#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
SLC26A10	65012	genome.wustl.edu	37	12	58019389	58019389	+	Missense_Mutation	SNP	G	G	T			TCGA-WK-A8XZ-01A-11D-A37C-09	TCGA-WK-A8XZ-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	82b3cc1e-5a9f-413a-bf84-f936bf806217	4f0633e4-1412-4a20-8b9c-0451a23d8b55	g.chr12:58019389G>T	ENST00000320442.4	+	14	1864	c.1553G>T	c.(1552-1554)cGg>cTg	p.R518L	SLC26A10_ENST00000490243.1_Intron|SLC26A10_ENST00000379218.2_3'UTR	NM_133489.2	NP_597996.2	Q8NG04	S2610_HUMAN	solute carrier family 26, member 10	518	STAS. {ECO:0000255|PROSITE- ProRule:PRU00198}.					integral component of membrane (GO:0016021)	antiporter activity (GO:0015297)|sulfate transmembrane transporter activity (GO:0015116)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(5)|large_intestine(4)|lung(7)	19	Melanoma(17;0.122)					ACACTGACCCGGGTAGGACTC	0.592																																																	0								ENSG00000135502						64.0	58.0	60.0					12																	58019389		2203	4300	6503	SLC26A10	SO:0001583	missense	0			-	HGNC		CCDS8949.2	12q13	2013-07-18			ENSG00000135502	ENSG00000135502		"""Solute carriers"""	14470	protein-coding gene	gene with protein product							Standard	NM_133489		Approved		uc001spe.3	Q8NG04	OTTHUMG00000128505	ENST00000320442.4:c.1553G>T	12.37:g.58019389G>T	ENSP00000320217:p.Arg518Leu	Somatic	0	53	0.00		0.5480226040680333	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	22	38.89	A6NMJ2|B6ZDQ3|Q6ZWI7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Sulph_transpt,pfam_STAS_dom,superfamily_STAS_dom,pfscan_STAS_dom	p.R518L	ENST00000320442.4	37	c.1553	CCDS8949.2	12	.	.	.	.	.	.	.	.	.	.	.	10.52	1.373855	0.24857	.	.	ENSG00000135502	ENST00000320442	D	0.88509	-2.39	4.62	1.47	0.22746	Sulphate transporter/antisigma-factor antagonist STAS (4);	.	.	.	.	T	0.74831	0.3768	N	0.20807	0.61	0.54753	D	0.999985	P	0.35468	0.503	B	0.29942	0.109	T	0.67019	-0.5776	9	0.66056	D	0.02	.	2.1838	0.03881	0.3312:0.0:0.4232:0.2456	.	518	Q8NG04	S2610_HUMAN	L	518	ENSP00000320217:R518L	ENSP00000320217:R518L	R	+	2	0	SLC26A10	56305656	0.987000	0.35691	0.843000	0.33291	0.276000	0.26787	1.188000	0.32102	0.179000	0.19938	0.557000	0.71058	CGG	-	pfam_STAS_dom,superfamily_STAS_dom,pfscan_STAS_dom		0.592	SLC26A10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC26A10	protein_coding	OTTHUMT00000250311.2	G		-		58019389	+1	no_errors	ENST00000320442	ensembl	human	known	74_37	missense	SNP	0.805	T
PMFBP1	83449	genome.wustl.edu	37	16	72162648	72162648	+	Silent	SNP	G	G	T			TCGA-WK-A8XZ-01A-11D-A37C-09	TCGA-WK-A8XZ-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	82b3cc1e-5a9f-413a-bf84-f936bf806217	4f0633e4-1412-4a20-8b9c-0451a23d8b55	g.chr16:72162648G>T	ENST00000237353.10	-	14	2257	c.1996C>A	c.(1996-1998)Cga>Aga	p.R666R	PMFBP1_ENST00000537465.1_Silent_p.R671R|PMFBP1_ENST00000355636.6_Silent_p.R521R	NM_031293.2	NP_112583.2	Q8TBY8	PMFBP_HUMAN	polyamine modulated factor 1 binding protein 1	671						cytoplasm (GO:0005737)				NS(1)|breast(3)|endometrium(1)|kidney(2)|large_intestine(7)|lung(25)|ovary(2)|skin(3)|urinary_tract(1)	45		Ovarian(137;0.179)				AGCTCTGCTCGGAGATTCTCA	0.408																																																	0								ENSG00000118557						162.0	146.0	152.0					16																	72162648		2198	4300	6498	PMFBP1	SO:0001819	synonymous_variant	0			-	HGNC	AF239683	CCDS32483.1	16q23.1	2008-08-04			ENSG00000118557	ENSG00000118557			17728	protein-coding gene	gene with protein product						11468771	Standard	NM_031293		Approved		uc002fcd.3	Q8TBY8	OTTHUMG00000167827	ENST00000237353.10:c.1996C>A	16.37:g.72162648G>T		Somatic	0	58	0.00		0.5480226040680333	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	27	9.38	B3KVI9|H7BY07|Q8NA09|Q9BY16|Q9H0H4	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.R671	ENST00000237353.10	37	c.2011	CCDS32483.1	16																																																																																			-	NULL		0.408	PMFBP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PMFBP1	protein_coding	OTTHUMT00000396473.2	G	NM_031293	-		72162648	-1	no_errors	ENST00000537465	ensembl	human	known	74_37	silent	SNP	0.043	T
UNC5B	219699	genome.wustl.edu	37	10	72975564	72975573	+	Intron	DEL	GTGTGTGTGT	GTGTGTGTGT	-	rs61070575|rs55848098|rs201949769|rs151276494|rs55906066|rs72091766|rs71924552		TCGA-WK-A8XZ-01A-11D-A37C-09	TCGA-WK-A8XZ-10A-01D-A37F-09	GTGTGTGTGT	GTGTGTGTGT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	82b3cc1e-5a9f-413a-bf84-f936bf806217	4f0633e4-1412-4a20-8b9c-0451a23d8b55	g.chr10:72975564_72975573delGTGTGTGTGT	ENST00000335350.6	+	1	495				UNC5B-AS1_ENST00000449737.1_RNA|AL359832.1_ENST00000401185.1_RNA|UNC5B_ENST00000373192.4_Intron|UNC5B-AS1_ENST00000447119.2_RNA	NM_170744.4	NP_734465.2	Q8IZJ1	UNC5B_HUMAN	unc-5 homolog B (C. elegans)						anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of apoptotic process (GO:0043065)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|prostate(4)|skin(4)	49						TCTCTGCTTGgtgtgtgtgtgtgtgtgtgt	0.481																																																	0								ENSG00000216004																																			AL359832.1	SO:0001627	intron_variant	0				Clone_based_ensembl_gene	AB096256	CCDS7309.1, CCDS58083.1	10q22.2	2013-01-11	2001-11-28		ENSG00000107731	ENSG00000107731		"""Immunoglobulin superfamily / I-set domain containing"""	12568	protein-coding gene	gene with protein product		607870	"""unc5 (C.elegans homolog) b"""				Standard	NM_170744		Approved	UNC5H2, p53RDL1	uc001jro.3	Q8IZJ1	OTTHUMG00000018422	ENST00000335350.6:c.79+2743GTGTGTGTGT>-	10.37:g.72975574_72975583delGTGTGTGTGT		Somatic	NA	NA	NA		0.5480226040680333	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q5T3R9|Q5T3S0|Q86SN3|Q8N1Y2|Q9H9F3	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000335350.6	37	NULL	CCDS7309.1	10																																																																																			-	-		0.481	UNC5B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000216004	protein_coding	OTTHUMT00000048541.1	GTGTGTGTGT	NM_170744			72975573	+1	no_errors	ENST00000401185	ensembl	human	novel	74_37	rna	DEL	0.024:0.453:0.476:0.522:0.594:0.095:0.090:0.011:0.001:0.001	-
ALOX12B	242	genome.wustl.edu	37	17	7984275	7984275	+	Missense_Mutation	SNP	C	C	A			TCGA-WK-A8XZ-01A-11D-A37C-09	TCGA-WK-A8XZ-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	82b3cc1e-5a9f-413a-bf84-f936bf806217	4f0633e4-1412-4a20-8b9c-0451a23d8b55	g.chr17:7984275C>A	ENST00000319144.4	-	4	714	c.454G>T	c.(454-456)Ggc>Tgc	p.G152C	ALOX12B_ENST00000577351.1_5'Flank|AC129492.6_ENST00000399413.3_3'UTR	NM_001139.2	NP_001130.1	O75342	LX12B_HUMAN	arachidonate 12-lipoxygenase, 12R type	152	Lipoxygenase. {ECO:0000255|PROSITE- ProRule:PRU00726}.				arachidonic acid metabolic process (GO:0019369)|ceramide biosynthetic process (GO:0046513)|establishment of skin barrier (GO:0061436)|hepoxilin biosynthetic process (GO:0051122)|linoleic acid metabolic process (GO:0043651)|lipoxygenase pathway (GO:0019372)|oxidation-reduction process (GO:0055114)|positive regulation of gene expression (GO:0010628)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mucus secretion (GO:0070257)|protein lipidation (GO:0006497)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	cytosol (GO:0005829)	arachidonate 12-lipoxygenase activity (GO:0004052)|iron ion binding (GO:0005506)|linoleate 9S-lipoxygenase activity (GO:1990136)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)			endometrium(5)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)|stomach(1)	16						CTGGGCAGGCCAGGAAGAAAG	0.647										Multiple Myeloma(8;0.094)																																							0								ENSG00000179477						70.0	65.0	66.0					17																	7984275		2203	4300	6503	ALOX12B	SO:0001583	missense	0			-	HGNC	AF038461	CCDS11129.1	17p13.1	2008-03-18			ENSG00000179477	ENSG00000179477	1.13.11.-	"""Arachidonate lipoxygenases"""	430	protein-coding gene	gene with protein product		603741				9618483	Standard	NM_001139		Approved	12R-LOX	uc002gjy.1	O75342	OTTHUMG00000108180	ENST00000319144.4:c.454G>T	17.37:g.7984275C>A	ENSP00000315167:p.Gly152Cys	Somatic	0	76	0.00		0.5480226040680333	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	7	69.57		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_LipOase_C,pfam_PLAT/LH2_dom,superfamily_LipOase_C,superfamily_Lipase_LipOase,smart_PLAT/LH2_dom,pfscan_PLAT/LH2_dom,prints_LipOase_C,prints_LipOase_mml	p.G152C	ENST00000319144.4	37	c.454	CCDS11129.1	17	.	.	.	.	.	.	.	.	.	.	C	15.97	2.990087	0.54041	.	.	ENSG00000179477	ENST00000319144	D	0.90732	-2.72	4.78	4.78	0.61160	Lipoxygenase, C-terminal (2);	0.154638	0.43579	D	0.000555	D	0.94185	0.8134	M	0.66939	2.045	0.41607	D	0.988885	D	0.89917	1.0	D	0.91635	0.999	D	0.94735	0.7913	10	0.87932	D	0	-25.5104	13.7238	0.62745	0.0:1.0:0.0:0.0	.	152	O75342	LX12B_HUMAN	C	152	ENSP00000315167:G152C	ENSP00000315167:G152C	G	-	1	0	ALOX12B	7925000	0.989000	0.36119	0.986000	0.45419	0.138000	0.21146	3.682000	0.54656	2.382000	0.81193	0.555000	0.69702	GGC	-	superfamily_LipOase_C,prints_LipOase_mml		0.647	ALOX12B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALOX12B	protein_coding	OTTHUMT00000226984.3	C		-		7984275	-1	no_errors	ENST00000319144	ensembl	human	known	74_37	missense	SNP	0.994	A
ANKRD20A1	84210	genome.wustl.edu	37	9	67925135	67925135	+	5'Flank	SNP	A	A	G			TCGA-WK-A8XZ-01A-11D-A37C-09	TCGA-WK-A8XZ-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	82b3cc1e-5a9f-413a-bf84-f936bf806217	4f0633e4-1412-4a20-8b9c-0451a23d8b55	g.chr9:67925135A>G	ENST00000377477.2	+	0	0				BX649567.1_ENST00000543078.1_Missense_Mutation_p.C26R	NM_032250.3	NP_115626.2	Q5TYW2	A20A1_HUMAN	ankyrin repeat domain 20 family, member A1							plasma membrane (GO:0005886)				kidney(1)|large_intestine(4)|lung(5)|urinary_tract(1)	11						GTCCTGGGACAATGCTGTGAG	0.587																																																	0								ENSG00000233434																																			BX649567.1	SO:0001631	upstream_gene_variant	0			-	Clone_based_ensembl_gene	AL136793	CCDS6620.1	9p12	2014-04-16	2005-08-23	2005-08-23	ENSG00000196774	ENSG00000260691		"""Ankyrin repeat domain containing"""	23665	protein-coding gene	gene with protein product			"""ankyrin repeat domain 20A"""	ANKRD20A			Standard	NM_032250		Approved	DKFZp434A171		Q5TYW2	OTTHUMG00000188594		9.37:g.67925135A>G	Exception_encountered	Somatic	0	13	0.00		0.5480226040680333	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	11	26.67	Q9H0H6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.C26R	ENST00000377477.2	37	c.76	CCDS6620.1	9																																																																																			-	NULL		0.587	ANKRD20A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000233434	protein_coding	OTTHUMT00000083800.1	A		-		67925135	-1	no_errors	ENST00000543078	ensembl	human	novel	74_37	missense	SNP	0.106	G
ASH1L	55870	genome.wustl.edu	37	1	155448260	155448260	+	Silent	SNP	G	G	A			TCGA-WK-A8XZ-01A-11D-A37C-09	TCGA-WK-A8XZ-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	82b3cc1e-5a9f-413a-bf84-f936bf806217	4f0633e4-1412-4a20-8b9c-0451a23d8b55	g.chr1:155448260G>A	ENST00000368346.3	-	3	5040	c.4401C>T	c.(4399-4401)ccC>ccT	p.P1467P	ASH1L_ENST00000392403.3_Silent_p.P1467P			Q9NR48	ASH1L_HUMAN	ash1 (absent, small, or homeotic)-like (Drosophila)	1467					cell-cell signaling (GO:0007267)|DNA packaging (GO:0006323)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|tight junction (GO:0005923)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(13)|large_intestine(28)|lung(39)|ovary(2)|pancreas(1)|prostate(6)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(4)	124	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			GAGGAACACTGGGGTAGGTAC	0.488																																																	0								ENSG00000116539						136.0	129.0	132.0					1																	155448260		2203	4300	6503	ASH1L	SO:0001819	synonymous_variant	0			-	HGNC	AB037841	CCDS1113.2	1q22	2013-01-28			ENSG00000116539	ENSG00000116539		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	19088	protein-coding gene	gene with protein product		607999				10860993, 16545939	Standard	NM_018489		Approved	huASH1, ASH1, ASH1L1, KMT2H	uc001fkt.3	Q9NR48	OTTHUMG00000014011	ENST00000368346.3:c.4401C>T	1.37:g.155448260G>A		Somatic	0	60	0.00		0.5480226040680333	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	42	28.33	Q59GP1|Q5T714|Q5T715|Q9P2C7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_SET_dom,pfam_BAH_dom,pfam_Bromodomain,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_AT_hook_DNA-bd_motif,smart_AWS,smart_SET_dom,smart_Bromodomain,smart_Znf_PHD,smart_BAH_dom,pfscan_AWS,pfscan_BAH_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Bromodomain	p.P1467	ENST00000368346.3	37	c.4401		1																																																																																			-	NULL		0.488	ASH1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	ASH1L	protein_coding	OTTHUMT00000039400.1	G	NM_018489	-		155448260	-1	no_errors	ENST00000368346	ensembl	human	known	74_37	silent	SNP	0.994	A
SAMM50	25813	genome.wustl.edu	37	22	44377307	44377307	+	Missense_Mutation	SNP	C	C	T			TCGA-WK-A8XZ-01A-11D-A37C-09	TCGA-WK-A8XZ-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	82b3cc1e-5a9f-413a-bf84-f936bf806217	4f0633e4-1412-4a20-8b9c-0451a23d8b55	g.chr22:44377307C>T	ENST00000350028.4	+	11	1130	c.973C>T	c.(973-975)Ccc>Tcc	p.P325S	SAMM50_ENST00000396202.3_Missense_Mutation_p.P115S	NM_015380.4	NP_056195.3	Q9Y512	SAM50_HUMAN	SAMM50 sorting and assembly machinery component	325					cellular protein metabolic process (GO:0044267)|protein import into mitochondrial outer membrane (GO:0045040)|protein targeting to mitochondrion (GO:0006626)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrial sorting and assembly machinery complex (GO:0001401)|mitochondrion (GO:0005739)				endometrium(3)|large_intestine(5)|liver(1)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	22		all_neural(38;0.0966)|Ovarian(80;0.105)|Glioma(61;0.222)				AATGTTGGTACCCATTGGTGA	0.388																																																	0								ENSG00000100347						215.0	191.0	199.0					22																	44377307		2203	4300	6503	SAMM50	SO:0001583	missense	0			-	HGNC	AK001087	CCDS14055.1	22q13.31	2013-08-21	2013-08-21	2005-11-20	ENSG00000100347	ENSG00000100347			24276	protein-coding gene	gene with protein product		612058	"""sorting and assembly machinery component 50 homolog (S. cerevisiae)"""			15644312	Standard	NM_015380		Approved	CGI-51, TRG-3, YNL026W, OMP85, TOB55	uc003bej.3	Q9Y512	OTTHUMG00000150557	ENST00000350028.4:c.973C>T	22.37:g.44377307C>T	ENSP00000345445:p.Pro325Ser	Somatic	0	70	0.00		0.5480226040680333	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	33	10.81	Q53HC4|Q56VW7|Q969Y9|Q96I46|Q9NW85|Q9UQM9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Bac_surfAg_D15	p.P325S	ENST00000350028.4	37	c.973	CCDS14055.1	22	.	.	.	.	.	.	.	.	.	.	C	14.89	2.669612	0.47677	.	.	ENSG00000100347	ENST00000350028;ENST00000396202	T;T	0.41065	1.01;1.01	4.95	4.95	0.65309	Bacterial surface antigen (D15) (1);	0.000000	0.85682	D	0.000000	T	0.40956	0.1138	L	0.54323	1.7	0.80722	D	1	B;B	0.32968	0.392;0.387	B;B	0.35859	0.173;0.212	T	0.19976	-1.0289	10	0.21014	T	0.42	-27.2941	15.7342	0.77831	0.0:1.0:0.0:0.0	.	130;325	B3KUE6;Q9Y512	.;SAM50_HUMAN	S	325;115	ENSP00000345445:P325S;ENSP00000379505:P115S	ENSP00000345445:P325S	P	+	1	0	SAMM50	42708640	1.000000	0.71417	0.983000	0.44433	0.514000	0.34195	4.664000	0.61540	2.458000	0.83093	0.557000	0.71058	CCC	-	pfam_Bac_surfAg_D15		0.388	SAMM50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAMM50	protein_coding	OTTHUMT00000318898.2	C	NM_015380	-		44377307	+1	no_errors	ENST00000350028	ensembl	human	known	74_37	missense	SNP	0.999	T
C9orf114	51490	genome.wustl.edu	37	9	131591119	131591120	+	Frame_Shift_Ins	INS	-	-	T	rs370087122		TCGA-WK-A8XZ-01A-11D-A37C-09	TCGA-WK-A8XZ-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	82b3cc1e-5a9f-413a-bf84-f936bf806217	4f0633e4-1412-4a20-8b9c-0451a23d8b55	g.chr9:131591119_131591120insT	ENST00000361256.5	-	3	142_143	c.102_103insA	c.(100-105)aaatggfs	p.W35fs		NM_016390.3	NP_057474.2	Q5T280	CI114_HUMAN	chromosome 9 open reading frame 114	35							poly(A) RNA binding (GO:0044822)			kidney(2)|large_intestine(4)|ovary(1)	7						AGATCCTTCCATTTTTTTTTCT	0.525																																																	0								ENSG00000198917																																			C9orf114	SO:0001589	frameshift_variant	0				HGNC		CCDS6913.1	9q34.11	2014-05-29			ENSG00000198917	ENSG00000198917			26933	protein-coding gene	gene with protein product	"""centromere protein 32"""					20813266	Standard	NM_016390		Approved	HSPC109, CENP-32	uc004bwd.3	Q5T280	OTTHUMG00000020762	ENST00000361256.5:c.103dupA	9.37:g.131591128_131591128dupT	ENSP00000354812:p.Trp35fs	Somatic	0	27	0.00		0.5480226040680333	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	20	9.09	Q0D2P6|Q6P469|Q6PGP9|Q6PIJ1|Q6PJV9	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_Put_MeTrfase,superfamily_NA-bd_OB-fold	p.W34fs	ENST00000361256.5	37	c.103_102	CCDS6913.1	9																																																																																			-	NULL		0.525	C9orf114-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf114	protein_coding	OTTHUMT00000054500.1	-	NM_016390			131591120	-1	no_errors	ENST00000361256	ensembl	human	known	74_37	frame_shift_ins	INS	1.000:0.998	T
TICAM1	148022	genome.wustl.edu	37	19	4817152	4817152	+	Missense_Mutation	SNP	C	C	A	rs372838204		TCGA-WK-A8XZ-01A-11D-A37C-09	TCGA-WK-A8XZ-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	82b3cc1e-5a9f-413a-bf84-f936bf806217	4f0633e4-1412-4a20-8b9c-0451a23d8b55	g.chr19:4817152C>A	ENST00000248244.5	-	2	1467	c.1238G>T	c.(1237-1239)cGg>cTg	p.R413L		NM_182919.3	NP_891549.1	Q8IUC6	TCAM1_HUMAN	toll-like receptor adaptor molecule 1	413	TIR.				apoptotic signaling pathway (GO:0097190)|defense response to virus (GO:0051607)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|macrophage activation involved in immune response (GO:0002281)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of natural killer cell activation (GO:0032816)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of protein binding (GO:0032092)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type I interferon production (GO:0032481)|regulation of protein homodimerization activity (GO:0043496)|response to exogenous dsRNA (GO:0043330)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|endosome membrane (GO:0010008)|ripoptosome (GO:0097342)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			NS(2)|breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	26				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0139)		CAGCTTCTCCCGAACCCGCAG	0.617																																																	0								ENSG00000127666						34.0	35.0	35.0					19																	4817152		2203	4300	6503	TICAM1	SO:0001583	missense	0			-	HGNC	AB086380	CCDS12136.1	19p13.3	2014-09-17				ENSG00000127666			18348	protein-coding gene	gene with protein product		607601				12539043, 12471095	Standard	NM_182919		Approved	TRIF, TICAM-1, MGC35334, PRVTIRB	uc002mbi.4	Q8IUC6		ENST00000248244.5:c.1238G>T	19.37:g.4817152C>A	ENSP00000248244:p.Arg413Leu	Somatic	0	60	0.00		0.5480226040680333	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	41	25.45	B3Y691|O75532|Q86XP8|Q96GA0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_TIR_dom,pirsf_TICAM1	p.R413L	ENST00000248244.5	37	c.1238	CCDS12136.1	19	.	.	.	.	.	.	.	.	.	.	C	16.94	3.261225	0.59431	.	.	ENSG00000127666	ENST00000248244	T	0.02216	4.39	4.66	2.51	0.30379	.	0.233755	0.22016	N	0.065797	T	0.03477	0.0100	L	0.50333	1.59	0.35774	D	0.821141	P	0.48998	0.918	P	0.47044	0.535	T	0.47661	-0.9100	10	0.72032	D	0.01	-33.6417	5.1332	0.14921	0.0:0.6319:0.0:0.3681	.	413	Q8IUC6	TCAM1_HUMAN	L	413	ENSP00000248244:R413L	ENSP00000248244:R413L	R	-	2	0	TICAM1	4768152	0.940000	0.31905	0.175000	0.22980	0.398000	0.30690	1.709000	0.37909	1.085000	0.41206	0.313000	0.20887	CGG	-	superfamily_TIR_dom,pirsf_TICAM1		0.617	TICAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TICAM1	protein_coding	OTTHUMT00000450435.1	C	NM_014261	-		4817152	-1	no_errors	ENST00000248244	ensembl	human	known	74_37	missense	SNP	0.746	A
ADAM3A	1587	genome.wustl.edu	37	8	39370106	39370106	+	RNA	SNP	T	T	C			TCGA-WK-A8XZ-01A-11D-A37C-09	TCGA-WK-A8XZ-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	82b3cc1e-5a9f-413a-bf84-f936bf806217	4f0633e4-1412-4a20-8b9c-0451a23d8b55	g.chr8:39370106T>C	ENST00000490268.2	-	0	220					NR_073423.1				ADAM metallopeptidase domain 3A (pseudogene)																		CCTTTGAAAATGAAGAATCTG	0.333																																																	0								ENSG00000197475																																			ADAM3A			0			-	HGNC	X89657		8p11.22	2012-06-11	2012-06-11		ENSG00000197475	ENSG00000197475		"""ADAM metallopeptidase domain containing"""	209	pseudogene	pseudogene			"""cyritestin 1"", ""a disintegrin and metalloproteinase domain 3a (cyritestin 1)"", ""ADAM metallopeptidase domain 3A, pseudogene"", ""ADAM metallopeptidase domain 3A"""	CYRN1		9502432, 11439107	Standard	NR_024107		Approved	ADAM3, tMDCI	uc003xnf.4		OTTHUMG00000154991		8.37:g.39370106T>C		Somatic	0	20	0.00		0.5480226040680333	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	13	31.58		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000490268.2	37	NULL		8																																																																																			-	-		0.333	ADAM3A-005	KNOWN	basic	processed_transcript	ADAM3A	pseudogene	OTTHUMT00000337953.1	T	NR_001569	-		39370106	-1	no_errors	ENST00000460383	ensembl	human	known	74_37	rna	SNP	0.060	C
C10orf55	414236	genome.wustl.edu	37	10	75674654	75674654	+	Intron	SNP	G	G	T			TCGA-WK-A8XZ-01A-11D-A37C-09	TCGA-WK-A8XZ-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	82b3cc1e-5a9f-413a-bf84-f936bf806217	4f0633e4-1412-4a20-8b9c-0451a23d8b55	g.chr10:75674654G>T	ENST00000409178.1	-	2	268				PLAU_ENST00000446342.1_Missense_Mutation_p.G300V|PLAU_ENST00000372762.4_Missense_Mutation_p.G281V|C10orf55_ENST00000412307.2_Intron|PLAU_ENST00000372764.3_Missense_Mutation_p.G317V	NM_001001791.2	NP_001001791.2	Q5SWW7	CJ055_HUMAN	chromosome 10 open reading frame 55											endometrium(1)	1	Prostate(51;0.0112)					GAGATCACTGGCTTTGGAAAA	0.502																																																	0								ENSG00000122861						92.0	78.0	83.0					10																	75674654		2203	4300	6503	PLAU	SO:0001627	intron_variant	0			-	HGNC		CCDS53541.1	10q22.2	2012-05-24			ENSG00000222047	ENSG00000222047			31008	protein-coding gene	gene with protein product							Standard	NM_001001791		Approved	bA417O11.3	uc001jvz.2	Q5SWW7	OTTHUMG00000018496	ENST00000409178.1:c.72+1622C>A	10.37:g.75674654G>T		Somatic	0	50	0.00		0.5480226040680333	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	18	14.29	Q3KRG4|Q8NAK4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_S1,pfam_Kringle,superfamily_Trypsin-like_Pept_dom,superfamily_Kringle-like,smart_Kringle,smart_Peptidase_S1,pfscan_EG-like_dom,pfscan_Kringle,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.G317V	ENST00000409178.1	37	c.950	CCDS53541.1	10	.	.	.	.	.	.	.	.	.	.	G	21.5	4.158188	0.78114	.	.	ENSG00000122861	ENST00000446342;ENST00000372764;ENST00000372762;ENST00000372761	D;D;D	0.95103	-3.61;-3.61;-3.61	5.78	4.87	0.63330	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.85682	D	0.000000	D	0.98432	0.9478	H	0.99609	4.655	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;0.999	D	0.97907	1.0306	10	0.87932	D	0	.	9.7625	0.40541	0.0909:0.0:0.9091:0.0	.	300;281;317;317	E7ET40;E7ESM2;B2R7F2;P00749	.;.;.;UROK_HUMAN	V	300;317;281;281	ENSP00000388474:G300V;ENSP00000361850:G317V;ENSP00000361848:G281V	ENSP00000361847:G281V	G	+	2	0	PLAU	75344660	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	4.514000	0.60482	2.730000	0.93505	0.655000	0.94253	GGC	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1		0.502	C10orf55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLAU	protein_coding	OTTHUMT00000048746.1	G	NM_001001791	-		75674654	+1	no_errors	ENST00000372764	ensembl	human	known	74_37	missense	SNP	1.000	T
