#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
PNMA3	29944	genome.wustl.edu	37	X	152226127	152226127	+	Missense_Mutation	SNP	G	G	C			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chrX:152226127G>C	ENST00000370264.4	+	1	741	c.715G>C	c.(715-717)Gtg>Ctg	p.V239L	PNMA3_ENST00000370265.4_Missense_Mutation_p.V239L|PNMA3_ENST00000447306.1_Missense_Mutation_p.V239L			Q9UL41	PNMA3_HUMAN	paraneoplastic Ma antigen 3	239					positive regulation of apoptotic process (GO:0043065)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)	16	Acute lymphoblastic leukemia(192;6.56e-05)					cttgcagcaggtgttcggacc	0.542																																																	0								ENSG00000183837						122.0	124.0	123.0					X																	152226127		2203	4300	6503	PNMA3	SO:0001583	missense	0			-	HGNC	AF083116	CCDS35435.2, CCDS65344.1	Xq28	2012-02-09	2012-02-09		ENSG00000183837	ENSG00000183837		"""Paraneoplastic Ma antigens"""	18742	protein-coding gene	gene with protein product	"""paraneoplastic cancer-testis-brain antigen"""	300675	"""paraneoplastic antigen MA3"""			11558790	Standard	NM_013364		Approved	MA5, MA3, MGC132756, MGC132758	uc004fhc.2	Q9UL41	OTTHUMG00000024195	ENST00000370264.4:c.715G>C	X.37:g.152226127G>C	ENSP00000359286:p.Val239Leu	Somatic	0	44	0.00		0.7032168817119823	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	28	46.15	D3DWT7|Q9H0A4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_Znf_CCHC,pfscan_Znf_CCHC	p.V239L	ENST00000370264.4	37	c.715	CCDS35435.2	X	.	.	.	.	.	.	.	.	.	.	g	13.16	2.153246	0.38021	.	.	ENSG00000183837	ENST00000370265;ENST00000447306;ENST00000370264	T;T;T	0.10477	2.87;2.87;2.87	1.98	1.1	0.20463	.	.	.	.	.	T	0.14657	0.0354	L	0.56340	1.77	0.09310	N	1	P	0.51933	0.949	P	0.52881	0.712	T	0.16897	-1.0387	9	0.25751	T	0.34	.	4.2224	0.10565	0.2157:0.0:0.7843:0.0	.	239	Q9UL41	PNMA3_HUMAN	L	239	ENSP00000359288:V239L;ENSP00000407642:V239L;ENSP00000359286:V239L	ENSP00000359286:V239L	V	+	1	0	PNMA3	151976783	0.773000	0.28580	0.043000	0.18650	0.033000	0.12548	0.226000	0.17776	0.309000	0.22966	0.464000	0.42555	GTG	-	NULL		0.542	PNMA3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PNMA3	protein_coding	OTTHUMT00000060946.2	G	NM_013364	-		152226127	+1	no_errors	ENST00000370264	ensembl	human	known	74_37	missense	SNP	0.039	C
CA2	760	genome.wustl.edu	37	8	86386014	86386014	+	Missense_Mutation	SNP	G	G	T			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr8:86386014G>T	ENST00000285379.5	+	3	555	c.325G>T	c.(325-327)Gtg>Ttg	p.V109L		NM_000067.2	NP_000058.1	P00918	CAH2_HUMAN	carbonic anhydrase II	109					angiotensin-activated signaling pathway (GO:0038166)|bicarbonate transport (GO:0015701)|kidney development (GO:0001822)|morphogenesis of an epithelium (GO:0002009)|odontogenesis of dentin-containing tooth (GO:0042475)|one-carbon metabolic process (GO:0006730)|positive regulation of bone resorption (GO:0045780)|positive regulation of cellular pH reduction (GO:0032849)|positive regulation of dipeptide transmembrane transport (GO:2001150)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|regulation of anion transport (GO:0044070)|regulation of chloride transport (GO:2001225)|regulation of intracellular pH (GO:0051453)|response to estrogen (GO:0043627)|response to pH (GO:0009268)|response to zinc ion (GO:0010043)|secretion (GO:0046903)|small molecule metabolic process (GO:0044281)	apical part of cell (GO:0045177)|axon (GO:0030424)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|microvillus (GO:0005902)|myelin sheath (GO:0043209)|plasma membrane (GO:0005886)	carbonate dehydratase activity (GO:0004089)|zinc ion binding (GO:0008270)			central_nervous_system(2)|cervix(1)|large_intestine(2)|lung(5)|prostate(1)	11					Acetazolamide(DB00819)|Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Brinzolamide(DB01194)|Chlorothiazide(DB00880)|Cyclothiazide(DB00606)|Diazoxide(DB01119)|Diclofenamide(DB01144)|Dorzolamide(DB00869)|Ethinamate(DB01031)|Furosemide(DB00695)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Methazolamide(DB00703)|Methyclothiazide(DB00232)|Quinethazone(DB01325)|Topiramate(DB00273)|Trichlormethiazide(DB01021)|Zonisamide(DB00909)	AGAGCATACTGTGGATAAAAA	0.353																																																	0								ENSG00000104267						91.0	96.0	94.0					8																	86386014		2203	4300	6503	CA2	SO:0001583	missense	0			-	HGNC	J03037	CCDS6239.1	8q21.2	2012-10-02			ENSG00000104267	ENSG00000104267	4.2.1.1	"""Carbonic anhydrases"""	1373	protein-coding gene	gene with protein product		611492				3107918	Standard	NM_000067		Approved	Car2, CA-II, CAII	uc003ydk.2	P00918	OTTHUMG00000164944	ENST00000285379.5:c.325G>T	8.37:g.86386014G>T	ENSP00000285379:p.Val109Leu	Somatic	0	28	0.00		0.7032168817119823	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	34	10.53	B2R7G8|Q6FI12|Q96ET9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Carbonic_anhydrase_a,superfamily_Carbonic_anhydrase_a,pfscan_Carbonic_anhydrase_a	p.V109L	ENST00000285379.5	37	c.325	CCDS6239.1	8	.	.	.	.	.	.	.	.	.	.	G	15.40	2.821997	0.50739	.	.	ENSG00000104267	ENST00000285379	T	0.72725	-0.68	5.56	3.57	0.40892	Carbonic anhydrase, alpha-class, conserved site (1);Carbonic anhydrase, alpha-class, catalytic domain (4);	0.294542	0.37219	N	0.002199	T	0.65481	0.2695	L	0.58669	1.825	0.51233	D	0.999919	B	0.13145	0.007	B	0.15870	0.014	T	0.66320	-0.5953	10	0.72032	D	0.01	1.1646	11.0576	0.47927	0.0751:0.0:0.7874:0.1375	.	109	P00918	CAH2_HUMAN	L	109	ENSP00000285379:V109L	ENSP00000285379:V109L	V	+	1	0	CA2	86573266	0.996000	0.38824	0.981000	0.43875	0.743000	0.42351	2.270000	0.43355	1.350000	0.45770	0.555000	0.69702	GTG	-	pfam_Carbonic_anhydrase_a,superfamily_Carbonic_anhydrase_a,pfscan_Carbonic_anhydrase_a		0.353	CA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CA2	protein_coding	OTTHUMT00000381097.2	G	NM_000067	-		86386014	+1	no_errors	ENST00000285379	ensembl	human	known	74_37	missense	SNP	0.997	T
ARID3B	10620	genome.wustl.edu	37	15	74889073	74889073	+	3'UTR	SNP	T	T	C			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr15:74889073T>C	ENST00000563567.1	+	0	137				ARID3B_ENST00000346246.5_3'UTR			Q8IVW6	ARI3B_HUMAN	AT rich interactive domain 3B (BRIGHT-like)							nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)			NS(1)|breast(1)|endometrium(1)|large_intestine(2)|lung(7)|prostate(2)	14						ATTGTTGATGTTTGAGTCTTC	0.363																																																	0								ENSG00000179361																																			ARID3B	SO:0001624	3_prime_UTR_variant	0			-	HGNC		CCDS10264.1	15q24	2013-02-07	2006-11-08		ENSG00000179361	ENSG00000179361		"""-"""	14350	protein-coding gene	gene with protein product		612457	"""AT rich interactive domain 3B (BRIGHT- like)"""				Standard	NM_006465		Approved	BDP, DRIL2	uc002ayd.3	Q8IVW6	OTTHUMG00000141321	ENST00000563567.1:c.*134T>C	15.37:g.74889073T>C		Somatic	0	36	0.00		0.7032168817119823	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	29	12.12	O95443|Q59HC9|Q6P9C9	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000563567.1	37	NULL		15																																																																																			-	-		0.363	ARID3B-006	PUTATIVE	basic|exp_conf	processed_transcript	ARID3B	protein_coding	OTTHUMT00000420641.1	T	NM_006465	-		74889073	+1	no_errors	ENST00000563567	ensembl	human	putative	74_37	rna	SNP	1.000	C
GPHB5	122876	genome.wustl.edu	37	14	63784386	63784386	+	RNA	SNP	C	C	A			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr14:63784386C>A	ENST00000539258.1	-	0	234							Q86YW7	GPHB5_HUMAN	glycoprotein hormone beta 5						regulation of thyroid hormone mediated signaling pathway (GO:0002155)	extracellular region (GO:0005576)				breast(1)|endometrium(1)|lung(4)|urinary_tract(1)	7				OV - Ovarian serous cystadenocarcinoma(108;0.00372)|all cancers(60;0.0226)|BRCA - Breast invasive adenocarcinoma(234;0.0978)		GCGACCCCAGCAGGCATCCGT	0.562																																																	0								ENSG00000179600						40.0	43.0	42.0					14																	63784386		2029	4181	6210	GPHB5			0			-	HGNC	AF467770	CCDS73643.1	14q23.3	2006-09-25				ENSG00000179600			18055	protein-coding gene	gene with protein product		609652					Standard	NM_145171		Approved	ZLUT1, GPB5	uc021rud.1	Q86YW7			14.37:g.63784386C>A		Somatic	0	63	0.00		0.7032168817119823	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	60	26.83	Q6NTD0|Q8NFW2	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000539258.1	37	NULL		14																																																																																			-	-		0.562	GPHB5-001	KNOWN	basic	processed_transcript	GPHB5	processed_transcript	OTTHUMT00000400582.1	C	NM_145171	-		63784386	-1	no_errors	ENST00000314140	ensembl	human	known	74_37	rna	SNP	1.000	A
ZBTB25	7597	genome.wustl.edu	37	14	64957138	64957138	+	Missense_Mutation	SNP	G	G	T			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr14:64957138G>T	ENST00000608382.1	-	2	305	c.114C>A	c.(112-114)caC>caA	p.H38Q	ZBTB25_ENST00000394715.1_Missense_Mutation_p.H38Q|ZBTB25_ENST00000555220.1_Missense_Mutation_p.H38Q|ZBTB25_ENST00000555424.1_Missense_Mutation_p.H38Q	NM_006977.2	NP_008908.2	P24278	ZBT25_HUMAN	zinc finger and BTB domain containing 25	38	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				gene expression (GO:0010467)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|large_intestine(1)|lung(3)|ovary(2)|skin(2)	10				all cancers(60;0.00865)|OV - Ovarian serous cystadenocarcinoma(108;0.0102)|BRCA - Breast invasive adenocarcinoma(234;0.0469)		GCACTGCTCTGTGGGCTTTGA	0.373																																																	0								ENSG00000089775						94.0	94.0	94.0					14																	64957138		2203	4300	6503	ZBTB25	SO:0001583	missense	0			-	HGNC	X16576	CCDS9765.1	14q23-q24	2013-01-08	2005-05-22	2005-05-22	ENSG00000089775	ENSG00000089775		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	13112	protein-coding gene	gene with protein product		194541	"""zinc finger protein 46 (KUP)"", ""chromosome 14 open reading frame 51"""	ZNF46, C14orf51			Standard	NM_006977		Approved	KUP	uc001xhf.3	P24278	OTTHUMG00000141310	ENST00000608382.1:c.114C>A	14.37:g.64957138G>T	ENSP00000476746:p.His38Gln	Somatic	0	32	0.00		0.7032168817119823	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	40	9.09	B3KUX6|Q8IYH9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.H38Q	ENST00000608382.1	37	c.114	CCDS9765.1	14	.	.	.	.	.	.	.	.	.	.	G	15.86	2.958026	0.53400	.	.	ENSG00000089775	ENST00000555220;ENST00000555424;ENST00000261683;ENST00000394715	T;T;T;T	0.79749	-1.3;1.17;1.17;1.17	5.39	0.355	0.16069	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	D	0.90728	0.7090	H	0.94886	3.595	0.50313	D	0.999869	D;D	0.89917	1.0;0.99	D;D	0.91635	0.999;0.988	D	0.90189	0.4248	10	0.87932	D	0	-19.8499	10.6011	0.45367	0.3264:0.0:0.6736:0.0	.	38;38	P24278;G3V2K3	ZBT25_HUMAN;.	Q	38	ENSP00000450718:H38Q;ENSP00000451046:H38Q;ENSP00000261683:H38Q;ENSP00000378204:H38Q	ENSP00000261683:H38Q	H	-	3	2	ZBTB25	64026891	1.000000	0.71417	0.997000	0.53966	0.564000	0.35744	1.779000	0.38624	0.084000	0.17077	0.313000	0.20887	CAC	-	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pfscan_BTB/POZ-like		0.373	ZBTB25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB25	protein_coding	OTTHUMT00000280649.2	G	NM_006977	-		64957138	-1	no_errors	ENST00000394715	ensembl	human	known	74_37	missense	SNP	0.996	T
KMT2C	58508	genome.wustl.edu	37	7	151962257	151962257	+	Silent	SNP	C	C	T	rs62478357		TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr7:151962257C>T	ENST00000262189.6	-	8	1268	c.1050G>A	c.(1048-1050)ccG>ccA	p.P350P	KMT2C_ENST00000355193.2_Silent_p.P350P	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	350					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										AGAGGTCTCCCGGGCTGTCGC	0.398																																																	0								ENSG00000055609						146.0	134.0	138.0					7																	151962257		2203	4296	6499	KMT2C	SO:0001819	synonymous_variant	0			-	HGNC	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.1050G>A	7.37:g.151962257C>T		Somatic	0	63	0.00		0.7032168817119823	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	78	9.30	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_box_dom,smart_Znf_PHD,smart_Znf_RING,smart_HMG_box_dom,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_DHHC_palmitoyltrfase,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.P350	ENST00000262189.6	37	c.1050	CCDS5931.1	7																																																																																			-	superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_Znf_RING,pfscan_Znf_PHD-finger,pfscan_Znf_RING		0.398	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KMT2C	protein_coding	OTTHUMT00000318887.3	C		rs62478357		151962257	-1	no_errors	ENST00000355193	ensembl	human	known	74_37	silent	SNP	1.000	T
MYO6	4646	genome.wustl.edu	37	6	76599937	76599937	+	Missense_Mutation	SNP	A	A	C			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr6:76599937A>C	ENST00000369977.3	+	26	2961	c.2822A>C	c.(2821-2823)gAa>gCa	p.E941A	MYO6_ENST00000369981.3_Missense_Mutation_p.E941A|MYO6_ENST00000369975.1_Missense_Mutation_p.E941A|MYO6_ENST00000369985.4_Missense_Mutation_p.E941A	NM_004999.3	NP_004990.3	Q9UM54	MYO6_HUMAN	myosin VI	941	Glu-rich.				actin filament-based movement (GO:0030048)|auditory receptor cell differentiation (GO:0042491)|cellular response to electrical stimulus (GO:0071257)|dendrite development (GO:0016358)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|endocytosis (GO:0006897)|glutamate secretion (GO:0014047)|inner ear morphogenesis (GO:0042472)|intracellular protein transport (GO:0006886)|locomotory behavior (GO:0007626)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein targeting (GO:0006605)|regulation of secretion (GO:0051046)|regulation of synaptic plasticity (GO:0048167)|response to drug (GO:0042493)|sensory perception of sound (GO:0007605)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	apical part of cell (GO:0045177)|axon (GO:0030424)|cell cortex (GO:0005938)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|microvillus (GO:0005902)|neuronal cell body (GO:0043025)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|ruffle membrane (GO:0032587)|unconventional myosin complex (GO:0016461)|vesicle membrane (GO:0012506)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|minus-end directed microfilament motor activity (GO:0060001)|motor activity (GO:0003774)			breast(2)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(16)|lung(19)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	58		all_hematologic(105;0.189)		BRCA - Breast invasive adenocarcinoma(397;0.223)		AAAAGACGTGAAGAAGACGAA	0.383																																																	0								ENSG00000196586						98.0	117.0	110.0					6																	76599937		2203	4300	6503	MYO6	SO:0001583	missense	0			-	HGNC	U90236, AB002387	CCDS34487.1, CCDS75481.1	6q14.1	2014-09-17	2004-05-19		ENSG00000196586	ENSG00000196586		"""Myosins / Myosin superfamily : Class VI"""	7605	protein-coding gene	gene with protein product		600970	"""deafness, autosomal recessive 37"""	DFNA22, DFNB37		9259267, 11468689	Standard	XM_005248719		Approved	KIAA0389	uc003pih.1	Q9UM54	OTTHUMG00000015061	ENST00000369977.3:c.2822A>C	6.37:g.76599937A>C	ENSP00000358994:p.Glu941Ala	Somatic	0	32	0.00		0.7032168817119823	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	15	40.00	A6H8V4|E1P540|Q5TEM5|Q5TEM6|Q5TEM7|Q9BZZ7|Q9UEG2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom,prints_Myosin_head_motor_dom	p.E941A	ENST00000369977.3	37	c.2822	CCDS34487.1	6	.	.	.	.	.	.	.	.	.	.	A	13.81	2.349351	0.41599	.	.	ENSG00000196586	ENST00000428345;ENST00000369981;ENST00000369985;ENST00000369977;ENST00000369975;ENST00000430435	T;T;T;T;T	0.67698	2.23;3.72;3.72;-0.28;0.88	5.98	5.98	0.97165	.	0.153546	0.56097	D	0.000027	T	0.78868	0.4351	M	0.85041	2.73	0.80722	D	1	D;D	0.56035	0.974;0.974	D;D	0.70487	0.969;0.969	T	0.78001	-0.2375	10	0.29301	T	0.29	.	16.1462	0.81575	1.0:0.0:0.0:0.0	.	941;941	Q9UM54-2;Q9UM54-1	.;.	A	941;941;941;941;941;4	ENSP00000358998:E941A;ENSP00000359002:E941A;ENSP00000358994:E941A;ENSP00000358992:E941A;ENSP00000399406:E4A	ENSP00000358992:E941A	E	+	2	0	MYO6	76656657	1.000000	0.71417	0.922000	0.36590	0.022000	0.10575	8.097000	0.89539	2.296000	0.77279	0.482000	0.46254	GAA	-	NULL		0.383	MYO6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO6	protein_coding	OTTHUMT00000041279.2	A	NM_004999	-		76599937	+1	no_errors	ENST00000369981	ensembl	human	known	74_37	missense	SNP	1.000	C
NOX4	50507	genome.wustl.edu	37	11	89069056	89069056	+	Silent	SNP	G	G	T	rs140266495		TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr11:89069056G>T	ENST00000263317.4	-	17	1811	c.1573C>A	c.(1573-1575)Cgg>Agg	p.R525R	NOX4_ENST00000535633.1_Silent_p.R501R|NOX4_ENST00000531342.1_Silent_p.R178R|NOX4_ENST00000424319.1_Silent_p.R501R|NOX4_ENST00000527626.1_Silent_p.R338R|NOX4_ENST00000542487.1_Silent_p.R501R|NOX4_ENST00000375979.3_Silent_p.R218R|NOX4_ENST00000532825.1_Silent_p.R461R|NOX4_ENST00000525196.1_Silent_p.R289R|NOX4_ENST00000534731.1_Silent_p.R485R|NOX4_ENST00000528341.1_Silent_p.R500R|NOX4_ENST00000413594.2_Silent_p.R546R|NOX4_ENST00000343727.5_Silent_p.R501R|NOX4_ENST00000527956.1_Silent_p.R501R			Q9NPH5	NOX4_HUMAN	NADPH oxidase 4	525	Mediates interaction with TLR4.				bone resorption (GO:0045453)|cardiac muscle cell differentiation (GO:0055007)|cell aging (GO:0007569)|cell morphogenesis (GO:0000902)|cellular response to cAMP (GO:0071320)|cellular response to gamma radiation (GO:0071480)|cellular response to glucose stimulus (GO:0071333)|cellular response to transforming growth factor beta stimulus (GO:0071560)|homocysteine metabolic process (GO:0050667)|inflammatory response (GO:0006954)|negative regulation of cell proliferation (GO:0008285)|oxidation-reduction process (GO:0055114)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of stress fiber assembly (GO:0051496)|reactive oxygen species metabolic process (GO:0072593)|response to hypoxia (GO:0001666)|superoxide anion generation (GO:0042554)	apical plasma membrane (GO:0016324)|endoplasmic reticulum (GO:0005783)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|NADPH oxidase complex (GO:0043020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|heme binding (GO:0020037)|modified amino acid binding (GO:0072341)|NAD(P)H oxidase activity (GO:0016174)|nucleotide binding (GO:0000166)|oxygen sensor activity (GO:0019826)|superoxide-generating NADPH oxidase activity (GO:0016175)			NS(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(20)|ovary(2)|prostate(3)|skin(2)	44		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.011)				AGTTTCCACCGAGGACGTCCT	0.289																																																	0								ENSG00000086991						73.0	74.0	74.0					11																	89069056		2201	4296	6497	NOX4	SO:0001819	synonymous_variant	0			-	HGNC	AF254621	CCDS8285.1, CCDS44695.1, CCDS44696.1, CCDS73361.1, CCDS73362.1	11q14.2-q21	2008-02-05			ENSG00000086991	ENSG00000086991			7891	protein-coding gene	gene with protein product		605261					Standard	NM_001143837		Approved	KOX-1, KOX	uc001pct.3	Q9NPH5	OTTHUMG00000167298	ENST00000263317.4:c.1573C>A	11.37:g.89069056G>T		Somatic	0	33	0.00		0.7032168817119823	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51	A8K715|B7Z520|E7EMD7|Q5K3R4|Q5K3R5|Q5K3R6|Q5K3R8|Q7Z7G3|Q86V92	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Fe_red_NAD-bd_6,pfam_Fe3_Rdtase_TM_dom,pfam_FAD-bd_8,superfamily_Riboflavin_synthase-like_b-brl,prints_Cyt_b245_heavy_chain	p.R546	ENST00000263317.4	37	c.1636	CCDS8285.1	11																																																																																			-	pfam_Fe_red_NAD-bd_6		0.289	NOX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOX4	protein_coding	OTTHUMT00000394054.1	G	NM_016931	-		89069056	-1	no_errors	ENST00000413594	ensembl	human	known	74_37	silent	SNP	0.986	T
ZMYND8	23613	genome.wustl.edu	37	20	45867410	45867410	+	Intron	DEL	A	A	-			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr20:45867410delA	ENST00000311275.7	-	15	2859				ZMYND8_ENST00000458360.2_Intron|ZMYND8_ENST00000540497.1_Intron|ZMYND8_ENST00000352431.2_Intron|ZMYND8_ENST00000372023.3_Intron|ZMYND8_ENST00000536340.1_Intron|ZMYND8_ENST00000446994.2_Intron|ZMYND8_ENST00000262975.4_Intron|ZMYND8_ENST00000360911.3_Intron|ZMYND8_ENST00000396281.4_Intron|ZMYND8_ENST00000468376.2_5'UTR|ZMYND8_ENST00000461685.1_Intron|ZMYND8_ENST00000355972.4_Intron|ZMYND8_ENST00000471951.2_Intron	NM_001281772.1|NM_001281778.1|NM_001281783.1	NP_001268701.1|NP_001268707.1|NP_001268712.1	Q9ULU4	PKCB1_HUMAN	zinc finger, MYND-type containing 8						negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)	repressing transcription factor binding (GO:0070491)|RNA polymerase II transcription corepressor activity (GO:0001106)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|lung(22)|ovary(1)|prostate(3)|skin(2)|urinary_tract(8)	62			Epithelial(1;0.0289)|all cancers(1;0.0962)|OV - Ovarian serous cystadenocarcinoma(1;0.154)			AACGAGAACTAAAAAAAAAAA	0.413																																																	0								ENSG00000101040																																			ZMYND8	SO:0001627	intron_variant	0				HGNC	U48251	CCDS13404.1, CCDS13405.1, CCDS46613.1, CCDS63300.1, CCDS63301.1, CCDS63304.1, CCDS63306.1, CCDS74738.1	20q13.12	2013-01-28	2007-01-29	2007-01-29	ENSG00000101040	ENSG00000101040		"""Zinc fingers, MYND-type"", ""Zinc fingers, PHD-type"""	9397	protein-coding gene	gene with protein product		615713	"""protein kinase C binding protein 1"""	PRKCBP1			Standard	NM_001281769		Approved	RACK7	uc002xtb.1	Q9ULU4	OTTHUMG00000032667	ENST00000311275.7:c.2605+91T>-	20.37:g.45867410delA		Somatic	0	50	0.00		0.7032168817119823	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	48	9.43	B3KVL2|B7Z2A8|B7Z3E0|B7Z680|B7ZM62|E1P5U5|F5H0X3|H7C0U2|J3KPU3|Q13517|Q2HXV1|Q2HXV2|Q2HXV3|Q2HXV4|Q2HXV7|Q2HXV8|Q2HXV9|Q2HXW0|Q2HXW1|Q2HXW2|Q4JJ94|Q4JJ95|Q5TH09|Q5TH11|Q6MZM1|Q8WXC5|Q9H1F3|Q9H1F4|Q9H1F5|Q9H1L8|Q9H1L9|Q9H2G5|Q9NYN3|Q9UIX6	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000311275.7	37	NULL		20																																																																																			-	-		0.413	ZMYND8-007	KNOWN	basic	protein_coding	ZMYND8	protein_coding	OTTHUMT00000079596.2	A	NM_183047			45867410	-1	no_errors	ENST00000468376	ensembl	human	known	74_37	rna	DEL	0.000	-
LCE1F	353137	genome.wustl.edu	37	1	152748994	152748994	+	Silent	SNP	A	A	G	rs562170324	byFrequency	TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr1:152748994A>G	ENST00000334371.2	+	1	147	c.147A>G	c.(145-147)ggA>ggG	p.G49G		NM_178354.2	NP_848131.1	Q5T754	LCE1F_HUMAN	late cornified envelope 1F	49					keratinization (GO:0031424)					kidney(1)|large_intestine(2)|lung(7)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			TCAGCTCCGGAGGCTGCTGTG	0.677													.|||	6	0.00119808	0.0008	0.0	5008	,	,		15070	0.001		0.0	False		,,,				2504	0.0041																0								ENSG00000240386						42.0	45.0	44.0					1																	152748994		2203	4300	6503	LCE1F	SO:0001819	synonymous_variant	0			-	HGNC		CCDS1023.1	1q21.3	2008-02-05			ENSG00000240386	ENSG00000240386		"""Late cornified envelopes"""	29467	protein-coding gene	gene with protein product		612608				11698679	Standard	NM_178354		Approved	LEP6	uc010pdv.2	Q5T754	OTTHUMG00000012403	ENST00000334371.2:c.147A>G	1.37:g.152748994A>G		Somatic	0	82	0.00		0.7032168817119823	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	89	11.00		Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.G49	ENST00000334371.2	37	c.147	CCDS1023.1	1																																																																																			-	NULL		0.677	LCE1F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCE1F	protein_coding	OTTHUMT00000034523.2	A	NM_178354	-		152748994	+1	no_errors	ENST00000334371	ensembl	human	known	74_37	silent	SNP	0.848	G
