#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
PRKDC	5591	genome.wustl.edu	37	8	48866457	48866457	+	Silent	SNP	G	G	A			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr8:48866457G>A	ENST00000314191.2	-	6	587	c.531C>T	c.(529-531)ctC>ctT	p.L177L	PRKDC_ENST00000523565.1_5'UTR|PRKDC_ENST00000338368.3_Silent_p.L177L	NM_006904.6	NP_008835.5	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic polypeptide	177					B cell lineage commitment (GO:0002326)|brain development (GO:0007420)|cellular protein modification process (GO:0006464)|cellular response to insulin stimulus (GO:0032869)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|ectopic germ cell programmed cell death (GO:0035234)|heart development (GO:0007507)|immunoglobulin V(D)J recombination (GO:0033152)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of protein phosphorylation (GO:0001933)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|pro-B cell differentiation (GO:0002328)|protein destabilization (GO:0031648)|regulation of circadian rhythm (GO:0042752)|response to gamma radiation (GO:0010332)|rhythmic process (GO:0048511)|signal transduction involved in mitotic G1 DNA damage checkpoint (GO:0072431)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell receptor V(D)J recombination (GO:0033153)|telomere maintenance (GO:0000723)	cytosol (GO:0005829)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription factor binding (GO:0008134)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(9)|cervix(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(30)|lung(56)|ovary(6)|pancreas(1)|prostate(8)|skin(7)	147		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)			Caffeine(DB00201)	ATAATCCTAGGAGCTCATATA	0.338								Non-homologous end-joining																													Esophageal Squamous(79;1091 1253 12329 31680 40677)												0								ENSG00000253729						48.0	42.0	43.0					8																	48866457		1786	4050	5836	PRKDC	SO:0001819	synonymous_variant	0			-	HGNC		CCDS75734.1, CCDS75735.1	8q11	2014-09-17				ENSG00000253729	2.7.11.1		9413	protein-coding gene	gene with protein product		600899		HYRC, HYRC1		7638222	Standard	NM_001081640		Approved	DNPK1, p350, DNAPK, XRCC7, DNA-PKcs	uc003xqi.3	P78527		ENST00000314191.2:c.531C>T	8.37:g.48866457G>A		Somatic	0	14	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	7	61.11	P78528|Q13327|Q13337|Q14175|Q59H99|Q7Z611|Q96SE6|Q9UME3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_NUC194,pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.L177	ENST00000314191.2	37	c.531		8																																																																																			-	superfamily_ARM-type_fold		0.338	PRKDC-201	KNOWN	basic|appris_principal	protein_coding	PRKDC	protein_coding		G	NM_001081640	-		48866457	-1	no_errors	ENST00000314191	ensembl	human	known	74_37	silent	SNP	0.879	A
SMARCAL1	50485	genome.wustl.edu	37	2	217332668	217332668	+	Splice_Site	SNP	G	G	T			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr2:217332668G>T	ENST00000357276.4	+	14	2473	c.2143G>T	c.(2143-2145)Gaa>Taa	p.E715*	SMARCAL1_ENST00000358207.5_Splice_Site_p.E715*	NM_014140.3	NP_054859.2	Q9NZC9	SMAL1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a-like 1	715					cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|DNA metabolic process (GO:0006259)|DNA strand renaturation (GO:0000733)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|replication fork processing (GO:0031297)	nucleus (GO:0005634)|site of double-strand break (GO:0035861)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)			NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(10)|liver(1)|lung(15)|ovary(3)|prostate(1)|skin(1)	42		Renal(323;0.0458)		Epithelial(149;9.48e-06)|all cancers(144;0.000621)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0111)		CAAATGCAGTGAATATATCTT	0.363									Schimke Immuno-Osseous Dysplasia																																								0								ENSG00000138375						153.0	146.0	148.0					2																	217332668		2203	4300	6503	SMARCAL1	SO:0001630	splice_region_variant	0	Familial Cancer Database	SIOD	-	HGNC	AF210833	CCDS2403.1	2q35	2014-09-17			ENSG00000138375	ENSG00000138375			11102	protein-coding gene	gene with protein product	"""HepA-related protein"", ""ATP-driven annealing helicase"""	606622				10713074, 10857751, 18974355	Standard	NM_014140		Approved	HHARP, HARP	uc002vgd.4	Q9NZC9	OTTHUMG00000133055	ENST00000357276.4:c.2142-1G>T	2.37:g.217332668G>T		Somatic	0	17	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	5	44.44	A6NEH0|Q53R00|Q96AY1|Q9NXQ5|Q9UFH3|Q9UI93	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_HARP_dom,pfam_SNF2_N,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.E715*	ENST00000357276.4	37	c.2143	CCDS2403.1	2	.	.	.	.	.	.	.	.	.	.	G	40	8.193393	0.98699	.	.	ENSG00000138375	ENST00000357276;ENST00000358207;ENST00000392128	.	.	.	4.76	4.76	0.60689	.	0.051263	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	-20.7682	16.9465	0.86231	0.0:0.0:1.0:0.0	.	.	.	.	X	715;715;557	.	ENSP00000349823:E715X	E	+	1	0	SMARCAL1	217040913	1.000000	0.71417	0.982000	0.44146	0.422000	0.31414	9.063000	0.93927	2.472000	0.83506	0.655000	0.94253	GAA	-	superfamily_P-loop_NTPase		0.363	SMARCAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMARCAL1	protein_coding	OTTHUMT00000256671.2	G		-	Nonsense_Mutation	217332668	+1	no_errors	ENST00000357276	ensembl	human	known	74_37	nonsense	SNP	1.000	T
TNPO3	23534	genome.wustl.edu	37	7	128655088	128655088	+	Missense_Mutation	SNP	C	C	T			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr7:128655088C>T	ENST00000265388.5	-	4	640	c.497G>A	c.(496-498)cGc>cAc	p.R166H	TNPO3_ENST00000471234.1_Missense_Mutation_p.R166H|TNPO3_ENST00000393245.1_Missense_Mutation_p.R166H|TNPO3_ENST00000471166.1_Missense_Mutation_p.R166H|TNPO3_ENST00000482320.1_Missense_Mutation_p.R100H			Q9Y5L0	TNPO3_HUMAN	transportin 3	166					splicing factor protein import into nucleus (GO:0035048)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	receptor activity (GO:0004872)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(7)|ovary(2)|prostate(2)|skin(3)	22						AATTTCTGTGCGCCGATTAGC	0.393																																					Pancreas(147;583 2585 39696 52331)												0								ENSG00000064419						115.0	108.0	110.0					7																	128655088		2203	4300	6503	TNPO3	SO:0001583	missense	0			-	HGNC	AF145029	CCDS5809.1, CCDS55162.1	7q32.2	2014-02-03			ENSG00000064419	ENSG00000064419		"""Importins"""	17103	protein-coding gene	gene with protein product	"""importin 12"""	610032	"""limb girdle muscular dystrophy 1F (autosomal dominant)"""	LGMD1F		10366588, 10713112, 23543484, 23667635	Standard	NM_012470		Approved	TRN-SR, MTR10A, TRN-SR2, IPO12	uc003vol.2	Q9Y5L0	OTTHUMG00000158409	ENST00000265388.5:c.497G>A	7.37:g.128655088C>T	ENSP00000265388:p.Arg166His	Somatic	0	31	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	25	13.79	A4D1K9|C9IZM0|Q6NUM1|Q96G71|Q96GU9|Q9Y3R2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Exportin-1/Importin-b-like,superfamily_ARM-type_fold	p.R166H	ENST00000265388.5	37	c.497	CCDS5809.1	7	.	.	.	.	.	.	.	.	.	.	C	31	5.095316	0.94197	.	.	ENSG00000064419	ENST00000393245;ENST00000265388;ENST00000482320;ENST00000471234;ENST00000471166	T;T;T;T;T	0.71934	-0.61;-0.61;-0.61;-0.61;-0.61	5.62	5.62	0.85841	Exportin-1/Importin-beta-like (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.85725	0.5763	M	0.86268	2.805	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.999	D	0.86259	0.1654	10	0.48119	T	0.1	.	17.1461	0.86767	0.0:1.0:0.0:0.0	.	166;166;166	C9IZM0;C9J7E5;Q9Y5L0	.;.;TNPO3_HUMAN	H	166;166;100;166;166	ENSP00000376936:R166H;ENSP00000265388:R166H;ENSP00000420089:R100H;ENSP00000418646:R166H;ENSP00000418267:R166H	ENSP00000265388:R166H	R	-	2	0	TNPO3	128442324	1.000000	0.71417	0.924000	0.36721	0.743000	0.42351	7.772000	0.85439	2.634000	0.89283	0.591000	0.81541	CGC	-	pfam_Exportin-1/Importin-b-like,superfamily_ARM-type_fold		0.393	TNPO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNPO3	protein_coding	OTTHUMT00000350929.1	C	NM_012470	-		128655088	-1	no_errors	ENST00000393245	ensembl	human	known	74_37	missense	SNP	0.999	T
MYH2	4620	genome.wustl.edu	37	17	10436721	10436721	+	Silent	SNP	A	A	G	rs371676280		TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr17:10436721A>G	ENST00000245503.5	-	21	2706	c.2322T>C	c.(2320-2322)ggT>ggC	p.G774G	MYH2_ENST00000397183.2_Silent_p.G774G|RP11-799N11.1_ENST00000581304.1_RNA|CTC-297N7.11_ENST00000587182.2_RNA|MYH2_ENST00000532183.2_Intron|RP11-799N11.1_ENST00000399342.2_RNA	NM_017534.5	NP_060004.3	Q9UKX2	MYH2_HUMAN	myosin, heavy chain 2, skeletal muscle, adult	774	Actin-binding. {ECO:0000250}.|Myosin motor.				Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|plasma membrane repair (GO:0001778)|response to activity (GO:0014823)	A band (GO:0031672)|actomyosin contractile ring (GO:0005826)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|protein complex (GO:0043234)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(99)|ovary(6)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(4)	176						GCCCCAGAAGACCAGCTTTGA	0.478																																																	0								ENSG00000125414						78.0	79.0	79.0					17																	10436721		2203	4300	6503	MYH2	SO:0001819	synonymous_variant	0			-	HGNC		CCDS11156.1	17p13.1	2014-02-04	2006-09-29		ENSG00000125414	ENSG00000125414		"""Myosins / Myosin superfamily : Class II"""	7572	protein-coding gene	gene with protein product		160740	"""myosin, heavy polypeptide 2, skeletal muscle, adult"", ""inclusion body myopathy 3, autosomal dominant"""	IBM3		7545970, 11889243	Standard	NM_001100112		Approved	MYH2A, MYHSA2, MyHC-IIa, MYHas8, MyHC-2A	uc010coi.3	Q9UKX2	OTTHUMG00000130363	ENST00000245503.5:c.2322T>C	17.37:g.10436721A>G		Somatic	0	41	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	17	43.33	A0AVL4|Q14322|Q16229|Q567P6|Q86T56	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,superfamily_Ribosomal_L29,superfamily_t-SNARE,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.G774	ENST00000245503.5	37	c.2322	CCDS11156.1	17																																																																																			-	superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom		0.478	MYH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH2	protein_coding	OTTHUMT00000252726.3	A	NM_017534	-		10436721	-1	no_errors	ENST00000245503	ensembl	human	known	74_37	silent	SNP	1.000	G
PLEK	5341	genome.wustl.edu	37	2	68620322	68620322	+	Missense_Mutation	SNP	G	G	T	rs531564877		TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr2:68620322G>T	ENST00000234313.7	+	7	970	c.791G>T	c.(790-792)aGg>aTg	p.R264M		NM_002664.2	NP_002655.2	P08567	PLEK_HUMAN	pleckstrin	264	PH 2. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin cytoskeleton reorganization (GO:0031532)|blood coagulation (GO:0007596)|cell projection organization (GO:0030030)|cortical actin cytoskeleton organization (GO:0030866)|hematopoietic progenitor cell differentiation (GO:0002244)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of calcium-mediated signaling (GO:0050849)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|negative regulation of inositol phosphate biosynthetic process (GO:0010920)|phosphatidylinositol metabolic process (GO:0046488)|phospholipase C-inhibiting G-protein coupled receptor signaling pathway (GO:0030845)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of actin filament bundle assembly (GO:0032233)|positive regulation of actin filament depolymerization (GO:0030836)|positive regulation of inositol-polyphosphate 5-phosphatase activity (GO:0010925)|positive regulation of integrin activation (GO:0033625)|positive regulation of platelet activation (GO:0010572)|protein kinase C signaling (GO:0070528)|protein secretion by platelet (GO:0070560)|regulation of cell diameter (GO:0060305)|ruffle organization (GO:0031529)|thrombin receptor signaling pathway (GO:0070493)|vesicle docking involved in exocytosis (GO:0006904)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|membrane (GO:0016020)|ruffle membrane (GO:0032587)	phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|protein homodimerization activity (GO:0042803)|protein kinase C binding (GO:0005080)			autonomic_ganglia(1)|endometrium(3)|large_intestine(6)|lung(12)|ovary(1)|skin(1)	24		Ovarian(717;0.0129)		STAD - Stomach adenocarcinoma(1183;0.00159)|READ - Rectum adenocarcinoma(193;0.0419)		TGGAAAGTGAGGAAGTTCATC	0.428																																																	0								ENSG00000115956						185.0	167.0	173.0					2																	68620322		2203	4300	6503	PLEK	SO:0001583	missense	0			-	HGNC	X07743	CCDS1887.1	2p13.3	2013-01-10			ENSG00000115956	ENSG00000115956		"""Pleckstrin homology (PH) domain containing"""	9070	protein-coding gene	gene with protein product		173570				2897630, 12054651	Standard	NM_002664		Approved	P47	uc002sen.4	P08567	OTTHUMG00000129562	ENST00000234313.7:c.791G>T	2.37:g.68620322G>T	ENSP00000234313:p.Arg264Met	Somatic	0	41	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	20	16.67	B2R9E8|Q53SU8|Q6FGM8|Q6FGQ1|Q8WV81	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Pleckstrin_homology,pfam_DEP_dom,smart_Pleckstrin_homology,smart_DEP_dom,pfscan_DEP_dom,pfscan_Pleckstrin_homology	p.R264M	ENST00000234313.7	37	c.791	CCDS1887.1	2	.	.	.	.	.	.	.	.	.	.	G	32	5.173719	0.94807	.	.	ENSG00000115956	ENST00000234313	T	0.48522	0.81	5.77	5.77	0.91146	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.85682	D	0.000000	T	0.81375	0.4809	H	0.97465	4.01	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.996;0.999	D	0.87465	0.2410	10	0.87932	D	0	.	19.6065	0.95583	0.0:0.0:1.0:0.0	.	282;264	Q59GZ2;P08567	.;PLEK_HUMAN	M	264	ENSP00000234313:R264M	ENSP00000234313:R264M	R	+	2	0	PLEK	68473826	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.405000	0.97313	2.744000	0.94065	0.561000	0.74099	AGG	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology		0.428	PLEK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEK	protein_coding	OTTHUMT00000251755.1	G	NM_002664	-		68620322	+1	no_errors	ENST00000234313	ensembl	human	known	74_37	missense	SNP	1.000	T
MAGEC1	9947	genome.wustl.edu	37	X	140996552	140996552	+	Missense_Mutation	SNP	C	C	T			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chrX:140996552C>T	ENST00000285879.4	+	4	3648	c.3362C>T	c.(3361-3363)aCa>aTa	p.T1121I	MAGEC1_ENST00000406005.2_Missense_Mutation_p.T188I	NM_005462.4	NP_005453.2	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	1121										breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(22)|lung(60)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(1)	127	Acute lymphoblastic leukemia(192;6.56e-05)					ATTGACACCACAGATGATTCG	0.473										HNSCC(15;0.026)																																							0								ENSG00000155495						97.0	83.0	87.0					X																	140996552		2203	4300	6503	MAGEC1	SO:0001583	missense	0			-	HGNC	AF064589	CCDS35417.1	Xq26	2009-03-18			ENSG00000155495	ENSG00000155495			6812	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 1"""	300223				9485030, 9618514	Standard	NM_005462		Approved	MAGE-C1, CT7, MGC39366, CT7.1	uc004fbt.3	O60732	OTTHUMG00000022569	ENST00000285879.4:c.3362C>T	X.37:g.140996552C>T	ENSP00000285879:p.Thr1121Ile	Somatic	0	22	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	10	23.08	A0PK03|O75451|Q8TCV4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MAGE,pfscan_MAGE	p.T1121I	ENST00000285879.4	37	c.3362	CCDS35417.1	X	.	.	.	.	.	.	.	.	.	.	c	2.075	-0.412091	0.04799	.	.	ENSG00000155495	ENST00000285879;ENST00000406005	T;T	0.04970	4.45;3.52	1.06	-0.116	0.13555	.	.	.	.	.	T	0.13713	0.0332	M	0.62723	1.935	0.09310	N	1	D	0.58970	0.984	P	0.59595	0.86	T	0.14172	-1.0482	9	0.72032	D	0.01	.	3.7477	0.08554	0.4272:0.5728:0.0:0.0	.	1121	O60732	MAGC1_HUMAN	I	1121;188	ENSP00000285879:T1121I;ENSP00000385500:T188I	ENSP00000285879:T1121I	T	+	2	0	MAGEC1	140824218	0.000000	0.05858	0.002000	0.10522	0.056000	0.15407	0.188000	0.17018	-0.085000	0.12573	0.279000	0.19357	ACA	-	NULL		0.473	MAGEC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAGEC1	protein_coding	OTTHUMT00000058604.1	C	NM_005462	-		140996552	+1	no_errors	ENST00000285879	ensembl	human	known	74_37	missense	SNP	0.002	T
GNPTAB	79158	genome.wustl.edu	37	12	102155456	102155456	+	Missense_Mutation	SNP	G	G	T			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr12:102155456G>T	ENST00000299314.7	-	14	3063	c.2801C>A	c.(2800-2802)tCc>tAc	p.S934Y		NM_024312.4	NP_077288.2	Q3T906	GNPTA_HUMAN	N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits	934					carbohydrate phosphorylation (GO:0046835)|cell differentiation (GO:0030154)|lysosome organization (GO:0007040)|protein secretion (GO:0009306)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|UDP-N-acetylglucosamine-lysosomal-enzyme N-acetylglucosaminephosphotransferase activity (GO:0003976)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(8)|lung(8)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	37						ATATCTGAGGGAATCTGCAAA	0.383																																																	0								ENSG00000111670						174.0	165.0	168.0					12																	102155456		2203	4300	6503	GNPTAB	SO:0001583	missense	0			-	HGNC	AY687932	CCDS9088.1	12q23.3	2013-01-10				ENSG00000111670		"""EF-hand domain containing"""	29670	protein-coding gene	gene with protein product		607840		GNPTA		10574462, 16116615	Standard	NM_024312		Approved	KIAA1208, MGC4170	uc001tit.3	Q3T906	OTTHUMG00000170444	ENST00000299314.7:c.2801C>A	12.37:g.102155456G>T	ENSP00000299314:p.Ser934Tyr	Somatic	0	34	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	26	13.33	A2RRQ9|Q3ZQK2|Q6IPW5|Q86TQ2|Q96N13|Q9ULL2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DMAP1-bd,pfam_Notch_dom,pfam_DUF3184,superfamily_Notch_dom,smart_Notch_dom,pfscan_EF_hand_dom,pfscan_Notch_dom	p.S934Y	ENST00000299314.7	37	c.2801	CCDS9088.1	12	.	.	.	.	.	.	.	.	.	.	G	24.6	4.545517	0.86022	.	.	ENSG00000111670	ENST00000299314	D	0.92149	-2.98	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	D	0.96676	0.8915	M	0.84948	2.725	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.96719	0.9531	10	0.87932	D	0	-19.6086	20.0374	0.97568	0.0:0.0:1.0:0.0	.	934	Q3T906	GNPTA_HUMAN	Y	934	ENSP00000299314:S934Y	ENSP00000299314:S934Y	S	-	2	0	GNPTAB	100679587	1.000000	0.71417	1.000000	0.80357	0.751000	0.42716	9.476000	0.97823	2.739000	0.93911	0.655000	0.94253	TCC	-	NULL		0.383	GNPTAB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNPTAB	protein_coding	OTTHUMT00000409182.1	G		-		102155456	-1	no_errors	ENST00000299314	ensembl	human	known	74_37	missense	SNP	1.000	T
ZNF629	23361	genome.wustl.edu	37	16	30794309	30794309	+	Missense_Mutation	SNP	C	C	T			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr16:30794309C>T	ENST00000262525.4	-	3	1547	c.1340G>A	c.(1339-1341)cGc>cAc	p.R447H	RP11-2C24.6_ENST00000575562.1_RNA	NM_001080417.1	NP_001073886.1	Q9UEG4	ZN629_HUMAN	zinc finger protein 629	447					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(3)|urinary_tract(1)	22			Colorectal(24;0.198)			GCGCTGGTGGCGGATAAGGGT	0.627																																																	0								ENSG00000102870						74.0	83.0	80.0					16																	30794309		2197	4300	6497	ZNF629	SO:0001583	missense	0			-	HGNC	AB002324	CCDS45463.1	16p11.2	2013-01-08				ENSG00000102870		"""Zinc fingers, C2H2-type"""	29008	protein-coding gene	gene with protein product			"""zinc finger protein 65"""	ZNF65		9205841	Standard	NM_001080417		Approved	KIAA0326	uc002dzs.1	Q9UEG4		ENST00000262525.4:c.1340G>A	16.37:g.30794309C>T	ENSP00000262525:p.Arg447His	Somatic	0	52	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	38	13.64	Q15938	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R447H	ENST00000262525.4	37	c.1340	CCDS45463.1	16	.	.	.	.	.	.	.	.	.	.	C	15.44	2.833828	0.50951	.	.	ENSG00000102870	ENST00000262525	T	0.26810	1.71	5.79	5.79	0.91817	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.45606	D	0.000353	T	0.44582	0.1300	L	0.55743	1.74	0.34078	D	0.659292	D	0.89917	1.0	D	0.83275	0.996	T	0.54337	-0.8309	10	0.44086	T	0.13	-61.6949	12.1679	0.54141	0.0:0.921:0.0:0.079	.	447	Q9UEG4	ZN629_HUMAN	H	447	ENSP00000262525:R447H	ENSP00000262525:R447H	R	-	2	0	ZNF629	30701810	0.000000	0.05858	1.000000	0.80357	0.997000	0.91878	-1.273000	0.02823	2.735000	0.93741	0.561000	0.74099	CGC	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.627	ZNF629-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF629	protein_coding	OTTHUMT00000434291.1	C	NM_015309	-		30794309	-1	no_errors	ENST00000262525	ensembl	human	known	74_37	missense	SNP	1.000	T
NFATC1	4772	genome.wustl.edu	37	18	77170842	77170842	+	Silent	SNP	C	C	T	rs140225213	byFrequency	TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr18:77170842C>T	ENST00000427363.2	+	2	567	c.567C>T	c.(565-567)taC>taT	p.Y189Y	NFATC1_ENST00000329101.4_Silent_p.Y176Y|NFATC1_ENST00000318065.5_Silent_p.Y176Y|NFATC1_ENST00000545796.1_Intron|NFATC1_ENST00000253506.5_Silent_p.Y189Y|NFATC1_ENST00000586434.1_Silent_p.Y176Y|NFATC1_ENST00000592223.1_Silent_p.Y176Y|NFATC1_ENST00000397790.2_Intron|NFATC1_ENST00000587635.1_Silent_p.Y189Y|NFATC1_ENST00000542384.1_Silent_p.Y189Y|NFATC1_ENST00000591814.1_Silent_p.Y189Y			O95644	NFAC1_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 1	189	Trans-activation domain A (TAD-A).				calcium ion transport (GO:0006816)|epithelial to mesenchymal transition (GO:0001837)|Fc-epsilon receptor signaling pathway (GO:0038095)|G1/S transition of mitotic cell cycle (GO:0000082)|heart development (GO:0007507)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|osteoclast differentiation (GO:0030316)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	FK506 binding (GO:0005528)|mitogen-activated protein kinase p38 binding (GO:0048273)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			NS(2)|breast(1)|endometrium(7)|kidney(1)|large_intestine(4)|lung(17)|ovary(2)|prostate(4)|skin(1)|soft_tissue(1)	40		Esophageal squamous(42;0.0157)|Melanoma(33;0.144)		OV - Ovarian serous cystadenocarcinoma(15;3.73e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0257)	Pseudoephedrine(DB00852)	CCTCCTCCTACGAGTCCAACT	0.672													C|||	2	0.000399361	0.0015	0.0	5008	,	,		15602	0.0		0.0	False		,,,				2504	0.0				GBM(151;1210 2593 28719 45011)												0								ENSG00000131196	C	,,,,	14,4392	21.2+/-45.6	0,14,2189	60.0	64.0	63.0		567,528,,528,567	-4.3	0.9	18	dbSNP_134	63	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,intron,coding-synonymous,coding-synonymous	NFATC1	NM_006162.3,NM_172387.1,NM_172388.1,NM_172389.1,NM_172390.1	,,,,	0,14,6489	TT,TC,CC		0.0,0.3177,0.1076	,,,,	189/826,176/931,,176/813,189/717	77170842	14,12992	2203	4300	6503	NFATC1	SO:0001819	synonymous_variant	0			GMAF=0.0005	HGNC	U08015	CCDS12015.1, CCDS12016.1, CCDS32850.1, CCDS59326.1, CCDS59327.1, CCDS62467.1, CCDS62468.1, CCDS62469.1, CCDS62470.1, CCDS62471.1	18q23	2009-11-24			ENSG00000131196	ENSG00000131196		"""Nuclear factor of activated T-cells"""	7775	protein-coding gene	gene with protein product		600489				8202141	Standard	NM_001278669		Approved	NF-ATC, NFATc, NFAT2	uc002lnf.3	O95644	OTTHUMG00000132897	ENST00000427363.2:c.567C>T	18.37:g.77170842C>T		Somatic	0	30	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	38	11.63	B5B2M4|B5B2M5|B5B2M6|B5B2M7|B5B2M8|B5B2M9|B5B2N1|Q12865|Q15793|Q2M1S3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_RHD,pfam_IPT,superfamily_p53-like_TF_DNA-bd,superfamily_Ig_E-set,smart_IPT,pfscan_RHD,prints_NFAT	p.Y189	ENST00000427363.2	37	c.567		18																																																																																			-	NULL		0.672	NFATC1-007	KNOWN	basic	protein_coding	NFATC1	protein_coding	OTTHUMT00000450507.1	C	NM_172390	rs140225213		77170842	+1	no_errors	ENST00000427363	ensembl	human	known	74_37	silent	SNP	0.595	T
RBBP6	5930	genome.wustl.edu	37	16	24583338	24583338	+	Missense_Mutation	SNP	T	T	A			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr16:24583338T>A	ENST00000319715.4	+	18	5383	c.4951T>A	c.(4951-4953)Tct>Act	p.S1651T	RBBP6_ENST00000348022.2_Missense_Mutation_p.S1617T|RBBP6_ENST00000381039.3_Missense_Mutation_p.S811T	NM_006910.4	NP_008841.2	Q7Z6E9	RBBP6_HUMAN	retinoblastoma binding protein 6	1651					embryonic organ development (GO:0048568)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|somite development (GO:0061053)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(17)|ovary(4)|pancreas(1)|prostate(2)|urinary_tract(1)	46				GBM - Glioblastoma multiforme(48;0.0518)		AAGTAATGTTTCTGTAAAAGA	0.383																																																	0								ENSG00000122257						74.0	82.0	80.0					16																	24583338		2195	4299	6494	RBBP6	SO:0001583	missense	0			-	HGNC		CCDS10621.1, CCDS10622.1, CCDS45444.1	16p12.2	2008-08-04	2001-11-28		ENSG00000122257	ENSG00000122257			9889	protein-coding gene	gene with protein product	"""proliferation potential-related protein"""	600938	"""retinoblastoma-binding protein 6"""			8595913, 16396680	Standard	NM_006910		Approved	P2P-R, PACT, SNAMA	uc002dmh.3	Q7Z6E9	OTTHUMG00000096991	ENST00000319715.4:c.4951T>A	16.37:g.24583338T>A	ENSP00000317872:p.Ser1651Thr	Somatic	0	18	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	10	37.50	Q147T5|Q15290|Q6DKH4|Q6P4C2|Q6YNC9|Q7Z6E8|Q8N0V2|Q96PH3|Q9H3I8|Q9H5M5|Q9NPX4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DWNN_domain,pfam_Ubox_domain,pfam_Znf_CCHC,superfamily_Znf_CCHC,smart_Znf_CCHC,smart_Znf_RING,pfscan_Znf_RING,pfscan_Znf_CCHC	p.S1651T	ENST00000319715.4	37	c.4951	CCDS10621.1	16	.	.	.	.	.	.	.	.	.	.	T	17.13	3.309580	0.60414	.	.	ENSG00000122257	ENST00000381039;ENST00000319715;ENST00000348022	T;T;T	0.23754	1.89;2.21;2.18	5.94	5.94	0.96194	.	0.000000	0.64402	D	0.000005	T	0.39733	0.1089	L	0.29908	0.895	0.41902	D	0.990425	D;D;D	0.71674	0.998;0.998;0.997	D;D;D	0.80764	0.994;0.994;0.985	T	0.12760	-1.0535	10	0.36615	T	0.2	-18.3689	16.3951	0.83601	0.0:0.0:0.0:1.0	.	811;1617;1651	Q7Z6E9-4;Q7Z6E9-2;Q7Z6E9	.;.;RBBP6_HUMAN	T	811;1651;1617	ENSP00000370427:S811T;ENSP00000317872:S1651T;ENSP00000316291:S1617T	ENSP00000317872:S1651T	S	+	1	0	RBBP6	24490839	1.000000	0.71417	0.783000	0.31826	0.921000	0.55340	6.810000	0.75216	2.272000	0.75746	0.460000	0.39030	TCT	-	NULL		0.383	RBBP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBBP6	protein_coding	OTTHUMT00000214067.2	T	NM_006910	-		24583338	+1	no_errors	ENST00000319715	ensembl	human	known	74_37	missense	SNP	0.998	A
PIWIL1	9271	genome.wustl.edu	37	12	130831551	130831551	+	Silent	SNP	T	T	C			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr12:130831551T>C	ENST00000245255.3	+	6	869	c.597T>C	c.(595-597)aaT>aaC	p.N199N		NM_001190971.1|NM_004764.4	NP_001177900.1|NP_004755.2	Q96J94	PIWL1_HUMAN	piwi-like RNA-mediated gene silencing 1	199					gene silencing by RNA (GO:0031047)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|regulation of translation (GO:0006417)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|mRNA cap binding complex (GO:0005845)|P granule (GO:0043186)|polysome (GO:0005844)	mRNA binding (GO:0003729)|piRNA binding (GO:0034584)|single-stranded RNA binding (GO:0003727)			breast(6)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(26)|ovary(2)|prostate(4)|skin(3)|urinary_tract(1)	57	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;3.02e-06)|Epithelial(86;3.85e-05)|all cancers(50;4.65e-05)		CTTTAACAAATGAACTTCCAC	0.348																																																	0								ENSG00000125207						127.0	121.0	123.0					12																	130831551		2203	4300	6503	PIWIL1	SO:0001819	synonymous_variant	0			-	HGNC	AF104260	CCDS9268.1	12q24.33	2014-01-21	2013-02-15		ENSG00000125207	ENSG00000125207		"""Argonaute/PIWI family"""	9007	protein-coding gene	gene with protein product		605571	"""piwi (Drosophila)-like 1"", ""piwi-like 1 (Drosophila)"""			9851978, 12906857	Standard	NM_004764		Approved	PIWI, HIWI, CT80.1	uc001uik.3	Q96J94	OTTHUMG00000168382	ENST00000245255.3:c.597T>C	12.37:g.130831551T>C		Somatic	0	35	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	32	11.11	A4F266|O95404|Q8NA60|Q8TBY5|Q96JD5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Piwi,pfam_PAZ_dom,pfam_GAGE,superfamily_RNaseH-like_dom,superfamily_PAZ_dom,smart_PAZ_dom,smart_Piwi,pfscan_PAZ_dom,pfscan_Piwi	p.N199	ENST00000245255.3	37	c.597	CCDS9268.1	12																																																																																			-	superfamily_PAZ_dom		0.348	PIWIL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIWIL1	protein_coding	OTTHUMT00000399510.1	T		-		130831551	+1	no_errors	ENST00000245255	ensembl	human	known	74_37	silent	SNP	0.999	C
HPSE2	60495	genome.wustl.edu	37	10	100401673	100401673	+	Silent	SNP	G	G	C			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr10:100401673G>C	ENST00000370552.3	-	7	1088	c.1029C>G	c.(1027-1029)gtC>gtG	p.V343V	HPSE2_ENST00000404542.1_Silent_p.V231V|HPSE2_ENST00000370546.1_Silent_p.V343V|HPSE2_ENST00000370549.1_Silent_p.V285V	NM_021828.4	NP_068600.4	Q8WWQ2	HPSE2_HUMAN	heparanase 2 (inactive)	343					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	intracellular (GO:0005622)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	heparan sulfate proteoglycan binding (GO:0043395)|heparanase activity (GO:0030305)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(14)|lung(15)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	40				Epithelial(162;1.8e-09)|all cancers(201;4.72e-07)		CCATCACCTTGACCACCCGGC	0.398																																																	0								ENSG00000172987						164.0	173.0	170.0					10																	100401673		2203	4300	6503	HPSE2	SO:0001819	synonymous_variant	0			-	HGNC	AF282885	CCDS7477.1, CCDS53567.1, CCDS53568.1	10q23-q24	2014-05-09	2014-05-09		ENSG00000172987	ENSG00000172987			18374	protein-coding gene	gene with protein product		613469	"""urofacial syndrome"", ""heparanase 2"""	UFS		11027606, 20605132, 9199567, 20576607	Standard	NM_021828		Approved	HPA2, HPR2	uc001kpn.2	Q8WWQ2	OTTHUMG00000018880	ENST00000370552.3:c.1029C>G	10.37:g.100401673G>C		Somatic	0	31	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	50	9.09	Q5VUH4|Q5VUH5|Q5VUH6|Q8WWQ1|Q9HB37|Q9HB38|Q9HB39	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Glyco_hydro_79,superfamily_Glycoside_hydrolase_SF	p.V343	ENST00000370552.3	37	c.1029	CCDS7477.1	10																																																																																			-	pfam_Glyco_hydro_79,superfamily_Glycoside_hydrolase_SF		0.398	HPSE2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HPSE2	protein_coding	OTTHUMT00000049789.1	G	NM_021828	-		100401673	-1	no_errors	ENST00000370552	ensembl	human	known	74_37	silent	SNP	1.000	C
KIAA1958	158405	genome.wustl.edu	37	9	115337138	115337138	+	Missense_Mutation	SNP	A	A	T			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr9:115337138A>T	ENST00000337530.6	+	2	1074	c.778A>T	c.(778-780)Atc>Ttc	p.I260F	KIAA1958_ENST00000536272.1_Missense_Mutation_p.I260F|KIAA1958_ENST00000374244.3_Missense_Mutation_p.I260F	NM_133465.2	NP_597722.1	Q8N8K9	K1958_HUMAN	KIAA1958	260										endometrium(1)|large_intestine(9)|lung(10)|prostate(2)|skin(3)	25						CACATCTGCCATCAGCACGGA	0.537																																																	0								ENSG00000165185						218.0	188.0	198.0					9																	115337138		2203	4300	6503	KIAA1958	SO:0001583	missense	0			-	HGNC	AB075838	CCDS35108.1, CCDS69642.1	9q33.1	2009-09-22			ENSG00000165185	ENSG00000165185			23427	protein-coding gene	gene with protein product							Standard	NM_001287038		Approved	FLJ39294	uc004bgf.1	Q8N8K9	OTTHUMG00000020508	ENST00000337530.6:c.778A>T	9.37:g.115337138A>T	ENSP00000336940:p.Ile260Phe	Somatic	0	13	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	4	60.00	B7ZKW6|Q2M336|Q5T252|Q8TF43|Q96N02	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF3504,superfamily_Integrase_Lambda-type_N	p.I260F	ENST00000337530.6	37	c.778	CCDS35108.1	9	.	.	.	.	.	.	.	.	.	.	A	12.30	1.895882	0.33442	.	.	ENSG00000165185	ENST00000337530;ENST00000374244;ENST00000536272	T;T;T	0.43294	0.95;0.95;0.95	6.07	2.53	0.30540	.	0.233195	0.35378	N	0.003241	T	0.17959	0.0431	N	0.14661	0.345	0.51233	D	0.999917	P;B	0.45902	0.868;0.244	B;B	0.34038	0.174;0.054	T	0.04708	-1.0932	10	0.17832	T	0.49	-9.9036	8.4289	0.32746	0.5871:0.3366:0.0763:0.0	.	260;260	B7ZKW6;Q8N8K9	.;K1958_HUMAN	F	260	ENSP00000336940:I260F;ENSP00000363362:I260F;ENSP00000440504:I260F	ENSP00000336940:I260F	I	+	1	0	KIAA1958	114376959	0.000000	0.05858	1.000000	0.80357	0.928000	0.56348	0.117000	0.15583	0.531000	0.28639	-0.264000	0.10439	ATC	-	NULL		0.537	KIAA1958-001	KNOWN	basic|CCDS	protein_coding	KIAA1958	protein_coding	OTTHUMT00000053690.1	A	NM_133465	-		115337138	+1	no_errors	ENST00000536272	ensembl	human	known	74_37	missense	SNP	0.998	T
MET	4233	genome.wustl.edu	37	7	116397813	116397813	+	Missense_Mutation	SNP	C	C	T			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr7:116397813C>T	ENST00000318493.6	+	8	2274	c.2087C>T	c.(2086-2088)aCa>aTa	p.T696I	MET_ENST00000397752.3_Missense_Mutation_p.T696I|MET_ENST00000436117.2_Missense_Mutation_p.T696I			Q9NWH9	SLTM_HUMAN	MET proto-oncogene, receptor tyrosine kinase	0	Arg/Glu-rich.				apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(10)|breast(4)|central_nervous_system(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(25)|large_intestine(8)|liver(3)|lung(70)|ovary(10)|pleura(2)|prostate(4)|skin(5)|stomach(6)|testis(1)|thyroid(4)|upper_aerodigestive_tract(64)|urinary_tract(3)	233	all_cancers(3;1.25e-07)|all_epithelial(6;4.07e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)	Ovarian(593;0.133)	GBM - Glioblastoma multiforme(2;2.31e-07)|all cancers(2;0.000419)|STAD - Stomach adenocarcinoma(10;0.000512)			GGTGGAAAAACATGTACTTTA	0.328			Mis		"""papillary renal, head-neck squamous cell """	papillary renal			Hereditary Papillary Renal Carcinoma (type 1)																															Dom	yes	Familial Papillary Renal Cancer	7	7q31	4233	met proto-oncogene (hepatocyte growth factor receptor)		E	0								ENSG00000105976						90.0	87.0	88.0					7																	116397813		1839	4094	5933	MET	SO:0001583	missense	0	Familial Cancer Database	HPRC, Hereditary Papillary Renal Cell Cancer	-	HGNC	M35073	CCDS43636.1, CCDS47689.1	7q31	2014-09-17	2014-06-26		ENSG00000105976	ENSG00000105976	2.7.10.1		7029	protein-coding gene	gene with protein product	"""hepatocyte growth factor receptor"""	164860	"""met proto-oncogene"""			1846706, 1611909	Standard	NM_001127500		Approved	HGFR, RCCP2	uc010lkh.3	P08581	OTTHUMG00000023299	ENST00000318493.6:c.2087C>T	7.37:g.116397813C>T	ENSP00000317272:p.Thr696Ile	Somatic	0	47	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	27	25.00	A8K5V8|B2RTX3|Q2VPK7|Q52MB3|Q658J7|Q6ZNF2|Q86TK6|Q9H7C3|Q9H8U9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_Tyr_kinase_HGF/MSP_rcpt,pfam_Semap_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_IPT,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Kinase-like_dom,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_IPT,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Semap_dom,pfscan_Prot_kinase_dom	p.T696I	ENST00000318493.6	37	c.2087	CCDS47689.1	7	.	.	.	.	.	.	.	.	.	.	C	13.32	2.202333	0.38905	.	.	ENSG00000105976	ENST00000397752;ENST00000318493;ENST00000436117	T;T;T	0.76709	-1.04;-1.04;-1.04	5.45	5.45	0.79879	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.312229	0.37955	N	0.001869	T	0.78672	0.4320	L	0.59436	1.845	0.80722	D	1	B;B;P;B;B;B;D	0.53462	0.44;0.054;0.831;0.11;0.121;0.058;0.96	B;B;P;B;B;B;P	0.52554	0.188;0.039;0.642;0.139;0.11;0.046;0.702	T	0.76493	-0.2939	10	0.34782	T	0.22	.	8.8144	0.34987	0.1506:0.7745:0.0:0.0749	.	696;696;696;696;668;696;696	B5A929;E7EQ94;B5A930;B5A934;B5A936;P08581-2;P08581	.;.;.;.;.;.;MET_HUMAN	I	696	ENSP00000380860:T696I;ENSP00000317272:T696I;ENSP00000410980:T696I	ENSP00000317272:T696I	T	+	2	0	MET	116185049	0.805000	0.28982	1.000000	0.80357	0.998000	0.95712	1.205000	0.32308	2.717000	0.92951	0.585000	0.79938	ACA	-	pirsf_Tyr_kinase_HGF/MSP_rcpt,pfam_IPT,superfamily_Ig_E-set,smart_IPT		0.328	MET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MET	protein_coding	OTTHUMT00000059620.3	C		-		116397813	+1	no_errors	ENST00000318493	ensembl	human	known	74_37	missense	SNP	1.000	T