THAP5	168451	genome.wustl.edu	37	7	108204958	108204958	+	Missense_Mutation	SNP	T	T	C			TCGA-WK-A8XZ-01A-11D-A37C-09	TCGA-WK-A8XZ-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	82b3cc1e-5a9f-413a-bf84-f936bf806217	4f0633e4-1412-4a20-8b9c-0451a23d8b55	g.chr7:108204958T>C	ENST00000415914.3	-	3	1018	c.865A>G	c.(865-867)Ata>Gta	p.I289V	THAP5_ENST00000493722.1_5'UTR|THAP5_ENST00000313516.5_Missense_Mutation_p.I247V	NM_001130475.1	NP_001123947.1	Q7Z6K1	THAP5_HUMAN	THAP domain containing 5	289					cell cycle (GO:0007049)|negative regulation of cell cycle (GO:0045786)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protease binding (GO:0002020)			central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(2)|skin(1)	8						TGTGCAGATATAAAAGAATTA	0.328																																																	0								ENSG00000177683						91.0	95.0	94.0					7																	108204958		2203	4300	6503	THAP5	SO:0001583	missense	0			-	HGNC	AL833137	CCDS34734.2, CCDS47687.1	7q22.3	2013-01-25			ENSG00000177683	ENSG00000177683		"""THAP (C2CH-type zinc finger) domain containing"""	23188	protein-coding gene	gene with protein product		612534				12575992	Standard	NM_001287598		Approved	DKFZp313O1132	uc003vfm.3	Q7Z6K1	OTTHUMG00000154951	ENST00000415914.3:c.865A>G	7.37:g.108204958T>C	ENSP00000400500:p.Ile289Val	Somatic	0	83	0.00		0.5480226040680333	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	47	36.49		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2CH,smart_Znf_C2CH,pfscan_Znf_C2CH	p.I289V	ENST00000415914.3	37	c.865	CCDS47687.1	7	.	.	.	.	.	.	.	.	.	.	T	4.011	-0.000584	0.07819	.	.	ENSG00000177683	ENST00000415914;ENST00000313516	D;D	0.96300	-3.97;-2.48	4.45	0.765	0.18470	.	0.965910	0.08423	U	0.947986	D	0.89008	0.6593	N	0.12182	0.205	0.18873	N	0.999988	B	0.02656	0.0	B	0.01281	0.0	T	0.78623	-0.2132	9	.	.	.	.	4.9224	0.13876	0.0:0.2736:0.1667:0.5597	.	289	Q7Z6K1	THAP5_HUMAN	V	289;247	ENSP00000400500:I289V;ENSP00000322440:I247V	.	I	-	1	0	THAP5	107992194	0.017000	0.18338	0.527000	0.27925	0.855000	0.48748	-0.343000	0.07791	0.210000	0.20664	0.528000	0.53228	ATA	-	NULL		0.328	THAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THAP5	protein_coding	OTTHUMT00000337777.2	T	NM_182529	-		108204958	-1	no_errors	ENST00000415914	ensembl	human	known	74_37	missense	SNP	0.155	C
CTDSPL2	51496	genome.wustl.edu	37	15	44791989	44791989	+	Missense_Mutation	SNP	T	T	C			TCGA-WK-A8XZ-01A-11D-A37C-09	TCGA-WK-A8XZ-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	82b3cc1e-5a9f-413a-bf84-f936bf806217	4f0633e4-1412-4a20-8b9c-0451a23d8b55	g.chr15:44791989T>C	ENST00000260327.4	+	8	1510	c.947T>C	c.(946-948)cTt>cCt	p.L316P	CTDSPL2_ENST00000558966.1_Missense_Mutation_p.L316P|CTDSPL2_ENST00000561189.1_3'UTR|CTDSPL2_ENST00000558373.1_Missense_Mutation_p.L244P|CTDSPL2_ENST00000396780.1_Missense_Mutation_p.L244P	NM_016396.2	NP_057480.2	Q05D32	CTSL2_HUMAN	CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase like 2	316	FCP1 homology. {ECO:0000255|PROSITE- ProRule:PRU00336}.						phosphoprotein phosphatase activity (GO:0004721)			breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(4)|upper_aerodigestive_tract(2)	13		all_cancers(109;4.36e-14)|all_epithelial(112;9.8e-12)|Lung NSC(122;1.66e-07)|all_lung(180;1.47e-06)|Melanoma(134;0.0122)		all cancers(107;1.02e-20)|GBM - Glioblastoma multiforme(94;1.49e-06)|COAD - Colon adenocarcinoma(120;0.0857)|Colorectal(105;0.0905)		TTTCCAGTCCTTTTCCAAGAT	0.284																																																	0								ENSG00000137770						125.0	131.0	129.0					15																	44791989		2198	4291	6489	CTDSPL2	SO:0001583	missense	0			-	HGNC	AF161478	CCDS10110.1	15q15.3-q21.1	2010-06-21			ENSG00000137770	ENSG00000137770		"""Serine/threonine phosphatases / CTD aspartate-based phosphatases"""	26936	protein-coding gene	gene with protein product							Standard	NM_016396		Approved	HSPC129, FLJ10523	uc001ztr.3	Q05D32	OTTHUMG00000131159	ENST00000260327.4:c.947T>C	15.37:g.44791989T>C	ENSP00000260327:p.Leu316Pro	Somatic	0	48	0.00		0.5480226040680333	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	28	12.50	Q3ZTU1|Q6AI06|Q8IYI9|Q9NVT2|Q9NZX8|Q9P030	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_NIF,superfamily_HAD-like_dom,smart_NIF,pfscan_NIF,tigrfam_Dullard_phosphatase	p.L316P	ENST00000260327.4	37	c.947	CCDS10110.1	15	.	.	.	.	.	.	.	.	.	.	T	19.09	3.760477	0.69763	.	.	ENSG00000137770	ENST00000260327;ENST00000396780	T;T	0.18338	2.22;2.22	5.35	5.35	0.76521	NLI interacting factor (3);Dullard phosphatase domain, eukaryotic (1);HAD-like domain (2);	0.055463	0.85682	D	0.000000	T	0.30386	0.0763	L	0.46885	1.475	0.80722	D	1	D;B	0.67145	0.996;0.075	P;B	0.58820	0.846;0.063	T	0.01039	-1.1472	10	0.36615	T	0.2	-9.0004	15.28	0.73773	0.0:0.0:0.0:1.0	.	244;316	Q05D32-2;Q05D32	.;CTSL2_HUMAN	P	316;244	ENSP00000260327:L316P;ENSP00000380000:L244P	ENSP00000260327:L316P	L	+	2	0	CTDSPL2	42579281	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.898000	0.87363	2.147000	0.66899	0.528000	0.53228	CTT	-	pfam_NIF,superfamily_HAD-like_dom,smart_NIF,pfscan_NIF,tigrfam_Dullard_phosphatase		0.284	CTDSPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTDSPL2	protein_coding	OTTHUMT00000253851.1	T	NM_016396	-		44791989	+1	no_errors	ENST00000260327	ensembl	human	known	74_37	missense	SNP	1.000	C
HCLS1	3059	genome.wustl.edu	37	3	121361875	121361875	+	Intron	SNP	T	T	C			TCGA-WK-A8XZ-01A-11D-A37C-09	TCGA-WK-A8XZ-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	82b3cc1e-5a9f-413a-bf84-f936bf806217	4f0633e4-1412-4a20-8b9c-0451a23d8b55	g.chr3:121361875T>C	ENST00000314583.3	-	6	491				HCLS1_ENST00000428394.2_Intron|HCLS1_ENST00000473883.1_5'UTR	NM_005335.4	NP_005326	P14317	HCLS1_HUMAN	hematopoietic cell-specific Lyn substrate 1						actin filament polymerization (GO:0030041)|cellular response to cytokine stimulus (GO:0071345)|erythrocyte differentiation (GO:0030218)|intracellular signal transduction (GO:0035556)|negative regulation of leukocyte apoptotic process (GO:2000107)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of cell proliferation (GO:0008284)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tyrosine phosphorylation of STAT protein (GO:0042531)|regulation of actin filament polymerization (GO:0030833)|regulation of transcription, DNA-templated (GO:0006355)|response to hormone (GO:0009725)	cytoplasm (GO:0005737)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	protein kinase binding (GO:0019901)|RNA polymerase II transcription factor binding (GO:0001085)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(13)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	35				GBM - Glioblastoma multiforme(114;0.0912)		AGCTGACAGGTTTTCCTCTTC	0.473																																																	0								ENSG00000180353						80.0	82.0	81.0					3																	121361875		2203	4300	6503	HCLS1	SO:0001627	intron_variant	0			-	HGNC		CCDS3003.1	3q13	2007-08-03			ENSG00000180353	ENSG00000180353			4844	protein-coding gene	gene with protein product	"""cortactin-like"""	601306				8978766, 15710041	Standard	NM_001292041		Approved	HS1, CTTNL	uc003eeh.4	P14317	OTTHUMG00000159409	ENST00000314583.3:c.400-47A>G	3.37:g.121361875T>C		Somatic	0	66	0.00		0.5480226040680333	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	32	22	59.26	B4DQ69|Q53Y93|Q6IBK9|Q9UDK0	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000314583.3	37	NULL	CCDS3003.1	3																																																																																			-	-		0.473	HCLS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCLS1	protein_coding	OTTHUMT00000355144.1	T	NM_005335	-		121361875	-1	no_errors	ENST00000473883	ensembl	human	known	74_37	rna	SNP	0.000	C
SNHG14	104472715	genome.wustl.edu	37	15	25346762	25346762	+	RNA	SNP	A	A	G			TCGA-WK-A8XZ-01A-11D-A37C-09	TCGA-WK-A8XZ-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	82b3cc1e-5a9f-413a-bf84-f936bf806217	4f0633e4-1412-4a20-8b9c-0451a23d8b55	g.chr15:25346762A>G	ENST00000546682.1	+	0	1475				SNORD116-26_ENST00000516006.1_RNA|SNHG14_ENST00000553108.1_RNA|SNHG14_ENST00000549804.2_RNA|SNORD116-27_ENST00000516087.1_RNA	NR_003361.1				small nucleolar RNA host gene 14 (non-protein coding)																		TTTAAATCTGAACAAAATGAG	0.418																																																	0								ENSG00000251896						65.0	62.0	63.0					15																	25346762		876	1991	2867	SNORD116-27			0			-	HGNC			15q11.2	2014-01-17	2011-08-22	2011-08-22	ENSG00000224078	ENSG00000224078		"""Long non-coding RNAs"""	37462	non-coding RNA	RNA, long non-coding	"""non-protein coding RNA 214"""		"""UBE3A antisense RNA 1 (non-protein coding)"""	UBE3A-AS1		23771028	Standard			Approved	NCRNA00214, UBE3A-AS			OTTHUMG00000056661		15.37:g.25346762A>G		Somatic	0	47	0.00		0.5480226040680333	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000546682.1	37	NULL		15																																																																																			-	-		0.418	SNHG14-022	KNOWN	basic	antisense	SNORD116-27	processed_transcript	OTTHUMT00000408281.1	A		-		25346762	+1	no_errors	ENST00000516087	ensembl	human	known	74_37	rna	SNP	0.019	G
P4HA3	283208	genome.wustl.edu	37	11	73990432	73990432	+	Splice_Site	SNP	C	C	T			TCGA-WK-A8XZ-01A-11D-A37C-09	TCGA-WK-A8XZ-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	82b3cc1e-5a9f-413a-bf84-f936bf806217	4f0633e4-1412-4a20-8b9c-0451a23d8b55	g.chr11:73990432C>T	ENST00000331597.4	-	8	1221		c.e8+1		P4HA3_ENST00000427714.2_Splice_Site	NM_182904.3	NP_878907.1	Q7Z4N8	P4HA3_HUMAN	prolyl 4-hydroxylase, alpha polypeptide III							endoplasmic reticulum (GO:0005783)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)|procollagen-proline 4-dioxygenase activity (GO:0004656)			NS(1)|biliary_tract(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|liver(1)|lung(5)|skin(1)	15	Breast(11;2.31e-05)					GCCCTTCTTACCTTTTGCTGA	0.552																																																	0								ENSG00000149380						242.0	196.0	211.0					11																	73990432		2200	4293	6493	P4HA3	SO:0001630	splice_region_variant	0			-	HGNC	AY327887	CCDS8230.1, CCDS73347.1	11q13	2008-12-09	2008-12-09			ENSG00000149380			30135	protein-coding gene	gene with protein product	"""collagen prolyl 4-hydroxylase alpha(III)"""	608987	"""procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha polypeptide III"""			14500733	Standard	XM_005273924		Approved	C-P4Halpha(III)	uc001ouz.3	Q7Z4N8		ENST00000331597.4:c.1175+1G>A	11.37:g.73990432C>T		Somatic	0	57	0.00		0.5480226040680333	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	23	36.11	A0AV13|B4DUD3|Q5EBL3|Q5JPA9	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e8+1	ENST00000331597.4	37	c.1175+1	CCDS8230.1	11	.	.	.	.	.	.	.	.	.	.	C	24.0	4.479342	0.84747	.	.	ENSG00000149380	ENST00000331597;ENST00000427714	.	.	.	4.39	4.39	0.52855	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.8385	0.70206	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	P4HA3	73668080	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	6.070000	0.71220	2.439000	0.82584	0.655000	0.94253	.	-	-		0.552	P4HA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	P4HA3	protein_coding	OTTHUMT00000382988.1	C	NM_182904	-	Intron	73990432	-1	no_errors	ENST00000331597	ensembl	human	known	74_37	splice_site	SNP	1.000	T
CLU	1191	genome.wustl.edu	37	8	27468062	27468062	+	Silent	SNP	C	C	A			TCGA-WK-A8XZ-01A-11D-A37C-09	TCGA-WK-A8XZ-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	82b3cc1e-5a9f-413a-bf84-f936bf806217	4f0633e4-1412-4a20-8b9c-0451a23d8b55	g.chr8:27468062C>A	ENST00000316403.10	-	2	432	c.27G>T	c.(25-27)gtG>gtT	p.V9V	CLU_ENST00000560366.1_Silent_p.V61V|CLU_ENST00000523500.1_Silent_p.V9V|CLU_ENST00000405140.3_Silent_p.V9V|CLU_ENST00000546343.1_Silent_p.V20V			P10909	CLUS_HUMAN	clusterin	9					blood coagulation (GO:0007596)|cell morphogenesis (GO:0000902)|central nervous system myelin maintenance (GO:0032286)|chaperone-mediated protein complex assembly (GO:0051131)|chaperone-mediated protein folding (GO:0061077)|complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|lipid metabolic process (GO:0006629)|microglial cell activation (GO:0001774)|microglial cell proliferation (GO:0061518)|negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of protein homooligomerization (GO:0032463)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of apoptotic process (GO:0043065)|positive regulation of beta-amyloid formation (GO:1902004)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of neurofibrillary tangle assembly (GO:1902998)|positive regulation of neuron death (GO:1901216)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of tau-protein kinase activity (GO:1902949)|positive regulation of tumor necrosis factor production (GO:0032760)|protein import (GO:0017038)|protein stabilization (GO:0050821)|regulation of beta-amyloid clearance (GO:1900221)|regulation of neuron death (GO:1901214)|regulation of neuronal signal transduction (GO:1902847)|release of cytochrome c from mitochondria (GO:0001836)|response to misfolded protein (GO:0051788)|response to virus (GO:0009615)|reverse cholesterol transport (GO:0043691)	apical dendrite (GO:0097440)|blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|platelet alpha granule lumen (GO:0031093)|spherical high-density lipoprotein particle (GO:0034366)	misfolded protein binding (GO:0051787)|ubiquitin protein ligase binding (GO:0031625)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)	21		Ovarian(32;2.61e-05)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0204)|Colorectal(74;0.132)		GCAGCAGCCCCACAAACAGCA	0.567																																																	0								ENSG00000120885						116.0	105.0	109.0					8																	27468062		2203	4300	6503	CLU	SO:0001819	synonymous_variant	0			-	HGNC	M64722	CCDS47832.1	8p21-p12	2012-11-30	2006-02-10		ENSG00000120885	ENSG00000120885			2095	protein-coding gene	gene with protein product	"""complement lysis inhibitor"", ""sulfated glycoprotein 2"", ""testosterone-repressed prostate message 2"", ""apolipoprotein J"""	185430	"""clusterin (complement lysis inhibitor, SP-40,40, sulfated glycoprotein 2, testosterone-repressed prostate message 2, apolipoprotein J)"""	CLI, APOJ		1585460	Standard	NR_038335		Approved	SGP-2, SP-40, TRPM-2, KUB1, CLU1, CLU2	uc003xfz.2	P10909	OTTHUMG00000102114	ENST00000316403.10:c.27G>T	8.37:g.27468062C>A		Somatic	0	65	0.00		0.5480226040680333	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	41	39.71	B2R9Q1|B3KSE6|P11380|P11381|Q2TU75|Q5HYC1|Q7Z5B9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Clusterin-like,smart_Clusterin_N,smart_Clusterin_C	p.V61	ENST00000316403.10	37	c.183	CCDS47832.1	8																																																																																			-	pfam_Clusterin-like		0.567	CLU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLU	protein_coding	OTTHUMT00000219953.3	C	NM_001831	-		27468062	-1	no_errors	ENST00000560366	ensembl	human	known	74_37	silent	SNP	0.999	A
NLRP9	338321	genome.wustl.edu	37	19	56249610	56249610	+	Missense_Mutation	SNP	C	C	A			TCGA-WK-A8XZ-01A-11D-A37C-09	TCGA-WK-A8XZ-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	82b3cc1e-5a9f-413a-bf84-f936bf806217	4f0633e4-1412-4a20-8b9c-0451a23d8b55	g.chr19:56249610C>A	ENST00000332836.2	-	1	158	c.131G>T	c.(130-132)tGg>tTg	p.W44L	RN7SKP109_ENST00000410592.1_RNA	NM_176820.2	NP_789790.2	Q7RTR0	NALP9_HUMAN	NLR family, pyrin domain containing 9	44	DAPIN. {ECO:0000255|PROSITE- ProRule:PRU00061}.					cytoplasm (GO:0005737)	ATP binding (GO:0005524)	p.W44L(1)		NS(2)|breast(5)|cervix(1)|endometrium(7)|kidney(8)|large_intestine(15)|lung(21)|ovary(2)|prostate(3)|skin(7)|urinary_tract(3)	74		Colorectal(82;0.000133)|Ovarian(87;0.133)		GBM - Glioblastoma multiforme(193;0.123)		CAGCTCAGCCCAGGGGATTGG	0.453																																																	1	Substitution - Missense(1)	endometrium(1)						ENSG00000185792						269.0	272.0	271.0					19																	56249610		2203	4300	6503	NLRP9	SO:0001583	missense	0			-	HGNC	AY154464	CCDS12934.1	19q13.43	2006-12-08	2006-12-08	2006-12-08				"""Nucleotide-binding domain and leucine rich repeat containing"""	22941	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 9"""	609663	"""NACHT, leucine rich repeat and PYD containing 9"""	NALP9		12563287	Standard	NM_176820		Approved	NOD6, PAN12, CLR19.1	uc002qly.3	Q7RTR0		ENST00000332836.2:c.131G>T	19.37:g.56249610C>A	ENSP00000331857:p.Trp44Leu	Somatic	0	69	0.00		0.5480226040680333	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	34	18	65.38	B2RN12|Q86W27	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DAPIN,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.W44L	ENST00000332836.2	37	c.131	CCDS12934.1	19	.	.	.	.	.	.	.	.	.	.	C	18.51	3.639461	0.67244	.	.	ENSG00000185792	ENST00000332836;ENST00000333452	T	0.52754	0.65	3.63	3.63	0.41609	Pyrin (2);DEATH-like (2);	.	.	.	.	T	0.60534	0.2276	M	0.76727	2.345	0.38327	D	0.943704	D	0.56521	0.976	P	0.57283	0.817	T	0.66308	-0.5956	9	0.51188	T	0.08	.	11.173	0.48582	0.0:1.0:0.0:0.0	.	44	Q7RTR0	NALP9_HUMAN	L	44	ENSP00000331857:W44L	ENSP00000331857:W44L	W	-	2	0	NLRP9	60941422	0.546000	0.26457	0.927000	0.36925	0.292000	0.27327	1.280000	0.33202	2.365000	0.80145	0.650000	0.86243	TGG	-	pfam_DAPIN,superfamily_DEATH-like_dom,pfscan_DAPIN		0.453	NLRP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP9	protein_coding	OTTHUMT00000453653.1	C	NM_176820	-		56249610	-1	no_errors	ENST00000332836	ensembl	human	known	74_37	missense	SNP	0.929	A
FSIP2	401024	genome.wustl.edu	37	2	186627948	186627948	+	Missense_Mutation	SNP	G	G	T			TCGA-WK-A8XZ-01A-11D-A37C-09	TCGA-WK-A8XZ-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	82b3cc1e-5a9f-413a-bf84-f936bf806217	4f0633e4-1412-4a20-8b9c-0451a23d8b55	g.chr2:186627948G>T	ENST00000424728.1	+	12	1279	c.1279G>T	c.(1279-1281)Gcg>Tcg	p.A427S	FSIP2_ENST00000546113.1_3'UTR|FSIP2_ENST00000343098.5_Missense_Mutation_p.A516S			Q5CZC0	FSIP2_HUMAN	fibrous sheath interacting protein 2	427										NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(11)|lung(46)|pancreas(1)|urinary_tract(2)	69						AATTATTTCAGCGCAGGTATC	0.358																																																	0								ENSG00000188738																																			FSIP2	SO:0001583	missense	0			-	HGNC	AK092099	CCDS54426.1	2q32.1	2010-06-18			ENSG00000188738	ENSG00000188738			21675	protein-coding gene	gene with protein product		615796				14702039	Standard	NM_173651		Approved	FLJ34780	uc002upl.3	Q5CZC0	OTTHUMG00000153874	ENST00000424728.1:c.1279G>T	2.37:g.186627948G>T	ENSP00000401306:p.Ala427Ser	Somatic	0	38	0.00		0.5480226040680333	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.16	Q53TL3|Q53TN5|Q5HYH2|Q6ZTZ5|Q6ZU14|Q6ZU21	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.A516S	ENST00000424728.1	37	c.1546		2	.	.	.	.	.	.	.	.	.	.	G	9.098	1.003542	0.19121	.	.	ENSG00000188738	ENST00000343098;ENST00000424728;ENST00000326147	T;T	0.48836	0.8;0.81	3.41	-2.08	0.07254	.	0.669483	0.12385	N	0.473534	T	0.25306	0.0615	N	0.24115	0.695	0.09310	N	1	P	0.42908	0.793	B	0.37780	0.258	T	0.19224	-1.0312	10	0.23891	T	0.37	.	5.9093	0.19018	0.1923:0.4713:0.3363:0.0	.	427	Q5CZC0	FSIP2_HUMAN	S	516;427;427	ENSP00000344403:A516S;ENSP00000401306:A427S	ENSP00000321903:A427S	A	+	1	0	FSIP2	186336193	0.001000	0.12720	0.011000	0.14972	0.010000	0.07245	-1.567000	0.02146	-0.475000	0.06852	-0.291000	0.09656	GCG	-	NULL		0.358	FSIP2-001	KNOWN	basic	protein_coding	FSIP2	protein_coding	OTTHUMT00000332778.3	G	NM_173651	-		186627948	+1	no_errors	ENST00000343098	ensembl	human	known	74_37	missense	SNP	0.016	T
OR2T12	127064	genome.wustl.edu	37	1	248458735	248458735	+	Nonsense_Mutation	SNP	C	C	T			TCGA-WK-A8XZ-01A-11D-A37C-09	TCGA-WK-A8XZ-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	82b3cc1e-5a9f-413a-bf84-f936bf806217	4f0633e4-1412-4a20-8b9c-0451a23d8b55	g.chr1:248458735C>T	ENST00000317996.1	-	1	145	c.146G>A	c.(145-147)tGg>tAg	p.W49*		NM_001004692.1	NP_001004692.1	Q8NG77	O2T12_HUMAN	olfactory receptor, family 2, subfamily T, member 12	49						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(4)|kidney(3)|large_intestine(3)|lung(25)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	43	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0201)			CCGGTGGTCCCAGTGAATCAG	0.537																																																	0								ENSG00000177201						97.0	79.0	85.0					1																	248458735		2203	4300	6503	OR2T12	SO:0001587	stop_gained	0			-	HGNC	BK004485	CCDS31110.1	1q44	2012-08-09			ENSG00000177201	ENSG00000177201		"""GPCR / Class A : Olfactory receptors"""	19592	protein-coding gene	gene with protein product							Standard	NM_001004692		Approved		uc010pzj.2	Q8NG77	OTTHUMG00000040457	ENST00000317996.1:c.146G>A	1.37:g.248458735C>T	ENSP00000324583:p.Trp49*	Somatic	0	37	0.00		0.5480226040680333	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	37	30.19		Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.W49*	ENST00000317996.1	37	c.146	CCDS31110.1	1	.	.	.	.	.	.	.	.	.	.	c	10.84	1.464874	0.26335	.	.	ENSG00000177201	ENST00000317996	.	.	.	1.55	-3.09	0.05331	.	3.014640	0.01683	U	0.026254	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	.	5.5529	0.17101	0.3578:0.5063:0.1359:0.0	.	.	.	.	X	49	.	ENSP00000324583:W49X	W	-	2	0	OR2T12	246525358	0.000000	0.05858	0.001000	0.08648	0.052000	0.14988	-2.290000	0.01148	-0.564000	0.06070	0.175000	0.17021	TGG	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM		0.537	OR2T12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T12	protein_coding	OTTHUMT00000097353.1	C	NM_001004692	-		248458735	-1	no_errors	ENST00000317996	ensembl	human	known	74_37	nonsense	SNP	0.000	T
RYR3	6263	genome.wustl.edu	37	15	34042401	34042401	+	Silent	SNP	C	C	A			TCGA-WK-A8XZ-01A-11D-A37C-09	TCGA-WK-A8XZ-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	82b3cc1e-5a9f-413a-bf84-f936bf806217	4f0633e4-1412-4a20-8b9c-0451a23d8b55	g.chr15:34042401C>A	ENST00000389232.4	+	57	8383	c.8313C>A	c.(8311-8313)acC>acA	p.T2771T	RYR3_ENST00000415757.3_Silent_p.T2771T	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	2771	4 X approximate repeats.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		CATATGACACCTTGACTGCCA	0.507																																																	0								ENSG00000198838						72.0	69.0	70.0					15																	34042401		1943	4154	6097	RYR3	SO:0001819	synonymous_variant	0			-	HGNC		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.8313C>A	15.37:g.34042401C>A		Somatic	0	42	0.00		0.5480226040680333	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	34	10.53	O15175|Q15412	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ryanodine_rcpt,pfam_Ca-rel_channel,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,superfamily_4_helix_cytokine-like_core,superfamily_ARM-type_fold,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_hand_dom,pfscan_MIR_motif	p.T2771	ENST00000389232.4	37	c.8313	CCDS45210.1	15																																																																																			-	pfam_Ryanodine_rcpt,superfamily_ARM-type_fold		0.507	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR3	protein_coding	OTTHUMT00000417514.1	C		-		34042401	+1	no_errors	ENST00000389232	ensembl	human	known	74_37	silent	SNP	0.993	A