C11orf49	79096	genome.wustl.edu	37	11	47183083	47183083	+	Missense_Mutation	SNP	G	G	T	rs541095717		TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr11:47183083G>T	ENST00000278460.7	+	9	949	c.890G>T	c.(889-891)cGg>cTg	p.R297L	C11orf49_ENST00000378615.3_Missense_Mutation_p.R303L|C11orf49_ENST00000543718.1_Missense_Mutation_p.R213L|C11orf49_ENST00000536126.1_Missense_Mutation_p.R200L|C11orf49_ENST00000395460.2_3'UTR|C11orf49_ENST00000378618.2_Intron	NM_001003677.1|NM_024113.3	NP_001003677.1|NP_077018.1	Q9H6J7	CK049_HUMAN	chromosome 11 open reading frame 49	297						nucleus (GO:0005634)				central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|skin(1)	11						CTGCCTTCCCGGACCCCTCCC	0.622											OREG0020950	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000149179						45.0	47.0	46.0					11																	47183083		2201	4299	6500	C11orf49	SO:0001583	missense	0			-	HGNC	AL136575	CCDS7925.1, CCDS31479.1, CCDS31480.1, CCDS41641.1	11p11.2	2006-02-02			ENSG00000149179	ENSG00000149179			28720	protein-coding gene	gene with protein product							Standard	NM_001003677		Approved	FLJ22210, MGC4707	uc001ndr.4	Q9H6J7	OTTHUMG00000166725	ENST00000278460.7:c.890G>T	11.37:g.47183083G>T	ENSP00000278460:p.Arg297Leu	Somatic	0	41	0.00	944	0.7032168817119823	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	38	28.30	D3DQQ8|E9PAX7|Q7L077|Q96CS8|Q9BQH4|Q9BUW5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.R303L	ENST00000278460.7	37	c.908	CCDS7925.1	11	.	.	.	.	.	.	.	.	.	.	G	34	5.371946	0.95923	.	.	ENSG00000149179	ENST00000536126;ENST00000278460;ENST00000378615;ENST00000543718	T;T;T;T	0.24723	1.84;1.84;1.84;1.84	5.63	5.63	0.86233	.	0.110104	0.64402	D	0.000008	T	0.52581	0.1743	M	0.68317	2.08	0.58432	D	0.99999	D;D;P;P	0.71674	0.998;0.998;0.932;0.932	D;D;P;P	0.80764	0.994;0.994;0.585;0.585	T	0.50759	-0.8790	10	0.72032	D	0.01	-4.9959	20.0471	0.97613	0.0:0.0:1.0:0.0	.	213;213;303;297	F5H6E0;B4DEG1;Q9H6J7-2;Q9H6J7	.;.;.;CK049_HUMAN	L	200;297;303;213	ENSP00000438207:R200L;ENSP00000278460:R297L;ENSP00000367878:R303L;ENSP00000437689:R213L	ENSP00000278460:R297L	R	+	2	0	C11orf49	47139659	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.417000	0.73337	2.815000	0.96918	0.561000	0.74099	CGG	-	NULL		0.622	C11orf49-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	C11orf49	protein_coding	OTTHUMT00000391218.1	G	NM_024113	-		47183083	+1	no_errors	ENST00000378615	ensembl	human	known	74_37	missense	SNP	1.000	T
SH3PXD2B	285590	genome.wustl.edu	37	5	171766855	171766855	+	Silent	SNP	C	C	T	rs115528822		TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr5:171766855C>T	ENST00000311601.5	-	13	1424	c.1254G>A	c.(1252-1254)ccG>ccA	p.P418P	SH3PXD2B_ENST00000519643.1_Intron	NM_001017995.2	NP_001017995.1	A1X283	SPD2B_HUMAN	SH3 and PX domains 2B	418	SH3 3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				adipose tissue development (GO:0060612)|bone development (GO:0060348)|cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|eye development (GO:0001654)|heart development (GO:0007507)|podosome assembly (GO:0071800)|positive regulation of fat cell differentiation (GO:0045600)|protein localization to membrane (GO:0072657)|skeletal system development (GO:0001501)|superoxide metabolic process (GO:0006801)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|podosome (GO:0002102)	phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)|SH2 domain binding (GO:0042169)			NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(12)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	36	Renal(175;0.000159)|Lung NSC(126;0.011)|all_lung(126;0.0175)	Medulloblastoma(196;0.0207)|all_neural(177;0.0625)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			TGAAGGTGGCCGGGGCCCACC	0.562													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18542	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000174705						67.0	69.0	68.0					5																	171766855		2203	4300	6503	SH3PXD2B	SO:0001819	synonymous_variant	0			GMAF=0.0005	HGNC	AK095834	CCDS34291.1	5q35.2	2008-02-05	2006-02-13	2006-02-13	ENSG00000174705	ENSG00000174705			29242	protein-coding gene	gene with protein product		613293	"""KIAA1295"""	KIAA1295		10718198	Standard	NM_001017995		Approved	FLJ20831	uc003mbr.3	A1X283	OTTHUMG00000163280	ENST00000311601.5:c.1254G>A	5.37:g.171766855C>T		Somatic	0	25	0.00		0.7032168817119823	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	20	45.95	B6F0V2|Q9P2Q1	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_SH3_domain,pfam_SH3_2,pfam_Phox,pfam_SH3-like_bac-type,pfam_DUF1058,superfamily_Phox,superfamily_SH3_domain,smart_Phox,smart_SH3_domain,pfscan_Phox,pfscan_SH3_domain	p.P418	ENST00000311601.5	37	c.1254	CCDS34291.1	5																																																																																			-	pfam_SH3_domain,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain		0.562	SH3PXD2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SH3PXD2B	protein_coding	OTTHUMT00000372449.1	C	NM_017963	rs115528822		171766855	-1	no_errors	ENST00000311601	ensembl	human	known	74_37	silent	SNP	0.991	T
OR4S1	256148	genome.wustl.edu	37	11	48328655	48328655	+	Missense_Mutation	SNP	A	A	G			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr11:48328655A>G	ENST00000319988.1	+	1	881	c.881A>G	c.(880-882)aAt>aGt	p.N294S		NM_001004725.1	NP_001004725.1	Q8NGB4	OR4S1_HUMAN	olfactory receptor, family 4, subfamily S, member 1	294						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(4)|lung(12)|ovary(1)|skin(3)	21						GATGTGAAAAATGCCATGAGG	0.443																																																	0								ENSG00000176555						76.0	71.0	72.0					11																	48328655		2201	4298	6499	OR4S1	SO:0001583	missense	0			-	HGNC	AB065908	CCDS31488.1	11p11.2	2012-08-09			ENSG00000176555	ENSG00000176555		"""GPCR / Class A : Olfactory receptors"""	14705	protein-coding gene	gene with protein product							Standard	NM_001004725		Approved		uc010rhu.2	Q8NGB4	OTTHUMG00000166578	ENST00000319988.1:c.881A>G	11.37:g.48328655A>G	ENSP00000321447:p.Asn294Ser	Somatic	0	15	0.00		0.7032168817119823	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	6	72.73	Q6IFB4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.N294S	ENST00000319988.1	37	c.881	CCDS31488.1	11	.	.	.	.	.	.	.	.	.	.	A	9.373	1.071053	0.20147	.	.	ENSG00000176555	ENST00000319988	T	0.37584	1.19	5.02	-0.143	0.13444	.	.	.	.	.	T	0.19805	0.0476	N	0.26130	0.795	0.09310	N	1	B	0.19706	0.038	B	0.19946	0.027	T	0.27191	-1.0081	9	0.45353	T	0.12	.	0.1609	0.00103	0.3572:0.1584:0.1777:0.3067	.	294	Q8NGB4	OR4S1_HUMAN	S	294	ENSP00000321447:N294S	ENSP00000321447:N294S	N	+	2	0	OR4S1	48285231	0.000000	0.05858	0.997000	0.53966	0.424000	0.31475	-0.113000	0.10774	0.011000	0.14865	0.533000	0.62120	AAT	-	NULL		0.443	OR4S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4S1	protein_coding	OTTHUMT00000390556.1	A	NM_001004725	-		48328655	+1	no_errors	ENST00000319988	ensembl	human	known	74_37	missense	SNP	0.191	G
C10orf113	387638	genome.wustl.edu	37	10	21414843	21414843	+	Missense_Mutation	SNP	C	C	T			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr10:21414843C>T	ENST00000534331.1	-	2	427	c.377G>A	c.(376-378)gGt>gAt	p.G126D	C10orf113_ENST00000529198.1_3'UTR|C10orf113_ENST00000377118.4_Missense_Mutation_p.G116D|NEBL_ENST00000417816.2_Intron	NM_001010896.2	NP_001010896.2	Q5VZT2	CJ113_HUMAN	chromosome 10 open reading frame 113	126										endometrium(1)|large_intestine(1)|lung(1)|ovary(3)|pancreas(1)	7						TTTGGTTATACCTTCTGGTCC	0.463																																																	0								ENSG00000204683						99.0	98.0	98.0					10																	21414843		2203	4300	6503	C10orf113	SO:0001583	missense	0			-	HGNC		CCDS31162.1, CCDS31162.2, CCDS53496.1	10p12.31	2012-06-12			ENSG00000204683	ENSG00000204683			31447	protein-coding gene	gene with protein product							Standard	NM_001010896		Approved	bA165O3.1	uc001iqm.3	Q5VZT2	OTTHUMG00000017786	ENST00000534331.1:c.377G>A	10.37:g.21414843C>T	ENSP00000433646:p.Gly126Asp	Somatic	0	42	0.00		0.7032168817119823	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	4	83.33	B9EIM9|E9PRX7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.G126D	ENST00000534331.1	37	c.377	CCDS31162.2	10	.	.	.	.	.	.	.	.	.	.	C	14.20	2.465854	0.43839	.	.	ENSG00000204683	ENST00000534331;ENST00000377118	T;T	0.45668	0.89;0.89	4.81	3.91	0.45181	.	.	.	.	.	T	0.26122	0.0637	N	0.08118	0	0.26429	N	0.975973	P	0.46706	0.883	B	0.43413	0.419	T	0.05920	-1.0856	9	0.87932	D	0	-2.0903	8.7064	0.34356	0.0:0.8969:0.0:0.1031	.	126	Q5VZT2	CJ113_HUMAN	D	126;116	ENSP00000433646:G126D;ENSP00000366322:G116D	ENSP00000366322:G116D	G	-	2	0	C10orf113	21454849	0.980000	0.34600	1.000000	0.80357	0.995000	0.86356	1.994000	0.40757	1.243000	0.43853	0.460000	0.39030	GGT	-	NULL		0.463	C10orf113-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C10orf113	protein_coding	OTTHUMT00000047108.3	C	NM_001010896	-		21414843	-1	no_errors	ENST00000534331	ensembl	human	known	74_37	missense	SNP	1.000	T
LCE1F	353137	genome.wustl.edu	37	1	152748991	152748991	+	Silent	SNP	C	C	T	rs573519221	byFrequency	TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr1:152748991C>T	ENST00000334371.2	+	1	144	c.144C>T	c.(142-144)tcC>tcT	p.S48S		NM_178354.2	NP_848131.1	Q5T754	LCE1F_HUMAN	late cornified envelope 1F	48					keratinization (GO:0031424)					kidney(1)|large_intestine(2)|lung(7)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			GCGTCAGCTCCGGAGGCTGCT	0.667													.|||	7	0.00139776	0.0008	0.0	5008	,	,		15152	0.001		0.0	False		,,,				2504	0.0051																0								ENSG00000240386						45.0	47.0	47.0					1																	152748991		2203	4300	6503	LCE1F	SO:0001819	synonymous_variant	0			-	HGNC		CCDS1023.1	1q21.3	2008-02-05			ENSG00000240386	ENSG00000240386		"""Late cornified envelopes"""	29467	protein-coding gene	gene with protein product		612608				11698679	Standard	NM_178354		Approved	LEP6	uc010pdv.2	Q5T754	OTTHUMG00000012403	ENST00000334371.2:c.144C>T	1.37:g.152748991C>T		Somatic	0	85	0.00		0.7032168817119823	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	89	11.00		Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.S48	ENST00000334371.2	37	c.144	CCDS1023.1	1																																																																																			-	NULL		0.667	LCE1F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCE1F	protein_coding	OTTHUMT00000034523.2	C	NM_178354	-		152748991	+1	no_errors	ENST00000334371	ensembl	human	known	74_37	silent	SNP	0.786	T
AC134698.1	0	genome.wustl.edu	37	8	43415867	43415867	+	RNA	SNP	G	G	A			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr8:43415867G>A	ENST00000408368.1	+	0	57																											gtgaccaagcgagttatagag	0.502																																																	0								ENSG00000221295																																			AC134698.1			0			-	Clone_based_ensembl_gene																													8.37:g.43415867G>A		Somatic	0	54	0.00		0.7032168817119823	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	19	53.66		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000408368.1	37	NULL		8																																																																																			-	-		0.502	AC134698.1-201	NOVEL	basic	miRNA	ENSG00000221295	miRNA		G		-		43415867	+1	no_errors	ENST00000408368	ensembl	human	novel	74_37	rna	SNP	0.000	A
FAM98C	147965	genome.wustl.edu	37	19	38899502	38899504	+	In_Frame_Del	DEL	AAG	AAG	-	rs372349446		TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	AAG	AAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr19:38899502_38899504delAAG	ENST00000252530.5	+	8	1049_1051	c.1030_1032delAAG	c.(1030-1032)aagdel	p.K349del	FAM98C_ENST00000343358.7_In_Frame_Del_p.K267del|FAM98C_ENST00000588262.1_3'UTR	NM_174905.3	NP_777565.3	Q17RN3	FA98C_HUMAN	family with sequence similarity 98, member C	349										endometrium(2)|large_intestine(3)|lung(6)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	15	all_cancers(60;3.95e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			TTGGGGTCGCAAGAAGAAGAAGA	0.606																																																	0								ENSG00000130244			414,186,2888		21,2,370,1,182,1168						-2.6	0.1		dbSNP_134	37	186,506,7042		7,0,172,3,500,3185	no	codingComplex	FAM98C	NM_174905.3		28,2,542,4,682,4353	A1A1,A1A2,A1R,A2A2,A2R,RR		8.9475,17.2018,11.5131				600,692,9930				FAM98C	SO:0001651	inframe_deletion	0				HGNC		CCDS42562.1	19q13.2	2008-02-05				ENSG00000130244			27119	protein-coding gene	gene with protein product						12477932	Standard	NM_174905		Approved	FLJ44669	uc002oin.1	Q17RN3		ENST00000252530.5:c.1030_1032delAAG	19.37:g.38899511_38899513delAAG	ENSP00000252530:p.Lys349del	Somatic	0	50	0.00		0.7032168817119823	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	42	10.64	A6NMW3|Q66K45	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Uncharacterised_FAM98	p.K347in_frame_del	ENST00000252530.5	37	c.1030_1032	CCDS42562.1	19																																																																																			-	NULL		0.606	FAM98C-001	KNOWN	basic|CCDS	protein_coding	FAM98C	protein_coding	OTTHUMT00000459222.1	AAG	NM_174905			38899504	+1	no_errors	ENST00000252530	ensembl	human	known	74_37	in_frame_del	DEL	0.830:0.873:0.987	-
BTK	695	genome.wustl.edu	37	X	100608059	100608059	+	Intron	DEL	A	A	-	rs376521920		TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chrX:100608059delA	ENST00000308731.7	-	18	2072				BTK_ENST00000372880.1_Intron	NM_000061.2	NP_000052.1	Q06187	BTK_HUMAN	Bruton agammaglobulinemia tyrosine kinase						adaptive immune response (GO:0002250)|apoptotic signaling pathway (GO:0097190)|B cell activation (GO:0042113)|B cell receptor signaling pathway (GO:0050853)|calcium-mediated signaling (GO:0019722)|cell maturation (GO:0048469)|Fc-epsilon receptor signaling pathway (GO:0038095)|histamine secretion by mast cell (GO:0002553)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of B cell apoptotic process (GO:0002902)|regulation of B cell cytokine production (GO:0002721)|response to organic substance (GO:0010033)|response to reactive oxygen species (GO:0000302)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|mast cell granule (GO:0042629)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein tyrosine kinase activity (GO:0004713)			breast(4)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(25)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	50						gtctcaaattaaaaaaaaaaa	0.418									Agammaglobulinemia, X-linked				|||unknown(HR)	1026	0.271788	0.1611	0.1383	3775	,	,		16549	0.2341		0.167	False		,,,				2504	0.32																0								ENSG00000010671																																			BTK	SO:0001627	intron_variant	0	Familial Cancer Database	Bruton Type Agammaglobulinemia		HGNC	AK057105	CCDS14482.1, CCDS76002.1, CCDS76003.1	Xq21.33-q22	2014-09-17			ENSG00000010671	ENSG00000010671	2.7.10.1	"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	1133	protein-coding gene	gene with protein product		300300		AGMX1, IMD1		8380905	Standard	NM_000061		Approved	ATK, XLA, PSCTK1	uc004ehg.2	Q06187	OTTHUMG00000022022	ENST00000308731.7:c.1908+122T>-	X.37:g.100608059delA		Somatic	0	19	0.00		0.7032168817119823	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	28	17.65	B2RAW1|Q32ML5	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000308731.7	37	NULL	CCDS14482.1	X																																																																																			-	-		0.418	BTK-006	KNOWN	basic|appris_principal|CCDS	protein_coding	BTK	protein_coding	OTTHUMT00000057532.2	A	NM_000061			100608059	-1	no_errors	ENST00000470069	ensembl	human	known	74_37	rna	DEL	0.006	-
SLC26A3	1811	genome.wustl.edu	37	7	107420137	107420137	+	Silent	SNP	C	C	T			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr7:107420137C>T	ENST00000340010.5	-	12	1567	c.1383G>A	c.(1381-1383)ttG>ttA	p.L461L	SLC26A3_ENST00000422236.2_Silent_p.L426L	NM_000111.2	NP_000102.1	P40879	S26A3_HUMAN	solute carrier family 26 (anion exchanger), member 3	461					anion transport (GO:0006820)|cellular response to cAMP (GO:0071320)|excretion (GO:0007588)|intracellular pH elevation (GO:0051454)|ion transport (GO:0006811)|membrane hyperpolarization (GO:0060081)|regulation of RNA biosynthetic process (GO:2001141)|regulation of transcription, DNA-templated (GO:0006355)|sperm capacitation (GO:0048240)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|sperm midpiece (GO:0097225)	anion:anion antiporter activity (GO:0015301)|bicarbonate transmembrane transporter activity (GO:0015106)|chloride transmembrane transporter activity (GO:0015108)|secondary active sulfate transmembrane transporter activity (GO:0008271)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)|transporter activity (GO:0005215)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(18)|ovary(4)|prostate(1)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	46						CCTTTCGCCACAATCTGCCTA	0.368																																																	0								ENSG00000091138						150.0	127.0	135.0					7																	107420137		2203	4300	6503	SLC26A3	SO:0001819	synonymous_variant	0			-	HGNC	L02785	CCDS5748.1	7q31	2014-09-17	2013-07-18		ENSG00000091138	ENSG00000091138		"""Solute carriers"""	3018	protein-coding gene	gene with protein product		126650	"""congenital chloride diarrhea"", ""solute carrier family 26, member 3"""	DRA, CLD		8020951, 11087667	Standard	NM_000111		Approved		uc003ver.2	P40879	OTTHUMG00000154812	ENST00000340010.5:c.1383G>A	7.37:g.107420137C>T		Somatic	0	24	0.00		0.7032168817119823	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	24	14.29		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Sulph_transpt,pfam_STAS_dom,superfamily_STAS_dom,pfscan_STAS_dom,tigrfam_SulP_transpt	p.L461	ENST00000340010.5	37	c.1383	CCDS5748.1	7																																																																																			-	pfam_Sulph_transpt,tigrfam_SulP_transpt		0.368	SLC26A3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC26A3	protein_coding	OTTHUMT00000337190.1	C	NM_000111	-		107420137	-1	no_errors	ENST00000340010	ensembl	human	known	74_37	silent	SNP	0.998	T
PPAP2B	8613	genome.wustl.edu	37	1	56978868	56978869	+	Intron	INS	-	-	A	rs188460333|rs367756101	byFrequency	TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr1:56978868_56978869insA	ENST00000371250.3	-	5	1185				PPAP2B_ENST00000459962.1_5'UTR	NM_003713.4	NP_003704.3	O14495	LPP3_HUMAN	phosphatidic acid phosphatase type 2B						Bergmann glial cell differentiation (GO:0060020)|blood vessel development (GO:0001568)|canonical Wnt signaling pathway involved in positive regulation of cell-cell adhesion (GO:0044329)|canonical Wnt signaling pathway involved in positive regulation of endothelial cell migration (GO:0044328)|canonical Wnt signaling pathway involved in positive regulation of wound healing (GO:0044330)|dephosphorylation (GO:0016311)|gastrulation with mouth forming second (GO:0001702)|germ cell migration (GO:0008354)|homotypic cell-cell adhesion (GO:0034109)|lipid metabolic process (GO:0006629)|negative regulation of protein phosphorylation (GO:0001933)|phospholipid metabolic process (GO:0006644)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein stabilization (GO:0050821)|regulation of sphingolipid mediated signaling pathway (GO:1902068)|regulation of Wnt signaling pathway (GO:0030111)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	adherens junction (GO:0005912)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	lipid phosphatase activity (GO:0042577)|phosphatidate phosphatase activity (GO:0008195)|phosphoprotein phosphatase activity (GO:0004721)|sphingosine-1-phosphate phosphatase activity (GO:0042392)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	17						AATGGAAGATTAAAAAAAAAAC	0.406																																																	0								ENSG00000162407																																			PPAP2B	SO:0001627	intron_variant	0				HGNC	AB000889	CCDS604.1	1p32.2	2009-05-27			ENSG00000162407	ENSG00000162407	3.1.3.4		9229	protein-coding gene	gene with protein product		607125				9305923	Standard	NM_003713		Approved	PAP-2b, LPP3	uc001cyj.2	O14495	OTTHUMG00000008160	ENST00000371250.3:c.634-1044->T	1.37:g.56978878_56978878dupA		Somatic	0	30	0.00		0.7032168817119823	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	20	13.04	B2R651|D3DQ52|Q5U0F7|Q96GW0|Q99782	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000371250.3	37	NULL	CCDS604.1	1																																																																																			-	-		0.406	PPAP2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPAP2B	protein_coding	OTTHUMT00000022334.2	-	NM_003713			56978869	-1	no_errors	ENST00000459962	ensembl	human	putative	74_37	rna	INS	0.000:0.000	A
KCP	375616	genome.wustl.edu	37	7	128520456	128520456	+	RNA	SNP	G	G	A			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr7:128520456G>A	ENST00000476647.2	-	0	3785							Q6ZWJ8	KCP_HUMAN	kielin/chordin-like protein							extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(3)	4						ACACGAGAGCGGTGAGCAGCG	0.657											OREG0018300	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000135253						9.0	13.0	12.0					7																	128520456		686	1583	2269	KCP			0			-	HGNC	AK122706		7q32.3	2009-11-06	2009-02-18	2009-02-18	ENSG00000135253	ENSG00000135253			17585	protein-coding gene	gene with protein product	"""kielin"""	609344	"""cysteine rich BMP regulator 2 (chordin-like)"""	CRIM2		15793581	Standard	NM_001135914		Approved	FLJ33365, NET67	uc011kor.2	Q6ZWJ8	OTTHUMG00000158363		7.37:g.128520456G>A		Somatic	0	55	0.00	1565	0.7032168817119823	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	59	23.38	Q8NBE0	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000476647.2	37	NULL		7																																																																																			-	-		0.657	KCP-006	KNOWN	basic	processed_transcript	KCP	processed_transcript	OTTHUMT00000403051.1	G	NM_199349	-		128520456	-1	no_errors	ENST00000297801	ensembl	human	known	74_37	rna	SNP	0.002	A
PCDH15	65217	genome.wustl.edu	37	10	55591267	55591267	+	Missense_Mutation	SNP	A	A	T			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr10:55591267A>T	ENST00000320301.6	-	30	4404	c.4010T>A	c.(4009-4011)aTc>aAc	p.I1337N	PCDH15_ENST00000361849.3_Missense_Mutation_p.I1337N|PCDH15_ENST00000395433.1_Missense_Mutation_p.I1315N|PCDH15_ENST00000373965.2_Missense_Mutation_p.I1344N|PCDH15_ENST00000463095.1_5'UTR|PCDH15_ENST00000395438.1_Missense_Mutation_p.I1337N|PCDH15_ENST00000395446.1_Intron|PCDH15_ENST00000437009.1_Missense_Mutation_p.I1266N|PCDH15_ENST00000373957.3_Intron|PCDH15_ENST00000395432.2_Missense_Mutation_p.I1300N|PCDH15_ENST00000395430.1_Missense_Mutation_p.I1337N|PCDH15_ENST00000395442.1_Intron|PCDH15_ENST00000409834.1_Missense_Mutation_p.I948N|PCDH15_ENST00000395445.1_Missense_Mutation_p.I1344N|PCDH15_ENST00000414778.1_Missense_Mutation_p.I1342N|PCDH15_ENST00000395440.1_Intron	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	1337					equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)			NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				GTCTTTATTGATATCAAGTAG	0.353										HNSCC(58;0.16)																																							0								ENSG00000150275						78.0	75.0	76.0					10																	55591267		2203	4300	6503	PCDH15	SO:0001583	missense	0			-	HGNC	AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.4010T>A	10.37:g.55591267A>T	ENSP00000322604:p.Ile1337Asn	Somatic	0	42	0.00		0.7032168817119823	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	18	14.29	A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.I1337N	ENST00000320301.6	37	c.4010	CCDS7248.1	10	.	.	.	.	.	.	.	.	.	.	A	24.8	4.574736	0.86542	.	.	ENSG00000150275	ENST00000373965;ENST00000414778;ENST00000455746;ENST00000395438;ENST00000409834;ENST00000395445;ENST00000395432;ENST00000361849;ENST00000395433;ENST00000320301;ENST00000395430;ENST00000417177;ENST00000437009	T;T;T;T;T;T;T;T;T;T;T	0.61510	0.27;0.32;0.24;0.26;0.22;0.13;0.11;0.16;0.11;0.1;0.1	5.76	5.76	0.90799	.	.	.	.	.	T	0.68430	0.3000	L	0.36672	1.1	0.80722	D	1	D;D;D;D;D;D;D;D;D;D;D;D;D	0.89917	0.998;1.0;1.0;0.999;0.999;1.0;0.998;0.997;0.999;0.999;0.999;0.999;1.0	D;D;D;D;D;D;D;D;D;D;D;D;D	0.85130	0.997;0.984;0.984;0.969;0.984;0.984;0.997;0.961;0.979;0.979;0.979;0.979;0.984	T	0.71626	-0.4536	9	0.87932	D	0	.	15.732	0.77814	1.0:0.0:0.0:0.0	.	1315;1337;1337;1342;1266;1300;1337;1337;1344;1344;1337;1342;1337	A2A3E8;E7EMG4;A2A3E7;C9JIG1;E7EM53;E7EMG0;A2A3E6;A2A3E3;C6ZEF5;A2A3E2;C6ZEF7;C9J4F3;Q96QU1	.;.;.;.;.;.;.;.;.;.;.;.;PCD15_HUMAN	N	1344;1342;1337;1337;948;1344;1300;1337;1315;1337;1337;1342;1266	ENSP00000363076:I1344N;ENSP00000410304:I1342N;ENSP00000378826:I1337N;ENSP00000386693:I948N;ENSP00000378832:I1344N;ENSP00000378820:I1300N;ENSP00000354950:I1337N;ENSP00000378821:I1315N;ENSP00000322604:I1337N;ENSP00000378818:I1337N;ENSP00000412628:I1266N	ENSP00000322604:I1337N	I	-	2	0	PCDH15	55261273	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.335000	0.96500	2.191000	0.70037	0.482000	0.46254	ATC	-	NULL		0.353	PCDH15-001	KNOWN	basic|CCDS	protein_coding	PCDH15	protein_coding	OTTHUMT00000048121.2	A	NM_033056	-		55591267	-1	no_errors	ENST00000320301	ensembl	human	known	74_37	missense	SNP	1.000	T
