	KNOWN	basic|appris_principal	protein_coding	LMNB2	protein_coding		G	NM_032737	-		2435112	-1	no_errors	ENST00000325327	ensembl	human	known	74_37	silent	SNP	1.000	T
SMAD3	4088	genome.wustl.edu	37	15	67358628	67358628	+	Missense_Mutation	SNP	G	G	T			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr15:67358628G>T	ENST00000327367.4	+	1	446	c.136G>T	c.(136-138)Ggg>Tgg	p.G46W		NM_005902.3	NP_005893.1	P84022	SMAD3_HUMAN	SMAD family member 3	46	MH1. {ECO:0000255|PROSITE- ProRule:PRU00438}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:0097296)|activin receptor signaling pathway (GO:0032924)|cell cycle arrest (GO:0007050)|cell-cell junction organization (GO:0045216)|developmental growth (GO:0048589)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic foregut morphogenesis (GO:0048617)|embryonic pattern specification (GO:0009880)|endoderm development (GO:0007492)|evasion or tolerance of host defenses by virus (GO:0019049)|extrinsic apoptotic signaling pathway (GO:0097191)|gene expression (GO:0010467)|heart looping (GO:0001947)|immune response (GO:0006955)|immune system development (GO:0002520)|in utero embryonic development (GO:0001701)|intracellular signal transduction (GO:0035556)|lens fiber cell differentiation (GO:0070306)|liver development (GO:0001889)|mesoderm formation (GO:0001707)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of inflammatory response (GO:0050728)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of osteoblast proliferation (GO:0033689)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of wound healing (GO:0061045)|nodal signaling pathway (GO:0038092)|osteoblast development (GO:0002076)|paraxial mesoderm morphogenesis (GO:0048340)|pericardium development (GO:0060039)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of bone mineralization (GO:0030501)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell migration (GO:0030335)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of gene expression (GO:0010628)|positive regulation of gene expression involved in extracellular matrix organization (GO:1901313)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta3 production (GO:0032916)|primary miRNA processing (GO:0031053)|protein stabilization (GO:0050821)|regulation of binding (GO:0051098)|regulation of epithelial cell proliferation (GO:0050678)|regulation of immune response (GO:0050776)|regulation of striated muscle tissue development (GO:0016202)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|signal transduction involved in regulation of gene expression (GO:0023019)|SMAD protein complex assembly (GO:0007183)|somitogenesis (GO:0001756)|T cell activation (GO:0042110)|thyroid gland development (GO:0030878)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transdifferentiation (GO:0060290)|transforming growth factor beta receptor signaling pathway (GO:0007179)|transport (GO:0006810)|ureteric bud development (GO:0001657)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nuclear inner membrane (GO:0005637)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|SMAD protein complex (GO:0071141)|SMAD2-SMAD3 protein complex (GO:0071144)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|bHLH transcription factor binding (GO:0043425)|chromatin DNA binding (GO:0031490)|co-SMAD binding (GO:0070410)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|double-stranded DNA binding (GO:0003690)|enhancer binding (GO:0035326)|phosphatase binding (GO:0019902)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor binding (GO:0005160)|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity (GO:0030618)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|large_intestine(11)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31				Colorectal(3;0.0129)|READ - Rectum adenocarcinoma(7;0.125)		CAAGAAGACGGGGCAGCTGGA	0.642																																																	0								ENSG00000166949						88.0	86.0	87.0					15																	67358628		2201	4298	6499	SMAD3	SO:0001583	missense	0			-	HGNC	BC050743	CCDS10222.1, CCDS45288.1, CCDS53950.1, CCDS53951.1	15q21-q22	2006-11-06	2006-11-06	2004-05-26	ENSG00000166949	ENSG00000166949		"""SMADs"""	6769	protein-coding gene	gene with protein product		603109	"""MAD, mothers against decapentaplegic homolog 3 (Drosophila)"", ""SMAD, mothers against DPP homolog 3 (Drosophila)"""	MADH3		8774881, 8673135	Standard	NM_001145102		Approved	JV15-2, HsT17436	uc002aqj.3	P84022	OTTHUMG00000133230	ENST00000327367.4:c.136G>T	15.37:g.67358628G>T	ENSP00000332973:p.Gly46Trp	Somatic	0	50	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	25	13.79	A8K4B6|B7Z4Z5|B7Z6M9|B7Z9Q2|F5H383|O09064|O09144|O14510|O35273|Q92940|Q93002|Q9GKR4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SMAD_dom_Dwarfin-type,pfam_MAD_homology1_Dwarfin-type,pfam_Interferon_reg_factor-3,superfamily_SMAD_FHA_domain,superfamily_MAD_homology_MH1,smart_MAD_homology1_Dwarfin-type,smart_SMAD_dom_Dwarfin-type,pfscan_MAD_homology_MH1,pfscan_SMAD_dom_Dwarfin-type	p.G46W	ENST00000327367.4	37	c.136	CCDS10222.1	15	.	.	.	.	.	.	.	.	.	.	G	24.3	4.512157	0.85389	.	.	ENSG00000166949	ENST00000327367;ENST00000535241	T	0.73047	-0.71	4.09	4.09	0.47781	MAD homology, MH1 (3);MAD homology 1, Dwarfin-type (2);	0.000000	0.85682	D	0.000000	D	0.85961	0.5819	M	0.91972	3.26	0.80722	D	1	D	0.58970	0.984	D	0.64237	0.923	D	0.89785	0.3964	10	0.87932	D	0	.	15.8154	0.78595	0.0:0.0:1.0:0.0	.	46	P84022	SMAD3_HUMAN	W	46	ENSP00000332973:G46W	ENSP00000332973:G46W	G	+	1	0	SMAD3	65145682	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.203000	0.95033	2.254000	0.74563	0.555000	0.69702	GGG	-	pfam_MAD_homology1_Dwarfin-type,superfamily_MAD_homology_MH1,smart_MAD_homology1_Dwarfin-type,pfscan_MAD_homology_MH1		0.642	SMAD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMAD3	protein_coding	OTTHUMT00000256967.2	G	NM_005902	-		67358628	+1	no_errors	ENST00000327367	ensembl	human	known	74_37	missense	SNP	1.000	T
TRAPPC11	60684	genome.wustl.edu	37	4	184618903	184618904	+	Frame_Shift_Ins	INS	-	-	A			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr4:184618903_184618904insA	ENST00000334690.6	+	25	2968_2969	c.2766_2767insA	c.(2767-2769)tggfs	p.W923fs	TRAPPC11_ENST00000357207.4_Frame_Shift_Ins_p.W923fs|TRAPPC11_ENST00000512476.1_Frame_Shift_Ins_p.W529fs	NM_021942.5	NP_068761.4	Q7Z392	TPC11_HUMAN	trafficking protein particle complex 11	923					vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)											GTGCCTCACCCTGGGCCCTCAC	0.495																																																	0								ENSG00000168538																																			TRAPPC11	SO:0001589	frameshift_variant	0				HGNC		CCDS34112.1, CCDS47166.1	4q35.1	2011-12-12	2011-12-12	2011-12-12	ENSG00000168538	ENSG00000168538		"""Trafficking protein particle complex"""	25751	protein-coding gene	gene with protein product	"""gryzun homolog (Drosophila)"", ""foie gras homolog (zebrafish)"""	614138	"""chromosome 4 open reading frame 41"""	C4orf41		19942856, 21525244	Standard	NM_021942		Approved	FLJ12716, gry, foigr	uc003ivx.3	Q7Z392	OTTHUMG00000160673	Exception_encountered	4.37:g.184618903_184618904insA	ENSP00000335371:p.Trp923fs	Somatic	0	47	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	14	12.50	A4QPB8|B2RCD6|Q5U5I7|Q6FI73|Q86T25|Q9H0L1|Q9H5K9|Q9H8Q1|Q9H9I7	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_Foie-gras_1,pfam_DUF1683_C	p.W922fs	ENST00000334690.6	37	c.2766_2767	CCDS34112.1	4																																																																																			-	NULL		0.495	TRAPPC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRAPPC11	protein_coding	OTTHUMT00000361654.2	-	NM_021942			184618904	+1	no_errors	ENST00000334690	ensembl	human	known	74_37	frame_shift_ins	INS	0.002:0.999	A
PCDHB16	57717	genome.wustl.edu	37	5	140562897	140562897	+	Missense_Mutation	SNP	A	A	G			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr5:140562897A>G	ENST00000361016.2	+	1	1918	c.763A>G	c.(763-765)Agt>Ggt	p.S255G		NM_020957.1	NP_066008.1	Q9NRJ7	PCDBG_HUMAN	protocadherin beta 16	255	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|endometrium(10)|kidney(3)|large_intestine(14)|lung(29)|ovary(5)|pancreas(2)|prostate(3)|skin(1)|urinary_tract(1)	69			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TCCAGAGAACAGTCCTCTTGG	0.507																																																	0								ENSG00000196963						74.0	72.0	73.0					5																	140562897		2203	4300	6503	PCDHB16	SO:0001583	missense	0			-	HGNC	AF217757	CCDS4251.1	5q31	2014-04-11			ENSG00000196963			"""Cadherins / Protocadherins : Clustered"""	14546	other	protocadherin	"""cadherin ME1"", ""protocadherin-3x"", ""PCDHbeta 16"""	606345				11230163, 11322959	Standard	NM_020957		Approved	PCDHB8a, PCDH3X, KIAA1621, PCDH-BETA16, ME1	uc003liv.3	Q9NRJ7	OTTHUMG00000188325	ENST00000361016.2:c.763A>G	5.37:g.140562897A>G	ENSP00000354293:p.Ser255Gly	Somatic	0	47	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	25	13.79	B3KPK5|Q8IYD5|Q96SE9|Q9HCF1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.S255G	ENST00000361016.2	37	c.763	CCDS4251.1	5	.	.	.	.	.	.	.	.	.	.	A	12.13	1.846547	0.32606	.	.	ENSG00000196963	ENST00000361016	T	0.01767	4.65	4.75	3.56	0.40772	Cadherin (4);Cadherin-like (1);	0.182510	0.26871	N	0.022079	T	0.07458	0.0188	M	0.86097	2.795	0.23653	N	0.997192	P	0.46020	0.871	P	0.54431	0.752	T	0.04781	-1.0927	10	0.46703	T	0.11	.	9.3871	0.38349	0.7159:0.0:0.0:0.2841	.	255	Q9NRJ7	PCDBG_HUMAN	G	255	ENSP00000354293:S255G	ENSP00000354293:S255G	S	+	1	0	PCDHB16	140543081	0.000000	0.05858	0.048000	0.18961	0.017000	0.09413	0.196000	0.17176	0.631000	0.30412	0.482000	0.46254	AGT	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin,prints_Cadherin		0.507	PCDHB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB16	protein_coding	OTTHUMT00000251800.1	A	NM_020957	-		140562897	+1	no_errors	ENST00000361016	ensembl	human	known	74_37	missense	SNP	0.820	G
GGTLC2	91227	genome.wustl.edu	37	22	22989254	22989254	+	Silent	SNP	C	C	T	rs138799771		TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr22:22989254C>T	ENST00000480559.1	+	2	207	c.207C>T	c.(205-207)agC>agT	p.S69S	POM121L1P_ENST00000402027.1_RNA|GGTLC2_ENST00000448514.1_Silent_p.S69S	NM_199127.2	NP_954578.2	Q14390	GGTL2_HUMAN	gamma-glutamyltransferase light chain 2	69					glutathione metabolic process (GO:0006749)|leukotriene biosynthetic process (GO:0019370)	anchored component of external side of plasma membrane (GO:0031362)|extracellular vesicular exosome (GO:0070062)	gamma-glutamyltransferase activity (GO:0003840)			endometrium(2)|large_intestine(1)|lung(1)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	11	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.3e-31)|Acute lymphoblastic leukemia(6;5.54e-23)		READ - Rectum adenocarcinoma(21;0.145)		CCCCGGTCAGCGAGATCCTGT	0.587																																																	0								ENSG00000100121	C		1,4405	2.1+/-5.4	0,1,2202	64.0	69.0	67.0		207		0.0	22	dbSNP_134	67	0,8592		0,0,4296	no	coding-synonymous	GGTLC2	NM_199127.2		0,1,6498	TT,TC,CC		0.0,0.0227,0.0077		69/219	22989254	1,12997	2203	4296	6499	GGTLC2	SO:0001819	synonymous_variant	0			-	HGNC	X98922	CCDS13802.2	22q11.21	2008-03-25	2008-03-10	2008-03-10	ENSG00000100121	ENSG00000100121		"""Gamma-glutamyltransferases"""	18596	protein-coding gene	gene with protein product		612339	"""gamma-glutamyltransferase-like 4"""	GGTL4		9074928, 18357469	Standard	NM_199127		Approved		uc010gtt.2	Q14390	OTTHUMG00000151177	ENST00000480559.1:c.207C>T	22.37:g.22989254C>T		Somatic	1	260	0.38		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	178	12.68	A1A516|A2VCM9|Q5NV76|Q6ISH0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GGT_peptidase,prints_GGT_peptidase	p.S69	ENST00000480559.1	37	c.207	CCDS13802.2	22																																																																																			-	pfam_GGT_peptidase,prints_GGT_peptidase		0.587	GGTLC2-001	KNOWN	basic|CCDS	protein_coding	GGTLC2	protein_coding	OTTHUMT00000321662.1	C	NM_199127	rs138799771		22989254	+1	no_errors	ENST00000448514	ensembl	human	known	74_37	silent	SNP	0.996	T
MOB1B	92597	genome.wustl.edu	37	4	71844995	71844995	+	Frame_Shift_Del	DEL	T	T	-			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr4:71844995delT	ENST00000309395.2	+	5	761	c.560delT	c.(559-561)attfs	p.I187fs	MOB1B_ENST00000396051.2_Frame_Shift_Del_p.I192fs|MOB1B_ENST00000511449.1_Intron	NM_001244766.1|NM_173468.3	NP_001231695.1|NP_775739.1	Q7L9L4	MOB1B_HUMAN	MOB kinase activator 1B	187					hippo signaling (GO:0035329)|positive regulation of phosphorylation (GO:0042327)|protein autophosphorylation (GO:0046777)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	kinase activator activity (GO:0019209)|kinase binding (GO:0019900)|metal ion binding (GO:0046872)										AAGCACTTTATTTTTTTTGTC	0.398																																																	0								ENSG00000173542						112.0	117.0	115.0					4																	71844995		2203	4300	6503	MOB1B	SO:0001589	frameshift_variant	0				HGNC	BC038112	CCDS34002.1, CCDS58903.1	4q13.3	2011-09-28	2011-09-28	2011-09-27	ENSG00000173542	ENSG00000173542		"""MOB kinase activators"""	29801	protein-coding gene	gene with protein product	"""Mob4A protein"""	609282	"""MOB1, Mps One Binder kinase activator-like 1A (yeast)"", ""MOB1 Mps One Binder homolog B (yeast)"""	MOBKL1A		15067004	Standard	NM_173468		Approved	MOB4A	uc003hfw.3	Q7L9L4	OTTHUMG00000160844	ENST00000309395.2:c.560delT	4.37:g.71844995delT	ENSP00000310189:p.Ile187fs	Somatic	0	65	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	19	13.64	B2R8U6|B4DRY3|Q8IY23	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Mob1_phocein,superfamily_Mob1_phocein	p.F189fs	ENST00000309395.2	37	c.560	CCDS34002.1	4																																																																																			-	pfam_Mob1_phocein,superfamily_Mob1_phocein		0.398	MOB1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MOB1B	protein_coding	OTTHUMT00000362634.1	T	NM_173468			71844995	+1	no_errors	ENST00000309395	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
LRRFIP2	9209	genome.wustl.edu	37	3	37190520	37190520	+	5'UTR	SNP	G	G	C			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr3:37190520G>C	ENST00000336686.4	-	0	35				LRRFIP2_ENST00000421307.1_5'UTR|LRRFIP2_ENST00000440230.1_5'UTR|LRRFIP2_ENST00000354379.4_5'UTR|LRRFIP2_ENST00000396428.2_5'UTR|LRRFIP2_ENST00000421276.2_5'UTR			Q9Y608	LRRF2_HUMAN	leucine rich repeat (in FLII) interacting protein 2						Wnt signaling pathway (GO:0016055)		LRR domain binding (GO:0030275)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(4)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	22						ATTTAACTGTGTTTTCAGCCC	0.328																																																	0								ENSG00000093167						49.0	47.0	48.0					3																	37190520		2202	4300	6502	LRRFIP2	SO:0001623	5_prime_UTR_variant	0			-	HGNC	AF115509	CCDS2664.1, CCDS2665.1, CCDS46791.1, CCDS63592.1	3p22.1	2008-07-18			ENSG00000093167	ENSG00000093167			6703	protein-coding gene	gene with protein product		614043				10366446	Standard	NM_017724		Approved	HUFI-2	uc003cgp.2	Q9Y608	OTTHUMG00000130796	ENST00000336686.4:c.-46C>G	3.37:g.37190520G>C		Somatic	0	55	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	23	14.81	A8K649|A8MXR0|B4DY63|Q68CV3|Q9NXH5	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000336686.4	37	NULL	CCDS2664.1	3																																																																																			-	-		0.328	LRRFIP2-001	KNOWN	basic|CCDS	protein_coding	LRRFIP2	protein_coding	OTTHUMT00000253335.3	G	NM_006309	-		37190520	-1	no_errors	ENST00000482466	ensembl	human	known	74_37	rna	SNP	0.003	C
LOC101927209	101927209	genome.wustl.edu	37	1	142716762	142716762	+	lincRNA	SNP	C	C	A			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr1:142716762C>A	ENST00000610091.1	-	0	282																											TATTTTTTCACTTTTGTTTGT	0.274																																																	0								ENSG00000203849																																			RP11-417J8.6			0			-	Clone_based_vega_gene																													1.37:g.142716762C>A		Somatic	0	67	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	20	31.03		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000610091.1	37	NULL		1																																																																																			-	-		0.274	RP11-417J8.6-001	KNOWN	basic	lincRNA	ENSG00000203849	lincRNA	OTTHUMT00000037265.2	C		-		142716762	-1	no_errors	ENST00000595144	ensembl	human	known	74_37	rna	SNP	0.007	A
VSTM4	196740	genome.wustl.edu	37	10	50285341	50285341	+	Missense_Mutation	SNP	C	C	T			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr10:50285341C>T	ENST00000332853.4	-	4	580	c.557G>A	c.(556-558)tGc>tAc	p.C186Y		NM_001031746.3	NP_001026916.2	Q8IW00	VSTM4_HUMAN	V-set and transmembrane domain containing 4	186						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(3)|kidney(1)|large_intestine(9)|liver(1)|lung(14)|skin(2)	31						GATCCCCACGCAGCACACGAG	0.522																																																	0								ENSG00000165633						128.0	100.0	110.0					10																	50285341		2203	4300	6503	VSTM4	SO:0001583	missense	0			-	HGNC	BC041414	CCDS7228.1, CCDS31198.1	10q11.23	2013-01-11	2011-07-01	2011-07-01	ENSG00000165633	ENSG00000165633		"""Immunoglobulin superfamily / V-set domain containing"""	26470	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 72"""	C10orf72			Standard	XR_246075		Approved	FLJ31737	uc001jhf.2	Q8IW00	OTTHUMG00000018184	ENST00000332853.4:c.557G>A	10.37:g.50285341C>T	ENSP00000331062:p.Cys186Tyr	Somatic	0	65	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	23	14.81	B4DNI6|Q96MX7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like_dom	p.C186Y	ENST00000332853.4	37	c.557	CCDS31198.1	10	.	.	.	.	.	.	.	.	.	.	C	16.97	3.269983	0.59540	.	.	ENSG00000165633	ENST00000332853	T	0.06687	3.27	5.3	5.3	0.74995	.	0.261225	0.37809	N	0.001928	T	0.17746	0.0426	L	0.47716	1.5	0.80722	D	1	D	0.65815	0.995	P	0.59221	0.854	T	0.00042	-1.2228	10	0.54805	T	0.06	-15.4913	12.0778	0.53653	0.0:0.8272:0.1728:0.0	.	186	Q8IW00	VSTM4_HUMAN	Y	186	ENSP00000331062:C186Y	ENSP00000331062:C186Y	C	-	2	0	VSTM4	49955347	0.991000	0.36638	0.967000	0.41034	0.746000	0.42486	2.906000	0.48735	2.758000	0.94735	0.655000	0.94253	TGC	-	NULL		0.522	VSTM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VSTM4	protein_coding	OTTHUMT00000047966.2	C	NM_144984	-		50285341	-1	no_errors	ENST00000332853	ensembl	human	known	74_37	missense	SNP	0.949	T
CCDC82	79780	genome.wustl.edu	37	11	96119421	96119421	+	5'UTR	SNP	A	A	T			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr11:96119421A>T	ENST00000278520.5	-	0	411				CCDC82_ENST00000542662.1_5'UTR|CCDC82_ENST00000525786.1_5'Flank|CCDC82_ENST00000423339.2_5'Flank			Q8N4S0	CCD82_HUMAN	coiled-coil domain containing 82											endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|lung(5)|ovary(1)|prostate(1)	19		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)		BRCA - Breast invasive adenocarcinoma(274;0.154)		atcttaccggactatgtttcc	0.328																																																	0								ENSG00000149231																																			CCDC82	SO:0001623	5_prime_UTR_variant	0			-	HGNC	AF245436	CCDS8307.1	11q21	2006-03-09			ENSG00000149231	ENSG00000149231			26282	protein-coding gene	gene with protein product						12477932	Standard	NM_024725		Approved	FLJ23518	uc001pfx.4	Q8N4S0	OTTHUMG00000167678	ENST00000278520.5:c.-18T>A	11.37:g.96119421A>T		Somatic	0	36	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	11	25.00	B3KPU7|Q8WV71|Q9H2Q5|Q9H5E3	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000278520.5	37	NULL	CCDS8307.1	11																																																																																			-	-		0.328	CCDC82-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC82	protein_coding	OTTHUMT00000395542.2	A	NM_024725	-		96119421	-1	no_errors	ENST00000524836	ensembl	human	known	74_37	rna	SNP	0.002	T
BMPR1A	657	genome.wustl.edu	37	10	88649943	88649943	+	Silent	SNP	A	A	G			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr10:88649943A>G	ENST00000372037.3	+	4	729	c.192A>G	c.(190-192)tcA>tcG	p.S64S	RNU1-19P_ENST00000363306.1_RNA	NM_004329.2	NP_004320.2	P36894	BMR1A_HUMAN	bone morphogenetic protein receptor, type IA	64					BMP signaling pathway (GO:0030509)|cartilage development (GO:0051216)|developmental growth (GO:0048589)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic digit morphogenesis (GO:0042733)|embryonic organ development (GO:0048568)|endocardial cushion formation (GO:0003272)|heart formation (GO:0060914)|hindlimb morphogenesis (GO:0035137)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|lateral mesoderm development (GO:0048368)|lung development (GO:0030324)|mesendoderm development (GO:0048382)|mesoderm formation (GO:0001707)|Mullerian duct regression (GO:0001880)|negative regulation of neurogenesis (GO:0050768)|neural crest cell development (GO:0014032)|neural plate mediolateral regionalization (GO:0021998)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|paraxial mesoderm structural organization (GO:0048352)|pituitary gland development (GO:0021983)|positive regulation of bone mineralization (GO:0030501)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of lateral mesodermal cell fate specification (GO:0048378)|somitogenesis (GO:0001756)|stem cell maintenance (GO:0019827)|transforming growth factor beta receptor signaling pathway (GO:0007179)	dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|SMAD binding (GO:0046332)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(12)|ovary(1)|skin(1)|stomach(1)	24						GCTATTGCTCAGGGCACTGTC	0.398			"""Mis, N, F"""			gastrointestinal polyps			Juvenile Polyposis;Hereditary Mixed Polyposis syndrome type 2																												Ovarian(190;603 2086 22044 30335 47971)		yes	Rec		Juvenile polyposis	10	10q22.3	657	"""bone morphogenetic protein receptor, type IA"""		E	0								ENSG00000107779						164.0	151.0	156.0					10																	88649943		2203	4300	6503	BMPR1A	SO:0001819	synonymous_variant	0	Familial Cancer Database	incl.: Juvenile Polyposis of the Stomach;HMPS2	-	HGNC	BC028383	CCDS7378.1	10q22.3	2014-09-17			ENSG00000107779	ENSG00000107779		"""CD molecules"""	1076	protein-coding gene	gene with protein product		601299		ACVRLK3		8397373, 9730621	Standard	NM_004329		Approved	ALK3, CD292	uc001kdy.3	P36894	OTTHUMG00000018657	ENST00000372037.3:c.192A>G	10.37:g.88649943A>G		Somatic	0	77	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	40	9.09	A8K6U9|Q8NEN8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_TGF_beta_rcpt_GS,pfam_Activin_rcpt,superfamily_Kinase-like_dom,smart_TGF_beta_rcpt_GS,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.S64	ENST00000372037.3	37	c.192	CCDS7378.1	10																																																																																			-	pfam_Activin_rcpt		0.398	BMPR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BMPR1A	protein_coding	OTTHUMT00000049170.3	A	NM_004329	-		88649943	+1	no_errors	ENST00000372037	ensembl	human	known	74_37	silent	SNP	1.000	G