ZNF271	10778	genome.wustl.edu	37	18	32888074	32888074	+	RNA	SNP	T	T	A			TCGA-WK-A8XZ-01A-11D-A37C-09	TCGA-WK-A8XZ-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	82b3cc1e-5a9f-413a-bf84-f936bf806217	4f0633e4-1412-4a20-8b9c-0451a23d8b55	g.chr18:32888074T>A	ENST00000399070.3	+	0	2468					NR_024565.1|NR_024566.1		Q14591	ZN271_HUMAN	zinc finger protein 271						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(3)|lung(9)	12						cctgtctatttaaaaaaaaaa	0.388																																																	0								ENSG00000257267																																			ZNF271			0			-	HGNC	X78930		18q12.2	2013-04-03			ENSG00000257267	ENSG00000257267		"""Zinc fingers, C2H2-type"""	13065	other	unknown		604754				7865130, 11777961	Standard	NR_024565		Approved	HZF7, ZNFEB	uc002kyp.4	Q14591	OTTHUMG00000132563		18.37:g.32888074T>A		Somatic	0	46	0.00		0.5480226040680333	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	47	9.62	B3KN34|Q96T29|Q9BSX2|Q9UN33|Q9Y5B7	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000399070.3	37	NULL		18																																																																																			-	-		0.388	ZNF271-002	KNOWN	basic	processed_transcript	ZNF271	pseudogene	OTTHUMT00000255767.2	T	NR_024565	-		32888074	+1	no_errors	ENST00000399070	ensembl	human	known	74_37	rna	SNP	0.004	A
CAGE1	285782	genome.wustl.edu	37	6	7365794	7365794	+	Silent	SNP	A	A	G			TCGA-WK-A8XZ-01A-11D-A37C-09	TCGA-WK-A8XZ-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	82b3cc1e-5a9f-413a-bf84-f936bf806217	4f0633e4-1412-4a20-8b9c-0451a23d8b55	g.chr6:7365794A>G	ENST00000512086.1	-	8	2221	c.2019T>C	c.(2017-2019)gaT>gaC	p.D673D	CAGE1_ENST00000502583.1_Silent_p.D700D|CAGE1_ENST00000379918.4_Silent_p.D678D|CAGE1_ENST00000338150.4_Silent_p.D700D|CAGE1_ENST00000296742.7_Silent_p.D537D			Q8TC20	CAGE1_HUMAN	cancer antigen 1	673										breast(1)|cervix(1)|endometrium(3)|kidney(2)|lung(11)|urinary_tract(1)	19	Ovarian(93;0.0418)					CTTCATCTGAATCACAGTCTA	0.348																																																	0								ENSG00000164304						122.0	114.0	117.0					6																	7365794		1857	4092	5949	CAGE1	SO:0001819	synonymous_variant	0			-	HGNC	BC026194	CCDS47367.1, CCDS54964.1, CCDS54965.1	6p24.3	2009-08-06	2005-01-26	2005-01-27	ENSG00000164304	ENSG00000164304			21622	protein-coding gene	gene with protein product	"""cancer/testis antigen 95"""	608304	"""cancer/testis antigen 3"""	CTAG3		12531476	Standard	NM_205864		Approved	bA69L16.7, CT95	uc003mxl.2	Q8TC20	OTTHUMG00000014200	ENST00000512086.1:c.2019T>C	6.37:g.7365794A>G		Somatic	0	69	0.00		0.5480226040680333	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	23	45.24	D6RCT9|Q5TAM0|Q86TM4|Q8N7R5	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.D700	ENST00000512086.1	37	c.2100		6																																																																																			-	NULL		0.348	CAGE1-008	PUTATIVE	non_canonical_conserved|basic	protein_coding	CAGE1	protein_coding	OTTHUMT00000367136.1	A	NM_175745	-		7365794	-1	no_errors	ENST00000338150	ensembl	human	known	74_37	silent	SNP	0.013	G
ALDH1A3	220	genome.wustl.edu	37	15	101425559	101425559	+	Missense_Mutation	SNP	G	G	T			TCGA-WK-A8XZ-01A-11D-A37C-09	TCGA-WK-A8XZ-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	82b3cc1e-5a9f-413a-bf84-f936bf806217	4f0633e4-1412-4a20-8b9c-0451a23d8b55	g.chr15:101425559G>T	ENST00000329841.5	+	2	719	c.187G>T	c.(187-189)Gtg>Ttg	p.V63L	ALDH1A3_ENST00000346623.6_Missense_Mutation_p.V63L|ALDH1A3_ENST00000560555.1_3'UTR|RP11-66B24.8_ENST00000558568.1_lincRNA	NM_000693.2	NP_000684.2	P47895	AL1A3_HUMAN	aldehyde dehydrogenase 1 family, member A3	63					embryonic eye morphogenesis (GO:0048048)|face development (GO:0060324)|inner ear morphogenesis (GO:0042472)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|nucleus accumbens development (GO:0021768)|olfactory pit development (GO:0060166)|optic cup morphogenesis involved in camera-type eye development (GO:0002072)|positive regulation of apoptotic process (GO:0043065)|retinal metabolic process (GO:0042574)|retinoic acid biosynthetic process (GO:0002138)|retinoic acid metabolic process (GO:0042573)|retinol metabolic process (GO:0042572)|righting reflex (GO:0060013)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	aldehyde dehydrogenase (NAD) activity (GO:0004029)|aldehyde dehydrogenase [NAD(P)+] activity (GO:0004030)|NAD+ binding (GO:0070403)|protein homodimerization activity (GO:0042803)|thyroid hormone binding (GO:0070324)			NS(1)|central_nervous_system(2)|endometrium(3)|large_intestine(7)|lung(9)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	27	Lung NSC(78;0.00144)|all_lung(78;0.0018)|Melanoma(26;0.00852)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.0766)|Lung(145;0.103)		Vitamin A(DB00162)	AATATGTGAAGTGGAAGAAGG	0.363																																																	0								ENSG00000184254						76.0	77.0	77.0					15																	101425559		2203	4300	6503	ALDH1A3	SO:0001583	missense	0			-	HGNC	U07919	CCDS10389.1	15q26	2010-05-07			ENSG00000184254	ENSG00000184254	1.2.1.5	"""Aldehyde dehydrogenases"""	409	protein-coding gene	gene with protein product	"""retinaldehyde dehydrogenase 3"""	600463		ALDH6		7698756	Standard	XR_111558		Approved	RALDH3	uc002bwn.4	P47895	OTTHUMG00000149870	ENST00000329841.5:c.187G>T	15.37:g.101425559G>T	ENSP00000332256:p.Val63Leu	Somatic	0	39	0.00		0.5480226040680333	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	25	33.33	Q6NT64	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Aldehyde_DH_dom,superfamily_Ald_DH/histidinol_DH	p.V63L	ENST00000329841.5	37	c.187	CCDS10389.1	15	.	.	.	.	.	.	.	.	.	.	G	18.26	3.584503	0.65992	.	.	ENSG00000184254	ENST00000329841;ENST00000415812;ENST00000346623	T	0.79352	-1.26	5.71	5.71	0.89125	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, N-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.121078	0.56097	D	0.000033	T	0.76948	0.4059	M	0.66560	2.04	0.29346	N	0.86567	P;B;B	0.34934	0.476;0.05;0.05	B;B;B	0.38264	0.269;0.071;0.065	T	0.77608	-0.2524	10	0.87932	D	0	.	11.226	0.48884	0.1158:0.0:0.8842:0.0	.	74;63;63	Q7Z3A2;B2R5T2;P47895	.;.;AL1A3_HUMAN	L	63;63;74	ENSP00000332256:V63L	ENSP00000332256:V63L	V	+	1	0	ALDH1A3	99243082	0.997000	0.39634	0.943000	0.38184	0.991000	0.79684	2.646000	0.46630	2.698000	0.92095	0.561000	0.74099	GTG	-	pfam_Aldehyde_DH_dom,superfamily_Ald_DH/histidinol_DH		0.363	ALDH1A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALDH1A3	protein_coding	OTTHUMT00000313620.2	G		-		101425559	+1	no_errors	ENST00000329841	ensembl	human	known	74_37	missense	SNP	0.995	T
TRAF2	7186	genome.wustl.edu	37	9	139815618	139815618	+	Missense_Mutation	SNP	G	G	T			TCGA-WK-A8XZ-01A-11D-A37C-09	TCGA-WK-A8XZ-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	82b3cc1e-5a9f-413a-bf84-f936bf806217	4f0633e4-1412-4a20-8b9c-0451a23d8b55	g.chr9:139815618G>T	ENST00000247668.2	+	9	1141	c.1089G>T	c.(1087-1089)agG>agT	p.R363S	TRAF2_ENST00000536468.1_Missense_Mutation_p.R363S|TRAF2_ENST00000359662.3_Missense_Mutation_p.R415S	NM_021138.3	NP_066961.2	Q12933	TRAF2_HUMAN	TNF receptor-associated factor 2	363	MATH. {ECO:0000255|PROSITE- ProRule:PRU00129}.			LEMEASTYDGVFIWKISDFARKR -> RPFQAQCGHRYCSF CLASILRKL (in Ref. 1; AAA87706). {ECO:0000305}.	activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of NF-kappaB-inducing kinase activity (GO:0007250)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular protein complex assembly (GO:0043623)|cellular response to nitric oxide (GO:0071732)|innate immune response (GO:0045087)|negative regulation of glial cell apoptotic process (GO:0034351)|negative regulation of neuron death (GO:1901215)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein homodimerization activity (GO:0090073)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell cytokine production (GO:0002726)|programmed necrotic cell death (GO:0097300)|protein autoubiquitination (GO:0051865)|protein catabolic process (GO:0030163)|protein complex assembly (GO:0006461)|protein heterooligomerization (GO:0051291)|protein homotrimerization (GO:0070207)|protein K63-linked ubiquitination (GO:0070534)|regulation of apoptotic process (GO:0042981)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|regulation of immunoglobulin secretion (GO:0051023)|signal transduction (GO:0007165)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	CD40 receptor complex (GO:0035631)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|membrane raft (GO:0045121)|ubiquitin ligase complex (GO:0000151)	CD40 receptor binding (GO:0005174)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|ligase activity (GO:0016874)|protein phosphatase binding (GO:0019903)|signal transducer activity (GO:0004871)|sphingolipid binding (GO:0046625)|thioesterase binding (GO:0031996)|tumor necrosis factor receptor binding (GO:0005164)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17	all_cancers(76;0.11)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.229)	OV - Ovarian serous cystadenocarcinoma(145;4.48e-06)|Epithelial(140;9.55e-06)		ACTTCGCCAGGAAGCGCCAGG	0.582																																																	0								ENSG00000127191						73.0	65.0	68.0					9																	139815618		2203	4300	6503	TRAF2	SO:0001583	missense	0			-	HGNC	U12597	CCDS7013.1	9q34	2013-01-09			ENSG00000127191	ENSG00000127191		"""RING-type (C3HC4) zinc fingers"""	12032	protein-coding gene	gene with protein product		601895				7639698	Standard	NM_021138		Approved	TRAP3	uc004cjv.3	Q12933	OTTHUMG00000020952	ENST00000247668.2:c.1089G>T	9.37:g.139815618G>T	ENSP00000247668:p.Arg363Ser	Somatic	0	56	0.00		0.5480226040680333	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00	A8K107|B4DPJ7|Q7Z337|Q96NT2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MATH,pfam_Znf_C3HC4_RING-type,superfamily_TRAF-like,smart_Znf_RING,smart_MATH,pirsf_TNF_rcpt--assoc_TRAF,pfscan_MATH,pfscan_Znf_RING,pfscan_Znf_TRAF	p.R415S	ENST00000247668.2	37	c.1245	CCDS7013.1	9	.	.	.	.	.	.	.	.	.	.	G	19.16	3.774105	0.69992	.	.	ENSG00000127191	ENST00000536468;ENST00000432785;ENST00000247668;ENST00000359662;ENST00000371645	T;T;T	0.36699	1.52;1.52;1.24	4.23	-0.197	0.13228	TRAF-type (1);TRAF-like (1);MATH (2);	0.115084	0.64402	D	0.000013	T	0.47210	0.1433	M	0.66378	2.025	0.40472	D	0.980358	D;D;D	0.63046	0.964;0.964;0.992	P;P;P	0.62184	0.727;0.824;0.899	T	0.44787	-0.9305	10	0.72032	D	0.01	-33.4344	6.5823	0.22602	0.1639:0.2728:0.5633:0.0	.	352;338;363	Q12933-3;Q12933-4;Q12933	.;.;TRAF2_HUMAN	S	363;362;363;415;284	ENSP00000446414:R363S;ENSP00000247668:R363S;ENSP00000352685:R415S	ENSP00000247668:R363S	R	+	3	2	TRAF2	138935439	0.995000	0.38212	0.932000	0.37286	0.964000	0.63967	0.279000	0.18771	0.028000	0.15324	0.491000	0.48974	AGG	-	superfamily_TRAF-like,smart_MATH,pirsf_TNF_rcpt--assoc_TRAF,pfscan_MATH		0.582	TRAF2-007	KNOWN	basic|appris_principal|CCDS	protein_coding	TRAF2	protein_coding	OTTHUMT00000055166.1	G	NM_021138	-		139815618	+1	no_errors	ENST00000359662	ensembl	human	known	74_37	missense	SNP	0.996	T
MUC2	4583	genome.wustl.edu	37	11	1080568	1080568	+	Missense_Mutation	SNP	G	G	C			TCGA-WK-A8XZ-01A-11D-A37C-09	TCGA-WK-A8XZ-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	82b3cc1e-5a9f-413a-bf84-f936bf806217	4f0633e4-1412-4a20-8b9c-0451a23d8b55	g.chr11:1080568G>C	ENST00000441003.2	+	9	1237	c.1210G>C	c.(1210-1212)Ggg>Cgg	p.G404R	MUC2_ENST00000359061.5_Missense_Mutation_p.G404R	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	404	VWFD 2. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	CACCTTCGATGGGAAGACGTA	0.652																																																	0								ENSG00000198788						27.0	31.0	30.0					11																	1080568		2035	4186	6221	MUC2	SO:0001583	missense	0			-	HGNC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.1210G>C	11.37:g.1080568G>C	ENSP00000415183:p.Gly404Arg	Somatic	0	17	0.00		0.5480226040680333	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	4	71.43	Q14878	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,superfamily_Prot_inh_PMP,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.G404R	ENST00000441003.2	37	c.1210		11	.	.	.	.	.	.	.	.	.	.	G	15.85	2.953778	0.53293	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.70045	-0.45;-0.45	4.25	4.25	0.50352	.	0.177614	0.33515	U	0.004828	D	0.82921	0.5142	M	0.88704	2.975	0.39277	D	0.964498	P	0.42649	0.786	P	0.58130	0.833	D	0.87214	0.2249	10	0.59425	D	0.04	.	16.817	0.85736	0.0:0.0:1.0:0.0	.	404	E7EUV1	.	R	404	ENSP00000415183:G404R;ENSP00000351956:G404R	ENSP00000351956:G404R	G	+	1	0	MUC2	1070568	1.000000	0.71417	0.841000	0.33234	0.847000	0.48162	6.347000	0.73004	2.219000	0.72066	0.491000	0.48974	GGG	-	pfam_VWF_type-D,smart_VWC_out,smart_VWF_type-D		0.652	MUC2-001	KNOWN	basic|appris_principal	protein_coding	MUC2	protein_coding	OTTHUMT00000345894.2	G	NM_002457	-		1080568	+1	no_errors	ENST00000441003	ensembl	human	known	74_37	missense	SNP	1.000	C
DIS3	22894	genome.wustl.edu	37	13	73345952	73345952	+	Missense_Mutation	SNP	G	G	T			TCGA-WK-A8XZ-01A-11D-A37C-09	TCGA-WK-A8XZ-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	82b3cc1e-5a9f-413a-bf84-f936bf806217	4f0633e4-1412-4a20-8b9c-0451a23d8b55	g.chr13:73345952G>T	ENST00000377767.4	-	11	1686	c.1586C>A	c.(1585-1587)aCt>aAt	p.T529N	DIS3_ENST00000545453.1_Missense_Mutation_p.T367N|DIS3_ENST00000377780.4_Missense_Mutation_p.T499N	NM_014953.3	NP_055768.3	Q9Y2L1	RRP44_HUMAN	DIS3 exosome endoribonuclease and 3'-5' exoribonuclease	529					CUT catabolic process (GO:0071034)|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|positive regulation of GTPase activity (GO:0043547)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA catabolic process (GO:0016075)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exosome (RNase complex) (GO:0000178)|membrane (GO:0016020)|nuclear exosome (RNase complex) (GO:0000176)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	3'-5'-exoribonuclease activity (GO:0000175)|endonuclease activity (GO:0004519)|guanyl-nucleotide exchange factor activity (GO:0005085)|RNA binding (GO:0003723)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(7)|kidney(5)|large_intestine(10)|lung(6)|prostate(2)|skin(1)	35		Breast(118;0.0074)|Acute lymphoblastic leukemia(28;0.0195)		GBM - Glioblastoma multiforme(99;0.000181)		AAGATACACAGTTGTTCCTCT	0.328										Multiple Myeloma(4;0.011)																																							0								ENSG00000083520						89.0	88.0	88.0					13																	73345952		2203	4300	6503	DIS3	SO:0001583	missense	0			-	HGNC	AB023225	CCDS9447.1, CCDS45057.1	13q21.32	2014-03-05	2014-03-05	2007-01-12	ENSG00000083520	ENSG00000083520			20604	protein-coding gene	gene with protein product	"""exosome component 11"""	607533	"""KIAA1008"", ""DIS3 mitotic control homolog (S. cerevisiae)"""	KIAA1008		11935316, 9562621	Standard	XM_005266294		Approved	dis3p, RRP44, EXOSC11	uc001vix.4	Q9Y2L1	OTTHUMG00000017070	ENST00000377767.4:c.1586C>A	13.37:g.73345952G>T	ENSP00000366997:p.Thr529Asn	Somatic	0	43	0.00		0.5480226040680333	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	12	25.00	A6NI21|B2RBL2|Q5W0P7|Q5W0P8|Q658Z7|Q7Z481|Q8WWI2|Q9UG36	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_PIN_dom	p.T529N	ENST00000377767.4	37	c.1586	CCDS9447.1	13	.	.	.	.	.	.	.	.	.	.	G	22.5	4.299240	0.81025	.	.	ENSG00000083520	ENST00000377767;ENST00000377780;ENST00000545453	T;T;T	0.57752	0.38;0.38;0.38	5.76	5.76	0.90799	Ribonuclease II/R (2);	0.000000	0.85682	D	0.000000	T	0.82061	0.4955	H	0.95611	3.695	0.80722	D	1	P;D	0.76494	0.923;0.999	D;D	0.81914	0.935;0.995	D	0.86806	0.1995	10	0.87932	D	0	.	19.972	0.97287	0.0:0.0:1.0:0.0	.	499;529	Q9Y2L1-2;Q9Y2L1	.;RRP44_HUMAN	N	529;499;367	ENSP00000366997:T529N;ENSP00000367011:T499N;ENSP00000440058:T367N	ENSP00000366997:T529N	T	-	2	0	DIS3	72243953	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	7.801000	0.85960	2.724000	0.93272	0.462000	0.41574	ACT	-	NULL		0.328	DIS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DIS3	protein_coding	OTTHUMT00000045250.2	G	NM_014953	-		73345952	-1	no_errors	ENST00000377767	ensembl	human	known	74_37	missense	SNP	1.000	T
GABRA2	2555	genome.wustl.edu	37	4	46252509	46252509	+	Missense_Mutation	SNP	G	G	A			TCGA-WK-A8XZ-01A-11D-A37C-09	TCGA-WK-A8XZ-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	82b3cc1e-5a9f-413a-bf84-f936bf806217	4f0633e4-1412-4a20-8b9c-0451a23d8b55	g.chr4:46252509G>A	ENST00000510861.1	-	10	1345	c.1172C>T	c.(1171-1173)gCa>gTa	p.A391V	GABRA2_ENST00000507069.1_Missense_Mutation_p.A451V|GABRA2_ENST00000356504.1_Missense_Mutation_p.A391V|GABRA2_ENST00000514090.1_Missense_Mutation_p.A391V|GABRA2_ENST00000540012.1_Missense_Mutation_p.A396V|GABRA2_ENST00000381620.4_Missense_Mutation_p.A391V			P47869	GBRA2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 2	391					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|neurotransmitter transport (GO:0006836)|regulation of neurotransmitter levels (GO:0001505)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	axon (GO:0030424)|cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of synaptic vesicle membrane (GO:0030285)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			NS(1)|breast(1)|cervix(1)|endometrium(2)|large_intestine(9)|lung(33)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	56					Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Quinidine barbiturate(DB01346)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zolpidem(DB00425)|Zopiclone(DB01198)	TGGCGTGGTTGCACTCTTGGA	0.438																																																	0								ENSG00000151834						185.0	185.0	185.0					4																	46252509		2203	4299	6502	GABRA2	SO:0001583	missense	0			-	HGNC		CCDS3471.1	4p12	2012-06-22			ENSG00000151834	ENSG00000151834		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4076	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 2"""	137140					Standard	NM_000807		Approved		uc010igc.2	P47869	OTTHUMG00000044266	ENST00000510861.1:c.1172C>T	4.37:g.46252509G>A	ENSP00000421828:p.Ala391Val	Somatic	0	60	0.00		0.5480226040680333	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	34	10.53	A8K0U7|B7Z1H8|Q59G14	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Neurotrans-gated_channel_TM,pfam_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,prints_GABAAa_rcpt,prints_GABAA_rcpt,prints_GABBAa2_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.A396V	ENST00000510861.1	37	c.1187	CCDS3471.1	4	.	.	.	.	.	.	.	.	.	.	G	14.04	2.416278	0.42918	.	.	ENSG00000151834	ENST00000510861;ENST00000514090;ENST00000381620;ENST00000356504;ENST00000540012;ENST00000507069	D;D;D;D;D;D	0.83419	-1.72;-1.72;-1.72;-1.72;-1.72;-1.72	5.96	5.11	0.69529	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.304730	0.40728	N	0.001023	T	0.76435	0.3987	L	0.34521	1.04	0.41197	D	0.986349	P;B	0.45957	0.869;0.044	P;B	0.45167	0.472;0.04	T	0.71968	-0.4432	10	0.15066	T	0.55	.	13.6959	0.62580	0.0732:0.0:0.9268:0.0	.	396;391	B7Z1H8;P47869	.;GBRA2_HUMAN	V	391;391;391;391;396;451	ENSP00000421828:A391V;ENSP00000421300:A391V;ENSP00000371033:A391V;ENSP00000348897:A391V;ENSP00000444409:A396V;ENSP00000427603:A451V	ENSP00000348897:A391V	A	-	2	0	GABRA2	45947266	1.000000	0.71417	0.992000	0.48379	0.986000	0.74619	5.289000	0.65656	2.827000	0.97445	0.655000	0.94253	GCA	-	pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM,prints_GABBAa2_rcpt,tigrfam_Neur_channel		0.438	GABRA2-005	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	GABRA2	protein_coding	OTTHUMT00000360848.2	G		-		46252509	-1	no_errors	ENST00000540012	ensembl	human	known	74_37	missense	SNP	0.995	A
NAP1L6	645996	genome.wustl.edu	37	X	72347614	72347614	+	Silent	SNP	G	G	A			TCGA-WK-A8XZ-01A-11D-A37C-09	TCGA-WK-A8XZ-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	82b3cc1e-5a9f-413a-bf84-f936bf806217	4f0633e4-1412-4a20-8b9c-0451a23d8b55	g.chrX:72347614G>A	ENST00000373518.1	-	1	305	c.108C>T	c.(106-108)gaC>gaT	p.D36D				A6NFF2	NP1L6_HUMAN	nucleosome assembly protein 1-like 6	36					nucleosome assembly (GO:0006334)	nucleus (GO:0005634)											TAAAATCTGCGTCTGAGGAGT	0.542																																																	0								ENSG00000204118																																			NAP1L6	SO:0001819	synonymous_variant	0			-	HGNC	AK090915		Xq13.2	2013-03-27			ENSG00000204118	ENSG00000204118			31706	other	unknown							Standard	NR_027291		Approved	FLJ33596	uc004ebh.1	A6NFF2	OTTHUMG00000021826	ENST00000373518.1:c.108C>T	X.37:g.72347614G>A		Somatic	0	157	0.00		0.5480226040680333	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	65	80	44.83		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_NAP_family	p.D36	ENST00000373518.1	37	c.108		X																																																																																			-	NULL		0.542	NAP1L6-001	KNOWN	basic|appris_principal	protein_coding	NAP1L6	protein_coding	OTTHUMT00000057224.1	G	NR_027291	-		72347614	-1	no_errors	ENST00000373518	ensembl	human	known	74_37	silent	SNP	0.000	A
MSH6	2956	genome.wustl.edu	37	2	48030640	48030640	+	Frame_Shift_Del	DEL	C	C	-	rs267608078		TCGA-WK-A8XZ-01A-11D-A37C-09	TCGA-WK-A8XZ-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	82b3cc1e-5a9f-413a-bf84-f936bf806217	4f0633e4-1412-4a20-8b9c-0451a23d8b55	g.chr2:48030640delC	ENST00000234420.5	+	5	3406	c.3254delC	c.(3253-3255)accfs	p.T1085fs	MSH6_ENST00000538136.1_Frame_Shift_Del_p.T783fs|FBXO11_ENST00000405808.1_Intron|MSH6_ENST00000540021.1_Frame_Shift_Del_p.T955fs	NM_000179.2	NP_000170.1	P52701	MSH6_HUMAN	mutS homolog 6	1085					ATP catabolic process (GO:0006200)|determination of adult lifespan (GO:0008340)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|isotype switching (GO:0045190)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|positive regulation of helicase activity (GO:0051096)|reciprocal meiotic recombination (GO:0007131)|response to UV (GO:0009411)|somatic hypermutation of immunoglobulin genes (GO:0016446)|somatic recombination of immunoglobulin gene segments (GO:0016447)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|MutSalpha complex (GO:0032301)|nuclear chromatin (GO:0000790)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|damaged DNA binding (GO:0003684)|DNA-dependent ATPase activity (GO:0008094)|guanine/thymine mispair binding (GO:0032137)|methylated histone binding (GO:0035064)|mismatched DNA binding (GO:0030983)	p.0?(2)|p.F1088fs*5(1)|p.F1088fs*2(1)		breast(8)|central_nervous_system(29)|cervix(1)|endometrium(32)|haematopoietic_and_lymphoid_tissue(12)|kidney(2)|large_intestine(75)|lung(25)|ovary(3)|prostate(3)|skin(10)|stomach(22)|thyroid(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	229		Acute lymphoblastic leukemia(82;0.0299)|all_hematologic(82;0.0358)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			CCGGAAGATACCCCCCCCTTC	0.438			"""Mis, N, F, S"""		colorectal	"""colorectal, endometrial, ovarian"""		Mismatch excision repair (MMR)	Turcot syndrome;Muir-Torre syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																														yes	Rec	yes	Hereditary non-polyposis colorectal cancer	2	2p16	2956	mutS homolog 6 (E. coli)		E	4	Whole gene deletion(2)|Insertion - Frameshift(1)|Deletion - Frameshift(1)	haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|lung(1)						ENSG00000116062						130.0	115.0	120.0					2																	48030640		2203	4300	6503	MSH6	SO:0001589	frameshift_variant	0	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome; ;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III		HGNC	U54777	CCDS1836.1, CCDS62906.1, CCDS62907.1	2p16	2014-09-17	2013-09-12		ENSG00000116062	ENSG00000116062			7329	protein-coding gene	gene with protein product		600678	"""mutS (E. coli) homolog 6"", ""mutS homolog 6 (E. coli)"""	GTBP		7604266	Standard	NM_000179		Approved		uc002rwd.4	P52701	OTTHUMG00000129129	ENST00000234420.5:c.3254delC	2.37:g.48030640delC	ENSP00000234420:p.Thr1085fs	Somatic	0	67	0.00		0.5480226040680333	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	27	10.00	B4DF41|B4E3I4|F5H2F9|O43706|O43917|Q8TCX4|Q9BTB5	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_DNA_mismatch_repair_MutS_C,pfam_DNA_mismatch_repair_MutS-lik_N,pfam_DNA_mismatch_repair_MutS_core,pfam_PWWP_dom,pfam_DNA_mismatch_repair_MutS_clamp,pfam_DNA_mmatch_repair_MutS_con_dom,superfamily_DNA_mismatch_repair_MutS_core,superfamily_P-loop_NTPase,superfamily_DNA_mismatch_repair_MutS_N,superfamily_DNA_mmatch_repair_MutS_con_dom,smart_PWWP_dom,smart_DNA_mismatch_repair_MutS_core,smart_DNA_mismatch_repair_MutS_C,pirsf_DNA_mismatch_repair_Msh6,pfscan_PWWP_dom	p.F1088fs	ENST00000234420.5	37	c.3254	CCDS1836.1	2																																																																																			-	pfam_DNA_mismatch_repair_MutS_C,superfamily_P-loop_NTPase,smart_DNA_mismatch_repair_MutS_core,pirsf_DNA_mismatch_repair_Msh6		0.438	MSH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MSH6	protein_coding	OTTHUMT00000251180.4	C	NM_000179			48030640	+1	no_errors	ENST00000234420	ensembl	human	known	74_37	frame_shift_del	DEL	0.003	-