CAPN5	726	genome.wustl.edu	37	11	76823688	76823688	+	Silent	SNP	C	C	T			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr11:76823688C>T	ENST00000278559.3	+	4	540	c.351C>T	c.(349-351)taC>taT	p.Y117Y	CAPN5_ENST00000456580.2_Silent_p.Y157Y|CAPN5_ENST00000531028.1_Intron|CAPN5_ENST00000529629.1_Silent_p.Y117Y	NM_004055.4	NP_004046.2	O15484	CAN5_HUMAN	calpain 5	117	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				proteolysis (GO:0006508)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)	p.Y117Y(2)		NS(1)|breast(2)|endometrium(2)|large_intestine(7)|lung(17)|urinary_tract(1)	30						CCAACGCCTACGCGGGCATCT	0.607																																																	2	Substitution - coding silent(2)	large_intestine(1)|endometrium(1)						ENSG00000149260						112.0	95.0	101.0					11																	76823688		2200	4292	6492	CAPN5	SO:0001819	synonymous_variant	0			-	HGNC		CCDS8248.1	11q14	2014-01-29				ENSG00000149260			1482	protein-coding gene	gene with protein product		602537	"""vitreoretinopathy, neovascular inflammatory"""	VRNI		9503024, 9367857, 23055945	Standard	NM_004055		Approved	nCL-3, HTRA3, ADNIV	uc001oxx.3	O15484		ENST00000278559.3:c.351C>T	11.37:g.76823688C>T		Somatic	0	21	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	23	14.81	O00263	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_C2_calpain_cat,pfam_Calpain_domain_III,pfam_C2_dom,superfamily_Calpain_domain_III,superfamily_C2_dom,smart_Peptidase_C2_calpain_cat,smart_Calpain_III,smart_C2_dom,pfscan_Peptidase_C2_calpain_cat,prints_Calpain_cysteine_protease	p.Y117	ENST00000278559.3	37	c.351	CCDS8248.1	11																																																																																			-	pfam_Peptidase_C2_calpain_cat,smart_Peptidase_C2_calpain_cat,pfscan_Peptidase_C2_calpain_cat,prints_Calpain_cysteine_protease		0.607	CAPN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAPN5	protein_coding	OTTHUMT00000382564.2	C	NM_004055	-		76823688	+1	no_errors	ENST00000278559	ensembl	human	known	74_37	silent	SNP	0.020	T
KRT8P47	644743	genome.wustl.edu	37	1	44569973	44569974	+	lincRNA	INS	-	-	TCTCCTGGCCCAGAGTCTCCAGCTGCCGCCGCT			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr1:44569973_44569974insTCTCCTGGCCCAGAGTCTCCAGCTGCCGCCGCT	ENST00000434244.1	+	0	1970_1971																											CAGCTTCAGCTTCTCCTGGCCC	0.554																																																	0								ENSG00000230615																																			RP5-1198O20.4			0				Clone_based_vega_gene																													1.37:g.44569973_44569974insTCTCCTGGCCCAGAGTCTCCAGCTGCCGCCGCT		Somatic	NA	NA	NA		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000434244.1	37	NULL		1																																																																																			-	-		0.554	RP5-1198O20.4-001	KNOWN	basic	lincRNA	ENSG00000230615	lincRNA	OTTHUMT00000022875.2	-				44569974	+1	no_errors	ENST00000434244	ensembl	human	known	74_37	rna	INS	1.000:1.000	TCTCCTGGCCCAGAGTCTCCAGCTGCCGCCGCT
SPINK5	11005	genome.wustl.edu	37	5	147499875	147499875	+	Frame_Shift_Del	DEL	A	A	-	rs565782662		TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr5:147499875delA	ENST00000256084.7	+	26	2501	c.2459delA	c.(2458-2460)gaafs	p.E820fs	SPINK5_ENST00000398454.1_Frame_Shift_Del_p.E820fs|SPINK5_ENST00000359874.3_Frame_Shift_Del_p.E820fs	NM_006846.3	NP_006837.2	Q9NQ38	ISK5_HUMAN	serine peptidase inhibitor, Kazal type 5	820	Kazal-like 12. {ECO:0000255|PROSITE- ProRule:PRU00798}.				anagen (GO:0042640)|epidermal cell differentiation (GO:0009913)|epithelial cell differentiation (GO:0030855)|extracellular matrix organization (GO:0030198)|hair cell differentiation (GO:0035315)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of immune response (GO:0050777)|negative regulation of proteolysis (GO:0045861)|negative regulation of serine-type peptidase activity (GO:1902572)|regulation of cell adhesion (GO:0030155)|regulation of T cell differentiation (GO:0045580)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|epidermal lamellar body (GO:0097209)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.K823fs*101(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(16)|ovary(4)|prostate(1)|skin(5)|stomach(8)|upper_aerodigestive_tract(2)	64			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAAGCAGCTGAAAAAAAAAAG	0.393																																																	1	Deletion - Frameshift(1)	ovary(1)						ENSG00000133710						119.0	120.0	120.0					5																	147499875		1843	4089	5932	SPINK5	SO:0001589	frameshift_variant	0				HGNC	AJ228139	CCDS43382.1, CCDS47300.1, CCDS47301.1	5q31-q32	2014-09-17	2005-08-17		ENSG00000133710	ENSG00000133710		"""Serine peptidase inhibitors, Kazal type"""	15464	protein-coding gene	gene with protein product	"""lymphoepithelial Kazal-type-related inhibitor"""	605010	"""serine protease inhibitor, Kazal type 5"""			10419450	Standard	NM_001127698		Approved	VAKTI, LEKTI, LETKI, NETS, NS, FLJ21544, FLJ97536, FLJ97596, FLJ99794, DKFZp686K19184	uc003loy.2	Q9NQ38	OTTHUMG00000134305	ENST00000256084.7:c.2459delA	5.37:g.147499875delA	ENSP00000256084:p.Glu820fs	Somatic	0	30	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	28	9.68	A8MYE8|B7WPB7|D6REN5|O75770|Q3LX95|Q3LX96|Q3LX97|Q96PP2|Q96PP3	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Kazal_dom,smart_Kazal_dom	p.K823fs	ENST00000256084.7	37	c.2459	CCDS43382.1	5																																																																																			-	pfam_Kazal_dom,smart_Kazal_dom		0.393	SPINK5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SPINK5	protein_coding	OTTHUMT00000259215.2	A	NM_001127698			147499875	+1	no_errors	ENST00000359874	ensembl	human	known	74_37	frame_shift_del	DEL	0.998	-
CYP11B2	1585	genome.wustl.edu	37	8	143994116	143994116	+	Silent	SNP	G	G	A			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr8:143994116G>A	ENST00000323110.2	-	8	1230	c.1228C>T	c.(1228-1230)Ctg>Ttg	p.L410L		NM_000498.3	NP_000489.3	P19099	C11B2_HUMAN	cytochrome P450, family 11, subfamily B, polypeptide 2	410					aldosterone biosynthetic process (GO:0032342)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|mineralocorticoid biosynthetic process (GO:0006705)|potassium ion homeostasis (GO:0055075)|regulation of blood volume by renal aldosterone (GO:0002017)|renal water homeostasis (GO:0003091)|small molecule metabolic process (GO:0044281)|sodium ion homeostasis (GO:0055078)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	corticosterone 18-monooxygenase activity (GO:0047783)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid 11-beta-monooxygenase activity (GO:0004507)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(22)|ovary(3)|upper_aerodigestive_tract(3)	39	all_cancers(97;5.56e-11)|all_epithelial(106;2.49e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Eplerenone(DB00700)|Etomidate(DB00292)|Hydrocortisone(DB00741)|Metoclopramide(DB01233)|Metyrapone(DB01011)|Spironolactone(DB00421)	TTGCGACCCAGCGAGTAGAGG	0.617									Familial Hyperaldosteronism type I																																								0								ENSG00000179142						95.0	92.0	93.0					8																	143994116		2203	4300	6503	CYP11B2	SO:0001819	synonymous_variant	0	Familial Cancer Database	Dexamethasone Sensitive Aldosteronism, FH-I	-	HGNC	X54741	CCDS6393.1	8q21-q22	2013-06-19	2003-01-14		ENSG00000179142	ENSG00000179142	1.14.15.4	"""Cytochrome P450s"""	2592	protein-coding gene	gene with protein product	"""steroid 11-beta-monooxygenase"""	124080	"""cytochrome P450, subfamily XIB (steroid 11-beta-hydroxylase), polypeptide 2"""	CYP11B		1303253	Standard	NM_000498		Approved	CYP11BL, CPN2, P-450C18, P450aldo, ALDOS	uc003yxk.1	P19099	OTTHUMG00000160254	ENST00000323110.2:c.1228C>T	8.37:g.143994116G>A		Somatic	0	56	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	66	15.38	B0ZBE4|Q16726	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_mitochondrial,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450,prints_Cyt_P450_B	p.L410	ENST00000323110.2	37	c.1228	CCDS6393.1	8																																																																																			-	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_B		0.617	CYP11B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP11B2	protein_coding	OTTHUMT00000359904.1	G		-		143994116	-1	no_errors	ENST00000323110	ensembl	human	known	74_37	silent	SNP	0.893	A
LGI4	163175	genome.wustl.edu	37	19	35617801	35617801	+	Nonsense_Mutation	SNP	C	C	T			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr19:35617801C>T	ENST00000310123.3	-	7	1268	c.749G>A	c.(748-750)tGg>tAg	p.W250*	LGI4_ENST00000392225.3_Nonsense_Mutation_p.W250*|LGI4_ENST00000493050.1_5'UTR	NM_139284.2	NP_644813.1	Q8N135	LGI4_HUMAN	leucine-rich repeat LGI family, member 4	250					adult locomotory behavior (GO:0008344)|glial cell proliferation (GO:0014009)|myelination in peripheral nervous system (GO:0022011)|neuron maturation (GO:0042551)	extracellular space (GO:0005615)				endometrium(1)|large_intestine(1)|lung(4)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	10	all_lung(56;7.56e-09)|Lung NSC(56;1.1e-08)|Esophageal squamous(110;0.162)		Epithelial(14;5.54e-20)|OV - Ovarian serous cystadenocarcinoma(14;1.33e-18)|all cancers(14;4.27e-17)|LUSC - Lung squamous cell carcinoma(66;0.0849)			GCTGTAGTCCCAGGAGAGAAT	0.677																																																	0								ENSG00000153902						30.0	35.0	33.0					19																	35617801		2203	4300	6503	LGI4	SO:0001587	stop_gained	0			-	HGNC	AJ487519	CCDS12444.1	19q13.13	2008-07-03			ENSG00000153902	ENSG00000153902			18712	protein-coding gene	gene with protein product		608303				12023020	Standard	NM_139284		Approved		uc002nxx.2	Q8N135	OTTHUMG00000044558	ENST00000310123.3:c.749G>A	19.37:g.35617801C>T	ENSP00000312273:p.Trp250*	Somatic	0	31	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	56	8.20	B2RN53|B9EGS7|Q5M8T1	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_EPTP,pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,pfscan_EAR	p.W250*	ENST00000310123.3	37	c.749	CCDS12444.1	19	.	.	.	.	.	.	.	.	.	.	C	38	6.767715	0.97825	.	.	ENSG00000153902	ENST00000310123;ENST00000392225;ENST00000437421	.	.	.	3.94	3.94	0.45596	.	0.238888	0.29791	N	0.011191	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.5039	0.61474	0.0:1.0:0.0:0.0	.	.	.	.	X	250	.	ENSP00000312273:W250X	W	-	2	0	LGI4	40309641	1.000000	0.71417	0.996000	0.52242	0.147000	0.21601	5.637000	0.67854	2.025000	0.59659	0.313000	0.20887	TGG	-	pfam_EPTP,pfscan_EAR		0.677	LGI4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LGI4	protein_coding	OTTHUMT00000103963.1	C		-		35617801	-1	no_errors	ENST00000310123	ensembl	human	known	74_37	nonsense	SNP	1.000	T
ABCA6	23460	genome.wustl.edu	37	17	67094140	67094140	+	Missense_Mutation	SNP	G	G	T			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr17:67094140G>T	ENST00000284425.2	-	23	3215	c.3041C>A	c.(3040-3042)cCg>cAg	p.P1014Q	MIR4524B_ENST00000581569.1_RNA|ABCA6_ENST00000446604.2_5'UTR	NM_080284.2	NP_525023.2	Q8N139	ABCA6_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 6	1014					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(6)|endometrium(5)|kidney(17)|large_intestine(18)|lung(20)|ovary(3)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	82	Breast(10;5.65e-12)					GGAACCATCCGGCAACCCAGT	0.358																																																	0								ENSG00000154262						43.0	43.0	43.0					17																	67094140		2203	4300	6503	ABCA6	SO:0001583	missense	0			-	HGNC	U66680	CCDS11683.1	17q21	2012-03-14			ENSG00000154262	ENSG00000154262		"""ATP binding cassette transporters / subfamily A"""	36	protein-coding gene	gene with protein product		612504				8894702	Standard	NM_080284		Approved	EST155051	uc002jhw.1	Q8N139		ENST00000284425.2:c.3041C>A	17.37:g.67094140G>T	ENSP00000284425:p.Pro1014Gln	Somatic	0	32	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	39	9.30	Q6NSH9|Q8N856|Q8WWZ6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.P1014Q	ENST00000284425.2	37	c.3041	CCDS11683.1	17	.	.	.	.	.	.	.	.	.	.	G	6.851	0.526380	0.13066	.	.	ENSG00000154262	ENST00000284425	D	0.86432	-2.12	4.71	-0.536	0.11876	.	0.853808	0.10049	N	0.722478	T	0.78033	0.4220	L	0.38838	1.175	0.09310	N	1	B	0.18310	0.027	B	0.27262	0.078	T	0.62364	-0.6870	10	0.30078	T	0.28	.	3.2518	0.06818	0.3876:0.0:0.4295:0.1829	.	1014	Q8N139	ABCA6_HUMAN	Q	1014	ENSP00000284425:P1014Q	ENSP00000284425:P1014Q	P	-	2	0	ABCA6	64605735	0.001000	0.12720	0.001000	0.08648	0.010000	0.07245	0.504000	0.22626	0.072000	0.16694	0.557000	0.71058	CCG	-	NULL		0.358	ABCA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA6	protein_coding	OTTHUMT00000450463.1	G	NM_080284	-		67094140	-1	no_errors	ENST00000284425	ensembl	human	known	74_37	missense	SNP	0.000	T
HPS6	79803	genome.wustl.edu	37	10	103826184	103826184	+	Missense_Mutation	SNP	G	G	A			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr10:103826184G>A	ENST00000299238.5	+	1	1038	c.953G>A	c.(952-954)gGc>gAc	p.G318D		NM_024747.5	NP_079023.2	Q86YV9	HPS6_HUMAN	Hermansky-Pudlak syndrome 6	318					blood coagulation (GO:0007596)|melanocyte differentiation (GO:0030318)|organelle organization (GO:0006996)|protein localization to membrane (GO:0072657)	BLOC-2 complex (GO:0031084)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|membrane (GO:0016020)	GTP-dependent protein binding (GO:0030742)|Rab GTPase binding (GO:0017137)			endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|prostate(1)	11		Colorectal(252;0.122)		Epithelial(162;5.93e-08)|all cancers(201;1.03e-06)		GCAGCCCTAGGCACATTTCAG	0.632									Hermansky-Pudlak syndrome																																								0								ENSG00000166189						59.0	62.0	61.0					10																	103826184		2203	4300	6503	HPS6	SO:0001583	missense	0	Familial Cancer Database	HPS, HPS1-8	-	HGNC	BC009258	CCDS7527.1	10q24.32	2014-06-18			ENSG00000166189	ENSG00000166189			18817	protein-coding gene	gene with protein product		607522				12548288	Standard	NM_024747		Approved	FLJ22501	uc001kuj.3	Q86YV9	OTTHUMG00000018945	ENST00000299238.5:c.953G>A	10.37:g.103826184G>A	ENSP00000299238:p.Gly318Asp	Somatic	0	25	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	34	10.53	Q5VV69|Q9H685	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_BLOC-2_complex_Hps6_subunit	p.G318D	ENST00000299238.5	37	c.953	CCDS7527.1	10	.	.	.	.	.	.	.	.	.	.	G	10.69	1.422515	0.25639	.	.	ENSG00000166189	ENST00000299238	T	0.77098	-1.07	5.17	5.17	0.71159	.	0.497506	0.23235	N	0.050404	T	0.80722	0.4677	L	0.57536	1.79	0.34465	D	0.702156	D	0.67145	0.996	P	0.59889	0.865	T	0.80303	-0.1439	10	0.18276	T	0.48	-8.7464	9.7574	0.40510	0.1231:0.0:0.8769:0.0	.	318	Q86YV9	HPS6_HUMAN	D	318	ENSP00000299238:G318D	ENSP00000299238:G318D	G	+	2	0	HPS6	103816174	0.999000	0.42202	0.957000	0.39632	0.777000	0.43975	3.314000	0.51943	2.681000	0.91329	0.561000	0.74099	GGC	-	pirsf_BLOC-2_complex_Hps6_subunit		0.632	HPS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HPS6	protein_coding	OTTHUMT00000050018.2	G	NM_024747	-		103826184	+1	no_errors	ENST00000299238	ensembl	human	known	74_37	missense	SNP	0.964	A
PADI1	29943	genome.wustl.edu	37	1	17567091	17567100	+	Intron	DEL	CTTCCTAGTC	CTTCCTAGTC	-	rs189392363|rs528133331|rs67058905|rs373493785|rs57943723	byFrequency	TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	CTTCCTAGTC	CTTCCTAGTC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr1:17567091_17567100delCTTCCTAGTC	ENST00000375471.4	+	15	1724				PADI1_ENST00000413717.2_Intron|PADI1_ENST00000460293.1_3'UTR|PADI1_ENST00000537499.1_Intron|PADI1_ENST00000536552.1_Intron	NM_013358.2	NP_037490.2	Q9ULC6	PADI1_HUMAN	peptidyl arginine deiminase, type I						protein citrullination (GO:0018101)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|protein-arginine deiminase activity (GO:0004668)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(4)|skin(1)|stomach(1)|urinary_tract(1)	28		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.00054)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00522)|BRCA - Breast invasive adenocarcinoma(304;1.3e-05)|COAD - Colon adenocarcinoma(227;1.31e-05)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(196;0.0069)|READ - Rectum adenocarcinoma(331;0.0681)|Lung(427;0.197)	L-Citrulline(DB00155)	gtgttatgctctTCCTAGTCCTGGGCTGCC	0.581																																					Esophageal Squamous(80;414 1257 4580 27746 50832)												0								ENSG00000142623			321,3941		16,289,1826						-3.3	0.0		dbSNP_130	51	429,7825		14,401,3712	no	intron	PADI1	NM_013358.2		30,690,5538	A1A1,A1R,RR		5.1975,7.5317,5.9923				750,11766				PADI1	SO:0001627	intron_variant	0				HGNC	AB033768	CCDS178.1	1p36.13	2008-07-18			ENSG00000142623	ENSG00000142623	3.5.3.15	"""Peptidyl arginine deiminases"""	18367	protein-coding gene	gene with protein product	"""peptidylarginine deiminase type I"", ""protein-arginine deiminase type-1"", ""hPAD-colony 10"""	607934				12416996	Standard	NM_013358		Approved	HPAD10, PDI1, PDI, PAD1	uc001bah.1	Q9ULC6	OTTHUMG00000002294	ENST00000375471.4:c.1633-30CTTCCTAGTC>-	1.37:g.17567091_17567100delCTTCCTAGTC		Somatic	NA	NA	NA		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A1L4K6|Q70SX6	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000375471.4	37	NULL	CCDS178.1	1																																																																																			-	-		0.581	PADI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PADI1	protein_coding	OTTHUMT00000006621.1	CTTCCTAGTC	NM_013358			17567100	+1	no_errors	ENST00000460293	ensembl	human	known	74_37	rna	DEL	0.010:0.001:0.000:0.002:0.002:0.000:0.000:0.000:0.000:0.000	-
EDF1	8721	genome.wustl.edu	37	9	139760677	139760677	+	Silent	SNP	G	G	A			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr9:139760677G>A	ENST00000224073.1	-	1	61	c.34C>T	c.(34-36)Ctg>Ttg	p.L12L	EDF1_ENST00000371649.1_Silent_p.L12L|EDF1_ENST00000371648.4_Silent_p.L12L	NM_003792.2	NP_003783.1	O60869	EDF1_HUMAN	endothelial differentiation-related factor 1	12					endothelial cell differentiation (GO:0045446)|multicellular organismal development (GO:0007275)|positive regulation of DNA binding (GO:0043388)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of lipid metabolic process (GO:0019216)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)			lung(1)	1	all_cancers(76;0.0841)|all_epithelial(76;0.217)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.52e-05)|Epithelial(140;0.000171)		TTCTTGCGCAGCACCGTCACC	0.736																																																	0								ENSG00000107223						34.0	33.0	34.0					9																	139760677		2200	4297	6497	EDF1	SO:0001819	synonymous_variant	0			-	HGNC	AJ005259	CCDS7011.1, CCDS7012.1, CCDS65193.1	9q34.3	2009-11-06			ENSG00000107223	ENSG00000107223			3164	protein-coding gene	gene with protein product	"""multiprotein bridging factor-1"""	605107				9813014, 15112053	Standard	NM_003792		Approved	EDF-1	uc004cjt.1	O60869	OTTHUMG00000020948	ENST00000224073.1:c.34C>T	9.37:g.139760677G>A		Somatic	0	54	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	18	48.57	Q5T5T2|Q9UIM1	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_MBF1_N,pfam_Cro/C1-type_HTH,superfamily_Lambda_DNA-bd_dom,smart_Cro/C1-type_HTH,pfscan_Cro/C1-type_HTH	p.L12	ENST00000224073.1	37	c.34	CCDS7011.1	9																																																																																			-	pfam_MBF1_N		0.736	EDF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EDF1	protein_coding	OTTHUMT00000055143.1	G		-		139760677	-1	no_errors	ENST00000224073	ensembl	human	known	74_37	silent	SNP	1.000	A
EVPLL	645027	genome.wustl.edu	37	17	18291433	18291438	+	Intron	DEL	CACAGC	CACAGC	-	rs140944304	byFrequency	TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	CACAGC	CACAGC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr17:18291433_18291438delCACAGC	ENST00000399134.4	+	10	1234				EVPLL_ENST00000583003.1_Intron|RP1-37N7.1_ENST00000579352.1_RNA	NM_001145127.1	NP_001138599.1	A8MZ36	EVPLL_HUMAN	envoplakin-like											NS(1)|endometrium(1)|large_intestine(1)|lung(2)	5						tttaattaatcacagccaaccctcaa	0.335														2505	0.5002	0.7262	0.5375	5008	,	,		11867	0.1925		0.5517	False		,,,				2504	0.4325																0								ENSG00000264177																																			RP1-37N7.1	SO:0001627	intron_variant	0				Clone_based_vega_gene		CCDS45626.1	17p11.2	2009-08-25			ENSG00000214860	ENSG00000214860			35236	protein-coding gene	gene with protein product							Standard	NM_001145127		Approved		uc002gte.3	A8MZ36	OTTHUMG00000059095	ENST00000399134.4:c.877-95CACAGC>-	17.37:g.18291433_18291438delCACAGC		Somatic	NA	NA	NA		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B4DPD4	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000399134.4	37	NULL	CCDS45626.1	17																																																																																			-	-		0.335	EVPLL-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	LOC101928729	protein_coding	OTTHUMT00000130836.2	CACAGC	NM_001145127			18291438	-1	no_errors	ENST00000579352	ensembl	human	known	74_37	rna	DEL	0.100:0.098:0.095:0.091:0.087:0.081	-
DSPP	1834	genome.wustl.edu	37	4	88534993	88534993	+	Silent	SNP	G	G	T			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr4:88534993G>T	ENST00000282478.7	+	4	1212	c.1179G>T	c.(1177-1179)ggG>ggT	p.G393G	RP11-742B18.1_ENST00000506480.1_RNA|DSPP_ENST00000399271.1_Silent_p.G393G			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	393					biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		AAGAAGTTGGGAAAGGCAACG	0.418																																																	0								ENSG00000152591						113.0	106.0	108.0					4																	88534993		1915	4122	6037	DSPP	SO:0001819	synonymous_variant	0			-	HGNC	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.1179G>T	4.37:g.88534993G>T		Somatic	0	24	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	21	16.00	A8MUI0|O95815	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.G393	ENST00000282478.7	37	c.1179	CCDS43248.1	4																																																																																			-	NULL		0.418	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	DSPP	protein_coding	OTTHUMT00000363616.3	G	NM_014208	-		88534993	+1	no_errors	ENST00000282478	ensembl	human	known	74_37	silent	SNP	0.790	T
KDM5D	8284	genome.wustl.edu	37	Y	21877620	21877620	+	Missense_Mutation	SNP	C	C	T			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chrY:21877620C>T	ENST00000317961.4	-	17	2490	c.2219G>A	c.(2218-2220)cGg>cAg	p.R740Q	KDM5D_ENST00000541639.1_Missense_Mutation_p.R771Q|KDM5D_ENST00000382806.2_Missense_Mutation_p.R683Q	NM_004653.4	NP_004644.2	Q9BY66	KDM5D_HUMAN	lysine (K)-specific demethylase 5D	740					histone H3-K4 demethylation (GO:0034720)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-K4 specific) (GO:0032453)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)			kidney(1)|large_intestine(9)|lung(6)|skin(1)	17					Vitamin C(DB00126)	CAAGGTGTACCGATACCTAGA	0.547																																																	0								ENSG00000012817																																			KDM5D	SO:0001583	missense	0			-	HGNC	U52191	CCDS14794.1, CCDS55554.1, CCDS55555.1	Yq11	2013-01-28	2009-04-06	2009-04-06	ENSG00000012817	ENSG00000012817		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	11115	protein-coding gene	gene with protein product		426000	"""Jumonji, AT rich interactive domain 1D (RBP2-like)"", ""Smcy homolog, Y-linked (mouse)"", ""jumonji, AT rich interactive domain 1D"""	HYA, HY, SMCY, JARID1D		795123, 8841177	Standard	NM_001146705		Approved	KIAA0234	uc011naz.2	Q9BY66	OTTHUMG00000036508	ENST00000317961.4:c.2219G>A	Y.37:g.21877620C>T	ENSP00000322408:p.Arg740Gln	Somatic	0	12	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	14	22.22	A2RU19|A6H8V7|B7ZLX1|Q92509|Q92809|Q9HCU1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Lys_sp_deMease_like_dom,pfam_JmjC_dom,pfam_ARID/BRIGHT_DNA-bd,pfam_Znf_C5HC2,pfam_Znf_PHD-finger,pfam_TF_JmjN,superfamily_ARID/BRIGHT_DNA-bd,superfamily_Znf_FYVE_PHD,smart_TF_JmjN,smart_ARID/BRIGHT_DNA-bd,smart_Znf_PHD,smart_JmjC_dom,pfscan_TF_JmjN,pfscan_JmjC_dom,pfscan_Znf_PHD-finger,pfscan_ARID/BRIGHT_DNA-bd	p.R771Q	ENST00000317961.4	37	c.2312	CCDS14794.1	Y																																																																																			-	pfam_Znf_C5HC2		0.547	KDM5D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM5D	protein_coding	OTTHUMT00000088790.1	C	NM_004653	-		21877620	-1	no_errors	ENST00000541639	ensembl	human	known	74_37	missense	SNP	1.000	T
ZFYVE9	9372	genome.wustl.edu	37	1	52744179	52744179	+	Missense_Mutation	SNP	A	A	G			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr1:52744179A>G	ENST00000371591.1	+	8	2893	c.2762A>G	c.(2761-2763)gAg>gGg	p.E921G	ZFYVE9_ENST00000287727.3_Missense_Mutation_p.E921G|ZFYVE9_ENST00000357206.2_Missense_Mutation_p.E862G	NM_004799.2|NM_007324.2	NP_004790.2|NP_015563.2	O95405	ZFYV9_HUMAN	zinc finger, FYVE domain containing 9	921					endocytosis (GO:0006897)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|proteolysis (GO:0006508)|SMAD protein complex assembly (GO:0007183)|SMAD protein import into nucleus (GO:0007184)|transforming growth factor beta receptor signaling pathway (GO:0007179)	early endosome (GO:0005769)|early endosome membrane (GO:0031901)	1-phosphatidylinositol binding (GO:0005545)|metal ion binding (GO:0046872)|serine-type peptidase activity (GO:0008236)			breast(1)|central_nervous_system(4)|endometrium(3)|kidney(1)|large_intestine(12)|lung(17)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	53						GCTGTGGAAGAGAAACCATCA	0.363																																																	0								ENSG00000157077						125.0	124.0	124.0					1																	52744179		2203	4300	6503	ZFYVE9	SO:0001583	missense	0			-	HGNC	AF104304	CCDS563.1, CCDS564.1	1p32.3	2014-06-13	2004-05-21	2004-05-26	ENSG00000157077	ENSG00000157077		"""Zinc fingers, FYVE domain containing"""	6775	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 173"""	603755	"""MAD, mothers against decapentaplegic homolog (Drosophila) interacting protein, receptor activation anchor"""	MADHIP		9865696	Standard	NM_007324		Approved	SMADIP, SARA, PPP1R173	uc001cto.4	O95405	OTTHUMG00000008061	ENST00000371591.1:c.2762A>G	1.37:g.52744179A>G	ENSP00000360647:p.Glu921Gly	Somatic	0	35	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	31	35	46.97	Q5T0F6|Q5T0F7|Q9UNE1|Q9Y5R7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF3480,pfam_SARA_Smad-bd,pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,smart_Znf_FYVE,pirsf_Znf_FYVE_SARA/endofin,pfscan_Znf_FYVE-rel	p.E921G	ENST00000371591.1	37	c.2762	CCDS563.1	1	.	.	.	.	.	.	.	.	.	.	A	23.4	4.406401	0.83230	.	.	ENSG00000157077	ENST00000357206;ENST00000287727;ENST00000371591	T;T;T	0.50277	0.85;0.75;0.75	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.66819	0.2828	M	0.70595	2.14	0.58432	D	0.999999	D;D	0.65815	0.993;0.995	D;D	0.67103	0.938;0.949	T	0.71027	-0.4711	10	0.87932	D	0	.	15.3345	0.74241	1.0:0.0:0.0:0.0	.	862;921	O95405-2;O95405	.;ZFYV9_HUMAN	G	862;921;921	ENSP00000349737:E862G;ENSP00000287727:E921G;ENSP00000360647:E921G	ENSP00000287727:E921G	E	+	2	0	ZFYVE9	52516767	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.650000	0.91073	2.205000	0.71048	0.482000	0.46254	GAG	-	pirsf_Znf_FYVE_SARA/endofin		0.363	ZFYVE9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFYVE9	protein_coding	OTTHUMT00000022083.1	A	NM_007324	-		52744179	+1	no_errors	ENST00000287727	ensembl	human	known	74_37	missense	SNP	1.000	G
CNTNAP1	8506	genome.wustl.edu	37	17	40840498	40840498	+	Missense_Mutation	SNP	G	G	A			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr17:40840498G>A	ENST00000264638.4	+	9	1542	c.1325G>A	c.(1324-1326)gGc>gAc	p.G442D	CTD-3193K9.3_ENST00000592440.1_RNA	NM_003632.2	NP_003623.1	P78357	CNTP1_HUMAN	contactin associated protein 1	442	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				axon cargo transport (GO:0008088)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cytoskeleton organization (GO:0007010)|neuromuscular process controlling balance (GO:0050885)|neuromuscular process controlling posture (GO:0050884)|neuron projection morphogenesis (GO:0048812)|neuronal action potential propagation (GO:0019227)|paranodal junction assembly (GO:0030913)|positive regulation of signal transduction (GO:0009967)|protein localization to paranode region of axon (GO:0002175)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|paranode region of axon (GO:0033270)|voltage-gated potassium channel complex (GO:0008076)	receptor activity (GO:0004872)|SH3 domain binding (GO:0017124)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|breast(4)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(11)|lung(15)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.143)		CTGAATGACGGCTTTTGGCAC	0.522																																																	0								ENSG00000108797						133.0	116.0	122.0					17																	40840498		2203	4300	6503	CNTNAP1	SO:0001583	missense	0			-	HGNC	U87223	CCDS11436.1	17q21	2008-07-18				ENSG00000108797			8011	protein-coding gene	gene with protein product	"""neurexin 4"""	602346		NRXN4		9118959	Standard	NM_003632		Approved	p190, Caspr, CNTNAP	uc002iay.3	P78357		ENST00000264638.4:c.1325G>A	17.37:g.40840498G>A	ENSP00000264638:p.Gly442Asp	Somatic	0	33	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	29	12.12		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Laminin_G,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Galactose-bd-like,superfamily_Fibrinogen_a/b/g_C_dom,smart_Coagulation_fac_5/8-C_type_dom,smart_Laminin_G,smart_Neurexin-like,pfscan_EG-like_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Laminin_G	p.G442D	ENST00000264638.4	37	c.1325	CCDS11436.1	17	.	.	.	.	.	.	.	.	.	.	G	25.7	4.669702	0.88348	.	.	ENSG00000108797	ENST00000264638	D	0.83992	-1.79	5.83	5.83	0.93111	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.073620	0.56097	D	0.000029	D	0.92192	0.7524	M	0.83312	2.635	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.91843	0.5485	10	0.54805	T	0.06	.	20.1152	0.97926	0.0:0.0:1.0:0.0	.	442	P78357	CNTP1_HUMAN	D	442	ENSP00000264638:G442D	ENSP00000264638:G442D	G	+	2	0	CNTNAP1	38094024	1.000000	0.71417	1.000000	0.80357	0.737000	0.42083	9.208000	0.95075	2.750000	0.94351	0.655000	0.94253	GGC	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,pfscan_Laminin_G		0.522	CNTNAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP1	protein_coding	OTTHUMT00000452342.1	G	NM_003632	-		40840498	+1	no_errors	ENST00000264638	ensembl	human	known	74_37	missense	SNP	1.000	A
PIAS1	8554	genome.wustl.edu	37	15	68468089	68468089	+	Frame_Shift_Del	DEL	T	T	-			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr15:68468089delT	ENST00000249636.6	+	10	1432	c.1284delT	c.(1282-1284)tctfs	p.S428fs	PIAS1_ENST00000545237.1_Frame_Shift_Del_p.S430fs	NM_016166.1	NP_057250.1	O75925	PIAS1_HUMAN	protein inhibitor of activated STAT, 1	428					androgen receptor signaling pathway (GO:0030521)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|JAK-STAT cascade (GO:0007259)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein sumoylation (GO:0033235)|positive regulation of smooth muscle cell differentiation (GO:0051152)|positive regulation of transcription, DNA-templated (GO:0045893)|protein sumoylation (GO:0016925)|protein-DNA complex assembly (GO:0065004)|regulation of cell proliferation (GO:0042127)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|SUMO ligase activity (GO:0019789)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			breast(2)|endometrium(5)|kidney(3)|large_intestine(5)|lung(8)|ovary(1)	24						TTTCTGCCTCTTACAATGGAG	0.388																																																	0								ENSG00000033800						78.0	78.0	78.0					15																	68468089		1873	4105	5978	PIAS1	SO:0001589	frameshift_variant	0				HGNC	AF077951	CCDS45290.1	15q	2011-10-11	2002-04-19	2002-04-19		ENSG00000033800		"""Zinc fingers, MIZ-type"""	2752	protein-coding gene	gene with protein product	"""zinc finger, MIZ-type containing 3"""	603566	"""DEAD/H (Asp-Glu-Ala-Asp/His) box binding protein 1"""	DDXBP1		9724754, 9177271	Standard	XM_005254735		Approved	GBP, GU/RH-II, ZMIZ3	uc002aqz.3	O75925		ENST00000249636.6:c.1284delT	15.37:g.68468089delT	ENSP00000249636:p.Ser428fs	Somatic	0	39	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	23	32.35	B2RB67|B3KSY9|C5J4B4|Q147X4|Q99751|Q9UN02	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Znf_MIZ,smart_SAP_dom,pfscan_Znf_MIZ,pfscan_SAP_dom	p.Y429fs	ENST00000249636.6	37	c.1284	CCDS45290.1	15																																																																																			-	NULL		0.388	PIAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIAS1	protein_coding	OTTHUMT00000419642.2	T				68468089	+1	no_errors	ENST00000249636	ensembl	human	known	74_37	frame_shift_del	DEL	0.985	-
HIVEP2	3097	genome.wustl.edu	37	6	143092861	143092861	+	Silent	SNP	C	C	T			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr6:143092861C>T	ENST00000367604.1	-	4	3654	c.3015G>A	c.(3013-3015)gaG>gaA	p.E1005E	HIVEP2_ENST00000367603.2_Silent_p.E1005E|HIVEP2_ENST00000012134.2_Silent_p.E1005E			P31629	ZEP2_HUMAN	human immunodeficiency virus type I enhancer binding protein 2	1005					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(4)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(19)|lung(35)|ovary(4)|prostate(6)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	100				OV - Ovarian serous cystadenocarcinoma(155;1.61e-05)|GBM - Glioblastoma multiforme(68;0.0102)		CAGTCAGAAACTCTGAATGCT	0.488																																					Esophageal Squamous(107;843 1510 13293 16805 42198)												0								ENSG00000010818						95.0	97.0	96.0					6																	143092861		1996	4183	6179	HIVEP2	SO:0001819	synonymous_variant	0			-	HGNC	M60119	CCDS43510.1	6q23-q24	2013-01-08	2001-11-28		ENSG00000010818	ENSG00000010818		"""Zinc fingers, C2H2-type"""	4921	protein-coding gene	gene with protein product	"""c-myc intron binding protein 1"""	143054	"""human immunodeficiency virus type I enhancer-binding protein 2"""			1733857, 2022670	Standard	NM_006734		Approved	MBP-2, HIV-EP2, MIBP1, ZAS2, Schnurri-2, ZNF40B	uc003qjd.3	P31629	OTTHUMG00000015713	ENST00000367604.1:c.3015G>A	6.37:g.143092861C>T		Somatic	0	21	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	24	14.29	Q02646|Q5THT5|Q9NS05	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Znf_C2H2_jaz,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E1005	ENST00000367604.1	37	c.3015	CCDS43510.1	6																																																																																			-	NULL		0.488	HIVEP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIVEP2	protein_coding	OTTHUMT00000042495.1	C		-		143092861	-1	no_errors	ENST00000012134	ensembl	human	known	74_37	silent	SNP	1.000	T
