#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
NKRF	55922	genome.wustl.edu	37	X	118722358	118722358	+	3'UTR	DEL	T	T	-			TCGA-WK-A8XQ-01A-11D-A37C-09	TCGA-WK-A8XQ-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a362ed3c-3c06-4aad-8b9e-a4b46b4cbcd3	779e9645-be20-45ce-842e-6224726c5e5a	g.chrX:118722358delT	ENST00000371527.1	-	0	3682				NKRF_ENST00000487600.1_5'UTR|NKRF_ENST00000304449.5_3'UTR|NKRF_ENST00000542113.1_3'UTR	NM_001173488.1	NP_001166959.1	O15226	NKRF_HUMAN	NFKB repressing factor						negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(2)|lung(9)|ovary(1)|prostate(3)|skin(1)|urinary_tract(1)	30						TTTTTATACATTTTTTTTTTT	0.368																																																	0								ENSG00000186416																																			NKRF	SO:0001624	3_prime_UTR_variant	0				HGNC	AJ011812	CCDS35375.1, CCDS55486.1	Xq24	2013-01-28	2008-03-26		ENSG00000186416	ENSG00000186416		"""G patch domain containing"""	19374	protein-coding gene	gene with protein product		300440	"""NF-kappaB repressing factor"""			10562553	Standard	NM_017544		Approved	ITBA4, NRF	uc022cdk.1	O15226	OTTHUMG00000022277	ENST00000371527.1:c.*957A>-	X.37:g.118722358delT		Somatic	0	15	0.00		0.7132304552168561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	17	22.73	G3V1N1|Q4VC41|Q9UJ91	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000371527.1	37	NULL	CCDS35375.1	X																																																																																			-	-		0.368	NKRF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NKRF	protein_coding	OTTHUMT00000058044.1	T	NM_017544			118722358	-1	no_errors	ENST00000487600	ensembl	human	known	74_37	rna	DEL	0.949	-
MUM1L1	139221	genome.wustl.edu	37	X	105451169	105451169	+	Missense_Mutation	SNP	T	T	C			TCGA-WK-A8XQ-01A-11D-A37C-09	TCGA-WK-A8XQ-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a362ed3c-3c06-4aad-8b9e-a4b46b4cbcd3	779e9645-be20-45ce-842e-6224726c5e5a	g.chrX:105451169T>C	ENST00000357175.2	+	4	2393	c.1744T>C	c.(1744-1746)Tgg>Cgg	p.W582R	MUM1L1_ENST00000337685.2_Missense_Mutation_p.W582R|MUM1L1_ENST00000372552.1_Missense_Mutation_p.W582R	NM_001171020.1	NP_001164491.1	Q5H9M0	MUML1_HUMAN	melanoma associated antigen (mutated) 1-like 1	582						extracellular vesicular exosome (GO:0070062)				autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	31						AGGATCCAGATGGCTGAAATC	0.413																																																	0								ENSG00000157502						49.0	43.0	45.0					X																	105451169		1865	4093	5958	MUM1L1	SO:0001583	missense	0			-	HGNC	AK090835	CCDS55469.1	Xq22.3	2008-02-05			ENSG00000157502	ENSG00000157502			26583	protein-coding gene	gene with protein product							Standard	NM_152423		Approved	FLJ33516	uc004emf.2	Q5H9M0	OTTHUMG00000022146	ENST00000357175.2:c.1744T>C	X.37:g.105451169T>C	ENSP00000349699:p.Trp582Arg	Somatic	0	18	0.00		0.7132304552168561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	0	100.00	D3DUX2|Q49AS5|Q8N2C0|Q96MT6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_PyrdxlP-dep_Trfase	p.W582R	ENST00000357175.2	37	c.1744	CCDS55469.1	X	.	.	.	.	.	.	.	.	.	.	T	15.70	2.911846	0.52439	.	.	ENSG00000157502	ENST00000357175;ENST00000337685;ENST00000372552	T;T;T	0.41065	1.01;1.01;1.01	5.08	5.08	0.68730	.	0.000000	0.49305	D	0.000143	T	0.61999	0.2392	M	0.73598	2.24	0.39573	D	0.969304	D	0.89917	1.0	D	0.91635	0.999	T	0.67734	-0.5594	10	0.87932	D	0	-41.673	10.1122	0.42570	0.0:0.0:0.0:1.0	.	582	Q5H9M0	MUML1_HUMAN	R	582	ENSP00000349699:W582R;ENSP00000338641:W582R;ENSP00000361632:W582R	ENSP00000338641:W582R	W	+	1	0	MUM1L1	105337825	1.000000	0.71417	0.997000	0.53966	0.989000	0.77384	3.428000	0.52792	1.992000	0.58205	0.486000	0.48141	TGG	-	NULL		0.413	MUM1L1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MUM1L1	protein_coding	OTTHUMT00000057795.1	T	NM_152423	-		105451169	+1	no_errors	ENST00000337685	ensembl	human	known	74_37	missense	SNP	0.999	C
CACNA1A	773	genome.wustl.edu	37	19	13318673	13318678	+	In_Frame_Del	DEL	CTGCTG	CTGCTG	-	rs16054|rs370146696	byFrequency	TCGA-WK-A8XQ-01A-11D-A37C-09	TCGA-WK-A8XQ-10A-01D-A37F-09	CTGCTG	CTGCTG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a362ed3c-3c06-4aad-8b9e-a4b46b4cbcd3	779e9645-be20-45ce-842e-6224726c5e5a	g.chr19:13318673_13318678delCTGCTG	ENST00000360228.5	-	47	6969_6974	c.6970_6975delCAGCAG	c.(6970-6975)cagcagdel	p.QQ2324del	CACNA1A_ENST00000573710.2_3'UTR	NM_000068.3|NM_001127222.1|NM_001174080.1|NM_023035.2	NP_000059.3|NP_001120694.1|NP_001167551.1|NP_075461.2	O00555	CAC1A_HUMAN	calcium channel, voltage-dependent, P/Q type, alpha 1A subunit	2323	Poly-Gln.				adult walking behavior (GO:0007628)|behavioral response to pain (GO:0048266)|calcium ion import (GO:0070509)|calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cell death (GO:0008219)|cell growth (GO:0016049)|cellular chloride ion homeostasis (GO:0030644)|cerebellar molecular layer development (GO:0021679)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellum maturation (GO:0021590)|dendrite morphogenesis (GO:0048813)|energy reserve metabolic process (GO:0006112)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glucose metabolic process (GO:0006006)|hormone metabolic process (GO:0042445)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of hormone biosynthetic process (GO:0032353)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular process controlling balance (GO:0050885)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter metabolic process (GO:0042133)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|receptor clustering (GO:0043113)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion-dependent exocytosis (GO:0017158)|regulation of insulin secretion (GO:0050796)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|spinal cord motor neuron differentiation (GO:0021522)|sulfur amino acid metabolic process (GO:0000096)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmission of nerve impulse (GO:0019226)|vestibular nucleus development (GO:0021750)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|syntaxin binding (GO:0019905)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(25)|prostate(2)|urinary_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Loperamide(DB00836)|Pregabalin(DB00230)|Spironolactone(DB00421)|Verapamil(DB00661)	TGGCCACCGCctgctgctgctgctgc	0.767																																																	0								ENSG00000141837																																			CACNA1A	SO:0001651	inframe_deletion	0				HGNC	U79666	CCDS45998.1, CCDS45999.1	19p13	2014-09-17			ENSG00000141837	ENSG00000141837		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1388	protein-coding gene	gene with protein product		601011		CACNL1A4, SCA6, MHP1, MHP		8825650, 16382099, 23827678	Standard	NM_000068		Approved	Cav2.1, EA2, APCA, HPCA, FHM	uc010xne.2	O00555	OTTHUMG00000044590	ENST00000360228.5:c.6970_6975delCAGCAG	19.37:g.13318679_13318684delCTGCTG	ENSP00000353362:p.Gln2324_Gln2325del	Somatic	NA	NA	NA		0.7132304552168561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	J3KP41|P78510|P78511|Q16290|Q92690|Q99790|Q99791|Q99792|Q99793|Q9NS88|Q9UDC4	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCCAlpha1,prints_VDCC_P/Q_a1su	p.QQ2324in_frame_del	ENST00000360228.5	37	c.6975_6970	CCDS45998.1	19																																																																																			-	NULL		0.767	CACNA1A-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	CACNA1A	protein_coding	OTTHUMT00000104062.2	CTGCTG	NM_000068			13318678	-1	no_errors	ENST00000360228	ensembl	human	known	74_37	in_frame_del	DEL	0.259:0.316:0.374:0.432:0.459:0.497	-
GPR98	84059	genome.wustl.edu	37	5	90106396	90106396	+	Missense_Mutation	SNP	G	G	A			TCGA-WK-A8XQ-01A-11D-A37C-09	TCGA-WK-A8XQ-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a362ed3c-3c06-4aad-8b9e-a4b46b4cbcd3	779e9645-be20-45ce-842e-6224726c5e5a	g.chr5:90106396G>A	ENST00000405460.2	+	74	15415	c.15319G>A	c.(15319-15321)Gtt>Att	p.V5107I	GPR98_ENST00000425867.2_Missense_Mutation_p.V768I	NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	5107					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		AAAGTTTGATGTTAATTGGAG	0.348																																																	0								ENSG00000164199						120.0	120.0	120.0					5																	90106396		1839	4086	5925	GPR98	SO:0001583	missense	0			-	HGNC	AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.15319G>A	5.37:g.90106396G>A	ENSP00000384582:p.Val5107Ile	Somatic	0	18	0.00		0.7132304552168561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	20	44.44	O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Calx_beta,pfam_EPTP,pfam_GPCR_2_secretin-like,pfam_GPS_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Gal_Oxase/kelch_b-propeller,smart_Calx_beta,pfscan_EAR,pfscan_GPS_dom,pfscan_GPCR_2-like	p.V5107I	ENST00000405460.2	37	c.15319	CCDS47246.1	5	.	.	.	.	.	.	.	.	.	.	G	0.201	-1.044848	0.01997	.	.	ENSG00000164199	ENST00000405460;ENST00000296619;ENST00000425867	T;T	0.35789	1.29;1.29	5.37	2.4	0.29515	.	0.730922	0.14273	N	0.330033	T	0.20414	0.0491	N	0.22421	0.69	0.09310	N	1	B;B;B	0.16396	0.01;0.006;0.017	B;B;B	0.18561	0.01;0.006;0.022	T	0.19484	-1.0304	9	.	.	.	.	4.9037	0.13788	0.0763:0.1577:0.5426:0.2234	.	768;5107;768	E7EML1;Q8WXG9;Q8WXG9-2	.;GPR98_HUMAN;.	I	5107;5107;768	ENSP00000384582:V5107I;ENSP00000392618:V768I	.	V	+	1	0	GPR98	90142152	0.984000	0.35163	0.005000	0.12908	0.133000	0.20885	2.188000	0.42612	0.743000	0.32719	-0.311000	0.09066	GTT	-	NULL		0.348	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR98	protein_coding	OTTHUMT00000369993.2	G	NM_032119	-		90106396	+1	no_errors	ENST00000405460	ensembl	human	known	74_37	missense	SNP	0.007	A
PTGES	9536	genome.wustl.edu	37	9	132501706	132501707	+	3'UTR	INS	-	-	ACACAT	rs1134680|rs137962222|rs35042232|rs3884098|rs367837009		TCGA-WK-A8XQ-01A-11D-A37C-09	TCGA-WK-A8XQ-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a362ed3c-3c06-4aad-8b9e-a4b46b4cbcd3	779e9645-be20-45ce-842e-6224726c5e5a	g.chr9:132501706_132501707insACACAT	ENST00000340607.4	-	0	676_677				PTGES_ENST00000481476.1_De_novo_Start_OutOfFrame	NM_004878.4	NP_004869.1	O14684	PTGES_HUMAN	prostaglandin E synthase						acute inflammatory response (GO:0002526)|arachidonic acid metabolic process (GO:0019369)|chronic inflammatory response (GO:0002544)|cyclooxygenase pathway (GO:0019371)|negative regulation of cell proliferation (GO:0008285)|prostaglandin biosynthetic process (GO:0001516)|prostaglandin metabolic process (GO:0006693)|response to calcium ion (GO:0051592)|response to cytokine (GO:0034097)|response to lipopolysaccharide (GO:0032496)|response to organic cyclic compound (GO:0014070)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)|perinuclear region of cytoplasm (GO:0048471)	glutathione binding (GO:0043295)|prostaglandin-E synthase activity (GO:0050220)			lung(1)|skin(1)	2		Ovarian(14;0.00556)				Aacatacacacacacatacaca	0.525																																																	0								ENSG00000148344																																			PTGES	SO:0001624	3_prime_UTR_variant	0				HGNC	AF010316	CCDS6927.1	9q34.3	2008-07-21			ENSG00000148344	ENSG00000148344			9599	protein-coding gene	gene with protein product	"""microsomal glutathione S-transferase 1-like 1"", ""tumor protein p53 inducible protein 12"", ""p53-induced gene 12"", ""microsomal prostaglandin E synthase-1"", ""glutathione S-transferase 1-like 1"", ""MGST1-like 1"""	605172		MGST1L1		9305847, 10091672	Standard	NM_004878		Approved	MGST-IV, PIG12, MGST1-L1, TP53I12	uc004byi.3	O14684	OTTHUMG00000020791	ENST00000340607.4:c.*184->ATGTGT	9.37:g.132501707_132501712dupACACAT		Somatic	NA	NA	NA		0.7132304552168561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	O14900|Q5SZC0	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000340607.4	37	NULL	CCDS6927.1	9																																																																																			-	-		0.525	PTGES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTGES	protein_coding	OTTHUMT00000054599.2	-	NM_004878			132501707	-1	no_errors	ENST00000481476	ensembl	human	known	74_37	rna	INS	0.000:0.000	ACACAT
RPA1	6117	genome.wustl.edu	37	17	1782517	1782517	+	Nonsense_Mutation	SNP	T	T	A			TCGA-WK-A8XQ-01A-11D-A37C-09	TCGA-WK-A8XQ-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a362ed3c-3c06-4aad-8b9e-a4b46b4cbcd3	779e9645-be20-45ce-842e-6224726c5e5a	g.chr17:1782517T>A	ENST00000254719.5	+	10	878	c.768T>A	c.(766-768)taT>taA	p.Y256*	RPA1_ENST00000573924.1_3'UTR	NM_002945.3	NP_002936.1	P27694	RFA1_HUMAN	replication protein A1, 70kDa	256					base-excision repair (GO:0006284)|DNA recombinase assembly (GO:0000730)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA-dependent DNA replication (GO:0006261)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|G1/S transition of mitotic cell cycle (GO:0000082)|hemopoiesis (GO:0030097)|homeostasis of number of cells within a tissue (GO:0048873)|in utero embryonic development (GO:0001701)|meiotic nuclear division (GO:0007126)|mismatch repair (GO:0006298)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA gap filling (GO:0006297)|positive regulation of cell proliferation (GO:0008284)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|DNA replication factor A complex (GO:0005662)|lateral element (GO:0000800)|male germ cell nucleus (GO:0001673)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	chromatin binding (GO:0003682)|damaged DNA binding (GO:0003684)|metal ion binding (GO:0046872)|single-stranded DNA binding (GO:0003697)			breast(1)|endometrium(3)|large_intestine(2)|lung(2)|ovary(2)	10						AGGTGTATTATTTCTCGAAAG	0.507								Nucleotide excision repair (NER)																																									0								ENSG00000132383						67.0	68.0	67.0					17																	1782517		2203	4300	6503	RPA1	SO:0001587	stop_gained	0			-	HGNC	M63488	CCDS11014.1	17p13.3	2008-02-05	2002-08-29		ENSG00000132383	ENSG00000132383			10289	protein-coding gene	gene with protein product		179835	"""replication protein A1 (70kD)"""			8454588	Standard	NM_002945		Approved	REPA1, RPA70, HSSB, RF-A, RP-A	uc002fto.2	P27694	OTTHUMG00000090579	ENST00000254719.5:c.768T>A	17.37:g.1782517T>A	ENSP00000254719:p.Tyr256*	Somatic	0	23	0.00		0.7132304552168561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	8	74.19	A8K0Y9|Q59ES9	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Rep_factor-A_C,pfam_Rep_factor-A_N,pfam_NA-bd_OB_tRNA,superfamily_NA-bd_OB-fold,tigrfam_Rep_factor_Rpa1	p.Y256*	ENST00000254719.5	37	c.768	CCDS11014.1	17	.	.	.	.	.	.	.	.	.	.	T	18.90	3.720587	0.68959	.	.	ENSG00000132383	ENST00000254719	.	.	.	6.08	-3.34	0.04943	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-16.6321	15.6688	0.77255	0.0:0.5576:0.0:0.4424	.	.	.	.	X	256	.	ENSP00000254719:Y256X	Y	+	3	2	RPA1	1729267	0.987000	0.35691	0.974000	0.42286	0.157000	0.22087	0.263000	0.18478	-0.532000	0.06332	0.482000	0.46254	TAT	-	pfam_NA-bd_OB_tRNA,superfamily_NA-bd_OB-fold,tigrfam_Rep_factor_Rpa1		0.507	RPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPA1	protein_coding	OTTHUMT00000207118.2	T	NM_002945	-		1782517	+1	no_errors	ENST00000254719	ensembl	human	known	74_37	nonsense	SNP	0.989	A