PUS7	54517	genome.wustl.edu	37	7	105142968	105142968	+	Missense_Mutation	SNP	G	G	C			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr7:105142968G>C	ENST00000356362.2	-	5	843	c.629C>G	c.(628-630)gCt>gGt	p.A210G	PUS7_ENST00000469408.1_Missense_Mutation_p.A210G	NM_019042.3	NP_061915.2	Q96PZ0	PUS7_HUMAN	pseudouridylate synthase 7 (putative)	210					pseudouridine synthesis (GO:0001522)|tRNA processing (GO:0008033)		enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|pseudouridine synthase activity (GO:0009982)			breast(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(8)|pancreas(1)|skin(1)	23						AGATTTGATAGCCTGATGGAT	0.398																																					Colon(138;2387 3051 17860)												0								ENSG00000091127						206.0	180.0	189.0					7																	105142968		2203	4300	6503	PUS7	SO:0001583	missense	0			-	HGNC	AK128629	CCDS34725.1	7q22.3	2014-02-14	2014-02-14		ENSG00000091127	ENSG00000091127			26033	protein-coding gene	gene with protein product			"""pseudouridylate synthase 7 homolog (S. cerevisiae)"""			11572484	Standard	NM_019042		Approved	FLJ20485	uc003vcx.3	Q96PZ0	OTTHUMG00000157399	ENST00000356362.2:c.629C>G	7.37:g.105142968G>C	ENSP00000348722:p.Ala210Gly	Somatic	0	80	0.00		0.7032168817119823	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	52	20.00	Q75MG4|Q9NX19	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PsdUridine_synth_TruD,superfamily_PsdUridine_synth_cat_dom,pirsf_PsdUridine_synth_TruD_euk,pfscan_PsdUridine_synth_TruD_insert,tigrfam_PsdUridine_synth_TruD	p.A210G	ENST00000356362.2	37	c.629	CCDS34725.1	7	.	.	.	.	.	.	.	.	.	.	G	21.1	4.098686	0.76870	.	.	ENSG00000091127	ENST00000356362;ENST00000544995;ENST00000469408	T;T	0.49720	0.77;0.77	5.84	5.84	0.93424	Pseudouridine synthase, catalytic domain (1);	0.051008	0.85682	D	0.000000	T	0.47322	0.1439	L	0.59436	1.845	0.80722	D	1	B;B	0.27068	0.086;0.167	B;B	0.23716	0.028;0.048	T	0.32745	-0.9895	10	0.26408	T	0.33	-19.0505	19.1228	0.93371	0.0:0.0:1.0:0.0	.	210;210	B3KY42;Q96PZ0	.;PUS7_HUMAN	G	210	ENSP00000348722:A210G;ENSP00000417402:A210G	ENSP00000348722:A210G	A	-	2	0	PUS7	104930204	1.000000	0.71417	0.995000	0.50966	0.997000	0.91878	7.634000	0.83273	2.765000	0.95021	0.655000	0.94253	GCT	-	superfamily_PsdUridine_synth_cat_dom,pirsf_PsdUridine_synth_TruD_euk		0.398	PUS7-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PUS7	protein_coding	OTTHUMT00000348681.1	G	NM_019042	-		105142968	-1	no_errors	ENST00000356362	ensembl	human	known	74_37	missense	SNP	1.000	C
OGDHL	55753	genome.wustl.edu	37	10	50947867	50947867	+	Missense_Mutation	SNP	G	G	A			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr10:50947867G>A	ENST00000374103.4	-	17	2244	c.2159C>T	c.(2158-2160)gCc>gTc	p.A720V	OGDHL_ENST00000490844.1_5'Flank|OGDHL_ENST00000432695.1_Missense_Mutation_p.A511V|OGDHL_ENST00000419399.1_Missense_Mutation_p.A663V	NM_018245.2	NP_060715.2	Q9ULD0	OGDHL_HUMAN	oxoglutarate dehydrogenase-like	720					glycolytic process (GO:0006096)|tricarboxylic acid cycle (GO:0006099)	mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|oxoglutarate dehydrogenase (succinyl-transferring) activity (GO:0004591)|thiamine pyrophosphate binding (GO:0030976)			central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|lung(30)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(1)	61						GCTGGCCATGGCATAGCCCAG	0.552																																																	0								ENSG00000197444						64.0	58.0	60.0					10																	50947867		2203	4300	6503	OGDHL	SO:0001583	missense	0			-	HGNC	AK001713	CCDS7234.1, CCDS44390.1, CCDS44391.1	10q11.23	2013-09-20			ENSG00000197444	ENSG00000197444			25590	protein-coding gene	gene with protein product						10574462	Standard	NM_018245		Approved	FLJ10851	uc001jie.3	Q9ULD0	OTTHUMG00000018200	ENST00000374103.4:c.2159C>T	10.37:g.50947867G>A	ENSP00000363216:p.Ala720Val	Somatic	0	41	0.00		0.7032168817119823	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	21	12.50	A8K2G1|B4DKG2|B4E193|Q8TAN9|Q9NVA0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DH_E1,pfam_Transketolase-like_Pyr-bd,smart_Transketolase-like_Pyr-bd,pirsf_2oxoglutarate_DH_E1,tigrfam_2oxoglutarate_DH_E1	p.A720V	ENST00000374103.4	37	c.2159	CCDS7234.1	10	.	.	.	.	.	.	.	.	.	.	G	31	5.062219	0.93846	.	.	ENSG00000197444	ENST00000374103;ENST00000419399;ENST00000432695	D;D;D	0.97186	-4.28;-4.28;-4.28	4.61	4.61	0.57282	Transketolase-like, pyrimidine-binding domain (2);	0.057465	0.64402	D	0.000002	D	0.98216	0.9410	M	0.86420	2.815	0.80722	D	1	P;B;P	0.38250	0.57;0.427;0.624	P;B;P	0.51701	0.549;0.197;0.677	D	0.99902	1.1164	10	0.87932	D	0	.	17.4702	0.87643	0.0:0.0:1.0:0.0	.	663;511;720	Q9ULD0-2;Q9ULD0-3;Q9ULD0	.;.;OGDHL_HUMAN	V	720;663;511	ENSP00000363216:A720V;ENSP00000401356:A663V;ENSP00000390240:A511V	ENSP00000363216:A720V	A	-	2	0	OGDHL	50617873	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.859000	0.99545	2.127000	0.65507	0.446000	0.29264	GCC	-	pfam_Transketolase-like_Pyr-bd,smart_Transketolase-like_Pyr-bd,pirsf_2oxoglutarate_DH_E1,tigrfam_2oxoglutarate_DH_E1		0.552	OGDHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OGDHL	protein_coding	OTTHUMT00000048007.1	G	NM_018245	-		50947867	-1	no_errors	ENST00000374103	ensembl	human	known	74_37	missense	SNP	1.000	A
KCNA7	3743	genome.wustl.edu	37	19	49573848	49573848	+	Silent	SNP	T	T	A			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr19:49573848T>A	ENST00000221444.1	-	2	1198	c.843A>T	c.(841-843)cgA>cgT	p.R281R		NM_031886.2	NP_114092.2	Q96RP8	KCNA7_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 7	281					protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(4)|skin(2)	11		all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_epithelial(76;3.83e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		all cancers(93;0.000397)|OV - Ovarian serous cystadenocarcinoma(262;0.000519)|GBM - Glioblastoma multiforme(486;0.00541)|Epithelial(262;0.0441)	Dalfampridine(DB06637)	CACGCACCAATCGGATGACTC	0.632																																					Colon(74;686 1235 3793 23366 48562)												0								ENSG00000104848						86.0	80.0	82.0					19																	49573848		2203	4300	6503	KCNA7	SO:0001819	synonymous_variant	0			-	HGNC	AF315818	CCDS12755.1	19q13.3	2012-07-05				ENSG00000104848		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6226	protein-coding gene	gene with protein product		176268				16382104	Standard	NM_031886		Approved	Kv1.7, HAK6	uc002pmg.3	Q96RP8		ENST00000221444.1:c.843A>T	19.37:g.49573848T>A		Somatic	0	40	0.00		0.7032168817119823	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	8	57.89	A1KYX7|Q9BYS4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_2pore_dom_K_chnl_dom,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv1	p.R281	ENST00000221444.1	37	c.843	CCDS12755.1	19																																																																																			-	pfam_Ion_trans_dom		0.632	KCNA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNA7	protein_coding	OTTHUMT00000466263.1	T	NM_031886	-		49573848	-1	no_errors	ENST00000221444	ensembl	human	known	74_37	silent	SNP	0.729	A
AGBL1	123624	genome.wustl.edu	37	15	86822903	86822903	+	Silent	SNP	C	C	T			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr15:86822903C>T	ENST00000441037.2	+	15	2066	c.1971C>T	c.(1969-1971)ggC>ggT	p.G657G	AGBL1_ENST00000421325.2_Silent_p.G657G|AGBL1_ENST00000389298.3_Silent_p.G388G	NM_152336.2	NP_689549.2	Q96MI9	CBPC4_HUMAN	ATP/GTP binding protein-like 1	657					C-terminal protein deglutamylation (GO:0035609)|protein side chain deglutamylation (GO:0035610)	cytoplasm (GO:0005737)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(3)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|liver(2)|lung(28)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	62						CTGTTGCAGGCGGAGCATCTG	0.512																																																	0								ENSG00000166748						144.0	144.0	144.0					15																	86822903		2073	4215	6288	AGBL1	SO:0001819	synonymous_variant	0			-	HGNC	AK056872	CCDS58398.1	15q25.3	2014-06-23			ENSG00000166748	ENSG00000166748			26504	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 4"""	615496				21074048, 24094747	Standard	NM_152336		Approved	FLJ32310, CCP4	uc002blz.1	Q96MI9	OTTHUMG00000149978	ENST00000441037.2:c.1971C>T	15.37:g.86822903C>T		Somatic	0	46	0.00		0.7032168817119823	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	30	29	50.85	A1A4X5|A6NJH6|C9JHL5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_M14,superfamily_ARM-type_fold	p.G657	ENST00000441037.2	37	c.1971	CCDS58398.1	15																																																																																			-	NULL		0.512	AGBL1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	AGBL1	protein_coding	OTTHUMT00000314929.5	C	NM_152336	-		86822903	+1	no_errors	ENST00000441037	ensembl	human	known	74_37	silent	SNP	0.215	T
HRCT1	646962	genome.wustl.edu	37	9	35906627	35906627	+	Missense_Mutation	SNP	C	C	T			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr9:35906627C>T	ENST00000354323.2	+	1	439	c.343C>T	c.(343-345)Cgc>Tgc	p.R115C	LINC00961_ENST00000443779.1_lincRNA	NM_001039792.1	NP_001034881.1	Q6UXD1	HRCT1_HUMAN	histidine rich carboxyl terminus 1	115						integral component of membrane (GO:0016021)				NS(1)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|prostate(1)	4						ccgccacGCTCGCTGAGGCTG	0.672																																																	0								ENSG00000196196						7.0	9.0	8.0					9																	35906627		1558	3078	4636	HRCT1	SO:0001583	missense	0			-	HGNC		CCDS35012.1	9p13.3	2008-09-30			ENSG00000196196	ENSG00000196196			33872	protein-coding gene	gene with protein product						12975309	Standard	NM_001039792		Approved	LGLL338, PRO537, UNQ338	uc003zyr.1	Q6UXD1	OTTHUMG00000154146	ENST00000354323.2:c.343C>T	9.37:g.35906627C>T	ENSP00000346283:p.Arg115Cys	Somatic	0	35	0.00		0.7032168817119823	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	40	9.09	B7ZBJ1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.R115C	ENST00000354323.2	37	c.343	CCDS35012.1	9	.	.	.	.	.	.	.	.	.	.	C	8.339	0.828175	0.16749	.	.	ENSG00000196196	ENST00000354323	.	.	.	3.29	2.39	0.29439	.	.	.	.	.	T	0.18635	0.0447	N	0.14661	0.345	0.09310	N	1	D	0.67145	0.996	B	0.43783	0.431	T	0.07790	-1.0754	8	0.87932	D	0	-17.2079	6.7921	0.23705	0.0:0.8711:0.0:0.1289	.	115	Q6UXD1	HRCT1_HUMAN	C	115	.	ENSP00000346283:R115C	R	+	1	0	HRCT1	35896627	0.005000	0.15991	0.006000	0.13384	0.215000	0.24574	1.885000	0.39678	0.994000	0.38892	-0.217000	0.12591	CGC	-	NULL		0.672	HRCT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HRCT1	protein_coding	OTTHUMT00000334099.1	C	NM_001039792	-		35906627	+1	no_errors	ENST00000354323	ensembl	human	known	74_37	missense	SNP	0.006	T
U2SURP	23350	genome.wustl.edu	37	3	142720221	142720222	+	5'Flank	INS	-	-	GGACAACGA	rs3832221|rs11282240	byFrequency	TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr3:142720221_142720222insGGACAACGA	ENST00000473835.2	+	0	0				RP11-372E1.6_ENST00000497652.1_RNA|RP11-372E1.6_ENST00000595248.1_RNA|U2SURP_ENST00000397933.2_5'Flank|U2SURP_ENST00000493598.2_5'Flank|RP11-372E1.6_ENST00000595774.1_RNA|RP11-91G21.1_ENST00000597953.1_lincRNA	NM_001080415.1	NP_001073884.1	O15042	SR140_HUMAN	U2 snRNP-associated SURP domain containing						RNA processing (GO:0006396)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	31						CAGCTGGCCCTGATTCTCTGAA	0.515														3604	0.719649	0.8949	0.6988	5008	,	,		19350	0.7212		0.6183	False		,,,				2504	0.6002																0								ENSG00000241570																																			RP11-372E1.6	SO:0001631	upstream_gene_variant	0				Clone_based_vega_gene	BK000564	CCDS46928.1	3q23	2013-02-12			ENSG00000163714	ENSG00000163714		"""RNA binding motif (RRM) containing"""	30855	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein a"", ""Ser/Arg-rich domain protein, 140 kDa"", ""U2 associated SR140 protein"""					9205841, 12234937	Standard	NM_001080415		Approved	fSAPa, SR140	uc003evh.1	O15042	OTTHUMG00000159323		3.37:g.142720221_142720222insGGACAACGA	Exception_encountered	Somatic	NA	NA	NA		0.7032168817119823	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A0PJ60|Q0D2M1|Q2NKQ7|Q9BR70	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000473835.2	37	NULL	CCDS46928.1	3																																																																																			-	-		0.515	U2SURP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC101927832	protein_coding	OTTHUMT00000354603.2	-	NM_001080415			142720222	+1	no_errors	ENST00000595248	ensembl	human	known	74_37	rna	INS	0.005:0.015	GGACAACGA
TTN	7273	genome.wustl.edu	37	2	179442293	179442293	+	Intron	DEL	A	A	-	rs148238009	byFrequency	TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr2:179442293delA	ENST00000591111.1	-	273	64126				TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000589042.1_Intron|TTN_ENST00000342992.6_Intron|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000586452.1_RNA|RP11-171I2.2_ENST00000603521.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000590932.1_RNA|RP11-171I2.5_ENST00000604215.1_RNA|TTN-AS1_ENST00000586707.1_RNA			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AATTTGCTTTAAAAAAAAAAG	0.348													|||unknown(HR)	340	0.0678914	0.0635	0.0634	5008	,	,		20948	0.006		0.1054	False		,,,				2504	0.1022																0								ENSG00000271011		,,,	70,290,3140		1,3,65,18,251,1412	46.0	40.0	42.0		,,,	5.0	0.4	2	dbSNP_134	46	11,929,6856		0,1,10,59,810,3018	no	intron,intron,intron,intron	TTN	NM_133437.3,NM_133432.3,NM_133378.4,NM_003319.4	,,,	1,4,75,77,1061,4430	A1A1,A1A2,A1R,A2A2,A2R,RR		12.0575,10.2857,11.5085	,,,	,,,	179442293	81,1219,9996	1802	4062	5864	RP11-171I2.5	SO:0001627	intron_variant	0				Clone_based_vega_gene	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.63901+35T>-	2.37:g.179442293delA		Somatic	0	23	0.00		0.7032168817119823	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	30	9.09	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000591111.1	37	NULL		2																																																																																			-	-		0.348	TTN-019	PUTATIVE	basic	protein_coding	ENSG00000271011	protein_coding	OTTHUMT00000460310.1	A	NM_133378			179442293	+1	no_errors	ENST00000604215	ensembl	human	known	74_37	rna	DEL	0.038	-
SERPINF1	5176	genome.wustl.edu	37	17	1675236	1675236	+	Silent	SNP	G	G	T			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr17:1675236G>T	ENST00000254722.4	+	5	673	c.510G>T	c.(508-510)acG>acT	p.T170T		NM_002615.5	NP_002606.3	P36955	PEDF_HUMAN	serpin peptidase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 1	170					aging (GO:0007568)|cell proliferation (GO:0008283)|kidney development (GO:0001822)|multicellular organismal development (GO:0007275)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of inflammatory response (GO:0050728)|positive regulation of neurogenesis (GO:0050769)|regulation of proteolysis (GO:0030162)|response to glucocorticoid (GO:0051384)|response to retinoic acid (GO:0032526)|short-term memory (GO:0007614)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(2)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	16						GAGTCCTGACGGGCAACCCTC	0.547																																																	0								ENSG00000132386						68.0	64.0	65.0					17																	1675236		2203	4300	6503	SERPINF1	SO:0001819	synonymous_variant	0			-	HGNC	M76979	CCDS11012.1	17p13.3	2014-02-18	2005-08-18		ENSG00000132386	ENSG00000132386		"""Serine (or cysteine) peptidase inhibitors"""	8824	protein-coding gene	gene with protein product	"""pigment epithelium-derived factor"", ""proliferation-inducing protein 35"""	172860	"""serine (or cysteine) proteinase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 1"""	PEDF		8434014, 24172014	Standard	NM_002615		Approved	EPC-1, PIG35	uc002ftl.3	P36955	OTTHUMG00000090571	ENST00000254722.4:c.510G>T	17.37:g.1675236G>T		Somatic	0	26	0.00		0.7032168817119823	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	14	17.65	F1T092|Q13236|Q2TU83|Q96CT1|Q96R01|Q9BWA4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	p.T170	ENST00000254722.4	37	c.510	CCDS11012.1	17																																																																																			-	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom		0.547	SERPINF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPINF1	protein_coding	OTTHUMT00000207109.4	G	NM_002615	-		1675236	+1	no_errors	ENST00000254722	ensembl	human	known	74_37	silent	SNP	0.007	T
MT1G	4495	genome.wustl.edu	37	16	56701214	56701214	+	Intron	SNP	C	C	A			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr16:56701214C>A	ENST00000379811.3	-	2	169				MT1G_ENST00000569500.1_Intron|MT1G_ENST00000444837.2_Intron|MT1H_ENST00000569155.1_5'Flank|MT1H_ENST00000332374.4_5'Flank|MT1G_ENST00000568675.1_Missense_Mutation_p.G35V			P13640	MT1G_HUMAN	metallothionein 1G						cellular response to cadmium ion (GO:0071276)|cellular response to copper ion (GO:0071280)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|cellular response to zinc ion (GO:0071294)|monocyte activation (GO:0042117)|monocyte differentiation (GO:0030224)|negative regulation of growth (GO:0045926)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	zinc ion binding (GO:0008270)			kidney(2)|large_intestine(1)|lung(2)	5						GGAGATGGCCCCGCACTCACT	0.582																																																	0								ENSG00000125144						45.0	46.0	46.0					16																	56701214		2198	4297	6495	MT1G	SO:0001627	intron_variant	0			-	HGNC	BC020757	CCDS10766.1	16q13	2008-02-05			ENSG00000125144	ENSG00000125144		"""Metallothioneins"""	7399	protein-coding gene	gene with protein product	"""metallothionein 1K"""	156353		MT1		3403543, 6089206	Standard	NM_001301267		Approved	MT1K	uc002eju.1	P13640	OTTHUMG00000133275	ENST00000379811.3:c.97+9G>T	16.37:g.56701214C>A		Somatic	0	72	0.00		0.7032168817119823	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	48	11.11	P80296	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Metalthion_sfam_euk,superfamily_Metalthion_dom	p.G35V	ENST00000379811.3	37	c.104		16																																																																																			-	pfam_Metalthion_sfam_euk		0.582	MT1G-001	KNOWN	basic	protein_coding	MT1G	protein_coding	OTTHUMT00000257054.1	C	NM_005950	-		56701214	-1	no_errors	ENST00000568675	ensembl	human	putative	74_37	missense	SNP	0.029	A
SLAMF8	56833	genome.wustl.edu	37	1	159799923	159799923	+	Missense_Mutation	SNP	T	T	A			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr1:159799923T>A	ENST00000289707.5	+	2	457	c.308T>A	c.(307-309)gTg>gAg	p.V103E	SLAMF8_ENST00000471286.1_3'UTR|SLAMF8_ENST00000368104.4_Intron	NM_020125.2	NP_064510.1	Q9P0V8	SLAF8_HUMAN	SLAM family member 8	103					cellular response to drug (GO:0035690)|defense response to bacterium (GO:0042742)|phagosome acidification (GO:0090383)|regulation of kinase activity (GO:0043549)|regulation of NAD(P)H oxidase activity (GO:0033860)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			endometrium(2)|large_intestine(4)|lung(6)	12	all_hematologic(112;0.0597)					AACTTCTCCGTGTTGATGGTG	0.632																																																	0								ENSG00000158714						47.0	49.0	48.0					1																	159799923		2203	4300	6503	SLAMF8	SO:0001583	missense	0			-	HGNC	AF146761	CCDS1188.1	1q23.1	2013-01-11			ENSG00000158714	ENSG00000158714		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	21391	protein-coding gene	gene with protein product		606620				11313408	Standard	NM_020125		Approved	BLAME, SBBI42, CD353	uc001fue.4	Q9P0V8	OTTHUMG00000035433	ENST00000289707.5:c.308T>A	1.37:g.159799923T>A	ENSP00000289707:p.Val103Glu	Somatic	0	37	0.00		0.7032168817119823	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	24	20.00	Q32MC6|Q5VU15	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfscan_Ig-like_dom	p.V103E	ENST00000289707.5	37	c.308	CCDS1188.1	1	.	.	.	.	.	.	.	.	.	.	T	15.07	2.723624	0.48728	.	.	ENSG00000158714	ENST00000289707	T	0.25579	1.79	4.44	4.44	0.53790	.	0.377503	0.25258	N	0.031972	T	0.12475	0.0303	L	0.32530	0.975	0.80722	D	1	P	0.50943	0.94	P	0.44860	0.462	T	0.02365	-1.1170	10	0.59425	D	0.04	-13.682	10.0044	0.41949	0.0:0.0:0.0:1.0	.	103	Q9P0V8	SLAF8_HUMAN	E	103	ENSP00000289707:V103E	ENSP00000289707:V103E	V	+	2	0	SLAMF8	158066547	0.884000	0.30299	0.797000	0.32132	0.881000	0.50899	2.238000	0.43070	1.861000	0.53984	0.260000	0.18958	GTG	-	NULL		0.632	SLAMF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLAMF8	protein_coding	OTTHUMT00000085983.1	T	NM_020125	-		159799923	+1	no_errors	ENST00000289707	ensembl	human	known	74_37	missense	SNP	0.778	A
LRP3	4037	genome.wustl.edu	37	19	33697152	33697152	+	Silent	SNP	C	C	T			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr19:33697152C>T	ENST00000253193.7	+	5	1678	c.1476C>T	c.(1474-1476)gcC>gcT	p.A492A	CTD-2540B15.13_ENST00000609744.1_RNA	NM_002333.3	NP_002324.2	O75074	LRP3_HUMAN	low density lipoprotein receptor-related protein 3	492					receptor-mediated endocytosis (GO:0006898)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)				breast(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(1)|pancreas(2)	15	Esophageal squamous(110;0.137)					GCCTGGCCGCCGTGCCCCGCA	0.657																																																	0								ENSG00000130881						24.0	23.0	23.0					19																	33697152		2201	4293	6494	LRP3	SO:0001819	synonymous_variant	0			-	HGNC	AB009462	CCDS12430.1	19q13.11	2013-05-30			ENSG00000130881	ENSG00000130881		"""Low density lipoprotein receptors"""	6695	protein-coding gene	gene with protein product		603159				9693042, 7959795	Standard	NM_002333		Approved	LRP-3, hLRp105	uc010edh.3	O75074	OTTHUMG00000180343	ENST00000253193.7:c.1476C>T	19.37:g.33697152C>T		Somatic	0	37	0.00		0.7032168817119823	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.16	B3KQD6|B4DKF2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_LDrepeatLR_classA_rpt,pfam_CUB_dom,superfamily_CUB_dom,superfamily_LDrepeatLR_classA_rpt,smart_CUB_dom,smart_LDrepeatLR_classA_rpt,pfscan_CUB_dom,pfscan_LDrepeatLR_classA_rpt,prints_LDrepeatLR_classA_rpt	p.A492	ENST00000253193.7	37	c.1476	CCDS12430.1	19																																																																																			-	NULL		0.657	LRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP3	protein_coding	OTTHUMT00000450842.4	C		-		33697152	+1	no_errors	ENST00000253193	ensembl	human	known	74_37	silent	SNP	0.004	T
CEL	1056	genome.wustl.edu	37	9	135945997	135945997	+	Missense_Mutation	SNP	C	C	T	rs201677850	byFrequency	TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr9:135945997C>T	ENST00000372080.4	+	10	1461	c.1445C>T	c.(1444-1446)aCa>aTa	p.T482I	CEL_ENST00000351304.7_Intron	NM_001807.3	NP_001798.2	P19835	CEL_HUMAN	carboxyl ester lipase	479					cholesterol catabolic process (GO:0006707)|fatty acid catabolic process (GO:0009062)|intestinal cholesterol absorption (GO:0030299)|intestinal lipid catabolic process (GO:0044258)|lipid digestion (GO:0044241)|lipid metabolic process (GO:0006629)|pancreatic juice secretion (GO:0030157)|protein esterification (GO:0018350)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	acylglycerol lipase activity (GO:0047372)|catalytic activity (GO:0003824)|heparin binding (GO:0008201)|hydrolase activity (GO:0016787)|sterol esterase activity (GO:0004771)|triglyceride lipase activity (GO:0004806)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(9)|pancreas(2)|skin(1)	20				OV - Ovarian serous cystadenocarcinoma(145;1.03e-40)|Epithelial(140;3.58e-37)|GBM - Glioblastoma multiforme(294;0.00164)|READ - Rectum adenocarcinoma(205;0.196)		CAAGACAGGACAGTCTCTAAG	0.607																																																	0								ENSG00000170835						83.0	95.0	91.0					9																	135945997		2003	4163	6166	CEL	SO:0001583	missense	0			-	HGNC	M54994	CCDS43896.1	9q34.3	2013-03-13	2013-03-13		ENSG00000170835	ENSG00000170835	3.1.1.3, 3.1.1.13		1848	protein-coding gene	gene with protein product	"""bile salt-stimulated lipase"""	114840				1676983	Standard	NM_001807		Approved	BSSL, MODY8	uc010naa.2	P19835	OTTHUMG00000020855	ENST00000372080.4:c.1445C>T	9.37:g.135945997C>T	ENSP00000361151:p.Thr482Ile	Somatic	0	42	0.00		0.7032168817119823	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	37	17.78	Q16398|Q5T7U7|Q9UCH1|Q9UP41	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_CarbesteraseB,pfam_AB_hydrolase_3	p.T482I	ENST00000372080.4	37	c.1445	CCDS43896.1	9	.	.	.	.	.	.	.	.	.	.	C	17.46	3.395574	0.62177	.	.	ENSG00000170835	ENST00000372080;ENST00000303626	T	0.67171	-0.25	5.69	5.69	0.88448	Carboxylesterase, type B (1);	0.296062	0.38058	N	0.001840	T	0.57344	0.2047	N	0.13327	0.33	0.80722	D	1	D	0.54397	0.966	P	0.50352	0.638	T	0.55386	-0.8149	10	0.26408	T	0.33	.	13.7707	0.63023	0.1534:0.8466:0.0:0.0	.	479	P19835	CEL_HUMAN	I	482;481	ENSP00000361151:T482I	ENSP00000304021:T481I	T	+	2	0	CEL	134935818	0.940000	0.31905	0.109000	0.21407	0.603000	0.37013	2.046000	0.41260	2.698000	0.92095	0.472000	0.43445	ACA	-	pfam_CarbesteraseB		0.607	CEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEL	protein_coding	OTTHUMT00000054823.1	C		rs201677850		135945997	+1	no_errors	ENST00000372080	ensembl	human	known	74_37	missense	SNP	0.994	T