MMRN1	22915	genome.wustl.edu	37	4	90857825	90857825	+	Silent	SNP	C	C	T			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr4:90857825C>T	ENST00000394980.1	+	7	3313	c.2994C>T	c.(2992-2994)gtC>gtT	p.V998V	MMRN1_ENST00000264790.2_Silent_p.V998V|MMRN1_ENST00000394981.1_Intron|MMRN1_ENST00000508372.1_Silent_p.V740V			Q13201	MMRN1_HUMAN	multimerin 1	998					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|platelet alpha granule lumen (GO:0031093)				breast(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(12)|liver(2)|lung(34)|ovary(5)|prostate(1)|skin(6)|stomach(1)|urinary_tract(2)	72		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;6.96e-05)		CAAATGTTGTCAAGTCTCAGA	0.373																																																	0								ENSG00000138722						62.0	67.0	65.0					4																	90857825		2202	4300	6502	MMRN1	SO:0001819	synonymous_variant	0			-	HGNC	U27109	CCDS3635.1	4q22	2008-02-05	2004-03-02	2004-03-02	ENSG00000138722	ENSG00000138722		"""EMI domain containing"""	7178	protein-coding gene	gene with protein product	"""glycoprotein Ia*"""	601456	"""multimerin"""	MMRN		7629143, 10828608	Standard	NM_007351		Approved	ECM, EMILIN4, GPIa*	uc003hst.3	Q13201	OTTHUMG00000130947	ENST00000394980.1:c.2994C>T	4.37:g.90857825C>T		Somatic	0	38	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	40	9.09	Q4W5L1|Q6P3T8|Q6ZUL9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_C1q,pfam_EMI_domain,pfam_EG-like_dom,superfamily_Tumour_necrosis_fac-like_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_C1q,prints_C1q,pfscan_C1q,pfscan_EG-like_dom,pfscan_EMI_domain	p.V998	ENST00000394980.1	37	c.2994	CCDS3635.1	4																																																																																			-	NULL		0.373	MMRN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMRN1	protein_coding	OTTHUMT00000253546.2	C	NM_007351	-		90857825	+1	no_errors	ENST00000264790	ensembl	human	known	74_37	silent	SNP	0.915	T
GPRC6A	222545	genome.wustl.edu	37	6	117114310	117114310	+	Silent	SNP	G	G	T			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr6:117114310G>T	ENST00000310357.3	-	6	1797	c.1776C>A	c.(1774-1776)tcC>tcA	p.S592S	GPRC6A_ENST00000368549.3_Silent_p.S521S|GPRC6A_ENST00000530250.1_Silent_p.S417S	NM_148963.2	NP_683766.2	Q5T6X5	GPC6A_HUMAN	G protein-coupled receptor, class C, group 6, member A	592					calcium-mediated signaling (GO:0019722)|response to amino acid (GO:0043200)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(8)|liver(1)|lung(24)|ovary(5)|pancreas(1)|skin(5)|stomach(3)|upper_aerodigestive_tract(3)	65		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.0265)|all cancers(137;0.0554)|OV - Ovarian serous cystadenocarcinoma(136;0.07)		GGATGGCCAAGGAGTCATTCC	0.428																																																	0								ENSG00000173612						106.0	103.0	104.0					6																	117114310		2203	4300	6503	GPRC6A	SO:0001819	synonymous_variant	0			-	HGNC	AF502962	CCDS5112.1, CCDS69184.1, CCDS69185.1	6q22.31	2014-01-30	2014-01-30		ENSG00000173612	ENSG00000173612		"""GPCR / Class C : Calcium-sensing receptors"""	18510	protein-coding gene	gene with protein product			"""G protein-coupled receptor, family C, group 6, member A"""				Standard	NM_001286354		Approved	bA86F4.3	uc003pxj.1	Q5T6X5	OTTHUMG00000015447	ENST00000310357.3:c.1776C>A	6.37:g.117114310G>T		Somatic	0	24	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	14	17.65	Q6JK43|Q6JK44|Q8NGU8|Q8NHZ9|Q8TDT6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_3_C,pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_9-Cys_dom,superfamily_Peripla_BP_I,pfscan_GPCR_3_C,prints_GPCR_3,prints_GPCR_3_vmron_rcpt_2	p.S592	ENST00000310357.3	37	c.1776	CCDS5112.1	6																																																																																			-	NULL		0.428	GPRC6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPRC6A	protein_coding	OTTHUMT00000041966.2	G		-		117114310	-1	no_errors	ENST00000310357	ensembl	human	known	74_37	silent	SNP	0.339	T
C2orf16	84226	genome.wustl.edu	37	2	27802045	27802045	+	Missense_Mutation	SNP	G	G	A			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr2:27802045G>A	ENST00000408964.2	+	1	2657	c.2606G>A	c.(2605-2607)gGc>gAc	p.G869D	AC074091.1_ENST00000408604.1_RNA	NM_032266.3	NP_115642.3	Q68DN1	CB016_HUMAN	chromosome 2 open reading frame 16	869						extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(33)|urinary_tract(1)	47	Acute lymphoblastic leukemia(172;0.155)					TCTTTCCCGGGCAGACAACAC	0.478																																																	0								ENSG00000221843						56.0	61.0	59.0					2																	27802045		2086	4229	6315	C2orf16	SO:0001583	missense	0			-	HGNC	AL136898	CCDS42666.1	2p23.3	2013-09-20			ENSG00000221843	ENSG00000221843			25275	protein-coding gene	gene with protein product	"""P-S-E-R-S-H-H-S repeats containing"""						Standard	NM_032266		Approved	DKFZp434G118	uc002rkz.4	Q68DN1	OTTHUMG00000159099	ENST00000408964.2:c.2606G>A	2.37:g.27802045G>A	ENSP00000386190:p.Gly869Asp	Somatic	0	23	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	11	21.43	B9EIQ4|Q53S01|Q8ND64|Q9H088	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.G869D	ENST00000408964.2	37	c.2606	CCDS42666.1	2	.	.	.	.	.	.	.	.	.	.	G	12.83	2.054656	0.36277	.	.	ENSG00000221843	ENST00000408964	T	0.08458	3.09	5.51	4.62	0.57501	.	.	.	.	.	T	0.17789	0.0427	L	0.32530	0.975	0.09310	N	1	D	0.76494	0.999	D	0.74023	0.982	T	0.05178	-1.0901	9	0.72032	D	0.01	.	10.7548	0.46230	0.0909:0.0:0.9091:0.0	.	869	Q68DN1	CB016_HUMAN	D	869	ENSP00000386190:G869D	ENSP00000386190:G869D	G	+	2	0	C2orf16	27655549	0.926000	0.31397	0.802000	0.32245	0.017000	0.09413	3.212000	0.51145	2.581000	0.87130	0.591000	0.81541	GGC	-	NULL		0.478	C2orf16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C2orf16	protein_coding	OTTHUMT00000353292.1	G	NM_032266	-		27802045	+1	no_errors	ENST00000408964	ensembl	human	known	74_37	missense	SNP	0.179	A
RHOF	54509	genome.wustl.edu	37	12	122235514	122235514	+	Intron	SNP	G	G	T			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr12:122235514G>T	ENST00000545544.1	-	3	737				AC084018.1_ENST00000539299.1_lincRNA|RP11-347I19.8_ENST00000609067.1_lincRNA			Q9HBH0	RHOF_HUMAN	ras homolog family member F (in filopodia)						actin filament organization (GO:0007015)|GTP catabolic process (GO:0006184)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			large_intestine(1)|lung(1)|ovary(1)	3	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;4.38e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.223)		GATCCAGGGAGGGGAGAAACT	0.587																																																	0								ENSG00000272849																																			RP11-347I19.8	SO:0001627	intron_variant	0			-	Clone_based_vega_gene	AK000254	CCDS9222.1	12q24.31	2013-09-23	2012-02-27	2004-03-24	ENSG00000139725	ENSG00000139725			15703	protein-coding gene	gene with protein product			"""ras homolog gene family, member F (in filopodia)"""	ARHF		11084341	Standard	NM_019034		Approved	FLJ20247, RIF	uc001ubb.3	Q9HBH0	OTTHUMG00000169077	ENST00000545544.1:c.89+2238C>A	12.37:g.122235514G>T		Somatic	0	37	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	29	12.12	Q8WVB1|Q9NXH6	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000545544.1	37	NULL		12																																																																																			-	-		0.587	RHOF-005	KNOWN	basic	processed_transcript	ENSG00000272849	protein_coding	OTTHUMT00000471561.1	G		-		122235514	+1	no_errors	ENST00000609067	ensembl	human	known	74_37	rna	SNP	0.000	T
EP400	57634	genome.wustl.edu	37	12	132522547	132522547	+	Missense_Mutation	SNP	G	G	T			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr12:132522547G>T	ENST00000333577.4	+	33	6330	c.6221G>T	c.(6220-6222)gGc>gTc	p.G2074V	EP400_ENST00000330386.6_Missense_Mutation_p.G1957V|EP400_ENST00000332482.4_Missense_Mutation_p.G2001V|EP400_ENST00000389562.2_Missense_Mutation_p.G2037V|EP400_ENST00000389561.2_Missense_Mutation_p.G2038V			Q96L91	EP400_HUMAN	E1A binding protein p400	2074					chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		GATGATGCTGGCTTCCCGGTC	0.478																																																	0								ENSG00000183495						223.0	203.0	210.0					12																	132522547		2203	4300	6503	EP400	SO:0001583	missense	0			-	HGNC	U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.6221G>T	12.37:g.132522547G>T	ENSP00000333602:p.Gly2074Val	Somatic	0	37	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	35	10.26	O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SNF2_N,pfam_Helicase/SANT-assoc_DNA-bd,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_Homeodomain-like,smart_HAS_subgr,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Myb-like_dom,pfscan_Helicase/SANT-assoc_DNA-bd,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.G2074V	ENST00000333577.4	37	c.6221		12	.	.	.	.	.	.	.	.	.	.	G	10.58	1.390939	0.25118	.	.	ENSG00000183495	ENST00000333577;ENST00000389561;ENST00000389562;ENST00000332482;ENST00000330386;ENST00000541296	D;D;D;D;D	0.90385	-2.66;-2.65;-2.66;-2.66;-2.66	5.43	5.43	0.79202	.	0.052730	0.85682	D	0.000000	D	0.92136	0.7507	N	0.24115	0.695	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.73380	0.98;0.98;0.98	D	0.93378	0.6741	10	0.72032	D	0.01	.	19.2486	0.93913	0.0:0.0:1.0:0.0	.	2038;1957;2037	Q96L91-2;Q96L91-4;Q96L91-5	.;.;.	V	2074;2038;2037;2001;1957;2038	ENSP00000333602:G2074V;ENSP00000374212:G2038V;ENSP00000374213:G2037V;ENSP00000331737:G2001V;ENSP00000330620:G1957V	ENSP00000330620:G1957V	G	+	2	0	EP400	131088500	1.000000	0.71417	0.998000	0.56505	0.268000	0.26511	4.421000	0.59848	2.534000	0.85438	0.650000	0.86243	GGC	-	NULL		0.478	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	EP400	protein_coding		G	NM_015409	-		132522547	+1	no_errors	ENST00000333577	ensembl	human	known	74_37	missense	SNP	1.000	T
TMEM82	388595	genome.wustl.edu	37	1	16073516	16073516	+	Silent	SNP	C	C	T			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr1:16073516C>T	ENST00000375782.1	+	5	1050	c.912C>T	c.(910-912)ggC>ggT	p.G304G	RP11-169K16.4_ENST00000418525.1_RNA	NM_001013641.1	NP_001013663.1	A0PJX8	TMM82_HUMAN	transmembrane protein 82	304						integral component of membrane (GO:0016021)				autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(2)|lung(5)|prostate(1)|skin(1)	13		Colorectal(325;0.00108)|Renal(390;0.00145)|Breast(348;0.00224)|Lung NSC(340;0.00566)|all_lung(284;0.00831)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0798)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.73e-07)|COAD - Colon adenocarcinoma(227;3.49e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000114)|KIRC - Kidney renal clear cell carcinoma(229;0.00244)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		GTCTCGTGGGCGTCCGCACCC	0.632																																																	0								ENSG00000162460						100.0	90.0	94.0					1																	16073516		2203	4300	6503	TMEM82	SO:0001819	synonymous_variant	0			-	HGNC		CCDS30608.1	1p36.13	2008-02-05				ENSG00000162460			32350	protein-coding gene	gene with protein product							Standard	NM_001013641		Approved		uc001axc.4	A0PJX8		ENST00000375782.1:c.912C>T	1.37:g.16073516C>T		Somatic	0	31	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	34	10.53	B2RP27|Q5VVD4	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.G304	ENST00000375782.1	37	c.912	CCDS30608.1	1																																																																																			-	NULL		0.632	TMEM82-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM82	protein_coding	OTTHUMT00000008471.2	C	NM_001013641	rs150729040		16073516	+1	no_errors	ENST00000375782	ensembl	human	known	74_37	silent	SNP	0.000	T
COL23A1	91522	genome.wustl.edu	37	5	177683352	177683352	+	Splice_Site	SNP	A	A	T			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr5:177683352A>T	ENST00000390654.3	-	15	1240		c.e15+1		COL23A1_ENST00000407622.1_Splice_Site	NM_173465.3	NP_775736.2	Q86Y22	CONA1_HUMAN	collagen, type XXIII, alpha 1						collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(3)|lung(6)|ovary(1)|skin(2)|urinary_tract(1)	19	all_cancers(89;0.00188)|Renal(175;0.000159)|Lung NSC(126;0.00814)|all_lung(126;0.0129)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	OV - Ovarian serous cystadenocarcinoma(192;0.153)|all cancers(165;0.172)		GCGGCAGCTTACCCGGGGCCC	0.647																																																	0								ENSG00000050767						19.0	23.0	22.0					5																	177683352		1959	4137	6096	COL23A1	SO:0001630	splice_region_variant	0			-	HGNC	AL137461	CCDS4436.1	5q35.3	2013-01-16			ENSG00000050767	ENSG00000050767		"""Collagens"""	22990	protein-coding gene	gene with protein product		610043				12644459	Standard	NM_173465		Approved	DKFZp434K0621	uc021yiz.1	Q86Y22	OTTHUMG00000130890	ENST00000390654.3:c.882+1T>A	5.37:g.177683352A>T		Somatic	0	48	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	57	31.33	Q8IVR4|Q9NT93	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e15+2	ENST00000390654.3	37	c.882+2	CCDS4436.1	5	.	.	.	.	.	.	.	.	.	.	A	14.89	2.671375	0.47781	.	.	ENSG00000050767	ENST00000390654;ENST00000407622	.	.	.	4.42	4.42	0.53409	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.2259	0.43225	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	COL23A1	177615958	1.000000	0.71417	1.000000	0.80357	0.474000	0.32979	2.577000	0.46042	1.998000	0.58463	0.459000	0.35465	.	-	-		0.647	COL23A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL23A1	protein_coding	OTTHUMT00000253475.1	A	NM_173465	-	Intron	177683352	-1	no_errors	ENST00000390654	ensembl	human	known	74_37	splice_site	SNP	1.000	T
TNFSF10	8743	genome.wustl.edu	37	3	172224433	172224433	+	Missense_Mutation	SNP	G	G	T			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr3:172224433G>T	ENST00000241261.2	-	5	817	c.695C>A	c.(694-696)tCt>tAt	p.S232Y	TNFSF10_ENST00000420541.2_3'UTR	NM_003810.3	NP_003801.1	P50591	TNF10_HUMAN	tumor necrosis factor (ligand) superfamily, member 10	232					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell-cell signaling (GO:0007267)|immune response (GO:0006955)|male gonad development (GO:0008584)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|response to insulin (GO:0032868)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	metal ion binding (GO:0046872)|receptor binding (GO:0005102)			breast(2)|cervix(1)|large_intestine(1)|lung(6)|ovary(1)|skin(4)	15	Ovarian(172;0.00197)|Breast(254;0.158)		Lung(28;1.67e-15)|LUSC - Lung squamous cell carcinoma(14;1.48e-14)|STAD - Stomach adenocarcinoma(35;0.235)			TGCATCTTTAGACCAACAACT	0.333																																																	0								ENSG00000121858						222.0	213.0	216.0					3																	172224433		2203	4300	6503	TNFSF10	SO:0001583	missense	0			-	HGNC	U37518	CCDS3219.1, CCDS54680.1	3q26	2006-09-20			ENSG00000121858	ENSG00000121858		"""Tumor necrosis factor (ligand) superfamily"", ""CD molecules"""	11925	protein-coding gene	gene with protein product		603598				8777713, 8663110	Standard	NM_003810		Approved	TRAIL, Apo-2L, TL2, CD253	uc003fid.3	P50591	OTTHUMG00000156917	ENST00000241261.2:c.695C>A	3.37:g.172224433G>T	ENSP00000241261:p.Ser232Tyr	Somatic	0	45	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	A1Y9B3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TNF_dom,superfamily_Tumour_necrosis_fac-like_dom,smart_TNF_dom,pirsf_TNF_ligand_10/11,pfscan_TNF_dom	p.S232Y	ENST00000241261.2	37	c.695	CCDS3219.1	3	.	.	.	.	.	.	.	.	.	.	G	15.07	2.723176	0.48728	.	.	ENSG00000121858	ENST00000241261	D	0.95035	-3.59	5.54	5.54	0.83059	Tumour necrosis factor (3);Tumour necrosis factor-like (2);	0.099831	0.64402	D	0.000001	D	0.97707	0.9248	M	0.86740	2.835	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97964	1.0339	10	0.72032	D	0.01	-23.4166	19.8397	0.96678	0.0:0.0:1.0:0.0	.	232	P50591	TNF10_HUMAN	Y	232	ENSP00000241261:S232Y	ENSP00000241261:S232Y	S	-	2	0	TNFSF10	173707127	1.000000	0.71417	1.000000	0.80357	0.007000	0.05969	8.208000	0.89748	2.768000	0.95171	0.491000	0.48974	TCT	-	pfam_TNF_dom,superfamily_Tumour_necrosis_fac-like_dom,smart_TNF_dom,pirsf_TNF_ligand_10/11,pfscan_TNF_dom		0.333	TNFSF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFSF10	protein_coding	OTTHUMT00000346601.1	G		-		172224433	-1	no_errors	ENST00000241261	ensembl	human	known	74_37	missense	SNP	1.000	T
CNR1	1268	genome.wustl.edu	37	6	88854252	88854252	+	Missense_Mutation	SNP	C	C	A			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr6:88854252C>A	ENST00000537554.1	-	2	4304	c.742G>T	c.(742-744)Gcc>Tcc	p.A248S	CNR1_ENST00000362094.5_3'UTR|CNR1_ENST00000549716.1_Missense_Mutation_p.A187S|CNR1_ENST00000369499.2_Missense_Mutation_p.A248S|CNR1_ENST00000428600.2_Missense_Mutation_p.A248S|CNR1_ENST00000535130.1_Missense_Mutation_p.A248S|CNR1_ENST00000549890.1_Missense_Mutation_p.A248S|CNR1_ENST00000369501.2_Missense_Mutation_p.A248S|CNR1_ENST00000468898.1_Missense_Mutation_p.A215S	NM_001160226.1|NM_001160258.1	NP_001153698.1|NP_001153730.1	P21554	CNR1_HUMAN	cannabinoid receptor 1 (brain)	248					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|aging (GO:0007568)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|glucose homeostasis (GO:0042593)|maternal process involved in female pregnancy (GO:0060135)|memory (GO:0007613)|negative regulation of action potential (GO:0045759)|negative regulation of blood pressure (GO:0045776)|negative regulation of dopamine secretion (GO:0033602)|negative regulation of fatty acid beta-oxidation (GO:0031999)|negative regulation of mast cell activation (GO:0033004)|negative regulation of nitric-oxide synthase activity (GO:0051001)|positive regulation of acute inflammatory response to antigenic stimulus (GO:0002866)|positive regulation of apoptotic process (GO:0043065)|positive regulation of blood pressure (GO:0045777)|positive regulation of fever generation (GO:0031622)|positive regulation of neuron projection development (GO:0010976)|regulation of feeding behavior (GO:0060259)|regulation of insulin secretion (GO:0050796)|regulation of penile erection (GO:0060405)|regulation of synaptic transmission, GABAergic (GO:0032228)|regulation of synaptic transmission, glutamatergic (GO:0051966)|response to cocaine (GO:0042220)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to morphine (GO:0043278)|response to nicotine (GO:0035094)|response to nutrient (GO:0007584)|sensory perception of pain (GO:0019233)|spermatogenesis (GO:0007283)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cannabinoid receptor activity (GO:0004949)|drug binding (GO:0008144)			breast(2)|endometrium(3)|kidney(1)|large_intestine(7)|liver(1)|lung(11)|prostate(1)|skin(10)|urinary_tract(1)	37		all_cancers(76;8.24e-09)|Acute lymphoblastic leukemia(125;2.15e-10)|Prostate(29;4.11e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;0.00011)		BRCA - Breast invasive adenocarcinoma(108;0.15)	Dronabinol(DB00470)|Nabilone(DB00486)|Rimonabant(DB06155)	GGCAGCACGGCGATCACAATG	0.527																																																	0								ENSG00000118432						85.0	77.0	80.0					6																	88854252		2203	4300	6503	CNR1	SO:0001583	missense	0			-	HGNC	AF107262	CCDS5015.1, CCDS5016.1, CCDS5016.2	6q14-q15	2012-08-08			ENSG00000118432	ENSG00000118432		"""GPCR / Class A : Cannabinoid receptors"""	2159	protein-coding gene	gene with protein product		114610		CNR			Standard	NM_016083		Approved	CB1K5, CB-R, CB1, CANN6, CB1A	uc003pmq.4	P21554	OTTHUMG00000015184	ENST00000537554.1:c.742G>T	6.37:g.88854252C>A	ENSP00000441046:p.Ala248Ser	Somatic	0	8	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	6	53.85	B2R9T4|E1P512|Q13949|Q495Z0|Q4PLI4|Q4VBM6|Q5JVL5|Q5UB37|Q9UNN0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pirsf_Canbinoid_rcpt_1,pfscan_GPCR_Rhodpsn_7TM,prints_Canbinoid_rcpt_1,prints_Cnbnoid_rcpt,prints_GPCR_Rhodpsn	p.A248S	ENST00000537554.1	37	c.742	CCDS5015.1	6	.	.	.	.	.	.	.	.	.	.	C	6.915	0.538497	0.13250	.	.	ENSG00000118432	ENST00000369501;ENST00000535130;ENST00000537554;ENST00000369499;ENST00000549890;ENST00000468898;ENST00000428600;ENST00000549716	T;T;T;T;T;T;T;T	0.35048	1.33;1.33;1.33;1.33;1.33;1.33;1.33;1.33	5.9	5.9	0.94986	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.12774	0.0310	N	0.01751	-0.74	0.80722	D	1	B;B	0.28713	0.22;0.151	B;B	0.39339	0.146;0.297	T	0.34750	-0.9816	10	0.20519	T	0.43	.	20.2861	0.98535	0.0:1.0:0.0:0.0	.	215;248	P21554-3;P21554	.;CNR1_HUMAN	S	248;248;248;248;248;215;248;187	ENSP00000358513:A248S;ENSP00000442689:A248S;ENSP00000441046:A248S;ENSP00000358511:A248S;ENSP00000446819:A248S;ENSP00000420188:A215S;ENSP00000412192:A248S;ENSP00000449549:A187S	ENSP00000358511:A248S	A	-	1	0	CNR1	88910971	1.000000	0.71417	0.339000	0.25562	0.090000	0.18270	7.818000	0.86416	2.800000	0.96347	0.655000	0.94253	GCC	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pirsf_Canbinoid_rcpt_1,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.527	CNR1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	CNR1	protein_coding	OTTHUMT00000354204.2	C		-		88854252	-1	no_errors	ENST00000369499	ensembl	human	known	74_37	missense	SNP	1.000	A
WNK1	65125	genome.wustl.edu	37	12	988968	988968	+	Missense_Mutation	SNP	G	G	T			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr12:988968G>T	ENST00000315939.6	+	11	3246	c.2603G>T	c.(2602-2604)gGc>gTc	p.G868V	WNK1_ENST00000535572.1_Intron|WNK1_ENST00000537687.1_Intron|WNK1_ENST00000530271.2_Missense_Mutation_p.G1366V|WNK1_ENST00000340908.4_Missense_Mutation_p.G461V	NM_018979.3	NP_061852.3	Q9H4A3	WNK1_HUMAN	WNK lysine deficient protein kinase 1	868					intracellular signal transduction (GO:0035556)|ion transport (GO:0006811)|negative regulation of pancreatic juice secretion (GO:0090188)|negative regulation of phosphatase activity (GO:0010923)|neuron development (GO:0048666)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of systemic arterial blood pressure (GO:0003084)|protein phosphorylation (GO:0006468)|regulation of cellular process (GO:0050794)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|phosphatase binding (GO:0019902)|protein kinase inhibitor activity (GO:0004860)|protein serine/threonine kinase activity (GO:0004674)			breast(7)|central_nervous_system(1)|endometrium(3)|kidney(6)|large_intestine(15)|lung(43)|ovary(6)|prostate(3)|skin(7)|stomach(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	104	all_cancers(10;0.00611)|all_epithelial(11;0.00825)|all_lung(10;0.0331)|Ovarian(42;0.0512)|Lung NSC(10;0.0632)		Epithelial(1;1.74e-08)|all cancers(1;7.04e-08)|OV - Ovarian serous cystadenocarcinoma(31;0.000423)|BRCA - Breast invasive adenocarcinoma(9;0.0149)|Colorectal(1;0.0197)			ATGGCAGCTGGCATTACTCAG	0.527																																					Colon(19;451 567 6672 12618 28860)												0								ENSG00000060237						163.0	136.0	145.0					12																	988968		2203	4300	6503	WNK1	SO:0001583	missense	0			-	HGNC	AJ296290	CCDS8506.1, CCDS53731.1, CCDS73419.1	12p13.3	2014-09-17	2005-01-19	2005-01-21	ENSG00000060237	ENSG00000060237			14540	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 167"""	605232	"""protein kinase, lysine deficient 1"", ""hereditary sensory neuropathy, type II"""	PRKWNK1, HSN2			Standard	NM_001184985		Approved	HSAN2, PPP1R167	uc031qfk.1	Q9H4A3	OTTHUMG00000090321	ENST00000315939.6:c.2603G>T	12.37:g.988968G>T	ENSP00000313059:p.Gly868Val	Somatic	0	30	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	8	27.27	A1L4B0|C5HTZ5|C5HTZ6|C5HTZ7|H6WZW3|O15052|P54963|Q4VBX9|Q6IFS5|Q86WL5|Q8N673|Q96CZ6|Q9P1S9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Kinase_OSR1/WNK_CCT,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.G1366V	ENST00000315939.6	37	c.4097	CCDS8506.1	12	.	.	.	.	.	.	.	.	.	.	G	13.59	2.283594	0.40394	.	.	ENSG00000060237	ENST00000315939;ENST00000530271;ENST00000340908;ENST00000535698	T;T;T;T	0.21191	2.02;2.02;2.02;2.02	5.53	5.53	0.82687	.	0.098484	0.44688	D	0.000421	T	0.31071	0.0785	L	0.29908	0.895	0.54753	D	0.999981	D	0.54047	0.964	P	0.55785	0.784	T	0.01090	-1.1455	10	0.42905	T	0.14	-7.0602	19.4537	0.94878	0.0:0.0:1.0:0.0	.	868	Q9H4A3	WNK1_HUMAN	V	868;1366;461;138	ENSP00000313059:G868V;ENSP00000433548:G1366V;ENSP00000341292:G461V;ENSP00000439552:G138V	ENSP00000313059:G868V	G	+	2	0	WNK1	859229	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	3.729000	0.54999	2.584000	0.87258	0.557000	0.71058	GGC	-	NULL		0.527	WNK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WNK1	protein_coding	OTTHUMT00000206683.1	G	NM_018979	-		988968	+1	no_errors	ENST00000530271	ensembl	human	known	74_37	missense	SNP	1.000	T
EDNRB	1910	genome.wustl.edu	37	13	78492295	78492295	+	Silent	SNP	G	G	T			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr13:78492295G>T	ENST00000334286.5	-	1	650	c.414C>A	c.(412-414)atC>atA	p.I138I	RNF219-AS1_ENST00000607862.1_RNA|EDNRB_ENST00000377211.4_Silent_p.I228I|EDNRB_ENST00000475537.1_5'Flank|EDNRB_ENST00000446573.1_Silent_p.I138I	NM_000115.3|NM_001122659.2	NP_000106.1|NP_001116131.1	P24530	EDNRB_HUMAN	endothelin receptor type B	138					aging (GO:0007568)|cell surface receptor signaling pathway (GO:0007166)|cellular response to lipopolysaccharide (GO:0071222)|cGMP-mediated signaling (GO:0019934)|endothelin receptor signaling pathway (GO:0086100)|enteric nervous system development (GO:0048484)|enteric smooth muscle cell differentiation (GO:0035645)|epithelial fluid transport (GO:0042045)|macrophage chemotaxis (GO:0048246)|melanocyte differentiation (GO:0030318)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular protein metabolic process (GO:0032269)|negative regulation of neuron maturation (GO:0014043)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|peripheral nervous system development (GO:0007422)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of penile erection (GO:0060406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of urine volume (GO:0035810)|posterior midgut development (GO:0007497)|regulation of blood pressure (GO:0008217)|regulation of epithelial cell proliferation (GO:0050678)|regulation of fever generation (GO:0031620)|regulation of pH (GO:0006885)|regulation of sensory perception of pain (GO:0051930)|response to organic cyclic compound (GO:0014070)|response to pain (GO:0048265)|sensory perception of pain (GO:0019233)|vasoconstriction (GO:0042310)|vasodilation (GO:0042311)|vein smooth muscle contraction (GO:0014826)	integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)	endothelin receptor activity (GO:0004962)|peptide hormone binding (GO:0017046)			breast(2)|endometrium(2)|kidney(1)|large_intestine(18)|lung(16)|skin(3)	42		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.037)		GBM - Glioblastoma multiforme(99;0.0933)	Bosentan(DB00559)|MACITENTAN(DB08932)|Sitaxentan(DB06268)	TGGCGATCAAGATATTGGGAC	0.512																																																	0								ENSG00000136160						126.0	114.0	118.0					13																	78492295		2203	4300	6503	EDNRB	SO:0001819	synonymous_variant	0			-	HGNC	L06623	CCDS9461.1, CCDS55902.1	13q22	2012-08-08			ENSG00000136160	ENSG00000136160		"""GPCR / Class A : Endothelin receptors"""	3180	protein-coding gene	gene with protein product		131244		HSCR2, HSCR		1659806, 9556633	Standard	NM_000115		Approved	ETB	uc001vkp.1	P24530	OTTHUMG00000017111	ENST00000334286.5:c.414C>A	13.37:g.78492295G>T		Somatic	0	43	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	35	10.26	A2A2Z8|A8K3T4|O15343|Q59GB1|Q5W0G9|Q8NHM6|Q8NHM7|Q8NHM8|Q8NHM9|Q9UD23|Q9UQK3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_ETB_rcpt,prints_Endthln_rcpt,prints_GPCR_Rhodpsn,prints_Bombsn_rcpt	p.I138	ENST00000334286.5	37	c.414	CCDS9461.1	13																																																																																			-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.512	EDNRB-003	KNOWN	basic|appris_principal|CCDS	protein_coding	EDNRB	protein_coding	OTTHUMT00000276505.1	G		-		78492295	-1	no_errors	ENST00000334286	ensembl	human	known	74_37	silent	SNP	1.000	T
IRF2BPL	64207	genome.wustl.edu	37	14	77493792	77493794	+	In_Frame_Del	DEL	TGT	TGT	-	rs377151545|rs28718623|rs71125518	byFrequency	TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	TGT	TGT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr14:77493792_77493794delTGT	ENST00000238647.3	-	1	1240_1242	c.342_344delACA	c.(340-345)caacag>cag	p.114_115QQ>Q		NM_024496.3	NP_078772.1	Q9H1B7	I2BPL_HUMAN	interferon regulatory factor 2 binding protein-like	114	Poly-Gln.				development of secondary female sexual characteristics (GO:0046543)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	extracellular space (GO:0005615)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			endometrium(2)|kidney(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	11						ctgctgctgctgttgctgctgct	0.7																																																	0								ENSG00000119669			1119,1147		390,339,404						-1.3	0.0			2	2585,1523		1057,471,526	no	coding	IRF2BPL	NM_024496.2		1447,810,930	A1A1,A1R,RR		37.074,49.3822,41.8889				3704,2670				IRF2BPL	SO:0001651	inframe_deletion	0				HGNC	AJ277365	CCDS9854.1	14q24.3	2011-02-23	2011-02-23	2011-02-23	ENSG00000119669	ENSG00000119669			14282	protein-coding gene	gene with protein product	"""enhanced at puberty 1"""	611720	"""chromosome 14 open reading frame 4"""	C14orf4		11095982, 17627301	Standard	NM_024496		Approved	EAP1, KIAA1865	uc001xsy.4	Q9H1B7		ENST00000238647.3:c.342_344delACA	14.37:g.77493792_77493794delTGT	ENSP00000238647:p.Gln127del	Somatic	0	8	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	7	41.67	Q8NDQ2|Q96JG2|Q9H3I7	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Interferon_reg_fac2-bd1_2_Znf	p.Q118in_frame_del	ENST00000238647.3	37	c.344_342	CCDS9854.1	14																																																																																			-	pfam_Interferon_reg_fac2-bd1_2_Znf		0.700	IRF2BPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRF2BPL	protein_coding	OTTHUMT00000414298.1	TGT	NM_024496			77493794	-1	no_errors	ENST00000238647	ensembl	human	known	74_37	in_frame_del	DEL	0.050:0.052:0.060	-
OR10H1	26539	genome.wustl.edu	37	19	15918238	15918238	+	Missense_Mutation	SNP	A	A	C	rs144349437	byFrequency	TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr19:15918238A>C	ENST00000334920.2	-	1	698	c.610T>G	c.(610-612)Tgt>Ggt	p.C204G		NM_013940.2	NP_039228.1	Q9Y4A9	O10H1_HUMAN	olfactory receptor, family 10, subfamily H, member 1	204						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(8)|ovary(4)|skin(2)|urinary_tract(1)	29						GCCGTGATACACACCAAGCCC	0.552																																																	0								ENSG00000186723						161.0	125.0	137.0					19																	15918238		2203	4300	6503	OR10H1	SO:0001583	missense	0			-	HGNC	AC004510	CCDS12335.1	19p13.1	2012-08-09				ENSG00000186723		"""GPCR / Class A : Olfactory receptors"""	8172	protein-coding gene	gene with protein product							Standard	NM_013940		Approved		uc002nbq.2	Q9Y4A9		ENST00000334920.2:c.610T>G	19.37:g.15918238A>C	ENSP00000335596:p.Cys204Gly	Somatic	0	55	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	70	10.26	Q6IFQ2|Q96R59	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.C204G	ENST00000334920.2	37	c.610	CCDS12335.1	19	66	0.03021978021978022	14	0.028455284552845527	11	0.03038674033149171	11	0.019230769230769232	30	0.0395778364116095	.	7.008	0.556262	0.13436	.	.	ENSG00000186723	ENST00000334920	T	0.35789	1.29	4.71	4.71	0.59529	GPCR, rhodopsin-like superfamily (1);	0.000000	0.53938	D	0.000044	T	0.08223	0.0205	N	0.02685	-0.53	0.38812	D	0.955438	D	0.71674	0.998	D	0.74674	0.984	T	0.14755	-1.0461	10	0.19147	T	0.46	.	10.5755	0.45225	1.0:0.0:0.0:0.0	.	204	Q9Y4A9	O10H1_HUMAN	G	204	ENSP00000335596:C204G	ENSP00000335596:C204G	C	-	1	0	OR10H1	15779238	0.003000	0.15002	0.959000	0.39883	0.114000	0.19823	0.767000	0.26575	1.760000	0.52011	0.523000	0.50628	TGT	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.552	OR10H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10H1	protein_coding	OTTHUMT00000460364.1	A		rs144349437		15918238	-1	no_errors	ENST00000334920	ensembl	human	known	74_37	missense	SNP	0.995	C
WDR59	79726	genome.wustl.edu	37	16	74976691	74976691	+	Frame_Shift_Del	DEL	T	T	-			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr16:74976691delT	ENST00000262144.6	-	7	609	c.479delA	c.(478-480)aatfs	p.N160fs		NM_030581.3	NP_085058.3	Q6PJI9	WDR59_HUMAN	WD repeat domain 59	160										breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|ovary(1)|prostate(1)	27						GCAGTTAGCATTTTTTTTATT	0.502																																																	0								ENSG00000103091						84.0	76.0	79.0					16																	74976691		2198	4300	6498	WDR59	SO:0001589	frameshift_variant	0				HGNC	AB067510	CCDS32488.1	16q22.3	2013-01-09				ENSG00000103091		"""WD repeat domain containing"""	25706	protein-coding gene	gene with protein product						11572484	Standard	XM_005256146		Approved	FLJ12270	uc002fdh.1	Q6PJI9		ENST00000262144.6:c.479delA	16.37:g.74976691delT	ENSP00000262144:p.Asn160fs	Somatic	0	25	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	22	15.38	B3KRC3|Q71RE7|Q96PW5|Q9BSW6|Q9HA43	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_UBQ-conjugating_enzyme/RWD,smart_WD40_repeat,smart_RWD-domain,pfscan_RWD-domain,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.N160fs	ENST00000262144.6	37	c.479	CCDS32488.1	16																																																																																			-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom		0.502	WDR59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR59	protein_coding	OTTHUMT00000410601.3	T	NM_030581			74976691	-1	no_errors	ENST00000262144	ensembl	human	known	74_37	frame_shift_del	DEL	0.999	-
IL2RB	3560	genome.wustl.edu	37	22	37524543	37524543	+	Missense_Mutation	SNP	C	C	T			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr22:37524543C>T	ENST00000216223.5	-	10	1447	c.1249G>A	c.(1249-1251)Gcc>Acc	p.A417T		NM_000878.3	NP_000869.1	P14784	IL2RB_HUMAN	interleukin 2 receptor, beta	417					cytokine-mediated signaling pathway (GO:0019221)|interleukin-2-mediated signaling pathway (GO:0038110)|negative regulation of apoptotic process (GO:0043066)|protein complex assembly (GO:0006461)|signal transduction (GO:0007165)|viral process (GO:0016032)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	interleukin-2 binding (GO:0019976)|interleukin-2 receptor activity (GO:0004911)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)|skin(5)	23					Aldesleukin(DB00041)|Basiliximab(DB00074)|Daclizumab(DB00111)|Denileukin diftitox(DB00004)	GTGCAGTAGGCGTCGTCCTCC	0.677																																																	0								ENSG00000100385						28.0	29.0	28.0					22																	37524543		2203	4300	6503	IL2RB	SO:0001583	missense	0			-	HGNC	M26062	CCDS13942.1	22q13	2011-02-15			ENSG00000100385	ENSG00000100385		"""Interleukins and interleukin receptors"", ""CD molecules"""	6009	protein-coding gene	gene with protein product		146710	"""interleukin 15 receptor, beta"""	IL15RB			Standard	NM_000878		Approved	CD122	uc003aqv.1	P14784	OTTHUMG00000150534	ENST00000216223.5:c.1249G>A	22.37:g.37524543C>T	ENSP00000216223:p.Ala417Thr	Somatic	0	29	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	11	45.00	B2R765	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.A417T	ENST00000216223.5	37	c.1249	CCDS13942.1	22	.	.	.	.	.	.	.	.	.	.	c	10.54	1.380029	0.24944	.	.	ENSG00000100385	ENST00000216223	T	0.08984	3.03	4.83	2.42	0.29668	.	0.431311	0.18721	N	0.133014	T	0.10208	0.0250	L	0.57536	1.79	0.09310	N	1	D	0.62365	0.991	P	0.47134	0.539	T	0.17868	-1.0355	10	0.16896	T	0.51	-12.971	7.5487	0.27783	0.2061:0.7034:0.0:0.0905	.	417	P14784	IL2RB_HUMAN	T	417	ENSP00000216223:A417T	ENSP00000216223:A417T	A	-	1	0	IL2RB	35854489	0.064000	0.20934	0.379000	0.26080	0.125000	0.20455	0.301000	0.19174	1.149000	0.42402	-0.119000	0.15052	GCC	-	NULL		0.677	IL2RB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL2RB	protein_coding	OTTHUMT00000318792.1	C		-		37524543	-1	no_errors	ENST00000216223	ensembl	human	known	74_37	missense	SNP	0.086	T