MINK1	50488	genome.wustl.edu	37	17	4787752	4787752	+	Missense_Mutation	SNP	G	G	A			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr17:4787752G>A	ENST00000355280.6	+	5	597	c.401G>A	c.(400-402)tGc>tAc	p.C134Y	MINK1_ENST00000347992.7_Missense_Mutation_p.C134Y|MINK1_ENST00000453408.3_Missense_Mutation_p.C134Y|RN7SL784P_ENST00000577319.1_RNA	NM_001024937.3|NM_015716.4|NM_153827.4	NP_001020108.1|NP_056531.1|NP_722549.2			misshapen-like kinase 1											central_nervous_system(2)|large_intestine(1)|lung(1)|skin(1)|stomach(1)	6						GCCTATATCTGCAGGGAGATC	0.557																																																	0								ENSG00000141503						119.0	121.0	120.0					17																	4787752		2042	4190	6232	MINK1	SO:0001583	missense	0			-	HGNC	AY775058	CCDS45588.1, CCDS45589.1, CCDS45590.1	17p13.2	2011-04-14	2010-06-24		ENSG00000141503	ENSG00000141503			17565	protein-coding gene	gene with protein product	"""misshapen/NIK-related kinase"""	609426	"""misshapen-like kinase 1 (zebrafish)"""			10708748, 12087176	Standard	NM_015716		Approved	B55, MINK, ZC3, MAP4K6, YSK2	uc010vsl.2	Q8N4C8		ENST00000355280.6:c.401G>A	17.37:g.4787752G>A	ENSP00000347427:p.Cys134Tyr	Somatic	0	50	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	12	20.00		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Citron,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Citron,pfscan_Prot_kinase_dom	p.C134Y	ENST00000355280.6	37	c.401	CCDS45588.1	17	.	.	.	.	.	.	.	.	.	.	G	21.6	4.167928	0.78339	.	.	ENSG00000141503	ENST00000355280;ENST00000453408;ENST00000347992	T;T;T	0.64803	-0.12;-0.12;-0.12	4.87	4.87	0.63330	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.80444	0.4624	M	0.84326	2.69	0.80722	D	1	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.83275	0.994;0.994;0.996;0.994	D	0.83477	0.0062	10	0.87932	D	0	.	15.5494	0.76137	0.0:0.0:1.0:0.0	.	134;134;134;134	Q8N4C8-2;Q8N4C8-4;Q8N4C8;Q8N4C8-3	.;.;MINK1_HUMAN;.	Y	134	ENSP00000347427:C134Y;ENSP00000406487:C134Y;ENSP00000269296:C134Y	ENSP00000269296:C134Y	C	+	2	0	MINK1	4728535	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	3.958000	0.56737	2.555000	0.86185	0.455000	0.32223	TGC	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.557	MINK1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MINK1	protein_coding	OTTHUMT00000439801.1	G	NM_015716	-		4787752	+1	no_errors	ENST00000355280	ensembl	human	known	74_37	missense	SNP	1.000	A
ZNF347	84671	genome.wustl.edu	37	19	53643945	53643946	+	Frame_Shift_Ins	INS	-	-	T			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr19:53643945_53643946insT	ENST00000334197.7	-	5	2203_2204	c.2135_2136insA	c.(2134-2136)aatfs	p.N712fs	ZNF347_ENST00000601804.1_Intron|ZNF347_ENST00000601469.2_Frame_Shift_Ins_p.N713fs|ZNF347_ENST00000452676.2_Frame_Shift_Ins_p.N713fs	NM_032584.2	NP_115973.2	Q96SE7	ZN347_HUMAN	zinc finger protein 347	712					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(2)|large_intestine(6)|lung(8)|prostate(3)|skin(1)	23				GBM - Glioblastoma multiforme(134;0.0179)		TCCCACACTGATTACACTCATA	0.421																																					Melanoma(64;205 1597 17324 45721)												0								ENSG00000197937																																			ZNF347	SO:0001589	frameshift_variant	0				HGNC	AY029765	CCDS33097.1, CCDS54314.1	19q13.3	2013-01-08				ENSG00000197937		"""Zinc fingers, C2H2-type"", ""-"""	16447	protein-coding gene	gene with protein product							Standard	NM_032584		Approved	ZNF1111	uc010eql.2	Q96SE7		ENST00000334197.7:c.2136dupA	19.37:g.53643947_53643947dupT	ENSP00000334146:p.Asn712fs	Somatic	0	77	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	50	9.09	B3KU77|B9EG59|G5E9N4|Q8TCN1	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.N713fs	ENST00000334197.7	37	c.2139_2138	CCDS33097.1	19																																																																																			-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.421	ZNF347-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF347	protein_coding	OTTHUMT00000464170.1	-	NM_032584			53643946	-1	no_errors	ENST00000452676	ensembl	human	known	74_37	frame_shift_ins	INS	0.000:0.000	T
AMD1	262	genome.wustl.edu	37	6	111208730	111208730	+	Frame_Shift_Del	DEL	A	A	-			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr6:111208730delA	ENST00000368885.3	+	2	469	c.133delA	c.(133-135)aagfs	p.K45fs	AMD1_ENST00000451850.2_Intron|AMD1_ENST00000368882.3_Intron|AMD1_ENST00000368877.5_Intron|AMD1_ENST00000368876.1_5'UTR	NM_001634.4	NP_001625.2	P17707	DCAM_HUMAN	adenosylmethionine decarboxylase 1	45					cellular nitrogen compound metabolic process (GO:0034641)|polyamine metabolic process (GO:0006595)|S-adenosylmethioninamine biosynthetic process (GO:0006557)|small molecule metabolic process (GO:0044281)|spermidine biosynthetic process (GO:0008295)|spermine biosynthetic process (GO:0006597)	cytosol (GO:0005829)	adenosylmethionine decarboxylase activity (GO:0004014)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(2)	8		all_cancers(87;3.83e-05)|Acute lymphoblastic leukemia(125;2.13e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.00225)|Colorectal(196;0.0209)		OV - Ovarian serous cystadenocarcinoma(136;0.0522)|Epithelial(106;0.111)|all cancers(137;0.143)	S-Adenosylmethionine(DB00118)	CATACTTTTGAAGGATGTGCA	0.343																																																	0								ENSG00000123505						177.0	173.0	174.0					6																	111208730		2203	4300	6503	AMD1	SO:0001589	frameshift_variant	0				HGNC	M88006	CCDS5086.1, CCDS75504.1, CCDS75505.1	6q21	2014-05-13			ENSG00000123505	ENSG00000123505	4.1.1.50		457	protein-coding gene	gene with protein product		180980	"""S-adenosylmethionine decarboxylase 1"""				Standard	NM_001634		Approved	SAMDC	uc003puk.1	P17707	OTTHUMG00000015369	ENST00000368885.3:c.133delA	6.37:g.111208730delA	ENSP00000357880:p.Lys45fs	Somatic	0	72	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	14	12.50	E1P5F7|Q5VXN4|Q5VXN6|Q9BWK4	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_S-AdoMet_decarboxylase,superfamily_S-AdoMet_deCO2ase_core,pirsf_S-AdoMet_decarboxylase_subgr,tigrfam_S-AdoMet_decarboxylase_subgr	p.K45fs	ENST00000368885.3	37	c.133	CCDS5086.1	6																																																																																			-	pfam_S-AdoMet_decarboxylase,superfamily_S-AdoMet_deCO2ase_core,pirsf_S-AdoMet_decarboxylase_subgr,tigrfam_S-AdoMet_decarboxylase_subgr		0.343	AMD1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	AMD1	protein_coding	OTTHUMT00000041816.1	A				111208730	+1	no_errors	ENST00000368885	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
GP6	51206	genome.wustl.edu	37	19	55526104	55526107	+	3'UTR	DEL	CAGA	CAGA	-	rs375520233		TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	CAGA	CAGA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr19:55526104_55526107delCAGA	ENST00000417454.1	-	0	1229_1232				GP6_ENST00000310373.3_Frame_Shift_Del_p.CL402fs|CTC-550B14.7_ENST00000586845.1_RNA|CTC-550B14.7_ENST00000593060.1_RNA|GP6_ENST00000333884.2_3'UTR	NM_016363.4	NP_057447	Q9HCN6	GPVI_HUMAN	glycoprotein VI (platelet)						blood coagulation (GO:0007596)|enzyme linked receptor protein signaling pathway (GO:0007167)|leukocyte migration (GO:0050900)|platelet activation (GO:0030168)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|tetraspanin-enriched microdomain (GO:0097197)	collagen binding (GO:0005518)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			NS(2)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19			BRCA - Breast invasive adenocarcinoma(297;0.156)	GBM - Glioblastoma multiforme(193;0.0515)		gacagagaggcagacagacagaca	0.593																																																	0								ENSG00000088053		,	18,301,3753		5,0,8,23,255,1745					,	0.4	0.0		dbSNP_132	66	31,160,7921		2,0,27,6,148,3873	yes	utr-3,codingComplex	GP6	NM_016363.4,NM_001083899.1	,	7,0,35,29,403,5618	A1A1,A1A2,A1R,A2A2,A2R,RR		2.3545,7.834,4.1858	,	,		49,461,11674				GP6	SO:0001624	3_prime_UTR_variant	0				HGNC	AB035073	CCDS42626.1, CCDS46184.1, CCDS58678.1	19q13.4	2013-01-29			ENSG00000088053	ENSG00000088053		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14388	protein-coding gene	gene with protein product		605546				11027634	Standard	NM_001083899		Approved	GPVI	uc002qil.3	Q9HCN6	OTTHUMG00000159709	ENST00000417454.1:c.*185TCTG>-	19.37:g.55526112_55526115delCAGA		Somatic	0	42	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	18	14.29	Q9HCN7|Q9UIF2	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	smart_Ig_sub,smart_Ig_sub2	p.P404fs	ENST00000417454.1	37	c.1209_1206	CCDS46184.1	19																																																																																			-	NULL		0.593	GP6-001	KNOWN	basic|CCDS	protein_coding	GP6	protein_coding	OTTHUMT00000357006.1	CAGA				55526107	-1	no_errors	ENST00000310373	ensembl	human	known	74_37	frame_shift_del	DEL	0.009:0.011:0.014:0.015	-
HMGB3	3149	genome.wustl.edu	37	X	150156358	150156360	+	In_Frame_Del	DEL	GAG	GAG	-			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	GAG	GAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chrX:150156358_150156360delGAG	ENST00000325307.7	+	5	670_672	c.574_576delGAG	c.(574-576)gagdel	p.E198del	HMGB3_ENST00000448905.2_In_Frame_Del_p.E198del	NM_005342.2	NP_005333.2	O15347	HMGB3_HUMAN	high mobility group box 3	198	Asp/Glu-rich (acidic).				DNA recombination (GO:0006310)|multicellular organismal development (GO:0007275)	chromosome (GO:0005694)|nucleus (GO:0005634)	DNA binding, bending (GO:0008301)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)	p.E192E(1)		endometrium(3)|large_intestine(2)|lung(2)|skin(1)	8	Acute lymphoblastic leukemia(192;6.56e-05)					ggaggaagaagaggaggaggagg	0.443																																																	1	Substitution - coding silent(1)	large_intestine(1)						ENSG00000029993																																			HMGB3	SO:0001651	inframe_deletion	0				HGNC	AF274572	CCDS35428.1	Xq28	2011-07-01	2011-04-05	2002-08-16	ENSG00000029993	ENSG00000029993		"""High-mobility group / Canonical"""	5004	protein-coding gene	gene with protein product	"""non-histone chromosomal protein"""	300193	"""high-mobility group (nonhistone chromosomal) protein 4"", ""high-mobility group box 3"""	HMG4		9598312	Standard	XM_005274665		Approved	HMG2A, MGC90319	uc004fep.3	O15347	OTTHUMG00000024162	ENST00000325307.7:c.574_576delGAG	X.37:g.150156367_150156369delGAG	ENSP00000359393:p.Glu198del	Somatic	0	46	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	12	14.29	O95556|Q6NS40	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	p.E195in_frame_del	ENST00000325307.7	37	c.574_576	CCDS35428.1	X																																																																																			-	NULL		0.443	HMGB3-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	HMGB3	protein_coding	OTTHUMT00000060867.1	GAG	NM_005342			150156360	+1	no_errors	ENST00000325307	ensembl	human	known	74_37	in_frame_del	DEL	0.987:0.994:0.985	-
KMT2D	8085	genome.wustl.edu	37	12	49426727	49426727	+	Frame_Shift_Del	DEL	G	G	-			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr12:49426727delG	ENST00000301067.7	-	39	11760	c.11761delC	c.(11761-11763)caafs	p.Q3925fs	KMT2D_ENST00000549743.1_5'Flank	NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	3925	Gln-rich.				chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										tgttgctgttgtagctgctgc	0.542																																																	0								ENSG00000167548						14.0	16.0	15.0					12																	49426727		1801	3355	5156	KMT2D	SO:0001589	frameshift_variant	0				HGNC	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.11761delC	12.37:g.49426727delG	ENSP00000301067:p.Gln3925fs	Somatic	0	57	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	23	25.81	O14687	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_box_dom,smart_Znf_PHD,smart_Znf_RING,smart_HMG_box_dom,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.Q3921fs	ENST00000301067.7	37	c.11761	CCDS44873.1	12																																																																																			-	NULL		0.542	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KMT2D	protein_coding	OTTHUMT00000390183.2	G				49426727	-1	no_errors	ENST00000301067	ensembl	human	known	74_37	frame_shift_del	DEL	0.012	-
AOX1	316	genome.wustl.edu	37	2	201473949	201473949	+	Intron	DEL	A	A	-			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr2:201473949delA	ENST00000374700.2	+	11	1300					NM_001159.3	NP_001150.3	Q06278	AOXA_HUMAN	aldehyde oxidase 1						inflammatory response (GO:0006954)|reactive oxygen species metabolic process (GO:0072593)|small molecule metabolic process (GO:0044281)|vitamin B6 metabolic process (GO:0042816)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	2 iron, 2 sulfur cluster binding (GO:0051537)|aldehyde oxidase activity (GO:0004031)|electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|iron ion binding (GO:0005506)|molybdopterin cofactor binding (GO:0043546)|NAD binding (GO:0051287)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)|xanthine dehydrogenase activity (GO:0004854)			breast(5)|endometrium(3)|kidney(4)|large_intestine(13)|lung(38)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	81					Allopurinol(DB00437)|Aminocaproic Acid(DB00513)|Brimonidine(DB00484)|Famciclovir(DB00426)|Menadione(DB00170)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|Pyrazinamide(DB00339)|Raloxifene(DB00481)|Zaleplon(DB00962)|Zonisamide(DB00909)	TGGAACAGACAAAAAAAATAG	0.323																																																	0								ENSG00000138356																																			AOX1	SO:0001627	intron_variant	0				HGNC	AF017060	CCDS33360.1	2q33	2008-05-20			ENSG00000138356	ENSG00000138356			553	protein-coding gene	gene with protein product		602841				7570184	Standard	NM_001159		Approved	AO, AOH1	uc002uvx.3	Q06278	OTTHUMG00000154536	ENST00000374700.2:c.1059+91A>-	2.37:g.201473949delA		Somatic	0	43	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	24	11.11	O14765|Q53RR8|Q53TV3|Q9BYF0|Q9UPG6	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000374700.2	37	NULL	CCDS33360.1	2																																																																																			-	-		0.323	AOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AOX1	protein_coding	OTTHUMT00000335844.1	A	NM_001159			201473949	+1	no_errors	ENST00000465297	ensembl	human	known	74_37	rna	DEL	0.003	-
AP4B1	10717	genome.wustl.edu	37	1	114438788	114438788	+	Intron	SNP	C	C	T			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr1:114438788C>T	ENST00000369569.1	-	8	1791				AP4B1-AS1_ENST00000419536.1_RNA|AP4B1_ENST00000462591.1_Intron|AP4B1_ENST00000369567.1_Intron|AP4B1_ENST00000256658.4_Intron	NM_001253852.1	NP_001240781.1	Q9Y6B7	AP4B1_HUMAN	adaptor-related protein complex 4, beta 1 subunit						intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	clathrin adaptor complex (GO:0030131)|coated pit (GO:0005905)|trans-Golgi network (GO:0005802)	protein transporter activity (GO:0008565)|transporter activity (GO:0005215)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(9)|ovary(3)|prostate(3)	25	Lung SC(450;0.184)	all_cancers(81;4.5e-08)|all_epithelial(167;1.1e-07)|all_lung(203;1.53e-05)|Lung NSC(69;2.76e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		ATTTTCTTCTCGGGTCCCAGA	0.383																																																	0								ENSG00000134262																																			AP4B1	SO:0001627	intron_variant	0			-	HGNC	AF092094	CCDS865.1	1p13.2	2012-03-30			ENSG00000134262	ENSG00000134262			572	protein-coding gene	gene with protein product	"""beta 4 subunit of AP-4"""	607245	"""spastic paraplegia 47"""	SPG47		10066790	Standard	NM_006594		Approved	BETA-4	uc001eeb.3	Q9Y6B7	OTTHUMG00000011943	ENST00000369569.1:c.1510+91G>A	1.37:g.114438788C>T		Somatic	0	36	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	18	18.18	B7Z4X3|Q59EJ4|Q96CL6	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000369569.1	37	NULL	CCDS865.1	1																																																																																			-	-		0.383	AP4B1-009	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	AP4B1	protein_coding	OTTHUMT00000033037.1	C	NM_006594	-		114438788	-1	no_errors	ENST00000479285	ensembl	human	known	74_37	rna	SNP	0.000	T
PCDHGA1	56114	genome.wustl.edu	37	5	140711527	140711527	+	Missense_Mutation	SNP	G	G	T			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr5:140711527G>T	ENST00000517417.1	+	1	1276	c.1276G>T	c.(1276-1278)Gac>Tac	p.D426Y	AC005618.6_ENST00000606901.1_lincRNA|PCDHGA1_ENST00000378105.3_Missense_Mutation_p.D426Y	NM_018912.2	NP_061735.1	Q9Y5H4	PCDG1_HUMAN	protocadherin gamma subfamily A, 1	426	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|lung(32)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AACAGCAATAGACCAAGGAAC	0.393																																																	0								ENSG00000204956						110.0	106.0	107.0					5																	140711527		2203	4300	6503	PCDHGA1	SO:0001583	missense	0			-	HGNC	AF152318	CCDS54922.1	5q31	2010-01-26				ENSG00000204956		"""Cadherins / Protocadherins : Clustered"""	8696	other	protocadherin		606288				10380929	Standard	NM_018912		Approved	PCDH-GAMMA-A1		Q9Y5H4		ENST00000517417.1:c.1276G>T	5.37:g.140711527G>T	ENSP00000431083:p.Asp426Tyr	Somatic	0	46	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	15	21.05	Q2M273|Q9Y5D6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.D426Y	ENST00000517417.1	37	c.1276	CCDS54922.1	5	.	.	.	.	.	.	.	.	.	.	G	17.98	3.520246	0.64747	.	.	ENSG00000204956	ENST00000517417;ENST00000378105	T;T	0.68903	-0.36;-0.36	4.0	4.0	0.46444	Cadherin (4);Cadherin-like (1);	0.000000	0.49916	D	0.000140	D	0.89382	0.6699	H	0.99211	4.47	0.43426	D	0.995589	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.94086	0.7348	10	0.87932	D	0	.	16.2823	0.82697	0.0:0.0:1.0:0.0	.	426;426	Q9Y5H4-2;Q9Y5H4	.;PCDG1_HUMAN	Y	426	ENSP00000431083:D426Y;ENSP00000367345:D426Y	ENSP00000367345:D426Y	D	+	1	0	PCDHGA1	140691711	1.000000	0.71417	0.993000	0.49108	0.901000	0.52897	9.601000	0.98297	2.242000	0.73789	0.655000	0.94253	GAC	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.393	PCDHGA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDHGA1	protein_coding	OTTHUMT00000374737.1	G	NM_018912	-		140711527	+1	no_errors	ENST00000517417	ensembl	human	known	74_37	missense	SNP	0.995	T
FAM86B3P	286042	genome.wustl.edu	37	8	8098246	8098246	+	RNA	SNP	G	G	T			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr8:8098246G>T	ENST00000310542.3	+	0	356				ALG1L13P_ENST00000523017.1_RNA					family with sequence similarity 86, member B3, pseudogene																		CTCTAATATTGTTTctgggtg	0.542																																																	0								ENSG00000173295																																			FAM86B3P			0			-	HGNC			8p23.1	2013-06-10			ENSG00000173295	ENSG00000173295			44371	pseudogene	pseudogene							Standard	NR_024361		Approved		uc011kwt.2		OTTHUMG00000163669		8.37:g.8098246G>T		Somatic	0	76	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	29	21.62		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000310542.3	37	NULL		8	.	.	.	.	.	.	.	.	.	.	.	4.912	0.169469	0.09339	.	.	ENSG00000173295	ENST00000310542	.	.	.	1.01	1.01	0.19927	.	.	.	.	.	T	0.45836	0.1362	.	.	.	0.30974	N	0.7227589999999999	.	.	.	.	.	.	T	0.56275	-0.8006	4	0.87932	D	0	.	5.4085	0.16335	0.0:0.0:1.0:0.0	.	.	.	.	F	8	.	ENSP00000312142:L8F	L	+	3	2	AC068020.1	8135656	0.001000	0.12720	0.012000	0.15200	0.342000	0.28953	1.068000	0.30629	0.844000	0.35094	0.162000	0.16502	TTG	-	-		0.542	FAM86B3P-005	KNOWN	basic	processed_transcript	FAM86B3P	pseudogene	OTTHUMT00000448496.1	G		-		8098246	+1	no_errors	ENST00000310542	ensembl	human	known	74_37	rna	SNP	0.016	T
IL27	246778	genome.wustl.edu	37	16	28513296	28513296	+	Splice_Site	SNP	C	C	T			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr16:28513296C>T	ENST00000356897.1	-	4	485		c.e4+1			NM_145659.3	NP_663634.2	Q8TAD2	IL17D_HUMAN	interleukin 27						inflammatory response (GO:0006954)	extracellular space (GO:0005615)				endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)	10						CCGGGCTCTACCTGGAAGCGG	0.632																																																	0								ENSG00000197272						100.0	106.0	104.0					16																	28513296		2197	4300	6497	IL27	SO:0001630	splice_region_variant	0			-	HGNC	AY099296	CCDS10633.1	16p11	2011-07-21	2003-12-17	2003-12-19	ENSG00000197272	ENSG00000197272		"""Interleukins and interleukin receptors"""	19157	protein-coding gene	gene with protein product		608273	"""interleukin 30"""	IL30		12121660	Standard	NM_145659		Approved	IL-27, p28, IL27p28, IL-27A, IL27A, MGC71873	uc002dqc.3	Q8NEV9	OTTHUMG00000097023	ENST00000356897.1:c.462+1G>A	16.37:g.28513296C>T		Somatic	0	64	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	31	16.22	B1AM69	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e4+1	ENST00000356897.1	37	c.462+1	CCDS10633.1	16	.	.	.	.	.	.	.	.	.	.	C	9.384	1.073737	0.20147	.	.	ENSG00000197272	ENST00000356897	.	.	.	3.52	3.52	0.40303	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.4612	0.44581	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	IL27	28420797	1.000000	0.71417	0.981000	0.43875	0.147000	0.21601	3.215000	0.51169	1.811000	0.52892	0.281000	0.19383	.	-	-		0.632	IL27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL27	protein_coding	OTTHUMT00000214114.1	C	NM_145659	-	Intron	28513296	-1	no_errors	ENST00000356897	ensembl	human	known	74_37	splice_site	SNP	0.993	T
DTX3	196403	genome.wustl.edu	37	12	58002927	58002937	+	Stop_Codon_Del	DEL	GATGACTGAAG	GATGACTGAAG	-	rs543446533	byFrequency	TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	GATGACTGAAG	GATGACTGAAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr12:58002927_58002937delGATGACTGAAG	ENST00000548198.1	+	0	2540_2550				DTX3_ENST00000337737.3_Stop_Codon_Del|DTX3_ENST00000548804.1_Stop_Codon_Del|ARHGEF25_ENST00000286494.4_5'Flank|ARHGEF25_ENST00000333972.7_5'Flank|DTX3_ENST00000551632.1_Stop_Codon_Del|AC025165.8_ENST00000356672.3_RNA			Q8N9I9	DTX3_HUMAN	deltex 3, E3 ubiquitin ligase						Notch signaling pathway (GO:0007219)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|large_intestine(1)|lung(6)|urinary_tract(1)	12	Melanoma(17;0.122)					GGGTATCACAGATGACTGAAGGACATCGCCT	0.588																																																	0								ENSG00000178498																																			DTX3	SO:0001567	stop_retained_variant	0				HGNC	AK094385	CCDS41800.1, CCDS66410.1	12q13.2	2014-01-28	2014-01-28			ENSG00000178498		"""RING-type (C3HC4) zinc fingers"""	24457	protein-coding gene	gene with protein product		613142	"""deltex 3 homolog (Drosophila)"", ""deltex homolog 3 (Drosophila)"""			12670957	Standard	XM_005268697		Approved	FLJ34766, RNF154	uc001sow.1	Q8N9I9		Exception_encountered	12.37:g.58002927_58002937delGATGACTGAAG	ENSP00000447873:p.*348Serext*11	Somatic	NA	NA	NA		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q53ZZ2|Q8NAU6|Q8NDS8	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.DD*349in_frame_del	ENST00000548198.1	37	c.1045_1053	CCDS41800.1	12																																																																																			-	NULL		0.588	DTX3-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	DTX3	protein_coding	OTTHUMT00000407848.1	GATGACTGAAG	NM_178502			58002937	+1	no_errors	ENST00000551632	ensembl	human	known	74_37	in_frame_del	DEL	0.987:0.979:0.973:1.000:1.000:1.000:1.000:1.000:0.982	-
OGFR	11054	genome.wustl.edu	37	20	61441851	61441851	+	Splice_Site	SNP	G	G	A			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr20:61441851G>A	ENST00000290291.6	+	5	424	c.399G>A	c.(397-399)tgG>tgA	p.W133*	OGFR_ENST00000370461.1_Splice_Site_p.W81*	NM_007346.2	NP_031372.2	Q9NZT2	OGFR_HUMAN	opioid growth factor receptor	133					opioid receptor signaling pathway (GO:0038003)|regulation of cell growth (GO:0001558)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	opioid receptor activity (GO:0004985)			endometrium(2)|kidney(1)|lung(4)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)	17	Breast(26;3.65e-08)					TCTCCTGCAGGCTGTTTCCTC	0.617																																																	0								ENSG00000060491						93.0	93.0	93.0					20																	61441851		2203	4300	6503	OGFR	SO:0001630	splice_region_variant	0			-	HGNC	AF109134	CCDS13504.1	20q13.3	2008-05-02			ENSG00000060491	ENSG00000060491			15768	protein-coding gene	gene with protein product		606459				10677613	Standard	NM_007346		Approved	7-60	uc002ydj.3	Q9NZT2	OTTHUMG00000032937	ENST00000290291.6:c.399-1G>A	20.37:g.61441851G>A		Somatic	1	100	0.99		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	39	9.30	O96029|Q4VXW5|Q96CM2|Q9BQW1|Q9H4H0|Q9H7J5|Q9NZT3|Q9NZT4	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_OGF_rcpt,pfam_OGF_rcpt_rpt	p.W133*	ENST00000290291.6	37	c.399	CCDS13504.1	20	.	.	.	.	.	.	.	.	.	.	G	34	5.322565	0.95708	.	.	ENSG00000060491	ENST00000290291;ENST00000370468;ENST00000357163;ENST00000370461;ENST00000450048	.	.	.	4.86	4.86	0.63082	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.5964	0.88013	0.0:0.0:1.0:0.0	.	.	.	.	X	133;133;133;81;74	.	.	W	+	3	0	OGFR	60912296	1.000000	0.71417	1.000000	0.80357	0.660000	0.38997	8.965000	0.93393	2.251000	0.74343	0.561000	0.74099	TGG	-	pfam_OGF_rcpt		0.617	OGFR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OGFR	protein_coding	OTTHUMT00000080067.1	G		-	Nonsense_Mutation	61441851	+1	no_errors	ENST00000290291	ensembl	human	known	74_37	nonsense	SNP	1.000	A