NIPAL3	57185	genome.wustl.edu	37	1	24779930	24779930	+	Silent	SNP	C	C	T			TCGA-WK-A8XZ-01A-11D-A37C-09	TCGA-WK-A8XZ-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	82b3cc1e-5a9f-413a-bf84-f936bf806217	4f0633e4-1412-4a20-8b9c-0451a23d8b55	g.chr1:24779930C>T	ENST00000374399.4	+	7	941	c.573C>T	c.(571-573)ctC>ctT	p.L191L	NIPAL3_ENST00000003912.3_Silent_p.L109L|NIPAL3_ENST00000358028.4_Silent_p.L191L|NIPAL3_ENST00000339255.2_Silent_p.L191L|NIPAL3_ENST00000428131.1_Silent_p.L191L	NM_020448.4	NP_065181.1	Q6P499	NPAL3_HUMAN	NIPA-like domain containing 3	191						integral component of membrane (GO:0016021)	magnesium ion transmembrane transporter activity (GO:0015095)			endometrium(1)|kidney(1)|large_intestine(6)|lung(5)|skin(1)	14						GCTTGCTGCTCTACTTCTACA	0.522																																																	0								ENSG00000001461						148.0	119.0	129.0					1																	24779930		2203	4300	6503	NIPAL3	SO:0001819	synonymous_variant	0			-	HGNC	BX640883	CCDS30631.1	1p36.12-p35.1	2009-03-24		2009-03-24	ENSG00000001461	ENSG00000001461			25233	protein-coding gene	gene with protein product				NPAL3		8619474, 9110174	Standard	NM_020448		Approved	DJ462O23.2	uc001bjh.3	Q6P499	OTTHUMG00000003299	ENST00000374399.4:c.573C>T	1.37:g.24779930C>T		Somatic	0	34	0.00		0.5480226040680333	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	20	33.33	A2A298|Q6MZT9|Q9BVE6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Mg_trans_NIPA	p.L191	ENST00000374399.4	37	c.573	CCDS30631.1	1																																																																																			-	pfam_Mg_trans_NIPA		0.522	NIPAL3-007	KNOWN	basic|appris_principal|CCDS	protein_coding	NIPAL3	protein_coding	OTTHUMT00000276996.1	C	NM_020448	-		24779930	+1	no_errors	ENST00000374399	ensembl	human	known	74_37	silent	SNP	0.970	T
PGLYRP3	114771	genome.wustl.edu	37	1	153283134	153283134	+	Missense_Mutation	SNP	G	G	A	rs79228057	byFrequency	TCGA-WK-A8XZ-01A-11D-A37C-09	TCGA-WK-A8XZ-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	82b3cc1e-5a9f-413a-bf84-f936bf806217	4f0633e4-1412-4a20-8b9c-0451a23d8b55	g.chr1:153283134G>A	ENST00000290722.1	-	1	60	c.8C>T	c.(7-9)aCg>aTg	p.T3M		NM_052891.1	NP_443123.1	Q96LB9	PGRP3_HUMAN	peptidoglycan recognition protein 3	3					defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|growth of symbiont in host (GO:0044117)|innate immune response (GO:0045087)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of natural killer cell differentiation involved in immune response (GO:0032827)|pattern recognition receptor signaling pathway (GO:0002221)|peptidoglycan catabolic process (GO:0009253)	extracellular region (GO:0005576)|intracellular (GO:0005622)|membrane (GO:0016020)	N-acetylmuramoyl-L-alanine amidase activity (GO:0008745)|peptidoglycan binding (GO:0042834)|peptidoglycan receptor activity (GO:0016019)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(1)|liver(1)|lung(10)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	28	all_lung(78;3.35e-32)|Lung NSC(65;1.22e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			CCATGGCAGCGTCCCCATGTG	0.522													G|||	4	0.000798722	0.0	0.0	5008	,	,		19577	0.001		0.0	False		,,,				2504	0.0031																0								ENSG00000159527	G	MET/THR	0,4406		0,0,2203	153.0	151.0	152.0		8	2.1	0.1	1	dbSNP_131	152	2,8598	2.2+/-6.3	0,2,4298	yes	missense	PGLYRP3	NM_052891.1	81	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	benign	3/342	153283134	2,13004	2203	4300	6503	PGLYRP3	SO:0001583	missense	0			GMAF=0.0005	HGNC	AY035376	CCDS1035.1	1q21	2008-02-05			ENSG00000159527	ENSG00000159527			30014	protein-coding gene	gene with protein product	"""peptidoglycan recognition protein I alpha precursor"""	608197				11461926	Standard	NM_052891		Approved	PGRPIA, PGLYRPIalpha, PGRP-Ialpha	uc001fbn.1	Q96LB9	OTTHUMG00000014044	ENST00000290722.1:c.8C>T	1.37:g.153283134G>A	ENSP00000290722:p.Thr3Met	Somatic	0	33	0.00		0.5480226040680333	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	18	43.75	A1A4U8|Q5SY65	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Amidase_domain,superfamily_Amidase_domain,smart_PGRP_domain_met/bac,smart_Amidase_domain	p.T3M	ENST00000290722.1	37	c.8	CCDS1035.1	1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	0.271	-0.992979	0.02162	0.0	2.33E-4	ENSG00000159527	ENST00000290722	T	0.07327	3.2	3.22	2.09	0.27110	.	0.141721	0.33075	N	0.005313	T	0.00552	0.0018	N	0.00217	-1.83	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.48670	-0.9015	10	0.40728	T	0.16	.	5.4417	0.16513	0.8689:0.0:0.1311:0.0	.	3	Q96LB9	PGRP3_HUMAN	M	3	ENSP00000290722:T3M	ENSP00000290722:T3M	T	-	2	0	PGLYRP3	151549758	0.824000	0.29247	0.085000	0.20634	0.001000	0.01503	1.975000	0.40569	0.592000	0.29728	-0.294000	0.09567	ACG	-	NULL		0.522	PGLYRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PGLYRP3	protein_coding	OTTHUMT00000039488.1	G	NM_052891	rs79228057		153283134	-1	no_errors	ENST00000290722	ensembl	human	known	74_37	missense	SNP	0.128	A
HOOK2	29911	genome.wustl.edu	37	19	12874565	12874565	+	Silent	SNP	G	G	T			TCGA-WK-A8XZ-01A-11D-A37C-09	TCGA-WK-A8XZ-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	82b3cc1e-5a9f-413a-bf84-f936bf806217	4f0633e4-1412-4a20-8b9c-0451a23d8b55	g.chr19:12874565G>T	ENST00000397668.3	-	21	1928	c.1855C>A	c.(1855-1857)Cgg>Agg	p.R619R	HOOK2_ENST00000264827.5_Silent_p.R617R|HOOK2_ENST00000589965.1_5'Flank	NM_013312.2	NP_037444.2	Q96ED9	HOOK2_HUMAN	hook microtubule-tethering protein 2	619	Required for localization to the centrosome and induction of aggresome formation.|Sufficient for interaction with CNTRL.				early endosome to late endosome transport (GO:0045022)|endocytosis (GO:0006897)|endosome organization (GO:0007032)|endosome to lysosome transport (GO:0008333)|lysosome organization (GO:0007040)|protein transport (GO:0015031)	centrosome (GO:0005813)|FHF complex (GO:0070695)|microtubule (GO:0005874)	identical protein binding (GO:0042802)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(5)|skin(1)	20						GCAGCTGGCCGCTGCTTGGGT	0.597																																																	0								ENSG00000095066						46.0	54.0	51.0					19																	12874565		2123	4256	6379	HOOK2	SO:0001819	synonymous_variant	0			-	HGNC	AF044924	CCDS42507.1, CCDS42508.1	19p13.2	2013-08-21	2013-08-21						19885	protein-coding gene	gene with protein product		607824	"""hook homolog 2 (Drosophila)"""			9927460	Standard	NM_013312		Approved	HK2	uc002muy.2	Q96ED9		ENST00000397668.3:c.1855C>A	19.37:g.12874565G>T		Somatic	0	29	0.00		0.5480226040680333	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	16	15.79	O60562	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Hook-related_fam,superfamily_UBA-like	p.R619	ENST00000397668.3	37	c.1855	CCDS42508.1	19																																																																																			-	pfam_Hook-related_fam		0.597	HOOK2-002	KNOWN	basic|CCDS	protein_coding	HOOK2	protein_coding	OTTHUMT00000451008.1	G	NM_013312	-		12874565	-1	no_errors	ENST00000397668	ensembl	human	known	74_37	silent	SNP	0.632	T
AR	367	genome.wustl.edu	37	X	66765229	66765229	+	Missense_Mutation	SNP	G	G	C			TCGA-WK-A8XZ-01A-11D-A37C-09	TCGA-WK-A8XZ-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	82b3cc1e-5a9f-413a-bf84-f936bf806217	4f0633e4-1412-4a20-8b9c-0451a23d8b55	g.chrX:66765229G>C	ENST00000374690.3	+	1	765	c.241G>C	c.(241-243)Gag>Cag	p.E81Q	AR_ENST00000396044.3_Missense_Mutation_p.E81Q|AR_ENST00000504326.1_Missense_Mutation_p.E81Q|AR_ENST00000513847.1_3'UTR	NM_000044.3	NP_000035.2	P10275	ANDR_HUMAN	androgen receptor	79	Gln-rich.|Modulating.				androgen receptor signaling pathway (GO:0030521)|cell death (GO:0008219)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of integrin biosynthetic process (GO:0045720)|positive regulation of cell proliferation (GO:0008284)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein oligomerization (GO:0051259)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	androgen binding (GO:0005497)|androgen receptor activity (GO:0004882)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|prostate(11)|stomach(2)|upper_aerodigestive_tract(3)	67	all_cancers(1;0.173)|Prostate(1;2.27e-16)|all_epithelial(1;0.102)	all_lung(315;1.3e-11)			Bicalutamide(DB01128)|Cyproterone acetate(DB04839)|Danazol(DB01406)|Drospirenone(DB01395)|Drostanolone(DB00858)|Enzalutamide(DB08899)|Fludrocortisone(DB00687)|Fluoxymesterone(DB01185)|Flutamide(DB00499)|Ketoconazole(DB01026)|Levonorgestrel(DB00367)|Methyltestosterone(DB06710)|Nandrolone decanoate(DB08804)|Nandrolone phenpropionate(DB00984)|Nilutamide(DB00665)|Oxandrolone(DB00621)|Spironolactone(DB00421)|Testosterone Propionate(DB01420)|Testosterone(DB00624)	gcagcagcaagagactagccc	0.642									Androgen Insensitivity Syndrome																																								0								ENSG00000169083						11.0	10.0	10.0					X																	66765229		2156	4212	6368	AR	SO:0001583	missense	0	Familial Cancer Database	CAIS, Testicular Feminisation, AIS, Morris syndrome; incl. Reifenstein Syndrome	-	HGNC	M20132	CCDS14387.1, CCDS43965.1	Xq12	2013-01-16	2008-08-07		ENSG00000169083	ENSG00000169083		"""Nuclear hormone receptors"""	644	protein-coding gene	gene with protein product	"""testicular feminization"", ""Kennedy disease"""	313700	"""dihydrotestosterone receptor"", ""spinal and bulbar muscular atrophy"""	DHTR, SBMA		3353726, 3377788	Standard	NM_000044		Approved	AIS, NR3C4, SMAX1, HUMARA	uc004dwu.2	P10275	OTTHUMG00000021740	ENST00000374690.3:c.241G>C	X.37:g.66765229G>C	ENSP00000363822:p.Glu81Gln	Somatic	0	49	0.00		0.5480226040680333	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	35	16.28	A2RUN2|B1AKD7|Q9UD95	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Andrgn_rcpt,pfam_Znf_hrmn_rcpt,pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Andrgn_rcpt,prints_Znf_hrmn_rcpt	p.E81Q	ENST00000374690.3	37	c.241	CCDS14387.1	X	.	.	.	.	.	.	.	.	.	.	N	0.251	-1.006630	0.02112	.	.	ENSG00000169083	ENST00000374690;ENST00000504326;ENST00000396044;ENST00000538891	T;T;T	0.71934	-0.61;-0.61;-0.61	5.2	-5.32	0.02722	.	.	.	.	.	T	0.50120	0.1597	N	0.05280	-0.08	0.09310	N	1	B;B;B	0.34329	0.078;0.025;0.449	B;B;B	0.38921	0.026;0.016;0.285	T	0.36841	-0.9731	9	0.20046	T	0.44	.	17.1942	0.86888	0.0:0.7494:0.1481:0.1025	.	81;81;79	E7EVX6;D3YPQ2;P10275	.;.;ANDR_HUMAN	Q	81;81;81;73	ENSP00000363822:E81Q;ENSP00000421155:E81Q;ENSP00000379359:E81Q	ENSP00000363822:E81Q	E	+	1	0	AR	66681954	0.000000	0.05858	0.001000	0.08648	0.047000	0.14425	-2.343000	0.01099	-1.154000	0.02825	-0.206000	0.12725	GAG	-	pfam_Andrgn_rcpt		0.642	AR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AR	protein_coding	OTTHUMT00000057007.1	G	NM_000044	-		66765229	+1	no_errors	ENST00000374690	ensembl	human	known	74_37	missense	SNP	0.001	C
RB1	5925	genome.wustl.edu	37	13	48955526	48955550	+	Frame_Shift_Del	DEL	AAACATTTAGAACGATGTGAACATC	AAACATTTAGAACGATGTGAACATC	-	rs147534828|rs121913303|rs146236493|rs121913304		TCGA-WK-A8XZ-01A-11D-A37C-09	TCGA-WK-A8XZ-10A-01D-A37F-09	AAACATTTAGAACGATGTGAACATC	AAACATTTAGAACGATGTGAACATC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	82b3cc1e-5a9f-413a-bf84-f936bf806217	4f0633e4-1412-4a20-8b9c-0451a23d8b55	g.chr13:48955526_48955550delAAACATTTAGAACGATGTGAACATC	ENST00000267163.4	+	17	1780_1804	c.1642_1666delAAACATTTAGAACGATGTGAACATC	c.(1642-1668)aaacatttagaacgatgtgaacatcgafs	p.KHLERCEHR548fs		NM_000321.2	NP_000312.2	P06400	RB_HUMAN	retinoblastoma 1	548	Domain A.|Pocket; binds T and E1A.				androgen receptor signaling pathway (GO:0030521)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell morphogenesis involved in neuron differentiation (GO:0048667)|chromatin remodeling (GO:0006338)|digestive tract development (GO:0048565)|enucleate erythrocyte differentiation (GO:0043353)|G1/S transition of mitotic cell cycle (GO:0000082)|glial cell apoptotic process (GO:0034349)|hepatocyte apoptotic process (GO:0097284)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|myoblast differentiation (GO:0045445)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|neuron maturation (GO:0042551)|neuron projection development (GO:0031175)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to chromosome, centromeric region (GO:0071459)|Ras protein signal transduction (GO:0007265)|regulation of centromere complex assembly (GO:0090230)|regulation of cohesin localization to chromatin (GO:0071922)|regulation of lipid kinase activity (GO:0043550)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|sister chromatid biorientation (GO:0031134)|skeletal muscle cell differentiation (GO:0035914)|striated muscle cell differentiation (GO:0051146)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|Rb-E2F complex (GO:0035189)|spindle (GO:0005819)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|phosphoprotein binding (GO:0051219)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.0?(15)|p.?(8)|p.R552*(5)|p.R556*(5)|p.C553fs*53(1)		NS(3)|adrenal_gland(1)|bone(22)|breast(30)|central_nervous_system(48)|cervix(3)|endometrium(14)|eye(95)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(20)|kidney(3)|large_intestine(10)|liver(3)|lung(153)|oesophagus(1)|ovary(13)|pancreas(5)|pituitary(1)|prostate(14)|salivary_gland(2)|skin(9)|soft_tissue(9)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(31)	496		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	AGAAATGATAAAACATTTAGAACGATGTGAACATCGAATCATGGA	0.342	R552*(NCIH1048_LUNG)	6	"""D, Mis, N, F, S"""		"""retinoblastoma, sarcoma, breast, small cell lung"""	"""retinoblastoma, sarcoma, breast, small cell lung"""			Hereditary Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)																													yes	Rec	yes	Familial retinoblastoma	13	13q14	5925	retinoblastoma gene		"""L, E, M, O"""	34	Whole gene deletion(15)|Substitution - Nonsense(10)|Unknown(8)|Deletion - Frameshift(1)	bone(11)|eye(7)|central_nervous_system(5)|breast(5)|adrenal_gland(1)|soft_tissue(1)|haematopoietic_and_lymphoid_tissue(1)|endometrium(1)|lung(1)|ovary(1)	GRCh37	CM942039|CM952103|CM961229|CM961230|CM961231	RB1	M	rs121913303|rs121913304	ENSG00000139687																																			RB1	SO:0001589	frameshift_variant	0	Familial Cancer Database			HGNC	M15400	CCDS31973.1	13q14.2	2014-09-17	2008-07-31		ENSG00000139687	ENSG00000139687		"""Endogenous ligands"""	9884	protein-coding gene	gene with protein product	"""prepro-retinoblastoma-associated protein"", ""protein phosphatase 1, regulatory subunit 130"""	614041	"""osteosarcoma"""	OSRC		1857421, 15057823	Standard	NM_000321		Approved	RB, PPP1R130	uc001vcb.3	P06400	OTTHUMG00000016900	ENST00000267163.4:c.1642_1666delAAACATTTAGAACGATGTGAACATC	13.37:g.48955526_48955550delAAACATTTAGAACGATGTGAACATC	ENSP00000267163:p.Lys548fs	Somatic	NA	NA	NA		0.5480226040680333	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A8K5E3|P78499|Q5VW46|Q8IZL4	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_RB_C,pfam_RB_A,pfam_RB_B,pfam_RB_N,superfamily_Cyclin-like,smart_Cyclin-like	p.K548fs	ENST00000267163.4	37	c.1642_1666	CCDS31973.1	13																																																																																			-	pfam_RB_A,superfamily_Cyclin-like		0.342	RB1-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	RB1	protein_coding	OTTHUMT00000044884.1	AAACATTTAGAACGATGTGAACATC				48955550	+1	no_errors	ENST00000267163	ensembl	human	known	74_37	frame_shift_del	DEL	1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000	-
ANKRD44	91526	genome.wustl.edu	37	2	197943383	197943384	+	Frame_Shift_Del	DEL	TG	TG	-	rs139294990		TCGA-WK-A8XZ-01A-11D-A37C-09	TCGA-WK-A8XZ-10A-01D-A37F-09	TG	TG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	82b3cc1e-5a9f-413a-bf84-f936bf806217	4f0633e4-1412-4a20-8b9c-0451a23d8b55	g.chr2:197943383_197943384delTG	ENST00000409153.1	-	16	1875_1876	c.1693_1694delCA	c.(1693-1695)catfs	p.H565fs	ANKRD44_ENST00000282272.8_Intron|ANKRD44_ENST00000450567.1_Intron|ANKRD44_ENST00000539527.1_Frame_Shift_Del_p.H493fs|ANKRD44_ENST00000337207.5_Intron|ANKRD44_ENST00000328737.2_Intron			Q8N8A2	ANR44_HUMAN	ankyrin repeat domain 44	0										NS(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(20)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	45			OV - Ovarian serous cystadenocarcinoma(117;0.246)			ATTTGGGGTATGTGTGTGTGTG	0.411																																																	0								ENSG00000065413																																			ANKRD44	SO:0001589	frameshift_variant	0				HGNC	AK097086	CCDS33355.1, CCDS33355.2, CCDS74619.1	2q33.1	2013-01-10			ENSG00000065413	ENSG00000065413		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"", ""Ankyrin repeat domain containing"""	25259	protein-coding gene	gene with protein product	"""protein phosphatase 6 ankyrin repeat subunit B"""						Standard	NM_153697		Approved	PP6-ARS-B	uc021vuj.1	Q8N8A2	OTTHUMG00000154411	ENST00000409153.1:c.1693_1694delCA	2.37:g.197943393_197943394delTG	ENSP00000387141:p.His565fs	Somatic	0	34	0.00		0.5480226040680333	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	31	11.43	Q53SL9|Q6P480|Q86VL5|Q8IZ72|Q9UFA4	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.H565fs	ENST00000409153.1	37	c.1694_1693		2																																																																																			-	NULL		0.411	ANKRD44-003	KNOWN	basic	protein_coding	ANKRD44	protein_coding	OTTHUMT00000335114.3	TG	NM_153697			197943384	-1	no_errors	ENST00000409153	ensembl	human	known	74_37	frame_shift_del	DEL	0.001:0.002	-
CARM1P1	100130873	genome.wustl.edu	37	9	2921838	2921838	+	RNA	SNP	C	C	T			TCGA-WK-A8XZ-01A-11D-A37C-09	TCGA-WK-A8XZ-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	82b3cc1e-5a9f-413a-bf84-f936bf806217	4f0633e4-1412-4a20-8b9c-0451a23d8b55	g.chr9:2921838C>T	ENST00000408523.2	-	0	88																											GTGTATTTGACTGTTCCAGCC	0.383																																																	0								ENSG00000227835																																			CARM1P1			0			-	HGNC																													9.37:g.2921838C>T		Somatic	0	36	0.00		0.5480226040680333	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	29	12.12		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000408523.2	37	NULL		9																																																																																			-	-		0.383	AL589675.1-201	NOVEL	basic	miRNA	CARM1P1	miRNA		C		-		2921838	-1	no_errors	ENST00000497195	ensembl	human	known	74_37	rna	SNP	0.938	T
MACF1	23499	genome.wustl.edu	37	1	39888445	39888445	+	Missense_Mutation	SNP	G	G	C			TCGA-WK-A8XZ-01A-11D-A37C-09	TCGA-WK-A8XZ-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	82b3cc1e-5a9f-413a-bf84-f936bf806217	4f0633e4-1412-4a20-8b9c-0451a23d8b55	g.chr1:39888445G>C	ENST00000372915.3	+	59	16124	c.16037G>C	c.(16036-16038)tGt>tCt	p.C5346S	MACF1_ENST00000545844.1_Missense_Mutation_p.C3279S|MACF1_ENST00000289893.4_Missense_Mutation_p.C3781S|MACF1_ENST00000317713.7_Missense_Mutation_p.C3279S|MACF1_ENST00000539005.1_Missense_Mutation_p.C3258S|MACF1_ENST00000361689.2_Missense_Mutation_p.C3279S|MACF1_ENST00000567887.1_Missense_Mutation_p.C5378S|MACF1_ENST00000564288.1_Missense_Mutation_p.C5341S			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	5346					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			TTGTTGCATTGTGGGAAGTTT	0.438																																																	0								ENSG00000127603						137.0	127.0	130.0					1																	39888445		2203	4300	6503	MACF1	SO:0001583	missense	0			-	HGNC	AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.16037G>C	1.37:g.39888445G>C	ENSP00000362006:p.Cys5346Ser	Somatic	0	47	0.00		0.5480226040680333	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	25	32.43	B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Spectrin_repeat,pfam_CH-domain,pfam_GAS2_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_GAS2_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_EF_hand_dom,smart_GAS2_dom,pfscan_CH-domain,pfscan_EF_hand_dom	p.C3279S	ENST00000372915.3	37	c.9836		1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	26.3|26.3	4.729087|4.729087	0.89390|0.89390	.|.	.|.	ENSG00000127603|ENSG00000127603	ENST00000545844;ENST00000372915;ENST00000361689;ENST00000317713;ENST00000539005;ENST00000289893;ENST00000482035|ENST00000372925	T;T;T;T;T;T;T|.	0.33216|.	1.42;1.42;1.42;1.42;1.42;1.42;1.42|.	5.96|5.96	5.96|5.96	0.96718|0.96718	.|.	0.000000|.	0.64402|.	D|.	0.000001|.	T|T	0.57417|0.57417	0.2052|0.2052	N|N	0.25201|0.25201	0.72|0.72	0.80722|0.80722	D|D	1|1	D;D;P|.	0.67145|.	0.996;0.984;0.708|.	D;P;B|.	0.76575|.	0.988;0.835;0.395|.	T|T	0.49123|0.49123	-0.8972|-0.8972	10|5	0.22109|.	T|.	0.4|.	.|.	20.4043|20.4043	0.99006|0.99006	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	5346;3279;3223|.	Q9UPN3;F8W8Q1;Q9UPN3-3|.	MACF1_HUMAN;.;.|.	S|F	3279;5346;3279;3279;3258;3781;95|2391	ENSP00000439537:C3279S;ENSP00000362006:C5346S;ENSP00000354573:C3279S;ENSP00000313438:C3279S;ENSP00000444364:C3258S;ENSP00000289893:C3781S;ENSP00000433104:C95S|.	ENSP00000289893:C3781S|.	C|L	+|+	2|3	0|2	MACF1|MACF1	39661032|39661032	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	9.864000|9.864000	0.99589|0.99589	2.823000|2.823000	0.97156|0.97156	0.650000|0.650000	0.86243|0.86243	TGT|TTG	-	NULL		0.438	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	MACF1	protein_coding	OTTHUMT00000392096.1	G	NM_033044	-		39888445	+1	no_errors	ENST00000317713	ensembl	human	known	74_37	missense	SNP	1.000	C
ARHGAP21	57584	genome.wustl.edu	37	10	24959220	24959220	+	Missense_Mutation	SNP	G	G	T			TCGA-WK-A8XZ-01A-11D-A37C-09	TCGA-WK-A8XZ-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	82b3cc1e-5a9f-413a-bf84-f936bf806217	4f0633e4-1412-4a20-8b9c-0451a23d8b55	g.chr10:24959220G>T	ENST00000396432.2	-	3	656	c.170C>A	c.(169-171)tCt>tAt	p.S57Y		NM_020824.3	NP_065875.3	Q5T5U3	RHG21_HUMAN	Rho GTPase activating protein 21	56	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				establishment of Golgi localization (GO:0051683)|Golgi organization (GO:0007030)|maintenance of Golgi location (GO:0051684)|organelle transport along microtubule (GO:0072384)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(17)|lung(21)|ovary(7)|pancreas(1)|prostate(5)|skin(2)|stomach(2)|urinary_tract(1)	78						AAAGCCTTGAGATGTTCTTTT	0.348																																																	0								ENSG00000107863						138.0	123.0	128.0					10																	24959220		2203	4300	6503	ARHGAP21	SO:0001583	missense	0			-	HGNC	AF480466	CCDS7144.2	10p12.31	2013-01-10			ENSG00000107863	ENSG00000107863		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	23725	protein-coding gene	gene with protein product		609870				12056806	Standard	NM_020824		Approved	KIAA1424, ARHGAP10	uc001isb.2	Q5T5U3	OTTHUMG00000017825	ENST00000396432.2:c.170C>A	10.37:g.24959220G>T	ENSP00000379709:p.Ser57Tyr	Somatic	0	58	0.00		0.5480226040680333	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	33	10.81	Q0VF98|Q7Z3P7|Q8N3A2|Q8NI19|Q8TBV5|Q9P2C3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RhoGAP_dom,pfam_Pleckstrin_homology,pfam_PDZ,superfamily_Rho_GTPase_activation_prot,superfamily_PDZ,smart_PDZ,smart_Pleckstrin_homology,smart_RhoGAP_dom,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_RhoGAP_dom	p.S57Y	ENST00000396432.2	37	c.170	CCDS7144.2	10	.	.	.	.	.	.	.	.	.	.	G	28.0	4.877942	0.91664	.	.	ENSG00000107863	ENST00000396432;ENST00000447364;ENST00000376410;ENST00000446003;ENST00000416305	T;T;T;T	0.18174	2.23;2.23;2.23;2.23	5.19	5.19	0.71726	PDZ/DHR/GLGF (2);	0.053667	0.85682	D	0.000000	T	0.44603	0.1301	M	0.76838	2.35	0.80722	D	1	D;P;D	0.61697	0.984;0.95;0.99	D;P;P	0.66351	0.943;0.824;0.892	T	0.44436	-0.9328	10	0.72032	D	0.01	.	19.0741	0.93151	0.0:0.0:1.0:0.0	.	57;56;56	F8W9U9;Q5T5U2;Q5T5U3	.;.;RHG21_HUMAN	Y	57;56;57;57;46	ENSP00000379709:S57Y;ENSP00000365592:S57Y;ENSP00000405018:S57Y;ENSP00000400566:S46Y	ENSP00000365592:S57Y	S	-	2	0	ARHGAP21	24999226	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.120000	0.94369	2.554000	0.86153	0.650000	0.86243	TCT	-	superfamily_PDZ,pfscan_PDZ		0.348	ARHGAP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP21	protein_coding	OTTHUMT00000047229.4	G	NM_020824	-		24959220	-1	no_errors	ENST00000396432	ensembl	human	known	74_37	missense	SNP	1.000	T