TNC	3371	genome.wustl.edu	37	9	117853062	117853062	+	Missense_Mutation	SNP	G	G	T			TCGA-WK-A8XQ-01A-11D-A37C-09	TCGA-WK-A8XQ-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a362ed3c-3c06-4aad-8b9e-a4b46b4cbcd3	779e9645-be20-45ce-842e-6224726c5e5a	g.chr9:117853062G>T	ENST00000350763.4	-	2	647	c.236C>A	c.(235-237)cCg>cAg	p.P79Q	TNC_ENST00000423613.2_Missense_Mutation_p.P79Q|TNC_ENST00000340094.3_Missense_Mutation_p.P79Q|TNC_ENST00000346706.3_Missense_Mutation_p.P79Q|TNC_ENST00000345230.3_Missense_Mutation_p.P79Q|TNC_ENST00000537320.1_Missense_Mutation_p.P79Q|TNC_ENST00000535648.1_Missense_Mutation_p.P79Q|TNC_ENST00000542877.1_Missense_Mutation_p.P79Q|TNC_ENST00000341037.4_Missense_Mutation_p.P79Q	NM_002160.3	NP_002151.2	P24821	TENA_HUMAN	tenascin C	79					bud outgrowth involved in lung branching (GO:0060447)|cell adhesion (GO:0007155)|cellular response to prostaglandin D stimulus (GO:0071799)|cellular response to retinoic acid (GO:0071300)|cellular response to vitamin D (GO:0071305)|extracellular matrix organization (GO:0030198)|mesenchymal-epithelial cell signaling involved in prostate gland development (GO:0060739)|negative regulation of cell adhesion (GO:0007162)|neuromuscular junction development (GO:0007528)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|peripheral nervous system axon regeneration (GO:0014012)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|prostate gland epithelium morphogenesis (GO:0060740)|response to ethanol (GO:0045471)|response to fibroblast growth factor (GO:0071774)|response to mechanical stimulus (GO:0009612)|response to wounding (GO:0009611)|wound healing (GO:0042060)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|interstitial matrix (GO:0005614)|membrane (GO:0016020)	syndecan binding (GO:0045545)			NS(3)|breast(5)|central_nervous_system(4)|endometrium(8)|kidney(6)|large_intestine(32)|liver(1)|lung(39)|ovary(1)|pancreas(2)|prostate(5)|skin(5)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	120						CTCTGAAGGCGGTGCCAGGTC	0.567																																																	0								ENSG00000041982						163.0	156.0	158.0					9																	117853062		2203	4300	6503	TNC	SO:0001583	missense	0			-	HGNC		CCDS6811.1	9q33.1	2014-01-28	2008-07-31	2002-06-07	ENSG00000041982	ENSG00000041982		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	5318	protein-coding gene	gene with protein product	"""hexabrachion (tenascin)"""	187380	"""hexabrachion (tenascin C, cytotactin)"", ""deafness, autosomal dominant 56"""	HXB, DFNA56		1704365, 1707164, 23936043	Standard	NM_002160		Approved	TN, MGC167029	uc004bjj.4	P24821	OTTHUMG00000021010	ENST00000350763.4:c.236C>A	9.37:g.117853062G>T	ENSP00000265131:p.Pro79Gln	Somatic	0	35	0.00		0.7132304552168561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70	C9IYT7|C9J575|C9J6D9|C9J848|Q14583|Q15567|Q5T7S3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Fibronectin_type3,pfam_Fibrinogen_a/b/g_C_dom,pfam_EGF_extracell,superfamily_Fibrinogen_a/b/g_C_dom,superfamily_Fibronectin_type3,smart_EG-like_dom,smart_Fibronectin_type3,smart_Fibrinogen_a/b/g_C_dom,pfscan_EG-like_dom,pfscan_Fibronectin_type3	p.P79Q	ENST00000350763.4	37	c.236	CCDS6811.1	9	.	.	.	.	.	.	.	.	.	.	G	9.960	1.222666	0.22457	.	.	ENSG00000041982	ENST00000340094;ENST00000535648;ENST00000346706;ENST00000345230;ENST00000350763;ENST00000442945;ENST00000341037;ENST00000423613;ENST00000537320;ENST00000542877;ENST00000534839	T;T;T;T;T;T;T;T;T;T	0.35789	1.29;1.29;1.29;1.29;1.29;1.29;1.29;1.29;1.29;1.29	5.94	4.13	0.48395	.	0.466873	0.25285	N	0.031773	T	0.30479	0.0766	L	0.42245	1.32	0.09310	N	1	B;B	0.18863	0.031;0.01	B;B	0.20767	0.031;0.008	T	0.27331	-1.0077	10	0.66056	D	0.02	.	9.229	0.37425	0.2182:0.0:0.7818:0.0	.	79;79	E9PC84;P24821	.;TENA_HUMAN	Q	79	ENSP00000344400:P79Q;ENSP00000438152:P79Q;ENSP00000344555:P79Q;ENSP00000345861:P79Q;ENSP00000265131:P79Q;ENSP00000339553:P79Q;ENSP00000411406:P79Q;ENSP00000443478:P79Q;ENSP00000442242:P79Q;ENSP00000443469:P79Q	ENSP00000344400:P79Q	P	-	2	0	TNC	116892883	0.957000	0.32711	0.003000	0.11579	0.039000	0.13416	4.976000	0.63785	0.853000	0.35312	-0.137000	0.14449	CCG	-	NULL		0.567	TNC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNC	protein_coding	OTTHUMT00000055418.2	G	NM_002160	-		117853062	-1	no_errors	ENST00000350763	ensembl	human	known	74_37	missense	SNP	0.035	T
ABCC6	368	genome.wustl.edu	37	16	16271462	16271462	+	Missense_Mutation	SNP	C	C	T			TCGA-WK-A8XQ-01A-11D-A37C-09	TCGA-WK-A8XQ-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a362ed3c-3c06-4aad-8b9e-a4b46b4cbcd3	779e9645-be20-45ce-842e-6224726c5e5a	g.chr16:16271462C>T	ENST00000205557.7	-	19	2466	c.2437G>A	c.(2437-2439)Gca>Aca	p.A813T		NM_001171.5	NP_001162	O95255	MRP6_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 6	813	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(10)|lung(10)|ovary(1)|skin(6)|urinary_tract(1)	43				UCEC - Uterine corpus endometrioid carcinoma (3;0.123)	Cisplatin(DB00515)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Doxorubicin(DB00997)|Etoposide(DB00773)|Indomethacin(DB00328)|Probenecid(DB01032)|Sulfinpyrazone(DB01138)|Teniposide(DB00444)|Vinblastine(DB00570)	ATGTGGAGTGCGTGCGTCACG	0.577																																																	0								ENSG00000091262						112.0	109.0	110.0					16																	16271462		2197	4300	6497	ABCC6	SO:0001583	missense	0			-	HGNC	AF076622	CCDS10568.1, CCDS58430.1	16p13.11	2013-01-08			ENSG00000091262	ENSG00000091262		"""ATP binding cassette transporters / subfamily C"""	57	protein-coding gene	gene with protein product		603234	"""pseudoxanthoma elasticum"""	ARA, PXE		9721217, 11439001	Standard	NM_001079528		Approved	MRP6, EST349056, MLP1, URG7	uc002den.4	O95255	OTTHUMG00000129967	ENST00000205557.7:c.2437G>A	16.37:g.16271462C>T	ENSP00000205557:p.Ala813Thr	Somatic	0	44	0.00		0.7132304552168561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	54	8.47	A2RRN8|A8KIG6|A8Y988|E7ESW8|P78420|Q8TCY8|Q9UMZ7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_P-loop_NTPase,superfamily_ABC1_TM_dom,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom,tigrfam_Multidrug-R_assoc	p.A813T	ENST00000205557.7	37	c.2437	CCDS10568.1	16	.	.	.	.	.	.	.	.	.	.	C	12.43	1.935186	0.34189	.	.	ENSG00000091262	ENST00000205557	T	0.67865	-0.29	4.89	-2.15	0.07102	ATPase, AAA+ type, core (1);ABC transporter-like (1);	0.662303	0.13051	N	0.417724	T	0.51007	0.1649	L	0.43152	1.355	0.49213	D	0.999768	B	0.09022	0.002	B	0.06405	0.002	T	0.14364	-1.0475	10	0.39692	T	0.17	.	5.9006	0.18964	0.1222:0.4219:0.0:0.4559	.	813	O95255	MRP6_HUMAN	T	813	ENSP00000205557:A813T	ENSP00000205557:A813T	A	-	1	0	ABCC6	16178963	0.002000	0.14202	0.124000	0.21820	0.575000	0.36095	0.306000	0.19279	-0.762000	0.04664	-0.672000	0.03802	GCA	-	superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like,tigrfam_Multidrug-R_assoc		0.577	ABCC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCC6	protein_coding	OTTHUMT00000252232.2	C		-		16271462	-1	no_errors	ENST00000205557	ensembl	human	known	74_37	missense	SNP	0.687	T
AHDC1	27245	genome.wustl.edu	37	1	27875353	27875355	+	In_Frame_Del	DEL	AGG	AGG	-			TCGA-WK-A8XQ-01A-11D-A37C-09	TCGA-WK-A8XQ-10A-01D-A37F-09	AGG	AGG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a362ed3c-3c06-4aad-8b9e-a4b46b4cbcd3	779e9645-be20-45ce-842e-6224726c5e5a	g.chr1:27875353_27875355delAGG	ENST00000247087.5	-	5	3868_3870	c.3272_3274delCCT	c.(3271-3276)tccttc>ttc	p.S1091del	AHDC1_ENST00000374011.2_In_Frame_Del_p.S1091del			Q5TGY3	AHDC1_HUMAN	AT hook, DNA binding motif, containing 1	1091							DNA binding (GO:0003677)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(8)|lung(20)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	42		all_lung(284;1.06e-05)|Lung NSC(340;1.86e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.00503)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0434)|OV - Ovarian serous cystadenocarcinoma(117;8.48e-25)|Colorectal(126;9.17e-09)|COAD - Colon adenocarcinoma(152;1.84e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00192)|BRCA - Breast invasive adenocarcinoma(304;0.00259)|STAD - Stomach adenocarcinoma(196;0.00311)|READ - Rectum adenocarcinoma(331;0.0291)		GAGGGCTGGAaggaggaggagga	0.665																																																	0								ENSG00000126705																																			AHDC1	SO:0001651	inframe_deletion	0				HGNC	AK125431	CCDS30652.1	1p36.13	2008-02-05			ENSG00000126705	ENSG00000126705			25230	protein-coding gene	gene with protein product		615790				8619474, 9110174	Standard	XM_005245848		Approved	DJ159A19.3, RP1-159A19.1	uc009vsy.3	Q5TGY3	OTTHUMG00000003398	ENST00000247087.5:c.3272_3274delCCT	1.37:g.27875362_27875364delAGG	ENSP00000247087:p.Ser1091del	Somatic	0	38	0.00		0.7132304552168561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	42	10.64	Q5TGY4|Q6PJK1|Q6ZUQ6|Q99769|Q9NUF5	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	NULL	p.S1091in_frame_del	ENST00000247087.5	37	c.3274_3272	CCDS30652.1	1																																																																																			-	NULL		0.665	AHDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AHDC1	protein_coding	OTTHUMT00000009523.3	AGG				27875355	-1	no_errors	ENST00000247087	ensembl	human	known	74_37	in_frame_del	DEL	1.000:1.000:1.000	-
ZNF285	26974	genome.wustl.edu	37	19	44891263	44891263	+	Missense_Mutation	SNP	C	C	A			TCGA-WK-A8XQ-01A-11D-A37C-09	TCGA-WK-A8XQ-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a362ed3c-3c06-4aad-8b9e-a4b46b4cbcd3	779e9645-be20-45ce-842e-6224726c5e5a	g.chr19:44891263C>A	ENST00000330997.4	-	4	1208	c.1144G>T	c.(1144-1146)Gat>Tat	p.D382Y	ZNF285_ENST00000544719.2_Missense_Mutation_p.D382Y|ZNF285_ENST00000591679.1_Missense_Mutation_p.D389Y|CTC-512J12.6_ENST00000588212.1_Intron	NM_152354.3	NP_689567.3	Q96NJ3	ZN285_HUMAN	zinc finger protein 285	382					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|prostate(5)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	44						GAGCTCTGATCAAAGCCCTTC	0.463																																																	0								ENSG00000267508						62.0	62.0	62.0					19																	44891263		2203	4300	6503	ZNF285	SO:0001583	missense	0			-	HGNC	AK055309	CCDS12638.1, CCDS74389.1	19q13.32	2013-01-08	2010-04-14	2010-04-14		ENSG00000267508		"""Zinc fingers, C2H2-type"", ""-"""	13079	protein-coding gene	gene with protein product			"""zinc finger protein 285A"""	ZNF285A			Standard	XM_005258734		Approved			Q96NJ3	OTTHUMG00000178848	ENST00000330997.4:c.1144G>T	19.37:g.44891263C>A	ENSP00000333595:p.Asp382Tyr	Somatic	0	90	0.00		0.7132304552168561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	47	48	49.47	Q17RJ3|Q6B0A8|Q6ISR5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.D382Y	ENST00000330997.4	37	c.1144	CCDS12638.1	19	.	.	.	.	.	.	.	.	.	.	C	9.615	1.132186	0.21041	.	.	ENSG00000062370	ENST00000544719;ENST00000330997	T	0.17370	2.28	3.36	-1.52	0.08637	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.12646	0.0307	N	0.17248	0.465	0.09310	N	1	P;P	0.44309	0.832;0.801	P;P	0.49140	0.601;0.58	T	0.20240	-1.0281	9	0.87932	D	0	.	3.4849	0.07615	0.2968:0.1973:0.0:0.5059	.	406;382	B7ZLR9;Q96NJ3	.;ZN285_HUMAN	Y	405;382	ENSP00000333595:D382Y	ENSP00000333595:D382Y	D	-	1	0	ZNF285	49583103	0.000000	0.05858	0.147000	0.22382	0.950000	0.60333	-4.159000	0.00283	-0.051000	0.13334	0.298000	0.19748	GAT	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.463	ZNF285-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF285	protein_coding	OTTHUMT00000443600.1	C	NM_152354	-		44891263	-1	no_errors	ENST00000330997	ensembl	human	known	74_37	missense	SNP	0.000	A
RRN3P2	653390	genome.wustl.edu	37	16	29110458	29110458	+	RNA	SNP	T	T	C	rs561841139		TCGA-WK-A8XQ-01A-11D-A37C-09	TCGA-WK-A8XQ-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a362ed3c-3c06-4aad-8b9e-a4b46b4cbcd3	779e9645-be20-45ce-842e-6224726c5e5a	g.chr16:29110458T>C	ENST00000564580.1	+	0	1131							A6NIE6	RN3P2_HUMAN	RNA polymerase I transcription factor homolog (S. cerevisiae) pseudogene 2									p.W375R(25)									GAATTTTGAGTGGATAGTGAT	0.328																																																	25	Substitution - Missense(25)	endometrium(19)|kidney(4)|prostate(2)						ENSG00000103472																																			RRN3P2			0			-	HGNC			16p11.2	2011-12-02			ENSG00000103472	ENSG00000103472			37619	pseudogene	pseudogene							Standard	NR_003369		Approved		uc002dsf.4	A6NIE6			16.37:g.29110458T>C		Somatic	0	50	0.00		0.7132304552168561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	107	11.57		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000564580.1	37	NULL		16	.	.	.	.	.	.	.	.	.	.	N	5.632	0.301362	0.10678	.	.	ENSG00000103472	ENST00000427965	.	.	.	1.93	1.93	0.25924	.	0.000000	0.64402	N	0.000001	T	0.11239	0.0274	.	.	.	.	.	.	.	.	.	.	.	.	T	0.29701	-1.0003	5	0.02654	T	1	.	2.7527	0.05285	0.2724:0.5536:0.0:0.174	.	.	.	.	R	375	.	ENSP00000398611:W375R	W	+	1	0	AC009093.1	29017959	1.000000	0.71417	0.564000	0.28396	0.423000	0.31445	3.439000	0.52878	0.163000	0.19507	-1.160000	0.01791	TGG	-	-		0.328	RRN3P2-001	KNOWN	basic	processed_transcript	RRN3P2	pseudogene	OTTHUMT00000433243.1	T	NR_003369	-		29110458	+1	no_errors	ENST00000427965	ensembl	human	known	74_37	rna	SNP	0.991	C
POTEG	404785	genome.wustl.edu	37	14	19563209	19563210	+	Intron	INS	-	-	T	rs574649851|rs535400901|rs369913188	byFrequency	TCGA-WK-A8XQ-01A-11D-A37C-09	TCGA-WK-A8XQ-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a362ed3c-3c06-4aad-8b9e-a4b46b4cbcd3	779e9645-be20-45ce-842e-6224726c5e5a	g.chr14:19563209_19563210insT	ENST00000409832.3	+	5	969				CTD-2311B13.5_ENST00000548748.1_lincRNA|RNU6-1239P_ENST00000391310.1_RNA	NM_001005356.2	NP_001005356.1	Q6S5H5	POTEG_HUMAN	POTE ankyrin domain family, member G											cervix(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(31)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	47						AGATAAGAGGGTTTTTTTTTTG	0.347																																																	0								ENSG00000258252																																			CTD-2311B13.5	SO:0001627	intron_variant	0				Clone_based_vega_gene		CCDS73610.1	14q11.2	2013-01-10	2008-11-26	2008-11-26	ENSG00000222036	ENSG00000222036		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33896	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 4"""	608916	"""ANKRD26-like family C, member 2"""	A26C2			Standard	NR_027480		Approved	POTE14, POTE-14, POTE14alpha, CT104.4	uc001vuz.1	Q6S5H5	OTTHUMG00000170340	ENST00000409832.3:c.918-194->T	14.37:g.19563219_19563219dupT		Somatic	0	15	0.00		0.7132304552168561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	16	23.81	A1L153|A6NMI9|Q6S5H6|Q6S8J2	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000409832.3	37	NULL	CCDS32018.1	14																																																																																			-	-		0.347	POTEG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC101929948	protein_coding	OTTHUMT00000408579.1	-	NM_001005356			19563210	-1	no_errors	ENST00000548748	ensembl	human	known	74_37	rna	INS	0.008:0.005	T
SLC35F4	341880	genome.wustl.edu	37	14	58096947	58096949	+	Intron	DEL	ATG	ATG	-			TCGA-WK-A8XQ-01A-11D-A37C-09	TCGA-WK-A8XQ-10A-01D-A37F-09	ATG	ATG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a362ed3c-3c06-4aad-8b9e-a4b46b4cbcd3	779e9645-be20-45ce-842e-6224726c5e5a	g.chr14:58096947_58096949delATG	ENST00000556826.1	-	2	340				CTD-2325K12.1_ENST00000600311.1_RNA|SLC35F4_ENST00000557430.1_Intron	NM_001206920.1	NP_001193849.1	A4IF30	S35F4_HUMAN	solute carrier family 35, member F4						transport (GO:0006810)	integral component of membrane (GO:0016021)				breast(1)|endometrium(4)|large_intestine(3)|lung(12)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						TCTTCATGCTATGATGATGATGA	0.399																																																	0								ENSG00000258856																																			CTD-2325K12.1	SO:0001627	intron_variant	0				Clone_based_vega_gene			14q22.3	2013-05-22		2003-11-28	ENSG00000151812	ENSG00000151812		"""Solute carriers"""	19845	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 36"""	C14orf36			Standard	NM_001206920		Approved	FLJ37712	uc021rtp.1	A4IF30	OTTHUMG00000171317	ENST00000556826.1:c.104-36105CAT>-	14.37:g.58096956_58096958delATG		Somatic	0	42	0.00		0.7132304552168561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	A6NDQ3	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000556826.1	37	NULL		14																																																																																			-	-		0.399	SLC35F4-004	NOVEL	not_organism_supported|upstream_uORF|basic|appris_principal	protein_coding	ENSG00000258856	protein_coding	OTTHUMT00000412973.1	ATG	XM_292260			58096949	+1	no_errors	ENST00000600311	ensembl	human	known	74_37	rna	DEL	0.920:0.978:0.994	-