CFAP57	149465	genome.wustl.edu	37	1	43650876	43650876	+	Missense_Mutation	SNP	C	C	T	rs368874977		TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr1:43650876C>T	ENST00000372492.4	+	5	1142	c.818C>T	c.(817-819)gCg>gTg	p.A273V	WDR65_ENST00000528956.1_Missense_Mutation_p.A273V	NM_001195831.2	NP_001182760.2	Q96MR6	WDR65_HUMAN		273										NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(7)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				CAGATGGTGGCGGCCAGTAGC	0.478																																																	0								ENSG00000243710	C	VAL/ALA,VAL/ALA,VAL/ALA	1,4405	2.1+/-5.4	0,1,2202	116.0	116.0	116.0		818,818,818	-10.3	0.0	1		116	0,8600		0,0,4300	no	missense,missense,missense	WDR65	NM_001167965.1,NM_001167966.1,NM_152498.3	64,64,64	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign,benign,benign	273/699,273/699,273/699	43650876	1,13005	2203	4300	6503	WDR65	SO:0001583	missense	0			-	HGNC																												ENST00000372492.4:c.818C>T	1.37:g.43650876C>T	ENSP00000361570:p.Ala273Val	Somatic	0	39	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	40	14.89	A6NKQ3|Q17RI9|Q5TAI0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,superfamily_Quinonprotein_ADH-like_supfam,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.A273V	ENST00000372492.4	37	c.818		1	.	.	.	.	.	.	.	.	.	.	C	12.56	1.975362	0.34848	2.27E-4	0.0	ENSG00000243710	ENST00000372492;ENST00000528956	T;T	0.37411	1.2;1.26	5.53	-10.3	0.00346	Quinonprotein alcohol dehydrogenase-like (1);WD40 repeat-like-containing domain (1);	2.347010	0.01159	N	0.006586	T	0.14917	0.0360	N	0.08118	0	0.09310	N	1	B;B	0.17465	0.001;0.022	B;B	0.12156	0.001;0.007	T	0.08764	-1.0706	10	0.25751	T	0.34	.	6.2819	0.21011	0.3186:0.2905:0.0:0.3909	.	273;273	Q96MR6;Q96MR6-2	WDR65_HUMAN;.	V	273	ENSP00000361570:A273V;ENSP00000435310:A273V	ENSP00000361570:A273V	A	+	2	0	WDR65	43423463	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.472000	0.06623	-1.458000	0.01916	-0.229000	0.12294	GCG	-	superfamily_Quinonprotein_ADH-like_supfam,superfamily_WD40_repeat_dom		0.478	WDR65-002	NOVEL	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	WDR65	protein_coding	OTTHUMT00000384325.1	C		-		43650876	+1	no_errors	ENST00000528956	ensembl	human	known	74_37	missense	SNP	0.000	T
DLGAP2	9228	genome.wustl.edu	37	8	1626652	1626652	+	Missense_Mutation	SNP	A	A	C			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr8:1626652A>C	ENST00000421627.2	+	9	2455	c.2321A>C	c.(2320-2322)gAc>gCc	p.D774A	DLGAP2_ENST00000524065.1_3'UTR	NM_004745.3	NP_004736.2	Q9P1A6	DLGP2_HUMAN	discs, large (Drosophila) homolog-associated protein 2	853					neuron-neuron synaptic transmission (GO:0007270)	cell junction (GO:0030054)|neurofilament (GO:0005883)|postsynaptic membrane (GO:0045211)				breast(1)|endometrium(6)|lung(31)|prostate(3)	41		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)		BRCA - Breast invasive adenocarcinoma(11;0.000169)|READ - Rectum adenocarcinoma(644;0.171)		CCCGCCATCGACACGGTAGAG	0.602																																																	0								ENSG00000198010						20.0	24.0	22.0					8																	1626652		1904	4124	6028	DLGAP2	SO:0001583	missense	0			-	HGNC	AB000275	CCDS47760.1, CCDS75689.1	8p23	2007-12-06	2001-11-28		ENSG00000198010	ENSG00000198010			2906	protein-coding gene	gene with protein product		605438	"""discs, large (Drosophila) homolog-associated protein 2"""			9286858, 10854099	Standard	NM_004745		Approved	DAP-2	uc003wpl.4	Q9P1A6	OTTHUMG00000163599	ENST00000421627.2:c.2321A>C	8.37:g.1626652A>C	ENSP00000400258:p.Asp774Ala	Somatic	0	54	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	46	19.30	A1QCF8|A1QCF9|A5D8Y2|O14488|O14664|Q9P1A7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GKAP	p.D774A	ENST00000421627.2	37	c.2321	CCDS47760.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	7.188|7.188	0.590935|0.590935	0.13812|0.13812	.|.	.|.	ENSG00000198010|ENSG00000198010	ENST00000356067;ENST00000421627|ENST00000520901	T|.	0.18174|.	2.23|.	5.32|5.32	5.32|5.32	0.75619|0.75619	.|.	0.556195|.	0.19455|.	N|.	0.113854|.	T|T	0.56529|0.56529	0.1991|0.1991	L|L	0.34521|0.34521	1.04|1.04	0.37174|0.37174	D|D	0.903169|0.903169	B;B|.	0.18610|.	0.01;0.029|.	B;B|.	0.24541|.	0.02;0.054|.	T|T	0.60276|0.60276	-0.7295|-0.7295	10|5	0.56958|.	D|.	0.05|.	-6.3732|-6.3732	15.2784|15.2784	0.73760|0.73760	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	839;853|.	Q9P1A6-2;Q9P1A6|.	.;DLGP2_HUMAN|.	A|P	805;774|777	ENSP00000400258:D774A|.	ENSP00000348366:D805A|.	D|T	+|+	2|1	0|0	DLGAP2|DLGAP2	1614059|1614059	1.000000|1.000000	0.71417|0.71417	0.046000|0.046000	0.18839|0.18839	0.011000|0.011000	0.07611|0.07611	3.546000|3.546000	0.53656|0.53656	2.003000|2.003000	0.58678|0.58678	0.528000|0.528000	0.53228|0.53228	GAC|ACA	-	pfam_GKAP		0.602	DLGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DLGAP2	protein_coding	OTTHUMT00000374478.1	A	NM_004745	-		1626652	+1	no_errors	ENST00000421627	ensembl	human	known	74_37	missense	SNP	0.880	C
EVX1	2128	genome.wustl.edu	37	7	27282704	27282704	+	Missense_Mutation	SNP	C	C	A	rs148966856		TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr7:27282704C>A	ENST00000496902.4	+	1	541	c.55C>A	c.(55-57)Ctg>Atg	p.L19M	EVX1_ENST00000535619.1_5'Flank|EVX1-AS_ENST00000519218.1_RNA|EVX1-AS_ENST00000519050.1_RNA|EVX1-AS_ENST00000517726.1_RNA|EVX1_ENST00000222761.3_Missense_Mutation_p.L19M|RP1-170O19.17_ENST00000523608.2_lincRNA			P49640	EVX1_HUMAN	even-skipped homeobox 1	19					embryo development ending in birth or egg hatching (GO:0009792)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter involved in ventral spinal cord interneuron specification (GO:0021913)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(1)|liver(1)|lung(10)|prostate(1)|skin(1)	14						GCTTGGCACTCTGGTTGGCAA	0.632																																																	0								ENSG00000106038						42.0	45.0	44.0					7																	27282704		2203	4300	6503	EVX1	SO:0001583	missense	0			-	HGNC		CCDS5413.1	7p15.2	2012-03-09	2007-02-15		ENSG00000106038	ENSG00000106038		"""Homeoboxes / ANTP class : HOXL subclass"""	3506	protein-coding gene	gene with protein product		142996	"""eve, even-skipped homeobox homolog 1 (Drosophila)"""			1684419	Standard	XM_005249640		Approved		uc003szd.1	P49640	OTTHUMG00000023093	ENST00000496902.4:c.55C>A	7.37:g.27282704C>A	ENSP00000419266:p.Leu19Met	Somatic	0	52	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	A4D199|B4DQJ0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_Homeobox_metazoa	p.L19M	ENST00000496902.4	37	c.55	CCDS5413.1	7	.	.	.	.	.	.	.	.	.	.	C	15.76	2.929463	0.52759	.	.	ENSG00000106038	ENST00000496902;ENST00000222761	D	0.91740	-2.9	5.09	1.18	0.20946	.	0.000000	0.64402	D	0.000005	D	0.92123	0.7503	M	0.64997	1.995	0.80722	D	1	D;D	0.57899	0.981;0.966	P;P	0.56700	0.804;0.641	D	0.88563	0.3124	10	0.49607	T	0.09	-13.0205	7.1787	0.25760	0.0:0.6675:0.1229:0.2096	.	19;19	F8W9J5;P49640	.;EVX1_HUMAN	M	19	ENSP00000419266:L19M	ENSP00000222761:L19M	L	+	1	2	EVX1	27249229	1.000000	0.71417	0.994000	0.49952	0.990000	0.78478	2.088000	0.41663	-0.064000	0.13043	0.462000	0.41574	CTG	-	NULL		0.632	EVX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EVX1	protein_coding	OTTHUMT00000358750.3	C		-		27282704	+1	no_errors	ENST00000496902	ensembl	human	known	74_37	missense	SNP	0.998	A
PCNXL2	80003	genome.wustl.edu	37	1	233121872	233121872	+	Missense_Mutation	SNP	C	C	T			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr1:233121872C>T	ENST00000258229.9	-	33	6440	c.6206G>A	c.(6205-6207)gGc>gAc	p.G2069D	PCNXL2_ENST00000344698.2_Missense_Mutation_p.G721D	NM_014801.3	NP_055616.3	A6NKB5	PCX2_HUMAN	pecanex-like 2 (Drosophila)	2069						integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(7)|large_intestine(19)|lung(30)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	86		all_cancers(173;0.0347)|Prostate(94;0.137)				GGCTGAGGGGCCCATCACGAT	0.657																																																	0								ENSG00000135749						12.0	15.0	14.0					1																	233121872		2049	4162	6211	PCNXL2	SO:0001583	missense	0			-	HGNC	AK055374	CCDS44335.1	1q42.2	2008-02-05	2001-11-28		ENSG00000135749	ENSG00000135749			8736	protein-coding gene	gene with protein product			"""pecanex (Drosophila)-like 2"""			12477932	Standard	NM_014801		Approved	KIAA0435, FLJ11383	uc001hvl.2	A6NKB5	OTTHUMG00000037824	ENST00000258229.9:c.6206G>A	1.37:g.233121872C>T	ENSP00000258229:p.Gly2069Asp	Somatic	0	35	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	25	28.57	O43162|Q5T9Z8|Q5TDF1|Q8TEP4|Q96HP9|Q9HAL8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Pecanex,superfamily_Trypsin-like_Pept_dom	p.G2069D	ENST00000258229.9	37	c.6206	CCDS44335.1	1	.	.	.	.	.	.	.	.	.	.	C	26.7	4.767591	0.90020	.	.	ENSG00000135749	ENST00000344698;ENST00000258229	T;T	0.24723	1.84;2.84	5.71	5.71	0.89125	.	0.127041	0.53938	D	0.000057	T	0.51787	0.1695	M	0.65975	2.015	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.76575	0.988;0.984	T	0.40776	-0.9545	10	0.42905	T	0.14	.	19.855	0.96755	0.0:1.0:0.0:0.0	.	2069;721	A6NKB5;A6NKB5-3	PCX2_HUMAN;.	D	721;2069	ENSP00000340759:G721D;ENSP00000258229:G2069D	ENSP00000258229:G2069D	G	-	2	0	PCNXL2	231188495	1.000000	0.71417	1.000000	0.80357	0.747000	0.42532	7.429000	0.80309	2.691000	0.91804	0.561000	0.74099	GGC	-	NULL		0.657	PCNXL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PCNXL2	protein_coding	OTTHUMT00000092480.3	C	NM_014801	-		233121872	-1	no_errors	ENST00000258229	ensembl	human	known	74_37	missense	SNP	1.000	T
RBFOX1	54715	genome.wustl.edu	37	16	7568226	7568226	+	Missense_Mutation	SNP	C	C	A	rs542828240		TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr16:7568226C>A	ENST00000550418.1	+	5	1093	c.105C>A	c.(103-105)aaC>aaA	p.N35K	RBFOX1_ENST00000547338.1_Missense_Mutation_p.N35K|RBFOX1_ENST00000547372.1_Missense_Mutation_p.N78K|RBFOX1_ENST00000553186.1_Missense_Mutation_p.N35K|RBFOX1_ENST00000340209.4_Missense_Mutation_p.N40K|RBFOX1_ENST00000552089.1_Missense_Mutation_p.N71K|RBFOX1_ENST00000355637.4_Missense_Mutation_p.N55K|RBFOX1_ENST00000311745.5_Missense_Mutation_p.N55K|RBFOX1_ENST00000422070.4_Missense_Mutation_p.N78K|RBFOX1_ENST00000535565.2_Missense_Mutation_p.N71K|RBFOX1_ENST00000436368.2_Missense_Mutation_p.N55K	NM_018723.3	NP_061193.2	Q9NWB1	RFOX1_HUMAN	RNA binding protein, fox-1 homolog (C. elegans) 1	35					mRNA processing (GO:0006397)|neuromuscular process controlling balance (GO:0050885)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|RNA transport (GO:0050658)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	nucleotide binding (GO:0000166)|protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(11)|lung(17)|ovary(1)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)	55						CCCCGCAGAACGGTATCCCCG	0.597																																					Ovarian(157;934 2567 15163 39509)												0								ENSG00000078328						127.0	127.0	127.0					16																	7568226		2197	4300	6497	RBFOX1	SO:0001583	missense	0			-	HGNC	AF107203	CCDS10531.1, CCDS10532.1, CCDS45405.1, CCDS55983.1, CCDS55984.1	16p13.3	2013-02-12			ENSG00000078328	ENSG00000078328		"""RNA binding motif (RRM) containing"""	18222	protein-coding gene	gene with protein product	"""ataxin 2-binding protein 1"", ""hexaribonucleotide binding protein 1"""	605104				10814712, 16260614	Standard	NM_018723		Approved	A2BP1, FOX-1, HRNBP1	uc002cyy.2	Q9NWB1	OTTHUMG00000129551	ENST00000550418.1:c.105C>A	16.37:g.7568226C>A	ENSP00000450031:p.Asn35Lys	Somatic	0	33	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	8	55.56	Q7Z7I7|Q8TAE3|Q8TAF2|Q8WYB2|Q9NS20	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Fox-1_C_dom,pfam_RRM_dom,smart_RRM_dom,pirsf_RNA-bd_Fox-1,pfscan_RRM_dom	p.N78K	ENST00000550418.1	37	c.234	CCDS55983.1	16	.	.	.	.	.	.	.	.	.	.	C	17.93	3.508913	0.64410	.	.	ENSG00000078328	ENST00000547605;ENST00000550418;ENST00000553186;ENST00000547372;ENST00000422070;ENST00000535565;ENST00000552089;ENST00000551752;ENST00000547338;ENST00000436368;ENST00000311745;ENST00000355637;ENST00000352951;ENST00000340209	T;T;T;T;T;T;T;T;T;T;T	0.34072	1.82;1.4;1.81;1.7;1.69;1.78;1.4;1.52;1.69;1.66;1.38	4.85	1.37	0.22104	.	0.112694	0.56097	D	0.000024	T	0.51991	0.1707	M	0.68952	2.095	0.49299	D	0.999779	D;D;D;D;D;D;D;D;D	0.89917	0.997;0.999;1.0;1.0;0.999;0.999;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D	0.97110	0.921;0.952;0.996;0.998;0.982;0.994;1.0;0.999;1.0	T	0.50440	-0.8828	10	0.72032	D	0.01	-10.6494	8.0799	0.30739	0.0:0.5778:0.0:0.4222	.	55;71;78;55;55;55;35;35;78	F8WAC5;F5H0M1;B7Z1U7;Q9NWB1-2;Q9NWB1-4;Q9NWB1-5;Q9NWB1-3;Q9NWB1;F8VZG9	.;.;.;.;.;.;.;RFOX1_HUMAN;.	K	35;35;35;78;78;71;71;35;35;55;55;55;55;40	ENSP00000450402:N35K;ENSP00000450031:N35K;ENSP00000447753:N35K;ENSP00000446842:N78K;ENSP00000391269:N78K;ENSP00000447281:N35K;ENSP00000447717:N35K;ENSP00000402745:N55K;ENSP00000309117:N55K;ENSP00000347855:N55K;ENSP00000344196:N40K	ENSP00000309117:N55K	N	+	3	2	RBFOX1	7508227	0.994000	0.37717	1.000000	0.80357	0.923000	0.55619	0.261000	0.18442	0.443000	0.26582	-0.262000	0.10625	AAC	-	pirsf_RNA-bd_Fox-1		0.597	RBFOX1-003	KNOWN	basic|CCDS	protein_coding	RBFOX1	protein_coding	OTTHUMT00000409492.2	C	NM_145891	-		7568226	+1	no_errors	ENST00000547372	ensembl	human	known	74_37	missense	SNP	1.000	A
PCDHB1	29930	genome.wustl.edu	37	5	140433279	140433279	+	Missense_Mutation	SNP	C	C	A			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr5:140433279C>A	ENST00000306549.3	+	1	2301	c.2224C>A	c.(2224-2226)Caa>Aaa	p.Q742K		NM_013340.2	NP_037472.2	Q9Y5F3	PCDB1_HUMAN	protocadherin beta 1	742					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(16)|liver(1)|lung(13)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	53			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CAACCTGGTACAAGGACAAGG	0.368																																																	0								ENSG00000171815						111.0	108.0	109.0					5																	140433279		2203	4300	6503	PCDHB1	SO:0001583	missense	0			-	HGNC	AF152488	CCDS4243.1	5q31	2010-01-26			ENSG00000171815	ENSG00000171815		"""Cadherins / Protocadherins : Clustered"""	8680	other	protocadherin		606327				10380929	Standard	NM_013340		Approved	PCDH-BETA1	uc003lik.1	Q9Y5F3	OTTHUMG00000129627	ENST00000306549.3:c.2224C>A	5.37:g.140433279C>A	ENSP00000307234:p.Gln742Lys	Somatic	0	26	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	9	55.00	Q2M257	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.Q742K	ENST00000306549.3	37	c.2224	CCDS4243.1	5	.	.	.	.	.	.	.	.	.	.	C	11.40	1.626580	0.28978	.	.	ENSG00000171815	ENST00000306549	T	0.47177	0.85	5.34	4.42	0.53409	.	0.438335	0.16950	N	0.192927	T	0.31420	0.0796	N	0.14661	0.345	0.09310	N	1	B	0.17038	0.02	B	0.16722	0.016	T	0.21211	-1.0252	10	0.87932	D	0	.	10.7937	0.46449	0.0:0.7914:0.1335:0.0751	.	742	Q9Y5F3	PCDB1_HUMAN	K	742	ENSP00000307234:Q742K	ENSP00000307234:Q742K	Q	+	1	0	PCDHB1	140413463	0.976000	0.34144	0.995000	0.50966	0.242000	0.25591	3.038000	0.49783	2.664000	0.90586	0.655000	0.94253	CAA	-	NULL		0.368	PCDHB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB1	protein_coding	OTTHUMT00000251822.2	C	NM_013340	-		140433279	+1	no_errors	ENST00000306549	ensembl	human	known	74_37	missense	SNP	0.056	A
RNASE8	122665	genome.wustl.edu	37	14	21526107	21526107	+	Missense_Mutation	SNP	G	G	T			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr14:21526107G>T	ENST00000308227.2	+	1	127	c.56G>T	c.(55-57)tGg>tTg	p.W19L	NDRG2_ENST00000403829.3_Intron	NM_138331.1	NP_612204.1	Q8TDE3	RNAS8_HUMAN	ribonuclease, RNase A family, 8	19					RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)	extracellular region (GO:0005576)	nucleic acid binding (GO:0003676)|pancreatic ribonuclease activity (GO:0004522)			endometrium(1)|kidney(1)|large_intestine(1)|lung(1)	4	all_cancers(95;0.000759)		OV - Ovarian serous cystadenocarcinoma(11;3.42e-11)|Epithelial(56;5.57e-09)|all cancers(55;2.36e-08)	GBM - Glioblastoma multiforme(265;0.0188)		CTGGGGCTGTGGGTGGCAGAG	0.567																																																	0								ENSG00000173431						95.0	78.0	84.0					14																	21526107		2203	4300	6503	RNASE8	SO:0001583	missense	0			-	HGNC	AF473854	CCDS9567.1	14q11.1	2003-03-13			ENSG00000173431	ENSG00000173431		"""Ribonucleases, RNase A"""	19277	protein-coding gene	gene with protein product		612485				11861908	Standard	NM_138331		Approved		uc010tlm.2	Q8TDE3	OTTHUMG00000029645	ENST00000308227.2:c.56G>T	14.37:g.21526107G>T	ENSP00000311398:p.Trp19Leu	Somatic	0	30	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	18	14.29	B2RPP6|B2RPP7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RNaseA_domain,superfamily_RNaseA_domain,smart_RNaseA_domain,prints_RNaseA	p.W19L	ENST00000308227.2	37	c.56	CCDS9567.1	14	.	.	.	.	.	.	.	.	.	.	G	12.05	1.822730	0.32237	.	.	ENSG00000173431	ENST00000308227	T	0.75938	-0.98	4.17	3.28	0.37604	.	0.427833	0.20321	N	0.094629	T	0.74512	0.3726	L	0.43923	1.385	0.20563	N	0.999885	D	0.58970	0.984	P	0.56823	0.807	T	0.63607	-0.6599	10	0.49607	T	0.09	-15.6422	7.9427	0.29967	0.1134:0.0:0.8866:0.0	.	19	Q8TDE3	RNAS8_HUMAN	L	19	ENSP00000311398:W19L	ENSP00000311398:W19L	W	+	2	0	RNASE8	20595947	1.000000	0.71417	0.914000	0.36105	0.455000	0.32408	1.558000	0.36309	1.084000	0.41184	0.655000	0.94253	TGG	-	NULL		0.567	RNASE8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNASE8	protein_coding	OTTHUMT00000073925.3	G	NM_138331	-		21526107	+1	no_errors	ENST00000308227	ensembl	human	known	74_37	missense	SNP	0.993	T
TP53	7157	genome.wustl.edu	37	17	7577505	7577505	+	Missense_Mutation	SNP	T	T	A			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr17:7577505T>A	ENST00000269305.4	-	7	965	c.776A>T	c.(775-777)gAc>gTc	p.D259V	TP53_ENST00000413465.2_Missense_Mutation_p.D259V|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Missense_Mutation_p.D259V|TP53_ENST00000420246.2_Missense_Mutation_p.D259V|TP53_ENST00000455263.2_Missense_Mutation_p.D259V|TP53_ENST00000445888.2_Missense_Mutation_p.D259V	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	259	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		D -> A (in a sporadic cancer; somatic mutation).|D -> E (in sporadic cancers; somatic mutation).|D -> G (in sporadic cancers; somatic mutation).|D -> H (in sporadic cancers; somatic mutation).|D -> N (in sporadic cancers; somatic mutation).|D -> P (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|D -> S (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|D -> V (in sporadic cancers; somatic mutation).|D -> Y (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:17224074}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.D259V(18)|p.0?(8)|p.D259G(4)|p.D259F(3)|p.D259fs*5(2)|p.?(1)|p.E258fs*85(1)|p.E258fs*71(1)|p.E258fs*2(1)|p.E258_S260delEDS(1)|p.D259S(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TGACCTGGAGTCTTCCAGTGT	0.587		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	41	Substitution - Missense(26)|Whole gene deletion(8)|Deletion - Frameshift(3)|Insertion - Frameshift(2)|Deletion - In frame(1)|Unknown(1)	lung(8)|upper_aerodigestive_tract(5)|bone(4)|large_intestine(3)|stomach(3)|central_nervous_system(3)|ovary(3)|haematopoietic_and_lymphoid_tissue(2)|urinary_tract(2)|oesophagus(2)|liver(2)|skin(2)|pancreas(1)|breast(1)						ENSG00000141510						134.0	95.0	108.0					17																	7577505		2203	4300	6503	TP53	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	-	HGNC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.776A>T	17.37:g.7577505T>A	ENSP00000269305:p.Asp259Val	Somatic	0	35	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	9	70.97	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.D259V	ENST00000269305.4	37	c.776	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	T	14.78	2.636906	0.47049	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D;D	0.99793	-6.77;-6.77;-6.77;-6.77;-6.77;-6.77;-6.77	4.52	4.52	0.55395	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.164918	0.53938	D	0.000053	D	0.99557	0.9841	M	0.82630	2.6	0.80722	D	1	P;P;P;P;P	0.52842	0.482;0.483;0.537;0.815;0.956	P;B;P;P;P	0.57244	0.692;0.401;0.63;0.795;0.816	D	0.98404	1.0569	10	0.62326	D	0.03	-22.926	7.6416	0.28296	0.1888:0.0:0.0:0.8112	.	259;259;259;259;259	P04637-2;P04637-3;P04637;Q1MSW8;E7EQX7	.;.;P53_HUMAN;.;.	V	259;259;259;259;259;259;248;127	ENSP00000410739:D259V;ENSP00000352610:D259V;ENSP00000269305:D259V;ENSP00000398846:D259V;ENSP00000391127:D259V;ENSP00000391478:D259V;ENSP00000425104:D127V	ENSP00000269305:D259V	D	-	2	0	TP53	7518230	1.000000	0.71417	1.000000	0.80357	0.329000	0.28539	2.616000	0.46376	2.036000	0.60181	0.379000	0.24179	GAC	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd		0.587	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	T	NM_000546	-		7577505	-1	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	SNP	1.000	A
RANBP2	5903	genome.wustl.edu	37	2	109368152	109368152	+	Missense_Mutation	SNP	A	A	G			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr2:109368152A>G	ENST00000283195.6	+	11	1750	c.1624A>G	c.(1624-1626)Aaa>Gaa	p.K542E		NM_006267.4	NP_006258.3	P49792	RBP2_HUMAN	RAN binding protein 2	542					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of glucokinase activity (GO:0033132)|protein folding (GO:0006457)|protein import into nucleus (GO:0006606)|protein sumoylation (GO:0016925)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)	ligase activity (GO:0016874)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|Ran GTPase binding (GO:0008536)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)		RANBP2/ALK(34)	NS(1)|biliary_tract(1)|breast(3)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(21)|large_intestine(19)|lung(51)|pancreas(1)|prostate(8)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	129						GATTCACAGAAAAGCAGTGTA	0.403																																																	0								ENSG00000153201						20.0	22.0	22.0					2																	109368152		975	2109	3084	RANBP2	SO:0001583	missense	0			-	HGNC	D42063	CCDS2079.1	2q13	2013-11-14			ENSG00000153201	ENSG00000153201		"""Tetratricopeptide (TTC) repeat domain containing"""	9848	protein-coding gene	gene with protein product		601181	"""acute necrotizing encephalopathy 1 (autosomal dominant)"""	ANE1		7724562, 19118815	Standard	NM_006267		Approved	NUP358, ADANE	uc002tem.4	P49792	OTTHUMG00000130981	ENST00000283195.6:c.1624A>G	2.37:g.109368152A>G	ENSP00000283195:p.Lys542Glu	Somatic	0	74	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	47	14.29	Q13074|Q15280|Q53TE2|Q59FH7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ran_bind_dom,pfam_Znf_RanBP2,pfam_IR1-M,pfam_Cyclophilin-like_PPIase_dom,pfam_TPR_1,superfamily_Cyclophilin-like_PPIase_dom,smart_TPR_repeat,smart_Ran_bind_dom,smart_Znf_RanBP2,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_Znf_RanBP2,pfscan_Cyclophilin-like_PPIase_dom,pfscan_Ran_bind_dom,prints_Cyclophilin-like_PPIase_dom	p.K542E	ENST00000283195.6	37	c.1624	CCDS2079.1	2	.	.	.	.	.	.	.	.	.	.	A	15.45	2.836811	0.50951	.	.	ENSG00000153201	ENST00000409491;ENST00000283195	T	0.52295	0.67	5.25	5.25	0.73442	.	.	.	.	.	T	0.43144	0.1234	M	0.63428	1.95	0.25504	N	0.987525	P	0.49090	0.919	B	0.36092	0.217	T	0.49908	-0.8889	9	0.59425	D	0.04	-25.5292	12.0375	0.53433	0.8559:0.1441:0.0:0.0	.	542	P49792	RBP2_HUMAN	E	542	ENSP00000283195:K542E	ENSP00000283195:K542E	K	+	1	0	RANBP2	108734584	1.000000	0.71417	1.000000	0.80357	0.876000	0.50452	4.857000	0.62939	2.102000	0.63906	0.528000	0.53228	AAA	-	NULL		0.403	RANBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RANBP2	protein_coding	OTTHUMT00000253594.1	A	NM_006267	-		109368152	+1	no_errors	ENST00000283195	ensembl	human	known	74_37	missense	SNP	1.000	G
RYR3	6263	genome.wustl.edu	37	15	33936613	33936613	+	Nonsense_Mutation	SNP	G	G	T			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr15:33936613G>T	ENST00000389232.4	+	28	3728	c.3658G>T	c.(3658-3660)Gag>Tag	p.E1220*	RYR3_ENST00000415757.3_Nonsense_Mutation_p.E1220*	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	1220	4 X approximate repeats.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		CGGTCTCCAAGAGGGCTTTGA	0.512																																																	0								ENSG00000198838						80.0	80.0	80.0					15																	33936613		1925	4141	6066	RYR3	SO:0001587	stop_gained	0			-	HGNC		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.3658G>T	15.37:g.33936613G>T	ENSP00000373884:p.Glu1220*	Somatic	0	34	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	39	9.30	O15175|Q15412	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ryanodine_rcpt,pfam_Ca-rel_channel,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,superfamily_4_helix_cytokine-like_core,superfamily_ARM-type_fold,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_hand_dom,pfscan_MIR_motif	p.E1220*	ENST00000389232.4	37	c.3658	CCDS45210.1	15	.	.	.	.	.	.	.	.	.	.	G	45	11.344936	0.99549	.	.	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	.	.	.	5.13	5.13	0.70059	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.1356	0.93426	0.0:0.0:1.0:0.0	.	.	.	.	X	1220	.	ENSP00000354735:E1220X	E	+	1	0	RYR3	31723905	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.488000	0.97947	2.826000	0.97356	0.655000	0.94253	GAG	-	NULL		0.512	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR3	protein_coding	OTTHUMT00000417514.1	G		-		33936613	+1	no_errors	ENST00000389232	ensembl	human	known	74_37	nonsense	SNP	1.000	T
KDELC2	143888	genome.wustl.edu	37	11	108357048	108357048	+	Missense_Mutation	SNP	T	T	C			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr11:108357048T>C	ENST00000323468.5	-	3	585	c.520A>G	c.(520-522)Aat>Gat	p.N174D	KDELC2_ENST00000532730.1_5'Flank|KDELC2_ENST00000375648.1_Missense_Mutation_p.N118D|KDELC2_ENST00000434945.2_Missense_Mutation_p.N118D	NM_153705.4	NP_714916.3	Q7Z4H8	KDEL2_HUMAN	KDEL (Lys-Asp-Glu-Leu) containing 2	174						endoplasmic reticulum (GO:0005783)				breast(1)|endometrium(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	13		all_cancers(61;1.38e-11)|all_epithelial(67;3.16e-07)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;6.93e-06)|BRCA - Breast invasive adenocarcinoma(274;8.54e-06)|all cancers(92;0.00016)|OV - Ovarian serous cystadenocarcinoma(223;0.132)|Colorectal(284;0.14)		TGCTGGAGATTGATGCTGGGA	0.458																																																	0								ENSG00000178202						167.0	151.0	156.0					11																	108357048		1866	4104	5970	KDELC2	SO:0001583	missense	0			-	HGNC	AF533708	CCDS41711.1	11q32	2010-11-18			ENSG00000178202	ENSG00000178202			28496	protein-coding gene	gene with protein product						12975309	Standard	NM_153705		Approved	MGC33424	uc001pkj.2	Q7Z4H8	OTTHUMG00000166535	ENST00000323468.5:c.520A>G	11.37:g.108357048T>C	ENSP00000315386:p.Asn174Asp	Somatic	0	39	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	33	10.81	Q6UWW2|Q6ZUM9|Q8N7L8|Q8NE24	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_LipoPS_modifying,pfam_Filamin/ABP280_repeat-like,superfamily_Ig_E-set,smart_Filamin,smart_LipoPS_modifying,pfscan_Filamin/ABP280_repeat-like	p.N174D	ENST00000323468.5	37	c.520	CCDS41711.1	11	.	.	.	.	.	.	.	.	.	.	T	4.704	0.130873	0.08981	.	.	ENSG00000178202	ENST00000323468;ENST00000434945;ENST00000375648	T;T;T	0.21543	2.0;2.0;2.0	4.68	3.56	0.40772	.	0.140567	0.64402	D	0.000007	T	0.06645	0.0170	N	0.03268	-0.37	0.33939	D	0.64303	B;B	0.10296	0.003;0.001	B;B	0.17979	0.02;0.007	T	0.27157	-1.0082	10	0.05833	T	0.94	-27.3271	5.0227	0.14369	0.0:0.3322:0.0:0.6678	.	174;118	Q7Z4H8;Q7Z4H8-2	KDEL2_HUMAN;.	D	174;118;118	ENSP00000315386:N174D;ENSP00000413429:N118D;ENSP00000364799:N118D	ENSP00000315386:N174D	N	-	1	0	KDELC2	107862258	0.981000	0.34729	1.000000	0.80357	0.978000	0.69477	1.047000	0.30367	1.113000	0.41760	0.533000	0.62120	AAT	-	pfam_LipoPS_modifying		0.458	KDELC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDELC2	protein_coding	OTTHUMT00000390273.1	T	NM_153705	-		108357048	-1	no_errors	ENST00000323468	ensembl	human	known	74_37	missense	SNP	1.000	C
FOXK1	221937	genome.wustl.edu	37	7	4722449	4722449	+	Silent	SNP	G	G	T			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr7:4722449G>T	ENST00000328914.4	+	1	510	c.510G>T	c.(508-510)gtG>gtT	p.V170V	FOXK1_ENST00000446823.1_Intron	NM_001037165.1	NP_001032242.1			forkhead box K1											breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(7)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	29		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)|OV - Ovarian serous cystadenocarcinoma(56;7.43e-15)		GCGTCTTCGTGGACGGGGCCT	0.726																																																	0								ENSG00000164916						11.0	11.0	11.0					7																	4722449		2195	4295	6490	FOXK1	SO:0001819	synonymous_variant	0			-	HGNC	BK004104	CCDS34591.1	7p22	2006-12-15			ENSG00000164916	ENSG00000164916		"""Forkhead boxes"""	23480	protein-coding gene	gene with protein product						15202027	Standard	NM_001037165		Approved	IMAGE:5164497	uc003snc.1	P85037	OTTHUMG00000151739	ENST00000328914.4:c.510G>T	7.37:g.4722449G>T		Somatic	0	21	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	10	50.00		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_TF_fork_head,pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_FHA_dom,smart_TF_fork_head,pfscan_FHA_dom,pfscan_TF_fork_head,prints_TF_fork_head	p.V170	ENST00000328914.4	37	c.510	CCDS34591.1	7																																																																																			-	pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_FHA_dom,pfscan_FHA_dom		0.726	FOXK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXK1	protein_coding	OTTHUMT00000323729.2	G		-		4722449	+1	no_errors	ENST00000328914	ensembl	human	known	74_37	silent	SNP	1.000	T
ACTG1P17	283693	genome.wustl.edu	37	15	83395590	83395590	+	RNA	SNP	G	G	T			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr15:83395590G>T	ENST00000560958.1	-	0	696				AC105339.2_ENST00000577648.1_RNA	NR_036446.1																						TGGTGATGAAGCTGTAGCGGG	0.592																																																	0								ENSG00000259315																																			RP11-752G15.9			0			-	Clone_based_vega_gene																													15.37:g.83395590G>T		Somatic	0	24	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	31	11.43		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000560958.1	37	NULL		15																																																																																			-	-		0.592	RP11-752G15.9-002	KNOWN	basic	processed_transcript	LOC283693	pseudogene	OTTHUMT00000418414.1	G		-		83395590	-1	no_errors	ENST00000560958	ensembl	human	known	74_37	rna	SNP	1.000	T
TRIO	7204	genome.wustl.edu	37	5	14378175	14378175	+	Missense_Mutation	SNP	T	T	C			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr5:14378175T>C	ENST00000344204.4	+	20	3410	c.3386T>C	c.(3385-3387)aTg>aCg	p.M1129T	TRIO_ENST00000537187.1_Missense_Mutation_p.M1129T|TRIO_ENST00000509967.2_Missense_Mutation_p.M1080T	NM_007118.2	NP_009049.2	O75962	TRIO_HUMAN	trio Rho guanine nucleotide exchange factor	1129					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cytosol (GO:0005829)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(2)|breast(6)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(21)|lung(34)|ovary(4)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	118	Lung NSC(4;0.000742)					TACTGGACCATGAGGAAGAGA	0.488																																																	0								ENSG00000038382						107.0	91.0	96.0					5																	14378175		2203	4300	6503	TRIO	SO:0001583	missense	0			-	HGNC	AF091395	CCDS3883.1	5p14-p15.1	2013-01-11	2012-07-12		ENSG00000038382	ENSG00000038382		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"""	12303	protein-coding gene	gene with protein product		601893	"""triple functional domain (PTPRF interacting)"""			8643598	Standard	NM_007118		Approved	ARHGEF23	uc003jff.3	O75962	OTTHUMG00000131057	ENST00000344204.4:c.3386T>C	5.37:g.14378175T>C	ENSP00000339299:p.Met1129Thr	Somatic	0	34	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	41	8.89	D3DTD1|Q13458|Q59EQ7|Q6PJC9|Q6ZN05|Q8IWK8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DH-domain,pfam_Prot_kinase_dom,pfam_Spectrin_repeat,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ig_I-set,pfam_SH3_domain,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_SH3_domain,superfamily_CRAL-TRIO_dom,superfamily_Capsid/spike_ssDNA_virus,smart_CRAL-TRIO_dom,smart_Spectrin/alpha-actinin,smart_DH-domain,smart_Pleckstrin_homology,smart_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_CRAL-TRIO_dom,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,pfscan_DH-domain	p.M1129T	ENST00000344204.4	37	c.3386	CCDS3883.1	5	.	.	.	.	.	.	.	.	.	.	T	16.66	3.184859	0.57909	.	.	ENSG00000038382	ENST00000344204;ENST00000537187;ENST00000509967;ENST00000513206	T;T;T	0.39997	1.05;1.05;1.05	5.81	5.81	0.92471	.	0.038459	0.85682	D	0.000000	T	0.38983	0.1061	L	0.43152	1.355	0.58432	D	0.999998	B;B;B	0.32245	0.101;0.004;0.361	B;B;B	0.33846	0.171;0.012;0.046	T	0.15321	-1.0441	10	0.31617	T	0.26	.	16.1773	0.81862	0.0:0.0:0.0:1.0	.	1080;1129;1129	F5H228;O75962-5;O75962	.;.;TRIO_HUMAN	T	1129;1129;1080;816	ENSP00000339299:M1129T;ENSP00000446348:M1129T;ENSP00000445592:M1080T	ENSP00000339299:M1129T	M	+	2	0	TRIO	14431175	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	8.040000	0.89188	2.217000	0.71921	0.482000	0.46254	ATG	-	NULL		0.488	TRIO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIO	protein_coding	OTTHUMT00000253711.2	T	NM_007118	-		14378175	+1	no_errors	ENST00000344204	ensembl	human	known	74_37	missense	SNP	1.000	C