LRP2	4036	genome.wustl.edu	37	2	170003437	170003437	+	Missense_Mutation	SNP	G	G	T			TCGA-WK-A8XZ-01A-11D-A37C-09	TCGA-WK-A8XZ-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	82b3cc1e-5a9f-413a-bf84-f936bf806217	4f0633e4-1412-4a20-8b9c-0451a23d8b55	g.chr2:170003437G>T	ENST00000263816.3	-	69	12908	c.12623C>A	c.(12622-12624)cCt>cAt	p.P4208H		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	4208					cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	CTCGATTTTAGGTTCCTTTCC	0.463																																																	0								ENSG00000081479						75.0	57.0	63.0					2																	170003437		2203	4300	6503	LRP2	SO:0001583	missense	0			-	HGNC		CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.12623C>A	2.37:g.170003437G>T	ENSP00000263816:p.Pro4208His	Somatic	0	65	0.00		0.5480226040680333	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	44	21.43	O00711|Q16215	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,superfamily_TIL_dom,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.P4208H	ENST00000263816.3	37	c.12623	CCDS2232.1	2	.	.	.	.	.	.	.	.	.	.	G	28.5	4.922246	0.92319	.	.	ENSG00000081479	ENST00000263816	D	0.96685	-4.09	5.67	5.67	0.87782	Six-bladed beta-propeller, TolB-like (1);Growth factor, receptor (1);	0.102069	0.64402	D	0.000002	D	0.98741	0.9577	H	0.94925	3.6	0.80722	D	1	D	0.89917	1.0	D	0.75020	0.985	D	0.99391	1.0925	10	0.87932	D	0	.	19.7612	0.96319	0.0:0.0:1.0:0.0	.	4208	P98164	LRP2_HUMAN	H	4208	ENSP00000263816:P4208H	ENSP00000263816:P4208H	P	-	2	0	LRP2	169711683	1.000000	0.71417	0.622000	0.29159	0.964000	0.63967	9.869000	0.99810	2.670000	0.90874	0.655000	0.94253	CCT	-	pfam_LDLR_classB_rpt,superfamily_Growth_fac_rcpt_N_dom,smart_LDLR_classB_rpt,pfscan_LDLR_classB_rpt		0.463	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP2	protein_coding	OTTHUMT00000255231.2	G	NM_004525	-		170003437	-1	no_errors	ENST00000263816	ensembl	human	known	74_37	missense	SNP	1.000	T
MTERF3	51001	genome.wustl.edu	37	8	97258655	97258655	+	Missense_Mutation	SNP	G	G	T			TCGA-WK-A8XZ-01A-11D-A37C-09	TCGA-WK-A8XZ-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	82b3cc1e-5a9f-413a-bf84-f936bf806217	4f0633e4-1412-4a20-8b9c-0451a23d8b55	g.chr8:97258655G>T	ENST00000287025.3	-	5	803	c.705C>A	c.(703-705)ttC>ttA	p.F235L	MTERFD1_ENST00000524341.1_Missense_Mutation_p.F45L|MTERFD1_ENST00000522822.1_Missense_Mutation_p.F114L|MTERFD1_ENST00000523821.1_Missense_Mutation_p.F235L	NM_015942.3	NP_057026.3	Q96E29	MTEF3_HUMAN		235					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)	transcription regulatory region DNA binding (GO:0044212)			endometrium(1)|kidney(1)|large_intestine(7)|lung(7)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	24	Breast(36;5.16e-05)					CTGCTTTACTGAAATTTTTTG	0.353																																																	0								ENSG00000156469						74.0	72.0	73.0					8																	97258655		2203	4300	6503	MTERFD1	SO:0001583	missense	0			-	HGNC																												ENST00000287025.3:c.705C>A	8.37:g.97258655G>T	ENSP00000287025:p.Phe235Leu	Somatic	0	71	0.00		0.5480226040680333	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00	B3KMG6|G3V130|Q9Y301	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Mit_transcrip_term-rel,smart_Mit_transcrip_term-rel	p.F235L	ENST00000287025.3	37	c.705	CCDS6270.1	8	.	.	.	.	.	.	.	.	.	.	G	21.8	4.196815	0.79015	.	.	ENSG00000156469	ENST00000523821;ENST00000522822;ENST00000524341;ENST00000287025	T;T;T;T	0.18810	2.19;2.19;2.19;2.19	6.02	4.25	0.50352	.	0.000000	0.85682	D	0.000000	T	0.40619	0.1124	M	0.74258	2.255	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.29488	-1.0010	10	0.17832	T	0.49	-8.2129	9.2183	0.37362	0.2359:0.0:0.7641:0.0	.	235;235	E5RIK9;Q96E29	.;MTER1_HUMAN	L	235;114;45;235	ENSP00000429400:F235L;ENSP00000430138:F114L;ENSP00000429267:F45L;ENSP00000287025:F235L	ENSP00000287025:F235L	F	-	3	2	MTERFD1	97327831	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.559000	0.53756	0.891000	0.36235	0.650000	0.86243	TTC	-	pfam_Mit_transcrip_term-rel,smart_Mit_transcrip_term-rel		0.353	MTERFD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MTERFD1	protein_coding	OTTHUMT00000379876.1	G		-		97258655	-1	no_errors	ENST00000287025	ensembl	human	known	74_37	missense	SNP	1.000	T
R3HDM2	22864	genome.wustl.edu	37	12	57674222	57674222	+	Silent	SNP	C	C	T			TCGA-WK-A8XZ-01A-11D-A37C-09	TCGA-WK-A8XZ-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	82b3cc1e-5a9f-413a-bf84-f936bf806217	4f0633e4-1412-4a20-8b9c-0451a23d8b55	g.chr12:57674222C>T	ENST00000347140.3	-	14	1611	c.1221G>A	c.(1219-1221)caG>caA	p.Q407Q	R3HDM2_ENST00000413953.2_Silent_p.Q134Q|R3HDM2_ENST00000403821.2_Silent_p.Q407Q|RP11-123K3.4_ENST00000548184.1_3'UTR|R3HDM2_ENST00000358907.2_Silent_p.Q407Q|R3HDM2_ENST00000402412.1_Silent_p.Q421Q|R3HDM2_ENST00000441731.2_Silent_p.Q68Q			Q9Y2K5	R3HD2_HUMAN	R3H domain containing 2	407	Gln-rich.					nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(3)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	22						gctgctgctgctgttgctgct	0.567																																																	0								ENSG00000179912						104.0	93.0	97.0					12																	57674222		2203	4300	6503	R3HDM2	SO:0001819	synonymous_variant	0			-	HGNC	AB023219	CCDS8937.2	12q13.3	2012-11-19			ENSG00000179912	ENSG00000179912			29167	protein-coding gene	gene with protein product							Standard	NM_014925		Approved	KIAA1002	uc009zpm.1	Q9Y2K5	OTTHUMG00000171568	ENST00000347140.3:c.1221G>A	12.37:g.57674222C>T		Somatic	0	37	0.00		0.5480226040680333	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	41	8.89	Q2M1T9|Q3ZCT5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_R3H_ss-bd,smart_R3H_ss-bd,pfscan_R3H_ss-bd	p.Q407	ENST00000347140.3	37	c.1221	CCDS8937.2	12	.	.	.	.	.	.	.	.	.	.	C	12.71	2.018308	0.35606	.	.	ENSG00000179912	ENST00000466401	.	.	.	4.49	1.62	0.23740	.	.	.	.	.	T	0.51719	0.1691	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.36768	-0.9734	4	.	.	.	1.0729	5.4164	0.16376	0.0:0.5998:0.1455:0.2548	.	.	.	.	N	5	.	.	S	-	2	0	R3HDM2	55960489	0.030000	0.19436	0.992000	0.48379	0.921000	0.55340	-1.132000	0.03235	0.156000	0.19299	-0.294000	0.09567	AGC	-	NULL		0.567	R3HDM2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	R3HDM2	protein_coding	OTTHUMT00000326570.2	C	NM_014925	-		57674222	-1	no_errors	ENST00000347140	ensembl	human	known	74_37	silent	SNP	0.991	T
FAR2P3	100288897	genome.wustl.edu	37	2	131453966	131453966	+	RNA	DEL	C	C	-			TCGA-WK-A8XZ-01A-11D-A37C-09	TCGA-WK-A8XZ-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	82b3cc1e-5a9f-413a-bf84-f936bf806217	4f0633e4-1412-4a20-8b9c-0451a23d8b55	g.chr2:131453966delC	ENST00000425151.1	+	0	337																											TCAATCCCTGCAACCGGAGCA	0.373																																																	0								ENSG00000240253																																			AC140481.7			0				Clone_based_vega_gene																													2.37:g.131453966delC		Somatic	0	27	0.00		0.5480226040680333	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	13	23.53		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000425151.1	37	NULL		2																																																																																			-	-		0.373	AC140481.7-006	KNOWN	basic	processed_transcript	ENSG00000240253	pseudogene	OTTHUMT00000333662.1	C				131453966	+1	no_errors	ENST00000425151	ensembl	human	known	74_37	rna	DEL	0.422	-
SLC6A6	6533	genome.wustl.edu	37	3	14487301	14487301	+	Silent	SNP	C	C	G			TCGA-WK-A8XZ-01A-11D-A37C-09	TCGA-WK-A8XZ-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	82b3cc1e-5a9f-413a-bf84-f936bf806217	4f0633e4-1412-4a20-8b9c-0451a23d8b55	g.chr3:14487301C>G	ENST00000454876.2	+	4	635	c.306C>G	c.(304-306)ggC>ggG	p.G102G	SLC6A6_ENST00000416216.2_Silent_p.G102G|SLC6A6_ENST00000360861.3_Silent_p.G102G|SLC6A6_ENST00000484191.1_3'UTR			P31641	SC6A6_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 6	102					amino acid transport (GO:0006865)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|taurine transport (GO:0015734)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neurotransmitter:sodium symporter activity (GO:0005328)|taurine binding (GO:0030977)|taurine:sodium symporter activity (GO:0005369)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)|skin(2)	28						TCATCATAGGCCAGTACACCT	0.517																																																	0								ENSG00000131389						148.0	134.0	139.0					3																	14487301		2203	4300	6503	SLC6A6	SO:0001819	synonymous_variant	0			-	HGNC		CCDS33705.1, CCDS46765.1	3p25.1	2013-07-19	2013-07-19		ENSG00000131389	ENSG00000131389		"""Solute carriers"""	11052	protein-coding gene	gene with protein product	"""taurine transporter"""	186854	"""solute carrier family 6 (neurotransmitter transporter, taurine), member 6"""			8010975, 8382624	Standard	XM_006713307		Approved	TAUT	uc010heg.4	P31641	OTTHUMG00000155525	ENST00000454876.2:c.306C>G	3.37:g.14487301C>G		Somatic	0	58	0.00		0.5480226040680333	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	54	46	54.00	B2RNU7|Q9BRI2|Q9BXB0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport,prints_Na/ntran_symport_taurine	p.G102	ENST00000454876.2	37	c.306	CCDS33705.1	3																																																																																			-	pfam_Na/ntran_symport,pfscan_Na/ntran_symport		0.517	SLC6A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A6	protein_coding	OTTHUMT00000340507.1	C	NM_003043	-		14487301	+1	no_errors	ENST00000360861	ensembl	human	known	74_37	silent	SNP	1.000	G
TTC3	7267	genome.wustl.edu	37	21	38563714	38563714	+	Nonsense_Mutation	SNP	G	G	T			TCGA-WK-A8XZ-01A-11D-A37C-09	TCGA-WK-A8XZ-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	82b3cc1e-5a9f-413a-bf84-f936bf806217	4f0633e4-1412-4a20-8b9c-0451a23d8b55	g.chr21:38563714G>T	ENST00000399017.2	+	40	7851	c.5104G>T	c.(5104-5106)Gag>Tag	p.E1702*	TTC3-AS1_ENST00000424733.1_RNA|TTC3_ENST00000479930.1_3'UTR|TTC3_ENST00000354749.2_Nonsense_Mutation_p.E1702*|TTC3_ENST00000355666.1_Nonsense_Mutation_p.E1702*	NM_003316.3	NP_003307.3	P53804	TTC3_HUMAN	tetratricopeptide repeat domain 3	1702					negative regulation of cell morphogenesis involved in differentiation (GO:0010771)|negative regulation of neuron differentiation (GO:0045665)|protein K48-linked ubiquitination (GO:0070936)|ubiquitin-dependent protein catabolic process (GO:0006511)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|vacuole (GO:0005773)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(5)|endometrium(7)|kidney(5)|large_intestine(17)|liver(1)|lung(18)|ovary(4)|prostate(2)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(5)	75		Myeloproliferative disorder(46;0.0412)				AAAAGAAATTGAGAAAGCAAA	0.313																																					Ovarian(38;194 1649 35661)												0								ENSG00000182670						36.0	36.0	36.0					21																	38563714		2202	4285	6487	TTC3	SO:0001587	stop_gained	0			-	HGNC	D84296	CCDS13651.1	21q22.2	2013-01-11			ENSG00000182670	ENSG00000182670		"""RING-type (C3HC4) zinc fingers"", ""Tetratricopeptide (TTC) repeat domain containing"""	12393	protein-coding gene	gene with protein product		602259				8947847	Standard	NM_003316		Approved	TPRD, TPRDI, DCRR1, TPRDII, TPRDIII, RNF105	uc002yvz.3	P53804	OTTHUMG00000086654	ENST00000399017.2:c.5104G>T	21.37:g.38563714G>T	ENSP00000381981:p.Glu1702*	Somatic	0	34	0.00		0.5480226040680333	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	16	15.79	A8K7H7|B2RPA7|D3DSG9|D3DSH2|D3DSH3|O60767|P78476|P78477|Q569I2|Q6P578|Q9UEK4	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C3HC4_RING-type,superfamily_DEATH-like_dom,smart_TPR_repeat,smart_Znf_RING,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_Znf_RING	p.E1702*	ENST00000399017.2	37	c.5104	CCDS13651.1	21	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	54|54	22.693385|22.693385	0.99950|0.99950	.|.	.|.	ENSG00000182670|ENSG00000182670	ENST00000355666;ENST00000399017;ENST00000354749|ENST00000428693	.|.	.|.	.|.	5.31|5.31	3.49|3.49	0.39957|0.39957	.|.	0.366568|.	0.27730|.	N|.	0.018081|.	.|.	.|.	.|.	.|.	.|.	.|.	0.58432|0.58432	D|D	0.999999|0.999999	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	0.45353|.	T|.	0.12|.	-10.942|-10.942	8.236|8.236	0.31627|0.31627	0.185:0.0:0.815:0.0|0.185:0.0:0.815:0.0	.|.	.|.	.|.	.|.	X|L	1702|27	.|.	ENSP00000346791:E1702X|.	E|X	+|+	1|2	0|2	TTC3|TTC3	37485584|37485584	1.000000|1.000000	0.71417|0.71417	0.309000|0.309000	0.25155|0.25155	0.979000|0.979000	0.70002|0.70002	1.838000|1.838000	0.39211|0.39211	0.718000|0.718000	0.32166|0.32166	0.650000|0.650000	0.86243|0.86243	GAG|TGA	-	NULL		0.313	TTC3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC3	protein_coding	OTTHUMT00000194776.1	G		-		38563714	+1	no_errors	ENST00000354749	ensembl	human	known	74_37	nonsense	SNP	0.839	T
HMGN5	79366	genome.wustl.edu	37	X	80377176	80377176	+	Intron	DEL	A	A	-	rs60170251		TCGA-WK-A8XZ-01A-11D-A37C-09	TCGA-WK-A8XZ-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	82b3cc1e-5a9f-413a-bf84-f936bf806217	4f0633e4-1412-4a20-8b9c-0451a23d8b55	g.chrX:80377176delA	ENST00000358130.2	-	2	206				HMGN5_ENST00000491275.1_5'UTR	NM_030763.2	NP_110390.1	P82970	HMGN5_HUMAN	high mobility group nucleosome binding domain 5						chromatin modification (GO:0016568)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(3)	10						TCTCCTCTGGAAAAAAAAAAA	0.463																																																	0								ENSG00000198157																																			HMGN5	SO:0001627	intron_variant	0				HGNC	AF250329	CCDS14448.1	Xq13.3	2011-07-01	2011-04-05	2009-09-15	ENSG00000198157	ENSG00000198157		"""High-mobility group / Canonical"""	8013	protein-coding gene	gene with protein product		300385	"""nucleosomal binding protein 1"", ""high-mobility group nucleosome binding domain 5"""	NSBP1		11161810, 19748358	Standard	NM_030763		Approved		uc004eee.1	P82970	OTTHUMG00000021911	ENST00000358130.2:c.123-5T>-	X.37:g.80377176delA		Somatic	0	17	0.00		0.5480226040680333	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	7	41.67	Q5JSL1	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000358130.2	37	NULL	CCDS14448.1	X																																																																																			-	-		0.463	HMGN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMGN5	protein_coding	OTTHUMT00000057354.1	A	NM_030763			80377176	-1	no_errors	ENST00000491275	ensembl	human	known	74_37	rna	DEL	0.000	-
MAGEC1	9947	genome.wustl.edu	37	X	140996392	140996392	+	Missense_Mutation	SNP	G	G	A	rs199683263		TCGA-WK-A8XZ-01A-11D-A37C-09	TCGA-WK-A8XZ-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	82b3cc1e-5a9f-413a-bf84-f936bf806217	4f0633e4-1412-4a20-8b9c-0451a23d8b55	g.chrX:140996392G>A	ENST00000285879.4	+	4	3488	c.3202G>A	c.(3202-3204)Gaa>Aaa	p.E1068K	MAGEC1_ENST00000406005.2_Missense_Mutation_p.E135K	NM_005462.4	NP_005453.2	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	1068	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(22)|lung(60)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(1)	127	Acute lymphoblastic leukemia(192;6.56e-05)					TCCTCGTTACGAATTCCTGTG	0.488										HNSCC(15;0.026)																																							0								ENSG00000155495						126.0	121.0	122.0					X																	140996392		2203	4300	6503	MAGEC1	SO:0001583	missense	0			GMAF=0	HGNC	AF064589	CCDS35417.1	Xq26	2009-03-18			ENSG00000155495	ENSG00000155495			6812	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 1"""	300223				9485030, 9618514	Standard	NM_005462		Approved	MAGE-C1, CT7, MGC39366, CT7.1	uc004fbt.3	O60732	OTTHUMG00000022569	ENST00000285879.4:c.3202G>A	X.37:g.140996392G>A	ENSP00000285879:p.Glu1068Lys	Somatic	0	60	0.00		0.5480226040680333	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	19	47.22	A0PK03|O75451|Q8TCV4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MAGE,pfscan_MAGE	p.E1068K	ENST00000285879.4	37	c.3202	CCDS35417.1	X	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	g	9.546	1.114687	0.20795	.	.	ENSG00000155495	ENST00000285879;ENST00000406005	T;T	0.05786	3.39;3.39	0.837	0.837	0.18896	.	.	.	.	.	T	0.15219	0.0367	L	0.58428	1.81	0.09310	N	1	D	0.61080	0.989	P	0.60949	0.881	T	0.08617	-1.0713	8	0.62326	D	0.03	.	.	.	.	.	1068	O60732	MAGC1_HUMAN	K	1068;135	ENSP00000285879:E1068K;ENSP00000385500:E135K	ENSP00000285879:E1068K	E	+	1	0	MAGEC1	140824058	0.055000	0.20627	0.003000	0.11579	0.015000	0.08874	1.631000	0.37092	0.696000	0.31696	0.279000	0.19357	GAA	-	pfam_MAGE,pfscan_MAGE		0.488	MAGEC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAGEC1	protein_coding	OTTHUMT00000058604.1	G	NM_005462	rs199683263		140996392	+1	no_errors	ENST00000285879	ensembl	human	known	74_37	missense	SNP	0.003	A
GPR158	57512	genome.wustl.edu	37	10	25878034	25878034	+	Missense_Mutation	SNP	C	C	G			TCGA-WK-A8XZ-01A-11D-A37C-09	TCGA-WK-A8XZ-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	82b3cc1e-5a9f-413a-bf84-f936bf806217	4f0633e4-1412-4a20-8b9c-0451a23d8b55	g.chr10:25878034C>G	ENST00000376351.3	+	8	2211	c.1852C>G	c.(1852-1854)Cac>Gac	p.H618D		NM_020752.2	NP_065803.2	Q5T848	GP158_HUMAN	G protein-coupled receptor 158	618					protein localization to plasma membrane (GO:0072659)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(5)|cervix(1)|endometrium(9)|kidney(10)|large_intestine(20)|lung(56)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	119						TGTTGCAGTTCACAATGAGCT	0.408																																																	0								ENSG00000151025						93.0	90.0	91.0					10																	25878034		2203	4300	6503	GPR158	SO:0001583	missense	0			-	HGNC	AB032962	CCDS31166.1	10p12.31	2012-08-21			ENSG00000151025	ENSG00000151025		"""GPCR / Class C : Orphans"""	23689	protein-coding gene	gene with protein product		614573					Standard	NM_020752		Approved	KIAA1136	uc001isj.3	Q5T848	OTTHUMG00000017832	ENST00000376351.3:c.1852C>G	10.37:g.25878034C>G	ENSP00000365529:p.His618Asp	Somatic	0	71	0.00		0.5480226040680333	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	34	10.53	Q6QR81|Q9ULT3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_3_C,pfscan_GPCR_3_C	p.H618D	ENST00000376351.3	37	c.1852	CCDS31166.1	10	.	.	.	.	.	.	.	.	.	.	C	24.8	4.574385	0.86542	.	.	ENSG00000151025	ENST00000376351	D	0.87809	-2.3	4.76	4.76	0.60689	GPCR, family 3, C-terminal (2);	0.000000	0.64402	D	0.000003	D	0.93475	0.7918	M	0.78223	2.4	0.58432	D	0.999999	D	0.89917	1.0	D	0.87578	0.998	D	0.94274	0.7513	10	0.72032	D	0.01	.	18.1492	0.89669	0.0:1.0:0.0:0.0	.	618	Q5T848	GP158_HUMAN	D	618	ENSP00000365529:H618D	ENSP00000365529:H618D	H	+	1	0	GPR158	25918040	0.999000	0.42202	1.000000	0.80357	0.994000	0.84299	3.669000	0.54561	2.359000	0.80004	0.650000	0.86243	CAC	-	pfam_GPCR_3_C,pfscan_GPCR_3_C		0.408	GPR158-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR158	protein_coding	OTTHUMT00000047248.2	C	XM_166110	-		25878034	+1	no_errors	ENST00000376351	ensembl	human	known	74_37	missense	SNP	1.000	G
DDX50	79009	genome.wustl.edu	37	10	70670138	70670138	+	Splice_Site	SNP	G	G	T			TCGA-WK-A8XZ-01A-11D-A37C-09	TCGA-WK-A8XZ-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	82b3cc1e-5a9f-413a-bf84-f936bf806217	4f0633e4-1412-4a20-8b9c-0451a23d8b55	g.chr10:70670138G>T	ENST00000373585.3	+	3	567	c.460G>T	c.(460-462)Ggt>Tgt	p.G154C	RNU6-571P_ENST00000384128.1_RNA	NM_024045.1	NP_076950.1	Q9BQ39	DDX50_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 50	154						membrane (GO:0016020)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(5)|liver(2)|lung(6)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	29						GCTTCTGAAAGGTATGCAGTT	0.438																																																	0								ENSG00000107625						102.0	102.0	102.0					10																	70670138		2203	4300	6503	DDX50	SO:0001630	splice_region_variant	0			-	HGNC	AF334103	CCDS7283.1	10q22.2	2010-09-30			ENSG00000107625	ENSG00000107625		"""DEAD-boxes"""	17906	protein-coding gene	gene with protein product		610373				11891046	Standard	NM_024045		Approved	GU2, MGC3199, GUB, RH-II/GuB	uc001jou.3	Q9BQ39	OTTHUMG00000018362	ENST00000373585.3:c.460+1G>T	10.37:g.70670138G>T		Somatic	0	66	0.00		0.5480226040680333	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	21	15.38	Q5VX37|Q8WV76|Q9BWI8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_GUCT,pfam_Helicase_C,pfam_Helicase/UvrB_dom,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.G154C	ENST00000373585.3	37	c.460	CCDS7283.1	10	.	.	.	.	.	.	.	.	.	.	G	23.0	4.360904	0.82353	.	.	ENSG00000107625	ENST00000373585;ENST00000541832	T	0.19806	2.12	5.14	5.14	0.70334	RNA helicase, DEAD-box type, Q motif (1);	0.227351	0.45126	D	0.000382	T	0.18173	0.0436	N	0.19112	0.55	0.80722	D	1	P;P	0.46952	0.887;0.472	B;B	0.42882	0.401;0.353	T	0.02167	-1.1202	10	0.59425	D	0.04	-12.8551	17.1218	0.86704	0.0:0.0:1.0:0.0	.	154;154	Q9BQ39;B4DED6	DDX50_HUMAN;.	C	154	ENSP00000362687:G154C	ENSP00000362687:G154C	G	+	1	0	DDX50	70340144	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	7.312000	0.78968	2.538000	0.85594	0.484000	0.47621	GGT	-	superfamily_P-loop_NTPase		0.438	DDX50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX50	protein_coding	OTTHUMT00000048363.1	G	NM_024045	-	Missense_Mutation	70670138	+1	no_errors	ENST00000373585	ensembl	human	known	74_37	missense	SNP	1.000	T
LINC00959	387723	genome.wustl.edu	37	10	131877888	131877888	+	lincRNA	SNP	G	G	T			TCGA-WK-A8XZ-01A-11D-A37C-09	TCGA-WK-A8XZ-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	82b3cc1e-5a9f-413a-bf84-f936bf806217	4f0633e4-1412-4a20-8b9c-0451a23d8b55	g.chr10:131877888G>T	ENST00000456581.1	-	0	549									long intergenic non-protein coding RNA 959																		ACCATTCTGAGAAATCTAGTT	0.378																																																	0								ENSG00000237489																																			LINC00959			0			-	HGNC			10q26.3	2013-06-06			ENSG00000237489	ENSG00000237489		"""Long non-coding RNAs"""	48677	non-coding RNA	RNA, long non-coding							Standard	NR_034125		Approved				OTTHUMG00000019268		10.37:g.131877888G>T		Somatic	0	28	0.00		0.5480226040680333	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	17	15.00		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000456581.1	37	NULL		10																																																																																			-	-		0.378	LINC00959-001	KNOWN	basic	lincRNA	LINC00959	lincRNA	OTTHUMT00000051025.1	G		-		131877888	-1	no_errors	ENST00000456581	ensembl	human	known	74_37	rna	SNP	0.000	T