CELF4	56853	genome.wustl.edu	37	18	34825066	34825066	+	3'UTR	SNP	G	G	T			TCGA-WK-A8XQ-01A-11D-A37C-09	TCGA-WK-A8XQ-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a362ed3c-3c06-4aad-8b9e-a4b46b4cbcd3	779e9645-be20-45ce-842e-6224726c5e5a	g.chr18:34825066G>T	ENST00000420428.2	-	0	1995				CELF4_ENST00000590011.1_5'UTR|CELF4_ENST00000591287.1_3'UTR|CELF4_ENST00000412753.1_3'UTR|CELF4_ENST00000334919.5_3'UTR|CELF4_ENST00000603232.1_3'UTR|RP11-95O2.5_ENST00000589281.1_RNA|CELF4_ENST00000601019.1_3'UTR|CELF4_ENST00000361795.5_3'UTR	NM_020180.3	NP_064565.1	Q9BZC1	CELF4_HUMAN	CUGBP, Elav-like family member 4						alternative mRNA splicing, via spliceosome (GO:0000380)|embryo development (GO:0009790)|germ cell development (GO:0007281)|mRNA splice site selection (GO:0006376)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of translation (GO:0017148)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	BRE binding (GO:0042835)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|translation repressor activity, nucleic acid binding (GO:0000900)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(8)|lung(18)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	44						GATTGATATTGGCTGATATGT	0.398																																																	0								ENSG00000101489																																			CELF4	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AF248651	CCDS32818.1, CCDS45857.1, CCDS45858.1	18q12	2013-02-12	2010-02-19	2010-02-19				"""RNA binding motif (RRM) containing"""	14015	protein-coding gene	gene with protein product		612679	"""Bruno (Drosophila) -like 4, RNA binding protein"", ""bruno-like 4, RNA binding protein (Drosophila)"""	BRUNOL4		10893231	Standard	NM_020180		Approved		uc002lae.2	Q9BZC1		ENST00000420428.2:c.*139C>A	18.37:g.34825066G>T		Somatic	0	8	0.00		0.7132304552168561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	7	53.33	Q59EN7|Q86XB9|Q8N2M6|Q9BQ96|Q9NR84|Q9NR85	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000420428.2	37	NULL	CCDS32818.1	18																																																																																			-	-		0.398	CELF4-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CELF4	protein_coding		G	NM_020180	-		34825066	-1	no_errors	ENST00000590011	ensembl	human	known	74_37	rna	SNP	1.000	T
ZAN	7455	genome.wustl.edu	37	7	100385562	100385596	+	RNA	DEL	GCTTCAGCTACCGCTTGCAAGGCCGCATGACCTAT	GCTTCAGCTACCGCTTGCAAGGCCGCATGACCTAT	-	rs549519838|rs369526619|rs112538235|rs373952854|rs113714278|rs72364644|rs59541653	byFrequency	TCGA-WK-A8XQ-01A-11D-A37C-09	TCGA-WK-A8XQ-10A-01D-A37F-09	GCTTCAGCTACCGCTTGCAAGGCCGCATGACCTAT	GCTTCAGCTACCGCTTGCAAGGCCGCATGACCTAT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a362ed3c-3c06-4aad-8b9e-a4b46b4cbcd3	779e9645-be20-45ce-842e-6224726c5e5a	g.chr7:100385562_100385596delGCTTCAGCTACCGCTTGCAAGGCCGCATGACCTAT	ENST00000348028.3	+	0	7195_7229				ZAN_ENST00000427578.1_RNA|ZAN_ENST00000349350.6_RNA|ZAN_ENST00000421100.1_RNA|ZAN_ENST00000546292.1_RNA|ZAN_ENST00000538115.1_RNA|ZAN_ENST00000443370.1_RNA|ZAN_ENST00000449052.1_RNA|ZAN_ENST00000542585.1_RNA|ZAN_ENST00000546213.1_RNA			Q9Y493	ZAN_HUMAN	zonadhesin (gene/pseudogene)						binding of sperm to zona pellucida (GO:0007339)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(2)|breast(3)|central_nervous_system(3)|endometrium(21)|kidney(6)|large_intestine(18)|lung(60)|ovary(4)|pancreas(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)	139	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			ACATTTGACGGCTTCAGCTACCGCTTGCAAGGCCGCATGACCTATGTTCTGATCA	0.583														1187	0.237021	0.1029	0.2752	5008	,	,		26483	0.0327		0.5388	False		,,,				2504	0.2914																0								ENSG00000146839		,	590,3208		88,414,1397					,	-3.1	0.0		dbSNP_130	52	3589,4247		975,1639,1304	no	frameshift,frameshift	ZAN	NM_173059.1,NM_003386.1	,	1063,2053,2701	A1A1,A1R,RR		45.8014,15.5345,35.9206	,	,		4179,7455				ZAN			0				HGNC	U83191		7q22.1	2013-10-10	2013-10-10		ENSG00000146839	ENSG00000146839			12857	protein-coding gene	gene with protein product		602372	"""zonadhesin"""			9799793, 17033959	Standard	NM_003386		Approved		uc003uwk.3	Q9Y493	OTTHUMG00000157037		7.37:g.100385562_100385596delGCTTCAGCTACCGCTTGCAAGGCCGCATGACCTAT		Somatic	NA	NA	NA		0.7132304552168561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A0FKC8|D6W5W4|O00218|Q96L85|Q96L86|Q96L87|Q96L88|Q96L89|Q96L90|Q9BXN9|Q9BZ83|Q9BZ84|Q9BZ85|Q9BZ86|Q9BZ87|Q9BZ88	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_VWF_type-D,pfam_MAM_dom,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_ConA-like_lec_gl_sf,superfamily_TIL_dom,smart_MAM_dom,smart_VWC_out,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_MAM_dom	p.F2344fs	ENST00000348028.3	37	c.7028_7062		7																																																																																			-	pfam_VWF_type-D,smart_VWF_type-D		0.583	ZAN-006	KNOWN	basic	polymorphic_pseudogene	ZAN	polymorphic_pseudogene	OTTHUMT00000347214.1	GCTTCAGCTACCGCTTGCAAGGCCGCATGACCTAT	NM_003386			100385596	+1	no_errors	ENST00000546292	ensembl	human	known	74_37	frame_shift_del	DEL	0.013:0.005:0.000:0.001:0.000:0.000:0.005:0.239:0.512:0.532:0.543:0.259:0.193:0.551:0.747:0.746:0.691:0.313:0.001:0.036:0.867:0.876:0.710:0.622:0.357:0.357:0.884:0.969:0.998:1.000:1.000:1.000:1.000:0.989:0.652	-
TMPRSS11D	9407	genome.wustl.edu	37	4	68708322	68708322	+	Missense_Mutation	SNP	A	A	T			TCGA-WK-A8XQ-01A-11D-A37C-09	TCGA-WK-A8XQ-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a362ed3c-3c06-4aad-8b9e-a4b46b4cbcd3	779e9645-be20-45ce-842e-6224726c5e5a	g.chr4:68708322A>T	ENST00000283916.6	-	4	369	c.271T>A	c.(271-273)Tca>Aca	p.S91T	UBA6-AS1_ENST00000500538.2_RNA|TMPRSS11D_ENST00000509584.1_5'UTR|TMPRSS11D_ENST00000545541.1_5'UTR	NM_004262.2	NP_004253.1	O60235	TM11D_HUMAN	transmembrane protease, serine 11D	91	SEA. {ECO:0000255|PROSITE- ProRule:PRU00188}.				proteolysis (GO:0006508)|respiratory gaseous exchange (GO:0007585)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)			cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	23						CTTAAATTTGATTCTTTGAAT	0.358																																																	0								ENSG00000153802						79.0	82.0	81.0					4																	68708322		2203	4299	6502	TMPRSS11D	SO:0001583	missense	0			-	HGNC	AB002134	CCDS3518.1	4q13.2	2010-04-13			ENSG00000153802	ENSG00000153802		"""Serine peptidases / Transmembrane"""	24059	protein-coding gene	gene with protein product	"""airway trypsin like protease"""	605369				9565616, 9070615	Standard	XM_005265710		Approved		uc003hdq.3	O60235	OTTHUMG00000129300	ENST00000283916.6:c.271T>A	4.37:g.68708322A>T	ENSP00000283916:p.Ser91Thr	Somatic	0	18	0.00		0.7132304552168561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	46	16.36	Q08AF6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_Pept_S1A_HAT/DESC1,pfam_Peptidase_S1,pfam_SEA_dom,pfam_Peptidase_S1A_nudel,superfamily_Trypsin-like_Pept_dom,smart_SEA_dom,smart_Peptidase_S1,prints_Peptidase_S1A,pfscan_SEA_dom,pfscan_Peptidase_S1	p.S91T	ENST00000283916.6	37	c.271	CCDS3518.1	4	.	.	.	.	.	.	.	.	.	.	A	16.96	3.266363	0.59540	.	.	ENSG00000153802	ENST00000283916	T	0.55052	0.54	5.19	5.19	0.71726	SEA (3);	0.000000	0.48767	D	0.000179	T	0.73674	0.3617	M	0.86420	2.815	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	T	0.75752	-0.3207	10	0.39692	T	0.17	.	11.7214	0.51685	1.0:0.0:0.0:0.0	.	91	O60235	TM11D_HUMAN	T	91	ENSP00000283916:S91T	ENSP00000283916:S91T	S	-	1	0	TMPRSS11D	68390917	0.998000	0.40836	0.536000	0.28039	0.654000	0.38779	4.243000	0.58721	2.067000	0.61834	0.533000	0.62120	TCA	-	pirsf_Pept_S1A_HAT/DESC1,pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom		0.358	TMPRSS11D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMPRSS11D	protein_coding	OTTHUMT00000251430.3	A	NM_004262	-		68708322	-1	no_errors	ENST00000283916	ensembl	human	known	74_37	missense	SNP	0.757	T
SFXN2	118980	genome.wustl.edu	37	10	104497506	104497506	+	Missense_Mutation	SNP	A	A	G	rs201424155		TCGA-WK-A8XQ-01A-11D-A37C-09	TCGA-WK-A8XQ-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a362ed3c-3c06-4aad-8b9e-a4b46b4cbcd3	779e9645-be20-45ce-842e-6224726c5e5a	g.chr10:104497506A>G	ENST00000369893.5	+	12	1123	c.956A>G	c.(955-957)aAt>aGt	p.N319S		NM_178858.4	NP_849189.1	Q96NB2	SFXN2_HUMAN	sideroflexin 2	319					iron ion homeostasis (GO:0055072)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	cation transmembrane transporter activity (GO:0008324)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|liver(2)|lung(3)|prostate(1)	13		Colorectal(252;0.207)		Epithelial(162;4.53e-09)|all cancers(201;1.2e-07)|BRCA - Breast invasive adenocarcinoma(275;0.218)		GTCTACTTCAATAAGGGTCTC	0.463													A|||	1	0.000199681	0.0	0.0	5008	,	,		21464	0.0		0.001	False		,,,				2504	0.0																0								ENSG00000156398						129.0	109.0	115.0					10																	104497506		2203	4300	6503	SFXN2	SO:0001583	missense	0			GMAF=0.0005	HGNC	AF462052	CCDS7539.1	10q24.32	2006-03-13			ENSG00000156398	ENSG00000156398		"""Sideroflexins"""	16086	protein-coding gene	gene with protein product		615570					Standard	NM_178858		Approved		uc001kwb.2	Q96NB2	OTTHUMG00000018967	ENST00000369893.5:c.956A>G	10.37:g.104497506A>G	ENSP00000358909:p.Asn319Ser	Somatic	0	29	0.00		0.7132304552168561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	28	50.88	Q5JSM6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Mtc,tigrfam_Mtc	p.N319S	ENST00000369893.5	37	c.956	CCDS7539.1	10	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	A	24.0	4.487136	0.84854	.	.	ENSG00000156398	ENST00000369893	T	0.37411	1.2	5.68	4.55	0.56014	.	0.000000	0.85682	D	0.000000	T	0.63570	0.2522	M	0.88241	2.94	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.68337	-0.5435	10	0.87932	D	0	-8.0034	10.3504	0.43931	0.9225:0.0:0.0775:0.0	.	319	Q96NB2	SFXN2_HUMAN	S	319	ENSP00000358909:N319S	ENSP00000358909:N319S	N	+	2	0	SFXN2	104487496	1.000000	0.71417	0.996000	0.52242	0.975000	0.68041	7.875000	0.87205	0.998000	0.38996	0.459000	0.35465	AAT	-	pfam_Mtc,tigrfam_Mtc		0.463	SFXN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SFXN2	protein_coding	OTTHUMT00000050096.2	A	XM_058359	rs201424155		104497506	+1	no_errors	ENST00000369893	ensembl	human	known	74_37	missense	SNP	1.000	G
CREB3L3	84699	genome.wustl.edu	37	19	4171147	4171147	+	Missense_Mutation	SNP	C	C	T			TCGA-WK-A8XQ-01A-11D-A37C-09	TCGA-WK-A8XQ-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a362ed3c-3c06-4aad-8b9e-a4b46b4cbcd3	779e9645-be20-45ce-842e-6224726c5e5a	g.chr19:4171147C>T	ENST00000078445.2	+	8	1097	c.950C>T	c.(949-951)tCa>tTa	p.S317L	CREB3L3_ENST00000252587.3_Intron|CREB3L3_ENST00000602147.1_Silent_p.V281V|CREB3L3_ENST00000595923.1_Missense_Mutation_p.S316L|CREB3L3_ENST00000602257.1_Missense_Mutation_p.S315L	NM_001271995.1|NM_001271996.1|NM_032607.1	NP_001258924.1|NP_001258925.1|NP_115996.1	Q68CJ9	CR3L3_HUMAN	cAMP responsive element binding protein 3-like 3	317					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to unfolded protein (GO:0006986)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			breast(2)|kidney(1)|large_intestine(3)|lung(12)|ovary(1)|skin(2)|urinary_tract(3)	24				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0232)|STAD - Stomach adenocarcinoma(1328;0.18)		ACCAGCAAGTCAGCCCAGACA	0.607																																																	0								ENSG00000060566						76.0	71.0	72.0					19																	4171147		2203	4300	6503	CREB3L3	SO:0001583	missense	0			-	HGNC		CCDS12121.1, CCDS62498.1, CCDS62499.1, CCDS62500.1	19p13.3	2013-01-10				ENSG00000060566		"""basic leucine zipper proteins"""	18855	protein-coding gene	gene with protein product		611998				11353085	Standard	NM_032607		Approved	CREB-H	uc002lzl.4	Q68CJ9		ENST00000078445.2:c.950C>T	19.37:g.4171147C>T	ENSP00000078445:p.Ser317Leu	Somatic	0	40	0.00		0.7132304552168561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	35	33	51.47	B2R7S6|B7ZL69|M0QYW7|Q6ZMC5|Q96TB9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_bZIP,superfamily_TF_DNA-bd,smart_bZIP,pfscan_bZIP	p.S317L	ENST00000078445.2	37	c.950	CCDS12121.1	19	.	.	.	.	.	.	.	.	.	.	C	16.52	3.146870	0.57151	.	.	ENSG00000060566	ENST00000078445;ENST00000381943	D	0.84223	-1.82	4.58	4.58	0.56647	.	0.353602	0.26023	N	0.026810	D	0.86485	0.5944	M	0.65975	2.015	0.80722	D	1	P;P;P	0.48640	0.828;0.913;0.858	B;P;B	0.47044	0.197;0.535;0.334	D	0.88006	0.2759	10	0.56958	D	0.05	-0.0711	14.8629	0.70394	0.0:1.0:0.0:0.0	.	315;316;317	B7ZL69;Q68CJ9-2;Q68CJ9	.;.;CR3L3_HUMAN	L	317;275	ENSP00000078445:S317L	ENSP00000078445:S317L	S	+	2	0	CREB3L3	4122147	0.994000	0.37717	0.949000	0.38748	0.231000	0.25187	5.371000	0.66150	2.093000	0.63338	0.561000	0.74099	TCA	-	NULL		0.607	CREB3L3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CREB3L3	protein_coding	OTTHUMT00000457922.1	C	NM_032607	-		4171147	+1	no_errors	ENST00000078445	ensembl	human	known	74_37	missense	SNP	0.925	T
SCN4B	6330	genome.wustl.edu	37	11	118006807	118006808	+	3'UTR	INS	-	-	GGGGGAGAAGC	rs144216378|rs397753873|rs59423170	byFrequency	TCGA-WK-A8XQ-01A-11D-A37C-09	TCGA-WK-A8XQ-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a362ed3c-3c06-4aad-8b9e-a4b46b4cbcd3	779e9645-be20-45ce-842e-6224726c5e5a	g.chr11:118006807_118006808insGGGGGAGAAGC	ENST00000324727.4	-	0	1767_1768				SCN4B_ENST00000423160.2_5'UTR	NM_001142349.1|NM_174934.3	NP_001135821.1|NP_777594.1	Q8IWT1	SCN4B_HUMAN	sodium channel, voltage-gated, type IV, beta subunit						AV node cell to bundle of His cell communication (GO:0086067)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|positive regulation of sodium ion transport (GO:0010765)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transporter activity (GO:2000649)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	intercalated disc (GO:0014704)|intrinsic component of plasma membrane (GO:0031226)|voltage-gated sodium channel complex (GO:0001518)	ion channel binding (GO:0044325)|sodium channel regulator activity (GO:0017080)|voltage-gated sodium channel activity (GO:0005248)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)			kidney(1)|large_intestine(2)|lung(2)|ovary(1)|skin(1)	7	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;3.33e-05)|Epithelial(105;0.00126)	Valproic Acid(DB00313)|Zonisamide(DB00909)	CTCAGGTAGGAGGGGGAGAAGC	0.683														1426	0.284744	0.2837	0.3343	5008	,	,		13940	0.2599		0.3588	False		,,,				2504	0.2004																0								ENSG00000177098																																			SCN4B	SO:0001624	3_prime_UTR_variant	0				HGNC	AY149967	CCDS8389.1, CCDS44744.1	11q23.3	2014-09-17	2012-02-28		ENSG00000177098	ENSG00000177098		"""Sodium channels"", ""Immunoglobulin superfamily / V-set domain containing"""	10592	protein-coding gene	gene with protein product		608256	"""sodium channel, voltage-gated, type IV, beta"""				Standard	NM_174934		Approved	LQT10	uc001pse.3	Q8IWT1	OTTHUMG00000166994	ENST00000324727.4:c.*935->GCTTCTCCCCC	11.37:g.118006808_118006818dupGGGGGAGAAGC		Somatic	NA	NA	NA		0.7132304552168561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	E9PPT5|Q6PIG5	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000324727.4	37	NULL	CCDS8389.1	11																																																																																			-	-		0.683	SCN4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN4B	protein_coding	OTTHUMT00000392326.1	-				118006808	-1	no_errors	ENST00000423160	ensembl	human	known	74_37	rna	INS	0.000:0.000	GGGGGAGAAGC