KLC2	64837	genome.wustl.edu	37	11	66031619	66031619	+	Missense_Mutation	SNP	C	C	T			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr11:66031619C>T	ENST00000417856.1	+	8	1288	c.1045C>T	c.(1045-1047)Cgg>Tgg	p.R349W	KLC2_ENST00000421552.1_Missense_Mutation_p.R272W|KLC2_ENST00000394066.2_Missense_Mutation_p.R272W|KLC2_ENST00000394067.2_Missense_Mutation_p.R349W|KLC2_ENST00000394078.1_Intron|KLC2_ENST00000316924.5_Missense_Mutation_p.R349W|RP11-867G23.1_ENST00000530805.1_RNA|KLC2_ENST00000394065.2_Missense_Mutation_p.R210W|RP11-755F10.3_ENST00000533576.1_RNA	NM_001134775.1	NP_001128247.1	Q9H0B6	KLC2_HUMAN	kinesin light chain 2	349					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon cargo transport (GO:0008088)|blood coagulation (GO:0007596)|microtubule-based movement (GO:0007018)	ciliary rootlet (GO:0035253)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinesin I complex (GO:0016938)|membrane (GO:0016020)|microtubule (GO:0005874)|neuron projection (GO:0043005)|protein complex (GO:0043234)	kinesin binding (GO:0019894)|microtubule motor activity (GO:0003777)			breast(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(3)|prostate(5)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	24						TTACTATCGGCGGGCACTGGA	0.587																																																	0								ENSG00000174996						27.0	23.0	24.0					11																	66031619		2200	4293	6493	KLC2	SO:0001583	missense	0			-	HGNC	AK022449	CCDS8130.1, CCDS44653.1	11q13.1	2013-01-10			ENSG00000174996	ENSG00000174996		"""Tetratricopeptide (TTC) repeat domain containing"""	20716	protein-coding gene	gene with protein product		611729				9624122	Standard	NM_022822		Approved	FLJ12387	uc001ohb.2	Q9H0B6	OTTHUMG00000133757	ENST00000417856.1:c.1045C>T	11.37:g.66031619C>T	ENSP00000399403:p.Arg349Trp	Somatic	0	28	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	16	15.79	A8MXL7|B2RDY4|Q9H9C8|Q9HA20	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Rabaptin_Rab5-bd_dom,pfam_TPR_1,smart_TPR_repeat,prints_Kinesin_light,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.R349W	ENST00000417856.1	37	c.1045	CCDS8130.1	11	.	.	.	.	.	.	.	.	.	.	C	14.52	2.558884	0.45590	.	.	ENSG00000174996	ENST00000417856;ENST00000394067;ENST00000316924;ENST00000421552;ENST00000394066;ENST00000394065	D;D;D;D;D;D	0.95035	-3.59;-3.59;-3.59;-3.59;-3.59;-3.59	4.23	1.11	0.20524	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.084816	0.47852	D	0.000210	D	0.97595	0.9212	H	0.94423	3.535	0.53005	D	0.999961	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.967;0.93;1.0	D	0.97160	0.9837	10	0.87932	D	0	-24.5033	12.019	0.53331	0.614:0.386:0.0:0.0	.	210;272;349	A8MZ87;A8MXL7;Q9H0B6	.;.;KLC2_HUMAN	W	349;349;349;272;272;210	ENSP00000399403:R349W;ENSP00000377631:R349W;ENSP00000314837:R349W;ENSP00000408484:R272W;ENSP00000377630:R272W;ENSP00000377629:R210W	ENSP00000314837:R349W	R	+	1	2	KLC2	65788195	0.983000	0.35010	0.997000	0.53966	0.120000	0.20174	0.474000	0.22148	0.049000	0.15920	0.555000	0.69702	CGG	-	smart_TPR_repeat,pfscan_TPR-contain_dom		0.587	KLC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	KLC2	protein_coding	OTTHUMT00000258200.1	C	NM_022822	-		66031619	+1	no_errors	ENST00000316924	ensembl	human	known	74_37	missense	SNP	1.000	T
TYR	7299	genome.wustl.edu	37	11	88911205	88911205	+	Missense_Mutation	SNP	G	G	C			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr11:88911205G>C	ENST00000263321.5	+	1	586	c.84G>C	c.(82-84)aaG>aaC	p.K28N	TYR_ENST00000526139.1_3'UTR	NM_000372.4	NP_000363.1	P14679	TYRO_HUMAN	tyrosinase	28					cell proliferation (GO:0008283)|eye pigment biosynthetic process (GO:0006726)|melanin biosynthetic process from tyrosine (GO:0006583)|thymus development (GO:0048538)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|Golgi-associated vesicle (GO:0005798)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|melanosome (GO:0042470)|perinuclear region of cytoplasm (GO:0048471)	copper ion binding (GO:0005507)|monophenol monooxygenase activity (GO:0004503)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(25)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	48		Acute lymphoblastic leukemia(157;2.33e-05)|all_hematologic(158;0.0033)			Azelaic Acid(DB00548)|Mimosine(DB01055)|Monobenzone(DB00600)	TCTCCTCTAAGAACCTGATGG	0.547																																																	0								ENSG00000077498						77.0	76.0	76.0					11																	88911205		2201	4299	6500	TYR	SO:0001583	missense	0			-	HGNC	M27160	CCDS8284.1	11q14.3	2013-09-27	2012-09-28		ENSG00000077498	ENSG00000077498	1.14.18.1		12442	protein-coding gene	gene with protein product	"""oculocutaneous albinism IA"""	606933					Standard	NM_000372		Approved	OCAIA, OCA1A, OCA1	uc001pcs.3	P14679	OTTHUMG00000167294	ENST00000263321.5:c.84G>C	11.37:g.88911205G>C	ENSP00000263321:p.Lys28Asn	Somatic	0	45	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	14	30.00	Q15675|Q15676|Q15680|Q8TAK4|Q9BYY0|Q9BZX1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Tyrosinase,superfamily_Unchr_di-copper_centre,prints_Tyrosinase	p.K28N	ENST00000263321.5	37	c.84	CCDS8284.1	11	.	.	.	.	.	.	.	.	.	.	G	15.01	2.706895	0.48412	.	.	ENSG00000077498	ENST00000263321	D	0.99136	-5.47	6.07	6.07	0.98685	.	0.414174	0.29964	N	0.010741	D	0.97801	0.9278	L	0.57536	1.79	0.38986	D	0.959057	B	0.27932	0.194	B	0.28991	0.097	D	0.97314	0.9939	9	.	.	.	.	16.8564	0.86007	0.0:0.1281:0.8719:0.0	.	28	P14679	TYRO_HUMAN	N	28	ENSP00000263321:K28N	.	K	+	3	2	TYR	88550853	1.000000	0.71417	0.976000	0.42696	0.775000	0.43874	1.193000	0.32162	2.885000	0.99019	0.655000	0.94253	AAG	-	NULL		0.547	TYR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TYR	protein_coding	OTTHUMT00000394045.2	G	NM_000372	-		88911205	+1	no_errors	ENST00000263321	ensembl	human	known	74_37	missense	SNP	0.999	C
UQCRC2	7385	genome.wustl.edu	37	16	21973817	21973817	+	Silent	SNP	G	G	T			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr16:21973817G>T	ENST00000268379.4	+	5	1133	c.369G>T	c.(367-369)gtG>gtT	p.V123V	UQCRC2_ENST00000561553.1_Silent_p.V123V	NM_003366.2	NP_003357.2	P22695	QCR2_HUMAN	ubiquinol-cytochrome c reductase core protein II	123					aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			breast(1)|cervix(1)|endometrium(2)|large_intestine(5)|lung(4)|prostate(1)|skin(1)	15				GBM - Glioblastoma multiforme(48;0.0264)		CTTATACTGTGGAATGCCTGC	0.408																																					Colon(123;450 1645 12841 25393 45623)												0								ENSG00000140740						235.0	204.0	215.0					16																	21973817		2198	4300	6498	UQCRC2	SO:0001819	synonymous_variant	0			-	HGNC	J04973	CCDS10601.1	16p12	2011-07-04			ENSG00000140740	ENSG00000140740	1.10.2.2	"""Mitochondrial respiratory chain complex / Complex III"""	12586	protein-coding gene	gene with protein product		191329				8288258, 2547763	Standard	NM_003366		Approved	QCR2, UQCR2	uc002djx.3	P22695	OTTHUMG00000131585	ENST00000268379.4:c.369G>T	16.37:g.21973817G>T		Somatic	0	95	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00	B3KSN4|Q9BQ05	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Pept_M16_N,pfam_Peptidase_M16_C,superfamily_Metalloenz_LuxS/M16	p.V123	ENST00000268379.4	37	c.369	CCDS10601.1	16																																																																																			-	pfam_Pept_M16_N,superfamily_Metalloenz_LuxS/M16		0.408	UQCRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UQCRC2	protein_coding	OTTHUMT00000254466.1	G	NM_003366	-		21973817	+1	no_errors	ENST00000268379	ensembl	human	known	74_37	silent	SNP	0.987	T
MAP4	4134	genome.wustl.edu	37	3	47958559	47958559	+	Missense_Mutation	SNP	G	G	T			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr3:47958559G>T	ENST00000360240.6	-	7	1276	c.758C>A	c.(757-759)tCt>tAt	p.S253Y	MAP4_ENST00000395734.3_Missense_Mutation_p.S253Y|MAP4_ENST00000426837.2_Missense_Mutation_p.S270Y|MAP4_ENST00000383737.4_Missense_Mutation_p.S253Y	NM_002375.4	NP_002366.2	P27816	MAP4_HUMAN	microtubule-associated protein 4	253	17 X 14 AA tandem repeats.				cell division (GO:0051301)|establishment of spindle orientation (GO:0051294)|microtubule sliding (GO:0051012)|mitotic spindle organization (GO:0007052)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|microtubule cytoskeleton (GO:0015630)|mitotic spindle (GO:0072686)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(10)|ovary(2)|pancreas(1)|skin(2)	32				BRCA - Breast invasive adenocarcinoma(193;0.000721)|KIRC - Kidney renal clear cell carcinoma(197;0.00641)|Kidney(197;0.00736)	Docetaxel(DB01248)|Paclitaxel(DB01229)	TGTTTCTTTAGATGGTGCCAT	0.463																																																	0								ENSG00000047849						329.0	285.0	300.0					3																	47958559		2203	4300	6503	MAP4	SO:0001583	missense	0			-	HGNC		CCDS33750.1, CCDS46818.1, CCDS46821.1	3p21	2008-07-18			ENSG00000047849	ENSG00000047849			6862	protein-coding gene	gene with protein product		157132				1905296	Standard	NM_002375		Approved		uc003csb.2	P27816	OTTHUMG00000156828	ENST00000360240.6:c.758C>A	3.37:g.47958559G>T	ENSP00000353375:p.Ser253Tyr	Somatic	0	57	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	20	13.04	Q13082|Q59FT2|Q68D74|Q6ZUW9|Q86V26|Q96A76|Q96NS9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MAP_tubulin-bd_rpt	p.S253Y	ENST00000360240.6	37	c.758	CCDS33750.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.88|12.88	2.069822|2.069822	0.36566|0.36566	.|.	.|.	ENSG00000047849|ENSG00000047849	ENST00000423088|ENST00000383737;ENST00000395734;ENST00000426837;ENST00000360240	.|T;T;T;T	.|0.12147	.|2.71;3.0;3.0;2.99	4.57|4.57	1.78|1.78	0.24846|0.24846	.|.	.|.	.|.	.|.	.|.	T|T	0.18923|0.18923	0.0454|0.0454	L|L	0.54323|0.54323	1.7|1.7	0.09310|0.09310	N|N	1|1	.|D;P;P	.|0.53885	.|0.963;0.85;0.951	.|P;B;P	.|0.50617	.|0.646;0.325;0.59	T|T	0.09509|0.09509	-1.0671|-1.0671	5|9	.|0.59425	.|D	.|0.04	-0.1366|-0.1366	6.4916|6.4916	0.22119|0.22119	0.3084:0.0:0.6916:0.0|0.3084:0.0:0.6916:0.0	.|.	.|230;253;253	.|C9JFC3;P27816-6;P27816	.|.;.;MAP4_HUMAN	I|Y	222|253;253;270;253	.|ENSP00000373243:S253Y;ENSP00000379083:S253Y;ENSP00000407602:S270Y;ENSP00000353375:S253Y	.|ENSP00000353375:S253Y	L|S	-|-	1|2	2|0	MAP4|MAP4	47933563|47933563	0.059000|0.059000	0.20769|0.20769	0.030000|0.030000	0.17652|0.17652	0.800000|0.800000	0.45204|0.45204	0.657000|0.657000	0.24963|0.24963	0.258000|0.258000	0.21686|0.21686	0.591000|0.591000	0.81541|0.81541	CTA|TCT	-	NULL		0.463	MAP4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MAP4	protein_coding	OTTHUMT00000346085.1	G	NM_002375	-		47958559	-1	no_errors	ENST00000360240	ensembl	human	known	74_37	missense	SNP	0.051	T
HDAC9	9734	genome.wustl.edu	37	7	18688256	18688256	+	Frame_Shift_Del	DEL	C	C	-			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr7:18688256delC	ENST00000432645.2	+	10	1408	c.1408delC	c.(1408-1410)caafs	p.Q470fs	HDAC9_ENST00000417496.2_Frame_Shift_Del_p.Q468fs|HDAC9_ENST00000405010.3_Frame_Shift_Del_p.Q470fs|HDAC9_ENST00000456174.2_Frame_Shift_Del_p.Q442fs|HDAC9_ENST00000406451.4_Frame_Shift_Del_p.Q470fs|HDAC9_ENST00000401921.1_Frame_Shift_Del_p.Q429fs|HDAC9_ENST00000406072.1_Frame_Shift_Del_p.Q457fs|HDAC9_ENST00000428307.2_Frame_Shift_Del_p.Q426fs|HDAC9_ENST00000524023.1_Frame_Shift_Del_p.Q393fs|HDAC9_ENST00000441542.2_Frame_Shift_Del_p.Q473fs	NM_058176.2	NP_478056.1	Q9UKV0	HDAC9_HUMAN	histone deacetylase 9	470					B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|cellular response to insulin stimulus (GO:0032869)|heart development (GO:0007507)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|inflammatory response (GO:0006954)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|peptidyl-lysine deacetylation (GO:0034983)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|regulation of skeletal muscle fiber development (GO:0048742)|regulation of striated muscle cell differentiation (GO:0051153)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|histone methyltransferase complex (GO:0035097)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein deacetylase activity (GO:0033558)|protein kinase C binding (GO:0005080)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			breast(3)|central_nervous_system(4)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(18)|liver(2)|lung(37)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	82	all_lung(11;0.187)				Valproic Acid(DB00313)	GCAACACCAGCAATTCTTGGA	0.498																																																	0								ENSG00000048052						51.0	53.0	52.0					7																	18688256		2052	4190	6242	HDAC9	SO:0001589	frameshift_variant	0				HGNC	AF124924	CCDS47553.1, CCDS47554.1, CCDS47555.1, CCDS47557.1, CCDS56465.1, CCDS56466.1, CCDS56467.1, CCDS56468.1, CCDS75565.1	7p21.1	2008-05-15			ENSG00000048052	ENSG00000048052			14065	protein-coding gene	gene with protein product		606543				10523670, 10487760	Standard	NM_178425		Approved	KIAA0744, HDAC, MITR, HD7, HDAC7B	uc003sui.3	Q9UKV0	OTTHUMG00000152487	ENST00000432645.2:c.1408delC	7.37:g.18688256delC	ENSP00000410337:p.Gln470fs	Somatic	0	63	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	18	10.00	A7E2F3|B7Z4I4|B7Z917|B7Z928|B7Z940|C9JS87|E7EX34|F8W9E0|O94845|O95028|Q2M2R6|Q86SL1|Q86US3	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_His_deacetylse_dom,pfam_Hist_deacetylase_Gln_rich_N,pirsf_Histone_deAcase_II_euk,prints_His_deacetylse	p.Q473fs	ENST00000432645.2	37	c.1417	CCDS47555.1	7																																																																																			-	pirsf_Histone_deAcase_II_euk		0.498	HDAC9-023	KNOWN	basic|CCDS	protein_coding	HDAC9	protein_coding	OTTHUMT00000376176.1	C				18688256	+1	no_errors	ENST00000441542	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
CYR61	3491	genome.wustl.edu	37	1	86047194	86047194	+	Silent	SNP	C	C	T			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr1:86047194C>T	ENST00000451137.2	+	2	434	c.210C>T	c.(208-210)tgC>tgT	p.C70C	CYR61_ENST00000480413.1_3'UTR|RP11-290M5.4_ENST00000609367.1_lincRNA	NM_001554.4	NP_001545.2	O00622	CYR61_HUMAN	cysteine-rich, angiogenic inducer, 61	70	IGFBP N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00653}.				anatomical structure morphogenesis (GO:0009653)|apoptotic process involved in heart morphogenesis (GO:0003278)|atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|cell proliferation (GO:0008283)|chemotaxis (GO:0006935)|chondroblast differentiation (GO:0060591)|chorio-allantoic fusion (GO:0060710)|extracellular matrix organization (GO:0030198)|intussusceptive angiogenesis (GO:0002041)|labyrinthine layer blood vessel development (GO:0060716)|negative regulation of apoptotic process (GO:0043066)|osteoblast differentiation (GO:0001649)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cartilage development (GO:0061036)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of ceramide biosynthetic process (GO:2000304)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|reactive oxygen species metabolic process (GO:0072593)|regulation of cell growth (GO:0001558)|regulation of ERK1 and ERK2 cascade (GO:0070372)|ventricular septum development (GO:0003281)|wound healing, spreading of cells (GO:0044319)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|heparin binding (GO:0008201)			central_nervous_system(1)|endometrium(1)|large_intestine(2)|prostate(1)	5				all cancers(265;0.0216)|Epithelial(280;0.0441)		CGCAGCCCTGCGACCACACCA	0.617											OREG0013583	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000142871						32.0	31.0	32.0					1																	86047194		2203	4300	6503	CYR61	SO:0001819	synonymous_variant	0			-	HGNC	AF031385	CCDS706.1	1p22.3	2008-02-05			ENSG00000142871	ENSG00000142871			2654	protein-coding gene	gene with protein product		602369		IGFBP10		9135077	Standard	NM_001554		Approved	GIG1, CCN1	uc001dle.3	O00622	OTTHUMG00000010577	ENST00000451137.2:c.210C>T	1.37:g.86047194C>T		Somatic	0	53	0.00	1241	0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	6	33.33	O14934|O43775|Q9BZL7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Cys_knot,pfam_IGFBP-like,pfam_VWF_C,pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_IGFBP-like,smart_VWF_C,smart_Thrombospondin_1_rpt,smart_Cys_knot_C,pirsf_IGFBP_CNN,pfscan_Cys_knot_C,pfscan_Thrombospondin_1_rpt,pfscan_VWF_C	p.C70	ENST00000451137.2	37	c.210	CCDS706.1	1																																																																																			-	pfam_IGFBP-like,smart_IGFBP-like,pirsf_IGFBP_CNN		0.617	CYR61-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYR61	protein_coding	OTTHUMT00000029187.1	C	NM_001554	-		86047194	+1	no_errors	ENST00000451137	ensembl	human	known	74_37	silent	SNP	1.000	T
KCNMA1	3778	genome.wustl.edu	37	10	78943284	78943284	+	Missense_Mutation	SNP	C	C	T			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr10:78943284C>T	ENST00000286628.8	-	5	702	c.703G>A	c.(703-705)Gca>Aca	p.A235T	KCNMA1_ENST00000372440.1_Missense_Mutation_p.A235T|KCNMA1_ENST00000372443.1_Missense_Mutation_p.A235T|KCNMA1_ENST00000406533.3_Missense_Mutation_p.A235T|KCNMA1_ENST00000404857.1_Missense_Mutation_p.A235T|KCNMA1_ENST00000404771.3_Missense_Mutation_p.A235T|KCNMA1_ENST00000286627.5_Missense_Mutation_p.A235T|KCNMA1_ENST00000354353.5_Missense_Mutation_p.A235T	NM_001161352.1	NP_001154824.1	Q12791	KCMA1_HUMAN	potassium large conductance calcium-activated channel, subfamily M, alpha member 1	235					blood coagulation (GO:0007596)|cellular potassium ion homeostasis (GO:0030007)|micturition (GO:0060073)|negative regulation of cell volume (GO:0045794)|positive regulation of apoptotic process (GO:0043065)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|response to calcium ion (GO:0051592)|response to carbon monoxide (GO:0034465)|response to hypoxia (GO:0001666)|response to osmotic stress (GO:0006970)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|caveola (GO:0005901)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	actin binding (GO:0003779)|calcium-activated potassium channel activity (GO:0015269)|large conductance calcium-activated potassium channel activity (GO:0060072)|metal ion binding (GO:0046872)|voltage-gated potassium channel activity (GO:0005249)			breast(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(17)|lung(23)|ovary(2)|pancreas(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	68	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		Bendroflumethiazide(DB00436)|Chlorzoxazone(DB00356)|Cromoglicic acid(DB01003)|Diazoxide(DB01119)|Halothane(DB01159)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Miconazole(DB01110)|Procaine(DB00721)	TCGTTGGCTGCAATAAACTGG	0.423																																																	0								ENSG00000156113						61.0	55.0	57.0					10																	78943284		2203	4300	6503	KCNMA1	SO:0001583	missense	0			-	HGNC	U11717	CCDS7352.1, CCDS60569.1, CCDS60571.1, CCDS60572.1, CCDS73156.1	10q22	2012-07-05			ENSG00000156113	ENSG00000156113		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6284	protein-coding gene	gene with protein product	"""BK channel alpha subunit"""	600150		SLO		7987297, 16382103	Standard	NM_002247		Approved	KCa1.1, mSLO1	uc001jxn.3	Q12791	OTTHUMG00000018543	ENST00000286628.8:c.703G>A	10.37:g.78943284C>T	ENSP00000286628:p.Ala235Thr	Somatic	0	53	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	16	15.00	F8WA96|Q12886|Q12917|Q12921|Q12960|Q13150|Q5JQ23|Q5SQR9|Q96LG8|Q9UBB0|Q9UCX0|Q9UQK6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_K_chnl_Ca-activ_BK_asu,pfam_Ion_trans_dom,pfam_2pore_dom_K_chnl_dom,pfam_RCK_N,prints_K_chnl_Ca-activ_BK_asu,prints_K_chnl	p.A235T	ENST00000286628.8	37	c.703		10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	35|35	5.472802|5.472802	0.96274|0.96274	.|.	.|.	ENSG00000156113|ENSG00000156113	ENST00000372440;ENST00000372408;ENST00000372437;ENST00000457953;ENST00000404771;ENST00000372443;ENST00000286627;ENST00000286628;ENST00000406533;ENST00000354353;ENST00000404857;ENST00000412708|ENST00000372421	T;T;T;T;T;T;T;T;T|.	0.49432|.	0.78;0.78;0.78;0.78;0.78;0.78;0.78;0.78;0.78|.	5.92|5.92	5.92|5.92	0.95590|0.95590	Ion transport (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.65668|0.65668	0.2713|0.2713	L|L	0.33485|0.33485	1.01|1.01	0.80722|0.80722	D|D	1|1	D;D;D;D;D;D|.	0.89917|.	0.999;0.998;1.0;1.0;1.0;0.998|.	D;D;D;D;D;D|.	0.87578|.	0.998;0.99;0.99;0.994;0.99;0.986|.	T|T	0.58482|0.58482	-0.7629|-0.7629	10|5	0.87932|.	D|.	0|.	-7.626|-7.626	20.3151|20.3151	0.98650|0.98650	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	235;235;235;235;235;235|.	Q12791-4;B7ZMF5;Q12791-2;Q12791;Q12791-5;Q5SVJ7|.	.;.;.;KCMA1_HUMAN;.;.|.	T|Y	235;172;170;209;172;235;235;209;235;235;235;17|223	ENSP00000361517:A235T;ENSP00000361485:A172T;ENSP00000361514:A170T;ENSP00000396608:A209T;ENSP00000361520:A235T;ENSP00000286627:A235T;ENSP00000385552:A235T;ENSP00000346321:A235T;ENSP00000385806:A235T|.	ENSP00000286627:A235T|.	A|C	-|-	1|2	0|0	KCNMA1|KCNMA1	78613290|78613290	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.933000|0.933000	0.57130|0.57130	7.707000|7.707000	0.84623|0.84623	2.809000|2.809000	0.96659|0.96659	0.467000|0.467000	0.42956|0.42956	GCA|TGC	-	pfam_Ion_trans_dom,prints_K_chnl		0.423	KCNMA1-009	KNOWN	basic|appris_candidate_longest	protein_coding	KCNMA1	protein_coding	OTTHUMT00000048885.3	C	NM_002247	-		78943284	-1	no_errors	ENST00000406533	ensembl	human	known	74_37	missense	SNP	1.000	T
TFAP2C	7022	genome.wustl.edu	37	20	55208622	55208622	+	Missense_Mutation	SNP	G	G	T			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr20:55208622G>T	ENST00000201031.2	+	4	1043	c.800G>T	c.(799-801)aGa>aTa	p.R267I	TFAP2C_ENST00000544508.1_Missense_Mutation_p.R98I	NM_003222.3	NP_003213.1	Q92754	AP2C_HUMAN	transcription factor AP-2 gamma (activating enhancer binding protein 2 gamma)	267					cell-cell signaling (GO:0007267)|cerebral cortex development (GO:0021987)|dichotomous subdivision of terminal units involved in mammary gland duct morphogenesis (GO:0060598)|epithelial cell proliferation involved in mammary gland duct elongation (GO:0060750)|forebrain neuron fate commitment (GO:0021877)|germ-line stem cell maintenance (GO:0030718)|hair follicle development (GO:0001942)|keratinocyte development (GO:0003334)|male gonad development (GO:0008584)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of epidermis development (GO:0045682)|regulation of gene expression, epigenetic (GO:0040029)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|sebaceous gland development (GO:0048733)|somatic stem cell maintenance (GO:0035019)|trophectodermal cell differentiation (GO:0001829)	nucleus (GO:0005634)	core promoter binding (GO:0001047)|DNA binding (GO:0003677)|protein dimerization activity (GO:0046983)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	13			Colorectal(105;0.229)			GGTGTTCTCAGAAGGTACTTG	0.463																																																	0								ENSG00000087510						61.0	55.0	57.0					20																	55208622		2203	4300	6503	TFAP2C	SO:0001583	missense	0			-	HGNC		CCDS13454.1	20q13.2	2008-07-17	2001-11-28		ENSG00000087510	ENSG00000087510			11744	protein-coding gene	gene with protein product	"""estrogen receptor factor 1"""	601602	"""transcription factor AP-2 gamma (activating enhancer-binding protein 2 gamma)"""			8661133	Standard	NM_003222		Approved	AP2-GAMMA, ERF1, TFAP2G, hAP-2g	uc002xya.3	Q92754	OTTHUMG00000032805	ENST00000201031.2:c.800G>T	20.37:g.55208622G>T	ENSP00000201031:p.Arg267Ile	Somatic	0	64	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	21	16.00	B4DWK3|O00685|O00730|Q86V30|Q8IVB6|Q9P1X2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TF_AP2_C,prints_TF_AP2_C,prints_TF_AP2_gamma	p.R267I	ENST00000201031.2	37	c.800	CCDS13454.1	20	.	.	.	.	.	.	.	.	.	.	G	35	5.586690	0.96578	.	.	ENSG00000087510	ENST00000201031;ENST00000544508	D;D	0.98090	-4.71;-4.71	5.93	5.93	0.95920	Transcription factor AP-2, C-terminal (2);	0.090159	0.85682	D	0.000000	D	0.99102	0.9691	M	0.92833	3.35	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	D	0.99282	1.0896	10	0.87932	D	0	-13.5462	20.3437	0.98782	0.0:0.0:1.0:0.0	.	267	Q92754	AP2C_HUMAN	I	267;98	ENSP00000201031:R267I;ENSP00000442274:R98I	ENSP00000201031:R267I	R	+	2	0	TFAP2C	54642029	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.689000	0.98673	2.815000	0.96918	0.561000	0.74099	AGA	-	pfam_TF_AP2_C,prints_TF_AP2_C		0.463	TFAP2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TFAP2C	protein_coding	OTTHUMT00000079823.2	G	NM_003222	-		55208622	+1	no_errors	ENST00000201031	ensembl	human	known	74_37	missense	SNP	1.000	T