EDNRA	1909	genome.wustl.edu	37	4	148463682	148463682	+	Missense_Mutation	SNP	C	C	T			TCGA-WK-A8XZ-01A-11D-A37C-09	TCGA-WK-A8XZ-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	82b3cc1e-5a9f-413a-bf84-f936bf806217	4f0633e4-1412-4a20-8b9c-0451a23d8b55	g.chr4:148463682C>T	ENST00000324300.5	+	8	1711	c.1196C>T	c.(1195-1197)cCc>cTc	p.P399L	EDNRA_ENST00000339690.5_3'UTR|EDNRA_ENST00000506066.1_Missense_Mutation_p.P290L|EDNRA_ENST00000358556.4_Missense_Mutation_p.P290L|EDNRA_ENST00000503721.1_3'UTR|EDNRA_ENST00000511804.1_Missense_Mutation_p.P174L	NM_001957.3	NP_001948.1	P25101	EDNRA_HUMAN	endothelin receptor type A	399					activation of adenylate cyclase activity (GO:0007190)|activation of phospholipase C activity (GO:0007202)|aging (GO:0007568)|artery smooth muscle contraction (GO:0014824)|cell proliferation (GO:0008283)|cellular response to mechanical stimulus (GO:0071260)|endothelin receptor signaling pathway (GO:0086100)|enteric nervous system development (GO:0048484)|fibroblast proliferation (GO:0048144)|G-protein coupled receptor signaling pathway (GO:0007186)|glomerular filtration (GO:0003094)|glucose transport (GO:0015758)|head development (GO:0060322)|heart development (GO:0007507)|histamine secretion (GO:0001821)|in utero embryonic development (GO:0001701)|maternal process involved in parturition (GO:0060137)|metabolic process (GO:0008152)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cAMP biosynthetic process (GO:0030818)|neural crest cell development (GO:0014032)|patterning of blood vessels (GO:0001569)|penile erection (GO:0043084)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of inflammatory response (GO:0050729)|positive regulation of kidney development (GO:0090184)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of odontogenesis (GO:0042482)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of blood pressure (GO:0008217)|regulation of epithelial cell proliferation (GO:0050678)|respiratory gaseous exchange (GO:0007585)|response to hypoxia (GO:0001666)|response to lipopolysaccharide (GO:0032496)|response to morphine (GO:0043278)|Rho protein signal transduction (GO:0007266)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)|smooth muscle cell proliferation (GO:0048659)|smooth muscle contraction (GO:0006939)|vasoconstriction (GO:0042310)	integral component of plasma membrane (GO:0005887)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)	endothelin receptor activity (GO:0004962)|phosphatidylinositol phospholipase C activity (GO:0004435)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(4)|lung(3)|ovary(1)	17	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.154)	Acetylsalicylic acid(DB00945)|Bosentan(DB00559)|MACITENTAN(DB08932)|Sitaxentan(DB06268)	ACCTCGGTCCCCATGAACGGA	0.527																																																	0								ENSG00000151617						189.0	165.0	173.0					4																	148463682		2203	4300	6503	EDNRA	SO:0001583	missense	0			-	HGNC	D90348	CCDS3769.1, CCDS54810.1, CCDS58927.1	4q31.22	2013-09-20			ENSG00000151617	ENSG00000151617		"""GPCR / Class A : Endothelin receptors"""	3179	protein-coding gene	gene with protein product		131243				1659806	Standard	NM_001957		Approved		uc003iky.3	P25101	OTTHUMG00000161354	ENST00000324300.5:c.1196C>T	4.37:g.148463682C>T	ENSP00000315011:p.Pro399Leu	Somatic	0	32	0.00		0.5480226040680333	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	19	13.64	B2R723|B4E2V6|B7Z9G6|D3DP03|E7ER36|O43441|Q16432|Q16433|Q8TBH2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_ETA_rcpt,prints_Endthln_rcpt,prints_GPCR_Rhodpsn	p.P399L	ENST00000324300.5	37	c.1196	CCDS3769.1	4	.	.	.	.	.	.	.	.	.	.	C	20.2	3.944889	0.73672	.	.	ENSG00000151617	ENST00000358556;ENST00000324300;ENST00000511804;ENST00000506066	T;T;T;T	0.37235	1.21;1.21;1.21;1.21	5.27	5.27	0.74061	.	0.047785	0.85682	D	0.000000	T	0.31389	0.0795	L	0.41824	1.3	0.80722	D	1	P;B	0.45474	0.859;0.044	B;B	0.38458	0.274;0.01	T	0.05162	-1.0902	10	0.25106	T	0.35	-17.9662	18.8855	0.92376	0.0:1.0:0.0:0.0	.	290;399	P25101-4;P25101	.;EDNRA_HUMAN	L	290;399;174;290	ENSP00000351359:P290L;ENSP00000315011:P399L;ENSP00000425354:P174L;ENSP00000425281:P290L	ENSP00000315011:P399L	P	+	2	0	EDNRA	148683132	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.571000	0.67404	2.452000	0.82932	0.591000	0.81541	CCC	-	prints_ETA_rcpt		0.527	EDNRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EDNRA	protein_coding	OTTHUMT00000364635.1	C		-		148463682	+1	no_errors	ENST00000324300	ensembl	human	known	74_37	missense	SNP	1.000	T
PPP2R2B	5521	genome.wustl.edu	37	5	146258290	146258291	+	5'UTR	INS	-	-	GCTGCTGCTGCT	rs142461655|rs57408722|rs10591869	byFrequency	TCGA-WK-A8XZ-01A-11D-A37C-09	TCGA-WK-A8XZ-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	82b3cc1e-5a9f-413a-bf84-f936bf806217	4f0633e4-1412-4a20-8b9c-0451a23d8b55	g.chr5:146258290_146258291insGCTGCTGCTGCT	ENST00000453001.1	-	0	166_167				PPP2R2B_ENST00000394414.1_Intron|PPP2R2B_ENST00000394410.2_Intron|PPP2R2B_ENST00000336640.6_Intron|PPP2R2B_ENST00000356826.3_Intron|PPP2R2B_ENST00000394411.4_5'UTR|PPP2R2B_ENST00000530902.1_5'UTR|PPP2R2B_ENST00000394409.3_Intron|PPP2R2B_ENST00000508545.2_Intron|PPP2R2B_ENST00000394413.3_5'Flank|PPP2R2B_ENST00000504198.1_Intron			Q00005	2ABB_HUMAN	protein phosphatase 2, regulatory subunit B, beta						apoptotic process (GO:0006915)|regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)	cytoskeleton (GO:0005856)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)			endometrium(3)|kidney(4)|large_intestine(6)|liver(2)|lung(9)|ovary(1)|prostate(4)|skin(3)	32			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GCGCACTCGCAgctgctgctgc	0.718																																																	0								ENSG00000156475																																			PPP2R2B	SO:0001623	5_prime_UTR_variant	0				HGNC	M64930	CCDS4283.1, CCDS4284.1, CCDS43380.1, CCDS4284.2, CCDS64282.1	5q32	2013-01-10	2010-04-14		ENSG00000156475	ENSG00000156475	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"", ""WD repeat domain containing"""	9305	protein-coding gene	gene with protein product	"""PP2A subunit B isoform beta"""	604325	"""spinocerebellar ataxia 12"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), beta isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B, beta isoform"""	SCA12		1849734, 10581021	Standard	NM_181674		Approved	PR55-BETA, PR52B	uc003log.5	Q00005	OTTHUMG00000163381	ENST00000453001.1:c.-152->AGCAGCAGCAGC	5.37:g.146258290_146258291insGCTGCTGCTGCT		Somatic	NA	NA	NA		0.5480226040680333	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A6NEJ2|A8K102|B3KPD0|B7Z2F2|B7Z304|D3DQF7|D3DQF8|G3V149	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000453001.1	37	NULL	CCDS4284.1	5																																																																																			-	-		0.718	PPP2R2B-204	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP2R2B	protein_coding	OTTHUMT00000388939.2	-	NM_181678			146258291	-1	no_errors	ENST00000530902	ensembl	human	known	74_37	rna	INS	0.975:0.996	GCTGCTGCTGCT
FAM84A	151354	genome.wustl.edu	37	2	14789582	14789582	+	3'UTR	SNP	G	G	T			TCGA-WK-A8XZ-01A-11D-A37C-09	TCGA-WK-A8XZ-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	82b3cc1e-5a9f-413a-bf84-f936bf806217	4f0633e4-1412-4a20-8b9c-0451a23d8b55	g.chr2:14789582G>T	ENST00000497769.1	+	0	697				AC011897.1_ENST00000581929.1_3'UTR			Q96KN4	FA84A_HUMAN	family with sequence similarity 84, member A											endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|pancreas(1)|upper_aerodigestive_tract(1)	10	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.197)		GBM - Glioblastoma multiforme(1;0.00969)			TGCCAGGTAAGGTGAGAAGCA	0.527																																																	0								ENSG00000162981																																			FAM84A	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AJ417080, BC026346	CCDS1684.1	2p24.3	2005-08-09			ENSG00000162981	ENSG00000162981			20743	protein-coding gene	gene with protein product	"""neurological/sensory 1"""	611234				14702039	Standard	NM_145175		Approved	NSE1, FLJ35392	uc002rbz.2	Q96KN4	OTTHUMG00000119093	ENST00000497769.1:c.*694G>T	2.37:g.14789582G>T		Somatic	0	50	0.00		0.5480226040680333	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	21	16.00	A6NP76|Q86UZ2|Q8NAH7|Q8TAM5	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000497769.1	37	NULL		2																																																																																			-	-		0.527	FAM84A-003	KNOWN	basic	processed_transcript	FAM84A	protein_coding	OTTHUMT00000323612.1	G	NM_145175	-		14789582	+1	no_errors	ENST00000497769	ensembl	human	known	74_37	rna	SNP	0.008	T
PANK3	79646	genome.wustl.edu	37	5	167984604	167984604	+	Missense_Mutation	SNP	G	G	T			TCGA-WK-A8XZ-01A-11D-A37C-09	TCGA-WK-A8XZ-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	82b3cc1e-5a9f-413a-bf84-f936bf806217	4f0633e4-1412-4a20-8b9c-0451a23d8b55	g.chr5:167984604G>T	ENST00000239231.6	-	7	1401	c.1085C>A	c.(1084-1086)gCa>gAa	p.A362E	PANK3_ENST00000520504.1_5'Flank	NM_024594.3	NP_078870.1	Q9H999	PANK3_HUMAN	pantothenate kinase 3	362					coenzyme A biosynthetic process (GO:0015937)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|pantothenate kinase activity (GO:0004594)			NS(1)|cervix(2)|endometrium(2)|large_intestine(3)|lung(4)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	16	Renal(175;0.000159)|Lung NSC(126;0.0441)|all_lung(126;0.0909)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0989)|OV - Ovarian serous cystadenocarcinoma(192;0.147)|Epithelial(171;0.188)		CCCAAGAAGTGCACCAACTGC	0.368																																																	0								ENSG00000120137						128.0	116.0	120.0					5																	167984604		2203	4300	6503	PANK3	SO:0001583	missense	0			-	HGNC	AK022961	CCDS4368.1	5q35.1	2008-02-05			ENSG00000120137	ENSG00000120137			19365	protein-coding gene	gene with protein product		606161				11479594	Standard	NM_024594		Approved	FLJ12899	uc003lzz.2	Q9H999	OTTHUMG00000130410	ENST00000239231.6:c.1085C>A	5.37:g.167984604G>T	ENSP00000239231:p.Ala362Glu	Somatic	0	46	0.00		0.5480226040680333	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	47	9.62	D3DQL1|Q53FJ9|Q7RTX4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Type_II_PanK,tigrfam_Type_II_PanK	p.A362E	ENST00000239231.6	37	c.1085	CCDS4368.1	5	.	.	.	.	.	.	.	.	.	.	G	32	5.132550	0.94473	.	.	ENSG00000120137	ENST00000239231	D	0.99816	-6.91	5.67	5.67	0.87782	.	0.198787	0.52532	D	0.000065	D	0.99873	0.9940	H	0.94771	3.58	0.80722	D	1	D	0.65815	0.995	D	0.65987	0.94	D	0.96736	0.9543	10	0.87932	D	0	5.522	18.7577	0.91838	0.0:0.0:1.0:0.0	.	362	Q9H999	PANK3_HUMAN	E	362	ENSP00000239231:A362E	ENSP00000239231:A362E	A	-	2	0	PANK3	167917182	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.062000	0.93920	2.668000	0.90789	0.563000	0.77884	GCA	-	pfam_Type_II_PanK,tigrfam_Type_II_PanK		0.368	PANK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PANK3	protein_coding	OTTHUMT00000252793.2	G	NM_024594	-		167984604	-1	no_errors	ENST00000239231	ensembl	human	known	74_37	missense	SNP	1.000	T
NKPD1	284353	genome.wustl.edu	37	19	45655411	45655411	+	Missense_Mutation	SNP	C	C	T			TCGA-WK-A8XZ-01A-11D-A37C-09	TCGA-WK-A8XZ-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	82b3cc1e-5a9f-413a-bf84-f936bf806217	4f0633e4-1412-4a20-8b9c-0451a23d8b55	g.chr19:45655411C>T	ENST00000438936.2	-	3	1829	c.1618G>A	c.(1618-1620)Gcg>Acg	p.A540T	NKPD1_ENST00000589776.1_Missense_Mutation_p.A540T|NKPD1_ENST00000317951.4_Missense_Mutation_p.A762T|AC005757.7_ENST00000589594.1_lincRNA|NKPD1_ENST00000429338.1_Intron			Q17RQ9	NKPD1_HUMAN	NTPase, KAP family P-loop domain containing 1	540						integral component of membrane (GO:0016021)				endometrium(1)|lung(4)|prostate(2)|urinary_tract(1)	8		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00863)|GBM - Glioblastoma multiforme(486;0.231)		GGCTTGAGCGCGCTGACGGCT	0.736																																																	0								ENSG00000179846						6.0	9.0	8.0					19																	45655411		1912	4033	5945	NKPD1	SO:0001583	missense	0			-	HGNC	AK090919		19q13.32	2012-07-02		2012-07-02	ENSG00000179846	ENSG00000179846			24739	protein-coding gene	gene with protein product						14702039	Standard	NM_198478		Approved	FLJ33600	uc010xxi.2	Q17RQ9	OTTHUMG00000160521	ENST00000438936.2:c.1618G>A	19.37:g.45655411C>T	ENSP00000401739:p.Ala540Thr	Somatic	0	42	0.00		0.5480226040680333	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	19	20.83	B7ZLG6|D6RH15|Q8N2A2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_KAP_NTPase	p.A762T	ENST00000438936.2	37	c.2284		19	.	.	.	.	.	.	.	.	.	.	C	10.46	1.356277	0.24598	.	.	ENSG00000179846	ENST00000317951;ENST00000438936	T;T	0.44881	0.91;0.93	4.8	0.752	0.18398	.	.	.	.	.	T	0.26122	0.0637	L	0.36672	1.1	0.58432	D	0.999993	B	0.25169	0.119	B	0.15870	0.014	T	0.06643	-1.0815	9	0.15066	T	0.55	-2.071	8.0025	0.30306	0.0:0.6698:0.0:0.3302	.	540	Q17RQ9	NKPD1_HUMAN	T	762;540	ENSP00000321976:A762T;ENSP00000401739:A540T	ENSP00000321976:A762T	A	-	1	0	NKPD1	50347251	0.000000	0.05858	0.681000	0.30009	0.912000	0.54170	-0.193000	0.09573	0.160000	0.19432	0.561000	0.74099	GCG	-	NULL		0.736	NKPD1-001	KNOWN	basic	protein_coding	NKPD1	protein_coding	OTTHUMT00000360950.2	C	NM_198478	-		45655411	-1	no_errors	ENST00000317951	ensembl	human	known	74_37	missense	SNP	0.557	T
ZNF623	9831	genome.wustl.edu	37	8	144732815	144732815	+	Missense_Mutation	SNP	C	C	T			TCGA-WK-A8XZ-01A-11D-A37C-09	TCGA-WK-A8XZ-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	82b3cc1e-5a9f-413a-bf84-f936bf806217	4f0633e4-1412-4a20-8b9c-0451a23d8b55	g.chr8:144732815C>T	ENST00000501748.2	+	1	862	c.773C>T	c.(772-774)aCg>aTg	p.T258M	ZNF623_ENST00000458270.2_Missense_Mutation_p.T218M|ZNF623_ENST00000526926.1_Missense_Mutation_p.T218M	NM_014789.3	NP_055604	O75123	ZN623_HUMAN	zinc finger protein 623	258					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(3)|large_intestine(6)|lung(11)|prostate(1)|stomach(1)|urinary_tract(3)	27	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;5.28e-40)|all cancers(56;5.23e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			AGGATTCACACGGGAGAAAGG	0.468																																																	0								ENSG00000183309						62.0	62.0	62.0					8																	144732815		2203	4300	6503	ZNF623	SO:0001583	missense	0			-	HGNC	AB014528	CCDS34957.1, CCDS47931.1	8q24.3	2013-01-08				ENSG00000183309		"""Zinc fingers, C2H2-type"""	29084	protein-coding gene	gene with protein product						9734811	Standard	NM_014789		Approved	KIAA0628	uc003yzd.2	O75123		ENST00000501748.2:c.773C>T	8.37:g.144732815C>T	ENSP00000445979:p.Thr258Met	Somatic	0	25	0.00		0.5480226040680333	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	22	15.38	A4FU80|B4DGP3|E7ENV5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.T258M	ENST00000501748.2	37	c.773	CCDS34957.1	8	.	.	.	.	.	.	.	.	.	.	C	14.41	2.526397	0.44969	.	.	ENSG00000183309	ENST00000526926;ENST00000328466;ENST00000458270;ENST00000532796;ENST00000501748	T;T;T	0.26373	1.74;1.74;1.74	4.25	3.37	0.38596	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.48277	0.1491	M	0.73430	2.235	0.30212	N	0.797652	D	0.89917	1.0	D	0.76071	0.987	T	0.48885	-0.8995	9	0.87932	D	0	-17.3833	9.9279	0.41503	0.0:0.8983:0.0:0.1017	.	258	O75123	ZN623_HUMAN	M	218;218;218;258;258	ENSP00000435232:T218M;ENSP00000411139:T218M;ENSP00000445979:T258M	ENSP00000330358:T218M	T	+	2	0	ZNF623	144803958	0.881000	0.30235	0.555000	0.28281	0.412000	0.31113	2.986000	0.49370	1.131000	0.42111	0.655000	0.94253	ACG	-	pfscan_Znf_C2H2		0.468	ZNF623-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF623	protein_coding	OTTHUMT00000382522.3	C	NM_014789	-		144732815	+1	no_errors	ENST00000501748	ensembl	human	known	74_37	missense	SNP	0.982	T
PPP1R15B	84919	genome.wustl.edu	37	1	204378836	204378836	+	Silent	SNP	A	A	G			TCGA-WK-A8XZ-01A-11D-A37C-09	TCGA-WK-A8XZ-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	82b3cc1e-5a9f-413a-bf84-f936bf806217	4f0633e4-1412-4a20-8b9c-0451a23d8b55	g.chr1:204378836A>G	ENST00000367188.4	-	1	2083	c.1704T>C	c.(1702-1704)ccT>ccC	p.P568P	RP11-739N20.2_ENST00000443515.1_RNA	NM_032833.3	NP_116222.3	Q5SWA1	PR15B_HUMAN	protein phosphatase 1, regulatory subunit 15B	568					ER overload response (GO:0006983)|regulation of translation (GO:0006417)|response to hydrogen peroxide (GO:0042542)	protein phosphatase type 1 complex (GO:0000164)	protein serine/threonine phosphatase activity (GO:0004722)			breast(3)|cervix(1)|kidney(4)|large_intestine(3)|lung(16)|ovary(1)|pancreas(2)|skin(1)|urinary_tract(3)	34	all_cancers(21;0.0032)|all_neural(3;0.0218)|Glioma(3;0.0382)|Breast(84;0.179)|all_epithelial(62;0.193)|Prostate(682;0.227)		all cancers(3;1.14e-29)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.139)			TAAAATTTAAAGGGTTGTAGG	0.443																																																	0								ENSG00000158615						66.0	66.0	66.0					1																	204378836		2203	4300	6503	PPP1R15B	SO:0001819	synonymous_variant	0			-	HGNC	AK027650	CCDS1445.1	1q32.1	2012-04-17	2011-10-04		ENSG00000158615	ENSG00000158615		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14951	protein-coding gene	gene with protein product		613257	"""protein phosphatase 1, regulatory (inhibitor) subunit 15B"""			11948623	Standard	XM_005245551		Approved	FLJ14744	uc001hav.4	Q5SWA1	OTTHUMG00000036105	ENST00000367188.4:c.1704T>C	1.37:g.204378836A>G		Somatic	0	35	0.00		0.5480226040680333	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	19	13.64	Q53GQ4|Q658M2|Q6P156|Q96SN1	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_Pase1_reg-su15B_N,pfam_Prot_Pase1_reg-su15A/B_C	p.P568	ENST00000367188.4	37	c.1704	CCDS1445.1	1																																																																																			-	pfam_Prot_Pase1_reg-su15A/B_C		0.443	PPP1R15B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R15B	protein_coding	OTTHUMT00000087974.1	A	NM_032833	-		204378836	-1	no_errors	ENST00000367188	ensembl	human	known	74_37	silent	SNP	0.978	G
GLT8D2	83468	genome.wustl.edu	37	12	104387183	104387183	+	Missense_Mutation	SNP	G	G	T			TCGA-WK-A8XZ-01A-11D-A37C-09	TCGA-WK-A8XZ-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	82b3cc1e-5a9f-413a-bf84-f936bf806217	4f0633e4-1412-4a20-8b9c-0451a23d8b55	g.chr12:104387183G>T	ENST00000360814.4	-	10	1272	c.867C>A	c.(865-867)caC>caA	p.H289Q	GLT8D2_ENST00000546436.1_Missense_Mutation_p.H289Q|GLT8D2_ENST00000548660.1_Missense_Mutation_p.H289Q	NM_031302.3	NP_112592.1	Q9H1C3	GL8D2_HUMAN	glycosyltransferase 8 domain containing 2	289						integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)			kidney(3)|large_intestine(5)|lung(5)|ovary(1)|prostate(1)|skin(1)	16						GGTGCCTTATGTGCCACAGGG	0.453																																																	0								ENSG00000120820						62.0	62.0	62.0					12																	104387183		2203	4300	6503	GLT8D2	SO:0001583	missense	0			-	HGNC	BC022343	CCDS9096.1	12q23.3	2013-02-22			ENSG00000120820	ENSG00000120820		"""Glycosyltransferase family 8 domain containing"""	24890	protein-coding gene	gene with protein product							Standard	NM_031302		Approved	FLJ31494	uc001tkh.1	Q9H1C3	OTTHUMG00000170120	ENST00000360814.4:c.867C>A	12.37:g.104387183G>T	ENSP00000354053:p.His289Gln	Somatic	0	58	0.00		0.5480226040680333	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	33	10.81	Q96KA2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Glyco_trans_8	p.H289Q	ENST00000360814.4	37	c.867	CCDS9096.1	12	.	.	.	.	.	.	.	.	.	.	G	20.4	3.982355	0.74474	.	.	ENSG00000120820	ENST00000360814;ENST00000546436;ENST00000548660	T;T;T	0.22945	1.93;1.93;1.93	5.44	5.44	0.79542	.	0.043012	0.85682	D	0.000000	T	0.50343	0.1610	M	0.78049	2.395	0.80722	D	1	D	0.69078	0.997	D	0.67382	0.951	T	0.53704	-0.8401	10	0.87932	D	0	.	13.5406	0.61672	0.0747:0.0:0.9252:0.0	.	289	Q9H1C3	GL8D2_HUMAN	Q	289	ENSP00000354053:H289Q;ENSP00000449750:H289Q;ENSP00000447450:H289Q	ENSP00000354053:H289Q	H	-	3	2	GLT8D2	102911313	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	4.538000	0.60650	2.557000	0.86248	0.655000	0.94253	CAC	-	pfam_Glyco_trans_8		0.453	GLT8D2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GLT8D2	protein_coding	OTTHUMT00000407371.1	G	NM_031302	-		104387183	-1	no_errors	ENST00000360814	ensembl	human	known	74_37	missense	SNP	1.000	T
DIAPH1	1729	genome.wustl.edu	37	5	140963175	140963175	+	Missense_Mutation	SNP	C	C	T			TCGA-WK-A8XZ-01A-11D-A37C-09	TCGA-WK-A8XZ-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	82b3cc1e-5a9f-413a-bf84-f936bf806217	4f0633e4-1412-4a20-8b9c-0451a23d8b55	g.chr5:140963175C>T	ENST00000398557.4	-	5	550	c.410G>A	c.(409-411)aGc>aAc	p.S137N	DIAPH1_ENST00000520569.1_Missense_Mutation_p.S83N|DIAPH1_ENST00000389057.5_Missense_Mutation_p.S128N|DIAPH1_ENST00000518047.1_Missense_Mutation_p.S128N|DIAPH1_ENST00000253811.6_Missense_Mutation_p.S137N|DIAPH1_ENST00000398566.3_Missense_Mutation_p.S128N|DIAPH1_ENST00000389054.3_Missense_Mutation_p.S137N|DIAPH1_ENST00000398562.2_Missense_Mutation_p.S128N	NM_005219.4	NP_005210.3	O60610	DIAP1_HUMAN	diaphanous-related formin 1	137	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				actin filament polymerization (GO:0030041)|cellular response to histamine (GO:0071420)|cytoskeleton organization (GO:0007010)|positive regulation of cell migration (GO:0030335)|protein localization to microtubule (GO:0035372)|regulation of cell shape (GO:0008360)|regulation of microtubule-based process (GO:0032886)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|mitotic spindle (GO:0072686)|ruffle membrane (GO:0032587)	ion channel binding (GO:0044325)|poly(A) RNA binding (GO:0044822)|receptor binding (GO:0005102)			breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(12)|pancreas(1)|skin(2)|stomach(2)	23			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTCCTTCTGGCTCATGCCCTA	0.443																																																	0								ENSG00000131504						97.0	99.0	98.0					5																	140963175		1950	4139	6089	DIAPH1	SO:0001583	missense	0			-	HGNC	BC007411		5q31	2013-05-24	2013-05-24		ENSG00000131504	ENSG00000131504			2876	protein-coding gene	gene with protein product		602121	"""diaphanous (Drosophila, homolog) 1"", ""diaphanous homolog 1 (Drosophila)"""	DFNA1		9360932, 1350680	Standard	NM_005219		Approved	hDIA1, LFHL1	uc003llb.4	O60610	OTTHUMG00000149893	ENST00000398557.4:c.410G>A	5.37:g.140963175C>T	ENSP00000381565:p.Ser137Asn	Somatic	0	29	0.00		0.5480226040680333	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	20	16.67	A6NF18|B7ZKW2|E9PEZ2|Q17RN4|Q59FH8|Q9UC76	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_FH2_Formin,pfam_FH3_dom,pfam_GTPase-bd,pfam_Formin_homology_1,pfam_Drf_DAD,superfamily_ARM-type_fold,superfamily_tRNA-bd_arm,smart_FH2_Formin	p.S137N	ENST00000398557.4	37	c.410	CCDS43374.1	5	.	.	.	.	.	.	.	.	.	.	C	9.096	1.002889	0.19121	.	.	ENSG00000131504	ENST00000389054;ENST00000520569;ENST00000398562;ENST00000389057;ENST00000398566;ENST00000398557;ENST00000253811;ENST00000518047;ENST00000524301	D;D;D;D;D;D;D;D;D	0.90504	-2.68;-2.68;-2.68;-2.68;-2.68;-2.68;-2.68;-2.68;-2.68	5.72	-1.4	0.08968	GTPase-binding/formin homology 3 (1);Diaphanous GTPase-binding (1);	0.326831	0.31010	N	0.008436	T	0.81800	0.4899	N	0.20357	0.565	0.29145	N	0.878731	B;B	0.29955	0.263;0.263	B;B	0.37346	0.247;0.247	T	0.70995	-0.4720	10	0.17832	T	0.49	.	10.6335	0.45551	0.0:0.4942:0.0:0.5058	.	128;137	E9PEZ2;O60610	.;DIAP1_HUMAN	N	137;83;128;128;128;137;137;128;83	ENSP00000373706:S137N;ENSP00000429282:S83N;ENSP00000381570:S128N;ENSP00000373709:S128N;ENSP00000381572:S128N;ENSP00000381565:S137N;ENSP00000253811:S137N;ENSP00000428268:S128N;ENSP00000430587:S83N	ENSP00000253811:S137N	S	-	2	0	DIAPH1	140943359	0.979000	0.34478	0.952000	0.39060	0.394000	0.30568	0.193000	0.17116	-0.367000	0.08052	-0.237000	0.12165	AGC	-	pfam_GTPase-bd		0.443	DIAPH1-203	KNOWN	basic|appris_candidate|CCDS	protein_coding	DIAPH1	protein_coding		C	NM_005219	-		140963175	-1	no_errors	ENST00000253811	ensembl	human	known	74_37	missense	SNP	0.895	T
NOP56	10528	genome.wustl.edu	37	20	2633378	2633379	+	Intron	INS	-	-	GAGCCTGGGCCTGGGCCTGGGCCT	rs71328095|rs149713688	byFrequency	TCGA-WK-A8XZ-01A-11D-A37C-09	TCGA-WK-A8XZ-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	82b3cc1e-5a9f-413a-bf84-f936bf806217	4f0633e4-1412-4a20-8b9c-0451a23d8b55	g.chr20:2633378_2633379insGAGCCTGGGCCTGGGCCTGGGCCT	ENST00000329276.5	+	1	519				MIR1292_ENST00000408135.1_RNA|SNORA51_ENST00000606420.1_RNA|SNORD110_ENST00000408189.1_RNA	NM_006392.3	NP_006383.2	O00567	NOP56_HUMAN	NOP56 ribonucleoprotein						cell death (GO:0008219)|rRNA processing (GO:0006364)	box C/D snoRNP complex (GO:0031428)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|pre-snoRNP complex (GO:0070761)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|snoRNA binding (GO:0030515)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(6)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	25						GGCCGCAGACAgggcctgggcc	0.748																																																	0								ENSG00000101361																																			NOP56	SO:0001627	intron_variant	0				HGNC	Y12065	CCDS13030.1	20p13	2012-12-10	2012-12-10	2009-01-13	ENSG00000101361	ENSG00000101361			15911	protein-coding gene	gene with protein product	"""spinocerebellar ataxia 36"""	614154	"""nucleolar protein 5A (56kD with KKE/D repeat)"", ""nucleolar protein 5A (56kDa with KKE/D repeat)"", ""NOP56 ribonucleoprotein homolog (yeast)"""	NOL5A		9372940, 21683323	Standard	NR_027700		Approved	SCA36	uc002wgh.3	O00567	OTTHUMG00000031703	ENST00000329276.5:c.3+69->GAGCCTGGGCCTGGGCCTGGGCCT	20.37:g.2633378_2633379insGAGCCTGGGCCTGGGCCTGGGCCT		Somatic	NA	NA	NA		0.5480226040680333	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q2M3T6|Q9NQ05	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000329276.5	37	NULL	CCDS13030.1	20																																																																																			-	-		0.748	NOP56-009	KNOWN	basic|appris_principal|CCDS	protein_coding	NOP56	protein_coding	OTTHUMT00000077631.2	-	NM_006392			2633379	+1	no_errors	ENST00000469588	ensembl	human	known	74_37	rna	INS	0.000:0.000	GAGCCTGGGCCTGGGCCTGGGCCT