SP4	6671	genome.wustl.edu	37	7	21470337	21470337	+	Silent	SNP	C	C	T			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr7:21470337C>T	ENST00000222584.3	+	3	1772	c.1554C>T	c.(1552-1554)gcC>gcT	p.A518A		NM_003112.3	NP_003103.2	Q02446	SP4_HUMAN	Sp4 transcription factor	518					regulation of heart contraction (GO:0008016)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(11)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	35						TTGCTGGTGCCCCAATAACTT	0.512																																																	0								ENSG00000105866						103.0	107.0	106.0					7																	21470337		2203	4300	6503	SP4	SO:0001819	synonymous_variant	0			-	HGNC		CCDS5373.1	7p15	2013-01-08			ENSG00000105866	ENSG00000105866		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	11209	protein-coding gene	gene with protein product		600540				1454515	Standard	XM_005249828		Approved	SPR-1, HF1B, MGC130008, MGC130009	uc003sva.3	Q02446	OTTHUMG00000094801	ENST00000222584.3:c.1554C>T	7.37:g.21470337C>T		Somatic	0	25	0.00		0.7032168817119823	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	25	13.79	O60402|Q32M52	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.A518	ENST00000222584.3	37	c.1554	CCDS5373.1	7																																																																																			-	NULL		0.512	SP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SP4	protein_coding	OTTHUMT00000211617.2	C	NM_003112	-		21470337	+1	no_errors	ENST00000222584	ensembl	human	known	74_37	silent	SNP	1.000	T
PPP1R3A	5506	genome.wustl.edu	37	7	113518500	113518500	+	Missense_Mutation	SNP	T	T	A			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr7:113518500T>A	ENST00000284601.3	-	4	2715	c.2647A>T	c.(2647-2649)Agg>Tgg	p.R883W		NM_002711.3	NP_002702.2	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory subunit 3A	883			R -> S (in dbSNP:rs1800000). {ECO:0000269|PubMed:9726244}.		glycogen metabolic process (GO:0005977)	integral component of membrane (GO:0016021)				NS(2)|breast(8)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|liver(1)|lung(43)|ovary(10)|pancreas(7)|prostate(3)|skin(15)|stomach(1)|upper_aerodigestive_tract(2)	121						TGAACCTGCCTAAGATCTCTG	0.368																																																	0								ENSG00000154415						92.0	89.0	90.0					7																	113518500		2203	4299	6502	PPP1R3A	SO:0001583	missense	0			-	HGNC	AF024578	CCDS5759.1	7q31.1	2012-04-17	2011-10-04	2001-07-02	ENSG00000154415	ENSG00000154415	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9291	protein-coding gene	gene with protein product	"""glycogen-associated regulatory subunit of protein phosphatase-1"", ""protein phosphatase 1 regulatory subunit GM"""	600917	"""protein phosphatase 1, regulatory (inhibitor) subunit 3A (glycogen and sarcoplasmic reticulum binding subunit, skeletal muscle)"", ""protein phosphatase 1, regulatory (inhibitor) subunit 3A"""	PPP1R3		7926294	Standard	NM_002711		Approved	GM	uc010ljy.1	Q16821	OTTHUMG00000156944	ENST00000284601.3:c.2647A>T	7.37:g.113518500T>A	ENSP00000284601:p.Arg883Trp	Somatic	0	27	0.00		0.7032168817119823	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	13	53.57	A0AVQ2|A4D0T6|O43476|Q75LN8|Q7KYM8|Q86UI6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_CBM_21,pfscan_CBM_21	p.R883W	ENST00000284601.3	37	c.2647	CCDS5759.1	7	.	.	.	.	.	.	.	.	.	.	T	3.991	-0.004434	0.07773	.	.	ENSG00000154415	ENST00000284601	T	0.16196	2.36	5.81	2.95	0.34219	.	0.934583	0.09032	N	0.858650	T	0.09818	0.0241	N	0.08118	0	0.09310	N	1	P	0.37525	0.598	B	0.36289	0.221	T	0.27123	-1.0083	10	0.62326	D	0.03	1.4488	8.75	0.34609	0.0:0.713:0.0:0.2869	.	883	Q16821	PPR3A_HUMAN	W	883	ENSP00000284601:R883W	ENSP00000284601:R883W	R	-	1	2	PPP1R3A	113305736	0.000000	0.05858	0.001000	0.08648	0.022000	0.10575	0.801000	0.27055	0.788000	0.33755	-0.182000	0.12963	AGG	-	NULL		0.368	PPP1R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R3A	protein_coding	OTTHUMT00000346724.1	T	NM_002711	-		113518500	-1	no_errors	ENST00000284601	ensembl	human	known	74_37	missense	SNP	0.000	A
RSRP1	57035	genome.wustl.edu	37	1	25570199	25570199	+	Intron	SNP	T	T	A			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr1:25570199T>A	ENST00000243189.7	-	4	949				C1orf63_ENST00000417642.2_Intron	NM_020317.3	NP_064713.3	Q9BUV0	RSRP1_HUMAN												breast(1)|large_intestine(1)|lung(4)|pancreas(1)	7		Colorectal(325;3.46e-05)|Lung NSC(340;0.000245)|all_lung(284;0.000335)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0101)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0415)|OV - Ovarian serous cystadenocarcinoma(117;7.9e-27)|Colorectal(126;8.83e-09)|COAD - Colon adenocarcinoma(152;6.43e-07)|STAD - Stomach adenocarcinoma(196;0.000333)|BRCA - Breast invasive adenocarcinoma(304;0.000443)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|GBM - Glioblastoma multiforme(114;0.000932)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		AAAAATAGCCTAATTGTAAAC	0.313																																																	0								ENSG00000117616																																			C1orf63	SO:0001627	intron_variant	0			-	HGNC																												ENST00000243189.7:c.673-75A>T	1.37:g.25570199T>A		Somatic	0	24	0.00		0.7032168817119823	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	21	22.22	A8K917|Q49AA4|Q5TH71|Q9GZP6	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000243189.7	37	NULL	CCDS260.1	1																																																																																			-	-		0.313	C1orf63-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	C1orf63	protein_coding	OTTHUMT00000101966.2	T		-		25570199	-1	no_errors	ENST00000569495	ensembl	human	known	74_37	rna	SNP	0.000	A
CCDC129	223075	genome.wustl.edu	37	7	31683190	31683198	+	In_Frame_Del	DEL	GAATGCACT	GAATGCACT	-			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	GAATGCACT	GAATGCACT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr7:31683190_31683198delGAATGCACT	ENST00000407970.3	+	11	2244_2252	c.2206_2214delGAATGCACT	c.(2206-2214)gaatgcactdel	p.ECT736del	CCDC129_ENST00000319386.3_In_Frame_Del_p.ECT588del|CCDC129_ENST00000409210.1_In_Frame_Del_p.ECT644del|CCDC129_ENST00000451887.2_In_Frame_Del_p.ECT762del	NM_001257967.1|NM_194300.3	NP_001244896.1|NP_919276.2	Q6ZRS4	CC129_HUMAN	coiled-coil domain containing 129	736										cervix(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(31)	44						AACATCTTTAGAATGCACTGTGTGTGATC	0.512																																																	0								ENSG00000180347																																			CCDC129	SO:0001651	inframe_deletion	0				HGNC	AK128026	CCDS5435.2, CCDS59050.1, CCDS75577.1	7p14.3	2006-08-21			ENSG00000180347	ENSG00000180347			27363	protein-coding gene	gene with protein product						14702039	Standard	NM_001257967		Approved	FLJ38344	uc011kad.1	Q6ZRS4	OTTHUMG00000128611	ENST00000407970.3:c.2206_2214delGAATGCACT	7.37:g.31683190_31683198delGAATGCACT	ENSP00000384416:p.Glu736_Thr738del	Somatic	NA	NA	NA		0.7032168817119823	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A2RU17|B3KTI9|B4DHB0|B4E2R1|F5H3V5	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	NULL	p.ECT762in_frame_del	ENST00000407970.3	37	c.2284_2292	CCDS5435.2	7																																																																																			-	NULL		0.512	CCDC129-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	CCDC129	protein_coding	OTTHUMT00000318975.1	GAATGCACT	NM_194300			31683198	+1	no_errors	ENST00000451887	ensembl	human	known	74_37	in_frame_del	DEL	0.004:0.017:0.011:0.008:0.001:0.000:0.018:0.029:0.025	-
MEGF9	1955	genome.wustl.edu	37	9	123476543	123476548	+	In_Frame_Del	DEL	CGGCGG	CGGCGG	-	rs200946879|rs369989873	byFrequency	TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	CGGCGG	CGGCGG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr9:123476543_123476548delCGGCGG	ENST00000373930.3	-	1	200_205	c.89_94delCCGCCG	c.(88-96)gccgccgtc>gtc	p.AA30del	MEGF9_ENST00000426959.1_In_Frame_Del_p.AA22del	NM_001080497.2	NP_001073966.2	Q9H1U4	MEGF9_HUMAN	multiple EGF-like-domains 9	30	Ala-rich.					integral component of membrane (GO:0016021)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(9)|upper_aerodigestive_tract(1)	16						gctgaggcgacggcggcggcggcggc	0.782														3349	0.66873	0.6044	0.7637	5008	,	,		7106	0.5853		0.7058	False		,,,				2504	0.7362																0								ENSG00000106780			26,6		13,0,3						2.8	0.2		dbSNP_119	1	80,32		39,2,15	no	coding	MEGF9	NM_001080497.2		52,2,18	A1A1,A1R,RR		28.5714,18.75,26.3889				106,38				MEGF9	SO:0001651	inframe_deletion	0				HGNC	AB011542	CCDS48010.1, CCDS48010.2	9q32-q33.3	2008-07-21	2006-03-31	2006-03-31	ENSG00000106780	ENSG00000106780			3234	protein-coding gene	gene with protein product		604268	"""EGF-like-domain, multiple 5"""	EGFL5		9693030	Standard	NM_001080497		Approved		uc022bms.1	Q9H1U4	OTTHUMG00000021039	ENST00000373930.3:c.89_94delCCGCCG	9.37:g.123476549_123476554delCGGCGG	ENSP00000363040:p.Ala30_Ala31del	Somatic	NA	NA	NA		0.7032168817119823	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B7Z315|O75098	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_EGF_laminin,smart_EGF_laminin,smart_EG-like_dom,pfscan_EGF_laminin	p.AA22in_frame_del	ENST00000373930.3	37	c.70_65	CCDS48010.2	9																																																																																			-	NULL		0.782	MEGF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MEGF9	protein_coding	OTTHUMT00000055513.1	CGGCGG	NM_001080497			123476548	-1	no_errors	ENST00000426959	ensembl	human	known	74_37	in_frame_del	DEL	0.255:0.243:0.247:0.263:0.993:0.998	-
INPPL1	3636	genome.wustl.edu	37	11	71943350	71943350	+	Missense_Mutation	SNP	A	A	T			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr11:71943350A>T	ENST00000298229.2	+	14	1886	c.1682A>T	c.(1681-1683)cAc>cTc	p.H561L	INPPL1_ENST00000538751.1_Missense_Mutation_p.H319L|INPPL1_ENST00000541756.1_Missense_Mutation_p.H319L	NM_001567.3	NP_001558.3	O15357	SHIP2_HUMAN	inositol polyphosphate phosphatase-like 1	561					actin filament organization (GO:0007015)|cell adhesion (GO:0007155)|endochondral ossification (GO:0001958)|endocytosis (GO:0006897)|glucose metabolic process (GO:0006006)|immune system process (GO:0002376)|inositol phosphate metabolic process (GO:0043647)|negative regulation of cell proliferation (GO:0008285)|negative regulation of gene expression (GO:0010629)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|post-embryonic development (GO:0009791)|response to insulin (GO:0032868)|ruffle assembly (GO:0097178)|small molecule metabolic process (GO:0044281)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	hydrolase activity (GO:0016787)|SH2 domain binding (GO:0042169)			breast(2)|endometrium(9)|kidney(1)|large_intestine(7)|lung(12)|ovary(1)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	44						GTGAATTGTCACCTCACCTCG	0.557																																																	0								ENSG00000165458						88.0	75.0	79.0					11																	71943350		2177	4257	6434	INPPL1	SO:0001583	missense	0			-	HGNC	Y14385	CCDS8213.1	11q23	2013-02-14			ENSG00000165458	ENSG00000165458		"""Sterile alpha motif (SAM) domain containing"", ""SH2 domain containing"""	6080	protein-coding gene	gene with protein product	"""51C protein"""	600829				8530088	Standard	NM_001567		Approved	SHIP2	uc001osf.3	O15357	OTTHUMG00000167879	ENST00000298229.2:c.1682A>T	11.37:g.71943350A>T	ENSP00000298229:p.His561Leu	Somatic	0	31	0.00		0.7032168817119823	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	3	86.36	B2RTX5|Q13577|Q13578	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Endo/exonuclease/phosphatase,pfam_SH2,pfam_SAM_2,pfam_SAM_type1,superfamily_Endo/exonuclease/phosphatase,superfamily_SAM/pointed,smart_SH2,smart_IPPc,smart_SAM,pfscan_SAM,pfscan_SH2,prints_SH2	p.H561L	ENST00000298229.2	37	c.1682	CCDS8213.1	11	.	.	.	.	.	.	.	.	.	.	a	28.9	4.956624	0.92726	.	.	ENSG00000165458	ENST00000298229;ENST00000541756;ENST00000538751	D;D;D	0.99042	-5.36;-5.36;-5.36	5.3	5.3	0.74995	Endonuclease/exonuclease/phosphatase (2);Inositol polyphosphate-related phosphatase (1);	0.057088	0.64402	D	0.000001	D	0.99566	0.9844	H	0.98525	4.255	0.58432	D	0.999999	D	0.89917	1.0	D	0.74348	0.983	D	0.97823	1.0258	10	0.87932	D	0	.	13.4861	0.61366	1.0:0.0:0.0:0.0	.	561	O15357	SHIP2_HUMAN	L	561;319;319	ENSP00000298229:H561L;ENSP00000446360:H319L;ENSP00000444619:H319L	ENSP00000298229:H561L	H	+	2	0	INPPL1	71620998	1.000000	0.71417	0.997000	0.53966	0.892000	0.51952	7.021000	0.76425	2.126000	0.65437	0.533000	0.62120	CAC	-	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase,smart_IPPc		0.557	INPPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INPPL1	protein_coding	OTTHUMT00000396789.1	A	NM_001567	-		71943350	+1	no_errors	ENST00000298229	ensembl	human	known	74_37	missense	SNP	1.000	T
CCDC168	643677	genome.wustl.edu	37	13	103386924	103386924	+	Frame_Shift_Del	DEL	T	T	-	rs61389599		TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr13:103386924delT	ENST00000322527.2	-	1	2235	c.2236delA	c.(2236-2238)atafs	p.I747fs		NM_001146197.1	NP_001139669.1	Q8NDH2	CC168_HUMAN	coiled-coil domain containing 168	747																	ATATCGATTATTTTTTTTTGG	0.398																																																	0								ENSG00000175820						276.0	197.0	221.0					13																	103386924		692	1591	2283	CCDC168	SO:0001589	frameshift_variant	0				HGNC		CCDS73596.1	13q33.1	2014-06-17	2011-08-09	2011-08-09	ENSG00000175820	ENSG00000175820			26851	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 40"""	C13orf40			Standard	NM_001146197		Approved	FLJ40176	uc001vpm.3	Q8NDH2	OTTHUMG00000187287	ENST00000322527.2:c.2236delA	13.37:g.103386924delT	ENSP00000320232:p.Ile747fs	Somatic	0	35	0.00		0.7032168817119823	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	11	15.38	Q8N800	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	NULL	p.I746fs	ENST00000322527.2	37	c.2236		13																																																																																			-	NULL		0.398	CCDC168-201	KNOWN	basic|appris_principal	protein_coding	CCDC168	protein_coding		T	NM_001146197			103386924	-1	no_errors	ENST00000322527	ensembl	human	known	74_37	frame_shift_del	DEL	0.005	-
GPR133	283383	genome.wustl.edu	37	12	131439034	131439034	+	Silent	SNP	C	C	T			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr12:131439034C>T	ENST00000261654.5	+	1	583	c.24C>T	c.(22-24)tgC>tgT	p.C8C	GPR133_ENST00000535015.1_Silent_p.C8C	NM_198827.3	NP_942122.2	Q6QNK2	GP133_HUMAN	G protein-coupled receptor 133	8					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(2)|endometrium(6)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|pancreas(6)|prostate(6)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(4)	67	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.68e-06)|all cancers(50;2.71e-06)|Epithelial(86;6.75e-06)		TGCGGCTGTGCTGCTGGTACT	0.537																																																	0								ENSG00000111452						69.0	68.0	68.0					12																	131439034		2203	4300	6503	GPR133	SO:0001819	synonymous_variant	0			-	HGNC	AY278561	CCDS9272.1	12q24.33	2014-08-08			ENSG00000111452	ENSG00000111452		"""-"", ""GPCR / Class B : Orphans"""	19893	protein-coding gene	gene with protein product		613639					Standard	NM_198827		Approved	DKFZp434B1272, PGR25	uc001uit.4	Q6QNK2	OTTHUMG00000168339	ENST00000261654.5:c.24C>T	12.37:g.131439034C>T		Somatic	0	57	0.00		0.7032168817119823	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	28	12.50	B2CKK9|B7ZLF7|Q2M1L3|Q6ZMQ1|Q7Z7M2|Q86SM4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_2_secretin-like,pfam_GPS_dom,superfamily_ConA-like_lec_gl_sf,smart_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	p.C8	ENST00000261654.5	37	c.24	CCDS9272.1	12																																																																																			-	NULL		0.537	GPR133-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR133	protein_coding	OTTHUMT00000399356.1	C	NM_198827	-		131439034	+1	no_errors	ENST00000261654	ensembl	human	known	74_37	silent	SNP	0.004	T
PTEN	5728	genome.wustl.edu	37	10	89720855	89720859	+	Frame_Shift_Del	DEL	TACTT	TACTT	-			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	TACTT	TACTT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr10:89720855_89720859delTACTT	ENST00000371953.3	+	8	2363_2367	c.1006_1010delTACTT	c.(1006-1011)tactttfs	p.YF336fs	PTEN_ENST00000472832.1_3'UTR	NM_000314.4	NP_000305.3	P60484	PTEN_HUMAN	phosphatase and tensin homolog	336	C2 tensin-type. {ECO:0000255|PROSITE- ProRule:PRU00589}.				activation of mitotic anaphase-promoting complex activity (GO:0007092)|aging (GO:0007568)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|brain morphogenesis (GO:0048854)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle tissue development (GO:0048738)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system development (GO:0007417)|central nervous system myelin maintenance (GO:0032286)|central nervous system neuron axonogenesis (GO:0021955)|dendritic spine morphogenesis (GO:0060997)|dentate gyrus development (GO:0021542)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|innate immune response (GO:0045087)|inositol phosphate dephosphorylation (GO:0046855)|inositol phosphate metabolic process (GO:0043647)|learning or memory (GO:0007611)|locomotor rhythm (GO:0045475)|locomotory behavior (GO:0007626)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|male mating behavior (GO:0060179)|maternal behavior (GO:0042711)|memory (GO:0007613)|multicellular organismal response to stress (GO:0033555)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell aging (GO:0090344)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031658)|negative regulation of dendritic spine morphogenesis (GO:0061002)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of myelination (GO:0031642)|negative regulation of organ growth (GO:0046621)|negative regulation of phagocytosis (GO:0050765)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of ribosome biogenesis (GO:0090071)|negative regulation of synaptic vesicle clustering (GO:2000808)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell proliferation (GO:0008284)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|postsynaptic density assembly (GO:0097107)|prepulse inhibition (GO:0060134)|presynaptic membrane assembly (GO:0097105)|prostate gland growth (GO:0060736)|protein dephosphorylation (GO:0006470)|protein kinase B signaling (GO:0043491)|protein stabilization (GO:0050821)|regulation of B cell apoptotic process (GO:0002902)|regulation of cellular component size (GO:0032535)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of myeloid cell apoptotic process (GO:0033032)|regulation of neuron projection development (GO:0010975)|regulation of protein stability (GO:0031647)|response to arsenic-containing substance (GO:0046685)|response to ATP (GO:0033198)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse maturation (GO:0060074)|T cell receptor signaling pathway (GO:0050852)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|myelin sheath adaxonal region (GO:0035749)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)	anaphase-promoting complex binding (GO:0010997)|enzyme binding (GO:0019899)|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity (GO:0051717)|lipid binding (GO:0008289)|magnesium ion binding (GO:0000287)|PDZ domain binding (GO:0030165)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity (GO:0051800)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.0?(37)|p.R55fs*1(5)|p.Y336*(5)|p.?(2)|p.N212fs*1(2)|p.Y27fs*1(2)|p.F337fs*7(2)|p.R335fs*8(1)|p.G165_*404del(1)|p.F337fs*6(1)|p.R335fs*4(1)|p.R335fs*7(1)|p.W274_F341del(1)|p.Y336F(1)|p.D326_K342del(1)		NS(28)|autonomic_ganglia(2)|biliary_tract(6)|bone(5)|breast(92)|central_nervous_system(676)|cervix(26)|endometrium(1068)|eye(8)|haematopoietic_and_lymphoid_tissue(137)|kidney(24)|large_intestine(98)|liver(20)|lung(91)|meninges(2)|oesophagus(2)|ovary(82)|pancreas(6)|prostate(129)|salivary_gland(5)|skin(127)|soft_tissue(19)|stomach(30)|testis(1)|thyroid(29)|upper_aerodigestive_tract(29)|urinary_tract(12)|vulva(17)	2771		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		AGCCAACCGATACTTTTCTCCAAAT	0.337		31	"""D, Mis, N, F, S"""		"""glioma,  prostate, endometrial"""	"""harmartoma, glioma,  prostate, endometrial"""			Proteus syndrome;Juvenile Polyposis;Hereditary Mixed Polyposis Syndrome type 1;Cowden syndrome;Bannayan-Riley-Ruvalcaba syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)																													yes	Rec	yes	"""Cowden Syndrome, Bannayan-Riley-Ruvalcaba syndrome"""	10	10q23.3	5728	phosphatase and tensin homolog gene		"""L, E, M, O"""	63	Whole gene deletion(37)|Deletion - Frameshift(14)|Substitution - Nonsense(5)|Deletion - In frame(3)|Unknown(2)|Insertion - Frameshift(1)|Substitution - Missense(1)	central_nervous_system(17)|prostate(17)|endometrium(6)|skin(6)|lung(4)|haematopoietic_and_lymphoid_tissue(3)|breast(3)|ovary(3)|urinary_tract(2)|soft_tissue(1)|kidney(1)	GRCh37	CI983205|CM074470	PTEN	I|M		ENSG00000171862																																			PTEN	SO:0001589	frameshift_variant	0	Familial Cancer Database	Incl.: Encephalocraniocutaneous Lipomatosis, ECCL, Proteus-like s.;incl.: Juvenile Polyposis of the Stomach;HMPS1, Colorectal Adenoma Carcinoma syndrome, CRAC, CRAC1;CS, Cowden disease, Multiple Hamartoma Syndrome, incl.: Lhermitte-Duclos; part of PTEN hamartoma tumour syndrome (PHTS) / PTEN-MATCHS, Cowden-like syndrome;subset of PTEN-Hamartoma Tumor Syndrome; incl.: Ruvalcaba-Myhre-Smith s.		HGNC	U92436	CCDS31238.1	10q23	2014-09-17	2008-07-31		ENSG00000171862	ENSG00000171862		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	9588	protein-coding gene	gene with protein product	"""mutated in multiple advanced cancers 1"""	601728		BZS, MHAM		9090379	Standard	NM_000314		Approved	MMAC1, TEP1, PTEN1	uc001kfb.3	P60484	OTTHUMG00000018688	ENST00000371953.3:c.1006_1010delTACTT	10.37:g.89720855_89720859delTACTT	ENSP00000361021:p.Tyr336fs	Somatic	NA	NA	NA		0.7032168817119823	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B2R904|F2YHV0|O00633|O02679|Q6ICT7	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Tensin_phosphatase_C2-dom,pfam_Dual-sp_phosphatase_cat-dom,pfam_Tyr_Pase_rcpt/non-rcpt,superfamily_C2_dom,smart_Tyr_Pase_cat,pirsf_Bifunc_PIno_P3_Pase/Pase_PTEN,pfscan_Tyr/Dual-sp_Pase,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom	p.Y336fs	ENST00000371953.3	37	c.1006_1010	CCDS31238.1	10																																																																																			-	pfam_Tensin_phosphatase_C2-dom,superfamily_C2_dom,pirsf_Bifunc_PIno_P3_Pase/Pase_PTEN,pfscan_Tensin_phosphatase_C2-dom		0.337	PTEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTEN	protein_coding	OTTHUMT00000049241.1	TACTT	NM_000314			89720859	+1	no_errors	ENST00000371953	ensembl	human	known	74_37	frame_shift_del	DEL	1.000:1.000:0.996:1.000:1.000	-