ZNF142	7701	genome.wustl.edu	37	2	219507332	219507332	+	Nonsense_Mutation	SNP	G	G	A			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr2:219507332G>A	ENST00000449707.1	-	8	4328	c.3907C>T	c.(3907-3909)Cag>Tag	p.Q1303*	ZNF142_ENST00000411696.2_Nonsense_Mutation_p.Q1303*	NM_001105537.1	NP_001099007.1	P52746	ZN142_HUMAN	zinc finger protein 142	1303					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(7)|endometrium(7)|large_intestine(5)|lung(12)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	38		Renal(207;0.0474)		Epithelial(149;5.21e-07)|all cancers(144;0.000106)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)		AGAGCATGCTGCTTAAGTGCT	0.622																																					Colon(170;867 1942 8995 15834 18053)												0								ENSG00000115568						37.0	42.0	40.0					2																	219507332		2167	4262	6429	ZNF142	SO:0001587	stop_gained	0			-	HGNC	U09849	CCDS42817.1	2q35	2013-01-08	2006-06-13		ENSG00000115568	ENSG00000115568		"""Zinc fingers, C2H2-type"""	12927	protein-coding gene	gene with protein product		604083	"""zinc finger protein 142 (clone pHZ-49)"""				Standard	NM_001105537		Approved	KIAA0236, pHZ-49	uc002vin.4	P52746	OTTHUMG00000154736	ENST00000449707.1:c.3907C>T	2.37:g.219507332G>A	ENSP00000408643:p.Gln1303*	Somatic	0	60	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	34	10.53	Q92510	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Q1303*	ENST00000449707.1	37	c.3907	CCDS42817.1	2	.	.	.	.	.	.	.	.	.	.	G	48	13.894653	0.99769	.	.	ENSG00000115568	ENST00000449707;ENST00000411696	.	.	.	5.48	5.48	0.80851	.	0.166832	0.53938	D	0.000045	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08837	T	0.75	-38.8647	19.5498	0.95312	0.0:0.0:1.0:0.0	.	.	.	.	X	1303	.	ENSP00000398798:Q1303X	Q	-	1	0	ZNF142	219215576	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.925000	0.70062	2.860000	0.98153	0.609000	0.83330	CAG	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.622	ZNF142-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF142	protein_coding	OTTHUMT00000336833.1	G	NM_005081	-		219507332	-1	no_errors	ENST00000411696	ensembl	human	known	74_37	nonsense	SNP	1.000	A
GCN1L1	10985	genome.wustl.edu	37	12	120572452	120572452	+	Frame_Shift_Del	DEL	C	C	-			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr12:120572452delC	ENST00000300648.6	-	52	7099	c.7087delG	c.(7087-7089)gtgfs	p.V2363fs		NM_006836.1	NP_006827	Q92616	GCN1L_HUMAN	GCN1 general control of amino-acid synthesis 1-like 1 (yeast)	2363					regulation of translation (GO:0006417)|translation (GO:0006412)	cytoplasm (GO:0005737)|membrane (GO:0016020)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)			NS(2)|breast(2)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(13)|liver(1)|lung(36)|ovary(4)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	94	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					TTCAGGCGCACCCCCCGGTTG	0.602																																																	0								ENSG00000089154						73.0	79.0	77.0					12																	120572452		1927	4138	6065	GCN1L1	SO:0001589	frameshift_variant	0				HGNC	U77700	CCDS41847.1	12q24.2	2008-07-03	2001-11-28						4199	protein-coding gene	gene with protein product		605614	"""GCN1 (general control of amino-acid synthesis 1, yeast)-like 1"""			9234705	Standard	NM_006836		Approved	KIAA0219, GCN1, GCN1L	uc001txo.3	Q92616	OTTHUMG00000169338	ENST00000300648.6:c.7087delG	12.37:g.120572452delC	ENSP00000300648:p.Val2363fs	Somatic	0	100	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	25	10.71	A8KAY1|O95001|O95651|Q6P2S3|Q86X65|Q8N5I5|Q8WU80|Q99736|Q9UE60	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_DUF3554,pfam_HEAT,superfamily_ARM-type_fold,pfscan_HEAT_type_2	p.V2363fs	ENST00000300648.6	37	c.7087	CCDS41847.1	12																																																																																			-	superfamily_ARM-type_fold		0.602	GCN1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCN1L1	protein_coding	OTTHUMT00000403592.1	C				120572452	-1	no_errors	ENST00000300648	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
ABLIM2	84448	genome.wustl.edu	37	4	8079400	8079400	+	Silent	SNP	G	G	A			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr4:8079400G>A	ENST00000341937.5	-	6	694	c.630C>T	c.(628-630)atC>atT	p.I210I	ABLIM2_ENST00000428004.2_Silent_p.I210I|ABLIM2_ENST00000545242.1_Silent_p.I210I|ABLIM2_ENST00000296372.8_Silent_p.I210I|ABLIM2_ENST00000546334.1_Silent_p.I210I|ABLIM2_ENST00000361737.5_Silent_p.I210I|ABLIM2_ENST00000505872.1_Silent_p.I210I|ABLIM2_ENST00000361581.5_Silent_p.I210I|ABLIM2_ENST00000407564.3_Silent_p.I210I|ABLIM2_ENST00000447017.2_Silent_p.I210I|ABLIM2_ENST00000318888.4_5'UTR	NM_001130084.1	NP_001123556.1	Q6H8Q1	ABLM2_HUMAN	actin binding LIM protein family, member 2	210	LIM zinc-binding 3. {ECO:0000255|PROSITE- ProRule:PRU00125}.|LIM zinc-binding 4. {ECO:0000255|PROSITE- ProRule:PRU00125}.				actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|myofibril (GO:0030016)	zinc ion binding (GO:0008270)			NS(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(6)|pancreas(3)|prostate(2)|urinary_tract(1)	25						TGTCACAGCGGATGCCGAACT	0.652																																																	0								ENSG00000163995						38.0	41.0	40.0					4																	8079400		2124	4238	6362	ABLIM2	SO:0001819	synonymous_variant	0			-	HGNC	AB058711	CCDS47011.1, CCDS47012.1, CCDS47013.1, CCDS47014.1, CCDS47015.1, CCDS47016.1, CCDS54719.1, CCDS68669.1	4p16.1	2012-05-16			ENSG00000163995	ENSG00000163995			19195	protein-coding gene	gene with protein product		612544	"""actin binding LIM protein 2"""				Standard	NM_001130083		Approved	KIAA1808	uc003gkj.4	Q6H8Q1	OTTHUMG00000057427	ENST00000341937.5:c.630C>T	4.37:g.8079400G>A		Somatic	0	162	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	54	14.29	E9PF39|Q08E71|Q19VH0|Q6H8Q0|Q6NX73|Q8N3C5|Q8N9E9|Q8N9G2|Q96JL7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_LIM,pfam_Villin_headpiece,superfamily_Villin_headpiece,smart_Znf_LIM,smart_Villin_headpiece,pfscan_Villin_headpiece,pfscan_Znf_LIM	p.I210	ENST00000341937.5	37	c.630	CCDS47013.1	4																																																																																			-	pfscan_Znf_LIM		0.652	ABLIM2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ABLIM2	protein_coding	OTTHUMT00000358862.2	G	NM_001130083	-		8079400	-1	no_errors	ENST00000447017	ensembl	human	known	74_37	silent	SNP	0.957	A
PCDHA5	56143	genome.wustl.edu	37	5	140202596	140202596	+	Silent	SNP	G	G	A			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr5:140202596G>A	ENST00000529859.1	+	1	1236	c.1236G>A	c.(1234-1236)ctG>ctA	p.L412L	PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA5_ENST00000529619.1_Silent_p.L412L|PCDHA4_ENST00000512229.2_Intron|PCDHA5_ENST00000378126.3_Silent_p.L412L|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron	NM_018908.2	NP_061731.1	Q9Y5H7	PCDA5_HUMAN	protocadherin alpha 5	412	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(6)|large_intestine(8)|liver(1)|lung(22)|ovary(2)|prostate(6)|skin(4)|upper_aerodigestive_tract(3)	60			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACAGCGCCCTGGACCGCGAGA	0.647																																																	0								ENSG00000204965						147.0	140.0	142.0					5																	140202596		2203	4300	6503	PCDHA5	SO:0001819	synonymous_variant	0			-	HGNC	AF152483	CCDS54917.1	5q31	2010-11-26				ENSG00000204965		"""Cadherins / Protocadherins : Clustered"""	8671	other	complex locus constituent	"""ortholog of mouse CNR6"", ""KIAA0345-like 9"""	606311		CNRS6		10380929, 10662547	Standard	NM_018908		Approved	CNR6, CRNR6, CNRN6, PCDH-ALPHA5		Q9Y5H7		ENST00000529859.1:c.1236G>A	5.37:g.140202596G>A		Somatic	1	165	0.60		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	33	35.29	O75284|Q8N4R3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.L412	ENST00000529859.1	37	c.1236	CCDS54917.1	5																																																																																			-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.647	PCDHA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA5	protein_coding	OTTHUMT00000372883.2	G	NM_018908	-		140202596	+1	no_errors	ENST00000529859	ensembl	human	known	74_37	silent	SNP	1.000	A
WDR89	112840	genome.wustl.edu	37	14	64066442	64066442	+	Silent	SNP	A	A	T	rs140593114		TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr14:64066442A>T	ENST00000394942.2	-	2	307	c.219T>A	c.(217-219)ctT>ctA	p.L73L	WDR89_ENST00000267522.3_Silent_p.L73L|CTD-2302E22.2_ENST00000553983.1_lincRNA	NM_001008726.2|NM_001258272.1|NM_080666.3	NP_001008726.1|NP_001245201.1|NP_542397.1	Q96FK6	WDR89_HUMAN	WD repeat domain 89	73										endometrium(1)|kidney(1)|large_intestine(3)|liver(1)|lung(7)|upper_aerodigestive_tract(1)	14				OV - Ovarian serous cystadenocarcinoma(108;0.00543)|all cancers(60;0.0181)|BRCA - Breast invasive adenocarcinoma(234;0.101)		TGACTCCATTAAGAAGTCCAG	0.373																																																	0								ENSG00000140006						60.0	61.0	61.0					14																	64066442		2203	4300	6503	WDR89	SO:0001819	synonymous_variant	0			-	HGNC	AF115513	CCDS9759.1	14q23.2	2013-01-09		2006-07-07	ENSG00000140006	ENSG00000140006		"""WD repeat domain containing"""	20489	protein-coding gene	gene with protein product				C14orf150			Standard	NM_080666		Approved	MGC9907	uc001xgi.4	Q96FK6	OTTHUMG00000140340	ENST00000394942.2:c.219T>A	14.37:g.64066442A>T		Somatic	0	78	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	24	14.29		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L73	ENST00000394942.2	37	c.219	CCDS9759.1	14																																																																																			-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom		0.373	WDR89-003	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	WDR89	protein_coding	OTTHUMT00000411879.2	A	NM_080666	-		64066442	-1	no_errors	ENST00000267522	ensembl	human	known	74_37	silent	SNP	0.760	T
EXOSC2	23404	genome.wustl.edu	37	9	133579172	133579172	+	3'UTR	SNP	C	C	T			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr9:133579172C>T	ENST00000372358.5	+	0	964				EXOSC2_ENST00000372351.3_3'UTR|EXOSC2_ENST00000546165.1_3'UTR|EXOSC2_ENST00000372352.3_3'UTR|EXOSC2_ENST00000467138.1_3'UTR			Q13868	EXOS2_HUMAN	exosome component 2						exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|positive regulation of cell growth (GO:0030307)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exosome (RNase complex) (GO:0000178)|nucleus (GO:0005634)	3'-5'-exoribonuclease activity (GO:0000175)|7S RNA binding (GO:0008312)			breast(1)|endometrium(1)|large_intestine(3)|ovary(1)	6		Acute lymphoblastic leukemia(5;0.0508)|all_hematologic(13;0.0588)		OV - Ovarian serous cystadenocarcinoma(145;0.000324)		GGAGGTGCTCCAGAAGCACGG	0.483																																					Pancreas(134;1683 1824 10118 27928 31640)												0								ENSG00000130713						99.0	107.0	104.0					9																	133579172		2203	4300	6503	EXOSC2	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AK001916	CCDS6935.1, CCDS65160.1, CCDS65161.1	9q34	2008-02-05			ENSG00000130713	ENSG00000130713			17097	protein-coding gene	gene with protein product	"""homolog of yeast RRP4 (ribosomal RNA processing 4), 3' 5' exoribonuclease (RRP4)"""	602238				8600032, 1538749	Standard	XM_005272176		Approved	hRrp4p, Rrp4p, RRP4, p7	uc004bzu.2	Q13868	OTTHUMG00000020811	ENST00000372358.5:c.*11C>T	9.37:g.133579172C>T		Somatic	0	42	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	34	10.53	A3KFL3|B4DKK6|Q9NUY4	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000372358.5	37	NULL	CCDS6935.1	9																																																																																			-	-		0.483	EXOSC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EXOSC2	protein_coding	OTTHUMT00000054673.1	C	NM_014285	-		133579172	+1	no_errors	ENST00000430138	ensembl	human	known	74_37	rna	SNP	0.000	T
C5orf42	65250	genome.wustl.edu	37	5	37227487	37227487	+	Missense_Mutation	SNP	C	C	T			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr5:37227487C>T	ENST00000508244.1	-	10	1472	c.1379G>A	c.(1378-1380)gGc>gAc	p.G460D	C5orf42_ENST00000425232.2_Missense_Mutation_p.G460D|C5orf42_ENST00000274258.7_5'UTR			Q9H799	CE042_HUMAN	chromosome 5 open reading frame 42	460						integral component of membrane (GO:0016021)				breast(5)|endometrium(3)|kidney(8)|large_intestine(24)|lung(28)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	79	all_lung(31;0.000616)		COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)			CAGTCCTTTGCCTTTTGGCTA	0.353																																																	0								ENSG00000197603						61.0	55.0	57.0					5																	37227487		692	1591	2283	C5orf42	SO:0001583	missense	0			-	HGNC		CCDS34146.1, CCDS34146.2	5p13.2	2014-01-28			ENSG00000197603	ENSG00000197603			25801	protein-coding gene	gene with protein product		614571				22264561	Standard	NM_023073		Approved	FLJ13231, JBTS17	uc011cpa.1	Q9H799	OTTHUMG00000160492	ENST00000508244.1:c.1379G>A	5.37:g.37227487C>T	ENSP00000421690:p.Gly460Asp	Somatic	0	90	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	26	10.34	A8MUB7|B7ZLV7|Q4G174|Q6DK46|Q8N8L4|Q9H5T1|Q9H8T9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_Quino_amine_DH_bsu	p.G460D	ENST00000508244.1	37	c.1379	CCDS34146.2	5	.	.	.	.	.	.	.	.	.	.	C	0.156	-1.085924	0.01873	.	.	ENSG00000197603	ENST00000508244;ENST00000425232	T;T	0.21932	1.98;1.98	5.44	4.08	0.47627	.	0.791079	0.10411	U	0.677938	T	0.17619	0.0423	L	0.38838	1.175	0.20489	N	0.999893	B	0.17268	0.021	B	0.18263	0.021	T	0.27905	-1.0060	10	0.28530	T	0.3	1.0074	8.9609	0.35847	0.0:0.8532:0.0:0.1468	.	460	E9PH94	.	D	460	ENSP00000421690:G460D;ENSP00000389014:G460D	ENSP00000389014:G460D	G	-	2	0	C5orf42	37263244	0.005000	0.15991	0.077000	0.20336	0.037000	0.13140	0.932000	0.28884	0.820000	0.34516	0.591000	0.81541	GGC	-	NULL		0.353	C5orf42-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	C5orf42	protein_coding	OTTHUMT00000360806.1	C	NM_023073	-		37227487	-1	no_errors	ENST00000425232	ensembl	human	known	74_37	missense	SNP	0.004	T
NR4A1	3164	genome.wustl.edu	37	12	52435632	52435632	+	Missense_Mutation	SNP	A	A	G	rs138157115	byFrequency	TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr12:52435632A>G	ENST00000545748.1	+	2	1074	c.79A>G	c.(79-81)Agg>Ggg	p.R27G	NR4A1_ENST00000360284.3_5'UTR|NR4A1_ENST00000550082.1_5'UTR			P22736	NR4A1_HUMAN	nuclear receptor subfamily 4, group A, member 1	0					cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|endothelial cell chemotaxis (GO:0035767)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|signal transduction (GO:0007165)|skeletal muscle cell differentiation (GO:0035914)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(2)|large_intestine(2)|lung(8)|upper_aerodigestive_tract(2)	16				BRCA - Breast invasive adenocarcinoma(357;0.0967)		TGCCCCTCCCAGGCAGCCTGG	0.597																																																	0								ENSG00000123358						19.0	17.0	18.0					12																	52435632		875	1987	2862	NR4A1	SO:0001583	missense	0			-	HGNC	L13740	CCDS8818.1, CCDS55828.1, CCDS73471.1	12q13	2013-01-16			ENSG00000123358	ENSG00000123358		"""Nuclear hormone receptors"""	7980	protein-coding gene	gene with protein product		139139		HMR, GFRP1		2626032	Standard	NM_002135		Approved	TR3, N10, NAK-1, NGFIB, NUR77	uc001rzt.3	P22736	OTTHUMG00000150393	ENST00000545748.1:c.79A>G	12.37:g.52435632A>G	ENSP00000440864:p.Arg27Gly	Somatic	0	44	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	12	20.00	B4DML7|Q15627|Q53Y00|Q6IBU8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Nuc_orph_rcpt,prints_Nuc_orp_HMR_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt	p.R27G	ENST00000545748.1	37	c.79		12	.	.	.	.	.	.	.	.	.	.	A	6.601	0.479228	0.12581	.	.	ENSG00000123358	ENST00000545748	D	0.92911	-3.13	3.48	-0.362	0.12560	.	9.859940	0.00357	U	0.000029	D	0.91233	0.7237	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.78526	-0.2170	7	0.87932	D	0	.	2.9803	0.05951	0.4099:0.1159:0.0:0.4742	.	.	.	.	G	27	ENSP00000440864:R27G	ENSP00000440864:R27G	R	+	1	2	NR4A1	50721899	0.919000	0.31177	0.890000	0.34922	0.153000	0.21895	-0.047000	0.11963	-0.066000	0.12998	-0.624000	0.04008	AGG	-	NULL		0.597	NR4A1-003	KNOWN	basic	protein_coding	NR4A1	protein_coding	OTTHUMT00000404959.2	A		-		52435632	+1	no_errors	ENST00000545748	ensembl	human	known	74_37	missense	SNP	0.902	G
AKAP4	8852	genome.wustl.edu	37	X	49963378	49963378	+	Missense_Mutation	SNP	C	C	T			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chrX:49963378C>T	ENST00000376056.2	-	2	176	c.26G>A	c.(25-27)cGc>cAc	p.R9H	AKAP4_ENST00000376064.3_Missense_Mutation_p.R9H|AKAP4_ENST00000481402.1_5'UTR|AKAP4_ENST00000376058.2_Missense_Mutation_p.R9H|AKAP4_ENST00000358526.2_Missense_Mutation_p.R18H					A kinase (PRKA) anchor protein 4											NS(2)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(6)|large_intestine(6)|lung(14)|ovary(1)|skin(4)	41	Ovarian(276;0.236)					CCTGTGGCTGCGTAACCAGTC	0.428																																																	0								ENSG00000147081						88.0	68.0	75.0					X																	49963378		2203	4300	6503	AKAP4	SO:0001583	missense	0			-	HGNC	AF072756	CCDS14329.1, CCDS14330.1	Xp11.2	2009-03-12			ENSG00000147081	ENSG00000147081		"""A-kinase anchor proteins"""	374	protein-coding gene	gene with protein product	"""A-kinase anchor protein 82 kDa"", ""testis-specific gene HI"", ""protein kinase A anchoring protein 4"", ""cancer/testis antigen 99"""	300185				9822690, 9514854	Standard	NM_003886		Approved	p82, hAKAP82, AKAP82, Fsc1, HI, CT99	uc004dow.1	Q5JQC9	OTTHUMG00000021517	ENST00000376056.2:c.26G>A	X.37:g.49963378C>T	ENSP00000365224:p.Arg9His	Somatic	0	67	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	25	13.79		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_AKAP_110_C,pfam_RII_binding_1,smart_AKAP_110	p.R18H	ENST00000376056.2	37	c.53	CCDS14330.1	X	.	.	.	.	.	.	.	.	.	.	C	1.313	-0.601510	0.03744	.	.	ENSG00000147081	ENST00000376056;ENST00000376058;ENST00000358526;ENST00000376064;ENST00000448865;ENST00000437370	T;T;T;T;T;T	0.30714	1.52;1.52;1.52;1.52;1.52;1.52	5.17	3.92	0.45320	.	0.113336	0.39146	N	0.001445	T	0.05640	0.0148	N	0.00116	-2.08	0.23016	N	0.998423	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.34104	-0.9842	9	.	.	.	-8.4427	6.9576	0.24580	0.0:0.1075:0.0:0.8925	.	18;9	Q5JQC9;A6ND82	AKAP4_HUMAN;.	H	9;9;18;9;9;9	ENSP00000365224:R9H;ENSP00000365226:R9H;ENSP00000351327:R18H;ENSP00000365232:R9H;ENSP00000402403:R9H;ENSP00000412279:R9H	.	R	-	2	0	AKAP4	49850118	0.990000	0.36364	0.989000	0.46669	0.586000	0.36452	1.751000	0.38339	0.636000	0.30508	-0.354000	0.07668	CGC	-	smart_AKAP_110		0.428	AKAP4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP4	protein_coding	OTTHUMT00000056552.1	C	NM_003886	-		49963378	-1	no_errors	ENST00000358526	ensembl	human	known	74_37	missense	SNP	0.989	T
DCAF4L2	138009	genome.wustl.edu	37	8	88885852	88885852	+	Silent	SNP	C	C	T			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr8:88885852C>T	ENST00000319675.3	-	1	444	c.348G>A	c.(346-348)ccG>ccA	p.P116P		NM_152418.3	NP_689631.1	Q8NA75	DC4L2_HUMAN	DDB1 and CUL4 associated factor 4-like 2	116										breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|liver(2)|lung(40)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	83						GGGTTTTGTGCGGGTATACCC	0.552																																																	0								ENSG00000176566						128.0	124.0	125.0					8																	88885852		2203	4300	6503	DCAF4L2	SO:0001819	synonymous_variant	0			-	HGNC	AL833507	CCDS6245.1	8q21.3	2013-01-09	2009-07-17	2009-07-17		ENSG00000176566		"""WD repeat domain containing"""	26657	protein-coding gene	gene with protein product			"""WD repeat domain 21C"""	WDR21C		14702039	Standard	NM_152418		Approved		uc003ydz.3	Q8NA75		ENST00000319675.3:c.348G>A	8.37:g.88885852C>T		Somatic	0	60	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	29	12.12		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.P116	ENST00000319675.3	37	c.348	CCDS6245.1	8																																																																																			-	superfamily_WD40_repeat_dom		0.552	DCAF4L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF4L2	protein_coding	OTTHUMT00000375302.1	C	NM_152418	-		88885852	-1	no_errors	ENST00000319675	ensembl	human	known	74_37	silent	SNP	0.946	T
ATP11A	23250	genome.wustl.edu	37	13	113527954	113527954	+	Frame_Shift_Del	DEL	A	A	-			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr13:113527954delA	ENST00000487903.1	+	27	3213	c.3125delA	c.(3124-3126)tacfs	p.Y1042fs	ATP11A_ENST00000283558.8_Frame_Shift_Del_p.Y1042fs|ATP11A_ENST00000375645.3_Frame_Shift_Del_p.Y1042fs|ATP11A_ENST00000375630.2_Frame_Shift_Del_p.Y1042fs			P98196	AT11A_HUMAN	ATPase, class VI, type 11A	1042					phospholipid translocation (GO:0045332)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(12)|lung(17)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	51	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_lung(25;0.134)|all_epithelial(44;0.141)				CTGCTGTTCTACGTTGTCTTT	0.398											OREG0003854	type=REGULATORY REGION|Gene=ATP11A|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																																					0								ENSG00000068650						223.0	184.0	197.0					13																	113527954		2203	4300	6503	ATP11A	SO:0001589	frameshift_variant	0				HGNC	AB028944	CCDS32011.1	13q34	2010-04-20	2007-09-19		ENSG00000068650	ENSG00000068650	3.6.3.1	"""ATPases / P-type"""	13552	protein-coding gene	gene with protein product	"""potential phospholipid-transporting ATPase IH"", ""phospholipid-translocating ATPase"""	605868	"""ATPase, Class VI, type 11A"""			11015572	Standard	NM_032189		Approved	ATPIH, ATPIS, KIAA1021	uc001vsj.4	P98196	OTTHUMG00000017371	ENST00000487903.1:c.3125delA	13.37:g.113527954delA	ENSP00000420387:p.Tyr1042fs	Somatic	0	63	0.00	1451	0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	13	13.33	Q5VXT2	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_ATPase_P-typ_transduc_dom_A,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	p.Y1042fs	ENST00000487903.1	37	c.3125	CCDS32011.1	13																																																																																			-	tigrfam_ATPase_P-typ_Plipid-transp		0.398	ATP11A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ATP11A	protein_coding	OTTHUMT00000045834.3	A	NM_015205			113527954	+1	no_errors	ENST00000375630	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