NCAPG	64151	genome.wustl.edu	37	4	17816903	17816903	+	Missense_Mutation	SNP	G	G	T			TCGA-WK-A8XZ-01A-11D-A37C-09	TCGA-WK-A8XZ-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	82b3cc1e-5a9f-413a-bf84-f936bf806217	4f0633e4-1412-4a20-8b9c-0451a23d8b55	g.chr4:17816903G>T	ENST00000251496.2	+	5	873	c.697G>T	c.(697-699)Gct>Tct	p.A233S		NM_022346.4	NP_071741.2	Q9BPX3	CND3_HUMAN	non-SMC condensin I complex, subunit G	233					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(11)|lung(10)|prostate(1)|upper_aerodigestive_tract(1)	27				STAD - Stomach adenocarcinoma(129;0.18)		TAAGGTTTTAGCTGAAAAGGT	0.313																																																	0								ENSG00000109805						48.0	50.0	49.0					4																	17816903		2203	4296	6499	NCAPG	SO:0001583	missense	0			-	HGNC	AF331796	CCDS3424.1	4p15.32	2014-01-15			ENSG00000109805	ENSG00000109805			24304	protein-coding gene	gene with protein product	"""chromosome condensation protein G"""	606280				10910072, 11136719	Standard	NM_022346		Approved	FLJ12450, hCAP-G, CAP-G, YCG1	uc003gpp.4	Q9BPX3	OTTHUMG00000128539	ENST00000251496.2:c.697G>T	4.37:g.17816903G>T	ENSP00000251496:p.Ala233Ser	Somatic	0	67	0.00		0.5480226040680333	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	Q3MJE0|Q96SV9|Q9BUR3|Q9BVY1|Q9H914|Q9H9Z6|Q9HBI9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_ARM-type_fold	p.A233S	ENST00000251496.2	37	c.697	CCDS3424.1	4	.	.	.	.	.	.	.	.	.	.	G	16.17	3.048829	0.55110	.	.	ENSG00000109805	ENST00000251496	T	0.32515	1.45	6.17	6.17	0.99709	Armadillo-like helical (1);Armadillo-type fold (1);	0.097811	0.64402	D	0.000001	T	0.27765	0.0683	L	0.33668	1.02	0.58432	D	0.999992	B	0.24368	0.102	B	0.29942	0.109	T	0.03202	-1.1061	10	0.27785	T	0.31	-12.5229	15.581	0.76439	0.0:0.0:0.8623:0.1377	.	233	Q9BPX3	CND3_HUMAN	S	233	ENSP00000251496:A233S	ENSP00000251496:A233S	A	+	1	0	NCAPG	17426001	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	4.979000	0.63806	2.941000	0.99782	0.655000	0.94253	GCT	-	superfamily_ARM-type_fold		0.313	NCAPG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCAPG	protein_coding	OTTHUMT00000250375.1	G	NM_022346	-		17816903	+1	no_errors	ENST00000251496	ensembl	human	known	74_37	missense	SNP	1.000	T
TCL6	27004	genome.wustl.edu	37	14	96138459	96138459	+	RNA	SNP	A	A	G			TCGA-WK-A8XZ-01A-11D-A37C-09	TCGA-WK-A8XZ-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	82b3cc1e-5a9f-413a-bf84-f936bf806217	4f0633e4-1412-4a20-8b9c-0451a23d8b55	g.chr14:96138459A>G	ENST00000467865.1	+	0	2333				RP11-1070N10.6_ENST00000461160.1_RNA					T-cell leukemia/lymphoma 6 (non-protein coding)											large_intestine(1)|lung(7)	8		all_cancers(154;0.103)		Epithelial(152;0.0655)|all cancers(159;0.149)|BRCA - Breast invasive adenocarcinoma(234;0.206)|COAD - Colon adenocarcinoma(157;0.207)		GATGGAGTACACAGCTGAGCA	0.483			T	TRA@	T-ALL																																			Dom	yes		14	14q32.1	27004	T-cell leukemia/lymphoma 6		L	0								ENSG00000187621																																			TCL6			0			-	HGNC	AB035338		14q32.1	2012-10-16	2010-06-01		ENSG00000187621	ENSG00000187621		"""Long non-coding RNAs"""	13463	non-coding RNA	RNA, long non-coding		604412	"""T-cell leukemia/lymphoma 6"""			10588720, 10851082	Standard	NR_028288		Approved	TCL6e1, TNG2, TNG1	uc001yev.2		OTTHUMG00000149979		14.37:g.96138459A>G		Somatic	0	31	0.00		0.5480226040680333	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000467865.1	37	NULL		14																																																																																			-	-		0.483	TCL6-009	KNOWN	basic	lincRNA	TCL6	processed_transcript	OTTHUMT00000315133.1	A	NM_012468	-		96138459	+1	no_errors	ENST00000459662	ensembl	human	known	74_37	rna	SNP	0.000	G
LIFR	3977	genome.wustl.edu	37	5	38557555	38557555	+	Intron	SNP	C	C	T			TCGA-WK-A8XZ-01A-11D-A37C-09	TCGA-WK-A8XZ-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	82b3cc1e-5a9f-413a-bf84-f936bf806217	4f0633e4-1412-4a20-8b9c-0451a23d8b55	g.chr5:38557555C>T	ENST00000263409.4	-	2	144				LIFR-AS1_ENST00000514291.1_RNA|LIFR-AS1_ENST00000500733.2_RNA|MIR3650_ENST00000581972.1_RNA|LIFR_ENST00000503088.1_Intron|LIFR_ENST00000453190.2_5'Flank|LIFR-AS1_ENST00000500817.2_RNA	NM_002310.5	NP_002301.1	P42702	LIFR_HUMAN	leukemia inhibitory factor receptor alpha						cell surface receptor signaling pathway (GO:0007166)|ciliary neurotrophic factor-mediated signaling pathway (GO:0070120)|cytokine-mediated signaling pathway (GO:0019221)|leukemia inhibitory factor signaling pathway (GO:0048861)|oncostatin-M-mediated signaling pathway (GO:0038165)|positive regulation of cell proliferation (GO:0008284)|response to cytokine (GO:0034097)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ciliary neurotrophic factor receptor binding (GO:0005127)|growth factor binding (GO:0019838)|leukemia inhibitory factor receptor activity (GO:0004923)			NS(2)|breast(4)|endometrium(6)|kidney(2)|large_intestine(30)|liver(2)|lung(21)|ovary(3)|skin(5)|stomach(1)|urinary_tract(2)	78	all_lung(31;0.00021)					ACGCTGTATGCCGGACGCGTT	0.483			T	PLAG1	salivary adenoma																																Melanoma(13;4 730 6426 9861 34751)			Dom	yes		5	5p13-p12	3977	leukemia inhibitory factor receptor		E	0								ENSG00000244968																																			LIFR-AS1	SO:0001627	intron_variant	0			-	HGNC	X61615	CCDS3927.1	5p13-p12	2013-02-11	2006-05-17		ENSG00000113594	ENSG00000113594		"""CD molecules"", ""Fibronectin type III domain containing"""	6597	protein-coding gene	gene with protein product		151443	"""leukemia inhibitory factor receptor"""			1915266	Standard	NM_001127671		Approved	CD118	uc003jli.2	P42702	OTTHUMG00000131138	ENST00000263409.4:c.19-26787G>A	5.37:g.38557555C>T		Somatic	0	46	0.00		0.5480226040680333	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	29	12.12	Q6LCD9	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000263409.4	37	NULL	CCDS3927.1	5																																																																																			-	-		0.483	LIFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIFR-AS1	protein_coding	OTTHUMT00000253823.1	C	NM_002310	-		38557555	+1	no_errors	ENST00000500733	ensembl	human	known	74_37	rna	SNP	0.987	T
NRXN1	9378	genome.wustl.edu	37	2	50147836	50147853	+	3'UTR	DEL	GTGTGTGTGTGTGTGTGT	GTGTGTGTGTGTGTGTGT	-	rs200264093|rs201814381|rs199597709|rs199689866|rs368179294|rs201801805|rs200666696|rs200969250|rs66612444		TCGA-WK-A8XZ-01A-11D-A37C-09	TCGA-WK-A8XZ-10A-01D-A37F-09	GTGTGTGTGTGTGTGTGT	GTGTGTGTGTGTGTGTGT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	82b3cc1e-5a9f-413a-bf84-f936bf806217	4f0633e4-1412-4a20-8b9c-0451a23d8b55	g.chr2:50147836_50147853delGTGTGTGTGTGTGTGTGT	ENST00000406316.2	-	0	7139_7156				NRXN1_ENST00000401710.1_3'UTR|NRXN1_ENST00000342183.5_3'UTR|NRXN1_ENST00000404971.1_3'UTR	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1						adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			CTGTGGATTCgtgtgtgtgtgtgtgtgtgtgtgtgtgt	0.385																																																	0								ENSG00000179915																																			NRXN1	SO:0001624	3_prime_UTR_variant	0				HGNC	AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.*1246ACACACACACACACACAC>-	2.37:g.50147836_50147853delGTGTGTGTGTGTGTGTGT		Somatic	NA	NA	NA		0.5480226040680333	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000406316.2	37	NULL	CCDS54360.1	2																																																																																			-	-		0.385	NRXN1-001	KNOWN	basic|CCDS	protein_coding	NRXN1	protein_coding	OTTHUMT00000325291.2	GTGTGTGTGTGTGTGTGT				50147853	-1	no_errors	ENST00000484192	ensembl	human	known	74_37	rna	DEL	0.000:0.001:0.005:0.106:0.113:0.127:0.107:0.109:0.093:0.096:0.025:0.055:0.070:0.324:0.354:0.283:0.295:0.258	-
MYH7	4625	genome.wustl.edu	37	14	23897840	23897840	+	Missense_Mutation	SNP	C	C	T	rs121913651		TCGA-WK-A8XZ-01A-11D-A37C-09	TCGA-WK-A8XZ-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	82b3cc1e-5a9f-413a-bf84-f936bf806217	4f0633e4-1412-4a20-8b9c-0451a23d8b55	g.chr14:23897840C>T	ENST00000355349.3	-	15	1609	c.1447G>A	c.(1447-1449)Gag>Aag	p.E483K		NM_000257.2	NP_000248.2	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	483	Myosin motor.		E -> K (in CMH1). {ECO:0000269|PubMed:12707239}.		adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)			NS(3)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(19)|lung(57)|ovary(5)|prostate(9)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	137	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		TGCAGCTTCTCGTTGGTGAAG	0.537																																																	0			GRCh37	CM990893	MYH7	M	rs121913651	ENSG00000092054						134.0	105.0	114.0					14																	23897840		2203	4300	6503	MYH7	SO:0001583	missense	0			-	HGNC	M58018	CCDS9601.1	14q11.2-q13	2014-09-17	2006-09-29		ENSG00000092054	ENSG00000092054		"""Myosins / Myosin superfamily : Class II"""	7577	protein-coding gene	gene with protein product		160760	"""myopathy, distal 1"", ""myosin, heavy polypeptide 7, cardiac muscle, beta"""	CMH1, MPD1		2494889, 8483915, 15322983	Standard	XM_005267696		Approved	CMD1S	uc001wjx.3	P12883	OTTHUMG00000028755	ENST00000355349.3:c.1447G>A	14.37:g.23897840C>T	ENSP00000347507:p.Glu483Lys	Somatic	0	179	0.00		0.5480226040680333	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	53	73	41.73	A2TDB6|B6D424|Q14836|Q14837|Q14904|Q16579|Q2M1Y6|Q92679|Q9H1D5|Q9UDA2|Q9UMM8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.E483K	ENST00000355349.3	37	c.1447	CCDS9601.1	14	.	.	.	.	.	.	.	.	.	.	C	28.7	4.947310	0.92593	.	.	ENSG00000092054	ENST00000355349;ENST00000544444	D	0.98120	-4.73	4.24	4.24	0.50183	Myosin head, motor domain (3);	.	.	.	.	D	0.99083	0.9685	H	0.98507	4.25	0.80722	D	1	P	0.37101	0.582	P	0.51229	0.663	D	0.99865	1.1088	9	0.87932	D	0	.	16.8116	0.85722	0.0:1.0:0.0:0.0	.	483	P12883	MYH7_HUMAN	K	483	ENSP00000347507:E483K	ENSP00000347507:E483K	E	-	1	0	MYH7	22967680	1.000000	0.71417	0.985000	0.45067	0.974000	0.67602	7.426000	0.80270	2.202000	0.70862	0.563000	0.77884	GAG	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom,prints_Myosin_head_motor_dom		0.537	MYH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH7	protein_coding	OTTHUMT00000071798.3	C	NM_000257	rs121913651		23897840	-1	no_errors	ENST00000355349	ensembl	human	known	74_37	missense	SNP	1.000	T
NMD3	51068	genome.wustl.edu	37	3	160945124	160945124	+	Missense_Mutation	SNP	T	T	C			TCGA-WK-A8XZ-01A-11D-A37C-09	TCGA-WK-A8XZ-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	82b3cc1e-5a9f-413a-bf84-f936bf806217	4f0633e4-1412-4a20-8b9c-0451a23d8b55	g.chr3:160945124T>C	ENST00000460469.1	+	3	724	c.269T>C	c.(268-270)cTg>cCg	p.L90P	NMD3_ENST00000472947.1_Missense_Mutation_p.L90P|NMD3_ENST00000478160.1_3'UTR|NMD3_ENST00000351193.2_Missense_Mutation_p.L90P			Q96D46	NMD3_HUMAN	NMD3 ribosome export adaptor	90					protein transport (GO:0015031)|ribosomal large subunit export from nucleus (GO:0000055)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|ribosomal large subunit binding (GO:0043023)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(10)|ovary(1)|skin(1)|urinary_tract(2)	25			Lung(72;0.00111)|LUSC - Lung squamous cell carcinoma(72;0.00156)			AAAGCCCCTCTGAGTAAGGTA	0.348																																																	0								ENSG00000169251						90.0	87.0	88.0					3																	160945124		2203	4300	6503	NMD3	SO:0001583	missense	0			-	HGNC	BC013317	CCDS3194.1	3q26.1	2013-08-06	2013-08-06		ENSG00000169251	ENSG00000169251			24250	protein-coding gene	gene with protein product		611021	"""NMD3 homolog (S. cerevisiae)"""			10810093, 23782956, 12773398	Standard	NM_015938		Approved	CGI-07	uc003feb.1	Q96D46	OTTHUMG00000159063	ENST00000460469.1:c.269T>C	3.37:g.160945124T>C	ENSP00000419004:p.Leu90Pro	Somatic	0	54	0.00		0.5480226040680333	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	21	50.00	D3DNM7|Q9Y2Z6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_NMD3	p.L90P	ENST00000460469.1	37	c.269	CCDS3194.1	3	.	.	.	.	.	.	.	.	.	.	T	21.6	4.171626	0.78452	.	.	ENSG00000169251	ENST00000468606;ENST00000460503;ENST00000493066;ENST00000351193;ENST00000472947;ENST00000463518;ENST00000476237;ENST00000460469	T;T;T;T;T;T;T;T	0.55413	0.64;0.68;0.66;0.54;0.52;0.66;0.67;0.54	5.54	5.54	0.83059	.	0.054983	0.64402	D	0.000001	T	0.81153	0.4763	H	0.96398	3.815	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.83275	0.996;0.975	D	0.87258	0.2277	10	0.87932	D	0	-38.0183	14.8418	0.70230	0.0:0.0:0.0:1.0	.	90;90	C9JA08;Q96D46	.;NMD3_HUMAN	P	90	ENSP00000418852:L90P;ENSP00000418980:L90P;ENSP00000419030:L90P;ENSP00000307525:L90P;ENSP00000417559:L90P;ENSP00000418908:L90P;ENSP00000419647:L90P;ENSP00000419004:L90P	ENSP00000307525:L90P	L	+	2	0	NMD3	162427818	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	7.120000	0.77153	2.096000	0.63516	0.482000	0.46254	CTG	-	pfam_NMD3		0.348	NMD3-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	NMD3	protein_coding	OTTHUMT00000353114.1	T	NM_015938	-		160945124	+1	no_errors	ENST00000351193	ensembl	human	known	74_37	missense	SNP	1.000	C
ALDH8A1	64577	genome.wustl.edu	37	6	135239814	135239814	+	Frame_Shift_Del	DEL	G	G	-			TCGA-WK-A8XZ-01A-11D-A37C-09	TCGA-WK-A8XZ-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	82b3cc1e-5a9f-413a-bf84-f936bf806217	4f0633e4-1412-4a20-8b9c-0451a23d8b55	g.chr6:135239814delG	ENST00000265605.2	-	7	1271	c.1203delC	c.(1201-1203)cccfs	p.P401fs	ALDH8A1_ENST00000367845.2_Frame_Shift_Del_p.P347fs|ALDH8A1_ENST00000367847.2_Frame_Shift_Del_p.P351fs	NM_022568.3	NP_072090.1	Q9H2A2	AL8A1_HUMAN	aldehyde dehydrogenase 8 family, member A1	401					9-cis-retinoic acid biosynthetic process (GO:0042904)|retinal metabolic process (GO:0042574)|retinoic acid metabolic process (GO:0042573)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)	retinal dehydrogenase activity (GO:0001758)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	36	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00401)|GBM - Glioblastoma multiforme(68;0.0058)		CACTATCAAAGGGGACGACAC	0.527																																																	0								ENSG00000118514						161.0	118.0	132.0					6																	135239814		2203	4300	6503	ALDH8A1	SO:0001589	frameshift_variant	0				HGNC	AL021939	CCDS5171.1, CCDS5172.1, CCDS55057.1	6q24.1-q25.1	2008-07-03			ENSG00000118514	ENSG00000118514		"""Aldehyde dehydrogenases"""	15471	protein-coding gene	gene with protein product		606467				11007799	Standard	NM_001193480		Approved	ALDH12	uc003qew.3	Q9H2A2	OTTHUMG00000015623	ENST00000265605.2:c.1203delC	6.37:g.135239814delG	ENSP00000265605:p.Pro401fs	Somatic	0	35	0.00		0.5480226040680333	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	15	34.78	B7Z521|O60793|Q24JS9|Q53GT3|Q5TI80	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Aldehyde_DH_dom,superfamily_Ald_DH/histidinol_DH	p.F402fs	ENST00000265605.2	37	c.1203	CCDS5171.1	6																																																																																			-	pfam_Aldehyde_DH_dom,superfamily_Ald_DH/histidinol_DH		0.527	ALDH8A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALDH8A1	protein_coding	OTTHUMT00000042334.2	G				135239814	-1	no_errors	ENST00000265605	ensembl	human	known	74_37	frame_shift_del	DEL	0.996	-
CENPF	1063	genome.wustl.edu	37	1	214814122	214814122	+	Missense_Mutation	SNP	G	G	T			TCGA-WK-A8XZ-01A-11D-A37C-09	TCGA-WK-A8XZ-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	82b3cc1e-5a9f-413a-bf84-f936bf806217	4f0633e4-1412-4a20-8b9c-0451a23d8b55	g.chr1:214814122G>T	ENST00000366955.3	+	12	2609	c.2441G>T	c.(2440-2442)tGt>tTt	p.C814F		NM_016343.3	NP_057427.3	P49454	CENPF_HUMAN	centromere protein F, 350/400kDa	0					cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|kinetochore assembly (GO:0051382)|metaphase plate congression (GO:0051310)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|muscle organ development (GO:0007517)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of striated muscle tissue development (GO:0016202)|response to drug (GO:0042493)	chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|midbody (GO:0030496)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|pronucleus (GO:0045120)|spindle (GO:0005819)|spindle pole (GO:0000922)	chromatin binding (GO:0003682)|dynein binding (GO:0045502)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)			NS(2)|breast(2)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(37)|lung(47)|ovary(7)|prostate(3)|skin(6)|stomach(1)|urinary_tract(1)	126				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		AGGAGTGAATGTCGTTTAGAA	0.393																																					Colon(80;575 1284 11000 14801 43496)												0								ENSG00000117724						51.0	53.0	53.0					1																	214814122		2201	4299	6500	CENPF	SO:0001583	missense	0			-	HGNC	U30872	CCDS31023.1	1q41	2013-11-05	2013-01-17		ENSG00000117724	ENSG00000117724			1857	protein-coding gene	gene with protein product	"""mitosin"""	600236	"""centromere protein F, 350/400kDa (mitosin)"""			7904902, 7851898	Standard	NM_016343		Approved	hcp-1	uc001hkm.3	P49454	OTTHUMG00000036955	ENST00000366955.3:c.2441G>T	1.37:g.214814122G>T	ENSP00000355922:p.Cys814Phe	Somatic	0	33	0.00		0.5480226040680333	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	21	16.00	Q13171|Q13246|Q5VVM7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Centromere_CenpF_N,pfam_Centromere_CenpF_leu-rich_rpt,pfam_CenpF/LEK1_Rb-prot-bd	p.C814F	ENST00000366955.3	37	c.2441	CCDS31023.1	1	.	.	.	.	.	.	.	.	.	.	G	2.694	-0.272476	0.05716	.	.	ENSG00000117724	ENST00000366955	T	0.03212	4.01	5.59	3.49	0.39957	.	0.179588	0.27402	N	0.019527	T	0.02610	0.0079	.	.	.	0.09310	N	1	P	0.45126	0.851	B	0.34873	0.191	T	0.48127	-0.9062	9	0.42905	T	0.14	.	7.9225	0.29854	0.0945:0.0:0.7164:0.189	.	814	P49454	CENPF_HUMAN	F	814	ENSP00000355922:C814F	ENSP00000355922:C814F	C	+	2	0	CENPF	212880745	0.003000	0.15002	0.030000	0.17652	0.254000	0.26022	0.790000	0.26900	1.297000	0.44761	0.609000	0.83330	TGT	-	NULL		0.393	CENPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CENPF	protein_coding	OTTHUMT00000089749.1	G	NM_016343	-		214814122	+1	no_errors	ENST00000366955	ensembl	human	known	74_37	missense	SNP	0.001	T
ANKRD28	23243	genome.wustl.edu	37	3	15838150	15838151	+	Intron	INS	-	-	T	rs397988804|rs144777884|rs34139082|rs192856159|rs201201313	byFrequency	TCGA-WK-A8XZ-01A-11D-A37C-09	TCGA-WK-A8XZ-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	82b3cc1e-5a9f-413a-bf84-f936bf806217	4f0633e4-1412-4a20-8b9c-0451a23d8b55	g.chr3:15838150_15838151insT	ENST00000399451.2	-	2	395				ANKRD28_ENST00000383777.1_5'Flank|ANKRD28_ENST00000497037.1_Intron	NM_001195098.1|NM_001195099.1|NM_015199.3	NP_001182027.1|NP_001182028.1|NP_056014.2	O15084	ANR28_HUMAN	ankyrin repeat domain 28							nucleus (GO:0005634)				breast(2)|endometrium(1)|large_intestine(2)|prostate(1)	6						GCACAGCTGGGTTTTTTTTTTT	0.297																																																	0								ENSG00000206560																																			ANKRD28	SO:0001627	intron_variant	0				HGNC	AY367056	CCDS46769.1, CCDS74908.1	3p25.1	2013-01-10			ENSG00000206560	ENSG00000206560		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"", ""Ankyrin repeat domain containing"""	29024	protein-coding gene	gene with protein product	"""phosphatase interactor targeting K protein"", ""protein phosphatase 6 ankyrin repeat subunit A"", ""protein phosphatase 1, regulatory subunit 65"""	611122				9205841	Standard	NM_015199		Approved	KIAA0379, PITK, PP6-ARS-A, PPP1R65	uc003caj.1	O15084	OTTHUMG00000155379	ENST00000399451.2:c.28-1337->A	3.37:g.15838161_15838161dupT		Somatic	0	10	0.00		0.5480226040680333	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	10	16.67	B4DES5|Q1WWL4|Q29RW6|Q3B857|Q6ULS0|Q6ZT57	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000399451.2	37	NULL	CCDS46769.1	3																																																																																			-	-		0.297	ANKRD28-003	PUTATIVE	basic|appris_candidate|CCDS	protein_coding	ANKRD28	protein_coding	OTTHUMT00000339758.1	-	NM_015199			15838151	-1	no_errors	ENST00000461696	ensembl	human	known	74_37	rna	INS	0.016:0.428	T
NEK1	4750	genome.wustl.edu	37	4	170482982	170482982	+	Splice_Site	SNP	C	C	T			TCGA-WK-A8XZ-01A-11D-A37C-09	TCGA-WK-A8XZ-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	82b3cc1e-5a9f-413a-bf84-f936bf806217	4f0633e4-1412-4a20-8b9c-0451a23d8b55	g.chr4:170482982C>T	ENST00000439128.2	-	13	1781		c.e13+1		NEK1_ENST00000511633.1_Splice_Site|NEK1_ENST00000512193.1_Splice_Site|NEK1_ENST00000507142.1_Splice_Site|NEK1_ENST00000510533.1_Splice_Site	NM_012224.2	NP_036356.1	Q96PY6	NEK1_HUMAN	NIMA-related kinase 1						cellular response to DNA damage stimulus (GO:0006974)|cilium assembly (GO:0042384)|mitotic nuclear division (GO:0007067)|response to ionizing radiation (GO:0010212)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|pericentriolar material (GO:0000242)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			NS(1)|breast(3)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|ovary(2)|prostate(2)|stomach(1)	45		Prostate(90;0.00601)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.0287)|KIRC - Kidney renal clear cell carcinoma(143;0.0325)|Kidney(143;0.0385)|LUSC - Lung squamous cell carcinoma(193;0.14)		CAAAAAACTACCTGATCCTTT	0.289																																																	0								ENSG00000137601						36.0	38.0	37.0					4																	170482982		1790	4062	5852	NEK1	SO:0001630	splice_region_variant	0			-	HGNC	AB067488	CCDS47162.1, CCDS56348.1, CCDS56349.1, CCDS56350.1, CCDS56351.1	4q32.3	2012-11-15	2012-11-15		ENSG00000137601	ENSG00000137601			7744	protein-coding gene	gene with protein product		604588	"""NIMA (never in mitosis gene a)-related kinase 1"""			1382974, 8274451	Standard	NM_012224		Approved	NY-REN-55, KIAA1901	uc003isd.2	Q96PY6	OTTHUMG00000160963	ENST00000439128.2:c.1140+1G>A	4.37:g.170482982C>T		Somatic	0	58	0.00		0.5480226040680333	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	34	30.61	G5E9Z3|Q05DG5|Q14CB7|Q5H9T1|Q6PIB8|Q96SS2|Q9H6P7|Q9Y594	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e12+1	ENST00000439128.2	37	c.1140+1	CCDS47162.1	4	.	.	.	.	.	.	.	.	.	.	C	18.79	3.699633	0.68501	.	.	ENSG00000137601	ENST00000439128;ENST00000511633;ENST00000510533;ENST00000507142;ENST00000512193	.	.	.	5.63	4.79	0.61399	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.6574	0.68844	0.0:0.9302:0.0:0.0698	.	.	.	.	.	-1	.	.	.	-	.	.	NEK1	170719557	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.586000	0.67503	1.397000	0.46682	0.655000	0.94253	.	-	-		0.289	NEK1-001	KNOWN	basic|CCDS	protein_coding	NEK1	protein_coding	OTTHUMT00000363157.3	C		-	Intron	170482982	-1	no_errors	ENST00000507142	ensembl	human	known	74_37	splice_site	SNP	1.000	T