ANKLE1	126549	genome.wustl.edu	37	19	17394064	17394064	+	Missense_Mutation	SNP	C	C	T			TCGA-WK-A8XQ-01A-11D-A37C-09	TCGA-WK-A8XQ-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a362ed3c-3c06-4aad-8b9e-a4b46b4cbcd3	779e9645-be20-45ce-842e-6224726c5e5a	g.chr19:17394064C>T	ENST00000394458.3	+	5	767	c.491C>T	c.(490-492)aCg>aTg	p.T164M	ANKLE1_ENST00000594072.1_Missense_Mutation_p.T153M|ANKLE1_ENST00000404085.1_Missense_Mutation_p.T186M|ANKLE1_ENST00000433424.2_Missense_Mutation_p.T218M|ANKLE1_ENST00000598347.1_Missense_Mutation_p.T164M	NM_152363.4	NP_689576	Q8NAG6	ANKL1_HUMAN	ankyrin repeat and LEM domain containing 1	164										large_intestine(1)|lung(3)|prostate(1)|skin(1)|urinary_tract(1)	7						ACCGATGAGACGCTGGACTCC	0.592											OREG0025341	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000160117						61.0	61.0	61.0					19																	17394064		2203	4300	6503	ANKLE1	SO:0001583	missense	0			-	HGNC	AK096688	CCDS12354.2, CCDS12354.3	19p13.11	2013-01-10	2008-03-25	2008-03-25	ENSG00000160117	ENSG00000160117		"""Ankyrin repeat domain containing"""	26812	protein-coding gene	gene with protein product	"""LEM domain containing 6"""		"""ankyrin repeat domain 41"""	ANKRD41			Standard	NM_152363		Approved	FLJ39369, LEMD6	uc002nga.2	Q8NAG6	OTTHUMG00000150839	ENST00000394458.3:c.491C>T	19.37:g.17394064C>T	ENSP00000377971:p.Thr164Met	Somatic	0	26	0.00	717	0.7132304552168561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	39	9.30	A8VU82|Q8N8J8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ankyrin_rpt,pfam_LEM_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_LEM/LEM-like_dom,superfamily_Lactate_DH/Glyco_Ohase_4_C,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_LEM_dom	p.T164M	ENST00000394458.3	37	c.491	CCDS12354.2	19	.	.	.	.	.	.	.	.	.	.	C	6.584	0.476018	0.12521	.	.	ENSG00000160117	ENST00000404261;ENST00000433424;ENST00000404085;ENST00000394458;ENST00000438921	T;T;T	0.72725	-0.57;-0.67;-0.68	3.58	-4.66	0.03329	.	12.237900	0.00654	N	0.000562	T	0.47173	0.1431	N	0.19112	0.55	0.09310	N	1	B;P;B;B	0.38167	0.291;0.621;0.002;0.002	B;B;B;B	0.24006	0.009;0.05;0.001;0.0	T	0.45056	-0.9287	10	0.36615	T	0.2	-14.946	6.255	0.20870	0.0:0.3888:0.1324:0.4788	.	164;150;164;153	E7ETZ9;Q8NAG6-1;Q8NAG6;A0JLW0	.;.;ANKL1_HUMAN;.	M	164;218;186;153;164	ENSP00000384753:T164M;ENSP00000394460:T218M;ENSP00000384008:T186M	ENSP00000377971:T153M	T	+	2	0	ANKLE1	17255064	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-1.360000	0.02600	-0.950000	0.03659	-1.786000	0.00637	ACG	-	NULL		0.592	ANKLE1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANKLE1	protein_coding	OTTHUMT00000325392.2	C	NM_152363	-		17394064	+1	no_errors	ENST00000394458	ensembl	human	known	74_37	missense	SNP	0.000	T
PSMD3	5709	genome.wustl.edu	37	17	38146359	38146359	+	Missense_Mutation	SNP	C	C	G			TCGA-WK-A8XQ-01A-11D-A37C-09	TCGA-WK-A8XQ-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a362ed3c-3c06-4aad-8b9e-a4b46b4cbcd3	779e9645-be20-45ce-842e-6224726c5e5a	g.chr17:38146359C>G	ENST00000264639.4	+	6	1064	c.890C>G	c.(889-891)gCc>gGc	p.A297G	PSMD3_ENST00000541736.1_Missense_Mutation_p.A159G	NM_002809.3	NP_002800.2	O43242	PSMD3_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 3	297					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of protein catabolic process (GO:0042176)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)	enzyme regulator activity (GO:0030234)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|pancreas(1)|prostate(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	26	Colorectal(19;0.000442)					CGAATCAAAGCCATCCAGCTG	0.587																																					Ovarian(186;531 2051 6385 19668 48409)												0								ENSG00000108344						69.0	59.0	63.0					17																	38146359		2203	4300	6503	PSMD3	SO:0001583	missense	0			-	HGNC	D67025	CCDS11356.1	17q21.2	2010-07-23			ENSG00000108344	ENSG00000108344		"""Proteasome (prosome, macropain) subunits"""	9560	protein-coding gene	gene with protein product			"""tissue specific transplantation antigen 2"""	TSTA2		9017604	Standard	NM_002809		Approved	S3, P58, Rpn3	uc002htn.2	O43242	OTTHUMG00000133251	ENST00000264639.4:c.890C>G	17.37:g.38146359C>G	ENSP00000264639:p.Ala297Gly	Somatic	0	53	0.00		0.7132304552168561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	35	45	43.75	B3KMW9|B4DT72|Q96EI2|Q9BQA4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_26S_Psome_reg_C,pfam_PCI_dom,smart_PAM,smart_PCI_dom	p.A297G	ENST00000264639.4	37	c.890	CCDS11356.1	17	.	.	.	.	.	.	.	.	.	.	C	18.46	3.628416	0.67015	.	.	ENSG00000108344	ENST00000264639;ENST00000415039;ENST00000541736	T;T	0.76578	-1.03;-1.03	4.96	2.97	0.34412	Tetratricopeptide-like helical (1);PCI/PINT associated module (1);	0.051446	0.85682	D	0.000000	D	0.83575	0.5284	H	0.94771	3.58	0.80722	D	1	P	0.46621	0.881	P	0.44518	0.452	D	0.85104	0.0959	10	0.72032	D	0.01	-14.5673	9.9572	0.41675	0.0:0.7844:0.1396:0.076	.	297	O43242	PSMD3_HUMAN	G	297;284;159	ENSP00000264639:A297G;ENSP00000442508:A159G	ENSP00000264639:A297G	A	+	2	0	PSMD3	35399885	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	7.446000	0.80609	0.679000	0.31345	0.655000	0.94253	GCC	-	smart_PAM		0.587	PSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMD3	protein_coding	OTTHUMT00000257018.1	C	NM_002809	-		38146359	+1	no_errors	ENST00000264639	ensembl	human	known	74_37	missense	SNP	1.000	G
OR5P2	120065	genome.wustl.edu	37	11	7817816	7817816	+	Missense_Mutation	SNP	C	C	T	rs372220227		TCGA-WK-A8XQ-01A-11D-A37C-09	TCGA-WK-A8XQ-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a362ed3c-3c06-4aad-8b9e-a4b46b4cbcd3	779e9645-be20-45ce-842e-6224726c5e5a	g.chr11:7817816C>T	ENST00000329434.2	-	1	704	c.674G>A	c.(673-675)cGc>cAc	p.R225H	RP11-35J10.5_ENST00000527565.1_lincRNA	NM_153444.1	NP_703145.1	Q8WZ92	OR5P2_HUMAN	olfactory receptor, family 5, subfamily P, member 2	225						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(4)	22				Epithelial(150;8.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		CTCAGTGGAGCGCATCTTCAG	0.493													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18924	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000183303	C	HIS/ARG	0,4214		0,0,2107	110.0	112.0	112.0		674	1.6	1.0	11		112	1,8583		0,1,4291	no	missense	OR5P2	NM_153444.1	29	0,1,6398	TT,TC,CC		0.0116,0.0,0.0078	benign	225/323	7817816	1,12797	2107	4292	6399	OR5P2	SO:0001583	missense	0			-	HGNC	AF173006	CCDS7782.1	11p15.4	2012-08-09			ENSG00000183303	ENSG00000183303		"""GPCR / Class A : Olfactory receptors"""	14783	protein-coding gene	gene with protein product							Standard	NM_153444		Approved	JCG3	uc001mfp.1	Q8WZ92	OTTHUMG00000165668	ENST00000329434.2:c.674G>A	11.37:g.7817816C>T	ENSP00000331823:p.Arg225His	Somatic	0	37	0.00		0.7132304552168561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	30	46.55	Q3MIS8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.R225H	ENST00000329434.2	37	c.674	CCDS7782.1	11	.	.	.	.	.	.	.	.	.	.	C	6.987	0.552188	0.13374	0.0	1.16E-4	ENSG00000183303	ENST00000329434	T	0.39229	1.09	5.5	1.61	0.23674	GPCR, rhodopsin-like superfamily (1);	1.249150	0.05210	N	0.506500	T	0.20901	0.0503	N	0.05124	-0.11	0.22096	N	0.999368	B	0.17852	0.024	B	0.20767	0.031	T	0.23726	-1.0180	10	0.13470	T	0.59	3.4885	4.7514	0.13063	0.0:0.5351:0.147:0.3179	.	225	Q8WZ92	OR5P2_HUMAN	H	225	ENSP00000331823:R225H	ENSP00000331823:R225H	R	-	2	0	OR5P2	7774392	0.000000	0.05858	0.994000	0.49952	0.866000	0.49608	-1.237000	0.02922	0.155000	0.19261	0.555000	0.69702	CGC	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM		0.493	OR5P2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5P2	protein_coding	OTTHUMT00000385696.1	C	NM_153444	-		7817816	-1	no_errors	ENST00000329434	ensembl	human	known	74_37	missense	SNP	0.435	T
GPR158	57512	genome.wustl.edu	37	10	25889363	25889363	+	3'UTR	DEL	A	A	-			TCGA-WK-A8XQ-01A-11D-A37C-09	TCGA-WK-A8XQ-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a362ed3c-3c06-4aad-8b9e-a4b46b4cbcd3	779e9645-be20-45ce-842e-6224726c5e5a	g.chr10:25889363delA	ENST00000376351.3	+	0	5167				GPR158_ENST00000490549.1_3'UTR	NM_020752.2	NP_065803.2	Q5T848	GP158_HUMAN	G protein-coupled receptor 158						protein localization to plasma membrane (GO:0072659)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(5)|cervix(1)|endometrium(9)|kidney(10)|large_intestine(20)|lung(56)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	119						TTTGCCTTTCAAAAAAAAACA	0.313																																																	0								ENSG00000151025																																			GPR158	SO:0001624	3_prime_UTR_variant	0				HGNC	AB032962	CCDS31166.1	10p12.31	2012-08-21			ENSG00000151025	ENSG00000151025		"""GPCR / Class C : Orphans"""	23689	protein-coding gene	gene with protein product		614573					Standard	NM_020752		Approved	KIAA1136	uc001isj.3	Q5T848	OTTHUMG00000017832	ENST00000376351.3:c.*1160A>-	10.37:g.25889363delA		Somatic	0	14	0.00		0.7132304552168561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	13	13.33	Q6QR81|Q9ULT3	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000376351.3	37	NULL	CCDS31166.1	10																																																																																			-	-		0.313	GPR158-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR158	protein_coding	OTTHUMT00000047248.2	A	XM_166110			25889363	+1	no_errors	ENST00000490549	ensembl	human	known	74_37	rna	DEL	0.417	-
GEMIN8	54960	genome.wustl.edu	37	X	14038512	14038512	+	Missense_Mutation	SNP	G	G	T			TCGA-WK-A8XQ-01A-11D-A37C-09	TCGA-WK-A8XQ-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a362ed3c-3c06-4aad-8b9e-a4b46b4cbcd3	779e9645-be20-45ce-842e-6224726c5e5a	g.chrX:14038512G>T	ENST00000380523.4	-	4	475	c.157C>A	c.(157-159)Cca>Aca	p.P53T	GEMIN8_ENST00000398355.3_Missense_Mutation_p.P53T|GEMIN8_ENST00000460203.1_5'UTR	NM_017856.2	NP_060326.1	Q9NWZ8	GEMI8_HUMAN	gem (nuclear organelle) associated protein 8	53					spliceosomal snRNP assembly (GO:0000387)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|SMN complex (GO:0032797)|SMN-Sm protein complex (GO:0034719)				breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)	9						AAGTACCATGGAAGATTGAAA	0.473																																																	0								ENSG00000046647						131.0	116.0	121.0					X																	14038512		2203	4300	6503	GEMIN8	SO:0001583	missense	0			-	HGNC	BC020785	CCDS14159.1	Xp22	2010-03-16	2006-11-24	2006-11-24	ENSG00000046647	ENSG00000046647			26044	protein-coding gene	gene with protein product			"""family with sequence similarity 51, member A1"""	FAM51A1		16434402	Standard	NM_017856		Approved	FLJ20514	uc004cwd.3	Q9NWZ8	OTTHUMG00000021160	ENST00000380523.4:c.157C>A	X.37:g.14038512G>T	ENSP00000369895:p.Pro53Thr	Somatic	0	19	0.00		0.7132304552168561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	15	21.05	C4AMC4|Q2LJ66|Q6ZV27	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.P53T	ENST00000380523.4	37	c.157	CCDS14159.1	X	.	.	.	.	.	.	.	.	.	.	g	13.64	2.296121	0.40594	.	.	ENSG00000046647	ENST00000380523;ENST00000398355;ENST00000332885	T;T;T	0.41400	1.0;1.0;1.0	5.11	3.25	0.37280	.	0.520319	0.20818	N	0.085113	T	0.47673	0.1458	L	0.60455	1.87	0.09310	N	1	D	0.58620	0.983	P	0.54544	0.755	T	0.31447	-0.9943	10	0.33940	T	0.23	.	7.6814	0.28515	0.2827:0.0:0.7173:0.0	.	53	Q9NWZ8	GEMI8_HUMAN	T	53	ENSP00000369895:P53T;ENSP00000381398:P53T;ENSP00000369894:P53T	ENSP00000369894:P53T	P	-	1	0	GEMIN8	13948433	0.007000	0.16637	0.001000	0.08648	0.022000	0.10575	0.859000	0.27858	0.337000	0.23665	-0.390000	0.06520	CCA	-	NULL		0.473	GEMIN8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GEMIN8	protein_coding	OTTHUMT00000055815.1	G	NM_017856	-		14038512	-1	no_errors	ENST00000380523	ensembl	human	known	74_37	missense	SNP	0.011	T
SETX	23064	genome.wustl.edu	37	9	135202975	135202975	+	Missense_Mutation	SNP	C	C	A			TCGA-WK-A8XQ-01A-11D-A37C-09	TCGA-WK-A8XQ-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a362ed3c-3c06-4aad-8b9e-a4b46b4cbcd3	779e9645-be20-45ce-842e-6224726c5e5a	g.chr9:135202975C>A	ENST00000224140.5	-	10	4192	c.4010G>T	c.(4009-4011)aGa>aTa	p.R1337I	SETX_ENST00000393220.1_Missense_Mutation_p.R1337I|SETX_ENST00000372169.2_Missense_Mutation_p.R1337I	NM_015046.5	NP_055861.3	Q7Z333	SETX_HUMAN	senataxin	1337					cell death (GO:0008219)|circadian rhythm (GO:0007623)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|RNA processing (GO:0006396)|termination of RNA polymerase II transcription (GO:0006369)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			breast(7)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(1)|lung(36)|ovary(2)|prostate(2)|skin(1)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	97		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000171)		CTTATTATTTCTGACAGACAG	0.358																																																	0								ENSG00000107290						65.0	66.0	66.0					9																	135202975		2202	4300	6502	SETX	SO:0001583	missense	0			-	HGNC	AB014525	CCDS6947.1	9q34	2014-09-17	2005-11-29	2005-11-29	ENSG00000107290	ENSG00000107290			445	protein-coding gene	gene with protein product		608465	"""amyotrophic lateral sclerosis 4"", ""spinocerebellar ataxia, recessive, non-Friedreich type 1"""	ALS4, SCAR1		9497266, 11022012	Standard	NM_015046		Approved	KIAA0625, AOA2	uc004cbk.3	Q7Z333	OTTHUMG00000020834	ENST00000224140.5:c.4010G>T	9.37:g.135202975C>A	ENSP00000224140:p.Arg1337Ile	Somatic	0	29	0.00		0.7132304552168561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	38	45	45.78	A2A396|B2RPB2|B5ME16|C9JQ10|O75120|Q3KQX4|Q5JUJ1|Q68DW5|Q6AZD7|Q7Z3J6|Q8WX33|Q9H9D1|Q9NVP9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_P-loop_NTPase	p.R1337I	ENST00000224140.5	37	c.4010	CCDS6947.1	9	.	.	.	.	.	.	.	.	.	.	C	10.99	1.506249	0.26949	.	.	ENSG00000107290	ENST00000224140;ENST00000372169;ENST00000393220	D;D;D	0.87334	-2.15;-2.24;-1.85	5.46	-6.75	0.01738	.	1.015060	0.07854	N	0.965186	D	0.82765	0.5108	L	0.36672	1.1	0.39908	D	0.973981	P;P;D	0.53151	0.911;0.877;0.958	P;B;P	0.44990	0.466;0.276;0.466	T	0.80674	-0.1277	10	0.87932	D	0	.	16.9966	0.86369	0.0:0.1018:0.0:0.8982	.	1337;1337;1337	Q7Z333-3;Q7Z333;Q7Z333-4	.;SETX_HUMAN;.	I	1337	ENSP00000224140:R1337I;ENSP00000361242:R1337I;ENSP00000376913:R1337I	ENSP00000224140:R1337I	R	-	2	0	SETX	134192796	0.296000	0.24398	0.145000	0.22337	0.048000	0.14542	-0.435000	0.06931	-1.509000	0.01798	-0.312000	0.09012	AGA	-	NULL		0.358	SETX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETX	protein_coding	OTTHUMT00000054774.3	C	NM_015046	-		135202975	-1	no_errors	ENST00000372169	ensembl	human	known	74_37	missense	SNP	0.923	A