SLC44A2	57153	genome.wustl.edu	37	19	10753122	10753122	+	Missense_Mutation	SNP	G	G	A			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr19:10753122G>A	ENST00000335757.5	+	21	2385	c.2009G>A	c.(2008-2010)tGc>tAc	p.C670Y	SLC44A2_ENST00000586078.1_Missense_Mutation_p.C670Y|SLC44A2_ENST00000407327.4_Missense_Mutation_p.C668Y			Q8IWA5	CTL2_HUMAN	solute carrier family 44 (choline transporter), member 2	670					choline transport (GO:0015871)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	choline transmembrane transporter activity (GO:0015220)|signal transducer activity (GO:0004871)			NS(1)|breast(3)|endometrium(5)|kidney(1)|large_intestine(7)|lung(4)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	27			Epithelial(33;8.7e-06)|all cancers(31;2.77e-05)		Choline(DB00122)	CTGTTCCTCTGCTTCTGTGAG	0.567																																																	0								ENSG00000129353						278.0	185.0	217.0					19																	10753122		2203	4300	6503	SLC44A2	SO:0001583	missense	0			-	HGNC	AF070636	CCDS12245.1, CCDS54216.1	19p13.2	2014-08-12	2013-07-17		ENSG00000129353	ENSG00000129353		"""Solute carriers"""	17292	protein-coding gene	gene with protein product		606106				10677542, 15715662	Standard	NM_001145056		Approved	CTL2	uc002mpf.3	Q8IWA5	OTTHUMG00000180585	ENST00000335757.5:c.2009G>A	19.37:g.10753122G>A	ENSP00000336888:p.Cys670Tyr	Somatic	0	60	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	33	10.81	B2RBB1|B3KNH3|B4DFJ0|F2Q9D7|Q658V1|Q658Z2|Q6PJV7|Q8N2F0|Q9NY68	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Choline_transptr-like	p.C670Y	ENST00000335757.5	37	c.2009	CCDS12245.1	19	.	.	.	.	.	.	.	.	.	.	G	27.6	4.847993	0.91277	.	.	ENSG00000129353	ENST00000407327;ENST00000335757;ENST00000380614	T;T	0.37058	1.22;1.22	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	T	0.75170	0.3813	H	0.97365	3.99	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.999;0.995	D	0.84290	0.0499	10	0.87932	D	0	-14.7321	18.5195	0.90947	0.0:0.0:1.0:0.0	.	670;670;668	Q8IWA5-2;Q8IWA5;Q8IWA5-3	.;CTL2_HUMAN;.	Y	668;670;670	ENSP00000385135:C668Y;ENSP00000336888:C670Y	ENSP00000336888:C670Y	C	+	2	0	SLC44A2	10614122	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.300000	0.96151	2.668000	0.90789	0.655000	0.94253	TGC	-	pfam_Choline_transptr-like		0.567	SLC44A2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC44A2	protein_coding	OTTHUMT00000452045.1	G		-		10753122	+1	no_errors	ENST00000335757	ensembl	human	known	74_37	missense	SNP	1.000	A
LIPE-AS1	100996307	genome.wustl.edu	37	19	42989258	42989258	+	RNA	SNP	T	T	C			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr19:42989258T>C	ENST00000594688.1	+	0	1450				LIPE-AS1_ENST00000457234.2_RNA|LIPE-AS1_ENST00000597203.1_RNA|LIPE-AS1_ENST00000596116.1_RNA|LIPE-AS1_ENST00000593740.2_RNA|LIPE-AS1_ENST00000594624.2_RNA	NR_073179.1				LIPE antisense RNA 1																		CCACAACAACTGGATTCTCTT	0.333																																																	0								ENSG00000213904																																			LIPE-AS1			0			-	HGNC	AK096849, BM974950		19q13.2	2013-05-21			ENSG00000213904	ENSG00000213904		"""Long non-coding RNAs"""	48589	non-coding RNA	RNA, long non-coding							Standard	NR_073179		Approved				OTTHUMG00000182815		19.37:g.42989258T>C		Somatic	0	96	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	27	12.90		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000594688.1	37	NULL		19																																																																																			-	-		0.333	LIPE-AS1-004	KNOWN	basic	antisense	LIPE-AS1	antisense	OTTHUMT00000464099.1	T	NR_073179	-		42989258	+1	no_errors	ENST00000457234	ensembl	human	known	74_37	rna	SNP	0.997	C
SEPT7	989	genome.wustl.edu	37	7	35882541	35882542	+	Intron	DEL	TA	TA	-	rs146264668		TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	TA	TA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr7:35882541_35882542delTA	ENST00000435235.1	+	2	442				SEPT7_ENST00000399035.3_Intron|SEPT7_ENST00000399034.2_Intron|SEPT7_ENST00000475109.1_Intron|SEPT7_ENST00000469679.2_Intron|SEPT7_ENST00000350320.6_Intron|AC007551.1_ENST00000408229.1_RNA|SEPT7_ENST00000494488.2_Intron			Q16181	SEPT7_HUMAN	septin 7						cilium morphogenesis (GO:0060271)|cytokinesis (GO:0000910)|mitotic nuclear division (GO:0007067)|protein heterooligomerization (GO:0051291)|regulation of embryonic cell shape (GO:0016476)	actin cytoskeleton (GO:0015629)|axoneme (GO:0005930)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|septin complex (GO:0031105)|stress fiber (GO:0001725)	GTP binding (GO:0005525)|identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(7)|prostate(1)	14						CACACACATTtatatatatatg	0.317																																																	0								ENSG00000221156																																			AC007551.1	SO:0001627	intron_variant	0				Clone_based_ensembl_gene	S72008	CCDS75582.1	7p14.2	2013-01-21	2005-01-11	2005-01-12	ENSG00000122545	ENSG00000122545		"""Septins"""	1717	protein-coding gene	gene with protein product		603151	"""CDC10 cell division cycle 10 homolog (S. cerevisiae)"""	CDC10		8037772	Standard	NM_001788		Approved	CDC3, SEPT7A	uc011kau.2	Q16181	OTTHUMG00000155063	ENST00000435235.1:c.10+10031TA>-	7.37:g.35882549_35882550delTA		Somatic	0	43	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	12	14.29	Q52M76|Q6NX50	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000435235.1	37	NULL		7																																																																																			-	-		0.317	SEPT7-001	NOVEL	basic	protein_coding	ENSG00000221156	protein_coding	OTTHUMT00000338285.1	TA	NM_001788			35882542	+1	no_errors	ENST00000408229	ensembl	human	novel	74_37	rna	DEL	0.000:0.000	-
BRCA2	675	genome.wustl.edu	37	13	32929041	32929041	+	Missense_Mutation	SNP	G	G	A	rs80358930		TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr13:32929041G>A	ENST00000380152.3	+	14	7284	c.7051G>A	c.(7051-7053)Gca>Aca	p.A2351T	BRCA2_ENST00000544455.1_Missense_Mutation_p.A2351T			P51587	BRCA2_HUMAN	breast cancer 2, early onset	2351	Interaction with FANCD2.				brain development (GO:0007420)|cell aging (GO:0007569)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|female gonad development (GO:0008585)|hemopoiesis (GO:0030097)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|inner cell mass cell proliferation (GO:0001833)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|male meiosis I (GO:0007141)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|nucleotide-excision repair (GO:0006289)|oocyte maturation (GO:0001556)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokinesis (GO:0032465)|replication fork protection (GO:0048478)|response to gamma radiation (GO:0010332)|response to UV-C (GO:0010225)|response to X-ray (GO:0010165)|spermatogenesis (GO:0007283)	BRCA2-MAGE-D1 complex (GO:0033593)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|secretory granule (GO:0030141)	gamma-tubulin binding (GO:0043015)|H3 histone acetyltransferase activity (GO:0010484)|H4 histone acetyltransferase activity (GO:0010485)|protease binding (GO:0002020)|single-stranded DNA binding (GO:0003697)			NS(3)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(32)|liver(1)|lung(41)|oesophagus(5)|ovary(22)|pancreas(4)|prostate(3)|salivary_gland(1)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	183		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		AAATTTTACCGCACCTGGTCA	0.333			"""D, Mis, N, F, S"""		"""breast, ovarian, pancreatic"""	"""breast, ovarian, pancreatic, leukemia  (FANCB, FANCD1)"""		Homologous recombination	Pancreatic Cancer, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Prostate Cancer;Hereditary Breast-Ovarian Cancer, BRCA2 type;Fanconi Anemia type D1, bi-allelic BRCA2 mutations;Fanconi Anemia	TCGA Ovarian(8;0.087)																											Esophageal Squamous(138;838 1285 7957 30353 30468 36915 49332)		yes	Rec	yes	Hereditary breast/ovarian cancer	13	13q12	675	familial breast/ovarian cancer gene 2		"""L, E"""	0								ENSG00000139618						86.0	90.0	89.0					13																	32929041		2203	4300	6503	BRCA2	SO:0001583	missense	0	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;HPC; ;FANCD1;Pancytopenia Dysmelia, FA (several complementation groups)	-	HGNC	U43746	CCDS9344.1	13q12-q13	2014-09-17	2003-10-14		ENSG00000139618	ENSG00000139618		"""Fanconi anemia, complementation groups"""	1101	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 2"""	600185	"""Fanconi anemia, complementation group D1"""	FANCD1, FACD, FANCD		8091231, 7581463, 15057823	Standard	NM_000059		Approved	FAD, FAD1, BRCC2	uc001uub.1	P51587	OTTHUMG00000017411	ENST00000380152.3:c.7051G>A	13.37:g.32929041G>A	ENSP00000369497:p.Ala2351Thr	Somatic	0	75	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	13	18.75	O00183|O15008|Q13879|Q5TBJ7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DNA_recomb/repair_BRCA2_hlx,pfam_BRCA2_repeat,pfam_BRCA2_OB_3,pfam_BRCA2_OB_1,pfam_Tower,superfamily_DNA_recomb/repair_BRCA2_hlx,superfamily_NA-bd_OB-fold,pirsf_BRCA2,pfscan_BRCA2_repeat	p.A2351T	ENST00000380152.3	37	c.7051	CCDS9344.1	13	.	.	.	.	.	.	.	.	.	.	G	12.96	2.093974	0.36952	.	.	ENSG00000139618	ENST00000380152;ENST00000544455	T;T	0.78707	-1.2;-1.2	5.66	1.92	0.25849	.	0.943531	0.08906	N	0.876575	T	0.67859	0.2938	M	0.73598	2.24	0.09310	N	1	P	0.35155	0.487	B	0.24848	0.056	T	0.52049	-0.8627	10	0.18276	T	0.48	.	1.8346	0.03137	0.1443:0.2575:0.3466:0.2516	.	2351	P51587	BRCA2_HUMAN	T	2351	ENSP00000369497:A2351T;ENSP00000439902:A2351T	ENSP00000369497:A2351T	A	+	1	0	BRCA2	31827041	0.000000	0.05858	0.012000	0.15200	0.988000	0.76386	-0.279000	0.08479	0.110000	0.17919	0.650000	0.86243	GCA	-	pirsf_BRCA2		0.333	BRCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRCA2	protein_coding	OTTHUMT00000046000.2	G	NM_000059	rs80358930		32929041	+1	no_errors	ENST00000380152	ensembl	human	known	74_37	missense	SNP	0.007	A
TPX2	22974	genome.wustl.edu	37	20	30381794	30381794	+	Missense_Mutation	SNP	G	G	T			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr20:30381794G>T	ENST00000300403.6	+	14	2181	c.1653G>T	c.(1651-1653)aaG>aaT	p.K551N	TPX2_ENST00000340513.4_Missense_Mutation_p.K587N	NM_012112.4	NP_036244.2	Q9ULW0	TPX2_HUMAN	TPX2, microtubule-associated	551					activation of protein kinase activity (GO:0032147)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|mitotic nuclear division (GO:0007067)|regulation of mitotic spindle organization (GO:0060236)	axon hillock (GO:0043203)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|protein kinase binding (GO:0019901)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	28			Epithelial(4;0.000771)|Colorectal(19;0.00306)|all cancers(5;0.004)|COAD - Colon adenocarcinoma(19;0.0347)|OV - Ovarian serous cystadenocarcinoma(3;0.0656)			AGTTACAGAAGGAGAAGAAAA	0.408																																																	0								ENSG00000088325						116.0	116.0	116.0					20																	30381794		2203	4300	6503	TPX2	SO:0001583	missense	0			-	HGNC	AF098158	CCDS13190.1	20q11.2	2013-07-23	2013-07-23	2003-10-08	ENSG00000088325	ENSG00000088325			1249	protein-coding gene	gene with protein product		605917	"""chromosome 20 open reading frame 1"", ""TPX2, microtubule-associated, homolog (Xenopus laevis)"""	C20orf2, C20orf1		9207457, 10393424	Standard	NM_012112		Approved	p100, DIL-2	uc002wwp.1	Q9ULW0	OTTHUMG00000032190	ENST00000300403.6:c.1653G>T	20.37:g.30381794G>T	ENSP00000300403:p.Lys551Asn	Somatic	0	74	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	17	15.00	Q9H1R4|Q9NRA3|Q9UFN9|Q9UL00|Q9Y2M1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TPX2_central_dom,pfam_Aurora-A-bd,pfam_TPX2_dom_C	p.K587N	ENST00000300403.6	37	c.1761	CCDS13190.1	20	.	.	.	.	.	.	.	.	.	.	G	17.30	3.355148	0.61293	.	.	ENSG00000088325	ENST00000300403;ENST00000340513	T	0.38560	1.13	5.82	2.82	0.32997	.	0.000000	0.85682	D	0.000000	T	0.60274	0.2256	M	0.78801	2.425	0.58432	D	0.999998	D;D	0.89917	0.999;1.0	D;D	0.87578	0.994;0.998	T	0.60052	-0.7338	10	0.54805	T	0.06	-22.1306	8.2493	0.31708	0.3792:0.0:0.6208:0.0	.	587;551	Q96RR5;Q9ULW0	.;TPX2_HUMAN	N	551;587	ENSP00000341145:K587N	ENSP00000300403:K551N	K	+	3	2	TPX2	29845455	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	0.855000	0.27805	0.820000	0.34516	-0.140000	0.14226	AAG	-	NULL		0.408	TPX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPX2	protein_coding	OTTHUMT00000078569.2	G		-		30381794	+1	no_errors	ENST00000340513	ensembl	human	known	74_37	missense	SNP	1.000	T
HOXC10	3226	genome.wustl.edu	37	12	54383304	54383304	+	3'UTR	DEL	T	T	-			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr12:54383304delT	ENST00000303460.4	+	0	1177				MIR196A2_ENST00000385189.1_RNA|HOXC10_ENST00000511575.1_3'UTR|RP11-834C11.12_ENST00000513209.1_Intron	NM_017409.3	NP_059105.2	Q9NYD6	HXC10_HUMAN	homeobox C10						anterior/posterior pattern specification (GO:0009952)|embryonic limb morphogenesis (GO:0030326)|neuromuscular process (GO:0050905)|positive regulation of cell proliferation (GO:0008284)|proximal/distal pattern formation (GO:0009954)|regulation of transcription, DNA-templated (GO:0006355)|skeletal system development (GO:0001501)|spinal cord motor neuron cell fate specification (GO:0021520)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(2)|large_intestine(3)|lung(14)|pancreas(1)	20						TGGTGATATATTTTTTTTTCC	0.522											OREG0021882	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000180818																																			HOXC10	SO:0001624	3_prime_UTR_variant	0				HGNC		CCDS8868.1	12q13.13	2011-06-20	2005-12-22		ENSG00000180818	ENSG00000180818		"""Homeoboxes / ANTP class : HOXL subclass"""	5122	protein-coding gene	gene with protein product		605560	"""homeo box C10"""	HOX3I		1358459	Standard	NM_017409		Approved		uc001sen.3	Q9NYD6	OTTHUMG00000160031	ENST00000303460.4:c.*74T>-	12.37:g.54383304delT		Somatic	0	58	0.00	999	0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	15	11.76	O15219|O15220|Q9BVD5	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000303460.4	37	NULL	CCDS8868.1	12																																																																																			-	-		0.522	HOXC10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOXC10	protein_coding	OTTHUMT00000358952.2	T				54383304	+1	no_errors	ENST00000511575	ensembl	human	known	74_37	rna	DEL	0.996	-
ANO3	63982	genome.wustl.edu	37	11	26677985	26677985	+	Frame_Shift_Del	DEL	G	G	-			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr11:26677985delG	ENST00000256737.3	+	26	3572	c.2720delG	c.(2719-2721)tggfs	p.W907fs	ANO3_ENST00000525139.1_Frame_Shift_Del_p.W891fs|ANO3_ENST00000531568.1_Frame_Shift_Del_p.W761fs|ANO3_ENST00000537978.1_Frame_Shift_Del_p.W891fs	NM_031418.2	NP_113606.2	Q9BYT9	ANO3_HUMAN	anoctamin 3	907					calcium activated galactosylceramide scrambling (GO:0061591)|calcium activated phosphatidylcholine scrambling (GO:0061590)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	phospholipid scramblase activity (GO:0017128)			breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(33)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	68						TTACAATACTGGCATATCCTT	0.373																																																	0								ENSG00000134343						165.0	169.0	167.0					11																	26677985		2203	4299	6502	ANO3	SO:0001589	frameshift_variant	0				HGNC	AJ300461	CCDS31447.1	11p14.2	2014-04-09	2008-08-28	2008-08-28	ENSG00000134343	ENSG00000134343		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	14004	protein-coding gene	gene with protein product	"""transmembrane protein 16C (eight membrane-spanning domains)"""	610110	"""chromosome 11 open reading frame 25"", ""transmembrane protein 16C"""	C11orf25, TMEM16C		12739008, 15067359, 23200863, 24692353	Standard	NM_031418		Approved	GENX-3947, DYT23	uc001mqt.4	Q9BYT9	OTTHUMG00000166096	ENST00000256737.3:c.2720delG	11.37:g.26677985delG	ENSP00000256737:p.Trp907fs	Somatic	0	84	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	17	10.53	B7Z3F5	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Anoctamin	p.W907fs	ENST00000256737.3	37	c.2720	CCDS31447.1	11																																																																																			-	pfam_Anoctamin		0.373	ANO3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANO3	protein_coding	OTTHUMT00000387806.1	G	NM_031418			26677985	+1	no_errors	ENST00000256737	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
ARG2	384	genome.wustl.edu	37	14	68117433	68117433	+	Splice_Site	SNP	G	G	A			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr14:68117433G>A	ENST00000261783.3	+	8	1041	c.861G>A	c.(859-861)ggG>ggA	p.G287G	VTI1B_ENST00000554659.1_3'UTR	NM_001172.3	NP_001163.1	P78540	ARGI2_HUMAN	arginase 2	287					arginine metabolic process (GO:0006525)|cellular nitrogen compound metabolic process (GO:0034641)|nitric oxide biosynthetic process (GO:0006809)|small molecule metabolic process (GO:0044281)|striated muscle contraction (GO:0006941)|urea cycle (GO:0000050)|ureteric bud development (GO:0001657)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	arginase activity (GO:0004053)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|ovary(1)|prostate(1)	11				all cancers(60;0.000582)|OV - Ovarian serous cystadenocarcinoma(108;0.00392)|BRCA - Breast invasive adenocarcinoma(234;0.00928)	L-Arginine(DB00125)|L-Ornithine(DB00129)	TTCTTCCAGGGTTGCTATCAG	0.488																																																	0								ENSG00000081181						103.0	95.0	98.0					14																	68117433		2203	4300	6503	ARG2	SO:0001630	splice_region_variant	0			-	HGNC	D86724	CCDS9785.1	14q24.1	2013-05-01	2013-05-01			ENSG00000081181			664	protein-coding gene	gene with protein product		107830	"""arginase, type II"""			8954792, 8898077	Standard	NM_001172		Approved		uc001xjs.3	P78540		ENST00000261783.3:c.860-1G>A	14.37:g.68117433G>A		Somatic	0	27	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	9	43.75	B2R690|Q6FHY8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ureohydrolase,prints_Ureohydrolase,tigrfam_Arginase	p.G287	ENST00000261783.3	37	c.861	CCDS9785.1	14																																																																																			-	pfam_Ureohydrolase,prints_Ureohydrolase,tigrfam_Arginase		0.488	ARG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARG2	protein_coding	OTTHUMT00000415190.2	G	NM_001172	-	Silent	68117433	+1	no_errors	ENST00000261783	ensembl	human	known	74_37	silent	SNP	0.687	A
USH2A	7399	genome.wustl.edu	37	1	216246595	216246595	+	Missense_Mutation	SNP	C	C	T	rs200923150		TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr1:216246595C>T	ENST00000307340.3	-	28	6006	c.5620G>A	c.(5620-5622)Gtt>Att	p.V1874I	USH2A_ENST00000366943.2_Missense_Mutation_p.V1874I|RP11-22M7.2_ENST00000446411.1_RNA|RP11-22M7.2_ENST00000445619.1_RNA|RP11-22M7.2_ENST00000430890.1_RNA	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	1874	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.|Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		GCCAAGTTAACGACAGCACCC	0.453										HNSCC(13;0.011)																																							0								ENSG00000042781						81.0	67.0	71.0					1																	216246595		2203	4300	6503	USH2A	SO:0001583	missense	0			-	HGNC	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.5620G>A	1.37:g.216246595C>T	ENSP00000305941:p.Val1874Ile	Somatic	0	44	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	11	26.67	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Fibronectin_type3,pfam_EGF_laminin,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_LamG-like,smart_Laminin_N,smart_EGF_laminin,smart_Fibronectin_type3,smart_Laminin_G,pfscan_EGF_laminin,pfscan_Fibronectin_type3,pfscan_Laminin_G,pfscan_Laminin_N	p.V1874I	ENST00000307340.3	37	c.5620	CCDS31025.1	1	.	.	.	.	.	.	.	.	.	.	C	14.26	2.481524	0.44147	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.79352	-1.26;-1.26	5.93	4.04	0.47022	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Fibronectin, type III (3);Laminin G domain (1);	0.174654	0.26875	N	0.022051	T	0.68833	0.3044	L	0.55103	1.725	0.36610	D	0.875133	B	0.19445	0.036	B	0.12837	0.008	T	0.63134	-0.6705	10	0.14656	T	0.56	.	9.6692	0.40002	0.1402:0.7891:0.0:0.0707	.	1874	O75445	USH2A_HUMAN	I	1874	ENSP00000305941:V1874I;ENSP00000355910:V1874I	ENSP00000305941:V1874I	V	-	1	0	USH2A	214313218	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.968000	0.40500	0.811000	0.34303	0.655000	0.94253	GTT	-	superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Laminin_G		0.453	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USH2A	protein_coding	OTTHUMT00000128138.1	C	NM_007123	-		216246595	-1	no_errors	ENST00000366943	ensembl	human	known	74_37	missense	SNP	1.000	T
FBN3	84467	genome.wustl.edu	37	19	8193949	8193949	+	Silent	SNP	G	G	A	rs60853419		TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr19:8193949G>A	ENST00000600128.1	-	18	2673	c.2259C>T	c.(2257-2259)ccC>ccT	p.P753P	FBN3_ENST00000601739.1_Silent_p.P753P|FBN3_ENST00000270509.2_Silent_p.P753P			Q75N90	FBN3_HUMAN	fibrillin 3	753	EGF-like 9; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.					proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(9)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(15)|lung(53)|ovary(7)|pancreas(2)|prostate(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	132						AGTGGAAGCCGGGGGGGCAGG	0.597													g|||	1	0.000199681	0.0	0.0	5008	,	,		18394	0.001		0.0	False		,,,				2504	0.0																0								ENSG00000142449	A		0,4406		0,0,2203	43.0	48.0	46.0		2259	-3.0	0.2	19	dbSNP_129	46	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	FBN3	NM_032447.3		0,2,6501	AA,AG,GG		0.0233,0.0,0.0154		753/2810	8193949	2,13004	2203	4300	6503	FBN3	SO:0001819	synonymous_variant	0			GMAF=0.0005	HGNC		CCDS12196.1	19p13	2008-02-05							18794	protein-coding gene	gene with protein product		608529					Standard	NM_032447		Approved		uc002mjf.3	Q75N90		ENST00000600128.1:c.2259C>T	19.37:g.8193949G>A		Somatic	0	79	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	33	36.36	Q75N91|Q75N92|Q75N93|Q86SJ5|Q96JP8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_EGF-like_Ca-bd_dom,pfam_TB_dom,pfam_EG-like_dom,superfamily_TB_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pirsf_FBN,pfscan_EG-like_dom	p.P753	ENST00000600128.1	37	c.2259	CCDS12196.1	19																																																																																			-	pfam_EGF-like_Ca-bd_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pirsf_FBN,pfscan_EG-like_dom		0.597	FBN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN3	protein_coding	OTTHUMT00000461428.2	G	NM_032447	rs60853419		8193949	-1	no_errors	ENST00000270509	ensembl	human	known	74_37	silent	SNP	0.646	A
CLN3	1201	genome.wustl.edu	37	16	28495386	28495386	+	Missense_Mutation	SNP	T	T	C			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr16:28495386T>C	ENST00000569430.1	-	11	1550	c.731A>G	c.(730-732)gAa>gGa	p.E244G	CLN3_ENST00000333496.9_Missense_Mutation_p.E220G|CLN3_ENST00000354630.5_Missense_Mutation_p.E244G|CLN3_ENST00000535392.1_Missense_Mutation_p.E166G|CLN3_ENST00000357076.5_Intron|CLN3_ENST00000567963.1_Missense_Mutation_p.E244G|CLN3_ENST00000565316.1_Missense_Mutation_p.E244G|CLN3_ENST00000359984.7_Missense_Mutation_p.E244G|CLN3_ENST00000568224.1_Missense_Mutation_p.E166G|CLN3_ENST00000357806.7_Missense_Mutation_p.E145G|CLN3_ENST00000395653.4_Missense_Mutation_p.E144G|CLN3_ENST00000360019.2_Missense_Mutation_p.E244G|CLN3_ENST00000355477.5_Missense_Mutation_p.E196G|CLN3_ENST00000357857.9_Missense_Mutation_p.E190G			Q13286	CLN3_HUMAN	ceroid-lipofuscinosis, neuronal 3	244					action potential (GO:0001508)|amyloid precursor protein catabolic process (GO:0042987)|arginine transport (GO:0015809)|associative learning (GO:0008306)|autophagic vacuole fusion (GO:0000046)|cell death (GO:0008219)|cellular amino acid metabolic process (GO:0006520)|ceramide metabolic process (GO:0006672)|cytosolic calcium ion homeostasis (GO:0051480)|galactosylceramide metabolic process (GO:0006681)|globoside metabolic process (GO:0001575)|glucosylceramide metabolic process (GO:0006678)|ionotropic glutamate receptor signaling pathway (GO:0035235)|lysosomal lumen acidification (GO:0007042)|lysosomal lumen pH elevation (GO:0035752)|lysosome organization (GO:0007040)|macroautophagy (GO:0016236)|membrane organization (GO:0061024)|negative regulation of apoptotic process (GO:0043066)|negative regulation of catalytic activity (GO:0043086)|negative regulation of macroautophagy (GO:0016242)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of proteolysis (GO:0045861)|neuromuscular process controlling balance (GO:0050885)|neurotransmitter metabolic process (GO:0042133)|protein catabolic process (GO:0030163)|protein processing (GO:0016485)|receptor-mediated endocytosis (GO:0006898)|sphingomyelin metabolic process (GO:0006684)|vacuolar transport (GO:0007034)|vesicle transport along microtubule (GO:0047496)	autophagic vacuole (GO:0005776)|caveola (GO:0005901)|cytoplasm (GO:0005737)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|trans-Golgi network (GO:0005802)	unfolded protein binding (GO:0051082)			breast(1)|large_intestine(2)|lung(11)|upper_aerodigestive_tract(1)	15						GCTCTCTGCTTCTTCTTCCCC	0.567																																																	0								ENSG00000188603						47.0	44.0	45.0					16																	28495386		2197	4300	6497	CLN3	SO:0001583	missense	0			-	HGNC	U32680	CCDS10632.1, CCDS73852.1, CCDS73853.1, CCDS73854.1, CCDS73855.1	16p12	2014-09-17	2008-07-29		ENSG00000188603	ENSG00000188603			2074	protein-coding gene	gene with protein product	"""juvenile neuronal ceroid lipofuscinosis"""	607042	"""Batten, Spielmeyer-Vogt disease"""	BTS		18317235	Standard	NM_001042432		Approved	JNCL	uc002dpp.3	Q13286	OTTHUMG00000097024	ENST00000569430.1:c.731A>G	16.37:g.28495386T>C	ENSP00000454229:p.Glu244Gly	Somatic	0	82	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	29	12.12	B2R7J1|O00668|O95089|Q549S9|Q9UP09|Q9UP11|Q9UP12|Q9UP13|Q9UP14	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Battenin_disease_Cln3,superfamily_MFS_dom_general_subst_transpt,pirsf_Battenin_disease_Cln3_subgr,prints_Battenin_disease_Cln3	p.E244G	ENST00000569430.1	37	c.731	CCDS10632.1	16	.	.	.	.	.	.	.	.	.	.	T	10.63	1.405265	0.25378	.	.	ENSG00000188603	ENST00000535392;ENST00000359984;ENST00000360019;ENST00000354630;ENST00000355477;ENST00000357857;ENST00000333496;ENST00000395653;ENST00000357806	D;D;D;D;D;D;D;D	0.96856	-4.15;-4.15;-4.15;-4.15;-4.15;-4.15;-4.15;-4.15	5.28	2.91	0.33838	Major facilitator superfamily domain, general substrate transporter (1);	0.432694	0.24654	N	0.036690	D	0.95001	0.8382	L	0.28608	0.87	0.24027	N	0.996121	D;B;B;B;P;D;P;B;B;B;B;B;B	0.59767	0.961;0.001;0.001;0.001;0.918;0.986;0.762;0.101;0.002;0.0;0.001;0.0;0.083	P;B;B;B;P;D;P;B;B;B;B;B;B	0.64144	0.721;0.006;0.004;0.005;0.697;0.922;0.565;0.119;0.01;0.004;0.004;0.002;0.07	D	0.87729	0.2578	10	0.72032	D	0.01	-9.5191	6.2956	0.21085	0.1549:0.0:0.1598:0.6853	.	144;220;244;244;295;91;121;142;144;190;196;244;145	B4DFT5;B4DXL3;Q13286-3;Q13286-4;B4DIA8;O95093;O95090;O95086;B4DMY6;B4DFF3;Q13286-2;Q13286;O95089	.;.;.;.;.;.;.;.;.;.;.;CLN3_HUMAN;.	G	166;244;244;244;196;190;121;144;145	ENSP00000443221:E166G;ENSP00000353073:E244G;ENSP00000353116:E244G;ENSP00000346650:E244G;ENSP00000347660:E196G;ENSP00000350523:E190G;ENSP00000379014:E144G;ENSP00000350457:E145G	ENSP00000329171:E121G	E	-	2	0	CLN3	28402887	0.195000	0.23338	0.879000	0.34478	0.335000	0.28730	1.314000	0.33597	2.004000	0.58718	0.454000	0.30748	GAA	-	pfam_Battenin_disease_Cln3,superfamily_MFS_dom_general_subst_transpt,pirsf_Battenin_disease_Cln3_subgr		0.567	CLN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLN3	protein_coding	OTTHUMT00000214115.2	T		-		28495386	-1	no_errors	ENST00000359984	ensembl	human	known	74_37	missense	SNP	0.077	C