LRPPRC	10128	genome.wustl.edu	37	2	44175301	44175301	+	Missense_Mutation	SNP	C	C	T	rs373011028		TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr2:44175301C>T	ENST00000260665.7	-	18	1937	c.1880G>A	c.(1879-1881)cGt>cAt	p.R627H		NM_133259.3	NP_573566.2	P42704	LPPRC_HUMAN	leucine-rich pentatricopeptide repeat containing	627					mitochondrion transport along microtubule (GO:0047497)|mRNA transport (GO:0051028)|negative regulation of mitochondrial RNA catabolic process (GO:0000961)|regulation of mitochondrial translation (GO:0070129)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome (GO:0000794)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|microtubule (GO:0005874)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|ribonucleoprotein complex (GO:0030529)	beta-tubulin binding (GO:0048487)|microtubule binding (GO:0008017)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			breast(3)|endometrium(3)|kidney(5)|large_intestine(9)|lung(15)|ovary(2)|prostate(2)|skin(2)	41		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				CAGGAGATTACGAATGCCTCT	0.368																																																	0								ENSG00000138095	C	HIS/ARG	1,4403	2.1+/-5.4	0,1,2201	94.0	99.0	97.0		1880	4.7	1.0	2		97	0,8600		0,0,4300	no	missense	LRPPRC	NM_133259.3	29	0,1,6501	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	627/1395	44175301	1,13003	2202	4300	6502	LRPPRC	SO:0001583	missense	0			-	HGNC	M92439	CCDS33189.1	2p21	2012-02-24	2012-02-24		ENSG00000138095	ENSG00000138095			15714	protein-coding gene	gene with protein product		607544	"""Leigh syndrome, French-Canadian type (cytochrome oxidase deficiency)"""	LSFC		8012652, 8619474, 22045337	Standard	NM_133259		Approved	GP130, LRP130	uc002rtr.2	P42704	OTTHUMG00000152782	ENST00000260665.7:c.1880G>A	2.37:g.44175301C>T	ENSP00000260665:p.Arg627His	Somatic	0	30	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	16	15.79	A0PJE3|A8K1V1|Q53PC0|Q53QN7|Q6ZUD8|Q7Z7A6|Q96D84	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Pentatricopeptide_repeat,tigrfam_Pentatricopeptide_repeat	p.R627H	ENST00000260665.7	37	c.1880	CCDS33189.1	2	.	.	.	.	.	.	.	.	.	.	C	11.86	1.764531	0.31228	2.27E-4	0.0	ENSG00000138095	ENST00000465633;ENST00000260665	T	0.58060	0.36	5.61	4.73	0.59995	.	0.165679	0.52532	D	0.000075	T	0.51702	0.1690	M	0.74258	2.255	0.80722	D	1	P;B	0.35433	0.501;0.271	B;B	0.29942	0.109;0.024	T	0.55296	-0.8163	10	0.40728	T	0.16	-7.8474	14.934	0.70938	0.0:0.9309:0.0:0.0691	.	527;627	F5H4J6;P42704	.;LPPRC_HUMAN	H	527;627	ENSP00000260665:R627H	ENSP00000260665:R627H	R	-	2	0	LRPPRC	44028805	0.995000	0.38212	0.994000	0.49952	0.980000	0.70556	2.161000	0.42358	1.504000	0.48704	0.655000	0.94253	CGT	-	NULL		0.368	LRPPRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRPPRC	protein_coding	OTTHUMT00000327823.1	C	NM_133259	-		44175301	-1	no_errors	ENST00000260665	ensembl	human	known	74_37	missense	SNP	1.000	T
GGCX	2677	genome.wustl.edu	37	2	85779538	85779538	+	Splice_Site	SNP	C	C	T			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr2:85779538C>T	ENST00000233838.4	-	10	1520		c.e10+1		GGCX_ENST00000473665.1_5'Flank|GGCX_ENST00000430215.3_Splice_Site	NM_000821.5	NP_000812.2	P38435	VKGC_HUMAN	gamma-glutamyl carboxylase						blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|peptidyl-glutamic acid carboxylation (GO:0017187)|post-translational protein modification (GO:0043687)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	gamma-glutamyl carboxylase activity (GO:0008488)			endometrium(3)|large_intestine(5)|lung(3)|ovary(1)|stomach(1)|urinary_tract(2)	15					Anisindione(DB01125)|Coagulation Factor IX(DB00100)|Coagulation factor VIIa(DB00036)|Drotrecogin alfa(DB00055)|Menadione(DB00170)|Phylloquinone(DB01022)	CCCTTGCCCACCTCTGCTGGA	0.483											OREG0014747	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000115486						97.0	99.0	99.0					2																	85779538		2203	4300	6503	GGCX	SO:0001630	splice_region_variant	0			-	HGNC		CCDS1978.1, CCDS46353.1	2p12	2008-05-21			ENSG00000115486	ENSG00000115486			4247	protein-coding gene	gene with protein product	"""vitamin K-dependent gamma-carboxylase"""	137167				1749935	Standard	NM_000821		Approved	VKCFD1	uc002sps.3	P38435	OTTHUMG00000130173	ENST00000233838.4:c.1439+1G>A	2.37:g.85779538C>T		Somatic	0	48	0.00	1239	0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	B4DMC5|E9PEE1|Q14415|Q6GU45	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e10+1	ENST00000233838.4	37	c.1439+1	CCDS1978.1	2	.	.	.	.	.	.	.	.	.	.	C	21.9	4.212772	0.79352	.	.	ENSG00000115486	ENST00000233838;ENST00000430215	.	.	.	5.95	5.95	0.96441	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.887	0.88858	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	GGCX	85633049	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.059000	0.76684	2.824000	0.97209	0.655000	0.94253	.	-	-		0.483	GGCX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GGCX	protein_coding	OTTHUMT00000252490.3	C	NM_000821	-	Intron	85779538	-1	no_errors	ENST00000233838	ensembl	human	known	74_37	splice_site	SNP	1.000	T
GALNT9	50614	genome.wustl.edu	37	12	132685742	132685742	+	Missense_Mutation	SNP	C	C	T			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr12:132685742C>T	ENST00000328957.8	-	8	1327	c.1328G>A	c.(1327-1329)cGc>cAc	p.R443H	GALNT9_ENST00000535228.1_Missense_Mutation_p.R194H|GALNT9_ENST00000397325.2_Missense_Mutation_p.R77H|GALNT9_ENST00000541995.1_Missense_Mutation_p.R77H	NM_001122636.1	NP_001116108.1	Q9HCQ5	GALT9_HUMAN	polypeptide N-acetylgalactosaminyltransferase 9	443					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			breast(1)|endometrium(1)|large_intestine(2)|lung(5)	9	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.241)		OV - Ovarian serous cystadenocarcinoma(86;7.49e-08)|Epithelial(86;3.55e-07)|all cancers(50;2.09e-05)		CTTGAAGCTGCGACACTTCAG	0.607																																					Colon(186;2147 2752 13553 41466)												0								ENSG00000182870						69.0	83.0	78.0					12																	132685742		2138	4242	6380	GALNT9	SO:0001583	missense	0			-	HGNC	AB040672	CCDS41866.1	12q24.33	2014-03-13	2014-03-13		ENSG00000182870	ENSG00000182870	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4131	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 9"""	606251	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 9 (GalNAc-T9)"""			10978536, 12407114	Standard	NM_021808		Approved	GALNAC-T9	uc001ukc.4	Q9HCQ5	OTTHUMG00000168256	ENST00000328957.8:c.1328G>A	12.37:g.132685742C>T	ENSP00000329846:p.Arg443His	Somatic	0	38	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	29	12.12	Q52LR8|Q6NT54|Q8NFR1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.R443H	ENST00000328957.8	37	c.1328		12	.	.	.	.	.	.	.	.	.	.	c	20.6	4.017356	0.75161	.	.	ENSG00000182870	ENST00000397325;ENST00000328957;ENST00000535228;ENST00000541995;ENST00000538356	T;T;T;T;T	0.31247	1.5;1.5;1.5;1.5;1.5	4.39	3.49	0.39957	.	0.114433	0.64402	N	0.000014	T	0.36936	0.0985	L	0.31926	0.97	0.49130	D	0.999757	D;P;P	0.71674	0.998;0.951;0.951	P;P;B	0.58172	0.834;0.635;0.444	T	0.10337	-1.0634	10	0.54805	T	0.06	.	11.9413	0.52903	0.0:0.9138:0.0:0.0862	.	194;443;300	B3KNR7;Q9HCQ5;B3KP58	.;GALT9_HUMAN;.	H	77;443;194;77;77	ENSP00000380488:R77H;ENSP00000329846:R443H;ENSP00000439745:R194H;ENSP00000440544:R77H;ENSP00000444709:R77H	ENSP00000329846:R443H	R	-	2	0	GALNT9	131251695	0.999000	0.42202	1.000000	0.80357	0.964000	0.63967	2.498000	0.45363	0.814000	0.34374	0.462000	0.41574	CGC	-	NULL		0.607	GALNT9-009	KNOWN	basic|appris_principal	protein_coding	GALNT9	protein_coding	OTTHUMT00000402967.1	C	NM_001122636	-		132685742	-1	no_errors	ENST00000328957	ensembl	human	known	74_37	missense	SNP	1.000	T
NRF1	4899	genome.wustl.edu	37	7	129311328	129311328	+	Missense_Mutation	SNP	C	C	T			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr7:129311328C>T	ENST00000393232.1	+	3	400	c.283C>T	c.(283-285)Cat>Tat	p.H95Y	NRF1_ENST00000539636.1_Intron|NRF1_ENST00000393231.3_Missense_Mutation_p.H95Y|NRF1_ENST00000311967.2_Missense_Mutation_p.H95Y|NRF1_ENST00000353868.4_Missense_Mutation_p.H95Y|NRF1_ENST00000393230.2_Missense_Mutation_p.H95Y|NRF1_ENST00000223190.4_Missense_Mutation_p.H95Y	NM_005011.3	NP_005002.3	Q16656	NRF1_HUMAN	nuclear respiratory factor 1	95					cellular lipid metabolic process (GO:0044255)|generation of precursor metabolites and energy (GO:0006091)|mitochondrion organization (GO:0007005)|organ regeneration (GO:0031100)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to electrical stimulus (GO:0051602)|response to estradiol (GO:0032355)|response to folic acid (GO:0051593)|response to hypoxia (GO:0001666)|response to lipopolysaccharide (GO:0032496)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(2)|central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(5)|lung(12)|ovary(1)|prostate(1)	24						GAAACGGCCTCATGTATTTGA	0.473																																																	0								ENSG00000106459						117.0	102.0	107.0					7																	129311328		2203	4300	6503	NRF1	SO:0001583	missense	0			-	HGNC	L22454	CCDS5813.2	7q32	2008-07-18			ENSG00000106459	ENSG00000106459			7996	protein-coding gene	gene with protein product	"""alpha palindromic-binding protein"""	600879				2584221	Standard	NM_005011		Approved	EWG, ALPHA-PAL	uc003voz.3	Q16656	OTTHUMG00000143736	ENST00000393232.1:c.283C>T	7.37:g.129311328C>T	ENSP00000376924:p.His95Tyr	Somatic	0	31	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	26	16.13	A8K4C6|B4DDV6|Q15305|Q96AN2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Nrf1_NLS/DNA-bd_dimer,pfam_Nrf1_activation-bd	p.H95Y	ENST00000393232.1	37	c.283	CCDS5813.2	7	.	.	.	.	.	.	.	.	.	.	C	32	5.150290	0.94645	.	.	ENSG00000106459	ENST00000393232;ENST00000353868;ENST00000454688;ENST00000223190;ENST00000311967;ENST00000393230;ENST00000393231	.	.	.	5.29	5.29	0.74685	Nuclear respiratory factor 1, NLS/DNA-binding, dimerisation domain (1);	0.045710	0.85682	D	0.000000	T	0.73016	0.3533	L	0.58302	1.8	0.80722	D	1	P;P	0.49635	0.926;0.843	P;P	0.56563	0.801;0.615	T	0.74386	-0.3682	9	0.54805	T	0.06	-8.0148	17.9646	0.89096	0.0:1.0:0.0:0.0	.	95;95	Q96AN2;Q16656	.;NRF1_HUMAN	Y	95	.	ENSP00000223190:H95Y	H	+	1	0	NRF1	129098564	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.252000	0.78309	2.482000	0.83794	0.585000	0.79938	CAT	-	pfam_Nrf1_NLS/DNA-bd_dimer		0.473	NRF1-203	KNOWN	basic|appris_principal|CCDS	protein_coding	NRF1	protein_coding	OTTHUMT00000289813.1	C	NM_001040110	-		129311328	+1	no_errors	ENST00000393231	ensembl	human	known	74_37	missense	SNP	1.000	T
IFNA6	3443	genome.wustl.edu	37	9	21350362	21350362	+	Missense_Mutation	SNP	G	G	T			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr9:21350362G>T	ENST00000380210.1	-	1	1015	c.525C>A	c.(523-525)ttC>ttA	p.F175L		NM_021002.2	NP_066282.1	P05013	IFNA6_HUMAN	interferon, alpha 6	175					adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|natural killer cell activation involved in immune response (GO:0002323)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to exogenous dsRNA (GO:0043330)|T cell activation involved in immune response (GO:0002286)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|type I interferon receptor binding (GO:0005132)			large_intestine(3)|lung(7)|skin(1)	11				Lung(24;7.66e-27)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.116)		TTGATGAAGAGAAGGATCTCA	0.438																																																	0								ENSG00000120235						278.0	273.0	274.0					9																	21350362		2203	4300	6503	IFNA6	SO:0001583	missense	0			-	HGNC		CCDS6504.1	9p22	2010-12-10			ENSG00000120235	ENSG00000120235		"""Interferons"""	5427	protein-coding gene	gene with protein product		147566				1385305	Standard	NM_021002		Approved	IFN-alphaK	uc011lni.2	P05013	OTTHUMG00000019676	ENST00000380210.1:c.525C>A	9.37:g.21350362G>T	ENSP00000369558:p.Phe175Leu	Somatic	0	76	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52	Q5VYQ1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Interferon_alpha/beta/delta,superfamily_4_helix_cytokine-like_core,smart_Interferon_alpha/beta/delta,prints_Interferon_alpha/beta/delta	p.F175L	ENST00000380210.1	37	c.525	CCDS6504.1	9	.	.	.	.	.	.	.	.	.	.	G	2.863	-0.235619	0.05944	.	.	ENSG00000120235	ENST00000380210	T	0.03772	3.81	3.78	0.706	0.18133	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.414434	0.24771	N	0.035723	T	0.02230	0.0069	N	0.12569	0.235	0.09310	N	1	B	0.12013	0.005	B	0.29176	0.099	T	0.47799	-0.9089	10	0.02654	T	1	.	4.7513	0.13063	0.2166:0.186:0.5974:0.0	.	175	P05013	IFNA6_HUMAN	L	175	ENSP00000369558:F175L	ENSP00000369558:F175L	F	-	3	2	IFNA6	21340362	0.000000	0.05858	0.025000	0.17156	0.399000	0.30720	-0.594000	0.05733	-0.106000	0.12110	-0.216000	0.12614	TTC	-	pfam_Interferon_alpha/beta/delta,superfamily_4_helix_cytokine-like_core,smart_Interferon_alpha/beta/delta		0.438	IFNA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFNA6	protein_coding	OTTHUMT00000051905.1	G	NM_021002	-		21350362	-1	no_errors	ENST00000380210	ensembl	human	known	74_37	missense	SNP	0.205	T
GPR124	25960	genome.wustl.edu	37	8	37698851	37698851	+	Nonsense_Mutation	SNP	C	C	T			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr8:37698851C>T	ENST00000412232.2	+	19	3008	c.2995C>T	c.(2995-2997)Cga>Tga	p.R999*	GPR124_ENST00000315215.7_Nonsense_Mutation_p.R782*	NM_032777.9	NP_116166.9	Q96PE1	GP124_HUMAN	G protein-coupled receptor 124	999					central nervous system development (GO:0007417)|endothelial cell migration (GO:0043542)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|neuropeptide signaling pathway (GO:0007218)|positive regulation of endothelial cell migration (GO:0010595)|regulation of angiogenesis (GO:0045765)|regulation of chemotaxis (GO:0050920)|regulation of establishment of blood-brain barrier (GO:0090210)|sprouting angiogenesis (GO:0002040)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(16)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	37			BRCA - Breast invasive adenocarcinoma(5;2.75e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)			TGGGAGCGCGCGAGTGGGGAC	0.672																																																	0								ENSG00000020181						15.0	18.0	17.0					8																	37698851		2197	4284	6481	GPR124	SO:0001587	stop_gained	0			-	HGNC	AB040964	CCDS6097.2	8p11.22	2014-08-08			ENSG00000020181	ENSG00000020181		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17849	protein-coding gene	gene with protein product	"""tumor endothelial marker 5"""	606823				11559528, 12565841	Standard	NM_032777		Approved	TEM5, DKFZp434C211, DKFZp434J0911, KIAA1531, FLJ14390	uc003xkj.3	Q96PE1	OTTHUMG00000156182	ENST00000412232.2:c.2995C>T	8.37:g.37698851C>T	ENSP00000406367:p.Arg999*	Somatic	0	42	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	A6H8W3|D3DSW4|Q8N3R1|Q8TEM3|Q96KB2|Q9P1Z7|Q9UFY4	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_GPCR_2_extracellular_dom,pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,pfscan_GPS_dom,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,pfscan_Ig-like_dom	p.R999*	ENST00000412232.2	37	c.2995	CCDS6097.2	8	.	.	.	.	.	.	.	.	.	.	C	24.1	4.490829	0.84962	.	.	ENSG00000020181	ENST00000416514;ENST00000315215;ENST00000412232	.	.	.	4.95	3.12	0.35913	.	0.606407	0.17195	N	0.183341	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.12103	T	0.63	-8.5584	5.4928	0.16785	0.0775:0.1446:0.6393:0.1386	.	.	.	.	X	992;782;999	.	ENSP00000323508:R782X	R	+	1	2	GPR124	37818009	0.958000	0.32768	0.006000	0.13384	0.001000	0.01503	2.999000	0.49473	1.069000	0.40788	-0.171000	0.13296	CGA	-	NULL		0.672	GPR124-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR124	protein_coding	OTTHUMT00000343331.2	C		-		37698851	+1	no_errors	ENST00000412232	ensembl	human	known	74_37	nonsense	SNP	0.001	T
C1orf198	84886	genome.wustl.edu	37	1	231004075	231004075	+	Missense_Mutation	SNP	G	G	A			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr1:231004075G>A	ENST00000366663.5	-	1	324	c.184C>T	c.(184-186)Ccg>Tcg	p.P62S	C1orf198_ENST00000470540.1_Missense_Mutation_p.P24S|C1orf198_ENST00000427697.2_Intron	NM_032800.2	NP_116189.1	Q9H425	CA198_HUMAN	chromosome 1 open reading frame 198	62						cytoplasm (GO:0005737)				breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	17	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.178)				TGCGCGGGCGGCAGCCGCGCC	0.701																																																	0								ENSG00000119280						18.0	22.0	21.0					1																	231004075		2196	4298	6494	C1orf198	SO:0001583	missense	0			-	HGNC	BC066649	CCDS1587.1, CCDS44330.1, CCDS44331.1	1q42.2	2008-02-05			ENSG00000119280	ENSG00000119280			25900	protein-coding gene	gene with protein product							Standard	NM_032800		Approved	FLJ14525, MGC10710, FLJ16283, DKFZp667D152, FLJ38847	uc001hub.3	Q9H425	OTTHUMG00000037790	ENST00000366663.5:c.184C>T	1.37:g.231004075G>A	ENSP00000355623:p.Pro62Ser	Somatic	0	35	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	26	13.33	A8K8R8|B3KTW1|G5EA08	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.P62S	ENST00000366663.5	37	c.184	CCDS1587.1	1	.	.	.	.	.	.	.	.	.	.	g	13.27	2.187749	0.38609	.	.	ENSG00000119280	ENST00000366663;ENST00000470540;ENST00000522201	T;T	0.27402	1.69;1.67	3.83	2.9	0.33743	.	0.369054	0.24725	U	0.036108	T	0.18341	0.0440	N	0.17474	0.49	0.80722	D	1	B	0.28713	0.22	B	0.33196	0.159	T	0.03000	-1.1084	10	0.07644	T	0.81	.	12.935	0.58309	0.0:0.1649:0.8351:0.0	.	62	Q9H425	CA198_HUMAN	S	62;24;19	ENSP00000355623:P62S;ENSP00000428172:P24S	ENSP00000355623:P62S	P	-	1	0	C1orf198	229070698	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.570000	0.53834	0.774000	0.33427	0.457000	0.33378	CCG	-	NULL		0.701	C1orf198-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C1orf198	protein_coding	OTTHUMT00000092236.2	G	NM_032800	-		231004075	-1	no_errors	ENST00000366663	ensembl	human	known	74_37	missense	SNP	1.000	A
CASP8	841	genome.wustl.edu	37	2	202139626	202139626	+	Missense_Mutation	SNP	G	G	T	rs577264458		TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr2:202139626G>T	ENST00000432109.2	+	7	799	c.610G>T	c.(610-612)Ggg>Tgg	p.G204W	CASP8_ENST00000392258.3_Intron|CASP8_ENST00000392259.2_Intron|CASP8_ENST00000358485.4_Missense_Mutation_p.G263W|CASP8_ENST00000392266.3_Intron|CASP8_ENST00000323492.7_Missense_Mutation_p.G189W|CASP8_ENST00000264275.5_Missense_Mutation_p.G221W|CASP8_ENST00000264274.9_Intron	NM_033355.3	NP_203519.1	Q14790	CASP8_HUMAN	caspase 8, apoptosis-related cysteine peptidase	204					activation of cysteine-type endopeptidase activity (GO:0097202)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|B cell activation (GO:0042113)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to mechanical stimulus (GO:0071260)|cellular response to organic cyclic compound (GO:0071407)|execution phase of apoptosis (GO:0097194)|extrinsic apoptotic signaling pathway (GO:0097191)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|heart development (GO:0007507)|hepatocyte apoptotic process (GO:0097284)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|macrophage differentiation (GO:0030225)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|natural killer cell activation (GO:0030101)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of necroptotic process (GO:0060546)|neural tube formation (GO:0001841)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of proteolysis (GO:0045862)|protein heterooligomerization (GO:0051291)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|regulation of thymocyte apoptotic process (GO:0070243)|response to antibiotic (GO:0046677)|response to cobalt ion (GO:0032025)|response to cold (GO:0009409)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to tumor necrosis factor (GO:0034612)|syncytiotrophoblast cell differentiation involved in labyrinthine layer development (GO:0060715)|T cell activation (GO:0042110)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRAIL-activated apoptotic signaling pathway (GO:0036462)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral process (GO:0016032)	CD95 death-inducing signaling complex (GO:0031265)|cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|death-inducing signaling complex (GO:0031264)|membrane raft (GO:0045121)|microtubule organizing center (GO:0005815)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|Noc1p-Noc2p complex (GO:0030690)|nucleus (GO:0005634)|ripoptosome (GO:0097342)	cysteine-type endopeptidase activity (GO:0004197)|cysteine-type endopeptidase activity involved in apoptotic process (GO:0097153)|cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:0097199)|cysteine-type peptidase activity (GO:0008234)|death effector domain binding (GO:0035877)|peptidase activity (GO:0008233)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)			breast(5)|cervix(2)|endometrium(6)|large_intestine(11)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(9)|urinary_tract(3)	52						GGAGTTGTGTGGGGTAATGAC	0.413										HNSCC(4;0.00038)																											Melanoma(82;831 1348 20716 36952 40159)												0								ENSG00000064012						141.0	127.0	132.0					2																	202139626		2203	4300	6503	CASP8	SO:0001583	missense	0			-	HGNC	U60520	CCDS2342.1, CCDS2343.1, CCDS2345.1, CCDS42798.1, CCDS42799.1	2q33-q34	2014-09-17	2005-08-17		ENSG00000064012	ENSG00000064012		"""Caspases"""	1509	protein-coding gene	gene with protein product		601763	"""caspase 8, apoptosis-related cysteine protease"""			8681376, 8681377	Standard	NM_033355		Approved	MCH5, MACH, FLICE, Casp-8	uc002uxt.1	Q14790	OTTHUMG00000132821	ENST00000432109.2:c.610G>T	2.37:g.202139626G>T	ENSP00000412523:p.Gly204Trp	Somatic	0	44	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70	O14676|Q14791|Q14792|Q14793|Q14794|Q14795|Q14796|Q15780|Q15806|Q53TT5|Q8TDI1|Q8TDI2|Q8TDI3|Q8TDI4|Q8TDI5|Q96T22|Q9C0K4|Q9UQ81	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DED,pfam_Pept_C14_caspase,superfamily_DEATH-like_dom,smart_DED,smart_Pept_C14A_p45_core,pfscan_DED,pfscan_Pept_C14_p10,pfscan_Pept_C14_ICE_p20,prints_Pept_C14A_p45_core	p.G263W	ENST00000432109.2	37	c.787	CCDS2342.1	2	.	.	.	.	.	.	.	.	.	.	G	15.15	2.748426	0.49257	.	.	ENSG00000064012	ENST00000392263;ENST00000432109;ENST00000264275;ENST00000450491;ENST00000358485;ENST00000392261;ENST00000323492	T;T;T;T;T;T	0.46063	4.36;4.38;4.35;0.88;4.36;4.36	3.7	-0.968	0.10313	DEATH-like (1);	7739.210000	0.00166	N	0.000000	T	0.31389	0.0795	N	0.14661	0.345	0.09310	N	1	B;D;B;P;B;B	0.61080	0.062;0.989;0.012;0.86;0.007;0.034	B;P;B;B;B;B	0.45681	0.015;0.49;0.015;0.23;0.012;0.015	T	0.30090	-0.9990	10	0.66056	D	0.02	.	6.903	0.24293	0.5807:0.0:0.4193:0.0	.	204;189;263;204;189;221	Q14790-7;A8MU92;Q14790-9;Q14790;Q14790-2;Q14790-4	.;.;.;CASP8_HUMAN;.;.	W	189;204;221;86;263;189;189	ENSP00000376091:G189W;ENSP00000412523:G204W;ENSP00000264275:G221W;ENSP00000391709:G86W;ENSP00000351273:G263W;ENSP00000325722:G189W	ENSP00000264275:G221W	G	+	1	0	CASP8	201847871	0.000000	0.05858	0.000000	0.03702	0.544000	0.35116	-0.341000	0.07811	-0.208000	0.10171	0.205000	0.17691	GGG	-	superfamily_DEATH-like_dom		0.413	CASP8-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	CASP8	protein_coding	OTTHUMT00000336853.2	G	NM_001228	-		202139626	+1	no_errors	ENST00000358485	ensembl	human	known	74_37	missense	SNP	0.000	T
CHPF	79586	genome.wustl.edu	37	2	220404162	220404162	+	Silent	SNP	G	G	T			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr2:220404162G>T	ENST00000243776.6	-	4	2519	c.2271C>A	c.(2269-2271)ggC>ggA	p.G757G	CHPF_ENST00000535926.1_Silent_p.G595G	NM_024536.5	NP_078812	Q8IZ52	CHSS2_HUMAN	chondroitin polymerizing factor	757					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047238)|metal ion binding (GO:0046872)|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity (GO:0050510)			central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)	21		Renal(207;0.0183)		Epithelial(149;3.02e-08)|all cancers(144;3.41e-06)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00802)		GGGTTCGGGAGCCGAGGCCCT	0.687																																																	0								ENSG00000123989						41.0	36.0	38.0					2																	220404162		2203	4299	6502	CHPF	SO:0001819	synonymous_variant	0			-	HGNC	BC008878	CCDS2443.1, CCDS56169.1	2q35	2014-02-12			ENSG00000123989	ENSG00000123989	2.4.1.175, 2.4.1.226	"""Beta 3-glycosyltransferases"", ""Beta 4-glycosyltransferases"""	24291	protein-coding gene	gene with protein product	"""chondroitin sulfate synthase 2"""	610405				11230166, 12716890	Standard	NM_024536		Approved	CSS2, CHSY2	uc002vmc.4	Q8IZ52	OTTHUMG00000058929	ENST00000243776.6:c.2271C>A	2.37:g.220404162G>T		Somatic	0	62	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	33	10.81	B4DXU0|Q6UXD6|Q7L4G1|Q9H0F8|Q9H618	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Chond_GalNAc	p.G757	ENST00000243776.6	37	c.2271	CCDS2443.1	2																																																																																			-	pfam_Chond_GalNAc		0.687	CHPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHPF	protein_coding	OTTHUMT00000130268.1	G	NM_024536	-		220404162	-1	no_errors	ENST00000243776	ensembl	human	known	74_37	silent	SNP	1.000	T
PARVB	29780	genome.wustl.edu	37	22	44543775	44543775	+	Silent	SNP	C	C	T			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr22:44543775C>T	ENST00000338758.7	+	9	810	c.747C>T	c.(745-747)gcC>gcT	p.A249A	PARVB_ENST00000404989.1_Silent_p.A212A|PARVB_ENST00000406477.3_Silent_p.A282A	NM_013327.4	NP_037459.2	Q9HBI1	PARVB_HUMAN	parvin, beta	249					actin cytoskeleton reorganization (GO:0031532)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell projection assembly (GO:0030031)|establishment or maintenance of cell polarity regulating cell shape (GO:0071963)|lamellipodium assembly (GO:0030032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)				NS(1)|breast(1)|endometrium(3)|large_intestine(7)|lung(8)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	25		Ovarian(80;0.0246)|all_neural(38;0.0423)				TCGACCACGCCCCGGATAAGC	0.577																																																	0								ENSG00000188677						88.0	71.0	77.0					22																	44543775		2203	4300	6503	PARVB	SO:0001819	synonymous_variant	0			-	HGNC	AF151814	CCDS14056.1, CCDS46724.1, CCDS58808.1, CCDS74874.1	22q13.2-q13.33	2013-01-24			ENSG00000188677	ENSG00000188677		"""Parvins"""	14653	protein-coding gene	gene with protein product	"""affixin"""	608121				10810093, 11171322	Standard	NM_001003828		Approved	CGI-56	uc003ben.3	Q9HBI1	OTTHUMG00000150665	ENST00000338758.7:c.747C>T	22.37:g.44543775C>T		Somatic	0	22	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	18	28.00	B0QYM8|B0QYN1|B2R9X6|Q5TGJ5|Q86X93|Q96PN1|Q9NSP7|Q9UGT3|Q9Y368|Q9Y3L6|Q9Y3L7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_CH-domain,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	p.A282	ENST00000338758.7	37	c.846	CCDS14056.1	22																																																																																			-	superfamily_CH-domain		0.577	PARVB-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PARVB	protein_coding	OTTHUMT00000319518.2	C	NM_001003828	-		44543775	+1	no_errors	ENST00000406477	ensembl	human	known	74_37	silent	SNP	1.000	T
TEX35	84066	genome.wustl.edu	37	1	178489670	178489670	+	Nonsense_Mutation	SNP	G	G	T			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr1:178489670G>T	ENST00000367642.3	+	4	339	c.268G>T	c.(268-270)Gag>Tag	p.E90*	TEX35_ENST00000319416.2_Intron|TEX35_ENST00000367639.1_Intron|TEX35_ENST00000367643.3_Intron|TEX35_ENST00000258298.2_Intron|TEX35_ENST00000367641.3_Intron					testis expressed 35																		CAGACTCTTGGAGGAGTTGTC	0.527																																																	0								ENSG00000240021																																			TEX35	SO:0001587	stop_gained	0			-	HGNC	AL136694	CCDS1323.1, CCDS53433.1, CCDS53434.1	1q25.2	2014-01-28	2012-06-29	2012-06-29	ENSG00000240021	ENSG00000240021			25366	protein-coding gene	gene with protein product	"""Testis-Specific Conserved gene 24kDa"""		"""chromosome 1 open reading frame 49"""	C1orf49		11230166, 17077512	Standard	NM_032126		Approved	DKFZP564J047, TSC24	uc001glt.2	Q5T0J7	OTTHUMG00000035023	ENST00000367642.3:c.268G>T	1.37:g.178489670G>T	ENSP00000356614:p.Glu90*	Somatic	0	30	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52		Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.E90*	ENST00000367642.3	37	c.268		1	.	.	.	.	.	.	.	.	.	.	G	13.35	2.210004	0.39003	.	.	ENSG00000240021	ENST00000367642	.	.	.	3.85	-5.26	0.02772	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	.	6.1863	0.20500	0.3893:0.1926:0.4181:0.0	.	.	.	.	X	90	.	ENSP00000356614:E90X	E	+	1	0	C1orf49	176756293	0.000000	0.05858	0.002000	0.10522	0.007000	0.05969	-1.002000	0.03686	-0.885000	0.03971	-0.490000	0.04691	GAG	-	NULL		0.527	TEX35-003	PUTATIVE	not_organism_supported|basic	protein_coding	TEX35	protein_coding	OTTHUMT00000084919.1	G	NM_032126	-		178489670	+1	no_errors	ENST00000367642	ensembl	human	putative	74_37	nonsense	SNP	0.000	T
CLPTM1	1209	genome.wustl.edu	37	19	45477820	45477820	+	Missense_Mutation	SNP	G	G	T			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr19:45477820G>T	ENST00000337392.5	+	4	584	c.434G>T	c.(433-435)tGc>tTc	p.C145F	CLPTM1_ENST00000546079.1_Missense_Mutation_p.C43F|CLPTM1_ENST00000541297.2_Missense_Mutation_p.C131F	NM_001282175.1|NM_001282176.1|NM_001294.2	NP_001269104.1|NP_001269105.1|NP_001285.1	O96005	CLPT1_HUMAN	cleft lip and palate associated transmembrane protein 1	145					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of T cell differentiation in thymus (GO:0033081)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)				endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00354)|Epithelial(262;0.187)		TCAGACGGCTGCTACGAGCAC	0.572																																																	0								ENSG00000104853						108.0	89.0	96.0					19																	45477820		2203	4300	6503	CLPTM1	SO:0001583	missense	0			-	HGNC	AF037339	CCDS12651.1, CCDS74394.1, CCDS74395.1	19q13.3	2008-02-05				ENSG00000104853			2087	protein-coding gene	gene with protein product		604783				9828125	Standard	NM_001294		Approved		uc002pai.3	O96005		ENST00000337392.5:c.434G>T	19.37:g.45477820G>T	ENSP00000336994:p.Cys145Phe	Somatic	0	19	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	7	30.00	B3KQH2|B4DDS3|B4E2X9|B7Z9X9|F5H8J3|Q53ET6|Q9BSS5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_CLPTM1	p.C145F	ENST00000337392.5	37	c.434	CCDS12651.1	19	.	.	.	.	.	.	.	.	.	.	G	15.64	2.893126	0.52121	.	.	ENSG00000104853	ENST00000546079;ENST00000541297;ENST00000337392;ENST00000347493	.	.	.	5.28	5.28	0.74379	.	0.000000	0.85682	D	0.000000	T	0.62551	0.2437	L	0.44542	1.39	0.80722	D	1	P;P;P	0.42993	0.797;0.67;0.67	P;P;P	0.50659	0.514;0.647;0.647	T	0.63037	-0.6726	9	0.54805	T	0.06	-54.0135	16.5186	0.84307	0.0:0.0:1.0:0.0	.	131;145;145	F5H8J3;B3KQH2;O96005	.;.;CLPT1_HUMAN	F	43;131;145;145	.	ENSP00000336994:C145F	C	+	2	0	CLPTM1	50169660	1.000000	0.71417	1.000000	0.80357	0.822000	0.46500	8.844000	0.92147	2.755000	0.94549	0.650000	0.86243	TGC	-	pfam_CLPTM1		0.572	CLPTM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLPTM1	protein_coding	OTTHUMT00000453267.1	G	NM_001294	-		45477820	+1	no_errors	ENST00000337392	ensembl	human	known	74_37	missense	SNP	1.000	T
CCNG1	900	genome.wustl.edu	37	5	162868282	162868282	+	Missense_Mutation	SNP	T	T	A			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr5:162868282T>A	ENST00000340828.2	+	3	687	c.463T>A	c.(463-465)Ttt>Att	p.F155I	CCNG1_ENST00000511683.2_Missense_Mutation_p.F21I|CCNG1_ENST00000510664.1_Missense_Mutation_p.F27I|CCNG1_ENST00000504553.1_Missense_Mutation_p.F21I|CCNG1_ENST00000512163.1_Missense_Mutation_p.F21I|AC112205.1_ENST00000599797.1_Intron|CCNG1_ENST00000393929.1_Missense_Mutation_p.F155I	NM_004060.3	NP_004051.1	P51959	CCNG1_HUMAN	cyclin G1	155					brain development (GO:0007420)|cell growth (GO:0016049)|mitotic G2 DNA damage checkpoint (GO:0007095)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|response to organonitrogen compound (GO:0010243)|syncytium formation (GO:0006949)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)				autonomic_ganglia(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|prostate(2)	12	Renal(175;0.000281)	Medulloblastoma(196;0.00853)|all_neural(177;0.0408)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0597)|OV - Ovarian serous cystadenocarcinoma(192;0.107)|Epithelial(171;0.164)		TACTACTGCCTTTCAATTTCT	0.368																																																	0								ENSG00000113328						108.0	105.0	106.0					5																	162868282		2203	4300	6503	CCNG1	SO:0001583	missense	0			-	HGNC	D78341	CCDS4360.1	5q32-q34	2010-11-15			ENSG00000113328	ENSG00000113328			1592	protein-coding gene	gene with protein product		601578		CCNG		8954786, 8806701	Standard	NM_004060		Approved		uc003lzb.3	P51959	OTTHUMG00000130380	ENST00000340828.2:c.463T>A	5.37:g.162868282T>A	ENSP00000344635:p.Phe155Ile	Somatic	0	35	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	25	13.79	B2R7B2|B4DLW7|D3DQK7|Q15757|Q96L32	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cyclin_N,superfamily_Cyclin-like,smart_Cyclin-like	p.F155I	ENST00000340828.2	37	c.463	CCDS4360.1	5	.	.	.	.	.	.	.	.	.	.	T	16.99	3.273892	0.59649	.	.	ENSG00000113328	ENST00000512163;ENST00000393929;ENST00000340828;ENST00000511683;ENST00000510664;ENST00000504553	T;T;T;T;T;T	0.30182	1.59;2.69;2.69;1.59;2.01;1.54	5.23	5.23	0.72850	.	0.057488	0.64402	D	0.000001	T	0.24122	0.0584	L	0.44542	1.39	0.43971	D	0.996657	B	0.31581	0.329	B	0.23574	0.047	T	0.06807	-1.0806	10	0.56958	D	0.05	-3.664	9.6221	0.39727	0.0:0.0781:0.0:0.9219	.	155	P51959	CCNG1_HUMAN	I	21;155;155;21;27;21	ENSP00000424315:F21I;ENSP00000377506:F155I;ENSP00000344635:F155I;ENSP00000424141:F21I;ENSP00000422379:F27I;ENSP00000427086:F21I	ENSP00000344635:F155I	F	+	1	0	CCNG1	162800860	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	3.764000	0.55264	1.979000	0.57680	0.533000	0.62120	TTT	-	NULL		0.368	CCNG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCNG1	protein_coding	OTTHUMT00000252750.3	T	NM_004060	-		162868282	+1	no_errors	ENST00000340828	ensembl	human	known	74_37	missense	SNP	1.000	A
U2SURP	23350	genome.wustl.edu	37	3	142720221	142720222	+	5'Flank	INS	-	-	GGACAACGA	rs3832221|rs11282240	byFrequency	TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr3:142720221_142720222insGGACAACGA	ENST00000473835.2	+	0	0				U2SURP_ENST00000493598.2_5'Flank|RP11-372E1.6_ENST00000497652.1_RNA|RP11-91G21.1_ENST00000597953.1_lincRNA|U2SURP_ENST00000397933.2_5'Flank|RP11-372E1.6_ENST00000595774.1_RNA|RP11-372E1.6_ENST00000595248.1_RNA	NM_001080415.1	NP_001073884.1	O15042	SR140_HUMAN	U2 snRNP-associated SURP domain containing						RNA processing (GO:0006396)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	31						CAGCTGGCCCTGATTCTCTGAA	0.515														3604	0.719649	0.8949	0.6988	5008	,	,		19350	0.7212		0.6183	False		,,,				2504	0.6002																0								ENSG00000241570																																			RP11-372E1.6	SO:0001631	upstream_gene_variant	0				Clone_based_vega_gene	BK000564	CCDS46928.1	3q23	2013-02-12			ENSG00000163714	ENSG00000163714		"""RNA binding motif (RRM) containing"""	30855	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein a"", ""Ser/Arg-rich domain protein, 140 kDa"", ""U2 associated SR140 protein"""					9205841, 12234937	Standard	NM_001080415		Approved	fSAPa, SR140	uc003evh.1	O15042	OTTHUMG00000159323		3.37:g.142720221_142720222insGGACAACGA	Exception_encountered	Somatic	NA	NA	NA		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A0PJ60|Q0D2M1|Q2NKQ7|Q9BR70	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000473835.2	37	NULL	CCDS46928.1	3																																																																																			-	-		0.515	U2SURP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC101927832	protein_coding	OTTHUMT00000354603.2	-	NM_001080415			142720222	+1	no_errors	ENST00000595248	ensembl	human	known	74_37	rna	INS	0.005:0.015	GGACAACGA