CYLD	1540	genome.wustl.edu	37	16	50785608	50785608	+	Missense_Mutation	SNP	G	G	T			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr16:50785608G>T	ENST00000427738.3	+	3	803	c.598G>T	c.(598-600)Gac>Tac	p.D200Y	CYLD_ENST00000566206.1_Missense_Mutation_p.D200Y|CYLD_ENST00000569418.1_Missense_Mutation_p.D200Y|CYLD_ENST00000568704.2_Missense_Mutation_p.D200Y|CYLD_ENST00000398568.2_Missense_Mutation_p.D200Y|CYLD_ENST00000540145.1_Missense_Mutation_p.D200Y|CYLD_ENST00000311559.9_Missense_Mutation_p.D200Y|CYLD_ENST00000564326.1_Missense_Mutation_p.D200Y			Q9NQC7	CYLD_HUMAN	cylindromatosis (turban tumor syndrome)	200	Interaction with TRIP.				cell cycle (GO:0007049)|innate immune response (GO:0045087)|necroptotic process (GO:0070266)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|protein K63-linked deubiquitination (GO:0070536)|regulation of intrinsic apoptotic signaling pathway (GO:2001242)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of mitotic cell cycle (GO:0007346)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)	centrosome (GO:0005813)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|microtubule (GO:0005874)|nucleus (GO:0005634)	Lys63-specific deubiquitinase activity (GO:0061578)|proline-rich region binding (GO:0070064)|protein kinase binding (GO:0019901)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			central_nervous_system(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(9)|lung(17)|pancreas(1)|skin(22)|upper_aerodigestive_tract(1)	62		all_cancers(37;0.0156)				TGTTGCATTGGACAAGCTAGA	0.453			"""Mis, N, F, S"""		cylindroma	cylindroma			Multiple Trichoepithelioma, Familial;Familial Cylindromatosis																														yes	Rec	yes	Familial cylindromatosis	16	16q12-q13	1540	familial cylindromatosis gene		E	0								ENSG00000083799						174.0	168.0	170.0					16																	50785608		2000	4174	6174	CYLD	SO:0001583	missense	0	Familial Cancer Database	;FADC, Turban Tumor syndrome, Epithelioma Adenoides Cysticum of Brooke, Hereditary Multiple Benign Cystic Epithelioma, Dermal Eccrine Cylindromatosis, Brooke-Spiegler s.	-	HGNC	AB020656	CCDS42164.1, CCDS45482.1	16q12-q13	2014-09-17							2584	protein-coding gene	gene with protein product	"""ubiquitin specific peptidase like 2"""	605018		CYLD1		7493027	Standard	NM_015247		Approved	KIAA0849, USPL2	uc002egq.1	Q9NQC7		ENST00000427738.3:c.598G>T	16.37:g.50785608G>T	ENSP00000392025:p.Asp200Tyr	Somatic	0	40	0.00		0.7032168817119823	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	16	15.00	O94934|Q7L3N6|Q96EH0|Q9NZX9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_CAP-Gly_domain,pfam_Peptidase_C19/C67,superfamily_CAP-Gly_domain,pfscan_CAP-Gly_domain,pfscan_Peptidase_C19/C67	p.D200Y	ENST00000427738.3	37	c.598	CCDS45482.1	16	.	.	.	.	.	.	.	.	.	.	G	27.3	4.818556	0.90790	.	.	ENSG00000083799	ENST00000540145;ENST00000311559;ENST00000427738;ENST00000398568	T;T;T;T	0.75367	-0.93;-0.93;-0.93;-0.93	6.07	6.07	0.98685	Cytoskeleton-associated protein, Gly-rich domain (3);	0.000000	0.85682	D	0.000000	D	0.85839	0.5790	M	0.64170	1.965	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	D	0.84915	0.0850	10	0.59425	D	0.04	-28.3111	20.6593	0.99626	0.0:0.0:1.0:0.0	.	200;200;200;200	A8KAB0;F5H2R7;Q9NQC7-2;Q9NQC7	.;.;.;CYLD_HUMAN	Y	200	ENSP00000445447:D200Y;ENSP00000308928:D200Y;ENSP00000392025:D200Y;ENSP00000381574:D200Y	ENSP00000308928:D200Y	D	+	1	0	CYLD	49343109	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.414000	0.97362	2.885000	0.99019	0.655000	0.94253	GAC	-	pfam_CAP-Gly_domain,superfamily_CAP-Gly_domain		0.453	CYLD-010	KNOWN	basic|CCDS	protein_coding	CYLD	protein_coding	OTTHUMT00000422998.2	G		-		50785608	+1	no_errors	ENST00000311559	ensembl	human	known	74_37	missense	SNP	1.000	T
ARPC1B	10095	genome.wustl.edu	37	7	98984121	98984121	+	Intron	SNP	C	C	T			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr7:98984121C>T	ENST00000451682.1	+	5	373				ARPC1B_ENST00000474880.1_Intron|ARPC1A_ENST00000432884.2_Intron|ARPC1B_ENST00000252725.5_Intron			O15143	ARC1B_HUMAN	actin related protein 2/3 complex, subunit 1B, 41kDa						Arp2/3 complex-mediated actin nucleation (GO:0034314)|cellular component movement (GO:0006928)	actin cytoskeleton (GO:0015629)|Arp2/3 protein complex (GO:0005885)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)	structural constituent of cytoskeleton (GO:0005200)			central_nervous_system(1)|endometrium(2)|large_intestine(5)|liver(2)|lung(1)	11	all_cancers(62;3.49e-09)|all_epithelial(64;2.57e-10)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		STAD - Stomach adenocarcinoma(171;0.215)			TAAAGGACAGCCAGTTCCAGG	0.602																																																	0								ENSG00000130429																																			ARPC1B	SO:0001627	intron_variant	0			-	HGNC	AF006084	CCDS5661.1	7q22.1	2013-03-14	2002-08-29		ENSG00000130429	ENSG00000130429		"""Actin related protein 2/3 complex subunits"", ""WD repeat domain containing"""	704	protein-coding gene	gene with protein product	"""ARP2/3 protein complex subunit p41"", ""actin related protein 2/3 complex, subunit 1A (41 kD)"""	604223	"""actin related protein 2/3 complex, subunit 1B (41 kD)"""			9230079, 9359840	Standard	NM_005720		Approved	ARC41, p40-ARC, p41-ARC	uc003upz.3	O15143	OTTHUMG00000154552	ENST00000451682.1:c.65-187C>T	7.37:g.98984121C>T		Somatic	0	54	0.00		0.7032168817119823	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00	Q9BU00	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.P24S	ENST00000451682.1	37	c.70	CCDS5661.1	7																																																																																			-	NULL		0.602	ARPC1B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ARPC1B	protein_coding	OTTHUMT00000335894.1	C	NM_005720	-		98984121	+1	no_errors	ENST00000445924	ensembl	human	known	74_37	missense	SNP	0.000	T
LPPR1	54886	genome.wustl.edu	37	9	104086318	104086318	+	Silent	SNP	G	G	A	rs371737348		TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr9:104086318G>A	ENST00000374874.3	+	8	1396	c.957G>A	c.(955-957)gcG>gcA	p.A319A	SNORA31_ENST00000517232.1_RNA|LPPR1_ENST00000395056.2_Silent_p.A319A	NM_207299.1	NP_997182.1	Q8TBJ4	LPPR1_HUMAN		319					nervous system development (GO:0007399)	integral component of membrane (GO:0016021)	catalytic activity (GO:0003824)										ATCACTCTGCGTCCATGACCG	0.413																																																	0								ENSG00000148123	G	,	1,4405	2.1+/-5.4	0,1,2202	163.0	126.0	138.0		957,957	3.3	1.0	9		138	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	LPPR1	NM_017753.2,NM_207299.1	,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,	319/326,319/326	104086318	1,13005	2203	4300	6503	LPPR1	SO:0001819	synonymous_variant	0			-	Uniprot_gn																												ENST00000374874.3:c.957G>A	9.37:g.104086318G>A		Somatic	0	32	0.00		0.7032168817119823	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	45	18.18	Q5VX23|Q9NXE2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_P_Acid_Pase_2/haloperoxidase,superfamily_P_Acid_Pase_2/haloperoxidase,smart_P_Acid_Pase_2/haloperoxidase	p.A319	ENST00000374874.3	37	c.957	CCDS6751.1	9																																																																																			-	NULL		0.413	LPPR1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LPPR1	protein_coding	OTTHUMT00000053425.1	G		-		104086318	+1	no_errors	ENST00000374874	ensembl	human	known	74_37	silent	SNP	1.000	A
CNGB3	54714	genome.wustl.edu	37	8	87679208	87679208	+	Missense_Mutation	SNP	T	T	C			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr8:87679208T>C	ENST00000320005.5	-	6	844	c.797A>G	c.(796-798)tAt>tGt	p.Y266C		NM_019098.4	NP_061971.3	Q9NQW8	CNGB3_HUMAN	cyclic nucleotide gated channel beta 3	266					cation transport (GO:0006812)|phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment (GO:0001750)|transmembrane transporter complex (GO:1902495)	cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(2)|endometrium(4)|kidney(6)|large_intestine(15)|lung(44)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	80						TAGCATATCATAAAGGTAGAT	0.423																																																	0								ENSG00000170289						111.0	101.0	104.0					8																	87679208		2203	4300	6503	CNGB3	SO:0001583	missense	0			-	HGNC	AF228520	CCDS6244.1	8q21.3	2013-01-23	2003-06-25		ENSG00000170289	ENSG00000170289		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2153	protein-coding gene	gene with protein product		605080	"""achromatopsia (rod monochromacy) 3"", ""achromatopsia (rod monochromacy) 1"""	ACHM3, ACHM1, RMCH		10888875, 10958649, 16382102	Standard	NM_019098		Approved		uc003ydx.3	Q9NQW8	OTTHUMG00000163738	ENST00000320005.5:c.797A>G	8.37:g.87679208T>C	ENSP00000316605:p.Tyr266Cys	Somatic	0	32	0.00		0.7032168817119823	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	14	54.84	C9JA51|Q9NRE9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom	p.Y266C	ENST00000320005.5	37	c.797	CCDS6244.1	8	.	.	.	.	.	.	.	.	.	.	T	0.439	-0.899597	0.02472	.	.	ENSG00000170289	ENST00000320005	D	0.97378	-4.36	5.55	1.63	0.23807	.	0.621291	0.16792	N	0.199358	D	0.83774	0.5327	N	0.00583	-1.355	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.77752	-0.2470	10	0.27082	T	0.32	.	2.4143	0.04432	0.2804:0.4527:0.1227:0.1443	.	266;266	Q9NQW8-2;Q9NQW8	.;CNGB3_HUMAN	C	266	ENSP00000316605:Y266C	ENSP00000316605:Y266C	Y	-	2	0	CNGB3	87748324	0.011000	0.17503	0.611000	0.29010	0.134000	0.20937	1.810000	0.38932	0.012000	0.14892	-0.242000	0.12053	TAT	-	NULL		0.423	CNGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNGB3	protein_coding	OTTHUMT00000375107.1	T	NM_019098	-		87679208	-1	no_errors	ENST00000320005	ensembl	human	known	74_37	missense	SNP	0.003	C
AP001623.1	0	genome.wustl.edu	37	21	43720386	43720387	+	RNA	DEL	GT	GT	-	rs142198765		TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	GT	GT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr21:43720386_43720387delGT	ENST00000401378.1	-	0	68_69																											ACAGGGGCTGgtgtgtgtgtgt	0.55																																																	0								ENSG00000216197			117,2837		8,101,1368						-0.2	0.0		dbSNP_134	70	210,4996		37,136,2430	no	intergenic				45,237,3798	A1A1,A1R,RR		4.0338,3.9607,4.0074				327,7833				AP001623.1			0				Clone_based_ensembl_gene																													21.37:g.43720396_43720397delGT		Somatic	0	35	0.00		0.7032168817119823	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	25	10.71		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000401378.1	37	NULL		21																																																																																			-	-		0.550	AP001623.1-201	NOVEL	basic	miRNA	ENSG00000216197	miRNA		GT				43720387	-1	no_errors	ENST00000401378	ensembl	human	novel	74_37	rna	DEL	0.001:0.000	-
TRIM26	7726	genome.wustl.edu	37	6	30154038	30154038	+	Missense_Mutation	SNP	G	G	A			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr6:30154038G>A	ENST00000454678.2	-	10	1671	c.1235C>T	c.(1234-1236)aCg>aTg	p.T412M	TRIM26_ENST00000437089.1_Missense_Mutation_p.T412M|TRIM26_ENST00000453195.1_Missense_Mutation_p.T412M	NM_003449.4	NP_003440.1	Q12899	TRI26_HUMAN	tripartite motif containing 26	412	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				innate immune response (GO:0045087)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral release from host cell (GO:1902187)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)	cytoplasm (GO:0005737)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|zinc ion binding (GO:0008270)			lung(1)|ovary(2)	3						ATCTTCGTCCGTTTCCCAGTC	0.552																																																	0								ENSG00000234127						135.0	73.0	96.0					6																	30154038		1511	2709	4220	TRIM26	SO:0001583	missense	0			-	HGNC	AB088090	CCDS4678.1	6p21.3	2013-01-09	2011-01-25	2001-11-23	ENSG00000234127	ENSG00000234127		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	12962	protein-coding gene	gene with protein product		600830	"""tripartite motif-containing 26"""	ZNF173		8530076	Standard	NM_003449		Approved	RNF95	uc003npt.3	Q12899	OTTHUMG00000031041	ENST00000454678.2:c.1235C>T	6.37:g.30154038G>A	ENSP00000410446:p.Thr412Met	Somatic	0	36	0.00		0.7032168817119823	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	4	86.21	A6NG96|Q5SRL2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl_sf,smart_Znf_RING,smart_Znf_B-box,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.T412M	ENST00000454678.2	37	c.1235	CCDS4678.1	6	.	.	.	.	.	.	.	.	.	.	G	5.120	0.207719	0.09704	.	.	ENSG00000234127	ENST00000453195;ENST00000454678;ENST00000437089	T;T;T	0.63096	-0.02;-0.02;-0.02	5.1	4.23	0.50019	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.000000	0.47455	D	0.000223	T	0.33089	0.0851	N	0.22421	0.69	0.09310	N	1	P;P	0.50443	0.935;0.813	P;B	0.45276	0.475;0.214	T	0.13019	-1.0525	10	0.56958	D	0.05	.	9.3508	0.38138	0.0965:0.0:0.9035:0.0	.	412;412	Q5SRL2;Q12899	.;TRI26_HUMAN	M	412	ENSP00000391879:T412M;ENSP00000410446:T412M;ENSP00000395491:T412M	ENSP00000395491:T412M	T	-	2	0	TRIM26	30262017	0.963000	0.33076	0.097000	0.21041	0.003000	0.03518	2.854000	0.48325	1.377000	0.46286	-0.277000	0.10078	ACG	-	superfamily_ConA-like_lec_gl_sf,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY		0.552	TRIM26-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM26	protein_coding	OTTHUMT00000253442.1	G	NM_003449	-		30154038	-1	no_errors	ENST00000437089	ensembl	human	known	74_37	missense	SNP	0.020	A
GSN	2934	genome.wustl.edu	37	9	124074857	124074857	+	Intron	DEL	A	A	-			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr9:124074857delA	ENST00000373818.4	+	5	885				GSN_ENST00000436847.1_Intron|GSN_ENST00000341272.2_Intron|GSN_ENST00000545652.1_Intron|GSN_ENST00000394353.2_Intron|GSN_ENST00000373823.3_Intron|GSN_ENST00000449733.1_Intron|GSN_ENST00000373808.2_Intron|GSN_ENST00000485767.1_3'UTR|GSN_ENST00000373807.1_Intron|GSN_ENST00000412819.1_Intron	NM_000177.4|NM_001258029.1	NP_000168.1|NP_001244958.1	P06396	GELS_HUMAN	gelsolin						actin filament polymerization (GO:0030041)|actin filament severing (GO:0051014)|aging (GO:0007568)|apoptotic process (GO:0006915)|barbed-end actin filament capping (GO:0051016)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to cadmium ion (GO:0071276)|cilium morphogenesis (GO:0060271)|oligodendrocyte development (GO:0014003)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of cell adhesion (GO:0030155)|response to ethanol (GO:0045471)|response to folic acid (GO:0051593)|tissue regeneration (GO:0042246)|vesicle-mediated transport (GO:0016192)	actin cytoskeleton (GO:0015629)|blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)|ruffle (GO:0001726)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(1)|lung(8)|ovary(1)	21						GAATTTGAGGAAAAAAAAAAA	0.423																																																	0								ENSG00000148180																																			GSN	SO:0001627	intron_variant	0				HGNC	X04412	CCDS6828.1, CCDS6829.1, CCDS48011.1, CCDS65118.1, CCDS75890.1, CCDS75891.1	9q33	2010-04-27	2010-04-27		ENSG00000148180	ENSG00000148180			4620	protein-coding gene	gene with protein product	"""amyloidosis, Finnish type"""	137350	"""gelsolin (amyloidosis, Finnish type)"""			1652889	Standard	NM_001127662		Approved	DKFZp313L0718	uc004blf.1	P06396	OTTHUMG00000020584	ENST00000373818.4:c.816+91A>-	9.37:g.124074857delA		Somatic	0	19	0.00		0.7032168817119823	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	24	11.11	A2A418|A8MUD1|A8MYN7|B7Z373|B7Z5V1|F5H1A8|Q5T0I2|Q8WVV7	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000373818.4	37	NULL	CCDS6828.1	9																																																																																			-	-		0.423	GSN-001	KNOWN	basic|CCDS	protein_coding	GSN	protein_coding	OTTHUMT00000053861.1	A	NM_000177			124074857	+1	no_errors	ENST00000485767	ensembl	human	known	74_37	rna	DEL	0.000	-
PPAPDC3	84814	genome.wustl.edu	37	9	134183431	134183431	+	Silent	SNP	C	C	T	rs371238589		TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr9:134183431C>T	ENST00000372264.3	+	2	877	c.573C>T	c.(571-573)gcC>gcT	p.A191A		NM_032728.3	NP_116117.3	Q8NBV4	PPAC3_HUMAN	phosphatidic acid phosphatase type 2 domain containing 3	191					negative regulation of myotube differentiation (GO:0010832)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)	hydrolase activity (GO:0016787)			breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(9)|skin(1)	16	all_hematologic(7;0.0119)			OV - Ovarian serous cystadenocarcinoma(145;1.22e-05)|Epithelial(140;0.000173)		CCTTCCCGGCCGGGCACGCCA	0.697																																																	0								ENSG00000160539	C		3,4401	6.2+/-15.9	0,3,2199	55.0	49.0	51.0		573	-2.4	1.0	9		51	0,8596		0,0,4298	no	coding-synonymous	PPAPDC3	NM_032728.3		0,3,6497	TT,TC,CC		0.0,0.0681,0.0231		191/272	134183431	3,12997	2202	4298	6500	PPAPDC3	SO:0001819	synonymous_variant	0			-	HGNC	AK027568	CCDS6942.1	9q34.2-q34.3	2008-02-26	2005-07-15	2005-07-15	ENSG00000160539	ENSG00000160539			28174	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 67"""	C9orf67		12958361	Standard	NM_032728		Approved	MGC12921, FLJ14662, NET39	uc004cal.2	Q8NBV4	OTTHUMG00000020822	ENST00000372264.3:c.573C>T	9.37:g.134183431C>T		Somatic	0	63	0.00		0.7032168817119823	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	63	22.22	Q5T6P0|Q96SS7|Q9BRC3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_P_Acid_Pase_2/haloperoxidase,superfamily_P_Acid_Pase_2/haloperoxidase,smart_P_Acid_Pase_2/haloperoxidase	p.A191	ENST00000372264.3	37	c.573	CCDS6942.1	9																																																																																			-	pfam_P_Acid_Pase_2/haloperoxidase,superfamily_P_Acid_Pase_2/haloperoxidase,smart_P_Acid_Pase_2/haloperoxidase		0.697	PPAPDC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPAPDC3	protein_coding	OTTHUMT00000054724.1	C	NM_032728	-		134183431	+1	no_errors	ENST00000372264	ensembl	human	known	74_37	silent	SNP	0.977	T
OR13G1	441933	genome.wustl.edu	37	1	247835974	247835974	+	Missense_Mutation	SNP	A	A	G			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr1:247835974A>G	ENST00000359688.2	-	1	391	c.370T>C	c.(370-372)Tgt>Cgt	p.C124R	RP11-634B7.4_ENST00000449298.1_RNA	NM_001005487.1	NP_001005487.1	Q8NGZ3	O13G1_HUMAN	olfactory receptor, family 13, subfamily G, member 1	124						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|kidney(1)|large_intestine(2)|lung(28)|skin(2)	35	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			AGAGGGAAACAAATGGCCACA	0.488																																																	0								ENSG00000197437						99.0	82.0	88.0					1																	247835974		2203	4300	6503	OR13G1	SO:0001583	missense	0			-	HGNC	AB065623	CCDS31094.1	1q44	2012-08-09			ENSG00000197437	ENSG00000197437		"""GPCR / Class A : Olfactory receptors"""	14999	protein-coding gene	gene with protein product		611677					Standard	NM_001005487		Approved		uc001idi.1	Q8NGZ3	OTTHUMG00000040212	ENST00000359688.2:c.370T>C	1.37:g.247835974A>G	ENSP00000352717:p.Cys124Arg	Somatic	0	24	0.00		0.7032168817119823	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	26	45.83	B2RN80|Q5T2T2|Q6IF86	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.C124R	ENST00000359688.2	37	c.370	CCDS31094.1	1	.	.	.	.	.	.	.	.	.	.	A	16.27	3.075084	0.55646	.	.	ENSG00000197437	ENST00000359688	T	0.34472	1.36	4.2	4.2	0.49525	GPCR, rhodopsin-like superfamily (1);	0.000000	0.47852	D	0.000219	T	0.65439	0.2691	M	0.91038	3.17	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.73164	-0.4069	10	0.72032	D	0.01	-43.0462	11.5555	0.50745	1.0:0.0:0.0:0.0	.	124	Q8NGZ3	O13G1_HUMAN	R	124	ENSP00000352717:C124R	ENSP00000352717:C124R	C	-	1	0	OR13G1	245902597	0.323000	0.24643	0.987000	0.45799	0.505000	0.33919	3.249000	0.51437	1.888000	0.54679	0.460000	0.39030	TGT	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM		0.488	OR13G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR13G1	protein_coding	OTTHUMT00000096869.1	A	NM_001005487	-		247835974	-1	no_errors	ENST00000359688	ensembl	human	known	74_37	missense	SNP	1.000	G
ATF1	466	genome.wustl.edu	37	12	51203362	51203362	+	Silent	SNP	C	C	T	rs534424376		TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr12:51203362C>T	ENST00000262053.3	+	4	340	c.318C>T	c.(316-318)agC>agT	p.S106S	ATF1_ENST00000539132.1_Intron	NM_005171.4	NP_005162.1	P18846	ATF1_HUMAN	activating transcription factor 1	106					cellular protein complex assembly (GO:0043623)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of DNA replication (GO:0045740)|positive regulation of neuron projection development (GO:0010976)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to cobalt ion (GO:0032025)|response to organic cyclic compound (GO:0014070)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)		EWSR1/ATF1(347)|FUS/ATF1(4)	breast(1)|large_intestine(1)|ovary(2)	4					Pseudoephedrine(DB00852)	AGACTAGCAGCGGACAGTACA	0.403			T	"""EWSR1, FUS"""	"""malignant melanoma of soft parts , angiomatoid fibrous histiocytoma """								C|||	1	0.000199681	0.0	0.0	5008	,	,		15507	0.0		0.0	False		,,,				2504	0.001							Dom	yes		12	12q13	466	activating transcription factor 1		"""E, M"""	0								ENSG00000123268						65.0	67.0	66.0					12																	51203362		2203	4300	6503	ATF1	SO:0001819	synonymous_variant	0			-	HGNC	BC029619	CCDS8803.1	12q13	2014-05-13			ENSG00000123268	ENSG00000123268		"""basic leucine zipper proteins"""	783	protein-coding gene	gene with protein product		123803				8401579	Standard	NM_005171		Approved	TREB36	uc001rww.4	P18846		ENST00000262053.3:c.318C>T	12.37:g.51203362C>T		Somatic	0	42	0.00		0.7032168817119823	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	29	9.38	B4DRF9|P25168|Q9H4A8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_bZIP,pfam_Coactivator_CBP_pKID,smart_bZIP,pfscan_Coactivator_CBP_pKID,pfscan_bZIP,prints_Leuzip_CREB	p.S106	ENST00000262053.3	37	c.318	CCDS8803.1	12																																																																																			-	prints_Leuzip_CREB		0.403	ATF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATF1	protein_coding	OTTHUMT00000404285.1	C	NM_005171	-		51203362	+1	no_errors	ENST00000262053	ensembl	human	known	74_37	silent	SNP	0.995	T
MRPL42	28977	genome.wustl.edu	37	12	93894747	93894748	+	Intron	INS	-	-	A			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr12:93894747_93894748insA	ENST00000549982.1	+	6	544				MRPL42_ENST00000552938.1_3'UTR|MRPL42_ENST00000361630.2_Intron|MRPL42_ENST00000552217.1_Intron|MRPL42_ENST00000393128.4_Intron	NM_014050.3|NM_172177.3	NP_054769.1|NP_751917.1	Q9Y6G3	RM42_HUMAN	mitochondrial ribosomal protein L42						translation (GO:0006412)	mitochondrial small ribosomal subunit (GO:0005763)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			breast(1)|endometrium(1)|large_intestine(1)|lung(2)|ovary(2)	7						ccagtctctagaaaaaaaaaat	0.366																																																	0								ENSG00000198015																																			MRPL42	SO:0001627	intron_variant	0				HGNC	AB051626	CCDS9045.1	12q22	2014-02-12			ENSG00000198015	ENSG00000198015		"""Mitochondrial ribosomal proteins / large subunits"", ""Mitochondrial ribosomal proteins / small subunits"""	14493	protein-coding gene	gene with protein product	"""mitochondrial ribosomal protein S32"""	611847				11279123, 11042152	Standard	NM_014050		Approved	MRPS32, MRP-L31, RPML31, PTD007, HSPC204, MRPL31	uc001tcr.3	Q9Y6G3	OTTHUMG00000170157	ENST00000549982.1:c.384-204->A	12.37:g.93894757_93894757dupA		Somatic	0	10	0.00		0.7032168817119823	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	4	55.56	Q6FID1|Q96Q48|Q9P0S1	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000549982.1	37	NULL	CCDS9045.1	12																																																																																			-	-		0.366	MRPL42-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MRPL42	protein_coding	OTTHUMT00000407715.1	-	NM_014050			93894748	+1	no_errors	ENST00000552938	ensembl	human	putative	74_37	rna	INS	0.002:0.008	A
DCT	1638	genome.wustl.edu	37	13	95131426	95131426	+	Silent	SNP	G	G	C			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr13:95131426G>C	ENST00000377028.5	-	1	497	c.84C>G	c.(82-84)gtC>gtG	p.V28V	DCT_ENST00000446125.1_Silent_p.V28V	NM_001922.3	NP_001913.2	P40126	TYRP2_HUMAN	dopachrome tautomerase	28					cell development (GO:0048468)|developmental pigmentation (GO:0048066)|epidermis development (GO:0008544)|melanin biosynthetic process from tyrosine (GO:0006583)|positive regulation of neuroblast proliferation (GO:0002052)|ventricular zone neuroblast division (GO:0021847)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|melanosome (GO:0042470)	copper ion binding (GO:0005507)|dopachrome isomerase activity (GO:0004167)|oxidoreductase activity (GO:0016491)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(14)|liver(1)|lung(16)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	50	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;3.71e-42)|all_epithelial(2;3.76e-31)|all_lung(2;5.16e-14)|Lung NSC(4;1.33e-13)|Breast(118;0.0013)|Hepatocellular(115;0.00886)|Renal(2;0.00988)		COAD - Colon adenocarcinoma(199;7.07e-05)|GBM - Glioblastoma multiforme(99;0.000472)		CCGTCATGCAGACTCGGGGGA	0.602																																																	0								ENSG00000080166						42.0	41.0	41.0					13																	95131426		2203	4300	6503	DCT	SO:0001819	synonymous_variant	0			-	HGNC	D17547	CCDS9470.1, CCDS45060.1	13q32	2012-09-28	2012-09-28		ENSG00000080166	ENSG00000080166	5.3.3.12		2709	protein-coding gene	gene with protein product	"""dopachrome delta-isomerase"""	191275	"""tyrosine-related protein 2"""	TYRP2		8306979	Standard	NM_001922		Approved		uc010afh.3	P40126	OTTHUMG00000017206	ENST00000377028.5:c.84C>G	13.37:g.95131426G>C		Somatic	0	18	0.00		0.7032168817119823	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	34	19.05	Q09GT4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Tyrosinase,superfamily_Unchr_di-copper_centre,prints_Tyrosinase	p.V28	ENST00000377028.5	37	c.84	CCDS9470.1	13																																																																																			-	NULL		0.602	DCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCT	protein_coding	OTTHUMT00000045461.3	G		-		95131426	-1	no_errors	ENST00000446125	ensembl	human	known	74_37	silent	SNP	1.000	C