STAU2	27067	genome.wustl.edu	37	8	74621369	74621369	+	Silent	SNP	T	T	A			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr8:74621369T>A	ENST00000524300.1	-	4	362	c.12A>T	c.(10-12)ccA>ccT	p.P4P	RP11-463D19.1_ENST00000533978.1_lincRNA|STAU2_ENST00000521419.1_Intron|STAU2_ENST00000519961.1_Silent_p.P4P|STAU2_ENST00000517542.1_Intron|STAU2_ENST00000523558.1_Intron|STAU2_ENST00000524104.1_Intron|STAU2_ENST00000521727.1_Intron|RP11-463D19.2_ENST00000358757.5_Intron|STAU2_ENST00000355780.5_Intron|STAU2_ENST00000521210.1_Intron|STAU2_ENST00000522695.1_Intron|STAU2_ENST00000522962.1_5'UTR|STAU2_ENST00000521451.1_Intron|STAU2_ENST00000522509.1_Intron	NM_001164380.1|NM_001164381.1	NP_001157852.1|NP_001157853.1	Q9NUL3	STAU2_HUMAN	staufen double-stranded RNA binding protein 2	4					transport (GO:0006810)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)	double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|liver(1)|lung(6)|ovary(1)	19	Breast(64;0.0138)		Epithelial(68;0.026)|BRCA - Breast invasive adenocarcinoma(89;0.0483)|all cancers(69;0.0972)			TTTTCTCTTTTGGGTTTGCCA	0.358																																																	0								ENSG00000040341						92.0	76.0	81.0					8																	74621369		692	1590	2282	STAU2	SO:0001819	synonymous_variant	0			-	HGNC	Y19062	CCDS6214.1, CCDS55244.1, CCDS55245.1, CCDS55246.1, CCDS55247.1, CCDS55248.1	8q21.11	2013-06-05	2013-06-05		ENSG00000040341	ENSG00000040341			11371	protein-coding gene	gene with protein product		605920	"""staufen (Drosophila, RNA-binding protein) homolog 2"", ""staufen, RNA binding protein, homolog 2 (Drosophila)"""			10585778	Standard	NM_014393		Approved	39K2	uc003xzm.3	Q9NUL3	OTTHUMG00000164499	ENST00000524300.1:c.12A>T	8.37:g.74621369T>A		Somatic	0	77	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	27	10.00	B7Z1I6|B7Z292|B7Z8B4|E7ER74|E9PEI3|E9PF26|E9PF50|Q6AHY7|Q96HM0|Q96HM1|Q9NVI5|Q9UGG6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_dsRNA-bd_dom,smart_dsRNA-bd_dom,pfscan_dsRNA-bd_dom	p.P4	ENST00000524300.1	37	c.12	CCDS55247.1	8																																																																																			-	NULL		0.358	STAU2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAU2	protein_coding	OTTHUMT00000379000.2	T	NM_001164380	-		74621369	-1	no_errors	ENST00000524300	ensembl	human	known	74_37	silent	SNP	1.000	A
DIP2B	57609	genome.wustl.edu	37	12	51112505	51112505	+	Silent	SNP	T	T	G			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr12:51112505T>G	ENST00000301180.5	+	24	2899	c.2865T>G	c.(2863-2865)gcT>gcG	p.A955A		NM_173602.2	NP_775873.2	Q9P265	DIP2B_HUMAN	DIP2 disco-interacting protein 2 homolog B (Drosophila)	955						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(15)|lung(18)|ovary(4)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	60						TAGGCCCTGCTTCCGTGATGG	0.458																																																	0								ENSG00000066084						137.0	114.0	122.0					12																	51112505		2203	4300	6503	DIP2B	SO:0001819	synonymous_variant	0			-	HGNC	AB040896	CCDS31799.1	12q13.12	2012-10-02	2006-01-13		ENSG00000066084	ENSG00000066084			29284	protein-coding gene	gene with protein product		611379					Standard	XM_005269044		Approved	KIAA1463, FLJ34278	uc001rwv.3	Q9P265	OTTHUMG00000169475	ENST00000301180.5:c.2865T>G	12.37:g.51112505T>G		Somatic	0	76	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	28	20.00	Q6B011|Q8N1L5|Q8NB38	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_AMP-dep_Synth/Lig,pfam_DMAP1-bd	p.A955	ENST00000301180.5	37	c.2865	CCDS31799.1	12																																																																																			-	NULL		0.458	DIP2B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DIP2B	protein_coding	OTTHUMT00000404243.1	T	NM_173602	-		51112505	+1	no_errors	ENST00000301180	ensembl	human	known	74_37	silent	SNP	0.986	G
TSPAN19	144448	genome.wustl.edu	37	12	85421771	85421771	+	Missense_Mutation	SNP	G	G	A			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr12:85421771G>A	ENST00000532498.2	-	4	250	c.170C>T	c.(169-171)tCt>tTt	p.S57F	TSPAN19_ENST00000547403.2_Intron	NM_001100917.1	NP_001094387.1	P0C672	TSN19_HUMAN	tetraspanin 19	57						integral component of membrane (GO:0016021)				ovary(1)	1						CAAAATTTGAGAAATAGGTAC	0.289																																																	0								ENSG00000231738						59.0	54.0	56.0					12																	85421771		1804	4066	5870	TSPAN19	SO:0001583	missense	0			-	HGNC		CCDS44949.1	12q21.31	2013-02-14			ENSG00000231738	ENSG00000231738		"""Tetraspanins"""	31886	protein-coding gene	gene with protein product							Standard	NM_001100917		Approved		uc009zsj.3	P0C672	OTTHUMG00000166181	ENST00000532498.2:c.170C>T	12.37:g.85421771G>A	ENSP00000433816:p.Ser57Phe	Somatic	0	91	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	180	165	52.17		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2,prints_Tetraspanin	p.S57F	ENST00000532498.2	37	c.170	CCDS44949.1	12	.	.	.	.	.	.	.	.	.	.	G	6.419	0.445465	0.12164	.	.	ENSG00000231738	ENST00000532498;ENST00000547836	T;T	0.79554	-1.28;-1.28	4.4	1.35	0.21983	.	.	.	.	.	T	0.68118	0.2966	L	0.29908	0.895	0.09310	N	1	B	0.12630	0.006	B	0.14023	0.01	T	0.56214	-0.8016	9	0.48119	T	0.1	.	7.2829	0.26322	0.2951:0.0:0.7049:0.0	.	57	P0C672	TSN19_HUMAN	F	57	ENSP00000433816:S57F;ENSP00000446898:S57F	ENSP00000433816:S57F	S	-	2	0	TSPAN19	83945902	0.112000	0.22096	0.002000	0.10522	0.047000	0.14425	0.260000	0.18424	0.129000	0.18514	0.655000	0.94253	TCT	-	pfam_Tetraspanin/Peripherin,prints_Tetraspanin		0.289	TSPAN19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSPAN19	protein_coding	OTTHUMT00000388240.2	G	NM_001100917	-		85421771	-1	no_errors	ENST00000532498	ensembl	human	known	74_37	missense	SNP	0.013	A
AK9	221264	genome.wustl.edu	37	6	109906341	109906342	+	Frame_Shift_Del	DEL	TC	TC	-	rs200236581|rs55642342|rs78047280		TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	TC	TC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr6:109906341_109906342delTC	ENST00000424296.2	-	19	2174_2175	c.2098_2099delGA	c.(2098-2100)gaafs	p.E703fs	AK9_ENST00000368948.2_Frame_Shift_Del_p.E703fs|AK9_ENST00000341338.6_5'UTR	NM_001145128.2	NP_001138600.2	Q5TCS8	KAD9_HUMAN	adenylate kinase 9	703					ADP phosphorylation (GO:0006757)|AMP phosphorylation (GO:0006756)|CDP phosphorylation (GO:0061508)|CMP phosphorylation (GO:0061566)|dADP phosphorylation (GO:0006174)|dAMP phosphorylation (GO:0061565)|dCDP phosphorylation (GO:0061570)|dCMP phosphorylation (GO:0061567)|dGDP phosphorylation (GO:0006186)|GDP phosphorylation (GO:0061568)|TDP phosphorylation (GO:0061571)|UDP phosphorylation (GO:0061569)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|nucleoside diphosphate kinase activity (GO:0004550)|nucleoside phosphate kinase activity (GO:0050145)										TTCTTCTTCTTCTTTTTTTTTC	0.238																																																	0								ENSG00000155085			355,1193		75,205,494						-1.0	0.7		dbSNP_129	5	1018,2100		253,512,794	no	frameshift	AKD1	NM_001145128.2		328,717,1288	A1A1,A1R,RR		32.6491,22.9328,29.4256				1373,3293				AK9	SO:0001589	frameshift_variant	0				HGNC	AK131244, BC146443, BC087860	CCDS5077.1, CCDS55048.1	6q21	2013-04-29	2013-04-29	2013-04-29			2.7.4.3		33814	protein-coding gene	gene with protein product		615358	"""chromosome 6 open reading frame 224"", ""adenylate kinase domain containing 2"", ""chromosome 6 open reading frame 199"", ""adenylate kinase domain containing 1"""	C6orf224, AKD2, C6orf199, AKD1		23416111	Standard	NM_145025		Approved	FLJ42177, FLJ25791, dJ70A9.1, MGC26954		Q5TCS8		ENST00000424296.2:c.2098_2099delGA	6.37:g.109906341_109906342delTC	ENSP00000410186:p.Glu703fs	Somatic	0	107	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	23	11.54	A6NL75|B2RDJ0|B6ZDM7|Q3MIS4|Q5I0W8|Q6ZNF1|Q6ZVR7|Q8N7C6|Q8WW00|Q96NF4	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Adenylate_kin,pfam_YHS_dom,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.E700fs	ENST00000424296.2	37	c.2099_2098	CCDS55048.1	6																																																																																			-	superfamily_P-loop_NTPase		0.238	AK9-202	KNOWN	basic|appris_principal|CCDS	protein_coding	AK9	protein_coding		TC	NM_001145128			109906342	-1	no_errors	ENST00000424296	ensembl	human	known	74_37	frame_shift_del	DEL	0.825:0.777	-
NRXN3	9369	genome.wustl.edu	37	14	80328258	80328258	+	Missense_Mutation	SNP	A	A	G	rs200832810		TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr14:80328258A>G	ENST00000557594.1	+	6	2818	c.1865A>G	c.(1864-1866)aAg>aGg	p.K622R	NRXN3_ENST00000428277.2_Missense_Mutation_p.K444R|NRXN3_ENST00000554719.1_Missense_Mutation_p.K1046R|NRXN3_ENST00000335750.5_Missense_Mutation_p.K1046R|NRXN3_ENST00000556003.1_3'UTR|NRXN3_ENST00000281127.7_Missense_Mutation_p.K417R	NM_001272020.1	NP_001258949.1	Q9HDB5	NRX3B_HUMAN	neurexin 3	622					adult behavior (GO:0030534)|angiogenesis (GO:0001525)|learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(23)|lung(40)|ovary(3)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(9)|urinary_tract(1)	104		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		CAGAGCTCGAAGAGCGGCCAC	0.522																																																	0								ENSG00000021645						78.0	81.0	80.0					14																	80328258		2203	4300	6503	NRXN3	SO:0001583	missense	0			GMAF=0	HGNC	AB018286	CCDS9870.1, CCDS9871.1, CCDS45145.1, CCDS61515.1	14q31	2010-01-19				ENSG00000021645			8010	protein-coding gene	gene with protein product		600567	"""chromosome 14 open reading frame 60"""	C14orf60		11944992, 12379233	Standard	NM_004796		Approved	KIAA0743	uc001xun.4	Q9HDB5		ENST00000557594.1:c.1865A>G	14.37:g.80328258A>G	ENSP00000451672:p.Lys622Arg	Somatic	0	17	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	6	36.36	A5PKW8|A8MPU5|B3KPM7|Q6NUR0|Q8IUD8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,smart_EG-like_dom,smart_Neurexin-like,pfscan_EG-like_dom,pfscan_Laminin_G	p.K1046R	ENST00000557594.1	37	c.3137		14	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	A	16.99	3.273327	0.59649	.	.	ENSG00000021645	ENST00000330071;ENST00000554719;ENST00000335750;ENST00000557594;ENST00000281127;ENST00000428277	T;T;T;T;T	0.70986	-0.53;-0.53;1.03;1.24;1.04	5.9	5.9	0.94986	.	0.108957	0.64402	D	0.000009	T	0.75606	0.3872	M	0.61703	1.905	0.40838	D	0.983641	P;P;D;B	0.57899	0.902;0.952;0.981;0.122	B;P;P;B	0.50537	0.318;0.6;0.643;0.173	T	0.76761	-0.2840	9	.	.	.	.	16.3322	0.83039	1.0:0.0:0.0:0.0	.	444;417;622;1046	Q9HDB5-4;Q9HDB5-2;Q9HDB5;Q9Y4C0-3	.;.;NRX3B_HUMAN;.	R	1628;1046;1046;622;417;444	ENSP00000451648:K1046R;ENSP00000338349:K1046R;ENSP00000451672:K622R;ENSP00000281127:K417R;ENSP00000394426:K444R	.	K	+	2	0	NRXN3	79398011	1.000000	0.71417	0.998000	0.56505	0.987000	0.75469	9.339000	0.96797	2.251000	0.74343	0.528000	0.53228	AAG	-	NULL		0.522	NRXN3-004	NOVEL	basic	protein_coding	NRXN3	protein_coding	OTTHUMT00000413790.1	A	NM_001105250	rs200832810		80328258	+1	no_errors	ENST00000335750	ensembl	human	known	74_37	missense	SNP	1.000	G
ZNF486	90649	genome.wustl.edu	37	19	20296831	20296831	+	Silent	SNP	C	C	T			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr19:20296831C>T	ENST00000335117.8	+	3	250	c.193C>T	c.(193-195)Ctg>Ttg	p.L65L	CTC-260E6.6_ENST00000593655.1_RNA|ZNF486_ENST00000597083.1_Silent_p.L65L|CTC-260E6.6_ENST00000586657.1_RNA|CTC-260E6.6_ENST00000585498.1_RNA	NM_052852.3	NP_443084.2	Q96H40	ZN486_HUMAN	zinc finger protein 486	65	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|large_intestine(3)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	11						GATCACCTGTCTGGAGCAAGG	0.373																																																	0								ENSG00000256229						80.0	83.0	82.0					19																	20296831		2173	4293	6466	ZNF486	SO:0001819	synonymous_variant	0			-	HGNC	BC008936	CCDS46029.1	19p12	2014-02-13	2003-12-16	2003-12-17	ENSG00000256229	ENSG00000256229		"""Zinc fingers, C2H2-type"", ""-"""	20807	protein-coding gene	gene with protein product			"""KRAB domain only 2"""	KRBO2			Standard	NM_052852		Approved	MGC2396	uc002nou.3	Q96H40	OTTHUMG00000179731	ENST00000335117.8:c.193C>T	19.37:g.20296831C>T		Somatic	0	94	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	47	17.54	Q0VG00	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.L65	ENST00000335117.8	37	c.193	CCDS46029.1	19																																																																																			-	superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box		0.373	ZNF486-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF486	protein_coding	OTTHUMT00000447843.2	C	NM_052852	-		20296831	+1	no_errors	ENST00000335117	ensembl	human	known	74_37	silent	SNP	0.043	T
HEATR4	399671	genome.wustl.edu	37	14	73962072	73962072	+	Missense_Mutation	SNP	T	T	G			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr14:73962072T>G	ENST00000553558.1	-	16	2966	c.2645A>C	c.(2644-2646)aAg>aCg	p.K882T	HEATR4_ENST00000334988.2_Missense_Mutation_p.K882T|C14orf169_ENST00000531973.1_RNA|HEATR4_ENST00000560393.1_Missense_Mutation_p.K835T	NM_001220484.1	NP_001207413.1	Q86WZ0	HEAT4_HUMAN	HEAT repeat containing 4	882										breast(3)|endometrium(2)|kidney(2)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	28				BRCA - Breast invasive adenocarcinoma(234;0.00386)|OV - Ovarian serous cystadenocarcinoma(108;0.0719)		CAGCAAGTCCTTTTGGCTTAG	0.348																																																	0								ENSG00000187105						123.0	109.0	114.0					14																	73962072		2203	4300	6503	HEATR4	SO:0001583	missense	0			-	HGNC	BC047590	CCDS9815.1, CCDS9815.2	14q24.3	2013-09-20			ENSG00000187105	ENSG00000187105			16761	protein-coding gene	gene with protein product						15489334	Standard	NM_203309		Approved	MGC48595	uc021rwf.2	Q86WZ0	OTTHUMG00000171602	ENST00000553558.1:c.2645A>C	14.37:g.73962072T>G	ENSP00000450444:p.Lys882Thr	Somatic	0	76	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	28	9.68	B7Z7V9|E9KL41	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_HEAT,superfamily_ARM-type_fold	p.K882T	ENST00000553558.1	37	c.2645	CCDS9815.2	14	.	.	.	.	.	.	.	.	.	.	T	15.79	2.938549	0.52972	.	.	ENSG00000187105	ENST00000553558;ENST00000334988	T	0.13307	2.6	4.82	4.82	0.62117	Armadillo-type fold (1);	0.000000	0.52532	D	0.000078	T	0.23806	0.0576	L	0.27053	0.805	0.32417	N	0.549903	D	0.89917	1.0	D	0.83275	0.996	T	0.15896	-1.0421	10	0.87932	D	0	-17.9489	12.0061	0.53259	0.0:0.0:0.0:1.0	.	882	Q86WZ0	HEAT4_HUMAN	T	882;835	ENSP00000450444:K882T	ENSP00000335447:K835T	K	-	2	0	HEATR4	73031825	1.000000	0.71417	1.000000	0.80357	0.506000	0.33950	2.584000	0.46102	2.029000	0.59856	0.459000	0.35465	AAG	-	superfamily_ARM-type_fold		0.348	HEATR4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	HEATR4	protein_coding	OTTHUMT00000414422.2	T	NM_203309	-		73962072	-1	no_errors	ENST00000334988	ensembl	human	known	74_37	missense	SNP	1.000	G
TERF1	7013	genome.wustl.edu	37	8	73921284	73921286	+	In_Frame_Del	DEL	GAG	GAG	-			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	GAG	GAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr8:73921284_73921286delGAG	ENST00000276603.5	+	1	186_188	c.163_165delGAG	c.(163-165)gagdel	p.E62del	TERF1_ENST00000276602.6_In_Frame_Del_p.E62del	NM_017489.2	NP_059523.2	P54274	TERF1_HUMAN	telomeric repeat binding factor (NIMA-interacting) 1	62	Asp/Glu-rich (acidic).|Poly-Glu.|TRFH dimerization.				age-dependent telomere shortening (GO:0001309)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of DNA replication (GO:0008156)|negative regulation of telomerase activity (GO:0051974)|negative regulation of telomere maintenance via semi-conservative replication (GO:0032214)|negative regulation of telomere maintenance via telomerase (GO:0032211)|positive regulation of apoptotic process (GO:0043065)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of mitosis (GO:0045840)|positive regulation of mitotic cell cycle (GO:0045931)|protein homooligomerization (GO:0051260)|response to drug (GO:0042493)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)|telomere maintenance via telomere shortening (GO:0010834)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nuclear telomere cap complex (GO:0000783)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|double-stranded telomeric DNA binding (GO:0003691)|microtubule binding (GO:0008017)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|telomeric DNA binding (GO:0042162)			central_nervous_system(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	9	Breast(64;0.218)		Epithelial(68;0.0984)			GGGGGCCCCCgaggaggaggagg	0.65																																																	0								ENSG00000147601																																			TERF1	SO:0001651	inframe_deletion	0				HGNC	U74382	CCDS6210.1, CCDS6211.1	8q21.11	2011-05-24			ENSG00000147601	ENSG00000147601			11728	protein-coding gene	gene with protein product		600951		TRBF1		9391075	Standard	NM_003218		Approved	PIN2, TRF1, TRF	uc003xzd.2	P54274	OTTHUMG00000164522	ENST00000276603.5:c.163_165delGAG	8.37:g.73921293_73921295delGAG	ENSP00000276603:p.Glu62del	Somatic	0	46	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	16	11.11	A7XP29|Q15553|Q8NHT6|Q93029	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Telomere_rpt-bd_fac_dimer_dom,pfam_SANT/Myb,superfamily_Telomere_rpt-bd_fac_dimer_dom,superfamily_Homeodomain-like,smart_SANT/Myb,pirsf_Telomere_repeat-bd-1/2,pfscan_Myb-like_dom	p.E58in_frame_del	ENST00000276603.5	37	c.163_165	CCDS6211.1	8																																																																																			-	pirsf_Telomere_repeat-bd-1/2		0.650	TERF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TERF1	protein_coding	OTTHUMT00000379093.1	GAG	NM_017489			73921286	+1	no_errors	ENST00000276603	ensembl	human	known	74_37	in_frame_del	DEL	0.121:0.130:0.144	-
BDNF	627	genome.wustl.edu	37	11	27678795	27678796	+	3'UTR	INS	-	-	A			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr11:27678795_27678796insA	ENST00000525528.1	-	0	2409_2410				BDNF_ENST00000530861.1_3'UTR|BDNF-AS_ENST00000499008.3_RNA|BDNF_ENST00000439476.2_3'UTR|BDNF-AS_ENST00000502161.2_RNA|BDNF_ENST00000418212.1_3'UTR|BDNF-AS_ENST00000501176.2_RNA|BDNF-AS_ENST00000530313.1_RNA|BDNF_ENST00000356660.4_3'UTR|BDNF-AS_ENST00000499568.2_RNA|BDNF_ENST00000395983.3_3'UTR|BDNF-AS_ENST00000500662.2_RNA|BDNF_ENST00000533131.1_3'UTR|BDNF-AS_ENST00000530686.1_RNA|BDNF_ENST00000395980.2_3'UTR|BDNF_ENST00000438929.1_3'UTR|BDNF_ENST00000525950.1_3'UTR|BDNF_ENST00000532997.1_3'UTR|BDNF_ENST00000395981.3_3'UTR|BDNF-AS_ENST00000532965.1_RNA|BDNF_ENST00000314915.6_3'UTR|BDNF_ENST00000420794.1_3'UTR|BDNF_ENST00000584049.1_5'UTR|BDNF_ENST00000533246.1_3'UTR|BDNF_ENST00000395978.3_3'UTR|BDNF_ENST00000395986.2_3'UTR	NM_170735.5	NP_733931.1	P23560	BDNF_HUMAN	brain-derived neurotrophic factor						axon extension (GO:0048675)|axon guidance (GO:0007411)|axon target recognition (GO:0007412)|behavioral fear response (GO:0001662)|chronic inflammatory response (GO:0002544)|circadian rhythm (GO:0007623)|dendrite development (GO:0016358)|dendrite extension (GO:0097484)|feeding behavior (GO:0007631)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glutamate secretion (GO:0014047)|inner ear development (GO:0048839)|learning or memory (GO:0007611)|mechanoreceptor differentiation (GO:0042490)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of striated muscle tissue development (GO:0045843)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|nerve development (GO:0021675)|nervous system development (GO:0007399)|neuron recognition (GO:0008038)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of synapse assembly (GO:0051965)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of retinal cell programmed cell death (GO:0046668)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|response to anesthetic (GO:0072347)|response to fluoxetine (GO:0014076)|response to hormone (GO:0009725)|response to hyperoxia (GO:0055093)|response to hypoxia (GO:0001666)|response to vitamin A (GO:0033189)|taste bud development (GO:0061193)|ureteric bud development (GO:0001657)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|perinuclear region of cytoplasm (GO:0048471)|synaptic vesicle (GO:0008021)	growth factor activity (GO:0008083)			breast(1)|large_intestine(3)|lung(2)	6						acaaacaaacgaaaaaaaaaca	0.361																																																	0								ENSG00000176697																																			BDNF	SO:0001624	3_prime_UTR_variant	0				HGNC	AB038670	CCDS7865.1, CCDS7866.1, CCDS44558.1, CCDS41628.1	11p14.1	2014-01-30			ENSG00000176697	ENSG00000176697		"""Endogenous ligands"""	1033	protein-coding gene	gene with protein product	"""neurotrophin"""	113505				2236018, 1889806, 17942328, 17493809	Standard	NM_170731		Approved		uc009yje.3	P23560	OTTHUMG00000178797	ENST00000525528.1:c.*573->T	11.37:g.27678804_27678804dupA		Somatic	0	61	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	25	10.71	A7LA85|A7LA92|D3DQZ2|Q598Q1|Q6DN19|Q6YNR2|Q6YNR3|Q9BYY7|Q9UC24	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000525528.1	37	NULL	CCDS7866.1	11																																																																																			-	-		0.361	BDNF-016	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	BDNF	protein_coding	OTTHUMT00000388135.1	-	NM_170735			27678796	-1	no_errors	ENST00000584049	ensembl	human	known	74_37	rna	INS	0.810:0.128	A