CYP3A7	1551	genome.wustl.edu	37	7	99308456	99308456	+	Missense_Mutation	SNP	T	T	C			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr7:99308456T>C	ENST00000336374.2	-	10	927	c.925A>G	c.(925-927)Acc>Gcc	p.T309A	AC069294.1_ENST00000408560.1_RNA	NM_000765.3	NP_000756.2	P24462	CP3A7_HUMAN	cytochrome P450, family 3, subfamily A, polypeptide 7	309					small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxygen binding (GO:0019825)			autonomic_ganglia(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(9)|lung(10)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	32	Lung NSC(181;0.0144)|Esophageal squamous(72;0.0166)|all_lung(186;0.0228)				Alfentanil(DB00802)|Alprazolam(DB00404)|Aminophenazone(DB01424)|Amiodarone(DB01118)|Amlodipine(DB00381)|Aprepitant(DB00673)|Aripiprazole(DB01238)|Astemizole(DB00637)|Atorvastatin(DB01076)|Buprenorphine(DB00921)|Buspirone(DB00490)|Caffeine(DB00201)|Carbamazepine(DB00564)|Chloramphenicol(DB00446)|Chlorphenamine(DB01114)|Cilostazol(DB01166)|Cimetidine(DB00501)|Ciprofloxacin(DB00537)|Cisapride(DB00604)|Clarithromycin(DB01211)|Clotrimazole(DB00257)|Cocaine(DB00907)|Codeine(DB00318)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dapsone(DB00250)|Delavirdine(DB00705)|Dexamethasone(DB01234)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Diazepam(DB00829)|Diltiazem(DB00343)|Docetaxel(DB01248)|Dolutegravir(DB08930)|Domperidone(DB01184)|Eplerenone(DB00700)|Erythromycin(DB00199)|Estradiol(DB00783)|Ethosuximide(DB00593)|Ethylmorphine(DB01466)|Felodipine(DB01023)|Fentanyl(DB00813)|Finasteride(DB01216)|Fluconazole(DB00196)|Fluticasone Propionate(DB00588)|Fluvoxamine(DB00176)|Gestodene(DB06730)|Haloperidol(DB00502)|Hydrocortisone(DB00741)|Ifosfamide(DB01181)|Iloperidone(DB04946)|Imatinib(DB00619)|Imipramine(DB00458)|Indinavir(DB00224)|Irinotecan(DB00762)|Itraconazole(DB01167)|Ketoconazole(DB01026)|Lercanidipine(DB00528)|Levomethadyl Acetate(DB01227)|Lidocaine(DB00281)|Lovastatin(DB00227)|Methadone(DB00333)|Midazolam(DB00683)|Mifepristone(DB00834)|Nateglinide(DB00731)|Nefazodone(DB01149)|Nelfinavir(DB00220)|Nifedipine(DB01115)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Norethindrone(DB00717)|Norfloxacin(DB01059)|Ondansetron(DB00904)|Oxazepam(DB00842)|Oxycodone(DB00497)|Paclitaxel(DB01229)|Phenelzine(DB00780)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pimozide(DB01100)|Praziquantel(DB01058)|Progesterone(DB00396)|Propranolol(DB00571)|Quetiapine(DB01224)|Quinidine(DB00908)|Quinine(DB00468)|Rifampicin(DB01045)|Rifapentine(DB01201)|Risperidone(DB00734)|Ritonavir(DB00503)|Salmeterol(DB00938)|Saquinavir(DB01232)|Sildenafil(DB00203)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sorafenib(DB00398)|Sunitinib(DB01268)|Tacrolimus(DB00864)|Tamoxifen(DB00675)|Telithromycin(DB00976)|Temsirolimus(DB06287)|Testosterone(DB00624)|Trazodone(DB00656)|Tretinoin(DB00755)|Triazolam(DB00897)|Verapamil(DB00661)|Vincristine(DB00541)|Voriconazole(DB00582)|Zalcitabine(DB00943)|Zaleplon(DB00962)|Ziprasidone(DB00246)|Zolpidem(DB00425)	CTGCTCGTGGTTTCATAGCCA	0.403																																																	0								ENSG00000160870						94.0	85.0	88.0					7																	99308456		2203	4300	6503	CYP3A7	SO:0001583	missense	0			-	HGNC	AF315325	CCDS5673.1	7q21-q22.1	2007-12-14	2003-01-14		ENSG00000160870	ENSG00000160870		"""Cytochrome P450s"""	2640	protein-coding gene	gene with protein product		605340	"""cytochrome P450, subfamily IIIA, polypeptide 7"""			2722762	Standard	NM_000765		Approved	CP37, P450-HFLA		P24462	OTTHUMG00000156726	ENST00000336374.2:c.925A>G	7.37:g.99308456T>C	ENSP00000337450:p.Thr309Ala	Somatic	0	39	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	A4D288|Q9H241	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_CYP3A,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-II,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450,prints_Cyt_P450_B	p.T309A	ENST00000336374.2	37	c.925	CCDS5673.1	7	.	.	.	.	.	.	.	.	.	.	t	11.45	1.642170	0.29157	.	.	ENSG00000160870	ENST00000292414;ENST00000336374	D	0.87571	-2.27	3.99	1.48	0.22813	.	0.047005	0.85682	D	0.000000	D	0.89051	0.6605	H	0.94620	3.56	0.40376	D	0.979394	B	0.25667	0.131	B	0.32022	0.139	D	0.83716	0.0190	10	0.62326	D	0.03	.	5.194	0.15225	0.0:0.103:0.1812:0.7158	.	309	P24462	CP3A7_HUMAN	A	309	ENSP00000337450:T309A	ENSP00000292414:T309A	T	-	1	0	CYP3A7	99146392	0.220000	0.23631	0.817000	0.32601	0.293000	0.27360	0.267000	0.18552	0.069000	0.16605	0.374000	0.22700	ACC	-	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450		0.403	CYP3A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP3A7	protein_coding	OTTHUMT00000345484.1	T		-		99308456	-1	no_errors	ENST00000336374	ensembl	human	known	74_37	missense	SNP	1.000	C
MAML3	55534	genome.wustl.edu	37	4	140811111	140811111	+	Silent	SNP	C	C	T	rs62344937		TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr4:140811111C>T	ENST00000509479.2	-	2	2335	c.1479G>A	c.(1477-1479)caG>caA	p.Q493Q	MAML3_ENST00000398940.1_Silent_p.Q32Q|MAML3_ENST00000327122.5_Silent_p.Q337Q	NM_018717.4	NP_061187			mastermind-like 3 (Drosophila)											breast(1)|endometrium(7)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)|urinary_tract(2)	25	all_hematologic(180;0.162)					gctgctgctgctgctgctgct	0.542																																																	0								ENSG00000196782						15.0	19.0	17.0					4																	140811111		2180	4283	6463	MAML3	SO:0001819	synonymous_variant	0			-	HGNC	AB058719	CCDS54805.1	4q31.1	2014-08-12	2003-09-24		ENSG00000196782	ENSG00000196782			16272	protein-coding gene	gene with protein product	"""mastermind (drosophila)-like 3"""	608991	"""trinucleotide repeat containing 3"""	TNRC3		12370315, 12386158	Standard	NM_018717		Approved	KIAA1816, MAM2, CAGH3, GDN	uc021xsg.1	Q96JK9	OTTHUMG00000161441	ENST00000509479.2:c.1479G>A	4.37:g.140811111C>T		Somatic	0	24	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	22	18.52		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Neuroggenic_mastermind-like_N	p.Q493	ENST00000509479.2	37	c.1479	CCDS54805.1	4																																																																																			-	NULL		0.542	MAML3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAML3	protein_coding	OTTHUMT00000364934.2	C		rs62344937		140811111	-1	no_errors	ENST00000509479	ensembl	human	known	74_37	silent	SNP	1.000	T
MED15	51586	genome.wustl.edu	37	22	20918916	20918918	+	In_Frame_Del	DEL	CAG	CAG	-	rs374794651		TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	CAG	CAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr22:20918916_20918918delCAG	ENST00000263205.7	+	6	700_702	c.631_633delCAG	c.(631-633)cagdel	p.Q218del	MED15_ENST00000425759.2_In_Frame_Del_p.Q107del|MED15_ENST00000406969.1_In_Frame_Del_p.Q192del|MED15_ENST00000292733.7_In_Frame_Del_p.Q218del|MED15_ENST00000541476.1_In_Frame_Del_p.Q192del|MED15_ENST00000542773.1_In_Frame_Del_p.Q23del|MED15_ENST00000382974.2_In_Frame_Del_p.Q147del	NM_001003891.1	NP_001003891.1	Q96RN5	MED15_HUMAN	mediator complex subunit 15	218	Poly-Gln.			Missing (in Ref. 4; CAG30423). {ECO:0000305}.	gene expression (GO:0010467)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	RNA polymerase II transcription cofactor activity (GO:0001104)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	25	all_cancers(11;2.07e-24)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)|Epithelial(17;0.209)			gcagcagctccagcagcagcagc	0.567											OREG0026319	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000099917																																			MED15	SO:0001651	inframe_deletion	0				HGNC	AF056191	CCDS13781.1, CCDS33602.1, CCDS74824.1	22q11.2	2007-07-30	2007-07-30	2007-07-30	ENSG00000099917	ENSG00000099917			14248	protein-coding gene	gene with protein product		607372	"""trinucleotide repeat containing 7"", ""PC2 (positive cofactor 2, multiprotein complex) glutamine/Q-rich-associated protein"""	TNRC7, PCQAP		11024300, 11414760, 15175163	Standard	XM_005261632		Approved	TIG-1, CAG7A, Arc105	uc002zsp.3	Q96RN5	OTTHUMG00000150810	ENST00000263205.7:c.631_633delCAG	22.37:g.20918925_20918927delCAG	ENSP00000263205:p.Gln218del	Somatic	0	29	0.00	744	0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	25	16.67	D3DX31|D3DX32|O15413|Q6IC31|Q8NF16|Q96CT0|Q96IH7|Q9P1T3	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Mediator_Med15_met	p.Q214in_frame_del	ENST00000263205.7	37	c.631_633	CCDS33602.1	22																																																																																			-	pfam_Mediator_Med15_met		0.567	MED15-004	KNOWN	basic|CCDS	protein_coding	MED15	protein_coding	OTTHUMT00000320177.2	CAG	NM_015889			20918918	+1	no_errors	ENST00000263205	ensembl	human	known	74_37	in_frame_del	DEL	0.552:0.544:0.569	-
PDE1B	5153	genome.wustl.edu	37	12	54966992	54966992	+	Nonsense_Mutation	SNP	G	G	T			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr12:54966992G>T	ENST00000243052.3	+	8	1232	c.796G>T	c.(796-798)Gag>Tag	p.E266*	PDE1B_ENST00000550620.1_Nonsense_Mutation_p.E246*|PDE1B_ENST00000538346.1_Nonsense_Mutation_p.E225*|PDE1B_ENST00000394277.3_3'UTR	NM_000924.3	NP_000915.1	Q01064	PDE1B_HUMAN	phosphodiesterase 1B, calmodulin-dependent	266	Catalytic. {ECO:0000250}.				activation of phospholipase C activity (GO:0007202)|apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cGMP catabolic process (GO:0046069)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|locomotory behavior (GO:0007626)|monocyte differentiation (GO:0030224)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of dopamine metabolic process (GO:0042053)|regulation of neurotransmitter levels (GO:0001505)|response to amphetamine (GO:0001975)|serotonin metabolic process (GO:0042428)|signal transduction (GO:0007165)|visual learning (GO:0008542)	cytosol (GO:0005829)|neuronal cell body (GO:0043025)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|calcium- and calmodulin-regulated 3',5'-cyclic-GMP phosphodiesterase activity (GO:0048101)|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity (GO:0004117)|metal ion binding (GO:0046872)			endometrium(1)|kidney(3)|large_intestine(4)|lung(16)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(4)	31					Bepridil(DB01244)|Caffeine(DB00201)|Felodipine(DB01023)|Nicardipine(DB00622)	CCATGATTATGAGCACACGGG	0.582																																																	0								ENSG00000123360						127.0	111.0	116.0					12																	54966992		2203	4300	6503	PDE1B	SO:0001587	stop_gained	0			-	HGNC	U56976	CCDS8882.1, CCDS53800.1, CCDS73477.1	12q13	2008-03-18				ENSG00000123360	3.1.4.17	"""Phosphodiesterases"""	8775	protein-coding gene	gene with protein product		171891		PDES1B		8855339, 9419816	Standard	NM_000924		Approved		uc001sgd.2	Q01064	OTTHUMG00000169844	ENST00000243052.3:c.796G>T	12.37:g.54966992G>T	ENSP00000243052:p.Glu266*	Somatic	0	39	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	16	15.79	Q92825|Q96KP3	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PDEase_catalytic_dom,pfam_PDEase_N,smart_HD/PDEase_dom,prints_PDEase	p.E266*	ENST00000243052.3	37	c.796	CCDS8882.1	12	.	.	.	.	.	.	.	.	.	.	G	37	6.558883	0.97663	.	.	ENSG00000123360	ENST00000243052;ENST00000538346;ENST00000550620	.	.	.	4.97	4.97	0.65823	.	0.062472	0.64402	D	0.000007	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	16.1331	0.81458	0.0:0.0:1.0:0.0	.	.	.	.	X	266;225;246	.	ENSP00000243052:E266X	E	+	1	0	PDE1B	53253259	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.520000	0.98027	2.763000	0.94921	0.650000	0.86243	GAG	-	pfam_PDEase_catalytic_dom,smart_HD/PDEase_dom,prints_PDEase		0.582	PDE1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDE1B	protein_coding	OTTHUMT00000406203.1	G		-		54966992	+1	no_errors	ENST00000243052	ensembl	human	known	74_37	nonsense	SNP	1.000	T
ELAVL3	1995	genome.wustl.edu	37	19	11569017	11569017	+	Missense_Mutation	SNP	G	G	A	rs148057857		TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr19:11569017G>A	ENST00000359227.3	-	5	996	c.572C>T	c.(571-573)cCg>cTg	p.P191L	ELAVL3_ENST00000438662.2_Missense_Mutation_p.P191L	NM_001420.3|NM_032281.2	NP_001411.2|NP_115657.2	Q14576	ELAV3_HUMAN	ELAV like neuron-specific RNA binding protein 3	191	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)		AU-rich element binding (GO:0017091)|nucleotide binding (GO:0000166)			breast(1)|endometrium(2)|large_intestine(4)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	15						TGCGCCCAGCGGCTTCTGCCC	0.612																																																	0								ENSG00000196361	G	LEU/PRO,LEU/PRO	0,4406		0,0,2203	80.0	70.0	73.0		572,572	3.9	0.8	19	dbSNP_134	73	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	ELAVL3	NM_001420.3,NM_032281.2	98,98	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging	191/368,191/361	11569017	1,13005	2203	4300	6503	ELAVL3	SO:0001583	missense	0			-	HGNC		CCDS32912.1, CCDS45978.1	19p13.2	2013-10-03	2013-10-03			ENSG00000196361		"""RNA binding motif (RRM) containing"""	3314	protein-coding gene	gene with protein product	"""Hu antigen C"", ""paraneoplastic limbic encephalitis antigen 21"", ""paraneoplastic cerebellar degeneration-associated antigen"", ""ELAV-like protein 3"""	603458	"""ELAV (embryonic lethal, abnormal vision, Drosophila)-like 3 (Hu antigen C)"""			9799595	Standard	NM_001420		Approved	HUC, PLE21, DKFZp547J036, HUCL, MGC20653	uc002mry.1	Q14576		ENST00000359227.3:c.572C>T	19.37:g.11569017G>A	ENSP00000352162:p.Pro191Leu	Somatic	0	35	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	29	17.14	Q16135|Q96CL8|Q96QS9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RRM_dom,smart_RRM_dom_euk,smart_RRM_dom,pfscan_RRM_dom,prints_Hud_Sxl_RNA,tigrfam_ELAD_HUD_SF	p.P191L	ENST00000359227.3	37	c.572	CCDS32912.1	19	.	.	.	.	.	.	.	.	.	.	G	23.5	4.421508	0.83559	0.0	1.16E-4	ENSG00000196361	ENST00000359227;ENST00000438662	T;T	0.07444	3.75;3.19	4.96	3.92	0.45320	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (2);	0.053537	0.85682	N	0.000000	T	0.01558	0.0050	N	0.00079	-2.23	0.80722	D	1	D;D	0.57571	0.98;0.976	B;B	0.35312	0.19;0.2	T	0.59690	-0.7407	10	0.56958	D	0.05	.	12.3811	0.55307	0.0845:0.0:0.9155:0.0	.	191;191	Q14576;Q14576-2	ELAV3_HUMAN;.	L	191	ENSP00000352162:P191L;ENSP00000390878:P191L	ENSP00000352162:P191L	P	-	2	0	ELAVL3	11430017	1.000000	0.71417	0.788000	0.31933	0.810000	0.45777	9.404000	0.97306	1.091000	0.41335	0.491000	0.48974	CCG	-	smart_RRM_dom,pfscan_RRM_dom,prints_Hud_Sxl_RNA,tigrfam_ELAD_HUD_SF		0.612	ELAVL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ELAVL3	protein_coding	OTTHUMT00000458827.2	G	NM_001420	rs148057857		11569017	-1	no_errors	ENST00000359227	ensembl	human	known	74_37	missense	SNP	0.998	A
OR10H1	26539	genome.wustl.edu	37	19	15918201	15918201	+	Missense_Mutation	SNP	A	A	G	rs201868341	byFrequency	TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr19:15918201A>G	ENST00000334920.2	-	1	735	c.647T>C	c.(646-648)cTc>cCc	p.L216P		NM_013940.2	NP_039228.1	Q9Y4A9	O10H1_HUMAN	olfactory receptor, family 10, subfamily H, member 1	216						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L216P(1)		cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(8)|ovary(4)|skin(2)|urinary_tract(1)	29						ATAGGAGAGGAGGATGAGGAG	0.577																																																	1	Substitution - Missense(1)	ovary(1)						ENSG00000186723						97.0	79.0	85.0					19																	15918201		2203	4294	6497	OR10H1	SO:0001583	missense	0			-	HGNC	AC004510	CCDS12335.1	19p13.1	2012-08-09				ENSG00000186723		"""GPCR / Class A : Olfactory receptors"""	8172	protein-coding gene	gene with protein product							Standard	NM_013940		Approved		uc002nbq.2	Q9Y4A9		ENST00000334920.2:c.647T>C	19.37:g.15918201A>G	ENSP00000335596:p.Leu216Pro	Somatic	0	52	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	56	15.15	Q6IFQ2|Q96R59	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L216P	ENST00000334920.2	37	c.647	CCDS12335.1	19	19	0.0086996336996337	2	0.0040650406504065045	4	0.011049723756906077	3	0.005244755244755245	10	0.013192612137203167	.	13.80	2.346237	0.41599	.	.	ENSG00000186723	ENST00000334920	T	0.00277	8.34	4.96	4.96	0.65561	GPCR, rhodopsin-like superfamily (1);	0.158488	0.29660	N	0.011531	T	0.00580	0.0019	M	0.90814	3.15	0.38102	D	0.937307	D	0.69078	0.997	D	0.72075	0.976	T	0.62397	-0.6863	10	0.72032	D	0.01	.	12.5636	0.56297	1.0:0.0:0.0:0.0	.	216	Q9Y4A9	O10H1_HUMAN	P	216	ENSP00000335596:L216P	ENSP00000335596:L216P	L	-	2	0	OR10H1	15779201	0.049000	0.20398	0.996000	0.52242	0.682000	0.39822	3.435000	0.52849	1.853000	0.53794	0.523000	0.50628	CTC	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.577	OR10H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10H1	protein_coding	OTTHUMT00000460364.1	A		rs201868341		15918201	-1	no_errors	ENST00000334920	ensembl	human	known	74_37	missense	SNP	0.436	G
ZNF800	168850	genome.wustl.edu	37	7	127014569	127014569	+	Missense_Mutation	SNP	G	G	T			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr7:127014569G>T	ENST00000393313.1	-	5	1412	c.821C>A	c.(820-822)tCt>tAt	p.S274Y	ZNF800_ENST00000393312.1_Missense_Mutation_p.S274Y|ZNF800_ENST00000265827.3_Missense_Mutation_p.S274Y|ZNF800_ENST00000485577.1_5'Flank			Q2TB10	ZN800_HUMAN	zinc finger protein 800	274					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(8)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	32						GCGTCCTTTAGAGGATTGGTT	0.373																																																	0								ENSG00000048405						247.0	233.0	238.0					7																	127014569		2203	4300	6503	ZNF800	SO:0001583	missense	0			-	HGNC	AF218032	CCDS5795.1	7q31.33	2008-05-02			ENSG00000048405	ENSG00000048405		"""Zinc fingers, C2H2-type"""	27267	protein-coding gene	gene with protein product						12477932	Standard	NM_176814		Approved		uc003vly.1	Q2TB10	OTTHUMG00000023456	ENST00000393313.1:c.821C>A	7.37:g.127014569G>T	ENSP00000376989:p.Ser274Tyr	Somatic	0	22	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	12	20.00	Q9HBN0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S274Y	ENST00000393313.1	37	c.821	CCDS5795.1	7	.	.	.	.	.	.	.	.	.	.	G	10.72	1.430615	0.25726	.	.	ENSG00000048405	ENST00000393313;ENST00000265827;ENST00000393312	T;T;T	0.16743	2.32;2.32;2.32	5.41	5.41	0.78517	.	0.379952	0.29233	N	0.012750	T	0.12178	0.0296	N	0.14661	0.345	0.29390	N	0.862716	P;P	0.46277	0.875;0.875	B;B	0.41571	0.36;0.36	T	0.21861	-1.0233	8	.	.	.	-7.031	16.3668	0.83335	0.0:0.0:1.0:0.0	.	177;274	B7Z4V7;Q2TB10	.;ZN800_HUMAN	Y	274	ENSP00000376989:S274Y;ENSP00000265827:S274Y;ENSP00000376988:S274Y	.	S	-	2	0	ZNF800	126801805	1.000000	0.71417	0.893000	0.35052	0.887000	0.51463	4.596000	0.61055	2.536000	0.85505	0.650000	0.86243	TCT	-	NULL		0.373	ZNF800-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	ZNF800	protein_coding	OTTHUMT00000141823.1	G	NM_176814	-		127014569	-1	no_errors	ENST00000265827	ensembl	human	known	74_37	missense	SNP	1.000	T
PIGG	54872	genome.wustl.edu	37	4	493032	493032	+	5'UTR	SNP	G	G	A	rs563346830	byFrequency	TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr4:493032G>A	ENST00000453061.2	+	0	14				PIGG_ENST00000503111.1_5'UTR|PIGG_ENST00000296306.7_5'UTR|PIGG_ENST00000504346.1_5'UTR|PIGG_ENST00000502311.1_3'UTR|PIGG_ENST00000310340.5_5'UTR|ZNF721_ENST00000338977.5_5'Flank|PIGG_ENST00000536264.1_5'UTR|PIGG_ENST00000509768.1_5'Flank|PIGG_ENST00000383028.4_5'Flank|ZNF721_ENST00000511833.2_5'Flank	NM_001127178.1	NP_001120650.1	Q5H8A4	PIGG_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class G						C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|GPI anchor biosynthetic process (GO:0006506)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	CP2 mannose-ethanolamine phosphotransferase activity (GO:0051267)|phosphotransferase activity, for other substituted phosphate groups (GO:0016780)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(5)|lung(16)|ovary(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	39						TGGCGTTATTGCTTAGAGGCG	0.697													G|||	4	0.000798722	0.0	0.0014	5008	,	,		13613	0.0		0.003	False		,,,				2504	0.0																0								ENSG00000174227																																			PIGG	SO:0001623	5_prime_UTR_variant	0			-	HGNC		CCDS3336.1, CCDS46992.1, CCDS75080.1, CCDS75081.1, CCDS75082.1, CCDS75083.1	4p16.3	2013-02-26	2006-06-28		ENSG00000174227	ENSG00000174227		"""Phosphatidylinositol glycan anchor biosynthesis"""	25985	protein-coding gene	gene with protein product			"""phosphatidylinositol glycan, class G"""			15632136	Standard	XM_005272287		Approved	FLJ20265, GPI7, LAS21	uc003gak.4	Q5H8A4	OTTHUMG00000112457	ENST00000453061.2:c.-93G>A	4.37:g.493032G>A		Somatic	0	15	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	12	50.00	B4DKC7|Q2TAK5|Q6UX31|Q7L5Y4|Q8N866|Q8NCC9|Q96SY9|Q9BVT7|Q9NXG5	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000453061.2	37	NULL	CCDS46992.1	4																																																																																			-	-		0.697	PIGG-001	KNOWN	basic|CCDS	protein_coding	PIGG	protein_coding	OTTHUMT00000357494.1	G	NM_017733	-		493032	+1	no_errors	ENST00000502311	ensembl	human	known	74_37	rna	SNP	0.000	A
HERC2P4	100289574	genome.wustl.edu	37	16	32163469	32163469	+	IGR	SNP	G	G	A			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr16:32163469G>A								RP11-1166P10.6 (67363 upstream) : HERC2P4 (17835 downstream)																							AATGTGACACGTCCGCATGTC	0.512																																																	0								ENSG00000230267																																			HERC2P4	SO:0001628	intergenic_variant	0			-	HGNC																													16.37:g.32163469G>A		Somatic	0	98	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	52	16.13		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL		37	NULL		16																																																																																			-	-	0	0.512					HERC2P4			G		-		32163469	-1	no_errors	ENST00000563904	ensembl	human	known	74_37	rna	SNP	0.986	A
NTN4	59277	genome.wustl.edu	37	12	96066670	96066670	+	Intron	SNP	G	G	T			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr12:96066670G>T	ENST00000343702.4	-	8	1959				NTN4_ENST00000344911.4_Intron|NTN4_ENST00000553059.1_Intron|PGAM1P5_ENST00000552554.1_RNA|NTN4_ENST00000538383.1_Intron	NM_021229.3	NP_067052.2	Q9HB63	NET4_HUMAN	netrin 4						axon guidance (GO:0007411)|extracellular matrix organization (GO:0030198)|neuron remodeling (GO:0016322)|regulation of branching involved in salivary gland morphogenesis by extracellular matrix-epithelial cell signaling (GO:0060668)	basement membrane (GO:0005604)|plasma membrane (GO:0005886)				NS(2)|breast(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	25						TCAAGCATCTGGAAGGTCTCT	0.498																																																	0								ENSG00000257150																																			PGAM1P5	SO:0001627	intron_variant	0			-	HGNC	AF119916	CCDS9054.1	12q22	2013-03-01			ENSG00000074527	ENSG00000074527		"""Netrins"""	13658	protein-coding gene	gene with protein product	"""beta-netrin"", ""Netrin-4"""	610401				11038171	Standard	NM_021229		Approved		uc001tei.3	Q9HB63	OTTHUMG00000170290	ENST00000343702.4:c.1511-2748C>A	12.37:g.96066670G>T		Somatic	0	42	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	30	31.82	B2RNC2|Q658K9|Q7L3F1|Q7L9D6|Q7Z5B6|Q9BZP1|Q9NT44|Q9P133	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000343702.4	37	NULL	CCDS9054.1	12																																																																																			-	-		0.498	NTN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PGAM1P5	protein_coding	OTTHUMT00000408372.1	G	NM_021229	-		96066670	+1	no_errors	ENST00000552554	ensembl	human	known	74_37	rna	SNP	1.000	T
CHL1	10752	genome.wustl.edu	37	3	424203	424203	+	Missense_Mutation	SNP	G	G	T			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr3:424203G>T	ENST00000256509.2	+	18	2667	c.2025G>T	c.(2023-2025)tgG>tgT	p.W675C	CHL1-AS1_ENST00000417612.1_RNA|CHL1_ENST00000397491.2_Missense_Mutation_p.W659C	NM_001253387.1|NM_001253388.1|NM_006614.3	NP_001240316.1|NP_001240317.1|NP_006605.2	Q96FC9	DDX11_HUMAN	cell adhesion molecule L1-like	0					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|sister chromatid cohesion (GO:0007062)|viral process (GO:0016032)	midbody (GO:0030496)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA-dependent ATPase activity (GO:0008094)|double-stranded DNA binding (GO:0003690)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			NS(1)|central_nervous_system(5)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|lung(31)|ovary(1)|prostate(4)|skin(10)|stomach(1)	93		all_cancers(2;1.14e-06)|all_epithelial(2;0.00367)|all_lung(1;0.061)|Lung NSC(2;0.201)		Epithelial(13;5.36e-06)|all cancers(10;1.4e-05)|OV - Ovarian serous cystadenocarcinoma(96;0.00323)|COAD - Colon adenocarcinoma(1;0.00925)|Colorectal(20;0.0198)		CTGGAAGGTGGGAGGAACTGA	0.398																																																	0								ENSG00000134121						96.0	111.0	105.0					3																	424203		2203	4300	6503	CHL1	SO:0001583	missense	0			-	HGNC	AF002246	CCDS2556.1, CCDS58812.1, CCDS74887.1	3p26	2013-05-01	2013-05-01		ENSG00000134121	ENSG00000134121		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	1939	protein-coding gene	gene with protein product	"""neural cell adhesion molecule"", ""close homolog of L1"""	607416	"""cell adhesion molecule with homology to L1CAM (close homologue of L1)"", ""cell adhesion molecule with homology to L1CAM (close homolog of L1)"""			9799093	Standard	NM_006614		Approved	CALL, L1CAM2, FLJ44930, MGC132578	uc003bot.3	O00533	OTTHUMG00000090601	ENST00000256509.2:c.2025G>T	3.37:g.424203G>T	ENSP00000256509:p.Trp675Cys	Somatic	0	41	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	39	20.41	Q13333|Q86VQ4|Q86W62|Q92498|Q92770|Q92998|Q92999	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.W675C	ENST00000256509.2	37	c.2025	CCDS2556.1	3	.	.	.	.	.	.	.	.	.	.	G	19.48	3.835885	0.71373	.	.	ENSG00000134121	ENST00000256509;ENST00000397491	T;T	0.58940	0.3;0.3	4.86	4.86	0.63082	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.85923	0.5810	H	0.98594	4.275	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.91871	0.5507	10	0.87932	D	0	.	18.3442	0.90315	0.0:0.0:1.0:0.0	.	659;659;675	B3KX75;O00533;O00533-2	.;CHL1_HUMAN;.	C	675;659	ENSP00000256509:W675C;ENSP00000380628:W659C	ENSP00000256509:W675C	W	+	3	0	CHL1	399203	1.000000	0.71417	0.997000	0.53966	0.818000	0.46254	9.067000	0.93955	2.396000	0.81511	0.591000	0.81541	TGG	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.398	CHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHL1	protein_coding	OTTHUMT00000207155.2	G	NM_006614	-		424203	+1	no_errors	ENST00000256509	ensembl	human	known	74_37	missense	SNP	1.000	T
FGB	2244	genome.wustl.edu	37	4	155489556	155489556	+	Missense_Mutation	SNP	G	G	A			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr4:155489556G>A	ENST00000302068.4	+	5	805	c.742G>A	c.(742-744)Gga>Aga	p.G248R	FGB_ENST00000509493.1_Missense_Mutation_p.G29R|FGB_ENST00000502545.1_3'UTR	NM_005141.4	NP_005132.2	P02675	FIBB_HUMAN	fibrinogen beta chain	248	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cellular protein complex assembly (GO:0043623)|cellular response to interleukin-1 (GO:0071347)|cellular response to leptin stimulus (GO:0044320)|extracellular matrix organization (GO:0030198)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of exocytosis (GO:0045921)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of peptide hormone secretion (GO:0090277)|positive regulation of protein secretion (GO:0050714)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of vasoconstriction (GO:0045907)|protein polymerization (GO:0051258)|response to calcium ion (GO:0051592)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|cell cortex (GO:0005938)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	chaperone binding (GO:0051087)|structural molecule activity (GO:0005198)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|liver(2)|lung(22)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34	all_hematologic(180;0.215)	Renal(120;0.0458)			Sucralfate(DB00364)	TATCAGGAAAGGAGGTGAAAC	0.338																																					NSCLC(106;1133 1613 21870 46110 52656)												0								ENSG00000171564						133.0	132.0	132.0					4																	155489556		2203	4300	6503	FGB	SO:0001583	missense	0			-	HGNC		CCDS3786.1	4q28	2014-09-17			ENSG00000171564	ENSG00000171564		"""Fibrinogen C domain containing"", ""Endogenous ligands"""	3662	protein-coding gene	gene with protein product		134830	"""fibrinogen, B beta polypeptide"""				Standard	NM_005141		Approved		uc003ioa.4	P02675	OTTHUMG00000150331	ENST00000302068.4:c.742G>A	4.37:g.155489556G>A	ENSP00000306099:p.Gly248Arg	Somatic	0	32	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	12	47.83	A0JLR9|B2R7G3|Q32Q65|Q3KPF2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Fibrinogen_a/b/g_C_dom,pfam_Fibrinogen_a/b/g_coil_dom,superfamily_Fibrinogen_a/b/g_C_dom,smart_Fibrinogen_a/b/g_C_dom	p.G248R	ENST00000302068.4	37	c.742	CCDS3786.1	4	.	.	.	.	.	.	.	.	.	.	G	32	5.184031	0.94885	.	.	ENSG00000171564	ENST00000302068;ENST00000537843;ENST00000509493	T;T	0.80738	-1.41;-1.41	5.74	5.74	0.90152	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 1 (1);	0.000000	0.85682	D	0.000000	D	0.91036	0.7180	M	0.86178	2.8	0.80722	D	1	D;D	0.76494	0.999;0.971	D;P	0.70487	0.969;0.838	D	0.91750	0.5411	10	0.87932	D	0	.	19.9139	0.97034	0.0:0.0:1.0:0.0	.	231;248	B4E1D3;P02675	.;FIBB_HUMAN	R	248;231;29	ENSP00000306099:G248R;ENSP00000426757:G29R	ENSP00000306099:G248R	G	+	1	0	FGB	155709006	1.000000	0.71417	0.999000	0.59377	0.969000	0.65631	7.946000	0.87746	2.704000	0.92352	0.491000	0.48974	GGA	-	pfam_Fibrinogen_a/b/g_C_dom,superfamily_Fibrinogen_a/b/g_C_dom,smart_Fibrinogen_a/b/g_C_dom		0.338	FGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGB	protein_coding	OTTHUMT00000317595.1	G	NM_005141	-		155489556	+1	no_errors	ENST00000302068	ensembl	human	known	74_37	missense	SNP	1.000	A
NFAT5	10725	genome.wustl.edu	37	16	69729107	69729124	+	In_Frame_Del	DEL	GGCCAACCACAAAACGAG	GGCCAACCACAAAACGAG	-			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	GGCCAACCACAAAACGAG	GGCCAACCACAAAACGAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr16:69729107_69729124delGGCCAACCACAAAACGAG	ENST00000354436.2	+	13	4747_4764	c.4429_4446delGGCCAACCACAAAACGAG	c.(4429-4446)ggccaaccacaaaacgagdel	p.GQPQNE1477del	NFAT5_ENST00000566899.1_In_Frame_Del_p.GQPQNE1401del|NFAT5_ENST00000567239.1_In_Frame_Del_p.GQPQNE1494del|NFAT5_ENST00000349945.1_In_Frame_Del_p.GQPQNE1401del|NFAT5_ENST00000393742.2_In_Frame_Del_p.GQPQNE1401del|NFAT5_ENST00000432919.1_In_Frame_Del_p.GQPQNE1495del	NM_006599.3	NP_006590.1	O94916	NFAT5_HUMAN	nuclear factor of activated T-cells 5, tonicity-responsive	1477					cytokine production (GO:0001816)|excretion (GO:0007588)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of calcineurin-NFAT signaling cascade (GO:0070884)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(11)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	37						AAGTCAGCCAGGCCAACCACAAAACGAGGGCCAGCCAC	0.454																																																	0								ENSG00000102908																																			NFAT5	SO:0001651	inframe_deletion	0				HGNC	AF134870	CCDS10881.1, CCDS10882.1, CCDS45519.1	16q22.1	2009-11-24			ENSG00000102908	ENSG00000102908		"""Nuclear factor of activated T-cells"""	7774	protein-coding gene	gene with protein product		604708				10377394	Standard	NM_173214		Approved	TONEBP, KIAA0827, NFATL1, OREBP, NFATZ, NF-AT5	uc002exl.2	O94916	OTTHUMG00000137572	ENST00000354436.2:c.4429_4446delGGCCAACCACAAAACGAG	16.37:g.69729107_69729124delGGCCAACCACAAAACGAG	ENSP00000346420:p.Gly1477_Glu1482del	Somatic	NA	NA	NA		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A2RRB4|A6H8V5|E9PHR7|O95693|Q7LA65|Q969Q8|Q96QH3|Q9UN18	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_RHD,superfamily_p53-like_TF_DNA-bd,superfamily_Ig_E-set,smart_IPT,pfscan_RHD,prints_NFAT	p.QNEGQP1498in_frame_del	ENST00000354436.2	37	c.4483_4500	CCDS10881.1	16																																																																																			-	NULL		0.454	NFAT5-001	KNOWN	basic|CCDS	protein_coding	NFAT5	protein_coding	OTTHUMT00000268952.2	GGCCAACCACAAAACGAG	NM_138714			69729124	+1	no_errors	ENST00000432919	ensembl	human	known	74_37	in_frame_del	DEL	1.000:1.000:0.997:1.000:1.000:0.987:1.000:1.000:0.988:1.000:1.000:1.000:0.998:0.985:0.965:1.000:1.000:1.000	-
PLCG2	5336	genome.wustl.edu	37	16	81914547	81914547	+	Silent	SNP	G	G	T			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr16:81914547G>T	ENST00000359376.3	+	8	895	c.681G>T	c.(679-681)gtG>gtT	p.V227V		NM_002661.3	NP_002652.2	P16885	PLCG2_HUMAN	phospholipase C, gamma 2 (phosphatidylinositol-specific)	227					B cell differentiation (GO:0030183)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid catabolic process (GO:0009395)|platelet activation (GO:0030168)|release of sequestered calcium ion into cytosol (GO:0051209)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			NS(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(18)|lung(21)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	58						ATTCGTCCGTGTTCATCCTGG	0.517																																																	0								ENSG00000197943						122.0	123.0	123.0					16																	81914547		1976	4150	6126	PLCG2	SO:0001819	synonymous_variant	0			-	HGNC		CCDS42204.1	16q24.1	2014-09-17				ENSG00000197943	3.1.4.11	"""SH2 domain containing"""	9066	protein-coding gene	gene with protein product		600220				7835906	Standard	XR_248240		Approved		uc002fgt.3	P16885		ENST00000359376.3:c.681G>T	16.37:g.81914547G>T		Somatic	0	45	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70	D3DUL3|Q3ZTS2|Q59H45|Q969T5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_PLipase_C_PInositol-sp_X_dom,pfam_SH2,pfam_PLipase_C_Pinositol-sp_Y,pfam_SH3_domain,pfam_C2_dom,pfam_PLipase_C_EF-hand-like,pfam_SH3_2,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_dom,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_PLipase_C_PInositol-sp_X_dom,smart_SH2,smart_SH3_domain,smart_PLipase_C_Pinositol-sp_Y,smart_C2_dom,pirsf_PLC-gamma,pfscan_C2_dom,pfscan_Pleckstrin_homology,pfscan_SH2,pfscan_SH3_domain,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,prints_Pinositol_PLipase_C,prints_SH2,prints_SH3_domain	p.V227	ENST00000359376.3	37	c.681	CCDS42204.1	16																																																																																			-	pirsf_PLC-gamma		0.517	PLCG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLCG2	protein_coding	OTTHUMT00000432429.1	G		-		81914547	+1	no_errors	ENST00000359376	ensembl	human	known	74_37	silent	SNP	1.000	T
PLET1	349633	genome.wustl.edu	37	11	112118610	112118619	+	IGR	DEL	ACACACACAC	ACACACACAC	-	rs201398125|rs79699298|rs202146857|rs146953253		TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	ACACACACAC	ACACACACAC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr11:112118610_112118619delACACACACAC	ENST00000338832.2	-	0	1541				AP002884.1_ENST00000401135.1_RNA	NM_001145024.1	NP_001138496.1	Q6UQ28	PLET1_HUMAN							cell differentiation (GO:0030154)|negative regulation of cell-matrix adhesion (GO:0001953)|positive regulation of cell migration (GO:0030335)|wound healing, spreading of epidermal cells (GO:0035313)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)				endometrium(2)	2						atgtatatATacacacacacacacacacac	0.352																																																	0								ENSG00000215954																																			AP002884.1	SO:0001628	intergenic_variant	0				Clone_based_ensembl_gene																													11.37:g.112118620_112118629delACACACACAC		Somatic	NA	NA	NA		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q6UQ24|Q6UQ25|Q6UQ27	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000338832.2	37	NULL		11																																																																																			-	-		0.352	C11orf34-201	KNOWN	basic|appris_principal	protein_coding	ENSG00000215954	protein_coding		ACACACACAC				112118619	+1	no_errors	ENST00000401135	ensembl	human	novel	74_37	rna	DEL	0.028:0.021:0.024:0.025:0.042:0.052:0.057:0.059:0.067:0.070	-