GPR113	165082	genome.wustl.edu	37	2	26536280	26536280	+	Missense_Mutation	SNP	C	C	T			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr2:26536280C>T	ENST00000311519.1	-	9	1437	c.1438G>A	c.(1438-1440)Gat>Aat	p.D480N	GPR113_ENST00000459892.1_5'UTR|GPR113_ENST00000541401.1_Missense_Mutation_p.D83N|GPR113_ENST00000333478.6_Missense_Mutation_p.D281N|GPR113_ENST00000421160.2_Missense_Mutation_p.D411N	NM_001145168.1	NP_001138640.1	Q8IZF5	GP113_HUMAN	G protein-coupled receptor 113	480					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(4)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	24	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AGCCTCGCATCTGTGCAGCTG	0.647																																																	0								ENSG00000173567						27.0	27.0	27.0					2																	26536280		2202	4300	6502	GPR113	SO:0001583	missense	0			-	HGNC	AB083619	CCDS33159.2, CCDS46238.1, CCDS46239.1	2p24.1	2014-08-08			ENSG00000173567	ENSG00000173567		"""-"", ""GPCR / Class B : Orphans"""	18989	protein-coding gene	gene with protein product						12435584	Standard	NM_153835		Approved	hGPCR37, PGR23	uc002rhe.4	Q8IZF5	OTTHUMG00000150225	ENST00000311519.1:c.1438G>A	2.37:g.26536280C>T	ENSP00000307831:p.Asp480Asn	Somatic	0	50	0.00		0.7032168817119823	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	39	23.53	B4DF15|E9PEV1|Q53TA5|Q6UXT7|Q6UXX3|Q86SL7|Q8IXD8|Q8TDT3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_2_secretin-like,pfam_DUF3497,pfam_GPS_dom,pfam_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	p.D281N	ENST00000311519.1	37	c.841	CCDS46239.1	2	.	.	.	.	.	.	.	.	.	.	C	14.36	2.512387	0.44660	.	.	ENSG00000173567	ENST00000541401;ENST00000333478;ENST00000421160;ENST00000311519	T;T;T;T	0.29397	1.57;3.08;3.08;3.08	5.84	4.96	0.65561	.	.	.	.	.	T	0.35480	0.0933	M	0.64997	1.995	0.80722	D	1	B;B;B;B	0.25609	0.1;0.13;0.061;0.082	B;B;B;B	0.32928	0.155;0.064;0.063;0.096	T	0.10428	-1.0630	9	0.27785	T	0.31	-14.3356	14.8179	0.70048	0.0:0.8552:0.1448:0.0	.	411;281;480;83	E9PEV1;Q8IZF5-2;Q8IZF5;F5H1E4	.;.;GP113_HUMAN;.	N	83;281;411;480	ENSP00000445729:D83N;ENSP00000327396:D281N;ENSP00000388537:D411N;ENSP00000307831:D480N	ENSP00000307831:D480N	D	-	1	0	GPR113	26389784	0.465000	0.25815	0.498000	0.27564	0.381000	0.30169	1.153000	0.31676	1.462000	0.47948	0.561000	0.74099	GAT	-	NULL		0.647	GPR113-004	PUTATIVE	basic|CCDS	protein_coding	GPR113	protein_coding	OTTHUMT00000316892.1	C	NM_153835	-		26536280	-1	no_errors	ENST00000333478	ensembl	human	known	74_37	missense	SNP	0.629	T
ZW10	9183	genome.wustl.edu	37	11	113604439	113604439	+	Missense_Mutation	SNP	C	C	T			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr11:113604439C>T	ENST00000200135.3	-	16	2461	c.2317G>A	c.(2317-2319)Gct>Act	p.A773T		NM_004724.3	NP_004715.1	O43264	ZW10_HUMAN	zw10 kinetochore protein	773					ER to Golgi vesicle-mediated transport (GO:0006888)|establishment of mitotic spindle orientation (GO:0000132)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic metaphase plate congression (GO:0007080)|mitotic sister chromatid segregation (GO:0000070)|protein complex assembly (GO:0006461)|protein localization to kinetochore (GO:0034501)|protein transport (GO:0015031)|regulation of exit from mitosis (GO:0007096)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|membrane (GO:0016020)|nucleus (GO:0005634)|spindle pole (GO:0000922)	centromeric DNA binding (GO:0019237)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|skin(1)	18		all_cancers(61;3.84e-16)|all_epithelial(67;1e-09)|Melanoma(852;1.46e-05)|all_hematologic(158;0.000237)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Prostate(24;0.0421)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;2.94e-06)|Epithelial(105;0.000103)|all cancers(92;0.000786)		GCAAGGGCAGCTGCTCTTCTT	0.423																																																	0								ENSG00000086827						102.0	100.0	101.0					11																	113604439		2201	4296	6497	ZW10	SO:0001583	missense	0			-	HGNC	U54996	CCDS8363.1	11q23	2013-01-17	2012-12-13		ENSG00000086827	ENSG00000086827			13194	protein-coding gene	gene with protein product		603954	"""ZW10 (Drosophila) homolog, centromere/kinetochore protein"", ""ZW10, kinetochore associated, homolog (Drosophila)"""			9298984	Standard	NM_004724		Approved	KNTC1AP	uc001poe.3	O43264	OTTHUMG00000168190	ENST00000200135.3:c.2317G>A	11.37:g.113604439C>T	ENSP00000200135:p.Ala773Thr	Somatic	0	40	0.00		0.7032168817119823	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	31	3	91.18	A1A528	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RZZ-complex_Zw10	p.A773T	ENST00000200135.3	37	c.2317	CCDS8363.1	11	.	.	.	.	.	.	.	.	.	.	C	15.13	2.742655	0.49151	.	.	ENSG00000086827	ENST00000200135	T	0.45668	0.89	5.58	4.48	0.54585	.	0.158128	0.56097	D	0.000035	T	0.30479	0.0766	L	0.28740	0.885	0.53688	D	0.999973	B	0.06786	0.001	B	0.08055	0.003	T	0.06991	-1.0796	10	0.14656	T	0.56	-13.6341	15.3329	0.74229	0.0:0.9213:0.0:0.0787	.	773	O43264	ZW10_HUMAN	T	773	ENSP00000200135:A773T	ENSP00000200135:A773T	A	-	1	0	ZW10	113109649	0.992000	0.36948	0.995000	0.50966	0.998000	0.95712	2.976000	0.49289	2.610000	0.88304	0.591000	0.81541	GCT	-	NULL		0.423	ZW10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZW10	protein_coding	OTTHUMT00000398700.1	C	NM_004724	-		113604439	-1	no_errors	ENST00000200135	ensembl	human	known	74_37	missense	SNP	0.997	T
FAM57B	83723	genome.wustl.edu	37	16	30036684	30036684	+	Silent	SNP	G	G	A	rs548429317		TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr16:30036684G>A	ENST00000380495.4	-	5	1376	c.645C>T	c.(643-645)taC>taT	p.Y215Y	FAM57B_ENST00000279389.4_Silent_p.Y165Y|FAM57B_ENST00000564806.1_3'UTR	NM_031478.4	NP_113666.2	Q71RH2	FA57B_HUMAN	family with sequence similarity 57, member B	215	TLC. {ECO:0000255|PROSITE- ProRule:PRU00205}.				ceramide biosynthetic process (GO:0046513)|negative regulation of fat cell differentiation (GO:0045599)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	sphingosine N-acyltransferase activity (GO:0050291)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(5)|upper_aerodigestive_tract(1)	14						CATGGCGCCCGTAGGCCCAGT	0.677													G|||	1	0.000199681	0.0	0.0	5008	,	,		14355	0.001		0.0	False		,,,				2504	0.0																0								ENSG00000149926						38.0	41.0	40.0					16																	30036684		2196	4299	6495	FAM57B	SO:0001819	synonymous_variant	0			-	HGNC	AF370365	CCDS10667.2	16p11.2	2013-02-19			ENSG00000149926	ENSG00000149926			25295	protein-coding gene	gene with protein product		615175				11230166, 23275342	Standard	NM_031478		Approved	DKFZP434I2117	uc002dvt.3	Q71RH2	OTTHUMG00000132105	ENST00000380495.4:c.645C>T	16.37:g.30036684G>A		Somatic	0	17	0.00		0.7032168817119823	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	6	33.33	Q9H0J1	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_TLC-dom,smart_TLC-dom,pfscan_TLC-dom	p.Y215	ENST00000380495.4	37	c.645	CCDS10667.2	16	.	.	.	.	.	.	.	.	.	.	G	9.172	1.021450	0.19433	.	.	ENSG00000149926	ENST00000279389	.	.	.	4.78	3.82	0.43975	.	.	.	.	.	T	0.59569	0.2203	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.55829	-0.8079	4	.	.	.	-8.3604	9.4372	0.38646	0.1772:0.0:0.8228:0.0	.	.	.	.	M	182	.	.	T	-	2	0	FAM57B	29944185	0.999000	0.42202	1.000000	0.80357	0.990000	0.78478	0.439000	0.21575	0.987000	0.38709	0.561000	0.74099	ACG	-	pfam_TLC-dom,smart_TLC-dom,pfscan_TLC-dom		0.677	FAM57B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM57B	protein_coding	OTTHUMT00000255142.2	G	NM_031478	-		30036684	-1	no_errors	ENST00000380495	ensembl	human	known	74_37	silent	SNP	1.000	A
PHF6	84295	genome.wustl.edu	37	X	133527620	133527620	+	Missense_Mutation	SNP	T	T	A			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chrX:133527620T>A	ENST00000332070.3	+	4	532	c.330T>A	c.(328-330)caT>caA	p.H110Q	PHF6_ENST00000370803.3_Missense_Mutation_p.H110Q|PHF6_ENST00000370799.1_Missense_Mutation_p.H110Q|PHF6_ENST00000394292.1_Missense_Mutation_p.H110Q|PHF6_ENST00000370800.4_Missense_Mutation_p.H110Q|PHF6_ENST00000416404.2_Missense_Mutation_p.H76Q	NM_032458.2	NP_115834.1	Q8IWS0	PHF6_HUMAN	PHD finger protein 6	110	Extended PHD1 domain (ePHD1).				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone binding (GO:0042393)|histone deacetylase binding (GO:0042826)|phosphoprotein binding (GO:0051219)|poly(A) RNA binding (GO:0044822)|ribonucleoprotein complex binding (GO:0043021)|scaffold protein binding (GO:0097110)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(88)|kidney(2)|large_intestine(1)|liver(1)|lung(6)|ovary(1)|skin(1)|urinary_tract(1)	103	Acute lymphoblastic leukemia(192;0.000127)					GTGCATTGCATGATAAAGCTC	0.348			"""F, N, Splice, Mis"""		ETP ALL																																Colon(100;666 1493 6344 21231 35807)			Rec	yes		X	Xq26.3	84295	PHD finger protein 6		L	0								ENSG00000156531						154.0	128.0	137.0					X																	133527620		2203	4300	6503	PHF6	SO:0001583	missense	0			-	HGNC	AB058726	CCDS14639.1, CCDS14640.1	Xq26	2014-09-17			ENSG00000156531	ENSG00000156531		"""Zinc fingers, PHD-type"""	18145	protein-coding gene	gene with protein product	"""centromere protein 31"""	300414	"""Borjeson-Forssman-Lehmann syndrome"""	BFLS, BORJ		12415272, 15466013	Standard	NM_032335		Approved	KIAA1823, MGC14797, CENP-31	uc004exk.3	Q8IWS0	OTTHUMG00000022453	ENST00000332070.3:c.330T>A	X.37:g.133527620T>A	ENSP00000329097:p.His110Gln	Somatic	0	57	0.00		0.7032168817119823	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	30	45.45	A8K230|B4E0G4|D3DTG3|E9PC97|Q5JRC7|Q5JRC8|Q96JK3|Q9BRU0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_Znf_FYVE_PHD,smart_Znf_PHD	p.H110Q	ENST00000332070.3	37	c.330	CCDS14639.1	X	.	.	.	.	.	.	.	.	.	.	T	8.052	0.766301	0.15983	.	.	ENSG00000156531	ENST00000370803;ENST00000332070;ENST00000394292;ENST00000370799;ENST00000416404;ENST00000370800	T;T;T;T;T;T	0.69040	-0.37;-0.37;-0.37;-0.37;-0.37;-0.37	5.15	1.33	0.21861	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, PHD-type (1);	0.166026	0.56097	D	0.000034	T	0.28830	0.0715	N	0.00583	-1.355	0.40701	D	0.982486	B;B;B;B;B	0.16396	0.017;0.002;0.01;0.01;0.005	B;B;B;B;B	0.18871	0.023;0.001;0.022;0.022;0.006	T	0.03287	-1.1052	10	0.26408	T	0.33	-12.7114	8.247	0.31695	0.0:0.2399:0.0:0.7601	.	76;110;110;110;110	B4E0G4;A8K230;Q8IWS0;E9PC97;Q8IWS0-2	.;.;PHF6_HUMAN;.;.	Q	110;110;110;110;76;110	ENSP00000359839:H110Q;ENSP00000329097:H110Q;ENSP00000377831:H110Q;ENSP00000359835:H110Q;ENSP00000394480:H76Q;ENSP00000359836:H110Q	ENSP00000329097:H110Q	H	+	3	2	PHF6	133355286	1.000000	0.71417	0.999000	0.59377	0.986000	0.74619	2.214000	0.42853	-0.039000	0.13602	-0.520000	0.04383	CAT	-	superfamily_Znf_FYVE_PHD,smart_Znf_PHD		0.348	PHF6-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	PHF6	protein_coding	OTTHUMT00000058367.1	T	NM_032458	-		133527620	+1	no_errors	ENST00000394292	ensembl	human	known	74_37	missense	SNP	1.000	A
HIVEP2	3097	genome.wustl.edu	37	6	143092313	143092313	+	Missense_Mutation	SNP	T	T	A			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr6:143092313T>A	ENST00000367604.1	-	4	4202	c.3563A>T	c.(3562-3564)cAc>cTc	p.H1188L	HIVEP2_ENST00000367603.2_Missense_Mutation_p.H1188L|HIVEP2_ENST00000012134.2_Missense_Mutation_p.H1188L			P31629	ZEP2_HUMAN	human immunodeficiency virus type I enhancer binding protein 2	1188					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(4)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(19)|lung(35)|ovary(4)|prostate(6)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	100				OV - Ovarian serous cystadenocarcinoma(155;1.61e-05)|GBM - Glioblastoma multiforme(68;0.0102)		TGGAAATAAGTGTGGCTGTTC	0.418																																					Esophageal Squamous(107;843 1510 13293 16805 42198)												0								ENSG00000010818						178.0	183.0	181.0					6																	143092313		2030	4182	6212	HIVEP2	SO:0001583	missense	0			-	HGNC	M60119	CCDS43510.1	6q23-q24	2013-01-08	2001-11-28		ENSG00000010818	ENSG00000010818		"""Zinc fingers, C2H2-type"""	4921	protein-coding gene	gene with protein product	"""c-myc intron binding protein 1"""	143054	"""human immunodeficiency virus type I enhancer-binding protein 2"""			1733857, 2022670	Standard	NM_006734		Approved	MBP-2, HIV-EP2, MIBP1, ZAS2, Schnurri-2, ZNF40B	uc003qjd.3	P31629	OTTHUMG00000015713	ENST00000367604.1:c.3563A>T	6.37:g.143092313T>A	ENSP00000356576:p.His1188Leu	Somatic	0	26	0.00		0.7032168817119823	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	32	11.11	Q02646|Q5THT5|Q9NS05	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Znf_C2H2_jaz,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.H1188L	ENST00000367604.1	37	c.3563	CCDS43510.1	6	.	.	.	.	.	.	.	.	.	.	T	9.870	1.198558	0.22121	.	.	ENSG00000010818	ENST00000367604;ENST00000367603;ENST00000012134	T;T;T	0.02301	4.35;4.35;4.35	5.8	3.34	0.38264	.	0.477990	0.26696	N	0.022977	T	0.00695	0.0023	L	0.34521	1.04	0.09310	N	1	B	0.19817	0.039	B	0.15870	0.014	T	0.49263	-0.8958	10	0.36615	T	0.2	-7.2678	7.3605	0.26744	0.0:0.0706:0.3036:0.6258	.	1188	P31629	ZEP2_HUMAN	L	1188	ENSP00000356576:H1188L;ENSP00000356575:H1188L;ENSP00000012134:H1188L	ENSP00000012134:H1188L	H	-	2	0	HIVEP2	143134006	0.836000	0.29430	0.641000	0.29422	0.991000	0.79684	1.256000	0.32921	0.426000	0.26116	0.533000	0.62120	CAC	-	NULL		0.418	HIVEP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIVEP2	protein_coding	OTTHUMT00000042495.1	T		-		143092313	-1	no_errors	ENST00000012134	ensembl	human	known	74_37	missense	SNP	0.024	A
NUP188	23511	genome.wustl.edu	37	9	131744924	131744924	+	Missense_Mutation	SNP	G	G	A			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr9:131744924G>A	ENST00000372577.2	+	16	1634	c.1613G>A	c.(1612-1614)aGc>aAc	p.S538N		NM_015354.1	NP_056169.1	Q5SRE5	NU188_HUMAN	nucleoporin 188kDa	538					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)				breast(2)|central_nervous_system(3)|endometrium(6)|kidney(4)|large_intestine(9)|lung(20)|ovary(6)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	60						TCCTATAGCAGCTGGACCCTC	0.488																																																	0								ENSG00000095319						139.0	111.0	120.0					9																	131744924		2203	4300	6503	NUP188	SO:0001583	missense	0			-	HGNC	D79991	CCDS35156.1	9q34.13	2014-01-28	2004-03-19	2004-03-24	ENSG00000095319	ENSG00000095319			17859	protein-coding gene	gene with protein product		615587	"""KIAA0169"""	KIAA0169		11029043	Standard	NM_015354		Approved		uc004bws.2	Q5SRE5	OTTHUMG00000020768	ENST00000372577.2:c.1613G>A	9.37:g.131744924G>A	ENSP00000361658:p.Ser538Asn	Somatic	0	19	0.00		0.7032168817119823	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	28	22	56.00	Q14675|Q2TA87|Q7Z3K8|Q8IWF1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Nucleoporin_Nup188,superfamily_ARM-type_fold	p.S538N	ENST00000372577.2	37	c.1613	CCDS35156.1	9	.	.	.	.	.	.	.	.	.	.	G	18.26	3.585803	0.66105	.	.	ENSG00000095319	ENST00000356693;ENST00000372577	T	0.31769	1.48	5.71	5.71	0.89125	.	0.171001	0.64402	D	0.000005	T	0.37293	0.0998	N	0.19112	0.55	0.49798	D	0.999825	D	0.58268	0.982	P	0.56865	0.808	T	0.08066	-1.0740	10	0.41790	T	0.15	-8.1849	18.8346	0.92157	0.0:0.0:1.0:0.0	.	538	Q5SRE5	NU188_HUMAN	N	427;538	ENSP00000361658:S538N	ENSP00000349125:S427N	S	+	2	0	NUP188	130784745	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.695000	0.74593	2.710000	0.92621	0.491000	0.48974	AGC	-	pfam_Nucleoporin_Nup188		0.488	NUP188-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP188	protein_coding	OTTHUMT00000054529.2	G		-		131744924	+1	no_errors	ENST00000372577	ensembl	human	known	74_37	missense	SNP	1.000	A
KCNJ12	3768	genome.wustl.edu	37	17	21318837	21318837	+	Silent	SNP	C	C	T	rs61514986	byFrequency	TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr17:21318837C>T	ENST00000583088.1	+	3	1078	c.183C>T	c.(181-183)gaC>gaT	p.D61D	KCNJ12_ENST00000331718.5_Silent_p.D61D	NM_021012.4	NP_066292.2	Q14500	KCJ12_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 12	61					muscle contraction (GO:0006936)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|protein homotetramerization (GO:0051289)|regulation of heart contraction (GO:0008016)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|intrinsic component of membrane (GO:0031224)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)			NS(1)|breast(4)|endometrium(4)|kidney(1)|large_intestine(5)|lung(39)|ovary(5)|skin(8)|stomach(3)	70				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)|Yohimbine(DB01392)	CCAACATGGACGAGAAGTCAC	0.592										Prostate(3;0.18)																																							0								ENSG00000184185	C		66,4340	55.5+/-91.7	0,66,2137	206.0	134.0	158.0		183	-1.7	1.0	17	dbSNP_129	158	117,8483	56.0+/-117.1	0,117,4183	no	coding-synonymous	KCNJ12	NM_021012.4		0,183,6320	TT,TC,CC		1.3605,1.498,1.407		61/434	21318837	183,12823	2203	4300	6503	KCNJ12	SO:0001819	synonymous_variant	0			-	HGNC	L36069	CCDS11219.1	17p11.1	2011-07-05	2004-01-13		ENSG00000184185	ENSG00000184185		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6258	protein-coding gene	gene with protein product		602323	"""potassium inwardly-rectifying channel, subfamily J, inhibitor 1"""	KCNJN1		7859381, 12417321, 16382105	Standard	NM_021012		Approved	Kir2.2, Kir2.2v, IRK2, hIRK1	uc021tss.1	Q14500	OTTHUMG00000132039	ENST00000583088.1:c.183C>T	17.37:g.21318837C>T		Somatic	0	56	0.00		0.7032168817119823	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	93	20.34	O43401|Q15756|Q8NG63	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_K_chnl_inward-rec_Kir,pfam_K_chnl_inward-rec_Kir_N,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir2.2	p.D61	ENST00000583088.1	37	c.183	CCDS11219.1	17																																																																																			-	pfam_K_chnl_inward-rec_Kir,pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir2.2		0.592	KCNJ12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNJ12	protein_coding	OTTHUMT00000255060.2	C	NM_021012	rs61514986		21318837	+1	no_errors	ENST00000331718	ensembl	human	known	74_37	silent	SNP	0.958	T
AGK	55750	genome.wustl.edu	37	7	141315307	141315307	+	Silent	SNP	C	C	T			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr7:141315307C>T	ENST00000355413.4	+	8	720	c.460C>T	c.(460-462)Ctg>Ttg	p.L154L	AGK_ENST00000473247.1_Silent_p.L126L|AGK_ENST00000535825.1_Silent_p.L151L	NM_018238.3	NP_060708.1	Q53H12	AGK_HUMAN	acylglycerol kinase	154	DAGKc. {ECO:0000255|PROSITE- ProRule:PRU00783}.				ceramide biosynthetic process (GO:0046513)|glycerolipid metabolic process (GO:0046486)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)	acylglycerol kinase activity (GO:0047620)|ATP binding (GO:0005524)|ceramide kinase activity (GO:0001729)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)			breast(1)|endometrium(1)|large_intestine(4)|lung(6)|ovary(1)|pancreas(1)|prostate(3)	17	Melanoma(164;0.0171)					ATTTATCCCACTGGGAGAGAC	0.443																																																	0								ENSG00000006530						180.0	183.0	182.0					7																	141315307		2203	4300	6503	AGK	SO:0001819	synonymous_variant	0			-	HGNC	BC022777	CCDS5865.1	7q34	2010-05-04	2007-01-11	2007-01-11	ENSG00000006530	ENSG00000006530	2.7.1.94		21869	protein-coding gene	gene with protein product		610345	"""multiple substrate lipid kinase"""	MULK		15252046, 15939762, 17135245	Standard	NM_018238		Approved	FLJ10842	uc003vwi.2	Q53H12	OTTHUMG00000157499	ENST00000355413.4:c.460C>T	7.37:g.141315307C>T		Somatic	0	76	0.00		0.7032168817119823	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	30	36	45.45	Q75KN1|Q96GC3|Q9NP48	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kinase_cat_dom	p.L154	ENST00000355413.4	37	c.460	CCDS5865.1	7																																																																																			-	pfam_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kinase_cat_dom		0.443	AGK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGK	protein_coding	OTTHUMT00000348969.1	C	NM_018238	-		141315307	+1	no_errors	ENST00000355413	ensembl	human	known	74_37	silent	SNP	1.000	T
PAPD5	64282	genome.wustl.edu	37	16	50269006	50269006	+	3'UTR	SNP	G	G	A	rs576865862		TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr16:50269006G>A	ENST00000357464.3	+	0	7627							Q8NDF8	PAPD5_HUMAN	PAP associated domain containing 5						histone mRNA catabolic process (GO:0071044)|mitotic nuclear division (GO:0007067)|mRNA processing (GO:0006397)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|polynucleotide adenylyltransferase activity (GO:0004652)			endometrium(1)|kidney(1)|lung(2)	4		all_cancers(37;0.0452)		BRCA - Breast invasive adenocarcinoma(181;0.0843)|GBM - Glioblastoma multiforme(240;0.231)		TCCTGAGGCCGTATCACTGGG	0.358													G|||	1	0.000199681	0.0	0.0014	5008	,	,		17553	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000121274																																			PAPD5	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AF089897	CCDS54006.1	16q12.1	2010-11-18				ENSG00000121274			30758	protein-coding gene	gene with protein product	"""TUTase3"""	605540				10066793	Standard	NM_001040284		Approved	TRF4-2	uc010vgo.2	Q8NDF8		ENST00000357464.3:c.*5767G>A	16.37:g.50269006G>A		Somatic	0	23	0.00		0.7032168817119823	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	17	15.00	B4DV38|Q9NW67|Q9Y6C0	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000357464.3	37	NULL		16																																																																																			-	-		0.358	PAPD5-201	KNOWN	basic|appris_candidate	protein_coding	PAPD5	protein_coding		G	NM_022447	-		50269006	+1	no_errors	ENST00000562717	ensembl	human	known	74_37	rna	SNP	0.001	A
ERCC8	1161	genome.wustl.edu	37	5	60200672	60200672	+	Missense_Mutation	SNP	G	G	T			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr5:60200672G>T	ENST00000265038.5	-	5	470	c.428C>A	c.(427-429)aCa>aAa	p.T143K	ERCC8_ENST00000543101.1_Intron|ERCC8_ENST00000462279.1_5'UTR|ERCC8_ENST00000426742.2_Missense_Mutation_p.T85K	NM_000082.3	NP_000073.1	Q13216	ERCC8_HUMAN	excision repair cross-complementation group 8	143					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|nucleotide-excision repair (GO:0006289)|positive regulation of DNA repair (GO:0045739)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein autoubiquitination (GO:0051865)|protein polyubiquitination (GO:0000209)|response to oxidative stress (GO:0006979)|response to UV (GO:0009411)|response to X-ray (GO:0010165)|transcription-coupled nucleotide-excision repair (GO:0006283)	Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleotide-excision repair complex (GO:0000109)|nucleus (GO:0005634)|protein complex (GO:0043234)	protein complex binding (GO:0032403)			breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)	14		Lung NSC(810;1.51e-06)|Prostate(74;0.0322)|Ovarian(174;0.0481)|Breast(144;0.077)				ACTATAAACTGTTTCCTCAAA	0.303																																																	0								ENSG00000049167						106.0	107.0	107.0					5																	60200672		2203	4298	6501	ERCC8	SO:0001583	missense	0			-	HGNC	U28413	CCDS3978.1	5q12.1	2014-09-17	2014-03-07		ENSG00000049167	ENSG00000049167		"""WD repeat domain containing"""	3439	protein-coding gene	gene with protein product		609412	"""Cockayne syndrome 1 (classical)"", ""excision repair cross-complementing rodent repair deficiency, complementation group 8"""	CKN1		8596535	Standard	NM_000082		Approved	CSA	uc003jsm.3	Q13216	OTTHUMG00000097741	ENST00000265038.5:c.428C>A	5.37:g.60200672G>T	ENSP00000265038:p.Thr143Lys	Somatic	0	39	0.00		0.7032168817119823	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	39	9.30	B2RB64|Q6FHX5|Q96GB9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.T143K	ENST00000265038.5	37	c.428	CCDS3978.1	5	.	.	.	.	.	.	.	.	.	.	G	13.63	2.295133	0.40594	.	.	ENSG00000049167	ENST00000426742;ENST00000265038;ENST00000536596;ENST00000439176	T;T;T	0.81163	-1.46;-1.46;-0.0	5.81	5.81	0.92471	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.203253	0.51477	D	0.000086	T	0.70211	0.3198	N	0.21448	0.665	0.80722	D	1	B;B	0.16603	0.009;0.018	B;B	0.13407	0.009;0.006	T	0.63989	-0.6512	10	0.15499	T	0.54	-11.9328	18.2637	0.90044	0.0:0.0:1.0:0.0	.	143;143	Q13216-2;Q13216	.;ERCC8_HUMAN	K	85;143;142;85	ENSP00000400110:T85K;ENSP00000265038:T143K;ENSP00000408344:T85K	ENSP00000265038:T143K	T	-	2	0	ERCC8	60236429	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.797000	0.69087	2.765000	0.95021	0.655000	0.94253	ACA	-	superfamily_WD40_repeat_dom,pfscan_WD40_repeat_dom		0.303	ERCC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERCC8	protein_coding	OTTHUMT00000214971.2	G	NM_000082	-		60200672	-1	no_errors	ENST00000265038	ensembl	human	known	74_37	missense	SNP	1.000	T