NGEF	25791	genome.wustl.edu	37	2	233877919	233877919	+	De_novo_Start_InFrame	SNP	C	C	T			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr2:233877919C>T	ENST00000264051.3	-	0	63				AC106876.2_ENST00000409905.1_Missense_Mutation_p.T63I	NM_019850.2	NP_062824.2	Q8N5V2	NGEF_HUMAN	neuronal guanine nucleotide exchange factor						apoptotic signaling pathway (GO:0097190)|ephrin receptor signaling pathway (GO:0048013)|negative regulation of dendritic spine morphogenesis (GO:0061002)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell projection (GO:0042995)|cytosol (GO:0005829)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			central_nervous_system(4)|endometrium(8)|kidney(2)|large_intestine(3)|lung(10)|ovary(3)|pancreas(1)|skin(4)	35		Breast(86;0.00279)|Renal(207;0.00339)|all_hematologic(139;0.00793)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)		Epithelial(121;8.65e-17)|BRCA - Breast invasive adenocarcinoma(100;0.00037)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(119;0.00984)|GBM - Glioblastoma multiforme(43;0.0604)		AGAGAGCCCACAGCCAAAAAC	0.587																																																	0								ENSG00000222001																																			AC106876.2			0			-	Clone_based_vega_gene	AJ238899	CCDS2500.1, CCDS46544.1	2q37	2012-07-24			ENSG00000066248	ENSG00000066248		"""Rho guanine nucleotide exchange factors"""	7807	protein-coding gene	gene with protein product	"""ephexin"""	605991				10777665	Standard	NM_019850		Approved	ARHGEF27	uc002vts.2	Q8N5V2	OTTHUMG00000133272		2.37:g.233877919C>T		Somatic	0	93	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	B4DMB8|B9A045|E9PC42|Q53QQ4|Q53ST7|Q6GMQ5|Q9NQD6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.T63I	ENST00000264051.3	37	c.188	CCDS2500.1	2	.	.	.	.	.	.	.	.	.	.	C	9.290	1.050466	0.19827	.	.	ENSG00000222001	ENST00000409905	.	.	.	3.24	0.253	0.15551	.	.	.	.	.	T	0.37489	0.1005	.	.	.	0.09310	N	0.999998	.	.	.	.	.	.	T	0.38499	-0.9658	5	0.87932	D	0	.	4.2293	0.10596	0.3968:0.4873:0.0:0.1159	.	.	.	.	I	63	.	ENSP00000386846:T63I	T	+	2	0	AC106876.2	233586163	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	0.024000	0.13555	0.038000	0.15604	0.655000	0.94253	ACA	-	NULL		0.587	NGEF-001	KNOWN	basic|CCDS	protein_coding	ENSG00000222001	protein_coding	OTTHUMT00000257051.2	C	XM_044799	-		233877919	+1	no_errors	ENST00000409905	ensembl	human	putative	74_37	missense	SNP	0.000	T
KIAA2018	205717	genome.wustl.edu	37	3	113377201	113377201	+	Missense_Mutation	SNP	C	C	T			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr3:113377201C>T	ENST00000478658.1	-	5	3345	c.3328G>A	c.(3328-3330)Gaa>Aaa	p.E1110K	KIAA2018_ENST00000491165.1_Intron|KIAA2018_ENST00000316407.4_Missense_Mutation_p.E1110K			Q68DE3	K2018_HUMAN	KIAA2018	1110						membrane (GO:0016020)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			NS(1)|breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(30)|ovary(8)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	80						GTCACATCTTCTCTTGTTGTT	0.443																																																	0								ENSG00000176542						146.0	137.0	140.0					3																	113377201		1989	4173	6162	KIAA2018	SO:0001583	missense	0			-	HGNC	AB095938	CCDS43133.1	3q13.2	2014-01-02			ENSG00000176542	ENSG00000176542			30494	protein-coding gene	gene with protein product							Standard	XM_005247208		Approved		uc003eam.3	Q68DE3	OTTHUMG00000159322	ENST00000478658.1:c.3328G>A	3.37:g.113377201C>T	ENSP00000420721:p.Glu1110Lys	Somatic	0	34	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	7	41.67	Q7Z3L9|Q8IVF3|Q9H8T4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.E1110K	ENST00000478658.1	37	c.3328	CCDS43133.1	3	.	.	.	.	.	.	.	.	.	.	C	19.31	3.802376	0.70682	.	.	ENSG00000176542	ENST00000316407;ENST00000478658	T;T	0.15834	2.39;2.39	4.9	4.9	0.64082	.	0.106321	0.41294	N	0.000917	T	0.31606	0.0802	L	0.29908	0.895	0.52501	D	0.999957	D	0.69078	0.997	D	0.75020	0.985	T	0.05022	-1.0911	10	0.59425	D	0.04	-11.3644	18.2797	0.90094	0.0:1.0:0.0:0.0	.	1110	Q68DE3	K2018_HUMAN	K	1110	ENSP00000320794:E1110K;ENSP00000420721:E1110K	ENSP00000320794:E1110K	E	-	1	0	KIAA2018	114859891	1.000000	0.71417	1.000000	0.80357	0.829000	0.46940	5.105000	0.64591	2.560000	0.86352	0.561000	0.74099	GAA	-	NULL		0.443	KIAA2018-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	KIAA2018	protein_coding	OTTHUMT00000354591.1	C	NM_001009899	-		113377201	-1	no_errors	ENST00000316407	ensembl	human	known	74_37	missense	SNP	1.000	T
DDX58	23586	genome.wustl.edu	37	9	32466417	32466417	+	Missense_Mutation	SNP	G	G	T			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr9:32466417G>T	ENST00000379883.2	-	16	2365	c.2208C>A	c.(2206-2208)agC>agA	p.S736R	DDX58_ENST00000379868.1_Missense_Mutation_p.S533R|DDX58_ENST00000545044.1_Missense_Mutation_p.A532E|DDX58_ENST00000542096.1_Missense_Mutation_p.S665R|DDX58_ENST00000379882.1_Missense_Mutation_p.S691R	NM_014314.3	NP_055129.2	O95786	DDX58_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 58	736	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.|Interaction with ZC3HAV1.|Repressor domain.				cytoplasmic pattern recognition receptor signaling pathway in response to virus (GO:0039528)|detection of virus (GO:0009597)|innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell migration (GO:0030334)|regulation of type III interferon production (GO:0034344)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|RIG-I signaling pathway (GO:0039529)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	ATP binding (GO:0005524)|double-stranded DNA binding (GO:0003690)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|identical protein binding (GO:0042802)|single-stranded RNA binding (GO:0003727)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|liver(1)|lung(9)|ovary(2)|pancreas(1)|prostate(1)	27			LUSC - Lung squamous cell carcinoma(29;0.00813)	GBM - Glioblastoma multiforme(74;0.00056)		GGAAGCACTTGCTACCTCTTG	0.318																																																	0								ENSG00000107201						120.0	110.0	113.0					9																	32466417		2203	4300	6503	DDX58	SO:0001583	missense	0			-	HGNC	AF038963	CCDS6526.1	9p12	2011-08-05			ENSG00000107201	ENSG00000107201		"""DEAD-boxes"""	19102	protein-coding gene	gene with protein product	"""RNA helicase RIG-I"", ""retinoic acid inducible gene I"""	609631				21690088	Standard	NM_014314		Approved	RIG-I, FLJ13599, DKFZp434J1111	uc003zra.3	O95786	OTTHUMG00000019746	ENST00000379883.2:c.2208C>A	9.37:g.32466417G>T	ENSP00000369213:p.Ser736Arg	Somatic	0	88	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	34	10.53	A2RU81|Q5HYE1|Q5VYT1|Q9NT04	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RIG-I_C-RD,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase/UvrB_dom,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_DEATH-like_dom,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.S736R	ENST00000379883.2	37	c.2208	CCDS6526.1	9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.87|16.87	3.242889|3.242889	0.58995|0.58995	.|.	.|.	ENSG00000107201|ENSG00000107201	ENST00000545044|ENST00000379882;ENST00000379883;ENST00000379868;ENST00000542096	T|T;T;T;T	0.09255|0.47177	3.0|0.85;0.85;0.85;0.85	5.45|5.45	5.45|5.45	0.79879|0.79879	.|Helicase, C-terminal (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.79028|0.79028	0.4377|0.4377	H|H	0.95611|0.95611	3.695|3.695	0.25255|0.25255	N|N	0.989644|0.989644	D|D;D;D	0.89917|0.89917	1.0|1.0;1.0;1.0	D|D;D;D	0.87578|0.97110	0.998|1.0;1.0;0.996	T|T	0.76030|0.76030	-0.3108|-0.3108	9|10	0.02654|0.72032	T|D	1|0.01	-15.2077|-15.2077	18.4259|18.4259	0.90608|0.90608	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	532|691;665;736	F5H5W6|O95786-2;B3KWW1;O95786	.|.;.;DDX58_HUMAN	E|R	532|691;736;533;665	ENSP00000443055:A532E|ENSP00000369212:S691R;ENSP00000369213:S736R;ENSP00000369197:S533R;ENSP00000442160:S665R	ENSP00000443055:A532E|ENSP00000369197:S533R	A|S	-|-	2|3	0|2	DDX58|DDX58	32456417|32456417	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	5.268000|5.268000	0.65536|0.65536	2.725000|2.725000	0.93324|0.93324	0.655000|0.655000	0.94253|0.94253	GCA|AGC	-	superfamily_P-loop_NTPase,pfscan_Helicase_C		0.318	DDX58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX58	protein_coding	OTTHUMT00000052011.1	G	NM_014314	-		32466417	-1	no_errors	ENST00000379883	ensembl	human	known	74_37	missense	SNP	1.000	T
EPB41L1	2036	genome.wustl.edu	37	20	34795631	34795631	+	Intron	SNP	C	C	T			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr20:34795631C>T	ENST00000338074.2	+	15	1829				EPB41L1_ENST00000441639.1_Intron|EPB41L1_ENST00000373941.1_Intron|EPB41L1_ENST00000202028.5_Intron|EPB41L1_ENST00000373946.3_Intron|EPB41L1_ENST00000479336.1_3'UTR|EPB41L1_ENST00000373950.2_Intron	NM_001258329.1|NM_012156.2	NP_001245258.1|NP_036288.2	Q9H4G0	E41L1_HUMAN	erythrocyte membrane protein band 4.1-like 1						cortical actin cytoskeleton organization (GO:0030866)|synaptic transmission (GO:0007268)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|plasma membrane (GO:0005886)	structural molecule activity (GO:0005198)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(10)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	37	Breast(12;0.0239)					CCAGGAAGCACACACGGAACT	0.597																																																	0								ENSG00000088367																																			EPB41L1	SO:0001627	intron_variant	0			-	HGNC	AB002336	CCDS13271.1, CCDS13272.1, CCDS58771.1	20q11.2-q12	2003-03-17			ENSG00000088367	ENSG00000088367			3378	protein-coding gene	gene with protein product		602879				9570967, 9828140	Standard	NM_012156		Approved	KIAA0338	uc002xfb.3	Q9H4G0	OTTHUMG00000032378	ENST00000338074.2:c.1669-1779C>T	20.37:g.34795631C>T		Somatic	0	57	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	18	14.29	O15046|Q4VXM6|Q4VXM7|Q4VXM8|Q4VXN4|Q6ZT61|Q8IUU7|Q96CV5|Q96L65	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000338074.2	37	NULL	CCDS13271.1	20	.	.	.	.	.	.	.	.	.	.	C	0.654	-0.808527	0.02819	.	.	ENSG00000088367	ENST00000344237	.	.	.	5.74	-10.3	0.00346	.	2.670400	0.01138	N	0.006136	T	0.21921	0.0528	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.08534	-1.0717	8	0.15066	T	0.55	0.3275	11.5664	0.50807	0.0:0.5171:0.3275:0.1554	.	786	E9PCJ3	.	Y	786	.	ENSP00000339184:H786Y	H	+	1	0	EPB41L1	34259045	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.546000	0.06062	-1.647000	0.01511	-0.136000	0.14681	CAC	-	-		0.597	EPB41L1-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EPB41L1	protein_coding	OTTHUMT00000078978.3	C	NM_012156	-		34795631	+1	no_errors	ENST00000479336	ensembl	human	known	74_37	rna	SNP	0.000	T
UBP1	7342	genome.wustl.edu	37	3	33481266	33481266	+	Silent	SNP	G	G	T			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr3:33481266G>T	ENST00000283629.3	-	1	604	c.75C>A	c.(73-75)ggC>ggA	p.G25G	UBP1_ENST00000447368.2_Silent_p.G25G|UBP1_ENST00000283628.5_Silent_p.G25G	NM_001128161.1|NM_014517.4	NP_001121633.1|NP_055332.3	Q9NZI7	UBIP1_HUMAN	upstream binding protein 1 (LBP-1a)	25					angiogenesis (GO:0001525)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral genome replication (GO:0019079)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(2)|kidney(4)|large_intestine(6)|lung(6)|ovary(2)|prostate(1)|urinary_tract(2)	23						CCTGCCCGATGCCCGAGAGGC	0.687																																																	0								ENSG00000153560						49.0	53.0	52.0					3																	33481266		2202	4297	6499	UBP1	SO:0001819	synonymous_variant	0			-	HGNC	AF198487	CCDS2659.1, CCDS46788.1	3p22.3	2004-03-02			ENSG00000153560	ENSG00000153560			12507	protein-coding gene	gene with protein product		609784				8114710	Standard	NM_014517		Approved	LBP-1a	uc010hga.3	Q9NZI7	OTTHUMG00000130749	ENST00000283629.3:c.75C>A	3.37:g.33481266G>T		Somatic	0	35	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	9	25.00	Q68CT0|Q86Y57|Q9H8V0|Q9UD76|Q9UD78	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_CP2,superfamily_SAM/pointed	p.G25	ENST00000283629.3	37	c.75	CCDS2659.1	3																																																																																			-	NULL		0.687	UBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBP1	protein_coding	OTTHUMT00000253249.2	G	NM_014517	-		33481266	-1	no_errors	ENST00000283628	ensembl	human	known	74_37	silent	SNP	1.000	T
MSH3	4437	genome.wustl.edu	37	5	79968152	79968152	+	Silent	SNP	A	A	T			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr5:79968152A>T	ENST00000265081.6	+	5	962	c.882A>T	c.(880-882)gtA>gtT	p.V294V		NM_002439.4	NP_002430.3	P20585	MSH3_HUMAN	mutS homolog 3	294	Interaction with EXO1.				ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|maintenance of DNA repeat elements (GO:0043570)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|positive regulation of helicase activity (GO:0051096)|reciprocal meiotic recombination (GO:0007131)|somatic recombination of immunoglobulin gene segments (GO:0016447)	membrane (GO:0016020)|MutSbeta complex (GO:0032302)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)	ATP binding (GO:0005524)|centromeric DNA binding (GO:0019237)|damaged DNA binding (GO:0003684)|DNA-dependent ATPase activity (GO:0008094)|double-strand/single-strand DNA junction binding (GO:0000406)|enzyme binding (GO:0019899)|heteroduplex DNA loop binding (GO:0000404)|Y-form DNA binding (GO:0000403)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(12)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	29		Lung NSC(167;0.00479)|all_lung(232;0.00507)|Ovarian(174;0.0261)|Breast(144;0.244)		OV - Ovarian serous cystadenocarcinoma(54;2.38e-45)|Epithelial(54;1.58e-38)|all cancers(79;4.93e-33)		TTGTTCATGTACGCCGCCTGG	0.413								Mismatch excision repair (MMR)																													Melanoma(88;1010 1399 13793 26548 36275)												0								ENSG00000113318						105.0	100.0	102.0					5																	79968152		2203	4300	6503	MSH3	SO:0001819	synonymous_variant	0			-	HGNC	U61981	CCDS34195.1	5q11-q12	2013-09-12	2013-09-12		ENSG00000113318	ENSG00000113318			7326	protein-coding gene	gene with protein product	"""Divergent upstream protein"", ""Mismatch repair protein 1"""	600887	"""mutS (E. coli) homolog 3"", ""mutS homolog 3 (E. coli)"""				Standard	NM_002439		Approved	DUP, MRP1	uc003kgz.4	P20585	OTTHUMG00000162540	ENST00000265081.6:c.882A>T	5.37:g.79968152A>T		Somatic	0	87	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	21	32.26	A1L480|A1L482|A6NMM6|Q6PJT5|Q86UQ6|Q92867	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_DNA_mismatch_repair_MutS_C,pfam_DNA_mismatch_repair_MutS_core,pfam_DNA_mmatch_repair_MutS_con_dom,pfam_DNA_mismatch_repair_MutS-lik_N,pfam_DNA_mismatch_repair_MutS_clamp,superfamily_DNA_mismatch_repair_MutS_core,superfamily_P-loop_NTPase,superfamily_DNA_mismatch_repair_MutS_N,superfamily_DNA_mmatch_repair_MutS_con_dom,smart_DNA_mismatch_repair_MutS_core,smart_DNA_mismatch_repair_MutS_C	p.V294	ENST00000265081.6	37	c.882	CCDS34195.1	5																																																																																			-	pfam_DNA_mismatch_repair_MutS-lik_N,superfamily_DNA_mismatch_repair_MutS_N		0.413	MSH3-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	MSH3	protein_coding	OTTHUMT00000369471.1	A	NM_002439	-		79968152	+1	no_errors	ENST00000265081	ensembl	human	known	74_37	silent	SNP	0.004	T
MDN1	23195	genome.wustl.edu	37	6	90406215	90406215	+	Missense_Mutation	SNP	A	A	T			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr6:90406215A>T	ENST00000369393.3	-	60	9362	c.9247T>A	c.(9247-9249)Tgg>Agg	p.W3083R	MDN1_ENST00000428876.1_Missense_Mutation_p.W3083R			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	3083					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)			NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		CTCACATCCCAGGGACTTGCT	0.517																																																	0								ENSG00000112159						76.0	74.0	74.0					6																	90406215		2203	4300	6503	MDN1	SO:0001583	missense	0			-	HGNC	AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.9247T>A	6.37:g.90406215A>T	ENSP00000358400:p.Trp3083Arg	Somatic	0	71	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	15	21.05	O15019|Q5T794	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA-3,superfamily_P-loop_NTPase,superfamily_ARM-type_fold,smart_AAA+_ATPase,smart_VWF_A,pirsf_Midasin,pfscan_VWF_A	p.W3083R	ENST00000369393.3	37	c.9247	CCDS5024.1	6	.	.	.	.	.	.	.	.	.	.	A	14.44	2.535053	0.45073	.	.	ENSG00000112159	ENST00000369393;ENST00000428876	T;T	0.03181	4.02;4.02	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	T	0.05273	0.0140	L	0.27053	0.805	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.57412	-0.7816	10	0.32370	T	0.25	.	15.5076	0.75753	1.0:0.0:0.0:0.0	.	3083	Q9NU22	MDN1_HUMAN	R	3083	ENSP00000358400:W3083R;ENSP00000413970:W3083R	ENSP00000358400:W3083R	W	-	1	0	MDN1	90462936	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	5.559000	0.67326	2.067000	0.61834	0.533000	0.62120	TGG	-	pirsf_Midasin		0.517	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	MDN1	protein_coding	OTTHUMT00000041514.2	A		-		90406215	-1	no_errors	ENST00000369393	ensembl	human	known	74_37	missense	SNP	0.999	T
ELANE	1991	genome.wustl.edu	37	19	855742	855742	+	Frame_Shift_Del	DEL	G	G	-	rs200449787		TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr19:855742delG	ENST00000590230.1	+	5	686	c.545delG	c.(544-546)cgtfs	p.R183fs	ELANE_ENST00000263621.1_Frame_Shift_Del_p.R183fs			P08246	ELNE_HUMAN	elastase, neutrophil expressed	183	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				acute inflammatory response to antigenic stimulus (GO:0002438)|cellular calcium ion homeostasis (GO:0006874)|collagen catabolic process (GO:0030574)|defense response to bacterium (GO:0042742)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|negative regulation of chemokine biosynthetic process (GO:0045079)|negative regulation of chemotaxis (GO:0050922)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-8 biosynthetic process (GO:0045415)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neutrophil mediated killing of fungus (GO:0070947)|phagocytosis (GO:0006909)|positive regulation of immune response (GO:0050778)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of smooth muscle cell proliferation (GO:0048661)|protein catabolic process (GO:0030163)|proteolysis (GO:0006508)|response to lipopolysaccharide (GO:0032496)|response to UV (GO:0009411)|response to yeast (GO:0001878)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|secretory granule (GO:0030141)|transcriptional repressor complex (GO:0017053)	cytokine binding (GO:0019955)|endopeptidase activity (GO:0004175)|heparin binding (GO:0008201)|peptidase activity (GO:0008233)|protease binding (GO:0002020)|RNA polymerase II transcription corepressor activity (GO:0001106)|serine-type endopeptidase activity (GO:0004252)			breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(1)|lung(4)|pancreas(1)	13					Alpha-1-proteinase inhibitor(DB00058)|Filgrastim(DB00099)|Pegfilgrastim(DB00019)	TCCCTCTGCCGTCGCAGCAAC	0.692																																																	0								ENSG00000197561						65.0	59.0	61.0					19																	855742		2202	4297	6499	ELANE	SO:0001589	frameshift_variant	0				HGNC		CCDS12045.1	19p13.3	2014-09-17	2009-05-05	2009-05-05	ENSG00000197561	ENSG00000197561	3.4.21.37		3309	protein-coding gene	gene with protein product	"""neutrophil elastase"", ""leukocyte elastase"", ""medullasin"""	130130	"""elastase 2, neutrophil"""	ELA2		2902087	Standard	XM_005259517		Approved	NE, HNE, HLE	uc002lqb.3	P08246		ENST00000590230.1:c.545delG	19.37:g.855742delG	ENSP00000466090:p.Arg183fs	Somatic	0	64	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	19	9.52	P09649|Q6B0D9|Q6LDP5	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Peptidase_S1,pfam_Peptidase_S1A_nudel,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.R182fs	ENST00000590230.1	37	c.545	CCDS12045.1	19																																																																																			-	pfam_Peptidase_S1,pfam_Peptidase_S1A_nudel,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1		0.692	ELANE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELANE	protein_coding	OTTHUMT00000457890.2	G	NM_001972			855742	+1	no_errors	ENST00000263621	ensembl	human	known	74_37	frame_shift_del	DEL	0.109	-
ZNF486	90649	genome.wustl.edu	37	19	20296824	20296824	+	Silent	SNP	C	C	T			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr19:20296824C>T	ENST00000335117.8	+	3	243	c.186C>T	c.(184-186)atC>atT	p.I62I	CTC-260E6.6_ENST00000593655.1_RNA|ZNF486_ENST00000597083.1_Silent_p.I62I|CTC-260E6.6_ENST00000586657.1_RNA|CTC-260E6.6_ENST00000585498.1_RNA	NM_052852.3	NP_443084.2	Q96H40	ZN486_HUMAN	zinc finger protein 486	62	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|large_intestine(3)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	11						CAGACCTGATCACCTGTCTGG	0.378																																																	0								ENSG00000256229						77.0	81.0	80.0					19																	20296824		2172	4293	6465	ZNF486	SO:0001819	synonymous_variant	0			-	HGNC	BC008936	CCDS46029.1	19p12	2014-02-13	2003-12-16	2003-12-17	ENSG00000256229	ENSG00000256229		"""Zinc fingers, C2H2-type"", ""-"""	20807	protein-coding gene	gene with protein product			"""KRAB domain only 2"""	KRBO2			Standard	NM_052852		Approved	MGC2396	uc002nou.3	Q96H40	OTTHUMG00000179731	ENST00000335117.8:c.186C>T	19.37:g.20296824C>T		Somatic	0	85	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	43	17.31	Q0VG00	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.I62	ENST00000335117.8	37	c.186	CCDS46029.1	19																																																																																			-	superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box		0.378	ZNF486-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF486	protein_coding	OTTHUMT00000447843.2	C	NM_052852	-		20296824	+1	no_errors	ENST00000335117	ensembl	human	known	74_37	silent	SNP	0.080	T
ARFGAP2	84364	genome.wustl.edu	37	11	47193866	47193866	+	Missense_Mutation	SNP	A	A	G	rs369493716		TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr11:47193866A>G	ENST00000524782.1	-	8	866	c.638T>C	c.(637-639)aTt>aCt	p.I213T	ARFGAP2_ENST00000395449.3_5'UTR|RP11-390K5.6_ENST00000524412.1_RNA|ARFGAP2_ENST00000319543.6_Intron|ARFGAP2_ENST00000426335.2_Intron|ARFGAP2_ENST00000419701.2_Missense_Mutation_p.I106T	NM_001242832.1|NM_032389.4	NP_001229761.1|NP_115765.2	Q8N6H7	ARFG2_HUMAN	ADP-ribosylation factor GTPase activating protein 2	213	Required for interaction with coatomer.				protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)	p.I213T(1)		breast(2)|kidney(2)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23						CTTCTTGCCAATGATGGAGCT	0.537																																																	1	Substitution - Missense(1)	kidney(1)						ENSG00000149182	A	THR/ILE,THR/ILE	1,4401	2.1+/-5.4	0,1,2200	316.0	285.0	295.0		554,638	6.1	1.0	11		295	0,8596		0,0,4298	no	missense,missense	ARFGAP2	NM_001242832.1,NM_032389.4	89,89	0,1,6498	GG,GA,AA		0.0,0.0227,0.0077	possibly-damaging,possibly-damaging	185/494,213/522	47193866	1,12997	2201	4298	6499	ARFGAP2	SO:0001583	missense	0			-	HGNC	AK027482	CCDS7926.1, CCDS73283.1	11p11.2-p11.12	2012-10-05	2008-01-09	2008-01-09	ENSG00000149182	ENSG00000149182		"""ADP-ribosylation factor GTPase activating proteins"""	13504	protein-coding gene	gene with protein product		606908	"""zinc finger protein 289, ID1 regulated"""	ZNF289		11278321, 14690497	Standard	NM_032389		Approved	IRZ, Zfp289, FLJ14576	uc001ndt.3	Q8N6H7	OTTHUMG00000166773	ENST00000524782.1:c.638T>C	11.37:g.47193866A>G	ENSP00000434442:p.Ile213Thr	Somatic	0	94	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	22	26.67	B4DX29|B7Z9M7|D3DQQ9|Q3LIF2|Q8N3I1|Q96SX7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ArfGAP,smart_ArfGAP,pfscan_ArfGAP,prints_ArfGAP	p.I213T	ENST00000524782.1	37	c.638	CCDS7926.1	11	.	.	.	.	.	.	.	.	.	.	A	22.3	4.276919	0.80580	2.27E-4	0.0	ENSG00000149182	ENST00000524782;ENST00000419701;ENST00000525398;ENST00000525314;ENST00000528444	T;T;T;T;T	0.46451	0.87;0.87;0.87;0.87;0.99	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.57051	0.2027	M	0.74258	2.255	0.80722	D	1	P;P	0.52061	0.95;0.745	P;B	0.53185	0.72;0.367	T	0.56269	-0.8007	10	0.34782	T	0.22	-15.0887	15.8218	0.78654	1.0:0.0:0.0:0.0	.	106;213	B4DX29;Q8N6H7	.;ARFG2_HUMAN	T	213;106;227;227;238	ENSP00000434442:I213T;ENSP00000389264:I106T;ENSP00000431939:I227T;ENSP00000434809:I227T;ENSP00000431684:I238T	ENSP00000389264:I106T	I	-	2	0	ARFGAP2	47150442	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.870000	0.92336	2.326000	0.78906	0.533000	0.62120	ATT	-	NULL		0.537	ARFGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARFGAP2	protein_coding	OTTHUMT00000391425.1	A	NM_032389	-		47193866	-1	no_errors	ENST00000524782	ensembl	human	known	74_37	missense	SNP	1.000	G