CNTN6	27255	genome.wustl.edu	37	3	1371493	1371493	+	Missense_Mutation	SNP	G	G	C			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr3:1371493G>C	ENST00000446702.2	+	11	1865	c.1238G>C	c.(1237-1239)aGt>aCt	p.S413T	CNTN6_ENST00000350110.2_Missense_Mutation_p.S413T|CNTN6_ENST00000539053.1_Missense_Mutation_p.S341T			Q9UQ52	CNTN6_HUMAN	contactin 6	413	Ig-like C2-type 5.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|Notch signaling pathway (GO:0007219)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(34)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	90		all_cancers(2;0.000164)|all_epithelial(2;0.107)		Epithelial(13;0.000233)|all cancers(10;0.0013)|OV - Ovarian serous cystadenocarcinoma(96;0.0139)		TTCTCCAAAAGTCCAGTTAAA	0.388																																																	0								ENSG00000134115						82.0	85.0	84.0					3																	1371493		2203	4297	6500	CNTN6	SO:0001583	missense	0			-	HGNC	AB003592	CCDS2557.1	3p26-p25	2013-02-11			ENSG00000134115	ENSG00000134115		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	2176	protein-coding gene	gene with protein product	"""neural adhesion molecule"""	607220				9486763	Standard	NM_014461		Approved	NB-3	uc003bpa.3	Q9UQ52	OTTHUMG00000119030	ENST00000446702.2:c.1238G>C	3.37:g.1371493G>C	ENSP00000407822:p.Ser413Thr	Somatic	0	45	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	53	11.48	Q2KHM2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.S413T	ENST00000446702.2	37	c.1238	CCDS2557.1	3	.	.	.	.	.	.	.	.	.	.	G	7.290	0.610781	0.14066	.	.	ENSG00000134115	ENST00000446702;ENST00000539053;ENST00000350110	T;T;T	0.66815	-0.23;-0.23;-0.23	5.71	2.0	0.26442	Immunoglobulin I-set (1);Immunoglobulin-like (1);	0.095788	0.45361	D	0.000368	T	0.36110	0.0955	N	0.02854	-0.475	0.25704	N	0.985556	B	0.24675	0.109	B	0.30105	0.111	T	0.23976	-1.0173	10	0.19147	T	0.46	.	5.3194	0.15874	0.6961:0.149:0.155:0.0	.	413	Q9UQ52	CNTN6_HUMAN	T	413;341;413	ENSP00000407822:S413T;ENSP00000442791:S341T;ENSP00000341882:S413T	ENSP00000341882:S413T	S	+	2	0	CNTN6	1346493	0.002000	0.14202	0.958000	0.39756	0.450000	0.32258	0.059000	0.14322	0.100000	0.17581	-0.471000	0.05019	AGT	-	pfam_Ig_I-set,pfscan_Ig-like_dom		0.388	CNTN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTN6	protein_coding	OTTHUMT00000239235.2	G	NM_014461	-		1371493	+1	no_errors	ENST00000350110	ensembl	human	known	74_37	missense	SNP	0.958	C
ANKRD42	338699	genome.wustl.edu	37	11	82935896	82935896	+	Splice_Site	SNP	G	G	T			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr11:82935896G>T	ENST00000393392.2	+	6	664		c.e6-1		ANKRD42_ENST00000533342.1_Splice_Site|ANKRD42_ENST00000260047.6_Splice_Site|ANKRD42_ENST00000531895.1_Splice_Site	NM_182603.2	NP_872409.2	Q8N9B4	ANR42_HUMAN	ankyrin repeat domain 42						positive regulation of cytokine production involved in inflammatory response (GO:1900017)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)	nucleus (GO:0005634)				central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(6)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	18						CTTTCCTCTAGTTCACTTAGC	0.333																																																	0								ENSG00000137494						56.0	56.0	56.0					11																	82935896		2203	4300	6503	ANKRD42	SO:0001630	splice_region_variant	0			-	HGNC	AK095193	CCDS8265.1, CCDS73355.1, CCDS73356.1	11q14.1	2014-06-12			ENSG00000137494	ENSG00000137494		"""Ankyrin repeat domain containing"""	26752	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 79"""						Standard	XM_005273971		Approved	FLJ37874, SARP, PPP1R79	uc001ozz.1	Q8N9B4	OTTHUMG00000167075	ENST00000393392.2:c.503-1G>T	11.37:g.82935896G>T		Somatic	0	37	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51	Q49A49	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e6-1	ENST00000393392.2	37	c.503-1	CCDS8265.1	11	.	.	.	.	.	.	.	.	.	.	G	19.35	3.810920	0.70797	.	.	ENSG00000137494	ENST00000545672;ENST00000260047;ENST00000531895;ENST00000393392;ENST00000533342	.	.	.	5.67	5.67	0.87782	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.5429	0.91035	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ANKRD42	82613544	1.000000	0.71417	1.000000	0.80357	0.893000	0.52053	6.638000	0.74309	2.666000	0.90696	0.655000	0.94253	.	-	-		0.333	ANKRD42-001	KNOWN	basic|CCDS	protein_coding	ANKRD42	protein_coding	OTTHUMT00000392934.1	G	NM_182603	-	Intron	82935896	+1	no_errors	ENST00000393392	ensembl	human	known	74_37	splice_site	SNP	1.000	T
ZMYM4	9202	genome.wustl.edu	37	1	35846959	35846960	+	Frame_Shift_Ins	INS	-	-	A			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr1:35846959_35846960insA	ENST00000314607.6	+	8	1361_1362	c.1281_1282insA	c.(1282-1284)aaafs	p.K428fs	ZMYM4_ENST00000373297.2_Frame_Shift_Ins_p.K428fs	NM_005095.2	NP_005086.2	Q5VZL5	ZMYM4_HUMAN	zinc finger, MYM-type 4	428					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(13)|lung(16)|ovary(2)|prostate(3)|skin(2)	54		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				CATATGAACTGAAAAAAAAACC	0.342																																																	0								ENSG00000146463																																			ZMYM4	SO:0001589	frameshift_variant	0				HGNC	AB007885	CCDS389.1	1p34-p32	2013-01-08	2005-12-19	2005-12-19	ENSG00000146463	ENSG00000146463		"""Zinc fingers, MYM type"""	13055	protein-coding gene	gene with protein product		613568	"""zinc finger protein 262"""	ZNF262		10449923	Standard	NM_005095		Approved	KIAA0425, ZNF198L3, MYM	uc001byt.3	Q5VZL5	OTTHUMG00000004241	ENST00000314607.6:c.1290dupA	1.37:g.35846968_35846968dupA	ENSP00000322915:p.Lys428fs	Somatic	0	25	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	17	10.53	A0JP19|A0JP20|O43308|Q5T5E1|Q5T5E2|Q7L3Q4	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_DUF3504,pfam_Znf_MYM,smart_TRASH_dom	p.P430fs	ENST00000314607.6	37	c.1281_1282	CCDS389.1	1																																																																																			-	NULL		0.342	ZMYM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZMYM4	protein_coding	OTTHUMT00000012207.3	-	NM_005095			35846960	+1	no_errors	ENST00000314607	ensembl	human	known	74_37	frame_shift_ins	INS	0.987:1.000	A
DUSP10	11221	genome.wustl.edu	37	1	221875157	221875158	+	3'UTR	DEL	AA	AA	-			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	AA	AA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr1:221875157_221875158delAA	ENST00000366899.3	-	0	2283_2284				DUSP10_ENST00000544095.1_3'UTR|DUSP10_ENST00000468085.1_5'UTR|DUSP10_ENST00000323825.3_3'UTR	NM_007207.4	NP_009138.1	Q9Y6W6	DUS10_HUMAN	dual specificity phosphatase 10						inactivation of MAPK activity (GO:0000188)|JNK cascade (GO:0007254)|negative regulation of JNK cascade (GO:0046329)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of respiratory burst involved in inflammatory response (GO:0060266)|oligodendrocyte differentiation (GO:0048709)|protein dephosphorylation (GO:0006470)|regulation of adaptive immune response (GO:0002819)|response to lipopolysaccharide (GO:0032496)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	MAP kinase phosphatase activity (GO:0033549)|MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|phosphatase activity (GO:0016791)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(16)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				GBM - Glioblastoma multiforme(131;0.0103)		CCAGAGAAGGAAAAAAAAAAAA	0.356																																																	0								ENSG00000143507																																			DUSP10	SO:0001624	3_prime_UTR_variant	0				HGNC	AB026436	CCDS1528.1	1q41	2011-06-09			ENSG00000143507	ENSG00000143507		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3065	protein-coding gene	gene with protein product		608867				10391943, 10597297	Standard	NM_007207		Approved	MKP-5, MKP5	uc001hmy.2	Q9Y6W6	OTTHUMG00000037269	ENST00000366899.3:c.*597TT>-	1.37:g.221875167_221875168delAA		Somatic	0	14	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	12	20.00	D3DTB4|Q6GSI4|Q9H9Z5	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000366899.3	37	NULL	CCDS1528.1	1																																																																																			-	-		0.356	DUSP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUSP10	protein_coding	OTTHUMT00000090716.1	AA	NM_007207			221875158	-1	no_errors	ENST00000468085	ensembl	human	known	74_37	rna	DEL	0.000:0.000	-
WDR81	124997	genome.wustl.edu	37	17	1631292	1631292	+	Silent	SNP	G	G	A			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr17:1631292G>A	ENST00000409644.1	+	1	3039	c.3039G>A	c.(3037-3039)gcG>gcA	p.A1013A	WDR81_ENST00000437219.2_Intron|WDR81_ENST00000446363.1_Intron|WDR81_ENST00000545662.1_5'Flank|WDR81_ENST00000309182.5_5'UTR|WDR81_ENST00000419248.1_Intron|RP11-961A15.1_ENST00000576540.1_RNA	NM_001163809.1	NP_001157281.1	Q562E7	WDR81_HUMAN	WD repeat domain 81	1013					negative regulation of phosphatase activity (GO:0010923)		transferase activity, transferring phosphorus-containing groups (GO:0016772)			cervix(1)|endometrium(1)|kidney(3)|lung(6)|ovary(2)|prostate(2)|skin(1)	16				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		AGGTGCTGGCGGGCGCAGAGG	0.672																																																	0								ENSG00000167716						8.0	10.0	10.0					17																	1631292		688	1581	2269	WDR81	SO:0001819	synonymous_variant	0			-	HGNC	AK074111	CCDS54061.1, CCDS54062.1, CCDS54063.1	17p13.3	2014-06-13			ENSG00000167716	ENSG00000167716		"""WD repeat domain containing"""	26600	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 166"""	614218					Standard	NM_001163673		Approved	FLJ33817, PPP1R166	uc002ftj.2	Q562E7	OTTHUMG00000153941	ENST00000409644.1:c.3039G>A	17.37:g.1631292G>A		Somatic	0	25	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	6	50.00	B3KW16|B3KXU1|B7Z579|E9PHG7|Q24JP6|Q8N277|Q8N3F3|Q8TEL1	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_Kinase-like_dom,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.A1013	ENST00000409644.1	37	c.3039	CCDS54062.1	17																																																																																			-	NULL		0.672	WDR81-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WDR81	protein_coding	OTTHUMT00000333118.2	G	NM_152348	-		1631292	+1	no_errors	ENST00000409644	ensembl	human	known	74_37	silent	SNP	0.912	A
ELN	2006	genome.wustl.edu	37	7	73467612	73467612	+	Missense_Mutation	SNP	G	G	T			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr7:73467612G>T	ENST00000252034.7	+	18	1468	c.1069G>T	c.(1069-1071)Gct>Tct	p.A357S	ELN_ENST00000429192.1_Missense_Mutation_p.A362S|ELN_ENST00000445912.1_Missense_Mutation_p.A357S|ELN_ENST00000380562.4_Missense_Mutation_p.A357S|ELN_ENST00000458204.1_Missense_Mutation_p.A347S|ELN_ENST00000357036.5_Missense_Mutation_p.A362S|ELN_ENST00000380553.4_Missense_Mutation_p.A240S|ELN_ENST00000358929.4_Missense_Mutation_p.A357S|ELN_ENST00000380575.4_Missense_Mutation_p.A347S|ELN_ENST00000320492.7_Missense_Mutation_p.A321S|ELN_ENST00000466878.1_3'UTR|ELN_ENST00000380576.5_Missense_Mutation_p.A357S|ELN_ENST00000320399.6_Missense_Mutation_p.A357S|ELN_ENST00000380584.4_Missense_Mutation_p.A343S|ELN_ENST00000414324.1_Missense_Mutation_p.A352S	NM_000501.2|NM_001278915.1	NP_000492.2|NP_001265844.1	P15502	ELN_HUMAN	elastin	357	Ala-rich.				blood circulation (GO:0008015)|blood vessel remodeling (GO:0001974)|cell proliferation (GO:0008283)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|organ morphogenesis (GO:0009887)|regulation of actin filament polymerization (GO:0030833)|respiratory gaseous exchange (GO:0007585)|skeletal muscle tissue development (GO:0007519)|stress fiber assembly (GO:0043149)	elastic fiber (GO:0071953)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix binding (GO:0050840)|extracellular matrix constituent conferring elasticity (GO:0030023)|extracellular matrix structural constituent (GO:0005201)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(10)|ovary(4)|pancreas(2)|prostate(1)|skin(2)|stomach(1)	32		Lung NSC(55;0.159)				TGTCCCAGGTGCTGGGATCCC	0.577			T	PAX5	B-ALL		"""Supravalvular Aortic Stenosis, Cutis laxa , Williams-Beuren Syndrome"""																																	Dom	yes		7	7q11.23	2006	elastin	yes	L	0								ENSG00000049540						92.0	81.0	85.0					7																	73467612		2203	4300	6503	ELN	SO:0001583	missense	0			-	HGNC		CCDS5562.2, CCDS43598.1, CCDS43599.1, CCDS47611.1, CCDS47612.1, CCDS64673.1, CCDS64674.1, CCDS64675.1, CCDS64676.1, CCDS64677.1, CCDS64678.1, CCDS75616.1, CCDS75617.1	7q11.1-q21.1	2008-08-01	2008-08-01		ENSG00000049540	ENSG00000049540			3327	protein-coding gene	gene with protein product	"""tropoelastin"", ""supravalvular aortic stenosis"", ""Williams-Beuren syndrome"""	130160				8096434	Standard	NM_001278939		Approved	WBS, WS, SVAS	uc003tzn.3	P15502	OTTHUMG00000150229	ENST00000252034.7:c.1069G>T	7.37:g.73467612G>T	ENSP00000252034:p.Ala357Ser	Somatic	0	40	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51	B3KTS6|O15336|O15337|Q14233|Q14234|Q14235|Q14238|Q6P0L4|Q6ZWJ6|Q75MU5|Q7Z316|Q7Z3F5|Q9UMF5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	prints_Tropoelastin	p.A357S	ENST00000252034.7	37	c.1069	CCDS5562.2	7	.	.	.	.	.	.	.	.	.	.	g	10.21	1.286853	0.23478	.	.	ENSG00000049540	ENST00000445912;ENST00000252034;ENST00000358929;ENST00000320492;ENST00000414324;ENST00000380562;ENST00000380575;ENST00000380584;ENST00000458204;ENST00000357036;ENST00000429192;ENST00000442462;ENST00000380553;ENST00000380576;ENST00000320399	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.34072	1.41;1.42;1.47;1.38;1.42;1.42;1.41;1.45;1.41;1.41;1.45;1.42;1.41;1.42	3.69	1.82	0.25136	.	.	.	.	.	T	0.16854	0.0405	N	0.14661	0.345	0.23003	N	0.998445	B;B;B;B;B;B;B;B;B;B;B;B;B;B	0.31290	0.318;0.318;0.318;0.318;0.318;0.318;0.318;0.318;0.318;0.318;0.318;0.318;0.318;0.318	B;B;B;B;B;B;B;B;B;B;B;B;B;B	0.29785	0.107;0.075;0.075;0.107;0.107;0.107;0.107;0.107;0.107;0.107;0.107;0.075;0.107;0.107	T	0.25398	-1.0133	9	0.11485	T	0.65	.	5.3574	0.16069	0.2741:0.0:0.7259:0.0	.	357;326;321;352;347;357;347;362;362;357;240;313;343;357	E7ENM0;E9PBM4;G5E950;G3V0G6;E7EN65;P15502-1;P15502-7;P15502-12;P15502-5;P15502-13;P15502-11;B3KRT8;P15502-8;P15502-2	.;.;.;.;.;.;.;.;.;.;.;.;.;.	S	357;357;357;321;352;357;347;343;347;362;362;326;240;357;357	ENSP00000389857:A357S;ENSP00000252034:A357S;ENSP00000351807:A357S;ENSP00000315607:A321S;ENSP00000392575:A352S;ENSP00000369936:A357S;ENSP00000369949:A347S;ENSP00000369958:A343S;ENSP00000403162:A347S;ENSP00000349540:A362S;ENSP00000391129:A362S;ENSP00000369926:A240S;ENSP00000369950:A357S;ENSP00000313565:A357S	ENSP00000252034:A357S	A	+	1	0	ELN	73105548	1.000000	0.71417	0.930000	0.37139	0.328000	0.28507	1.593000	0.36686	0.359000	0.24239	0.434000	0.28630	GCT	-	NULL		0.577	ELN-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ELN	protein_coding	OTTHUMT00000316913.1	G	NM_000501	-		73467612	+1	no_errors	ENST00000358929	ensembl	human	known	74_37	missense	SNP	0.922	T
AP3D1	8943	genome.wustl.edu	37	19	2115549	2115549	+	Missense_Mutation	SNP	A	A	T			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr19:2115549A>T	ENST00000345016.5	-	19	2368	c.2137T>A	c.(2137-2139)Ttg>Atg	p.L713M	AP3D1_ENST00000356926.4_Missense_Mutation_p.L622M|AP3D1_ENST00000350812.6_Missense_Mutation_p.L544M|AP3D1_ENST00000355272.6_Missense_Mutation_p.L713M	NM_003938.6	NP_003929.4	O14617	AP3D1_HUMAN	adaptor-related protein complex 3, delta 1 subunit	713					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|antigen processing and presentation, exogenous lipid antigen via MHC class Ib (GO:0048007)|endosome to melanosome transport (GO:0035646)|eye pigment biosynthetic process (GO:0006726)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|positive regulation of NK T cell differentiation (GO:0051138)|protein localization to membrane (GO:0072657)|protein localization to organelle (GO:0033365)|regulation of sequestering of zinc ion (GO:0061088)|synaptic vesicle membrane organization (GO:0048499)	endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|membrane coat (GO:0030117)|terminal bouton (GO:0043195)	protein transporter activity (GO:0008565)|transporter activity (GO:0005215)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(23)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGAACCTTCAAGGGGACGGAG	0.662																																																	0								ENSG00000065000						65.0	78.0	74.0					19																	2115549		2093	4211	6304	AP3D1	SO:0001583	missense	0			-	HGNC	U91930	CCDS42459.1, CCDS58638.1	19p13.3	2014-09-04			ENSG00000065000	ENSG00000065000			568	protein-coding gene	gene with protein product		607246				9151686, 9303295	Standard	NM_003938		Approved	ADTD	uc002lva.4	O14617	OTTHUMG00000180354	ENST00000345016.5:c.2137T>A	19.37:g.2115549A>T	ENSP00000344055:p.Leu713Met	Somatic	0	32	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	21	36.36	O00202|O75262|Q59HF5|Q96G11|Q9H3C6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_BLV_receptor,pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,pirsf_AP3_complex_dsu	p.L713M	ENST00000345016.5	37	c.2137	CCDS42459.1	19	.	.	.	.	.	.	.	.	.	.	A	12.56	1.974435	0.34848	.	.	ENSG00000065000	ENST00000356926;ENST00000345016;ENST00000355272;ENST00000343722;ENST00000350812	T;T;T;T	0.63744	1.64;-0.06;1.42;-0.06	4.67	-3.25	0.05079	.	0.000000	0.64402	D	0.000001	T	0.77418	0.4127	M	0.89287	3.02	0.42068	D	0.991192	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	T	0.78099	-0.2336	10	0.72032	D	0.01	-19.4064	11.2528	0.49037	0.7467:0.0:0.2533:0.0	.	713;713;622	O14617-5;O14617;G5E988	.;AP3D1_HUMAN;.	M	622;713;713;713;544	ENSP00000349398:L622M;ENSP00000344055:L713M;ENSP00000347416:L713M;ENSP00000342321:L544M	ENSP00000341579:L713M	L	-	1	2	AP3D1	2066549	0.056000	0.20664	0.002000	0.10522	0.064000	0.16182	0.394000	0.20834	-0.640000	0.05495	-0.464000	0.05259	TTG	-	pfam_BLV_receptor,pirsf_AP3_complex_dsu		0.662	AP3D1-002	KNOWN	basic|CCDS	protein_coding	AP3D1	protein_coding	OTTHUMT00000450912.1	A		-		2115549	-1	no_errors	ENST00000355272	ensembl	human	known	74_37	missense	SNP	0.254	T
RHBG	57127	genome.wustl.edu	37	1	156354244	156354244	+	Intron	SNP	T	T	C			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr1:156354244T>C	ENST00000368249.1	+	9	1272				RHBG_ENST00000494874.1_Intron|RHBG_ENST00000255013.3_Intron|RHBG_ENST00000451864.2_Missense_Mutation_p.L347P|RHBG_ENST00000368246.2_Intron|RHBG_ENST00000400992.2_Intron	NM_001256396.1|NM_020407.4	NP_001243325.1|NP_065140.3	Q9H310	RHBG_HUMAN	Rh family, B glycoprotein (gene/pseudogene)						ammonium transmembrane transport (GO:0072488)|ammonium transport (GO:0015696)|transepithelial ammonium transport (GO:0070634)|transmembrane transport (GO:0055085)	anchored component of plasma membrane (GO:0046658)|basolateral plasma membrane (GO:0016323)|cytoplasmic vesicle (GO:0031410)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|spectrin-associated cytoskeleton (GO:0014731)	ammonium transmembrane transporter activity (GO:0008519)|ankyrin binding (GO:0030506)			endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(3)|skin(2)|stomach(1)|urinary_tract(1)	22	Hepatocellular(266;0.158)					CCCTGTGCCCTGTGGCACTGG	0.572											OREG0013871	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000132677																																			RHBG	SO:0001627	intron_variant	0			-	HGNC	AF193807		1q22	2013-05-22	2009-01-22		ENSG00000132677	ENSG00000132677		"""Solute carriers"""	14572	protein-coding gene	gene with protein product		607079	"""Rhesus blood group, B glycoprotein"""			10852913	Standard	NM_020407		Approved	SLC42A2	uc010pho.3	Q9H310	OTTHUMG00000024057	ENST00000368249.1:c.1235-74T>C	1.37:g.156354244T>C		Somatic	0	29	0.00	1777	0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	29	14.71	A8K475|Q5SZW4|Q5SZW6|Q5SZW7|Q6P193|Q6YJI2|Q6YJI3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_NH4_transpt_AmtB-like_dom,superfamily_NH4_transpt_AmtB-like_dom,prints_RhesusRHD	p.L347P	ENST00000368249.1	37	c.1040		1	.	.	.	.	.	.	.	.	.	.	T	6.874	0.530679	0.13127	.	.	ENSG00000132677	ENST00000451864	T	0.38722	1.12	4.25	-1.24	0.09435	.	.	.	.	.	T	0.09069	0.0224	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.32428	-0.9907	6	0.30854	T	0.27	.	0.6346	0.00800	0.1659:0.2162:0.1713:0.4466	.	.	.	.	P	347	ENSP00000389836:L347P	ENSP00000389836:L347P	L	+	2	0	RHBG	154620868	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.477000	0.06583	-0.323000	0.08602	-0.496000	0.04628	CTG	-	NULL		0.572	RHBG-001	NOVEL	basic	protein_coding	RHBG	protein_coding	OTTHUMT00000060589.2	T	NM_001256395	-		156354244	+1	no_errors	ENST00000451864	ensembl	human	known	74_37	missense	SNP	0.000	C
GIMAP8	155038	genome.wustl.edu	37	7	150174802	150174802	+	Missense_Mutation	SNP	T	T	G			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr7:150174802T>G	ENST00000307271.3	+	5	2506	c.1932T>G	c.(1930-1932)atT>atG	p.I644M		NM_175571.2	NP_783161.1	Q8ND71	GIMA8_HUMAN	GTPase, IMAP family member 8	644						cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	GTP binding (GO:0005525)			breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(11)|lung(26)|ovary(2)|skin(7)|stomach(1)|urinary_tract(1)	62			OV - Ovarian serous cystadenocarcinoma(82;0.0218)	UCEC - Uterine corpus endometrioid carcinoma (81;0.17)		GCAAACTAATTAAAAATGTCC	0.408																																																	0								ENSG00000171115						56.0	63.0	61.0					7																	150174802		2198	4297	6495	GIMAP8	SO:0001583	missense	0			-	HGNC	AL834361	CCDS34777.1	7q36.1	2014-04-04			ENSG00000171115	ENSG00000171115		"""GTPases, IMAP"""	21792	protein-coding gene	gene with protein product	"""immune-associated nucleotide-binding protein 9"""					15474311	Standard	XM_005249951		Approved	DKFZp667I133, hIAN6, IAN9	uc003whj.3	Q8ND71	OTTHUMG00000158327	ENST00000307271.3:c.1932T>G	7.37:g.150174802T>G	ENSP00000305107:p.Ile644Met	Somatic	0	56	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	37	30.91		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_AIG1,superfamily_P-loop_NTPase	p.I644M	ENST00000307271.3	37	c.1932	CCDS34777.1	7	.	.	.	.	.	.	.	.	.	.	T	1.877	-0.458731	0.04508	.	.	ENSG00000171115	ENST00000307271	T	0.07021	3.23	4.31	-8.63	0.00878	AIG1 (1);	2.679310	0.02165	N	0.059204	T	0.02807	0.0084	N	0.04880	-0.145	0.09310	N	1	B	0.10296	0.003	B	0.13407	0.009	T	0.39542	-0.9609	10	0.19590	T	0.45	.	0.073	0.00024	0.2687:0.2312:0.2132:0.2869	.	644	Q8ND71	GIMA8_HUMAN	M	644	ENSP00000305107:I644M	ENSP00000305107:I644M	I	+	3	3	GIMAP8	149805735	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.494000	0.02296	-2.472000	0.00529	-2.020000	0.00432	ATT	-	pfam_AIG1		0.408	GIMAP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GIMAP8	protein_coding	OTTHUMT00000350701.1	T	NM_175571	-		150174802	+1	no_errors	ENST00000307271	ensembl	human	known	74_37	missense	SNP	0.000	G
KLKB1	3818	genome.wustl.edu	37	4	187171526	187171526	+	Missense_Mutation	SNP	A	A	T			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr4:187171526A>T	ENST00000264690.6	+	7	915	c.728A>T	c.(727-729)tAt>tTt	p.Y243F	KLKB1_ENST00000513864.1_Missense_Mutation_p.Y243F	NM_000892.3	NP_000883.2	P03952	KLKB1_HUMAN	kallikrein B, plasma (Fletcher factor) 1	243	Apple 3. {ECO:0000255|PROSITE- ProRule:PRU00315}.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|Factor XII activation (GO:0002542)|fibrinolysis (GO:0042730)|plasminogen activation (GO:0031639)|positive regulation of fibrinolysis (GO:0051919)|proteolysis (GO:0006508)|zymogen activation (GO:0031638)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	40		all_cancers(14;1.55e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.00664)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.29e-10)|BRCA - Breast invasive adenocarcinoma(30;3.8e-05)|GBM - Glioblastoma multiforme(59;0.000131)|STAD - Stomach adenocarcinoma(60;0.000292)|LUSC - Lung squamous cell carcinoma(40;0.00241)|READ - Rectum adenocarcinoma(43;0.168)		TTTACATTCTATACAAATGTA	0.468																																																	0								ENSG00000164344						157.0	139.0	145.0					4																	187171526		2203	4300	6503	KLKB1	SO:0001583	missense	0			-	HGNC	M13143	CCDS34120.1	4q35	2008-02-05			ENSG00000164344	ENSG00000164344		"""Kallikreins"""	6371	protein-coding gene	gene with protein product		229000		KLK3		9535413, 3521732	Standard	XM_005262987		Approved		uc003iyy.3	P03952	OTTHUMG00000150347	ENST00000264690.6:c.728A>T	4.37:g.187171526A>T	ENSP00000264690:p.Tyr243Phe	Somatic	0	48	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	37	21.28	A6NH96|B2R8H9|Q17RE8|Q17RE9|Q4W5C3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_S1,pfam_PAN-1_domain,superfamily_Trypsin-like_Pept_dom,smart_Apple,smart_Peptidase_S1,pfscan_Pan_app,pfscan_Peptidase_S1,prints_Apple,prints_Peptidase_S1A	p.Y243F	ENST00000264690.6	37	c.728	CCDS34120.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	a|a	2.458|2.458	-0.324741|-0.324741	0.05350|0.05350	.|.	.|.	ENSG00000164344|ENSG00000164344	ENST00000511608|ENST00000264690;ENST00000513864;ENST00000418715	.|D;D	.|0.88818	.|-2.43;-2.43	5.06|5.06	5.06|5.06	0.68205|0.68205	.|Apple domain (3);PAN-1 domain (1);Apple-like (1);	.|0.101496	.|0.42964	.|D	.|0.000625	D|D	0.85553|0.85553	0.5723|0.5723	N|N	0.25201|0.25201	0.72|0.72	0.27508|0.27508	N|N	0.951761|0.951761	.|D;P	.|0.57571	.|0.98;0.944	.|P;P	.|0.59357	.|0.856;0.652	T|T	0.75311|0.75311	-0.3362|-0.3362	5|10	.|0.02654	.|T	.|1	.|.	10.9114|10.9114	0.47110|0.47110	0.851:0.0:0.0:0.149|0.851:0.0:0.0:0.149	.|.	.|205;243	.|E7EQA8;P03952	.|.;KLKB1_HUMAN	L|F	291|243;243;205	.|ENSP00000264690:Y243F;ENSP00000424469:Y243F	.|ENSP00000264690:Y243F	I|Y	+|+	1|2	0|0	KLKB1|KLKB1	187408520|187408520	0.967000|0.967000	0.33354|0.33354	0.725000|0.725000	0.30721|0.30721	0.013000|0.013000	0.08279|0.08279	2.917000|2.917000	0.48821|0.48821	2.127000|2.127000	0.65507|0.65507	0.449000|0.449000	0.29647|0.29647	ATA|TAT	-	pfam_PAN-1_domain,smart_Apple,pfscan_Pan_app,prints_Apple		0.468	KLKB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLKB1	protein_coding	OTTHUMT00000317732.1	A	NM_000892	-		187171526	+1	no_errors	ENST00000264690	ensembl	human	known	74_37	missense	SNP	0.929	T
ACPP	55	genome.wustl.edu	37	3	132075691	132075691	+	Missense_Mutation	SNP	G	G	T			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr3:132075691G>T	ENST00000336375.5	+	10	1220	c.1130G>T	c.(1129-1131)aGc>aTc	p.S377I	ACPP_ENST00000475741.1_Missense_Mutation_p.S344I|ACPP_ENST00000351273.7_Missense_Mutation_p.S377I	NM_001099.4	NP_001090.2	P15309	PPAP_HUMAN	acid phosphatase, prostate	377					adenosine metabolic process (GO:0046085)|dephosphorylation (GO:0016311)|nucleotide metabolic process (GO:0009117)|positive regulation of adenosine receptor signaling pathway (GO:0060168)|purine nucleobase metabolic process (GO:0006144)|regulation of sensory perception of pain (GO:0051930)|thiamine metabolic process (GO:0006772)	apical part of cell (GO:0045177)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|Golgi cisterna (GO:0031985)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|lysosomal membrane (GO:0005765)|multivesicular body (GO:0005771)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|vesicle membrane (GO:0012506)	5'-nucleotidase activity (GO:0008253)|acid phosphatase activity (GO:0003993)|choline binding (GO:0033265)|identical protein binding (GO:0042802)|lysophosphatidic acid phosphatase activity (GO:0052642)|phosphatase activity (GO:0016791)|thiamine phosphate phosphatase activity (GO:0042131)			NS(1)|breast(1)|endometrium(2)|large_intestine(5)|lung(13)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	27						ACCACAAACAGCCATCAAGGT	0.522																																																	0								ENSG00000014257						133.0	116.0	122.0					3																	132075691		2203	4300	6503	ACPP	SO:0001583	missense	0			-	HGNC		CCDS3073.1, CCDS46916.1	3q22.1	2012-05-16			ENSG00000014257	ENSG00000014257	3.1.3.2		125	protein-coding gene	gene with protein product		171790					Standard	NM_001099		Approved	ACP3, ACP-3	uc003eop.4	P15309	OTTHUMG00000159650	ENST00000336375.5:c.1130G>T	3.37:g.132075691G>T	ENSP00000337471:p.Ser377Ile	Somatic	0	22	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	23	14.81	D3DNC6|Q5FBY0|Q96KY0|Q96QK9|Q96QM0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_His_Pase_superF_clade-2	p.S377I	ENST00000336375.5	37	c.1130	CCDS3073.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.78|16.78	3.217116|3.217116	0.58560|0.58560	.|.	.|.	ENSG00000014257|ENSG00000014257	ENST00000507647|ENST00000336375;ENST00000475741;ENST00000351273	.|T;T;T	.|0.08546	.|3.08;3.08;3.2	5.67|5.67	-5.11|-5.11	0.02901|0.02901	.|.	.|1.587520	.|0.02849	.|N	.|0.128866	T|T	0.09113|0.09113	0.0225|0.0225	L|L	0.52573|0.52573	1.65|1.65	0.09310|0.09310	N|N	1|1	.|B;B;B	.|0.32731	.|0.25;0.365;0.382	.|B;B;B	.|0.34301	.|0.087;0.179;0.087	T|T	0.35001|0.35001	-0.9806|-0.9806	5|10	.|0.40728	.|T	.|0.16	.|.	6.9424|6.9424	0.24500|0.24500	0.2872:0.2714:0.4414:0.0|0.2872:0.2714:0.4414:0.0	.|.	.|377;377;344	.|P15309;P15309-2;Q5FBY0	.|PPAP_HUMAN;.;.	S|I	62|377;344;377	.|ENSP00000337471:S377I;ENSP00000417744:S344I;ENSP00000323036:S377I	.|ENSP00000337471:S377I	A|S	+|+	1|2	0|0	ACPP|ACPP	133558381|133558381	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.119000|0.119000	0.20118|0.20118	-0.638000|-0.638000	0.05452|0.05452	-0.786000|-0.786000	0.04516|0.04516	-0.302000|-0.302000	0.09304|0.09304	GCC|AGC	-	NULL		0.522	ACPP-001	KNOWN	basic|CCDS	protein_coding	ACPP	protein_coding	OTTHUMT00000356699.2	G	NM_001099	-		132075691	+1	no_errors	ENST00000351273	ensembl	human	known	74_37	missense	SNP	0.000	T
UNC93A	54346	genome.wustl.edu	37	6	167728838	167728838	+	Silent	SNP	G	G	T	rs148062483	byFrequency	TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr6:167728838G>T	ENST00000230256.3	+	8	1447	c.1272G>T	c.(1270-1272)gcG>gcT	p.A424A	UNC93A_ENST00000366829.2_Silent_p.A382A	NM_018974.3	NP_061847.2	Q86WB7	UN93A_HUMAN	unc-93 homolog A (C. elegans)	424						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.A424A(1)		breast(2)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(20)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	40		Breast(66;7.62e-05)|Ovarian(120;0.105)		OV - Ovarian serous cystadenocarcinoma(33;2.22e-20)|BRCA - Breast invasive adenocarcinoma(81;6.17e-07)|GBM - Glioblastoma multiforme(31;0.00492)		CCATGGTGGCGTATGGGCTTG	0.547																																																	1	Substitution - coding silent(1)	large_intestine(1)						ENSG00000112494						212.0	234.0	227.0					6																	167728838		2203	4300	6503	UNC93A	SO:0001819	synonymous_variant	0			-	HGNC	AJ508812	CCDS5300.1, CCDS47515.1	6q27	2014-05-16	2001-11-28		ENSG00000112494	ENSG00000112494			12570	protein-coding gene	gene with protein product		607995	"""unc93 (C.elegans) homolog A"""			12381271	Standard	NM_001143947		Approved	dJ366N23.2, dJ366N23.1	uc003qvq.3	Q86WB7	OTTHUMG00000016021	ENST00000230256.3:c.1272G>T	6.37:g.167728838G>T		Somatic	0	79	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	77	22.22	B3KRP5|Q4QQJ4|Q5JZD6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_channel_UNC-93,superfamily_MFS_dom_general_subst_transpt	p.A424	ENST00000230256.3	37	c.1272	CCDS5300.1	6																																																																																			-	superfamily_MFS_dom_general_subst_transpt		0.547	UNC93A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UNC93A	protein_coding	OTTHUMT00000043125.2	G	NM_018974	-		167728838	+1	no_errors	ENST00000230256	ensembl	human	known	74_37	silent	SNP	0.000	T
THAP5	168451	genome.wustl.edu	37	7	108205136	108205136	+	Silent	SNP	G	G	A			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr7:108205136G>A	ENST00000415914.3	-	3	840	c.687C>T	c.(685-687)acC>acT	p.T229T	THAP5_ENST00000438865.1_3'UTR|THAP5_ENST00000493722.1_5'UTR|THAP5_ENST00000313516.5_Silent_p.T187T	NM_001130475.1	NP_001123947.1	Q7Z6K1	THAP5_HUMAN	THAP domain containing 5	229					cell cycle (GO:0007049)|negative regulation of cell cycle (GO:0045786)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protease binding (GO:0002020)			central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(2)|skin(1)	8						CAAGATGACTGGTAGTTACTT	0.313																																																	0								ENSG00000177683						54.0	56.0	56.0					7																	108205136		2202	4298	6500	THAP5	SO:0001819	synonymous_variant	0			-	HGNC	AL833137	CCDS34734.2, CCDS47687.1	7q22.3	2013-01-25			ENSG00000177683	ENSG00000177683		"""THAP (C2CH-type zinc finger) domain containing"""	23188	protein-coding gene	gene with protein product		612534				12575992	Standard	NM_001287598		Approved	DKFZp313O1132	uc003vfm.3	Q7Z6K1	OTTHUMG00000154951	ENST00000415914.3:c.687C>T	7.37:g.108205136G>A		Somatic	0	39	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	29	9.38		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2CH,smart_Znf_C2CH,pfscan_Znf_C2CH	p.T229	ENST00000415914.3	37	c.687	CCDS47687.1	7																																																																																			-	NULL		0.313	THAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THAP5	protein_coding	OTTHUMT00000337777.2	G	NM_182529	-		108205136	-1	no_errors	ENST00000415914	ensembl	human	known	74_37	silent	SNP	0.014	A
MACF1	23499	genome.wustl.edu	37	1	39798401	39798401	+	Silent	SNP	G	G	A			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr1:39798401G>A	ENST00000372915.3	+	36	6243	c.6156G>A	c.(6154-6156)caG>caA	p.Q2052Q	MACF1_ENST00000361689.2_Intron|MACF1_ENST00000289893.4_Silent_p.Q487Q|MACF1_ENST00000564288.1_Silent_p.Q2047Q|MACF1_ENST00000539005.1_Intron|MACF1_ENST00000545844.1_Intron|MACF1_ENST00000317713.7_Intron|MACF1_ENST00000567887.1_Silent_p.Q2084Q|MACF1_ENST00000476350.1_Intron			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	2052					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			TTTCTTCTCAGAACAAAGAAT	0.438																																																	0								ENSG00000127603						70.0	73.0	72.0					1																	39798401		2203	4300	6503	MACF1	SO:0001819	synonymous_variant	0			-	HGNC	AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.6156G>A	1.37:g.39798401G>A		Somatic	0	13	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	5	54.55	B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Spectrin_repeat,pfam_Plectin_repeat,pfam_CH-domain,pfam_GAS2_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_GAS2_dom,superfamily_RNaseH-like_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,smart_EF_hand_dom,smart_GAS2_dom,pfscan_CH-domain,pfscan_EF_hand_dom	p.Q2084	ENST00000372915.3	37	c.6252		1																																																																																			-	superfamily_RNaseH-like_dom		0.438	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	MACF1	protein_coding	OTTHUMT00000392096.1	G	NM_033044	-		39798401	+1	no_errors	ENST00000567887	ensembl	human	putative	74_37	silent	SNP	0.003	A