CDH4	1002	genome.wustl.edu	37	20	60318791	60318791	+	Silent	SNP	C	C	T			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr20:60318791C>T	ENST00000360469.5	+	3	430	c.342C>T	c.(340-342)gaC>gaT	p.D114D	CDH4_ENST00000543233.1_Silent_p.D40D|RP11-429E11.2_ENST00000447909.1_RNA|RP11-429E11.2_ENST00000442888.1_RNA	NM_001794.3	NP_001785.2	P55283	CADH4_HUMAN	cadherin 4, type 1, R-cadherin (retinal)	114					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(2)|lung(25)|ovary(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	74			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)			AGAAATGGGACGCCGTGGTGC	0.637																																																	0								ENSG00000179242						61.0	48.0	52.0					20																	60318791		2202	4300	6502	CDH4	SO:0001819	synonymous_variant	0			-	HGNC	L34059	CCDS13488.1, CCDS58784.1	20q13.3	2010-01-26			ENSG00000179242	ENSG00000179242		"""Cadherins / Major cadherins"""	1763	protein-coding gene	gene with protein product	"""R-Cadherin"""	603006				10191097, 10516427	Standard	NM_001794		Approved		uc002ybn.2	P55283	OTTHUMG00000032890	ENST00000360469.5:c.342C>T	20.37:g.60318791C>T		Somatic	0	15	0.00		0.7032168817119823	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	7	58.82	B3KWB8|G3V1P8|Q2M208|Q5VZ44|Q9BZ05	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,pfam_Cadherin_pro_dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin,prints_Cadherin/Desmocollin	p.D114	ENST00000360469.5	37	c.342	CCDS13488.1	20																																																																																			-	pfam_Cadherin_pro_dom,superfamily_Cadherin-like		0.637	CDH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH4	protein_coding	OTTHUMT00000079965.2	C	NM_001794	-		60318791	+1	no_errors	ENST00000360469	ensembl	human	known	74_37	silent	SNP	0.001	T
TRPM3	80036	genome.wustl.edu	37	9	73151413	73151413	+	Missense_Mutation	SNP	G	G	T			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr9:73151413G>T	ENST00000377110.3	-	25	4823	c.4580C>A	c.(4579-4581)cCc>cAc	p.P1527H	TRPM3_ENST00000377111.2_Intron|TRPM3_ENST00000358082.3_Missense_Mutation_p.P1389H|TRPM3_ENST00000396280.5_Missense_Mutation_p.P1376H|TRPM3_ENST00000408909.2_Missense_Mutation_p.P1386H|TRPM3_ENST00000357533.2_Missense_Mutation_p.P1531H|TRPM3_ENST00000396285.1_Missense_Mutation_p.P1386H|TRPM3_ENST00000423814.3_Missense_Mutation_p.P1554H|TRPM3_ENST00000360823.2_Missense_Mutation_p.P1389H|TRPM3_ENST00000377106.1_Missense_Mutation_p.P1399H|TRPM3_ENST00000377105.1_Missense_Mutation_p.P1386H|TRPM3_ENST00000396292.4_Missense_Mutation_p.P1399H			Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel, subfamily M, member 3	1552					calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|sensory perception of temperature stimulus (GO:0050951)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)			NS(2)|breast(4)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(18)|liver(1)|lung(46)|ovary(3)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(1)	95						GCTCCTTGAGGGGGAAAACAT	0.453																																																	0								ENSG00000083067						92.0	99.0	97.0					9																	73151413		2203	4300	6503	TRPM3	SO:0001583	missense	0			-	HGNC	AB046836	CCDS6634.1, CCDS6635.1, CCDS6636.1, CCDS6637.1, CCDS43835.1, CCDS65064.1	9q21.11	2011-12-14			ENSG00000083067	ENSG00000083067		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17992	protein-coding gene	gene with protein product	"""melastatin 2"""	608961				16382100	Standard	NM_206946		Approved	KIAA1616, LTRPC3, GON-2	uc004aid.3	Q9HCF6	OTTHUMG00000019997	ENST00000377110.3:c.4580C>A	9.37:g.73151413G>T	ENSP00000366314:p.Pro1527His	Somatic	0	31	0.00		0.7032168817119823	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52	A2A3F6|A9Z1Y7|Q5VW02|Q5VW03|Q5VW04|Q5W5T7|Q86SH0|Q86SH6|Q86UL0|Q86WK1|Q86WK2|Q86WK3|Q86WK4|Q86YZ9|Q86Z00|Q86Z01|Q9H0X2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom	p.P1554H	ENST00000377110.3	37	c.4661	CCDS43835.1	9	.	.	.	.	.	.	.	.	.	.	G	16.06	3.016036	0.54468	.	.	ENSG00000083067	ENST00000377110;ENST00000377106;ENST00000360823;ENST00000377105;ENST00000357533;ENST00000408909;ENST00000396285;ENST00000396292;ENST00000358082;ENST00000423814	T;T;T;T;T;T;T;T;T;T	0.58060	0.46;0.38;0.38;0.36;0.46;0.36;0.37;0.38;0.38;0.45	5.71	5.71	0.89125	.	0.119371	0.64402	D	0.000014	T	0.58293	0.2112	N	0.24115	0.695	0.50171	D	0.999859	D;B;D;D;D;D;D	0.65815	0.995;0.017;0.992;0.992;0.995;0.995;0.992	P;B;P;P;P;P;P	0.58873	0.847;0.022;0.62;0.707;0.789;0.789;0.62	T	0.58808	-0.7571	10	0.48119	T	0.1	-14.2391	19.8683	0.96840	0.0:0.0:1.0:0.0	.	1527;1517;1531;1389;1386;1499;1386	Q9HCF6-2;Q9HCF6-4;A2A3F7;A2A3F4;G5E9G1;Q9HCF6-8;A2A3F3	.;.;.;.;.;.;.	H	1527;1399;1389;1386;1531;1386;1386;1399;1389;1554	ENSP00000366314:P1527H;ENSP00000366310:P1399H;ENSP00000354066:P1389H;ENSP00000366309:P1386H;ENSP00000350140:P1531H;ENSP00000386127:P1386H;ENSP00000379581:P1386H;ENSP00000379587:P1399H;ENSP00000350791:P1389H;ENSP00000389542:P1554H	ENSP00000350140:P1531H	P	-	2	0	TRPM3	72341233	1.000000	0.71417	0.957000	0.39632	0.850000	0.48378	9.204000	0.95041	2.702000	0.92279	0.655000	0.94253	CCC	-	NULL		0.453	TRPM3-008	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPM3	protein_coding	OTTHUMT00000214158.3	G	NM_206945	-		73151413	-1	no_errors	ENST00000423814	ensembl	human	known	74_37	missense	SNP	1.000	T
SLC4A7	9497	genome.wustl.edu	37	3	27453211	27453211	+	Missense_Mutation	SNP	T	T	C	rs370056312		TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr3:27453211T>C	ENST00000295736.5	-	12	1731	c.1661A>G	c.(1660-1662)aAt>aGt	p.N554S	SLC4A7_ENST00000455077.1_Missense_Mutation_p.N435S|SLC4A7_ENST00000446700.1_Missense_Mutation_p.N546S|SLC4A7_ENST00000425128.2_Missense_Mutation_p.N546S|SLC4A7_ENST00000445684.1_Missense_Mutation_p.N550S|SLC4A7_ENST00000440156.1_Missense_Mutation_p.N550S|SLC4A7_ENST00000428386.1_Missense_Mutation_p.N430S|SLC4A7_ENST00000454389.1_Missense_Mutation_p.N563S|SLC4A7_ENST00000437179.1_Missense_Mutation_p.N435S|SLC4A7_ENST00000388777.4_Missense_Mutation_p.N104S|SLC4A7_ENST00000435667.2_Missense_Mutation_p.N439S	NM_003615.4	NP_003606.3	Q9Y6M7	S4A7_HUMAN	solute carrier family 4, sodium bicarbonate cotransporter, member 7	554					auditory receptor cell development (GO:0060117)|bicarbonate transport (GO:0015701)|cochlear nucleus development (GO:0021747)|ion transport (GO:0006811)|retina vasculature morphogenesis in camera-type eye (GO:0061299)|retinal cell programmed cell death (GO:0046666)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|cell projection (GO:0042995)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|sodium:bicarbonate symporter activity (GO:0008510)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(12)|lung(9)|ovary(4)|skin(1)	38					Sodium bicarbonate(DB01390)	GGTAGATCCATTGTGAAACAC	0.413																																																	0								ENSG00000033867	T	SER/ASN	0,4406		0,0,2203	57.0	59.0	58.0		1661	5.4	1.0	3		58	1,8599	1.2+/-3.3	0,1,4299	no	missense	SLC4A7	NM_003615.3	46	0,1,6502	CC,CT,TT		0.0116,0.0,0.0077	probably-damaging	554/1215	27453211	1,13005	2203	4300	6503	SLC4A7	SO:0001583	missense	0			-	HGNC	AB012130	CCDS33721.1, CCDS58819.1, CCDS58820.1	3p24.1	2013-05-22			ENSG00000033867	ENSG00000033867		"""Solute carriers"""	11033	protein-coding gene	gene with protein product		603353		SLC4A6		10198178, 9610397	Standard	NM_003615		Approved	NBC3, SBC2	uc003cdv.4	Q9Y6M7	OTTHUMG00000155679	ENST00000295736.5:c.1661A>G	3.37:g.27453211T>C	ENSP00000295736:p.Asn554Ser	Somatic	0	69	0.00		0.7032168817119823	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	85	12.37	A6NIA8|B2CI53|B5M449|B5M451|B5M452|B5M453|B6DY52|B6DY53|C9JST9|D3K174|D3K175|O60350|Q6AHZ9|Q9HC88|Q9UIB9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_HCO3_transpt_C,pfam_Band3_cytoplasmic_dom,superfamily_PTrfase/Anion_transptr,prints_HCO3_transpt_euk,tigrfam_HCO3_transpt_euk	p.N563S	ENST00000295736.5	37	c.1688	CCDS33721.1	3	.	.	.	.	.	.	.	.	.	.	T	15.55	2.867078	0.51588	0.0	1.16E-4	ENSG00000033867	ENST00000419036;ENST00000295736;ENST00000428386;ENST00000454389;ENST00000440156;ENST00000437179;ENST00000446700;ENST00000455077;ENST00000445684;ENST00000435667;ENST00000388777;ENST00000425128;ENST00000428179	T;T;T;T;T;T;T;T;T;T;T;T;T	0.80393	-1.36;-1.06;-1.11;-1.07;-1.15;-1.11;-1.14;-1.11;-1.14;-1.11;-1.37;0.24;-1.1	5.43	5.43	0.79202	Bicarbonate transporter, cytoplasmic (1);	0.000000	0.85682	D	0.000000	D	0.87321	0.6148	M	0.73598	2.24	0.41352	D	0.987372	D;D;D;D;D;D;D;D;D	0.61080	0.985;0.977;0.985;0.976;0.985;0.963;0.987;0.985;0.989	P;P;P;P;P;P;D;P;D	0.67548	0.867;0.887;0.867;0.695;0.867;0.883;0.947;0.867;0.952	D	0.84750	0.0756	10	0.11182	T	0.66	.	15.7674	0.78138	0.0:0.0:0.0:1.0	.	550;435;546;550;563;104;430;554;435	E9PFN4;B5M452;E9PGC1;B5M453;E9PDL9;F8W7E6;Q9Y6M7-2;Q9Y6M7;B2CI53	.;.;.;.;.;.;.;S4A7_HUMAN;.	S	105;554;430;563;550;435;546;435;550;439;104;546;450	ENSP00000411031:N105S;ENSP00000295736:N554S;ENSP00000416368:N430S;ENSP00000390394:N563S;ENSP00000414797:N550S;ENSP00000394252:N435S;ENSP00000406605:N546S;ENSP00000407382:N435S;ENSP00000406804:N550S;ENSP00000395336:N439S;ENSP00000373429:N104S;ENSP00000401949:N546S;ENSP00000388703:N450S	ENSP00000295736:N554S	N	-	2	0	SLC4A7	27428215	1.000000	0.71417	1.000000	0.80357	0.709000	0.40893	7.499000	0.81566	2.179000	0.69175	0.533000	0.62120	AAT	-	tigrfam_HCO3_transpt_euk		0.413	SLC4A7-001	KNOWN	basic|CCDS	protein_coding	SLC4A7	protein_coding	OTTHUMT00000341230.2	T	NM_003615	-		27453211	-1	no_errors	ENST00000454389	ensembl	human	known	74_37	missense	SNP	1.000	C
ZC3H13	23091	genome.wustl.edu	37	13	46619628	46619628	+	Silent	SNP	T	T	C			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr13:46619628T>C	ENST00000242848.4	-	2	363	c.15A>G	c.(13-15)agA>agG	p.R5R	ZC3H13_ENST00000282007.3_Silent_p.R5R			Q5T200	ZC3HD_HUMAN	zinc finger CCCH-type containing 13	5							metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|lung(25)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	79		Lung NSC(96;7.26e-05)|Breast(56;0.000118)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;4.18e-05)		TGACCTTCCTTCTAATTTTTG	0.403																																					Esophageal Squamous(187;747 2077 11056 31291 44172)												0								ENSG00000123200						178.0	183.0	181.0					13																	46619628		2203	4300	6503	ZC3H13	SO:0001819	synonymous_variant	0			-	HGNC	AB020660	CCDS9400.1	13q14.11	2012-07-05	2006-05-15	2006-05-15	ENSG00000123200	ENSG00000123200		"""Zinc fingers, CCCH-type domain containing"""	20368	protein-coding gene	gene with protein product			"""KIAA0853"""	KIAA0853		10048485	Standard	XM_005266301		Approved	DKFZp434D1812	uc001vas.1	Q5T200	OTTHUMG00000016863	ENST00000242848.4:c.15A>G	13.37:g.46619628T>C		Somatic	0	31	0.00		0.7032168817119823	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	18	14.29	A2A323|O94936|Q5T1Z9|Q7Z7J3|Q8NDT6|Q9H0L6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_CCCH,smart_Znf_CCCH	p.R5	ENST00000242848.4	37	c.15		13																																																																																			-	NULL		0.403	ZC3H13-001	KNOWN	basic|appris_candidate_longest	protein_coding	ZC3H13	protein_coding	OTTHUMT00000044789.1	T	NM_015070	-		46619628	-1	no_errors	ENST00000242848	ensembl	human	known	74_37	silent	SNP	1.000	C
CUL1	8454	genome.wustl.edu	37	7	148494904	148494904	+	Splice_Site	SNP	G	G	C			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr7:148494904G>C	ENST00000325222.4	+	18	2179	c.1900G>C	c.(1900-1902)Gac>Cac	p.D634H	CUL1_ENST00000602748.1_Splice_Site_p.D634H|CUL1_ENST00000409469.1_Splice_Site_p.D634H	NM_003592.2	NP_003583.2	Q13616	CUL1_HUMAN	cullin 1	634					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway (GO:0097193)|mitotic cell cycle (GO:0000278)|negative regulation of cell proliferation (GO:0008285)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein monoubiquitination (GO:0006513)|protein ubiquitination (GO:0016567)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|viral process (GO:0016032)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|SCF ubiquitin ligase complex (GO:0019005)				breast(2)|central_nervous_system(2)|endometrium(1)|kidney(5)|large_intestine(10)|liver(2)|lung(10)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	40	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00291)			TTAATTGCAGGACATTTTGGC	0.358																																																	0								ENSG00000055130						96.0	96.0	96.0					7																	148494904		2203	4300	6503	CUL1	SO:0001630	splice_region_variant	0			-	HGNC	U58087	CCDS34772.1	7q36.1	2011-05-24			ENSG00000055130	ENSG00000055130			2551	protein-coding gene	gene with protein product		603134				8681378	Standard	NM_003592		Approved		uc003wey.3	Q13616	OTTHUMG00000152776	ENST00000325222.4:c.1900-1G>C	7.37:g.148494904G>C		Somatic	0	59	0.00		0.7032168817119823	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	38	32	54.29	D3DWG3|O60719|Q08AL6|Q8IYW1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cullin_N,pfam_Cullin_neddylation_domain,superfamily_Cullin_repeat-like_dom,superfamily_Cullin_homology,smart_Cullin_homology,smart_Cullin_neddylation_domain,pfscan_Cullin_homology	p.D634H	ENST00000325222.4	37	c.1900	CCDS34772.1	7	.	.	.	.	.	.	.	.	.	.	.	15.39	2.820799	0.50633	.	.	ENSG00000055130	ENST00000409469;ENST00000325222;ENST00000543583;ENST00000433865	T;T	0.75821	-0.97;-0.97	4.89	4.89	0.63831	Cullin, N-terminal (1);Winged helix-turn-helix transcription repressor DNA-binding (1);Cullin homology (2);	0.048371	0.85682	D	0.000000	T	0.73133	0.3548	M	0.66506	2.035	0.80722	D	1	B;B	0.30406	0.113;0.278	B;B	0.30855	0.046;0.121	T	0.71537	-0.4563	9	.	.	.	-34.6695	17.0586	0.86541	0.0:0.0:1.0:0.0	.	561;634	E7EWR0;Q13616	.;CUL1_HUMAN	H	634;634;592;561	ENSP00000387160:D634H;ENSP00000326804:D634H	.	D	+	1	0	CUL1	148125837	1.000000	0.71417	1.000000	0.80357	0.538000	0.34931	9.430000	0.97488	2.263000	0.75096	0.313000	0.20887	GAC	-	pfam_Cullin_N,superfamily_Cullin_homology,pfscan_Cullin_homology		0.358	CUL1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CUL1	protein_coding	OTTHUMT00000467785.1	G	NM_003592	-	Missense_Mutation	148494904	+1	no_errors	ENST00000325222	ensembl	human	known	74_37	missense	SNP	1.000	C
FRG2FP	100128827	genome.wustl.edu	37	3	197838274	197838274	+	RNA	DEL	A	A	-	rs398052594|rs71623397	byFrequency	TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr3:197838274delA	ENST00000419104.1	+	0	396																											GCTTGATGTTAAAAAAAAAAA	0.478													|||unknown(HR)	2434	0.486022	0.4153	0.5303	5008	,	,		21832	0.5992		0.4443	False		,,,				2504	0.4765																0								ENSG00000232783																																			AC073135.3			0				Clone_based_vega_gene																													3.37:g.197838274delA		Somatic	0	11	0.00		0.7032168817119823	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	26	18.75		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000419104.1	37	NULL		3																																																																																			-	-		0.478	AC073135.3-003	KNOWN	basic	processed_transcript	ENSG00000232783	pseudogene	OTTHUMT00000339698.1	A				197838274	+1	no_errors	ENST00000411596	ensembl	human	known	74_37	rna	DEL	0.001	-
RASAL2	9462	genome.wustl.edu	37	1	178269251	178269251	+	Missense_Mutation	SNP	T	T	G			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr1:178269251T>G	ENST00000367649.3	+	3	807	c.455T>G	c.(454-456)cTg>cGg	p.L152R	RASAL2_ENST00000448150.3_Missense_Mutation_p.L134R			Q9UJF2	NGAP_HUMAN	RAS protein activator like 2	0	PH.				negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	Ras GTPase activator activity (GO:0005099)			biliary_tract(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(2)|lung(25)|ovary(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	54						GCCACTAAACTGGGTAAGCTA	0.458											OREG0014010	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000075391						56.0	59.0	58.0					1																	178269251		2203	4300	6503	RASAL2	SO:0001583	missense	0			-	HGNC	AF047711	CCDS1321.1, CCDS1322.1, CCDS1321.2	1q25	2013-01-10			ENSG00000075391	ENSG00000075391		"""Pleckstrin homology (PH) domain containing"""	9874	protein-coding gene	gene with protein product	"""Ras GTPase activating protein-like"", ""Ras protein activator like 1"""	606136				9877179	Standard	NM_004841		Approved	nGAP	uc001glq.3	Q9UJF2	OTTHUMG00000035022	ENST00000367649.3:c.455T>G	1.37:g.178269251T>G	ENSP00000356621:p.Leu152Arg	Somatic	0	41	0.00	1945	0.7032168817119823	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	28	41.67	F8W755|O95174|Q2TB22|Q5TFU9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF3498,pfam_RasGAP,pfam_Pleckstrin_homology,pfam_C2_dom,superfamily_Rho_GTPase_activation_prot,superfamily_C2_dom,superfamily_PP1_inhibitor,smart_Pleckstrin_homology,smart_C2_dom,smart_RasGAP,pfscan_Pleckstrin_homology,pfscan_RasGAP	p.L152R	ENST00000367649.3	37	c.455	CCDS1321.2	1	.	.	.	.	.	.	.	.	.	.	T	21.6	4.178999	0.78564	.	.	ENSG00000075391	ENST00000448150;ENST00000367649	T;T	0.20881	2.07;2.04	5.61	5.61	0.85477	.	0.490245	0.19404	N	0.115110	T	0.37433	0.1003	L	0.36672	1.1	0.51767	D	0.999932	D	0.69078	0.997	D	0.78314	0.991	T	0.07028	-1.0794	10	0.56958	D	0.05	.	15.0834	0.72133	0.0:0.0:0.0:1.0	.	152	F8W755	.	R	134;152	ENSP00000407768:L134R;ENSP00000356621:L152R	ENSP00000356621:L152R	L	+	2	0	RASAL2	176535874	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.728000	0.68531	2.254000	0.74563	0.533000	0.62120	CTG	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology		0.458	RASAL2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RASAL2	protein_coding	OTTHUMT00000352415.1	T	NM_170692	-		178269251	+1	no_errors	ENST00000367649	ensembl	human	known	74_37	missense	SNP	1.000	G
MAP2K2	5605	genome.wustl.edu	37	19	4099304	4099304	+	Missense_Mutation	SNP	C	C	T			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr19:4099304C>T	ENST00000262948.5	-	7	1067	c.814G>A	c.(814-816)Gcc>Acc	p.A272T	MAP2K2_ENST00000394867.4_Missense_Mutation_p.A175T|MAP2K2_ENST00000599345.1_5'Flank	NM_030662.3	NP_109587.1	P36507	MP2K2_HUMAN	mitogen-activated protein kinase kinase 2	272	Pro-rich.|Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERK1 and ERK2 cascade (GO:0070371)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|MAPK cascade (GO:0000165)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine autophosphorylation (GO:0036289)|positive regulation of cell motility (GO:2000147)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|Ras protein signal transduction (GO:0007265)|regulation of early endosome to late endosome transport (GO:2000641)|regulation of Golgi inheritance (GO:0090170)|regulation of stress-activated MAPK cascade (GO:0032872)|small GTPase mediated signal transduction (GO:0007264)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cell cortex (GO:0005938)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|late endosome (GO:0005770)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|peroxisomal membrane (GO:0005778)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|PDZ domain binding (GO:0030165)|protein serine/threonine kinase activator activity (GO:0043539)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|scaffold protein binding (GO:0097110)						Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0149)|STAD - Stomach adenocarcinoma(1328;0.18)	Bosutinib(DB06616)|Trametinib(DB08911)	AGCTCTTTGGCGTCGGGCGGG	0.687																																																	0								ENSG00000126934						14.0	16.0	15.0					19																	4099304		2198	4296	6494	MAP2K2	SO:0001583	missense	0			-	HGNC	L11285	CCDS12120.1	19p13.3	2014-09-17			ENSG00000126934	ENSG00000126934	2.7.12.2	"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6842	protein-coding gene	gene with protein product		601263		PRKMK2		8388392	Standard	NM_030662		Approved	MEK2	uc002lzk.3	P36507	OTTHUMG00000134286	ENST00000262948.5:c.814G>A	19.37:g.4099304C>T	ENSP00000262948:p.Ala272Thr	Somatic	0	55	0.00		0.7032168817119823	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	47	38.16		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.A272T	ENST00000262948.5	37	c.814	CCDS12120.1	19	.	.	.	.	.	.	.	.	.	.	c	14.81	2.646264	0.47258	.	.	ENSG00000126934	ENST00000262948;ENST00000394867	T;T	0.65178	-0.14;-0.14	4.53	2.27	0.28462	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.317119	0.33938	N	0.004415	T	0.41650	0.1168	N	0.21097	0.63	0.43457	D	0.99565	B	0.15719	0.014	B	0.19946	0.027	T	0.28073	-1.0055	10	0.27082	T	0.32	-26.8413	6.599	0.22691	0.1812:0.7179:0.0:0.1008	.	272	P36507	MP2K2_HUMAN	T	272;175	ENSP00000262948:A272T;ENSP00000378336:A175T	ENSP00000262948:A272T	A	-	1	0	MAP2K2	4050304	0.843000	0.29541	0.983000	0.44433	0.989000	0.77384	1.636000	0.37144	2.252000	0.74401	0.549000	0.68633	GCC	-	pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.687	MAP2K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP2K2	protein_coding	OTTHUMT00000258957.2	C		-		4099304	-1	no_errors	ENST00000262948	ensembl	human	known	74_37	missense	SNP	0.995	T
MARS	4141	genome.wustl.edu	37	12	57883288	57883288	+	Missense_Mutation	SNP	C	C	G			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr12:57883288C>G	ENST00000262027.5	+	4	495	c.361C>G	c.(361-363)Ctg>Gtg	p.L121V	MARS_ENST00000447721.2_Intron|ARHGAP9_ENST00000550288.1_5'Flank|MARS_ENST00000315473.5_5'UTR|ARHGAP9_ENST00000393797.2_5'Flank	NM_004990.3	NP_004981.2	P56192	SYMC_HUMAN	methionyl-tRNA synthetase	121	GST C-terminal.				gene expression (GO:0010467)|methionyl-tRNA aminoacylation (GO:0006431)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|methionine-tRNA ligase activity (GO:0004825)|tRNA binding (GO:0000049)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(8)|ovary(3)|pancreas(1)|prostate(2)|skin(1)	33			GBM - Glioblastoma multiforme(3;4.27e-41)		L-Methionine(DB00134)	GCGGAGAGCCCTGACTCACAT	0.522																																																	0								ENSG00000166986						159.0	146.0	150.0					12																	57883288		2203	4300	6503	MARS	SO:0001583	missense	0			-	HGNC	X94754	CCDS8942.1	12q13.3	2014-05-06	2007-02-26		ENSG00000166986	ENSG00000166986	6.1.1.10	"""Aminoacyl tRNA synthetases / Class I"""	6898	protein-coding gene	gene with protein product	"""methionine tRNA ligase 1, cytoplasmic"""	156560				10448063, 24482476	Standard	NM_004990		Approved	MetRS, SPG70	uc001sog.3	P56192	OTTHUMG00000169996	ENST00000262027.5:c.361C>G	12.37:g.57883288C>G	ENSP00000262027:p.Leu121Val	Somatic	0	22	0.00		0.7032168817119823	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	4	63.64	B3KVK7|Q14895|Q53H14|Q96A15|Q96BZ0|Q9NSE0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Methionyl/Leucyl_tRNA_Synth,pfam_WHEP-TRS,superfamily_tRNAsynth_1a_anticodon-bd,superfamily_Glutathione-S-Trfase_C-like,superfamily_S15_NS1_RNA-bd,superfamily_Thioredoxin-like_fold,pfscan_WHEP-TRS,prints_Met-tRNA_synth,tigrfam_Met-tRNA_synth	p.L121V	ENST00000262027.5	37	c.361	CCDS8942.1	12	.	.	.	.	.	.	.	.	.	.	C	6.614	0.481621	0.12581	.	.	ENSG00000166986	ENST00000262027	T	0.77229	-1.08	5.1	1.21	0.21127	Glutathione S-transferase, C-terminal-like (2);Glutathione S-transferase/chloride channel, C-terminal (1);	0.000000	0.64402	D	0.000005	T	0.65112	0.2660	L	0.42245	1.32	0.80722	D	1	B	0.33238	0.403	B	0.30316	0.114	T	0.56450	-0.7977	10	0.30078	T	0.28	-9.3015	9.7008	0.40184	0.0:0.6272:0.0:0.3728	.	121	P56192	SYMC_HUMAN	V	121	ENSP00000262027:L121V	ENSP00000262027:L121V	L	+	1	2	MARS	56169555	0.785000	0.28726	0.997000	0.53966	0.040000	0.13550	0.805000	0.27112	0.288000	0.22398	-0.794000	0.03295	CTG	-	superfamily_Glutathione-S-Trfase_C-like		0.522	MARS-003	KNOWN	basic|appris_principal|CCDS	protein_coding	MARS	protein_coding	OTTHUMT00000407014.1	C	NM_004990	-		57883288	+1	no_errors	ENST00000262027	ensembl	human	known	74_37	missense	SNP	0.998	G