SMR3B	10879	genome.wustl.edu	37	4	71255546	71255546	+	Missense_Mutation	SNP	C	C	A			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr4:71255546C>A	ENST00000304915.3	+	3	370	c.221C>A	c.(220-222)cCa>cAa	p.P74Q	SMR3B_ENST00000504825.1_Missense_Mutation_p.P74Q	NM_006685.3	NP_006676.1	P02814	SMR3B_HUMAN	submaxillary gland androgen regulated protein 3B	74	Poly-Pro.|Pro-rich.					extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				large_intestine(2)|lung(3)|skin(2)	7		all_hematologic(202;0.196)				ATATTTCCACCACCCCCTCCT	0.582																																																	0								ENSG00000171201						119.0	111.0	114.0					4																	71255546		2203	4300	6503	SMR3B	SO:0001583	missense	0			-	HGNC	D29833	CCDS3540.1	4q13.3	2008-02-27	2008-02-27	2005-02-07	ENSG00000171201	ENSG00000171201			17326	protein-coding gene	gene with protein product		611593	"""proline rich 3"", ""submaxillary gland androgen regulated protein 3 homolog B (mouse)"""	PROL3		7982889, 479131	Standard	NM_006685		Approved	P-B, PRL3		P02814	OTTHUMG00000129396	ENST00000304915.3:c.221C>A	4.37:g.71255546C>A	ENSP00000302400:p.Pro74Gln	Somatic	0	160	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	34	37.04	B7ZMG7|Q9UBN0|Q9UCT0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.P74Q	ENST00000304915.3	37	c.221	CCDS3540.1	4	.	.	.	.	.	.	.	.	.	.	C	2.065	-0.414438	0.04766	.	.	ENSG00000171201	ENST00000504825;ENST00000304915	T;T	0.56611	0.45;0.45	1.02	1.02	0.19986	.	.	.	.	.	T	0.64549	0.2608	.	.	.	0.09310	N	1	D	0.76494	0.999	D	0.76575	0.988	T	0.49606	-0.8922	8	0.87932	D	0	.	5.3705	0.16136	0.0:1.0:0.0:0.0	.	74	P02814	SMR3B_HUMAN	Q	74	ENSP00000423138:P74Q;ENSP00000302400:P74Q	ENSP00000302400:P74Q	P	+	2	0	SMR3B	71290135	0.004000	0.15560	0.045000	0.18777	0.022000	0.10575	0.632000	0.24583	0.881000	0.35993	0.205000	0.17691	CCA	-	NULL		0.582	SMR3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMR3B	protein_coding	OTTHUMT00000251552.2	C	NM_006685	-		71255546	+1	no_errors	ENST00000304915	ensembl	human	known	74_37	missense	SNP	0.047	A
LRP11	84918	genome.wustl.edu	37	6	150184442	150184442	+	Intron	SNP	G	G	A			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr6:150184442G>A	ENST00000239367.2	-	1	619				LRP11_ENST00000367368.2_Intron|LRP11_ENST00000546019.1_Intron|RP11-244K5.8_ENST00000606915.1_RNA|RP11-244K5.8_ENST00000596229.1_RNA	NM_032832.5	NP_116221.3	Q86VZ4	LRP11_HUMAN	low density lipoprotein receptor-related protein 11							integral component of membrane (GO:0016021)				cervix(1)|kidney(5)|large_intestine(1)|lung(1)	8		Ovarian(120;0.0907)	BRCA - Breast invasive adenocarcinoma(37;0.193)	OV - Ovarian serous cystadenocarcinoma(155;4.56e-12)|GBM - Glioblastoma multiforme(68;0.225)		GGTGCCCGCGGCTAAAATAAC	0.627																																																	0								ENSG00000268592																																			RP11-244K5.8	SO:0001627	intron_variant	0			-	Clone_based_vega_gene	AK027641	CCDS5220.1	6q24.3	2013-02-27			ENSG00000120256	ENSG00000120256		"""Low density lipoprotein receptors"""	16936	protein-coding gene	gene with protein product							Standard	NM_032832		Approved	bA350J20.3, MANSC3	uc003qng.2	Q86VZ4	OTTHUMG00000015801	ENST00000239367.2:c.613+101C>T	6.37:g.150184442G>A		Somatic	0	53	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	16	15.79	Q5VYC0|Q96SN6	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000239367.2	37	NULL	CCDS5220.1	6																																																																																			-	-		0.627	LRP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAET1E-AS1	protein_coding	OTTHUMT00000042664.1	G	NM_032832	-		150184442	+1	no_errors	ENST00000596229	ensembl	human	known	74_37	rna	SNP	0.000	A
LMBR1L	55716	genome.wustl.edu	37	12	49504411	49504411	+	5'UTR	SNP	G	G	A			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr12:49504411G>A	ENST00000267102.8	-	0	270				LMBR1L_ENST00000547382.1_5'UTR|LMBR1L_ENST00000553204.1_5'UTR	NM_018113.2	NP_060583.2	Q6UX01	LMBRL_HUMAN	limb development membrane protein 1-like						endocytosis (GO:0006897)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(2)|kidney(2)|large_intestine(1)|lung(5)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						AGCCGCCGCCGCCAAGCACCC	0.657																																																	0								ENSG00000139636																																			LMBR1L	SO:0001623	5_prime_UTR_variant	0			-	HGNC	AB033000	CCDS8780.2, CCDS73466.1	12q13.12	2013-08-05	2013-08-05		ENSG00000139636	ENSG00000139636			18268	protein-coding gene	gene with protein product		610007	"""limb region 1 homolog (mouse)-like"""			10574461, 11287427	Standard	XM_005269022		Approved	FLJ10494, KIAA1174	uc001rth.4	Q6UX01	OTTHUMG00000150511	ENST00000267102.8:c.-73C>T	12.37:g.49504411G>A		Somatic	0	80	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00	Q969J4|Q96BY8|Q96HN8|Q9NT09|Q9NVE1|Q9NVU9|Q9ULP6	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000267102.8	37	NULL	CCDS8780.2	12																																																																																			-	-		0.657	LMBR1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LMBR1L	protein_coding	OTTHUMT00000318696.1	G	NM_018113	-		49504411	-1	no_errors	ENST00000548983	ensembl	human	known	74_37	rna	SNP	1.000	A
CDH18	1016	genome.wustl.edu	37	5	19473754	19473754	+	Missense_Mutation	SNP	G	G	A			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr5:19473754G>A	ENST00000507958.1	-	15	2944	c.1954C>T	c.(1954-1956)Cgg>Tgg	p.R652W	CDH18_ENST00000274170.4_Missense_Mutation_p.R652W|CDH18_ENST00000506372.1_3'UTR|CDH18_ENST00000510297.1_5'UTR|CDH18_ENST00000502796.1_3'UTR|CDH18_ENST00000382275.1_Missense_Mutation_p.R652W			Q13634	CAD18_HUMAN	cadherin 18, type 2	652					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(24)|lung(76)|ovary(5)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)	138	Lung NSC(1;0.00734)|all_lung(1;0.0197)					ACGTTCTCCCGTACATCCTCT	0.478																																																	0								ENSG00000145526						159.0	165.0	163.0					5																	19473754		2203	4300	6503	CDH18	SO:0001583	missense	0			-	HGNC	U59325	CCDS3889.1, CCDS54835.1, CCDS75229.1	5p14.3	2010-01-26			ENSG00000145526	ENSG00000145526		"""Cadherins / Major cadherins"""	1757	protein-coding gene	gene with protein product		603019				9030594, 10191097	Standard	NM_004934		Approved	CDH14, EY-CADHERIN	uc003jgd.3	Q13634	OTTHUMG00000090578	ENST00000507958.1:c.1954C>T	5.37:g.19473754G>A	ENSP00000425093:p.Arg652Trp	Somatic	0	69	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	20	31.03	A8K0I2|B4DHG6|Q8N5Z2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R652W	ENST00000507958.1	37	c.1954	CCDS3889.1	5	.	.	.	.	.	.	.	.	.	.	G	18.75	3.690107	0.68271	.	.	ENSG00000145526	ENST00000382275;ENST00000507958;ENST00000542864;ENST00000274170	D;D;D	0.84589	-1.87;-1.87;-1.87	6.16	3.01	0.34805	Cadherin, cytoplasmic domain (1);	0.000000	0.85682	D	0.000000	D	0.93989	0.8075	H	0.94771	3.58	0.47949	D	0.999552	D	0.89917	1.0	D	0.70487	0.969	D	0.95553	0.8622	9	.	.	.	.	15.5988	0.76609	0.0:0.0:0.6347:0.3653	.	652	Q13634	CAD18_HUMAN	W	652	ENSP00000371710:R652W;ENSP00000425093:R652W;ENSP00000274170:R652W	.	R	-	1	2	CDH18	19509511	0.032000	0.19561	0.990000	0.47175	0.965000	0.64279	0.309000	0.19332	0.860000	0.35481	0.650000	0.86243	CGG	-	pfam_Cadherin_cytoplasmic-dom		0.478	CDH18-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CDH18	protein_coding	OTTHUMT00000366747.1	G	NM_004934	-		19473754	-1	no_errors	ENST00000274170	ensembl	human	known	74_37	missense	SNP	0.827	A
STT3A	3703	genome.wustl.edu	37	11	125482602	125482602	+	Missense_Mutation	SNP	G	G	T			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr11:125482602G>T	ENST00000529196.1	+	13	1531	c.1325G>T	c.(1324-1326)aGc>aTc	p.S442I	STT3A_ENST00000392708.4_Missense_Mutation_p.S442I|STT3A_ENST00000531491.1_Missense_Mutation_p.S350I			P46977	STT3A_HUMAN	STT3A, subunit of the oligosaccharyltransferase complex (catalytic)	442					cellular protein metabolic process (GO:0044267)|co-translational protein modification (GO:0043686)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|oligosaccharyltransferase complex (GO:0008250)	dolichyl-diphosphooligosaccharide-protein glycotransferase activity (GO:0004579)			NS(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(15)|skin(1)	33	all_hematologic(175;0.228)	Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.0919)|all_lung(97;0.0994)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0996)		GACAAGAAGAGCAAGAAGCAA	0.448																																																	0								ENSG00000134910						143.0	123.0	130.0					11																	125482602		2201	4299	6500	STT3A	SO:0001583	missense	0			-	HGNC	BC020965	CCDS8458.1, CCDS60998.1	11q23.3	2013-03-06	2013-03-06	2006-02-07	ENSG00000134910	ENSG00000134910	2.4.99.18		6172	protein-coding gene	gene with protein product	"""dolichyl-diphosphooligosaccharide protein glycotransferase"""	601134	"""integral membrane protein 1"", ""STT3, subunit of the oligosaccharyltransferase complex, homolog A (S. cerevisiae)"", ""STT3A, cataylic subunit of the oligosaccharyltransferase complex"""	ITM1		8941377, 8634329, 10234787	Standard	NM_152713		Approved	TMC, MGC9042, STT3-A	uc001qcd.2	P46977	OTTHUMG00000165852	ENST00000529196.1:c.1325G>T	11.37:g.125482602G>T	ENSP00000436962:p.Ser442Ile	Somatic	0	61	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	22	12.00	B4DJ24|E9PNQ1|Q86XU9|Q8TE35|Q8WUB4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Oligo_trans_STT3	p.S442I	ENST00000529196.1	37	c.1325	CCDS8458.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.05|15.05	2.719196|2.719196	0.48728|0.48728	.|.	.|.	ENSG00000134910|ENSG00000134910	ENST00000526726|ENST00000392708;ENST00000529196;ENST00000531491	.|.	.|.	.|.	5.97|5.97	0.439|0.439	0.16567|0.16567	.|.	.|0.313724	.|0.38381	.|N	.|0.001707	T|T	0.27559|0.27559	0.0677|0.0677	N|N	0.04355|0.04355	-0.22|-0.22	0.39324|0.39324	D|D	0.965291|0.965291	.|B;B	.|0.31503	.|0.065;0.326	.|B;B	.|0.36335	.|0.091;0.222	T|T	0.06232|0.06232	-1.0838|-1.0838	5|9	.|0.44086	.|T	.|0.13	-4.1249|-4.1249	6.879|6.879	0.24163|0.24163	0.2914:0.2194:0.4892:0.0|0.2914:0.2194:0.4892:0.0	.|.	.|350;442	.|B4DJ24;P46977	.|.;STT3A_HUMAN	S|I	154|442;442;350	.|.	.|ENSP00000376472:S442I	A|S	+|+	1|2	0|0	STT3A|STT3A	124987812|124987812	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	0.665000|0.665000	0.25083|0.25083	0.391000|0.391000	0.25143|0.25143	0.655000|0.655000	0.94253|0.94253	GCA|AGC	-	pfam_Oligo_trans_STT3		0.448	STT3A-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	STT3A	protein_coding	OTTHUMT00000386691.1	G	NM_152713	-		125482602	+1	no_errors	ENST00000392708	ensembl	human	known	74_37	missense	SNP	0.987	T
NAPA	8775	genome.wustl.edu	37	19	47993012	47993012	+	Silent	SNP	G	G	A			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr19:47993012G>A	ENST00000263354.3	-	10	1041	c.742C>T	c.(742-744)Cta>Tta	p.L248L	NAPA_ENST00000595227.1_Silent_p.L209L|NAPA-AS1_ENST00000593284.1_RNA|NAPA-AS1_ENST00000594367.1_RNA	NM_003827.3	NP_003818.2	P54920	SNAA_HUMAN	N-ethylmaleimide-sensitive factor attachment protein, alpha	248					apical protein localization (GO:0045176)|brain development (GO:0007420)|intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|membrane organization (GO:0061024)|neuron differentiation (GO:0030182)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of synaptic vesicle priming (GO:0010807)|SNARE complex disassembly (GO:0035494)|synaptic transmission, glutamatergic (GO:0035249)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|synaptobrevin 2-SNAP-25-syntaxin-1a complex (GO:0070044)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(3)	11		all_cancers(25;1.55e-10)|all_epithelial(76;3.4e-08)|all_lung(116;1.73e-07)|Lung NSC(112;3.95e-07)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		OV - Ovarian serous cystadenocarcinoma(262;0.000466)|all cancers(93;0.000739)|Epithelial(262;0.0168)|GBM - Glioblastoma multiforme(486;0.049)		TGGGCCTCTAGCAATTTCTGC	0.587																																					Ovarian(185;1135 2042 27703 31345 42493)												0								ENSG00000105402						50.0	45.0	46.0					19																	47993012		2203	4300	6503	NAPA	SO:0001819	synonymous_variant	0			-	HGNC	U39412	CCDS12702.1	19q13.33	2012-08-16			ENSG00000105402	ENSG00000105402			7641	protein-coding gene	gene with protein product	"""alpha SNAP"""	603215				9269766	Standard	NM_003827		Approved		uc002pha.2	P54920		ENST00000263354.3:c.742C>T	19.37:g.47993012G>A		Somatic	0	24	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	11	21.43	A8K879|Q96IK3|Q9BVJ3	Silent	SNP	NA	NA	NA	NA	NA	NA	prints_NSF_attach	p.L248	ENST00000263354.3	37	c.742	CCDS12702.1	19																																																																																			-	prints_NSF_attach		0.587	NAPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAPA	protein_coding	OTTHUMT00000466048.2	G	NM_003827	-		47993012	-1	no_errors	ENST00000263354	ensembl	human	known	74_37	silent	SNP	0.683	A
PUS3	83480	genome.wustl.edu	37	11	125766086	125766086	+	Missense_Mutation	SNP	G	G	T	rs147862544		TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr11:125766086G>T	ENST00000530811.1	-	1	139	c.94C>A	c.(94-96)Cag>Aag	p.Q32K	HYLS1_ENST00000356438.3_Intron|PUS3_ENST00000227474.3_Missense_Mutation_p.Q32K|HYLS1_ENST00000526028.1_Intron|HYLS1_ENST00000425380.2_Intron			Q9BZE2	PUS3_HUMAN	pseudouridylate synthase 3	32					tRNA pseudouridine synthesis (GO:0031119)	nucleus (GO:0005634)	pseudouridine synthase activity (GO:0009982)|RNA binding (GO:0003723)			NS(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)	10	all_hematologic(175;0.177)	Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.131)|all_lung(97;0.139)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.043)		TTTTTGGCCTGTTCCTTTTTA	0.418																																																	0								ENSG00000110060						219.0	218.0	218.0					11																	125766086		2201	4299	6500	PUS3	SO:0001583	missense	0			-	HGNC	BC004822	CCDS8466.1, CCDS73411.1	11q24.2	2008-02-05							25461	protein-coding gene	gene with protein product						12477932	Standard	NM_031307		Approved	FKSG32	uc001qcy.2	Q9BZE2		ENST00000530811.1:c.94C>A	11.37:g.125766086G>T	ENSP00000432386:p.Gln32Lys	Somatic	0	87	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	B2RAM0|Q96D17|Q96J23|Q96NB4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PsdUridine_synth_TruA_a/b_dom,superfamily_PsdUridine_synth_cat_dom,tigrfam_PsdUridine_synth_TruA	p.Q32K	ENST00000530811.1	37	c.94	CCDS8466.1	11	.	.	.	.	.	.	.	.	.	.	G	3.705	-0.060664	0.07317	.	.	ENSG00000110060	ENST00000227474;ENST00000530811;ENST00000534158;ENST00000529801	T;T;T;T	0.54279	1.56;1.56;0.58;1.0	6.03	5.11	0.69529	.	0.499688	0.22665	N	0.057146	T	0.45216	0.1331	L	0.51422	1.61	0.32172	N	0.581487	B	0.15141	0.012	B	0.08055	0.003	T	0.50048	-0.8873	10	0.06099	T	0.92	-3.7453	16.7524	0.85489	0.0:0.0:0.8698:0.1302	.	32	Q9BZE2	PUS3_HUMAN	K	32	ENSP00000227474:Q32K;ENSP00000432386:Q32K;ENSP00000432272:Q32K;ENSP00000437077:Q32K	ENSP00000227474:Q32K	Q	-	1	0	PUS3	125271296	0.976000	0.34144	0.935000	0.37517	0.549000	0.35272	2.510000	0.45468	1.541000	0.49316	0.655000	0.94253	CAG	-	NULL		0.418	PUS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PUS3	protein_coding	OTTHUMT00000386783.1	G	NM_031307	-		125766086	-1	no_errors	ENST00000227474	ensembl	human	known	74_37	missense	SNP	0.992	T
TTLL5	23093	genome.wustl.edu	37	14	76420882	76420882	+	3'UTR	DEL	T	T	-			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr14:76420882delT	ENST00000298832.9	+	0	4144					NM_015072.4	NP_055887.3	Q6EMB2	TTLL5_HUMAN	tubulin tyrosine ligase-like family, member 5						fertilization (GO:0009566)|protein polyglutamylation (GO:0018095)|sperm axoneme assembly (GO:0007288)|sperm motility (GO:0030317)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)			NS(2)|breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(3)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|urinary_tract(2)	50				BRCA - Breast invasive adenocarcinoma(234;0.029)		GTCCATAGTATTTTTTTTTTT	0.463																																																	0								ENSG00000119685																																			TTLL5	SO:0001624	3_prime_UTR_variant	0				HGNC	AF107885	CCDS32124.1	14q24.3	2014-09-09	2005-07-29	2005-07-29	ENSG00000119685	ENSG00000119685		"""Tubulin tyrosine ligase-like family"""	19963	protein-coding gene	gene with protein product		612268	"""KIAA0998"""	KIAA0998		15890843	Standard	NM_015072		Approved		uc001xrx.3	Q6EMB2	OTTHUMG00000171611	ENST00000298832.9:c.*93T>-	14.37:g.76420882delT		Somatic	0	53	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	25	13.79	B9EGH8|B9EGH9|Q9BUB0|Q9H0G4|Q9H7W2|Q9P1V5|Q9UPZ4	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000298832.9	37	NULL	CCDS32124.1	14																																																																																			-	-		0.463	TTLL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTLL5	protein_coding	OTTHUMT00000414453.1	T	NM_015072			76420882	+1	no_errors	ENST00000554972	ensembl	human	known	74_37	rna	DEL	0.005	-
CPZ	8532	genome.wustl.edu	37	4	8601254	8601254	+	Intron	SNP	G	G	A			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr4:8601254G>A	ENST00000360986.4	+	2	295				CPZ_ENST00000506287.1_3'UTR|CPZ_ENST00000315782.6_Intron|CPZ_ENST00000429646.2_5'Flank|CPZ_ENST00000382480.2_De_novo_Start_OutOfFrame	NM_001014447.2	NP_001014447	Q66K79	CBPZ_HUMAN	carboxypeptidase Z						proteolysis (GO:0006508)|Wnt signaling pathway (GO:0016055)	extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(23)|ovary(3)|pancreas(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						CTGTAGGAGGGCTGCAGCCCC	0.532																																																	0								ENSG00000109625						72.0	55.0	61.0					4																	8601254		2202	4300	6502	CPZ	SO:0001627	intron_variant	0			-	HGNC	U83411	CCDS3404.1, CCDS33953.1, CCDS43212.1	4p16.1	2012-02-10			ENSG00000109625	ENSG00000109625			2333	protein-coding gene	gene with protein product	"""metallocarboxypeptidase Z"""	603105				9099699	Standard	NM_001014447		Approved		uc003glm.3	Q66K79	OTTHUMG00000090513	ENST00000360986.4:c.121+42G>A	4.37:g.8601254G>A		Somatic	0	68	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	39	9.30	O00520|Q96MX2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.A55T	ENST00000360986.4	37	c.163	CCDS33953.1	4																																																																																			-	NULL		0.532	CPZ-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CPZ	protein_coding	OTTHUMT00000207001.4	G	NM_003652	-		8601254	+1	no_errors	ENST00000515606	ensembl	human	known	74_37	missense	SNP	0.001	A
NPTX1	4884	genome.wustl.edu	37	17	78447240	78447240	+	Missense_Mutation	SNP	C	C	A			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr17:78447240C>A	ENST00000306773.4	-	3	814	c.657G>T	c.(655-657)caG>caT	p.Q219H	NPTX1_ENST00000575212.1_5'UTR	NM_002522.3	NP_002513.2	Q15818	NPTX1_HUMAN	neuronal pentraxin I	219					axonogenesis involved in innervation (GO:0060385)|cellular response to glucose stimulus (GO:0071333)|cellular response to potassium ion (GO:0035865)|central nervous system development (GO:0007417)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|mitochondrial transport (GO:0006839)|synaptic transmission (GO:0007268)|transport (GO:0006810)	cytoplasmic vesicle (GO:0031410)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			kidney(1)|large_intestine(2)|liver(1)|lung(4)|prostate(2)|upper_aerodigestive_tract(1)	11	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0232)|OV - Ovarian serous cystadenocarcinoma(97;0.0487)			GGTTGTCTTTCTGACCTGCGG	0.547																																																	0								ENSG00000171246						208.0	174.0	186.0					17																	78447240		2203	4300	6503	NPTX1	SO:0001583	missense	0			-	HGNC	U61849	CCDS32762.1	17q25.3	2008-05-14				ENSG00000171246			7952	protein-coding gene	gene with protein product		602367				8884281	Standard	NM_002522		Approved		uc002jyp.1	Q15818		ENST00000306773.4:c.657G>T	17.37:g.78447240C>A	ENSP00000307549:p.Gln219His	Somatic	0	90	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	24	11.11	B3KXH3|Q5FWE6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Pentaxin,superfamily_ConA-like_lec_gl_sf,smart_Pentaxin,prints_Pentaxin	p.Q219H	ENST00000306773.4	37	c.657	CCDS32762.1	17	.	.	.	.	.	.	.	.	.	.	C	13.65	2.301287	0.40694	.	.	ENSG00000171246	ENST00000306773	T	0.10192	2.9	4.84	3.85	0.44370	.	0.301359	0.32593	N	0.005886	T	0.09379	0.0231	L	0.44542	1.39	0.50632	D	0.999885	P	0.36438	0.553	B	0.35510	0.204	T	0.21690	-1.0238	10	0.14252	T	0.57	-22.3546	12.3291	0.55028	0.0:0.9136:0.0:0.0864	.	219	Q15818	NPTX1_HUMAN	H	219	ENSP00000307549:Q219H	ENSP00000307549:Q219H	Q	-	3	2	NPTX1	76061835	0.998000	0.40836	1.000000	0.80357	0.964000	0.63967	0.533000	0.23082	2.221000	0.72209	0.511000	0.50034	CAG	-	NULL		0.547	NPTX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPTX1	protein_coding	OTTHUMT00000438051.1	C		-		78447240	-1	no_errors	ENST00000306773	ensembl	human	known	74_37	missense	SNP	1.000	A
LMO7	4008	genome.wustl.edu	37	13	76381810	76381810	+	Missense_Mutation	SNP	T	T	C			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr13:76381810T>C	ENST00000321797.8	+	8	1413	c.692T>C	c.(691-693)tTt>tCt	p.F231S	LMO7_ENST00000526202.1_Intron|RP11-29G8.3_ENST00000563635.1_RNA|LMO7_ENST00000465261.2_Missense_Mutation_p.F231S|LMO7_ENST00000357063.3_Missense_Mutation_p.F516S|LMO7_ENST00000377534.3_Missense_Mutation_p.F516S|LMO7_ENST00000341547.4_Intron			Q8WWI1	LMO7_HUMAN	LIM domain 7	516					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(20)|lung(15)|ovary(2)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		Breast(118;0.0992)		GBM - Glioblastoma multiforme(99;0.0109)		GATGATTTCTTTGTCAGAAAG	0.443																																																	0								ENSG00000136153						86.0	81.0	83.0					13																	76381810		1568	3582	5150	LMO7	SO:0001583	missense	0			-	HGNC	AF092557	CCDS9454.1, CCDS53876.1	13q22.2	2008-02-05	2004-06-15		ENSG00000136153	ENSG00000136153			6646	protein-coding gene	gene with protein product	"""F-box only protein 20"""	604362	"""LIM domain only 7"""	FBXO20		9826547, 10531035	Standard	NM_005358		Approved	FBX20, KIAA0858	uc021rkq.1	Q8WWI1	OTTHUMG00000017093	ENST00000321797.8:c.692T>C	13.37:g.76381810T>C	ENSP00000317802:p.Phe231Ser	Somatic	0	65	0.00		0.43913268170776937	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	13	18.75	E9PLH4|O15462|O95346|Q5TBK6|Q9UKC1|Q9UQM5|Q9Y6A7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_CH-domain,pfam_PDZ,superfamily_CH-domain,superfamily_PDZ,smart_CH-domain,smart_PDZ,pfscan_CH-domain,pfscan_PDZ,prints_SM22_calponin	p.F516S	ENST00000321797.8	37	c.1547		13	.	.	.	.	.	.	.	.	.	.	T	24.8	4.574614	0.86542	.	.	ENSG00000136153	ENST00000357063;ENST00000377534;ENST00000321797;ENST00000465261;ENST00000526528	T;T;T;T	0.58210	0.35;0.35;0.35;0.35	5.83	5.83	0.93111	.	0.053706	0.85682	D	0.000000	T	0.68714	0.3031	M	0.68952	2.095	0.58432	D	0.999999	D;D	0.63880	0.993;0.993	P;P	0.60949	0.881;0.881	T	0.72250	-0.4348	10	0.87932	D	0	-19.7539	16.1968	0.82036	0.0:0.0:0.0:1.0	.	516;231	Q8WWI1;E9PLH4	LMO7_HUMAN;.	S	516;516;231;231;137	ENSP00000349571:F516S;ENSP00000366757:F516S;ENSP00000317802:F231S;ENSP00000433352:F231S	ENSP00000317802:F231S	F	+	2	0	LMO7	75279811	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.503000	0.81632	2.225000	0.72522	0.533000	0.62120	TTT	-	NULL		0.443	LMO7-005	PUTATIVE	alternative_5_UTR|not_organism_supported|basic|exp_conf	protein_coding	LMO7	protein_coding	OTTHUMT00000045301.3	T	NM_005358	-		76381810	+1	no_errors	ENST00000357063	ensembl	human	known	74_37	missense	SNP	1.000	C