PICK1	9463	genome.wustl.edu	37	22	38471034	38471036	+	In_Frame_Del	DEL	GGA	GGA	-			TCGA-WK-A8XQ-01A-11D-A37C-09	TCGA-WK-A8XQ-10A-01D-A37F-09	GGA	GGA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a362ed3c-3c06-4aad-8b9e-a4b46b4cbcd3	779e9645-be20-45ce-842e-6224726c5e5a	g.chr22:38471034_38471036delGGA	ENST00000404072.3	+	13	1490_1492	c.1143_1145delGGA	c.(1141-1146)ggggag>ggg	p.E388del	RP5-1039K5.13_ENST00000445483.1_RNA|PICK1_ENST00000356976.3_In_Frame_Del_p.E388del	NM_001039583.1|NM_001039584.1	NP_001034672.1|NP_001034673.1	Q9NRD5	PICK1_HUMAN	protein interacting with PRKCA 1	388	Poly-Glu.				ATP catabolic process (GO:0006200)|cellular response to decreased oxygen levels (GO:0036294)|cellular response to glucose starvation (GO:0042149)|dendritic spine maintenance (GO:0097062)|dendritic spine organization (GO:0097061)|DNA methylation involved in embryo development (GO:0043045)|DNA methylation involved in gamete generation (GO:0043046)|glial cell development (GO:0021782)|long term synaptic depression (GO:0060292)|monoamine transport (GO:0015844)|negative regulation of Arp2/3 complex-mediated actin nucleation (GO:0034316)|neuronal ion channel clustering (GO:0045161)|positive regulation of receptor internalization (GO:0002092)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein phosphorylation (GO:0006468)|protein targeting (GO:0006605)|receptor clustering (GO:0043113)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|endocytic vesicle membrane (GO:0030666)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synapse (GO:0045202)	actin filament binding (GO:0051015)|Arp2/3 complex binding (GO:0071933)|ATPase activity (GO:0016887)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein kinase C binding (GO:0005080)|receptor binding (GO:0005102)			cervix(1)|endometrium(3)|large_intestine(1)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)	13	Melanoma(58;0.045)					TCACAGATGGggaggaggaggag	0.635																																																	0								ENSG00000100151																																			PICK1	SO:0001651	inframe_deletion	0				HGNC	AL049654	CCDS13965.1	22q13.1	2006-02-14	2006-02-14	2006-02-14	ENSG00000100151	ENSG00000100151			9394	protein-coding gene	gene with protein product		605926	"""protein kinase C, alpha binding protein"", ""protein interacting with PRKCA"""	PRKCABP		10340301, 10591208	Standard	XM_006724377		Approved	dJ1039K5, MGC15204	uc003aus.3	Q9NRD5	OTTHUMG00000151159	ENST00000404072.3:c.1143_1145delGGA	22.37:g.38471043_38471045delGGA	ENSP00000385205:p.Glu388del	Somatic	0	23	0.00		0.7132304552168561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	23	11.54	B3KS52|O95906	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_AH_dom,pfam_PDZ,pfam_BAR_dom,superfamily_PDZ,smart_PDZ,pfscan_AH_dom,pfscan_PDZ	p.E385in_frame_del	ENST00000404072.3	37	c.1143_1145	CCDS13965.1	22																																																																																			-	NULL		0.635	PICK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PICK1	protein_coding	OTTHUMT00000321569.2	GGA	NM_012407			38471036	+1	no_errors	ENST00000356976	ensembl	human	known	74_37	in_frame_del	DEL	0.071:1.000:1.000	-
OTX1	5013	genome.wustl.edu	37	2	63283301	63283301	+	Silent	SNP	T	T	A			TCGA-WK-A8XQ-01A-11D-A37C-09	TCGA-WK-A8XQ-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a362ed3c-3c06-4aad-8b9e-a4b46b4cbcd3	779e9645-be20-45ce-842e-6224726c5e5a	g.chr2:63283301T>A	ENST00000282549.2	+	5	1191	c.915T>A	c.(913-915)ggT>ggA	p.G305G	OTX1_ENST00000366671.3_Silent_p.G305G	NM_014562.3	NP_055377.1	P32242	OTX1_HUMAN	orthodenticle homeobox 1	305					anterior/posterior pattern specification (GO:0009952)|diencephalon morphogenesis (GO:0048852)|inner ear morphogenesis (GO:0042472)|metencephalon development (GO:0022037)|midbrain development (GO:0030901)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			endometrium(1)|kidney(2)|large_intestine(6)|lung(6)|pancreas(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	20	Lung NSC(7;0.121)|all_lung(7;0.211)					aAGGCTACGGTGGCTCTGGGC	0.627																																																	0								ENSG00000115507						93.0	71.0	79.0					2																	63283301		2203	4300	6503	OTX1	SO:0001819	synonymous_variant	0			-	HGNC		CCDS1873.1	2p15	2011-06-20	2007-02-15		ENSG00000115507	ENSG00000115507		"""Homeoboxes / PRD class"""	8521	protein-coding gene	gene with protein product		600036	"""orthodenticle (Drosophila) homolog 1"", ""orthodenticle homolog 1 (Drosophila)"""			7959790	Standard	NM_001199770		Approved		uc002scd.3	P32242	OTTHUMG00000129454	ENST00000282549.2:c.915T>A	2.37:g.63283301T>A		Somatic	0	41	0.00		0.7132304552168561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	33	46.77	A6NHA2|B3KTJ4|Q53TG6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Otx_TF_C,pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_Otx1_TF,prints_Otx_TF	p.G305	ENST00000282549.2	37	c.915	CCDS1873.1	2																																																																																			-	NULL		0.627	OTX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OTX1	protein_coding	OTTHUMT00000251617.1	T		-		63283301	+1	no_errors	ENST00000282549	ensembl	human	known	74_37	silent	SNP	0.997	A
PRKAR1B	5575	genome.wustl.edu	37	7	647042	647042	+	Missense_Mutation	SNP	G	G	T			TCGA-WK-A8XQ-01A-11D-A37C-09	TCGA-WK-A8XQ-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a362ed3c-3c06-4aad-8b9e-a4b46b4cbcd3	779e9645-be20-45ce-842e-6224726c5e5a	g.chr7:647042G>T	ENST00000406797.1	-	5	662	c.488C>A	c.(487-489)aCt>aAt	p.T163N	PRKAR1B_ENST00000544935.1_Missense_Mutation_p.T163N|PRKAR1B_ENST00000537384.1_Missense_Mutation_p.T163N|PRKAR1B_ENST00000403562.1_Missense_Mutation_p.T163N|AC147651.4_ENST00000429872.1_RNA|PRKAR1B_ENST00000360274.4_Missense_Mutation_p.T163N	NM_001164761.1	NP_001158233.1	P31321	KAP1_HUMAN	protein kinase, cAMP-dependent, regulatory, type I, beta	163					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|blood coagulation (GO:0007596)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|negative regulation of cAMP-dependent protein kinase activity (GO:2000480)|neurotrophin TRK receptor signaling pathway (GO:0048011)|protein phosphorylation (GO:0006468)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cAMP-dependent protein kinase complex (GO:0005952)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|cAMP-dependent protein kinase inhibitor activity (GO:0004862)|cAMP-dependent protein kinase regulator activity (GO:0008603)|protein kinase A catalytic subunit binding (GO:0034236)			endometrium(4)|large_intestine(1)|liver(1)|lung(10)|prostate(1)	17		Ovarian(82;0.0779)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|Epithelial(4;5.75e-19)|OV - Ovarian serous cystadenocarcinoma(56;2.01e-18)|all cancers(6;3.96e-16)|BRCA - Breast invasive adenocarcinoma(126;0.152)		CTGTATAACAGTCTCCCCAGC	0.473																																																	0								ENSG00000188191						125.0	105.0	112.0					7																	647042		2203	4296	6499	PRKAR1B	SO:0001583	missense	0			-	HGNC	M65066	CCDS34579.1	7p22.3	2013-09-19			ENSG00000188191	ENSG00000188191	2.7.11.1		9390	protein-coding gene	gene with protein product		176911				1358799, 3479018	Standard	NM_002735		Approved		uc003siw.2	P31321	OTTHUMG00000151411	ENST00000406797.1:c.488C>A	7.37:g.647042G>T	ENSP00000385749:p.Thr163Asn	Somatic	0	27	0.00		0.7132304552168561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	32	11.11	Q8N422	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_cNMP-bd_dom,pfam_cAMP_dep_PK_reg_su_I/II_a/b,superfamily_cNMP-bd-like,superfamily_cAMP_dep_PK_reg_su_I/II_a/b,smart_cAMP_dep_PK_reg_su_I/II_a/b,smart_cNMP-bd_dom,pirsf_cAMP_dep_PK_reg_su,pfscan_cNMP-bd_dom,prints_cAMP/cGMP_kin	p.T163N	ENST00000406797.1	37	c.488	CCDS34579.1	7	.	.	.	.	.	.	.	.	.	.	G	8.648	0.897666	0.17686	.	.	ENSG00000188191	ENST00000537384;ENST00000544935;ENST00000406797;ENST00000403562;ENST00000360274;ENST00000430040;ENST00000414568;ENST00000417852	D;D;D;D;D;D;D;D	0.93547	-3.24;-3.24;-3.24;-3.24;-3.24;-3.24;-3.24;-1.94	3.66	2.77	0.32553	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (3);	0.115116	0.64402	U	0.000019	D	0.85915	0.5808	N	0.25245	0.725	0.58432	D	0.999994	B	0.02656	0.0	B	0.04013	0.001	T	0.78135	-0.2322	10	0.23302	T	0.38	-27.1612	10.4063	0.44258	0.1008:0.0:0.8992:0.0	.	163	P31321	KAP1_HUMAN	N	163;163;163;163;163;163;108;163	ENSP00000440449:T163N;ENSP00000444487:T163N;ENSP00000385749:T163N;ENSP00000385349:T163N;ENSP00000353415:T163N;ENSP00000402648:T163N;ENSP00000394633:T108N;ENSP00000406670:T163N	ENSP00000353415:T163N	T	-	2	0	PRKAR1B	613568	1.000000	0.71417	0.717000	0.30585	0.634000	0.38068	3.526000	0.53509	0.868000	0.35678	0.478000	0.44815	ACT	-	pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pirsf_cAMP_dep_PK_reg_su,pfscan_cNMP-bd_dom,prints_cAMP/cGMP_kin		0.473	PRKAR1B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PRKAR1B	protein_coding	OTTHUMT00000322525.1	G		-		647042	-1	no_errors	ENST00000360274	ensembl	human	known	74_37	missense	SNP	0.919	T
DGKI	9162	genome.wustl.edu	37	7	137257551	137257551	+	Nonsense_Mutation	SNP	C	C	A			TCGA-WK-A8XQ-01A-11D-A37C-09	TCGA-WK-A8XQ-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a362ed3c-3c06-4aad-8b9e-a4b46b4cbcd3	779e9645-be20-45ce-842e-6224726c5e5a	g.chr7:137257551C>A	ENST00000288490.5	-	18	1795	c.1795G>T	c.(1795-1797)Gaa>Taa	p.E599*	DGKI_ENST00000424189.2_Nonsense_Mutation_p.E599*|DGKI_ENST00000453654.2_Nonsense_Mutation_p.E299*|DGKI_ENST00000446122.1_Nonsense_Mutation_p.E599*	NM_004717.2	NP_004708.1	O75912	DGKI_HUMAN	diacylglycerol kinase, iota	599					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|positive regulation of Ras protein signal transduction (GO:0046579)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of Rap GTPase activity (GO:0032317)	cytoplasm (GO:0005737)|guanyl-nucleotide exchange factor complex (GO:0032045)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|GTPase inhibitor activity (GO:0005095)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(46)|ovary(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	84						AACTTCAGTTCCTGAATCTTT	0.373																																																	0								ENSG00000157680						110.0	114.0	113.0					7																	137257551		2203	4300	6503	DGKI	SO:0001587	stop_gained	0			-	HGNC	AF061936	CCDS5845.1	7q32.3-q33	2013-01-10			ENSG00000157680	ENSG00000157680		"""Ankyrin repeat domain containing"""	2855	protein-coding gene	gene with protein product		604072				9830018	Standard	NM_004717		Approved	DGK-IOTA	uc003vtt.3	O75912	OTTHUMG00000155697	ENST00000288490.5:c.1795G>T	7.37:g.137257551C>A	ENSP00000288490:p.Glu599*	Somatic	0	28	0.00		0.7132304552168561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	21	12.50	A4D1Q9|Q9NZ49	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Diacylglycerol_kin_accessory,pfam_Diacylglycerol_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kin_accessory,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.E599*	ENST00000288490.5	37	c.1795	CCDS5845.1	7	.	.	.	.	.	.	.	.	.	.	C	43	9.959362	0.99304	.	.	ENSG00000157680	ENST00000453654;ENST00000540376;ENST00000424189;ENST00000288490;ENST00000446122	.	.	.	5.45	5.45	0.79879	.	0.049193	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.40728	T	0.16	.	18.8994	0.92435	0.0:1.0:0.0:0.0	.	.	.	.	X	299;547;599;599;599	.	ENSP00000288490:E599X	E	-	1	0	DGKI	136908091	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.426000	0.80270	2.567000	0.86603	0.563000	0.77884	GAA	-	pfam_Diacylglycerol_kin_accessory,smart_Diacylglycerol_kin_accessory		0.373	DGKI-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DGKI	protein_coding	OTTHUMT00000341286.3	C	NM_004717	-		137257551	-1	no_errors	ENST00000288490	ensembl	human	known	74_37	nonsense	SNP	1.000	A
CPEB1	64506	genome.wustl.edu	37	15	83297194	83297194	+	5'UTR	SNP	G	G	C			TCGA-WK-A8XQ-01A-11D-A37C-09	TCGA-WK-A8XQ-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a362ed3c-3c06-4aad-8b9e-a4b46b4cbcd3	779e9645-be20-45ce-842e-6224726c5e5a	g.chr15:83297194G>C	ENST00000562019.1	-	0	26				CPEB1_ENST00000450751.2_Intron|CPEB1_ENST00000568128.1_Intron|CPEB1_ENST00000568757.1_Intron|CPEB1_ENST00000563800.1_Missense_Mutation_p.A6G			Q9BZB8	CPEB1_HUMAN	cytoplasmic polyadenylation element binding protein 1						cellular response to amino acid stimulus (GO:0071230)|cellular response to hypoxia (GO:0071456)|cellular response to insulin stimulus (GO:0032869)|mRNA processing (GO:0006397)|negative regulation of cytoplasmic translation (GO:2000766)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|ribonucleoprotein complex (GO:0030529)	metal ion binding (GO:0046872)|mRNA 3'-UTR AU-rich region binding (GO:0035925)|nucleotide binding (GO:0000166)|translation repressor activity, nucleic acid binding (GO:0000900)			breast(5)|endometrium(1)|kidney(4)|large_intestine(6)|liver(1)|lung(9)|ovary(1)|skin(1)	28			BRCA - Breast invasive adenocarcinoma(143;0.229)			tgttgaagtagcaatgccaga	0.398																																																	0								ENSG00000214575																																			CPEB1	SO:0001623	5_prime_UTR_variant	0			-	HGNC	AF329402	CCDS42072.1, CCDS45329.1, CCDS45330.1, CCDS42072.2, CCDS45329.2, CCDS45330.2	15q25.1	2008-02-05				ENSG00000214575			21744	protein-coding gene	gene with protein product		607342				11223249	Standard	NM_001079533		Approved	FLJ13203, CPEB	uc002biv.3	Q9BZB8		ENST00000562019.1:c.-291C>G	15.37:g.83297194G>C		Somatic	0	13	0.00		0.7132304552168561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	7	69.57	B7Z6C6|Q86W46|Q8IV41|Q9BZB7|Q9H8V5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfscan_RRM_dom	p.A6G	ENST00000562019.1	37	c.17		15																																																																																			-	NULL		0.398	CPEB1-006	KNOWN	basic|appris_candidate_longest	protein_coding	CPEB1	protein_coding	OTTHUMT00000421102.1	G	NM_030594	-		83297194	-1	no_errors	ENST00000563800	ensembl	human	putative	74_37	missense	SNP	0.118	C
DIS3L2	129563	genome.wustl.edu	37	2	232995570	232995570	+	3'UTR	DEL	A	A	-			TCGA-WK-A8XQ-01A-11D-A37C-09	TCGA-WK-A8XQ-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a362ed3c-3c06-4aad-8b9e-a4b46b4cbcd3	779e9645-be20-45ce-842e-6224726c5e5a	g.chr2:232995570delA	ENST00000409401.3	+	0	1018				DIS3L2_ENST00000360410.4_Intron|DIS3L2_ENST00000325385.7_Intron|DIS3L2_ENST00000470087.1_3'UTR|DIS3L2_ENST00000409307.1_Intron|DIS3L2_ENST00000273009.6_Intron	NM_001257282.1	NP_001244211.1			DIS3 like 3'-5' exoribonuclease 2											breast(2)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(18)|ovary(1)|prostate(2)|urinary_tract(1)	40		all_hematologic(139;0.00809)|Renal(207;0.0113)|Acute lymphoblastic leukemia(138;0.0195)|all_lung(227;0.0465)|Lung NSC(271;0.136)		Epithelial(121;1.6e-13)|BRCA - Breast invasive adenocarcinoma(100;0.00104)|LUSC - Lung squamous cell carcinoma(224;0.0109)|Lung(119;0.0149)		aaagtgaattaaaaaaaaaaa	0.353																																																	0								ENSG00000144535																																			DIS3L2	SO:0001624	3_prime_UTR_variant	0				HGNC	BC026166	CCDS42834.1, CCDS58752.1, CCDS58753.1	2q37.1	2014-09-17	2014-03-05		ENSG00000144535	ENSG00000144535			28648	protein-coding gene	gene with protein product		614184	"""family with sequence similarity 6, member A"", ""DIS3 mitotic control homolog (S. cerevisiae)-like 2"""	FAM6A		22306653, 23503588	Standard	NM_152383		Approved	FLJ36974, MGC42174	uc010fxz.3	Q8IYB7	OTTHUMG00000153385	ENST00000409401.3:c.*93A>-	2.37:g.232995570delA		Somatic	0	14	0.00		0.7132304552168561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	23	8.00		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000409401.3	37	NULL	CCDS58753.1	2																																																																																			-	-		0.353	DIS3L2-003	KNOWN	basic|CCDS	protein_coding	DIS3L2	protein_coding	OTTHUMT00000330976.1	A	NM_152383			232995570	+1	no_errors	ENST00000470087	ensembl	human	known	74_37	rna	DEL	0.000	-