DRAM1	55332	genome.wustl.edu	37	12	102302067	102302067	+	Missense_Mutation	SNP	C	C	T			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr12:102302067C>T	ENST00000258534.8	+	4	885	c.446C>T	c.(445-447)cCc>cTc	p.P149L	DRAM1_ENST00000544152.1_Intron	NM_018370.2	NP_060840.2	Q8N682	DRAM1_HUMAN	DNA-damage regulated autophagy modulator 1	149					apoptotic process (GO:0006915)|autophagy (GO:0006914)|regulation of autophagy (GO:0010506)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)				central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)|skin(1)	12						AAATCATGTCCCCAGTGGAAC	0.512																																																	0								ENSG00000136048						191.0	188.0	189.0					12																	102302067		2069	4211	6280	DRAM1	SO:0001583	missense	0			-	HGNC	BC018435, DA721965	CCDS41823.1	12q23.2	2014-02-12	2009-06-12		ENSG00000136048	ENSG00000136048			25645	protein-coding gene	gene with protein product	"""damage-regulated autophagy modulator"""	610776				16839881	Standard	NM_018370		Approved	FLJ11259, DRAM	uc001tix.3	Q8N682		ENST00000258534.8:c.446C>T	12.37:g.102302067C>T	ENSP00000258534:p.Pro149Leu	Somatic	0	28	0.00		0.7032168817119823	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	13	40.91	B7Z4T0|Q7L3E3|Q9NUN1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Frag1/DRAM/Sfk1	p.P149L	ENST00000258534.8	37	c.446	CCDS41823.1	12	.	.	.	.	.	.	.	.	.	.	C	24.9	4.581917	0.86748	.	.	ENSG00000136048	ENST00000258534	T	0.43294	0.95	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	T	0.68915	0.3053	M	0.82823	2.61	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.68561	-0.5376	10	0.40728	T	0.16	.	19.2868	0.94082	0.0:1.0:0.0:0.0	.	149	Q8N682	DRAM1_HUMAN	L	149	ENSP00000258534:P149L	ENSP00000258534:P149L	P	+	2	0	DRAM1	100826198	1.000000	0.71417	0.999000	0.59377	0.628000	0.37860	5.184000	0.65070	2.653000	0.90120	0.643000	0.83706	CCC	-	pfam_Frag1/DRAM/Sfk1		0.512	DRAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DRAM1	protein_coding	OTTHUMT00000409195.1	C	NM_018370	-		102302067	+1	no_errors	ENST00000258534	ensembl	human	known	74_37	missense	SNP	1.000	T
EFCAB2	84288	genome.wustl.edu	37	1	245133623	245133624	+	Frame_Shift_Ins	INS	-	-	CCTCC	rs145835471|rs78699431|rs373891984	byFrequency	TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr1:245133623_245133624insCCTCC	ENST00000366522.2	+	1	340_341	c.199_200insCCTCC	c.(199-201)tccfs	p.S67fs	EFCAB2_ENST00000366523.1_Intron|RP11-156E8.1_ENST00000607453.1_Frame_Shift_Ins_p.R252fs|EFCAB2_ENST00000447569.2_5'Flank			Q5VUJ9	EFCB2_HUMAN	EF-hand calcium binding domain 2	67							calcium ion binding (GO:0005509)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)|stomach(2)	13	all_cancers(71;2.93e-06)|all_epithelial(71;2.13e-05)|all_lung(81;0.0337)|Lung NSC(105;0.0472)|Ovarian(71;0.0584)|Breast(184;0.0716)|all_neural(11;0.0982)		OV - Ovarian serous cystadenocarcinoma(106;0.015)			GAGCGGCCCCTCCTCCAGGCCA	0.743														2490	0.497204	0.2315	0.415	5008	,	,		8334	0.7272		0.5517	False		,,,				2504	0.6217																0								ENSG00000203666																																			EFCAB2	SO:0001589	frameshift_variant	0				HGNC	AB209286	CCDS31082.1, CCDS44341.1	1q44	2014-07-18			ENSG00000203666	ENSG00000203666		"""EF-hand domain containing"""	28166	protein-coding gene	gene with protein product	"""dynein regulatory complex subunit 8"""					23427265	Standard	NM_032328		Approved	MGC12458, DRC8, CFAP200	uc001ibc.2	Q5VUJ9	OTTHUMG00000040474	ENST00000366522.2:c.200_204dupCCTCC	1.37:g.245133624_245133628dupCCTCC	ENSP00000355479:p.Ser67fs	Somatic	NA	NA	NA		0.7032168817119823	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B4DZE9|Q59G23|Q9BS36	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	smart_EF_hand_dom,pfscan_EF_hand_dom	p.R69fs	ENST00000366522.2	37	c.199_200		1																																																																																			-	NULL		0.743	EFCAB2-001	KNOWN	basic	protein_coding	EFCAB2	protein_coding	OTTHUMT00000097407.2	-				245133624	+1	no_errors	ENST00000366522	ensembl	human	known	74_37	frame_shift_ins	INS	0.000:0.000	CCTCC
GOLGA2P7	388152	genome.wustl.edu	37	15	84873329	84873329	+	RNA	SNP	C	C	T			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr15:84873329C>T	ENST00000559668.1	-	0	452				AC136698.1_ENST00000408081.1_RNA|RN7SL331P_ENST00000461138.2_RNA	NR_049748.1																						CTCCCCCCAGCGGTGCCCTAG	0.597																																																	0								ENSG00000225151																																			AC103965.1			0			-	Clone_based_vega_gene																													15.37:g.84873329C>T		Somatic	0	13	0.00		0.7032168817119823	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	13	35.00		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000559668.1	37	NULL		15																																																																																			-	-		0.597	AC103965.1-008	KNOWN	basic	processed_transcript	LOC101929847	pseudogene	OTTHUMT00000418802.1	C		-		84873329	-1	no_errors	ENST00000561015	ensembl	human	known	74_37	rna	SNP	0.219	T
CEL	1056	genome.wustl.edu	37	9	135945988	135945988	+	Missense_Mutation	SNP	A	A	G	rs201074543	byFrequency	TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr9:135945988A>G	ENST00000372080.4	+	10	1452	c.1436A>G	c.(1435-1437)cAa>cGa	p.Q479R	CEL_ENST00000351304.7_Intron	NM_001807.3	NP_001798.2	P19835	CEL_HUMAN	carboxyl ester lipase	476					cholesterol catabolic process (GO:0006707)|fatty acid catabolic process (GO:0009062)|intestinal cholesterol absorption (GO:0030299)|intestinal lipid catabolic process (GO:0044258)|lipid digestion (GO:0044241)|lipid metabolic process (GO:0006629)|pancreatic juice secretion (GO:0030157)|protein esterification (GO:0018350)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	acylglycerol lipase activity (GO:0047372)|catalytic activity (GO:0003824)|heparin binding (GO:0008201)|hydrolase activity (GO:0016787)|sterol esterase activity (GO:0004771)|triglyceride lipase activity (GO:0004806)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(9)|pancreas(2)|skin(1)	20				OV - Ovarian serous cystadenocarcinoma(145;1.03e-40)|Epithelial(140;3.58e-37)|GBM - Glioblastoma multiforme(294;0.00164)|READ - Rectum adenocarcinoma(205;0.196)		TACCGGCCCCAAGACAGGACA	0.607													A|||	4	0.000798722	0.0	0.0058	5008	,	,		19512	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000170835						83.0	94.0	91.0					9																	135945988		1992	4156	6148	CEL	SO:0001583	missense	0			-	HGNC	M54994	CCDS43896.1	9q34.3	2013-03-13	2013-03-13		ENSG00000170835	ENSG00000170835	3.1.1.3, 3.1.1.13		1848	protein-coding gene	gene with protein product	"""bile salt-stimulated lipase"""	114840				1676983	Standard	NM_001807		Approved	BSSL, MODY8	uc010naa.2	P19835	OTTHUMG00000020855	ENST00000372080.4:c.1436A>G	9.37:g.135945988A>G	ENSP00000361151:p.Gln479Arg	Somatic	0	48	0.00		0.7032168817119823	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	40	11.11	Q16398|Q5T7U7|Q9UCH1|Q9UP41	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_CarbesteraseB,pfam_AB_hydrolase_3	p.Q479R	ENST00000372080.4	37	c.1436	CCDS43896.1	9	.	.	.	.	.	.	.	.	.	.	A	10.08	1.253212	0.22965	.	.	ENSG00000170835	ENST00000372080;ENST00000303626	T	0.66099	-0.19	5.69	4.52	0.55395	Carboxylesterase, type B (1);	0.353337	0.32785	N	0.005644	T	0.35364	0.0929	N	0.02315	-0.6	0.80722	D	1	B	0.23540	0.087	B	0.20184	0.028	T	0.13710	-1.0499	10	0.35671	T	0.21	.	11.3338	0.49492	0.8638:0.0:0.0:0.1362	.	476	P19835	CEL_HUMAN	R	479;478	ENSP00000361151:Q479R	ENSP00000304021:Q478R	Q	+	2	0	CEL	134935809	0.976000	0.34144	0.074000	0.20217	0.366000	0.29705	4.432000	0.59922	0.945000	0.37605	0.386000	0.25728	CAA	-	pfam_CarbesteraseB		0.607	CEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEL	protein_coding	OTTHUMT00000054823.1	A		rs201074543		135945988	+1	no_errors	ENST00000372080	ensembl	human	known	74_37	missense	SNP	0.831	G
CNTNAP2	26047	genome.wustl.edu	37	7	148112884	148112884	+	3'UTR	SNP	C	C	A	rs200052441		TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr7:148112884C>A	ENST00000361727.3	+	0	4688				CNTNAP2_ENST00000538075.1_3'UTR|CNTNAP2_ENST00000463592.2_3'UTR	NM_014141.5	NP_054860.1	Q9UHC6	CNTP2_HUMAN	contactin associated protein-like 2						adult behavior (GO:0030534)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|cerebral cortex development (GO:0021987)|clustering of voltage-gated potassium channels (GO:0045163)|learning (GO:0007612)|limbic system development (GO:0021761)|neuron projection development (GO:0031175)|neuron recognition (GO:0008038)|protein localization to juxtaparanode region of axon (GO:0071205)|social behavior (GO:0035176)|striatum development (GO:0021756)|superior temporal gyrus development (GO:0071109)|thalamus development (GO:0021794)|transmission of nerve impulse (GO:0019226)|vocalization behavior (GO:0071625)	axolemma (GO:0030673)|axon (GO:0030424)|cell surface (GO:0009986)|dendrite (GO:0030425)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|juxtaparanode region of axon (GO:0044224)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|voltage-gated potassium channel complex (GO:0008076)	enzyme binding (GO:0019899)			NS(3)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(105)|ovary(9)|pancreas(2)|prostate(5)|skin(7)|stomach(3)|upper_aerodigestive_tract(6)|urinary_tract(3)	188	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			AAAAAAAAAACCTTTTTAATA	0.313										HNSCC(39;0.1)																																							0								ENSG00000174469																																			CNTNAP2	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AF193613	CCDS5889.1	7q35	2008-02-04			ENSG00000174469	ENSG00000174469			13830	protein-coding gene	gene with protein product		604569				10624965, 10048485	Standard	NM_014141		Approved	Caspr2, KIAA0868, NRXN4	uc003weu.2	Q9UHC6	OTTHUMG00000152743	ENST00000361727.3:c.*176C>A	7.37:g.148112884C>A		Somatic	0	46	0.00		0.7032168817119823	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	35	10.26	D3DWG2|Q14DG2|Q52LV1|Q5H9Q7|Q9UQ12	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000361727.3	37	NULL	CCDS5889.1	7																																																																																			-	-		0.313	CNTNAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP2	protein_coding	OTTHUMT00000327668.1	C		rs200052441		148112884	+1	no_errors	ENST00000463592	ensembl	human	known	74_37	rna	SNP	0.958	A
SRRM2	23524	genome.wustl.edu	37	16	2812100	2812100	+	Missense_Mutation	SNP	G	G	C			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr16:2812100G>C	ENST00000301740.8	+	11	2120	c.1571G>C	c.(1570-1572)aGa>aCa	p.R524T		NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	524	Arg-rich.|Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						AGGTGGGGAAGATCTAGAAGC	0.592																																																	0								ENSG00000167978						72.0	63.0	66.0					16																	2812100		2198	4300	6498	SRRM2	SO:0001583	missense	0			-	HGNC	AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.1571G>C	16.37:g.2812100G>C	ENSP00000301740:p.Arg524Thr	Somatic	0	24	0.00		0.7032168817119823	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	26	23.53	A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_mRNA_splic_Cwf21	p.R524T	ENST00000301740.8	37	c.1571	CCDS32373.1	16	.	.	.	.	.	.	.	.	.	.	G	12.84	2.058824	0.36277	.	.	ENSG00000167978	ENST00000301740;ENST00000382301;ENST00000426305	T	0.29397	1.57	5.91	2.89	0.33648	.	0.331639	0.25692	N	0.028926	T	0.17492	0.0420	N	0.19112	0.55	0.26132	N	0.980403	B	0.27498	0.18	B	0.24269	0.052	T	0.13656	-1.0501	10	0.45353	T	0.12	-1.7673	7.4897	0.27454	0.271:0.0:0.729:0.0	.	524	Q9UQ35	SRRM2_HUMAN	T	524;524;489	ENSP00000301740:R524T	ENSP00000301740:R524T	R	+	2	0	SRRM2	2752101	0.812000	0.29077	0.929000	0.37066	0.999000	0.98932	1.872000	0.39549	0.391000	0.25143	0.655000	0.94253	AGA	-	NULL		0.592	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRRM2	protein_coding	OTTHUMT00000436411.1	G		-		2812100	+1	no_errors	ENST00000301740	ensembl	human	known	74_37	missense	SNP	0.931	C
ZFPL1	7542	genome.wustl.edu	37	11	64852291	64852291	+	Intron	SNP	C	C	T			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr11:64852291C>T	ENST00000294258.3	+	2	254				CDCA5_ENST00000404147.3_5'Flank|ZFPL1_ENST00000525509.1_Nonsense_Mutation_p.R41*|ZFPL1_ENST00000526791.1_Nonsense_Mutation_p.R41*|CDCA5_ENST00000275517.3_5'Flank	NM_006782.3	NP_006773.2	O95159	ZFPL1_HUMAN	zinc finger protein-like 1						regulation of transcription, DNA-templated (GO:0006355)|vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|skin(1)	11						TTCAGGGGAGCGACTGAGCAG	0.592																																																	0								ENSG00000162300						47.0	43.0	44.0					11																	64852291		2201	4297	6498	ZFPL1	SO:0001627	intron_variant	0			-	HGNC		CCDS8092.1	11q13	2013-01-08			ENSG00000162300	ENSG00000162300			12868	protein-coding gene	gene with protein product	"""zinc-finger protein in MEN1 region"""					9653652	Standard	NM_006782		Approved	D11S750, MCG4	uc001ocq.1	O95159	OTTHUMG00000165597	ENST00000294258.3:c.102+19C>T	11.37:g.64852291C>T		Somatic	0	39	0.00		0.7032168817119823	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	0	100.00	A8K7E9|O14616|Q9UID0	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.R41*	ENST00000294258.3	37	c.121	CCDS8092.1	11	.	.	.	.	.	.	.	.	.	.	C	33	5.218152	0.95104	.	.	ENSG00000162300	ENST00000525509;ENST00000526791	.	.	.	4.92	-4.68	0.03309	.	.	.	.	.	.	.	.	.	.	.	0.36529	D	0.870645	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	0.1404	0.00082	0.2507:0.223:0.2476:0.2787	.	.	.	.	X	41	.	ENSP00000433673:R41X	R	+	1	2	ZFPL1	64608867	0.000000	0.05858	0.000000	0.03702	0.882000	0.50991	-2.607000	0.00887	-0.401000	0.07644	0.561000	0.74099	CGA	-	NULL		0.592	ZFPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFPL1	protein_coding	OTTHUMT00000385196.1	C	NM_006782	-		64852291	+1	no_errors	ENST00000525509	ensembl	human	putative	74_37	nonsense	SNP	0.000	T
MT1G	4495	genome.wustl.edu	37	16	56701216	56701216	+	Intron	SNP	G	G	T			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr16:56701216G>T	ENST00000379811.3	-	2	169				MT1G_ENST00000569500.1_Intron|MT1G_ENST00000444837.2_Intron|MT1H_ENST00000569155.1_5'Flank|MT1H_ENST00000332374.4_5'Flank|MT1G_ENST00000568675.1_Nonsense_Mutation_p.C34*			P13640	MT1G_HUMAN	metallothionein 1G						cellular response to cadmium ion (GO:0071276)|cellular response to copper ion (GO:0071280)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|cellular response to zinc ion (GO:0071294)|monocyte activation (GO:0042117)|monocyte differentiation (GO:0030224)|negative regulation of growth (GO:0045926)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	zinc ion binding (GO:0008270)			kidney(2)|large_intestine(1)|lung(2)	5						AGATGGCCCCGCACTCACTCT	0.582																																																	0								ENSG00000125144						47.0	48.0	48.0					16																	56701216		2198	4297	6495	MT1G	SO:0001627	intron_variant	0			-	HGNC	BC020757	CCDS10766.1	16q13	2008-02-05			ENSG00000125144	ENSG00000125144		"""Metallothioneins"""	7399	protein-coding gene	gene with protein product	"""metallothionein 1K"""	156353		MT1		3403543, 6089206	Standard	NM_001301267		Approved	MT1K	uc002eju.1	P13640	OTTHUMG00000133275	ENST00000379811.3:c.97+7C>A	16.37:g.56701216G>T		Somatic	0	72	0.00		0.7032168817119823	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	49	12.50	P80296	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Metalthion_sfam_euk,superfamily_Metalthion_dom	p.C34*	ENST00000379811.3	37	c.102		16																																																																																			-	pfam_Metalthion_sfam_euk		0.582	MT1G-001	KNOWN	basic	protein_coding	MT1G	protein_coding	OTTHUMT00000257054.1	G	NM_005950	-		56701216	-1	no_errors	ENST00000568675	ensembl	human	putative	74_37	nonsense	SNP	0.025	T
KANK2	25959	genome.wustl.edu	37	19	11303728	11303729	+	Frame_Shift_Ins	INS	-	-	C			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr19:11303728_11303729insC	ENST00000586659.1	-	4	1341_1342	c.1027_1028insG	c.(1027-1029)gccfs	p.A343fs	KANK2_ENST00000432929.2_Frame_Shift_Ins_p.A343fs|KANK2_ENST00000589359.1_Frame_Shift_Ins_p.A343fs|KANK2_ENST00000589894.1_Frame_Shift_Ins_p.A343fs|KANK2_ENST00000355150.5_Frame_Shift_Ins_p.A343fs			Q63ZY3	KANK2_HUMAN	KN motif and ankyrin repeat domains 2	343					apoptotic process (GO:0006915)|negative regulation of cell proliferation (GO:0008285)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of programmed cell death (GO:0043069)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)				endometrium(2)|large_intestine(1)|lung(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14						GGCTGTGCTGGCCACCACCTCC	0.728																																																	0								ENSG00000197256																																			KANK2	SO:0001589	frameshift_variant	0				HGNC	AK000011	CCDS12255.1, CCDS54219.1	19p13.2	2013-01-10	2008-01-29	2008-01-29		ENSG00000197256		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	29300	protein-coding gene	gene with protein product		614610	"""matrix-remodelling associated 3"", ""ankyrin repeat domain 25"""	MXRA3, ANKRD25		10819331, 17996375, 19554261	Standard	NM_015493		Approved	KIAA1518	uc002mqm.3	Q63ZY3		ENST00000586659.1:c.1028dupG	19.37:g.11303730_11303730dupC	ENSP00000465650:p.Ala343fs	Somatic	0	33	0.00		0.7032168817119823	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	32	13.51	B0I1P4|Q3KQZ3|Q6GUF5|Q9H8S4|Q9NUP0|Q9P210	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_Ankyrin_rpt,pfam_KN_motif,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.A343fs	ENST00000586659.1	37	c.1028_1027	CCDS12255.1	19																																																																																			-	NULL		0.728	KANK2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KANK2	protein_coding	OTTHUMT00000453066.2	-	NM_015493			11303729	-1	no_errors	ENST00000432929	ensembl	human	known	74_37	frame_shift_ins	INS	0.984:0.975	C
FGFR1	2260	genome.wustl.edu	37	8	38283652	38283652	+	Silent	SNP	G	G	A			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr8:38283652G>A	ENST00000447712.2	-	6	1674	c.733C>T	c.(733-735)Ctg>Ttg	p.L245L	FGFR1_ENST00000341462.5_Silent_p.L246L|FGFR1_ENST00000356207.5_Silent_p.L156L|FGFR1_ENST00000326324.6_Silent_p.L154L|FGFR1_ENST00000397113.2_Silent_p.L243L|FGFR1_ENST00000397091.5_Silent_p.L243L|FGFR1_ENST00000532791.1_Silent_p.L245L|FGFR1_ENST00000335922.5_Silent_p.L237L|RP11-350N15.4_ENST00000528407.1_RNA|FGFR1_ENST00000397108.4_Silent_p.L243L|FGFR1_ENST00000425967.3_Silent_p.L276L|FGFR1_ENST00000397103.1_Silent_p.L154L	NM_001174063.1|NM_015850.3|NM_023110.2	NP_001167534.1|NP_056934.2|NP_075598.2	P11362	FGFR1_HUMAN	fibroblast growth factor receptor 1	245	Ig-like C2-type 2.		L -> P (in HH2). {ECO:0000269|PubMed:16882753}.		angiogenesis (GO:0001525)|auditory receptor cell development (GO:0060117)|axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell maturation (GO:0048469)|cell migration (GO:0016477)|chondrocyte differentiation (GO:0002062)|chordate embryonic development (GO:0043009)|embryonic limb morphogenesis (GO:0030326)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|fibroblast growth factor receptor signaling pathway involved in orbitofrontal cortex development (GO:0035607)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|insulin receptor signaling pathway (GO:0008286)|lung-associated mesenchyme development (GO:0060484)|MAPK cascade (GO:0000165)|mesenchymal cell differentiation (GO:0048762)|midbrain development (GO:0030901)|middle ear morphogenesis (GO:0042474)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ induction (GO:0001759)|outer ear morphogenesis (GO:0042473)|paraxial mesoderm development (GO:0048339)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of phospholipase C activity (GO:0010863)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of branching involved in salivary gland morphogenesis by mesenchymal-epithelial signaling (GO:0060665)|regulation of cell differentiation (GO:0045595)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|regulation of lateral mesodermal cell fate specification (GO:0048378)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|skeletal system morphogenesis (GO:0048705)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ventricular zone neuroblast division (GO:0021847)	cytoplasmic vesicle (GO:0031410)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)		FGFR1/ZNF703(2)	breast(2)|central_nervous_system(7)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(18)|ovary(1)|prostate(1)|stomach(2)|urinary_tract(2)	50	all_cancers(2;9.05e-47)|all_epithelial(2;2.64e-50)|all_lung(3;1.71e-23)|Lung NSC(2;3.61e-23)|Colorectal(12;0.000442)	Breast(189;1.48e-05)|all_lung(54;0.00354)|Lung NSC(58;0.0138)|Hepatocellular(245;0.065)	Epithelial(3;3.96e-34)|all cancers(3;3.06e-30)|BRCA - Breast invasive adenocarcinoma(5;2.28e-21)|COAD - Colon adenocarcinoma(9;0.24)		Palifermin(DB00039)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)	ACGACATCCAGCTGGTATGTG	0.547		1	T	"""BCR, FOP, ZNF198, CEP1"""	"""MPD, NHL"""		"""Pfeiffer syndrome, Kallman syndrome"""				OREG0018722	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									Melanoma(146;1153 1840 21453 21841 43625)			Dom	yes		8	8p11.2-p11.1	2260	fibroblast growth factor receptor 1	yes	L	0								ENSG00000077782						187.0	182.0	184.0					8																	38283652		2049	4218	6267	FGFR1	SO:0001819	synonymous_variant	0			-	HGNC	M34185	CCDS6107.2, CCDS43730.1, CCDS43731.1, CCDS43732.1, CCDS55221.1, CCDS55222.1, CCDS55223.1	8p11.23-p11.22	2014-04-03	2008-08-01		ENSG00000077782	ENSG00000077782	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3688	protein-coding gene	gene with protein product	"""Pfeiffer syndrome"""	136350	"""fms-related tyrosine kinase 2"""	FLT2, KAL2		2162671	Standard	NM_015850		Approved	H2, H3, H4, H5, CEK, FLG, BFGFR, N-SAM, CD331	uc011lbu.2	P11362	OTTHUMG00000147366	ENST00000447712.2:c.733C>T	8.37:g.38283652G>A		Somatic	0	26	0.00	877	0.7032168817119823	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	31	11.43	A8K6T9|A8K8V5|C1KBH8|P17049|Q02063|Q02065|Q14306|Q14307|Q53H63|Q59H40|Q5BJG2|Q8N685|Q9UD50|Q9UDF0|Q9UDF1|Q9UDF2	Silent	SNP	NA	NA	NA	NA	NA	NA	pirsf_FGF_rcpt_fam,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.L276	ENST00000447712.2	37	c.826	CCDS6107.2	8																																																																																			-	pirsf_FGF_rcpt_fam,pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like_dom		0.547	FGFR1-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FGFR1	protein_coding		G		-		38283652	-1	no_errors	ENST00000425967	ensembl	human	known	74_37	silent	SNP	1.000	A
BAZ1B	9031	genome.wustl.edu	37	7	72856562	72856562	+	Silent	SNP	G	G	T			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr7:72856562G>T	ENST00000339594.4	-	19	4754	c.4416C>A	c.(4414-4416)gcC>gcA	p.A1472A	BAZ1B_ENST00000404251.1_Silent_p.A1472A	NM_032408.3	NP_115784.1	Q9UIG0	BAZ1B_HUMAN	bromodomain adjacent to zinc finger domain, 1B	1472					cellular response to DNA damage stimulus (GO:0006974)|chromatin assembly or disassembly (GO:0006333)|chromatin-mediated maintenance of transcription (GO:0048096)|double-strand break repair (GO:0006302)|heart morphogenesis (GO:0003007)|histone phosphorylation (GO:0016572)|peptidyl-tyrosine phosphorylation (GO:0018108)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed chromosome (GO:0000793)|nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|histone kinase activity (GO:0035173)|lysine-acetylated histone binding (GO:0070577)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)|vitamin D receptor activator activity (GO:0071884)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(12)|lung(20)|ovary(5)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	61		Lung NSC(55;0.0659)|all_lung(88;0.152)				ACTGTCCAACGGCCTCTGGCT	0.587																																					Esophageal Squamous(112;1167 1561 21085 43672 48228)												0								ENSG00000009954						166.0	167.0	166.0					7																	72856562		2203	4300	6503	BAZ1B	SO:0001819	synonymous_variant	0			-	HGNC	AF084479	CCDS5549.1	7q11.23	2013-01-28			ENSG00000009954	ENSG00000009954		"""Zinc fingers, PHD-type"""	961	protein-coding gene	gene with protein product	"""Williams-Beuren syndrome chromosome region 9"", ""Williams-Beuren syndrome chromosome region 10"", ""transcription factor WSTF"""	605681		WBSCR9, WBSCR10		9858827, 9828126	Standard	NM_032408		Approved	WSTF	uc003tyc.3	Q9UIG0	OTTHUMG00000023847	ENST00000339594.4:c.4416C>A	7.37:g.72856562G>T		Somatic	0	36	0.00		0.7032168817119823	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	28	14.71	B9EGK3|D3DXE9|O95039|O95247|O95277|Q6P1K4|Q86UJ6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_WSTF_Acf1_Cbp146,pfam_Bromodomain,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,superfamily_ARM-type_fold,smart_DDT_dom_subgr,smart_Znf_PHD,smart_Bromodomain,pfscan_WSTF_Acf1_Cbp146,pfscan_Znf_PHD-finger,pfscan_Znf_RING,pfscan_DDT_dom_superfamily,pfscan_Bromodomain,prints_Bromodomain	p.A1472	ENST00000339594.4	37	c.4416	CCDS5549.1	7																																																																																			-	NULL		0.587	BAZ1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAZ1B	protein_coding	OTTHUMT00000252123.4	G	NM_032408	-		72856562	-1	no_errors	ENST00000339594	ensembl	human	known	74_37	silent	SNP	0.001	T