BARD1	580	genome.wustl.edu	37	2	215645861	215645861	+	Frame_Shift_Del	DEL	G	G	-	rs151325889		TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr2:215645861delG	ENST00000260947.4	-	4	871	c.737delC	c.(736-738)ccafs	p.P246fs	BARD1_ENST00000471787.1_5'UTR|BARD1_ENST00000449967.2_Frame_Shift_Del_p.P102fs	NM_000465.2|NM_001282543.1|NM_001282545.1|NM_001282548.1	NP_000456.2|NP_001269472.1|NP_001269474.1|NP_001269477.1	Q99728	BARD1_HUMAN	BRCA1 associated RING domain 1	246					cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|negative regulation of apoptotic process (GO:0043066)|negative regulation of mRNA 3'-end processing (GO:0031441)|negative regulation of protein export from nucleus (GO:0046826)|positive regulation of apoptotic process (GO:0043065)|positive regulation of protein catabolic process (GO:0045732)|protein K6-linked ubiquitination (GO:0085020)|protein ubiquitination (GO:0016567)|regulation of phosphorylation (GO:0042325)|tissue homeostasis (GO:0001894)	BRCA1-A complex (GO:0070531)|BRCA1-BARD1 complex (GO:0031436)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	kinase binding (GO:0019900)|ligase activity (GO:0016874)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(2)|breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(14)|prostate(4)|upper_aerodigestive_tract(1)	35		Renal(323;0.0243)		Epithelial(149;3.2e-06)|all cancers(144;0.000461)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		GATAACAGATGGTTGGCTACA	0.383									Neuroblastoma, Familial Clustering of;Congenital Central Hypoventilation Syndrome																																								0								ENSG00000138376						64.0	66.0	65.0					2																	215645861		2203	4299	6502	BARD1	SO:0001589	frameshift_variant	0	Familial Cancer Database	Familial Neuroblastoma;CCHS, Ondine Curse, incl. Ondine-Hirschsprung Disease		HGNC		CCDS2397.1, CCDS74645.1, CCDS74646.1, CCDS74647.1, CCDS74648.1	2q34-q35	2013-01-10			ENSG00000138376	ENSG00000138376		"""Ankyrin repeat domain containing"""	952	protein-coding gene	gene with protein product		601593				8944023, 9425226, 15159397	Standard	NM_001282548		Approved		uc002veu.2	Q99728	OTTHUMG00000133016	ENST00000260947.4:c.737delC	2.37:g.215645861delG	ENSP00000260947:p.Pro246fs	Somatic	0	39	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	11	15.38	F6MDH7|F6MDH8|F6MDH9|O43574|Q53SS5	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Ankyrin_rpt,pfam_BRCT_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_BRCT_dom,smart_Ankyrin_rpt,smart_BRCT_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_BRCT_dom,pfscan_Znf_RING,prints_Ankyrin_rpt	p.P246fs	ENST00000260947.4	37	c.737	CCDS2397.1	2																																																																																			-	NULL		0.383	BARD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BARD1	protein_coding	OTTHUMT00000256602.1	G	NM_000465			215645861	-1	no_errors	ENST00000260947	ensembl	human	known	74_37	frame_shift_del	DEL	0.001	-
ZAN	7455	genome.wustl.edu	37	7	100344302	100344302	+	RNA	SNP	T	T	C			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr7:100344302T>C	ENST00000348028.3	+	0	1073				ZAN_ENST00000427578.1_RNA|ZAN_ENST00000421100.1_RNA|ZAN_ENST00000449052.1_RNA|ZAN_ENST00000538115.1_RNA|ZAN_ENST00000443370.1_RNA|ZAN_ENST00000349350.6_RNA|ZAN_ENST00000546292.1_RNA|ZAN_ENST00000542585.1_RNA|ZAN_ENST00000546213.1_RNA			Q9Y493	ZAN_HUMAN	zonadhesin (gene/pseudogene)						binding of sperm to zona pellucida (GO:0007339)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(2)|breast(3)|central_nervous_system(3)|endometrium(21)|kidney(6)|large_intestine(18)|lung(60)|ovary(4)|pancreas(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)	139	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			GGTGCAGCCCTCCACATTTAT	0.562																																																	0								ENSG00000146839						132.0	135.0	134.0					7																	100344302		1938	4149	6087	ZAN			0			-	HGNC	U83191		7q22.1	2013-10-10	2013-10-10		ENSG00000146839	ENSG00000146839			12857	protein-coding gene	gene with protein product		602372	"""zonadhesin"""			9799793, 17033959	Standard	NM_003386		Approved		uc003uwk.3	Q9Y493	OTTHUMG00000157037		7.37:g.100344302T>C		Somatic	0	33	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	9	64.00	A0FKC8|D6W5W4|O00218|Q96L85|Q96L86|Q96L87|Q96L88|Q96L89|Q96L90|Q9BXN9|Q9BZ83|Q9BZ84|Q9BZ85|Q9BZ86|Q9BZ87|Q9BZ88	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_VWF_type-D,pfam_MAM_dom,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_ConA-like_lec_gl_sf,superfamily_TIL_dom,smart_MAM_dom,smart_VWC_out,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_MAM_dom	p.L303P	ENST00000348028.3	37	c.908		7	.	.	.	.	.	.	.	.	.	.	T	18.34	3.601550	0.66445	.	.	ENSG00000146839	ENST00000546292;ENST00000538115;ENST00000542585	T;T;T	0.08370	3.1;3.1;3.1	4.88	4.88	0.63580	Concanavalin A-like lectin/glucanase (1);MAM domain (3);	0.210314	0.24126	N	0.041305	T	0.34716	0.0907	M	0.90870	3.155	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.79108	0.986;0.992	T	0.33085	-0.9882	10	0.87932	D	0	.	11.4571	0.50189	0.0:0.0:0.0:1.0	.	303;303	F5H0T8;Q9Y493	.;ZAN_HUMAN	P	303	ENSP00000445943:L303P;ENSP00000445091:L303P;ENSP00000444427:L303P	ENSP00000423579:L303P	L	+	2	0	ZAN	100182238	0.074000	0.21230	0.026000	0.17262	0.257000	0.26127	3.487000	0.53222	2.130000	0.65690	0.528000	0.53228	CTC	-	pfam_MAM_dom,superfamily_ConA-like_lec_gl_sf,smart_MAM_dom,pfscan_MAM_dom		0.562	ZAN-006	KNOWN	basic	polymorphic_pseudogene	ZAN	polymorphic_pseudogene	OTTHUMT00000347214.1	T	NM_003386	-		100344302	+1	no_errors	ENST00000546292	ensembl	human	known	74_37	missense	SNP	0.089	C
TSHZ3	57616	genome.wustl.edu	37	19	31769390	31769390	+	Silent	SNP	G	G	A			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr19:31769390G>A	ENST00000240587.4	-	2	1636	c.1309C>T	c.(1309-1311)Ctg>Ttg	p.L437L		NM_020856.2	NP_065907.2	Q63HK5	TSH3_HUMAN	teashirt zinc finger homeobox 3	437					in utero embryonic development (GO:0001701)|kidney morphogenesis (GO:0060993)|kidney smooth muscle cell differentiation (GO:0072195)|lung development (GO:0030324)|metanephros development (GO:0001656)|musculoskeletal movement (GO:0050881)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of smooth muscle cell differentiation (GO:0051152)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|sensory perception of touch (GO:0050975)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)|ureteric peristalsis (GO:0072105)	growth cone (GO:0030426)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(15)|kidney(9)|large_intestine(20)|lung(60)|ovary(4)|pancreas(2)|prostate(4)|skin(5)	123	Esophageal squamous(110;0.226)					TCATCCAGCAGGGTTGTGATG	0.557																																																	0								ENSG00000121297						112.0	108.0	109.0					19																	31769390		2203	4300	6503	TSHZ3	SO:0001819	synonymous_variant	0			-	HGNC	AL136805	CCDS12421.2	19q13.11	2013-11-20	2007-07-16	2006-03-14	ENSG00000121297	ENSG00000121297		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	30700	protein-coding gene	gene with protein product	"""teashirt 3"""	614119	"""zinc finger protein 537"", ""teashirt family zinc finger 3"""	ZNF537			Standard	NM_020856		Approved	KIAA1474, TSH3	uc002nsy.4	Q63HK5	OTTHUMG00000150184	ENST00000240587.4:c.1309C>T	19.37:g.31769390G>A		Somatic	0	40	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	24	29.41	Q9H0G6|Q9P254	Silent	SNP	NA	NA	NA	NA	NA	NA	superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Znf_C2H2	p.L437	ENST00000240587.4	37	c.1309	CCDS12421.2	19																																																																																			-	NULL		0.557	TSHZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSHZ3	protein_coding	OTTHUMT00000316743.2	G	NM_020856	-		31769390	-1	no_errors	ENST00000240587	ensembl	human	known	74_37	silent	SNP	0.954	A
PDPR	55066	genome.wustl.edu	37	16	70154480	70154480	+	Missense_Mutation	SNP	A	A	G	rs587776506|rs200469748	byFrequency	TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr16:70154480A>G	ENST00000288050.4	+	3	1042	c.85A>G	c.(85-87)Acg>Gcg	p.T29A	PDPR_ENST00000568530.1_Missense_Mutation_p.T29A|PDPR_ENST00000398122.3_Intron	NM_017990.3	NP_060460.4	Q8NCN5	PDPR_HUMAN	pyruvate dehydrogenase phosphatase regulatory subunit	29				T -> A (in Ref. 3; CAH10555). {ECO:0000305}.	cellular metabolic process (GO:0044237)|glycine catabolic process (GO:0006546)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)	aminomethyltransferase activity (GO:0004047)|oxidoreductase activity (GO:0016491)	p.T29A(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(17)|skin(2)|stomach(3)	33				BRCA - Breast invasive adenocarcinoma(221;0.124)		AAGAAACAGCACGTCAGCTGC	0.572																																																	1	Substitution - Missense(1)	central_nervous_system(1)						ENSG00000090857						51.0	53.0	52.0					16																	70154480		2117	4237	6354	PDPR	SO:0001583	missense	0			-	HGNC		CCDS45520.1	16q22.1	2010-08-24			ENSG00000090857	ENSG00000090857			30264	protein-coding gene	gene with protein product						9395502	Standard	NM_017990		Approved	PDP3	uc002eyf.1	Q8NCN5		ENST00000288050.4:c.85A>G	16.37:g.70154480A>G	ENSP00000288050:p.Thr29Ala	Somatic	0	28	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	33	19.51	A7E298|A8K8Y7|B3KSE1|Q6AI20|Q6AWC9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_FAD-dep_OxRdtase,pfam_GCV_T_N,pfam_GCV_T_C,pfam_FAD_bind_dom	p.T29A	ENST00000288050.4	37	c.85	CCDS45520.1	16	.	.	.	.	.	.	.	.	.	.	G	1.592	-0.528814	0.04112	.	.	ENSG00000090857	ENST00000288050	T	0.69435	-0.4	4.13	-5.16	0.02857	.	1.037440	0.07658	N	0.933150	T	0.37320	0.0999	N	0.14661	0.345	0.09310	N	0.999999	B	0.02656	0.0	B	0.01281	0.0	T	0.34378	-0.9831	10	0.06494	T	0.89	.	5.1635	0.15073	0.443:0.0:0.2448:0.3121	.	29	Q8NCN5	PDPR_HUMAN	A	29	ENSP00000288050:T29A	ENSP00000288050:T29A	T	+	1	0	PDPR	68711981	0.000000	0.05858	0.000000	0.03702	0.027000	0.11550	-0.944000	0.03913	-0.959000	0.03618	-0.318000	0.08688	ACG	-	NULL		0.572	PDPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDPR	protein_coding	OTTHUMT00000434502.1	A	NM_017990	rs200469748		70154480	+1	no_errors	ENST00000288050	ensembl	human	known	74_37	missense	SNP	0.000	G
WDHD1	11169	genome.wustl.edu	37	14	55480246	55480246	+	Missense_Mutation	SNP	T	T	A			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr14:55480246T>A	ENST00000360586.3	-	3	211	c.146A>T	c.(145-147)aAg>aTg	p.K49M	WDHD1_ENST00000420358.2_De_novo_Start_InFrame|WDHD1_ENST00000421192.1_De_novo_Start_InFrame	NM_007086.3	NP_009017.1	O75717	WDHD1_HUMAN	WD repeat and HMG-box DNA binding protein 1	49					heterochromatin maintenance (GO:0070829)|regulation of chromosome organization (GO:0033044)|RNA processing (GO:0006396)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|RNA binding (GO:0003723)			breast(3)|endometrium(4)|kidney(3)|large_intestine(9)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|urinary_tract(2)	42						ATTAATGAACTTAGGATCATC	0.338																																																	0								ENSG00000198554						169.0	144.0	153.0					14																	55480246		2203	4300	6503	WDHD1	SO:0001583	missense	0			-	HGNC	AJ006266	CCDS9721.1, CCDS41955.1	14q22.2	2013-01-09			ENSG00000198554	ENSG00000198554		"""WD repeat domain containing"""	23170	protein-coding gene	gene with protein product	"""CTF4, chromosome transmission fidelity factor 4 homolog (S. cerevisiae)"""	608126				9175701, 20028748	Standard	NM_007086		Approved	AND-1, CTF4, CHTF4	uc001xbm.2	O75717	OTTHUMG00000140304	ENST00000360586.3:c.146A>T	14.37:g.55480246T>A	ENSP00000353793:p.Lys49Met	Somatic	0	29	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	9	43.75	C9JW18|F6W0U7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,pfam_DUF3639,pfam_TIF_beta_prop-like,superfamily_WD40_repeat_dom,superfamily_HMG_box_dom,smart_WD40_repeat,smart_HMG_box_dom,pfscan_HMG_box_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.K49M	ENST00000360586.3	37	c.146	CCDS9721.1	14	.	.	.	.	.	.	.	.	.	.	T	21.6	4.176622	0.78564	.	.	ENSG00000198554	ENST00000360586;ENST00000455555	T;D	0.81499	4.9;-1.5	5.84	5.84	0.93424	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.88618	0.6485	M	0.70595	2.14	0.80722	D	1	D	0.76494	0.999	D	0.69479	0.964	D	0.89193	0.3552	10	0.56958	D	0.05	.	16.2129	0.82178	0.0:0.0:0.0:1.0	.	49	O75717	WDHD1_HUMAN	M	49	ENSP00000353793:K49M;ENSP00000413435:K49M	ENSP00000353793:K49M	K	-	2	0	WDHD1	54549996	1.000000	0.71417	1.000000	0.80357	0.756000	0.42949	4.600000	0.61083	2.220000	0.72140	0.482000	0.46254	AAG	-	superfamily_WD40_repeat_dom,pfscan_WD40_repeat_dom		0.338	WDHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDHD1	protein_coding	OTTHUMT00000276897.2	T	NM_007086	-		55480246	-1	no_errors	ENST00000360586	ensembl	human	known	74_37	missense	SNP	1.000	A
INPP5D	3635	genome.wustl.edu	37	2	234106746	234106746	+	Missense_Mutation	SNP	C	C	T			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr2:234106746C>T	ENST00000359570.5	+	27	2663	c.2663C>T	c.(2662-2664)cCt>cTt	p.P888L	INPP5D_ENST00000450745.1_Missense_Mutation_p.P652L|INPP5D_ENST00000455936.2_Missense_Mutation_p.P652L			Q92835	SHIP1_HUMAN	inositol polyphosphate-5-phosphatase, 145kDa	900					apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|determination of adult lifespan (GO:0008340)|immunoglobulin mediated immune response (GO:0016064)|inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of bone resorption (GO:0045779)|negative regulation of immune response (GO:0050777)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of monocyte differentiation (GO:0045656)|negative regulation of neutrophil differentiation (GO:0045659)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of signal transduction (GO:0009968)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of apoptotic process (GO:0043065)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of erythrocyte differentiation (GO:0045648)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)	cytosol (GO:0005829)|membrane (GO:0016020)	inositol-polyphosphate 5-phosphatase activity (GO:0004445)|phosphatidylinositol trisphosphate phosphatase activity (GO:0034594)			central_nervous_system(1)|ovary(1)	2		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0273)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0843)		Epithelial(121;1.16e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000479)|LUSC - Lung squamous cell carcinoma(224;0.00655)|Lung(119;0.00802)|GBM - Glioblastoma multiforme(43;0.0185)		TGCAGGGCCCCTCCGTGCAGT	0.597																																					NSCLC(82;1215 1426 16163 20348 41018)												0								ENSG00000168918						16.0	18.0	17.0					2																	234106746		2003	4159	6162	INPP5D	SO:0001583	missense	0			-	HGNC	U57650	CCDS74672.1	2q37.1	2013-02-14	2002-08-29		ENSG00000168918	ENSG00000168918		"""SH2 domain containing"""	6079	protein-coding gene	gene with protein product		601582	"""inositol polyphosphate-5-phosphatase, 145kD"""			8643691, 8874179	Standard	NM_001017915		Approved	SHIP, hp51CN	uc010zmp.2	Q92835	OTTHUMG00000133688	ENST00000359570.5:c.2663C>T	2.37:g.234106746C>T	ENSP00000352575:p.Pro888Leu	Somatic	0	43	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	16	19.05	O00145|Q13544|Q13545|Q6P5A4|Q92656|Q9UE80	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Endo/exonuclease/phosphatase,pfam_SH2,superfamily_Endo/exonuclease/phosphatase,smart_SH2,smart_IPPc,pfscan_SH2,prints_SH2	p.P888L	ENST00000359570.5	37	c.2663		2	.	.	.	.	.	.	.	.	.	.	C	9.854	1.194341	0.22037	.	.	ENSG00000168918	ENST00000359570;ENST00000450745;ENST00000455936;ENST00000435188;ENST00000415617;ENST00000445964;ENST00000417661	D;D;D;D;D;D	0.96365	-3.94;-3.99;-3.99;-3.99;-3.99;-3.99	5.02	3.1	0.35709	.	0.266379	0.37178	N	0.002207	D	0.90858	0.7128	.	.	.	0.20703	N	0.999864	P;P	0.41848	0.763;0.651	B;B	0.31101	0.124;0.086	D	0.85268	0.1054	9	0.52906	T	0.07	.	8.2606	0.31781	0.1527:0.7637:0.0:0.0836	.	899;900	Q92835-2;Q92835	.;SHIP1_HUMAN	L	888;652;652;521;521;521;22	ENSP00000352575:P888L;ENSP00000407916:P652L;ENSP00000404610:P652L;ENSP00000400151:P521L;ENSP00000397421:P521L;ENSP00000405338:P521L	ENSP00000352575:P888L	P	+	2	0	INPP5D	233771485	0.001000	0.12720	0.526000	0.27913	0.261000	0.26267	0.606000	0.24194	1.232000	0.43678	0.655000	0.94253	CCT	-	NULL		0.597	INPP5D-201	KNOWN	basic|appris_principal	protein_coding	INPP5D	protein_coding		C	NM_001017915	-		234106746	+1	no_errors	ENST00000359570	ensembl	human	known	74_37	missense	SNP	0.193	T
LOC100130331	100130331	genome.wustl.edu	37	1	238090602	238090607	+	RNA	DEL	GGGTCA	GGGTCA	-	rs398089991|rs80150242|rs78088310|rs386640842	byFrequency	TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	GGGTCA	GGGTCA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr1:238090602_238090607delGGGTCA	ENST00000450451.1	+	0	2108_2113					NR_027247.2																						TCTGGAGATGGGGTCAGGGTCACTCA	0.617														2264	0.452077	0.7284	0.3141	5008	,	,		21919	0.4355		0.2465	False		,,,				2504	0.4049																0								ENSG00000237250																																			RP11-193H5.1			0				Clone_based_vega_gene																													1.37:g.238090608_238090613delGGGTCA		Somatic	NA	NA	NA		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000450451.1	37	NULL		1																																																																																			-	-		0.617	RP11-193H5.1-001	KNOWN	basic	antisense	LOC100130331	antisense	OTTHUMT00000095477.1	GGGTCA				238090607	+1	no_errors	ENST00000450451	ensembl	human	known	74_37	rna	DEL	1.000:0.998:1.000:1.000:1.000:1.000	-
CDON	50937	genome.wustl.edu	37	11	125880373	125880373	+	Missense_Mutation	SNP	G	G	T			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr11:125880373G>T	ENST00000392693.3	-	8	1542	c.1415C>A	c.(1414-1416)cCt>cAt	p.P472H	CDON_ENST00000263577.7_Missense_Mutation_p.P472H	NM_001243597.1|NM_016952.4	NP_001230526.1|NP_058648.4	Q4KMG0	CDON_HUMAN	cell adhesion associated, oncogene regulated	472	Ig-like C2-type 5.				anterior/posterior pattern specification (GO:0009952)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cerebral cortex development (GO:0021987)|embryonic body morphogenesis (GO:0010172)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|lens development in camera-type eye (GO:0002088)|muscle cell differentiation (GO:0042692)|myoblast fusion (GO:0007520)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of protein heterodimerization activity (GO:0043497)|skeletal muscle satellite cell differentiation (GO:0014816)|smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(9)|ovary(3)|prostate(2)|skin(4)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	61	all_hematologic(175;0.177)	Breast(109;0.00157)|Lung NSC(97;0.0127)|all_lung(97;0.0133)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.51e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0604)		GAAGTACACAGGCTCCAGGTT	0.488																																																	0								ENSG00000064309						160.0	150.0	154.0					11																	125880373		2201	4299	6500	CDON	SO:0001583	missense	0			-	HGNC	AF004841	CCDS8468.1, CCDS58192.1	11q24.2	2013-02-11	2012-12-07		ENSG00000064309	ENSG00000064309		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	17104	protein-coding gene	gene with protein product	"""cell adhesion molecule-related/down-regulated by oncogenes"""	608707	"""Cdon homolog (mouse)"""			9214393	Standard	NM_016952		Approved	ORCAM, CDO, CDON1	uc009zbw.3	Q4KMG0	OTTHUMG00000165862	ENST00000392693.3:c.1415C>A	11.37:g.125880373G>T	ENSP00000376458:p.Pro472His	Somatic	0	51	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	40	9.09	O14631	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.P472H	ENST00000392693.3	37	c.1415	CCDS58192.1	11	.	.	.	.	.	.	.	.	.	.	G	13.23	2.175874	0.38413	.	.	ENSG00000064309	ENST00000392693;ENST00000263577	T;T	0.28454	1.61;1.61	5.48	5.48	0.80851	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.50627	D	0.000104	T	0.48960	0.1529	L	0.52573	1.65	0.34411	D	0.696403	D;D	0.76494	0.999;0.999	D;D	0.71656	0.974;0.952	T	0.61282	-0.7094	10	0.72032	D	0.01	-20.0433	14.4144	0.67139	0.0:0.1487:0.8513:0.0	.	472;472	Q4KMG0;Q4KMG0-2	CDON_HUMAN;.	H	472	ENSP00000376458:P472H;ENSP00000263577:P472H	ENSP00000263577:P472H	P	-	2	0	CDON	125385583	1.000000	0.71417	1.000000	0.80357	0.065000	0.16274	4.844000	0.62846	2.572000	0.86782	0.591000	0.81541	CCT	-	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.488	CDON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CDON	protein_coding	OTTHUMT00000386749.2	G	NM_016952	-		125880373	-1	no_errors	ENST00000392693	ensembl	human	known	74_37	missense	SNP	0.997	T
SDCBP	6386	genome.wustl.edu	37	8	59494256	59494256	+	Missense_Mutation	SNP	G	G	T	rs34911491		TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr8:59494256G>T	ENST00000260130.4	+	9	1004	c.854G>T	c.(853-855)aGc>aTc	p.S285I	SDCBP_ENST00000447182.2_Missense_Mutation_p.S284I|SDCBP_ENST00000422546.2_Missense_Mutation_p.S284I|SDCBP_ENST00000413219.2_Missense_Mutation_p.S285I|SDCBP_ENST00000447267.2_Missense_Mutation_p.S231I|SDCBP_ENST00000424270.2_Missense_Mutation_p.S279I|SDCBP_ENST00000520168.1_Missense_Mutation_p.S226I|SDCBP_ENST00000523483.1_Missense_Mutation_p.S305I	NM_001007068.1|NM_001007069.1|NM_005625.3	NP_001007069.1|NP_001007070.1|NP_005616.2	O00560	SDCB1_HUMAN	syndecan binding protein (syntenin)	285					actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|intracellular signal transduction (GO:0035556)|positive regulation of JNK cascade (GO:0046330)|positive regulation of phosphorylation (GO:0042327)|protein targeting to membrane (GO:0006612)|Ras protein signal transduction (GO:0007265)|substrate-dependent cell migration, cell extension (GO:0006930)|synaptic transmission (GO:0007268)	adherens junction (GO:0005912)|blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|interleukin-5 receptor complex (GO:0005895)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	cytoskeletal adaptor activity (GO:0008093)|frizzled binding (GO:0005109)|identical protein binding (GO:0042802)|interleukin-5 receptor binding (GO:0005137)|protein heterodimerization activity (GO:0046982)|protein N-terminus binding (GO:0047485)|syndecan binding (GO:0045545)			breast(1)|cervix(2)|kidney(1)|large_intestine(1)|lung(1)|skin(1)|urinary_tract(1)	8		all_lung(136;0.0271)|Lung NSC(129;0.0351)|all_epithelial(80;0.0554)				ATGGCACCAAGCATTATGAAA	0.383																																																	0								ENSG00000137575						134.0	119.0	124.0					8																	59494256		2203	4300	6503	SDCBP	SO:0001583	missense	0			-	HGNC	AF000652	CCDS6172.1, CCDS47862.1, CCDS47863.1	8q12.1	2012-12-04			ENSG00000137575	ENSG00000137575			10662	protein-coding gene	gene with protein product		602217				9391086	Standard	NM_001007067		Approved	SYCL	uc003xtq.3	O00560	OTTHUMG00000164303	ENST00000260130.4:c.854G>T	8.37:g.59494256G>T	ENSP00000260130:p.Ser285Ile	Somatic	0	19	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	15	16.67	B2R5Q7|B4DUH3|B7ZLN2|O00173|O43391|Q14CP2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.S285I	ENST00000260130.4	37	c.854	CCDS6172.1	8	.	.	.	.	.	.	.	.	.	.	G	20.2	3.947821	0.73787	.	.	ENSG00000137575	ENST00000260130;ENST00000422546;ENST00000447182;ENST00000413219;ENST00000424270;ENST00000523483;ENST00000520168;ENST00000447267	T;T;T;T;T;T;T;T	0.16597	2.33;2.33;2.33;2.33;2.33;2.33;2.33;2.33	5.78	4.89	0.63831	PDZ/DHR/GLGF (1);	0.042915	0.85682	D	0.000000	T	0.44767	0.1309	M	0.82716	2.605	0.54753	D	0.999989	B;D;D;D	0.58970	0.196;0.976;0.984;0.961	B;D;D;P	0.70716	0.072;0.937;0.97;0.897	T	0.34675	-0.9819	9	.	.	.	-17.1602	15.7647	0.78117	0.0684:0.0:0.9316:0.0	.	226;305;279;285	B4DHN5;G5EA09;O00560-3;O00560	.;.;.;SDCB1_HUMAN	I	285;284;284;285;279;305;226;231	ENSP00000260130:S285I;ENSP00000391687:S284I;ENSP00000409288:S284I;ENSP00000411771:S285I;ENSP00000395351:S279I;ENSP00000428184:S305I;ENSP00000430730:S226I;ENSP00000397820:S231I	.	S	+	2	0	SDCBP	59656810	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	4.953000	0.63624	2.894000	0.99253	0.591000	0.81541	AGC	-	superfamily_PDZ		0.383	SDCBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SDCBP	protein_coding	OTTHUMT00000378193.1	G	NM_005625	-		59494256	+1	no_errors	ENST00000260130	ensembl	human	known	74_37	missense	SNP	1.000	T
TACO1	51204	genome.wustl.edu	37	17	61681893	61681893	+	Splice_Site	SNP	G	G	T			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr17:61681893G>T	ENST00000258975.6	+	2	492		c.e2-1			NM_016360.3	NP_057444.2	Q9BSH4	TACO1_HUMAN	translational activator of mitochondrially encoded cytochrome c oxidase I						regulation of translation (GO:0006417)	mitochondrion (GO:0005739)|nucleus (GO:0005634)				breast(2)|endometrium(1)|lung(1)	4						TTAAATCTCAGAAGGAGGCCC	0.453																																																	0								ENSG00000136463						117.0	112.0	113.0					17																	61681893		2203	4300	6503	TACO1	SO:0001630	splice_region_variant	0			-	HGNC	BC005049	CCDS11640.1	17q23.3	2009-06-26	2009-06-26	2009-06-26		ENSG00000136463			24316	protein-coding gene	gene with protein product		612958	"""coiled-coil domain containing 44"""	CCDC44		19503089	Standard	NM_016360		Approved		uc002jbd.3	Q9BSH4		ENST00000258975.6:c.281-1G>T	17.37:g.61681893G>T		Somatic	0	17	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	11	26.67	B2RD21|Q8N3N6|Q9UI60	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e2-1	ENST00000258975.6	37	c.281-1	CCDS11640.1	17	.	.	.	.	.	.	.	.	.	.	G	18.62	3.664002	0.67700	.	.	ENSG00000136463	ENST00000258975	.	.	.	5.57	5.57	0.84162	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.0322	0.86464	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TACO1	59035625	1.000000	0.71417	1.000000	0.80357	0.733000	0.41908	7.882000	0.87258	2.626000	0.88956	0.603000	0.83216	.	-	-		0.453	TACO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TACO1	protein_coding	OTTHUMT00000443862.1	G	NM_016360	-	Intron	61681893	+1	no_errors	ENST00000258975	ensembl	human	known	74_37	splice_site	SNP	1.000	T
OTOP1	133060	genome.wustl.edu	37	4	4204225	4204229	+	Frame_Shift_Del	DEL	TTGAG	TTGAG	-	rs369956607		TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	TTGAG	TTGAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr4:4204225_4204229delTTGAG	ENST00000296358.4	-	4	700_704	c.676_680delCTCAA	c.(676-681)ctcaatfs	p.LN226fs		NM_177998.1	NP_819056.1	Q7RTM1	OTOP1_HUMAN	otopetrin 1	226					biomineral tissue development (GO:0031214)|detection of gravity (GO:0009590)|inner ear morphogenesis (GO:0042472)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)		p.L226fs*1(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|liver(4)|lung(14)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		CTTGTGCTCATTGAGTTGGTGCTTT	0.502																																																	1	Deletion - Frameshift(1)	liver(1)						ENSG00000163982																																			OTOP1	SO:0001589	frameshift_variant	0				HGNC	BK000653	CCDS3372.1	4p16.2	2008-02-05			ENSG00000163982	ENSG00000163982			19656	protein-coding gene	gene with protein product		607806				12651873	Standard	NM_177998		Approved		uc003ghp.1	Q7RTM1	OTTHUMG00000090301	ENST00000296358.4:c.676_680delCTCAA	4.37:g.4204225_4204229delTTGAG	ENSP00000296358:p.Leu226fs	Somatic	NA	NA	NA		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A1L476	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Otopetrin	p.L226fs	ENST00000296358.4	37	c.680_676	CCDS3372.1	4																																																																																			-	pfam_Otopetrin		0.502	OTOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OTOP1	protein_coding	OTTHUMT00000206661.2	TTGAG	NM_177998			4204229	-1	no_errors	ENST00000296358	ensembl	human	known	74_37	frame_shift_del	DEL	0.998:0.995:0.417:0.986:0.987	-
LEO1	123169	genome.wustl.edu	37	15	52258498	52258498	+	Missense_Mutation	SNP	A	A	G			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr15:52258498A>G	ENST00000299601.5	-	2	322	c.262T>C	c.(262-264)Tca>Cca	p.S88P	LEO1_ENST00000315141.5_Missense_Mutation_p.S88P	NM_138792.2	NP_620147.1	Q8WVC0	LEO1_HUMAN	Leo1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)	88	Asp-rich.				endodermal cell fate commitment (GO:0001711)|histone H2B ubiquitination (GO:0033523)|histone monoubiquitination (GO:0010390)|mRNA polyadenylation (GO:0006378)|negative regulation of myeloid cell differentiation (GO:0045638)|positive regulation of mRNA 3'-end processing (GO:0031442)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	Cdc73/Paf1 complex (GO:0016593)				endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(5)|skin(1)	14				all cancers(107;0.00264)		GAAGCTTCTGATCTATTGTCT	0.448																																					Esophageal Squamous(40;229 896 18505 32465 43844)|Ovarian(53;886 1123 14462 18432 23189)												0								ENSG00000166477						200.0	181.0	187.0					15																	52258498		2195	4293	6488	LEO1	SO:0001583	missense	0			-	HGNC	AY302186	CCDS10146.1, CCDS66767.1	15q21.2	2008-02-05			ENSG00000166477	ENSG00000166477			30401	protein-coding gene	gene with protein product		610507				15632063	Standard	NM_001286430		Approved		uc002abo.3	Q8WVC0	OTTHUMG00000131843	ENST00000299601.5:c.262T>C	15.37:g.52258498A>G	ENSP00000299601:p.Ser88Pro	Somatic	0	38	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	35	10.26	Q96N99	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Leo1	p.S88P	ENST00000299601.5	37	c.262	CCDS10146.1	15	.	.	.	.	.	.	.	.	.	.	A	22.0	4.235725	0.79800	.	.	ENSG00000166477	ENST00000299601;ENST00000538386;ENST00000315141	.	.	.	5.59	4.44	0.53790	.	0.199976	0.44688	D	0.000424	T	0.64472	0.2601	L	0.34521	1.04	0.80722	D	1	D;D	0.71674	0.971;0.998	P;D	0.75484	0.776;0.986	T	0.64483	-0.6397	9	0.52906	T	0.07	.	11.8043	0.52145	0.8684:0.0:0.0:0.1316	.	88;88	Q8WVC0-2;Q8WVC0	.;LEO1_HUMAN	P	88	.	ENSP00000299601:S88P	S	-	1	0	LEO1	50045790	1.000000	0.71417	0.961000	0.40146	0.926000	0.56050	7.243000	0.78219	0.908000	0.36671	0.533000	0.62120	TCA	-	NULL		0.448	LEO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LEO1	protein_coding	OTTHUMT00000254791.2	A	NM_138792	-		52258498	-1	no_errors	ENST00000299601	ensembl	human	known	74_37	missense	SNP	0.999	G
ATP10B	23120	genome.wustl.edu	37	5	159992826	159992826	+	Missense_Mutation	SNP	G	G	T			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr5:159992826G>T	ENST00000327245.5	-	26	4866	c.4020C>A	c.(4018-4020)gaC>gaA	p.D1340E		NM_025153.2	NP_079429.2	O94823	AT10B_HUMAN	ATPase, class V, type 10B	1340					phospholipid translocation (GO:0045332)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(37)|ovary(4)|pancreas(1)|prostate(5)|skin(3)|stomach(1)	75	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GGTTTCTTTTGTCTGGGGGGA	0.488																																																	0								ENSG00000118322						116.0	118.0	117.0					5																	159992826		1815	4081	5896	ATP10B	SO:0001583	missense	0			-	HGNC	AB018258	CCDS43394.1	5q34	2010-04-20	2007-09-19		ENSG00000118322	ENSG00000118322		"""ATPases / P-type"""	13543	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10B"""			9872452, 11015572	Standard	NM_025153		Approved	ATPVB, KIAA0715, FLJ21477	uc003lym.1	O94823	OTTHUMG00000163551	ENST00000327245.5:c.4020C>A	5.37:g.159992826G>T	ENSP00000313600:p.Asp1340Glu	Somatic	0	22	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	12	58.62	Q9H725	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ATPase_P-typ_transduc_dom_A,pfam_HAD-like_dom,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	p.D1340E	ENST00000327245.5	37	c.4020	CCDS43394.1	5	.	.	.	.	.	.	.	.	.	.	G	1.690	-0.504322	0.04261	.	.	ENSG00000118322	ENST00000327245	T	0.39406	1.08	5.65	1.48	0.22813	.	0.334767	0.29246	N	0.012711	T	0.18383	0.0441	N	0.11724	0.165	0.27240	N	0.959174	B	0.09022	0.002	B	0.04013	0.001	T	0.10823	-1.0613	9	.	.	.	.	4.076	0.09904	0.3171:0.1887:0.4943:0.0	.	1340	O94823	AT10B_HUMAN	E	1340	ENSP00000313600:D1340E	.	D	-	3	2	ATP10B	159925404	0.995000	0.38212	0.963000	0.40424	0.640000	0.38277	0.108000	0.15396	0.687000	0.31509	-0.365000	0.07479	GAC	-	NULL		0.488	ATP10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP10B	protein_coding	OTTHUMT00000374127.1	G	NM_025153	-		159992826	-1	no_errors	ENST00000327245	ensembl	human	known	74_37	missense	SNP	0.921	T
DPY19L1	23333	genome.wustl.edu	37	7	35006539	35006539	+	Silent	SNP	T	T	A			TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr7:35006539T>A	ENST00000310974.4	-	10	984	c.840A>T	c.(838-840)atA>atT	p.I280I	DPY19L1_ENST00000462134.2_5'UTR	NM_015283.1	NP_056098.1	Q2PZI1	D19L1_HUMAN	dpy-19-like 1 (C. elegans)	280						integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity, transferring glycosyl groups (GO:0016757)			endometrium(3)|kidney(5)|large_intestine(8)|lung(8)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(4)	31						GTAATTTACATATATCAATGT	0.244																																																	0								ENSG00000173852						43.0	39.0	40.0					7																	35006539		1784	4018	5802	DPY19L1	SO:0001819	synonymous_variant	0			-	HGNC	AB020684	CCDS43567.1	7p14.3-p14.2	2006-04-26			ENSG00000173852	ENSG00000173852			22205	protein-coding gene	gene with protein product		613892					Standard	NM_015283		Approved	KIAA0877	uc003tem.4	Q2PZI1	OTTHUMG00000154888	ENST00000310974.4:c.840A>T	7.37:g.35006539T>A		Somatic	0	41	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	35	10.26	O94954|Q4G151	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Dpy-19	p.I280	ENST00000310974.4	37	c.840	CCDS43567.1	7																																																																																			-	pfam_Dpy-19		0.244	DPY19L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPY19L1	protein_coding	OTTHUMT00000337506.1	T		-		35006539	-1	no_errors	ENST00000310974	ensembl	human	known	74_37	silent	SNP	0.993	A
DLC1	10395	genome.wustl.edu	37	8	12943086	12943087	+	3'UTR	DEL	TT	TT	-	rs60094700		TCGA-WK-A8XX-01A-11D-A37C-09	TCGA-WK-A8XX-10A-01D-A37F-09	TT	TT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde6b1fa-e014-4a04-ab32-1f035cc3ad88	385b779c-11ea-4519-a025-a0fb7f0f2fb6	g.chr8:12943086_12943087delTT	ENST00000276297.4	-	0	5229_5230				DLC1_ENST00000358919.2_3'UTR|DLC1_ENST00000512044.2_3'UTR|DLC1_ENST00000510318.1_5'UTR	NM_182643.2	NP_872584.2	Q96QB1	RHG07_HUMAN	DLC1 Rho GTPase activating protein						actin cytoskeleton organization (GO:0030036)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|focal adhesion assembly (GO:0048041)|forebrain development (GO:0030900)|heart morphogenesis (GO:0003007)|hindbrain morphogenesis (GO:0021575)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of stress fiber assembly (GO:0051497)|neural tube closure (GO:0001843)|positive regulation of execution phase of apoptosis (GO:1900119)|positive regulation of protein dephosphorylation (GO:0035307)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	lipid binding (GO:0008289)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)			NS(2)|breast(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(39)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	110						TACACataaatttttttttttt	0.297																																																	0								ENSG00000164741																																			DLC1	SO:0001624	3_prime_UTR_variant	0				HGNC	AF035119	CCDS5989.1, CCDS5990.1, CCDS5991.1, CCDS5991.2, CCDS55201.1	8p22	2014-06-20	2014-06-20		ENSG00000164741	ENSG00000164741		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	2897	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 12"""	604258	"""deleted in liver cancer 1"""			9605766, 11214970	Standard	NM_182643		Approved	HP, ARHGAP7, STARD12, DLC-1, p122-RhoGAP	uc003wwm.2	Q96QB1	OTTHUMG00000090825	ENST00000276297.4:c.*234AA>-	8.37:g.12943096_12943097delTT		Somatic	0	23	0.00		0.6142193720949689	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	23	11.54	B4DR10|B8PTI0|E9PDZ8|E9PF76|E9PGY9|O14868|O43199|Q7Z5R8|Q86UC6|Q9C0E0|Q9H7A2	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000276297.4	37	NULL	CCDS5989.1	8																																																																																			-	-		0.297	DLC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DLC1	protein_coding	OTTHUMT00000207632.2	TT	NM_182643, NM_006094			12943087	-1	no_errors	ENST00000510318	ensembl	human	known	74_37	rna	DEL	0.000:0.000	-