ZNF589	51385	genome.wustl.edu	37	3	48309726	48309726	+	Missense_Mutation	SNP	A	A	G			TCGA-WK-A8XQ-01A-11D-A37C-09	TCGA-WK-A8XQ-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a362ed3c-3c06-4aad-8b9e-a4b46b4cbcd3	779e9645-be20-45ce-842e-6224726c5e5a	g.chr3:48309726A>G	ENST00000354698.3	+	4	617	c.545A>G	c.(544-546)aAc>aGc	p.N182S	ZNF589_ENST00000412564.1_Intron|ZNF589_ENST00000440261.2_Intron|ZNF589_ENST00000427617.2_Intron	NM_016089.2	NP_057173.2	Q86UQ0	ZN589_HUMAN	zinc finger protein 589	182					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(1)|lung(1)|ovary(1)|skin(1)	4				BRCA - Breast invasive adenocarcinoma(193;0.000649)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		TGGGGAGGCAACAGAATATTA	0.502																																					Colon(9;319 328 25374 27611 50948)												0								ENSG00000164048						51.0	55.0	54.0					3																	48309726		1873	4120	5993	ZNF589	SO:0001583	missense	0			-	HGNC	AF114816	CCDS43085.1	3p21	2013-01-08			ENSG00000164048	ENSG00000164048		"""Zinc fingers, C2H2-type"", ""-"""	16747	protein-coding gene	gene with protein product						10029171	Standard	NM_016089		Approved	SZF1	uc003csl.4	Q86UQ0	OTTHUMG00000156833	ENST00000354698.3:c.545A>G	3.37:g.48309726A>G	ENSP00000346729:p.Asn182Ser	Somatic	0	21	0.00		0.7132304552168561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	20	42.86	Q86UC9|Q9BRI6|Q9BRY3|Q9Y611|Q9Y612	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Krueppel-associated_box,pfam_Znf_C2H2,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.N182S	ENST00000354698.3	37	c.545	CCDS43085.1	3	.	.	.	.	.	.	.	.	.	.	A	6.947	0.544587	0.13312	.	.	ENSG00000164048	ENST00000354698;ENST00000296437	T	0.05996	3.36	1.32	-1.25	0.09405	.	.	.	.	.	T	0.04815	0.0130	L	0.38175	1.15	0.09310	N	0.999999	B;B	0.23854	0.092;0.055	B;B	0.11329	0.006;0.003	T	0.38200	-0.9672	9	0.42905	T	0.14	.	5.1691	0.15101	0.6428:0.0:0.3572:0.0	.	179;182	Q86UQ0-2;Q86UQ0	.;ZN589_HUMAN	S	182;179	ENSP00000346729:N182S	ENSP00000296437:N179S	N	+	2	0	ZNF589	48284730	.	.	0.002000	0.10522	0.544000	0.35116	.	.	-0.384000	0.07845	0.383000	0.25322	AAC	-	NULL		0.502	ZNF589-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF589	protein_coding	OTTHUMT00000346124.1	A	NM_016089	-		48309726	+1	no_errors	ENST00000354698	ensembl	human	known	74_37	missense	SNP	0.048	G
UGT2B11	10720	genome.wustl.edu	37	4	70079967	70079967	+	Missense_Mutation	SNP	C	C	A			TCGA-WK-A8XQ-01A-11D-A37C-09	TCGA-WK-A8XQ-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a362ed3c-3c06-4aad-8b9e-a4b46b4cbcd3	779e9645-be20-45ce-842e-6224726c5e5a	g.chr4:70079967C>A	ENST00000446444.1	-	1	482	c.474G>T	c.(472-474)gaG>gaT	p.E158D	RP11-704M14.1_ENST00000505646.1_RNA|RP11-704M14.1_ENST00000504301.1_RNA	NM_001073.1	NP_001064.1	O75310	UDB11_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B11	158					estrogen metabolic process (GO:0008210)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(18)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	42						CAGCCAGCAGCTCACCACAGG	0.413																																																	0								ENSG00000213759						132.0	128.0	130.0					4																	70079967		2203	4298	6501	UGT2B11	SO:0001583	missense	0			-	HGNC	AF016492	CCDS3527.1	4q13.3	2008-02-05	2005-07-20		ENSG00000213759	ENSG00000213759		"""UDP glucuronosyltransferases"""	12545	protein-coding gene	gene with protein product		603064	"""UDP glycosyltransferase 2 family, polypeptide B11"""			9675083	Standard	NM_001073		Approved		uc003heh.3	O75310	OTTHUMG00000129395	ENST00000446444.1:c.474G>T	4.37:g.70079967C>A	ENSP00000387683:p.Glu158Asp	Somatic	0	94	0.00		0.7132304552168561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	59	72	45.04	Q3KNV9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	p.E158D	ENST00000446444.1	37	c.474	CCDS3527.1	4	.	.	.	.	.	.	.	.	.	.	-	0.568	-0.842466	0.02671	.	.	ENSG00000213759	ENST00000446444	T	0.60920	0.15	1.96	1.96	0.26148	.	0.081913	0.47852	U	0.000201	T	0.42381	0.1200	L	0.38692	1.165	0.20638	N	0.999873	B	0.16802	0.019	B	0.20384	0.029	T	0.21895	-1.0232	10	0.20519	T	0.43	.	9.5515	0.39313	0.0:1.0:0.0:0.0	.	158	O75310	UDB11_HUMAN	D	158	ENSP00000387683:E158D	ENSP00000387683:E158D	E	-	3	2	UGT2B11	70114556	0.211000	0.23529	0.976000	0.42696	0.037000	0.13140	-0.666000	0.05280	1.087000	0.41251	0.184000	0.17185	GAG	-	pfam_UDP_glucos_trans		0.413	UGT2B11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGT2B11	protein_coding	OTTHUMT00000251551.2	C	NM_001073	-		70079967	-1	no_errors	ENST00000446444	ensembl	human	known	74_37	missense	SNP	1.000	A
DNAJC9	23234	genome.wustl.edu	37	10	75008170	75008170	+	5'UTR	SNP	G	G	T			TCGA-WK-A8XQ-01A-11D-A37C-09	TCGA-WK-A8XQ-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a362ed3c-3c06-4aad-8b9e-a4b46b4cbcd3	779e9645-be20-45ce-842e-6224726c5e5a	g.chr10:75008170G>T	ENST00000372950.4	-	0	450				DNAJC9-AS1_ENST00000513954.1_RNA|MRPS16_ENST00000416782.2_Intron|MRPS16_ENST00000479005.1_5'Flank|DNAJC9-AS1_ENST00000440197.2_RNA	NM_015190.3	NP_056005.1	Q8WXX5	DNJC9_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 9						social behavior (GO:0035176)	nucleus (GO:0005634)				endometrium(2)|kidney(1)|large_intestine(2)|stomach(1)	6	Prostate(51;0.0119)					CACAGAATTTGAGATGGCTGG	0.453																																																	0								ENSG00000236756																																			DNAJC9-AS1	SO:0001623	5_prime_UTR_variant	0			-	HGNC	AF327347	CCDS7322.1	10q22.3	2011-09-02			ENSG00000213551	ENSG00000213551		"""Heat shock proteins / DNAJ (HSP40)"""	19123	protein-coding gene	gene with protein product		611206					Standard	NM_015190		Approved	JDD1, SB73	uc001jtr.3	Q8WXX5	OTTHUMG00000018461	ENST00000372950.4:c.-1223C>A	10.37:g.75008170G>T		Somatic	0	35	0.00		0.7132304552168561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52	B2RMW6	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000372950.4	37	NULL	CCDS7322.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	9.589|9.589	1.125638|1.125638	0.20959|0.20959	.|.	.|.	ENSG00000236756|ENSG00000236756	ENST00000440197|ENST00000513954	.|.	.|.	.|.	3.13|3.13	-0.105|-0.105	0.13601|0.13601	.|.	.|.	.|.	.|.	.|.	.|T	.|0.29945	.|0.0749	.|.	.|.	.|.	0.44652|0.44652	A|A	0.997633|0.997633	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.35500	.|-0.9786	.|3	0.87932|.	D|.	0|.	.|.	4.6202|4.6202	0.12445|0.12445	0.241:0.0:0.5892:0.1698|0.241:0.0:0.5892:0.1698	.|.	.|.	.|.	.|.	X|F	106|10	.|.	ENSP00000394678:E106X|.	E|L	+|+	1|3	0|2	C10orf103|C10orf103	74678176|74678176	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.002000|0.002000	0.02628|0.02628	-0.316000|-0.316000	0.08071|0.08071	-0.255000|-0.255000	0.09486|0.09486	-1.134000|-1.134000	0.01955|0.01955	GAG|TTG	-	-		0.453	DNAJC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC9-AS1	protein_coding	OTTHUMT00000048643.1	G	NM_015190	-		75008170	+1	no_errors	ENST00000440197	ensembl	human	known	74_37	rna	SNP	0.000	T
CHD9	80205	genome.wustl.edu	37	16	53302010	53302010	+	Silent	SNP	A	A	G			TCGA-WK-A8XQ-01A-11D-A37C-09	TCGA-WK-A8XQ-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a362ed3c-3c06-4aad-8b9e-a4b46b4cbcd3	779e9645-be20-45ce-842e-6224726c5e5a	g.chr16:53302010A>G	ENST00000398510.3	+	21	4776	c.4689A>G	c.(4687-4689)ggA>ggG	p.G1563G	CHD9_ENST00000564845.1_Silent_p.G1563G|CHD9_ENST00000447540.1_Silent_p.G1563G|CHD9_ENST00000566029.1_Silent_p.G1563G			Q3L8U1	CHD9_HUMAN	chromodomain helicase DNA binding protein 9	1563					cellular lipid metabolic process (GO:0044255)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(21)|lung(32)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	78		all_cancers(37;0.0212)				CTGAAGATGGACAGACACGAG	0.338																																																	0								ENSG00000177200						80.0	73.0	75.0					16																	53302010		1859	4097	5956	CHD9	SO:0001819	synonymous_variant	0			-	HGNC	AK022240	CCDS45485.1	16q12.2	2006-04-12				ENSG00000177200			25701	protein-coding gene	gene with protein product						9205841	Standard	XM_005256168		Approved	FLJ12178, KIAA0308, BC022889	uc002egy.3	Q3L8U1		ENST00000398510.3:c.4689A>G	16.37:g.53302010A>G		Somatic	0	20	0.00		0.7132304552168561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	8	61.90	B2RTU2|B9ZVQ0|O15025|Q1WF12|Q6DTK9|Q9H9V7|Q9UHM2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_SNF2_N,pfam_BRK_domain,pfam_Chromo_domain,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,smart_BRK_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.G1563	ENST00000398510.3	37	c.4689		16																																																																																			-	NULL		0.338	CHD9-020	KNOWN	basic	protein_coding	CHD9	protein_coding	OTTHUMT00000422345.1	A	NM_025134	-		53302010	+1	no_errors	ENST00000398510	ensembl	human	known	74_37	silent	SNP	0.922	G
VWF	7450	genome.wustl.edu	37	12	6184682	6184682	+	Silent	SNP	G	G	A	rs527344390	byFrequency	TCGA-WK-A8XQ-01A-11D-A37C-09	TCGA-WK-A8XQ-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a362ed3c-3c06-4aad-8b9e-a4b46b4cbcd3	779e9645-be20-45ce-842e-6224726c5e5a	g.chr12:6184682G>A	ENST00000261405.5	-	7	947	c.693C>T	c.(691-693)acC>acT	p.T231T		NM_000552.3	NP_000543	P04275	VWF_HUMAN	von Willebrand factor	231	VWFD 1. {ECO:0000255|PROSITE- ProRule:PRU00580}.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|extracellular matrix organization (GO:0030198)|hemostasis (GO:0007599)|liver development (GO:0001889)|placenta development (GO:0001890)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein homooligomerization (GO:0051260)|response to wounding (GO:0009611)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)|Weibel-Palade body (GO:0033093)	chaperone binding (GO:0051087)|collagen binding (GO:0005518)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|immunoglobulin binding (GO:0019865)|integrin binding (GO:0005178)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)	p.T231T(1)		NS(1)|breast(6)|central_nervous_system(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(41)|ovary(7)|pancreas(2)|prostate(6)|skin(15)|stomach(1)|upper_aerodigestive_tract(5)	129					Antihemophilic Factor(DB00025)	CAAACACCGAGGTGCTCTTCA	0.627																																																	1	Substitution - coding silent(1)	lung(1)						ENSG00000110799						43.0	42.0	42.0					12																	6184682		2203	4299	6502	VWF	SO:0001819	synonymous_variant	0			-	HGNC		CCDS8539.1	12p13.3	2014-09-17			ENSG00000110799	ENSG00000110799		"""Endogenous ligands"""	12726	protein-coding gene	gene with protein product		613160		F8VWF		2251280	Standard	NM_000552		Approved		uc001qnn.1	P04275	OTTHUMG00000168265	ENST00000261405.5:c.693C>T	12.37:g.6184682G>A		Somatic	0	62	0.00		0.7132304552168561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	32	41	43.84	Q8TCE8|Q99806	Silent	SNP	NA	NA	NA	NA	NA	NA	pirsf_VWF,pfam_VWF_type-D,pfam_VWF_A,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_VWF_C,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_VWF_A,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_A,pfscan_VWF_C	p.T231	ENST00000261405.5	37	c.693	CCDS8539.1	12																																																																																			-	pirsf_VWF,pfam_Unchr_dom_Cys-rich,smart_Unchr_dom_Cys-rich		0.627	VWF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	VWF	protein_coding	OTTHUMT00000399020.1	G	NM_000552	-		6184682	-1	no_errors	ENST00000261405	ensembl	human	known	74_37	silent	SNP	0.136	A
MACF1	23499	genome.wustl.edu	37	1	39835666	39835717	+	Splice_Site	DEL	TTAGTCTGGCAAGTAACAAAACTGCTTCATTGACAGAGAGAAAGATGCATCA	TTAGTCTGGCAAGTAACAAAACTGCTTCATTGACAGAGAGAAAGATGCATCA	-	rs201988306|rs145935087|rs201455314|rs193920778		TCGA-WK-A8XQ-01A-11D-A37C-09	TCGA-WK-A8XQ-10A-01D-A37F-09	TTAGTCTGGCAAGTAACAAAACTGCTTCATTGACAGAGAGAAAGATGCATCA	TTAGTCTGGCAAGTAACAAAACTGCTTCATTGACAGAGAGAAAGATGCATCA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a362ed3c-3c06-4aad-8b9e-a4b46b4cbcd3	779e9645-be20-45ce-842e-6224726c5e5a	g.chr1:39835666_39835717delTTAGTCTGGCAAGTAACAAAACTGCTTCATTGACAGAGAGAAAGATGCATCA	ENST00000372915.3	+	50	13040_13056	c.12953_12969delTTAGTCTGGCAAGTAACAAAACTGCTTCATTGACAGAGAGAAAGATGCATCA	c.(12952-12969)attagtctggcaagtaac>a	p.ISLASN4318fs	MACF1_ENST00000317713.7_Splice_Site_p.ISLASN2251fs|MACF1_ENST00000564288.1_Splice_Site_p.ISLASN4313fs|MACF1_ENST00000476350.1_3'UTR|MACF1_ENST00000539005.1_Splice_Site_p.ISLASN2251fs|MACF1_ENST00000545844.1_Splice_Site_p.ISLASN2251fs|MACF1_ENST00000361689.2_Splice_Site_p.ISLASN2251fs|MACF1_ENST00000289893.4_Splice_Site_p.ISLASN2753fs|MACF1_ENST00000567887.1_Splice_Site_p.ISLASN4350fs			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	4318					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			TTTATAAAACTTAGTCTGGCAAGTAACAAAACTGCTTCATTGACAGAGAGAAAGATGCATCATCTTGCCAGG	0.409																																																	0								ENSG00000127603																																			MACF1	SO:0001630	splice_region_variant	0				HGNC	AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.12954-1TTAGTCTGGCAAGTAACAAAACTGCTTCATTGACAGAGAGAAAGATGCATCA>-	1.37:g.39835666_39835717delTTAGTCTGGCAAGTAACAAAACTGCTTCATTGACAGAGAGAAAGATGCATCA		Somatic	NA	NA	NA		0.7132304552168561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Spectrin_repeat,pfam_CH-domain,pfam_GAS2_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_GAS2_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_EF_hand_dom,smart_GAS2_dom,pfscan_CH-domain,pfscan_EF_hand_dom	p.R2274fs	ENST00000372915.3	37	c.6789_6768		1																																																																																			-	smart_Spectrin/alpha-actinin		0.409	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	MACF1	protein_coding	OTTHUMT00000392096.1	TTAGTCTGGCAAGTAACAAAACTGCTTCATTGACAGAGAGAAAGATGCATCA	NM_033044		Frame_Shift_Del	39835717	+1	no_errors	ENST00000317713	ensembl	human	known	74_37	frame_shift_del	DEL	0.055:0.031:0.000:0.000:0.013:0.023:0.020:0.004:0.004:0.005:0.013:0.021:0.028:0.810:0.820:0.813:0.686:0.438:0.151:0.046:0.011:0.000:0.002:0.082:0.260:0.176:0.100:0.003:0.002:0.113:0.958:0.968:0.980:0.997:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:0.999:1.000:1.000:0.983:0.998:0.998:0.986	-
HERC2P3	283755	genome.wustl.edu	37	15	20657785	20657785	+	RNA	SNP	A	A	T			TCGA-WK-A8XQ-01A-11D-A37C-09	TCGA-WK-A8XQ-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a362ed3c-3c06-4aad-8b9e-a4b46b4cbcd3	779e9645-be20-45ce-842e-6224726c5e5a	g.chr15:20657785A>T	ENST00000428453.1	-	0	2173							Q9BVR0	HRC23_HUMAN	hect domain and RLD 2 pseudogene 3								metal ion binding (GO:0046872)|ubiquitin-protein transferase activity (GO:0004842)			central_nervous_system(1)|endometrium(11)|kidney(2)|large_intestine(1)|lung(14)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	35						CTCATTGGTGATGGTTTGCAG	0.537																																																	0								ENSG00000180229						103.0	92.0	96.0					15																	20657785		2175	4237	6412	HERC2P3			0			-	HGNC	AF041081		15q11.2	2010-08-02			ENSG00000180229	ENSG00000180229			4871	pseudogene	pseudogene						9730612	Standard	NR_036432		Approved	D15F37S4, LOC283755	uc001ytg.3	Q9BVR0	OTTHUMG00000157175		15.37:g.20657785A>T		Somatic	1	263	0.38		0.7132304552168561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	109	236	31.59		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000428453.1	37	NULL		15																																																																																			-	-		0.537	HERC2P3-014	KNOWN	basic	processed_transcript	HERC2P3	pseudogene	OTTHUMT00000347772.2	A	NG_008269	-		20657785	-1	no_errors	ENST00000426501	ensembl	human	known	74_37	rna	SNP	1.000	T