TP53	7157	genome.wustl.edu	37	17	7578536	7578536	+	Missense_Mutation	SNP	T	T	C			TCGA-WK-A8XZ-01A-11D-A37C-09	TCGA-WK-A8XZ-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	82b3cc1e-5a9f-413a-bf84-f936bf806217	4f0633e4-1412-4a20-8b9c-0451a23d8b55	g.chr17:7578536T>C	ENST00000269305.4	-	5	583	c.394A>G	c.(394-396)Aag>Gag	p.K132E	TP53_ENST00000413465.2_Missense_Mutation_p.K132E|TP53_ENST00000445888.2_Missense_Mutation_p.K132E|TP53_ENST00000359597.4_Missense_Mutation_p.K132E|TP53_ENST00000455263.2_Missense_Mutation_p.K132E|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Missense_Mutation_p.K132E	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	132	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		K -> E (in LFS; germline mutation and in sporadic cancers; somatic mutation).|K -> L (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|K -> M (in sporadic cancers; somatic mutation).|K -> N (in sporadic cancers; somatic mutation).|K -> Q (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1694291}.|K -> R (in sporadic cancers; somatic mutation).|K -> T (in sporadic cancers; somatic mutation).|K -> W (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|KM -> NL (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.K132E(20)|p.K132Q(13)|p.0?(8)|p.Y126_K132delYSPALNK(6)|p.N131del(3)|p.K132*(3)|p.N131fs*27(2)|p.K132fs*38(2)|p.V73fs*9(1)|p.S127fs*36(1)|p.A129_K132delALNK(1)|p.Y126fs*11(1)|p.K132_A138delKMFCQLA(1)|p.S127_Q136del10(1)|p.L130_M133delLNKM(1)|p.L130fs*16(1)|p.K132W(1)|p.K39E(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CAAAACATCTTGTTGAGGGCA	0.557		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	67	Substitution - Missense(35)|Deletion - In frame(13)|Whole gene deletion(8)|Deletion - Frameshift(8)|Substitution - Nonsense(3)	breast(11)|central_nervous_system(7)|haematopoietic_and_lymphoid_tissue(7)|ovary(6)|large_intestine(5)|urinary_tract(5)|lung(5)|bone(4)|upper_aerodigestive_tract(3)|adrenal_gland(2)|stomach(2)|oesophagus(2)|prostate(2)|soft_tissue(1)|cervix(1)|kidney(1)|biliary_tract(1)|pancreas(1)|liver(1)	GRCh37	CM086989|CM973641	TP53	M		ENSG00000141510						46.0	47.0	46.0					17																	7578536		2203	4300	6503	TP53	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	-	HGNC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.394A>G	17.37:g.7578536T>C	ENSP00000269305:p.Lys132Glu	Somatic	0	39	0.00		0.5480226040680333	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	2	85.71	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.K132E	ENST00000269305.4	37	c.394	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	T	25.8	4.670498	0.88348	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000514944;ENST00000508793	D;D;D;D;D;D;D;D	0.99854	-7.19;-7.19;-7.19;-7.19;-7.19;-7.19;-7.19;-7.19	5.48	5.48	0.80851	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99876	0.9941	M	0.91768	3.24	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;0.991;0.999;1.0;0.999;1.0	D;D;D;D;D;D;D	0.97110	0.992;0.992;0.953;0.98;0.995;0.989;1.0	D	0.96352	0.9259	10	0.87932	D	0	-14.0777	13.8301	0.63375	0.0:0.0:0.0:1.0	.	93;132;132;39;132;132;132	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	E	132;132;132;132;132;132;121;39;39;132	ENSP00000410739:K132E;ENSP00000352610:K132E;ENSP00000269305:K132E;ENSP00000398846:K132E;ENSP00000391127:K132E;ENSP00000391478:K132E;ENSP00000423862:K39E;ENSP00000424104:K132E	ENSP00000269305:K132E	K	-	1	0	TP53	7519261	1.000000	0.71417	1.000000	0.80357	0.777000	0.43975	7.993000	0.88291	2.206000	0.71126	0.533000	0.62120	AAG	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor		0.557	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	T	NM_000546	-		7578536	-1	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	SNP	1.000	C
EXOSC10	5394	genome.wustl.edu	37	1	11140854	11140854	+	Frame_Shift_Del	DEL	T	T	-			TCGA-WK-A8XZ-01A-11D-A37C-09	TCGA-WK-A8XZ-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	82b3cc1e-5a9f-413a-bf84-f936bf806217	4f0633e4-1412-4a20-8b9c-0451a23d8b55	g.chr1:11140854delT	ENST00000376936.4	-	12	1602	c.1553delA	c.(1552-1554)gatfs	p.D518fs	EXOSC10_ENST00000485606.1_5'UTR|EXOSC10_ENST00000304457.7_Frame_Shift_Del_p.D518fs|EXOSC10_ENST00000544779.1_Frame_Shift_Del_p.D518fs	NM_001001998.1	NP_001001998.1	Q01780	EXOSX_HUMAN	exosome component 10	518	HRDC. {ECO:0000255|PROSITE- ProRule:PRU00328}.				CUT catabolic process (GO:0071034)|dosage compensation by inactivation of X chromosome (GO:0009048)|histone mRNA catabolic process (GO:0071044)|maturation of 5.8S rRNA (GO:0000460)|nuclear mRNA surveillance (GO:0071028)|nuclear polyadenylation-dependent rRNA catabolic process (GO:0071035)|nuclear retention of unspliced pre-mRNA at the site of transcription (GO:0071048)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)	cytoplasm (GO:0005737)|exosome (RNase complex) (GO:0000178)|membrane (GO:0016020)|nuclear exosome (RNase complex) (GO:0000176)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcriptionally active chromatin (GO:0035327)	3'-5' exonuclease activity (GO:0008408)|exoribonuclease activity (GO:0004532)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(9)|prostate(1)|stomach(3)|upper_aerodigestive_tract(1)	27	Ovarian(185;0.249)	Lung NSC(185;1.74e-05)|all_lung(284;2.05e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00262)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;4.18e-07)|COAD - Colon adenocarcinoma(227;8.33e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000315)|Kidney(185;0.000832)|KIRC - Kidney renal clear cell carcinoma(229;0.00269)|READ - Rectum adenocarcinoma(331;0.0526)|STAD - Stomach adenocarcinoma(313;0.202)		AGCTGTTTTATCCCTCCAGGC	0.423																																					Colon(179;105 1987 14326 27364 29542)												0								ENSG00000171824						123.0	131.0	128.0					1																	11140854		2203	4300	6503	EXOSC10	SO:0001589	frameshift_variant	0				HGNC	BC073788	CCDS126.1, CCDS30584.1	1p36.22	2008-02-05	2004-06-16	2004-06-18	ENSG00000171824	ENSG00000171824			9138	protein-coding gene	gene with protein product	"""polymyositis/scleroderma autoantigen 2 (100kD)"""	605960	"""polymyositis/scleroderma autoantigen 2, 100kDa"""	PMSCL2		1383382, 1644924	Standard	NM_001001998		Approved	PM-Scl, PM/Scl-100, Rrp6p, RRP6, p2, p3, p4	uc001asa.3	Q01780	OTTHUMG00000002123	ENST00000376936.4:c.1553delA	1.37:g.11140854delT	ENSP00000366135:p.Asp518fs	Somatic	0	49	0.00		0.5480226040680333	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	17	10.53	B1AKQ0|B1AKQ1|Q15158	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_3'-5'_exonuclease_dom,pfam_Exosome-assoc_fac_Rrp6_N,pfam_HRDC_dom,superfamily_RNaseH-like_dom,superfamily_HRDC-like,smart_3'-5'_exonuclease_dom,smart_HRDC_dom,pfscan_HRDC_dom	p.D518fs	ENST00000376936.4	37	c.1553	CCDS30584.1	1																																																																																			-	pfam_HRDC_dom,superfamily_HRDC-like,smart_HRDC_dom,pfscan_HRDC_dom		0.423	EXOSC10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EXOSC10	protein_coding	OTTHUMT00000006078.1	T	NM_001001998			11140854	-1	no_errors	ENST00000376936	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
POTEB	100996331	genome.wustl.edu	37	15	22063539	22063539	+	Missense_Mutation	SNP	A	A	G	rs200568517|rs551150352	byFrequency	TCGA-WK-A8XZ-01A-11D-A37C-09	TCGA-WK-A8XZ-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	82b3cc1e-5a9f-413a-bf84-f936bf806217	4f0633e4-1412-4a20-8b9c-0451a23d8b55	g.chr15:22063539A>G	ENST00000439682.1	-	8	1171	c.1120T>C	c.(1120-1122)Tgt>Cgt	p.C374R		NM_001277304.1	NP_001264233.1	Q6S5H4	POTEB_HUMAN	POTE ankyrin domain family, member B	411										endometrium(2)|kidney(8)|lung(4)	14						TCTCTATCACAGTCCTTATTT	0.328																																																	0								ENSG00000233917																																			POTEB	SO:0001583	missense	0			-	HGNC	AY465170	CCDS59250.1	15q11.2	2014-01-10	2008-11-26	2008-11-26	ENSG00000233917	ENSG00000233917		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33734	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 5"""	608912	"""ANKRD26-like family B, member 1"""	A26B1			Standard	NM_001277304		Approved	POTE15, POTE-15, CT104.5	uc031qqz.1	Q6S5H4		ENST00000439682.1:c.1120T>C	15.37:g.22063539A>G	ENSP00000457689:p.Cys374Arg	Somatic	0	11	0.00		0.5480226040680333	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	7	30.00	Q6NXN7|Q6S5H7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,prints_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.C374R	ENST00000439682.1	37	c.1120	CCDS59250.1	15																																																																																			-	NULL		0.328	POTEB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POTEB	protein_coding	OTTHUMT00000414911.2	A	NM_207355	rs200568517		22063539	-1	no_errors	ENST00000439682	ensembl	human	known	74_37	missense	SNP	0.028	G
PLEC	5339	genome.wustl.edu	37	8	144995719	144995719	+	Missense_Mutation	SNP	C	C	G			TCGA-WK-A8XZ-01A-11D-A37C-09	TCGA-WK-A8XZ-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	82b3cc1e-5a9f-413a-bf84-f936bf806217	4f0633e4-1412-4a20-8b9c-0451a23d8b55	g.chr8:144995719C>G	ENST00000322810.4	-	32	8850	c.8681G>C	c.(8680-8682)gGt>gCt	p.G2894A	PLEC_ENST00000356346.3_Missense_Mutation_p.G2743A|PLEC_ENST00000527096.1_Missense_Mutation_p.G2780A|PLEC_ENST00000354589.3_Missense_Mutation_p.G2757A|PLEC_ENST00000354958.2_Missense_Mutation_p.G2735A|PLEC_ENST00000357649.2_Missense_Mutation_p.G2761A|PLEC_ENST00000398774.2_Missense_Mutation_p.G2725A|PLEC_ENST00000345136.3_Missense_Mutation_p.G2757A|PLEC_ENST00000436759.2_Missense_Mutation_p.G2784A	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	2894	Globular 2.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						GCCCACCACACCCTCCTTCAC	0.672																																																	0								ENSG00000178209						31.0	40.0	37.0					8																	144995719		2083	4192	6275	PLEC	SO:0001583	missense	0			-	HGNC	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.8681G>C	8.37:g.144995719C>G	ENSP00000323856:p.Gly2894Ala	Somatic	0	47	0.00		0.5480226040680333	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	24	40.00	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Plectin_repeat,pfam_CH-domain,pfam_S10_plectin_N,superfamily_CH-domain,superfamily_Chorismate_mutase_type_II,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,pfscan_CH-domain	p.G2894A	ENST00000322810.4	37	c.8681	CCDS43772.1	8	.	.	.	.	.	.	.	.	.	.	C	4.608	0.112999	0.08831	.	.	ENSG00000178209	ENST00000345136;ENST00000357649;ENST00000354589;ENST00000398774;ENST00000322810;ENST00000354958;ENST00000356346;ENST00000436759;ENST00000527096	D;D;D;D;D;D;D;D;D	0.85411	-1.98;-1.98;-1.98;-1.98;-1.98;-1.98;-1.98;-1.98;-1.98	4.44	4.44	0.53790	.	0.183823	0.32488	U	0.006034	D	0.87791	0.6266	H	0.94345	3.525	0.36682	D	0.879082	B;B;B;B;B;B;B;B	0.30179	0.229;0.143;0.143;0.271;0.143;0.143;0.229;0.229	B;B;B;B;B;B;B;B	0.25506	0.036;0.036;0.036;0.061;0.036;0.036;0.036;0.036	D	0.90467	0.4450	10	0.72032	D	0.01	.	10.8439	0.46733	0.0:0.9111:0.0:0.0889	.	2784;2743;2735;2894;2725;2757;2761;2757	Q15149-2;Q15149-9;Q15149-8;Q15149;Q15149-7;Q15149-5;Q15149-6;Q15149-4	.;.;.;PLEC_HUMAN;.;.;.;.	A	2757;2761;2757;2725;2894;2735;2743;2784;2780	ENSP00000344848:G2757A;ENSP00000350277:G2761A;ENSP00000346602:G2757A;ENSP00000381756:G2725A;ENSP00000323856:G2894A;ENSP00000347044:G2735A;ENSP00000348702:G2743A;ENSP00000388180:G2784A;ENSP00000434583:G2780A	ENSP00000323856:G2894A	G	-	2	0	PLEC	145067707	0.803000	0.28956	0.100000	0.21137	0.164000	0.22412	2.961000	0.49168	2.470000	0.83445	0.442000	0.29010	GGT	-	pfam_Plectin_repeat,smart_Plectin_repeat		0.672	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEC	protein_coding	OTTHUMT00000383281.1	C	NM_000445	-		144995719	-1	no_errors	ENST00000322810	ensembl	human	known	74_37	missense	SNP	0.602	G
CPN1	1369	genome.wustl.edu	37	10	101841225	101841225	+	Missense_Mutation	SNP	C	C	T			TCGA-WK-A8XZ-01A-11D-A37C-09	TCGA-WK-A8XZ-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	82b3cc1e-5a9f-413a-bf84-f936bf806217	4f0633e4-1412-4a20-8b9c-0451a23d8b55	g.chr10:101841225C>T	ENST00000370418.3	-	1	409	c.158G>A	c.(157-159)cGc>cAc	p.R53H		NM_001308.2	NP_001299.1	P15169	CBPN_HUMAN	carboxypeptidase N, polypeptide 1	53	Catalytic.				response to glucocorticoid (GO:0051384)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(14)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	33		Colorectal(252;0.234)		Epithelial(162;4.77e-10)|all cancers(201;3.82e-08)		CTCCACGCTGCGCCCAATGCT	0.597																																																	0								ENSG00000120054						64.0	57.0	60.0					10																	101841225		2203	4300	6503	CPN1	SO:0001583	missense	0			-	HGNC	X14329	CCDS7486.1	10q24.2	2012-02-10	2007-02-23		ENSG00000120054	ENSG00000120054	3.4.17.3		2312	protein-coding gene	gene with protein product	"""anaphylatoxin inactivator"", ""arginine carboxypeptidase"", ""carboxypeptidase K"", ""kininase I"", ""lysine carboxypeptidase"""	603103	"""carboxypeptidase N, polypeptide 1, 50kD"""			9628828, 2912725	Standard	NM_001308		Approved		uc001kql.2	P15169	OTTHUMG00000018896	ENST00000370418.3:c.158G>A	10.37:g.101841225C>T	ENSP00000359446:p.Arg53His	Somatic	0	28	0.00		0.5480226040680333	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	13	18.75	B1AP59	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_M14,pfam_DUF2817,superfamily_CarboxyPept-like_regulatory,smart_Peptidase_M14,prints_Peptidase_M14	p.R53H	ENST00000370418.3	37	c.158	CCDS7486.1	10	.	.	.	.	.	.	.	.	.	.	C	17.60	3.428843	0.62844	.	.	ENSG00000120054	ENST00000370418	T	0.11495	2.77	5.45	4.54	0.55810	Peptidase M14, carboxypeptidase A (3);	0.110754	0.64402	D	0.000008	T	0.17534	0.0421	M	0.78801	2.425	0.54753	D	0.999986	B	0.15473	0.013	B	0.14578	0.011	T	0.03025	-1.1081	10	0.87932	D	0	-4.2766	14.5973	0.68415	0.0:0.9282:0.0:0.0718	.	53	P15169	CBPN_HUMAN	H	53	ENSP00000359446:R53H	ENSP00000359446:R53H	R	-	2	0	CPN1	101831215	1.000000	0.71417	0.997000	0.53966	0.985000	0.73830	1.651000	0.37302	2.555000	0.86185	0.555000	0.69702	CGC	-	pfam_Peptidase_M14,smart_Peptidase_M14,prints_Peptidase_M14		0.597	CPN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPN1	protein_coding	OTTHUMT00000049828.1	C	NM_001308	-		101841225	-1	no_errors	ENST00000370418	ensembl	human	known	74_37	missense	SNP	0.997	T
EMR2	30817	genome.wustl.edu	37	19	14875250	14875250	+	Missense_Mutation	SNP	C	C	T			TCGA-WK-A8XZ-01A-11D-A37C-09	TCGA-WK-A8XZ-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	82b3cc1e-5a9f-413a-bf84-f936bf806217	4f0633e4-1412-4a20-8b9c-0451a23d8b55	g.chr19:14875250C>T	ENST00000315576.3	-	11	1530	c.1079G>A	c.(1078-1080)gGc>gAc	p.G360D	EMR2_ENST00000353876.1_Missense_Mutation_p.G267D|EMR2_ENST00000594076.1_Missense_Mutation_p.G267D|EMR2_ENST00000594294.1_Missense_Mutation_p.G311D|EMR2_ENST00000392967.2_Missense_Mutation_p.G360D|EMR2_ENST00000346057.1_Missense_Mutation_p.G311D|EMR2_ENST00000353005.1_Missense_Mutation_p.G218D|EMR2_ENST00000595839.1_Missense_Mutation_p.G218D|EMR2_ENST00000596991.2_Missense_Mutation_p.G360D|EMR2_ENST00000601345.1_Missense_Mutation_p.G360D|EMR2_ENST00000392964.3_Missense_Mutation_p.G99D|EMR2_ENST00000392965.3_Missense_Mutation_p.G360D	NM_013447.3	NP_038475.2	Q9UHX3	EMR2_HUMAN	egf-like module containing, mucin-like, hormone receptor-like 2	360					cell adhesion (GO:0007155)|cell migration (GO:0016477)|G-protein coupled receptor signaling pathway (GO:0007186)|granulocyte chemotaxis (GO:0071621)|inflammatory response (GO:0006954)|neuropeptide signaling pathway (GO:0007218)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|leading edge membrane (GO:0031256)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chondroitin sulfate binding (GO:0035374)|G-protein coupled receptor activity (GO:0004930)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(8)|lung(19)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	48						CCTACCTGTGCCTGCAGGATA	0.552																																																	0								ENSG00000127507						56.0	53.0	54.0					19																	14875250		2203	4300	6503	EMR2	SO:0001583	missense	0			-	HGNC	AF114491	CCDS32935.1, CCDS59361.1	19p13.1	2014-08-08	2003-11-26			ENSG00000127507		"""CD molecules"", ""-"", ""GPCR / Class B : Orphans"""	3337	protein-coding gene	gene with protein product		606100	"""egf-like module containing, mucin-like, hormone receptor-like sequence 2"""				Standard	NM_013447		Approved	CD312	uc002mzp.2	Q9UHX3		ENST00000315576.3:c.1079G>A	19.37:g.14875250C>T	ENSP00000319883:p.Gly360Asp	Somatic	0	42	0.00		0.5480226040680333	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	31	11.43	B4DQ96|E7ESD7|E9PBR1|E9PEL6|E9PFQ5|E9PG91|Q8NG96|Q9Y4B1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_2_secretin-like,pfam_EGF-like_Ca-bd_dom,pfam_GPS_dom,pfam_EG-like_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_GPS_dom,pfscan_EG-like_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_CD97,prints_GPCR_2_EMR1_rcpt,prints_GPCR_2_secretin-like	p.G360D	ENST00000315576.3	37	c.1079	CCDS32935.1	19	.	.	.	.	.	.	.	.	.	.	C	15.43	2.832012	0.50845	.	.	ENSG00000127507	ENST00000315576;ENST00000392967;ENST00000346057;ENST00000353876;ENST00000353005;ENST00000392965;ENST00000392964;ENST00000392962	T;T;T;T;T;T;T;T	0.79940	-0.89;-1.03;-0.43;0.37;1.07;-1.26;1.18;-1.32	3.54	2.48	0.30137	.	.	.	.	.	D	0.83031	0.5166	L	0.59436	1.845	0.80722	D	1	P;D;D;D;D;D;P;B	0.76494	0.787;0.958;0.998;0.999;0.997;0.998;0.777;0.343	B;P;D;D;D;D;B;B	0.68192	0.219;0.601;0.951;0.956;0.95;0.928;0.275;0.25	T	0.77965	-0.2389	9	0.17369	T	0.5	.	7.481	0.27404	0.0:0.8697:0.0:0.1303	.	360;267;360;218;311;360;360;360	E7ESD7;Q9UHX3-4;A0JNV7;Q9UHX3-5;Q9UHX3-3;A8K6W1;Q9UHX3;Q9UHX3-2	.;.;.;.;.;.;EMR2_HUMAN;.	D	360;360;311;267;218;360;99;311	ENSP00000319883:G360D;ENSP00000376694:G360D;ENSP00000263380:G311D;ENSP00000319454:G267D;ENSP00000319838:G218D;ENSP00000376692:G360D;ENSP00000376691:G99D;ENSP00000376689:G311D	ENSP00000319883:G360D	G	-	2	0	EMR2	14736250	0.013000	0.17824	0.671000	0.29857	0.128000	0.20619	-0.461000	0.06712	0.783000	0.33636	0.508000	0.49915	GGC	-	prints_GPCR_2_CD97		0.552	EMR2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	EMR2	protein_coding	OTTHUMT00000466502.2	C		-		14875250	-1	no_errors	ENST00000315576	ensembl	human	known	74_37	missense	SNP	0.957	T
KCNC2	3747	genome.wustl.edu	37	12	75441989	75441989	+	Missense_Mutation	SNP	C	C	T			TCGA-WK-A8XZ-01A-11D-A37C-09	TCGA-WK-A8XZ-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	82b3cc1e-5a9f-413a-bf84-f936bf806217	4f0633e4-1412-4a20-8b9c-0451a23d8b55	g.chr12:75441989C>T	ENST00000549446.1	-	4	2404	c.1724G>A	c.(1723-1725)tGt>tAt	p.C575Y	KCNC2_ENST00000540018.1_Intron|KCNC2_ENST00000393288.2_Missense_Mutation_p.C575Y|KCNC2_ENST00000341669.3_Missense_Mutation_p.C575Y|KCNC2_ENST00000350228.2_Intron|KCNC2_ENST00000548243.1_5'Flank|KCNC2_ENST00000548513.1_Missense_Mutation_p.C575Y|KCNC2_ENST00000298972.1_Missense_Mutation_p.C575Y|KCNC2_ENST00000550433.1_Missense_Mutation_p.C575Y	NM_001260497.1|NM_139137.3	NP_001247426.1|NP_631875.1	Q96PR1	KCNC2_HUMAN	potassium voltage-gated channel, Shaw-related subfamily, member 2	575					action potential (GO:0001508)|energy reserve metabolic process (GO:0006112)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			breast(3)|endometrium(4)|kidney(1)|large_intestine(9)|liver(1)|lung(28)|ovary(1)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	54					Dalfampridine(DB06637)	CAGTAGGAAACATGTTTCCCC	0.483																																																	0								ENSG00000166006						326.0	254.0	279.0					12																	75441989		2203	4300	6503	KCNC2	SO:0001583	missense	0			-	HGNC	AF268896	CCDS9005.1, CCDS9006.1, CCDS9007.1, CCDS58255.1, CCDS58256.1, CCDS58257.1	12q14.1	2012-07-05						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6234	protein-coding gene	gene with protein product		176256				8111118, 16382104	Standard	NM_139136		Approved	Kv3.2	uc001sxg.2	Q96PR1	OTTHUMG00000169717	ENST00000549446.1:c.1724G>A	12.37:g.75441989C>T	ENSP00000449253:p.Cys575Tyr	Somatic	0	54	0.00		0.5480226040680333	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	26	39.53	B7Z231|F5H030|J3KPP5|Q4LE77|Q86W09|Q8N1V9|Q96PR0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_2pore_dom_K_chnl_dom,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv3,prints_K_chnl_volt-dep_Kv	p.C575Y	ENST00000549446.1	37	c.1724	CCDS9007.1	12	.	.	.	.	.	.	.	.	.	.	C	25.1	4.607081	0.87157	.	.	ENSG00000166006	ENST00000550433;ENST00000548513;ENST00000549446;ENST00000341669;ENST00000298972;ENST00000393288	D;D;D;D;D;D	0.98732	-4.58;-4.77;-5.1;-4.58;-4.77;-4.7	5.55	5.55	0.83447	.	0.918110	0.09437	N	0.802364	D	0.98982	0.9653	L	0.54323	1.7	0.80722	D	1	P;P;D	0.69078	0.917;0.864;0.997	P;B;D	0.80764	0.584;0.38;0.994	D	0.97849	1.0273	10	0.66056	D	0.02	.	19.4922	0.95054	0.0:1.0:0.0:0.0	.	575;575;575	Q96PR1-2;Q96PR1;Q96PR1-3	.;KCNC2_HUMAN;.	Y	575	ENSP00000448301:C575Y;ENSP00000449941:C575Y;ENSP00000449253:C575Y;ENSP00000340121:C575Y;ENSP00000298972:C575Y;ENSP00000376966:C575Y	ENSP00000298972:C575Y	C	-	2	0	KCNC2	73728256	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.256000	0.78350	2.604000	0.88044	0.585000	0.79938	TGT	-	NULL		0.483	KCNC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KCNC2	protein_coding	OTTHUMT00000405581.2	C	NM_153748	-		75441989	-1	no_errors	ENST00000549446	ensembl	human	known	74_37	missense	SNP	1.000	T
PSD	5662	genome.wustl.edu	37	10	104172156	104172156	+	Missense_Mutation	SNP	G	G	A			TCGA-WK-A8XZ-01A-11D-A37C-09	TCGA-WK-A8XZ-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	82b3cc1e-5a9f-413a-bf84-f936bf806217	4f0633e4-1412-4a20-8b9c-0451a23d8b55	g.chr10:104172156G>A	ENST00000020673.5	-	6	2256	c.1730C>T	c.(1729-1731)gCc>gTc	p.A577V	PSD_ENST00000406432.1_Missense_Mutation_p.A577V	NM_001270966.1|NM_002779.4	NP_001257895.1|NP_002770.3	A5PKW4	PSD1_HUMAN	pleckstrin and Sec7 domain containing	577	SEC7. {ECO:0000255|PROSITE- ProRule:PRU00189}.				neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cell projection (GO:0042995)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phospholipid binding (GO:0005543)|signal transducer activity (GO:0004871)			breast(4)|endometrium(2)|large_intestine(5)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	34				Epithelial(162;1.27e-08)|all cancers(201;2.85e-07)		CAGGTGCCGGGCCACATCGGC	0.602																																																	0								ENSG00000059915						60.0	52.0	55.0					10																	104172156		2203	4300	6503	PSD	SO:0001583	missense	0			-	HGNC	X99688	CCDS31272.1, CCDS73187.1	10q24	2013-01-10	2004-04-28		ENSG00000059915	ENSG00000059915		"""Pleckstrin homology (PH) domain containing"""	9507	protein-coding gene	gene with protein product		602327	"""pleckstrin and Sec7 domain protein"""			9417912	Standard	NM_002779		Approved	KIAA2011, TYL, PSD1	uc009xxd.2	A5PKW4	OTTHUMG00000018954	ENST00000020673.5:c.1730C>T	10.37:g.104172156G>A	ENSP00000020673:p.Ala577Val	Somatic	0	63	0.00		0.5480226040680333	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	33	10.81	B1AKX7|D3DR87|Q15673|Q8IVG0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Sec7_dom,pfam_Pleckstrin_homology,superfamily_Sec7_dom,smart_Sec7_dom,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Sec7_dom,prints_PH_dom-spectrin-type	p.A577V	ENST00000020673.5	37	c.1730	CCDS31272.1	10	.	.	.	.	.	.	.	.	.	.	G	35	5.445731	0.96187	.	.	ENSG00000059915	ENST00000020673;ENST00000541902;ENST00000406432	T;T	0.49720	0.77;0.77	5.77	5.77	0.91146	SEC7-like (4);	0.000000	0.85682	D	0.000000	T	0.77136	0.4086	M	0.93462	3.42	0.80722	D	1	P	0.42248	0.774	P	0.58577	0.841	T	0.81200	-0.1041	10	0.87932	D	0	.	19.9961	0.97386	0.0:0.0:1.0:0.0	.	577	A5PKW4	PSD1_HUMAN	V	577;480;577	ENSP00000020673:A577V;ENSP00000384830:A577V	ENSP00000020673:A577V	A	-	2	0	PSD	104162146	1.000000	0.71417	1.000000	0.80357	0.759000	0.43091	9.476000	0.97823	2.744000	0.94065	0.561000	0.74099	GCC	-	pfam_Sec7_dom,superfamily_Sec7_dom,smart_Sec7_dom,pfscan_Sec7_dom		0.602	PSD-004	KNOWN	basic|appris_principal|CCDS	protein_coding	PSD	protein_coding	OTTHUMT00000050041.2	G		-		104172156	-1	no_errors	ENST00000020673	ensembl	human	known	74_37	missense	SNP	1.000	A