YWHAG	7532	genome.wustl.edu	37	7	75958930	75958930	+	Silent	SNP	G	G	A			TCGA-WK-A8XQ-01A-11D-A37C-09	TCGA-WK-A8XQ-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a362ed3c-3c06-4aad-8b9e-a4b46b4cbcd3	779e9645-be20-45ce-842e-6224726c5e5a	g.chr7:75958930G>A	ENST00000307630.3	-	2	930	c.708C>T	c.(706-708)gaC>gaT	p.D236D		NM_012479.3	NP_036611.2	P61981	1433G_HUMAN	tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma	236					apoptotic process (GO:0006915)|cellular response to insulin stimulus (GO:0032869)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway (GO:0097193)|membrane organization (GO:0061024)|mitotic cell cycle (GO:0000278)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|protein targeting (GO:0006605)|regulation of neuron differentiation (GO:0045664)|regulation of signal transduction (GO:0009966)|regulation of synaptic plasticity (GO:0048167)	cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)	insulin-like growth factor receptor binding (GO:0005159)|poly(A) RNA binding (GO:0044822)|protein kinase C binding (GO:0005080)|protein kinase C inhibitor activity (GO:0008426)			endometrium(2)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)	8						CGTCCTGCTGGTCGCTCGTCC	0.582																																																	0								ENSG00000170027						71.0	56.0	61.0					7																	75958930		2203	4300	6503	YWHAG	SO:0001819	synonymous_variant	0			-	HGNC	AF142498	CCDS5584.1	7q11.23	2014-06-13	2013-12-03		ENSG00000170027	ENSG00000170027			12852	protein-coding gene	gene with protein product	"""14-3-3 gamma"", ""protein phosphatase 1, regulatory subunit 170"""	605356	"""tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma polypeptide"""			10486217, 10433554	Standard	NM_012479		Approved	PPP1R170	uc011kgj.1	P61981	OTTHUMG00000022862	ENST00000307630.3:c.708C>T	7.37:g.75958930G>A		Somatic	0	29	0.00		0.7132304552168561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	24	52.00	O70457|P35214|Q6FH52|Q9UDP2|Q9UN99	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_14-3-3_domain,superfamily_14-3-3_domain,smart_14-3-3_domain,pirsf_14-3-3,prints_14-3-3	p.D236	ENST00000307630.3	37	c.708	CCDS5584.1	7																																																																																			-	pfam_14-3-3_domain,superfamily_14-3-3_domain,smart_14-3-3_domain,pirsf_14-3-3,prints_14-3-3		0.582	YWHAG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YWHAG	protein_coding	OTTHUMT00000253002.1	G	NM_012479	-		75958930	-1	no_errors	ENST00000307630	ensembl	human	known	74_37	silent	SNP	0.728	A
KRT27	342574	genome.wustl.edu	37	17	38935802	38935802	+	Silent	SNP	T	T	C			TCGA-WK-A8XQ-01A-11D-A37C-09	TCGA-WK-A8XQ-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a362ed3c-3c06-4aad-8b9e-a4b46b4cbcd3	779e9645-be20-45ce-842e-6224726c5e5a	g.chr17:38935802T>C	ENST00000301656.3	-	5	964	c.924A>G	c.(922-924)aaA>aaG	p.K308K	KRT27_ENST00000540723.1_5'Flank	NM_181537.3	NP_853515.2			keratin 27											NS(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(3)|skin(1)|stomach(1)	21		Breast(137;0.000812)				GAAGAGTGCGTTTCATCTCGA	0.493																																																	0								ENSG00000171446						71.0	64.0	66.0					17																	38935802		2203	4300	6503	KRT27	SO:0001819	synonymous_variant	0			-	HGNC	AJ564206	CCDS11375.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000171446	ENSG00000171446		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	30841	protein-coding gene	gene with protein product			"""keratin 25C"""	KRT25C		16831889	Standard	NM_181537		Approved		uc002hvg.3	Q7Z3Y8	OTTHUMG00000133371	ENST00000301656.3:c.924A>G	17.37:g.38935802T>C		Somatic	0	49	0.00		0.7132304552168561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	29	45.28		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_IF,superfamily_Prefoldin,prints_Keratin_I	p.K308	ENST00000301656.3	37	c.924	CCDS11375.1	17																																																																																			-	pfam_IF,superfamily_Prefoldin		0.493	KRT27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT27	protein_coding	OTTHUMT00000257216.1	T	NM_181537	-		38935802	-1	no_errors	ENST00000301656	ensembl	human	known	74_37	silent	SNP	0.999	C
HPCA	3208	genome.wustl.edu	37	1	33359548	33359548	+	3'UTR	SNP	G	G	A			TCGA-WK-A8XQ-01A-11D-A37C-09	TCGA-WK-A8XQ-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a362ed3c-3c06-4aad-8b9e-a4b46b4cbcd3	779e9645-be20-45ce-842e-6224726c5e5a	g.chr1:33359548G>A	ENST00000373467.3	+	0	769				TMEM54_ENST00000475208.1_5'Flank	NM_002143.2	NP_002134.2	P84074	HPCA_HUMAN	hippocalcin						inner ear development (GO:0048839)		actin binding (GO:0003779)|calcium ion binding (GO:0005509)			breast(1)|endometrium(1)|large_intestine(1)|lung(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	9		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)				ATTCTGGCTGGGGGCCAGATT	0.642																																																	0								ENSG00000121905																																			HPCA	SO:0001624	3_prime_UTR_variant	0			-	HGNC	BC001777	CCDS370.1	1p35-p34.2	2013-01-10			ENSG00000121905	ENSG00000121905		"""EF-hand domain containing"""	5144	protein-coding gene	gene with protein product		142622				8166736, 9931466	Standard	NM_002143		Approved		uc001bwh.3	P84074	OTTHUMG00000004017	ENST00000373467.3:c.*85G>A	1.37:g.33359548G>A		Somatic	0	19	0.00		0.7132304552168561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	10	56.52	B2R9T3|D3DPQ7|P32076|P41211|P70510	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000373467.3	37	NULL	CCDS370.1	1																																																																																			-	-		0.642	HPCA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HPCA	protein_coding	OTTHUMT00000011480.1	G	NM_002143	-		33359548	+1	no_errors	ENST00000459874	ensembl	human	known	74_37	rna	SNP	1.000	A
RHBDD2	57414	genome.wustl.edu	37	7	75512836	75512837	+	Intron	INS	-	-	A	rs143886218		TCGA-WK-A8XQ-01A-11D-A37C-09	TCGA-WK-A8XQ-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a362ed3c-3c06-4aad-8b9e-a4b46b4cbcd3	779e9645-be20-45ce-842e-6224726c5e5a	g.chr7:75512836_75512837insA	ENST00000006777.6	+	3	721				RHBDD2_ENST00000318622.4_Intron|RHBDD2_ENST00000468304.1_Intron|RHBDD2_ENST00000428119.1_Intron	NM_001040456.1	NP_001035546.1	Q6NTF9	RHBD2_HUMAN	rhomboid domain containing 2							Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	serine-type endopeptidase activity (GO:0004252)			kidney(1)|lung(4)|prostate(1)	6						gactccatctcaaaaaaaaaaa	0.535																																																	0								ENSG00000005486																																			RHBDD2	SO:0001627	intron_variant	0				HGNC	AF226732	CCDS43602.1, CCDS43603.1	7q11	2008-09-04	2006-02-22	2006-02-22	ENSG00000005486	ENSG00000005486			23082	protein-coding gene	gene with protein product		615203	"""rhomboid, veinlet-like 7 (Drosophila)"""	RHBDL7		12838346	Standard	XM_005250511		Approved	NPD007	uc003udw.1	Q6NTF9	OTTHUMG00000156435	ENST00000006777.6:c.587-179->A	7.37:g.75512847_75512847dupA		Somatic	0	11	0.00		0.7132304552168561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	17	15.00	Q7L534|Q9H5W6|Q9HBK7|Q9UDT2	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000006777.6	37	NULL	CCDS43602.1	7																																																																																			-	-		0.535	RHBDD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RHBDD2	protein_coding	OTTHUMT00000344176.1	-	NM_020684			75512837	+1	no_errors	ENST00000467406	ensembl	human	putative	74_37	rna	INS	0.001:0.010	A
DNAJC1	64215	genome.wustl.edu	37	10	22048139	22048139	+	Missense_Mutation	SNP	C	C	T			TCGA-WK-A8XQ-01A-11D-A37C-09	TCGA-WK-A8XQ-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a362ed3c-3c06-4aad-8b9e-a4b46b4cbcd3	779e9645-be20-45ce-842e-6224726c5e5a	g.chr10:22048139C>T	ENST00000376980.3	-	11	1846	c.1556G>A	c.(1555-1557)cGc>cAc	p.R519H	DNAJC1_ENST00000483085.1_5'Flank	NM_022365.3	NP_071760.2	Q96KC8	DNJC1_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 1	519	SANT 2. {ECO:0000255|PROSITE- ProRule:PRU00624}.				negative regulation of proteolysis (GO:0045861)|positive regulation of ATPase activity (GO:0032781)|protein folding (GO:0006457)|regulation of protein secretion (GO:0050708)|regulation of translation (GO:0006417)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ATPase activator activity (GO:0001671)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)			cervix(1)|endometrium(1)|large_intestine(2)|lung(13)|skin(2)|upper_aerodigestive_tract(2)	21		Breast(68;0.00869)|Prostate(175;0.0181)|Lung SC(717;0.0262)				TTTGTCCCAGCGGTCAGAGGA	0.542																																																	0								ENSG00000136770						129.0	130.0	130.0					10																	22048139		2203	4300	6503	DNAJC1	SO:0001583	missense	0			-	HGNC	AK026062	CCDS7136.1	10p11.23	2011-09-02			ENSG00000136770	ENSG00000136770		"""Heat shock proteins / DNAJ (HSP40)"""	20090	protein-coding gene	gene with protein product		611207					Standard	NM_022365		Approved	DNAJL1, ERdj1, MTJ1	uc001irc.3	Q96KC8	OTTHUMG00000017800	ENST00000376980.3:c.1556G>A	10.37:g.22048139C>T	ENSP00000366179:p.Arg519His	Somatic	0	37	0.00		0.7132304552168561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	20	42.86	B0YIZ8|Q5VX89|Q9H6B8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DnaJ_domain,pfam_SANT/Myb,superfamily_DnaJ_domain,superfamily_Homeodomain-like,smart_DnaJ_domain,smart_SANT/Myb,pfscan_Myb-like_dom,pfscan_DnaJ_domain,prints_DnaJ_domain	p.R519H	ENST00000376980.3	37	c.1556	CCDS7136.1	10	.	.	.	.	.	.	.	.	.	.	C	22.2	4.257777	0.80246	.	.	ENSG00000136770	ENST00000376980	T	0.44881	0.91	5.94	5.94	0.96194	Myb, DNA-binding (1);SANT domain, DNA binding (1);Homeodomain-related (1);Homeodomain-like (1);SANT, eukarya (1);	0.050907	0.85682	D	0.000000	T	0.78528	0.4297	H	0.97158	3.95	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.84896	0.0839	10	0.87932	D	0	-2.6786	20.3633	0.98874	0.0:1.0:0.0:0.0	.	240;519	Q96NY3;Q96KC8	.;DNJC1_HUMAN	H	519	ENSP00000366179:R519H	ENSP00000366179:R519H	R	-	2	0	DNAJC1	22088145	1.000000	0.71417	1.000000	0.80357	0.042000	0.13812	7.729000	0.84864	2.826000	0.97356	0.561000	0.74099	CGC	-	pfam_SANT/Myb,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom		0.542	DNAJC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC1	protein_coding	OTTHUMT00000047149.1	C	NM_022365	-		22048139	-1	no_errors	ENST00000376980	ensembl	human	known	74_37	missense	SNP	1.000	T
ADK	132	genome.wustl.edu	37	10	76154044	76154044	+	Missense_Mutation	SNP	G	G	T			TCGA-WK-A8XQ-01A-11D-A37C-09	TCGA-WK-A8XQ-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a362ed3c-3c06-4aad-8b9e-a4b46b4cbcd3	779e9645-be20-45ce-842e-6224726c5e5a	g.chr10:76154044G>T	ENST00000286621.2	+	5	469	c.419G>T	c.(418-420)tGt>tTt	p.C140F	ADK_ENST00000539909.1_Missense_Mutation_p.C140F|ADK_ENST00000541550.1_Missense_Mutation_p.C105F|ADK_ENST00000372734.3_Missense_Mutation_p.C123F	NM_006721.3	NP_006712.2	P55263	ADK_HUMAN	adenosine kinase	140					adenosine metabolic process (GO:0046085)|AMP salvage (GO:0044209)|circadian regulation of gene expression (GO:0032922)|dATP biosynthetic process (GO:0006175)|nucleobase-containing small molecule metabolic process (GO:0055086)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of T cell proliferation (GO:0042102)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|ribonucleoside monophosphate biosynthetic process (GO:0009156)|small molecule metabolic process (GO:0044281)|type B pancreatic cell proliferation (GO:0044342)	cytosol (GO:0005829)|nucleus (GO:0005634)	adenosine kinase activity (GO:0004001)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|phosphotransferase activity, alcohol group as acceptor (GO:0016773)|poly(A) RNA binding (GO:0044822)			breast(1)|large_intestine(2)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	8	Prostate(51;0.0112)|Ovarian(15;0.148)				Abacavir(DB01048)|Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)|Adenosine(DB00640)|Ribavirin(DB00811)	ACAGGAACTTGTGCTGCATGC	0.423																																																	0								ENSG00000156110						84.0	81.0	82.0					10																	76154044		2203	4300	6503	ADK	SO:0001583	missense	0			-	HGNC	U50196	CCDS7343.1, CCDS7344.1, CCDS55716.1, CCDS55717.1	10q22.2	2006-02-21			ENSG00000156110	ENSG00000156110	2.7.1.20		257	protein-coding gene	gene with protein product	"""adenosine 5'-phosphotransferase"""	102750				8577746	Standard	NM_001123		Approved	AK	uc001jwi.3	P55263	OTTHUMG00000018506	ENST00000286621.2:c.419G>T	10.37:g.76154044G>T	ENSP00000286621:p.Cys140Phe	Somatic	0	34	0.00		0.7132304552168561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	20	13.04	B7Z783|B7Z800|O00741|O00742|Q16710|Q5JQ10|Q5JQ11|Q9BTN2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PfkB_dom,prints_Adenokinase	p.C140F	ENST00000286621.2	37	c.419	CCDS7343.1	10	.	.	.	.	.	.	.	.	.	.	G	24.3	4.511667	0.85389	.	.	ENSG00000156110	ENST00000539909;ENST00000286621;ENST00000372734;ENST00000541550	T;T;T;T	0.78364	-1.17;-1.17;-1.17;-1.17	5.68	5.68	0.88126	Carbohydrate/purine kinase (1);	0.000000	0.85682	D	0.000000	D	0.92231	0.7536	H	0.95504	3.68	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.93948	0.7229	10	0.87932	D	0	-10.4479	19.7958	0.96481	0.0:0.0:1.0:0.0	.	105;140;123;140	B7Z800;B7Z783;Q5JQ10;P55263	.;.;.;ADK_HUMAN	F	140;140;123;105	ENSP00000443965:C140F;ENSP00000286621:C140F;ENSP00000361819:C123F;ENSP00000438321:C105F	ENSP00000286621:C140F	C	+	2	0	ADK	75824050	1.000000	0.71417	0.997000	0.53966	0.974000	0.67602	9.439000	0.97543	2.669000	0.90835	0.563000	0.77884	TGT	-	pfam_PfkB_dom,prints_Adenokinase		0.423	ADK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ADK	protein_coding	OTTHUMT00000048763.1	G	NM_001123, NM_006721	-		76154044	+1	no_errors	ENST00000286621	ensembl	human	known	74_37	missense	SNP	1.000	T
UNC13D	201294	genome.wustl.edu	37	17	73839249	73839249	+	Nonsense_Mutation	SNP	G	G	T			TCGA-WK-A8XQ-01A-11D-A37C-09	TCGA-WK-A8XQ-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a362ed3c-3c06-4aad-8b9e-a4b46b4cbcd3	779e9645-be20-45ce-842e-6224726c5e5a	g.chr17:73839249G>T	ENST00000207549.4	-	3	631	c.252C>A	c.(250-252)taC>taA	p.Y84*	UNC13D_ENST00000412096.2_Nonsense_Mutation_p.Y84*|UNC13D_ENST00000587504.1_5'UTR	NM_199242.2	NP_954712.1	Q70J99	UN13D_HUMAN	unc-13 homolog D (C. elegans)	84					defense response to virus (GO:0051607)|germinal center formation (GO:0002467)|granuloma formation (GO:0002432)|natural killer cell degranulation (GO:0043320)|phagocytosis (GO:0006909)|positive regulation of exocytosis (GO:0045921)|regulation of mast cell degranulation (GO:0043304)	endosome (GO:0005768)|exocytic vesicle (GO:0070382)|lysosome (GO:0005764)|membrane (GO:0016020)				central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(9)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29			all cancers(21;2.11e-06)|Epithelial(20;2.32e-06)|BRCA - Breast invasive adenocarcinoma(9;0.000618)|LUSC - Lung squamous cell carcinoma(166;0.154)			CCTCCTGCAGGTATCGCAGCA	0.682									Familial Hemophagocytic Lymphohistiocytosis																																								0								ENSG00000092929						46.0	47.0	47.0					17																	73839249		2203	4300	6503	UNC13D	SO:0001587	stop_gained	0	Familial Cancer Database	FHLH, FHL, Familial Hemophagocytic Reticulosis, FHR	-	HGNC	AK024474	CCDS11730.1	17q25.3	2014-09-17				ENSG00000092929			23147	protein-coding gene	gene with protein product		608897					Standard	NM_199242		Approved	Munc13-4	uc002jpp.3	Q70J99		ENST00000207549.4:c.252C>A	17.37:g.73839249G>T	ENSP00000207549:p.Tyr84*	Somatic	0	25	0.00		0.7132304552168561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	24	14.29	B4DWG9|Q9H7K5	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_C2_dom,pfam_Munc13_subgr_dom-2,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	p.Y84*	ENST00000207549.4	37	c.252	CCDS11730.1	17	.	.	.	.	.	.	.	.	.	.	G	35	5.420418	0.96111	.	.	ENSG00000092929	ENST00000207549;ENST00000412096;ENST00000448606	.	.	.	4.72	1.23	0.21249	.	0.000000	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.0154	4.925	0.13889	0.2788:0.1593:0.5619:0.0	.	.	.	.	X	84	.	ENSP00000207549:Y84X	Y	-	3	2	UNC13D	71350844	0.999000	0.42202	0.989000	0.46669	0.128000	0.20619	0.306000	0.19279	0.924000	0.37069	0.561000	0.74099	TAC	-	NULL		0.682	UNC13D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UNC13D	protein_coding	OTTHUMT00000448847.2	G	XM_113950	-		73839249	-1	no_errors	ENST00000412096	ensembl	human	known	74_37	nonsense	SNP	0.997	T
PPP3CB	5532	genome.wustl.edu	37	10	75239251	75239251	+	Missense_Mutation	SNP	C	C	T	rs149808527		TCGA-WK-A8XQ-01A-11D-A37C-09	TCGA-WK-A8XQ-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a362ed3c-3c06-4aad-8b9e-a4b46b4cbcd3	779e9645-be20-45ce-842e-6224726c5e5a	g.chr10:75239251C>T	ENST00000360663.5	-	2	221	c.110G>A	c.(109-111)cGc>cAc	p.R37H	PPP3CB_ENST00000342558.3_Missense_Mutation_p.R37H|PPP3CB_ENST00000394822.2_Missense_Mutation_p.R37H|PPP3CB_ENST00000394828.2_Missense_Mutation_p.R37H|PPP3CB_ENST00000545874.1_5'UTR|PPP3CB_ENST00000394829.2_Missense_Mutation_p.R37H			P16298	PP2BB_HUMAN	protein phosphatase 3, catalytic subunit, beta isozyme	37	Catalytic.				axon extension (GO:0048675)|calcium ion-dependent exocytosis (GO:0017156)|cellular response to drug (GO:0035690)|dephosphorylation (GO:0016311)|Fc-epsilon receptor signaling pathway (GO:0038095)|heart development (GO:0007507)|innate immune response (GO:0045087)|learning (GO:0007612)|locomotion involved in locomotory behavior (GO:0031987)|memory (GO:0007613)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of transcription, DNA-templated (GO:0045893)|protein dephosphorylation (GO:0006470)|protein phosphorylation (GO:0006468)|regulation of insulin secretion (GO:0050796)|regulation of synaptic plasticity (GO:0048167)|response to cytokine (GO:0034097)|signal transduction (GO:0007165)|social behavior (GO:0035176)|T cell activation (GO:0042110)|T cell differentiation (GO:0030217)|T cell homeostasis (GO:0043029)|T cell proliferation (GO:0042098)	calcineurin complex (GO:0005955)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|calmodulin-dependent protein phosphatase activity (GO:0033192)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|protein dimerization activity (GO:0046983)|protein phosphatase 2B binding (GO:0030346)|protein serine/threonine phosphatase activity (GO:0004722)			breast(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(7)|skin(1)|urinary_tract(1)	22	Prostate(51;0.0119)					AGATGTCAAGCGATGTGTTGG	0.363																																																	0								ENSG00000107758						81.0	78.0	79.0					10																	75239251		2203	4300	6503	PPP3CB	SO:0001583	missense	0			-	HGNC	M29551	CCDS7328.1, CCDS44436.1, CCDS44437.1	10q22.2	2010-03-17	2010-03-05		ENSG00000107758	ENSG00000107758	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"""	9315	protein-coding gene	gene with protein product	"""calcineurin A beta"", ""protein phosphatase 2B, catalytic subunit, beta isoform"""	114106	"""protein phosphatase 3 (formerly 2B), catalytic subunit, beta isoform (calcineurin A beta)"", ""protein phosphatase 3 (formerly 2B), catalytic subunit, beta isoform"""	CALNB		1659808, 2558868	Standard	XM_005269944		Approved	CALNA2, CNA2, PP2Bbeta	uc001juf.3	P16298	OTTHUMG00000018472	ENST00000360663.5:c.110G>A	10.37:g.75239251C>T	ENSP00000353881:p.Arg37His	Somatic	0	23	0.00		0.7132304552168561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	26	12.90	P16299|Q5F2F9|Q8N1F0|Q8N3W4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PEstase_dom,smart_Ser/Thr-sp_prot-phosphatase,prints_Ser/Thr-sp_prot-phosphatase	p.R37H	ENST00000360663.5	37	c.110	CCDS7328.1	10	.	.	.	.	.	.	.	.	.	.	C	15.82	2.944900	0.53079	.	.	ENSG00000107758	ENST00000360663;ENST00000394829;ENST00000394828;ENST00000342558;ENST00000394822	T;T;T;T;T	0.05925	3.37;3.37;3.37;3.37;3.37	5.58	5.58	0.84498	.	0.000000	0.56097	D	0.000021	T	0.32436	0.0829	M	0.89715	3.055	0.80722	D	1	B;B;D;B	0.76494	0.142;0.043;0.999;0.021	B;B;D;B	0.74674	0.025;0.008;0.984;0.006	T	0.12760	-1.0535	10	0.28530	T	0.3	.	19.5736	0.95432	0.0:1.0:0.0:0.0	.	37;37;37;37	P16298-2;P16298-3;Q8N1F0;P16298	.;.;.;PP2BB_HUMAN	H	37	ENSP00000353881:R37H;ENSP00000378306:R37H;ENSP00000378305:R37H;ENSP00000343147:R37H;ENSP00000378299:R37H	ENSP00000343147:R37H	R	-	2	0	PPP3CB	74909257	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.837000	0.62796	2.636000	0.89361	0.655000	0.94253	CGC	-	NULL		0.363	PPP3CB-001	KNOWN	basic|CCDS	protein_coding	PPP3CB	protein_coding	OTTHUMT00000048669.1	C	NM_021132	-		75239251	-1	no_errors	ENST00000394829	ensembl	human	known	74_37	missense	SNP	1.000	T
WBP11P1	441818	genome.wustl.edu	37	18	30093484	30093484	+	RNA	SNP	A	A	T			TCGA-WK-A8XQ-01A-11D-A37C-09	TCGA-WK-A8XQ-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a362ed3c-3c06-4aad-8b9e-a4b46b4cbcd3	779e9645-be20-45ce-842e-6224726c5e5a	g.chr18:30093484A>T	ENST00000567636.1	+	0	1859					NR_003558.1				WW domain binding protein 11 pseudogene 1																		AAGTGCAGCCACCGTTGAGAA	0.517																																																	0								ENSG00000260389																																			WBP11P1			0			-	HGNC	BC059403		18q12.1	2007-05-15				ENSG00000260389			26250	pseudogene	pseudogene							Standard	NR_003558		Approved	HsT3017	uc010dmc.3				18.37:g.30093484A>T		Somatic	0	28	0.00		0.7132304552168561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	25	43.18		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000567636.1	37	NULL		18																																																																																			-	-		0.517	WBP11P1-002	KNOWN	basic	processed_transcript	WBP11P1	pseudogene	OTTHUMT00000435119.1	A		-		30093484	+1	no_errors	ENST00000567636	ensembl	human	known	74_37	rna	SNP	1.000	T
NCOR2	9612	genome.wustl.edu	37	12	124824721	124824722	+	In_Frame_Ins	INS	-	-	GCCGCTGCT	rs61519723|rs112797765|rs143952466	byFrequency	TCGA-WK-A8XQ-01A-11D-A37C-09	TCGA-WK-A8XQ-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a362ed3c-3c06-4aad-8b9e-a4b46b4cbcd3	779e9645-be20-45ce-842e-6224726c5e5a	g.chr12:124824721_124824722insGCCGCTGCT	ENST00000405201.1	-	37	5517_5518	c.5517_5518insAGCAGCGGC	c.(5515-5520)ggcggg>ggcAGCAGCGGCggg	p.1838_1839insGSS	NCOR2_ENST00000404621.1_In_Frame_Ins_p.1828_1829insGSS|NCOR2_ENST00000429285.2_In_Frame_Ins_p.1828_1829insGSS|NCOR2_ENST00000356219.3_In_Frame_Ins_p.1845_1846insGSS|NCOR2_ENST00000404121.2_In_Frame_Ins_p.1399_1400insGSS|NCOR2_ENST00000397355.1_In_Frame_Ins_p.1829_1830insGSS			Q9Y618	NCOR2_HUMAN	nuclear receptor corepressor 2	1849					cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|regulation of cellular ketone metabolic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072365)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|Notch binding (GO:0005112)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(7)|lung(28)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		cccccacccccgccgctgctgc	0.713														4762	0.950879	0.8979	0.9496	5008	,	,		14227	0.9633		0.9672	False		,,,				2504	0.9939																0								ENSG00000196498																																			NCOR2	SO:0001652	inframe_insertion	0				HGNC	U37146	CCDS41857.1, CCDS41858.1, CCDS41857.2, CCDS41858.2, CCDS55892.1	12q24	2010-06-10	2010-06-10		ENSG00000196498	ENSG00000196498			7673	protein-coding gene	gene with protein product		600848	"""nuclear receptor co-repressor 2"""			7566127, 8813722	Standard	NM_001077261		Approved	SMRT, SMRTE, TRAC-1, CTG26, TNRC14	uc010tbb.2	Q9Y618	OTTHUMG00000150455	ENST00000405201.1:c.5509_5517dupAGCAGCGGC	12.37:g.124824722_124824730dupGCCGCTGCT	ENSP00000384018:p.Gly1836_Ser1838dup	Somatic	NA	NA	NA		0.7132304552168561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	O00613|O15416|O15421|Q13354|Q56D06|Q59GM0|Q9Y5U0	In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_SANT/Myb,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.1846in_frame_insSSG	ENST00000405201.1	37	c.5539_5538	CCDS41858.2	12																																																																																			-	NULL		0.713	NCOR2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	NCOR2	protein_coding	OTTHUMT00000318173.2	-	NM_006312			124824722	-1	no_errors	ENST00000356219	ensembl	human	known	74_37	in_frame_ins	INS	1.000:0.999	GCCGCTGCT
SPDYE2B	100310812	genome.wustl.edu	37	7	102294074	102294074	+	Missense_Mutation	SNP	T	T	C			TCGA-WK-A8XQ-01A-11D-A37C-09	TCGA-WK-A8XQ-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a362ed3c-3c06-4aad-8b9e-a4b46b4cbcd3	779e9645-be20-45ce-842e-6224726c5e5a	g.chr7:102294074T>C	ENST00000507450.1	+	3	811	c.337T>C	c.(337-339)Tcc>Ccc	p.S113P	SPDYE2B_ENST00000455020.2_5'Flank|POLR2J2_ENST00000476151.1_Intron|POLR2J2_ENST00000333432.6_Intron|SPDYE2B_ENST00000436228.2_Missense_Mutation_p.S113P|POLR2J2_ENST00000591000.1_Intron	NM_001166339.1	NP_001159811.1	A6NHP3	SPE2B_HUMAN	speedy/RINGO cell cycle regulator family member E2B	113																	GCGAGTGTCATCCATCCTCCC	0.542																																																	0								ENSG00000173678																																			SPDYE2B	SO:0001583	missense	0			-	HGNC		CCDS59507.1	7q22.1	2013-05-08			ENSG00000173678	ENSG00000173678		"""Speedy homologs"""	48334	protein-coding gene	gene with protein product							Standard	NM_001166339		Approved			A6NHP3	OTTHUMG00000158393	ENST00000507450.1:c.337T>C	7.37:g.102294074T>C	ENSP00000424058:p.Ser113Pro	Somatic	0	8	0.00		0.7132304552168561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	6	40.00	D6RBN0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cell_cycle_regulatory_Spy1	p.S113P	ENST00000507450.1	37	c.337	CCDS59507.1	7	.	.	.	.	.	.	.	.	.	.	c	0	-2.811089	0.00074	.	.	ENSG00000173678	ENST00000540965;ENST00000507450;ENST00000436228	.	.	.	.	.	.	.	.	.	.	.	T	0.12732	0.0309	N	0.04959	-0.14	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.15350	-1.0440	6	0.27082	T	0.32	.	.	.	.	.	113	A6NHP3	SPE2L_HUMAN	P	113	.	ENSP00000440393:S113P	S	+	1	0	RP11-577H5.4	102081310	0.724000	0.28038	0.002000	0.10522	0.002000	0.02628	-0.913000	0.04042	-1.655000	0.01497	-1.635000	0.00777	TCC	-	NULL		0.542	SPDYE2B-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	SPDYE2B	protein_coding	OTTHUMT00000350899.3	T		-		102294074	+1	no_errors	ENST00000436228	ensembl	human	known	74_37	missense	SNP	0.002	C
MAP7D1	55700	genome.wustl.edu	37	1	36636667	36636667	+	Missense_Mutation	SNP	C	C	G			TCGA-WK-A8XQ-01A-11D-A37C-09	TCGA-WK-A8XQ-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a362ed3c-3c06-4aad-8b9e-a4b46b4cbcd3	779e9645-be20-45ce-842e-6224726c5e5a	g.chr1:36636667C>G	ENST00000373151.2	+	2	358	c.142C>G	c.(142-144)Ccc>Gcc	p.P48A	MAP7D1_ENST00000373150.4_Missense_Mutation_p.P48A|MAP7D1_ENST00000316156.4_Missense_Mutation_p.P48A	NM_018067.3	NP_060537.3	Q3KQU3	MA7D1_HUMAN	MAP7 domain containing 1	48	Pro-rich.				microtubule cytoskeleton organization (GO:0000226)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)				breast(2)|cervix(1)|endometrium(2)|large_intestine(3)|lung(3)|ovary(3)|prostate(3)|skin(1)|urinary_tract(1)	19		Myeloproliferative disorder(586;0.0393)				CCCCGACACTCCCCCGGACAC	0.652																																																	0								ENSG00000116871						46.0	51.0	50.0					1																	36636667		2203	4300	6503	MAP7D1	SO:0001583	missense	0			-	HGNC	AK096341	CCDS30673.1, CCDS65492.1, CCDS65493.1	1p34.3	2008-02-05	2007-02-08	2007-02-08	ENSG00000116871	ENSG00000116871			25514	protein-coding gene	gene with protein product			"""proline arginine rich coiled coil 1"", ""arginine/proline rich coiled-coil 1"""	PARCC1, RPRC1		10574461	Standard	XM_005271024		Approved	FLJ10350, FLJ39022	uc001bzz.3	Q3KQU3	OTTHUMG00000007714	ENST00000373151.2:c.142C>G	1.37:g.36636667C>G	ENSP00000362244:p.Pro48Ala	Somatic	0	78	0.00		0.7132304552168561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	67	63	51.54	D3DPS4|Q7L8J5|Q8N905|Q8TAK0|Q9HBQ2|Q9NW29|Q9ULN3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MAP7	p.P48A	ENST00000373151.2	37	c.142	CCDS30673.1	1	.	.	.	.	.	.	.	.	.	.	C	19.84	3.902286	0.72754	.	.	ENSG00000116871	ENST00000429533;ENST00000316156;ENST00000373150;ENST00000373151;ENST00000530729	T;T;T;T;T	0.04758	3.56;3.56;3.56;3.56;3.56	4.74	4.74	0.60224	.	0.000000	0.41500	D	0.000866	T	0.14830	0.0358	L	0.43152	1.355	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.993	D;D;D	0.83275	0.996;0.996;0.971	T	0.00468	-1.1721	10	0.49607	T	0.09	-18.004	14.9178	0.70812	0.0:1.0:0.0:0.0	.	48;48;48	Q3KQU3-2;Q3KQU3-4;Q3KQU3	.;.;MA7D1_HUMAN	A	9;48;48;48;9	ENSP00000390091:P9A;ENSP00000320228:P48A;ENSP00000362243:P48A;ENSP00000362244:P48A;ENSP00000435126:P9A	ENSP00000320228:P48A	P	+	1	0	MAP7D1	36409254	0.246000	0.23909	1.000000	0.80357	0.938000	0.57974	1.368000	0.34216	2.631000	0.89168	0.462000	0.41574	CCC	-	NULL		0.652	MAP7D1-009	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAP7D1	protein_coding	OTTHUMT00000382095.1	C	NM_018067	-		36636667	+1	no_errors	ENST00000373151	ensembl	human	known	74_37	missense	SNP	1.000	G
MUC3A	4584	genome.wustl.edu	37	7	100608123	100608124	+	Intron	INS	-	-	G	rs111295588		TCGA-WK-A8XQ-01A-11D-A37C-09	TCGA-WK-A8XQ-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a362ed3c-3c06-4aad-8b9e-a4b46b4cbcd3	779e9645-be20-45ce-842e-6224726c5e5a	g.chr7:100608123_100608124insG	ENST00000319509.7	+	6	2041				RP11-395B7.2_ENST00000420080.1_RNA|RP11-395B7.2_ENST00000434775.1_RNA			Q02505	MUC3A_HUMAN	mucin 3A, cell surface associated						cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|extracellular matrix structural constituent (GO:0005201)			breast(3)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(1)|lung(32)|prostate(3)	44						CAGCATTTCCCGATGGCTGAAG	0.589																																																	0								ENSG00000225946																																			RP11-395B7.2	SO:0001627	intron_variant	0				Clone_based_vega_gene	AF113616		7q22.1	2012-04-20	2006-03-14		ENSG00000169894	ENSG00000169894		"""Mucins"""	7513	protein-coding gene	gene with protein product		158371	"""mucin 3A, intestinal"""	MUC3		2393399, 10973822	Standard	XM_006710192		Approved		uc003uxl.1	Q02505	OTTHUMG00000157038	ENST00000319509.7:c.2042-183->G	7.37:g.100608124_100608124dupG		Somatic	0	12	0.00		0.7132304552168561	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	12	36.84	O14650|O14651|O43418|O43421|Q02506|Q6W763|Q9H3Q7|Q9UKW9|Q9UN93|Q9UN94|Q9UN95	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000319509.7	37	NULL		7																																																																																			-	-		0.589	MUC3A-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_candidate_longest	protein_coding	ENSG00000225946	protein_coding	OTTHUMT00000347215.1	-	XM_001725354			100608124	-1	no_errors	ENST00000420080	ensembl	human	known	74_37	rna	INS	0.000:0.037	G
